U.S. patent application number 12/974694 was filed with the patent office on 2011-07-14 for conjugates for use in hepatocyte free uptake assays.
This patent application is currently assigned to ISIS PHARMACEUTICALS, INC.. Invention is credited to Brenda F. Baker, C. Frank Bennett, Robert McKay, Brett P. Monia, Namir Sioufi.
Application Number | 20110171730 12/974694 |
Document ID | / |
Family ID | 36181221 |
Filed Date | 2011-07-14 |
United States Patent
Application |
20110171730 |
Kind Code |
A1 |
Bennett; C. Frank ; et
al. |
July 14, 2011 |
Conjugates For Use In Hepatocyte Free Uptake Assays
Abstract
The present invention provides methods of identifying oligomeric
compounds, such as siRNA and double-stranded RNA compounds, having
bioactivity in vivo, and kits.
Inventors: |
Bennett; C. Frank;
(Carlsbad, CA) ; McKay; Robert; (Poway, CA)
; Monia; Brett P.; (Encinitas, CA) ; Baker; Brenda
F.; (Carlsbad, CA) ; Sioufi; Namir; (Beirut,
LB) |
Assignee: |
ISIS PHARMACEUTICALS, INC.
Carlsbad
CA
|
Family ID: |
36181221 |
Appl. No.: |
12/974694 |
Filed: |
December 21, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11221001 |
Sep 7, 2005 |
7884086 |
|
|
12974694 |
|
|
|
|
60608482 |
Sep 8, 2004 |
|
|
|
Current U.S.
Class: |
435/352 ;
435/375 |
Current CPC
Class: |
C12N 2310/321 20130101;
C12N 2310/14 20130101; C12N 2310/323 20130101; C12N 15/111
20130101; C12N 2310/315 20130101; C12N 2320/32 20130101; C12N
2310/321 20130101; C12N 2310/3341 20130101; C12N 2310/321 20130101;
C12N 2320/11 20130101; C12Y 301/03048 20130101; C12N 2310/341
20130101; C12N 2310/346 20130101; C12N 2310/322 20130101; C12N
15/1137 20130101; C12N 2310/3515 20130101; C12N 2310/11 20130101;
C12N 2310/3521 20130101; C12N 2310/3525 20130101 |
Class at
Publication: |
435/352 ;
435/375 |
International
Class: |
C12N 5/071 20100101
C12N005/071 |
Claims
1-33. (canceled)
34. A method for reducing the level of target mRNA in a cell
comprising: contacting the cell with a single-stranded sense
oligonucleotide consisting of 10 to 40 linked nucleosides; and
contacting the cell with a single-stranded antisense
oligonucleotide consisting of 10 to 40 linked nucleosides at least
one hour after contacting the cell with the sense oligonucleotide;
wherein the antisense oligonucleotide is complementary to the
target mRNA, the sense and antisense oligonucleotides are fully
complementary to each other, the contacting occurs in the absence
of a transfection reagent, and the sense oligonucleotide is a
symmetric gapped oligomeric compound, thereby reducing the level of
target mRNA in the cell.
35. The method of claim 34 wherein the cell is a mammalian
tissue-derived cell.
36. The method of claim 34 wherein the cell is a rodent primary
hepatocyte or a primate primary hepatocyte.
37. The method of claim 34 wherein the cell is contacted with the
antisense oligonucleotide at least two hours after the cell is
contacted with the sense oligonucleotide.
38. The method of claim 34 wherein each of the nucleosides of the
antisense oligonucleotide comprises a .beta.-D-ribofuranose sugar
group.
39. The method of claim 34 wherein at least one nucleoside of the
antisense oligonucleotide comprises a 2'-substituent selected from
the group consisting of --F, --O--CH.sub.2CH.sub.2--O--CH.sub.3,
--O--CH.sub.3, --O--CH.sub.2--CH.dbd.CH.sub.2 or
--O--CH.sub.2--CH--CH.sub.2--NH(R.sub.j), where R.sub.j is H or
C.sub.1-C.sub.10 alkyl.
40. The method of claim 34 wherein each nucleoside of the sense
oligonucleotide comprises a 2' sugar modification that conveys
3'-endo sugar conformational geometry.
41. The method of claim 34 wherein the 3'-terminus of at least one
of the sense and antisense oligonucleotides, independently,
comprises a stabilizing or conjugate group.
42. The method of claim 41 wherein the stabilizing group is a
capping group or a dTdT dimer.
43. The method of claim 34 wherein at least one of the sense and
antisense oligonucleotides comprises a 5'-phosphate group.
44. The method of claim 34 wherein the 5'-terminus of at least one
of the sense and antisense oligonucleotides, independently,
comprises a stabilizing or conjugate group.
45. The method of claim 44 wherein the stabilizing group is a
capping group.
46. The method of claim 34 wherein at least one of the sense and
antisense oligonucleotides comprises at least one terminal cap
moiety.
47. The method of claim 46 wherein the terminal cap moiety is
attached to one or both of the 3'-terminal and 5'-terminal ends of
the at least one oligonucleotide.
48. The method of claim 46 wherein the terminal cap moiety is an
inverted deoxy abasic moiety.
49. The method of claim 34 wherein each of the internucleoside
linking groups of at least one of the sense oligonucleotide and the
antisense oligonucleotide is, independently, a
phosphorothioate.
50. The method of claim 34 wherein the sense and antisense
oligonucleotides are capable of hybridizing to form a duplex having
3'-dTdT overhangs.
51. The method of claim 34 wherein the sense and antisense
oligonucleotides are capable of hybridizing to form a duplex having
blunt ends.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 11/221,001, filed Sep. 7, 2005, which claims the benefit of
U.S. provisional application Ser. No. 60/608,482, filed Sep. 8,
2004, each of which is incorporated herein by reference in its
entirety.
FIELD OF THE INVENTION
[0002] The present invention is directed, in part, to methods of
identifying oligomeric compounds, such as double-stranded RNA
molecules, having bioactivity in vivo and to kits therefore.
BACKGROUND OF THE INVENTION
[0003] The concept of using antisense oligonucleotides (ASOs) to
reduce protein expression was first proposed by Zamecnik and
Stephenson in 1978 when they demonstrated that an oligonucleotide
complementary to 13 nucleotides of the Rous sarcoma virus 35S RNA
inhibited virus production in Rous infected chick embryo
fibroblasts (Zamecnik et al., Proc. Natl. Acad. Sci., 1978, 75,
280-284). Advances in antisense therapeutics since this time have
been substantial, with the first therapeutic ASO being approved for
human use in 1998 (Marwick, J. Am. Med. Assoc., 1998, 280, 871).
The recent introduction of RNA interference as a method to analyze
gene function in invertibrates and plants (Fraser et al., Nature,
2000, 408, 325-330) has suggested that double-stranded RNA,
specifically small nucleotide interfering RNAs (siRNAs), may also
have therapeutic applications (Vickers et al., J. Biol. Chem.,
2003, 278, 7108-7118).
[0004] When double-stranded RNA molecules are introduced into cells
they are metabolized to small 21-23 nucleotide siRNAs with
two-nucleotide (2-nt) 3'-overhangs via the endogenous ribonuclease
Dicer (Grishok et al., Science, 2000, 287, 2494-2497; and Zamore et
al., Cell, 2000, 101, 25-33). Inside cells, siRNA molecules bind to
an RNA-induced silencing protein complex. This complex, which
possesses helicase activity, unwinds the double-stranded siRNA,
thereby allowing the antisense strand to bind to the targeted RNA.
An endonuclease then hydrolyzes the target RNA (Zamore et al.,
Cell, 2000, 101, 25-33; and Zamore, Science, 2002, 296, 1265-1269).
Since ultimately a single stranded RNA molecule binds to the target
RNA molecule according to Watson-Crick base pairing rules, siRNA
driven RNA interference is essentially an antisense mechanism of
action (Vickers et al., J. Biol. Chem., 2003, 278, 7108-7118).
siRNA duplexes used for silencing mammalian genes in cultured cells
are usually chemically synthesized 21-23 nucleotide (21-23-nt)
siRNAs, where the siRNA's sense and antisense strands are paired,
containing 2-nt 3'-overhangs (Harborth et al., J. Cell. Sci., 2001,
114, 4557-4565). siRNA molecules were designed with a 2 nucleotide
(2 nt) 3'-overhang because this form of siRNA has been shown to be
most effective in vitro (Elbashir et al., Nature, 2001, 411,
494-498). The 5'-hydroxyl is not blocked by methylation or a
5'-phosphodiester linkage, as both prevent the 5'-phosphorylation
of the antisense siRNA, a step necessary for target RNA degradation
inside cells (Nykanen et al., Cell, 2001, 107, 309-321; and
Schwartz et al., Mol. Cell., 2002, 10, 537-548).
[0005] Zamore and others have reported that single-stranded
antisense oligonucleotides are less potent and less effective than
siRNAs at reducing gene transcript levels (Zamore et al., 2000,
Cell, 101, 25-33; and Caplen et al., Proc. Natl. Acad. Sci. USA,
2001, 98, 9742-9747). As the antisense molecules used in those
studies were single-stranded unmodified RNA, which are rapidly
degraded by endogenous nucleases, here we compare antisense siRNA
molecules to "second generation" phosphorothioate (PS)
oligodeoxynucleotides modified to contain 2'-O-methoxyethyls
(MOEs), both in vitro and in vivo. These second generation
antisense oligonucleotides are chimeric molecules, which by design,
contain a stretch of RNAse H sensitive 2' deoxy residues in the
middle, flanked on both sides with a region of 2'MOE modifications.
These molecules, termed MOE gapmers, take advantage of: 1) 2'-MOE
modifications, which form higher affinity complexes and possess
higher nuclease resistance relative to "first generation" PS
oligonucleotides, resulting in increased ASO potency both in vitro
and in vivo (Altmann et al., Biochem. Soc. Trans., 1996, 24,
630-637; Dean, N. M., Pharmacology of 2'-O-(2-methoxy)-ethyl
modified antisense oligonucleotides, in Antisense Technology:
Principles, Strategies and Applications, S. Crooke, Editor, Marcel
Dekker, 2001; and Kurreck, Eur. J. Biochem., 2003, 270, 1628-1644);
and 2) PS 2' deoxyoligonucleotides, which when duplexed with RNA,
serve as efficient substrates for the robust endogenous RNAse H
antisense-mediated cleavage of RNA (Baker et al., Biochim. Biophys.
Acta, 1999, 1489, 3-18). Indeed, antisense MOE gapmer reduction of
target mRNA levels can be in the order of 85-90% of control levels
(Crooke et al., Annu. Rev. Pharmacol. Toxicol., 1996, 36, 107-129;
and Baker et al., Biochim. Biophys. Acta, 1999, 1489, 3-18).
[0006] Antisense oligonucleotides are known to preferentially
accumulate in hepatic tissue in vivo (Cossum et al., J. Pharmacol.
Exp. Ther., 1993, 267, 1181-1190; and Graham et al., J. Pharmacol.
Exp. Therap., 1998, 286, 447-458). Nestle and colleagues have
previously reported that cultured hepatocytes rapidly internalize
antisense compounds in the absence of cationic lipid transfection
reagents (Nestle et al., J. Invest. Dermatol., 1994, 103, 569-575).
These observations are likely related to the remarkable transport
rates displayed by hepatocytes, where fluid-phase endocytosis at
the basolateral membrane is estimated to be 8% of the total
membrane surface area per minute per cell (Crawford, Semin. Liver
Dis., 1996, 16, 169-189).
[0007] The present invention provides a primary hepatocyte cell
model that demonstrates in vitro antisense oligonucleotide uptake
and intracellular trafficking similar to postulated in vivo
antisense oligonucleotide uptake and trafficking. In particular,
the present invention demonstrates antisense oligonucleotide
mediated target mRNA reduction in primary hepatocytes without
cationic lipid carriers, analogous to that postulated to occur in
vivo. The results described herein suggest that the mechanism of
cellular uptake of single strand MOE gapmers and double strand
siRNA are different. Single strand MOE gapmers, but likely not
double strand siRNA, are taken up in hepatocytes in vivo and in
vitro without aid of cationic lipids. When siRNA molecules are
transfected into cells, they produce a dose dependent reduction of
target gene expression.
SUMMARY OF THE INVENTION
[0008] The present invention provides methods of identifying
oligomeric compounds having bioactivity in vivo. A bioindicative
cell is contacted with one or more pairs of candidate oligomeric
compounds in vitro. The bioindicative cell is contacted with a
first oligomeric compound having a sense strand orientation. The
bioindicative cell is contacted with a second oligomeric compound
having an antisense strand orientation. The bioindicative cell is
contacted with the second oligomeric compound at least one hour
after the bioindicative cell is contacted with the first oligomeric
compound. At least a portion of the second oligomeric compound is
capable of hybridizing with at least a portion of the first
oligomeric compound. It is determined whether the bioindicative
cell has an altered phenotype. If the bioindicative cell has an
altered phenotype, one or more of the pairs of candidate oligomeric
compounds comprises in vivo bioactivity.
[0009] In some embodiments, the first and second oligomeric
compounds are small interfering RNA. In some embodiments, the
contacting occurs in the absence of a transfection reagent. In some
embodiments, the bioindicative cell is a mammalian tissue-derived
cell, such as a primary hepatocyte, primary keratinocyte, primary
macrophage, primary fibroblast, primary pancreatic cell, or a stem
cell. In some embodiments, the mammalian tissue-derived cell is a
rodent or primary primate hepatocyte such as a Cynomolgus monkey or
human.
[0010] In some embodiments, the altered phenotype is an increase in
uptake of the candidate oligomeric compounds, decrease in
expression of the mRNA produced from the gene to which the
candidate oligomeric compounds are targeted, or decrease in
expression of the protein encoded by the gene or mRNA to which the
candidate oligomeric compounds are targeted.
[0011] In some embodiments, the bioindicative cell is contacted
with the second oligomeric compound at least two hours after the
bioindicative cell is contacted with the first oligomeric compound.
In some embodiments, the bioindicative cell is contacted with the
second oligomeric compound between two hours and four hours after
the bioindicative cell is contacted with the first oligomeric
compound. In some embodiments, each of the first and second
oligomeric compounds comprises 10 to 40 nucleotides, 18 to 30
nucleotides, or 21 to 24 nucleotides.
[0012] In some embodiments, at least a portion of the second
oligomeric compound is complementary to and capable of hybridizing
to a selected target nucleic acid, the second oligomeric compound
comprises a plurality of linked nucleosides linked by
internucleoside linking groups, the first oligomeric compound
comprises a plurality of linked nucleosides linked by
internucleoside linking groups and wherein essentially each of the
nucleosides is other than 2'-OH and have 3'-endo conformational
geometry, and the first and second oligomeric compounds optionally
comprise a phosphate group, a 3'-overhang, or a conjugate
group.
[0013] The present invention also provides kits comprising an assay
platform, a bioindicative cell, and one or more bioactive pairs of
oligomeric compounds which comprise a first oligomeric compound
having a sense strand orientation and a second oligomeric compound
having an antisense strand orientation, wherein at least a portion
of the second oligomeric compound is capable of hybridizing with at
least a portion of the first oligomeric compound.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIG. 1 shows the results of a dose-response for PTEN siRNA
oligomeric compounds in primary hepatocytes.
[0015] FIG. 2 shows 2'-OMe and 2'-MOE modification resulted in
highly potent siRNA.
[0016] FIG. 3 shows 4'-thio modification resulted in increased
stability and activity to RNA on sense and antisense strand.
[0017] FIG. 4 shows levels of PTEN mRNA upon treatment with MOE
gapmer, 4'-thio gapmer, unmodified, alternating PO/PS, and
alternating OMe/F siRNA constructs.
[0018] FIG. 5 shows reduction of mouse PTEN mRNA in mouse primary
hepatocyts via lipofectin transfection using particular
constructs.
[0019] FIG. 6 shows reduction of mouse PTEN mRNA in mouse primary
hepatocyts via lipofectin transfection using particular
constructs.
[0020] FIG. 7 shows reduction of mouse PTEN mRNA in mouse primary
hepatocyts via free uptake transfection using particular
constructs.
[0021] FIG. 8 shows reduction of mouse PTEN mRNA in mouse primary
hepatocyts via free uptake transfection using particular
constructs.
DESCRIPTION OF EMBODIMENTS
[0022] The present invention provides methods of identifying
oligomeric compounds having bioactivity in vivo, and kits. In
particular, the present invention provides methods of identifying
oligomeric compounds, such as double-stranded RNA, having
bioactivity in vivo. A bioindicative cell is contacted with one or
more pairs of candidate oligomeric compounds in vitro. Contacting
can occur by any means known to those skilled in the art. The
bioindicative cell is examined to determine whether it has an
altered phenotype. Such examination can be carried out via
morphological analysis, biochemical analysis, or the like. If the
bioindicative cell has an altered phenotype, one or more of the
pairs of candidate oligomeric compounds comprises in vivo
bioactivity.
[0023] In some embodiments, the oligomeric compound can be double
stranded. In some embodiments, the oligomeric compound is a small
interfering RNA. In some embodiments, the bioindicative cell is a
mammalian tissue-derived cell including, but not limited to, a
primary hepatocyte, primary keratinocyte, primary macrophage,
primary fibroblast, primary pancreatic cell, or a stem cell. In
some embodiments, the mammalian tissue-derived cell is a rodent
(i.e., mouse or rat) primary hepatocyte. In other embodiments, the
mammalian tissue-derived cell is a primate primary hepatocyte.
Primates include, but are not limited to, monkeys (i.e.,
Cynomolgus) and humans.
[0024] Altered phenotypes include, but are not limited to, an
increase in uptake of the candidate oligomeric compound, decrease
in expression of the mRNA produced from the gene to which the
candidate oligomeric compound is targeted, or decrease in
expression of the protein encoded by the gene or mRNA to which the
candidate oligomeric compound is targeted.
[0025] As used herein, "bioactivity in vivo" is any activity within
a cell in vivo including, but not limited to, alteration of the
level of an RNA molecule to which the oligomeric compound(s) is
targeted, or alteration of a protein encoded by an RNA molecule to
which the oligomeric compound(s) is targeted.
[0026] As used herein, "a bioindicative cell" is any cell in which
an in vitro activity of an oligomeric compound(s) is observed and
is correlated to an in vivo activity of the same oligomeric
compound(s). Bioindicative cells include, but are not limited to,
mammalian tissue-derived cells such as, for example, primary
hepatocytes, primary keratinocytes, primary macrophages, primary
fibroblasts, primary pancreatic cells, or stem cells.
[0027] As used herein, "altered phenotype" is any phenotypic trait
for which an alteration can be observed. Altered phenotypes
include, but are not limited to, an increase in uptake of the
candidate oligomeric compound(s), decrease in expression of the RNA
produced from the gene to which the candidate oligomeric
compound(s) is targeted, or decrease in expression of the protein
encoded by the gene to which the candidate oligomeric compound(s)
is targeted.
[0028] As used herein, "transfection reagent" is any reagent that
enhances transfection of an oligomeric compound(s) into a cell.
Transfection reagents are well known to the skilled artisan.
[0029] As used herein, "assay platform" is any platform in which a
cell-based assay can be carried out including, but not limited to,
a 96-well microtiter plate, a 48-well microtiter plate, a 6-well
microtiter plate, and the like.
[0030] In particular, the present invention provides methods of
sequentially delivering a first oligomeric compound, such as an
siRNA, comprising a sense strand orientation followed by delivery
of a second oligomeric compound, such as another siRNA, comprising
an antisense orientation. In some embodiments, the second
oligomeric compound is delivered to the bioindicative cell at least
one hour, at least two hours, or between two and four hours after
delivery of the first oligomeric compound.
[0031] In some embodiments, at least the nucleic acid target region
of the second oligomeric compound has 3'-endo sugar conformational
geometry and comprises uniform ribofuranose nucleosides. Another
suitable modification of the second oligomeric compound is a
5'-phosphate group. In some embodiments, at least one of the
monomeric subunits of the hybridizing region of the first
oligomeric compound are modified to give each monomeric subunit
3'-endo sugar conformational geometry. Another modification of the
first oligomeric compound is a 5'-phosphate group. In some
embodiments, the compositions have a double stranded region that at
least in part hybridizes to and is complementary to a nucleic acid
target.
[0032] In one aspect of the present invention, the second
oligomeric compound is a full phosphodiester or phosphorothioate
RNA that can include a 5'-phosphate group and the first oligomeric
compound is a fully modified phosphodiester or phosphorothioate
such that each monomeric subunit has 3'-endo sugar conformational
geometry. Suitable 3'-endo modifications include, without
limitation, --F, --O--CH.sub.2CH.sub.2--O--CH.sub.3, --O--CH.sub.3,
--O--CH.sub.2--CH.dbd.CH.sub.2 or
--O--CH.sub.2--CH--CH.sub.2--NH(R.sub.j) where R.sub.j is H or
C.sub.1-C.sub.10 alkyl with 2'-O-methy as a more suitable group.
The presence of modifications in both the sense and the antisense
strand of compositions of the present invention greatly enhance the
stability of the corresponding compositions.
[0033] In the context of this invention, the term "oligomeric
compound" refers to a plurality of naturally-occurring and/or
non-naturally-occurring monomeric units joined together in a
specific sequence. This term includes oligonucleotides,
oligonucleosides, oligonucleotide analogs, oligonucleotide
mimetics, and combinations of these. Oligomeric compounds are
typically structurally distinguishable from, yet functionally
inter-change-able with, naturally-occurring or synthetic wild-type
oligonucleotides. Thus, oligomeric compounds include all such
structures that function effectively to mimic the structure and/or
function of a desired RNA or DNA strand, for example, by
hybridizing to a target.
[0034] Oligomeric compounds are routinely prepared linearly but can
be joined or otherwise prepared to be circular and may also include
branching. Oligomeric compounds can included double stranded
constructs such as for example two strands hybridized to form
double stranded compounds. The double stranded compounds can be
linked or separate and can include overhangs on the ends. In
general an oligomeric compound comprises a backbone of linked
monomeric subunits where each linked monomeric subunit is directly
or indirectly attached to a heterocyclic base moiety. Oligomeric
compounds may also include monomeric subunits that are not linked
to a heterocyclic base moiety thereby providing abasic sites. The
linkages joining the monomeric subunits, the sugar moieties or
surrogates and the heterocyclic base moieties can be independently
modified giving rise to a plurality of motifs for the resulting
oligomeric compounds including hemimers, gapmers and chimeras.
[0035] In the context of this invention, the term "oligonucleotide"
refers to an oligomer or polymer of ribonucleic acid (RNA) or
deoxyribonucleic acid (DNA) or mimetics thereof. This term includes
oligonucleotides composed of naturally-occurring nucleobases,
sugars and covalent internucleoside (backbone) linkages as well as
oligonucleotides having non-naturally-occurring portions that
function similarly. Such modified or substituted oligonucleotides
are often suitable over native forms because of desirable
properties such as, for example, enhanced cellular uptake, enhanced
affinity for nucleic acid target, and increased stability in the
presence of nucleases.
[0036] Included in suitable oligomeric compounds are
oligonucleotides such as antisense oligonucleotides, ribozymes,
external guide sequence (EGS) oligonucleotides, alternate splicers,
primers, probes, and other oligonucleotides that hybridize to at
least a portion of the target nucleic acid. As such, these
oligonucleotides may be introduced in the form of single-stranded,
double-stranded, circular or hairpin oligonucleotides and may
contain structural elements such as internal or terminal bulges or
loops. Once introduced to a system, the compositions of the
invention may elicit the action of one or more enzymes or
structural proteins to effect modification of the target nucleic
acid.
[0037] One non-limiting example of such an enzyme is RNAse H, a
cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. Single-stranded antisense oligonucleotides that are
"DNA-like" elicit RNAse H. Activation of RNase H, therefore,
results in cleavage of the RNA target, thereby greatly enhancing
the efficiency of oligonucleotide-mediated inhibition of gene
expression. Similar roles have been postulated for other
ribonucleases such as those in the RNase III and ribonuclease L
family of enzymes.
[0038] While a suitable form of antisense oligonucleotide is a
single-stranded antisense oligonucleotide, in many species the
introduction of double-stranded structures, such as double-stranded
RNA (dsRNA) molecules, has been shown to induce potent and specific
antisense-mediated reduction of the function of a gene or its
associated gene products. This phenomenon occurs in both plants and
animals and is believed to have an evolutionary connection to viral
defense and transposon silencing.
[0039] In the context of this invention, the term "oligonucleoside"
refers to a sequence of nucleosides that are joined by
internucleoside linkages that do not have phosphorus atoms.
Internucleoside linkages of this type include short chain alkyl,
cycloalkyl, mixed heteroatom alkyl, mixed heteroatom cycloalkyl,
one or more short chain heteroatomic and one or more short chain
heterocyclic. These internucleoside linkages include but are not
limited to siloxane, sulfide, sulfoxide, sulfone, acetyl,
formacetyl, thioformacetyl, methylene formacetyl, thioformacetyl,
alkeneyl, sulfamate; methyleneimino, methylenehydrazino, sulfonate,
sulfonamide, amide and others having mixed N, O, S, and CH.sub.2
component parts.
[0040] Representative U.S. patents that teach the preparation of
the above oligonucleosides include, but are not limited to, U.S.
Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141;
5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677;
5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240;
5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070;
5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and
5,677,439.
[0041] In addition to the modifications described above, the
nucleosides of the compositions of the invention can have a variety
of other modifications so long as these other modifications either
alone or in combination with other nucleosides enhance one or more
of the desired properties described above. Thus, for nucleotides
that are incorporated into compositions of the invention, these
nucleotides can have sugar portions that correspond to
naturally-occurring sugars or modified sugars. Representative
modified sugars include carbocyclic or acyclic sugars, sugars
having substituent groups at one or more of their 2', 3' or 4'
positions and sugars having substituents in place of one or more
hydrogen atoms of the sugar. Additional nucleosides amenable to the
present invention having altered base moieties and or altered sugar
moieties are disclosed in U.S. Pat. No. 3,687,808 and PCT
application PCT/US 89/02323.
[0042] Oligomeric compounds having altered base moieties or altered
sugar moieties are also included in the present invention. All such
modified oligomeric compounds are comprehended by this invention so
long as they function effectively to mimic the structure of a
desired RNA or DNA strand. A class of representative base
modifications include tricyclic cytosine analog, termed "G clamp"
(Lin et al., J. Am. Chem. Soc., 1998, 120, 8531). This analog makes
four hydrogen bonds to a complementary guanine (G) within a helix
by simultaneously recognizing the Watson-Crick and Hoogsteen faces
of the targeted G. This G clamp modification when incorporated into
phosphorothioate oligonucleotides, dramatically enhances antisense
potencies in cell culture. The compositions of the invention also
can include phenoxazine-substituted bases of the type disclosed by
Flanagan et al., Nat. Biotechnol., 1999, 17, 48-52.
[0043] The oligomeric compounds in accordance with this invention
can comprise from about 8 to about 80 monomeric subunits (i.e. from
about 8 to about 80 linked nucleosides). One of ordinary skill in
the art will appreciate that the invention embodies oligomeric
compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,
39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55,
56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72,
73, 74, 75, 76, 77, 78, 79, or 80 monomeric subunits in length, or
any range therewithin.
[0044] In some embodiments, the oligomeric compounds of the
invention are 12 to 50 monomeric subunits in length. One having
ordinary skill in the art will appreciate that this embodies
oligomeric compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 monomeric subunits in
length, or any range therewithin.
[0045] In other embodiments, the oligomeric compounds of the
invention are 15 to 30 monomeric subunits in length. One having
ordinary skill in the art will appreciate that this embodies
oligomeric compounds of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, or 30 monomeric subunits in length, or any range
therewithin.
[0046] Oligomeric compounds used in the compositions of the present
invention can also be modified to have one or more stabilizing
groups that are generally attached to one or both termini of
oligomeric compounds to enhance properties such as for example
nuclease stability. Included in stabilizing groups are cap
structures. By "cap structure" or "terminal cap moiety" is meant
chemical modifications, which have been incorporated at either
terminus of oligonucleotides (see for example Wincott et al., WO
97/26270). These terminal modifications protect the oligomeric
compounds having terminal nucleic acid molecules from exonuclease
degradation, and can help in delivery and/or localization within a
cell. The cap can be present at the 5'-terminus (5'-cap) or at the
3'-terminus (3'-cap) or can be present on both termini. In
non-limiting examples, the 5'-cap includes inverted abasic residue
(moiety), 4',5'-methylene nucleotide; 1-(beta-D-erythrofuranosyl)
nucleotide, 4'-thio nucleotide, carbocyclic nucleotide;
1,5-anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides;
modified base nucleotide; phosphorodithioate linkage;
threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide;
acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl
nucleotide, 3'-3'-inverted nucleotide moiety; 3'-3'-inverted abasic
moiety; 3'-2'-inverted nucleotide moiety; 3'-2'-inverted abasic
moiety; 1,4-butanediol phosphate; 3'-phosphoramidate;
hexylphosphate; aminohexyl phosphate; 3'-phosphate;
3'-phosphorothioate; phosphorodithioate; or bridging or
non-bridging methylphosphonate moiety (for more details see Wincott
et al., International PCT publication No. WO 97/26270).
[0047] Particularly suitable 3'-cap structures of the present
invention include, for example, 4',5'-methylene nucleotide;
1-(beta-D-erythrofuranosyl) nucleotide; 4'-thio nucleotide,
carbocyclic nucleotide; 5'-amino-alkyl phosphate;
1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate;
6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl
phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide;
alpha-nucleotide; modified base nucleotide; phosphorodithioate;
threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide;
3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide,
5'-5'-inverted nucleotide moiety; 5'-5'-inverted abasic moiety;
5'-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate;
5'-amino; bridging and/or non-bridging 5'-phosphoramidate,
phosphorothioate and/or phosphorodithioate, bridging or non
bridging methylphosphonate and 5'-mercapto moieties (for more
details see Beaucage and Tyer, 1993, Tetrahedron 49, 1925).
[0048] A further embodiment of the present invention is
"structured" antisense constructs, e.g. siRNA, which contain
suitable and/or enabling attributes and compositions for regulation
of gene expression in vivo through usage of conventional
administration procedures. One primary feature of the structured
constructs is that they exist in both a structured and unstructured
form under physiological conditions, e.g. unhybridized
single-strand and hybridized double-strand forms. The antisense
construct may be modified to impart resistance to degradation by
nucleases in either or both forms.
[0049] Modifications to the base, sugar, and phosphate linkage may
also be used to affect changes in the equilibrium between the
structured and unstructured form, in particular for sequences or
compositions that yield duplex stabilities below or above the
optimal range for in vivo delivery applications, e.g.
T.sub.m=37.+-.8.degree. C. These modifications may include bases
that form mismatches, with preference for mismatched bases in the
sense portion of the antisense construct. See FIG. 1.
[0050] It is not necessary for all positions in an oligomeric
compound to be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
oligomeric compound or even at a single monomeric subunit such as a
nucleoside within an oligonucleotide. The present invention also
includes chimeric oligomeric compounds such as chimeric
oligonucleotides. "Chimeric" oligomeric compounds or "chimeras," in
the context of this invention, are oligomeric compounds such as
oligonucleotides containing two or more chemically distinct
regions, each made up of at least one monomer unit, i.e., a
nucleotide in the case of a nucleic acid based oligomer.
[0051] Chimeric oligomeric compounds typically contain at least one
region modified so as to confer increased resistance to nuclease
degradation, increased cellular uptake, and/or increased binding
affinity for the target nucleic acid. An additional region of the
oligonucleotide may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is
a cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. Activation of RNase H, therefore, results in cleavage of
the RNA target, thereby greatly enhancing the efficiency of
inhibition of gene expression. Consequently, comparable results can
often be obtained with shorter oligonucleotides when chimeras are
used, compared to for example phosphorothioate
deoxyoligonucleotides hybridizing to the same target region.
Cleavage of the RNA target can be routinely detected by gel
electrophoresis and, if necessary, associated nucleic acid
hybridization techniques known in the art.
[0052] Chimeric compositions of the invention may be formed as
composite structures of two or more oligomeric compounds such as
oligonucleotides, oligonucleotide analogs, oligonucleosides and/or
oligonucleotide mimetics as described above. Such oligomeric
compounds have also been referred to in the art as hybrids
hemimers, gapmers or inverted gapmers. Representative U.S. patents
that teach the preparation of such hybrid structures include, but
are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007;
5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065;
5,652,355; 5,652,356; and 5,700,922.
[0053] Specific examples of suitable oligomeric compounds useful in
this invention include oligonucleotides containing modified e.g.
non-naturally occurring internucleoside linkages. As defined in
this specification, oligonucleotides having modified
internucleoside linkages include internucleoside linkages that
retain a phosphorus atom and internucleoside linkages that do not
have a phosphorus atom. For the purposes of this specification, and
as sometimes referenced in the art, modified oligonucleotides that
do not have a phosphorus atom in their internucleoside backbone can
also be considered to be oligonucleosides.
[0054] In the C. elegans system, modification of the
internucleotide linkage (phosphorothioate) did not significantly
interfere with RNAi activity. Based on this observation, it is
suggested that certain compositions of the invention can also have
one or more modified internucleoside linkages. A suitable
phosphorus containing modified internucleoside linkage is the
phosphorothioate internucleoside linkage.
[0055] Suitable modified oligonucleotide backbones containing a
phosphorus atom therein include, for example, phosphorothioates,
chiral phosphorothioates, phosphorodithioates, phosphotriesters,
aminoalkylphosphotriesters, methyl and other alkyl phosphonates
including 3'-alkylene phosphonates, 5'-alkylene phosphonates and
chiral phosphonates, phosphinates, phosphoramidates including
3'-amino phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, selenophosphates and borano-phosphates
having normal 3'-5' linkages, 2'-5' linked analogs of these, and
those having inverted polarity wherein one or more internucleotide
linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Suitable
oligonucleotides having inverted polarity comprise a single 3' to
3' linkage at the 3'-most internucleotide linkage, i.e. a single
inverted nucleoside residue that may be abasic (the nucleobase is
missing or has a hydroxyl group in place thereof). Various salts,
mixed salts and free acid forms are also included.
[0056] Representative U.S. patents that teach the preparation of
the above phosphorus-containing linkages include, but are not
limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301;
5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302;
5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233;
5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111;
5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899;
5,721,218; 5,672,697 and 5,625,050.
[0057] In some embodiments, oligonucleotides have one or more
phosphorothioate and/or heteroatom internucleoside linkages, in
particular --CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- (known as a methylene
(methylimino) or MMI backbone),
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- (wherein the native
phosphodiester internucleotide linkage is represented as
--O--P(.dbd.O)(OH)--O--CH.sub.2--). The MMI type internucleoside
linkages are disclosed in the above referenced U.S. Pat. No.
5,489,677. Suitable amide internucleoside linkages are disclosed in
the above referenced U.S. Pat. No. 5,602,240.
[0058] Suitable modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; riboacetyl backbones; alkene containing backbones;
sulfamate backbones; methyleneimino and methylenehydrazino
backbones; sulfonate and sulfonamide backbones; amide backbones;
and others having mixed N, O, S and CH.sub.2 component parts.
[0059] Representative U.S. patents that teach the preparation of
the above oligonucleosides include, but are not limited to, U.S.
Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141;
5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677;
5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240;
5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070;
5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and
5,677,439.
[0060] In addition to having a 2'-O-methyl modified nucleiside the
compositions of the present invention may also contain additional
modified sugar moieties. Suitable modified sugar moieties comprise
a sugar substituent group selected from, but not limited to: OH; F;
O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or
O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be
substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2
to C.sub.10 alkenyl and alkynyl. Particularly suitable are
O((CH.sub.2).sub.nO).sub.m--CH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON--((CH.sub.2).sub.nCH.sub.3).sub.2, where n and
m are from 1 to about 10, or any subset thereof. Other suitable
sugar substituent groups include, but are not limited to: C.sub.1
to C.sub.10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl,
alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl,
Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3,
ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl,
heterocyclo-alkaryl, aminoalkylamino, polyalkylamino, substituted
silyl, an RNA cleaving group, a reporter group, an intercalator, a
group for improving the pharmacokinetic properties of an
oligonucleotide, or a group for improving the pharmacodynamic
properties of an oligonucleotide, and other substituents having
similar properties, or any subset thereof. A suitable modification
includes 2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2OCH.sub.3, also
known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv.
Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group. A
further modification includes 2'-dimethylamino-oxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples hereinbelow, and
2'-dimethylamino-ethoxyethoxy (also known in the art as
2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.3).sub.2.
[0061] Other suitable sugar substituent groups include, but are not
limited to, methoxy (--O--CH.sub.3), aminopropoxy
(--OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), allyl
(--CH.sub.2--CH.dbd.CH.sub.2), --O-allyl
(--O--CH.sub.2--CH.dbd.CH.sub.2) and fluoro (F). 2'-Sugar
substituent groups may be in the arabino (up) position or ribo
(down) position. A suitable 2'-arabino modification is 2'-F.
Similar modifications may also be made at other positions on the
oligomeric compound, particularly the 3' position of the sugar on
the 3' terminal nucleoside or in 2'-5' linked oligonucleotides and
the 5' position of 5' terminal nucleotide. Oligonucleotides may
also have sugar mimetics such as cyclobutyl moieties in place of
the pentofuranosyl sugar. Representative U.S. patents that teach
the preparation of such modified sugar structures include, but are
not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080;
5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134;
5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053;
5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and
5,700,920.
[0062] Particularly suitable sugar substituent groups include
O((CH.sub.2).sub.nO).sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON((CH.sub.2).sub.nCH.sub.3)).sub.2, where n and m
are from 1 to about 10.
[0063] Further representative sugar substituent groups include
groups of formula I.sub.a or II.sub.a:
##STR00001##
wherein: [0064] R.sub.b is O, S or NH; [0065] R.sub.d is a single
bond, O, S or C(.dbd.O); [0066] R.sub.e is C.sub.1-C.sub.10 alkyl,
N(R.sub.k)(R.sub.m), N(R.sub.k)(R.sub.n),
N.dbd.C(R.sub.p)(R.sub.q), N.dbd.C(R.sub.p)(R.sub.r) or has formula
III.sub.a;
[0066] ##STR00002## [0067] R.sub.p and R.sub.q are each
independently hydrogen or C.sub.1-C.sub.10 alkyl; [0068] R.sub.r is
--R.sub.x--R.sub.y; [0069] each R.sub.s, R.sub.t, R.sub.u and
R.sub.v is, independently, hydrogen, C(O)R.sub.W, substituted or
unsubstituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted
C.sub.2-C.sub.10 alkenyl, substituted or unsubstituted
C.sub.2-C.sub.10 alkynyl, alkylsulfonyl, arylsulfonyl, a chemical
functional group or a conjugate group, wherein the substituent
groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl,
phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and
alkynyl; [0070] or optionally, R.sub.u and R.sub.v, together form a
phthalimido moiety with the nitrogen atom to which they are
attached; [0071] each R.sub.w is, independently, substituted or
unsubstituted C.sub.1-C.sub.10 alkyl, trifluoromethyl,
cyanoethyloxy, methoxy, ethoxy, t-butoxy, allyloxy,
9-fluorenylmethoxy, 2-(trimethylsilyl)-ethoxy,
2,2,2-trichloroethoxy, benzyloxy, butyryl, iso-butyryl, phenyl or
aryl; [0072] R.sub.k is hydrogen, a nitrogen protecting group or
--R.sub.x--R.sub.y; [0073] R.sub.p is hydrogen, a nitrogen
protecting group or --R.sub.x--R.sub.y; [0074] R.sub.x is a bond or
a linking moiety; [0075] R.sub.y is a chemical functional group, a
conjugate group or a solid support medium; [0076] each R.sub.m, and
R.sub.n is, independently, H, a nitrogen protecting group,
substituted or unsubstituted C.sub.1-C.sub.10 alkyl, substituted or
unsubstituted C.sub.2-C.sub.10 alkenyl, substituted or
unsubstituted C.sub.2-C.sub.10 alkynyl, wherein the substituent
groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl,
phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl,
alkynyl; NH.sub.3.sup.+, N(R.sub.u)(R.sub.v), guanidino and acyl
where the acyl is an acid amide or an ester; [0077] or R.sub.m and
R.sub.n, together, are a nitrogen protecting group, are joined in a
ring structure that optionally includes an additional heteroatom
selected from N and O or are a chemical functional group; [0078]
R.sub.i is OR.sub.z, SR.sub.z, or N(R.sub.z).sub.2; [0079] each
R.sub.z is, independently, H, C.sub.1-C.sub.8 alkyl,
C.sub.1-C.sub.8 haloalkyl, C(.dbd.NH)N(H)R.sub.u,
C(.dbd.O)N(H)R.sub.u or OC(.dbd.O)N(F)R.sub.u; [0080] R.sub.f,
R.sub.g and R.sub.h comprise a ring system having from about 4 to
about 7 carbon atoms or having from about 3 to about 6 carbon atoms
and 1 or 2 heteroatoms wherein said heteroatoms are selected from
oxygen, nitrogen and sulfur and wherein said ring system is
aliphatic, unsaturated aliphatic, aromatic, or saturated or
unsaturated heterocyclic; [0081] R.sub.j is alkyl or haloalkyl
having 1 to about 10 carbon atoms, alkenyl having 2 to about 10
carbon atoms, alkynyl having 2 to about 10 carbon atoms, aryl
having 6 to about 14 carbon atoms, N(R.sub.k)(R.sub.m) OR.sub.k,
halo, SR.sub.k or CN; [0082] m.sub.a is 1 to about 10; [0083] each
mb is, independently, 0 or 1; [0084] mc is 0 or an integer from 1
to 10; [0085] md is an integer from 1 to 10; [0086] me is from 0, 1
or 2; and [0087] provided that when mc is 0, md is greater than
1.
[0088] Representative substituents groups of Formula I are
disclosed in U.S. patent application Ser. No. 09/130,973, filed
Aug. 7, 1998, entitled "Capped 2'-Oxyethoxy Oligonucleotides."
[0089] Representative cyclic substituent groups of Formula II are
disclosed in U.S. patent application Ser. No. 09/123,108, filed
Jul. 27, 1998, entitled "RNA Targeted 2'-Oligomeric compounds that
are Conformationally Preorganized."
[0090] Representative guanidino substituent groups that are shown
in formula III and IV are disclosed in co-owned U.S. patent
application Ser. No. 09/349,040, entitled "Functionalized
Oligomers", filed Jul. 7, 1999.
[0091] Representative acetamido substituent groups are disclosed in
U.S. Pat. No. 6,147,200.
[0092] Representative dimethylaminoethyloxyethyl substituent groups
are disclosed in International Patent Application PCT/US99/17895,
entitled "2'-O-Dimethylaminoethyloxy-ethyl-Oligomeric compounds",
filed Aug. 6, 1999.
[0093] Oligomeric compounds including oligonucleotides may also
include nucleobase (often referred to in the art simply as "base"
or "heterocyclic base moiety") modifications or substitutions. As
used herein, "unmodified" or "natural" nucleobases include the
purine bases adenine (A) and guanine (G), and the pyrimidine bases
thymine (T), cytosine (C) and uracil (U). Modified nucleobases also
referred herein as heterocyclic base moieties include other
synthetic and natural nucleobases such as 5-methylcytosine
(5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine,
2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and
guanine, 2-propyl and other alkyl derivatives of adenine and
guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine,
5-halouracil and cytosine, 5-propynyl (--C.ident.C--CH.sub.3)
uracil and cytosine and other alkynyl derivatives of pyrimidine
bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil),
4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and
other 8-substituted adenines and guanines, 5-halo particularly
5-bromo, 5-trifluoromethyl and other 5-substituted uracils and
cytosines, 7-methylguanine and 7-methyl-adenine, 2-F-adenine,
2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deaza-guanine and
7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
[0094] Heterocyclic base moieties may also include those in which
the purine or pyrimidine base is replaced with other heterocycles,
for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and
2-pyridone. Further nucleobases include those disclosed in U.S.
Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of
Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I.,
ed. John Wiley & Sons, 1990, those disclosed by Englisch et
al., Angewandte Chemie, International Edition, 1991, 30, 613, and
those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research
and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed.,
CRC Press, 1993. Certain of these nucleobases are particularly
useful for increasing the binding affinity of the compositions of
the invention. These include 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
including 2 aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5 methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C.
(Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense
Research and Applications, CRC Press, Boca Raton, 1993, pp.
276-278) and are presently suitable base substitutions, even more
particularly when combined with 2'-O-methoxyethyl sugar
modifications.
[0095] Oligomeric compounds of the present invention can also
include polycyclic heterocyclic compounds in place of one or more
heterocyclic base moieties. A number of tricyclic heterocyclic
compounds have been previously reported. These compounds are
routinely used in antisense applications to increase the binding
properties of the modified strand to a target strand. The most
studied modifications are targeted to guanosines hence they have
been termed G-clamps or cytidine analogs. Many of these polycyclic
heterocyclic compounds have the general formula:
##STR00003##
[0096] Representative cytosine analogs that make 3 hydrogen bonds
with a guanosine in a second strand include
1,3-diazaphenoxazine-2-one (R.sub.10=O, R.sub.11-R.sub.14=H)
(Kurchavov et al., Nucleosides and Nucleotides, 1997, 16,
1837-1846), 1,3-diazaphenothiazine-2-one (R.sub.10=S,
R.sub.11-R.sub.14=H), (Lin et al., J. Am. Chem. Soc., 1995, 117,
3873-3874) and 6,7,8,9-tetrafluoro-1,3-diazaphenoxazine-2-one
(R.sub.10=O, R.sub.11-R.sub.14=F) (Wang et al., Tetrahedron Lett.,
1998, 39, 8385-8388). Incorporated into oligonucleotides these base
modifications were shown to hybridize with complementary guanine
and the latter was also shown to hybridize with adenine and to
enhance helical thermal stability by extended stacking interactions
(also see U.S. patent application entitled "Modified Peptide
Nucleic Acids" filed May 24, 2002, Ser. No. 10/155,920; and U.S.
patent application entitled "Nuclease Resistant Chimeric
Oligonucleotides" filed May 24, 2002, Ser. No. 10/013,295).
[0097] Further helix-stabilizing properties have been observed when
a cytosine analog/substitute has an aminoethoxy moiety attached to
the rigid 1,3-diazaphenoxazine-2-one scaffold (R.sub.10=O,
R.sub.11=--O--(CH.sub.2).sub.2--NH.sub.2, R.sub.12-14=H) (Lin et
al., J. Am. Chem. Soc., 1998, 120, 8531-8532). Binding studies
demonstrated that a single incorporation could enhance the binding
affinity of a model oligonucleotide to its complementary target DNA
or RNA with a .DELTA.T.sub.m of up to 18.degree. relative to
5-methyl cytosine (dC5.sup.me), which is the highest known affinity
enhancement for a single modification, yet. On the other hand, the
gain in helical stability does not compromise the specificity of
the oligonucleotides. The T.sub.m data indicate an even greater
discrimination between the perfect match and mismatched sequences
compared to dC5.sup.me. It was suggested that the tethered amino
group serves as an additional hydrogen bond donor to interact with
the Hoogsteen face, namely the O6, of a complementary guanine
thereby forming 4 hydrogen bonds. This means that the increased
affinity of G-clamp is mediated by the combination of extended base
stacking and additional specific hydrogen bonding.
[0098] Further tricyclic heterocyclic compounds and methods of
using them that are amenable to the present invention are disclosed
in U.S. Pat. No. 6,028,183, which issued on May 22, 2000, and U.S.
Pat. No. 6,007,992, which issued on Dec. 28, 1999.
[0099] The enhanced binding affinity of the phenoxazine derivatives
together with their uncompromised sequence specificity makes them
valuable nucleobase analogs for the development of more potent
antisense-based drugs. In fact, promising data have been derived
from in vitro experiments demonstrating that heptanucleotides
containing phenoxazine substitutions are capable to activate
RNaseH, enhance cellular uptake and exhibit an increased antisense
activity (Lin et al., J. Am. Chem. Soc., 1998, 120, 8531-8532). The
activity enhancement was even more pronounced in case of G-clamp,
as a single substitution was shown to significantly improve the in
vitro potency of a 20mer 2'-deoxyphosphorothioate oligonucleotides
(Flanagan et al., Proc. Natl. Acad. Sci. USA, 1999, 96, 3513-3518).
Nevertheless, to optimize oligonucleotide design and to better
understand the impact of these heterocyclic modifications on the
biological activity, it is important to evaluate their effect on
the nuclease stability of the oligomers.
[0100] Further modified polycyclic heterocyclic compounds useful as
heterocyclcic bases are disclosed in but not limited to, the above
noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205;
5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,646,269;
5,750,692; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, and U.S.
patent application Ser. No. 09/996,292 filed Nov. 28, 2001.
[0101] Oligomeric compounds used in the compositions of the present
invention can also be modified to have one or more moieties or
conjugates which enhance the activity, cellular distribution or
cellular uptake of the resulting oligomeric compounds. In one
embodiment such modified oligomeric compounds are prepared by
covalently attaching conjugate groups to functional groups such as
hydroxyl or amino groups. Conjugate groups of the invention include
intercalators, reporter molecules, polyamines, polyamides,
polyethylene glycols, polyethers, groups that enhance the
pharmacodynamic properties of oligomers, and groups that enhance
the pharmacokinetic properties of oligomers. Typical conjugates
groups include cholesterols, lipids, phospholipids, biotin,
phenazine, folate, phenanthridine, anthraquinone, acridine,
fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance
the pharmaco-dynamic properties, in the context of this invention,
include groups that improve oligomer uptake, enhance oligomer
resistance to degradation, and/or strengthen sequence-specific
hybridization with RNA. Groups that enhance the pharmacokinetic
properties, in the context of this invention, include groups that
improve oligomer uptake, distribution, metabolism or excretion.
Representative conjugate groups are disclosed in International
Patent Application PCT/US92/09196, filed Oct. 23, 1992.
[0102] Conjugate moieties include but are not limited to lipid
moieties such as a cholesterol moiety (Letsinger et al., Proc.
Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan
et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether,
e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci.,
1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let.,
1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl.
Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g.,
dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J.,
1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259,
327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937.
[0103] The oligomeric compounds of the invention may also be
conjugated to active drug substances, for example, aspirin,
warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen,
ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine,
2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a
benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a
barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an
antibacterial or an antibiotic. Oligonucleotide-drug conjugates and
their preparation are described in U.S. patent application Ser. No.
09/334,130 (filed Jun. 15, 1999).
[0104] Representative U.S. patents that teach the preparation of
such oligonucleotide conjugates include, but are not limited to,
U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465;
5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731;
5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603;
5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025;
4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582;
4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963;
5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250;
5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463;
5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142;
5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928
and 5,688,941.
[0105] In one aspect of the present invention oligomeric compounds
include nucleosides synthetically modified to induce a 3'-endo
sugar conformation. A nucleoside can incorporate synthetic
modifications of the heterocyclic base moiety, the sugar moiety or
both to induce a desired 3'-endo sugar conformation. These modified
nucleosides are used to mimic RNA like nucleosides so that
particular properties of an oligomeric compound can be enhanced
while maintaining the desirable 3'-endo conformational geometry.
There is an apparent preference for an RNA type duplex (A form
helix, predominantly 3'-endo) as a requirement of RNA interference
which is supported in part by the fact that duplexes composed of
2'-deoxy-2'-F-nucleosides appear efficient in triggering RNAi
response in the C. elegans system. Properties that are enhanced by
using more stable 3'-endo nucleosides include but aren't limited to
modulation of pharmacokinetic properties through modification of
protein binding, protein off-rate, absorption and clearance;
modulation of nuclease stability as well as chemical stability;
modulation of the binding affinity and specificity of the oligomer
(affinity and specificity for enzymes as well as for complementary
sequences); and increasing efficacy of RNA cleavage. The present
invention provides oligomeric compounds having one or more
nucleosides modified in such a way as to favor a C3'-endo type
conformation.
##STR00004##
[0106] Nucleoside conformation is influenced by various factors
including substitution at the 2', 3' or 4'-positions of the
pentofuranosyl sugar. Electronegative substituents generally prefer
the axial positions, while sterically demanding substituents
generally prefer the equatorial positions (Principles of Nucleic
Acid Structure, Wolfgang Sanger, 1984, Springer-Verlag.)
Modification of the 2' position to favor the 3'-endo conformation
can be achieved while maintaining the 2'-OH as a recognition
element (Gallo et al., Tetrahedron, 2001, 57, 5707-5713;
Harry-O'kuru et al., J. Org. Chem., 1997, 62, 1754-1759; and Tang
et al., J. Org. Chem., 1999, 64, 747-754). Alternatively,
preference for the 3'-endo conformation can be achieved by deletion
of the 2'-OH as exemplified by 2' deoxy-2'F-nucleosides (Kawasaki
et al., J. Med. Chem., 1993, 36, 831-841), which adopts the 3'-endo
conformation positioning the electronegative fluorine atom in the
axial position. Other modifications of the ribose ring, for example
substitution at the 4'-position to give 4'-F modified nucleosides
(Guillerm et al., Bioorganic and Medicinal Chemistry Letters, 1995,
5, 1455-1460; and Owen et al., J. Org. Chem., 1976, 41, 3010-3017),
or for example modification to yield methanocarba nucleoside
analogs (Jacobson et al., J. Med. Chem. Lett., 2000, 43, 2196-2203;
and Lee et al., Bioorganic and Medicinal Chemistry Letters, 2001,
11, 1333-1337) also induce preference for the 3'-endo conformation.
Some modifications actually lock the conformational geometry by
formation of a bicyclic sugar moiety e.g. locked nucleic acid (LNA)
(Singh et al, Chem. Commun., 1998, 4, 455-456), and ethylene
bridged nucleic acids (ENA) (Morita et al, Bioorganic &
Medicinal Chemistry Letters, 2002, 12, 73-76).
[0107] Examples of modified nucleosides amenable to the present
invention are shown below in Table 1. These examples are meant to
be representative and not exhaustive.
[0108] Suitable conformations of modified nucleosides and their
oligomers can be estimated by various methods such as molecular
dynamics calculations, nuclear magnetic resonance spectroscopy and
CD measurements. Hence, modifications predicted to induce RNA like
conformations, A-form duplex geometry in an oligomeric context, are
selected for use in one or more of the oligomeric compounds of the
present invention. The synthesis of numerous of the modified
nucleosides amenable to the present invention are known in the art
(see for example, Chemistry of Nucleosides and Nucleotides Vol 1-3,
ed. Leroy B. Townsend, 1988, Plenum press., and the examples
section below.) Nucleosides known to be inhibitors/substrates for
RNA dependent RNA polymerases (for example HCV NS5B).
[0109] In one aspect, the present invention is directed to
oligomeric compounds that are prepared having enhanced properties
compared to native RNA against nucleic acid targets. A target is
identified and an oligomeric compound is selected having an
effective length and sequence that is complementary to a portion of
the target sequence. Each nucleoside of the selected sequence is
scrutinized for possible enhancing modifications. A suitable
modification would be the replacement of one or more RNA
nucleosides with nucleosides that have the same 3'-endo
conformational geometry. Such modifications can enhance chemical
and nuclease stability relative to native RNA while at the same
time being much cheaper and easier to synthesize and/or incorporate
into an oligomeric compound. The selected sequence can be further
divided into regions and the nucleosides of each region evaluated
for enhancing modifications that can be the result of a chimeric
configuration. Consideration is also given to the termini (e.g. 5'
and 3'-termini) as there are often advantageous modifications that
can be made to one or more of the terminal monomeric subunits. In
one aspect of the invention, desired properties and or activity of
oligomeric compounds are enhanced by the inclusion of a
5'-phosphate or modified phosphate moiety.
[0110] The terms used to describe the conformational geometry of
homoduplex nucleic acids are "A Form" for RNA and "B Form" for DNA.
The respective conformational geometry for RNA and DNA duplexes was
determined from X-ray diffraction analysis of nucleic acid fibers
(Arnott et al., Biochem. Biophys. Res. Comm., 1970, 47, 1504). In
general, RNA:RNA duplexes are more stable and have higher melting
temperatures (Tm's) than DNA:DNA duplexes (Sanger et al.,
Principles of Nucleic Acid Structure, 1984, Springer-Verlag; New
York, N.Y.; Lesnik et al., Biochemistry, 1995, 34, 10807-10815;
Conte et al., Nucleic Acids Res., 1997, 25, 2627-2634). The
increased stability of RNA has been attributed to several
structural features, most notably the improved base stacking
interactions that result from an A-form geometry (Searle et al.,
Nucleic Acids Res., 1993, 21, 2051-2056). The presence of the 2'
hydroxyl in RNA biases the sugar toward a C3' endo pucker, i.e.,
also designated as Northern pucker, which causes the duplex to
favor the A-form geometry. In addition, the 2' hydroxyl groups of
RNA can form a network of water mediated hydrogen bonds that help
stabilize the RNA duplex (Egli et al., Biochemistry, 1996, 35,
8489-8494). On the other hand, deoxy nucleic acids prefer a C2'
endo sugar pucker, i.e., also known as Southern pucker, which is
thought to impart a less stable B-form geometry (Sanger, W. (1984)
Principles of Nucleic Acid Structure, Springer-Verlag, New York,
N.Y.). As used herein, B-form geometry is inclusive of both
C2'-endo pucker and O4'-endo pucker. This is consistent with Berger
et. al., Nucleic Acids Research, 1998, 26, 2473-2480, who pointed
out that in considering the furanose conformations which give rise
to B-form duplexes consideration should also be given to a O4'-endo
pucker contribution.
[0111] DNA:RNA hybrid duplexes, however, are usually less stable
than pure RNA:RNA duplexes, and depending on their sequence may be
either more or less stable than DNA:DNA duplexes (Searle et al.,
Nucleic Acids Res., 1993, 21, 2051-2056). The structure of a hybrid
duplex is intermediate between A- and B-form geometries, which may
result in poor stacking interactions (Lane et al., Eur. J.
Biochem., 1993, 215, 297-306; Fedoroff et al., J. Mol. Biol., 1993,
233, 509-523; Gonzalez et al., Biochemistry, 1995, 34, 4969-4982;
Horton et al., J. Mol. Biol., 1996, 264, 521-533). The stability of
the duplex formed between a target RNA and a synthetic sequence is
central to therapies such as but not limited to antisense and RNA
interference as these mechanisms require the binding of a synthetic
strand of oligomeric compound to an RNA target strand. In the case
of antisense, effective inhibition of the mRNA requires that the
antisense DNA have a very high binding affinity with the mRNA.
Otherwise the desired interaction between the synthetic strand and
target mRNA strand will occur infrequently, resulting in decreased
efficacy.
[0112] One routinely used method of modifying the sugar puckering
is the substitution of the sugar at the 2'-position with a
substituent group that influences the sugar geometry. The influence
on ring conformation is dependant on the nature of the substituent
at the 2'-position. A number of different substituents have been
studied to determine their sugar puckering effect. For example,
2'-halogens have been studied showing that the 2'-fluoro derivative
exhibits the largest population (65%) of the C3'-endo form, and the
2'-iodo exhibits the lowest population (7%). The populations of
adenosine (2'-OH) versus deoxyadenosine (2'-H) are 36% and 19%,
respectively. Furthermore, the effect of the 2'-fluoro group of
adenosine dimers
(2'-deoxy-2'-fluoroadenosine-2'-deoxy-2'-fluoro-adenosine) is
further correlated to the stabilization of the stacked
conformation.
[0113] As expected, the relative duplex stability can be enhanced
by replacement of 2'-OH groups with 2'-F groups thereby increasing
the C3'-endo population. It is assumed that the highly polar nature
of the 2'-F bond and the extreme preference for C3'-endo puckering
may stabilize the stacked conformation in an A-form duplex. Data
from UV hypochromicity, circular dichroism, and .sup.1H NMR also
indicate that the degree of stacking decreases as the
electronegativity of the halo substituent decreases. Furthermore,
steric bulk at the 2'-position of the sugar moiety is better
accommodated in an A-form duplex than a B-form duplex. Thus, a
2'-substituent on the 3'-terminus of a dinucleoside monophosphate
is thought to exert a number of effects on the stacking
conformation: steric repulsion, furanose puckering preference,
electrostatic repulsion, hydrophobic attraction, and hydrogen
bonding capabilities. These substituent effects are thought to be
determined by the molecular size, electronegativity, and
hydrophobicity of the substituent. Melting temperatures of
complementary strands is also increased with the 2'-substituted
adenosine diphosphates. It is not clear whether the 3'-endo
preference of the conformation or the presence of the substituent
is responsible for the increased binding. However, greater overlap
of adjacent bases (stacking) can be achieved with the 3'-endo
conformation.
[0114] One synthetic 2'-modification that imparts increased
nuclease resistance and a very high binding affinity to nucleotides
is the 2-methoxyethoxy (2'-MOE, 2'-OCH.sub.2CH.sub.2OCH.sub.3) side
chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). One
of the immediate advantages of the 2'-MOE substitution is the
improvement in binding affinity, which is greater than many similar
2' modifications such as O-methyl, O-propyl, and O-aminopropyl.
Oligonucleotides having the 2'-O-methoxyethyl substituent also have
been shown to be antisense inhibitors of gene expression with
promising features for in vivo use (Martin, P., Helv. Chim. Acta,
1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176;
Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and
Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).
Relative to DNA, the oligonucleotides having the 2'-MOE
modification displayed improved RNA affinity and higher nuclease
resistance. Chimeric oligonucleotides having 2'-MOE substituents in
the wing nucleosides and an internal region of
deoxy-phosphorothioate nucleotides (also termed a gapped
oligonucleotide or gapmer) have shown effective reduction in the
growth of tumors in animal models at low doses. 2'-MOE substituted
oligonucleotides have also shown outstanding promise as antisense
agents in several disease states. One such MOE substituted
oligonucleotide is presently being investigated in clinical trials
for the treatment of CMV retinitis.
[0115] To better understand the higher RNA affinity of
2'-O-methoxyethyl substituted RNA and to examine the conformational
properties of the 2'-O-methoxyethyl substituent, two dodecamer
oligonucleotides were synthesized having SEQ ID NO: 18 (CGC GAA UUC
GCG) and SEQ ID NO: 19 (GCG CUU AAG CGC). These self-complementary
strands have every 2'-position modified with a 2'-O-methoxyethyl.
The duplex was crystallized at a resolution of 1.7 .ANG.ngstrom and
the crystal structure was determined. The conditions used for the
crystallization were 2 mM oligonucleotide, 50 mM Na Hepes pH
6.2-7.5, 10.50 mM MgCl.sub.2, 15% PEG 400. The crystal data showed:
space group C2, cell constants a=41.2 .ANG., b=34.4 .ANG., c=46.6
.ANG., .=92.4.degree.. The resolution was 1.7 .ANG. at -170.degree.
C. The current R=factor was 20% (R.sub.free 26%).
[0116] This crystal structure is believed to be the first crystal
structure of a fully modified RNA oligonucleotide analogue. The
duplex adopts an overall A-form conformation and all modified
sugars display C3'-endo pucker. In most of the 2'-O-substituents,
the torsion angle around the A'-B' bond, as depicted in Structure
II below, of the ethylene glycol linker has a gauche conformation.
For 2'-O-MOE, A' and B' of Structure II below are methylene
moieties of the ethyl portion of the MOE and R' is the methoxy
portion.
##STR00005##
[0117] In the crystal, the 2'-O-MOE RNA duplex adopts a general
orientation such that the crystallographic 2-fold rotation axis
does not coincide with the molecular 2-fold rotation axis. The
duplex adopts the expected A-type geometry and all of the 24
2'-O-MOE substituents were visible in the electron density maps at
full resolution. The electron density maps as well as the
temperature factors of substituent atoms indicate flexibility of
the 2'-O-MOE substituent in some cases.
[0118] Most of the 2'-O-MOE substituents display a gauche
conformation around the C--C bond of the ethyl linker. However, in
two cases, a trans conformation around the C--C bond is observed.
The lattice interactions in the crystal include packing of duplexes
against each other via their minor grooves. Therefore, for some
residues, the conformation of the 2'-O-substituent is affected by
contacts to an adjacent duplex. In general, variations in the
conformation of the substituents (e.g. g.sup.+ or g.sup.- around
the C--C bonds) create a range of interactions between
substituents, both inter-strand, across the minor groove, and
intra-strand. At one location, atoms of substituents from two
residues are in van der Waals contact across the minor groove.
Similarly, a close contact occurs between atoms of substituents
from two adjacent intra-strand residues.
[0119] Previously determined crystal structures of A-DNA duplexes
were for those that incorporated isolated 2'-O-methyl T residues.
In the crystal structure noted above for the 2'-O-MOE substituents,
a conserved hydration pattern has been observed for the 2'-O-MOE
residues. A single water molecule is seen located between O2', O3'
and the methoxy oxygen atom of the substituent, forming contacts to
all three of between 2.9 and 3.4 .ANG.. In addition, oxygen atoms
of substituents are involved in several other hydrogen bonding
contacts. For example, the methoxy oxygen atom of a particular
2'-O-substituent forms a hydrogen bond to N3 of an adenosine from
the opposite strand via a bridging water molecule.
[0120] In several cases a water molecule is trapped between the
oxygen atoms O2', O3' and OC' of modified nucleosides. 2'-O-MOE
substituents with trans conformation around the C--C bond of the
ethylene glycol linker are associated with close contacts between
OC' and N2 of a guanosine from the opposite strand, and,
water-mediated, between OC' and N3(G). When combined with the
available thermodynamic data for duplexes containing 2'-O-MOE
modified strands, this crystal structure allows for further
detailed structure-stability analysis of other modifications.
[0121] In extending the crystallographic structure studies,
molecular modeling experiments were performed to study further
enhanced binding affinity of oligonucleotides having
2'-O-modifications. The computer simulations were conducted on
compounds of SEQ ID NO: 18, above, having 2'-O-modifications
located at each of the nucleosides of the oligonucleotide. The
simulations were performed with the oligonucleotide in aqueous
solution using the AMBER force field method (Cornell et al., J. Am.
Chem. Soc., 1995, 117, 5179-5197) (modeling software package from
UCSF, San Francisco, Calif.). The calculations were performed on an
Indigo2 SGI machine (Silicon Graphics, Mountain View, Calif.).
[0122] Further 2'-O-modifications that will have a 3'-endo sugar
influence include those having a ring structure that incorporates a
two atom portion corresponding to the A' and B' atoms of Structure
II. The ring structure is attached at the 2' position of a sugar
moiety of one or more nucleosides that are incorporated into an
oligonucleotide. The 2'-oxygen of the nucleoside links to a carbon
atom corresponding to the A' atom of Structure II. These ring
structures can be aliphatic, unsaturated aliphatic, aromatic or
heterocyclic. A further atom of the ring (corresponding to the B'
atom of Structure II), bears a further oxygen atom, or a sulfur or
nitrogen atom. This oxygen, sulfur or nitrogen atom is bonded to
one or more hydrogen atoms, alkyl moieties, or haloalkyl moieties,
or is part of a further chemical moiety such as a ureido,
carbamate, amide or amidine moiety. The remainder of the ring
structure restricts rotation about the bond joining these two ring
atoms. This assists in positioning the "further oxygen, sulfur or
nitrogen atom" (part of the R position as described above) such
that the further atom can be located in close proximity to the
3'-oxygen atom (O3') of the nucleoside.
[0123] Another suitable 2'-sugar substituent group that gives a
3'-endo sugar conformational geometry is the 2'-OMe group.
2'-Substitution of guanosine, cytidine, and uridine dinucleoside
phosphates with the 2'-OMe group showed enhanced stacking effects
with respect to the corresponding native (2'-OH) species leading to
the conclusion that the sugar is adopting a C3'-endo conformation.
In this case, it is believed that the hydrophobic attractive forces
of the methyl group tend to overcome the destabilizing effects of
its steric bulk.
[0124] The ability of oligonucleotides to bind to their
complementary target strands is compared by determining the melting
temperature (T.sub.m) of the hybridization complex of the
oligonucleotide and its complementary strand. The melting
temperature (T.sub.m), a characteristic physical property of double
helices, denotes the temperature (in degrees centigrade) at which
50% helical (hybridized) versus coil (unhybridized) forms are
present. T.sub.m is measured by using the UV spectrum to determine
the formation and breakdown (melting) of the hybridization complex.
Base stacking, which occurs during hybridization, is accompanied by
a reduction in UV absorption (hypochromicity). Consequently, a
reduction in UV absorption indicates a higher T.sub.m. The higher
the T.sub.m, the greater the strength of the bonds between the
strands.
[0125] Freier and Altmann, Nucleic Acids Research, 1997, 25,
4429-4443, have previously published a study on the influence of
structural modifications of oligonucleotides on the stability of
their duplexes with target RNA. In this study, the authors reviewed
a series of oligonucleotides containing more than 200 different
modifications that had been synthesized and assessed for their
hybridization affinity and Tm. Sugar modifications studied included
substitutions on the 2'-position of the sugar, 3'-substitution,
replacement of the 4'-oxygen, the use of bicyclic sugars, and four
member ring replacements. Several nucleobase modifications were
also studied including substitutions at the 5, or 6 position of
thymine, modifications of pyrimidine heterocycle and modifications
of the purine heterocycle. Modified internucleoside linkages were
also studied including neutral, phosphorus and non-phosphorus
containing internucleoside linkages.
[0126] Increasing the percentage of C3'-endo sugars in a modified
oligonucleotide targeted to an RNA target strand should preorganize
this strand for binding to RNA. Of the several sugar modifications
that have been reported and studied in the literature, the
incorporation of electronegative substituents such as 2'-fluoro or
2'-alkoxy shift the sugar conformation towards the 3' endo
(northern) pucker conformation. This preorganizes an
oligonucleotide that incorporates such modifications to have an
A-form conformational geometry. This A-form conformation results in
increased binding affinity of the oligonucleotide to a target RNA
strand.
[0127] Molecular modeling experiments were performed to study
further enhanced binding affinity of oligonucleotides having
2'-O-modifications. Computer simulations were conducted on
compounds having r(CGC GAA UUC GCG) (SEQ ID NO: 18), having
2'-O-modifications of the invention located at each of the
nucleoside of the oligonucleotide. The simulations were performed
with the oligonucleotide in aqueous solution using the AMBER force
field method (Cornell et al., J. Am. Chem. Soc., 1995, 117,
5179-5197) (modeling software package from UCSF, San Francisco,
Calif.). The calculations were performed on an Indigo2 SGI machine
(Silicon Graphics, Mountain View, Calif.).
[0128] In addition, for 2'-substituents containing an ethylene
glycol motif, a gauche interaction between the oxygen atoms around
the O--C--C--O torsion of the side chain may have a stabilizing
effect on the duplex (Freier ibid.). Such gauche interactions have
been observed experimentally for a number of years (Wolfe et al.,
Acc. Chem. Res., 1972, 5, 102; Abe et al., J. Am. Chem. Soc., 1976,
98, 468). This gauche effect may result in a configuration of the
side chain that is favorable for duplex formation. The exact nature
of this stabilizing configuration has not yet been explained. While
we do not want to be bound by theory, it may be that holding the
O--C--C--O torsion in a single gauche configuration, rather than a
more random distribution seen in an alkyl side chain, provides an
entropic advantage for duplex formation.
[0129] Representative 2'-substituent groups amenable to the present
invention that give A-form conformational properties (3'-endo) to
the resultant duplexes include 2'-O-alkyl, 2'-O-substituted alkyl
and 2'-fluoro substituent groups. Suitable substituent groups are
various alkyl and aryl ethers and thioethers, amines and monoalkyl
and dialkyl substituted amines. It is further intended that
multiple modifications can be made to one or more of the oligomeric
compounds of the invention at multiple sites of one or more
monomeric subunits (nucleosides are suitable) and or
internucleoside linkages to enhance properties such as but not
limited to activity in a selected application. Tables 2 through 8
list nucleoside and internucleotide linkage
modifications/replacements that have been shown to give a positive
.epsilon.Tm per modification when the modification/replacement was
made to a DNA strand that was hybridized to an RNA complement.
[0130] Substitution at R.sub.1 can be stabilizing, substitution at
R.sub.2 is generally greatly destabilizing (unable to form anti
conformation), motiffs with stabilizing 5 and 2'-substituent groups
are generally additive e.g. increase stability.
[0131] Substitution of the O4 and O2 positions of 2'-O-methyl
uridine was greatly duplex destabilizing as these modifications
remove hydrogen binding sites that would be an expected result.
6-Aza T also showed extreme destabilization as this substitution
reduces the pK.sub.a and shifts the nucleoside toward the enol
tautomer resulting in reduced hydrogen bonding.
[0132] Suitable ring structures of the invention for inclusion as a
2'-O modification include cyclohexyl, cyclopentyl and phenyl rings
as well as heterocyclic rings having spacial footprints similar to
cyclohexyl, cyclopentyl and phenyl rings. Particularly suitable
2'-O-substituent groups of the invention are listed below including
an abbreviation for each: [0133] 2'-O-(trans 2-methoxy
cyclohexyl)-2'-O-(TMCHL) [0134] 2'-O-(trans 2-methoxy
cyclopentyl)-2'-O-(TMCPL) [0135] 2'-O-(trans 2-ureido
cyclohexyl)-2'-O-(TUCHL) [0136] 2'-O-(trans
2-methoxyphenyl)-2'-O-(2MP)
[0137] Structural details for duplexes incorporating such
2-O-substituents were analyzed using the described AMBER force
field program on the Indigo2 SGI machine. The simulated structure
maintained a stable A-form geometry throughout the duration of the
simulation. The presence of the 2' substitutions locked the sugars
in the C3'-endo conformation.
[0138] The simulation for the TMCHL modification revealed that the
2'-O-(TMCHL) side chains have a direct interaction with water
molecules solvating the duplex. The oxygen atoms in the
2'-O-(TMCHL) side chain are capable of forming a water-mediated
interaction with the 3' oxygen of the phosphate backbone. The
presence of the two oxygen atoms in the 2'-O-(TMCHL) side chain
gives rise to favorable gauche interactions. The barrier for
rotation around the O--C--C--O torsion is made even larger by this
novel modification. The preferential preorganization in an A-type
geometry increases the binding affinity of the 2'-O-(TMCHL) to the
target RNA. The locked side chain conformation in the 2'-O-(TMCHL)
group created a more favorable pocket for binding water molecules.
The presence of these water molecules played a key role in holding
the side chains in the preferable gauche conformation. While not
wishing to be bound by theory, the bulk of the substituent, the
diequatorial orientation of the substituents in the cyclohexane
ring, the water of hydration and the potential for trapping of
metal ions in the conformation generated will additionally
contribute to improved binding affinity and nuclease resistance of
oligonucleotides incorporating nucleosides having this
2'-O-modification.
[0139] As described for the TMCHL modification above, identical
computer simulations of the 2'-O-(TMCPL), the 2'-O-(2 MP) and
2'-O-(TUCHL) modified oligonucleotides in aqueous solution also
illustrate that stable A-form geometry will be maintained
throughout the duration of the simulation. The presence of the 2'
substitution will lock the sugars in the C3'-endo conformation and
the side chains will have direct interaction with water molecules
solvating the duplex. The oxygen atoms in the respective side
chains are capable of forming a water-mediated interaction with the
3' oxygen of the phosphate backbone. The presence of the two oxygen
atoms in the respective side chains give rise to the favorable
gauche interactions. The barrier for rotation around the respective
O--C--C--O torsions will be made even larger by respective
modification. The preferential preorganization in A-type geometry
will increase the binding affinity of the respective 2'-O-modified
oligonucleotides to the target RNA. The locked side chain
conformation in the respective modifications will create a more
favorable pocket for binding water molecules. The presence of these
water molecules plays a key role in holding the side chains in the
preferable gauche conformation. The bulk of the substituent, the
diequatorial orientation of the substituents in their respective
rings, the water of hydration and the potential trapping of metal
ions in the conformation generated will all contribute to improved
binding affinity and nuclease resistance of oligonucleotides
incorporating nucleosides having these respective
2'-O-modification.
[0140] Ribose conformations in C2'-modified nucleosides containing
S-methyl groups were examined. To understand the influence of
2'-O-methyl and 2'-S-methyl groups on the conformation of
nucleosides, we evaluated the relative energies of the 2'-O- and
2'-S-methylguanosine, along with normal deoxyguanosine and
riboguanosine, starting from both C2'-endo and C3'-endo
conformations using ab initio quantum mechanical calculations. All
the structures were fully optimized at HF/6-31G* level and single
point energies with electron-correlation were obtained at the
MP2/6-31G*//HF/6-31G* level. As shown in Table 9, the C2'-endo
conformation of deoxyguanosine is estimated to be 0.6 kcal/mol more
stable than the C3'-endo conformation in the gas-phase. The
conformational preference of the C2'-endo over the C3'-endo
conformation appears to be less dependent upon electron correlation
as revealed by the MP2/6-31G*//HF/6-31G* values which also predict
the same difference in energy. The opposite trend is noted for
riboguanosine. At the HF/6-31G* and MP2/6-31G*//HF/6-31G* levels,
the C3'-endo form of riboguanosine is shown to be about 0.65 and
1.41 kcal/mol more stable than the C2' endo form, respectively.
[0141] Table 9 also includes the relative energies of
2'-O-methylguanosine and 2'-S-methylguanosine in C2'-endo and
C3'-endo conformation. This data indicates the electronic nature of
C2'-substitution has a significant impact on the relative stability
of these conformations. Substitution of the 2'-O-methyl group
increases the preference for the C3'-endo conformation (when
compared to riboguanosine) by about 0.4 kcal/mol at both the
HF/6-31G* and MP2/6-31G*//HF/6-31G* levels. In contrast, the
2'-S-methyl group reverses the trend. The C2'-endo conformation is
favored by about 2.6 kcal/mol at the HF/6-31G* level, while the
same difference is reduced to 1.41 kcal/mol at the
MP2/6-31G*//HF/6-31G* level. For comparison, and also to evaluate
the accuracy of the molecular mechanical force-field parameters
used for the 2'-O-methyl and 2'-S-methyl substituted nucleosides,
we have calculated the gas phase energies of the nucleosides. The
results reported in Table 9 indicate that the calculated relative
energies of these nucleosides compare qualitatively well with the
ab initio calculations.
[0142] Additional calculations were also performed to gauge the
effect of solvation on the relative stability of nucleoside
conformations. The estimated solvation effect using HF/6-31G*
geometries confirms that the relative energetic preference of the
four nucleosides in the gas-phase is maintained in the aqueous
phase as well (Table 9). Solvation effects were also examined using
molecular dynamics simulations of the nucleosides in explicit
water. From these trajectories, one can observe the predominance of
C2'-endo conformation for deoxyriboguanosine and
2'-S-methylriboguanosine while riboguanosine and
2'-O-methylriboguanosine prefer the C3'-endo conformation. These
results are in much accord with the available NMR results on
2'-S-methylribonucleosides. NMR studies of sugar puckering
equilibrium using vicinal spin-coupling constants have indicated
that the conformation of the sugar ring in 2'-S-methylpyrimidine
nucleosides show an average of >75% S-character, whereas the
corresponding purine analogs exhibit an average of >90% S-pucker
(Fraser et al., J. Heterocycl. Chem., 1993, 30, 1277-1287). It was
observed that the 2'-S-methyl substitution in deoxynucleoside
confers more conformational rigidity to the sugar conformation when
compared with deoxyribonucleosides.
[0143] Structural features of DNA:RNA, OMe-DNA:RNA and SMe-DNA:RNA
hybrids were also observed. The average RMS deviation of the
DNA:RNA structure from the starting hybrid coordinates indicate the
structure is stabilized over the length of the simulation with an
approximate average RMS deviation of 1.0 .ANG.. This deviation is
due, in part, to inherent differences in averaged structures (i.e.
the starting conformation) and structures at thermal equilibrium.
The changes in sugar pucker conformation for three of the central
base pairs of this hybrid are in good agreement with the
observations made in previous NMR studies. The sugars in the RNA
strand maintain very stable geometries in the C3'-endo conformation
with ring pucker values near 0.degree.. In contrast, the sugars of
the DNA strand show significant variability.
[0144] The average RMS deviation of the OMe-DNA:RNA is
approximately 1.2 .ANG. from the starting A-form conformation;
while the SMe-DNA:RNA shows a slightly higher deviation
(approximately 1.8 .ANG.) from the starting hybrid conformation.
The SMe-DNA strand also shows a greater variance in RMS deviation,
suggesting the S-methyl group may induce some structural
fluctuations. The sugar puckers of the RNA complements maintain
C3'-endo puckering throughout the simulation. As expected from the
nucleoside calculations, however, significant differences are noted
in the puckering of the OMe-DNA and SMe-DNA strands, with the
former adopting C3'-endo, and the latter, C1'-exo/C2'-endo
conformations.
[0145] An analysis of the helicoidal parameters for all three
hybrid structures has also been performed to further characterize
the duplex conformation. Three of the more important axis-basepair
parameters that distinguish the different forms of the duplexes,
X-displacement, propeller twist, and inclination, are reported in
Table 10. Usually, an X-displacement near zero represents a B-form
duplex; while a negative displacement, which is a direct measure of
deviation of the helix from the helical axis, makes the structure
appear more A-like in conformation. In A-form duplexes, these
values typically vary from -4 .ANG. to -5 .ANG.. In comparing these
values for all three hybrids, the SMe_DNA:RNA hybrid shows the most
deviation from the A-form value, the OMe_DNA:RNA shows the least,
and the DNA:RNA is intermediate. A similar trend is also evident
when comparing the inclination and propeller twist values with
ideal A-form parameters. These results are further supported by an
analysis of the backbone and glycosidic torsion angles of the
hybrid structures. Glycosidic angles (X) of A-form geometries, for
example, are typically near -159.degree. while B form values are
near -102.degree.. These angles are found to be -162.degree.,
-133.degree., and -108.degree. for the OMe-DNA, DNA, and SMe-DNA
strands, respectively. All RNA complements adopt an X angle close
to -160.degree.. In addition, "crankshaft" transitions were also
noted in the backbone torsions of the central UpU steps of the RNA
strand in the SMe-DNA:RNA and DNA; RNA hybrids. Such transitions
suggest some local conformational changes may occur to relieve a
less favorable global conformation. Taken overall, the results
indicate the amount of A-character decreases as
OMe-DNA:RNA>DNA:RNA>SMe-DNA:RNA, with the latter two adopting
more intermediate conformations when compared to A- and B-form
geometries.
[0146] Stability of C2'-modified DNA:RNA hybrids was determined.
Although the overall stability of the DNA:RNA hybrids depends on
several factors including sequence-dependencies and the purine
content in the DNA or RNA strands DNA:RNA hybrids are usually less
stable than RNA:RNA duplexes and, in some cases, even less stable
than DNA:DNA duplexes. Available experimental data attributes the
relatively lowered stability of DNA:RNA hybrids largely to its
intermediate conformational nature between DNA:DNA (B-family) and
RNA:RNA (A-family) duplexes. The overall thermodynamic stability of
nucleic acid duplexes may originate from several factors including
the conformation of backbone, base-pairing and stacking
interactions. While it is difficult to ascertain the individual
thermodynamic contributions to the overall stabilization of the
duplex, it is reasonable to argue that the major factors that
promote increased stability of hybrid duplexes are better stacking
interactions (electrostatic .pi.-.pi. interactions) and more
favorable groove dimensions for hydration. The C2'-S-methyl
substitution has been shown to destabilize the hybrid duplex. The
notable differences in the rise values among the three hybrids may
offer some explanation. While the 2'-S-methyl group has a strong
influence on decreasing the base-stacking through high rise values
(.about.3.2 .ANG.), the 2'-O-methyl group makes the overall
structure more compact with a rise value that is equal to that of
A-form duplexes (.about.2.6 .ANG.). Despite its overall A-like
structural features, the SMe_DNA:RNA hybrid structure possesses an
average rise value of 3.2 .ANG. which is quite close to that of
B-family duplexes. In fact, some local base-steps (CG steps) may be
observed to have unusually high rise values (as high as 4.5 .ANG.).
Thus, the greater destabilization of 2'-S-methyl substituted
DNA:RNA hybrids may be partly attributed to poor stacking
interactions.
[0147] It has been postulated that RNase H binds to the minor
groove of RNA:DNA hybrid complexes, requiring an intermediate minor
groove width between ideal A- and B-form geometries to optimize
interactions between the sugar phosphate backbone atoms and RNase
H. A close inspection of the averaged structures for the hybrid
duplexes using computer simulations reveals significant variation
in the minor groove width dimensions as shown in Table 3. Whereas
the O-methyl substitution leads to a slight expansion of the minor
groove width when compared to the standard DNA:RNA complex, the
S-methyl substitution leads to a general contraction (approximately
0.9 .ANG.). These changes are most likely due to the preferred
sugar puckering noted for the antisense strands which induce either
A- or B-like single strand conformations. In addition to minor
groove variations, the results also point to potential differences
in the steric makeup of the minor groove. The O-methyl group points
into the minor groove while the S-methyl is directed away towards
the major groove. Essentially, the S-methyl group has flipped
through the bases into the major groove as a consequence of
C2'-endo puckering.
[0148] Unless otherwise defined herein, alkyl means
C.sub.1-C.sub.12, C.sub.1-C.sub.8, or C.sub.1-C.sub.6, straight or
(where possible) branched chain aliphatic hydrocarbyl.
[0149] Unless otherwise defined herein, heteroalkyl means
C.sub.1-C.sub.12, C.sub.1-C.sub.8, or C.sub.1-C.sub.6, straight or
(where possible) branched chain aliphatic hydrocarbyl containing at
least one or about 1 to about 3, hetero atoms in the chain,
including the terminal portion of the chain. Suitable heteroatoms
include N, O and S.
[0150] Unless otherwise defined herein, cycloalkyl means
C.sub.3-C.sub.12, C.sub.3-C.sub.8, or C.sub.3-C.sub.6, aliphatic
hydrocarbyl ring.
[0151] Unless otherwise defined herein, alkenyl means
C.sub.2-C.sub.12, C.sub.2-C.sub.8, or C.sub.2-C.sub.6 alkenyl,
which may be straight or (where possible) branched hydrocarbyl
moiety, which contains at least one carbon-carbon double bond.
[0152] Unless otherwise defined herein, alkynyl means
C.sub.2-C.sub.12, C.sub.2-C.sub.8, or C.sub.2-C.sub.6 alkynyl,
which may be straight or (where possible) branched hydrocarbyl
moiety, which contains at least one carbon-carbon triple bond.
[0153] Unless otherwise defined herein, heterocycloalkyl means a
ring moiety containing at least three ring members, at least one of
which is carbon, and of which 1, 2 or three ring members are other
than carbon. The number of carbon atoms can vary from 1 to about
12, from 1 to about 6, and the total number of ring members varies
from three to about 15, or from about 3 to about 8. Suitable ring
heteroatoms are N, O and S. Suitable heterocycloalkyl groups
include, but are not limited to, morpholino, thiomorpholino,
piperidinyl, piperazinyl, homopiperidinyl, homopiperazinyl,
homomorpholino, homothiomorpholino, pyrrolodinyl,
tetrahydrooxazolyl, tetrahydroimidazolyl, tetrahydrothiazolyl,
tetrahydroisoxazolyl, tetrahydropyrrazolyl, furanyl, pyranyl, and
tetrahydroisothiazolyl.
[0154] Unless otherwise defined herein, aryl means any hydrocarbon
ring structure containing at least one aryl ring. Suitable aryl
rings have about 6 to about 20 ring carbons. In addition, suitable
aryl rings include phenyl, napthyl, anthracenyl, and
phenanthrenyl.
[0155] Unless otherwise defined herein, hetaryl means a ring moiety
containing at least one fully unsaturated ring, the ring consisting
of carbon and non-carbon atoms. The ring system can contain about 1
to about 4 rings. The number of carbon atoms can vary from 1 to
about 12, from 1 to about 6, and the total number of ring members
varies from three to about 15, or from about 3 to about 8. Suitable
ring heteroatoms are N, O and S. Suitable hetaryl moieties include,
but are not limited to, pyrazolyl, thiophenyl, pyridyl, imidazolyl,
tetrazolyl, pyridyl, pyrimidinyl, purinyl, quinazolinyl,
quinoxalinyl, benzimidazolyl, benzothiophenyl, etc.
[0156] Unless otherwise defined herein, where a moiety is defined
as a compound moiety, such as hetarylalkyl (hetaryl and alkyl),
aralkyl (aryl and alkyl), etc., each of the sub-moieties is as
defined herein.
[0157] Unless otherwise defined herein, an electron withdrawing
group is a group, such as the cyano or isocyanato group that draws
electronic charge away from the carbon to which it is attached.
Other electron withdrawing groups of note include those whose
electronegativities exceed that of carbon, for example halogen,
nitro, or phenyl substituted in the ortho- or para-position with
one or more cyano, isothiocyanato, nitro or halo groups.
[0158] Unless otherwise defined herein, the terms halogen and halo
have their ordinary meanings. Suitable halo (halogen) substituents
are Cl, Br, and I.
[0159] The aforementioned optional substituents are, unless
otherwise herein defined, suitable substituents depending upon
desired properties. Included are halogens (Cl, Br, I), alkyl,
alkenyl, and alkynyl moieties, NO.sub.2, NH.sub.3 (substituted and
unsubstituted), acid moieties (e.g. --CO.sub.2H,
--OSO.sub.3H.sub.2, etc.), heterocycloalkyl moieties, hetaryl
moieties, aryl moieties, etc.
[0160] In all the preceding formulae, the squiggle (.about.)
indicates a bond to an oxygen or sulfur of the 5'-phosphate.
Phosphate protecting groups include those described in U.S. Pat.
No. 5,760,209, U.S. Pat. No. 5,614,621, U.S. Pat. No. 6,051,699,
U.S. Pat. No. 6,020,475, U.S. Pat. No. 6,326,478, U.S. Pat. No.
6,169,177, U.S. Pat. No. 6,121,437, U.S. Pat. No. 6,465,628.
[0161] Oligomerization of modified and unmodified nucleosides is
performed according to literature procedures for DNA (Protocols for
Oligonucleotides and Analogs, Ed. Agrawal (1993), Humana Press)
and/or RNA (Scaringe, Methods (2001), 23, 206-217. Gait et al.,
Applications of Chemically synthesized RNA in RNA:Protein
Interactions, Ed. Smith (1998), 1-36. Gallo et al., Tetrahedron,
2001, 57, 5707-5713) synthesis as appropriate. In addition,
specific protocols for the synthesis of oligomeric compounds of the
invention are illustrated in the examples below.
[0162] The oligomeric compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0163] The present invention is also useful for the preparation of
oligomeric compounds incorporating at least one 2'-O-protected
nucleoside. After incorporation and appropriate deprotection the
2'-O-protected nucleoside will be converted to a ribonucleoside at
the position of incorporation. The number and position of the
2-ribonucleoside units in the final oligomeric compound can vary
from one at any site or the strategy can be used to prepare up to a
full 2'-OH modified oligomeric compound. All 2'-O-protecting groups
amenable to the synthesis of oligomeric compounds are included in
the present invention. In general a protected nucleoside is
attached to a solid support by for example a succinate linker. Then
the oligonucleotide is elongated by repeated cycles of deprotecting
the 5'-terminal hydroxyl group, coupling of a further nucleoside
unit, capping and oxidation (alternatively sulfurization). In a
more frequently used method of synthesis the completed
oligonucleotide is cleaved from the solid support with the removal
of phosphate protecting groups and exocyclic amino protecting
groups by treatment with an ammonia solution. Then a further
deprotection step is normally required for removal of the more
specialized protecting groups used for the protection of
2'-hydroxyl groups thereby affording the fully deprotected
oligonucleotide.
[0164] A large number of 2'-O-protecting groups have been used for
the synthesis of oligoribonucleotides but over the years more
effective groups have been discovered. The key to an effective
2'-O-protecting group is that it is capable of selectively being
introduced at the 2'-O-position and that it can be removed easily
after synthesis without the formation of unwanted side products.
The protecting group also needs to be inert to the normal
deprotecting, coupling, and capping steps required for
oligoribonucleotide synthesis. Some of the protecting groups used
initially for oligoribonucleotide synthesis included
tetrahydropyran-1-yl and 4-methoxytetrahydropyran-4-yl. These two
groups are not compatible with all 5'-O-protecting groups so
modified versions were used with 5'-DMT groups such as
1-(2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp). Reese has
identified a number of piperidine derivatives (like Fpmp) that are
useful in the synthesis of oligoribonucleotides including
1-((chloro-4-methyl)phenyl)-4'-methoxypiperidin-4-yl (Reese et al.,
Tetrahedron Lett., 1986, (27), 2291). Another approach was to
replace the standard 5'-DMT (dimethoxytrityl) group with protecting
groups that were removed under non-acidic conditions such as
levulinyl and 9-fluorenylmethoxycarbonyl. Such groups enable the
use of acid labile 2'-protecting groups for oligoribonucleotide
synthesis. Another more widely used protecting group initially used
for the synthesis of oligoribonucleotides was the
t-butyldimethylsilyl group (Ogilvie et al., Tetrahedron Lett.,
1974, 2861; Hakimelahi et al., Tetrahedron Lett., 1981, (22), 2543;
and Jones et al., J. Chem. Soc. Perkin I., 2762). The
2'-O-protecting groups can require special reagents for their
removal such as for example the t-butyldimethylsilyl group is
normally removed after all other cleaving/deprotecting steps by
treatment of the oligomeric compound with tetrabutylammonium
fluoride (TBAF).
[0165] One group of researchers examined a number of
2'-O-protecting groups (Pitsch, S., Chimia, 2001, 55, 320-324). The
group examined fluoride labile and photolabile protecting groups
that are removed using moderate conditions. One photolabile group
that was examined was the (2-(nitrobenzyl)oxy)methyl (nbm)
protecting group (Schwartz et al., Bioorg. Med. Chem. Lett., 1992,
2, 1019). Other groups examined included a number structurally
related formaldehyde acetal-derived, 2'-O-protecting groups. Also
prepared were a number of related protecting groups for preparing
2'-O-alkylated nucleoside phosphoramidites including
2'-O-((triisopropylsilyl)oxy)methyl
(2'-O--CH.sub.2--O--Si(iPr).sub.3; TOM). One 2'-O-protecting group
that was prepared to be used orthogonally to the TOM group was
2'-O--((R)-1-(2-nitrophenyl)ethyloxy)methyl) ((R)-mnbm).
[0166] Another strategy using a fluoride labile 5'-O-protecting
group (non-acid labile) and an acid labile 2'-O-protecting group
has been reported (Scaringe, Stephen A., Methods, 2001, (23)
206-217). A number of possible silyl ethers were examined for
5'-O-protection and a number of acetals and orthoesters were
examined for 2'-O-protection. The protection scheme that gave the
best results was 5'-O-silyl ether-2'-ACE
(5'-O-bis(trimethylsiloxy)cyclododecyloxysilylether
(DOD)-2'-O-bis(2-acetoxyethoxy)methyl (ACE). This approach uses a
modified phosphoramidite synthesis approach in that some different
reagents are required that are not routinely used for RNA/DNA
synthesis.
[0167] Although a lot of research has focused on the synthesis of
oligoribonucleotides the main RNA synthesis strategies that are
presently being used commercially include
5'-O-DMT-2'-O-t-butyldimethylsilyl (TBDMS),
5'-O-DMT-2'-O-(1(2-fluorophenyl)-4-methoxypiperidin-4-yl) (FPMP),
2'-O-((triisopropylsilyl)oxy)methyl
(2'-O--CH.sub.2--O--Si(iPr).sub.3 (TOM), and the 5'-O-silyl
ether-2'-ACE (5'-O-bis(trimethylsiloxy)cyclododecyloxysilyl ether
(DOD)-2'-O-bis(2-acetoxyethoxy)methyl (ACE). A current list of some
of the major companies currently offering RNA products include
Pierce Nucleic Acid Technologies, Dharmacon Research Inc., Ameri
Biotechnologies Inc., and Integrated DNA Technologies, Inc. One
company, Princeton Separations, is marketing an RNA synthesis
activator advertised to reduce coupling times especially with TOM
and TBDMS chemistries. Such an activator would also be amenable to
the present invention.
[0168] The primary groups being used for commercial RNA synthesis
are: [0169] TBDMS=5'-O-DMT-2'-O-t-butyldimethylsilyl; [0170]
TOM=2'-O-((triisopropylsilyl)oxy)methyl; [0171]
DOD/ACE=(5'-O-bis(trimethylsiloxy)cyclododecyloxysilyl
ether-2'-O-bis(2-acetoxyethoxy)methyl [0172]
FPMP=5'-O-DMT-2'-O-(1(2-fluorophenyl)-4-methoxypiperidin-4-yl).
[0173] All of the aforementioned RNA synthesis strategies are
amenable to the present invention. Strategies that would be a
hybrid of the above e.g. using a 5'-protecting group from one
strategy with a 2'-O-protecting from another strategy is also
amenable to the present invention.
[0174] The preparation of ribonucleotides and oligomeric compounds
having at least one ribonucleoside incorporated and all the
possible configurations falling in between these two extremes are
encompassed by the present invention. The corresponding oligomeric
compounds can be hybridized to further oligomeric compounds
including oligoribonucleotides having regions of complementarity to
form double-stranded (duplexed) oligomeric compounds. Such double
stranded oligonucleotide moieties have been shown in the art to
modulate target expression and regulate translation as well as RNA
processsing via an antisense mechanism. Moreover, the
double-stranded moieties may be subject to chemical modifications
(Fire et al., Nature, 1998, 391, 806-811; Timmons and Fire, Nature
1998, 395, 854; Timmons et al., Gene, 2001, 263, 103-112; Tabara et
al., Science, 1998, 282, 430-431; Montgomery et al., Proc. Natl.
Acad. Sci. USA, 1998, 95, 15502-15507; Tuschl et al., Genes Dev.,
1999, 13, 3191-3197; Elbashir et al., Nature, 2001, 411, 494-498;
Elbashir et al., Genes Dev. 2001, 15, 188-200). For example, such
double-stranded moieties have been shown to inhibit the target by
the classical hybridization of antisense strand of the duplex to
the target, thereby triggering enzymatic degradation of the target
(Tijsterman et al., Science, 2002, 295, 694-697).
[0175] The methods of preparing oligomeric compounds of the present
invention can also be applied in the areas of drug discovery and
target validation. The present invention comprehends the use of the
oligomeric compounds and suitable targets identified herein in drug
discovery efforts to elucidate relationships that exist between
proteins and a disease state, phenotype, or condition. These
methods include detecting or modulating a target peptide comprising
contacting a sample, tissue, cell, or organism with the oligomeric
compounds of the present invention, measuring the nucleic acid or
protein level of the target and/or a related phenotypic or chemical
endpoint at some time after treatment, and optionally comparing the
measured value to a non-treated sample or sample treated with a
further oligomeric compound of the invention. These methods can
also be performed in parallel or in combination with other
experiments to determine the function of unknown genes for the
process of target validation or to determine the validity of a
particular gene product as a target for treatment or prevention of
a particular disease, condition, or phenotype.
[0176] Effect of nucleoside modifications on RNAi activity is
evaluated according to existing literature (Elbashir et al.,
Nature, 2001, 411, 494-498; Nishikura et al., Cell, 2001, 107,
415-416; and Bass et al., Cell, 2000, 101, 235-238.)
[0177] In order that the invention disclosed herein may be more
efficiently understood, examples are provided below. It should be
understood that these examples are for illustrative purposes only
and are not to be construed as limiting the invention in any
manner. Throughout these examples, molecular cloning reactions, and
other standard recombinant DNA techniques, were carried out
according to methods described in Maniatis et al., Molecular
Cloning--A Laboratory Manual, 2nd ed., Cold Spring Harbor Press
(1989), using commercially available reagents, except where
otherwise noted.
EXAMPLES
Example 1
Animals
[0178] Balb/c mice, 18-24 g (5-7 weeks old), were obtained from
Charles River (Wilmington Mass.) and used for subsequent in vitro
and in vivo experiments. Animals were housed in polycarbonate cages
and given access to chow and water ad libitum, in accordance with
protocols approved by the Institutional Animal Care and Use
Committee.
Example 2
Oligonucleotides
[0179] All chimeric MOE Gapmers are 20-mer phosphorothioate
oligodeoxynucleotides containing 2'-O-methoxyethyl (2'-MOE)
modifications at positions 1-5 and 16-20. MOE Gapmers and the
2'-deoxy unmodified phosphorothioate oligodeoxynucleotides ODN-PTEN
and ODN-PTEN(6MM) were synthesized on a Milligen model 8800 DNA
synthesizer (Millipore Inc., Bedford Mass.) using conventional
solid-phase triester chemistry (Sanghvi, 1999) at Isis
Pharmaceuticals Inc. Deprotected and desalted siRNA analogs were
obtained from Dharmacon Research, Inc. (LaFayette, Colo.).
Sequences of siRNA compounds, and the oligonucleotides and
placement of their 2'-O-methoxyethyl modifications, are detailed in
Table 12. 2'-MOE Gapmers (MG) are first generation 20-mer
phosphorothioate oligodeoxynucleotides which contain
2'-O-methoxyethyl (2'-MOE) modifications at positions 1-5 and 16-20
(boldface type). ISIS 160847 and 160848 are first generation
phosphorothioate oligodeoxynucleotides (ODN). Both antisense and
sense strands are shown for each siRNA construct (si). Six-base
mismatch (6MM) control oligonucleotides are of similar nucleoside
composition as the respective antisense oligonucleotides.
Example 3
In Vitro Analysis
[0180] Primary hepatocyte isolation/culture. Mouse hepatocytes were
isolated from mice using a two step in situ liver perfusion as
previously described (McQueen et al., Cell. Biol. Toxicol., 1989,
5, 201-206). Briefly, animals were anesthetized with Avertin (50
mg/kg, intraperitoneal) and the portal vein was exposed. Hank's
Balanced Salt Solution (Life Technologies, Grand Island, N.Y.) was
perfused through the portal vein for 3.5 min at 2 ml/min followed
by Williams Medium E (WME: Life Technologies, Grand Island, N.Y.)
containing 0.3 mg/ml collagenase B (Roche Molecular Biochemicals,
Indianapolis, N) for 5.5 minutes. The liver was removed from the
animal and gently massaged through Nitex nylon mesh (Tetko, Depew,
N.Y.) to obtain a suspension of cells. The suspension was
centrifuged (4 minutes at 500 rpm) and the supernatant discarded.
The remaining pellet was gently resuspended in WME and centrifuged
(4 minutes at 500 rpm) two more times to remove nonparenchymal
cells. The pelleted hepatocytes were resuspended in WME
supplemented with 10% fetal bovine serum (FBS) (v:v) and the
concentration of cells was determined. For plating, cells were
resuspended to the desired working concentration in WME
supplemented with 10% FBS, 1% L-glutamine (v:v), 1% HEPES (v:v),
and 1% gentamycin (antimitotic-antibiotic). Cells were plated on
Primaria.TM. coated 6-well plates at a density of 100,000 per ml or
Primaria.TM. 96-well coated plates at a density of 10,000 per ml.
Cells were allowed to adhere to plates for one hour and then gently
washed with PBS to remove dead cells and the media replaced with
fresh HepatoZYME.TM. media (Invitrogen, Carlsbad, Calif.)
supplemented with 1% L-glutamine (v:v), 1% HEPES (v:v), 1%
non-essential amino acids (NEAA) and 1% gentamycin
(antimitotic-antibiotic).
[0181] In vitro hepatocyte oligodeoxynucleotide transfections. For
experiments transfecting primary hepatocytes with cationic lipids,
transfections were performed either four hours after plating or
after an additional 8-12 hours (overnight). No difference in
transfection results were observed comparing the two plating
intervals (data not shown). The oligonucleotide or siRNA
(oligo/siRNA) was mixed with Lipofectin (Invitrogen, Carlsbad,
Calif.) at a working concentration of 3 .mu.g per 100 nM of single
strand DNA or RNA per 1 ml of media. Prior to addition to cells,
the mix was incubated 5-10 minutes as per vendor recommendations.
Plating media was then removed and the cells were treated for 4-6
hours, the media changed to fresh HepatoZYME.TM. (supplemented as
above) and cells incubated overnight for an additional 16-20 hours.
Cells were then lysed and the RNA isolated and purified as
described below. For free uptake studies, cells were allowed to
adhere to the plastic for 4 hours then treated with the
oligos/siRNA in the HepatoZYME.TM. media for 12-16 hours
(overnight). Cells were then lysed and the RNA isolated and
purified as described below.
[0182] RNA isolation and expression analysis. In vitro total RNA
was harvested at the indicated times post-transfection using the
RNeasy Mini kit (Qiagen, Valencia, Calif.) for the 6-well
treatments and using the Qiagen BioRobot 3000 for the 96-well
plates, according to the manufacturers protocol. Gene expression
was determined via real time quantitative RT-PCR on the ABI Prism
7700 system (Applied Biosystems, Foster City Calif.) as suggested
by the manufacturer and described in the literature (Gibson et al.,
Genome Res., 1996, 6, 995-1001; Winer et al., Anal. Biochem., 1999,
270, 41-49; and Vickers et al., J. Biol. Chem., 2003, 278,
7108-7118). Primers and probes were obtained from IDT, Inc.
(Coralville, Iowa) and the following primer/probe sets were used:
PTEN (accession number U92437.1), forward primer
(ATGACAATCATGTTGCAGCAATTC; SEQ ID NO:1), reverse primer
(CGATGCAATAAATATGCACAAATCA; SEQ ID NO:2), and probe
(GTAAAGCTGGAAAGGGACGGACTGGT; SEQ ID NO:3); Fas (accession number
M83649.1), forward primer (TCCAAGACACAGCTGAGCAGA; SEQ ID NO:4),
reverse primer (TGCATCACTCTTCCCATGAGAT; SEQ ID NO:5), and probe
(AGTCCAGCTGCTCCTGTGCTGGTACC; SEQ ID NO:6); Apolipoprotein B
(accession number M35186.1), forward primer (CGTGGGCTCCAGCATTCTA;
SEQ ID NO:7), reverse primer (AGTCATTTCTGCCTTTGCGTC; SEQ ID NO:8),
and probe (CCAATGGTCGGGCACTGCTCAA; SEQ ID NO:9); Microsomal
triglyceride transfer protein (accession number NM.sub.--008642.1),
forward primer (GAGCGGTCTGGATTTACAACG; SEQ ID NO:10), reverse
primer (AGGTAGTGACAGATGTGGCTTTTG; SEQ ID NO:11), and probe
(CAAACCAGGTGCTGGGCGTCAGT; SEQ ID NO:12); and murine cyclophilin A
(accession number), forward primer (TCGCCGCTTGCTGCA; SEQ ID NO:13),
reverse primer (ATCGGCCGTGATGTCGA; SEQ ID NO:14) and probe
(CCATGGTCAACCCCACCGTGTTC; SEQ ID NO:15). Cyclophilin A mRNA levels
were used with 96-weel transfection experiments as an internal
standard for sample to sample normalization. All mRNA expression
levels were normalized both to RiboGreen (Molecular Probes, Eugene,
Oreg.), and GAPDH mRNA, also determined by quantitave RT-PCR (data
not shown), from the same total RNA samples. Dose-response trends
were independent of the normalization technique, and only RiboGreen
normalized data is presented here.
[0183] Statistical Analysis. Simple Student's T-Test were
performed.
[0184] Primary hepatocyte monolayer model. Mouse primary
hepatocytes plated in 6-well plates were dosed with ISIS 116847
(MG-PTEN), a MOE gapmer specific for PTEN (Butler et al., Diabetes,
2002, 51, 1028-1034), at 25 and 100 nM in the presence of
lipofectin. PTEN mRNA expression levels fell in a dose-dependent
manner. Transcript expression was reduced by a maximum of 87%
(0.13.+-.0.06 of control) at 100 nM, with an IC50 of approximately
25 nM. Doses above 100 nM did not significantly decrease message
knockdown (data not shown).
Example 4
In Vivo Analysis
[0185] In vivo oligonucleotide treatment. MOE gapmer or siRNA
oligonucleotides were administered in saline (0.9% NaCl) via
intravenous tail vein injection at the indicated doses once per day
for five days. Mice were sacrificed on day five, six hours post
administration. Liver RNA was isolated as described below.
[0186] RNA isolation and expression analysis. Total RNA was
extracted from mouse liver by homogenizing liver in guanidinium
isothiocyanate at time of sacrifice, and isolating total RNA
standard cesium chloride gradient centrifugation techniques. Gene
expression was determined via real time quantitative RT-PCR on the
ABI Prism 7700 system (Applied Biosystems, Foster City Calif.) as
described above.
[0187] Primary hepatocyte monolayer model. Mouse primary
hepatocytes plated in 6-well plates were dosed with ISIS 116847
(MG-PTEN), a MOE gapmer specific for PTEN (Butler et al., Diabetes,
2002, 51, 1028-1034), at 25 and 100 nM in the presence of
lipofectin PTEN mRNA expression levels fell in a dose-dependent
manner. Transcript expression was reduced by a maximum of 87%
(0.13.+-.0.06 of control) at 100 nM, with an IC50 of approximately
25 nM. Doses above 100 nM did not significantly decrease message
knockdown (data not shown).
Example 5
Design of Single and Double-Strand Antisense Constructs
[0188] MG-PTEN is a 20-base chimeric 2'-O-methoxyethyl
oligonucleotide (MOE gapmer) that has previously been demonstrated
to be a potent inhibitor of mouse PTEN expression (Butler et al.,
Diabetes, 2002, 51, 1028-1034). siRNA analogs to the same coding
region targeted by MG-PTEN were synthesized to compare the in vitro
dose-response characteristics of the two classes of antisense
compounds. Table 12 is a representative list of oligonucleotides
used, their sequences, and specific chemical modifications.
[0189] Single-strand MOE gapmers and double-strand RNA (dsRNA) show
comparable activity profiles in primary mouse hepatocytes under
cationic lipid transfection conditions.
[0190] Mouse primary hepatocytes plated in 96-well plates were
transfected with either: the MOE gapmer MG-PTEN, the 6-base
mismatch (MG-PTEN(6MM)), the blunt ended dsRNA analog to the MOE
116847 site (si-PTEN(blunt)), the 2-nt 3'-overhang dsRNA analog
with mixed backbone (si-PTEN), or the 6 base-pair 2-nt 3'-overhang
dsRNA mismatch to si-PTEN with mixed backbone (si-PTEN(6MM)) in the
presence of Lipofectin. Both the MOE gapmer and the dsRNA designed
against the target region 116847 significantly reduced PTEN mRNA in
a dose-dependent manner. The mixed backbone dsRNA containing 2-nt
3'-dTdT overhangs, si-PTEN, appeared to have a slightly lower
IC.sub.50 than the corresponding blunt-end dsRNA, si-PTEN (blunt).
While, the IC.sub.50 for the 2'-MOE MG-PTEN was significantly lower
(12.5 nM), maximal mRNA reduction was achieved at 200 nM (higher
dosages not shown). The lower IC.sub.50 observed for MG-PTEN could
reflect mechanistic differences in target reduction or reflect that
the sequence used for comparative purposes was optimized for MOE
gapmer chemistry. The PTEN mismatch control to the mixed backbone
dsRNA containing 2-nt 3'-dTdT overhangs, si-PTEN(6MM), did not
effect PTEN mRNA levels, suggesting that target reduction was not
due to non-specific dsRNA or siRNA effects.
[0191] Uptake activity is independent of sequence. Evidence
suggests that the uptake of antisense oligonucleotides is
independent of oligonucleotide sequence (Leeds et al., Nucleosides
Nucleotides, 1997, 16, 1689-1693; and Geary et al., J. Pharmacol.
Exp., 2001, 296, 890-897). To confirm that the in vitro Lipofectin
mediated dose-dependent inhibition of target observed with the MOE
gapmer MG-PTEN could be reproduced with other potent antisense MOE
gapmers, another potent MOE gapmer, MG-Fas, was selected for
Lipofectin mediated dose-response analysis. MG-Fas targets a
sequence within the translated region of the murine Fas transcript.
It is a 20-base chimeric MOE gapmer that has been shown to inhibit
Fas expression both in vitro and in vivo in a dose-dependent and
sequence-specific manner. It has been reported that both Fas mRNA
and protein levels fall as much as 90% in mice dosed with MG-Fas
(Zhang et al., Nat. Biotechnol., 2000, 18, 862-867). As described
for PTEN, mouse primary hepatocytes were plated in 96-well plates
and transfected with either: the MOE gapmer MG-Fas; MG-Fas(6MM), a
6 base mismatch control to MG-Fas; si-Fas, a dsRNA containing an
antisense strand using the anti-Fas siRNA sequence 1 from a study
by Song et. al. (Nat. Med., 2003, 9, 347-351), where they reported
that hydrodynamic tail vein injection of this sequence into mice
reduced Fas mRNA expression in liver hepatocytes by approximately
86% of control; and si-Fas(6MM), a 6 base mismatch control dsRNA.
Both MG-Fas and si-Fas reduced Fas mRNA expression in a
dose-dependent manner, MG-Fas reducing Fas mRNA to 0.76.+-.0.12 and
0.04.+-.0.03 of control at 75 and 300 nM, respectively; and si-Fas
reducing expression to 0.82.+-.0.05 and 0.29.+-.0.08 of control at
75 and 300 nM, respectively. Thus, the PTEN and Fas data taken
together suggest that both MOE gapmers and dsRNAs inhibit gene
expression in a dose-dependent manner when transfected into
isolated mouse hepatocytes.
[0192] To further investigate whether chemical modifications to the
MOE gapmer backbone would alter dose-response characteristics,
mouse primary hepatocytes were transfected with either the MOE
gapmer MG-PTEN; MG-PTEN(6MM), the 6 base mismatch control to
MG-PTEN; ODN-PTEN, a first generation unmodified 20-mer
phosphorothioate (PS) oligonucleotide (no MOE modifications); or
ODN-PTEN(6MM), ODN-PTEN's 6 base mismatch control (Table 12). These
oligodeoxynucleotides contain PS backbones, but are uniformly 2'-OH
unmodified. Both the MOE gapmer and the unmodified PS
oligonucleotide significantly reduced PTEN mRNA in a dose-sensitive
manner. The slightly greater target knockdown seen with the MG-PTEN
supports previous observations that MOE modified PS
oligonucleotides have slightly increased binding affinity for their
complementary RNAs (Crooke et al., Biochem. J., 1995, 312 (Pt 2),
599-608). MOE gapmer increased nuclease resistance may also be
increasing MG-PTENs efficacy in this assay by increasing
intracellular concentrations relative to ODN-PTEN over time.
[0193] Single-strand MOE gapmers and PS oligonucleotides show
different activity profiles than double-strand RNA (dsRNA) in
primary mouse hepatocytes in free-uptake conditions. Graham et al.
(J. Pharmacol. Exp. Therap., 1998, 286, 447-458) has previously
demonstrated both free uptake and activity of MOE gapmers incubated
with primary hepatocytes without the use of cationic lipids similar
to that seen in vivo. To investigate the dose-response sensitivity
of the MOE gapmers, experiments were conducted in mouse primary
hepatocytes plated in 6-well plates with both MG-PTEN and MG-Fas at
concentrations ranging from 75 to 10000 nM (see above procedures).
The expression levels of both targeted PTEN and Fas mRNA
subsequently fell in a dose-dependent manner. Maximal inhibition
(.about.90%) of both PTEN and Fas mRNA levels was achieved at 3000
nM, with an IC50 of approximately 350 nM for PTEN and 750 nM for
Fas. Higher concentrations of either MG-PTEN or MG-Fas did not
significantly reduce transcript levels. Six base mismatches to both
MG-PTEN and MG-Fas, MG-PTEN(6MM) and MG-Fas(6MM), did not reduce
transcript levels; arguing against ASO dose related mRNA toxicity
(data not shown). PTEN and Fas transcript levels were normalized
with RiboGreen. However, the dose-response trends observed were
independent of the normalization technique, as normalization using
either RiboGreen or GAPDH transcript levels yielded similar results
(GAPDH data not shown).
[0194] To further confirm that the in vitro dose-dependent
inhibition of target observed with both MG-PTEN and MG-Fas could be
reproduced with other potent antisense MOE gapmers, two additional
potent MOE gapmers, MG-ApoB and MG-MTTP were selected for free
uptake dose-response analysis (see Table 12). MG-ApoB is a potent
inhibitor of the mouse apolipoprotein B (ApoB) (unpublished data).
MG-MTTP targets mouse microsomal triglyceride transfer protein
(MTTP) (unpublished data). All MOE gapmers tested displayed similar
dose-response dynamics (data not shown), suggesting that the
mechanism of MOE gapmer uptake and subsequent RNA inhibition is
highly conserved.
[0195] To determine whether dsRNA might also demonstrate both free
uptake and activity without the use of cationic lipids, mouse
primary hepatocytes were dosed with either si-PTEN(blunt), si-PTEN,
si-PTEN(6MM), the MG-PTEN, MG-Fas, MG-Fas(6MM), si-Fas, or
si-Fas(6MM); at concentrations ranging from 375 to 1500 nM. The
siRNA constructs are capable of specific target reduction in the
presence of the cationic lipid Lipofectin. However, whereas the MOE
modified single-strand DNAs MG-PTEN and MG-Fas show robust target
reduction even at the lowest concentrations (375 nM), no target
reduction was observed with dsRNA under these conditions.
[0196] Given the lack of activity observed for dsRNA in free uptake
experiments under the expressed conditions, it was of interest to
determine whether MOE modifications were aiding free uptake of
single-strand DNA. Again, the unmodified homologs to MG-PTEN and
the 6 base mismatch MG-PTEN(6MM), ODN-PTEN and ODN-PTEN(6MM) were
used. These first generation, unmodified molecules demonstrate a
dose responsive, specific target reduction. Again, the MOE modified
gapmer MG-PTEN demonstrated much greater message knockout,
suggesting that the MOE modification may assist and improve the
oligonucleotide delivery in the absence of transfection reagents.
Again, the half-lives of unmodified first generation
oligodeoxynucleotides are much shorter, which may in part explain
the reduced activity observed with these molecules.
[0197] Capillary gel electrophoresis (CGE) was used to look at the
stability of the duplex siRNA constructs in the treatment media
(see above for media description) at different time points. If the
duplex is still intact after 16 hrs, which is the duration of our
treatments, the construct is considered valid for the in vitro
assay proposed herein, and tested for uptake and/or activity.
Example 6
In vivo Target Inhibition--MOE Gapmers Versus dsRNAs
[0198] Given the observed robust target inhibition with both
single-stranded MOE gapmers, unmodified PS oligonucleotides and
dsRNA when using Lipofectin as a transfection agent, but no
observation of dsRNA activity when a transfection reagent was not
used under the conditions described above, coupled with reports
that dsRNA when administered in vivo via high pressure tail
injections knock down target (McCafferey et al., Nature, 2002, 418,
38-39; Lewis et al., Nat. Genet., 2002, 32, 107-108; and Song et
al., Nat. Med., 2003, 3, 347-351), it was of interest to compare
MOE gapmer and dsRNA activity in vivo using conventional
intravenous injections. MG-PTEN, MG-PTEN(6MM), si-PTEN and
si-PTEN(6MM) were administered daily for 5 days at concentrations
of either 2.5 mg/kg or 25 mg/kg. Only MG-PTEN reduced PTEN mRNA
levels in liver. Further, in a separate study, animals were dosed
daily for five days with si-PTEN(blunt) to concentrations as high
as 50 mg/kg. Again, only MG-PTEN reduced PTEN mRNA levels in liver.
No effect was observed for intraperitoneal injected siPTEN(blunt)
under the conditions described above. High-pressure delivery
systems may mimic in vitro transfection mediated oligonucleotide
delivery by altering cell membrane permeability; however, we are
unaware of any studies demonstrating mRNA knockdown with dsRNA
using conventional delivery systems.
[0199] The results suggest that the in vitro primary hepatocyte
model correlates both with single-strand DNA oligonucleotide (both
MOE gapmer and PS oligonucleotides) and dsRNA in vivo activity.
Specifically, whereas single-strand oligonucleotides effectively
decrease target mRNA expression both in vitro and in vivo without
the aid of a delivery system, dsRNA does not decrease target mRNA
expression in hepatocytes in vitro without the aid of transfection
reagents under the conditions described above or in vivo when
delivered by conventional dosing methods.
Example 7
Sequential Delivery
[0200] dsRNA is now shown to decrease target mRNA expression in
hepatocytes in vitro without the aid of transfection reagents. The
following PTEN oligomeric compounds were used in a free uptake
assay in primary mouse hepatocytes, as described above: Compound
303912 antisense (TTTGTCTCTGGTCCTTACTT; SEQ ID NO: 34; PS backbone,
RNA sugar); Compound 316449 antisense (TTTGTCTCTGGTCCTTACTT; SEQ ID
NO:34; PS backbone, 3' 3.times.Ome sugar); Compound 347849
antisense (TTTGTCTCTGGTCCTTACTTT; SEQ ID NO:36; PO backbone, RNA
sugar); Compound 341315 sense (AAGTAAGGACCAGAGACAAA; SEQ ID NO:37;
PS backbone, full Ome sugar); and Compound 308746 sense
(AAGTAAGGACCAGAGACAAA; SEQ ID NO: 37; PO backbone, RNA sugar). The
mRNA target levels were normalized to total RNA (RiboGreen). The
results are expressed as % UTC and are reported in Table 13. The
following Table 2 shows the delivery protocol and results of
treatment of each group.
[0201] Oligomeric siRNA compound combinations 303912:341315 and
316449:341315 show activity in this free uptake system.
Sequentially treating with these antisense sequences first followed
by the sense strand do not show appreciable target reduction. In
contrast, sequentially treating with the sense strand first
followed by the antisense strand shows good activity except at the
one hour strand switching. In addition, sequential treatment with
303912 is as potent as the corresponding siRNA. Further, sequential
treatment with 316449 is more potent than the corresponding siRNA.
Even further, chemical modification of the terminal three 3'
nucleotides to comprise 2'-Ome sugar residues, as in Compound
316449, is suitable.
[0202] A dose-response study was also performed in the primary
hepatocyte free uptake assay with the following oligomeric
compounds: Compound 303912 antisense (TTTGTCTCTGGTCCTTACTT; SEQ ID
NO:34; PS backbone, RNA sugar); Compound 335449 antisense
(TTTGTCTCTGGTCCTTACTT; SEQ ID NO: 34; PO backbone, RNA sugar);
Compound 341315 sense (AAGTAAGGACCAGAGACAAA; SEQ ID NO:37; PS
backbone, full 2'-Ome sugar); Compound 330696 sense
(AAGTAAGGACCAGAGACAAA; SEQ ID NO: 37; PO backbone, full 2'-Ome
sugar); and Compound 344178 sense (AAGTAAGGACCAGAGACAAA; SEQ ID NO:
37; PS backbone, RNA sugar). Results are shown in FIG. 1.
Example 8
Sequential Delivery-Effects of Modifications
[0203] The following PTEN oligomeric compounds were used in a free
uptake assay in primary mouse hepatocytes, as described above:
Compound 303912 antisense (TTTGTCTCTGGTCCTTACTT; SEQ ID NO:34; PS
backbone, RNA sugar, 5' phosphate); Compound 335449 antisense
(TTTGTCTCTGGTCCTTACTT; SEQ ID NO: 34; PO backbone, RNA sugar, 5'
phosphate); Compound 317502 antisense (TTTGTCTCTGGTCCTTACTTT; SEQ
ID NO: 36; PS backbone, RNA sugar with 2' Fluoro modifications at
the bolded positions, 5' phosphate); Compound 354626 antisense
(TTTGTCTCTGGTCCTTACTT; SEQ ID NO: 34; PS backbone, RNA sugar, 5'
hydroxyl); Compound 116847 antisense (TTTGTCTCTGGTCCTTACTT; SEQ ID
NO: 34; PS backbone, MOE/DNA sugar having 2'MOE groups at positions
1-5 and 16-20); Compound 344178 sense (AAGTAAGGACCAGAGACAAA; SEQ ID
NO: 37; PS backbone, RNA sugar); Compound 341315 sense
(AAGTAAGGACCAGAGACAAA; SEQ ID NO:37; PS backbone, full 2'O-methyl
sugar); Compound 354622 sense (AAGCAACGAGAAGCGATAAA; SEQ ID NO: 37;
PS backbone, full 2'O-methyl sugar; 6base mismatch to Compound
341315) and Compound 330696 sense (AAGTAAGGACCAGAGACAAA; SEQ ID NO:
37; PO backbone, full 2'-O-methyl sugar). The mRNA target levels
were normalized to total RNA (RiboGreen). The results are expressed
as % UTC and are reported in Table 14. The following Table 3 shows
the delivery protocol and results of treatment of each group.
[0204] Oligomeric siRNA compound combinations 303912:344178 and
354626:344178 show activity in this free uptake system.
Sequentially treating with the sense strand of these duplexes first
followed by the antisense strand shows good activity at every time
point tested. In addition, sequential treatment with 303912 or
354626 at the one hour time point is as potent as the corresponding
siRNA (compare sequential treatments B and N with siRNA treatments
Y and Z). Even further, chemical modification with a fluoro group
at select 2' positions in the antisense strand was also found to
effectively reduce target RNA levels.
Example 9
Sequential Delivery-Comparison of Backbone Chemistry in 2'OMe
Background Construct
[0205] The following PTEN oligomeric compounds were used in a free
uptake assay in primary mouse hepatocytes, as described above:
Compound 303912 antisense (TTTGTCTCTGGTCCTTACTT; SEQ ID NO:34; PS
backbone, RNA sugar, 5' phosphate); Compound 335449 antisense
(TTTGTCTCTGGTCCTTACTT; SEQ ID NO: 34; PO backbone, RNA sugar, 5'
phosphate); Compound 317502 antisense (TTTGTCTCTGGTCCTTACTTT; SEQ
ID NO: 36; PS backbone, RNA sugar with 2' Fluoro modifications at
the bolded positions, 5' phosphate); Compound 354626 antisense
(TTTGTCTCTGGTCCTTACTT; SEQ ID NO: 34; PS backbone, RNA sugar, 5'
hydroxyl); Compound 116847 antisense (TTTGTCTCTGGTCCTTACTT; SEQ ID
NO: 34; PS backbone, MOE/DNA sugar having 2'MOE groups at positions
1-5 and 16-20); Compound 341315 sense (AAGTAAGGACCAGAGACAAA; SEQ ID
NO:37; PS backbone, full 2'O-methyl sugar); and Compound 330696
sense (AAGTAAGGACCAGAGACAAA; SEQ ID NO: 37; PO backbone, full
2'-O-methyl sugar). The mRNA target levels were normalized to total
RNA (RiboGreen). The results are expressed as % UTC and are
reported in Table 15. The following Table 15 shows the delivery
protocol and results of treatment of each group. Entry of "ND" in
the Table indicates at least one reagent or construct was limiting
and no data were gathered for this group.
[0206] Oligomeric siRNA compound combinations 354626:341315 show
activity in this free uptake system. Sequentially treating with the
sense strand of these duplexes first followed by the antisense
strand shows good activity at every time point tested.
[0207] Even further, sequentially treating with compound 341315, a
sense strand having a phosphorothioate backbone and which is fully
modified with OMe at the 2' positions, followed by either the
antisense strand of compound 303912 or 354626 (differing in the 5'
terminal moitety) show equally potent results, suggesting that the
5' terminus is not the determinant factor in target reduction for
these constructs.
Example 10
Activity for Backbone Chemistry
[0208] PTEN constructs and results are shown in Table 16. As shown
in Table 16, 2' MOE in both strands improves activity.
[0209] PTEN constructs and results are shown in Table 17. As shown
in Table 17, MOE gapmer sense strands enhance the potency of siRNA
duplexes.
[0210] PTEN 2'-OMe and 2'-MOE modified constructs and results are
shown in Table 18 and FIG. 2. As shown in Table 18 and FIG. 2,
2'-OMe and 2'-MOE modification resulted in highly potent siRNA. A
similar trend was observed for other targets.
[0211] PTEN 4'-Thio modified constructs and results are shown in
Table 19 and FIG. 3. As shown in Table 19 and FIG. 3, 4'-Thio
modification resulted in increased stability and activity to RNA on
sense and antisense strand.
Example 11
In Vivo Activity
[0212] 4 Balb/c per group were dosed at 25 and 6.25 mg/kg twice
daily via I.P., and were sacrificed after the 9.sup.th dose. In
some embodiments, PTEN mRNA levels and glucose were measured. In
some embodiments, AST, ALT, triglycerides, and organ weight were
measured. In some embodiments, liver, kidney, and urine wew
collected for PK. Results are shown in Table 20 and FIG. 4.
Referring to FIG. 4, after the saline group is: MOE gapmer, 4'-thio
gapmer, unmodified, alternating PO/PS, and alternating OMe/F. There
was no observed change in AST or ALT levels in any siRNA group.
There was also no observed change in liver, spleen, kidney, or WAT
weights in any group. There was also no observed change in glucose,
cholesterol, or triglycerides.
[0213] A sandwich ELISA assay was developed to measure the levels
of sense and antisense strands in tissue and urine. Less than 0.06
nM concentration of either sense or antisense RNA strand was
detected in the liver. See Table 21.
Example 12
In Vitro Analysis of Cholesterol Conjugates
[0214] An in vitro analysis of cholesterol conjugates was also
carried out, the results of which are set forth in Tables 22-25 and
FIGS. 5-8. Sense strand 3'-cholesterol conjugated siRNA showed
comparable activity to 5'-conjugated constructs in lipofectine
mediated in vitro assays. 5'-cholesterol conjugated siRNA showed
better activity in mouse primary hepatocytes in free uptake assays.
Conjugtaes with OMe/F alternating chemistries resulted in improved
potency.
Example 13
General Target X Chemistries and Activity Thereof
[0215] The compounds litsed in Table 26 were administered IV at 25
mg/kg, BID.times.2 (8 hours apart on day 1 and 4 hours apart on day
2. Target X siRNA 1 is antisense and sense blunted siRNA. Target X
siRNA 2 is antisense (3 bases 4'-thio at 5' and 3' ends) and sense
(blunted) siRNA. Target X siRNA 3 is antisense (2'-OMe internal and
3') and sense (alternating 2'-MOE). Target X siRNA 4 is antissense
and sense alternating 2'-OMe and 2'-F. Tissues (liver, kidney, and
serum) were collected 2 hours after the last dose. Normalized to
Target Y, the Target X siRNA 1 demonstrated no inhibition (results
not shown). Normalized to Target Y, Target X siRNA 2 demonstrated
48.37.+-.10.52% inhibition (data not shown). Normalized to Target
Y, Target X siRNA 2 demonstrated 44.39.+-.12.47% inhibition (data
not shown). Normalized to Target Y, Target X siRNA 4 demonstrated
59.62.+-.10.22% inhibition (data not shown). In sum, 1) blunted
naked siRNA duplex 1 did not show protein reduction; 2) inhibition
of target X expression was observed with siRNAs modified with
4'-thio, 2'-O-Me/2'-MOE, and with alternating 2'-O-Me/2'-F
modification; and 3) alternating 2'-O-Me/2'-F modifications of both
sense and antisense strands of Target X siRNA appeared to be more
potent than other modifications.
[0216] Various modifications of the invention, in addition to those
described herein, will be apparent to those skilled in the art from
the foregoing description. Such modifications are also intended to
fall within the scope of the appended claims. Each reference
(including, but not limited to, journal articles, U.S. and non-U.S.
patents, patent application publications, international patent
application publications, gene bank accession numbers, and the
like) cited in the present application is incorporated herein by
reference in its entirety.
TABLE-US-00001 TABLE 1 ##STR00006## ##STR00007## ##STR00008##
##STR00009## ##STR00010## ##STR00011## ##STR00012## ##STR00013##
##STR00014## ##STR00015## ##STR00016## ##STR00017## ##STR00018##
##STR00019## ##STR00020## ##STR00021## ##STR00022## ##STR00023##
##STR00024##
TABLE-US-00002 TABLE 2 Modified DNA strand having 2'-substituent
groups that gave an overall increase in Tm against an RNA
complement: Positive .di-elect cons.Tm/mod 2'-substituents 2'-OH
2'-O--C.sub.1-C.sub.4 alkyl 2'-O--(CH.sub.2).sub.2CH.sub.3
2'-O--CH.sub.2CH.dbd.CH.sub.2 2'-F
2'-O--(CH.sub.2).sub.2--O--CH.sub.3
2'-(O--(CH.sub.2).sub.2).sub.2--O--CH.sub.3
2'-(O--(CH.sub.2).sub.2).sub.3--O--CH.sub.3
2'-(O--(CH.sub.2).sub.2).sub.4--O--CH.sub.3
2'-(O--(CH.sub.2).sub.2).sub.3--O--(CH.sub.2).sub.8CH.sub.3
2'-O--(CH.sub.2).sub.2CF.sub.3 2'-O--(CH.sub.2).sub.2OH
2'-O--(CH.sub.2).sub.2F 2'-O--CH.sub.2CH(CH.sub.3)F
2'-O--CH.sub.2CH(CH.sub.2OH)OH
2'-O--CH.sub.2CH(CH.sub.2OCH.sub.3)OCH.sub.3
2'-O--CH.sub.2CH(CH.sub.3)OCH.sub.3
2'-O--CH.sub.2--C.sub.14H.sub.7O.sub.2(--C.sub.14H.sub.7O.sub.2 =
Anthraquinone) 2'-O--(CH.sub.2).sub.3--NH.sub.2*
2'-O--(CH.sub.2).sub.4--NH.sub.2* These modifications can increase
the Tm of oligonucleotides but can also decrease the Tm depending
on positioning and number (motiff dependant).
TABLE-US-00003 TABLE 3 Modified DNA strand having modified sugar
ring (see structure x) that gave an overall increase in Tm against
an RNA complement: ##STR00025## Positive .di-elect cons.Tm/mod Q
--S-- --CH.sub.2-- Note: In general ring oxygen substitution with
sulfur or methylene had only a minor effect on Tm for the specific
motiffs studied. Substitution at the 2'-position with groups shown
to stabilize the duplex were destabilizing when CH.sub.2 replaced
the ring O. This is thought to be due to the necessary gauche
interaction between the ring O with particular 2'-substituents (for
example --O--CH.sub.3 and
--(O--CH.sub.2CH.sub.2).sub.3--O--CH.sub.3.
TABLE-US-00004 TABLE 4 Modified DNA strand having modified sugar
ring that give an overall increase in Tm against an RNA complement:
##STR00026## Positive .di-elect cons.Tm/mod --C(H)R.sub.1 effects
OH (R.sub.2, R.sub.3 both = H) CH.sub.3* CH.sub.2OH* OCH.sub.3*
These modifications can increase the Tm of oligonucleotides but can
also decrease the Tm depending on positioning and number (motiff
dependant).
TABLE-US-00005 TABLE 5 Modified DNA strand having bicyclic
substitute sugar modifications that give an overall increase in Tm
against an RNA complement: Formula Positive .di-elect cons.Tm/mod I
+ II + I ##STR00027## II ##STR00028##
TABLE-US-00006 TABLE 6 Modified DNA strand having modified
heterocyclic base moieties that give an overall increase in Tm
against an RNA complement: Modification/Formula Positive .di-elect
cons.Tm/mod Heterocyclic base 2-thioT modifications
2'-O-methylpseudoU 7-halo-7-deaza purines 7-propyne-7-deaza purines
2-aminoA(2,6-diaminopurine) ##STR00029## (R.sub.2, R.sub.3 = H),
R.sub.1 = Br C/C--CH.sub.3 (CH.sub.2).sub.3NH.sub.2 CH.sub.3
Motiffs-disubstitution R.sub.1 = C/C--CH.sub.3, R.sub.2 = H,
R.sub.3 = F R.sub.1 = C/C--CH.sub.3, R.sub.2 = H R.sub.3 =
O--(CH.sub.2).sub.2--O--CH.sub.3 R.sub.1 = O--CH.sub.3, R.sub.2 =
H, R.sub.3 = O--(CH.sub.2).sub.2--O--CH.sub.3* This modification
can increase the Tm of oligonucleotides but can also decrease the
Tm depending on positioning and number (motiff dependant).
TABLE-US-00007 TABLE 7 DNA strand having at least one modified
phosphorus containing internucleoside linkage and the effect on the
Tm against an RNA complement: .di-elect cons.Tm/mod + .di-elect
cons.Tm/mod - phosphorothioate.sup.1 phosphoramidate.sup.1 methyl
phosphonates.sup.1 (.sup.1one of the non-bridging oxygen atoms
replaced with S, N(H)R or --CH.sub.3) phosphoramidate (the
3'-bridging atom replaced with an N(H)R group, stabilization effect
enhanced when also have 2'-F)
TABLE-US-00008 TABLE 8 DNA strand having at least one
non-phosphorus containing internucleoside linkage and the effect on
the Tm against an RNA complement: Positive .di-elect cons.Tm/mod
--CH.sub.2C(.dbd.O)NHCH.sub.2--*
--CH.sub.2C(.dbd.O)N(CH.sub.3)CH.sub.2--*
--CH.sub.2C(.dbd.O)N(CH.sub.2CH.sub.2CH.sub.3)CH.sub.2--*
--CH.sub.2C(.dbd.O)N(H)CH.sub.2-- (motiff with 5'-propyne on T's)
--CH.sub.2N(H)C(.dbd.O)CH.sub.2--*
--CH.sub.2N(CH.sub.3)OCH.sub.2--*
--CH.sub.2N(CH.sub.3)N(CH.sub.3)CH.sub.2--* This modification can
increase the Tm of oligonucleotides but can also decrease the Tm
depending on positioning and number (motiff dependant). Notes: In
general carbon chain internucleotide linkages were destabilizing to
duplex formation. This destabilization was not as severe when
double and tripple bonds were utilized. The use of glycol and
flexible ether linkages were also destabilizing.
TABLE-US-00009 TABLE 9 Relative energies* of the C3'-endo and
C2'-endo conformations of representative nucleosides. HF/6-31G
MP2/6-31-G CONTINUUM AMBER MODEL dG 0.60 0.56 0.88 0.65 rG -0.65
-1.41 -0.28 -2.09 2'-O--MeG -0.89 -1.79 -0.36 -0.86 2'-S--MeG 2.55
1.41 3.16 2.43 *energies are in kcal/mol relative to the C2'-endo
conformation
TABLE-US-00010 TABLE 10 Average helical parameters derived from the
last 500 ps of simulation time. (canonical A-and B-form values are
given for comparison) Helicoidal B-DNA B-DNA A-DNA Parameter
(x-ray) (fibre) (fibre) DNA:RNA OMe_DNA:RNA SMe_DNA:RNA X-disp 1.2
0.0 -5.3 -4.5 -5.4 -3.5 Inclination -2.3 1.5 20.7 11.6 15.1 0.7
Propeller -16.4 -13.3 -7.5 -12.7 -15.8 -10.3
TABLE-US-00011 TABLE 11 Minor groove widths averaged over the last
500 ps of simulation time Phosphate DNA:RNA RNA:RNA Distance
DNA:RNA OMe_DNA:RNA SMe_DNA:RNA (B-form) (A-form) P5-P20 15.27
16.82 13.73 14.19 17.32 P6-P19 15.52 16.79 15.73 12.66 17.12 P7-P18
15.19 16.40 14.08 11.10 16.60 P8-P17 15.07 16.12 14.00 10.98 16.14
P9-P16 15.29 16.25 14.98 11.65 16.93 P10-P15 15.37 16.57 13.92
14.05 17.69
TABLE-US-00012 TABLE 12 Isis No. Target Strand Sequence (5' to 3')
SEQ ID NO: Composition ASOs 160847 PTEN as CTGCTAGCCTCTGGATTTGA 16
2'-deoxy P = S; 5-MeC ODN-PTEN 160848 PTEN as CTTCTGGCATCCGGTTTAGA
17 2'-deoxy P = S; 5-MeC (6MM) (6MM) MG-PTEN 116847 PTEN as
CTGCTAGCCTCTGGATTTGA 16 5_10_5 2'MOE Gapmer; 5-MeC MG-PTEN 116848
PTEN as CTTCTGGCATCCGGTTTAGA 17 5_10_5 2'MOE (6MM) (6MM) Gapmer;
5-MeC MG-Fas 22023 Fas as TCCAGCACTTTCTTTTCCGG 20 5_10_5 2'MOE
Gapmer; 5-MeC MG-Fas 29836 Fas as TCCATCTCCTTTTATGCCGG 21 5_10_5
2'MOE (6MM) (6MM) Gapmer; 5-MeC MG-MTTP 144477 MTTP as
CCCAGCACCTGGTTTGCCGT 22 5_10_5 2'MOE Gapmer; 5-MeC MG-ApoB 147764
Apo B as GTCCCTGAAGATGTCAATGC 23 5_10_5 2'MOE Gapmer; 5-MeC
siRNAs.dagger. si-PTEN 263186 PTEN as CU*GC*UA*GC*CU*CU*GG* 24 alt
*P = S, P = O AU*UU*GdT*dT linkage; 3'-dTdT overhang 263187 PTEN s
CA*AA*UC*CA*GA*GG*CU* 25 alt *P = S,P = O AG*CA*GdT*dT linkage;
3'-dTdT overhang si-PTEN 263188 PTEN as CU*UC*UG*GC*AU*CC*GG* 26
alt *P = S, P = O (6MM) (6MM) UU*UA*GdT*dT linkage; 3'-dTdT
overhang 263189 PTEN s CU*AA*AC*CG*GA*UG*CC* 27 alt *P = S,P = O
(6MM) AG*AA*GdT*dT linkage; 3'-dTdT overhang si-PTEN 278626 PTEN as
CUGCUAGCCUCUGGAUUUG 28 unmodified RNA (blunt) AC 278627 PTEN s
GUCAAAUCCAGAGGCUAGC 29 unmodified RNA AG si-Fas.dagger-dbl. -- Fas
as 5'-P 30 unmodified RNA; GUCUGGUUUGCACUUGCAC 5'-Phosphate, dTdT
3'-dTdT overhang -- Fas s 5'-P 31 unmodified RNA;
GUGCAAGUGCAAACCAGAC 5'-Phosphate, dTdT 3'-dTdT overhang si-Fas
328798 Fas as 5'-P 32 unmodified RNA; (6MM) (6MM)
GUGUCGUGUUCAGUUCCAC 5'-Phosphate, dTdT 3'-dTdT overhang 328799 Fas
s 5'-P 33 unmodified RNA; (6MM) GUGGAACUGAACACGACAC 5'-Phosphate,
dTdT 3'-dTdT overhang .dagger.siRNAs are named as dsRNA sets (e.g.,
si-PTEN includes the antisense strand 263186 and sense strand
263187) .dagger-dbl.si-Fas sequences from Song et. al. (2003)
Legend: as-antisense strand, s-sense strand, ApoB-Apolipoprotein B,
PTEN-Phosphotase and Tensin homolog deleted on chromosome Ten,
MTTP-Microsomal Triglyceride Transfer Protein
TABLE-US-00013 TABLE 13 0 1 2 4 % UTC A 303912 add 341315 130 (4
uM) B 303912 replace (replaced with 303912 105 with 341315 instead
by mistake) C 303912 replace 104 with 341315 D 303912 replace 94
with 341315 E 316449 add 341315 141 (4 uM) F 316449 replace 103
with 341315 G 316449 replace 107 with 341315 H 316449 replace 114
with 341315 I 341315 add 303912 31 (4 uM) J 341315 replace 122 with
303912 K 341315 replace 23 with 303912 L 341315 replace 29 with
303912 M 341315 add 316449 50 (4 uM) N 341315 replace 120 with
316449 O 341315 replace 42 with 316449 P 341315 replace 50 with
316449 Q 303912:341315 31 R 316449:341315 68 S 303912 82 T 316449
89 U 347849:308746 83 A, E, I & M - cells were treated at time
0 with one strand; after four hours, the other strand was added. B,
F, J & N - cells were treated at time 0 with one strand; after
1 hour, the first treatment is removed and replaced with the one
containing the other strand. C, G, K & O - cells were treated
at time 0 with one strand; after 2 hours, the first treatment is
removed and replaced with the one containing the other strand. D,
H, L & P - cells were treated at time 0 with one strand; after
4 hours, the first treatment is removed and replaced with the one
containing the other strand. Q-U - these were treated at time 0 and
left untouched until lysis time.
TABLE-US-00014 TABLE 14 Free Uptake in mouse hepatocytes- effects
of chemical modifications Time (hr) 0 1 2 4 % UTC A 344178 add
303912 45 (2 uM) B 344178 replace 28 with 303912 C 344178 replace
41 with 303912 D 344178 replace 43 with 303912 E 344178 add 317502
50 (2 uM) F 344178 replace 40 with 317502 G 344178 replace 66 with
317502 H 344178 replace 73 with 317502 I 344178 add 335449 89 (2
uM) J 344178 replace 79 with 335449 K 344178 replace 82 with 335449
L 344178 replace 82 with 335449 M 344178 add 354626 49 (2 uM) N
344178 replace 29 with 354626 O 344178 replace 45 with 354626 P
344178 replace 47 with 354626 Q 354622 add 303912 98 (2 uM) R
354622 replace 86 with 303912 S 354622 replace 88 with 303912 T
354622 replace 94 with 303912 U 303912 95 V 317502 122 W 354626 96
X 116847 7 Y 303912:344178 23 Z 354626:344178 23 A, E, I, M and Q-
cells were treated at time 0 with one strand; after four hours, the
other strand was added. B, F, J, N and R - cells were treated at
time 0 with one strand; after 1 hour, the first treatment is
removed and replaced with the one containing the other strand. C,
G, K, O and S- cells were treated at time 0 with one strand; after
2 hours, the first treatment is removed and replaced with the one
containing the other strand. D, H, L, P and T - cells were treated
at time 0 with one strand; after 4 hours, the first treatment is
removed and replaced with the one containing the other strand. U,
V, W, X, Y and Z - these were treated at time 0 and left untouched
until lysis time.
TABLE-US-00015 TABLE 15 Free Uptake in mouse hepatocytes- effects
of backbone modifications Time (hr) 0 1 2 4 % UTC A 330696 add
303912 ND (2 .mu.M) B 330696 replace ND with 303912 C 330696
replace ND with 303912 D 330696 replace ND with 303912 E 330696 add
335449 84 (2 .mu.M) F 330696 replace 86 with 335449 G 330696
replace 85 with 335449 H 330696 replace 104 with 335449 I 341315
add 303912 ND (2 .mu.M) J 341315 replace 24 with 303912 K 341315
replace 27 with 303912 L 341315 replace 32 with 303912 M 341315 add
317502 79 (2 .mu.M) N 341315 replace 52 with 317502 O 341315
replace 69 with 317502 P 341315 replace 97 with 317502 Q 341315 add
335449 96 (2 .mu.M) R 341315 replace 89 with 335449 S 341315
replace 94 with 335449 T 341315 replace 105 with 335449 U 341315
add 354626 35 (2 .mu.M) V 341315 replace 29 with 354626 W 341315
replace 37 with 354626 X 341315 replace 39 with 354626 Y
354626:341315 34 Z 116847 9 A, E, I, M, Q and U- cells were treated
at time 0 with one strand; after four hours, the other strand was
added. B, F, J, N, R and V- cells were treated at time 0 with one
strand; after 1 hour, the first treatment is removed and replaced
with the one containing the other strand. C, G, K, O, S and W-
cells were treated at time 0 with one strand; after 2 hours, the
first treatment is removed and replaced with the one containing the
other strand. D, H, L, P, T and X- cells were treated at time 0
with one strand; after 4 hours, the first treatment is removed and
replaced with the one containing the other strand. Y and Z - these
were treated at time 0 and left untouched until lysis time.
TABLE-US-00016 TABLE 16 MOE in Both Strands Improves Activity
Compound Construct IC.sub.50 Efficacy (sense_antisense) (sense 5'
to 3/antisense) (nM) (% UTC) Unmodified P-5'-AAGUAAGGACCAGAGACAA-3'
(SEQ ID NO: 35) 2.8 17 sense/antisense 3'-UUCAUUCCUGGUCUCUGUUU-5'-P
(SEQ ID NO: 38) Unmodified sense/ P-5'-AAGUAAGGACCAGAGACAA-3' (SEQ
ID NO: 35) <0.1 17 MOE modified 3'-UUCAUUCCUGGUCUCUGUUU-5'-P
(SEQ ID NO: 38) antisense Modified sense &
P-5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) 0.9 20 antisense
3'-UUCAUUCCUGGUCUCUGUUU-5'-P (SEQ ID NO: 38) bolded nucleotides
indicated point of modification.
TABLE-US-00017 TABLE 17 MOE Gapmer Sense Strands Enhance Potentcy
of siRNA Duplexes Construct IC.sub.50 Efficacy Compound (Sense 5'
to 3'/Antisense) (nM) (% UTC) Unmodified 5'-AAGUAAGGACCAGAGACAA-3'
(SEQ ID NO: 35) 0.9 14 3'-UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 38)
MOE gapmer sense 5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) 0.5 13
Unmodified 3'-UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 38) antisense
Unmodified sense 5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) 5.0 18
4'-thio gapmer 3'-UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 38) antisense
MOE gapmer sense 5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) 0.5 15
4'-thio gapmer 3'-UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 38) antisense
Unmodified sense 5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) 0.7 15
OMe/4'-thio gap 3'-UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 38) antisense
MOE gapmer sense 5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) 0.2 11
OMe/4'-thio gap 3'-UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 38) antisense
bolded nucleotides indicated point of modification.
TABLE-US-00018 TABLE 18 Human PTEN Modified siRNA in HeLa Cells-
Normalized to Ribogreen # Sense_Antisense 1
5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) 3'-UUCAUUCCUGGUCUCUGUU-5'
(SEQ ID NO: 40) 2 P-5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) MOE
3'-UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 40) MOE 3
P-5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) OMe
3'-UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 40) OMe 4
5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) 3'-UUCAUUCCUGGUCUCUGUU-5'
(SEQ ID NO: 40) MOE 5 5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) MOE
3'-UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 40) 6
5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) MOE
3'-UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 40) OMe 7
5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) MOE
3'-UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 40) OMe 8
5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) OMe
3'-UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 40) OMe 9
P-5'-AAGUAAGGACCAGAGACAA-3' (SEQ ID NO: 35) MOE
3'-UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 40) OMe
TABLE-US-00019 TABLE 19 Human PTEN Sense Strand 4'-Thioribose
IC.sub.50 Efficacy # Sense_Antisense, 5'_3' nM % UTC 1
AAGUAAGGACCAGAGACAAA-3' (SEQ ID 0.4 10 NO: 39)
UUCAUUCCUGGUCUCUGUUU-5' (SEQ ID NO: 38) 2 AAGUAAGGACCAGAGACAA-3'
(SEQ ID 1.0 20 NO: 35) UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 40) 3
AAGUAAGGACCAGAGACAAA-3' (SEQ ID 1.9 10 NO: 39)
uucAUUCCUGGUCUCUGUUU-5' (SEQ ID NO: 38) 4 AAGUAAGGACCAGAGACAAA-3'
(SEQ ID 1.7 20 NO: 39) UUCAUUCCUGGUCUCUGUUU-5' (SEQ ID NO: 38) 5
AAGUAAGGACCAGAGACAAA-3' (SEQ ID 2.4 20 NO: 39)
UUCAUUCCUGGUCUCUGUUU-5' (SEQ ID NO: 38) 6 AAGUAAGGACCAGAGACAAA-3'
(SEQ ID 1.0 20 NO: 39) UUCAUUCCUGGUCUCUGUUU-5' (SEQ ID NO: 38) 7
AAGUAAGGACCAGAGACAAA-3' (SEQ ID 0.3 10 NO: 39)
UUCAUUCCUGGUCUCUGUUU-5' (SEQ ID NO: 38) 8 AAGUAAGGACCAGAGACAAA-3'
(SEQ ID 0.2 10 NO: 39) UUCAUUCCUGGUCUCUGUUU-5' (SEQ ID NO: 38) 9
AAGUAAGGACCAGAGACAAA-3' (SEQ ID <0.1 10 NO: 39)
uucAUUCCUGGUCUCUGUUU-5' (SEQ ID NO: 38) 10 AAGUAAGGACCAGAGACAAA-3'
(SEQ ID 1.4 20 NO: 39) UUCAUUCCUGGUCUCUGUUU-5' (SEQ ID NO: 38)
bolded nucleotides = 4'-thio; small letter nucleotides = OMe
TABLE-US-00020 TABLE 20 In Vivo Constructs Compound Construct
(Sense_antisense) (Sense 5'.fwdarw.3'/Antisense) Target
341401_341391 5'-AAGUAAGGACCAGAGACAA-3' PO (SEQ ID NO: 35) PTEN
3'-UUCAUUCCUGGUCUCUGUU-5' (SEQ ID NO: 40) 359551_359550
5'-A.sub.sAG.sub.sUA.sub.sAG.sub.sGA.sub.sCC.sub.sAG.sub.sAG.sub.sAC.sub.-
sAA-3' PO/PS (SEQ ID NO: 35) PTEN
3'-UU.sub.sCA.sub.sUU.sub.sCC.sub.sUG.sub.sGU.sub.sCU.sub.sCU.sub.sGU.sub-
.sU-5' (SEQ ID NO: 40) 352821_352820 5'-AaGuAaGgAcCaGaGaCaA-3'
OMe/F* PO (SEQ ID NO: 35) PTEN 3'-uUcAuUcCuGgUcUcUgUu-5' (SEQ ID
NO: 40) 308746_342851 5'-AAGUAAGGACCAGAGACAAA-3' (20-mer) (SEQ ID
NO: 39) PTEN 3'-UUCAUUCCUGGUCUCUGUUU-5' 4' Thio PO (SEQ ID NO: 38)
*small letter nucleotides = OMe; bolded nucleotides = F
TABLE-US-00021 TABLE 22 In Vitro Analysis of Cholesterol Conjugates
# Sense_ Antisense SEQ ID NO. 341401 5'-AAGUAAGGACCAGAGACAA-3' 35
341391 3'-UUCAUUCCUGGUCUCUGUU-5' 40 366559
AAGUAAGGACCAGAGACAA-3'chol 35 341391 UUCAUUCCUGGUCUCUGUU-5' 40
366559 AAGUAAGGACCAGAGACAA-3'chol 35 359995 uUcAuUcCuGgUcUcUgUu-5'
40 366667 5'chol-AaGuAaGgAcCaGaGaCaA 35 341391
3'-UUCAUUCCUGGUCUCUGUU 40 359467 5'-AAGUAAGGACCAGAGACAA 35 366561
3'chol-uUcAuUcCuGgUcUcUgUu 40 341401 5'-AAGUAAGGACCAGAGACAA 35
366561 3'chol-uUcAuUcCuGgUcUcUgUu 40 *small letter nucleotides =
OMe; bolded nucleotides = F
TABLE-US-00022 TABLE 23 In Vitro Analysis of Cholesterol Conjugates
SEQ ID # Sense_Antisense NO. 359996 5'-AaGuAaGgAcCaGaGaCaA-3' 35
359995 3'-uUcAuUcCuGgUcUcUgUu-5' 40 366667
5'chol-AaGuAaGgAcCaGaGaCaA 35 359995 3'-uUcAuUcCuGgUcUcUgUu 40
366667 5'chol-AaGuAaGgAcCaGaGaCaA 35 352820
3'-uUcAuUcCuGgUcUcUgUu-P 40 359996 5'-AaGuAaGgAcCaGaGaCaA 35 366561
3'-chol uUcAuUcCuGgUcUcUgUu 40 344178 5'-AAGUAAGGACCAGAGACAAA 39
303912 3'-UUCAUUCCUGGUCUCUGUUA 41 29592
3'-T*T*C*A*TTCCTGGTCTC*T*G*T*-5' 42 *small letter nucleotides =
OMe; bolded nucleotides = F; * = MOE
TABLE-US-00023 TABLE 24 In Vitro Analysis of Cholesterol Conjugates
# Sense_Antisense SEQ ID NO. 341401 5'-AAGUAAGGACCAGAGACAA-3' 35
341391 3'-UUCAUUCCUGGUCUCUGUU-5' 40 366559
AAGUAAGGACCAGAGACAA-3'chol 35 341391 UUCAUUCCUGGUCUCUGUU-5' 40
366559 AAGUAAGGACCAGAGACAA-3'chol 35 359995 uUcAuUcCuGgUcUcUgUu-5'
40 366667 5'chol-AaGuAaGgAcCaGaGaCaA 35 341391
3'-UUCAUUCCUGGUCUCUGUU 40 359467 5'-AAGUAAGGACCAGAGACAA 35 366561
3'chol-uUcAuUcCuGgUcUcUgUu 40 341401 5'-AAGUAAGGACCAGAGACAA 35
366561 3'chol-uUcAuUcCuGgUcUcUgUu 40 *small letter nucleotides =
OMe; bolded nucleotides = F
TABLE-US-00024 TABLE 25 In Vitro Analysis of Cholesterol Conjugates
SEQ ID # Sense_Antisense NO. 359996 5'-AaGuAaGgAcCaGaGaCaA-3' 35
359995 3'-uUcAuUcCuGgUcUcUgUu-5' 40 366667
5'chol-AaGuAaGgAcCaGaGaCaA 35 359995 3'-uUcAuUcCuGgUcUcUgUu 40
366667 5'chol-AaGuAaGgAcCaGaGaCaA 35 352820
3'-uUcAuUcCuGgUcUcUgUu-P 40 359996 5'-AaGuAaGgAcCaGaGaCaA 35 366561
3'-chol-uUcAuUcCuGgUcUcUgUu 40 344178 5'-AAGUAAGGACCAGAGACAAA 35
303912 3'-UUCAUUCCUGGUCUCUGUUA 40 29592
3'-T*T*C*A*TTCCTGGTCTC*T*G*T*-5' 42 *small letter nucleotides =
OMe; bolded nucleotides = F; * = MOE
TABLE-US-00025 TABLE 26 In Vitro mRNA and Protein Reduction Results
with Target X Chemistries Protein Construct IC.sub.50 Efficacy
IC.sub.50 Stability Compound (Sense 5'.fwdarw.,3'/Antisense) (nM)
(% UTC) (nM) t 1/2 (h) siRNA 1 XXXXXXXXXXXXXXXXXXX 0.60 14 <1.0
<1 XXXXXXXXXXXXXXXXXXX siRNA 2 XXXXXXXXXXXXXXXXXXX 0.2 26
<1.0 >4
X.dagger.X.dagger.X.dagger.XXXXXXXXXXXXXX.dagger.X.dagger.X.dagger.
siRNA 3 XX*XX*XX*XX*XX*XX*XX*XX*XX*X .12 8 2.9 >4
xxxXXXXXxxXXxxXXXXX siRNA 4 XxXxXxXxXxXxXxXxXxX 0.06 8 4.0 >4
xXxXxXxXxXxXxXxXxXx *small letter nucleotides = OMe; bolded
nucleotides = F; * = MOE; .dagger. = 4'-Thio
Sequence CWU 1
1
42124DNAArtificial SequencePrimer 1atgacaatca tgttgcagca attc
24225DNAArtificial SequencePrimer 2cgatgcaata aatatgcaca aatca
25326DNAArtificial SequenceProbe 3gtaaagctgg aaagggacgg actggt
26421DNAArtificial SequencePrimer 4tccaagacac agctgagcag a
21522DNAArtificial SequencePrimer 5tgcatcactc ttcccatgag at
22626DNAArtificial SequenceProbe 6agtccagctg ctcctgtgct ggtacc
26719DNAArtificial SequencePrimer 7cgtgggctcc agcattcta
19821DNAArtificial SequencePrimer 8agtcatttct gcctttgcgt c
21922DNAArtificial SequenceProbe 9ccaatggtcg ggcactgctc aa
221021DNAArtificial SequencePrimer 10gagcggtctg gatttacaac g
211124DNAArtificial SequencePrimer 11aggtagtgac agatgtggct tttg
241223DNAArtificial SequenceProbe 12caaaccaggt gctgggcgtc agt
231315DNAArtificial SequencePrimer 13tcgccgcttg ctgca
151417DNAArtificial SequencePrimer 14atcggccgtg atgtcga
171523DNAArtificial SequenceProbe 15ccatggtcaa ccccaccgtg ttc
231620DNAArtificial SequenceOligomeric Compound 16ctgctagcct
ctggatttga 201720DNAArtificial SequenceOligomeric Compound
17cttctggcat ccggtttaga 201812RNAArtificial SequenceOligomeric
Compound 18cgcgaauucg cg 121912RNAArtificial SequenceOligomeric
Compound 19gcgcuuaagc gc 122020DNAArtificial SequenceOligomeric
Compound 20tccagcactt tcttttccgg 202120DNAArtificial
SequenceOligomeric Compound 21tccatctcct tttatgccgg
202220DNAArtificial SequenceOligomeric Compound 22cccagcacct
ggtttgccgt 202320DNAArtificial SequenceOligomeric Compound
23gtccctgaag atgtcaatgc 202421DNAArtificial SequenceOligomeric
Compound 24cugcuagccu cuggauuugt t 212521DNAArtificial
SequenceOligomeric Compound 25caaauccaga ggcuagcagt t
212621DNAArtificial SequenceOligomeric Compound 26cuucuggcau
ccgguuuagt t 212721DNAArtificial SequenceOligomeric Compound
27cuaaaccgga ugccagaagt t 212821RNAArtificial SequenceOligomeric
Compound 28cugcuagccu cuggauuuga c 212921RNAArtificial
SequenceOligomeric Compound 29gucaaaucca gaggcuagca g
213021DNAArtificial SequenceOligomeric Compound 30gucugguuug
cacuugcact t 213121DNAArtificial SequenceOligomeric Compound
31gugcaagugc aaaccagact t 213221DNAArtificial SequenceOligomeric
Compound 32gugucguguu caguuccact t 213321DNAArtificial
SequenceOligomeric Compound 33guggaacuga acacgacact t
213420DNAArtificial SequenceOligomeric Compound 34tttgtctctg
gtccttactt 203519RNAArtificial SequenceOligomeric Compound
35aaguaaggac cagagacaa 193621DNAArtificial SequenceOligomeric
Compound 36tttgtctctg gtccttactt t 213720DNAArtificial
SequenceOligomeric Compound 37aagtaaggac cagagacaaa
203820RNAArtificial SequenceOligomeric Compound 38uucauuccug
gucucuguuu 203920RNAArtificial SequenceOligomeric Compound
39aaguaaggac cagagacaaa 204019RNAArtificial SequenceOligomeric
Compound 40uucauuccug gucucuguu 194120RNAArtificial
SequenceOligomeric Compound 41uucauuccug gucucuguua
204218DNAArtificial SequenceOligomeric Compound 42ttcattcctg
gtctctgt 18
* * * * *