U.S. patent application number 13/290899 was filed with the patent office on 2012-05-17 for method for estimating a melting temperature of a nucleic acid in buffers containing magnesium ions.
This patent application is currently assigned to INTEGRATED DNA TECHNOLOGIES, INC.. Invention is credited to Mark Aaron Behlke, Bernardo Moreira, Richard Owczarzy, Joseph Alan Walder, Yong You.
Application Number | 20120123751 13/290899 |
Document ID | / |
Family ID | 39609344 |
Filed Date | 2012-05-17 |
United States Patent
Application |
20120123751 |
Kind Code |
A1 |
Owczarzy; Richard ; et
al. |
May 17, 2012 |
Method for Estimating a Melting Temperature of a Nucleic Acid in
Buffers Containing Magnesium Ions
Abstract
The invention relates to methods and systems for predicting or
estimating the melting temperature of duplex nucleic acids, in the
presence of divalent cations, particularly duplexes of
oligonucleotides which may be used as, for example, but not limited
to primers or probes in PCR and/or hybridization assays. The
methods and algorithms use novel formulas, having terms and
coefficients that are functions of the particular nucleotide
sequence, to estimate the effect of divalent cation salt conditions
on the melting temperature.
Inventors: |
Owczarzy; Richard;
(Coraliville, IA) ; Moreira; Bernardo; (Iowa City,
IA) ; You; Yong; (Coralville, IA) ; Behlke;
Mark Aaron; (Coralville, IA) ; Walder; Joseph
Alan; (Chicago, IL) |
Assignee: |
INTEGRATED DNA TECHNOLOGIES,
INC.
Coralville
IA
|
Family ID: |
39609344 |
Appl. No.: |
13/290899 |
Filed: |
November 7, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11970509 |
Jan 7, 2008 |
8055451 |
|
|
13290899 |
|
|
|
|
60879259 |
Jan 5, 2007 |
|
|
|
Current U.S.
Class: |
703/2 |
Current CPC
Class: |
G16B 20/00 20190201;
G16B 25/00 20190201 |
Class at
Publication: |
703/2 |
International
Class: |
G06F 19/12 20110101
G06F019/12; G06F 17/10 20060101 G06F017/10 |
Claims
1. A method for estimating a melting temperature,
T.sub.m(X.sup.2+), for a polynucleotide at a desired divalent
cation concentration, [X.sup.2+], and an optionally present
monovalent cation concentration [Mon.sup.+], said polynucleotide
having a known G-C content value, f.sub.GC, comprising: (a)
obtaining a reference melting temperature, T.sub.m.degree., for the
polynucleotide, said reference melting temperature being a melting
temperature obtained or provided for the polynucleotide at a
reference monovalent ion concentration, [Mon.sup.+0]; and (b)
modifying said reference melting temperature, or reciprocal of said
melting temperature, by one or more terms which are a function of
fGC to determine the melting temperature of the polynucleotide at
the desired monovalent and divalent cation concentrations.
2. The method of claim 1, wherein the said reference melting
temperature or the reciprocal of said reference melting temperature
is modified by a term which is a function of the fGC multiplied by
a term comprising a logarithm of the divalent cation
concentration.
3. The method of claim 2, wherein the reciprocal of the reference
melting temperature is modified by adding a term comprising a+b ln
[X.sup.2+]+f.sub.GC(c+d ln [X.sup.2+]), wherein each of the
coefficients a, b, c, and d is optimized for predicting
polynucleotide melting temperatures.
4. The method of claim 3, wherein the melting temperature,
T.sub.m(X.sup.2+), is estimated according to a formula comprising:
1 T m ( X 2 + ) = 1 T m .degree. ( Mon 0 + ) + a + b ln [ X 2 + ] +
f GC ( c + d ln [ X 2 + ] ) ##EQU00024## wherein each of the
coefficients a, b, c, and d is optimized for predicting
polynucleotide melting temperatures.
5. The method of claim 2, wherein the melting temperature,
T.sub.m(X.sup.2+), is estimated according to a formula comprising:
1 T m ( X 2 + ) = 1 T m .degree. ( Mon 0 + ) + a + b ln [ X 2 + ] +
f GC ( c + d ln [ X 2 + ] ) + ( e + f ln [ X 2 + ] 2 ( N bp - 1 ) )
##EQU00025## wherein N.sub.bp, is the number of base pairs in the
polynucleotide, and wherein each of the coefficients a, b, c, d, e,
and f is optimized for predicting polynucleotide melting
temperatures.
6. The method of claim 2, wherein the melting temperature,
T.sub.m(X.sup.2+), is estimated according to a formula comprising:
1 T m ( X 2 + ) = 1 T m .degree. ( Mon 0 + ) + a + b ln [ X 2 + ] +
f GC ( c + d ln [ X 2 + ] ) + e + f ln [ X 2 + ] + g ( ln [ X 2 + ]
) 2 2 ( N bp - 1 ) ##EQU00026## wherein N.sub.bp, is the number of
base pairs in the polynucleotide, and wherein each of the
coefficients a, b, c, d, e, f and g is optimized for predicting
polynucleotide melting temperatures.
7. The method of claim 6, wherein the reciprocal of the reference
melting temperature is further modified by adding one or more
additional terms q ( ln [ X 2 + ] ) p 2 ( N bp - 1 ) ##EQU00027##
wherein N.sub.bp, is the number of base pairs in the
polynucleotide, wherein p is an integer, and q is a coefficient
which is optimized for predicting polynucleotide melting
temperatures, and wherein one or more such terms may be added to
the formula, and wherein p and q may be unique for each additional
added term.
8. The method of claim 2, wherein the reference melting temperature
is modified by adding a term comprising a'+b'ln
[X.sup.2+]+f.sub.GC(c'+d'ln [X.sup.2+]), wherein each of the
coefficients a', b', c', and d' is optimized for predicting
polynucleotide melting temperatures.
9. The method of claim 8, wherein the melting temperature,
T.sub.m(X.sup.2+), is estimated according to a formula comprising:
T.sub.m(X.sup.2+)=T.sub.m.degree.+a'+b'ln
[X.sup.2+]+f.sub.GC(c'+d'ln [X.sup.2+]) wherein each of the
coefficients a', b', c', and d' is optimized for predicting
polynucleotide melting temperatures.
10. The method of claim 2, wherein the melting temperature,
T.sub.m(X.sup.2+), is estimated according to a formula comprising:
T m ( X 2 + ) = T m .degree. + a ' + b ' ln [ X 2 - ] + f GC ( c '
+ d ' ln [ X 2 + ] ) + e ' + f ' ln [ X 2 + ] 2 ( N bp - 1 )
##EQU00028## wherein, N.sub.bp is the number of base pairs in the
polynucleotide, and wherein each of the coefficients a', b', c',
d', e', and f' is optimized for predicting polynucleotide melting
temperatures.
11. The method of claim 2, wherein the melting temperature,
T.sub.m(X.sup.2+), is estimated according to a formula comprising:
T m ( X 2 + ) = T m .degree. + a ' + b ' ln [ X 2 + ] + f GC ( c '
+ d ' ln [ X 2 + ] ) + e ' + f ' ln [ X 2 + ] + g ' ( ln [ X 2 + ]
) 2 2 ( N bp - 1 ) ##EQU00029## wherein N.sub.bp, is the number of
base pairs in the polynucleotide, and wherein each of the
coefficients a', b', c', d', e', f', and g' is optimized for
predicting polynucleotide melting temperatures.
12. The method of claim 11, wherein the reference melting
temperature is further modified by adding one or more additional
terms q ( ln [ X 2 + ] ) p 2 ( N bp - 1 ) ##EQU00030## wherein
N.sub.bp, is the number of base pairs in the polynucleotide,
wherein p is an integer, and q is a coefficient which is optimized
for predicting polynucleotide melting temperatures, and wherein p
and q may be unique for each additional added term.
13. The method of claim 6, wherein the coefficients a, b, c, d, e,
f, and g are 3.92.times.10.sup.-5 K.sup.-1, -9.11.times.10.sup.-6
K.sup.-1, 6.26.times.10.sup.-5 K.sup.-1, 1.42.times.10.sup.-5
K.sup.-1, -4.82.times.10.sup.-4 K.sup.-1, 5.25.times.10.sup.-4
K.sup.-1, 8.31.times.10.sup.-5 K.sup.-1 respectively and wherein
the reference monovalent ion concentration, [Mon.sup.+0], is about
1 M.
14. The method of claim 11, wherein the coefficients a', b', c',
d', e', f', and g' are -4.59 K, 1.06 K, -7.26 K, -1.34 K, 63.3 K,
-60.4 K, and -8.78 K respectively, and wherein the reference
monovalent ion concentration, [Mon.sup.+.sub.0], is about 1 M.
15. The method of claim 2, further comprising: (a) calculating the
ratio R of free divalent ion, [X.sup.2+], and monovalent ion,
[Mon.sup.+], concentrations, R = [ X 2 + ] [ Mon + ] ; ##EQU00031##
and (b) comparing the ratio R to one or more limiting values.
16. The method of claim 15, wherein R is compared to the limiting
values 0.22 M.sup.-1/2 and 6.0 M.sup.-1/2.
17. The methods of claims 6, and 11 wherein the coefficients are
allowed to vary with monovalent cation concentration,
[Mon.sup.+].
18. The methods of claims 6 and 17, wherein the coefficient a is
calculated according to formula
a=3.92.times.10.sup.-5(1-0.157-0.352 {square root over
([Mon.sup.+])}ln [Mon.sup.+]), the coefficient d is calculated
according to formula
d=1.42.times.10.sup.-5(1+0.279-4.03.times.10.sup.-3 ln
[Mon.sup.+]-8.03.times.10.sup.-3 ln.sup.2[Mon.sup.+]), the
coefficient g is calculated according to formula
g=8.31.times.10.sup.-5(1-0.514-0.258 ln
[Mon.sup.+]+5.25.times.10.sup.-3 ln.sup.3[Mon.sup.+]), and wherein
the reference monovalent ion concentration, [Mon.sup.+.sub.0], is
about 1 M.
19. The method of claim 1, wherein the monovalent ion is selected
from the group consisting of Tris ions, ammonium ions
(NH.sub.4.sup.+), lithium ions (Li.sup.+), sodium ions (Na.sup.+),
potassium ions (K.sup.+), rubidium ions (Rb.sup.+), cesium ions
(Cs.sup.+), and francium ions (Fr.sup.+).
20. The method of claim 1, wherein the divalent ion is selected
from the group consisting of magnesium ions (Mg.sup.2+), manganese
ions (Mn.sup.2+) and calcium ions (Ca.sup.2+).
21. The method of claim 1, wherein the polynucleotide is DNA.
22. The method of claim 1, wherein the polynucleotide ranges in
length from about 8 to about 500 base pairs.
23. The method of claim 22, wherein the polynucleotide ranges from
about 10 to about 30 base pairs in length.
24. The method of claim 1, wherein the reference melting
temperature is experimentally determined, calculated from a
theoretical model, and/or calculated from a nearest neighbor
model.
25. The method of claim 1, wherein the reference ion concentration
is about 1 M.
26. The method of claim 1, wherein the divalent cation
concentration ranges between about 0.1 mM and about 1 M.
27. The method of claim 1, wherein the presence of compounds that
bind to the divalent cation is subtracted from the divalent cation
concentration through the formula: [X.sup.2+]=c(X.sup.2+)-c(binding
compound).times.(no. of X.sup.2+ ions bound per binding
compound).
28. A computer system for predicting a melting temperature, which
computer system comprises: (a) a memory; and (b) a processor
interconnected with the memory and having one or more software
components loaded therein, wherein the one or more software
components cause the processor to execute steps of a method
according to claim 1.
29. A computer program product comprising a computer readable
medium having one or more software components encoded thereon in
computer readable form, wherein the one or more software components
may be loaded into a memory of a computer system and cause a
processor interconnected with said memory to execute steps of a
method according to claim 1.
Description
FIELD OF THE INVENTION
[0001] The invention relates to methods and systems for predicting
or estimating the melting temperature of duplex nucleic acids, in
the presence of divalent cations, particularly duplexes of
oligonucleotides which may be used as, for example, but not limited
to, primers or probes in PCR and/or hybridization assays. The
invention also relates to methods and systems for designing and
selecting oligonucleotide probes and primers having a predicted
melting temperature which is optimized for such assays. The methods
and algorithms use novel formulas, having terms and coefficients
that are functions of the particular nucleotide sequence, to
estimate the effect of divalent cation salt conditions on the
melting temperature.
FIELD OF THE INVENTION
[0002] The invention relates to methods and systems for predicting
or estimating the melting temperature of duplex nucleic acids, in
the presence of divalent cations, particularly duplexes of
oligonucleotides which may be used as, for example, but not limited
to, primers or probes in PCR and/or hybridization assays. The
invention also relates to methods and systems for designing and
selecting oligonucleotide probes and primers having a predicted
melting temperature which is optimized for such assays. The methods
and algorithms use novel formulas, having terms and coefficients
that are functions of the particular nucleotide sequence, to
estimate the effect of divalent cation salt conditions on the
melting temperature.
BACKGROUND OF THE INVENTION
[0003] Hybridization between complementary nucleic acids is an
implicit feature in the Watson-Crick model for DNA structure that
is exploited for many applications of the biological and biomedical
arts. For example, virtually all methods for replicating and/or
amplifying nucleic acid molecules are initiated by a step in which
a complementary oligonucleotide (typically referred to as a
"primer") hybridizes to some portion of a "target" nucleic acid
molecule. A polymerase then synthesizes a complementary nucleic
acid from the primer, using the target nucleic acid as a
"template." See, Kleppe et al., J. Mol. Biol. 1971, 56:341-361.
[0004] One particular application, known as the polymerase chain
reaction, PCR, is widely used in a variety of biological and
medical arts. For a description, see Saiki et al., Science 1985,
230:1350-1354. In PCR, two or more primers are used that hybridize
to separate regions of a target nucleic acid and its complementary
sequence. The sample is then subjected to multiple cycles of
heating and cooling, repeatedly hybridizing and dissociating the
complementary strands so that multiple replications of the target
nucleic acid and its complement are performed. As a result, even
very small initial quantities of a target nucleic acid may be
enormously increased, or "amplified," for subsequent uses (e.g.,
for detection, sequencing, etc.).
[0005] Multiplex PCR is a particular version of PCR in which
several different primers are used to amplify and detect a
plurality of different nucleic acids in a sample--usually ten to a
hundred different target nucleic acids. Thus, the technique allows
a user to amplify and evaluate large numbers of different nucleic
acids simultaneously in a single sample. The enormous benefits of
high throughput, speed and efficiency offered by this technique has
made multiplex PCR increasingly popular. However, achievement of
successful multiplex PCR usually involves empirical testing as
existing computer programs that pick and/or design PCR primers have
errors. In multiplex PCR, the errors become additive and therefore
good results are seldom achieved without a substantialsome amount
of trial and error. See, Markouatos et al., J. Clin. Lab Anal.
2002, 16(1):47-51; Henegarin et al., Biotechniques 1997,
23(3):504-11.
[0006] Other techniques that are widely used in the biological and
medical arts exploit nucleic acid hybridization to detect target
nucleic acid sequences in a sample. See, for example, Southern, J.
Mol. Biol. 1975, 98:503-517; Denhardt, Biochem. Biophys. Res.
Commun. 1966, 23:641-646; Meinhoth & Wahl, Anal. Biochem. 1984,
138:267-284. For instance, Southern blotting and similar techniques
have long been used in which nucleic acid molecules from a sample
are immobilized onto a solid surface or support (e.g., a membrane
support). A target nucleic acid molecule of interest may then be
detected by contacting one or more complementary nucleic acids
(often referred to as nucleic acid "probes") and detecting their
hybridization to nucleic acid molecules on the surface or support.
A signal generated by some detectable label on the probes is
proportional to the amount of hybridization to the target.
[0007] Similar techniques are also known in which one or more
nucleic acid probes are immobilized onto a solid surface or
support, and a sample of nucleic acid molecules is hybridized
thereto. Nucleic acid arrays, for example, are known and have
become increasingly popular in the art. See, e.g., DeRisi et al.,
Science 1997, 278:680-686; Schena et al., Science 1995,
270:467-470; and Lockhart et al., Nature Biotech. 1996, 14:1675.
See also, U.S. Pat. No. 5,510,270 issued Apr. 23, 1996 to Fodor et
al. Nucleic acid arrays typically comprise a plurality (often many
hundreds or even thousands) of different probes, each immobilized
at a defined location on the surface or support. A sample of
nucleic acids (for example, an mRNA, sample, or a sample of cDNA or
cRNA derived therefrom), that may be detectably labeled, may then
be hybridized to the array. Hybridization of those nucleic acids to
the different probes may be assessed, e.g., by detecting labeled
nucleic acids at each probe's location on the array. Thus,
hybridization techniques using nucleic acid arrays have the
potential for simultaneously detecting a large number of different
nucleic acid molecules in a sample, by simultaneously detecting
their hybridization to the different probes of the array.
[0008] The successful implementation of all techniques involving
nucleic acid hybridization (including the exemplary techniques
described, supra) is dependent upon the use of nucleic acid probes
and primers that specifically hybridize with complementary nucleic
acids of interest while, at the same time, avoiding non-specific
hybridization with other nucleic acid molecules that may be
present. For a review, see Wetmur, Critical Reviews in Biochemistry
and Molecular Biology 1991, 26:227-259. These properties are even
more critical in techniques, such as multiplex PCR and microarray
hybridization, where a plurality of different probes or primers is
used, each of which may be specific for a different target nucleic
acid.
[0009] Duplex stability between complementary nucleic acid
molecules is frequently expressed by the duplex's "melting
temperature", T.sub.m. Roughly speaking, the T.sub.m indicates the
temperature at which a duplex nucleic acid dissociates into
single-stranded nucleic acids. Nucleic acid hybridization may be
performed at a temperature just slightly below the T.sub.m, so that
hybridization between a probe or primer and its target nucleic acid
is optimized, while minimizing non-specific hybridization of the
probe or primer to other, non-target nucleic acids. Duplex
stability and T.sub.m are also important in applications, such as
PCR, where thermocycling may be involved. During such thermocycling
melting steps, it is important that the sample temperature be
raised sufficiently above the T.sub.m so that duplexes of the
target nucleic acid and its complement are dissociated. In
subsequent steps of reannealing, however, the temperature must be
brought sufficiently below the T.sub.m that duplexes of the target
nucleic acid and primer are able to form, while still remaining
high enough to avoid non-specific hybridization events. For a
general discussion, see Rychlik et al., Nucleic Acids Research
1990, 18:6409-6412.
[0010] Traditionally, theoretical or empirical models that relate
duplex stability to nucleotide sequence have been used to predict
or estimate melting temperatures for particular nucleic acids. For
example, Breslauer et al. (Proc. Natl. Acad. Sci. U.S.A. 1986,
83:3746-3750) describe a model for predicting melting temperatures
that is widely used in the art, known as the "nearest neighbor
model." See also, SantaLucia et al., Biophys. Biomol. Struct. 2004,
33:415-440; Owczarzy et al., Biopolymers 1997, 44:217-239; and
SantaLucia, Proc. Natl. Acad. Sci. U.S.A. 1998, 95:1460-1465. Such
models are usually calibrated or optimized for particular salt
conditions, typically 1 M Na.sup.+. However, applications that
exploit nucleic acid hybridization may be implemented in a variety
of different salt conditions, including, for example, magnesium and
potassium, with cation concentrations typically being on the order
of magnitude of 0.001-1 M. Thus, melting temperatures for
particular probes or primers in an assay are typically predicted by
predicting a melting temperature at a first salt concentration
using the nearest neighbor or other models, and then using another
theoretical or empirical model to predict what effect(s) the salt
conditions of the particular assay will have on that melting
temperature.
[0011] Most existing models used to estimate T.sub.m do so in
solutions of some specific cation concentrations and then correct
for presence and concentrations of all cations. Schildkraut et al.
(Biopolymers 1965, 3:195-208) proposed the following formula to
estimate nucleic acid melting temperatures at different sodium ion
concentrations, [Na.sup.+]:
T.sub.m([Na.sup.+])=T.sub.m(1M Na.sup.+)+16.6.times.log [Na.sup.+]
(Equation 1)
where T.sub.m(1M Na.sup.+) is the melting temperature of the DNA
duplex in solution of 1 M sodium ions. Equation 1, above, is based
on empirical data from the specific study of Escherichia coli
genomic DNA in buffer of between 0.01-0.2 M [Na.sup.+].
Nevertheless, the use of this equation has been routinely
generalized to model any DNA duplex oligomer pair. See, for
example, Rychlik et al., Nucleic Acids Res. 1990, 18:6409-6412,
Ivanov & AbouHaidar, Analytical Biochemistry 1995, 232:249-251;
Wetmur, Critical Review in Biochemistry and Molecular Biology 1991,
26:227-259.
[0012] SantaLucia and Peyret analyzed data of 26 oligonucleotide
duplexes and published correction equations for effects of sodium
ions. They assumed that sodium ions change the transition entropy
of duplex melting, but do not effect a value of .DELTA.H.degree.
(see SantaLucia, Proc. Natl. Acad. Sci. U.S.A. 1998, 95:1460-1465
and Peyret, Ph.D. Thesis, Wayne State University, Detroit, Mich.,
pp. 128, section 5.4.2 (2000)), and derived the following
equation,
1 T m ( Na + ) = 1 T m ( 1 M Na + ) + 0.368 N .DELTA. H 0 .times.
ln [ Na + ] ( Equation 2 ) ##EQU00001##
.DELTA.H.sup.0 is the standard transition enthalpy predicted from a
nearest-neighbor model and N is the number of phosphate groups in
the duplex divided by 2. That is, N is typically for synthetic
oligomers equal to number of base pairs decreased by one.
[0013] Also, U.S. Pat. No. 6,889,143 (incorporated herein by
reference in its entirety) describes equations developed for
varying sodium cation concentrations, taking into account the G-C
content of the oligonucleotides,
1 T m ( Na + ) = 1 T m ( 1 M Na + ) + ( 4.29 f GC - 3.95 ) 10 - 5
ln [ Mon + ] + 9.40 10 - 6 ( ln [ Mon + ] ) 2 ( Equation 3 )
##EQU00002##
[0014] While several equations were published to model
relationships between monovalent cations (e.g., sodium) and DNA
melting temperature (see, e.g., Owczarzy et al., Biochemistry 2004,
43:3537-3554), little is known about the effect of divalent
cations. Corrections were previously suggested to explain effects
of magnesium ions on DNA melting temperatures that are based on the
assumption that stabilizing effects of magnesium ions are very
similar to stabilizing effects of sodium ions and therefore T.sub.m
salt correction for sodium ions can be applied to solutions of
magnesium ions using a simple adjustment. These corrections
(Equations 6, 7, and 8, below) use Equation 4 where the square root
of Mg.sup.2+ concentration is added to monovalent cation
concentrations [Mon.sup.+] (e.g., Na.sup.+, Tri.sup.+, or K.sup.+)
and the "equivalent effect" sodium concentration,
[Na.sup.+].sub.eq, is calculated,
[Na.sup.+].sub.eq=.beta..times. {square root over
([Mg.sup.2+])}+[Mon.sup.+] (Equation 4)
The monovalent cation concentration, [Mon.sup.+], is a sum of the
concentrations of all monovalent cations in solution. In the pH
range typically employed the H.sup.+ concentration is less than
10.sup.-5 M and need not be considered; however, H.sup.+ ions are
not considered. For a typical PCR buffer, concentrations of K.sup.+
and Tris.sup.+ ions are summed,
[Mon.sup.+]=[K.sup.+]+[Tris.sup.+] (Equation 5)
Values of the conversion factor .beta. from 3.3 to 4 were suggested
in published literature. The equivalent sodium concentration from
Equation 4, [Na.sup.+].sub.eq, may be combined with the T.sub.m
sodium correction equations 1 and 2. Three such correction
equations were reported in the published literature,
T.sub.m(Mg.sup.2+)=T.sub.m(1M Na.sup.+)+16.6.times.log(4 {square
root over ([Mg.sup.2+])}+[Mon.sup.+]) (Equation 6) [0015]
(Mitsuhashi, J. Clin. Lab. Analysis, 1996, 10:277-284)
[0015] 1 T m ( Mg 2 + ) = 1 T m ( 1 M Na + ) + 0.368 N .DELTA. H 0
.times. ln ( 3.79 [ Mg 2 + ] + [ Mon + ] ) ( Equation 7 )
##EQU00003## [0016] (von Ahsen et al., Clin. Chem. 2001,
47:1956-1961)
[0016] 1 T m ( Mg 2 + ) = 1 T m ( 1 M Na + ) + 0.368 N .DELTA. H 0
.times. ln ( 3.3 [ Mg 2 + ] + [ Mon + ] ) ( Equation 8 )
##EQU00004## [0017] (Peyret, Ph.D. Thesis, Wayne State University,
Detroit, Mich., pp. 128, section 5.4.2 (2000)). In some of the
above cases, the Tm correction function is expressed directly in
terms of Tm (Equation 6), and in Equation 7 and 8 the Tm correction
function is related to the reciprocal of Tm (1/Tm).
[0018] These equations were used to determine the T.sub.m salt
correction for a solution containing magnesium ions in the absence
or presence of other monovalent ions.
[0019] Recently, Tan and Chen (Biophys. J. 2006, 90:1175-1190)
developed the "Tightly Bound Ion model" and proposed a new formula
for dependence of melting temperatures on magnesium
concentrations,
1 T m ( Mg 2 + ) = 1 T m ( 1 M Na + ) - 0.00322 .times. .DELTA. g
el .times. ( N bp - 1 ) .DELTA. H 0 ( Equation 9 ) ##EQU00005##
where .DELTA.g.sub.e1 is the electrostatic free energy per base
stack (kcal/mol),
.DELTA. g el = ( 0.02 + 1.18 N bp 2 ) ln [ Mg 2 + ] + ( 0.0068 +
0.344 N bp 2 ) ( ln [ Mg 2 + ] ) 2 ( Equation 10 ) ##EQU00006##
The Equations 9 and 10 were proposed to be appropriate for duplexes
with six or more base pairs in solutions where magnesium ions have
dominant effects. These magnesium correction equations do not apply
to mixed buffers where monovalent ions compete with magnesium
ions.
[0020] Further studies on the correction of melting temperature
include Nakano et al., Nucleic Acids Research 1999, 27:2957-2965;
Williams et al., Biochemistry 1989, 28:4283-4291; Record,
Biopolymers 1975, 14:2137-2158.
[0021] Notably, none of the Tm correction equations in the prior
art consider the sequence of the polynucleotide or its G/C content
value, fGC.
[0022] As will be demonstrated below, the above equations do not
adequately predict melting temperatures in the presence of divalent
cations. The errors are significant, in some cases as large as 15
C, and can adversely affect the performance of probes and primers
in experiments and assays. The effects on melting temperature due
to divalent cations, in the presence and/or absence of monovalent
ions, differ significantly from the effects of sodium ions and are
not adequately described in the equations above. Therefore, there
is a significant need for methods of estimating and predicting
melting temperatures with improved accuracy, especially for
oligonucleotides in the presence of divalent cations. There further
exists a need for methods of designing experiments in which the
melting temperature of each oligonucleotide in the presence of
divalent cations is optimized for the particular method or assay,
such as PCR or other assay that involves nucleic acid
hybridization. The present invention meets these needs by providing
methods to more accurately predict the melting temperature of
nucleic acids in buffers with divalent cations.
[0023] The citation or discussion of any reference in this section
or elsewhere in the specification is made only to clarify the
description of the present invention and is not an admission that
any such reference is "prior art" against any invention described
herein.
SUMMARY OF THE INVENTION
[0024] The present invention provides a method for predicting
melting temperatures, T.sub.m, for nucleic acid duplex oligomers.
The method applies to nucleic acid duplexes in solutions containing
divalent cations [X.sup.2+], wherein the divalent cation
concentration preferably ranges from 0.1 mM to about 1 M
concentration. Specifically, the method allows for an accurate
prediction of the melting temperatures, T.sub.m, for nucleic acid
duplex oligomers as divalent and, optionally, monovalent,
[Mon.sup.+], cation concentration varies, wherein:
[0025] (a) a reference melting temperature, Tm.degree., for the
polynucleotide is obtained or provided at a reference monovalent
ion concentration [Mon.sup.+].sup.0, and
[0026] (b) modifying said reference melting temperature, or
reciprocal of said melting temperature, by one or more terms which
are a function of f.sub.GC to determine the melting temperature of
the polynucleotide at the desired monovalent and divalent cation
concentrations.
[0027] In some certain embodiments, the present invention provides
a novel method for estimating a melting temperature,
T.sub.m(X.sup.2+), for a polynucleotide at a desired divalent ion
concentration, [X.sup.2+], and an optionally present monovalent ion
concentration [Mon.sup.+], said polynucleotide having a known G-C
content value, f.sub.GC, the method comprising:
[0028] (a) obtaining a reference melting temperature,
T.sub.m.sup.0, for the polynucleotide, said reference melting
temperature being a melting temperature obtained or provided for
the polynucleotide at a reference monovalent ion concentration,
[Mon.sup.+0];
[0029] (b) modifying said reference melting temperature, or the
reciprocal of said reference melting temperature, by adding (i) a
term comprising a logarithm of the divalent ion concentration, and
(ii) a term comprising f.sub.GC multiplied by a term comprising a
logarithm of the divalent ion concentration, and
[0030] optionally adding a further term comprising a logarithm of
the divalent ion concentration,
[0031] to determine the melting temperature of the oligonucleotide
at the desired monovalent aid divalent cation concentrations;
and
[0032] When the reciprocal of the reference melting temperature is
used, the method further comprises (c) taking the reciprocal of the
modified reciprocal; wherein the estimated melting temperature is
calculated using the reference melting temperature.
[0033] In a further embodiment, the present invention provides a
novel method for estimating a melting temperature,
T.sub.m(X.sup.2+), for a polynucleotide at a desired divalent ion
concentration, [X.sup.2+], and an optionally present monovalent ion
concentration [Mon.sup.+], said polynucleotide having a known G-C
content value, f.sub.GC, wherein the reciprocal of a reference
melting temperature, T.sub.m.sup.0, is modified by adding a term
comprising a+b ln [X.sup.2+]+f.sub.GC(c+d ln [X.sup.2+]),
[0034] wherein the reference melting temperature is a melting
temperature obtained or provided for the polynucleotide at a
reference monovalent ion concentration, [Mon.sup.+].sup.0, and
wherein each of the coefficients a, b, c, and d is optimized for
predicting polynucleotide melting temperatures based on, for
example, experimental data.
[0035] In another embodiment, the present invention provides a
novel method for estimating a melting temperature,
T.sub.m(X.sup.2+), for a polynucleotide at a desired divalent ion
concentration, [X.sup.2+], and an optionally present monovalent ion
concentration [Mon.sup.+], said polynucleotide having a known G-C
content value, f.sub.GC, according to a formula comprising:
1 T m ( X 2 + ) = 1 T m o + a + b ln [ X 2 + ] + f GC ( c + d ln [
X 2 + ] ) Equation 11 ##EQU00007##
[0036] wherein the reference melting temperature is a melting
temperature obtained or provided for the polynucleotide at a
reference monovalent ion concentration, [Mon.sup.+].sup.0, and
wherein each of the coefficients a, b, c, and d is optimized for
predicting polynucleotide melting temperatures based on, for
example, experimental data.
[0037] In another embodiment, the present invention provides a
novel method for estimating a melting temperature,
T.sub.m(X.sup.2+), for a polynucleotide at a desired divalent ion
concentration, [X.sup.2+], and an optionally present monovalent ion
concentration [Mon.sup.+], said polynucleotide having a known G-C
content value, f.sub.GC, and length, that is number of base pairs
(Nbp), according to a formula comprising:
1 T m ( X 2 + ) = 1 T m o + a + b ln [ X 2 + ] + f GC ( c + d ln [
X 2 ] ) + ( e + f ln [ X 2 + ] 2 ( N bp - 1 ) ) , Equation 12
##EQU00008##
[0038] wherein the reference melting temperature is a melting
temperature obtained or provided for the polynucleotide at a
reference monovalent ion concentration, [Mon.sup.+].sup.0, wherein
each of the coefficients a, b, c, d, e, and f is optimized for
predicting polynucleotide melting temperatures based on, for
example, experimental data.
[0039] In another embodiment, the present invention provides a
novel method for estimating a melting temperature,
T.sub.m(X.sup.2+), for a polynucleotide at a desired divalent ion
concentration, [X.sup.2+], and an optionally present monovalent ion
concentration [Mon.sup.+], said polynucleotide having a known G-C
content value, f.sub.GC, and length (Nbp) according to a formula
comprising:
1 T m ( X 2 + ) = 1 T m o + a + b ln [ X 2 ] + f GC ( c + d ln [ X
2 + ] ) + e + f ln [ X 2 + ] + g ( ln [ X 2 + ] ) 2 2 ( N bp - 1 )
, Equation 13 ##EQU00009##
[0040] wherein the reference melting temperature is a melting
temperature obtained or provided for the polynucleotide at a
reference monovalent ion concentration, [Mon.sup.+].sup.0, wherein
each of the coefficients a, b, c, d, e, f and g is optimized for
predicting polynucleotide melting temperatures based, for example,
on experimental data. In some embodiments, the present invention
provides a novel method for estimating a melting temperature,
T.sub.m(X.sup.2+), for a polynucleotide at a desired divalent ion
concentration, [X.sup.2+], and an optionally present monovalent ion
concentration [Mon.sup.+], said polynucleotide having a known G-C
content value, f.sub.GC, the method comprising:
[0041] (a) obtaining a reference melting temperature,
T.sub.m.degree., for the polynucleotide, said reference melting
temperature being a melting temperature obtained or provided for
the polynucleotide at a reference monovalent ion concentration,
[Mon.sup.+0]; and
[0042] (b) modifying the reference melting temperature by adding a
term which is a function of the f.sub.GC multiplied by a term
comprising a logarithm of the divalent cation concentration to
determine the melting temperature of the polynucleotide at the
desired divalent and monovalent cation concentrations.
[0043] In a further embodiment, the present invention provides a
novel method for estimating a melting temperature,
T.sub.m(X.sup.2+), for a polynucleotide at a desired divalent ion
concentration, [X.sup.2+], and an optionally present monovalent ion
concentration [Mon.sup.+], said polynucleotide having a known G-C
content value, f.sub.GC, wherein a reference melting temperature,
T.sub.m.sup.0, is modified by adding a term comprising a'+b'ln
[X.sup.2+]+f.sub.GC(c'+d'ln [X.sup.2+]), wherein
[0044] the reference melting temperature is a melting temperature
obtained or provided for the polynucleotide at a reference
monovalent ion concentration, [Mon.sup.+0], and wherein each of the
coefficients a', b', c', and d' is optimized for predicting
polynucleotide melting temperatures based, for example, on
experimental data.
[0045] In another embodiment, the present invention provides a
novel method for estimating a melting temperature,
T.sub.m(X.sup.2+), for a polynucleotide at a desired divalent ion
concentration, [X.sup.2+], and an optionally present monovalent ion
concentration [Mon.sup.+], said polynucleotide having a known G-C
content value, f.sub.GC, according to a formula comprising:
T.sub.m(X.sup.2+)=T.sub.m.degree.+a'+b'ln
[X.sup.2+]+f.sub.GC(c'+d'ln [X.sup.2+]), Equation 14
[0046] wherein the reference melting temperature is a melting
temperature obtained or provided for the polynucleotide at a
reference monovalent ion concentration, [Mon.sup.+0], and each of
the coefficients a', b', c', and d' is optimized for predicting
polynucleotide melting temperatures based, for example, on
experimental data.
[0047] In another embodiment, the present invention provides a
novel method for estimating a melting temperature,
T.sub.m(X.sup.2+), for a polynucleotide at a desired divalent ion
concentration, [X.sup.2+], and an optionally present monovalent ion
concentration [Mon.sup.+], said polynucleotide having a known G-C
content value, f.sub.GC, and length (Nbp) according to a formula
comprising:
T m ( X 2 + ) = T m o + a ' + b ' ln [ X 2 + ] + f GC ( c ' + d '
ln [ X 2 + ] ) + e ' + f ' ln [ X 2 + ] 2 ( N bp - 1 ) Equation 15
##EQU00010##
[0048] wherein the reference melting temperature is a melting
temperature obtained or provided for the polynucleotide at a
reference monovalent ion concentration, [Mon.sup.+], and wherein
the number of base pairs, Nbp, is the number of paired bases in the
polynucleotide, and wherein each of the coefficients a', b', c',
d', e', and f' is optimized for predicting polynucleotide melting
temperatures based on, for example, experimental data.
[0049] In another embodiment, the present invention provides a
novel method for estimating a melting temperature,
T.sub.m(X.sup.2+), for a polynucleotide at a desired divalent ion
concentration, [X.sup.2+], and an optionally present monovalent ion
concentration [Mon.sup.+], said polynucleotide having a known G-C
content value, f.sub.GC, according to a formula comprising:
T m ( X 2 + ) = T m o + a ' + b ' ln [ X 2 + ] + f GC ( c ' + d '
ln [ X 2 + ] ) + e ' + f ' ln [ X 2 + ] + g ' ( ln [ X 2 + ] ) 2 2
( N bp - 1 ) Equation 16 ##EQU00011##
wherein the reference melting temperature is a melting temperature
obtained or provided for the polynucleotide at a reference
monovalent ion concentration, [Mon.sup.+0], and wherein the number
of base pairs, N.sub.bp, is the number of paired bases in the
polynucleotide, and wherein each of the coefficients a', b', c',
d', e', f', and g' is optimized for predicting polynucleotide
melting temperatures based on, for example, experimental data.
[0050] The coefficients of the above methods are each optionally
present, and can be found through optimization based on
experimental data. For example, they can be obtained from the
present invention, such that a' is -4.59 K, b' is 1.06 K, c' is
-7.26 K, d' is -1.34 K, e' is 63.3 K, f' is -60.4 K, and g' is
-8.78 K when they are present, and especially when [Mon.sup.+0] is
about 1M. The coefficients may also be allowed to vary with
monovalent cation concentration.
[0051] In a further embodiment, the above methods can be modified
by adding one or more additional terms,
q ( ln [ X 2 + ] ) p 2 ( N bp - 1 ) , ##EQU00012##
wherein p is an integer, and q is a coefficient which is optimized
for predicting polynucleotide melting temperatures based on, for
example, experimental data. When one or more such terms are be
added to the formula, the values for p and q may be unique for each
additional added term.
[0052] The choice of the above methods for estimating the melting
temperature, T.sub.m(X.sup.2+), can be determined by calculating a
ratio R of free divalent ion concentrations, [X.sup.2+], and
monovalent ion concentrations, [Mon.sup.+], according to the
formula
R = [ X 2 + ] [ Mon + ] ; ##EQU00013##
and comparing the ratio R to a limiting value.
[0053] The present invention further provides a novel computer
system that may be used to implement the analytical methods of the
invention, including methods of estimating a salt-corrected melting
temperature of a polynucleotide. These computer systems comprise a
processor interconnected with a memory that contains one or more
software components. In particular, the one or more software
components include programs that cause the processor to implement
steps of the analytical methods described herein. The software
components may comprise additional programs and/or files including,
for example, but not limited to, sequence or structural databases
of polymers.
[0054] Computer program products are further provided, which
comprise a computer readable medium, such as one or more floppy
disks, compact discs (e.g., CD-ROMS or RW-CDS), DVDs, data tapes,
etc., that have one or more software components encoded thereon in
computer readable form. In particular, the software components may
be loaded into the memory of a computer system and may then cause a
processor of the computer system to execute steps of the analytical
methods described herein. The software components may include
additional programs and/or files including databases, e.g., of
polymer sequences and/or structures.
[0055] A computer system for predicting a melting temperature may
comprise:
a memory; and a processor interconnected with the memory and having
one or more software components loaded therein, and one or more
software components may cause the processor to execute the steps of
the invention.
[0056] A computer program product for predicting a melting
temperature may comprise: a computer readable medium having one or
more software components encoded thereon in computer readable form,
wherein the one or more software components may be loaded into a
memory of a computer system and cause a processor interconnected
with said memory to execute steps of the invention.
BRIEF DESCRIPTION OF DRAWINGS
[0057] FIG. 1A is a graph showing a UV-melting curve at 268 nm for
a 2 .mu.M solution of the oligonucleotide
5'-TACTTCCAGTGCTCAGCGTA-3' (SEQ ID NO: 31) and its complement
dissolved in 3 mM Mg.sup.2+ and 50 mM KCl PCR buffer.
[0058] FIG. 1B is a graph showing a differential scanning
calorimetry (DSC) curve for a 98 .mu.M solution of the
oligonucleotide 5'-TACTTCCAGTGCTCAGCGTA-3' (SEQ ID NO:31) and its
complement dissolved in 3 mM Mg.sup.2+ and 50 mM KCl buffer.
[0059] FIG. 2 is a schematic of an exemplary computer system that
may be used to implement the analytical methods of the
invention.
[0060] FIG. 3A is a graph showing errors of T.sub.m predictions for
the oligonucleotides represented in Table I using Equation 13 in
1.5 mM Mg.sup.2+ when no KCl is present. ( =10-mers;
.largecircle.=11-mers; .tangle-solidup.=15-mers; .DELTA.=20-mers;
.quadrature.=25-mers; .box-solid.=30-mers)
[0061] FIG. 3B is a graph showing errors of T.sub.m predictions for
the oligonucleotides represented in Table I using Equation 13 in 50
mM Mg.sup.2+ when no KCl is present. ( =10-mers;
.largecircle.=11-mers; .tangle-solidup.=15-mers; .DELTA.=20-mers;
.quadrature.=25-mers; .box-solid.=30-mers)
[0062] FIG. 4 shows the competitive effects of K.sup.+ and
Mg.sup.2+ that were examined for the 25 bp long duplex,
CTGGTCTGGATCTGAGAACTTCAGG (SEQ ID NO: 52). Solid circles ( ) are
T.sub.ms plotted against ln R, where
R=[Mg.sup.2+].sup.0.5/[Mon.sup.+]. Buffers are composed of constant
1.5 mM Mg.sup.2+ while KCl concentration varies. The solid line
shows melting temperatures predicted by sodium salt correction
(Equation 3) when no Mg.sup.2+ is present. The dashed line
indicates T.sub.m in magnesium buffer when no KCl is present. The
dominant ion crossover that occurs on average at R of 0.22 is
indicated with the dotted vertical line.
[0063] FIG. 5 is a diagram of embodiment of the invented algorithm
for solutions containing monovalent and magnesium ions. The
algorithm provides the most accurate T.sub.m correction equation
based on concentrations of magnesium and monovalent ions.
[0064] FIG. 6 is a comparison of effects of Na.sup.+ and K.sup.+ on
melting temperatures in buffers of 55 mM (.DELTA.) and 205 mM ( )
monovalent ion concentrations. Oligonucleotides range in length
from 15 to 30 base pairs and are taken from Table I. Melting
temperatures determined in 10 mM Tris-HCl, and 50 or 200 mM KCl
buffers are plotted versus melting temperatures measured in 10 mM
sodium phosphate and NaCl buffers (Owczarzy et al., Biochemistry
2004, 43:3537-3554). Diagonal solid line connects points where
melting temperatures in both buffers would be the same.
[0065] FIG. 7 is a graph that depicts melting temperatures of DNA
duplex oligomers in the pH range from 6.5 to 8.3. Solid symbols are
15-mers, open symbols are 30-mers, fraction of G-C base pairs vary
from 0.3 to 0.7. Sequences are TTCTACCTATGTGAT (SED ID: 5;
.tangle-solidup.), GCAGTGGATGTGAGA (SED ID: 12; ), CAGCCTCGTCGCAGC
(SED ID: 8; ), CTTAAGATATGAGAACTTCAACTAATGTGT (SED ID: 64;
.DELTA.), AGTCTGGTCTGGATCTGAGAACTTCAGGCT (SED ID: 71;
.largecircle.), GACCTGACGTGGACCGCTCCTGGGCGTGGT (SED ID: 78;
.quadrature.). Buffers contained 1.5 mM MgCl.sub.2, 50 mM KCl and
10 mM cacodylic acid or MOPS.
[0066] FIG. 8 displays experimental melting temperatures of the
60-mer duplex 5'-TTCGCGGATTAGCCCTACGCATCGGTTACAAACGAGGACCTTATGCAC
TTTGACAGCATG-3', SEQ ID NO: 93, that were obtained using DSC at low
DNA concentration (C.sub.t=2 .mu.M). Buffers contained 50 mM KCl,
10 mM Tris-HCl (pH=8.3) and various amounts of magnesium ions and
deoxynucleotide triphosphates. Concentrations (mM) used in each
experiment are indicated below the graph. The first row is the free
[Mg.sup.2+], which is calculated as the difference between total
Mg.sup.2+ and dNTP concentrations. dNTP "mix" contained equimolar
concentrations of dATP, dGTP, dCTP and dTTP. The sum of their
concentrations is shown in the table below the graph.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0067] Melting. The term "melting profile" refers to a collection
of measurements of an oligonucleotide and its complement which
indicate the oligonucleotide molecule's transition from
double-stranded to single-stranded nucleic acid (or vice-versa).
The transition of a nucleic acid from double-stranded to
single-stranded is often described in the art as the "melting" of
that nucleic acid molecule. The transition may also be described as
the "denaturation" or "dissociation" of the nucleic acid.
Accordingly, a melting profile of the present invention may also be
referred to with terms such as "dissociation profile", a
"denaturation profile", a "melting curve", a "dissociation
curve."
[0068] The "melting temperature" or "T.sub.m" of a nucleic acid
molecule generally refers to the temperature at which a
polynucleotide dissociates from its complementary sequence.
Generally, the T.sub.m may be defined as the temperature at which
one-half of the base pairs in duplex nucleic acid molecules are
broken or dissociated (i.e., are "melted") while the other half of
the base pairs remain intact in a double stranded conformation
(i.e., the fraction of broken based pairs, .theta.(T)=0.5 when
T=T.sub.m). In embodiments where duplex nucleic acid molecules are
oligonucleotides and in other embodiments where the duplex nucleic
acids dissociate in a two-state fashion, the T.sub.m of a nucleic
acid may also be defined as the temperature at which one-half of
the nucleic acid molecules in a sample are in a single-stranded
conformation while the other half of the nucleic acid molecules in
that sample are in a double-stranded conformation. T.sub.m,
therefore, defines a midpoint in the transition from
double-stranded to single-stranded nucleic acid molecules (or,
conversely, in the transition from single-stranded to
double-stranded nucleic acid molecules). It is well appreciated in
the art that the transition from double-stranded to single-stranded
nucleic acid molecules does not occur at a single temperature but,
rather, occurs over a range of temperatures (e.g., typically a
narrow range of between about 3 and 10.degree. C.). Nevertheless,
the T.sub.m provides a convenient measurement for approximating
whether nucleic acid molecules in a sample exist in a
single-stranded or double-stranded conformation. As such, the
melting temperature of a nucleic acid sample may be readily
obtained by simply evaluating a melting profile for that
sample.
[0069] Ions. The term "Tris" as used herein is an abbreviation for
2-amino-2-(hydroxymethyl)-1,3-propanediol compound.
[0070] The term "salt concentration" as used herein is
interchangeably used with the term "ion concentration". Types of
ions include, but are not limited to, magnesium, potassium, sodium,
rubidium, lithium, cesium and francium. Ions may carry a single or
multiple charges. The term "divalent cation concentration" or
"divalent ion concentration" refers to the free divalent cation
concentration, and is calculated from total divalent cation
concentration by subtracting those divalent cations that are bound
to other compounds in solution. The divalent cation concentration
may range from about 0.01 mM to about 5 M, preferably from about
0.1 mM to about 1 M, and more preferably from about 0.5 mM to about
600 mM, and more preferably from about 0.1 mM to about 20 mM.
[0071] The term "monovalent cation concentration" or "monovalent
ion concentration" refers to the free monovalent cation
concentration, and is calculated from total monovalent cation
concentration by subtracting those monovalent cations that are
bound to other compounds in solution. The monovalent cation
concentration may range from 0 to about 5M.
[0072] Additional additives may also be present in the reaction
buffers. For example, solutions may contain glycerol, ethylene
glycol, dimethyl sulfoxide, betaine, tetramethylammonium chloride
to name a few.
[0073] Nucleic Acids. The methods and algorithms of this invention
involve calculating estimated melting temperatures for
complementary nucleic acids and can be applied generally to any of
the various types of nucleic acids, including but not limited to
DNA, RNA, mRNA, cDNA, and cRNA. Polynucleotides that may be used in
accordance with the present invention also include double stranded
DNA and RNA duplex oligomers, single stranded DNA and RNA. This
also includes nucleic acids containing modified bases, for example,
but not limited to, thio-uracil, thio-guanine and
fluoro-uracil.
[0074] As used herein, the terms "polynucleotide",
"oligonucleotide" and "oligomers" are interchangeable and are
generally used to describe nucleic acid polymers typically having
no more than about 500 base pairs. In certain embodiments, the
present invention is practiced using oligonucleotides between about
5 and 150 nucleotides in length, preferably between about 5 and 100
nucleotides in length, more_preferably between about 10 and 30
nucleotides in length. Oligonucleotides used in the present
invention may hybridize to any type of nucleic acid from any
source; including but not limited to genomic DNA, mRNA, cDNA,
Expressed Sequence Tags (ESTs), and chemically synthesized nucleic
acids. Oligonucleotides of the invention may also hybridize to
other oligonucleotide molecules.
[0075] The nucleic acids may also be modified by many means known
in the art. Non-limiting examples of such modifications include
methylation, "caps", substitution of one or more of the naturally
occurring nucleotides with an analog, and internucleotide
modifications such as, for example, but not limited to, those with
uncharged linkages (e.g., methylphosphonates, phosphotriesters,
phosphoroamidates, carbamates, etc.) and with charged linkages
(e.g., phosphorothioates, phosphorodithioates, etc.).
Polynucleotides may contain one or more additional covalently
linked moieties, such as proteins (e.g., nucleases, toxins,
antibodies, signal peptides, poly-L-lysine, etc.), intercalators
(e.g., acridine, psoralen, etc.), chelators (e.g., metals,
radioactive metals, iron, oxidative metals, etc.) and alkylators to
name a few. Furthermore, the polynucleotides herein may also be
modified with a label capable of providing a detectable signal,
either directly or indirectly. Exemplary labels include
radioisotopes, fluorescent molecules, biotin and the like.
[0076] Oligonucleotides and other polynucleotides can be labeled,
e.g., with .sup.32P-nucleotides or nucleotides to which a label,
such as biotin or a fluorescent dye (for example, but not limited
to, Cy3 or Cy5) has been covalently conjugated. Generally,
oligonucleotides are prepared synthetically, for example, on a
nucleic acid synthesizer. Accordingly, oligonucleotides can be
prepared with non-naturally occurring phosphoester analog bonds,
such as thioester bonds, etc.
[0077] Hybridization. A nucleic acid molecule is "hybridizable" to
another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA,
when a single stranded form of the nucleic acid molecule can anneal
to the other nucleic acid molecule under the appropriate conditions
of temperature and solution ionic strength (see, e.g., Sambrook et
al., 1989, infra). The conditions of temperature and ionic strength
determine the "stringency" of the hybridization.
[0078] Hybridization requires that the two nucleic acids contain
complementary sequences. However, mismatches between bases are
possible depending on the stringency of the hybridization
conditions. The appropriate stringency for hybridizing nucleic
acids depends on the length of the nucleic acids and the degree of
complementarity, variables well known in the art. The greater the
degree of similarity or homology between two nucleotide sequences,
the greater the value of T.sub.m for a duplex of nucleic acids
having those sequences. For duplexes of greater than 100
nucleotides in length, equations for calculating T.sub.m have been
derived (see Sambrook et al., 1989, infra, 9.50-9.51). For
hybridization with shorter nucleic acids, i.e., oligonucleotides,
the position of mismatches becomes more important, and the length
of the oligonucleotide determines its specificity (see Sambrook et
al., 1989 infra, 11.7-11.8). A minimum length for a hybridizable
nucleic acid is at least about 8 nucleotides.
[0079] Suitable hybridization conditions for oligonucleotides
(e.g., for oligonucleotide probes or primers) are typically
somewhat different than for full-length nucleic acids (e.g.,
full-length cDNA), because of the oligonucleotides' lower melting
temperature. Because the melting temperature of oligonucleotides
will depend on the length of the oligonucleotide sequences
involved, suitable hybridization temperatures will vary depending
upon the oligonucleotide molecules and the application. Exemplary
temperatures may be 37.degree. C. (for 14-base oligonucleotides),
48.degree. C. (for 17-base oligonucleotides), 55.degree. C. (for
20-base oligonucleotides) and 60.degree. C. (for 23-base
oligonucleotides). Exemplary suitable conditions used in PCR
experiments include solutions containing 3 mM magnesium chloride,
50 mM potassium chloride, 0.8 mM deoxynucleoside triphosphates and
10 mM Tris-HCl preferably in the range of pH from 6 to 9, or other
conditions that afford equivalent levels of hybridization. In other
methods, solutions may contain additives or denaturants. For
example, dimethyl sulfoxide, formamide, urea, betaine,
tetramethylammonium chloride, glycerol, ethylene glycol, Tween 20
are widely used additives in molecular biology methods.
[0080] A pair of hybridized polynucleotides may be complementary
along their entire length or, alternatively, along only a part of
their sequence. In certain embodiments, all of the nucleotides in a
pair of hybridized oligonucleotides are complementary. However,
mismatch base pairing between complementary nucleic acids may
occur, and such nucleic acids are therefore said to be less than
100% complementary. In particular, the extent of complementarity is
usually indicated by the fraction (e.g., the percentage) of matched
base pairs out of the total number of base pairs in the
complementary polynucleotides. It may be that there is at least 99%
complementarity between the polynucleotide and its complementary
sequence. However, less complementarity may be acceptable or even
desirable in some embodiments. For example, in some embodiments,
the level of complementary may be as low as 95%, 85% or 75%.
[0081] Purification. Nucleic acids can be purified by
precipitation, chromatography (including preparative solid phase
chromatography), oligonucleotide hybridization,
ultracentrifugation, and other means. In one method, nucleic acids
are purified using polyacrylamide gel purification (PAGE)
techniques. In another embodiment, they are purified using high
pressure liquid chromatography (HPLC). Such methods of purification
are also well known in the art.
[0082] Other Relevant Terms. In certain embodiments, the terms
"about" and "approximately" shall generally mean an acceptable
degree of error for the quantity measured given the nature or
precision of the measurements. Typical, exemplary degrees of error
are within 20 percent (%), within 10%, or within 5% of a given
value or range of values. Alternatively, and particularly in
biological systems, the terms "about" and "approximately" may mean
values that are within an order of magnitude, for example, within
5-fold or within 2-fold of a given value. Numerical quantities
given herein are approximate unless stated otherwise, meaning that
the term "about" or "approximately" can be inferred when not
expressly stated.
General Methods
[0083] The present invention can be applied to the design of
oligonucleotide probes, hybridization and PCR methods, and
microarray hybridization methods.
[0084] In accordance with the invention, there may be employed
conventional molecular biology, microbiology and recombinant DNA
techniques within the ordinary skill of the art. Such techniques
are explained fully in the literature. See, for example, Sambrook
et al. (2001) Molecular Cloning: A Laboratory Manual. 3.sup.rd ed.
Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y.;
Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual.
2.sup.nd ed. Cold Spring Harbor Laboratory Press: Cold Spring
Harbor, N.Y.; Ausubel et al. eds. (2006) Current Protocols in
Molecular Biology. John Wiley and Sons, Inc.: Hoboken, N.J.;
Bonifacino et al. eds. (2006) Current Protocols in Cell Biology.
John Wiley and Sons, Inc.: Hoboken, N.J.; Coligan et al. eds.
(2006) Current Protocols in Immunology, John Wiley and Sons, Inc.:
Hoboken, N.J.; Coico et al. eds. (2006) Current Protocols in
Microbiology, John Wiley and Sons, Inc.: Hoboken, N.J.; Coligan et
al. eds. (2006) Current Protocols in Protein Science, John Wiley
and Sons, Inc.: Hoboken, N.J.; Enna et al. eds. (2006) Current
Protocols in Pharmacology John Wiley and Sons, Inc.: Hoboken, N.J.;
Hames et al. eds. (1999) Protein Expression: A Practical Approach.
Oxford University Press: Oxford; Freshney (2000) Culture of Animal
Cells: A Manual of Basic Technique. 4.sup.th ed. Wiley-Liss; among
others. The Current Protocols listed above are updated several
times every year.
Overview of the Method of the Invention
[0085] In accordance with the present invention, methods are
provided here for estimating a melting temperature, T.sub.m, for a
polynucleotide or, more specifically, for a polynucleotide and its
complementary sequence. Such methods are particularly well suited
for the design of oligonucleotide probes and primers, e.g., for use
in biological assays such as PCR and nucleic acid hybridization
assays. The methods of the invention are robust and
straightforward, and provide reliable predictions or estimations of
melting temperatures for polynucleotides under conditions that are
typically used in such assays. In particular, using the methods of
the invention one of ordinary skill in the art may readily
determine or estimate melting temperatures for polynucleotides
under particular salt conditions and/or may adjust salt conditions
for an assay accordingly. Alternatively, the methods of the
invention may be used to determine or estimate melting temperatures
for a variety of different polynucleotide probes and/or primers in
desired salt conditions, and those probes and/or primers having
optimal melting temperatures for the assay may then be
selected.
[0086] In its simplest form, the method of the invention comprises
a step of obtaining or determining a "reference" melting
temperature for a polynucleotide in a particular monovalent cation
concentration (i.e., the "reference" cation concentration) The
reference temperature may then be used in accordance with the
present invention to obtain or estimate a "salt-corrected" melting
temperature therefrom.
[0087] Reference melting temperature. A reference melting
temperature at a particular monovalent ion_concentration may be
readily obtained for a particular nucleic acid using any technique
known in the art for obtaining or determining melting temperatures.
For example, melting temperatures may be experimentally determined
for one or more polynucleotides (as described in the Examples,
infra) at some standard or reference monovalent ion concentration
and these experimentally determined melting temperatures may then
be used as reference melting temperatures in accordance with the
present invention. However, a reference melting temperature may
also be obtained or provided using theoretical, empirical or
semi-empirical models that predict melting temperatures at some
monovalent ion concentration. In certain embodiments, the reference
melting temperature for a polynucleotide is obtained using the
"nearest neighbor model", which is well known in the art (see,
e.g., Breslauer et al., Proc. Natl. Acad. Sci. U.S.A. 1986,
83:3746-3750; Owczarzy et al., Biopolymers 1997, 44:217-239; and
SantaLucia, Proc. Natl. Acad. Sci. U.S.A. 1998, 95:1460). In other
embodiments, the T.sub.r, monovalent ion correction (e.g., Owczarzy
et al., Biochemistry 2004, 43:3537-3554) may be applied to predict
reference T.sub.m.degree. in 1M Na.sup.+ solution from an
experimentally determined or predicted melting temperature at other
monovalent ion concentrations. Various other models are known in
the art and may also be used in accordance with the present
invention.
[0088] The exact experimental method, model, or formula used to
obtain the reference melting temperature is not crucial for
practicing the invention. For example and as noted above, the
reference melting temperature may be determined experimentally,
e.g., by using the melting temperature of a polynucleotide duplex
at some reference monovalent ion concentration. However, the
melting temperature may also be calculated using some theoretical,
empirical or semi-empirical model.
[0089] In embodiments where a reference melting temperature is
calculated from a theoretical model, the parameters of that model
will typically have been calibrated, optimized or otherwise
selected for a particular concentration of cations (e.g., for 1 M
Na.sup.+). One of ordinary skill in the art practicing the
invention will appreciate, therefore, that the reference
concentration of cations used in such embodiments will preferably
be that value for which the theoretical model's parameters have
been evaluated.
[0090] The model may provide an accurate or reliable estimate of
the melting temperature at some monovalent ion concentration for
which the model has been optimized. For example, the nearest
neighbor model and many other models for predicting melting
temperatures use parameters that have been particularly optimized
for a 1 M concentration of monovalent cations (specifically, for 1
M Na.sup.+). Accordingly, in embodiments where such models are used
to obtain a reference melting temperature, the reference monovalent
ion concentration may be 1 M. However, the value of T.sub.m.sup.0
at reference salt concentration may also be calculated from an
experimentally determined or calculated melting temperature at
another salt concentration using T.sub.m salt correction for
monovalent ions (e.g., Owczarzy et al., Biochemistry 2004,
43:3537-3554). Generally, one of ordinary skill in the art will
readily appreciate for what monovalent ion concentrations a method
or model for obtaining melting temperatures has been optimized and,
accordingly, will be able to use those monovalent ion
concentrations as the "reference" monovalent ion concentration for
practicing the methods of this invention. Preferably, both the
predicted melting temperature T.sub.m and the reference melting
temperature T.sub.m.sup.0 are specified in Kelvin (K).
[0091] Salt concentration. In accordance with the methods of this
invention, the melting temperature of a polynucleotide may be
readily determined for a particular monovalent ion (denoted
[Mon.sup.+]) concentration and particular divalent cation
concentration (denoted [X.sup.2+]) of interest to a user.
Generally, the cation concentration of interest will correspond to
salt conditions for a biological assay (e.g. a PCR or hybridization
assay) of particular interest to the user. In certain embodiments
of the invention, the divalent cation concentration of interest
will be a concentration of free magnesium ions. However, other
divalent cations (e.g., calcium, manganese, iron, zinc, copper,
nickel, lead, etc.) may be substituted.
[0092] The free divalent cation concentration is calculated from
total divalent cation concentration by subtracting those divalent
cations that are bound to other compounds in solution, for example,
but not limited to, deoxynucleoside triphosphates (dNTPs). One of
ordinary skill in the art will recognize that free magnesium ion
concentration may be calculated by subtracting dNTP concentrations,
c(dNTP), from total magnesium concentration, c(Mg.sup.2+),
[Mg.sup.2+]=c(Mg.sup.2+)-c(dNTP).
(See von Ahsen et al., Clin. Chem. 2001, 47:1956-1961.) The
concentration of divalent ions may be compensated for in this
manner for any compound which binds the divalent ions, including
taking into account the stoichiometry of binding, e.g.,
[X.sup.2+]=c(X.sup.2+)-c(binding compound).times.(no. of X.sup.2+
ions bound per binding compound).
[0093] Additionally, the monovalent cation concentration,
[Mon.sup.+], is a sum of concentrations of all monovalent cations
in solution; however, H.sup.+ ions are not considered. The
functional group primarily involved in the buffering action of Tris
is an --NH.sub.2 group that ionizes to --NH.sub.3.sup.+ with a
pK.sub.a of 8.3. The pK.sub.a is the pH at which 50% of the buffer
concentration is ionized and 50% is not. Because approximately half
of the Tris molecules are ionized at pH 8.3 and the experiments of
Example 1 were at pH 8.3, in some embodiments, it may be assumed
that the monovalent cation concentration is equal to half of the
total Tris cation concentration for the calculations. For a typical
PCR buffer, concentrations of K.sup.+ and Tris.sup.+ ions are
summed,
[Mon.sup.+]=[K.sup.+]+[Tris.sup.+] (Equation 5)
[0094] In a more general case, the free monovalent ion
concentration is calculated from total monovalent cation
concentration by subtracting those monovalent cations that are
bound to other compounds in solution
[Mon.sup.+]=c(Mon.sup.+)-c(binding compound).times.(no. of
Mon.sup.+ ions bound per binding compound).
In most cases, the binding of monovalent ions to other components
in the solution is small and can be neglected.
[0095] The formulas presented in this application, as well as the
algorithms they represent and illustrate, may be used with any
reference monovalent or divalent ions including, but not limited
to, magnesium ions (Mg.sup.2+), manganese ions (Mn.sup.2+), calcium
ions (Ca.sup.2+), potassium cations (K.sup.+), ammonium cations
(NH.sub.4.sup.+), lithium cations (Li.sup.+), rubidium cations
(Rb.sup.+), cesium cations (Cs.sup.+) and francium cations
(Fr.sup.+). These reference solutions contain cations and may
contain various additives or denaturants (e.g., dimethyl sulfoxide,
formamide, Tween 20, urea, betaine, tetramethylammonium chloride,
glycerol, ethylene glycol).
[0096] As demonstrated in the Examples, infra, the methods of the
invention are robust, and may be used reliably to determine melting
temperatures for a wide range of different monovalent and divalent
cation conditions. Divalent cation concentrations may be anywhere
from about 0.1 mM to about 1 M, preferably between about 0.5 mM and
about 600 mM, more preferably between about 0.5 mM and 125 mM.
Monovalent cation concentrations may be anywhere from about 5 mM to
about 1.5 M, preferably between about 10 mM and 1.005, more
preferably from about 55 mM to 1.005M. However, using empirical
techniques that are demonstrated in the below examples, one of
ordinary skill in the art can readily optimize the formulas and
methods of this invention for any salt concentration or range of
salt concentrations of interest. Accordingly, the formulas and
techniques described here need not be limited to the specific
ranges of salt concentration used in those examples.
[0097] Number of base pair value. In certain embodiments, the
methods of the invention adjust T.sub.m values based on the lengths
of the duplex, denoted by the symbol N.sub.bp and equal to the
number of bases at each strand. In other embodiments, the T.sub.m
values can be predicted or estimated without requiring a correction
factor based on the number of base pairs. Overhanging bases at the
ends of a duplex are not counted in N.sub.bp. For example, if two
polynucleotides that contain different numbers of nucleotides
anneal, all of the paired bases, and none of the unpaired bases,
would be included in the N.sub.bp value. The N.sub.bp value
includes nucleotides from one of the stands only, not both stands
(see Example 6 if further clarification is needed with regard to
the N.sub.bp value).
[0098] G-C content value. The invention provides methods and
formulas which more accurately estimate salt effects on the melting
temperature of a polynucleotide. In particular, these methods
adjust the "reference" melting temperature in a manner that is
dependent upon the polynucleotide's sequence content, specifically
the content of guanine (G) and cytosine (C) base pairs that form
between a polynucleotide and its complement. Accordingly, the
systems and methods of the invention also use a value, referred to
herein as the "G-C content value" and denoted by the symbol
f.sub.GC. The G-C content value f.sub.GC provides a numerical value
which is indicative of the number of G-C base pairs formed between
a polynucleotide and its complementary sequence. One of ordinary
skill in the art will recognize that adenine (A) and thymine (T)
form another type of base pair. In certain embodiments, the G-C
content of a polynucleotide may be obtained or provided from the
molar fraction of G-C base pairs in the polynucleotide duplex;
i.e.,
f GC = ( number of G - C base pairs ) ( number of G - C base pairs
) + ( number of A - T base pairs ) ##EQU00014##
One of ordinary skill in the art would recognize that
F.sub.GC+f.sub.AT=1, and thus that f.sub.GC=1-f.sub.AT, so that
f.sub.GC can be optionally replaced by (1-f.sub.AT).
Estimating Salt Dependent Effects on Melting Temperature
[0099] In accordance with the present invention, applicants have
discovered novel relationships between the melting temperature of a
polynucleotide, T.sub.m, the free divalent cation concentration,
[X.sup.2+], in which the polynucleotide dissociation (or
hybridization) occurs, the polynucleotide's G-C content value,
f.sub.GC, a reference temperature, T.sub.m.degree., calculated at
some monovalent ion concentration, and, optionally, the number of
base pairs value, N.sub.bp. Accordingly, the invention provides
novel methods for estimating melting temperatures using these novel
relationships. Generally speaking, a "reference" melting
temperature T.sub.m.degree. is obtained or provided for the
polynucleotide at a "reference" monovalent cation concentration, as
described above. The reference melting temperature is then used to
calculate a melting temperature, T.sub.m, according to a
relationship that has been optimized for the polynucleotide's G-C
content.
[0100] Predictive Formulas. For example, in one embodiment, a
melting temperature, T.sub.m(X.sup.2+), may be estimated or
obtained from a reference melting temperature, T.sub.m.degree.,
using the formula:
1 T m ( X 2 + ) = 1 T m o + a + b ln [ X 2 + ] + f GC ( c + d ln [
X 2 + ] ) ( Equation 11 ) ##EQU00015##
[0101] It is noted that for equations such as Equation 11, as well
as for other equations throughout the specification based on the
reciprocal of the melting temperature (i.e., 1/T.sub.m),
temperatures should be entered in units of Kelvin. One of ordinary
skill in the art will be able to readily convert between other
scales for measuring temperature (e.g., degrees of Celsius) and
units of Kelvin using formulas that are well known and routinely
used in the art (for example: K=.degree. C.+273.15). Equation 11
provides an estimate for Tm when working in the 0.5 mM to 50 mM
range, and provides an more accurate estimate when working in a the
0.5 mM to 20 mM range.
[0102] In another embodiment, a melting temperature,
T.sub.m(X.sup.2+), may be estimated or obtained from a reference
melting temperature, T.sub.m.degree., using the formula:
1 T m ( X 2 + ) = 1 T m o + a + b ln [ X 2 + ] + f GC ( c + d ln [
X 2 + ] ) + ( e + f ln [ X 2 + ] 2 ( N bp - 1 ) ) ( Equation 12 )
##EQU00016##
[0103] Equation 12 provides a more accurate estimate for Tm when
working with polynucleotides of varying length.
[0104] In yet another embodiment, a melting temperature,
T.sub.m(X.sup.2+), may be estimated or obtained from a reference
melting temperature, T.sub.m.degree., using the formula:
1 T m ( X 2 + ) = 1 T m .degree. + a + b ln [ X 2 + ] + f GC ( c +
d ln [ X 2 + ] ) + ( e + f ln [ X 2 + ] + g ( ln [ X 2 + ] ) 2 2 (
N bp - 1 ) ) ( Equation 13 ) ##EQU00017##
[0105] Equation 13 provides an even more accurate estimate for Tm
when working with polynucleotides of varying length.
[0106] One of ordinary skill in the art will recognize that the
terms a+b ln [X.sup.2+]+f.sub.GC(c+d ln [X.sup.2+]) in equations
11-13 can be very closely approximated by many other mathematical
expressions. As such, when practicing the present invention, the
terms a+b ln [X.sup.2+]+f.sub.GC(c+d ln [X.sup.2++]) can be
replaced by any such equivalent expression without changing the
meaning of said term in equations 11-13 of the invention. For
example, the term ln [X.sup.2+]) can be closely approximated by a
polynomial expression using the Taylor expansion, which therefore
can also be used when implementing those equations in the in the
practice of this invention.
(f.sub.GC+f.sub.AT)a+(f.sub.GC+f.sub.AT)b ln
[X.sup.2+]+f.sub.GC(c+d ln [X.sup.2+]) (Equation 11a)
f.sub.GCa+f.sub.ATa+f.sub.GCb ln [X.sup.2+]+f.sub.ATb ln
[X.sup.2+]+f.sub.GC(c+d ln [X.sup.2+]) (Equation 11b)
f.sub.ATa+f.sub.GC(c+a)+[f.sub.ATb+f.sub.GC(b+d)].times.ln
[X.sup.2+] (Equation 11c)
[0107] In many embodiments, the relationship provided in Equations
11-13 may be well approximated by a function linear in the
reference melting temperature rather than of its inverse (i.e.,
1/T.sub.m). Such a relationship is less computationally intensive
than Equations 11-13 and therefore will be simpler to compute.
Accordingly, the use of such a linear approximation may be
preferred, particularly when considering the usually relatively
narrow range of melting temperatures of nucleic acids; i.e., for
physiological temperatures, for example, between about 20 and
80.degree. C. (i.e., between about 293 and 353 K).
[0108] Accordingly, in another embodiment, a salt-corrected melting
temperature, T.sub.m(X.sup.2+), may be estimated or obtained from a
reference melting temperature using the formula:
T.sub.m(X.sup.2+)=T.sub.m.degree.+a'+b' ln
[X.sup.2+]+f.sub.GC(c'+d' ln [X.sup.2+]) (Equation 14)
which is a linear approximation of Equation 11. For equation 11,
units of Kelvin and degrees Celsius may be used
interchangeably.
[0109] In yet another embodiment, a salt-corrected melting
temperature, T.sub.m(X.sup.2+), may be estimated or obtained from a
reference melting temperature using the formula:
T m ( X 2 + ) = T m .degree. + a ' + b ' ln [ X 2 + ] + f GC ( c '
+ d ' ln [ X 2 + ] ) ++ ( e ' + f ' ln [ X 2 + ] 2 ( N bp - 1 ) ) (
Equation 15 ) ##EQU00018##
which is a linear approximation of Equation 12. Like Equation 12,
Equation 15 provides a more accurate estimate of Tm when working
with polynucleotides of varying length.
[0110] In a further embodiment, a salt-corrected melting
temperature, T.sub.m(X.sup.2+), may be estimated or obtained from a
reference melting temperature using the formula:
T m ( X 2 + ) = T m .degree. + a ' + b ' ln [ X 2 + ] + f GC ( c '
+ d ' ln [ X 2 + ] ) ++ ( e ' + f ' ln [ X 2 + ] + g ' ( ln [ X 2 +
] ) 2 2 ( N bp - 1 ) ) ( Equation 16 ) ##EQU00019##
which is a linear approximation of Equation 13. As in the case of
Equation 13, Equation 16 provides a further improved estimate of
the Tm when working with polynucleotides of varying length.
[0111] Higher Order Terms. Formulas for estimating or providing a
salt-corrected melting temperature (e.g., Equations 11-16 above)
may be further optimized by the addition of one or more higher
order polynomial terms. Thus, for example, embodiments of the
invention are also contemplated that may use, e.g., a third order,
forth order, and/or even fifth order polynomial term. One of
ordinary skill in the art will be able to modify the equations used
in this invention to incorporate still higher order polynomial
terms; e.g. (ln [X.sup.2+]).sup.3, (ln [X.sup.2+]).sup.4, (ln
[X.sup.2+]).sup.5, etc. using routine formulas and methods well
known in the mathematical arts.
[0112] Formula Coefficients. The coefficients a, b, c, d, e, f, and
g in Equations 11-13, and the coefficients a', b', c', d', e', f',
and g' in Equations 14-16, may be optimized to determine melting
temperatures for polynucleotides having different G-C content,
different number of base pairs, different monovalent ion
concentrations, and different divalent ions under the salt
concentration(s) or range of salt concentrations of interest. For
instance, the Examples infra describe experiments when appropriate
values for these coefficients are optimized for all of Equations
11-16 above, by optimizing the fit quality to melting data for a
plurality of polynucleotide sequences (see the Examples for further
clarification.) One of ordinary skill in the art will appreciate
that the exact value of the coefficients will depend on which
formula (Equations 11-16) is used to estimate or obtain the salt
corrected melting temperature. Therefore, the coefficients may be
optimized independently for each formula. Further, when practicing
the invention, one should realize that the coefficients depend on
the chosen reference monovalent ion concentration, and may be
optimized independently for difference reference monovalent ion
concentrations.
[0113] Applicants have determined that the effect of salt
concentration on the melting temperature of a polynucleotide is
dependent on the nucleotide sequence. However, as demonstrated
herein, such sequence-dependent effects may be accounted for when
predicting or estimating T.sub.m values, by simply using terms of
Equations 11-16 which are a function of the nucleotide sequence
content. In particular and in preferred embodiments of the
invention, the terms may be a function of the polynucleotide's G-C
content, f.sub.GC, and, optionally, a polynucleotides' number of
base pairs, N.sub.bp.
[0114] In still other embodiments, additional higher order
polynomial terms may also be used in Equations 11-16 to estimate
salt-corrected melting temperatures with even greater accuracy and
reliability. Thus, the invention also contemplates the optional use
of third, forth and/or even fifth order polynomial terms. One of
ordinary skill in the art will be able to modify the equations used
in this invention to incorporate such higher order polynomial terms
using routine formulas and methods well known in the mathematical
arts. One of ordinary skill in the art will also recognize that,
when higher order polynomial terms are used in these equations, it
will be necessary to re-optimize the coefficients for optimal
results.
[0115] It is also noted that the formulas provided in Equations
11-16 are set forth with respect to the "natural logarithm" (i.e.,
a logarithm of the base e=2.1718) of a cation concentration. As one
of ordinary skill in the art will readily appreciate, it may be
preferable in many instances to perform calculations using
logarithms of a different base (e.g., the logarithm of base 10 or
of base 2) which may, for example, be simpler to calculate. The
logarithmic terms in Equations 11-16, as well as in the other
formulas and equations set forth in this document, may be readily
adapted to such other forms by simply making an appropriate
adjustment to the coefficient(s); more specifically by multiplying
the coefficient(s) by an appropriate factor. One of ordinary skill
in the art will be able to readily obtain or determine the
appropriate factor(s) and make the necessary adjustment to the
logarithmic coefficient(s). Accordingly, it is understood that
versions of these equations which use logarithms of other bases are
mathematically equivalent to the equations and formulations set
forth in this application, and merely provide alternative
representations or descriptions of the algorithms and computational
methods of this invention. Indeed, one of ordinary skill in the
mathematical arts will appreciate that the equations and formulas
set forth throughout this application may be written or expressed
in a variety of different ways that are mathematically equivalent.
Such mathematically equivalent expressions merely represent
alternative representations or descriptions of the computational
methods that they describe rather than any departure from those
methods.
Relative Monovalent/Divalent Cation Concentrations
[0116] The coefficients for the above equations can be estimated
from fitting the equations to experimentally determined melting
temperatures of a set of polynucleotides, and the resulting
coefficients may be constant values or functions of the monovalent
ion concentration. Whether the coefficients are constant values or
functions of monovalent ion concentration depends on the relative
concentration of divalent cations, [X.sup.2+], and monovalent
cations, [Mon.sup.+], in solution. In solutions where divalent
cations, [X.sup.2+], are "dominant" over monovalent ions,
[Mon.sup.+], in their effects on melting temperatures, the
coefficients of the above equations are constants and do not vary
with [Mon.sup.+]. In solutions where neither divalent cations,
[X.sup.2+], nor monovalent cations, [Mon.sup.+], are dominant in
their effects on melting temperature, the optimal coefficients of
the above equations do vary with [Mon.sup.+]. Finally, in solutions
where monovalent cations, [Mon.sup.+], are "dominant" over divalent
cations, [X2.sup.+], in their effects on melting temperatures.
Equations which predict melting temperatures based on [Mon+] alone
are used, see for example Equation 3.
[0117] Applicants have discovered that the ratio, R,
R= {square root over ([X.sup.2+])}/[Mon.sup.+] (Equation 17)
is a suitable function to show whether divalent ions or monovalent
ions are "dominant" in their effects on T.sub.m and whether T.sub.m
correction formulae for divalent cations (Equations 11-16) or
T.sub.m correction formulae for monovalent cations (for example,
Equation 3) are the most accurate and relevant.
[0118] For example, if the ratio R is equal to or greater than 0.22
for solutions of magnesium and monovalent cations, then Mg.sup.2+
ions have dominant effects on T.sub.m values and correction
formulae for divalent cations (for example, Equations 11-16) are
the most accurate. When the ratio R is less than 0.22, T.sub.m
correction for monovalent ions (for example, Equation 3) is the
most accurate. A flowchart of this algorithm used to select the
most accurate T.sub.m correction equation is shown in FIG. 6.
[0119] FIG. 5 illustrates that effects of magnesium and monovalent
cations on duplex melting temperature are competitive. Depending on
the ratio R of ion concentrations, as determined by Equation 17,
melting temperatures are largely determined by the "dominant" ions
present.
[0120] T.sub.m prediction can be further improved by allowing the
coefficients of Equations 11-16 to vary depending upon monovalent
cation concentration. For example, additional terms describing the
dependence of the coefficients a, b, c, d, e, f, g on [Mon.sup.+]
can be used in magnesium buffers where the ratio
R= {square root over ([Mg.sup.2+])}/[Mon.sup.+]
is in the range from 0.22 to 6.0. Although Equations 11-16 with
constant coefficients are accurate in this range, further
improvements of T.sub.m predictions were observed when the
coefficients were allowed to vary with [Mon.sup.+]. For example,
the accuracy of equation 13 was improved in the range of R values
from 0.22 to 6.0 when coefficients a, d and g were allowed to vary
with [Mon.sup.+] according to Equations 18-20.
a=3.92.times.10.sup.-5(1-0.157-0.352 {square root over
([Mon.sup.+])}ln [Mon.sup.+]) (Equation 18)
d=1.42.times.10.sup.-5[1+0.279-4.03.times.10.sup.-3 ln
[Mon.sup.+]-8.03.times.10.sup.-3(ln [Mon.sup.+]).sup.2] (Equation
19)
g=8.31.times.10.sup.-5[1-0.514-0.258 ln
[Mon.sup.+]+5.25.times.10.sup.-3(ln [Mon.sup.+]).sup.3] (Equation
20).
[0121] Temperatures and concentrations have units of Kelvin and
mol/L, respectively.
[0122] Monovalent cations concentration is a sum of concentrations
of all monovalent cations in solution. Concentration of H.sup.+
ions is negligible under experimental conditions of interest.
Exemplary condition is a typical PCR buffer where concentrations of
K.sup.+ and Tris.sup.+ ions are summed,
[Mon.sup.+]=[K.sup.+]+[Tris.sup.+] (Equation 5)
Concentrations of cations are under equilibrium conditions. Amounts
of basic and acidic forms of buffering compounds vary with pH. Only
concentrations of cations are included in Equation 5. For example,
Tris at pH 8.3 and 25.degree. C. is about half ionized. Thus, a
buffer of 10 mM total Tris concentration at these conditions will
contain approximately 5 mM of Tris.sup.+ cations and this value is
entered into Equation 5.
[0123] These equations applied according to the flowchart on FIG. 6
were shown to be accurate for solutions of 0-600 mM Mg.sup.2+, and
0-1M K.sup.+ and pH from 6 to 9. These equations may be less
accurate in higher magnesium concentrations, specifically above 1 M
Mg.sup.2+, because Mg.sup.2+ ions at such high concentrations can
bind to additional sites on nucleic acids.
Implementation Systems and Methods
[0124] Computer System. The analytical methods described herein can
be implemented by the use of one or more computer systems. FIG. 2
schematically illustrates an exemplary computer system suitable for
implementation of the analytical methods of this invention. The
components of the computer system 201 include processor element 202
interconnected with a main memory 203. The computer system can
contain other components such as a mass storage device 204 and user
interface devices 205 including for example, but not limited to, a
monitor, a keyboard, and/or pointing devices 206 like a mouse or
other graphical input device. The computer system 201 can be linked
to a network 207, which can be part of an Ethernet, a local
computer system (e.g., as part of a local area network or LAN),
and/or a wide area communication network (WAN) such as the
Internet.
[0125] Typically, one or more software components are loaded into
main memory 203 during operation of computer system 201. Software
component 210 represents an operating system, which is responsible
for managing computer system 201 and its network connections.
Software component 211 represents common languages and functions in
the system to assist programs implementing the methods specific to
the invention. Equations for practicing the methods of the
invention can also be programmed and implemented using any
programmable spreadsheet software program. Programmable database
systems (for example, but not limited to, a SQL database) can be
used to program and/or implement the equations and methods of this
invention. Thus, software component 212 represents the analytic
methods of the invention as programmed in an appropriate procedural
language, symbolic package, or the like.
[0126] Computer Program Products. The invention also provides
computer program products which can be used, e.g., to program or
configure a computer system for the implementation of analytical
methods of the invention. A computer program product of the
invention comprises a computer readable medium such as one or more
compact disks (i.e., one or more "CDs", which may be CD-ROMs or a
RW-CDs), one or more DVDs, one or more floppy disks (including, for
example, but not limited to, one or more ZIP.TM. disks) or one or
more DATs to name a few. The computer readable medium has encoded
thereon, in computer readable form, one or more of the software
components 212 that, when loaded into memory 203 of a computer
system 201, cause the computer system to implement analytic methods
of the invention. The computer readable medium may also have other
software components encoded thereon in computer readable form. Such
other software components may include, for example, but not limited
to, functional languages 211 or an operating system 210.
[0127] The invention also contemplates the use of the Internet. For
example, a web browser may be used as an interface between the user
and a server, wherein the user inputs data into the browser, and
the data is sent to the server over the Internet. The server may
then use the methods of the invention to perform calculations as
described within this application and output calculated parameters,
e.g., melting temperatures. The server may then provide the
calculated parameters through the interface/browser to the
user.
[0128] System Implementation. In an exemplary implementation, to
practice the methods of the invention a G-C content value and/or
cation concentrations may be loaded into the computer system 201.
For example, the G-C content value may be directly entered by a
user from monitor and keyboard 205 by directly typing a sequence of
symbols representing numbers (e.g., G-C content value).
Alternatively, a user may specify a reference ion concentration,
e.g., by selecting an ion concentration from a menu of candidate
ion concentrations presented on the monitor or by entering an
accession number for a ion concentration in a database and the
computer system may access the selected ion concentration from the
database, e.g., by accessing a database in memory 203 or by
accessing the sequence from a database over the network connection,
e.g., over the internet.
[0129] Finally, the software components of the computer system,
when loaded into memory 203, preferably also cause the computer
system to estimate a melting temperature according to the methods
described herein. For example, the software components may cause
the computer system to use the reference melting temperature of the
polynucleotide at a particular reference ion concentration to
calculate a modified melting temperature for the polynucleotide at
another ion concentration utilizing the methods described
herein.
[0130] Upon implementing these analytic methods, the computer
system preferably then outputs, e.g., the melting temperature for
the polynucleotide at a desired ion concentration. The output may
be output to the monitor, printed on a printer (not shown), written
on mass storage 204 or sent through a computer network (e.g., the
interne or an intranet such as a Local Area Network) to one or more
other computers.
[0131] Alternative systems and methods for implementing the
analytic methods of this invention are also intended to be
comprehended within the accompanying claims. In particular, the
accompanying claims are intended to include the alternative program
structures for implementing the methods of this invention that will
be readily apparent to one of ordinary skill in the relevant
art(s).
EXAMPLES
[0132] The present invention is also described by means of the
following examples. However, the use of these or other examples
anywhere in the specification is illustrative only and in no way
limits the scope and meaning of the invention or of any exemplified
term. Likewise, the invention is not limited to any particular
embodiments described herein. Indeed, many modifications and
variations of the invention may be apparent to one of ordinary
skill in the art upon reading this specification and can be made
without departing from its spirit and scope. The invention is
therefore to be limited only by the terms of the appended claims
along with the full scope of equivalents to which the claims are
entitled.
Example 1
Melting Temperatures of Various Oligomers Measured in Different
Salt Conditions
[0133] This example describes experiments in which melting profiles
were measured for 92 different, exemplary oligonucleotide duplex
molecules ranging in length from 10 to 30 base pairs in various
salt concentrations. Melting temperatures are extracted from those
profiles for each oligonucleotide at each salt concentration
observed, and those melting temperatures are provided in the
results, infra. Sequence information for each of the exemplary
oligonucleotides is also provided. Methods of Moreira et al.,
Biochem. Biophys. Res. Commun. 2005, 327:473-484 and Owczarzy et
al., Biochemistry 2004, 43:3537-3554 (both of which are
incorporated herein by reference in their entireties) were followed
according to the below:
[0134] Oligonucleotide synthesis and purification. DNA
oligonucleotides (SEQ ID NOS:1-92) were synthesized using solid
phase phosphoramidite chemistry, deprotected and desalted on NAP-5
columns (Amersham Pharmacia Biotech, Piscataway, N.J.) according to
routine techniques (Caruthers et al., Methods Enzymol. 1992,
211:3-20). The oligomers were purified using 20% polyacrylamide gel
electrophoresis in 1.times.TBE buffer (50 mM Tris, 50 mM boric
acid, 1 mM Na.sub.2EDTA). The purity of each oligomer was
determined by capillary electrophoresis (CE) carried out on a
Beckman PACE 5000 (Beckman Coulter, Inc., Fullerton, Calif.). The
CE capillaries had a 11 .mu.m inner diameter and contained ssDNA
100R gel (Beckman-Coulter, Inc., Fullerton, Calif.). Typically,
about 0.6 nmole of oligonucleotide was injected into a capillary,
ran in an electric field of 444 V/cm and detected by UV absorbance
at 254 nm. The assays indicated that all oligomers were more than
92% pure.
[0135] Compound identity was verified by matrix-assisted laser
desorption ionization time-of-flight (MALDI-TOF) mass spectroscopy
on a Voyager DE.TM. Biospectometry.TM. Work station (Applied
Biosystems, Foster, Calif.) or an electrospray ionization-liquid
chromatography/mass spectrometry (ESI-LCMS) Oligo HTCS system
(Novatia, Princenton, N.J.) following the manufacturer's
recommended protocol. Experimental molar masses of all oligomers
were within 0.1% of expected molar masses.
[0136] Preparation of Magnesium and DNA Samples. in the First Set
of Experiments (Examples 1-4), melting studies were carried out in
buffers containing 2 mM Tris-HCl with 0.5 mM, 1.5 mM, 3 mM, 10 mM,
or 20 mM MgCl.sub.2; or in buffers containing 10 mM Tris-HCl with
50 mM, 125 mM, 300 mM or 600 mM MgCl.sub.2. These were the lowest
concentrations of Tris that exhibited sufficient buffering
capacity.
[0137] In the second set of experiments (Example 5), competitive
effects of Mg.sup.2+ and K.sup.+ ions were examined. Therefore,
buffers contained 10 mM Tris-HCl with 0.5 mM, 1.5 mM, 3 mM, 10 mM,
20 mM, 50 mM or 125 mM MgCl.sub.2 and with 50 mM, 100 mM, 200 mM,
600 mM or 1M KCl.
[0138] Buffer pH was adjusted to 8.3 (at 25.degree. C.) with 0.6 M
HCl. Magnesium concentrations of buffers were verified using
chelatometric EDTA titrations (Moreira et al., Biochem. Biophys.
Res. Commun. 2005, 327:473-484) and had errors less than 2%.
[0139] The DNA samples were thoroughly dialyzed against melting
buffer in a 28-Well Microdialysis System (Invitrogen Corp.,
Carlsbad, Calif.) following the manufacturer's recommended
protocol. Concentrations of DNA oligomers were determined using UV
absorbance of the samples at 260 nm in a spectrophotometer (Beckman
Coulter, Inc., Fullerton, Calif.), using extinction coefficients
for each oligonucleotide that were estimated using the nearest
neighbor model for calculating extinction coefficients. (See,
Warshaw et al., J. Mol. Biol. 1966, 20:29-38. See also, Fasman ed.,
Handbook of Biochemistry and Molecular Biology, vol. 1, CRC Press:
Cleveland, Ohio, 1975). Oligomer concentrations were estimated at
least twice for each sample. If the estimated concentrations for
any sample differed more than 4%, the results were discarded and
new absorbance measurements were performed.
[0140] To prepare oligonucleotide duplexes, complementary DNA
oligomers were mixed in 1:1 molar ratio, heated to 368 K (i.e.,
95.degree. C.) and slowly cooled to an ambient temperature. Each
solution of duplex DNA was diluted with melting buffer to a total
DNA concentration, C.sub.T, of 2 .mu.M.
[0141] Measurement of UV-melting curves. Melting experiments were
conducted on a single beam Beckman DU 650 spectrophotometer
(Beckman-Coulter) with a Micro T.sub.m Analysis accessory, a
Beckman High Performance Peltier Controller (to regulate the
temperature), and 1 cm path-length cuvettes. Melting data were
recorded using a PC interfaced to the spectrophotometer.
UV-absorbance values at 268 nm wavelength were measured at 0.1
degree increments in the temperature range from 283 to 368 K (i.e.,
10-95.degree. C.). Both heating (i.e., "denaturation") and cooling
(i.e., "renaturation") transition curves were recorded for each
sample at a controlled rate of temperature change (24.9.+-.0.3
Kelvin per hour). Sample temperatures were collected from the
internal probe located inside the Peltier holder, and recorded with
each sample's UV-absorbance data. Melting profiles were also
recorded for samples of buffer alone (no oligonucleotide), and
these "blank" profiles were digitally subtracted from melting
curves of the DNA samples. To minimize systematic errors, at least
three melting curves were collected for each sample in different
cuvettes and in different positions within the Peltier holder.
[0142] It is well known by those of ordinary skill in the art that
a sample of double-stranded nucleic acid molecules absorbs less
UV-light than an equivalent sample of single-stranded nucleic acid
molecules. Thus, in one certain embodiment, a melting profile may
comprise a collection of measurements indicating the UV absorption
of a nucleic acid sample over a range of temperatures. Such a
collection of measurements was obtained for the melting profiles
here, in FIG. 1A, following the procedures described, supra. In
such a melting profile, an increase in UV-absorption as the
temperature increases will indicate the extent to which more and
more base pairs of duplex nucleic acid molecules in the sample are
dissociating and an increasing fraction, .theta., of those
molecules are present in a single-stranded conformation.
Conversely, a decrease in UV-absorption as the temperature
decreases indicates that more and more base pairs are forming in
the sample so that the fraction of double stranded nucleic acid
molecules (1-.theta.) in the sample is increasing while the
fraction of single-stranded nucleic acid molecules (.theta.) is
decreasing.
[0143] Determination of melting temperatures. To determine each
sample's melting temperature, the melting profiles were analyzed
using methods that have been previously described (Owczarzy et al.,
Biochemistry 2004, 43:3537-3554). Briefly, the experimental data
for each sample was smoothed, using a digital filter, to obtain a
plot of the sample's UV-absorbance as a function of its
temperature. The fraction of single-stranded oligonucleotide
molecules, 0, was then calculated from that plot. The "melting
temperature" or "T.sub.m" of a sample was defined as the
temperature where .theta.=0.5.
[0144] As an example, FIG. 1A shows an exemplary "UV-melting curve"
for a 2 .mu.M solution of the oligonucleotide
5'-TACTTCCAGTGCTCAGCGTA-3' (SEQ ID NO: 31) and its complement
dissolved in 3 mM Mg.sup.2+ and 50 mM KCl PCR buffer. This "melting
curve" was obtained as described in the Materials and Method
section, supra. Because the solution absorbs more UV-light (260 nm)
when the nucleic acid molecules are in a single-stranded
conformation then when they are in a double-stranded conformation,
the UV-melting curve in FIG. 1A actually monitors the
oligonucleotide's transition from the double-stranded to the
single-stranded conformation. Inspection of the UV-melting curve
reveals that the transition from double to single-stranded
conformation does not occur completely at a single temperature, but
rather takes place across a range of temperatures. However, this
range is very narrow (between about 5-10.degree. C.). Thus, at
temperatures above the center of this transition (above about
65.6.degree. C. or 339 K) the oligonucleotides in this sample can
generally be regarded as existing in a single-stranded
conformation, whereas at temperatures below that "melting
temperature" the oligonucleotides in the sample are generally
regarded as existing in a double-stranded conformation (i.e., as
"duplex" oligonucleotide).
[0145] Measurement of melting curves from Differential Scanning
calorimetry, DSC. A melting curve for measuring melting temperature
may be obtained from differential scanning calorimetry, DSC. The
exemplary DSC curve shown in FIG. 1B shows that the melting
temperature of a nucleic acid sample may be readily obtained by
evaluating a melting profile for that sample from a DSC curve, such
as the DSC curve shown in FIG. 1B, in addition to a UV-melting
curve, as shown in FIG. 1A. For a detailed description of this
experimental technique, see, e.g., Cooper, Curr. Opinion Chem.
Biol., 1999, 3:557-563; and Plum & Breslauer, Curr. Opinion
Struct. Biol., 1995, 5:682-690.
[0146] FIG. 1B shows data from a DSC experiment for a sample of the
same oligonucleotide at much higher concentrations (98 .mu.M
solution of SEQ ID NO: 31, C.sub.t=196 .mu.M, in 3 mM Mg.sup.2+ and
50 mM KCl buffer). The plot shows the sample's excess heat
capacity, .DELTA.C.sub.p, as the temperature is raised from about
293 to about 373 K (i.e., 20.degree. C. to about 100.degree. C.).
Heat capacity of the sample increases as the oligonucleotide
duplexes in that sample undergo a transition from the
double-stranded conformation to the single-stranded conformation.
Again, inspection of this figure shows that the transition occurs
across a finite but narrow range (e.g., about 5-15 degrees) of
temperatures centered at 74.6.degree. C., where the heat absorption
is maximal. Thus, again, at temperatures above 74.6.degree. C. (348
K) the oligonucleotides within this sample can generally be
regarded as existing in a single-stranded conformation, whereas the
oligonucleotides may be generally regarded as existing in a
double-stranded conformation at temperatures below 74.6.degree.
C.
[0147] The observation that this transition (from double-stranded
to single-stranded DNA) occurs at a higher temperature for the
sample in FIG. 1B (74.6.degree. C.) than for the sample in FIG. 1A
(65.6.degree. C.) may be readily attributed to the much higher
oligonucleotide concentration in FIG. 1B (196 .mu.M vs. 2 .mu.M)
which, as is well known in the art, drives the equilibrium towards
the double-stranded nucleic acid conformation.
[0148] Melting Temperatures of Various DNA Duplex Oligomers.
Oligonucleotides corresponding to each of the sequences set forth
in SEQ ID NOS:1-92 and their complementary sequences were
synthesized and purified according to the methods described in the
Materials and Methods section, supra. For the melting experiments,
each of the oligonucleotides (SEQ ID NOS: 1-92) listed in Table I,
below, was mixed in a 1:1 molar ratio with its 100% complementary
sequence, as described in Material and Methods Section, supra.
Melting profiles were then recorded for each oligomer in 0.5 mM,
1.5 mM, 3 mM, 10 mM, 20 mM, 50 mM, 125 mM, 300 mM and 600 mM
[Mg.sup.2+], and the melting temperature was extracted from each
profile. The experimentally determined T.sub.m values for each
sample were reproducible within 0.3.degree. C. Denaturation and
renaturation melting profiles were superimposable indicating
equilibrium conditions.
[0149] The T.sub.m values obtained for each oligomer are provided
in Tables I and II, below. In this first example of experiments,
buffers did not contain potassium ions. For convenience, the
melting temperatures specified in Tables I and II are listed in
units of Kelvin (K), which may be used in the implementation of
this invention. However, one of ordinary skill in the art will be
able to readily convert between units of Kelvin and other scales or
units for measuring temperature (e.g., degrees Celsius) using
formulas that are well known and routinely used in the art (for
example, K=.degree. C.+273.15). Sequence information was also
recorded for each oligomer, including the number of base pairs,
N.sub.bp, and the G-C content. Specifically, an oligomer's G-C
content f.sub.GC is defined here as the fraction of bases that are
either guanine or cytosine. Thus, for example, the oligonucleotide
set forth in SEQ ID NO:1 comprises a total of 15 bases pairs (i.e.,
N.sub.bp=15), of which three are either guanine (zero) or cytosine
(three). Thus, that particular oligomer's G-C content may be
obtained or provided by: f.sub.GC=3/15=0.2. The nucleotide
sequence, total number of base pairs and G-C content for each
oligomer are also provided in Tables I and II, along with the
corresponding SEQ ID NO.
TABLE-US-00001 TABLE I Melting Temperatures of 92 DNA Duplex
Oligomers in Tris-HCl Buffers with Various [Mg.sup.2+], no KCl, and
[DNA] = 2 .mu.M 2 mM 10 mM Tris-HCl Tris-HCl SEQ Melting
temperatures (K) at Mg.sup.2+ concentration (mM) ID N.sub.bp
Sequence 0.5 1.5 3 10 20 50 125 NO: f.sub.GC (5' to 3') mM mM mM mM
mM mM mM 1 15 TACTAACATTAACTA 312.4 316.0 317.5 320.3 320.6 321.5
322.1 0.20 2 15 ATACTTACTGATTAG 313.0 316.7 318.1 319.9 321.0 321.8
322.4 0.27 3 15 GTACACTGTCTTATA 316.5 320.3 321.8 323.7 324.4 325.3
325.6 0.33 4 15 GTATGAGAGACTTTA 316.6 320.1 321.7 324.1 324.6 325.4
326.0 0.33 5 15 TTCTACCTATGTGAT 316.4 319.2 321.0 323.4 323.5 324.1
324.6 0.33 6 15 AGTAGTAATCACACC 319.7 322.6 324.1 326.2 326.6 327.2
327.6 0.40 7 15 ATCGTCTCGGTATAA 321.1 324.2 325.8 327.9 328.3 328.7
329.5 0.40 8 15 ACGACAGGTTTACCA 324.7 327.7 329.1 331.3 331.7 332.1
332.6 0.47 9 15 CTTTCATGTCCGCAT 325.9 328.3 329.6 331.5 332.1 332.7
332.8 0.47 10 15 TGGATGTGTGAACAC 323.0 326.6 327.9 329.8 330.4
331.0 331.4 0.47 11 15 ACCCCGCAATACATG 325.8 328.5 329.8 331.6
332.2 332.0 332.4 0.53 12 15 GCAGTGGATGTGAGA 325.5 328.3 329.6
331.2 331.8 332.4 332.2 0.53 13 15 GGTCCTTACTTGGTG 323.5 326.5
327.9 329.7 330.3 330.6 330.7 0.53 14 15 CGCCTCATGCTCATC 327.5
330.4 331.8 333.3 333.8 334.4 334.2 0.60 15 15 AAATAGCCGGGCCGC
333.6 336.6 337.7 339.3 339.5 340.2 340.3 0.67 16 15
CCAGCCAGTCTCTCC 329.7 332.6 333.7 335.2 335.6 336.1 336.1 0.67 17
15 GACGACAAGACCGCG 332.5 334.9 336.0 337.3 337.7 338.4 338.1 0.67 8
15 CAGCCTCGTCGCAGC 335.0 337.3 338.5 340.0 340.4 340.6 340.5 0.73
19 15 CTCGCGGTCGAAGCG 334.5 337.1 338.3 339.4 340.0 340.4 339.9
0.73 20 15 GCGTCGGTCCGGGCT 338.4 340.7 341.7 342.7 343.5 343.7
343.3 0.80 21 20 TATGTATATTTTGTAATCAG 321.7 324.5 325.7 327.5 328.2
328.9 329.4 0.20 22 20 TTCAAGTTAAACATTCTATC 323.1 325.7 327.1 328.8
329.6 330.4 331.0 0.25 23 20 TGATTCTACCTATGTGATTT 324.9 327.7 328.9
330.8 331.4 332.4 332.7 0.30 24 20 GAGATTGTTTCCCTTTCAAA 326.4 329.3
330.7 332.4 333.3 334.0 334.4 0.35 25 20 ATGCAATGCTACATATTCGC 330.5
333.1 334.1 335.7 336.3 337.0 336.9 0.40 26 20 CCACTATACCATCTATGTAC
326.1 328.6 329.8 331.2 331.9 332.3 332.6 0.40 27 20
CCATCATTGTGTCTACCTCA 331.2 333.6 334.7 336.0 336.6 337.2 337.2 0.45
28 20 CGGGACCAACTAAAGGAAAT 330.7 333.3 334.6 336.0 336.6 337.1
337.6 0.45 29 20 TAGTGGCGATTAGATTCTGC 333.2 335.6 336.7 338.0 338.8
339.4 339.6 0.45 30 20 AGCTGCAGTGGATGTGAGAA 334.2 336.8 338.0 339.5
340.0 340.8 340.4 0.50 31 20 TACTTCCAGTGCTCAGCGTA 335.3 337.8 339.0
340.4 340.8 341.4 341.5 0.50 32 20 CAGTGAGACAGCAATGGTCG 334.5 337.0
338.2 339.4 339.9 340.3 340.2 0.55 33 20 CGAGCTTATCCCTATCCCTC 333.2
335.6 336.7 338.1 338.6 339.1 339.0 0.55 34 20 CGTACTAGCGTTGGTCATGG
334.3 336.5 337.5 339.0 339.3 339.7 339.6 0.55 35 20
AAGGCGAGTCAGGCTCAGTG 339.3 341.6 342.9 343.8 344.4 344.7 344.6 0.60
36 20 ACCGACGACGCTGATCCGAT 339.4 341.8 342.7 344.2 344.1 344.8
344.4 0.60 37 20 AGCAGTCCGCCACACCCTGA 340.8 343.1 343.8 345.3 345.6
345.9 345.5 0.65 38 20 CAGCCTCGTTCGCACAGCCC 342.1 344.5 345.4 346.6
347.1 347.3 347.0 0.70 39 20 GTGGTGGGCCGTGCGCTCTG 342.9 345.2 346.3
347.5 347.8 348.1 347.6 0.75 40 20 GTCCACGCCCGGTGCGACGG 343.5 345.6
347.0 347.2 347.6 347.8 347.4 0.80 41 25 GATATAGCAAAATTCTAAGTTAATA
327.4 330.0 331.1 332.9 334.0 334.4 335.0 0.20 42 25
ATAACTTTACGTGTGTGACCTATTA 333.0 335.5 336.6 338.1 338.6 339.3 339.5
0.32 43 25 GTTCTATACTCTTGAAGTTGATTAC 330.4 332.8 334.0 335.6 336.1
336.9 337.1 0.32 44 25 CCCTGCACTTTAACTGAATTGTTTA 333.9 336.3 337.3
338.8 339.2 339.9 340.2 0.36 45 25 TAACCATACTGAATACCTTTTGACG 332.9
335.2 336.2 337.6 338.2 338.8 339.0 0.36 46 25
TCCACACGGTAGTAAAATTAGGCTT 335.6 337.9 338.8 340.1 341.2 341.3 341.3
0.40 47 25 TTCCAAAAGGAGTTATGAGTTGCGA 335.3 337.5 338.7 340.0 340.5
341.1 341.2 0.40 48 25 AATATCTCTCATGCGCCAAGCTACA 337.6 340.1 341.0
342.3 342.6 343.4 343.2 0.44 49 25 TAGTATATCGCAGCATCATACAGGC 336.1
338.2 339.3 341.1 341.0 341.5 341.5 0.44 50 25
TGGATTCTACTCAACCTTAGTCTGG 335.4 337.6 338.7 340.0 340.5 341.0 341.0
0.44 51 25 CGGAATCCATGTTACTTCGGCTATC 337.1 339.4 340.3 341.7 342.1
342.6 342.6 0.48 52 25 CTGGTCTGGATCTGAGAACTTCAGG 338.7 340.8 341.8
343.0 343.5 343.8 343.8 0.52 53 25 ACAGCGAATGGACCTACGTGGCCTT 343.1
345.1 346.1 347.1 347.3 347.5 347.4 0.56 54 25
AGCAAGTCGAGCAGGGCCTACGTTT 343.4 345.4 346.5 347.3 347.9 348.2 348.2
0.56 55 25 GCGAGCGACAGGTTACTTGGCTGAT 342.6 344.6 345.6 346.5 347.1
347.4 347.1 0.56 56 25 AAAGGTGTCGCGGAGAGTCGTGCTG 344.0 346.3 347.1
348.4 348.8 348.9 348.6 0.60 57 25 ATGGGTGGGAGCCTCGGTAGCAGCC 345.3
347.6 348.4 349.6 349.8 350.0 349.9 0.68 58 25
CAGTGGGCTCCTGGGCGTGCTGGTC 346.6 348.5 349.3 350.4 350.7 351.4 350.6
0.72 59 25 GCCAACTCCGTCGCCGTTCGTGCGC 346.9 348.8 349.6 350.3 350.6
350.8 350.7 0.72 60 25 ACGGGTCCCCGCACCGCACCGCCAG 350.4 352.1 352.9
353.4 353.7 353.9 353.5 0.80 61 30 TTATGTATTAAGTTATATAGTAGTAGTAGT
328.2 330.7 331.7 333.2 333.7 334.5 334.9 0.20 62 30
ATTGATATCCTTTTCTATTCATCTTTCATT 332.0 334.4 335.5 336.9 337.5 338.2
338.7 0.23 63 30 AAAGTACATCAACATAGAGAATTGCATTTC 334.6 336.9 337.9
339.1 339.7 340.3 340.7 0.30 64 30 CTTAAGATATGAGAACTTCAACTAATGTGT
334.1 336.3 337.2 338.6 339.2 340.3 340.3 0.30 65 30
CTCAACTTGCGGTAAATAAATCGCTTAATC 337.2 339.3 340.3 341.5 342.0 342.7
342.9 0.37 66 30 TATTGAGAACAAGTGTCCGATTAGCAGAAA 338.4 340.6 341.5
342.8 343.2 343.8 344.0 0.37 67 30 GTCATACGACTGAGTGCAACATTGTTCAAA
338.6 340.8 341.6 342.9 343.2 343.8 344.0 0.40 68 30
AACCTGCAACATGGAGTTTTTGTCTCATGC 341.0 343.1 344.0 344.8 345.5 345.9
346.0 0.43 69 30 CCGTGCGGTGTGTACGTTTTATTCATCATA 339.8 341.9 342.7
343.9 344.4 344.8 344.7 0.43 70 30 GTTCACGTCCGAAAGCTCGAAAAAGGATAC
341.3 343.4 344.3 345.3 345.9 346.3 346.6 0.47 71 30
AGTCTGGTCTGGATCTGAGAACTTCAGGCT 343.0 344.8 345.7 346.7 347.1 347.3
347.6 0.50 72 30 TCGGAGAAATCACTGAGCTGCCTGAGAAGA 342.1 344.1 345.1
346.0 346.5 346.9 346.8 0.50 73 30 CTTCAACGGATCAGGTAGGACTGTGGTGGG
341.4 343.2 344.2 345.2 345.6 346.1 346.1 0.57 74 30
ACGCCCACAGGATTAGGCTGGCCCACATTG 346.3 348.1 349.0 349.8 350.1 350.5
350.3 0.60 75 30 GTTATTCCGCAGTCCGATGGCAGCAGGCTC 346.0 347.9 348.7
349.8 350.1 350.5 350.2 0.60
76 30 TCAGTAGGCGTGACGCAGAGCTGGCGATGG 346.8 348.9 349.1 350.1 350.9
351.2 350.9 0.63 77 30 CGCGCCACGTGTGATCTACAGCCGTTCGGC 347.0 348.4
349.1 350.2 350.1 350.6 350.2 0.67 78 30
GACCTGACGTGGACCGCTCCTGGGCGTGGT 349.3 350.9 351.7 352.6 352.8 353.2
353.0 0.70 79 30 GCCCCTCCACTGGCCGACGGCAGCAGGCTC 350.7 352.2 353.0
353.6 354.0 354.1 353.8 0.77 80 30 CGCCGCTGCCGACTGGAGGAGCGCGGGACG
351.8 353.2 354.0 354.2 354.8 354.8 354.3 0.80 81 10 ATCAATCATA
295.1 298.7 300.6 303.0 304.0 306.2 306.3 0.20 82 10 TTGTAGTCAT
300.3 304.0 305.5 308.0 309.2 310.4 310.7 0.30 83 10 GAAATGAAAG
297.7 300.6 303.7 304.6 307.0 307.8 308.5 0.30 84 10 CCAACTTCTT
303.2 308.4 309.6 312.5 312.9 313.6 313.4 0.40 85 10 ATCGTCTGGA
308.3 312.1 313.7 317.0 316.5 316.9 317.5 0.50 86 10 AGCGTAAGTC
302.8 309.3 310.7 312.5 314.0 315.3 315.6 0.50 87 10 CGATCTGCGA
311.5 316.4 317.2 320.8 320.8 320.4 320.7 0.60 88 10 TGGCGAGCAC
318.4 322.8 323.7 325.9 326.4 327.3 327.6 0.70 89 10 GATGCGCTCG
317.2 320.9 322.0 323.8 324.4 324.7 325.0 0.70 90 10 GGGACCGCCT
321.5 325.1 326.9 328.6 329.0 328.6 329.2 0.80 91 11 CGTACACATGC
313.3 317.4 318.8 321.2 321.2 321.3 321.8 0.55 92 11 CCATTGCTACC
312.0 315.8 317.3 319.5 320.1 320.4 320.7 0.55
TABLE-US-00002 TABLE II Melting Temperatures of Selected DNA Duplex
Oligomers in Tris-HCl Buffers with Various [Mg.sup.2+], no KCl, and
[DNA] = 2 .mu.M 10 mM Tris-HCl SEQ Melting temperatures (K) at
Mg.sup.2+ ID N.sub.bp Sequence concentrations (mM) NO: f.sub.GC (5'
to 3') 300 nM 600 nM 5 15 TTCTACCTATGTGAT 323.9 322.6 0.33 12 15
GCAGTGGATGTGAGA 331.3 329.3 0.53 18 15 CAGCCTCGTCGCAGC 338.7 336.9
0.73 23 20 TGATTCTACCTATGTGATTT 331.9 330.8 0.30 30 20
AGCTGCAGTGGATGTGAGAA 339.4 337.9 0.50 38 20 CAGCCTCGTTCGCACAGCCC
345.5 343.5 0.70 43 25 GTTCTATACTCTTGAAGTTGATTAC 336.7 335.7 0.32
52 25 CTGGTCTGGATCTGAGAACTTCAGG 343.0 341.7 0.52 58 25
CAGTGGGCTCCTGGGCGTGCTGGTC 349.0 347.1 0.72 64 30
CTTAAGATATGAGAACTTCAACTAATGTGT 339.3 338.4 0.30 71 30
AGTCTGGTCTGGATCTGAGAACTTCAGGCT 346.6 345.3 0.50 78 30
GACCTGACGTGGACCGCTCCTGGGCGTGGT 351.2 349.6 0.70 82 10 TTGTAGTCAT
310.3 308.6 0.30 85 10 ATCGTCTGGA 316.2 314.7 0.50 89 10 GATGCGCTCG
323.1 320.8 0.70 90 10 GGGACCGCCT 328.1 325.4 0.80 91 11
CGTACACATGC 320.1 318.0 0.55 92 11 CCATTGCTACC 320.2 318.0 0.55
Example 2
Determination of Coefficient Values of Equations 13 and 16 Based on
the Data of Example
[0150] Coefficients. The experimentally determined melting
temperatures set forth in Tables I and II, supra, were fit to
Equations 13 and 16 to determine the value of their
coefficients.
[0151] In each analysis of this Example, a reference salt
concentration of [Na.sup.+].sub.0=1.0 M was used, and the reference
melting temperature, T.sub.m.sup.0, was the oligomer's
experimentally determined melting temperature at that cation
concentration. This reference set of melting temperatures in 1.0 M
Na.sup.+ buffer was published in Owczarzy et al., Biochemistry
2004, 43:35367-3554.
[0152] The coefficients in Equation 13 and 16 were derived from
experimentally measured T.sub.m(Mg.sup.2+) and T.sub.m.sup.0 values
using multiple linear regression fit.
[0153] Equation 13 describes the fit of 1/T.sub.m and
1/T.sub.m.degree. differences and is consistent with the previously
published T.sub.m correction for sodium salt (Owczarzy et al.,
Biochemistry 2004, 43:3537-3554). The coefficients optimized for
Equation 13 are summarized in Table IIIa.
TABLE-US-00003 TABLE IIIa Determined Coefficient Values for
Equation 13, for T.sub.m.degree. obtained at 1M cation
concentration. Coefficient Value (K.sup.-1) Standard error
(K.sup.-1) Relative error (%) a 3.92 .times. 10.sup.-5 0.2 .times.
10.sup.-5 5.1 b -9.11 .times. 10.sup.-6 0.5 .times. 10.sup.-6 5.5 c
6.26 .times. 10.sup.-5 0.4 .times. 10.sup.-5 6.4 d 1.42 .times.
10.sup.-5 0.08 .times. 10.sup.-5 5.6 e -4.82 .times. 10.sup.-4 0.7
.times. 10.sup.-4 14.5 f 5.25 .times. 10.sup.-4 0.2 .times.
10.sup.-4 3.8 g 8.31 .times. 10.sup.-5 0.2 .times. 10.sup.-5
2.4
[0154] Equation 16 describes the fit of T.sub.m and T.sub.m.degree.
differences. The method required a separate optimization for the
equation, which resulted in different coefficient values. The
coefficients optimized for Equation 16 are summarized in Table
Mb.
TABLE-US-00004 TABLE IIIb Determined Coefficient Values for
Equation 16, for T.sub.m.degree. obtained at 1M cation
concentration. Coefficient Value (K) Standard error (K) Relative
error (%) a' -4.59 0.3 6.5 b' 1.06 0.05 4.7 c' -7.26 0.4 5.5 d'
-1.34 0.08 6.0 e' 63.3 6 9.5 f' -60.4 2 3.3 g' -8.78 0.2 2.3
[0155] Estimated Errors. Two methods were used to estimate standard
errors of coefficients. The errors were obtained from residuals of
the multiple linear regression fit and from bootstrap simulations
(see Efron, B., Tibshirani, R. J., 1993, An Introduction to the
Bootstrap. Chapman & Hall/CRC, Boca Raton, Fla.). The
experimental dataset consisted of 680 T.sub.m values for 92 unique
duplex DNAs that are shown in Table I and II. Ten thousand
bootstrap sample datasets were generated from the experimental
dataset. Each bootstrap dataset was of the same size (680
T.sub.m's) and was constructed by random drawing of T.sub.m values,
with replacement, from the original experimental dataset. Entire
experimental dataset was used in each drawing. Coefficients of
Equations 13 (a, b, c, d, e, f, g) and 16 (a', b', c', d', e', f',
g') were obtained from each bootstrap dataset using a multivariate
linear regression fit. The fits were calculated for each dataset
using Excel LINEST function. Bootstrap simulations were run in
Microsoft Excel 2003 environment. The procedure generated ten
thousand bootstrap estimates of coefficients (a, b, c, d, e, f, g)
and (a', b', c', d', e', f', g'). Bootstrap estimates of standard
errors for each coefficient were calculated from these estimates of
coefficients. The errors are presented in the third column of Table
IIIa and Table IIIb. Extra significant figures of the coefficients
are reported to prevent rounding errors when coefficient are used.
Addition of higher order terms, e.g., (ln [Mg.sup.2+]).sup.3, (ln
[Mg.sup.2+]).sup.4, in Equations 13 and 16, and re-optimization of
the coefficients could give additional useful and functional
T.sub.m magnesium corrections.
Example 3
Melting Temperatures Predicted by Equation 13 Compared to
Experimentally Determined Melting Temperatures in Buffers where
Monovalent Ions do not Compete with Divalent (Mg.sup.+) Ions
[0156] Starting from published T.sub.m (1M Na.sup.+) values
(Owczarzy et al., Biochemistry 2004, 43:3537-3554), melting
temperatures for SEQ ID NOS: 1-92 were predicted from Equation 13
using the coefficients determined in Example 2.
[0157] Comparison of predicted T.sub.m with the experimental values
of Example 1 reveals that melting temperatures were predicted with
an average error of 0.5.degree. C. Errors of T.sub.m predictions as
a function of N.sub.bp, f.sub.GC, and magnesium concentration were
examined. They are presented in Tables IVa and IVb, and in FIGS. 3A
and 3B. No systematic error trends have been found. Predicted
melting temperatures provided by the Equation 13 have similar
accuracy for all sequences.
TABLE-US-00005 TABLE IVa Errors of T.sub.m predictions,
T.sub.m(prediction) - T.sub.m(experiment), for 92 DNA duplex
oligomers from Table 1. Melting temperatures were predicted from
Equation 13 and experimentally measured T.sub.m.sup.0 in 1M
Na.sup.+. 2 mM 10 mM Tris-HCl Tris-HCl SEQ Error of T.sub.m
prediction (K) at Mg.sup.2+ concentration indicated ID Sequence 0.5
1.5 3 10 20 50 125 NO: (5' to 3') mM mM mM mM mM mM mM 1
TACTAACATTAACTA 0.6 0.1 0.3 -0.2 0.5 0.3 -0.1 2 ATACTTACTGATTAG 0.6
0.0 0.2 0.5 0.3 0.2 -0.2 3 GTACACTGTCTTATA 0.5 -0.2 0.0 0.0 0.2
-0.1 -0.4 4 GTATGAGAGACTTTA 1.0 0.5 0.5 0.3 0.5 0.3 -0.1 5
TTCTACCTATGTGAT -0.5 -0.2 -0.4 -0.7 -0.1 -0.1 -0.5 6
AGTAGTAATCACACC -0.2 -0.1 -0.1 -0.2 0.1 0.1 -0.4 7 ATCGTCTCGGTATAA
-0.2 -0.3 -0.4 -0.4 -0.1 0.0 -0.8 8 ACGACAGGTTTACCA -1.0 -1.0 -0.9
-1.2 -1.0 -0.9 -1.5 9 CTTTCATGTCCGCAT -0.8 -0.2 0.0 0.0 0.1 0.0
-0.3 10 TGGATGTGTGAACAC -0.2 -0.8 -0.6 -0.6 -0.5 -0.7 -1.2 11
ACCCCGCAATACATG -0.3 0.0 0.2 0.1 0.2 0.7 0.1 12 GCAGTGGATGTGAGA 0.5
0.6 0.7 0.9 0.9 0.7 0.7 13 GGTCCTTACTTGGTG -0.4 -0.5 -0.5 -0.5 -0.5
-0.5 -0.7 14 CGCCTCATGCTCATC 1.1 1.0 1.0 1.2 1.3 0.9 0.8 15
AAATAGCCGGGCCGC -0.3 -0.6 -0.3 -0.3 0.0 -0.5 -1.0 16
CCAGCCAGTCTCTCC 0.0 -0.1 0.2 0.2 0.3 0.0 -0.5 17 GACGACAAGACCGCG
-1.0 -0.5 -0.3 0.0 0.1 -0.5 -0.6 18 CAGCCTCGTCGCAGC 0.1 0.5 0.7 0.7
0.6 0.5 0.1 19 CTCGCGGTCGAAGCG -0.6 -0.5 -0.4 0.0 -0.2 -0.6 -0.6 20
GCGTCGGTCCGGGCT -0.9 -0.6 -0.4 0.0 -0.4 -0.7 -1.0 21
TATGTATATTTTGTAATCAG -0.3 -0.4 -0.2 -0.1 0.1 0.1 0.0 22
TTCAAGTTAAACATTCTATC 0.1 0.1 0.1 0.3 0.2 0.2 -0.2 23
TGATTCTACCTATGTGATTT 1.2 1.0 1.1 1.1 1.2 0.8 0.8 24
GAGATTGTTTCCCTTTCAAA 0.9 0.4 0.4 0.4 0.2 0.0 -0.2 25
ATGCAATGCTACATATTCGC 0.3 0.2 0.5 0.6 0.7 0.5 0.6 26
CCACTATACCATCTATGTAC 0.5 0.5 0.5 0.7 0.7 0.7 0.5 27
CCATCATTGTGTCTACCTCA -0.5 -0.4 -0.3 -0.1 -0.1 -0.3 -0.3 28
CGGGACCAACTAAAGGAAAT 0.0 -0.2 -0.3 -0.1 -0.1 -0.2 -0.7 29
TAGTGGCGATTAGATTCTGC 0.1 0.1 0.2 0.5 0.4 0.2 0.0 30
AGCTGCAGTGGATGTGAGAA 1.0 0.8 0.8 0.9 0.9 0.4 0.7 31
TACTTCCAGTGCTCAGCGTA 0.5 0.4 0.4 0.5 0.6 0.4 0.2 32
CAGTGAGAcAGcAATGGTCG 0.4 0.2 0.2 0.4 0.4 0.2 0.2 33
CGAGCTTATCCCTATCCCTC -0.2 -0.5 -0.4 -0.4 -0.4 -0.6 -0.7 34
CGTACTAGCGTTGGTCATGG -0.6 -0.7 -0.5 -0.5 -0.4 -0.5 -0.6 35
AAGGCGAGTCAGGCTCAGTG -0.5 -0.6 -0.8 -0.3 -0.4 -0.6 -0.7 36
ACCGACGACGCTGATCCGAT 0.4 0.2 0.5 0.3 0.8 0.4 0.5 37
AGCAGTCCGCCACACCCTGA 0.4 0.2 0.6 0.4 0.4 0.3 0.3 38
CAGCCTCGTTCGCACAGCCC -1.0 -1.3 -1.3 -1.3 -1.4 -1.6 -1.7 39
GTGGTGGGCCGTGCGCTCTG 1.1 0.9 0.7 0.6 0.6 0.3 0.3 40
GTCCACGCCCGGTGCGACGG 0.9 0.7 0.2 1.0 0.8 0.5 0.3 41
GATATAGCAAAATTCTAAGTTAATA 0.1 -0.1 0.0 0.0 -0.4 0.0 -0.1 42
ATAACTTTACGTGTGTGACCTATTA 0.4 0.1 0.2 0.3 0.5 0.4 0.4 43
GTTCTATACTCTTGAAGTTGATTAC -0.9 -1.1 -1.1 -1.2 -1.1 -1.3 -1.2 44
CCCTGCACTTTAACTGAATTGTTTA 0.4 0.1 0.2 0.3 0.5 0.3 0.2 45
TAACCATACTGAATACCTTTTGACG 0.2 0.0 0.1 0.2 0.2 0.2 0.2 46
TCCACACGGTAGTAAAATTAGGCTT 0.0 -0.2 0.0 0.1 -0.4 0.1 0.1 47
TTCCAAAAGGAGTTATGAGTTGCGA 0.3 0.2 0.2 0.3 0.4 0.3 0.3 48
AATATCTCTCATGCGCCAAGCTACA 0.7 0.3 0.5 0.6 0.8 0.5 0.7 49
TAGTATATCGCAGCATCATACAGGC 0.9 0.8 0.8 0.4 1.0 0.9 1.0 50
TGGATTCTACTCAACCTTAGTCTGG 0.2 0.1 0.0 0.1 0.2 0.1 0.2 51
CGGAATCCATGTTACTTCGGCTATC -0.1 -0.4 -0.3 -0.4 -0.3 -0.4 -0.4 52
CTGGTCTGGATCTGAGAACTTCAGG -0.8 -1.0 -1.0 -0.9 -1.0 -1.0 -1.0 53
ACAGCGAATGGACCTACGTGGCCTT 0.2 0.1 0.1 0.2 0.4 0.5 0.5 54
AGCAAGTCGAGCAGGGCCTACGTTT 0.3 0.2 0.1 0.4 0.2 0.2 0.1 55
GCGAGCGACAGGTTACTTGGCTGAT -0.2 -0.4 -0.4 -0.2 -0.3 -0.3 -0.2 56
AAAGGTGTCGCGGAGAGTCGTGCTG 0.7 0.3 0.4 0.3 0.2 0.3 0.4 57
ATGGGTGGGAGCCTCGGTAGCAGCC 0.8 0.3 0.3 0.1 0.1 0.0 -0.2 58
CAGTGGGCTCCTGGGCGTGCTGGTC -0.2 -0.4 -0.5 -0.8 -0.8 -1.5 -1.0 59
GCCAACTCCGTCGCCGTTCGTGCGC 0.6 0.3 0.3 0.5 0.4 0.2 0.0 60
ACGGGTCCCCGCACCGCACCGCCAG 1.0 0.9 0.8 1.0 0.9 0.5 0.4 61
TTATGTATTAAGTTATATAGTAGTAGTAGT -0.1 -0.5 -0.4 -0.3 -0.1 -0.1 -0.1
62 ATTGATATCCTTTTCTATTCATCTTTCATT -0.2 -0.6 -0.6 -0.5 -0.3 -0.4
-0.4 63 AAAGTACATCAACATAGAGAATTGCATTTC 0.0 -0.3 -0.2 0.1 0.1 0.1
0.0 64 CTTAAGATATGAGAACTTCAACTAATGTGT -0.8 -1.0 -0.9 -0.8 -0.7 -1.2
-0.9 65 CTCAACTTGCGGTAAATAAATCGCTTAATC 0.0 -0.2 -0.2 0.0 0.1 -0.2
-0.1 66 TATTGAGAACAAGTGTCCGATTAGCAGAAA -0.4 -0.6 -0.6 -0.4 -0.3
-0.4 -0.3 67 GTCATACGACTGAGTGCAACATTGTTCAAA 0.1 -0.2 -0.1 -0.1 0.1
0.0 0.0 68 AACCTGCAACATGGAGTTTTTGTCTCATGC -0.5 -0.7 -0.7 -0.3 -0.4
-0.5 -0.4 69 CCGTGCGGTGTGTACGTTTTATTCATCATA -0.3 -0.5 -0.4 -0.4
-0.4 -0.3 -0.1 70 GTTCACGTCCGAAAGCTCGAAAAAGGATAC -0.5 -0.9 -0.9
-0.7 -0.8 -1.0 -1.1 71 AGTCTGGTCTGGATCTGAGAACTTCAGGCT -0.3 -0.4
-0.4 -0.4 -0.3 -0.2 -0.4 72 TCGGAGAAATCACTGAGCTGCCTGAGAAGA 0.9 0.6
0.5 0.7 0.7 0.6 0.6 73 CTTCAACGGATCAGGTAGGACTGTGGTGGG 1.1 0.9 0.7
0.7 0.6 0.4 0.3 74 ACGCCCACAGGATTAGGCTGGCCCACATTG 0.0 -0.2 -0.3
-0.2 -0.1 -0.4 -0.3 75 GTTATTCCGCAGTCCGATGGCAGCAGGCTC 0.5 0.1 0.2
0.0 0.0 -0.2 0.0 76 TCAGTAGGCGTGACGCAGAGCTGGCGATGG 0.3 -0.3 0.2 0.1
-0.4 -0.6 -0.5 77 CGCGCCACGTGTGATCTACAGCCGTTCGGC 0.2 0.2 0.2 0.0
0.3 -0.1 0.1 78 GACCTGACGTGGACCGCTCCTGGGCGTGGT -0.1 -0.4 -0.5 -0.6
-0.7 -1.0 -1.1 79 GCCCCTCCACTGGCCGACGGCAGCAGGCTC 0.1 -0.2 -0.4 -0.3
-0.6 -0.8 -0.9 80 CGCCGCTGCCGACTGGAGGAGCGCGGGACG 0.0 -0.1 -0.4 0.0
-0.5 -0.7 -0.7 81 ATCAATCATA 0.9 1.4 1.7 2.1 2.2 0.7 0.7 82
TTGTAGTCAT -1.6 -1.3 -0.6 -0.5 -0.6 -1.2 -1.5 83 GAAATGAAAG -0.5
0.7 -0.4 1.4 -0.1 -0.2 -1.0 84 CCAACTTCTT 0.1 -1.0 -0.2 -0.4 0.1
-0.1 -0.1 85 ATCGTCTGGA -0.4 -0.2 0.2 -0.6 0.7 0.8 -0.2 86
AGCGTAAGTC 0.7 -1.9 -1.3 -0.7 -1.3 -2.2 -2.9 87 CGATCTGCGA 0.7 -0.2
1.1 -0.2 0.6 1.2 0.5 88 TGGCGAGCAC 0.2 -0.3 0.7 0.8 1.0 0.3 -0.6 89
GATGCGCTCG -0.4 -0.1 0.7 1.1 1.2 1.1 0.1 90 GGGACCGCCT -0.9 -0.6
-0.6 -0.1 0.0 0.6 -0.9 91 CGTACACATGC -0.4 -0.7 -0.4 -0.5 0.3 0.5
-0.3 92 CCATTGCTACC 0.0 -0.2 0.1 0.2 0.3 0.4 -0.3
TABLE-US-00006 TABLE IVb Errors of T.sub.m predictions,
T.sub.m(prediction) - T.sub.m(experiment), for DNA duplex oligomers
from Table II. Melting temperatures were predicted from Equation 13
and experimentally measured T.sub.m.sup.0 in 1M Na.sup.+. 10 mM
Tris-HCl SEQ Error of T.sub.m prediction (K) at Mg.sup.2+ ID
Sequence concentration indicated NO: (5' to 3') 300 mM 600 mM 5
TTCTACCTATGTGAT -0.2 0.4 12 GCAGTGGATGTGAGA 0.8 1.9 18
CAGCCTCGTCGCAGC 0.8 1.5 23 TGATTCTACCTATGTGATTT 1.3 2.1 30
AGCTGCAGTGGATGTGAGAA 1.3 2.2 38 CAGCCTCGTTCGCACAGCCC -0.9 0.2 43
GTTCTATACTCTTGAAGTTGATTAC -0.9 -0.2 52 CTGGTCTGGATCTGAGAACTTCAGG
-0.6 0.2 58 CAGTGGGCTCCTGGGCGTGCTGGTC -0.2 1.0 64
CTTAAGATATGAGAACTTCAACTAATGTGT 0.1 0.9 71
AGTCTGGTCTGGATCTGAGAACTTCAGGCT 0.3 1.2 78
GACCTGACGTGGACCGCTCCTGGGCGTGGT 0.1 1.1 82 TTGTAGTCAT -1.9 -1.3 85
ATCGTCTGGA 0.1 0.3 89 GATGCGCTCG 0.7 1.4 90 GGGACCGCCT -1.3 -0.3 91
CGTACACATGC 0.3 1.1 92 CCATTGCTACC -0.7 0.2
Example 4
Comparison of T.sub.m Determined by Equations 13 and 16 Against
Previously Published Equations
[0158] The accuracy of T.sub.m predictions for Equations 13, 16,
and the four following magnesium corrections reported in the
published literature were studied by comparison of T.sub.m
predictions for the data of Tables I and II. The four published
equations include:
T.sub.m(Mg.sup.2+)=T.sub.m(1M Na.sup.+)+16.6.times.log(4.times.
{square root over ([Mg.sup.2+])}+[Mon.sup.+]) (Equation 6) [0159]
(Mitsuhashi, J. Clin. Lab. Analysis, 1996, 10:277-284)
[0159] 1 T m ( Mg 2 + ) = 1 T m ( 1 M Na + ) + 0.368 N .DELTA. H 0
.times. ln ( 3.79 .times. [ Mg 2 + ] + [ Mon + ] ) ( Equation 7 )
##EQU00020## [0160] (von Ahsen et al., Clin. Chem. 2001,
47:1956-1961)
[0160] 1 T m ( Mg 2 + ) = 1 T m ( 1 M Na + ) + 0.368 N .DELTA. H 0
.times. ln ( 3.3 .times. [ Mg 2 + ] + [ Mon + ] ) ( Equation 8 )
##EQU00021## [0161] (Peyret, Ph.D. Thesis, Wayne State University,
Detroit, Mich., pp. 128, section 5.4.2 (2000))
[0161] 1 T m ( Mg 2 + ) = 1 T m ( 1 M Na + ) - 0.00322 .times.
.DELTA. g el .times. ( N bp - 1 ) .DELTA. H .degree. ( Equation 9 )
##EQU00022## [0162] (Tan and Chen, Biophys. J. 2006,
90:1175-1190).
[0163] Because the solution was buffered at a pH of 8.3, the
monovalent concentration was assumed to be equal to half of the
total Tris concentration in these calculations (1 mM monovalent ion
for the 0.5-20 mM magnesium solutions and 5 mM for the 50-600 mM
magnesium solutions). This is because the functional group
primarily involved in the buffering action of Tris is an --NH.sub.2
group that ionizes to --NH.sub.3.sup.+ at a pK.sub.a of 8.3, and
the pK.sub.a is the pH at which 50% of the buffer concentration is
ionized and 50% is not.
[0164] Statistical comparisons of experimental results with
predictions from Equations and 6-9 and Equations 13 and 16 are
summarized in the Table V. As before, each analysis used a
reference salt concentration [Na.sup.+].sub.0=1.0 M. The reference
melting temperature, T.sub.m.sup.0 was the oligomer's
experimentally determined melting temperature, previously published
in Owczarzy et al., Biochemistry 2004, 43:35367-3554. Goodness of
fit was evaluated from the reduced "chi-square" value
(.chi..sub.r.sup.2=.chi..sup.2/.nu.) and from
<|.DELTA.T.sub.m|>.sub.AVE, the average difference between
the measured T.sub.m values and corresponding T.sub.m values
predicted using Equations 6-9 and Equations 13 and 16 for scaling
of T.sub.m from 1 M Na.sup.+ buffer to Mg.sup.2+ buffers. The R
ratios were larger than 6.0 in all experiments reported in Table I
and Table II, that is, magnesium ions were dominant. The
chi-squared goodness-of-fit test compares a theoretical
distribution with the observed data from a sample. (See William H.
Press et al., Numerical Recipes in C: The Art of Scientific
Computing 659-61 (2d Ed. 1992)). Thus, smaller values for
.chi..sub.r.sup.2 and/or <|.DELTA.T.sub.m|>.sub.AVE indicate
that the equation or model used accurately and reliably predicts
actual melting temperatures for different salt concentrations. .nu.
is the number of degrees of freedom in the fit. Statistical F-tests
were applied to compare .chi..sup.2.sub.r differences between each
T.sub.m magnesium correction. The tests provided probability P
(compared to Equation 13) that observed differences in values of
.chi..sup.2.sub.r can happen by random chance alone.
[0165] Equation 13 predicts T.sub.m values from Table I and Table
II with the highest accuracy and with the average error of
0.5.degree. C. The P values show that Equation 13 provides
significantly more accurate T.sub.m predictions than the Equations
6, 7, 8 and 9. Without being limited to any particular theory or
mechanism of action, it is believed that Equations 6-9 are less
accurate because the assumption of equivalent effects for Na.sup.+
and Mg.sup.2+ ions does not hold. It was discovered that the
effects of magnesium ions on T.sub.m differ significantly both
quantitatively and qualitatively from effects of sodium ions as
discussed above. The changes of T.sub.m caused by magnesium ions
depend both on the number of base pairs Nbp as well as the fraction
of G-C base pairs f.sub.GC. In contrast, T.sub.m changes brought
about by sodium ions are independent of the number of base pairs
and depend mainly on the fraction of G-C base pairs (Owczarzy et
al., Biochemistry 2004, 43:3537-3554). Therefore, the T.sub.m
magnesium correction function contains extra terms and is different
from the T.sub.m sodium correction function. Equations 6-9 in the
prior art take no account of the effect of the G-C base pair
content on the influence of monovalent and divalent cations on
duplex stability and hence Tm.
TABLE-US-00007 TABLE V Statistical analysis of T.sub.m predictions
for data of Table I and Table II at "dominant" divalent ion
concentrations, in Tris-HCl, no KCl, and [DNA] = 2 .mu.M.
<|.DELTA.T.sub.m|>.sub.AVE Equation Magnesium T.sub.m
correction (.degree. C.) .chi..sup.2/.nu. P 13 This invention 0.5
4.6 (1/T.sub.m correction function) 16 This invention 0.5 5.0 0.266
(T.sub.m correction function) 8 Peyret correction 2.9 163.1
<10.sup.-300 7 Ahsen et al. correction 3.0 185.3 <10.sup.-300
9 Tan and Chen correction 3.2 171.5 <10.sup.-300 6 Mitsuhashi
correction 4.7 350.7 <10.sup.-300
The data presented in Table IV and Table V, supra, shows that the
Equations 13 and 16, predict the melting temperature of a
particular polynucleotide with greater accuracy and reliability
than existing methods (P<0.05). Equation 16 provided slightly
less accurate T.sub.m predictions, however, the difference between
equation 13 and equation 16 is not statistically significant
(P=0.27).
Example 5
Selection of the Most Accurate T.sub.m Correction Function and
Calculation of Coefficients in Buffers where Divalent Ions
(Mg.sup.+) Compete with Monovalent Ions (K.sup.+)
[0166] DNA oligomers were prepared using a published procedure
(Moreira et al., Biochem. Biophys. Res. Commun. 2005, 327:473-484
and Owczarzy et al., Biochemistry 2004, 43:3537-3554), as outlined
in Example 1. In this Example 5, both monovalent ions (K.sup.+,
Tris.sup.+) and divalent ions (Mg.sup.+) were present in
significant concentrations and competed for their effects on
melting temperatures. Therefore, the algorithm outlined in FIG. 5
was used to select the most accurate T.sub.m salt correction based
on concentrations of magnesium and monovalent ions. When ratios R
were in the range from 0.22 to 6.0, coefficients a, d, g, in
Equation 13 were allowed to vary with monovalent ion concentrations
according to Equations 18, 19 and 20. In the first set of
experiments, the concentration of potassium ions was 50 mM KCl,
which is a typical concentration of KCl in PCR buffers. In the
second set of experiments, 12 oligonucleotides were melted in 38
different magnesium buffers where magnesium concentrations were 0.5
mM, 1.5 mM, 3.0 mM, 10 mM, 20 mM, 50 mM or 125 mM and KCl
concentrations were 0 mM, 50 mM, 100 mM, 200 mM, 600 mM or 1M. As
stated in Example 1, buffers contained 10 mM Tris-HCl adjusted to
pH 8.3 (at 25.degree. C.) with 0.6 M HCl. Accuracy of T.sub.m
predictions was estimated for both sets of experiments. DNA
concentrations were 2 .mu.M. Experimental results are shown in
Tables VI and VII.
TABLE-US-00008 TABLE VI Experimental melting temperatures of 80 DNA
duplex oligomers in buffers containing 50 mM KCl and various
magnesium concentrations. SEQ T.sub.m (.degree. C.) at 50 mM KCl,
10 mM Tris-HCl and ID DNA Sequence [Mg.sup.2+] indicated NO: (5' to
3') 0.5 mM 1.5 mM 3.0 mM 10 mM 20 mM 1 TACTAACATTAACTA 38.1 40.8
42.6 46.3 47.4 2 ATACTTACTGATTAG 38.7 41.3 43.2 45.9 47.5 3
GTACACTGTCTTATA 42.8 45.3 47.1 49.9 51.0 4 GTATGAGAGACTTTA 42.1
45.1 47.1 50.2 51.4 6 AGTAGTAATCACACC 45.6 48.1 49.7 52.6 53.6 7
ATCGTCTCGGTATAA 47.3 49.8 51.4 54.2 55.1 8 ACGACAGGTTTACCA 50.3
53.1 54.6 57.8 58.5 9 CTTTCATGTCCGCAT 52.4 54.6 56.3 58.5 59.5 10
TGGATGTGTGAACAC 49.2 51.9 53.7 56.5 57.6 11 ACCCCGCAATACATG 52.8
55.0 56.2 58.5 59.2 13 GGTCCTTACTTGGTG 50.1 52.2 53.9 56.3 56.9 14
CGCCTCATGCTCATC 54.8 57.0 58.4 60.5 61.2 15 AAATAGCCGGGCCGC 61.0
63.5 64.5 66.3 67.0 16 CCAGCCAGTCTCTCC 56.5 58.9 60.3 62.3 63.1 17
GACGACAAGACCGCG 59.6 61.4 62.7 64.4 65.1 19 CTCGCGGTCGAAGCG 62.0
64.3 65.2 66.8 67.4 20 GCGTCGGTCCGGGCT 66.0 68.2 68.9 70.3 70.5 21
TATGTATATTTTGTAATCAG 46.7 49.5 51.4 54.0 55.2 22
TTCAAGTTAAACATTCTATC 48.1 50.8 52.8 55.4 56.5 24
GAGATTGTTTCCCTTTCAAA 51.3 54.2 56.3 59.3 60.3 25
ATGCAATGCTACATATTCGC 56.9 59.3 60.7 62.8 63.6 26
CCACTATACCATCTATGTAC 52.9 55.0 56.4 58.3 59.1 27
CCATCATTGTGTCTACCTCA 57.5 60.1 61.2 63.0 64.0 28
CGGGACCAACTAAAGGAAAT 56.3 59.5 60.8 63.2 64.1 29
TAGTGGCGATTAGATTCTGC 59.4 61.8 63.1 65.1 66.1 31
TACTTCCAGTGCTCAGCGTA 62.2 64.6 65.6 67.4 68.2 32
CAGTGAGACAGCAATGGTCG 61.5 63.9 64.9 66.8 67.4 33
CGAGCTTATCCCTATCCCTC 58.9 61.9 63.4 65.2 65.9 34
CGTACTAGCGTTGGTCATGG 61.2 63.4 64.6 66.1 66.9 35
AAGGCGAGTCAGGCTCAGTG 66.1 68.3 69.5 71.0 71.5 36
ACCGACGACGCTGATCCGAT 67.3 69.3 70.1 71.9 72.3 37
AGCAGTCCGCCACACCCTGA 68.3 70.3 71.2 72.7 73.1 39
GTGGTGGGCCGTGCGCTCTG 70.9 72.6 73.8 75.2 75.7 40
GTCCACGCCCGGTGCGACGG 71.7 73.3 74.5 75.1 75.3 41
GATATAGCAAAATTCTAAGTTAATA 51.9 54.7 56.8 59.5 60.6 42
ATAACTTTACGTGTGTGACCTATTA 58.9 61.4 62.8 65.1 66.1 44
CCCTGCACTTTAACTGAATTGTTTA 59.4 61.9 63.5 65.7 66.6 45
TAACCATACTGAATACCTTTTGACG 58.6 61.0 62.7 65.3 65.6 46
TCCACACGGTAGTAAAATTAGGCTT 61.3 64.0 65.4 67.3 68.2 47
TTCCAAAAGGAGTTATGAGTTGCGA 61.2 63.7 65.2 67.2 68.0 48
AATATCTCTCATGCGCCAAGCTACA 64.0 66.4 67.7 70.2 70.2 49
TAGTATATCGCAGCATCATACAGGC 62.7 64.9 66.4 67.7 68.4 50
TGGATTCTACTCAACCTTAGTCTGG 61.2 63.8 65.3 67.2 68.0 51
CGGAATCCATGTTACTTCGGCTATC 63.2 65.5 67.1 69.0 69.6 53
ACAGCGAATGGACCTACGTGGCCTT 70.2 72.0 73.2 75.3 75.2 54
AGCAAGTCGAGCAGGGCCTACGTTT 70.5 72.5 73.4 74.6 75.3 55
GCGAGCGACAGGTTACTTGGCTGAT 69.2 71.2 72.5 74.0 74.6 56
AAAGGTGTCGCGGAGAGTCGTGCTG 71.1 73.2 74.3 75.6 76.2 57
ATGGGTGGGAGCCTCGGTAGCAGCC 72.8 74.7 75.8 76.9 77.6 59
GCCAACTCCGTCGCCGTTCGTGCGC 74.3 76.2 76.8 77.5 78.0 60
ACGGGTCCCCGCACCGCACCGCCAG 78.4 80.1 80.8 81.5 81.5 61
TTATGTATTAAGTTATATAGTAGTAGTAGT 53.1 55.8 57.7 60.4 61.1 62
ATTGATATCCTTTTCTATTCATCTTTCATT 56.4 59.5 61.3 63.6 64.7 63
AAAGTACATCAACATAGAGAATTGCATTTC 59.9 62.6 64.2 66.1 66.9 65
CTCAACTTGCGGTAAATAAATCGCTTAATC 62.7 65.2 66.6 68.7 69.3 66
TATTGAGAACAAGTGTCCGATTAGCAGAAA 63.7 66.4 67.9 70.0 70.6 67
GTCATACGACTGAGTGCAACATTGTTCAAA 64.8 67.1 68.4 70.2 71.0 68
AACCTGCAACATGGAGTTTTTGTCTCATGC 66.8 69.0 70.1 71.8 72.5 69
CCGTGCGGTGTGTACGTTTTATTCATCATA 66.1 68.3 69.6 71.3 72.0 70
GTTCACGTCCGAAAGCTCGAAAAAGGATAC 66.7 69.0 70.5 72.0 73.2 72
TCGGAGAAATCACTGAGCTGCCTGAGAAGA 68.4 70.8 72.0 73.6 74.4 73
CTTCAACGGATCAGGTAGGACTGTGGTGGG 69.3 71.6 72.4 73.6 74.4 74
ACGCCCACAGGATTAGGCTGGCCCACATTG 73.2 75.3 76.5 77.2 77.8 75
GTTATTCCGCAGTCCGATGGCAGCAGGCTC 72.7 74.7 76.0 77.1 77.7 76
TCAGTAGGCGTGACGCAGAGCTGGCGATGG 74.6 76.3 77.2 78.3 78.4 77
CGCGCCACGTGTGATCTACAGCCGTTCGGC 74.1 75.6 76.6 77.8 77.9 79
GCCCCTCCACTGGCCGACGGCAGCAGGCTC 77.9 79.9 80.5 81.0 81.5 80
CGCCGCTGCCGACTGGAGGAGCGCGGGACG 79.4 81.0 81.5 81.9 82.3 81
ATCAATCATA 22.4 24.3 25.9 29.5 30.4 82 TTGTAGTCAT 25.6 28.1 30.2
33.3 34.6 83 GAAATGAAAG 23.6 25.7 27.4 30.8 32.3 84 CCAACTTCTT 30.0
32.2 34.5 37.4 38.9 85 ATCGTCTGGA 35.5 37.8 39.2 41.8 43.2 86
AGCGTAAGTC 28.3 30.9 33.2 38.0 39.3 87 CGATCTGCGA 40.4 41.9 42.8
45.4 46.9 88 TGGCGAGCAC 45.6 47.8 49.2 52.4 52.8 89 GATGCGCTCG 44.8
46.7 47.9 50.4 50.9 90 GGGACCGCCT 49.1 50.9 52.6 55.1 56.0 91
CGTACACATGC 41.5 43.4 44.2 46.6 47.6 92 CCATTGCTACC 38.9 41.2 43.0
45.6 46.3
[0167] For Table VII, the [Mon.sup.+] is the sum of the
[Tris.sup.+] and [K.sup.+]. Solution contained either 0 mM, 50 mM,
100 mM, 200 mM, 600 mM or 1M of KCl.
TABLE-US-00009 TABLE VII Experimental melting temperatures
(.degree. C.) for 12 DNA duplex oligonucleotides in buffers of
various magnesium, potassium and Tris ion concentrations and at
constant DNA concentration. (C.sub.T = 2 .+-. 0.2 .mu.M).
[Mon.sup.+] [Mg.sup.2+](mM) DNA sequence (5' to 3') (mM) 0 0.5 1.5
3.0 10 20 50 125 TTCTACCTATGTGAT 1 -- 43.3 46.1 47.8 50.2 50.4 --
-- (SEQ ID NO: 5) 5 -- 42.1 45.6 47.6 49.5 50.4 51.0 51.5 55 39.3
42.5 44.7 46.2 49.1 49.6 51.0 51.5 105 43.8 44.8 45.8 47.1 49.1
50.1 51.1 51.6 205 47.7 -- 48.1 -- 49.9 -- 51.1 51.4 605 52.1 --
51.9 -- 51.9 -- 51.8 51.7 1005 53.2 -- 53.0 -- 53.0 -- 52.0 51.4
GCAGTGGATGTGAGA 1 -- 52.3 55.1 56.5 58.1 58.7 -- -- (SEQ ID NO: 12)
5 -- 51.9 54.7 56.2 58.2 58.8 59.2 59.0 55 49.5 52.5 54.6 56.0 58.0
58.8 59.3 59.1 105 53.8 54.6 55.8 56.6 58.2 58.9 59.4 59.4 205 57.3
-- 57.9 -- 59.1 -- 59.4 59.5 605 61.6 -- 61.3 -- 61.1 -- 60.2 59.5
1005 62.4 -- 62.3 -- 61.7 -- 60.3 59.6 CAGCCTCGTCGCAGC 1 -- 61.9
64.1 65.3 66.8 67.3 -- -- (SEQ ID NO: 18) 5 -- 61.1 64.2 65.1 67.2
67.5 67.5 67.3 55 58.9 62.0 64.0 65.2 66.6 67.4 68.1 67.4 105 63.1
63.8 65.0 65.7 67.5 67.5 67.8 67.2 205 66.5 -- 67.0 -- 68.1 -- 67.6
67.3 605 69.9 -- 69.8 -- 69.4 -- 67.9 67.3 1005 70.6 -- 70.3 --
70.1 -- 68.1 66.9 TGATTCTACCTATGTGATTT 1 -- 51.8 54.6 55.8 57.7
58.2 -- -- (SEQ ID NO: 23) 5 -- 51.0 54.5 55.8 58.1 58.5 59.3 59.5
55 47.6 51.1 53.8 55.4 57.9 58.9 59.4 59.5 105 51.9 53.0 54.7 55.4
57.9 58.4 59.5 59.7 205 56.1 -- 57.0 -- 58.7 -- 59.4 59.9 605 61.6
-- 61.7 -- 61.6 -- 60.7 60.3 1005 63.2 -- 63.2 -- 63.0 -- 61.4 60.7
AGCTGCAGTGGATGTGAGAA 1 -- 61.1 63.7 64.8 66.3 66.8 -- -- (SEQ ID
NO: 30) 5 -- 60.7 63.9 65.1 66.9 67.3 67.7 67.3 55 57.8 61.1 63.2
64.6 65.8 67.1 67.8 67.5 105 62.4 63.3 64.8 65.2 67.0 67.4 67.7
67.7 205 66.4 -- 67.1 -- 68.1 -- 67.5 67.8 605 71.2 -- 71.1 -- 70.7
-- 68.7 68.2 1005 72.3 -- 72.2 -- 71.7 -- 69.7 68.5
CAGCCTCGTTCGCACAGCCC 1 -- 68.9 71.3 72.3 73.4 73.9 -- -- (SEQ ID
NO: 38) 5 -- 68.7 71.3 72.3 73.8 74.0 74.2 73.9 55 65.0 68.7 70.8
71.9 73.2 74.0 74.2 73.8 105 69.4 70.8 72.0 72.6 74.0 74.2 74.4
73.8 205 73.5 -- 74.0 -- 74.8 -- 74.4 73.9 605 77.6 -- 77.6 -- 77.0
-- 75.2 74.2 1005 78.4 -- 78.2 -- 77.5 -- 75.5 74.3
GTTCTATACTCTTGAAGTTGATTAC 1 -- 57.2 59.7 60.8 62.4 63.0 -- -- (SEQ
ID NO: 43) 5 -- 56.3 59.4 60.7 62.6 63.1 63.8 64.0 55 50.7 54.6
57.5 59.1 61.5 63.0 63.8 64.2 105 55.9 57.3 58.9 60.0 62.2 63.2
63.9 64.3 205 60.3 -- 61.3 -- 63.1 -- 63.9 64.4 605 66.1 -- 66.2 --
66.0 -- 65.2 64.9 1005 68.0 -- 67.9 -- 67.5 -- 66.1 65.5
CTGGTCTGGATCTGAGAACTTCAGG 1 -- 65.6 67.7 68.7 69.8 70.3 -- -- (SEQ
ID NO: 52) 5 -- 65.1 67.6 68.5 70.1 70.3 70.7 70.6 55 60.3 64.5
66.9 68.1 69.7 70.4 70.7 70.8 105 64.9 66.2 68.0 68.8 70.3 70.7
71.0 70.9 205 69.1 -- 70.0 -- 71.2 -- 71.1 71.0 605 74.2 -- 74.1 --
74.0 -- 72.5 71.6 1005 75.8 -- 75.6 -- 75.2 -- 73.2 72.3
CAGTGGGCTCCTGGGCGTGCTGGTC 1 -- 73.5 75.3 76.2 77.3 77.6 -- -- (SEQ
ID NO: 58) 5 -- 73.3 75.9 76.6 78.0 78.0 78.2 77.4 55 70.6 73.9
75.6 76.5 77.3 78.1 78.3 78.0 105 74.3 75.6 77.2 77.4 78.7 78.4
78.3 77.8 205 78.2 -- 79.3 -- 79.5 -- 78.2 77.8 605 82.6 -- 82.6 --
81.9 -- 79.4 78.3 1005 83.4 -- 83.3 -- 82.6 -- 79.8 78.4
CTTAAGATATGAGAACTTCAACTAATGTGT 1 -- 61.0 63.1 64.1 65.5 66.0 -- --
(SEQ ID NO: 64) 5 -- 60.5 63.2 64.4 65.9 66.4 67.1 67.1 55 55.2
59.2 61.8 63.4 65.2 66.1 67.3 67.2 105 60.2 61.5 63.0 64.0 66.0
66.6 67.2 67.2 205 64.6 -- 65.3 -- 66.8 -- 67.0 67.3 605 70.4 --
70.4 -- 70.1 -- 68.5 68.1 1005 72.4 -- 72.0 -- 71.4 -- 69.6 68.5
AGTCTGGTCTGGATCTGAGAACTTCAGGCT 1 -- 69.8 71.6 72.5 73.6 73.9 -- --
(SEQ ID NO: 71) 5 -- 68.8 71.6 72.3 73.8 73.9 74.2 74.4 55 64.6
68.5 71.0 72.1 73.8 74.1 74.4 74.7 105 68.9 70.3 72.1 73.0 74.2
74.3 74.9 74.7 205 73.2 -- 74.3 -- 75.1 -- 74.7 74.9 605 78.4 --
78.2 -- 78.1 -- 76.4 75.6 1005 80.1 -- 79.9 -- 79.4 -- 77.2 76.2
GACCTGACGTGGACCGCTCCTGGGCGTGGT 1 -- 76.1 77.8 78.6 79.4 79.7 -- --
(SEQ ID NO: 78) 5 -- 75.9 78.1 79.0 79.8 79.9 80.0 79.8 55 73.2
76.5 78.0 79.0 79.5 80.0 80.3 79.6 105 77.4 78.6 79.7 79.9 80.7
80.6 80.4 79.7 205 81.2 -- 81.8 -- 81.8 -- 80.5 79.9 605 85.6 --
85.5 -- 84.4 -- 81.9 80.6 1005 86.7 -- 86.3 -- 85.2 -- 82.5
81.0
[0168] Starting from published experimentally measured reference
T.sub.m.sup.0 values in 1.0 M Na.sup.+ buffer (see Owczarzy et al.,
Biochemistry 2004, 43:3537-3554), melting temperatures for the
sequences in Tables VI and VII were predicted using the invented
algorithms and published algorithms, which were shown earlier in
Example 4. Statistical comparisons of the predicted T.sub.m values
with the experimentally measured values are reported in Table VIII.
Using the method of the invention, it is shown that melting
temperatures were predicted with an average error of 0.9.degree. C.
or less.
[0169] The first row of Table VIII shows the combined results of
using the Equation 13 with the data in Tables VI and VII when the
coefficients a, d, and g were allowed to vary with [Mon.sup.+]
(Equations 18-20) when ratio R was from 0.22 to 6.0. The second row
of Table VIII shows the combined results of using Equation 13 with
the data in Tables VI and VII when the coefficients a, d, and g
were set to constant values from Table IIIa. The remaining rows of
Table VIII show the results of using Equations 8, 7, and 6,
respectively, with the data of Tables VI and VII.
TABLE-US-00010 TABLE VIII Statistical analysis of T.sub.m
predictions for data in Tables VI and VII where magnesium and
potassium ions compete in their effects on melting temperatures.
Data in buffers containing 50 mM KCl and various [Mg.sup.2+] from
Data from Table VII where both Table VI and VII (n = 484) [K.sup.+]
and [Mg.sup.2+] vary (n = 456) <|.DELTA.T.sub.m|>.sub.AVE
<|.DELTA.T.sub.m|>.sub.AVE Equations T.sub.m correction
function (.degree. C.) .chi..sup.2/.nu. (.degree. C.)
.chi..sup.2/.nu. 13,, This invention (1/T.sub.m 0.6 6.8 0.8 10.0
18-20 correction function, allowing coefficients a, d, and g to
vary with [Mon.sup.+]) 13 This invention (1/T.sub.m 0.8 10.7 0.9
15.3 correction function when coefficients a-g are constant) 8
Peyret correction 1.2 32.0 2.6 137.5 7 Ahsen et al. correction 1.5
48.5 2.9 163.1 6 Mitsuhashi correction 2.1 77.5 3.8 250.0
[0170] Goodness of fit was evaluated from reduced .chi..sup.2.sub.r
and from average errors of T.sub.m magnesium predictions
<|.DELTA.T.sub.m|>.sub.AVE, where
.DELTA.T.sub.m=T.sub.m(predicted)-T.sub.m(measured) for scaling of
T.sub.m from 1M Na.sup.+ buffer to magnesium buffers. .nu. is the
number of degrees of freedom in the fit. The current invention
predicts T.sub.m values with the highest accuracy. The most
accurate T.sub.m predictions were obtained when coefficients a, d,
g were allowed to vary with monovalent ion concentrations.
Equations 6, 7, and 8 from the prior art are less accurate because
the assumption of additive effects for Mon.sup.+ and Mg.sup.2+ ions
is invalid. Since the magnesium and monovalent ions compete in
their effects on melting temperatures of oligonucleotides, the
effects of Mg.sup.2+ were not properly modeled.
Example 6
Application of Equations 13 to Calculate Melting Temperature for a
DNA Duplex in a Magnesium Solution
[0171] Below we illustrate the utility of Equation 13 in estimating
melting temperature of a 25 base-pair duplex,
d(CAGTGGGCTCCTGGGCGTGCTGGTC) with 18 G-C base pairs
(f.sub.GC=18/25=0.720). A reference T.sub.m.degree. of 83.4.degree.
C. was measured in 1M Na.sup.+ and 2 .mu.M total single strand
concentration. The melting temperature is predicted using Equation
13 in 0.5 mM Mg.sup.2+, 10 mM Tris-HCl buffer. Since the total
monovalent cation concentration is 5 mM Tris.sup.+, R= {square root
over (0.0005)}/0.005=4.47. As the ratio R is larger than 0.22,
magnesium ions will exhibit dominant effects on melting
temperatures and Equation 13 is accurate under these conditions.
However, since R is smaller than 6.0, the most accurate prediction
will be obtained when coefficients a, d, g from Equation 16 are
calculated according to Equations 18-20,
a=3.92.times.10.sup.-5(1-0.157-0.352 {square root over (0.005)}ln
0.005)=3.82.times.10.sup.-5
d=1.42.times.10.sup.-5[1+0.279-4.03.times.10.sup.-3 ln
0.005-8.03.times.10.sup.-3(ln
0.005).sup.2]=1.53.times.10.sup.-5
g=8.31.times.10.sup.-5[1-0.514-0.258 ln
0.005+5.25.times.10.sup.-3(ln
0.005).sup.3]=8.91.times.10.sup.-5
The remaining coefficients are taken directly from Table IIIa and
entered into Equation 13,
1 T m ( Mg 2 + ) = 1 T m .degree. + 3.82 .times. 10 - 5 - 9.11
.times. 10 - 6 ln 0.0005 + 0.72 .times. ( 6.26 .times. 10 - 5 +
1.53 .times. 10 - 5 ln 0.0005 ) ++ 1 2 ( 25 - 1 ) .times. [ - 4.82
.times. 10 - 4 + 5.25 .times. 10 - 4 ln 0.0005 + 8.91 .times. 10 -
5 ( ln 0.0005 ) 2 ] = 1 ( 83.4 + 273.15 ) + 8.2851 .times. 10 - 5 =
2.8875 .times. 10 - 3 K - 1 ##EQU00023##
The predicted T.sub.m(Mg.sup.2+)=346.3 K=73.2.degree. C. This value
is in excellent agreement with experimentally determined T.sub.m of
73.3.degree. C. under these conditions. Table IX shows comparison
of T.sub.m predictions using Equations 8-9 from the prior art.
These predictions are significantly less accurate than the Tm
prediction from Equation 13 of the present invention.
TABLE-US-00011 TABLE IX Analysis of T.sub.m predictions for a 25
base-pair duplex, d(CAGTGGGCTCCTGGGCGTGCTGGTC) (SEQ ID: 58) in 0.5
mM MgCl.sub.2, 10 mM Tris-HCl buffer. Predicted T.sub.m Error of
Equation Magnesium T.sub.m correction (.degree. C.) prediction
(.degree. C.) 13, This invention (1/T.sub.m correction function,
allowing 73.2 -0.1 18-20 coefficients a, d, and g to vary with
[Mon.sup.+]) 8 Peyret correction 69.9 -3.4 7 Ahsen et al.
correction 70.6 -2.7 6 Mitsuhashi correction 66.4 -6.9
Example 7
Implications for PCR and DNA Sequencing
[0172] Accurate prediction of T.sub.m in specific reaction
conditions is a fundamental step when designing
oligodeoxynucleotides for use in PCR, DNA sequencing and other
molecular biology applications. T.sub.m prediction is particularly
important when working with closely related sequences (allelic
variants, single nucleotide polymorphisms, etc.) or when designing
multiplex reactions where a large number of primers must function
together. We have studied a number of the solution components that
can affect DNA duplex stability and therefore impacts the design of
DNA primers and probes.
[0173] Buffers used in molecular biology experiments generally
contain a mixture of monovalent cations (Na.sup.+ or K.sup.+) and
Mg.sup.2+. As shown in FIG. 6, the effects of sodium and potassium
ions on duplex stability are equivalent. This is true even under
conditions in which Na.sup.+ and K.sup.+ compete with Mg.sup.2+ for
binding to DNA. Therefore, nearest-neighbor parameters and salt
correction formulas developed for buffers containing Na.sup.+ can
be used interchangeably with K.sup.+.
[0174] We have found that the effect of Mg.sup.2+ on T.sub.m is
dominant over monovalent cations under typical reaction conditions
used for PCR and DNA sequencing ([K.sup.+]=20-100 mM and
[Mg.sup.2+]=1.5-5 mM). Values of R range from about 0.3 to 4
M.sup.-1/2. Accurate treatment of the effect of Mg.sup.2+ on
T.sub.m is, therefore, very important in the design of DNA primers
and probes for these assays. Using the algorithm of FIG. 5 with the
correction formulas presented herein, the T.sub.m can be predicted
within an average accuracy of 1.degree. C. Earlier models are less
accurate and in some cases lead to large errors (>10.degree.
C.). The procedure of converting the Mg.sup.2+ component to an
"equivalent Na.sup.+ concentration" is not justified. The influence
of magnesium and monovalent cations on DNA duplex stability differ
both with respect to f.sub.GC and oligonucleotide length and must
be treated differently.
[0175] Although metal ions present in reaction buffers (Na.sup.+,
K.sup.+, Mg.sup.2+) have the greatest impact on T.sub.m, other
components contribute and should be taken into account. Most
buffers used in molecular biology applications rely on Tris or
other ammonium salts, which exhibit a significant dependence of
ionization constant on temperature. Tris buffer adjusted to pH of
8.3 at 25.degree. C. decreases to pH 6.9 as temperature is raised
to 95.degree. C. This pH change, however, has little effect on the
stability of DNA duplexes (see FIG. 7) as pK.sub.Hs of the
ionizable groups of the bases lie outside of this range. Nucleic
acid bases have pK.sub.H values lower than 4.5 (dC) and greater
than 9.4 (dG) in the single-stranded state which move even further
from neutrality in the duplex state (Record. Biopolymers 1967,
5:993-1008). Furthermore, the temperature range where primer
hybridization and DNA synthesis occur during PCR is usually between
60.degree. C. (the primer annealing step) and 72.degree. C. (the
enzymatic extension step). Within this narrow temperature window,
pH varies only between 7.6 and 7.4. Thus the large pH shifts seen
in Tris buffers with changes in temperature should have no effect
on hybridization efficiency during PCR or other thermal cycling
reactions. However, the protonated form of Tris is a monovalent
cation and should be added to the total monovalent cation
concentration when performing T.sub.m calculations. Due to the
relative extent of ionization, 10 mM Tris is equivalent to about 5
mM Na.sup.+.
[0176] The binding of magnesium to dNTPs in a reaction mixture
decreases the free magnesium ion concentration, which, in turn,
lowers the T.sub.m for DNA hybridization reactions done in that
buffer. As shown by the results in FIG. 8, the Mg-dNTP binding
constant is sufficiently large (Sigel. Chem. Soc. Rev. I 1993,
22:255-267) that the free Mg.sup.2+ concentration can be
approximated simply by the difference between the total magnesium
concentration and the total concentration of dNTPs. In a typical
PCR reaction, the four dNTPs together are usually present at a
concentration of 0.8 mM. If the total concentration of the
magnesium were 3.0 mM, the free concentration of the Mg2+ used in
conjunction with the algorithms and formulae of the present
invention would be 2.2 mM.
REFERENCES CITED
[0177] Numerous references, including patents, patent applications
and various publications, are cited and discussed in the
description of this invention. The citation and/or discussion of
such references is provided merely to clarify the description of
the present invention and is not an admission that any such
reference is "prior art" to the invention described herein. All
references cited and discussed in this specification are
incorporated herein by reference in their entirety and to the same
extent as if each reference was individually incorporated by
reference.
Sequence CWU 1
1
93115DNAArtificialprimer 1tactaacatt aacta 15215DNAArtificialprimer
2atacttactg attag 15315DNAArtificialprimer 3gtacactgtc ttata
15415DNAArtificialprimer 4gtatgagaga cttta 15515DNAArtificialprimer
5ttctacctat gtgat 15615DNAArtificialprimer 6agtagtaatc acacc
15715DNAArtificialprimer 7atcgtctcgg tataa 15815DNAArtificialprimer
8acgacaggtt tacca 15915DNAArtificialprimer 9ctttcatgtc cgcat
151015DNAArtificialprimer 10tggatgtgtg aacac
151115DNAArtificialprimer 11accccgcaat acatg
151215DNAArtificialprimer 12gcagtggatg tgaga
151315DNAArtificialprimer 13ggtccttact tggtg
151415DNAArtificialprimer 14cgcctcatgc tcatc
151515DNAArtificialprimer 15aaatagccgg gccgc
151615DNAArtificialprimer 16ccagccagtc tctcc
151715DNAArtificialprimer 17gacgacaaga ccgcg
151815DNAArtificialprimer 18cagcctcgtc gcagc
151915DNAArtificialprimer 19ctcgcggtcg aagcg
152015DNAArtificialprimer 20gcgtcggtcc gggct
152120DNAArtificialprimer 21tatgtatatt ttgtaatcag
202220DNAArtificialprimer 22ttcaagttaa acattctatc
202320DNAArtificialprimer 23tgattctacc tatgtgattt
202420DNAArtificialprimer 24gagattgttt ccctttcaaa
202520DNAArtificialprimer 25atgcaatgct acatattcgc
202620DNAArtificialprimer 26ccactatacc atctatgtac
202720DNAArtificialprimer 27ccatcattgt gtctacctca
202820DNAArtificialprimer 28cgggaccaac taaaggaaat
202920DNAArtificialprimer 29tagtggcgat tagattctgc
203020DNAArtificialprimer 30agctgcagtg gatgtgagaa
203120DNAArtificialprimer 31tacttccagt gctcagcgta
203220DNAArtificialprimer 32cagtgagaca gcaatggtcg
203320DNAArtificialprimer 33cgagcttatc cctatccctc
203420DNAArtificialprimer 34cgtactagcg ttggtcatgg
203520DNAArtificialprimer 35aaggcgagtc aggctcagtg
203620DNAArtificialprimer 36accgacgacg ctgatccgat
203720DNAArtificialprimer 37agcagtccgc cacaccctga
203820DNAArtificialprimer 38cagcctcgtt cgcacagccc
203920DNAArtificialprimer 39gtggtgggcc gtgcgctctg
204020DNAArtificialprimer 40gtccacgccc ggtgcgacgg
204125DNAArtificialprimer 41gatatagcaa aattctaagt taata
254225DNAArtificialprimer 42ataactttac gtgtgtgacc tatta
254325DNAArtificialprimer 43gttctatact cttgaagttg attac
254425DNAArtificialprimer 44ccctgcactt taactgaatt gttta
254525DNAArtificialprimer 45taaccatact gaataccttt tgacg
254625DNAArtificialprimer 46tccacacggt agtaaaatta ggctt
254725DNAArtificialprimer 47ttccaaaagg agttatgagt tgcga
254825DNAArtificialprimer 48aatatctctc atgcgccaag ctaca
254925DNAArtificialprimer 49tagtatatcg cagcatcata caggc
255025DNAArtificialprimer 50tggattctac tcaaccttag tctgg
255125DNAArtificialprimer 51cggaatccat gttacttcgg ctatc
255225DNAArtificialprimer 52ctggtctgga tctgagaact tcagg
255325DNAArtificialprimer 53acagcgaatg gacctacgtg gcctt
255425DNAArtificialprimer 54agcaagtcga gcagggccta cgttt
255525DNAArtificialprimer 55gcgagcgaca ggttacttgg ctgat
255625DNAArtificialprimer 56aaaggtgtcg cggagagtcg tgctg
255725DNAArtificialprimer 57atgggtggga gcctcggtag cagcc
255825DNAArtificialprimer 58cagtgggctc ctgggcgtgc tggtc
255925DNAArtificialprimer 59gccaactccg tcgccgttcg tgcgc
256025DNAArtificialprimer 60acgggtcccc gcaccgcacc gccag
256130DNAArtificialprimer 61ttatgtatta agttatatag tagtagtagt
306230DNAArtificialprimer 62attgatatcc ttttctattc atctttcatt
306330DNAArtificialprimer 63aaagtacatc aacatagaga attgcatttc
306430DNAArtificialprimer 64cttaagatat gagaacttca actaatgtgt
306530DNAArtificialprimer 65ctcaacttgc ggtaaataaa tcgcttaatc
306630DNAArtificialprimer 66tattgagaac aagtgtccga ttagcagaaa
306730DNAArtificialprimer 67gtcatacgac tgagtgcaac attgttcaaa
306830DNAArtificialprimer 68aacctgcaac atggagtttt tgtctcatgc
306930DNAArtificialprimer 69ccgtgcggtg tgtacgtttt attcatcata
307030DNAArtificialprimer 70gttcacgtcc gaaagctcga aaaaggatac
307130DNAArtificialprimer 71agtctggtct ggatctgaga acttcaggct
307230DNAArtificialprimer 72tcggagaaat cactgagctg cctgagaaga
307330DNAArtificialprimer 73cttcaacgga tcaggtagga ctgtggtggg
307430DNAArtificialprimer 74acgcccacag gattaggctg gcccacattg
307530DNAArtificialprimer 75gttattccgc agtccgatgg cagcaggctc
307630DNAArtificialprimer 76tcagtaggcg tgacgcagag ctggcgatgg
307730DNAArtificialprimer 77cgcgccacgt gtgatctaca gccgttcggc
307830DNAArtificialprimer 78gacctgacgt ggaccgctcc tgggcgtggt
307930DNAArtificialprimer 79gcccctccac tggccgacgg cagcaggctc
308030DNAArtificialprimer 80cgccgctgcc gactggagga gcgcgggacg
308110DNAArtificialprimer 81atcaatcata 108210DNAArtificialprimer
82ttgtagtcat 108310DNAArtificialprimer 83gaaatgaaag
108410DNAArtificialprimer 84ccaacttctt 108510DNAArtificialprimer
85atcgtctgga 108610DNAArtificialprimer 86agcgtaagtc
108710DNAArtificialprimer 87cgatctgcga 108810DNAArtificialprimer
88tggcgagcac 108910DNAArtificialprimer 89gatgcgctcg
109010DNAArtificialprimer 90gggaccgcct 109111DNAArtificialprimer
91cgtacacatg c 119211DNAArtificialprimer 92ccattgctac c
119360DNAArtificial Sequenceprimer 93ttcgcggatt agccctacgc
atcggttaca aacgaggacc ttatgcactt tgacagcatg 60
* * * * *