U.S. patent application number 12/299605 was filed with the patent office on 2009-11-26 for compounds and methods for modulating expression of dgat2.
Invention is credited to Sanjay Bhanot, Richard S. Geary, Robert McKay, Brett P. Monia, Punit P. Seth, Andrew M. Siwkowski, Eric E. Swayze, Edward Wancewicz.
Application Number | 20090292006 12/299605 |
Document ID | / |
Family ID | 40134111 |
Filed Date | 2009-11-26 |
United States Patent
Application |
20090292006 |
Kind Code |
A1 |
Bhanot; Sanjay ; et
al. |
November 26, 2009 |
COMPOUNDS AND METHODS FOR MODULATING EXPRESSION OF DGAT2
Abstract
The present disclosure describes short antisense compounds,
including such compounds comprising chemically-modified
high-affinity monomers 8-16 monomers in length. Certain such short
antisense compound are useful for the reduction of target nucleic
acids and/or proteins in cells, tissues, and animals with increased
potency and improved therapeutic index. Thus, provided herein are
short antisense compounds comprising high-affinity nucleotide
modifications useful for reducing a target RNA in vivo. Such short
antisense compounds are effective at lower doses than previously
described antisense compounds, allowing for a reduction in toxicity
and cost of treatment. In addition, the described short antisense
compounds have greater potential for oral dosing.
Inventors: |
Bhanot; Sanjay; (Carlsbad,
CA) ; Geary; Richard S.; (Carlsbad, CA) ;
McKay; Robert; (Poway, CA) ; Monia; Brett P.;
(Encinitas, CA) ; Seth; Punit P.; (San Marcos,
CA) ; Siwkowski; Andrew M.; (Carlsbad, CA) ;
Swayze; Eric E.; (Carlsbad, CA) ; Wancewicz;
Edward; (Poway, CA) |
Correspondence
Address: |
McDermott Will & Emery
11682 EL CAMINO REAL, SUITE 400
SAN DIEGO
CA
92130-2047
US
|
Family ID: |
40134111 |
Appl. No.: |
12/299605 |
Filed: |
May 7, 2007 |
PCT Filed: |
May 7, 2007 |
PCT NO: |
PCT/US07/68415 |
371 Date: |
May 8, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60746631 |
May 5, 2006 |
|
|
|
60747059 |
May 11, 2006 |
|
|
|
60805660 |
Jun 23, 2006 |
|
|
|
60864554 |
Nov 6, 2006 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/375; 536/24.5 |
Current CPC
Class: |
C12N 2310/3231 20130101;
C12N 2310/11 20130101; C12N 15/113 20130101; A61P 3/00 20180101;
A61P 3/06 20180101; A61P 3/08 20180101; C12N 2310/321 20130101;
A61P 7/00 20180101; A61P 9/00 20180101; A61P 9/10 20180101; C12N
2310/341 20130101; A61P 43/00 20180101; A61P 3/10 20180101; C12N
2310/3515 20130101; C12Y 203/0102 20130101; C12N 15/1137 20130101;
C12N 2310/31 20130101; C12N 2310/322 20130101; A61P 1/16 20180101;
A61P 5/46 20180101; A61P 5/50 20180101; C12N 2310/315 20130101;
A61P 3/04 20180101; C12N 2310/321 20130101; C12N 2310/3521
20130101 |
Class at
Publication: |
514/44.A ;
536/24.5; 435/375 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C07H 21/04 20060101 C07H021/04; C12N 5/06 20060101
C12N005/06 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 27, 2007 |
US |
PCT/US07/61183 |
Claims
1. A short antisense compound 8 to 16 monomers in length,
comprising a 2'-deoxyribonucleotide gap region flanked on each side
by a wing, wherein each wing independently comprises 1 to 3
high-affinity modified monomers and wherein the short antisense
compound is targeted to a nucleotide encoding DGAT2.
2. The short antisense compound of claim 1, wherein said
high-affinity modified monomers are sugar-modified nucleotides.
3. The short antisense compound of claim 2, wherein at least one of
the sugar-modified nucleotides comprises a bridge between the 4'
and the 2' position of the sugar.
4. The short antisense compound of claim 2, wherein each of said
high-affinity modified nucleotides confers a .DELTA.T.sub.m of 1 to
4 degrees per nucleotide.
5. The short antisense compound of claim 2, wherein each of said
sugar-modified nucleotides comprises a 2'-substituent group that is
other than H or OH.
6. The short antisense compound of claim 5, wherein at least one of
said sugar-modified nucleotides is a 4' to 2' bridged bicyclic
nucleotide.
7. The short antisense compound of claim 5, wherein each of the
2'-substituent groups is, independently, alkoxy, substituted
alkoxy, or halogen.
8. The short antisense compound of claim 7, wherein each of the
2'-substituent groups is OCH.sub.2CH.sub.2OCH.sub.3.
9. The short antisense compound claim 3, wherein the conformation
of each of said sugar-modified nucleotides is, independently,
.beta.-D or .alpha.-L.
10. The short antisense compound claim 5, wherein each of said
bridges independently comprises 1 or from 2 to 4 linked groups
independently selected from --[C(R.sub.1)(R.sub.2)].sub.n--,
--C(R.sub.1).dbd.C(R.sub.2)--, --C(R.sub.1).dbd.N--,
--C(.dbd.NR.sub.1)--, --C(.dbd.O)--, --C(.dbd.S)--, --O--,
--Si(R.sub.1).sub.2--, --S(.dbd.O).sub.x-- and --N(R.sub.1)--;
wherein x is 0, 1, or 2; n is 1, 2, 3, or 4; each R.sub.1 and
R.sub.2 is, independently, H, a protecting group, hydroxyl,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl,
heterocycle radical, substituted heterocycle radical, heteroaryl,
substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical,
substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1,
NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl
(C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12
alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12
alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12
alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20
aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(.dbd.O)--H),
substituted acyl, a heterocycle radical, a substituted heterocycle
radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12
aminoalkyl or a protecting group.
11. The short antisense compound of claim 10, wherein each of said
bridges is, independently,
4'-CH.sub.2-2',4'-(CH.sub.2).sub.2-2',4'-CH.sub.2--O-2',4'-(CH.sub.2).sub-
.2--O-2',4'-CH.sub.2--O--N(R.sub.1)-2' and
4'-CH.sub.2--N(R.sub.1)--O-2'- wherein each R.sub.1 is,
independently, H, a protecting group or C.sub.1-C.sub.12 alkyl.
12. The short antisense compound of claim 1, wherein each of the
high-affinity modified monomer is independently selected from
bicyclic nucleotides or other 2'-modified nucleotides.
13. The short antisense compound of claim 12, wherein the
2'-modified nucleotides are selected from halogen, allyl, amino,
azido, thio, O-allyl, O--C.sub.1-C.sub.10alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n) or
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl.
14. The short antisense compound of claim 13, wherein the
2'-modified nucleotide is a 2'-OCH.sub.2CH.sub.2OCH.sub.3
nucleotide.
15. The short antisense compound of claim 1, wherein at least one
monomeric linkage is a modified monomeric linkage.
16. The antisense compound of claim 15, wherein the modified
monomeric linkage is a phosphorothioate linkage.
17. The short antisense compound of claim 1, wherein each monomeric
linkage is a phosphorothioate internucleoside linkage.
18. The short antisense compound of claim 1, that is 8-15 monomers
in length.
19. The short antisense compound of claim 18 that is 9-15 monomers
in length.
20. The short antisense compound of claim 18 that is 10-15 monomers
in length.
21. The short antisense compound of claim 18 that is 9-14 monomers
in length.
22. The short antisense compound of claim 18 that is 10-14 monomers
in length.
23. The short antisense compound of claim 18 that is 9-13 monomers
in length.
24. The short antisense compound of claim 18 that is 10-13 monomers
in length.
25. The short antisense compound of claim 18 that is 9-12 monomers
in length.
26. The short antisense compound of claim 18 that is 10-12 monomers
in length.
27. The short antisense compound of claim 18 that is 9-11 monomers
in length.
28. The short antisense compound of claim 18 that is 10-11 monomers
in length.
29. The short antisense compound of claim 18 that is 8 monomers in
length.
30. The short antisense compound of claim 18 that is 9 monomers in
length.
31. The short antisense compound of claim 18 that is 10 monomers in
length.
32. The short antisense compound of claim 18 that is 11 monomers in
length.
33. The short antisense compound of claim 18 that is 12 monomers in
length.
34. The short antisense compound of claim 18 that is 13 monomers in
length.
35. The short antisense compound of claim 18 that is 14 monomers in
length.
36. The short antisense compound of claim 18 that is 15 monomers in
length.
37. The short antisense compound of claim 18 that is 16 monomers in
length.
38. The short antisense compound of claim 1, having a motif
selected from 1-12-1; 3-10-3; 2-10-3; 2-10-2; 1-10-1; 1-10-2;
3-8-3; 2-8-2; 1-8-1; 3-6-3; and 1-6-11 wherein, the first number
represents the number of monomers in the 5'-wing, the second number
represents the number of monomers in the gap, and the third number
represents the number of monomers in the 3' wing.
39. The short antisense compound of claim 38 wherein the motif is
selected from 1-10-1; 2-10-2; 3-10-3; and 1-9-2.
40. The short antisense compound of claim 1 having a motif selected
from 1-1-10-2, 1-1-8-2, 1-1-6-3, and 1-2-8-2, wherein the first
number represents the number of monomers in a first 5' wing, the
second number represents the number of monomers in a second 5'
wing, the third number represents the number of monomers in the
gap, and the fourth number represents the number of monomers in the
3' wing.
41. The short antisense compound of claim 1 having a motif selected
from 2-10-1-1, 2-8-1-1, 3-6-1-1, and 2-8-2-1, wherein the first
number represents the number of monomers in the 5' wing, the second
number represents the number of monomers in the gap, the third
number represents the number of monomers in a first 3' wing, and
the fourth number represents the number of monomers in a second 3'
wing.
42. The short antisense compound of claim 1 having a motif selected
from 1-2-10-1-1; 1-1-8-1-1; 2-1-6-1-1; and 1-2-8-2-1, wherein the
first number represents the number of monomers in a first 5' wing,
the second number represents the number of monomers in a second 5'
wing, the third number represents the number of monomers in the
gap, the fourth number represents the number of monomers in a first
3' wing and the fifth number represents the number of monomers in a
second 3'wing.
43. A method of modulating expression of a DGAT2 by contacting a
nucleic acid encoding DGAT2 with a short antisense compound.
44. The method of claim 43 wherein the DGAT2 nucleic acid is in a
cell.
45. The method of claim 44, wherein the DGAT2 nucleic acid is in an
animal.
46. The method of claim 45, wherein the animal is a human.
47. The method of claim 43, wherein the short antisense compound is
the short antisense compound of claim 1.
48. Use of the short antisense compound of claim 1 for the
preparation of a medicament for reducing the expression of DGAT2
RNA in an animal.
49. The use of claim 48, wherein the medicament decreases total
serum cholesterol, serum LDL, serum VLDL, serum HDL, serum
triglycerides, serum apolipoprotein(a) and/or free fatty acids in
an animal.
50. A method of inhibiting expression of DGAT2 RNA in an animal,
comprising administering to said animal the short antisense
compound of claim 1.
51. A method of treating a cardiovascular disorder in an animal,
comprising administering to an animal in need of such therapy the
short antisense compound of claim 1.
Description
SEQUENCE LISTING
[0001] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled CORE0061WO14SEQ.TXT, created on May 7, 2007 which is
700 Kb in size. The information in the electronic format of the
sequence listing is incorporated herein by reference in its
entirety.
BACKGROUND
[0002] Targeting disease-causing gene sequences was first suggested
nearly 40 years ago (Belikova et al., Tet. Lett., 1967, 37,
3557-3562), and antisense activity was demonstrated in cell culture
a decade later (Zamecnik et al., Proc. Natl. Acad. Sci. U.S.A.,
1978, 75, 280-284). One advantage of antisense technology in the
treatment of a disease or condition that stems from a
disease-causing gene is that it is a direct genetic approach that
has the ability to modulate expression of specific disease-causing
genes.
[0003] Generally, the principle behind antisense technology is that
an antisense compound hybridizes to a target nucleic acid and
effects modulation of gene expression activity or function, such as
transcription, translation or splicing. The modulation of gene
expression can be achieved by, for example, target degradation or
occupancy-based inhibition. An example of modulation of RNA target
function by degradation is RNase H-based degradation of the target
RNA upon hybridization with a DNA-like antisense compound. Another
example of modulation of gene expression by target degradation is
RNA interference (RNAi). RNAi is a form of antisense-mediated gene
silencing involving the introduction of dsRNA leading to the
sequence-specific reduction of targeted endogenous mRNA levels.
Sequence-specificity makes antisense compounds extremely attractive
as tools for target validation and gene functionalization, as well
as research tools for identifying and characterizing nucleases and
as therapeutics to selectively modulate the expression of genes
involved in the pathogenesis of any one of a variety of
diseases.
[0004] Antisense technology is an effective means for reducing the
expression of one or more specific gene products and can therefore
prove to be uniquely useful in a number of therapeutic, diagnostic,
and research applications. Chemically modified nucleosides are
routinely used for incorporation into antisense compounds to
enhance one or more properties, such as nuclease resistance,
pharmacokinetics or affinity for a target RNA.
[0005] Despite the expansion of knowledge since the discovery of
antisense technology, there remains an unmet need for antisense
compounds with greater efficacy, reduced toxicity and lower cost.
Until the present disclosure, high-affinity modifications have not
been employed in the design of short antisense compounds for
reducing target RNA in vivo. This is because of concerns regarding
the degree of target specificity that a sequence 15 nucleotides or
shorter would have when employed to reduce target in a living
system. Previous studies have described that greater specificity,
and therefore greater potential for potency, is achieved by
antisense compounds between 16 and 20 nucleobases in length.
[0006] The present disclosure describes incorporation of
chemically-modified high-affinity nucleotides into antisense
compounds allows for short antisense compounds about 8-16
nucleobases in length useful in the reduction of target RNAs in
animals with increased potency and improved therapeutic index.
Thus, provided herein are short antisense compounds comprising
high-affinity nucleotide modifications useful for reducing a target
RNA in vivo. Such short antisense compounds are effective at lower
doses than previously described antisense compounds, allowing for a
reduction in toxicity and cost of treatment.
SUMMARY
[0007] Disclosed herein are short antisense compounds and methods
of using said compounds to reduce target RNA expression in cells or
tissues. In certain embodiments, provided herein is a method of
reducing expression of a target in an animal, comprising
administering to the animal a short antisense compound targeted to
a nucleic acid of such target. In certain embodiments, shorts
antisense compounds are oligonucleotide compounds. In certain
embodiments short antisense oligonucleotides are about 8 to 16,
preferably 9 to 15, more preferably 9 to 14, more preferably 10 to
14 nucleotides in length and comprises a gap region flanked on each
side by a wing, wherein each wing independently consists of 1 to 3
nucleotides. Preferred motifs include but are not limited to
wing-deoxy gap-wing motifs selected from 3-10-3, 2-10-3, 2-10-2,
1-10-1, 2-8-2, 1-8-1, 3-6-3 or 1-6-1. In a preferred embodiment,
the short antisense oligonucleotide comprise at least one
high-affinity modification. In a further embodiment, the
high-affinity modification includes chemically-modified
high-affinity nucleotides. In a preferred embodiment, each wing
independently consists of 1 to 3 high-affinity modified
nucleotides. In one embodiment the high affinity modified
nucleotides are sugar-modified nucleotides.
[0008] In certain embodiments short antisense compounds exhibit
greater uptake in the gut as compared to antisense compounds of
greater length. Thus, also provided herein are methods of reducing
a target in an animal, comprising orally administering the short
antisense compounds of the present invention.
[0009] In certain embodiments, short antisense compounds are
targeted to a nucleic acid encoding a protein selected from ApoB,
SGLT2, PCSK9, SOD1, CRP, GCCR, GCGR, DGAT2, PTP1B and PTEN.
[0010] Further provided are methods of treating a metabolic
disorder in an animal, comprising administering to an animal in
need of such therapy a short antisense compound targeted to a
nucleic acid involved in regulating glucose metabolism or
clearance, lipid metabolism, cholesterol metabolism, or insulin
signaling.
[0011] Also provided are methods of increasing insulin sensitivity,
decreasing blood glucose or decreasing HbA.sub.1c in an animal,
comprising administering to said animal a short antisense compound
targeted to a nucleic acid encoding a target involved in regulating
glucose metabolism or clearance, lipid metabolism, cholesterol
metabolism, or insulin signaling.
[0012] Further provided are methods of decreasing total serum
cholesterol, serum LDL, serum VLDL, serum HDL, serum triglycerides,
serum apolipoprotein(a) or free fatty acids in an animal,
comprising administering to said animal a short antisense compound
targeted to a nucleic acid encoding a target that is involved in
regulating glucose metabolism or clearance, lipid metabolism,
cholesterol metabolism, or insulin signaling, wherein said short
antisense compound is 8 to 16 nucleotides in length and comprises a
gap region flanked on each side by a wing, wherein each wing
independently consists of 1 to 3 high-affinity modified
nucleotides.
[0013] Certain targets involved in regulating glucose metabolism or
clearance, lipid metabolism, cholesterol metabolism, or insulin
signaling include, but are not limited to, GCGR and ApoB-100. Thus,
provided are short antisense compounds targeting nucleic acids
encoding GCGR and ApoB-100 and methods of reducing expression of
said targets and/or target nucleic acids in animal. In addition,
provided is the use of short antisense compounds targeting nucleic
acids encoding GCGR, and ApoB-100 for the treatment of a metabolic
or cardiovascular disease or condition.
[0014] In certain embodiments, short antisense compounds further
comprise a conjugate group. Conjugate groups include, but are not
limited to, C.sub.16 and cholesterol.
[0015] In certain embodiments short antisense compounds comprise at
least one modified nucleobase, internucleoside linkage or sugar
moiety. In certain embodiments, such modified internucleoside
linkage is a phosphorothioate internucleoside linkage. In certain
embodiments, each internucleoside linkage is a phosphorothioate
internucleoside linkage.
[0016] In certain embodiments, short antisense compounds comprise
at least one high affinity modification. In certain such
embodiments, the high-affinity modification is a
chemically-modified high-affinity nucleotide. In certain
embodiments, chemically-modified high affinity nucleotides are
sugar-modified nucleotides. In certain embodiments, at least one of
the sugar-modified nucleotides comprises a bridge between the 4'
and the 2' position of the sugar. Each of the sugar-modified
nucleotides is, independently, in the .beta.-D or .alpha.-L sugar
conformation. In certain embodiments, each of said high-affinity
modified nucleotides confers a T.sub.m of at least 1 to 4 degrees
per nucleotide. In certain embodiments, each of said sugar-modified
nucleotides comprises a 2'-substituent group that is other than H
or OH. Such sugar-modified nucleotides include those having a 4' to
2' bridged bicyclic sugar moiety. In certain embodiments, each of
the 2'-substituent groups is, independently, alkoxy, substituted
alkoxy, or halogen. In certain embodiments, each of the
2'-substituent groups is OCH.sub.2CH.sub.2OCH.sub.3 (2'-MOE).
[0017] In certain embodiments, short antisense compounds have one
or more sugar-modified nucleotides comprising a bridge between the
4' and 2' position of the sugar, wherein each of said bridges
independently comprises from 2 to 4 linked groups independently
selected from --[C(R.sub.1)(R.sub.2)].sub.n--,
--C(R.sub.1).dbd.C(R.sub.2)--, --C(R.sub.1--).dbd.N--,
--C(.dbd.NR.sub.1)--, --C(.dbd.O)--, --C(.dbd.S)--, --O--,
--Si(R.sub.1).sub.2--, --S(.dbd.O).sub.n-- and --N(R.sub.1)--;
[0018] wherein [0019] x is 0, 1, or 2; [0020] n is 1, 2, 3, or 4;
[0021] each R.sub.1 and R.sub.2 is, independently, H, a protecting
group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2 The-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle
radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7
alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical,
halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1,
acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
[0022] each J.sub.3 and J.sub.2 is, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group.
[0023] In one aspect, each of said bridges is, independently,
--[C(R.sub.1)(R.sub.2)].sub.n--,
--[C(R.sub.1)(R.sub.2)].sub.n--O--,
--C(R.sub.1R.sub.2)--N(R.sub.1)--O-- or
--C(R.sub.1R.sub.2)--O--N(R.sub.1)--. In another aspect, each of
said bridges is, independently,
4'-(CH.sub.2).sub.3-2',4'-(CH.sub.2).sub.2-2',4'-CH.sub.2--O-2',4'-(CH.su-
b.2).sub.2--O-2',4'-CH.sub.2--O--N(R.sub.1)-2' and
4'-CH.sub.2--N(R.sub.1)--O-2'- wherein each R.sub.1 is,
independently, H, a protecting group or C.sub.1-C.sub.12 alkyl.
[0024] In certain embodiments, provided herein are short antisense
compounds useful in the reduction of targets and/or target RNAs
associated with disease states in animals. In certain embodiments,
provided are methods of using the short antisense compounds for
reducing expression of a target RNA in an animal. In certain
embodiments, provided herein is the use of a short antisense
compound in the preparation of a medicament for the treatment of a
metabolic disorder in an animal. In certain embodiments, provided
herein is the use of a short antisense compound in the preparation
of a medicament for increasing insulin sensitivity, decreasing
blood glucose or decreasing HbA.sub.1c in an animal. Also provided
is the use of a short antisense compound in the preparation of a
medicament for decreasing total serum cholesterol, serum LDL, serum
VLDL, serum HDL, serum triglycerides, serum apolipoprotein(a) or
free fatty acids in an animal.
[0025] In certain embodiments, short antisense compounds provided
herein exhibit equal or increased potency with regard to target RNA
knockdown as compared to longer parent antisense oligonucleotide at
least 20 nucleotides in length. In certain embodiments, short
antisense compounds exhibit a faster onset of action (target RNA
reduction) as compared to the parent antisense oligonucleotide. In
certain embodiments, increased potency is in the kidney. In certain
embodiments, target RNA is predominately expressed in the kidney.
In certain embodiments, increased potency is in the liver. In
certain embodiments, target RNA is predominately expressed in the
liver.
DETAILED DESCRIPTION
[0026] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed. Herein, the use of the singular includes the plural unless
specifically stated otherwise. As used herein, the use of "or"
means "and/or" unless stated otherwise. Furthermore, the use of the
term "including" as well as other forms, such as "includes" and
"included", is not limiting. Also, terms such as "element" or
"component" encompass both elements and components comprising one
unit and elements and components that comprise more than one
subunit, unless specifically stated otherwise.
[0027] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
this application, including, but not limited to, patents, patent
applications, articles, books, and treatises, are hereby expressly
incorporated by reference in their entirety for any purpose. U.S.
patent application Ser. Nos 10/712,795 and 10/200,710 are hereby
expressly incorporated by reference in their entirety for any
purpose.
A. DEFINITIONS
[0028] Unless specific definitions are provided, the nomenclature
utilized in connection with, and the procedures and techniques of,
analytical chemistry, synthetic organic chemistry, and medicinal
and pharmaceutical chemistry described herein are those well known
and commonly used in the art. Standard techniques may be used for
chemical synthesis, chemical analysis, pharmaceutical preparation,
formulation and delivery, and treatment of subjects. Certain such
techniques and procedures may be found for example in "Carbohydrate
Modifications in Antisense Research" Edited by Sangvi and Cook,
American Chemical Society, Washington D.C., 1994; and "Remington's
Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., 18th
edition, 1990; and which is hereby incorporated by reference for
any purpose. Where permitted, all patents, applications, published
applications and other publications and sequences from GenBank and
other data bases referred to throughout in the disclosure herein
are incorporated by reference in their entirety.
[0029] Unless otherwise indicated, the following terms have the
following meanings:
[0030] As used herein, the term "nucleoside" means a glycosylamine
comprising a nucleobase and a sugar. Nucleosides includes, but are
not limited to, naturally occurring nucleosides, abasic
nucleosides, modified nucleosides, and nucleosides having mimetic
bases and/or sugar groups.
[0031] As used herein, the term "nucleotide" refers to a
glycosomine comprising a nucleobase and a sugar having a phosphate
group covalently linked to the sugar. Nucleotides may be modified
with any of a variety of substituents.
[0032] As used herein, the term "nucleobase" refers to the base
portion of a nucleoside or nucleotide. A nucleobase may comprise
any atom or group of atoms capable of hydrogen bonding to a base of
another nucleic acid.
[0033] As used herein, the term "heterocyclic base moiety" refers
to a nucleobase comprising a heterocycle.
[0034] As used herein, the term "deoxyribonucleotide" means a
nucleotide having a hydrogen at the 2' position of the sugar
portion of the nucleotide. Deoxyribonucleotides may be modified
with any of a variety of substituents.
[0035] As used herein, the term "ribonucleotide" means a nucleotide
having a hydroxy at the 2' position of the sugar portion of the
nucleotide. Ribonucleotides may be modified with any of a variety
of substituents.
[0036] As used herein, the term "oligomeric compound" refers to a
polymeric structure comprising two or more sub-structures and
capable of hybridizing to a region of a nucleic acid molecule. In
certain embodiments, oligomeric compounds are oligonucleosides. In
certain embodiments, oligomeric compounds are oligonucleotides. In
certain embodiments, oligomeric compounds are antisense compounds.
In certain embodiments, oligomeric compounds are antisense
oligonucleotides. In certain embodiments, oligomeric compounds are
short antisense compounds. In certain embodiments, oligomeric
compounds are short antisense oligonucleotides. In certain
embodiments, oligomeric compounds are chimeric
oligonucleotides.
[0037] As used herein, the term "monomer" refers to a single unit
of an oligomer. Monomers include, but are not limited to,
nucleosides and nucleotides, whether naturally occurring or
modified.
[0038] As used herein "oligonucleoside" refers to an
oligonucleotide in which the internucleoside linkages do not
contain a phosphorus atom.
[0039] As used herein, the term "oligonucleotide" refers to an
oligomeric compound comprising a plurality of linked nucleotides.
In certain embodiment, one or more nucleotides of an
oligonucleotide is modified. In certain embodiments, an
oligonucleotide comprises ribonucleic acid (RNA) or
deoxyribonucleic acid (DNA). In certain embodiments,
oligonucleotides are composed of naturally- and/or
non-naturally-occurring nucleobases, sugars and covalent
internucleotide linkages, and may further include non-nucleic acid
conjugates.
[0040] As used herein "internucleotide linkage" refers to a
covalent linkage between adjacent nucleotides.
[0041] As used herein, the term "monomeric linkage" refers to a
covalent linkage between two monmers. Monomeric linkages include,
but are not limited to internucleotide linkages and internucleoside
linkages.
[0042] As used herein "naturally occurring internucleotide linkage"
refers to a 3' to 5' phosphodiester linkage.
[0043] As used herein, the term "antisense compound" refers to an
oligomeric compound that is at least partially complementary to a
target nucleic acid molecule to which it hybridizes. In certain
embodiments, an antisense compound modulates (increases or
decreases) expression of a target nucleic acid. Antisense compounds
include, but are not limited to, compounds that are
oligonucleotides, oligonucleosides, oligonucleotide analogs,
oligonucleotide mimetics, and chimeric combinations of these.
Consequently, while all antisense compounds are oligomeric
compounds, not all oligomeric compounds are antisense
compounds.
[0044] As used herein, the term "antisense oligonucleotide" refers
to an antisense compound that is an oligonucleotide.
[0045] As used herein, the term "parent antisense oligonucleotide"
refers to an oligonucleotide 20 nucleotides in length having a
deoxy gap region having ten 2'-deoxyribonucleotides, flanked by a
first and a second wing region each having five
2'-O-(2-methoxyethyl) ribonucleotides (a 5-10-5 MOE gapmer) and
comprising the sequence of the corresponding short antisense
compound to which it is a parent.
[0046] As used herein, the term "short antisense compound" refers
to an antisense compound about 8, 9, 10, 11, 12, 13, 14, 15 or 16
monomers in length. In certain embodiments, a short antisense
compound has at least one high-affinity modification.
[0047] As used herein, the term "short antisense oligonucleotide"
or refers to an antisense oligonucleotide about 8, 9, 10, 11, 12,
13, 14, 15 or 16 nucleotides in length. In certain embodiments, a
short antisense oligonucleotide has at least one high-affinity
modification.
[0048] As used herein, the term "short gapmer" refers to a short
antisense oligonucleotide having a first and a second wing region
each independently 1 to 3 nucleotides in length and a gap region 2
to 14 nucleobase in length.
[0049] As used herein, the term "motif" refers to the pattern of
unmodified and modified nucleotides in a short antisense
compound.
[0050] As used herein, the term "chimeric antisense oligomer"
refers to an antisense oligomeric compound, having at least one
sugar, nucleobase or internucleoside linkage that is differentially
modified as compared to at least on other sugar, nucleobase or
internucleoside linkage within the same antisense oligomeric
compound. The remainder of the sugars, nucleobases and
internucleoside linkages can be independently modified or
unmodified, the same or different.
[0051] As used herein, the term "chimeric antisense
oligonucleotide" refers to an antisense oligonucleotide, having at
least one sugar, nucleobase or internucleoside linkage that is
differentially modified as compared to at least on other sugar,
nucleobase or internucleoside linkage within the same antisense
oligonucleotide. The remainder of the sugars, nucleobases and
internucleoside linkages can be independently modified or
unmodified, the same or different.
[0052] As used herein, the term "mixed-backbone antisense
oligonucleotide" refers to an antisense oligonucleotide wherein at
least one internucleoside linkage of the antisense oligonucleotide
is different from at least one other internucleotide linkage of the
antisense oligonucleotide.
[0053] As used herein, the term "target" refers to a protein, the
modulation of which is desired.
[0054] As used herein, the term "target gene" refers to a gene
encoding a target.
[0055] As used herein, the terms "target nucleic acid" and "nucleic
acid molecule encoding a target" refer to any nucleic acid molecule
the expression or activity of which is capable of being modulated
by an antisense compound. Target nucleic acids include, but are not
limited to, RNA (including, but not limited to pre-mRNA and mRNA or
portions thereof) transcribed from DNA encoding a target, and also
cDNA derived from such RNA, and miRNA. For example, the target
nucleic acid can be a cellular gene (or mRNA transcribed from the
gene) whose expression is associated with a particular disorder or
disease state, or a nucleic acid molecule from an infectious
agent.
[0056] As used herein, the term "targeting" or "targeted to" refers
to the association of an antisense compound to a particular target
nucleic acid molecule or a particular region of nucleotides within
a target nucleic acid molecule.
[0057] As used herein, the term "5' target site" refers to the
nucleotide of a target nucleic acid which is complementary to the
5'-most nucleotide of a particular antisense compound.
[0058] As used herein, the term "3' target site" refers to the
nucleotide of a target nucleic acid which is complementary to the
3'-most nucleotide of a particular antisense compound.
[0059] As used herein, the term "target region," refers to a
portion of a target nucleic acid to which one or more antisense
compounds is complementary.
[0060] As used herein, the term "target segment" refers to a
smaller or sub-portions of a region within a target nucleic
acid.
[0061] As used herein, the term "nucleobase complementarity" refers
to a nucleobase that is capable of base pairing with another
nucleobase. For example, in DNA, adenine (A) is complementary to
thymine (T). For example, in RNA, adenine (A) is complementary to
uracil (U). In certain embodiments, complementary nucleobase refers
to a nucleobase of an antisense compound that is capable of base
pairing with a nucleobase of its target nucleic acid. For example,
if a nucleobase at a certain position of an antisense compound is
capable of hydrogen bonding with a nucleobase at a certain position
of a target nucleic acid, then the position of hydrogen bonding
between the oligonucleotide and the target nucleic acid is
considered to be complementary at that nucleobase pair.
[0062] As used herein, the term "non-complementary nucleobase"
refers to a pair of nucleobases that do not form hydrogen bonds
with one another or otherwise support hybridization.
[0063] As used herein, the term "complementary" refers to the
capacity of an oligomeric compound to hybridize to another
oligomeric compound or nucleic acid through nucleobase
complementarity. In certain embodiments, an antisense compound and
its target are complementary to each other when a sufficient number
of corresponding positions in each molecule are occupied by
nucleobases that can bond with each other to allow stable
association between the antisense compound and the target. One
skilled in the art recognizes that the inclusion of mismatches is
possible without eliminating the ability of the oligomeric
compounds to remain in association. Therefore, described herein are
antisense compounds that may comprise up to about 20% nucleotides
that are mismatched (i.e., are not nucleobase complementary to the
corresponding nucleotides of the target). Preferably the antisense
compounds contain no more than about 15%, more preferably not more
than about 10%, most preferably not more than 5% or no mismatches.
The remaining nucleotides are nucleobase complementary or otherwise
do not disrupt hybridization (e.g., universal bases). One of
ordinary skill in the art would recognize the compounds provided
herein are at least 80%, at least 85%, at least 90%, at least 95%,
at least 96%, at least 97%, at least 98%, at least 99% or 100%
complementary to a target nucleic acid.
[0064] As used herein, the term "mismatch" refers to a
non-complementary nucleobase within a complementary oligomeric
compound.
[0065] As used herein, "hybridization" means the pairing of
complementary oligomeric compounds (e.g., an antisense compound and
its target nucleic acid). While not limited to a particular
mechanism, the most common mechanism of pairing involves hydrogen
bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen
hydrogen bonding, between complementary nucleoside or nucleotide
bases (nucleobases). For example, the natural base adenine is
nucleobase complementary to the natural nucleobases thymidine and
uracil which pair through the formation of hydrogen bonds. The
natural base guanine is nucleobase complementary to the natural
bases cytosine and 5-methyl cytosine. Hybridization can occur under
varying circumstances.
[0066] As used herein, the term "specifically hybridizes" refers to
the ability of an oligomeric compound to hybridize to one nucleic
acid site with greater affinity than it hybridizes to another
nucleic acid site. In certain embodiments, an antisense
oligonucleotide specifically hybridizes to more than one target
site.
[0067] As used herein, "designing" or "designed to" refer to the
process of designing an oligomeric compound that specifically
hybridizes with a selected nucleic acid molecule.
[0068] As used herein, the term "modulation" refers to a
perturbation of function or activity when compared to the level of
the function or activity prior to modulation. For example,
modulation includes the change, either an increase (stimulation or
induction) or a decrease (inhibition or reduction) in gene
expression. As further example, modulation of expression can
include perturbing splice site selection of pre-mRNA
processing.
[0069] As used herein, the term "expression" refers to all the
functions and steps by which a gene's coded information is
converted into structures present and operating in a cell. Such
structures include, but are not limited to the products of
transcription and translation.
[0070] As used herein, "variant" refers to an alternative RNA
transcript that can be produced from the same genomic region of
DNA. Variants include, but are not limited to "pre-mRNA variants"
which are transcripts produced from the same genomic DNA that
differ from other transcripts produced from the same genomic DNA in
either their start or stop position and contain both intronic and
exonic sequence. Variants also include, but are not limited to,
those with alternate splice junctions, or alternate initiation and
termination codons.
[0071] As used herein, "high-affinity modified monomer" refers to a
monomer having at least one modified nucleobase, internucleoside
linkage or sugar moiety, when compared to naturally occurring
monomers, such that the modification increases the affinity of an
antisense compound comprising the high-affinity modified monomer to
its target nucleic acid. High-affinity modifications include, but
are not limited to, monomers (e.g., nucleosides and nucleotides)
comprising 2'-modified sugars.
[0072] As used herein, the term "2'-modified" or "2'-substituted"
means a sugar comprising substituent at the 2' position other than
H or OH. 2'-modified monomers, include, but are not limited to,
BNA's and monomers (e.g., nucleosides and nucleotides) with
2'-substituents, such as allyl, amino, azido, thio, O-allyl,
O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), or
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. In certain embodiments, short antisense
compounds comprise a 2'modified monomer that does not have the
formula 2'-O(CH.sub.2).sub.nH, wherein n is one to six. In certain
embodiments, short antisense compounds comprise a 2'modified
monomer that does not have the formula 2'-OCH.sub.3. In certain
embodiments, short antisense compounds comprise a 2'modified
monomer that does not have the formula or, in the alternative,
2'-O(CH.sub.2).sub.2OCH.sub.3.
[0073] As used herein, the term "bicyclic nucleic acid" or "BNA" or
"bicyclic nucleoside" or "bicyclic nucleotide" refers to a
nucleoside or nucleotide wherein the furanose portion of the
nucleoside includes a bridge connecting two carbon atoms on the
furanose ring, thereby forming a bicyclic ring system.
[0074] As used herein, unless otherwise indicated, the term
"methyleneoxy BNA" alone refers to .beta.-D-methyleneoxy BNA.
[0075] As used herein, the term "MOE" refers to a 2'-methoxyethyl
substituent.
[0076] As used herein, the term "gapmer" refers to a chimeric
oligomeric compound comprising a central region (a "gap") and a
region on either side of the central region (the "wings"), wherein
the gap comprises at least one modification that is different from
that of each wing. Such modifications include nucleobase, monomeric
linkage, and sugar modifications as well as the absence of
modification (unmodified). Thus, in certain embodiments, the
nucleotide linkages in each of the wings are different than the
nucleotide linkages in the gap. In certain embodiments, each wing
comprises nucleotides with high affinity modifications and the gap
comprises nucleotides that do not comprise that modification. In
certain embodiments the nucleotides in the gap and the nucleotides
in the wings all comprise high affinity modifications, but the high
affinity modifications in the gap are different than the high
affinity modifications in the wings. In certain embodiments, the
modifications in the wings are the same as one another. In certain
embodiments, the modifications in the wings are different from each
other. In certain embodiments, nucleotides in the gap are
unmodified and nucleotides in the wings are modified. In certain
embodiments, the modification(s) in each wing are the same. In
certain embodiments, the modification(s) in one wing are different
from the modification(s) in the other wing. In certain embodiments,
short antisense compounds are gapmers having 2'-deoxynucleotides in
the gap and nucleotides with high-affinity modifications in the
wing.
[0077] As used herein, the term "prodrug" refers to a therapeutic
agent that is prepared in an inactive form that is converted to an
active form (i.e., drug) within the body or cells thereof by the
action of endogenous enzymes or other chemicals and/or
conditions.
[0078] As used herein, the term "pharmaceutically acceptable salts"
refers to salts of active compounds that retain the desired
biological activity of the active compound and do not impart
undesired toxicological effects thereto.
[0079] As used herein, the term "cap structure" or "terminal cap
moiety" refers to chemical modifications, which have been
incorporated at either terminus of an antisense compound.
[0080] As used herein, the term "prevention" refers to delaying or
forestalling the onset or development of a condition or disease for
a period of time from hours to days, preferably weeks to
months.
[0081] As used herein, the term "amelioration" refers to a
lessening of at least one indicator of the severity of a condition
or disease. The severity of indicators may be determined by
subjective or objective measures which are known to those skilled
in the art.
[0082] As used herein, the term "treatment" refers to administering
a composition of the invention to effect an alteration or
improvement of the disease or condition. Prevention, amelioration,
and/or treatment may require administration of multiple doses at
regular intervals, or prior to onset of the disease or condition to
alter the course of the disease or condition. Moreover, a single
agent may be used in a single individual for each prevention,
amelioration, and treatment of a condition or disease sequentially,
or concurrently.
[0083] As used herein, the term "pharmaceutical agent" refers to a
substance provides a therapeutic benefit when administered to a
subject.
[0084] As used herein, the term "therapeutically effective amount"
refers to an amount of a pharmaceutical agent that provides a
therapeutic benefit to an animal.
[0085] As used herein, "administering" means providing a
pharmaceutical agent to an animal, and includes, but is not limited
to administering by a medical professional and
self-administering.
[0086] As used herein, the term "co-administration" refers to
administration of two or more pharmaceutical agents to an animal.
The two or more pharmaceutical agents may be in a single
pharmaceutical composition, or may be in separate pharmaceutical
compositions. Each of the two or more pharmaceutical agents may be
administered through the same or different routes of
administration. Co-administration encompasses administration in
parallel or sequentially.
[0087] As used herein, the term "pharmaceutical composition" refers
to a mixture of substances suitable for administering to an
individual. For example, a pharmaceutical composition may comprise
an antisense oligonucleotide and a sterile aqueous solution.
[0088] As used herein, the term "individual" refers to a human or
non-human animal selected for treatment or therapy.
[0089] As used herein, the term "animal" refers to a human or
non-human animal, including, but not limited to, mice, rats,
rabbits, dogs, cats, pigs, and non-human primates, including, but
not limited to, monkeys and chimpanzees.
[0090] As used herein, the term "subject" refers to an animal,
including, but not limited to a human, to whom a pharmaceutical
composition is administered.
[0091] As used herein, the term "duration" refers to the period of
time during which an activity or event continues. In certain
embodiments, the duration of treatment is the period of time during
which doses of a pharmaceutical agent are administered.
[0092] As used herein, the term "parenteral administration," refers
to administration through injection or infusion. Parenteral
administration includes, but is not limited to, subcutaneous
administration, intravenous administration, or intramuscular
administration.
[0093] As used herein, the term "subcutaneous administration"
refers to administration just below the skin. "Intravenous
administration" means administration into a vein.
[0094] As used herein, the term "dose" refers to a specified
quantity of a pharmaceutical agent provided in a single
administration. In certain embodiments, a dose may be administered
in two or more boluses, tablets, or injections. For example, in
certain embodiments, where subcutaneous administration is desired,
the desired dose requires a volume not easily accommodated by a
single injection. In such embodiments, two or more injections may
be used to achieve the desired dose. In certain embodiments, a dose
may be administered in two or more injections to minimize injection
site reaction in an individual.
[0095] As used herein, the term "dosage unit" refers to a form in
which a pharmaceutical agent is provided. In certain embodiments, a
dosage unit is a vial comprising lyophilized antisense
oligonucleotide. In certain embodiments, a dosage unit is a vial
comprising reconstituted antisense oligonucleotide.
[0096] As used herein, the term "pharmaceutical agent" refers to a
substance provides a therapeutic benefit when administered to an
individual. For example, in certain embodiments, an antisense
oligonucleotide is a pharmaceutical agent.
[0097] As used herein, the term "active pharmaceutical ingredient"
refers to the substance in a pharmaceutical composition that
provides a desired effect.
[0098] As used herein, the term "therapeutically effective amount"
refers to an amount of a pharmaceutical agent that provides a
therapeutic benefit to an individual. In certain embodiments, a
therapeutically effective amount of an antisense compound is the
amount that needs to be administered to result in an observable
benefit.
[0099] As used herein, the term "hypercholesterolemia" refers to a
condition characterized by elevated serum cholesterol.
[0100] As used herein, the term "hyperlipidemia" refers to a
condition characterized by elevated serum lipids.
[0101] As used herein, the term "hypertriglyceridemia" refers to a
condition characterized by elevated triglyceride levels.
[0102] As used herein, the term "non-familial hypercholesterolemia"
refers to a condition characterized by elevated cholesterol that is
not the result of a single inherited gene mutation.
[0103] As used herein, the term "polygenic hypercholesterolemia"
refers to a condition characterized by elevated cholesterol that
results from the influence of a variety of genetic factors. In
certain embodiments, polygenic hypercholesterolemia may be
exacerbated by dietary intake of lipids.
[0104] As used herein, the term "familial hypercholesterolemia
(FH)" refers to an autosomal dominant metabolic disorder
characterized by a mutation in the LDL-receptor (LDL-R) gene,
markedly elevated LDL-C and premature onset of atherosclerosis. A
diagnosis of familial hypercholesterolemia is made when a
individual meets one or more of the following criteria: genetic
testing confirming 2 mutated LDL-receptor genes; genetic testing
confirming one mutated LDL-receptor gene; document history of
untreated serum LDL-cholesterol greater than 500 mg/dL; tendinous
and/or cutaneous xanthoma prior to age 10 years; or, both parents
have documented elevated serum LDL-cholesterol prior to
lipid-lowering therapy consistent with heterozygous familial
hypercholesterolemia.
[0105] As used herein, the term "homozygous familial
hypercholesterolemia" or "HoFH" refers to a condition characterized
by a mutation in both maternal and paternal LDL-R genes.
[0106] As used herein, the term "heterozygous familial
hypercholesterolemia" or "HeFH" refers to a condition characterized
by a mutation in either the maternal or paternal LDL-R gene.
[0107] As used herein, the term "mixed dyslipidemia" refers to a
condition characterized by elevated serum cholesterol and elevated
serum triglycerides.
[0108] As used herein, the term "diabetic dyslipidemia" or "Type II
diabetes with dyslipidemia" refers to a condition characterized by
Type II diabetes, reduced HDL-C, elevated serum triglycerides, and
elevated small, dense LDL particles.
[0109] As used herein, the term "CHD risk equivalents," refers to
indicators of clinical atherosclerotic disease that confer a high
risk for coronary heart disease. For example, in certain
embodiments, CHD risk equivalents include, without limitation,
clinical coronary heart disease, symptomatic carotid artery
disease, peripheral arterial disease, and/or abdominal aortic
aneurysm.
[0110] As used herein, the term "non-alcoholic fatty liver disease
(NAFLD)" refers to a condition characterized by fatty inflammation
of the liver that is not due to excessive alcohol use (for example,
alcohol consumption of over 20 g/day). In certain embodiments,
NAFLD is related to insulin resistance and the metabolic
syndrome.
[0111] As used herein, the term "non-alcoholic steatohepatitis
(NASH)" refers to a condition characterized by inflammation and the
accumulation of fat and fibrous tissue in the liver, that is not
due to excessive alcohol use. NASH is an extreme form of NAFLD.
[0112] As used herein, the term "major risk factors" refers to
factors that contribute to a high risk for a particular disease or
condition. In certain embodiments, major risk factors for coronary
heart disease include, without limitation, cigarette smoking,
hypertension, low HDL-C, family history of coronary heart disease,
and age.
[0113] As used herein, the term "CHD risk factors" refers to CHD
risk equivalents and major risk factors.
[0114] As used herein, the term "coronary heart disease (CHD)"
refers to a narrowing of the small blood vessels that supply blood
and oxygen to the heart, which is often a result of
atherosclerosis.
[0115] As used herein, the term "reduced coronary heart disease
risk" refers to a reduction in the likelihood that a individual
will develop coronary heart disease. In certain embodiments, a
reduction in coronary heart disease risk is measured by an
improvement in one or more CHD risk factors, for example, a
decrease in LDL-C levels.
[0116] As used herein, the term "atherosclerosis" refers to a
hardening of the arteries affecting large and medium-sized arteries
and is characterized by the presence of fatty deposits. The fatty
deposits are called "atheromas" or "plaques," which consist mainly
of cholesterol and other fats, calcium and scar tissue, and damage
the lining of arteries.
[0117] As used herein, the term "history of coronary heart disease"
refers to the occurrence of clinically evident coronary heart
disease in the medical history of a individual or a individual's
family member.
[0118] As used herein, the term "Early onset coronary heart
disease" refers to a diagnosis of coronary heart disease prior to
age 50.
[0119] As used herein, the term "statin intolerant individual"
refers to a individual who as a result of statin therapy
experiences one or more of creatine kinase increases, liver
function test abnormalities, muscle aches, or central nervous
system side effects.
[0120] As used herein, the term "efficacy" refers to the ability to
produce a desired effect. For example, efficacy of a lipid-lowering
therapy may be reduction in the concentration of one or more of
LDL-C, VLDL-C, IDL-C, non-HDL-C, ApoB, lipoprotein(a), or
triglycerides.
[0121] As used herein, the term "acceptable safety profile" refers
to a pattern of side effects that is within clinically acceptable
limits.
[0122] As used herein, the term "side effects" refers to
physiological responses attributable to a treatment other than
desired effects. In certain embodiments, side effects include,
without limitation, injection site reactions, liver function test
abnormalities, renal function abnormalities, liver toxicity, renal
toxicity, central nervous system abnormalities, and myopathies. For
example, increased aminotransferase levels in serum may indicate
liver toxicity or liver function abnormality. For example,
increased bilirubin may indicate liver toxicity or liver function
abnormality.
[0123] As used herein, the term "injection site reaction" refers to
inflammation or abnormal redness of skin at a site of injection in
an individual.
[0124] As used herein, the term "individual compliance" refers to
adherence to a recommended or prescribed therapy by an
individual.
[0125] As used herein, the term "lipid-lowering therapy" refers to
a therapeutic regimen provided to a individual to reduce one or
more lipids in a individual. In certain embodiments, a
lipid-lowering therapy is provide to reduce one or more of ApoB,
total cholesterol, LDL-C, VLDL-C, IDL-C, non-HDL-C, triglycerides,
small dense LDL particles, and Lp(a) in an individual.
[0126] As used herein, the term "lipid-lowering agent" refers to a
pharmaceutical agent provided to a individual to achieve a lowering
of lipids in the individual. For example, in certain embodiments, a
lipid-lowering agent is provided to an individual to reduce one or
more of ApoB, LDL-C, total cholesterol, and triglycerides.
[0127] As used herein, the term "LDL-C target" refers to an LDL-C
level that is desired following lipid-lowering therapy.
[0128] As used herein, the term "comply" refers to the adherence
with a recommended therapy by an individual.
[0129] As used herein, the term "recommended therapy" refers to a
therapeutic regimen recommended by a medical professional for the
treatment, amelioration, or prevention of a disease.
[0130] As used herein, the term "low LDL-receptor activity" refers
to LDL-receptor activity that is not sufficiently high to maintain
clinically acceptable levels of LDL-C in the bloodstream.
[0131] As used herein, the term "cardiovascular outcome" refers to
the occurrence of major adverse cardiovascular events.
[0132] As used herein, the term "improved cardiovascular outcome"
refers to a reduction in the occurrence of major adverse
cardiovascular events, or the risk thereof. Examples of major
adverse cardiovascular events include, without limitation, death,
reinfarction, stroke, cardiogenic shock, pulmonary edema, cardiac
arrest, and atrial dysrhythmia.
[0133] As used herein, the term "surrogate markers of
cardiovascular outcome" refers to indirect indicators of
cardiovascular events, or the risk thereof. For example, surrogate
markers of cardiovascular outcome include carotid intimal media
thickness (CIMT). Another example of a surrogate marker of
cardiovascular outcome includes atheroma size. Atheroma size may be
determined by intravascular ultrasound (IVUS).
[0134] As used herein, the term "increased HDL-C" refers to an
increase in serum HDL-C in an individual over time.
[0135] As used herein, the term "lipid-lowering" refers to a
reduction in one or more serum lipids in an individual over
time.
[0136] As used herein, the term "metabolic disorder" refers to a
condition characterized by an alteration or disturbance in
metabolic function. "Metabolic" and "metabolism" are terms well
know in the art and generally include the whole range of
biochemical processes that occur within a living organism.
Metabolic disorders include, but are not limited to, hyperglycemia,
prediabetes, diabetes (type I and type II), obesity, insulin
resistance and metabolic syndrome.
[0137] As used herein, the term "metabolic syndrome" refers to a
clustering of lipid and non-lipid cardiovascular risk factors of
metabolic origin. It has been closely linked to the generalized
metabolic disorder known as insulin resistance. The National
Cholesterol Education Program (NCEP) Adult Treatment Panel III
(ATPIII) established criteria for diagnosis of metabolic syndrome
when three or more of five risk determinants are present. The five
risk determinants are abdominal obesity defined as waist
circumference of greater than 102 cm for men or greater than 88 cm
for women, triglyceride levels greater than or equal to 150 mg/dL,
HDL cholesterol levels of less than 40 mg/dL for men and less than
50 mg/dL for women, blood pressure greater than or equal to 130/85
mm Hg and fasting glucose levels greater than or equal to 110
mg/dL. These determinants can be readily measured in clinical
practice (JAMA, 2001, 285: 2486-2497).
[0138] The term "alkyl," as used herein, refers to a saturated
straight or branched hydrocarbon radical containing up to twenty
four carbon atoms. Examples of alkyl groups include, but are not
limited to, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl,
octyl, decyl, dodecyl and the like. Alkyl groups typically include
from 1 to about 24 carbon atoms, more typically from 1 to about 12
carbon atoms (C.sub.1-C.sub.12 alkyl) with from 1 to about 6 carbon
atoms being more preferred. The term "lower alkyl" as used herein
includes from 1 to about 6 carbon atoms. Alkyl groups as used
herein may optionally include one or more further substituent
groups.
[0139] The term "alkenyl," as used herein, refers to a straight or
branched hydrocarbon chain radical containing up to twenty four
carbon atoms and having at least one carbon-carbon double bond.
Examples of alkenyl groups include, but are not limited to,
ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as
1,3-butadiene and the like. Alkenyl groups typically include from 2
to about 24 carbon atoms, more typically from 2 to about 12 carbon
atoms with from 2 to about 6 carbon atoms being more preferred.
Alkenyl groups as used herein may optionally include one or more
further substituent groups.
[0140] The term "alkynyl," as used herein, refers to a straight or
branched hydrocarbon radical containing up to twenty four carbon
atoms and having at least one carbon-carbon triple bond. Examples
of alkynyl groups include, but are not limited to, ethynyl,
1-propynyl, 1-butynyl, and the like. Alkynyl groups typically
include from 2 to about 24 carbon atoms, more typically from 2 to
about 12 carbon atoms with from 2 to about 6 carbon atoms being
more preferred. Alkynyl groups as used herein may optionally
include one or more further substitutent groups.
[0141] The term "aminoalkyl" as used herein, refers to an amino
substituted alkyl radical. This term is meant to include
C.sub.1-C.sub.12 alkyl groups having an amino substituent at any
position and wherein the alkyl group attaches the aminoalkyl group
to the parent molecule. The alkyl and/or amino portions of the
aminoalkyl group can be further substituted with substituent
groups.
[0142] The term "aliphatic," as used herein, refers to a straight
or branched hydrocarbon radical containing up to twenty four carbon
atoms wherein the saturation between any two carbon atoms is a
single, double or triple bond. An aliphatic group preferably
contains from 1 to about 24 carbon atoms, more typically from 1 to
about 12 carbon atoms with from 1 to about 6 carbon atoms being
more preferred. The straight or branched chain of an aliphatic
group may be interrupted with one or more heteroatoms that include
nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups
interrupted by heteroatoms include without limitation polyalkoxys,
such as polyalkylene glycols, polyamines, and polyimines. Aliphatic
groups as used herein may optionally include further substitutent
groups.
[0143] The term "alicyclic" or "alicyclyl" refers to a cyclic ring
system wherein the ring is aliphatic. The ring system can comprise
one or more rings wherein at least one ring is aliphatic. Preferred
alicyclics include rings having from about 5 to about 9 carbon
atoms in the ring. Alicyclic as used herein may optionally include
further substitutent groups.
[0144] The term "alkoxy," as used herein, refers to a radical
formed between an alkyl group and an oxygen atom wherein the oxygen
atom is used to attach the alkoxy group to a parent molecule.
Examples of alkoxy groups include, but are not limited to, methoxy,
ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy,
n-pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used
herein may optionally include further substitutent groups.
[0145] The terms "halo" and "halogen," as used herein, refer to an
atom selected from fluorine, chlorine, bromine and iodine.
[0146] The terms "aryl" and "aromatic," as used herein, refer to a
mono- or polycyclic carbocyclic ring system radicals having one or
more aromatic rings. Examples of aryl groups include, but are not
limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl
and the like. Preferred aryl ring systems have from about 5 to
about 20 carbon atoms in one or more rings. Aryl groups as used
herein may optionally include further substitutent groups.
[0147] The terms "aralkyl" and "arylalkyl," as used herein, refer
to a radical formed between an alkyl group and an aryl group
wherein the alkyl group is used to attach the aralkyl group to a
parent molecule. Examples include, but are not limited to, benzyl,
phenethyl and the like. Aralkyl groups as used herein may
optionally include further substitutent groups attached to the
alkyl, the aryl or both groups that form the radical group.
[0148] The term "heterocyclic radical" as used herein, refers to a
radical mono-, or poly-cyclic ring system that includes at least
one heteroatom and is unsaturated, partially saturated or fully
saturated, thereby including heteroaryl groups. Heterocyclic is
also meant to include fused ring systems wherein one or more of the
fused rings contain at least one heteroatom and the other rings can
contain one or more heteroatoms or optionally contain no
heteroatoms. A heterocyclic group typically includes at least one
atom selected from sulfur, nitrogen or oxygen. Examples of
heterocyclic groups include, [1,3]dioxolane, pyrrolidinyl,
pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl,
piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl,
morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl,
pyridazinonyl, tetrahydrofuryl and the like. Heterocyclic groups as
used herein may optionally include further substitutent groups.
[0149] The terms "heteroaryl," and "heteroaromatic," as used
herein, refer to a radical comprising a mono- or poly-cyclic
aromatic ring, ring system or fused ring system wherein at least
one of the rings is aromatic and includes one or more heteroatom.
Heteroaryl is also meant to include fused ring systems including
systems where one or more of the fused rings contain no
heteroatoms. Heteroaryl groups typically include one ring atom
selected from sulfur, nitrogen or oxygen. Examples of heteroaryl
groups include, but are not limited to, pyridinyl, pyrazinyl,
pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl,
isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl,
quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl,
quinoxalinyl, and the like. Heteroaryl radicals can be attached to
a parent molecule directly or through a linking moiety such as an
aliphatic group or hetero atom. Heteroaryl groups as used herein
may optionally include further substitutent groups.
[0150] The term "heteroarylalkyl," as used herein, refers to a
heteroaryl group as previously defined having an alky radical that
can attach the heteroarylalkyl group to a parent molecule. Examples
include, but are not limited to, pyridinylmethyl, pyrimidinylethyl,
napthyridinylpropyl and the like. Heteroarylalkyl groups as used
herein may optionally include further substitutent groups on one or
both of the heteroaryl or alkyl portions.
[0151] The term "mono or poly cyclic structure" as used in the
present invention includes all ring systems that are single or
polycyclic having rings that are fused or linked and is meant to be
inclusive of single and mixed ring systems individually selected
from aliphatic, alicyclic, aryl, heteroaryl, aralkyl, arylalkyl,
heterocyclic, heteroaryl, heteroaromatic, heteroarylalkyl. Such
mono and poly cyclic structures can contain rings that are uniform
or have varying degrees of saturation including fully saturated,
partially saturated or fully unsaturated. Each ring can comprise
ring atoms selected from C, N, O and S to give rise to heterocyclic
rings as well as rings comprising only C ring atoms which can be
present in a mixed motif such as for example benzimidazole wherein
one ring has only carbon ring atoms and the fused ring has two
nitrogen atoms. The mono or poly cyclic structures can be further
substituted with substituent groups such as for example phthalimide
which has two .dbd.O groups attached to one of the rings. In
another aspect, mono or poly cyclic structures can be attached to a
parent molecule directly through a ring atom, through a substituent
group or a bifunctional linking moiety.
[0152] The term "acyl," as used herein, refers to a radical formed
by removal of a hydroxyl group from an organic acid and has the
general formula --C(O)--X where X is typically aliphatic, alicyclic
or aromatic. Examples include aliphatic carbonyls, aromatic
carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic
sulfinyls, aromatic phosphates, aliphatic phosphates and the like.
Acyl groups as used herein may optionally include further
substitutent groups.
[0153] The term "hydrocarbyl" includes groups comprising C, O and
H. Included are straight, branched and cyclic groups having any
degree of saturation. Such hydrocarbyl groups can include one or
more heteroatoms selected from N, O and S and can be further mono
or poly substituted with one or more substituent groups.
[0154] The terms "substituent" and "substituent group," as used
herein, include groups that are typically added to other groups or
parent compounds to enhance desired properties or give desired
effects. Substituent groups can be protected or unprotected and can
be added to one available site or to many available sites in a
parent compound. Substituent groups may also be further substituted
with other substituent groups and may be attached directly or via a
linking group such as an alkyl or hydrocarbyl group to a parent
compound. Such groups include without limitation, halogen,
hydroxyl, alkyl, alkenyl, alkynyl, acyl (--C(O)R.sub.aa), carboxyl
(--C(O)O--R.sub.aa), aliphatic groups, alicyclic groups, alkoxy,
substituted oxo (--O--R.sub.aa), aryl, aralkyl, heterocyclic,
heteroaryl, heteroarylalkyl, amino (--NR.sub.bbR.sub.cc),
imino(.dbd.NR.sub.bb), amido (--C(O)NR.sub.bbR.sub.cc or
--N(R.sub.bb)C(O)R.sub.aa), azido (--N.sub.3), nitro (--NO.sub.2),
cyano (--CN), carbamido (--OC(O)NR.sub.bbR.sub.cc or
--N(R.sub.bb)C(O)OR.sub.aa), ureido
(--N(R.sub.bb)C(O)NR.sub.bbR.sub.cc), thioureido
(--N(R.sub.bb)C(S)NR.sub.bbR.sub.cc), guanidinyl
(--N(R.sub.bb)C(.dbd.NR.sub.bb)NR.sub.bbR.sub.cc), amidinyl
(--C(.dbd.NR.sub.bb)NR.sub.bbR.sub.cc or
--N(R.sub.bb)C(NR.sub.bb)R.sub.aa), thiol (--SR.sub.bb), sulfinyl
(--S(O)R.sub.bb), sulfonyl (--S(O).sub.2R.sub.bb), sulfonamidyl
(--S(O).sub.2NR.sub.bbR.sub.cc or --N(R.sub.bb)S(O).sub.2R.sub.bb)
and conjugate groups. Wherein each R.sub.aa, R.sub.bb and R.sub.cc
is, independently, H, an optionally linked chemical functional
group or a further substituent group with a preferred list
including without limitation H, alkyl, alkenyl, alkynyl, aliphatic,
alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic
and heteroarylalkyl.
B. Certain Oligomeric Compounds
[0155] In certain embodiments, it is desirable to chemically modify
oligomeric compounds, compared to naturally occurring oligomers,
such as DNA or RNA. Certain such modifications alter the activity
of the oligomeric compound. Certain such chemical modifications can
alter activity by, for example: increasing affinity of an antisense
compound for its target nucleic acid, increasing its resistance to
one or more nucleases, and/or altering the pharmacokinetics or
tissue distribution of the oligomeric compound. In certain
instances, the use of chemistries that increase the affinity of an
oligomeric compound for its target can allow for the use of shorter
oligomeric compounds.
[0156] 1. Certain Monomers
[0157] In certain embodiment, oligomeric compounds comprise one or
more modified monomer. In certain such embodiments, oligomeric
compounds comprise one or more high affinity monomer. In certain
embodiments, such high-affinity monomer is selected from monomers
(e.g., nucleosides and nucleotides) comprising 2'-modified sugars,
including, but not limited to: BNA's and monomers (e.g.,
nucleosides and nucleotides) with 2'-substituents such as allyl,
amino, azido, thio, O-allyl, O--C.sub.1-C.sub.10 alkyl,
--OCF.sub.3, O--(CH.sub.2).sub.2--O--CH.sub.3,
2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), or
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl.
[0158] In certain embodiments, the oligomeric compounds including,
but no limited to short antisense compounds of the present
invention, comprise one or more high affinity monomers provided
that the oligomeric compound does not comprise a nucleotide
comprising a 2'-O(CH.sub.2).sub.nH, wherein n is one to six.
[0159] In certain embodiments, the oligomeric compounds including,
but no limited to short antisense compounds of the present
invention, comprise one or more high affinity monomer provided that
the oligomeric compound does not comprise a nucleotide comprising a
2'-OCH.sub.3 or a 2'-O(CH.sub.2).sub.2OCH.sub.3.
[0160] In certain embodiments, the oligomeric compounds including,
but no limited to short antisense compounds of the present
invention, comprise one or more high affinity monomer provided that
the oligomeric compound does not comprise a .alpha.-L-Methyleneoxy
(4'-CH.sub.2--O-2') BNA.
[0161] In certain embodiments, the oligomeric compounds including,
but no limited to short antisense compounds of the present
invention, comprise one or more high affinity monomer provided that
the oligomeric compound does not comprise a .beta.-D-Methyleneoxy
(4'-CH.sub.2--O-2') BNA.
[0162] In certain embodiments, the oligomeric compounds including,
but no limited to short antisense compounds of the present
invention, comprise one or more high affinity monomer provided that
the oligomeric compound does not comprise a .alpha.-L-Methyleneoxy
(4'-CH.sub.2--O-2') BNA or a .beta.-D-Methyleneoxy
(4'-CH.sub.2--O-2') BNA.
[0163] a. Certain Nucleobases
[0164] The naturally occurring base portion of a nucleoside is
typically a heterocyclic base. The two most common classes of such
heterocyclic bases are the purines and the pyrimidines. For those
nucleosides that include a pentofuranosyl sugar, a phosphate group
can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. In
forming oligonucleotides, those phosphate groups covalently link
adjacent nucleosides to one another to form a linear polymeric
compound. Within oligonucleotides, the phosphate groups are
commonly referred to as forming the internucleotide backbone of the
oligonucleotide. The naturally occurring linkage or backbone of RNA
and of DNA is a 3' to 5' phosphodiester linkage.
[0165] In addition to "unmodified" or "natural" nucleobases such as
the purine nucleobases adenine (A) and guanine (G), and the
pyrimidine nucleobases thymine (T), cytosine (C) and uracil (U),
many modified nucleobases or nucleobase mimetics known to those
skilled in the art are amenable with the compounds described
herein. In certain embodiments, a modified nucleobase is a
nucleobase that is fairly similar in structure to the parent
nucleobase, such as for example a 7-deaza purine, a 5-methyl
cytosine, or a G-clamp. In certain embodiments, nucleobase mimetic
include more complicated structures, such as for example a
tricyclic phenoxazine nucleobase mimetic. Methods for preparation
of the above noted modified nucleobases are well known to those
skilled in the art.
[0166] b. Certain Sugars
[0167] Oligomeric compounds provided herein may comprise one or
more monomer, including a nucleoside or nucleotide, having a
modified sugar moiety. For example, the furanosyl sugar ring of a
nucleoside can be modified in a number of ways including, but not
limited to, addition of a substituent group, bridging of two
non-geminal ring atoms to form a bicyclic nucleic acid (BNA).
[0168] In certain embodiments, oligomeric compounds comprise one or
more monomers that is a BNA. In certain such embodiments, BNA s
include, but are not limited to, (A) .alpha.-L-Methyleneoxy
(4'-CH.sub.2--O-2') BNA, (B) .beta.-D-Methyleneoxy
(4'-CH.sub.2--O-2') BNA, (C) Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') BNA, (D) Aminooxy
(4'-CH.sub.2--O--N(R)-2') BNA and (E) Oxyamino
(4'-CH.sub.2--N(R)--O-2') BNA, as depicted in FIG. 1.
##STR00001##
[0169] In certain embodiments, BNA compounds include, but are not
limited to, compounds having at least one bridge between the 4' and
the 2' position of the sugar wherein each of the bridges
independently comprises 1 or from 2 to 4 linked groups
independently selected from --[C(R.sub.1)(R.sub.2)].sub.n--,
--C(R.sub.1).dbd.C(R.sub.2)--, --C(R.sub.1).dbd.N--,
--C(.dbd.NR.sub.1)--, --C(.dbd.O)--, --C(.dbd.S)--, --O--,
--Si(R.sub.1).sub.2--, --S(.dbd.O).sub.n-- and --N(R.sub.1)--;
[0170] wherein:
[0171] x is 0, 1, or 2;
[0172] n is 1, 2, 3, or 4;
[0173] each R.sub.1 and R.sub.2 is, independently, H, a protecting
group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle
radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7
alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical,
halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1,
acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
[0174] each J.sub.1 and J.sub.2 is, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group.
[0175] In one embodiment, each of the bridges of the BNA compounds
is, independently, --[C(R.sub.1)(R.sub.2)].sub.n--,
--[C(R.sub.1)(R.sub.2)].sub.n--O--,
--C(R.sub.1R.sub.2)--N(R.sub.1)--O-- or
--C(R.sub.1R.sub.2)--O--N(R.sub.1)--. In another embodiment, each
of said bridges is, independently,
4'-CH.sub.2-2',4'-(CH.sub.2).sub.2-2',4'-(CH.sub.2).sub.3-2',4'-CH.sub.2--
-O-2',4'-(CH.sub.2).sub.2--O-2',4'-CH.sub.2--O--N(R.sub.1)-2' and
4'-CH.sub.2--N(R.sub.1)--O-2'- wherein each R.sub.1 is,
independently, H, a protecting group or C.sub.1-C.sub.12 alkyl.
[0176] Certain BNA's have been prepared and disclosed in the patent
literature as well as in scientific literature (Singh et al., Chem.
Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54,
3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000,
97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8,
2219-2222; WO 94/14226; WO 2005/021570; Singh et al., J. Org.
Chem., 1998, 63, 10035-10039; Examples of issued US patents and
published applications that disclose BNA s include, for example,
U.S. Pat. Nos. 7,053,207; 6,268,490; 6,770,748; 6,794,499;
7,034,133; and 6,525,191; and U.S. Pre-Grant Publication Nos.
2004-0171570; 2004-0219565; 2004-0014959; 2003-0207841;
2004-0143114; and 20030082807.
[0177] Also provided herein are BNAs in which the 2'-hydroxyl group
of the ribosyl sugar ring is linked to the 4' carbon atom of the
sugar ring thereby forming a methyleneoxy (4'-CH.sub.2--O-2')
linkage to form the bicyclic sugar moiety (reviewed in Elayadi et
al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al.,
Chem. Biol., 2001, 8 1-7; and Orum et al., Curr. Opinion Mol.
Ther., 2001, 3, 239-243; see also U.S. Pat. Nos. 6,268,490 and
6,670,461). The linkage can be a methylene (--CH.sub.2--) group
bridging the 2' oxygen atom and the 4' carbon atom, for which the
term methyleneoxy (4'-CH.sub.2--O-2') BNA is used for the bicyclic
moiety; in the case of an ethylene group in this position, the term
ethyleneoxy (4'-CH.sub.2CH.sub.2--O-2') BNA is used (Singh et al.,
Chem. Commun., 1998, 4, 455-456: Morita et al., Bioorganic
Medicinal Chemistry, 2003, 11, 2211-2226). Methyleneoxy
(4'-CH.sub.2--O-2') BNA and other bicyclic sugar analogs display
very high duplex thermal stabilities with complementary DNA and RNA
(Tm=+3 to +10.degree. C.), stability towards 3'-exonucleolytic
degradation and good solubility properties. Potent and nontoxic
antisense oligonucleotides comprising BNAs have been described
(Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97,
5633-5638).
[0178] An isomer of methyleneoxy (4'-CH.sub.2--O-2') BNA that has
also been discussed is alpha-L-methyleneoxy (4'-CH.sub.2--O-2') BNA
which has been shown to have superior stability against a
3'-exonuclease. The alpha-L-methyleneoxy (4'-CH.sub.2--O-2') BNA's
were incorporated into antisense gapmers and chimeras that showed
potent antisense activity (Frieden et al., Nucleic Acids Research,
2003, 21, 6365-6372).
[0179] The synthesis and preparation of the methyleneoxy
(4'-CH.sub.2--O-2') BNA monomers adenine, cytosine, guanine,
5-methyl-cytosine, thymine and uracil, along with their
oligomerization, and nucleic acid recognition properties have been
described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs
and preparation thereof are also described in WO 98/39352 and WO
99/14226.
[0180] Analogs of methyleneoxy (4'-CH.sub.2--O-2') BNA,
phosphorothioate-methyleneoxy (4'-CH.sub.2--O-2') BNA and
2'-thio-BNAs, have also been prepared (Kumar et al., Bioorg. Med.
Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside
analogs comprising oligodeoxyribonucleotide duplexes as substrates
for nucleic acid polymerases has also been described (Wengel et
al., WO 99/14226). Furthermore, synthesis of 2'-amino-BNA, a novel
conformationally restricted high-affinity oligonucleotide analog
has been described in the art (Singh et al., J. Org. Chem., 1998,
63, 10035-10039). In addition, 2'-Amino- and 2'-methylamino-BNA's
have been prepared and the thermal stability of their duplexes with
complementary RNA and DNA strands has been previously reported.
[0181] Modified sugar moieties are well known and can be used to
alter, typically increase, the affinity of the antisense compound
for its target and/or increase nuclease resistance. A
representative list of preferred modified sugars includes but is
not limited to bicyclic modified sugars (BNA's), including
methyleneoxy (4'-CH.sub.2--O-2') BNA and ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2' bridge) BNA; substituted sugars,
especially 2'-substituted sugars having a 2'-F, 2'-OCH.sub.3 or a
2'-O(CH.sub.2).sub.2--OCH.sub.3 substituent group; and 4'-thio
modified sugars. Sugars can also be replaced with sugar mimetic
groups among others. Methods for the preparations of modified
sugars are well known to those skilled in the art. Some
representative patents and publications that teach the preparation
of such modified sugars include, but are not limited to, U.S. Pat.
Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878;
5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427;
5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265;
5,658,873; 5,670,633; 5,792,747; 5,700,920; 6,531,584; and
6,600,032; and WO 2005/121371.
[0182] In certain embodiments, BNA's include bicyclic nucleoside
having the formula:
##STR00002##
wherein:
[0183] Bx is a heterocyclic base moiety;
[0184] T.sub.1 is H or a hydroxyl protecting group;
[0185] T.sub.2 is H, a hydroxyl protecting group or a reactive
phosphorus group;
[0186] Z is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl,
substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6
alkynyl, acyl, substituted acyl, or substituted amide.
[0187] In one embodiment, each of the substituted groups, is,
independently, mono or poly substituted with optionally protected
substituent groups independently selected from halogen, oxo,
hydroxyl, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3,
OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.3J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 and CN, wherein each J.sub.1,
J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl,
and X is O, S or NJ.sub.1.
[0188] In certain such embodiments, each of the substituted groups,
is, independently, mono or poly substituted with substituent groups
independently selected from halogen, oxo, hydroxyl, OJ.sub.1,
NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1, and
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2, wherein each J.sub.1, J.sub.2 and
J.sub.3 is, independently, H, C.sub.1-C.sub.6 alkyl, or substituted
C.sub.1-C.sub.6 alkyl and X is O or NJ.sub.1.
[0189] In certain embodiments, the Z group is C.sub.1-C.sub.6 alkyl
substituted with one or more X.sup.x, wherein each X.sup.x is
independently OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3,
OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 or CN; wherein each J.sub.1,
J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl,
and X is O, S or NJ.sub.1. In another embodiment, the Z group is
C.sub.1-C.sub.6 alkyl substituted with one or more X.sup.x, wherein
each X.sup.x is independently halo (e.g., fluoro), hydroxyl, alkoxy
(e.g., CH.sub.3O--), substituted alkoxy or azido.
[0190] In certain embodiments, the Z group is --CH.sub.2X.sup.x,
wherein X.sup.x is OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3,
OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.3J.sub.2 or CN; wherein each J.sub.3,
J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl,
and X is O, S or NJ.sub.1. In another embodiment, the Z group is
CH.sub.2X.sup.x, wherein X.sup.x is halo (e.g., fluoro), hydroxyl,
alkoxy (e.g., CH.sub.3O--) or azido.
[0191] In certain such embodiments, the Z group is in the
(R)-configuration:
##STR00003##
[0192] In certain such embodiments, the Z group is in the
(S)-configuration:
##STR00004##
[0193] In certain embodiments, each T.sub.1 and T.sub.2 is a
hydroxyl protecting group. A preferred list of hydroxyl protecting
groups includes benzyl, benzoyl, 2,6-dichlorobenzyl,
t-butyldimethylsilyl, t-butyldiphenylsilyl, mesylate, tosylate,
dimethoxytrityl (DMT), 9-phenylxanthine-9-yl (Pixyl) and
9-(p-methoxyphenyl)xanthine-9-yl (MOX). In certain embodiments,
T.sub.1 is a hydroxyl protecting group selected from acetyl,
benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl and
dimethoxytrityl wherein a more preferred hydroxyl protecting group
is T.sub.1 is 4,4'-dimethoxytrityl.
[0194] In certain embodiments, T.sub.2 is a reactive phosphorus
group wherein preferred reactive phosphorus groups include
diisopropylcyanoethoxy phosphoramidite and H-phosphonate. In
certain embodiments T.sub.1 is 4,4'-dimethoxytrityl and T.sub.2 is
diisopropylcyanoethoxy phosphoramidite.
[0195] In certain embodiments, oligomeric compounds have at least
one monomer of the formula:
##STR00005##
or of the formula:
##STR00006##
or of the formula:
##STR00007##
wherein
[0196] Bx is a heterocyclic base moiety;
[0197] T.sub.3 is H, a hydroxyl protecting group, a linked
conjugate group or an internucleoside linking group attached to a
nucleoside, a nucleotide, an oligonucleotide, an oligonucleotide, a
monomeric subunit or an oligomeric compound;
[0198] T.sub.4 is H, a hydroxyl protecting group, a linked
conjugate group or an internucleoside linking group attached to a
nucleoside, a nucleotide, an oligonucleotide, an oligonucleotide, a
monomeric subunit or an oligomeric compound;
[0199] wherein at least one of T.sub.3 and T.sub.4 is an
internucleoside linking group attached to a nucleoside, a
nucleotide, an oligonucleotide, an oligonucleotide, a monomeric
subunit or an oligomeric compound; and
[0200] Z is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl,
substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6
alkynyl, acyl, substituted acyl, or substituted amide.
[0201] In one embodiment, each of the substituted groups, is,
independently, mono or poly substituted with optionally protected
substituent groups independently selected from halogen, oxo,
hydroxyl, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3,
OC(.dbd.X).sub.1-1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 and CN, wherein each J.sub.1,
J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl,
and X is O, S or NJ.sub.1.
[0202] In one embodiment, each of the substituted groups, is,
independently, mono or poly substituted with substituent groups
independently selected from halogen, oxo, hydroxyl, OJ.sub.1,
NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1, and
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2, wherein each J.sub.1, J.sub.2 and
J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl, and X is O
or NJ.sub.1.
[0203] In certain such embodiments, at least one Z is
C.sub.1-C.sub.6 alkyl or substituted C.sub.1-C.sub.6 alkyl. In
certain embodiments, each Z is, independently, C.sub.1-C.sub.6
alkyl or substituted C.sub.1-C.sub.6 alkyl. In certain embodiments,
at least one Z is C.sub.1-C.sub.6 alkyl. In certain embodiments,
each Z is, independently, C.sub.1-C.sub.6 alkyl. In certain
embodiments, at least one Z is methyl. In certain embodiments, each
Z is methyl. In certain embodiments, at least one Z is ethyl. In
certain embodiments, each Z is ethyl. In certain embodiments, at
least one Z is substituted C.sub.1-C.sub.6 alkyl. In certain
embodiments, each Z is, independently, substituted C.sub.1-C.sub.6
alkyl. In certain embodiments, at least one Z is substituted
methyl. In certain embodiments, each Z is substituted methyl. In
certain embodiments, at least one Z is substituted ethyl. In
certain embodiments, each Z is substituted ethyl.
[0204] In certain embodiments, at least one substituent group is
C.sub.1-C.sub.6 alkoxy (e.g., at least one Z is C.sub.1-C.sub.6
alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy). In
another embodiment, each substituent group is, independently,
C.sub.1-C.sub.6 alkoxy (e.g., each Z is, independently,
C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6
alkoxy).
[0205] In certain embodiments, at least one C.sub.1-C.sub.6 alkoxy
substituent group is CH.sub.3O-- (e.g., at least one Z is
CH.sub.3OCH.sub.2--). In another embodiment, each C.sub.1-C.sub.6
alkoxy substituent group is CH.sub.3O-- (e.g., each Z is
CH.sub.3OCH.sub.2--).
[0206] In certain embodiments, at least one substituent group is
halogen (e.g., at least one Z is C.sub.1-C.sub.6 alkyl substituted
with one or more halogen). In certain embodiments, each substituent
group is, independently, halogen (e.g., each Z is, independently,
C.sub.1-C.sub.6 alkyl substituted with one or more halogen). In
certain embodiments, at least one halogen substituent group is
fluoro (e.g., at least one Z is CH.sub.2FCH.sub.2--,
CHF.sub.2CH.sub.2-- or CF.sub.3CH.sub.2--). In certain embodiments,
each halo substituent group is fluoro (e.g., each Z is,
independently, CH.sub.2FCH.sub.2--, CHF.sub.2CH.sub.2-- or
CF.sub.3CH.sub.2--).
[0207] In certain embodiments, at least one substituent group is
hydroxyl (e.g., at least one Z is C.sub.1-C.sub.6 alkyl substituted
with one or more hydroxyl). In certain embodiments, each
substituent group is, independently, hydroxyl (e.g., each Z is,
independently, C.sub.1-C.sub.6 alkyl substituted with one or more
hydroxyl). In certain embodiments, at least one Z is HOCH.sub.2--.
In another embodiment, each Z is HOCH.sub.2--.
[0208] In certain embodiments, at least one Z is CH.sub.3--,
CH.sub.3CH.sub.2--, CH.sub.2OCH.sub.3--, CH.sub.2F-- or
HOCH.sub.2--. In certain embodiments, each Z is, independently,
CH.sub.3--, CH.sub.3CH.sub.2--, CH.sub.2OCH.sub.3--, CH.sub.2F-- or
HOCH.sub.2--.
[0209] In certain embodiments, at least one Z group is
C.sub.1-C.sub.6 alkyl substituted with one or more X.sup.x, wherein
each X.sup.x is, independently, OJ.sub.1, NJ.sub.1J.sub.2,
SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 or CN; wherein each J.sub.1,
J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl,
and X is O, S or NJ.sub.1. In another embodiment, at least one Z
group is C.sub.1-C.sub.6 alkyl substituted with one or more
X.sup.x, wherein each X.sup.x is, independently, halo (e.g.,
fluoro), hydroxyl, alkoxy (e.g., CH.sub.3O--) or azido.
[0210] In certain embodiments, each Z group is, independently,
C.sub.1-C.sub.6 alkyl substituted with one or more X.sup.x, wherein
each X.sup.x is independently OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1,
N.sub.3, OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 or CN; wherein each J.sub.1,
J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl,
and X is O, S or NJ.sub.1. In another embodiment, each Z group is,
independently, C.sub.1-C.sub.6 alkyl substituted with one or more
X.sup.x, wherein each X.sup.x is independently halo (e.g., fluoro),
hydroxyl, alkoxy (e.g., CH.sub.3O--) or azido.
[0211] In certain embodiments, at least one Z group is
--CH.sub.2X.sup.x, wherein X.sup.x is OJ.sub.1, NJ.sub.1J.sub.2,
SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 or CN; wherein each J.sub.1,
J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl,
and X is O, S or NJ.sub.1 In certain embodiments, at least one Z
group is --CH.sub.2X.sup.x, wherein X.sup.x is halo (e.g., fluoro),
hydroxyl, alkoxy (e.g., CH.sub.3O--) or azido.
[0212] In certain embodiments, each Z group is, independently,
--CH.sub.2X.sup.x, wherein each X.sup.x is, independently,
OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1,
OC(.dbd.X)NJ.sub.1J.sub.2, NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 or CN;
wherein each J.sub.1, J.sub.2 and J.sub.3 is, independently, H or
C.sub.1-C.sub.6 alkyl, and X is O, S or NJ.sub.1. In another
embodiment, each Z group is, independently, --CH.sub.2X.sup.x,
wherein each X.sup.x is, independently, halo (e.g., fluoro),
hydroxyl, alkoxy (e.g., CH.sub.3O--) or azido.
[0213] In certain embodiments, at least one Z is CH.sub.3--. In
another embodiment, each Z is, CH.sub.3--.
[0214] In certain embodiments, the Z group of at least one monomer
is in the (R)-configuration represented by the formula:
##STR00008##
or the formula:
##STR00009##
or the formula:
##STR00010##
[0215] In certain embodiments, the Z group of each monomer of the
formula is in the (R)-configuration.
[0216] In certain embodiments, the Z group of at least one monomer
is in the (S)-configuration represented by the formula:
##STR00011##
or the formula:
##STR00012##
or the formula:
##STR00013##
[0217] In certain embodiments, the Z group of each monomer of the
formula is in the (S)-- configuration.
[0218] In certain embodiments, T.sub.3 is H or a hydroxyl
protecting group. In certain embodiments, T.sub.4 is H or a
hydroxyl protecting group. In a further embodiment T.sub.3 is an
internucleoside linking group attached to a nucleoside, a
nucleotide or a monomeric subunit. In certain embodiments, T.sub.4
is an internucleoside linking group attached to a nucleoside, a
nucleotide or a monomeric subunit. In certain embodiments, T.sub.3
is an internucleoside linking group attached to an oligonucleotide
or an oligonucleotide. In certain embodiments, T.sub.4 is an
internucleoside linking group attached to an oligonucleotide or an
oligonucleotide. In certain embodiments, T.sub.3 is an
internucleoside linking group attached to an oligomeric compound.
In certain embodiments, T.sub.4 is an internucleoside linking group
attached to an oligomeric compound. In certain embodiments, at
least one of T.sub.3 and T.sub.4 comprises an internucleoside
linking group selected from phosphodiester or phosphorothioate.
[0219] In certain embodiments, oligomeric compounds have at least
one region of at least two contiguous monomers of the formula:
##STR00014##
or of the formula:
##STR00015##
or of the formula: to
##STR00016##
[0220] In certain embodiments, the oligomeric compound comprises at
least two regions of at least two contiguous monomers of the above
formula. In certain embodiments, the oligomeric compound comprises
a gapped oligomeric compound. In certain embodiments, the
oligomeric compound comprises at least one region of from about 8
to about 14 contiguous .beta.-D-2'-deoxyribofuranosyl nucleosides.
In certain embodiments, the oligomeric compound comprises at least
one region of from about 9 to about 12 contiguous
.beta.-D-2'-deoxyribofuranosyl nucleosides.
[0221] In certain embodiments, monmers include sugar mimetics. In
certain such embodiments, a mimetic is used in place of the sugar
or sugar-internucleoside linkage combination, and the nucleobase is
maintained for hybridization to a selected target. Representative
examples of a sugar mimetics include, but are not limited to,
cyclohexenyl or morpholino. Representative examples of a mimetic
for a sugar-internucleoside linkage combination include, but are
not limited to, peptide nucleic acids (PNA) and morpholino groups
linked by uncharged achiral linkages. In some instances a mimetic
is used in place of the nucleobase. Representative nucleobase
mimetics are well known in the art and include, but are not limited
to, tricyclic phenoxazine analogs and universal bases (Berger et
al., Nuc Acid Res. 2000, 28:2911-14, incorporated herein by
reference). Methods of synthesis of sugar, nucleoside and
nucleobase mimetics are well known to those skilled in the art.
[0222] 3. Monomeric Linkages
[0223] Described herein are linking groups that link monomers
(including, but not limited to, modified and unmodified nucleosides
and nucleotides) together, thereby forming an oligomeric compound.
The two main classes of linking groups are defined by the presence
or absence of a phosphorus atom. Representative phosphorus
containing linkages include, but are not limited to,
phosphodiesters (P.dbd.O), phosphotriesters, methylphosphonates,
phosphoramidate, and phosphorothioates (P.dbd.S). Representative
non-phosphorus containing linking groups include, but are not
limited to, methylenemethylimino
(--CH.sub.2--N(CH.sub.3)--O--CH.sub.2--), thiodiester
(--O--C(O)--S--), thionocarbamate (--O--C(O)(NH)--S--); siloxane
(--O--Si(H).sub.2--O--); and N,N'-dimethylhydrazine
(--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--). Oligomeric compounds
having non-phosphorus linking groups are referred to as
oligonucleosides. Modified linkages, compared to natural
phosphodiester linkages, can be used to alter, typically increase,
nuclease resistance of the oligomeric compound. In certain
embodiments, linkages having a chiral atom can be prepared a
racemic mixtures, as separate enantomers. Representative chiral
linkages include, but are not limited to, alkylphosphonates and
phosphorothioates. Methods of preparation of phosphorous-containing
and non-phosphorous-containing linkages are well known to those
skilled in the art.
[0224] The oligomeric compounds described herein contain one or
more asymmetric centers and thus give rise to enantiomers,
diastereomers, and other stereoisomeric configurations that may be
defined, in terms of absolute stereochemistry, as (R) or (S),
.alpha. or .beta. such as for sugar anomers, or as (D) or (L) such
as for amino acids et al. Included in the antisense compounds
provided herein are all such possible isomers, as well as their
racemic and optically pure forms.
[0225] 4. Oligomeric Compounds
[0226] In certain embodiments, provided herein are oligomeric
compounds having reactive phosphorus groups useful for forming
linkages including for example phosphodiester and phosphorothioate
internucleoside linkages. Methods of preparation and/or
purification of precursors or oligomeric compounds are not a
limitation of the compositions or methods provided herein. Methods
for synthesis and purification of oligomeric compounds including
DNA, RNA, oligonucleotides, oligonucleosides, and antisense
compounds are well known to those skilled in the art.
[0227] Generally, oligomeric compounds comprise a plurality of
monomeric subunits linked together by linking groups. Nonlimiting
examples of oligomeric compounds include primers, probes, antisense
compounds, antisense oligonucleotides, external guide sequence
(EGS) oligonucleotides, alternate splicers, and siRNAs. As such,
these compounds can be introduced in the form of single-stranded,
double-stranded, circular, branched or hairpins and can contain
structural elements such as internal or terminal bulges or loops.
Oligomeric double-stranded compounds can be two strands hybridized
to form double-stranded compounds or a single strand with
sufficient self complementarity to allow for hybridization and
formation of a fully or partially double-stranded compound.
[0228] In certain embodiments, the present invention provides
chimeric oligomeric compounds. In certain such embodiments,
chimeric oligomeric compounds are chimeric oligonucleotides. In
certain such embodiments, the chimeric oligonucleotides comprise
differently modified nucleotides. In certain embodiments, chimeric
oligonucleotides are mixed-backbone antisense oligonucleotides.
[0229] In general a chimeric oligomeric compound will have modified
nucleosides that can be in isolated positions or grouped together
in regions that will define a particular motif. Any combination of
modifications and/or mimetic groups can comprise a chimeric
oligomeric compound as described herein.
[0230] In certain embodiments, chimeric oligomeric compounds
typically comprise at least one region modified so as to confer
increased resistance to nuclease degradation, increased cellular
uptake, and/or increased binding affinity for the target nucleic
acid. In certain embodiments, an additional region of the
oligomeric compound may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is
a cellular endonuclease that cleaves the RNA strand of an RNA:DNA
duplex. Activation of RNase H, therefore, results in cleavage of
the RNA target, thereby greatly enhancing the efficiency of
inhibition of gene expression. Consequently, comparable results can
often be obtained with shorter oligomeric compounds when chimeras
are used, compared to for example phosphorothioate
deoxyoligonucleotides hybridizing to the same target region.
Cleavage of the RNA target can be routinely detected by gel
electrophoresis and, if necessary, associated nucleic acid
hybridization techniques known in the art.
[0231] In certain embodiments, chimeric oligomeric compounds are
gapmers. In certain embodiments, chimeric compounds are short
antisense compounds. In certain embodiments, short antisense
compounds are gapmers. In certain such embodiments, a
mixed-backbone antisense oligomer has one type of internucleotide
linkages in one or both wings and a different type of
internucleotide linkages in the gap. In certain such embodiments,
the mixed-backbone antisense oligonucleotide has phosphodiester
linkages in the wings and phosphorothioate linkages in the gap. In
certain embodiments in which the internucleotide linkages in a wing
is different from the internucleotide linkages in the gap, the
internucleotide linkage bridging that wing and the gap is the same
as the internucleotide linkage in the wing. In certain embodiments
in which the internucleotide linkages in a wing is different from
the internucleotide linkages in the gap, the internucleotide
linkage bridging that wing and the gap is the same as the
internucleotide linkage in the gap.
C. Certain Short Antisense Compounds
[0232] Disclosed herein are short antisense compounds 8 to 16,
preferably 9 to 15, more preferably 9 to 14, more preferably 10 to
14 nucleotides in length. In certain embodiments, short antisense
compounds are 9 to 14 nucleotides in length. In certain
embodiments, short antisense compounds are 10 to 14 nucleotides in
length. In certain embodiments, such short antisense compounds are
short antisense oligonucleotides.
[0233] In certain embodiments, short antisense compounds comprise
one or more chemical modifications. In certain such embodiments,
short antisense compounds comprise at least one modified
nucleotide. In certain embodiments short antisense compounds
comprise at least two or more modified nucleotides. In certain
embodiments, short antisense compounds comprise at least one
modified internucleotide linkage. In certain embodiments, short
antisense compounds are mixed-backbone oligonucleotides. In certain
embodiments, short antisense compounds are chimeric
oligonucleotides. In certain embodiments, short antisense
oligonucleotides are uniformly modified. In certain embodiments,
short antisense oligonucleotides comprise modifications
independently selected at each nucleobase and at each linkage.
[0234] In certain embodiments, short antisense compounds are short
gapmers. In certain such embodiments, short gapmers comprise at
least one high affinity modification in one or more wings of the
compound. In certain embodiments, short antisense compounds
comprise 1 to 3 high-affinity modifications in each wing. In
certain embodiments, high affinity modifications of the short
antisense compounds allow for a target affinity similar to, or even
greater than, the target affinity of longer antisense compounds. In
certain embodiments, the high-affinity modified nucleotides are
sugar modified nucleotides. Such sugar modified nucleotides include
those comprising a bridge between the 4' and 2' position of the
sugar. Exemplary high affinity sugar modifications include, but are
not limited to, BNA s and other 2'-modifications such as 2'-MOE. In
an alternate embodiment of the invention, the high affinity
modification is not a 2'-O--(CH.sub.2).sub.nH (n=1-6)
sugar-modified nucleotide. In an additional alternate embodiment,
the high affinity modified nucleotide is not a 2'-OCH.sub.3 or a
2'-OCH.sub.2CH.sub.2OCH.sub.3 nucleotide. In certain embodiments,
the high-affinity modified nucleotides confer a T.sub.m of at least
1, at least 1.5, at least 2, at least 2.5, at least 3.0, at least
3.5 or at least 4.0 degrees per nucleotide. Some high-affinity
nucleotide modifications are known in the art to increase toxicity.
As shown herein, short antisense compounds having a limited number
(generally 2 to 6) of high affinity modifications exhibit little to
no increase in toxicity but retain or increase affinity for the
target RNA, while also significantly reducing expression of the RNA
target. Short antisense compounds of the invention may optionally
comprise a conjugate group, such as, for example, cholesterol or
C.sub.1-6.
[0235] 1. Certain Wings
[0236] In certain embodiments, the short antisense compounds
comprise a 5' wing and/or a 3' wing. In such embodiments, the
features of the 3' wing and the features of the 5' wing are
selected independently. Thus, in such embodiments, the number of
monomers in the 5' wing and the number of monomers (length) in the
3' wing may be the same or may be different; the modifications, if
any, in the 5' wing may be the same as the modifications, if any,
in the 3' wing or such modifications, if any, may be different; and
the monomeric linkages in the 5' wing and the monomeric linkages in
the 3' wing may be the same or they may be different.
[0237] In certain embodiments a wing comprises one, two or three
monomers (i.e. has a length of 1, 2, or 3). In certain embodiments,
the monomers of a wing are modified. In certain such embodiments,
the monomers of the wing are modified to increase affinity of the
antisense compound for its target nucleic acid. In certain
embodiments, the monomers of a wing are nucleosides or nucleotides.
In certain such embodiments, the nucleosides or nucleotides of the
wing comprise a 2' modification. In certain such embodiments, the
monomers (nucleosides or nucleotides) of the wing are BNA's. In
certain such embodiments, the monomers of the wing are selected
from .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2') BNA,
.beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA, Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') BNA, Aminooxy (4'-CH.sub.2--O--N(R)-2')
BNA and Oxyamino (4'-CH.sub.2--N(R)--O-2') BNA. In certain
embodiments, the monomers of a wing comprise a substituent at the
2' position selected from allyl, amino, azido, thio, O-allyl,
O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), and
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. In certain embodiments, the monomers of a
wing are 2'MOE nucleotides.
[0238] In certain embodiments, the monomeric linkages in a wing are
naturally occurring internucleotide linkages. In certain
embodiments, the monomeric linkages in a wing are non-naturally
occurring internucleotide or internucleoside linkages. In certain
such embodiments, the monomeric linkages in the wing are more
resistant to one or more nucleases than naturally occurring
internucleotide linkages. In certain such embodiments, the
monomeric linkages in the wing are phosphorothioate linkages
(P.dbd.S). In certain embodiments where a wing has more than one
monomeric linkage, the monomeric linkages are the same as one
another. In certain embodiments where a wing has more than one
monomers linkage, the monomers linkages are different from each
other.
[0239] One of ordinary skill in the art will recognize that the
features and modifications discussed above may be used in any
combination to prepare a wing. The table below provides
non-limiting examples showing how one might prepare a wing by
selecting a certain number of monomers, monomeric modifications (if
any), and monomeric linkages both within the wing.
TABLE-US-00001 Monomer type/ monomeric linkages Length
modifications within wing 1 2' MOE None 1 BNA None 1 Methyleneoxy
None BNA 1 ENA None 2 2' MOE P.dbd.S 2 BNA P.dbd.S 2 Methyleneoxy
P.dbd.S BNA 2 ENA P.dbd.S 2 2' MOE P.dbd.O 2 BNA P.dbd.O 2
Methyleneoxy P.dbd.O BNA 2 ENA P.dbd.O 3 2' MOE P.dbd.S 3 BNA
P.dbd.S 3 Methyleneoxy P.dbd.S BNA 3 ENA P.dbd.S 3 2' MOE P.dbd.O 3
BNA P.dbd.O 3 Methyleneoxy P.dbd.O BNA 3 ENA P.dbd.O
[0240] In certain embodiments in which a wing comprises two, three
or four monomers, those two, three or four monomers all comprise
the same modifications, if any. In certain embodiments in which a
wing comprises two, three or four monomers, one or more of those
two, three or four nucleobases comprises one or more modifications
that is different from one or more of the modifications of one or
more of the remaining monomers.
[0241] 2. Certain Gaps
[0242] In certain embodiments, the short antisense compounds
comprise a gap between the 5' wing and the 3' wing. In certain
embodiments the gap comprises five, six, seven, eight, nine, ten,
eleven, twelve, thirteen, or fourteen monomers. In certain
embodiments, the monomers of the gap are unmodified
deoxyribonucleotides. In certain embodiments, the monomers of the
gap are unmodified ribonucleotides. In certain embodiments, gap
modifications (if any) gap result in an antisense compound that,
when bound to its target nucleic acid, supports cleavage by an
RNase, including, but not limited to, RNase H.
[0243] In certain embodiments, the monomeric linkages in the gap
are naturally occurring internucleotide linkages. In certain
embodiments, the monomeric linkages in the gap are non-naturally
occurring linkages. In certain such embodiments, the monomeric
linkages in the gap are more resistant to one or more nuclease than
naturally occurring internucleotide linkages. In certain such
embodiments, the monomeric linkages in the gap are phosphorothioate
linkages (P.dbd.S). In certain embodiments, the monomeric linkages
in the gap are all the same as one another. In certain embodiments,
the monomeric linkages within the gap are not all the same.
[0244] One of ordinary skill in the art will recognize that the
features and modifications discussed above may be used in any
combination to prepare a gap. The table below provides non-limiting
examples showing how one might prepare a gap by selecting a certain
number of monomers, monomeric modifications (if any), and monomeric
linkages within the gap region.
TABLE-US-00002 Monomer type/ Monomeric linkages Length
modifications within gap 5 DNA P.dbd.S 6 DNA P.dbd.S 7 DNA P.dbd.S
8 DNA P.dbd.S 9 DNA P.dbd.S 10 DNA P.dbd.S 11 DNA P.dbd.S 12 DNA
P.dbd.S 13 DNA P.dbd.S 14 DNA P.dbd.S 6 DNA P.dbd.O 7 DNA P.dbd.O 8
DNA P.dbd.O 9 DNA P.dbd.O 10 DNA P.dbd.O 11 DNA P.dbd.O 12 DNA
P.dbd.O 8 RNA P.dbd.S 9 RNA P.dbd.S 10 RNA P.dbd.S 11 RNA P.dbd.S
12 RNA P.dbd.S
[0245] 3. Certain Gapped Antisense Oligomeric Compounds
[0246] One of ordinary skill in the art will recognize that the
wings and the gaps discussed above may be selected and then
combined in a variety of combinations to generate gapped oligomeric
compounds, including, but not limited to, gapped antisense
oligomeric compounds, and gapped antisense oligonucleotides. The
features (length, modifications, linkages) of the 5' wing and the
3' wing may be selected independently of one another. The features
of the gap include at least one difference in modification compared
to the features of the 5' wing and at least one difference compared
to the features of the 3' wing (i.e., there must be at least one
difference in modification between neighboring regions to
distinguish those neighboring regions from one another). The
features of the gap may otherwise be selected independently.
[0247] In certain embodiments, the monomeric linkages within a wing
and the monomeric linkages within the gap are the same. In certain
embodiments, the monomeric linkages within a wing and the monomeric
linkages within the gap are different. In certain such embodiments,
the monomeric linkage bridging the wing and the gap are the same as
the monomeric linkages in the wing. In certain embodiments, the
monomeric linkage bridging the wing and the gap are the same as the
monomeric linkages in the gap. In certain embodiments, short
antisense compounds have uniform linkages throughout the compound.
In certain such embodiments, all of the linkages are
phosphorothioate (P.dbd.S) linkages.
[0248] One of ordinary skill in the art will recognize that the 3'
wings, 5' wings, gaps, and linkages discussed above may be used in
any combination to prepare a gapmer. The table below provides
non-limiting examples showing how one might prepare a gapmer by
selecting a certain 5' wing, a gap, a 3' wing and certain linkages
bridging the gap and each wing.
TABLE-US-00003 5' 3' 5' Wing Bridge Gap Bridge 3' Wing Length
Monomer Link Link Length Monomer Link Link Length Monomer Link 2
MOE P.dbd.S P.dbd.S 6 DNA P.dbd.S P.dbd.S 2 MOE P.dbd.S 2 BNA
P.dbd.S P.dbd.O 8 DNA P.dbd.O P.dbd.S 3 BNA P.dbd.S 1 MOE None
P.dbd.S 10 DNA P.dbd.S P.dbd.S 1 MOE P.dbd.S 2 MOE P.dbd.S P.dbd.S
8 RNA P.dbd.S P.dbd.S 2 MOE P.dbd.S 3 Methyleneoxy P.dbd.S P.dbd.S
8 RNA P.dbd.S P.dbd.S 3 MOE P.dbd.S BNA 3 DNA P.dbd.O P.dbd.O 10
RNA P.dbd.S P.dbd.O 3 2'OH P.dbd.O 2 2-F P.dbd.S P.dbd.S 5 RNA
P.dbd.S P.dbd.S 2 2'-F P.dbd.S 1 MOE P.dbd.O P.dbd.S 5 DNA P.dbd.O
P.dbd.S 4 MOE P.dbd.S
[0249] In certain embodiments, the oligomeric compounds disclosed
herein may comprise from about 8 to about 16, preferably 9 to 15,
more preferably 9 to 14, more preferably 10 to 14 monomers (i.e.
from about 8 to about 16 linked monomers). One of ordinary skill in
the art will appreciate that this comprehends antisense compounds
of 8, 9, 10, 11, 12, 13, 14, 15 or 16 nucleobases. In certain
embodiments, oligomeric compounds are antisense compounds.
[0250] In certain embodiments, short antisense compounds are 8
nucleobases in length.
[0251] In certain embodiments, short antisense compounds are 9
nucleobases in length.
[0252] In certain embodiments, short antisense compounds are 10
nucleobases in length.
[0253] In certain embodiments, short antisense compounds are 11
nucleobases in length.
[0254] In certain embodiments, short antisense compounds are 12
nucleobases in length.
[0255] In certain embodiments, short antisense compounds are 13
nucleobases in length.
[0256] In certain embodiments, short antisense compounds are 14
nucleobases in length.
[0257] In certain embodiments, short antisense compounds are 15
nucleobases in length.
[0258] In certain embodiments, short antisense compounds are 16
nucleobases in length.
[0259] In certain embodiments, short antisense compounds are 8
monomers in length. In certain embodiments, short antisense
compounds are 9 monomers in length. In certain embodiments, short
antisense compounds are 10 monomers in length. In certain
embodiments, short antisense compounds are 11 monomers in length.
In certain embodiments, short antisense compounds are monomers in
length. In certain embodiments, short antisense compounds are 13
monomers in length. In certain embodiments, short antisense
compounds are 14 monomers in length. In certain embodiments, short
antisense compounds are 15 monomers in length. In certain
embodiments, short antisense compounds are 16 monomers in length.
In certain embodiments, short antisense compounds comprise 9 to 15
monomers. In certain embodiments, short antisense compounds
comprise 10 to 15 monomers. In certain embodiments, short antisense
compounds comprise 12 to 14 monomers. In certain embodiments, short
antisense compounds comprise 12 to 14 nucleotides or
nucleosides.
[0260] One having skill in the art and informed by the short
antisense compounds illustrated herein will be able, without undue
experimentation, to identify further short antisense compounds.
[0261] In certain embodiments, short antisense compounds comprise a
gap flanked by more than one wing on either or both sides. Thus, in
certain embodiments, a short antisense compound comprises two or
more 5' wings and two or more 3' wings. In certain embodiments, a
short antisense compound comprises one 5' wing and two or more 3'
wings. In certain embodiments, a short antisense compound comprises
one 3' wing and two or more 5' wings. Certain such embodiments
comprise, for example, the following regions: a first 5' wing--a
bridge--a second 5' wing--a bridge--a gap--a bridge--a second 3'
wing--a bridge--a first 3'wing. In such embodiments, each region
has at least one difference in modification when compared to its
neighboring region. Thus, in such embodiments, the second 5' wing
and the second 3' wing each independently comprises one or more
differences in modification compared to the gap and compared to the
first 5' wing and the first 3' wing. In such embodiments, the
modifications of the first 3' wing and first 5' wing may either or
both be the same or different from the modifications of the gap, if
any.
[0262] 4. Certain Conjugate Groups
[0263] In one aspect, oligomeric compounds are modified by covalent
attachment of one or more conjugate groups. In general, conjugate
groups modify one or more properties of the attached oligomeric
compound including but not limited to pharmacodynamic,
pharmacokinetic, binding, absorption, cellular distribution,
cellular uptake, charge and clearance. Conjugate groups are
routinely used in the chemical arts and are linked directly or via
an optional linking moiety or linking group to a parent compound
such as an oligomeric compound. A preferred list of conjugate
groups includes without limitation, intercalators, reporter
molecules, polyamines, polyamides, polyethylene glycols,
thioethers, polyethers, cholesterols, thiocholesterols, cholic acid
moieties, folate, lipids, phospholipids, biotin, phenazine,
phenanthridine, anthraquinone, adamantane, acridine, fluoresceins,
rhodamines, coumarins and dyes.
[0264] Preferred conjugate groups amenable to the present invention
include lipid moieties such as a cholesterol moiety (Letsinger et
al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553); cholic acid
(Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053); a
thioether, e.g., hexyl-5-tritylthiol (Manoharan et al., Ann. N.Y.
Acad. Sci., 1992, 660, 306; Manoharan et al., Bioorg. Med. Chem.
Let., 1993, 3, 2765); a thiocholesterol (Oberhauser et al., Nucl.
Acids Res, 1992, 20, 533); an aliphatic chain, e.g., dodecandiol or
undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 111;
Kabanov et al., FEBS Lett., 1990, 259, 327; Svinarchuk et al.,
Biochimie, 1993, 75, 49); a phospholipid, e.g.,
di-hexadecyl-rac-glycerol or
triethyl-ammonium-1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651; Shea et al.,
Nucl. Acids Res., 1990, 18, 3777); a polyamine or a polyethylene
glycol chain (Manoharan et al., Nucleosides & Nucleotides,
1995, 14, 969); adamantane acetic acid (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651); a palmityl moiety (Mishra et
al., Biochim. Biophys. Acta, 1995, 1264, 229); or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923).
[0265] Linking groups or bifunctional linking moieties such as
those known in the art are amenable to the compounds provided
herein. Linking groups are useful for attachment of chemical
functional groups, conjugate groups, reporter groups and other
groups to selective sites in a parent compound such as for example
an oligomeric compound. In general a bifunctional linking moiety
comprises a hydrocarbyl moiety having two functional groups. One of
the functional groups is selected to bind to a parent molecule or
compound of interest and the other is selected to bind essentially
any selected group such as chemical functional group or a conjugate
group. In some embodiments, the linker comprises a chain structure
or an oligomer of repeating units such as ethylene glycol or amino
acid units. Examples of functional groups that are routinely used
in a bifunctional linking moiety include, but are not limited to,
electrophiles for reacting with nucleophilic groups and
nucleophiles for reacting with electrophilic groups. In some
embodiments, bifunctional linking moieties include amino, hydroxyl,
carboxylic acid, thiol, unsaturations (e.g., double or triple
bonds), and the like. Some nonlimiting examples of bifunctional
linking moieties include 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC)
and 6-aminohexanoic acid (AHEX or AHA). Other linking groups
include, but are not limited to, substituted C.sub.1-C.sub.10
alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or
substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a
nonlimiting list of preferred substituent groups includes hydroxyl,
amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy,
halogen, alkyl, aryl, alkenyl and alkynyl.
[0266] 5. Synthesis Purification and Analysis
[0267] Oligomerization of modified and unmodified nucleosides and
nucleotides can be routinely performed according to literature
procedures for DNA (Protocols for Oligonucleotides and Analogs, Ed.
Agrawal (1993), Humana Press) and/or RNA (Scaringe, Methods (2001),
23, 206-217. Gait et al., Applications of Chemically synthesized
RNA in RNA: Protein Interactions, Ed. Smith (1998), 1-36. Gallo et
al., Tetrahedron (2001), 57, 5707-5713).
[0268] Oligomeric compounds provided herein can be conveniently and
routinely made through the well-known technique of solid phase
synthesis. Equipment for such synthesis is sold by several vendors
including, for example, Applied Biosystems (Foster City, Calif.).
Any other means for such synthesis known in the art may
additionally or alternatively be employed. It is well known to use
similar techniques to prepare oligonucleotides such as the
phosphorothioates and alkylated derivatives. The invention is not
limited by the method of antisense compound synthesis.
[0269] Methods of purification and analysis of oligomeric compounds
are known to those skilled in the art. Analysis methods include
capillary electrophoresis (CE) and electrospray-mass spectroscopy.
Such synthesis and analysis methods can be performed in multi-well
plates. The method of the invention is not limited by the method of
oligomer purification.
D. Antisense
[0270] Antisense mechanisms are all those involving the
hybridization of a compound with target nucleic acid, wherein the
outcome or effect of the hybridization is either target degradation
or target occupancy with concomitant stalling of the cellular
machinery involving, for example, transcription or splicing.
[0271] One type of antisense mechanism involving target degradation
includes an RNase H. RNase H is a cellular endonuclease which
cleaves the RNA strand of an RNA:DNA duplex. It is known in the art
that single-stranded antisense compounds which are "DNA-like"
elicit RNAse H activity in mammalian cells. Activation of RNase H,
therefore, results in cleavage of the RNA target, thereby greatly
enhancing the efficiency of DNA-like oligonucleotide-mediated
inhibition of gene expression.
[0272] In certain embodiments, chemically-modified antisense
compounds have a higher affinity for target RNAs than does
non-modified DNA. In certain such embodiments, that higher affinity
in turn provides increased potency allowing for the administration
of lower doses of such compounds, reduced potential for toxicity
and improvement in therapeutic index and decreased overall cost of
therapy.
[0273] The present disclosure demonstrates that the incorporation
of chemically-modified high-affinity nucleotides and nucleosides
into antisense compounds allows for the design of short antisense
compounds 8-16 nucleobases in length useful for the reduction of
target RNAs and/or target proteins in cells, tissues, and animals,
including, but not limited to, humans with increased potency and
improved therapeutic index. Thus, in certain embodiments, provided
herein are short antisense compounds comprising high-affinity
nucleotide modifications useful for reducing a target RNA in vivo.
Certain such short antisense compounds are effective at lower doses
than previously described antisense compounds, allowing for a
reduction in toxicity and cost of treatment. In addition, certain
short antisense compounds have greater potential for oral
dosing.
[0274] To address the need for more potent antisense compounds,
provided herein are short antisense compounds (8-16, preferably 9
to 15, more preferably 9 to 14, more preferably 10 to 14
nucleotides in length) with increased activity in vivo relative to
longer compounds. Certain short antisense compounds are gapmer
compounds comprising high-affinity chemically-modified nucleotides
on the 3' and 5' ends (wings) of the compound. In certain
embodiments, the addition of high-affinity modified nucleotides
allows antisense compounds to be active against, and specific for,
their intended target RNA in vivo despite being shorter in length.
Contemplated herein are short antisense compounds wherein each of
the wings independently comprises 1 to 3 high-affinity modified
nucleotides. In certain embodiments, the high-affinity
modifications are sugar modifications. High-affinity modified
nucleotides include, but are not limited to, BNA s or other
2'-modified nucleotides, such as 2'-MOE nucleotides. Also
contemplated are short antisense compounds having at least one
modified internucleotide linkage, such as a phosphorothioate
internucleotide linkage. In certain embodiments, the short
antisense compounds of the present invention can have all
phosphorothioate internucleoside linkages. The short antisense
compounds optionally comprise a conjugate group. As shown herein,
short antisense compounds have greater affinity for target RNA than
they have for DNA and are significantly more potent in vivo as
shown by reduction of target mRNA as well as by amelioration of a
variety of disease indications.
[0275] As used herein, an RNA which is involved in regulating
glucose metabolism or clearance, lipid metabolism, cholesterol
metabolism or insulin metabolism is any RNA involved in the
biochemical pathways that regulate these processes. Such RNAs are
well known in the art. Examples of target genes include, but are
not limited to, ApoB-100 (also known as APOB; Ag(x) antigen;
apoB-48; apolipoprotein B; apolipoprotein B-100; apolipoprotein
B48) and GCGR (also known as glucagon receptor; GR), CRP, DGAT2,
GCCR, PCSK9, PTEN, PTP1B, SGLT2, and SOD1.
[0276] 1. Modulation of Target Expression
[0277] In certain embodiments, a target is identified and antisense
oligonucleotides are designed to modulate that target or its
expression. In certain embodiments, designing an oligomeric
compound to a target nucleic acid molecule can be a multistep
process. Typically the process begins with the identification of a
target protein, the activity of which is to be modulated, and then
identifying the nucleic acid the expression of which yields the
target protein. In certain embodiments, designing of an antisense
compound results in an antisense compound that is hybridizable to
the targeted nucleic acid molecule. In certain embodiments, the
antisense compound is an antisense oligonucleotide or antisense
oligonucleoside. In certain embodiments, an antisense compound and
a target nucleic acid are complementary to one another. In certain
such embodiments, an antisense compound is perfectly complementary
to a target nucleic acid. In certain embodiments, an antisense
compound includes one mismatch. In certain embodiments, an
antisense compound includes two mismatches. In certain embodiments,
an antisense compound includes three or more mismatches.
[0278] Modulation of expression of a target nucleic acid can be
achieved through alteration of any number of nucleic acid
functions. In certain embodiments, the functions of RNA to be
modulated include, but are not limited to, translocation functions,
which include, but are not limited to, translocation of the RNA to
a site of protein translation, translocation of the RNA to sites
within the cell which are distant from the site of RNA synthesis,
and translation of protein from the RNA. RNA processing functions
that can be modulated include, but are not limited to, splicing of
the RNA to yield one or more RNA species, capping of the RNA, 3'
maturation of the RNA and catalytic activity or complex formation
involving the RNA which may be engaged in or facilitated by the
RNA. Modulation of expression can result in the increased level of
one or more nucleic acid species or the decreased level of one or
more nucleic acid species, either temporally or by net steady state
level. Thus, in one embodiment modulation of expression can mean
increase or decrease in target RNA or protein levels. In another
embodiment modulation of expression can mean an increase or
decrease of one or more RNA splice products, or a change in the
ratio of two or more splice products.
[0279] In certain embodiments, expression of a target gene is
modulated using an oligomeric compound comprising from about 8 to
about 16, preferably 9 to 15, more preferably 9 to 14, more
preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked
monomers). One of ordinary skill in the art will appreciate that
this comprehends methods of modulating expression of a target gene
using one or more antisense compounds of 8, 9, 10, 11, 12, 13, 14,
15 or 16 nucleobases.
[0280] In certain embodiments, methods of modulating a target gene
comprises use of a short antisense compound that is 8 nucleobases
in length. In certain embodiments, methods of modulating a target
gene comprises use of a short antisense compound that is 9
nucleobases in length. In certain embodiments, methods of
modulating a target gene comprises use of a short antisense
compound that is 8 nucleobases in length. In certain embodiments,
methods of modulating a target gene comprises use of a short
antisense compound that is 10 nucleobases in length. In certain
embodiments, methods of modulating a target gene comprises use of a
short antisense compound that is 10 nucleobases in length. In
certain embodiments, methods of modulating a target gene comprises
use of a short antisense compound that is 11 nucleobases in length.
In certain embodiments, methods of modulating a target gene
comprises use of a short antisense compound that is 12 nucleobases
in length. In certain embodiments, methods of modulating a target
gene comprises use of a short antisense compound that is 13
nucleobases in length. In certain embodiments, methods of
modulating a target gene comprises use of a short antisense
compound that is 14 nucleobases in length. In certain embodiments,
methods of modulating a target gene comprises use of a short
antisense compound that is 15 nucleobases in length. In certain
embodiments, methods of modulating a target gene comprises use of a
short antisense compound that is 16 nucleobases in length.
[0281] In certain embodiments, methods of modulating expression of
a target gene comprises use of a short antisense compound
comprising 9 to 15 monomers. In certain embodiments, methods of
modulating expression of a target gene comprises use of a short
antisense compound comprising 10 to 15 monomers. In certain
embodiments, methods of modulating expression of a target gene
comprises use of a short antisense compound comprising 12 to 14
monomers. In certain embodiments, methods of modulating expression
of a target gene comprises use of a short antisense compound
comprising 12 or 14 nucleotides or nucleosides.
[0282] 2. Hybridization
[0283] In certain embodiments, antisense compounds specifically
hybridize when there is a sufficient degree of complementarity to
avoid non-specific binding of the antisense compound to non-target
nucleic acid sequences under conditions in which specific binding
is desired, i.e., under physiological conditions in the case of in
vivo assays or therapeutic treatment, and under conditions in which
assays are performed in the case of in vitro assays.
[0284] As used herein, "stringent hybridization conditions" or
"stringent conditions" refers to conditions under which an
antisense compound will hybridize to its target sequence, but to a
minimal number of other sequences. Stringent conditions are
sequence-dependent and will be different in different
circumstances, and "stringent conditions" under which antisense
compounds hybridize to a target sequence are determined by the
nature and composition of the antisense compounds and the assays in
which they are being investigated.
[0285] 3. Complementarity
[0286] It is understood in the art that incorporation of nucleotide
affinity modifications may allow for a greater number of mismatches
compared to an unmodified compound. Similarly, certain
oligonucleotide sequences may be more tolerant to mismatches than
other oligonucleotide sequences. One of ordinary skill in the art
is capable of determining an appropriate number of mismatches
between oligonucleotides, or between an oligonucleotide and a
target nucleic acid, such as by determining melting temperature
(T.sub.m). T.sub.m or T.sub.m can be calculated by techniques that
are familiar to one of ordinary skill in the art. For example,
techniques described in Freier et al. (Nucleic Acids Research,
1997, 25, 22: 4429-4443) allow one of ordinary skill in the art to
evaluate nucleotide modifications for their ability to increase the
melting temperature of an RNA:DNA duplex.
[0287] 4. Identity
[0288] Antisense compounds, or a portion thereof, may have a
defined percent identity to a SEQ ID NO, or a compound having a
specific Isis number. As used herein, a sequence is identical to
the sequence disclosed herein if it has the same nucleobase pairing
ability. For example, an RNA which contains uracil in place of
thymidine in the disclosed sequences of the compounds described
herein would be considered identical as they both pair with
adenine. This identity may be over the entire length of the
oligomeric compound, or in a portion of the antisense compound
(e.g., nucleobases 1-20 of a 27-mer may be compared to a 20-mer to
determine percent identity of the oligomeric compound to the SEQ ID
NO. It is understood by those skilled in the art that an antisense
compound need not have an identical sequence to those described
herein to function similarly to the antisense compound described
herein. Shortened versions of antisense compounds taught herein, or
non-identical versions of the antisense compounds taught herein,
are also provided herein. Non-identical versions are those wherein
each base does not have the same pairing activity as the antisense
compounds disclosed herein. Bases do not have the same pairing
activity by being shorter or having at least one abasic site.
Alternatively, a non-identical version can include at least one
base replaced with a different base with different pairing activity
(e.g., G can be replaced by C, A, or T). Percent identity is
calculated according to the number of bases that have identical
base pairing corresponding to the SEQ ID NO or antisense compound
to which it is being compared. The non-identical bases may be
adjacent to each other, dispersed through out the oligonucleotide,
or both.
[0289] For example, a 16-mer having the same sequence as
nucleobases 2-17 of a 20-mer is 80% identical to the 20-mer.
Alternatively, a 20-mer containing four nucleobases not identical
to the 20-mer is also 80% identical to the 20-mer. A 14-mer having
the same sequence as nucleobases 1-14 of an 18-mer is 78% identical
to the 18-mer. Such calculations are well within the ability of
those skilled in the art.
[0290] The percent identity is based on the percent of nucleobases
in the original sequence present in a portion of the modified
sequence. Therefore, a 30 nucleobase antisense compound comprising
the full sequence of the complement of a 20 nucleobase active
target segment would have a portion of 100% identity with the
complement of the 20 nucleobase active target segment, while
further comprising an additional 10 nucleobase portion. In the
context of the instant description, the complement of an active
target segment may constitute a single portion. In preferred
embodiments, the oligonucleotides provided herein are at least 80%,
at least 85%, at least 90%, at least 95%, at least 96%, at least
97%, at least 98%, at least 99% or 100% identical to at least a
portion of the complement of the active target segments presented
herein.
E. Target Nucleic Acids, Regions and Segments
[0291] In certain embodiments, short antisense compounds may be
designed to target any target nucleic acid. In certain embodiments,
the target nucleic acid encodes a target that is clinically
relevant. In such embodiments, modulation of the target nucleic
acid results in clinical benefit. Certain target nucleic acids
include, but are not limited to, the target nucleic acids
illustrated in Table 1.
[0292] In certain embodiments, a target nucleic acid is a nucleic
acid molecule encoding ApoB. Nucleic acid molecules that encode
ApoB include, without limitation, SEQ ID NO: 1 and SEQ ID NO:
2.
[0293] In certain embodiments, a target nucleic acid is a nucleic
acid molecule encoding SGLT2. Nucleic acid molecules that encode
SGLT2 include, without limitation, SEQ ID NO: 3.
[0294] In certain embodiments, a target nucleic acid is a nucleic
acid molecule encoding PCSK9. Nucleic acid molecules that encode
PCSK9 include, without limitation, SEQ ID NO: 4.
[0295] In certain embodiments, a target nucleic acid is a nucleic
acid molecule encoding SOD1. Nucleic acid molecules that encode
SOD1 include, without limitation, SEQ ID NO: 5.
[0296] In certain embodiments, a target nucleic acid is a nucleic
acid molecule encoding CRP. Nucleic acid molecules that encode CRP
include, without limitation, SEQ ID NO: 6.
[0297] In certain embodiments, a target nucleic acid is a nucleic
acid molecule encoding GCCR. Nucleic acid molecules that encode
GCCR include, without limitation, SEQ ID NO: 7 and SEQ ID NO:
8.
[0298] In certain embodiments, a target nucleic acid is a nucleic
acid molecule encoding GCGR. Nucleic acid molecules that encode
GCGR include, without limitation, SEQ ID NO: 9.
[0299] In certain embodiments, a target nucleic acid is a nucleic
acid molecule encoding DGAT2. Nucleic acid molecules that encode
DGAT2 include, without limitation, SEQ ID NO: 10.
[0300] In certain embodiments, a target nucleic acid is a nucleic
acid molecule encoding PTP1B. Nucleic acid molecules that encode
PTP1B include, without limitation, SEQ ID NO: 11 and SEQ ID NO:
12.
[0301] In certain embodiments, a target nucleic acid is a nucleic
acid molecule encoding PTEN. Nucleic acid molecules that encode
PTEN include, without limitation, SEQ ID NO: 14 or SEQ ID NO:
15.
TABLE-US-00004 TABLE 1 Certain Target Nucleic Acids SEQ ID Target
Species GENBANK .RTM. Accession Number NO ApoB Human NM_000384.1 1
ApoB Mouse XM_137955.5 2 SGLT2 Human NM_003041.1 3 PCSK9 Human
NM_174936.2 4 SOD1 Human X02317.1 5 CRP Human NM_000567.1 6 GCCR
Mouse BC031885.1 7 GCCR Human Nucleotides 1 to 10600 of AC012634 8
GCGR Human NM_000160.1 9 DGAT2 Human NM_032564.2 10 PTP1B Human
NM_002827.2 11 PTP1B Human Nucleotides 1417800 to 1425600 of 12
NT_011362.9 PTEN Mouse U92437.1 13 PTEN Human NM_000314.4 14 PTEN
Human Nucleotides 8063255 to 8167140 of 15 NT_033890.3
[0302] The targeting process usually includes determination of at
least one target region, segment, or site within the target nucleic
acid for the antisense interaction to occur such that the desired
effect will result.
[0303] In certain embodiments, the 5'-most nucleotide of a target
region is the 5' target site of a short antisense compound and the
3'-most nucleotide of a target region is the 3' target site of the
same short antisense compound. In certain embodiments, the 5'-most
nucleotide of a target region is the 5' target site of a short
antisense compound and the 3'-most nucleotide of a target region is
the 3' target site of a different short antisense compound. In
certain embodiments, a target region comprises a nucleotide
sequence within 10, 15, or 20 nucleotides of a 5' target site or a
3' target site.
[0304] In certain embodiments, a target region is a structurally
defined region of the nucleic acid. For example, in certain such
embodiments, a target region may encompass a 3' UTR, a 5' UTR, an
exon, an intron, a coding region, a translation initiation region,
translation termination region, or other defined nucleic acid
region.
[0305] The locations on the target nucleic acid defined by having
one or more active short antisense compounds targeted thereto are
referred to as "active target segments." In certain embodiments,
the target nucleic acid having one or more active short antisense
compounds targeted thereto is a target RNA. When an active target
segment is defined by multiple short antisense compounds, the
compounds are preferably separated by no more than about 10
nucleotides on the target sequence, more preferably no more than
about 5 nucleotides on the target sequence, even more preferably
the short antisense compounds are contiguous, most preferably the
short antisense compounds are overlapping. There may be substantial
variation in activity (e.g., as defined by percent inhibition) of
the short antisense compounds within an active target segment.
Active short antisense compounds are those that modulate the
expression of their target nucleic acid, including but not limited
to a target RNA. Active short antisense compounds inhibit
expression of their target RNA at least 10%, preferably 20%. In a
preferred embodiment, at least about 50%, preferably about 70% of
the short antisense compounds targeted to the active target segment
modulate expression of their target RNA at least 40%. In a more
preferred embodiment, the level of inhibition required to define an
active short antisense compound is defined based on the results
from the screen used to define the active target segments.
[0306] A suitable target segment is at least about an 8-nucleobase
portion of a target region to which an active short antisense
compound is targeted. Target segments can include DNA or RNA
sequences that comprise at least the 8 consecutive nucleobases from
the 5'-terminus of one of the illustrative target segments (the
remaining nucleobases being a consecutive stretch of the same DNA
or RNA beginning immediately upstream of the 5'-terminus of the
target segment and continuing until the DNA or RNA comprises about
8 to about 16 nucleobases). Target segments are also represented by
DNA or RNA sequences that comprise at least the 8 consecutive
nucleobases from the 3'-terminus of one of the illustrative target
segments (the remaining nucleobases being a consecutive stretch of
the same DNA or RNA beginning immediately downstream of the
3'-terminus of the target segment and continuing until the DNA or
RNA comprises about 8 to about 16 nucleobases). It is also
understood that antisense target segments may be represented by DNA
or RNA sequences that comprise at least 8 consecutive nucleobases
from an internal portion of the sequence of an illustrative target
segment, and may extend in either or both directions until the
short antisense compound comprises about 8 to about 16 nucleobases.
One having skill in the art armed with the target segments
illustrated herein will be able, without undue experimentation, to
identify further target segments.
[0307] Once one or more target regions, segments or sites have been
identified, short antisense compounds are chosen which are
sufficiently complementary to the target, i.e., hybridize
sufficiently well and with sufficient specificity, to give the
desired effect.
[0308] The short antisense compounds may also be targeted to
regions of the target nucleobase sequence comprising any
consecutive nucleobases 8 to 16 nucleobases in length along the
target nucleic acid molecule.
[0309] Target segments 8-16 nucleobases in length comprising a
stretch of at least eight (8) consecutive nucleobases selected from
within the illustrative target segments are considered to be
suitable for targeting as well. Thus, the short antisense compounds
may also encompass 8-16 nucleobases within those segments
identified herein as beginning at a particular 5' target site. Any
segment of 8, 9, 10, 11, or more preferably 12, 13, 14, 15 or 16
contiguous nucleobases in a 50, preferably 25, more preferably 16
nucleobase perimeter around these regions are also considered to be
suitable for targeting.
[0310] In a further embodiment, the "suitable target segments"
identified herein may be employed in a screen for additional short
antisense compounds that modulate the expression of a target
nucleic acid. "Modulators" are those compounds that decrease or
increase the expression of a target nucleic acid and which comprise
at least an 8-nucleobase portion which is complementary to a target
segment. The screening method comprises the steps of contacting a
target segment of a nucleic acid with one or more candidate
modulators, and selecting for one or more candidate modulators
which decrease or increase the expression of a target nucleic acid.
Once it is shown that the candidate modulator or modulators are
capable of modulating (e.g. either decreasing or increasing) the
expression of a target nucleic acid, the modulator may then be
employed in further investigative studies of the function of the
target, or for use as a research, diagnostic, or therapeutic agent
in accordance with the present invention.
[0311] For all short antisense compounds discussed herein,
sequence, monomer, monomeric modification, and monomeric linkage
may each be selected independently. In certain embodiments, short
antisense compounds are described by a motif. In such embodiments,
any motif may be used with any sequence, whether or not the
sequence and/or the motif is specifically disclosed herein. In
certain embodiments, short antisense compounds comprise
modifications that are not amenable to description by motif (for
example, short antisense compounds comprising several different
modifications and/or linkages at various positions throughout the
compound). Such combinations may be incorporated for any sequence,
whether or not it is disclosed herein. The sequence listing
accompanying this filing provides certain nucleic acid sequences
independent of chemical modification. Though that listing
identifies each sequence as either "RNA" or "DNA" as required, in
reality, those sequences may be modified with any combination of
chemical modifications and/or motifs.
[0312] In certain embodiments, short antisense compounds comprise
at least one high-affinity modified monomer. In certain
embodiments, provided are short antisense compounds targeted to
nucleic acid molecules encoding targets including, but not limited
to, ApoB-100 (also known as APOB; Ag(x) antigen; apoB48;
apolipoprotein B; apolipoprotein B-100; apolipoprotein B48), GCGR
(also known as glucagon receptor; GR), CRP, DGAT2, GCCR, PCSK9,
PTEN, PTP1B, SGLT2, and SOD1. In certain such embodiments, such
short antisense compounds are targeted to a nucleic acid molecule
encoding any of those targets.
F. Certain Targets
[0313] In certain embodiments, short antisense compounds may be
designed to modulate any target. In certain embodiments, the target
is clinically relevant. In such embodiments, modulation of the
target results in clinical benefit. Certain targets are
preferentially expressed in the kidney. Certain targets are
preferentially expressed in the liver. Certain targets are
associated with a metabolic disorder. Certain targets are
associated to a cardiovascular disorder. In certain embodiments, a
target is selected from: ApoB, SGLT2, PCSK9, SOD1, CRP, GCCR, GCGR,
DGAT2, PTP1B, and PTEN. In certain embodiments, a target is
selected from: ApoB, SGLT2, PCSK9, SOD1, CRP, GCCR, GCGR, DGAT2,
and PTP1B. In certain embodiments, a target is any protein other
than SGLT2.
[0314] In certain embodiments, short antisense compounds exhibit
liver and kidney-specific target RNA reduction in vivo. Such
property renders those short antisense compounds particularly
useful for inhibition of many target RNAs involved in metabolic and
cardiovascular diseases. Thus, provided herein are methods of
treating cardiovascular or metabolic disorders by contacting said
kidney or liver tissues with short antisense compounds targeted to
RNAs associated with said disorders. Thus, also provided are
methods for ameliorating any of a variety of metabolic or
cardiovascular disease indications with the short antisense
compounds of the present invention.
[0315] 1. ApoB
[0316] ApoB (also known as apolipoprotein B-100; ApoB-100,
apolipoprotein B-48; ApoB-48 and Ag(x) antigen), is a large
glycoprotein that serves an indispensable role in the assembly and
secretion of lipids and in the transport and receptor-mediated
uptake and delivery of distinct classes of lipoproteins. ApoB
performs a variety of activities, from the absorption and
processing of dietary lipids to the regulation of circulating
lipoprotein levels (Davidson and Shelness, Annu. Rev. Nutr., 2000,
20, 169-193). This latter property underlies its relevance in terms
of atherosclerosis susceptibility, which is highly correlated with
the ambient concentration of ApoB-containing lipoproteins (Davidson
and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). ApoB-100 is the
major protein component of LDL-C and contains the domain required
for interaction of this lipoprotein species with the LDL receptor.
Elevated levels of LDL-C are a risk factor for cardiovascular
disease, including atherosclerosis.
Definitions
[0317] "ApoB" is the gene product or protein of which expression is
to be modulated by administration of a short antisense
compound.
[0318] "ApoB nucleic acid" means any nucleic acid encoding ApoB.
For example, in certain embodiments, a ApoB nucleic acid includes,
without limitation, a DNA sequence encoding ApoB, an RNA sequence
transcribed from DNA encoding ApoB, and an mRNA sequence encoding
ApoB.
[0319] "ApoB mRNA" means an mRNA encoding ApoB.
ApoB Therapeutic Indications
[0320] In certain embodiments, the invention provides methods of
modulating the expression of ApoB in an individual comprising
administering a short antisense compound targeted to an ApoB
nucleic acid. In certain embodiments, the invention provides
methods of treating an individual comprising administering one or
more pharmaceutical compositions comprising a short antisense
compound targeted to an ApoB nucleic acid. In certain embodiments,
the individual has hypercholesterolemia, non-familial
hypercholesterolemia, familial hypercholesterolemia, heterozygous
familial hypercholesterolemia, homozygous familial
hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk
of developing atherosclerosis, coronary heart disease, a history of
coronary heart disease, early onset coronary heart disease, one or
more risk factors for coronary heart disease, type II diabetes,
type II diabetes with dyslipidemia, dyslipidemia,
hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic
steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty
liver disease.
[0321] Guidelines for lipid-lowering therapy were established in
2001 by Adult Treatment Panel III (ATP III) of the National
Cholesterol Education Program (NCEP), and updated in 2004 (Grundy
et al., Circulation, 2004, 110, 227-239). The guidelines include
obtaining a complete lipoprotein profile, typically after a 9 to 12
hour fast, for determination of LDL-C, total cholesterol, and HDL-C
levels. According to the most recently established guidelines,
LDL-C levels of 130-159 mg/dL, 160-189 mg/dL, and greater than or
equal to 190 mg/dL are considered borderline high, high, and very
high, respectively. Total cholesterol levels of 200-239 and greater
than or equal to 240 mg/dL are considered borderline high and high,
respectively. HDL-C levels of less than 40 mg/dL are considered
low.
[0322] In certain embodiments, the individual has been identified
as in need of lipid-lowering therapy. In certain such embodiments,
the individual has been identified as in need of lipid-lowering
therapy according to the guidelines established in 2001 by Adult
Treatment Panel III (ATP III) of the National Cholesterol Education
Program (NCEP), and updated in 2004 (Grundy et al., Circulation,
2004, 110, 227-239). In certain such embodiments, the individual in
need of lipid-lowering therapy has LDL-C above 190 mg/dL. In
certain such embodiments, the individual in need of lipid-lowering
therapy has LDL-C above 160 mg/dL. In certain such embodiments, the
individual in need of lipid-lowering therapy has LDL-C above 130
mg/dL. In certain such embodiments the individual in need of
lipid-lowering therapy has LDL-C above 100 mg/dL. In certain such
embodiments the individual in need of lipid-lowering therapy should
maintain LDL-C below 160 mg/dL. In certain such embodiments the
individual in need of lipid-lowering therapy should maintain LDL-C
below 130 mg/dL. In certain such embodiments the individual in need
of lipid-lowering therapy should maintain LDL-C below 100 mg/dL. In
certain such embodiments the individual should maintain LDL-C below
70 mg/dL.
[0323] In certain embodiments the invention provides methods for
reducing ApoB in an individual. In certain embodiments the
invention provides methods for reducing ApoB-containing lipoprotein
in an individual. In certain embodiments the invention provides
methods for reducing LDL-C in an individual. In certain embodiments
the invention provides methods for reducing VLDL-C in an
individual. In certain embodiments the invention provides methods
for reducing IDL-C in an individual. In certain embodiments the
invention provides methods for reducing non-HDL-C in an individual.
In certain embodiments the invention provides methods for reducing
Lp(a) in an individual. In certain embodiments the invention
provides methods for reducing serum triglyceride in an individual.
In certain embodiments the invention provides methods for reducing
liver triglyceride in an individual. In certain embodiments the
invention provides methods for reducing Ox-LDL-C in an individual.
In certain embodiments the invention provides methods for reducing
small LDL particles in an individual. In certain embodiments the
invention provides methods for reducing small VLDL particles in an
individual. In certain embodiments the invention provides methods
for reducing phospholipids in an individual. In certain embodiments
the invention provides methods for reducing oxidized phospholipids
in an individual.
[0324] In certain embodiments the invention provides methods for
reducing Ox-LDL-C concentration in a subject. In certain such
embodiments, the reduction in ApoB, LDL-C, VLDL-C, IDL-C, total
cholesterol, non-HDL-C, Lp(a), triglyerides, or Ox-LDL-C is,
independently, selected from at least 10%, at least 15%, at least
20%, at least 25%, at least 30%, at least 35%, at least 40%, at
least 45%, at least 50%, at least 55%, at least 60%, at least 65%,
at least 70%, at least 75%, at least 80%, at least 85%, at least
90%, at least 95%, and at least 100%. In certain such embodiments,
the reduction in ApoB, LDL-C, VLDL-C, IDL-C, total cholesterol,
non-HDL-C, Lp(a), triglyerides, or Ox-LDL-C is, independently,
selected from at least 20%, at least 30%, at least 40%, at least
50%, at least 60%, and at least 70%. In certain such embodiments,
the reduction in ApoB, LDL-C, VLDL-C, IDL-C, total cholesterol,
non-HDL-C, Lp(a), triglyerides, or Ox-LDL-C is, independently,
selected from at least 40%, at least 50%, at least 60%, and at
least 70%.
[0325] In certain embodiments, the invention provides method for
raising HDL-C concentration in a subject.
[0326] In certain embodiments, the methods provided by the present
invention do not lower HDL-C. In certain embodiments, the methods
provided by the present invention do not result in accumulation of
lipids in the liver. In certain embodiments, the methods provided
by the present invention do not cause hepatic steatosis.
[0327] In certain embodiments, the invention provides methods for
lowering ApoB concentration in a subject while reducing side
effects associated with treatment. In certain such embodiments, a
side effect is liver toxicity. In certain such embodiments, a side
effect is abnormal liver function. In certain such embodiments, a
side effect is elevated alanine aminotransferase (ALT). In certain
such embodiments, a side effect is elevated aspartate
aminotransferase (AST).
[0328] In certain embodiments, the invention provides methods for
lowering ApoB concentration in a subject who is not reaching target
LDL-C levels as a result of lipid-lowering therapy. In certain such
embodiments, a short antisense compound targeted to an ApoB nucleic
acid is the only lipid-lowering agent administered to the subject.
In certain such embodiments, the subject has not complied with
recommended lipid-lowering therapy. In certain such embodiments, a
pharmaceutical composition of the invention is co-administered with
an additional different lipid-lowering therapy. In certain such
embodiments, an additional lipid-lowering therapy is LDL-apheresis.
In certain such embodiments, an additional lipid-lowering therapy
is a statin. In certain such embodiments, an additional
lipid-lowering therapy is ezetimibe.
[0329] In certain embodiments, the invention provides methods for
lowering ApoB concentration in a statin-intolerant subject. In
certain such embodiments, the subject has creatine kinase
concentration increases as a result of statin administration. In
certain such embodiments, the subject has liver function
abnormalities as a result of statin administration. In certain such
embodiments the subject has muscle aches as a result of statin
administration. In certain such embodiments the subject has central
nervous system side effects as a result of statin administration.
In certain embodiments, the subject has not complied with
recommended statin administration.
[0330] In certain embodiments, the invention provides methods for
lowering liver triglycerides in a subject.
[0331] In certain such embodiments, the subject has elevated liver
triglycerides. In certain such embodiments, the subject has
steatohepatitis. In certain such embodiments, the subject has
steatosis. In certain such embodiments, liver triglyceride levels
are measured by magnetic resonance imaging.
[0332] In certain embodiments, the invention provides methods for
reducing coronary heart disease risk in a subject. In certain
embodiments the invention provides methods for slowing the
progression of atherosclerosis in a subject. In certain such
embodiments the invention provides methods for stopping the
progression of atherosclerosis in a subject. In certain such
embodiments the invention provides methods for reducing the size
and/or prevalence of atherosclerotic plaques in a subject. In
certain embodiments the methods provided reduce a subject's risk of
developing atherosclerosis.
[0333] In certain embodiments the methods provided improve the
cardiovascular outcome in a subject. In certain such embodiments
improved cardiovascular outcome is the reduction of the risk of
developing coronary heart disease. In certain such embodiments,
improved cardiovascular outcome is a reduction in the occurrence of
one or more major cardiovascular events, which include, but are not
limited to, death, myocardial infarction, reinfarction, stroke,
cardiogenic shock, pulmonary edema, cardiac arrest, and atrial
dysrhythmia. In certain such embodiments, the improved
cardiovascular outcome is evidenced by improved carotid intimal
media thickness. In certain such embodiments, improved carotid
intimal media thickness is a decrease in thickness. In certain such
embodiments, improved carotid intimal media thickness is a
prevention an increase of intimal media thickness.
[0334] In certain embodiments a pharmaceutical composition
comprising a short antisense compound targeted to an ApoB nucleic
acid is for use in therapy. In certain embodiments, the therapy is
the reduction of LDL-C, ApoB, VLDL-C, IDL-C, non-HDL-C, Lp(a),
serum triglyceride, liver triglyceride, Ox-LDL-C, small LDL
particles, small VLDL, phospholipids, or oxidized phospholipids in
an individual. In certain embodiments, the therapy is the treatment
of hypercholesterolemia, non-familial hypercholesterolemia,
familial hypercholesterolemia, heterozygous familial
hypercholesterolemia, homozygous familial hypercholesterolemia,
mixed dyslipidemia, atherosclerosis, a risk of developing
atherosclerosis, coronary heart disease, a history of coronary
heart disease, early onset coronary heart disease, one or more risk
factors for coronary heart disease, type II diabetes, type II
diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia,
hyperlipidemia, hyperfattyacidemia, hepatic steatosis,
non-alcoholic steatohepatitis, or non-alcoholic fatty liver
disease. In additional embodiments, the therapy is the reduction of
CHD risk. In certain the therapy is prevention of atherosclerosis.
In certain embodiments, the therapy is the prevention of coronary
heart disease.
[0335] In certain embodiments a pharmaceutical composition
comprising a short antisense compound targeted to an ApoB nucleic
acid is used for the preparation of a medicament for reducing
LDL-C, ApoB, VLDL-C, IDL-C, non-HDL-C, Lp(a), serum triglyceride,
liver triglyceride, Ox-LDL-C, small LDL particles, small VLDL,
phospholipids, or oxidized phospholipids in an individual. In
certain embodiments pharmaceutical composition comprising a short
antisense compound targeted to an ApoB nucleic acid is used for the
preparation of a medicament for reducing coronary heart disease
risk. In certain embodiments a short antisense compound targeted to
an ApoB nucleic acid is used for the preparation of a medicament
for the treatment of hypercholesterolemia, non-familial
hypercholesterolemia, familial hypercholesterolemia, heterozygous
familial hypercholesterolemia, homozygous familial
hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk
of developing atherosclerosis, coronary heart disease, a history of
coronary heart disease, early onset coronary heart disease, one or
more risk factors for coronary heart disease, type II diabetes,
type II diabetes with dyslipidemia, dyslipidemia,
hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic
steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty
liver disease.
ApoB Combination Therapies
[0336] In certain embodiments, one or more pharmaceutical
compositions comprising a short antisense compound targeted to an
ApoB nucleic acid are co-administered with one or more other
pharmaceutical agents. In certain embodiments, such one or more
other pharmaceutical agents are designed to treat the same disease
or condition as the one or more pharmaceutical compositions of the
present invention. In certain such embodiments, the one or more
pharmaceutical agents are lipid-lowering agents. In certain
embodiments, such one or more other pharmaceutical agents are
designed to treat a different disease or condition as the one or
more pharmaceutical compositions of the present invention. In
certain embodiments, such one or more other pharmaceutical agents
are designed to treat an undesired effect of one or more
pharmaceutical compositions of the present invention. In certain
embodiments, one or more pharmaceutical compositions of the present
invention are co-administered with another pharmaceutical agent to
treat an undesired effect of that other pharmaceutical agent. In
certain embodiments, one or more pharmaceutical compositions of the
present invention and one or more other pharmaceutical agents are
administered at the same time. In certain embodiments, one or more
pharmaceutical compositions of the present invention and one or
more other pharmaceutical agents are administered at different
times. In certain embodiments, one or more pharmaceutical
compositions of the present invention and one or more other
pharmaceutical agents are prepared together in a single
formulation. In certain embodiments, one or more pharmaceutical
compositions of the present invention and one or more other
pharmaceutical agents are prepared separately.
[0337] In certain embodiments, pharmaceutical agents that may be
co-administered with a pharmaceutical composition comprising a
short antisense compound targeted to an ApoB nucleic acid include
lipid-lowering agents. In certain such embodiments, pharmaceutical
agents that may be co-administered with a pharmaceutical
composition of the present invention include, but are not limited
to atorvastatin, simvastatin, rosuvastatin, and ezetimibe. In
certain such embodiments, the lipid-lowering agent is administered
prior to administration of a pharmaceutical composition of the
present invention. In certain such embodiments, the lipid-lowering
agent is administered following administration of a pharmaceutical
composition of the present invention. In certain such embodiments
the lipid-lowering agent is administered at the same time as a
pharmaceutical composition of the present invention. In certain
such embodiments the dose of a co-administered lipid-lowering agent
is the same as the dose that would be administered if the
lipid-lowering agent was administered alone. In certain such
embodiments the dose of a co-administered lipid-lowering agent is
lower than the dose that would be administered if the
lipid-lowering agent was administered alone. In certain such
embodiments the dose of a co-administered lipid-lowering agent is
greater than the dose that would be administered if the
lipid-lowering agent was administered alone.
[0338] In certain embodiments, a co-administered lipid-lowering
agent is a HMG-CoA reductase inhibitor. In certain such embodiments
the HMG-CoA reductase inhibitor is a statin. In certain such
embodiments the statin is selected from atorvastatin, simvastatin,
pravastatin, fluvastatin, and rosuvastatin.
[0339] In certain embodiments, a co-administered lipid-lowering
agent is a cholesterol absorption inhibitor. In certain such
embodiments, cholesterol absorption inhibitor is ezetimibe.
[0340] In certain embodiments, a co-administered lipid-lowering
agent is a co-formulated HMG-CoA reductase inhibitor and
cholesterol absorption inhibitor. In certain such embodiments the
co-formulated lipid-lowering agent is ezetimibe/simvastatin.
[0341] In certain embodiments, a co-administered lipid-lowering
agent is a microsomal triglyceride transfer protein inhibitor (MTP
inhibitor).
[0342] In certain embodiments, a co-administered pharmaceutical
agent is a bile acid sequestrant. In certain such embodiments, the
bile acid sequestrant is selected from cholestyramine, colestipol,
and colesevelam.
[0343] In certain embodiments, a co-administered pharmaceutical
agent is a nicotinic acid. In certain such embodiments, the
nicotinic acid is selected from immediate release nicotinic acid,
extended release nicotinic acid, and sustained release nicotinic
acid.
[0344] In certain embodiments, a co-administered pharmaceutical
agent is a fibric acid. In certain such embodiments, a fibric acid
is selected from gemfibrozil, fenofibrate, clofibrate, bezafibrate,
and ciprofibrate.
[0345] Further examples of pharmaceutical agents that may be
co-administered with a pharmaceutical composition comprising a
short antisense compound targeted to an ApoB nucleic acid include,
but are not limited to, corticosteroids, including but not limited
to prednisone; immunoglobulins, including, but not limited to
intravenous immunoglobulin (IVIg); analgesics (e.g.,
acetaminophen); anti-inflammatory agents, including, but not
limited to non-steroidal anti-inflammatory drugs (e.g., ibuprofen,
COX-1 inhibitors, and COX-2, inhibitors); salicylates; antibiotics;
antivirals; antifungal agents; antidiabetic agents (e.g.,
biguanides, glucosidase inhibitors, insulins, sulfonylureas, and
thiazolidenediones); adrenergic modifiers; diuretics; hormones
(e.g., anabolic steroids, androgen, estrogen, calcitonin,
progestin, somatostan, and thyroid hormones); immunomodulators;
muscle relaxants; antihistamines; osteoporosis agents (e.g.,
biphosphonates, calcitonin, and estrogens); prostaglandins,
antineoplastic agents; psychotherapeutic agents; sedatives; poison
oak or poison sumac products; antibodies; and vaccines.
[0346] In certain embodiments, a pharmaceutical composition
comprising a short antisense compound targeted to an ApoB nucleic
acid may be administered in conjunction with a lipid-lowering
therapy. In certain such embodiments, a lipid-lowering therapy is
therapeutic lifestyle change. In certain such embodiments, a
lipid-lowering therapy is LDL apheresis.
[0347] In one embodiment, the antisense compounds provided herein
can be used to lower the level of apolipoprotein B-containing
lipoproteins in a human subject. As used herein, "apolipoprotein
B-containing lipoprotein" refers to any lipoprotein that has
apolipoprotein B as its protein component, and is understood to
include LDL, VLDL, IDL, and lipoprotein(a). LDL, VLDL, IDL and
lipoprotein(a) each contain one molecule of apolipoprotein B, thus
a serum apolipoprotein B measurement reflects the total number of
these lipoproteins. As is known in the art, each of the
aforementioned lipoproteins is atherogenic. Thus, lowering one or
more apolipoprotein B-containing lipoproteins in serum may provide
a therapeutic benefit to a human subject. Small LDL particles are
considered to be particularly atherogenic relative to large LDL
particles, thus lowering small LDL particles can provide a
therapeutic benefit to a human subject. Additional lipid parameters
can also be determined in a subject. Reduction of total
cholesterol:HDL ratio or LDL:HDL ratio is a clinically desirable
improvement in cholesterol ratio. Similarly, it is clinically
desirable to reduce serum triglycerides in humans who exhibit
elevated lipid levels.
[0348] Other indications of cardiovascular disease that can be
measured in a subject include serum LDL particle size; serum LDL
cholesteryl ester concentration; serum LDL cholesteryl ester
composition; the extent of polyunsaturation of serum LDL
cholesteryl esters; and serum HDL cholesterol levels. As used
herein, "serum LDL particle size" refers to the classification of
serum LDL particle size, which may be very small, small, medium, or
large, and is typically expressed in g/.mu.mol. In the context of
the present invention, "serum LDL cholesteryl ester concentration"
means the amount of cholesteryl ester present in LDL particles, and
is typically measured as mg/dL. In the context of the present
invention, "serum LDL cholesteryl ester composition" is a
measurement of the percentage of saturated, monounsaturated and
polyunsaturated cholesteryl ester fatty acids present in serum LDL
particles. "Polyunsaturation of serum LDL cholesteryl esters" means
the percentage of polyunsaturated cholesteryl ester fatty acids in
serum LDL particles.
[0349] Methods of obtaining serum or plasma samples for analysis
and methods of preparation of the serum samples to allow for
analysis are well known to those skilled in the art. With regard to
measurements of lipoproteins, cholesterol, triglyceride and
cholesteryl esters, the terms "serum" and "plasma" are herein used
interchangeably.
[0350] In another embodiment, the antisense compounds provided
herein can be used to treat metabolic disorders. A variety of
biomarkers can be used for evaluating metabolic disease. For
example, blood glucose levels can be determined by a physician or
even by the patient using a commonly available test kit or
glucometer (for example, the Ascensia ELITE.TM. kit, Ascensia
(Bayer), Tarrytown N.Y., or Accucheck, Roche Diagnostics). Glycated
hemoglobin (HbA.sub.1c) can also be measured. HbA.sub.1c is a
stable minor hemoglobin variant formed in vivo via
posttranslational modification by glucose, and it contains
predominantly glycated --NH.sub.2-terminal .beta.-chains. There is
a strong correlation between levels of HbA.sub.1c and the average
blood glucose levels over the previous 3 months. Thus HbA.sub.1c is
often viewed as the "gold standard" for measuring sustained blood
glucose control (Bunn, H. F. et al., 1978, Science. 200, 21-7).
HbA.sub.1c can be measured by ion-exchange HPLC or immunoassay;
home blood collection and mailing kits for HbA.sub.1c measurement
are now widely available. Serum fructosamine is another measure of
stable glucose control and can be measured by a colorimetric method
(Cobas Integra, Roche Diagnostics).
Certain Short Antisense Compounds Targeted to an ApoB Nucleic
Acid
[0351] In certain embodiments, short antisense compounds are
targeted to an ApoB nucleic acid having the sequence of
GENBANK.RTM. Accession No. NM.sub.--000384.1, incorporated herein
as SEQ ID NO: 1. In certain such embodiments, a short antisense
compound targeted to SEQ ID NO: 1 is at least 90% complementary to
SEQ ID NO: 1. In certain such embodiments, a short antisense
compound targeted to SEQ ID NO: 1 is at least 95% complementary to
SEQ ID NO: 1. In certain such embodiments, a short antisense
compound targeted to SEQ ID NO: 1 is 100% complementary to SEQ ID
NO: 1. In certain embodiments, a short antisense compound targeted
to SEQ ID NO: 1 comprises a nucleotide sequence selected from the
nucleotide sequences set forth in Table 2 and Table 3.
[0352] The nucleotide sequence set forth in each SEQ ID NO in
Tables 2 and 3 is independent of any modification to a sugar
moiety, a monomeric linkage, or a nucleobase. As such, short
antisense compounds defined by a SEQ ID NO may comprise,
independently, one or more modifications to a sugar moiety, an
internucleoside linkage, or a nucleobase. Antisense compounds
described by Isis Number (Isis NO.) indicate a combination of
nucleobase sequence and one or more modifications to a sugar
moiety, an internucleoside linkage, or a nucleobase.
[0353] Tables 2 and 3 illustrate examples of short antisense
compounds targeted to SEQ ID NO: 1. Table 2 illustrates short
antisense compounds that are 100% complementary to SEQ ID NO: 1.
Table 3 illustrates short antisense compounds that have one or two
mismatches with respect to SEQ ID NO: 1. The column labeled `gapmer
motif` indicates the wing-gap-wing motif of each short antisense
compounds. The gap segment comprises 2'-deoxynucleotides and each
nucleotide of each wing segment comprises a 2'-modified sugar. The
particular 2'-modified sugar is also indicated in the `gapmer
motif` column. For example, `2-10-2 MOE` means a 2-10-2 gapmer
motif, where a gap segment of ten 2'-deoxynucleotides is flanked by
wing segments of two nucleotides, where the nucleotides of the wing
segments are 2'-MOE nucleotides. Internucleoside linkages are
phosphorothioate. The short antisense compounds comprise
5-methylcytidine in place of unmodified cytosine, unless
"unmodified cytosine" is listed in the gapmer motif column, in
which case the indicated cytosines are unmodified cytosines. For
example, "5-mC in gap only" indicates that the gap segment has
5-methylcytosines, while the wing segments have unmodified
cytosines.
TABLE-US-00005 TABLE 2 Short Antisense Compounds targeted to SEQ ID
NO: 1 5' 3' ISIS Target Target SEQ No Site Site Sequence (5'-3')
Gapmer Motif ID NO 372816 263 278 CCGGAGGTGCTTGAAT 3-10-3 MOE 16
372894 264 277 CGGAGGTGCTTGAA 2-10-2 MOE 17 372817 428 443
GAAGCCATACACCTCT 3-10-3 MOE 18 372895 429 442 AAGCCATACACCTC 2-10-2
MOE 19 372818 431 446 GTTGAAGCCATACACC 3-10-3 MOE 20 372896 432 445
TTGAAGCCATACAC 2-10-2 MOE 21 372819 438 453 CCTCAGGGTTGAAGCC 3-10-3
MOE 22 372897 439 452 CTCAGGGTTGAAGC 2-10-2 MOE 23 372820 443 458
TTTGCCCTCAGGGTTG 3-10-3 MOE 24 372898 444 457 TTGCCCTCAGGGTT 2-10-2
MOE 25 372821 468 483 AGTTCTTGGTTTTCTT 3-10-3 MOE 26 372899 469 482
GTTCTTGGTTTTCT 2-10-2 MOE 27 372822 587 602 CCTCTTGATGTTCAGG 3-10-3
MOE 28 372900 588 601 CTCTTGATGTTCAG 2-10-2 MOE 29 372823 592 607
ATGCCCCTCTTGATGT 3-10-3 MOE 30 372901 593 606 TGCCCCTCTTGATG 2-10-2
MOE 31 346583 715 728 TGCCACATTGCCCT 3-8-3 MOE 32 346584 716 729
TTGCCACATTGCCC 3-8-3 MOE 33 346585 717 730 GTTGCCACATTGCC 3-8-3 MOE
34 346586 718 731 TGTTGCCACATTGC 3-8-3 MOE 35 346587 719 732
CTGTTGCCACATTG 3-8-3 MOE 36 346588 720 733 TCTGTTGCCACATT 3-8-3 MOE
37 346589 721 734 TTCTGTTGCCACAT 3-8-3 MOE 38 346590 722 735
TTTCTGTTGCCACA 3-8-3 MOE 39 346591 723 736 ATTTCTGTTGCCAC 3-8-3 MOE
40 372824 929 944 GTAGGAGAAAGGCAGG 3-10-3 MOE 41 372902 930 943
TAGGAGAAAGGCAG 2-10-2 MOE 42 372825 1256 1271 GGCTTGTAAAGTGATG
3-10-3 MOE 43 372903 1257 1270 GCTTGTAAAGTGAT 2-10-2 MOE 44 372826
1304 1319 CCACTGGAGGATGTGA 3-10-3 MOE 45 372904 1305 1318
CACTGGAGGATGTG 2-10-2 MOE 46 372829 2135 2150 TTTCAGCATGCTTTCT
3-10-3 MOE 47 372907 2136 2149 TTCAGCATGCTTTC 2-10-2 MOE 48 372832
2774 2789 CATATTTGTCACAAAC 3-10-3 MOE 49 372910 2775 2788
ATATTTGTCACAAA 2-10-2 MOE 50 372833 2779 2794 ATGCCCATATTTGTCA
3-10-3 MOE 51 372911 2780 2793 TGCCCATATTTGTC 2-10-2 MOE 52 372835
2961 2976 TTTTGGTGGTAGAGAC 3-10-3 MOE 53 372913 2962 2975
TTTGGTGGTAGAGA 2-10-2 MOE 54 346592 3248 3261 TCTGCTTCGCACCT 3-8-3
MOE 55 346593 3249 3262 GTCTGCTTCGCACC 3-8-3 MOE 56 346594 3250
3263 AGTCTGCTTCGCAC 3-8-3 MOE 57 346595 3251 3264 CAGTCTGCTTCGCA
3-8-3 MOE 58 346596 3252 3265 TCAGTCTGCTTCGC 3-8-3 MOE 59 346597
3253 3266 CTCAGTCTGCTTCG 3-8-3 MOE 60 346598 3254 3267
CCTCAGTCTGCTTC 3-8-3 MOE 61 346599 3255 3268 GCCTCAGTCTGCTT 3-8-3
MOE 62 346600 3256 3269 AGCCTCAGTCTGCT 3-8-3 MOE 63 372836 3350
3365 AACTCTGAGGATTGTT 3-10-3 MOE 64 372914 3351 3364 ACTCTGAGGATTGT
2-10-2 MOE 65 372837 3355 3370 TCATTAACTCTGAGGA 3-10-3 MOE 66
372915 3356 3369 CATTAACTCTGAGG 2-10-2 MOE 67 372838 3360 3375
ATTCATCATTAACTCT 3-10-3 MOE 68 372916 3361 3374 TTCATCATTAACTC
2-10-2 MOE 69 372839 3409 3424 TTGTTCTGAATGTCCA 3-10-3 MOE 70
387461 3409 3424 TTGTTCTGAATGTCCA 3-10-3 Methyleneoxy 70 BNA
Unmodified cytosines in gap 380147 3409 3424 TTGTTCTGAATGTCCA
3-10-3 Methyleneoxy 70 BNA 372917 3410 3423 TGTTCTGAATGTCC 2-10-2
MOE 73 372840 3573 3588 CAGATGAGTCCATTTG 3-10-3 MOE 74 372918 3574
3587 AGATGAGTCCATTT 2-10-2 MOE 75 372841 3701 3716 ATCCACAGGGAAATTG
3-10-3 MOE 76 372919 3702 3715 TCCACAGGGAAATT 2-10-2 MOE 77 372843
4219 4234 CAGTTGTACAAGTTGC 3-10-3 MOE 78 372921 4220 4233
AGTTGTACAAGTTG 2-10-2 MOE 79 372844 4301 4316 CACAGAGTCAGCCTTC
3-10-3 MOE 80 372922 4302 4315 ACAGAGTCAGCCTT 2-10-2 MOE 81 372845
4308 4323 GGTCAACCACAGAGTC 3-10-3 MOE 82 372923 4309 4322
GTCAACCACAGAGT 2-10-2 MOE 83 346601 5588 5601 CAGCCACATGCAGC 3-8-3
MOE 84 346602 5589 5602 CCAGCCACATGCAG 3-8-3 MOE 85 346603 5590
5603 ACCAGCCACATGCA 3-8-3 MOE 86 346604 5591 5604 TACCAGCCACATGC
3-8-3 MOE 87 346605 5592 5605 TTACCAGCCACATG 3-8-3 MOE 88 346606
5593 5606 GTTACCAGCCACAT 3-8-3 MOE 89 346607 5594 5607
GGTTACCAGCCACA 3-8-3 MOE 90 346608 5595 5608 AGGTTACCAGCCAC 3-8-3
MOE 91 346609 5596 5609 TAGGTTACCAGCCA 3-8-3 MOE 92 372851 5924
5939 AGGTTCTGCTTTCAAC 3-10-3 MOE 93 372929 5925 5938 GGTTCTGCTTTCAA
2-10-2 MOE 94 372854 6664 6679 TACTGATCAAATTGTA 3-10-3 MOE 95
372932 6665 6678 ACTGATCAAATTGT 2-10-2 MOE 96 372855 6908 6923
TTTTTCTTGTATCTGG 3-10-3 MOE 97 372933 6909 6922 TTTTCTTGTATCTG
2-10-2 MOE 98 372856 7190 7205 ATCCATTAAAACCTGG 3-10-3 MOE 99
372934 7191 7204 TCCATTAAAACCTG 2-10-2 MOE 100 372858 7817 7832
ATATTGCTCTGCAAAG 3-10-3 MOE 101 372936 7818 7831 TATTGCTCTGCAAA
2-10-2 MOE 102 346610 7818 7831 TATTGCTCTGCAAA 3-8-3 MOE 102 346611
7819 7832 ATATTGCTCTGCAA 3-8-3 MOE 104 346612 7820 7833
AATATTGCTCTGCA 3-8-3 MOE 105 346613 7821 7834 GAATATTGCTCTGC 3-8-3
MOE 106 346614 7822 7835 AGAATATTGCTCTG 3-8-3 MOE 107 346615 7823
7836 TAGAATATTGCTCT 3-8-3 MOE 108 346616 7824 7837 ATAGAATATTGCTC
3-8-3 MOE 109 346617 7825 7838 GATAGAATATTGCT 3-8-3 MOE 110 346618
7826 7839 GGATAGAATATTGC 3-8-3 MOE 111 372859 7995 8010
ATGGAATCCTCAAATC 3-10-3 MOE 112 372937 7996 8009 TGGAATCCTCAAAT
2-10-2 MOE 113 372861 8336 8351 GAATTCTGGTATGTGA 3-10-3 MOE 114
372939 8337 8350 AATTCTGGTATGTG 2-10-2 MOE 115 372862 8341 8356
AGCTGGAATTCTGGTA 3-10-3 MOE 116 372940 8342 8355 GCTGGAATTCTGGT
2-10-2 MOE 117 372863 8539 8554 TGAAAATCAAAATTGA 3-10-3 MOE 118
372941 8540 8553 GAAAATCAAAATTG 2-10-2 MOE 119 372871 9344 9359
AAACAGTGCATAGTTA 3-10-3 MOE 120 372949 9345 9358 AACAGTGCATAGTT
2-10-2 MOE 121 372872 9515 9530 TTCAGGAATTGTTAAA 3-10-3 MOE 122
372950 9516 9529 TCAGGAATTGTTAA 2-10-2 MOE 123 372875 9794 9809
TTTTGTTTCATTATAG 3-10-3 MOE 124 372953 9795 9808 TTTGTTTCATTATA
2-10-2 MOE 125 372877 10157 10172 GATGACACTTGATTTA 3-10-3 MOE 126
372955 10158 10171 ATGACACTTGATTT 2-10-2 MOE 127 372878 10161 10176
GTGTGATGACACTTGA 3-10-3 MOE 128 372956 10162 10175 TGTGATGACACTTG
2-10-2 MOE 129 372879 10167 10182 TATTCAGTGTGATGAC 3-10-3 MOE 130
372957 10168 10181 ATTCAGTGTGATGA 2-10-2 MOE 131 372880 10172 10187
ATTGGTATTCAGTGTG 3-10-3 MOE 132 372958 10173 10186 TTGGTATTCAGTGT
2-10-2 MOE 133 346619 10838 10851 CCTCTAGCTGTAAG 3-8-3 MOE 134
346620 10839 10852 CCCTCTAGCTGTAA 3-8-3 MOE 135
346621 10840 10853 GCCCTCTAGCTGTA 3-8-3 MOE 136 346622 10841 10854
GGCCCTCTAGCTGT 3-8-3 MOE 137 346623 10842 10855 AGGCCCTCTAGCTG
3-8-3 MOE 138 346624 10843 10856 GAGGCCCTCTAGCT 3-8-3 MOE 139
346625 10844 10857 AGAGGCCCTCTAGC 3-8-3 MOE 140 346626 10845 10858
AAGAGGCCCTCTAG 3-8-3 MOE 141 346627 10846 10859 AAAGAGGCCCTCTA
3-8-3 MOE 142 372890 13689 13704 GAATGGACAGGTCAAT 3-10-3 MOE 143
372968 13690 13703 AATGGACAGGTCAA 2-10-2 MOE 144 372891 13694 13709
GTTTTGAATGGACAGG 3-10-3 MOE 145 372969 13695 13708 TTTTGAATGGACAG
2-10-2 MOE 146 372892 13699 13714 TGGTAGTTTTGAATGG 3-10-3 MOE 147
372970 13700 13713 GGTAGTTTTGAATG 2-10-2 MOE 148 346628 13907 13920
TCACTGTATGGTTT 3-8-3 MOE 149 346629 13908 13921 CTCACTGTATGGTT
3-8-3 MOE 150 346630 13909 13922 GCTCACTGTATGGT 3-8-3 MOE 151
346631 13910 13923 GGCTCACTGTATGG 3-8-3 MOE 152 346632 13911 13924
TGGCTCACTGTATG 3-8-3 MOE 153 346633 13912 13925 CTGGCTCACTGTAT
3-8-3 MOE 154 346634 13913 13926 GCTGGCTCACTGTA 3-8-3 MOE 155
346635 13914 13927 GGCTGGCTCACTGT 3-8-3 MOE 156 346636 13915 13928
AGGCTGGCTCACTG 3-8-3 MOE 157 346637 13963 13976 CAGGTCCAGTTCAT
3-8-3 MOE 158 346638 13964 13977 GCAGGTCCAGTTCA 3-8-3 MOE 159
346639 13965 13978 TGCAGGTCCAGTTC 3-8-3 MOE 160 346640 13966 13979
GTGCAGGTCCAGTT 3-8-3 MOE 161 346641 13967 13980 GGTGCAGGTCCAGT
3-8-3 MOE 162 346642 13968 13981 TGGTGCAGGTCCAG 3-8-3 MOE 163
346643 13969 13982 TTGGTGCAGGTCCA 3-8-3 MOE 164 346644 13970 13983
TTTGGTGCAGGTCC 3-8-3 MOE 165 346645 13971 13984 CTTTGGTGCAGGTC
3-8-3 MOE 166 346646 14051 14064 TAACTCAGATCCTG 3-8-3 MOE 167
346647 14052 14065 ATAACTCAGATCCT 3-8-3 MOE 168 346648 14053 14066
AATAACTCAGATCC 3-8-3 MOE 169 346649 14054 14067 AAATAACTCAGATC
3-8-3 MOE 170 346650 14055 14068 AAAATAACTCAGAT 3-8-3 MOE 171
346651 14056 14069 CAAAATAACTCAGA 3-8-3 MOE 172 346652 14057 14070
GCAAAATAACTCAG 3-8-3 MOE 173 346653 14058 14071 AGCAAAATAACTCA
3-8-3 MOE 174 346654 14059 14072 TAGCAAAATAACTC 3-8-3 MOE 175
TABLE-US-00006 TABLE 3 Short antisense compounds targeted to SEQ ID
NO: 1 and having 1 or 2 mismatches 5' 3' SEQ Isis Target Target ID
NO. Site Site Sequence (5'-3') Gapmer Motif NO 372894 771 784
CGGAGGTGCTTGAA 2-10-2 MOE 17 372905 1111 1124 CAGGGCCTGGAGAG 2-10-2
MOE 176 346628 1493 1506 TCACTGTATGGTTT 3-8-3 MOE 149 372828 2006
2021 TCTGAAGTCCATGATC 3-10-3 MOE 177 372906 2007 2020
CTGAAGTCCATGAT 2-10-2 MOE 178 372830 2382 2397 TGGGCATGATTCCATT
3-10-3 MOE 179 372908 2383 2396 GGGCATGATTCCAT 2-10-2 MOE 180
346616 3162 3175 ATAGAATATTGCTC 3-8-3 MOE 109 346617 3163 3176
GATAGAATATTGCT 3-8-3 MOE 110 372929 3513 3526 GGTTCTGCTTTCAA 2-10-2
MOE 94 372946 3800 3813 TGGAGCCCACGTGC 2-10-2 MOE 181 372904 4040
4053 CACTGGAGGATGTG 2-10-2 MOE 46 372842 4084 4099 TTGAAGTTGAGGGCTG
3-10-3 MOE 182 372920 4085 4098 TGAAGTTGAGGGCT 2-10-2 MOE 183
346586 4778 4791 TGTTGCCACATTGC 3-8-3 MOE 35 372847 5030 5045
ACCAGTATTAATTTTG 3-10-3 MOE 184 372925 5031 5044 CCAGTATTAATTTT
2-10-2 MOE 185 372848 5192 5207 GTGTTCTTTGAAGCGG 3-10-3 MOE 186
372926 5193 5206 TGTTCTTTGAAGCG 2-10-2 MOE 187 372953 5625 5638
TTTGTTTCATTATA 2-10-2 MOE 125 372935 7585 7598 AGTTACTTTGGTGT
2-10-2 MOE 188 372860 8255 8270 TGGTACATGGAAGTCT 3-10-3 MOE 189
372938 8256 8269 GGTACATGGAAGTC 2-10-2 MOE 190 391260 8256 8269
GGTACATGGAAGTC 2-10-2 MOE 190 392068 8256 8269 GGTACATGGAAGTC
2-10-2 MOE 190 387462 8256 8269 GGTACATGGAAGTC 2-10-2 Methyleneoxy
190 BNA 391872 8256 8269 GGTACATGGAAGTC 1-1-10-2 2'- 190
(butylacetomido)- palmitamide Methyleneoxy BNA/Methyleneoxy BNA
Unmodified cytosines in gap 380148 8256 8269 GGTACATGGAAGTC 2-10-2
Methyleneoxy 190 BNA 391871 8256 8269 GGTACATGGAAGTC 1-1-10-2 2'-
190 (butylacetomido)- palmitamide/MOE/MOE Unmodified cytosines in
gap 391755 8256 8269 GGTACATGGAAGTC 2-10-2 ENA 190 mC in wing only
398296 8256 8269 GGTACATGGAAGTC 2-10-2 (6'S)-6'-methyl- 190
Methyleneoxy BNA Unmodified Cytosines 372942 8455 8468
TCCATGCCATATGT 2-10-2 MOE 200 372865 8888 8903 CCCTGAAGAAGTCCAT
3-10-3 MOE 201 372943 8889 8902 CCTGAAGAAGTCCA 2-10-2 MOE 202
372866 8908 8923 GCCCAGTTCCATGACC 3-10-3 MOE 203 372944 8909 8922
CCCAGTTCCATGAC 2-10-2 MOE 204 372867 9058 9073 TTGAGGAAGCCAGATT
3-10-3 MOE 205 372945 9059 9072 TGAGGAAGCCAGAT 2-10-2 MOE 206
372870 9261 9276 TGGATGCAGTAATCTC 3-10-3 MOE 207 372948 9262 9275
GGATGCAGTAATCT 2-10-2 MOE 208 372881 10185 10200 TATAAAGTCCAGCATT
3-10-3 MOE 209 372959 10186 10199 ATAAAGTCCAGCAT 2-10-2 MOE 210
372882 10445 10460 AAGTTCCTGCTTGAAG 3-10-3 MOE 211 372960 10446
10459 AGTTCCTGCTTGAA 2-10-2 MOE 212 372964 11451 11464
AATGGTGAAGTACT 2-10-2 MOE 213 346612 13459 13472 AATATTGCTCTGCA
3-8-3 MOE 105 346613 13460 13473 GAATATTGCTCTGC 3-8-3 MOE 106
[0354] In certain embodiments, a target region is nucleotides
263-278 of SEQ ID NO: 1. In certain such embodiments, short
antisense compounds targeted to nucleotides 263-278 of SEQ ID NO: 1
comprise a nucleotide sequence selected from SEQ ID NO: 16 or 17.
In certain such embodiments, a short antisense compound targeted to
nucleotides 263-278 of SEQ ID NO: 1 is selected from Isis NO.
372816 or 372894.
[0355] In certain embodiments, a target region is nucleotides
428-483 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 428-483 of SEQ ID NO: 1
comprises a nucleotide sequence selected from SEQ ID NO 18, 19, 20,
21, 22, 23, 24, 25, 26, or 27. In certain such embodiments, a short
antisense compound targeted to nucleotides 428-483 of SEQ ID NO: 1
is selected from Isis NO. 372817, 372895, 372818, 372896, 372819,
372897, 372820, 372898, 372821, or 372899.
[0356] In certain embodiments, a target region is nucleotides
428-458 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 428-458 of SEQ ID NO: 1
comprises a nucleotide sequence selected from SEQ ID NO 18, 19, 20,
21, 22, 23, 24, or 25. In certain such embodiments, a short
antisense compound targeted to nucleotides 428-458 of SEQ ID NO: 1
is selected from Isis NO. 372817, 372895, 372818, 372896, 372819,
372897, 372820, or 372898.
[0357] In certain embodiments, a target region is nucleotides
468-483 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 468-483 of SEQ ID NO: 1
comprises a nucleotide sequence selected from SEQ ID NO 26 or 27.
In certain such embodiments, a short antisense compound targeted to
nucleotides 468-483 of SEQ ID NO: 1 is selected from Isis NO.
372821 or 372899.
[0358] In certain embodiments, a target region is nucleotides
587-607 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 587-607 of SEQ ID NO: 1
comprises a nucleotide sequence selected from SEQ ID NO 28, 29, 30,
or 31. In certain such embodiments, a short antisense compound
targeted to nucleotides 587-607 of SEQ ID NO: 1 is selected from
ISIS NO. 372822, 372900, 372823, or 372901.
[0359] In certain embodiments, a target region is nucleotides
715-736 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 715-736 of SEQ ID NO: 1
comprises a nucleotide sequence selected from SEQ ID NO 32, 33, 34,
35, 36, 37, 38, 39, or 40. In certain such embodiments, a short
antisense compound targeted to nucleotides 715-736 of SEQ ID NO: 1
is selected from Isis NO. 346583, 346584, 346585, 346586, 346587,
346588, 346589, 346590, or 346591.
[0360] In certain embodiments, a target region is nucleotides
929-944 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 929-944 of SEQ ID NO: 1
comprises a nucleotide sequence selected from SEQ ID NO 41 or 42.
In certain such embodiments, a short antisense compound targeted to
nucleotides 929-944 of SEQ ID NO: 1 is selected from Isis NO.
372824 or 372902.
[0361] In certain embodiments, a target region is nucleotides
1256-1319 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 1256-1319 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 43, 44,
45, or 46. In certain such embodiments, a short antisense compound
targeted to nucleotides 1256-1319 of SEQ ID NO: 1 is selected from
Isis NO. 372825, 372903, 372826, or 372904.
[0362] In certain embodiments, a target region is nucleotides
1256-1271 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 1256-1271 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 43 or 44.
In certain such embodiments, a short antisense compound targeted to
nucleotides 1256-1271 of SEQ ID NO: 1 is selected from Isis NO.
372825 or 372903.
[0363] In certain embodiments, a target region is nucleotides
1304-1319 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 1304-1319 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 45 or 46.
In certain such embodiments, a short antisense compound targeted to
nucleotides 1304-1319 of SEQ ID NO: 1 is selected from Isis NO.
372826 or 372904.
[0364] In certain embodiments, a target region is nucleotides
2135-2150 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 2135-2150 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 47 or 48.
In certain such embodiments, a short antisense compound targeted to
nucleotides 2135-2150 of SEQ ID NO: 1 is selected from ISIS NO.
372829 or 372907.
[0365] In certain embodiments, a target region is nucleotides
2774-2794 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 2774-2794 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 49, 50,
51, or 52. In certain such embodiments, a short antisense compound
targeted to nucleotides 2774-2794 of SEQ ID NO: 1 is selected from
ISIS NO. 372832, 372910, 372833, or 372911.
[0366] In certain embodiments, a target region is nucleotides
2961-2976 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 2961-2976 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 53 or 54.
In certain such embodiments, a short antisense compound targeted to
nucleotides 2961-2976 of SEQ ID NO: 1 is selected from ISIS NO.
372835 or 372913.
[0367] In certain embodiments, a target region is nucleotides
3248-3269 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 3248-3269 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 55, 56,
57, 58, 59, 60, 61, 62, or 63. In certain such embodiments, a short
antisense compound targeted to nucleotides 3248-3269 of SEQ ID NO:
1 is selected from ISIS NO. 346592, 346593, 346594, 346595, 346596,
346597, 346598, 346599, or 346600.
[0368] In certain embodiments, a target region is nucleotides
3350-3375 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 3350-3375 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 64, 65,
66, 67, 68, or 69. In certain such embodiments, a short antisense
compound targeted to nucleotides 3350-3375 of SEQ ID NO: 1 is
selected from ISIS NO. 372836, 372914, 372837, 372915, 372838, or
372916.
[0369] In certain embodiments, a target region is nucleotides
3409-3424 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 3409-3424 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 70 or 73.
In certain such embodiments, a short antisense compound targeted to
nucleotides 3409-3424 of SEQ ID NO: 1 is selected from ISIS NO.
372839, 387461, 380147, or 372917.
[0370] In certain embodiments, a target region is nucleotides
3573-3588 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 3573-3588 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 74 or 75.
In certain such embodiments, a short antisense compound targeted to
nucleotides 3573-3588 of SEQ ID NO: 1 is selected from ISIS NO.
372840 or 372918.
[0371] In certain embodiments, a target region is nucleotides
3701-3716 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 3701-3716 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 76 or 77.
In certain such embodiments, a short antisense compound targeted to
nucleotides 3701-3716 of SEQ ID NO: 1 is selected from ISIS NO.
372841 or 372919.
[0372] In certain embodiments, a target region is nucleotides
4219-4234 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 4219-4234 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 78 or 79.
In certain such embodiments, a short antisense compound targeted to
nucleotides 4219-4234 of SEQ ID NO: 1 is selected from ISIS NO.
372843 or 372921.
[0373] In certain embodiments, a target region is nucleotides
4301-4323 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 4301-4323 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 80, 81,
82, or 83. In certain embodiments, a short antisense compound
targeted to nucleotides 4301-4323 of SEQ ID NO: 1 is selected from
ISIS NO. 372844, 372922, 372845, or 372923.
[0374] In certain embodiments, a target region is nucleotides
5588-5609 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 5588-5609 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 84, 85,
86, 87, 88, 89, 90, 91, or 92. In certain such embodiments, a short
antisense compound targeted to nucleotides 5588-5609 of SEQ ID NO:
1 is selected from ISIS NO. 346601, 346602, 346603, 346604, 346605,
346606, 346607, 346608, or 346609.
[0375] In certain embodiments, a target region is nucleotides
5924-5939 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 5924-5939 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 93 or 94.
In certain such embodiments, a short antisense compound targeted to
nucleotides 5924-5939 of SEQ ID NO: 1 is selected from ISIS NO.
372851 or 372929.
[0376] In certain embodiments, a target region is nucleotides
6664-6679 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 6664-6679 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 95 or 96.
In certain such embodiments, a short antisense compound targeted to
nucleotides 6664-6679 of SEQ ID NO: 1 is selected from ISIS NO.
372854 or 372932.
[0377] In certain embodiments, a target region is nucleotides
6908-6923 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 6908-6923 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 97 or 98.
In certain such embodiments, a short antisense compound targeted to
nucleotides 6908-6923 of SEQ ID NO: 1 is selected from ISIS NO.
372855 or 372933.
[0378] In certain embodiments, a target region is nucleotides
7190-7205 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 7190-7205 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 99 or
100. In certain such embodiments, a short antisense compound
targeted to nucleotides 7190-7205 of SEQ ID NO: 1 is selected from
ISIS NO. 372856 or 372934.
[0379] In certain embodiments, a target region is nucleotides
7817-7839 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 7817-7839 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 101, 102,
104, 105, 106, 107, 108, 109, 110, or 111. In certain such
embodiments, a short antisense compound targeted to nucleotides
7817-7839 of SEQ ID NO: 1 is selected from ISIS NO. 372858, 372936,
346610, 346611, 346612, 346613, 346614, 346615, 346616, 346617, or
346618.
[0380] In certain embodiments, a target region is nucleotides
7995-8010 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 7995-8010 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 112 or
113. In certain such embodiments, a short antisense compound
targeted to nucleotides 7995-8010 of SEQ ID NO: 1 is selected from
ISIS NO. 372859 or 372937.
[0381] In certain embodiments, a target region is nucleotides
8336-8356 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 8336-8356 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 114, 115,
116, or 117. In certain such embodiments, a short antisense
compound targeted to nucleotides 8336-8356 of SEQ ID NO: 1 is
selected from ISIS NO. 372861, 372939, 372862, or 372940.
[0382] In certain embodiments, a target region is nucleotides
8539-8554 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 8539-8554 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 118 or
119. In certain such embodiments, a short antisense compound
targeted to nucleotides 8539-8554 of SEQ ID NO: 1 is selected from
ISIS NO. 372863 or 372941.
[0383] In certain embodiments, a target region is nucleotides
9344-9359 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 9344-9359 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 120 or
121. In certain such embodiments, a short antisense compound
targeted to nucleotides 9344-9359 of SEQ ID NO: 1 is selected from
ISIS NO. 372871 or 372949.
[0384] In certain embodiments, a target region is nucleotides
9515-9530 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 9515-9530 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 122 or
123. In certain such embodiments, a short antisense compound
targeted to nucleotides 9515-9530 of SEQ ID NO: 1 is selected from
ISIS NO. 372872 or 372950.
[0385] In certain embodiments, a target region is nucleotides
9794-9809 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 9794-9809 of SEQ ID NO:
1 comprises a nucleotide sequence selected from SEQ ID NO 124 or
125. In certain such embodiments, a short antisense compound
targeted to nucleotides 9794-9809 of SEQ ID NO: 1 is selected from
ISIS NO. 372875 or 372953.
[0386] In certain embodiments, a target region is nucleotides
10157-10187 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 10157-10187 of SEQ ID
NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 126,
127, 128, 129, 130, 131, 132, or 133. In certain such embodiments,
a short antisense compound targeted to nucleotides 10157-10187 of
SEQ ID NO: 1 is selected from ISIS NO. 372877, 372955, 372878,
372956, 372879, 372957, 372880, or 372958.
[0387] In certain embodiments, a target region is nucleotides
10838-10859 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 10838-10859 of SEQ ID
NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 134,
135, 136, 137, 138, 139, 140, 141, or 142. In certain such
embodiments, a short antisense compound targeted to nucleotides
10838-10859 of SEQ ID NO: 1 is selected from ISIS NO. 346619,
346620, 346621, 346622, 346623, 346624, 346625, 346626, or
346627.
[0388] In certain embodiments, a target region is nucleotides
13689-13714 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 13689-13714 of SEQ ID
NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 143,
144, 145, 146, 147, or 148. In certain such embodiments, a short
antisense compound targeted to nucleotides 13689-13714 of SEQ ID
NO: 1 is selected from ISIS NO. 372890, 372968, 372891, 372969,
372892, or 372970.
[0389] In certain embodiments, a target region is nucleotides
13907-13928 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 13907-13928 of SEQ ID
NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 149,
150, 151, 152, 153, 154, 155, 156, or 157. In certain such
embodiments, a short antisense compound targeted to nucleotides
13907-13928 of SEQ ID NO: 1 is selected from ISIS NO. 346628,
346629, 346630, 346631, 346632, 346633, 346634, 346635, or
346636.
[0390] In certain embodiments, a target region is nucleotides
13963-13984 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 13963-13984 of SEQ ID
NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 158,
159, 160, 161, 162, 163, 164, 165, or 166. In certain such
embodiments, a short antisense compound targeted to nucleotides
13963-13984 of SEQ ID NO: 1 is selected from ISIS NO. 346637,
346638, 346639, 346640, 346641, 346642, 346643, 346644, or
346645.
[0391] In certain embodiments, a target region is nucleotides
14051-14072 of SEQ ID NO: 1. In certain such embodiments, a short
antisense compound targeted to nucleotides 14051-14072 of SEQ ID
NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 167,
168, 169, 170, 171, 172, 173, 174, or 175. In certain such
embodiments, a short antisense compound targeted to nucleotides
14051-14072 of SEQ ID NO: 1 is selected from ISIS NO. 346646,
346647, 346648, 346649, 346650, 346651, 346652, 346653, or
346654.
[0392] In certain embodiments, short antisense compounds targeted
to an ApoB nucleic acid are 8 to 16, preferably 9 to 15, more
preferably 9 to 14, more preferably 10 to 14 nucleotides in length.
In certain embodiments, short antisense compounds targeted to an
ApoB nucleic acid are 9 to 14 nucleotides in length. In certain
embodiments, short antisense compounds targeted to an ApoB nucleic
acid are 10 to 14 nucleotides in length. In certain embodiments,
such short antisense compounds are short antisense
oligonucleotides.
[0393] In certain embodiments, short antisense compounds targeted
to an ApoB nucleic acid are short gapmers. In certain such
embodiments, short gapmers targeted to an ApoB nucleic acid
comprise at least one high affinity modification in one or more
wings of the compound. In certain embodiments, short antisense
compounds targeted to an ApoB nucleic acid comprise 1 to 3
high-affinity modifications in each wing. In certain such
embodiments, the nucleosides or nucleotides of the wing comprise a
2' modification. In certain such embodiments, the monomers of the
wing are BNA's. In certain such embodiments, the monomers of the
wing are selected from .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2')
BNA, .beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA, Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') BNA, Aminooxy (4'-CH.sub.2--O--N(R)-2')
BNA and Oxyamino (4'-CH.sub.2--N(R)--O-2') BNA. In certain
embodiments, the monomers of a wing comprise a substituent at the
2' position selected from allyl, amino, azido, thio, O-allyl,
O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), and
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. In certain embodiments, the monomers of a
wing are 2'MOE nucleotides.
[0394] In certain embodiments, short antisense compounds targeted
to an ApoB nucleic acid comprise a gap between the 5' wing and the
3' wing. In certain embodiments the gap comprises five, six, seven,
eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
In certain embodiments, the monomers of the gap are unmodified
deoxyribonucleotides. In certain embodiments, the monomers of the
gap are unmodified ribonucleotides. In certain embodiments, gap
modifications (if any) gap result in an antisense compound that,
when bound to its target nucleic acid, supports cleavage by an
RNase, including, but not limited to, RNase H.
[0395] In certain embodiments, short antisense compounds targeted
to an ApoB nucleic acid have uniform monomeric linkages. In certain
such embodiments, those linkages are all phosphorothioate linkages.
In certain embodiments, the linkages are all phosphodiester
linkages. In certain embodiments, short antisense compounds
targeted to an ApoB nucleic acid have mixed backbones.
[0396] In certain embodiments, short antisense compounds targeted
to an ApoB nucleic acid are 8 monomers in length. In certain
embodiments, short antisense compounds targeted to an ApoB nucleic
acid are 9 monomers in length. In certain embodiments, short
antisense compounds targeted to an ApoB nucleic acid are 10
monomers in length. In certain embodiments, short antisense
compounds targeted to an ApoB nucleic acid are 11 monomers in
length. In certain embodiments, short antisense compounds targeted
to an ApoB nucleic acid are monomers in length. In certain
embodiments, short antisense compounds targeted to an ApoB nucleic
acid are 13 monomers in length. In certain embodiments, short
antisense compounds targeted to an ApoB nucleic acid are 14
monomers in length. In certain embodiments, short antisense
compounds targeted to an ApoB nucleic acid are 15 monomers in
length. In certain embodiments, short antisense compounds targeted
to an ApoB nucleic acid are 16 monomers in length. In certain
embodiments, short antisense compounds targeted to an ApoB nucleic
acid comprise 9 to 15 monomers. In certain embodiments, short
antisense compounds targeted to an ApoB nucleic acid comprise 10 to
15 monomers. In certain embodiments, short antisense compounds
targeted to an ApoB nucleic acid comprise 12 to 14 monomers. In
certain embodiments, short antisense compounds targeted to an ApoB
nucleic acid comprise 12 to 14 nucleotides or nucleosides.
[0397] In certain embodiments, the invention provides methods of
modulating expression of ApoB. In certain embodiments, such methods
comprise use of one or more short antisense compound targeted to an
ApoB nucleic acid, wherein the short antisense compound targeted to
an ApoB nucleic acid is from about 8 to about 16, preferably 9 to
15, more preferably 9 to 14, more preferably 10 to 14 monomers
(i.e. from about 8 to about 16 linked monomers). One of ordinary
skill in the art will appreciate that this comprehends methods of
modulating expression of ApoB using one or more short antisense
compounds targeted to an ApoB nucleic acid of 8, 9, 10, 11, 12, 13,
14, 15 or 16 monomers.
[0398] In certain embodiments, methods of modulating ApoB comprise
use of a short antisense compound targeted to an ApoB nucleic acid
that is 8 monomers in length. In certain embodiments, methods of
modulating ApoB comprise use of a short antisense compound targeted
to an ApoB nucleic acid that is 9 monomers in length. In certain
embodiments, methods of modulating ApoB comprise use of a short
antisense compound targeted to an ApoB nucleic acid that is 10
monomers in length. In certain embodiments, methods of modulating
ApoB comprise use of a short antisense compound targeted to an ApoB
nucleic acid that is 11 monomers in length. In certain embodiments,
methods of modulating ApoB comprise use of a short antisense
compound targeted to an ApoB nucleic acid that is 12 monomers in
length. In certain embodiments, methods of modulating ApoB comprise
use of a short antisense compound targeted to an ApoB nucleic acid
that is 13 monomers in length. In certain embodiments, methods of
modulating ApoB comprise use of a short antisense compound targeted
to an ApoB nucleic acid that is 14 monomers in length. In certain
embodiments, methods of modulating ApoB comprise use of a short
antisense compound targeted to an ApoB nucleic acid that is 15
monomers in length. In certain embodiments, methods of modulating
ApoB comprise use of a short antisense compound targeted to an ApoB
nucleic acid that is 16 monomers in length.
[0399] In certain embodiments, methods of modulating expression of
ApoB comprise use of a short antisense compound targeted to an ApoB
nucleic acid comprising 9 to 15 monomers. In certain embodiments,
methods of modulating expression of ApoB comprise use of a short
antisense compound targeted to an ApoB nucleic acid comprising 10
to 15 monomers. In certain embodiments, methods of modulating
expression of ApoB comprise use of a short antisense compound
targeted to an ApoB nucleic acid comprising 12 to 14 monomers. In
certain embodiments, methods of modulating expression of ApoB
comprise use of a short antisense compound targeted to an ApoB
nucleic acid comprising 12 or 14 nucleotides or nucleosides.
[0400] In certain embodiments, short antisense compounds targeting
a ApoB nucleic acid may have any one or more properties or
characteristics of the short antisense compounds generally
described herein. In certain embodiments, short antisense compounds
targeting a ApoB nucleic acid have a motif (wing-deoxy gap-wing)
selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2,
1-10-1, 1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more
preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.
[0401] 2. SGLT-2
[0402] Sodium dependent glucose transporter 2 (SGLT-2) is expressed
in the kidney proximal tubule epithelial cells, and functions to
reabsorb glucose preventing glucose loss in the urine. For the
human genome SGLT-2 is a member of an 11-membered family of sodium
substrate co-transporters. Many of these family members share
sequence homology, for example SGLT-1 shares about 59% sequence
identity with SGLT-2 and about 70% sequence identity with SGLT-3.
SGLT-1 is a glucose transporter found in the heart and the CNS.
SGLT-3 is a glucose sensing sodium channel in the small intestine.
The separate localization patterns for these SGLTs is one point of
distinction between the homologous family members. (Handlon, A. L.,
Expert Opin. Ther. Patents (2005) 15(11):1532-1540; Kanai et al.,
J. Clin. Invest., 1994, 93, 397-404; Wells et al., Am. J. Physiol.
Endocrinol. Metab., 1992, 263, F459-465).
[0403] Studies of human SGLT2 injected into Xenopus oocytes
demonstrated that this protein mediates sodium-dependent transport
of D-glucose and .alpha.-methyl-D-glucopyranoside (.alpha.-MeG1c; a
glucose analog) with a Km value of 1.6 mM for .alpha.-MeG1c and a
sodium to glucose coupling ratio of 1:1 (Kanai et al., J. Clin.
Invest., 1994, 93, 397-404; You et al., J. Biol. Chem., 1995, 270,
29365-29371). This transport activity was suppressed by phlorizin,
a plant glycoside that binds to the glucose site of the SGLTs but
is not transported and thus inhibits SGLT action (You et al., J.
Biol. Chem., 1995, 270, 29365-29371).
[0404] Diabetes is a disorder characterized by hyperglycemia due to
deficient insulin action. Chronic hyperglycemia is a major risk
factor for diabetes-associated complications, including heart
disease, retinopathy, nephropathy and neuropathy. As the kidneys
play a major role in the regulation of plasma glucose levels, renal
glucose transporters are becoming attractive drug targets (Wright,
Am. J. Physiol. Renal Physiol., 2001, 280, F10-18). Diabetic
nephropathy is the most common cause of end-stage renal disease
that develops in many patients with diabetes. Glucotoxicity, which
results from long-term hyperglycemia, induces tissue-dependent
insulin resistance in diabetic patients (Nawano et al., Am. J.
Physiol. Endocrinol. Metab., 2000, 278, E535-543).
Definitions
[0405] "Sodium dependent glucose transporter 2" is the gene product
or protein of which expression is to be modulated by administration
of a short antisense compound. Sodium dependent glucose transporter
2 is generally referred to as SGLT2 but may also be referred to as
SLC5A2; sodium-glucose transporter 2; sodium-glucose cotransporter,
kidney low affinity; sodium-glucose cotransporter, renal; solute
carrier family 5 (sodium/glucose cotransporter), member 2;
SL52.
[0406] "SGLT2 nucleic acid" means any nucleic acid encoding SGLT2.
For example, in certain embodiments, a SGLT2 nucleic acid includes,
without limitation, a DNA sequence encoding SGLT2, an RNA sequence
transcribed from DNA encoding SGLT2, and an mRNA sequence encoding
SGLT2. "SGLT2 mRNA" means an mRNA encoding a SGLT2 protein.
Therapeutic Indications
[0407] In certain embodiments, short antisense compounds are used
to modulate expression of SGLT-2 and related proteins. In certain
embodiments, such modulation is accomplished by providing short
antisense compounds that hybridize with one or more target nucleic
acid molecules encoding SGLT-2, including, but is not limited to,
SGLT2, SL52, SLC5A2, Sodium-Glucose Co-Transporter, Kidney Low
Affinity Sodium-Glucose Co-Transporter, Renal Sodium-Glucose
Co-Transporter 2 and Solute Carrier Family 5 Sodium/Glucose
Co-Transporter Member 2. Also provided are methods of treating
metabolic and/or cardiovascular disease and disorders as described
herein. In particular embodiments, short antisense compounds that
inhibit the expression of SGLT2 are used in methods of lowering
blood glucose levels in an animal and methods of delaying or
preventing the onset of type 2 diabetes. Such methods comprise
administering a therapeutically or prophylactically effective
amount of one or more of the compounds of the invention to the
animal, which may be in need of treatment. The one or more
compounds can be a short antisense compound targeting a nucleic
acid encoding SGLT2. Provided herein are methods of enhancing
inhibition of expression of SGLT2 in kidney cells or kidney
tissues, comprising contacting the cells or tissues with one or
more of the compounds of the invention, such as short antisense
compounds targeting a nucleic acid encoding SGLT2.
[0408] While certain compounds, compositions and methods have been
described with specificity in accordance with certain embodiments,
the following examples serve only to illustrate the compounds of
the invention and are not intended to limit the same.
[0409] In certain embodiments, short antisense compounds are
chimeric oligomeric compounds having mixed phosphorothioate and
phosphodiester backbones. Certain mixed backbone short antisense
compounds have a central gap comprising at least 5 contiguous
2'-deoxy nucleosides flanked by two wings each of which comprises
at least one 2'-O-methoxyethyl nucleoside. In certain embodiments,
the internucleoside linkages of the mixed backbone compounds are
phosphorothioate linkages in the gap and phosphodiester linkages in
the two wings. In certain embodiments, mixed backbone compounds
have phosphorothioate linkages in the wings, except for one
phosphodiester linkage at one or both of the extreme 5' and 3' ends
of the oligonucleotide. In certain embodiments short antisense
compounds targeted to SGLT2 have a motif (wing-deoxy gap-wing)
selected from 3-10-3, 2-10-3, 2-10-2, 1-10-1, 1-10-2, 2-8-2, 1-9-2,
1-8-1, 3-6-3 or 1-6-1. In certain embodiments short antisense
compounds targeted to SGLT2 have a motif (wing-deoxy gap-wing)
selected from 1-10-1, 1-10-2, 2-8-2, 1-9-2, 1-8-1, 3-6-3 or
1-6-1.
[0410] In certain embodiments, short antisense compounds targeted
to an SGLT2 nucleic acid and having a mixed backbone are
efficiently delivered to the kidney. In certain embodiments,
administration of short antisense compounds targeted to an SGLT2
nucleic acid and having a mixed backbone results in modulation of
target gene expression in the kidney. In certain such embodiments,
there is little or no liver or kidney toxicity. In certain
embodiments, short antisense compounds targeted to an SGLT2 nucleic
acid and having a mixed backbone are more potent for reducing
SGLT-2 mRNA and have a faster onset compared with a short antisense
compound that does not have a mixed back-bone, but is otherwise
identical. In certain such embodiments, such increase potency
and/or reduced toxicity is in mouse and/or rat. In certain such
embodiments, such increase potency and/or reduced toxicity is in a
human.
[0411] By way of example, and only for illustrative purposes, ISIS
145733, which comprises uniform phosphorothioate linkages and ISIS
257016 which comprises phosphodiester linkage in the wings and
phosphorothioate linkages in the gap, are otherwise identical. Both
comprise the sequence GAAGTAGCCACCAACTGTGC (SEQ ID NO. 1572). Both
of the oligonucleotides further comprise a gap consisting of ten
2'-deoxynucleotides, flanked on each side by five-nucleotide
"2'-methoxyethyl (2'-MOE) nucleotides. All cytidine residues are
5-methylcytidines. The mixed back-bone compound, ISIS 257016, was
about 50 times more potent for reducing SGLT-2 mRNA compared to the
non-mixed parent compound, ISIS 145733 (see EXAMPLE 9).
[0412] Pharmacokinetic studies of certain mixed backbone compound
ISIS 257016 indicate that in certain embodiments, the compound acts
as a prodrug that is metabolized to a 12 nucleobase pharmacophore.
Studies with ISIS 370717, a 12 nucleobase short antisense compound
corresponding to ISIS 257016, show that the compound has a similar
pharmacological profile to ISIS 257016 but with a faster onset of
action. ISIS 370717 is a 12 nucleobase antisense oligonucleotide
targeted to SGLT-2 comprising the sequence TAGCCACCAACT (SEQ ID NO.
1554), further comprising a gap consisting of ten
2'-deoxynucleotides, flanked on both sides by one-nucleotide wings.
The wings are composed of 2'-methoxyethyl (2'-MOE) nucleotides. All
cytidine residues are 5-methylcytidines. The internucleoside
linkages are phosphorothioate (P.dbd.S) throughout the
oligonucleotide. The similarity in pharmacological activity of ISIS
257016 and ISIS 370717 supports the pharmacokinetic studies
indicating ISIS 257016 was a prodrug having a 12 nucleotide
pharmacophore (see EXAMPLE 10). Further, studies with stabilized
(end-capped) versions of ISIS 257016 show dramatic loss of
activity.
[0413] In certain embodiments, short antisense compounds comprising
2' MOE monomers in the wings are efficiently delivered to the
kidney and treatment with such compounds results in efficient
modulation of target gene expression in the kidney without liver or
kidney toxicity. It is further shown herein that in certain
embodiments, short antisense compounds are more potent for reducing
SGLT-2 mRNA and have a faster onset compared with parent
oligonucleotides targeted to SGLT-2 mRNA in mouse and rat. 2' MOE
gap shortmers are shown herein to improve potency and
bioavailability over parent compounds.
[0414] By way of example, and only for illustrative purposes
studies with ISIS 370717 reveal significantly higher accumulation
of the short antisense compound in the kidney tissue (approximately
500 micro grams per gram of tissue) compared to the longer parent.
Moreover, SGLT-2 mRNA was reduced by more than 80% over the
controls (see EXAMPLE 11). ISIS 370717 1-10-1 gapmer was used as a
template to make sequence related oligos with varying motifs.
Studies evaluating wing, gap and total length variations around the
ISIS 370717 12 mer oligonucleotide can be seen in EXAMPLE 12.
Certain motifs evaluated included 1-10-1, 2-8-2, 1-8-1, 3-6-3, and
1-6-1 (see Table 60 in EXAMPLE 12). The compounds were analyzed for
their effect on SGLT2 mRNA levels. All the motifs inhibited the
expression of SGLT2 in vivo in a dose-dependent manner. The 1-10-1,
2-8-2 and 1-8-1 gapmers were found to be particularly potent.
SGLT-2 mRNA was reduced by more than 80% over the controls using
these motifs.
[0415] In certain embodiments, the invention provides short
antisense compounds targeted to an SGLT2 nucleic acid and having a
motif selected from: 1-10-1 and 1-10-2 MOE gapmer. (see Table 62 in
EXAMPLE 13). Certain such compounds were analyzed for their effect
on rat SGLT2 mRNA. Results in Table 63 illustrate that both the
1-10-1 and 1-10-2 MOE gapmers inhibit the expression of SGLT2 in
vivo in a dose-dependent manner and over 80% reduction of SGLT-2
mRNA could be achieved.
[0416] Certain additional 1-10-1 and 2-8-2 MOE gapmers were
evaluated in both mouse and rat in vivo models (see, e.g., EXAMPLE
14 and 15). Greater than 80% reduction in SGLT-2 mRNA was achieved
with many of the 1-10-1 and 2-8-2 MOE gapmers at relatively low
concentrations of oligo and in the absence of any toxicity
effects.
[0417] In another non-limiting example, the effect of ISIS 388625
on dog SGLT2 mRNA levels was also analyzed. Dog studies illustrate
that greater than 80% inhibition of the expression of SGLT2 can be
achieved at a 1 mg/kg/wk dose. Even greater inhibition can be
achieved at slightly higher doses. Administration of ISIS 388625 in
dog was also shown to improved glucose tolerance. Peak plasma
glucose levels were decreased by over 50% on average and the
subsequent drop in glucose was lessened compared to saline controls
in a standard glucose tolerance test (See EXAMPLE 17). Also, in a
rat model of diabetes, short antisense compounds were shown to
significantly decrease plasma glucose levels and HbA1C over time
compared to PBS and control treated animals (See Example 16).
[0418] The animals in all studies were further evaluated for
toxicity. For example, total body weight, liver, spleen and kidney
weight were evaluated. Significant changes in spleen, liver or body
weight can indicate that a particular compound causes toxic
effects. All changes were found to be within the margin of error.
No significant changes in body weight were observed during the
treatment or at study termination. No significant changes in liver
or spleen weights were observed.
Certain Short Antisense Compounds Targeted to an SGLT2 Nucleic
Acid
[0419] In certain embodiments, short antisense compounds are
targeted to an SGLT2 nucleic acid having the sequence of
GENBANK.RTM.V Accession No. NM.sub.--003041.1, incorporated herein
as SEQ ID NO: 2. In certain such embodiments, a short antisense
compound targeted to SEQ ID NO: 3 is at least 90% complementary to
SEQ ID NO: 3. In certain such embodiments, a short antisense
compound targeted to SEQ ID NO: 3 is at least 95% complementary to
SEQ ID NO: 3. In certain such embodiments, a short antisense
compound targeted to SEQ ID NO: 3 is 100% complementary to SEQ ID
NO: 1. In certain embodiments, a short antisense compound targeted
to SEQ ID NO: 3 comprises a nucleotide sequence selected from the
nucleotide sequences set forth in Table 4 and 5.
[0420] The nucleotide sequence set forth in each SEQ ID NO set
forth in Tables 4 and 5 is independent of any modification to a
sugar moiety, a monomeric linkage, or a nucleobase. As such, short
antisense compounds defined by a SEQ ID NO may comprise,
independently, one or more modifications to a sugar moiety, an
internucleoside linkage, or a nucleobase. Antisense compounds
described by Isis Number (Isis NO.) indicate a combination of
nucleobase sequence and one or more modifications to a sugar
moiety, an internucleoside linkage, or a nucleobase.
[0421] Tables 4 and 5 illustrate examples of short antisense
compounds targeted to SEQ ID NO: 3. Table 4 illustrates short
antisense compounds that are 100% complementary to SEQ ID NO: 3.
Table 5 illustrates short antisense compounds that have one or two
mismatches with respect to SEQ ID NO: 3. The column labeled `gapmer
motif` indicates the wing-gap-wing motif of each short antisense
compounds. The gap segment comprises 2'-deoxynucleotides and each
nucleotide of each wing segment comprises a 2'-modified sugar. The
particular 2'-modified sugar is also indicated in the `gapmer
motif` column. For example, `2-10-2 MOE` means a 2-10-2 gapmer
motif, where a gap segment of ten 2'-deoxynucleotides is flanked by
wing segments of two nucleotides, where the nucleotides of the wing
segments are 2'-MOE nucleotides. Internucleoside linkages are
phosphorothioate. The short antisense compounds comprise
5-methylcytidine in place of unmodified cytosine, unless
"unmodified cytosine" is listed in the gapmer motif column, in
which case the indicated cytosines are unmodified cytosines. For
example, "5-mC in gap only" indicates that the gap segment has
5-methylcytosines, while the wing segments have unmodified
cytosines.
TABLE-US-00007 TABLE 4 Short Antisense Compounds Targeted to SEQ ID
NO: 3 5' 3' SEQ ISIS Target Target Sequence ID No Site Site (5'-3')
Gapmer Motif NO 379684 84 95 TGTCAGCAGGAT 1-10-1 MOE 214 405193 113
124 CAGCAGGAAATA 2-8-2 MOE 215 405194 114 125 CCAGCAGGAAAT 2-8-2
MOE 216 405195 115 126 ACCAGCAGGAAA 2-8-2 MOE 217 405196 116 127
GACCAGCAGGAA 2-8-2 MOE 218 405197 117 128 TGACCAGCAGGA 2-8-2 MOE
219 379685 117 128 TGACCAGCAGGA 1-10-1 MOE 219 405198 118 129
ATGACCAGCAGG 2-8-2 MOE 221 405199 119 130 AATGACCAGCAG 2-8-2 MOE
222 405200 120 131 CAATGACCAGCA 2-8-2 MOE 223 405201 121 132
CCAATGACCAGC 2-8-2 MOE 224 379686 135 146 ACCACAAGCCAA 1-10-1 MOE
225 379711 172 183 TAGCCGCCCACA 1-10-1 MOE 226 388628 172 183
TAGCCGCCCACA 2-8-2 MOE 226 405202 207 218 CCGGCCACCACA 2-8-2 MOE
228 405203 208 219 ACCGGCCACCAC 2-8-2 MOE 229 405204 236 247
GATGTTGCTGGC 2-8-2 MOE 230 379687 236 247 GATGTTGCTGGC 1-10-1 MOE
230 405205 237 248 CGATGTTGCTGG 2-8-2 MOE 232 405206 238 249
CCGATGTTGCTG 2-8-2 MOE 233 405207 239 250 GCCGATGTTGCT 2-8-2 MOE
234 405208 240 251 TGCCGATGTTGC 2-8-2 MOE 235 405209 241 252
CTGCCGATGTTG 2-8-2 MOE 236 405210 260 271 CAGGCCCACAAA 2-8-2 MOE
237 405211 261 272 CCAGGCCCACAA 2-8-2 MOE 238 405212 262 273
GCCAGGCCCACA 2-8-2 MOE 239 379688 288 299 CCAAGCCACTTG 1-10-1 MOE
240 379689 318 329 AGAGCGCATTCC 1-10-1 MOE 241 379690 435 446
ACAGGTAGAGGC 1-10-1 MOE 242 405248 474 485 AGATCTTGGTGA 2-8-2 MOE
243 379691 474 485 AGATCTTGGTGA 1-10-1 MOE 243 382676 527 539
TGTTCCAGCCCAG 1-10-2 MOE 245 388625 528 539 TGTTCCAGCCCA 2-8-2 MOE
246 389780 528 539 TGTTCCAGCCCA 1-9-2 MOE 246 379692 528 539
TGTTCCAGCCCA 1-10-1 MOE 246 392170 528 539 TGTTCCAGCCCA 1-10-1 246
Methyleneoxy BNA 392173 528 539 TGTTCCAGCCCA 2-8-2 246 Methyleneoxy
BNA 405213 529 540 ATGTTCCAGCCC 2-8-2 MOE 251 405214 564 575
TGGTGATGCCCA 2-8-2 MOE 252 405215 565 576 ATGGTGATGCCC 2-8-2 MOE
253 405216 566 577 CATGGTGATGCC 2-8-2 MOE 254 379693 566 577
CATGGTGATGCC 1-10-1 MOE 254 405217 567 578 TCATGGTGATGC 2-8-2 MOE
256 405218 568 579 ATCATGGTGATG 2-8-2 MOE 257 405219 587 598
CCCTCCTGTCAC 2-8-2 MOE 258 405220 588 599 GCCCTCCTGTCA 2-8-2 MOE
259 405221 589 600 AGCCCTCCTGTC 2-8-2 MOE 260 405222 590 601
CAGCCCTCCTGT 2-8-2 MOE 261 405223 591 602 CCAGCCCTCCTG 2-8-2 MOE
262 405224 592 603 GCCAGCCCTCCT 2-8-2 MOE 263 379694 629 640
GACGAAGGTCTG 1-10-1 MOE 264 405225 707 718 GTATTTGTCGAA 2-8-2 MOE
265 379695 737 748 GGACACCGTCAG 1-10-1 MOE 266 379696 974 985
CAGCTTCAGGTA 1-10-1 MOE 267 405226 998 1009 CATGACCATGAG 2-8-2 MOE
268 405227 999 1010 GCATGACCATGA 2-8-2 MOE 269 405228 1000 1011
GGCATGACCATG 2-8-2 MOE 270 405229 1001 1012 TGGCATGACCAT 2-8-2 MOE
271 405230 1002 1013 CTGGCATGACCA 2-8-2 MOE 272 379697 1002 1013
CTGGCATGACCA 1-10-1 MOE 272 405231 1003 1014 CCTGGCATGACC 2-8-2 MOE
274 379698 1091 1102 GCAGCCCACCTC 1-10-1 MOE 275 405232 1092 1103
AGCAGCCCACCT 2-8-2 MOE 276 405233 1093 1104 GAGCAGCCCACC 2-8-2 MOE
277 405234 1130 1141 CATGAGCTTCAC 2-8-2 MOE 278 405235 1131 1142
GCATGAGCTTCA 2-8-2 MOE 279 382677 1131 1143 GGCATGAGCTTCA 1-10-2
MOE 280 388626 1132 1143 GGCATGAGCTTC 2-8-2 MOE 281 379699 1132
1143 GGCATGAGCTTC 1-10-1 MOE 281 405236 1133 1144 GGGCATGAGCTT
2-8-2 MOE 283 405237 1157 1168 CAGCATGAGTCC 2-8-2 MOE 284 405238
1158 1169 CCAGCATGAGTC 2-8-2 MOE 285 379700 1158 1169 CCAGCATGAGTC
1-10-1 MOE 285 405239 1159 1170 GCCAGCATGAGT 2-8-2 MOE 287 379701
1230 1241 CCATGGTGAAGA 1-10-1 MOE 288 405240 1542 1553 CACAGCTGCCCG
2-8-2 MOE 289 405241 1543 1554 ACACAGCTGCCC 2-8-2 MOE 290 405242
1544 1555 CACACAGCTGCC 2-8-2 MOE 291 382678 1544 1556 GCACACAGCTGCC
1-10-2 MOE 292 388627 1545 1556 GCACACAGCTGC 2-8-2 MOE 293 379702
1545 1556 GCACACAGCTGC 1-10-1 MOE 293 379703 1701 1712 GCCGGAGACTGA
1-10-1 MOE 295 405243 1976 1987 ATTGAGGTTGAC 2-8-2 MOE 296 405244
1977 1988 CATTGAGGTTGA 2-8-2 MOE 297 405245 1978 1989 GCATTGAGGTTG
2-8-2 MOE 298 405246 1979 1990 GGCATTGAGGTT 2-8-2 MOE 299 405247
1980 1991 GGGCATTGAGGT 2-8-2 MOE 300
TABLE-US-00008 TABLE 5 Short antisense compounds targeted to SEQ ID
NO: 3 and having 1 or 2 mismatches 5' 3' SEQ ISIS Target Target
Gapmer ID No Site Site Sequence (5'-3') Motif NO 405200 96 107
CAATGACCAGCA 2-8-2 MOE 223 405215 382 393 ATGGTGATGCCC 2-8-2 MOE
253 405216 383 394 CATGGTGATGCC 2-8-2 MOE 254 379693 383 394
CATGGTGATGCC 1-10-1 MOE 254 379701 471 482 CCATGGTGAAGA 1-10-1 MOE
288 405218 472 483 ATCATGGTGATG 2-8-2 MOE 257 405246 536 547
GGCATTGAGGTT 2-8-2 MOE 299 405248 570 581 AGATCTTGGTGA 2-8-2 MOE
243 379691 570 581 AGATCTTGGTGA 1-10-1 MOE 243 379698 683 694
GCAGCCCACCTC 1-10-1 MOE 275 405232 684 695 AGCAGCCCACCT 2-8-2 MOE
276 379711 685 696 TAGCCGCCCACA 1-10-1 MOE 226 388628 685 696
TAGCCGCCCACA 2-8-2 MOE 226 379698 950 961 GCAGCCCACCTC 1-10-1 MOE
275 405232 951 962 AGCAGCCCACCT 2-8-2 MOE 276 405235 978 989
GCATGAGCTTCA 2-8-2 MOE 279 382677 978 990 GGCATGAGCTTCA 1-10-2 MOE
280 388626 979 990 GGCATGAGCTTC 2-8-2 MOE 281 379699 979 990
GGCATGAGCTTC 1-10-1 MOE 281 405236 980 991 GGGCATGAGCTT 2-8-2 MOE
283 379698 1043 1054 GCAGCCCACCTC 1-10-1 MOE 275 405239 1171 1182
GCCAGCATGAGT 2-8-2 MOE 287 405209 1213 1224 CTGCCGATGTTG 2-8-2 MOE
236 405233 1364 1375 GAGCAGCCCACC 2-8-2 MOE 277 405240 1366 1377
CACAGCTGCCCG 2-8-2 MOE 289 405211 1500 1511 CCAGGCCCACAA 2-8-2 MOE
238 405212 1501 1512 GCCAGGCCCACA 2-8-2 MOE 239 379695 1643 1654
GGACACCGTCAG 1-10-1 MOE 266 379698 1875 1886 GCAGCCCACCTC 1-10-1
MOE 275 405239 1993 2004 GCCAGCATGAGT 2-8-2 MOE 287 405211 2210
2221 CCAGGCCCACAA 2-8-2 MOE 238 405212 2211 2222 GCCAGGCCCACA 2-8-2
MOE 239
[0422] In certain embodiments, a target region is nucleotides
85-184 of SEQ ID NO: 3. In certain embodiments, a short antisense
compound is targeted to nucleotides 85-184 of SEQ ID NO: 3. In
certain such embodiments, a short antisense compound targeted to
nucleotides 85-184 comprises a nucleotide sequence selected from
SEQ ID NO 214, 215, 216, 217, 218, 219, 221, 222, 223, 224, 225, or
227. In certain such embodiments, a short antisense compound
targeted to nucleotides 85-184 of SEQ ID NO: 3 is selected from
Isis No 379684, 405193, 405194, 405195, 405196, 405197, 379685,
405198, 405199, 405200, 405201, 379686, 379711 or 388628.
[0423] In certain embodiments, a target region is nucleotides
113-132 of SEQ ID NO: 3. In certain embodiments, a short antisense
compound is targeted to nucleotides 113-132 of SEQ ID NO: 3. In
certain such embodiments, a short antisense compound targeted to
nucleotides 113-132 comprises a nucleotide sequence selected from
SEQ ID NO 215, 216, 217, 218, 219, 221, 222, 223, or 224. In
certain such embodiments, a short antisense compound targeted to
nucleotides 113-132 of SEQ ID NO: 3 is selected from Isis No
405193, 405194, 405195, 405196, 405197, 379685, 405198, 405199,
405200, or 405201.
[0424] In certain embodiments, a target region is nucleotides
207-329 of SEQ ID NO: 3. In certain embodiments, a short antisense
compound is targeted to nucleotides 207-329 of SEQ ID NO: 3. In
certain such embodiments, a short antisense compound targeted to
nucleotides 207-329 comprises a nucleotide sequence selected from
SEQ ID NO 228, 229, 230, 232, 233, 234, 235, 236, 237, 238, 239,
240, or 241. In certain such embodiments, a short antisense
compound targeted to nucleotides 207-329 of SEQ ID NO: 3 is
selected from Isis No 405202, 405203, 405204, 379687, 405205,
405206, 405207, 405208, 405209, 405210, 405211, 405212, 379688, or
379689.
[0425] In certain embodiments, a target region is nucleotides
207-273 of SEQ ID NO: 3. In certain embodiments, a short antisense
compound is targeted to nucleotides 207-273 of SEQ ID NO: 3. In
certain such embodiments, a short antisense compound targeted to
nucleotides 207-273 comprises a nucleotide sequence selected from
SEQ ID NO 228, 229, 230, 232, 233, 234, 235, 236, 237, 238, or 239.
In certain such embodiments, a short antisense compound targeted to
nucleotides 207-273 of SEQ ID NO: 3 is selected from Isis No
405202, 405203, 405204, 379687, 405205, 405206, 405207, 405208,
405209, 405210, 405211, or 405212.
[0426] In certain embodiments, a target region is nucleotides
207-219 of SEQ ID NO: 3. In certain embodiments, a short antisense
compound is targeted to nucleotides 207-219 of SEQ ID NO: 3. In
certain such embodiments, a short antisense compound targeted to
nucleotides 207-219 comprises a nucleotide sequence selected from
SEQ ID NO 228 or 229. In certain such embodiments, a short
antisense compound targeted to nucleotides 207-219 of SEQ ID NO: 3
is selected from Isis NO. 405202 or 405203.
[0427] In certain embodiments, a target region is nucleotides
236-252 of SEQ ID NO: 3. In certain embodiments, a short antisense
compound is targeted to nucleotides 236-252 of SEQ iD NO: 3. In
certain such embodiments, a short antisense compound targeted to
nucleotides 236-252 comprises a nucleotide sequence selected from
SEQ ID NO 230, 232, 233, 234, 235, or 236. In certain such
embodiments, a short antisense compound targeted to nucleotides
236-252 of SEQ ID NO: 3 is selected from Isis NO. 405204, 379687,
405205, 405206, 405207, 405208, or 405209.
[0428] In certain embodiments, a target region is nucleotides
260-273 of SEQ ID NO: 3. In certain embodiments, a short antisense
compound is targeted to nucleotides 260-273 of SEQ ID NO: 3. In
certain such embodiments, a short antisense compound targeted to
nucleotides 260-273 comprises a nucleotide sequence selected from
SEQ ID NO 237, 238, or 239. In certain such embodiments, a short
antisense compound targeted to nucleotides 260-273 of SEQ ID NO: 3
is selected from Isis NO. 405210, 405211, or 405212.
[0429] In certain embodiments, a target region is nucleotides
435-640 of SEQ ID NO: 3. In certain embodiments, a short antisense
compound is targeted to nucleotides 435-640 of SEQ ID NO: 3. In
certain such embodiments, a short antisense compound targeted to
nucleotides 435-640 comprises a nucleotide sequence selected from
SEQ ID NO 242, 243, 245, 246, 251, 252, 253, 254, 256, 257, 258,
259, 260, 261, 262, 263, or 264. In certain such embodiments, a
short antisense compound targeted to nucleotides 435-640 of SEQ ID
NO: 3 is selected from Isis NO. 379690, 405248, 379691, 389780,
379692, 382676, 388625, 392170, 392173, 405213, 405214, 405215,
405216, 379693, 405217, 405218, 405219, 405220, 405221, 405222,
405223, 405224, or 379694.
[0430] In certain embodiments, a target region is nucleotides
527-540 of SEQ ID NO: 3. In certain embodiments, a short antisense
compound is targeted to nucleotides 527-540 of SEQ ID NO: 3. In
certain such embodiments, a short antisense compound targeted to
nucleotides 527-540 comprises a nucleotide sequence selected from
SEQ ID NO 245, 246, or 251. In certain such embodiments, a short
antisense compound targeted to nucleotides 527-540 of SEQ ID NO: 3
is selected from Isis NO. 389780, 379692, 382676, 388626, 392170,
392173, or 405213.
[0431] In certain embodiments, a target region is nucleotides
564-603 of SEQ ID NO: 3. In certain embodiments, a short antisense
compound is targeted to nucleotides 564-603 of SEQ ID NO: 3. In
certain such embodiments, a short antisense compound targeted to
nucleotides 564-603 comprises a nucleotide sequence selected from
SEQ ID NO 252, 253, 254, 256, 257, 258, 259, 260, 261, 262, or 263.
In certain such embodiments, a short antisense compound targeted to
nucleotides 564-603 of SEQ ID NO: 3 is selected from Isis NO.
405214, 405215, 405216, 379693, 405217, 405218, 405219, 405220,
405221, 405222, 405223, or 405224.
[0432] In certain embodiments, a target region is nucleotides
564-579 of SEQ ID NO: 3. In certain embodiments, a short antisense
compound is targeted to nucleotides 564-579 of SEQ ID NO: 3. In
certain such embodiments, a short antisense compound targeted to
nucleotides 564-579 comprises a nucleotide sequence selected from
SEQ ID NO 252, 253, 254, 256, or 257. In certain such embodiments,
a short antisense compound targeted to nucleotides 564-579 of SEQ
ID NO: 3 is selected from Isis NO. 405214, 405215, 405216, 379693,
405217, or 405218.
[0433] In certain embodiments, a target region is nucleotides
587-603 of SEQ ID NO: 3. In certain embodiments, a short antisense
compound is targeted to nucleotides 587-603 of SEQ ID NO: 3. In
certain such embodiments, a short antisense compound targeted to
nucleotides 587-603 comprises a nucleotide sequence selected from
SEQ ID NO 258, 259, 260, 261, 262, or 263. In certain such
embodiments, a short antisense compound targeted to nucleotides
587-603 of SEQ ID NO: 3 is selected from Isis NO. 405219, 405220,
405221, 405222, 405223, or 405224.
[0434] In certain embodiments, a target region is nucleotides
974-1014 of SEQ ID NO: 3. In certain embodiments, a short antisense
compound is targeted to nucleotides 974-1014 of SEQ ID NO: 3. In
certain such embodiments, a short antisense compound targeted to
nucleotides 974-1014 comprises a nucleotide sequence selected from
SEQ ID NO 267, 268, 269, 270, 271, 272, or 274. In certain such
embodiments, a short antisense compound targeted to nucleotides
974-1014 of SEQ ID NO: 3 is selected from Isis NO. 379696, 405226,
405227, 405228, 405229, 405230, 379697, or 405231.
[0435] In certain embodiments, a target region is nucleotides
998-1014 of SEQ ID NO: 3. In certain embodiments, a short antisense
compound is targeted to nucleotides 998-1014 of SEQ ID NO: 3. In
certain such embodiments, a short antisense compound targeted to
nucleotides 998-1014 comprises a nucleotide sequence selected from
SEQ ID NO 268, 269, 270, 271, 272, or 274. In certain such
embodiments, a short antisense compound targeted to nucleotides
998-1014 of SEQ ID NO: 3 is selected from Isis NO. 405226, 405227,
405228, 405229, 405230, 379697, or 405231.
[0436] In certain embodiments, a target region is nucleotides
1091-1170 of SEQ ID NO: 3. In certain embodiments, a short
antisense compound is targeted to nucleotides 1091-1170 of SEQ ID
NO: 3. In certain such embodiments, a short antisense compound
targeted to nucleotides 1091-1170 comprises a nucleotide sequence
selected from SEQ ID NO 275, 276, 277, 278, 279, 280, 281, 283,
284, 285, 286, or 287. In certain such embodiments, a short
antisense compound targeted to nucleotides 1091-1170 of SEQ ID NO:
3 is selected from Isis NO. 379698, 405232, 405233, 405234, 405235,
388626, 379699, 382677, 405236, 405237, 405238, 379700, or
405239.
[0437] In certain embodiments, a target region is nucleotides
1091-1104 of SEQ ID NO: 3. In certain embodiments, a short
antisense compound is targeted to nucleotides 1091-1104 of SEQ ID
NO: 3. In certain such embodiments, a short antisense compound
targeted to nucleotides 1091-1104 comprises a nucleotide sequence
selected from SEQ ID NO 275, 276, or 277. In certain such
embodiments, an short antisense compound targeted to nucleotides
1091-1104 of SEQ ID NO: 3 is selected from Isis NO. 379698, 405232,
or 405233.
[0438] In certain embodiments, a target region is nucleotides
1130-1144 of SEQ ID NO: 3. In certain embodiments, a short
antisense compound is targeted to nucleotides 1130-1144 of SEQ ID
NO: 3. In certain such embodiments, a short antisense compound
targeted to nucleotides 1130-1144 comprises a nucleotide sequence
selected from SEQ ID NO 278, 279, 280, 281, or 283. In certain such
embodiments, a short antisense compound targeted to nucleotides
1130-1144 of SEQ ID NO: 3 is selected from Isis NO. 405234, 405235,
388626, 379699, 382677, or 405236.
[0439] In certain embodiments, a target region is nucleotides
1157-1170 of SEQ ID NO: 3. In certain embodiments, a short
antisense compound is targeted to nucleotides 1157-1170 of SEQ ID
NO: 3. In certain such embodiments, a short antisense compound
targeted to nucleotides 1157-1170 comprises a nucleotide sequence
selected from SEQ ID NO 284, 285, or 287. In certain such
embodiments, a short antisense compound targeted to nucleotides
1157-1170 of SEQ ID NO: 3 is selected from Isis NO. 405237, 405238,
379700, or 405239.
[0440] In certain embodiments, a target region is nucleotides
1542-1556 of SEQ ID NO: 3. In certain embodiments, a short
antisense compound is targeted to nucleotides 1542-1556 of SEQ ID
NO: 3. In certain such embodiments, a short antisense compound
targeted to nucleotides 1542-1556 comprises a nucleotide sequence
selected from SEQ ID NO 289, 290, 291, 292, or 293. In certain such
embodiments, a short antisense compound targeted to nucleotides
1542-1556 of SEQ ID NO: 3 is selected from Isis NO. 405240, 405241,
405242, 388629, 379702, or 382678.
[0441] In certain embodiments, a target region is nucleotides
1976-1991 of SEQ ID NO: 3. In certain embodiments, a short
antisense compound is targeted to nucleotides 1976-1991 of SEQ ID
NO: 3. In certain such embodiments, a short antisense compound
targeted to nucleotides 1976-1991 comprises a nucleotide sequence
selected from SEQ ID NO 296, 297, 298, 299, or 300. In certain such
embodiments, a short antisense compound targeted to nucleotides
1976-1991 of SEQ ID NO: 3 is selected from Isis NO. 405243, 405244,
405245, 405246, or 405247.
[0442] In certain embodiments, short antisense compounds targeted
to an SGLT2 nucleic acid are 8 to 16, preferably 9 to 15, more
preferably 9 to 14, more preferably 10 to 14 nucleotides in length.
In certain embodiments, short antisense compounds targeted to an
SGLT2 nucleic acid are 9 to 14 nucleotides in length. In certain
embodiments, short antisense compounds targeted to an SGLT2 nucleic
acid are 10 to 14 nucleotides in length. In certain embodiments,
such short antisense compounds are short antisense
oligonucleotides.
[0443] In certain embodiments, short antisense compounds targeted
to an SGLT2 nucleic acid are short gapmers. In certain such
embodiments, short gapmers targeted to an SGLT2 nucleic acid
comprise at least one high affinity modification in one or more
wings of the compound. In certain embodiments, short antisense
compounds targeted to an SGLT2 nucleic acid comprise 1 to 3
high-affinity modifications in each wing. In certain such
embodiments, the nucleosides or nucleotides of the wing comprise a
2' modification. In certain such embodiments, the monomers of the
wing are BNA's. In certain such embodiments, the monomers of the
wing are selected from .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2')
BNA, .beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA, Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') BNA, Aminooxy (4'-CH.sub.2--O--N(R)-2')
BNA and Oxyamino (4'-CH.sub.2--N(R)--O-2') BNA. In certain
embodiments, the monomers of a wing comprise a substituent at the
2' position selected from allyl, amino, azido, thio, O-allyl,
O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), and
O--CH.sub.2--C(.dbd.O)--N(R.sub.n)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. In certain embodiments, the monomers of a
wing are 2'MOE nucleotides.
[0444] In certain embodiments, short antisense compounds targeted
to an SGLT2 nucleic acid comprise a gap between the 5' wing and the
3' wing. In certain embodiments the gap comprises five, six, seven,
eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
In certain embodiments, the monomers of the gap are unmodified
deoxyribonucleotides. In certain embodiments, the monomers of the
gap are unmodified ribonucleotides. In certain embodiments, gap
modifications (if any) gap result in an antisense compound that,
when bound to its target nucleic acid, supports cleavage by an
RNase, including, but not limited to, RNase H.
[0445] In certain embodiments, short antisense compounds targeted
to an SGLT2 nucleic acid have uniform monomeric linkages. In
certain such embodiments, those linkages are all phosphorothioate
linkages. In certain embodiments, the linkages are all
phosphodiester linkages. In certain embodiments, short antisense
compounds targeted to an SGLT2 nucleic acid have mixed
backbones.
[0446] In certain embodiments, short antisense compounds targeted
to an SGLT2 nucleic acid are 8 monomers in length. In certain
embodiments, short antisense compounds targeted to an SGLT2 nucleic
acid are 9 monomers in length. In certain embodiments, short
antisense compounds targeted to an SGLT2 nucleic acid are 10
monomers in length. In certain embodiments, short antisense
compounds targeted to an SGLT2 nucleic acid are 11 monomers in
length. In certain embodiments, short antisense compounds targeted
to an SGLT2 nucleic acid are monomers in length. In certain
embodiments, short antisense compounds targeted to an SGLT2 nucleic
acid are 13 monomers in length. In certain embodiments, short
antisense compounds targeted to an SGLT2 nucleic acid are 14
monomers in length. In certain embodiments, short antisense
compounds targeted to an SGLT2 nucleic acid are 15 monomers in
length. In certain embodiments, short antisense compounds targeted
to an SGLT2 nucleic acid are 16 monomers in length. In certain
embodiments, short antisense compounds targeted to an SGLT2 nucleic
acid comprise 9 to 15 monomers. In certain embodiments, short
antisense compounds targeted to an SGLT2 nucleic acid comprise 10
to 15 monomers. In certain embodiments, short antisense compounds
targeted to an SGLT2 nucleic acid comprise 12 to 14 monomers. In
certain embodiments, short antisense compounds targeted to an SGLT2
nucleic acid comprise 12 to 14 nucleotides or nucleosides.
[0447] In certain embodiments, the invention provides methods of
modulating expression of SGLT2. In certain embodiments, such
methods comprise use of one or more short antisense compound
targeted to an SGLT2 nucleic acid, wherein the short antisense
compound targeted to an SGLT2 nucleic acid is from about 8 to about
16, preferably 9 to 15, more preferably 9 to 14, more preferably 10
to 14 monomers (i.e. from about 8 to about 16 linked monomers). One
of ordinary skill in the art will appreciate that this comprehends
methods of modulating expression of SGLT2 using one or more short
antisense compounds targeted to an SGLT2 nucleic acid of 8, 9, 10,
11, 12, 13, 14, 15 or 16 monomers.
[0448] In certain embodiments, methods of modulating SGLT2 comprise
use of a short antisense compound targeted to an SGLT2 nucleic acid
that is 8 monomers in length. In certain embodiments, methods of
modulating SGLT2 comprise use of a short antisense compound
targeted to an SGLT2 nucleic acid that is 9 monomers in length. In
certain embodiments, methods of modulating SGLT2 comprise use of a
short antisense compound targeted to an SGLT2 nucleic acid that is
10 monomers in length. In certain embodiments, methods of
modulating SGLT2 comprise use of a short antisense compound
targeted to an SGLT2 nucleic acid that is 11 monomers in length. In
certain embodiments, methods of modulating SGLT2 comprise use of a
short antisense compound targeted to an SGLT2 nucleic acid that is
12 monomers in length. In certain embodiments, methods of
modulating SGLT2 comprise use of a short antisense compound
targeted to an SGLT2 nucleic acid that is 13 monomers in length. In
certain embodiments, methods of modulating SGLT2 comprise use of a
short antisense compound targeted to an SGLT2 nucleic acid that is
14 monomers in length. In certain embodiments, methods of
modulating SGLT2 comprise use of a short antisense compound
targeted to an SGLT2 nucleic acid that is 15 monomers in length. In
certain embodiments, methods of modulating SGLT2 comprise use of a
short antisense compound targeted to an SGLT2 nucleic acid that is
16 monomers in length.
[0449] In certain embodiments, methods of modulating expression of
SGLT2 comprise use of a short antisense compound targeted to an
SGLT2 nucleic acid comprising 9 to 15 monomers. In certain
embodiments, methods of modulating expression of SGLT2 comprise use
of a short antisense compound targeted to an SGLT2 nucleic acid
comprising 10 to 15 monomers. In certain embodiments, methods of
modulating expression of SGLT2 comprise use of a short antisense
compound targeted to an SGLT2 nucleic acid comprising 12 to 14
monomers. In certain embodiments, methods of modulating expression
of SGLT2 comprise use of a short antisense compound targeted to an
SGLT2 nucleic acid comprising 12 or 14 nucleotides or
nucleosides.
[0450] 3. PCSK9
[0451] In individuals with autosomal dominant hypercholesterolemia
(ADH), elevated LDL-C levels have been linked to mutations in the
genes encoding LDL-receptor (LDL-R), apolipoprotein B (apoB), or
proprotein convertase subtilisin/kexin type 9 (PCSK9) (Abifadel et
al., Nat. Genet., 2003, 34:154-156). PCSK9 was identified as a
third locus associated with ADH when gain-of-function mutations in
PCSK9 were found to be linked to elevated LDL-C levels. ApoB
participates in the intracellular assembly and secretion of
triglyceride-rich lipoproteins and is a ligand for the LDL-R. PCSK9
is proposed to reduce LDL-R expression levels in the liver. Reduced
LDL-R expression results in reduced hepatic uptake of circulating
ApoB-containing lipoproteins, which in turn leads to elevated
cholesterol.
Definitions
[0452] "PCSK9" is the gene product or protein of which expression
is to be modulated by administration of a short antisense
compound.
[0453] "PCSK9 nucleic acid" means any nucleic acid encoding PCSK9.
For example, in certain embodiments, a PCSK9 nucleic acid includes,
without limitation, a DNA sequence encoding PCSK9, an RNA sequence
transcribed from DNA encoding PCSK9, and an mRNA sequence encoding
PCSK9.
[0454] "PCSK9 mRNA" means an mRNA encoding PCSK9.
PCSK9 Therapeutic Indications
[0455] In certain embodiments, the invention provides methods of
modulating the expression of PCSK9 in an individual comprising
administering a short antisense compound targeted to a PCSK9
nucleic acid. In certain embodiments, the invention provides
methods of treating an individual comprising administering one or
more pharmaceutical compositions of the present invention. In
certain embodiments, the individual has hypercholesterolemia, mixed
dyslipidemia, atherosclerosis, a risk of developing
atherosclerosis, coronary heart disease, a history of coronary
heart disease, early onset coronary heart disease, one or more risk
factors for coronary heart disease, type II diabetes, type II
diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia,
hyperlipidemia, hyperfattyacidemia, hepatic steatosis,
non-alcoholic steatohepatitis, or non-alcoholic fatty liver
disease.
[0456] Guidelines for lipid-lowering therapy were established in
2001 by Adult Treatment Panel III (ATP III) of the National
Cholesterol Education Program (NCEP), and updated in 2004 (Grundy
et al., Circulation, 2004, 110, 227-239). The guidelines include
obtaining a complete lipoprotein profile, typically after a 9 to 12
hour fast, for determination of LDL-C, total cholesterol, and HDL-C
levels. According to the most recently established guidelines,
LDL-C levels of 130-159 mg/dL, 160-189 mg/dL, and greater than or
equal to 190 mg/dL are considered borderline high, high, and very
high, respectively. Total cholesterol levels of 200-239 and greater
than or equal to 240 mg/dL are considered borderline high and high,
respectively. HDL-C levels of less than 40 mg/dL are considered
low.
[0457] In certain embodiments, the individual has been identified
as in need of lipid-lowering therapy. In certain such embodiments,
the individual has been identified as in need of lipid-lowering
therapy according to the guidelines established in 2001 by Adult
Treatment Panel III (ATP III) of the National Cholesterol Education
Program (NCEP), and updated in 2004 (Grundy et al., Circulation,
2004, 110, 227-239). In certain such embodiments, the individual in
need of lipid-lowering therapy has LDL-C above 190 mg/dL. In
certain such embodiments, the individual in need of lipid-lowering
therapy has LDL-C above 160 mg/dL. In certain such embodiments, the
individual in need of lipid-lowering therapy has LDL-C above 130
mg/dL. In certain such embodiments the individual in need of
lipid-lowering therapy has LDL-C above 100 mg/dL. In certain such
embodiments the individual in need of lipid-lowering therapy should
maintain LDL-C below 160 mg/dL. In certain such embodiments the
individual in need of lipid-lowering therapy should maintain LDL-C
below 130 mg/dL. In certain such embodiments the individual in need
of lipid-lowering therapy should maintain LDL-C below 100 mg/dL. In
certain such embodiments the individual should maintain LDL-C below
70 mg/dL.
[0458] In certain embodiments the invention provides methods for
reducing ApoB in an individual. In certain embodiments the
invention provides methods for reducing ApoB-containing lipoprotein
in an individual. In certain embodiments the invention provides
methods for reducing LDL-C in an individual. In certain embodiments
the invention provides methods for reducing VLDL-C in an
individual. In certain embodiments the invention provides methods
for reducing IDL-C in an individual. In certain embodiments the
invention provides methods for reducing non-HDL-C in an individual.
In certain embodiments the invention provides methods for reducing
Lp(a) in an individual. In certain embodiments the invention
provides methods for reducing serum triglyceride in an individual.
In certain embodiments the invention provides methods for reducing
liver triglyceride in an individual. In certain embodiments the
invention provides methods for reducing Ox-LDL-C in an individual.
In certain embodiments the invention provides methods for reducing
small LDL particles in an individual. In certain embodiments the
invention provides methods for reducing small VLDL particles in an
individual. In certain embodiments the invention provides methods
for reducing phospholipids in an individual. In certain embodiments
the invention provides methods for reducing oxidized phospholipids
in an individual.
[0459] In certain embodiments, the methods provided by the present
invention do not lower HDL-C. In certain embodiments, the methods
provided by the present invention do not result in accumulation of
lipids in the liver.
[0460] In certain embodiments a pharmaceutical composition
comprising a short antisense compound targeted to a PCSK9 nucleic
acid is for use in therapy. In certain embodiments, the therapy is
the reduction of LDL-C, ApoB, VLDL-C, IDL-C, non-HDL-C, Lp(a),
serum triglyceride, liver triglyceride, Ox-LDL-C, small LDL
particles, small VLDL, phospholipids, or oxidized phospholipids in
an individual. In certain embodiments, the therapy is the treatment
of hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a
risk of developing atherosclerosis, coronary heart disease, a
history of coronary heart disease, early onset coronary heart
disease, one or more risk factors for coronary heart disease, type
II diabetes, type II diabetes with dyslipidemia, dyslipidemia,
hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic
steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty
liver disease. In additional embodiments, the therapy is the
reduction of CHD risk. In certain the therapy is prevention of
atherosclerosis. In certain embodiments, the therapy is the
prevention of coronary heart disease.
[0461] In certain embodiments a pharmaceutical composition
comprising a short antisense compound targeted to a PCSK9 nucleic
acid is used for the preparation of a medicament for reducing
LDL-C, ApoB, VLDL-C, IDL-C, non-HDL-C, Lp(a), serum triglyceride,
liver triglyceride, Ox-LDL-C, small LDL particles, small VLDL,
phospholipids, or oxidized phospholipids in an individual. In
certain embodiments pharmaceutical composition comprising a short
antisense compound targeted to PCKS9 is used for the preparation of
a medicament for reducing coronary heart disease risk. In certain
embodiments a short antisense compound targeted to a PCSK9 nucleic
acid is used for the preparation of a medicament for the treatment
of hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a
risk of developing atherosclerosis, coronary heart disease, a
history of coronary heart disease, early onset coronary heart
disease, one or more risk factors for coronary heart disease, type
II diabetes, type II diabetes with dyslipidemia, dyslipidemia,
hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic
steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty
liver disease.
PCSK9 Combination Therapies
[0462] In certain embodiments, one or more pharmaceutical
compositions of the present invention are co-administered with one
or more other pharmaceutical agents. In certain embodiments, such
one or more other pharmaceutical agents are designed to treat the
same disease or condition as the one or more pharmaceutical
compositions of the present invention. In certain embodiments, such
one or more other pharmaceutical agents are designed to treat a
different disease or condition as the one or more pharmaceutical
compositions of the present invention. In certain embodiments, such
one or more other pharmaceutical agents are designed to treat an
undesired effect of one or more pharmaceutical compositions of the
present invention. In certain embodiments, one or more
pharmaceutical compositions of the present invention are
co-administered with another pharmaceutical agent to treat an
undesired effect of that other pharmaceutical agent. In certain
embodiments, one or more pharmaceutical compositions of the present
invention and one or more other pharmaceutical agents are
administered at the same time. In certain embodiments, one or more
pharmaceutical compositions of the present invention and one or
more other pharmaceutical agents are administered at different
times. In certain embodiments, one or more pharmaceutical
compositions of the present invention and one or more other
pharmaceutical agents are prepared together in a single
formulation. In certain embodiments, one or more pharmaceutical
compositions of the present invention and one or more other
pharmaceutical agents are prepared separately.
[0463] In certain embodiments, pharmaceutical agents that may be
co-administered with a pharmaceutical composition of the present
invention include lipid-lowering agents. In certain such
embodiments, pharmaceutical agents that may be co-administered with
a pharmaceutical composition of the present invention include, but
are not limited to atorvastatin, simvastatin, rosuvastatin, and
ezetimibe. In certain such embodiments, the lipid-lowering agent is
administered prior to administration of a pharmaceutical
composition of the present invention. In certain such embodiments,
the lipid-lowering agent is administered following administration
of a pharmaceutical composition of the present invention. In
certain such embodiments the lipid-lowering agent is administered
at the same time as a pharmaceutical composition of the present
invention. In certain such embodiments the dose of a
co-administered lipid-lowering agent is the same as the dose that
would be administered if the lipid-lowering agent was administered
alone. In certain such embodiments the dose of a co-administered
lipid-lowering agent is lower than the dose that would be
administered if the lipid-lowering agent was administered alone. In
certain such embodiments the dose of a co-administered
lipid-lowering agent is greater than the dose that would be
administered if the lipid-lowering agent was administered
alone.
[0464] In certain embodiments, a co-administered lipid-lowering
agent is a HMG-CoA reductase inhibitor. In certain such embodiments
the HMG-CoA reductase inhibitor is a statin. In certain such
embodiments the statin is selected from atorvastatin, simvastatin,
pravastatin, fluvastatin, and rosuvastatin.
[0465] In certain embodiments, a co-administered lipid-lowering
agent is a cholesterol absorption inhibitor. In certain such
embodiments, cholesterol absorption inhibitor is ezetimibe.
[0466] In certain embodiments, a co-administered lipid-lowering
agent is a co-formulated HMG-CoA reductase inhibitor and
cholesterol absorption inhibitor. In certain such embodiments the
co-formulated lipid-lowering agent is ezetimibe/simvastatin.
[0467] In certain embodiments, a co-administered lipid-lowering
agent is a microsomal triglyceride transfer protein inhibitor (MTP
inhibitor).
[0468] In certain embodiments, a co-administered lipid-lowering
agent is an oligonucleotide targeted to an ApoB nucleic acid.
[0469] In certain embodiments, a co-administered pharmaceutical
agent is a bile acid sequestrant. In certain such embodiments, the
bile acid sequestrant is selected from cholestyramine, colestipol,
and colesevelam.
[0470] In certain embodiments, a co-administered pharmaceutical
agent is a nicotinic acid. In certain such embodiments, the
nicotinic acid is selected from immediate release nicotinic acid,
extended release nicotinic acid, and sustained release nicotinic
acid.
[0471] In certain embodiments, a co-administered pharmaceutical
agent is a fibric acid. In certain such embodiments, a fibric acid
is selected from gemfibrozil, fenofibrate, clofibrate, bezafibrate,
and ciprofibrate.
[0472] Further examples of pharmaceutical agents that may be
co-administered with a pharmaceutical composition of the present
invention include, but are not limited to, corticosteroids,
including but not limited to prednisone; immunoglobulins,
including, but not limited to intravenous immunoglobulin (IVIg);
analgesics (e.g., acetaminophen); anti-inflammatory agents,
including, but not limited to non-steroidal anti-inflammatory drugs
(e.g., ibuprofen, COX-1 inhibitors, and COX-2, inhibitors);
salicylates; antibiotics; antivirals; antifungal agents;
antidiabetic agents (e.g., biguanides, glucosidase inhibitors,
insulins, sulfonylureas, and thiazolidenediones); adrenergic
modifiers; diuretics; hormones (e.g., anabolic steroids, androgen,
estrogen, calcitonin, progestin, somatostan, and thyroid hormones);
immunomodulators; muscle relaxants; antihistamines; osteoporosis
agents (e.g., biphosphonates, calcitonin, and estrogens);
prostaglandins, antineoplastic agents; psychotherapeutic agents;
sedatives; poison oak or poison sumac products; antibodies; and
vaccines.
[0473] In certain embodiments, the pharmaceutical compositions of
the present invention may be administered in conjuction with a
lipid-lowering therapy. In certain such embodiments, a
lipid-lowering therapy is therapeutic lifestyle change. In certain
such embodiments, a lipid-lowering therapy is LDL apheresis.
Certain Short Antisense Compounds Targeted to a PCSK9 Nucleic
Acid
[0474] In certain embodiments, short antisense compounds are
targeted to a PCSK9 nucleic acid having the sequence of
GENBANK.RTM. Accession No. NM.sub.--174936.2, incorporated herein
as SEQ ID NO: 4. In certain such embodiments, a short antisense
compound targeted to SEQ ID NO: 4 is at least 90% complementary to
SEQ ID NO: 4. In certain such embodiments, a short antisense
compound targeted to SEQ ID NO: 4 is at least 95% complementary to
SEQ ID NO: 4. In certain such embodiments, a short antisense
compound targeted to SEQ ID NO: 4 is 100% complementary to SEQ ID
NO: 4. In certain embodiments, a short antisense compound targeted
to SEQ ID NO: 4 comprises a nucleotide sequence selected from the
nucleotide sequences set forth in Table 6 or Table 7.
[0475] The nucleotide sequence set forth in each SEQ ID NO in
Tables 6 and 7 is independent of any modification to a sugar
moiety, an internucleoside linkage, or a nucleobase. As such, short
antisense compounds defined by a SEQ ID NO may comprise,
independently, one or more modifications to a sugar moiety, an
internucleoside linkage, or a nucleobase. Short antisense compounds
described by Isis Number (Isis NO.) indicate a combination of
nucleobase sequence and one or more modifications to a sugar
moiety, an internucleoside linkage, or a nucleobase.
[0476] Tables 6 and 7 illustrate examples of short antisense
compounds targeted to SEQ ID NO: 4. Table 6 illustrates short
antisense compounds that are 100% complementary to SEQ ID NO: 4.
Table 7 illustrates short antisense compounds that have one or two
mismatches with respect to SEQ ID NO: 4. The column labeled `gapmer
motif` indicates the wing-gap-wing motif of each short antisense
compounds. The gap segment comprises 2'-deoxynucleotides and each
nucleotide of each wing segment comprises a 2'-modified sugar. The
particular 2'-modified sugar is also indicated in the `gapmer
motif` column. For example, `2-10-2 MOE` means a 2-10-2 gapmer
motif, where a gap segment of ten 2'-deoxynucleotides is flanked by
wing segments of two nucleotides, where the nucleotides of the wing
segments are 2'-MOE nucleotides. Internucleoside linkages are
phosphorothioate. The short antisense compounds comprise
5-methylcytidine in place of unmodified cytosine, unless
"unmodified cytosine" is listed in the gapmer motif column, in
which case the indicated cytosines are unmodified cytosines. For
example, "5-mC in gap only" indicates that the gap segment has
5-methylcytosines, while the wing segments have unmodified
cytosines.
TABLE-US-00009 TABLE 6 Short Antisense Compounds targeted to SEQ ID
NO: 4 5' 3' SEQ ISIS Target Target Sequence ID NO. Site Site
(5'-3') Gapmer Motif NO 400297 695 708 ATGGGGCAACTTCA 2-10-2 MOE
329 400298 696 709 CATGGGGCAACTTC 2-10-2 MOE 330 400299 697 710
ACATGGGGCAACTT 2-10-2 MOE 331 400300 742 755 GGGATGCTCTGGGC 2-10-2
MOE 332 400301 757 770 CGCTCCAGGTTCCA 2-10-2 MOE 333 400302 828 841
GATACACCTCCACC 2-10-2 MOE 334 400303 829 842 AGATACACCTCCAC 2-10-2
MOE 335 400304 830 843 GAGATACACCTCCA 2-10-2 MOE 336 400305 937 950
GCCTGTCTGTGGAA 2-10-2 MOE 337 400306 952 965 CTGTCACACTTGCT 2-10-2
MOE 338 400307 988 1001 CGGCCGCTGACCAC 2-10-2 MOE 339 400308 989
1002 CCGGCCGCTGACCA 2-10-2 MOE 340 400309 990 1003 CCCGGCCGCTGACC
2-10-2 MOE 341 400310 991 1004 TCCCGGCCGCTGAC 2-10-2 MOE 342 400311
992 1005 ATCCCGGCCGCTGA 2-10-2 MOE 343 400312 993 1006
CATCCCGGCCGCTG 2-10-2 MOE 344 400313 994 1007 GCATCCCGGCCGCT 2-10-2
MOE 345 400314 1057 1070 GTGCCCTTCCCTTG 2-10-2 MOE 346 400315 1075
1088 ATGAGGGTGCCGCT 2-10-2 MOE 347 400316 1076 1089 TATGAGGGTGCCGC
2-10-2 MOE 348 400317 1077 1090 CTATGAGGGTGCCG 2-10-2 MOE 349
400318 1078 1091 CCTATGAGGGTGCC 2-10-2 MOE 350 400319 1093 1106
CGAATAAACTCCAG 2-10-2 MOE 351 400320 1094 1107 CCGAATAAACTCCA
2-10-2 MOE 352 400321 1095 1108 TCCGAATAAACTCC 2-10-2 MOE 353
400322 1096 1109 TTCCGAATAAACTC 2-10-2 MOE 354 400323 1147 1160
GCCAGGGGCAGCAG 2-10-2 MOE 355 400324 1255 1268 GAGTAGAGGCAGGC
2-10-2 MOE 356 400325 1334 1347 CCCCAAAGTCCCCA 2-10-2 MOE 357
400326 1335 1348 TCCCCAAAGTCCCC 2-10-2 MOE 358 400327 1336 1349
GTCCCCAAAGTCCC 2-10-2 MOE 359 400328 1453 1466 ACGTGGGCAGCAGC
2-10-2 MOE 360 400329 1454 1467 CACGTGGGCAGCAG 2-10-2 MOE 361
400330 1455 1468 CCACGTGGGCAGCA 2-10-2 MOE 362 400331 1456 1469
GCCACGTGGGCAGC 2-10-2 MOE 363 400332 1569 1582 CAGGGAACCAGGCC
2-10-2 MOE 364 400333 1570 1583 TCAGGGAACCAGGC 2-10-2 MOE 365
400334 1571 1584 CTCAGGGAACCAGG 2-10-2 MOE 366 400335 1572 1585
CCTCAGGGAACCAG 2-10-2 MOE 367 400336 1573 1586 TCCTCAGGGAACCA
2-10-2 MOE 368 400337 1574 1587 GTCCTCAGGGAACC 2-10-2 MOE 369
400338 1575 1588 GGTCCTCAGGGAAC 2-10-2 MOE 370 400339 1576 1589
TGGTCCTCAGGGAA 2-10-2 MOE 371 400340 1577 1590 CTGGTCCTCAGGGA
2-10-2 MOE 372 400341 1578 1591 GCTGGTCCTCAGGG 2-10-2 MOE 373
400342 1621 1634 GTGCTGGGGGGCAG 2-10-2 MOE 374 400343 1622 1635
GGTGCTGGGGGGCA 2-10-2 MOE 375 400344 1623 1636 GGGTGCTGGGGGGC
2-10-2 MOE 376 400345 1624 1637 TGGGTGCTGGGGGG 2-10-2 MOE 377
400346 1738 1751 GAGCAGCTCAGCAG 2-10-2 MOE 378 400347 1739 1752
GGAGCAGCTCAGCA 2-10-2 MOE 379 400348 1740 1753 TGGAGCAGCTCAGC
2-10-2 MOE 380 400349 1741 1754 CTGGAGCAGCTCAG 2-10-2 MOE 381
400350 1834 1847 CCCTCACCCCCAAA 2-10-2 MOE 382 400351 1835 1848
ACCCTCACCCCCAA 2-10-2 MOE 383 400352 1836 1849 CACCCTCACCCCCA
2-10-2 MOE 384 400353 1837 1850 ACACCCTCACCCCC 2-10-2 MOE 385
400354 1838 1851 GACACCCTCACCCC 2-10-2 MOE 386 400355 1839 1852
AGACACCCTCACCC 2-10-2 MOE 387 400356 1840 1853 TAGACACCCTCACC
2-10-2 MOE 388 400357 2083 2096 TGGCAGCAGGAAGC 2-10-2 MOE 389
400358 2084 2097 ATGGCAGCAGGAAG 2-10-2 MOE 390 400359 2085 2098
CATGGCAGCAGGAA 2-10-2 MOE 391 400360 2086 2099 GCATGGCAGCAGGA
2-10-2 MOE 392 400361 2316 2329 GGCAGCAGATGGCA 2-10-2 MOE 393
400362 2317 2330 CGGCAGCAGATGGC 2-10-2 MOE 394 400363 2318 2331
CCGGCAGCAGATGG 2-10-2 MOE 395 400364 2319 2332 TCCGGCAGCAGATG
2-10-2 MOE 396 400365 2320 2333 CTCCGGCAGCAGAT 2-10-2 MOE 397
400366 2321 2334 GCTCCGGCAGCAGA 2-10-2 MOE 398 400367 2322 2335
GGCTCCGGCAGCAG 2-10-2 MOE 399 400368 2323 2336 CGGCTCCGGCAGCA
2-10-2 MOE 400 400369 2324 2337 CCGGCTCCGGCAGC 2-10-2 MOE 401
400370 2325 2338 GCCGGCTCCGGCAG 2-10-2 MOE 402 400371 3543 3556
AGTTACAAAAGCAA 2-10-2 MOE 403 403739 988 1001 CGGCCGCTGACCAC 2-10-2
339 (6'S)-6'- methyl- Methyleneoxy BNA 403740 1455 1468
CCACGTGGGCAGCA 2-10-2 362 (6'S)-6'- methyl- Methyleneoxy BNA
TABLE-US-00010 TABLE 7 Short antisense compounds targeted to SEQ ID
NO: 4 and having 1 or 2 mismatches 5' 3' SEQ ISIS Target Target
Gapmer ID NO. Site Site Sequence (5'-3') Motif NO 400323 349 362
GCCAGGGGCAGCAG 2-10-2 MOE 355 400370 679 692 GCCGGCTCCGGCAG 2-10-2
MOE 402 400361 1860 1873 GGCAGCAGATGGCA 2-10-2 MOE 393 400323 1873
1886 GCCAGGGGCAGCAG 2-10-2 MOE 355 400310 2257 2270 TCCCGGCCGCTGAC
2-10-2 MOE 342 400361 2653 2666 GGCAGCAGATGGCA 2-10-2 MOE 393
400350 2811 2824 CCCTCACCCCCAAA 2-10-2 MOE 382 400351 2812 2825
ACCCTCACCCCCAA 2-10-2 MOE 383 400352 2813 2826 CACCCTCACCCCCA
2-10-2 MOE 384 400353 2814 2827 ACACCCTCACCCCC 2-10-2 MOE 385
400334 2966 2979 CTCAGGGAACCAGG 2-10-2 MOE 366 400332 3379 3392
CAGGGAACCAGGCC 2-10-2 MOE 364 400340 3448 3461 CTGGTCCTCAGGGA
2-10-2 MOE 372 400341 3449 3462 GCTGGTCCTCAGGG 2-10-2 MOE 373
[0477] In certain embodiments, a target region is nucleotides
695-710 of SEQ ID NO: 4. In certain such embodiments, short
antisense compounds targeted to nucleotides 695-710 of SEQ ID NO: 4
comprise a nucleotide sequence selected from SEQ ID NO: 329, 330,
or 331. In certain such embodiments, a short antisense compound
targeted to nucleotides 695-710 of SEQ ID NO: 4 is selected from
Isis NO. 400297, 400298, or 400299.
[0478] In certain embodiments, a target region is nucleotides
742-770 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 742-770 of SEQ ID NO: 4
comprises a nucleotide sequence selected from SEQ ID NO 332 or 333.
In certain such embodiments, a short antisense compound targeted to
nucleotides 742-770 of SEQ ID NO: 4 is selected from Isis NO.
400300 or 400301.
[0479] In certain embodiments, a target region is nucleotides
828-843 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 828-843 of SEQ ID NO: 4
comprises a nucleotide sequence selected from SEQ ID NO 334, 335,
or 336. In certain such embodiments, a short antisense compound
targeted to nucleotides 828-843 of SEQ ID NO: 4 is selected from
ISIS No. 400302, 400303, or 400304.
[0480] In certain embodiments, a target region is nucleotides
937-1007 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 937-1007 of SEQ ID NO: 4
comprises a nucleotide sequence selected from SEQ ID NO 337, 338,
339, 340, 341, 342, 343, 344, or 345. In certain such embodiments,
a short antisense compound targeted to nucleotides 937-1007 of SEQ
ID NO: 4 is selected from Isis NO. 400305, 400306, 400307, 400308,
400309, 400310, 400311, 400312, 400313, or 403739.
[0481] In certain embodiments, a target region is nucleotides
937-965 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 937-965 of SEQ ID NO: 4
comprises a nucleotide sequence selected from SEQ ID NO 337 or 338.
In certain such embodiments, a short antisense compound targeted to
nucleotides 937-965 of SEQ ID NO: 4 is selected from Isis NO.
400305 or 400306.
[0482] In certain embodiments, a target region is nucleotides
988-1007 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 988-1007 of SEQ ID NO: 4
comprises a nucleotide sequence selected from SEQ ID NO 339, 340,
341, 342, 343, 344, or 345. In certain such embodiments, a short
antisense compound targeted to nucleotides 937-1007 of SEQ ID NO: 4
is selected from Isis NO. 400307, 400308, 400309, 400310, 400311,
400312, 4003313, or 403739.
[0483] In certain embodiments, a target region is nucleotides
1057-1160 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 1057-1160 of SEQ ID NO:
4 comprises a nucleotide sequence selected from SEQ ID NO 346, 347,
348, 349, 350, 351, 352, 353, 354, or 355. In certain such
embodiments, a short antisense compound targeted to nucleotides
1057-1160 of SEQ ID NO: 4 is selected from ISIS NO. 400314, 400315,
400316, 400317, 400318, 400319, 400320, 400321, 400322, or
400323.
[0484] In certain embodiments, a target region is nucleotides
1057-1109 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 1057-1109 of SEQ ID NO:
4 comprises a nucleotide sequence selected from SEQ ID NO 346, 347,
348, 349, 350, 351, 352, 353, or 354. In certain such embodiments,
a short antisense compound targeted to nucleotides 1057-1109 of SEQ
ID NO: 4 is selected from ISIS NO. 400314, 400315, 400316, 400317,
400318, 400319, 400320, 400321, or 400322.
[0485] In certain embodiments, a target region is nucleotides
1057-1091 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 1057-1091 of SEQ ID NO:
4 comprises a nucleotide sequence selected from SEQ ID NO 346, 347,
348, 349, or 350. In certain such embodiments, a short antisense
compound targeted to nucleotides 1057-1091 of SEQ ID NO: 4 is
selected from ISIS NO. 400314, 400315, 400316, 400317, or
400318.
[0486] In certain embodiments, a target region is nucleotides
1093-1109 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 1093-1109 of SEQ ID NO:
4 comprises a nucleotide sequence selected from SEQ ID NO 351, 352,
353, or 354. In certain such embodiments, a short antisense
compound targeted to nucleotides 1057-1109 of SEQ ID NO: 4 is
selected from ISIS NO. 400319, 400320, 400321, or 400322.
[0487] In certain embodiments, a target region is nucleotides
1334-1349 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 1334-1349 of SEQ ID NO:
4 comprises a nucleotide sequence selected from SEQ ID NO 357, 358,
or 359. In certain such embodiments, a short antisense compound
targeted to nucleotides 1334-1349 of SEQ ID NO: 4 is selected from
ISIS NO 400325, 400326, or 400327.
[0488] In certain embodiments, a target region is nucleotides
1453-1469 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 1453-1469 of SEQ ID NO:
4 comprises a nucleotide sequence selected from SEQ ID NO 360, 361,
362, or 363. In certain such embodiments, a short antisense
compound targeted to nucleotides 1453-1469 of SEQ ID NO: 4 is
selected from ISIS NO 400328, 400329, 400330, 400331, or
403-470.
[0489] In certain embodiments, a target region is nucleotides
1569-1591 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 1569-1591 of SEQ ID NO:
4 comprises a nucleotide sequence selected from SEQ ID NO 364, 365,
366, 367, 368, 369, 370, 371, 372, or 373. In certain such
embodiments, a short antisense compound targeted to nucleotides
1569-1591 of SEQ ID NO: 4 is selected from ISIS NO 400332, 400333,
400334, 400335, 400336, 400337, 400338, 400339, 400340, or
400341.
[0490] In certain embodiments, a target region is nucleotides
1621-1637 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 1621-1637 of SEQ ID NO:
4 comprises a nucleotide sequence selected from SEQ ID NO 374, 375,
376, or 377. In certain such embodiments, a short antisense
compound targeted to nucleotides 1621-1637 of SEQ ID NO: 4 is
selected from ISIS NO 400342, 400343, 400344, or 400345.
[0491] In certain embodiments, a target region is nucleotides
1738-1754 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 1738-1754 of SEQ ID NO:
4 comprises a nucleotide sequence selected from SEQ ID NO 378, 379,
380, or 381. In certain such embodiments, a short antisense
compound targeted to nucleotides 1738-1754 of SEQ ID NO: 4 is
selected from ISIS NO 400346, 400347, 400348, or 400349.
[0492] In certain embodiments, a target region is nucleotides
1834-1853 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 1834-1853 of SEQ ID NO:
4 comprises a nucleotide sequence selected from SEQ ID NO 382, 383,
384, 385, 386, 387, or 388. In certain embodiments, a short
antisense compound targeted to nucleotides 1834-1853 of SEQ ID NO:
4 is selected from ISIS NO 400350, 400351, 400352, 400353, 400354,
400355, or 400356.
[0493] In certain embodiments, a target region is nucleotides
2083-2099 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 2083-2099 of SEQ ID NO:
4 comprises a nucleotide sequence selected from SEQ ID NO 389, 390,
391, or 392. In certain such embodiments, a short antisense
compound targeted to nucleotides 2083-2099 of SEQ ID NO: 4 is
selected from ISIS NO 400357, 400358, 400359, or 400360.
[0494] In certain embodiments, a target region is nucleotides
2316-2338 of SEQ ID NO: 4. In certain such embodiments, a short
antisense compound targeted to nucleotides 2316-2338 of SEQ ID NO:
4 comprises a nucleotide sequence selected from SEQ ID NO 393, 394,
395, 396, 397, 398, 399, 400, 401, or 402. In certain such
embodiments, a short antisense compound targeted to nucleotides
2316-2338 of SEQ ID NO: 4 is selected from ISIS NO 400361, 400362,
400363, 400364, 400365, 400366, 400367, 400368, 400369, or
400370.
[0495] In certain embodiments, short antisense compounds targeted
to a PCSK9 nucleic acid are 8 to 16, preferably 9 to 15, more
preferably 9 to 14, more preferably 10 to 14 nucleotides in length.
In certain embodiments, short antisense compounds targeted to a
PCSK9 nucleic acid are 9 to 14 nucleotides in length. In certain
embodiments, short antisense compounds targeted to a PCSK9 nucleic
acid are 10 to 14 nucleotides in length. In certain embodiments,
such short antisense compounds are short antisense
oligonucleotides.
[0496] In certain embodiments, short antisense compounds targeted
to a PCSK9 nucleic acid are short gapmers. In certain such
embodiments, short gapmers targeted to a PCSK9 nucleic acid
comprise at least one high affinity modification in one or more
wings of the compound. In certain embodiments, short antisense
compounds targeted to a PCSK9 nucleic acid comprise 1 to 3
high-affinity modifications in each wing. In certain such
embodiments, the nucleosides or nucleotides of the wing comprise a
2' modification. In certain such embodiments, the monomers of the
wing are BNA's. In certain such embodiments, the monomers of the
wing are selected from .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2')
BNA, .beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA, Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') BNA, Aminooxy (4'-CH.sub.2--O--N(R)-2')
BNA and Oxyamino (4'-CH.sub.2--N(R)-0-2') BNA. In certain
embodiments, the monomers of a wing comprise a substituent at the
2' position selected from allyl, amino, azido, thio, O-allyl,
O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), and
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. In certain embodiments, the monomers of a
wing are 2'MOE nucleotides.
[0497] In certain embodiments, short antisense compounds targeted
to a PCSK9 nucleic acid comprise a gap between the 5' wing and the
3' wing. In certain embodiments the gap comprises five, six, seven,
eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
In certain embodiments, the monomers of the gap are unmodified
deoxyribonucleotides. In certain embodiments, the monomers of the
gap are unmodified ribonucleotides. In certain embodiments, gap
modifications (if any) gap result in an antisense compound that,
when bound to its target nucleic acid, supports cleavage by an
RNase, including, but not limited to, RNase H.
[0498] In certain embodiments, short antisense compounds targeting
a PCSK9 nucleic acid may have any one or more properties or
characteristics of the short antisense compounds generally
described herein. In certain embodiments, short antisense compounds
targeting a PCSK9 nucleic acid have a motif (wing-deoxy gap-wing)
selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2,
1-10-1, 1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more
preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.
[0499] In certain embodiments, short antisense compounds targeted
to a PCSK9 nucleic acid have uniform monomeric linkages. In certain
such embodiments, those linkages are all phosphorothioate linkages.
In certain embodiments, the linkages are all phosphodiester
linkages. In certain embodiments, short antisense compounds
targeted to a PCSK9 nucleic acid have mixed backbones.
[0500] In certain embodiments, short antisense compounds targeted
to a PCSK9 nucleic acid are 8 monomers in length. In certain
embodiments, short antisense compounds targeted to a PCSK9 nucleic
acid are 9 monomers in length. In certain embodiments, short
antisense compounds targeted to a PCSK9 nucleic acid are 10
monomers in length. In certain embodiments, short antisense
compounds targeted to a PCSK9 nucleic acid are 11 monomers in
length. In certain embodiments, short antisense compounds targeted
to a PCSK9 nucleic acid are monomers in length. In certain
embodiments, short antisense compounds targeted to a PCSK9 nucleic
acid are 13 monomers in length. In certain embodiments, short
antisense compounds targeted to a PCSK9 nucleic acid are 14
monomers in length. In certain embodiments, short antisense
compounds targeted to a PCSK9 nucleic acid are 15 monomers in
length. In certain embodiments, short antisense compounds targeted
to a PCSK9 nucleic acid are 16 monomers in length. In certain
embodiments, short antisense compounds targeted to a PCSK9 nucleic
acid comprise 9 to 15 monomers. In certain embodiments, short
antisense compounds targeted to a PCSK9 nucleic acid comprise 10 to
15 monomers. In certain embodiments, short antisense compounds
targeted to a PCSK9 nucleic acid comprise 12 to 14 monomers. In
certain embodiments, short antisense compounds targeted to a PCSK9
nucleic acid comprise 12 to 14 nucleotides or nucleosides.
[0501] In certain embodiments, the invention provides methods of
modulating expression of PCSK9. In certain embodiments, such
methods comprise use of one or more short antisense compound
targeted to a PCSK9 nucleic acid, wherein the short antisense
compound targeted to a PCSK9 nucleic acid is from about 8 to about
16, preferably 9 to 15, more preferably 9 to 14, more preferably 10
to 14 monomers (i.e. from about 8 to about 16 linked monomers). One
of ordinary skill in the art will appreciate that this comprehends
methods of modulating expression of PCSK9 using one or more short
antisense compounds targeted to a PCSK9 nucleic acid of 8, 9, 10,
11, 12, 13, 14, 15 or 16 monomers.
[0502] In certain embodiments, methods of modulating PCSK9 comprise
use of a short antisense compound targeted to a PCSK9 nucleic acid
that is 8 monomers in length. In certain embodiments, methods of
modulating PCSK9 comprise use of a short antisense compound
targeted to a PCSK9 nucleic acid that is 9 monomers in length. In
certain embodiments, methods of modulating PCSK9 comprise use of a
short antisense compound targeted to a PCSK9 nucleic acid that is
10 monomers in length. In certain embodiments, methods of
modulating PCSK9 comprise use of a short antisense compound
targeted to a PCSK9 nucleic acid that is 11 monomers in length. In
certain embodiments, methods of modulating PCSK9 comprise use of a
short antisense compound targeted to a PCSK9 nucleic acid that is
12 monomers in length. In certain embodiments, methods of
modulating PCSK9 comprise use of a short antisense compound
targeted to a PCSK9 nucleic acid that is 13 monomers in length. In
certain embodiments, methods of modulating PCSK9 comprise use of a
short antisense compound targeted to a PCSK9 nucleic acid that is
14 monomers in length. In certain embodiments, methods of
modulating PCSK9 comprise use of a short antisense compound
targeted to a PCSK9 nucleic acid that is 15 monomers in length. In
certain embodiments, methods of modulating PCSK9 comprise use of a
short antisense compound targeted to a PCSK9 nucleic acid that is
16 monomers in length.
[0503] In certain embodiments, methods of modulating expression of
PCSK9 comprise use of a short antisense compound targeted to a
PCSK9 nucleic acid comprising 9 to 15 monomers. In certain
embodiments, methods of modulating expression of PCSK9 comprise use
of a short antisense compound targeted to a PCSK9 nucleic acid
comprising 10 to 15 monomers. In certain embodiments, methods of
modulating expression of PCSK9 comprise use of a short antisense
compound targeted to a PCSK9 nucleic acid comprising 12 to 14
monomers. In certain embodiments, methods of modulating expression
of PCSK9 comprise use of a short antisense compound targeted to a
PCSK9 nucleic acid comprising 12 or 14 nucleotides or
nucleosides.
[0504] 4. Superoxide Dismutase 1 Enzyme (SOD1)
[0505] The enzymes known as the superoxide dismutases (SODs)
provide defense against oxidative damage of biomolecules by
catalyzing the dismutation of superoxide to hydrogen peroxide
(H.sub.2O.sub.2) (Fridovich, Annu. Rev. Biochem., 1995, 64,
97-112). Two major classes of superoxide dismutases exist. One
consists of a group of enzymes with active sites containing copper
and zinc while the other class has either manganese or iron at the
active site (Fridovich, Annu. Rev. Biochem., 1995, 64, 97-112).
[0506] Mutations in the superoxide dismutase 1 gene are associated
with a dominantly-inherited form of amyotrophic lateral sclerosis
(ALS, also known as Lou Gehrig's disease) a disorder characterized
by a selective degeneration of upper and lower motor neurons
(Cleveland and Liu, Nat. Med., 2000, 6, 1320-1321). The deleterious
effects of various mutations on superoxide dismutase 1 are most
likely mediated through a gain of toxic function rather than a loss
of superoxide dismutase 1 activity, as the complete absence of
superoxide dismutase 1 in mice neither diminishes life nor provokes
overt disease (Al-Chalabi and Leigh, Curr. Opin. Neurol., 2000, 13,
397-405; Alisky and Davidson, Hum. Gene Ther., 2000, 11,
2315-2329).
[0507] Over 100 mutations of the human SOD1 gene have been
identified, and altogether account for approximately 20% of
familial amyotrophic lateral sclerosis (ALS) cases. Some mutations,
such as the A4V mutation most commonly found in the United States,
are highly lethal and result in survival only nine months from the
onset of disease symptoms. Other mutations of SOD1 manifest in a
slower disease course.
Definitions
[0508] "SOD1" means the gene product or protein of which expression
is to be modulated by administration of a short antisense
compound.
[0509] "SOD1 nucleic acid" means any nucleic acid encoding SOD1.
For example, in certain embodiments, a SOD1 nucleic acid includes,
without limitations, a DNA sequence encoding SOD1, an RNA sequence
transcribed from DNA encoding SOD1, and an mRNA sequence encoding
SOD1.
[0510] "SOD1 mRNA" means an mRNA encoding SOD1.
SOD1 Therapeutic Indications
[0511] It has been discovered that antisense inhibition of
superoxide dismutase 1 (SOD1) in an animal model of familial ALS
reduces both SOD1 mRNA and protein, and further results in a
slowing of disease progression and, importantly, increased survival
time. Accordingly, in certain embodiments, the invention provides
methods for the slowing of disease progression in an individual
suffering from familial ALS by administering to such an individual
a short antisense compound targeted to an SOD1 nucleic acid. In
certain such embodiments, a short antisense compound targeted to
SOD1 are delivered directly to the cerebrospinal fluid of the
individual. In certain such embodiments, methods further comprise
increasing survival time of an individual suffering from familial
ALS. Slowing of disease progression is indicated by an improvement
in one or more indicators of ALS disease progression, including,
without limitation, the revised ALS functional rating scale,
pulmonary function tests, and muscle strength measurements.
SOD1 Combination Therapies
[0512] In certain embodiments, one or more pharmaceutical
compositions comprising a short antisense compound targeted to an
SOD1 nucleic acid is co-administered with one or more other
pharmaceutical agents. In certain embodiments, such one or more
other pharmaceutical agents are designed to treat the same disease
or condition as the one or more pharmaceutical compositions of the
present invention. In certain embodiments, such one or more other
pharmaceutical agents are designed to treat a different disease or
condition as the one or more pharmaceutical compositions of the
present invention. In certain embodiments, such one or more other
pharmaceutical agents are designed to treat an undesired effect of
one or more pharmaceutical compositions of the present invention.
In certain embodiments, one or more pharmaceutical compositions of
the present invention are co-administered with another
pharmaceutical agent to treat an undesired effect of that other
pharmaceutical agent. In certain embodiments, one or more
pharmaceutical compositions of the present invention and one or
more other pharmaceutical agents are administered at the same time.
In certain embodiments, one or more pharmaceutical compositions of
the present invention and one or more other pharmaceutical agents
are administered at different times. In certain embodiments, one or
more pharmaceutical compositions of the present invention and one
or more other pharmaceutical agents are prepared together in a
single formulation. In certain embodiments, one or more
pharmaceutical compositions of the present invention and one or
more other pharmaceutical agents are prepared separately.
[0513] In certain embodiments, a co-administered pharmaceutical
agent is a nicotinic acid. In certain such embodiments, the
nicotinic acid is selected from immediate release nicotinic acid,
extended release nicotinic acid, and sustained release nicotinic
acid.
[0514] In certain embodiments, a co-administered pharmaceutical
agent is a fibric acid. In certain such embodiments, a fibric acid
is selected from gemfibrozil, fenofibrate, clofibrate, bezafibrate,
and ciprofibrate.
[0515] Further examples of pharmaceutical agents that may be
co-administered with a pharmaceutical composition comprising a
short antisense compound targeted to SOD1 include, but are not
limited to, corticosteroids, including but not limited to
prednisone; immunoglobulins, including, but not limited to
intravenous immunoglobulin (IVIg); analgesics (e.g.,
acetaminophen); anti-inflammatory agents, including, but not
limited to non-steroidal anti-inflammatory drugs (e.g., ibuprofen,
COX-1 inhibitors, and COX-2, inhibitors); salicylates; antibiotics;
antivirals; antifungal agents; antidiabetic agents (e.g.,
biguanides, glucosidase inhibitors, insulins, sulfonylureas, and
thiazolidenediones); adrenergic modifiers; diuretics; hormones
(e.g., anabolic steroids, androgen, estrogen, calcitonin,
progestin, somatostan, and thyroid hormones); immunomodulators;
muscle relaxants; antihistamines; osteoporosis agents (e.g.,
biphosphonates, calcitonin, and estrogens); prostaglandins,
antineoplastic agents; psychotherapeutic agents; sedatives; poison
oak or poison sumac products; antibodies; and vaccines.
Certain Short Antisense Compounds Targeted to a SOD1 Nucleic
Acid
[0516] In certain embodiments, short antisense compounds are
targeted to a SOD1 nucleic acid having the sequence of GENBANK.RTM.
Accession No. NM_X02317.1, incorporated herein as SEQ ID NO: 5. In
certain such embodiments, a short antisense compound targeted to
SEQ ID NO: 5 is at least 90% complementary to SEQ ID NO: 5. In
certain such embodiments, a short antisense compound targeted to
SEQ ID NO: 5 is at least 95% complementary to SEQ ID NO: 5. In
certain such embodiments, a short antisense compound targeted to
SEQ ID NO: 5 is 100% complementary to SEQ ID NO: 5. In certain
embodiments, a short antisense compound targeted to SEQ ID NO: 5
comprises a nucleotide sequence selected from the nucleotide
sequences set forth in Table 8 or Table 9.
[0517] The nucleotide sequence set forth in each SEQ ID NO in
Tables 8 and 9 is independent of any modification to a sugar
moiety, an internucleoside linkage, or a nucleobase. As such, short
antisense compounds defined by a SEQ ID NO may comprise,
independently, one or more modifications to a sugar moiety, an
internucleoside linkage, or a nucleobase. Short antisense compounds
described by Isis Number (Isis NO.) indicate a combination of
nucleobase sequence and one or more modifications to a sugar
moiety, an internucleoside linkage, or a nucleobase.
[0518] Table 8 illustrates examples of short antisense compounds
targeted to SEQ ID NO: 5. Table 8 illustrates short antisense
compounds that are 100% complementary to SEQ ID NO: 5. The column
labeled `gapmer motif` indicates the wing-gap-wing motif of each
short antisense compounds. The gap segment comprises
2'-deoxynucleotides and each nucleotide of each wing segment
comprises a 2'-modified sugar. The particular 2'-modified sugar is
also indicated in the `gapmer motif` column. For example, `2-10-2
MOE` means a 2-10-2 gapmer motif, where a gap segment of ten
2'-deoxynucleotides is flanked by wing segments of two nucleotides,
where the nucleotides of the wing segments are 2'-MOE nucleotides.
Internucleoside linkages are phosphorothioate. The short antisense
compounds comprise 5-methylcytidine in place of unmodified
cytosine, unless "unmodified cytosine" is listed in the gapmer
motif column, in which case the indicated cytosines are unmodified
cytosines. For example, "5-mC in gap only" indicates that the gap
segment has 5-methylcytosines, while the wing segments have
unmodified cytosines.
[0519] In certain embodiments, short antisense compounds targeting
a SOD1 nucleic acid may have any one or more properties or
characteristics of the short antisense compounds generally
described herein. In certain embodiments, short antisense compounds
targeting a SOD1 nucleic acid have a motif (wing-deoxy gap-wing)
selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2,
1-10-1, 1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more
preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.
TABLE-US-00011 TABLE 8 Short Antisense Compounds targeted to SEQ ID
NO: 5 5' 3' SEQ ISIS Target Target Gapmer ID NO. Site Site Sequence
(5'-3') Motif NO 387541 85 100 GTCGCCCTTCAGCACG 3-10-3 MOE 406
387540 86 99 TCGCCCTTCAGCAC 2-10-2 MOE 407 387539 87 98
CGCCCTTCAGCA 1-10-1 MOE 408
[0520] In certain embodiments, a target region is nucleotides
85-100 of SEQ ID NO: 5. In certain such embodiments, short
antisense compounds targeted to nucleotides 85-100 of SEQ ID NO: 5
comprise a nucleotide sequence selected from SEQ ID NO: 406, 407,
or 408. In certain such embodiments, a short antisense compound
targeted to nucleotides 85-100 of SEQ ID NO: 5 is selected from
Isis No. 387541, 387540, or 387539.
[0521] In certain embodiments, short antisense compounds targeted
to a SOD1 nucleic acid are 8 to 16, preferably 9 to 15, more
preferably 9 to 14, more preferably 10 to 14 nucleotides in length.
In certain embodiments, short antisense compounds targeted to a
SOD1 nucleic acid are 9 to 14 nucleotides in length. In certain
embodiments, short antisense compounds targeted to a SOD1 nucleic
acid are 10 to 14 nucleotides in length. In certain embodiments,
such short antisense compounds are short antisense
oligonucleotides.
[0522] In certain embodiments, short antisense compounds targeted
to a SOD1 nucleic acid are short gapmers. In certain such
embodiments, short gapmers targeted to a SOD1 nucleic acid comprise
at least one high affinity modification in one or more wings of the
compound. In certain embodiments, short antisense compounds
targeted to a SOD1 nucleic acid comprise 1 to 3 high-affinity
modifications in each wing. In certain such embodiments, the
nucleosides or nucleotides of the wing comprise a 2' modification.
In certain such embodiments, the monomers of the wing are BNA's. In
certain such embodiments, the monomers of the wing are selected
from .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2') BNA,
.beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA, Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') BNA, Aminooxy (4'-CH.sub.2--O--N(R)-2')
BNA and Oxyamino (4'-CH.sub.2--N(R)-0-2') BNA. In certain
embodiments, the monomers of a wing comprise a substituent at the
2' position selected from allyl, amino, azido, thio, O-allyl,
O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), and
O--CH.sub.2C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. In certain embodiments, the monomers of a
wing are 2'MOE nucleotides.
[0523] In certain embodiments, short antisense compounds targeted
to a SOD1 nucleic acid comprise a gap between the 5' wing and the
3' wing. In certain embodiments the gap comprises five, six, seven,
eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
In certain embodiments, the monomers of the gap are unmodified
deoxyribonucleotides. In certain embodiments, the monomers of the
gap are unmodified ribonucleotides. In certain embodiments, gap
modifications (if any) gap result in an antisense compound that,
when bound to its target nucleic acid, supports cleavage by an
RNase, including, but not limited to, RNase H.
[0524] In certain embodiments, short antisense compounds targeted
to a SOD1 nucleic acid have uniform monomeric linkages. In certain
such embodiments, those linkages are all phosphorothioate linkages.
In certain embodiments, the linkages are all phosphodiester
linkages. In certain embodiments, short antisense compounds
targeted to a SOD1 nucleic acid have mixed backbones.
[0525] In certain embodiments, short antisense compounds targeted
to a SOD1 nucleic acid are 8 monomers in length. In certain
embodiments, short antisense compounds targeted to a SOD1 nucleic
acid are 9 monomers in length. In certain embodiments, short
antisense compounds targeted to a SOD1 nucleic acid are 10 monomers
in length. In certain embodiments, short antisense compounds
targeted to a SOD1 nucleic acid are 11 monomers in length. In
certain embodiments, short antisense compounds targeted to a SOD1
nucleic acid are monomers in length. In certain embodiments, short
antisense compounds targeted to a SOD1 nucleic acid are 13 monomers
in length. In certain embodiments, short antisense compounds
targeted to a SOD1 nucleic acid are 14 monomers in length. In
certain embodiments, short antisense compounds targeted to a SOD1
nucleic acid are 15 monomers in length. In certain embodiments,
short antisense compounds targeted to a SOD1 nucleic acid are 16
monomers in length. In certain embodiments, short antisense
compounds targeted to a SOD1 nucleic acid comprise 9 to 15
monomers. In certain embodiments, short antisense compounds
targeted to a SOD1 nucleic acid comprise 10 to 15 monomers. In
certain embodiments, short antisense compounds targeted to a SOD1
nucleic acid comprise 12 to 14 monomers. In certain embodiments,
short antisense compounds targeted to a SOD1 nucleic acid comprise
12 to 14 nucleotides or nucleosides.
[0526] In certain embodiments, the invention provides methods of
modulating expression of SOD1. In certain embodiments, such methods
comprise use of one or more short antisense compound targeted to a
SOD1 nucleic acid, wherein the short antisense compound targeted to
a SOD1 nucleic acid is from about 8 to about 16, preferably 9 to
15, more preferably 9 to 14, more preferably 10 to 14 monomers
(i.e. from about 8 to about 16 linked monomers). One of ordinary
skill in the art will appreciate that this comprehends methods of
modulating expression of SOD1 using one or more short antisense
compounds targeted to a SOD1 nucleic acid of 8, 9, 10, 11, 12, 13,
14, 15 or 16 monomers.
[0527] In certain embodiments, methods of modulating SOD1 comprise
use of a short antisense compound targeted to a SOD1 nucleic acid
that is 8 monomers in length. In certain embodiments, methods of
modulating SOD1 comprise use of a short antisense compound targeted
to a SOD1 nucleic acid that is 9 monomers in length. In certain
embodiments, methods of modulating SOD1 comprise use of a short
antisense compound targeted to a SOD1 nucleic acid that is 10
monomers in length. In certain embodiments, methods of modulating
SOD1 comprise use of a short antisense compound targeted to a SOD1
nucleic acid that is 11 monomers in length. In certain embodiments,
methods of modulating SOD1 comprise use of a short antisense
compound targeted to a SOD1 nucleic acid that is 12 monomers in
length. In certain embodiments, methods of modulating SOD1 comprise
use of a short antisense compound targeted to a SOD1 nucleic acid
that is 13 monomers in length. In certain embodiments, methods of
modulating SOD1 comprise use of a short antisense compound targeted
to a SOD1 nucleic acid that is 14 monomers in length. In certain
embodiments, methods of modulating SOD1 comprise use of a short
antisense compound targeted to a SOD1 nucleic acid that is 15
monomers in length. In certain embodiments, methods of modulating
SOD1 comprise use of a short antisense compound targeted to a SOD1
nucleic acid that is 16 monomers in length.
[0528] In certain embodiments, methods of modulating expression of
SOD1 comprise use of a short antisense compound targeted to a SOD1
nucleic acid comprising 9 to 15 monomers. In certain embodiments,
methods of modulating expression of SOD1 comprise use of a short
antisense compound targeted to a SOD1 nucleic acid comprising 10 to
15 monomers. In certain embodiments, methods of modulating
expression of SOD1 comprise use of a short antisense compound
targeted to a SOD1 nucleic acid comprising 12 to 14 monomers. In
certain embodiments, methods of modulating expression of SOD1
comprise use of a short antisense compound targeted to a SOD1
nucleic acid comprising 12 or 14 nucleotides or nucleosides.
[0529] 5. CRP
[0530] CRP (also known as C-reactive protein and PTX1) is an
essential human acute-phase reactant produced in the liver in
response to a variety of inflammatory cytokines. The protein, first
identified in 1930, is highly conserved and considered to be an
early indicator of infectious or inflammatory conditions. Plasma
CRP levels increase 1,000-fold in response to infection, ischemia,
trauma, burns, and inflammatory conditions. In clinical trials
where patients receive lipid-lowering therapy, such as statin
therapy, it has been demonstrated that patients having reductions
in both LDL-C and CRP have a reduced risk of future coronary events
relative to patients experiencing only reductions in LDL-C.
Definitions
[0531] "CRP" means the gene product or protein of which expression
is to be modulated by a short antisense compound.
[0532] "CRP nucleic acid" means any nucleic acid encoding CRP. For
example, in certain embodiments, a CRP nucleic acid includes,
without limitations, a DNA sequence encoding CRP, an RNA sequence
transcribed from DNA encoding CRP, and an mRNA sequence encoding
CRP.
[0533] "CRP mRNA" means an mRNA encoding CRP.
CRP Therapeutic Indications
[0534] In certain embodiments, the invention provides methods of
modulating CRP expression in an individual comprising administering
to the individual a short antisense compound targeted to a CRP
nucleic acid. In certain embodiments, the invention provides
methods of treating an individual comprising administering one or
more pharmaceutical compositions comprising a short antisense
compound targeted to a CRP nucleic acid. In certain embodiments,
the individual has hypercholesterolemia, non-familial
hypercholesterolemia, familial hypercholesterolemia, heterozygous
familial hypercholesterolemia, homozygous familial
hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk
of developing atherosclerosis, coronary heart disease, a history of
coronary heart disease, early onset coronary heart disease, one or
more risk factors for coronary heart disease. In certain
embodiments, the individual has acute coronary syndrome, vascular
injury, arterial occlusion, unstable angina, post peripheral
vascular disease, post myocardial infarction (MI), thrombosis, deep
vein thrombus, end-stage renal disease (ESRD), chronic renal
failure, complement activation, congestive heart failure, or
systemic vasculitis. In certain embodiments, the individual has had
a stroke.
[0535] In certain embodiments, the individual has undergone a
procedure selected from elective stent placement, angioplasty, post
percutaneous transluminal angioplasty (PTCA), cardiac
transplantation, renal dialysis or cardiopulmonary bypass.
[0536] In certain embodiments, the individual has an inflammatory
disease. In certain such embodiments, the inflammatory disease is
selected from inflammatory bowel disease, ulcerative colitis,
rheumatoid arthritis, or osteoarthritis.
[0537] Guidelines for lipid-lowering therapy were established in
2001 by Adult Treatment Panel III (ATP III) of the National
Cholesterol Education Program (NCEP), and updated in 2004 (Grundy
et al., Circulation, 2004, 110, 227-239). The guidelines include
obtaining a complete lipoprotein profile, typically after a 9 to 12
hour fast, for determination of LDL-C, total cholesterol, and HDL-C
levels. According to the most recently established guidelines,
LDL-C levels of 130-159 mg/dL, 160-189 mg/dL, and greater than or
equal to 190 mg/dL are considered borderline high, high, and very
high, respectively. Total cholesterol levels of 200-239 and greater
than or equal to 240 mg/dL are considered borderline high and high,
respectively. HDL-C levels of less than 40 mg/dL are considered
low.
[0538] In certain embodiments, the individual has been identified
as in need of lipid-lowering therapy. In certain such embodiments,
the individual has been identified as in need of lipid-lowering
therapy according to the guidelines established in 2001 by Adult
Treatment Panel III (ATP III) of the National Cholesterol Education
Program (NCEP), and updated in 2004 (Grundy et al., Circulation,
2004, 110, 227-239). In certain such embodiments, the individual in
need of lipid-lowering therapy has LDL-C above 190 mg/dL. In
certain such embodiments, the individual in need of lipid-lowering
therapy has LDL-C above 160 mg/dL. In certain such embodiments, the
individual in need of lipid-lowering therapy has LDL-C above 130
mg/dL. In certain such embodiments the individual in need of
lipid-lowering therapy has LDL-C above 100 mg/dL. In certain such
embodiments the individual in need of lipid-lowering therapy should
maintain LDL-C below 160 mg/dL. In certain such embodiments the
individual in need of lipid-lowering therapy should maintain LDL-C
below 130 mg/dL. In certain such embodiments the individual in need
of lipid-lowering therapy should maintain LDL-C below 100 mg/dL. In
certain such embodiments the individual should maintain LDL-C below
70 mg/dL.
[0539] In certain embodiments the invention provides methods for
reducing CRP in an individual. In certain such embodiments, the
reduction in CRP is at least 10%, at least 15%, at least 20%, at
least 25%, at least 30%, at least 35%, at least 40%, at least 45%,
at least 50%, at least 55%, at least 60%, at least 65%, at least
70%, at least 75%, at least 80%, at least 85%, at least 90%, at
least 95%, and at least 100%.
[0540] In certain embodiments, the methods provided by the present
invention do not lower HDL-C. In certain embodiments, the methods
provided by the present invention do not result in accumulation of
lipids in the liver. In certain embodiments, the methods provided
by the present invention do not cause hepatic steatosis.
[0541] In certain embodiments, the invention provides methods for
lowering CRP concentration in a subject while reducing side effects
associated with treatment. In certain such embodiments, a side
effect is liver toxicity. In certain such embodiments, a side
effect is abnormal liver function. In certain such embodiments, a
side effect is elevated alanine aminotransferase (ALT). In certain
such embodiments, a side effect is elevated aspartate
aminotransferase (AST).
[0542] In certain embodiments, the invention provides methods for
lowering CRP concentration in a subject who is not reaching target
LDL-C levels as a result of lipid-lowering therapy. In certain such
embodiments, a short antisense compound targeted to a CRP nucleic
acid is the only pharmaceutical agent administered to the subject.
In certain such embodiments, the subject has not complied with
recommended lipid-lowering therapy. In certain such embodiments, a
pharmaceutical composition of the invention is co-administered with
an additional different lipid-lowering therapy. In certain such
embodiments, an additional lipid-lowering therapy is LDL-apheresis.
In certain such embodiments, an additional lipid-lowering therapy
is a statin. In certain such embodiments, an additional
lipid-lowering therapy is ezetimibe.
[0543] In certain embodiments, the invention provides methods for
lowering CRP concentration in a statin-intolerant subject. In
certain such embodiments, the subject has creatine kinase
concentration increases as a result of statin administration. In
certain such embodiments, the subject has liver function
abnormalities as a result of statin administration. In certain such
embodiments the subject has muscle aches as a result of statin
administration. In certain such embodiments the subject has central
nervous system side effects as a result of statin administration.
In certain embodiments, the subject has not complied with
recommended statin administration.
[0544] In certain embodiments, the invention provides methods for
reducing coronary heart disease risk in a subject. In certain
embodiments the invention provides methods for slowing the
progression of atherosclerosis in a subject. In certain such
embodiments the invention provides methods for stopping the
progression of atherosclerosis in a subject. In certain such
embodiments the invention provides methods for reducing the size
and/or prevalence of atherosclerotic plaques in a subject. In
certain embodiments the methods provided reduce a subject's risk of
developing atherosclerosis.
[0545] In certain embodiments the methods provided improve the
cardiovascular outcome in a subject. In certain such embodiments
improved cardiovascular outcome is the reduction of the risk of
developing coronary heart disease. In certain such embodiments,
improved cardiovascular outcome is a reduction in the occurance of
one or more major cardiovascular events, which include, but are not
limited to, death, myocardial infarction, reinfarction, stroke,
cardiogenic shock, pulmonary edema, cardiac arrest, and atrial
dysrhythmia. In certain such embodiments, the improved
cardiovascular outcome is evidenced by improved carotid intimal
media thickness. In certain such embodiments, improved carotid
intimal media thickness is a decrease in thickness. In certain such
embodiments, improved carotid intimal media thickness is a
prevention an increase of intimal media thickness.
[0546] In certain embodiments a pharmaceutical composition
comprising a short antisense compound targeted to a CRP nucleic
acid is for use in therapy. In certain embodiments, the therapy is
the reduction of CRP in an individual. In certain embodiments, the
therapy is the treatment of hypercholesterolemia, non-familial
hypercholesterolemia, familial hypercholesterolemia, heterozygous
familial hypercholesterolemia, homozygous familial
hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk
of developing atherosclerosis, coronary heart disease, a history of
coronary heart disease, or early onset coronary heart disease. In
additional embodiments, the therapy is the reduction of CHD risk.
In certain the therapy is prevention of atherosclerosis. In certain
embodiments, the therapy is the prevention of coronary heart
disease. In certain embodiments, the therapy is the treatment of
acute coronary syndrome, chronic renal failure, vascular injury,
arterial occlusion, atherothrombosis, unstable angina, post
peripheral vascular disease, post myocardial infarction (MI),
thrombosis, deep vein thrombus, end-stage renal disease (ESRD),
complement activation, congestive heart failure, or systemic
vasculitis. In certain embodiments the therapy is the treatment of
an individual who has undergone a procedure selected from elective
stent placement, angioplasty, post percutaneous transluminal
angioplasty (PTCA), cardiac transplantation, renal dialysis or
cardiopulmonary bypass. In certain embodiments, the therapy is the
treatment of an inflammatory disorder.
[0547] In certain embodiments a pharmaceutical composition
comprising a short antisense compound targeted to a CRP nucleic
acid is used for the preparation of a medicament for reducing CRP
in an individual. In certain embodiments pharmaceutical composition
comprising a short antisense compound targeted to a CRP nucleic
acid is used for the preparation of a medicament for reducing
coronary heart disease risk. In certain embodiments a short
antisense compound targeted to a CRP nucleic acid is used for the
preparation of a medicament for the treatment of
hypercholesterolemia, non-familial hypercholesterolemia, familial
hypercholesterolemia, heterozygous familial hypercholesterolemia,
homozygous familial hypercholesterolemia, mixed dyslipidemia,
atherosclerosis, a risk of developing atherosclerosis, coronary
heart disease, a history of coronary heart disease, early onset
coronary heart disease, or one or more risk factors for coronary
heart disease.
[0548] In certain embodiments, a short antisense compound targeted
to a CRP nucleic acid is used for the preparation of a medicament
for the treatment of acute coronary syndrome, chronic renal
failure, vascular injury, arterial occlusion, atherothrombosis,
unstable angina, post peripheral vascular disease, post myocardial
infarction (MI), thrombosis, deep vein thrombus, end-stage renal
disease (ESRD), complement activation, congestive heart failure, or
systemic vasculitis. In certain embodiments, a short antisense
compound targeted to a CRP nucleic acid is used for the preparation
of a medicament for the treatment of an individual who has had a
stroke.
[0549] In certain embodiments, a short antisense compound targeted
to a CRP nucleic acid is used for the preparation of a medicament
for the treatment in an individual who has undergone a procedure
selected from elective stent placement, angioplasty, post
percutaneous transluminal angioplasty (PTCA), cardiac
transplantation, renal dialysis or cardiopulmonary bypass.
[0550] In certain embodiments, a short antisense compound targeted
to a CRP nucleic acid is used for the preparation of a medicament
for the treatment of an inflammatory disease. In certain such
embodiments, a short antisense compound targeted to a CRP nucleic
acid is used for the preparation of a medicament for the treatment
of inflammatory bowel disease, ulcerative colitis, rheumatoid
arthritis, or osteoarthritis.
CRP Combination Therapies
[0551] In certain embodiments, one or more pharmaceutical
compositions comprising a short antisense compound targeted to a
CRP nucleic acid are co-administered with one or more other
pharmaceutical agents. In certain embodiments, the one or more
other pharmaceutical agents is a lipid-lowering agent. In certain
embodiments, such one or more other pharmaceutical agents are
designed to treat the same disease or condition as the one or more
pharmaceutical compositions of the present invention. In certain
embodiments, such one or more other pharmaceutical agents are
designed to treat a different disease or condition as the one or
more pharmaceutical compositions of the present invention. In
certain embodiments, such one or more other pharmaceutical agents
are designed to treat an undesired effect of one or more
pharmaceutical compositions of the present invention. In certain
embodiments, one or more pharmaceutical compositions of the present
invention are co-administered with another pharmaceutical agent to
treat an undesired effect of that other pharmaceutical agent. In
certain embodiments, one or more pharmaceutical compositions of the
present invention and one or more other pharmaceutical agents are
administered at the same time. In certain embodiments, one or more
pharmaceutical compositions of the present invention and one or
more other pharmaceutical agents are administered at different
times. In certain embodiments, one or more pharmaceutical
compositions of the present invention and one or more other
pharmaceutical agents are prepared together in a single
formulation. In certain embodiments, one or more pharmaceutical
compositions of the present invention and one or more other
pharmaceutical agents are prepared separately.
[0552] In certain embodiments, pharmaceutical agents that may be
co-administered with a pharmaceutical composition comprising a
short antisense compound targeted to a CRP nucleic acid include
lipid-lowering agents. In certain such embodiments, pharmaceutical
agents that may be co-administered with a pharmaceutical
composition of the present invention include, but are not limited
to atorvastatin, simvastatin, rosuvastatin, and ezetimibe. In
certain such embodiments, the lipid-lowering agent is administered
prior to administration of a pharmaceutical composition of the
present invention. In certain such embodiments, the lipid-lowering
agent is administered following administration of a pharmaceutical
composition of the present invention. In certain such embodiments
the lipid-lowering agent is administered at the same time as a
pharmaceutical composition of the present invention. In certain
such embodiments the dose of a co-administered lipid-lowering agent
is the same as the dose that would be administered if the
lipid-lowering agent was administered alone. In certain such
embodiments the dose of a co-administered lipid-lowering agent is
lower than the dose that would be administered if the
lipid-lowering agent was administered alone. In certain such
embodiments the dose of a co-administered lipid-lowering agent is
greater than the dose that would be administered if the
lipid-lowering agent was administered alone.
[0553] In certain embodiments, a co-administered lipid-lowering
agent is a HMG-CoA reductase inhibitor. In certain such embodiments
the HMG-CoA reductase inhibitor is a statin. In certain such
embodiments the statin is selected from atorvastatin, simvastatin,
pravastatin, fluvastatin, and rosuvastatin.
[0554] In certain embodiments, a co-administered lipid-lowering
agent is ISIS 301012.
[0555] In certain embodiments, a co-administered lipid-lowering
agent is a cholesterol absorption inhibitor. In certain such
embodiments, cholesterol absorption inhibitor is ezetimibe.
[0556] In certain embodiments, a co-administered lipid-lowering
agent is a co-formulated HMG-CoA reductase inhibitor and
cholesterol absorption inhibitor. In certain such embodiments the
co-formulated lipid-lowering agent is ezetimibe/simvastatin.
[0557] In certain embodiments, a co-administered lipid-lowering
agent is a microsomal triglyceride transfer protein inhibitor (MTP
inhibitor).
[0558] In certain embodiments, a co-administered pharmaceutical
agent is a bile acid sequestrant. In certain such embodiments, the
bile acid sequestrant is selected from cholestyramine, colestipol,
and colesevelam.
[0559] In certain embodiments, a co-administered pharmaceutical
agent is a nicotinic acid. In certain such embodiments, the
nicotinic acid is selected from immediate release nicotinic acid,
extended release nicotinic acid, and sustained release nicotinic
acid.
[0560] In certain embodiments, a co-administered pharmaceutical
agent is a fibric acid. In certain such embodiments, a fibric acid
is selected from gemfibrozil, fenofibrate, clofibrate, bezafibrate,
and ciprofibrate.
[0561] Further examples of pharmaceutical agents that may be
co-administered with a pharmaceutical composition comprising a
short antisense compound targeted to a CRP nucleic acid include,
but are not limited to, corticosteroids, including but not limited
to prednisone; immunoglobulins, including, but not limited to
intravenous immunoglobulin (IVIg); analgesics (e.g.,
acetaminophen); anti-inflammatory agents, including, but not
limited to non-steroidal anti-inflammatory drugs (e.g., ibuprofen,
COX-1 inhibitors, and COX-2, inhibitors); salicylates; antibiotics;
antivirals; antifungal agents; antidiabetic agents (e.g.,
biguanides, glucosidase inhibitors, insulins, sulfonylureas, and
thiazolidenediones); adrenergic modifiers; diuretics; hormones
(e.g., anabolic steroids, androgen, estrogen, calcitonin,
progestin, somatostan, and thyroid hormones); immunomodulators;
muscle relaxants; antihistamines; osteoporosis agents (e.g.,
biphosphonates, calcitonin, and estrogens); prostaglandins,
antineoplastic agents; psychotherapeutic agents; sedatives; poison
oak or poison sumac products; antibodies; and vaccines.
[0562] In certain embodiments, a pharmaceutical composition
comprising a short antisense compound targeted to a CRP nucleic
acid may be administered in conjuction with a lipid-lowering
therapy. In certain such embodiments, a lipid-lowering therapy is
therapeutic lifestyle change. In certain such embodiments, a
lipid-lowering therapy is LDL apheresis.
Certain Short Antisense Compounds Targeted to a CRP Nucleic
Acid
[0563] In certain embodiments, short antisense compounds are
targeted to a CRP nucleic acid having the sequence of GENBANK.RTM.
Accession No. NM.sub.--000567.1, incorporated herein as SEQ ID NO:
6. In certain such embodiments, a short antisense compound targeted
to SEQ ID NO: 6 is at least 90% complementary to SEQ ID NO: 6. In
certain such embodiments, a short antisense compound targeted to
SEQ ID NO: 6 is at least 95% complementary to SEQ ID NO: 6. In
certain such embodiments, a short antisense compound targeted to
SEQ ID NO: 6 is 100% complementary to SEQ ID NO: 6. In certain
embodiments, a short antisense compound targeted to SEQ ID NO: 6
comprises a nucleotide sequence selected from the nucleotide
sequences set forth in Table 9.
[0564] The nucleotide sequence set forth in each SEQ ID NO in Table
9 is independent of any modification to a sugar moiety, an
internucleoside linkage, or a nucleobase. As such, short antisense
compounds defined by a SEQ ID NO may comprise, independently, one
or more modifications to a sugar moiety, an internucleoside
linkage, or a nucleobase. Short antisense compounds described by
Isis Number (Isis NO.) indicate a combination of nucleobase
sequence and one or more modifications to a sugar moiety, an
internucleoside linkage, or a nucleobase.
[0565] Table 9 illustrates examples of short antisense compounds
targeted to SEQ ID NO: 6. Table 9 illustrates short antisense
compounds that are 100% complementary to SEQ ID NO: 6. The column
labeled `gapmer motif` indicates the wing-gap-wing motif of each
short antisense compounds. The gap segment comprises
2'-deoxynucleotides and each nucleotide of each wing segment
comprises a 2'-modified sugar. The particular 2'-modified sugar is
also indicated in the `gapmer motif` column. For example, `2-10-2
MOE` means a 2-10-2 gapmer motif, where a gap segment of ten
2'-deoxynucleotides is flanked by wing segments of two nucleotides,
where the nucleotides of the wing segments are 2'-MOE nucleotides.
Internucleoside linkages are phosphorothioate. The short antisense
compounds comprise 5-methylcytidine in place of unmodified
cytosine, unless "unmodified cytosine" is listed in the gapmer
motif column, in which case the indicated cytosines are unmodified
cytosines. For example, "5-mC in gap only" indicates that the gap
segment has 5-methylcytosines, while the wing segments have
unmodified cytosines.
[0566] In certain embodiments, short antisense compounds targeting
a CRP nucleic acid may have any one or more properties or
characteristics of the short antisense compounds generally
described herein. In certain embodiments, short antisense compounds
targeting a CRP nucleic acid have a motif (wing-deoxy gap-wing)
selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2,
1-10-1, 1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more
preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.
TABLE-US-00012 TABLE 9 Short Antisense Compounds targeted to SEQ ID
NO: 6 5' 3' Seq ISIS Target Target Gapmer ID NO. Site Site Sequence
(5'-3') Motif NO 353506 1257 1272 ACTCTGGACCCAAACC 3-10-3 MOE 409
353507 1258 1271 CTCTGGACCCAAAC 2-10-2 MOE 410 353484 1305 1320
CCATTTCAGGAGACCT 3-10-3 MOE 411 353485 1306 1319 CATTTCAGGAGACC
2-10-2 MOE 412
[0567] In certain embodiments, a target region is nucleotides
1305-1320 of NM.sub.--000567.1. In certain such embodiments, short
antisense compounds targeted to nucleotides 1305-1320 of
NM.sub.--000567.1 comprise a nucleotide sequence selected from SEQ
ID NO: 1305 or 1306. In certain such embodiments, a short antisense
compound targeted to nucleotides 263-278 of NM.sub.--000567.1 is
selected from Isis NO. 353484 or 353485.
[0568] In certain embodiments, a target region is nucleotides
1257-1272 of NM.sub.--000567.1. In certain such embodiments, a
short antisense compound targeted to nucleotides 1257-1272 of
NM.sub.--000567.1 comprises a nucleotide sequence selected from SEQ
ID NO 1257 or 1258. In certain such embodiments, a short antisense
compound targeted to nucleotides 428-483 of NM.sub.--000567.1 is
selected from Isis NO. 353506 or 353507.
[0569] In certain embodiments, short antisense compounds targeted
to a CRP nucleic acid are 8 to 16, preferably 9 to 15, more
preferably 9 to 14, more preferably 10 to 14 nucleotides in length.
In certain embodiments, short antisense compounds targeted to a CRP
nucleic acid are 9 to 14 nucleotides in length. In certain
embodiments, short antisense compounds targeted to a CRP nucleic
acid are 10 to 14 nucleotides in length. In certain embodiments,
such short antisense compounds are short antisense
oligonucleotides.
[0570] In certain embodiments, short antisense compounds targeted
to a CRP nucleic acid are short gapmers. In certain such
embodiments, short gapmers targeted to a CRP nucleic acid comprise
at least one high affinity modification in one or more wings of the
compound. In certain embodiments, short antisense compounds
targeted to a CRP nucleic acid comprise 1 to 3 high-affinity
modifications in each wing. In certain such embodiments, the
nucleosides or nucleotides of the wing comprise a 2' modification.
In certain such embodiments, the monomers of the wing are BNA's. In
certain such embodiments, the monomers of the wing are selected
from .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2') BNA,
.beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA, Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') BNA, Aminooxy (4'-CH.sub.2--O--N(R)-2')
BNA and Oxyamino (4'-CH.sub.2--N(R)--O-2') BNA. In certain
embodiments, the monomers of a wing comprise a substituent at the
2' position selected from allyl, amino, azido, thio, O-allyl,
O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), and
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. In certain embodiments, the monomers of a
wing are 2'MOE nucleotides.
[0571] In certain embodiments, short antisense compounds targeted
to a CRP nucleic acid comprise a gap between the 5' wing and the 3'
wing. In certain embodiments the gap comprises five, six, seven,
eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
In certain embodiments, the monomers of the gap are unmodified
deoxyribonucleotides. In certain embodiments, the monomers of the
gap are unmodified ribonucleotides. In certain embodiments, gap
modifications (if any) gap result in an antisense compound that,
when bound to its target nucleic acid, supports cleavage by an
RNase, including, but not limited to, RNase H.
[0572] In certain embodiments, short antisense compounds targeted
to a CRP nucleic acid have uniform monomeric linkages. In certain
such embodiments, those linkages are all phosphorothioate linkages.
In certain embodiments, the linkages are all phosphodiester
linkages. In certain embodiments, short antisense compounds
targeted to a CRP nucleic acid have mixed backbones.
[0573] In certain embodiments, short antisense compounds targeted
to a CRP nucleic acid are 8 monomers in length. In certain
embodiments, short antisense compounds targeted to a CRP nucleic
acid are 9 monomers in length. In certain embodiments, short
antisense compounds targeted to a CRP nucleic acid are 10 monomers
in length. In certain embodiments, short antisense compounds
targeted to a CRP nucleic acid are 11 monomers in length. In
certain embodiments, short antisense compounds targeted to a CRP
nucleic acid are monomers in length. In certain embodiments, short
antisense compounds targeted to a CRP nucleic acid are 13 monomers
in length. In certain embodiments, short antisense compounds
targeted to a CRP nucleic acid are 14 monomers in length. In
certain embodiments, short antisense compounds targeted to a CRP
nucleic acid are 15 monomers in length. In certain embodiments,
short antisense compounds targeted to a CRP nucleic acid are 16
monomers in length. In certain embodiments, short antisense
compounds targeted to a CRP nucleic acid comprise 9 to 15 monomers.
In certain embodiments, short antisense compounds targeted to a CRP
nucleic acid comprise 10 to 15 monomers. In certain embodiments,
short antisense compounds targeted to a CRP nucleic acid comprise
12 to 14 monomers. In certain embodiments, short antisense
compounds targeted to a CRP nucleic acid comprise 12 to 14
nucleotides or nucleosides.
[0574] In certain embodiments, the invention provides methods of
modulating expression of CRP. In certain embodiments, such methods
comprise use of one or more short antisense compound targeted to a
CRP nucleic acid, wherein the short antisense compound targeted to
a CRP nucleic acid is from about 8 to about 16, preferably 9 to 15,
more preferably 9 to 14, more preferably 10 to 14 monomers (i.e.
from about 8 to about 16 linked monomers). One of ordinary skill in
the art will appreciate that this comprehends methods of modulating
expression of CRP using one or more short antisense compounds
targeted to a CRP nucleic acid of 8, 9, 10, 11, 12, 13, 14, 15 or
16 monomers.
[0575] In certain embodiments, methods of modulating CRP comprise
use of a short antisense compound targeted to a CRP nucleic acid
that is 8 monomers in length. In certain embodiments, methods of
modulating CRP comprise use of a short antisense compound targeted
to a CRP nucleic acid that is 9 monomers in length. In certain
embodiments, methods of modulating CRP comprise use of a short
antisense compound targeted to a CRP nucleic acid that is 10
monomers in length. In certain embodiments, methods of modulating
CRP comprise use of a short antisense compound targeted to a CRP
nucleic acid that is 11 monomers in length. In certain embodiments,
methods of modulating CRP comprise use of a short antisense
compound targeted to a CRP nucleic acid that is 12 monomers in
length. In certain embodiments, methods of modulating CRP comprise
use of a short antisense compound targeted to a CRP nucleic acid
that is 13 monomers in length. In certain embodiments, methods of
modulating CRP comprise use of a short antisense compound targeted
to a CRP nucleic acid that is 14 monomers in length. In certain
embodiments, methods of modulating CRP comprise use of a short
antisense compound targeted to a CRP nucleic acid that is 15
monomers in length. In certain embodiments, methods of modulating
CRP comprise use of a short antisense compound targeted to a CRP
nucleic acid that is 16 monomers in length.
[0576] In certain embodiments, methods of modulating expression of
CRP comprise use of a short antisense compound targeted to a CRP
nucleic acid comprising 9 to 15 monomers. In certain embodiments,
methods of modulating expression of CRP comprise use of a short
antisense compound targeted to a CRP nucleic acid comprising 10 to
15 monomers. In certain embodiments, methods of modulating
expression of CRP comprise use of a short antisense compound
targeted to a CRP nucleic acid comprising 12 to 14 monomers. In
certain embodiments, methods of modulating expression of CRP
comprise use of a short antisense compound targeted to a CRP
nucleic acid comprising 12 or 14 nucleotides or nucleosides.
[0577] 6. Glucocorticoid Receptor (GCCR)
[0578] Glucocorticoids were among the first steroid hormones to be
identified and are responsible for a multitude of physiological
functions, including the stimulation of gluconeogenesis, decreased
glucose uptake and utilization in peripheral tissues, increased
glycogen deposition, suppression of immune and inflammatory
responses, inhibition of cytokine synthesis and acceleration of
various developmental events. Glucocorticoids are also especially
important for combating stress. Stress-induced elevation of
glucocorticoid synthesis and release leads to, among other
responses, increased ventricular workload, inhibition of
inflammatory mediators, inhibition of cytokine synthesis and
increased glucose production (Karin, Cell, 1998, 93, 487-490).
[0579] Both natural glucocorticoids and their synthetic derivatives
exert their action through the glucocorticoid receptor, a
ubiquitously expressed cytoplasmic member of the nuclear hormone
superfamily of receptors. Human glucocorticoid receptor is also
known as nuclear receptor subfamily 3, group C, member 1; NR3C1;
GCCR; GCR; GRL; Glucocorticoid receptor, lymphocyte. The gene is
located on human chromosome 5q11-q13 and consists of 9 exons (Encio
and Detera-Wadleigh, J Biol Chem, 1991, 266, 7182-7188; Gehring et
al., Proc Natl Acad Sci USA, 1985, 82, 3751-3755). Multiple forms
of human glucocorticoid receptor mRNA exist: a 5.5 kb human
glucocorticoid receptor a cDNA containing exons 1-8 and exon
9.alpha.; a 4.3 kb human glucocorticoid receptor 0 cDNA containing
exons 1-8 and exon 90; and a 7.0 kb human glucocorticoid receptor a
cDNA containing exons 1-8 and the entire exon 9, which includes
exon 9.alpha., exon 9.beta. and the `J region`, which is flanked by
exons 9.alpha. and 9.beta. (Hollenberg et al., Nature, 1985, 318,
635-641; Oakley et al., J Biol Chem, 1996, 271, 9550-9559). Human
glucocorticoid receptor a is the predominant isoform of the
receptor and the one that exhibits steroid binding activity
(Hollenberg et al., Nature, 1985, 318, 635-641). Additionally,
through usage of three different promoters three different exon 1
variants can be transcribed, and alternative splicing of one exon 1
variant can result in three different versions of this exon. Thus,
human glucocorticoid receptor mRNA may contain 5 different versions
of exon 1 (Breslin et al., Mol Endocrinol, 2001, 15,
1381-1395).
[0580] Examination of the expression patterns of the .alpha. and
.beta. isoforms of human glucocorticoid receptor mRNA reveals that
the a isoform is more abundantly expressed. Both isoforms are
expressed in similar tissues and cell types, including lung,
kidney, heart, liver, skeletal muscle, macrophages, neutrophils and
peripheral blood mononuclear cells. Only human glucocorticoid
receptor a is expressed in colon. At the level of protein, while
the .alpha. isoform is detected in all tissues examined, the .beta.
isoform is undetectable, suggesting that under physiological
conditions, the default splicing pathway is the one that produces
the .alpha. isoform (Pujols et al., Am J Physiol Cell Physiol,
2002, 283, C1324-1331). The .beta. isoform of glucocorticoid
receptor binds neither a glucocorticoid agonist nor an antagonist.
Furthermore, the .beta. isoform is localized primarily in the
nucleus in transfected cells, independent of hormone stimulation.
When both isoforms are expressed in the same cell, the
glucocorticoid receptor .beta. inhibits the hormone-induced,
glucocorticoid receptor .alpha.-mediated stimulation of gene
expression, suggesting that the .beta. isoform functions as an
inhibitor of glucocorticoid receptor .alpha. activity (Oakley et
al., J Biol Chem, 1996, 271, 9550-9559). Unless otherwise noted,
the human glucocorticoid receptor described herein is defined as
the ubiquitous product(s) of the gene located on chromosome
5q11-q13.
[0581] Cell lines transfected with a complementary glucocorticoid
receptor antisense RNA strand exhibited a reduction in
glucocorticoid receptor mRNA levels and a decreased response to the
glucocorticoid receptor agonist dexamethasone (Pepin and Barden,
Mol Cell Biol, 1991, 11, 1647-1653). Transgenic mice bearing an
antisense glucocorticoid receptor gene construct were used to study
the glucocorticoid feedback effect on the
hypothalamus-pituitary-adrenal axis (Pepin et al., Nature, 1992,
355, 725-728). In another study of similarly genetically engineered
mice, energy intake and expenditure, heart and vastus lateralis
muscle lipoprotein lipase activity, and heart and brown adipose
tissue norepinephrine were lower than in control animals.
Conversely, fat content and total body energy were significantly
higher than in control animals. These results suggest that a
defective glucocorticoid receptor system may affect energy balance
through increasing energetic efficiency, and they emphasize the
modulatory effects of hypothalamic-pituitary-adrenal axis changes
on muscle lipoprotein lipase activity (Richard et al., Am J
Physiol, 1993, 265, R146-150).
[0582] Behavorial effects of glucocorticoid receptor antagonists
have been measured in animal models designed to assess anxiety,
learning and memory. Reduced expression of glucocorticoid receptor
in rats long-term intracerebroventricularly infused with antisense
oligodeoxynucleotides targeting glucocorticoid receptor mRNA did
not interfere with spatial navigation in the Morris water maze test
(Engelmann et al., Eur J Pharmacol, 1998, 361, 17-26). Bilateral
infusion of an antisense oligodeoxynucleotide targeting the
glucocorticoid receptor mRNA into the dentate gyrus of the rat
hippocampus reduced the immobility of rats in the Porsolt forced
swim test (Korte et al., Eur J Pharmacol, 1996, 301, 19-25).
[0583] Glucocorticoids are frequently used for their
immunosuppressive, anti-inflammatory effects in the treatment of
diseases such as allergies, athsma, rheumatoid arthritis, AIDS,
systemic lupus erythematosus and degenerative osteoarthritis.
Negative regulation of gene expression, such as that caused by the
interaction of glucocorticoid receptor with NF-kB, is proposed to
be at least partly responsible for the anti-inflammatory action of
glucocorticoids in vivo. Interleukin-6, tumor necrosis factor
.alpha. and interleukin-1 are the three cytokines that account for
most of the hypothalamic-pituitary-adrenal (HPA) axis stimulation
during the stress of inflammation. The HPA axis and the systemic
sympathetic and adrenomedullary system are the peripheral
components of the stress system, responsible for maintaining basal
and stress-related homeostasis. Glucocorticoids, the end products
of the HPA axis, inhibit the production of all three inflammatory
cytokines and also inhibit their effects on target tissues, with
the exception of interleukin-6, which acts synergistically with
glucocorticoids to stimulate the production of acute-phase
reactants. Glucocorticoid treatment decreases the activity of the
HPA axis (Chrousos, N Engl J Med, 1995, 332, 1351-1362).
[0584] In some cases, patients are refractory to glucocorticoid
treatment. One reason for this resistance to steroids lies with
mutations or polymorphisms present in the glucocorticoid receptor
gene. A total of 15 missense, three nonsense, three frameshift, one
splice site, and two alternative spliced mutations, as well as 16
polymorphisms, have been reported in the NR3C1 gene in association
with glucocorticoid resistance (Bray and Cotton, Hum Mutat, 2003,
21, 557-568). Additional studies in humans have suggested a
positive association between metabolic syndrome incidence and
progression, with alleles at the glucocorticoid receptor (GR) gene
(Rosmond, Obes Res, 2002, 10, 1078-1086).
[0585] Other cases of glucocorticoid insensitivity are associated
with altered expression of glucocorticoid receptor isoforms. A
study of human glucocorticoid receptor .beta. isoform mRNA
expression in glucocorticoid-resistant ulcerative colitis patients
revealed the presence of this mRNA was significantly higher than in
the glucocorticoid-sensitive patients, suggesting that the
expression of human glucocorticoid receptor .beta. mRNA in the
peripheral blood mononuclear cells may serve as a predictor of
glucocorticoid response in ulcerative colitis (Honda et al.,
Gastroenterology, 2000, 118, 859-866). Increased expression of
glucocorticoid receptor .beta. is also observed in a significantly
high number of glucocorticoid-insensitive asthmatics. Additionally,
cytokine-induced abnormalities in the DNA binding capacity of the
glucocorticoid receptor were found in peripheral blood mononuclear
cells from glucocorticoid-insensitive patients transfection, and
HepG2 cells with the glucocorticoid receptor, gene resulted in a
significant reduction of glucocorticoid receptor a DNA-binding
capacity (Leung et al., J Exp Med, 1997, 186, 1567-1574).
Dexamethasone binding studies demonstrate that human glucocorticoid
receptor P does not alter the affinity of glucocorticoid receptor a
for hormonal ligands, but rather its ability to bind to the GRE
(Bamberger et al., J Clin Invest, 1995, 95, 2435-2441). Taken
together, these results illustrate that glucocorticoid receptor
.beta. through competition with glucocorticoid receptor a for GRE
target sites, may function as a physiologically and
pathophysiologically relevant endogenous inhibitor of
glucocorticoid action.
[0586] In the liver, glucocorticoid agonists increase hepatic
glucose production by activating the glucocorticoid receptor, which
subsequently leads to increased expression of the gluconeogenic
enzymes phosphoenolpyruvate carboxykinase (PEPCK) and
glucose-6-phosphatase. Through gluconeogenesis, glucose is formed
through non-hexose precursors, such as lactate, pyruvate and
alanine (Link, Curr Opin Investig Drugs, 2003, 4, 421-429).
Steroidal glucocorticoid receptor antagonists such as RU 486 have
been tested in rodent models of diabetes. Mice deficient in the
leptin receptor gene, termed db/db mice, are genetically obese,
diabetic and hyperinsulinemic. Treatment of hyperglycemic db/db
mice with RU 486 decreased blood glucose levels by approximately
49%, without affecting plasma insulin levels. Additionally, RU 486
treatment reduced the expression of glucocorticoid receptor
responsive genes PEPCK, glucose-6-phosphatase, glucose transporter
type 2 and tyrosine aminotransferase in db/db mice as compared to
untreated animals (Friedman et al., J Biol Chem, 1997, 272,
31475-31481). RU 486 also ameliorates diabetes in the ob/ob mouse
model of diabetes, obesity and hyperinsulinemia, through a
reduction in serum insulin and blood glucose levels (Gettys et al.,
Int J Obes Relat Metab Disord, 1997, 21, 865-873).
[0587] As increased gluconeogenesis is considered to be the major
source of increased glucose production in diabetes, a number of
therapeutic targets for the inhibition of hepatic glucose
production have been investigated. Due to the ability of
antagonists of the glucocorticoid receptor to ameliorate diabetes
in animal models, such compounds are among the potential therapies
being explored. However, there are detrimental systemic effects of
glucocorticoid receptor antagonists, including activation of the
HPA axis (Link, Curr Opin Investig Drugs, 2003, 4, 421-429).
Increased HPA axis activity is associated with suppression of
immune-related inflammatory action, which can increase
susceptibility to infectious agents and neoplasms. Conditions
associated with suppression of immune-mediated inflammation through
defects in the HPA axis, or its target tissues, include Cushing's
syndrome, chronic stress, chronic alcoholism and melancholic
depression (Chrousos, N Engl J Med, 1995, 332, 1351-1362). Thus, it
is of great value to develop liver-specific glucocorticoid receptor
antagonists. Steroidal glucocorticoid receptor antagonists have
been conjugated to bile acids for the purpose of targeting them to
the liver (Apelqvist et al., 2000). Currently, there are no known
therapeutic agents that target the glucocorticoid receptor without
undesired peripheral effects (Link, Curr Opin Investig Drugs, 2003,
4, 421-429). Consequently, there remains a long felt need for
agents capable of effectively inhibiting hepatic glucocorticoid
receptor.
Definitions
[0588] "Glucocorticoid receptor" is the gene product or protein of
which expression is to be modulated by administration of a short
antisense compound. Glucocorticoid receptor is generally referred
to as GCCR.
[0589] "GCCR nucleic acid" means any nucleic acid encoding GCCR.
For example, in certain embodiments, a GCCR nucleic acid includes,
without limitation, a DNA sequence encoding GCCR, an RNA sequence
transcribed from DNA encoding GCCR, and an mRNA sequence encoding
GCCR. "GCCR mRNA" means an mRNA encoding GCCR.
Therapeutic Indications
[0590] Antisense technology is an effective means of reducing the
expression of specific gene products and therefore is useful in a
number of therapeutic, diagnostic and research applications for the
modulation of glucocorticoid receptor expression. Furthermore, in
certain embodiments, liver is one of the tissues in which the
highest concentrations of antisense oligonucleotides are found
following administration (Geary et al., Curr. Opin. Investig.
Drugs, 2001, 2, 562-573). Therefore, in such embodiments, antisense
technology represents an attractive method for the liver-specific
inhibition of glucocorticoid receptor.
[0591] In certain embodiments, short antisense compounds targeted
to a nucleic acid encoding glucocorticoid receptor are
preferentially distributed to the liver. In certain embodiments,
short antisense compounds have increased potency in the liver when
compared to a longer parent compound. In certain embodiments,
target RNA is predominantly expressed in the liver.
[0592] For therapeutics, a subject, suspected of having a disease
or disorder which can be treated by modulating the expression of
GCCR is treated by administering one or more short antisense
compound. In a non-limiting example, the methods comprise the step
of administering to an animal a therapeutically effective amount of
a short antisense compound. Certain short antisense compounds
inhibit the activity of GCCR and/or inhibit expression of GCCR. In
certain embodiments, the activity or expression of GCCR in a
subject is inhibited by at least 10%, by at least 20%, by at least
25%, by at least 30%, by at least 40%, by at least 50%, by at least
60%, by at least 70%, by at least 75%, by at least 80%, by at least
85%, by at least 90%, by at least 95%, by at least 98%, by at least
99%, or by 100%. In certain embodiments, the activity or expression
of GCCR in a subject is inhibited by at least 30%. In certain
embodiments, the activity or expression of GCCR in a subject is
inhibited by at least 50% or more.
[0593] The reduction of the expression of GCCR may be measured, for
example, in blood, plasma, serum, adipose tissue, liver or any
other body fluid, tissue or organ of the animal. In certain
embodiments, cells contained within such fluids, tissues or organs
being analyzed comprise nucleic acids encoding GCCR and/or they
contain the GCCR protein itself.
[0594] Certain pharmaceutical and other compositions comprising
short antisense compounds are also provided. In certain
embodiments, short antisense compounds are be utilized in
pharmaceutical compositions by adding to them an effective amount
of a compound to a suitable pharmaceutically acceptable diluent or
carrier.
[0595] In certain embodiments, short antisense compounds targeting
a GCCR nucleic acid have any one or more properties or
characteristics of the short antisense compounds generally
described herein. In certain embodiments, short antisense compounds
targeting a GCCR nucleic acid have a motif (wing-deoxy gap-wing)
selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2,
1-10-1, 1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1. In certain
embodiments, short antisense compounds targeting a GCCR nucleic
acid have a motif (wing-deoxy gap-wing) selected from 1-10-1,
2-10-2, 3-10-3, and 1-9-2. In certain embodiments, short antisense
compounds targeting a GCCR nucleic acid have a motif (wing-deoxy
gap-wing) selected from 3-10-3, 2-10-3, 2-10-2, 1-10-1, 1-10-2,
2-8-2, 1-8-1, 3-6-3 or 1-6-1, more preferably 2-10-2 and 2-8-2.
[0596] In certain embodiments, provided herein are methods of
treating an individual by administering one or more short antisense
compound targeted to a GCCR nucleic acid or a pharmaceutical
composition comprising such compound. Further provided are methods
of treating a subject having a disease or conditions associated
with GCCR activity by administering a short antisense compound
targeted to a GCCR nucleic acid. In addition to diabetes,
particularly type 2 diabetes, diseases and conditions associated
with GCCR include but are not limited to, obesity, Metabolic
syndrome X, Cushing's Syndrome, Addison's disease, inflammatory
diseases such as asthma, rhinitis and arthritis, allergy,
autoimmune disease, immunodeficiency, anorexia, cachexia, bone loss
or bone frailty, and wound healing. Metabolic syndrome, metabolic
syndrome X or simply Syndrome X refers to a cluster of risk factors
that include obesity, dyslipidemia, particularly high blood
triglycerides, glucose intolerance, high blood sugar and high blood
pressure. In certain embodiments, short antisense compounds
targeted to GCCR are used for amelioration of hyperglycemia induced
by systemic steroid therapy. Moreover, antisense technology
provides a means of inhibiting the expression of the glucocorticoid
receptor .beta. isoform, demonstrated to be overexpressed in
patients refractory to glucocorticoid treatment.
[0597] In certain embodiments, the invention provides short
antisense compounds targeted to a nucleic acid encoding GCGR, and
which modulate the expression of glucocorticoid receptor.
Pharmaceutical and other compositions comprising the compounds of
the invention are also provided. Further provided are methods of
screening for modulators of glucocorticoid receptor and methods of
modulating the expression of glucocorticoid receptor in cells,
tissues or animals comprising contacting said cells, tissues or
animals with one or more of the compounds or compositions of the
invention. Methods of treating an animal, particularly a human,
suspected of having or being prone to a disease or condition
associated with expression of glucocorticoid receptor are also set
forth herein. Such methods comprise administering a therapeutically
or prophylactically effective amount of one or more of the
compounds or compositions of the invention to the person in need of
treatment.
Certain Short Antisense Compounds Targeted to a GCCR Nucleic
Acid
[0598] In certain embodiments, short antisense compounds are
targeted to a GCCR nucleic acid having the sequence of nucleotides
1 to 106000 of GENBANK.RTM.V Accession No. AC012634, incorporated
herein as SEQ ID NO: 8. In certain such embodiments, a short
antisense compound targeted to SEQ ID NO: 8 is at least 90%
complementary to SEQ ID NO: 8. In certain such embodiments, a short
antisense compound targeted to SEQ ID NO: 8 is at least 95%
complementary to SEQ ID NO: 8. In certain such embodiments, a short
antisense compound targeted to SEQ ID NO: 8 is 100% complementary
to SEQ ID NO: 8. In certain embodiments, a short antisense compound
targeted to SEQ ID NO: 8 includes a nucleotide sequence selected
from the nucleotide sequences set forth in Tables 10 and 11.
[0599] The nucleotide sequence set forth in each SEQ ID NO in
Tables 10 and 11 is independent of any modification to a sugar
moiety, an internucleoside linkage, or a nucleobase. As such, short
antisense compounds defined by a SEQ ID NO may comprise,
independently, one or more modifications to a sugar moiety, an
internucleoside linkage, or a nucleobase. Short antisense compounds
described by Isis Number (Isis NO.) indicate a combination of
nucleobase sequence and one or more modifications to a sugar
moiety, an internucleoside linkage, or a nucleobase.
[0600] In certain embodiments, short antisense compounds targeted
to a GCCR nucleic acid comprise a gapmer motif. In certain
embodiments, a short antisense compound targeted to a GCCR nucleic
acid comprises a 2-10-2 gapmer motif.
[0601] Tables 10 and 11 illustrate examples of short antisense
compounds targeted to SEQ ID NO: 8. Table 10 illustrates short
antisense compounds that are 100% complementary to SEQ ID NO: 8.
Table 11 illustrates short antisense compounds that have one or two
mismatches with respect to SEQ ID NO: 8. The column labeled `gapmer
motif` indicates the wing-gap-wing motif of each short antisense
compounds. The gap segment comprises 2'-deoxynucleotides and each
nucleotide of each wing segment comprises a 2'-modified sugar. The
particular 2'-modified sugar is also indicated in the `gapmer
motif` column. For example, `2-10-2 MOE` means a 2-10-2 gapmer
motif, where a gap segment of ten 2'-deoxynucleotides is flanked by
wing segments of two nucleotides, where the nucleotides of the wing
segments are 2'-MOE nucleotides. Internucleoside linkages are
phosphorothioate. The short antisense compounds comprise
5-methylcytidine in place of unmodified cytosine, unless
"unmodified cytosine" is listed in the gapmer motif column, in
which case the indicated cytosines are unmodified cytosines. For
example, "5-mC in gap only" indicates that the gap segment has
5-methylcytosines, while the wing segments have unmodified
cytosines.
TABLE-US-00013 TABLE 10 Short Antisense Compounds targeted to SEQ
ID NO: 8 5' 3' SEQ ISIS Target Target Gapmer ID NO. Site Site
Sequence (5'-3') Motif NO 371644 88142 88155 TTTGGGAGGTGGTC 2-10-2
MOE 413 371645 88156 88169 CACACCAGGCAGAG 2-10-2 MOE 414 371649
88212 88225 CTTTACAGCTTCCA 2-10-2 MOE 415 371651 88242 88255
CACTACCTTCCACT 2-10-2 MOE 416 371652 88248 88261 AACACACACTACCT
2-10-2 MOE 417 371653 88256 88269 CTCTTCAAAACACA 2-10-2 MOE 418
371665 92037 92050 GTAATTGTGCTGTC 2-10-2 MOE 419 371669 92086 92099
TTTTTCTTCGAATT 2-10-2 MOE 420 371671 92114 92127 CATTTTCGATAGCG
2-10-2 MOE 421 371673 92142 92155 ACCTTCCAGGTTCA 2-10-2 MOE 422
TABLE-US-00014 TABLE 11 Short antisense compounds targeted to SEQ
ID NO: 8 and having 1 or 2 mismatches 5' 3' SEQ ISIS Target Target
Gapmer ID NO Site Site Sequence (5'-3') Motif NO 371638 2039 2052
ATAGGAAGCATAAA 2-10-2 MOE 423 371650 4949 4962 TCTTTTAAAGAAGA
2-10-2 MOE 424 371673 10187 10200 ACCTTCCAGGTTCA 2-10-2 MOE 422
371660 13465 13478 AAGGATATTTTAAA 2-10-2 MOE 425 371660 14428 14441
AAGGATATTTTAAA 2-10-2 MOE 425 371654 15486 15499 GAACAAAAATTAAA
2-10-2 MOE 427 371661 16638 16651 TTCCACAGATCTGT 2-10-2 MOE 428
371653 17892 17905 CTCTTCAAAACACA 2-10-2 MOE 418 371679 18444 18457
TTTATAAAGTAAAG 2-10-2 MOE 429 371645 19816 19829 CACACCAGGCAGAG
2-10-2 MOE 414 371638 21555 21568 ATAGGAAGCATAAA 2-10-2 MOE 423
371650 21775 21788 TCTTTTAAAGAAGA 2-10-2 MOE 424 371679 21902 21915
TTTATAAAGTAAAG 2-10-2 MOE 429 371655 22507 22520 TACTGTGAGAAATA
2-10-2 MOE 433 371655 22722 22735 TACTGTGAGAAATA 2-10-2 MOE 433
371672 25662 25675 TTCCAGCTTGAAGA 2-10-2 MOE 435 371678 25926 25939
GATCAGTTCTCATG 2-10-2 MOE 436 371655 26041 26054 TACTGTGAGAAATA
2-10-2 MOE 433 371638 29770 29783 ATAGGAAGCATAAA 2-10-2 MOE 423
371668 30551 30564 TTATCAATGATGCA 2-10-2 MOE 439 371670 40584 40597
GCATGCTGGACAGT 2-10-2 MOE 440 371654 43331 43344 GAACAAAAATTAAA
2-10-2 MOE 427 371650 46024 46037 TCTTTTAAAGAAGA 2-10-2 MOE 424
371659 50372 50385 TTGCACCTGAACTA 2-10-2 MOE 443 371634 50565 50578
CAGAATATATTTCT 2-10-2 MOE 444 371673 56942 56955 ACCTTCCAGGTTCA
2-10-2 MOE 422 371654 62372 62385 GAACAAAAATTAAA 2-10-2 MOE 427
371679 63537 63550 TTTATAAAGTAAAG 2-10-2 MOE 429 371654 64908 64921
GAACAAAAATTAAA 2-10-2 MOE 427 371661 65795 65808 TTCCACAGATCTGT
2-10-2 MOE 428 371645 70997 71010 CACACCAGGCAGAG 2-10-2 MOE 414
371661 77400 77413 TTCCACAGATCTGT 2-10-2 MOE 428 371663 82329 82342
ATAAGAGATTAAAA 2-10-2 MOE 450 371633 83426 83439 TCCCCCTTCTCATT
2-10-2 MOE 451 371662 85873 85886 GGGCATTGTTAAAA 2-10-2 MOE 452
371654 86476 86489 GAACAAAAATTAAA 2-10-2 MOE 427 371679 86516 86529
TTTATAAAGTAAAG 2-10-2 MOE 429 371641 88097 88110 AGAACTCACATCTG
2-10-2 MOE 455 371642 88111 88124 GAGCTGGACGGAGG 2-10-2 MOE 456
371646 88170 88183 AAGCTTCATCGGAG 2-10-2 MOE 457 371647 88184 88197
ATAATGGCATCCCG 2-10-2 MOE 458 371650 88226 88239 TCTTTTAAAGAAGA
2-10-2 MOE 424 371673 91493 91506 ACCTTCCAGGTTCA 2-10-2 MOE 422
371664 92030 92043 TGCTGTCCTATAAG 2-10-2 MOE 460 371666 92044 92057
CACAAAGGTAATTG 2-10-2 MOE 461 371667 92058 92071 ATCATTTCTTCCAG
2-10-2 MOE 462 371668 92072 92085 TTATCAATGATGCA 2-10-2 MOE 463
371670 92100 92113 GCATGCTGGACAGT 2-10-2 MOE 440 371672 92128 92141
TTCCAGCTTGAAGA 2-10-2 MOE 435 371674 92147 92160 CCATTACCTTCCAG
2-10-2 MOE 466 371637 92983 92996 GCATAAACAGGGTT 2-10-2 MOE 467
371654 93928 93941 GAACAAAAATTAAA 2-10-2 MOE 427 371641 99772 99785
AGAACTCACATCTG 2-10-2 MOE 455 371679 99883 99896 TTTATAAAGTAAAG
2-10-2 MOE 429 371660 99933 99946 AAGGATATTTTAAA 2-10-2 MOE 425
371635 105004 105017 TATGAAAGGAATGT 2-10-2 MOE 472 371654 105028
105041 GAACAAAAATTAAA 2-10-2 MOE 427 371676 106482 106495
TTCCTTAAGCTTCC 2-10-2 MOE 474 371650 107838 107851 TCTTTTAAAGAAGA
2-10-2 MOE 424 371673 110922 110935 ACCTTCCAGGTTCA 2-10-2 MOE 422
371673 111580 111593 ACCTTCCAGGTTCA 2-10-2 MOE 422 371634 114608
114621 CAGAATATATTTCT 2-10-2 MOE 444 371638 115040 115053
ATAGGAAGCATAAA 2-10-2 MOE 423 371660 116244 116257 AAGGATATTTTAAA
2-10-2 MOE 425 371663 116657 116670 ATAAGAGATTAAAA 2-10-2 MOE 450
371673 118068 118081 ACCTTCCAGGTTCA 2-10-2 MOE 422 371666 118834
118847 CACAAAGGTAATTG 2-10-2 MOE 461 371660 119858 119871
AAGGATATTTTAAA 2-10-2 MOE 425 371660 120210 120223 AAGGATATTTTAAA
2-10-2 MOE 425 371662 120876 120889 GGGCATTGTTAAAA 2-10-2 MOE 452
371655 124004 124017 TACTGTGAGAAATA 2-10-2 MOE 433 371656 124170
124183 GAACAGTTAAACAT 2-10-2 MOE 485
[0602] In certain embodiments, a target region is nucleotides
88142-88269 of SEQ ID NO: 8. In certain embodiments, a short
antisense compound is targeted to nucleotides 88142-88269 of SEQ ID
NO: 8. In certain such embodiments, a short antisense compound
targeted to nucleotides 88142-88269 comprises a nucleotide sequence
selected from SEQ ID NO 413, 414, 415, 416, 417, or 418. In certain
such embodiments, an antisense compound targeted to nucleotides
88142-88269 of SEQ ID NO: 8 is selected from Isis NO. 371644,
371645, 371649, 371651, 371652, or 371653.
[0603] In certain embodiments, a target region is nucleotides
88142-88169 of SEQ ID NO: 8. In certain embodiments, a short
antisense compound is targeted to nucleotides 88142-88169 of SEQ ID
NO: 8. In certain such embodiments, a short antisense compound
targeted to nucleotides 88142-88169 comprises a nucleotide sequence
selected from SEQ ID NO 413 or 414. In certain such embodiments, an
antisense compound targeted to nucleotides 88142-88169 of SEQ ID
NO: 8 is selected from Isis NO. 371644 or 371645.
[0604] In certain embodiments, a target region is nucleotides
88242-88269 of SEQ ID NO: 8. In certain embodiments, a short
antisense compound is targeted to nucleotides 88242-88269 of SEQ ID
NO: 8. In certain such embodiments, a short antisense compound
targeted to nucleotides 88242-88269 comprises a nucleotide sequence
selected from SEQ ID NO 416, 417, or 418. In certain such
embodiments, an antisense compound targeted to nucleotides
88242-88269 of SEQ ID NO: 8 is selected from Isis NO. 371651,
371652, or 371653.
[0605] In certain embodiments, a target region is nucleotides
92037-92155 of SEQ ID NO: 8. In certain embodiments, a short
antisense compound is targeted to nucleotides 92037-92155 of SEQ ID
NO: 8. In certain such embodiments, a short antisense compound
targeted to nucleotides 92037-92155 comprises a nucleotide sequence
selected from SEQ ID NO 419, 420, 421, or 422. In certain such
embodiments, an antisense compound targeted to nucleotides
92037-92155 of SEQ ID NO: 8 is selected from Isis NO. 371665,
371669, 371671, or 171673.
[0606] In certain embodiments, a target region is nucleotides
92114-92155 of SEQ ID NO: 8. In certain embodiments, a short
antisense compound is targeted to nucleotides 92114-92155 of SEQ ID
NO: 8. In certain such embodiments, a short antisense compound
targeted to nucleotides 92114-92155 comprises a nucleotide sequence
selected from SEQ ID NO 421 or 422. In certain such embodiments, an
antisense compound targeted to nucleotides 92114-92155 of SEQ ID
NO: 8 is selected from Isis NO. 371671 or 171673.
[0607] In certain embodiments, short antisense compounds targeted
to a GCCR nucleic acid are 8 to 16, preferably 9 to 15, more
preferably 9 to 14, more preferably 10 to 14 nucleotides in length.
In certain embodiments, short antisense compounds targeted to a
GCCR nucleic acid are 9 to 14 nucleotides in length. In certain
embodiments, short antisense compounds targeted to a GCCR nucleic
acid are 10 to 14 nucleotides in length. In certain embodiments,
such short antisense compounds are short antisense
oligonucleotides.
[0608] In certain embodiments, short antisense compounds targeted
to a GCCR nucleic acid are short gapmers. In certain such
embodiments, short gapmers targeted to a GCCR nucleic acid comprise
at least one high affinity modification in one or more wings of the
compound. In certain embodiments, short antisense compounds
targeted to a GCCR nucleic acid comprise 1 to 3 high-affinity
modifications in each wing. In certain such embodiments, the
nucleosides or nucleotides of the wing comprise a 2' modification.
In certain such embodiments, the monomers of the wing are BNA's. In
certain such embodiments, the monomers of the wing are selected
from .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2') BNA,
.beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA, Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') BNA, Aminooxy (4'-CH.sub.2--O--N(R)-2')
BNA and Oxyamino (4'-CH.sub.2--N(R)-0-2') BNA. In certain
embodiments, the monomers of a wing comprise a substituent at the
2' position selected from allyl, amino, azido, thio, O-allyl,
O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), and
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. In certain embodiments, the monomers of a
wing are 2'MOE nucleotides.
[0609] In certain embodiments, short antisense compounds targeted
to a GCCR nucleic acid comprise a gap between the 5' wing and the
3' wing. In certain embodiments the gap comprises five, six, seven,
eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
In certain embodiments, the monomers of the gap are unmodified
deoxyribonucleotides. In certain embodiments, the monomers of the
gap are unmodified ribonucleotides. In certain embodiments, gap
modifications (if any) gap result in an antisense compound that,
when bound to its target nucleic acid, supports cleavage by an
RNase, including, but not limited to, RNase H.
[0610] In certain embodiments, short antisense compounds targeted
to a GCCR nucleic acid have uniform monomeric linkages. In certain
such embodiments, those linkages are all phosphorothioate linkages.
In certain embodiments, the linkages are all phosphodiester
linkages. In certain embodiments, short antisense compounds
targeted to a GCCR nucleic acid have mixed backbones.
[0611] In certain embodiments, short antisense compounds targeted
to a GCCR nucleic acid are 8 monomers in length. In certain
embodiments, short antisense compounds targeted to a GCCR nucleic
acid are 9 monomers in length. In certain embodiments, short
antisense compounds targeted to a GCCR nucleic acid are 10 monomers
in length. In certain embodiments, short antisense compounds
targeted to a GCCR nucleic acid are 11 monomers in length. In
certain embodiments, short antisense compounds targeted to a GCCR
nucleic acid are monomers in length. In certain embodiments, short
antisense compounds targeted to a GCCR nucleic acid are 13 monomers
in length. In certain embodiments, short antisense compounds
targeted to a GCCR nucleic acid are 14 monomers in length. In
certain embodiments, short antisense compounds targeted to a GCCR
nucleic acid are 15 monomers in length. In certain embodiments,
short antisense compounds targeted to a GCCR nucleic acid are 16
monomers in length. In certain embodiments, short antisense
compounds targeted to a GCCR nucleic acid comprise 9 to 15
monomers. In certain embodiments, short antisense compounds
targeted to a GCCR nucleic acid comprise 10 to 15 monomers. In
certain embodiments, short antisense compounds targeted to a GCCR
nucleic acid comprise 12 to 14 monomers. In certain embodiments,
short antisense compounds targeted to a GCCR nucleic acid comprise
12 to 14 nucleotides or nucleosides.
[0612] In certain embodiments, the invention provides methods of
modulating expression of GCCR. In certain embodiments, such methods
comprise use of one or more short antisense compound targeted to a
GCCR nucleic acid, wherein the short antisense compound targeted to
a GCCR nucleic acid is from about 8 to about 16, preferably 9 to
15, more preferably 9 to 14, more preferably 10 to 14 monomers
(i.e. from about 8 to about 16 linked monomers). One of ordinary
skill in the art will appreciate that this comprehends methods of
modulating expression of GCCR using one or more short antisense
compounds targeted to a GCCR nucleic acid of 8, 9, 10, 11, 12, 13,
14, 15 or 16 monomers.
[0613] In certain embodiments, methods of modulating GCCR comprise
use of a short antisense compound targeted to a GCCR nucleic acid
that is 8 monomers in length. In certain embodiments, methods of
modulating GCCR comprise use of a short antisense compound targeted
to a GCCR nucleic acid that is 9 monomers in length. In certain
embodiments, methods of modulating GCCR comprise use of a short
antisense compound targeted to a GCCR nucleic acid that is 10
monomers in length. In certain embodiments, methods of modulating
GCCR comprise use of a short antisense compound targeted to a GCCR
nucleic acid that is 11 monomers in length. In certain embodiments,
methods of modulating GCCR comprise use of a short antisense
compound targeted to a GCCR nucleic acid that is 12 monomers in
length. In certain embodiments, methods of modulating GCCR comprise
use of a short antisense compound targeted to a GCCR nucleic acid
that is 13 monomers in length. In certain embodiments, methods of
modulating GCCR comprise use of a short antisense compound targeted
to a GCCR nucleic acid that is 14 monomers in length. In certain
embodiments, methods of modulating GCCR comprise use of a short
antisense compound targeted to a GCCR nucleic acid that is 15
monomers in length. In certain embodiments, methods of modulating
GCCR comprise use of a short antisense compound targeted to a GCCR
nucleic acid that is 16 monomers in length.
[0614] In certain embodiments, methods of modulating expression of
GCCR comprise use of a short antisense compound targeted to a GCCR
nucleic acid comprising 9 to 15 monomers. In certain embodiments,
methods of modulating expression of GCCR comprise use of a short
antisense compound targeted to a GCCR nucleic acid comprising 10 to
15 monomers. In certain embodiments, methods of modulating
expression of GCCR comprise use of a short antisense compound
targeted to a GCCR nucleic acid comprising 12 to 14 monomers. In
certain embodiments, methods of modulating expression of GCCR
comprise use of a short antisense compound targeted to a GCCR
nucleic acid comprising 12 or 14 nucleotides or nucleosides.
[0615] 7. Glucagon Receptor (GCGR)
[0616] The maintenance of normal glycemia is a carefully regulated
metabolic event. Glucagon, the 29-amino acid peptide responsible
for maintaining blood glucose levels in the postabsorbative state,
increases glucose release from the liver by activating hepatic
glycogenolysis, gluconeogenesis, stimulating lipolysis in adipose
tissue, and stimulating insulin secretion. During high blood
glucose levels, insulin reverses the glucagon-mediated enhancement
of glycogenolysis and gluconeogenesis. In patients with diabetes,
insulin is either not available or not fully effective. While
treatment for diabetes has traditionally focused on increasing
insulin levels, antagonism of glucagon function has been considered
as an alternative therapy. As glucagon exerts its physiological
effects by signaling through the glucagon receptor, the glucagon
receptor has been proposed as a potential therapeutic target for
diabetes (Madsen et al., Curr. Pharm. Des., 1999, 5, 683-691).
[0617] Glucagon receptor is belongs to the superfamily of
G-protein-coupled receptors having seven transmembrane domains. It
is also a member of the smaller sub-family of homologous receptors
which bind peptides that are structurally similar to glucagon. The
gene encoding human glucagon receptor was cloned in 1994 and
analysis of the genomic sequence revealed multiple introns and an
82% identity to the rat glucagon receptor gene (Lok et al., Gene,
1994, 140, 203-209; MacNeil et al., Biochem. Biophys. Res. Commun.,
1994, 198, 328-334). Cloning of the rat glucagon receptor gene also
led to the description of multiple alternative splice variants
(Maget et al., FEBS Lett., 1994, 351, 271-275). The human glucagon
receptor gene is localized to chromosome 17q25 (Menzel et al.,
Genomics, 1994, 20, 327-328). A missense mutation of Gly to Ser at
codon 40 in the glucagon receptor gene leads to a 3-fold lower
affinity for glucagon (Fujisawa et al., Diabetologia, 1995, 38,
983-985) and this mutation has been linked to several disease
states, including non-insulin-dependent diabetes mellitus (Fujisawa
et al., Diabetologia, 1995, 38, 983-985), hypertension (Chambers
and Morris, Nat. Genet., 1996, 12, 122), and central adiposity
(Siani et al., Obes. Res., 2001, 9, 722-726).
Definitions
[0618] "Glucagon receptor" is the gene product or protein of which
expression is to be modulated by administration of a short
antisense compound. Glucagon receptor is generally referred to as
GCGR but may also be referred to as GR, GGR, MGC138246,
MGC93090.
[0619] "GCGR nucleic acid" means any nucleic acid encoding GCGR.
For example, in certain embodiments, a GCGR nucleic acid includes,
without limitation, a GCGR sequence encoding GCGR, an RNA sequence
transcribed from DNA encoding GCGR, and an mRNA sequence encoding
GCGR. "GCGR mRNA" means an mRNA encoding a GCGR protein.
Therapeutic Indications
[0620] Antisense technology is an effective means for reducing
glucagon receptor (GCGR) expression and has proven to be uniquely
useful in a number of therapeutic, diagnostic, and research
applications. As such, in certain embodiments, the present
invention provides short antisense compounds targeted to a nucleic
acid encoding glucagon receptor, and which modulate the expression
of glucagon receptor. Further provided herein are short antisense
compounds capable of inhibiting GCGR expression. Also provided
herein are methods of treating an individual comprising
administering one or more pharmaceutical compositions comprising a
short antisense compound targeted to a GCGR nucleic acid. In
certain embodiments, because short antisense compounds targeted to
a GCGR nucleic acid inhibit GCGR expression, provided herein are
methods of treating a subject having a disease or condition
associated with GCGR activity by administering one or more
pharmaceutical compositions comprising a short antisense compound
targeted to a GCGR nucleic acid. For example, provided herein are
methods of treating a subject having high blood glucose,
hyperglycemia, prediabetes, diabetes, Type 2 diabetes, metabolic
syndrome, obesity and/or insulin resistance.
[0621] Also contemplated herein are pharmaceutical composition
comprising one or more short antisense compounds targeted to GCGR
and optionally a pharmaceutically acceptable carrier, diluent,
enhancer or excipient. Certain compounds of the invention can also
be used in the manufacture of a medicament for the treatment of
diseases and disorders related to glucagon effects mediated by
GCGR.
[0622] Certain embodiments of the present invention include methods
of reducing the expression of GCGR in tissues or cells comprising
contacting said cells or tissues with a short antisense compound
targeted to a nucleic acid encoding GCGRor pharmaceutical
composition comprising such a short antisense compound. In certain
such embodiments, the invention provides methods of decreasing
blood glucose levels, blood triglyceride levels, or blood
cholesterol levels in a subject comprising administering to the
subject a short antisense compound or a pharmaceutical composition.
Blood levels may be plasma levels or serum levels. Also
contemplated are methods of improving insulin sensitivity, methods
of increasing GLP-1 levels and methods of inhibiting hepatic
glucose output in an animal comprising administering to said animal
an antisense oligonucleotide or a pharmaceutical composition of the
invention. An improvement in insulin sensitivity may be indicated
by a reduction in circulating insulin levels.
[0623] In certain embodiments, the invention provides methods of
treating a subject having a disease or condition associated with
glucagon activity via GCGR comprising administering to the subject
a therapeutically or prophylactically effective amount of a short
antisense compound or a pharmaceutical composition. In certain
embodiments, such disease or condition may be a metabolic disease
or condition. In certain embodiments, the metabolic disease or
condition is diabetes, hyperglycemia, hyperlipidemia, metabolic
syndrome X, obesity, primary hyperglucagonemia, insulin deficiency,
or insulin resistance. In some embodiments, the diabetes is Type 2
diabetes. In some embodiments the obesity is diet-induced. In some
embodiments, hyperlipidemia is associated with elevated blood lipid
levels. Lipids include cholesterol and triglycerides. In one
embodiment, the condition is liver steatosis. In some embodiments,
the steatosis is steatohepatitis or non-alcoholic
steatohepatitis.
[0624] In certain embodiments, the invention provides methods of
preventing or delaying the onset of elevated blood glucose levels
in an animal as well as methods of preserving beta-cell function in
an animal using the oligomeric compounds delineated herein.
[0625] Certain short antisense compounds targeted to GCGR can be
used to modulate the expression of GCGR in a subject in need
thereof, such as an animal, including, but not limited to, a human
In certain embodiments, such methods comprise the step of
administering to said animal an effective amount of a short
antisense compound that reduces expression of GCGR RNA. In certain
embodiments, short antisense compounds effectively reduce the
levels or function of GCGR RNA. Because reduction in GCGR mRNA
levels can lead to alteration in GCGR protein products of
expression as well, such resultant alterations can also be
measured. Certain antisense compounds that effectively reduce the
levels or function of GCGR RNA or protein products of expression is
considered an active antisense compound. In certain embodiments,
short antisense compounds reduce the expression of GCGR causing a
reduction of RNA by at least 10%, by at least 20%, by at least 25%,
by at least 30%, by at least 40%, by at least 50%, by at least 60%,
by at least 70%, by at least 75%, by at least 80%, by at least 85%,
by at least 90%, by at least 95%, by at least 98%, by at least 99%,
or by 100%.
[0626] Further provided are methods of screening for modulators of
glucagon receptor and methods of modulating the expression of
glucagon receptor in cells, tissues or animals comprising
contacting said cells, tissues or animals with one or more short
antisense compounds targeted to GCGRor with compositions comprising
such compounds. Methods of treating an animal, particularly a
human, suspected of having or being prone to a disease or condition
associated with expression of glucagon receptor are also set forth
herein. Certain such methods comprise administering a
therapeutically or prophylactically effective amount of one or more
of the compounds or compositions of the invention to the person in
need of treatment.
[0627] The reduction of the expression of glucagon receptor may be
measured, for example, in blood, plasma, serum, adipose tissue,
liver or any other body fluid, tissue or organ of the animal.
Preferably, the cells contained within said fluids, tissues or
organs being analyzed contain a nucleic acid molecule encoding
glucagon receptor protein and/or the glucagon receptor protein
itself.
[0628] Pharmaceutical and other compositions comprising short
antisense compounds are also provided. In certain embodiments short
antisense compounds targeted to a nucleic acid encoding GCGR are
utilized in pharmaceutical compositions by adding an effective
amount of a compound to a suitable pharmaceutically acceptable
diluent or carrier.
[0629] The short antisense compounds targeting a GCGR nucleic acid
may have any one or more properties or characteristics of the short
antisense compounds generally described herein. In certain
embodiments, short antisense compounds targeting a GCGR nucleic
acid have a motif (wing-deoxy gap-wing) selected from 1-12-1,
1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1, 1-10-2, 3-8-3,
2-8-2, 1-8-1, 3-6-3 or 1-6-1. In certain embodiments, short
antisense compounds targeting a GCGR nucleic acid have a motif
(wing-deoxy gap-wing) selected from 1-12-1, 2-10-2, 3-10-3, 3-8-3,
1-1-10-2.
Certain Short Antisense Compounds Targeted to a GCGR Nucleic
Acid
[0630] In certain embodiments, short antisense compounds are
targeted to a GCGR nucleic acid having the sequence GENBANK.RTM.
Accession No. NM.sub.--000160.1, incorporated herein as SEQ ID NO:
9. In certain such embodiments, a short antisense compound targeted
to SEQ ID NO: 9 is at least 90% complementary to SEQ ID NO: 9. In
certain such embodiments, a short antisense compound targeted to
SEQ ID NO: 9 is at least 95% complementary to SEQ ID NO: 9. In
certain such embodiments, a short antisense compound targeted to
SEQ ID NO: 9 is 100% complementary to SEQ ID NO: 9. In certain
embodiments, a short antisense compound targeted to SEQ ID NO: 9
includes a nucleotide sequence selected from the nucleotide
sequences set forth in Tables 12 and 13.
[0631] The nucleotide sequences set forth in each SEQ ID NO in
Tables 12 and 13 are independent of any modification to a sugar
moiety, an internucleoside linkage, or a nucleobase. As such, short
antisense compounds defined by a SEQ ID NO may comprise,
independently, one or more modifications to a sugar moiety, an
internucleoside linkage, or a nucleobase. Short antisense compounds
described by Isis Number (Isis NO.) indicate a combination of
nucleobase sequence and one or more modifications to a sugar
moiety, an internucleoside linkage, or a nucleobase.
[0632] In certain embodiments, short antisense compounds targeted
to a GCCR nucleic acid comprise a gapmer motif. In certain
embodiments, a short antisense compound targeted to a GCCR nucleic
acid comprises a 3-10-3 gapmer motif. In certain embodiments, short
antisense compounds targeted to a GCCR nucleic acid comprise a
gapmer motif. In certain embodiments, a short antisense compound
targeted to a GCCR nucleic acid comprises a 3-8-3 gapmer motif. In
certain embodiments, short antisense compounds targeted to a GCCR
nucleic acid comprise a gapmer motif. In certain embodiments, a
short antisense compound targeted to a GCCR nucleic acid comprises
a 2-10-2 gapmer motif.
[0633] Tables 12 and 13 illustrate examples of short antisense
compounds targeted to SEQ ID NO: 9. Table 12 illustrates short
antisense compounds that are 100% complementary to SEQ ID NO: 9.
Table 13 illustrates short antisense compounds that have one or two
mismatches with respect to SEQ ID NO: 9. The column labeled `gapmer
motif` indicates the wing-gap-wing motif of each short antisense
compounds. The gap segment comprises 2'-deoxynucleotides and each
nucleotide of each wing segment comprises a 2'-modified sugar. The
particular 2'-modified sugar is also indicated in the `gapmer
motif` column. For example, `2-10-2 MOE` means a 2-10-2 gapmer
motif, where a gap segment of ten 2'-deoxynucleotides is flanked by
wing segments of two nucleotides, where the nucleotides of the wing
segments are 2'-MOE nucleotides. Internucleoside linkages are
phosphorothioate. The short antisense compounds comprise
5-methylcytidine in place of unmodified cytosine, unless
"unmodified cytosine" is listed in the gapmer motif column, in
which case the indicated cytosines are unmodified cytosines. For
example, "5-mC in gap only" indicates that the gap segment has
5-methylcytosines, while the wing segments have unmodified
cytosines.
TABLE-US-00015 TABLE 12 Short Antisense Compounds targeted to SEQ
ID NO: 9 5' 3' SEQ ISIS Target Target Gapmer ID NO. Site Site
Sequence (5'-3') Motif NO 338463 378 393 TAGAGCTTCCACTTCT 3-10-3
MOE 486 338534 378 391 GAGCTTCCACTTCT 3-8-3 MOE 487 327130 499 512
TGTTGGCCGTGGTA 3-8-3 MOE 488 327131 500 513 ATGTTGGCCGTGGT 3-8-3
MOE 489 327132 501 514 GATGTTGGCCGTGG 3-8-3 MOE 490 327133 502 515
AGATGTTGGCCGTG 3-8-3 MOE 491 327134 503 516 GAGATGTTGGCCGT 3-8-3
MOE 492 327135 504 517 GGAGATGTTGGCCG 3-8-3 MOE 493 327136 505 518
AGGAGATGTTGGCC 3-8-3 MOE 494 327137 506 519 CAGGAGATGTTGGC 3-8-3
MOE 495 327138 507 520 GCAGGAGATGTTGG 3-8-3 MOE 496 327139 508 521
GGCAGGAGATGTTG 3-8-3 MOE 497 327140 531 544 GTGGTGCCAAGGCA 3-8-3
MOE 498 327141 532 545 TGTGGTGCCAAGGC 3-8-3 MOE 499 327142 533 546
TTGTGGTGCCAAGG 3-8-3 MOE 500 327143 534 547 TTTGTGGTGCCAAG 3-8-3
MOE 501 327144 535 548 CTTTGTGGTGCCAA 3-8-3 MOE 502 327145 536 549
ACTTTGTGGTGCCA 3-8-3 MOE 503 327146 537 550 CACTTTGTGGTGCC 3-8-3
MOE 504 327147 538 551 GCACTTTGTGGTGC 3-8-3 MOE 505 327148 539 552
TGCACTTTGTGGTG 3-8-3 MOE 506 327149 540 553 TTGCACTTTGTGGT 3-8-3
MOE 507 327150 545 558 CGGTGTTGCACTTT 3-8-3 MOE 508 327151 546 559
GCGGTGTTGCACTT 3-8-3 MOE 509 327152 547 560 AGCGGTGTTGCACT 3-8-3
MOE 510 327153 548 561 AAGCGGTGTTGCAC 3-8-3 MOE 511 327154 549 562
GAAGCGGTGTTGCA 3-8-3 MOE 512 327155 550 563 CGAAGCGGTGTTGC 3-8-3
MOE 513 327156 551 564 ACGAAGCGGTGTTG 3-8-3 MOE 514 327157 552 565
CACGAAGCGGTGTT 3-8-3 MOE 515 327158 553 566 ACACGAAGCGGTGT 3-8-3
MOE 516 327159 554 567 AACACGAAGCGGTG 3-8-3 MOE 517 345897 684 697
GCTGCTGTACATCT 2-10-2 MOE 518 327160 684 697 GCTGCTGTACATCT 3-8-3
MOE 518 327161 685 698 AGCTGCTGTACATC 3-8-3 MOE 520 327162 686 699
AAGCTGCTGTACAT 3-8-3 MOE 521 327163 687 700 GAAGCTGCTGTACA 3-8-3
MOE 522 327164 688 701 GGAAGCTGCTGTAC 3-8-3 MOE 523 327165 689 702
TGGAAGCTGCTGTA 3-8-3 MOE 524 327166 690 703 CTGGAAGCTGCTGT 3-8-3
MOE 525 327167 691 704 CCTGGAAGCTGCTG 3-8-3 MOE 526 327168 692 705
ACCTGGAAGCTGCT 3-8-3 MOE 527 327169 693 706 CACCTGGAAGCTGC 3-8-3
MOE 528 327170 694 707 TCACCTGGAAGCTG 3-8-3 MOE 529 327171 695 708
ATCACCTGGAAGCT 3-8-3 MOE 530 327172 696 709 CATCACCTGGAAGC 3-8-3
MOE 531 327173 697 710 ACATCACCTGGAAG 3-8-3 MOE 532 327174 698 711
TACATCACCTGGAA 3-8-3 MOE 533 327175 699 712 GTACATCACCTGGA 3-8-3
MOE 534 327176 700 713 TGTACATCACCTGG 3-8-3 MOE 535 327177 701 714
GTGTACATCACCTG 3-8-3 MOE 536 327178 869 882 TAGCGGGTCCTGAG 3-8-3
MOE 537 327179 870 883 GTAGCGGGTCCTGA 3-8-3 MOE 538 327180 871 884
TGTAGCGGGTCCTG 3-8-3 MOE 539 327181 872 885 CTGTAGCGGGTCCT 3-8-3
MOE 540 327182 873 886 GCTGTAGCGGGTCC 3-8-3 MOE 541 327183 874 887
GGCTGTAGCGGGTC 3-8-3 MOE 542 327184 875 888 TGGCTGTAGCGGGT 3-8-3
MOE 543 327185 876 889 CTGGCTGTAGCGGG 3-8-3 MOE 544 327186 877 890
TCTGGCTGTAGCGG 3-8-3 MOE 545 327187 878 891 TTCTGGCTGTAGCG 3-8-3
MOE 546 327188 955 968 TGAACACCGCGGCC 3-8-3 MOE 547 327189 956 969
ATGAACACCGCGGC 3-8-3 MOE 548 327190 957 970 CATGAACACCGCGG 3-8-3
MOE 549 327191 958 971 GCATGAACACCGCG 3-8-3 MOE 550 327192 959 972
TGCATGAACACCGC 3-8-3 MOE 551 327193 960 973 TTGCATGAACACCG 3-8-3
MOE 552 327194 961 974 ATTGCATGAACACC 3-8-3 MOE 553 327195 962 975
TATTGCATGAACAC 3-8-3 MOE 554 327196 963 976 ATATTGCATGAACA 3-8-3
MOE 555 327197 964 977 CATATTGCATGAAC 3-8-3 MOE 556 327198 1019
1032 AGGTTGTGCAGGTA 3-8-3 MOE 557 327199 1020 1033 CAGGTTGTGCAGGT
3-8-3 MOE 558 327200 1021 1034 GCAGGTTGTGCAGG 3-8-3 MOE 559 327201
1022 1035 AGCAGGTTGTGCAG 3-8-3 MOE 560 327202 1023 1036
CAGCAGGTTGTGCA 3-8-3 MOE 561 327203 1024 1037 CCAGCAGGTTGTGC 3-8-3
MOE 562 327204 1025 1038 CCCAGCAGGTTGTG 3-8-3 MOE 563 327205 1026
1039 GCCCAGCAGGTTGT 3-8-3 MOE 564 327206 1027 1040 GGCCCAGCAGGTTG
3-8-3 MOE 565 327207 1028 1041 AGGCCCAGCAGGTT 3-8-3 MOE 566 338491
1160 1175 TGTCATTGCTGGTCCA 3-10-3 MOE 567 338562 1160 1173
TCATTGCTGGTCCA 3-8-3 MOE 568 338498 1307 1322 TGGCCAGCCGGAACTT
3-10-3 MOE 569 338569 1307 1320 GCCAGCCGGAACTT 3-8-3 MOE 570 338499
1329 1344 GGGATGAGGGTCAGCG 3-10-3 MOE 571 338570 1329 1342
GATGAGGGTCAGCG 3-8-3 MOE 572 385067 1364 1377 AAGGCAAAGACCAC 3-8-3
MOE 573 338573 1401 1414 GGAGCGCAGGGTGC 3-8-3 MOE 574 338580 1487
1500 TGCACCTCCTTGTT 3-8-3 MOE 575
TABLE-US-00016 TABLE 13 Short antisense compounds targeted to SEQ
ID NO: 1 and having 1 or 2 mismatches 3' 5' Tar- SEQ ISIS Target
get ID NO. Site Site Sequence (5'-3') Gapmer Motif NO 338577 158
171 CAGCAGACCCTGGA 3-8-3 MOE 576 338458 237 252 ACATCTGGCAGAGGTT
3-10-3 MOE 577 338529 237 250 ATCTGGCAGAGGTT 3-8-3 MOE 578 338466
318 333 CAGGCCAGCAGGAGTA 3-10-3 MOE 579 338537 318 331
GGCCAGCAGGAGTA 3-8-3 MOE 580 338533 364 377 CAAACAAAAAGTCC 3-8-3
MOE 582 338462 364 379 CTCAAACAAAAAGTCC 3-10-3 MOE 581 338535 397
410 GGTGACATTGGTCA 3-8-3 MOE 584 338464 397 412 GTGGTGACATTGGTCA
3-10-3 MOE 583 338466 470 485 CAGGCCAGCAGGAGTA 3-10-3 MOE 579
338537 470 483 GGCCAGCAGGAGTA 3-8-3 MOE 580 385048 497 510
TTGGCAGTGGTGTT 3-8-3 MOE 587 385049 500 513 ATGTTGGCAGTGGT 3-8-3
MOE 588 338467 503 518 AGGAAATGTTGGCAGT 3-10-3 MOE 589 338538 503
516 GAAATGTTGGCAGT 3-8-3 MOE 590 385050 506 519 CAGGAAATGTTGGC
3-8-3 MOE 591 385051 509 522 GGGCAGGAAATGTT 3-8-3 MOE 592 385052
523 536 AAGGTAGGTACCAG 3-8-3 MOE 593 385053 526 539 ACCAAGGTAGGTAC
3-8-3 MOE 594 385056 535 548 CTTTGTGGCACCAA 3-8-3 MOE 595 385057
538 551 GCACTTTGTGGCAC 3-8-3 MOE 596 338539 539 552 TGCACTTTGTGGCA
3-8-3 MOE 597 385058 541 554 GCTGCACTTTGTGG 3-8-3 MOE 598 385059
544 557 GGTGCTGCACTTTG 3-8-3 MOE 599 385060 547 560 GGCGGTGCTGCACT
3-8-3 MOE 600 385063 556 569 TGAACACTAGGCGG 3-8-3 MOE 601 385064
559 572 TCTTGAACACTAGG 3-8-3 MOE 602 338469 561 576
CACCTCTTGAACACTA 3-10-3 MOE 603 338540 561 574 CCTCTTGAACACTA 3-8-3
MOE 604 385065 562 575 ACCTCTTGAACACT 3-8-3 MOE 605 385066 565 578
CACACCTCTTGAAC 3-8-3 MOE 606 338541 590 603 CCTCGAACCCACTG 3-8-3
MOE 607 338473 658 673 CTTCTGGACCTCGATC 3-10-3 MOE 608 338544 658
671 TCTGGACCTCGATC 3-8-3 MOE 609 338474 681 696 CTGCTATACATCTTGG
3-10-3 MOE 610 338545 681 694 GCTATACATCTTGG 3-8-3 MOE 611 338475
703 718 CACGGTGTACATCACC 3-10-3 MOE 612 338546 703 716
CGGTGTACATCACC 3-8-3 MOE 613 338547 718 731 ACAGACTGTAGCCC 3-8-3
MOE 615 338476 718 733 GGACAGACTGTAGCCC 3-10-3 MOE 614 338550 889
902 CATCGCCAATCTTC 3-8-3 MOE 617 338479 889 904 GTCATCGCCAATCTTC
3-10-3 MOE 616 338551 899 912 ACACTGAGGTCATC 3-8-3 MOE 619 338480
899 914 TCACACTGAGGTCATC 3-10-3 MOE 618 338552 924 937
CGCCCCGTCACTGA 3-8-3 MOE 620 338555 992 1005 AGCAACCAGCAATA 3-8-3
MOE 622 338484 992 1007 CCAGCAACCAGCAATA 3-10-3 MOE 621 338485 1018
1033 CAGGCTGTACAGGTAC 3-10-3 MOE 623 338556 1018 1031
GGCTGTACAGGTAC 3-8-3 MOE 624 338558 1051 1064 AGCTCCTCTCAGAG 3-8-3
MOE 626 338487 1051 1066 GAAGCTCCTCTCAGAG 3-10-3 MOE 625 338559
1079 1092 CAGCCAATGCCCAG 3-8-3 MOE 628 338488 1079 1094
CCCAGCCAATGCCCAG 3-10-3 MOE 627 338560 1131 1144 AAACAGACACTTGA
3-8-3 MOE 630 338489 1131 1146 TCAAACAGACACTTGA 3-10-3 MOE 629
338490 1145 1160 AGCACTGAACATTCTC 3-10-3 MOE 631 338561 1145 1158
CACTGAACATTCTC 3-8-3 MOE 632 338563 1181 1194 ATCCACCAGAATCC 3-8-3
MOE 634 338492 1181 1196 GGATCCACCAGAATCC 3-10-3 MOE 633 338564
1216 1229 TGATCAGTAAGGCC 3-8-3 MOE 635 338565 1232 1245
ACAAAGATGAAAAA 3-8-3 MOE 637 338494 1232 1247 GGACAAAGATGAAAAA
3-10-3 MOE 636 338566 1267 1280 CACGCAGCTTGGCC 3-8-3 MOE 639 338495
1267 1282 GGCACGCAGCTTGGCC 3-10-3 MOE 638 338571 1344 1357
GACCCCCAGCAGAG 3-8-3 MOE 641 338500 1344 1359 TGGACCCCCAGCAGAG
3-10-3 MOE 640 385068 1366 1379 CAAAGGCAAAGACC 3-8-3 MOE 642 385069
1369 1382 TCACAAAGGCAAAG 3-8-3 MOE 643 385070 1372 1385
CAGTCACAAAGGCA 3-8-3 MOE 644 385071 1375 1388 CGTCAGTCACAAAG 3-8-3
MOE 645 385072 1378 1391 GCTCGTCAGTCACA 3-8-3 MOE 646 385073 1381
1394 CATGCTCGTCAGTC 3-8-3 MOE 647 386608 1384 1397 GGGCATGCTCGTCA
1-12-1 MOE 648 386593 1384 1397 GGGCATGCTCGTCA 2-10-2 MOE 648
396146 1384 1397 GGGCATGCTCGTCA 2-10-2 MOE 648 338572 1384 1397
GGGCATGCTCGTCA 3-8-3 MOE 648 396149 1384 1397 GGGCATGCTCGTCA
1-1-10-2 2'- 648 (butyl- acetamido)- palmitamide/ OMe/OMe 386627
1384 1397 GGGCATGCTCGTCA 2-10-2 648 Methyleneoxy BNA 386610 1387
1400 CTTGGGCATGCTCG 1-12-1 MOE 654 386595 1387 1400 CTTGGGCATGCTCG
2-10-2 MOE 654 385074 1387 1400 CTTGGGCATGCTCG 3-8-3 MOE 654 385075
1390 1403 TGCCTTGGGCATGC 3-8-3 MOE 657 385076 1393 1406
GGGTGCCTTGGGCA 3-8-3 MOE 648 385077 1396 1409 GCAGGGTGCCTTGG 3-8-3
MOE 659 385078 1399 1412 AGCGCAGGGTGCCT 3-8-3 MOE 660 338502 1401
1416 GTGGAGCGCAGGGTGC 3-10-3 MOE 661 385079 1402 1415
TGGAGCGCAGGGTG 3-8-3 MOE 662 385080 1405 1418 TGGTGGAGCGCAGG 3-8-3
MOE 663 385081 1408 1421 GCTTGGTGGAGCGC 3-8-3 MOE 664 385082 1411
1424 AGAGCTTGGTGGAG 3-8-3 MOE 665 338503 1412 1427 AAAAGAGCTTGGTGGA
3-10-3 MOE 666 338574 1412 1425 AAGAGCTTGGTGGA 3-8-3 MOE 667 385083
1414 1427 AAAAGAGCTTGGTG 3-8-3 MOE 668 385084 1417 1430
CAAAAAAGAGCTTG 3-8-3 MOE 669 338504 1434 1449 AAGGAGCTGAGGAACA
3-10-3 MOE 670 338575 1434 1447 GGAGCTGAGGAACA 3-8-3 MOE 671 327167
1441 1454 CCTGGAAGCTGCTG 3-8-3 MOE 526 338576 1445 1458
AGACCCTGGAAGGA 3-8-3 MOE 673 338505 1445 1460 GCAGACCCTGGAAGGA
3-10-3 MOE 672 338506 1449 1464 ACCAGCAGACCCTGGA 3-10-3 MOE 674
338577 1449 1462 CAGCAGACCCTGGA 3-8-3 MOE 576 338507 1464 1479
CAGTAGAGAACAGCCA 3-10-3 MOE 676 338578 1464 1477 GTAGAGAACAGCCA
3-8-3 MOE 677 338508 1475 1490 TGTTGAGGAAACAGTA 3-10-3 MOE 678
338579 1475 1488 TTGAGGAAACAGTA 3-8-3 MOE 679 338509 1487 1502
CCTGCACCTCCTTGTT 3-10-3 MOE 680 338580 1610 1623 TGCACCTCCTTGTT
3-8-3 MOE 575
[0634] In certain embodiments, a target region is nucleotides
378-391 of SEQ ID NO: 9. In certain embodiments, a short antisense
compound is targeted to nucleotides 378-391 of SEQ ID NO: 9. In
certain such embodiments, a short antisense compound targeted to
nucleotides 378-391 comprises a nucleotide sequence selected from
SEQ ID NO 486 or 487. In certain such embodiments, a short
antisense compound targeted to nucleotides 378-391 of SEQ ID NO: 9
is selected from Isis No 338463 or 338534.
[0635] In certain embodiments, a target region is nucleotides
499-521 of SEQ ID NO: 9. In certain embodiments, a short antisense
compound is targeted to nucleotides 499-521 of SEQ ID NO: 9. In
certain such embodiments, a short antisense compound targeted to
nucleotides 499-521 comprises a nucleotide sequence selected from
SEQ ID NO 488, 489, 490, 491, 492, 493, 494, 495, 496, or 497. In
certain such embodiments, a short antisense compound targeted to
nucleotides 499-521 of SEQ ID NO: 9 is selected from Isis No
327130, 327131, 327132, 327133, 327134, 327135, 327136, 327137,
327138, or 327139.
[0636] In certain embodiments, a target region is nucleotides
531-553 of SEQ ID NO: 9. In certain embodiments, a short antisense
compound is targeted to nucleotides 531-553 of SEQ ID NO: 9. In
certain such embodiments, a short antisense compound targeted to
nucleotides 531-553 comprises a nucleotide sequence selected from
SEQ ID NO 498, 499, 500, 501, 502, 503, 504, 505, 506, or 507. In
certain such embodiments, a short antisense compound targeted to
nucleotides 531-553 of SEQ ID NO: 9 is selected from Isis No
327140, 327141, 327142, 327143, 327144, 327145, 327146, 327147,
327148, or 327149.
[0637] In certain embodiments, a target region is nucleotides
545-567 of SEQ ID NO: 9. In certain embodiments, a short antisense
compound is targeted to nucleotides 545-567 of SEQ ID NO: 9. In
certain such embodiments, a short antisense compound targeted to
nucleotides 545-567 comprises a nucleotide sequence selected from
SEQ ID NO 508, 509, 510, 511, 512, 513, 514, 515, 516, or 517. In
certain such embodiments, a short antisense compound targeted to
nucleotides 545-567 of SEQ ID NO: 9 is selected from Isis No
327150, 327151, 327152, 327153, 327154, 327155, 327156, 327157,
327158, or 327159.
[0638] In certain embodiments, a target region is nucleotides
531-567 of SEQ ID NO: 9. In certain embodiments, a short antisense
compound is targeted to nucleotides 531-567 of SEQ ID NO: 9. In
certain such embodiments, a short antisense compound targeted to
nucleotides 531-567 comprises a nucleotide sequence selected from
SEQ ID NO 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508,
509, 510, 511, 512, 513, 514, 515, 516, or 517. In certain such
embodiments, a short antisense compound targeted to nucleotides
531-567 of SEQ ID NO: 9 is selected from Isis No 327140, 327141,
327142, 327143, 327144, 327145, 327146, 327147, 327148, 327149,
327150, 327151, 327152, 327153, 327154, 327155, 327156, 327157,
327158, or 327159.
[0639] In certain embodiments, a target region is nucleotides
684-714 of SEQ ID NO: 9. In certain embodiments, a short antisense
compound is targeted to nucleotides 684-714 of SEQ ID NO: 9. In
certain such embodiments, a short antisense compound targeted to
nucleotides 684-714 comprises a nucleotide sequence selected from
SEQ ID NO 518, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529,
530, 531, 532, 533, 534, 535, or 536. In certain such embodiments,
a short antisense compound targeted to nucleotides 684-714 of SEQ
ID NO: 9 is selected from Isis No 345897, 327160, 327161, 327162,
327163, 327164, 327165, 327166, 327167, 327168, 327169, 327170,
327171, 327172, 327173, 327174, 327175, 327176, or 327177.
[0640] In certain embodiments, a target region is nucleotides
869-891 of SEQ ID NO: 9. In certain embodiments, a short antisense
compound is targeted to nucleotides 869-891 of SEQ ID NO: 9. In
certain such embodiments, a short antisense compound targeted to
nucleotides 869-891 comprises a nucleotide sequence selected from
SEQ ID NO 537, 538, 539, 540, 541, 542, 543, 544, 545, or 546. In
certain such embodiments, a short antisense compound targeted to
nucleotides 869-891 of SEQ ID NO: 9 is selected from Isis No
327178, 327179, 327180, 327181, 327182, 327183, 327184, 327185,
327186, or 327187.
[0641] In certain embodiments, a target region is nucleotides
955-977 of SEQ ID NO: 9. In certain embodiments, a short antisense
compound is targeted to nucleotides 955-977 of SEQ ID NO: 9. In
certain such embodiments, a short antisense compound targeted to
nucleotides 955-977 comprises a nucleotide sequence selected from
SEQ ID NO 547, 548, 549, 550, 551, 552, 553, 554, 555, or 556. In
certain such embodiments, a short antisense compound targeted to
nucleotides 955-977 of SEQ ID NO: 9 is selected from Isis No
327188, 327189, 327190, 327191, 327192, 327193, 327194, 327195,
327196, or 327197.
[0642] In certain embodiments, a target region is nucleotides
1019-1041 of SEQ ID NO: 9. In certain embodiments, a short
antisense compound is targeted to nucleotides 1019-1041 of SEQ ID
NO: 9. In certain such embodiments, a short antisense compound
targeted to nucleotides 1019-1041 comprises a nucleotide sequence
selected from SEQ ID NO 557, 558, 559, 560, 561, 562, 563, 564,
565, or 566. In certain such embodiments, a short antisense
compound targeted to nucleotides 1019-1041 of SEQ ID NO: 9 is
selected from Isis No 327198, 327199, 327200, 327201, 327202,
327203, 327204, 327205, 327206, or 327207.
[0643] In certain embodiments, a target region is nucleotides
1160-1175 of SEQ ID NO: 9. In certain embodiments, a short
antisense compound is targeted to nucleotides 1160-1175 of SEQ ID
NO: 9. In certain such embodiments, a short antisense compound
targeted to nucleotides 1160-1175 comprises a nucleotide sequence
selected from SEQ ID NO 567 or 568. In certain such embodiments, a
short antisense compound targeted to nucleotides 1160-1175 of SEQ
ID NO: 9 is selected from Isis No 338491 or 338562.
[0644] In certain embodiments, a target region is nucleotides
1307-1377 of SEQ ID NO: 9. In certain embodiments, a short
antisense compound is targeted to nucleotides 1307-1377 of SEQ ID
NO: 9. In certain such embodiments, a short antisense compound
targeted to nucleotides 1307-1377 comprises a nucleotide sequence
selected from SEQ ID NO 569, 570, 571, 572, or 573. In certain such
embodiments, a short antisense compound targeted to nucleotides
1307-1377 of SEQ ID NO: 9 is selected from Isis No 338498, 338569,
338499, 338570, or 385067.
[0645] In certain embodiments, a target region is nucleotides
1307-1414 of SEQ ID NO: 9. In certain embodiments, a short
antisense compound is targeted to nucleotides 1307-1414 of SEQ ID
NO: 9. In certain such embodiments, a short antisense compound
targeted to nucleotides 1307-1414 comprises a nucleotide sequence
selected from SEQ ID NO 569, 570, 571, 572, 573, or 574. In certain
such embodiments, a short antisense compound targeted to
nucleotides 1307-1414 of SEQ ID NO: 9 is selected from Isis No
338498, 338569, 338499, 338570, 385067, or 338573.
[0646] In certain embodiments, short antisense compounds targeted
to a GCGR nucleic acid are 8 to 16, preferably 9 to 15, more
preferably 9 to 14, more preferably 10 to 14 nucleotides in length.
In certain embodiments, short antisense compounds targeted to a
GCGR nucleic acid are 9 to 14 nucleotides in length. In certain
embodiments, short antisense compounds targeted to a GCGR nucleic
acid are 10 to 14 nucleotides in length. In certain embodiments,
such short antisense compounds are short antisense
oligonucleotides.
[0647] In certain embodiments, short antisense compounds targeted
to a GCGR nucleic acid are short gapmers. In certain such
embodiments, short gapmers targeted to a GCGR nucleic acid comprise
at least one high affinity modification in one or more wings of the
compound. In certain embodiments, short antisense compounds
targeted to a GCGR nucleic acid comprise 1 to 3 high-affinity
modifications in each wing. In certain such embodiments, the
nucleosides or nucleotides of the wing comprise a 2' modification.
In certain such embodiments, the monomers of the wing are BNA's. In
certain such embodiments, the monomers of the wing are selected
from .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2') BNA,
.beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA, Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') BNA, Aminooxy (4'-CH.sub.2--O--N(R)-2')
BNA and Oxyamino (4'-CH.sub.2--N(R)--O-2') BNA. In certain
embodiments, the monomers of a wing comprise a substituent at the
2' position selected from allyl, amino, azido, thio, O-allyl,
O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3, O
--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), and
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. In certain embodiments, the monomers of a
wing are 2'MOE nucleotides.
[0648] In certain embodiments, short antisense compounds targeted
to a GCGR nucleic acid comprise a gap between the 5' wing and the
3' wing. In certain embodiments the gap comprises five, six, seven,
eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
In certain embodiments, the monomers of the gap are unmodified
deoxyribonucleotides. In certain embodiments, the monomers of the
gap are unmodified ribonucleotides. In certain embodiments, gap
modifications (if any) gap result in an antisense compound that,
when bound to its target nucleic acid, supports cleavage by an
RNase, including, but not limited to, RNase H.
[0649] In certain embodiments, short antisense compounds targeted
to a GCGR nucleic acid have uniform monomeric linkages. In certain
such embodiments, those linkages are all phosphorothioate linkages.
In certain embodiments, the linkages are all phosphodiester
linkages. In certain embodiments, short antisense compounds
targeted to a GCGR nucleic acid have mixed backbones.
[0650] In certain embodiments, short antisense compounds targeted
to a GCGR nucleic acid are 8 monomers in length. In certain
embodiments, short antisense compounds targeted to a GCGR nucleic
acid are 9 monomers in length. In certain embodiments, short
antisense compounds targeted to a GCGR nucleic acid are 10 monomers
in length. In certain embodiments, short antisense compounds
targeted to a GCGR nucleic acid are 11 monomers in length. In
certain embodiments, short antisense compounds targeted to a GCGR
nucleic acid are monomers in length. In certain embodiments, short
antisense compounds targeted to a GCGR nucleic acid are 13 monomers
in length. In certain embodiments, short antisense compounds
targeted to a GCGR nucleic acid are 14 monomers in length. In
certain embodiments, short antisense compounds targeted to a GCGR
nucleic acid are 15 monomers in length. In certain embodiments,
short antisense compounds targeted to a GCGR nucleic acid are 16
monomers in length. In certain embodiments, short antisense
compounds targeted to a GCGR nucleic acid comprise 9 to 15
monomers. In certain embodiments, short antisense compounds
targeted to a GCGR nucleic acid comprise 10 to 15 monomers. In
certain embodiments, short antisense compounds targeted to a GCGR
nucleic acid comprise 12 to 14 monomers. In certain embodiments,
short antisense compounds targeted to a GCGR nucleic acid comprise
12 to 14 nucleotides or nucleosides.
[0651] In certain embodiments, the invention provides methods of
modulating expression of GCGR. In certain embodiments, such methods
comprise use of one or more short antisense compound targeted to a
GCGR nucleic acid, wherein the short antisense compound targeted to
a GCGR nucleic acid is from about 8 to about 16, preferably 9 to
15, more preferably 9 to 14, more preferably 10 to 14 monomers
(i.e. from about 8 to about 16 linked monomers). One of ordinary
skill in the art will appreciate that this comprehends methods of
modulating expression of GCGR using one or more short antisense
compounds targeted to a GCGR nucleic acid of 8, 9, 10, 11, 12, 13,
14, 15 or 16 monomers.
[0652] In certain embodiments, methods of modulating GCGR comprise
use of a short antisense compound targeted to a GCGR nucleic acid
that is 8 monomers in length. In certain embodiments, methods of
modulating GCGR comprise use of a short antisense compound targeted
to a GCGR nucleic acid that is 9 monomers in length. In certain
embodiments, methods of modulating GCGR comprise use of a short
antisense compound targeted to a GCGR nucleic acid that is 10
monomers in length. In certain embodiments, methods of modulating
GCGR comprise use of a short antisense compound targeted to a GCGR
nucleic acid that is 11 monomers in length. In certain embodiments,
methods of modulating GCGR comprise use of a short antisense
compound targeted to a GCGR nucleic acid that is 12 monomers in
length. In certain embodiments, methods of modulating GCGR comprise
use of a short antisense compound targeted to a GCGR nucleic acid
that is 13 monomers in length. In certain embodiments, methods of
modulating GCGR comprise use of a short antisense compound targeted
to a GCGR nucleic acid that is 14 monomers in length. In certain
embodiments, methods of modulating GCGR comprise use of a short
antisense compound targeted to a GCGR nucleic acid that is 15
monomers in length. In certain embodiments, methods of modulating
GCGR comprise use of a short antisense compound targeted to a GCGR
nucleic acid that is 16 monomers in length.
[0653] In certain embodiments, methods of modulating expression of
GCGR comprise use of a short antisense compound targeted to a GCGR
nucleic acid comprising 9 to 15 monomers. In certain embodiments,
methods of modulating expression of GCGR comprise use of a short
antisense compound targeted to a GCGR nucleic acid comprising 10 to
15 monomers. In certain embodiments, methods of modulating
expression of GCGR comprise use of a short antisense compound
targeted to a GCGR nucleic acid comprising 12 to 14 monomers. In
certain embodiments, methods of modulating expression of GCGR
comprise use of a short antisense compound targeted to a GCGR
nucleic acid comprising 12 or 14 nucleotides or nucleosides.
[0654] 8. DGAT2
[0655] Diacylglycerol transferase 2 (also known as DGAT2,
diacylglycerol O-transferase 2, acyl-CoA:diacylglycerol
acyltransferase 2), Diacylglycerol transferase 2 has been shown to
be implicated in the absorption process of triglycerides (also
called triacylglycerols) from food.
[0656] The absorption of triglycerides from food is a very
efficient process which occurs by a series of steps wherein the
dietary triacylglycerols are hydrolyzed in the intestinal lumen and
then resynthesized within enterocytes. The resynthesis of
triacylglycerols can occur via the monoacylglycerol pathway which
commences with monoacylglycerol acyltransferase (MGAT) catalyzing
the synthesis of diacylglycerol from monoacylglycerol and fatty
acyl-CoA. An alternative synthesis of diacylglycerols is provided
by the glycerol-phosphate pathway which describes the coupling of
two molecules of fatty acyl-CoA to glycerol-3-phosphate. In either
case, diacylglycerol is then acylated with another molecule of
fatty acyl-CoA in a reaction catalyzed by one of two diacylglycerol
acyltransferase enzymes to form the triglyceride (Farese et al.,
Curr. Opin. Lipidol., 2000, 11, 229-234).
[0657] The reaction catalyzed by diacylglycerol acyltransferase is
the final and only committed step in triglyceride synthesis. As
such, diacylglycerol acyltransferase is involved in intestinal fat
absorption, lipoprotein assembly, regulating plasma triglyceride
concentrations, and fat storage in adipocytes. The first
diacylglycerol acyltransferase, diacylglycerol transferase 1, was
identified in 1960 and the human and mouse genes encoding this
protein were isolated in 1998 (Cases et al., Proc. Natl. Acad. Sci.
U.S.A., 1998, 95, 13018-13023; Oelkers et al., J. Biol. Chem.,
1998, 273, 26765-26771). Mice lacking diacylglycerol
acyltransferase 1 are viable and can still synthesize triglycerides
through other biological routes, suggesting the existence of
multiple mechanisms for triglyceride synthesis (Smith et al., Nat.
Genet., 2000, 25, 87-90).
[0658] A second diacylglycerol transferase, diacylglycerol
transferase 2 (also known as DGAT2, diacylglycerol O-transferase 2,
acyl-CoA:diacylglycerol acyltransferase 2), was subsequently
identified in the fungus Mortierella, humans and mice (Cases et
al., J. Biol. Chem., 2001, 276, 38870-38876; Lardizabal et al., J.
Biol. Chem., 2001, 276, 38862-38869). Enzymatic assays indicate
that this recently identified protein does possess diacylglycerol
transferase activity that utilizes a broad range of long chain
fatty acyl-CoA substrates (Cases et al., J. Biol. Chem., 2001, 276,
38870-38876).
[0659] Diacylglycerol transferase 2 is a member of a family of
genes whose sequences are unrelated to diacylglycerol transferase
1. In addition to differing in sequence compared to diacylglycerol
transferase 1, in vitro assays illustrate that diacylglycerol
transferase 2 has higher activity at lower concentrations of
magnesium chloride and oleoyl-CoA (Cases et al., J. Biol. Chem.,
2001, 276, 38870-38876). The predicted protein sequence of
diacylglycerol transferase 2 contains at least one putative
transmembrane domain, three potential N-linked glycosylation sites,
six potential protein kinase C phosphorylation consensus sites, as
well as sequences in common with a putative glycerol
phosphorylation site found in acyltransferase enzymes (Cases et
al., J. Biol. Chem., 2001, 276, 38870-38876). The International
Radiation Hybrid Mapping Consortium has mapped human diacylglycerol
transferase 2 to chromosome 11q13.3.
[0660] In human tissues, the highest levels of diacylglycerol
transferase 2 are detected in liver and white adipose tissues, with
lower levels found in mammary gland, testis and peripheral blood
leukocytes (Cases et al., J. Biol. Chem., 2001, 276, 38870-38876).
Two mRNA species of 2.4 and 1.8 kilobases are detected in human
tissues, whereas the major diacylglycerol transferase 2 mRNA
species in mouse tissues is 2.4 kilobases. In addition to liver and
white adipose tissues, diacylglycerol transferase 2 is expressed in
all segments of the small intestine in mice, with higher expression
in the proximal intestine and lower expression in the distal
intestine (Cases et al., J. Biol. Chem., 2001, 276,
38870-38876).
[0661] Diacylglycerol transferase activity exhibits distinct
patterns during postnatal development of the rat liver. As there is
no correlation between the mRNA expression and activity patterns,
post-translational modifications may participate in the regulation
of diacylglycerol transferase 2 activity during rat development
(Waterman et al., J. Lipid. Res., 2002, 43, 1555-1562).
[0662] Diacylglycerol transferase 2 mRNA is preferentially
upregulated by insulin treatment, as shown by in vitro assays
measuring the diacylglycerol activity from the membrane fraction of
cultured mouse adipocytes (Meegalla et al., Biochem. Biophys. Res.
Commun., 2002, 298, 317-323). In fasting mice, diacylglycerol
transferase 2 expression is greatly reduced, and dramatically
increases upon refeeding. The expression patterns of two enzymes
that participate in fatty acid synthesis, acetyl-CoA carboxylase
and fatty acid synthase, respond to fasting and refeeding in a
similar fashion. These results, combined with the observation that
diacylglycerol transferase 2 is abundantly expressed in liver,
suggest that diacylglycerol transferase 2 is tightly linked to the
endogenous fatty acid synthesis pathway (Meegalla et al., Biochem.
Biophys. Res. Commun., 2002, 298, 317-323).
[0663] Studies of mice harboring a disruption in the diacylglycerol
acyltransferase 1 gene provide evidence that diacylglycerol
acyltransferase 2 contributes to triglyceride synthesis. Levels of
diacylglycerol transferase 2 mRNA expression are similar in
intestinal segments from both wild type and diacylglycerol
transferase 1-deficient mice (Buhman et al., J. Biol. Chem., 2002,
277, 25474-25479). Using magnesium chloride to distinguish between
diacylglycerol transferase 1 and 2 activity, Buhman, et al.
observed that, in diacylglycerol transferase 1-deficient mice,
diacylglycerol transferase activity is reduced to 50% in the
proximal intestine and to 10-15% in the distal intestine (Buhman et
al., J. Biol. Chem., 2002, 277, 25474-25479).
[0664] Additionally, diacylglycerol transferase 2 mRNA levels are
not up-regulated the liver or adipose tissues of diacylglycerol
transferase 1-deficient mice, even after weeks of high-fat diet
(Cases et al., J. Biol. Chem., 2001, 276, 38870-38876; Chen et al.,
J. Clin. Invest., 2002, 109, 1049-1055). However, in ob/ob mice,
which have a mutation in the leptin gene that results in obesity,
diacylglycerol transferase 2 is more highly expressed than in wild
type mice, suggesting that diacylglycerol transferase 2 may be
partly responsible for the highly accumulated fat mass seen in
these mice. Furthermore, the combined mutations of leptin and
diacylglycerol transferase 1 leads to a three-fold elevation in
diacylglycerol transferase 2 expression in white adipose tissue,
compared to the levels in the same tissue from diacylglycerol
transferase 1-deficient mice (Chen et al., J. Clin. Invest., 2002,
109, 1049-1055). Diacylglycerol transferase 2 mRNA is also
upregulated in the skin of these mice (Chen et al., J. Clin.
Invest., 2002, 109, 175-181). These data suggest leptin normally
downregulates diacylglycerol transferase 2 expression, and that the
upregulation of diacylglycerol transferase 2 in white adipose
tissue in these mice may provide an alternate pathway for the
triglyceride synthesis that still occurs in leptin
deficient/diacylglycerol transferase 1-deficient mice (Chen et al.,
J. Clin. Invest., 2002, 109, 1049-1055).
[0665] Diacylglycerol acyltransferase 1 knockout mice exhibit
interesting phenotypes in that they are lean, resistant to
diet-induce obesity, have decreased levels of tissue triglycerides
and increased sensitivity to insulin and leptin (Chen et al., J.
Clin. Invest., 2002, 109, 1049-1055; Smith et al., Nat. Genet.,
2000, 25, 87-90). As diacylglycerol transferase 2 also participates
in triglyceride synthesis, interfering with diacylglycerol
transferase 2 may similarly lead to reduced body fat content.
Definitions
[0666] "DGAT2" means the gene product or protein of which
expression is to be modulated by administration of a short
antisense compound.
[0667] "DGAT2 nucleic acid" means any nucleic acid encoding DGAT2.
For example, in certain embodiments, a DGAT2 nucleic acid includes,
without limitation, a DNA sequence encoding DGAT2, an RNA sequence
transcribed from DNA encoding DGAT2, and an mRNA sequence encoding
DGAT2.
[0668] "DGAT2 mRNA" means an mRNA encoding DGAT2.
Therapeutic Indications
[0669] Antisense technology is an effective means for reducing
DGAT2 expression and has proven to be uniquely useful in a number
of therapeutic, diagnostic, and research applications. As such, in
certain embodiments, the present invention provides compounds
targeted to nucleic acid encoding DGAT2, which modulate the
expression of DGAT2. Further provided herein are short antisense
compounds capable of effectively inhibiting DGAT2 expression.
[0670] In certain embodiments, a subject, suspected of having a
disease or associated with DGAT2 is treated by administering one or
more short antisense compounds targeted to a nucleic acid encoding
DGAT2. For example, in a non-limiting embodiment, such methods
comprise the step of administering to an animal a therapeutically
effective amount of a short antisense compound. In certain such
embodiments, short antisense compounds effectively inhibit the
activity of DGAT2 or inhibit the expression of DGAT2. In one
embodiment, the activity or expression of DGAT2 in a subject is
inhibited by at least 10%, by at least 20%, by at least 25%, by at
least 30%, by at least 40%, by at least 50%, by at least 60%, by at
least 70%, by at least 75%, by at least 80%, by at least 85%, by at
least 90%, by at least 95%, by at least 98%, by at least 99%, or by
100%. In certain embodiments, the activity or expression of DGAT2
in a subject is inhibited by about 30%. More preferably, the
activity or expression of DGAT2 in a subject is inhibited by 50% or
more.
[0671] The reduction of the expression of DGAT2 may be measured,
for example, in blood, plasma, serum, adipose tissue, liver or any
other body fluid, tissue or organ of the animal. Preferably, the
cells contained within said fluids, tissues or organs being
analyzed contain a nucleic acid molecule encoding DGAT2 and/or the
DGAT2 protein itself.
[0672] In certain embodiments, pharmaceutical and other
compositions comprising the compounds of the invention are also
provided. For example, short antisense compounds targeted to a
DGAT2 nucleic acid can be utilized in pharmaceutical compositions
by adding an effective amount of a compound to a suitable
pharmaceutically acceptable diluent or carrier.
[0673] Certain short antisense compounds targeting DGAT2 may have
any one or more properties or characteristics of the short
antisense compounds generally described herein. In certain
embodiments, short antisense compounds targeting a DGAT2 nucleic
acid have a motif (wing-deoxy gap-wing) selected from 1-12-1,
1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1, 1-10-2, 3-8-3,
2-8-2, 1-8-1, 3-6-3 or 1-6-1. In certain embodiments, short
antisense compounds targeting a DGAT2 nucleic acid have a motif
(wing-deoxy gap-wing) selected from 1-10-1, 2-10-2 and 3-10-3.
[0674] Provided herein are methods of treating an individual by
administering one or more short antisense compound targeted to a
DGAT2 nucleic acid or a pharmaceutical composition comprising such
compound. Further provided are methods of treating a subject having
a disease or conditions associated with DGAT2 activity by
administering a short antisense compound targeted to a DGAT2
nucleic acid. Diseases and conditions associated with DGAT2
include, but are not limited to, cardiovascular disorders, obesity,
diabetes, cholesterolemia, and liver steatosis.
Certain Short Antisense Compounds Targeted to a DGAT2 Nucleic
Acid
[0675] In certain embodiments, short antisense compounds are
targeted to a DGAT2 nucleic acid having the sequence of
GENBANK.RTM. Accession No. NM.sub.--032564.2, incorporated herein
as SEQ ID NO: 10. In certain such embodiments, a short antisense
compound targeted to SEQ ID NO: 10 is at least 90% complementary to
SEQ ID NO: 10. In certain such embodiments, a short antisense
compound targeted to SEQ ID NO: 10 is at least 95% complementary to
SEQ ID NO: 10. In certain such embodiments, a short antisense
compound targeted to SEQ ID NO: 10 is 100% complementary to SEQ ID
NO: 10. In certain embodiments, a short antisense compound targeted
to SEQ ID NO: 10 includes a nucleotide sequence selected from the
nucleotide sequences set forth in Tables 14 and 15.
[0676] Each nucleotide sequence set forth in each Tables 14 and 15
is independent of any modification to a sugar moiety, an
internucleoside linkage, or a nucleobase. As such, short antisense
compounds comprising a nucleotide sequence as set forth in Tables
14 and 15 may comprise, independently, one or more modifications to
a sugar moiety, an internucleoside linkage, or a nucleobase.
Antisense compounds described by Isis Number (Isis NO.) indicate a
combination of nucleobase sequence and one or more modifications to
a sugar moiety, an internucleoside linkage, or a nucleobase.
[0677] Tables 14 and 15 illustrate examples of short antisense
compounds targeted to SEQ ID NO: 10. Table 14 illustrates short
antisense compounds that are 100% complementary to SEQ ID NO: 10.
Table 15 illustrates short antisense compounds that have one or two
mismatches with respect to SEQ ID NO: 10. The column labeled
`gapmer motif` indicates the wing-gap-wing motif of each short
antisense compounds. The gap segment comprises 2'-deoxynucleotides
and each nucleotide of each wing segment comprises a 2'-modified
sugar. The particular 2'-modified sugar is also indicated in the
`gapmer motif` column. For example, `2-10-2 MOE` means a 2-10-2
gapmer motif, where a gap segment of ten 2'-deoxynucleotides is
flanked by wing segments of two nucleotides, where the nucleotides
of the wing segments are 2'-MOE nucleotides. Internucleoside
linkages are phosphorothioate. The short antisense compounds
comprise 5-methylcytidine in place of unmodified cytosine, unless
"unmodified cytosine" is listed in the gapmer motif column, in
which case the indicated cytosines are unmodified cytosines. For
example, "5-mC in gap only" indicates that the gap segment has
5-methylcytosines, while the wing segments have unmodified
cytosines.
TABLE-US-00017 TABLE 14 Short Antisense Compounds targeted to SEQ
ID NO: 10 5' 3' SEQ ISIS Target Target Gapmer ID NO. Site Site
Sequence (5'-3') Motif NO 372556 231 244 ATGAGGGTCTTCAT 2-10-2 MOE
681 372557 249 262 ACCCCGGAGTAGGC 2-10-2 MOE 682 382601 249 260
CCCGGAGTAGGC 1-10-1 MOE 683 372480 251 266 CAGGACCCCGGAGTAG 3-10-3
MOE 684 372481 252 267 GCAGGACCCCGGAGTA 3-10-3 MOE 685 372558 252
265 AGGACCCCGGAGTA 2-10-2 MOE 686 372559 253 266 CAGGACCCCGGAGT
2-10-2 MOE 687 382603 331 342 CAGACCCCTCGC 1-10-1 MOE 688 382604
361 372 AGAGGATGCTGG 1-10-1 MOE 689 372485 392 407 GAGCCAGGTGACAGAG
3-10-3 MOE 690 372563 393 406 AGCCAGGTGACAGA 2-10-2 MOE 691 382605
397 408 TGAGCCAGGTGA 1-10-1 MOE 692 372565 414 427 TTTTCCACCTTGGA
2-10-2 MOE 693 382606 482 493 CTGCAGGCCACT 1-10-1 MOE 694 372497
651 666 TCACCAGCTGGATGGG 3-10-3 MOE 695 372498 652 667
TTCACCAGCTGGATGG 3-10-3 MOE 696 372575 652 665 CACCAGCTGGATGG
2-10-2 MOE 697 372576 653 666 TCACCAGCTGGATG 2-10-2 MOE 698 382607
655 666 TCACCAGCTGGA 1-10-1 MOE 699 372499 656 671 TGTCTTCACCAGCTGG
3-10-3 MOE 700 372577 657 670 GTCTTCACCAGCTG 2-10-2 MOE 701 372500
659 674 GTGTGTCTTCACCAGC 3-10-3 MOE 702 372578 660 673
TGTGTCTTCACCAG 2-10-2 MOE 703 372501 661 676 TTGTGTGTCTTCACCA
3-10-3 MOE 704 372579 662 675 TGTGTGTCTTCACC 2-10-2 MOE 705 372502
664 679 AGGTTGTGTGTCTTCA 3-10-3 MOE 706 372580 665 678
GGTTGTGTGTCTTC 2-10-2 MOE 707 372503 666 681 GCAGGTTGTGTGTCTT
3-10-3 MOE 708 372581 667 680 CAGGTTGTGTGTCT 2-10-2 MOE 709 372504
669 684 TCAGCAGGTTGTGTGT 3-10-3 MOE 710 372582 670 683
CAGCAGGTTGTGTG 2-10-2 MOE 711 372505 671 686 GGTCAGCAGGTTGTGT
3-10-3 MOE 712 372506 672 687 TGGTCAGCAGGTTGTG 3-10-3 MOE 713
372583 672 685 GTCAGCAGGTTGTG 2-10-2 MOE 714 372584 673 686
GGTCAGCAGGTTGT 2-10-2 MOE 715 372507 676 691 CTGGTGGTCAGCAGGT
3-10-3 MOE 716 372585 677 690 TGGTGGTCAGCAGG 2-10-2 MOE 717 382608
680 691 CTGGTGGTCAGC 1-10-1 MOE 718 372508 681 696 AGTTCCTGGTGGTCAG
3-10-3 MOE 719 372586 682 695 GTTCCTGGTGGTCA 2-10-2 MOE 720 372509
684 699 TATAGTTCCTGGTGGT 3-10-3 MOE 721 372587 685 698
ATAGTTCCTGGTGG 2-10-2 MOE 722 372510 686 701 GATATAGTTCCTGGTG
3-10-3 MOE 723 372588 687 700 ATATAGTTCCTGGT 2-10-2 MOE 724 372511
691 706 CCAAAGATATAGTTCC 3-10-3 MOE 725 372512 692 707
TCCAAAGATATAGTTC 3-10-3 MOE 726 372589 692 705 CAAAGATATAGTTC
2-10-2 MOE 727 372590 693 706 CCAAAGATATAGTT 2-10-2 MOE 728 382609
724 735 CCAGGCCCATGA 1-10-1 MOE 729 372514 725 740 GGCACCCAGGCCCATG
3-10-3 MOE 730 372592 726 739 GCACCCAGGCCCAT 2-10-2 MOE 731 372515
730 745 CAGAAGGCACCCAGGC 3-10-3 MOE 732 372593 731 744
AGAAGGCACCCAGG 2-10-2 MOE 733 382610 851 862 CCAGACATCAGG 1-10-1
MOE 734 382611 867 878 GACAGGGCAGAT 1-10-1 MOE 735 382602 868 879
TGACAGGGCAGA 1-10-1 MOE 736 382612 911 922 CCACTCCCATTC 1-10-1 MOE
737 372524 965 980 GCCAGGCATGGAGCTC 3-10-3 MOE 738 372602 966 979
CCAGGCATGGAGCT 2-10-2 MOE 739 382613 968 979 CCAGGCATGGAG 1-10-1
MOE 740 382614 987 998 CAGGGTGACTGC 1-10-1 MOE 741 372525 989 1004
GTTCCGCAGGGTGACT 3-10-3 MOE 742 372603 990 1003 TTCCGCAGGGTGAC
2-10-2 MOE 743 372526 992 1007 GCGGTTCCGCAGGGTG 3-10-3 MOE 744
372604 993 1006 CGGTTCCGCAGGGT 2-10-2 MOE 745 372530 1106 1121
TCGGCCCCAGGAGCCC 3-10-3 MOE 746 372608 1107 1120 CGGCCCCAGGAGCC
2-10-2 MOE 747 372531 1109 1124 CCATCGGCCCCAGGAG 3-10-3 MOE 748
372609 1110 1123 CATCGGCCCCAGGA 2-10-2 MOE 749 372532 1112 1127
GACCCATCGGCCCCAG 3-10-3 MOE 750 372610 1113 1126 ACCCATCGGCCCCA
2-10-2 MOE 751 372533 1117 1132 TTCTGGACCCATCGGC 3-10-3 MOE 752
382615 1117 1128 GGACCCATCGGC 1-10-1 MOE 753 372611 1118 1131
TCTGGACCCATCGG 2-10-2 MOE 754 372536 1199 1214 CACCAGCCCCCAGGTG
3-10-3 MOE 755 372614 1200 1213 ACCAGCCCCCAGGT 2-10-2 MOE 756
372537 1204 1219 TAGGGCACCAGCCCCC 3-10-3 MOE 757 372615 1205 1218
AGGGCACCAGCCCC 2-10-2 MOE 758 372538 1209 1224 TGGAGTAGGGCACCAG
3-10-3 MOE 759 372616 1210 1223 GGAGTAGGGCACCA 2-10-2 MOE 760
382616 1215 1226 CTTGGAGTAGGG 1-10-1 MOE 761 372539 1218 1233
TGATGGGCTTGGAGTA 3-10-3 MOE 762 372617 1219 1232 GATGGGCTTGGAGT
2-10-2 MOE 763 372540 1293 1308 TGTGGTACAGGTCGAT 3-10-3 MOE 764
372618 1294 1307 GTGGTACAGGTCGA 2-10-2 MOE 765 382617 1294 1305
GGTACAGGTCGA 1-10-1 MOE 766 372541 1295 1310 GGTGTGGTACAGGTCG
3-10-3 MOE 767 372619 1296 1309 GTGTGGTACAGGTC 2-10-2 MOE 768
372542 1298 1313 CATGGTGTGGTACAGG 3-10-3 MOE 769 372620 1299 1312
ATGGTGTGGTACAG 2-10-2 MOE 770 372543 1300 1315 TACATGGTGTGGTACA
3-10-3 MOE 771 372621 1301 1314 ACATGGTGTGGTAC 2-10-2 MOE 772
372544 1303 1318 ATGTACATGGTGTGGT 3-10-3 MOE 773 372622 1304 1317
TGTACATGGTGTGG 2-10-2 MOE 774 382618 1313 1324 GCCTCCATGTAC 1-10-1
MOE 775 382619 1325 1336 AGCTTCACCAGG 1-10-1 MOE 776 382620 1383
1394 GTTCACCTCCAG 1-10-1 MOE 777
TABLE-US-00018 TABLE 15 Short antisense compounds targeted to SEQ
ID NO: 10 and having 1 or 2 mismatches 5' 3' SEQ ISIS Target Target
Gapmer ID NO Site Site Sequence (5'-3') Motif NO 372608 151 164
CGGCCCCAGGAGCC 2-10-2 MOE 747 372474 156 171 CATGCCCCAGCCGCCG
3-10-3 MOE 778 372552 157 170 ATGCCCCAGCCGCC 2-10-2 MOE 779 382609
167 178 CCAGGCCCATGA 1-10-1 MOE 729 372478 230 245 GATGAGGGTCTTCATG
3-10-3 MOE 780 372479 248 263 GACCCCGGAGTAGGCA 3-10-3 MOE 781
382611 317 328 GACAGGGCAGAT 1-10-1 MOE 735 372483 352 367
ATGCTGGAGCCAGTGC 3-10-3 MOE 782 372561 353 366 TGCTGGAGCCAGTG
2-10-2 MOE 783 372562 373 386 GTCTTGGAGGGCCG 2-10-2 MOE 784 382602
388 399 TGACAGGGCAGA 1-10-1 MOE 736 372613 392 405 CCCAGGTGTCAGAG
2-10-2 MOE 785 372486 412 427 TTTTCCACCTTGGATC 3-10-3 MOE 786
372564 413 426 TTTCCACCTTGGAT 2-10-2 MOE 787 372487 413 428
TTTTTCCACCTTGGAT 3-10-3 MOE 788 372488 418 433 AGGTGTTTTTCCACCT
3-10-3 MOE 789 372566 419 432 GGTGTTTTTCCACC 2-10-2 MOE 790 372489
459 474 CCAGGAAGGATAGGAC 3-10-3 MOE 791 372567 460 473
CAGGAAGGATAGGA 2-10-2 MOE 792 382612 475 486 CCACTCCCATTC 1-10-1
MOE 737 372490 483 498 TGACACTGCAGGCCAC 3-10-3 MOE 793 372568 484
497 GACACTGCAGGCCA 2-10-2 MOE 794 372491 492 507 ACATGAGGATGACACT
3-10-3 MOE 795 372569 493 506 CATGAGGATGACAC 2-10-2 MOE 796 372492
503 518 GCAGAAGGTGTACATG 3-10-3 MOE 797 372570 504 517
CAGAAGGTGTACAT 2-10-2 MOE 798 372493 512 527 GCAGTCAGTGCAGAAG
3-10-3 MOE 799 372571 513 526 CAGTCAGTGCAGAA 2-10-2 MOE 800 372496
612 627 ACACGGCCCAGTTTCG 3-10-3 MOE 801 372574 613 626
CACGGCCCAGTTTC 2-10-2 MOE 802 372513 717 732 GGCCCATGATGCCATG
3-10-3 MOE 803 372591 718 731 GCCCATGATGCCAT 2-10-2 MOE 804 372516
732 747 TACAGAAGGCACCCAG 3-10-3 MOE 805 372594 733 746
ACAGAAGGCACCCA 2-10-2 MOE 806 372518 812 827 GAAGTTGCCAGCCAAT
3-10-3 MOE 807 372596 813 826 AAGTTGCCAGCCAA 2-10-2 MOE 808 372560
863 876 CAGGGCAGATCCTT 2-10-2 MOE 809 372519 887 902
CAAGTAGTCTATGGTG 3-10-3 MOE 810 372597 888 901 AAGTAGTCTATGGT
2-10-2 MOE 811 372520 894 909 TGGAAAGCAAGTAGTC 3-10-3 MOE 812
372598 895 908 GGAAAGCAAGTAGT 2-10-2 MOE 813 372527 1013 1028
GGCCAGCTTTACAAAG 3-10-3 MOE 814 372605 1014 1027 GCCAGCTTTACAAA
2-10-2 MOE 815 372606 1020 1033 CGCAGGGCCAGCTT 2-10-2 MOE 816
372529 1052 1067 AAAGGAATAGGTGGGA 3-10-3 MOE 817 372607 1053 1066
AAGGAATAGGTGGG 2-10-2 MOE 818 372534 1144 1159 GCGAAACCAATATACT
3-10-3 MOE 819 372612 1145 1158 CGAAACCAATATAC 2-10-2 MOE 820
372535 1192 1207 CCCCAGGTGTCAGAGG 3-10-3 MOE 821 372613 1193 1206
CCCAGGTGTCAGAG 2-10-2 MOE 822 372545 1332 1347 GATTGTCAAAGAGCTT
3-10-3 MOE 823 372623 1333 1346 ATTGTCAAAGAGCT 2-10-2 MOE 824
372546 1342 1357 TTGGTCTTGTGATTGT 3-10-3 MOE 825 372624 1343 1356
TGGTCTTGTGATTG 2-10-2 MOE 826 372547 1352 1367 AAGGCCGAATTTGGTC
3-10-3 MOE 827 372625 1353 1366 AGGCCGAATTTGGT 2-10-2 MOE 828
382601 1617 1628 CCCGGAGTAGGC 1-10-1 MOE 683 382606 1971 1982
CTGCAGGCCACT 1-10-1 MOE 694 382612 1988 1999 CCACTCCCATTC 1-10-1
MOE 737
[0678] In certain embodiments, a target region is nucleotides
231-267 of SEQ ID NO: 10. In certain embodiments, a short antisense
compound is targeted to nucleotides 231-267 of SEQ ID NO: 10. In
certain such embodiments, a short antisense compound targeted to
nucleotides 231-267 comprises a nucleotide sequence selected from
SEQ ID NO 681, 682, 683, 684, 685, 686, or 687. In certain such
embodiments, a short antisense compound targeted to nucleotides
231-267 of SEQ ID NO: 10 is selected from Isis No 372556, 372557,
382601, 372480, 372481, 372558, or 372559.
[0679] In certain embodiments, a target region is nucleotides
249-267 of SEQ ID) NO: 10. In certain embodiments, a short
antisense compound is targeted to nucleotides 249-267 of SEQ ID NO:
10. In certain such embodiments, a short antisense compound
targeted to nucleotides 249-267 comprises a nucleotide sequence
selected from SEQ ID NO 683, 684, 685, 686, or 687. In certain such
embodiments, a short antisense compound targeted to nucleotides
249-267 of SEQ ID NO: 10 is selected from Isis No 382601, 372480,
372481, 372558, or 372559.
[0680] In certain embodiments, a target region is nucleotides
331-493 of SEQ ID NO: 10. In certain embodiments, a short antisense
compound is targeted to nucleotides 331-493 of SEQ ID NO: 10. In
certain such embodiments, a short antisense compound targeted to
nucleotides 331-493 comprises a nucleotide sequence selected from
SEQ ID NO 688, 689, 690, 691, 692, 693, or 694. In certain such
embodiments, a short antisense compound targeted to nucleotides
331-493 of SEQ ID NO: 10 is selected from Isis No 382603, 382604,
372485, 372563, 382605, 372565, or 382606.
[0681] In certain embodiments, a target region is nucleotides
331-427 of SEQ ID NO: 10. In certain embodiments, a short antisense
compound is targeted to nucleotides 331-427 of SEQ ID NO: 10. In
certain such embodiments, a short antisense compound targeted to
nucleotides 331-427 comprises a nucleotide sequence selected from
SEQ ID NO 688, 689, 690, 691, 692, or 693. In certain such
embodiments, a short antisense compound targeted to nucleotides
331-427 of SEQ ID NO: 10 is selected from Isis No 382603, 382604,
372485, 372563, 382605, or 372565.
[0682] In certain embodiments, a target region is nucleotides
392-408 of SEQ ID NO: 10. In certain embodiments, a short antisense
compound is targeted to nucleotides 392-408 of SEQ ID NO: 10. In
certain such embodiments, a short antisense compound targeted to
nucleotides 392-408 comprises a nucleotide sequence selected from
SEQ ID NO 690, 691, or 692. In certain such embodiments, a short
antisense compound targeted to nucleotides 392-408 of SEQ ID NO: 10
is selected from Isis No 372485, 372563, or 382605.
[0683] In certain embodiments, a target region is nucleotides
651-707 of SEQ ID NO: 10. In certain embodiments, a short antisense
compound is targeted to nucleotides 651-707 of SEQ ID NO: 10. In
certain such embodiments, a short antisense compound targeted to
nucleotides 651-707 comprises a nucleotide sequence selected from
SEQ ID NO 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705,
706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718,
719, 720, 721, 722, 723, 724, 725, 726, 727, or 728. In certain
such embodiments, a short antisense compound targeted to
nucleotides 651-707 of SEQ ID NO: 10 is selected from Isis No
372497, 372498, 372575, 372576, 382607, 372499, 372577, 372500,
372578, 372501, 372579, 372502, 372580, 372503, 372581, 372504,
372582, 372505, 372506, 372583, 372584, 372507, 372585, 382608,
372508, 372586, 372509, 372587, 372510, 372588, 372511, 372512,
372589, or 372590.
[0684] In certain embodiments, a target region is nucleotides
724-745 of SEQ ID NO: 10. In certain embodiments, a short antisense
compound is targeted to nucleotides 724-745 of SEQ ID NO: 10. In
certain such embodiments, a short antisense compound targeted to
nucleotides 724-745 comprises a nucleotide sequence selected from
SEQ ID NO 729, 730, 731, 732, or 733. In certain such embodiments,
a short antisense compound targeted to nucleotides 724-745 of SEQ
ID NO: 10 is selected from Isis No 382609, 372514, 372592, 372515,
or 372593.
[0685] In certain embodiments, a target region is nucleotides
651-745 of SEQ ID NO: 10. In certain embodiments, a short antisense
compound is targeted to nucleotides 651-745 of SEQ ID NO: 10. In
certain such embodiments, a short antisense compound targeted to
nucleotides 651-745 comprises a nucleotide sequence selected from
SEQ ID NO 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705,
706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718,
719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731,
732, or 733. In certain such embodiments, a short antisense
compound targeted to nucleotides 651-745 of SEQ ID NO: 10 is
selected from Isis No 372497, 372498, 372575, 372576, 382607,
372499, 372577, 372500, 372578, 372501, 372579, 372502, 372580,
372503, 372581, 372504, 372582, 372505, 372506, 372583, 372584,
372507, 372585, 382608, 372508, 372586, 372509, 372587, 372510,
372588, 372511, 372512, 372589, 372590, 382609, 372514, 372592,
372515, or 372593.
[0686] In certain embodiments, a target region is nucleotides
851-922 of SEQ ID NO: 10. In certain embodiments, a short antisense
compound is targeted to nucleotides 851-922 of SEQ ID NO: 10. In
certain such embodiments, a short antisense compound targeted to
nucleotides 851-922 comprises a nucleotide sequence selected from
SEQ ID NO 734, 735, 736, or 737. In certain such embodiments, a
short antisense compound targeted to nucleotides 851-922 of SEQ ID
NO: 10 is selected from Isis No 382610, 382611, 382602, or
382612.
[0687] In certain embodiments, a target region is nucleotides
851-879 of SEQ ID NO: 10. In certain embodiments, a short antisense
compound is targeted to nucleotides 851-879 of SEQ ID NO: 10. In
certain such embodiments, a short antisense compound targeted to
nucleotides 851-879 comprises a nucleotide sequence selected from
SEQ ID NO 734, 735, or 736. In certain such embodiments, a short
antisense compound targeted to nucleotides 851-879 of SEQ ID NO: 10
is selected from Isis No 382610, 382611, or 382602.
[0688] In certain embodiments, a target region is nucleotides
965-1007 of SEQ ID NO: 10. In certain embodiments, a short
antisense compound is targeted to nucleotides 965-1007 of SEQ ID
NO: 10. In certain such embodiments, a short antisense compound
targeted to nucleotides 965-1007 comprises a nucleotide sequence
selected from SEQ ID NO 738, 739, 740, 741, 742, 743, 744, or 745.
In certain such embodiments, a short antisense compound targeted to
nucleotides 965-1007 of SEQ ID NO: 10 is selected from Isis No
372524, 372602, 382613, 382614, 372525, 372603, 372526, or
372604.
[0689] In certain embodiments, a target region is nucleotides
965-979 of SEQ ID NO: 10. In certain embodiments, a short antisense
compound is targeted to nucleotides 965-979 of SEQ ID NO: 10. In
certain such embodiments, a short antisense compound targeted to
nucleotides 965-979 comprises a nucleotide sequence selected from
SEQ ID NO 738, 739, or 740. In certain such embodiments, a short
antisense compound targeted to nucleotides 965-979 of SEQ ID NO: 10
is selected from Isis No 372524, 372602, or 382613.
[0690] In certain embodiments, a target region is nucleotides
987-1007 of SEQ ID NO: 10. In certain embodiments, a short
antisense compound is targeted to nucleotides 987-1007 of SEQ ID
NO: 10. In certain such embodiments, a short antisense compound
targeted to nucleotides 987-1007 comprises a nucleotide sequence
selected from SEQ ID NO 741, 742, 743, 744, or 745. In certain such
embodiments, a short antisense compound targeted to nucleotides
987-1007 of SEQ ID NO: 10 is selected from Isis No 382614, 372525,
372603, 372526, or 372604.
[0691] In certain embodiments, a target region is nucleotides
1106-1132 of SEQ ID NO: 10. In certain embodiments, a short
antisense compound is targeted to nucleotides 1106-1132 of SEQ ID
NO: 10. In certain such embodiments, a short antisense compound
targeted to nucleotides 1106-1132 comprises a nucleotide sequence
selected from SEQ ID NO 746, 747, 748, 749, 750, 751, 752, 753, or
754. In certain such embodiments, a short antisense compound
targeted to nucleotides 1106-1132 of SEQ ID NO: 10 is selected from
Isis No 372530, 372608, 372531, 372609, 372532, 372610, 372533,
382615, or 372611.
[0692] In certain embodiments, a target region is nucleotides
1199-1233 of SEQ ID NO: 10. In certain embodiments, a short
antisense compound is targeted to nucleotides 1199-1233 of SEQ ID
NO: 10. In certain such embodiments, a short antisense compound
targeted to nucleotides 1199-1233 comprises a nucleotide sequence
selected from SEQ ID NO 755, 756, 757, 758, 759, 760, 761, 762, or
763. In certain such embodiments, a short antisense compound
targeted to nucleotides 1199-1233 of SEQ ID NO: 10 is selected from
Isis No 372536, 372614, 372537, 372615, 372538, 372616, 382616,
372539, or 372617.
[0693] In certain embodiments, a target region is nucleotides
1293-1394 of SEQ ID NO: 10. In certain embodiments, a short
antisense compound is targeted to nucleotides 1293-1394 of SEQ ID
NO: 10. In certain such embodiments, a short antisense compound
targeted to nucleotides 1293-1394 comprises a nucleotide sequence
selected from SEQ ID NO 764, 765, 766, 767, 768, 769, 770, 771,
772, 773, 774, 775, 776, or 777. In certain such embodiments, a
short antisense compound targeted to nucleotides 1293-1394 of SEQ
ID NO: 10 is selected from Isis No 372540, 372618, 382617, 372541,
372619, 372542, 372620, 372543, 372621, 372544, 372622, 382618,
382619, or 382620.
[0694] In certain embodiments, a target region is nucleotides
1293-1336 of SEQ ID NO: 10. In certain embodiments, a short
antisense compound is targeted to nucleotides 1293-1336 of SEQ ID
NO: 10. In certain such embodiments, a short antisense compound
targeted to nucleotides 1293-1336 comprises a nucleotide sequence
selected from SEQ ID NO 764, 765, 766, 767, 768, 769, 770, 771,
772, 773, 774, 775, or 776. In certain such embodiments, a short
antisense compound targeted to nucleotides 1293-1336 of SEQ ID NO:
10 is selected from Isis No 372540, 372618, 382617, 372541, 372619,
372542, 372620, 372543, 372621, 372544, 372622, 382618, or
382619.
[0695] In certain embodiments, a target region is nucleotides
1293-1324 of SEQ ID NO: 10. In certain embodiments, a short
antisense compound is targeted to nucleotides 1293-1324 of SEQ ID
NO: 10. In certain such embodiments, a short antisense compound
targeted to nucleotides 1293-1324 comprises a nucleotide sequence
selected from SEQ ID NO 764, 765, 766, 767, 768, 769, 770, 771,
772, 773, 774, or 775. In certain such embodiments, a short
antisense compound targeted to nucleotides 1293-1324 of SEQ ID NO:
10 is selected from Isis No 372540, 372618, 382617, 372541, 372619,
372542, 372620, 372543, 372621, 372544, 372622, or 382618.
[0696] In certain embodiments, short antisense compounds targeted
to a DGAT2 nucleic acid are 8 to 16, preferably 9 to 15, more
preferably 9 to 14, more preferably 10 to 14 nucleotides in length.
In certain embodiments, short antisense compounds targeted to a
DGAT2 nucleic acid are 9 to 14 nucleotides in length. In certain
embodiments, short antisense compounds targeted to a DGAT2 nucleic
acid are 10 to 14 nucleotides in length. In certain embodiments,
such short antisense compounds are short antisense
oligonucleotides.
[0697] In certain embodiments, short antisense compounds targeted
to a DGAT2 nucleic acid are short gapmers. In certain such
embodiments, short gapmers targeted to a DGAT2 nucleic acid
comprise at least one high affinity modification in one or more
wings of the compound. In certain embodiments, short antisense
compounds targeted to a DGAT2 nucleic acid comprise 1 to 3
high-affinity modifications in each wing. In certain such
embodiments, the nucleosides or nucleotides of the wing comprise a
2' modification. In certain such embodiments, the monomers of the
wing are BNA's. In certain such embodiments, the monomers of the
wing are selected from .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2')
BNA, .beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA, Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') BNA, Aminooxy (4'-CH.sub.2--O--N(R)-2')
BNA and Oxyamino (4'-CH.sub.2--N(R)--O-2') BNA. In certain
embodiments, the monomers of a wing comprise a substituent at the
2' position selected from allyl, amino, azido, thio, O-allyl,
O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), and
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. In certain embodiments, the monomers of a
wing are 2'MOE nucleotides.
[0698] In certain embodiments, short antisense compounds targeted
to a DGAT2 nucleic acid comprise a gap between the 5' wing and the
3' wing. In certain embodiments the gap comprises five, six, seven,
eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
In certain embodiments, the monomers of the gap are unmodified
deoxyribonucleotides. In certain embodiments, the monomers of the
gap are unmodified ribonucleotides. In certain embodiments, gap
modifications (if any) gap result in a short antisense compound
that, when bound to its target nucleic acid, supports cleavage by
an RNase, including, but not limited to, RNase H.
[0699] In certain embodiments, short antisense compounds targeted
to a DGAT2 nucleic acid have uniform monomeric linkages. In certain
such embodiments, those linkages are all phosphorothioate linkages.
In certain embodiments, the linkages are all phosphodiester
linkages. In certain embodiments, short antisense compounds
targeted to a DGAT2 nucleic acid have mixed backbones.
[0700] In certain embodiments, short antisense compounds targeted
to a DGAT2 nucleic acid are 8 monomers in length. In certain
embodiments, short antisense compounds targeted to a DGAT2 nucleic
acid are 9 monomers in length. In certain embodiments, short
antisense compounds targeted to a DGAT2 nucleic acid are 10
monomers in length. In certain embodiments, short antisense
compounds targeted to a DGAT2 nucleic acid are 11 monomers in
length. In certain embodiments, short antisense compounds targeted
to a DGAT2 nucleic acid are monomers in length. In certain
embodiments, short antisense compounds targeted to a DGAT2 nucleic
acid are 13 monomers in length. In certain embodiments, short
antisense compounds targeted to a DGAT2 nucleic acid are 14
monomers in length. In certain embodiments, short antisense
compounds targeted to a DGAT2 nucleic acid are 15 monomers in
length. In certain embodiments, short antisense compounds targeted
to a DGAT2 nucleic acid are 16 monomers in length. In certain
embodiments, short antisense compounds targeted to a DGAT2 nucleic
acid comprise 9 to 15 monomers. In certain embodiments, short
antisense compounds targeted to a DGAT2 nucleic acid comprise 10 to
15 monomers. In certain embodiments, short antisense compounds
targeted to a DGAT2 nucleic acid comprise 12 to 14 monomers. In
certain embodiments, short antisense compounds targeted to a DGAT2
nucleic acid comprise 12 to 14 nucleotides or nucleosides.
[0701] In certain embodiments, the invention provides methods of
modulating expression of DGAT2. In certain embodiments, such
methods comprise use of one or more short antisense compound
targeted to a DGAT2 nucleic acid, wherein the short antisense
compound targeted to a DGAT2 nucleic acid is from about 8 to about
16, preferably 9 to 15, more preferably 9 to 14, more preferably 10
to 14 monomers (i.e. from about 8 to about 16 linked monomers). One
of ordinary skill in the art will appreciate that this comprehends
methods of modulating expression of DGAT2 using one or more short
antisense compounds targeted to a DGAT2 nucleic acid of 8, 9, 10,
11, 12, 13, 14, 15 or 16 monomers.
[0702] In certain embodiments, methods of modulating DGAT2 comprise
use of a short antisense compound targeted to a DGAT2 nucleic acid
that is 8 monomers in length. In certain embodiments, methods of
modulating DGAT2 comprise use of a short antisense compound
targeted to a DGAT2 nucleic acid that is 9 monomers in length. In
certain embodiments, methods of modulating DGAT2 comprise use of a
short antisense compound targeted to a DGAT2 nucleic acid that is
10 monomers in length. In certain embodiments, methods of
modulating DGAT2 comprise use of a short antisense compound
targeted to a DGAT2 nucleic acid that is 11 monomers in length. In
certain embodiments, methods of modulating DGAT2 comprise use of a
short antisense compound targeted to a DGAT2 nucleic acid that is
12 monomers in length. In certain embodiments, methods of
modulating DGAT2 comprise use of a short antisense compound
targeted to a DGAT2 nucleic acid that is 13 monomers in length. In
certain embodiments, methods of modulating DGAT2 comprise use of a
short antisense compound targeted to a DGAT2 nucleic acid that is
14 monomers in length. In certain embodiments, methods of
modulating DGAT2 comprise use of a short antisense compound
targeted to a DGAT2 nucleic acid that is 15 monomers in length. In
certain embodiments, methods of modulating DGAT2 comprise use of a
short antisense compound targeted to a DGAT2 nucleic acid that is
16 monomers in length.
[0703] In certain embodiments, methods of modulating expression of
DGAT2 comprise use of a short antisense compound targeted to a
DGAT2 nucleic acid comprising 9 to 15 monomers. In certain
embodiments, methods of modulating expression of DGAT2 comprise use
of a short antisense compound targeted to a DGAT2 nucleic acid
comprising 10 to 15 monomers. In certain embodiments, methods of
modulating expression of DGAT2 comprise use of a short antisense
compound targeted to a DGAT2 nucleic acid comprising 12 to 14
monomers. In certain embodiments, methods of modulating expression
of DGAT2 comprise use of a short antisense compound targeted to a
DGAT2 nucleic acid comprising 12 or 14 nucleotides or
nucleosides.
[0704] 9. PTP1B
[0705] PTP1B (also known as protein phosphatase 1B and PTPN1) is an
endoplasmic reticulum (ER)-associated enzyme originally isolated as
the major protein tyrosine phosphatase of the human placenta (Tonks
et al., J. Biol. Chem., 1988, 263, 6731-6737; Tonks et al., J.
Biol. Chem., 1988, 263, 6722-6730).
[0706] An essential regulatory role in signaling mediated by the
insulin receptor has been established for PTP1B. In certain
instances, PTP1B interacts with and dephosphorylates the activated
insulin receptor both in vitro and in intact cells resulting in the
downregulation of the signaling pathway (Goldstein et al., Mol.
Cell. Biochem., 1998, 182, 91-99; Seely et al., Diabetes, 1996, 45,
1379-1385). In addition, PTP1B modulates the mitogenic actions of
insulin (Goldstein et al., Mol. Cell. Biochem., 1998, 182, 91-99).
In rat adipose cells overexpressing PTP1B, the translocation of the
GLUT4 glucose transporter was inhibited, implicating PTP1B as a
negative regulator of glucose transport as well (Chen et al., J.
Biol. Chem., 1997, 272, 8026-8031).
[0707] Mouse knockout models lacking the PTP1B gene also point
toward the negative regulation of insulin signaling by PTP1B. Mice
harboring a disrupted PTP1B gene showed increased insulin
sensitivity and increased phosphorylation of the insulin receptor.
When placed on a high-fat diet, PTP1B -/- mice were resistant to
weight gain and remained insulin sensitive (Elchebly et al.,
Science, 1999, 283, 1544-1548). These studies clearly establish
PTP1B as a therapeutic target in the treatment of diabetes and
obesity.
[0708] Diabetes and obesity (sometimes now collectively referred to
as "diabesity") are interrelated. Most human obesity is associated
with insulin resistance and leptin resistance. In fact obesity may
have an even greater impact on insulin action than does diabetes
itself (Sindelka et al., Physiol Res., 2002, 51, 85-91). Syndrome X
or metabolic syndrome is a new term for a cluster of conditions,
that, when occurring together, may indicate a predisposition to
diabetes and cardiovascular disease. These symptoms, including high
blood pressure, high triglycerides, decreased HDL and obesity, tend
to appear together in some individuals. Because of its role in both
diabetes and obesity, PTP1B is believed to be a therapeutic target
for a range of metabolic conditions, including diabetes, obesity
and metabolic syndrome. By improving blood glucose control,
inhibitors of PTP1B may also be useful in slowing, preventing,
delaying or ameliorating the sequelae of diabetes, which include
retinopathy, neuropathy, cardiovascular complications and
nephropathy.
[0709] PTP1B, which is differentially regulated during the cell
cycle (Schievella et al., Cell. Growth Differ., 1993, 4, 239-246),
is expressed in insulin sensitive tissues as two different isoforms
that arise from alternate splicing of the pre-mRNA (Shifrin and
Neel, J. Biol. Chem., 1993, 268, 25376-25384). The ratio of the
alternatively spliced products is affected by growth factors, such
as insulin, and differs in various tissues examined (Sell and
Reese, Mol. Genet. Metab., 1999, 66, 189-192). In these studies the
levels of the variants correlated with the plasma insulin
concentration and percentage body fat. These variants may therefore
be used as a biomarker for patients with chronic hyperinsulinemia
or type 2 diabetes.
Definitions
[0710] "Protein tyrosine phosphatase 1B" is the gene product or
protein of which expression is to be modulated by administration of
a short antisense compound. Protein tyrosine phosphatase 1B is
generally referred to as PTP1B but may also be referred to as
protein tyrosine phosphatase; PTPN1; RKPTP; protein tyrosine
phosphatase, non-receptor type 1.
[0711] "PTP1B nucleic acid" means any nucleic acid encoding PTP1B.
For example, in certain embodiments, a PTP1B nucleic acid includes,
without limitation, a DNA sequence encoding PTP1B, an RNA sequence
transcribed from DNA encoding PTP1B, and an mRNA sequence encoding
PTP1B. "PTP1B mRNA" means an mRNA encoding a PTP1B protein.
Therapeutic Indications
[0712] Antisense technology is an effective means for reducing
PTP1B expression and has proven to be uniquely useful in a number
of therapeutic, diagnostic, and research applications. As such, in
certain embodiments, the present invention provides compounds
targeted to a nucleic acid encoding PTP1B, which modulate the
expression of PTP1B. Further provided herein are short antisense
compounds capable of effectively inhibiting PTP1B expression.
[0713] In certain therapeutics, a subject, suspected of having a
disease or disorder which can be treated by modulating the
expression of PTP1B is treated by administering one or more short
antisense compounds targeted to a nucleic acid encoding PTP1B. For
example, in one non-limiting embodiment, the methods comprise the
step of administering to an animal a therapeutically effective
amount of a short antisense compound. The short antisense compounds
of the present invention effectively inhibit the activity of PTP1B
or inhibit the expression of PTP1B. In one embodiment, the activity
or expression of PTP1B in a subject is inhibited by at least 10%,
by at least 20%, by at least 25%, by at least 30%, by at least 40%,
by at least 50%, by at least 60%, by at least 70%, by at least 75%,
by at least 80%, by at least 85%, by at least 90%, by at least 95%,
by at least 98%, by at least 99%, or by 100%. In certain
embodiments, activity or expression of PTP1B in a subject is
inhibited by about 30%. In certain embodiments, the activity or
expression of PTP1B in a subject is inhibited by 50% or more.
[0714] The reduction of the expression of PTP1B may be measured,
for example, in blood, plasma, serum, adipose tissue, liver or any
other body fluid, tissue or organ of the animal. Preferably, the
cells contained within said fluids, tissues or organs being
analyzed contain a nucleic acid molecule encoding PTP1B and/or the
PTP1B protein itself.
[0715] Certain pharmaceutical and other compositions comprising the
compounds of the invention are also provided. In certain
embodiments short antisense compounds targeted to a PTP1B nucleic
acid are utilized in pharmaceutical compositions by adding an
effective amount of a compound to a suitable pharmaceutically
acceptable diluent or carrier.
[0716] The short antisense compounds targeting PTP1B may have any
one or more properties or characteristics of the short antisense
compounds generally described herein. In certain embodiments, short
antisense compounds targeting a PTP1B nucleic acid have a motif
(wing-deoxy gap-wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1,
3-10-3, 2-10-3, 2-10-2, 1-10-1, 1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3
or 1-6-1, more preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.
[0717] In certain embodiments provided herein are methods of
treating an individual by administering one or more short antisense
compound targeted to a PTP1B nucleic acid or a pharmaceutical
composition comprising such compound. Further provided are methods
of treating a subject having a disease or conditions associated
with PTP1B activity by administering a short antisense compound
targeted to a PTP1B nucleic acid. Diseases and conditions
associated with PTP1B include but are not limited to high blood
glucose or hyperglycemia, prediabetes, diabetes, Type 2 diabetes,
metabolic syndrome, obesity and insulin resistance. Therefore,
provided herein are methods of treating to high blood glucose or
hyperglycemia, prediabetes, diabetes, Type 2 diabetes, metabolic
syndrome, obesity and insulin resistance by administering a short
antisense compound targeted to a PTP1B nucleic acid.
[0718] In certain embodiments the present invention provides
compositions and methods for decreasing blood glucose levels in a
subject or for preventing or delaying the onset of a rise in blood
glucose levels in a subject, by administering to the subject a
short antisense inhibitor of PTP1B expression.
[0719] In certain embodiments, the present invention provides
compositions and methods for improving insulin sensitivity in a
subject or for preventing or delaying the onset of insulin
resistance in a subject, by administering to the subject a short
antisense inhibitor of PTP1B expression.
[0720] In certain embodiments, the present invention provides
compositions and methods for treating a metabolic condition in a
subject or for preventing or delaying the onset of a metabolic
condition in a subject, by administering to the subject a short
antisense compound targeted to a PTP1B nucleic acid. Such metabolic
condition may be any metabolic condition associated with PTP1B
expression, including but not limited to diabetes and obesity. Also
provided are methods of reducing adiposity. Also provided is a
method of treating obesity wherein metabolic rate is increased.
[0721] In certain embodiments, the subject has Type 2 diabetes. In
certain embodiments the subject exhibits elevated HbA1c levels In
certain embodiments, HbA1c levels are at least about 6%, at least
about 7%, at least about 8%, at least about 9%, at least about 10%
or at least about 11%. In preferred embodiments, HbA.sub.1c levels
are reduced to about 7% or below about 7%. In certain embodiments,
the subject exhibits an elevated body mass index In certain
embodiments, the elevated body mass index is greater than 25 kg/m2.
In certain embodiments, the subject exhibits hyperglycemia or
elevated blood glucose levels. In a particular embodiment, the
blood glucose levels are fasting blood glucose levels. In certain
embodiments, the elevated fasting blood glucose levels are at least
130 mg/dL. In certain embodiments, the subject exhibits
hyperglycemia prior to the start of treatment or exhibits fasting
blood glucose levels above about 130 mg/dL, baseline HbA1c levels
of at least about 7%, or body mass index of greater than 25
kg/m.sup.2 or any combination thereof.
[0722] In certain embodiments a method of reducing one or more such
levels by administering a short antisense compound targeted to a
PTP1B nucleic acid is provided. For example, provided is a method
of reducing fasting glucose levels, HbA.sub.1c levels or, body mass
index levels or any combination thereof in a subject by
administering to a subject a short antisense compound targeting
PTP1B. Fasting glucose may be fasting blood glucose, fasting serum
glucose, or fasting plasma glucose. In some embodiments, fasting
plasma glucose levels are reduced by at least about 25 mg/dL or by
at least about 10 mg/dL. In a certain embodiments, said subject
does not achieve normal glucose levels on a therapeutic regimen of
a glucose-lowering agent such as insulin, sulfonylurea, or
metformin.
[0723] In certain embodiments the invention provides methods of
altering lipid levels. Certain such methods reduce cholesterol, LDL
and/or VLDL levels or any combination thereof in a subject by
administering to the subject a short antisense compound targeted to
a PTP1B nucleic acid. In certain embodiments HDL levels in a
subject are increased by administering to the subject a short
antisense compound targeted to a PTP1B nucleic acid. In certain
embodiments, LDL:HDL ratio and/or total cholesterol:HDL ratio in a
subject is reduced by administering to the subject a short
antisense compound targeted to a PTP1B nucleic acid. In certain
embodiments HDL:LDL ratio and/or HDL:total cholesterol ratio in a
subject's increased by administering to the subject a short
antisense compound targeted to a PTP1B nucleic acid. In certain
embodiments lipid profile in a subject is improved by increasing
HDL, lowering LDL, lowering VLDL, lowering triglycerides, lowering
apolipoprotein B levels, or lowering total cholesterol levels, or a
combination thereof, by administering to the subject a short
antisense compound targeted to a PTP1B nucleic acid. In such
embodiments, the subject is an animal, including a human.
Combination Therapy
[0724] In certain embodiments, one or more pharmaceutical
compositions comprising a short antisense compound targeted to a
PTP1B nucleic acid are co-administered with one or more other
pharmaceutical agents. In certain embodiments, such one or more
other pharmaceutical agents are designed to treat the same disease
or condition as the one or more pharmaceutical compositions of the
present invention. In certain embodiments, such one or more other
pharmaceutical agents are designed to treat a different disease or
condition as the one or more pharmaceutical compositions of the
present invention. In certain embodiments, such one or more other
pharmaceutical agents are designed to treat an undesired effect of
one or more pharmaceutical compositions of the present invention.
In certain embodiments, one or more pharmaceutical compositions of
the present invention are co-administered with another
pharmaceutical agent to treat an undesired effect of that other
pharmaceutical agent. In certain embodiments, one or more
pharmaceutical compositions of the present invention and one or
more other pharmaceutical agents are administered at the same time.
In certain embodiments, one or more pharmaceutical compositions of
the present invention and one or more other pharmaceutical agents
are administered at different times. In certain embodiments, one or
more pharmaceutical compositions of the present invention and one
or more other pharmaceutical agents are prepared together in a
single formulation. In certain embodiments, one or more
pharmaceutical compositions of the present invention and one or
more other pharmaceutical agents are prepared separately.
[0725] In certain embodiments, pharmaceutical agents that may be
co-administered with a pharmaceutical composition comprising a
short antisense compound targeted to a PTP1B nucleic acid include
glucose-lowering agents and therapies. In some embodiments, the
glucose-lowering agent is a PPAR agonist (gamma, dual, or pan), a
dipeptidyl peptidase (IV) inhibitor, a GLP-1 analog, insulin or an
insulin analog, an insulin secretagogue, a SGLT2 inhibitor, a human
amylin analog, a biguanide, an alpha-glucosidase inhibitor, a
meglitinide, a thiazolidinedione, or a sulfonylurea.
[0726] In some embodiments, the glucose-lowering therapeutic is a
GLP-1 analog. In some embodiments, the GLP-1 analog is exendin-4 or
liraglutide.
[0727] In other embodiments, the glucose-lowering therapeutic is a
sulfonylurea. In some embodiments, the sulfonylurea is
acetohexamide, chlorpropamide, tolbutamide, tolazamide,
glimepiride, a glipizide, a glyburide, or a gliclazide.
[0728] In some embodiments, the glucose lowering drug is a
biguanide. In some embodiments, the biguanide is metformin, and in
some embodiments, blood glucose levels are decreased without
increased lactic acidosis as compared to the lactic acidosis
observed after treatment with metformin alone.
[0729] In some embodiments, the glucose lowering drug is a
meglitinide. In some embodiments, the meglitinide is nateglinide or
repaglinide.
[0730] In some embodiments, the glucose-lowering drug is a
thiazolidinedione. In some embodiments, the thiazolidinedione is
pioglitazone, rosiglitazone, or troglitazone. In some embodiments,
blood glucose levels are decreased without greater weight gain than
observed with rosiglitazone treatment alone.
[0731] In some embodiments, the glucose-lowering drug is an
alpha-glucosidase inhibitor. In some embodiments, the
alpha-glucosidase inhibitor is acarbose or miglitol.
[0732] In a certain embodiment, a co-administered glucose-lowering
agent is ISIS 113715.
[0733] In a certain embodiment, glucose-lowering therapy is
therapeutic lifestyle change.
[0734] In certain such embodiments, the glucose-lowering agent is
administered prior to administration of a pharmaceutical
composition of the present invention. In certain such embodiments,
the glucose-lowering agent is administered following administration
of a pharmaceutical composition of the present invention. In
certain such embodiments the glucose-lowering agent is administered
at the same time as a pharmaceutical composition of the present
invention. In certain such embodiments the dose of a
co-administered glucose-lowering agent is the same as the dose that
would be administered if the glucose-lowering agent was
administered alone. In certain such embodiments the dose of a
co-administered glucose-lowering agent is lower than the dose that
would be administered if the glucose-lowering agent was
administered alone. In certain such embodiments the dose of a
co-administered glucose-lowering agent is greater than the dose
that would be administered if the glucose-lowering agent was
administered alone.
[0735] In certain embodiments, pharmaceutical agents that may be
co-administered with a pharmaceutical composition comprising a
short antisense compound targeted to a PTP1B nucleic acid include
lipid-lowering agents. Such lipid lowering agents are discussed
elsewhere in the application and are included here with respect to
PTP1B. Such lipid lowering agents may be administered as described
above for glucose lowering agents.
[0736] In certain embodiments, pharmaceutical agents that may be
co-administered with a pharmaceutical composition comprising a
short antisense compound targeted to a PTP1B nucleic acid include
anti-obesity agents therapeutics. Such anti-obesity agents
therapeutics may be administered as described above for glucose
lowering agents.
[0737] Further provided is a method of administering a short
antisense compound targeted to a PTP1B nucleic acid via injection
and further including administering a topical steroid at the
injection site.
Medicaments
[0738] Also provided herein are uses of a short antisense compound
which is targeted to a PTP1B nucleic acid for the preparation of a
medicament for reducing blood glucose levels including fasting
glucose levels, and HbA.sub.1c levels, body mass index levels or
any combination thereof. The medicament can be administered during
a loading period and a maintenance period. In some embodiments, the
medicament is administered subcutaneously or intravenously. In
other embodiments, the administration of said medicament occurs at
least once daily, at least once weekly, or at least once monthly.
In a particular embodiment the short antisense compound present in
the medicament is administered in a dose lower than a short
antisense compound with a longer sequence and particularly a
sequence 20 or more nucleobases. The medicament may be administered
to a subject that exhibits high blood glucose or hyperglycemia,
prediabetes, diabetes, Type 2 diabetes, metabolic syndrome, obesity
and insulin resistance.
[0739] Other aspects and advantages of short antisense compounds
are provided herein. All aspect and advantages disclosed herein and
specifically with regard to other targets is applicable with regard
to compositions including short antisense compounds targeted to a
PTP1B nucleic acid and methods of their use.
Certain Short Antisense Compounds Targeted to a PTP1B Nucleic
Acid
[0740] In certain embodiments, short antisense compounds are
targeted to a PTP1B nucleic acid having the sequence of
GENBANK.RTM. Accession No. NM.sub.--002827.2, incorporated herein
as SEQ ID NO: 11 or the nucleotides 14178000 to 1425600 of the
sequence of GENBANK.RTM. Accession No. NT.sub.--011362.9,
incorporated herein as SEQ ID NO: 12. In certain such embodiments,
a short antisense compound targeted to SEQ ID NO: 11 is at least
90% complementary to SEQ ID NO: 11. In certain such embodiments, a
short antisense compound targeted to SEQ ID NO: 11 is at least 95%
complementary to SEQ ID NO: 11. In certain such embodiments, a
short antisense compound targeted to SEQ ID NO: 12 is 100%
complementary to SEQ ID NO: 12. In certain such embodiments, a
short antisense compound targeted to SEQ ID NO: 12 is at least 90%
complementary to SEQ ID NO: 12. In certain such embodiments, a
short antisense compound targeted to SEQ ID NO: 12 is at least 95%
complementary to SEQ ID NO: 12. In certain such embodiments, a
short antisense compound targeted to SEQ ID NO: 12 is 100%
complementary to SEQ ID NO: 12.
[0741] In certain embodiments, a short antisense compound targeted
to SEQ ID NO: 11 comprises a nucleotide sequence selected from the
nucleotide sequences set forth in Tables 16 and 17. In certain
embodiments, a short antisense compound targeted to SEQ ID NO: 12
comprises a nucleotide sequence selected from the nucleotide
sequences set forth in Tables 18 and 19.
[0742] Each nucleotide sequence set forth in each Tables 16, 17,
18, and 19 is independent of any modification to a sugar moiety, an
internucleoside linkage, or a nucleobase. As such, short antisense
compounds comprising a nucleotide sequence as set forth in Tables
16, 17, 18, and 19 may comprise, independently, one or more
modifications to a sugar moiety, an internucleoside linkage, or a
nucleobase. Antisense compounds described by Isis Number (Isis NO.)
indicate a combination of nucleobase sequence and one or more
modifications to a sugar moiety, an internucleoside linkage, or a
nucleobase.
[0743] Tables 16 and 17 illustrate examples of short antisense
compounds targeted to SEQ ID NO: 11. Table 16 illustrates short
antisense compounds that are 100% complementary to SEQ ID NO: 11.
Table 17 illustrates short antisense compounds that have one or two
mismatches with respect to SEQ ID NO: 11. Table 18 illustrates
short antisense compounds that are 100% complementary to SEQ ID NO:
12. Table 19 illustrates short antisense compounds that have 1 or 2
mismatches with respect to SEQ ID NO: 12. The column labeled
`gapmer motif` indicates the wing-gap-wing motif of each short
antisense compounds. The gap segment comprises 2'-deoxynucleotides
and each nucleotide of each wing segment comprises a 2'-modified
sugar. The particular 2'-modified sugar is also indicated in the
`gapmer motif` column. For example, `2-10-2 MOE` means a 2-10-2
gapmer motif, where a gap segment of ten 2'-deoxynucleotides is
flanked by wing segments of two nucleotides, where the nucleotides
of the wing segments are 2'-MOE nucleotides. Internucleoside
linkages are phosphorothioate. The short antisense compounds
comprise 5-methylcytidine in place of unmodified cytosine, unless
"unmodified cytosine" is listed in the gapmer motif column, in
which case the indicated cytosines are unmodified cytosines. For
example, "5-mC in gap only" indicates that the gap segment has
5-methylcytosines, while the wing segments have unmodified
cytosines.
TABLE-US-00019 TABLE 16 Short Antisense Compounds targeted to SEQ
ID NO: 11 5' 3' SEQ ISIS Target Target Gapmer ID NO. Site Site
Sequence (5'-3') Motif NO 147022 177 188 TTGTCGATCTCC 1-10-1 MOE
886 147023 178 189 CTTGTCGATCTC 1-10-1 MOE 859 147024 179 190
CCTTGTCGATCT 1-10-1 MOE 853 147019 195 206 TCGATCTCCTCG 1-10-1 MOE
877 147020 196 207 GTCGATCTCCTC 1-10-1 MOE 868 147021 197 208
TGTCGATCTCCT 1-10-1 MOE 882 147022 198 209 TTGTCGATCTCC 1-10-1 MOE
886 147023 199 210 CTTGTCGATCTC 1-10-1 MOE 859 147024 200 211
CCTTGTCGATCT 1-10-1 MOE 853 147025 201 212 GCCTTGTCGATC 1-10-1 MOE
865 147026 202 213 AGCCTTGTCGAT 1-10-1 MOE 835 147027 203 214
CAGCCTTGTCGA 1-10-1 MOE 843 147028 204 215 CCAGCCTTGTCG 1-10-1 MOE
846 147073 204 215 CACTGATCCTGC 1-10-1 MOE 842 147029 205 216
CCCAGCCTTGTC 1-10-1 MOE 848 147030 206 217 TCCCAGCCTTGT 1-10-1 MOE
874 147036 212 223 CCCAGTTCCCAG 1-10-1 MOE 849 147037 213 224
GCCCAGTTCCCA 1-10-1 MOE 863 147038 214 225 CGCCCAGTTCCC 1-10-1 MOE
855 147039 215 226 CCGCCCAGTTCC 1-10-1 MOE 850 147040 216 227
GCCGCCCAGTTC 1-10-1 MOE 864 147041 217 228 AGCCGCCCAGTT 1-10-1 MOE
834 147073 311 322 CACTGATCCTGC 1-10-1 MOE 842 147042 323 334
GGTCAAAAGGGC 1-10-1 MOE 866 147043 324 335 TGGTCAAAAGGG 1-10-1 MOE
881 147044 325 336 GTGGTCAAAAGG 1-10-1 MOE 869 147045 326 337
TGTGGTCAAAAG 1-10-1 MOE 883 147046 327 338 CTGTGGTCAAAA 1-10-1 MOE
858 147047 328 339 ACTGTGGTCAAA 1-10-1 MOE 833 147051 332 343
TCCGACTGTGGT 1-10-1 MOE 875 147052 333 344 ATCCGACTGTGG 1-10-1 MOE
837 147053 334 345 AATCCGACTGTG 1-10-1 MOE 829 147054 335 346
TAATCCGACTGT 1-10-1 MOE 871 147055 336 347 TTAATCCGACTG 1-10-1 MOE
884 147056 337 348 TTTAATCCGACT 1-10-1 MOE 887 147057 338 349
ATTTAATCCGAC 1-10-1 MOE 839 147058 339 350 AATTTAATCCGA 1-10-1 MOE
830 147059 340 351 CAATTTAATCCG 1-10-1 MOE 840 147060 341 352
GCAATTTAATCC 1-10-1 MOE 861 147061 342 353 TGCAATTTAATC 1-10-1 MOE
879 147045 679 690 TGTGGTCAAAAG 1-10-1 MOE 883 147046 680 691
CTGTGGTCAAAA 1-10-1 MOE 858 147045 787 798 TGTGGTCAAAAG 1-10-1 MOE
883 147046 788 799 CTGTGGTCAAAA 1-10-1 MOE 858 147066 816 827
CCTGCACTGACG 1-10-1 MOE 851 104131 992 1005 ACCTTCGATCACAG 2-10-2
MOE 831 147062 1024 1035 CACTGACGAGTC 1-10-1 MOE 841 147063 1025
1036 GCACTGACGAGT 1-10-1 MOE 862 147064 1026 1037 TGCACTGACGAG
1-10-1 MOE 880 147065 1027 1038 CTGCACTGACGA 1-10-1 MOE 857 147066
1028 1039 CCTGCACTGACG 1-10-1 MOE 851 147067 1029 1040 TCCTGCACTGAC
1-10-1 MOE 876 147068 1030 1041 ATCCTGCACTGA 1-10-1 MOE 838 147069
1031 1042 GATCCTGCACTG 1-10-1 MOE 860 147070 1032 1043 TGATCCTGCACT
1-10-1 MOE 878 147071 1033 1044 CTGATCCTGCAC 1-10-1 MOE 856 147072
1034 1045 ACTGATCCTGCA 1-10-1 MOE 832 147073 1035 1046 CACTGATCCTGC
1-10-1 MOE 842 147067 1199 1210 TCCTGCACTGAC 1-10-1 MOE 876 147040
1288 1299 GCCGCCCAGTTC 1-10-1 MOE 864 147040 1396 1407 GCCGCCCAGTTC
1-10-1 MOE 864 147022 1868 1879 TTGTCGATCTCC 1-10-1 MOE 886 147023
1869 1880 CTTGTCGATCTC 1-10-1 MOE 859 147024 1870 1881 CCTTGTCGATCT
1-10-1 MOE 853 147019 1886 1897 TCGATCTCCTCG 1-10-1 MOE 877 147020
1887 1898 GTCGATCTCCTC 1-10-1 MOE 868 147021 1888 1899 TGTCGATCTCCT
1-10-1 MOE 882 147022 1889 1900 TTGTCGATCTCC 1-10-1 MOE 886 147023
1890 1901 CTTGTCGATCTC 1-10-1 MOE 859 147025 1892 1903 GCCTTGTCGATC
1-10-1 MOE 865 147027 1894 1905 CAGCCTTGTCGA 1-10-1 MOE 843 147028
1895 1906 CCAGCCTTGTCG 1-10-1 MOE 846 147030 1897 1908 TCCCAGCCTTGT
1-10-1 MOE 874 147037 1904 1915 GCCCAGTTCCCA 1-10-1 MOE 863 147038
1905 1916 CGCCCAGTTCCC 1-10-1 MOE 855 147040 1907 1918 GCCGCCCAGTTC
1-10-1 MOE 864 147041 1908 1919 AGCCGCCCAGTT 1-10-1 MOE 834 147022
1976 1987 TTGTCGATCTCC 1-10-1 MOE 886 147023 1977 1988 CTTGTCGATCTC
1-10-1 MOE 859 147024 1978 1989 CCTTGTCGATCT 1-10-1 MOE 853 147020
1995 2006 GTCGATCTCCTC 1-10-1 MOE 868 147021 1996 2007 TGTCGATCTCCT
1-10-1 MOE 882 147022 1997 2008 TTGTCGATCTCC 1-10-1 MOE 886 147023
1998 2009 CTTGTCGATCTC 1-10-1 MOE 859 147024 1999 2010 CCTTGTCGATCT
1-10-1 MOE 853 147025 2000 2011 GCCTTGTCGATC 1-10-1 MOE 865 147026
2001 2012 AGCCTTGTCGAT 1-10-1 MOE 835 147027 2002 2013 CAGCCTTGTCGA
1-10-1 MOE 843 147028 2003 2014 CCAGCCTTGTCG 1-10-1 MOE 846 147029
2004 2015 CCCAGCCTTGTC 1-10-1 MOE 848 147030 2005 2016 TCCCAGCCTTGT
1-10-1 MOE 874 147036 2011 2022 CCCAGTTCCCAG 1-10-1 MOE 849 147037
2012 2023 GCCCAGTTCCCA 1-10-1 MOE 863 147038 2013 2024 CGCCCAGTTCCC
1-10-1 MOE 855 147039 2014 2025 CCGCCCAGTTCC 1-10-1 MOE 850 147040
2015 2026 GCCGCCCAGTTC 1-10-1 MOE 864 147041 2016 2027 AGCCGCCCAGTT
1-10-1 MOE 834 104199 2366 2379 GGTCATGCACAGGC 2-10-2 MOE 867
104134 2369 2382 TCAGGTCATGCACA 2-10-2 MOE 873 104132 2548 2561
CCTTGGAATGTCTG 2-10-2 MOE 852 147020 2613 2624 GTCGATCTCCTC 1-10-1
MOE 868 147020 2721 2732 GTCGATCTCCTC 1-10-1 MOE 868 104133 3289
3302 TATTCCATGGCCAT 2-10-2 MOE 872 147032 6220 6231 GTTCCCAGCCTT
1-10-1 MOE 870 147033 6221 6232 AGTTCCCAGCCT 1-10-1 MOE 836 147034
6222 6233 CAGTTCCCAGCC 1-10-1 MOE 844 147044 6288 6299 GTGGTCAAAAGG
1-10-1 MOE 869 147045 6289 6300 TGTGGTCAAAAG 1-10-1 MOE 883 147032
6329 6340 GTTCCCAGCCTT 1-10-1 MOE 870 147033 6330 6341 AGTTCCCAGCCT
1-10-1 MOE 836 147034 6331 6342 CAGTTCCCAGCC 1-10-1 MOE 844 147044
6397 6408 GTGGTCAAAAGG 1-10-1 MOE 869 147045 6398 6409 TGTGGTCAAAAG
1-10-1 MOE 883 147058 7057 7068 AATTTAATCCGA 1-10-1 MOE 830 147059
7058 7069 CAATTTAATCCG 1-10-1 MOE 840 147060 7059 7070 GCAATTTAATCC
1-10-1 MOE 861 147058 7166 7177 AATTTAATCCGA 1-10-1 MOE 830 147059
7167 7178 CAATTTAATCCG 1-10-1 MOE 840 147041 8084 8095 AGCCGCCCAGTT
1-10-1 MOE 834 147041 8192 8203 AGCCGCCCAGTT 1-10-1 MOE 834 147027
8630 8641 CAGCCTTGTCGA 1-10-1 MOE 843
147028 8631 8642 CCAGCCTTGTCG 1-10-1 MOE 846 147027 8738 8749
CAGCCTTGTCGA 1-10-1 MOE 843 147028 8739 8750 CCAGCCTTGTCG 1-10-1
MOE 846 147043 10957 10968 TGGTCAAAAGGG 1-10-1 MOE 881 147044 10958
10969 GTGGTCAAAAGG 1-10-1 MOE 869 147043 11065 11076 TGGTCAAAAGGG
1-10-1 MOE 881 147044 11066 11077 GTGGTCAAAAGG 1-10-1 MOE 869
147071 11605 11616 CTGATCCTGCAC 1-10-1 MOE 856 147070 11611 11622
TGATCCTGCACT 1-10-1 MOE 878 147071 11612 11623 CTGATCCTGCAC 1-10-1
MOE 856 147072 12294 12305 ACTGATCCTGCA 1-10-1 MOE 832 147072 12299
12310 ACTGATCCTGCA 1-10-1 MOE 832 147030 12805 12816 TCCCAGCCTTGT
1-10-1 MOE 874 147031 12806 12817 TTCCCAGCCTTG 1-10-1 MOE 885
147053 12939 12950 AATCCGACTGTG 1-10-1 MOE 829 147030 12986 12997
TCCCAGCCTTGT 1-10-1 MOE 874 147031 12987 12998 TTCCCAGCCTTG 1-10-1
MOE 885 147053 13120 13131 AATCCGACTGTG 1-10-1 MOE 829 147051 13162
13173 TCCGACTGTGGT 1-10-1 MOE 875 147061 13316 13327 TGCAATTTAATC
1-10-1 MOE 879 147047 13339 13350 ACTGTGGTCAAA 1-10-1 MOE 833
147029 14058 14069 CCCAGCCTTGTC 1-10-1 MOE 848 147029 14239 14250
CCCAGCCTTGTC 1-10-1 MOE 848 147067 15560 15571 TCCTGCACTGAC 1-10-1
MOE 876 147068 15561 15572 ATCCTGCACTGA 1-10-1 MOE 838 147067 15742
15753 TCCTGCACTGAC 1-10-1 MOE 876 147069 15744 15755 GATCCTGCACTG
1-10-1 MOE 860 147042 16561 16572 GGTCAAAAGGGC 1-10-1 MOE 866
147042 16727 16738 GGTCAAAAGGGC 1-10-1 MOE 866 147030 17619 17630
TCCCAGCCTTGT 1-10-1 MOE 874 147064 17762 17773 TGCACTGACGAG 1-10-1
MOE 880 147030 17787 17798 TCCCAGCCTTGT 1-10-1 MOE 874 147064 17930
17941 TGCACTGACGAG 1-10-1 MOE 880 147042 19201 19212 GGTCAAAAGGGC
1-10-1 MOE 866 147042 19369 19380 GGTCAAAAGGGC 1-10-1 MOE 866
147027 21190 21201 CAGCCTTGTCGA 1-10-1 MOE 843 147028 21191 21202
CCAGCCTTGTCG 1-10-1 MOE 846 147027 21358 21369 CAGCCTTGTCGA 1-10-1
MOE 843 147028 21359 21370 CCAGCCTTGTCG 1-10-1 MOE 846 147070 22021
22032 TGATCCTGCACT 1-10-1 MOE 878 147070 22189 22200 TGATCCTGCACT
1-10-1 MOE 878 147047 22606 22617 ACTGTGGTCAAA 1-10-1 MOE 833
147043 24318 24329 TGGTCAAAAGGG 1-10-1 MOE 881 147044 24319 24330
GTGGTCAAAAGG 1-10-1 MOE 869 147045 24320 24331 TGTGGTCAAAAG 1-10-1
MOE 883 147046 24321 24332 CTGTGGTCAAAA 1-10-1 MOE 858 147043 24486
24497 TGGTCAAAAGGG 1-10-1 MOE 881 147044 24487 24498 GTGGTCAAAAGG
1-10-1 MOE 869 147046 24489 24500 CTGTGGTCAAAA 1-10-1 MOE 858
147047 24490 24501 ACTGTGGTCAAA 1-10-1 MOE 833 147040 25065 25076
GCCGCCCAGTTC 1-10-1 MOE 864 147041 25066 25077 AGCCGCCCAGTT 1-10-1
MOE 834 147046 25160 25171 CTGTGGTCAAAA 1-10-1 MOE 858 147039 25232
25243 CCGCCCAGTTCC 1-10-1 MOE 850 147040 25233 25244 GCCGCCCAGTTC
1-10-1 MOE 864 147041 25234 25245 AGCCGCCCAGTT 1-10-1 MOE 834
147046 25328 25339 CTGTGGTCAAAA 1-10-1 MOE 858 147057 25508 25519
ATTTAATCCGAC 1-10-1 MOE 839 147061 25512 25523 TGCAATTTAATC 1-10-1
MOE 879 147057 25676 25687 ATTTAATCCGAC 1-10-1 MOE 839 147069 28878
28889 GATCCTGCACTG 1-10-1 MOE 860 147070 28879 28890 TGATCCTGCACT
1-10-1 MOE 878 147053 30133 30144 AATCCGACTGTG 1-10-1 MOE 829
147053 30278 30289 AATCCGACTGTG 1-10-1 MOE 829 147054 30864 30875
TAATCCGACTGT 1-10-1 MOE 871 147043 30985 30996 TGGTCAAAAGGG 1-10-1
MOE 881 147054 31011 31022 TAATCCGACTGT 1-10-1 MOE 871 147043 31133
31144 TGGTCAAAAGGG 1-10-1 MOE 881 147036 32233 32244 CCCAGTTCCCAG
1-10-1 MOE 849 147072 32372 32383 ACTGATCCTGCA 1-10-1 MOE 832
147072 32520 32531 ACTGATCCTGCA 1-10-1 MOE 832 147069 33056 33067
GATCCTGCACTG 1-10-1 MOE 860 147070 33057 33068 TGATCCTGCACT 1-10-1
MOE 878 147071 33058 33069 CTGATCCTGCAC 1-10-1 MOE 856 147051 33126
33137 TCCGACTGTGGT 1-10-1 MOE 875 147070 33205 33216 TGATCCTGCACT
1-10-1 MOE 878 147071 33206 33217 CTGATCCTGCAC 1-10-1 MOE 856
147051 33274 33285 TCCGACTGTGGT 1-10-1 MOE 875 147046 33318 33329
CTGTGGTCAAAA 1-10-1 MOE 858 147049 33321 33332 CGACTGTGGTCA 1-10-1
MOE 854 147051 33323 33334 TCCGACTGTGGT 1-10-1 MOE 875 147046 33466
33477 CTGTGGTCAAAA 1-10-1 MOE 858 147047 33467 33478 ACTGTGGTCAAA
1-10-1 MOE 833 147051 33471 33482 TCCGACTGTGGT 1-10-1 MOE 875
147046 33640 33651 CTGTGGTCAAAA 1-10-1 MOE 858 147051 33645 33656
TCCGACTGTGGT 1-10-1 MOE 875 147046 33788 33799 CTGTGGTCAAAA 1-10-1
MOE 858 147051 33793 33804 TCCGACTGTGGT 1-10-1 MOE 875 147059 35437
35448 CAATTTAATCCG 1-10-1 MOE 840 147060 35438 35449 GCAATTTAATCC
1-10-1 MOE 861 147060 35586 35597 GCAATTTAATCC 1-10-1 MOE 861
147021 36093 36104 TGTCGATCTCCT 1-10-1 MOE 882 147061 36250 36261
TGCAATTTAATC 1-10-1 MOE 879 147061 36398 36409 TGCAATTTAATC 1-10-1
MOE 879 147073 37485 37496 CACTGATCCTGC 1-10-1 MOE 842 147073 37633
37644 CACTGATCCTGC 1-10-1 MOE 842 147043 40214 40225 TGGTCAAAAGGG
1-10-1 MOE 881 147061 40353 40364 TGCAATTTAATC 1-10-1 MOE 879
147043 40362 40373 TGGTCAAAAGGG 1-10-1 MOE 881 147061 40501 40512
TGCAATTTAATC 1-10-1 MOE 879 147031 42527 42538 TTCCCAGCCTTG 1-10-1
MOE 885 147032 42528 42539 GTTCCCAGCCTT 1-10-1 MOE 870 147034 42530
42541 CAGTTCCCAGCC 1-10-1 MOE 844 147031 42675 42686 TTCCCAGCCTTG
1-10-1 MOE 885 147032 42676 42687 GTTCCCAGCCTT 1-10-1 MOE 870
147033 42677 42688 AGTTCCCAGCCT 1-10-1 MOE 836 147034 42678 42689
CAGTTCCCAGCC 1-10-1 MOE 844 147074 43848 43859 CCACTGATCCTG 1-10-1
MOE 845 147074 43996 44007 CCACTGATCCTG 1-10-1 MOE 845 147051 45402
45413 TCCGACTGTGGT 1-10-1 MOE 875 147051 45550 45561 TCCGACTGTGGT
1-10-1 MOE 875 147074 46125 46136 CCACTGATCCTG 1-10-1 MOE 845
147057 46313 46324 ATTTAATCCGAC 1-10-1 MOE 839 147058 46314 46325
AATTTAATCCGA 1-10-1 MOE 830 147059 46315 46326 CAATTTAATCCG 1-10-1
MOE 840 147061 46317 46328 TGCAATTTAATC 1-10-1 MOE 879 147057 46461
46472 ATTTAATCCGAC 1-10-1 MOE 839 147059 46463 46474 CAATTTAATCCG
1-10-1 MOE 840 147061 46465 46476 TGCAATTTAATC 1-10-1 MOE 879
147058 47413 47424 AATTTAATCCGA 1-10-1 MOE 830 147073 48221 48232
CACTGATCCTGC 1-10-1 MOE 842 147073 48369 48380 CACTGATCCTGC 1-10-1
MOE 842 147074 48370 48381 CCACTGATCCTG 1-10-1 MOE 845 147027 48566
48577 CAGCCTTGTCGA 1-10-1 MOE 843 147027 48714 48725 CAGCCTTGTCGA
1-10-1 MOE 843 147028 48715 48726 CCAGCCTTGTCG 1-10-1 MOE 846
147067 49050 49061 TCCTGCACTGAC 1-10-1 MOE 876 147068 49051 49062
ATCCTGCACTGA 1-10-1 MOE 838 147067 49198 49209 TCCTGCACTGAC 1-10-1
MOE 876 147073 49524 49535 CACTGATCCTGC 1-10-1 MOE 842 147073 49672
49683 CACTGATCCTGC 1-10-1 MOE 842 147074 49673 49684 CCACTGATCCTG
1-10-1 MOE 845 147036 50421 50432 CCCAGTTCCCAG 1-10-1 MOE 849
147036 52292 52303 CCCAGTTCCCAG 1-10-1 MOE 849 147037 52293 52304
GCCCAGTTCCCA 1-10-1 MOE 863 147036 52438 52449 CCCAGTTCCCAG 1-10-1
MOE 849 147037 52439 52450 GCCCAGTTCCCA 1-10-1 MOE 863 147034 53148
53159 CAGTTCCCAGCC 1-10-1 MOE 844 147034 53294 53305 CAGTTCCCAGCC
1-10-1 MOE 844 147042 53445 53456 GGTCAAAAGGGC 1-10-1 MOE 866
147043 53446 53457 TGGTCAAAAGGG 1-10-1 MOE 881 147044 53447 53458
GTGGTCAAAAGG 1-10-1 MOE 869 147042 53591 53602 GGTCAAAAGGGC 1-10-1
MOE 866 147030 53592 53603 TCCCAGCCTTGT 1-10-1 MOE 874 147043 53592
53603 TGGTCAAAAGGG 1-10-1 MOE 881 147031 53593 53604 TTCCCAGCCTTG
1-10-1 MOE 885 147044 53593 53604 GTGGTCAAAAGG 1-10-1 MOE 869
147030 53738 53749 TCCCAGCCTTGT 1-10-1 MOE 874 147031 53739 53750
TTCCCAGCCTTG 1-10-1 MOE 885 147040 53783 53794 GCCGCCCAGTTC 1-10-1
MOE 864 147041 53784 53795 AGCCGCCCAGTT 1-10-1 MOE 834 147041 53930
53941 AGCCGCCCAGTT 1-10-1 MOE 834 147042 55008 55019 GGTCAAAAGGGC
1-10-1 MOE 866 147043 55009 55020 TGGTCAAAAGGG 1-10-1 MOE 881
147042 55154 55165 GGTCAAAAGGGC 1-10-1 MOE 866 147043 55155 55166
TGGTCAAAAGGG 1-10-1 MOE 881 147058 55281 55292 AATTTAATCCGA 1-10-1
MOE 830 147058 55427 55438 AATTTAATCCGA 1-10-1 MOE 830 147019 55682
55693 TCGATCTCCTCG 1-10-1 MOE 877 147021 55684 55695 TGTCGATCTCCT
1-10-1 MOE 882 147021 55830 55841 TGTCGATCTCCT 1-10-1 MOE 882
147054 56275 56286 TAATCCGACTGT 1-10-1 MOE 871 147055 56276 56287
TTAATCCGACTG 1-10-1 MOE 884 147056 56277 56288 TTTAATCCGACT 1-10-1
MOE 887 147058 56279 56290 AATTTAATCCGA 1-10-1 MOE 830 147059 56280
56291 CAATTTAATCCG 1-10-1 MOE 840 147060 56281 56292 GCAATTTAATCC
1-10-1 MOE 861 147061 56282 56293 TGCAATTTAATC 1-10-1 MOE 879
147051 56418 56429 TCCGACTGTGGT 1-10-1 MOE 875 147053 56420 56431
AATCCGACTGTG 1-10-1 MOE 829 147054 56421 56432 TAATCCGACTGT 1-10-1
MOE 871 147055 56422 56433 TTAATCCGACTG 1-10-1 MOE 884 147056 56423
56434 TTTAATCCGACT 1-10-1 MOE 887 147057 56424 56435 ATTTAATCCGAC
1-10-1 MOE 839 147058 56425 56436 AATTTAATCCGA 1-10-1 MOE 830
147061 56428 56439 TGCAATTTAATC 1-10-1 MOE 879 147045 57118 57129
TGTGGTCAAAAG 1-10-1 MOE 883 147045 57264 57275 TGTGGTCAAAAG 1-10-1
MOE 883 147046 57265 57276 CTGTGGTCAAAA 1-10-1 MOE 858 147071 58028
58039 CTGATCCTGCAC 1-10-1 MOE 856 147071 58174 58185 CTGATCCTGCAC
1-10-1 MOE 856 147043 61111 61122 TGGTCAAAAGGG 1-10-1 MOE 881
147071 61130 61141 CTGATCCTGCAC 1-10-1 MOE 856 147020 61226 61237
GTCGATCTCCTC 1-10-1 MOE 868 147043 61257 61268 TGGTCAAAAGGG 1-10-1
MOE 881 147071 61276 61287 CTGATCCTGCAC 1-10-1 MOE 856 147035 61277
61288 CCAGTTCCCAGC 1-10-1 MOE 847 147036 61278 61289 CCCAGTTCCCAG
1-10-1 MOE 849 147037 61279 61290 GCCCAGTTCCCA 1-10-1 MOE 863
147038 61280 61291 CGCCCAGTTCCC 1-10-1 MOE 855 147039 61281 61292
CCGCCCAGTTCC 1-10-1 MOE 850 147040 61282 61293 GCCGCCCAGTTC 1-10-1
MOE 864 147071 61309 61320 CTGATCCTGCAC 1-10-1 MOE 856 147020 61372
61383 GTCGATCTCCTC 1-10-1 MOE 868 147034 61422 61433 CAGTTCCCAGCC
1-10-1 MOE 844 147035 61423 61434 CCAGTTCCCAGC 1-10-1 MOE 847
147036 61424 61435 CCCAGTTCCCAG 1-10-1 MOE 849 147037 61425 61436
GCCCAGTTCCCA 1-10-1 MOE 863 147038 61426 61437 CGCCCAGTTCCC 1-10-1
MOE 855 147040 61428 61439 GCCGCCCAGTTC 1-10-1 MOE 864 147071 61455
61466 CTGATCCTGCAC 1-10-1 MOE 856 147073 62003 62014 CACTGATCCTGC
1-10-1 MOE 842 147073 62149 62160 CACTGATCCTGC 1-10-1 MOE 842
147066 63065 63076 CCTGCACTGACG 1-10-1 MOE 851 147068 63067 63078
ATCCTGCACTGA 1-10-1 MOE 838 147069 63146 63157 GATCCTGCACTG 1-10-1
MOE 860 147062 63207 63218 CACTGACGAGTC 1-10-1 MOE 841 147066 63211
63222 CCTGCACTGACG 1-10-1 MOE 851 147057 64054 64065 ATTTAATCCGAC
1-10-1 MOE 839 147036 64538 64549 CCCAGTTCCCAG 1-10-1 MOE 849
147037 64539 64550 GCCCAGTTCCCA 1-10-1 MOE 863 147037 64685 64696
GCCCAGTTCCCA 1-10-1 MOE 863 147066 64864 64875 CCTGCACTGACG 1-10-1
MOE 851 147067 64865 64876 TCCTGCACTGAC 1-10-1 MOE 876 147066 65010
65021 CCTGCACTGACG 1-10-1 MOE 851 147067 65011 65022 TCCTGCACTGAC
1-10-1 MOE 876 147045 65017 65028 TGTGGTCAAAAG 1-10-1 MOE 883
147045 65163 65174 TGTGGTCAAAAG 1-10-1 MOE 883 147046 65164 65175
CTGTGGTCAAAA 1-10-1 MOE 858 147068 65408 65419 ATCCTGCACTGA 1-10-1
MOE 838 147071 65411 65422 CTGATCCTGCAC 1-10-1 MOE 856 147069 65549
65560 GATCCTGCACTG 1-10-1 MOE 860 147068 65554 65565 ATCCTGCACTGA
1-10-1 MOE 838 147071 65557 65568 CTGATCCTGCAC 1-10-1 MOE 856
147029 67741 67752 CCCAGCCTTGTC 1-10-1 MOE 848 147030 67742 67753
TCCCAGCCTTGT 1-10-1 MOE 874 147031 67743 67754 TTCCCAGCCTTG 1-10-1
MOE 885 147028 67886 67897 CCAGCCTTGTCG 1-10-1 MOE 846 147029 67887
67898 CCCAGCCTTGTC 1-10-1 MOE 848 147030 67888 67899 TCCCAGCCTTGT
1-10-1 MOE 874 147031 67889 67900 TTCCCAGCCTTG 1-10-1 MOE 885
147043 68867 68878 TGGTCAAAAGGG 1-10-1 MOE 881 147044 68868 68879
GTGGTCAAAAGG 1-10-1 MOE 869 147045 68869 68880 TGTGGTCAAAAG 1-10-1
MOE 883 147043 69013 69024 TGGTCAAAAGGG 1-10-1 MOE 881 147044 69014
69025 GTGGTCAAAAGG 1-10-1 MOE 869 147045 69015 69026 TGTGGTCAAAAG
1-10-1 MOE 883 147046 69016 69027 CTGTGGTCAAAA 1-10-1 MOE 858
147071 69519 69530 CTGATCCTGCAC 1-10-1 MOE 856 147072 69520 69531
ACTGATCCTGCA 1-10-1 MOE 832 147073 69521 69532 CACTGATCCTGC 1-10-1
MOE 842 147071 69665 69676 CTGATCCTGCAC 1-10-1 MOE 856 147072 69666
69677 ACTGATCCTGCA 1-10-1 MOE 832 147073 69667 69678 CACTGATCCTGC
1-10-1 MOE 842 147074 69668 69679 CCACTGATCCTG 1-10-1 MOE 845
147066 69869 69880 CCTGCACTGACG 1-10-1 MOE 851 147066 70015 70026
CCTGCACTGACG 1-10-1 MOE 851 147023 70465 70476 CTTGTCGATCTC 1-10-1
MOE 859 147023 70611 70622 CTTGTCGATCTC 1-10-1 MOE 859 147062 70615
70626 CACTGACGAGTC 1-10-1 MOE 841 147063 70616 70627 GCACTGACGAGT
1-10-1 MOE 862
147064 70617 70628 TGCACTGACGAG 1-10-1 MOE 880 147065 70618 70629
CTGCACTGACGA 1-10-1 MOE 857 147066 70619 70630 CCTGCACTGACG 1-10-1
MOE 851 147063 70762 70773 GCACTGACGAGT 1-10-1 MOE 862 147064 70763
70774 TGCACTGACGAG 1-10-1 MOE 880 147065 70764 70775 CTGCACTGACGA
1-10-1 MOE 857 147066 70765 70776 CCTGCACTGACG 1-10-1 MOE 851
147072 70998 71009 ACTGATCCTGCA 1-10-1 MOE 832 147073 70999 71010
CACTGATCCTGC 1-10-1 MOE 842 147072 71144 71155 ACTGATCCTGCA 1-10-1
MOE 832 147073 71145 71156 CACTGATCCTGC 1-10-1 MOE 842 147074 71146
71157 CCACTGATCCTG 1-10-1 MOE 845 147037 71351 71362 GCCCAGTTCCCA
1-10-1 MOE 863 147038 71352 71363 CGCCCAGTTCCC 1-10-1 MOE 855
147039 71353 71364 CCGCCCAGTTCC 1-10-1 MOE 850 147037 71497 71508
GCCCAGTTCCCA 1-10-1 MOE 863 147038 71498 71509 CGCCCAGTTCCC 1-10-1
MOE 855 147039 71499 71510 CCGCCCAGTTCC 1-10-1 MOE 850 147061 71641
71652 TGCAATTTAATC 1-10-1 MOE 879 147061 71787 71798 TGCAATTTAATC
1-10-1 MOE 879
TABLE-US-00020 TABLE 17 Short antisense compounds targeted to SEQ
ID NO: 11 and having 1 or 2 mismatches 5' 3' SEQ ISIS Target Target
Gapmer ID NO. Site Site Sequence (5'-3') Motif NO 147022 177 188
TTGTCGATCTCC 1-10-1 MOE 886 147023 178 189 CTTGTCGATCTC 1-10-1 MOE
859 147020 196 207 GTCGATCTCCTC 1-10-1 MOE 868 147022 198 209
TTGTCGATCTCC 1-10-1 MOE 886 147024 200 211 CCTTGTCGATCT 1-10-1 MOE
853 147026 202 213 AGCCTTGTCGAT 1-10-1 MOE 835 147028 204 215
CCAGCCTTGTCG 1-10-1 MOE 846 147029 205 216 CCCAGCCTTGTC 1-10-1 MOE
848 147030 206 217 TCCCAGCCTTGT 1-10-1 MOE 874 147036 212 223
CCCAGTTCCCAG 1-10-1 MOE 849 147073 311 322 CACTGATCCTGC 1-10-1 MOE
842 147046 327 338 CTGTGGTCAAAA 1-10-1 MOE 858 147047 328 339
ACTGTGGTCAAA 1-10-1 MOE 833 147048 329 340 GACTGTGGTCAA 1-10-1 MOE
888 147049 330 341 CGACTGTGGTCA 1-10-1 MOE 854 147050 331 342
CCGACTGTGGTC 1-10-1 MOE 889 147051 332 343 TCCGACTGTGGT 1-10-1 MOE
875 147052 333 344 ATCCGACTGTGG 1-10-1 MOE 837 147053 334 345
AATCCGACTGTG 1-10-1 MOE 829 147054 335 346 TAATCCGACTGT 1-10-1 MOE
871 147055 336 347 TTAATCCGACTG 1-10-1 MOE 884 147056 337 348
TTTAATCCGACT 1-10-1 MOE 887 147057 338 349 ATTTAATCCGAC 1-10-1 MOE
839 147058 339 350 AATTTAATCCGA 1-10-1 MOE 830 147060 341 352
GCAATTTAATCC 1-10-1 MOE 861 147061 342 353 TGCAATTTAATC 1-10-1 MOE
879 147062 1024 1035 CACTGACGAGTC 1-10-1 MOE 841 147063 1025 1036
GCACTGACGAGT 1-10-1 MOE 862 147068 1030 1041 ATCCTGCACTGA 1-10-1
MOE 838 147071 1033 1044 CTGATCCTGCAC 1-10-1 MOE 856 147073 1035
1046 CACTGATCCTGC 1-10-1 MOE 842 147074 1036 1047 CCACTGATCCTG
1-10-1 MOE 845 147067 1091 1102 TCCTGCACTGAC 1-10-1 MOE 876 147024
1891 1902 CCTTGTCGATCT 1-10-1 MOE 853 147026 1893 1904 AGCCTTGTCGAT
1-10-1 MOE 835 147029 1896 1907 CCCAGCCTTGTC 1-10-1 MOE 848 147036
1903 1914 CCCAGTTCCCAG 1-10-1 MOE 849 147039 1906 1917 CCGCCCAGTTCC
1-10-1 MOE 850 147019 1994 2005 TCGATCTCCTCG 1-10-1 MOE 877 401385
2815 2828 CCCAGTGGGTTTGA 2-10-2 MOE 890 147033 5265 5276
AGTTCCCAGCCT 1-10-1 MOE 836 147033 5373 5384 AGTTCCCAGCCT 1-10-1
MOE 836 147060 7168 7179 GCAATTTAATCC 1-10-1 MOE 861 147053 10527
10538 AATCCGACTGTG 1-10-1 MOE 829 147053 10635 10646 AATCCGACTGTG
1-10-1 MOE 829 147070 11604 11615 TGATCCTGCACT 1-10-1 MOE 878
147071 11612 11623 CTGATCCTGCAC 1-10-1 MOE 856 147072 12294 12305
ACTGATCCTGCA 1-10-1 MOE 832 147072 12299 12310 ACTGATCCTGCA 1-10-1
MOE 832 147052 12938 12949 ATCCGACTGTGG 1-10-1 MOE 837 147052 13119
13130 ATCCGACTGTGG 1-10-1 MOE 837 147047 13158 13169 ACTGTGGTCAAA
1-10-1 MOE 833 147048 13159 13170 GACTGTGGTCAA 1-10-1 MOE 888
147049 13160 13171 CGACTGTGGTCA 1-10-1 MOE 854 147048 13340 13351
GACTGTGGTCAA 1-10-1 MOE 888 147049 13341 13352 CGACTGTGGTCA 1-10-1
MOE 854 147051 13343 13354 TCCGACTGTGGT 1-10-1 MOE 875 147061 13497
13508 TGCAATTTAATC 1-10-1 MOE 879 147069 15562 15573 GATCCTGCACTG
1-10-1 MOE 860 147068 15743 15754 ATCCTGCACTGA 1-10-1 MOE 838
147049 17181 17192 CGACTGTGGTCA 1-10-1 MOE 854 147049 17349 17360
CGACTGTGGTCA 1-10-1 MOE 854 147047 22438 22449 ACTGTGGTCAAA 1-10-1
MOE 833 147047 24322 24333 ACTGTGGTCAAA 1-10-1 MOE 833 147045 24488
24499 TGTGGTCAAAAG 1-10-1 MOE 883 147039 25064 25075 CCGCCCAGTTCC
1-10-1 MOE 850 147057 25508 25519 ATTTAATCCGAC 1-10-1 MOE 839
147057 25676 25687 ATTTAATCCGAC 1-10-1 MOE 839 147061 25680 25691
TGCAATTTAATC 1-10-1 MOE 879 147069 28731 28742 GATCCTGCACTG 1-10-1
MOE 860 147052 30132 30143 ATCCGACTGTGG 1-10-1 MOE 837 147052 30277
30288 ATCCGACTGTGG 1-10-1 MOE 837 147036 32085 32096 CCCAGTTCCCAG
1-10-1 MOE 849 147072 32520 32531 ACTGATCCTGCA 1-10-1 MOE 832
147071 33058 33069 CTGATCCTGCAC 1-10-1 MOE 856 147050 33125 33136
CCGACTGTGGTC 1-10-1 MOE 889 147069 33204 33215 GATCCTGCACTG 1-10-1
MOE 860 147050 33273 33284 CCGACTGTGGTC 1-10-1 MOE 889 147047 33319
33330 ACTGTGGTCAAA 1-10-1 MOE 833 147050 33322 33333 CCGACTGTGGTC
1-10-1 MOE 889 147052 33324 33335 ATCCGACTGTGG 1-10-1 MOE 837
147049 33469 33480 CGACTGTGGTCA 1-10-1 MOE 854 147050 33470 33481
CCGACTGTGGTC 1-10-1 MOE 889 147052 33472 33483 ATCCGACTGTGG 1-10-1
MOE 837 147047 33641 33652 ACTGTGGTCAAA 1-10-1 MOE 833 147047 33789
33800 ACTGTGGTCAAA 1-10-1 MOE 833 147059 35585 35596 CAATTTAATCCG
1-10-1 MOE 840 147021 36241 36252 TGTCGATCTCCT 1-10-1 MOE 882
147073 37633 37644 CACTGATCCTGC 1-10-1 MOE 842 147033 42529 42540
AGTTCCCAGCCT 1-10-1 MOE 836 147050 45401 45412 CCGACTGTGGTC 1-10-1
MOE 889 147050 45549 45560 CCGACTGTGGTC 1-10-1 MOE 889 147074 46125
46136 CCACTGATCCTG 1-10-1 MOE 845 147057 46313 46324 ATTTAATCCGAC
1-10-1 MOE 839 147058 46462 46473 AATTTAATCCGA 1-10-1 MOE 830
147058 47413 47424 AATTTAATCCGA 1-10-1 MOE 830 147058 47561 47572
AATTTAATCCGA 1-10-1 MOE 830 147073 48221 48232 CACTGATCCTGC 1-10-1
MOE 842 147073 48369 48380 CACTGATCCTGC 1-10-1 MOE 842 147028 48567
48578 CCAGCCTTGTCG 1-10-1 MOE 846 147068 49199 49210 ATCCTGCACTGA
1-10-1 MOE 838 147036 50273 50284 CCCAGTTCCCAG 1-10-1 MOE 849
147040 53929 53940 GCCGCCCAGTTC 1-10-1 MOE 864 147047 54769 54780
ACTGTGGTCAAA 1-10-1 MOE 833 147048 54770 54781 GACTGTGGTCAA 1-10-1
MOE 888 147047 54915 54926 ACTGTGGTCAAA 1-10-1 MOE 833 147048 54916
54927 GACTGTGGTCAA 1-10-1 MOE 888 147019 55828 55839 TCGATCTCCTCG
1-10-1 MOE 877 147047 56268 56279 ACTGTGGTCAAA 1-10-1 MOE 833
147048 56269 56280 GACTGTGGTCAA 1-10-1 MOE 888 147049 56270 56281
CGACTGTGGTCA 1-10-1 MOE 854 147050 56271 56282 CCGACTGTGGTC 1-10-1
MOE 889 147051 56272 56283 TCCGACTGTGGT 1-10-1 MOE 875 147052 56273
56284 ATCCGACTGTGG 1-10-1 MOE 837 147053 56274 56285 AATCCGACTGTG
1-10-1 MOE 829 147056 56277 56288 TTTAATCCGACT 1-10-1 MOE 887
147057 56278 56289 ATTTAATCCGAC 1-10-1 MOE 839 147047 56414 56425
ACTGTGGTCAAA 1-10-1 MOE 833 147048 56415 56426 GACTGTGGTCAA 1-10-1
MOE 888 147049 56416 56427 CGACTGTGGTCA 1-10-1 MOE 854 147050 56417
56428 CCGACTGTGGTC 1-10-1 MOE 889
147052 56419 56430 ATCCGACTGTGG 1-10-1 MOE 837 147057 56424 56435
ATTTAATCCGAC 1-10-1 MOE 839 147058 56425 56436 AATTTAATCCGA 1-10-1
MOE 830 147059 56426 56437 CAATTTAATCCG 1-10-1 MOE 840 147060 56427
56438 GCAATTTAATCC 1-10-1 MOE 861 147046 57119 57130 CTGTGGTCAAAA
1-10-1 MOE 858 147071 58174 58185 CTGATCCTGCAC 1-10-1 MOE 856
147071 61130 61141 CTGATCCTGCAC 1-10-1 MOE 856 147034 61276 61287
CAGTTCCCAGCC 1-10-1 MOE 844 147071 61309 61320 CTGATCCTGCAC 1-10-1
MOE 856 147039 61427 61438 CCGCCCAGTTCC 1-10-1 MOE 850 147071 61455
61466 CTGATCCTGCAC 1-10-1 MOE 856 147073 62003 62014 CACTGATCCTGC
1-10-1 MOE 842 147062 63061 63072 CACTGACGAGTC 1-10-1 MOE 841
147068 63213 63224 ATCCTGCACTGA 1-10-1 MOE 838 147069 63292 63303
GATCCTGCACTG 1-10-1 MOE 860 147057 64054 64065 ATTTAATCCGAC 1-10-1
MOE 839 147057 64200 64211 ATTTAATCCGAC 1-10-1 MOE 839 147070 64427
64438 TGATCCTGCACT 1-10-1 MOE 878 147070 64573 64584 TGATCCTGCACT
1-10-1 MOE 878 147036 64684 64695 CCCAGTTCCCAG 1-10-1 MOE 849
147046 65018 65029 CTGTGGTCAAAA 1-10-1 MOE 858 147071 65557 65568
CTGATCCTGCAC 1-10-1 MOE 856 147069 65695 65706 GATCCTGCACTG 1-10-1
MOE 860 147047 66163 66174 ACTGTGGTCAAA 1-10-1 MOE 833 147047 66309
66320 ACTGTGGTCAAA 1-10-1 MOE 833 147028 67740 67751 CCAGCCTTGTCG
1-10-1 MOE 846 147046 68870 68881 CTGTGGTCAAAA 1-10-1 MOE 858
147047 68871 68882 ACTGTGGTCAAA 1-10-1 MOE 833 147048 68872 68883
GACTGTGGTCAA 1-10-1 MOE 888 147049 68873 68884 CGACTGTGGTCA 1-10-1
MOE 854 147047 69017 69028 ACTGTGGTCAAA 1-10-1 MOE 833 147048 69018
69029 GACTGTGGTCAA 1-10-1 MOE 888 147049 69019 69030 CGACTGTGGTCA
1-10-1 MOE 854 147071 69519 69530 CTGATCCTGCAC 1-10-1 MOE 856
147073 69521 69532 CACTGATCCTGC 1-10-1 MOE 842 147071 69665 69676
CTGATCCTGCAC 1-10-1 MOE 856 147072 69666 69677 ACTGATCCTGCA 1-10-1
MOE 832 147024 70466 70477 CCTTGTCGATCT 1-10-1 MOE 853 147024 70612
70623 CCTTGTCGATCT 1-10-1 MOE 853 147062 70761 70772 CACTGACGAGTC
1-10-1 MOE 841 147072 70998 71009 ACTGATCCTGCA 1-10-1 MOE 832
147073 70999 71010 CACTGATCCTGC 1-10-1 MOE 842 147072 71144 71155
ACTGATCCTGCA 1-10-1 MOE 832 147073 71145 71156 CACTGATCCTGC 1-10-1
MOE 842 147048 71366 71377 GACTGTGGTCAA 1-10-1 MOE 888 147048 71512
71523 GACTGTGGTCAA 1-10-1 MOE 888
TABLE-US-00021 TABLE 18 Short Antisense Compounds targeted to SEQ
ID NO: 12 5' 3' Seq ISIS Target Target ID NO. Site Site Sequence
(5'-3') Gapmer Motif NO 398163 20 31 ATGTCAACCGGC 1-10-1 MOE 908
384545 23 34 CAAGTAGGATGT 1-10-1 MOE 951 147705 159 170
CGGTTTTTGTTC 1-10-1 MOE 1002 147703 245 256 TGGCTTCATGTC 1-10-1 MOE
971 398090 283 296 TTGTTCTTAGGAAG 2-10-2 MOE 972 147704 285 296
TTGTTCTTAGGA 1-10-1 MOE 1012 147705 291 302 CGGTTTTTGTTC 1-10-1 MOE
1002 147709 311 322 CCATTTTTATCA 1-10-1 MOE 978 147733 349 360
TTCTTGATGTCC 1-10-1 MOE 891 147707 360 371 TAGTCATTATCT 1-10-1 MOE
977 147708 366 377 TTGATATAGTCA 1-10-1 MOE 997 390030 381 392
TTTATAAAACTG 1-10-1 MOE 1074 147709 386 397 CCATTTTTATCA 1-10-1 MOE
978 147081 393 404 GCTCCTTCCACT 1-10-1 MOE 1006 398091 393 406
GGGCTTCTTCCATT 2-10-2 MOE 979 398166 395 406 GGGCTTCTTCCA 1-10-1
MOE 1070 147709 418 429 CCATTTTTATCA 1-10-1 MOE 978 147711 425 436
AAGGGCCCTGGG 1-10-1 MOE 1040 147712 461 472 ACACCATCTCCC 1-10-1 MOE
1005 147713 466 477 CTCCCACACCAT 1-10-1 MOE 985 147714 471 482
TTCTGCTCCCAC 1-10-1 MOE 986 147715 496 507 GTTGAGCATGAC 1-10-1 MOE
1077 147716 521 532 TTAACGAGCCTT 1-10-1 MOE 949 147717 574 585
ATCTTCAGAGAT 1-10-1 MOE 996 147717 607 618 ATCTTCAGAGAT 1-10-1 MOE
996 147708 612 623 TTGATATAGTCA 1-10-1 MOE 997 147718 621 632
TAATATGACTTG 1-10-1 MOE 998 147746 625 636 TAAAAACAACAA 1-10-1 MOE
1073 398167 704 715 CAGGCCATGTGG 1-10-1 MOE 1059 398092 705 718
AGTCAGGCCATGTG 2-10-2 MOE 1060 147723 715 726 GACTCCAAAGTC 1-10-1
MOE 892 398093 758 771 TCGGACTTTGAAAA 2-10-2 MOE 1009 398168 760
771 TCGGACTTTGAA 1-10-1 MOE 1008 147738 780 791 TGGGTGGCCGGG 1-10-1
MOE 1069 398094 848 861 ATCAGCCAGACAGA 2-10-2 MOE 1010 398169 849
860 TCAGCCAGACAG 1-10-1 MOE 909 398164 873 884 TTGTCGATCTGC 1-10-1
MOE 1014 147735 973 984 GGAGAAGCGCAG 1-10-1 MOE 1016 147737 984 995
ACAGCCAGGTAG 1-10-1 MOE 1067 368369 1025 1040 TCCTGCACTGACGAGT
3-10-3 MOE 893 368372 1031 1046 CACTGATCCTGCACTG 3-10-3 MOE 894
368353 1033 1046 CACTGATCCTGCAC 2-10-2 MOE 1007 368354 1035 1048
TCCACTGATCCTGC 2-10-2 MOE 1024 368388 1035 1050 CTTCCACTGATCCTTA
3-10-3 MOE 895 368355 1036 1049 TTCCACTGATCCTG 2-10-2 MOE 1025
368356 1037 1050 CTTCCACTGATCCT 2-10-2 MOE 1027 368376 1037 1052
TCCTTCCACTGATCCT 3-10-3 MOE 1028 147076 1038 1049 TTCCACTGATCC
1-10-1 MOE 1029 368357 1038 1051 CCTTCCACTGATCC 2-10-2 MOE 1046
147077 1039 1050 CTTCCACTGATC 1-10-1 MOE 1047 368358 1039 1052
TCCTTCCACTGATC 2-10-2 MOE 1031 368378 1039 1054 GCTCCTTCCACTGATC
3-10-3 MOE 1032 368359 1041 1054 GCTCCTTCCACTGA 2-10-2 MOE 1033
147080 1042 1053 CTCCTTCCACTG 1-10-1 MOE 1021 147081 1043 1054
GCTCCTTCCACT 1-10-1 MOE 1006 368360 1043 1056 AAGCTCCTTCCACT 2-10-2
MOE 1035 368380 1043 1058 GAAAGCTCCTTCCACT 3-10-3 MOE 896 147082
1044 1055 AGCTCCTTCCAC 1-10-1 MOE 1036 368381 1045 1060
GGGAAAGCTCCTTCCA 3-10-3 MOE 1037 147739 1107 1118 CGTTTGGGTGGC
1-10-1 MOE 1023 147741 1165 1176 CACCCACTGGTG 1-10-1 MOE 1055
398097 1194 1207 GGCAGTCTTTATCC 2-10-2 MOE 897 147742 1273 1284
AACTTCAGTGTC 1-10-1 MOE 1041 147743 1388 1399 AGGGCTTCCAGT 1-10-1
MOE 1042 147744 1392 1403 AGGAAGGGCTTC 1-10-1 MOE 1043 147745 1398
1409 TTGACCAGGAAG 1-10-1 MOE 1058 398157 1455 1468 GGAAACATACCCTG
2-10-2 MOE 1045 398167 1475 1486 CAGGCCATGTGG 1-10-1 MOE 1059
398092 1476 1489 AGTCAGGCCATGTG 2-10-2 MOE 1060 368357 1596 1609
CCTTCCACTGATCC 2-10-2 MOE 1046 398160 1691 1704 GAATAGGTTAAGGC
2-10-2 MOE 1048 398163 1711 1722 ATGTCAACCGGC 1-10-1 MOE 908 147746
1750 1761 TAAAAACAACAA 1-10-1 MOE 1073 389949 1777 1788
GCGCGAGCCCGA 1-10-1 MOE 1061 398161 1790 1803 AACAATGTGTTGTA 2-10-2
MOE 1049 147746 1799 1810 TAAAAACAACAA 1-10-1 MOE 1073 398163 1819
1830 ATGTCAACCGGC 1-10-1 MOE 908 389950 1848 1859 CCCTGAAGGTTC
1-10-1 MOE 1063 398164 1889 1900 TTGTCGATCTGC 1-10-1 MOE 1014
147702 1917 1928 CTGGTAAATAGC 1-10-1 MOE 898 147088 1971 1982
CCCTCTACACCA 1-10-1 MOE 1050 398102 2003 2016 CTACCTGAGGATTT 2-10-2
MOE 899 398103 2010 2023 CCCAGTACTACCTG 2-10-2 MOE 900 147737 2386
2397 ACAGCCAGGTAG 1-10-1 MOE 1067 398095 2407 2420 CATCAGCAAGAGGC
2-10-2 MOE 1011 398106 2441 2454 TGGAAAACTGCACC 2-10-2 MOE 1068
147745 2497 2508 TTGACCAGGAAG 1-10-1 MOE 1058 147712 2499 2510
ACACCATCTCCC 1-10-1 MOE 1005 147712 2607 2618 ACACCATCTCCC 1-10-1
MOE 1005 147745 2689 2700 TTGACCAGGAAG 1-10-1 MOE 1058 398167 2706
2717 CAGGCCATGTGG 1-10-1 MOE 1059 398092 2707 2720 AGTCAGGCCATGTG
2-10-2 MOE 1060 398166 2966 2977 GGGCTTCTTCCA 1-10-1 MOE 1070
147091 2992 3003 GTTCCCTCTACA 1-10-1 MOE 1004 147092 2993 3004
TGTTCCCTCTAC 1-10-1 MOE 901 389949 3008 3019 GCGCGAGCCCGA 1-10-1
MOE 1061 147087 3149 3160 CCTCTACACCAG 1-10-1 MOE 982 147088 3150
3161 CCCTCTACACCA 1-10-1 MOE 1050 398113 3160 3173 AGGAGGTTAAACCA
2-10-2 MOE 905 147087 3257 3268 CCTCTACACCAG 1-10-1 MOE 982 147088
3258 3269 CCCTCTACACCA 1-10-1 MOE 1050 147737 3591 3602
ACAGCCAGGTAG 1-10-1 MOE 1067 147737 3617 3628 ACAGCCAGGTAG 1-10-1
MOE 1067 147079 3637 3648 TCCTTCCACTGA 1-10-1 MOE 1001 147080 3638
3649 CTCCTTCCACTG 1-10-1 MOE 1021 398095 3638 3651 CATCAGCAAGAGGC
2-10-2 MOE 1011 398106 3672 3685 TGGAAAACTGCACC 2-10-2 MOE 1068
398107 3678 3691 TATTCCTGGAAAAC 2-10-2 MOE 902 147691 3806 3817
GAGGTGGGAAAA 1-10-1 MOE 966 147683 3848 3859 GCTTACGATTGT 1-10-1
MOE 922 147738 3853 3864 TGGGTGGCCGGG 1-10-1 MOE 1069 398167 3926
3937 CAGGCCATGTGG 1-10-1 MOE 1059 398109 3945 3958 CAAGAAGTGTGGTT
2-10-2 MOE 903 398167 4034 4045 CAGGCCATGTGG 1-10-1 MOE 1059 398110
4083 4096 GTTCCCTTTGCAGG 2-10-2 MOE 952 398111 4168 4181
GTGAAAATGCTGGC 2-10-2 MOE 904 147706 4238 4249 GCTGACATCTCG 1-10-1
MOE 1071 398112 4282 4295 CAGCCTGGCACCTA 2-10-2 MOE 1072 147746
4315 4326 TAAAAACAACAA 1-10-1 MOE 1073 398113 4391 4404
AGGAGGTTAAACCA 2-10-2 MOE 905 398115 4484 4497 AGTAAATATTGGCT
2-10-2 MOE 1076 390030 4491 4502 TTTATAAAACTG 1-10-1 MOE 1074
390030 4537 4548 TTTATAAAACTG 1-10-1 MOE 1074 147703 5034 5045
TGGCTTCATGTC 1-10-1 MOE 971 147684 5035 5046 ACCCAGTCAGGG 1-10-1
MOE 964 398125 5075 5088 CAGTAAGGAATTTT 2-10-2 MOE 913 147696 5083
5094 TGGATGATTGGC 1-10-1 MOE 906 147684 5143 5154 ACCCAGTCAGGG
1-10-1 MOE 964 147712 5366 5377 ACACCATCTCCC 1-10-1 MOE 1005 147714
5416 5427 TTCTGCTCCCAC 1-10-1 MOE 986 398128 5443 5456
CTAAATTTAGTTCA 2-10-2 MOE 911 147712 5474 5485 ACACCATCTCCC 1-10-1
MOE 1005 147746 5498 5509 TAAAAACAACAA 1-10-1 MOE 1073 147714 5524
5535 TTCTGCTCCCAC 1-10-1 MOE 986 147736 5600 5611 AGGTAGGAGAAG
1-10-1 MOE 963 147085 5762 5773 TCTACACCAGGT 1-10-1 MOE 961 147679
5825 5836 CAAAAGGATCCC 1-10-1 MOE 907 390030 6803 6814 TTTATAAAACTG
1-10-1 MOE 1074 398142 6885 6898 CCAGCACACTGGAA 2-10-2 MOE 923
398142 6994 7007 CCAGCACACTGGAA 2-10-2 MOE 923 398166 7306 7317
GGGCTTCTTCCA 1-10-1 MOE 1070 147684 7551 7562 ACCCAGTCAGGG 1-10-1
MOE 964 147085 8308 8319 TCTACACCAGGT 1-10-1 MOE 961 147085 8416
8427 TCTACACCAGGT 1-10-1 MOE 961 398163 8473 8484 ATGTCAACCGGC
1-10-1 MOE 908 147718 8523 8534 TAATATGACTTG 1-10-1 MOE 998 147718
8631 8642 TAATATGACTTG 1-10-1 MOE 998 147691 8806 8817 GAGGTGGGAAAA
1-10-1 MOE 966 147728 8835 8846 GCCAGACAGAAG 1-10-1 MOE 1013 147728
8943 8954 GCCAGACAGAAG 1-10-1 MOE 1013 398169 8946 8957
TCAGCCAGACAG 1-10-1 MOE 909 147742 9060 9071 AACTTCAGTGTC 1-10-1
MOE 1041 404136 9162 9175 TAAGTGTCCCTTTG 2-10-2 MOE 910 147746 9963
9974 TAAAAACAACAA 1-10-1 MOE 1073 147746 9966 9977 TAAAAACAACAA
1-10-1 MOE 1073 147746 9969 9980 TAAAAACAACAA 1-10-1 MOE 1073
147746 9991 10002 TAAAAACAACAA 1-10-1 MOE 1073 147746 10071 10082
TAAAAACAACAA 1-10-1 MOE 1073 147746 10074 10085 TAAAAACAACAA 1-10-1
MOE 1073 147746 10077 10088 TAAAAACAACAA 1-10-1 MOE 1073 390030
10170 10181 TTTATAAAACTG 1-10-1 MOE 1074 147084 10220 10231
CTACACCAGGTC 1-10-1 MOE 993 390030 10278 10289 TTTATAAAACTG 1-10-1
MOE 1074 147085 10329 10340 TCTACACCAGGT 1-10-1 MOE 961 147711
10684 10695 AAGGGCCCTGGG 1-10-1 MOE 1040 147711 10792 10803
AAGGGCCCTGGG 1-10-1 MOE 1040 398128 11333 11346 CTAAATTTAGTTCA
2-10-2 MOE 911 147707 11960 11971 TAGTCATTATCT 1-10-1 MOE 977
147707 11965 11976 TAGTCATTATCT 1-10-1 MOE 977 147090 12013 12024
TTCCCTCTACAC 1-10-1 MOE 955 398096 12146 12159 GGAGAAGCGCAGCT
2-10-2 MOE 1015 398166 12214 12225 GGGCTTCTTCCA 1-10-1 MOE 1070
398135 12308 12321 GACTACATTTTACA 2-10-2 MOE 912 147741 12389 12400
CACCCACTGGTG 1-10-1 MOE 1055 398125 12431 12444 CAGTAAGGAATTTT
2-10-2 MOE 913 147714 12585 12596 TTCTGCTCCCAC 1-10-1 MOE 986
147718 12594 12605 TAATATGACTTG 1-10-1 MOE 998 398125 12612 12625
CAGTAAGGAATTTT 2-10-2 MOE 913 147737 12803 12814 ACAGCCAGGTAG
1-10-1 MOE 1067 147746 12876 12887 TAAAAACAACAA 1-10-1 MOE 1073
147691 12900 12911 GAGGTGGGAAAA 1-10-1 MOE 966 398137 13111 13124
TGTGTCCCTCAGTC 2-10-2 MOE 914 398138 13254 13267 AACATCAAGCTTGA
2-10-2 MOE 931 398137 13292 13305 TGTGTCCCTCAGTC 2-10-2 MOE 914
398138 13435 13448 AACATCAAGCTTGA 2-10-2 MOE 931 389764 14020 14031
CTGCAACATGAT 1-9-2 MOE 1018 389948 14067 14078 CCGTTGGACCCC 1-10-1
MOE 915 389948 14248 14259 CCGTTGGACCCC 1-10-1 MOE 915 147738 14279
14290 TGGGTGGCCGGG 1-10-1 MOE 1069 147698 14572 14583 CCCGCCACCACC
1-10-1 MOE 928 147717 14750 14761 ATCTTCAGAGAT 1-10-1 MOE 996
147717 14932 14943 ATCTTCAGAGAT 1-10-1 MOE 996 398167 15374 15385
CAGGCCATGTGG 1-10-1 MOE 1059 147736 16444 16455 AGGTAGGAGAAG 1-10-1
MOE 963 147746 16510 16521 TAAAAACAACAA 1-10-1 MOE 1073 147738
16590 16601 TGGGTGGCCGGG 1-10-1 MOE 1069 147746 16676 16687
TAAAAACAACAA 1-10-1 MOE 1073 398167 16797 16808 CAGGCCATGTGG 1-10-1
MOE 1059 398144 16911 16924 GACAGCTTCTATAA 2-10-2 MOE 916 389764
17096 17107 CTGCAACATGAT 1-9-2 MOE 1018 147709 17238 17249
CCATTTTTATCA 1-10-1 MOE 978 147709 17406 17417 CCATTTTTATCA 1-10-1
MOE 978 147695 17466 17477 TCATTCCCCACT 1-10-1 MOE 984 147746 17497
17508 TAAAAACAACAA 1-10-1 MOE 1073 147088 17539 17550 CCCTCTACACCA
1-10-1 MOE 1050 147711 17808 17819 AAGGGCCCTGGG 1-10-1 MOE 1040
147711 17976 17987 AAGGGCCCTGGG 1-10-1 MOE 1040 398139 18049 18062
AGTGACTGACCACA 2-10-2 MOE 917 398139 18217 18230 AGTGACTGACCACA
2-10-2 MOE 917 398140 18596 18609 GTAGCATAGAGCCT 2-10-2 MOE 918
398140 18764 18777 GTAGCATAGAGCCT 2-10-2 MOE 918 398167 18927 18938
CAGGCCATGTGG 1-10-1 MOE 1059 398141 18947 18960 CAGATCTTGTCAAG
2-10-2 MOE 919 398167 19095 19106 CAGGCCATGTGG 1-10-1 MOE 1059
398141 19115 19128 CAGATCTTGTCAAG 2-10-2 MOE 919 147746 19207 19218
TAAAAACAACAA 1-10-1 MOE 1073 147711 19508 19519 AAGGGCCCTGGG 1-10-1
MOE 1040 147729 19554 19565 GTAAGAGGCAGG 1-10-1 MOE 920 147718
19617 19628 TAATATGACTTG 1-10-1 MOE 998 390030 19618 19629
TTTATAAAACTG 1-10-1 MOE 1074 147701 19671 19682 CCATGGCGGGAC 1-10-1
MOE 921 147711 19676 19687 AAGGGCCCTGGG 1-10-1 MOE 1040 147718
19785 19796 TAATATGACTTG 1-10-1 MOE 998 147079 20515 20526
TCCTTCCACTGA 1-10-1 MOE 1001 389764 20620 20631 CTGCAACATGAT 1-9-2
MOE 1018 398142 20653 20666 CCAGCACACTGGAA 2-10-2 MOE 923 147078
20682 20693 CCTTCCACTGAT 1-10-1 MOE 1044 147079 20683 20694
TCCTTCCACTGA 1-10-1 MOE 1001 147080 20704 20715 CTCCTTCCACTG 1-10-1
MOE 1021 147081 20705 20716 GCTCCTTCCACT 1-10-1 MOE 1006 389965
20788 20799 CTGCAACATGAT 1-10-1 MOE 1018 147746 20870 20881
TAAAAACAACAA 1-10-1 MOE 1073 147746 21038 21049 TAAAAACAACAA 1-10-1
MOE 1073 147717 21080 21091 ATCTTCAGAGAT 1-10-1 MOE 996 147076
21222 21233 TTCCACTGATCC 1-10-1 MOE 1029 398094 21441 21454
ATCAGCCAGACAGA 2-10-2 MOE 1010 147746 21633 21644 TAAAAACAACAA
1-10-1 MOE 1073 147738 21884 21895 TGGGTGGCCGGG 1-10-1 MOE 1069
147683 21939 21950 GCTTACGATTGT 1-10-1 MOE 922 147743 22213 22224
AGGGCTTCCAGT 1-10-1 MOE 1042 147736 22759 22770 AGGTAGGAGAAG 1-10-1
MOE 963 147736 22927 22938 AGGTAGGAGAAG 1-10-1 MOE 963 398142 23008
23021 CCAGCACACTGGAA 2-10-2 MOE 923 398147 23784 23797
CTACAGGACAATAC 2-10-2 MOE 957 398147 23952 23965 CTACAGGACAATAC
2-10-2 MOE 957 147713 24434 24445 CTCCCACACCAT 1-10-1 MOE 985
389965 24543 24554 CTGCAACATGAT 1-10-1 MOE 1018
147713 24602 24613 CTCCCACACCAT 1-10-1 MOE 985 389965 24711 24722
CTGCAACATGAT 1-10-1 MOE 1018 147746 25384 25395 TAAAAACAACAA 1-10-1
MOE 1073 398143 25505 25518 GTCAGTCCCAGCTA 2-10-2 MOE 924 147691
25610 25621 GAGGTGGGAAAA 1-10-1 MOE 966 398130 25672 25685
TTAGTATGACAGCT 2-10-2 MOE 925 147746 25810 25821 TAAAAACAACAA
1-10-1 MOE 1073 147746 25978 25989 TAAAAACAACAA 1-10-1 MOE 1073
147746 26172 26183 TAAAAACAACAA 1-10-1 MOE 1073 398151 26718 26731
TCAGTGTAGGAAGA 2-10-2 MOE 926 147728 26917 26928 GCCAGACAGAAG
1-10-1 MOE 1013 398152 27708 27721 TGAATATACAGATG 2-10-2 MOE 927
147698 28629 28640 CCCGCCACCACC 1-10-1 MOE 928 389965 28714 28725
CTGCAACATGAT 1-10-1 MOE 1018 389764 28714 28725 CTGCAACATGAT 1-9-2
MOE 1018 389764 28861 28872 CTGCAACATGAT 1-9-2 MOE 1018 390030
29945 29956 TTTATAAAACTG 1-10-1 MOE 1074 147744 30654 30665
AGGAAGGGCTTC 1-10-1 MOE 1043 147093 30836 30847 TTGTTCCCTCTA 1-10-1
MOE 929 147746 30957 30968 TAAAAACAACAA 1-10-1 MOE 1073 147746
31105 31116 TAAAAACAACAA 1-10-1 MOE 1073 390030 31477 31488
TTTATAAAACTG 1-10-1 MOE 1074 384545 31829 31840 CAAGTAGGATGT 1-10-1
MOE 951 384545 31977 31988 CAAGTAGGATGT 1-10-1 MOE 951 401382 32094
32107 TCTACCTGAGTCCA 2-10-2 MOE 930 147089 32387 32398 TCCCTCTACACC
1-10-1 MOE 956 389950 32949 32960 CCCTGAAGGTTC 1-10-1 MOE 1063
398165 33002 33013 GTTCTTAGGAAG 1-10-1 MOE 968 147081 33073 33084
GCTCCTTCCACT 1-10-1 MOE 1006 147082 33074 33085 AGCTCCTTCCAC 1-10-1
MOE 1036 389950 33097 33108 CCCTGAAGGTTC 1-10-1 MOE 1063 147736
33160 33171 AGGTAGGAGAAG 1-10-1 MOE 963 147081 33221 33232
GCTCCTTCCACT 1-10-1 MOE 1006 368360 33221 33234 AAGCTCCTTCCACT
2-10-2 MOE 1035 147082 33222 33233 AGCTCCTTCCAC 1-10-1 MOE 1036
398138 33244 33257 AACATCAAGCTTGA 2-10-2 MOE 931 147746 33250 33261
TAAAAACAACAA 1-10-1 MOE 1073 398138 33392 33405 AACATCAAGCTTGA
2-10-2 MOE 931 401383 33588 33601 GATCACCTTCAGAG 2-10-2 MOE 932
147746 33886 33897 TAAAAACAACAA 1-10-1 MOE 1073 147746 34606 34617
TAAAAACAACAA 1-10-1 MOE 1073 398165 34704 34715 GTTCTTAGGAAG 1-10-1
MOE 968 147717 34745 34756 ATCTTCAGAGAT 1-10-1 MOE 996 147746 34754
34765 TAAAAACAACAA 1-10-1 MOE 1073 398165 34852 34863 GTTCTTAGGAAG
1-10-1 MOE 968 147717 34893 34904 ATCTTCAGAGAT 1-10-1 MOE 996
401384 34905 34918 TGAACACATCACTA 2-10-2 MOE 933 147738 35391 35402
TGGGTGGCCGGG 1-10-1 MOE 1069 147736 35396 35407 AGGTAGGAGAAG 1-10-1
MOE 963 147738 35539 35550 TGGGTGGCCGGG 1-10-1 MOE 1069 147691
35554 35565 GAGGTGGGAAAA 1-10-1 MOE 966 147691 35702 35713
GAGGTGGGAAAA 1-10-1 MOE 966 147746 35814 35825 TAAAAACAACAA 1-10-1
MOE 1073 401385 36109 36122 CCCAGTGGGTTTGA 2-10-2 MOE 890 147691
36360 36371 GAGGTGGGAAAA 1-10-1 MOE 966 147746 36416 36427
TAAAAACAACAA 1-10-1 MOE 1073 147731 36620 36631 TTTCCTCTTGTC 1-10-1
MOE 934 147714 37881 37892 TTCTGCTCCCAC 1-10-1 MOE 986 147714 38029
38040 TTCTGCTCCCAC 1-10-1 MOE 986 147681 38512 38523 ATGTCATTAAAC
1-10-1 MOE 965 401386 38516 38529 TAATTGATGTCAAT 2-10-2 MOE 935
401387 38518 38531 AGTAATTGATGTCA 2-10-2 MOE 936 401388 38520 38533
ACAGTAATTGATGT 2-10-2 MOE 937 401389 38522 38535 TTACAGTAATTGAT
2-10-2 MOE 938 401390 38524 38537 ACTTACAGTAATTG 2-10-2 MOE 939
401391 38526 38539 AGACTTACAGTAAT 2-10-2 MOE 940 401392 38528 38541
TCAGACTTACAGTA 2-10-2 MOE 941 401393 38530 38543 AATCAGACTTACAG
2-10-2 MOE 942 401394 38532 38545 TGAATCAGACTTAC 2-10-2 MOE 943
401395 38534 38547 AATGAATCAGACTT 2-10-2 MOE 944 147738 38909 38920
TGGGTGGCCGGG 1-10-1 MOE 1069 147738 39057 39068 TGGGTGGCCGGG 1-10-1
MOE 1069 390030 39249 39260 TTTATAAAACTG 1-10-1 MOE 1074 390030
39397 39408 TTTATAAAACTG 1-10-1 MOE 1074 401396 39488 39501
TGCAGGATGTTGAG 2-10-2 MOE 945 147717 39545 39556 ATCTTCAGAGAT
1-10-1 MOE 996 147746 39641 39652 TAAAAACAACAA 1-10-1 MOE 1073
147717 39693 39704 ATCTTCAGAGAT 1-10-1 MOE 996 147746 39729 39740
TAAAAACAACAA 1-10-1 MOE 1073 147746 39877 39888 TAAAAACAACAA 1-10-1
MOE 1073 147746 40185 40196 TAAAAACAACAA 1-10-1 MOE 1073 147746
40478 40489 TAAAAACAACAA 1-10-1 MOE 1073 398166 40589 40600
GGGCTTCTTCCA 1-10-1 MOE 1070 147735 40662 40673 GGAGAAGCGCAG 1-10-1
MOE 1016 147746 40706 40717 TAAAAACAACAA 1-10-1 MOE 1073 398166
40737 40748 GGGCTTCTTCCA 1-10-1 MOE 1070 147746 40854 40865
TAAAAACAACAA 1-10-1 MOE 1073 401397 41012 41025 CTGGTCAGCATTGA
2-10-2 MOE 946 147718 41070 41081 TAATATGACTTG 1-10-1 MOE 998
147718 41218 41229 TAATATGACTTG 1-10-1 MOE 998 147717 41221 41232
ATCTTCAGAGAT 1-10-1 MOE 996 147717 41369 41380 ATCTTCAGAGAT 1-10-1
MOE 996 147717 41599 41610 ATCTTCAGAGAT 1-10-1 MOE 996 147717 41747
41758 ATCTTCAGAGAT 1-10-1 MOE 996 401398 41768 41781 CAAAGTCCCTTAGC
2-10-2 MOE 947 390030 42056 42067 TTTATAAAACTG 1-10-1 MOE 1074
398153 42157 42170 ATTTCTCTTACAGG 2-10-2 MOE 948 398153 42305 42318
ATTTCTCTTACAGG 2-10-2 MOE 948 147710 42691 42702 TATAGCTCCTCT
1-10-1 MOE 994 147079 43322 43333 TCCTTCCACTGA 1-10-1 MOE 1001
147080 43323 43334 CTCCTTCCACTG 1-10-1 MOE 1021 147716 43477 43488
TTAACGAGCCTT 1-10-1 MOE 949 147746 43992 44003 TAAAAACAACAA 1-10-1
MOE 1073 147736 44137 44148 AGGTAGGAGAAG 1-10-1 MOE 963 384545
44242 44253 CAAGTAGGATGT 1-10-1 MOE 951 147687 44354 44365
CGACACGGGAAC 1-10-1 MOE 950 384545 44390 44401 CAAGTAGGATGT 1-10-1
MOE 951 398110 44713 44726 GTTCCCTTTGCAGG 2-10-2 MOE 952 147705
45092 45103 CGGTTTTTGTTC 1-10-1 MOE 1002 147705 45240 45251
CGGTTTTTGTTC 1-10-1 MOE 1002 147074 45977 45988 CCACTGATCCTG 1-10-1
MOE 845 147075 45978 45989 TCCACTGATCCT 1-10-1 MOE 1026 147076
45979 45990 TTCCACTGATCC 1-10-1 MOE 1029 147076 46127 46138
TTCCACTGATCC 1-10-1 MOE 1029 401399 46247 46260 ATTAGCCATATCTC
2-10-2 MOE 953 147705 46555 46566 CGGTTTTTGTTC 1-10-1 MOE 1002
147714 46685 46696 TTCTGCTCCCAC 1-10-1 MOE 986 147705 46703 46714
CGGTTTTTGTTC 1-10-1 MOE 1002 390030 46859 46870 TTTATAAAACTG 1-10-1
MOE 1074 390030 46933 46944 TTTATAAAACTG 1-10-1 MOE 1074 147681
46984 46995 ATGTCATTAAAC 1-10-1 MOE 965 390030 47007 47018
TTTATAAAACTG 1-10-1 MOE 1074 147746 47023 47034 TAAAAACAACAA 1-10-1
MOE 1073 390030 47081 47092 TTTATAAAACTG 1-10-1 MOE 1074 147681
47132 47143 ATGTCATTAAAC 1-10-1 MOE 965 147746 47171 47182
TAAAAACAACAA 1-10-1 MOE 1073
401400 47411 47424 AGCATTCAGCAGTG 2-10-2 MOE 954 147746 47461 47472
TAAAAACAACAA 1-10-1 MOE 1073 147086 47608 47619 CTCTACACCAGG 1-10-1
MOE 969 147087 47609 47620 CCTCTACACCAG 1-10-1 MOE 982 147088 47610
47621 CCCTCTACACCA 1-10-1 MOE 1050 147090 47612 47623 TTCCCTCTACAC
1-10-1 MOE 955 147691 47729 47740 GAGGTGGGAAAA 1-10-1 MOE 966
147086 47756 47767 CTCTACACCAGG 1-10-1 MOE 969 147088 47758 47769
CCCTCTACACCA 1-10-1 MOE 1050 147089 47759 47770 TCCCTCTACACC 1-10-1
MOE 956 390030 47847 47858 TTTATAAAACTG 1-10-1 MOE 1074 390030
47995 48006 TTTATAAAACTG 1-10-1 MOE 1074 147691 48393 48404
GAGGTGGGAAAA 1-10-1 MOE 966 398147 48887 48900 CTACAGGACAATAC
2-10-2 MOE 957 147706 49133 49144 GCTGACATCTCG 1-10-1 MOE 1071
147706 49281 49292 GCTGACATCTCG 1-10-1 MOE 1071 398168 49742 49753
TCGGACTTTGAA 1-10-1 MOE 1008 401401 49791 49804 AACTGGGTTAAGTA
2-10-2 MOE 958 147689 49936 49947 CAGAGAAGGTCT 1-10-1 MOE 987
401402 50192 50205 TGAACACGCTATCC 2-10-2 MOE 959 398117 50241 50254
TTTCCACTTGGGTG 2-10-2 MOE 960 147736 50582 50593 AGGTAGGAGAAG
1-10-1 MOE 963 398168 50703 50714 TCGGACTTTGAA 1-10-1 MOE 1008
398168 50849 50860 TCGGACTTTGAA 1-10-1 MOE 1008 147746 51019 51030
TAAAAACAACAA 1-10-1 MOE 1073 147708 51101 51112 TTGATATAGTCA 1-10-1
MOE 997 147746 51178 51189 TAAAAACAACAA 1-10-1 MOE 1073 147708
51247 51258 TTGATATAGTCA 1-10-1 MOE 997 147083 51281 51292
TACACCAGGTCA 1-10-1 MOE 973 147081 51287 51298 GCTCCTTCCACT 1-10-1
MOE 1006 147082 51288 51299 AGCTCCTTCCAC 1-10-1 MOE 1036 147746
51331 51342 TAAAAACAACAA 1-10-1 MOE 1073 147085 51416 51427
TCTACACCAGGT 1-10-1 MOE 961 147083 51427 51438 TACACCAGGTCA 1-10-1
MOE 973 147081 51433 51444 GCTCCTTCCACT 1-10-1 MOE 1006 147082
51434 51445 AGCTCCTTCCAC 1-10-1 MOE 1036 147728 51522 51533
GCCAGACAGAAG 1-10-1 MOE 1013 147085 51562 51573 TCTACACCAGGT 1-10-1
MOE 961 147081 51633 51644 GCTCCTTCCACT 1-10-1 MOE 1006 368360
51633 51646 AAGCTCCTTCCACT 2-10-2 MOE 1035 147082 51634 51645
AGCTCCTTCCAC 1-10-1 MOE 1036 368361 51635 51648 GAAAGCTCCTTCCA
2-10-2 MOE 962 368360 51779 51792 AAGCTCCTTCCACT 2-10-2 MOE 1035
147082 51780 51791 AGCTCCTTCCAC 1-10-1 MOE 1036 147736 51859 51870
AGGTAGGAGAAG 1-10-1 MOE 963 147684 51867 51878 ACCCAGTCAGGG 1-10-1
MOE 964 147746 51918 51929 TAAAAACAACAA 1-10-1 MOE 1073 147077
51988 51999 CTTCCACTGATC 1-10-1 MOE 1047 147746 52064 52075
TAAAAACAACAA 1-10-1 MOE 1073 147084 52125 52136 CTACACCAGGTC 1-10-1
MOE 993 147079 52136 52147 TCCTTCCACTGA 1-10-1 MOE 1001 147681
52231 52242 ATGTCATTAAAC 1-10-1 MOE 965 147084 52271 52282
CTACACCAGGTC 1-10-1 MOE 993 147691 52312 52323 GAGGTGGGAAAA 1-10-1
MOE 966 401403 52318 52331 TTTCCTAGGAGGTG 2-10-2 MOE 967 398167
52527 52538 CAGGCCATGTGG 1-10-1 MOE 1059 147703 52670 52681
TGGCTTCATGTC 1-10-1 MOE 971 398167 52673 52684 CAGGCCATGTGG 1-10-1
MOE 1059 398165 52708 52719 GTTCTTAGGAAG 1-10-1 MOE 968 398090
52708 52721 TTGTTCTTAGGAAG 2-10-2 MOE 972 147705 52716 52727
CGGTTTTTGTTC 1-10-1 MOE 1002 147682 52717 52728 CGGGTACTATGG 1-10-1
MOE 992 398167 52762 52773 CAGGCCATGTGG 1-10-1 MOE 1059 147703
52816 52827 TGGCTTCATGTC 1-10-1 MOE 971 398090 52854 52867
TTGTTCTTAGGAAG 2-10-2 MOE 972 147704 52856 52867 TTGTTCTTAGGA
1-10-1 MOE 1012 147705 52862 52873 CGGTTTTTGTTC 1-10-1 MOE 1002
398167 52908 52919 CAGGCCATGTGG 1-10-1 MOE 1059 147084 53704 53715
CTACACCAGGTC 1-10-1 MOE 993 147088 53708 53719 CCCTCTACACCA 1-10-1
MOE 1050 147083 53849 53860 TACACCAGGTCA 1-10-1 MOE 973 147084
53850 53861 CTACACCAGGTC 1-10-1 MOE 993 147086 53852 53863
CTCTACACCAGG 1-10-1 MOE 969 147088 53854 53865 CCCTCTACACCA 1-10-1
MOE 1050 398167 53870 53881 CAGGCCATGTGG 1-10-1 MOE 1059 147703
54137 54148 TGGCTTCATGTC 1-10-1 MOE 971 398155 54172 54185
TGTTTTTACACAGA 2-10-2 MOE 970 390030 54263 54274 TTTATAAAACTG
1-10-1 MOE 1074 147705 54275 54286 CGGTTTTTGTTC 1-10-1 MOE 1002
147703 54283 54294 TGGCTTCATGTC 1-10-1 MOE 971 390030 54409 54420
TTTATAAAACTG 1-10-1 MOE 1074 147704 54965 54976 TTGTTCTTAGGA 1-10-1
MOE 1012 147705 54971 54982 CGGTTTTTGTTC 1-10-1 MOE 1002 398090
55109 55122 TTGTTCTTAGGAAG 2-10-2 MOE 972 147705 55117 55128
CGGTTTTTGTTC 1-10-1 MOE 1002 147083 55206 55217 TACACCAGGTCA 1-10-1
MOE 973 147084 55207 55218 CTACACCAGGTC 1-10-1 MOE 993 147084 55353
55364 CTACACCAGGTC 1-10-1 MOE 993 147705 55524 55535 CGGTTTTTGTTC
1-10-1 MOE 1002 147685 55602 55613 GGCTGACATTCA 1-10-1 MOE 975
401404 55638 55651 TGAGCTACAGTAGG 2-10-2 MOE 974 147685 55748 55759
GGCTGACATTCA 1-10-1 MOE 975 147712 55819 55830 ACACCATCTCCC 1-10-1
MOE 1005 147712 55965 55976 ACACCATCTCCC 1-10-1 MOE 1005 147707
56300 56311 TAGTCATTATCT 1-10-1 MOE 977 147708 56306 56317
TTGATATAGTCA 1-10-1 MOE 997 390030 56321 56332 TTTATAAAACTG 1-10-1
MOE 1074 147709 56326 56337 CCATTTTTATCA 1-10-1 MOE 978 398091
56333 56346 GGGCTTCTTCCATT 2-10-2 MOE 979 401405 56408 56421
TGGTCAACTGAAAG 2-10-2 MOE 976 147707 56446 56457 TAGTCATTATCT
1-10-1 MOE 977 147708 56452 56463 TTGATATAGTCA 1-10-1 MOE 997
147709 56472 56483 CCATTTTTATCA 1-10-1 MOE 978 398091 56479 56492
GGGCTTCTTCCATT 2-10-2 MOE 979 401406 56570 56583 GGTGTGGATAACAG
2-10-2 MOE 980 368366 56664 56677 CTGATCCTTAGAAG 2-10-2 MOE 1019
398148 57157 57170 TCATAACTATTAAG 2-10-2 MOE 981 147082 57220 57231
AGCTCCTTCCAC 1-10-1 MOE 1036 398148 57303 57316 TCATAACTATTAAG
2-10-2 MOE 981 147082 57366 57377 AGCTCCTTCCAC 1-10-1 MOE 1036
147743 57758 57769 AGGGCTTCCAGT 1-10-1 MOE 1042 398093 57963 57976
TCGGACTTTGAAAA 2-10-2 MOE 1009 398093 58109 58122 TCGGACTTTGAAAA
2-10-2 MOE 1009 147735 58279 58290 GGAGAAGCGCAG 1-10-1 MOE 1016
147087 58821 58832 CCTCTACACCAG 1-10-1 MOE 982 147087 58967 58978
CCTCTACACCAG 1-10-1 MOE 982 390030 59180 59191 TTTATAAAACTG 1-10-1
MOE 1074 390030 59326 59337 TTTATAAAACTG 1-10-1 MOE 1074 147711
59357 59368 AAGGGCCCTGGG 1-10-1 MOE 1040 147743 59382 59393
AGGGCTTCCAGT 1-10-1 MOE 1042 147711 59503 59514 AAGGGCCCTGGG 1-10-1
MOE 1040 147711 59675 59686 AAGGGCCCTGGG 1-10-1 MOE 1040 401407
59710 59723 CAGCTTAGGCAGAG 2-10-2 MOE 983 147712 59711 59722
ACACCATCTCCC 1-10-1 MOE 1005 147713 59716 59727 CTCCCACACCAT 1-10-1
MOE 985
147714 59721 59732 TTCTGCTCCCAC 1-10-1 MOE 986 147695 59722 59733
TCATTCCCCACT 1-10-1 MOE 984 147715 59746 59757 GTTGAGCATGAC 1-10-1
MOE 1077 147711 59821 59832 AAGGGCCCTGGG 1-10-1 MOE 1040 390030
59847 59858 TTTATAAAACTG 1-10-1 MOE 1074 147712 59857 59868
ACACCATCTCCC 1-10-1 MOE 1005 147713 59862 59873 CTCCCACACCAT 1-10-1
MOE 985 147714 59867 59878 TTCTGCTCCCAC 1-10-1 MOE 986 390030 59993
60004 TTTATAAAACTG 1-10-1 MOE 1074 389949 60471 60482 GCGCGAGCCCGA
1-10-1 MOE 1061 147746 60619 60630 TAAAAACAACAA 1-10-1 MOE 1073
147689 61113 61124 CAGAGAAGGTCT 1-10-1 MOE 987 398105 61267 61280
TGCACAGGCAGGTT 2-10-2 MOE 1066 147680 61473 61484 GTATGCACTGCT
1-10-1 MOE 988 147080 61757 61768 CTCCTTCCACTG 1-10-1 MOE 1021
147078 61901 61912 CCTTCCACTGAT 1-10-1 MOE 1044 147079 61902 61913
TCCTTCCACTGA 1-10-1 MOE 1001 147088 62215 62226 CCCTCTACACCA 1-10-1
MOE 1050 401408 62600 62613 CAATGAAGCACAGG 2-10-2 MOE 989 147688
62843 62854 TCCCAAACAAAT 1-10-1 MOE 990 147746 63102 63113
TAAAAACAACAA 1-10-1 MOE 1073 147746 63248 63259 TAAAAACAACAA 1-10-1
MOE 1073 401409 63430 63443 ATTCTTAACACAGA 2-10-2 MOE 991 147682
63483 63494 CGGGTACTATGG 1-10-1 MOE 992 147084 63677 63688
CTACACCAGGTC 1-10-1 MOE 993 147710 64847 64858 TATAGCTCCTCT 1-10-1
MOE 994 147710 64993 65004 TATAGCTCCTCT 1-10-1 MOE 994 147746 65151
65162 TAAAAACAACAA 1-10-1 MOE 1073 401410 65263 65276
CATTTAGGGTCTAA 2-10-2 MOE 995 147717 65862 65873 ATCTTCAGAGAT
1-10-1 MOE 996 147717 65895 65906 ATCTTCAGAGAT 1-10-1 MOE 996
147708 65900 65911 TTGATATAGTCA 1-10-1 MOE 997 147718 65909 65920
TAATATGACTTG 1-10-1 MOE 998 147717 66008 66019 ATCTTCAGAGAT 1-10-1
MOE 996 147717 66041 66052 ATCTTCAGAGAT 1-10-1 MOE 996 147708 66046
66057 TTGATATAGTCA 1-10-1 MOE 997 147718 66055 66066 TAATATGACTTG
1-10-1 MOE 998 401411 66123 66136 AGCCGCCTGAAGTG 2-10-2 MOE 999
147697 66497 66508 CCCCAGCAGCGG 1-10-1 MOE 1000 368377 66562 66577
CTCCTTCCACTGATCC 3-10-3 MOE 1030 147077 66563 66574 CTTCCACTGATC
1-10-1 MOE 1047 368358 66563 66576 TCCTTCCACTGATC 2-10-2 MOE 1031
147078 66564 66575 CCTTCCACTGAT 1-10-1 MOE 1044 147079 66565 66576
TCCTTCCACTGA 1-10-1 MOE 1001 147080 66566 66577 CTCCTTCCACTG 1-10-1
MOE 1021 147697 66643 66654 CCCCAGCAGCGG 1-10-1 MOE 1000 368358
66709 66722 TCCTTCCACTGATC 2-10-2 MOE 1031 147078 66710 66721
CCTTCCACTGAT 1-10-1 MOE 1044 147079 66711 66722 TCCTTCCACTGA 1-10-1
MOE 1001 147075 66999 67010 TCCACTGATCCT 1-10-1 MOE 1026 147705
67067 67078 CGGTTTTTGTTC 1-10-1 MOE 1002 147088 67409 67420
CCCTCTACACCA 1-10-1 MOE 1050 147080 67430 67441 CTCCTTCCACTG 1-10-1
MOE 1021 147082 67432 67443 AGCTCCTTCCAC 1-10-1 MOE 1036 147737
67455 67466 ACAGCCAGGTAG 1-10-1 MOE 1067 147088 67555 67566
CCCTCTACACCA 1-10-1 MOE 1050 147082 67578 67589 AGCTCCTTCCAC 1-10-1
MOE 1036 401412 67637 67650 TAAATCCTCTAGCA 2-10-2 MOE 1003 147091
67729 67740 GTTCCCTCTACA 1-10-1 MOE 1004 147742 67737 67748
AACTTCAGTGTC 1-10-1 MOE 1041 147712 68527 68538 ACACCATCTCCC 1-10-1
MOE 1005 147712 68673 68684 ACACCATCTCCC 1-10-1 MOE 1005 147711
68760 68771 AAGGGCCCTGGG 1-10-1 MOE 1040 147711 68906 68917
AAGGGCCCTGGG 1-10-1 MOE 1040 389965 69271 69282 CTGCAACATGAT 1-10-1
MOE 1018 389965 69417 69428 CTGCAACATGAT 1-10-1 MOE 1018 368353
69519 69532 CACTGATCCTGCAC 2-10-2 MOE 1007 147080 69630 69641
CTCCTTCCACTG 1-10-1 MOE 1021 147081 69631 69642 GCTCCTTCCACT 1-10-1
MOE 1006 368353 69665 69678 CACTGATCCTGCAC 2-10-2 MOE 1007 398167
69757 69768 CAGGCCATGTGG 1-10-1 MOE 1059 398092 69758 69771
AGTCAGGCCATGTG 2-10-2 MOE 1060 398093 69811 69824 TCGGACTTTGAAAA
2-10-2 MOE 1009 398168 69813 69824 TCGGACTTTGAA 1-10-1 MOE 1008
398167 69903 69914 CAGGCCATGTGG 1-10-1 MOE 1059 398093 69957 69970
TCGGACTTTGAAAA 2-10-2 MOE 1009 398094 70047 70060 ATCAGCCAGACAGA
2-10-2 MOE 1010 398095 70065 70078 CATCAGCAAGAGGC 2-10-2 MOE 1011
147704 70137 70148 TTGTTCTTAGGA 1-10-1 MOE 1012 147728 70450 70461
GCCAGACAGAAG 1-10-1 MOE 1013 398164 70464 70475 TTGTCGATCTGC 1-10-1
MOE 1014 398096 70562 70575 GGAGAAGCGCAGCT 2-10-2 MOE 1015 147735
70564 70575 GGAGAAGCGCAG 1-10-1 MOE 1016 147737 70575 70586
ACAGCCAGGTAG 1-10-1 MOE 1067 147735 70710 70721 GGAGAAGCGCAG 1-10-1
MOE 1016 147737 70721 70732 ACAGCCAGGTAG 1-10-1 MOE 1067 404131
70729 70742 ACCTTCGATCACAG 2-10-2 MOE 831 368349 70762 70775
CTGCACTGACGAGT 2-10-2 MOE 1017 389965 70930 70941 CTGCAACATGAT
1-10-1 MOE 1018 368366 70995 71008 CTGATCCTTAGAAG 2-10-2 MOE 1019
368354 70999 71012 TCCACTGATCCTGC 2-10-2 MOE 1024 368375 71000
71015 CCTTCCACTGATCCTG 3-10-3 MOE 1020 368356 71001 71014
CTTCCACTGATCCT 2-10-2 MOE 1027 368376 71001 71016 TCCTTCCACTGATCCT
3-10-3 MOE 1028 368357 71002 71015 CCTTCCACTGATCC 2-10-2 MOE 1046
368377 71002 71017 CTCCTTCCACTGATCC 3-10-3 MOE 1030 147077 71003
71014 CTTCCACTGATC 1-10-1 MOE 1047 368358 71003 71016
TCCTTCCACTGATC 2-10-2 MOE 1031 368378 71003 71018 GCTCCTTCCACTGATC
3-10-3 MOE 1032 147078 71004 71015 CCTTCCACTGAT 1-10-1 MOE 1044
368359 71005 71018 GCTCCTTCCACTGA 2-10-2 MOE 1033 368379 71005
71020 AAGCTCCTTCCACTGA 3-10-3 MOE 1034 147080 71006 71017
CTCCTTCCACTG 1-10-1 MOE 1021 147082 71008 71019 AGCTCCTTCCAC 1-10-1
MOE 1036 401413 71019 71032 TGCAGCCATGTACT 2-10-2 MOE 1022 147738
71067 71078 TGGGTGGCCGGG 1-10-1 MOE 1069 147739 71071 71082
CGTTTGGGTGGC 1-10-1 MOE 1023 147741 71129 71140 CACCCACTGGTG 1-10-1
MOE 1055 368354 71145 71158 TCCACTGATCCTGC 2-10-2 MOE 1024 368355
71146 71159 TTCCACTGATCCTG 2-10-2 MOE 1025 147075 71147 71158
TCCACTGATCCT 1-10-1 MOE 1026 368356 71147 71160 CTTCCACTGATCCT
2-10-2 MOE 1027 368376 71147 71162 TCCTTCCACTGATCCT 3-10-3 MOE 1028
147076 71148 71159 TTCCACTGATCC 1-10-1 MOE 1029 368357 71148 71161
CCTTCCACTGATCC 2-10-2 MOE 1046 368377 71148 71163 CTCCTTCCACTGATCC
3-10-3 MOE 1030 147077 71149 71160 CTTCCACTGATC 1-10-1 MOE 1047
368358 71149 71162 TCCTTCCACTGATC 2-10-2 MOE 1031 368378 71149
71164 GCTCCTTCCACTGATC 3-10-3 MOE 1032 147078 71150 71161
CCTTCCACTGAT 1-10-1 MOE 1044 368359 71151 71164 GCTCCTTCCACTGA
2-10-2 MOE 1033 368379 71151 71166 AAGCTCCTTCCACTGA 3-10-3 MOE 1034
368360 71153 71166 AAGCTCCTTCCACT 2-10-2 MOE 1035 147082 71154
71165 AGCTCCTTCCAC 1-10-1 MOE 1036 368381 71155 71170
GGGAAAGCTCCTTCCA 3-10-3 MOE 1037 390030 71986 71997 TTTATAAAACTG
1-10-1 MOE 1074
390030 72132 72143 TTTATAAAACTG 1-10-1 MOE 1074 147711 72300 72311
AAGGGCCCTGGG 1-10-1 MOE 1040 401414 72347 72360 TTGCAATGTCTGGC
2-10-2 MOE 1038 147741 72400 72411 CACCCACTGGTG 1-10-1 MOE 1055
401415 72415 72428 GATTTATCTGGCTG 2-10-2 MOE 1039 147711 72446
72457 AAGGGCCCTGGG 1-10-1 MOE 1040 147742 72575 72586 AACTTCAGTGTC
1-10-1 MOE 1041 147743 72690 72701 AGGGCTTCCAGT 1-10-1 MOE 1042
147744 72694 72705 AGGAAGGGCTTC 1-10-1 MOE 1043 147745 72700 72711
TTGACCAGGAAG 1-10-1 MOE 1058 147742 72721 72732 AACTTCAGTGTC 1-10-1
MOE 1041 147743 72836 72847 AGGGCTTCCAGT 1-10-1 MOE 1042 147744
72840 72851 AGGAAGGGCTTC 1-10-1 MOE 1043 368357 72898 72911
CCTTCCACTGATCC 2-10-2 MOE 1046 147078 72900 72911 CCTTCCACTGAT
1-10-1 MOE 1044 398157 72903 72916 GGAAACATACCCTG 2-10-2 MOE 1045
368357 73044 73057 CCTTCCACTGATCC 2-10-2 MOE 1046 147077 73045
73056 CTTCCACTGATC 1-10-1 MOE 1047 147746 73052 73063 TAAAAACAACAA
1-10-1 MOE 1073 147746 73101 73112 TAAAAACAACAA 1-10-1 MOE 1073
398160 73139 73152 GAATAGGTTAAGGC 2-10-2 MOE 1048 147746 73198
73209 TAAAAACAACAA 1-10-1 MOE 1073 398161 73238 73251
AACAATGTGTTGTA 2-10-2 MOE 1049 147088 73419 73430 CCCTCTACACCA
1-10-1 MOE 1050 404140 73457 73470 GCACACAGCTGAGG 2-10-2 MOE 1051
404139 73459 73472 GTGCACACAGCTGA 2-10-2 MOE 1052 399301 73461
73474 GTGTGCACACAGCT 2-10-2 MOE 1542 404137 73463 73476
CAGTGTGCACACAG 2-10-2 MOE 1053 404138 73465 73478 CTCAGTGTGCACAC
2-10-2 MOE 1054 147741 73705 73716 CACCCACTGGTG 1-10-1 MOE 1055
404135 73858 73871 CATTTCCATGGCCA 2-10-2 MOE 1056 398167 74008
74019 CAGGCCATGTGG 1-10-1 MOE 1059 398092 74009 74022
AGTCAGGCCATGTG 2-10-2 MOE 1060 398162 74114 74127 ACCAAACAGTTCAG
2-10-2 MOE 1057 147745 74137 74148 TTGACCAGGAAG 1-10-1 MOE 1058
398167 74154 74165 CAGGCCATGTGG 1-10-1 MOE 1059 398092 74155 74168
AGTCAGGCCATGTG 2-10-2 MOE 1060 389949 74310 74321 GCGCGAGCCCGA
1-10-1 MOE 1061 147740 74485 74496 TGTGAGGCTCCA 1-10-1 MOE 1062
389950 74527 74538 CCCTGAAGGTTC 1-10-1 MOE 1063 398101 74656 74669
TTTGATAAAGCCCT 2-10-2 MOE 1064 398104 74805 74818 CAAGAAGACCTTAC
2-10-2 MOE 1065 147737 74893 74904 ACAGCCAGGTAG 1-10-1 MOE 1067
398105 74894 74907 TGCACAGGCAGGTT 2-10-2 MOE 1066 147737 74919
74930 ACAGCCAGGTAG 1-10-1 MOE 1067 398106 74974 74987
TGGAAAACTGCACC 2-10-2 MOE 1068 404199 75045 75058 GGTCATGCACAGGC
2-10-2 MOE 867 404134 75048 75061 TCAGGTCATGCACA 2-10-2 MOE 873
398106 75120 75133 TGGAAAACTGCACC 2-10-2 MOE 1068 147738 75155
75166 TGGGTGGCCGGG 1-10-1 MOE 1069 404132 75227 75240
CCTTGGAATGTCTG 2-10-2 MOE 852 147738 75301 75312 TGGGTGGCCGGG
1-10-1 MOE 1069 398166 75499 75510 GGGCTTCTTCCA 1-10-1 MOE 1070
147746 75617 75628 TAAAAACAACAA 1-10-1 MOE 1073 147706 75686 75697
GCTGACATCTCG 1-10-1 MOE 1071 398112 75730 75743 CAGCCTGGCACCTA
2-10-2 MOE 1072 147746 75763 75774 TAAAAACAACAA 1-10-1 MOE 1073
398115 75786 75799 AGTAAATATTGGCT 2-10-2 MOE 1076 390030 75839
75850 TTTATAAAACTG 1-10-1 MOE 1074 398114 75916 75929
AGGCATATAGCAGA 2-10-2 MOE 1075 398115 75932 75945 AGTAAATATTGGCT
2-10-2 MOE 1076 404133 75968 75981 TATTCCATGGCCAT 2-10-2 MOE 872
147715 77045 77056 GTTGAGCATGAC 1-10-1 MOE 1077 147715 77190 77201
GTTGAGCATGAC 1-10-1 MOE 1077 147693 77385 77396 GTGCGCTCCCAT 1-10-1
MOE 1078 398173 40201 40212 CAGCCTGGGCAC 1-10-1 MOE 1543 398173
72764 72775 CAGCCTGGGCAC 1-10-1 MOE 1543 399096 1986 1999
TGCTCGAACTCCTT 2-10-2 MOE 1544 399102 52822 52835 GAAGTCACTGGCTT
2-10-2 MOE 1545 399103 52824 52837 GGGAAGTCACTGGC 2-10-2 MOE 1546
399113 59827 59840 GTTAGGCAAAGGGC 2-10-2 MOE 1547 399132 69977
69990 GGGCTGAGTGACCC 2-10-2 MOE 1548 399173 74592 74605
ATGCTAGTGCACTA 2-10-2 MOE 1549 399208 75900 75913 AGCTCGCTACCTCT
2-10-2 MOE 1550 399276 27559 27572 GAGGTATCCCATCT 2-10-2 MOE 1551
399315 74039 74052 GGCAACTTCAACCT 2-10-2 MOE 1552
TABLE-US-00022 TABLE 19 Short antisense compounds targeted to SEQ
ID NO: 12 and having 1 or 2 mismatches Seq ISIS 5' Target 3' Target
Gapmer ID NO. Site Site Sequence (5'-3') Motif NO 398163 20 31
ATGTCAACCGGC 1-10-1 MOE 908 384545 23 34 CAAGTAGGATGT 1-10-1 MOE
951 147733 26 37 TTCTTGATGTCC 1-10-1 MOE 891 147721 59 70
AATGCAGGATCT 1-10-1 MOE 1118 147700 110 121 GCGCTAGGCCGC 1-10-1 MOE
1110 384545 130 141 CAAGTAGGATGT 1-10-1 MOE 951 147705 159 170
CGGTTTTTGTTC 1-10-1 MOE 1002 147701 167 178 CCATGGCGGGAC 1-10-1 MOE
921 398164 198 209 TTGTCGATCTGC 1-10-1 MOE 1014 147730 199 210
CTTGTCCATCAG 1-10-1 MOE 1121 147702 226 237 CTGGTAAATAGC 1-10-1 MOE
898 147703 245 256 TGGCTTCATGTC 1-10-1 MOE 971 147705 266 277
CGGTTTTTGTTC 1-10-1 MOE 1002 398165 283 294 GTTCTTAGGAAG 1-10-1 MOE
968 147704 285 296 TTGTTCTTAGGA 1-10-1 MOE 1012 147705 291 302
CGGTTTTTGTTC 1-10-1 MOE 1002 147709 311 322 CCATTTTTATCA 1-10-1 MOE
978 147733 349 360 TTCTTGATGTCC 1-10-1 MOE 891 147707 360 371
TAGTCATTATCT 1-10-1 MOE 977 147708 366 377 TTGATATAGTCA 1-10-1 MOE
997 390030 381 392 TTTATAAAACTG 1-10-1 MOE 1074 147709 386 397
CCATTTTTATCA 1-10-1 MOE 978 147081 393 404 GCTCCTTCCACT 1-10-1 MOE
1006 398091 393 406 GGGCTTCTTCCATT 2-10-2 MOE 979 398166 395 406
GGGCTTCTTCCA 1-10-1 MOE 1070 147712 461 472 ACACCATCTCCC 1-10-1 MOE
1005 147713 466 477 CTCCCACACCAT 1-10-1 MOE 985 147714 471 482
TTCTGCTCCCAC 1-10-1 MOE 986 147710 502 513 TATAGCTCCTCT 1-10-1 MOE
994 147736 551 562 AGGTAGGAGAAG 1-10-1 MOE 963 147717 574 585
ATCTTCAGAGAT 1-10-1 MOE 996 147717 607 618 ATCTTCAGAGAT 1-10-1 MOE
996 147710 609 620 TATAGCTCCTCT 1-10-1 MOE 994 147708 612 623
TTGATATAGTCA 1-10-1 MOE 997 147718 621 632 TAATATGACTTG 1-10-1 MOE
998 147746 625 636 TAAAAACAACAA 1-10-1 MOE 1073 147736 658 669
AGGTAGGAGAAG 1-10-1 MOE 963 147720 676 687 GATCTCTCGAGT 1-10-1 MOE
1117 147721 683 694 AATGCAGGATCT 1-10-1 MOE 1118 398167 704 715
CAGGCCATGTGG 1-10-1 MOE 1059 398092 705 718 AGTCAGGCCATGTG 2-10-2
MOE 1060 147722 709 720 AAAGTCAGGCCA 1-10-1 MOE 1130 147723 715 726
GACTCCAAAGTC 1-10-1 MOE 892 147746 733 744 TAAAAACAACAA 1-10-1 MOE
1073 398093 758 771 TCGGACTTTGAAAA 2-10-2 MOE 1009 398168 760 771
TCGGACTTTGAA 1-10-1 MOE 1008 147725 761 772 CTCGGACTTTGA 1-10-1 MOE
1119 147726 766 777 TGACTCTCGGAC 1-10-1 MOE 1120 147738 780 791
TGGGTGGCCGGG 1-10-1 MOE 1069 147727 807 818 CAGTGGACCACA 1-10-1 MOE
1128 147728 846 857 GCCAGACAGAAG 1-10-1 MOE 1013 398094 848 861
ATCAGCCAGACAGA 2-10-2 MOE 1010 398169 849 860 TCAGCCAGACAG 1-10-1
MOE 909 147729 863 874 GTAAGAGGCAGG 1-10-1 MOE 920 398095 866 879
CATCAGCAAGAGGC 2-10-2 MOE 1011 398164 873 884 TTGTCGATCTGC 1-10-1
MOE 1014 147730 874 885 CTTGTCCATCAG 1-10-1 MOE 1121 147731 880 891
TTTCCTCTTGTC 1-10-1 MOE 934 147732 885 896 GGGTCTTTCCTC 1-10-1 MOE
1122 147738 888 899 TGGGTGGCCGGG 1-10-1 MOE 1069 147733 906 917
TTCTTGATGTCC 1-10-1 MOE 891 398096 971 984 GGAGAAGCGCAGCT 2-10-2
MOE 1015 147735 973 984 GGAGAAGCGCAG 1-10-1 MOE 1016 147736 978 989
AGGTAGGAGAAG 1-10-1 MOE 963 147729 979 990 GTAAGAGGCAGG 1-10-1 MOE
920 147737 984 995 ACAGCCAGGTAG 1-10-1 MOE 1067 368349 1025 1038
CTGCACTGACGAGT 2-10-2 MOE 1017 368369 1025 1040 TCCTGCACTGACGAGT
3-10-3 MOE 893 368350 1027 1040 TCCTGCACTGACGA 2-10-2 MOE 1079
368370 1027 1042 GATCCTGCACTGACGA 3-10-3 MOE 1080 368351 1029 1042
GATCCTGCACTGAC 2-10-2 MOE 1081 368371 1029 1044 CTGATCCTGCACTGAC
3-10-3 MOE 1082 368352 1031 1044 CTGATCCTGCACTG 2-10-2 MOE 1105
368372 1031 1046 CACTGATCCTGCACTG 3-10-3 MOE 894 368353 1033 1046
CACTGATCCTGCAC 2-10-2 MOE 1007 368373 1033 1048 TCCACTGATCCTGCAC
3-10-3 MOE 1083 368354 1035 1048 TCCACTGATCCTGC 2-10-2 MOE 1024
368368 1035 1048 TCCACTGATCCTTA 2-10-2 MOE 1127 368374 1035 1050
CTTCCACTGATCCTGC 3-10-3 MOE 1126 368388 1035 1050 CTTCCACTGATCCTTA
3-10-3 MOE 895 147074 1036 1047 CCACTGATCCTG 1-10-1 MOE 845 368355
1036 1049 TTCCACTGATCCTG 2-10-2 MOE 1025 368375 1036 1051
CCTTCCACTGATCCTG 3-10-3 MOE 1020 147075 1037 1048 TCCACTGATCCT
1-10-1 MOE 1026 368356 1037 1050 CTTCCACTGATCCT 2-10-2 MOE 1027
368376 1037 1052 TCCTTCCACTGATCCT 3-10-3 MOE 1028 147076 1038 1049
TTCCACTGATCC 1-10-1 MOE 1029 368357 1038 1051 CCTTCCACTGATCC 2-10-2
MOE 1046 368377 1038 1053 CTCCTTCCACTGATCC 3-10-3 MOE 1030 147077
1039 1050 CTTCCACTGATC 1-10-1 MOE 1047 368358 1039 1052
TCCTTCCACTGATC 2-10-2 MOE 1031 368378 1039 1054 GCTCCTTCCACTGATC
3-10-3 MOE 1032 147078 1040 1051 CCTTCCACTGAT 1-10-1 MOE 1044
147079 1041 1052 TCCTTCCACTGA 1-10-1 MOE 1001 368359 1041 1054
GCTCCTTCCACTGA 2-10-2 MOE 1033 368379 1041 1056 AAGCTCCTTCCACTGA
3-10-3 MOE 1034 147080 1042 1053 CTCCTTCCACTG 1-10-1 MOE 1021
147081 1043 1054 GCTCCTTCCACT 1-10-1 MOE 1006 368360 1043 1056
AAGCTCCTTCCACT 2-10-2 MOE 1035 368380 1043 1058 GAAAGCTCCTTCCACT
3-10-3 MOE 896 147082 1044 1055 AGCTCCTTCCAC 1-10-1 MOE 1036 368361
1045 1058 GAAAGCTCCTTCCA 2-10-2 MOE 962 368381 1045 1060
GGGAAAGCTCCTTCCA 3-10-3 MOE 1037 147729 1087 1098 GTAAGAGGCAGG
1-10-1 MOE 920 147738 1103 1114 TGGGTGGCCGGG 1-10-1 MOE 1069 147739
1107 1118 CGTTTGGGTGGC 1-10-1 MOE 1023 147740 1124 1135
TGTGAGGCTCCA 1-10-1 MOE 1062 398117 1164 1177 TTTCCACTTGGGTG 2-10-2
MOE 960 147741 1165 1176 CACCCACTGGTG 1-10-1 MOE 1055 398097 1194
1207 GGCAGTCTTTATCC 2-10-2 MOE 897 398098 1272 1285 TAACTTCAGTGTCT
2-10-2 MOE 1131 398117 1272 1285 TTTCCACTTGGGTG 2-10-2 MOE 960
147742 1273 1284 AACTTCAGTGTC 1-10-1 MOE 1041 147698 1293 1304
CCCGCCACCACC 1-10-1 MOE 928 147743 1388 1399 AGGGCTTCCAGT 1-10-1
MOE 1042 398099 1388 1401 GAAGGGCTTCCAGT 2-10-2 MOE 1132 147744
1392 1403 AGGAAGGGCTTC 1-10-1 MOE 1043 398100 1395 1408
TGACCAGGAAGGGC 2-10-2 MOE 1133 147745 1398 1409 TTGACCAGGAAG 1-10-1
MOE 1058 398157 1455 1468 GGAAACATACCCTG 2-10-2 MOE 1045 147745
1458 1469 TTGACCAGGAAG 1-10-1 MOE 1058
398167 1475 1486 CAGGCCATGTGG 1-10-1 MOE 1059 398118 1564 1577
CGCGAGATATCTAA 2-10-2 MOE 1084 147697 1575 1586 CCCCAGCAGCGG 1-10-1
MOE 1000 147076 1596 1607 TTCCACTGATCC 1-10-1 MOE 1029 368357 1596
1609 CCTTCCACTGATCC 2-10-2 MOE 1046 147077 1597 1608 CTTCCACTGATC
1-10-1 MOE 1047 147078 1598 1609 CCTTCCACTGAT 1-10-1 MOE 1044
398118 1672 1685 CGCGAGATATCTAA 2-10-2 MOE 1084 398158 1681 1694
AGGCCCTGAGATTA 2-10-2 MOE 1134 147697 1683 1694 CCCCAGCAGCGG 1-10-1
MOE 1000 398159 1686 1699 GGTTAAGGCCCTGA 2-10-2 MOE 1135 398160
1691 1704 GAATAGGTTAAGGC 2-10-2 MOE 1048 398163 1711 1722
ATGTCAACCGGC 1-10-1 MOE 908 147733 1717 1728 TTCTTGATGTCC 1-10-1
MOE 891 147089 1747 1758 TCCCTCTACACC 1-10-1 MOE 956 147090 1748
1759 TTCCCTCTACAC 1-10-1 MOE 955 147746 1750 1761 TAAAAACAACAA
1-10-1 MOE 1073 389949 1777 1788 GCGCGAGCCCGA 1-10-1 MOE 1061
398161 1790 1803 AACAATGTGTTGTA 2-10-2 MOE 1049 147746 1799 1810
TAAAAACAACAA 1-10-1 MOE 1073 147700 1801 1812 GCGCTAGGCCGC 1-10-1
MOE 1110 147740 1806 1817 TGTGAGGCTCCA 1-10-1 MOE 1062 398163 1819
1830 ATGTCAACCGGC 1-10-1 MOE 908 147733 1825 1836 TTCTTGATGTCC
1-10-1 MOE 891 389950 1848 1859 CCCTGAAGGTTC 1-10-1 MOE 1063 147701
1858 1869 CCATGGCGGGAC 1-10-1 MOE 921 398164 1889 1900 TTGTCGATCTGC
1-10-1 MOE 1014 147730 1890 1901 CTTGTCCATCAG 1-10-1 MOE 1121
147700 1909 1920 GCGCTAGGCCGC 1-10-1 MOE 1110 398119 1920 1933
CGCACCTGGTAAAT 2-10-2 MOE 1085 147685 1957 1968 GGCTGACATTCA 1-10-1
MOE 975 147701 1966 1977 CCATGGCGGGAC 1-10-1 MOE 921 398120 1966
1979 GTTCAAGCGGCCTA 2-10-2 MOE 1086 398101 1977 1990 TTTGATAAAGCCCT
2-10-2 MOE 1064 398164 1997 2008 TTGTCGATCTGC 1-10-1 MOE 1014
147730 1998 2009 CTTGTCCATCAG 1-10-1 MOE 1121 147702 2025 2036
CTGGTAAATAGC 1-10-1 MOE 898 398119 2028 2041 CGCACCTGGTAAAT 2-10-2
MOE 1085 398120 2074 2087 GTTCAAGCGGCCTA 2-10-2 MOE 1086 398105
2099 2112 TGCACAGGCAGGTT 2-10-2 MOE 1066 147736 2204 2215
AGGTAGGAGAAG 1-10-1 MOE 963 147741 2257 2268 CACCCACTGGTG 1-10-1
MOE 1055 398104 2272 2285 CAAGAAGACCTTAC 2-10-2 MOE 1065 147737
2360 2371 ACAGCCAGGTAG 1-10-1 MOE 1067 398105 2361 2374
TGCACAGGCAGGTT 2-10-2 MOE 1066 147737 2386 2397 ACAGCCAGGTAG 1-10-1
MOE 1067 398095 2407 2420 CATCAGCAAGAGGC 2-10-2 MOE 1011 398106
2441 2454 TGGAAAACTGCACC 2-10-2 MOE 1068 398107 2447 2460
TATTCCTGGAAAAC 2-10-2 MOE 902 398121 2474 2487 GTGCCTAGCACAGA
2-10-2 MOE 1097 147745 2497 2508 TTGACCAGGAAG 1-10-1 MOE 1058
147712 2499 2510 ACACCATCTCCC 1-10-1 MOE 1005 398108 2544 2557
GGAATGTCTGAGTT 2-10-2 MOE 1136 147691 2575 2586 GAGGTGGGAAAA 1-10-1
MOE 966 398121 2582 2595 GTGCCTAGCACAGA 2-10-2 MOE 1097 147738 2622
2633 TGGGTGGCCGGG 1-10-1 MOE 1069 398162 2666 2679 ACCAAACAGTTCAG
2-10-2 MOE 1057 147745 2689 2700 TTGACCAGGAAG 1-10-1 MOE 1058
398167 2706 2717 CAGGCCATGTGG 1-10-1 MOE 1059 398092 2707 2720
AGTCAGGCCATGTG 2-10-2 MOE 1060 398109 2714 2727 CAAGAAGTGTGGTT
2-10-2 MOE 903 398110 2852 2865 GTTCCCTTTGCAGG 2-10-2 MOE 952
147091 2854 2865 GTTCCCTCTACA 1-10-1 MOE 1004 147723 2924 2935
GACTCCAAAGTC 1-10-1 MOE 892 398111 2937 2950 GTGAAAATGCTGGC 2-10-2
MOE 904 398166 2966 2977 GGGCTTCTTCCA 1-10-1 MOE 1070 147089 2978
2989 TCCCTCTACACC 1-10-1 MOE 956 147090 2979 2990 TTCCCTCTACAC
1-10-1 MOE 955 147706 3007 3018 GCTGACATCTCG 1-10-1 MOE 1071 389949
3008 3019 GCGCGAGCCCGA 1-10-1 MOE 1061 147723 3032 3043
GACTCCAAAGTC 1-10-1 MOE 892 147740 3037 3048 TGTGAGGCTCCA 1-10-1
MOE 1062 398112 3051 3064 CAGCCTGGCACCTA 2-10-2 MOE 1072 389950
3079 3090 CCCTGAAGGTTC 1-10-1 MOE 1063 147746 3084 3095
TAAAAACAACAA 1-10-1 MOE 1073 398122 3148 3161 CCCTTTACACAAGT 2-10-2
MOE 1087 147089 3151 3162 TCCCTCTACACC 1-10-1 MOE 956 147090 3152
3163 TTCCCTCTACAC 1-10-1 MOE 955 398113 3160 3173 AGGAGGTTAAACCA
2-10-2 MOE 905 147685 3188 3199 GGCTGACATTCA 1-10-1 MOE 975 398101
3208 3221 TTTGATAAAGCCCT 2-10-2 MOE 1064 398102 3234 3247
CTACCTGAGGATTT 2-10-2 MOE 899 398123 3235 3248 CTCAAAATAGATTT
2-10-2 MOE 1088 398114 3237 3250 AGGCATATAGCAGA 2-10-2 MOE 1075
398103 3241 3254 CCCAGTACTACCTG 2-10-2 MOE 900 398115 3253 3266
AGTAAATATTGGCT 2-10-2 MOE 1076 398122 3256 3269 CCCTTTACACAAGT
2-10-2 MOE 1087 147089 3259 3270 TCCCTCTACACC 1-10-1 MOE 956 147090
3260 3271 TTCCCTCTACAC 1-10-1 MOE 955 398116 3266 3279
TAATGACCTGATGA 2-10-2 MOE 1137 390030 3306 3317 TTTATAAAACTG 1-10-1
MOE 1074 398123 3343 3356 CTCAAAATAGATTT 2-10-2 MOE 1088 147736
3435 3446 AGGTAGGAGAAG 1-10-1 MOE 963 398104 3503 3516
CAAGAAGACCTTAC 2-10-2 MOE 1065 147737 3591 3602 ACAGCCAGGTAG 1-10-1
MOE 1067 398105 3592 3605 TGCACAGGCAGGTT 2-10-2 MOE 1066 147719
3608 3619 CCAACTCCAACT 1-10-1 MOE 1116 147737 3617 3628
ACAGCCAGGTAG 1-10-1 MOE 1067 401398 3621 3634 CAAAGTCCCTTAGC 2-10-2
MOE 947 147079 3637 3648 TCCTTCCACTGA 1-10-1 MOE 1001 147080 3638
3649 CTCCTTCCACTG 1-10-1 MOE 1021 398095 3638 3651 CATCAGCAAGAGGC
2-10-2 MOE 1011 398106 3672 3685 TGGAAAACTGCACC 2-10-2 MOE 1068
147733 3687 3698 TTCTTGATGTCC 1-10-1 MOE 891 147731 3688 3699
TTTCCTCTTGTC 1-10-1 MOE 934 147719 3716 3727 CCAACTCCAACT 1-10-1
MOE 1116 147745 3728 3739 TTGACCAGGAAG 1-10-1 MOE 1058 147683 3740
3751 GCTTACGATTGT 1-10-1 MOE 922 147079 3745 3756 TCCTTCCACTGA
1-10-1 MOE 1001 147080 3746 3757 CTCCTTCCACTG 1-10-1 MOE 1021
398108 3775 3788 GGAATGTCTGAGTT 2-10-2 MOE 1136 147733 3795 3806
TTCTTGATGTCC 1-10-1 MOE 891 147731 3796 3807 TTTCCTCTTGTC 1-10-1
MOE 934 147691 3806 3817 GAGGTGGGAAAA 1-10-1 MOE 966 147738 3853
3864 TGGGTGGCCGGG 1-10-1 MOE 1069 398167 3926 3937 CAGGCCATGTGG
1-10-1 MOE 1059 147691 3978 3989 GAGGTGGGAAAA 1-10-1 MOE 966 398167
4034 4045 CAGGCCATGTGG 1-10-1 MOE 1059 147091 4085 4096
GTTCCCTCTACA 1-10-1 MOE 1004 147691 4086 4097 GAGGTGGGAAAA 1-10-1
MOE 966 398111 4168 4181 GTGAAAATGCTGGC 2-10-2 MOE 904 398166 4197
4208 GGGCTTCTTCCA 1-10-1 MOE 1070 147091 4223 4234 GTTCCCTCTACA
1-10-1 MOE 1004 147092 4224 4235 TGTTCCCTCTAC 1-10-1 MOE 901 398112
4282 4295 CAGCCTGGCACCTA 2-10-2 MOE 1072 147746 4315 4326
TAAAAACAACAA 1-10-1 MOE 1073
398113 4391 4404 AGGAGGTTAAACCA 2-10-2 MOE 905 147723 4422 4433
GACTCCAAAGTC 1-10-1 MOE 892 398114 4468 4481 AGGCATATAGCAGA 2-10-2
MOE 1075 398115 4484 4497 AGTAAATATTGGCT 2-10-2 MOE 1076 390030
4491 4502 TTTATAAAACTG 1-10-1 MOE 1074 398116 4497 4510
TAATGACCTGATGA 2-10-2 MOE 1137 147723 4530 4541 GACTCCAAAGTC 1-10-1
MOE 892 390030 4599 4610 TTTATAAAACTG 1-10-1 MOE 1074 398124 4761
4774 CACATGAGCTATTC 2-10-2 MOE 1089 398124 4869 4882 CACATGAGCTATTC
2-10-2 MOE 1089 147703 4926 4937 TGGCTTCATGTC 1-10-1 MOE 971 147692
4928 4939 CTCACCTTCATG 1-10-1 MOE 1113 147696 4975 4986
TGGATGATTGGC 1-10-1 MOE 906 147703 5034 5045 TGGCTTCATGTC 1-10-1
MOE 971 147692 5036 5047 CTCACCTTCATG 1-10-1 MOE 1113 147098 5173
5184 AGTTGTTGTTCC 1-10-1 MOE 1112 398125 5183 5196 CAGTAAGGAATTTT
2-10-2 MOE 913 398126 5216 5229 GTGAAGTGAGTCAT 2-10-2 MOE 1090
147098 5281 5292 AGTTGTTGTTCC 1-10-1 MOE 1112 398127 5283 5296
GGTCACTCAAGATG 2-10-2 MOE 1091 398126 5324 5337 GTGAAGTGAGTCAT
2-10-2 MOE 1090 398128 5335 5348 CTAAATTTAGTTCA 2-10-2 MOE 911
398127 5391 5404 GGTCACTCAAGATG 2-10-2 MOE 1091 398128 5443 5456
CTAAATTTAGTTCA 2-10-2 MOE 911 147712 5474 5485 ACACCATCTCCC 1-10-1
MOE 1005 147736 5600 5611 AGGTAGGAGAAG 1-10-1 MOE 963 147746 5606
5617 TAAAAACAACAA 1-10-1 MOE 1073 398129 5628 5641 TTTGAGGAGCTATT
2-10-2 MOE 1106 147085 5654 5665 TCTACACCAGGT 1-10-1 MOE 961 147736
5708 5719 AGGTAGGAGAAG 1-10-1 MOE 963 398129 5736 5749
TTTGAGGAGCTATT 2-10-2 MOE 1106 147679 5934 5945 CAAAAGGATCCC 1-10-1
MOE 907 147723 6229 6240 GACTCCAAAGTC 1-10-1 MOE 892 147723 6338
6349 GACTCCAAAGTC 1-10-1 MOE 892 390030 6803 6814 TTTATAAAACTG
1-10-1 MOE 1074 398142 6885 6898 CCAGCACACTGGAA 2-10-2 MOE 923
390030 6912 6923 TTTATAAAACTG 1-10-1 MOE 1074 398142 6994 7007
CCAGCACACTGGAA 2-10-2 MOE 923 147695 7054 7065 TCATTCCCCACT 1-10-1
MOE 984 147695 7163 7174 TCATTCCCCACT 1-10-1 MOE 984 398166 7197
7208 GGGCTTCTTCCA 1-10-1 MOE 1070 398166 7306 7317 GGGCTTCTTCCA
1-10-1 MOE 1070 147684 7442 7453 ACCCAGTCAGGG 1-10-1 MOE 964 398130
7694 7707 TTAGTATGACAGCT 2-10-2 MOE 925 398131 7711 7724
GGACTCACTCAGCA 2-10-2 MOE 1092 398130 7802 7815 TTAGTATGACAGCT
2-10-2 MOE 925 398125 7804 7817 CAGTAAGGAATTTT 2-10-2 MOE 913
398131 7819 7832 GGACTCACTCAGCA 2-10-2 MOE 1092 390030 7877 7888
TTTATAAAACTG 1-10-1 MOE 1074 398125 7912 7925 CAGTAAGGAATTTT 2-10-2
MOE 913 390030 7985 7996 TTTATAAAACTG 1-10-1 MOE 1074 398132 8031
8044 TCAGGGCTACTCAT 2-10-2 MOE 1093 398132 8139 8152 TCAGGGCTACTCAT
2-10-2 MOE 1093 147684 8148 8159 ACCCAGTCAGGG 1-10-1 MOE 964 147684
8256 8267 ACCCAGTCAGGG 1-10-1 MOE 964 398163 8365 8376 ATGTCAACCGGC
1-10-1 MOE 908 398166 8447 8458 GGGCTTCTTCCA 1-10-1 MOE 1070 398163
8473 8484 ATGTCAACCGGC 1-10-1 MOE 908 398166 8555 8566 GGGCTTCTTCCA
1-10-1 MOE 1070 147718 8631 8642 TAATATGACTTG 1-10-1 MOE 998 147691
8698 8709 GAGGTGGGAAAA 1-10-1 MOE 966 147691 8806 8817 GAGGTGGGAAAA
1-10-1 MOE 966 147728 8835 8846 GCCAGACAGAAG 1-10-1 MOE 1013 147727
8876 8887 CAGTGGACCACA 1-10-1 MOE 1128 147728 8943 8954
GCCAGACAGAAG 1-10-1 MOE 1013 398169 8946 8957 TCAGCCAGACAG 1-10-1
MOE 909 147727 8984 8995 CAGTGGACCACA 1-10-1 MOE 1128 147742 9060
9071 AACTTCAGTGTC 1-10-1 MOE 1041 398133 9112 9125 CAGCACTAGATTCA
2-10-2 MOE 1094 384545 9135 9146 CAAGTAGGATGT 1-10-1 MOE 951 147742
9168 9179 AACTTCAGTGTC 1-10-1 MOE 1041 398133 9220 9233
CAGCACTAGATTCA 2-10-2 MOE 1094 384545 9243 9254 CAAGTAGGATGT 1-10-1
MOE 951 398125 9368 9381 CAGTAAGGAATTTT 2-10-2 MOE 913 398125 9476
9489 CAGTAAGGAATTTT 2-10-2 MOE 913 401409 9516 9529 ATTCTTAACACAGA
2-10-2 MOE 991 147096 9594 9605 TTGTTGTTCCCT 1-10-1 MOE 1107 147733
9597 9608 TTCTTGATGTCC 1-10-1 MOE 891 147720 9689 9700 GATCTCTCGAGT
1-10-1 MOE 1117 147096 9702 9713 TTGTTGTTCCCT 1-10-1 MOE 1107
147733 9705 9716 TTCTTGATGTCC 1-10-1 MOE 891 147720 9797 9808
GATCTCTCGAGT 1-10-1 MOE 1117 147746 9963 9974 TAAAAACAACAA 1-10-1
MOE 1073 147746 9966 9977 TAAAAACAACAA 1-10-1 MOE 1073 147746 9969
9980 TAAAAACAACAA 1-10-1 MOE 1073 147746 9991 10002 TAAAAACAACAA
1-10-1 MOE 1073 147746 10071 10082 TAAAAACAACAA 1-10-1 MOE 1073
147746 10074 10085 TAAAAACAACAA 1-10-1 MOE 1073 147746 10077 10088
TAAAAACAACAA 1-10-1 MOE 1073 147746 10099 10110 TAAAAACAACAA 1-10-1
MOE 1073 398134 10153 10166 TAGCTTAATGTAAC 2-10-2 MOE 1095 147085
10221 10232 TCTACACCAGGT 1-10-1 MOE 961 398134 10261 10274
TAGCTTAATGTAAC 2-10-2 MOE 1095 390030 10278 10289 TTTATAAAACTG
1-10-1 MOE 1074 147084 10328 10339 CTACACCAGGTC 1-10-1 MOE 993
147711 10684 10695 AAGGGCCCTGGG 1-10-1 MOE 1040 398128 11333 11346
CTAAATTTAGTTCA 2-10-2 MOE 911 398128 11340 11353 CTAAATTTAGTTCA
2-10-2 MOE 911 147730 11783 11794 CTTGTCCATCAG 1-10-1 MOE 1121
147731 11789 11800 TTTCCTCTTGTC 1-10-1 MOE 934 147730 11790 11801
CTTGTCCATCAG 1-10-1 MOE 1121 147731 11796 11807 TTTCCTCTTGTC 1-10-1
MOE 934 147707 11960 11971 TAGTCATTATCT 1-10-1 MOE 977 147090 12008
12019 TTCCCTCTACAC 1-10-1 MOE 955 147091 12009 12020 GTTCCCTCTACA
1-10-1 MOE 1004 147091 12014 12025 GTTCCCTCTACA 1-10-1 MOE 1004
398096 12141 12154 GGAGAAGCGCAGCT 2-10-2 MOE 1015 147735 12143
12154 GGAGAAGCGCAG 1-10-1 MOE 1016 398096 12146 12159
GGAGAAGCGCAGCT 2-10-2 MOE 1015 147735 12148 12159 GGAGAAGCGCAG
1-10-1 MOE 1016 398166 12209 12220 GGGCTTCTTCCA 1-10-1 MOE 1070
398166 12214 12225 GGGCTTCTTCCA 1-10-1 MOE 1070 398135 12303 12316
GACTACATTTTACA 2-10-2 MOE 912 147741 12389 12400 CACCCACTGGTG
1-10-1 MOE 1055 147741 12394 12405 CACCCACTGGTG 1-10-1 MOE 1055
398125 12431 12444 CAGTAAGGAATTTT 2-10-2 MOE 913 147714 12585 12596
TTCTGCTCCCAC 1-10-1 MOE 986 147718 12594 12605 TAATATGACTTG 1-10-1
MOE 998 398125 12612 12625 CAGTAAGGAATTTT 2-10-2 MOE 913 147737
12803 12814 ACAGCCAGGTAG 1-10-1 MOE 1067 147746 12876 12887
TAAAAACAACAA 1-10-1 MOE 1073 147691 12900 12911 GAGGTGGGAAAA 1-10-1
MOE 966 398136 12915 12928 TTGTGACATCTAGG 2-10-2 MOE 1096 147737
12984 12995 ACAGCCAGGTAG 1-10-1 MOE 1067 147746 13057 13068
TAAAAACAACAA 1-10-1 MOE 1073
147691 13081 13092 GAGGTGGGAAAA 1-10-1 MOE 966 398136 13096 13109
TTGTGACATCTAGG 2-10-2 MOE 1096 398138 13254 13267 AACATCAAGCTTGA
2-10-2 MOE 931 398138 13435 13448 AACATCAAGCTTGA 2-10-2 MOE 931
147691 13488 13499 GAGGTGGGAAAA 1-10-1 MOE 966 147681 13659 13670
ATGTCATTAAAC 1-10-1 MOE 965 147691 13669 13680 GAGGTGGGAAAA 1-10-1
MOE 966 389965 13839 13850 CTGCAACATGAT 1-10-1 MOE 1018 389764
13839 13850 CTGCAACATGAT 1-9-2 MOE 1018 147681 13840 13851
ATGTCATTAAAC 1-10-1 MOE 965 389965 14020 14031 CTGCAACATGAT 1-10-1
MOE 1018 389764 14020 14031 CTGCAACATGAT 1-9-2 MOE 1018 389948
14067 14078 CCGTTGGACCCC 1-10-1 MOE 915 147736 14123 14134
AGGTAGGAGAAG 1-10-1 MOE 963 389948 14248 14259 CCGTTGGACCCC 1-10-1
MOE 915 147738 14279 14290 TGGGTGGCCGGG 1-10-1 MOE 1069 147736
14304 14315 AGGTAGGAGAAG 1-10-1 MOE 963 147731 14411 14422
TTTCCTCTTGTC 1-10-1 MOE 934 147738 14461 14472 TGGGTGGCCGGG 1-10-1
MOE 1069 147692 14475 14486 CTCACCTTCATG 1-10-1 MOE 1113 147731
14593 14604 TTTCCTCTTGTC 1-10-1 MOE 934 389950 14614 14625
CCCTGAAGGTTC 1-10-1 MOE 1063 147692 14657 14668 CTCACCTTCATG 1-10-1
MOE 1113 147717 14750 14761 ATCTTCAGAGAT 1-10-1 MOE 996 147698
14754 14765 CCCGCCACCACC 1-10-1 MOE 928 389950 14796 14807
CCCTGAAGGTTC 1-10-1 MOE 1063 398112 14863 14876 CAGCCTGGCACCTA
2-10-2 MOE 1072 398121 14875 14888 GTGCCTAGCACAGA 2-10-2 MOE 1097
147717 14932 14943 ATCTTCAGAGAT 1-10-1 MOE 996 398112 15045 15058
CAGCCTGGCACCTA 2-10-2 MOE 1072 398121 15057 15070 GTGCCTAGCACAGA
2-10-2 MOE 1097 147730 15117 15128 CTTGTCCATCAG 1-10-1 MOE 1121
147730 15299 15310 CTTGTCCATCAG 1-10-1 MOE 1121 401407 15339 15352
CAGCTTAGGCAGAG 2-10-2 MOE 983 398167 15556 15567 CAGGCCATGTGG
1-10-1 MOE 1059 147736 16444 16455 AGGTAGGAGAAG 1-10-1 MOE 963
147746 16510 16521 TAAAAACAACAA 1-10-1 MOE 1073 147738 16590 16601
TGGGTGGCCGGG 1-10-1 MOE 1069 147736 16610 16621 AGGTAGGAGAAG 1-10-1
MOE 963 398167 16631 16642 CAGGCCATGTGG 1-10-1 MOE 1059 401411
16657 16670 AGCCGCCTGAAGTG 2-10-2 MOE 999 147746 16676 16687
TAAAAACAACAA 1-10-1 MOE 1073 398144 16745 16758 GACAGCTTCTATAA
2-10-2 MOE 916 147738 16756 16767 TGGGTGGCCGGG 1-10-1 MOE 1069
398167 16797 16808 CAGGCCATGTGG 1-10-1 MOE 1059 398144 16911 16924
GACAGCTTCTATAA 2-10-2 MOE 916 389965 17096 17107 CTGCAACATGAT
1-10-1 MOE 1018 389764 17096 17107 CTGCAACATGAT 1-9-2 MOE 1018
389965 17264 17275 CTGCAACATGAT 1-10-1 MOE 1018 389764 17264 17275
CTGCAACATGAT 1-9-2 MOE 1018 147709 17406 17417 CCATTTTTATCA 1-10-1
MOE 978 147745 17443 17454 TTGACCAGGAAG 1-10-1 MOE 1058 147746
17497 17508 TAAAAACAACAA 1-10-1 MOE 1073 147720 17589 17600
GATCTCTCGAGT 1-10-1 MOE 1117 147745 17611 17622 TTGACCAGGAAG 1-10-1
MOE 1058 147695 17634 17645 TCATTCCCCACT 1-10-1 MOE 984 147746
17665 17676 TAAAAACAACAA 1-10-1 MOE 1073 147088 17707 17718
CCCTCTACACCA 1-10-1 MOE 1050 147720 17757 17768 GATCTCTCGAGT 1-10-1
MOE 1117 147711 17808 17819 AAGGGCCCTGGG 1-10-1 MOE 1040 147711
17976 17987 AAGGGCCCTGGG 1-10-1 MOE 1040 398139 18049 18062
AGTGACTGACCACA 2-10-2 MOE 917 398139 18217 18230 AGTGACTGACCACA
2-10-2 MOE 917 398140 18596 18609 GTAGCATAGAGCCT 2-10-2 MOE 918
398140 18764 18777 GTAGCATAGAGCCT 2-10-2 MOE 918 398167 18927 18938
CAGGCCATGTGG 1-10-1 MOE 1059 398167 19095 19106 CAGGCCATGTGG 1-10-1
MOE 1059 147724 19147 19158 GAAATTGAGGAA 1-10-1 MOE 1139 147746
19207 19218 TAAAAACAACAA 1-10-1 MOE 1073 147724 19315 19326
GAAATTGAGGAA 1-10-1 MOE 1139 147740 19348 19359 TGTGAGGCTCCA 1-10-1
MOE 1062 147746 19375 19386 TAAAAACAACAA 1-10-1 MOE 1073 147729
19386 19397 GTAAGAGGCAGG 1-10-1 MOE 920 147701 19503 19514
CCATGGCGGGAC 1-10-1 MOE 921 147711 19508 19519 AAGGGCCCTGGG 1-10-1
MOE 1040 147740 19516 19527 TGTGAGGCTCCA 1-10-1 MOE 1062 147718
19617 19628 TAATATGACTTG 1-10-1 MOE 998 390030 19618 19629
TTTATAAAACTG 1-10-1 MOE 1074 147679 19635 19646 CAAAAGGATCCC 1-10-1
MOE 907 147711 19676 19687 AAGGGCCCTGGG 1-10-1 MOE 1040 147694
19747 19758 CAGCCTACCAGT 1-10-1 MOE 1098 147718 19785 19796
TAATATGACTTG 1-10-1 MOE 998 390030 19786 19797 TTTATAAAACTG 1-10-1
MOE 1074 147679 19803 19814 CAAAAGGATCCC 1-10-1 MOE 907 147698
19852 19863 CCCGCCACCACC 1-10-1 MOE 928 147694 19915 19926
CAGCCTACCAGT 1-10-1 MOE 1098 147704 20011 20022 TTGTTCTTAGGA 1-10-1
MOE 1012 147698 20020 20031 CCCGCCACCACC 1-10-1 MOE 928 398142
20485 20498 CCAGCACACTGGAA 2-10-2 MOE 923 147078 20514 20525
CCTTCCACTGAT 1-10-1 MOE 1044 147079 20515 20526 TCCTTCCACTGA 1-10-1
MOE 1001 147080 20516 20527 CTCCTTCCACTG 1-10-1 MOE 1021 398143
20561 20574 GTCAGTCCCAGCTA 2-10-2 MOE 924 389965 20620 20631
CTGCAACATGAT 1-10-1 MOE 1018 389764 20620 20631 CTGCAACATGAT 1-9-2
MOE 1018 398142 20653 20666 CCAGCACACTGGAA 2-10-2 MOE 923 147078
20682 20693 CCTTCCACTGAT 1-10-1 MOE 1044 147079 20683 20694
TCCTTCCACTGA 1-10-1 MOE 1001 147080 20684 20695 CTCCTTCCACTG 1-10-1
MOE 1021 147080 20704 20715 CTCCTTCCACTG 1-10-1 MOE 1021 147081
20705 20716 GCTCCTTCCACT 1-10-1 MOE 1006 398143 20729 20742
GTCAGTCCCAGCTA 2-10-2 MOE 924 389965 20788 20799 CTGCAACATGAT
1-10-1 MOE 1018 389764 20788 20799 CTGCAACATGAT 1-9-2 MOE 1018
147746 20870 20881 TAAAAACAACAA 1-10-1 MOE 1073 147080 20872 20883
CTCCTTCCACTG 1-10-1 MOE 1021 147081 20873 20884 GCTCCTTCCACT 1-10-1
MOE 1006 147746 21038 21049 TAAAAACAACAA 1-10-1 MOE 1073 147717
21080 21091 ATCTTCAGAGAT 1-10-1 MOE 996 147076 21222 21233
TTCCACTGATCC 1-10-1 MOE 1029 147076 21390 21401 TTCCACTGATCC 1-10-1
MOE 1029 398094 21441 21454 ATCAGCCAGACAGA 2-10-2 MOE 1010 147746
21465 21476 TAAAAACAACAA 1-10-1 MOE 1073 398094 21609 21622
ATCAGCCAGACAGA 2-10-2 MOE 1010 398169 21610 21621 TCAGCCAGACAG
1-10-1 MOE 909 147746 21633 21644 TAAAAACAACAA 1-10-1 MOE 1073
147738 21884 21895 TGGGTGGCCGGG 1-10-1 MOE 1069 147743 22045 22056
AGGGCTTCCAGT 1-10-1 MOE 1042 147738 22052 22063 TGGGTGGCCGGG 1-10-1
MOE 1069 147683 22107 22118 GCTTACGATTGT 1-10-1 MOE 922 147743
22213 22224 AGGGCTTCCAGT 1-10-1 MOE 1042 147681 22566 22577
ATGTCATTAAAC 1-10-1 MOE 965 389950 22619 22630 CCCTGAAGGTTC 1-10-1
MOE 1063 147681 22734 22745 ATGTCATTAAAC 1-10-1 MOE 965 147736
22759 22770 AGGTAGGAGAAG 1-10-1 MOE 963 389950 22787 22798
CCCTGAAGGTTC 1-10-1 MOE 1063
389949 22794 22805 GCGCGAGCCCGA 1-10-1 MOE 1061 147736 22927 22938
AGGTAGGAGAAG 1-10-1 MOE 963 389949 22962 22973 GCGCGAGCCCGA 1-10-1
MOE 1061 398144 22962 22975 GACAGCTTCTATAA 2-10-2 MOE 916 398142
23008 23021 CCAGCACACTGGAA 2-10-2 MOE 923 147727 23019 23030
CAGTGGACCACA 1-10-1 MOE 1128 398169 23064 23075 TCAGCCAGACAG 1-10-1
MOE 909 398144 23130 23143 GACAGCTTCTATAA 2-10-2 MOE 916 398145
23154 23167 ACATGTCAGTAATT 2-10-2 MOE 1099 398142 23176 23189
CCAGCACACTGGAA 2-10-2 MOE 923 147727 23187 23198 CAGTGGACCACA
1-10-1 MOE 1128 147735 23243 23254 GGAGAAGCGCAG 1-10-1 MOE 1016
398145 23322 23335 ACATGTCAGTAATT 2-10-2 MOE 1099 147735 23411
23422 GGAGAAGCGCAG 1-10-1 MOE 1016 398146 23478 23491
CTCATGGACACAAA 2-10-2 MOE 1100 398146 23646 23659 CTCATGGACACAAA
2-10-2 MOE 1100 398147 23784 23797 CTACAGGACAATAC 2-10-2 MOE 957
398114 23853 23866 AGGCATATAGCAGA 2-10-2 MOE 1075 398147 23952
23965 CTACAGGACAATAC 2-10-2 MOE 957 398114 24021 24034
AGGCATATAGCAGA 2-10-2 MOE 1075 147702 24319 24330 CTGGTAAATAGC
1-10-1 MOE 898 147702 24487 24498 CTGGTAAATAGC 1-10-1 MOE 898
389965 24543 24554 CTGCAACATGAT 1-10-1 MOE 1018 389764 24543 24554
CTGCAACATGAT 1-9-2 MOE 1018 147713 24602 24613 CTCCCACACCAT 1-10-1
MOE 985 389965 24711 24722 CTGCAACATGAT 1-10-1 MOE 1018 389764
24711 24722 CTGCAACATGAT 1-9-2 MOE 1018 147684 24918 24929
ACCCAGTCAGGG 1-10-1 MOE 964 147684 25086 25097 ACCCAGTCAGGG 1-10-1
MOE 964 398148 25152 25165 TCATAACTATTAAG 2-10-2 MOE 981 398144
25192 25205 GACAGCTTCTATAA 2-10-2 MOE 916 147746 25216 25227
TAAAAACAACAA 1-10-1 MOE 1073 147736 25313 25324 AGGTAGGAGAAG 1-10-1
MOE 963 398148 25320 25333 TCATAACTATTAAG 2-10-2 MOE 981 398143
25337 25350 GTCAGTCCCAGCTA 2-10-2 MOE 924 398144 25360 25373
GACAGCTTCTATAA 2-10-2 MOE 916 147746 25384 25395 TAAAAACAACAA
1-10-1 MOE 1073 147691 25442 25453 GAGGTGGGAAAA 1-10-1 MOE 966
147736 25481 25492 AGGTAGGAGAAG 1-10-1 MOE 963 398130 25504 25517
TTAGTATGACAGCT 2-10-2 MOE 925 147691 25610 25621 GAGGTGGGAAAA
1-10-1 MOE 966 147721 25662 25673 AATGCAGGATCT 1-10-1 MOE 1118
398130 25672 25685 TTAGTATGACAGCT 2-10-2 MOE 925 147688 25750 25761
TCCCAAACAAAT 1-10-1 MOE 990 147746 25810 25821 TAAAAACAACAA 1-10-1
MOE 1073 147721 25830 25841 AATGCAGGATCT 1-10-1 MOE 1118 147688
25918 25929 TCCCAAACAAAT 1-10-1 MOE 990 147746 25978 25989
TAAAAACAACAA 1-10-1 MOE 1073 147746 26172 26183 TAAAAACAACAA 1-10-1
MOE 1073 147746 26340 26351 TAAAAACAACAA 1-10-1 MOE 1073 398149
26492 26505 GGAAGTTTTCAAGT 2-10-2 MOE 1101 398150 26526 26539
GAATCTGGAGGTAA 2-10-2 MOE 1102 398149 26641 26654 GGAAGTTTTCAAGT
2-10-2 MOE 1101 398150 26675 26688 GAATCTGGAGGTAA 2-10-2 MOE 1102
147729 26712 26723 GTAAGAGGCAGG 1-10-1 MOE 920 398151 26718 26731
TCAGTGTAGGAAGA 2-10-2 MOE 926 147729 26861 26872 GTAAGAGGCAGG
1-10-1 MOE 920 398151 26867 26880 TCAGTGTAGGAAGA 2-10-2 MOE 926
147728 26917 26928 GCCAGACAGAAG 1-10-1 MOE 1013 147728 27066 27077
GCCAGACAGAAG 1-10-1 MOE 1013 147076 27258 27269 TTCCACTGATCC 1-10-1
MOE 1029 147731 27267 27278 TTTCCTCTTGTC 1-10-1 MOE 934 147076
27407 27418 TTCCACTGATCC 1-10-1 MOE 1029 147731 27416 27427
TTTCCTCTTGTC 1-10-1 MOE 934 398152 27559 27572 TGAATATACAGATG
2-10-2 MOE 927 398152 27708 27721 TGAATATACAGATG 2-10-2 MOE 927
147696 28265 28276 TGGATGATTGGC 1-10-1 MOE 906 147696 28414 28425
TGGATGATTGGC 1-10-1 MOE 906 147698 28481 28492 CCCGCCACCACC 1-10-1
MOE 928 147720 28662 28673 GATCTCTCGAGT 1-10-1 MOE 1117 389965
28714 28725 CTGCAACATGAT 1-10-1 MOE 1018 389764 28714 28725
CTGCAACATGAT 1-9-2 MOE 1018 389965 28861 28872 CTGCAACATGAT 1-10-1
MOE 1018 389764 28861 28872 CTGCAACATGAT 1-9-2 MOE 1018 398153
28980 28993 ATTTCTCTTACAGG 2-10-2 MOE 948 398153 29126 29139
ATTTCTCTTACAGG 2-10-2 MOE 948 147719 29570 29581 CCAACTCCAACT
1-10-1 MOE 1116 398154 29692 29705 AGCCCCTTGGCCGT 2-10-2 MOE 1103
147719 29715 29726 CCAACTCCAACT 1-10-1 MOE 1116 398155 29785 29798
TGTTTTTACACAGA 2-10-2 MOE 970 398154 29837 29850 AGCCCCTTGGCCGT
2-10-2 MOE 1103 401384 29905 29918 TGAACACATCACTA 2-10-2 MOE 933
398155 29930 29943 TGTTTTTACACAGA 2-10-2 MOE 970 390030 29945 29956
TTTATAAAACTG 1-10-1 MOE 1074 390030 30090 30101 TTTATAAAACTG 1-10-1
MOE 1074 398156 30141 30154 GAATACTTCAAATC 2-10-2 MOE 1104 398156
30286 30299 GAATACTTCAAATC 2-10-2 MOE 1104 389948 30384 30395
CCGTTGGACCCC 1-10-1 MOE 915 389948 30530 30541 CCGTTGGACCCC 1-10-1
MOE 915 398142 30591 30604 CCAGCACACTGGAA 2-10-2 MOE 923 147744
30654 30665 AGGAAGGGCTTC 1-10-1 MOE 1043 147093 30689 30700
TTGTTCCCTCTA 1-10-1 MOE 929 398142 30738 30751 CCAGCACACTGGAA
2-10-2 MOE 923 147744 30801 30812 AGGAAGGGCTTC 1-10-1 MOE 1043
398168 31082 31093 TCGGACTTTGAA 1-10-1 MOE 1008 147746 31105 31116
TAAAAACAACAA 1-10-1 MOE 1073 398168 31230 31241 TCGGACTTTGAA 1-10-1
MOE 1008 390030 31329 31340 TTTATAAAACTG 1-10-1 MOE 1074 147736
31458 31469 AGGTAGGAGAAG 1-10-1 MOE 963 390030 31477 31488
TTTATAAAACTG 1-10-1 MOE 1074 147736 31606 31617 AGGTAGGAGAAG 1-10-1
MOE 963 147698 31713 31724 CCCGCCACCACC 1-10-1 MOE 928 384545 31829
31840 CAAGTAGGATGT 1-10-1 MOE 951 147698 31861 31872 CCCGCCACCACC
1-10-1 MOE 928 147723 31941 31952 GACTCCAAAGTC 1-10-1 MOE 892
384545 31977 31988 CAAGTAGGATGT 1-10-1 MOE 951 147692 32061 32072
CTCACCTTCATG 1-10-1 MOE 1113 147723 32089 32100 GACTCCAAAGTC 1-10-1
MOE 892 147692 32209 32220 CTCACCTTCATG 1-10-1 MOE 1113 147089
32535 32546 TCCCTCTACACC 1-10-1 MOE 956 401396 32569 32582
TGCAGGATGTTGAG 2-10-2 MOE 945 147730 32714 32725 CTTGTCCATCAG
1-10-1 MOE 1121 398165 32854 32865 GTTCTTAGGAAG 1-10-1 MOE 968
147730 32862 32873 CTTGTCCATCAG 1-10-1 MOE 1121 389950 32949 32960
CCCTGAAGGTTC 1-10-1 MOE 1063 398165 33002 33013 GTTCTTAGGAAG 1-10-1
MOE 968 147736 33012 33023 AGGTAGGAGAAG 1-10-1 MOE 963 368352 33056
33069 CTGATCCTGCACTG 2-10-2 MOE 1105 147081 33073 33084
GCTCCTTCCACT 1-10-1 MOE 1006 368360 33073 33086 AAGCTCCTTCCACT
2-10-2 MOE 1035 147082 33074 33085 AGCTCCTTCCAC 1-10-1 MOE 1036
389950 33097 33108 CCCTGAAGGTTC 1-10-1 MOE 1063 147736 33160 33171
AGGTAGGAGAAG 1-10-1 MOE 963 368352 33204 33217 CTGATCCTGCACTG
2-10-2 MOE 1105 147081 33221 33232 GCTCCTTCCACT 1-10-1 MOE 1006
147082 33222 33233 AGCTCCTTCCAC 1-10-1 MOE 1036 398138 33244 33257
AACATCAAGCTTGA 2-10-2 MOE 931 147746 33250 33261 TAAAAACAACAA
1-10-1 MOE 1073 398138 33392 33405 AACATCAAGCTTGA 2-10-2 MOE 931
147746 33398 33409 TAAAAACAACAA 1-10-1 MOE 1073 147732 33652 33663
GGGTCTTTCCTC 1-10-1 MOE 1122 147724 33733 33744 GAAATTGAGGAA 1-10-1
MOE 1139 147732 33800 33811 GGGTCTTTCCTC 1-10-1 MOE 1122 147724
33881 33892 GAAATTGAGGAA 1-10-1 MOE 1139 147719 33976 33987
CCAACTCCAACT 1-10-1 MOE 1116 147746 34034 34045 TAAAAACAACAA 1-10-1
MOE 1073 398129 34045 34058 TTTGAGGAGCTATT 2-10-2 MOE 1106 147719
34124 34135 CCAACTCCAACT 1-10-1 MOE 1116 147721 34156 34167
AATGCAGGATCT 1-10-1 MOE 1118 398129 34193 34206 TTTGAGGAGCTATT
2-10-2 MOE 1106 147721 34304 34315 AATGCAGGATCT 1-10-1 MOE 1118
147746 34606 34617 TAAAAACAACAA 1-10-1 MOE 1073 398165 34704 34715
GTTCTTAGGAAG 1-10-1 MOE 968 147746 34754 34765 TAAAAACAACAA 1-10-1
MOE 1073 398165 34852 34863 GTTCTTAGGAAG 1-10-1 MOE 968 147717
34893 34904 ATCTTCAGAGAT 1-10-1 MOE 996 147719 34976 34987
CCAACTCCAACT 1-10-1 MOE 1116 147092 34987 34998 TGTTCCCTCTAC 1-10-1
MOE 901 147719 35124 35135 CCAACTCCAACT 1-10-1 MOE 1116 147092
35135 35146 TGTTCCCTCTAC 1-10-1 MOE 901 147736 35248 35259
AGGTAGGAGAAG 1-10-1 MOE 963 147738 35391 35402 TGGGTGGCCGGG 1-10-1
MOE 1069 147736 35396 35407 AGGTAGGAGAAG 1-10-1 MOE 963 147738
35539 35550 TGGGTGGCCGGG 1-10-1 MOE 1069 147691 35554 35565
GAGGTGGGAAAA 1-10-1 MOE 966 147691 35702 35713 GAGGTGGGAAAA 1-10-1
MOE 966 147746 35814 35825 TAAAAACAACAA 1-10-1 MOE 1073 147733
35889 35900 TTCTTGATGTCC 1-10-1 MOE 891 147733 35923 35934
TTCTTGATGTCC 1-10-1 MOE 891 147746 35962 35973 TAAAAACAACAA 1-10-1
MOE 1073 147726 35978 35989 TGACTCTCGGAC 1-10-1 MOE 1120 147733
36037 36048 TTCTTGATGTCC 1-10-1 MOE 891 147733 36071 36082
TTCTTGATGTCC 1-10-1 MOE 891 147726 36126 36137 TGACTCTCGGAC 1-10-1
MOE 1120 147736 36359 36370 AGGTAGGAGAAG 1-10-1 MOE 963 147691
36360 36371 GAGGTGGGAAAA 1-10-1 MOE 966 147736 36507 36518
AGGTAGGAGAAG 1-10-1 MOE 963 147691 36508 36519 GAGGTGGGAAAA 1-10-1
MOE 966 147746 36564 36575 TAAAAACAACAA 1-10-1 MOE 1073 147723
36575 36586 GACTCCAAAGTC 1-10-1 MOE 892 147731 36620 36631
TTTCCTCTTGTC 1-10-1 MOE 934 147723 36723 36734 GACTCCAAAGTC 1-10-1
MOE 892 147731 36768 36779 TTTCCTCTTGTC 1-10-1 MOE 934 398169 37174
37185 TCAGCCAGACAG 1-10-1 MOE 909 147688 37380 37391 TCCCAAACAAAT
1-10-1 MOE 990 147688 37528 37539 TCCCAAACAAAT 1-10-1 MOE 990
147714 37881 37892 TTCTGCTCCCAC 1-10-1 MOE 986 147714 38029 38040
TTCTGCTCCCAC 1-10-1 MOE 986 147681 38364 38375 ATGTCATTAAAC 1-10-1
MOE 965 147736 38766 38777 AGGTAGGAGAAG 1-10-1 MOE 963 147738 38909
38920 TGGGTGGCCGGG 1-10-1 MOE 1069 147736 38914 38925 AGGTAGGAGAAG
1-10-1 MOE 963 147738 39057 39068 TGGGTGGCCGGG 1-10-1 MOE 1069
390030 39249 39260 TTTATAAAACTG 1-10-1 MOE 1074 390030 39397 39408
TTTATAAAACTG 1-10-1 MOE 1074 147717 39545 39556 ATCTTCAGAGAT 1-10-1
MOE 996 147717 39693 39704 ATCTTCAGAGAT 1-10-1 MOE 996 147746 39729
39740 TAAAAACAACAA 1-10-1 MOE 1073 147746 39789 39800 TAAAAACAACAA
1-10-1 MOE 1073 147691 39829 39840 GAGGTGGGAAAA 1-10-1 MOE 966
147746 39877 39888 TAAAAACAACAA 1-10-1 MOE 1073 147691 39977 39988
GAGGTGGGAAAA 1-10-1 MOE 966 147727 39983 39994 CAGTGGACCACA 1-10-1
MOE 1128 147727 40131 40142 CAGTGGACCACA 1-10-1 MOE 1128 147746
40333 40344 TAAAAACAACAA 1-10-1 MOE 1073 147719 40457 40468
CCAACTCCAACT 1-10-1 MOE 1116 147679 40467 40478 CAAAAGGATCCC 1-10-1
MOE 907 147746 40478 40489 TAAAAACAACAA 1-10-1 MOE 1073 147741
40565 40576 CACCCACTGGTG 1-10-1 MOE 1055 398166 40589 40600
GGGCTTCTTCCA 1-10-1 MOE 1070 147719 40605 40616 CCAACTCCAACT 1-10-1
MOE 1116 147679 40615 40626 CAAAAGGATCCC 1-10-1 MOE 907 147746
40626 40637 TAAAAACAACAA 1-10-1 MOE 1073 147735 40662 40673
GGAGAAGCGCAG 1-10-1 MOE 1016 147746 40706 40717 TAAAAACAACAA 1-10-1
MOE 1073 147741 40713 40724 CACCCACTGGTG 1-10-1 MOE 1055 398166
40737 40748 GGGCTTCTTCCA 1-10-1 MOE 1070 147735 40810 40821
GGAGAAGCGCAG 1-10-1 MOE 1016 147746 40854 40865 TAAAAACAACAA 1-10-1
MOE 1073 147718 41218 41229 TAATATGACTTG 1-10-1 MOE 998 147717
41221 41232 ATCTTCAGAGAT 1-10-1 MOE 996 147717 41369 41380
ATCTTCAGAGAT 1-10-1 MOE 996 147723 41627 41638 GACTCCAAAGTC 1-10-1
MOE 892 147717 41747 41758 ATCTTCAGAGAT 1-10-1 MOE 996 147723 41775
41786 GACTCCAAAGTC 1-10-1 MOE 892 390030 41908 41919 TTTATAAAACTG
1-10-1 MOE 1074 390030 42056 42067 TTTATAAAACTG 1-10-1 MOE 1074
398153 42157 42170 ATTTCTCTTACAGG 2-10-2 MOE 948 398153 42305 42318
ATTTCTCTTACAGG 2-10-2 MOE 948 147690 42423 42434 TGAAGTTAATTC
1-10-1 MOE 1138 147695 42521 42532 TCATTCCCCACT 1-10-1 MOE 984
147710 42543 42554 TATAGCTCCTCT 1-10-1 MOE 994 147690 42571 42582
TGAAGTTAATTC 1-10-1 MOE 1138 147695 42669 42680 TCATTCCCCACT 1-10-1
MOE 984 147078 43321 43332 CCTTCCACTGAT 1-10-1 MOE 1044 147079
43322 43333 TCCTTCCACTGA 1-10-1 MOE 1001 147716 43329 43340
TTAACGAGCCTT 1-10-1 MOE 949 147078 43469 43480 CCTTCCACTGAT 1-10-1
MOE 1044 147079 43470 43481 TCCTTCCACTGA 1-10-1 MOE 1001 147080
43471 43482 CTCCTTCCACTG 1-10-1 MOE 1021 398102 43837 43850
CTACCTGAGGATTT 2-10-2 MOE 899 147074 43848 43859 CCACTGATCCTG
1-10-1 MOE 845 401408 43871 43884 CAATGAAGCACAGG 2-10-2 MOE 989
398102 43985 43998 CTACCTGAGGATTT 2-10-2 MOE 899 147736 44137 44148
AGGTAGGAGAAG 1-10-1 MOE 963 147746 44140 44151 TAAAAACAACAA 1-10-1
MOE 1073 147687 44206 44217 CGACACGGGAAC 1-10-1 MOE 950 147743
44223 44234 AGGGCTTCCAGT 1-10-1 MOE 1042 384545 44242 44253
CAAGTAGGATGT 1-10-1 MOE 951 147736 44285 44296 AGGTAGGAGAAG 1-10-1
MOE 963 147743 44371 44382 AGGGCTTCCAGT 1-10-1 MOE 1042 384545
44390 44401 CAAGTAGGATGT 1-10-1 MOE 951 147728 44589 44600
GCCAGACAGAAG 1-10-1 MOE 1013 389948 44628 44639 CCGTTGGACCCC 1-10-1
MOE 915 147720 44703 44714 GATCTCTCGAGT 1-10-1 MOE 1117 147728
44729 44740 GCCAGACAGAAG 1-10-1 MOE 1013 147728 44737 44748
GCCAGACAGAAG 1-10-1 MOE 1013 389948 44776 44787 CCGTTGGACCCC 1-10-1
MOE 915 147720 44851 44862 GATCTCTCGAGT 1-10-1 MOE 1117 398110
44861 44874 GTTCCCTTTGCAGG 2-10-2 MOE 952 147728 44877 44888
GCCAGACAGAAG 1-10-1 MOE 1013
147705 45092 45103 CGGTTTTTGTTC 1-10-1 MOE 1002 147705 45240 45251
CGGTTTTTGTTC 1-10-1 MOE 1002 147681 45337 45348 ATGTCATTAAAC 1-10-1
MOE 965 147681 45485 45496 ATGTCATTAAAC 1-10-1 MOE 965 147096 45660
45671 TTGTTGTTCCCT 1-10-1 MOE 1107 147096 45808 45819 TTGTTGTTCCCT
1-10-1 MOE 1107 368368 45976 45989 TCCACTGATCCTTA 2-10-2 MOE 1127
147074 45977 45988 CCACTGATCCTG 1-10-1 MOE 845 147075 45978 45989
TCCACTGATCCT 1-10-1 MOE 1026 147076 45979 45990 TTCCACTGATCC 1-10-1
MOE 1029 368368 46124 46137 TCCACTGATCCTTA 2-10-2 MOE 1127 147075
46126 46137 TCCACTGATCCT 1-10-1 MOE 1026 147076 46127 46138
TTCCACTGATCC 1-10-1 MOE 1029 147705 46555 46566 CGGTTTTTGTTC 1-10-1
MOE 1002 147714 46685 46696 TTCTGCTCCCAC 1-10-1 MOE 986 147705
46703 46714 CGGTTTTTGTTC 1-10-1 MOE 1002 147714 46833 46844
TTCTGCTCCCAC 1-10-1 MOE 986 390030 47007 47018 TTTATAAAACTG 1-10-1
MOE 1074 147746 47023 47034 TAAAAACAACAA 1-10-1 MOE 1073 147746
47171 47182 TAAAAACAACAA 1-10-1 MOE 1073 147085 47607 47618
TCTACACCAGGT 1-10-1 MOE 961 147746 47609 47620 TAAAAACAACAA 1-10-1
MOE 1073 147089 47611 47622 TCCCTCTACACC 1-10-1 MOE 956 147091
47613 47624 GTTCCCTCTACA 1-10-1 MOE 1004 401384 47689 47702
TGAACACATCACTA 2-10-2 MOE 933 147691 47729 47740 GAGGTGGGAAAA
1-10-1 MOE 966 147085 47755 47766 TCTACACCAGGT 1-10-1 MOE 961
147087 47757 47768 CCTCTACACCAG 1-10-1 MOE 982 147090 47760 47771
TTCCCTCTACAC 1-10-1 MOE 955 147091 47761 47772 GTTCCCTCTACA 1-10-1
MOE 1004 147099 47770 47781 GAGTTGTTGTTC 1-10-1 MOE 1108 147100
47771 47782 CGAGTTGTTGTT 1-10-1 MOE 1109 390030 47847 47858
TTTATAAAACTG 1-10-1 MOE 1074 147691 47877 47888 GAGGTGGGAAAA 1-10-1
MOE 966 147099 47918 47929 GAGTTGTTGTTC 1-10-1 MOE 1108 147100
47919 47930 CGAGTTGTTGTT 1-10-1 MOE 1109 390030 47995 48006
TTTATAAAACTG 1-10-1 MOE 1074 147074 48222 48233 CCACTGATCCTG 1-10-1
MOE 845 147731 48340 48351 TTTCCTCTTGTC 1-10-1 MOE 934 147691 48393
48404 GAGGTGGGAAAA 1-10-1 MOE 966 147731 48488 48499 TTTCCTCTTGTC
1-10-1 MOE 934 147691 48541 48552 GAGGTGGGAAAA 1-10-1 MOE 966
398147 48887 48900 CTACAGGACAATAC 2-10-2 MOE 957 398147 49035 49048
CTACAGGACAATAC 2-10-2 MOE 957 147074 49525 49536 CCACTGATCCTG
1-10-1 MOE 845 398168 49742 49753 TCGGACTTTGAA 1-10-1 MOE 1008
384545 49858 49869 CAAGTAGGATGT 1-10-1 MOE 951 398168 49890 49901
TCGGACTTTGAA 1-10-1 MOE 1008 147724 49974 49985 GAAATTGAGGAA 1-10-1
MOE 1139 384545 50006 50017 CAAGTAGGATGT 1-10-1 MOE 951 147689
50084 50095 CAGAGAAGGTCT 1-10-1 MOE 987 147687 50102 50113
CGACACGGGAAC 1-10-1 MOE 950 147724 50122 50133 GAAATTGAGGAA 1-10-1
MOE 1139 147687 50250 50261 CGACACGGGAAC 1-10-1 MOE 950 398117
50389 50402 TTTCCACTTGGGTG 2-10-2 MOE 960 147736 50436 50447
AGGTAGGAGAAG 1-10-1 MOE 963 147736 50582 50593 AGGTAGGAGAAG 1-10-1
MOE 963 398168 50703 50714 TCGGACTTTGAA 1-10-1 MOE 1008 401397
50822 50835 CTGGTCAGCATTGA 2-10-2 MOE 946 147746 51019 51030
TAAAAACAACAA 1-10-1 MOE 1073 147708 51101 51112 TTGATATAGTCA 1-10-1
MOE 997 147746 51165 51176 TAAAAACAACAA 1-10-1 MOE 1073 147746
51185 51196 TAAAAACAACAA 1-10-1 MOE 1073 147708 51247 51258
TTGATATAGTCA 1-10-1 MOE 997 147081 51287 51298 GCTCCTTCCACT 1-10-1
MOE 1006 147082 51288 51299 AGCTCCTTCCAC 1-10-1 MOE 1036 147746
51324 51335 TAAAAACAACAA 1-10-1 MOE 1073 147746 51331 51342
TAAAAACAACAA 1-10-1 MOE 1073 147728 51376 51387 GCCAGACAGAAG 1-10-1
MOE 1013 147729 51406 51417 GTAAGAGGCAGG 1-10-1 MOE 920 147081
51433 51444 GCTCCTTCCACT 1-10-1 MOE 1006 147082 51434 51445
AGCTCCTTCCAC 1-10-1 MOE 1036 147728 51492 51503 GCCAGACAGAAG 1-10-1
MOE 1013 147728 51522 51533 GCCAGACAGAAG 1-10-1 MOE 1013 147729
51552 51563 GTAAGAGGCAGG 1-10-1 MOE 920 368360 51633 51646
AAGCTCCTTCCACT 2-10-2 MOE 1035 147082 51634 51645 AGCTCCTTCCAC
1-10-1 MOE 1036 368361 51635 51648 GAAAGCTCCTTCCA 2-10-2 MOE 962
147728 51638 51649 GCCAGACAGAAG 1-10-1 MOE 1013 147695 51644 51655
TCATTCCCCACT 1-10-1 MOE 984 147736 51713 51724 AGGTAGGAGAAG 1-10-1
MOE 963 147684 51721 51732 ACCCAGTCAGGG 1-10-1 MOE 964 147081 51779
51790 GCTCCTTCCACT 1-10-1 MOE 1006 368360 51779 51792
AAGCTCCTTCCACT 2-10-2 MOE 1035 147082 51780 51791 AGCTCCTTCCAC
1-10-1 MOE 1036 368361 51781 51794 GAAAGCTCCTTCCA 2-10-2 MOE 962
147695 51790 51801 TCATTCCCCACT 1-10-1 MOE 984 147736 51859 51870
AGGTAGGAGAAG 1-10-1 MOE 963 147077 51988 51999 CTTCCACTGATC 1-10-1
MOE 1047 147079 51990 52001 TCCTTCCACTGA 1-10-1 MOE 1001 147746
52064 52075 TAAAAACAACAA 1-10-1 MOE 1073 147681 52085 52096
ATGTCATTAAAC 1-10-1 MOE 965 147077 52134 52145 CTTCCACTGATC 1-10-1
MOE 1047 147079 52136 52147 TCCTTCCACTGA 1-10-1 MOE 1001 147691
52166 52177 GAGGTGGGAAAA 1-10-1 MOE 966 147719 52252 52263
CCAACTCCAACT 1-10-1 MOE 1116 147691 52312 52323 GAGGTGGGAAAA 1-10-1
MOE 966 147719 52398 52409 CCAACTCCAACT 1-10-1 MOE 1116 147728
52428 52439 GCCAGACAGAAG 1-10-1 MOE 1013 147729 52483 52494
GTAAGAGGCAGG 1-10-1 MOE 920 398167 52527 52538 CAGGCCATGTGG 1-10-1
MOE 1059 147682 52571 52582 CGGGTACTATGG 1-10-1 MOE 992 147728
52574 52585 GCCAGACAGAAG 1-10-1 MOE 1013 147724 52615 52626
GAAATTGAGGAA 1-10-1 MOE 1139 147729 52629 52640 GTAAGAGGCAGG 1-10-1
MOE 920 147703 52670 52681 TGGCTTCATGTC 1-10-1 MOE 971 398167 52673
52684 CAGGCCATGTGG 1-10-1 MOE 1059 398165 52708 52719 GTTCTTAGGAAG
1-10-1 MOE 968 147704 52710 52721 TTGTTCTTAGGA 1-10-1 MOE 1012
147705 52716 52727 CGGTTTTTGTTC 1-10-1 MOE 1002 147724 52761 52772
GAAATTGAGGAA 1-10-1 MOE 1139 398167 52762 52773 CAGGCCATGTGG 1-10-1
MOE 1059 147703 52816 52827 TGGCTTCATGTC 1-10-1 MOE 971 398165
52854 52865 GTTCTTAGGAAG 1-10-1 MOE 968 147704 52856 52867
TTGTTCTTAGGA 1-10-1 MOE 1012 147705 52862 52873 CGGTTTTTGTTC 1-10-1
MOE 1002 398167 52908 52919 CAGGCCATGTGG 1-10-1 MOE 1059 147689
53063 53074 CAGAGAAGGTCT 1-10-1 MOE 987 147727 53111 53122
CAGTGGACCACA 1-10-1 MOE 1128 147727 53158 53169 CAGTGGACCACA 1-10-1
MOE 1128 147689 53209 53220 CAGAGAAGGTCT 1-10-1 MOE 987 147727
53257 53268 CAGTGGACCACA 1-10-1 MOE 1128 147727 53304 53315
CAGTGGACCACA 1-10-1 MOE 1128 147680 53638 53649 GTATGCACTGCT 1-10-1
MOE 988 147722 53650 53661 AAAGTCAGGCCA 1-10-1 MOE 1130
147083 53703 53714 TACACCAGGTCA 1-10-1 MOE 973 147085 53705 53716
TCTACACCAGGT 1-10-1 MOE 961 147086 53706 53717 CTCTACACCAGG 1-10-1
MOE 969 398167 53724 53735 CAGGCCATGTGG 1-10-1 MOE 1059 147684
53747 53758 ACCCAGTCAGGG 1-10-1 MOE 964 147680 53784 53795
GTATGCACTGCT 1-10-1 MOE 988 147722 53796 53807 AAAGTCAGGCCA 1-10-1
MOE 1130 147085 53851 53862 TCTACACCAGGT 1-10-1 MOE 961 398167
53870 53881 CAGGCCATGTGG 1-10-1 MOE 1059 147684 53893 53904
ACCCAGTCAGGG 1-10-1 MOE 964 398155 54026 54039 TGTTTTTACACAGA
2-10-2 MOE 970 147703 54137 54148 TGGCTTCATGTC 1-10-1 MOE 971
398155 54172 54185 TGTTTTTACACAGA 2-10-2 MOE 970 147705 54275 54286
CGGTTTTTGTTC 1-10-1 MOE 1002 147703 54283 54294 TGGCTTCATGTC 1-10-1
MOE 971 147705 54421 54432 CGGTTTTTGTTC 1-10-1 MOE 1002 147727
54853 54864 CAGTGGACCACA 1-10-1 MOE 1128 398165 54963 54974
GTTCTTAGGAAG 1-10-1 MOE 968 398090 54963 54976 TTGTTCTTAGGAAG
2-10-2 MOE 972 147704 54965 54976 TTGTTCTTAGGA 1-10-1 MOE 1012
147705 54971 54982 CGGTTTTTGTTC 1-10-1 MOE 1002 147727 54999 55010
CAGTGGACCACA 1-10-1 MOE 1128 398165 55109 55120 GTTCTTAGGAAG 1-10-1
MOE 968 147704 55111 55122 TTGTTCTTAGGA 1-10-1 MOE 1012 147705
55117 55128 CGGTTTTTGTTC 1-10-1 MOE 1002 147083 55352 55363
TACACCAGGTCA 1-10-1 MOE 973 147705 55378 55389 CGGTTTTTGTTC 1-10-1
MOE 1002 147705 55524 55535 CGGTTTTTGTTC 1-10-1 MOE 1002 147712
55819 55830 ACACCATCTCCC 1-10-1 MOE 1005 147712 55965 55976
ACACCATCTCCC 1-10-1 MOE 1005 147733 56289 56300 TTCTTGATGTCC 1-10-1
MOE 891 147707 56300 56311 TAGTCATTATCT 1-10-1 MOE 977 147708 56306
56317 TTGATATAGTCA 1-10-1 MOE 997 390030 56321 56332 TTTATAAAACTG
1-10-1 MOE 1074 147081 56333 56344 GCTCCTTCCACT 1-10-1 MOE 1006
398166 56335 56346 GGGCTTCTTCCA 1-10-1 MOE 1070 147733 56435 56446
TTCTTGATGTCC 1-10-1 MOE 891 147707 56446 56457 TAGTCATTATCT 1-10-1
MOE 977 147708 56452 56463 TTGATATAGTCA 1-10-1 MOE 997 390030 56467
56478 TTTATAAAACTG 1-10-1 MOE 1074 147081 56479 56490 GCTCCTTCCACT
1-10-1 MOE 1006 398091 56479 56492 GGGCTTCTTCCATT 2-10-2 MOE 979
398166 56481 56492 GGGCTTCTTCCA 1-10-1 MOE 1070 368366 56518 56531
CTGATCCTTAGAAG 2-10-2 MOE 1019 147743 57612 57623 AGGGCTTCCAGT
1-10-1 MOE 1042 147700 57709 57720 GCGCTAGGCCGC 1-10-1 MOE 1110
147743 57758 57769 AGGGCTTCCAGT 1-10-1 MOE 1042 147700 57855 57866
GCGCTAGGCCGC 1-10-1 MOE 1110 398093 57963 57976 TCGGACTTTGAAAA
2-10-2 MOE 1009 398168 57965 57976 TCGGACTTTGAA 1-10-1 MOE 1008
147698 58105 58116 CCCGCCACCACC 1-10-1 MOE 928 398093 58109 58122
TCGGACTTTGAAAA 2-10-2 MOE 1009 398168 58111 58122 TCGGACTTTGAA
1-10-1 MOE 1008 147698 58251 58262 CCCGCCACCACC 1-10-1 MOE 928
147735 58279 58290 GGAGAAGCGCAG 1-10-1 MOE 1016 147735 58425 58436
GGAGAAGCGCAG 1-10-1 MOE 1016 404135 58946 58959 CATTTCCATGGCCA
2-10-2 MOE 1056 390030 59326 59337 TTTATAAAACTG 1-10-1 MOE 1074
147711 59357 59368 AAGGGCCCTGGG 1-10-1 MOE 1040 147743 59382 59393
AGGGCTTCCAGT 1-10-1 MOE 1042 147711 59503 59514 AAGGGCCCTGGG 1-10-1
MOE 1040 147743 59528 59539 AGGGCTTCCAGT 1-10-1 MOE 1042 147695
59576 59587 TCATTCCCCACT 1-10-1 MOE 984 147713 59716 59727
CTCCCACACCAT 1-10-1 MOE 985 147714 59721 59732 TTCTGCTCCCAC 1-10-1
MOE 986 147715 59746 59757 GTTGAGCATGAC 1-10-1 MOE 1077 147716
59771 59782 TTAACGAGCCTT 1-10-1 MOE 949 147712 59857 59868
ACACCATCTCCC 1-10-1 MOE 1005 147714 59867 59878 TTCTGCTCCCAC 1-10-1
MOE 986 147715 59892 59903 GTTGAGCATGAC 1-10-1 MOE 1077 147716
59917 59928 TTAACGAGCCTT 1-10-1 MOE 949 390030 59993 60004
TTTATAAAACTG 1-10-1 MOE 1074 147690 60270 60281 TGAAGTTAATTC 1-10-1
MOE 1138 389949 60325 60336 GCGCGAGCCCGA 1-10-1 MOE 1061 147690
60416 60427 TGAAGTTAATTC 1-10-1 MOE 1138 389949 60471 60482
GCGCGAGCCCGA 1-10-1 MOE 1061 147746 60619 60630 TAAAAACAACAA 1-10-1
MOE 1073 384545 60676 60687 CAAGTAGGATGT 1-10-1 MOE 951 147746
60765 60776 TAAAAACAACAA 1-10-1 MOE 1073 384545 60822 60833
CAAGTAGGATGT 1-10-1 MOE 951 147689 60967 60978 CAGAGAAGGTCT 1-10-1
MOE 987 147689 61008 61019 CAGAGAAGGTCT 1-10-1 MOE 987 147689 61049
61060 CAGAGAAGGTCT 1-10-1 MOE 987 398105 61121 61134 TGCACAGGCAGGTT
2-10-2 MOE 1066 147689 61154 61165 CAGAGAAGGTCT 1-10-1 MOE 987
147689 61195 61206 CAGAGAAGGTCT 1-10-1 MOE 987 398105 61267 61280
TGCACAGGCAGGTT 2-10-2 MOE 1066 147692 61365 61376 CTCACCTTCATG
1-10-1 MOE 1113 147692 61511 61522 CTCACCTTCATG 1-10-1 MOE 1113
147680 61619 61630 GTATGCACTGCT 1-10-1 MOE 988 147078 61755 61766
CCTTCCACTGAT 1-10-1 MOE 1044 147079 61756 61767 TCCTTCCACTGA 1-10-1
MOE 1001 147080 61757 61768 CTCCTTCCACTG 1-10-1 MOE 1021 147078
61901 61912 CCTTCCACTGAT 1-10-1 MOE 1044 147079 61902 61913
TCCTTCCACTGA 1-10-1 MOE 1001 147080 61903 61914 CTCCTTCCACTG 1-10-1
MOE 1021 147088 62361 62372 CCCTCTACACCA 1-10-1 MOE 1050 401384
62573 62586 TGAACACATCACTA 2-10-2 MOE 933 147688 62697 62708
TCCCAAACAAAT 1-10-1 MOE 990 147746 63102 63113 TAAAAACAACAA 1-10-1
MOE 1073 147721 63225 63236 AATGCAGGATCT 1-10-1 MOE 1118 147742
63226 63237 AACTTCAGTGTC 1-10-1 MOE 1041 147746 63248 63259
TAAAAACAACAA 1-10-1 MOE 1073 147682 63337 63348 CGGGTACTATGG 1-10-1
MOE 992 147721 63371 63382 AATGCAGGATCT 1-10-1 MOE 1118 147742
63372 63383 AACTTCAGTGTC 1-10-1 MOE 1041 147688 63401 63412
TCCCAAACAAAT 1-10-1 MOE 990 147097 63449 63460 GTTGTTGTTCCC 1-10-1
MOE 1111 147098 63450 63461 AGTTGTTGTTCC 1-10-1 MOE 1112 401409
63458 63471 ATTCTTAACACAGA 2-10-2 MOE 991 147084 63531 63542
CTACACCAGGTC 1-10-1 MOE 993 147688 63547 63558 TCCCAAACAAAT 1-10-1
MOE 990 147097 63595 63606 GTTGTTGTTCCC 1-10-1 MOE 1111 147098
63596 63607 AGTTGTTGTTCC 1-10-1 MOE 1112 147721 64086 64097
AATGCAGGATCT 1-10-1 MOE 1118 147721 64232 64243 AATGCAGGATCT 1-10-1
MOE 1118 147692 64233 64244 CTCACCTTCATG 1-10-1 MOE 1113 147692
64379 64390 CTCACCTTCATG 1-10-1 MOE 1113 147729 64633 64644
GTAAGAGGCAGG 1-10-1 MOE 920 401403 64746 64759 TTTCCTAGGAGGTG
2-10-2 MOE 967 147729 64779 64790 GTAAGAGGCAGG 1-10-1 MOE 920
147746 65151 65162 TAAAAACAACAA 1-10-1 MOE 1073 147746 65297 65308
TAAAAACAACAA 1-10-1 MOE 1073 147689 65302 65313 CAGAGAAGGTCT 1-10-1
MOE 987 147689 65448 65459 CAGAGAAGGTCT 1-10-1 MOE 987 147717 65862
65873 ATCTTCAGAGAT 1-10-1 MOE 996
147717 65895 65906 ATCTTCAGAGAT 1-10-1 MOE 996 147729 66000 66011
GTAAGAGGCAGG 1-10-1 MOE 920 147717 66008 66019 ATCTTCAGAGAT 1-10-1
MOE 996 147717 66041 66052 ATCTTCAGAGAT 1-10-1 MOE 996 147708 66046
66057 TTGATATAGTCA 1-10-1 MOE 997 147718 66055 66066 TAATATGACTTG
1-10-1 MOE 998 147729 66146 66157 GTAAGAGGCAGG 1-10-1 MOE 920
147089 66236 66247 TCCCTCTACACC 1-10-1 MOE 956 368363 66281 66294
CTTAGAAGGCAGCA 2-10-2 MOE 1114 147727 66293 66304 CAGTGGACCACA
1-10-1 MOE 1128 147093 66319 66330 TTGTTCCCTCTA 1-10-1 MOE 929
147094 66320 66331 GTTGTTCCCTCT 1-10-1 MOE 1115 147089 66382 66393
TCCCTCTACACC 1-10-1 MOE 956 368363 66427 66440 CTTAGAAGGCAGCA
2-10-2 MOE 1114 147727 66439 66450 CAGTGGACCACA 1-10-1 MOE 1128
147719 66441 66452 CCAACTCCAACT 1-10-1 MOE 1116 147093 66465 66476
TTGTTCCCTCTA 1-10-1 MOE 929 147094 66466 66477 GTTGTTCCCTCT 1-10-1
MOE 1115 147075 66561 66572 TCCACTGATCCT 1-10-1 MOE 1026 368357
66562 66575 CCTTCCACTGATCC 2-10-2 MOE 1046 147076 66562 66573
TTCCACTGATCC 1-10-1 MOE 1029 368377 66562 66577 CTCCTTCCACTGATCC
3-10-3 MOE 1030 147077 66563 66574 CTTCCACTGATC 1-10-1 MOE 1047
368358 66563 66576 TCCTTCCACTGATC 2-10-2 MOE 1031 147078 66564
66575 CCTTCCACTGAT 1-10-1 MOE 1044 147079 66565 66576 TCCTTCCACTGA
1-10-1 MOE 1001 147080 66566 66577 CTCCTTCCACTG 1-10-1 MOE 1021
147081 66567 66578 GCTCCTTCCACT 1-10-1 MOE 1006 147719 66587 66598
CCAACTCCAACT 1-10-1 MOE 1116 147075 66707 66718 TCCACTGATCCT 1-10-1
MOE 1026 368377 66708 66723 CTCCTTCCACTGATCC 3-10-3 MOE 1030 147076
66708 66719 TTCCACTGATCC 1-10-1 MOE 1029 368357 66708 66721
CCTTCCACTGATCC 2-10-2 MOE 1046 147077 66709 66720 CTTCCACTGATC
1-10-1 MOE 1047 147078 66710 66721 CCTTCCACTGAT 1-10-1 MOE 1044
147079 66711 66722 TCCTTCCACTGA 1-10-1 MOE 1001 147080 66712 66723
CTCCTTCCACTG 1-10-1 MOE 1021 147081 66713 66724 GCTCCTTCCACT 1-10-1
MOE 1006 147089 66842 66853 TCCCTCTACACC 1-10-1 MOE 956 147089
66988 66999 TCCCTCTACACC 1-10-1 MOE 956 147075 66999 67010
TCCACTGATCCT 1-10-1 MOE 1026 147075 67145 67156 TCCACTGATCCT 1-10-1
MOE 1026 147705 67213 67224 CGGTTTTTGTTC 1-10-1 MOE 1002 401413
67301 67314 TGCAGCCATGTACT 2-10-2 MOE 1022 147737 67309 67320
ACAGCCAGGTAG 1-10-1 MOE 1067 147080 67430 67441 CTCCTTCCACTG 1-10-1
MOE 1021 147737 67455 67466 ACAGCCAGGTAG 1-10-1 MOE 1067 147080
67576 67587 CTCCTTCCACTG 1-10-1 MOE 1021 147082 67578 67589
AGCTCCTTCCAC 1-10-1 MOE 1036 147090 67582 67593 TTCCCTCTACAC 1-10-1
MOE 955 147091 67583 67594 GTTCCCTCTACA 1-10-1 MOE 1004 147742
67591 67602 AACTTCAGTGTC 1-10-1 MOE 1041 147090 67728 67739
TTCCCTCTACAC 1-10-1 MOE 955 147698 68036 68047 CCCGCCACCACC 1-10-1
MOE 928 147698 68182 68193 CCCGCCACCACC 1-10-1 MOE 928 147681 68267
68278 ATGTCATTAAAC 1-10-1 MOE 965 147721 68386 68397 AATGCAGGATCT
1-10-1 MOE 1118 147681 68413 68424 ATGTCATTAAAC 1-10-1 MOE 965
147712 68527 68538 ACACCATCTCCC 1-10-1 MOE 1005 147721 68532 68543
AATGCAGGATCT 1-10-1 MOE 1118 147711 68760 68771 AAGGGCCCTGGG 1-10-1
MOE 1040 147711 68906 68917 AAGGGCCCTGGG 1-10-1 MOE 1040 147696
69045 69056 TGGATGATTGGC 1-10-1 MOE 906 147696 69191 69202
TGGATGATTGGC 1-10-1 MOE 906 147723 69194 69205 GACTCCAAAGTC 1-10-1
MOE 892 147723 69210 69221 GACTCCAAAGTC 1-10-1 MOE 892 389965 69271
69282 CTGCAACATGAT 1-10-1 MOE 1018 389764 69271 69282 CTGCAACATGAT
1-9-2 MOE 1018 147723 69340 69351 GACTCCAAAGTC 1-10-1 MOE 892
147723 69356 69367 GACTCCAAAGTC 1-10-1 MOE 892 398101 69357 69370
TTTGATAAAGCCCT 2-10-2 MOE 1064 389965 69417 69428 CTGCAACATGAT
1-10-1 MOE 1018 389764 69417 69428 CTGCAACATGAT 1-9-2 MOE 1018
398101 69503 69516 TTTGATAAAGCCCT 2-10-2 MOE 1064 368353 69519
69532 CACTGATCCTGCAC 2-10-2 MOE 1007 147074 69522 69533
CCACTGATCCTG 1-10-1 MOE 845 147081 69631 69642 GCTCCTTCCACT 1-10-1
MOE 1006 368353 69665 69678 CACTGATCCTGCAC 2-10-2 MOE 1007 147720
69729 69740 GATCTCTCGAGT 1-10-1 MOE 1117 147721 69736 69747
AATGCAGGATCT 1-10-1 MOE 1118 398167 69757 69768 CAGGCCATGTGG 1-10-1
MOE 1059 147722 69762 69773 AAAGTCAGGCCA 1-10-1 MOE 1130 147723
69768 69779 GACTCCAAAGTC 1-10-1 MOE 892 147080 69776 69787
CTCCTTCCACTG 1-10-1 MOE 1021 147081 69777 69788 GCTCCTTCCACT 1-10-1
MOE 1006 398093 69811 69824 TCGGACTTTGAAAA 2-10-2 MOE 1009 398168
69813 69824 TCGGACTTTGAA 1-10-1 MOE 1008 147725 69814 69825
CTCGGACTTTGA 1-10-1 MOE 1119 147726 69819 69830 TGACTCTCGGAC 1-10-1
MOE 1120 147727 69860 69871 CAGTGGACCACA 1-10-1 MOE 1128 147720
69875 69886 GATCTCTCGAGT 1-10-1 MOE 1117 147721 69882 69893
AATGCAGGATCT 1-10-1 MOE 1118 147728 69899 69910 GCCAGACAGAAG 1-10-1
MOE 1013 398094 69901 69914 ATCAGCCAGACAGA 2-10-2 MOE 1010 398167
69903 69914 CAGGCCATGTGG 1-10-1 MOE 1059 398092 69904 69917
AGTCAGGCCATGTG 2-10-2 MOE 1060 147722 69908 69919 AAAGTCAGGCCA
1-10-1 MOE 1130 147723 69914 69925 GACTCCAAAGTC 1-10-1 MOE 892
147729 69916 69927 GTAAGAGGCAGG 1-10-1 MOE 920 398095 69919 69932
CATCAGCAAGAGGC 2-10-2 MOE 1011 398093 69957 69970 TCGGACTTTGAAAA
2-10-2 MOE 1009 398168 69959 69970 TCGGACTTTGAA 1-10-1 MOE 1008
147725 69960 69971 CTCGGACTTTGA 1-10-1 MOE 1119 147726 69965 69976
TGACTCTCGGAC 1-10-1 MOE 1120 147704 69991 70002 TTGTTCTTAGGA 1-10-1
MOE 1012 147727 70006 70017 CAGTGGACCACA 1-10-1 MOE 1128 147728
70045 70056 GCCAGACAGAAG 1-10-1 MOE 1013 398094 70047 70060
ATCAGCCAGACAGA 2-10-2 MOE 1010 398169 70048 70059 TCAGCCAGACAG
1-10-1 MOE 909 147729 70062 70073 GTAAGAGGCAGG 1-10-1 MOE 920
398095 70065 70078 CATCAGCAAGAGGC 2-10-2 MOE 1011 147704 70137
70148 TTGTTCTTAGGA 1-10-1 MOE 1012 147697 70161 70172 CCCCAGCAGCGG
1-10-1 MOE 1000 147697 70307 70318 CCCCAGCAGCGG 1-10-1 MOE 1000
147728 70450 70461 GCCAGACAGAAG 1-10-1 MOE 1013 398164 70464 70475
TTGTCGATCTGC 1-10-1 MOE 1014 147730 70465 70476 CTTGTCCATCAG 1-10-1
MOE 1121 147731 70471 70482 TTTCCTCTTGTC 1-10-1 MOE 934 147732
70476 70487 GGGTCTTTCCTC 1-10-1 MOE 1122 147733 70497 70508
TTCTTGATGTCC 1-10-1 MOE 891 398096 70562 70575 GGAGAAGCGCAGCT
2-10-2 MOE 1015 147735 70564 70575 GGAGAAGCGCAG 1-10-1 MOE 1016
147736 70569 70580 AGGTAGGAGAAG 1-10-1 MOE 963 147737 70575 70586
ACAGCCAGGTAG 1-10-1 MOE 1067 147728 70596 70607 GCCAGACAGAAG 1-10-1
MOE 1013
398164 70610 70621 TTGTCGATCTGC 1-10-1 MOE 1014 147730 70611 70622
CTTGTCCATCAG 1-10-1 MOE 1121 368349 70616 70629 CTGCACTGACGAGT
2-10-2 MOE 1017 147731 70617 70628 TTTCCTCTTGTC 1-10-1 MOE 934
147732 70622 70633 GGGTCTTTCCTC 1-10-1 MOE 1122 147733 70643 70654
TTCTTGATGTCC 1-10-1 MOE 891 398096 70708 70721 GGAGAAGCGCAGCT
2-10-2 MOE 1015 147735 70710 70721 GGAGAAGCGCAG 1-10-1 MOE 1016
147736 70715 70726 AGGTAGGAGAAG 1-10-1 MOE 963 147737 70721 70732
ACAGCCAGGTAG 1-10-1 MOE 1067 389764 70784 70795 CTGCAACATGAT 1-9-2
MOE 1018 389965 70784 70795 CTGCAACATGAT 1-10-1 MOE 1018 389965
70930 70941 CTGCAACATGAT 1-10-1 MOE 1018 389764 70930 70941
CTGCAACATGAT 1-9-2 MOE 1018 368386 70995 71010 CACTGATCCTTAGAAG
3-10-3 MOE 1123 368367 70997 71010 CACTGATCCTTAGA 2-10-2 MOE 1124
368387 70997 71012 TCCACTGATCCTTAGA 3-10-3 MOE 1125 368354 70999
71012 TCCACTGATCCTGC 2-10-2 MOE 1024 368374 70999 71014
CTTCCACTGATCCTGC 3-10-3 MOE 1126 368368 70999 71012 TCCACTGATCCTTA
2-10-2 MOE 1127 368388 70999 71014 CTTCCACTGATCCTTA 3-10-3 MOE 895
368355 71000 71013 TTCCACTGATCCTG 2-10-2 MOE 1025 147074 71000
71011 CCACTGATCCTG 1-10-1 MOE 845 368375 71000 71015
CCTTCCACTGATCCTG 3-10-3 MOE 1020 147075 71001 71012 TCCACTGATCCT
1-10-1 MOE 1026 368376 71001 71016 TCCTTCCACTGATCCT 3-10-3 MOE 1028
147076 71002 71013 TTCCACTGATCC 1-10-1 MOE 1029 368357 71002 71015
CCTTCCACTGATCC 2-10-2 MOE 1046 368377 71002 71017 CTCCTTCCACTGATCC
3-10-3 MOE 1030 147077 71003 71014 CTTCCACTGATC 1-10-1 MOE 1047
368378 71003 71018 GCTCCTTCCACTGATC 3-10-3 MOE 1032 147078 71004
71015 CCTTCCACTGAT 1-10-1 MOE 1044 368359 71005 71018
GCTCCTTCCACTGA 2-10-2 MOE 1033 368379 71005 71020 AAGCTCCTTCCACTGA
3-10-3 MOE 1034 147079 71005 71016 TCCTTCCACTGA 1-10-1 MOE 1001
147080 71006 71017 CTCCTTCCACTG 1-10-1 MOE 1021 368360 71007 71020
AAGCTCCTTCCACT 2-10-2 MOE 1035 368380 71007 71022 GAAAGCTCCTTCCACT
3-10-3 MOE 896 147081 71007 71018 GCTCCTTCCACT 1-10-1 MOE 1006
147082 71008 71019 AGCTCCTTCCAC 1-10-1 MOE 1036 368361 71009 71022
GAAAGCTCCTTCCA 2-10-2 MOE 962 368381 71009 71024 GGGAAAGCTCCTTCCA
3-10-3 MOE 1037 147738 71067 71078 TGGGTGGCCGGG 1-10-1 MOE 1069
147739 71071 71082 CGTTTGGGTGGC 1-10-1 MOE 1023 147740 71088 71099
TGTGAGGCTCCA 1-10-1 MOE 1062 147741 71129 71140 CACCCACTGGTG 1-10-1
MOE 1055 368366 71141 71154 CTGATCCTTAGAAG 2-10-2 MOE 1019 368386
71141 71156 CACTGATCCTTAGAAG 3-10-3 MOE 1123 368367 71143 71156
CACTGATCCTTAGA 2-10-2 MOE 1124 368387 71143 71158 TCCACTGATCCTTAGA
3-10-3 MOE 1125 368374 71145 71160 CTTCCACTGATCCTGC 3-10-3 MOE 1126
368354 71145 71158 TCCACTGATCCTGC 2-10-2 MOE 1024 368368 71145
71158 TCCACTGATCCTTA 2-10-2 MOE 1127 368388 71145 71160
CTTCCACTGATCCTTA 3-10-3 MOE 895 368355 71146 71159 TTCCACTGATCCTG
2-10-2 MOE 1025 368375 71146 71161 CCTTCCACTGATCCTG 3-10-3 MOE 1020
147075 71147 71158 TCCACTGATCCT 1-10-1 MOE 1026 368356 71147 71160
CTTCCACTGATCCT 2-10-2 MOE 1027 368376 71147 71162 TCCTTCCACTGATCCT
3-10-3 MOE 1028 147076 71148 71159 TTCCACTGATCC 1-10-1 MOE 1029
368357 71148 71161 CCTTCCACTGATCC 2-10-2 MOE 1046 368377 71148
71163 CTCCTTCCACTGATCC 3-10-3 MOE 1030 147077 71149 71160
CTTCCACTGATC 1-10-1 MOE 1047 368358 71149 71162 TCCTTCCACTGATC
2-10-2 MOE 1031 368378 71149 71164 GCTCCTTCCACTGATC 3-10-3 MOE 1032
147078 71150 71161 CCTTCCACTGAT 1-10-1 MOE 1044 368359 71151 71164
GCTCCTTCCACTGA 2-10-2 MOE 1033 147079 71151 71162 TCCTTCCACTGA
1-10-1 MOE 1001 368379 71151 71166 AAGCTCCTTCCACTGA 3-10-3 MOE 1034
147080 71152 71163 CTCCTTCCACTG 1-10-1 MOE 1021 368380 71153 71168
GAAAGCTCCTTCCACT 3-10-3 MOE 896 147081 71153 71164 GCTCCTTCCACT
1-10-1 MOE 1006 368360 71153 71166 AAGCTCCTTCCACT 2-10-2 MOE 1035
147082 71154 71165 AGCTCCTTCCAC 1-10-1 MOE 1036 368381 71155 71170
GGGAAAGCTCCTTCCA 3-10-3 MOE 1037 368361 71155 71168 GAAAGCTCCTTCCA
2-10-2 MOE 962 398097 71158 71171 GGCAGTCTTTATCC 2-10-2 MOE 897
147738 71213 71224 TGGGTGGCCGGG 1-10-1 MOE 1069 147739 71217 71228
CGTTTGGGTGGC 1-10-1 MOE 1023 147740 71234 71245 TGTGAGGCTCCA 1-10-1
MOE 1062 147741 71275 71286 CACCCACTGGTG 1-10-1 MOE 1055 398097
71304 71317 GGCAGTCTTTATCC 2-10-2 MOE 897 147727 71702 71713
CAGTGGACCACA 1-10-1 MOE 1128 147727 71848 71859 CAGTGGACCACA 1-10-1
MOE 1128 390030 71986 71997 TTTATAAAACTG 1-10-1 MOE 1074 147102
72015 72026 TGCGAGTTGTTG 1-10-1 MOE 1129 390030 72132 72143
TTTATAAAACTG 1-10-1 MOE 1074 147102 72161 72172 TGCGAGTTGTTG 1-10-1
MOE 1129 147722 72199 72210 AAAGTCAGGCCA 1-10-1 MOE 1130 147696
72232 72243 TGGATGATTGGC 1-10-1 MOE 906 147741 72254 72265
CACCCACTGGTG 1-10-1 MOE 1055 147722 72345 72356 AAAGTCAGGCCA 1-10-1
MOE 1130 147696 72378 72389 TGGATGATTGGC 1-10-1 MOE 906 147741
72400 72411 CACCCACTGGTG 1-10-1 MOE 1055 147711 72446 72457
AAGGGCCCTGGG 1-10-1 MOE 1040 398098 72574 72587 TAACTTCAGTGTCT
2-10-2 MOE 1131 147742 72575 72586 AACTTCAGTGTC 1-10-1 MOE 1041
147698 72595 72606 CCCGCCACCACC 1-10-1 MOE 928 147743 72690 72701
AGGGCTTCCAGT 1-10-1 MOE 1042 398099 72690 72703 GAAGGGCTTCCAGT
2-10-2 MOE 1132 147744 72694 72705 AGGAAGGGCTTC 1-10-1 MOE 1043
398100 72697 72710 TGACCAGGAAGGGC 2-10-2 MOE 1133 147745 72700
72711 TTGACCAGGAAG 1-10-1 MOE 1058 398098 72720 72733
TAACTTCAGTGTCT 2-10-2 MOE 1131 147742 72721 72732 AACTTCAGTGTC
1-10-1 MOE 1041 147698 72741 72752 CCCGCCACCACC 1-10-1 MOE 928
398157 72757 72770 GGAAACATACCCTG 2-10-2 MOE 1045 147743 72836
72847 AGGGCTTCCAGT 1-10-1 MOE 1042 398099 72836 72849
GAAGGGCTTCCAGT 2-10-2 MOE 1132 147744 72840 72851 AGGAAGGGCTTC
1-10-1 MOE 1043 398100 72843 72856 TGACCAGGAAGGGC 2-10-2 MOE 1133
147745 72846 72857 TTGACCAGGAAG 1-10-1 MOE 1058 147076 72898 72909
TTCCACTGATCC 1-10-1 MOE 1029 368357 72898 72911 CCTTCCACTGATCC
2-10-2 MOE 1046 147077 72899 72910 CTTCCACTGATC 1-10-1 MOE 1047
147078 72900 72911 CCTTCCACTGAT 1-10-1 MOE 1044 398157 72903 72916
GGAAACATACCCTG 2-10-2 MOE 1045 398158 72983 72996 AGGCCCTGAGATTA
2-10-2 MOE 1134 398159 72988 73001 GGTTAAGGCCCTGA 2-10-2 MOE 1135
398160 72993 73006 GAATAGGTTAAGGC 2-10-2 MOE 1048 147076 73044
73055 TTCCACTGATCC 1-10-1 MOE 1029 368357 73044 73057
CCTTCCACTGATCC 2-10-2 MOE 1046 147077 73045 73056 CTTCCACTGATC
1-10-1 MOE 1047 147078 73046 73057 CCTTCCACTGAT 1-10-1 MOE 1044
147746 73052 73063 TAAAAACAACAA 1-10-1 MOE 1073 398161 73092 73105
AACAATGTGTTGTA 2-10-2 MOE 1049
147746 73101 73112 TAAAAACAACAA 1-10-1 MOE 1073 398158 73129 73142
AGGCCCTGAGATTA 2-10-2 MOE 1134 398159 73134 73147 GGTTAAGGCCCTGA
2-10-2 MOE 1135 398160 73139 73152 GAATAGGTTAAGGC 2-10-2 MOE 1048
147746 73198 73209 TAAAAACAACAA 1-10-1 MOE 1073 398161 73238 73251
AACAATGTGTTGTA 2-10-2 MOE 1049 147746 73247 73258 TAAAAACAACAA
1-10-1 MOE 1073 147088 73273 73284 CCCTCTACACCA 1-10-1 MOE 1050
398105 73401 73414 TGCACAGGCAGGTT 2-10-2 MOE 1066 398105 73547
73560 TGCACAGGCAGGTT 2-10-2 MOE 1066 147741 73559 73570
CACCCACTGGTG 1-10-1 MOE 1055 147741 73705 73716 CACCCACTGGTG 1-10-1
MOE 1055 398162 73968 73981 ACCAAACAGTTCAG 2-10-2 MOE 1057 147745
73991 74002 TTGACCAGGAAG 1-10-1 MOE 1058 398167 74008 74019
CAGGCCATGTGG 1-10-1 MOE 1059 398092 74009 74022 AGTCAGGCCATGTG
2-10-2 MOE 1060 398162 74114 74127 ACCAAACAGTTCAG 2-10-2 MOE 1057
147745 74137 74148 TTGACCAGGAAG 1-10-1 MOE 1058 398167 74154 74165
CAGGCCATGTGG 1-10-1 MOE 1059 147089 74280 74291 TCCCTCTACACC 1-10-1
MOE 956 147090 74281 74292 TTCCCTCTACAC 1-10-1 MOE 955 389949 74310
74321 GCGCGAGCCCGA 1-10-1 MOE 1061 147740 74339 74350 TGTGAGGCTCCA
1-10-1 MOE 1062 389950 74381 74392 CCCTGAAGGTTC 1-10-1 MOE 1063
147089 74426 74437 TCCCTCTACACC 1-10-1 MOE 956 147090 74427 74438
TTCCCTCTACAC 1-10-1 MOE 955 389949 74456 74467 GCGCGAGCCCGA 1-10-1
MOE 1061 147685 74490 74501 GGCTGACATTCA 1-10-1 MOE 975 398101
74510 74523 TTTGATAAAGCCCT 2-10-2 MOE 1064 398102 74536 74549
CTACCTGAGGATTT 2-10-2 MOE 899 398103 74543 74556 CCCAGTACTACCTG
2-10-2 MOE 900 147685 74636 74647 GGCTGACATTCA 1-10-1 MOE 975
398102 74682 74695 CTACCTGAGGATTT 2-10-2 MOE 899 398103 74689 74702
CCCAGTACTACCTG 2-10-2 MOE 900 147736 74737 74748 AGGTAGGAGAAG
1-10-1 MOE 963 398104 74805 74818 CAAGAAGACCTTAC 2-10-2 MOE 1065
147736 74883 74894 AGGTAGGAGAAG 1-10-1 MOE 963 147737 74893 74904
ACAGCCAGGTAG 1-10-1 MOE 1067 398105 74894 74907 TGCACAGGCAGGTT
2-10-2 MOE 1066 147737 74919 74930 ACAGCCAGGTAG 1-10-1 MOE 1067
398095 74940 74953 CATCAGCAAGAGGC 2-10-2 MOE 1011 398104 74951
74964 CAAGAAGACCTTAC 2-10-2 MOE 1065 398106 74974 74987
TGGAAAACTGCACC 2-10-2 MOE 1068 398107 74980 74993 TATTCCTGGAAAAC
2-10-2 MOE 902 147745 75030 75041 TTGACCAGGAAG 1-10-1 MOE 1058
147737 75039 75050 ACAGCCAGGTAG 1-10-1 MOE 1067 398105 75040 75053
TGCACAGGCAGGTT 2-10-2 MOE 1066 147737 75065 75076 ACAGCCAGGTAG
1-10-1 MOE 1067 398108 75077 75090 GGAATGTCTGAGTT 2-10-2 MOE 1136
398095 75086 75099 CATCAGCAAGAGGC 2-10-2 MOE 1011 147691 75108
75119 GAGGTGGGAAAA 1-10-1 MOE 966 398106 75120 75133 TGGAAAACTGCACC
2-10-2 MOE 1068 398107 75126 75139 TATTCCTGGAAAAC 2-10-2 MOE 902
147738 75155 75166 TGGGTGGCCGGG 1-10-1 MOE 1069 147745 75176 75187
TTGACCAGGAAG 1-10-1 MOE 1058 398108 75223 75236 GGAATGTCTGAGTT
2-10-2 MOE 1136 398109 75247 75260 CAAGAAGTGTGGTT 2-10-2 MOE 903
147691 75254 75265 GAGGTGGGAAAA 1-10-1 MOE 966 147738 75301 75312
TGGGTGGCCGGG 1-10-1 MOE 1069 398110 75385 75398 GTTCCCTTTGCAGG
2-10-2 MOE 952 147091 75387 75398 GTTCCCTCTACA 1-10-1 MOE 1004
398109 75393 75406 CAAGAAGTGTGGTT 2-10-2 MOE 903 398111 75470 75483
GTGAAAATGCTGGC 2-10-2 MOE 904 401385 75494 75507 CCCAGTGGGTTTGA
2-10-2 MOE 890 398166 75499 75510 GGGCTTCTTCCA 1-10-1 MOE 1070
147091 75525 75536 GTTCCCTCTACA 1-10-1 MOE 1004 147092 75526 75537
TGTTCCCTCTAC 1-10-1 MOE 901 398110 75531 75544 GTTCCCTTTGCAGG
2-10-2 MOE 952 147091 75533 75544 GTTCCCTCTACA 1-10-1 MOE 1004
147706 75540 75551 GCTGACATCTCG 1-10-1 MOE 1071 398112 75584 75597
CAGCCTGGCACCTA 2-10-2 MOE 1072 398111 75616 75629 GTGAAAATGCTGGC
2-10-2 MOE 904 147746 75617 75628 TAAAAACAACAA 1-10-1 MOE 1073
398166 75645 75656 GGGCTTCTTCCA 1-10-1 MOE 1070 147091 75671 75682
GTTCCCTCTACA 1-10-1 MOE 1004 147092 75672 75683 TGTTCCCTCTAC 1-10-1
MOE 901 398113 75693 75706 AGGAGGTTAAACCA 2-10-2 MOE 905 398112
75730 75743 CAGCCTGGCACCTA 2-10-2 MOE 1072 147746 75763 75774
TAAAAACAACAA 1-10-1 MOE 1073 398114 75770 75783 AGGCATATAGCAGA
2-10-2 MOE 1075 398115 75786 75799 AGTAAATATTGGCT 2-10-2 MOE 1076
398116 75799 75812 TAATGACCTGATGA 2-10-2 MOE 1137 398113 75839
75852 AGGAGGTTAAACCA 2-10-2 MOE 905 390030 75839 75850 TTTATAAAACTG
1-10-1 MOE 1074 398115 75932 75945 AGTAAATATTGGCT 2-10-2 MOE 1076
398116 75945 75958 TAATGACCTGATGA 2-10-2 MOE 1137 398106 75982
75995 TGGAAAACTGCACC 2-10-2 MOE 1068 390030 75985 75996
TTTATAAAACTG 1-10-1 MOE 1074 398106 76127 76140 TGGAAAACTGCACC
2-10-2 MOE 1068 147690 76196 76207 TGAAGTTAATTC 1-10-1 MOE 1138
147690 76341 76352 TGAAGTTAATTC 1-10-1 MOE 1138 147724 76740 76751
GAAATTGAGGAA 1-10-1 MOE 1139 147089 76873 76884 TCCCTCTACACC 1-10-1
MOE 956 147679 76881 76892 CAAAAGGATCCC 1-10-1 MOE 907 147724 76885
76896 GAAATTGAGGAA 1-10-1 MOE 1139 147089 77018 77029 TCCCTCTACACC
1-10-1 MOE 956 147679 77026 77037 CAAAAGGATCCC 1-10-1 MOE 907
147693 77240 77251 GTGCGCTCCCAT 1-10-1 MOE 1078 147697 77759 77770
CCCCAGCAGCGG 1-10-1 MOE 1000
[0744] In certain embodiments, a target region is nucleotides
177-190 of SEQ ID NO: 11. In certain embodiments, a short antisense
compound is targeted to nucleotides 177-190 of SEQ ID NO: 11. In
certain such embodiments, a short antisense compound targeted to
nucleotides 177-190 comprises a nucleotide sequence selected from
SEQ ID NO 886, 859, or 853. In certain such embodiments, a short
antisense compound targeted to nucleotides 177-190 of SEQ ID NO: 11
is selected from Isis No 147022, 147023, or 147024.
[0745] In certain embodiments, a target region is nucleotides
195-228 of SEQ ID NO: 11. In certain embodiments, a short antisense
compound is targeted to nucleotides 195-228 of SEQ ID NO: 11. In
certain such embodiments, a short antisense compound targeted to
nucleotides 195-228 comprises a nucleotide sequence selected from
SEQ ID NO 877, 868, 882, 886, 859, 853, 865, 835, 843, 846, 842,
848, 874, 849, 863, 855, 850, 864, or 834. In certain such
embodiments, a short antisense compound targeted to nucleotides
195-228 of SEQ ID NO: 11 is selected from Isis No 147019, 147020,
147021, 147022, 147023, 147024, 147025, 147026, 147027, 147028,
147073, 147029, 147030, 147036, 147037, 147038, 147039, 147040, or
147041.
[0746] In certain embodiments, a target region is nucleotides
323-353 of SEQ ID NO: 11. In certain embodiments, a short antisense
compound is targeted to nucleotides 323-353 of SEQ ID NO: 11. In
certain such embodiments, a short antisense compound targeted to
nucleotides 323-353 comprises a nucleotide sequence selected from
SEQ ID NO 866, 881, 869, 883, 858, 833, 875, 837, 829, 871, 884,
887, 839, 830, 840, 861, or 879. In certain such embodiments, a
short antisense compound targeted to nucleotides 323-353 of SEQ ID
NO: 11 is selected from Isis No 147042, 147043, 147044, 147045,
147046, 147047, 147051, 147052, 147053, 147054, 147055, 147056,
147057, 147058, 147059, 147060, or 147061.
[0747] In certain embodiments, a target region is nucleotides
322-353 of SEQ ID NO: 11. In certain embodiments, a short antisense
compound is targeted to nucleotides 322-353 of SEQ ID NO: 11. In
certain such embodiments, a short antisense compound targeted to
nucleotides 322-353 comprises a nucleotide sequence selected from
SEQ ID NO 842, 866, 881, 869, 883, 858, 833, 875, 837, 829, 871,
884, 887, 839, 830, 840, 861, or 879. In certain such embodiments,
a short antisense compound targeted to nucleotides 322-353 of SEQ
ID NO: 11 is selected from Isis No 147073, 147042, 147043, 147044,
147045, 147046, 147047, 147051, 147052, 147053, 147054, 147055,
147056, 147057, 147058, 147059, 147060, or 147061.
[0748] In certain embodiments, a target region is nucleotides
679-799 of SEQ ID NO: 11. In certain embodiments, a short antisense
compound is targeted to nucleotides 679-799 of SEQ ID NO: 11. In
certain such embodiments, a short antisense compound targeted to
nucleotides 679-799 comprises a nucleotide sequence selected from
SEQ ID NO 883, 858, 883, or 858. In certain such embodiments, a
short antisense compound targeted to nucleotides 679-799 of SEQ ID
NO: 11 is selected from Isis No 147045, 147046, 147045, or
147046.
[0749] In certain embodiments, a target region is nucleotides
679-827 of SEQ ID NO: 11. In certain embodiments, a short antisense
compound is targeted to nucleotides 679-827 of SEQ ID NO: 11. In
certain such embodiments, a short antisense compound targeted to
nucleotides 679-827 comprises a nucleotide sequence selected from
SEQ ID NO 883, 858, 883, 858, or 851. In certain such embodiments,
a short antisense compound targeted to nucleotides 679-827 of SEQ
ID NO: 11 is selected from Isis No 147045, 147046, 147045, 147046,
or 147066.
[0750] In certain embodiments, a target region is nucleotides
1024-1046 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 1024-1046 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to nucleotides 1024-1046 comprises a nucleotide sequence
selected from SEQ ID NO 841, 862, 880, 857, 851, 876, 838, 860,
878, 856, 832, or 842. In certain such embodiments, a short
antisense compound targeted to nucleotides 1024-1046 of SEQ ID NO:
11 is selected from Isis No 147062, 147063, 147064, 147065, 147066,
147067, 147068, 147069, 147070, 147071, 147072, or 147073.
[0751] In certain embodiments, a target region is nucleotides
992-1046 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 992-1046 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to nucleotides 992-1046 comprises a nucleotide sequence
selected from SEQ ID NO 831, 841, 862, 880, 857, 851, 876, 838,
860, 878, 856, 832, or 842. In certain such embodiments, a short
antisense compound targeted to nucleotides 992-1046 of SEQ ID NO:
11 is selected from Isis No 404131, 147062, 147063, 147064, 147065,
147066, 147067, 147068, 147069, 147070, 147071, 147072, or
147073.
[0752] In certain embodiments, a target region is nucleotides
1868-1881 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 1868-1881 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to nucleotides 1868-1881 comprises a nucleotide sequence
selected from SEQ ID NO 886, 859, or 853. In certain such
embodiments, a short antisense compound targeted to nucleotides
1868-1881 of SEQ ID NO: 11 is selected from Isis No 147022, 147023,
or 147024.
[0753] In certain embodiments, a target region is nucleotides
1886-1919 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 1886-1919 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to nucleotides 1886-1919 comprises a nucleotide sequence
selected from SEQ ID NO 877, 868, 882, 886, 859, 865, 843, 846,
874, 863, 855, 864, or 834. In certain such embodiments, a short
antisense compound targeted to nucleotides 1886-1919 of SEQ ID NO:
11 is selected from Isis No 147019, 147020, 147021, 147022, 147023,
147025, 147027, 147028, 147030, 147037, 147038, 147040, or
147041.
[0754] In certain embodiments, a target region is nucleotides
1869-1919 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 1869-1919 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to nucleotides 1869-1919 comprises a nucleotide sequence
selected from SEQ ID NO 859, 853, 877, 868, 882, 886, 859, 865,
843, 846, 874, 863, 855, 864, or 834. In certain such embodiments,
a short antisense compound targeted to nucleotides 1869-1919 of SEQ
ID NO: 11 is selected from Isis No 147023, 147024, 147019, 147020,
147021, 147022, 147023, 147025, 147027, 147028, 147030, 147037,
147038, 147040, or 147041.
[0755] In certain embodiments, a target region is nucleotides
1976-1989 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 1976-1989 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to nucleotides 1976-1989 comprises a nucleotide sequence
selected from SEQ ID NO 886, 859, or 853. In certain such
embodiments, a short antisense compound targeted to nucleotides
1976-1989 of SEQ ID NO: 11 is selected from Isis No 147022, 147023,
or 147024.
[0756] In certain embodiments, a target region is nucleotides
1995-2027 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 1995-2027 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to nucleotides 1995-2027 comprises a nucleotide sequence
selected from SEQ ID NO 868, 882, 886, 859, 853, 865, 835, 843,
846, 848, 874, 849, 863, 855, 850, 864, or 834. In certain such
embodiments, a short antisense compound targeted to nucleotides
1995-2027 of SEQ ID NO: 11 is selected from Isis No 147020, 147021,
147022, 147023, 147024, 147025, 147026, 147027, 147028, 147029,
147030, 147036, 147037, 147038, 147039, 147040, or 147041.
[0757] In certain embodiments, a target region is nucleotides
2366-2382 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 2366-2382 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to nucleotides 2366-2382 comprises a nucleotide sequence
selected from SEQ ID NO 867 or 873. In certain such embodiments, a
short antisense compound targeted to nucleotides 2366-2382 of SEQ
ID NO: 11 is selected from Isis No 404199 or 404134.
[0758] In certain embodiments, a target region is nucleotides
6220-6233 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 6220-6233 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to nucleotides 6220-6233 comprises a nucleotide sequence
selected from SEQ ID NO 870, 836, or 844. In certain such
embodiments, a short antisense compound targeted to nucleotides
6220-6233 of SEQ ID NO: 11 is selected from Isis No 147032, 147033,
or 147034.
[0759] In certain embodiments, a target region is nucleotides
6288-6300 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 6288-6300 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to nucleotides 6288-6300 comprises a nucleotide sequence
selected from SEQ ID NO 869 or 883. In certain such embodiments, a
short antisense compound targeted to nucleotides 6288-6300 of SEQ
ID NO: 11 is selected from Isis No 147044 or 147045.
[0760] In certain embodiments, a target region is nucleotides
6329-6342 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 6329-6342 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to nucleotides 6329-6342 comprises a nucleotide sequence
selected from SEQ ID NO 870, 836, or 844. In certain such
embodiments, a short antisense compound targeted to nucleotides
6329-6342 of SEQ ID NO: 11 is selected from Isis No 147032, 147033,
or 147034.
[0761] In certain embodiments, a target region is nucleotides
6397-6409 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 6397-6409 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to nucleotides 6397-6409 comprises a nucleotide sequence
selected from SEQ ID NO 869 or 883. In certain such embodiments, a
short antisense compound targeted to nucleotides 6397-6409 of SEQ
ID NO: 11 is selected from Isis No 147044 or 147045.
[0762] In certain embodiments, a target region is nucleotides
7057-7178 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 7057-7178 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 7057-7178 comprises a nucleotide sequence selected from
SEQ ID NO 830, 840, 861, 830, or 840. In certain such embodiments,
a short antisense compound targeted to nucleotides 7057-7178 of SEQ
ID NO: 11 is selected from Isis No 147058, 147059, 147060, 147058,
or 147059.
[0763] In certain embodiments, a target region is nucleotides
8630-8750 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 8630-8750 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 8630-8750 comprises a nucleotide sequence selected from
SEQ D) NO 843, 846, 843, or 846. In certain such embodiments, a
short antisense compound targeted to nucleotides 8630-8750 of SEQ
ID NO: 11 is selected from Isis No 147027, 147028, 147027, or
147028.
[0764] In certain embodiments, a target region is nucleotides
10957-11077 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 10957-11077 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 10957-11077 comprises a nucleotide sequence selected
from SEQ ID NO 881, 869, 881, or 869. In certain such embodiments,
a short antisense compound targeted to nucleotides 10957-11077 of
SEQ ID NO: 11 is selected from Isis No 147043, 147044, 147043, or
147044.
[0765] In certain embodiments, a target region is nucleotides
11605-11623 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 11605-11623 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 11605-11623 comprises a nucleotide sequence selected
from SEQ ID NO 856, 878, or 856. In certain such embodiments, a
short antisense compound targeted to nucleotides 11605-11623 of SEQ
ID NO: 11 is selected from Isis No 147071, 147070, or 147071.
[0766] In certain embodiments, a target region is nucleotides
12805-12817 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 12805-12817 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 12805-12817 comprises a nucleotide sequence selected
from SEQ ID NO 874 or 885. In certain such embodiments, a short
antisense compound targeted to nucleotides 12805-12817 of SEQ ID
NO: 11 is selected from Isis No 147030 or 147031.
[0767] In certain embodiments, a target region is nucleotides
12986-12998 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 12986-12998 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 12986-12998 comprises a nucleotide sequence selected
from SEQ ID NO 874 or 885. In certain such embodiments, a short
antisense compound targeted to nucleotides 12986-12998 of SEQ ID
NO: 11 is selected from Isis No 147030 or 147031.
[0768] In certain embodiments, a target region is nucleotides
15560-15572 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 15560-15572 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 15560-15572 comprises a nucleotide sequence selected
from SEQ ID NO 876 or 838. In certain such embodiments, a short
antisense compound targeted to nucleotides 15560-15572 of SEQ ID
NO: 11 is selected from Isis No 147067 or 147068.
[0769] In certain embodiments, a target region is nucleotides
17787-17941 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 17787-17941 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 17787-17941 comprises a nucleotide sequence selected
from SEQ ID NO 874 or 880. In certain such embodiments, a short
antisense compound targeted to nucleotides 17787-17941 of SEQ ID
NO: 11 is selected from Isis No 147030 or 147064.
[0770] In certain embodiments, a target region is nucleotides
21190-21202 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 21190-21202 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 21190-21202 comprises a nucleotide sequence selected
from SEQ ID NO 843 or 846. In certain such embodiments, a short
antisense compound targeted to nucleotides 21190-21202 of SEQ ID
NO: 11 is selected from Isis No 147027 or 147028.
[0771] In certain embodiments, a target region is nucleotides
21358-21370 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 21358-21370 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 21358-21370 comprises a nucleotide sequence selected
from SEQ ID NO 843 or 846. In certain such embodiments, a short
antisense compound targeted to nucleotides 21358-21370 of SEQ iD
NO: 11 is selected from Isis No 017027 or 147028.
[0772] In certain embodiments, a target region is nucleotides
24318-24332 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 24318-24332 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 24318-24332 comprises a nucleotide sequence selected
from SEQ ID NO 881, 869, 883, or 858. In certain such embodiments,
a short antisense compound targeted to nucleotides 24318-24332 of
SEQ ID NO: 11 is selected from Isis No 147043, 147044, 147045, or
147046.
[0773] In certain embodiments, a target region is nucleotides
24486-24501 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 24486-24501 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 24486-24501 comprises a nucleotide sequence selected
from SEQ ID NO 881, 869, 858, or 833. In certain such embodiments,
a short antisense compound targeted to nucleotides 24486-24501 of
SEQ ID NO: 11 is selected from Isis No 147043, 147044, 147046, or
147047.
[0774] In certain embodiments, a target region is nucleotides
25065-25077 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 25065-25077 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 25065-25077 comprises a nucleotide sequence selected
from SEQ ID NO 864 or 834. In certain such embodiments, a short
antisense compound targeted to nucleotides 25065-25077 of SEQ ID
NO: 11 is selected from Isis No 147040 or 147041.
[0775] In certain embodiments, a target region is nucleotides
25232-25245 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 25232-25245 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 25232-25245 comprises a nucleotide sequence selected
from SEQ ID NO 850, 864, or 834. In certain such embodiments, a
short antisense compound targeted to nucleotides 25232-25245 of SEQ
ID NO: 11 is selected from Isis No 147039, 147040, or 147041.
[0776] In certain embodiments, a target region is nucleotides
25508-25523 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 25508-25523 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 25508-25523 comprises a nucleotide sequence selected
from SEQ ID NO 839 or 879. In certain such embodiments, a short
antisense compound targeted to nucleotides 25508-25523 of SEQ ID
NO: 11 is selected from Isis No 147057 or 147061.
[0777] In certain embodiments, a target region is nucleotides
25676-28890 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 25676-28890 of SEQ ID
NO:11. In certain such embodiments, a short antisense compound
targeted to 25676-28890 comprises a nucleotide sequence selected
from SEQ ID NO 839, 860, or 878. In certain such embodiments, a
short antisense compound targeted to nucleotides 25676-28890 of SEQ
ID NO: 11 is selected from Isis No 147057, 147069, or 147070.
[0778] In certain embodiments, a target region is nucleotides
33056-33069 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 33056-33069 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 33056-33069 comprises a nucleotide sequence selected
from SEQ ID NO 860, 878, or 856. In certain such embodiments, a
short antisense compound targeted to nucleotides 33056-33069 of SEQ
ID NO: 11 is selected from Isis No 147069, 147070, or 147071.
[0779] In certain embodiments, a target region is nucleotides
33205-33217 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 33205-33217 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 33205-33217 comprises a nucleotide sequence selected
from SEQ ID NO 878 or 856. In certain such embodiments, a short
antisense compound targeted to nucleotides 33205-33217 of SEQ ID
NO: 11 is selected from Isis No 14707 or 147071.
[0780] In certain embodiments, a target region is nucleotides
33318-33334 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 33318-33334 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted to 33318-33334 comprises a nucleotide sequence selected
from SEQ ID NO 858, 854, or 875. In certain such embodiments, a
short antisense compound targeted to nucleotides 33318-33334 of SEQ
ID NO: 11 is selected from Isis No 147046, 147049, or 147051.
[0781] In certain embodiments, a target region is nucleotides
33466-33482 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 33466-33482 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 33466-33482 comprises a nucleotide sequence selected from
SEQ ID NO 858, 833, or 875. In certain such embodiments, a short
antisense compound targeted to nucleotides 33466-33482 of SEQ ID
NO: 11 is selected from Isis No 147046, 147047, or 147051.
[0782] In certain embodiments, a target region is nucleotides
33640-33656 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 33640-33656 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 33640-33656 comprises a nucleotide sequence selected from
SEQ ID NO 858 or 875. In certain such embodiments, a short
antisense compound targeted to nucleotides 33640-33656 of SEQ ID
NO: 11 is selected from Isis No 147046 or 147051.
[0783] In certain embodiments, a target region is nucleotides
33788-33804 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 33788-33804 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 33788-33804 comprises a nucleotide sequence selected from
SEQ ID NO 858 or 875. In certain such embodiments, a short
antisense compound targeted to nucleotides 33788-33804 of SEQ ID
NO: 11 is selected from Isis No 147046 or 147051.
[0784] In certain embodiments, a target region is nucleotides
35437-35449 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 35437-35449 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 35437-35449 comprises a nucleotide sequence selected from
SEQ ID NO 840 or 861. In certain such embodiments, a short
antisense compound targeted to nucleotides 35437-35449 of SEQ ID
NO: 11 is selected from Isis No 147059 or 147060.
[0785] In certain embodiments, a target region is nucleotides
40353-40373 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 40353-40373 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 40353-40373 comprises a nucleotide sequence selected from
SEQ ID NO 879 or 881. In certain such embodiments, a short
antisense compound targeted to nucleotides 40353-40373 of SEQ ID
NO: 11 is selected from Isis No 147061 or 147043.
[0786] In certain embodiments, a target region is nucleotides
42527-42541 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 4252742541 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 42527-42541 comprises a nucleotide sequence selected from
SEQ ID NO 885, 870, or 844. In certain such embodiments, a short
antisense compound targeted to nucleotides 42527-42541 of SEQ ID
NO: 11 is selected from Isis No 147031, 147032, or 147034.
[0787] In certain embodiments, a target region is nucleotides
42675-42689 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 42675-42689 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 42675-42689 comprises a nucleotide sequence selected from
SEQ ID NO 885, 870, 836, or 844. In certain such embodiments, a
short antisense compound targeted to nucleotides 42675-42689 of SEQ
ID NO: 11 is selected from Isis No 147031, 147032, 147033, or
147034.
[0788] In certain embodiments, a target region is nucleotides
46313-46328 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 46313-46328 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 46313-46328 comprises a nucleotide sequence selected from
SEQ ID NO 839, 830, 840, or 879. In certain such embodiments, a
short antisense compound targeted to nucleotides 46313-46328 of SEQ
ID NO: 11 is selected from Isis No 147057, 147058, 147059, or
147061.
[0789] In certain embodiments, a target region is nucleotides
46461-46476 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 46461-46476 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 46461-46476 comprises a nucleotide sequence selected from
SEQ ID NO 839, 840, or 879. In certain such embodiments, a short
antisense compound targeted to nucleotides 46461-46476 of SEQ ID
NO: 11 is selected from Isis No 147057, 147059, or 147061.
[0790] In certain embodiments, a target region is nucleotides
48369-48381 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 48369-48381 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 48369-48381 comprises a nucleotide sequence selected from
SEQ ID NO 842 or 845. In certain such embodiments, a short
antisense compound targeted to nucleotides 48369-48381 of SEQ ID
NO: 11 is selected from Isis No 147073 or 147074.
[0791] In certain embodiments, a target region is nucleotides
48714-48726 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 48714-48726 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 48714-48726 comprises a nucleotide sequence selected from
SEQ ID NO 843 or 846. In certain such embodiments, a short
antisense compound targeted to nucleotides 48714-48726 of SEQ ID
NO: 11 is selected from Isis No 147027 or 147028.
[0792] In certain embodiments, a target region is nucleotides
49050-49062 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 49050-49062 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 49050-49062 of comprises a nucleotide sequence selected
from SEQ ID NO 876 or 838. In certain such embodiments, a short
antisense compound targeted to nucleotides 49050-49062 of SEQ ID
NO: 11 is selected from Isis No 147067 or 147068.
[0793] In certain embodiments, a target region is nucleotides
49672-49684 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 49672-49684 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 49672-49684 of comprises a nucleotide sequence selected
from SEQ ID NO 842 or 845. In certain such embodiments, a short
antisense compound targeted to nucleotides 49672-49684 of SEQ ID
NO: 11 is selected from Isis No 147073 or 147074.
[0794] In certain embodiments, a target region is nucleotides
52292-52304 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 52292-52304 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 52292-52304 of comprises a nucleotide sequence selected
from SEQ ID NO 849 or 863. In certain such embodiments, a short
antisense compound targeted to nucleotides 52292-52304 of SEQ ID
NO: 11 is selected from Isis No 147036 or 147037.
[0795] In certain embodiments, a target region is nucleotides
52438-52450 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 52438-52450 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 52438-52450 of comprises a nucleotide sequence selected
from SEQ ID NO 849 or 863. In certain such embodiments, a short
antisense compound targeted to nucleotides 52438-52450 of SEQ ID
NO: 11 is selected from Isis No 147036 or 147037.
[0796] In certain embodiments, a target region is nucleotides
53445-53458 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 53445-53458 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 53445-53458 of comprises a nucleotide sequence selected
from SEQ ID NO 866, 881, or 869. In certain such embodiments, a
short antisense compound targeted to nucleotides 53445-53458 of SEQ
ID NO: 11 is selected from Isis No 147042, 147043, or 147044.
[0797] In certain embodiments, a target region is nucleotides
53591-53604 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 53591-53604 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 53591-53604 of comprises a nucleotide sequence selected
from SEQ ID NO 866, 874, 881, 885, or 869. In certain such
embodiments, a short antisense compound targeted to nucleotides
53591-53604 of SEQ ID NO: 11 is selected from Isis No 147042,
147030, 147043, 147031, or 147044.
[0798] In certain embodiments, a target region is nucleotides
53738-53750 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 53738-53750 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 53738-53750 of comprises a nucleotide sequence selected
from SEQ ID NO 874 or 885. In certain such embodiments, a short
antisense compound targeted to nucleotides 53738-53750 of SEQ ID
NO: 11 is selected from Isis No 147030 or 147031.
[0799] In certain embodiments, a target region is nucleotides
53783-53795 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 53783-53795 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 53783-53795 of comprises a nucleotide sequence selected
from SEQ ID NO 864 or 834. In certain such embodiments, a short
antisense compound targeted to nucleotides 53783-53795 of SEQ ID
NO: 11 is selected from Isis No 147040 or 147041.
[0800] In certain embodiments, a target region is nucleotides
55008-55020 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 55008-55020 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 55008-55020 of comprises a nucleotide sequence selected
from SEQ ID NO 866 or 881. In certain such embodiments, a short
antisense compound targeted to nucleotides 55008-55020 of SEQ ID
NO: 11 is selected from Isis No 147042 or 147043.
[0801] In certain embodiments, a target region is nucleotides
55154-55166 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 55154-55166 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 55154-55166 of comprises a nucleotide sequence selected
from SEQ ID NO 866 or 881. In certain such embodiments, a short
antisense compound targeted to nucleotides 55154-55166 of SEQ ID
NO: 11 is selected from Isis No 147042 or 147043.
[0802] In certain embodiments, a target region is nucleotides
55682-55695 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 55682-55695 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 55682-55695 of comprises a nucleotide sequence selected
from SEQ ID NO 877 or 882. In certain such embodiments, a short
antisense compound targeted to nucleotides 55682-55695 of SEQ ID
NO: 11 is selected from Isis No 147019 or 147021.
[0803] In certain embodiments, a target region is nucleotides
56275-56293 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 56275-56293 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 56275-56293 of comprises a nucleotide sequence selected
from SEQ ID NO 871, 884, 887, 830, 840, 861, or 879. In certain
such embodiments, a short antisense compound targeted to
nucleotides 56275-56293 of SEQ ID NO: 11 is selected from Isis No
147054, 147055, 147056, 147058, 147059, 147060, or 147061.
[0804] In certain embodiments, a target region is nucleotides
56418-56439 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 56418-56439 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 56418-56439 of comprises a nucleotide sequence selected
from SEQ ID NO 875, 829, 871, 884, 887, 839, 830, or 879. In
certain such embodiments, a short antisense compound targeted to
nucleotides 56418-56439 of SEQ ID NO: 11 is selected from Isis No
147051, 147053, 147054, 147055, 147056, 147057, 147058, or
147061.
[0805] In certain embodiments, a target region is nucleotides
57264-57276 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 57264-57276 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 57264-57276 of comprises a nucleotide sequence selected
from SEQ ID NO 883 or 858. In certain such embodiments, a short
antisense compound targeted to nucleotides 57264-57276 of SEQ ID
NO: 11 is selected from Isis No 147045 or 147046.
[0806] In certain embodiments, a target region is nucleotides
61276-61293 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 61276-61293 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 61276-61293 of comprises a nucleotide sequence selected
from SEQ ID NO 856, 847, 849, 863, 855, 850, or 864. In certain
such embodiments, a short antisense compound targeted to
nucleotides 61276-61293 of SEQ ID NO: 11 is selected from Isis No
147071, 147035, 147036, 147037, 147038, 147039, or 147040.
[0807] In certain embodiments, a target region is nucleotides
61257-61320 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 61257-61320 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 61257-61320 of comprises a nucleotide sequence selected
from SEQ ID NO 881, 856, 847, 849, 863, 855, 850, 864, or 886. In
certain such embodiments, a short antisense compound targeted to
nucleotides 61257-61320 of SEQ ID NO: 11 is selected from Isis No
147043, 147071, 147035, 147036, 147037, 147038, 147039, 147040, or
147071.
[0808] In certain embodiments, a target region is nucleotides
61422-61439 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 61422-61439 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 61422-61439 of comprises a nucleotide sequence selected
from SEQ ID NO 844, 847, 849, 863, 855, or 864. In certain such
embodiments, a short antisense compound targeted to nucleotides
61422-61439 of SEQ ID NO: 11 is selected from Isis No 147034,
147035, 147036, 147037, 147038, or 147040.
[0809] In certain embodiments, a target region is nucleotides
61422-61466 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 61422-61466 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 61422-61466 of comprises a nucleotide sequence selected
from SEQ ID NO 844, 847, 849, 863, 855, 864, or 856. In certain
such embodiments, a short antisense compound targeted to
nucleotides 61422-61466 of SEQ ID NO: 11 is selected from Isis No
147034, 147035, 147036, 147037, 147038, 147040, or 147071.
[0810] In certain embodiments, a target region is nucleotides
63065-63078 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 63065-63078 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 63065-63078 of comprises a nucleotide sequence selected
from SEQ ID NO 851 or 838. In certain such embodiments, a short
antisense compound targeted to nucleotides 63065-63078 of SEQ ID
NO: 11 is selected from Isis No 147066 or 147068.
[0811] In certain embodiments, a target region is nucleotides
63207-63222 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 63207-63222 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 63207-63222 of comprises a nucleotide sequence selected
from SEQ ID NO 841 or 851. In certain such embodiments, a short
antisense compound targeted to nucleotides 63207-63222 of SEQ ID
NO: 11 is selected from Isis No 147062 or 147066.
[0812] In certain embodiments, a target region is nucleotides
64538-64550 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 64538-64550 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 64538-64550 of comprises a nucleotide sequence selected
from SEQ ID NO 849 or 863. In certain such embodiments, a short
antisense compound targeted to nucleotides 64538-64550 of SEQ ID
NO: 11 is selected from Isis No 147036 or 147037.
[0813] In certain embodiments, a target region is nucleotides
64864-64876 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 64864-64876 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 64864-64876 of comprises a nucleotide sequence selected
from SEQ ID NO 851 or 876. In certain such embodiments, a short
antisense compound targeted to nucleotides 64864-64876 of SEQ ID
NO: 11 is selected from Isis No 147066 or 147067.
[0814] In certain embodiments, a target region is nucleotides
65010-65028 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 65010-65028 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 65010-65028 of comprises a nucleotide sequence selected
from SEQ ID NO 851, 876, or 883. In certain such embodiments, a
short antisense compound targeted to nucleotides 65010-65028 of SEQ
ID NO: 11 is selected from Isis No 147066, 147067, or 147045.
[0815] In certain embodiments, a target region is nucleotides
65163-65175 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 65163-65175 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 65163-65175 of comprises a nucleotide sequence selected
from SEQ ID NO 883 or 858. In certain such embodiments, a short
antisense compound targeted to nucleotides 65163-65175 of SEQ ID
NO: 11 is selected from Isis No 147045 or 147046.
[0816] In certain embodiments, a target region is nucleotides
65408-65422 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 65408-65422 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 65408-65422 of comprises a nucleotide sequence selected
from SEQ ID NO 883 or 856. In certain such embodiments, a short
antisense compound targeted to nucleotides 65408-65422 of SEQ ID
NO: 11 is selected from Isis No 147068 or 147071.
[0817] In certain embodiments, a target region is nucleotides
65549-65568 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 65549-65568 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 65549-65568 of comprises a nucleotide sequence selected
from SEQ ID NO 860, 838, or 856. In certain such embodiments, a
short antisense compound targeted to nucleotides 65549-65568 of SEQ
ID NO: 11 is selected from Isis No 147069, 147068, or 147071.
[0818] In certain embodiments, a target region is nucleotides
67741-67754 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 67741-67754 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 67741-67754 of comprises a nucleotide sequence selected
from SEQ ID NO 848, 874, or 885. In certain such embodiments, a
short antisense compound targeted to nucleotides 67741-67754 of SEQ
ID NO: 11 is selected from Isis No 147029, 147030, or 147031.
[0819] In certain embodiments, a target region is nucleotides
67886-67900 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 67886-67900 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 67886-67900 of comprises a nucleotide sequence selected
from SEQ ID NO 846, 848, 874, or 885. In certain such embodiments,
a short antisense compound targeted to nucleotides 67886-67900 of
SEQ ID NO: 11 is selected from Isis No 147028, 147029, 147030, or
147031.
[0820] In certain embodiments, a target region is nucleotides
68867-68880 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 68867-68880 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 68867-68880 of comprises a nucleotide sequence selected
from SEQ ID NO 881, 869, or 883. In certain such embodiments, a
short antisense compound targeted to nucleotides 68867-68880 of SEQ
ID NO: 11 is selected from Isis No 147043, 147044, or 147045.
[0821] In certain embodiments, a target region is nucleotides
69013-69532 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 69013-69532 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 69013-69532 of comprises a nucleotide sequence selected
from SEQ ID NO 881, 869, 883, 858, 856, 832, or 842. In certain
such embodiments, a short antisense compound targeted to
nucleotides 69013-69532 of SEQ ID NO: 11 is selected from Isis No
147043, 147044, 147045, 147046, 147071, 147072, or 147073.
[0822] In certain embodiments, a target region is nucleotides
69665-69880 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 69665-69880 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 69665-69880 of comprises a nucleotide sequence selected
from SEQ ID NO 856, 832, 842, 845, or 851. In certain such
embodiments, a short antisense compound targeted to nucleotides
69665-69880 of SEQ ID NO: 11 is selected from Isis No 147071,
147072, 147073, 147074, or 147066.
[0823] In certain embodiments, a target region is nucleotides
70611-70630 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 70611-70630 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 70611-70630 of comprises a nucleotide sequence selected
from SEQ ID NO 859, 841, 862, 880, 857, or 851. In certain such
embodiments, a short antisense compound targeted to nucleotides
70611-70630 of SEQ ID NO: 11 is selected from Isis No 147023,
147062, 147063, 147064, 147065, or 147066.
[0824] In certain embodiments, a target region is nucleotides
70762-70776 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 70762-70776 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 70762-70776 of comprises a nucleotide sequence selected
from SEQ ID NO 862, 880, 857, or 851. In certain such embodiments,
a short antisense compound targeted to nucleotides 70762-70776 of
SEQ ID NO: 11 is selected from Isis No 147063, 147064, 147065, or
147066.
[0825] In certain embodiments, a target region is nucleotides
70998-71010 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 70998-71010 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 70998-71010 of comprises a nucleotide sequence selected
from SEQ ID NO 832 or 842. In certain such embodiments, a short
antisense compound targeted to nucleotides 70998-71010 of SEQ ID
NO: 11 is selected from Isis No 147072 or 147073.
[0826] In certain embodiments, a target region is nucleotides
71144-714364 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 71144-714364 of SEQ
ID NO: 11. In certain such embodiments, a short antisense compound
targeted 71144-714364 of comprises a nucleotide sequence selected
from SEQ ID NO 832, 842, 845, 863, 855, or 850. In certain such
embodiments, a short antisense compound targeted to nucleotides
71144-714364 of SEQ ID NO: 11 is selected from Isis No 147072,
147073, 147074, 147037, 147038, or 147039.
[0827] In certain embodiments, a target region is nucleotides
71497-71652 of SEQ ID NO: 11. In certain embodiments, a short
antisense compound is targeted to nucleotides 71497-71652 of SEQ ID
NO: 11. In certain such embodiments, a short antisense compound
targeted 71497-71652 of comprises a nucleotide sequence selected
from SEQ ID NO 863, 855, 850, or 879. In certain such embodiments,
a short antisense compound targeted to nucleotides 71497-71652 of
SEQ ID NO: 11 is selected from Isis No 147037, 147038, 147039, or
147061.
[0828] In certain embodiments, short antisense compounds targeted
to a PTP1B nucleic acid are 8 to 16, preferably 9 to 15, more
preferably 9 to 14, more preferably 10 to 14 nucleotides in length.
In certain embodiments, short antisense compounds targeted to a
PTP1B nucleic acid are 9 to 14 nucleotides in length. In certain
embodiments, short antisense compounds targeted to a PTP1B nucleic
acid are 10 to 14 nucleotides in length. In certain embodiments,
such short antisense compounds are short antisense
oligonucleotides.
[0829] In certain embodiments, short antisense compounds targeted
to a PTP1B nucleic acid are short gapmers. In certain such
embodiments, short gapmers targeted to a PTP1B nucleic acid
comprise at least one high affinity modification in one or more
wings of the compound. In certain embodiments, short antisense
compounds targeted to a PTP1B nucleic acid comprise 1 to 3
high-affinity modifications in each wing. In certain such
embodiments, the nucleosides or nucleotides of the wing comprise a
2' modification. In certain such embodiments, the monomers of the
wing are BNA's. In certain such embodiments, the monomers of the
wing are selected from .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2')
BNA, .beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA, Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') BNA, Aminooxy (4'-CH.sub.2--O--N(R)-2')
BNA and Oxyamino (4'-CH.sub.2--N(R)--O-2') BNA. In certain
embodiments, the monomers of a wing comprise a substituent at the
2' position selected from allyl, amino, azido, thio, O-allyl,
O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3, O
--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), and
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. In certain embodiments, the monomers of a
wing are 2'MOE nucleotides.
[0830] In certain embodiments, short antisense compounds targeted
to a PTP1B nucleic acid comprise a gap between the 5' wing and the
3' wing. In certain embodiments the gap comprises five, six, seven,
eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
In certain embodiments, the monomers of the gap are unmodified
deoxyribonucleotides. In certain embodiments, the monomers of the
gap are unmodified ribonucleotides. In certain embodiments, gap
modifications (if any) gap result in an antisense compound that,
when bound to its target nucleic acid, supports cleavage by an
RNase, including, but not limited to, RNase H.
[0831] In certain embodiments, short antisense compounds targeted
to a PTP1B nucleic acid have uniform monomeric linkages. In certain
such embodiments, those linkages are all phosphorothioate linkages.
In certain embodiments, the linkages are all phosphodiester
linkages. In certain embodiments, short antisense compounds
targeted to a PTP1B nucleic acid have mixed backbones.
[0832] In certain embodiments, short antisense compounds targeted
to a PTP1B nucleic acid are 8 monomers in length. In certain
embodiments, short antisense compounds targeted to a PTP1B nucleic
acid are 9 monomers in length. In certain embodiments, short
antisense compounds targeted to a PTP1B nucleic acid are 10
monomers in length. In certain embodiments, short antisense
compounds targeted to a PTP1B nucleic acid are 11 monomers in
length. In certain embodiments, short antisense compounds targeted
to a PTP1B nucleic acid are monomers in length. In certain
embodiments, short antisense compounds targeted to a PTP1B nucleic
acid are 13 monomers in length. In certain embodiments, short
antisense compounds targeted to a PTP1B nucleic acid are 14
monomers in length. In certain embodiments, short antisense
compounds targeted to a PTP1B nucleic acid are 15 monomers in
length. In certain embodiments, short antisense compounds targeted
to a PTP1B nucleic acid are 16 monomers in length. In certain
embodiments, short antisense compounds targeted to a PTP1B nucleic
acid comprise 9 to 15 monomers. In certain embodiments, short
antisense compounds targeted to a PTP1B nucleic acid comprise 10 to
15 monomers. In certain embodiments, short antisense compounds
targeted to a PTP1B nucleic acid comprise 12 to 14 monomers. In
certain embodiments, short antisense compounds targeted to a PTP1B
nucleic acid comprise 12 to 14 nucleotides or nucleosides.
[0833] In certain embodiments, the invention provides methods of
modulating expression of PTP1B. In certain embodiments, such
methods comprise use of one or more short antisense compound
targeted to a PTP1B nucleic acid, wherein the short antisense
compound targeted to a PTP1B nucleic acid is from about 8 to about
16, preferably 9 to 15, more preferably 9 to 14, more preferably 10
to 14 monomers (i.e. from about 8 to about 16 linked monomers). One
of ordinary skill in the art will appreciate that this comprehends
methods of modulating expression of PTP1B using one or more short
antisense compounds targeted to a PTP1B nucleic acid of 8, 9, 10,
11, 12, 13, 14, 15 or 16 monomers.
[0834] In certain embodiments, methods of modulating PTP1B comprise
use of a short antisense compound targeted to a PTP1B nucleic acid
that is 8 monomers in length. In certain embodiments, methods of
modulating PTP1B comprise use of a short antisense compound
targeted to a PTP1B nucleic acid that is 9 monomers in length. In
certain embodiments, methods of modulating PTP1B comprise use of a
short antisense compound targeted to a PTP1B nucleic acid that is
10 monomers in length. In certain embodiments, methods of
modulating PTP1B comprise use of a short antisense compound
targeted to a PTP1B nucleic acid that is 11 monomers in length. In
certain embodiments, methods of modulating PTP1B comprise use of a
short antisense compound targeted to a PTP1B nucleic acid that is
12 monomers in length. In certain embodiments, methods of
modulating PTP1B comprise use of a short antisense compound
targeted to a PTP1B nucleic acid that is 13 monomers in length. In
certain embodiments, methods of modulating PTP1B comprise use of a
short antisense compound targeted to a PTP1B nucleic acid that is
14 monomers in length. In certain embodiments, methods of
modulating PTP1B comprise use of a short antisense compound
targeted to a PTP1B nucleic acid that is 15 monomers in length. In
certain embodiments, methods of modulating PTP1B comprise use of a
short antisense compound targeted to a PTP1B nucleic acid that is
16 monomers in length.
[0835] In certain embodiments, methods of modulating expression of
PTP1B comprise use of a short antisense compound targeted to a
PTP1B nucleic acid comprising 9 to 15 monomers. In certain
embodiments, methods of modulating expression of PTP1B comprise use
of a short antisense compound targeted to a PTP1B nucleic acid
comprising 10 to 15 monomers. In certain embodiments, methods of
modulating expression of PTP1B comprise use of a short antisense
compound targeted to a PTP1B nucleic acid comprising 12 to 14
monomers. In certain embodiments, methods of modulating expression
of PTP1B comprise use of a short antisense compound targeted to a
PTP1B nucleic acid comprising 12 or 14 nucleotides or
nucleosides.
[0836] 10. PTEN
[0837] In certain embodiments, the invention provides short
antisense compounds targeted to a nucleic acid encoding PTEN. In
certain embodiments, such compounds are used to modulate PTEN
expression if cells. In certain such embodiments, short antisense
compounds targeted to a PTEN nucleic acid are administered to an
animal. In certain embodiments, short antisense compounds targeted
to a PTEN nucleic acid are useful for studying PTEN, for studying
certain nucleases and/or for assessing antisense activity. In
certain such embodiments, short antisense compounds targeted to
PTEN nucleic acids are useful for assessing certain motifs and/or
chemical modifications. In certain embodiments, administration of a
short antisense compound targeted to PTEN nucleic acid to an animal
results in a measurable phenotypic change.
[0838] The short antisense compounds targeting PTEN may have any
one or more properties or characteristics of the short antisense
compounds generally described herein. In certain embodiments, short
antisense compounds targeting a PTP1B nucleic acid have a motif
(wing-deoxy gap-wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1,
3-10-3, 2-10-3, 2-10-2, 1-10-1, 1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6-3
or 1-6-1, more preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.
Certain Short Antisense Compounds Targeted to a PTEN Nucleic
Acid
[0839] In certain embodiments, short antisense compounds are
targeted to a PTEN nucleic acid having the sequence of GENBANK.RTM.
Accession No. NM.sub.--000314.4, incorporated herein as SEQ ID NO:
14. In certain embodiments, short antisense compounds are targeted
to a PTEN nucleic acid having the sequence of nucleotides 8063255
to 8167140 of the sequence of GENBANK.RTM. Accession No.
NT.sub.--033890.3, incorporated herein as SEQ ID NO: 15. In certain
such embodiments, a short antisense compound targeted to SEQ ID NO:
14 is at least 90% complementary to SEQ ID NO: 14. In certain such
embodiments, a short antisense compound targeted to SEQ ID NO: 14
is at least 95% complementary to SEQ ID NO: 14. In certain such
embodiments, a short antisense compound targeted to SEQ ID NO: 15
is 100% complementary to SEQ ID NO: 15. In certain such
embodiments, a short antisense compound targeted to SEQ ID NO: 15
is at least 90% complementary to SEQ ID NO: 15. In certain such
embodiments, a short antisense compound targeted to SEQ ID NO: 15
is at least 95% complementary to SEQ ID NO: 15. In certain such
embodiments, a short antisense compound targeted to SEQ ID NO: 15
is 100% complementary to SEQ ID NO: 15.
[0840] In certain embodiments, a short antisense compound targeted
to SEQ ID NO: 14 comprises a nucleotide sequence selected from the
nucleotide sequences set forth in Tables 20 and 21. In certain
embodiments, a short antisense compound targeted to SEQ ID NO: 15
comprises a nucleotide sequence selected from the nucleotide
sequences set forth in Tables 22 and 23.
[0841] Each nucleotide sequence set forth in Tables 20, 21, 22, and
23 is independent of any modification to a sugar moiety, an
internucleoside linkage, or a nucleobase. As such, short antisense
compounds comprising a nucleotide sequence as set forth in Tables
20, 21, 22, and 23 may comprise, independently, one or more
modifications to a sugar moiety, an internucleoside linkage, or a
nucleobase. Antisense compounds described by Isis Number (Isis NO.)
indicate a combination of nucleobase sequence and one or more
modifications to a sugar moiety, an internucleoside linkage, or a
nucleobase.
[0842] Table 20 illustrates short antisense compounds that are 100%
complementary to SEQ ID NO: 14. Table 22 illustrates short
antisense compounds that are 100% complementary to SEQ ID NO: 15.
The column labeled `gapmer motif` indicates the wing-gap-wing motif
of each short antisense compounds. The gap segment comprises
2'-deoxynucleotides and each nucleotide of each wing segment
comprises a 2'-modified sugar. The particular 2'-modified sugar is
also indicated in the `gapmer motif` column. For example, `2-10-2
MOE` means a 2-10-2 gapmer motif, where a gap segment of ten
2'-deoxynucleotides is flanked by wing segments of two nucleotides,
where the nucleotides of the wing segments are 2'-MOE nucleotides.
Internucleoside linkages are phosphorothioate. The short antisense
compounds comprise 5-methylcytidine in place of unmodified
cytosine, unless "unmodified cytosine" is listed in the gapmer
motif column, in which case the indicated cytosines are unmodified
cytosines. For example, "5-mC in gap only" indicates that the gap
segment has 5-methylcytosines, while the wing segments have
unmodified cytosines.
[0843] The 2'-modified nucleotides and abbreviations include:
2'-O-methoxyethyl (MOE); 2'-O-methyl (OMe);
2'-O-(2,2,3,3,3-pentafluoropropyl) (PentaF);
2'-O-[(2-methoxy)ethyl]-4'-thio (2'-MOE-4'-thio). (R)-CMOE-BNA. As
illustrated in Tables 20 and 22, a wing may comprise monomers
comprising more than type of 2' substituent. For example, 1-2-10-2
MOE/PentaF/MOE indicates one MOE-modified nucleotide, followed by
two PentaF-modified nucleotides, followed by a gap of ten
deoxynucleotides, followed by two PentaF-modified nucleotides. For
example, 1-1-10-22'-(butylacetomido)-palmitamide Methyleneoxy
BNA/Methyleneoxy BNA indicates that the 5'-most nucleotide is
2'-(butylacetomide)-palmitamide, the second nucleotide is a
methyleneoxy BNA nucleotide, and the 3' wing is methyleneoxy BNA.
Unless otherwise indicated, cytosines are 5-methylcytosines and
internucleoside linkages are phosphorothioate.
TABLE-US-00023 TABLE 20 Short Antisense Compounds Targeted to SEQ
ID NO: 14 5' 3' SEQ ISIS Target Target ID No Site Site Sequence
(5'-3') Gapmer Motif NO 390092 5530 5541 AGAATGAGACTT 1-10-1 MOE
1514 390091 5435 5446 TGAGGCATTATC 1-10-1 MOE 1522 390090 5346 5357
AGAGTATCTGAA 1-10-1 MOE 1227 390088 5162 5173 CACATTAACAGT 1-10-1
MOE 1511 390087 5126 5137 GTGGCAACCACA 1-10-1 MOE 1501 390085 5031
5042 ATTTGATGCTGC 1-10-1 MOE 1505 390084 4982 4993 CAAAGAATGGTG
1-10-1 MOE 1215 390082 4910 4921 AGGACTTGGGAT 1-10-1 MOE 1503
390080 4833 4844 TGCTGCACATCC 1-10-1 MOE 1150 392067 4832 4845
CTGCTGCACATCCA 2-10-2 Methyleneoxy BNA 1510 Unmodified cytosines in
gap 390078 4714 4725 CTTTCAGTCATA 1-10-1 MOE 1520 390077 4693 4704
GTCAAATTCTAT 1-10-1 MOE 1252 390076 4599 4610 TTCCAATGACTA 1-10-1
MOE 1506 390075 4576 4587 GTAAGCAAGGCT 1-10-1 MOE #N/A 390074 4533
4544 ACCCTCATTCAG 1-10-1 MOE 1513 390068 4191 4202 GTAAATCCTAAG
1-10-1 MOE 1515 390064 4001 4012 ACCACAGCTAGT 1-10-1 MOE 1498
390063 3977 3988 CACCAATAAGTT 1-10-1 MOE 1219 390058 3828 3839
AGTAGTTGTACT 1-10-1 MOE 1192 390056 3793 3804 GGGCATATCAAA 1-10-1
MOE 1521 390054 3705 3716 AACACTGCACAT 1-10-1 MOE 1493 390052 3623
3634 GACAATTTCTAC 1-10-1 MOE 1492 390050 3503 3514 GTATTCAAGTAA
1-10-1 MOE 1140 390049 3479 3490 GTTAATGACATT 1-10-1 MOE 1491
390047 3428 3439 TGTGTAAGGTCA 1-10-1 MOE 1490 390041 3175 3186
TTAGCACTGGCC 1-10-1 MOE 1489 398076 3171 3182 CACTGGCCTTGA 1-10-1
MOE 1488 398009 3170 3183 GCACTGGCCTTGAT 2-10-2 MOE 1487 398075
3111 3122 AAATCATTGTCA 1-10-1 MOE 1233 398008 3110 3123
TAAATCATTGTCAA 2-10-2 MOE 1486 398074 2913 2924 GCACCAATATGC 1-10-1
MOE 1248 398007 2912 2925 AGCACCAATATGCT 2-10-2 MOE 1247 398073
2681 2692 TTAGCCAACTGC 1-10-1 MOE 1485 398006 2680 2693
CTTAGCCAACTGCA 2-10-2 MOE 1484 390033 2679 2690 AGCCAACTGCAA 1-10-1
MOE 1483 398072 2671 2682 GCAAACTTATCT 1-10-1 MOE 1482 398005 2670
2683 TGCAAACTTATCTG 2-10-2 MOE 1481 390030 2534 2545 TTTATAAAACTG
1-10-1 MOE 1074 398071 2533 2544 TTATAAAACTGG 1-10-1 MOE 1480
398004 2532 2545 TTTATAAAACTGGA 2-10-2 MOE 1479 390029 2510 2521
AAAGTGCCATCT 1-10-1 MOE 1478 390028 2491 2502 TCCTAATTGAAT 1-10-1
MOE 1477 398070 2481 2492 ATTTTAAATGTC 1-10-1 MOE 1476 398003 2480
2493 AATTTTAAATGTCC 2-10-2 MOE 1475 390027 2455 2466 AGGTATATACAT
1-10-1 MOE 1206 398069 2451 2462 ATATACATGACA 1-10-1 MOE 1474
398002 2450 2463 TATATACATGACAC 2-10-2 MOE 1473 398068 2440 2451
ACAGCTACACAA 1-10-1 MOE 1472 398001 2439 2452 CACAGCTACACAAC 2-10-2
MOE 1471 390026 2438 2449 AGCTACACAACC 1-10-1 MOE 1470 390025 2406
2417 GTGTCAAAACCC 1-10-1 MOE 1211 398067 2405 2416 TGTCAAAACCCT
1-10-1 MOE 1210 398000 2404 2417 GTGTCAAAACCCTG 2-10-2 MOE 1469
398066 2372 2383 AGATTGGTCAGG 1-10-1 MOE 1468 397999 2371 2384
AAGATTGGTCAGGA 2-10-2 MOE 1467 398065 2349 2360 GTTCCTATAACT 1-10-1
MOE 1466 397998 2348 2361 TGTTCCTATAACTG 2-10-2 MOE 1465 398064
2331 2342 CTGACACAATGT 1-10-1 MOE 1464 397997 2330 2343
TCTGACACAATGTC 2-10-2 MOE 1463 398063 2321 2332 GTCCTATTGCCA 1-10-1
MOE 1205 397996 2320 2333 TGTCCTATTGCCAT 2-10-2 MOE 1462 390022
2286 2297 CAGTTTATTCAA 1-10-1 MOE 1142 336221 2230 2243
TCAGACTTTTGTAA 3-8-3 MOE 1461 336220 2224 2237 TTTTGTAATTTGTG 3-8-3
MOE 1460 336219 2209 2222 ATGCTGATCTTCAT 3-8-3 MOE 1459 390021 2203
2214 CTTCATCAAAAG 1-10-1 MOE 1458 336218 2201 2214 CTTCATCAAAAGGT
3-8-3 MOE 1457 389779 2201 2212 TCATCAAAAGGT 1-9-2 MOE 1176 389979
2201 2212 TCATCAAAAGGT 1-10-1 MOE 1176 397995 2200 2213
TTGATCAAAAGGTT 2-10-2 MOE 1456 336217 2192 2205 AAGGTTCATTCTCT
3-8-3 MOE 1455 390020 2183 2194 TCTGGATCAGAG 1-10-1 MOE 1149 336216
2182 2195 CTCTGGATCAGAGT 3-8-3 MOE 1454 336215 2169 2182
TCAGTGGTGTCAGA 3-8-3 MOE 1453 398062 2166 2177 GGTGTCAGAATA 1-10-1
MOE 1255 397994 2165 2178 TGGTGTCAGAATAT 2-10-2 MOE 1452 390019
2163 2174 GTCAGAATATCT 1-10-1 MOE 1173 336214 2157 2170
GAATATCTATAATG 3-8-3 MOE 1573 398061 2151 2162 ATAATGATCAGG 1-10-1
MOE 1451 397993 2150 2163 TATAATGATCAGGT 2-10-2 MOE 1450 336213
2146 2159 ATGATCAGGTTCAT 3-8-3 MOE 1449 389778 2144 2155
TCAGGTTCATTG 1-9-2 MOE 1448 389978 2144 2155 TCAGGTTCATTG 1-10-1
MOE 1448 398060 2137 2148 CATTGTCACTAA 1-10-1 MOE 1447 336212 2136
2149 TCATTGTCACTAAC 3-8-3 MOE 1446 397992 2136 2149 TCATTGTCACTAAC
2-10-2 MOE 1446 336211 2112 2125 ACAGAAGTTGAACT 3-8-3 MOE 1445
390017 2111 2122 GAAGTTGAACTG 1-10-1 MOE 1444 398059 2108 2119
GTTGAACTGCTA 1-10-1 MOE 1443 397991 2107 2120 AGTTGAACTGCTAG 2-10-2
MOE 1442 336210 2104 2117 TGAACTGCTAGCCT 3-8-3 MOE 1441 335340 2104
2118 TTGAACTGCTAGCCT 1-10-4 MOE 1440 335339 2103 2117
TGAACTGCTAGCCTC 1-10-4 MOE 1439 335338 2102 2116 GAACTGCTAGCCTCT
1-10-4 MOE 1438 335337 2101 2115 AACTGCTAGCCTCTG 1-10-4 MOE 1437
335336 2100 2114 ACTGCTAGCCTCTGG 1-10-4 MOE 1436 390430 2099 2111
GCTAGCCTCTGGA 1-10-2 MOE 1163 Unmodified cytosines 390431 2099 2111
GCTAGCCTCTGGA 1-10-2 MOE 1163 Unmodified cytosines C in wing 9-
(aminoethoxy)phenoxazine 390432 2099 2111 GCTAGCCTCTGGA 1-10-2 MOE
1163 390433 2099 2111 GCTAGCCTCTGGA 1-10-2 MOE 1163 Unmodified
cytosines Nt 6 is 9-(aminoethoxy)phenoxazine 390434 2099 2111
GCTAGCCTCTGGA 1-10-2 MOE 1163 Unmodified cytosines Nt 7 is
9-(aminoethoxy)phenoxazine 390435 2099 2111 GCTAGCCTCTGGA 1-10-2
MOE 1163 Unmodified cytosines Nt 9 is 9-(aminoethoxy)phenoxazine
335335 2099 2113 CTGCTAGCCTCTGGA 1-10-4 MOE 1435 389777 2098 2109
TAGCCTCTGGAT 1-9-2 MOE 1434 389954 2098 2109 TAGCCTCTGGAT 1-10-1
MOE 1434 335334 2098 2112 TGCTAGCCTCTGGAT 1-10-4 MOE 1433 331429
2097 2110 CTAGCCTCTGGATT 2-10-2 MOE 1431 335349 2097 2110
CTAGCCTCTGGATT 2-10-2 MOE 1431 335367 2097 2110 CTAGCCTCTGGATT
2-10-2 Methyleneoxy BNA 1431 335378 2097 2110 CTAGCCTCTGGATT 2-10-2
Methyleneoxy BNA 1431 392061 2097 2110 CTAGCCTCTGGATT 2-10-2
Methyleneoxy BNA 1431 Unmodified cytosines in gap 383991 2097 2109
TAGCCTCTGGATT 1-10-2 1432 2'-(acetylamino-butyl-acetamido)-
cholesterol/MOE 383992 2097 2109 TAGCCTCTGGATT 1-10-2 1432
2'-(acetylamino-butyl-acetamido)- cholic acid/MOE 386970 2097 2109
TAGCCTCTGGATT 1-10-2 MOE 1432
390578 2097 2109 TAGCCTCTGGATT 1-10-2 MOE 1432 Unmodified cytosines
Ts in wings are 2-thiothymines 390614 2097 2109 TAGCCTCTGGATT
1-10-2 PentaF 1432 335333 2097 2111 GCTAGCCTCTGGATT 1-10-4 MOE 1430
386683 2097 2109 TAGCCTCTGGATT 1-10-2 2'-(butylacetamido)- 1432
palmitamide/MOE 371975 2096 2110 CTAGCCTCTGGATTT 3-10-2 MOE 1429
335341 2096 2111 GCTAGCCTCTGGATTT 3-10-3 MOE 1428 335350 2096 2111
GCTAGCCTCTGGATTT 3-10-3 MOE 1428 335368 2096 2111 GCTAGCCTCTGGATTT
3-10-3 Methyleneoxy BNA 1428 Phosphodiester linkages in wings
335379 2096 2111 GCTAGCCTCTGGATTT 3-10-3 Methyleneoxy BNA 1428
383739 2096 2111 GCTAGCCTCTGGATTT 3-10-3 MOE 1428 5-methylcytosine
in gap 384071 2096 2111 GCTAGCCTCTGGATTT 3-10-3 OMe 1428
5-methylcytosine in gap 384073 2096 2111 GCTAGCCTCTGGATTT 3-10-3
Methyleneoxy BNA 1428 5-methylcytosine in gap 390576 2096 2111
GCTAGCCTCTGGATTT 3-10-3 MOE 1428 5-methylcytosine in gap T's in
wings are 2-thiothymines 390580 2096 2111 GCTAGCCTCTGGATTT 3-10-3
MOE 1428 Pyrimidines in wings are 5-thiazole Unmodified cytosines
in gap 390581 2096 2111 GCTAGCCTCTGGATTT 3-10-3 MOE 1428 Unmodified
cytosines in gap 391863 2096 2111 GCTAGCCTCTGGATTT 3-10-3 MOE 1428
Unmodified cytosines 391864 2096 2111 GCTAGCCTCTGGATTT 3-10-3
Methyleneoxy BNA 1428 Unmodified cytosines in gap 391865 2096 2111
GCTAGCCTCTGGATTT 3-10-3 Methyleneoxy BNA 1428 Unmodified cytosines
375560 2096 2110 CTAGCCTCTGGATTT 2-10-3 MOE 1429 391172 2096 2110
CTAGCCTCTGGATTT 2-10-2 Methyleneoxy BNA 1429 Unmodified cytosines
391175 2096 2110 CTAGCCTCTGGATTT 2-10-3 Methyleneoxy BNA 1429
391449 2096 2110 CTAGCCTCTGGATTT 2-10-3 MOE 1429 Unmodified
cytosines 392054 2096 2110 CTAGCCTCTGGATTT 2-10-3 Methyleneoxy BNA
1429 Unmodified cytosines in gap 392055 2096 2110 CTAGCCTCTGGATTT
2-10-3 MOE 1429 Unmodified cytosines in gap 362977 2096 2111
GCTAGCCTCTGGATTT 2-12-2 MOE 1428 386770 2096 2109 TAGCCTCTGGATTT
1-11-2 MOE 1427 390577 2096 2109 TAGCCTCTGGATTT 1-10-3 MOE 1427
Unmodified cytosines T's in wings are 2-thiothymines 335332 2096
2110 CTAGCCTCTGGATTT 1-10-4 MOE 1429 390579 2096 2111
GCTAGCCTCTGGATTT 1-1-1-10-3 MOE/4'-thio/2'-O-[(2- 1428
methoxy)ethyl]-4'-thio/2'-O-[(2- methoxy)ethyl]-4'-thio Unmodified
cytosines in wings Phosphorodiester linkage in wings 391173 2096
2110 CTAGCCTCTGGATTT 2-10-3 (5'R)-5'-methyl- 1429 Methyleneoxy BNA
Unmodified cytosines 391174 2096 2110 CTAGCCTCTGGATTT 2-10-3
(5'S)-5'-methyl- 1429 Methyleneoxy BNA Unmodified cytosines 390607
2096 2111 GCTAGCCTCTGGATTT 3-10-3 MOE/pentaF 1428 Unmodified
cytosines in wing 390609 2096 2111 GCTAGCCTCTGGATTT 3-10-2-1
MOE/MOE/pentaF 1428 Unmodified cytosines in wing 384072 2096 2111
GCTAGCCTCTGGATTT 1-2-10-3 MOE/pentaF/pentaF 1428 Unmodified
cytosines in wings 390606 2096 2111 GCTAGCCTCTGGATTT 1-2-10-3
MOE/pentaF/pentaF 1428 Unmodified cytosines in wing 390608 2096
2111 GCTAGCCTCTGGATTT 1-2-10-3 MOE/pentaF/pentaF 1428 Unmodified
cytosines in wing 391869 2096 2111 GCTAGCCTCTGGATTT 1-2-10-3
Methyleneoxy BNA/(5'S)- 1428 5'-methyl-Methyleneoxy BNA/
(5'S)-5'-methyl-Methyleneoxy BNA Unmodified cytosines 385036 2096
2111 GCTAGCCTCTGGATTT 1-2-10-3 OMe/2'-O-methyl-4'- 1428
thio/2'-O-methyl-4'-thio Unmodified cytosines in wing 385871 2096
2111 GCTAGCCTCTGGATTT 1-2-10-3 OMe/ 2'-O-[(2- 1428
methoxy)ethyl]-4'-thio/2'-O-[(2- methoxy)ethyl]-4'-thio Unmodified
cytosines in wing 386682 2096 2111 GCTAGCCTCTGGATTT 1-2-10-3
2'-(butylacetamido)- 1428 palmitamide/MOE/MOE 390582 2096 2111
GCTAGCCTCTGGATTT 1-2-10-3 MOE/2'-O-[(2- 1428
methoxy)ethyl]-4'-thio/2'-O-[(2- methoxy)ethyl]-4'-thio Unmodified
cytosines in wings Phosphodiester linkage in wings 391868 2096 2111
GCTAGCCTCTGGATTT 1-2-10-3 (5'R)-5'-methyl- 1428 Methyleneoxy
BNA/Methyleneoxy BNA/(5'R)-5'-methyl- Methyleneoxy BNA Unmodified
cytosines 336209 2095 2108 AGCCTCTGGATTTG 3-8-3 MOE 1425 335331
2095 2109 TAGCCTCTGGATTTG 1-10-4 MOE 1426 335376 2095 2109
TAGCCTCTGGATTTG 1-10-4 Methyleneoxy BNA 1426 335377 2095 2109
TAGCCTCTGGATTTG 1-10-4 Methyleneoxy BNA 1426 Phosphodiester in 3'
wing 335330 2094 2108 AGCCTCTGGATTTGA 1-10-4 MOE 1424 336208 2079
2092 GGCTCCTCTACTGT 3-8-3 MOE 1423 336207 2073 2086 TCTACTGTTTTTGT
3-8-3 MOE 1422 336206 2047 2060 CACCTTAAAATTTG 3-8-3 MOE 1518
389776 2046 2057 CTTAAAATTTGG 1-9-2 MOE 1421 389977 2046 2057
CTTAAAATTTGG 1-10-1 MOE 1421 397990 2045 2058 CCTTAAAATTTGGA 2-10-2
MOE 1420 336205 2043 2056 TTAAATTTGGAGA 3-8-3 MOE 1419 398058 2029
2040 AGTATCGGTTGG 1-10-1 MOE 1418 336204 2028 2041 AAGTATCGGTTGGC
3-8-3 MOE 1417 397989 2028 2041 AAGTATCGGTTGGC 2-10-2 MOE 1417
336203 2002 2015 TGCTTTGTCAAGAT 3-8-3 MOE 1416 389775 2002 2013
CTTTGTCAAGAT 1-9-2 MOE 1177 389976 2002 2013 CTTTGTCAAGAT 1-10-1
MOE 1177 397988 2001 2014 GCTTTGTCAAGATC 2-10-2 MOE 1415 336202
1959 1972 TCCTTGTCATTATC 3-8-3 MOE 1414 389774 1945 1956
CACGCTCTATAC 1-9-2 MOE 1413 389975 1945 1956 CACGCTCTATAC 1-10-1
MOE 1413 336201 1944 1957 GCACGCTCTATACT 3-8-3 MOE 1412 336200 1929
1942 CAAATGCTATCGAT 3-8-3 MOE 1411 389773 1904 1915 AGACTTCCATTT
1-9-2 MOE 1410 389974 1904 1915 AGACTTCCATTT 1-10-1 MOE 1410 336199
1902 1915 AGACTTCCATTTTC 3-8-3 MOE 1409 336198 1884 1897
TTTTCTGAGGTTTC 3-8-3 MOE 1408 398057 1878 1889 GGTTTCCTCTGG 1-10-1
MOE 1407 397987 1877 1890 AGGTTTCCTCTGGT 2-10-2 MOE 1406 336197
1873 1886 TTCCTCTGGTCCTG 3-8-3 MOE 1405 390015 1868 1879
GGTCCTGGTATG 1-10-1 MOE 1404 398056 1865 1876 CCTGGTATGAAG 1-10-1
MOE 1403 336196 1864 1877 TCCTGGTATGAAGA 3-8-3 MOE 1402 397986 1864
1877 TCCTGGTATGAAGA 2-10-2 MOE 1402 398055 1849 1860 TATTTACCCAAA
1-10-1 MOE 1401 397985 1848 1861 GTATTTACCCAAAA 2-10-2 MOE 1400
336195 1847 1860 TATTTACCCAAAAG 3-8-3 MOE 1399 389772 1846 1857
TTACCCAAAAGT 1-9-2 MOE 1398 389973 1846 1857 TTACCCAAAAGT 1-10-1
MOE 1398 336194 1838 1851 AAAAGTGAAACATT 3-8-3 MOE 1145 398054 1836
1847 GTGAAACATTTT 1-10-1 MOE 1144 397984 1835 1848 AGTGAAACATTTTG
2-10-2 MOE 1397 336193 1828 1841 CATTTTGTCCTTTT 3-8-3 MOE 1182
336192 1810 1823 CATCTTGTTCTGTT 3-8-3 MOE 1396 336191 1800 1813
TGTTTGTGGAAGAA 3-8-3 MOE 1395 398053 1796 1807 TGGAAGAACTCT 1-10-1
MOE 1394 397983 1795 1808 GTGGAAGAACTCTA 2-10-2 MOE 1393 389771
1794 1805 GAAGAACTCTAC 1-9-2 MOE 1392 389972 1794 1805 GAAGAACTCTAC
1-10-1 MOE 1392 336190 1789 1802 GAACTCTACTTTGA 3-8-3 MOE 1391
336189 1773 1786 TCACCACACACAGG 3-8-3 MOE 1390 336188 1754 1767
GCTGAGGGAACTCA 3-8-3 MOE 1389 398052 1751 1762 GGGAACTCAAAG 1-10-1
MOE 1388 389770 1750 1761 GGAACTCAAAGT 1-9-2 MOE 1386 389971 1750
1761 GGAACTCAAAGT 1-10-1 MOE 1386 397982 1750 1763 AGGGAACTCAAAGT
2-10-2 MOE 1387
336187 1747 1760 GAACTCAAAGTACA 3-8-3 MOE 1385 390012 1745 1756
TCAAAGTACATG 1-10-1 MOE 1384 336186 1688 1701 TCTTCACCTTTAGC 3-8-3
MOE 1383 398051 1684 1695 CCTTTAGCTGGC 1-10-1 MOE 1220 397981 1683
1696 ACCTTTAGCTGGCA 2-10-2 MOE 1382 336185 1677 1690 AGCTGGCAGACCAC
3-8-3 MOE 1381 389769 1676 1687 TGGCAGACCACA 1-9-2 MOE 1249 389970
1676 1687 TGGCAGACCACA 1-10-1 MOE 1249 392060 1675 1688
CTGGCAGACCACAA 2-10-2 Methyleneoxy BNA 1380 Unmodified cytosines in
gap 398050 1672 1683 AGACCACAAACT 1-10-1 MOE 1379 397980 1671 1684
CAGACCACAAACTG 2-10-2 MOE 1378 390011 1658 1669 GGATTGCAAGTT 1-10-1
MOE 1238 336184 1655 1668 GATTGCAAGTTCCG 3-8-3 MOE 1508 336183 1644
1657 CCGCCACTGAACAT 3-8-3 MOE 1377 390010 1643 1654 CCACTGAACATT
1-10-1 MOE 1240 398049 1641 1652 ACTGAACATTGG 1-10-1 MOE 1376
397979 1640 1653 CACTGAACATTGGA 2-10-2 MOE 1375 336182 1633 1646
CATTGGAATAGTTT 3-8-3 MOE 1374 389768 1630 1641 GAATAGTTTCAA 1-9-2
MOE 1373 389969 1630 1641 GAATAGTTTCAA 1-10-1 MOE 1373 398048 1626
1637 AGTTTCAAACAT 1-10-1 MOE 1372 397978 1625 1638 TAGTTTCAAACATC
2-10-2 MOE 1371 336181 1623 1636 GTTTCAAACATCAT 3-8-3 MOE 1370
398047 1614 1625 CATCTTGTGAAA 1-10-1 MOE 1369 336180 1613 1626
TCATCTTGTGAAAC 3-8-3 MOE 1368 390009 1613 1624 ATCTTGTGAAAC 1-10-1
MOE 1175 397977 1613 1626 TCATCTTGTGAAAC 2-10-2 MOE 1368 390007
1563 1574 CAGGTAGCTATA 1-10-1 MOE 1367 336179 1561 1574
CAGGTAGCTATAAT 3-8-3 MOE 1366 336178 1541 1554 CATAGCGCCTCTGA 3-8-3
MOE 1365 336177 1534 1547 CCTCTGACTGGGAA 3-8-3 MOE 1364 389767 1534
1545 TCTGACTGGGAA 1-9-2 MOE 1151 389968 1534 1545 TCTGACTGGGAA
1-10-1 MOE 1151 335344 1503 1516 TCTCTGGTCCTTAC 2-10-2 MOE 1363
335355 1503 1516 TCTCTGGTCCTTAC 2-10-2 MOE 1363 Phosphodiester
linkage in wings 335370 1503 1516 TCTCTGGTCCTTAC 2-10-2
Methyleneoxy BNA 1363 Phosphodiester linkage in wings 335381 1503
1516 TCTCTGGTCCTTAC 2-10-2 Methyleneoxy BNA 1363 335411 1503 1516
TCTCTGGTCCTTAC 2-10-2 MOE 1363 3' C is 9-(aminoethoxy)phenoxazine
335412 1503 1516 TCTCTGGTCCTTAC 2-10-2 MOE 1363 C in 5' wing is 9-
(aminoethoxy)phenoxazine 335413 1503 1516 TCTCTGGTCCTTAC 2-10-2 MOE
1363 C in wings are 9-(aminoethoxy)phenoxazine 336176 1502 1515
CTCTGGTCCTTACT 3-8-3 MOE 1361 335345 1502 1517 GTCTCTGGTCCTTACT
3-10-3 MOE 1362 335356 1502 1517 GTCTCTGGTCCTTACT 3-10-3 MOE 1362
Phosphodiester linkage in wings 335371 1502 1517 GTCTCTGGTCCTTACT
3-10-3 Methyleneoxy BNA 1362 Phosphodiester linkage in wings 335382
1502 1517 GTCTCTGGTCCTTACT 3-10-3 Methyleneoxy BNA 1362 335414 1502
1517 GTCTCTGGTCCTTACT 3-10-3 MOE 1362 C in 3' wing is 9-
(aminoethoxy)phenoxazine 335415 1502 1517 GTCTCTGGTCCTTACT 3-10-3
MOE 1362 C in 5' wing is 9- (aminoethoxy)phenoxazine 335416 1502
1517 GTCTCTGGTCCTTACT 3-10-3 MOE 1362 C's in wings are
9-(aminoethoxy)phenoxazine 336175 1495 1508 CCTTACTTCCCCAT 3-8-3
MOE 1360 336174 1472 1485 GGGCCTCTTGTGCC 3-8-3 MOE 1359 336173 1465
1478 TTGTGCCTTTAAAA 3-8-3 MOE 1358 398046 1465 1476 GTGCCTTTAAAA
1-10-1 MOE 1199 389766 1464 1475 TGCCTTTAAAAA 1-9-2 MOE 1217 389967
1464 1475 TGCCTTTAAAAA 1-10-1 MOE 1217 397976 1464 1477
TGTGCCTTTAAAAA 2-10-2 MOE 1357 336172 1437 1450 AATAAATATGCACA
3-8-3 MOE 1356 398045 1423 1434 TCATTACACCAG 1-10-1 MOE 1355 336171
1422 1435 ATCATTACACCAGT 3-8-3 MOE 1354 389765 1422 1433
CATTACACCAGT 1-9-2 MOE 1353 389966 1422 1433 CATTACACCAGT 1-10-1
MOE 1353 397975 1422 1435 ATCATTACACCAGT 2-10-2 MOE 1354 390005
1400 1411 CCAGCTTTACAG 1-10-1 MOE 1352 336170 1392 1405
TTACAGTGAATTGC 3-8-3 MOE 1351 398044 1382 1393 GCTGCAACATGA 1-10-1
MOE 1350 336169 1381 1394 TGCTGCAACATGAT 3-8-3 MOE 1349 389764 1381
1392 CTGCAACATGAT 1-9-2 MOE 1018 389965 1381 1392 CTGCAACATGAT
1-10-1 MOE 1018 397974 1381 1394 TGCTGCAACATGAT 2-10-2 MOE 1349
336168 1362 1375 TCTTCACTTAGCCA 3-8-3 MOE 1348 390004 1362 1373
TTCACTTAGCCA 1-10-1 MOE 1208 336167 1353 1366 AGCCATTGGTCAAG 3-8-3
MOE 1347 398043 1345 1356 CAAGATCTTCAC 1-10-1 MOE 1244 336166 1344
1357 TCAAGATCTTCACA 3-8-3 MOE 1346 390003 1344 1355 AAGATCTTCACA
1-10-1 MOE 1243 397973 1344 1357 TCAAGATCTTCACA 2-10-2 MOE 1346
336165 1329 1342 AAGGGTTTGATAAG 3-8-3 MOE 1345 390002 1322 1333
ATAAGTTCTAGC 1-10-1 MOE 1344 336164 1318 1331 AAGTTCTAGCTGTG 3-8-3
MOE 1343 398042 1305 1316 TGGGTTATGGTC 1-10-1 MOE 1214 336163 1304
1317 GTGGGTTATGGTCT 3-8-3 MOE 1342 397972 1304 1317 GTGGGTTATGGTCT
2-10-2 MOE 1342 398089 1298 1309 TGGTCTTCAAAA 1-10-1 MOE 1341
389763 1296 1307 GTCTTCAAAAGG 1-9-2 MOE 1197 389964 1296 1307
GTCTTCAAAAGG 1-10-1 MOE 1197 398041 1294 1305 CTTCAAAAGGAT 1-10-1
MOE 1196 336162 1293 1306 TCTTCAAAAGGATA 3-8-3 MOE 1340 397971 1293
1306 TCTTCAAAAGGATA 2-10-2 MOE 1340 398040 1279 1290 GTGCAACTCTGC
1-10-1 MOE 1236 336161 1278 1291 TGTGCAACTCTGCA 3-8-3 MOE 1235
397970 1278 1291 TGTGCAACTCTGCA 2-10-2 MOE 1235 398039 1264 1275
TAAATTTGGCGG 1-10-1 MOE 1339 397969 1263 1276 TTAAATTTGGCGGT 2-10-2
MOE 1338 336160 1261 1274 AAATTTGGCGGTGT 3-8-3 MOE 1337 336159 1253
1266 CGGTGTCATAATGT 3-8-3 MOE 1336 398038 1252 1263 TGTCATAATGTC
1-10-1 MOE 1200 390000 1251 1262 GTCATAATGTCT 1-10-1 MOE 1194
397968 1251 1264 GTGTCATAATGTCT 2-10-2 MOE 1195 336158 1227 1240
AGATTGTATATCTT 3-8-3 MOE 1335 389762 1220 1231 ATCTTGTAATGG 1-9-2
MOE 1334 389963 1220 1231 ATCTTGTAATGG 1-10-1 MOE 1334 336157 1215
1228 TTGTAATGGTTTTT 3-8-3 MOE 1333 336156 1202 1215 TATGCTTTGAATCC
3-8-3 MOE 1332 389998 1199 1210 TTTGAATCCAAA 1-10-1 MOE 1331 397967
1198 1211 CTTTGAATCCAAAA 2-10-2 MOE 1330 336155 1190 1203
CCAAAAACCTTACT 3-8-3 MOE 1500 336154 1176 1189 ACATCATCAATATT 3-8-3
MOE 1329 389761 1171 1182 CAATATTGTTCC 1-9-2 MOE 1328 389962 1171
1182 CAATATTGTTCC 1-10-1 MOE 1328 398037 1170 1181 AATATTGTTCCT
1-10-1 MOE 1202 397966 1169 1182 CAATATTGTTCCTG 2-10-2 MOE 1327
336153 1164 1177 TTGTTCCTGTATAC 3-8-3 MOE 1326 336152 1149 1162
CCTTCAAGTCTTTC 3-8-3 MOE 1325 389996 1141 1152 TTTCTGCAGGAA 1-10-1
MOE 1165 336151 1138 1151 TTCTGCAGGAAATC 3-8-3 MOE 1324 398036 1138
1149 CTGCAGGAAATC 1-10-1 MOE 1323 397965 1137 1150 TCTGCAGGAAATCC
2-10-2 MOE 1322 389760 1129 1140 ATCCCATAGCAA 1-9-2 MOE 1321
389961 1129 1140 ATCCCATAGCAA 1-10-1 MOE 1321 398035 1126 1137
CCATAGCAATAA 1-10-1 MOE 1320 336150 1125 1138 CCCATAGCAATAAT 3-8-3
MOE 1319 397964 1125 1138 CCCATAGCAATAAT 2-10-2 MOE 1319 336149
1110 1123 TTTGGATAAATATA 3-8-3 MOE 1496 389995 1106 1117
TAAATATAGGTC 1-10-1 MOE 1516 336148 1100 1113 TATAGGTCAAGTCT 3-8-3
MOE 1495 398034 1099 1110 AGGTCAAGTCTA 1-10-1 MOE 1300 397963 1098
1111 TAGGTCAAGTCTAA 2-10-2 MOE 1494 389994 1095 1106 CAAGTCTAAGTC
1-10-1 MOE 1299 336147 1090 1103 GTCTAAGTCGAATC 3-8-3 MOE 1298
389993 1083 1094 GAATCCATCCTC 1-10-1 MOE 1297 336146 1080 1093
AATCCATCCTCTTG 3-8-3 MOE 1296 398033 1077 1088 ATCCTCTTGATA 1-10-1
MOE 1198 397962 1076 1089 CATCCTCTTGATAT 2-10-2 MOE 1295 336145
1070 1083 CTTGATATCTCCTT 3-8-3 MOE 1294 336144 1057 1070
TTTGTTTCTGCTAA 3-8-3 MOE 1293 389759 1056 1067 GTTTCTGCTAAC 1-9-2
MOE 1292 389960 1056 1067 GTTTCTGCTAAC 1-10-1 MOE 1292 392059 1055
1068 TGTTTCTGCTAACG 2-10-2 Methyleneoxy BNA 1291 Unmodified
cytosines in gap 336143 1044 1057 ACGATCTCTTTGAT 3-8-3 MOE 1290
398032 1038 1049 TTTGATGATGGC 1-10-1 MOE 1222 397961 1037 1050
CTTTGATGATGGCT 2-10-2 MOE 1289 389992 1036 1047 TGATGATGGCTG 1-10-1
MOE 1288 336142 1032 1045 ATGATGGCTGTCAT 3-8-3 MOE 1287 389991 1021
1032 TGTCTGGGAGCC 1-10-1 MOE 1286 392058 1020 1033 ATGTCTGGGAGCCT
2-10-2 Methyleneoxy BNA 1285 Unmodified cytosines in gap 397960
1020 1033 ATGTCTGGGAGCCT 2-10-2 MOE 1285 389990 1007 1018
TGGCTGAAGAAA 1-10-1 MOE 1284 397959 1006 1019 GTGGCTGAAGAAAA 2-10-2
MOE 1283 398031 987 998 GAGAGATGGCAG 1-10-1 MOE 1282 397958 986 999
AGAGAGATGGCAGA 2-10-2 MOE 1281 389758 983 994 GATGGCAGAAGC 1-9-2
MOE 1280 389959 983 994 GATGGCAGAAGC 1-10-1 MOE 1280 398030 976 987
GAAGCTGCTGGT 1-10-1 MOE 1143 397957 975 988 AGAAGCTGCTGGTG 2-10-2
MOE 1279 389989 953 964 TTCTGCAGGATG 1-10-1 MOE 1170 389757 941 952
GAAATGGCTCTG 1-9-2 MOE 1278 389958 941 952 GAAATGGCTCTG 1-10-1 MOE
1278 397956 940 953 GGAAATGGCTCTGG 2-10-2 MOE 1277 398029 931 942
TGGACTTGGCGG 1-10-1 MOE 1186 397955 930 943 CTGGACTTGGCGGT 2-10-2
MOE 1276 398028 914 925 GATGCCCCTCGC 1-10-1 MOE 1275 397954 913 926
TGATGCCCCTCGCT 2-10-2 MOE 1274 398027 883 894 GGACCGCAGCCG 1-10-1
MOE 1155 397953 882 895 TGGACCGCAGCCGG 2-10-2 MOE 1273 389756 874
885 CCGGGTAATGGC 1-9-2 MOE 1272 389957 874 885 CCGGGTAATGGC 1-10-1
MOE 1272 398026 867 878 ATGGCTGCTGCG 1-10-1 MOE 1160 397952 866 879
AATGGCTGCTGCGG 2-10-2 MOE 1271 389987 848 859 CTGGATGGTTGC 1-10-1
MOE 1270 389755 806 817 AGAGGCCTGGCA 1-9-2 MOE 1269 389956 806 817
AGAGGCCTGGCA 1-10-1 MOE 1269 389985 584 595 ATGGTGACAGGC 1-10-1 MOE
1268 398025 581 592 GTGACAGGCGAC 1-10-1 MOE 1267 397951 580 593
GGTGACAGGCGACT 2-10-2 MOE 1266 389754 312 323 TGCTCACAGGCG 1-9-2
MOE 1158 389955 312 323 TGCTCACAGGCG 1-10-1 MOE 1158 398024 231 242
CAGCGGCTCAAC 1-10-1 MOE 1265 397950 230 243 ACAGCGGCTCAACT 2-10-2
MOE 1264 389982 205 216 CATGGCTGCAGC 1-10-1 MOE 1161 392056 204 217
TCATGGCTGCAGCT 2-10-2 Methyleneoxy BNA 1263 394424 204 217
TCATGGCTGCAGCT 2-10-2 MOE 1263 396007 204 217 TCATGGCTGCAGCT 2-10-2
(R)-CMOE BNA 1263 Unmodified cytosines 396008 204 217
TCATGGCTGCAGCT 2-10-2 (S)-CMOE BNA 1263 Unmodified cytosines 396009
204 217 TCATGGCTGCAGCT 2-10-2 .alpha.-L-methyleneoxy BNA 1263
Unmodified cytosines 396566 204 217 TCATGGCTGCAGCT 2-10-2 Oxyamino
BNA 1263 Unmodified cytosines 396567 204 217 TCATGGCTGCAGCT 2-10-2
N-Methyl-Oxyamino BNA 1263 Unmodified cytosines 396568 204 217
TCATGGCTGCAGCT 2-10-2 (6R)-6-Methyl 1263 Methyleneoxy BNA
Unmodified cytosines 397913 204 217 TCATGGCTGCAGCT 2-10-2 OMe 1263
Unmodified cytosines in gap 401974 204 217 TCATGGCTGCAGCT 2-10-2
OMe 1263 Unmodified cytosines 403737 204 217 TCATGGCTGCAGCT 2-10-2
Methyleneoxy BNA 1263 5-thiazole nucleobases in wings 404121 204
217 TCATGGCTGCAGCT 2-10-2 Methyleneoxy BNA 1263 5-methylcytosine in
gaps 3' Terminal THF phosphorothioate 404228 204 217 TCATGGCTGCAGCT
2-10-2 Methyleneoxy BNA 1263 5-methylcytosinse in gaps 5'-terminal
reverse abasic 396024 204 217 TCATGGCTGCAGCT 2-10-2
(6'S)-6'-methyl- 1263 Methyleneoxy BNA Unmodified cytosines 396569
204 217 TCATGGCTGCAGCT 2-10-2 (5'S)-5'-methyl- 1263 Methyleneoxy
BNA Unmodified cytosines 396577 204 217 TCATGGCTGCAGCT 2-10-1-1
Methyleneoxy BNA/ 1263 Methyleneoxy BNA/2'-
(butylacetamido)-palmitamide/ Unmodified cytosines in gap 396576
204 217 TCATGGCTGCAGCT 1-1-10-2 2'-(butylacetamido)- 1263
palmitamide/Methyleneoxy BNA/ Methyleneoxy BNA Unmodified cytosines
in gap 398023 191 202 CCGAGAGGAGAG 1-10-1 MOE 1262 397949 190 203
TCCGAGAGGAGAGA 2-10-2 MOE 1261 398022 126 137 AAGAGTCCCGCC 1-10-1
MOE 1260 397948 125 138 AAAGAGTCCCGCCA 2-10-2 MOE 1259
TABLE-US-00024 TABLE 22 Short Antisense Compounds targeted to SEQ
ID NO: 15 5' 3' SEQ ISIS Target Target ID No. Site Site Sequence
(5'-3') Gapmer Motif NO 397948 525 538 AAAGAGTCCCGCCA 2-10-2 MOE
1259 398022 526 537 AAGAGTCCCGCC 1-10-1 MOE 1260 397949 590 603
TCCGAGAGGAGAGA 2-10-2 MOE 1261 398023 591 602 CCGAGAGGAGAG 1-10-1
MOE 1262 394424 604 617 TCATGGCTGCAGCT 2-10-2 MOE 1263 397913 604
617 TCATGGCTGCAGCT 2-10-2 OMe 1263 Unmodified cytosines in gap
401974 604 617 TCATGGCTGCAGCT 2-10-2 Ome 1263 Unmodified cytosines
403737 604 617 TCATGGCTGCAGCT 2-10-2 Methyleneoxy BNA 1263
5-thiazole nucleobases in wings 392056 604 617 TCATGGCTGCAGCT
2-10-2 Methyleneoxy BNA 1263 Unmodified cytosines in gap 396576 604
617 TCATGGCTGCAGCT 1-1-10-2 2'- 1263 (butylacetamido)-
palmitamide/Methyleneoxy BNA/Methyleneoxy BNA Unmodified cytosines
in gap 396577 604 617 TCATGGCTGCAGCT 2-10-1-2 Methyleneoxy 1263
BNA/Methyleneoxy BNA/ 2'-(butylacetamido)- palmitamide/ Unmodified
cytosines in gap 404121 604 617 TCATGGCTGCAGCT 2-10-2 Methyleneoxy
BNA 1263 5-methylcytosine in gaps 3' Terminal THF phosphorothioate
404228 604 617 TCATGGCTGCAGCT 2-10-2 Methyleneoxy BNA 1263
5-methylcytosinse in gaps 5'-terminal reverse abasic 396007 604 617
TCATGGCTGCAGCT 2-10-2 (R)-CMOE BNA 1263 Unmodified cytosines 396008
604 617 TCATGGCTGCAGCT 2-10-2 (S)-CMOE BNA 1263 Unmodified
cytosines 396009 604 617 TCATGGCTGCAGCT 2-10-2
.alpha.-L-methyleneoxy 1263 BNA Unmodified cytosines 396024 604 617
TCATGGCTGCAGCT 2-10-2 (6'S)-6'-methyl- 1263 Methyleneoxy BNA
Unmodified cytosines 396566 604 617 TCATGGCTGCAGCT 2-10-2 Oxyamino
BNA 1263 Unmodified cytosines 396567 604 617 TCATGGCTGCAGCT 2-10-2
N-Methyl-Oxyamino 1263 BNA Unmodified cytosines 396568 604 617
TCATGGCTGCAGCT 2-10-2 (6R)-6-Methyl 1263 Methyleneoxy BNA
Unmodified cytosines 396569 604 617 TCATGGCTGCAGCT 2-10-2
(5'S)-5'-methyl- 1263 Methyleneoxy BNA Unmodified cytosines 389982
605 616 CATGGCTGCAGC 1-10-1 MOE 1161 397950 630 643 ACAGCGGCTCAACT
2-10-2 MOE 1264 398024 631 642 CAGCGGCTCAAC 1-10-1 MOE 1265 389955
712 723 TGCTCACAGGCG 1-10-1 MOE 1158 389754 712 723 TGCTCACAGGCG
1-9-2 MOE 1158 397951 980 993 GGTGACAGGCGACT 2-10-2 MOE 1266 398025
981 992 GTGACAGGCGAC 1-10-1 MOE 1267 389985 984 995 ATGGTGACAGGC
1-10-1 MOE 1268 389956 1206 1217 AGAGGCCTGGCA 1-10-1 MOE 1269
389755 1206 1217 AGAGGCCTGGCA 1-9-2 MOE 1269 389987 1248 1259
CTGGATGGTTGC 1-10-1 MOE 1270 397952 1266 1279 AATGGCTGCTGCGG 2-10-2
MOE 1271 398026 1267 1278 ATGGCTGCTGCG 1-10-1 MOE 1160 389957 1274
1285 CCGGGTAATGGC 1-10-1 MOE 1272 389756 1274 1285 CCGGGTAATGGC
1-9-2 MOE 1272 397953 1282 1295 TGGACCGCAGCCGG 2-10-2 MOE 1273
398027 1283 1294 GGACCGCAGCCG 1-10-1 MOE 1155 397954 1313 1326
TGATGCCCCTCGCT 2-10-2 MOE 1274 398028 1314 1325 GATGCCCCTCGC 1-10-1
MOE 1275 397955 1330 1343 CTGGACTTGGCGGT 2-10-2 MOE 1276 398029
1331 1342 TGGACTTGGCGG 1-10-1 MOE 1186 397956 1340 1353
GGAAATGGCTCTGG 2-10-2 MOE 1277 389958 1341 1352 GAAATGGCTCTG 1-10-1
MOE 1278 389757 1341 1352 GAAATGGCTCTG 1-9-2 MOE 1278 389989 1353
1364 TTCTGCAGGATG 1-10-1 MOE 1170 397957 1375 1388 AGAAGCTGCTGGTG
2-10-2 MOE 1279 398030 1376 1387 GAAGCTGCTGGT 1-10-1 MOE 1143
389959 1383 1394 GATGGCAGAAGC 1-10-1 MOE 1280 389758 1383 1394
GATGGCAGAAGC 1-9-2 MOE 1280 397958 1386 1399 AGAGAGATGGCAGA 2-10-2
MOE 1281 398031 1387 1398 GAGAGATGGCAG 1-10-1 MOE 1282 397959 1406
1419 GTGGCTGAAGAAAA 2-10-2 MOE 1283 389990 1407 1418 TGGCTGAAGAAA
1-10-1 MOE 1284 397960 1420 1433 ATGTCTGGGAGCCT 2-10-2 MOE 1285
392058 1420 1433 ATGTCTGGGAGCCT 2-10-2 Methyleneoxy BNA 1285
5-methylcytosine in wing 389991 1421 1432 TGTCTGGGAGCC 1-10-1 MOE
1286 336142 1432 1445 ATGATGGCTGTCAT 3-8-3 MOE 1287 389992 1436
1447 TGATGATGGCTG 1-10-1 MOE 1288 397961 1437 1450 CTTTGATGATGGCT
2-10-2 MOE 1289 398032 1438 1449 TTTGATGATGGC 1-10-1 MOE 1222
336143 1444 1457 ACGATCTCTTTGAT 3-8-3 MOE 1290 392059 1455 1468
TGTTTCTGCTAACG 2-10-2 Methyleneoxy BNA 1291 5-methylcytosine in
wing 389960 1456 1467 GTTTCTGCTAAC 1-10-1 MOE 1292 389759 1456 1467
GTTTCTGCTAAC 1-9-2 MOE 1292 336144 1457 1470 TTTGTTTCTGCTAA 3-8-3
MOE 1293 336145 1470 1483 CTTGATATCTCCTT 3-8-3 MOE 1294 397962 1476
1489 CATCCTCTTGATAT 2-10-2 MOE 1295 398033 1477 1488 ATCCTCTTGATA
1-10-1 MOE 1198 336146 1480 1493 AATCCATCCTCTTG 3-8-3 MOE 1296
389993 1483 1494 GAATCCATCCTC 1-10-1 MOE 1297 336147 1490 1503
GTCTAAGTCGAATC 3-8-3 MOE 1298 389994 1495 1506 CAAGTCTAAGTC 1-10-1
MOE 1299 398034 1499 1510 AGGTCAAGTCTA 1-10-1 MOE 1300 398010 1500
1513 TACAGGTCAAGTCT 2-10-2 MOE 1166 398077 1501 1512 ACAGGTCAAGTC
1-10-1 MOE 1167 398011 1512 1525 CGCAGAAATGGATA 2-10-2 MOE 1301
398078 1513 1524 GCAGAAATGGAT 1-10-1 MOE 1302 398012 1570 1583
TTCGCATCCGTCTA 2-10-2 MOE 1303 398079 1571 1582 TCGCATCCGTCT 1-10-1
MOE 1304 398013 1663 1676 CCCTAGGTTGAATA 2-10-2 MOE 1305 398080
1664 1675 CCTAGGTTGAAT 1-10-1 MOE 1306 398014 2025 2038
GTTATGCAAATCAG 2-10-2 MOE 1307 398081 2026 2037 TTATGCAAATCA 1-10-1
MOE 1308 398015 2620 2633 TGACTCAGTAAATT 2-10-2 MOE 1309 398082
2621 2632 GACTCAGTAAAT 1-10-1 MOE 1310 398016 2655 2668
TTAAAATTCTTGGG 2-10-2 MOE 1311 398083 2656 2667 TAAAATTCTTGG 1-10-1
MOE 1312 398017 2687 2700 CCTAACTTTTAGAC 2-10-2 MOE 1313 398084
2688 2699 CTAACTTTTAGA 1-10-1 MOE 1314 398018 2745 2758
ACCTGAAACTGCAA 2-10-2 MOE 1315 398085 2746 2757 CCTGAAACTGCA 1-10-1
MOE 1157 398019 13166 13179 GTGTCAAAACCACT 2-10-2 MOE 1316 398086
13167 13178 TGTCAAAACCAC 1-10-1 MOE 1204 398020 14675 14688
CCTATTCCCACTGA 2-10-2 MOE 1317 398087 14676 14687 CTATTCCCACTG
1-10-1 MOE 1318 390033 15351 15362 AGCCAACTGCAA 1-10-1 MOE 1483
398021 30985 30998 TTGGATAAATATCT 2-10-2 MOE 1168 398088 30986
30997 TGGATAAATATC 1-10-1 MOE 1169 397964 31001 31014
CCCATAGCAATAAT 2-10-2 MOE 1319 336150 31001 31014 CCCATAGCAATAAT
3-8-3 MOE 1319 398035 31002 31013 CCATAGCAATAA 1-10-1 MOE 1320
389961 31005 31016 ATCCCATAGCAA 1-10-1 MOE 1321 389760 31005 31016
ATCCCATAGCAA 1-9-2 MOE 1321 397965 31013 31026 TCTGCAGGAAATCC
2-10-2 MOE 1322
398036 31014 31025 CTGCAGGAAATC 1-10-1 MOE 1323 336151 31014 31027
TTCTGCAGGAAATC 3-8-3 MOE 1324 389996 31017 31028 TTTCTGCAGGAA
1-10-1 MOE 1165 336152 31025 31038 CCTTCAAGTCTTTC 3-8-3 MOE 1325
336153 31040 31053 TTGTTCCTGTATAC 3-8-3 MOE 1326 397966 31045 31058
CAATATTGTTCCTG 2-10-2 MOE 1327 398037 31046 31057 AATATTGTTCCT
1-10-1 MOE 1202 389962 31047 31058 CAATATTGTTCC 1-10-1 MOE 1328
389761 31047 31058 CAATATTGTTCC 1-9-2 MOE 1328 336154 31052 31065
ACATCATCAATATT 3-8-3 MOE 1329 389977 31480 31491 CTTAAAATTTGG
1-10-1 MOE 1421 389776 31480 31491 CTTAAAATTTGG 1-9-2 MOE 1421
397967 62446 62459 CTTTGAATCCAAAA 2-10-2 MOE 1330 389998 62447
62458 TTTGAATCCAAA 1-10-1 MOE 1331 336156 62450 62463
TATGCTTTGAATCC 3-8-3 MOE 1332 336157 62463 62476 TTGTAATGGTTTTT
3-8-3 MOE 1333 389963 62468 62479 ATCTTGTAATGG 1-10-1 MOE 1334
389762 62468 62479 ATCTTGTAATGG 1-9-2 MOE 1334 336158 62475 62488
AGATTGTATATCTT 3-8-3 MOE 1335 390000 67987 67998 GTCATAATGTCT
1-10-1 MOE 1194 397968 67987 68000 GTGTCATAATGTCT 2-10-2 MOE 1195
398038 67988 67999 TGTCATAATGTC 1-10-1 MOE 1200 336159 67989 68002
CGGTGTCATAATGT 3-8-3 MOE 1336 336160 67997 68010 AAATTTGGCGGTGT
3-8-3 MOE 1337 397969 67999 68012 TTAAATTTGGCGGT 2-10-2 MOE 1338
398039 68000 68011 TAAATTTGGCGG 1-10-1 MOE 1339 397971 69952 69965
TCTTCAAAAGGATA 2-10-2 MOE 1340 336162 69952 69965 TCTTCAAAAGGATA
3-8-3 MOE 1340 398041 69953 69964 CTTCAAAAGGAT 1-10-1 MOE 1196
389964 69955 69966 GTCTTCAAAAGG 1-10-1 MOE 1197 389763 69955 69966
GTCTTCAAAAGG 1-9-2 MOE 1197 398089 69957 69968 TGGTCTTCAAAA 1-10-1
MOE 1341 397972 69963 69976 GTGGGTTATGGTCT 2-10-2 MOE 1342 336163
69963 69976 GTGGGTTATGGTCT 3-8-3 MOE 1342 398042 69964 69975
TGGGTTATGGTC 1-10-1 MOE 1214 336164 69977 69990 AAGTTCTAGCTGTG
3-8-3 MOE 1343 390002 69981 69992 ATAAGTTCTAGC 1-10-1 MOE 1344
336165 69988 70001 AAGGGTTTGATAAG 3-8-3 MOE 1345 390003 70003 70014
AAGATCTTCACA 1-10-1 MOE 1243 397973 70003 70016 TCAAGATCTTCACA
2-10-2 MOE 1346 336166 70003 70016 TCAAGATCTTCACA 3-8-3 MOE 1346
398043 70004 70015 CAAGATCTTCAC 1-10-1 MOE 1244 336167 70012 70025
AGCCATTGGTCAAG 3-8-3 MOE 1347 390004 70021 70032 TTCACTTAGCCA
1-10-1 MOE 1208 336168 70021 70034 TCTTCACTTAGCCA 3-8-3 MOE 1348
389965 70040 70051 CTGCAACATGAT 1-10-1 MOE 1018 389764 70040 70051
CTGCAACATGAT 1-9-2 MOE 1018 397974 70040 70053 TGCTGCAACATGAT
2-10-2 MOE 1349 336169 70040 70053 TGCTGCAACATGAT 3-8-3 MOE 1349
398044 70041 70052 GCTGCAACATGA 1-10-1 MOE 1350 336170 70051 70064
TTACAGTGAATTGC 3-8-3 MOE 1351 390005 70059 70070 CCAGCTTTACAG
1-10-1 MOE 1352 389966 70081 70092 CATTACACCAGT 1-10-1 MOE 1353
389765 70081 70092 CATTACACCAGT 1-9-2 MOE 1353 397975 70081 70094
ATCATTACACCAGT 2-10-2 MOE 1354 336171 70081 70094 ATCATTACACCAGT
3-8-3 MOE 1354 398045 70082 70093 TCATTACACCAG 1-10-1 MOE 1355
336172 70096 70109 AATAAATATGCACA 3-8-3 MOE 1356 389967 70123 70134
TGCCTTTAAAAA 1-10-1 MOE 1217 389766 70123 70134 TGCCTTTAAAAA 1-9-2
MOE 1217 397976 70123 70136 TGTGCCTTTAAAAA 2-10-2 MOE 1357 398046
70124 70135 GTGCCTTTAAAA 1-10-1 MOE 1199 336173 70124 70137
TTGTGCCTTTAAAA 3-8-3 MOE 1358 336174 70131 70144 GGGCCTCTTGTGCC
3-8-3 MOE 1359 336175 70154 70167 CCTTACTTCCCCAT 3-8-3 MOE 1360
335345 70161 70176 GTCTCTGGTCCTTACT 3-10-3 MOE 1362 335356 70161
70176 GTCTCTGGTCCTTACT 3-10-3 MOE 1362 Phosphodiester linkage in
wings 335414 70161 70176 GTCTCTGGTCCTTACT 3-10-3 MOE 1362 C in 3'
wing is 9- (aminoethoxy)phenoxazine 335415 70161 70176
GTCTCTGGTCCTTACT 3-10-3 MOE 1362 C in 5' wing is 9-
(aminoethoxy)phenoxazine 335416 70161 70176 GTCTCTGGTCCTTACT 3-10-3
MOE 1362 C's in wings are 9- (aminoethoxy)phenoxazine 336176 70161
70174 CTCTGGTCCTTACT 3-8-3 MOE 1361 335371 70161 70176
GTCTCTGGTCCTTACT 3-10-3 Methyleneoxy BNA 1362 Phosphodiester
linkage in wings 335382 70161 70176 GTCTCTGGTCCTTACT 3-10-3
Methyleneoxy BNA 1362 335344 70162 70175 TCTCTGGTCCTTAC 2-10-2 MOE
1363 335355 70162 70175 TCTCTGGTCCTTAC 2-10-2 MOE 1363
Phosphodiester linkage in wings 335411 70162 70175 TCTCTGGTCCTTAC
2-10-2 MOE 1363 3' C is 9- (aminoethoxy)phenoxazine 335412 70162
70175 TCTCTGGTCCTTAC 2-10-2 MOE 1363 2.sup.nd C is 9-
(aminoethoxy)phenoxazine 335413 70162 70175 TCTCTGGTCCTTAC 2-10-2
MOE 1363 2.sup.nd and 3' terminal C's are 9-
(aminoethoxy)phenoxazine 335370 70162 70175 TCTCTGGTCCTTAC 2-10-2
Methyleneoxy BNA 1363 Phosphodiester linkage in wings 335381 70162
70175 TCTCTGGTCCTTAC 2-10-2 Methyleneoxy BNA 1363 398068 79799
79810 ACAGCTACACAA 1-10-1 MOE 1472 389968 89056 89067 TCTGACTGGGAA
1-10-1 MOE 1151 389767 89056 89067 TCTGACTGGGAA 1-9-2 MOE 1151
336177 89056 89069 CCTCTGACTGGGAA 3-8-3 MOE 1364 336178 89063 89076
CATAGCGCCTCTGA 3-8-3 MOE 1365 336179 89083 89096 CAGGTAGCTATAAT
3-8-3 MOE 1366 390007 89085 89096 CAGGTAGCTATA 1-10-1 MOE 1367
390009 89135 89146 ATCTTGTGAAAC 1-10-1 MOE 1175 397977 89135 89148
TCATCTTGTGAAAC 2-10-2 MOE 1368 336180 89135 89148 TCATCTTGTGAAAC
3-8-3 MOE 1368 398047 89136 89147 CATCTTGTGAAA 1-10-1 MOE 1369
336181 89145 89158 GTTTCAAACATCAT 3-8-3 MOE 1370 397978 89147 89160
TAGTTTCAAACATC 2-10-2 MOE 1371 398048 89148 89159 AGTTTCAAACAT
1-10-1 MOE 1372 389969 89152 89163 GAATAGTTTCAA 1-10-1 MOE 1373
389768 89152 89163 GAATAGTTTCAA 1-9-2 MOE 1373 336182 89155 89168
CATTGGAATAGTTT 3-8-3 MOE 1374 397979 89162 89175 CACTGAACATTGGA
2-10-2 MOE 1375 398049 89163 89174 ACTGAACATTGG 1-10-1 MOE 1376
390010 89165 89176 CCACTGAACATT 1-10-1 MOE 1240 336183 89166 89179
CCGCCACTGAACAT 3-8-3 MOE 1377 397980 94786 94799 CAGACCACAAACTG
2-10-2 MOE 1378 398050 94787 94798 AGACCACAAACT 1-10-1 MOE 1379
392060 94790 94803 CTGGCAGACCACAA 2-10-2 Methyleneoxy BNA 1380
Unmodified cytosines in gap 389970 94791 94802 TGGCAGACCACA 1-10-1
MOE 1249 389769 94791 94802 TGGCAGACCACA 1-9-2 MOE 1249 336185
94792 94805 AGCTGGCAGACCAC 3-8-3 MOE 1381 397981 94798 94811
ACCTTTAGCTGGCA 2-10-2 MOE 1382 398051 94799 94810 CCTTTAGCTGGC
1-10-1 MOE 1220 336186 94803 94816 TCTTCACCTTTAGC 3-8-3 MOE 1383
390012 94860 94871 TCAAAGTACATG 1-10-1 MOE 1384 336187 94862 94875
GAACTCAAAGTACA 3-8-3 MOE 1385 389971 94865 94876 GGAACTCAAAGT
1-10-1 MOE 1386 389770 94865 94876 GGAACTCAAAGT 1-9-2 MOE 1386
397982 94865 94878 AGGGAACTCAAAGT 2-10-2 MOE 1387 398052 94866
94877 GGGAACTCAAAG 1-10-1 MOE 1388 336188 94869 94882
GCTGAGGGAACTCA 3-8-3 MOE 1389 336189 94888 94901 TCACCACACACAGG
3-8-3 MOE 1390 336190 94904 94917 GAACTCTACTTTGA 3-8-3 MOE 1391
389972 94909 94920 GAAGAACTCTAC 1-10-1 MOE 1392 389771 94909 94920
GAAGAACTCTAC 1-9-2 MOE 1392 397983 94910 94923 GTGGAAGAACTCTA
2-10-2 MOE 1393 398053 94911 94922 TGGAAGAACTCT 1-10-1 MOE 1394
336191 94915 94928 TGTTTGTGGAAGAA 3-8-3 MOE 1395 336192 94925 94938
CATCTTGTTCTGTT 3-8-3 MOE 1396 397984 97824 97837 AGTGAAACATTTTG
2-10-2 MOE 1397 398054 97825 97836 GTGAAACATTTT 1-10-1 MOE 1144
336194 97827 97840 AAAAGTGAAACATT 3-8-3 MOE 1145 389973 97835 97846
TTACCCAAAAGT 1-10-1 MOE 1398 389772 97835 97846 TTACCCAAAAGT 1-9-2
MOE 1398 336195 97836 97849 TATTTACCCAAAAG 3-8-3 MOE 1399 397985
97837 97850 GTATTTACCCAAAA 2-10-2 MOE 1400 398055 97838 97849
TATTTACCCAAA 1-10-1 MOE 1401 397986 97853 97866 TCCTGGTATGAAGA
2-10-2 MOE 1402 336196 97853 97866 TCCTGGTATGAAGA 3-8-3 MOE 1402
398056 97854 97865 CCTGGTATGAAG 1-10-1 MOE 1403 390015 97857 97868
GGTCCTGGTATG 1-10-1 MOE 1404 336197 97862 97875 TTCCTCTGGTCCTG
3-8-3 MOE 1405 397987 97866 97879 AGGTTTCCTCTGGT 2-10-2 MOE 1406
398057 97867 97878 GGTTTCCTCTGG 1-10-1 MOE 1407 336198 97873 97886
TTTTCTGAGGTTTC 3-8-3 MOE 1408 336199 97891 97904 AGACTTCCATTTTC
3-8-3 MOE 1409 389974 97893 97904 AGACTTCCATTT 1-10-1 MOE 1410
389773 97893 97904 AGACTTCCATTT 1-9-2 MOE 1410 336200 97918 97931
CAAATGCTATCGAT 3-8-3 MOE 1411 336201 97933 97946 GCACGCTCTATACT
3-8-3 MOE 1412 389975 97934 97945 CACGCTCTATAC 1-10-1 MOE 1413
389774 97934 97945 CACGCTCTATAC 1-9-2 MOE 1413 336202 97948 97961
TCCTTGTCATTATC 3-8-3 MOE 1414 397988 97990 98003 GCTTTGTCAAGATC
2-10-2 MOE 1415 389976 97991 98002 CTTTGTCAAGAT 1-10-1 MOE 1177
389775 97991 98002 CTTTGTCAAGAT 1-9-2 MOE 1177 336203 97991 98004
TGCTTTGTCAAGAT 3-8-3 MOE 1416 397989 98017 98030 AAGTATCGGTTGGC
2-10-2 MOE 1417 336204 98017 98030 AAGTATCGGTTGGC 3-8-3 MOE 1417
398058 98018 98029 AGTATCGGTTGG 1-10-1 MOE 1418 336205 98032 98045
TTAAAATTTGGAGA 3-8-3 MOE 1419 397990 98034 98047 CCTTAAAATTTGGA
2-10-2 MOE 1420 389977 98035 98046 CTTAAAATTTGG 1-10-1 MOE 1421
389776 98035 98046 CTTAAAATTTGG 1-9-2 MOE 1421 336207 102230 102243
TCTACTGTTTTTGT 3-8-3 MOE 1422 336208 102236 102249 GGCTCCTCTACTGT
3-8-3 MOE 1423 335330 102251 102265 AGCCTCTGGATTTGA 1-10-4 MOE 1424
335331 102252 102266 TAGCCTCTGGATTTG 1-10-4 MOE 1426 336209 102252
102265 AGCCTCTGGATTTG 3-8-3 MOE 1425 335377 102252 102266
TAGCCTCTGGATTTG 1-10-4 Methyleneoxy BNA 1426 Phosphodiester in 3'
wing 335376 102252 102266 TAGCCTCTGGATTTG 1-10-4 Methyleneoxy BNA
1426 390577 102253 102266 TAGCCTCTGGATTT 1-10-3 MOE 1427 Unmodified
cytosines T's in wings are 2- thiothymines 335332 102253 102267
CTAGCCTCTGGATTT 1-10-4 MOE 1429 386770 102253 102266 TAGCCTCTGGATTT
1-11-2 MOE 1427 375560 102253 102267 CTAGCCTCTGGATTT 2-10-3 MOE
1429 391449 102253 102267 CTAGCCTCTGGATTT 2-10-3 MOE 1429
Unmodified cytosines 392055 102253 102267 CTAGCCTCTGGATTT 2-10-3
MOE 1429 Unmodified cytosines in gap 362977 102253 102268
GCTAGCCTCTGGATTT 2-12-2 MOE 1428 371975 102253 102267
CTAGCCTCTGGATTT 3-10-2 MOE 1429 386556 102253 102268
GCTAGCCTCTGGATTT 3-10-3 MOE 1428 335341 102253 102268
GCTAGCCTCTGGATTT 3-10-3 MOE 1428 335350 102253 102268
GCTAGCCTCTGGATTT 3-10-3 MOE 1428 383739 102253 102268
GCTAGCCTCTGGATTT 3-10-3 MOE 1428 5-methylcytosine in gap 390576
102253 102268 GCTAGCCTCTGGATTT 3-10-3 MOE 1428 5-methylcytosine in
gap T's in wings are 2- thiothymines 390580 102253 102268
GCTAGCCTCTGGATTT 3-10-3 MOE 1428 Pyrimidines in wings are 5-
thiazole Unmodified cytosines in gap 390581 102253 102268
GCTAGCCTCTGGATTT 3-10-3 MOE 1428 Unmodified cytosines in gap 391096
102253 102268 GCTAGCCTCTGGATTT 3-10-3 MOE 1428 391098 102253 102268
GCTAGCCTCTGGATTT 3-10-3 MOE 1428 391863 102253 102268
GCTAGCCTCTGGATTT 3-10-3 MOE 1428 Unmodified cytosines 384071 102253
102268 GCTAGCCTCTGGATTT 3-10-3 OMe 1428 5-methylcytosine in gap
385036 102253 102268 GCTAGCCTCTGGATTT 1-2-10-3 OMe/2'-O-methyl-
1428 4'-thio/2'-O-methyl-4'-thio Unmodified cytosines in wing
335368 102253 102268 GCTAGCCTCTGGATTT 3-10-3 Methyleneoxy BNA 1428
Phosphodiester linkages in wings 391864 102253 102268
GCTAGCCTCTGGATTT 3-10-3 Methyleneoxy BNA 1428 Unmodified cytosines
in gap 392054 102253 102267 CTAGCCTCTGGATTT 2-10-3 Methyleneoxy BNA
1429 Unmodified cytosines in gap 391172 102253 102267
CTAGCCTCTGGATTT 2-10-3 Methyleneoxy BNA 1429 Unmodified cytosines
391865 102253 102268 GCTAGCCTCTGGATTT 3-10-3 Methyleneoxy BNA 1428
Unmodified cytosines 391868 102253 102268 GCTAGCCTCTGGATTT 1-2-10-3
(5'R)-5'-methyl- 1428 Methyleneoxy BNA/ Methyleneoxy BNA/(5'R)-
5'-methyl-Methyleneoxy BNA Unmodified cytosines 391869 102253
102268 GCTAGCCTCTGGATTT 1-2-10-3 Methyleneoxy 1428
BNA/(5'S)-5'-methyl- Methyleneoxy BNA/(5'S)- 5'-methyl-Methyleneoxy
BNA Unmodified cytosines 384073 102253 102268 GCTAGCCTCTGGATTT
3-10-3 Methyleneoxy BNA 1428 5-methylcytosine in gap 335379 102253
102268 GCTAGCCTCTGGATTT 3-10-3 Methyleneoxy BNA 1428 390579 102253
102268 GCTAGCCTCTGGATTT 1-1-1-10-3 MOE/4'thio/2'- 1428
O-[(2-methoxy)ethyl]-4'- thio/2'-O-[(2- methoxy)ethyl]-4'-thio
Unmodified cytosines in wings Phosphorodiester linkage in wings
390582 102253 102268 GCTAGCCTCTGGATTT 1-2-10-3 MOE/4'thio/2'-O-
1428 [(2-methoxy)ethyl]-4'-thio Unmodified cytosines in wings
Phosphorodiester linkage in wings 390606 102253 102268
GCTAGCCTCTGGATTT 1-2-10-3 1428 MOE/pentaF/pentaF Unmodified
cytosines in wings Phosphodiester linkage in wings 384072 102253
102268 GCTAGCCTCTGGATTT 1-2-10-3 1428 MOE/pentaF/pentaF Unmodified
cytosines in wings 385871 102253 102268 GCTAGCCTCTGGATTT 1-2-10-3
OMe/2'-O-[(2- 1428 methoxy)ethyl]-4'-thio/2'-O-
[(2-methoxy)ethyl]-4'-thio Unmodified cytosines in wing 390607
102253 102268 GCTAGCCTCTGGATTT 3-10-3 MOE/pentaF 1428 Unmodified
cytosines in wing 390608 102253 102268 GCTAGCCTCTGGATTT 1-2-10-3
1428 MOE/pentaF/pentaF Unmodified cytosines in wing 390609 102253
102268 GCTAGCCTCTGGATTT 3-10-2-1 MOE/MOE/pentaF 1428 Unmodified
cytosines in wing 386682 102253 102268 GCTAGCCTCTGGATTT 1-2-10-3
2'- 1428 (butylacetamido)- palmitamide/MOE/MOE
391173 102253 102267 CTAGCCTCTGGATTT 2-10-3 (5'R)-5'-methyl- 1429
Methyleneoxy BNA Unmodified cytosines 391174 102253 102267
CTAGCCTCTGGATTT 2-10-3 (5'S)-5'-methyl- 1429 Methyleneoxy BNA
Unmodified cytosines 386970 102254 102266 TAGCCTCTGGATT 1-10-2 MOE
1432 390578 102254 102266 TAGCCTCTGGATT 1-10-2 MOE 1432 Unmodified
cytosines Ts in wings are 2- thiothymines 335333 102254 102268
GCTAGCCTCTGGATT 1-10-4 MOE 1430 331429 102254 102267 CTAGCCTCTGGATT
2-10-2 MOE 1431 335349 102254 102267 CTAGCCTCTGGATT 2-10-2 MOE 1431
335367 102254 102267 CTAGCCTCTGGATT 2-10-2 Methyleneoxy BNA 1431
Phosphodiester linkages in wings 392061 102254 102267
CTAGCCTCTGGATT 2-10-2 Methyleneoxy BNA 1431 Unmodified cytosines in
gap 335378 102254 102267 CTAGCCTCTGGATT 2-10-2 Methyleneoxy BNA
1431 383991 102254 102266 TAGCCTCTGGATT 1-10-2 1432
2'-(acetylamino-butyl- acetamido)-cholesterol/ MOE 383992 102254
102266 TAGCCTCTGGATT 1-10-2 1432 2'-(acetylamino-butyl-
acetamido)-cholic acid/MOE 386683 102254 102266 TAGCCTCTGGATT
1-10-2 1432 5' terminal 2'- (butylacetamido)- palmitamide/MOE
390614 102254 102266 TAGCCTCTGGATT 1-10-2 PentaF 1432 389954 102255
102266 TAGCCTCTGGAT 1-10-1 MOE 1434 335334 102255 102269
TGCTAGCCTCTGGAT 1-10-4 MOE 1433 389777 102255 102266 TAGCCTCTGGAT
1-9-2 MOE 1434 390430 102256 102268 GCTAGCCTCTGGA 1-10-2 MOE 1163
Unmodified cytosines 390431 102256 102268 GCTAGCCTCTGGA 1-10-2 MOE
1163 Unmodified cytosines C in wing 9- (aminoethoxy)phenoxazine
390432 102256 102268 GCTAGCCTCTGGA 1-10-2 MOE 1163 390433 102256
102268 GCTAGCCTCTGGA 1-10-2 MOE 1163 Unmodified cytosines Nt 6 is
9- (aminoethoxy)phenoxazine 390434 102256 102268 GCTAGCCTCTGGA
1-10-2 MOE 1163 Unmodified cytosines Nt 7 is 9-
(aminoethoxy)phenoxazine 390435 102256 102268 GCTAGCCTCTGGA 1-10-2
MOE 1163 Unmodified cytosines Nt 9 is 9- (aminoethoxy)phenoxazine
335335 102256 102270 CTGCTAGCCTCTGGA 1-10-4 MOE 1435 335336 102257
102271 ACTGCTAGCCTCTGG 1-10-4 MOE 1436 335337 102258 102272
AACTGCTAGCCTCTG 1-10-4 MOE 1437 335338 102259 102273
GAACTGCTAGCCTCT 1-10-4 MOE 1438 335339 102260 102274
TGAACTGCTAGCCTC 1-10-4 MOE 1439 335340 102261 102275
TTGAACTGCTAGCCT 1-10-4 MOE 1440 336210 102261 102274 TGAACTGCTAGCCT
3-8-3 MOE 1441 397991 102264 102277 AGTTGAACTGCTAG 2-10-2 MOE 1442
398059 102265 102276 GTTGAACTGCTA 1-10-1 MOE 1443 390017 102268
102279 GAAGTTGAACTG 1-10-1 MOE 1444 336211 102269 102282
ACAGAAGTTGAACT 3-8-3 MOE 1445 397992 102293 102306 TCATTGTCACTAAC
2-10-2 MOE 1446 336212 102293 102306 TCATTGTCACTAAC 3-8-3 MOE 1446
398060 102294 102305 CATTGTCACTAA 1-10-1 MOE 1447 389978 102301
102312 TCAGGTTCATTG 1-10-1 MOE 1448 389778 102301 102312
TCAGGTTCATTG 1-9-2 MOE 1448 336213 102303 102316 ATGATCAGGTTCAT
3-8-3 MOE 1449 397993 102307 102320 TATAATGATCAGGT 2-10-2 MOE 1450
398061 102308 102319 ATAATGATCAGG 1-10-1 MOE 1451 336214 102314
102327 GAATATCTATAATG 3-8-3 MOE 1139 390019 102320 102331
GTCAGAATATCT 1-10-1 MOE 1173 397994 102322 102335 TGGTGTCAGAATAT
2-10-2 MOE 1452 398062 102323 102334 GGTGTCAGAATA 1-10-1 MOE 1255
336215 102326 102339 TCAGTGGTGTCAGA 3-8-3 MOE 1453 336216 102339
102352 CTCTGGATCAGAGT 3-8-3 MOE 1454 390020 102340 102351
TCTGGATCAGAG 1-10-1 MOE 1149 336217 102349 102362 AAGGTTCATTCTCT
3-8-3 MOE 1455 397995 102357 102370 TTCATCAAAAGGTT 2-10-2 MOE 1456
389979 102358 102369 TCATCAAAAGGT 1-10-1 MOE 1176 389779 102358
102369 TCATCAAAAGGT 1-9-2 MOE 1176 336218 102358 102371
CTTCATCAAAAGGT 3-8-3 MOE 1457 390021 102360 102371 CTTCATCAAAAG
1-10-1 MOE 1458 336219 102366 102379 ATGCTGATCTTCAT 3-8-3 MOE 1459
336220 102381 102394 TTTTGTAATTTGTG 3-8-3 MOE 1460 336221 102387
102400 TCAGACTTTTGTAA 3-8-3 MOE 1461 390022 102443 102454
CAGTTTATTCAA 1-10-1 MOE 1142 397996 102477 102490 TGTCCTATTGCCAT
2-10-2 MOE 1462 398063 102478 102489 GTCCTATTGCCA 1-10-1 MOE 1205
397997 102487 102500 TCTGACACAATGTC 2-10-2 MOE 1463 398064 102488
102499 CTGACACAATGT 1-10-1 MOE 1464 397998 102505 102518
TGTTCCTATAACTG 2-10-2 MOE 1465 398065 102506 102517 GTTCCTATAACT
1-10-1 MOE 1466 397999 102528 102541 AAGATTGGTCAGGA 2-10-2 MOE 1467
398066 102529 102540 AGATTGGTCAGG 1-10-1 MOE 1468 398000 102561
102574 GTGTCAAAACCCTG 2-10-2 MOE 1469 398067 102562 102573
TGTCAAAACCCT 1-10-1 MOE 1210 390025 102563 102574 GTGTCAAAACCC
1-10-1 MOE 1211 390026 102595 102606 AGCTACACAACC 1-10-1 MOE 1470
398001 102596 102609 CACAGCTACACAAC 2-10-2 MOE 1471 398068 102597
102608 ACAGCTACACAA 1-10-1 MOE 1472 398002 102607 102620
TATATACATGACAC 2-10-2 MOE 1473 398069 102608 102619 ATATACATGACA
1-10-1 MOE 1474 390027 102612 102623 AGGTATATACAT 1-10-1 MOE 1206
398003 102637 102650 AATTTTAAATGTCC 2-10-2 MOE 1475 398070 102638
102649 ATTTTAAATGTC 1-10-1 MOE 1476 390028 102648 102659
TCCTAATTGAAT 1-10-1 MOE 1477 390029 102667 102678 AAAGTGCCATCT
1-10-1 MOE 1478 398004 102689 102702 TTTATAAAACTGGA 2-10-2 MOE 1479
398071 102690 102701 TTATAAAACTGG 1-10-1 MOE 1480 390030 102691
102702 TTTATAAAACTG 1-10-1 MOE 1074 398005 102827 102840
TGCAAACTTATCTG 2-10-2 MOE 1481 398072 102828 102839 GCAAACTTATCT
1-10-1 MOE 1482 390033 102836 102847 AGCCAACTGCAA 1-10-1 MOE 1483
398006 102837 102850 CTTAGCCAACTGCA 2-10-2 MOE 1484 398073 102838
102849 TTAGCCAACTGC 1-10-1 MOE 1485 398007 103069 103082
AGCACCAATATGCT 2-10-2 MOE 1247 398074 103070 103081 GCACCAATATGC
1-10-1 MOE 1248 398008 103267 103280 TAAATCATTGTCAA 2-10-2 MOE 1486
398075 103268 103279 AAATCATTGTCA 1-10-1 MOE 1233 398009 103327
103340 GCACTGGCCTTGAT 2-10-2 MOE 1487 398076 103328 103339
CACTGGCCTTGA 1-10-1 MOE 1488 390041 103332 103343 TTAGCACTGGCC
1-10-1 MOE 1489 390047 103585 103596 TGTGTAAGGTCA 1-10-1 MOE 1490
390049 103636 103647 GTTAATGACATT 1-10-1 MOE 1491 390050 103660
103671 GTATTCAAGTAA 1-10-1 MOE 1140 390052 103780 103791
GACAATTTCTAC 1-10-1 MOE 1492 390054 103862 103873 AACACTGCACAT
1-10-1 MOE 1493
Salts, Prodrugs and Bioequivalents
[0844] The antisense compounds provided herein comprise any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other functional chemical equivalent which, upon
administration to an animal including a human, is capable of
providing (directly or indirectly) the biologically active
metabolite or residue thereof. Accordingly, for example, the
disclosure is also drawn to prodrugs and pharmaceutically
acceptable salts of the antisense compounds, pharmaceutically
acceptable salts of such prodrugs, and other bioequivalents.
[0845] The term "prodrug" indicates a therapeutic agent that is
prepared in an inactive or less active form that is converted to an
active form (i.e., drug) within the body or cells thereof by the
action of endogenous enzymes, chemicals, and/or conditions. In
particular, prodrug versions of the oligonucleotides are prepared
as SATE ((S-acetyl-2-thioethyl) phosphate) derivatives according to
the methods disclosed in WO 93/24510 or WO 94/26764. Prodrugs can
also include antisense compounds wherein one or both ends comprise
nucleobases that are cleaved (e.g., by incorporating phosphodiester
backbone linkages at the ends) to produce the active compound. In
certain embodiments, one or more non-drug moieties is cleaved from
a prodrug to yield the active form. In certain such embodiments,
such non-drug moieties is not a nucleotide or oligonucleotide.
[0846] The term "pharmaceutically acceptable salts" refers to
physiologically and pharmaceutically acceptable salts of the
compounds described herein: i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto. Sodium salts of antisense
oligonucleotides are useful and are well accepted for therapeutic
administration to humans.
[0847] In certain embodiments, salts, including, but not limited to
sodium salts, of double stranded nucleic acids (including but not
limited to dsRNA compounds) are also provided.
G. Certain Pharmaceutical Compositions
[0848] In certain embodiments, pharmaceutical compositions of the
present invention comprise one or more short antisense compound and
one or more excipients. In certain such embodiments, excipients are
selected from water, salt solutions, alcohol, polyethylene glycols,
gelatin, lactose, amylase, magnesium stearate, talc, silicic acid,
viscous paraffin, hydroxymethylcellulose and
polyvinylpyrrolidone.
[0849] In certain embodiments, a pharmaceutical composition of the
present invention is prepared using known techniques, including,
but not limited to mixing, dissolving, granulating, dragee-making,
levigating, emulsifying, encapsulating, entrapping or tabletting
processes.
[0850] In certain embodiments, a pharmaceutical composition of the
present invention is a liquid (e.g., a suspension, elixir and/or
solution). In certain of such embodiments, a liquid pharmaceutical
composition is prepared using ingredients known in the art,
including, but not limited to, water, glycols, oils, alcohols,
flavoring agents, preservatives, and coloring agents.
[0851] In certain embodiments, a pharmaceutical composition of the
present invention is a solid (e.g., a powder, tablet, and/or
capsule). In certain of such embodiments, a solid pharmaceutical
composition comprising one or more oligonucleotides is prepared
using ingredients known in the art, including, but not limited to,
starches, sugars, diluents, granulating agents, lubricants,
binders, and disintegrating agents.
[0852] In certain embodiments, a pharmaceutical composition of the
present invention is formulated as a depot preparation. Certain
such depot preparations are typically longer acting than non-depot
preparations. In certain embodiments, such preparations are
administered by implantation (for example subcutaneously or
intramuscularly) or by intramuscular injection. In certain
embodiments, depot preparations are prepared using suitable
polymeric or hydrophobic materials (for example an emulsion in an
acceptable oil) or ion exchange resins, or as sparingly soluble
derivatives, for example, as a sparingly soluble salt.
[0853] In certain embodiments, a pharmaceutical composition of the
present invention comprises a delivery system. Examples of delivery
systems include, but are not limited to, liposomes and emulsions.
Certain delivery systems are useful for preparing certain
pharmaceutical compositions including those comprising hydrophobic
compounds. In certain embodiments, certain organic solvents such as
dimethylsulfoxide are used.
[0854] In certain embodiments, a pharmaceutical composition of the
present invention comprises one or more tissue-specific delivery
molecules designed to deliver the one or more pharmaceutical agents
of the present invention to specific tissues or cell types. For
example, in certain embodiments, pharmaceutical compositions
include liposomes coated with a tissue-specific antibody.
[0855] In certain embodiments, a pharmaceutical composition of the
present invention comprises a co-solvent system. Certain of such
co-solvent systems comprise, for example, benzyl alcohol, a
nonpolar surfactant, a water-miscible organic polymer, and an
aqueous phase. In certain embodiments, such co-solvent systems are
used for hydrophobic compounds. A non-limiting example of such a
co-solvent system is the VPD co-solvent system, which is a solution
of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the
nonpolar surfactant Polysorbate 80..TM.., and 65% w/v polyethylene
glycol 300. The proportions of such co-solvent systems may be
varied considerably without significantly altering their solubility
and toxicity characteristics. Furthermore, the identity of
co-solvent components may be varied: for example, other surfactants
may be used instead of Polysorbate 80.TM.; the fraction size of
polyethylene glycol may be varied; other biocompatible polymers may
replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other
sugars or polysaccharides may substitute for dextrose.
[0856] In certain embodiments, a pharmaceutical composition of the
present invention comprises a sustained-release system. A
non-limiting example of such a sustained-release system is a
semi-permeable matrix of solid hydrophobic polymers. In certain
embodiments, sustained-release systems may, depending on their
chemical nature, release pharmaceutical agents over a period of
hours, days, weeks or months.
[0857] In certain embodiments, a pharmaceutical composition of the
present invention is prepared for oral administration. In certain
of such embodiments, a pharmaceutical composition is formulated by
combining one or more oligonucleotides with one or more
pharmaceutically acceptable carriers. Certain of such carriers
enable pharmaceutical compositions to be formulated as tablets,
pills, dragees, capsules, liquids, gels, syrups, slurries,
suspensions and the like, for oral ingestion by a subject. In
certain embodiments, pharmaceutical compositions for oral use are
obtained by mixing oligonucleotide and one or more solid excipient.
Suitable excipients include, but are not limited to, fillers, such
as sugars, including lactose, sucrose, mannitol, or sorbitol;
cellulose preparations such as, for example, maize starch, wheat
starch, rice starch, potato starch, gelatin, gum tragacanth, methyl
cellulose, hydroxypropylmethyl-cellulose, sodium
carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). In
certain embodiments, such a mixture is optionally ground and
auxiliaries are optionally added. In certain embodiments,
pharmaceutical compositions are formed to obtain tablets or dragee
cores. In certain embodiments, disintegrating agents (e.g.,
cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt
thereof, such as sodium alginate) are added.
[0858] In certain embodiments, dragee cores are provided with
coatings. In certain such embodiments, concentrated sugar solutions
may be used, which may optionally comprise gum arabic, talc,
polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or
titanium dioxide, lacquer solutions, and suitable organic solvents
or solvent mixtures. Dyestuffs or pigments may be added to tablets
or dragee coatings.
[0859] In certain embodiments, pharmaceutical compositions for oral
administration are push-fit capsules made of gelatin. Certain of
such push-fit capsules comprise one or more pharmaceutical agents
of the present invention in admixture with one or more filler such
as lactose, binders such as starches, and/or lubricants such as
talc or magnesium stearate and, optionally, stabilizers. In certain
embodiments, pharmaceutical compositions for oral administration
are soft, sealed capsules made of gelatin and a plasticizer, such
as glycerol or sorbitol. In certain soft capsules, one or more
pharmaceutical agents of the present invention are be dissolved or
suspended in suitable liquids, such as fatty oils, liquid paraffin,
or liquid polyethylene glycols. In addition, stabilizers may be
added.
[0860] In certain embodiments, pharmaceutical compositions are
prepared for buccal administration. Certain of such pharmaceutical
compositions are tablets or lozenges formulated in conventional
manner.
[0861] In certain embodiments, a pharmaceutical composition is
prepared for administration by injection (e.g., intravenous,
subcutaneous, intramuscular, etc.). In certain of such embodiments,
a pharmaceutical composition comprises a carrier and is formulated
in aqueous solution, such as water or physiologically compatible
buffers such as Hanks's solution, Ringer's solution, or
physiological saline buffer. In certain embodiments, other
ingredients are included (e.g., ingredients that aid in solubility
or serve as preservatives). In certain embodiments, injectable
suspensions are prepared using appropriate liquid carriers,
suspending agents and the like. Certain pharmaceutical compositions
for injection are presented in unit dosage form, e.g., in ampoules
or in multi-dose containers. Certain pharmaceutical compositions
for injection are suspensions, solutions or emulsions in oily or
aqueous vehicles, and may comprise formulatory agents such as
suspending, stabilizing and/or dispersing agents. Certain solvents
suitable for use in pharmaceutical compositions for injection
include, but are not limited to, lipophilic solvents and fatty
oils, such as sesame oil, synthetic fatty acid esters, such as
ethyl oleate or triglycerides, and liposomes. Aqueous injection
suspensions may comprise substances that increase the viscosity of
the suspension, such as sodium carboxymethyl cellulose, sorbitol,
or dextran. Optionally, such suspensions may also comprise suitable
stabilizers or agents that increase the solubility of the
pharmaceutical agents to allow for the preparation of highly
concentrated solutions.
[0862] In certain embodiments, a pharmaceutical composition is
prepared for transmucosal administration. In certain of such
embodiments penetrants appropriate to the barrier to be permeated
are used in the formulation. Such penetrants are generally known in
the art.
[0863] In certain embodiments, a pharmaceutical composition is
prepared for administration by inhalation. Certain of such
pharmaceutical compositions for inhalation are prepared in the form
of an aerosol spray in a pressurized pack or a nebulizer. Certain
of such pharmaceutical compositions comprise a propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
certain embodiments using a pressurized aerosol, the dosage unit
may be determined with a valve that delivers a metered amount. In
certain embodiments, capsules and cartridges for use in an inhaler
or insufflator may be formulated. Certain of such formulations
comprise a powder mixture of a pharmaceutical agent of the
invention and a suitable powder base such as lactose or starch.
[0864] In certain embodiments, a pharmaceutical composition is
prepared for rectal administration, such as a suppositories or
retention enema. Certain of such pharmaceutical compositions
comprise known ingredients, such as cocoa butter and/or other
glycerides.
[0865] In certain embodiments, a pharmaceutical composition is
prepared for topical administration. Certain of such pharmaceutical
compositions comprise bland moisturizing bases, such as ointments
or creams. Exemplary suitable ointment bases include, but are not
limited to, petrolatum, petrolatum plus volatile silicones, lanolin
and water in oil emulsions such as Eucerin..TM.., available from
Beiersdorf (Cincinnati, Ohio). Exemplary suitable cream bases
include, but are not limited to, Nivea..TM.. Cream, available from
Beiersdorf (Cincinnati, Ohio), cold cream (USP), Purpose
Cream..TM.., available from Johnson & Johnson (New Brunswick,
N.J.), hydrophilic ointment (USP) and Lubriderm..TM.., available
from Pfizer (Morris Plains, N.J.).
[0866] In certain embodiments, a pharmaceutical composition of the
present invention comprises an oligonucleotide in a therapeutically
effective amount. In certain embodiments, the therapeutically
effective amount is sufficient to prevent, alleviate or ameliorate
symptoms of a disease or to prolong the survival of the subject
being treated. Determination of a therapeutically effective amount
is well within the capability of those skilled in the art.
[0867] In certain embodiments, one or more short antisense compound
of the present invention is formulated as a prodrug. In certain
embodiments, upon in vivo administration, a prodrug is chemically
converted to the biologically, pharmaceutically or therapeutically
more active form of the short antisense compound. In certain
embodiments, prodrugs are useful because they are easier to
administer than the corresponding active form. For example, in
certain instances, a prodrug may be more bioavailable (e.g.,
through oral administration) than is the corresponding active form.
In certain instances, a prodrug may have improved solubility
compared to the corresponding active form. In certain embodiments,
prodrugs are less water soluble than the corresponding active form.
In certain instances, such prodrugs possess superior transmittal
across cell membranes, where water solubility is detrimental to
mobility. In certain embodiments, a prodrug is an ester. In certain
such embodiments, the ester is metabolically hydrolyzed to
carboxylic acid upon administration. In certain instances the
carboxylic acid containing compound is the corresponding active
form. In certain embodiments, a prodrug comprises a short peptide
(polyaminoacid) bound to an acid group. In certain of such
embodiments, the peptide is cleaved upon administration to form the
corresponding active form.
[0868] In certain embodiments, a prodrug is produced by modifying a
pharmaceutically active compound such that the active compound will
be regenerated upon in vivo administration. The prodrug can be
designed to alter the metabolic stability or the transport
characteristics of a drug, to mask side effects or toxicity, to
improve the flavor of a drug or to alter other characteristics or
properties of a drug. By virtue of knowledge of pharmacodynamic
processes and drug metabolism in vivo, those of skill in this art,
once a pharmaceutically active compound is known, can design
prodrugs of the compound (see, e.g., Nogrady (1985) Medicinal
Chemistry A Biochemical Approach, Oxford University Press, New
York, pages 388-392).
[0869] In certain embodiments, a pharmaceutical composition
comprising one or more pharmaceutical agents of the present
invention is useful for treating a conditions or disorders in a
mammalian, and particularly in a human, subject. Suitable
administration routes include, but are not limited to, oral,
rectal, transmucosal, intestinal, enteral, topical, suppository,
through inhalation, intrathecal, intraventricular, intraperitoneal,
intranasal, intraocular and parenteral (e.g., intravenous,
intramuscular, intramedullary, and subcutaneous). In certain
embodiments, pharmaceutical intrathecals are administered to
achieve local rather than systemic exposures. For example,
pharmaceutical compositions may be injected directly in the area of
desired effect (e.g., in the renal or cardiac area).
[0870] In certain embodiments, short antisense compounds, compared
to their parent oligonucleotides, make them particularly suited to
oral administration. In certain embodiments, short antisense
compounds are better suited for oral administration than their
parent oligonucleotides because they have increased potency
compared to those parent oligonucleotides. In certain embodiments,
short antisense compounds are better suited for oral administration
than their parent oligonucleotides because they have better
stability, availability or solubility properties compared to those
parent oligonucleotides.
[0871] In a further aspect, a pharmaceutical agent is sterile
lyophilized oligonucleotide that is reconstituted with a suitable
diluent, e.g., sterile water for injection. The reconstituted
product is administered as a subcutaneous injection or as an
intravenous infusion after dilution into saline. The lyophilized
drug product consists of the oligonucleotide which has been
prepared in water for injection, adjusted to pH 7.0-9.0 with acid
or base during preparation, and then lyophilized. The lyophilized
oligonucleotide may be 25-800 mg of the oligonucleotide. It is
understood that this encompasses 25, 50, 75, 100, 125, 150, 175,
200, 225, 250, 275, 300, 325, 350, 375, 425, 450, 475, 500, 525,
550, 575, 600, 625, 650, 675, 700, 725, 750, 775, and 800 mg of
lyophilized oligonucleotide. The lyophilized drug product may be
packaged in a 2 mL Type I, clear glass vial (ammonium
sulfate-treated), stoppered with a bromobutyl rubber closure and
sealed with an aluminum FLIP-OFF.RTM. overseal.
[0872] The compositions of the present invention may additionally
comprise other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions may comprise additional,
compatible, pharmaceutically-active materials such as, for example,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may comprise additional materials useful in physically
formulating various dosage forms of the compositions of the present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the present invention. The formulations can be
sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the oligonucleotide(s) of the
formulation.
[0873] The antisense compounds provided herein may also be admixed,
encapsulated, conjugated or otherwise associated with other
molecules, molecule structures or mixtures of compounds.
[0874] Also described herein are pharmaceutical compositions and
formulations which include the antisense compounds provided herein.
The pharmaceutical compositions may be administered in a number of
ways depending upon whether local or systemic treatment is desired
and upon the area to be treated. In a preferred embodiment,
administration is topical to the surface of the respiratory tract,
particularly pulmonary, e.g., by nebulization, inhalation, or
insufflation of powders or aerosols, by mouth and/or nose.
[0875] The pharmaceutical formulations described herein, which may
conveniently be presented in unit dosage form, may be prepared
according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general, the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers, finely
divided solid carriers, or both, and then, if necessary, shaping
the product (e.g., into a specific particle size for delivery). In
a preferred embodiment, the pharmaceutical formulations are
prepared for pulmonary administration in an appropriate solvent,
e.g., water or normal saline, possibly in a sterile formulation,
with carriers or other agents to allow for the formation of
droplets of the desired diameter for delivery using inhalers, nasal
delivery devices, nebulizers, and other devices for pulmonary
delivery. Alternatively, the pharmaceutical formulations may be
formulated as dry powders for use in dry powder inhalers.
[0876] A "pharmaceutical carrier" or "excipient" can be a
pharmaceutically acceptable solvent, suspending agent or any other
pharmacologically inert vehicle for delivering one or more nucleic
acids to an individual and are known in the art. The excipient may
be liquid or solid and is selected, with the planned manner of
administration in mind, so as to provide for the desired bulk,
consistency, etc., when combined with a nucleic acid and the other
components of a given pharmaceutical composition.
H. Certain Therapeutic Uses
[0877] In certain embodiments, antisense compounds are used to
modulate the expression of a target gene in an animal, such as a
human. In certain embodiments, such compounds can be used to treat
metabolic disorders or modulate one or more disease indications.
For example, the methods comprise the step of administering to said
animal in need of therapy for a disease or condition associated
with a target gene an effective amount of an antisense compound
that modulates expression of the target gene. Antisense compounds
provided herein which effectively modulate expression of a target
RNA or protein products of expression are considered active
antisense compounds. Active antisense compounds also include
compounds which effectively modulate one or more of a number of
disease indications, including metabolic and cardiovascular disease
indications, examples of which are described below.
[0878] Modulation of expression of a target gene can be measured in
a bodily fluid, which may or may not contain cells; tissue; or
organ of the animal. Methods of obtaining samples for analysis,
such as body fluids (e.g., sputum, serum, urine), tissues (e.g.,
biopsy), or organs, and methods of preparation of the samples to
allow for analysis are well known to those skilled in the art.
Methods for analysis of RNA and protein levels are discussed above
and are well known to those skilled in the art. The effects of
treatment can be assessed by measuring biomarkers, or disease
indications, associated with the target gene expression in the
aforementioned fluids, tissues or organs, collected from an animal
contacted with one or more compounds described herein, by routine
clinical methods known in the art. These biomarkers include but are
not limited to: liver transaminases, bilirubin, albumin, blood urea
nitrogen, creatine and other markers of kidney and liver function;
interleukins, tumor necrosis factors, intracellular adhesion
molecules, C-reactive protein, chemokines, cytokines, and other
markers of inflammation.
[0879] The antisense compounds provided herein can be utilized in
pharmaceutical compositions by adding an effective amount of a
compound to a suitable pharmaceutically acceptable diluent or
carrier. Acceptable carriers and diluents are well known to those
skilled in the art. Selection of a diluent or carrier is based on a
number of factors, including, but not limited to, the solubility of
the compound and the route of administration. Such considerations
are well understood by those skilled in the art. In one aspect, the
antisense compounds described herein inhibit expression of a target
gene. The compounds can also be used in the manufacture of a
medicament for the treatment of diseases and disorders related to a
target gene.
[0880] Methods whereby bodily fluids, organs or tissues are
contacted with an effective amount of one or more of the antisense
compounds or compositions provided herein are also contemplated.
Bodily fluids, organs or tissues can be contacted with one or more
of the compounds resulting in modulation of target gene expression
in the cells of bodily fluids, organs or tissues. An effective
amount can be determined by monitoring the modulatory effect of the
antisense compound or compounds or compositions on target nucleic
acids or their products by methods routine to the skilled
artisan.
[0881] Co-Administration
[0882] In certain embodiments, two or more antisense compounds are
co-administered. In certain embodiments, pharmaceutical
compositions include one or more antisense compounds, particularly
oligonucleotides, targeted to a first nucleic acid and one or more
antisense compounds targeted to a second nucleic acid target. One
or more of those antisense compounds may be a short antisense
compound. In certain embodiments, pharmaceutical compositions
include two or more antisense compounds targeted to different
regions of the same nucleic acid target. One or more of such
antisense compounds may be a short antisense compound. Two or more
combined compounds may be used together or sequentially.
[0883] In certain embodiments, one or more pharmaceutical
compositions are co-administered with one or more other
pharmaceutical agents. In certain embodiments, such one or more
other pharmaceutical agents are designed to treat the same disease
or condition as the one or more pharmaceutical compositions of the
present invention. In certain embodiments, such one or more other
pharmaceutical agents are designed to treat a different disease or
condition as the one or more pharmaceutical compositions of the
present invention. In certain embodiments, such one or more other
pharmaceutical agents are designed to treat an undesired effect of
one or more pharmaceutical compositions of the present invention.
In certain embodiments, one or more pharmaceutical compositions of
the present invention are co-administered with another
pharmaceutical agent to treat an undesired effect of that other
pharmaceutical agent. In certain embodiments, one or more
pharmaceutical compositions of the present invention and one or
more other pharmaceutical agents are administered at the same time.
In certain embodiments, one or more pharmaceutical compositions of
the present invention and one or more other pharmaceutical agents
are administered at different times. In certain embodiments, one or
more pharmaceutical compositions of the present invention and one
or more other pharmaceutical agents are prepared together in a
single formulation. In certain embodiments, one or more
pharmaceutical compositions of the present invention and one or
more other pharmaceutical agents are prepared separately.
[0884] In certain embodiments, pharmaceutical agents that may be
co-administered with a pharmaceutical composition of the present
invention include lipid-lowering agents. In certain such
embodiments, pharmaceutical agents that may be co-administered with
a pharmaceutical composition of the present invention include, but
are not limited to atorvastatin, simvastatin, rosuvastatin, and
ezetimibe. In certain such embodiments, the lipid-lowering agent is
administered prior to administration of a pharmaceutical
composition of the present invention. In certain such embodiments,
the lipid-lowering agent is administered following administration
of a pharmaceutical composition of the present invention. In
certain such embodiments the lipid-lowering agent is administered
at the same time as a pharmaceutical composition of the present
invention. In certain such embodiments the dose of a
co-administered lipid-lowering agent is the same as the dose that
would be administered if the lipid-lowering agent was administered
alone. In certain such embodiments the dose of a co-administered
lipid-lowering agent is lower than the dose that would be
administered if the lipid-lowering agent was administered alone. In
certain such embodiments the dose of a co-administered
lipid-lowering agent is greater than the dose that would be
administered if the lipid-lowering agent was administered
alone.
[0885] In certain embodiments, a co-administered lipid-lowering
agent is a HMG-CoA reductase inhibitor. In certain such embodiments
the HMG-CoA reductase inhibitor is a statin. In certain such
embodiments the statin is selected from atorvastatin, simvastatin,
pravastatin, fluvastatin, and rosuvastatin. In certain embodiments,
a co-administered lipid-lowering agent is a cholesterol absorption
inhibitor. In certain such embodiments, cholesterol absorption
inhibitor is ezetimibe. In certain embodiments, a co-administered
lipid-lowering agent is a co-formulated HMG-CoA reductase inhibitor
and cholesterol absorption inhibitor. In certain such embodiments
the co-formulated lipid-lowering agent is ezetimibe/simvastatin. In
certain embodiments, a co-administered lipid-lowering agent is a
microsomal triglyceride transfer protein inhibitor.
[0886] In certain embodiments, a co-administered pharmaceutical
agent is a bile acid sequestrant. In certain such embodiments, the
bile acid sequestrant is selected from cholestyramine, colestipol,
and colesevelam.
[0887] In certain embodiments, a co-administered pharmaceutical
agent is a nicotinic acid. In certain such embodiments, the
nicotinic acid is selected from immediate release nicotinic acid,
extended release nicotinic acid, and sustained release nicotinic
acid.
[0888] In certain embodiments, a co-administered pharmaceutical
agent is a fibric acid. In certain such embodiments, a fibric acid
is selected from gemfibrozil, fenofibrate, clofibrate, bezafibrate,
and ciprofibrate.
[0889] Further examples of pharmaceutical agents that may be
co-administered with a pharmaceutical composition of the present
invention include, but are not limited to, corticosteroids,
including but not limited to prednisone; immunoglobulins,
including, but not limited to intravenous immunoglobulin (IVIg);
analgesics (e.g., acetaminophen); anti-inflammatory agents,
including, but not limited to non-steroidal anti-inflammatory drugs
(e.g., ibuprofen, COX-1 inhibitors, and COX-2, inhibitors);
salicylates; antibiotics; antivirals; antifungal agents;
antidiabetic agents (e.g., biguanides, glucosidase inhibitors,
insulins, sulfonylureas, and thiazolidenediones); adrenergic
modifiers; diuretics; hormones (e.g., anabolic steroids, androgen,
estrogen, calcitonin, progestin, somatostan, and thyroid hormones);
immunomodulators; muscle relaxants; antihistamines; osteoporosis
agents (e.g., biphosphonates, calcitonin, and estrogens);
prostaglandins, antineoplastic agents; psychotherapeutic agents;
sedatives; poison oak or poison sumac products; antibodies;
vaccines.
[0890] In certain embodiments, the pharmaceutical compositions of
the present invention may be administered in conjuction with a
lipid-lowering therapy. In certain such embodiments, a
lipid-lowering therapy is therapeutic lifestyle change. In certain
such embodiments, a lipid-lowering therapy is LDL apheresis.
I. Kits, Research Reagents and Diagnostics
[0891] The antisense compounds provided herein can be utilized for
diagnostics, and as research reagents and kits. Furthermore,
antisense compounds, which are able to inhibit gene expression or
modulate gene expression with specificity, are often used by those
of ordinary skill to elucidate the function of particular genes or
to distinguish between functions of various members of a biological
pathway.
[0892] For use in kits and diagnostics, the antisense compounds
described herein, either alone or in combination with other
compounds or therapeutics, can be used as tools in differential
and/or combinatorial analyses to elucidate expression patterns of a
portion or the entire complement of genes expressed within cells
and tissues. Methods of gene expression analysis are well known to
those skilled in the art.
J. Certain Advantages of Short Antisense Compounds
[0893] In certain embodiments, short antisense compounds have
advantages when compared to their parent oligonucleotides. For
example, in certain embodiments, short antisense compounds have
greater affinity for a target nucleic acid than their parent
oligonucleotide. In certain embodiments, short antisense compounds
have greater potency in vitro than their parent oligonucleotide. In
certain such embodiments, that increased in vitro potency is not
entirely explained by increased affinity. In certain embodiments,
such increased in vitro potency may be attributable to increased
ability of short antisense compounds to penetrate cells and/or
increased ability to access target nucleic acids in a cell. In
certain embodiments, short antisense compounds have greater potency
in vivo than their parent oligonucleotides. In certain embodiments,
such greater in vivo potency is not attributable to increased in
vitro potency or increased affinity. In certain embodiments, short
antisense compounds have even greater in vivo potency compared to
their parent oligonucleotides than would be predicted based on in
vitro potencies or on affinities. In certain embodiments, such
increased in vivo potency may be attributable to increased
bioavailability, better penetration into the cell, better access to
target nucleic acid once in the cell, or other factors.
[0894] In certain embodiments, one would expect short antisense
compounds to be less specific for their target nucleic acid
compared to their parent oligonucleotides. In certain such
embodiments, one would expect increased side-effects, including
potential for toxic effects, from short antisense compounds. In
certain embodiments, such additional side-effects are not observed.
In certain embodiments, non-target nucleic acids to which a
particular short antisense compound may bind are not available to
the short antisense compound. In such embodiments, side-effects,
including toxicity, are less problematic than would be
predicted.
[0895] In certain embodiments, because they are smaller, short
antisense compounds are less likely to bind proteins. In certain
such embodiments, such less binding of proteins results in lower
toxicity, since protein binding may have undesired consequences. In
certain embodiments, such less binding of proteins results in
greater potency, since it leaves more antisense compound available
for therapeutic effect. In certain embodiments, less binding of
proteins results in decreased drug-drug interaction toxicity.
NONLIMITING DISCLOSURE AND INCORPORATION BY REFERENCE
[0896] While certain compounds, compositions and methods described
herein have been described with specificity in accordance with
certain embodiments, the following examples serve only to
illustrate the compounds described herein and are not intended to
limit the same. Each of the references, GenBank accession numbers,
and the like recited in the present application is incorporated
herein by reference in its entirety.
Example 1
Cell Culture and Treatment with Short Antisense Compounds
[0897] The effect of short antisense compounds on target nucleic
acid expression can be tested in any one of a number of cultured or
primary cell lines. Cells lines can be obtained from publicly
available sources, such as the American Type Culture Collection
(Manassas, Va.). Cells are cultured according to methods well known
to those of ordinary skill in the art.
[0898] When cells reached appropriate confluency, they were treated
with oligonucleotide using LIPOFECTIN.RTM. as described. When cells
reached 65-75% confluency, they were treated with oligonucleotide.
Oligonucleotide was mixed with LIPOFECTIN.RTM. Invitrogen Life
Technologies, Carlsbad, Calif.) in Opti-MEMS-1 reduced serum medium
(Invitrogen Life Technologies, Carlsbad, Calif.) to achieve the
desired concentration of oligonucleotide and a LIPOFECTIN.RTM.
concentration of 2.5- or 3 .mu.g/mL per 100 nM oligonucleotide.
This transfection mixture was incubated at room temperature for
approximately 0.5 hours. For cells grown in 96-well plates, wells
were washed once with 100 .mu.L OPTI-MEM.RTM.-1 and then treated
with 130 .mu.L of the transfection mixture. Cells grown in 24-well
plates or other standard tissue culture plates were treated
similarly, using appropriate volumes of medium and oligonucleotide.
Cells were treated and data were obtained in duplicate or
triplicate. After approximately 4-7 hours of treatment at
37.degree. C., the medium containing the transfection mixture was
replaced with fresh culture medium. Cells were harvested 16-24
hours after oligonucleotide treatment.
[0899] Control oligonucleotides are used to determine the optimal
oligomeric compound concentration for a particular cell line.
Furthermore, when oligomeric compounds are tested in oligomeric
compound screening experiments or phenotypic assays, control
oligonucleotides are tested in parallel.
[0900] The concentration of oligonucleotide used varies from cell
line to cell line. To determine the optimal oligonucleotide
concentration for a particular cell line, the cells are treated
with a positive control oligonucleotide at a range of
concentrations. The concentration of positive control
oligonucleotide that results in 80% inhibition of the target mRNA
is then utilized as the screening concentration for new
oligonucleotides in subsequent experiments for that cell line. If
80% inhibition is not achieved, the lowest concentration of
positive control oligonucleotide that results in 60% inhibition of
the target mRNA is then utilized as the oligonucleotide screening
concentration in subsequent experiments for that cell line. If 60%
inhibition is not achieved, that particular cell line is deemed as
unsuitable for oligonucleotide transfection experiments. The
concentrations of antisense oligonucleotides used herein are from
50 nM to 300 nM when the antisense oligonucleotide is transfected
using a liposome reagent and 1 nM to 40 nM when the antisense
oligonucleotide is transfected by electroporation.
Example 2
Real-time Quantitative PCR Analysis of Target mRNA Levels
[0901] Quantitation of target mRNA levels was accomplished by
real-time quantitative PCR using the ABI PRISM.RTM. 7600, 7700, or
7900 Sequence Detection System (PE-Applied Biosystems, Foster City,
Calif.) according to manufacturer's instructions.
[0902] Prior to quantitative PCR analysis, primer-probe sets
specific to the target gene being measured were evaluated for their
ability to be "multiplexed" with a GAPDH amplification reaction.
After isolation the RNA is subjected to sequential reverse
transcriptase (RT) reaction and real-time PCR, both of which are
performed in the same well. RT and PCR reagents were obtained from
Invitrogen Life Technologies (Carlsbad, Calif.). RT, real-time PCR
was carried out in the same by adding 20 .mu.L PCR cocktail
(2.5.times.PCR buffer minus MgCl.sub.2, 6.6 mM MgCl.sub.2, 375
.mu.M each of DATP, dCTP, dCTP and dGTP, 375 nM each of forward
primer and reverse primer, 125 nM of probe, 4 Units RNAse
inhibitor, 1.25 Units PLATINUM.RTM. Taq, 5 Units MuLV reverse
transcriptase, and 2.5.times.ROX dye) to 96-well plates containing
30 .mu.L total RNA solution (20-200 ng). The RT reaction was
carried out by incubation for 30 minutes at 48.degree. C. Following
a 10 minute incubation at 95.degree. C. to activate the
PLATINUM.RTM. Taq, 40 cycles of a two-step PCR protocol were
carried out: 95.degree. C. for 15 seconds (denaturation) followed
by 60.degree. C. for 1.5 minutes (annealing/extension).
[0903] Gene target quantities obtained by RT, real-time PCR were
normalized using either the expression level of GAPDH, a gene whose
expression is constant, or by quantifying total RNA using
RiboGreen.RTM. (Molecular Probes, Inc. Eugene, Oreg.). GAPDH
expression was quantified by RT, real-time PCR, by being run
simultaneously with the target, multiplexing, or separately. Total
RNA was quantified using RiboGreen.RTM. RNA quantification reagent
(Molecular Probes, Inc. Eugene, Oreg.).
[0904] 170 .mu.L of RiboGreen.RTM. working reagent (RiboGreen.RTM.
reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) was
pipetted into a 96-well plate containing 30 .mu.L purified cellular
RNA. The plate was read in a CytoFluor 4000 (PE Applied Biosystems)
with excitation at 485 nm and emission at 530 nm.
[0905] The GAPDH PCR probes have JOE covalently linked to the 5'
end and TAMRA or MGB covalently linked to the 3' end, where JOE is
the fluorescent reporter dye and TAMRA or MGB is the quencher dye.
In some cell types, primers and probe designed to a GAPDH sequence
from a different species are used to measure GAPDH expression. For
example, a human GAPDH primer and probe set is used to measure
GAPDH expression in monkey-derived cells and cell lines.
[0906] Probes and primers for use in real-time PCR were designed to
hybridize to target nucleic acids using routine methods. For
example, PrimerExpress.RTM. (Applied Biosystems, Foster City,
Calif.) software is routinely used to design probes and primers for
use in real-time PCR. Examples of primer and probe sequences and
the target nucleic acids to which they hybridize are presented in
Table 24. The target-specific PCR probes have FAM covalently linked
to the 5' end and TAMRA or MGB covalently linked to the 3' end,
where FAM is the fluorescent dye and TAMRA or MGB is the quencher
dye.
TABLE-US-00025 TABLE 24 Target-specific primers and probes for use
in real-time PCR Target Sequence Sequence SEQ ID Name Species
Description (5' to 3') NO ApoB Mouse Forward CGTGGGCTCCAGCATTC 1524
Primer TA ApoB Mouse Reverse AGTCATTTCTGCCTTTG 1525 Primer CGTC
ApoB Mouse Probe CCAATGGTCGGGCACTG 1526 CTCAA ApoB Mouse Forward
GAAAATAGACTTCCTGA 1527 Primer ATAACTATGCATT ApoB Mouse Reverse
ACTCGCTTGCCAGCTTGC 1528 Primer ApoB Mouse Probe TTTCTGAGTCCCCGTGC
1529 CCAACA GCGR Mouse Forward TGAGCCTTGCCACCTTC 1530 Primer TCT
GCGR Mouse Reverse GCGCACCCCAGCCAA 1531 Primer GCGR Mouse Probe
AGAGGAGCTTCTTTTCC 1532 CTCTACCTGGGC GCGR Mouse Forward
ATTTCCTGCCCCTGGTA 1533 Primer CCT GCGR Mouse Reverse
CGGGCCCACACCTCTTG 1534 Primer GCGR Mouse Probe CCACAAAGTGCAGCACC
1535 GCCTAGTGT PTEN Mouse Forward GCCACAGGCTCCCAGAC 1536 Primer AT
PTEN Mouse Reverse TCCATCCTCTTGATATC 1537 Primer TCCTTTTG PTEN
Mouse Probe ACAGCCATCATCAAAGA 1538 GATCGTTAGCAGAA PTEN Mouse
Forward ATGACAATCATGTTGCA 1539 Primer GCAATTC PTEN Mouse Reverse
CGATGCAATAAATATGC 1540 Primer ACAAATCA PTEN Mouse Probe
CTGTAAAGCTGGAAAGGG 1541 ACGGACTGGT
Example 3
Short Antisense Compounds Targeted to an ApoB Nucleic Acid and
having 2'-MOE or Methyleneoxy (4'-CH.sub.2--O-2') BNA
Modifications
[0907] Six-week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were injected intraperitoneally (i.p.) with antisense
compounds targeted to ApoB, at a frequency of twice per week for
three weeks. Antisense compound doses included 2.4, 1.2, 0.6, 0.3
and 0.15 .mu.mol/kg. For antisense compounds 14 nucleotides in
length, these doses equate to approximately 12, 6, 3, 1.5 or 0.75
mg/kg, respectively. Shown in Table 25 are the sequences and motifs
of the antisense compounds used in this study. The antisense
compounds are either 20 or 14 nucleotides in length and have a
central "gap" region consisting of ten 2'-deoxynucleotides flanked
by wings having 2'-O-methoxyethyl (2'-MOE) or BNA modified "wings."
For example, the 2-10-2 MOE gapmer motif indicates an antisense
compound with a gap of ten nucleotides flanked by 2 nucleotide
wings with 2'-MOE modifications. Bolded residues indicate
2'-O-methoxyethyl moieties and italicized residues indicate
methyleneoxy (4'-CH.sub.2--O-2') BNAs. The internucleoside linkages
of each compound are phosphorothioate throughout. All cytosine
residues of ISIS 147764 and ISIS 372938 are replaced by 5-methyl
cytosines. For ISIS 387462, only the cytosine residue in the wing
of the compound is replaced by 5-methyl cytosine. ApoB antisense
compounds are targeted to publicly available ApoB-100 sequences,
including Genbank Accession No. XM.sub.--137955.5 (SEQ ID NO:
2).
TABLE-US-00026 TABLE 25 Antisense Compounds Targeted to an ApoB
nucleic acid Target 5' ISIS SEQ Target SEQ NO ID NO Site Sequence
(5'-3') Gapmer Motif ID NO 147764 2 8865 GTCCCTGAAGATGTCAATGC
5-10-5 MOE 1561 372938 2 8235 GGTACATGGAAGTC 2-10-2 MOE 190 387462
2 8235 GGTACATGGAAGTC 2-10-2 190 methyleneoxy (4'- CH.sub.2--O-2')
BNA
[0908] Forty-eight hours following the final injection, mice were
sacrificed to evaluate transaminases (Table 26); liver and kidney
weight (Table 27); triglyceride, LDL, HDL and free fatty acid
levels (Table 28); target mRNA level in liver (Table 29); target
protein level in plasma; and oligonucleotide tissue concentration
(Table 30). These endpoints were determined using methods described
herein and well known to those of ordinary skill in the art.
TABLE-US-00027 TABLE 26 ALT and AST Levels (IU/L) Dose ISIS NO
.mu.mol/kg ALT AST Saline N/A 27.8 46.3 147764 2.4 29.5 64.0 372938
2.4 26.0 49.0 372938 1.2 24.8 49.5 372938 0.6 28.0 79.3 372938 0.3
28.3 60.0 372938 0.15 28.3 50.3 387462 2.4 41.3 84.0 387462 1.2
35.3 63.5 387462 0.6 32.0 77.3 387462 0.3 27.8 55.0 387462 0.15
29.3 68.3
TABLE-US-00028 TABLE 27 Liver and Kidney Weight (% of saline
control) Dose ISIS NO .mu.mol/kg Liver Kidney Saline N/A 100 100
147764 2.4 102 105 372938 2.4 100 100 372938 1.2 90 101 372938 0.6
96 112 372938 0.3 91 107 372938 0.15 96 98 387462 2.4 116 90 387462
1.2 113 90 387462 0.6 106 97 387462 0.3 101 126 387462 0.15 95
100
[0909] Total body weight and food consumption did not differ
significantly between saline-treated or oligonucleotide-treated
animals. Glucose levels also were similar among all treatment
groups.
TABLE-US-00029 TABLE 28 Triglyceride (TRIG), Total Cholesterol
(CHOL), HDL, LDL and Free Fatty Acid (FFA) Levels Dose TRIG CHOL
HDL LDL FFA ISIS NO .mu.mol/kg (mg/dL) (mg/dL) (mg/dL) (mg/dL)
(mg/dL) Saline N/A 167 107 81.8 11.0 1.76 147764 2.4 167 107 81.3
10.3 1.29 372938 2.4 153 104 79.0 10.3 1.28 372938 1.2 136 101 77.8
9.5 1.70 372938 0.6 184 110 83.3 10.8 1.66 372938 0.3 138 109 84.3
11.0 1.53 372938 0.15 151 106 82.8 10.8 1.57 387462 2.4 49 14 9.0
1.5 0.74 387462 1.2 71 23 16.5 2.0 0.76 387462 0.6 150 55 39.3 3.7
1.43 387462 0.3 136 92 72.8 7.5 1.14 387462 0.15 163 104 81.5 9.3
1.47
TABLE-US-00030 TABLE 29 % ApoB mRNA Level (relative to saline
control) 0.3 0.15 ISIS NO 2.4 .mu.mol/kg 1.2 .mu.mol/kg 0.6
.mu.mol/kg .mu.mol/kg .mu.mol/kg 147764 57.7 ND ND ND ND 372938
77.0 90.0 87.3 92.6 93.1 387462 1.5 8.5 27.4 58.9 75.8
[0910] Treatment with ISIS 387462 resulted in a significant and
dose-dependent decrease in triglycerides, total cholesterol, HDL,
LDL and free fatty acids. In accordance with these phenotypic
findings, treatment with ISIS 387462 also led to a dose-dependent
reduction in ApoB mRNA (Table 29) and protein (not shown) levels in
mouse plasma. To determine whether the observed increase in
efficiency with the methyleneoxy (4'-CH.sub.2--O-2') BNA gapmer is
due to an increase in oligonucleotide accumulation, full-length and
total oligonucleotide concentration in the liver and kidney were
determined.
TABLE-US-00031 TABLE 30 Full-length and Total Antisense Compound
Tissue Concentration (.mu.M) Relative to ApoB mRNA level (% of
saline control) Kidney Dose Full- Liver Kidney Liver ApoB ISIS NO
.mu.mol/kg Length Full-Length Total Total mRNA 147764 2.4 28.6 22.9
33.5 31.3 58 372938 2.4 32.0 5.49 34.0 7.76 77 387462 2.4 37.2 5.69
38.9 7.31 1.5 387462 1.2 29.8 3.71 31.3 4.91 8.5 387462 0.6 18.9
1.97 20.0 2.57 27 387462 0.3 9.11 0.73 9.49 0.78 59 387462 0.15
6.97 0.19 7.43 0.24 76
[0911] Levels of the 2-10-2 methyleneoxy (4'-CH.sub.2--O-2') BNA
gapmer were similar to the 5-10-5 and 2-10-2 MOE gapmers in the
kidney, but significantly reduced in the liver. The EC.sub.50 for
ISIS 387462 in the liver was determined by comparing
oligonucleotide concentration in the liver to inhibition of ApoB
mRNA. The approximate EC.sub.50 for ISIS 387462 is 1 .mu.M. In
contrast, an effective 5-10-5 MOE gapmer compound typically has an
EC.sub.50 of approximately 15 .mu.M in the liver.
[0912] Taken together, these results demonstrate that the ApoB
short gapmer having methyleneoxy (4'-CH.sub.2-0-2') in the wings is
a potent inhibitor of target mRNA expression and can effectively
lower triglycerides, cholesterol and free fatty acids. The potency
of the short antisense compound does not appear to be a result of
increased tissue accumulation since similar levels of the compound
were observed in kidney and reduced levels were found in the liver,
relative to the 5-10-5 MOE gapmer. In addition, the methyleneoxy
(4'-CH.sub.2--O-2') BNA gapmer exhibited little to no adverse side
effects.
Example 4
Short Antisense Compounds Targeted to a GCGR Nucleic Acid and
Having 2'-MOE Modifications
[0913] Eight-week old male C57/BL6 mice (Jackson Laboratory, Bar
Harbor, Me.) were administered a single dose of GCGR
oligonucleotide by intraperitoneal injection at a concentration of
6.25, 12.5, 25 or 50 mg. Each dose group consisted of four animals.
Shown in Table 31 are the sequences, motifs and conjugates of the
GCGR antisense compounds used in this study. Bolded residues
indicate 2'-O-methoxyethyl (2'-MOE) moieties. All compounds
comprise phosphorothioate internucleoside linkages throughout and
each cytosine is replaced with 5-methylcytosine. ISIS 386626, ISIS
386627 and ISIS 386628 further comprise a C.sub.16 conjugate group
attached to the 2'-O position of the sugar via a diamide linkage
(2'-OCH.sub.2C(.dbd.O)N(H)(CH.sub.2).sub.4N(H)C(.dbd.O)--(CH.sub.2).sub.1-
5CH.sub.3). GCGR antisense compounds target published GCGR
sequences, including Genbank.RTM. Accession No. BC031885.1 (SEQ ID
NO: 7).
TABLE-US-00032 TABLE 31 Short antisense compounds targeted to a
GCGR nucleic acid Target 5' SEQ ISIS SEQ Target Gapmer ID NO ID NO
Site Sequence (5'-3') Motif Conjugate NO 148364 7 393
TGCACTTTGTGGTACCAAGG 5-10-5 MOE None 1562 386626 7 1768
G.sub.C16CTTCTCCATCATA 2-10-2 MOE C16 1563 386627 7 1244
G.sub.C16GGCATGCTCGTCA 2-10-2 MOE C16 653 386593 7 1244
GGGCATGCTCGTCA 2-10-2 MOE None 649 386628 7 1680
T.sub.C16GTCTTGCTGCTTT 2-10-2 MOE C16 1564 386594 7 1680
TGTCTTGCTGCTTT 2-10-2 MOE None 1565
[0914] Mice were sacrificed 48 hours following injection to
determine serum transaminase levels (Table 32); liver, white
adipose tissue (WAT), spleen and kidney weight (Table 33);
cholesterol, triglyceride and glucose levels (Table 34); GCGR mRNA
levels (Tables 35-41); and full-length and total oligonucleotide
concentration in liver and kidney (Table 42). Endpoints were
assessed using methods described herein and well known to those of
ordinary skill in the art. Data is included from a pre-treatment
bleed (Pre-Bleed) and post-treatment bleed (Post-Bleed).
TABLE-US-00033 TABLE 32 ALT & AST Levels (IU/L) Dose ALT ALT
AST AST ISIS NO (mg/kg) Pre-Bleed Post-Bleed Pre-Bleed Post-Bleed
Saline N/A 36 51 55 85 148364 50 24 40 40 115 148364 25 26 35 42 87
148364 12.5 23 32 44 69 148364 6.25 28 34 47 76 386626 50 28 40 48
120 386626 25 30 36 44 92 386626 12.5 28 34 44 90 386626 6.25 26 42
46 69 386627 50 27 457 42 451 386627 25 29 97 45 142 386627 12.5 29
62 46 81 386627 6.25 23 87 38 96 386593 50 23 33 46 58 386593 25 25
32 41 95 386593 12.5 26 33 43 74 386593 6.25 28 31 43 53 386628 50
28 68 44 76 386628 25 24 32 40 57 386628 12.5 28 35 42 75 386628
6.25 22 29 40 59 386594 50 29 34 46 92 386594 25 27 31 47 82 386594
12.5 28 33 45 74 386594 6.25 23 48 42 67
TABLE-US-00034 TABLE 33 Organ Weights (% saline control) ISIS NO
Dose (mg/kg) Liver WAT Kidney Spleen Saline N/A 100 100 100 100
148364 50 103 80 108 123 148364 25 103 75 112 115 148364 12.5 100
84 108 96 148364 6.25 101 89 104 113 386626 50 112 77 104 130
386626 25 109 97 103 120 386626 12.5 96 73 97 114 386626 6.25 100
90 100 95 386627 50 90 113 102 165 386627 25 99 87 99 143 386627
12.5 109 93 102 136 386627 6.25 103 96 102 131 386593 50 96 98 102
118 386593 25 83 94 100 104 386593 12.5 99 82 101 129 386593 6.25
96 77 98 144 386628 50 104 100 99 126 386628 25 102 97 109 113
386628 12.5 101 111 99 114 386628 6.25 98 106 102 151 386594 50 90
80 99 131 386594 25 93 76 99 128 386594 12.5 94 98 100 113 386594
6.25 102 85 101 119
[0915] Overall, the GCGR antisense compounds exhibited little to no
adverse side effects.
TABLE-US-00035 TABLE 34 Triglyceride (TRIG), Cholesterol (CHOL) and
Glucose Levels (IU/L) TRIG TRIG CHOL CHOL Glucose Glucose ISIS NO
Dose (mg/kg) Pre-Bleed Post-Bleed Pre-Bleed Post-Bleed Pre-Bleed
Post-Bleed Saline N/A 132 181 91 96 208 285 148364 50 110 177 81 94
207 228 148364 25 115 200 83 96 219 239 148364 12.5 106 179 85 89
198 256 148364 6.25 86 162 86 89 226 215 386626 50 87 163 79 57 239
179 386626 25 100 187 87 72 235 186 386626 12.5 100 148 82 76 232
185 386626 6.25 86 162 85 90 222 221 386627 50 106 120 83 126 227
150 386627 25 101 148 90 115 218 203 386627 12.5 99 203 86 98 237
219 386627 6.25 111 165 88 104 238 228 386593 50 130 128 100 95 244
213 386593 25 119 135 83 77 206 208 386593 12.5 122 128 83 79 222
233 386593 6.25 120 138 84 78 214 219 386628 50 102 98 88 95 209
232 386628 25 102 129 84 85 210 223 386628 12.5 90 123 90 94 231
240 386628 6.25 117 121 83 85 228 229 386594 50 93 99 84 85 203 274
386594 25 106 94 90 86 219 272 386594 12.5 118 133 85 95 200 292
386594 6.25 112 146 78 94 222 275
[0916] GCGR 2-10-2 MOE gapmers exhibited a trend toward lower
post-bleed triglyceride levels, relative to the 5-10-5 MOE gapmer,
with ISIS 386628 and ISIS 386594 having the greatest dose-dependent
effect. Glucose levels also were decreased in a dose-dependent
manner following treatment with ISIS 386626 and ISIS 386627.
Treatment with ISIS 386628, ISIS 386593 and ISIS 386594 also
generally led to a decrease in post-bleed glucose levels.
Cholesterol levels did not appear to significantly differ among
treatment groups.
[0917] To determine whether the phenotypic changes shown above
correlated with a decrease in GCGR mRNA, treated animals were
evaluated for levels of target mRNA in liver by real time PCR
according to methods described herein. Tables 35 to 41 show results
from direct comparisons of the antisense compounds targeting GCGR
nucleic acid for their effect on target expression. Results are
expressed as percent of saline control.
TABLE-US-00036 TABLE 35 GCGR mRNA levels following treatment with
ISIS 148364 & ISIS 386626 ISIS NO 50 mg/kg 25 mg/kg 12.5 mg/kg
6.25 mg/kg 148364 36 79 87 62 386626 0 8 3 7
TABLE-US-00037 TABLE 36 GCGR mRNA levels following treatment with
ISIS 148364 & ISIS 386627 ISIS NO 50 mg/kg 25 mg/kg 12.5 mg/kg
6.25 mg/kg 148364 63 87 105 86 386627 3 30 57 74
TABLE-US-00038 TABLE 37 GCGR mRNA levels following treatment with
ISIS 148364 & ISIS 386593 ISIS NO 50 mg/kg 25 mg/kg 12.5 mg/kg
6.25 mg/kg 148364 56 74 105 86 386593 9 38 74 90
TABLE-US-00039 TABLE 38 GCGR mRNA levels following treatment with
ISIS 148364 & ISIS 386628 ISIS NO 50 mg/kg 25 mg/kg 12.5 mg/kg
6.25 mg/kg 148364 42 77 98 101 386628 2 18 53 77
TABLE-US-00040 TABLE 39 GCGR mRNA levels following treatment with
ISIS 148364 & ISIS 386594 ISIS NO 50 mg/kg 25 mg/kg 12.5 mg/kg
6.25 mg/kg 148364 59 98 102 96 386594 25 47 50 96
TABLE-US-00041 TABLE 40 GCGR mRNA levels following treatment with
ISIS 386627 & ISIS 386593 ISIS NO 50 mg/kg 25 mg/kg 12.5 mg/kg
6.25 mg/kg 386627 5 40 58 42 386593 10 29 34 71
TABLE-US-00042 TABLE 41 GCGR mRNA levels following treatment with
ISIS 386628 & ISIS 386594 ISIS NO 50 mg/kg 25 mg/kg 12.5 mg/kg
6.25 mg/kg 386628 4 13 38 97 386594 19 50 56 99
[0918] Treatment with the 2-10-2 MOE gapmers led to a significant
dose-dependent decrease in GCGR mRNA expression. ISIS 386626
exhibited the greatest decrease in target mRNA. To determine
whether the observed increase in efficiency with the short
antisense compounds is due to an increase in antisense compound
accumulation, full-length and total antisense compound
concentration in the liver and kidney were determined.
TABLE-US-00043 TABLE 42 Total and Full-length Antisense Compound
Concentrations in Liver and Kidney (.mu.g/g) Full- Total Total
Full-length length ISIS NO Kidney Liver Kidney Liver 148364 90 54
58 46 386626 757 274 355 125 386593 91 12 77 12 386628 496 286 305
202
[0919] The results shown in Table 42 demonstrate that short
antisense compounds comprising a C.sub.16 conjugate exhibit a
significant increase in antisense compound accumulation in both
liver and kidney. However, ISIS 386593, which was effective at
reducing target mRNA, triglycerides and glucose levels, accumulates
to a level similar to the 5-10-5 MOE gapmer in liver and to a lower
level in kidney. These results suggest that while conjugation with
C.sub.16 can increase liver and kidney antisense compound
concentration, it does not entirely account for the effectiveness
of the short antisense compounds.
[0920] Taken together, these results demonstrate that GCGR short
antisense compounds are capable of significantly inhibiting target
mRNA expression while also lowering triglyceride and glucose
levels. In addition, with the exception of ISIS 386627, the short
MOE gapmers exhibited little to no toxic effects.
Example 5
Short Antisense Compounds Targeting to a GCGR Nucleic Acid and
Having 2'-MOE and Methyleneoxy (4'-CH.sub.2--O-2') BNA
Modifications
[0921] Eight-week old male C57/BL6 mice (Jackson Laboratory, Bar
Harbor, Me.) were administered a single dose of GCGR antisense
compound by intraperitonel (i.p.) injection at a concentration of
10, 3.2, 1, and 0.32 .mu.molkg. Each dose group consisted of four
animals. Shown in Table 43 are the sequences, motifs and conjugates
of the GCGR antisense compounds used in this study. Bolded residues
indicate 2'-O-methoxyethyl (2'-MOE) modifications and the
italicized residues indicate methyleneoxy (4'-CH.sub.2--O-2') BNA
modifications. All antisense compounds comprise phosphorothioate
internucleoside linkages throughout and each cytosine is replaced
with 5-methylcytosine. GCGR antisense compounds target published
GCGR nucleic acids, including Genbank Accession No. BC031885.1 (SEQ
ID NO: 7).
TABLE-US-00044 TABLE 43 Antisense Compounds targeted to a GCGR
nucleic acid Target 5' SEQ ISIS SEQ ID Target Sequence ID NO NO
Site (5'-3') Gapmer Motif NO 148364 7 393 TGCACTTTGTGG 5-10-5 MOE
1562 TACCAAGG 396144 7 1768 GCTTCTCCATCA 2-10-2 MOE 1566 TA 396148
7 1768 GCTTCTCCATCA 2-10-2 1567 TA Methyleneoxy (4'-CH.sub.2--O-2')
BNA 396145 7 1765 ATGGCTTCTCCA 5-10-5 MOE 1568 TCATATCC 396146 7
1244 GGGCATGCTCGT 2-10-2 MOE 650 CA 396149 7 1244 GGGCATGCTCGT
2-10-2 652 CA Methyleneoxy (4'-CH.sub.2--O-2') BNA 396147 7 1241
CTTGGGCATGCT 5-10-5 MOE 1569 CGTCAGTC
[0922] To determine whether the phenotypic changes shown above
correlated with a decrease in GCGR mRNA, treated animals were
evaluated for levels of target mRNA in liver by RT, real time PCR
according to methods described herein. Table 44 show results from
direct comparisons of the antisense compounds targeting GCGR
nucleic acid for their effect on target expression. Results are
expressed as percent of saline control.
TABLE-US-00045 TABLE 44 GCGR mRNA levels SIS NO. 0.32 .mu.mol/kg 1
.mu.mol/kg 3.2 .mu.mol/kg 10 .mu.mol/kg 148364 105 106 73 38 396144
122 117 40 35 396148 20 6 2 1 396145 nd Nd 33 8 396146 98 135 95 35
396149 91 41 30 7 396147 nd Nd 68 28
[0923] As shown in Table 44, each short antisense compound having
methyleneoxy (4'-CH.sub.2--O-2') BNA modifications demonstrated a
dose-dependent reduction in GCGR mRNA levels. Furthermore, the
short antisense compounds were more effective at target reduction
than the 5-10-5 MOE gapmer. Each short antisense compound
comprising methyleneoxy (4'-CH.sub.2--O-2') BNA in the wings
resulted in a significant reduction in GCGR protein relative to
both saline control and ISIS 148364 treatment. Next, estimated
ED.sub.50 concentrations for each antisense were calculated using
Graphpad Prism; ED.sub.50 is the dose at which 50% mRNA reduction
is observed. The results are shown below in Table 45.
TABLE-US-00046 TABLE 45 Estimated ED.sub.50 Concentration ISIS
Gapmer Motif NO ED.sub.50 (.mu.mole/kg) ED.sub.50 (mg/kg) 5-10-5
MOE 148364 7 50.6 2-10-2 MOE 396144 4 18.1 2-10-2 methyleneoxy BNA
396148 0.1 0.4 5-10-5 MOE 396145 2.1 9.3 2-10-2 MOE 396146 8.3 40
2-10-2 methylenexy BNA 396149 1.1 5 5-10-5 MOE 396147 5.2 37.5
Example 6
Short Antisense Compounds Targeting a PTEN Nucleic Acid and Having
Methyleneoxy (4'-CH.sub.2--O-2') BNA Modifications
[0924] Six-week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were administered a single i.p. injection of PTEN
antisense compound at a dose of 8 .mu.mol/kg. Each dose group
consisted of four animals. Shown in Table 46 are the sequences and
motifs of the PTEN antisense compounds used in this study. Bolded
residues indicate 2'-O-methoxyethyl moieties (2'-MOE) and
italicized residues indicate Methyleneoxy BNA nucleotides. Each
antisense compound comprises phosphorothioate linkages throughout.
In addition, the cytosine residues in the gap of ISIS 384073 and in
the wings of ISIS 392056, ISIS 392057, ISIS 392061 and ISIS 392063
are replaced with 5-methylcytosines. Antisense compounds target
published PTEN nucleic acids, including Genbank Accession No.
U92437.1 (SEQ ID NO: 13).
TABLE-US-00047 TABLE 46 Antisense Compounds targeted to a PTEN
nucleic acid Target 5' ISIS SEQ ID Target SEQ NO NO Site Sequence
(5'-3') Gapmer Motif ID NO 141923 Control N/A CCTTCCCTGAAGGTTCCTCC
5-10-5 MOE 1570 116847 29 2011 TCAAATCCAGAGGCTAGCAG 5-10-5 MOE 1571
384073 29 2013 AAATCCAGAGGCTAGC 3-10-3 methyleneoxy 1428
(4'-CH.sub.2--O-2') BNA 391172 29 2013 AAATCCAGAGGCTAG 2-10-3
methyleneoxy 1429 (4'-CH.sub.2--O-2') BNA 392056 29 140
AGCTGCAGCCATGA 2-10-2 methyleneoxy 1263 (4'-CH.sub.2--O-2') BNA
392057 29 807 GGTCCAGGGCCAAG 2-10-2 methyleneoxy 1162
(4'-CH.sub.2--O-2') BNA 392061 29 2014 AATCCAGAGGCTAG 2-10-2
methyleneoxy 1431 (4'-CH.sub.2--O-2') BNA 392063 29 3099
AGGCCAGTGCTAAG 2-10-2 methyleneoxy 1226 (4'-CH.sub.2--O-2') BNA
[0925] Mice were sacrificed 72 hours following injection to
determine serum transaminase levels (Table 47); liver and spleen
weights (Table 47); and PTEN mRNA levels in liver, kidney and fat
(Table 48), according to procedures described herein and well know
to one of ordinary skill in the art.
TABLE-US-00048 TABLE 47 Transaminase Levels and Organ Weights Liver
ISIS AST ALT Weight Spleen Weight NO (IU/L) (IU/L) % Saline %
Saline Saline 98.5 37.5 100 100 141923 89.5 34.8 101 108 116847
59.8 29.5 109 108 384073 57.8 29.3 115 111 391172 48.5 32.8 120 112
392056 516 892 125 167 392057 63.8 34.5 125 101 392061 189 42.0 123
111 392063 67.3 21.8 127 134
[0926] Overall, the short antisense compounds with methyleneoxy
(4'-CH.sub.2--O-2') BNA modifications exhibited little to no
adverse effects. In addition, total body weight did not
significantly differ between treatment groups.
TABLE-US-00049 TABLE 48 % PTEN mRNA levels in Liver, Kidney and Fat
ISIS NO Liver Kidney Fat Saline 100 100 100 141923 102 133 118
116847 37 96 85 384073 24 74 77 391172 18 63 101 392056 27 88 74
392057 33 79 96 392061 24 61 85 392063 6.5 52 72
[0927] As shown in Table 48, each antisense compound targeted to a
PTEN nucleic acid led to a significant reduction in target mRNA
levels in liver as compared with saline treated and control treated
animals. The antisense compounds had various effects on target mRNA
levels in kidney and fat.
Example 7
Short Antisense Compounds Targeting a PTEN Nucleic Acid and having
BNA Modifications
[0928] Six-week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were administered a single intraperitoneal (i.p.)
injection of antisense compound targeted a PTEN nucleic acid at a
dose of 8, 4, 2 or 1 .mu.mol/kg. Each dose group consisted of four
animals. Shown in Table 49 are the sequence, wing chemistry and
motif of each antisense compound used in this study. Bold residues
indicate 2'-MOE modified nucleotides, italicized letters indicate
methyleneoxy (4'-CH.sub.2--O-2') BNA modifications. All antisense
compounds comprise phosphorothioate linkages at each position. Each
cytosine of ISIS 116847 and the cytosine residues in the
methyleneoxy (4'-CH.sub.2--O-2') BNA wings of ISIS 392063 are
replaced with 5-methylcytosines, while the thymidine residues in
the methyleneoxy (4'-CH.sub.2--O-2') BNA wings of ISIS 392745 are
replaced with 5-methyl thymidines. Antisense compounds target
published PTEN nucleic acids, including Genbank Accession No.
U92437.1 (SEQ ID NO: 13).
TABLE-US-00050 TABLE 49 Antisense Compounds Targeted to a PTEN
Nucleic Acid Target SEQ ISIS SEQ Target Sequence ID NO ID NO Site
(5'-3') Gapmer Motif NO 116847 13 2011 TCAAATCCAGAG 5-10-5 1571
GCTAGCAG MOE 392063 13 3099 CTTAGCACTGGC 2-10-2 1226 CT
Methyleneoxy BNA 392745 13 3099 CTTAGCACTGGC 2-10-2 1226 CT
methyleneoxy BNA
[0929] Mice were sacrificed 72 hours following injection to
determine serum transaminase levels (Table 50); liver, kidney and
spleen weights (Table 50); PTEN mRNA levels in liver (Table 51);
and estimated ED.sub.50 oligonucleotide concentration (Table 52).
These endpoints were measured using methods described herein and
well known to those of ordinary skill in the art.
TABLE-US-00051 TABLE 50 AST, ALT and Bilirubin Levels and Organ
Weights Liver Kidney Spleen ISIS Dose AST ALT Bilirubin Weight %
Weight Weight NO .mu.mol/kg (IU/L) (IU/L) (mg/dL) Saline % Saline %
Saline Saline N/A 64.0 31.8 0.15 100 100 100 116847 8 73.0 32.0 0.1
114 92 106 392063 8 50.3 17.3 0.1 115 98 115 392063 4 100.8 31.3
0.15 122 94 116 392063 2 60.5 32.8 0.1 112 99 106 392063 1 57.5
29.3 0.1 104 95 107 392745 8 75.5 23.5 0.13 125 99 100 392745 4
77.0 29.3 0.13 121 100 96 392745 2 69.0 32.0 0.13 110 98 103 392745
1 52.0 27.3 0.1 109 97 104
[0930] Overall, the PTEN antisense compounds did not show
significant signs of toxicity. Kidney, liver and spleen weights
were all within normal ranges. Total body weight did not
significantly differ between treatment groups.
TABLE-US-00052 TABLE 51 % PTEN mRNA levels in Liver (relative to
saline control) ISIS NO 8 .mu.mol/kg 4 .mu.mol/kg 2 .mu.mol/kg 1
.mu.mol/kg 116847 36 ND ND ND 392063 7.4 16 32 60 392745 5.2 11 31
60
[0931] As shown in Table 51, each short antisense compound having
methyleneoxy (4'-CH.sub.2--O-2') BNA modifications demonstrated a
dose-dependent reduction in PTEN mRNA levels. Furthermore, the
short antisense compounds were more effective at target reduction
than the 5-10-5 MOE gapmer. Levels of PTEN protein in liver were
also determined following administration of each antisense compound
at a dose of 8 .mu.mol/kg. Each short antisense compound comprising
methyleneoxy (4'-CH.sub.2--O-2') BNA in the wings resulted in a
significant reduction in PTEN protein relative to both saline
control and ISIS 116847 treatment. Next, estimated ED.sub.50
concentrations for each oligonucleotide were calculated using
Graphpad Prism. The results are shown below in Table 52.
TABLE-US-00053 TABLE 52 Estimated ED.sub.50 Concentration ISIS Wing
Chemistry NO ED.sub.50 (.mu.mole/kg) ED.sub.50 (mg/kg) MOE (with
5-MeC) 116847 6.3 45.2 methyleneoxy BNA 392063 1.3 5.8 (with 5-MeC)
methyleneoxy BNA 392745 1.2 5.6
[0932] To further investigate different types of bicyclic nucleic
acid compounds, an additional set of short antisense compounds
targeting a PTEN nucleic acid was designed and tested. Six-week old
male Balb/c mice (Jackson Laboratory, Bar Harbor, Me.) were
administered a single intraperitoneal (i.p.) injection of antisense
compound at a dose of 8, 4, 2 or 1 .mu.mol/kg. Each dose group
consisted of four animals. Shown in Table 53 are the sequence, wing
chemistry and motif of each antisense compound used in this study.
All antisense compounds comprise phosphorothioate linkages at each
position. The cytosine residues in the methyleneoxy
(4'-CH.sub.2--O-2') BNA wings of ISIS 392063 are replaced with
5-methylcytosines. The antisense compound target published PTEN
nucleic acids, including Genbank Accession No. U92437.1 (SEQ ID NO:
13).
TABLE-US-00054 TABLE 53 Antisense Compounds Targeting a PTEN
Nucleic Acid Target 5' ISIS SEQ Target SEQ ID NO ID NO Site
Sequence (5'-3') Gapmer Motif NO 392063 29 3099 CTTAGCACTGGCCT
2-10-2 1226 Methyleneoxy BNA 396564 29 3099 CTTAGCACTGGCCT 2-10-2
1226 Oxyamino (4'-CH.sub.2--N(R)--O-2') BNA 396006 29 3099
CTTAGCACTGGCCT 2-10-2.alpha.-L- 1226 Methyleneoxy BNA
[0933] Mice were sacrificed 72 hours following injection to
determine serum transaminase levels (Table 54); liver and spleen
weights (Table 54); and PTEN mRNA levels in liver (Table 55),
according to methods described herein and well known to those of
ordinary skill in the art.
TABLE-US-00055 TABLE 54 AST and ALT Levels and Organ Weights ISIS
Dose AST ALT Liver Spleen NO .mu.mol/kg (IU/L) (IU/L) Weight Weight
Saline N/A 71 33 100 100 392063 8 97 38 118 103 392063 4 179 36 115
107 392063 2 67 32 109 116 392063 1 68 27 102 105 396564 8 67 25
100 104 396564 4 96 30 102 106 396564 2 68 27 100 119 396564 1 79
39 97 109 396006 8 56 28 110 104 396006 2 139 36 97 105
TABLE-US-00056 TABLE 55 % PTEN mRNA levels in Liver (relative to
saline control) ISIS NO 8 .mu.mol/kg 4 .mu.mol/kg 2 .mu.mol/kg 1
.mu.mol/kg 392063 6.9 18 39 71 396564 86 97 100 96 396006 6.5 ND ND
70
[0934] As shown above, short antisense compounds having
.alpha.-L-methyleneoxy (4'-CH.sub.2--O-2') BNA modifications led to
a dose-dependent reduction in target mRNA levels. Treatment with
the short antisense compound having oxyamino BNA modifications led
to a modest reduction in target expression.
Example 8
Single Dose Administration Dose Response Study with Short Antisense
Compounds Targeting ApoB and PTEN Nucleic Acids
[0935] Six-week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were administered a single intraperitoneal (i.p.)
injection of antisense compound at a dose of 8, 4, 2 or 1
.mu.mol/kg. Each dose group consisted of four animals. Shown in
Table 56 are the sequence, wing chemistry and motif of each
antisense compound used in this study. Italicized residues indicate
methyleneoxy (4'-CH.sub.2--O-2') BNA modifications, underlined
residues indicate N-methyl-oxyamino
(4'-CH.sub.2--N(CH.sub.3)--O-2') BNA modifications, and boxed
residues indicate .alpha.-L-methyleneoxy (4'-CH.sub.2--O-2') BNA
modifications. All antisense compounds comprise phosphorothioate
linkages at each position. Each cytosine of ISIS 116847 and the
cytosine residues in the methyleneoxy (4'-CH.sub.2--O-2') BNA wings
of ISIS 392063 are replaced with 5-methylcytosines, while the
thymidine residues in the methyleneoxy (4'-CH.sub.2--O-2') BNA
wings of ISIS 392745 are replaced with 5-methyl thymidines. PTEN
antisense compounds target published PTEN nucleic acid, including
Genbank Accession No. U92437.1 (SEQ ID NO: 13). ApoB antisense
compounds target published ApoB nucleic acid, including Genbank
Accession No. XM.sub.--137955.5 (SEQ ID NO: 2).
TABLE-US-00057 TABLE 56 Short Antisense Compounds Targeted to ApoB
and PTEN Nucleic Acids ISOS Target 5' Target NO Target Seq ID Site
SEQUENCE Gapmer SEQ ID NO 387462 ApoB 19 8235 GGTACATGGAAGTC 2-10-2
193 Methyleneoxy BNA 392063 PTEN 29 3099 CTTAGCACTGGCCT 2-10-2 1226
Methyleneoxy BNA 396565 PTEN 29 3099 CUTAGCACTGGCCU 2-102 1226
N-Me-oxyamino BNA 396006 PTEN 29 3009 ##STR00017## 2-10-2
.alpha.-L-methyleneoxy BNA 1226
TABLE-US-00058 TABLE 57 % ApoB and PTEN mRNA Reduction (relative to
saline control) % PTEN mRNA ISIS Dose % ApoB mRNA Reduction
Reduction NO (.mu.mol/kg) (relative to saline) (relative to saline)
387462 8 0.62 92.8 4 6.55 103 2 18.6 105 1 42.0 98.0 392063 8 126
6.79 4 111 18.1 2 112 42.4 1 114 62.3 396565 8 116 23.8 4 1.04 46.6
2 94.4 76.1 1 115 89.5 396006 8 94.3 62.9 4 101 18.2 2 79.7 52.4 1
111 82.4
[0936] As shown in Table 57, each short antisense compound having
Methyleneoxy BNA modifications demonstrated a dose-dependent
reduction in target mRNA levels. Notably, the short antisense
compound with N-methyl-oxyamino BNA wings (ISIS 396565) also
demonstrated dose-dependent reduction in PTEN expression similar to
both the .beta.-D-methyleneoxy BNA and .alpha.-L-methyleneoxy BNA
short antisense compounds. Next, estimated ED.sub.50 concentrations
for each antisense were calculated using Graphpad Prism. The
results are shown below in Table 58.
TABLE-US-00059 TABLE 58 Estimated ED.sub.50 Concentrations ISIS
Wing Chemistry NO ED.sub.50 (.mu.mole/kg) ED.sub.50 (mg/kg)
Methyleneoxy BNA 387462 0.8 3.9 Methyleneoxy BNA 392063 1.5 7
N-Me-oxyamino BNA 396565 3.8 17.4 .alpha.-L-methyleneoxy BNA 396006
2.1 9.3
Example 9
Administration of a Parent and Parent Mixed Backbone Antisense
Compound Targeting SGLT-2 mRNA
[0937] ISIS 257016 was administered to db/db mice (Charles River
Laboratories, Wilmington, Mass.) intraperitoneally at a dose of 1,
7.5, 14 or 17 mg/kg twice a week. Control groups included a group
receiving saline on the same dosing schedule and a group receiving
ISIS 145733. ISIS 257016 and ISIS 145733 both comprise the sequence
GAAGTAGCCACCAACTGTGC (SEQ ID NO: 1572) further comprising a central
"gap" region consisting of ten 2'-deoxynucleotides, which is
flanked on both sides (5' and 3' directions) by five-nucleotide
"wings". The wings are composed of 2'-methoxyethyl (2'-MOE)
nucleotides. All cytidine residues are 5-methylcytidines. The
internucleoside (backbone) linkages are phosphorothioate (P.dbd.S)
throughout the oligonucleotide for ISIS 145733; however ISIS 257016
has a mixed backbone. The internucleoside linkages for ISIS 257016
are phosphodiester (P.dbd.O) in the wings and phosphorothioate in
the gap. Forty-eight hours following administration of the last
dose the mice were sacrificed and kidney tissue was analyzed for
SGLT-2 mRNA levels. The results are shown below in Table 59.
TABLE-US-00060 TABLE 59 Antisense inhibition of SGLT2 mRNA
expression in vivo by 5-10-5 MOE gapmers % change in SGLT2 Dose of
oligonucleotide expression relative to saline nmol/kg ISIS 145733
ISIS 257016 17 -37.5 -76 14 -31.25 -74 7.5 -12.5 -62.5 1 +3 -44
[0938] Both ISIS 257016 and ISIS 145733 markedly reduced SGLT-2
levels compared to saline control. (mRNA levels determined using
RT, real-time PCR as described above) However, ISIS 257016 has been
shown to be about 20-50 times more potent for reducing SGLT-2 mRNA
compared to ISIS 145733. An associated reduction in plasma glucose
levels was seen for the treatment groups (661.+-.14 for the saline
group compared to 470.+-.23 for the group receiving ISIS 257016).
Accumulation of ISIS 257016 and ISIS 145733 in the kidney was
similar over the dose range, however little of the full length
257016 antisense was detected in the kidney which supports the
theory that a degradation product is responsible for the increased
activity. Also the onset of action following a single dose of 25
mg/kg correlated to a time pint were little intact 257016 antisense
compound was left.
[0939] Similar studies were performed in lean mice, ob/ob mice and
in ZDF rats (Charles Rivers Laboratories) using ISIS 257016, ISIS
145733 or saline in a similar same dosing schedule as described
above. The sequence of the binding site for ISIS 145733 and ISIS
257016 is conserved between mouse and rat (see Table 60). Reduction
of SGLT-2 mRNA in the kidney was similar to that seen above. In a
study utilizing rats, at a dose of 10 mg/kg given two times a week
for two weeks, ISIS 145733 was shown to reduce SGLT-2 mRNA levels
by about 40% whereas the reduction achieved with ISIS 257016 was
greater than 80%. ISIS 257016 reduces SGLT2 expression maximally at
a low dose of 12.5 mg/kg. Additional studies at lower dosing ranges
show significant reduction of SGLT2 mRNA levels with the mixed
backbone antisense compound at doses less than 1 mg/kg/wk.
Example 10
Administration of a Parent and Short Antisense Compound Targeting
SGLT-2 mRNA
[0940] Pharmacokinetic studies indicated that ISIS 257016 was
acting as a prodrug that was metabolized to a 12 nucleobase
pharmacophore. In a next study, ZDF rats were dosed
intraperitoneally twice per week with 1.5 mg/kg of either ISIS
257016 or ISIS 370717, or with saline at a similar dosing schedule.
ISIS 370717 is a 12 nucleobase antisense compound targeted to
SGLT-2 nucleic acid comprising the sequence TAGCCACCAACT (SEQ ID
NO: 154) and further comprising central "gap" region consisting of
ten 2'-deoxynucleotides, which is flanked on both sides (5' and 3'
directions) by one-nucleotide "wings". The wings are composed of
2'-methoxyethyl (2'-MOE) nucleotides. All cytidine residues are
5-methylcytidines. The internucleoside (backbone) linkages are
phosphorothioate (P.dbd.S) throughout the oligonucleotide.
[0941] Following five weeks of dosing the animals were sacrificed
and kidney tissue was analyzed for SGLT-2 mRNA levels. The
pharmacological activity of ISIS 257016 and ISIS 370717 were
similar, however, the 12 nucleotide antisense compound displayed a
faster onset of action. ISIS 370717 displayed nearly 80% inhibition
of SGLT2 expression in kidney on day two after a single dose of 2.8
umoles/kg whereas ISIS 257016 displayed only about 25% inhibition
on day 2 after the same single dose administration. The date
support that ISIS 257016 is a prodrug having a 12 nucleotide
pharmacophore.
Example 11
Potency and Bioavailability of a Short Antisense Compound
[0942] The improved potency displayed by ISIS 370717 and the
improved oral bioavailability for these short antisense compounds
makes these compounds useful for oral administration. Normal rats
received ISIS 370717, ISIS 145733 or saline at 100 mg/kg twice per
week via intrajejunal administration. About 48 hours following the
last dose, the animals were sacrificed and kidney tissue was
analyzed for antisense compound concentration and SGLT-2 mRNA
levels. There was a significantly higher accumulation of ISIS
370717 in the kidney tissue (approximately 500 micro grams per gram
of tissue) compared to the controls. Moreover, SGLT-2 mRNA was
reduced by more than 80% over the controls.
Example 12
Wing, Gap and Total Length Variations Around a 12 Nucleotide Short
Antisense Compound
[0943] ISIS 370717 1-10-1 MOE gapmer was used as a template to make
sequence related oligos with varying motifs. These variations are
provided in Table 60. The antisense compounds were designed to
target different regions of the mouse or rat SGLT2 nucleic acid,
using published sequences (GenBank accession number U29881.1,
incorporated herein as SEQ ID NO: 1575, and GenBank accession
number AJ292928.1, incorporated herein as SEQ ID NO: 1576,
respectively).
TABLE-US-00061 TABLE 60 Short Antisense compounds targeting SGLT2
nucleic acids 5' Target Site 5' Target Site on mouse on rat SEQ
ISIS SEQ ID NO: SEQ ID NO: Gapmer ID NO 1575 1576 Motif Sequence
(5'-3') NO 257016 2680 148 5-10-5 GAAGTAGCCACCAACTGTGC 1553 MOE
370717 2684 152 1-10-1 TAGCCACCAACT 1554 MOE 386169 2684 152 2-8-2
TAGCCACCAACT 1555 MOE 386176 2685 153 1-8-1 AGCCACCAAC 1556 MOE
386196 2684 152 3-6-3 TAGCCACCAACT 1557 MOE
[0944] The antisense compounds were analyzed for their effect on
mouse SGLT2 mRNA levels. Data are ranges taken from three
experiments in which mice were dosed twice per week for three weeks
with 2.5, 0.5 or 0.1 umol/kg of the above MOE gapmers given by
intraperitoneal injection. Mice were sacrificed 48 hours following
last administration and evaluated for SGLT2 levels in kidney. SGLT2
mRNA levels were determined by RT, real-time PCR as described by
other examples herein. PCR results were normalized to an internal
ISIS control. The results are shown below in Table 61.
TABLE-US-00062 TABLE 61 Antisense inhibition of SGLT2 in vivo by
1-10-1 and 1-10-2 MOE gapmers % change in SGLT2 expression relative
to saline Dose of oligonucleotide ISIS ISIS ISIS ISIS ISIS umol/kg
370717 386169 386176 386196 386197 2.5 -82 -85 -80 -50 -20 0.5 -70
-80 -68 -30 -15 0.1 -55 -70 -65 -35 -20
[0945] These results illustrate that all the various motifs tested
inhibit the expression of SGLT2 in vivo in a dose-dependent manner.
The 1-10-1, 2-8-2 and 1-8-1 gapmers were found to be particularly
potent.
Example 13
Antisense Inhibition of Rat SGLT-2 by 1-10-1 and 1-10-2 MOE
Gapmers
[0946] 1-10-1 and 1-10-2 MOE gapmer antisense compounds, provided
in Table 62, were designed to target different regions of the mouse
or rat SGLT2 RNA. All short antisense compounds in Table 62 are
chimeric oligonucleotides ("gapmers") either 12 or 13 nucleotides
in length, composed of a central "gap" segment consisting of ten
2'-deoxynucleotides, which are flanked on the 5' side by a
one-nucleoside "wing" and on the 3' side by a two or one-nucleotide
"wing". The wings are composed of 2'-methoxyethyl (2'-MOE)
nucleotides. The internucleoside (backbone) linkages are
phosphorothioate (P.dbd.S) throughout the oligonucleotide. All
cytidine residues are 5-methylcytidines.
TABLE-US-00063 TABLE 62 Antisense compounds targeting SGLT2 nucleic
acid 5' Target Site 5' Target Site on SEQ ID on SEQ ID NO: XXX NO:
XXX Gapmer SEQ ISIS NO (mouse) (rat) Motif Sequence (5'-3') ID NO
370717 2684 152 1-10-1 MOE TAGCCACCAACT 1554 382675 2683 151 1-10-1
MOE TAGCCACCAACTG 1559 379692 508 1-10-1 MOE TGTTCCAGCCCA 246
382676 507 1-10-2 MOE TGTTCCAGCCCAG 246 379699 1112 1-10-2 MOE
GGCATGAGCTTC 281 382677 1111 1-10-2 MOE GGCATGAGCTTCA 281 382677
958 1-10-2 MOE GGCATGAGCTTCA 281
[0947] The short antisense compounds were analyzed for their effect
on rat SGLT2 mRNA levels. Data are ranges taken from three
experiments in which Male Sprague-Dawley rats (170-200 g) were
dosed twice per week for three weeks with 450, 150 or 50 nmol/kg of
either a 1-10-1 or 1-10-2 MOE gapmer given by intraperitoneal
injection. Rats were sacrificed 48 hours following last
administration and evaluated for SGLT2 mRNA levels in kidney.
Target levels were determined by RT, real-time PCR as described by
other examples herein. PCR results were normalized to an internal
ISIS control. The results are shown below in Table 63.
TABLE-US-00064 TABLE 63 Antisense inhibition of SGLT2 mRNA in vivo
by 1-10-1 and 1-10-2 MOE gapmers % change in SGLT2 expression
relative to saline Dose of ISIS ISIS ISIS ISIS ISIS ISIS
oligonucleotide 370717 382675 379692 382676 379699 382677 nmol/kg
1-10-1 1-10-2 1-10-1 1-10-2 1-10-1 1-10-2 450 -70 -80 -90 -85 -83
-75 150 -70 -65 -85 -80 -75 -60 50 -55 -50 -80 -65 -60 -40
[0948] These results illustrate that both the 1-10-1 and 1-10-2 MOE
gapmers reduce SGLT2 mRNA in vivo in a dose-dependent manner.
[0949] Rats were further evaluated for total body weight, liver,
spleen and kidney weight. Significant changes in spleen, liver or
body weight can indicate that a particular compound causes toxic
effects. All changes were within the margin of error of the
experiment. No significant changes in body weight were observed
during the treatment or at study termination. No significant
changes in liver or spleen weights were observed.
[0950] Toxic effects of short antisense compounds administered in
vivo can also be assessed by measuring the levels of enzymes and
proteins associated with disease or injury of the liver or kidney.
Elevations in the levels of the serum transaminases aspartate
aminotransferase (AST) and alanine aminotransferase (ALT) are often
indicators of liver disease or injury. Serum total bilirubin is an
indicator of liver and biliary function, and albumin and blood urea
nitrogen (BUN) are indicators of renal function. Glucose and
triglyceride levels are sometimes altered due to toxicity of a
treatment. Serum glucose also depends in part upon the activity of
SGLT2. The levels of ALT, AST, total bilirubin, albumin, BUN,
glucose and triglyceride were measured in rats treated with the
short antisense compounds. The levels of routine clinical
indicators of liver and kidney injury and disease were within
normal ranges and are not significantly changed relative to
saline-treated animals, demonstrating that the short antisense
compounds do not significantly affect renal or hepatic function.
Triglyceride and glucose levels were not significantly elevated
relative to saline-treated animals.
Example 14
Antisense Inhibition of Mouse and Rat SGLT2 by 1-10-1 MOE
Gapmers
[0951] 1-10-1 MOE gapmer antisense compounds designed to target
different regions of mouse SGLT2 mRNA are shown in Table 64.
TABLE-US-00065 TABLE 64 Composition of Antisense Compounds
Targeting SGLT2 mRNA 5' Target Site 5' Target Site on SEQ ID on SEQ
ID ISIS NO: XXX NO: XXX SEQ NO (mouse) (rat) Motif Sequence (5'-3')
ID NO 370717 2684 152 1-10-1 MOE TAGCCACCAACT 1554 379692 508
1-10-1 MOE TGTTCCAGCCCA 246 379699 1112 1-10-1 MOE GGCATGAGCTTC 281
379702 1525 1-10-1 MOE GCACACAGCTGC 293 381408 3034** 1-10-1 MOE
TACCGAACACCT 1560 **indicates 3 mismatches to a target sequence
[0952] The short antisense compounds were analyzed for their effect
on mouse SGLT2 mRNA levels. Data was taken from three experiments
in which Male 6-week old Balb/c mice were dosed twice per week for
two weeks with 450, 150, or 50 nmol/kg of one of the above 1-10-1
MOE gapmers given by intraperitoneal injection. Mice were
sacrificed 48 hours following last administration and evaluated for
SGLT2 mRNA levels in kidney. Target levels were determined by RT,
real-time PCR as described by other examples herein. PCR results
were normalized to an internal ISIS control. The results are shown
below in Table 65.
TABLE-US-00066 TABLE 65 Antisense inhibition of SGLT2 mRNA in vivo
by 1-10-1 MOE gapmers % change in SGLT2 expression relative to
saline Dose of oligonucleotide ISIS ISIS ISIS ISIS ISIS nmol/kg
370717 379692 379699 379702 381408 450 -65 -80 -80 -75 -- 150 -55
-70 -62.5 -72.5 -- 50 -47.5 -52.5 -42.5 -52.5 --
[0953] These results illustrate that all the 1-10-1 MOE gapmers
except, ISIS 381408, inhibit the expression of SGLT2 in vivo in a
dose-dependent manner in mouse. Activity of ISIS 381408 has been
shown in Rat studies (See Table 65).
Evaluation of 1-10-1 Gapmers in Rat
[0954] The effect of the above 1-10-1gapmers (see Table 64 above)
on rat SGLT2 mRNA levels. Data are taken from four experiments in
which male Sprague-Dawley rats (170-200 g) were dosed twice per
week for three weeks with 250 nmol/kg given by intraperitoneal
injection. Rats were sacrificed 48 hours following last
administration and evaluated for SGLT2 mRNA levels in kidney.
Target levels were determined by RT, real-time PCR as described by
other examples herein. PCR results were normalized to an internal
ISIS control. The results are shown below in Table 66.
TABLE-US-00067 TABLE 66 Antisense inhibition of SGLT2 mRNA in vivo
by 1-10-1 MOE gapmers % change in SGLT2 expression relative to
saline Dose of oligonucleotide ISIS ISIS ISIS ISIS ISIS nmol/kg
370717 379692 379699 379702 381408 250 -70 -85 -75 -25 -5
[0955] These results illustrate that all the 1-10-1 MOE gapmers
inhibit the expression of SGLT2 in in vivo rat studies.
Example 15
Antisense Inhibition of Mouse and Rat SGLT2 Expression by
Additional 1-10-1 and 2-8-2 MOE Gapmers
[0956] 1-10-1 and 2-8-2 MOE gapmer short antisense compounds were
designed to target different regions of the mouse SGLT2 RNA but
have complementarity across species. The short antisense compounds
are shown in Table 67. All short antisense compounds in Table 67
are gapmers 12 nucleotides in length, composed of a central "gap"
segment consisting of 2'-deoxynucleotides, which are flanked on
both sides (5' and 3' directions) by wing segments having
2'-modifications. The wings are composed of 2'-methoxyethyl
(2'-MOE) nucleotides. The internucleoside (backbone) linkages are
phosphorothioate (P.dbd.S) throughout the oligonucleotide. All
cytidine residues are 5-methylcytidines.
TABLE-US-00068 TABLE 67 Short Antisense Compounds Targeting SGLT2
nucleic acid 5' Target Target SEQ ID Gapmer SEQ ID ISIS NO Site
(rat) (rat) Motif Sequence (5'-3') NO 379692 508 1-10-1 MOE
TGTTCCAGCCCA 246 388625 508 1-10-1 MOE TGTTCCAGCCCA 246 379699 1112
1-10-1 MOE GGCATGAGCTTC 281 388626 1112 2-8-2 MOE GGCATGAGCTTC 281
379702 1525 2-8-2 MOE GCACACAGCTGC 293 388627 1525 2-8-2 MOE
GCACACAGCTGC 293
[0957] The short antisense compounds were analyzed for their effect
on mouse SGLT2 mRNA levels in vivo. Data was taken from three
experiments in which male 6-week old Balb/c mice were dosed twice
per week for three weeks with 0.5, 0.1, or 0.02 umol/kg of either a
1-10-1 or 2-8-2 MOE gapmer given by intraperitoneal injection. Mice
were sacrificed 48 hours following last administration and
evaluated for SGLT2 levels in kidney. Target levels were determined
by RT, real-time PCR as described by other examples herein. PCR
results were normalized to an internal ISIS control. The results
are shown below in Table 68.
TABLE-US-00069 TABLE 68 Antisense inhibition of SGLT2 mRNA in vivo
by 1-10-1 and 2-8-2 MOE gapmers % change in SGLT2 expression
relative to saline Dose of ISIS ISIS ISIS ISIS ISIS ISIS
oligonucleotide 379692 388625 379699 388626 379702 388627 umol/kg
1-10-1 2-8-2 1-10-1 2-8-2 1-10-1 2-8-2 0.5 -85 -90 -75 -80 -70 -65
0.1 -75 -88 -60 -60 -65 -50 0.02 -55 -65 -30 -45 -40 -38
[0958] These results illustrate that both the 1-10-1 and 2-8-2 MOE
gapmers inhibit the expression of SGLT2 in vivo in a dose-dependent
manner.
[0959] Mice were further evaluated for total body weight, liver,
spleen and kidney weight. All changes were within the margin of
error of the experiment. No significant changes in body weight were
observed during the treatment or at study termination. No
significant changes in liver or spleen weights were observed.
[0960] The levels of ALT, AST, BUN, transaminases, plasma
creatinine, glucose and triglyceride were measured in mice treated
with the short antisense compounds. The levels of routine clinical
indicators of liver and kidney injury and disease were within
normal ranges and are not significantly changed relative to
saline-treated animals, demonstrating that the short antisense
compounds do not significantly affect renal or hepatic function.
Triglyceride and glucose levels were not significantly elevated
relative to saline-treated animals.
Evaluation of ISIS 379692 1-10-1 MOE Gapmer, ISIS 392170 1-10-1
Methyleneoxy BNA Gapmer, ISIS 388625 2-8-2 MOE Gapmer and ISIS
392173 2-8-2 Methyleneoxy BNA Gapmer in Mice
[0961] The effect of ISIS 379692 1-10-1 MOE gapmer and ISIS 388625
2-8-2 MOE gapmer are compared with the effect of ISIS 392170 1-10-1
Methyleneoxy BNA Gapmer and ISIS 392173 2-8-2 Methyleneoxy BNA
Gapmer (see Table 69) on mouse SGLT2 mRNA levels in vivo. Data are
taken from three experiments in which male 6-week old Balb/c mice
were dosed twice per week for three weeks with 5, 25 and 125
nmol/kg of either the ISIS 379692 1-10-1 MOE gapmer or the ISIS
388625 2-8-2 MOE gapmer given by intraperitoneal injection. Mice
were sacrificed 48 hours following last administration and
evaluated for SGLT2 mRNA levels in kidney. Target levels were
determined by RT, real-time PCR as described by other examples
herein. PCR results were normalized to an internal ISIS control.
The data are expressed as percent change ("+" indicates an
increase, "-" indicates a decrease) relative to saline treated
animals and are illustrated in Table 69.
TABLE-US-00070 TABLE 69 Antisense inhibition of SGLT2 mRNA in vivo
by a 1-10-1 and a 2-8-2 MOE gapmer ISIS ISIS ISIS 392170 392173
Dose of 379692 1-10-1 ISIS 2-8-2 oligonucleotide 1-10-1
Methyleneoxy 388625 Methyleneoxy nmol/kg MOE BNA 2-8-2 MOE BNA 125
-58 -69 -70 -75 25 -46 -54 -47 -57 5 -7 -23 -18 -44
[0962] These results illustrate that both the 1-10-1 and 2-8-2 MOE
gapmer inhibit the expression of SGLT2 in vivo at the highest three
dosing ranges in a dose-dependent manner. The results also
illustrate that the Methyleneoxy BNA constructs are more potent
then the MOE constructs. No significant changes in body weight were
observed during the treatment or at study termination. No
significant changes in liver or spleen weights were observed. The
toxicity parameters including levels of ALT, AST, BUN, and
creatinine were within normal ranges and are not significantly
changed relative to saline-treated animals, demonstrating that the
compounds do not significantly affect renal or hepatic
function.
Evaluation of ISIS 379692 1-10-1 MOE Gapmer and ISIS 388625 2-8-2
MOE Gapmer in Rat
[0963] The effect of ISIS 379692 1-10-1 MOE gapmer and ISIS 388625
MOE 2-8-2 gapmer (see Table 70) on rat SGLT2 mRNA levels in vivo.
Data are taken from four experiments in which male Sprague-Dawley
rats (170-200 g) were dosed twice per week for three weeks with
200, 50, 12.5, or 3.125 nmol/kg of either the ISIS 379692 1-10-1
MOE gapmer or the ISIS 388625 2-8-2 MOE gapmer given by
intraperitoneal injection. Rats were sacrificed 48 hours following
last administration and evaluated for SGLT2 levels in kidney.
Target levels were determined by RT, real-time PCR as described by
other examples herein. PCR results were normalized to an internal
ISIS control. The results are shown below in Table 70.
TABLE-US-00071 TABLE 70 Antisense inhibition of SGLT2 mRNA in vivo
by a 1-10-1 and a 2-8-2 MOE gapmer % change in SGLT2 expression
relative to saline ISIS ISIS Dose of oligonucleotide 379692 388625
umol/kg 1-10-1 2-8-2 200 -80 -80 50 -65 -65 12.5 -15 -15 3.125 +30
+25
[0964] These results illustrate that both the 1-10-1 and 2-8-2 MOE
gapmer inhibit the expression of SGLT2 in vivo at the highest three
dosing ranges in a dose-dependent manner.
[0965] Rats were further evaluated for total body weight, liver,
spleen and kidney weight. All changes were within the margin of
error of the experiment. No significant changes in body weight were
observed during the treatment or at study termination. No
significant changes in liver or spleen weights were observed.
[0966] The levels of ALT, AST, BUN, cholesterol, plasma creatinine
and triglycerides were measured in rats treated with the short
antisense compounds. The levels of routine clinical indicators of
liver and kidney injury and disease were within normal ranges and
are not significantly changed relative to saline-treated animals,
demonstrating that the short antisense compounds do not
significantly affect renal or hepatic function.
Example 16
Antisense Inhibition of SGLT2 Expression in ZDF Rat
[0967] ISIS 388625, 388626 and control oligo ISIS 388628 were
analyzed for their effect on ZDF rat plasma glucose levels and
HbA1c. The leptin receptor deficient Zucker diabetic fatty (ZDF)
rat is a useful model for the investigation of type 2 diabetes.
Diabetes develops spontaneously in these male rats at ages 8-10
weeks, and is associated with hyperphagia, polyuria, polydipsia,
and impaired weight gain, symptoms which parallel the clinical
symptoms of diabetes (Phillips M S, et al., 1996, Nat Genet. 13,
18-19). Six week old ZDF rats were injected intraperitoneally with
short antisense compound at a dose of 400 nM/kg once a week for
twelve weeks. Data are illustrated in Tables 71 and 72.
TABLE-US-00072 TABLE 71 Plasma glucose Plasma glucose Seq levels
recorded ISIS ID on specific dates (mg/dl) NO. NO Sequence (5'-3')
Motif Day 10 Day 40 Day 55 Day 66 PBS n/a n/a 450.7 478.5 392.8
526.2 388625 246 TGTTCCAGCCCA 2-8-2 MOE 435.5 278.7 213.8 325.5
388626 281 GGCATGAGCTTC 2-8-2 MOE 434.7 300.5 219.8 379.8 388628
226 TAGCCGCCCACA 2-8-2 MOE 436.0 502.0 411.2 668.8
TABLE-US-00073 TABLE 72 HbA1c Status Percentage HbA1c on specific
dates (%) Seq p < 0.001 ID Sequence Day ISIS NO. NO (5'-3')
Motif 40 Day 55 Day 68 PBS n/a n/a 8.0 8.9 10.0 388625 246
TGTTCCAGCCCA 2-8-2 MOE 6.5 5.8 4.3 388626 281 GGCATGAGCTTC 2-8-2
MOE 6.6 5.9 4.0 388628 226 TAGCCGCCCACA 2-8-2 MOE 8.0 9.1 7.8
[0968] ISIS 388625 and 388626 significantly reduced plasma glucose
levels and HbA1C compared to PBS and control treated animals.
Example 17
Antisense Inhibition of SGLT2 Expression in Dog Kidney (ISIS
388625)
[0969] ISIS 388625 is a 2-8-2 MOE Gapmer with sequence TGTTCCAGCCCA
(SEQ ID NO: 246) (e.g. see Table 71). The effect of ISIS 388625 on
dog SGLT2 mRNA levels. Data are taken from two dosing groups in
which a total of nine male beagle dogs were dosed with either one
or ten mg/kg/week of ISIS or saline given by subcutaneous injection
twice weekly. On day 46 of the study all dogs were sacrificed and
evaluated for SGLT2 levels in kidney. Target levels were determined
by quantitative RT, real-time PCR as described by other examples
herein. PCR results were normalized to an internal ISIS control.
The results are shown below in Table 73.
TABLE-US-00074 TABLE 73 Antisense inhibition of SGLT2 mRNA in vivo
by ISIS 388625 % change in SGLT2 expression Dose of oligonucleotide
Relative to saline mg/kg/wk ISIS 388625 1 -85 10 -95
[0970] These results illustrate that greater than 80% reduction of
SGLT2 mRNA can be achieved at a 1 mg/kg/wk dose of ISIS 388625.
Even greater reduction can be achieved at slightly higher doses.
Administration of ISIS 388625 in dog was also shown to improve
glucose tolerance. Peak plasma glucose levels were decreased by
over 50% on average and the subsequent drop in glucose was lessened
compared to saline controls in a standard glucose tolerance test.
Urinary glucose excretion was also increased.
Example 18
In Vivo Testing of Short Antisense Compounds Targeted to SGLT2
Nucleic Acid
[0971] Twenty 1-10-1 MOE gapmers that are complementary to
human/monkey/mouse/rat SGLT2 were designed, synthesized and tested
in vivo for suppression of SGLT2 mRNA levels in kidney. Target
sites for mouse and rat are indicated in Table 74. Target sites for
human are indicated in Tables 4 and 5. Data are averages from two
experiments in which male 6-week old Balb/c mice were administered
intraperitoneal injections of 350 nmol/kg of oligonucleotide, twice
per week, over a period of two weeks (a total of four injections).
Mice were sacrificed 48 hours following the last administration and
evaluated for SGLT2 mRNA levels in kidney. SGLT2 mRNA levels were
determined by quantitative real-time PCR analysis according to
standard procedures, using two different PCR primer probe sets,
primer probe set (PPS) 534 and PPS 553. SGLT2 mRNA levels were
normalized to cyclophilin mRNA levels, which were also measured by
quantitative real-time PCR. The results are shown below in Table
74.
TABLE-US-00075 TABLE 74 Antisense inhibition of SGLT2 in vivo 5'
Target 5' Target Site on Site on SEQ ID SEQ ID PPS PPS SEQ ISIS NO:
XXX NO: XXX 534 553 ID NO (mouse) (rat) Sequence (5'-3') Motif %
Saline % Saline NO PBS N/A -- -- 370717 2684 152 TAGCCACCAACT
1-10-1 -84.4 -84.3 1554 MOE 379684 2070 64 TGTCAGCAGGAT 1-10-1
-45.0 -43.2 214 MOE 379685 2103 97 TGACCAGCAGGA 1-10-1 -10.3 -20.5
219 MOE 379686 2121* 115 ACCACAAGCCAA 1-10-1 -71.9 -75.1 225 MOE
379687 2824 216 GATGTTGCTGGC 1-10-1 -47.1 -52.1 230 MOE 379688 2876
268 CCAAGCCACTTG 1-10-1 -62.6 -70.4 240 MOE 379689 298 AGAGCGCATTCC
1-10-1 -17.5 -30.4 241 MOE 379690 415 ACAGGTAGAGGC 1-10-1 -18.9
-22.5 242 MOE 379691 454 AGATCTTGGTGA 1-10-1 -35.0 -48.6 243 MOE
379692 508 TGTTCCAGCCCA 1-10-1 -88.1 -88.5 246 MOE 379693 546
CATGGTGATGCC 1-10-1 -51.6 -59.9 254 MOE 379694 609 GACGAAGGTCTG
1-10-1 -42.1 -54.4 264 MOE 379695 717 GGACACCGTCAG 1-10-1 -52.5
-64.1 266 MOE 379696 954 CAGCTTCAGGTA 1-10-1 -24.6 -36.2 267 MOE
379697 982 CTGGCATGACCA 1-10-1 -32.0 -46.3 272 MOE 379698 1071
GCAGCCCACCTC 1-10-1 -11.8 -27.0 275 MOE 379699 1112 GGCATGAGCTTC
1-10-1 -83.5 -85.8 281 MOE 379700 1138 CCAGCATGAGTC 1-10-1 -2.8
-16.4 285 MOE 379701 1210 CCATGGTGAAGA 1-10-1 -0.3 -11.9 288 MOE
379702 1525 GCACACAGCTGC 1-10-1 -87.8 -89.5 293 MOE 379703 1681
GCCGGAGACTGA 1-10-1 -44.2 -45.9 295 MOE *indicates 1 or 2
mismatches to a target sequence
Example 19
Antisense Inhibition of Human PCSK9 in Hep3B Cells
[0972] Short antisense compounds targeted to a PCSK9 nucleic acid
were tested for their effects on PCSK9 mRNA in vitro. The short
antisense compounds are presented in Table 6. The Isis No, gapmer
motif and SEQ ID NO of each short antisense compound are shown
again in Table 75. Cultured Hep3B cells were treated with 100 nM of
short antisense compound. 5-10-5 MOE gapmers targeted to a PCSK9
nucleic acid were used as positive controls. After the treatment
period, RNA was isolated from the cells and PCSK9 mRNA levels were
measured by quantitative real-time PCR, as described herein. PCSK9
mRNA levels were adjusted according to total RNA content as
measured by RIBOGREEN.RTM.. Results are presented in Table 75 as
percent inhibition of PCSK9 (% Inhib), relative to untreated
control cells. In the "% nhib" column, a "0" indicates that no
reduction of PCSK9 mRNA was observed with that particular short
antisense compound.
TABLE-US-00076 TABLE 75 Antisense inhibition of PCSK9 by short
antisense compounds 5' 3' Target Target Site on Site on % ISIS SEQ
ID SEQ ID SEQ ID Gapmer Inhibition % No. NO NO: 4 NO: 4 Motif Range
Inhib 400297 329 695 708 2-10-2 MOE 0 400298 330 696 709 2-10-2 MOE
0 400299 331 697 710 2-10-2 MOE 0 400300 332 742 755 2-10-2 MOE 9
400301 333 757 770 2-10-2 MOE 20-30% 27 400302 334 828 841 2-10-2
MOE 0 400303 335 829 842 2-10-2 MOE 0 400304 336 830 843 2-10-2 MOE
10-20% 11 400305 337 937 950 2-10-2 MOE 30-40% 38 400306 338 952
965 2-10-2 MOE 40-50% 40 400307 339 988 1001 2-10-2 MOE 70-80% 76
400308 340 989 1002 2-10-2 MOE 50-60% 55 400309 341 990 1003 2-10-2
MOE 40-50% 44 400310 342 991 1004 2-10-2 MOE 8 400311 343 992 1005
2-10-2 MOE 10-20% 18 400312 344 993 1006 2-10-2 MOE 20-30% 28
400313 345 994 1007 2-10-2 MOE 10-20% 10 400314 346 1057 1070
2-10-2 MOE 20-30% 26 400315 347 1075 1088 2-10-2 MOE 0 400316 348
1076 1089 2-10-2 MOE 8 400317 349 1077 1090 2-10-2 MOE 7 400318 350
1078 1091 2-10-2 MOE 20-30% 26 400319 351 1093 1106 2-10-2 MOE 0
400320 352 1094 1107 2-10-2 MOE 0 400321 353 1095 1108 2-10-2 MOE 0
400322 354 1096 1109 2-10-2 MOE 0 400323 355 1147 1160 2-10-2 MOE 0
400324 356 1255 1268 2-10-2 MOE 7 400325 357 1334 1347 2-10-2 MOE 4
400326 358 1335 1348 2-10-2 MOE 0 400327 359 1336 1349 2-10-2 MOE
30-40% 36 400328 360 1453 1466 2-10-2 MOE 10-20% 13 400329 361 1454
1467 2-10-2 MOE 10-20% 14 400330 362 1455 1468 2-10-2 MOE 40-50% 43
400331 363 1456 1469 2-10-2 MOE 30-40% 35 400332 364 1569 1582
2-10-2 MOE 0 400333 365 1570 1583 2-10-2 MOE 0 400334 366 1571 1584
2-10-2 MOE 0 400335 367 1572 1585 2-10-2 MOE 0 400336 368 1573 1586
2-10-2 MOE 4 400337 369 1574 1587 2-10-2 MOE 0 400338 370 1575 1588
2-10-2 MOE 9 400339 371 1576 1589 2-10-2 MOE 0 400340 372 1577 1590
2-10-2 MOE 0 400341 373 1578 1591 2-10-2 MOE 0 400342 374 1621 1634
2-10-2 MOE 0 400343 375 1622 1635 2-10-2 MOE 0 400344 376 1623 1636
2-10-2 MOE 0 400345 377 1624 1637 2-10-2 MOE 0 400346 378 1738 1751
2-10-2 MOE 5 400347 379 1739 1752 2-10-2 MOE 0 400348 380 1740 1753
2-10-2 MOE 0 400349 381 1741 1754 2-10-2 MOE 10-20% 13 400350 382
1834 1847 2-10-2 MOE 10-20% 15 400351 383 1835 1848 2-10-2 MOE
10-20% 14 400352 384 1836 1849 2-10-2 MOE 20-30% 29 400353 385 1837
1850 2-10-2 MOE 10-20% 19 400354 386 1838 1851 2-10-2 MOE 10-20% 19
400355 387 1839 1852 2-10-2 MOE 0 400356 388 1840 1853 2-10-2 MOE 0
400357 389 2083 2096 2-10-2 MOE 0 400358 390 2084 2097 2-10-2 MOE
10-20% 12 400359 391 2085 2098 2-10-2 MOE 0 400360 392 2086 2099
2-10-2 MOE 30-40% 38 400361 393 2316 2329 2-10-2 MOE 2 400362 394
2317 2330 2-10-2 MOE 10-20% 16 400363 395 2318 2331 2-10-2 MOE 8
400364 396 2319 2332 2-10-2 MOE 0 400365 397 2320 2333 2-10-2 MOE
20-30% 25 400366 398 2321 2334 2-10-2 MOE 10-20% 15 400367 399 2322
2335 2-10-2 MOE 10-20% 12 400368 400 2323 2336 2-10-2 MOE 10-20% 11
400369 401 2324 2337 2-10-2 MOE 0 400370 402 2325 2338 2-10-2 MOE
10-20% 13 400371 403 3543 3556 2-10-2 MOE 0
[0973] As illustrated in Table 75, short antisense compounds
targeted to a PCSK9 nucleic acid, having a 2-10-2 MOE gapmer motif,
reduced PCSK9 mRNA in cultured cells.
[0974] Short antisense compounds targeted to a PCSK9 nucleic acid
were tested in a dose response experiment Hep3B cells. Cells were
treated as described herein with nM concentrations of short
antisense compound as indicated in Tables 76. After the treatment
period, RNA was isolated from the cells and PCSK9 mRNA levels were
measured by quantitative real-time PCR, as described herein. PCSK9
mRNA levels were normalized to cyclophilin mRNA levels, as measured
by real-time PCR using a cyclophilin-specific primer probe set.
Results are presented as percent inhibition of PCSK9, relative to
untreated control cells. Also shown is the EC.sub.50 (concentration
at which 50% reduction of mRNA is observed) for each short
antisense compound tested in the dose response experiment, as
calculated using Graphpad Prism. As illustrated in the following
table, PCSK9 mRNA levels were reduced in a dose-dependent
manner.
TABLE-US-00077 TABLE 76 Dose-dependent antisense inhibition of
PCSK9 by short antisense compounds % Inhibition 160 nM 80 nM 40 nM
20 nM 10 nM 5 nM 5-10-5 95 96 85 78 58 38 400307 93 92 56 45 39 35
400308 86 77 40 26 10 31 400309 78 72 12 38 23 49 400327 55 43 49
23 37 5 400330 71 82 69 40 32 8 400331 82 75 63 47 40 29 400352 64
63 44 40 16 7 400353 48 54 43 23 27 15
Example 20
Antisense Inhibition of PCSK9 by Short Antisense Compounds
Comprising BNAs
[0975] Short antisense compounds targeted to a PCSK9 nucleic acid
were tested in dose response experiments, in both mouse and human
cultured cells. The compounds tested included ISIS 403739 and ISIS
403740. ISIS 403739 is a short antisense compound consisting of the
nucleotide sequence of SEQ ID NO: 404 and having a 2-10-2 gapmer
motif, where the nucleotides in the wings comprise (6'S)-6'methyl
BNA. ISIS 403740 is a short antisense compound consisting of the
nucleotide sequence of SEQ ID NO: 405 and having a 2-10-2 gapmer
motif, where the nucleotides in the wings comprise (6'S)-6'methyl
BNA. Also tested was a 5-10-5 MOE gapmer targeted to a PCSK9
nucleic acid.
[0976] Mouse hepatocytes were plated and treated as described
herein with nM concentrations of short antisense compound as
indicated in Table 77. After the treatment period, RNA was isolated
from the cells and PCSK9 mRNA levels were measured by quantitative
real-time PCR, as described herein. PCSK9 mRNA levels were
normalized to cyclophilin mRNA levels, as measured by real-time PCR
using a cyclophilin-specific primer probe set. Results are
presented as percent inhibition of PCSK9, relative to untreated
control cells. Where present, "0" indicates no observed reduction
in PCSK9 mRNA. ISIS 403739 exhibited dose-dependent reduction of
mouse PCSK9 mRNA at the doses of 30 nM and higher. ISIS 403740
exhibited reduction of mouse PCSK9 mRNA at the two highest doses of
short antisense compound.
TABLE-US-00078 TABLE 77 Antisense inhibition of mouse PCSK9 by
short antisense compounds comprising BNAs % Inhibition 3.75 nM 7.5
nM 15 nM 30 nM 60 nM 120 nM 240 nM 5-10-5 10 15 21 18 44 43 77
403739 40 19 29 29 32 49 57 403740 3 0 29 13 0 40 33
[0977] Human Hep3B cells were treated with mM concentrations of
short antisense compound as described herein. After the treatment
period, RNA was isolated from the cells and PCSK9 mRNA levels were
measured by quantitative real-time PCR, as described herein. PCSK9
mRNA levels were normalized to cyclophilin mRNA levels, as measured
by real-time PCR using a cyclophilin-specific primer probe set.
Results are presented as percent inhibition of PCSK9, relative to
untreated control cells. The data are shown in Table 78 and
demonstrate a dose-dependent reduction in human PCSK9 mRNA
following treatment with ISIS 403740. ISIS 403739 exhibited
dose-dependent reduction at higher doses.
TABLE-US-00079 TABLE 78 Antisense inhibition of mouse PCSK9 by
short antisense compounds comprising BNAs % Inhibition 2.5 nM 5 nM
10 nM 20 nM 40 nM 80 nM 160 nM 5-10-5 7 2 21 33 30 59 71 403739 10
5 7 6 25 52 65 403740 6 12 16 29 45 48 59
Example 21
Antisense Inhibition of GCGR in HepG2 Cells
[0978] Short antisense compounds targeted to a GCGR nucleic acid
were tested for their effects on GCGR mRNA in vitro.
HepG2 Cells
[0979] Cultured HepG2 cells at a density of 10000 cells per well in
a 96-well plate were treated as described herein with 25, 50, 100
or 200 nM of antisense oligonucleotide. After the treatment period,
RNA was isolated from the cells and GCGR mRNA levels were measured
by quantitative real-time PCR, as described herein. GCGR mRNA
levels were adjusted according to total RNA content as measured by
RIBOGREEN.RTM.. Results are presented as percent reduction in GCGR
mRNA, relative to untreated control cells.
[0980] Table 79 presents data following treatment with the
indicated doses of ISIS 327161, a 3-10-3 MOE gapmer. ISIS 327161
reduced GCGR mRNA in a dose-dependent manner.
TABLE-US-00080 TABLE 79 Antisense inhibition of GCGR in HepG2 cells
by a short antisense compound ISIS Seq ID Gapmer NO. NO Sequence
(5'-3') Motif 25 nM 50 nM 100 nM 200 nM 327161 520 AGCTGCTGTACATC
3-8-3 -36 -30 -33 -64 MOE
Monkey Hepatocytes
[0981] Additional short antisense compounds targeted to a GCGR
nucleic acid were tested for their effects on monkey GCGR mRNA in
vitro. Cultured primary monkey hepatocytes were treated as
described herein with 25, 50, 100 or 200 nM of short antisense
compound. After the treatment period, RNA was isolated from the
cells and GCGR mRNA levels were measured by quantitative real-time
PCR, as described herein. GCGR mRNA levels were adjusted according
to total RNA content as measured by RIBOGREEN.RTM.. Results are
presented in Table 80 as percent reduction in GCGR mRNA, relative
to untreated control cells.
TABLE-US-00081 TABLE 80 Antisense inhibition of GCGR in primary
monkey hepatocytes by short antisense compounds ISIS Seq ID Gapmer
NO. NO Sequence (5'-3') Motif 25 nM 50 nM 100 nM 200 nM 327131 489
ATGTTGGCCGTGGT 3-8-3 0 -8 -36 -36 MOE 327161 520 AGCTGCTGTACATC
3-8-3 -19 -33 -55 -54 MOE
Example 22
Antisense Inhibition of DGAT2 by Short Antisense Compounds
[0982] Short antisense compounds targeted to a DGAT2 nucleic acid
were tested for their effects on DGAT2 mRNA in vitro. Cultured A10
cells in a 96-well plate were treated with 75 nM of short antisense
compound. After a treatment period of approximately 24 hours, RNA
was isolated from the cells and DGAT2 mRNA levels were measured by
quantitative real-time PCR, as described herein. DGAT2 mRNA levels
were adjusted according to total RNA content as measured by
RIBOGREEN.RTM.. Results are presented as percent inhibition of
DGAT2, relative to untreated control cells in Table 81.
TABLE-US-00082 TABLE 81 Antisense inhibition of DGAT2 in A10 cells
ISIS Seq ID % NO. NO Sequence (5'-3') Gapmer Motif Control 372491
795 ACATGAGGATGACACT 3-10-3 MOE 80 372500 702 GTGTGTCTTCACCAGC
3-10-3 MOE 16 372501 704 TTGTGTGTCTTCACCA 3-10-3 MOE 28 372503 708
GCAGGTTGTGTGTCTT 3-10-3 MOE 35 372508 719 AGTTCCTGGTGGTCAG 3-10-3
MOE 35 372516 805 TACAGAAGGCACCCAG 3-10-3 MOE 27 372524 738
GCCAGGCATGGAGCTC 3-10-3 MOE 21 372530 746 TCGGCCCCAGGAGCCC 3-10-3
MOE 35 372546 825 TTGGTCTTGTGATTGT 3-10-3 MOE 34 372563 691
AGCCAGGTGACAGA 2-10-2 MOE 48 372569 796 CATGAGGATGACAC 2-10-2 MOE
104 372578 703 TGTGTCTTCACCAG 2-10-2 MOE 59 372580 707
GGTTGTGTGTCTTC 2-10-2 MOE 48 372586 720 GTTCCTGGTGGTCA 2-10-2 MOE
40 372594 806 ACAGAAGGCACCCA 2-10-2 MOE 77 372602 739
CCAGGCATGGAGCT 2-10-2 MOE 39 372618 765 GTGGTACAGGTCGA 2-10-2 MOE
29 372624 826 TGGTCTTGTGATTG 2-10-2 MOE 56
[0983] Additional short antisense compounds targeted to DGAT2 mRNA
were tested in vitro in a dose-response experiment. A10 cells were
prepared as described above and treated with 6.25, 12.5, 25.0,
50.0, 100.0, and 200.0 nM short antisense compounds to determine if
DGAT2 inhibition occurs in a dose-dependent manner. The data
demonstrate that each of the short antisense compounds presented in
Table 82 reduces rat DGAT2 mRNA in a dose-dependent manner. Results
are presented as percent inhibition, relative to untreated control
cells. A "0" indicates that DGAT2 mRNA was not reduced.
TABLE-US-00083 TABLE 82 Dose-Dependent Inhibition of DGAT2 in A10
cells Seq ISIS ID Gapmer NO. NO Sequence (5'-3') Motif 6.25 nM 12.5
nM 25.0 nM 50.0 nM 100.0 nM 200.0 nM 372562 784 GTCTTGGAGGGCCG
2-10-2 0 0 0 36 48 75 MOE 372568 794 GACACTGCAGGCCA 2-10-2 0 0 15
26 72 69 MOE 372586 720 GTTCCTGGTGGTCA 2-10-2 19 0 7 22 45 77 MOE
372602 739 CCAGGCATGGAGCT 2-10-2 0 0 0 18 47 76 MOE 372618 765
GTGGTACAGGTCGA 2-10-2 0 5 0 27 65 80 MOE
[0984] Additional short antisense compounds targeted to DGAT2 mRNA
were tested in vitro. A10 cells were prepared as described above
and treated with 0.62, 1.85, 5.56, 16.67, 50.0, and 150.0 nM short
antisense compounds to determine if DGAT2 inhibition occurs in a
dose-dependent manner. DGAT2 mRNA was measured using quantitative
real-time PCR, as described herein. The data demonstrate that each
of the short antisense compounds presented in Table 83 below
inhibit rat DGAT2 mRNA in a dose-dependent manner. Results are
presented as percent inhibition of rat DGAT2, relative to untreated
control cells. Where present, "0" indicates that no reduction in
DGAT2 mRNA was observed.
TABLE-US-00084 TABLE 83 Dose-Dependent Inhibition of DGAT2 in A10
cells Seq ISIS ID Gapmer NO. NO Sequence (5'-3') Motif 0.62 nM 1.85
nM 5.56 nM 16.67 nM 50 nM 150 nM 372500 702 GTGTGTCTTCACCAGC 3-10-3
0 0 0 18 64 88 MOE 372501 704 TTGTGTGTCTTCACCA 3-10-3 1 5 10 11 25
68 MOE 372503 708 GCAGGTTGTGTGTCTT 3-10-3 7 10 4 25 54 80 MOE
372508 719 AGTTCCTGGTGGTCAG 3-10-3 0 0 6 14 39 71 MOE 372516 805
TACAGAAGGCACCCAG 3-10-3 1 10 0 4 35 81 MOE 372524 738
GCCAGGCATGGAGCTC 3-10-3 7 0 5 30 68 91 MOE 372530 746
TCGGCCCCAGGAGCCC 3-10-3 0 2 0 10 38 78 MOE 372546 825
TTGGTCTTGTGATTGT 3-10-3 0 2 11 4 48 78 MOE 372563 691
AGCCAGGTGACAGA 2-10-2 0 0 0 1 4 46 MOE 372578 703 TGTGTCTTCACCAG
2-10-2 0 0 0 2 7 42 MOE 372580 707 GGTTGTGTGTCTTC 2-10-2 0 5 5 3 16
42 MOE 372586 720 GTTCCTGGTGGTCA 2-10-2 0 0 0 0 7 55 MOE 372594 806
ACAGAAGGCACCCA 2-10-2 0 0 0 0 2 15 MOE 372602 739 CCAGGCATGGAGCT
2-10-2 0 0 10 0 19 51 MOE 372618 765 GTGGTACAGGTCGA 2-10-2 0 0 0 0
30 60 MOE 372624 826 TGGTCTTGTGATTG 2-10-2 0 0 0 1 16 38 MOE
Example 23
Antisense Inhibition of Human PTP1B in HuVEC Cells
[0985] Short antisense compounds targeted to a PTP1B nucleic acid
were tested for their effects on PTP1B mRNA in vitro. Cultured
HuVEC cells at a density of 5000 cells per well in a 96-well plate
were treated as described herein with 3 nM of short antisense
compound. After the treatment period, RNA was isolated from the
cells and PTP1B mRNA levels were measured by quantitative real-time
PCR, as described herein. PTP1B mRNA levels were adjusted according
to total RNA content as measured by RIBOGREEN.RTM.. Results are
presented as percent inhibition of PTP1B (% Inhib), relative to
untreated control cells. The data demonstrated that short antisense
compounds targeted to a PTP1B nucleic acid and having a 2-10-2
gapmer motif can inhibit PTP1B in HuVEC cells in Table 84.
TABLE-US-00085 TABLE 84 Antisense inhibition of PTP1B in HuVEC
cells by short antisense compounds ISIS NO. SEQ ID NO Gapmer Motif
% Inhib 399301 1542 2-10-2 OMe 55 404137 1053 2-10-2 MOE 76 404138
1054 2-10-2 MOE 76 404139 1052 2-10-2 MOE 80 404140 1051 2-10-2 MOE
73
Example 24
Antisense Inhibition of Human PTP1B in HepG2 Cells
[0986] Short antisense compounds targeted to a PTP1B nucleic acid
were tested for their effects on PTP1B mRNA in vitro. Cultured
HepG2 cells at a density of 10000 cells per well in a 96-well plate
were treated with 25 nM of antisense oligonucleotide. After the
treatment period, RNA was isolated from the cells and PTP1B mRNA
levels were measured by quantitative real-time PCR, as described
herein. PTP1B mRNA levels were adjusted according to total RNA
content as measured by RIBOGREEN.RTM.. Results are presented as
percent inhibition (% Ihib) of PTP1B, relative to untreated control
cells. The data demonstrated that short antisense compounds
targeted to a PTP1B nucleic acid and having a 2-10-2 gapmer motif
can inhibit PTP1B in HepG2 cells in Table 85.
TABLE-US-00086 TABLE 85 Antisense inhibition of PTP1B in HepG2
cells by short antisense compounds ISIS NO. SEQ ID NO Gapmer Motif
% Inhib 399301 1542 2-10-2 OMe 43 404137 1053 2-10-2 MOE 71 404138
1054 2-10-2 MOE 86 404139 1052 2-10-2 MOE 45 404140 1051 2-10-2 MOE
93
Example 25
Antisense Inhibition of PTP1B in HuVEC Cells: Dose Response
Experiment
[0987] Human vascular endothelial (HuVEC) cells were plated at a
density of 5000 cells per well and treated as described herein with
nM concentrations of short antisense compound as indicated in Table
86. After the treatment period, RNA was isolated from the cells and
PTP1B mRNA levels were measured by quantitative real-time PCR, as
described herein. PTP1B mRNA levels were adjusted according to
total RNA content as measured by RIBOGREEN.RTM.. Two different
human PTP1B primer probe sets were used to measure mRNA levels.
Results with Primer Probe Set (PPS) 198 are shown in Table 86, and
results with Primer Probe Set (PPS) 3000 are shown in Table 87.
Results are presented as percent inhibition of PTP1B mRNA
expression relative to untreated control cells. Where present, "0"
indicates that no PTP1B mRNA reduction was observed. As illustrated
in Tables 86 and 87, PTP1B mRNA levels were reduced in a
dose-dependent manner.
TABLE-US-00087 TABLE 86 Dose Response for Human PTP1B in HuVEC
cells, using PPS 198 % Inhibition Seq ID Gapmer 1.11 10.0 ISIS NO.
NO Motif nM 3.33 nM nM 30.0 nM 398105 1066 2-10-2 MOE 0 25 79 90
398112 1072 2-10-2 MOE 1 10 73 93 398120 1086 2-10-2 MOE 0 31 80 96
399096 1544 2-10-2 MOE 3 30 78 96 399102 1545 2-10-2 MOE 0 15 62 88
399113 1547 2-10-2 MOE 0 31 72 90 399132 1548 2-10-2 MOE 0 32 75 95
399173 1549 2-10-2 MOE 0 24 63 89 399208 1550 2-10-2 MOE 0 37 86 93
399276 1551 2-10-2 MOE 0 8 61 89 399301 1542 2-10-2 MOE 8 63 91 97
399315 1552 2-10-2 MOE 0 20 68 88 398173 1543 1-10-1 MOE 0 4 80
97
TABLE-US-00088 TABLE 87 Dose Response for Human PTP1B in HuVEC
cells, using PPS 3000 % Inhibition Seq ID Gapmer 1.11 10.0 ISIS NO.
NO Motif nM 3.33 nM nM 30.0 nM 398105 1066 2-10-2 MOE 0 35 79 93
398112 1072 2-10-2 MOE 0 26 77 94 398120 1086 2-10-2 MOE 0 35 79 93
399096 1544 2-10-2 MOE 0 23 75 94 399102 1545 2-10-2 MOE 0 9 60 87
399113 1547 2-10-2 MOE 0 9 65 90 399132 1548 2-10-2 MOE 0 26 76 91
399173 1549 2-10-2 MOE 0 11 59 92 399208 1550 2-10-2 MOE 0 47 85 96
399276 1551 2-10-2 MOE 0 14 64 86 399301 1542 2-10-2 MOE 16 65 93
99 399315 1552 2-10-2 MOE 0 25 71 93 398173 1543 1-10-1 MOE 0 18 80
90
Example 26
Antisense Inhibition of ApoB by Short Antisense Compounds
[0988] The short antisense compounds shown in Table 88 were tested
for their effects in vivo. Six-week old male Balb/c mice (Jackson
Laboratory, Bar Harbor, Me.) were administered intraperitoneal
doses of 3.2, 1, 0.32, or 0.1 umol/kg, twice per week for three
weeks. A 5-10-5 MOE gapmer was used for a control treatment. Mice
were sacrificed approximately 48 hours following the final dose.
Liver tissue was collected for RNA isolation, and blood was
collected for serum chemistry analyses. ApoB mRNA levels were
measured by real-time PCR as described herein. ApoB mRNA levels
were normalized to RNA levels as determined by RIBOGREEN, and are
presented in Table 89 as percent inhibition relative to ApoB mRNA
levels in saline-treated control animals.
TABLE-US-00089 TABLE 88 Short Antisense Compounds Targeting an ApoB
nucleic acid ISIS SEQ NO Sequence (5'-3') Gapmer Motif ID NO 387462
GGTACATGGAAGTC 2-10-2 Methyleneoxy 190 BNA 398296 GGTACATGGAAGTC
2-10-2 190 6'-(S)-methyl Methyleneoxy BNA
TABLE-US-00090 TABLE 89 Antisense inhibition of ApoB by Short
Antisense Compounds Comprising BNA Dose Isis No (umol/kg) % Inhib
379818 1 56 387462 0.1 33 0.32 57 1 93 3.2 99 398296 0.1 17 0.32 35
1 80 3.2 98
[0989] Table 89 shows that ApoB mRNA levels were reduced in a
dose-dependent manner following treatment with short antisense
compounds having a 2-10-2 gapmer motif and BNA modifications in the
wings. At the 1 umol/kg dose, ApoB inhibition by the short
antisense compounds was greater than observed with a 5-10-5 MOE
gapmer at an equivalent dose. Cholesterol was reduced at the 1 and
3.2 umol/kg doses of short antisense compound.
[0990] The short antisense compounds exhibited little to no adverse
side effects, as judged by organ and body weights, serum
transaminases, bilirubin, blood urea nitrogen, and creatinine.
Example 27
Antisense Inhibition of PTEN by Short Antisense Compounds
[0991] The short antisense compounds shown in Table 90 were tested
for their effects in vivo. Six-week old male Balb/c mice (Jackson
Laboratory, Bar Harbor, Me.) were administered intraperitoneal
doses of 3.2, 1, 0.32, or 0.1 umol/kg, twice per week for three
weeks. A 5-10-5 MOE gapmer was used for a control treatment. Mice
were sacrificed approximately 48 hours following the final dose.
Liver tissue was collected for RNA isolation, and blood was
collected for serum chemistry analyses. PTEN mRNA levels were
measured by real-time PCR as described herein. PTEN mRNA levels
were normalized to RNA levels as determined by RIBOGREEN, and are
presented in Table 91 as percent inhibition relative to PTEN mRNA
levels in saline-treated control animals.
TABLE-US-00091 TABLE 90 Short Antisense Compounds targeted to a
PTEN nucleic acid ISIS SEQ NO Sequence (5'-3') Gapmer Motif ID NO
392063 AGGCCAGTGCTAAG 2-10-2 Methyleneoxy 1226 BNA 392749
AGGCCAGTGCTAAG 2-10-2 1226 (6'S)-6'-methyl Methyleneoxy BNA 396006
AGGCCAGTGCTAAG 2-10-2 1226 alpha-L-methyleneoxy BNA
TABLE-US-00092 TABLE 91 Antisense inhibition of PTEN by short
antisense compounds comprising BNA modifications Dose Isis No
(umol/kg) % Inhib 116847 1 47 392063 0.1 26 0.32 43 1 74 3.2 96
392749 0.1 17 0.32 34 1 64 3.2 96 396006 0.1 20 0.32 32 1 67 3.2
88
[0992] Table 91 shows that PTEN mRNA levels were reduced in a
dose-dependent manner following treatment with short antisense
compounds having a 2-10-2 gapmer motif and BNA modifications in the
wings. At the 1 umol/kg dose, PTEN inhibition by the short
antisense compounds was greater than observed with a 5-10-5 MOE
gapmer at an equivalent dose.
[0993] With the exception of the highest dose of ISIS 392063, no
significant increases in serum transaminases were observed.
Overall, the short antisense compounds exhibited little to no
adverse side effects.
Example 28
Single Dose Administration of Short Antisense Compounds Comprising
BNA Modifications
[0994] Six-week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were administered a single intraperitoneal injection
of short antisense compound at a dose of 8, 4, 2 or 1 p.mu.mol/kg.
The short antisense compounds tested were ISIS 387462 and ISIS
398296. Each dose group consisted of four animals. A 5-10-5 MOE
gapmer was used for a control treatment. Mice were sacrificed
approximately 48 hours following the final dose. Liver tissue was
collected for RNA isolation, and blood was collected for serum
chemistry analyses. ApoB mRNA levels were measured by real-time PCR
as described herein. ApoB mRNA levels were normalized to RNA levels
as determined by RIBOGREEN, and are presented in Table 92 as
percent inhibition relative to ApoB mRNA levels in saline-treated
control animals.
TABLE-US-00093 TABLE 92 Antisense inhibition of ApoB by Short
Antisense Compounds Comprising BNA Dose Isis No (umol/kg) % Inhib
379818 8 77 387462 8 99 4 93 2 81 1 58 398296 8 97 4 81 2 54 1
19
[0995] Table 92 shows that ApoB mRNA levels were reduced in a
dose-dependent manner following a single administration of short
antisense compounds having a 2-10-2 gapmer motif and BNA
modifications in the wings. At the 8 umol/kg dose, ApoB inhibition
by the short antisense compounds was greater than observed with a
5-10-5 MOE gapmer at an equivalent dose. The ED.sub.50 of ISIS
387462 was 3.9 mg/kg, and the ED.sub.50 of ISIS 398296 was 8.7
mg/kg. Cholesterol was also reduced in a dose-dependent manner.
Triglycerides were reduced at the highest dose.
[0996] The short antisense compounds exhibited little to no adverse
side effects, as judged by organ and body weights, serum
transaminases, bilirubin, blood urea nitrogen, and creatinine.
[0997] In a similar single dose administration study, ISIS 392748,
having SEQ ID NO: 1226, a 2-10-2 gapmer motif, where the
nucleotides of the wings comprise (6'R)-6'-methyl methyleneoxy BNA
modifications, reduced PTEN mRNA in a dose-dependent manner.
Additionally, ISIS 392749, having SEQ ID NO: 1226, a 2-10-2 gapmer
motif, where the nucleotides of the wings comprise (6'S)-6'-methyl
methyleneoxy BNA modifications, reduced PTEN mRNA in a
dose-dependent manner. A short antisense compound having 2-10-2
gapmer motifs, the sequence of SEQ ID NO: 1226, and
6-(S)--CH.sub.2--O--CH.sub.3-BNA modifications also reduced PTEN
mRNA in a similar in vivo study. A short antisense compound having
2-10-2 gapmer motifs, the sequence of SEQ ID NO: 1226, and
6-(R)--CH.sub.2--O--CH.sub.3-BNA modifications also reduced PTEN
mRNA in a similar in vivo study.
Example 29
Single Dose Administration of Short Antisense Compounds Comprising
BNA Modifications
[0998] Six-week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were administered a single intraperitoneal injection
of antisense compound at a dose of 8, 4, 2 or 1 p.mu.mol/kg. Each
dose group consisted of four animals. The compounds tested were
ISIS 392063, ISIS 392749, and ISIS 366006. A 5-10-5 MOE gapmer was
used for a control treatment. Mice were sacrificed approximately 48
hours following the final dose. Liver tissue was collected for RNA
isolation, and blood was collected for serum chemistry analyses.
ApoB mRNA levels were measured by real-time PCR as described
herein. ApoB mRNA levels were normalized to RNA levels as
determined by RIBOGREEN, and are presented in Table 93 as percent
inhibition relative to ApoB mRNA levels in saline-treated control
animals.
TABLE-US-00094 TABLE 93 Antisense inhibition of PTEN by short
antisense compounds comprising BNA modifications Dose Isis No
(umol/kg) % Inhib 116847 8 62 392063 8 92 4 82 2 58 1 38 396565 8
76 4 38 2 24 1 11 396006 8 94 4 82 2 48 1 18
[0999] Table 93 shows that PTEN mRNA levels were reduced in a
dose-dependent manner following treatment with short antisense
compounds having a 2-10-2 gapmer motif and BNA modifications in the
wings. At the 8 umol/kg dose, PTEN inhibition by the short
antisense compounds was greater than observed with a 5-10-5 MOE
gapmer at an equivalent dose. The estimated ED.sub.50s were 7 mg/kg
for ISIS 392063, 17.4 mg/kg for ISIS 396565, and 9.3 mg/kg for ISIS
396006.
[1000] With the exception of the highest dose of ISIS 392063, no
significant increases in serum transaminases were observed.
Overall, the short antisense compounds exhibited little to no
adverse side effects.
Example 30
Antisense Inhibition of ApoB by Short Antisense Compounds
Comprising Palmitic Acid Conjugates
[1001] Six-week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were administered a single intraperitoneal injection
of antisense compound at a dose of 2.5, 1.0. 0.4, and 0.16 umol/kg.
Each dose group consisted of four animals. The compounds tested are
shown in Table 94. A 5-10-5 MOE gapmer was used for a control
treatment. Mice were sacrificed approximately 48 hours following
the final dose. Liver tissue was collected for RNA isolation, and
blood was collected for serum chemistry analyses. ApoB mRNA levels
were measured by real-time PCR as described herein. ApoB mRNA
levels were normalized to RNA levels as determined by RIBOGREEN,
and are presented in Table 95 as percent inhibition relative to
ApoB mRNA levels in saline-treated control animals.
TABLE-US-00095 TABLE 94 Short antisense compounds comprising
palmitic conjugates ISIS SEQ NO Sequence (5'-3') Gapmer Motif ID NO
387462 GGTACATGGAAGTC 2-10-2 Methyleneoxy BNA 190 391871
GGTACATGGAAGTC 1-1-10-2 2'-(butylacetomido)- 190
palmitamide/MOE/MOE Unmodified cytosines in gap (i.e., 2-10-2 MOE
with 2'- (butylacetomido)-palmitamide substituted at 5' nucleotide
391872 GGTACATGGAAGTC 1-1-10-2 2'-(butylacetomido)- 190 palmitamide
Methyleneoxy BNA/Methyleneoxy BNA Unmodified cytosines in gap
(i.e., 2-10-2 methyleneoxy BNA with 2'-(butylacetomido)-
palmitamide substituted at 5' nucleotide)
TABLE-US-00096 TABLE 95 Antisense inhibition by short antisense
compounds comprising palmitic acid conjugates Dose Isis No
(umol/kg) % Inhib 5-10-5 2.5 54 387462 2.5 99 1.0 91 0.4 65 0.16 16
391871 2.5 49 1.0 18 0.4 5 0.16 0 391872 2.5 99 1.0 92 0.4 50 0.16
18
[1002] Table 95 shows that ApoB mRNA levels were reduced in a
dose-dependent manner following treatment with short antisense
compounds having a palmitic acid (C16) conjugate. At the 2.5
umol/kg dose, ApoB inhibition by the short antisense compounds was
greater than observed with a 5-10-5 MOE gapmer at an equivalent
dose. In this study, the estimated ED.sub.50s were 1.5 mg/kg for
ISIS 387462, 13.1 mg/kg for ISIS 391871, and 1.9 mg/kg for ISIS
391872. The estimated ED.sub.50 for the 5-10-5 MOE gapmer was 17.4
mg/kg. Triglycerides were reduced at the 2.5 and 1.0 mg/kg doses of
ISIS 387462 and ISIS 391872. ISIS 387462 and ISIS 391872 markedly
reduced total cholesterol, HDL-C and LDL-C in a dose-dependent
manner; reduction in LDL-C was so marked that it fell below the
limit of detection. Overall, the short antisense compounds
exhibited little to no adverse effects.
Example 31
Antisense Inhibition of PCSK9 In Vivo by Short Antisense Compounds
Comprising BNA Modifications
[1003] Six-week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were administered a single intraperitoneal injection
of antisense compound at a dose of 15, 4.7, 1.5 and 0.47 umol/kg of
ISIS 403739 or 403740. Each dose group consisted of four animals. A
5-10-5 MOE gapmer was used for a control treatment. Mice were
sacrificed approximately 72 hours following the final dose. Liver
tissue was collected for RNA isolation, and blood was collected for
serum chemistry analyses. PCSK9 mRNA levels were measured by
real-time PCR as described herein. PCSK9 mRNA levels were
normalized to cyclophilin mRNA levels as determined by real-time
PCR. ISIS 403739 reduced PCSK9 mRNA by approximately 70%, relative
to saline controls. ISIS 403740 reduced PCSK9 by approximately 13%
relative to saline controls, however, the reduction was not
statistically significant. The lower doses did not significantly
reduce PCSK9 mRNA. Overall, the short antisense compounds exhibited
little to no adverse side effects.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20090292006A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20090292006A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References