U.S. patent application number 13/047515 was filed with the patent office on 2011-08-11 for internalizing anti-cd74 antibodies and methods of use.
This patent application is currently assigned to IMMUNOMEDICS, INC.. Invention is credited to David M. Goldenberg, Hans J. Hansen, Zhengxing Qu.
Application Number | 20110195023 13/047515 |
Document ID | / |
Family ID | 27788972 |
Filed Date | 2011-08-11 |
United States Patent
Application |
20110195023 |
Kind Code |
A1 |
Hansen; Hans J. ; et
al. |
August 11, 2011 |
Internalizing Anti-CD74 Antibodies and Methods of Use
Abstract
The present invention provides humanized, chimeric and human
anti-CD74 antibodies, CD74 antibody fusion proteins,
immunoconjugates, vaccines and bispecific that bind to CD74, the
major histocompatibility complex (MHC) class-II invariant chain,
Ii, which is useful for the treatment and diagnosis of B-cell
disorders, such as B-cell malignancies, other malignancies in which
the cells are reactive with CD74, and autoimmune diseases, and
methods of treatment and diagnosis.
Inventors: |
Hansen; Hans J.; (Picayune,
MS) ; Qu; Zhengxing; (Warren, NJ) ;
Goldenberg; David M.; (Mendham, NJ) |
Assignee: |
IMMUNOMEDICS, INC.
Morris Plains
NJ
|
Family ID: |
27788972 |
Appl. No.: |
13/047515 |
Filed: |
March 14, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12794823 |
Jun 7, 2010 |
7931903 |
|
|
13047515 |
|
|
|
|
11867775 |
Oct 5, 2007 |
7772373 |
|
|
12794823 |
|
|
|
|
10377122 |
Mar 3, 2003 |
7312318 |
|
|
11867775 |
|
|
|
|
60360259 |
Mar 1, 2002 |
|
|
|
Current U.S.
Class: |
424/1.49 ;
424/133.1; 424/134.1; 424/135.1; 424/136.1; 424/178.1; 424/85.1;
424/85.2; 424/85.4 |
Current CPC
Class: |
A61K 51/1027 20130101;
A61P 3/10 20180101; A61P 35/02 20180101; A61K 2039/505 20130101;
A61P 37/00 20180101; A61P 37/06 20180101; C07K 16/2896 20130101;
A61K 45/06 20130101; A61P 25/14 20180101; A61P 17/00 20180101; A61P
31/00 20180101; A61P 35/00 20180101; C07K 16/2833 20130101; C07K
2317/77 20130101; C07K 2317/24 20130101; A61P 37/02 20180101; A61K
47/6849 20170801; A61K 38/00 20130101; A61P 21/00 20180101 |
Class at
Publication: |
424/1.49 ;
424/133.1; 424/178.1; 424/136.1; 424/85.1; 424/85.4; 424/85.2;
424/134.1; 424/135.1 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61K 51/10 20060101 A61K051/10; A61K 38/19 20060101
A61K038/19; A61K 38/21 20060101 A61K038/21; A61K 38/20 20060101
A61K038/20; A61P 37/02 20060101 A61P037/02; A61P 37/06 20060101
A61P037/06; A61P 17/00 20060101 A61P017/00; A61P 3/10 20060101
A61P003/10; A61P 25/14 20060101 A61P025/14 |
Claims
1. A method for treating a disease selected from the group
consisting of cancer, autoimmune, immune dysregulation, organ graft
rejection and graft versus host disease comprising: a)
administering to a subject a humanized anti-CD74 antibody or
antigen binding fragment thereof, wherein said antibody or fragment
thereof: (i) is internalized by Raji lymphoma cells in culture;
(ii) induces apoptosis of Raji cells in cell culture when
cross-linked with goat antisera reactive with the Fc of a human
IgG; and (iii) competes for binding to CD74 with, or binds to the
same epitope of CD74 as, an anti-CD74 antibody comprising the light
chain complementarity-determining region (CDR) sequences CDR1
(RSSQSLVHRNGNTYLH; SEQ ID NO:16), CDR2 (TVSNRFS; SEQ ID NO:17), and
CDR3 (SQSSHVPPT; SEQ ID NO:18) and the heavy chain CDR sequences
CDR1 (NYGVN; SEQ ID NO:19), CDR2 (WINPNTGEPTFDDDFKG; SEQ ID NO:20),
and CDR3 (SRGKNEAWFAY; SEQ ID NO:21).
2. The method of claim 1, wherein said humanized anti-CD74 antibody
or fragment thereof competes for binding to CD74 with an anti-CD74
antibody comprising the light chain complementarity-determining
region (CDR) sequences CDR1 (RSSQSLVHRNGNTYLH; SEQ ID NO:16), CDR2
(TVSNRFS; SEQ ID NO:17), and CDR3 (SQSSHVPPT; SEQ ID NO:18) and the
heavy chain CDR sequences CDR1 (NYGVN; SEQ ID NO:19), CDR2
(WINPNTGEPTFDDDFKG; SEQ ID NO:20), and CDR3 (SRGKNEAWFAY; SEQ ID
NO:21).
3. The method of claim 1, wherein said humanized anti-CD74 antibody
or fragment thereof binds to the same epitope of CD74 as an
anti-CD74 antibody comprising the light chain
complementarity-determining region (CDR) sequences CDR1
(RSSQSLVHRNGNTYLH; SEQ ID NO:16), CDR2 (TVSNRFS; SEQ ID NO:17), and
CDR3 (SQSSHVPPT; SEQ ID NO:18) and the heavy chain CDR sequences
CDR1 (NYGVN; SEQ ID NO:19), CDR2 (WINPNTGEPTFDDDFKG; SEQ ID NO:20),
and CDR3 (SRGKNEAWFAY; SEQ ID NO:21).
4. The method of claim 1, wherein the humanized anti-CD74 antibody
is a naked antibody.
5. The method of claim 4, wherein said naked anti-CD74 antibody is
effective to treat said disease in the absence of any other
administered antibody or antibody fragment.
6. The method of claim 1, wherein the humanized anti-CD74 antibody
or fragment thereof is conjugated to at least one therapeutic
agent.
7. The method of claim 6, wherein the therapeutic agent is selected
from the group consisting of a second antibody or fragment thereof,
an immunoconjugate, an immunomodulator, a hormone, a cytotoxic
agent, an enzyme, an antisense oligonucleotide, a boron compound, a
photoactive agent and a radionuclide.
8. The method of claim 7, wherein the cytotoxic agent is a drug or
toxin.
9. The method of claim 7, wherein the immunomodulator is selected
from the group consisting of a cytokine, a stem cell growth factor,
a lymphotoxin, a tumor necrosis factor, a hematopoietic factor, a
colony stimulating factor, an interferon, erythropoietin,
thrombopoietin, or a combination thereof.
10. The method of claim 9, wherein the hematopoietic factor is an
interleukin selected from the group consisting of IL-1, IL-2, IL-3,
IL-6, IL-10, IL-12, IL-18 and IL-21.
11. The method of claim 9, wherein the colony stimulating factor is
granulocyte-colony stimulating factor (G-CSF) or granulocyte
macrophage-colony stimulating factor (GM-CSF).
12. The method of claim 7, wherein the radionuclide is selected
from the group consisting of .sup.225Ac, .sup.68Ga, .sup.67Ga,
.sup.90Y, .sup.86Y, .sup.111In, .sup.131I, .sup.125I, .sup.123I,
.sup.99mTc, .sup.94mTc, .sup.186Re, .sup.188Re, .sup.177Lu,
.sup.62Cu, .sup.64Cu, .sup.67Cu, .sup.212Bi, .sup.213Bi, .sup.32P,
.sup.11C, .sup.13N, .sup.15O, .sup.76Br, and .sup.211At.
13. The method of claim 7, wherein the second antibody binds to an
antigen selected from the group consisting of CD4, CD5, CD8, CD14,
CD15, CD19, CD20, CD21, CD22, CD23, CD25, CD30, CD33, CD37, CD38,
CD40, CD40L, CD46, CD52, CD54, CD74, CD80, CD126, B7, MUC-1, Ia,
tenascin, HM1.24 and HLA-DR.
14. The method of claim 8, wherein the drug is selected from the
group consisting of vinca alkaloids, anthracyclines,
epipodophyllotoxins, taxanes, antimetabolites, alkylating agents,
antibiotics, COX-2 inhibitors, antimitotics, antiangiogenic agents,
apoptotic agents, doxorubicin, methotrexate, taxol, CPT-11,
camptothecins, nitrogen mustards, alkyl sulfonates, nitrosoureas,
triazenes, folic acid analogs, COX-2 inhibitors, pyrimidine
analogs, purine analogs, platinum coordination complexes,
cyclophosphamide, etoposide, carmustine, vincristine, procarbazine,
prednisone, methotrexate, bleomycin, dexamethasone, leucovorin,
phenyl butyrate, bryostatin-1 and hormones.
15. The method of claim 8, wherein the toxin is selected from the
group consisting of ricin, abrin, DNase I, Staphylococcal
enterotoxin-A, pokeweed antiviral protein, gelonin, diphtheria
toxin, Pseudomonas exotoxin, and Pseudomonas endotoxin.
16. The method of claim 1, wherein said humanized anti-CD74
antibody or fragment thereof comprises human IgG1, IgG2a, IgG3 or
IgG4 constant regions.
17. The method of claim 1, wherein said humanized anti-CD74
antibody fragment is selected from the group consisting of an
F(ab').sub.2, F(ab'), Fab, scFv and Fv fragment.
18. The method of claim 1, wherein said humanized anti-CD74
antibody or fragment thereof is a fusion protein.
19. The method of claim 1, wherein the autoimmune disease is
selected from the group consisting of immune-mediated
thrombocytopenia, acute idiopathic thrombocytopenic purpura,
chronic idiopathic thrombocytopenic purpura, dermatomyositis,
Sjogren's syndrome, multiple sclerosis, Sydenham's chorea,
myasthenia gravis, systemic lupus erythematosus, lupus nephritis,
rheumatic fever, polyglandular syndromes, bullous pemphigoid,
diabetes mellitus, Henoch-Schonlein purpura, post-streptococcal
nephritis, erythema nodosum, Takayasu's arteritis, Addison's
disease, rheumatoid arthritis, sarcoidosis, ulcerative colitis,
erythema multiforme, IgA nephropathy, polyarteritis nodosa,
ankylosing spondylitis, Goodpasture's syndrome, thromboangitis
obliterans, primary biliary cirrhosis, Hashimoto's thyroiditis,
thyrotoxicosis, scleroderma, chronic active hepatitis,
polymyositis/dermatomyositis, polychondritis, pemphigus vulgaris,
Wegener's granulomatosis, membranous nephropathy, amyotrophic
lateral sclerosis, tabes dorsalis, giant cell
arteritis/polymyalgia, pernicious anemia, rapidly progressive
glomerulonephritis and fibrosing alveolitis.
20. The method of claim 1, wherein the disease is graft versus host
disease (GVHD).
21. The method of claim 1, wherein the disease is organ transplant
rejection.
22. The method of claim 1, wherein the humanized anti-CD74 antibody
or fragment thereof is a bispecific antibody or fragment
thereof.
23. The method of claim 22, wherein the bispecific antibody
comprises at least one hapten-binding site.
24. The method of claim 23, further comprising administering to the
subject a targetable conjugate comprising at least one hapten and
at least one therapeutic agent.
25. The method of claim 1, wherein the humanized anti-CD74 antibody
or fragment thereof is a multispecific antibody or fragment
thereof.
26. The method of claim 1, further comprising administering at
least one therapeutic agent to said subject.
27. The method of claim 26, wherein the therapeutic agent is
selected from the group consisting of a second antibody or fragment
thereof, an immunoconjugate, an immunomodulator, a hormone, a
cytotoxic agent, an enzyme, an antisense oligonucleotide, a boron
compound, a photoactive agent and a radionuclide.
28. The method of claim 27, wherein the cytotoxic agent is a drug
or toxin.
29. The method of claim 27, wherein the immunomodulator is selected
from the group consisting of a cytokine, a stem cell growth factor,
a lymphotoxin, a tumor necrosis factor, a hematopoietic factor, a
colony stimulating factor, an interferon, erythropoietin,
thrombopoietin, or a combination thereof.
30. The method of claim 29, wherein the hematopoietic factor is an
interleukin selected from the group consisting of IL-1, IL-2, IL-3,
IL-6, IL-10, IL-12, IL-18 and IL-21.
31. The method of claim 29, wherein the colony stimulating factor
is granulocyte-colony stimulating factor (G-CSF) or granulocyte
macrophage-colony stimulating factor (GM-CSF).
32. The method of claim 27, wherein the radionuclide is selected
from the group consisting of .sup.225Ac, .sup.68Ga, .sup.67Ga,
.sup.90Y, .sup.86Y, .sup.111In, .sup.131I, .sup.125I, .sup.123I,
.sup.99mTc, .sup.94mTc, .sup.186Re, .sup.188Re, .sup.177Lu,
.sup.62Cu, .sup.64Cu, .sup.67Cu, .sup.212Bi, .sup.213Bi, .sup.32P,
.sup.11C, .sup.13N, .sup.15O, .sup.76Br, and .sup.211At.
33. The method of claim 27, wherein the second antibody binds to an
antigen selected from the group consisting of CD4, CD5, CD8, CD14,
CD15, CD19, CD20, CD21, CD22, CD23, CD25, CD30, CD33, CD37, CD38,
CD40, CD40L, CD46, CD52, CD54, CD74, CD80, CD126, B7, MUC-1, Ia,
tenascin, HM1.24 and HLA-DR.
34. The method of claim 28, wherein the drug is selected from the
group consisting of vinca alkaloids, anthracyclines,
epipodophyllotoxins, taxanes, antimetabolites, alkylating agents,
antibiotics, COX-2 inhibitors, antimitotics, antiangiogenic agents,
apoptotic agents, doxorubicin, methotrexate, taxol, CPT-11,
camptothecins, nitrogen mustards, alkyl sulfonates, nitrosoureas,
triazenes, folic acid analogs, COX-2 inhibitors, pyrimidine
analogs, purine analogs, platinum coordination complexes,
cyclophosphamide, etoposide, carmustine, vincristine, procarbazine,
prednisone, methotrexate, bleomycin, dexamethasone, leucovorin,
phenyl butyrate, bryostatin-1 and hormones.
35. The method of claim 28, wherein the toxin is selected from the
group consisting of ricin, abrin, DNase 1, Staphylococcal
enterotoxin-A, pokeweed antiviral protein, gelonin, diphtheria
toxin, Pseudomonas exotoxin, and Pseudomonas endotoxin.
Description
[0001] This application is a divisional of U.S. Ser. No.
12/794,823, filed Jun. 7, 2010, which is a divisional of U.S. Ser.
No. 11/867,775 (now issued U.S. Pat. No. 7,772,373), filed Oct. 5,
2007, which is a continuation of U.S. Ser. No. 10/377,122 (now
issued U.S. Pat. No. 7,312,318), filed Mar. 3, 2003, which claimed
the benefit under 35 U.S.C. .sctn.119(e) of U.S. Provisional
Application No. 60/360,259, filed Mar. 1, 2002, each of which is
incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to humanized, chimeric and
human anti-CD74 antibodies or fragments thereof or antibody fusion
proteins comprising at least one anti-CD74 antibody, particularly
monoclonal antibodies (mAbs), therapeutic and diagnostic conjugates
of humanized, chimeric and human anti-CD74 mAbs or fragments
thereof, and methods of treating and diagnosing B cell lymphomas
and leukemias, malignancies other than lymphomas and leukemias in
which the cells are positive for the CD74 antigen and various
autoimmune and immune dysregulation diseases using these humanized,
chimeric and human anti-CD74 mAbs or fragments thereof. The present
invention relates to multivalent and/or multispecific anti-CD74
mAbs or fragments thereof comprising at least one arm of an
anti-CD74 mAb or fragment thereof and at least one arm of the
multispecific mAb to a noxious substance, such as a pathogenic
organism, such as a cancer cell, a parasite or an infectious agent.
The present invention further relates to an anti-CD74 mAb or
fragment thereof conjugated to an antigenic peptide. The humanized,
chimeric and human anti-CD74 mAbs, fragments thereof, and
conjugates thereof may be administered alone or as part of a
multimodal therapeutic regimen. The present invention relates to
DNA sequences encoding humanized, chimeric and human anti-CD74
antibodies, and multivalent and/or multispecific anti-CD74 mAbs and
fragments thereof, and therapeutic, diagnostic and antigenic
conjugates thereof, vectors and host cells containing the DNA
sequences, and methods of making the humanized, chimeric and human
anti-CD74 antibodies.
[0004] 2. Background
[0005] One of the major goals of immunotherapy is to harness a
patient's immune system against tumor cells or infectious
organisms. With regard to cancer therapy, the object is to direct
the patient's immune system against tumor cells. Non-Hodgkins
lymphoma (NHL), multiple myeloma, and chronic and acute lymphocytic
leukemia are B-cell malignancies that remain important contributors
to cancer mortality. The response of these malignancies to various
forms of treatment is mixed.
[0006] Induction of a T-lymphocyte response is a critical initial
step in a host's immune response. Activation of T cells results in
T cell proliferation, cytokine production by T cells and generation
of T cell-mediated effector functions. T-cell activation requires
an antigen-specific signal, often called a primary activation
signal, which results from stimulation of a clonally-distributed T
cell receptor (TcR) present on the surface of the T cell. This
antigen-specific signal is usually in the form of an antigenic
peptide bound either to a major histocompatibility complex (MHC)
class I protein or an MHC class II protein present on the surface
of an antigen-presenting cell (APC). The MHC molecules in humans
are designated as HLA (human leukocyte antigen) molecules.
[0007] Class-II molecules are found on a limited number of cell
types, primarily B cells, monocytes/macrophages and dendritic
cells, and, in most cases, present peptides derived from proteins
taken up from the extracellular environment. MHC class-II are
charged in cellular compartments which communicate with the
extracellular environment. In humans the MHC-II molecules comprise
the HLA-DR, HLA-DQ and HLA-DP molecules, which occur in various
genetically coded alleles. Thus, e.g., bacterial antigens from the
extracellular environment can be taken up and be presented after
intracellular processing in the antigen-presenting cells on their
cell surface. CD4+T cells recognize peptides associated with
class-II molecules.
[0008] The use of targeting monoclonal antibodies conjugated to
radionuclides or other cytotoxic agents offers the possibility of
delivering such agents directly to the tumor site, thereby limiting
the exposure of normal tissues to toxic agents (Goldenberg, Semin.
Nucl. Med., 19: 332 (1989)). In recent years, the potential of
antibody-based therapy and its accuracy in the localization of
tumor-associated antigens have been demonstrated both in the
laboratory and clinical studies (see, e.g., Thorpe, TIBTECH, 11: 42
(1993); Goldenberg, Scientific American, Science & Medicine, 1:
64 (1994); Baldwin et al., U.S. Pat. Nos. 4,925,922 and 4,916,213;
Young, U.S. Pat. No. 4,918,163; U.S. Pat. No. 5,204,095; hie et
al., U.S. Pat. No. 5,196,337; Hellstrom et al., U.S. Pat. Nos.
5,134,075 and 5,171,665). In general, the use of radio-labeled
antibodies or antibody fragments against tumor-associated markers
for localization of tumors has been more successful than for
therapy, in part because antibody uptake by the tumor is generally
low, ranging from only 0.01% to 0.001% of the total dose injected
(Vaughan et al., Brit. J. Radiol., 60: 567 (1987)). Increasing the
concentration of the radiolabel to increase the dosage to the tumor
is counterproductive, generally, as this also increases exposure of
healthy tissue to radioactivity.
[0009] Murine LL1 (mLL1 or murine anti-CD74 antibody) is a specific
monoclonal antibody (mAb) reactive with CD74, the HLA Class-II-Iike
antigen, i.e., the invariant chain (Ii determinant) on the surface
of B-lymphocytes, monocytes and histiocytes, human B-lymphoma cell
lines, melanomas, T-cell lymphomas and a variety of other tumor
cell types (Hansen et al., Biochem. J. 320:293 (1996)). Cell
surface-bound LL1 is rapidly internalized to the lysosomal
compartment and quickly catabolized, much faster than other mAbs,
such as anti-CD19 and anti-CD22. Id. This inherent property of LL1
overcomes some of the aforementioned difficulties with
immunotherapy.
[0010] Murine LL1 was developed by fusion of mouse myeloma cells
with splenocytes from BALB/c mice immunized with preparations from
the Raji B-lymphoma cell line (called EPB-1 in Pawlak-Byczkowska et
al., Can. Res., 49: 4568 (1989)). The clinical use of mLL1, just as
with most other promising murine antibodies, has been limited by
the development in humans of a human anti-mouse antibody (HAMA)
response. A HAMA response is generally not observed following
injection of mLL1 Fab', as evidenced in a bone marrow imaging study
using a mLL1 Fab' labeled with .sup.99mTc. Juweid et. al., Nuc.
Med. Carom. 18: 142-148 (1997). However, in some therapeutic and
diagnostic uses, a full-length anti-CD74 mAb may be preferred. This
use of the full-length anti-CD74 mAb can limit the diagnostic and
therapeutic usefulness of such antibodies and antibody conjugates,
not only because of the potential anaphylactic problem, but also as
a major portion of the circulating conjugate may be complexed to
and sequestered by the circulating anti-mouse antibodies. Although
the use of antibody fragments of mLL1 may circumvent the problems
of immunogenicity, there are circumstances in which whole IgG is
more desirable and the induction of cellular immunity is intended
for therapy or enhanced antibody survival time. In general, HAMA
responses pose a potential obstacle to realizing the full
diagnostic and therapeutic potential of murine anti-CD74 mAbs.
Therefore, the development of chimeric, humanized and human
anti-CD74 mAbs and fragments thereof, antibody fusion proteins
thereof and fragments thereof, immunoconjugates for therapy and
diagnosis, multivalent and/or multispecific mAbs, and fragments
thereof and vaccine conjugates thereof would be extremely useful
for therapy and diagnosis, with reduced production of human
anti-mouse antibodies.
SUMMARY OF THE INVENTION
[0011] The present invention is directed to anti-CD74 antibodies
and fragments thereof and antibody fusion proteins thereof,
particularly chimeric, humanized or human antibodies, which can be
rapidly internalized into a cell.
[0012] The present invention is further directed to anti-CD74
antibody fusion proteins containing antibodies or fragments thereof
that are fused to each other and/or to other antibodies and
fragments thereof of the present invention.
[0013] The present invention additionally is directed to
immunoconjugates containing the anti-CD74 antibodies or fragments
thereof or the antibody fusion proteins or fragments thereof of the
present invention linked to a diagnostic or therapeutic agent.
[0014] The present invention also is directed to a vaccine
comprising an antibody conjugate containing the anti-CD74
antibodies or fragments thereof or the antibody fusion proteins or
fragments thereof of the present invention linked to antigenic
peptides.
[0015] The present invention further is directed to a bispecific or
multispecific antibody comprising an antibody conjugate containing
the anti-CD74 antibodies or fragments thereof or the antibody
fusion proteins or fragments thereof of the present invention
linked to an antibody or antibody fragment specific for a cancer
marker substance, an epitope on the surface of an infectious
disease organism or a noxious substance in the blood or other body
fluid.
[0016] The present invention is additionally directed to methods of
treating and diagnosing diseases using the CD74 antibodies and
fragments thereof or antibody fusion proteins thereof and
conjugates thereof of the present invention.
[0017] The present invention also is directed to DNA sequences
encoding the CD74 antibodies or fragments thereof or antibody
fusion proteins or fragments thereof, immunoconjugates and antibody
conjugates and multispecific antibodies thereof, expression vectors
and host cells containing the DNA sequences, and methods of
expressing these CD74 antibodies of the present invention.
BRIEF DESCRIPTION OF THE FIGURES
[0018] FIG. 1 shows the DNA and amino acid sequences of the murine
LL1 heavy and light chain variable regions. FIG. 1A shows the DNA
(SEQ ID NO:1) and amino acid (SEQ ID NO:2) sequences of the LL1 VH
obtained by RT-PCR. FIG. 1B shows the DNA (SEQ ID NO:3) and amino
acid (SEQ ID NO:4) sequences of the LL1Vk obtained by 5'-RACE.
Amino acid sequences encoded by the corresponding DNA sequences are
given as one-letter codes below the nucleotide sequence. Numbering
of the nucleotide sequences is on the right side. The amino acid
residues in the CDR regions are shown in bold and underlined.
Kabat's Ig molecule numbering is used for amino acid residues as
shown by the numbering above the amino acid residues. The residues
numbered by a letter following a particular digit indicates the
insertion residues defined by Kabat numbering scheme. The insertion
residues numbered with a letter have the same preceding digit. For
example, residues 82A, 82B and 82C in FIG. 1A are indicated as 82A,
B, and C.
[0019] FIG. 2 shows the DNA and amino acid sequences of the
chimeric LL1 (cLL1) heavy and light chain variable regions
expressed in Sp2/0 cells. FIG. 2A shows the DNA (SEQ ID NO:5) and
amino acid (SEQ ID NO:6) sequences of the cLL1 VH. FIG. 2B shows
the double-stranded DNA (SEQ ID NO:7) and amino acid (SEQ ID NO:8)
sequences of the cLL1 Vk. Amino acid sequences encoded by the
corresponding DNA sequences are given as one-letter codes. The
amino acid residues in the CDR regions are shown in bold and
underlined. The numbering of nucleotides and amino acids is same as
that in FIG. 1. The restriction sites used for constructing the
cLL1 are boxed and indicated.
[0020] FIG. 3 shows the alignment of the amino acid sequences of
light and heavy chain variable regions of a human antibody, cLL1
and hLL1. FIG. 3A shows the VH amino acid sequence alignment of the
human antibody RF-TS3, (SEQ ID NO:9) cLL1 (SEQ ID NO:6) and hLL1
(SEQ ID NO:11) and FIG. 3B shows the Vk amino acid sequence
alignment of the human antibody HF-21/28, (SEQ ID NO:12) cLL1 (SEQ
ID NO:8) and hLL1 (SEQ ID NO:14). Dots indicate the residues in
cLL1 that are identical to the corresponding residues in the human
antibodies. Boxed regions prepresent the CDR regions. Both N- and
C-terminal residues (underlined) of cLL1 are fixed by the staging
vectors used and not compared with the human antibodies. Kabat's Ig
molecule number scheme is used as in FIG. 1.
[0021] FIG. 4 shows the DNA and amino acid sequences of the
humanized LL1 (hLL1) heavy and light chain variable regions
expressed in Sp2/0 cells. FIG. 4A shows the DNA (SEQ ID NO:10) and
amino acid (SEQ ID NO:11) sequences of the hLL1VH and FIG. 4B shows
the DNA (SEQ ID NO:13) and amino acid (SEQ ID NO:14) sequences of
the hLL1 Vk. Amino acid sequences encoded by the corresponding DNA
sequences are given as one letter codes. The amino acid residues in
the CDR regions are shown in bold and underlined. Kabat's Ig
molecule numbering scheme is used for amino acid residues as in
FIG. 1A and FIG. 1B.
[0022] FIG. 5 shows a schematic diagram of construction of hLL1VH
gene. Oligos used as templates and primers are shown as arrow
lines. The arrow heads indicate the 3'-ends. The sense DNA strands
(templates, primers and PCR products) are shown in solid lines and
the anti-sense strands in doted lines. The Vk gene was similarly
constructed.
[0023] FIG. 6 shows the result of a competitive cell surface
binding assay to compare the binding affinity of cLL1 with that of
murine LL1. Varying concentrations of cLL1 (triangles) or mLL1
(diamonds) were mixed with a constant amount of .sup.125I-labeled
mLL1 and incubated with Raji cells at 4.degree. C. for 1 h. The
cell surface bound radiolabeled mLL1 was counted after washing.
cLL1 and the murine LL1 competed equally well for the binding of
radiolabeled LL1 to Raji cells, confirming the cloned V genes are
authentic.
[0024] FIG. 7 shows the result of a competitive binding assay in
Raji cell membrane coated micro wells to compare the binding
affinity of hLL1 with that of cLL1. Varying concentrations of hLL1
(triangles) or cLL1 (diamonds) were mixed with a constant amount of
HRP conjugated LL1 and incubated in 96-well microtitration plate
coated with Raji membrane extracts at room temperature for 1 h. The
membrane bound HRP-LL1 was measured. hLL1 and cLL1 competed equally
well for the binding of HRP-LL1, indicating the binding specificity
and affinity of mAb LL1 are preserved in the humanized LL1.
[0025] FIG. 8 shows the fate of .sup.125I-labeled hLL1 and mLL1
bound to the surface of Raji cells. The radiolabeled hLL1 (solid
line with symbols) or mLL1 (dotted line with symbols) was incubated
with Raji cells and unbound Abs were removed by washing. The cells
were then cultured as normal and the radiolabeled Abs associated
with cells (diamond lines), secreted into medium (triangle lines)
or degraded (circle lines) were measured at indicated time point.
FIG. 8A shows the fate of the bound Ab followed for up to 3 days.
FIG. 8B shows the result of hLL1 processing studied at early time
points (less than 3 h). The data was averaged of two
experiments.
[0026] FIG. 9 shows the cytotoxicity effect of crosslinked LL1 Abs
on Raji cells. 5.times.10.sup.5 Raji cells were seeded at day 0 in
1 ml of culture medium containing (as indicated on top of the
panels) 5 .mu.g/ml of mLL1, cLL1 or hLL1, or no any Ab (Nil), with
50 .mu.g/ml of -mFc or -hFc Ab, or without any crosslinker (Nil),
indicated at right side of panels. The numbers of total and viable
cells were counted daily for 3 days. Percentage of viable cells
(squares) and the ratio of viable cells over the viable cells at
time zero (diamonds) were calculated and plotted against culture
time.
[0027] FIG. 10 shows the cytotoxicity effect of crosslinked hLL1 on
Daudi cells. 5.times.10.sup.5 Daudi cells were seeded at day 0 in 1
ml of culture medium containing (as indicated on top of the panels)
5 .mu.g/ml of hLL1, or hLL2 (an anti-CD22, internalizing Ab), or no
any Ab (Nil), with 50 .mu.g/ml of -hFc Ab, or without (Nil),
indicated at right side of panels. The numbers of total and viable
cells were counted daily for 3 days. Percentage of viable cells
(squares) and the ratio of viable cells over the viable cells at
time zero (diamonds) were calculated and plotted against culture
time.
DETAILED DESCRIPTION OF THE INVENTION
[0028] Unless otherwise specified, the terms "a" or "an" mean "one
or more."
[0029] Overview
[0030] The present invention provides a humanized, a chimeric and a
human anti-CD74 mAb, fragments thereof, an antibody fusion protein,
and therapeutic and diagnostic conjugates thereof useful for
treatment of mammalian subjects, humans and domestic animals,
alone, as a conjugate or administered in combination with other
therapeutic agents, including other naked antibodies and antibody
therapeutic conjugates as part of a multimodal therapy regimen.
Methods of treatment and diagnosis of B-cell malignancies, other
CD74 positive malignancies and autoimmune diseases are
disclosed.
DEFINITIONS
[0031] In the description that follows, a number of terms are used
and the following definitions are provided to facilitate
understanding of the present invention.
[0032] An antibody, as described herein, refers to a full-length
(i.e., naturally occurring or formed by normal immunoglobulin gene
fragment recombinatorial processes) immunoglobulin molecule (e.g.,
an IgG antibody) or an immunologically active (i.e., specifically
binding) portion of an immunoglobulin molecule, like an antibody
fragment.
[0033] An antibody fragment is a portion of an antibody such as
F(ab').sub.2, F(ab).sub.2, Fab', Fab, Fv, sFv and the like.
Regardless of structure, an antibody fragment binds with the same
antigen that is recognized by the intact antibody. For example, an
anti-CD74 monoclonal antibody fragment binds with an epitope of
CD74. The term "antibody fragment" also includes any synthetic or
genetically engineered protein that acts like an antibody by
binding to a specific antigen to form a complex. For example,
antibody fragments include isolated fragments consisting of the
variable regions, such as the "Fv" fragments consisting of the
variable regions of the heavy and light chains, recombinant single
chain polypeptide molecules in which light and heavy variable
regions are connected by a peptide linker ("scFv proteins"), and
minimal recognition units consisting of the amino acid residues
that mimic the hypervariable region.
[0034] A naked antibody is generally an entire antibody that is not
conjugated to a therapeutic agent. This is so because the Fc
portion of the antibody molecule provides effector functions, such
as complement fixation and ADCC (antibody dependent cell
cytotoxicity) that set mechanisms into action that may result in
cell lysis. However, it is possible that the Fc portion is not
required for therapeutic function, with other mechanisms, such as
apoptosis, coming into play. Naked antibodies include both
polyclonal and monoclonal antibodies, as well as certain
recombinant antibodies, such as chimeric, humanized or human
antibodies.
[0035] A chimeric antibody is a recombinant protein that contains
the variable domains including the complementarity determining
regions (CDRs) of an antibody derived from one species, preferably
a rodent antibody, while the constant domains of the antibody
molecule is derived from those of a human antibody. For veterinary
applications, the constant domains of the chimeric antibody may be
derived from that of other species, such as a cat or dog.
[0036] A humanized antibody is a recombinant protein in which the
CDRs from an antibody from one species; e.g., a rodent antibody, is
transferred from the heavy and light variable chains of the rodent
antibody into human heavy and light variable domains. The constant
domains of the antibody molecule is derived from those of a human
antibody.
[0037] A human antibody is an antibody obtained from transgenic
mice that have been "engineered" to produce specific human
antibodies in response to antigenic challenge. In this technique,
elements of the human heavy and light chain locus are introduced
into strains of mice derived from embryonic stem cell lines that
contain targeted disruptions of the endogenous heavy chain and
light chain loci. The transgenic mice can synthesize human
antibodies specific for human antigens, and the mice can be used to
produce human antibody-secreting hybridomas. Methods for obtaining
human antibodies from transgenic mice are described by Green et
al., Nature Genet. 7:13 (1994), Lonberg et al., Nature 368:856
(1994), and Taylor et al., Int. Immun. 6:579 (1994). A fully human
antibody also can be constructed by genetic or chromosomal
transfection methods, as well as phage display technology, all of
which are known in the art. See for example, McCafferty et al.,
Nature 348:552-553 (1990) for the production of human antibodies
and fragments thereof in vitro, from immunoglobulin variable domain
gene repertoires from unimmunized donors. In this technique,
antibody variable domain genes are cloned in-frame into either a
major or minor coat protein gene of a filamentous bacteriophage,
and displayed as functional antibody fragments on the surface of
the phage particle. Because the filamentous particle contains a
single-stranded DNA copy of the phage genome, selections based on
the functional properties of the antibody also result in selection
of the gene encoding the antibody exhibiting those properties. In
this way, the phage mimics some of the properties of the B cell.
Phage display can be performed in a variety of formats, for their
review, see e.g. Johnson and Chiswell, Current Opinion in
Structural Biology 3:5564-571 (1993).
[0038] Human antibodies may also be generated by in vitro activated
B cells. See U.S. Pat. Nos. 5,567,610 and 5,229,275, which are
incorporated in their entirety by reference.
[0039] A therapeutic agent is a molecule or atom which is
administered separately, concurrently or sequentially with an
antibody moiety or conjugated to an antibody moiety, i.e., antibody
or antibody fragment, or a subfragment, and is useful in the
treatment of a disease. Examples of therapeutic agents include
antibodies, antibody fragments, drugs, toxins, enzymes, nucleases,
hormones, immunomodulators, antisense oligonucleotides, chelators,
boron compounds, photoactive agents or dyes and radioisotopes.
[0040] A diagnostic agent is a molecule or atom which is
administered conjugated to an antibody moiety, i.e., antibody or
antibody fragment, or subfragment, and is useful in diagnosing a
disease by locating the cells containing the antigen. Useful
diagnostic agents include, but are not limited to, radioisotopes,
dyes (such as with the biotin-streptavidin complex), contrast
agents, fluorescent compounds or molecules and enhancing agents
(e.g., paramagnetic ions) for magnetic resonance imaging (MRI).
U.S. Pat. No. 6,331,175 describes MRI technique and the preparation
of antibodies conjugated to a MRI enhancing agent and is
incorporated in its entirety by reference. Preferably, the
diagnostic agents are selected from the group consisting of
radioisotopes, enhancing agents for use in magnetic resonance
imaging, and fluorescent compounds. In order to load an antibody
component with radioactive metals or paramagnetic ions, it may be
necessary to react it with a reagent having a long tail to which
are attached a multiplicity of chelating groups for binding the
ions. Such a tail can be a polymer such as a polylysine,
polysaccharide, or other derivatized or derivatizable chain having
pendant groups to which can be bound chelating groups such as,
e.g., ethylenediaminetetraacetic acid (EDTA),
diethylenetriaminepentaacetic acid (DTPA), porphyrins, polyamines,
crown ethers, bis-thiosemicarbazones, polyoximes, and like groups
known to be useful for this purpose. Chelates are coupled to the
peptide antigens using standard chemistries. The chelate is
normally linked to the antibody by a group which enables formation
of a bond to the molecule with minimal loss of immunoreactivity and
minimal aggregation and/or internal cross-linking. Other, more
unusual, methods and reagents for conjugating chelates to
antibodies are disclosed in U.S. Pat. No. 4,824,659 to Hawthorne,
entitled "Antibody Conjugates", issued Apr. 25, 1989, the
disclosure of which is incorporated herein in its entirety by
reference. Particularly useful metal-chelate combinations include
2-benzyl-DTPA and its monomethyl and cyclohexyl analogs, used with
diagnostic isotopes in the general energy range of 60 to 4,000 keV,
such as .sup.125I, .sup.131I, .sup.123I, .sup.124I, .sup.62CU,
.sup.64CU, .sup.18F, .sup.111In, .sup.67Ga, .sup.99mTc, .sup.94mTc,
.sup.11C, .sup.13N, .sup.15O, .sup.76Br, for radio-imaging. The
same chelates, when complexed with non-radioactive metals, such as
manganese, iron and gadolinium are useful for MRI, when used along
with the antibodies of the invention. Macrocyclic chelates such as
NOTA, DATA, and TETA are of use with a variety of metals and
radiometals, most particularly with radionuclides of gallium,
yttrium and copper, respectively. Such metal-chelate complexes can
be made very stable by tailoring the ring size to the metal of
interest. Other ring-type chelates such as macrocyclic polyethers,
which are of interest for stably binding nuclides, such as
.sup.223Ra for RAIT are encompassed by the invention.
[0041] An immunoconjugate is a conjugate of an antibody component
with a therapeutic or diagnostic agent. The diagnostic agent can
comprise a radioactive or non-radioactive label, a contrast agent
(such as for magnetic resonance imaging, computed tomography or
ultrasound), and the radioactive label can be a gamma-, beta-,
alpha-, Auger electron-, or positron-emitting isotope.
[0042] An expression vector is a DNA molecule comprising a gene
that is expressed in a host cell. Typically, gene expression is
placed under the control of certain regulatory elements, including
constitutive or inducible promoters, tissue-specific regulatory
elements and enhancers. Such a gene is said to be "operably linked
to" the regulatory elements.
[0043] A recombinant host may be any prokaryotic or eukaryotic cell
that contains either a cloning vector or expression vector. This
term also includes those prokaryotic or eukaryotic cells, such as
bacteria, yeast and mammalian cells, as well as an transgenic
animal, that have been genetically engineered to contain the cloned
gene(s) in the chromosome or genome of the host cell or cells of
the host cells. Suitable mammalian host cells include myeloma
cells, such as SP2/O cells, and NSO cells, as well as Chinese
Hamster Ovary (CHO) cells, hybridoma cell lines and other mammalian
host cell useful for expressing antibodies. Also particularly
useful to express mAbs and other fusion proteins, is a human cell
line, PER.C6 disclosed in WO 0063403 A2, which produces 2 to
200-fold more recombinant protein as compared to conventional
mammalian cell lines, such as CHO, COS, Vero, Hela, BHK and SP2--
cell lines. Special transgenic animals with a modified immune
system are particularly useful for making fully human
antibodies.
[0044] As used herein, the term antibody fusion protein is a
recombinantly produced antigen-binding molecule in which two or
more of the same or different single-chain antibody or antibody
fragment segments with the same or different specificities are
linked. Valency of the fusion protein indicates how many binding
arms or sites the fusion protein has to a single antigen or
epitope; i.e., monovalent, bivalent, trivalent or mutlivalent. The
multivalency of the antibody fusion protein means that it can take
advantage of multiple interactions in binding to an antigen, thus
increasing the avidity of binding to the antigen. Specificity
indicates how many antigens or epitopes an antibody fusion protein
is able to bind; i.e., monospecific, bispecific, trispecific,
multispecific. Using these definitions, a natural antibody, e.g.,
an IgG, is bivalent because it has two binding arms but is
monospecific because it binds to one epitope. Monospecific,
multivalent fusion proteins have more than one binding site for an
epitope but only binds with one epitope, for example a diabody with
two binding site reactive with the same antigen. The fusion protein
may comprise a single antibody component, a multivalent or
multispecific combination of different antibody components or
multiple copies of the same antibody component. The fusion protein
may additionally comprise an antibody or an antibody fragment and a
therapeutic agent. Examples of therapeutic agents suitable for such
fusion proteins include immunomodulators ("antibody-immunomodulator
fusion protein") and toxins ("antibody-toxin fusion protein"). One
preferred toxin comprises a ribonuclease (RNase), preferably a
recombinant RNase.
[0045] A multispecific antibody is an antibody that can bind
simultaneously to at least two targets that are of different
structure, e.g., two different antigens, two different epitopes on
the same antigen, or a hapten and/or an antigen or epitope. One
specificity would be for a B-cell, T-cell, myeloid-, plasma-, and
mast-cell antigen or epitope. Another specificity could be to a
different antigen on the same cell type, such as CD20, CD19, CD21,
CD23, CD46, CD80, HLA-DR, CD74, and CD22 on B-cells. Multispecific,
multivalent antibodies are constructs that have more than one
binding site, and the binding sites are of different specificity.
For example, a diabody, where one binding site reacts with one
antigen and the otherwith another antigen.
[0046] A bispecific antibody is an antibody that can bind
simultaneously to two targets which are of different structure.
Bispecific antibodies (bsAb) and bispecific antibody fragments
(bsFab) have at least one arm that specifically binds to, for
example, a B-cell, T-cell, myeloid-, plasma-, and mast-cell antigen
or epitope and at least one other arm that specifically binds to a
targetable conjugate that bears a therapeutic or diagnostic agent.
A variety of bispecific fusion proteins can be produced using
molecular engineering. In one form, the bispecific fusion protein
is monovalent, consisting of, for example, a scFv with a single
binding site for one antigen and a Fab fragment with a single
binding site for a second antigen. In another form, the bispecific
fusion protein is divalent, consisting of, for example, an IgG with
a binding site for one antigen and two scFv with two binding sites
for a second antigen.
[0047] Caninized or felinized antibodies are recombinant proteins
in which rodent (or another species) complementarity determining
regions of a monoclonal antibody have been transferred from heavy
and light variable chains of rodent (or another species)
immunoglobulin into a dog or cat, respectively, immunoglobulin
variable domain.
[0048] Domestic animals include large animals such as horses,
cattle, sheep, goats, llamas, alpacas, and pigs, as well as
companion animals. In a preferred embodiment, the domestic animal
is a horse.
[0049] Companion animals include animals kept as pets. These are
primarily dogs and cats, although small rodents, such as guinea
pigs, hamsters, rats, and ferrets, are also included, as are
subhuman primates such as monkeys. In a preferred embodiment the
companion animal is a dog or a cat.
[0050] Preparation of Monoclonal Antibodies Including Chimeric,
Humanized and Human Antibodies
[0051] Monoclonal antibodies (MAbs) are a homogeneous population of
antibodies to a particular antigen and the antibody comprises only
one type of antigen binding site and binds to only one epitope on
an antigenic determinant. Rodent monoclonal antibodies to specific
antigens may be obtained by methods known to those skilled in the
art. See, for example, Kohler and Milstein, Nature 256: 495 (1975),
and Coligan et al. (eds.), CURRENT PROTOCOLS IN IMMUNOLOGY, VOL. 1,
pages 2.5.1-2.6.7 (John Wiley & Sons 1991) [hereinafter
"Coligan"]. Briefly, monoclonal antibodies can be obtained by
injecting mice with a composition comprising an antigen, verifying
the presence of antibody production by removing a serum sample,
removing the spleen to obtain B-lymphocytes, fusing the
B-lymphocytes with myeloma cells to produce hybridomas, cloning the
hybridomas, selecting positive clones which produce antibodies to
the antigen, culturing the clones that produce antibodies to the
antigen, and isolating the antibodies from the hybridoma
cultures.
[0052] MAbs can be isolated and purified from hybridoma cultures by
a variety of well-established techniques. Such isolation techniques
include affinity chromatography with Protein-A Sepharose,
size-exclusion chromatography, and ion-exchange chromatography.
See, for example, Coligan at pages 2.7.1-2.7.12 and pages
2.9.1-2.9.3. Also, see Baines et al., "Purification of
Immunoglobulin G (IgG)," in METHODS IN MOLECULAR BIOLOGY, VOL. 10,
pages 79-104 (The Humana Press, Inc. 1992).
[0053] After the initial raising of antibodies to the immunogen,
the antibodies can be sequenced and subsequently prepared by
recombinant techniques. Humanization and chimerization of murine
antibodies and antibody fragments are well known to those skilled
in the art. For example, humanized monoclonal antibodies are
produced by transferring mouse complementary determining regions
from heavy and light variable chains of the mouse immunoglobulin
into a human variable domain, and then, substituting human residues
in the framework regions of the murine counterparts. The use of
antibody components derived from humanized monoclonal antibodies
obviates potential problems associated with the immunogenicity of
murine constant regions.
[0054] General techniques for cloning murine immunoglobulin
variable domains are described, for example, by the publication of
Orlandi et al., Proc. Nat'l Acad. Sci. USA 86: 3833 (1989), which
is incorporated by reference in its entirety. Techniques for
constructing chimeric antibodies are well known to those of skill
in the art. As an example, Leung et al., Hybridoma 13:469 (1994),
describe how they produced an LL2 chimera by combining DNA
sequences encoding the VK and VH domains of LL2 monoclonal
antibody, an anti-CD22 antibody, with respective human kappa and
IgG.sub.1 constant region domains. This publication also provides
the nucleotide sequences of the LL2 light and heavy chain variable
regions, VK and VH, respectively. Techniques for producing
humanized MAbs are described, for example, by Jones et al., Nature
321: 522 (1986), Riechmann et al., Nature 332: 323 (1988),
Verhoeyen et al., Science 239: 1534 (1988), Carter et al., Proc.
Nat'l Acad. Sci. USA 89: 4285 (1992), Sandhu, Crit. Rev. Biotech.
12: 437 (1992), and Singer et al., J. Immun. 150: 2844 (1993), each
of which is hereby incorporated by reference.
[0055] To this end, the present invention describes chimeric,
humanized and human antibodies and fragments thereof that bind the
CD74 antigen and can be used for diagnostic and therapeutic
methods. Humanized antibodies and antibody fragments are described
in Provisional U.S. Application titled "Anti-CD20 Antibodies And
Fusion Proteins Thereof And Methods Of Use", Attorney Docket No.
18733/1073, U.S. Provisional No. 60/356,132, U.S. Provisional
Application No. 60/416,232 and Attorney Docket No. 18733/1155;
hMN-14 antibodies, such as those disclosed in U.S. Application No.
5,874,540, which is a Class III anti-carcinoembryonic antigen
antibody (anti-CEA antibody); Mu-9 antibodies, such as those
described in U.S. application Ser. No. 10/116,116; AFP antibodies,
such as those described in U.S. Provisional Application No.
60/399,707; PAM4 antibodies, such as those described in Provisional
U.S. Application titled "Monoclonal Antibody cPAM4", Attorney
Docket No. 18733/1102; RS7 antibodies, such as those described in
U.S. Provisional Application No. 60/360,229; and CD22 antibodies,
such as those disclosed in U.S. Pat. Nos. 5,789,554 and 6,187,287
and U.S. application Ser. Nos. 09/741,843 and 09/988,013, all of
which are incorporated herein by reference in their entirety.
[0056] A chimeric antibody is a recombinant protein that contains
the variable domains including the CDRs derived from one species of
animal, such as a rodent antibody, while the remainder of the
antibody molecule; i.e., the constant domains, is derived from a
human antibody. Accordingly, a chimeric monoclonal antibody can
also be humanized by replacing the sequences of the murine FR in
the variable domains of the chimeric mAb with one or more different
human FR. Specifically, mouse CDRs are transferred from heavy and
light variable chains of the mouse immunoglobulin into the
corresponding variable domains of a human antibody. As simply
transferring mouse CDRs into human FRs often results in a reduction
or even loss of antibody affinity, additional modification might be
required in order to restore the original affinity of the murine
antibody. This can be accomplished by the replacement of one or
more some human residues in the FR regions with their murine
counterparts to obtain an antibody that possesses good binding
affinity to its epitope. See, for example, Tempest et al.,
Biotechnology 9:266 (1991) and Verhoeyen et al., Science 239:1534
(1988). Further, the affinity of humanized, chimeric and human MAbs
to a specific epitope can be increased by mutagenesis of the CDRs,
so that a lower dose of antibody may be as effective as a higher
dose of a lower affinity MAb prior to mutagenesis. See for example,
WO 0029584A 1.
[0057] Another method for producing the antibodies of the present
invention is by production in the milk of transgenic livestock.
See, e.g., Colman, A., Biochem. Soc. Symp., 63: 141-147, 1998; U.S.
Pat. No. 5,827,690, both of which are incorporated in their
entirety by reference. Two DNA constructs are prepared which
contain, respectively, DNA segments encoding paired immunoglobulin
heavy and light chains. The DNA segments are cloned into expression
vectors which contain a promoter sequence that is preferentially
expressed in mammary epithelial cells. Examples include, but are
not limited to, promoters from rabbit, cow and sheep casein genes,
the cow .alpha.-lactoglobulin gene, the sheep .beta.-lactoglobulin
gene and the mouse whey acid protein gene. Preferably, the inserted
fragment is flanked on its 3' side by cognate genomic sequences
from a mammary-specific gene. This provides a polyadenylation site
and transcript-stabilizing sequences. The expression cassettes are
coinjected into the pronuclei of fertilized, mammalian eggs, which
are then implanted into the uterus of a recipient female and
allowed to gestate. After birth, the progeny are screened for the
presence of both transgenes by Southern analysis. In order for the
antibody to be present, both heavy and light chain genes must be
expressed concurrently in the same cell. Milk from transgenic
females is analyzed for the presence and functionality of the
antibody or antibody fragment using standard immunological methods
known in the art. The antibody can be purified from the milk using
standard methods known in the art.
[0058] A fully human antibody of the present invention, i.e., human
anti-CD74 MAbs or other human antibodies, such as anti-CD22,
anti-CD19, anti-CD23, anti-CD20 or anti-CD21 MAbs for combination
therapy with humanized, chimeric or human anti-CD74 antibodies, can
be obtained from a transgenic non-human animal. See, e.g., Mendez
et al., Nature Genetics, 15: 146-156 (1997); U.S. Pat. No.
5,633,425, which are incorporated in their entirety by reference.
For example, a human antibody can be recovered from a transgenic
mouse possessing human immunoglobulin loci. The mouse humoral
immune system is humanized by inactivating the endogenous
immunoglobulin genes and introducing human immunoglobulin loci. The
human immunoglobulin loci are exceedingly complex and comprise a
large number of discrete segments which together occupy almost 0.2%
of the human genome. To ensure that transgenic mice are capable of
producing adequate repertoires of antibodies, large portions of
human heavy- and light-chain loci must be introduced into the mouse
genome. This is accomplished in a stepwise process beginning with
the formation of yeast artificial chromosomes (YACs) containing
either human heavy- or light-chain immunoglobulin loci in germline
configuration. Since each insert is approximately 1 Mb in size, YAC
construction requires homologous recombination of overlapping
fragments of the immunoglobulin loci. The two YACs, one containing
the heavy-chain loci and one containing the light-chain loci, are
introduced separately into mice via fusion of YAC-containing yeast
spheroblasts with mouse embryonic stem cells. Embryonic stem cell
clones are then microinjected into mouse blastocysts. Resulting
chimeric males are screened for their ability to transmit the YAC
through their germline and are bred with mice deficient in murine
antibody production. Breeding the two transgenic strains, one
containing the human heavy-chain loci and the other containing the
human light-chain loci, creates progeny which produce human
antibodies in response to immunization.
[0059] Further recent methods for producing bispecific mAbs include
engineered recombinant mAbs which have additional cysteine residues
so that they crosslink more strongly than the more common
immunoglobulin isotypes. See, e.g., FitzGerald et al., Protein Eng.
10 (10): 1221-1225, 1997. Another approach is to engineer
recombinant fusion proteins linking two or more different
single-chain antibody or antibody fragment segments with the needed
dual specificities. See, e.g., Coloma et al., Nature Biotech.
15:159-163, 1997. A variety of bispecific fusion proteins can be
produced using molecular engineering. In one form, the bispecific
fusion protein is monovalent, consisting of, for example, a scFv
with a single binding site for one antigen and a Fab fragment with
a single binding site for a second antigen. In another form, the
bispecific fusion protein is divalent, consisting of, for example,
an IgG with two binding sites for one antigen and two scFv with two
binding sites for a second antigen.
[0060] Bispecific fusion proteins linking two or more different
single-chain antibodies or antibody fragments are produced in
similar manner. Recombinant methods can be used to produce a
variety of fusion proteins. For example, a fusion protein
comprising a Fab fragment derived from a humanized monoclonal
anti-CD74 antibody and a scFv derived from a murine anti-diDTPA can
be produced. A flexible linker, such as GGGS (SEQ ID NO:15)
connects the scFv to the constant region of the heavy chain of the
anti-CD74 antibody. Alternatively, the scFv can be connected to the
constant region of the light chain of another humanized antibody.
Appropriate linker sequences necessary for the in-frame connection
of the heavy chain Fd to the scFv are introduced into the VX and
Vic domains through PCR reactions. The DNA fragment encoding the
scFv is then ligated into a staging vector containing a DNA
sequence encoding the CH1 domain. The resulting scFvCH1 construct
is excised and ligated into a vector containing a DNA sequence
encoding the VH region of an anti-CD74 antibody. The resulting
vector can be used to transfect an appropriate host cell, such as a
mammalian cell for the expression of the bispecific fusion
protein.
[0061] Production of Antibody Fragments
[0062] Antibody fragments which recognize specific epitopes can be
generated by known techniques. The antibody fragments are antigen
binding portions of an antibody, such as F(ab').sub.2, Fab', Fab,
Fv, sFv and the like. Other antibody fragments include, but are not
limited to: the F(ab').sub.2 fragments which can be produced by
pepsin digestion of the antibody molecule and the Fab' fragments,
which can be generated by reducing disulfide bridges of the
F(ab').sub.2 fragments. Alternatively, Fab' expression libraries
can be constructed (Huse et al., 1989, Science, 246: 1274-1281) to
allow rapid and easy identification of monoclonal Fab' fragments
with the desired specificity. The present invention encompasses
antibodies and antibody fragments.
[0063] A single chain Fv molecule (scFv) comprises a VL domain and
a VH domain. The VL and VH domains associate to form a target
binding site. These two domains are further covalently linked by a
peptide linker (L). A scFv molecule is denoted as either VL-L-VH if
the VL domain is the N-terminal part of the scFv molecule, or as
VH-L-VL if the VH domain is the N-terminal part of the scFv
molecule. Methods for making scFv molecules and designing suitable
peptide linkers are described in U.S. Pat. No. 4,704,692, U.S. Pat.
No. 4,946,778, R. Raag and M. Whitlow, "Single Chain Fvs." FASEB
Vol 9:73-80 (1995) and R. E. Bird and B. W. Walker, "Single Chain
Antibody Variable Regions," TIBTECH, Vol 9: 132-137 (1991). These
references are incorporated herein by reference.
[0064] An antibody fragment can be prepared by proteolytic
hydrolysis of the full-length antibody or by expression in E. coli
or another host of the DNA coding for the fragment. An antibody
fragment can be obtained by pepsin or papain digestion of full
length antibodies by conventional methods. For example, an antibody
fragment can be produced by enzymatic cleavage of antibodies with
pepsin to provide a 5S fragment denoted F(ab').sub.2. This fragment
can be further cleaved using a thiol reducing agent, and optionally
a blocking group for the sulfhydryl groups resulting from cleavage
of disulfide linkages, to produce 3.5S Fab' monovalent fragments.
Alternatively, an enzymatic cleavage using papain produces two
monovalent Fab fragments and an Fc fragment directly. These methods
are described, for example, by Goldenberg, U.S. Pat. Nos. 4,036,945
and 4,331,647 and references contained therein, which patents are
incorporated herein in their entireties by reference. Also, see
Nisonoff et al., Arch Biochem. Biophys. 89:230 (1960); Porter,
Biochem. J. 73: 119 (1959), Edelman et al., in METHODS IN
ENZYMOLOGY VOL. 1, page 422 (Academic Press 1967), and Coligan at
pages 2.8.1-2.8.10 and 2.10.-2.10.4.
[0065] Another form of an antibody fragment is a peptide coding for
a single complementarity-determining region (CDR). A CDR is a
segment of the variable region of an antibody that is complementary
in structure to the epitope to which the antibody binds and is more
variable than the rest of the variable region. Accordingly, a CDR
is sometimes referred to as hypervariable region. A variable region
comprises three CDRs. CDR peptides can be obtained by constructing
genes encoding the CDR of an antibody of interest. Such genes are
prepared, for example, by using the polymerase chain reaction to
synthesize the variable region from RNA of antibody-producing
cells. See, for example, Larrick et al., Methods: A Companion to
Methods in Enzymology 2: 106 (1991); Courtenay-Luck, "Genetic
Manipulation of Monoclonal Antibodies," in MONOCLONAL ANTIBODIES:
PRODUCTION, ENGINEERING AND CLINICAL APPLICATION, Ritter et al.
(eds.), pages 166-179 (Cambridge University Press 1995); and Ward
et al., "Genetic Manipulation and Expression of Antibodies," in
MONOCLONAL ANTIBODIES: PRINCIPLES AND APPLICATIONS, Birch et al.,
(eds.), pages 137-185 (Wiley-Liss, Inc. 1995).
[0066] Other methods of cleaving antibodies, such as separation of
heavy chains to form monovalent light-heavy chain fragments,
further cleavage of fragments, or other enzymatic, chemical or
genetic techniques may also be used, so long as the fragments bind
to the antigen that is recognized by the intact antibody.
[0067] Anti-CD74 Antibodies
[0068] The anti-CD74 mAbs of the present invention contain specific
murine CDRs that have specificity for the CD74 antigen. The
anti-CD74 mAbs of the present invention are humanized, chimeric or
human mAbs and they contain the amino acids of the CDRs of a murine
anti-CD74 mAb, the murine LL1 mAb. The humanized anti-CD74
monoclonal antibody (mAb) or fragment thereof comprise CDRs of a
light chain variable region of a murine anti-CD74 mAb, that
comprises CDR1 comprising an amino acid sequence RSSQSLVHRNGNTYLH
(SEQ ID NO:16), CDR2 comprising an amino acid sequence TVSNRFS (SEQ
ID NO:17), and CDR3 comprising an amino acid sequence SQSSHVPPT
(SEQ ID NO:18). Further, the humanized anti-CD74 monoclonal
antibody or fragment thereof comprises the heavy chain variable
region of said humanized mAb that comprises CDRs of a heavy chain
variable region of a murine anti-CD74 mAb, that comprises CDR1
comprising an amino acid sequence NYGVN (SEQ ID NO:19), CDR2
comprising an amino acid sequence WINPNTGEPTFDDDFKG (SEQ ID NO:20),
and CDR3 comprising an amino acid sequence SRGKNEAWFAY (SEQ ID
NO:21). Further, the humanized mAb retains substantially the
specificity for the CD74, i.e., the MHC class-II invariant chain,
Ii, present on the surface of cells, such as B-lymphocytes,
monocyte and histiocytes, as well as B-cell lymphoma and leukemia,
as well as myeloma cells resulting in the rapid internalization and
catabolization of these mAbs, fragments thereof or mAb
conjugates.
[0069] In one embodiment, a CD74 antibodies of the present
invention is a humanized anti-CD74 monoclonal antibody (mAb) or
fragment thereof comprising light and heavy chain variable regions
comprising complementarity-determining regions (CDRs) of murine
anti-CD74 (mLL1) and the framework (FR) regions of a human
antibody, wherein the light chain variable region of the humanized
mAb comprises CDRs of a light chain variable region of a murine
anti-CD74 mAb, that comprises CDR1 comprising an amino acid
sequence RSSQSLVHRNGNTYLH (SEQ ID NO:16), CDR2 comprising an amino
acid sequence TVSNRFS (SE ID NO:17), and CDR3 comprising an amino
acid sequence SQSSHVPPT (SEQ ID NO:18), and wherein the heavy chain
variable region of the humanized mAb comprises CDRs of a heavy
chain variable region of a murine anti-CD74 mAb, that comprises
CDR1 comprising an amino acid sequence NYGVN (SEQ ID NO:19), CDR2
comprising an amino acid sequence WINPNTGEPTFDDDFKG (SEQ ID NO:20),
and CDR3 comprising an amino acid sequence SRGKNEAWFAY (SEQ ID
NO:21). The murine CDRs of the heavy and light chain variable
regions are shown in FIGS. 1A and 1B, respectively. The human FRs
of the light and heavy chain variable regions may be modified to
maintain specificity to CD74 by substituting at least one amino
acid substituted from the corresponding FRs of the murine mAb. More
specifically, one or more specific amino acids from the murine mAb
identified by amino acid residue 2, 3, 4, 46, 87 and 100 of the
murine light chain variable region of the cLL1Vk sequence of FIG.
3B, and amino acid residues 5, 37, 38, 46, 68, 91 and 93 of the
murine heavy chain variable region of the cLL1VH sequence of FIG.
3A may be maintained in the human FRs of the humanized anti-CD74 to
maintain specificity.
[0070] In a preferred embodiment, the humanized anti-CD74 mAb, the
humanized LL1 (hLL1) or fragment thereof containing a heavy chain
variable region of FIG. 4A and a light chain variable region of
FIG. 4B is used in the methods disclosed in the present invention.
More specifically, the humanized anti-CD74 mAb or fragment thereof
contains a light and heavy chain constant region of a human
antibody or a portion thereof. Additionally, the humanized
anti-CD74 mAb or fragment thereof of anyone of the humanized
anti-CD74 mAbs or fragments thereof, described herein, can be a
humanized IgG1.
[0071] Although humanized anti-CD74 mAbs are preferred, chimeric
anti-CD74 (cCD74) mAbs or fragments thereof also are encompassed by
the present invention. In one embodiment, the chimeric anti-CD74
monoclonal antibody, (mAb) or fragment thereof comprises a light
chain variable region of a murine anti-CD74 mAb, that comprises
CDR1 comprising an amino acid sequence RSSQSLVHRNGNTYLH (SEQ ID
NO:16), CDR2 comprising an amino acid sequence TVSNRFS (SEQ ID
NO:17), and CDR3 comprising an amino acid sequence SQSSHVPPT (SEQ
ID NO:18). In a further embodiment, the chimeric anti-CD74
monoclonal antibody or fragment thereof comprises a heavy chain
variable region of a murine anti-CD74 mAb, that comprises CDR1
comprising an amino acid sequence NYGVN (SEQ ID NO:19), CDR2
comprising an amino acid sequence WINPNTGEPTFDDDFKG (SEQ ID NO:20),
and CDR3 comprising an amino acid sequence SRGKNEAWFAY (SEQ ID
NO:21). In a further embodiment the chimeric anti-CD74 mAb
comprises light and heavy chain variable regions comprising
complementarity-determining regions (CDRs) of a murine anti-CD74
mAb and the framework (FR) regions of a murine anti-CD74 mAb and
the light and heavy chain constant regions of a human antibody,
wherein the light chain variable region of the chimeric mAb
comprises CDRs of a light chain variable region of a murine
antiCD74 mAb, that comprises CDR1 comprising an amino acid sequence
RSSQSLVHRNGNTYLH (SEQ ID NO:16), CDR2 comprising an amino acid
sequence TVSNRFS (SEQ ID NO:17), and CDR3 comprising an amino acid
sequence SQSSHVPPT (SEQ ID NO:18), and wherein the heavy chain
variable region of said chimeric mAb comprises CDRs of a heavy
chain variable region of a murine anti-CD74 mAb, that comprises
CDR1 comprising an amino acid sequence NYGVN (SEQ ID NO:19), CDR2
comprising an amino acid sequence WINPNTGEPTFDDDFKG (SEQ ID NO:20),
and CDR3 comprising an amino acid sequence SRGKNEAWFAY (SEQ ID
NO:21). The preferred chimeric anti-CD74 mAb or fragment thereof
comprises a heavy chain variable region of FIG. 2A and a light
chain variable region of FIG. 2B.
[0072] Also encompassed within the present invention is a human
anti-CD74 monoclonal antibody (mAb) or fragment thereof comprising
a light chain variable region of the human anti-CD74 mAb that
comprises CDR1 comprising an amino acid sequence RSSQSLVHRNGNTYLH
(SEQ ID NO:16), CDR2 comprising an amino acid sequence TVSNRFS (SEQ
ID NO:17), and CDR3 comprising an amino acid sequence SQSSHVPPT
(SEQ ID NO:18). Further, encompasses is a human anti-CD74
monoclonal antibody (mAb) or fragment thereof comprising a heavy
chain variable region of said human mAb that comprises CDRs of a
heavy chain variable region of a murine anti-CD74 mAb, that
comprises CDR1 comprising an amino acid sequence NYGVN (SEQ ID
NO:19), CDR2 comprising an amino acid sequence WINPNTGEPTFDDDFKG
(SEQ ID NO:20), and CDR3 comprising an amino acid sequence
SRGKNEAWFAY (SEQ ID NO:21). More preferably, the present invention
discloses a human anti-CD74 (huCD74) monoclonal antibody (mAb) or
fragment thereof comprising the light and heavy chain variable and
constant regions of a human antibody, wherein the huCD74 CDRs of
the light chain variable region of the human anti-CD74 mAb
comprises CDR1 comprising an amino acid sequence RSSQSLVHRNGNTYLH
(SEQ ID NO:16), CDR2 comprising an amino acid sequence TVSNRFS (SEQ
ID NO:17), and CDR3 comprising an amino acid sequence SQSSHVPPT
(SEQ ID NO:18), and wherein the heavy chain variable region of the
human mAb comprises CDRs of a heavy chain variable region of a
murine anti-CD74 mAb, that comprises CDR1 comprising an amino acid
sequence NYGVN (SEQ ID NO:19), CDR2 comprising an amino acid
sequence WINPNTGEPTFDDDFKG (SEQ ID NO:20), and CDR3 comprising an
amino acid sequence SRGKNEAWFAY (SEQ ID NO:21).
[0073] Each of the human, chimeric or humanized anti-CD74 mAb of
the present invention is preferably an IgG1, where the constant
regions are preferably a human IgG1, but the IgG1 may be referred
to as a human IgG1, a chimeric IgG1 or a humanized IgG1,
respectively. In particular, the humanized CD74 mAb, hLL1, has
constant domains and the hinge region from a human IgG1.
Preferably, both the chimeric and the human LL1 mAb has the same
constant domain and hinge region. However, modifications can be
made so that the constant regions of the IgG1 are replaced with
human constant regions of human IgG2a, IgG3 or IgG4.
[0074] The present invention also is directed to a murine anti-CD74
monoclonal antibody or fragment thereof, comprising CDRs of a light
chain variable region of a murine anti-CD74 mAb, that comprises
CDR1 comprising an amino acid sequence RSSQSLVHRNGNTYLH (SEQ ID
NO:16), CDR2 comprising an amino acid sequence TVSNRFS (SEQ ID
NO:17), and CDR3 comprising an amino acid sequence SQSSHVPPT (SEQ
ID NO:18). Further, the murine antiCD74 monoclonal antibody or
fragment thereof, comprising CDRs of a heavy chain variable region
of a murine anti-CD74 mAb, that comprises CDR1 comprising an amino
acid sequence NYGVN (SEQ ID NO:19), CDR2 comprising an amino acid
sequence WINPNTGEPTFDDDFKG (SEQ ID NO:20), and CDR3 comprising an
amino acid sequence SRGKNEAWFAY (SEQ ID NO:21). More preferably,
the murine anti-CD74 monoclonal antibody or fragment thereof
comprising complementarity-determining regions (CDRs) of murine
anti-CD74 (mLL1) and the framework (FR) regions of a murine
anti-CD74 antibody, wherein the light chain variable region of said
murine mAb comprises CDR1 comprising an amino acid sequence
RSSQSLVHRNGNTYLH (SEQ ID NO:16), CDR2 comprising an amino acid
sequence TVSNRFS (SEQ ID NO:17), and CDR3 comprising an amino acid
sequence SQSSHVPPT (SEQ ID NO:18), and wherein the heavy chain
variable region of said murine mAb comprises CDR1 comprising an
amino acid sequence NYGVN (SEQ ID NO:19), CDR2 comprising an amino
acid sequence WINPNTGEPTFDDDFKG (SEQ ID NO:20), and CDR3 comprising
an amino acid sequence SRGKNEAWFAY (SEQ ID NO:21).
[0075] Each of the human, chimeric, humanized or murine anti-CD74
mAbs or fragment thereof of the present invention possess at least
one of the following properties: it binds specifically and is
reactive with the antigen, CD74, its binding to CD74 is blocked by
an antibody or fragment thereof specific for or reactive with CD74;
it is internalized by Raji lymphoma cells in culture; and it
induces apoptosis of Raji cells in cell culture when cross-linked
with goat antisera reactive with the Fc of a murine IgG1 mAb.
[0076] The fragments of the human, chimeric or humanized anti-CD74
mAb may be a fragment, such is F(ab').sub.2, Fab, scFv, Fv, or a
fusion construct utilizing part or all the light and heavy chains
of the F(ab').sub.2, Fab, scFv, or Fv. It is important that the
fragment binds to CD74.
[0077] Multispecific and Multivalent Antibodies
[0078] The anti-CD74 antibodies, as well as other antibodies with
different specificities for use in combination therapy, described
herein, can also be made as multispecific antibodies (comprising at
least one binding site to a CD74 epitope or antigen and at least
one binding site to another epitope on CD74 or another antigen) and
multivalent antibodies (comprising multiple binding sites to the
same epitope or antigen), or the antibodies can be both multivalent
and multispecific.
[0079] A preferred antibody fusion protein of the present invention
contains four or more Fvs, or Fab' s of the humanized, chimeric,
human or murine anti-CD74 mAbs or fragments thereof described
herein. Additionally, another preferred antibody fusion protein
contains one or more Fvs, or Fab' s of the mAbs or fragments
thereof of the humanized, chimeric, human or murine anti-CD74 mAbs
or fragments thereof described herein, and one or more Fvs or Fab'
s from antibodies specific for another antigen that is specific for
a tumor cell marker that is not a CD74 antigen, that is expressed
by the CD74-expressing cells, such as, for example, a tumor marker
selected from a B-cell lineage antigen, such as CD19, CD20, or CD22
for the treatment of B-cell malignancies; as well as other CD74
positive cells causing other types of malignancies, such as S100 in
melanoma, etc. Further, the tumor cell marker may be a non-B-cell
lineage antigen selected from the group consisting of HLA-DR, CD30,
CD33, CD52 MUC1 and TAC.
[0080] The present invention also provides a bispecific or
multispecific antibody, wherein the anti-CD74 mAbs or fragments
thereof or antibody fusion proteins thereof of the present
invention are linked to an antibody or antibody fragment specific
for a cancer marker substance, an epitope on the surface of a
infectious disease organism, or a noxious substance in the blood or
other body fluids. The bispecific and multispecific antibodies of
the present invention are particularly useful in the method of
inducing clearance of a variety of noxious substances, where the
bispecific antibody has at least one specificity for a noxious
substance, such as a pathogenic organism, and at least one
specificity for CD74, the HLA class-II invariant chain (Ii), as
described in detail in U.S. Ser. No. 09/314,135, filed on May 19,
1999, entitled "Therapeutic Using a Bispecific Antibody," which is
herein incorporated in its entirety by reference.
[0081] The present invention further provides a bispecific antibody
or antibody fragment having at least a binding region that
specifically binds a targeted cell marker and at least one other
binding region that specifically binds a targetable conjugate. The
targetable conjugate comprises a carrier portion which comprises or
bears at least one epitope recognized by at least one binding
region of the bispecific antibody or antibody fragment.
[0082] A variety of recombinant methods can be used to produce
bispecific antibodies and antibody fragments as described
above.
[0083] An anti-CD74 multivalent antibody is also contemplated in
the present invention. This multivalent target binding protein is
constructed by association of a first and a second polypeptide. The
first polypeptide comprises a first single chain Fv molecule
covalently linked to a first immunoglobulin-like domain that
preferably is an immunoglobulin light chain variable region domain.
The second polypeptide comprises a second single chain Fv molecule
covalently linked to a second immunoglobulin-like domain that
preferably is an immunoglobulin heavy chain variable region domain.
Each of the first and second single chain Fv molecules forms a
target binding site, and the first and second immunoglobulin-like
domains associate to form a third target binding site.
[0084] A single chain Fv molecule with the VL-L-VH configuration,
wherein L is a linker, may associate with another single chain Fv
molecule with the VH-L-VL configuration to form a bivalent dimer.
In this case, the VL domain of the first scFv and the VH domain of
the second scFv molecule associate to form one target binding site,
while the VH domain of the first scFv and the VL domain of the
second scFv associate to form the other target binding site.
[0085] Another embodiment of the present invention is a CD74
bispecific, trivalent targeting protein comprising two heterologous
polypeptide chains associated non-covalently to form three binding
sites, two of which have affinity for one target and a third which
has affinity for a hapten that can be made and attached to a
carrier for a diagnostic and/or therapeutic agent. Preferably, the
binding protein has two CD20 binding sites and one CD22 binding
site. The bispecific, trivalent targeting agents have two different
scFvs, one scFv contains two V.sub.H domains from one antibody
connected by a short linker to the VL domain of another antibody
and the second scFv contains two VL domains from the first antibody
connected by a short linker to the VH domain of the other antibody.
The methods for generating multivalent, multispecific agents from
VH and VL domains provide that individual chains synthesized from a
DNA plasmid in a host organism are composed entirely of VH domains
(the VH-chain) or entirely of VL domains (the VL-chain) in such a
way that any agent of multivalency and multispecificity can be
produced by non-covalent association of one VH-chain with one
VL-chain. For example, forming a trivalent, trispecific agent, the
VH-chain will consist of the amino acid sequences of three V.sub.H
domains, each from an antibody of different specificity, joined by
peptide linkers of variable lengths, and the VL-chain will consist
of complementary VL domains, joined by peptide linkers similar to
those used for the VH-chain. Since the VH and VL domains of
antibodies associate in an anti-parallel fashion, the preferred
method in this invention has the VL domains in the VL-chain
arranged in the reverse order of the VH domains in the
VH-chain.
[0086] Diabodies, Triabodies and Tetrabodies
[0087] The anti-CD74 antibodies of the present invention can also
be used to prepare functional bispecific single-chain antibodies
(bscAb), also called diabodies, and can be produced in mammalian
cells using recombinant methods. See, e.g., Mack et al., Proc.
Natl. Acad. Sci., 92: 7021-7025, 1995, incorporated. For example,
bscAb are produced by joining two single-chain Fv fragments via a
glycine-serine linker using recombinant methods. The V light-chain
(VL) and V heavy-chain (VH) domains of two antibodies of interest
are isolated using standard PCR methods. The VL and VH cDNA's
obtained from each hybridoma are then joined to form a single-chain
fragment in a two-step fusion PCR. The first PCR step introduces
the (Gly.sub.4-Ser.sub.1).sub.3 linker (SEQ ID NO:22), and the
second step joins the VL and VH amplicons. Each single chain
molecule is then cloned into a bacterial expression vector.
Following amplification, one of the single-chain molecules is
excised and sub-cloned into the other vector, containing the second
single-chain molecule of interest. The resulting bscAb fragment is
subcloned into an eukaryotic expression vector. Functional protein
expression can be obtained by transfecting the vector into Chinese
Hamster Ovary cells. Bispecific fusion proteins are prepared in a
similar manner. Bispecific single-chain antibodies and bispecific
fusion proteins are included within the scope of the present
invention.
[0088] For example, a humanized, chimeric or human anti-CD74
monoclonal antibody can be used to produce antigen specific
diabodies, triabodies, and tetrabodies. The monospecific diabodies,
triabodies, and tetrabodies bind selectively to targeted antigens
and as the number of binding sites on the molecule increases, the
affinity for the target cell increases and a longer residence time
is observed at the desired location. For diabodies, the two chains
comprising the VH polypeptide of the humanized CD74 mAb connected
to the VK polypeptide of the humanized CD74 mAb by a five amino
acid residue linker are utilized. Each chain forms one half of the
humanized CD74 diabody. In the case of triabodies, the three chains
comprising V.sub.H polypeptide of the humanized CD74 MAb connected
to the VK polypeptide of the humanized CD74 MAb by no linker are
utilized. Each chain forms one third of the hCD74 triabody.
[0089] The ultimate use of the bispecific diabodies described
herein is for pretargeting CD74 positive tumors for subsequent
specific delivery of diagnostic or therapeutic agents. These
diabodies bind selectively to targeted antigens allowing for
increased affinity and a longer residence time at the desired
location. Moreover, non-antigen bound diabodies are cleared from
the body quickly and exposure of normal tissues is minimized. The
diagnostic and therapeutic agents can include isotopes, drugs,
toxins, cytokines, hormones, enzymes, oligonucleotides, growth
factors, conjugates, radionuclides, and metals. For example,
gadolinium metal is used for magnetic resonance imaging (MRI).
Examples of radionuclides are .sup.225Ac, .sup.18F, .sup.68Ga,
.sup.67Ga, .sup.90Y, .sup.86Y, .sup.111In, .sup.131I, .sup.125I,
.sup.123I, .sup.99mTc, .sup.94mTc, .sup.186Re, .sup.188Re,
.sup.177Lu, .sup.62Cu, .sup.64Cu, .sup.67Cu, .sup.212Bi,
.sup.213Bi, .sup.32P, .sup.11C, .sup.13N, .sup.15O, .sup.76Br, and
.sup.211At. Other radionuclides are also available as diagnostic
and therapeutic agents, especially those in the energy range of 60
to 4,000 keV for diagnostic agents and in the energy range of
60-700 for the therapeutic agents.
[0090] More recently, a tetravalent tandem diabody (termed tandab)
with dual specificity has also been reported (Cochlovius et al.,
Cancer Research (2000) 60: 4336-4341). The bispecific tandab is a
dimer of two identical polypeptides, each containing four variable
domains of two different antibodies (V.sub.H1, V.sub.L1, V.sub.H2,
V.sub.L2) linked in an orientation to facilitate the formation of
two potential binding sites for each of the two different
specificities upon self-association.
[0091] Conjugated Multivalent and Multispecific Anti-CD74
Antibodies
[0092] In another embodiment of the instant invention is a
conjugated multivalent anti-CD74 antibody. Additional amino acid
residues may be added to either the N- or C-terminus of the first
or the second polypeptide. The additional amino acid residues may
comprise a peptide tag, a signal peptide, a cytokine, an enzyme
(for example, a pro-drug activating enzyme), a hormone, a peptide
toxin, such as pseudomonas extoxin, a peptide drug, a cytotoxic
protein or other functional proteins. As used herein, a functional
protein is a protein that has a biological function.
[0093] In one embodiment, drugs, toxins, radioactive compounds,
enzymes, hormones, cytotoxic proteins, chelates, cytokines and
other functional agents may be conjugated to the multivalent target
binding protein, preferably through covalent attachments to the
side chains of the amino acid residues of the multivalent target
binding protein, for example amine, carboxyl, phenyl, thiol or
hydroxyl groups. Various conventional linkers may be used for this
purpose, for example, diisocyanates, diisothiocyanates,
bis(hydroxysuccinimide) esters, carbodiimides,
maleimide-hydroxysuccinimide esters, glutaraldehyde and the like.
Conjugation of agents to the multivalent protein preferably does
not significantly affect the protein's binding specificity or
affinity to its target. As used herein, a functional agent is an
agent which has a biological function. A preferred functional agent
is a cytotoxic agent.
[0094] In still other embodiments, bispecific antibody-directed
delivery of therapeutics or prodrug polymers to in vivo targets can
be combined with bispecific antibody delivery of radionuclides,
such that combination chemotherapy and radioimmunotherapy is
achieved. Each therapy can be conjugated to the targetable
conjugate and administered simultaneously, or the nuclide can be
given as part of a first targetable conjugate and the drug given in
a later step as part of a second targetable conjugate.
[0095] In another embodiment, cytotoxic agents may be conjugated to
a polymeric carrier, and the polymeric carrier may subsequently be
conjugated to the multivalent target binding protein. For this
method, see Ryser et al., Proc. Natl. Acad. Sci. USA, 75:3867-3870,
1978, U.S. Pat. No. 4,699,784 and U.S. Pat. No. 4,046,722, which
are incorporated herein by reference. Conjugation preferably does
not significantly affect the binding specificity or affinity of the
multivalent binding protein.
[0096] Humanized, Chimeric and Human Antibodies Use for Treatment
and Diagnosis
[0097] Humanized, chimeric and human monoclonal antibodies, i.e.,
anti-CD74 mAbs and other MAbs described herein, in accordance with
this invention are suitable for use in therapeutic methods and
diagnostic methods. Accordingly, the present invention contemplates
the administration of the humanized, chimeric and human antibodies
of the present invention alone as a naked antibody or administered
as a multimodal therapy, temporally according to a dosing regimen,
but not conjugated to, a therapeutic agent. An immunoconjugate is a
conjugate comprising an antibody component comprising at least one
mAb or fragment thereof or antibody fusion protein thereof of the
humanized, chimeric or human CD74 mAbs described in the present
invention that binds to CD74, which is linked to a diagnostic or
therapeutic agent.
[0098] The efficacy of the naked anti-CD74 mAbs can be enhanced by
supplementing naked antibodies with one or more other naked
antibodies, i.e., mAbs to specific antigens, such as CD4, CD5, CD8,
CD14, CD15, CD19, CD21, CD22, CD23, CD25, CD30, CD33, CD37, CD38,
CD40, CD40L, CD46, CD52, CD54, CD8O, CD126, B7, MUC1, 1a, tenascin,
HM1.24, or HLA-DR, preferably mature HLA-DR dimer, with one or more
immunoconjugates of anti-CD74, or antibodies to these recited
antigens, conjugated with therapeutic agents, including drugs,
toxins, immunomodulators, hormones, enzymes, therapeutic
radionuclides, etc., with one or more therapeutic agents, including
drugs, toxins, immunomodulators, hormones, enzymes, therapeutic
radionuclides, etc., administered concurrently or sequentially or
according to a prescribed dosing regimen, with the mAbs. Preferred
B-cell associated antigens include those equivalent to human CD19,
CD20, CD21, CD22, CD23, CD46, CD52, CD74, CD8O, and CD5 antigens.
Preferred T-cell antigens include those equivalent to human CD4,
CD8 and CD25 (the IL-2 receptor) antigens. An equivalent to HLA-DR
antigen can be used in treatment of both B-cell and T-cell
disorders. Particularly preferred B-cell antigens are those
equivalent to human CD19, CD22, CD21, CD23, CD74, CD8O, and HLA-DR
antigens. Particularly preferred T-cell antigens are those
equivalent to human CD4, CD8 and CD25 antigens. CD46 is an antigen
on the surface of cancer cells that block complement-dependent
lysis (CDC). Preferred malignant melanoma associated antigens are
those equivalent to MART-1, TRP-1, TRP-2 and gp100. Further,
preferred multiple myeloma-associated antigens are those equivalent
to MUC1 and CD38.
[0099] Further, the present invention contemplates the
administration of an immunoconjugate for diagnostic and therapeutic
uses in B cell lymphomas and other disease or disorders. An
immunoconjugate, as described herein, is a molecule comprising an
antibody component and a therapeutic or diagnostic agent, including
a peptide that may bear the diagnostic or therapeutic agent. An
immunoconjugate retains the immunoreactivity of the antibody
component, i.e., the antibody moiety has about the same or slightly
reduced ability to bind the cognate antigen after conjugation as
before conjugation.
[0100] A wide variety of diagnostic and therapeutic reagents can be
advantageously conjugated to the antibodies of the invention. The
therapeutic agents recited here are those agents that also are
useful for administration separately with the naked antibody as
described above. Therapeutic agents include, for example,
chemotherapeutic drugs such as vinca alkaloids, anthracyclines,
epidophyllotoxins, taxanes, antimetabolites, alkylating agents,
antibiotics, COX-2 inhibitors, antimitotics, antiangiogenic and
apoptotoic agents, particularly doxorubicin, methotrexate, taxol,
CPT-11, camptothecans, and others from these and other classes of
anticancer agents, and the like. Other useful cancer
chemotherapeutic drugs for the preparation of immunoconjugates and
antibody fusion proteins include nitrogen mustards, alkyl
sulfonates, nitrosoureas, triazenes, folic acid analogs, COX-2
inhibitors, pyrimidine analogs, purine analogs, platinum
coordination complexes, hormones, and the like. Suitable
chemotherapeutic agents are described in REMINGTON'S PHARMACEUTICAL
SCIENCES, 19th Ed. (Mack Publishing Co. 1995), and in GOODMAN AND
GILMAN'S THE PHARMACOLOGICAL BASIS OF THERAPEUTICS, 7th Ed.
(MacMillan Publishing Co. 1985), as well as revised editions of
these publications. Other suitable chemotherapeutic agents, such as
experimental drugs, are known to those of skill in the art.
[0101] Additionally, a chelator such as DTPA, DOTA, TETA, or NOTA
or a suitable peptide, to which a detectable label, such as a
fluorescent molecule, or cytotoxic agent, such as a heavy metal or
radionuclide, can be conjugated. For example, a therapeutically
useful immunoconjugate can be obtained by conjugating a photoactive
agent or dye to an antibody composite. Fluorescent compositions,
such as fluorochrome, and other chromogens, or dyes, such as
porphyrins sensitive to visible light, have been used to detect and
to treat lesions by directing the suitable light to the lesion. In
therapy, this has been termed photoradiation, phototherapy, or
photodynamic therapy (Jori et al. (eds.), PHOTODYNAMIC THERAPY OF
TUMORS AND OTHER DISEASES (Libreria Progetto 1985); van den Bergh,
Chem. Britain 22:430 (1986)). Moreover, monoclonal antibodies have
been coupled with photoactivated dyes for achieving phototherapy.
Mew et al., J. Immunol. 130:1473 (1983); idem., Cancer Res. 45:4380
(1985); Oseroff et. al., Proc. Natl. Acad. Sci. USA 83:8744 (1986);
idem., Photochem. Photobiol. 46:83 (1987); Hasan et al., Prog.
Clin. Biol. Res. 288:471 (1989); Tatsuta et al., Lasers Surg. Med.
9:422 (1989); Pelegrin et al., Cancer 67:2529 (1991). However,
these earlier studies did not include use of endoscopic therapy
applications, especially with the use of antibody fragments or
subfragments. Thus, the present invention contemplates the
therapeutic use of immunoconjugates comprising photoactive agents
or dyes.
[0102] Also contemplated by the present invention is the use of
radioactive and non-radioactive agents as diagnostic agents. A
suitable non-radioactive diagnostic agent is a contrast agent
suitable for magnetic resonance imaging, computed tomography or
ultrasound. Magnetic imaging agents include, for example,
non-radioactive metals, such as manganese, iron and gadolinium,
complexed with metal-chelate combinations that include
2-benzyl-DTPA and its monomethyl and cyclohexyl analogs, when used
along with the antibodies of the invention. See U.S. Ser. No.
09/921,290 filed on Oct. 10, 2001, which is incorporated in its
entirety by reference.
[0103] Furthermore, a radiolabeled antibody or immunoconjugate may
comprise a .sub.7-emitting radioisotope or a positron-emitter
useful for diagnostic imaging. Suitable radioisotopes, particularly
in the energy range of 60 to 4,000 keV, include .sup.131I,
.sup.123I, .sup.124I, .sup.86Y, .sup.62Cu, .sup.64Cu, .sup.111In,
.sup.67Ga, .sup.68Ga, .sup.99mTc, .sup.94mTc, .sup.18F, .sup.11C,
.sup.13N, .sup.15O, .sup.75Br, and the like. See, for example, U.S.
patent application entitled "Labeling Targeting Agents with
Gallium-68"-Inventors G. L. Griffiths and W. J. McBride, (U.S.
Provisional Application No. 60/342,104), which discloses positron
emitters, such as .sup.18F, .sup.68Ga, .sup.94mTc. and the like,
for imaging purposes and which is incorporated in its entirety by
reference.
[0104] A toxin, such as Pseudomonas exotoxin, may also be complexed
to or form the therapeutic agent portion of an antibody fusion
protein of an anti-CD74 antibody of the present invention. Other
toxins suitably employed in the preparation of such conjugates or
other fusion proteins, include ricin, abrin, ribonuclease (RNase),
DNase I, Staphylococcal enterotoxin-A, pokeweed antiviral protein,
gelonin, diphtherin toxin, Pseudomonas exotoxin, and Pseudomonas
endotoxin. See, for example, Pastan et al., Cell 47:641 (1986), and
Goldenberg, Calif.--A Cancer Journal for Clinicians 44:43 (1994).
Additional toxins suitable for use in the present invention are
known to those of skill in the art and are disclosed in U.S. Pat.
No. 6,077,499, which is incorporated in its entirety by
reference.
[0105] An immunomodulator, such as a cytokine may also be
conjugated to, or form the therapeutic agent portion of an antibody
fusion protein or be administered with the humanized anti-CD20
antibodies of the present invention. Suitable cytokines for the
present invention include, but are not limited to, interferons and
interleukins, as described below.
[0106] Also contemplated by the present invention is a vaccine
comprising the humanized, chimeric or human CD74 mAabs or fragments
thereof or an antibody fusion protein thereof covalently linked to
Class-1 or Class-II MHC antigenic peptides forming an antibody
conjugate, wherein the vaccine is used to treat patients with
cancer or infectious disease. When the antibody conjugate is
internalized by the cell containing the CD74 marker, the Class-1 or
Class-II antigenic peptides are released by protolytic digestion
from a larger peptide or protein linked to the Mab or fragment
thereof, by a antigen presenting cell, such as a dendritic cell.
This antibody conjugate is prepared by fusing cDNA coding for the
mAb or fragment thereof with cDNA coding for the antigenic peptide
or protein, and expressing the fusion protein in a bacteria, yeast,
or mammalian cell. Antibody conjugates containing the humanized,
chimeric or human CD74 MAbs or fragments thereof or antibody fusion
proteins of the present invention are particularly useful in a
method of treatment described in pending U.S. Ser. No. 08/577,106,
filed on Dec. 22, 1995, entitled "Use of Immunoconjugates to
Enhance the Efficacy of Multi-Stage Cascade Boosting Vaccines,"
which is herein incorporated in its entirety by reference. The
humanized anti-CD74 MAb of the present invention is particularly
useful in place of the murine LL1 in Example 5.
[0107] Preparation of Immunoconjugates
[0108] Any of the antibodies or antibody fusion proteins of the
present invention can be conjugated with one or more therapeutic or
diagnostic agents. Generally, one therapeutic or diagnostic agent
is attached to each antibody or antibody fragment but more than one
therapeutic agent or diagnostic agent can be attached to the same
antibody or antibody fragment. The antibody fusion proteins of the
present invention comprise two or more antibodies or fragments
thereof and each of the antibodies that comprises this fusion
protein can contain a therapeutic agent or diagnostic agent.
Additionally, one or more of the antibodies of the antibody fusion
protein can have more than one therapeutic of diagnostic agent
attached. Further, the therapeutic agents do not need to be the
same but can be different therapeutic agents. For example, one can
attach a drug and a radioisotope to the same fusion protein.
Particularly, an IgG can be radiolabeled with .sup.131I and
attached to a drug. The .sup.131I can be incorporated into the
tyrosine of the IgG and the drug attached to the epsilon amino
group of the IgG Iysines. Both therapeutic and diagnostic agents
also can be attached to reduced SH groups and to the carbohydrate
side chains.
[0109] Bispecific antibodies of the present invention are useful in
pretargeting methods and provide a preferred way to deliver two
therapeutic agents or two diagnostic agents to a subject. U.S. Ser.
No. 09/382,186 discloses a method of pretargeting using a
bispecific antibody, in which the bispecific antibody is labeled
with .sup.125I and delivered to a subject, followed by a divalent
peptide labeled with .sup.99mTc. The delivery results in excellent
tumor/normal tissue ratios for .sup.125I and .sup.99mTc, thus
showing the utility of two diagnostic radioisotopes. Any
combination of known therapeutic agents or diagnostic agents can be
used to label the antibodies and antibody fusion proteins. The
binding specificity of the antibody component of the mAb conjugate,
the efficacy of the therapeutic agent or diagnostic agent and the
effector activity of the Fc portion of the antibody can be
determined by standard testing of the conjugates.
[0110] A therapeutic or diagnostic agent can be attached at the
hinge region of a reduced antibody component via disulfide bond
formation. As an alternative, such peptides can be attached to the
antibody component using a heterobifunctional cross-linker, such as
N-succinyl 3-(2-pyridyldithio)proprionate (SPDP). Yu et al., Int.
J. Cancer 56: 244 (1994). General techniques for such conjugation
are well-known in the art. See, for example, Wong, CHEMISTRY OF
PROTEIN CONJUGATION AND CROSS-LINKING (CRC Press 1991); Upeslacis
et al., "Modification of Antibodies by Chemical Methods," in
MONOCLONAL ANTIBODIES: PRINCIPLES AND APPLICATIONS, Birch et al.
(eds.), pages 187-230 (Wiley-Liss, Inc. 1995); Price, "Production
and Characterization of Synthetic Peptide-Derived Antibodies," in
MONOCLONAL ANTIBODIES: PRODUCTION, ENGINEERING AND CLINICAL
APPLICATION, Ritter et al. (eds.), pages 60-84 (Cambridge
University Press 1995). Alternatively, the therapeutic or
diagnostic agent can be conjugated via a carbohydrate moiety in the
Fc region of the antibody. The carbohydrate group can be used to
increase the loading of the same peptide that is bound to a thiol
group, or the carbohydrate moiety can be used to bind a different
peptide.
[0111] Methods for conjugating peptides to antibody components via
an antibody carbohydrate moiety are well-known to those of skill in
the art. See, for example, Shih et al., Int. J. Cancer 41: 832
(1988); Shih et al., Int. J. Cancer 46: 1101 (1990); and Shih et
al., U.S. Pat. No. 5,057,313, all of which are incorporated in
their entirety by reference. The general method involves reacting
an antibody component having an oxidized carbohydrate portion with
a carrier polymer that has at least one free amine function and
that is loaded with a plurality of peptide. This reaction results
in an initial Schiff base (imine) linkage, which can be stabilized
by reduction to a secondary amine to form the final conjugate.
[0112] The Fc region is absent if the antibody used as the antibody
component of the immunoconjugate is an antibody fragment. However,
it is possible to introduce a carbohydrate moiety into the light
chain variable region of a full-length antibody or antibody
fragment. See, for example, Leung et al., J. Immunol. 154: 5919
(1995); Hansen et al., U.S. Pat. No. 5,443,953 (1995), Leung et
al., U.S. Pat. No. 6,254,868, all of which are incorporated in
their entirety by reference. The engineered carbohydrate moiety is
used to attach the therapeutic or diagnostic agent.
[0113] Pharmaceutically Acceptable Excipients
[0114] The humanized, chimeric and human anti-CD74 mAbs to be
delivered to a subject can consist of the mAb alone,
immunoconjugate, fusion protein, or can comprise one or more
pharmaceutically suitable excipients, one or more additional
ingredients, or some combination of these.
[0115] The immunoconjugate or naked antibody of the present
invention can be formulated according to known methods to prepare
pharmaceutically useful compositions, whereby the immunoconjugate
or naked antibody are combined in a mixture with a pharmaceutically
suitable excipient. Sterile phosphate-buffered saline is one
example of a pharmaceutically suitable excipient. Other suitable
excipients are well-known to those in the art. See, for example,
Ansel et al., PHARMACEUTICAL DOSAGE FORMS AND DRUG DELIVERY
SYSTEMS, 5th Edition (Lea & Febiger 1990), and Gennaro (ed.),
REMINGTON'S PHARMACEUTICAL SCIENCES, 18th Edition (Mack Publishing
Company 1990), and revised editions thereof.
[0116] The immunoconjugate or naked antibody of the present
invention can be formulated for intravenous administration via, for
example, bolus injection or continuous infusion. Formulations for
injection can be presented in unit dosage form, e.g., in ampules or
in multi-dose containers, with an added preservative. The
compositions can take such forms as suspensions, solutions or
emulsions in oily or aqueous vehicles, and can contain formulatory
agents such as suspending, stabilizing and/or dispersing agents.
Alternatively, the active ingredient can be in powder form for
constitution with a suitable vehicle, e.g., sterile pyrogen-free
water, before use.
[0117] Additional pharmaceutical methods may be employed to control
the. duration of action of the therapeutic or diagnostic conjugate
or naked antibody. Control release preparations can be prepared
through the use of polymers to complex or absorb the
immunoconjugate or naked antibody. For example, biocompatible
polymers include matrices of poly(ethylene-co-vinyl acetate) and
matrices of a polyanhydride copolymer of a stearic acid dimer and
sebacic acid. Sherwood et al., Bio/Technology 10: 1446 (1992). The
rate of release of an immunoconjugate or antibody from such a
matrix depends upon the molecular weight of the immunoconjugate or
antibody, the amount of immunoconjugate, antibody within the
matrix, and the size of dispersed particles. Saltzman et al.,
Biophys. J. 55: 163 (1989); Sherwood et al., supra. Other solid
dosage forms are described in Ansel et al., PHARMACEUTICAL DOSAGE
FORMS AND DRUG DELIVERY SYSTEMS, 5th Edition (Lea & Febiger
1990), and Gennaro (ed.), REMINGTON'S PHARMACEUTICAL SCIENCES, 18th
Edition (Mack Publishing Company 1990), and revised editions
thereof.
[0118] The immunoconjugate, antibody fusion proteins, or naked
antibody may also be administered to a mammal subcutaneously or
even by other parenteral routes. Moreover, the administration may
be by continuous infusion or by single or multiple boluses. In
general, the dosage of an administered immunoconjugate, fusion
protein or naked antibody for humans will vary depending upon such
factors as the patient's age, weight, height, sex, general medical
condition and previous medical history. Typically, it is desirable
to provide the recipient with a dosage of immunoconjugate, antibody
fusion protein or naked antibody that is in the range of from about
1 mg/kg to 20 mg/kg as a single intravenous infusion, although a
lower or higher dosage also may be administered as circumstances
dictate. This dosage may be repeated as needed, for example, once
per week for 4-10 weeks, preferably once per week for 8 weeks, and
more preferably, once per week for 4 weeks. It may also be given
less frequently, such as every other week for several months. The
dosage may be given through various parenteral routes, with
appropriate adjustment of the dose and schedule.
[0119] For purposes of therapy, the immunoconjugate, fusion
protein, or naked antibody is administered to a mammal in a
therapeutically effective amount. A suitable subject for the
present invention is usually a human, although a nonhuman animal
subject is also contemplated. An antibody preparation is said to be
administered in a "therapeutically effective amount" if the amount
administered is physiologically significant. An agent is
physiologically significant if its presence results in a detectable
change in the physiology of a recipient mammal. In particular, an
antibody preparation of the present invention is physiologically
significant if its presence invokes an antitumor response or
mitigates the signs and symptoms of an autoimmune disease state. A
physiologically significant effect could also be the evocation of a
humoral and/or cellular immune response in the recipient
mammal.
[0120] Methods of Treatment
[0121] The present invention contemplates the use of naked
anti-CD74 antibodies of the present invention as the primary
composition for treatment of a CD74 expressing malignancy, where
the disease or disorder is selected from the group consisting of an
immune dysregulation disease, an autoimmune disease, organ graft
rejection, and graft versus host disease. The CD74 expressing
malignancy is selected from the group consisting of a solid tumor,
non-Hodgkin's lymphoma, Hodgkin's lymphoma, multiple myeloma,
another B-cell malignancy and a T-cell malignancy. The solid tumor
is selected from the group consisting of a melanoma, carcinoma and
sarcoma and the carcinoma is selected from the group consisting of
a renal carcinoma, lung carcinoma, intestinal carcinoma, stomach
carcinoma and melanoma. The B-cell malignany is selected from the
group consisting of non-Hodgkins lymphoma, Hodkgin's lymphoma,
indolent forms of B-cell lymphomas, aggressive forms of B-cell
lymphomas, chronic lymphatic leukemias, acute lymphatic leukemias,
and multiple myeloma, B-cell disorders and other diseases. In
particular, the compositions described herein are particularly
useful for treatment of various autoimmune as well as indolent
forms of B-cell lymphomas, aggressive forms of B-cell lymphomas,
chronic lymphatic leukemias, acute lymphatic leukemias, multiple
myeloma, and Waldenstrom's macroglobulinemia. For example, the
humanized anti-CD74 antibody components and immuno conjugates can
be used to treat both indolent and aggressive forms of
non-Hodgkin's lymphoma.
[0122] More specifically, the invention contemplates a method for
treating a B-cell malignancy comprising administering to a subject
with a B-cell related malignancy, a therapeutic composition
comprising a pharmaceutically acceptable carrier and at least one
humanized, chimeric, or human anti-CD74 mAb or fragment thereof or
antibody fusion protein thereof of the present invention, wherein
the B-cell malignancy is lymphoma or leukemia. More specifically,
the B-cell malignancy is non-Hodgkin's lymphoma, indolent forms of
B-cell lymphomas, aggressive forms of B-cell lymphomas, multiple
myeloma, chronic lymphatic leukemias, or acute lymphatic leukemias.
The CD74 mAb or fragment thereof is administered intravenously or
intramuscularly at a dose of 20-2000 mg. The present method further
comprises administering the anti-CD74 mAb or fragment thereof
before, during or after the administration of at least one
therapeutic agent used to treat the B-cell malignancy. The
therapeutic agent comprises a naked antibody, an immunomodulator, a
hormone, a cytotoxic agent, an enzyme, an antibody conjugated to at
least one immunomodulator, radioactive label, hormone, enzyme, or
cytotoxic agent, or a combination thereof. The immunomodulator
preferably is a cytokine and said cytotoxic agent is a drug or
toxin. The antibody that is administered in combination as a naked
antibody or as a supplemental immunoconjugate is reactive with CD4,
CD5, CD8, CD14, CD15, CD19, CD20, CD21, CD22, CD23, CD25, CD30,
CD33, CD37, CD38, CD40, CD40L, CD46, CD52, CD54, CD80, CD126, B7,
MUC1, Ia, HM1.24, tenascin, and HLA-DR, preferably a mature HLA-DR
dimer, formulated in a pharmaceutically acceptable vehicle.
[0123] The invention also contemplates treating a malignancy
comprising administering to a subject with a CD74 antigen-positive
malignancy other than lymphoma or leukemia, a therapeutic
composition comprising a pharmaceutically acceptable carrier and at
least one anti-CD74 mAb or fragment thereof or an antibody fusion
protein thereof as disclosed in the present invention. The
anti-CD74 mAb or fragment thereof or an antibody fusion protein
thereof is administered intravenously or intramuscularly at a dose
of 20-2000 mg. Further, the anti-CD74 mAb or fragment thereof or an
antibody fusion protein thereof is administered before, during or
after the administration of at least one therapeutic agent used to
treat the malignancy. The therapeutic agent, as described above and
throughout the specification, comprises an antibody, an
immunomodulator, a hormone, a cytotoxic agent, an antibody
conjugated to at least one immunomodulator, radioactive label,
enzyme, hormone, cytotoxic agent, antisense oligonucleotide, or a
combination thereof, where the immunomodulator is a cytokine and
said cytotoxic agent is a drug or toxin. When an antibody is
administered in combination with the anti-CD74 mAb or fragment
thereof to treat a malignancy that is not a B-cell malignancy, it
should be reactive with a tumor marker other than CD74, expressed
by the cells that comprise the malignancy that is treated,
formulated in a pharmaceutically acceptable vehicle. Examples of
antibodies that can be administered for malignant melanoma
associated antigens are those antibodies reactive with MART-1,
TRP-1, TRP-2 and gp100. Further, preferred antibodies to multiple
myeloma-associated antigens are those reactive with MUC1 and
CD38.
[0124] The compositions for treatment contain at least one
humanized, chimeric or human monoclonal anti-CD74 antibody alone or
in combination with other antibodies, such as other humanized,
chimeric, or human antibodies, therapeutic agents or
immunomodulators. In particular, combination therapy with a fully
human antibody is also contemplated and is produced by the methods
as set forth above.
[0125] Naked or conjugated antibodies to the same or different
epitope or antigen may also be combined with one or more of the
antibodies of the present invention. For example, a humanized,
chimeric or human naked anti-CD74 antibody may be combined with
another naked humanized, naked chimeric or naked human anti-CD74
mAb; a humanized, chimeric or human naked anti-CD74 antibody may be
combined with an anti-CD74 immunoconjugate; a naked anti-CD74
antibody may be combined with an anti-CD22 radioconjugate; or an
anti-CD22 naked antibody may be combined with a humanized, chimeric
or human anti-CD74 antibody conjugated to an isotope, or one or
more chemotherapeutic agents, cytokines, enzymes, toxins or a
combination thereof. A fusion protein of a humanized, chimeric or
human CD20 antibody and a toxin or immunomodulator, or a fusion
protein of at least two different B-cell antibodies (e.g., a CD74
and a CD22 mAb, a CD20 mAb or a CD19 mAb) may also be used in this
invention. Reference is made to pending U.S. Ser. No. 09/965,796
filed on Oct. 1, 2001, entitled "Immunotherapy of B-Cell
Malignancies Using Anti-CD-22 Antibodies," which is a continuation
of U.S. Pat. No. 6,306,393, both of which are incorporated in their
entirety by reference, that discloses treatment with an anti-CD22
antibodies in combination with other naked antibodies. Many
different antibody combinations, targeting at least two different
antigens associated with B-cell disorders, as listed already above,
may be constructed, either as naked antibodies or as partly naked
and partly conjugated with a therapeutic agent or immunomodulator,
or merely in combination with another therapeutic agents, such as a
cytotoxic drug or with radiation.
[0126] As used herein, the term "immunomodulator" includes
cytokines, stem cell growth factors, lymphotoxins, such as tumor
necrosis factor (TNF), and hematopoietic factors, such as
interleukins (e.g., interleukin-1 (IL-1), IL-2, IL-3, IL-6, IL-10,
IL-12, IL-18, and IL-21), colony stimulating factors (e.g.,
granulocytecolony stimulating factor (G-CSF) and granulocyte
macrophage-colony stimulating factor (GM-CSF)), interferons (e.g.,
interferons-.alpha., -.beta. and -.gamma.), the stem cell growth
factor designated "Si factor," erythropoietin, thrombopoietin or a
combination thereof. Examples of suitable immunomodulator moieties
include IL-1, IL-2, IL-3, IL-6, IL-10, IL-12, IL-18, IL-21, and a
combination thereof; and interferon-.gamma., TNF-.alpha., and the
like. Alternatively, subjects can receive naked anti-CD74
antibodies and a separately administered cytokine, which can be
administered before, concurrently or after administration of the
naked anti-CD74 antibodies. As discussed supra, the anti-CD74
antibody may also be conjugated to the immunomodulator. The
immunomodulator may also be conjugated to a hybrid antibody
consisting of one or more antibodies binding to different
antigens.
[0127] Multimodal therapies of the present invention further
include immunotherapy with naked anti-CD74 antibodies supplemented
with administration of anti-CD22, anti-CD19, anti-CD21, anti-CD20,
anti-CD80, anti-CD23, anti-CD46 or HLA-DR, preferably the mature
HLA-DR dimer antibodies in the form of naked antibodies, fusion
proteins, or as immunoconjugates. These antibodies include
polyclonal, monoclonal, chimeric, human or humanized antibodies
that recognize at least one epitope on these antigenic
determinants. Anti-CD19 and anti-CD22 antibodies are known to those
of skill in the art. See, for example, Ghetie et al., Cancer Res.
48:2610 (1988); Heiman et al., Cancer Immunol. Immunother. 32:364
(1991); Longo, Curro Opin. Oncol. 8:353 (1996) and U.S. Pat. Nos.
5,798,554 and 6,187,287, incorporated in their entirety by
reference.
[0128] In another form of multimodal therapy, subjects receive
naked anti-CD74 antibodies, and/or immunoconjugates, in conjunction
with standard cancer chemotherapy. For example, "CVB" (1.5
g/m.sup.2 cyclophosphamide, 200-400 mg/m.sup.2 etoposide, and
150-200 mg/m.sup.2 carmustine) is a regimen used to treat
non-Hodgkin's lymphoma. Patti et al., Eur. J. Haematol. 51: 18
(1993). Other suitable combination chemotherapeutic regimens are
well-known to those of skill in the art. See, for example, Freedman
et al., "Non-Hodgkin's Lymphomas," in CANCER MEDICINE, VOLUME 2,
3rd Edition, Holland et al. (eds.), pages 2028-2068 (Lea &
Febiger 1993). As an illustration, first generation
chemotherapeutic regimens for treatment of intermediate-grade
non-Hodgkin's lymphoma (NHL) include C-MOPP (cyclophosphamide,
vincristine, procarbazine and prednisone) and CHOP
(cyclophosphamide, doxorubicin, vincristine, and prednisone). A
useful second generation chemotherapeutic regimen is m-BACOD
(methotrexate, bleomycin, doxorubicin, cyclophosphamide,
vincristine, dexamethasone and leucovorin), while a suitable third
generation regimen is MACOP-B (methotrexate, doxorubicin,
cyclophosphamide, vincristine, prednisone, bleomycin and
leucovorin). Additional useful drugs include phenyl butyrate and
brostatin-1. In a preferred multimodal therapy, both
chemotherapeutic drugs and cytokines are co-administered with an
antibody, immunoconjugate or fusion protein according to the
present invention. The cytokines, chemotherapeutic drugs and
antibody or immunoconjugate can be administered in any order, or
together.
[0129] In a preferred embodiment, NHL is treated with 4 weekly
infusions of the humanized anti-CD74 antibody at a dose of 200-400
mg/m.sup.2 weekly for 4 consecutive weeks or every-other week (iv
over 2-8 hours), repeated as needed over next months/yrs. Also
preferred, NHL is treated with 4 semi-monthly infusions as above,
but combined with epratuzumAb (anti-CD22 humanized antibody) on the
same days, at a dose of 360 mg/m.sup.2, given as an iv infusion
over 1 hour, either before, during or after the anti-CD74
monoclonal antibody infusion. Still preferred, NHL is treated with
4 weekly infusions of the anti-CD74 antibody as above, combined
with one or more injections of CD22 mAb radiolabeled with a
therapeutic isotope such as yttrium-90 (at dose of Y.sup.90 between
5 and 35 mCi/meter-square as one or more injections over a period
of weeks or months.
[0130] In addition, a therapeutic composition of the present
invention can contain a mixture or hybrid molecules of monoclonal
naked anti-CD74 antibodies directed to different, non-blocking CD74
epitopes. Accordingly, the present invention contemplates
therapeutic compositions comprising a mixture of monoclonal
anti-CD74 antibodies that bind at least two CD74 epitopes.
Additionally, the therapeutic composition described herein may
contain a mixture of anti-CD74 antibodies with varying CDR
sequences.
[0131] Although naked anti-CD74 antibodies are the primary
therapeutic compositions for treatment of B cell lymphoma and
autoimmune diseases, the efficacy of such antibody therapy can be
enhanced by supplementing the naked antibodies, with supplemental
agents, such as immunomodulators, like interferons, including
IFN.alpha., IFN.beta. and IFN.gamma., interleukins including IL-1,
IL-2, IL-3, IL-6, IL-10, IL12, IL-15, IL-18, IL-21, and a
combination thereof, and cytokines including G-CSF and GM-CSF.
Accordingly, the CD74 antibodies can be combined not only with
antibodies and cytokines, either as mixtures (given separately or
in some predetermined dosing regiment) or as conjugates or fusion
proteins to the anti-CD74 antibody, but also can be given as a
combination with drugs or with antisense olignucleotides. For
example, the anti-CD74 antibody may be combined with CHOP as a
4-drug chemotherapy regimen. Additionally, a naked anti-CD74
antibody may be combined with a naked anti-CD22 antibodies and CHOP
or Fludarabine as a drug combination for NHL therapy. The
supplemental therapeutic compositions can be administered before,
concurrently or after administration of the anti-CD74 antibodies.
The naked anti-CD74 mAb may also be combined with an antisense bcl
oligonucleotide.
[0132] As discussed supra, the antibodies of the present invention
can be used for treating B cell lymphoma and leukemia, and other B
cell diseases or disorders as well as other malignancies in which
affected or associated malignant cells are reactive with CD74. For
example, anti-CD74 antibodies can be used to treat immune
dysregulation disease and related autoimmune diseases, including
Class-III autoimmune diseases such as immune-mediated
thrombocytopenias, such as acute idiopathic thrombocytopenic
purpura and chronic idiopathic thrombocytopenic purpura,
dermatomyositis, Sjogren's syndrome, multiple sclerosis, Sydenham's
chorea, myasthenia gravis, systemic lupus erythematosus, lupus
nephritis, rheumatic fever, polyglandular syndromes, bullous
pemphigoid, diabetes mellitus, Henoch-Schonlein purpura,
post-streptococcal nephritis, erythema nodosum, Takayasu's
arteritis, Addison's disease, rheumatoid arthritis, sarcoidosis,
ulcerative colitis, erythema multiforme, IgA nephropathy,
polyarteritis nodosa, ankylosing spondylitis, Goodpasture's
syndrome, thromboangitis ubiterans, primary biliary cirrhosis,
Hashimoto's thyroiditis, thyrotoxicosis, scleroderma, chronic
active hepatitis, polymyositis/dermatomyositis, polychondritis,
pamphigus vulgaris, Wegener's granulomatosis, membranous
nephropathy, amyotrophic lateral sclerosis, tabes dorsalis, giant
cell arteritis/polymyalgia, pernicious anemia, rapidly progressive
glomerulonephritis and fibrosing alveolitis.
[0133] Particularly, the humanized, chimeric or human anti-CD74
mAbs or fragments thereof or antibody fusion proteins thereof of
the present invention are administered to a subject with one or
more of these autoimmune diseases. The anti-CD74 antibodies of the
present invention are particularly useful in the method of treating
autoimmune disorders, disclosed in pending U.S. Ser. No. 09/590,284
filed on Jun. 9, 2000 entitled "Immunotherapy of Autoimmune
Disorders using Antibodies that Target B-Cells," which is
incorporated in its entirety by reference. Preferably the anti-CD74
mAb or fragment thereof or an antibody fusion protein thereof is
administered intravenously or intramuscularly at a dose of 20-2000
mg. Further, the anti-CD74 mAb or fragment thereof or an antibody
fusion protein thereof is administered before, during or after the
administration of at least one therapeutic agent used to treat the
disorder. The therapeutic agent, as described above and throughout
the specification, comprises an antibody, an immunomodulator, a
hormone, an enzyme, a cytotoxic agent, an antibody conjugated to at
least one immunomodulator, radioactive label, hormone, enzyme, or
cytotoxic agent, antisense oligonucleotide or a combination
thereof, where the immunomodulator is a cytokine and said cytotoxic
agent is a drug or toxin. The antibody that is administered in
combination as a naked antibody or as a supplemental
immunoconjugate is reactive with CD4, CD5, CD8, CD14, CD15, CD19,
CD20, CD21, CD22, CD23, CD25, CD30, CD33, CD37, CD38, CD40, CD40L,
CD46, CD52, CD54, CD80, CD126, B7, MUC1, Ia, HM1.24, tenascin, and
mature HLA-DR, preferably a mature HLA-DR dimer, formulated in a
pharmaceutically acceptable vehicle.
[0134] A further method for treating one of the diseases selected
from the group consisting of lymphoma, leukemia, myeloma, other
CD74-expressing malignancies, immune dysregulation disease,
autoimmune disease and a combination thereof, comprising
administering a therapeutic composition comprising a
pharmaceutically acceptable carrier and at least one anti-CD74 mAb
or fragment thereof or an antibody fusion protein thereof of the
present invention, wherein at least one therapeutic agent is linked
to the mAb or fragment thereof or the Fvs or Fab' s of the antibody
fusion protein thereof by chemical conjugation or by genetic
fusion. The therapeutic agent may be an immunomodulator, a
radioactive label, a hormone, an enzyme, or a cytotoxic agent, and
the immunomodulator is a cytokine and said cytotoxic agent is a
drug or toxin.
[0135] Anti-CD74 antibodies may also induce apoptosis in cells
expressing the CD74 antigen. Evidence of this induction is
supported in the examples of the present invention. Other
antibodies have demonstrated that apoptosis could be induced using
lymphoid cells that have Fc-receptors reactive with the IgG 1-Fc of
CD20 MAbs that crosslinked. See Shan et al., Cancer Immunol.
Immunother. 48(12):673-683 (2000). Further, it was reported that
aggregates of a chimeric CD20 MAb, i.e., homopolymers, induced
apoptosis. See Ghetie et al., Blood 97(5): 1392-1398 (2000) and
Ghetie et al., Proc. Natl. Acad. Sci. USA 94(14): 7509-7514
(1997).
[0136] Antibodies specific to the CD74 surface antigen of B cells
can be injected into a mammalian subject, which then bind to the
CD74 cell surface antigen of both normal and malignant B cells. A
mammalian subject includes humans and domestic animals, including
pets, such as dogs and cats. The anti-CD74 mAbs of the present
invention, i.e., humanized, chimeric, human, caninized and
felinized, and even murine anti-CD74 mAbs, can be used to treat the
nonhuman mammalian subjects when there is a species cross
reactivity for the CD74 antigen. The murine mAbs, which are
immunogenic in humans, are usually less immunogenic in non-human
mammalian subjects. The anti-CD74 antibody bound to the CD74
surface antigen leads to the destruction and depletion of
neoplastic B cells.
[0137] Method of Diagnosis
[0138] Also provided for in the present invention is a method of
diagnosing a disease in a subject, diagnosed with or suspected of
having at least one of the diseases selected from the groups
consisting of lymphoma, leukemia, myeloma, other CD74-expressing
malignancies, immune dysregulation disease, autoimmune disease and
a combination thereof, comprising administering to said subject a
diagnostically effective amount of a diagnostic conjugate a
pharmaceutically acceptable carrier and at least one anti-CD74 mAb
or fragment thereof or antibody fusion protein thereof, wherein a
diagnostic agent is linked to the mAb or fragment thereof or the
Fvs or Fabs of the antibody fusion protein thereof by chemical
conjugation and detecting the diagnostic agent. Diagnostic agents
useful in the present invention are a radioisotope, wherein the
photons of the radioisotope are detected by radioscintigrapy or
PET, or a metal that can be detected by MRI, or a liposome or gas
filled liposome, and wherein the liposome can be detected by an
ultrasound scanning device.
[0139] The internalization of murine anti-CD74 mAb, chimeric
anti-CD74 mAb and humanized anti-CD74 mAb into target cells can be
followed by fluorescence labeling, essentially according to the
procedure of Pirker et al., J. Clin. Invest., 76:1261 (1985), which
is incorporated by reference. Cultured Raji cells are centrifuged
and the cells resuspended in fresh medium to a concentration of
about 5.times.10.sup.6 cells/ml. To each well of a 96-well
microtiter plate, 100 .mu.l of the cell suspension is added. The
antibodies, 40 .mu.g/ml, in a volume of 100 .mu.l are added to the
reaction wells at timed intervals so as to terminate all reactions
simultaneously. The plate is incubated at 37.degree. C. in a
CO.sub.2 cell culture incubator. Unbound antibodies are removed by
washing the cells three times with cold 1% FCS/PBS at the end of
the incubation. The cells are then treated with 1 ml of
Formaid-Fresh [10% formalin solution (Fisher, Fair Lawn, N.J.)] for
15 min at 4.degree. C. After washing, antibodies present either on
the cell surface or inside the cells are detected by treatment with
FITC-labeled goat anti-mouse antibody (Tago, Burlingame, Calif.),
or FITC-labeled goat anti-human antibody (Jackson ImmunoResearch,
West Grove, Pa.), depending on whether the antibody being assayed
for is murine, chimeric, or humanized, respectively. Fluorescence
distributions are evaluated using a BH-2 fluorescence microscope
(Olympus, Lake Success, N.Y.).
[0140] In a related vein, a method for screening/diagnosing bone
cancers is described in Juweid et al., 1999, could benefit from the
superior anti-CD74 mAbs of the present invention. Accordingly, a
method comprising .sup.99mTc-labeled humanized or chimeric
anti-CD74 mAb is contemplated.
[0141] Expression Vectors
[0142] The DNA sequence encoding a humanized, chimeric or human
anti-CD74 mAb. More specifically the DNA sequence comprises a
nucleic acid encoding a mAb or fragment thereof selected from the
group consisting (a) an anti-CD74 mAb or fragment described herein,
(b) an immunoconjugate comprising anyone of the anti-CD74 mAbs or
fragment thereof described herein, (c) an antibody fusion protein
or fragment thereof comprising at least two of said anti-CD74 mAbs
or fragments thereof described herein; (d) an antibody fusion
protein or fragment described herein; (e) a vaccine as described
herein; and a bispecific or multispecifc antibody described herein.
Any of the DNA sequences of the present invention can be
recombinantly engineered into a variety of known host vectors that
provide for replication of the nucleic acid. These vectors can be
designed, using known methods, to contain the elements necessary
for directing transcription, translation, or both, of the nucleic
acid in a cell to which it is delivered. Known methodology can be
used to generate expression constructs the have a protein-coding
sequence operably linked with appropriate
transcriptional/translational control signals. These methods
include in vitro recombinant DNA techniques and synthetic
techniques. For example, see Sambrook et al., 1989) MOLECULAR
CLONING: A LABORATORY MANUAL, Cold Spring Harbor Laboratory (New
York); Ausubel et al., 1997, CURRENT PROTOCOLS 1N MOLECULAR
BIOLOGY, John Wiley & Sons (New York). Also provided for in
this invention is the delivery of a polynucleotide not associated
with a vector.
[0143] Vectors suitable for use in the instant invention can be
viral or non-viral. Particular examples of viral vectors include
adenovirus, AA V, herpes simplex virus, lentivirus, and retrovirus
vectors. An example of a non-viral vector is a plasmid. In a
preferred embodiment, the vector is a plasmid.
[0144] An expression vector, as described herein, is a
polynucleotide comprising a gene that is expressed in a host cell.
Typically, gene expression is placed under the control of certain
regulatory elements, including constitutive or inducible promoters,
tissue-specific regulatory elements, and enhancers. Such a gene is
said to be "operably linked to" the regulatory elements. Preferred
expression vectors are the pdHI2 and GS vector.
[0145] Preferably, the expression vector of the instant invention
comprises the DNA sequence encoding a humanized, chimeric or human
anti-CD74 mAb, which includes both the heavy and the light chain
variable and constant regions. However, two expression vectors may
be used, with one comprising the heavy chain variable and constant
regions and the other comprising the light chain variable and
constant regions. Still preferred, the expression vector further
comprises a promoter. Because any strong promoter can be used, a
DNA sequence encoding a secretion signal peptide, a genomic
sequence encoding a human IgG1 heavy chain constant region, an Ig
enhancer element and at least one DNA sequence encoding a selection
marker.
[0146] The method for the expression of an anti-CD74 mAb or
fragment thereof or antibody fusion protein or fragment thereof
employing the present invention comprises: (a) transfecting a host
cell with a DNA sequence encoding an anti-CD74 mAb or fragment
thereof or an immunoconjugate, fusion protein or bispecific or
multispecific antibody thereof; and (b) culturing the cell
secreting the antiCD74 mAb or fragment thereof or antibody fusion
protein or fragment thereof. The host cell is derived from
bacterial, yeast or mammalian cells. More preferably from a
mammalian cells, which in one embodiment is a lymphocyctic cell,
such as a myeloma cell.
[0147] Also contemplated herein is a method for expressing a
humanized anti-CD74 mAb, comprising (i) linearizing at least one
expression vector comprising a DNA sequence encoding a humanized,
chimeric, or human anti-CD74 mAb, (ii) transfecting mammalian cells
with at least one of said linearized vector, (iii) selecting
transfected cells which express a marker gene, and (iv) identifying
the cells secreting the humanized anti-CD74 mAb from the
transfected cells.
[0148] The inventors have isolated cDNAs encoding the VL and VH
regions of the murine anti-CD74 monoclonal antibody (mLL1 mAb) and
recombinantly subcloned them into mammalian expression vectors
containing the genes encoding kappa and IgG1 constant regions,
respectively, of human antibodies. Cotransfection of mammalian
cells with these two recombinant DNAs expressed a chimeric antiCD74
mAb (cLL1) that, like the parent mLL1 mAb, bound avidly to, and was
rapidly internalized by, B-lymphoma cells.
[0149] The CDRs of the VK and VH DNAs have been similarly
recombinantly linked to the framework (FR) sequences of the human
VK and VH regions, respectively, which are subsequently linked,
respectively, to the human kappa and IgG1 constant regions, so as
to express in mammalian cells as described above a humanized
anti-CD74 mAb (hLL1).
[0150] Other methods of cleaving antibodies, such as separation of
heavy chains to form monovalent light-heavy chain fragments,
further cleavage of fragments, or other enzymatic, chemical or
genetic techniques may also be used, so long as the fragments bind
to the antigen that is recognized by the intact antibody.
[0151] The antibody described herein is a monoclonal antibody
(mAb). Monoclonal antibodies are a homogeneous population of
antibodies to a particular antigen and the antibody comprises only
one type of antigen binding site to which the nucleic acid
specifically binds. Rodent monoclonal antibodies to specific
antigens may be obtained by methods known to those skilled in the
art. See, for example, Kohler and Milstein, Nature 256: 495 (1975),
and Coligan et al. (eds.), CURRENT PROTOCOLS IN IMMUNOLOGY, VOL. 1,
pages 2.5.1-2.6.7 (John Wiley & Sons 1991) [hereinafter
"Coligan"]. Briefly, monoclonal antibodies can be obtained by
injecting mice with a composition comprising an antigen, verifying
the presence of antibody production by removing a serum sample,
removing the spleen to obtain B-lymphocytes, fusing the
B-lymphocytes with myeloma cells to produce hybridomas, cloning the
hybridomas, selecting positive clones which produce antibodies to
the antigen, culturing the clones that produce antibodies to the
antigen, and isolating the antibodies from the hybridoma
cultures.
[0152] MAbs can be isolated and purified from hybridoma cultures by
a variety of well-established techniques. Such isolation techniques
include affinity chromatography with Protein-A Sepharose,
size-exclusion chromatography, and ion-exchange chromatography.
See, for example, Coligan at pages 2.7.1-2.7.12 and pages
2.9.1-2.9.3. Also, see Baines et al., "Purification of
Immunoglobulin G (IgG)," in METHODS IN MOLECULAR BIOLOGY, VOL 10,
pages 79-104 (The Humana Press, Inc. 1992).
[0153] Method of Making
[0154] The VK and VH sequences for chimeric or humanized anti-CD74
mAb can amplified by PCR as described by Orlandi et al., (Proc.
Natl. Acad. Sci., USA, 86: 3833 (1989)) which is incorporated by
reference. VK sequences may be amplified using the primers CK3BH
and VK5-3 (Leung et al., BioTechniques, 15: 286 (1993), which is
incorporated by reference), while VH sequences can be amplified
using the primer CH1B which anneals to the CH1 region of murine
IgG, and VHIBACK (Orlandi et al., 1989 above). The PCR reaction
mixtures containing 10 .mu.l of the first strand cDNA product, 9
.mu.l of 10.times.PCR buffer [500 mM KCl, 100 mM Tris-HCl (pH 8.3),
15 mM MgCl2, and 0.01% (w/v) gelatin] (Perkin Elmer Cetus, Norwalk,
Conn.), can be subjected to 30 cycles of PCR. Each PCR cycle
preferably consists of denaturation at 94.degree. C. for 1 min,
annealing at 50.degree. C. for 1.5 min, and polymerization at
72.degree. C. for 1.5 min. Amplified VK and VH fragments can be
purified on 2% agarose (BioRad, Richmond, Calif.). See Example 3
for a method for the synthesis of an oligo A (149-mer) and an oligo
B (140-mer) on an automated Cyclone Plus DNA synthesizer
(Milligan-Biosearch) for use in constructing humanized V genes.
[0155] PCR products for VK can be subcloned into a staging vector,
such as a pBR327-based staging vector VKpBR that contains an Ig
promoter, a signal peptide sequence and convenient restriction
sites to facilitate in-frame ligation of the VK PCR products. PCR
products for VH can be subcloned into a similar staging vector,
such as the pBluescript-based VHpBS. Individual clones containing
the respective PCR products may be sequenced by, for example, the
method of Sanger et al., Proc. Natl. Acad. Sci., USA, 74: 5463
(1977) which is incorporated by reference.
[0156] The DNA sequences described herein are to be taken as
including all alleles, mutants and variants thereof, whether
occurring naturally or induced.
[0157] The two plasmids can be co-transfected into an appropriate
cell, e.g., myeloma Sp2/0-Ag 14, colonies selected for hygromycin
resistance, and supernatant fluids monitored for production of
chimeric or humanized anti-CD74 mAbs by, for example, an ELISA
assay, as described below.
[0158] Transfection, and assay for antibody secreting clones by
ELISA, can be carried out as follows. About 10 .mu.g of hLL1 pKh
(light chain expression vector) and 20 .mu.g of hLL1pG1g (heavy
chain expression vector) can be used for the transfection of
5.times.10.sup.6 SP2/0 myeloma cells by electroporation (BioRad,
Richmond, Calif.) according to Co et al., J. Immunol., 148: 1149
(1992) which is incorporated by reference. Following transfection,
celis may be grown in 96-well microtiter plates in complete HSFM
medium (GIBCO, Gaithersburg, Md.) at 37.degree. C., 5% CO.sub.2.
The selection process can be initiated after two days by the
addition of hygromycin selection medium (Calbiochem, San Diego,
Calif.) at a final concentration of 500 .mu.g/ml of hygromycin.
Colonies typically emerge 2-3 weeks post-electroporation. The
cultures can then be expanded for further analysis.
[0159] Transfectoma clones that are positive for the secretion of
chimeric or humanized heavy chain can be identified by ELISA assay.
Briefly, supernatant samples (100 .mu.A) from transfectoma cultures
are added in triplicate to ELISA microtiter plates precoated with
goat anti-human (GAH)-IgG, F(ab').sub.2 fragment-specific antibody
(Jackson ImmunoResearch, West Grove, Pa.). Plates are incubated for
1 h at room temperature. Unbound proteins are removed by washing
three times with wash buffer (PBS containing 0.05% polysorbate 20).
Horseradish peroxidase (HRP) conjugated GAH-IgG, Fc
fragment-specific antibodies (Jackson ImmunoResearch, West Grove,
Pa.) are added to the wells, (100 .mu.l of antibody stock
diluted.times.10.sup.4, supplemented with the unconjugated antibody
to a final concentration of 1.0 .mu.l/ml). Following an incubation
of 1 h, the plates are washed, typically three times. A reaction
solution, [100 containing 167 .mu.g of orthophenylene-diamine (OPD)
(Sigma, St. Louis, Mo.), 0.025% hydrogen peroxide in PBS], is added
to the wells. Color is allowed to develop in the dark for 30
minutes. The reaction is stopped by the addition of 50 .mu.l of 4 N
HCl solution into each well before measuring absorbance at 490 nm
in an automated ELISA reader (Bio-Tek instruments, Winooski, Vt.).
Bound chimeric antibodies are than determined relative to an
irrelevant chimeric antibody standard (obtainable from Scotgen,
Ltd., Edinburg, Scotland).
[0160] Antibodies can be isolated from cell culture media as
follows. Transfectoma cultures are adapted to serum-free medium.
For production of chimeric antibody, cells are grown as a 500 ml
culture in roller bottles using HSFM. Cultures are centrifuged and
the supernatant filtered through a 0.2 micron membrane. The
filtered medium is passed through a protein A column (1.times.3 cm)
at a flow rate of 1 ml/min. The resin is then washed with about 10
column volumes of PBS and protein A-bound antibody is eluted from
the column with 0.1 M glycine buffer (pH 3.5) containing 10 mM
EDTA. Fractions of 1.0 ml are collected in tubes containing 10
.mu.l of 3 M Tris (pH 8.6), and protein concentrations determined
from the absorbancy at 280/260 nm. Peak fractions are pooled,
dialyzed against PBS, and the antibody concentrated, for example,
with the Centricon 30 (Amicon, Beverly, Mass.). The antibody
concentration is determined by ELISA, as before, and its
concentration adjusted to about 1 mg/ml using PBS. Sodium azide,
0.01% (w/v), is conveniently added to the sample as
preservative.
[0161] All published articles and patents, as well as filings of
patents cited herein are incorporated in their entirety by
reference. The invention is further described by reference to the
following examples, which are provided for illustration only. The
invention is not limited to the examples but rather includes all
variations that are evident from the teachings provided herein.
EXAMPLES
Example 1
Molecular Cloning and Sequence Elucidation for LL1 Heavy and Light
Chain Variable Regions
[0162] The V gene of mLL1 was obtained by RT-PCR using VK5'-4 and
VK1FOR primers as described by Leung et al. 1993 and Orlandi et al.
(PNAS 86:3833-3837. (1989), respectively, and cloned into pCR2.1
AT-cloning vector (Invitrogen). Multiple clones were sequenced to
eliminate possible errors resulted from PCR reaction. Majority of
clones (6) contained an identical murine V sequence, which was
designated as LL1V and the sequence is shown in FIG. 1B. Comparison
with other mouse Vk sequences revealed LL1 Vk is a member of the
kappa light chain subclass II.
[0163] Since RT-PCR failed to yield a full-length sequence encoding
a mouse VH gene, the second cloning approach, rapid amplification
of cDNA 5'-ends (5'-RACE) was employed. The adaptor-ligated cDNA
prepared from LL1 hybridoma cells was amplified by PCR using a
universal anchor primer (Life Technologies) and a gene specific
primer, CH-1B (Leung et al. 1994), which anneals to the CH1 region
of murine heavy chain. The major PCR species of .about.650 by
resulted from PCR was cloned into pCR2.1 AT-cloning vector and
multiple clones were sequenced by DNA sequencing. The PCR product
contained a full-length VH sequence (FIG. 1A) flanked by the
sequences of non-coding and secretion signal peptide at '5-end and
partial coding sequence for the CH1 domain of 1 chain. No defective
mutation was found within the sequence encoding the VH, which was
designated as LL1 VH. Comparison of hLL1 VH with other mouse VH
sequences revealed that it belonged to mouse heavy chain subgroup
miscellaneous (Kabat et al., 1991). By comparing the amino acid
sequences of LL1VH and V with murine Ab V genes in Kabat database
and following Kabat's definition, the CDR regions of hLL1VH and Vk
were identified as shown in FIGS. 1A and B, respectively. By
comparing the amino acid sequences of LL1VH and V with murine Ab V
genes in Kabat database and following Kabat's definition, the CDR
regions of hLL1VH and Vk were identified as shown in FIGS. 1A and
B, respectively.
Example 2
Construction of the Expression Vector for Chimeric LL1
[0164] To evaluated the authenticity of the cloned Fv for LL1, a
chimeric LL1 (cLL1) was constructed and expressed. The nucleotide
residues 7-12 of LL1Vk were modified to a PvuII restriction site,
CAGCTG, by PCR with primers LL1VK-PvuII and VK1 FOR. The resulting
PCR product was digested with PvuII and BglII (partially, due to
the presence of an internal BglII site in the Vk) and force-cloned
into a pBR327-based staging vector (digested with PvuII and Ben
VKpBR2, which contained same Ig promoter, signal peptide sequence
and convenient restriction sites to facilitate in-frame ligation of
the VK PCR product as used by Orlandi et al., 1989 and Leung et
al., 1994.
TABLE-US-00001 LL1VK-PvuII (SEQ ID NO: 23) 5'GAT GTT CAG CTG ACC
CAA ACT CCA CTC TCC-3'
[0165] Similarly, the nucleotide sequences at positions 10-15 and
345-351 of LL1VH were converted to PstI and BstEII, respectively,
by PCR with primers LL1 B-1 and LL1F-1. The VH PCR product was then
digested with PstI and BstEII and ligated into PstI and BstEII
digested VHpBS2, a pBluescript-based staging vector containing a
signal peptide sequence and convenient restriction sites to
facilitate in-frame ligation of the VH PCR product {Orlandi,
Gussow, et al., 1989 741/id}, modified from VHpBS (Leung, S. O.,
Shevitz, J., Pellegrini, M. C., Dion, A. S., Shih, L. B.,
Goldenberg, D. M., and Hansen, H. J. (1994)).
TABLE-US-00002 LL1B-1 (SEQ ID NO: 24) 5'-CAG ATC CAG CTG CAG CAG
TCT GGA CCT GAG-3' LL1F-1 (SEQ ID NO: 25) 5'-GA GAC GGT GAC CAG AGT
CCC TTG GCC CCA A-3'
[0166] The sequences of both cLL1 VH and Vk were confirmed by DNA
sequencing and shown in FIGS. 2A and 2B, respectively.
[0167] The fragment containing the Vk sequences of cLL1, together
with the signal peptide sequences, were excised from LL1VKpBR2 by
double restriction digestion with XbaI and BamHI. The .about.550 by
Vk fragments was then subcloned into the XbaUBamHI site of a
mammalian expression vector, pdHL2. The resulting vector designated
as cLL1VkpdHL2. Similarly, the ca. 750 by fragments containing the
LL1VH, together with the signal peptide sequences, were excised
from LL1VHpBS2 by Xhof and BamHI digestion and isolated by
electrophoresis in an agarose gel. The fragment was subcloned into
the XhoI and HindIII site of cLL1VkpdHL2 with the aid of linker
comparable to both BamHI and HindIII ends, resulting in the final
expression vectors, designated as cLL1pdHL2.
Example 3
Transfection and Expression of cLL1
[0168] Approximately 30 .mu.g of cLL1pdHL2 was linearized by
digestion with SaIl and transfected into Sp2/0-Ag14 cells by
electroporation. The transfected cells were plated into 96-well
plate for 2 days and then selected for MTX resistance. Supernatants
from colonies surviving selection were monitored for chimeric
antibody secretion by ELISA assay. Positive cell clones were
expanded and cLL1 was purified from cell culture supernatant by
affinity chromatography on a Protein A column.
Example 4
Binding Activity Assays
[0169] A competition cell binding assay was carried out to assess
the immunoreactivity of cLL1 relative to the parent mLL1. A
constant amount of .sup.125I-labeled mLL1 (100,000 cpm) was
incubated with Raji cells in the presence of varying concentrations
of cLL1 or mLL1 at 4.degree. C. for 1-2 h. The radioactivity
associated with cells was determined after washing. As shown in
FIG. 5, cLL1 antibody exhibited comparable binding activity as that
of mLL1, confirming the authenticity of the cloned V genes.
[0170] The results were confirmed by a second competition assay
based on flow cytometry. Briefly, using Raji cells as before and
varying the concentration of one antibody relative to other, as
before, the amount of bound mLL1 or cLL1 was determined with
FITC-labeled anti-mouse Fc or anti-human Fc antibodies followed by
analysis using flow cytometry.
[0171] An ELISA competitive binding assay were carried out in Raji
cell membrane coated plate to assess the immunoreactivity of cLL1
relative to the parent mLL1. Raji cell membrane fraction was
prepared by sonication and centrifugation. The crude membrane
extracts were coated in 96-well flat bottomed PVC plate by
centrifugation and fixed with 0.1% glutaraldehyde. Constant amount
of the biotinylated mLL1 mixed with varying concentrations of mLL1
or cLL1 was added to the membrane coated wells and incubated at
room temperature for 1-2 h. After washing, HRP-conjugated
streptavidin was added and incubated for 1 h at room temperature.
The amount of HRP-conjugated streptavidin bound to the
membrane-bound biotinylated mLL1 was revealed by reading A490 nm
after the addition of a substrate solution containing 4 mM
ortho-phenylenediamine dihydrochloride and 0.04%
H.sub.2O.sub.2.
Example 5
Choice of Human Frameworks and Sequence Design for the Humanization
of LL1 Monoclonal Antibody
[0172] By comparing the variable (V) region framework (FR)
sequences of cLL1 to that of human antibodies in the Kabat data
base, the FRs of cLL1VH and Vk were found to exhibit the highest
degree of sequence homology to that of the human antibodies, RF-TS3
VH and HF-21/28 Vk, respectively. The amino acid sequences of are
provided in FIGS. 3A and 3B and are compared with the cLL1VH and Vk
sequences. Therefore, the FRs of RF-TS3 VH and the HF-21/28 Vk and
FRs were selected as the human frameworks onto which the CDRs for
LL1 VH and Vk were grafted, respectively. The FR4 sequence of NEWM,
however, rather than that of RF-TS3, was used to replace the RF-TS3
FR4 sequence for the humanization of LL1 heavy chain. See FIG. 3A.
A few amino acid residues in the LL1 FRs that are close to the
putative CDRs were maintained in hLL1 based on the guideline
described previously (Qu et al., Clin. Cancer Rec. 5:3095s-3100s
(1990)). These residues are L46, F87 and Q100 of VK (FIG. 3B) and
136, K37, Q46, A68, F91 and S93 of VH (FIG. 3A). FIGS. 3A and 3B
compare the human, chimeric and humanized VH and Vk amino acid
sequences. The dots indicate the residues in the cLL1 and hLL1 that
are identical to the corresponding residues in the human VH and Vk
sequences. The DNA and amino acid sequences of hLL1 VH and Vk are
shown in FIGS. 4A and 48, respectively.
Example 6
PCR/Gene Synthesis of the Humanized V Genes
[0173] A modified strategy as described by Leung et al. (Leung et
al, 1994) was used to construct the designed VK and VH genes for
hLL1 using a combination of long oligonucleotide synthesis and PCR
as illustrated in FIG. 5. For the construction of the hLL1 VH
domain, two long oligonucleotides, hLL1 VHA (176 mer) and hLL1VHB
(165-mer) were synthesized on an automated DNA synthesizer (Applied
Biosystem). The hLL1VHA sequence represents nt 20 to 195 of the
hLL1VH domain:
TABLE-US-00003 (SEQ ID NO: 26) 5'-GGTCTGAGTT GAAGAAGCCT GGGGCCTCAG
TGAAGGTTTC CTGCAAGGCT TCTGGATACA CCTTCACTAA CTATGGAGTG AACTGGATAA
AGCAGGCCCC TGGACAAGGG CTTCAGTGGATGGGCTGGAT AAACCCCAAC ACTGGAGAGC
CAACATTTGA TGATGACTTC AAGGGA-3'
[0174] The hLL1 VHB sequence represents the minus strand of the
hLL1 VH domain complementary to nt 173 to 337:
TABLE-US-00004 (SEQ ID NO: 27) 5'-TCCCTTGGCC CCAATAAGCA AACCAGGCTT
CGTTTTTACC CCTCGATCTT GAACAGAAAT ACACGGCAGT GTCGTCAGCC TTTAGGCTGC
TGATCTGGAG ATATGCCGTG CTGACAGAGG TGTCCAAGGA GAAGGCAAAT CGTCCCTTGA
AGTCATCATC AAATG-3'
[0175] The 3'-terminal sequences (22 nt residues) of hLL1 VHA and B
are complementary to each other. Under defined PCR condition,
3'-ends of hLL1 VHA and B anneal to form a short double stranded
DNA flanked by the rest of the long oligonucleotides. Each annealed
end serves as a primer for the transcription of the single stranded
DNA, resulting in a double strand DNA composed of the nt 20 to 337
of hLL1VH. This DNA was further amplified in the presence of two
short oligonucleotides, hLL1VHBACK and hLL1VHFOR to form the
full-length hLL1VH.
TABLE-US-00005 hLL1VHBACK (SEQ ID NO: 28) 5'-GTG GTG CTG CAG CAA
TCT GGG TCT GAG TTC AAG AAG CT-3' hLL1VHFOR (SEQ ID NO: 29) 5'-AAG
TGG ATC CTA TAA TCA TTC CTA GGA TTA ATG-3'.
[0176] Minimum amount of hLL1VHA and B (determined empirically) was
amplified in the presence of 10 .mu.l of 10.times.PCR Buffer (500
mM KCl, 100 mM Tris-HCl buffer, pH 8.3, 15 mM MgCl.sub.2), 2 mol of
hLL1VHBACK and hLL1VHFOR, and 2.5 units of Taq DNA polymerase
(Perkin Elmer Cetus, Norwalk, Conn.). This reaction mixture was
subjected to 3 cycles of PCR reaction consisting of denaturation at
94.degree. C. for 1 minute, annealing at 45.degree. C. for 1
minute, and polymerization at 72.degree. C. for 1.5 minutes, and
followed by 27 cycles of PCR reaction consisting of denaturation at
94.degree. C. for 1 minute, annealing at 55.degree. C. for 1
minute, and polymerization at 72.degree. C. for 1 minute.
Double-stranded PCR-amplified product for hLL1VH was gel-purified,
restriction-digested with PstI and BstEII and cloned into the
complementary PstI/BstEII sites of the heavy chain staging vector,
VHpBS2.
[0177] For constructing the full length DNA of the humanized VK
sequence, hLL1VKA (159-mer) and hLL1VKB (169-mer) were synthesized
as described above. hLL1VKA and B were amplified by two short
oligonucleotides hLL1 VKBACK and hLL1 VKFOR as described above.
[0178] The hLL1 VHA sequence represents nt 16 to 174 of the hLL1VH
domain.
TABLE-US-00006 (SEQ ID NO: 30) 5'-CAGTCTCCAC TCTCCCTGCC CGTCACCCTT
GGACAGCCGG CCTCCATCTC CTGCAGATCA AGTCAGAGCC TTGTACACAG AAATGGAAAC
ACCTATTTAC ATTGGTTTCA GCAGAGGCCA GGCCAATCTC CAAGGCTCCT GATCTACACA
GTTTCCAAC-3'
[0179] The hLL1VHB sequence represents the minus strand of the
hLL1VH domain complementary to nt 153 to 321.
TABLE-US-00007 (SEQ ID NO: 31) 5'-TGTCCCAGCA CCGAACGTGG GAGGAACATG
TGAACTTTGA GAGCAGAAAT AAACCCCAAC ATCCTCAGCC TCCACCCTGC TGATTTTCAG
TGTGAAATCA GTGCCTGACC CACTGCCGCT GAATCTGTCT GGGACCCCAG AAAATCGGTT
GGAAACTGTG TAGATCAGG-3'. hLL1VKBACK (SEQ ID NO: 32) 5'-GAT GTT CAG
CTG ACT CAG TCT CCA CTC TCC CTG-3' hLL1VKFOR (SEQ ID NO: 33) 5'-G
TTA GAT CTC CAG TCG TGT CCC AGC ACC GAA CG-3'
[0180] Gel-purified PCR products for hLL1 Vk were
restriction-digested with PvuII and BglIII and cloned into the
complementary PvuLBclI sites of the light chain staging vector,
VKpBR2. The final expression vector hLL1pdHL2 was constructed by
sequentially subcloning the Xba1-BamHI and XhoI/BamHI fragments of
hLL1Vk and VH, respectively, into pdHL2 as described above.
Example 7
Transfection, Expression and Binding Activity Assays for hLL1
[0181] The methods for expression and binding activity assays for
hLL1 were same as described for cLL1.
[0182] An ELISA competitive binding assay using Raji cell membrane
extract coated plate was developed to assess the immunoreactivity
of hLL1. Raji cell membrane fraction was prepared by sonication and
centrifugation. The crude membrane extracts were coated in 96-well
flat bottomed PVC plate by centrifugation and fixed with 0.1%
glutaraldehyde. Constant amount of the biotinylated mLL1 mixed with
varying concentrations of mLL1 or cLL1 was added to the membrane
coated wells and incubated at room temperature for 1-2 h. After
washing, HRP-conjugated streptavidin was added and incubated for 1
h at room temperature. The amount of HRP-conjugated streptavidin
bound to the membrane bound biotinylated mLL1 was revealed by
reading A.sub.490 nm after the addition of a substrate solution
containing 4 mM ortho-phenylenediamine dihydrochloride and 0.04%
H.sub.2O.sub.2. As shown by the competition assays in FIG. 6, mLL1
and cLL1 antibodies exhibited similar binding activities. Likewise,
the competition assays in FIG. 7, hLL1 and cLL1 antibodies
exhibited similar binding activities.
Example 8
Internalization of hLL1
[0183] Standard antibody processing assay was used to evaluate the
internalization and metabolism of hLL1 in Raji cells (Hansen et
al., 1996). Cells (10.sup.7) were incubated in 1 ml of tissue
culture medium containing .sup.125I-labeled hLL1 or LL1 (10.sup.7
cpm) for 1 h at 37.degree. C. To ensure the specificity of Ab
binding, controls of 1/10 sample size (cells, radioactivity and
medium) were set up in every experiment with and without excess
unlabeled Ab (a final concentration of 100 .mu.g/ml). After the
binding incubation, unbound radioactivity was removed by washing.
The specificity controls were counted. In all experiments, the
binding of radioactivity to cells was at least 90% blocked by the
unlabeled Ab. The cells were then resuspended in 30 ml of fresh
medium and dispensed in a 24-well plate with 1.5 ml/well. Samples
of 1.5 ml were saved for radioactivity determination, which was the
initially bound cpm. The plate was incubated in a CO.sub.2
incubator. At 3, 24, 48, and 72 h, the cells were collected as
follows. Cells were resuspended by repeated pipetting and
transferred to conical tubes. The wells and pipette were rinsed
with 1 ml fresh culture medium, which was added to the initial cell
suspension collected. The tube was centrifuged for 10 min at
600.times.g and 1 ml of supernatant was carefully collected (40% of
the total supernatant) and counted for radioactivity. BSA was added
as carrier protein to a final concentration of 1% and the protein
was precipitated with 5 ml of cold 10% (w/v) trichloroacetic acid
(TCA). After incubation for 30 min at 4.degree. C. and
centrifugation for 15 min at 5000.times.g, the supernatant was
discarded and the precipitated protein was counted for
radioactivity. The radiolabeled protein that was not precipitated
by TCA was considered degraded, and precipitated radioactive
protein was considered intact. The cell pellet was counted for the
radioactivity remaining in the cells after being washed.
Radioactivity in each fraction was expressed as a percentage of
that initially bound. As shown in FIG. 8A, hLL1 showed similar
rapid internalizing and catabolic manner as murine LL1 after bound
to the surface of Raji cells, i.e. almost all of the bound
radioactivity was catabolized and released into the supernatant
within 3 h. This is much faster than with other internalizing Abs,
such as anti-CD22 and anti-CD19 (Hansen et al., 1996). The studies
with early time points confirmed the similar processing patterns of
hLL1 and mLL1. Most catabolism was accomplished within one hour
(FIG. 8B).
Example 9
Cytotoxicity of hLL1
[0184] The cytotoxic effect of hLL1 was compared with that of mLL1
and cLL1 in Raji cells, a human lymphoma cell line. Goat anti-human
IgG Fc fragment specific Ab (.alpha.-hFc) was used as the
crosslinker for hLL1 and cLL1 and goat antimouse IgG Fc specific Ab
(.alpha.-mFc) was used for mLL1. 5.times.10.sup.5 Raji cells were
seeded at day 0 in 1 ml of culture medium containing 5 mg/ml of a
LL1 Ab and 50 .mu.g/ml of the appropriate crosslinker. The numbers
of total and viable cells were counted daily for 3 days. As shown
in FIG. 9, The total number of normal Raji cells increased 4-5 fold
in 3 days and cell viability remained >80% at the end of third
day. Cells treated with a crosslinker alone, a LL1 Ab alone, or a
LL1 Ab with an uncomparable crosslinker (e.g. hLL1 and goat
anti-mouse IgG Fc specific Ab), were indistinguishable from normal
Raji cells. However, a combination of hLL1 and anti-human IgG Fe
specific Ab effectively caused cell death: >40% reduction in
cell viability in one day and almost total cell death in 3 days.
The effectiveness of hLL1 was comparable with that of mLL1 and
cLL1. Similar results were observed when Daudi cells were used
(FIG. 10). No such effect was observed with another internalizing
Ab, hLL2, (humanized anti-CD22 Ab). These results demonstrated that
the cytotoxicity effect of hLL1 on lymphoma cell lines is
specifically dependent on crosslinking of the Ab on cell surface.
Sequence CWU 1
1
331360DNAMus sp.CDS(1)..(360) 1cag atc cag ttg gtg cag tct gga cct
gag ctg aag aag cct gga gag 48Gln Ile Gln Leu Val Gln Ser Gly Pro
Glu Leu Lys Lys Pro Gly Glu1 5 10 15aca gtc aag gtc acc tgc aag act
tct gga tat acc ttc aca aac tat 96Thr Val Lys Val Thr Cys Lys Thr
Ser Gly Tyr Thr Phe Thr Asn Tyr 20 25 30gga gtg aac tgg ata aag cag
act cca gga gag ggt tta cag tgg atg 144Gly Val Asn Trp Ile Lys Gln
Thr Pro Gly Glu Gly Leu Gln Trp Met 35 40 45ggc tgg ata aac ccc aac
act gga gag cca aca ttt gat gat gac ttc 192Gly Trp Ile Asn Pro Asn
Thr Gly Glu Pro Thr Phe Asp Asp Asp Phe 50 55 60aag gga cga ttt gcc
ttc tct ttg gaa tcc tct gcc agc act gcc ttt 240Lys Gly Arg Phe Ala
Phe Ser Leu Glu Ser Ser Ala Ser Thr Ala Phe65 70 75 80ttg cag atc
agc aac ctc aaa aat gag gac atg ggt aca tat ttc tgt 288Leu Gln Ile
Ser Asn Leu Lys Asn Glu Asp Met Gly Thr Tyr Phe Cys 85 90 95tca aga
tcg agg ggt aaa aac gaa gcc tgg ttt gct tat tgg ggc caa 336Ser Arg
Ser Arg Gly Lys Asn Glu Ala Trp Phe Ala Tyr Trp Gly Gln 100 105
110ggg act ctg gtc act gtc tct gaa 360Gly Thr Leu Val Thr Val Ser
Glu 115 1202120PRTMus sp. 2Gln Ile Gln Leu Val Gln Ser Gly Pro Glu
Leu Lys Lys Pro Gly Glu1 5 10 15Thr Val Lys Val Thr Cys Lys Thr Ser
Gly Tyr Thr Phe Thr Asn Tyr 20 25 30Gly Val Asn Trp Ile Lys Gln Thr
Pro Gly Glu Gly Leu Gln Trp Met 35 40 45Gly Trp Ile Asn Pro Asn Thr
Gly Glu Pro Thr Phe Asp Asp Asp Phe 50 55 60Lys Gly Arg Phe Ala Phe
Ser Leu Glu Ser Ser Ala Ser Thr Ala Phe65 70 75 80Leu Gln Ile Ser
Asn Leu Lys Asn Glu Asp Met Gly Thr Tyr Phe Cys 85 90 95Ser Arg Ser
Arg Gly Lys Asn Glu Ala Trp Phe Ala Tyr Trp Gly Gln 100 105 110Gly
Thr Leu Val Thr Val Ser Glu 115 1203337DNAMus sp.CDS(1)..(333) 3gat
gtt gtg atg acc caa act cca ctc tcc ctg cct gtc agt ctt gga 48Asp
Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly1 5 10
15gat caa gcc tcc atc tct tgc aga tct agt cag agc ctt gta cac aga
96Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Arg
20 25 30aat gga aac acc tat tta cat tgg tac ctg cag aag cca ggc cag
tct 144Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln
Ser 35 40 45cca aag ctc ctg atc tac aca gtt tcc aac cga ttt tct ggg
gtc cca 192Pro Lys Leu Leu Ile Tyr Thr Val Ser Asn Arg Phe Ser Gly
Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggg aca gat ttc aca
ctc aag atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr
Leu Lys Ile65 70 75 80agt aga gtg gag gct gag gat ctg gga ctt tat
ttc tgc tct caa agt 288Ser Arg Val Glu Ala Glu Asp Leu Gly Leu Tyr
Phe Cys Ser Gln Ser 85 90 95tca cat gtt cct ccc acg ttc ggt gct ggg
acc aag ctg gag atc taac 337Ser His Val Pro Pro Thr Phe Gly Ala Gly
Thr Lys Leu Glu Ile 100 105 1104111PRTMus sp. 4Asp Val Val Met Thr
Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly1 5 10 15Asp Gln Ala Ser
Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Arg 20 25 30Asn Gly Asn
Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Lys
Leu Leu Ile Tyr Thr Val Ser Asn Arg Phe Ser Gly Val Pro 50 55 60Asp
Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75
80Ser Arg Val Glu Ala Glu Asp Leu Gly Leu Tyr Phe Cys Ser Gln Ser
85 90 95Ser His Val Pro Pro Thr Phe Gly Ala Gly Thr Lys Leu Glu Ile
100 105 1105360DNAArtificial SequenceDescription of Artificial
Sequence Synthetic polynucleotide 5cag gtc caa ctg cag cag tct gga
cct gag ctg aag aag cct gga gag 48Gln Val Gln Leu Gln Gln Ser Gly
Pro Glu Leu Lys Lys Pro Gly Glu1 5 10 15aca gtc aag gtc acc tgc aag
act tct gga tat acc ttc aca aac tat 96Thr Val Lys Val Thr Cys Lys
Thr Ser Gly Tyr Thr Phe Thr Asn Tyr 20 25 30gga gtg aac tgg ata aag
cag act cca gga gag ggt tta cag tgg atg 144Gly Val Asn Trp Ile Lys
Gln Thr Pro Gly Glu Gly Leu Gln Trp Met 35 40 45ggc tgg ata aac ccc
aac act gga gag cca aca ttt gat gat gac ttc 192Gly Trp Ile Asn Pro
Asn Thr Gly Glu Pro Thr Phe Asp Asp Asp Phe 50 55 60aag gga cga ttt
gcc ttc tct ttg gaa tcc tct gcc agc act gcc ttt 240Lys Gly Arg Phe
Ala Phe Ser Leu Glu Ser Ser Ala Ser Thr Ala Phe65 70 75 80ttg cag
atc agc aac ctc aaa aat gag gac atg ggt aca tat ttc tgt 288Leu Gln
Ile Ser Asn Leu Lys Asn Glu Asp Met Gly Thr Tyr Phe Cys 85 90 95tca
aga tcg agg ggt aaa aac gaa gcc tgg ttt gct tat tgg ggc caa 336Ser
Arg Ser Arg Gly Lys Asn Glu Ala Trp Phe Ala Tyr Trp Gly Gln 100 105
110ggg act ctg gtc acc gtc tcc tca 360Gly Thr Leu Val Thr Val Ser
Ser 115 1206120PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 6Gln Val Gln Leu Gln Gln Ser Gly Pro
Glu Leu Lys Lys Pro Gly Glu1 5 10 15Thr Val Lys Val Thr Cys Lys Thr
Ser Gly Tyr Thr Phe Thr Asn Tyr 20 25 30Gly Val Asn Trp Ile Lys Gln
Thr Pro Gly Glu Gly Leu Gln Trp Met 35 40 45Gly Trp Ile Asn Pro Asn
Thr Gly Glu Pro Thr Phe Asp Asp Asp Phe 50 55 60Lys Gly Arg Phe Ala
Phe Ser Leu Glu Ser Ser Ala Ser Thr Ala Phe65 70 75 80Leu Gln Ile
Ser Asn Leu Lys Asn Glu Asp Met Gly Thr Tyr Phe Cys 85 90 95Ser Arg
Ser Arg Gly Lys Asn Glu Ala Trp Phe Ala Tyr Trp Gly Gln 100 105
110Gly Thr Leu Val Thr Val Ser Ser 115 1207339DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
7gac atc cag ctg acc caa act cca ctc tcc ctg cct gtc agt ctt gga
48Asp Ile Gln Leu Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly1
5 10 15gat caa gcc tcc atc tct tgc aga tct agt cag agc ctt gta cac
aga 96Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His
Arg 20 25 30aat gga aac acc tat tta cat tgg tac ctg cag aag cca ggc
cag tct 144Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly
Gln Ser 35 40 45cca aag ctc ctg atc tac aca gtt tcc aac cga ttt tct
ggg gtc cca 192Pro Lys Leu Leu Ile Tyr Thr Val Ser Asn Arg Phe Ser
Gly Val Pro 50 55 60gac agg ttc agt ggc agt gga tca ggg aca gat ttc
aca ctc aag atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Lys Ile65 70 75 80agt aga gtg gag gct gag gat ctg gga ctt
tat ttc tgc tct caa agt 288Ser Arg Val Glu Ala Glu Asp Leu Gly Leu
Tyr Phe Cys Ser Gln Ser 85 90 95tca cat gtt cct ccc acg ttc ggt gct
ggg acc aag ctg gag atc aaa 336Ser His Val Pro Pro Thr Phe Gly Ala
Gly Thr Lys Leu Glu Ile Lys 100 105 110cgt 339Arg8113PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
8Asp Ile Gln Leu Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly1 5
10 15Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His
Arg 20 25 30Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly
Gln Ser 35 40 45Pro Lys Leu Leu Ile Tyr Thr Val Ser Asn Arg Phe Ser
Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Leu Gly Leu
Tyr Phe Cys Ser Gln Ser 85 90 95Ser His Val Pro Pro Thr Phe Gly Ala
Gly Thr Lys Leu Glu Ile Lys 100 105 110Arg 9120PRTHomo sapiens 9Gln
Val Gln Leu Val Gln Ser Gly Ser Glu Leu Lys Lys Pro Gly Ala1 5 10
15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30Ala Met Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp
Met 35 40 45Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln
Gly Phe 50 55 60Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser
Thr Ala Tyr65 70 75 80Leu Gln Ile Ser Ser Leu Lys Ala Asp Asp Thr
Ala Val Tyr Tyr Cys 85 90 95Ala Arg Glu Asp Ser Asn Gly Tyr Lys Ile
Phe Asp Tyr Trp Gly Gln 100 105 110Gly Ser Leu Val Thr Val Ser Ser
115 12010360DNAArtificial SequenceDescription of Artificial
Sequence Synthetic polynucleotide 10cag gtc caa ctg cag caa tct ggg
tct gag ttg aag aag cct ggg gcc 48Gln Val Gln Leu Gln Gln Ser Gly
Ser Glu Leu Lys Lys Pro Gly Ala1 5 10 15tca gtg aag gtt tcc tgc aag
gct tct gga tac acc ttc act aac tat 96Ser Val Lys Val Ser Cys Lys
Ala Ser Gly Tyr Thr Phe Thr Asn Tyr 20 25 30gga gtg aac tgg ata aag
cag gcc cct gga caa ggg ctt cag tgg atg 144Gly Val Asn Trp Ile Lys
Gln Ala Pro Gly Gln Gly Leu Gln Trp Met 35 40 45ggc tgg ata aac ccc
aac act gga gag cca aca ttt gat gat gac ttc 192Gly Trp Ile Asn Pro
Asn Thr Gly Glu Pro Thr Phe Asp Asp Asp Phe 50 55 60aag gga cga ttt
gcc ttc tcc ttg gac acc tct gtc agc acg gca tat 240Lys Gly Arg Phe
Ala Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr65 70 75 80ctc cag
atc agc agc cta aag gct gac gac act gcc gtg tat ttc tgt 288Leu Gln
Ile Ser Ser Leu Lys Ala Asp Asp Thr Ala Val Tyr Phe Cys 85 90 95tca
aga tcg agg ggt aaa aac gaa gcc tgg ttt gct tat tgg ggc caa 336Ser
Arg Ser Arg Gly Lys Asn Glu Ala Trp Phe Ala Tyr Trp Gly Gln 100 105
110ggg agc ctg gtc acc gtc tcc tca 360Gly Ser Leu Val Thr Val Ser
Ser 115 12011120PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 11Gln Val Gln Leu Gln Gln Ser Gly
Ser Glu Leu Lys Lys Pro Gly Ala1 5 10 15Ser Val Lys Val Ser Cys Lys
Ala Ser Gly Tyr Thr Phe Thr Asn Tyr 20 25 30Gly Val Asn Trp Ile Lys
Gln Ala Pro Gly Gln Gly Leu Gln Trp Met 35 40 45Gly Trp Ile Asn Pro
Asn Thr Gly Glu Pro Thr Phe Asp Asp Asp Phe 50 55 60Lys Gly Arg Phe
Ala Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr65 70 75 80Leu Gln
Ile Ser Ser Leu Lys Ala Asp Asp Thr Ala Val Tyr Phe Cys 85 90 95Ser
Arg Ser Arg Gly Lys Asn Glu Ala Trp Phe Ala Tyr Trp Gly Gln 100 105
110Gly Ser Leu Val Thr Val Ser Ser 115 12012111PRTHomo sapiens
12Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Leu Gly1
5 10 15Gln Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His
Ser 20 25 30Asp Gly Asn Thr Tyr Leu Asn Trp Phe Gln Gln Arg Pro Gly
Gln Ser 35 40 45Pro Arg Arg Leu Ile Tyr Lys Val Ser Asn Arg Asp Ser
Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val
Tyr Tyr Cys Met Gln Gly 85 90 95Thr His Trp Pro Phe Thr Phe Gly Gln
Gly Thr Arg Leu Glu Ile 100 105 11013339DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
13gac atc cag ctg act cag tct cca ctc tcc ctg ccc gtc acc ctt gga
48Asp Ile Gln Leu Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Leu Gly1
5 10 15cag ccg gcc tcc atc tcc tgc aga tca agt cag agc ctt gta cac
aga 96Gln Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His
Arg 20 25 30aat gga aac acc tat tta cat tgg ttt cag cag agg cca ggc
caa tct 144Asn Gly Asn Thr Tyr Leu His Trp Phe Gln Gln Arg Pro Gly
Gln Ser 35 40 45cca agg ctc ctg atc tac aca gtt tcc aac cga ttt tct
ggg gtc cca 192Pro Arg Leu Leu Ile Tyr Thr Val Ser Asn Arg Phe Ser
Gly Val Pro 50 55 60gac aga ttc agc ggc agt ggg tca ggc act gat ttc
aca ctg aaa atc 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Lys Ile65 70 75 80agc agg gtg gag gct gag gat gtt ggg gtt
tat ttc tgc tct caa agt 288Ser Arg Val Glu Ala Glu Asp Val Gly Val
Tyr Phe Cys Ser Gln Ser 85 90 95tca cat gtt cct ccc acg ttc ggt gct
ggg aca cga ctg gag atc aaa 336Ser His Val Pro Pro Thr Phe Gly Ala
Gly Thr Arg Leu Glu Ile Lys 100 105 110cgt 339Arg14113PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
14Asp Ile Gln Leu Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Leu Gly1
5 10 15Gln Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His
Arg 20 25 30Asn Gly Asn Thr Tyr Leu His Trp Phe Gln Gln Arg Pro Gly
Gln Ser 35 40 45Pro Arg Leu Leu Ile Tyr Thr Val Ser Asn Arg Phe Ser
Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val
Tyr Phe Cys Ser Gln Ser 85 90 95Ser His Val Pro Pro Thr Phe Gly Ala
Gly Thr Arg Leu Glu Ile Lys 100 105 110Arg 154PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 15Gly
Gly Gly Ser11616PRTMus sp. 16Arg Ser Ser Gln Ser Leu Val His Arg
Asn Gly Asn Thr Tyr Leu His1 5 10 15177PRTMus sp. 17Thr Val Ser Asn
Arg Phe Ser1 5189PRTMus sp. 18Ser Gln Ser Ser His Val Pro Pro Thr1
5195PRTMus sp. 19Asn Tyr Gly Val Asn1 52017PRTMus sp. 20Trp Ile Asn
Pro Asn Thr Gly Glu Pro Thr Phe Asp Asp Asp Phe Lys1 5 10
15Gly2111PRTMus sp. 21Ser Arg Gly Lys Asn Glu Ala Trp Phe Ala Tyr1
5 102215PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 22Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser1 5 10 152330DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 23gatgttcagc tgacccaaac
tccactctcc 302430DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 24cagatccagc tgcagcagtc tggacctgag
302530DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 25gagacggtga ccagagtccc ttggccccaa
3026176DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 26ggtctgagtt gaagaagcct ggggcctcag
tgaaggtttc ctgcaaggct tctggataca 60ccttcactaa ctatggagtg aactggataa
agcaggcccc tggacaaggg cttcagtgga 120tgggctggat aaaccccaac
actggagagc caacatttga tgatgacttc aaggga 17627165DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
27tcccttggcc ccaataagca aaccaggctt cgtttttacc cctcgatctt gaacagaaat
60acacggcagt gtcgtcagcc tttaggctgc tgatctggag atatgccgtg ctgacagagg
120tgtccaagga gaaggcaaat
cgtcccttga agtcatcatc aaatg 1652838DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 28gtggtgctgc agcaatctgg gtctgagttc aagaagct
382933DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 29aagtggatcc tataatcatt cctaggatta atg
3330159DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 30cagtctccac tctccctgcc cgtcaccctt
ggacagccgg cctccatctc ctgcagatca 60agtcagagcc ttgtacacag aaatggaaac
acctatttac attggtttca gcagaggcca 120ggccaatctc caaggctcct
gatctacaca gtttccaac 15931169DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 31tgtcccagca
ccgaacgtgg gaggaacatg tgaactttga gagcagaaat aaaccccaac 60atcctcagcc
tccaccctgc tgattttcag tgtgaaatca gtgcctgacc cactgccgct
120gaatctgtct gggaccccag aaaatcggtt ggaaactgtg tagatcagg
1693233DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 32gatgttcagc tgactcagtc tccactctcc ctg
333333DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 33gttagatctc cagtcgtgtc ccagcaccga acg
33
* * * * *