U.S. patent application number 12/859905 was filed with the patent office on 2011-03-24 for i-crei meganuclease variants with modified specificity, method of preparation and uses thereof.
This patent application is currently assigned to CELLECTIS. Invention is credited to Philippe DUCHATEAU, Frederic Paques.
Application Number | 20110072527 12/859905 |
Document ID | / |
Family ID | 36659837 |
Filed Date | 2011-03-24 |
United States Patent
Application |
20110072527 |
Kind Code |
A1 |
DUCHATEAU; Philippe ; et
al. |
March 24, 2011 |
I-CREI MEGANUCLEASE VARIANTS WITH MODIFIED SPECIFICITY, METHOD OF
PREPARATION AND USES THEREOF
Abstract
Method of preparing I-CreI meganuclease variants having a
modified cleavage specificity, variants obtainable by said method
and their applications either for cleaving new DNA target or for
genetic engineering and genome engineering for non-therapeutic
purposes. Nucleic acids encoding said variants, expression
cassettes comprising said nucleic acids, vectors comprising said
expression cassettes, cells or organisms, plants or animals except
humans, transformed by said vectors.
Inventors: |
DUCHATEAU; Philippe;
(Gandelu, FR) ; Paques; Frederic; (Bourg-la-Reine,
FR) |
Assignee: |
CELLECTIS
Romainville
FR
|
Family ID: |
36659837 |
Appl. No.: |
12/859905 |
Filed: |
August 20, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11908798 |
Sep 17, 2007 |
|
|
|
PCT/IB2006/001203 |
Mar 15, 2006 |
|
|
|
12859905 |
|
|
|
|
Current U.S.
Class: |
800/14 ; 435/196;
435/320.1; 435/325; 435/91.41; 514/44R; 536/23.2; 800/298 |
Current CPC
Class: |
A61P 31/12 20180101;
C12N 9/22 20130101; A61P 43/00 20180101; A61K 48/00 20130101; A61P
31/00 20180101; A61K 38/00 20130101 |
Class at
Publication: |
800/14 ; 435/196;
536/23.2; 435/320.1; 435/325; 800/298; 435/91.41; 514/44.R |
International
Class: |
A01K 67/027 20060101
A01K067/027; C12N 9/16 20060101 C12N009/16; C07H 21/00 20060101
C07H021/00; C12N 15/63 20060101 C12N015/63; C12N 5/10 20060101
C12N005/10; A01H 5/00 20060101 A01H005/00; C12N 15/66 20060101
C12N015/66; A61K 31/7088 20060101 A61K031/7088 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 15, 2005 |
IB |
PCT IB2005 000981 |
Sep 19, 2005 |
IB |
PCT IB2005 003083 |
Claims
1. A method of preparing at least one I-CreI meganuclease variant
having a modified cleavage specificity, said method comprising: (a)
replacing amino acids Q44, R68 and/or R70, in reference with I-CreI
pdb accession code 1g9y, with an amino acid selected from the group
consisting of A, D, E, G, H, K, N, P, Q, R, S, T and Y to obtain
one or more I-CreI meganuclease variants; and (b) selecting said
one or more I-CreI meganuclease variants obtained in (a) having at
least one of the following R.sub.3 triplet cleaving profile in
reference to positions -5 to -3 in a double-strand DNA target, said
positions -5 to -3 corresponding to R.sub.3 of the following
formula I: TABLE-US-00003
5'-R.sub.1CAAAR.sub.2R.sub.3R.sub.4R'.sub.4R'.sub.3R'.sub.2TTTGR'.sub.1-3'-
, (SEQ ID NO: 92)
wherein: R.sub.1 is absent or present; and when present represents
a nucleic acid fragment comprising 1 to 9 nucleotides corresponding
either to a random nucleic acid sequence or to a fragment of a
I-CreI meganuclease homing site situated from position -20 to -12
(from 5' to 3'), R.sub.1 corresponding at least to position -12 of
said homing site, R.sub.2 represents the nucleic acid doublet ac or
ct and corresponds to positions -7 to -6 of said homing site,
R.sub.3 represents a nucleic acid triplet corresponding to said
positions -5 to -3, selected among g, t, c and a, except the
following triplets: gtc, gcc, gtg, gtt and get, R.sub.4 represents
the nucleic acid doublet gt or tc and corresponds to positions -2
to -1 of said homing site, R'.sub.1 is absent or present; and when
present represents a nucleic acid fragment comprising 1 to 9
nucleotides corresponding either to a random nucleic acid sequence
or to a fragment of a I-CreI meganuclease homing site situated from
position +12 to +20 (from 5' to 3'), R'.sub.1 corresponding at
least to position +12 of said homing site, R'.sub.2 represents the
nucleic acid doublet ag or gt, and corresponds to positions +6 to
+7 of said homing site, R'.sub.3 represents a nucleic acid triplet
corresponding to said positions +3 to +5, selected among g, t, c,
and a; R'.sub.3 being different from gac, ggc, cac, aac, and age,
when R.sub.3 and R'.sub.3 are non-palindromic, and R'.sub.4
represents the nucleic acid doublet ga or ac and corresponds to
positions +1 to +2 of said homing site.
2. The method according to claim 1, wherein said nucleic acid
triplet R.sub.3 is selected among the following triplets: ggg, gga,
ggt, ggc, gag, gaa, gat, gac, gta, gcg, gca, tgg, tga, tgt, tgc,
tag, taa, tat, tac, ttg, tta, ttt, ttc, tcg, tca, tct, tcc, agg,
aga, agt, agc, aag, aaa, aat, aac, atg, ata, att, atc, acg, aca,
act, acc, cgg, cga, cgt, cgc, cag, caa, cat, cac, ctg, eta, ctt,
ctc, ccg, cca, cct and ccc.
3. The method according to claim 2, wherein said nucleic acid
triplet R.sub.3 is selected among the following triplets: ggg, ggt,
ggc, gag, gat, gac, gta, gcg, gca, tag, taa, tat, tac, ttg, ttt,
ttc, tcg, tct, tee, agg, aag, aat, aac, att, atc, act, acc, cag,
cat, cac, ctt, ctc, ccg, cct and ccc.
4. The method according to claim 1, wherein the at least one I-CreI
meganuclease variant selected in (b) is selected from the group
consisting of: A44/A68/A70, A44/A68/G70, A44/A68/H70, A44/A68/K70,
A44/A68/N70, A44/A68/Q70, A44/A68/R70, A44/A68/S70, A44/A68/T70,
A44/D68/H70, A44/D68/K70, A44/D68/R70, A44/G68/H70, A44/G68/K70,
A44/G68/N70, A44/G68/P70, A44/G68/R70, A44/H68/A70, A44/H68/G70,
A44/H68/H70, A44/H68/K70, A44/H68/N70, A44/H68/Q70, A44/H68/R70,
A44/H68/S70, A44/H68/T70, A44/K68/A70, A44/K68/G70, A44/K68/H70,
A44/K68/K70, A44/K68/N70, A44/K68/Q70, A44/K68/R70, A44/K68/S70,
A44/K68/T70, A44/N68/A70, A44/N68/E70, A44/N68/G70, A44/N68/H70,
A44/N68/K70, A44/N68/N70, A44/N68/Q70, A44/N68/R70, A44/N68/S70,
A44/N68/T70, A44/Q68/A70, A44/Q68/D70, A44/Q68/G70, A44/Q68/H70,
A44/Q68/N70, A44/Q68/R70, A44/Q68/S70, A44/R68/A70, A44/R68/D70,
A44/R68/E70, A44/R68/G70, A44/R68/H70, A44/R68/K70, A44/R68/L70,
A44/R68/N70, A44/R68/R70, A44/R68/S70, A44/R68/T70, A44/S68/A70,
A44/S68/G70, A44/S68/K70, A44/S68/N70, A44/S68/Q70, A44/S68/R70,
A44/S68/S70, A44/S68/T70, A44/T68/A70, A44/T68/G70, A44/T68/H70,
A44/T68/K70, A44/T68/N70, A44/T68/Q70, A44/T68/R70, A44/T68/S70,
A44/T68/T70, D44/D68/H70, D44/N68/S70, D44/R68/A70, D44/R68/K70,
D44/R68/N70, D44/R68/Q70, D44/R68/R70, D44/R68/S70, D44/R68/T70,
E44/H68/H70, E44/R68/A70, E44/R68/H70, E44/R68/N70, E44/R68/S70,
E44/R68/T70, E44/S68/T70, G44/H68/K70, G44/Q68/H70, G44/R68/Q70,
G44/R68/R70, G44/T68/D70, G44/T68/P70, G44/T68/R70, H44/A68/S70,
H44/A68/T70, H44/R68/A70, H44/R68/D70, H44/R68/E70, H44/R68/G70,
H44/R68/N70, H44/R68/R70, H44/R68/S70, H44/R68/T70, H44/S68/G70,
H44/S68/S70, H44/S68/T70, H44/T68/S70, H44/T68/T70, K44/A68/A70,
K44/A68/D70, K44/A68/E70, K44/A68/G70, K44/A68/H70, K44/A68/N70,
K44/A68/Q70, K44/A68/S70, K44/A68/T70, K44/D68/A70, K44/D68/T70,
K44/E68/G70, K44/E68/N70, K44/E68/S70, K44/G68/A70, K44/G68/G70,
K44/G68/N70, K44/G68/S70, K44/G68/T70, K44/H68/D70, K44/H68/E70,
K44/H68/G70, K44/H68/N70, K44/H68/S70, K44/H68/T70, K44/K68/A70,
K44/K68/D70, K44/K68/H70, K44/K68/T70, K44/N68/A70, K44/N68/D70,
K44/N68/E70, K44/N68/G70, K441N68/H70, K44/N68/N70, K44/N68/Q70,
K44/N68/S70, K44/N68/T70, K44/P68/H70, K44/Q68/A70, K44/Q68/D70,
K44/Q68/E70, K44/Q68/S70, K44/Q68/T70, K44/R68/A70, K44/R68/D70,
K44/R68/E70, K44/R68/G70, K44/R68/H70, K44/R68/N70, K44/R68/Q70,
K44/R68/S70, K44/R68/T70, K44/S68/A70, K44/S68/D70, K44/S68/H70,
K44/S68/N70, K44/S68/S70, K44/S68/T70, K44/T68/A70, K44/T68/D70,
K44/T68/E70, K44/T68/G70, K44/T68/H70, K44/T68/N70, K44/T68/Q70,
K44/T68/S70, K44/T68/T70, N44/A68/H70, N44/A68/R70, N44/H68/N70,
N44/H68/R70, N44/K68/G70, N44/K68/H70, N44/K68/R70, N44/K68/S70,
N44/N68/R70, N44/P68/D70, N44/Q68/H70, N44/Q68/R70, N44/R68/A70,
N44/R68/D70, N44/R68/E70, N44/R68/G70, N44/R68/H70, N44/R68/K70,
N44/R68/N70, N44/R68/R70, N44/R68/S70, N44/R68/T70, N44/S68/G70,
N44/S68/H70, N44/S68/K70, N44/S68/R70, N44/T68/H70, N44/T68/K70,
N44/T68/Q70, N44/T68/R70, N44/T68/S70, P44/N68/D70, P44/T68/T70,
Q44/A68/A70, Q44/A68/H70, Q44/A68/R70, Q44/G68/K70, Q44/G68/R70,
Q44/K68/G70, Q44/N68/A70, Q44/N68/H70, Q44/N68/S70, Q44/P68/P70,
Q44/Q68/G70, Q44/R68/A70, Q44/R68/D70, Q44/R68/E70, Q44/R68/G70,
Q44/R68/H70, Q44/R68/N70, Q44/R68/Q70, Q44/R68/S70, Q44/S68/H70,
Q44/S68/R70, Q44/S68/S70, Q44/T68/A70, Q44/T68/G70, Q44/T68/H70,
Q44/T68/R70, R44/A68/G70, R44/A68/T70, R44/G68/T70, R44/H68/D70,
R44/H68/T70, R44/N68/T70, R44/R68/A70, R44/R68/D70, R44/R68/E70,
R44/R68/G70, R44/R68/N70, R44/R68/Q70, R44/R68/S70, R44/R68/T70,
R44/S68/G70, R44/S68/N70, R44/S68/S70, R44/S68/T70, S44/D68/K70,
S44/H68/R70, S44/R68/G70, S44/R68/N70, S44/R68/R70, S44/R68/S70,
T44/A68/K70, T44/A68/R70, T44/H68/R70, T44/K68/R70, T44/N68/P70,
T44/N68/R70, T44/Q68/K70, T44/Q68/R70, T44/R68/A70, T44/R68/D70,
T44/R68/E70, T44/R68/G70, T44/R68/H70, T44/R68/K70, T44/R68/N70,
T44/R68/Q70, T44/R68/R70, T44/R68/S70, T44/R68/T70, T44/S68/K70,
T44/S68/R70, T44/T68/K70, and T44/T68/R70.
5. The method according to claim 1, wherein said selecting (b) of
said at least one I-CreI meganuclease variant is performed in vivo
in yeast cells.
6. At least one I-CreI meganuclease variant prepared by the method
according to claim 1, wherein said at least one I-CreI meganuclease
variant is selected from the group consisting of: A44/A68/A70,
A44/A68/G70, A44/A68/H70, A44/A68/K70, A44/A68/N70, A44/A68/Q70,
A44/A68/S70, A44/A68/T70, A44/D68/H70, A44/D68/K70, A44/D68/R70,
A44/G68/H70, A44/G68/K70, A44/G68/N70, A44/G68/P70, A44/H68/A70,
A44/H68/G70, A44/H68/H70, A44/H68/K70, A44/H68/N70, A44/H68/Q70,
A44/H68/S70, A44/H68/T70, A44/K68/A70, A44/K68/G70, A44/K68/H70,
A44/K68/N70, A44/K68/Q70, A44/K68/R70, A44/K68/S70, A44/K68/T70,
A44/N68/A70, A44/N68/E70, A44/N68/G70, A44/N68/H70, A44/N68/K70,
A44/N68/N70, A44/N68/Q70, A44/N68/R70, A44/N68/S70, A44/N68/T70,
A44/Q68/A70, A44/Q68/D70, A44/Q68/G70, A44/Q68/H70, A44/Q68/N70,
A44/Q68/S70, A44/R68/E70, A44/R68/K70, A44/R68/L70, A44/S68/A70,
A44/S68/G70, A44/S68/N70, A44/S68/Q70, A44/S68/R70, A44/S68/S70,
A44/S68/T70, A44/T68/A70, A44/T68/G70, A44/T68/H70, A44/T68/N70,
A44/T68/Q70, A44/T68/S70, A44/T68/T70, D44/D68/H70, D44/N68/S70,
D44/R68/A70, D44/R68/N70, D44/R68/Q70, D44/R68/R70, D44/R68/S70,
D44/R68/T70, E44/H68/H70, E44/R68/A70, E44/R68/H70, E44/R68/N70,
E44/R68/S70, E44/R68/T70, E44/S68/T70, G44/H68/K70, G44/Q68/H70,
G44/R68/Q70, G44/T68/D70, G44/T68/P70, G44/T68/R70, H44/A68/S70,
H44/A68/T70, H44/R68/D70, H44/R68/E70, H44/R68/G70, H44/R68/N70,
H44/R68/R70, H44/R68/S70, H44/S68/G70, H44/S68/S70, H44/S68/T70,
H44/T68/S70, H44/T68/T70, K44/A68/A70, K44/A68/D70, K44/A68/E70,
K44/A68/G70, K44/A68/H70, K44/A68/N70, K44/A68/Q70, K44/D68/A70,
K44/D68/T70, K44/E68/G70, K44/E68/S70, K44/G68/A70, K44/G68/G70,
K44/G68/N70, K44/G68/S70, K44/G68/T70, K44/H68/D70, K44/H68/E70,
K44/H68/G70, K44/H68/N70, K44/H68/S70, K44/H68/T70, K44/K68/A70,
K44/K68/D70, K44/K68/H70, K44/K68/T70, K44/N68/A70, K44/N68/D70,
K44/N68/E70, K44/N68/G70, K44/N68/H70, K44/N68/N70, K44/N68/Q70,
K44/N68/S70, K44/N68/T70, K44/P68/H70, K44/Q68/A70, K44/Q68/D70,
K44/Q68/E70, K44/Q68/S70, K44/Q68/T70, K44/R68/A70, K44/R68/D70,
K44/R68/E70, K44/R68/G70, K44/R68/H70, K44/R68/N70, K44/R68/S70,
K44/S68/A70, K44/S68/D70, K44/S68/H70, K44/S68/N70, K44/S68/S70,
K44/S68/T70, K44/T68/A70, K44/T68/D70, K44/T68/E70, K44/T68/G70,
K44/T68/H70, K44/T68/N70, K44/T68/Q70, K44/T68/S70, K44/T68/T70,
N44/A68/H70, N44/H68/N70, N44/H68/R70, N44/K68/G70, N44/K68/H70,
N44/K68/R70, N44/K68/S70, N44/P68/D70, N44/Q68/H70, N44/R68/A70,
N44/R68/D70, N44/R68/E70, N44/R68/K70, N44/S68/G70, N44/S68/H70,
N44/S68/K70, N44/S68/R70, N44/T68/H70, N44/T68/K70, N44/T68/Q70,
N44/T68/S70, P44/N68/D70, P44/T68/T70, Q44/G68/K70, Q44/G68/R70,
Q44/K68/G70, Q44/N68/A70, Q44/N68/H70, Q44/N68/S70, Q44/P68/P70,
Q44/Q68/G70, Q44/R68/D70, Q44/R68/E70, Q44/R68/G70, Q44/R68/Q70,
Q44/S68/S70, Q44/T68/A70, Q44/T68/G70, Q44/T68/H70, R44/A68/G70,
R44/A68/T70, R44/G68/T70, R44/H68/D70, R44/H68/T70, R44/N68/T70,
R44/R68/A70, R44/R68/D70, R44/R68/E70, R44/R68/G70, R44/R68/Q70,
R44/R68/S70, R44/R68/T70, R44/S68/G70, R44/S68/N70, R44/S68/S70,
R44/S68/T70, S44/D68/K70, S44/R68/R70, S44/R68/S70, T44/A68/K70,
T44/N68/P70, T44/N68/R70, T44/R68/E70, T44/R68/Q70, and
T44/S68/K70.
7. The at least one I-CreI meganuclease variant according to claim
6, wherein said at least one I-CreI meganuclease variant comprises
an alanine (A) or an asparagine (N) in position 44 and cleaves a
double-strand nucleic acid target comprising nucleotide a in
position -4, and/or nucleotide t in position +4.
8. The at least one I-CreI meganuclease variant according to claim
6, wherein said at least one I-CreI meganuclease variant comprises
a lysine (K) in position 44 and cleaves a double-strand nucleic
acid target comprising nucleotide c in position -4, and/or
nucleotide g in position +4.
9. The at least one I-CreI meganuclease variant according to claim
6, wherein said at least one I-CreI meganuclease variant comprises
a glutamine (Q) in position 44 and cleaves a double-strand nucleic
acid target comprising nucleotide t in position -4, and/or
nucleotide a in position +4.
10. The at least one I-CreI meganuclease variant according to claim
6, wherein said at least one I-CreI meganuclease variant is a
homodimer.
11. The at least one I-CreI meganuclease variant according to claim
6, wherein said at least one I-CreI meganuclease variant is a
heterodimer consisting of two monomers, each of said monomers being
selected from a different I-CreI meganuclease variant as defined in
claim 6.
12. A polynucleotide encoding the at least one I-CreI meganuclease
variant according to claim 6.
13. An expression cassette.sub.s comprising the polynucleotide
according to claim 12 and regulation sequences.
14. An expression vector comprising the expression cassette
according to claim 13.
15. The expression vector according to claim 14, wherein said
expression vector further comprises a targeting DNA construct.
16. The expression vector according to claim 15, wherein said
targeting DNA construct comprises a sequence sharing homologies
with a region surrounding a cleavage site of the at least one
I-CreI meganuclease variant.
17. The expression vector according to claim 16, wherein said
targeting DNA construct comprises: a) sequences sharing homologies
with the region surrounding the cleavage site of the at least one
I-CreI meganuclease variant, and b) sequences to be introduced
flanked by sequence as in a).
18. A modified cell comprising the polynucleotide according to
claim 12.
19. A transgenic plant comprising the polynucleotide according to
claim 12.
20. A non-human transgenic mammal comprising the polynucleotide
according to claim 12.
21. A method of genetic engineering comprising double-strand
nucleic acid breaking in a site of interest located on a vector,
comprising a DNA target of at least one I-CreI meganuclease variant
according to claim 6, by contacting said vector with said at least
one I-CreI meganuclease variant, thereby inducing a homologous
recombination with another vector presenting homology with a
sequence surrounding a cleavage site of said at least one I-CreI
meganuclease variant.
22. A method of genome engineering comprising: 1) double-strand
breaking a genomic locus comprising at least one recognition and
cleavage site of at least one I-CreI meganuclease variant according
to claim 6, by contacting said cleavage site with said at least one
I-CreI meganuclease variant; and 2) maintaining said broken genomic
locus under conditions appropriate for homologous recombination
with a targeting DNA construct comprising a sequence to be
introduced in said genomic locus, flanked by sequences sharing
homologies with said genomic locus.
23. A method of genome engineering comprising: 1) double-strand
breaking a genomic locus comprising at least one recognition and
cleavage site of at least one I-CreI meganuclease variant according
to claim 6, by contacting said cleavage site with said at least one
I-CreI meganuclease variant; and 2) maintaining said broken genomic
locus under conditions appropriate for homologous recombination
with a chromosomal DNA sharing homologies to regions surrounding
said cleavage site.
24. A composition comprising said at least one I-CreI meganuclease
variant according to claim 6.
25. The composition according to claim 24, wherein said composition
further comprises a targeting DNA construct comprising a sequence
which repairs a site of interest flanked by sequences sharing
homologies with a targeted locus.
26. A modified cell comprising the expression vector according to
claim 14.
27. A transgenic plant comprising the expression vector according
to claim 14.
28. A non-human transgenic mammal comprising the expression vector
according to claim 14.
29. A composition comprising said polynucleotide according to claim
12.
30. The composition according to claim 29, wherein said composition
further comprises a targeting DNA construct comprising a sequence
which repairs a site of interest flanked by sequences sharing
homologies with a targeted locus.
31. A composition comprising said expression vector according to
claim 14.
32. The composition according to claim 31, wherein said composition
further comprises a targeting DNA construct comprising a sequence
which repairs a site of interest flanked by sequences sharing
homologies with a targeted locus.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S. Ser. No.
11/908,798, filed on Sep. 17, 2007, which is a National Stage (371)
of PCT/IB06/01203, filed on Mar. 15, 2006, which claims priority to
PCT/IB05/00981, filed on Mar. 15, 2005, and PCT/IB05/03083, filed
on Sep. 19, 2005.
BACKGROUND OF THE INVENTION
[0002] The present invention relates to a method of preparing
I-CreI meganuclease variants having a modified cleavage
specificity. The invention relates also to the I-CreI meganuclease
variants obtainable by said method and to their applications either
for cleaving new DNA target or for genetic engineering and genome
engineering fornon-therapeutic purposes.
[0003] The invention also relates to nucleic acids encoding said
variants, to expression cassettes comprising said nucleic acids, to
vectors comprising said expression cassettes, to cells or
organisms, plants or animals except humans, transformed by said
vectors.
[0004] Meganucleases are sequence specific endonucleases
recognizing large (>12 bp; usually 14-40 bp) DNA cleavage sites
(Thierry and Dujon, 1992). In the wild, meganucleases are
essentially represented by homing endonucleases, generally encoded
by mobile genetic elements such as inteins and class I introns
(Belfort and Roberts, 1997; Chevalier and Stoddard, 2001). Homing
refers to the mobilization of these elements, which relies on DNA
double-strand break (DSB) repair, initiated by the endonuclease
activity of the meganuclease. Early studies on the HO (Haber, 1998;
Klar et al., 1984; Kostriken et al., 1983), I-SceI (Colleaux et
al., 1988; Jacquier and Dujon, 1985; Perrin et al., 1993; Plessis
et al., 1992) and I-TevI (Bell-Pedersen et al., 1990; Bell-Pedersen
et al., 1989; Bell-Pedersen et al., 1991; Mueller et al., 1996)
proteins have illustrated the biology of the homing process. On
another hand, these studies have also provided a paradigm for the
study of DSB repair in living cells.
[0005] General asymmetry of homing endonuclease target sequences
contrasts with the characteristic dyad symmetry of most restriction
enzyme recognition sites. Several homing endonucleases encoded by
introns ORF or inteins have been shown to promote the homing of
their respective genetic elements into allelic intronless or
inteinless sites. By making a site-specific double-strand break in
the intronless or inteinless alleles, these nucleases create
recombinogenic ends, which engage in a gene conversion process that
duplicates the coding sequence and leads to the insertion of an
intron or an intervening sequence at the DNA level.
[0006] Homing endonucleases fall into 4 separated families on the
basis of pretty well conserved amino acids motifs [for review, see
Chevalier and Stoddard (Nucleic Acids Research, 2001, 29,
3757-3774)]. One of them is the dodecapeptide family (dodecamer,
DOD, D1-D2, LAGLIDADG (SEQ ID NO: 91), P1-P2). This is the largest
family of proteins clustered by their most general conserved
sequence motif: one or two copies (vast majority) of a
twelve-residue sequence: the dodecapeptide. Homing endonucleases
with one dodecapetide (D) are around 20 kDa in molecular mass and
act as homodimers. Those with two copies (DD) range from 25 kDa
(230 amino acids) to 50 kDa (HO, 545 amino acids) with 70 to 150
residues between each motif and act as monomer. Cleavage is inside
the recognition site, leaving 4 nt staggered cut with 3'OH
overhangs. Enzymes that contain a single copy of the LAGLIDADG (SEQ
ID NO: 91) motif, such as I-CeuI and I-CreI act as homodimers and
recognize a nearly palindromic homing site.
[0007] The sequence and the structure of the homing endonuclease
I-CreI (pdb accession code 1g9y) have been determined (Rochaix J D
et al., NAR, 1985, 13, 975-984; Heath P J et al., Nat. Struct.
Biol., 1997, 4, 468-476; Wang et al., NAR, 1997, 25, 3767-3776;
Jurica et al. Mol. Cell, 1998, 2, 469-476) and structural models
using X-ray crystallography have been generated (Heath et al.,
1997).
[0008] I-CreI comprises 163 amino acids (pdb accession code 1g9y);
said endonuclease cuts as a dimer. The LAGLIDADG (SEQ ID NO: 91)
motif corresponds to residues 13 to 21; on either side of the
LAGLIDADG (SEQ ID NO: 91) .alpha.-helices, a four .beta.-sheet
(positions 21-29; 37-48; 66-70 and 73-78) provides a DNA binding
interface that drives the interaction of the protein with the
half-site of the target DNA sequence. The dimerization interface
involves the two LAGLIDADG (SEQ ID NO: 91) helix as well as other
residues.
[0009] The homing site recognized and cleaved by I-CreI is 22-24 by
in length and is a degenerate palindrome (see FIG. 2 of Jurica M S
et al, 1998 and SEQ ID NO:65). More precisely, said I-CreI homing
site is a semi-palindromic 22 by sequence, with 7 of 11 by
identical in each half-site (Seligman L M et al., NAR, 2002, 30,
3870-3879).
[0010] The endonuclease-DNA interface has also been described (see
FIG. 4 of Jurica M S et al, 1998) and has led to a number of
predictions about specific protein-DNA contacts (Seligman L M et
al., Genetics, 1997, 147, 1653-1664; Jurica M S et al., 1998;
Chevalier B. et al., Biochemistry, 2004, 43, 14015-14026).
[0011] It emerges from said documents that:
[0012] the residues G19, D20, Q47, R51, K98 and D137 are part of
the endonucleolytic site of I-CreI;
[0013] homing site sequence must have at least 20 by to achieve a
maximal binding affinity of 0.2 nM;
[0014] sequence-specific contacts are distributed across the entire
length of the homing site;
[0015] base-pair substitutions can be tolerated at many different
homing site positions, without seriously disrupting homing site
binding or cleavage;
[0016] R51 and K98 are located in the enzyme active site and are
candidates to act as Lewis acid or to activate a proton donor in
the cleavage reaction; mutations in each of these residues have
been observed to sharply reduce I-CreI endonucleolytic activity
(R51G, K98Q);
[0017] five additional residues, which when mutated abolish I-CreI
endonuclease activity are located in or near the enzyme active site
(R70A, L39R, L91R, D75G, Q47H).
[0018] These studies have paved the way for a general use of
meganuclease for genome engineering. Homologous gene targeting is
the most precise way to stably modify a chromosomal locus in living
cells, but its low efficiency remains a major drawback. Since
meganuclease-induced DSB stimulates homologous recombination up to
10 000-fold, meganucleases are today the best way to improve the
efficiency of gene targeting in mammalian cells (Choulika et al.,
1995; Cohen-Tannoudji et al., 1998; Donoho et al., 1998; Elliott et
al., 1998; Rouet et al., 1994), and to bring it to workable
efficiencies in organisms such as plants (Puchta et al., 1993;
Puchta et al., 1996) and insects (Rong and Golic, 2000; Rong and
Golic, 2001; Rong et al., 2002).
[0019] Meganucleases have been used to induce various kinds of
homologous recombination events, such as direct repeat
recombination in mammalian cells (Liang et al., 1998), plants
(Siebert and Puchta, 2002), insects (Rong et al., 2002), and
bacteria (Posfai et al., 1999), or interchromosomal recombination
(Moynahan and Jasin, 1997; Puchta, 1999; Richardson et al.,
1998).
[0020] However, this technology is still limited by the low number
of potential natural target sites for meganucleases: although
several hundreds of natural homing endonucleases have been
identified (Belfort and Roberts, 1997; Chevalier and Stoddard,
2001), the probability to have a natural meganuclease cleaving a
gene of interest is extremely low. The making of artificial
meganucleases with dedicated specificities would bypass this
limitation.
[0021] Artificial endonucleases with novel specificity have been
made, based on the fusion of endonucleases domains to zinc-finger
DNA binding domains (Bibikova et al., 2003; Bibikova et al., 2001;
Bibikova et al., 2002; Porteus and Baltimore, 2003).
[0022] Homing endonucleases have also been used as scaffolds to
make novel endonucleases, either by fusion of different protein
domains (Chevalier et al., 2002; Epinat et al., 2003), or by
mutation of single specific amino acid residues (Seligman et al.,
1997, 2002; Sussman et al., 2004; International PCT Application WO
2004/067736).
[0023] The International PCT Application WO 2004/067736 describes a
general method for producing a custom-made meganuclease derived
from an initial meganuclease, said meganuclease variant being able
to cleave a DNA target sequence which is different from the
recognition and cleavage site of the initial meganuclease. This
general method comprises the steps of preparing a library of
meganuclease variants having mutations at positions contacting the
DNA target sequence or interacting directly or indirectly with said
DNA target, and selecting the variants able to cleave the DNA
target sequence. When the initial meganuclease is the I-CreI N75
protein a library, wherein residues 44, 68 and 70 have been mutated
was built and screened against a series of six targets close to the
I-CreI natural target site; the screened mutants have altered
binding profiles compared to the I-CreI N75 scaffold protein ;
however, they cleave the I-CreI natural target site.
[0024] Seligman et al., 2002, describe mutations altering the
cleavage specificity of I-CreI. More specifically, they have
studied the role of the nine amino acids of I-CreI predicted to
directly contact the DNA target (Q26, K28, N30, S32, Y33, Q38, Q44,
R68 and R70). Among these nine amino acids, seven are thought to
interact with nucleotides at symmetrical positions (S32, Y33, N30,
Q38, R68, Q44 and R70). Mutants having each of said nine amino
acids and a tenth (T140) predicted to participate in a
water-mediated interaction, converted to alanine, were constructed
and tested in a E. coli based assay.
[0025] The resulting I-CreI mutants fell into four distinct
phenotypic classes in relation to the wild-type homing site :
[0026] S32A and T140A contacts appear least important for homing
site recognition,
[0027] N30A, Q38A and Q44A displayed intermediate levels of
activity in each assay,
[0028] Q26A, R68A and Y33A are inactive,
[0029] K28A and R70A are inactive and non-toxic.
[0030] It emerges from the results that I-CreI mutants at positions
30, 38, 44, 26, 68, 33, 28 and 70 have a modified behaviour in
relation to the wild-type I-CreI homing site.
[0031] As regards the mutations altering the seven symmetrical
positions in the I-CreI homing site, it emerges from the obtained
results that five of the seven symmetrical positions in each
half-site appear to be essential for efficient site recognition in
vivo by wild-type I-CreI: 2/21, 3/20, 7/16, 8/15 and 9/14
(corresponding to positions -10/+10, -9/+9, -51+5, -4/+4 and -3/+3
in SEQ ID NO:65). All mutants altered at these positions were
resistant to cleavage by wild-type I-CreI in vivo ; however, in
vitro assay using E. coli appears to be more sensitive than the in
vivo test and allows the detection of homing sites of wild-type
I-CreI more effectively than the in vivo test; thus in vitro test
shows that the DNA target of wild-type I-CreI may be the
followings: gtc (recognized homing site in all the cited
documents), gcc or gtt triplet at the positions -5 to -3, in
reference to SEQ ID NO:65.
[0032] Seligman et al. have also studied the interaction between
I-CreI position 33 and homing site bases 2 and 21 (.+-.10) or
between I-CreI position 32 and homing site bases 1 and 22 (.+-.11)
; Y33C, Y33H, Y33R, Y33L, Y33S and Y33T mutants were found to
cleave a homing site modified in positions .+-.10 that is not
cleaved by I-CreI (Table 3). On the other hand, S32K and S32R were
found to cleave a homing site modified in positions .+-.11 that is
cleaved by I-CreI (Table 3).
[0033] Sussman et al., 2004, report studies in which the
homodimeric LAGLIDADG (SEQ ID NO: 91) homing endonuclease I-CreI is
altered at positions 26, and eventually 66, or at position 33,
contacting the homing site bases in positions .+-.6 and .+-.10,
respectively. The resulting enzymes constructs (Q26A, Q26C, Y66R,
Q26C/Y66R, Y33C, Y33H) drive specific elimination of selected DNA
targets in vivo and display shifted specificities of DNA binding
and cleavage in vitro.
[0034] The overall result of the selection and characterization of
enzyme point mutants against individual target site variants is
both a shift and a broadening in binding specificity and in
kinetics of substrate cleavage.
[0035] Each mutant displays a higher dissociation constant (lower
affinity) against the original wild-type target site than does the
wild-type enzyme, and each mutant displays a lower dissociation
constant (higher affinity) against its novel target than does the
wild-type enzyme.
[0036] The enzyme mutants display similar kinetics of substrate
cleavage, with shifts and broadening in substrate preferences
similar to those described for binding affinities.
[0037] To reach a larger number of DNA target sequences, it would
be extremely valuable to generate new I-CreI variants with novel
specificity, ie able to cleave DNA targets which are not cleaved by
I-CreI or the few variants which have been isolated so far.
[0038] Such variants would be of a particular interest for genetic
and genome engineering.
SUMMARY OF THE INVENTION
[0039] Here the inventors have found mutations in positions 44, 68
and 70 of I-CreI which result in variants able to cleave at least
one homing site modified in positions .+-.3 to 5.
[0040] Therefore, the subject-matter of the present invention is a
method of preparing a I-CreI meganuclease variant having a modified
cleavage specificity, said method comprising:
[0041] (a) replacing amino acids Q44, R68 and/or R70, in reference
with I-CreI pdb accession code 1g9y , with an amino acid selected
in the group consisting of A, D, E, G, H, K, N, P, Q, R, S, T and
Y;
[0042] (b) selecting the I-CreI meganuclease variants obtained in
step (a) having at least one of the following R.sub.3 triplet
cleaving profile in reference to positions -5 to -3 in a
double-strand DNA target, said positions -5 to -3 corresponding to
R.sub.3 of the following formula I:
TABLE-US-00001 5'-
R.sub.1CAAAR.sub.2R.sub.3R.sub.4R'.sub.4R'.sub.3R'.sub.2TTTGR'.sub.1
-3', (SEQ ID NO: 92)
[0043] wherein:
[0044] R.sub.1 is absent or present; and when present represents a
nucleic acid fragment comprising 1 to 9 nucleotides corresponding
either to a random nucleic acid sequence or to a fragment of a
I-CreI meganuclease homing site situated from position -20 to -12
(from 5' to 3'), R.sub.1 corresponding at least to position -12 of
said homing site,
[0045] R.sub.2 represents the nucleic acid doublet ac or ct and
corresponds to positions -7 to -6 of said homing site,
[0046] R.sub.3 represents a nucleic acid triplet corresponding to
said positions -5 to -3, selected among g, t, c and a, except the
following triplets : gtc, gcc, gtg, gtt and gct; therefore said
nucleic acid triplet is preferably selected among the following
triplets: ggg, gga, ggt, ggc, gag, gaa, gat, gac, gta, gcg, gca,
tgg, tga, tgt, tgc, tag, taa, tat, tac, ttg, tta, ttt, ttc, tcg,
tca, tct, tcc, agg, aga, agt, agc, aag, aaa, aat, aac, atg, ata,
att, atc, acg, aca, act, acc, cgg, cga, cgt, cgc, cag, caa, cat,
cac, ctg, cta, ctt, etc, ccg, cca, cct and ccc and more preferably
among the following triplets: ggg, ggt, ggc, gag, gat, gac, gta,
gcg, gca, tag, taa, tat, tac, ttg, ttt, ttc, tcg, tct, tcc, agg,
aag, aat, aac, att, atc, act, ace, cag, cat, cac, ctt, etc, ccg,
ect and ccc,
[0047] R.sub.4 represents the nucleic acid doublet gt or tc and
corresponds to positions -2 to -1 of said homing site,
[0048] R'.sub.1 is absent or present; and when present represents a
nucleic acid fragment comprising 1 to 9 nucleotides corresponding
either to a random nucleic acid sequence or to a fragment of a
I-CreI meganuclease homing site situated from position +12 to +20
(from 5' to 3'), R'.sub.1 corresponding at least to position +12 of
said homing site,
[0049] R'.sub.2 represents the nucleic acid doublet ag or gt, and
corresponds to positions +6 to +7 of said homing site,
[0050] R'.sub.3 represents a nucleic acid triplet corresponding to
said positions +3 to +5, selected among g, t, c, and a; R'.sub.3
being different from gac, ggc, cac, aac, and agc, when R.sub.3 and
R'.sub.3 are non-palindromic,
[0051] R'.sub.4 represents the nucleic acid doublet ga or ac and
corresponds to positions +1 to +2 of said homing site.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0052] Amino acid residues in a polypeptide sequence are designated
herein according to the one-letter code, in which, for example, Q
means Gln or Glutamine residue, R means Arg or Arginine residue and
D means Asp or Aspartic acid residue.
[0053] In the present invention, unless otherwise mentioned, the
residue numbers refer to the amino acid numbering of the I-CreI
sequence SWISSPROT P05725 or the pdb accession code 1g9y. According
to this definition, a variant named "ADR" is I-CreI meganuclease in
which amino acid residues Q44 and R68 have been replaced by alanine
and aspartic acid, respectively, while R70 has not been replaced.
Other mutations that do not alter the cleavage activity of the
variant are not indicated and the nomenclature adopted here does
not limit the mutations to the only three positions 44, 68 and
70.
[0054] Nucleotides are designated as follows: one-letter code is
used for designating the base of a nucleoside: a is adenine, t is
thymine, c is cytosine, and g is guanine. For the degenerated
nucleotides, r represents g or a (purine nucleotides), k represents
g or t, s represents g or c, w represents a or t, m represents a or
c, y represents t or c (pyrimidine nucleotides), d represents g, a
or t, v represents g, a or c, b represents g, t or c, h represents
a, t or c, and n represents g, a, t or c.
[0055] In the present application, when a sequence is given for
illustrating a recognition or homing site, it is to be understood
that it represents, from 5' to 3', only one strand of the
double-stranded polynucleotide.
[0056] The term "partially palindromic sequence", "partially
symmetrical sequence", "degenerate palindrome", "pseudopalindromic
sequence" are indiscriminately used for designating a palindromic
sequence having a broken symmetry. For example the 22 by sequence:
c.sub.-11a.sub.-10a.sub.-9a.sub.-8a.sub.-7c.sub.-6g.sub.-5t.sub.-4t.sub.--
3g.sub.-2t.sub.-1g.sub.+1a.sub.+2g.sub.+3a.sub.+4c.sub.+5a.sub.+6g.sub.+7t-
.sub.+8t.sub.+9t.sub.+10g.sub.+11 (SEQ ID NO: 71) is a partially
palindromic sequence in which symmetry is broken at base-pairs
+/-1, 2, 6 and 7. According to another formulation, nucleotide
sequences of positions +/-8 to 11 and +/-3 to 5 are palindromic
sequences. Symmetry axe is situated between the base-pairs in
positions -1 and +1. Using another numbering, from the 5' extremity
to the 3' extremity, palindromic sequences are in positions 1 to 4
and 19 to 22, and 7 to 9 and 14 to 16, symmetry is broken at
base-pairs 5, 6, 10, 11, 12, 13, 17 and 18, and the symmetry axe is
situated between the base-pairs in positions 11 and 12.
[0057] As used herein, the term "wild-type I-CreI" designates a
I-CreI meganuclase having the sequence SWISSPROT P05725 or pdb
accession code 1g9y.
[0058] The terms "recognition site", "recognition sequence",
"target", "target sequence", "DNA target", "homing recognition
site", "homing site", "cleavage site" are indiscriminately used for
designating a 14 to 40 by double-stranded, palindromic,
non-palindromic or partially palindromic polynucleotide sequence
that is recognized and cleaved by a meganuclease. These terms refer
to a distinct DNA location, preferably a chromosomal location, at
which a double stranded break (cleavage) is to be induced by the
meganuclease.
[0059] For example, the known homing recognition site of wild-type
I-CreI is represented by the 22 by sequence
5'-caaaacgtcgtgagacagtttg-3' (SEQ ID NO: 71) or the 24 by sequence
5'-tcaaaacgtcgtgagacagtttgg-3' presented in FIG. 2A (here named
C1234, SEQ ID NO: 65; gtc in positions -5 to -3 and gac in
positions +3 to +5). This particular site is hereafter also named
"I-CreI natural target site". From the natural target can be
derived two palindromic sequences by mutation of the nucleotides in
positions +1,+2, +6, and +7 or -1, -2, -6 and -7: C1221 (SEQ ID NO:
12) and C4334 (SEQ ID NO:66), presented in FIG. 2A. Both have gtc
in positions -5 to -3 and gac in positions +3 to +5, and are cut by
I-CreI, in vitro and in yeast.
[0060] The term "modified specificity" relates to a meganuclease
variant able to cleave a homing site that is not cleaved, in the
same conditions by the initial meganuclease (scaffold protein) it
is derived from; said initial or scaffold protein may be the
wild-type meganuclease or a mutant thereof.
[0061] Indeed, when using an in vivo assay in a yeast strain, the
Inventors found that wild-type I-CreI cleaves not only homing sites
wherein the palindromic sequence in positions -5 to -3 is gtc (as
in C1234, C1221 or C4334), but also gcc, gac, ggc, atc, ctc and ttc
(FIG. 9a).
[0062] The I-CreI D75N mutant (I-CreI N75) which may also be used
as scaffold protein for making variants with novel specificity,
cleaves not only homing sites wherein the palindromic sequence in
positions -5 to -3 is gtc, but also gcc, gtt, gtg, or get (FIGS. 8
and 9a).
[0063] Heterodimeric form may be obtained for example by proceeding
to the fusion of the two monomers. Resulting heterodimeric
meganuclease is able to cleave at least one target site that is not
cleaved by the homodimeric form. Therefore a meganuclease variant
is still part of the invention when used in a heteromeric form. The
other monomer chosen for the formation of the heterodimeric
meganuclease may be another variant monomer, but it may also be a
wild-type monomer, for example a I-CreI monomer or a I-DmoI
monomer.
[0064] Thus, the inventors constructed a I-CreI variants library
from a I-CreI scaffold protein (I-CreI D75N) , each of them
presenting at least one mutation in the amino acid residues in
positions 44, 68 and/or 70 (pdb code 1g9y), and each of them being
able to cleave at least one target site not cleaved by the I-CreI
scaffold protein.
[0065] In this particular approach, the mutation consists of the
replacement of at least one amino acid residue in position 44, 68,
and/or 70 by another residue selected in the group comprising A, D,
E, G, H, K, N, P, Q, R, S, T and Y. Each mutated amino acid residue
is changed independently from the other residues, and the selected
amino acid residues may be the same or may be different from the
other amino acid residues in position 44, 68 and/or 70. In this
approach, the homing site, cleaved by the I-CreI meganuclease
variant according to the invention but not cleaved by the I-CreI
scaffold protein, is the same as described above and illustrated in
FIG. 2, except that the triplet sequence in positions -5 to -3
(corresponding to R.sub.3 in formula I) and/or triplet sequence in
positions +3 to +5 (corresponding to R.sub.3' in formula I) differ
from the triplet sequence in the same positions in the homing sites
cleaved by the I-CreI scaffold protein.
[0066] Unexpectedly, the I-CreI meganuclease variants, obtainable
by the method described above, i.e. with a "modified specificity"
are able to cleave at least one target that differs from the I-CreI
scaffold protein target in positions -5 to -3 and/or in positions
+3 to +5. It must be noted that said DNA target is not necessarily
palindromic in positions +/-3 to 5. I-CreI is active in homodimeric
form, but may be active in a heterodimeric form. Therefore I-CreI
variants according to the instant invention could be active not
only in a homodimeric form, but also in a heterodimeric form, and
in both cases, they could recognize a target with either
palindromic or non palindromic sequence in position +/-3 to 5,
provided that when the I-CreI N75 protein is used as scaffold, the
triplet in position -5 to -3 and/or +3 to +5 differs from gtc, gcc,
gtg, gtt and gct, and from gac, ggc, cac, aac, and agc,
respectively. Since each monomer of I-CreI variant binds a half of
the homing site, a variant able to cleave a plurality of targets
could also cleave a target which sequence in position +/-3 to 5 is
not palindromic. Further, a variant could act both in a homodimeric
form and in a heterodimeric form. I-CreI variant could form a
heterodimeric meganuclease, in which the other variant could be a
wild-type I-CreI monomer, another wild-type meganuclease monomer,
such as I-DmoI, another I-CreI variant monomer, or a monomer of a
variant from another meganuclease than I-CreI.
[0067] According to an advantageous embodiment of said method, the
I-CreI meganuclease variant obtained in step (b) is selected from
the group consisting of: A44/A68/A70, A44/A68/G70, A44/A68/H70,
A44/A68/K70, A44/A68/N70, A44/A68/Q70, A44/A68/R70, A44/A68/S70,
A44/A68/T70, A44/D68/H70, A44/D68/K70, A44/D68/R70, A44/G68/H70,
A44/G68/K70, A44/G68/N70, A44/G68/P70, A44/G68/R70, A44/H68/A70,
A44/H68/G70, A44/H68/H70, A44/H68/K70, A44/H68/N70, A44/H68/Q70,
A44/H68/R70, A44/H68/S70, A44/H68/T70, A44/K68/A70, A44/K68/G70,
A44/K68/H70, A44/K68/K70, A44/K68/N70, A44/K68/Q70, A44/K68/R70,
A44/K68/S70, A44/K68/T70, A44/N68/A70, A44/N68/E70, A44/N68/G70,
A44/N68/H70, A44/N68/K70, A44/N68/N70, A44/N68/Q70, A44/N68/R70,
A44/N68/S70, A44/N68/T70, A44/Q68/A70, A44/Q68/D70, A44/Q68/G70,
A44/Q68/H70, A44/Q68/N70, A44/Q68/R70, A44/Q68/S70, A44/R68/A70,
A44/R68/D70, A44/R68/E70, A44/R68/G70, A44/R68/H70, A44/R68/K70,
A44/R68/L70, A44/R68/N70, A44/R68/R70, A44/R68/S70, A44/R68/T70,
A44/S68/A70, A44/S68/G70, A44/S68/K70, A44/S68/N70, A44/S68/Q70,
A44/S68/R70, A44/S68/S70, A44/S68/T70, A44/T68/A70, A44/T68/G70,
A44/T68/H70, A44/T68/K70, A44/T68/N70, A44/T68/Q70, A44/T68/R70,
A44/T68/S70, A44/T68/T70, D44/D68/H70, D44/N68/S70, D44/R68/A70,
D44/R68/K70, D44/R68/N70, D44/R68/Q70, D44/R68/R70, D44/R68/S70,
D44/R68/T70, E44/H68/H70, E44/R68/A70, E44/R68/H70, E44/R68/N70,
E44/R68/S70, E44/R68/T70, E44/S68/T70, G44/H68/K70, G44/Q68/H70,
G44/R68/Q70, G44/R68/R70, G44/T68/D70, G44/T68/P70, G44/T68/R70,
H44/A68/S70, H44/A68/T70, H44/R68/A70, H44/R68/D70, H44/R68/E70,
H44/R68/G70, H44/R68/N70, H44/R68/R70, H44/R68/S70, H44/R68/T70,
H44/S68/G70, H44/S68/S70, H44/S68/T70, H44/T68/S70, H44/T68/T70,
K44/A68/A70, K44/A68/D70, K44/A68/E70, K44/A68/G70, K44/A68/H70,
K44/A68/N70, K44/A68/Q70, K44/A68/S70, K44/A68/T70, K44/D68/A70,
K44/D68/T70, K44/E68/G70, K44/E68/N70, K44/E68/S70, K44/G68/A70,
K44/G68/G70, K44/G68/N70, K44/G68/S70, K44/G68/T70, K44/H68/D70,
K44/H68/E70, K44/H68/G70, K44/H68/N70, K44/H68/S70, K44/H68/T70,
K44/K68/A70, K44/K68/D70, K44/K68/H70, K44/K68/T70, K44/N68/A70,
K44/N68/D70, K44/N68/E70, K44/N68/G70, K44/N68/H70, K44/N68/N70,
K44/N68/Q70, K44/N68/S70, K44/N68/T70, K44/P68/H70, K44/Q68/A70,
K44/Q68/D70, K44/Q68/E70, K44/Q68/S70, K44/Q68/T70, K44/R68/A70,
K44/R68/D70, K44/R68/E70, K44/R68/G70, K44/R68/H70, K44/R68/N70,
K44/R68/Q70, K44/R68/S70, K44/R68/T70, K44/S68/A70, K44/S68/D70,
K44/S68/H70, K44/S68/N70, K44/S68/S70, K44/S68/T70, K44/T68/A70,
K44/T68/D70, K44/T68/E70, K44/T68/G70, K44/T68/H70, K44/T68/N70,
K44/T68/Q70, K44/T68/S70, K44/T68/T70, N44/A68/H70, N44/A68/R70,
N44/H68/N70, N44/H68/R70, N44/K68/G70, N44/K68/H70, N44/K68/R70,
N44/K68/S70, N44/N68/R70, N44/P68/D70, N44/Q68/H70, N44/Q68/R70,
N44/R68/A70, N44/R68/D70, N44/R68/E70, N44/R68/G70, N44/R68/H70,
N44/R68/K70, N44/R68/N70, N44/R68/R70, N44/R68/S70, N44/R68/T70,
N44/S68/G70, N44/S68/H70, N44/S68/K70, N44/S68/R70, N44/T68/H70,
N44/T68/K70, N44/T68/Q70, N44/T68/R70, N44/T68/S70, P44/N68/D70,
P44/T68/T70, Q44/A68/A70, Q44/A68/H70, Q44/A68/R70, Q44/G68/K70,
Q44/G68/R70, Q44/K68/G70, Q44/N68/A70, Q44/N68/H70, Q44/N68/S70,
Q44/P68/P70, Q44/Q68/G70, Q44/R68/A70, Q44/R68/D70, Q44/R68/E70,
Q44/R68/G70, Q44/R68/H70, Q44/R68/N70, Q44/R68/Q70, Q44/R68/S70,
Q44/S68/H70, Q44/S68/R70, Q44/S68/S70, Q44/T68/A70, Q44/T68/G70,
Q44/T68/H70, Q44/T68/R70, R44/A68/G70, R44/A68/T70, R44/G68/T70,
R44/H68/D70, R44/H68/T70, R44/N68/T70, R44/R68/A70, R44/R68/D70,
R44/R68/E70, R44/R68/G70, R44/R68/N70, R44/R68/Q70, R44/R68/S70,
R44/R68/T70, R44/S68/G70, R44/S68/N70, R44/S68/S70, R44/S68/T70,
S44/D68/K70, S44/H68/R70, S44/R68/G70, S44/R68/N70, S44/R68/R70,
S44/R68/S70, T44/A68/K70, T44/A68/R70, T44/H68/R70, T44/K68/R70,
T44/N68/P70, T44/N68/R70, T44/Q68/K70, T44/Q68/R70, T44/R68/A70,
T44/R68/D70, T44/R68/E70, T44/R68/G70, T44/R68/H70, T44/R68/K70,
T44/R68/N70, T44/R68/Q70, T44/R68/R70, T44/R68/S70, T44/R68/T70,
T44/S68/K70, T44/S68/R70, T44/T68/K70, and T44/T68/R70.
[0068] According to another advantageous embodiment of said method,
the step (b) of selecting said I-CreI meganuclease variant is
performed in vivo in yeast cells.
[0069] The subject-matter of the present invention is also the use
of a I-CreI meganuclease variant as defined here above, i.e.
obtainable by the method as described above, in vitro or in vivo
for non-therapeutic purposes, for cleaving a double-strand nucleic
acid target comprising at least a 20-24 by partially palindromic
sequence, wherein at least the sequence in positions +/-8 to 11 is
palindromic, and the nucleotide triplet in positions -5 to -3
and/or the nucleotide triplet in positions +3 to +5 differs from
gtc, gcc, gtg, gtt, and get, and from gac, ggc, cac, aac and age,
respectively. Formula I describes such a DNA target.
[0070] According to an advantageous embodiment of said use, said
I-CreI meganuclease variant is selected from the group consisting
of: A44/A68/A70, A44/A68/G70, A44/A68/H70, A44/A68/K70,
A44/A68/N70, A44/A68/Q70, A44/A68/R70, A44/A68/S70, A44/A68/T70,
A44/D68/H70, A44/D68/K70, A44/D68/R70, A44/G68/H70, A44/G68/K70,
A44/G68/N70, A44/G68/P70, A44/G68/R70, A44/H68/A70, A44/H68/G70,
A44/H68/H70, A44/H68/K70, A44/H68/N70, A44/H68/Q70, A44/H68/R70,
A44/H68/S70, A44/H68/T70, A44/K68/A70, A44/K68/G70, A44/K68/H70,
A44/K68/K70, A44/K68/N70, A44/K68/Q70, A44/K68/R70, A44/K68/S70,
A44/K68/T70, A44/N68/A70, A44/N68/E70, A44/N68/G70, A44/N68/H70,
A44/N68/K70, A44/N68/N70, A44/N68/Q70, A44/N68/R70, A44/N68/S70,
A44/N68/T70, A44/Q68/A70, A44/Q68/D70, A44/Q68/G70, A44/Q68/H70,
A44/Q68/N70, A44/Q68/R70, A44/Q68/S70, A44/R68/A70, A44/R68/D70,
A44/R68/E70, A44/R68/G70, A44/R68/H70, A44/R68/K70, A44/R68/L70,
A44/R68/N70, A44/R68/R70, A44/R68/S70, A44/R68/T70, A44/S68/A70,
A44/S68/G70, A44/S68/K70, A44/S68/N70, A44/S68/Q70, A44/S68/R70,
A44/S68/S70, A44/S68/T70, A44/T68/A70, A44/T68/G70, A44/T68/H70,
A44/T68/K70, A44/T68/N70, A44/T68/Q70, A44/T68/R70, A44/T8/S70,
A44/T68/T70, D44/D68/H70, D44/N68/S70, D44/R68/A70, D44/R68/K70,
D44/R68/N70, D44/R68/Q70, D44/R68/R70, D44/R68/S70, D44/R68/T70,
E44/H68/H70, E44/R68/A70, E44/R68/H70, E44/R68/N70, E44/R68/S70,
E44/R68/T70, E44/S68/T70, G44/H68/K70, G44/Q68/H70, G44/R68/Q70,
G44/R68/R70, G44/T68/D70, G44/T68/P70, G44/T68/R70, H44/A68/S70,
H44/A68/T70, H44/R68/A70, H44/R68/D70, H44/R68/E70, H44/R68/G70,
H44/R68/N70, H44/R68/R70, H44/R68/S70, H44/R68/T70, H44/S68/G70,
H44/S68/S70, H44/S68/T70, H44/T68/S70, H44/T68/T70, K44/A68/A70,
K44/A68/D70, K44/A68/E70, K44/A68/G70, K44/A68/H70, K44/A68/N70,
K44/A68/Q70, K44/A68/S70, K44/A68/T70, K44/D68/A70, K44/D68/T70,
K44/E68/G70, K44/E68/N70, K44/E68/S70, K44/G68/A70, K44/G68/G70,
K44/G68/N70, K44/G68/S70, K44/G68/T70, K44/H68/D70, K44/H68/E70,
K44/H68/G70, K44/H68/N70, K44/H68/S70, K44/H68/T70, K44/K68/A70,
K44/K68/D70, K44/K68/H70, K44/K68/T70, K44/N68/A70, K44/N68/D70,
K44/N68/E70, K44/N68/G70, K44/N68/H70, K44/N68/N70, K44/N68/Q70,
K44/N68/S70, K44/N68/T70, K44/P68/H70, K44/Q68/A70, K44/Q68/D70,
K44/Q68/E70, K44/Q68/S70, K44/Q68/T70, K44/R68/A70, K44/R68/D70,
K44/R68/E70, K44/R68/G70, K44/R68/H70, K44/R68/N70, K44/R68/Q70,
K44/R68/S70, K44/R68/T70, K44/S68/A70, K44/S68/D70, K44/S68/H70,
K44/S68/N70, K44/S68/S70, K44/S68/T70, K44/T68/A70, K44/T68/D70,
K44/T68/E70, K44/T68/G70, K44/T68/H70, K44/T68/N70, K44/T68/Q70,
K44/T68/S70, K44/T68/T70, N44/A68/H70, N44/A68/R70, N44/H68/N70,
N44/H68/R70, N44/K68/G70, N44/K68/H70, N44/K68/R70, N44/K68/S70,
N44/N68/R70, N44/P68/D70, N44/Q68/H70, N44/Q68/R70, N44/R68/A70,
N44/R68/D70, N44/R68/E70, N44/R68/G70, N44/R68/H70, N44/R68/K70,
N44/R68/N70, N44/R68/R70, N44/R68/S70, N44/R68/T70, N44/S68/G70,
N44/S68/H70, N44/S68/K70, N44/S68/R70, N44/T68/H70, N44/T68/K70,
N44/T68/Q70, N44/T68/R70, N44/T68/S70, P44/N68/D70, P44/T68/T70,
Q44/A68/A70, Q44/A68/H70, Q44/A68/R70, Q44/G68/K70, Q44/G68/R70,
Q44/K68/G70, Q44/N68/A70, Q44/N68/H70, Q44/N68/S70, Q44/P68/P70,
Q44/Q68/G70, Q44/R68/A70, Q44/R68/D70, Q44/R68/E70, Q44/R68/G70,
Q44/R68/H70, Q44/R68/N70, Q44/R68/Q70, Q44/R68/S70, Q44/S68/H70,
Q44/S68/R70, Q44/S68/S70, Q44/T68/A70, Q44/T68/G70, Q44/T68/H70,
Q44/T68/R70, R44/A68/G70, R44/A68/T70, R44/G68/T70, R44/H68/D70,
R44/H68/T70, R44/N68/T70, R44/R68/A70, R44/R68/D70, R44/R68/E70,
R44/R68/G70, R44/R68/N70, R44/R68/Q70, R44/R68/S70, R44/R68/T70,
R44/S68/G70, R44/S68/N70, R44/S68/S70, R44/S68/T70, S44/D68/K70,
S44/H68/R70, S44/R68/G70, S44/R68/N70, S44/R68/R70, S44/R68/S70,
T44/A68/K70, T44/A68/R70, T44/H68/R70, T44/K68/R70, T44/N68/P70,
T44/N68/R70, T44/Q68/K70, T44/Q68/R70, T44/R68/A70, T44/R68/D70,
T44/R68/E70, T44/R68/G70, T44/R68/H70, T44/R68/K70, T44/R68/N70,
T44/R68/Q70, T44/R68/R70, T44/R68/S70, T44/R68/T70, T44/S68/K70,
T44/S68/R70, T44/T68/K70, and T44/T68/R70.
[0071] According to another advantageous embodiment of said use,
the I-CreI meganuclease variant is a homodimer.
[0072] According to another advantageous embodiment of said use,
said I-CreI meganuclease variant is a heterodimer.
[0073] Said heterodimer may be either a single-chain chimeric
molecule consisting of the fusion of two different I-CreI variants
as defined in the present invention or of I-CreI scaffold protein
with a I-CreI variant as defined in the present invention.
Alternatively, said heterodimer may consist of two separate
monomers chosen from two different I-CreI variants as defined in
the present invention or I-CreI scaffold protein and a I-CreI
variant as defined in the present invention.
[0074] According to said use:
[0075] either the I-CreI meganuclease variant is able to cleave a
DNA target in which sequence in positions +/-3 to 5 is
palindromic,
[0076] or, said I-CreI meganuclease variant is able to cleave a DNA
target in which sequence in positions +/-3 to 5 is
non-palindromic.
[0077] According to another advantageous embodiment of said use the
cleaved nucleic acid target is a DNA target in which palindromic
sequences in positions -11 to -8 and +8 to +11 are caaa and tttg,
respectively.
[0078] According to another advantageous embodiment of said use,
said I-CreI meganuclease variant further comprises a mutation in
position 75, preferably a mutation in an uncharged amino acid, more
preferably an asparagine or a valine (D75N or D75V).
[0079] According to yet another advantageous embodiment of said
use, said I-CreI meganuclease variant has an alanine (A) or an
asparagine (N) in position 44, for cleaving a DNA target comprising
nucleotide a in position -4, and/or t in position +4.
[0080] According to yet another advantageous embodiment of said
use, said I-CreI meganuclease variant has a glutamine (Q) in
position 44, for cleaving a DNA target comprising nucleotide t in
position -4 or a in position +4.
[0081] According to yet another advantageous embodiment of said
use, said I-CreI meganuclease variant has a lysine (K) in position
44, for cleaving a target comprising nucleotide c in position -4,
and/or g in position +4.
[0082] The subject-matter of the present invention is also I-CreI
meganuclease variants:
[0083] Obtainable by the method of preparation as defined
above;
[0084] Having one mutation of at least one of the amino acid
residues in positions 44, 68 and 70 of I-CreI; said mutations may
be the only ones within the amino acids contacting directly the DNA
target; and
[0085] Having a modified cleavage specificity in positions .+-.3 to
5.
[0086] Such novel I-CreI meganucleases may be used either as very
specific endonucleases in in vitro digestion, for restriction or
mapping use, either in vivo or ex vivo as tools for genome
engineering. In addition, each one can be used as a new scaffold
for a second round of mutagenesis and selection/screening, for the
purpose of making novel, second generation homing
endonucleases.
[0087] The I-CreI meganuclease variants according to the invention
are mutated only at positions 44, 68 and/or 70 of the DNA binding
domain. However, the instant invention also includes different
proteins able to form heterodimers: heterodimerization of two
different proteins from the above list result also in cleavage of
non palindromic sequences, made of two halves from the sites
cleaved by the parental proteins alone. This can be obtained in
vitro by adding the two different I-CreI variants in the reaction
buffer, and in vivo or ex vivo by coexpression. Another possibility
is to build a single-chain molecule, as described by Epinat et al.
(Epinat et al., 2003). This single chain molecule would be the
fusion of two different I-CreI variants, and should also result in
the cleavage of chimeric, non-palindromic sequences.
[0088] According to an advantageous embodiment of said I-CreI
meganuclease variant, the amino acid residue chosen for the
replacement of the amino acid in positions 44, 68 and/or 70 is
selected in the group comprising A, D, E, G, H, K, N, P, Q, R, S, T
and Y.
[0089] According to another advantageous embodiment, said I-CreI
meganuclease variant is selected in the group consisting of:
A44/A68/A70, A44/A68/G70, A44/A68/H70, A44/A68/K70, A44/A68/N70,
A44/A68/Q70, A44/A68/S70, A44/A68/T70, A44/D68/H70, A44/D68/K70,
A44/D68/R70, A44/G68/H70, A44/G68/K70, A44/G68/N70, A44/G68/P70,
A44/H68/A70, A44/H68/G70, A44/H68/H70, A44/H68/K70, A44/H68/N70,
A44/H68/Q70, A44/H68/S70, A44/H68/T70, A44/K68/A70, A44/K68/G70,
A44/K68/H70, A44/K68/N70, A44/K68/Q70, A44/K68/R70, A44/K68/S70,
A44/K68/T70, A44/N68/A70, A44/N68/E70, A44/N68/G70, A44/N68/H70,
A44/N68/K70, A44/N68/N70, A44/N68/Q70, A44/N68/R70, A44/N68/S70,
A44/N68/T70, A44/Q68/A70, A44/Q68/D70, A44/Q68/G70, A44/Q68/H70,
A44/Q68/N70, A44/Q68/S70, A44/R68/E70, A44/R68/K70, A44/R68/L70,
A44/S68/A70, A44/S68/G70, A44/S68/N70, A44/S68/Q70, A44/S68/R70,
A44/S68/S70, A44/S68/T70, A44/T68/A70, A44/T68/G70, A44/T68/H70,
A44/T68/N70, A44/T68/Q70, A44/T68/S70, A44/T68/T70, D44/D68/H70,
D44/N68/S70, D44/R68/A70, D44/R68/N70, D44/R68/Q70, D44/R68/R70,
D44/R68/S70, D44/R68/T70, E44/H68/H70, E44/R68/A70, E44/R68/H70,
E44/R68/N70, E44/R68/S70, E44/R68/T70, E44/S68/T70, G44/H68/K70,
G44/Q68/H70, G44/R68/Q70, G44/T68/D70, G44/T68/P70, G44/T68/R70,
H44/A68/S70, H44/A68/T70, H44/R68/D70, H44/R68/E70, H44/R68/G70,
H44/R68/N70, H44/R68/R70, H44/R68/S70, H44/S68/G70, H44/S68/S70,
H44/S68/T70, H44/T68/S70, H44/T68/T70, K44/A68/A70, K44/A68/D70,
K44/A68/E70, K44/A68/G70, K44/A68/H70, K44/A68/N70, K44/A68/Q70,
K44/D68/A70, K44/D68/T70, K44/E68/G70, K44/E68/S70, K44/G68/A70,
K44/G68/G70, K44/G68/N70, K44/G68/S70, K44/G68/T70, K44/H68/D70,
K44/H68/E70, K44/H68/G70, K44/H68/N70, K44/H68/S70, K44/H68/T70,
K44/K68/A70, K44/K68/D70, K44/K68/H70, K44/K68/T70, K44/N68/A70,
K44/N68/D70, K44/N68/E70, K44/N68/G70, K44/N68/H70, K44/N68/N70,
K44/N68/Q70, K44/N68/S70, K44/N68/T70, K44/P68/H70, K44/Q68/A70,
K44/Q68/D70, K44/Q68/E70, K44/Q68/S70, K44/Q68/T70, K44/R68/A70,
K44/R68/D70, K44/R68/E70, K44/R68/G70, K44/R68/H70, K44/R68/N70,
K44/R68/S70, K44/S68/A70, K44/S68/D70, K44/S68/H70, K44/S68/N70,
K44/S68/S70, K44/S68/T70, K44/T68/A70, K44/T68/D70, K44/T68/E70,
K44/T68/G70, K44/T68/H70, K44/T68/N70, K44/T68/Q70, K44/T68/S70,
K44/T68/T70, N44/A68/H70, N44/H68/N70, N44/H68/R70, N44/K68/G70,
N44/K68/H70, N44/K68/R70, N44/K68/S70, N44/P68/D70, N44/Q68/H70,
N44/R68/A70, N44/R68/D70, N44/R68/E70, N44/R68/K70, N44/S68/G70,
N44/S68/H70, N44/S68/K70, N44/S68/R70, N44/T68/H70, N44/T68/K70,
N44/T68/Q70, N44/T68/S70, P44/N68/D70, P44/T68/T70, Q44/G68/K70,
Q44/G68/R70, Q44/K68/G70, Q44/N68/A70, Q44/N68/H70, Q44/N68/S70,
Q44/P68/P70, Q44/Q68/G70, Q44/R68/D70, Q44/R68/E70, Q44/R68/G70,
Q44/R68/Q70, Q44/S68/S70, Q44/T68/A70, Q44/T68/G70, Q44/T68/H70,
R44/A68/G70, R44/A68/T70, R44/G68/T70, R44/H68/D70, R44/H68/T70,
R44/N68/T70, R44/R68/A70, R44/R68/D70, R44/R68/E70, R44/R68/G70,
R44/R68/Q70, R44/R68/S70, R44/R68/T70, R44/S68/G70, R44/S68/N70,
R44/S68/S70, R44/S68/T70, S44/D68/K70, S44/R68/R70, S44/R68/S70,
T44/A68/K70, T44/N68/P70, T44/N68/R70, T44/R68/E70, T44/R68/Q70,
and T44/S68/K70; said I-CreI meganuclease variant is able to cleave
at least one target, as defined above, that is not cleaved by the
I-CreI N75 scaffold protein.
[0090] According to yet another advantageous embodiment, the I-CreI
meganuclease variant has an alanine (A) or an asparagine (N), in
position 44, and cleaves a target comprising the nucleotide a in
position -4, and/or t in position +4, with the exclusion of the
variants presented in Table 4 and Table 5 of the International PCT
Application WO 2004/067736, preferably said variant has an alanine
or an asparagine.
[0091] According to yet another advantageous embodiment, the I-CreI
meganuclease variant has a glutamine (Q) and cleaves a target
comprising the nucleotide t in position -4, and/or a in position +4
in position 44, with the exclusion of the variants presented in
Table 3, Table 4 and Table 5 of the International PCT Application
WO 2004/067736.
[0092] According to yet another advantageous embodiment, the I-CreI
meganuclease variant of the invention has a lysine (K) in position
44, and cleaves a target comprising c in position -4, and/or g in
position +4, with the exclusion of the variant presented Table 5 of
the International PCT Application WO 2004/067736.
[0093] As specified hereabove, in the frame of the definition of
the I-CreI meganuclease variant in the use application, said I-CreI
meganuclease variant may be a homodimer or a heterodimer. It may be
able to cleave a palindromic or a non-palindromic DNA target. It
may further comprise a mutation in position 75, as specified
hereabove.
[0094] The subject-matter of the present invention is also a
polynucleotide, characterized in that it encodes a I-CreI
meganuclease variant according to the invention.
[0095] Further, the subject-matter of the present invention is an
expression cassette comprising said polynucleotide and regulation
sequences such as a promoter, and an expression vector comprising
said expression cassette. When said variant is an heterodimer
consisting of two different monomers, each monomer may be expressed
from a single vector (dual expression vector) or from two different
vectors.
[0096] The subject-matter of the present invention is also an
expression vector, as described above, further comprising a
targeting DNA construct.
[0097] The term "vector" refers to a nucleic acid molecule capable
of transporting another nucleic acid to which it has been linked.
One type of preferred vector is an episome, i.e., a nucleic acid
capable of extra-chromosomal replication. Preferred vectors are
those capable of autonomous replication and/or expression of
nucleic acids to which they are linked. Vectors capable of
directing the expression of genes to which they are operatively
linked are referred to herein as "expression vectors A vector
according to the present invention comprises, but is not limited
to, a YAC (yeast artificial chromosome), a BAC (bacterial
artificial), a baculovirus vector, a phage, a phagemid, a cosmid, a
viral vector, a plasmid, a RNA vector or a linear or circular DNA
or RNA molecule which may consist of chromosomal, non chromosomal,
semi-synthetic or synthetic DNA. In general, expression vectors of
utility in recombinant DNA techniques are often in the form of
"plasmids" which refer generally to circular double stranded DNA
loops which, in their vector form are not bound to the chromosome.
Large numbers of suitable vectors are known to those of skill in
the art and commercially available, such as the following bacterial
vectors: pQE7O, pQE6O, pQE-9 (Qiagen), pbs, pDIO, phagescript,
psiX174. pbluescript SK, pbsks, pNH8A, pNH16A, pNH18A, pNH46A
(Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pR1T5
(Pharmacia); pWLNEO, pSV2CAT, pOG44, pXTI, pSG (Stratagene); pSVK3,
pBPV, pMSG, pSVL (Pharmacia); pQE-30 (Q1Aexpress), pET
(Novagen).
[0098] Viral vectors include retrovirus, adenovirus, parvovirus (e.
g. adenoassociated viruses), coronavirus, negative strand RNA
viruses such as orthomyxovirus (e. g., influenza virus),
rhabdovirus (e.g., rabies and vesicular stomatitis virus),
paramyxovirus (e. g. measles and Sendai), positive strand RNA
viruses such as picornavirus and alphavirus, and double-stranded
DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex
virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and
poxvirus (e.g., vaccinia, fowlpox and canarypox). Other viruses
include Norwalk virus, togavirus, flavivirus, reoviruses,
papovavirus, hepadnavirus, and hepatitis virus, for example.
[0099] Vectors can comprise selectable markers, for example:
neomycin phosphotransferase, histidinol dehydrogenase,
dihydrofolate reductase, hygromycin phosphotransferase, herpes
simplex virus thymidine kinase, adenosine deaminase, glutamine
synthetase, and hypoxanthine-guanine phosphoribosyl transferase for
eukaryotic cell culture; TRP1 for S. cerevisiae; tetracycline,
rifampicin or ampicillin resistance in E. coli.
[0100] Preferably said vectors are expression vectors, wherein the
sequences encoding the polypeptides of the invention are placed
under control of appropriate transcriptional and translational
control elements to permit production or synthesis of said
polypeptides. Therefore, said polynucleotides are comprised in
expression cassette(s). More particularly, the vector comprises a
replication origin, a promoter operatively linked to said encoding
polynucleotide, a ribosome binding site, an RNA-splicing site (when
genomic DNA is used), a polyadenylation site and a transcription
termination site. It also can comprise an enhancer. Selection of
the promoter will depend upon the cell in which the polypeptide is
expressed.
[0101] According to an advantageous embodiment of said expression
vector, said targeting DNA construct comprises a sequence sharing
homologies with the region surrounding the cleavage site of the
I-CreI meganuclease variant of the invention.
[0102] According to another advantageous embodiment of said
expression vector, said targeting DNA construct comprises:
[0103] a) sequences sharing homologies with the region surrounding
the cleavage site of the I-CreI meganuclease variant according to
claim, and
[0104] b) sequences to be introduced flanked by sequence as in
a).
[0105] The subject-matter of the present invention is also a cell,
characterized in that it is modified by a polynucleotide as defined
above or by a vector as defined above.
[0106] The subject-matter of the present invention is also a
transgenic plant, characterized in that it comprises a
polynucleotide as defined above, or a vector as defined above.
[0107] The subject-matter of the present invention is also a
non-human transgenic mammal, characterized in that it comprises a
polynucleotide as defined above or a vector as defined above.
[0108] The polynucleotide sequences encoding the polypeptides as
defined in the present invention may be prepared by any method
known by the man skilled in the art. For example, they are
amplified from a cDNA template, by polymerase chain reaction with
specific primers. Preferably the codons of said cDNA are chosen to
favour the expression of said protein in the desired expression
system.
[0109] The recombinant vector comprising said polynucleotides may
be obtained and introduced in a host cell by the well-known
recombinant DNA and genetic engineering techniques.
[0110] The heterodimeric meganuclease of the invention is produced
by expressing the two polypeptides as defined above; preferably
said polypeptides are co-expressed in a host cell modified by two
expression vectors, each comprising a polynucleotide fragment
encoding a different polypeptide as defined above or by a dual
expression vector comprising both polynucleotide fragments as
defined above, under conditions suitable for the co-expression of
the polypeptides, and the heterodimeric meganuclease is recovered
from the host cell culture.
[0111] The subject-matter of the present invention is further the
use of a I-CreI meganuclease variant, one or two polynucleotide(s),
preferably both included in one expression vector (dual expression
vector) or each included in a different expression vector, a cell,
a transgenic plant, a non-human transgenic mammal, as defined
above, for molecular biology, for in vivo or in vitro genetic
engineering, and for in vivo or in vitro genome engineering, for
non-therapeutic purposes.
[0112] Non therapeutic purposes include for example (i) gene
targeting of specific loci in cell packaging lines for protein
production, (ii) gene targeting of specific loci in crop plants,
for strain improvements and metabolic engineering, (iii) targeted
recombination for the removal of markers in genetically modified
crop plants, (iv) targeted recombination for the removal of markers
in genetically modified microorganism strains (for antibiotic
production for example).
[0113] According to an advantageous embodiment of said use, it is
for inducing a double-strand break in a site of interest comprising
a DNA target sequence, thereby inducing a DNA recombination event,
a DNA loss or cell death.
[0114] According to the invention, said double-strand break is for:
repairing a specific sequence, modifying a specific sequence,
restoring a functional gene in place of a mutated one, attenuating
or activating an endogenous gene of interest, introducing a
mutation into a site of interest, introducing an exogenous gene or
a part thereof, inactivating or deleting an endogenous gene or a
part thereof, translocating a chromosomal arm, or leaving the DNA
unrepaired and degraded.
[0115] According to another advantageous embodiment of said use,
said I-CreI meganuclease variant, polynucleotide, vector, cell,
transgenic plant or non-human transgenic mammal are associated with
a targeting DNA construct as defined above.
[0116] The subject-matter of the present invention is also a method
of genetic engineering, characterized in that it comprises a step
of double-strand nucleic acid breaking in a site of interest
located on a vector, comprising a DNA target of a I-CreI
meganuclease variant as defined hereabove, by contacting said
vector with a I-CreI meganuclease variant as defined above, thereby
inducing a homologous recombination with another vector presenting
homology with the sequence surrounding the cleavage site of said
I-CreI meganuclease variant.
[0117] The subjet-matter of the present invention is also a method
of genome engineering, characterized in that it comprises the
following steps: 1) double-strand breaking a genomic locus
comprising at least one recognition and cleavage site of a I-CreI
meganuclease variant as defined above, by contacting said cleavage
site with said I-CreI meganuclease variant; 2) maintaining said
broken genomic locus under conditions appropriate for homologous
recombination with a targeting DNA construct comprising the
sequence to be introduced in said locus, flanked by sequences
sharing homologies with the target locus.
[0118] The subjet-matter of the present invention is also a method
of genome engineering, characterized in that it comprises the
following steps: 1) double-strand breaking a genomic locus
comprising at least one recognition and cleavage site of a I-CreI
meganuclease variant as defined above, by contacting said cleavage
site with said I-CreI meganuclease variant; 2) maintaining said
broken genomic locus under conditions appropriate for homologous
recombination with chromosomal DNA sharing homologies to regions
surrounding the cleavage site.
[0119] The subject-matter of the present invention is also a
composition characterized in that it comprises at least one I-CreI
meganuclease variant, a polynucleotide or a vector as defined
above.
[0120] In a preferred embodiment of said composition, it comprises
a targeting DNA construct comprising the sequence which repairs the
site of interest flanked by sequences sharing homologies with the
targeted locus.
[0121] The subject-matter of the present invention is also the use
of at least one I-CreI meganuclease variant, a polynucleotide or a
vector, as defined above for the preparation of a medicament for
preventing, improving or curing a genetic disease in an individual
in need thereof, said medicament being administrated by any means
to said individual.
[0122] The subject-matter of the present invention is also the use
of at least one I-CreI meganuclease variant, a polynucleotide or a
vector as defined above for the preparation of a medicament for
preventing, improving or curing a disease caused by an infectious
agent that presents a DNA intermediate, in an individual in need
thereof, said medicament being administrated by any means to said
individual.
[0123] The subject-matter of the present invention is also the use
of at least one I-CreI meganuclease variant, a polynucleotide or a
vector, as defined above, in vitro, for inhibiting the propagation,
inactivating or deleting an infectious agent that presents a DNA
intermediate, in biological derived products or products intended
for biological uses or for disinfecting an object.
[0124] In a particular embodiment, said infectious agent is a
virus.
[0125] In addition to the preceding features, the invention further
comprises other features which will emerge from the description
which follows, which refers to examples illustrating the I-CreI
meganuclease variants and their uses according to the invention, as
well as to the appended drawings in which:
[0126] FIG. 1 illustrates the rationale of the experiments. (a)
Structure of I-CreI bound to its DNA target. (b) Zoom of the
structure showing residues 44, 68, 70 chosen for randomization, D75
and interacting base pairs. (c) Design of the library and targets.
The interactions of I-CreI residues Q44, R68 an R70 with DNA
targets are indicated (top). Other amino acid residues interacting
directly or indirectly with the DNA target are not shown. Arginine
(R) residue in position 44 of a I-CreI monomer directly interacts
with guanine in position -5 of the target sequence, while glutamine
(Q) residue of position 44 and Arginine (R) residue of position 70
directly interact with adenine in position +4 and guanine in
position +3 of the complementary strand, respectively. The target
described here (C1221, SEQ ID NO: 12) is a palindrome derived from
the I-CreI natural target (C 1234, SEQ ID NO:65), and cleaved by
I-CreI (Chevalier et al., 2003, precited). Cleavage positions are
indicated by arrowheads. In the library, residues 44, 68 and 70 are
replaced with ADEGHKNPQRST. Since I-CreI is an homodimer, the
library was screened with palindromic targets. Sixty four
palindromic targets resulting from substitutions in positions
.+-.3, .+-.4 and .+-.5 were generated. A few examples of such
targets are shown (bottom; SEQ ID NO: 1 to 7).
[0127] FIG. 2 illustrates the target used in the study. A. Two
palindromic targets derived from the natural I-CreI target (here
named C 1234, SEQ ID NO: 65). The I-CreI natural target contains
two palindromes, boxed in grey: the -8 to -12 and +8 to +12
nucleotides on one hand, and the -5 to -3 and +3 to +5 nucleotide
on another hand. Vertical dotted line, from which are numbered the
nucleotide bases, represents the symmetry axe for the palindromic
sequences. From the natural target can be derived two palindromic
sequences, C1221 (SEQ ID NOS: 1-6, 81, 8-18, 82-83, 21-27, 84,
29-31, 85, 33-38, 86, 40-50, 87-88, 53-59, 89, 61-63 and 90,
respectively, in order of appearance) and C4334 (SEQ ID NO:66).
Both are cut by I-CreI, in vitro and in yeast. Only one strand of
each target site is shown. B. The 64 targets. The 64 targets (SEQ
ID NO: 1 to 64) are derived from C1221 (SEQ ID NO: 12) a palindrome
derived from the I-CreI natural target (C1234, SEQ ID NO:65), and
cleaved by I-CreI (Chevalier et al., 2003, precited). They
correspond to all the 24 by palindromes resulting from
substitutions at positions -5, -4, -3, +3, +4 and +5.
[0128] FIG. 3 illustrates the screening of the variants. (a) Yeast
are transformed with the meganuclease expressing vector, marked
with the LEU2 gene, and individually mated with yeast transformed
with the reporter plasmid, marked by the TRP1 gene. In the reporter
plasmid, a LacZ reporter gene is interrupted with an insert
containing the site of interest, flanked by two direct repeats. In
diploids (LEU2 TRP1), cleavage of the target site by the
meganuclease (white oval) induces homologous recombination between
the two lacZ repeats, resulting in a functional beta-galactosidase
gene (grey oval), which can be monitored by X-Gal staining. (b)
Scheme of the experiment. A library of I-CreI variants is built
using PCR, cloned into a replicative yeast expression vector and
transformed in S. cerevisiae strain FYC2-6A (MAT.alpha.,
trp1.DELTA.63, leu2.DELTA.1, his3.DELTA.200). The 64 palindromic
targets are cloned in the LacZ-based yeast reporter vector, and the
resulting clones transformed into strain FYBL2-7B (MATa,
ura3.DELTA.851, trp1.DELTA.63, leu2.DELTA.1, lys2.DELTA.202).
Robot-assisted gridding on filter membrane is used to perform
mating between individual clones expressing meganuclease variants
and individual clones harboring a reporter plasmid. After primary
high throughput screening, the ORF of positive clones are amplified
by PCR and sequenced. 410 different variants were identified among
the 2100 positives, and tested at low density, to establish
complete patterns, and 350 clones were validated. Also, 294 mutants
were recloned in yeast vectors, and tested in a secondary screen,
and results confirmed those obtained without recloning. Chosen
clones are then assayed for cleavage activity in a similar
CHO-based assay and eventually in vitro.
[0129] FIG. 4 represents the cDNA sequence encoding the I-CreI N75
scaffold protein and degenerated primers used for the Ulib2 library
construction. A. The coding sequence (CDS) of the scaffold protein
(SEQ ID NO: 69) is from base-pair 1 to base-pair 501 and the "STOP"
codon TGA (not shown) follows the base-pair 501. In addition to the
D75N mutation, the protein further contains mutations that do not
alter its activity; in the protein sequence (SEQ ID NO:70), the two
first N-terminal residues are methionine and alanine (MA), and the
three C-terminal residues alanine, alanine and aspartic acid
(AAD).B. Degenerated primers (SEQ ID NO: 67, 68).
[0130] FIG. 5 represents the pCLS0542 meganuclease expression
vector map. The meganuclease expression vector is marked with LEU2.
cDNAs encoding I-CreI meganuclease variants are cloned into this
vector digested with NcoI and EagI, in order to have the variant
expression driven by the inducible Gal10 promoter.
[0131] FIG. 6 represents the pCLS0042 reporter vector map. The
reporter vector is marked with TRP1 and URA3. The LacZ tandem
repeats share 800 by of homology, and are separated by 1,3 kb of
DNA. They are surrounded by ADH promoter and terminator sequences.
Target sites are cloned into the SmaI site.
[0132] FIG. 7 illustrates the cleavage profile of 292 I-CreI
meganuclease variants with a modified specificity. The variants
derive from the I-CreI N75 scaffold protein. Proteins are defined
by the amino acid present in positions 44, 68 and 70 (three first
columns). Numeration of the amino acids is according to pdb
accession code 1g9y. Targets are defined by nucleotides at
positions -5 to -3. For each protein, observed cleavage (1) or non
observed cleavage (0) is shown for each one of the 64 targets.
[0133] FIG. 8 illustrates eight examples I-CreI variants cleavage
pattern. The meganucleases are tested 4 times against the 64
targets described in FIG. 2B. The position of the different targets
is indicated on the top, left panel. The variants which derive from
the I-CreI N75 scaffold protein, are identified by the amino acids
in positions 44, 68 and 70 (ex: KSS is K44, S68, S70 and N75, or
K44/S68/S70). Numeration of the amino acids is according to pdb
code 1g9y. QRR corresponds to I-CreI N75. The cleaved targets are
indicated besides the panels.
[0134] FIG. 9 illustrates the cleavage patterns of the variants.
Mutants are identified by three letters, corresponding to the
residues in positions 44, 68 and 70. Each mutant is tested versus
the 64 targets derived from the I-CreI natural targets, and a
series of control targets. Target map is indicated in the top right
panel. (a) Cleavage patterns in yeast (left) and mammalian cells
(right) for the wild-type I-CreI (I-CreI) and I-CreI N75 (QRR)
proteins, and 7 derivatives of the I-CreI N75 protein. For yeast,
the initial raw data (filter) is shown. For CHO cells, quantitative
raw data (ONPG measurement) are shown, values superior to 0.25 are
boxed, values superior to 0.5 are highlighted in medium grey,
values superior to 1 in dark grey. LacZ: positive control. 0: no
target. U1, U2 and U3: three different uncleaved controls. (b)
Cleavage in vitro. I-CreI and four mutants are tested against a set
of 2 or 4 targets, including the target resulting in the strongest
signal in yeast and CHO. Digests are performed at 37.degree. C. for
1 hour, with 2 nM linearized substrate, as described in Methods.
Raw data are shown for I-CreI with two different targets. With both
ggg and cct, cleavage is not detected with I-CreI.
[0135] FIG. 10 represents the statistical analysis. (a) Cleaved
targets: targets cleaved by I-CreI variants are colored in grey.
The number of proteins cleaving each target is shown below, and the
level of grey coloration is proportional to the average signal
intensity obtained with these cutters in yeast. (b) Analysis of 3
out of the 7 clusters. For each mutant cluster (clusters 1, 3 and
7), the cumulated intensities for each target was computed and a
bar plot (left column) shows in decreasing order the normalized
intensities. For each cluster, the number of amino acid of each
type at each position (44, 68 and 70) is shown as a coded histogram
in the right column. The legend of amino-acid color code is at the
bottom of the figure. (b) Hierarchical clustering of mutant and
target data in yeast. Both mutants and targets were clustered using
hierarchical clustering with Euclidean distance and Ward's method
(Ward, J. H., American statist. Assoc., 1963, 58, 236-244).
Clustering was done with hclust from the R package. Mutants and
targets dendrograms were reordered to optimize positions of the
clusters and the mutant dendrogram was cut at the height of 8 with
deduced clusters. QRR mutant and GTC target are indicated by an
arrow. Gray levels reflects the intensity of the signal.
[0136] FIG. 11 illustrates an example of hybrid or chimeric site:
gtt (SEQ ID NO: 79) and cct (SEQ ID NO: 77) are two palindromic
sites derived from the I-CreI site. The gtt/cct hybrid site (SEQ ID
NO: 80) displays the gtt sequence on the top strand in -5, -4, -3
and the cct sequence on the bottom strand in 5, 4, 3.
[0137] FIG. 12 illustrates the cleavage activity of the
heterodimeric variants. Yeast were co-transformed with the KTG and
QAN variants. Target organization is shown on the top panel: target
with a single gtt, cct or gcc half site are in bold; targets with
two such half sites, which are expected to be cleaved by homo-
and/or heterodimers, are in bold and highlighted in grey; 0: no
target. Results are shown on the three panels below. Unexpected
faint signals are observed only for gtc/cct and gtt/gtc, cleaved by
KTG and QAN, respectively.
[0138] FIG. 13 represents the quantitative analysis of the cleavage
activity of the heterodimeric variants. (a) Co-transformation of
selected mutants in yeast. For clarity, only results on relevant
hybrid targets are shown. The aac/acc target is always shown as an
example of unrelated target. For the KTGxAGR couple, the
palindromic tac and tct targets, although not shown, are cleaved by
AGR and KTG, respectively. Cleavage of the cat target by the RRN
mutant is very low, and could not be quantified in yeast. (b)
Transient co-transfection in CHO cells. For (a) and (b), Black
bars: signal for the first mutant alone; grey bars: signal for the
second mutant alone; striped bars: signal obtained by co-expression
or cotransfection.
[0139] FIG. 14 illustrates the activity of the assembled
heterodimer ARS-KRE on the selected mouse chromosome 17 DNA target.
CHO-K1 cell line were co-transfected with equimolar of target LagoZ
plasmid, ARS and KRE expression plasmids, and the beta
galactosidase activity was measured. Cells co-transfected with the
LagoZ plasmid and the I-SceI, I-CreI, ARS or KRE recombinant
plasmid or an empty plasmid were used as control.
EXAMPLES
[0140] The following examples are presented here only for
illustrating the invention and not for limiting the scope thereof.
Other variants, obtained from a cDNA, which sequence differs from
SEQ ID NO: 69, and using appropriate primers, are still part of the
invention.
Example 1
Screening for New Functional Endonucleases
[0141] The method for producing meganuclease variants and the
assays based on cleavage-induced recombination in mammal or yeast
cells, which are used for screening variants with altered
specificity, are described in the International PCT Application WO
2004/067736. These assays result in a functional LacZ reporter gene
which can be monitored by standard methods (FIG. 3a).
A) Material and Methods
a) Construction of Mutant Libraries
[0142] I-CreI wt and I-CreI D75N (or I-CreI N75) open reading
frames (SEQ ID NO:69, FIG. 4A) were synthesized, as described
previously (Epinat et al., N.A.R., 2003, 31, 2952-2962). Mutation
D75N was introduced by replacing codon 75 with aac. The diversity
of the meganuclease library was generated by PCR using degenerate
primers from Sigma harboring codon VVK (18 codons, amino acids
ADEGHKNPQRST) at position 44, 68 and 70 which interact directly
with the bases at positions 3 to 5, and as DNA template, the I-CreI
D75N gene. Such primers allow mutation of residues 44, 68 and 70
with a theoretical diversity of 12. Briefly, forward primer
(5'-gtttaaacatcagctaagattgacctttvvkgtgacttcaaaagacccag-3', SEQ ID
NO: 67) and reverse primer
(5'-gatgtagttggaaacggatccmbbatcmbbtacgtaaccaacgcc-3', SEQ ID NO:
68) were used to amplify a PCR fragment in 50 .mu.l PCR reactions:
PCR products were pooled, EtOH precipitated and resuspended in 50
.mu.l 10 mM Tris. PCR products were cloned into a pET expression
vector containing the I-CreI D75N gene, digested with appropriate
restriction enzymes. Digestion of vector and insert DNA were
conducted in two steps (single enzyme digestion) between which the
DNA sample was extracted (using classic
phenol:chloroform:isoamylalcohol-based methods) and
EtOH-precipitated. 10 .mu.g of digested vector DNA were used for
ligation, with a 5:1 excess of insert DNA. E coli TG1 cells were
transformed with the resulting vector by electroporation. To
produce a number of cell clones above the theoretical diversity of
the library, 6.times.10.sup.4 clones were produced. Bacterial
clones were scraped from plates and the corresponding plasmid
vectors were extracted and purified.
[0143] The library was recloned in the yeast pCLS0542 vector (FIG.
5), by sub-cloning a NcoI-EagI DNA fragment containing the entire
I-CreI D75N ORF. In this 2 micron-based replicative vector marked
with the LEU2 gene, I-CreI variants are under the control of a
galactose inducible promoter (Epinat et al., precited). After
electroporation in E. coli, 7.times.10.sup.4 clones were obtained
7.times.10.sup.4 clones, representing 12 times the theoretical
diversity at the DNA level (18.sup.3=5832). DNA was extracted and
transformed into S. cerevisiae strain FYC2-6A (MAT.alpha.,
trp1.DELTA.63, leu2.DELTA.1, his3.DELTA.200). 13824 colonies were
picked using a colony picker (QpixII, GENETIX), and grown in 144
microtiter plates.
b) Construction of Target Clones
[0144] The C1221 twenty-four by palindrome
(tcaaaacgtcgtacgacgttttga, SEQ ID NO: 12) is a repeat of the
half-site of the nearly palindromic natural I-CreI target
(tcaaaacgtcgtgagacagtttgg, SEQ ID NO: 65). C1221 is cleaved as
efficiently as the I-CreI natural target in vitro and ex vivo in
both yeast and mammalian cells. The 64 palindromic targets were
derived as follows: 64 pair of oligonucleotides
(ggcatacaagtttcaaaacnnngtacnnngttttgacaatcgtctgtca (SEQ ID NO: 72)
and reverse complementary sequences) corresponding to the two
strands of the 64 DNA targets, with 12 pb of non palindromic extra
sequence on each side, were ordered form Sigma, annealed and cloned
into pGEM-T Easy (PROMEGA). Next, a 400 by PvuII fragment was
excised from each one of the 64 pGEM-T-derived vector and cloned
into the yeast vector pFL39-ADH-LACURAZ, described previously
(Epinat et al., precited), also called pCLS0042 (FIG. 6), resulting
in 64 yeast reporter vectors. Steps of excision, digestion and
ligation are performed using typical methods known by those skilled
in the art. Insertion of the target sequence is made at the SmaI
site of pCLS0042. The 64 palindromic targets are described in FIG.
2B (positions -5 to -3 and +3 to +5, SEQ ID NOS: 1-6, 81, 8-18,
82-83, 21-27, 84, 29-31, 85, 33-38, 86, 40-50, 87-88, 53-59, 89,
61-63 and 90, respectively, in order of appearance).
c) Yeast Strains and Transformation
[0145] The library of meganuclease expression variants and the
A44/R68/L70 variant, were transformed into strain FYC2-6A
(MAT.alpha., trp1.DELTA.63, leu2.DELTA.1, his3.DELTA.200).
[0146] The target plasmids were transformed into yeast strain
FYBL2-7B: (MAT.alpha., ura3.DELTA.851, trp1.DELTA.63, leu2.DELTA.1,
lys2.DELTA.202).
[0147] For transformation, a classical chemical/heat choc protocol
can be used, and routinely gives 10.sup.6 independent transformants
per .mu.g of DNA; transformants were selected on leucine drop-out
synthetic medium (Gietz and Woods, 2002).
d) Mating of Meganuclease Expressing Clones and Screening in
Yeast
[0148] I-CreI variant clones as well as yeast reporter strains were
stocked in glycerol (20%) stock and replicated in novel
microplates. Mutants were gridded on nylon filters covering YPD
plates, using a high gridding density (about 20 spots/cm.sup.2). A
second gridding process was performed on the same filters to spot a
second layer consisting of 64 or 75 different reporter-harboring
yeast strains for each variant. Briefly, each reporter strain was
spotted 13 824 times on a nylon membrane, and on each one of this
spot was spotted one out of the 13 824 yeast clones expressing a
variant meganuclease. Membranes were placed on solid agar YPD rich
medium, and incubated at 30.degree. C. for one night, to allow
mating. Next, filters were transferred to synthetic medium, lacking
leucine and tryptophan, with galactose (1%) as a carbon source (and
with G418 for coexpression experiments), and incubated for five
days at 37.degree. C., to select for diploids carrying the
expression and target vectors. After 5 days, filters were placed on
solid agarose medium with 0.02% X-Gal in 0.5 M sodium phosphate
buffer, pH 7.0, 0.1% SDS, 6% dimethyl formamide (DMF), 7 mM
.beta.-mercaptoethanol, 1% agarose, and incubated at 37.degree. C.,
to monitor .beta.-galactosidase activity. Positive clones were
identified after two days of incubation, according to staining.
Results were analyzed by scanning and quantification was performed
using a proprietary software. For secondary screening, the same
procedure was followed with the 292 selected positives, except that
each mutant was tested 4 times on the same membrane (see FIGS. 8
and 9a).
d) Sequence and Re-Cloning of Primary Hits
[0149] The open reading frame (ORF) of positive clones identified
during the primary screening in yeast was amplified by PCR and
sequenced. Then, ORFs were recloned using the Gateway protocol
(Invitrogen). ORFs were amplified by PCR on yeast colonies (Akada
et al., Biotechniques, 28, 668-670, 672-674), using primers:
ggggacaagtttgtacaaaaaagcaggcttcgaaggagatagaaccatggccaataccaaatataacaaagag-
ttcc (SEQ ID NO: 73) and
ggggaccactttgtacaagaaagctgggtttagtcggccgccggggaggatttcttcttctcgc
(SEQ ID NO: 74) from PROLIGO. PCR products were cloned in: (i)
yeast gateway expression vector harboring a galactose inducible
promoter, LEU2 or KanR as selectable marker and a 2 micron origin
of replication, and (ii) a pET 24d(+) vector from NOVAGEN.
Resulting clones were verified by sequencing (MILLEGEN).
B) Results
[0150] I-CreI is a dimeric homing endonuclease that cleaves a 22 by
pseudo-palindromic target. Analysis of I-CreI structure bound to
its natural target has shown that in each monomer, eight residues
establish direct interactions with seven bases (Jurica et al.,
1998, precited). Residues Q44, R68, R70 contact three consecutive
base pairs at position 3 to 5 (and -3 to -5, FIG. 1). An exhaustive
protein library vs. target library approach was undertaken to
engineer locally this part of the DNA binding interface. First, the
I-CreI scaffold was mutated from D75 to N to decrease likely
energetic strains caused by the replacement of the basic residues
R68 and R70 in the library that satisfy the hydrogen-acceptor
potential of the buried D75 in the I-CreI structure. Homodimers of
mutant D75N (purified from E. coli cells wherein it was
over-expressed using a pET expression vector) were shown to cleave
the I-CreI homing site. The D75N mutation did not affect the
protein structure, but decreased the toxicity of I-CreI in
overexpression experiments. Next, positions 44, 68 and 70 were
randomized and 64 palindromic targets resulting from substitutions
in positions .+-.3, .+-.4 and .+-.5 of a palindromic target cleaved
by I-CreI (Chevalier et al., 2003, precited) were generated, as
described in FIGS. 1 and 2B. Eventually, mutants in the protein
library corresponded to independant combinations of any of the 12
amino acids encoded by the vvk codon at three residue positions. In
consequence, the maximal (theoretical) diversity of the protein
library was 12.sup.3 or 1728. However, in terms of nucleic acids,
the diversity is 18.sup.3 or 5832.
[0151] The resulting library was cloned in a yeast replicative
expression vector carrying a LEU2 auxotrophic marker gene and
transformed into a leu2 mutant haploid yeast strain (FYC2-6A). The
64 targets were cloned in the appropriate yeast reporter vector and
transformed into an haploid strain (FYBL2-7B), resulting in 64
tester strains.
[0152] A robot-assisted mating protocol was used to screen a large
number of meganucleases from our library. The general screening
strategy is described in FIG. 3b. 13,8247 meganuclease expressing
clones (about 2.3-fold the theoretical diversity) were spotted at
high density (20 spots/cm.sup.2) on nylon filters and individually
tested against each one of the 64 target strains (884,608 spots).
2100 clones showing an activity against at least one target were
isolated (FIG. 3b) and the ORF encoding the meganuclease was
amplified by PCR and sequenced. 410 different sequences were
identified and a similar number of corresponding clones were chosen
for further analysis. The spotting density was reduced to 4
spots/cm.sup.2 and each clone was tested against the 64 reporter
strains in quadruplicate, thereby creating complete profiles (as in
FIGS. 8 and 9a). 350 positives could be confirmed. Next, to avoid
the possibility of strains containing more than one clone, mutant
ORFs were amplified by PCR, and recloned in the yeast vector. The
resulting plasmids were individually transformed back into yeast.
294 such clones were obtained and tested at low density (4
spots/cm.sup.2). Differences with primary screening were observed
mostly for weak signals, with 28 weak cleavers appearing now as
negatives. Only one positive clone displayed a pattern different
from what was observed in the primary profiling.
Example 2
I-CreI Meganuclease Variants with Different Cleavage Profiles
[0153] The validated clones from example 1 showed very diverse
patterns. Some of these new profiles shared some similarity with
the initial scaffold whereas many others were totally different.
Various examples of profiles, including wild-type I-CreI and I-CreI
N75, are shown in FIGS. 8 and 9a. The overall results (only for the
292 variants with modified specificity) are summarized in FIG.
7.
[0154] Homing endonucleases can usually accommodate some degeneracy
in their target sequences, and one of our first findings was that
the original I-CreI protein itself cleaves seven different targets
in yeast. Many of our mutants followed this rule as well, with the
number of cleaved sequences ranging from 1 to 21 with an average of
5.0 sequences cleaved (standard deviation=3.6). Interestingly, in
50 mutants (14%), specificity was altered so that they cleaved
exactly one target. 37 (11%) cleaved 2 targets, 61 (17%) cleaved 3
targets and 58 (17%) cleaved 4 targets. For 5 targets and above,
percentages were lower than 10%. Altogether, 38 targets were
cleaved by the mutants (FIG. 10a). It is noteworthy that cleavage
was barely observed on targets with an A in position .+-.3, and
never with targets with tgn and cgn at position .+-.5, .+-.4,
.+-.3.
[0155] These results do not limit the scope of the invention, since
FIG. 7 only shows results obtained with 292 variants (291 out of
the 1728 (or 12.sup.3) I-CreI meganuclease variants obtainable in a
complete library).
Example 3
Novel Meganucleases Can Cleave Novel Targets While Keeping High
Activity and Narrow Specificity
A) Material and Methods
a) Construction of Target Clones
[0156] The 64 palindromic targets were cloned into pGEM-T Easy
(PROMEGA), as described in example 1. Next, a 400 by PvuII fragment
was excised and cloned into the mammalian vector
pcDNA3.1-LACURAZ-AURA, described previously (Epinat et al.,
precited). The 75 hybrid targets sequences were cloned as follows:
oligonucleotides were designed that contained two different half
sites of each mutant palindrome (PROLIGO).
b) Re-Cloning of Primary Hits
[0157] The open reading frame (ORF) of positive clones identified
during the primary screening in yeast was recloned in: (i) a CHO
gateway expression vector pCDNA6.2, following the instructions of
the supplier (INVITROGEN), and ii) a pET 24d(+) vector from NOVAGEN
Resulting clones were verified by sequencing (MILLEGEN).
c) Mammalian Cells Assay
[0158] CHO-K1 cell line from the American Type Culture Collection
(ATCC) was cultured in Ham'sF12K medium supplemented with 10% Fetal
Bovine Serum. For transient Single Strand Annealing (SSA) assays,
cells were seeded in 12 well-plates at 13.10.sup.3 cells per well
one day prior transfection. Cotransfection was carried out the
following day with 400 ng of DNA using the EFFECTENE transfection
kit (QIAGEN). Equimolar amounts of target LagoZ plasmid and
expression plasmid were used. The next day, medium was replaced and
cells were incubated for another 72 hours. CHO-K1 cell monolayers
were washed once with PBS. The cells were then lysed with 150 .mu.l
of lysis/revelation buffer added for .beta.-galactosidase liquid
assay (100 ml of lysis buffer (Tris-HCl 10 mM pH7.5, NaCl 150 mM,
Triton X100 0.1%, BSA 0.1 mg/ml, protease inhibitors) and 900 ml of
revelation buffer (10 ml of Mg 100.times. buffer (MgCl.sub.2 100
mM, .beta.-mercaptoethanol 35%), 110 ml ONPG (8 mg/ml) and 780 ml
of sodium phosphate 0.1 M pH7.5), 30 minutes on ice.
Beta-galactosidase activity was assayed by measuring optical
density at 415 nm. The entire process was performed on an automated
Velocity11 BioCel platform. The beta-galactosidase activity is
calculated as relative units normalized for protein concentration,
incubation time and transfection efficiency.
d) Protein Expression and Purification
[0159] His-tagged proteins were over-expressed in E.coli BL21
(DE3)pLysS cells using pET-24d (+) vectors (NOVAGEN). Induction
with IPTG (0.3 mM), was performed at 25.degree. C. Cells were
sonicated in a solution of 50 mM Sodium Phosphate (pH 8), 300 mM
sodium chloride containing protease inhibitors (Complete EDTA-free
tablets, Roche) and 5% (v/v) glycerol. Cell lysates were
centrifuged at 100000 g for 60 min. His-tagged proteins were then
affinity-purified, using 5 ml Hi-Trap chelating HP columns
(Amersham Biosciences) loaded with cobalt. Several fractions were
collected during elution with a linear gradient of imidazole (up to
0.25M imidazole, followed by plateau at 0.5 M imidazole, 0.3 M NaCl
and 50 mM Sodium Phosphate pH 8). Protein-rich fractions
(determined by SDS-PAGE) were applied to the second column. The
crude purified samples were taken to pH 6 and applied to a 5 ml
HiTrap Heparin HP column (Amersham Biosciences) equilibrated with
20 mM Sodium Phosphate pH 6.0. Bound proteins are eluted with a
sodium chloride continuous gradient with 20 mM sodium phosphate and
1M sodium chloride. The purified fractions were submitted to
SDS-PAGE and concentrated (10 kDa cut-off centriprep Amicon Ultra
system), frozen in liquid nitrogen and stored at -80.degree. C.,
Purified proteins were desalted using PD10 columns (Sephadex G-25M,
Amersham Biosciences) in PBS or 10 mM Tris-HCl (pH 8) buffer.
e) In Vitro Cleavage Assays
[0160] pGEM plasmids with single meganuclease DNA target cut sites
were first linearized with XmnI. Cleavage assays were performed at
37.degree. C. in 10 mM Tris-HCl (pH 8), 50 mM NaCl, 10 mM MgCl2, 1
mM DTT and 50 .mu.g/ml BSA. 2 nM was used as target substrate
concentration. A dilution range between 0 and 85 nM was used for
each protein, in 25 .mu.l final volume reaction. Reactions were
stopped after 1 hour by addition of 5 .mu.l of 45% glycerol, 95 mM
EDTA (pH 8), 1.5% (w/v) SDS, 1.5 mg/ml proteinase K and 0.048%
(w/v) bromophenol blue (6.times. Buffer Stop) and incubated at
37.degree. C. for 30 minutes. Digests were run on agarosse
electrophoresis gel, and fragment quantified after ethidium bromide
staining, to calculate the percentage of cleavage.
B) Results
[0161] Eight representative mutants (belonging to 6 different
clusters, see below) were chosen for further characterization (FIG.
9). First, data in yeast were confirmed in mammalian cells, by
using an assay based on the transient cotransfection of a
meganuclease expressing vector and a target vector, as described in
a previous report. The 8 mutant ORFs and the 64 targets were cloned
into appropriate vectors, and a robot-assisted microtiter-based
protocol was used to co-transfect in CHO cells each selected
variant with each one the 64 different reporter plasmids.
Meganuclease-induced recombination was measured by a standard,
quantitative ONPG assay that monitors the restoration of a
functional .beta.-galactosidase gene. Profiles were found to be
qualitatively and quantitatively reproducible in five independent
experiments. As shown on FIG. 9a, strong and medium signals were
nearly always observed with both yeast and CHO cells (with the
exception of ADK), thereby validating the relevance of the yeast
HTS process. However, weak signals observed in yeast were often not
detected in CHO cells, likely due to a difference in the detection
level (see QRR and targets gtg, get, and ttc). Four mutants were
also produced in E. coli and purified by metal affinity
chromatography. Their relative in vitro cleavage efficiencies
against the wild-type site and their cognate sites was determined.
The extent of cleavage under standardized conditions was assessed
across a broad range of concentrations for the mutants (FIG. 9b).
Similarly, the activity of I-CreI wt on these targets, was analysed
. In many case, 100% cleavage of the substrate could not be
achieved, likely reflecting the fact that these proteins may have
little or no turnover (Perrin et al., EMBO J., 1993, 12, 2939-2947;
Wang et al., Nucleic Acids Res., 1997, 25, 3767-3776). In general,
in vitro assay confirmed the data obtained in yeast and CHO cells,
but surprinsingly, the gtt target was efficiently cleaved by
I-CreI
[0162] Specificity shifts were obvious from the profiles obtained
in yeast and CHO: the I-CreI favorite gtc target was not cleaved or
barely cleaved, while signals were observed with new targets. This
switch of specificity was confirmed for QAN, DRK, RAT and KTG by in
vitro analysis, as shown on FIG. 9b. In addition, these four
mutants, which display various levels of activity in yeast and CHO
(FIG. 9a) were shown to cleave 17-60% of their favorite target in
vitro (FIG. 9b), with similar kinetics to I-CreI (half of maximal
cleavage by 13-25 nM). Thus, activity was largely preserved by
engineering. Third, the number of cleaved targets varied among the
mutants: strong cleavers such as QRR, QAN, ARL and KTG have a
spectrum of cleavage in the range of what is observed with I-CreI
(5-8 detectable signals in yeast, 3-6 in CHO). Specificity is more
difficult to compare with mutants that cleave weakly. For example,
a single weak signal is observed with DRK but might represent the
only detectable signal resulting from the attenuation of a more
complex pattern. Nevertheless, the behavior of variants that cleave
strongly shows that engineering preserves a very narrow
specificity.
Example 4
Hierarchical Clustering Defines Seven I-CreI Variant Families
A) Material and Methods
[0163] Clustering was done using hclust from the R package. We used
quantitative data from the primary, low density screening. Both
variants and targets were clustered using standard hierarchical
clustering with Euclidean distance and Ward's method (Ward, J. H.,
American Stat. Assoc., 1963, 58, 236-244). Mutants and targets
dendrograms were reordered to optimize positions of the clusters
and the mutant dendrogram was cut at the height of 8 to define the
cluster.
B) Results
[0164] Next, hierarchical clustering was used to determine whether
families could be identified among the numerous and diverse
cleavage patterns of the variants. Since primary and secondary
screening gave congruent results, quantitative data from the first
round of yeast low density screening was used for analysis, to
permit a larger sample size. Both variants and targets were
clustered using standard hierarchical clustering with Euclidean
distance and Ward's method (Ward, J. H., precited) and seven
clusters were defined (FIG. 10b). Detailed analysis is shown for 3
of them (FIG. 10c) and the results are summarized in Table I.
TABLE-US-00002 TABLE I Cluster Analysis Nucleotide in examples
Three preferred targets .sup.1 position 4 preferred amino acid
.sup.2 cluster (FIG. 3a) sequence % cleavage (%) .sup.1 44 68 70 1
QAN gtt 46.2 g 0.5 Q gtc 18.3 a 2.0 80.5% 77 proteins gtg 13.6 t
82.4 (62/77) .SIGMA. = 78.1 c 15.1 2 QRR gtt 13.4 g 0 Q R gtc 11.8
a 4.9 100.0% 100.0% 8 proteins tct 11.4 t 56.9 (8/8) (8/8) .SIGMA.
= 36.6 c 38.2 3 ARL gat 27.9 g 2.4 A R tat 23.2 a 88.9 63.0% 33.8%
65 proteins gag 15.7 t 5.7 (41/65) (22/65) .SIGMA. = 66.8 c 3.0 4
AGR gac 22.7 g 0.3 A&N R R 51.6% & tac 14.5 a 91.9 35.4%
48.4% 67.7% 31 proteins gat 13.4 t 6.6 (16 & 11/31) 15/31 21/31
.SIGMA. = 50.6 c 1.2 5 ADK gat 29.21 g 1.6 DRK tat 15.4 a 73.8 81
proteins gac 11.4 t 13.4 .SIGMA. = 56.05.9 c 11.2 6 KTG cct 30.1 g
0 K RAT tct 19.6 a 4.0 62.7% 51 proteins tcc 13.9 t 6.3 (32/51)
.SIGMA. = 63.6 c 89.7 7 cct 20.8 g 0 K tct 19.6 a 0.2 91.9% 37
proteins tcc 15.3 t 14.4 (34/37) .SIGMA. = 55.7 c 85.4 .sup.1
frequencies according to the cleavage index, as described in FIG.
10c .sup.2 in each position, residues present in more than 1/3 of
the cluster are indicated
[0165] For each cluster, a set of preferred targets could be
identified on the basis of the frequency and intensity of the
signal (FIG. 10c). The three preferred targets for each cluster are
indicated in Table 1, with their cleavage frequencies. The sum of
these frequencies is a measurement of the specificity of the
cluster. For example, in cluster 1, the three preferred targets
(gtt/c/g), account for 78.1% of the observed cleavage, with 46.2%
for gtt alone, revealing a very narrow specificity. Actually, this
cluster includes several proteins which, as QAN, which cleaves
mostly gtt (FIG. 9a). In contrast, the three preferred targets in
cluster 2 represent only 36.6% of all observed signals. In
accordance with the relatively broad and diverse patterns observed
in this cluster, QRR cleaves 5 targets (FIG. 9a), while other
cluster members' activity are not restricted to these 5
targets.
[0166] Analysis of the residues found in each cluster showed strong
biases for position 44: Q is overwhelmingly represented in clusters
1 and 2, whereas A and N are more frequent in clusters 3 and 4, and
K in clusters 6 and 7. Meanwhile, these biases were correlated with
strong base preferences for DNA positions .+-.4, with a large
majority of t:a base pairs in cluster 1 and 2, a:t in clusters 3, 4
and 5, and c:g in clusters 6 and 7 (see Table I). The structure of
I-CreI bound to its target shows that residue Q44 interacts with
the bottom strand in position -4 (and the top strand of position
+4, see FIGS. 1b and 1c). These results suggests that this
interaction is largely conserved in our mutants, and reveals a
"code", wherein Q44 would establish contact with adenine, A44 (or
less frequently N44) with thymine, and K44 with guanine. Such
correlation was not observed for positions 68 and 70.
Example 5
Variants Can be Assembled in Functional Heterodimers to Cleave New
DNA Target Sequences
A) Materials and Methods
[0167] The 75 hybrid targets sequences were cloned as follows:
oligonucleotides were designed that contained two different half
sites of each mutant palindrome (PROLIGO). Double-stranded target
DNA, generated by PCR amplification of the single stranded
oligonucleotides, was cloned using the Gateway protocol
(INVITROGEN) into yeast and mammalian reporter vectors. Yeast
reporter vectors were transformed into S. cerevisiae strain
FYBL2-7B (MAT.alpha., ura3.DELTA.851, trp1.DELTA.63, leu2.DELTA.1,
lys2.DELTA.202).
B) Results
[0168] Variants are homodimers capable of cleaving palindromic
sites. To test whether the list of cleavable targets could be
extended by creating heterodimers that would cleave hybrid cleavage
sites (as described in FIG. 11), a subset of I-CreI variants with
distinct profiles was chosen and cloned in two different yeast
vectors marked by LEU2 or KAN genes. Combinations of mutants having
mutations at positions 44, 68 and/or 70 and N at position 75, were
then co-expressed in yeast with a set of palindromic and non
palindromic chimeric DNA targets. An example is shown on FIG. 12:
co-expression of the K44, T68, G70,N75 (KTG) and Q44, A68, N70,N75
(QAN) mutants resulted in the cleavage of two chimeric targets,
gtt/gcc and gtt/cct, that were not cleaved by either mutant alone.
The palindromic gtt, cct and gcc targets (and other targets of KTG
and QAN) were also cleaved, likely resulting from homodimeric
species formation, but unrelated targets were not. In addition, a
gtt, cct or gee half-site was not sufficient to allow cleavage,
since such targets were fully resistant (see ggg/gcc, gat/gcc,
gcc/tac, and many others, on FIG. 12). Unexpected cleavage was
observed only with gtc/cct and gtt/gtc, with KTG and QAN
homodimers, respectively, but signal remained very weak. Thus,
efficient cleavage requires the cooperative binding of two mutant
monomers. These results demonstrate a good level of specificity for
heterodimeric species.
[0169] Altogether, a total of 112 combinations of 14 different
proteins were tested in yeast, and 37.5% of the combinations
(42/112) revealed a positive signal on their predicted chimeric
target. Quantitative data are shown for six examples on FIG. 13a,
and for the same six combinations, results were confirmed in CHO
cells in transient co-transfection experiments, with a subset of
relevant targets (FIG. 13b). As a general rule, functional
heterodimers were always obtained when one of the two expressed
proteins gave a strong signal as homodimer. For example, DRN and
RRN, two low activity mutants, give functional heterodimers with
strong cutters such as KTG or QRR (FIGS. 13a and 13b) whereas no
cleavage of chimeric targets could be detected by co-expression of
the same weak mutants
Example 6
Cleavage of a Natural DNA Target by Assembled Heterodimer
A) Materials and Methods
a) Genome Survey
[0170] A natural target potentially cleaved by a I-CreI variant,
was identified by scanning the public databases, for genomic
sequences matching the pattern caaaacnnnnnnnnnngttttg, wherein n is
a, t, c, or g (SEQ ID NO: 78). The natural target DNA sequence
caaaactatgtagagggttttg (SEQ ID NO: 75) was identified in mouse
chromosome 17.
[0171] This DNA sequence is potentially cleaved by a combination of
two I-CreI variants cleaving the sequences tcaaaactatgtgaatagttttga
(SEQ ID NO: 76) and tcaaaaccctgtgaagggttttga (SEQ ID NO: 77),
respectively.
b) Isolation of Meganuclease Variants
[0172] Variants were selected by the cleavage-induced recombination
assay in yeast, as described in example 1, using the sequence
tcaaaactatgtgaatagttttga (SEQ ID NO: 76) or the sequence
tcaaaaccctgtgaagggttttga (SEQ ID NO: 77) as targets.
c) Construction of the Target Plasmid
[0173] Oligonucleotides were designed that contained two different
half sites of each mutant palindrome (PROLIGO). Double-stranded
target DNA, generated by PCR amplification of the single stranded
oligonucleotides, was cloned using the Gateway protocol
(INVITROGEN) into the mammalian reporter vector
pcDNA3.1-LACURAZ-AURA, described previously (Epinat et al.,
precited), to generate the target LagoZ plasmid.
d) Construction of Meganuclease Expression Vector
[0174] The open reading frames (ORFs) of the clones identified
during the screening in yeast were amplified by PCR on yeast colony
and cloned individually in the CHO expression vector pCDNA6.2
(INVITROGEN), as described in example 1. I-Crel variants were
expressed under the control of the CMV promoter.
e) Mammalian Cells Assay
[0175] CHO-K1 cell line were transiently co-transfected with
equimolar amounts of target LagoZ plasmid and expression plasmids,
and the beta galactosidase activity was measured as described in
examples 3 and 5.
B) Results
[0176] A natural DNA target, potentially cleaved by I-CreI variants
was identified by performing a genome survey of sequences matching
the pattern caaaacnnnnnnnnnngttttg (SEQ ID NO: 78). A randomly
chosen DNA sequence (SEQ ID NO: 78) identified in chromosome 17 of
the mouse was cloned into a reporter plasmid. This DNA target was
potentially cleaved by a combination of the I-CreI variants
A44,R68,S70,N75 (ARS) and K44,R68,E70,N75 (KRE).
[0177] The co-expression of these two variants in CHO cell leads to
the formation of functional heterodimer protein as shown in FIG.
14. Indeed when the I-CreI variants were expressed individually,
virtually no cleavage activity could be detected on the mouse DNA
target although the KRE protein showed a residual activity. In
contrast, when these two variants were co-expressed together with
the plasmid carrying the potential target, a strong
beta-galactosidase activity could be measured. All together these
data revealed that heterodimerization occurred in the CHO cells and
that heterodimers were functional.
[0178] These data demonstrate that heterodimers proteins created by
assembling homodimeric variants, extend the list of natural
occurring DNA target sequences to all the potential hybrid
cleavable targets resulting from all possible combination of the
variants.
[0179] Moreover, these data demonstrated that it is possible to
predict the DNA sequences that can be cleaved by a combination of
variant knowing their individual DNA target of homodimer.
Furthermore, the nucleotides at positions 1 et 2 (and -1 and -2) of
the target can be different from gtac, indicating that they play
little role in DNA/protein interaction.
REFERENCES
[0180] Belfort, M. and Roberts, R. J. (1997) Homing endonucleases:
keeping the house in order. Nucleic Acids Res, 25, 3379-3388.
[0181] Bell-Pedersen, D., Quirk, S., Clyman, J. and Belfort, M.
(1990) Intron mobility in phage T4 is dependent upon a distinctive
class of endonucleases and independent of DNA sequences encoding
the intron core: mechanistic and evolutionary implications. Nucleic
Acids Res, 18, 3763-3770.
[0182] Bell-Pedersen, D., Quirk, S. M., Aubrey, M. and Belfort, M.
(1989) A site-specific endonuclease and co-conversion of flanking
exons associated with the mobile td intron of phage T4. Gene, 82,
119-126.
[0183] Bell-Pedersen, D., Quirk, S. M., Bryk, M. and Belfort, M.
(1991) I-TevI, the endonuclease encoded by the mobile td intron,
recognizes binding and cleavage domains on its DNA target. Proc
Natl Acad Sci USA, 88, 7719-7723.
[0184] Bibikova, M., Beumer, K., Trautman, J. K. and Carroll, D.
(2003) Enhancing gene targeting with designed zinc finger
nucleases. Science, 300, 764.
[0185] Bibikova, M., Carroll, D., Segal, D. J., Trautman, J. K.,
Smith, J., Kim, Y. G. and Chandrasegaran, S. (2001) Stimulation of
homologous recombination through targeted cleavage by chimeric
nucleases. Mol Cell Biol, 21, 289-297.
[0186] Bibikova, M., Golic, M., Golic, K. G. and Carroll, D. (2002)
Targeted chromosomal cleavage and mutagenesis in Drosophila using
zinc-finger nucleases. Genetics, 161, 1169-1175.
[0187] Chevalier, B., Sussman, D., Otis, C., Noel A. J., Turmel,
M., Lemieux, C., Stephens, K., Monnat, R. Jr., Stoddard, B. L.,
(2004) Metal-Dependant DNA cleavage mechanism of the I-CreI
LAGLIDADG (SEQ ID NO: 91) homing endonuclease. Biochemistry, 43,
14015-14026.
[0188] Chevalier, B. S., Kortemme, T., Chadsey, M. S., Baker, D.,
Monnat, R. J. and Stoddard, B. L. (2002) Design, activity, and
structure of a highly specific artificial endonuclease. Mol Cell,
10, 895-905.
[0189] Chevalier, B. S. and Stoddard, B. L. (2001) Homing
endonucleases: structural and functional insight into the catalysts
of intron/intein mobility. Nucleic Acids Res, 29, 3757-3774.
[0190] Choulika, A., Perrin, A., Dujon, B. and Nicolas, J. F.
(1995) Induction of homologous recombination in mammalian
chromosomes by using the I-SceI system of Saccharomyces cerevisiae.
Mol Cell Biol, 15, 1968-1973.
[0191] Cohen-Tannoudji, M., Robine, S., Choulika, A., Pinto, D., El
Marjou, F., Babinet, C., Louvard, D. and Jaisser, F. (1998)
I-SceI-induced gene replacement at a natural locus in embryonic
stem cells. Mol Cell Biol, 18, 1444-1448.
[0192] Colleaux, L., D'Auriol, L., Galibert, F. and Dujon, B.
(1988) Recognition and cleavage site of the intron-encoded omega
transposase. Proc Natl Acad Sci USA, 85, 6022-6026.
[0193] Donoho, G., Jasin, M. and Berg, P. (1998) Analysis of gene
targeting and intrachromosomal homologous recombination stimulated
by genomic double-strand breaks in mouse embryonic stem cells. Mol
Cell Biol, 18, 4070-4078.
[0194] Elliott, B., Richardson, C., Winderbaum, J., Nickoloff, J.
A. and Jasin, M. (1998) Gene conversion tracts from double-strand
break repair in mammalian cells. Mol Cell Biol, 18, 93-101.
[0195] Epinat, J. C., Arnould, S., Chames, P., Rochaix, P.,
Desfontaines, D., Puzin, C., Patin, A., Zanghellini, A., Paques, F.
and Lacroix, E. (2003) A novel engineered meganuclease induces
homologous recombination in yeast and mammalian cells. Nucleic
Acids Res, 31, 2952-2962.
[0196] Gietz, R. D. and Woods, R. A. (2002) Transformation of yeast
by lithium acetate/single-stranded carrier DNA/polyethylene glycol
method. Methods Enzymol, 350, 87-96.
[0197] Haber, J. E. (1998) Mating-type gene switching in
Saccharomyces cerevisiae. Annu Rev Genet, 32, 561-599.
[0198] Jacquier, A. and Dujon, B. (1985) An intron-encoded protein
is active in a gene conversion process that spreads an intron into
a mitochondrial gene. Cell, 41, 383-394.
[0199] Jurica, M. S., Monnat, R. J., Jr. and Stoddard, B. L. (1998)
DNA recognition and cleavage by the LAGLIDADG (SEQ ID NO: 91)
homing endonuclease I-CreI. Mol Cell, 2, 469-476.
[0200] Klar, A. J., Strathern, J. N. and Abraham, J. A. (1984)
Involvement of double-strand chromosomal breaks for mating-type
switching in Saccharomyces cerevisiae. Cold Spring Harb Symp Quant
Biol, 49, 77-88.
[0201] Kostriken, R., Strathern, J. N., Klar, A. J., Hicks, J. B.
and Heffron, F. (1983) A site-specific endonuclease essential for
mating-type switching in Saccharomyces cerevisiae. Cell, 35,
167-174.
[0202] Liang, F., Han, M., Romanienko, P. J. and Jasin, M. (1998)
Homology-directed repair is a major double-strand break repair
pathway in mammalian cells. Proc Natl Acad Sci USA, 95,
5172-5177.
[0203] Moynahan, M. E. and Jasin, M. (1997) Loss of heterozygosity
induced by a chromosomal double-strand break. Proc Natl Acad Sci
USA, 94, 8988-8993.
[0204] Mueller, J. E., Smith, D. and Belfort, M. (1996) Exon
coconversion biases accompanying intron homing: battle of the
nucleases. Genes Dev, 10, 2158-2166.
[0205] Perrin, A., Buckle, M. and Dujon, B. (1993) Asymmetrical
recognition and activity of the I-SceI endonuclease on its site and
on intron-exon junctions. Embo J, 12, 2939-2947.
[0206] Plessis, A., Perrin, A., Haber, J. E. and Dujon, B. (1992)
Site-specific recombination determined by I-SceI, a mitochondrial
group I intron-encoded endonuclease expressed in the yeast nucleus.
Genetics, 130, 451-460.
[0207] Porteus, M. H. and Baltimore, D. (2003) Chimeric nucleases
stimulate gene targeting in human cells. Science, 300, 763.
[0208] Posfai, G., Kolisnychenko, V., Bereczki, Z. and Blattner, F.
R. (1999) Markerless gene replacement in Escherichia coli
stimulated by a double-strand break in the chromosome. Nucleic
Acids Res, 27, 4409-4415.
[0209] Puchta, H. (1999) Double-strand break-induced recombination
between ectopic homologous sequences in somatic plant cells.
Genetics, 152, 1173-1181.
[0210] Puchta, H., Dujon, B. and Hohn, B. (1993) Homologous
recombination in plant cells is enhanced by in vivo induction of
double strand breaks into DNA by a site-specific endonuclease.
Nucleic Acids Res, 21, 5034-5040.
[0211] Puchta, H., Dujon, B. and Hohn, B. (1996) Two different but
related mechanisms are used in plants for the repair of genomic
double-strand breaks by homologous recombination. Proc Natl Acad
Sci USA, 93, 5055-5060.
[0212] Richardson, C., Moynahan, M. E. and Jasin, M. (1998)
Double-strand break repair by interchromosomal recombination:
suppression of chromosomal translocations. Genes Dev, 12,
3831-3842.
[0213] Rong, Y. S. and Golic, K. G. (2000) Gene targeting by
homologous recombination in Drosophila. Science, 288,
2013-2018.
[0214] Rong, Y. S. and Golic, K. G. (2001) A targeted gene knockout
in Drosophila. Genetics, 157, 1307-1312.
[0215] Rong, Y. S., Titen, S. W., Xie, H. B., Golic, M. M.,
Bastiani, M., Bandyopadhyay, P., Olivera, B. M., Brodsky, M.,
Rubin, G. M. and Golic, K. G. (2002) Targeted mutagenesis by
homologous recombination in D. melanogaster. Genes Dev, 16,
1568-1581.
[0216] Rouet, P., Smih, F. and Jasin, M. (1994) Introduction of
double-strand breaks into the genome of mouse cells by expression
of a rare-cutting endonuclease. Mol Cell Biol, 14, 8096-8106.
[0217] Seligman et al., 1997, Genetics, 1997, 147, 1653-1664
[0218] Seligman, L. M., Chisholm, K. M., Chevalier, B. S., Chadsey,
M. S., Edwards, S. T., Savage, J. H. and Veillet, A. L. (2002)
Mutations altering the cleavage specificity of a homing
endonuclease. Nucleic Acids Res, 30, 3870-3879.
[0219] Siebert, R. and Puchta, H. (2002) Efficient repair of
genomic double-strand breaks by homologous recombination between
directly repeated sequences in the plant genome. Plant Cell, 14,
1121-1131.
[0220] Sussman, D., Chadsey, M., Fauce, S., Engel, A., Bruett, A.,
Monnat, R., Jr., Stoddard, B. L. and Seligman, L. M. (2004)
Isolation and characterization of new homing endonuclease
specificities at individual target site positions. J Mol Biol, 342,
31-41.
[0221] Thierry, A. and Dujon, B. (1992) Nested chromosomal
fragmentation in yeast using the meganuclease I-Sce I: a new method
for physical mapping of eukaryotic genomes. Nucleic Acids Res, 20,
5625-5631.
Sequence CWU 1
1
92124DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1tcaaaacggg gtaccccgtt ttga
24224DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 2tcaaaacgga gtactccgtt ttga
24324DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 3tcaaaacggt gtacaccgtt ttga
24424DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 4tcaaaacggc gtacgccgtt ttga
24524DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 5tcaaaacgag gtacctcgtt ttga
24624DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 6tcaaaacgaa gtacttcgtt ttga
24724DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 7tcaaaacgat gtacatcgtt ttga
24824DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 8tcaaaacgac gtacgtcgtt ttga
24924DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 9tcaaaacgtg gtaccacgtt ttga
241024DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 10tcaaaacgta gtactacgtt ttga
241124DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 11tcaaaacgtt gtacaacgtt ttga
241224DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 12tcaaaacgtc gtacgacgtt ttga
241324DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 13tcaaaacgcg gtaccgcgtt ttga
241424DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 14tcaaaacgca gtactgcgtt ttga
241524DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 15tcaaaacgct gtacagcgtt ttga
241624DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 16tcaaaacgcc gtacggcgtt ttga
241724DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 17tcaaaacagg gtaccctgtt ttga
241824DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 18tcaaaacaga gtactctgtt ttga
241924DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 19tcaaaacagt gtacactgtt ttga
242024DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 20tcaaaacagc gtacgctgtt ttga
242124DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 21tcaaaacaag gtaccttgtt ttga
242224DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 22tcaaaacaaa gtactttgtt ttga
242324DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 23tcaaaacaat gtacattgtt ttga
242424DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 24tcaaaacaac gtacgttgtt ttga
242524DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 25tcaaaacatg gtaccatgtt ttga
242624DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 26tcaaaacata gtactatgtt ttga
242724DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 27tcaaaacatt gtacaatgtt ttga
242824DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 28tcaaaacatc gtacgatgtt ttga
242924DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 29tcaaaacacg gtaccgtgtt ttga
243024DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 30tcaaaacaca gtactgtgtt ttga
243124DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 31tcaaaacact gtacagtgtt ttga
243224DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 32tcaaaacacc gtacggtgtt ttga
243324DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 33tcaaaactgg gtacccagtt ttga
243424DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 34tcaaaactga gtactcagtt ttga
243524DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 35tcaaaactgt gtacacagtt ttga
243624DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 36tcaaaactgc gtacgcagtt ttga
243724DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 37tcaaaactag gtacctagtt ttga
243824DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 38tcaaaactaa gtacttagtt ttga
243924DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 39tcaaaactat gtacatagtt ttga
244024DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 40tcaaaactac gtacgtagtt ttga
244124DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 41tcaaaacttg gtaccaagtt ttga
244224DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 42tcaaaactta gtactaagtt ttga
244324DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 43tcaaaacttt gtacaaagtt ttga
244424DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 44tcaaaacttc gtacgaagtt ttga
244524DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 45tcaaaactcg gtaccgagtt ttga
244624DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 46tcaaaactca gtactgagtt ttga
244724DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 47tcaaaactct gtacagagtt ttga
244824DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 48tcaaaactcc gtacggagtt ttga
244924DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 49tcaaaaccgg gtacccggtt ttga
245024DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 50tcaaaaccga gtactcggtt ttga
245124DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 51tcaaaaccgt gtacacggtt ttga
245224DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 52tcaaaaccgc gtacgcggtt ttga
245324DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 53tcaaaaccag gtacctggtt ttga
245424DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 54tcaaaaccaa gtacttggtt ttga
245524DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 55tcaaaaccat gtacatggtt ttga
245624DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 56tcaaaaccac gtacgtggtt ttga
245724DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 57tcaaaacctg gtaccaggtt ttga
245824DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 58tcaaaaccta gtactaggtt ttga
245924DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 59tcaaaacctt gtacaaggtt ttga
246024DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 60tcaaaacctc gtacgaggtt ttga
246124DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 61tcaaaacccg gtaccgggtt ttga
246224DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 62tcaaaaccca gtactgggtt ttga
246324DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 63tcaaaaccct gtacagggtt ttga
246424DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 64tcaaaacccc gtacggggtt ttga
246524DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 65tcaaaacgtc gtgagacagt ttgg
246624DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 66ccaaactgtc tcgagacagt ttgg
246749DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 67gtttaaacat cagctaagct tgacctttvv kgtgactcaa
aagacccag 496845DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 68gatgtagttg gaaacggatc cmbbatcmbb
tacgtaacca acgcc 4569501DNAChlamydomonas reinhardtiiCDS(1)..(501)
69atg gcc aat acc aaa tat aac aaa gag ttc ctg ctg tac ctg gcc ggc
48Met Ala Asn Thr Lys Tyr Asn Lys Glu Phe Leu Leu Tyr Leu Ala Gly1
5 10 15ttt gtg gac ggt gac ggt agc atc atc gct cag att aaa cca aac
cag 96Phe Val Asp Gly Asp Gly Ser Ile Ile Ala Gln Ile Lys Pro Asn
Gln 20 25 30tct tat aag ttt aaa cat cag cta agc ttg acc ttt cag gtg
act caa 144Ser Tyr Lys Phe Lys His Gln Leu Ser Leu Thr Phe Gln Val
Thr Gln 35 40 45aag acc cag cgc cgt tgg ttt ctg gac aaa cta gtg gat
gaa att ggc 192Lys Thr Gln Arg Arg Trp Phe Leu Asp Lys Leu Val Asp
Glu Ile Gly 50 55 60gtt ggt tac gta cgt gat cgc gga tcc gtt tcc aac
tac atc tta agc 240Val Gly Tyr Val Arg Asp Arg Gly Ser Val Ser Asn
Tyr Ile Leu Ser65 70 75 80gaa atc aag ccg ctg cac aac ttc ctg act
caa ctg cag ccg ttt ctg 288Glu Ile Lys Pro Leu His Asn Phe Leu Thr
Gln Leu Gln Pro Phe Leu 85 90 95aaa ctg aaa cag aaa cag gca aac ctg
gtt ctg aaa att atc gaa cag 336Lys Leu Lys Gln Lys Gln Ala Asn Leu
Val Leu Lys Ile Ile Glu Gln 100 105 110ctg ccg tct gca aaa gaa tcc
ccg gac aaa ttc ctg gaa gtt tgt acc 384Leu Pro Ser Ala Lys Glu Ser
Pro Asp Lys Phe Leu Glu Val Cys Thr 115 120 125tgg gtg gat cag att
gca gct ctg aac gat tct aag acg cgt aaa acc 432Trp Val Asp Gln Ile
Ala Ala Leu Asn Asp Ser Lys Thr Arg Lys Thr 130 135 140act tct gaa
acc gtt cgt gct gtg ctg gac agc ctg agc gag aag aag 480Thr Ser Glu
Thr Val Arg Ala Val Leu Asp Ser Leu Ser Glu Lys Lys145 150 155
160aaa tcc tcc ccg gcg gcc gac 501Lys Ser Ser Pro Ala Ala Asp
16570167PRTChlamydomonas reinhardtii 70Met Ala Asn Thr Lys Tyr Asn
Lys Glu Phe Leu Leu Tyr Leu Ala Gly1 5 10 15Phe Val Asp Gly Asp Gly
Ser Ile Ile Ala Gln Ile Lys Pro Asn Gln 20 25 30Ser Tyr Lys Phe Lys
His Gln Leu Ser Leu Thr Phe Gln Val Thr Gln 35 40 45Lys Thr Gln Arg
Arg Trp Phe Leu Asp Lys Leu Val Asp Glu Ile Gly 50 55 60Val Gly Tyr
Val Arg Asp Arg Gly Ser Val Ser Asn Tyr Ile Leu Ser65 70 75 80Glu
Ile Lys Pro Leu His Asn Phe Leu Thr Gln Leu Gln Pro Phe Leu 85 90
95Lys Leu Lys Gln Lys Gln Ala Asn Leu Val Leu Lys Ile Ile Glu Gln
100 105 110Leu Pro Ser Ala Lys Glu Ser Pro Asp Lys Phe Leu Glu Val
Cys Thr 115 120 125Trp Val Asp Gln Ile Ala Ala Leu Asn Asp Ser Lys
Thr Arg Lys Thr 130 135 140Thr Ser Glu Thr Val Arg Ala Val Leu Asp
Ser Leu Ser Glu Lys Lys145 150 155 160Lys Ser Ser Pro Ala Ala Asp
1657122DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 71caaaacgtcg tgagacagtt tg
227249DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 72ggcatacaag tttcaaaacn nngtacnnng
ttttgacaat cgtctgtca 497377DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 73ggggacaagt ttgtacaaaa
aagcaggctt cgaaggagat agaaccatgg ccaataccaa 60atataacaaa gagttcc
777464DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 74ggggaccact ttgtacaaga aagctgggtt tagtcggccg
ccggggagga tttcttcttc 60tcgc 647522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 75caaaactatg tagagggttt tg 227624DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 76tcaaaactat gtgaatagtt ttga 247724DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 77tcaaaaccct gtacagggtt ttga 247822DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 78caaaacnnnn nnnnnngttt tg 227924DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 79tcaaaacgtt gtacaacgtt ttga 248024DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 80tcaaaacgtt gtacagggtt ttga 248124DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 81tcaaaacgat gtaaatcgtt ttga 248224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 82tcaaaacagt gtacgttgtt ttga 248324DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 83tcaaaacagc gtacattgtt ttga 248424DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 84tcaaaacatg gtaccatgtt ttga 248524DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 85tcaaaacacg gtaccgtgtt ttga 248624DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 86tcaaaactat gtaaatagtt ttga 248724DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 87tcaaaaccgt gtacgtggtt ttga 248824DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 88tcaaaaccgc gtacatggtt ttga 248924DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 89tcaaaacctg gtaccaggtt ttga 249024DNAArtificial
SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 90tcaaaacccg gtaccgggtt ttga
24919PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 91Leu Ala Gly Leu Ile Asp Ala Asp Gly1
59240DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 92nnnnnnnnnc aaannnnnnn nnnnnnnttt
gnnnnnnnnn 40
* * * * *