U.S. patent application number 13/021473 was filed with the patent office on 2011-06-23 for use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof.
Invention is credited to Sylvain Arnould, Sylvia Bruneau, Jean-Pierre Cabaniols, Patrick Chames, Andre Choulika, Philippe Duchateau, Jean-Charles Epinat, Agnes Gouble, Emmanuel Lacroix, Frederic Paques, Christophe Perez-Michaut, Julianne Smith, David Sourdive.
Application Number | 20110151539 13/021473 |
Document ID | / |
Family ID | 32829807 |
Filed Date | 2011-06-23 |
United States Patent
Application |
20110151539 |
Kind Code |
A1 |
Arnould; Sylvain ; et
al. |
June 23, 2011 |
USE OF MEGANUCLEASES FOR INDUCING HOMOLOGOUS RECOMBINATION EX VIVO
AND IN TOTO IN VERTEBRATE SOMATIC TISSUES AND APPLICATION
THEREOF
Abstract
A single chain homing endonuclease, comprising a first variant
of I-CreI having the amino acid sequence of accession number pdb
1g9y and a second variant of I-CreI variant having the amino acid
sequence of accession number pdb 1g9y in a single polypeptide.
Inventors: |
Arnould; Sylvain; (Paris,
FR) ; Bruneau; Sylvia; (Paris, FR) ;
Cabaniols; Jean-Pierre; (Saint Leu La Foret, FR) ;
Chames; Patrick; (Paris, FR) ; Choulika; Andre;
(Paris, FR) ; Duchateau; Philippe; (Cemy, FR)
; Epinat; Jean-Charles; (Paris, FR) ; Gouble;
Agnes; (Paris, FR) ; Lacroix; Emmanuel;
(Paris, FR) ; Paques; Frederic; (Bourg La Reine,
FR) ; Perez-Michaut; Christophe; (Paris, FR) ;
Smith; Julianne; (Paris, FR) ; Sourdive; David;
(Levallois-Perret, FR) |
Family ID: |
32829807 |
Appl. No.: |
13/021473 |
Filed: |
February 4, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10543557 |
Mar 14, 2006 |
|
|
|
PCT/IB04/00848 |
Jan 28, 2004 |
|
|
|
13021473 |
|
|
|
|
60491535 |
Aug 1, 2003 |
|
|
|
60442911 |
Jan 28, 2003 |
|
|
|
Current U.S.
Class: |
435/196 |
Current CPC
Class: |
A01K 67/0275 20130101;
C12N 2840/44 20130101; A61P 43/00 20180101; C12N 15/907 20130101;
A61K 38/1709 20130101; A61K 48/0058 20130101; C07K 14/435 20130101;
A61P 31/18 20180101; C12N 2830/55 20130101; C07K 2319/81 20130101;
C12N 15/1058 20130101; A01K 2217/00 20130101; C12N 2800/80
20130101; A61P 31/00 20180101; A01K 2207/15 20130101; A61K 38/00
20130101; C12N 15/86 20130101; C12N 2799/022 20130101; A61K 48/00
20130101; A01K 2267/03 20130101; C12N 9/22 20130101; C12N 2830/002
20130101; C12N 2840/20 20130101; A01K 2267/0337 20130101; A61P
31/12 20180101; C12N 15/8509 20130101; A01K 67/0278 20130101; C12N
7/00 20130101; C12N 15/90 20130101; C12N 2730/10143 20130101; A61K
38/465 20130101; A61P 35/02 20180101; C12Y 301/00 20130101; A01K
2217/05 20130101; A01K 2227/105 20130101; A61P 35/00 20180101; C12Y
301/21004 20130101; A61P 31/20 20180101 |
Class at
Publication: |
435/196 |
International
Class: |
C12N 9/16 20060101
C12N009/16 |
Claims
1. A single chain homing endonuclease, comprising a first variant
of I-CreI having the amino acid sequence of SEQ ID NO:23 and a
second variant of I-CreI having the amino acid sequence of SEQ ID
NO:23 in a single polypeptide, wherein said first variant of I-CreI
contains the following substitutions: one to six substitutions in
the sequence of amino acid residues 26 to 40 and one to three
substitutions in the sequence of amino acid residues 44 to 77,
wherein in said first variant of I-CreI there is a substitution at
positions 33 and 68, and independently, said second variant of
I-CreI contains the following substitutions: four to six
substitutions in the sequence of amino acid residues 26 to 40 and
two to three substitutions in the sequence of amino acid residues
44 to 77, wherein in said second variant of I-CreI there is a
substitution at positions 26, 30, 32, 38, 44, 68 and 77 wherein the
endonuclease binds and cleaves DNA.
2. The single chain homing endonuclease according to claim 1,
wherein said second variant of I-CreI further contains a
substitution at positions 40.
3. The single chain homing endonuclease according to claim 1,
wherein said first variant of I-CreI has a substitution at
positions 24, 33 and 68.
4. The single chain homing endonuclease according to claim 1,
wherein said first variant of I-CreI has a substitution at
positions 24, 33, 68 and 77.
5. The single chain homing endonuclease according to claim 1
wherein said second variant of I-CreI has a substitution at
position 42.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S. Ser. No.
10/543,557, which entered the U.S. National Stage on Jul. 27, 2005,
as a National Stage (371) application of PCT/IB04/00848 (compliance
with 35 U.S.C. .sctn.371(c) on Mar. 14, 2006), filed on Jan. 28,
2004, and claims priority to U.S. 60/491,535, filed on Aug. 1,
2003, and U.S. 60/442,911, filed on Jan. 28, 2003.
FIELD OF THE INVENTION
[0002] The present invention relates to the use of meganucleases
for inducing homologous recombination ex vivo and in toto in
vertebrate somatic tissues and to its application for genome
engineering and gene therapy.
BACKGROUND OF THE INVENTION
[0003] Homologous gene targeting has been widely used in the past
to obtain site-specific and precise genome surgery (Thomas and
Capecchi, 1986, Nature, 324, 34-8; Thomas et al., 1986, Cell, 44,
419-28; Thomas and Capecchi, 1986, Cold Spring Harb Symp Quant
Biol, 51 Pt 2, 1101-13; Doetschman et al., 1988, PNAS, 85, 8583-7).
Homologous gene targeting relies on the homologous recombination
machinery, one of the endogenous maintenance systems of the cell.
Since this system has been well conserved throughout evolution,
gene targeting could be used in organisms as different as bacteria,
yeast, filamentous fungi, mammals, insects, and plants.
[0004] One direct application is the modulation of gene expression
by modifying the regulatory sequences surrounding the gene (EP
419621; U.S. Pat. Nos. 6,528,313; 6,528,314; 5,272,071; 5,641,670).
Correction of mutated genes by homologous recombination is another
application (Fischer et al., 2002, Isr Med Assoc J, 4, 51-4). A
deleterious mutation can often be complemented by the introduction
of a wild type gene anywhere else in the genome. However, there are
three major drawbacks in such an approach (random transgenesis).
First, the mutated gene is still present. Certain mutation will
result in a gain of function, that will not be complemented by the
wild type gene, or that can at least interfere with the wild type
gene. Second, gene expression often depends on very long tracts of
surrounding sequences. In higher eukaryotes, these sequences can
span over several hundreds of kbs, and are necessary for the
precise tuning of gene expression during the cell cycle,
development, or in response to physiological signals. Even though
transgenic sequences involve most of the time a few kbs, there is
no way they can restore a fully wild type phenotype. This problem
can however be alleviated by transformation with very large
sequences (BAC), but it requires additional skills. Third, random
transgenesis results in insertions anywhere in the genome, with a
non-null probability of a deleterious effect: insertion in a gene
will disrupt the gene or its proper regulation. Such deleterious
effect have been fully illustrated recently in gene therapy trials
for SCID patients (Fischer et al., precited), which resulted in
cases of leukemia-like syndromes, probably as a consequence of
deleterious insertions of the virus-borne transgenes.
[0005] In contrast with random transgenesis, homologous
recombination allows the precise modification of a chromosomal
locus: it can result in gene deletion, gene insertion, or gene
replacement, depending on the targeting vector. In addition, subtle
changes can be introduced in a specific locus, including the
modification of coding and regulatory sequences (EP 419621; U.S.
Pat. Nos. 6,528,313; 6,528,314; 5,272,071; 5,641,670;
6,063,630).
[0006] These specific advantages should make homologous gene
targeting a universal tool for genome engineering, and the only
safe methodology for gene therapy. However, the use of homologous
recombination is limited by its poor efficiency in most cells.
Although homologous gene targeting is extremely efficient in the
yeast Saccharomyces cerevisiae (Paques and Haber, 1999, Microbiol
Mol Biol Rev, 63, 349-404), the moss Physcomitrella patens
(Schaefer and Zryd, 1997, Plant J, 11, 1195-206), certain mutant
Escherichia coli strains (Murphy, 1998, J. Bacteriol, 180, 2063-71;
Zhang et al., 1998, Nat Genet, 20, 123-8), and in avian cell lines
such as DT40 (Buerstedde and Takeda, 1991, Cell, 67, 179-88), its
efficiency remains extremely low in most cells and organisms. For
example in cultured mammalian cells, such recombination events
usually occur in only one in ten thousands cells which have taken
up the relevant correcting or targeting DNA.
[0007] As a consequence, many approaches have been used to improve
the efficiency of homologous gene targeting. Chimeraplasty (Yoon et
al., 1996, PNAS, 93, 2071-6), Small Fragment Homologous
Recombination (Goncz et al., 2002, Gene Ther, 9, 691-4) and Triplex
Forming Oligonucleotides (Gorman and Glazer, 2001, Curr Mol Med, 1,
391-9) are as many examples. However, the most robust and efficient
way to improve homologous gene targeting remains to deliver a DNA
double-strand break (DSB) in the locus of interest (U.S. Pat. Nos.
5,474,896; 5,792,632; 5,866,361; 5,948,678; 5,948,678, 5,962,327;
6,395,959; 6,238,924; 5,830,729). This method improves the
targeting efficiency by several orders of magnitude in mammalian
cells (Donoho et al., 1998, Mol Cell Biol, 18, 4070-8; Rouet et
al., 1994, Mol Cell Biol, 14, 8096-106; Choulika et al., 1995, Mol
Cell Biol, 15, 1968-73; Cohen-Tannoudji et al., 1998, Mol Cell
Biol, 18, 1444-8; Porteus and Baltimore, 2003, Science, 300, 763;
Porteus et al., 2003, Mol Cell Biol, 23, 3558-65; Miller et al.,
2003, Mol Cell Biol, 23, 3550-7) and allows gene targeting in
plants (Puchta et al., 1993, Nucleic Acids Res, 21, 5034-40) and
Drosophila (Bibikova et al., 2003, Science, 300, 764).
[0008] Therefore, the introduction of the double-strand break is
accompanied by the introduction of a targeting segment of DNA
homologous to the region surrounding the cleavage site, which
results in the efficient introduction of the targeting sequences
into the locus (either to repair a genetic lesion or to alter the
chromosomal DNA in some specific way). Alternatively, the induction
of a double-strand break at a site of interest is employed to
obtain correction of a genetic lesion via a gene conversion event
in which the homologous chromosomal DNA sequences from an other
copy of the gene donates sequences to the sequences where the
double-strand break was induced. This latter strategy leads to the
correction of genetic diseases either in which one copy of a
defective gene causes the disease phenotype (such as occurs in the
case of dominant mutations) or in which mutations occur in both
alleles of the gene, but at different locations (as is the case of
compound heterozygous mutations), (WO 96/14408; WO 00/46386; U.S.
Pat. No. 5,830,729; Choulika et al., precited; Donoho et al.,
precited; Rouet et al., precited).
[0009] However, the delivery of site-specific DSBs proved to be
another challenge. It requires the use of site-specific
endonucleases recognizing large sequences. Such very rare-cutting
endonucleases recognizing sequences larger than 12 base pairs are
called meganucleases. Ideally, one would like to use endonucleases
cutting only once in the genome of interest, the cleavage being
limited to the locus of interest.
[0010] In the wild, such endonucleases are essentially represented
by homing endonucleases (Chevalier and Stoddard, 2001, N.A.R., 29,
3757-74). Homing endonucleases are found in fungi, algae,
eubacteria and archae, and are often encoded in mobile genetic
elements. Their cleavage activities initiate the spreading of these
mobile elements by homologous recombination. The biology of HO
(Haber, 1998, Annu Rev Genet, 32, 561-99; Haber, 1995, Bioessays,
17, 609-20), I-SceI (Jacquier and Dujon, 1985, Cell, 41, 383-94;
Fairhead and Dujon, 1993, Mol Gen Genet, 240, 170-8; Colleaux et
al., 1988, PNAS, 85, 6022-6; Perrin et al., 1993, Embo J, 12,
2939-47; Plessis et al., 1992, Genetics, 130, 451-60) and I-TevI
endonucleases (Bell-Pedersen et al., 1989, Gene, 82, 119-26;
Bell-Pedersen et al., 1990, Nucleic Acids Res, 18, 3763-70; Mueller
et al., 1996, Genes Dev, 10, 2158-66) are among the many paradigms
for such DSB-induced recombination events.
[0011] HO and I-SceI have been used to induce homologous gene
targeting in yeast (Haber, 1995, precited; Fairhead and Dujon,
1993, precited; Plessis et al., 1992, precited; U.S. Pat. Nos.
5,792,632 and 6,238,924), in cultured mammalian cells (Donoho et
al.; Rouet et al.; Choulika et al.; Cohen-Tannoudji et al.,
precited; U.S. Pat. Nos. 5,792,632; 5,830,729 and 6,238,924) and
plants (Puchta et al., 1996, PNAS, 93, 5055-60; U.S. Pat. Nos.
5,792,632 and 6,238,924). Meganucleases have also been used to
trigger various intra- and interchromosomal rearrangements based on
DSB-induced homologous recombinations in bacteria (Posfai et al.,
1999, N.A.R., 27, 4409-15), yeast (Paques and Haber, 1999,
Microbiol Mol Biol Rev, 63, 349-404), plants (Siebert and Puchta,
2002, Plant Cell, 14, 1121-31; Chiurazzi et al., 1996, Plant Cell,
8, 2057-66; Puchta, 1999, Genetics, 152, 1173-81), insects (Rong et
al., 2002, Genes Dev, 16, 1568-81) and cultured mammalian cells
(Lin and Waldman, 2001, Genetics, 158, 1665-74; Liang et al., 1998,
PNAS, 95, 5172-7).
[0012] Group II introns proteins can also be used as meganucleases.
The biology of these proteins is much more complex than the biology
of homing endonucleases encoded by group I introns and inteins
(Chevalier and Stoddard, precited). The protein is involved in
intron splicing, and forms a ribonucleic particle with the spliced
RNA molecule. This complex displays different activities including
reverse splicing (of the RNA intron in a DNA strand from the target
gene), nicking (of the second DNA strand in the novel gene) and
reverse transcriptase (which copies the inserted RNA into a DNA
strand). The final insertion of the intron into the target gene
depends on all these activities. These proteins seem to induce
homologous recombination, with a DSB intermediate, when the reverse
transcriptase activity is mutated (Karberg et al., 2001, Nat.
Biotechnol, 19, 1162-7).
[0013] Unfortunately, this method of genome engineering by using
natural meganucleases for inducing homologous recombination by a
double-strand break is limited by the introduction of a recognition
and cleavage site of said natural meganuclease at the position
where the recombinational event is desired.
[0014] Up today, in a first approach for generating new
meganucleases (artificial or man-made meganucleases), some chimeric
restriction enzymes have been prepared through hybrids between a
DNA-binding domain (namely a zinc finger domain) and a catalytic
domain (the non-specific DNA-cleavage domain from the natural
restriction enzyme Fok I), (Smith et al, 2000, N.A.R, 28, 3361-9;
Smith et al., 1999, Nucleic Acids Res., 27, 274-281; Kim et al.,
1996, PNAS, 93, 1156-60; Kim & Chandrasegaran, 1994, PNAS, 91,
883-7; WO 95/09233; WO 94/18313; U.S. Pat. No. 5,436,150). The
resulting so-called Zinc-finger nucleases have been used to induce
tandem repeat recombination in Xenopus oocytes (Bibikova et al.,
2001, Mol Cell Biol, 21, 289-97), and homologous gene targeting in
cultured mammalian cell lines (Porteus and Baltimore, precited) and
Drosophila (Bibikova et al., precited).
[0015] Another approach consisted of embedding DNA binding and
catalytic activities within a single structural unit, such as a
type II restriction endonuclease. However, efforts to increase the
length of recognition sequence or alter the specificity of these
enzymes have resulted in the loss of catalytic activity or overall
diminution of specificity due to the tight interdependence of
enzyme structure, substrate recognition and catalysis (Lanio et
al., 2000, Protein Eng., 13, 275-281).
[0016] Based on homing endonuclease, Chevalier et al. (2002,
Molecular Cell, 10, 895-905) have also generated an artificial
highly specific endonuclease by fusing domains of homing
endonucleases I-Dmo I and I-Cre I. The resulting enzyme binds a
long chimeric DNA target site and cleaves it precisely at a rate
equivalent to its natural parents. However, this experiment leads
to one endonuclease with a new specificity but it is not applicable
to find an endonuclease that recognizes and cleaves any desired
polynucleotide sequence.
[0017] Fusions between nucleic acids and chemical compounds are
another class of artificial meganucleases, wherein DNA binding and
specificity rely on an oligonucleotide and cleavage on a chemical
compound tethered to the oligonucleotide. The chemical compounds
can have an endogenous cleavage activity, or cleave when complexed
with topoisomerases (Arimondo et al., 2001, Angew Chem Int Ed Engl,
40, 3045-3048; Arimondo and Helene, 2001, Curr Med Chem Anti-Cane
Agents, 1, 219-35).
[0018] Thus, meganuclease-induced recombination appears to be an
extremely powerful tool for introducing targeted modifications in
genomes. In addition, the development of new meganucleases able to
cleave DNA at the position where the recombinational event is
desired, for example derived from Zinc-finger nucleases, or from
natural homing endonucleases, would allow targeting at any given
locus at will and with a reasonable efficiency.
[0019] Nevertheless, it clearly emerges from the above analysis of
the prior art that the use of this technology in animals has so far
been mostly limited to its applications in vitro or ex vivo in
cultured cells, except in the case of Drosophila (Bibikova et al.
2003, precited), where it could be used to induce recombination in
a living animal, in the germline and somatic tissues.
[0020] It would be extremely advantageous to be able to use this
technology to induce recombination in a whole organism, in the
somatic tissues: [0021] This could be used for tissue-specific
genome engineering in animal models or foreign sequences excision
in genetically-modified organisms (once the trait depending on
these foreign sequences is not useful anymore). DSBs between two
tandem repeats induce very high levels of homologous recombination
resulting in deletion of one repeat together with all the
intervening sequences (Paques and Haber, 1999, Microbiol Mol Biol
Rev, 63, 349-404), and this can easily be used for the removal of
any transgene with an appropriate design. [0022] One other major
application would be the use of meganuclease-induced recombination
in gene therapy. In a number of cases, an ex vivo approach could be
used: precursor stem cells would be taken from the patients, healed
ex vivo, and grafted back in the deficient tissue. So far, ex vivo
techniques have been mostly used with blood cells in SCID and other
syndromes (although random insertion was used instead of homologous
recombination (Fischer et al., precited). The manipulation of stem
cells makes it an attractive approach for other tissues. However,
the use of meganuclease-induced recombination in toto would bypass
the ex vivo steps and enlarge the range of tissues that can be
treated.
[0023] There are however two major reasons why this approach is not
straightforward: [0024] First, this would require the delivery of a
meganuclease in the appropriate tissue. [0025] Second, cells in a
living organism do not necessarily behave as cultured cells or
germinal cells. Cultured cells and early (and sometimes late) germ
cells are dividing cells, going through G1, S, G2, and M phases. In
contrast, most cells in an adult animal are differentiated cells,
stuck in a G0 phase. Many results indicate and/or suggest that
homologous recombination does not have the same efficiency in all
phases of the cell cycle (Takata et al., 1998, Embo J, 17,
5497-508; Kadyk and Hartwell, 1992, Genetics, 132, 387-402; Gasior
et al., 2001, PNAS, 98, 8411-8; Essers et al., 1997, Cell, 89,
195-204). In general, the different tissues might have distinct
proficiencies for homologous gene conversions. Therefore, it is not
clear whether gene targeting and meganuclease-induced genome
engineering by homologous recombination could be used in whole
organisms, or even for ex vivo approaches, which relies on specific
cell types for which recombination proficiencies are largely
unknown.
[0026] Surprisingly, by using appropriate targeting constructs and
meganuclease expression vectors, the Inventors have shown that
meganucleases are indeed able to induce targeted homologous
recombination ex vivo and in toto, in vertebrate somatic
tissues.
[0027] Accordingly, meganucleases can be used for repairing a
specific sequence, modifying a specific sequence, for attenuating
or activating an endogenous gene of interest, for inactivating or
deleting an endogenous gene of interest or part thereof, for
introducing a mutation into a site of interest or for introducing
an exogenous gene or part thereof, in vertebrate somatic
tissues.
[0028] Therefore, these results establish a basis for efficient
site-specific genomic manipulation in mammalian somatic tissues for
experimental purposes and raise the possibility of therapeutically
correcting mutations by gene targeting.
DETAILED DISCUSSION OF THE INVENTION
[0029] Thus, the purpose of the present invention is to use
meganucleases for inducing homologous recombination ex vivo and in
toto in vertebrate somatic tissues.
[0030] Applications are in different fields: research, including
animal models generation (tissue specific genome surgery: knock-in
or knock-out); agricultural biotechnology (addition or removal of a
trait, marker excision, protein production) and therapeutics (gene
therapy: gene repair ex vivo and in toto and antiviral therapy:
excision of virus ex vivo and in toto).
[0031] Accordingly, the present invention relates to the use of at
least one meganuclease for the preparation of a medicament for
preventing, improving or curing a genetic disease in a vertebrate
in need thereof; said medicament being administered by any means to
said vertebrate.
[0032] The invention, also concerns the use of at least one
meganuclease for the preparation of a medicament for preventing,
improving or curing a disease caused by an infectious agent that
presents a DNA intermediate, in a vertebrate in need thereof; said
medicament being administered by any means to said vertebrate.
Preferably, said infectious agent is a virus.
[0033] Another object of the present invention is the use of at
least one meganuclease for genome engineering of non-human
vertebrate somatic tissues, for non-therapeutic purpose, by
introducing said meganuclease into the body of said non-human
vertebrate.
DEFINITIONS
[0034] In the present application, by "meganuclease" is intended a
double-stranded endonuclease having a large polynucleotide
recognition site, at least 12 bp, preferably from 12 bp to 60 bp.
Said meganuclease is also called rare-cutting or very rare-cutting
endonuclease. Said meganuclease is either monomeric or dimeric. It
includes any natural meganuclease such as a homing endonuclease,
but also any artificial or man-made meganuclease endowed with such
high specificity, either derived from homing endonucleases of group
I introns and inteins, or other proteins such as Zinc-Finger
proteins or group II intron proteins, or compounds such as nucleic
acid fused with chemical compounds.
[0035] In particular, artificial meganucleases include the
so-called "custom-made meganuclease" which is a meganuclease
derived from any initial meganuclease, either natural or not,
presenting a recognition and cleavage site different from the site
of the initial one; zinc-finger nucleases may also be considered as
custom-made meganucleases. By "different" is intended that the
custom-made meganuclease cleaves the novel site with an efficacy at
least 10 fold more than the natural meganuclease, preferably at
least 50 fold, more preferably at least 100 fold. "Natural" refers
to the fact that an object can be found in nature. For example, a
meganuclease that is present in an organism, that can be isolated
from a source in nature and which has not been intentionally
modified by man in the laboratory is natural.
[0036] By "in toto" is intended that the homologous recombination
event induced by the meganuclease takes place in vivo in the body
of a vertebrate; said meganuclease is introduced into the body of
said vertebrate by any convenient mean.
[0037] By "ex vivo" is intended that the homologous recombination
event induced by the meganuclease takes place in somatic cells
removed from the body of a vertebrate; said meganuclease is
introduced (ex vivo) into the cells of said vertebrate by any
convenient mean and the modified cells are then returned into the
body of said vertebrate.
[0038] By "somatic tissue" is intended any tissue within the body
of an organism including any type of cells from the precursor cells
(stem cells) to the fully differentiated cells, with the exception
of the germ line cells.
[0039] "Identity" refers to sequence identity between two nucleic
acid molecules or polypeptides. Identity can be determined by
comparing a position in each sequence which may be aligned for
purposes of comparison. When a position in the compared sequence is
occupied by the same base, then the molecules are identical at that
position. A degree of similarity or identity between nucleic acid
or amino acid sequences is a function of the number of identical or
matching nucleotides at positions shared by the nucleic acid
sequences. Various alignment algorithms and/or programs may be used
to calculate the identity between two sequences, including FASTA,
or BLAST which are available as a part of the GCG sequence analysis
package (University of Wisconsin, Madison, Wis.), and can be used
with, e.g., default settings.
[0040] By "homologous" is intended a sequence with enough identity
to another one to lead to a homologous recombination between
sequences, more particularly having at least 95% identity,
preferably 97%, and more preferably 99%.
[0041] The phrases "site of interest", "target site" and "specific
site", as used herein, refer to a distinct DNA location, preferably
a chromosomal location, at which a double stranded break (cleavage)
is to be induced by the meganuclease.
[0042] As used herein, the term "individual" includes mammals, as
well as other vertebrates (e.g., birds, fish and reptiles). The
terms "mammal" and "mammalian", as used herein, refer to any
vertebrate animal, including monotremes, marsupials and placental,
that suckle their young and either give birth to living young
(eutharian or placental mammals) or are egg-laying (metatharian or
nonplacental mammals). Examples of mammalian species include humans
and other primates (e.g., monkeys, chimpanzees), rodents (e.g.,
rats, mice, guinea pigs) and ruminants (e.g., cows, pigs,
horses).
[0043] By "genetic disease" is intended any disease, partially or
completely, directly or indirectly, due to an abnormality in one or
several genes. Said abnormality can be a mutation, an insertion or
a deletion. Said mutation can be a punctual mutation. Said
abnormality can affect the coding sequence of the gene or its
regulatory sequence.
[0044] Said abnormality can affect the structure of the genomic
sequence or the structure or stability of the encoded mRNA. Said
genetic disease can be recessive or dominant.
[0045] The term "vector" refers to a nucleic acid molecule capable
of transporting another nucleic acid to which it has been
linked.
[0046] --Meganucleases
[0047] In another embodiment of the above uses according to the
invention, said meganuclease is selected from the group consisting
of a homing endonuclease, a zinc-finger nuclease or a meganuclease
variant. [0048] homing endonuclease are as described in Chevalier
and Stoddard, precited.
[0049] --Custom-Made Meganucleases [0050] zinc-finger nuclease
[0051] Meganuclease based on Zinc-Finger domains have the structure
described by Smith et al., precited. The meganuclease is a
heterodimer of two fusion protein. Each fusion protein includes a
DNA-binding domain derived from Zif268 (or other zinc-finger
proteins), tethered to a nuclease domain (derived from the FokI
endonuclease or other endonucleases) through a linker. The DNA
target site includes two external regions of 9 bp, bound by the DNA
binding domains, and a central spacer region of 0-15 bp. In each
monomer, the DNA binding Zinc-Finger domain has been selected to
bind one of the 9 bp external regions, as described by Isalan and
Choo (2001, Methods Mol Biol, 148, 417-29), Isalan et al. (2001,
Nat. Biotechnol, 19, 656-60) and Isalan and Choo (2001, Methods
Enzymol, 340, 593-609). Selection can be made by phage display, as
described by the authors, but other methods such as screening in
yeast or with a bacterial two-hybrid system can also be used, as
described by Young et al. (2000, PNAS, 97, 7382-7) and Bae et al.
(2003, Nat Biotechnol, 21, 275-80). Also, to enhance specificity,
DNA binding domains encompassing 6 Zinc Finger motifs can be used,
as described by Klug and collaborators (Moore et al., 2001, PNAS,
98, 1432-6; Papworth et al., 2003, PNAS, 100, 1621-6; Reynolds et
al., 2003, PNAS, 100, 1615-20; Moore et al., 2001, PNAS, 98,
1437-41). However, if the endonucleolytic activity relies on a FokI
domain, two such monomers have to be used, each one bound to a FokI
catalytic site: each FokI catalytic domain cleaving only one
strand, it takes two such domains to obtain a double-strand
cleavage.
[0052] --Meganuclease Variants
[0053] Custom-made meganuclease is defined as a meganuclease able
to cleave a targeted DNA sequence. This definition includes any
meganuclease variant produced by a method comprising the steps of
preparing a library of meganuclease variants and isolating, by
selection and/or screening, the variants able to cleave the
targeted DNA sequence. Said custom-made meganuclease which is
derived from any initial meganuclease by introduction of diversity,
presents a recognition and cleavage site different from the site of
the initial one.
[0054] The diversity could be introduced in the meganuclease by any
method available for the man skilled in the art. Preferably, the
diversity is introduced by targeted mutagenesis (i.e. cassette
mutagenesis, oligonucleotide directed codon mutagenesis, targeted
random mutagenesis), by random mutagenesis (i.e. mutator strains,
Neurospora crassa system (U.S. Pat. No. 6,232,112; WO01/70946,
error-prone PCR), by DNA shuffling, by directed mutation or a
combination of these technologies (See Current Protocols in
Molecular Biology, Chapter 8 "Mutagenesis in cloned DNA", Eds
Ausubel et al., John Wiley and Sons). The meganuclease variants are
preferably prepared by the targeted mutagenesis of the initial
meganuclease. The diversity is introduced at positions of the
residues contacting the DNA target or interacting (directly or
indirectly) with the DNA target. The diversity is preferably
introduced in regions interacting with the DNA target, and more
preferably introduced at the positions of the interacting amino
acids. In libraries generated by targeted mutagenesis, the 20 amino
acids can be introduced at the chosen variable positions.
Preferably, the amino acids present at the variable positions are
the amino acids well-known to be generally involved in protein-DNA
interaction. More particularly, these amino acids are generally the
hydrophilic amino acids. More preferably, the amino acids present
at the variable positions comprise D, E, H, K, N, Q, R, S, T, Y.
Optionally, the amino acids present at the variable positions are
selected from the group consisting of D, E, H, K, N, Q, R, S, T, Y.
Synthetic or modified amino acids may also be used.
[0055] One preferred way to generate a directed library is the use
of degenerated codons at the positions where diversity has to be
introduced. Several types of degenerated codons could be used. A
degenerated codon N N K ([ATCG] [ATCG] [TG]) leads to 32 different
codons encoding the 20 amino acids and one stop. A degenerated
codon N V K ([ATCG] [ACG] [TG]) leads to 24 different codons
encoding the 15 amino acids and one stop. A degenerated codon V V K
([ACG] [ACG] [TG]) leads to 18 different codons encoding the 12
amino acids (A, D, E, G, H, K, N, P, Q, R, 5, T) and no stop. A
degenerated codon R V K ([AG] [ACG] [TG]) leads to 12 different
codons encoding the 9 amino acids (A, D, E, G, K, N, R, S, T).
Preferably, a degenerated codon V V K ([ACG] [ACG] [TG]) leading to
18 different codons encoding the 12 amino acids (A, D, E, G, H, K,
N, P, Q, R, S, T) is used for generating the library. Indeed, the V
V K degenerated codon does not contain any stop codon and comprises
all the hydrophilic amino acids.
[0056] If a directed library is generated, knowledge on amino acids
interacting with the DNA target is useful. This knowledge could be
provided, for example, by X-ray crystallography, Alanine scanning,
or cross-linking experiments. The amino acids interacting with the
DNA target can also be deduced by sequence alignment with a
homologous protein.
[0057] The custom-made meganuclease is derived from any initial
meganuclease. Optionally, the initial meganuclease is selected so
as its natural recognition and cleavage site is the closest to the
targeted DNA site. Preferably, the initial meganuclease is a homing
endonuclease, as specified, in the here above definitions. Homing
endonucleases fall into 4 separated families on the basis of well
conserved amino acids motifs, namely the LAGLIDADG family, the
GIY-YIG family, the His-Cys box family, and the HNH family
(Chevalier et al., 2001, N.A.R, 29, 3757-3774).
[0058] The detailed three-dimensional structures of several homing
endonucleases are known, namely I-Dmo I, PI-Sce I, PI-Pfu I, I-Cre
I, I-Ppo I, and a hybrid homing endonuclease I-Dmo I/I-Cre I called
E-Dre I (Chevalier et al., 2001, Nat Struct Biol, 8, 312-316; Duan
et al., 1997, Cell, 89, 555-564; Heath et al., 1997, Nat Struct
Biol, 4, 468-476; Hu et al., 2000, J Biol Chem, 275, 2705-2712;
Ichiyanagi et al., 2000, J Mol Biol, 300, 889-901; Jurica et al.,
1998, Mol Cell, 2, 469-476; Poland et al., 2000, J Biol Chem, 275,
16408-16413; Silva et al., 1999, J Mol Biol, 286, 1123-1136;
Chevalier et al., 2002, Molecular Cell, 10, 895-905).
[0059] The LAGLIDADG family is the largest family of proteins
clustered by their most general conserved sequence motif: one or
two copies of a twelve-residue sequence: the di-dodecapeptide, also
called LAGLIDADG motif. Homing endo-nucleases with one
dodecapeptide (D) are around 20 kDa in molecular mass and act as
homodimer. Those with two copies (DD) range from 25 kDa (230 AA) to
50 kDa (HO, 545 AA) with 70 to 150 residues between each motif and
act as monomer. Cleavage is inside the recognition site, leaving 4
nt staggered cut with 3'OH overhangs. I-Ceu I, and I-Cre I
illustrate the homodimeric homing endonucleases with one
Dodecapeptide motif (mono-dodecapeptide). I-Dmo I, I-Sce I, PI-Pfu
I and PI-Sce I illustrate monomeric homing endonucleases with two
Dodecapeptide motifs.
[0060] The initial LAGLIDADG homing endonuclease can be selected
from the group consisting of: I-Sce I, I-Chu I, I-Dmo I, I-Cre I,
I-Csm I, PI-Sce I, PI-Tli I, PI-Mtu I, I-Ceu I, I-Sce II, I-Sce
III, HO, PI-Civ I, PI-Ctr I, PI-Aae I, PI-Bsu I, PI-Dha I, PI-Dra
I, PI-Mav I, PI-Mch I, PI-Mfu I, PI-Mfl I, PI-Mga I, PI-Mgo I,
PI-Min I, PI-Mka I, PI-Mle I, PI-Mma I, PI-Msh I, PI-Msm I, PI-Mth
I, PI-Mtu I, PI-Mxe I, PI-Npu I, PI-Pfu I, PI-Rma I, PI-Spb I,
PI-Ssp I, PI-Fac I, PI-Mja I, PI-Pho I, PI-Tag I, PI-Thy I, PI-Tko
I, and PI-Tsp I; preferably, I-Sce I, I-Chu I, I-Dmo I, I-Cre I,
I-Csm I, PI-Sce I, PI-Pfu I, PI-Tli I, PI-Mtu I, and I-Ceu I; more
preferably, I-Dmo I, I-Cre I, PI-Sce I, and PI-Pfu I; still more
preferably I-Cre I.
[0061] The four structures of LAGLIDADG homing endonucleases,
namely those of I-Dmo I, PI-Sce I, PI-Pfu I, and I-Cre I, reveal
the functional significance of the LAGIDADG motif, and the nature
of the DNA-binding interface. The core .alpha. .beta. .beta.
.alpha. .beta. .beta. .alpha. fold of the homodimer homing
endonuclease is repeated twice in the monomer homing endonuclease
and confers upon the monomer a pseudo-dimeric structure. The first
.alpha.-helix of each domain or subunit contains the defining
LAGLIDADG motif. The two LAGLIDADG helices of each protein form a
tightly packed dimer or domain interface. The DNA binding interface
is formed by the four .beta.-strands of each domain or subunit that
fold into an antiparallel .beta.-sheet. A minimal DNA binding
moiety could be defined in the LAGLIDADG homing endonucleases as a
.beta.-hairpin (2 .beta.-strands connected by a loop or turn), two
such .beta.-hairpins being connected into the 4-stranded
.beta.-sheet.
[0062] Each domain or subunit interacts with a half recognition
site. The <<external>> quarter recognition site can be
defined by its interaction with only one of the 2 .beta.-hairpins
of each domain or subunit.
[0063] Therefore, meganuclease variants derived from LAGLIDADG
homing endonuclease can be fragmented in several directed
libraries. This fragmented approach for the evolution of an initial
meganuclease allows the introduction of a greater diversity (more
amino acids at a position and/or more diversificated positions). In
each library, the diversity is introduced only in the region
involved in the inter-action with a half or a quarter recognition
site, the targeted DNA being modified only for the part interacting
with the region comprising the introduced diversity. More
particularly, if a new half site is searched for, then the
diversity is preferably introduced in the 4-stranded .beta.-sheet
of one domain or subunit, more preferably at the positions of the
DNA interacting amino acids in this structure. If a new quarter
site is searched for, then the diversity is introduced in the
corresponding .beta.-hairpin, more preferably at the positions of
the DNA interacting amino acids of this structure.
[0064] Preferably, a set of libraries covers the entire targeted
DNA site. Hence, if the libraries comprise diversity only in the
region interacting with a half-site, at least two libraries,
preferably two, are necessary. However, if the initial meganuclease
is a dimer, one library is enough with a half-site approach. If the
libraries comprise diversity only in the region interacting with a
quarter site, at least four libraries, preferably four, are
necessary. If the initial meganuclease is a dimer, two libraries
can be enough with a quarter site approach.
[0065] After the selection or screening of the primary libraries,
the selected elements from the primary libraries are fused or
combined in a subsequent library for a new cycle of selection. For
example, two libraries can be fused by shuffling. A new cycle of
selection could be then done on the whole targeted DNA site.
Optionally, the new cycle of selection can be done on a half
targeted DNA site if the first libraries are based on a quarter
site. Subsequently, the results of the selection and/or screening
of the half site are combined to give a final library which can be
screened for the whole targeted DNA site.
[0066] Alternatively, the best elements from each libraries are
joined together in order to obtain a meganuclease able to bind and
cleave the targeted DNA site.
[0067] In another approach, a library with diversity located only
in the region involved in the interaction with a half or a quarter
recognition site is prepared. Then, after selection or screening of
this library, the selected elements from the library are modified
such as to introduce diversity in another region involved in the
interaction with recognition site, leading to a subsequent library.
Libraries are generated until the complete targeted DNA site is
bound and cleaved by the selected meganuclease.
[0068] More specifically, for the dimeric homing endonuclease (such
as I-Cre I and I-Ceu I), a library can be generated by introducing
diversity only in the region interacting with a half-site, a half
site corresponding to one monomer of the initial homing
endonuclease. This library can be used for selection and/or
screening on each half sites of the target DNA sequence. When
positive elements from the library have been selected for each half
sites, a variant for the first half site and a variant for the
other half site are brought together for binding and cleaving the
whole target DNA sequence. Alternatively, the positive variants can
be introduced in a single chain meganuclease structure. As
described in Example 1, a single chain meganuclease is an enzyme in
which the two monomers of the initial dimeric homing endonuclease
are covalently bound by a linker.
[0069] If an approach by a quarter site is chosen from an initial
dimer homing endonuclease, at least two libraries are generated by
introducing diversity only in the region involved in the
interaction with each quarter recognition sites. After the
selection or screening of the primary libraries, the selected
variants from the primary libraries are fused in a subsequent
library for a new cycle of selection on the half site.
Alternatively, the best elements from each libraries are joined
together to obtain a monomer able to bind the half site. Otherwise,
a library with diversity only in the region involved in the
interaction with a quarter recognition site is prepared. Then,
after selection or screening of this library, the selected elements
from the library are modified such as to introduce diversity in the
region involved in the interaction with the other quarter site,
leading to a subsequent library. The selection and/or screening of
this second library lead to the variants monomer able to bind the
half site. When positive elements from the library have been
selected for each half sites, a variant for the first half site and
a variant for the other half site are brought together for binding
and cleaving the target DNA sequence. Alternatively, the positive
variants can be introduced in a single chain meganuclease
structure.
[0070] Preferably, the custom-made meganuclease which recognizes
and cleaves a desired polynucleotide target is derived from the
directed evolution of the homing endonuclease I-Cre I. As the
homing endonuclease is a homodimer, the approach in this case is
based either on the half recognition site or on the quarter
site.
[0071] The directed evolution is based on a library of I-Cre I
variants. These I-Cre I variants present a diversity of amino acids
at several positions predicted to interact with the polynucleotide
target.
[0072] The X-ray structure of I-Cre endonuclease with its DNA
target predicted that the following positions are involved: Q26,
K28, N30, S32, Y33, Q38, Q44, R68, R70 and T140. Seligman et al
(supra) showed that the positions S32 and T140 appear to be
relatively unimportant for DNA recognition.
[0073] A set of I-Cre I variants is prepared by introducing amino
acid diversity in positions selected from the group consisting of:
Q26, K28, N30, S32, Y33, Q38, Q44, R68, R70 and T140. In a
preferred embodiment, a set of I-Cre I variants is prepared by
introducing diversity in positions: a) Q26, K28, N30, Y33, Q38,
Q44, R68, R70, T140; b) Q26, K28, N30, Y33, Q38, Q44, R68, R70; c)
Q26, K28, N30, Y33, Q44, R68, R70; or d) Q26, K28, Y33, Q38, Q44,
R68, R70. Preferably, a set of I-Cre I variants is prepared by
introducing diversity in positions Q26, K28, N30, Y33, Q38, Q44,
R68, and R70.
[0074] Optionally, the residue D75 of I-Cre I could be mutated in
an uncharged amino acid such as N. Indeed, this amino acid has an
interaction with 2 residues which are preferably modified in the
library. As this charge is present in the core of the structure, it
could be preferable to abolish this charge.
[0075] If the evolution approach of the homing endonuclease I-Cre I
is based on the quarter recognition site, replacing the DNA binding
residues presented by a .beta.-hairpin (within the 4-stranded
b-sheet) is a practical solution. As those residues are part of an
element with limited length (i.e. less than 25 residue), they can
be mutated together at once, for example by cassette replacement.
Visual inspection of structure 1 g9y, SEQ ID NO: 23, (I-CreI with
its target double-stranded DNA) indicates that the first
.beta.-hairpin is a unique or major contributor to the recognition
of the last six bases of the target (i.e. either bases -12 to -7 or
bases +7 to +12). Thus replacing the sequence from residue S22 to
residue Q44, more preferably from residue I24 to residue T42,
should be sufficient to specify new interaction specificity for the
last six bases of the target site. More preferably, the residues
interacting directly with DNA should be modified: I24, Q26, K28,
N30, S32, Y33, Q38, S40 and T42. Alternatively (or in addition),
the turn at the middle of the .beta.-hairpin, which interacts with
the very end of the 24 bp-long DNA target, may be replaced by a
short and flexible loop that would be tolerant to DNA bases
substitution. For example, residues 30 to 36 could be replaced by
2, 3, 4, 5 or 6 glycine residues. This strategy is worth testing
with all meganucleases presenting a comparable 3D structure. The
second hairpin could be replaced similarly as a single unit (from
residue Y66 to I77). However, while this hairpin interacts
predominantly with the internal quarter site (bases -6 to -1 or +1
to +6), other residues (i.e. S22, Q44 and T46) separated from the
hairpin may play a role in directing the specificity of
interaction. Thus, a library could be created by replacing residues
Y66, R68, R70, V73, D75 and I77. In parallel, S22, Q44 and T46 may
either be left untouched, replaced by small polar amino acids (G, S
or T; more preferably S or T), or randomized to contribute to the
library. Mutants selected from separate library (the first wherein
randomized residues are I24, Q26, K28, N30, S32, Y33, Q38, S40 and
T42 and the second wherein randomized residues are Y66, R68, R70,
V73, D75 and I77) can be combined together by standard DNA
shuffling methods based on recombination at homologous DNA regions
(i.e. the DNA coding for the region between residue 43 and residue
65 is strictly conserved). However, if the second library includes
mutations of residues S22, Q44 and T46, recombination becomes
impractical, and more classical DNA/protein engineering is
required.
[0076] If the evolution approach of the homing endonuclease I-Cre I
is based on the quarter recognition site, a library of I-Cre I
variants is prepared by introducing diversity in positions selected
from the group consisting of: a) I24, Q26, K28, N30, S32, Y33, Q38,
S40 and T42; or b) Y66, R68, R70, V73, D75, and I77. In the
alternative b), the diversity could be also introduced in positions
selected from the group consisting of: S22, Q44, and T46.
[0077] Alternatively, a custom-made meganuclease which recognizes
and cleaves a desired polynucleotide target could be prepared by
the directed evolution of single chain I-Cre I endonuclease. A set
of single-chain I-Cre I variants is prepared by introducing amino
acid diversity in positions selected from the group consisting of:
Q26, K28, N30, S32, Y33, Q38, Q44, R68, R70, Q123, K125, N127,
S129, Y130, Q135, Q141, R165, R167.
[0078] Two properties of the meganuclease can be used for the steps
of selection and/or screening, namely the capacity to bind the
targeted DNA sequence and the ability to cleave it.
[0079] The meganuclease variants can be selected and screened, or
only screened. The selection and/or screening can be done directly
for the ability of the meganuclease to cleave the targeted DNA
sequence. Alternatively, the selection and/or screening can be done
for the binding capacity on the targeted DNA sequence, and then for
ability of the meganuclease to cleave it. Preferably, the method to
prepare a custom-made meganuclease comprises or consists of the
following steps:
[0080] a) a selection step for the binding ability, a screening
step for the binding ability, a selection for the cleavage
activity, and a screening step for the cleavage activity;
[0081] b) a selection step for the binding ability, a screening
step for the binding ability, and a screening step for the cleavage
activity;
[0082] c) a selection step for the binding ability, a selection for
the cleavage activity, and a screening step for the cleavage
activity;
[0083] d) a screening step for the binding ability and a screening
step for the cleavage activity;
[0084] e) a selection step for and a screening step for the
cleavage activity; or,
[0085] f) a screening step for the cleavage activity.
[0086] More preferably, the method to prepare a custom-made
meganuclease comprises or consists of the following steps: a
selection step for the binding ability, a selection for the
cleavage activity, and a screening step for the cleavage activity.
A screening assay for the binding ability after a selection step
based on the binding capacity can be done in order to estimate the
enrichment of the library for meganuclease variants presenting a
binding capacity.
[0087] The selection and screening assays are performed on the DNA
region in which a double stranded cleavage has to be introduced or
a fragment thereof.
[0088] Preferably, the targeted sequences comprise at least 15
nucleotides, preferably 18 to 40, more preferably 18 to 30
nucleotides. In case of dimeric meganuclease, the targeted DNA
polynucleotide can be reduced to at least 8 nucleotides for binding
only. Preferably, the targeted DNA polynucleotide length is less
than 10 kb, preferably less than 3 kb, more preferably less than 1
kb. For the DNA binding assay, the targeted DNA polynucleotide
length is preferably less than 500 bp, more preferably less than
200 bp.
[0089] Any targeted sequence can be used to generate a custom-made
meganuclease able to cleave it according. Optionally, the targeted
sequence is chosen such as to present the most identity with the
original recognition and cleavage site of the initial meganuclease.
Therefore, the DNA region in which a double stranded break has to
be introduced is analyzed to choose at least 1, 2, 3 or 5 sequences
of at least 15 nucleotides length, preferably 18 to 40, more
preferably 18 to 30 nucleotides, having at least 25% identity,
preferably 50% identity and more preferably 75% identity with the
original recognition and cleavage site of the initial
meganuclease.
[0090] The targeted DNA sequence is adapted to the type of
meganuclease variants library. If the library is based on a half
site approach, the targeted DNA sequence used for the
selection/screening comprises one half original site and one half
site of the desired DNA sequence. If the library is based on a
quarter site approach, the targeted DNA sequence used for the
selection/screening comprises three quarters of the original site
and one quarter site of the desired DNA sequence.
[0091] The meganuclease variants resulting from the selection
and/or screening steps could optionally be an input for another
cycle of diversity introduction.
[0092] The positive meganuclease variants selected by the selection
and/or screening steps are validated by in vitro and/or ex vivo
cleavage assay.
[0093] The selection and screening of meganuclease variants based
on the binding capacity has to be made in conditions that are not
compatible with the cleavage activity. For example, most of homing
endonucleases need manganese or magnesium for their cleavage
activity. Therefore, the binding assays on this type of homing
endonuclease variants are done without manganese or magnesium,
preferably replaced by calcium.
[0094] The binding selection assay is based on the enrichment of
the meganuclease variants able to bind the targeted DNA
polynucleotide. Therefore, the meganuclease variants encoded by the
library are incubated with an immobilized targeted DNA
polynucleotide so that meganuclease variants that bind to the
immobilized targeted DNA polynucleotide can be differentially
partitioned from those that do not present any binding capacity.
The meganuclease variants which are bound to the immobilized
targeted DNA polynucleotide are then recovered and amplified for a
subsequent round of affinity enrichment and amplification. After
several rounds of affinity enrichment and amplification, the
library members that are thus selected can be isolated. Optionally,
the nucleotide sequences encoding the selected meganuclease
variants are determined, thereby identifying of the meganuclease
variants able to bind the targeted DNA sequence.
[0095] The selection of meganuclease variants requires a system
linking genotype and phenotype such as phage display (WO91/17271,
WO91/18980, and WO91/19818 and WO93/08278; the disclosures of which
are incorporated herein by reference), ribosome display (Hanes
& Pluckthun, PNAS, 1997, vol. 94, 4937-4942; He & Taussig,
Nucl. Acids Res. (1997) vol. 25, p 5132-5143) and mRNA-protein
fusion (WO00/47775; U.S. Pat. No. 5,843,701; Tabuchi et al FEBS
Letters 508 (2001) 309-312; the disclosures of which are
incorporated herein by reference).
[0096] Phage display involves the presentation of a meganuclease
variant on the surface of a filamentous bacteriophage, typically as
a fusion with a bacteriophage coat protein. The library of
meganuclease variants is introduced into a phage chromosome or
phagemid so as to obtain a protein fusion with a bacteriophage coat
protein, preferably with the pIII protein. If the initial
meganuclease is a homodimer, the monomer variants of the
meganuclease are introduced so as to be displayed and the constant
monomer can be introduced so as to be produced in the periplasm.
The bacteriophage library can be incubated with an immobilized
targeted DNA sequence so that elements able to bind the DNA are
selected.
[0097] mRNA-protein fusion system opens the possibility to select
among 10.sup.13 different meganuclease variants. This system
consists in the creation of a link between the mRNA and the encoded
protein via a puromycin at the 3' end of the mRNA which leads to a
covalent mRNA-protein fusion at the end of the translation. Hence,
a double-stranded DNA library comprising the coding sequence for
the meganuclease variants is used regenerate mRNA templates for
translation that contain 3' puromycin. The mRNA-puromycin
conjugates are translated in vitro to generate the
mRNA-meganuclease fusions. After cDNA synthesis, the fusions are
tested for the ability to bind the immobilized targeted DNA
polynucleotide. A PCR is then used to generate double-stranded DNA
enriched in meganuclease variants presenting the binding capacity.
If the initial meganuclease is a homodimer, the constant monomer
can be introduced either as DNA or mRNA encoding this monomer or as
a monomer protein. In this case, an approach with the single chain
meganuclease will be preferably used.
[0098] Ribosome display involves a double-stranded DNA library
comprising the coding sequence for the meganuclease variants that
is used to generate mRNA templates for translation. After a brief
incubation, translation is halted by addition of Mg.sup.2+ and
incubational low temperature or addition of translation inhibitor.
The ribosome complexes are then tested for the ability to bind
immobilized targeted DNA polynucleotide. The selected mRNA is used
to construct cDNA and a PCR generates double-stranded DNA enriched
in meganuclease variants presenting the binding capacity. If the
initial meganuclease is a homodimer, the constant monomer is
introduced either as DNA or mRNA encoding this monomer or as a
monomer protein. In this case, an approach with the single chain
meganuclease will be preferably used.
[0099] The targeted DNA sequence can be immobilized on a solid
support. Said solid support could be a column, paramagnetic beads
or a well of a microplate. For example, the polynucleotides
comprising the targeted DNA sequence present a ligand (such as a
biotin) at one end, said ligand allowing the immobilization on a
solid support bearing the target of the ligand (for example,
streptavidin if biotin is used).
[0100] The selection of the meganuclease variants may usually be
monitored by a screening assay based on the binding or cleavage
capacity of these meganucleases. However, the selected meganuclease
variants can be also directly introduced in a selection step based
on the cleavage capacity.
[0101] In order to perform the screening assay, the selected
meganuclease variants need to be cloned. If the selection was done
with the phage display system, the clone encoding each meganuclease
variants can be easily isolated. If the selection was done by
mRNA-protein fusion or ribosome display, the selected meganuclease
variants have to be subcloned in expression vector.
[0102] The screening assays are preferably performed in microplates
(96, 384 or 1536 wells) in which the targeted DNA polynucleotides
are immobilized. After expression of the meganuclease variants,
these variants are incubated with the immobilized targeted DNA
polynucleotides. The meganuclease variants expression can be
performed either in vivo or in vitro, preferably by in vitro
expression system. Preferably, the meganuclease variants are
purified prior to the incubation with the targeted polynucleotide.
The retained meganuclease variants are then detected. The detection
could be done by several means well known by the man skilled in the
art. For example, if phages are used, the detection can be done
with antibodies against phages (ELISA). Otherwise, the expression
could be done in presence of S35 amino acids in order to obtain
radioactive meganucleases. Thus, the binding is estimated by a
radio-activity measurement. The invention also considers the others
means of detection of DNA binding by meganuclease available to the
man skilled in the art.
[0103] Optionally, the nucleotide sequences encoding the positively
screened meganuclease variants are determined, thereby identifying
of the meganuclease variants able to bind the targeted DNA
sequence.
[0104] The positively screened meganuclease variants have to be
tested for their cleavage capacity. Therefore, said meganuclease
variants are incorporated in a cleavage selection and/or screening
experiment, preferably an in vivo cleavage screening assay.
Optionally, said meganuclease variants can be tested by an in vitro
cleavage assay.
[0105] The screening assay can also be used only for estimate the
enrichment in meganuclease variants presenting the binding
capacity. This estimation helps to decide if a new round of
selection based on the binding capacity is necessary or if the
selected library can be submitted to a cleavage selection and/or
screening, preferably an in vivo cleavage selection and/or
screening.
[0106] The selection and screening of meganuclease variants based
on the cleavage capacity has to be made in conditions compatible
with the cleavage activity. The meganuclease variants used in the
selection and/or screening based on cleavage capacity may be either
the initial library of meganuclease variants or the meganuclease
variants selected and/or screened for the binding activity.
[0107] If necessary, the selected and/or screened meganuclease
variants are subcloned in an appropriate expression vector for the
in vitro and in vivo cleavage assay. Such subcloning step can be
performed in batch or individually. More particularly, if the
initial meganuclease is a dimer, the subcloning step allows the
introduction of the selected library(ies) in a single chain
meganuclease structure. If two libraries have been selected and/or
screened for two half recognition and cleavage sites, the
subcloning step allows to bring together the two selected libraries
in a single chain meganuclease structure.
[0108] The general principle of an in vivo selection of the
meganuclease variants based on their cleavage capacity is that the
double-strand break leads to the activation of a positive selection
marker or the inactivation of a negative selection marker.
[0109] If the selection is based on the inactivation of a negative
selection marker, the method involves the use of cell containing an
expression vector comprising the coding sequence for a negative
selection marker and the targeted DNA sequence for the desired
meganuclease and an expression vector comprising the library of
meganuclease variants. Preferably said expression vector is a
plasmid. Preferably said targeted DNA sequence is located either
near the negative selection gene or in the negative selection gene,
preferably between the promoter driving the expression of the
negative selection and the ORF. The expression of the negative
selection marker has to be conditional in order to keep the cell
alive until the meganuclease variants have the opportunity to
cleave. Such a conditional expression can be easily done with a
conditional promoter. However, there are other conditional systems
that could be used. The meganuclease variants are introduced in an
expression cassette. The meganuclease encoding sequence can be
operably linked to an inducible promoter or to a constitutive
promoter. Of course, the promoter is compatible with the cell used
in the assay. If the meganuclease variant has the capacity to
cleave the targeted DNA, then the negative selection marker is
inactivated, either by deleting the whole negative marker gene or a
part thereof (coding sequence or promoter) or by degrading the
vector. A culture in a negative selection condition allows the
selection of the cell containing the meganuclease variants able to
cleave the targeted DNA sequence.
[0110] The vector comprising the negative selection marker is
preferably transfected before the introduction of the vector
encoding the meganuclease variants. Optionally, the vector
comprising the negative selection marker can be conserved in the
cell in an episomal form. Alternatively, the vector comprising the
negative selection marker and the vector encoding the meganuclease
variants can be cotransfected into the cell. The cell can be
prokaryotic or eukaryotic. Preferably, the prokaryotic cell is E.
coli. Preferably, the eukaryotic cell is a yeast cell. The negative
selection marker is a protein directly or indirectly toxic for the
cell. For example, the negative selection marker can be selected
from the group consisting of toxins, translation inhibitors,
barnase, and antibiotic for bacteria, URA3 with 5FOA
(5-fluoro-orotic acid) medium and LYS2 with a .alpha.-AA medium
(alpha-adipic acid) for yeast, and thymidine kinase for superior
eukaryotic cells. For an example of negative marker selection, see
Gruen et al., 2002, Nucleic Acids Research, 30, e29; the disclosure
of which is incorporated herein by reference.
[0111] If the selection is based on the activation of a positive
selection marker, the method involves the use of cell containing an
expression vector comprising an inactive positive selection marker
and the targeted DNA sequence for the desired meganuclease and an
expression vector comprising the library of meganuclease variants.
Optionally, the inactive positive selection marker, the targeted
DNA sequence and the library of meganuclease variants can be on the
same vector (See WO 02/44409). Preferably said expression vector is
a plasmid. The meganuclease variants are introduced in an
expression cassette. The meganuclease encoding sequence can be
operably linked to an inducible promoter or to a constitutive
promoter. Of course, the promoter is compatible with the cell used
in the assay. For example, the positive selection marker can be an
antibiotic resistance (e.g. tetracycline, rifampicin and ampicillin
resistance) or an auxotrophy marker for bacteria, TRP1, URA3, or an
auxotrophy marker for yeast, and neomycine et puromycine for
superior eukaryotic cell. Optionally, the positive selection marker
can be an auxotrophy marker compatible with both bacteria and yeast
(e.g. URA3, LYS2, TRP1 and LEU2). The inactive positive selection
marker gene and the targeted DNA sequence have to be arranged so
that the double-strand break leads to a rearrangement of the marker
in an active positive marker. Two kinds of repair processes can
lead to an active positive selection marker, namely single-strand
annealing (SSA) or gene conversion (GC).
[0112] The in vivo Single-strand annealing recombination test (SSA)
is known by the man skilled in the art and disclosed for example in
Rudin et al. (Genetics 1989, 122, 519-534; Fishman-Lobell &
Haber (Science 1992, 258, 480-4); Lin et al (Mol. Cell. Biol.,
1984, 4, 1020-1034) and Rouet et al (Proc. Natl. Acad. Sci. USA,
1994, 91, 6064-6068); the disclosure of which are incorporated
herein by reference.
[0113] To test the meganuclease variants, an in vivo assay based on
SSA in a cell, preferably a bacterial or yeast cell has been
developed. For instance, the method uses a yeast cell. This
organism has the advantage that it recombines naturally its DNA via
homologous recombination with a high frequency.
[0114] This in vivo test is based on the reparation by SSA of a
positive selection marker induced by double-strand break generated
by an active meganuclease variant. The target consists of a
modified positive selection gene with an internal duplication
separated by a intervening sequence comprising the targeted DNA
sequence. The internal duplication should contain at least 50 bp,
preferably at least 200 bp. The efficiency of the SSA test will be
increased by the size of the internal duplication. The intervening
sequences are at least the targeted DNA sequence. The intervening
sequence can optionally comprise a selection marker, this marker
allowing checking that the cell has not repaired the positive
selection marker by a spontaneous recombination event. The positive
selection marker gene is preferably operably linked to a
constitutive promoter relating to the cell used in the assay.
According to said assay method, the cell will be selected only if a
SSA event occurs following the double-strand break introduced by an
active meganuclease variant.
[0115] Optionally, each vector can comprise a selectable marker to
ensure the presence of the plasmid in the cell. The presence of
this selectable marker is preferable for the assay performed in
yeast cell. For example, for yeast, a first construct comprising
the target gene can comprise a Leu2 selectable marker allowing
transformed yeast to grow on a synthetic medium that does not
contain any Leucine and a second construct can comprise the Trp1
selectable marker allowing transformed yeast to grow on a synthetic
medium that does not contain any tryptophane.
[0116] The vector comprising the positive selection marker is
preferably transfected before the introduction of the vector
encoding the meganuclease variants. Optionally, the vector
comprising the positive selection marker can be conserved in the
cell in an episomal form. Alternatively, the vector comprising the
positive selection marker and the vector encoding the meganuclease
variants can be cotransfected into the cell.
[0117] The in vivo selection of the meganuclease variants can also
be performed with a gene conversion assay. For example, the
selection vector comprises a first modified positive selection gene
with a deletion or a mutation and an insertion of the targeted DNA
sequence for the meganuclease at the place of the deletion. The
positive selection gene can also be inactivated by the interruption
of the gene by an insert comprising the targeted DNA sequence. The
selection construct further comprises the segment of the positive
selection marker gene which has been deleted flanked at each side
by the positive selection marker gene sequences bordering the
deletion. The bordering sequences comprise at least 100 bp of
homology with the positive selection marker gene at each side,
preferably at least 300 pb. The double-stand break generated by an
active meganuclease variant in the targeted DNA sequence triggers
on a gene conversion event resulting in a functional positive
selection marker gene. This kind of assay is documented in the
following articles: Rudin et al (Genetics 1989, 122, 519-534),
Fishman-Lobell & Haber (Science 1992, 258, 480-4), Paques &
Haber (Mol. Cell. Biol., 1997, 17, 6765-6771), the disclosures of
which are incorporated herein by reference.
[0118] Otherwise, the in vivo selection of the meganuclease
variants can be performed through a recombination assay on
chromosomic target. The recombination can be based on SSA or gene
conversion mechanisms.
[0119] A first example based on SSA is the following. A modified
positive selection gene with an internal duplication separated by
an intervening sequence comprising the targeted DNA sequence for
the desired meganuclease variant is introduced into the chromosome
of the cell. The internal duplication should contain at least 50
bp, preferably at least 200 bp. The efficiency of the SSA test will
be increased by the size of the internal duplication. The
intervening sequence is at least the targeted DNA sequence. By
transfecting the cell with an expression construct allowing the
production of a meganuclease variant in the cell, the repair by
homologous recombination of the double-strand break generated by an
active meganuclease variant will lead to a functional positive
selection marker gene.
[0120] Another example based on gene conversion is the following. A
mutated non-functional positive selection marker gene comprising
the targeted DNA sequence for the desired meganuclease variant is
introduced into the chromosome of the cell. Said targeted DNA
sequence has to be in the vicinity of the mutation, preferably at
less than 1 kb from the mutation, more preferably at less than 500
bp, 200 bp, or 100 pb surrounding the mutation. By transfecting the
cell with a fragment of the functional positive selection marker
gene corresponding to the mutation area and an expression construct
allowing the production of a meganuclease variant in the cell, the
repair by homologous recombination of the double-strand break
generated by an active meganuclease variant will lead to a
functional positive selection marker gene. Alternatively, the
fragment of the functional positive selection marker allowing the
repair can be integrated on the chromosome. This kind of assay is
documented in the following articles: Rouet et al (Mol. Cell.
Biol., 1994, 14, 8096-8106); Choulika et al (Mol. Cell. Biol.,
1995, 15, 1968-1973); Donoho et al (Mol. Cell. Biol., 1998, 18,
4070-4078); the disclosures of which are incorporated herein by
reference.
[0121] The selected clones comprise a meganuclease variant
presenting the capacity to cleave the targeted DNA sequence. It is
preferable to validate the selection by a screening assay. This
screening assay can be performed in vivo or in vitro, preferably in
vivo.
[0122] Optionally, the nucleotide sequences encoding the positively
screened meganuclease variants are determined, thereby identifying
the meganuclease variants able to cleave the targeted DNA
sequence.
[0123] In order to perform the screening assay, the selected
meganuclease variants need to be cloned and the cleavage assay need
to be performed individually for each clone.
[0124] The in vivo cleavage assay for the screening is similar to
those used for the selection step. It can be based on the
inactivation of either a negative selection marker or a reporter
gene, or on the activation of either a positive selection marker or
a reporter gene.
[0125] By reporter gene is intended any nucleic acid encoding a
product easily assayed, for example .beta.-galactosidase,
luciferase, alkaline phosphatase, green fluorescent protein,
tyrosinase, DsRed proteins. The reporter gene is preferably
operably linked to a constitutive promoter relating to the cell
used in the assay (for example CMV promoter).
[0126] Cells used for this screening assay can be prokaryotic,
preferably E. coli, or eukaryotic, preferably a yeast cell or a
mammalian cell. More particularly, it could be interesting to use
mammalian cells for a validation of a positive meganuclease variant
by an ex vivo cleavage assay.
[0127] The recognition and cleavage of the targeted DNA sequence or
a part thereof by the meganuclease variants can be assayed by any
method known by the man skilled in the art.
[0128] One way to test the activity of the meganuclease variants is
to use an in vitro cleavage assay on a polynucleotide substrate
comprising the targeted DNA sequence or a part thereof. Said
polynucleotide substrate could be a synthetic target site
corresponding to: [0129] the whole targeted DNA site; [0130] a half
targeted DNA site and a half original site; or, [0131] a quarter
targeted DNA site and three quarters original site.
[0132] Said polynucleotide substrate can be linear or circular and
comprises preferably only one cleavage site. The assayed
meganuclease variant is incubated with the polynucleotide substrate
in appropriate conditions. The resulting polynucleotides are
analyzed by any known method, for example by electrophoresis on
agarose or by chromatography. If the polynucleotide substrate is a
linearized plasmid, the meganuclease activity is detected by the
apparition of two bands (products) and the disappearance of the
initial full-length substrate band. Preferably, said assayed
meganuclease variants are digested by proteinase K, for example,
before the analysis of the resulting polynucleotides. For instance,
the polynucleotide substrate is prepared by the introduction of a
polynucleotide comprising the sequence of the target site in a
plasmid by TA or restriction enzyme cloning, optionally followed by
the linearization of the plasmid. Preferably, such linearization is
not done in the surrounding of the targeted DNA sequence. See Wang
et al, 1997, Nucleic Acid Research, 25, 3767-3776; See Examples,
Materials & Methods "in vitro activity assays" section) and the
characterization papers of the initial homing endonucleases.
[0133] Alternatively, such in vitro cleavage assay can be performed
with polynucleotide substrates linked to fluorophores, such
substrates comprising the targeted DNA sequence. These
polynucleotide substrates are immobilized on a solid support. Said
solid support is preferably a microplate (96, 384 or 1536 wells).
For example, the polynucleotides comprising the targeted DNA
sequence present a ligand (such as a biotin) at one end, said
ligand allowing the immobilization on a solid support bearing the
target of the ligand (for example, streptavidin if biotin is used).
The end opposite to the immobilized end is linked to a fluorophore.
Cleavage leads to loss of fluorescence by release of the
fluorochrome from the solid support.
[0134] Otherwise, some in vitro cleavage assays can be based on the
fluorescence quenching. A fluorophore (for example, FAM or TAMRA)
and a quencher (for example, DABCYL) are located on the
polynucleotide substrate such as the quencher inhibits the
fluorescence emission. The quenching is abolished when the cleavage
by the meganuclease variants occurs on the polynucleotide
substrates. Several examples of this quenching assays are detailed
in Eisenschmidt et al (2002, Journal of Biotechnology, 96, 185-191)
and WO 02/42497, the disclosure of these documents are incorporated
herein by reference.
[0135] --Targeting DNA
[0136] In a first embodiment of the above uses according to the
invention a targeting fragment of DNA (or targeting DNA) comprising
a sequence which modifies the site of interest flanked by sequences
sharing homologies to a targeted locus is also introduced, when
necessary (see hereafter the Chapter Meganuclease delivery) into
the body of said vertebrate (human or non-human). Preferably,
homologous sequences of at least 50 bp, preferably more than 100 bp
and more preferably more than 200 bp are used. The sequence which
modifies the site of interest can be the correct sequence of a gene
for repairing a genetic lesion (gene therapy). Alternatively, it
can be any other sequence used to alter the chromosomal DNA in some
specific way including a sequence used to modify of a specific
sequence, to attenuate or activate an endogenous gene of interest,
to inactivate or delete an endogenous gene of interest or part
thereof, to introduce a mutation into a site of interest or to
introduce an exogenous gene or part thereof. Such chromosomal DNA
alterations are used for genome engineering (animal models, protein
production) or for antiviral therapy.
[0137] --Meganuclease Delivery
[0138] The meganuclease can be used either as a polypeptide or as a
polynucleotide construct encoding said polypeptide under the
control of appropriate transcription regulatory elements including
a promoter, for example a tissue specific and/or inducible
promoter. Examples of inducible promoters are: eukaryotic
metallothionine promoter which is induced by increased levels of
heavy metals, prokaryotic lacZ promoter which is induced in
response to isopropyl-.beta.-D-thiogalacto-pyranoside (IPTG) and
eukaryotic heat shock promoter which is induced by increased
temperature. Examples of tissue specific promoters are skeletal
muscle creatine kinase, prostate-specific antigen (PSA),
.alpha.-antitrypsin protease, human surfactant (SP) A and B
proteins, .beta.-casein and acidic whey protein genes. It is
introduced into somatic cells of an individual, by any convenient
mean well-known to those in the art, alone or in association with
either at least an appropriate vehicle or carrier and/or with the
targeting DNA.
[0139] According to an advantageous embodiment of the uses
according to the invention, the meganuclease (polypeptide) is
associated with: [0140] liposomes, polyethyleneimine (PEI); in such
a case said association is administered and therefore introduced
into somatic cells target. [0141] membrane translocating peptides
(Bonetta, 2002, The Sientist, 16, 38; Ford et al, Gene Ther, 2001,
8, 1-4; Wadia & Dowdy, 2002, Curr Opin Biotechnol, 13, 52-56);
in such a case, there is a fusion with said peptides.
[0142] Meganucleases can also be introduced into somatic tissue(s)
from an individual according to methods generally known in the art
which are appropriate for the particular meganuclease and cell
type.
[0143] According to another advantageous embodiment of the uses
according to the invention, the meganuclease (polynucleotide
encoding said meganuclease) and/or the targeting DNA is inserted in
a vector. Vectors comprising targeting DNA and/or nucleic acid
encoding a meganuclease can be introduced into a cell by a variety
of methods (e.g., injection, direct uptake, projectile bombardment,
liposomes). Meganucleases can be stably or transiently expressed
into cells using expression vectors. Techniques of expression in
eukaryotic cells are well known to those in the art. (See Current
Protocols in Human Genetics: Chapter 12 "Vectors For Gene Therapy"
& Chapter 13 "Delivery Systems for Gene Therapy"). Optionally,
it may be preferable to incorporate a nuclear localization signal
into the recombinant protein to be sure that it is expressed within
the nucleus.
[0144] Advantageously, the sequence encoding the meganuclease and
the targeting DNA are inserted in the same vector.
[0145] A vector which can be used in the present invention
includes, but is not limited to, a viral vector, a plasmid, a RNA
vector or a linear or circular DNA or RNA molecule which may
consists of a chromosomal, non chromosomal, semi-synthetic or
synthetic DNA. Preferred vectors are those capable of autonomous
replication (episomal vector) and/or expression of nucleic acids to
which they are linked (expression vectors). Large numbers of
suitable vectors are known to those of skill in the art and
commercially available.
[0146] Viral vectors include retrovirus, adenovirus, parvovirus
(e.g., adenoassociated viruses), coronavirus, negative strand RNA
viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus
(e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g.
measles and Sendai), positive strand RNA viruses such as
picornavirus and alphavirus, and double stranded DNA viruses
including adenovirus, herpesvirus (e.g., Herpes Simplex virus types
1 and 2, Epstein-Barr virus, cytomega-lovirus), and poxvirus (e.g.,
vaccinia, fowlpox and canarypox). Other viruses include Norwalk
virus, togavirus, flavivirus, reoviruses, papovavirus,
hepadnavirus, and hepatitis virus, for example. Examples of
retroviruses include: avian leukosis-sarcoma, mammalian C-type,
B-type viruses, Dtype viruses, HTLV-BLV group, lenti-virus,
spumavirus (Coffin, J. M., Retroviridae: The viruses and their
replication, In Fundamental Virology, Third Edition, B. N. Fields,
et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996).
Other examples include murine leukemia viruses, murine sarcoma
viruses, mouse mammary tumor virus, bovine leukemia virus, feline
leukemia virus, feline sarcoma virus, avian leukemia virus, human
T-cell leukemia virus, baboon endogenous virus, Gibbon ape leukemia
virus, Mason Pfizer monkey virus, simian immunodeficiency virus,
simian sarcoma virus, Rous sarcoma virus and lentiviruses. Other
examples of vectors are described, for example, in McVey et al.,
U.S. Pat. No. 5,801,030, the teachings of which are incorporated
herein by reference.
[0147] Vectors can also comprise selectable markers (for example,
neomycin phosphotransferase, histidinol dehydrogenase,
dihydrofolate reductase, hygromycin phosphotransferase, herpes
simplex virus thymidine kinase, adenosine deaminase, glutamine
synthetase, and hypoxanthine-guanine phosphoribosyl transferase for
eukaryotic cell culture; TRP1 for S. cerevisiae; tetracycline,
rifampicin or ampicillin resistance in E. coli; etc. . . . ).
[0148] Once in a cell, the meganuclease and if present, the vector
comprising targeting DNA and/or nucleic acid encoding a
meganuclease are imported or translocated by the cell from the
cytoplasm to the site of action in the nucleus.
[0149] Meganucleases and vectors which comprise targeting DNA
homologous to the region surrounding the cleavage site and/or
nucleic acid encoding a custom-made meganuclease can be introduced
into an individual using routes of administration generally known
in the art. Administration may be topical or internal, or by any
other suitable avenue for introducing a therapeutic agent to a
patient. Topical administration may be by application to the skin,
or to the eyes, ears, or nose. Internal administration may proceed
intradermally, subcutaneously, intramuscularly, intraperitoneally,
intraarterially or intravenously, or by any other suitable route.
It also may in some cases be advantageous to administer a
composition of the invention by oral ingestion, by respiration,
rectally, or vaginally.
[0150] The meganucleases and vectors can be administered in a
pharmaceutically acceptable carrier, such as saline, sterile water,
Ringer's solution, and isotonic sodium chloride solution.
Typically, for therapeutic applications, the meganucleases will be
combined with a pharmaceutically acceptable vehicle appropriate to
a planned route of administration. A variety of pharmaceutically
acceptable vehicles are well known, from which those that are
effective for delivering meganucleases to a site of infection may
be selected. The HANDBOOK OF PHARMACEUTICAL EXCIPIENTS published by
the American Pharmaceutical Association is one useful guide to
appropriate vehicles for use in the invention. A composition is
said to be a "pharmaceutically acceptable vehicle" if its
administration can be tolerated by the recipient. Sterile
phosphate-buffered saline is one example of a pharmaceutically
acceptable vehicle that is appropriate for intravenous
administration. The mode of administration is preferably at the
location of the targeted cells.
[0151] The dosage of meganuclease or vector according to the
present invention administered to an individual, including
frequency of administration, will vary depending upon a variety of
factors, including mode and route of administration: size, age,
sex, health, body weight and diet of the recipient; nature and
extent of symptoms of the disease or disorder being treated; kind
of concurrent treatment, frequency of treatment, and the effect
desired. For a brief review of pharmaceutical dosage forms and
their use, see PHARMACEUTICAL DOSAGE FORMS AND THEIR USE (1985)
(Hans Huber Publishers, Berne, Switzerland).
[0152] For purposes of therapy, the meganucleases and a
pharmaceutically acceptable excipient are administered in a
therapeutically effective amount. Such a combination is said to be
administered in a "therapeutically effective amount" if the amount
administered is physiologically significant. An agent is
physiologically significant if its presence results in a detectable
change in the physiology of the recipient. In the present context,
an agent is physiologically significant if its presence results: in
a decrease in the severity of one or more symptoms of the targeted
disease, in a genome correction of the lesion or abnormality, or in
inhibition of viral infection.
[0153] In one embodiment of the uses according to the present
invention, the meganuclease is substantially non-immunogenic, i.e.,
engender little or no adverse immunological response. A variety of
methods for ameliorating or eliminating deleterious immunological
reactions of this sort can be used in accordance with the
invention. In a preferred embodiment, the meganuclease is
substantially free of N-formyl methionine. Another way to avoid
unwanted immunological reactions is to conjugate meganucleases to
polyethylene glycol ("PEG") or polypropylene glycol ("PPG")
(preferably of 500 to 20,000 daltons average molecular weight
(MW)). Conjugation with PEG or PPG, as described by Davis et al.,
(U.S. Pat. No. 4,179,337) for example, can provide non-immunogenic,
physiologically active, water soluble endonuclease conjugates with
anti-viral activity. Similar methods also using a
polyethylene-polypropylene glycol copolymer are described in Saifer
et al. (U.S. Pat. No. 5,006,333).
[0154] --Gene Therapy
[0155] The use of meganucleases for gene therapy according to the
present invention varies depending on the type of genetic disease
(monogenic recessive disease, trinucleotide repeats diseases or
diseases caused by dominant and compound heterozygous
mutations).
[0156] Thus, in one embodiment of the present invention, the
meganuclease is used in association with a targeting DNA as defined
above, comprising a sequence to repair the site of interest, for
preventing, improving or curing a monogenetic recessive
disease.
[0157] In this case, the use of the meganuclease comprises at least
the step of (a) inducing in somatic tissue(s) of the individual a
double stranded cleavage at a site of interest comprising at least
one recognition and cleavage site of said meganuclease, and (b)
introducing into the individual a targeting DNA, wherein said
targeting DNA comprises (1) DNA sharing homologies to the region
surrounding the cleavage site and (2) DNA which repairs the site of
interest upon recombination between the targeting DNA and the
chromosomal DNA. The targeting DNA is introduced into the
individual under conditions appropriate for introduction of the
targeting DNA into the site of interest.
[0158] Monogenetic recessive diseases include with no limitations
diseases affecting the following genes in the corresponding somatic
tissues: [0159] liver: apolipoprotein deficiencies (apoA-I or apoB
genes); familial hypercholesterolemia (FH; LDL receptor gene);
Wilson's disease (WND gene); Sickle cell anemia (hemoglobin beta
gene (HBB)); alpha-1 antitrypsin deficiency (alpha-1 antitrypsin
gene); Hereditary hemochromatosis (HFE gene); Hemophilia A or B
(Factor IX or X genes); Aminoacidopathies (tyrosinemia
(fumarylacetoacetate hydrolase gene (FAH)), phenylketonurea
(phenylalanine hydroxylase gene (PAH)), . . . ). [0160] Lung:
Cystic fibrosis (CFTR: Cystic Fibrosis Transmembrane Regulator)
[0161] Muscle: Limb-girdle Muscular Dystrophies (.alpha., (.beta.,
.gamma. or .delta.-sarcoglycan genes) [0162] Kidney: Polycystic
Kidney Disease (PKHDI) [0163] Retina: Retinitis pigmentosa
(Rhodopsin gene [0164] Central Nervous system (CNS): Tay-Sachs
disease; Lese-Nyhan syndrome (HPRT gene).
[0165] In another embodiment of the present invention, the
meganuclease is used alone or in association with at least one
appropriate vehicle and/or carrier for preventing, improving or
curing a trinucleotide repeats disease.
[0166] In this case, the trinucleotide repeats ((CGG)n, (CAG)n, or
(GAA)n) flanking the meganuclease recognition and cleavage site are
deleted by intrachromosomal homologous recombination. More
precisely, the use of the meganuclease comprises: inducing in
somatic tissue(s) of the individual a double stranded break at a
site of interest comprising at least one recognition and cleavage
site of said meganuclease under conditions appropriate for
chromosomal DNA homologous to the region surrounding the site of
cleavage to be deleted into the site of interest and repair of the
site of interest (intrachromosomal homologous recombination).
[0167] Trinucleotide repeats diseases include with no limitations,
diseases affecting the genes as follows: [0168] Fragile X syndrome:
CGG repeat, FMR1 gene [0169] Fragile XE syndrome: CCG repeat, FMR2
gene [0170] Friedreich ataxia: GAA repeat, X25 gene [0171] Myotonic
dystrophy: CAG repeat, DMPK gene [0172] Huntington disease: CAG
repeat, HD gene [0173] Spinocerebellar ataxia: CAG repeat, SCA1, 2,
3, 6, 7, and 8 genes [0174] Haw river syndrome: GAA repeat, DRPLA
gene.
[0175] In yet another embodiment of the present invention, the
meganuclease is used alone or in association with a targeting DNA
as defined above and/or with at least one appropriate vehicle
and/or carrier for preventing, improving or curing genetic diseases
caused by dominant or compound heterozygous mutations.
[0176] Therefore, there are two cases:
[0177] 1. Meganuclease used alone: the double-strand break at the
site of the mutation is employed to obtain correction of a genetic
lesion via a gene conversion event in which the homologous
chromosomal DNA sequences from another copy of the gene donates
sequences to the sequences where the double-stranded break was
induced (interchromosomal homologous recombination). More
precisely, the use of the meganuclease comprises: inducing in
somatic tissue(s) of the individual a double stranded break at a
site of interest comprising at least one recognition and cleavage
site of said meganuclease under conditions appropriate for
chromosomal DNA homologous to the region surrounding the site of
cleavage to be introduced into the site of interest and repair of
the site of interest.
[0178] 2. Meganuclease used in association with a targeting DNA:
the use of the meganuclease comprises at least the step of (a)
inducing in somatic tissue(s) of the individual a double stranded
cleavage at a site of interest comprising at least one recognition
and cleavage site of said meganuclease, and (b) introducing into
the individual a targeting DNA, wherein said targeting DNA
comprises (1) DNA sharing homologies to the region surrounding the
cleavage site and (2) DNA which repairs the site of interest upon
recombination between the targeting DNA and the chromosomal DNA.
The targeting DNA is introduced into the individual under
conditions appropriate for introduction of the targeting DNA into
the site of interest. The sequence encoding the meganuclease and
the sequence encoding the targeting DNA may be carried by the same
vector.
[0179] According to the present invention, in both cases, said
double-stranded cleavage is induced, either in toto by
administration of said meganuclease to an individual, or ex vivo by
introduction of said meganuclease into somatic cells removed from
an individual and returned into the individual after
modification.
[0180] Genetic diseases caused by dominant or compound heterozygous
mutations include with no limitations: Huntington disease, familial
hypercholesterolaemia, familial hyperlipidaemia, oro-facio-digital
syndrome type 1, dominant otosclerosis, the Bannayan syndrome,
hailey-hailey disease, achondroplasia.
[0181] --Antiviral Therapy
[0182] According to the present invention meganucleases are used as
therapeutics in the treatment of viral diseases caused by viruses
or retroviruses that present a DNA intermediate. Indeed, many
viruses which infect eukaryotic cells possess, during at least one
part of their life cycle, genomes that consist of double stranded
DNA which can be cleaved readily by a meganuclease. This strategy
involves identification of DNA sequences within the viral genome
that are viral-specific, i.e., they are not present within the
human genome. Once identified, meganucleases that specifically bind
and cleave such sequences with high affinity and specificity can be
designed using the method for preparing custom-made meganucleases
as described in the present invention. Then the designed
meganucleases are used for the treatment of viral infection.
[0183] Meganucleases or expression vector encoding said
meganucleases are introduced into the individual by any convenient
mean. When the custom-made meganucleases are introduced or
expressed into the infected cells, the virus is inactivated and/or
deleted. The meganuclease treatment has no functional impact on
healthy cells. Similarly, such antiviral therapy based on the use
of at least one meganuclease could be used to treat organs of an
animal dedicated to xenotransplantation.
[0184] Any virus that contains a double stranded DNA stage in its
life cycle can be targeted for deletion or inactivation by creating
a meganuclease that recognizes DNA sequences specific of the viral
genome. These viruses could be in replicative or latent form. They
could stay either episomal or integrated in the host's genome.
[0185] The double stranded DNA genome viruses are well appropriate
to be treated by using meganucleases as defined in the present
invention. Among them are found the adenoviruses, the
herpesviruses, the hepadnaviruses, the papovaviruses, and the
poxviruses. Among the herpesviruses are found herpes simplex virus
(HSV), varicella virus (VZV), Epstein-Barr virus (EBV), cytomegalo
virus (CMV), herpes virus 6, 7 and 8. Among the hepadnaviruses are
found the human hepatitis B virus (HBV). Among the papovaviruses
are found papillomavirus (HPV) (i.e. HPV 16 or HPV 18) and polyoma
virus. Among the adenoviruses are found adenovirus 11 and 21 which
are involved in acute hemorrhagic cystitis.
[0186] The retroviruses are also well appropriate to be treated by
using meganucleases according to the present invention. Although
they are RNA viruses, they are integrated in the host genome as
double-stranded DNA form. Among the retroviruses are found the
human immunodeficiency virus (HIV) and the human T lymphoma virus
(HTLV) (i.e. HTLV1).
[0187] According to an advantageous embodiment of the use according
to the present invention, said virus is selected from HIV, HBV,
HTLV, HPV and HSV.
[0188] Several above-mentioned viruses are well-known to be
involved in carcinogenesis: EBV in Burkitt's lymphoma, other
lymphoproliferative disease and nasopharyngeal carcinoma; herpes
virus 8 in Kaposi sarcoma; HBV in hepatocellular carcinoma; HPV in
genital cancer; HTLV-1 in T-cell leukemia.
[0189] For episomal viruses, a double-strand break introduced in
its genome leads to the linearisation of the genome and its
degradation. Examples of episomal viruses are HSV-1, EBV, and
HPV.
[0190] For integrated viruses, a double strand break introduced in
or near the integrated viral sequence leads to partial or complete
deletion of the integrated viral sequence. Examples of integrated
viruses are HPV, HTLV, HBV, and HIV. Several mechanisms could be
involved in the deletion. A double-strand break in a chromosome
induces a gene conversion with the homologous chromosome, therefore
leading to viral sequence deletion. If directed repeat sequences
are present near the double strand break, the break could also be
repaired by SSA (single strand annealing) leading to partial or
complete viral deletion. If two double-strand breaks are
introduced, then the chromosome could also be repaired by end
joining leading to partial or complete deletion of the virus,
depending on the positions of the double-strand breaks. See Example
5 in U.S. Pat. No. 5,948,678, the disclosure of which is
incorporated herein by reference.
[0191] To ensure that the targeted viral DNA sequences are not
present in the host's genome, such DNA target sequences should be
at least 15 nucleotides in length and preferably at least 18
nucleotides in length. As the homing endonuclease present a
recognition sequence spanning to 12-40 bp, this condition is
fulfilled with the custom-made meganucleases as defined in the
present invention. More particularly, I-Cre I homing endonuclease
has a 22 bp recognition sequence.
[0192] Any DNA sequence of viral genomes can be targeted for
cleavage by meganucleases as defined in the present invention.
Preferred target sites include those sequences that are conserved
between strains of virus and/or which genes are essential for virus
propagation or infectivity. These positions are preferable for at
least two reasons. First, essential parts of viruses are less
mutated than others. Secondly, it is preferably to target an
essential region of the virus to maximize the inactivation of the
virus.
[0193] A good target for the custom-made meganuclease could be the
viral origin of replication (ori) and/or the viral gene encoding an
ori binding protein. Examples of ori binding proteins include the
HSV-1 UL9 gene product, the VZV gene 51 product, the human
herpesvirus 6B CH6R gene product, the EBV EBNA-1 gene product and
the HPV E1 and E2 gene products. Other interesting targets for HPV
are the genes E6 and E7 as products of which are involved in the
initiation and maintenance of the proliferative and malignant
phenotype. A preferred target is the highly conserved 62
nucleotides sequence in the pre-core/core region of HPV (E6, E7).
Examples of interesting targets for EBV are the genes EBNA and LMP.
It could be interesting to target the gene Tax of HTLV-1 which
appears to mediate the oncogenic effects of the virus. For HBV, an
interesting target could be the X gene as the X protein interacts
with elements of the DNA repair system and may increase the
mutation rate of p53. For HIV, a preferred target is within TAT,
REV, or TAR genes. The viral targets are not limited to the
above-mentioned examples. Optionally, the target DNA could be
located in the viral repeated sequences such as ITR (Inverted
Terminal Repeat) and LTR (Long Terminal Repeat).
[0194] Preferably, at least two different targeted sites are used.
Indeed, as the main protection of the viruses is their ability to
mutate. Therefore, two targeted sites avoid the virus to escape the
treatment by using the custom-made meganucleases, according to the
present invention. Moreover, the successive use of different
custom-made meganucleases may avoid the adverse immunologic
response. Said different custom-made meganuclease can present
different initial meganucleases, therefore different
immunogenicities.
[0195] The effectiveness of a meganuclease to inhibit viral
propagation and infection is preferably assessed by in vitro and in
vivo assays of infection. Such assays can be carried out first in
cell culture to establish the potential of different meganucleases
to cleave a viral DNA in a way that deleteriously affects viral
propagation. Preliminary studies of this type are followed by
studies in appropriate animal models. Finally, clinical studies
will be carried out.
[0196] Different viruses require different assay systems, since
hosts and culture conditions suitable to different viruses vary
greatly. However, such appropriate conditions have been described
for culturing many viruses and these conditions can be used to test
the effect of exposing virus and/or host to meganucleases to
determine the ability of the endonuclease to inhibit viral
infection. For one discussion of culture conditions for specific
viruses see Chapter 17 in Fields and Knipe, Eds., FIELDS VIROLOGY,
2nd Ed., Raven Press, N.Y. (1990).
[0197] A host and/or virus can be exposed at various times during a
course of infection, under varying conditions, in several amounts,
and in a variety of vehicles, to mention just a few relevant
parameters that can be varied, to assess the potential of
meganuclease to achieve a potentially therapeutic effect.
[0198] In addition, in order to tests ex vivo in cultured cells,
potential therapeutical meganuclease can be tested in animal models
to assess prophylactic, ameliorative, therapeutic and/or curative
potential, either alone or in conjunction with other therapeutic
agents. In some cases, it will not be possible to culture a virus
and it will be necessary to perform all biological assays in animal
models. It will be readily appreciated that different animal models
will be appropriate to different viruses. Any animal model,
however, can be used to assess the therapeutic potential of a
meganuclease.
[0199] A potentially effective dose of the assayed meganucleases
may be administered to a suitable population of animals, and the
effect of the meganucleases on the course of a viral infection may
be assessed by comparison with an appropriate control. Such methods
for assessing pharmacological effect are well known in the art and
can readily be adapted to determining the therapeutic profile of
the meganucleases.
[0200] --Genome Engineering
[0201] Genome engineering is the set of methods used to induce a
change in the genetic program of a living cell and/or organism. The
meganucleases obtained by the method of the present invention
allows rational site directed modifications of cell genomes. The
purpose of these techniques is to rewrite chromosomes precisely
where they should be modified leaving the rest of the genome
intact. Fields of applications of the genome engineering are
multiple: animal models generation (knock-in or knock-out), protein
production (engineering of production strains, protein production
in plant and animals for protein production in milks), agricultural
biotechnology (addition or removal of a trait, marker excision),
modification and study of metabolic pathway.
[0202] In a first embodiment of the use according to the present
invention, it comprises at least the following steps: 1)
introducing a double-strand break at the genomic locus comprising
at least one recognition and cleavage site of said meganuclease; 2)
providing a targeting DNA construct comprising the sequence to be
introduced flanked by sequences sharing homologies to the targeted
locus. Indeed, shared DNA homologies are located in regions
flanking upstream and downstream the site of the break in the
targeting DNA construct and the DNA that might be introduced should
be located between the two arms. Said meganuclease can be provided
directly to the cell or through an expression vector comprising the
polynucleotide sequence encoding said meganuclease and suitable for
its expression in the used cell. This strategy is used to introduce
a DNA sequence at the target site, for example to generate knock-in
animal models or cell lines that can be used for drug testing or
the production of proteins.
[0203] In another embodiment of the use according to the present
invention it comprises at least the following steps: 1) introducing
a double-strand break at the genomic locus comprising at least one
recognition and cleavage site of said meganuclease; 2) maintaining
under conditions appropriate for homologous recombination with the
chromosomal DNA homologous to the region surrounding the cleavage
site. This strategy is used to delete a DNA sequence at the target
site, for example to generate knock-out animal models for
functional genomic studies or for the generation of appropriate
animal models for drug testing. Additionally, knock-outs can be
used for the improvement or optimization of cell lines including
the modification of metabolic pathways or the generation of cell
lines for drug testing.
BRIEF DESCRIPTION OF THE DRAWINGS
[0204] The present invention will be further illustrated by the
additional description and drawings which follows, which refers to
examples illustrating the use of meganucleases for inducing
homologous recombination in somatic tissues according to the
invention. It should be understood however that these examples are
given only by way of illustration of the invention and do not
constitute in anyway a limitation thereof.
[0205] FIG. 1 discloses the amino acid sequence of a single chain
I-Cre I meganuclease and one polynucleotide encoding said single
chain meganuclease. In the protein sequence, the two first
N-terminal residues are methionine and alanine (MA), and the three
C-terminal residues alanine, alanine and aspartic acid (AAD). These
sequences allow having DNA coding sequences comprising the NcoI
(CCATGG) and EagI (CGGCCG) restriction sites, which are used for
cloning into various vectors.
[0206] FIG. 2 discloses polynucleotide sequences. FIG. 2A discloses
a polynucleotide called "Natural" encoding the I-Cre I homing
endonuclease. FIG. 2B discloses a polynucleotide sequence called
"Non homologous" encoding the I-Cre I homing endonuclease. FIG. 2C
discloses a polynucleotide sequence called "Template" encoding the
I-Cre I homing endonuclease comprising the mutation D75NJ. Each
I-Cre I homing endonuclease has two additional amino acids (MA) at
the N terminal end and three additional amino acids (AAD) at the
C-terminal ends. FIG. 2D discloses the polynucleotide sequences of
the primers, called UlibIfor, UlibIrev, UlibIIfor, and UlibIIrev,
used for the generation of the libraries UlibI and UlibII.
[0207] FIG. 3 is a schematic representation of the polynucleotide
sequence called "Template" encoding the I-Cre I homing endonuclease
comprising the mutation D75N. The dark arrows indicate the position
of the primers UlibIfor, UlibIrev, UlibIIfor, and UlibIIrev used to
generate the two libraries UlibI and UliblII. D-Helix refers to the
LAGLIDADG helix. N75 refers to the mutation D75N.
[0208] FIG. 4 is a schematic representation of the strategy for the
library construction. Step 1: pET24C-T is a plasmid comprising a
polynucleotide <<Template>>. Two PCR amplifications,
PCR ulib1 and ulib2, are done with either UlibIfor and UlibIIrev,
or UlibIIfor and Ulib1IIrev. The PCR ulib1 products are cloned in a
phagemid pCes4 NHT. The PCR ulib2 products are cloned in a plasmid
pET24C-T. Step 2: Subcloning a fragment of Ulib2 vector
(pET45C-Ulib2) into the Ulib1 phagemid (pCes4-Ulib1).
[0209] FIG. 5: COS cells monolayers were transfected with vector
expressing I Sce-I (B) or with control plasmid (A). Fourty eight
(48) hours after transfection cells were infected with rHSV-1 (30
PFU). Two days later monolayer was fixed and stained (X-Gal).
Infected cells appeared in blue.
[0210] FIG. 6: FIG. 6A: cells monolayer was infected with 30 PFU.
HSV-1 growth was quantified by B-galactosidase activity in cell
lysate. FIG. 6B, cell monolayer was infected with 300 PFU. Cell
survival was measured by protein determination in cell lysate.
I-Sce I refers to vector expressing I-Sce I; I-Sce I(-) refers to a
vector in which ORF of I Sce-I was inserted in reverse orientation;
negative control refers to control plasmid.
[0211] FIG. 7: FIG. 7A is a schematic representation of recombinant
HSV-1 genomic DNA. Cassette containing CMV promoter driving Lac
gene was inserted in the major LAT transcript. I-Sce I restriction
site was cloned between promoter and reporter gene. a and b
represent primers used for the semi-quantitative PCR. COS-7
monolayers were transfected with vector expressing I-Sce I or with
control plasmids. Fourty eight hours after transfection cells were
infected with rHSV-1 (30 PFU). DNA was extracted 1, 2 or 3 days
after infection. PCR was carried out as described in
<<experimental procedures>>. Std refers to Internal
standard; Lac refers to an amplicon of the rHSV-1 Lac gene. I-Sce I
refers to vector expressing I-Sce I; I-Sce I(-) refers to a vector
in which ORF of I-Sce I was inserted in reverse orientation;
negative control refers to control plasmid. FIG. 7B, PCR
quantification of the viral thymidine kinase (TK) gene. PCR was
carried out at 2 DNA concentrations. ISce-I refers to vector
expressing I-Sce I; I-Sce I(-) refers to a vector in which ORF of
1-Sce I was inserted in reverse orientation; negative control
refers to control plasmid.
[0212] FIG. 8 illustrates the titration of the virus released in
the medium after infection of the transfected cells. Every day,
medium was collected and fresh medium was added. Viruses were
measured by standard plaque assay. I-Sce I refers to vector
expressing I-SceI; I-Sce I(-) refers to a vector in which ORF of
I-Sce I was inserted in reverse orientation; negative control
refers to control plasmid.
[0213] FIG. 9 represents the I-CreI DNA target and five related
targets. (C1234=SEQ ID NO: 10; C1221=SEQ ID NO: 11; C4334=SEQ ID
NO: 12; H1234=SEQ ID NO: 13; H1221=SEQ ID NO: 14; H4334=SEQ ID NO:
15). Conserved positions are in grey boxes.
[0214] FIG. 10 illustrates four binding patterns obtained after
screening of the Lib2 library with six targets. Positives were
identified in a first screen and confirmed in a second one during
which they were assayed eight times (corresponding to the eight
solid bars) on each of the targets (C1234, C1221, C4334, H1234,
H1221 and H4334). Histograms are shown for one clone from each
class. Targets are described in FIG. 9.
[0215] FIG. 11 illustrates the schematic representation of the
target vectors. The CpG depleted LacZ gene (LagoZ) is driven by the
human elongation factor 1 alpha promoter. The LagoZ gene is
inactivated by the insertion of I-SceI cleavage site. Flanking
repeats are represented by open arrows. The length of the
homologous sequences are indicated in bold.
[0216] FIG. 12 illustrates the effect of the length of homology on
single strand annealing (SSA) efficiency. Cells monolayers were
transfected with equimolar amounts of target plasmid bearing
different lengths of homologous repeat sequences and vector
expressing ISce-I or with control plasmid. Seventy-two hours after
transfection cells were collected and .beta.-galactosidase activity
was quantified in cell lysates. (+)I-SceI, cotransfection with
vector expressing I-SceI; (-)I-SceI, cotransfection with expression
vector where the ORF of I-SceI was inserted in the reverse
orientation.
[0217] FIG. 13: Cell monolayers were cotransfected with a vector
expressing (+)I-SceI or with a control plasmid (-)I-SceI
Seventy-two hours after transfection cells were fixed and stained
(X-Gal). FIG. 13A: cells where gene repair took place appeared in
dark. FIG. 13B: frequency of I-SceI induced recombination on 70 and
220 bp duplication target vectors. The frequency is calculated by
the ratio of blue cells/transfected cells.
[0218] FIG. 14A: X-Gal staining of liver from mice injected with a
mixture of the target LagoZ gene (30 .mu.g) and an I-SceI
expression vector (10 .mu.g). FIG. 14B: X-Gal staining of liver
from mice injected with a mixture of the target LagoZ gene (30
.mu.g) and an expression vector where the ORF of I-SceI was
inserted in the reverse orientation (10 .mu.g).
[0219] FIG. 15: X-Gal staining of the liver of hemizygote
transgenic mice of two independent strains infected with the
<<Ad.I-SceI>> adenovirus by IV. A. Five days
post-infection, .beta.-galactosidase activity is detected in
multiple cells of the entire liver of 10.sup.10 infectious units
infected <<58A>> hemizygote. In contrast, no
.beta.-galactosidase activity could be detected by X-Gal staining
of the livers of <<Ad.control>>-infected hemizygote or
un-infected <<58A>> littermates (data not shown). B.
and C. Fourteen days post-infection, .beta.-galactosidase activity
is detected in multiple cells of the entire liver of 10.sup.9
infectious units infected mouse (B) and 10.sup.10 infectious units
infected mouse (C). Stronger signal is detected in C compared to B,
probably because of the bigger number of cells that were infected
with the <<Ad.I-SceI>>. In contrast, no
.beta.-galactosidase activity could be detected by X-Gal staining
of the livers of un-infected <<361>> littermates (data
not shown).
[0220] FIG. 16: Fluorescent .beta.-galactosidase assay on liver
extract. Two independent strains of transgenic mice (58 A and 361)
were injected with 10.sup.9 or 10.sup.10 PFU of adenovirus
expressing I-SceI (Ad.I-SceI) or control virus (Ad.control). Mice
were sacrificed 5 or 14 days post injection, liver was dissected
and protein were extracted. 30 .mu.l of liver protein extract were
incubated at 37.degree. C. in presence of Fluorescein digalactoside
(FDG). Bars represent the standard deviation of the assay (two
measure experiments with samples of the same extracts). NI, non
injected mice; Ad.I-SceI, mice injected with adenovirus expressing
I-SceI; Ad.control, mice injected with control adenovirus.
[0221] FIG. 17 represents the transgene, the DNA repair matrix and
the sequences of the primers used in example 7. (E=SEQ ID NO: 16;
F=SEQ ID NO: 17; G=SEQ ID NO: 18; H=SEQ ID NO: 19; I=SEQ ID NO: 20;
Actin S=SEQ ID NO: 21; Actin R=SEQ ID NO: 22)
[0222] FIG. 18 illustrates the RT-PCR analysis of I-SceI-hApo A-I
transgene repair by I-SceI induced gene conversion in mice.
Hydrodynamic tail vein injection of naked DNA (I-SceI expression
vector and DNA repair matrix) in 3 to 4 weeks old transgenic mice
(line 14A and 21). A: 2 kbp DNA repair matrix (RM) and B: 1.5 kbp
RM. I-SceI induced gene conversion on I-SceI-hApo A-I transgene in
CHO cells was used as PCR positive control.
EXAMPLES
Example 1
Single Chain Meganuclease Derived from Dimeric Homing
Endonucleases
[0223] Some LAGLIDADG homing endonucleases are active as homodimer.
Each monomer mainly dimerizes through their dodecapeptide motifs. A
single-chain meganuclease can be engineered by covalently binding
two monomers modified such as to introduce a covalent link between
the two sub-units of this enzyme. Preferably, the covalent link is
introduced by creating a peptide bond between the two monomers.
However, other convenient covalent links are also contemplated. The
single-chain meganuclease preferably comprises two subunits from
the same homing endonuclease such as single-chain I-Cre I and
single-chain I-Ceu I. A single-chain meganuclease has multiple
advantages. For example, a single-chain meganuclease is easier to
manipulate. The single-chain meganuclease is thermodynamically
favored, for example for the recognition of the target sequence,
compared to a dimer formation. The single-chain meganuclease allows
the control of the oligomerisation.
[0224] A single chain version of I-CreI (scI-CreI) was modeled and
engineered. scI-CreI cleaves its cognate DNA substrate in vitro and
induces homologous recombination both in yeast and mammalian
cells.
--Design of the Single Chain I-CreI Meganuclease
[0225] I-CreI from Chlamydomonas reinhardtii is a small LAGLIDADG
homing endonuclease that dimerizes into a structure similar to that
of larger monomer LAGLIDADG homing endonuclease. To engineer a
single chain version of I-CreI (scI-CreI), two I-CreI copies were
fused. This required placing a linker region between the two
domains, and a significant part of the I-CreI protein had to be
removed at the end of the domain preceding the linker.
[0226] The three-dimensional structure of I-DmoI is comparable to
that of I-CreI, with the exception that I-DmoI comprises a linker
region that leads from one apparent domain to the other. The
boundary of that linker finely matches related main chain atoms of
the I-CreI dimer. In the first domain, residues 93 to 95 from the
third .alpha.-helices of I-CreI and I-DmoI (prior to the linker)
are structurally equivalent. At the beginning of the second
LAGLIDADG .alpha.-helix (second domain), I-DmoI residues 104 to 106
correspond to I-CreI residues 7 to 9. In addition, Leu95 and Glu105
from I-DmoI have conserved identities in I-CreI, and I-DmoI residue
Arg104 aligns with another basic residue in I-CreI (Lys7). Thus,
the single chain I-CreI (scI-CreI), was designed by inserting the
I-DmoI linker region from residue 94 to 104 (sequence MLERIRLFNMR)
between a first I-CreI domain (terminated at Pro93) and a second
I-CreI domain (starting at Glu8).
[0227] Detailed structural analysis of how the new linker connects
the scI-CreI protein domains (in a modeled structure) revealed no
potential incompatibility. For example, the side chains of nonpolar
amino acids taken from I-DmoI, Met94, Ile98 and Phe109 point inside
fitting cavities of I-CreI. A single mutation was made (P93A),
however, to promote regularity of the backbone in the .alpha.-helix
prior to the linker region. (See FIG. 1 for amino acids and
polynucleotide sequences).
--Materials and Methods
Protein Expression and Purification
[0228] His-tagged proteins were over-expressed in E. coli BL21
(DE3) cells using pET-24d (+) vectors (Novagen). Induction with
IPTG (1 mM), was performed at 25.degree. C. Cells were sonicated in
a solution of 25 mM HEPES (pH 8) containing protease inhibitors
(Complete EDTA-free tablets, Roche) and 5% (v/v) glycerol. Cell
lysates were centrifuged twice (15 000 g for 30 min). His-tagged
proteins were then affinity-purified, using 5 ml Hi-Trap chelating
columns (Amersham) loaded with cobalt. Several fractions were
collected during elution with a linear gradient of immidazole (up
to 0.25M immidazole, followed by plateau at 0.5M immidazole and
0.5M NaCl). Protein-rich fractions (determined by SDS-PAGE) were
concentrated with a 10 kDa cut-off centriprep Amicon system. The
resulting sample was eventually purified by exclusion
chromatography on a Superdex75 PG Hi-Load 26-60 column (Amersham).
Fractions collected were submitted to SDS-PAGE. Selected protein
fractions concentrated and dialyzed against a solution of 25 mM
HEPES (pH 7.5) and 20% (v/v) glycerol.
In Vitro Cleavage Assays
[0229] pGEM plasmids with single meganuclease DNA target cut sites
were first linearized with XmnI. Cleavage assays were performed at
37.degree. C. or 65.degree. C. in 12.5 mM HEPES (pH 8), 2.5% (v/v)
glycerol and 10 mM MgCl2. Reactions were stopped by addition of 0.1
volume of 0.1 M Tris-HCl (pH 7.5), 0.25 M EDTA, 5% (w/v) SDS, and
0.5 mg/ml proteinase K and incubation at 37.degree. C. for 20
minutes. Reaction products were examined following separation by
electrophoresis in 1% agarose gels.
[0230] Yeast Colorimetric Assay.
[0231] The yeast transformation method has been adapted from
previous protocols. For staining, a classic qualitative X-Gal
Agarose Overlay Assay was used. Each plate was covered with 2.5 ml
of 1% agarose in 0.1 M Sodium Phosphate buffer, pH 7.0, 0.2% SDS,
12% Dimethyl Formamide (DMF), 14 mM .beta.-mercaptoethanol, 0.4%
X-Gal, at 60.degree.. Plates were incubated at 37.degree. C.
[0232] Mammalian Cells Assays
[0233] COS cells were transfected with Superfect transfection
reagent accordingly to the supplier (Qiagen) protocol. 72 hours
after transfection, cells were rinsed twice with PBS1.times. and
incubated in lysis buffer (Tris-HCl 10 mM pH7.5, NaCl 150 mM,
Triton X100 0.1%, BSA 0.1 mg/ml, protease inhibitors). Lysate was
centrifuged and the supernatant used for protein concentration
determination and .beta.-galactosidase liquid assay. Typically, 30
.mu.l of extract were combined with 3 .mu.l Mg 100.times. buffer
(MgCl.sub.2 100 mM, .beta.-mercaptoethanol 35%), 33 .mu.l ONPG 8
mg/ml and 234 .mu.l sodium phosphate 0.1M pH7.5. After incubation
at 37.degree. C., the reaction was stopped with 500 .mu.l of 1M
Na.sub.2CO.sub.3 and OD was measured at 415 nm. The relative
.beta.-galactosidase activity is determined as a function of this
OD, normalized by the reaction time, and the total protein
quantity.
--Results: Single Chain I-CreI Cleaves its DNA Substrate In Vitro
and in Living Cells
[0234] A synthetic gene corresponding to the new enzyme was
engineered and the scI-CreI protein over-expressed in E. coli. The
ability of purified scI-CreI to cleave DNA substrates in vitro was
tested, using linearized plasmids bearing a copy of the I-CreI
homing site. Similarly to parent I-CreI, the novel enzyme cleaves
an I-CreI target site at 37.degree. C.
[0235] In order to test the functionality of scI-CreI in vivo, an
assay to monitor meganuclease-induced homologous recombination in
yeast and mammalian cells was designed. In yeast, Xenopus oocytes
and mammalian cells, DNA cleavage between two direct repeats is
known to induce a very high level of homologous recombination
between the repeats. The recombination pathway, often referred to
as Single-Strand Annealing (SSA), removes one repeat unit and all
intervening sequences. Thus, a SSA reporter vector, with two
truncated, non-functional copies of the bacterial LacZ gene and an
I-CreI cut site within the intervening sequence was constructed in
a yeast replicative plasmid. Cleavage of the cut site should result
in a unique, functional LacZ copy that can be easily detected by
X-gal staining.
[0236] The reporter vector was used to transform yeast cells. A
small fraction of cells appeared to express functional LacZ,
probably due to recombination events during transformation.
Co-transformation with plasmids expressing either I-CreI or
scI-CreI, in contrast, resulted in blue staining for all plated
cells. Even in non-induced conditions (glucose), the residual level
of protein was enough to induce SSA, suggesting that scI-CreI, as
much as I-CreI, is highly efficient in yeast cells. Further-more,
SSA induction was truly dependent on cleavage of the target cut
site by I-CreI proteins, as vectors devoid of that site display no
increase in .beta.-galactosidase activity compared to background
levels.
[0237] The SSA assay was modified for tests in mammalian cells. The
promoter and termination sequences of the reporter and meganuclease
expression plasmid were changed, and plasmid recombination was
evaluated in a transient transfection assay. Similar levels of
induced recombination (2 to 3-fold increase) were observed with
either scI-CreI or I-CreI. As in the yeast experiment,
recombination depends on an I-CreI cut site between the repeats,
for no increase of the .beta.-galactosidase was observed in the
absence of this site.
[0238] Another recombination assay, based on recombination between
inverted repeats, was also used to monitor meganuclease-induced
recombination in COS cells. As direct repeats can recombine by SSA,
homologous recombination between indirect repeats requires a gene
conversion event. Similar stimulation of gene conversion (3 to
4-fold) was observed with either scI-CreI or I-CreI. As expected
for a true homologous recombination event, no enhancement was
observed in the absence of an homologous donor template.
Example 2
Custom-Made Meganuclease Derived from I-CreI Homing Endonuclease
for HIV-2 Target
--Construction of a Phage-Displayed Library of I-Cre I Variants
[0239] In order to engineer new meganuclease with altered
specificities, a combinatorial library was constructed by
mutagenesis of the I-Cre I homing endonuclease replacing DNA
binding residues. Selection and screening applications then enabled
to find those variants that were able to bind a particular, chosen
DNA target. For phage display, as I-Cre I is a homodimer, a
phagemid vector was required that encoded two separate I-Cre I
proteins. Only one of the two I-Cre I copies, which was fused to
the phage coat protein p3, was mutated. The resulting protein
library, in phage display format, comprised thus I-Cre I
wild-type/mutant heterodimers. Eight residues (Q26, K28, N30, Y33,
Q38, Q44, R68 and R70) capable together of specific interactions
with most of the bases in a single hal-site within the DNA target
were selected. Our combinatorial library was obtained by replacing
the eight corresponding codons with a unique degenerated VVK codon.
Eventually, mutants in the protein library corresponded to
independent combinations of any of the 12 amino acids encoded by
the VVK codon (ADEGHKNPQRST) at eight residue positions. In
consequence, the maximal (theoretical) diversity of the protein
library was 12.sup.8 or 4.29.times.10.sup.8
--Construction of the Library
[0240] First, residue D75, which is shielded from solvent by R68
and R70, was mutated to N (Asn) in order to remove the likely
energetic strain caused by replacements of those two basic residues
in the library. Homodimers of mutant D75N (purified from E. coli
cells wherein it was over-expressed using a pET expression vector)
were shown to cleave the I-CreI homing site. A phagemid vector was
then engineered that encodes wild-type I-CreI (FIGS. 2A and 2B:
<<Natural>> or <<Non homologous>>) and the
D75N mutant (FIG. 2C: <<Template>>) fused to the phage
coat protein p3 and phage-displayed wild-type/D75N heterodimers
were shown to bind that target DNA.
[0241] Second, two intermediate libraries of moderate size have
been built: Lib1 (residues 26, 28, 30, 33 and 38 mutated;
theoretical diversity 12.sup.5 or 2.48.times.10.sup.5) and Lib2
(residues 44, 68 and 70 mutated; theoretical diversity 12.sup.3 or
1.7.times.10.sup.3). DNA fragments carrying combinations of the
desired mutations were obtained by PCR (several reactions in 50
.mu.l), using degenerated primers (FIG. 2D: Ulib1for, Ulib1rev,
Ulib11for, Ulib11rev) and as DNA template, the D75N gene. Lib1 and
Lib2 were constructed by ligation of the corresponding PCR
products, digested with specific restriction enzymes, into the D75N
mutant gene, within the phagemid vector and within the pET
expression vector, respectively. Digestions of vectors and inserts
DNA were conducted in two steps (single enzyme digestions) between
which the DNA sample was extracted
(phenol:chloroform:isoamylalcohol) and EtOH-precipitated. 10 .mu.g
of digested vector DNA were used for ligations, with a 5:1 excess
of insert DNA. E. coli TG1 cells were transformed with the
resulting vectors by electroporation. To produce a number of cell
clones above the theoretical diversity of either library, up to 35
electroporations of the Lib1 ligation samples and 4
electroporations of the Lib2 ligation samples were necessary.
4.times.10.sup.6 (16 times the maximal diversity) and
6.times.10.sup.4 (35 times the diversity) clones were thus obtained
for Lib 1 and Lib2, respectively (these numbers were corrected by
the number of clones obtained using ligations done without
inserts).
[0242] Finally, Lib1 and Lib2 bacterial clones were scraped from
plates and the corresponding plasmid vectors were extracted and
purified. The complete library was then obtained by sub-cloning a
fragment of the Lib2 vector into the Lib1 phagemid vector (see FIG.
4 for a schematic diagram of the library construction). Several
rounds of DNA 2-step digestions, dephosphorylation, purification,
quantification, ligation and electroporation were performed. After
4 rounds of 150 electroporation shots (which corresponds to 12
ligations of 1.4 .mu.g vector with 0.4 .mu.g insert),
5.5.times.10.sup.7 bacterial clones were obtained (after correction
for background). Bacteria were scraped and stored as a glycerol
stock. In addition, an aliquot of this glycerol stock was used to
inoculate a 200 ml culture and the library vector was extracted and
purified from this culture for storage or potential subcloning.
--Material and Methods
Protein Expression and Purification
[0243] His-tagged proteins were over-expressed in E. coli BL21
(DE3) cells using pET 24d (+) vectors (Novagen). Induction with
IPTG (1 mM), was performed at 15.degree. C. over 5 night. Cells
were cracked for 1 h at 4.degree. C. in a B-Per solution (Bacterial
Protein Extraction Reagent, Pierce, 5 ml for 200 ml culture cell),
containing protease inhibitors (Complete EDTA-free tablets, Roche)
and DNase I (80 units)/nuclease (respectively 80 and 60 units,
Roche). Alternatively, cells were sonicated in a solution of 25 mM
HEPES (pH 8) containing protease inhibitors (Complete EDTA-free
tablets, Roche) and 5% (v/v) glycerol.
[0244] Cell lysates were centrifuged twice (15 000 g for 30 min).
His-tagged proteins were then affinity-purified, using 1 ml Hi-Trap
chelating columns (Amersham) loaded with cobalt. Several fractions
were collected during elution with a linear gradient of immidazole
(up to 0.25 M immidazole, followed by plateau at 0.5 M immidazole
and 0.5 M NaCl). Protein-rich fractions (determined by SDS-PAGE)
were concentrated with a 10 kDa cut-off centriprep Amicon system.
The resulting sample was eventually purified by exclusion
chromatography on a Superdex75 PG Hi-Load 26-60 column
(Amersham).
[0245] Fractions collected were submitted to SDS-PAGE. Selected
protein fractions concentrated and dialyzed against a solution of
25 mM HEPES (pH 7.5) and 20% (v/v) glycerol.
[0246] In Vitro Cleavage Assay
[0247] pGEM plasmids with single meganuclease DNA target cut sites
were first linearized with XmnI. Cleavage assays were performed at
37.degree. C. in 12.5 mM HEPES (pH 8), 2.5% (v/v) glycerol and 10
mM MgCl.sub.2. Reactions were stopped by addition of 0.1 volume of
0.1 M Tris-HCl (pH 7.5), 0.25 M EDTA, 5% (w/v) SDS, and 0.5 mg/ml
proteinase K and incubation at 37.degree. C. for 20 minutes.
Reaction products were examined following separation by
electrophoresis in 1% agarose gels.
[0248] Phagemid Construction
[0249] Phage Display of I-Cre I/D75N heterodimer was obtained by
using a phagemid harboring two different ORFs as a bicistron, under
the control of promoter pLac. The first one yields a soluble
protein fused to a N-terminal signal sequence directing the product
into the periplasmic space of E. coli Gene I-Cre I WT was cloned
into this ORF using restriction enzymes ApaLI and AscI. The D75N
domain was cloned into the second ORF using Nco I and Eag I
restriction enzyme, leading to a fusion with the phage coat protein
p3 via a hexahis tag, a C-Myc tag and an amber stop codon. This
final phagemid was called pCes1CreT. In a suppressive strain like
TG1 or XL1blue, and after infection by a helper phage (e.g.
M13K07), D75N-p3 fusions are incorporated in the phage coat and the
soluble I-CreI monomers produced in the same compartment will
either dimerize or interact with the displayed D75N domain, thereby
producing particles displaying I-CreI WT/D75N heterodimer.
[0250] Phage Production
[0251] A 5 mL culture of 2.times.TY containing 100 .mu.g/ml of
ampicillin and 2% glucose was inoculated with a 1/100 dilution of
an overnight culture of bacteria containing phagemid pCes1CreT and
agitated at 37.degree. C. At an OD.sub.600 of 0.5, phage helper
M13K07 (Pharmacia) was added at a ratio phage:bacteria of 20:1.
After 30 min at 37.degree. C. without agitation, the culture was
centrifuged for 10 min at 4000 rpm and the pellet was resuspended
in 25 ml of 2.times.TY containing 100 .mu.g/mL Ampicillin and 25
.mu.g/mL Kanamycin, and agitated overnight at 30.degree. C. Culture
were centrifuged and supernatant were used as such in phage
ELISA.
[0252] PhageELISA
[0253] Microtiter plates were coated for 1 h at 37.degree. C. with
100 .mu.l/well of biotinylated BSA at 2 .mu.g/mL in PBS. After
several washes in PBS containing 0.1% Tween20 (PBST), wells were
incubated with 100 .mu.l/well of streptavidin at 10 .mu.g/mL in PBS
and incubated for 1 h at RT. Plates were further washed and
incubated with biotinylated PCR fragments harboring the target
site, at 250 pM in PBS. After 1 h incubation at RT and washing,
plates were saturated with 200 .mu.l/well of PBS containing 3%
powder milk and 25 mM CaCl.sub.2 (PMC). PMC was discarded and
plates were filled with 80 .mu.l of PMC and 20 .mu.l/well of
culture supernatant containing the phage particles. After 1 h of
incubation at RT, plates were extensively washed with PBST and
incubated with 100 .mu.l/well of anti 25 M13-HRP conjugated
antibody (Pharmacia) diluted 1/5000 in PMC. Plates were incubated
for 1 h at RT, washed and incubated with TMB solution (Sigma). The
reaction was blocked with 50 .mu.l/well of 1M H.sub.2SO.sub.4.
Plates were read at 450 nm. A signal higher than 3.times. the
background (irrelevant target) can be considered as positive.
[0254] PCR-Based Mutagenesis
[0255] Plasmid pET24-T45 containing the gene I-CreI D75N was
diluted at 1 ng/.mu.l to be used as template for PCR. Degenerated
oligonucleotides encoding the desired randomizations were used to
amplify PCR fragments Lib1 and Lib2 in 4.times.50 .mu.l PCR
reactions per inserts. PCR products were pooled, EtOH precipitated
and resuspended in 50 .mu.l 10 mM Tris.
[0256] DNA Digestions
[0257] All enzymes and the corresponding buffers were from
NEBiolabs. Digestions of up to 10 .mu.g DNA were realised using up
to 100 U of a first restriction enzyme, at 37.degree. C., in 150 or
500 .mu.l final reaction volume. After 2 h to 6 h, digested DNA was
phenol extracted and EtOH precipitated. Digestion substrates and
products were separated using agarose gel electrophoresis, the
desired product being extracted from the gel and purified
(Nucleospin Extract, Macherey-Nagel). For PCR inserts, digestions
were directly purified on Nucleospin columns. The second digestion
was then performed in identical conditions. At the end of this
second digestion reaction, 0.1 volume of 10.times.CAP buffer and
0.5 .mu.l of CAP were added to the digested vectors, and the
samples were further incubated for 30 min at 37.degree. C. (The
alkaline phosphatase was inactivated by incubating the sample 10
min at 70.degree. C., after addition of EDTA). Eventually, the
digested and de-phosphorylated DNA was phenol extracted, EtOH
precipitated and resuspended in 30 .mu.l of 10 mM Tris pH8. Final
DNA concentrations were estimated by comparison of band intensities
in agarose gels after electrophoresis.
[0258] Ligations
[0259] Large-scale ligations were done at 16.degree. C. (for 16 h)
using 1400 ng of digested vector and a 5:1 molar excess of digested
in 200 .mu.l reaction volumes and with 4000 U of T4 DNA ligase
(NEBiolabs). After ligation, reaction samples were incubated for 20
min at 65.degree. C. to inactivate the ligase. The vector DNA was
eventually EtOH precipitated and resuspended at 25 ng/.mu.l in 10
mM Tris pH8.
Electroporations
[0260] 40 .mu.l of homemade electrocompetent cells TG1 were mixed
with 25 ng of ligated DNA (1 .mu.l) in a 2 mm cuvette. After 1 min
on ice, cells were pulsed (2.5 Kv, 25 .mu.F, 200 Ohm) and
immediately resuspended in 1 ml of 2.times.TY +2% glucose. Cells
were placed at 37.degree. C. for 1 h with agitation, and then
plated on large 2.times.TY plates containing ampicillin (phagemid
vector) or kanamycin (pET vector) and 2% glucose and incubated
overnight at 30.degree. C. Aliquots were also diluted in 2.times.TY
and plates on small 2.times.TY Ampicillin glucose plates to obtain
isolated colonies allowing the calculation of library diversities
and characterization of several clones by restriction analysis.
--Selection and Screening of Meganuclease Binding to a HIV2-Derived
DNA Target from a Library of I-Cre I Variant Using Phage
Display
[0261] The goal of this project was to obtain a meganuclease
capable of cutting a sequence found in the genome of HIV2
(GGAAGAAGCCTTAAGACATTTTGA). The homing endonuclease I-Cre I was
used as a scaffold to build a library of 10.sup.8 variants by
randomizing 8 residues located at the DNA-binding interface of one
I-Cre I monomer (see previous section). This library was enriched
for binders by several rounds of selection/amplification using
biotinylated DNA fragments harboring the HIV2 derived target
(HIV6335). The selected targets were subsequently screened for
binding using a phage ELISA.
Materials and Methods
Phagemid Format
[0262] A phagemid based on pCes1 (pCLS346) was chosen. This plasmid
harbored two different ORFs as a bicistron, under the control of
promoter pLac. The first one yielded a soluble protein fused to a
N-terminal signal sequence directing the product into the
periplasmic space of E. coli. In our case, this first product was a
wild-type monomer of I-CreI. The second ORF encoded an I-CreI
monomer that was fused to the phage coat protein p3 via a hexahis
tag, a C-Myc tag and an amber stop codon. In a suppressive strain
like TG1 or XL1blue, and after infection by a helper phage (e.g.
M13K07), bacteria harboring this phagemid produces phage particles
and around 1-10% of them displays the recombinant protein on their
surface. The monomer fused to p3 and randomized on the DNA-binding
interface was incorporated in the phage coat and the soluble I-CreI
monomers produced in the same compartment either dimerize or
interact with the displayed monomer, thereby producing particles
displaying I-CreI homodimers (or heterodimers if the monomer fused
to p3 was mutated).
[0263] Target Production
[0264] Two complementary primers encoding the desired sequences but
harboring an extra adenosine in 3' were annealed and ligated into
pGEM-t Easy (Promega). After sequencing, a correct clone was chosen
as template to PCR amplify a biotinylated 200 pb fragment using the
kit KOD (Novagen) and primers SP6 (TTTAGGTGACACTATAGAATAC) and
biotT7 (biot-TAATACGACTCACTATAGG). The PCR product concentration
was estimated on gel and the fragment was used as such in ELISA or
selection procedures.
[0265] Rescue of the Phagemid Library
[0266] A representative aliquot of the library (at least 10.times.
more bacteria than the library size) was used to inoculate 50 ml of
2.times.TY containing 100 .mu.g/ml ampicillin and 2% glucose
(2TYAG) and the culture was agitated at 37.degree. C. At an
OD.sub.600 of 0.5, 5 ml of this culture was infected with helper
phage K07 at a ratio phage:bacteria of 20:1 and incubated without
agitation for 30 min at 37.degree. C. After centrifugation at 4000
rpm for 10 min at room temperature (RT), the pellet was resuspended
in 25 ml of 2.times.TY containing 100 .mu.g/ml ampicillin and 25
.mu.g/ml kanamycin (2TYAK) and agitated overnight at 30.degree. C.
The culture was centrifuged at 4000 rpm for 20 min at 4.degree. C.
and phage particles were precipitated by the addition of 0.2 volume
of 20% PEG6000 /2.5M NaCl for 1 h on ice.
[0267] After centrifugation at 4000 rpm for 20 min at 4.degree. C.,
the phage pellet was resuspended in 1 ml of PBS and centrifuged at
10 00 rpm for 5 min. 0.2 volume of 20% PEG6000/2.5M NaCl was added
to the supernatant and the mix was centrifuged at 10 000 rpm to
pellet the phage particles. Particles were finally resuspended in
250 .mu.l PBS.
Selection Procedure
[0268] Phage particles were diluted in 1 ml of PBS containing 3%
dry milk and 25 mM CaCl (PMC) and incubated for 1 h at RT. 100 pI
Streptavidin beads (Dynal, 200 .mu.l for the first round) were
washed 3.times. in PMC and blocked for 1 h in the same buffer. The
biotinylated targets were added to the phage at the indicated
concentration and the mix was agitated at RT for 1 h. Beads were
added to the mix and incubated at RT for 15 min. Beads were
collected on the vial wall using a magnet and washed 10.times. in
PMC containing 0.1% tween. After a final wash in PBS, beads were
resuspended in 0.5 ml of 100 mM Triethanolamine pH 12 and incubated
for exactly 10 min. The supernatant were collected and immediately
neutralized by 0.5 ml of 1 M Tris pH8. An aliquot of this eluate
was serially diluted for titration and with 4 ml 2.times.TY. 5 ml
of exponentially growing TG1 cells were added and the mix was
incubated for 30 min at 37.degree. C. without agitation. Cells were
plated on large 2TYAG plates and incubated overnight at 30.degree.
C. Colonies were resuspended in 2TYAG, adjusted to an OD.sub.600 of
100 and kept at -80.degree. C. after addition of 15% glycerol.
Screening by Phage ELISA
[0269] Isolated colonies from selection outputs were toothpicked
into 100 .mu.l of 2TYAG in 96 well plates, and agitated overnight
at 37.degree. C. Next day, a fresh plate containing 100 .mu.l 2TYAG
was isolated using a transfer device. 50 .mu.l of sterile 60%
glycerol was added to the overnight plate and this masterplate was
stored at -80.degree. C. The fresh plate was agitated at 37.degree.
C. for 2.5 h, rescued by the addition of 2TYAG containing
2.times.10.sup.9 pfu of helper phage M13K07, incubated for 30 min
at 30.degree. C., spun at 1700 rpm for 15 min. Cells pellets were
resuspended in 150 .mu.l TYAK and agitated overnight at 30.degree.
C. After centrifugation, 20 .mu.A of supernatant was used as
described in the previous section.
--Results
Selections
[0270] Phage particles displaying I-Cre I variants were produced by
infecting bacteria harboring the phagemid library with helper phage
M13KO7. Phage particles were purified by PEG precipitation and
incubated with a biotinylated PCR fragment harboring HIV6335
target. After 1 h of incubation at room temperature,
streptavidin-coated magnetic beads were added to the solution to
retrieve the biotinylated DMA and bound phages. The beads were
extensively washed and the bound phages were eluted by pH shock.
Bacteria were infected with the eluted phages and plated on large
2.times. TYplates containing ampicillin and 2% glucose. Serial
dilutions of an aliquot of the eluted phages were used to infect
bacteria to calculate the number of phage particle and obtain
isolated colonies.
[0271] The day after, bacteria were scrapped from the large plates
and stored as glycerol stocks. An aliquot (representative of the
diversity) was used to produce a new batch of phage particles for a
second round of selection.
[0272] The stringency of the selections was increased after each
round. The first selection was done using 10 nM of biotinylated
target. The second was done with 400 pM and the washing steps were
extended. The third round was done using 250 pM and washed more
extensively.
[0273] As shown on Table 1, the first and second rounds of
selection against the HIV2 target lead to an output titer
characteristic of background values (10.sup.5 to 10.sup.6 pfu/ml).
However, a significant enrichment was measured on round 3.
TABLE-US-00001 TABLE 1 Selection titers. Selection Round Input
(pfu/ml) Output (pfu/ml) Enrichment 1 6.4 .times. 10.sup.11 1.4
.times. 10.sup.5 NA 2 4.0 .times. 10.sup.12 3.0 .times. 10.sup.6 3
3 2.8 .times. 10.sup.12 6.9 .times. 10.sup.7 33 C2H6335: selection
done on HIV2 target using the library described in the other
example. NA: non applicable. Enrichment is defined as (output n +
1/input n + 1)/(output n/input n).
Screening by Phage ELISA
[0274] 80 clones randomly picked from each output (as well as
unselected clones) were used to produce phage particles displaying
I-CreI variants in a monoclonal fashion. Supernatants containing
the phage particles were incubated on biotinylated PCR fragment
immobilized on plastic via streptavidin. Bound phages were stained
with an HRP-labeled anti p8 (major coat protein) monoclonal
antibody (Pharmacia). As shown on Table 2, no binders were detected
among the unselected clones or from the outputs of the first round
of selection. However 60% of clones picked after round 2 against
are positive against H6335 but negative on an irrelevant target
(P1234, target of homing endonuclease PI-SceI). This result is in
good agreement with the output titer. Indeed this selection only
resulted in a mild enrichment, suggesting that a large number of
clones still originate from background. As expected, a third round
of selection lead to 99% of strong binders, which explains the
large number of output phages after this third selection.
TABLE-US-00002 TABLE 2 Percentage of positive clones in a ELISA
assay directed against the I-CreI target (C1234) or the HIV2
derived target (H6335). 77 clones were assayed for each output.
Selection % positive % positive round against C1234 against P1234 0
0 0 1 0 0 2 60 0 3 99 0 Round 0: unselected library
[0275] Using phage display, new meganucleases were selected from a
large library of I-Cre I variants. Selections on biotynilated DNA
targets lead to an increase of output titers characteristic of an
enrichment for molecules capable of binding the DNA targets. This
enrichment was confirmed by phage ELISA. These results demonstrate
the efficiency of the selection and screening methods.
A Selection/Screen Experiment in Yeast to Identify Novel
Meganucleases.
Material and Methods
Bacterial and Yeast Strains
[0276] Every subcloning and plasmid preparations are performed in
XLI-blue: E. coli provided by Stratagene following standard
procedures. Experiments in S. cerevisiae are done in the following
strains:
FYC2-6A: alpha, trp1.DELTA.63, leu2.DELTA.1, his3.DELTA.200
FYBL2-7B: a, ura3.DELTA.851, trp1.DELTA.63, leu2.DELTA.1,
lys2.DELTA.202 YASP3 (derived from FYC2-6A): alpha,
ura3::SSA-ura3-HIV2-KanR, ade2::SSA-ade2-HIV2-TRP1, trp1.DELTA.63,
leu2.DELTA., his3.DELTA.200
Plasmids:
[0277] pCLS0279: ADH1 promoter, TRP1 selectable marker and ARS-CEN
origin of replication, .beta.-galactosidase SSA target, HIV2 6335
cleavage site.
[0278] pCLS0569: kanamycin resistance cassette, HIV2 6335, internal
fragment of the URA3gene.
[0279] pCLS0570: kanamycin resistance cassette, HIV2 6335, internal
fragment of the LYS2 gene.
[0280] pCLS0576: TRP1 selectable marker, HIV2 6335, internal
fragment of the ADE2 gene.
[0281] pCLS0047: Galactose inducible promoter, LEU2 selectable
marker and 2 micron origin of replication.
Results
[0282] We decided to perform an in vivo assay in yeast that allows
to screen mutagenized I-CreI protein variants with detectable
activity towards a specified target.
[0283] A library of mutated I-CreI meganucleases has been first
selected by a phage display procedure, resulting in a sub-library
enriched for variants of interest, able to bind the HIV2 6335
target. The inserts from this enriched sub-library are subcloned
into pCLS0047 under the control of a galactose-inducible promoter,
for further selection in yeast. However, we can produce the library
directly in the suitable yeast expression vector, and void the
phage display step.
[0284] We prepared a specific yeast strain (YASP3) containing two
reporter systems integrated in chromosomes. These two reporter
systems are based on recombination by Single Strand Annealing
(SSA). SSA is induced by specific cleavage of the HIV2 6335
site.
[0285] Namely, we introduced a URA3 SSA target and an ADE2 SSA
target. The URA3 SSA target was a modified ura3 gene with 2 direct
repeats of 600 base pairs separated by 4.3 kb (containing a
kanamycin resistance cassette and the HIV2 6335 cleavage site). The
strain was unable to grow on a minimal medium lacking uracile but
was resistant to G418. When this target was cleaved and recombined
properly, the yeast was able to grow on media without uracil and
was sensitive to G418.
[0286] The ADE2 SSA target was a modified ade2 gene with 2 direct
repeats of 1.1 kb separated by 3.6 kb (containing a tryptophan
selectable marker and the HIV2 6335 cleavage site). Because of this
mutated ade2 gene, the yeast strain was unable to grow on a minimal
medium lacking adenine, but harbored a red color on a medium with a
low adenine content. Because of the tryptophan selectable marker,
it was able to grow on minimal media without tryptophan. When this
target was cleaved and recombined properly, the yeast was white,
able to grow on media without adenine and unable to grow on a
minimal medium lacking tryptophan.
[0287] Basically, the recipient yeast strain was red (on low
adenine medium), G418 resistant, tryptophan prototroph and
auxotroph for uracile and adenine. If a specific meganuclease is
expressed in this strain and cleaves its target sites, the
resulting yeast clone is white, G418 sensitive, prototroph for
tryptophan and auxotroph for uracile and adenine.
[0288] The YASP3 strain was validated by determining the level of
spontaneous recombination of each target alone and of both targets
taken together. The URA3 SSA 10 target recombined spontaneously as
an uracile prototrophe, G418 sensitive at an approximate 6
10.sup.-4 rate. The ADE2 SSA target recombined spontaneously as an
adenine prototrophe at an approximate 2.7 10.sup.-3 rate.
Recombination of both markers occurred spontaneously (resulting in
uracile/adenine rototrophes) at an approximate 10.sup.-6 rate.
[0289] A pilot experiment with 1.5.times.10 in transformants showed
no background level of uracileladenine prototrophs means that the
number of false positive clones should be less than 10 after a
transformation experiment with a library that would yield about a
million of independent clones.
[0290] The library is used to transform YASP3. A classical
chemical/heat chock protocol that routinely gives 10.sup.6
independent transformants per pg of DNA was used (Gietz, R. D. and
Woods, R. A., 2002) Transformation of yeast by lithium
acetate/single-stranded carrier DNA/polyethylene glycol method
(Methods Enzymol, 350, 87-96).
[0291] Transformation of the strain with the library gives more
than 10.sup.6 independent yeast transformants from which a number
of clones are able to grow on a selective medium whiteout uracile,
leucine and containing galactose as a carbon source and a low
amount of adenine. Among those clones, the interesting ones are
white indicating that they contain a LEU2 vector allowing the
expression of a meganuclease specific for HIV2 6335 site and that
the enzyme is able to cut both URA3 and ADE2 reporters.
[0292] The positive clones are isolated and screened for their
ability to induce the specific recombination of a plasmidic SSA
.beta.-galactosidase target (pCLSO279). This plasmidic reporter was
a modified LacZ gene with 2 direct repeats of 825 base pairs
separated by 1.3 kb (containing a URA3 selectable marker and the
HIV2 6335 cleavage site). The vector (which can be selected on a
medium without tryptophan) is used to transform a yeast strain
(FYBL2-7B) and clones are maintained on minimal media 35 lacking
uracile to maintain the unrecombined LacZ target.
[0293] Yeast clones resulting from the selection experiment are
mated with the yeast strain containing the SSA .beta.-galactosidase
target. Diploids are selected and assayed for induced
.beta.-galactosidase activity. A number of clones are expected to
behave as false positives at this step. They correspond to the
background level of spontaneous recombination of the URA3 and ADE2
SSA targets. All remaining clones (uracile and adenine auxotrophes
able to induce recombination of the SSA-LacZ target) are true
positives expressing a meganuclease cleaving the HIV2 6335 target
in vivo. Also, other experiments, based on the ones described
above, can be used to determine more precisely the activity of such
novel enzymes.
Example 3
Use of Meganuclease for Antiviral Therapy
--Experimental Procedures
Cells
[0294] COS-7 cell lines from the american Type culture collection
(ATCC) were cultured in DMEM plus 10% fetal bovine serum. PC-12
cells from ATCC were grown in RPMI1640 supplemented with 10%
heat-inactivated horse serum and 5% heat-inactivated fetal bovine
serum. PC-12 cells were differentiated as previously described (Su
et al., 1999, Journal of Virology, 4171-4180). Briefly, cells were
seeded on 6 well-plate at 5 10.sup.4 cells per well. The following
day, cells were incubated in PC-12 medium containing 100 ng/ml of
2.5S NGF (Invitrogen). Medium was changed every three days. After 7
days of incubation, undifferentiated cells were eliminated by
adding 2 .mu.M of fluorodeoxyuridine (FdUrd).
Construction of Recombinant HSV-1
[0295] HSV-1 was purchased from ATCC. Viruses were propagated on
COS-7 cells at low MOI (0.01 PFU/cell). Recombinant virus (rHSV-1)
were generated as previously described (Lachmann, R. H.,
Efstathiou, S., 1997, Journal of Virology, 3197-3207). A 4.6 Kb
pstI-bamHI viral genomic DNA fragment was cloned in pUC 19. Based
on HSV-1 sequence from data base (ID: NC 001806), this region
represents nucleotides 118867 to 123460. A cassette consisting of a
CMV promoter driving Lac gene expression was introduced into a168
bp HpaI deletion. This region is located within the major LAT locus
of HSV-1. I-Sce I cleavage site was finally cloned directly after
the CMV promoter. This construct was used to generate recombinant
viruses. Plasmid was linearized by XmnI digestion, and 2 .mu.g of
this plasmid DNA was cotransfected with 15 .mu.g of HSV-1 genomic
DNA prepared from COS-7 infected cells by CaCl.sub.2 method. After
3 or 4 days, infected cells were harvested and sonicated. Aliquot
of the lysed cells were used to infect COS monolayer. Virus
recombinant were selected by overlaying COS monolayer with 1%
agarose in medium containing 300 .mu.g/ml of X-Gal
(5-bromo-4-chloro-3-indolyl-.beta.-D-galactopyranoside). Blue
clones were picked and further subjected to three round of plaque
purification. Presence of the I-Sce I site was confirmed by PCR and
in vitro I Sce-I enzymatic digestion.
Viral Inhibition
[0296] 6 well-plate were seeded with 2.10.sup.4 cells per well. The
next day COS-7 cells were transfected with 0.5 .mu.g of plasmid
expressing ISce-I or containing the ISce-I ORF in the opposite
orientation by the EFFECTENE method according to the manufacturer
protocol. We achieved routinely in our laboratory 60 to 70%
efficiency using this methodology. Fourty eight hours later,
subconfluent transfected cells were infected with rHSV-1. For
infection, rHSV-1 was diluted in PBS containing 1% fetal bovine
serum and adsorbed onto cells for 20-40 min at 37.degree., in
humidified incubator with 5% CO2. 6 wells-plates were infected at
30 or 300 PFU per well for respectively viral inhibition or cells
survival experiments. Cells were harvested at day 1, 2, and 3 and
.beta.-galactosidase activity was assayed and DNA extracted.
[0297] .beta.-Galactosidase Activity
[0298] Cell monolayer was fixed in 0.5% glutaraldehyde in 100 mM
PBS containing 1 mM MgCl.sub.2 at 4.degree. for 10 minutes. After
one wash with detergent solution (100 mM PBS, 1 mM MgCl.sub.2,
0.02% Nonidet p-40) cells were incubated at 37.degree. in X-Gal
stain solution (10 mM PBS, 1 mM MgCl.sub.2, 150 mM NaCl, 33 mM
K.sub.4Fe(CN).sub.6.3H.sub.2O, 33 mM K.sub.3Fe(CN).sub.6, 0.1%
X-Gal) until color development. Beta-galactosidase activity was
also measured on cell extract with
o-nitrophenyl-.beta.-D-galactopyrannoside (ONPG) as substrate. Cell
monolayer was washed once with PBS. Cells were then lysed with 10
mM Tris ph 7.5, 150 mM NaCl, 1% Triton X-100, protease inhibitors.
After 30 minutes incubation on ice cell lysate was centrifuged and
.beta.-galactosidase was assayed. Typically 30 .mu.l of supernatant
was combined with 270 .mu.l of reaction buffer (10 mM PBS; ph 7.5,
1 mM MgCl.sub.2, 0.3% .beta.-mercaptoethanol) containing 800
.mu.g/ml ONPG. The reaction was carried out at 37.degree. and
stopped with 0.5 ml of 1M NaCO.sub.3. Optical density was measured
at 415 nm. Beta-galactosidase activity is calculated as relative
unit normalized for protein concentration and incubation time.
Semi-Quantitative PCR
[0299] To measure viral replication of rHSV-1, oligonucleotides
were designed to amplify a 217 bp fragment from Lac gene. The
standard DNA used in this assay was generated by cloning this
fragment in a Bluescript plasmid, and by inserting a 50 bp fragment
downstream to the 5' oligonucleotide. PCR of the standard produced
267 bp amplicon. Series of PCR (not shown) were carried out to fix
the amount of standard and DNA sample, and the number of cycles to
achieve linear response of the amplification. The basic
semi-quantitative PCR were carried out in a total volume of 30
.mu.l, using the READYMIX.TM. TAQ (Sigma) with 20 pmols of each
primers and 180 pg of DNA. The tubes were heated for 4 min at
94.degree. and subjected to 22 cycles: 94.degree. for 1 min,
62.degree. for 50 sec, 72.degree. for 2 min, and 72.degree. for 7
min.
Virus Titration
[0300] In one series of experiments, the culture medium was
collected every day at days 1, 2, 3, and 4, and fresh medium was
added. In the other, the medium was not changed during experiment
and aliquots were collected every day. To monitor for the release
of HSV-1 progeny, aliquot of medium were titred on COS-7 cells by
standard plaque assay.
--Results
[0301] The effect of I-Sce I on viral replication was examined
using a recombinant Herpes simplex virus carrying a I-Sce I
restriction site (rHSV-1). For convenience, rHSV-1 was build with a
cassette containing CMV promoter driving the Lac gene. I-Sce I site
was inserted at the junction of the CMV promoter and Lac gene. The
expression cassette was cloned by homologous recombination in the
major LAT locus which allowed Beta-galactosidase (.beta.-gal)
expression during lytic infection in COS-7 cell monolayer.
Strinkingly transfection of I-Sce I expression vector before viral
infection virtually completely inhibited HSV-1 plaque formation in
COS cells (FIG. 5) as shown by X-Gal coloration. In contrast,
control transfection with expression vector containing I-Sce I open
reading frame in the reverse orientation which did not allow any
functional transcript, did not affect viral replication.
Furthermore, 48 hours after infection, the cells were checked for
I-Sce I expression. All the lysis plaques formed in cells monolayer
transfected with I-Sce I expression vector represented cells which
did not expressed I-Sce I (the transient transfection is about 70%
efficient). However, cells expressing I-Sce I surrounding the lysis
plaque inhibited the viral propagation. The I-Sce I effect was
confirmed by measuring the .beta.-galactosidase activity in a cell
lysate. After infection of COS-7 cells monolayer transiently
expressing I-Sce I with 30 Pfu per well cell monolayer was
collected at day 1, 2, and 3 post infection and .beta.-gal was
assayed. FIG. 6A shows a drastic decrease of the
.beta.-galactosidase activity reflecting the inhibition of rHSV-1
replication. The protective effect of I-Sce I over a time course of
rHSV-1 infection was evaluated next. At 3 days after infection,
cells transfected with I-Sce I expressing vector shown no sign of
cytopathic effect whereas control cultures were completely lysed as
shown in FIG. 6B. In an effort to quantify the degree of inhibition
of viral DNA replication by I-Sce I, we have set-up a
semi-quantitative PCR. Genomic DNA was extracted from cells at day
1, 2, and 3 after infection. PCR was carried out with primers a and
b (FIG. 7A) generating a 217 bp amplicon in Lac gene. An internal
standard was added in sample before PCR to quantify DNA. Lac gene
was virtually not detectable in I-Sce I expressing cells at 3 days
post-infection (FIG. 7A). In contrast cells that did not received
I-Sce I expression vector shown high levels of virus DNA. This
result was confirmed by PCR using primers in viral endogenous gene
(FIG. 7B). Amplification of Thymidine Kinase (TK) gene shown that
I-Sce I inhibited the viral replication. Finally COS-7 cells
expressing active I-Sce I or I-Sce I ORF in the reverse orientation
were infected with rHSV-1 and the concentration of virus released
in the medium at different time points was measured by plaque assay
(FIG. 8). Viruses were quantified in a rough array at day one when
I-Sce I was produced. Viruses production was still markedly
decreased two days after the infection when compared with cells
which did not expressed I-Sce I showing that I-Sce I effectively
inhibited viral replication. This effect was still observed at day
three although in a lesser extent. Probably the high mutation rate
occurring during viral replication allowed emergence of mutant
HSV-1 which were able to escape the I-Sce I activity.
[0302] Taking together, these results demonstrates that I-Sce I and
more generally meganucleases can be used to inhibit viral
infection. The use of custom-made meganuclease or combination of
custom-made meganucleases designed to cut specific viral sequences
could represent a powerful new strategy in the antiviral
therapy.
Example 4
Meganuclease with Altered Binding Properties Derived from I-CreI
Homing Endonuclease
[0303] The purpose of this experiment was to obtain novel
meganucleases binding target sites close to the I-CreI natural
target site. A series of 6 targets were used (FIG. 9), including
the wild-type natural I-CreI target (named C1234), the HIV2 target
described in example 2 (named here H1234), and four additional
targets. These four additional targets are 24 bp palindromes
corresponding to inverted repeats of a 12 bp half I-CreI or HIV2
target site: C1221 and C4334 are inverted repeats of the first half
and second half, respectively, of the C1234 target; H1221 and H4334
are inverted repeats of the first half and second half,
respectively, of the H1234 target. In contrast with example 2, the
method used here did not involve any selection step, but was based
on the extensive screening of the Lib2 library (see example 2).
Three residues (Q44, R68 and R70) capable of base specific
interactions with the DNA target were selected. The combinatorial
library was obtained by replacing the three corresponding codons
with a unique degenerated VVK codon. Eventually, mutants in the
protein library corresponded to independant combinations of any of
the 12 amino acids encoded by the VVK codon (ADEGHKNPQRST) at three
residue positions. In consequence, the maximal (theoretical)
diversity of the protein library was 12.sup.3 or 1728.
Materials and Methods
Construction of a Phage-Displayed Library of I-CreI Variants.
[0304] First, residue D75, which is shielded from solvent by R68
and R70, was mutated to N (Asn) in order to remove the likely
energetic strain caused by replacements of those two basic residues
in the library. Homodimers of mutant D75N (purified from E. coli
cells wherein it was over-expressed using a pET expression vector)
were shown to cleave the I-CreI homing site. A phagemid vector was
then engineered that encodes the D75N mutant (FIG. 2C:
<<Template>>) fused to the phage coat protein p3 and
phage-displayed D75N monomers were shown to bind the I-CreI natural
DNA target (C 1234 on FIG. 9).
[0305] Then, DNA fragments carrying combinations of the desired
mutations were obtained by PCR (several reactions in 50 .mu.l),
using degenerated primers (FIG. 2D: UlibIIfor, UlibIIrev) and as
DNA template, the D75N gene. Lib2 was constructed by ligation of
the corresponding PCR products, digested with specific restriction
enzymes, into the D75N mutant gene, within the phagemid vector, as
described in example 2.
Screening of Meganucleases Binding to the 6 Different Targets
[0306] Screening was performed by Phage ELISA, as described in
example 2.
--Results
[0307] 4560 clones (more than 2.5 times the theoretical mutant
library diversity) were individually picked and screened by phage
ELISA with the 6 different targets. 28 positives (clones binding
one of the six targets) were identified. For validation, these 28
clones were re-assayed by phage ELISA, 8 times in parallel with the
6 different targets; 20 clones were thus confirmed as true
positives. Finally, all 28 clones were sequenced.
TABLE-US-00003 TABLE 3 Sequence of the proteins found in the four
different classes. Only amino acids from position 44, 68 and 70 are
indicated. Clones found twice are labeled with (2). Class I Class
II Class III Class IV Q R K (NTQH) N Q R T (2) Unknown Q R R Q R N
(RG) (ED) sequence H (KEQ) E Q R A Q Q K (2) Q S R Q N K Q T R (2)
Q Q R Q H K D S H Unknown sequence
[0308] Four different patterns (ELISA results) could be observed.
FIG. 10 features one representative example for each one. The first
class (Class I) corresponds to a strong binding of C1234, C1221,
C4334 and H4334. The wild-type protein (QRR) was recovered in this
class, showing that Class I profile is the regular binding profile
of the original scaffold. Two variants were also shown to display
such binding (QRK and another yet not completely identified
mutant).
[0309] Variants from the second class have lowered their affinity
for all targets, but H4334, since no binding was observed with
C1234, C1221 and C4334. Eight different proteins were found to
belong to this class, plus a protein which sequence could not be
determined. Among the sequence variants of Class II, five retain
the Q44 amino acid from the wild-type sequence, and one of the two
arginines in position 68 or 70. However, in one mutant (DSH), none
of the amino acids from position 44, 68 and 70 has been retained.
Class III (4 different proteins) has a more complex pattern, as it
retains apparent binding for the C1221 and H4334 target. Finally,
one protein (Class IV) retains only a slight binding for target
C1221 as none of the other targets are bound anymore.
[0310] It is difficult to draw conclusions from Class IV, since the
residual binding with C1221 is very low, and sequencing of the
unique Class IV mutant has failed. However, comparison of Class II
and III with the wild-type profile of Class I clearly shows that
the binding specificity has been altered.
[0311] The conclusion is that even from small libraries such as
Lib2 (complexity 1.7 10.sup.3), variants with altered binding
profiles can be isolated, as shown in FIG. 10. Therefore,
strategies based on screening, starting with larger mutant
libraries, should allow the identification of more dramatic
alterations, for instance binding for targets that were not bound
by the initial protein scaffold. In addition, this approach leads
to the identification of many different proteins for each profile.
An extensive study of this kind should also bring the basis of a
better understanding of DNA/meganuclease interactions.
Example 5
Meganuclease-Induced Recombination of an Extrachromosomal Reporter
in Toto Using I-Sce I Expressing Plasmid
A-Optimization of the Reporter System
--Experimental Procedures
Vectors Construction
[0312] The target vectors are based on a LagoZ expression vector
driven by promoter of the human EF1-alpha gene. This promoter has
been shown previously to have wide expression spectrum in vivo
(Kim, D. W., Uetsuki, T., Kaziro, Y., Yamaguchi, N., Sugano, S,
1990, Gene, 91, 217-223). The promoter region includes splice donor
and acceptor sites in the 5' untranslated region of the h-EF1-alpha
gene-LagoZ is a CpG island depleted LacZ gene designed to abolish
gene silencing in transgenic mice (Henry I, Forlani S, Vaillant S,
Muschler J, Choulika A, Nicolas J F, 1999, C R Acad Sci III. 322,
1061-70). To construct target vectors with different lengths of
homology, the 3' fragment of the LagoZ gene was first deleted
(about 2000 bp) and replaced by the I-Sce I cleavage site. The 3'
fragments of different lengths were generated by digestion of the
parental plasmid. These fragments contained different amounts of
homology with the 5' fragment of the LagoZ gene. Finally these DNA
fragments were individually cloned adjacent to the I-SceI cleavage
site, creating different target vectors with 0, 70, 220, 570, and
1200 bp of homology, respectively.
Cell Culture
[0313] COS-7 and CHO-K1 cell lines from the American Type Culture
Collection (ATCC) were cultured in DMEM or Ham's F12K medium
respectively plus 10% fetal bovine serum. For I-Sce I induced
Single Strand annealing (SSA) assays, cells were seeded in 12
well-plates at a 1510.sup.3 cells per well one day prior
transfection. Transient transfection was carried out the following
day with 500 ng of DNA using the EFFECTENE transfection kit
(Qiagen). Equimolar amounts of target plasmid and I--SceI
expression vector were used. The next day, medium was replaced and
cells were incubated for an other 72 hours.
.beta.-Galactosidase Activity
[0314] Cell monolayers were fixed in 0.5% glutaraldehyde in 100 mM
PBS containing 1 mM MgCl.sub.2 at 4.degree. for 10 minutes. After
one wash with detergent solution (100 mM PBS, 1 mM MgCl.sub.2,
0.02% Nonidet p-40) cells were incubated at 37.degree. in X-Gal
stain solution (10 mM PBS, 1 mM MgCl.sub.2, 150 mM NaCl, 33 mM
K.sub.4Fe(CN).sub.6.3H.sub.2O, 33 mM K.sub.3Fe(CN).sub.6, 0.1%
X-Gal) until color development. Beta-galactosidase activity was
also measured in cell extracts with
o-nitrophenyl-.beta.-D-galactopyrannoside (ONPG) as a substrate.
Cell monolayers were washed once with PBS. Cells were then lysed
with 10 mM Tris pH 7.5, 150 mM NaCl, 1% Triton X-100, protease
inhibitors. After 30 minutes incubation on ice, cells lysates were
centrifuged and .beta.-galactosidase was assayed. Typically 30
.mu.l of supernatant was combined with 270 .mu.l of reaction buffer
(10 mM PBS; pH 7.5, 1 mM MgCl.sub.2, 0.3% .beta.-mercaptoethanol)
containing 800 .mu.g/ml ONPG. The reaction was carried out at
37.degree. and stopped with 0.5 ml of 1M NaCO.sub.3. Optical
density was measured at 415 nm. Beta-galactosidase activity is
calculated as relative unit normalized for protein concentration
and incubation time.
--Results
[0315] When a DNA double-strand break (DSB) is introduced between
two repeated sequences, it induces homologous recombination
resulting in a deletion of the repeats, together with all the
intervening sequences. The recombination pathway is often referred
to as the single-strand annealing (SSA) pathway. A reporter system
was designed to monitor meganuclease-induced SSA in animal models
in toto. In order to optimize the reporter system, the correlation
between meganuclease-induced SSA efficiency and repeat length was
first examined. Different target vectors carrying a LagoZ gene
containing duplications of various sizes were constructed (FIG.
11). The presence of the duplication and of the I-SceI cleavage
site inactivates the gene. The repair of the LagoZ gene by SSA
results in the loss of one repeat and of the cleavage site, and in
the restoration of a functional LagoZ gene. LagoZ codes for the
.beta.-galactosidase enzyme which can be detected by colorimetry.
Transient transfection with equimolar amounts of target vector and
I-SceI expression vector or expression vector that doesn't express
the meganuclease were carried out in CHO or COS-7 cells. The
results obtained with the different constructs are presented in
FIG. 12. I-SceI induced DSBs clearly stimulate the SSA repair
mechanism. Furthermore, homology of 70 bp was sufficient to achieve
nearly maximum efficiencies of induced SSA, while the level of
spontaneous recombination (without I-SceI induced DSB) was minimal.
With duplication of 220 bp maximum efficiency was achieved while no
additional gains in SSA efficiency were observed with longer
duplications. Similar results were obtained with COS-7 cells (data
not shown). 70 and 220 bp of homology gave the best ratio of
activity vs background. Because .beta.-galactosidase is assayed in
cell lysates and one single cell can contain several copies of the
target plasmid, it is impossible to evaluate the absolute SSA
efficiency by this method. Therefore direct coloration of the
cellular monolayer was performed 72 hours post-transfection (FIG.
13). Virtually no blue cells were detected in the absence of the
meganuclease (FIG. 13A). In contrast, many
.beta.-galactosidase-positive cells are present when I-SceI is
cotransfected with the target vector, demonstrating the stimulation
of homologous recombination by meganuclease induced DSB. The
efficiency of I-SceI induced SSA was calculated by counting the
blue cells (cells where recombination has taken place) and
comparing it with the number of transfected cells (cells that
effectively received DNA). FIG. 13B shows that 50 to 60% of the
cells undergo homologous recombination when I-SceI is present along
with the target vector carrying 70 or 220 bp duplications while
spontaneous recombination represents less than 0.1% of the events.
Thus, the construct with the 70 bp and 220 bp of homology as well
as the transgene were selected for the animal study.
4B. Meganuclease-Induced Recombination of an Extrachromosomal
Reporter in Toto
[0316] --Experimental procedures
Hydrodynamic-Based Transfection In Vivo
[0317] Transduction of the mouse liver cells was performed by
hydrodynamic tail vein injections as previously described (Zhang,
G., Budker, V., Wolff, A., 1999, Human Gene Therapy, 10, 1735-1737;
Liu, F., Song, Y. K., Liu, D., 1999, Gene Therapy, 6, 1258-1266).
This method allows efficient transduction and expression of
exogenous genes in animals by administration of plasmid DNA by tail
vein injection. Briefly, DNA is mixed in 1.5 to 2 ml of PBS, which
represents 10% of the animal's weight. Tail vein injections are
subsequently performed with a 26-gauge needle over a 5-10 sec
period using sterile materials and working conditions. Using such a
protocol, almost exclusively liver cells are transduced, thus the
I-SceI-mediated SSA event leading to the correction of the LagoZ
gene was studied in the liver. The I-SceI expressing vector used is
the pCLS 197 corresponding to the I-SceI-coding sequences (U.S.
Pat. No. 5,474,896) under the control of the CMV promoter in a pUC
backbone and is 5737 bp long.
[0318] OF1 mice weighing fifteen to twenty grams were obtained from
Charles River Laboratories, France. A total of twenty micrograms of
DNA, containing equal amounts of target vector and either an I-SceI
expression or control vector, was injected into mouse tail veins.
The target vector contains the LagoZ gene interrupted by an I--SceI
cleavage site flanked by direct repeat sequences containing 70 bp
of homology. Control mice were injected with a mixture of the
target vector and a plasmid that does not express I-SceI.
.beta.-Galactosidase Activity
[0319] Three days after injection, mice were euthanized by cervical
dislocation and X-Gal stainings of their livers were performed.
Livers were dissected out of the animals in cold 1.times.PBS and
the lobes were cut in pieces of about one fourth a centimeter in
order to allow a better access of the X-Gal in the tissue. Then
liver pieces were placed in fresh cold PBS 1.times. in a 12-well
cell culture plate kept on ice, and fixed in 4% paraformaldehyde
for 1 hour under agitation at 4.degree. C. Samples were then washed
3 times at room temperature for 30 minutes with wash buffer (100 mM
sodium phosphate pH=7.3, 2 mM MgCl.sub.2, 0.01% sodium
deoxycholate, 0.02% NP-40 by volume). In toto X-Gal staining was
performed overnight at 37.degree. C. in staining solution (5 mM
potassium ferricyanide, 5 mM potassium ferrocyanide, 1 mg/ml X-gal,
20 mM Tris pH=7.3 in wash buffer). Finally samples were washed
extensively with PBS and examined under microscope. Pictures were
taken with a Nikon Coolpix camera under a Nikon SMZ 1500
binocular.
--Results
[0320] Cellular study has shown that homology of 70 bp is
sufficient to achieve nearly maximal efficiencies of DSB induced
SSA, while the level of spontaneous recombination (without I-SceI
induced DSB) is minimal. Thus, in a first attempt to stimulate
recombination in vivo, transient experiments were performed. A
mixture of the target vector (30 .mu.g) and either the I-SceI
expression or control plasmid (10 .mu.g) were introduced into the
liver via a hydrodynamic tail vein injection method. FIG. 14 shows
a magnified picture of liver collected and stained 3 days after
injection. Blue dots represent cells where a defective LagoZ gene,
bearing an I-SceI site flanked by a 70 bp duplication, was
repaired. After meganuclease induced DSB, the SSA pathway results
in the deletion of one repeat and reconstitution of a functional
gene. Active .beta.-galactosidase encoded by the LagoZ gene can
then be detected by X-Gal stainings. Furthermore, no gene
correction was detected in the absence of the meganuclease
expression vector. These data represent the first evidence that
meganuclease induced recombination can be stimulated in liver and
that in toto repair of an extrachromosomal target can be
achieved.
Example 6
Meganuclease-Induced Recombination of a Chromosomal Reporter in
Toto Using I-Sce I Expressing Adenovirus
[0321] In order to demonstrate meganuclease-induced genomic surgery
of a chromosomal reporter in toto in different mice tissues, the
repair of the lagoZ gene in toto was tested by transducing cells of
several organs with an I-SceI-expressing adenovirus,
<<Ad.I-SceI>>. Control transgenic littermates were
infected with a non-I-SceI-expressing adenovirus,
<<Ad.control>>. Adenovirus infections in transgenic
mice were performed by intravenous (IV) injections. Repair of the
lagoZ gene in toto in several tissues was then tested by two
methods that detect .beta.-galactosidase activity in toto: X-gal
staining and FDG assays.
--Experimental Procedures
Transgenic Mice
[0322] The transgene used for the generation of transgenic founders
was a BglII/NotI fragment of 5919 bp carrying the defective LagoZ
gene, inactivated by a LagoZ duplication of 70 bp or 220 bp and the
I-SceI cleavage site, under the control of the human elongation
factor 1 alpha promoter (See FIG. 11).
[0323] Transgenic founder were generated by classical transgenesis,
i.e. by microinjecting the linear and purified BglII/NotI fragment
described above at 500 copies/picolitres into the male pronuclei of
fertilized ova at the one-cell stage derived from the mating of
B6D2F1 males and females purchased from Elevage Janvier.
Microinjections were performed under a Nikon TE2000 microscope with
Normarski DIC with eppendorf transferMan NK2 micromanipulators and
eppendorf Femtojet 5247 micro-injector. After injections, ova were
transferred to surrogate pseudopregnant B6CBAF1/J females (Elevage
Janvier) for development and delivery. Transgenic mice generated by
this procedure were identified by PCR and Southern Blot analysis on
genomic DNA extracted from tail biopsies of F0 mice. The molecular
characterization of the transgene integration was done by PCR and
Southern Blot analysis.
[0324] Then the founder were mated to B6D2F1 mice in order to
obtain hemizygote transgenic F1 animal. Expression of the transgene
was tested by performing an RT-PCR experiment on RNAs extracted
from a tail biopsy from a transgenic F1 animal using Qiagen RNeasy
kit (cat No 74124). Hemizygote F1 mice were then mated to B6D2F1
mice in order to establish an F2 hemizygote transgenic strain.
[0325] Two independent strains were used bearing either 220 bp or
70 bp long lagoZ gene repeated sequences. These transgenic strains
are referred as strain <<361>> and <<58A>>,
respectively. The molecular characterization of the transgene
integration showed that the integration is about 5 direct repeats
of the BglII/NotI transgene in <<361>> and 2 inverted
repeats plus 5 direct repeats in <<58A>>. Hemizygote
mice were identified by tail biopsies, genomic DNA extraction and
PCR analysis. <<361>> and <<58A>>
hemizygote mice were then used for in toto I-SceI mediated-lagoZ
gene repair and transgenic littermates were used as negative
controls.
Adenovirus-Based Transduction in Toto
[0326] Recombinant type V adenovirus bearing the I-SceI
meganuclease coding region under the control of a CMV promoter,
<<Ad.I-SceI>> was provided by Q BIO gene company at
1.58 10.sup.11 infectious units concentration scored by the
TCID.sub.50 method. The negative adenovirus control <<Ad
control>> was as well provided by Q BIO gene company at 3.76
10.sup.11 infectious units concentration. Recombinant type V
adenovirus infections were performed by intravenous (IV) injections
in transgenic mice tail veins. Transgenic mice were weighed and
anesthetized before infections by intraperitoneal injection of a
mixture of Xylasin (100 mg/kg) and Ketamine (10 mg/kg). IV
infections were performed with 10.sup.10 infectious units/animal in
a volume of 400 .mu.l. Infections were performed in 4 to 7
weeks-old transgenic mice. Adenovirus-infected mice and uninfected
control littermates were bred in isolator until sacrificed for
.beta.-galactosidase assays.
.beta.-Galactosidase Activity
[0327] Adenovirus-infected mice were sacrificed by CO.sub.2
inhalation from 5 to 14 days-post-infections (dpi) and their organs
were processed for .beta.-galactosidase assays. About 10% of the
liver (8 mm.sup.3) was employed for protein extraction and the
remaining 90% was used for .beta.-galactosidase in toto X-gal
assays (protocol described previously).
[0328] Fluorescent .beta.-galactosidase assays were incubated at
37.degree. C. in 96 well plate. The assays were performed in a
total volume of 100 .mu.l containing 30 .mu.l of protein extract, 1
.mu.M Fluorescein digalactoside (FDG, Sigma), 0.1%
.beta.-mercaptoethanol, 1 mM MgCl.sub.2, and 100 mM Phosphate
buffer, pH 7.0. The plates were scanned on the Fluoroskan Ascent
(Labsystem) at 5-minutes intervals. The .beta.-galactosidase
activity is calculated as relative unit normalized for protein
concentration and incubation time.
--Results
[0329] Two <<58A>> transgenic mice were IV-injected
with 10.sup.10 infectious units of <<Ad.I-SceI>>
adenovirus in order to target a DSB in-between the 70 bp duplicated
lagoZ sequences and induce the repair of the reporter gene. At
various times post-injection the mice were sacrificed and several
organs were dissected and analyzed by in toto X-gal assays. Blue
staining was detected as dispersed cells over the entire liver of
infected mouse euthanized at 5 dpi (FIG. 15A). No staining could be
detected in the other organs tested, i.e. kidneys, spleen, heart
and lungs. Two <<58A>> transgenic mouse littermates
were used as controls, one IV-injected with 10.sup.10 infectious
units of the control adenovirus <<Ad.control>> and the
other uninfected. No .beta.-galactosidase activity could be
detected in the liver of either control (data not shown). Similar
results were obtained with two <<361>> transgenic mice
injected with 10.sup.9 and 10.sup.10 infectious units of the
Ad.I-SceI adenovirus (FIGS. 15B and 15C respectively). These
results were confirmed by measuring the .beta.-galactosidase
activity in liver extract (FIG. 16). A high activity was detected
in liver of mice injected with Adenovirus expressing I-SceI
(Ad.1Sce-I). In contrast, Non-injected mice (NI) shows only a
residual background activity similar to the activity detected in
mice injected with the control adenovirus (Ad.control).
[0330] The IV-injected mouse with 10.sup.10 infectious units of
<<Ad.1-SceI>> adenovirus exhibited more stained liver
cells and more .beta.-galactosidase activity than the IV-injected
mouse with 10.sup.9 infectious units of <<Ad.1-SceI>>
adenovirus. These results suggest that I-SceI-induced recombination
could be dose dependent and that a better yield of I-SceI induced
recombination could be obtained by increasing the
injected-adenovirus titer. Thus, the detection of I-SceI-induced
genome surgery in other organs reported to be less sensitive to
type V adenovirus infection should be feasible.
[0331] Taken together, these data strongly suggest that the
reporter gene repair was induced by the activity of the I-SceI
meganuclease. This result is the first evidence that I-SceI and
more generally the meganucleases can be used in toto to induce
efficient site-specific homologous recombination leading to the
repair of a chromosomal gene. Thus, these results open applications
in the field of gene therapy in mammals.
Example 7
Meganuclease-Induced Correction of a Mutated Human ApoAI Gene in
Toto
[0332] Gene correction would be the safest methodology of gene
therapy. Indeed homologous recombination allows precise
modification of chromosomal locus and has been widely used in cell
culture. Unfortunately its efficiency is extremely low and cannot
be envisioned, as it is, as a therapeutic tool. However this
mechanism has been shown to be enhanced by double strand break
(DSB) in the genomic target. So far, in vertebrates, the use of
this technology has been limited to cell applications. This is the
report for the first time of the use of DSB inducted gene
conversion in mammal in toto by direct injection of a mixture of
meganuclease expression cassette and DNA repair matrix in the blood
stream.
[0333] The system is based on the repair of a human Apo A-I
transgene in mice in tow. The apolipoprotein A-I (APO A-I) is the
main protein constituent of high density lipoprotein (HDL) and
plays an important role in HDL metabolism. High density
lipoproteins have a major cardio-protective role as the principal
mediator of the reverse cholesterol transport. The Apo A-I gene is
expressed in the liver and the protein is secreted in the blood.
Moreover, Apo A-I deficiency in human leads to premature coronary
heart disease. All together, these criteria make Apo A-I gene a
good candidate for the study of meganuclease-induced gene
correction.
--Experimental Procedures
Transgene
[0334] The genomic sequence coding for the human Apo A-I gene was
used to construct the transgene. Expression of the Apo A-I gene is
driven by its own minimal promotor (328 bp) that has been shown to
be sufficient to promote transgene expression in the liver (Walsh
et al., J. Biol. Chem., 1989, 264, 6488-6494). Briefly, human Apo
A-I gene was obtained by PCR on human liver genomic DNA (Clontech)
and cloned in plasmide pUC19. The I-SceI site, containing two stop
codons, was inserted by PCR at the beginning of exon 4 (FIG. 17).
The resulting mutated gene (1-SceI-hApo A-I) encodes a truncated
form of the native human APO A-I (80 residues vs. 267 amino-acids
for the wild type APO A-I). All the constructs were sequenced and
checked against the human Apo A-I gene sequence.
Generation of Transgenic Mice
[0335] The EcoRI/XbaI genomic DNA fragment carrying the mutated
human Apo A-I gene was used for the generation of transgenic
founders. Microinjections were done into fertilized oocytes from
breeding of knock out males for the mouse apo a-I gene (WT KO mice)
(The Jackson Laboratory, #002055) and B6SJLF1 females (Janvier).
Transgenic founder mice (F0) were identified by PCR and Southern
blot analysis on genomic DNA extracted from tail. F0 were then
mated to WT KO mice in order to derive I-SceI-hApo A-I transgenic
lines in knock out genetic background for the endogenous murine apo
a-I gene. A total of seven independent transgenic lines were
studied. The molecular characterization of transgene integration
was done by Southern blot experiments.
[0336] Analysis of transgene expression in each transgenic line was
performed by RT-PCR on total RNA extracted from the liver (Trizol
Reagent, Invitrogen). In order to avoid cross reaction with the
murine transcript, we used primers specific for the human
transgenic I-SceI-hApo A-I cDNA (oligonucleotides E and F, FIG.
17). Actin primers were used as an internal control.
Hydrodynamic-Based Transduction in Toto
[0337] Transduction of transgenic mouse liver cells in toto was
performed by hydrodynamic tail vein injection as previously
described (Zhang et al., 1999, Human Gene Therapy, 10, 1735-1737).
10 to 20 g animals were injected with circular plasmid DNA in a
volume of one tenth their weight in PBS in less than 10 seconds. We
used a mixture of 20 or 50 .mu.g of a plasmid coding for I-SceI
under the control of the CMV promoter and the same amount of a
plasmid carrying the DNA repair matrix (2 kbp or 1.5 kbp as
depicted in FIG. 17). We also used 20 or 50 .mu.g of a plasmid
carrying the I-SceI expression cassette and the 2 kbp DNA repair
matrix in the same vector.
Analysis of Gene Correction
[0338] The correction of the transgene in mice after injection of
the I-SceI expression cassette and DNA repair matrix was analyzed
by nested PCR on total liver RNA reverse transcribed using random
hexamers. In order to detect the corrected gene, but not the
uncorrected, we used primers sets that specifically amplified the
repaired transgene. The specificity was achieved by using reverse
oligonucleotides spanning the I-SceI site, forward being located
outside the repair matrix (oligonucleotides G and H in the first
PCR and E and I in the nested one, FIG. 17). Actin primers were
used as an internal control.
--Results
[0339] Seven transgenic lines carrying one or several copies of the
I-SceI-hapo A-I transgene were used in these experiments. Table 4
summarized the molecular characterization and the expression of the
transgene in each transgenic line.
TABLE-US-00004 TABLE 4 Molecular characterization of transgene
integration and level of expression in the liver. copy lines
integration number expression 14A direct repeat ~5-10 ++ 14B single
1 + 21 direct repeat .ltoreq.5 + 49 direct repeat .ltoreq.5 +/- 50
single 1 +/- 66 single 1 + 95 single 1 +
[0340] Because transgene expression was very low in lines 49 and 50
further analyses were done on the five other lines. In these
experiments, mice were injected with either a mixture of
I-SceI-expressing vector and DNA repair matrix or with a vector
carrying both I-SceI-expressing cassette and the DNA repair matrix.
The repair of the mutated human Apo A-I gene was monitored by
RT-PCR on total liver RNA (FIG. 18) using primers specifically
designed to pair only with the corrected human Apo A-I gene (FIG.
17). As a control, RT-PCR was performed on non-injected transgenic
mice or injected with I-SceI expressing vector alone or the DNA
repair matrix alone. No gene correction could be detected with
these experimental conditions. Furthermore, wild type mice injected
with either a mixture of I-SceI-expressing vector and DNA repair
matrix or with a vector carrying both I-SceI-expressing cassette
and the DNA repair matrix did not reveal any PCR-amplified DNA
fragment. In contrast, PCR fragments were specifically visualized
in transgenic mice where I-SceI-expressing cassette and the DNA
repair matrix were injected (FIG. 18). The gene correction was
detectable in all the transgenic lines tested containing one or
several copies of the transgene (Table 5).
TABLE-US-00005 TABLE 5 RT-PCR analysis of transgene correction
after I-SceI expression vector and repair matrix injections (IV) in
mice. IV I-SceI/ I-SceI/ I-SceI- I-SceI RM A RM B Line RM A RM B RM
A Total alone alone alone NI 14A 3/3 2/2 6/6 11/11 0/2 0/1 0/2 0/6
100% 14B 4/4 0/1 1/3 5/8 0/1 0/3 62% 21 2/6 1/1 0/1 3/8 0/2 0/2 0/1
0/6 37% 66 2/2 2/2 0/1 100% 95 0/3 1/4 1/7 0/4 14% Total 22/36 61%
WT 0/6 0/1 0/8 0/4 0/1 Mice where transgene was repaired/number of
injected mice. NI: non-injected mice; WT: wild type mice; I-SceI:
vector carrying the I-SceI expression cassette; RM A: vector
containing the 2 kbp repair matrix; RM B: vector containing the 1.5
kbp repair matrix and I-SceI-RM A: I-SceI expression cassette and
the 2 kbp repair matrix in the same vector.
[0341] Detection of a corrected transgene occurs in 14 to 100% of
injected mice depending on the transgenic lines. This heterogeneity
probably reflects the high variability of the hydrodynamic tail
vein injection methodology. Simple injection of one plasmid
carrying the I-SceI-expressing cassette and the DNA repair matrix
or injection of two vectors at the same time gave the same results.
Finally, results were also similar with 20 or 50 .mu.g of DNA
injected. These results demonstrate that human Apo A-I gene
correction was induced by I-SceI DSB repair mechanism.
[0342] These results give evidence that meganuclease-induced gene
conversion can be used to perform in toto genome surgery, and that
meganucleases can be used as drugs for such applications.
Sequence CWU 1
1
231264PRTArtificial SequenceSynthetic protein 1Met Ala Asn Thr Lys
Tyr Asn Lys Glu Phe Leu Leu Tyr Leu Ala Gly1 5 10 15Phe Val Asp Gly
Asp Gly Ser Ile Ile Ala Gln Ile Lys Pro Asn Gln 20 25 30Ser Tyr Lys
Phe Lys His Gln Leu Ser Leu Thr Phe Gln Val Thr Gln 35 40 45Lys Thr
Gln Arg Arg Trp Phe Leu Asp Lys Leu Val Asp Glu Ile Gly 50 55 60Val
Gly Tyr Val Arg Asp Arg Gly Ser Val Ser Asp Tyr Ile Leu Ser65 70 75
80Glu Ile Lys Pro Leu His Asn Phe Leu Thr Gln Leu Gln Ala Met Leu
85 90 95Glu Arg Ile Arg Leu Phe Asn Met Arg Glu Phe Leu Leu Tyr Leu
Ala 100 105 110Gly Phe Val Asp Gly Asp Gly Ser Ile Ile Ala Gln Ile
Lys Pro Asn 115 120 125Gln Ser Tyr Lys Phe Lys His Gln Leu Ser Leu
Thr Phe Gln Val Thr 130 135 140Gln Lys Thr Gln Arg Arg Trp Phe Leu
Asp Lys Leu Val Asp Glu Ile145 150 155 160Gly Val Gly Tyr Val Arg
Asp Arg Gly Ser Val Ser Asp Tyr Ile Leu 165 170 175Ser Glu Ile Lys
Pro Leu His Asn Phe Leu Thr Gln Leu Gln Pro Phe 180 185 190Leu Lys
Leu Lys Gln Lys Gln Ala Asn Leu Val Leu Lys Ile Ile Glu 195 200
205Gln Leu Pro Ser Ala Lys Glu Ser Pro Asp Lys Phe Leu Glu Val Cys
210 215 220Thr Trp Val Asp Gln Ile Ala Ala Leu Asn Asp Ser Lys Thr
Arg Lys225 230 235 240Thr Thr Ser Glu Thr Val Arg Ala Val Leu Asp
Ser Leu Ser Glu Lys 245 250 255Lys Lys Ser Ser Pro Ala Ala Asp
2602795DNAArtificial SequenceSynthetic DNA 2atggccaaca ctaagtacaa
taaagaattt ctcctgtatc tggcaggttt cgtcgacggc 60gatggctcca ttatcgcaca
gatcaagccg aatcagagct acaagtttaa acaccaactg 120tctctcactt
tccaggttac ccagaaaact caacgtcgct ggttcctgga taagctggta
180gatgagatcg gtgtgggcta tgtacgcgac cgtggctctg tgagcgacta
tatcctgtct 240gagattaaac cactgcataa ttttctgacc cagctgcagg
ctatgctgga gcgtatccgt 300ctgttcaaca tgcgtgagtt cctgctgtac
ctggccggct ttgtggacgg tgacggtagc 360atcatcgctc agattaaacc
aaaccagtct tataaattca agcatcagct gtccctgacc 420tttcaggtga
ctcaaaagac ccagcgccgt tggtttctgg acaaactggt ggatgaaatt
480ggcgttggtt acgtacgtga tcgcggtagc gtttccgatt acattctgag
cgaaatcaag 540ccgctgcaca acttcctgac tcaactgcaa ccgtttctga
aactgaaaca gaaacaggca 600aacctggttc tgaaaattat cgaacagctg
ccgtctgcaa aagaatcccc ggacaaattc 660ctggaagttt gtacctgggt
ggatcagatt gcagctctga acgattctaa gacgcgtaaa 720accacttctg
aaaccgttcg tgctgtgctg gacagcctga gcgagaagaa gaaatcctcc
780ccggcggccg actag 7953492DNAArtificial SequenceSynthetic DNA
3atggccaata ccaaatataa caaagagttc ctgctgtacc tggccggctt tgtggacggt
60gacggtagca tcatcgctca gattaaacca aaccagtctt ataaattcaa gcatcagctg
120tccctgacct ttcaggtgac tcaaaagacc cagcgccgtt ggtttctgga
caaactggtg 180gatgaaattg gcgttggtta cgtacgtgat cgcggtagcg
tttccgatta cattctgagc 240gaaatcaagc cgctgcacaa cttcctgact
caactgcaac cgtttctgaa actgaaacag 300aaacaggcaa acctggttct
gaaaattatc gaacagctgc cgtctgcaaa agaatccccg 360gacaaattcc
tggaagtttg tacctgggtg gatcagattg cagctctgaa cgattctaag
420acgcgtaaaa ccacttctga aaccgttcgt gctgtgctgg acagcctgag
cgagaagaag 480aaatcctccc cg 4924492DNAArtificial SequenceSynthetic
DNA 4atggccaaca ctaagtacaa taaagaattt ctcctgtatc tggcaggttt
cgtcgacggc 60gatggctcca ttatcgcaca gatcaagccg aatcagagct acaagtttaa
acaccaactg 120tctctcactt tccaggttac ccagaaaact caacgtcgct
ggttcctgga taagctggta 180gatgagatcg gtgtgggcta tgtacgcgac
cgtggctctg tgagcgacta tatcctgtct 240gagattaaac cactgcataa
ttttctgacc cagctgcagc cgttcctcaa gctgaagcaa 300aaacaggcca
atctcgtgct gaagatcatt gagcaactgc catccgccaa agagtctccg
360gataaatttc tggaggtctg cacttgggtt gaccaaatcg ctgcactcaa
cgactccaaa 420acccgcaaga cgaccagcga gactgtacgc gcagttctgg
attctctctc cgaaaaaaag 480aagtctagcc cg 4925492DNAArtificial
SequenceSynthetic DNA 5atggccaata ccaaatataa caaagagttc ctgctgtacc
tggccggctt tgtggacggt 60gacggtagca tcatcgctca gattaaacca aaccagtctt
ataagtttaa acatcagcta 120agcttgacct ttcaggtgac tcaaaagacc
cagcgccgtt ggtttctgga caaactagtg 180gatgaaattg gcgttggtta
cgtacgtgat cgcggatccg tttccaacta catcttaagc 240gaaatcaagc
cgctgcacaa cttcctgact caactgcagc cgtttctgaa actgaaacag
300aaacaggcaa acctggttct gaaaattatc gaacagctgc cgtctgcaaa
agaatccccg 360gacaaattcc tggaagtttg tacctgggtg gatcagattg
cagctctgaa cgattctaag 420acgcgtaaaa ccacttctga aaccgttcgt
gctgtgctgg acagcctgag cgagaagaag 480aaatcctccc cg
492642DNAArtificial SequenceSynthetic DNA 6acgacggcca gtgaattcac
catggccaat accaaatata ac 42775DNAArtificial SequenceSynthetic DNA
7cacctgaaag gtcaagctta gmbbatgttt aaacttmbba gactgmbbtg gmbbaatmbb
60agcgatgatg ctacc 75849DNAArtificial SequenceSynthetic DNA
8gtttaaacat cagctaagct tgacctttvv kgtgactcaa aagacccag
49945DNAArtificial SequenceSynthetic DNA 9gatgtagttg gaaacggatc
cmbbatcmbb tacgtaacca acgcc 451024DNAArtificial SequenceSynthetic
DNA 10tcaaaacgtc gtgagacagt ttgg 241124DNAArtificial
SequenceSynthetic DNA 11tcaaaacgtc gtacgacgtt ttga
241224DNAArtificial SequenceSynthetic DNA 12ccaaactgtc tcgagacagt
ttgg 241324DNAArtificial SequenceSynthetic DNA 13ggaagaagcc
ttaagacatt ttga 241424DNAArtificial SequenceSynthetic DNA
14ggaagaagcc ttaaggcttc ttcc 241524DNAArtificial SequenceSynthetic
DNA 15tcaaaatgtc ttaagacatt ttga 241620DNAArtificial
SequenceSynthetic DNA 16tgcggtgctg accttggccg 201720DNAArtificial
SequenceSynthetic DNA 17ctgttatccc tagcggatcc 201820DNAArtificial
SequenceSynthetic DNA 18gagaaggagg tcccccacgg 201922DNAArtificial
SequenceSynthetic DNA 19cgcagcttgc tgaaggtgga gg
222022DNAArtificial SequenceSynthetic DNA 20cttgctgaag gtggaggtca
cg 222122DNAArtificial SequenceSynthetic DNA 21gacggccaag
tcatcactat tg 222222DNAArtificial SequenceSynthetic DNA
22ccacaggatt ccatacccaa ga 2223153PRTArtificial SequenceSynthetic
protein 23Met Asn Thr Lys Tyr Asn Lys Glu Phe Leu Leu Tyr Leu Ala
Gly Phe1 5 10 15Val Asp Gly Asp Gly Ser Ile Ile Ala Gln Ile Lys Pro
Asn Gln Ser 20 25 30Tyr Lys Phe Lys His Gln Leu Ser Leu Thr Phe Gln
Val Thr Gln Lys 35 40 45Thr Gln Arg Arg Trp Phe Leu Asp Lys Leu Val
Asp Glu Ile Gly Val 50 55 60Gly Tyr Val Arg Asp Arg Gly Ser Val Ser
Asp Tyr Ile Leu Ser Glu65 70 75 80Ile Lys Pro Leu His Asn Phe Leu
Thr Gln Leu Gln Pro Phe Leu Lys 85 90 95Leu Lys Gln Lys Gln Ala Asn
Leu Val Leu Lys Ile Ile Glu Gln Leu 100 105 110Pro Ser Ala Lys Glu
Ser Pro Asp Lys Phe Leu Glu Val Cys Thr Trp 115 120 125Val Asp Gln
Ile Ala Ala Leu Asn Asp Ser Lys Thr Arg Lys Thr Thr 130 135 140Ser
Glu Thr Val Arg Ala Val Leu Asp145 150
* * * * *