U.S. patent application number 12/334197 was filed with the patent office on 2009-10-08 for rna interference mediated inhibition of tnf and tnf receptor gene expression using short interfering nucleic acid (sina).
This patent application is currently assigned to Sirna Therapeutics, Inc.. Invention is credited to Leonid Beigelman, James McSwiggen.
Application Number | 20090253773 12/334197 |
Document ID | / |
Family ID | 46332080 |
Filed Date | 2009-10-08 |
United States Patent
Application |
20090253773 |
Kind Code |
A1 |
McSwiggen; James ; et
al. |
October 8, 2009 |
RNA INTERFERENCE MEDIATED INHIBITION OF TNF AND TNF RECEPTOR GENE
EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
Abstract
This invention relates to compounds, compositions, and methods
useful for modulating tumor necrosis factor and/or tumor necrosis
factor receptor gene expression using short interfering nucleic
acid (siNA) molecules. This invention also relates to compounds,
compositions, and methods useful for modulating the expression and
activity of other genes involved in pathways of tumor necrosis
factor and/or tumor necrosis factor receptor gene expression and/or
activity by RNA interference (RNAi) using small nucleic acid
molecules. In particular, the instant invention features small
nucleic acid molecules, such as short interfering nucleic acid
(siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA),
micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and
methods used to modulate the expression of tumor necrosis factor
and/or tumor necrosis factor receptor genes, (TNF and/or TNF
receptor).
Inventors: |
McSwiggen; James; (Boulder,
CO) ; Beigelman; Leonid; (San Mateo, CA) |
Correspondence
Address: |
Sirna Therapeutics, Inc.
1700 Owens Street, 4th Floor
San Francisco
CA
94158
US
|
Assignee: |
Sirna Therapeutics, Inc.
San Francisco
CA
|
Family ID: |
46332080 |
Appl. No.: |
12/334197 |
Filed: |
December 12, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10923470 |
Aug 20, 2004 |
|
|
|
12334197 |
|
|
|
|
PCT/US03/04741 |
Feb 20, 2003 |
|
|
|
10923470 |
|
|
|
|
PCT/US04/16390 |
May 24, 2004 |
|
|
|
10923470 |
|
|
|
|
10826966 |
Apr 16, 2004 |
|
|
|
PCT/US04/16390 |
|
|
|
|
10757803 |
Jan 14, 2004 |
|
|
|
10826966 |
|
|
|
|
10720448 |
Nov 24, 2003 |
|
|
|
10757803 |
|
|
|
|
10693059 |
Oct 23, 2003 |
|
|
|
10720448 |
|
|
|
|
10444853 |
May 23, 2003 |
|
|
|
10693059 |
|
|
|
|
PCT/US03/05346 |
Feb 20, 2003 |
|
|
|
10444853 |
|
|
|
|
PCT/US03/05028 |
Feb 20, 2003 |
|
|
|
PCT/US03/05346 |
|
|
|
|
60429359 |
Nov 26, 2002 |
|
|
|
60358580 |
Feb 20, 2002 |
|
|
|
60363124 |
Mar 11, 2002 |
|
|
|
60386782 |
Jun 6, 2002 |
|
|
|
60406784 |
Aug 29, 2002 |
|
|
|
60408378 |
Sep 5, 2002 |
|
|
|
60409293 |
Sep 9, 2002 |
|
|
|
60440129 |
Jan 15, 2003 |
|
|
|
60358580 |
Feb 20, 2002 |
|
|
|
60363124 |
Mar 11, 2002 |
|
|
|
60386782 |
Jun 6, 2002 |
|
|
|
60406784 |
Aug 29, 2002 |
|
|
|
60408378 |
Sep 5, 2002 |
|
|
|
60409293 |
Sep 9, 2002 |
|
|
|
60440129 |
Jan 15, 2003 |
|
|
|
60543480 |
Feb 10, 2004 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/24.5 |
Current CPC
Class: |
A61P 37/00 20180101;
C12N 15/1136 20130101; C12N 2310/14 20130101; C07H 21/02 20130101;
C12N 15/1138 20130101 |
Class at
Publication: |
514/44.A ;
536/24.5 |
International
Class: |
A61K 31/7105 20060101
A61K031/7105; C07H 21/02 20060101 C07H021/02 |
Claims
1. A chemically modified nucleic acid molecule, wherein: (a) the
nucleic acid molecule comprises a sense strand and a separate
antisense strand, each strand having one or more pyrimidine
nucleotides and one or more purine nucleotides; (b) each strand of
the nucleic acid molecule is independently 18 to 27 nucleotides in
length; (c) an 18 to 27 nucleotide sequence of the antisense strand
is complementary to a human tumor necrosis factor (TNF) receptor
RNA sequence comprising SEQ ID NO: 373; (d) an 18 to 27 nucleotide
sequence of the sense strand is complementary to the antisense
strand and comprises an 18 to 27 nucleotide sequence of the human
TNF receptor RNA sequence; and (e) 50 percent or more of the
nucleotides in at least one strand comprise a 2-sugar modification,
wherein the 2'-sugar modification of any of the pyrimidine
nucleotides differs from the 2'-sugar modification of any of the
purine nucleotides.
2. The nucleic acid molecule of claim 1, wherein 50 percent or more
of the nucleotides in each strand comprise a 2'-sugar
modification.
3. The nucleic acid molecule of claim 1, wherein the 2'-sugar
modification is selected from the group consisting of
2'-deoxy-2'-fluoro, 2'-O-methyl, and 2'-deoxy.
4. The nucleic acid of claim 3, wherein the 2'-deoxy-2'-fluoro
sugar modification is a pyrimidine modification.
5. The nucleic acid of claim 3, wherein the 2'-deoxy sugar
modification is a pyrimidine modification.
6. The nucleic acid of claim 3, wherein the 2'-O-methyl sugar
modification is a pyrimidine modification.
7. The nucleic acid molecule of claim 4, wherein said pyrimidine
modification is in the sense strand, the antisense strand, or both
the sense strand and antisense strand.
8. The nucleic acid molecule of claim 6, wherein said pyrimidine
modification is in the sense strand, the antisense strand, or both
the sense strand and antisense strand.
9. The nucleic acid molecule of claim 3, wherein the 2'-deoxy sugar
modification is a purine modification.
10. The nucleic acid molecule of claim 3, wherein the 2'-O-methyl
sugar modification is a purine modification.
11. The nucleic acid molecule of claim 9, wherein the purine
modification is in the sense strand.
12. The nucleic acid molecule of claim 10, wherein the purine
modification is in the antisense strand.
13. The nucleic acid molecule of claim 1, wherein the nucleic acid
molecule comprises ribonucleotides.
14. The nucleic acid molecule of claim 1, wherein the sense strand
includes a terminal cap moiety at the 5'-end, the 3'-end, or both
of the 5'- and 3'-ends.
15. The nucleic acid molecule of claim 14, wherein the terminal cap
moiety is an inverted deoxy abasic moiety.
16. The nucleic acid molecule of claim 1, wherein said nucleic acid
molecule includes one or more phosphorothioate internucleotide
linkages.
17. The nucleic acid molecule of claim 16, wherein one of the
phosphorothioate internucleotide linkages is at the 3'-end of the
antisense strand.
18. The nucleic acid molecule of claim 1, wherein the 5'-end of the
antisense strand includes a terminal phosphate group.
19. The nucleic acid molecule of claim 1, wherein the sense strand,
the antisense strand, or both the sense strand and the antisense
strand include a 3'-overhang.
20. A composition comprising the nucleic acid molecule of claim 1,
in a pharmaceutically acceptable carrier or diluent.
Description
[0001] This application is a continuation of U.S. patent
application Ser. No. 10/923,470, filed Aug. 20, 2004, which is a
continuation-in-part of International Patent Application No.
PCT/US03/04741, filed Feb. 20, 2003, which claims the benefit of
U.S. Provisional Application No. 60/429,359, filed Nov. 26, 2002.
The parent application Ser. No. 10/923,470 is also a
continuation-in-part of International Patent Application No.
PCT/US04/16390, filed May 24, 2004, which is a continuation-in-part
of U.S. patent application Ser. No. 10/826,966, filed Apr. 16, 2004
(now abandoned), which is continuation-in-part of U.S. patent
application Ser. No. 10/757,803, filed Jan. 14, 2004, which is a
continuation-in-part of U.S. patent application Ser. No.
10/720,448, filed Nov. 24, 2003 (now abandoned), which is a
continuation-in-part of U.S. patent application Ser. No.
10/693,059, filed Oct. 23, 2003, which is a continuation-in-part of
U.S. patent application Ser. No. 10/444,853, filed May 23, 2003,
which is a continuation-in-part of International Patent Application
No. PCT/US03/05346, filed Feb. 20, 2003, and a continuation-in-part
of International Patent Application No. PCT/US03/05028, filed Feb.
20, 2003, both of which claim the benefit of U.S. Provisional
Application No. 60/358,580 filed Feb. 20, 2002, U.S. Provisional
Application No. 60/363,124 filed Mar. 11, 2002, U.S. Provisional
Application No. 60/386,782 filed Jun. 6, 2002, U.S. Provisional
Application No. 60/406,784 filed Aug. 29, 2002, U.S. Provisional
Application No. 60/408,378 filed Sep. 5, 2002, U.S. Provisional
Application No. 60/409,293 filed Sep. 9, 2002, and U.S. Provisional
Application No. 60/440,129 filed Jan. 15, 2003. The parent
application Ser. No. 10/923,470 also claims the benefit of U.S.
Provisional Application No. 60/543,480, filed Feb. 10, 2004. The
instant application claims the benefit of all the listed
applications, which are hereby incorporated by reference herein in
their entireties, including the drawings.
SEQUENCE LISTING
[0002] The sequence listing submitted via EFS, in compliance with
37 CFR .sctn. 1.52(e)(5), is incorporated herein by reference. The
sequence listing text file submitted via EFS contains the file
"SequenceListing46USCNT", created on Dec. 12, 2008, which is
113,635 bytes in size.
FIELD OF THE INVENTION
[0003] The present invention relates to compounds, compositions,
and methods for the study, diagnosis, and treatment of traits,
diseases and conditions that respond to the modulation of tumor
necrosis factor (TNF) superfamily genes and tumor necrosis factor
receptor superfamily gene expression and/or activity. The present
invention is also directed to compounds, compositions, and methods
relating to traits, diseases and conditions that respond to the
modulation of expression and/or activity of genes involved in TNF
superfamily and/or TNF receptor superfamily gene expression
pathways or other cellular processes that mediate the maintenance
or development of such traits, diseases and conditions.
Specifically, the invention relates to small nucleic acid
molecules, such as short interfering nucleic acid (siNA), short
interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA
(miRNA), and short hairpin RNA (shRNA) molecules capable of
mediating RNA interference (RNAi) against TNF superfamily and/or
TNF receptor superfamily gene expression. Such small nucleic acid
molecules are useful, for example, in providing compositions for
treatment of traits, diseases and conditions that can respond to
modulation of TNF superfamily and/or TNF receptor superfamily
expression in a subject, such as cancer, proliferative,
inflammatory, respiratory, neurological, cardiovascular and/or
autoimmune diseases, disorders, or conditions.
BACKGROUND OF THE INVENTION
[0004] The following is a discussion of relevant art pertaining to
RNAi. The discussion is provided only for understanding of the
invention that follows. The summary is not an admission that any of
the work described below is prior art to the claimed invention.
[0005] RNA interference refers to the process of sequence-specific
post-transcriptional gene silencing in animals mediated by short
interfering RNAs (siRNAs) (Zamore et al., 2000, Cell, 101, 25-33;
Fire et al., 1998, Nature, 391, 806; Hamilton et al., 1999,
Science, 286, 950-951; Lin et al., 1999, Nature, 402, 128-129;
Sharp, 1999, Genes & Dev., 13:139-141; and Strauss, 1999,
Science, 286, 886). The corresponding process in plants (Heifetz et
al., International PCT Publication No. WO 99/61631) is commonly
referred to as post-transcriptional gene silencing or RNA silencing
and is also referred to as quelling in fungi. The process of
post-transcriptional gene silencing is thought to be an
evolutionarily-conserved cellular defense mechanism used to prevent
the expression of foreign genes and is commonly shared by diverse
flora and phyla (Fire et al., 1999, Trends Genet., 15, 358). Such
protection from foreign gene expression may have evolved in
response to the production of double-stranded RNAs (dsRNAs) derived
from viral infection or from the random integration of transposon
elements into a host genome via a cellular response that
specifically destroys homologous single-stranded RNA or viral
genomic RNA. The presence of dsRNA in cells triggers the RNAi
response through a mechanism that has yet to be fully
characterized. This mechanism appears to be different from other
known mechanisms involving double stranded RNA-specific
ribonucleases, such as the interferon response that results from
dsRNA-mediated activation of protein kinase PKR and
2',5'-oligoadenylate synthetase resulting in non-specific cleavage
of mRNA by ribonuclease L (see for example U.S. Pat. Nos.
6,107,094; 5,898,031; Clemens et al., 1997, J. Interferon &
Cytokine Res., 17, 503-524; Adah et al., 2001, Curr. Med. Chem., 8,
1189).
[0006] The presence of long dsRNAs in cells stimulates the activity
of a ribonuclease III enzyme referred to as dicer (Bass, 2000,
Cell, 101, 235; Zamore et al., 2000, Cell, 101, 25-33; Hammond et
al., 2000, Nature, 404, 293). Dicer is involved in the processing
of the dsRNA into short pieces of dsRNA known as short interfering
RNAs (siRNAs) (Zamore et al., 2000, Cell, 101, 25-33; Bass, 2000,
Cell, 101, 235; Berstein et al., 2001, Nature, 409, 363). Short
interfering RNAs derived from dicer activity are typically about 21
to about 23 nucleotides in length and comprise about 19 base pair
duplexes (Zamore et al., 2000, Cell, 101, 25-33; Elbashir et al.,
2001, Genes Dev., 15, 188). Dicer has also been implicated in the
excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from
precursor RNA of conserved structure that are implicated in
translational control (Hutvagner et al., 2001, Science, 293, 834).
The RNAi response also features an endonuclease complex, commonly
referred to as an RNA-induced silencing complex (RISC), which
mediates cleavage of single-stranded RNA having sequence
complementary to the antisense strand of the siRNA duplex. Cleavage
of the target RNA takes place in the middle of the region
complementary to the antisense strand of the siRNA duplex (Elbashir
et al., 2001, Genes Dev., 15, 188).
[0007] RNAi has been studied in a variety of systems. Fire et al.,
1998, Nature, 391, 806, were the first to observe RNAi in C.
elegans. Bahramian and Zarbl, 1999, Molecular and Cellular Biology,
19, 274-283 and Wianny and Goetz, 1999, Nature Cell Biol., 2, 70,
describe RNAi mediated by dsRNA in mammalian systems. Hammond et
al., 2000, Nature, 404, 293, describe RNAi in Drosophila cells
transfected with dsRNA. Elbashir et al., 2001, Nature, 411, 494 and
Tuschl et al., International PCT Publication No. WO 01/75164,
describe RNAi induced by introduction of duplexes of synthetic
21-nucleotide RNAs in cultured mammalian cells including human
embryonic kidney and HeLa cells. Recent work in Drosophila
embryonic lysates (Elbashir et al., 2001, EMBO J., 20, 6877 and
Tuschl et al., International PCT Publication No. WO 01/75164) has
revealed certain requirements for siRNA length, structure, chemical
composition, and sequence that are essential to mediate efficient
RNAi activity. These studies have shown that 21-nucleotide siRNA
duplexes are most active when containing 3'-terminal dinucleotide
overhangs. Furthermore, complete substitution of one or both siRNA
strands with 2'-deoxy (2'-H) or 2'-O-methyl nucleotides abolishes
RNAi activity, whereas substitution of the 3'-terminal siRNA
overhang nucleotides with 2'-deoxy nucleotides (2'-H) was shown to
be tolerated. Single mismatch sequences in the center of the siRNA
duplex were also shown to abolish RNAi activity. In addition, these
studies also indicate that the position of the cleavage site in the
target RNA is defined by the 5'-end of the siRNA guide sequence
rather than the 3'-end of the guide sequence (Elbashir et al.,
2001, EMBO J., 20, 6877). Other studies have indicated that a
5'-phosphate on the target-complementary strand of a siRNA duplex
is required for siRNA activity and that ATP is utilized to maintain
the 5'-phosphate moiety on the siRNA (Nykanen et al., 2001, Cell,
107, 309).
[0008] Studies have shown that replacing the 3'-terminal nucleotide
overhanging segments of a 21-mer siRNA duplex having two-nucleotide
3'-overhangs with deoxyribonucleotides does not have an adverse
effect on RNAi activity. Replacing up to four nucleotides on each
end of the siRNA with deoxyribonucleotides has been reported to be
well tolerated, whereas complete substitution with
deoxyribonucleotides results in no RNAi activity (Elbashir et al.,
2001, EMBO J., 20, 6877 and Tuschl et al., International PCT
Publication No. WO 01/75164). In addition, Elbashir et al., supra,
also report that substitution of siRNA with 2'-O-methyl nucleotides
completely abolishes RNAi activity. Li et al., International PCT
Publication No. WO 00/44914, and Beach et al., International PCT
Publication No. WO 01/68836 preliminarily suggest that siRNA may
include modifications to either the phosphate-sugar backbone or the
nucleoside to include at least one of a nitrogen or sulfur
heteroatom, however, neither application postulates to what extent
such modifications would be tolerated in siRNA molecules, nor
provides any further guidance or examples of such modified siRNA.
Kreutzer et al., Canadian Patent Application No. 2,359,180, also
describe certain chemical modifications for use in dsRNA constructs
in order to counteract activation of double-stranded RNA-dependent
protein kinase PKR, specifically 2'-amino or 2'-methyl nucleotides,
and nucleotides containing a 2'-O or 4'-C methylene bridge.
However, Kreutzer et al. similarly fails to provide examples or
guidance as to what extent these modifications would be tolerated
in dsRNA molecules.
[0009] Parrish et al., 2000, Molecular Cell, 6, 1077-1087, tested
certain chemical modifications targeting the unc-22 gene in C.
elegans using long (>25 nt) siRNA transcripts. The authors
describe the introduction of thiophosphate residues into these
siRNA transcripts by incorporating thiophosphate nucleotide analogs
with T7 and T3 RNA polymerase and observed that RNAs with two
phosphorothioate modified bases also had substantial decreases in
effectiveness as RNAi. Further, Parrish et al. reported that
phosphorothioate modification of more than two residues greatly
destabilized the RNAs in vitro such that interference activities
could not be assayed. Id. at 1081. The authors also tested certain
modifications at the 2'-position of the nucleotide sugar in the
long siRNA transcripts and found that substituting deoxynucleotides
for ribonucleotides produced a substantial decrease in interference
activity, especially in the case of Uridine to Thymidine and/or
Cytidine to deoxy-Cytidine substitutions. Id. In addition, the
authors tested certain base modifications, including substituting,
in sense and antisense strands of the siRNA, 4-thiouracil,
5-bromouracil, 5-iodouracil, and 3-(aminoallyl)uracil for uracil,
and inosine for guanosine. Whereas 4-thiouracil and 5-bromouracil
substitution appeared to be tolerated, Parrish reported that
inosine produced a substantial decrease in interference activity
when incorporated in either strand. Parrish also reported that
incorporation of 5-iodouracil and 3-(aminoallyl)uracil in the
antisense strand resulted in a substantial decrease in RNAi
activity as well.
[0010] The use of longer dsRNA has been described. For example,
Beach et al., International PCT Publication No. WO 01/68836,
describes specific methods for attenuating gene expression using
endogenously-derived dsRNA. Tuschl et al., International PCT
Publication No. WO 01/75164, describe a Drosophila in vitro RNAi
system and the use of specific siRNA molecules for certain
functional genomic and certain therapeutic applications; although
Tuschl, 2001, Chem. Biochem., 2, 239-245, doubts that RNAi can be
used to cure genetic diseases or viral infection due to the danger
of activating interferon response. Li et al., International PCT
Publication No. WO 00/44914, describe the use of specific long (141
bp-488 bp) enzymatically synthesized or vector expressed dsRNAs for
attenuating the expression of certain target genes. Zernicka-Goetz
et al., International PCT Publication No. WO 01/36646, describe
certain methods for inhibiting the expression of particular genes
in mammalian cells using certain long (550 bp-714 bp),
enzymatically synthesized or vector expressed dsRNA molecules. Fire
et al., International PCT Publication No. WO 99/32619, describe
particular methods for introducing certain long dsRNA molecules
into cells for use in inhibiting gene expression in nematodes.
Plaetinck et al., International PCT Publication No. WO 00/01846,
describe certain methods for identifying specific genes responsible
for conferring a particular phenotype in a cell using specific long
dsRNA molecules. Mello et al., International PCT Publication No. WO
01/29058, describe the identification of specific genes involved in
dsRNA-mediated RNAi. Pachuck et al., International PCT Publication
No. WO 00/63364, describe certain long (at least 200 nucleotides)
dsRNA constructs. Deschamps Depaillette et al., International PCT
Publication No. WO 99/07409, describe specific compositions
consisting of particular dsRNA molecules combined with certain
anti-viral agents. Waterhouse et al., International PCT Publication
No. 99/53050 and 1998, PNAS, 95, 13959-13964, describe certain
methods for decreasing the phenotypic expression of a nucleic acid
in plant cells using certain dsRNAs. Driscoll et al., International
PCT Publication No. WO 01/49844, describe specific DNA expression
constructs for use in facilitating gene silencing in targeted
organisms.
[0011] Others have reported on various RNAi and gene-silencing
systems. For example, Parrish et al., 2000, Molecular Cell, 6,
1077-1087, describe specific chemically-modified dsRNA constructs
targeting the unc-22 gene of C. elegans. Grossniklaus,
International PCT Publication No. WO 01/38551, describes certain
methods for regulating polycomb gene expression in plants using
certain dsRNAs. Churikov et al., International PCT Publication No.
WO 01/42443, describe certain methods for modifying genetic
characteristics of an organism using certain dsRNAs. Cogoni et al,
International PCT Publication No. WO 01/53475, describe certain
methods for isolating a Neurospora silencing gene and uses thereof.
Reed et al., International PCT Publication No. WO 01/68836,
describe certain methods for gene silencing in plants. Honer et
al., International PCT Publication No. WO 01/70944, describe
certain methods of drug screening using transgenic nematodes as
Parkinson's Disease models using certain dsRNAs. Deak et al.,
International PCT Publication No. WO 01/72774, describe certain
Drosophila-derived gene products that may be related to RNAi in
Drosophila. Arndt et al., International PCT Publication No. WO
01/92513 describe certain methods for mediating gene suppression by
using factors that enhance RNAi. Tuschl et al., International PCT
Publication No. WO 02/44321, describe certain synthetic siRNA
constructs. Pachuk et al., International PCT Publication No. WO
00/63364, and Satishchandran et al., International PCT Publication
No. WO 01/04313, describe certain methods and compositions for
inhibiting the function of certain polynucleotide sequences using
certain long (over 250 bp), vector expressed dsRNAs. Echeverri et
al., International PCT Publication No. WO 02/38805, describe
certain C. elegans genes identified via RNAi. Kreutzer et al.,
International PCT Publications Nos. WO 02/055692, WO 02/055693, and
EP 1144623 B1 describes certain methods for inhibiting gene
expression using dsRNA. Graham et al., International PCT
Publications Nos. WO 99/49029 and WO 01/70949, and AU 4037501
describe certain vector expressed siRNA molecules. Fire et al.,
U.S. Pat. No. 6,506,559, describe certain methods for inhibiting
gene expression in vitro using certain long dsRNA (299 bp-1033 bp)
constructs that mediate RNAi. Martinez et al., 2002, Cell, 110,
563-574, describe certain single stranded siRNA constructs,
including certain 5'-phosphorylated single stranded siRNAs that
mediate RNA interference in Hela cells. Harborth et al., 2003,
Antisense & Nucleic Acid Drug Development, 13, 83-105, describe
certain chemically and structurally modified siRNA molecules. Chiu
and Rana, 2003, RNA, 9, 1034-1048, describe certain chemically and
structurally modified siRNA molecules. Woolf et al., International
PCT Publication Nos. WO 03/064626 and WO 03/064625 describe certain
chemically modified dsRNA constructs.
SUMMARY OF THE INVENTION
[0012] This invention relates to compounds, compositions, and
methods useful for modulating tumor necrosis factor (TNF)
superfamily genes and tumor necrosis factor (TNF) receptor
superfamily gene expression using short interfering nucleic acid
(siNA) molecules. This invention also relates to compounds,
compositions, and methods useful for modulating the expression and
activity of other genes involved in pathways of tumor necrosis
factor (TNF) superfamily genes and tumor necrosis factor (TNF)
receptor superfamily gene expression and/or activity by RNA
interference (RNAi) using small nucleic acid molecules. In
particular, the instant invention features small nucleic acid
molecules, such as short interfering nucleic acid (siNA), short
interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA
(miRNA), and short hairpin RNA (shRNA) molecules and methods used
to modulate the expression of tumor necrosis factor (TNF)
superfamily genes and tumor necrosis factor (TNF) receptor
superfamily genes.
[0013] A siNA of the invention can be unmodified or
chemically-modified. A siNA of the instant invention can be
chemically synthesized, expressed from a vector or enzymatically
synthesized. The instant invention also features various
chemically-modified synthetic short interfering nucleic acid (siNA)
molecules capable of modulating TNF and/or TNF receptor gene
expression or activity in cells by RNA interference (RNAi). The use
of chemically-modified siNA improves various properties of native
siNA molecules through increased resistance to nuclease degradation
in vivo and/or through improved cellular uptake. Further, contrary
to earlier published studies, siNA having multiple chemical
modifications retains its RNAi activity. The siNA molecules of the
instant invention provide useful reagents and methods for a variety
of therapeutic, veterinary, diagnostic, target validation, genomic
discovery, genetic engineering, and pharmacogenomic
applications.
[0014] In one embodiment, the invention features one or more siNA
molecules and methods that independently or in combination modulate
the expression of TNF and/or TNF receptor genes encoding proteins,
such as proteins comprising TNF and/or TNF receptor associated with
the maintenance and/or development of cancer, proliferative,
inflammatory, respiratory, neurological, cardiovascular and/or
autoimmune diseases, traits, conditions and disorders, such as
genes encoding sequences comprising those sequences referred to by
GenBank Accession Nos. shown in Table I, referred to herein
generally as TNF and/or TNF receptor. The description below of the
various aspects and embodiments of the invention is provided with
reference to exemplary TNF receptor gene referred to herein as TNF
receptor. However, the various aspects and embodiments are also
directed to other TNF and/or TNF receptor genes, such as homolog
genes and transcript variants, and polymorphisms (e.g., single
nucleotide polymorphism, (SNPs)) associated with certain TNF and/or
TNF receptor genes. As such, the various aspects and embodiments
are also directed to other genes that are involved in TNF and/or
TNF receptor mediated pathways of signal transduction or gene
expression that are involved, for example, in the maintenance or
development of diseases, traits, or conditions described herein.
These additional genes can be analyzed for target sites using the
methods described for TNF and/or TNF receptor genes herein. Thus,
the modulation of other genes and the effects of such modulation of
the other genes can be performed, determined, and measured as
described herein.
[0015] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a TNF and/or TNF receptor gene, wherein said siNA
molecule comprises about 15 to about 28 base pairs.
[0016] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that directs
cleavage of a TNF and/or TNF receptor RNA via RNA interference
(RNAi), wherein the double stranded siNA molecule comprises a first
and a second strand, each strand of the siNA molecule is about 18
to about 28 nucleotides in length, the first strand of the siNA
molecule comprises nucleotide sequence having sufficient
complementarity to the TNF and/or TNF receptor RNA for the siNA
molecule to direct cleavage of the TNF and/or TNF receptor RNA via
RNA interference, and the second strand of said siNA molecule
comprises nucleotide sequence that is complementary to the first
strand.
[0017] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that directs
cleavage of a TNF and/or TNF receptor RNA via RNA interference
(RNAi), wherein the double stranded siNA molecule comprises a first
and a second strand, each strand of the siNA molecule is about 18
to about 23 nucleotides in length, the first strand of the siNA
molecule comprises nucleotide sequence having sufficient
complementarity to the TNF and/or TNF receptor RNA for the siNA
molecule to direct cleavage of the TNF and/or TNF receptor RNA via
RNA interference, and the second strand of said siNA molecule
comprises nucleotide sequence that is complementary to the first
strand.
[0018] In one embodiment, the invention features a chemically
synthesized double stranded short interfering nucleic acid (siNA)
molecule that directs cleavage of a TNF and/or TNF receptor RNA via
RNA interference (RNAi), wherein each strand of the siNA molecule
is about 18 to about 28 nucleotides in length; and one strand of
the siNA molecule comprises nucleotide sequence having sufficient
complementarity to the TNF and/or TNF receptor RNA for the siNA
molecule to direct cleavage of the TNF and/or TNF receptor RNA via
RNA interference.
[0019] In one embodiment, the invention features a chemically
synthesized double stranded short interfering nucleic acid (siNA)
molecule that directs cleavage of a TNF and/or TNF receptor RNA via
RNA interference (RNAi), wherein each strand of the siNA molecule
is about 18 to about 23 nucleotides in length; and one strand of
the siNA molecule comprises nucleotide sequence having sufficient
complementarity to the TNF and/or TNF receptor RNA for the siNA
molecule to direct cleavage of the TNF and/or TNF receptor RNA via
RNA interference.
[0020] In one embodiment, the invention features a siNA molecule
that down-regulates expression of a TNF and/or TNF receptor gene,
for example, wherein the TNF and/or TNF receptor gene comprises TNF
and/or TNF receptor encoding sequence. In one embodiment, the
invention features a siNA molecule that down-regulates expression
of a TNF and/or TNF receptor gene, for example, wherein the TNF
and/or TNF receptor gene comprises TNF and/or TNF receptor
non-coding sequence or regulatory elements involved in TNF and/or
TNF receptor gene expression.
[0021] In one embodiment, a siNA of the invention is used to
inhibit the expression of TNF and/or TNF receptor genes or a TNF
and/or TNF receptor gene family (e.g., TNF superfamily and/or TNF
receptor superfamily genes), wherein the genes or gene family
sequences share sequence homology. Such homologous sequences can be
identified as is known in the art, for example using sequence
alignments. siNA molecules can be designed to target such
homologous sequences, for example using perfectly complementary
sequences or by incorporating non-canonical base pairs, for example
mismatches and/or wobble base pairs, that can provide additional
target sequences. In instances where mismatches are identified,
non-canonical base pairs (for example, mismatches and/or wobble
bases) can be used to generate siNA molecules that target more than
one gene sequence. In a non-limiting example, non-canonical base
pairs such as UU and CC base pairs are used to generate siNA
molecules that are capable of targeting sequences for differing TNF
and/or TNF receptor targets that share sequence homology. As such,
one advantage of using siNAs of the invention is that a single siNA
can be designed to include nucleic acid sequence that is
complementary to the nucleotide sequence that is conserved between
the homologous genes. In this approach, a single siNA can be used
to inhibit expression of more than one gene instead of using more
than one siNA molecule to target the different genes.
[0022] In one embodiment, the invention features a siNA molecule
having RNAi activity against TNF and/or TNF receptor RNA, wherein
the siNA molecule comprises a sequence complementary to any RNA
having TNF and/or TNF receptor encoding sequence, such as those
sequences having GenBank Accession Nos. shown in Table I.
[0023] In another embodiment, the invention features a siNA
molecule having RNAi activity against TNF and/or TNF receptor RNA,
wherein the siNA molecule comprises a sequence complementary to an
RNA having variant TNF and/or TNF receptor encoding sequence, for
example other mutant TNF and/or TNF receptor genes not shown in
Table I but known in the art to be associated with the maintenance
and/or development of cancer, proliferative, inflammatory,
respiratory, neurological, cardiovascular and/or autoimmune
diseases, disorders, and/or conditions. Chemical modifications as
shown in Tables III and IV or otherwise described herein can be
applied to any siNA construct of the invention. In another
embodiment, a siNA molecule of the invention includes a nucleotide
sequence that can interact with nucleotide sequence of a TNF and/or
TNF receptor gene and thereby mediate silencing of TNF and/or TNF
receptor gene expression, for example, wherein the siNA mediates
regulation of TNF and/or TNF receptor gene expression by cellular
processes that modulate the chromatin structure or methylation
patterns of the TNF and/or TNF receptor gene and prevent
transcription of the TNF and/or TNF receptor gene.
[0024] In one embodiment, siNA molecules of the invention are used
to down regulate or inhibit the expression of TNF and/or TNF
receptor proteins arising from TNF and/or TNF receptor haplotype
polymorphisms that are associated with a disease or condition,
(e.g., cancer, proliferative, inflammatory, respiratory,
neurological, cardiovascular and/or autoimmune diseases, disorders,
and/or conditions). Analysis of TNF and/or TNF receptor genes, or
TNF and/or TNF receptor protein or RNA levels can be used to
identify subjects with such polymorphisms or those subjects who are
at risk of developing traits, conditions, or diseases described
herein. These subjects are amenable to treatment, for example,
treatment with siNA molecules of the invention and any other
composition useful in treating diseases related to TNF and/or TNF
receptor gene expression. As such, analysis of TNF and/or TNF
receptor protein or RNA levels can be used to determine treatment
type and the course of therapy in treating a subject. Monitoring of
TNF and/or TNF receptor protein or RNA levels can be used to
predict treatment outcome and to determine the efficacy of
compounds and compositions that modulate the level and/or activity
of certain TNF and/or TNF receptor proteins associated with a
trait, condition, or disease.
[0025] In one embodiment of the invention a siNA molecule comprises
an antisense strand comprising a nucleotide sequence that is
complementary to a nucleotide sequence or a portion thereof
encoding a TNF and/or TNF receptor protein. The siNA further
comprises a sense strand, wherein said sense strand comprises a
nucleotide sequence of a TNF and/or TNF receptor gene or a portion
thereof.
[0026] In another embodiment, a siNA molecule comprises an
antisense region comprising a nucleotide sequence that is
complementary to a nucleotide sequence encoding a TNF and/or TNF
receptor protein or a portion thereof. The siNA molecule further
comprises a sense region, wherein said sense region comprises a
nucleotide sequence of a TNF and/or TNF receptor gene or a portion
thereof.
[0027] In another embodiment, the invention features a siNA
molecule comprising a nucleotide sequence in the antisense region
of the siNA molecule that is complementary to a nucleotide sequence
or portion of sequence of a TNF and/or TNF receptor gene. In
another embodiment, the invention features a siNA molecule
comprising a region, for example, the antisense region of the siNA
construct, complementary to a sequence comprising a TNF and/or TNF
receptor gene sequence or a portion thereof.
[0028] In one embodiment, the antisense region of TNF receptor siNA
constructs comprises a sequence complementary to sequence having
any of SEQ ID NOs. 1-123, 247-262, 271-278, 287-294, 303-310,
319-326, 351, 353, 355, 357, 358, 360, 362, 364, 366, or 367. In
one embodiment, the antisense region of TNF receptor constructs
comprises sequence having any of SEQ ID NOs. 124-246, 263-270,
279-286, 295-302, 311-318, 327-350, 352, 354, 356, 359, 361, 363,
365, or 368. In another embodiment, the sense region of TNF
receptor constructs comprises sequence having any of SEQ ID NOs.
1-123, 247-262, 271-278, 287-294, 303-310, 319-326, 351, 353, 355,
357, 358, 360, 362, 364, 366, or 367.
[0029] In one embodiment, a siNA molecule of the invention
comprises any of SEQ ID NOs. 1-368. The sequences shown in SEQ ID
NOs. 1-368 are not limiting. A siNA molecule of the invention can
comprise any contiguous TNF and/or TNF receptor sequence (e.g.,
about 15 to about 25 or more, or about 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, or 25 or more contiguous TNF and/or TNF receptor
nucleotides).
[0030] In yet another embodiment, the invention features a siNA
molecule comprising a sequence, for example, the antisense sequence
of the siNA construct, complementary to a sequence or portion of
sequence comprising sequence represented by GenBank Accession Nos.
shown in Table I. Chemical modifications in Tables III and IV and
described herein can be applied to any siNA construct of the
invention.
[0031] In one embodiment of the invention a siNA molecule comprises
an antisense strand having about 15 to about 30 (e.g., about 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30)
nucleotides, wherein the antisense strand is complementary to a RNA
sequence or a portion thereof encoding a TNF and/or TNF receptor
protein, and wherein said siNA further comprises a sense strand
having about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, and wherein
said sense strand and said antisense strand are distinct nucleotide
sequences where at least about 15 nucleotides in each strand are
complementary to the other strand.
[0032] In another embodiment of the invention a siNA molecule of
the invention comprises an antisense region having about 15 to
about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, or 30) nucleotides, wherein the antisense region is
complementary to a RNA sequence encoding a TNF and/or TNF receptor
protein, and wherein said siNA further comprises a sense region
having about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, wherein
said sense region and said antisense region are comprised in a
linear molecule where the sense region comprises at least about 15
nucleotides that are complementary to the antisense region.
[0033] In one embodiment, a siNA molecule of the invention has RNAi
activity that modulates expression of RNA encoded by a TNF and/or
TNF receptor gene. Because TNF and/or TNF receptor (e.g., TNF
superfamily and/or TNF receptor superfamily) genes can share some
degree of sequence homology with each other, siNA molecules can be
designed to target a class of TNF and/or TNF receptor genes or
alternately specific TNF and/or TNF receptor genes (e.g.,
polymorphic variants) by selecting sequences that are either shared
amongst different TNF and/or TNF receptor targets or alternatively
that are unique for a specific TNF and/or TNF receptor target.
Therefore, in one embodiment, the siNA molecule can be designed to
target conserved regions of TNF and/or TNF receptor RNA sequences
having homology among several TNF and/or TNF receptor gene variants
so as to target a class of TNF and/or TNF receptor genes with one
siNA molecule. Accordingly, in one embodiment, the siNA molecule of
the invention modulates the expression of one or both TNF and/or
TNF receptor alleles in a subject. In another embodiment, the siNA
molecule can be designed to target a sequence that is unique to a
specific TNF and/or TNF receptor RNA sequence (e.g., a single TNF
and/or TNF receptor allele or TNF and/or TNF receptor single
nucleotide polymorphism (SNP)) due to the high degree of
specificity that the siNA molecule requires to mediate RNAi
activity.
[0034] In one embodiment, nucleic acid molecules of the invention
that act as mediators of the RNA interference gene silencing
response are double-stranded nucleic acid molecules. In another
embodiment, the siNA molecules of the invention consist of duplex
nucleic acid molecules containing about 15 to about 30 base pairs
between oligonucleotides comprising about 15 to about 30 (e.g.,
about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
or 30) nucleotides. In yet another embodiment, siNA molecules of
the invention comprise duplex nucleic acid molecules with
overhanging ends of about 1 to about 3 (e.g., about 1, 2, or 3)
nucleotides, for example, about 21-nucleotide duplexes with about
19 base pairs and 3'-terminal mononucleotide, dinucleotide, or
trinucleotide overhangs. In yet another embodiment, siNA molecules
of the invention comprise duplex nucleic acid molecules with blunt
ends, where both ends are blunt, or alternatively, where one of the
ends is blunt.
[0035] In one embodiment, the invention features one or more
chemically-modified siNA constructs having specificity for TNF
and/or TNF receptor expressing nucleic acid molecules, such as RNA
encoding a TNF and/or TNF receptor protein. In one embodiment, the
invention features a RNA based siNA molecule (e.g., a siNA
comprising 2'-OH nucleotides) having specificity for TNF and/or TNF
receptor expressing nucleic acid molecules that includes one or
more chemical modifications described herein. Non-limiting examples
of such chemical modifications include without limitation
phosphorothioate internucleotide linkages, 2'-deoxyribonucleotides,
2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides,
"universal base" nucleotides, "acyclic" nucleotides, 5-C-methyl
nucleotides, and terminal glyceryl and/or inverted deoxy abasic
residue incorporation. These chemical modifications, when used in
various siNA constructs, (e.g., RNA based siNA constructs), are
shown to preserve RNAi activity in cells while at the same time,
dramatically increasing the serum stability of these compounds.
Furthermore, contrary to the data published by Parrish et al.,
supra, applicant demonstrates that multiple (greater than one)
phosphorothioate substitutions are well-tolerated and confer
substantial increases in serum stability for modified siNA
constructs.
[0036] In one embodiment, a siNA molecule of the invention
comprises modified nucleotides while maintaining the ability to
mediate RNAi. The modified nucleotides can be used to improve in
vitro or in vivo characteristics such as stability, activity,
and/or bioavailability. For example, a siNA molecule of the
invention can comprise modified nucleotides as a percentage of the
total number of nucleotides present in the siNA molecule. As such,
a siNA molecule of the invention can generally comprise about 5% to
about 100% modified nucleotides (e.g., about 5%, 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 95% or 100% modified nucleotides). The actual percentage of
modified nucleotides present in a given siNA molecule will depend
on the total number of nucleotides present in the siNA. If the siNA
molecule is single stranded, the percent modification can be based
upon the total number of nucleotides present in the single stranded
siNA molecules. Likewise, if the siNA molecule is double stranded,
the percent modification can be based upon the total number of
nucleotides present in the sense strand, antisense strand, or both
the sense and antisense strands.
[0037] One aspect of the invention features a double-stranded short
interfering nucleic acid (siNA) molecule that down-regulates
expression of a TNF and/or a TNF receptor gene. In one embodiment,
the double stranded siNA molecule comprises one or more chemical
modifications and each strand of the double-stranded siNA is about
21 nucleotides long. In one embodiment, the double-stranded siNA
molecule does not contain any ribonucleotides. In another
embodiment, the double-stranded siNA molecule comprises one or more
ribonucleotides. In one embodiment, each strand of the
double-stranded siNA molecule independently comprises about 15 to
about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, or 30) nucleotides, wherein each strand comprises
about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, or 30) nucleotides that are
complementary to the nucleotides of the other strand. In one
embodiment, one of the strands of the double-stranded siNA molecule
comprises a nucleotide sequence that is complementary to a
nucleotide sequence or a portion thereof of the TNF and/or TNF
receptor gene, and the second strand of the double-stranded siNA
molecule comprises a nucleotide sequence substantially similar to
the nucleotide sequence of the TNF and/or TNF receptor gene or a
portion thereof.
[0038] In another embodiment, the invention features a
double-stranded short interfering nucleic acid (siNA) molecule that
down-regulates expression of a TNF and/or TNF receptor gene
comprising an antisense region, wherein the antisense region
comprises a nucleotide sequence that is complementary to a
nucleotide sequence of the TNF and/or TNF receptor gene or a
portion thereof, and a sense region, wherein the sense region
comprises a nucleotide sequence substantially similar to the
nucleotide sequence of the TNF and/or TNF receptor gene or a
portion thereof. In one embodiment, the antisense region and the
sense region independently comprise about 15 to about 30 (e.g.
about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
or 30) nucleotides, wherein the antisense region comprises about 15
to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, or 30) nucleotides that are complementary to
nucleotides of the sense region.
[0039] In another embodiment, the invention features a
double-stranded short interfering nucleic acid (siNA) molecule that
down-regulates expression of a TNF and/or TNF receptor gene
comprising a sense region and an antisense region, wherein the
antisense region comprises a nucleotide sequence that is
complementary to a nucleotide sequence of RNA encoded by the TNF
and/or TNF receptor gene or a portion thereof and the sense region
comprises a nucleotide sequence that is complementary to the
antisense region.
[0040] In one embodiment, a siNA molecule of the invention
comprises blunt ends, i.e., ends that do not include any
overhanging nucleotides. For example, a siNA molecule comprising
modifications described herein (e.g., comprising nucleotides having
Formulae I-VII or siNA constructs comprising "Stab 00"-"Stab 32"
(Table IV) or any combination thereof (see Table IV)) and/or any
length described herein can comprise blunt ends or ends with no
overhanging nucleotides.
[0041] In one embodiment, any siNA molecule of the invention can
comprise one or more blunt ends, i.e. where a blunt end does not
have any overhanging nucleotides. In one embodiment, the blunt
ended siNA molecule has a number of base pairs equal to the number
of nucleotides present in each strand of the siNA molecule. In
another embodiment, the siNA molecule comprises one blunt end, for
example wherein the 5'-end of the antisense strand and the 3'-end
of the sense strand do not have any overhanging nucleotides. In
another example, the siNA molecule comprises one blunt end, for
example wherein the 3'-end of the antisense strand and the 5'-end
of the sense strand do not have any overhanging nucleotides. In
another example, a siNA molecule comprises two blunt ends, for
example wherein the 3'-end of the antisense strand and the 5'-end
of the sense strand as well as the 5'-end of the antisense strand
and 3'-end of the sense strand do not have any overhanging
nucleotides. A blunt ended siNA molecule can comprise, for example,
from about 15 to about 30 nucleotides (e.g., about 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides).
Other nucleotides present in a blunt ended siNA molecule can
comprise, for example, mismatches, bulges, loops, or wobble base
pairs to modulate the activity of the siNA molecule to mediate RNA
interference.
[0042] By "blunt ends" is meant symmetric termini or termini of a
double stranded siNA molecule having no overhanging nucleotides.
The two strands of a double stranded siNA molecule align with each
other without over-hanging nucleotides at the termini. For example,
a blunt ended siNA construct comprises terminal nucleotides that
are complementary between the sense and antisense regions of the
siNA molecule.
[0043] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a TNF and/or TNF receptor gene, wherein the siNA
molecule is assembled from two separate oligonucleotide fragments
wherein one fragment comprises the sense region and the second
fragment comprises the antisense region of the siNA molecule. The
sense region can be connected to the antisense region via a linker
molecule, such as a polynucleotide linker or a non-nucleotide
linker.
[0044] In one embodiment, the invention features double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a TNF and/or TNF receptor gene, wherein the siNA
molecule comprises about 15 to about 30 (e.g. about 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) base pairs, and
wherein each strand of the siNA molecule comprises one or more
chemical modifications. In another embodiment, one of the strands
of the double-stranded siNA molecule comprises a nucleotide
sequence that is complementary to a nucleotide sequence of a TNF
and/or TNF receptor gene or a portion thereof, and the second
strand of the double-stranded siNA molecule comprises a nucleotide
sequence substantially similar to the nucleotide sequence or a
portion thereof of the TNF and/or TNF receptor gene. In another
embodiment, one of the strands of the double-stranded siNA molecule
comprises a nucleotide sequence that is complementary to a
nucleotide sequence of a TNF and/or TNF receptor gene or portion
thereof, and the second strand of the double-stranded siNA molecule
comprises a nucleotide sequence substantially similar to the
nucleotide sequence or portion thereof of the TNF and/or TNF
receptor gene. In another embodiment, each strand of the siNA
molecule comprises about 15 to about 30 (e.g. about 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, and
each strand comprises at least about 15 to about 30 (e.g. about 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30)
nucleotides that are complementary to the nucleotides of the other
strand. The TNF and/or TNF receptor gene can comprise, for example,
sequences referred to in Table I.
[0045] In one embodiment, a siNA molecule of the invention
comprises no ribonucleotides. In another embodiment, a siNA
molecule of the invention comprises ribonucleotides.
[0046] In one embodiment, a siNA molecule of the invention
comprises an antisense region comprising a nucleotide sequence that
is complementary to a nucleotide sequence of a TNF and/or TNF
receptor gene or a portion thereof, and the siNA further comprises
a sense region comprising a nucleotide sequence substantially
similar to the nucleotide sequence of the TNF and/or TNF receptor
gene or a portion thereof. In another embodiment, the antisense
region and the sense region each comprise about 15 to about 30
(e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, or 30) nucleotides and the antisense region comprises at least
about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, or 30) nucleotides that are
complementary to nucleotides of the sense region. The TNF and/or
TNF receptor gene can comprise, for example, sequences referred to
in Table I. In another embodiment, the siNA is a double stranded
nucleic acid molecule, where each of the two strands of the siNA
molecule independently comprise about 15 to about 40 (e.g. about
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
23, 33, 34, 35, 36, 37, 38, 39, or 40) nucleotides, and where one
of the strands of the siNA molecule comprises at least about 15
(e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 or more)
nucleotides that are complementary to the nucleic acid sequence of
the TNF and/or TNF receptor gene or a portion thereof.
[0047] In one embodiment, a siNA molecule of the invention
comprises a sense region and an antisense region, wherein the
antisense region comprises a nucleotide sequence that is
complementary to a nucleotide sequence of RNA encoded by a TNF
and/or TNF receptor gene, or a portion thereof, and the sense
region comprises a nucleotide sequence that is complementary to the
antisense region. In one embodiment, the siNA molecule is assembled
from two separate oligonucleotide fragments, wherein one fragment
comprises the sense region and the second fragment comprises the
antisense region of the siNA molecule. In another embodiment, the
sense region is connected to the antisense region via a linker
molecule. In another embodiment, the sense region is connected to
the antisense region via a linker molecule, such as a nucleotide or
non-nucleotide linker. The TNF and/or TNF receptor gene can
comprise, for example, sequences referred in to Table I.
[0048] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a TNF and/or TNF receptor gene comprising a sense
region and an antisense region, wherein the antisense region
comprises a nucleotide sequence that is complementary to a
nucleotide sequence of RNA encoded by the TNF and/or TNF receptor
gene or a portion thereof and the sense region comprises a
nucleotide sequence that is complementary to the antisense region,
and wherein the siNA molecule has one or more modified pyrimidine
and/or purine nucleotides. In one embodiment, the pyrimidine
nucleotides in the sense region are 2'-O-methylpyrimidine
nucleotides or 2'-deoxy-2'-fluoro pyrimidine nucleotides and the
purine nucleotides present in the sense region are 2'-deoxy purine
nucleotides. In another embodiment, the pyrimidine nucleotides in
the sense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides and
the purine nucleotides present in the sense region are 2'-O-methyl
purine nucleotides. In another embodiment, the pyrimidine
nucleotides in the sense region are 2'-deoxy-2'-fluoro pyrimidine
nucleotides and the purine nucleotides present in the sense region
are 2'-deoxy purine nucleotides. In one embodiment, the pyrimidine
nucleotides in the antisense region are 2'-deoxy-2'-fluoro
pyrimidine nucleotides and the purine nucleotides present in the
antisense region are 2'-O-methyl or 2'-deoxy purine nucleotides. In
another embodiment of any of the above-described siNA molecules,
any nucleotides present in a non-complementary region of the sense
strand (e.g. overhang region) are 2'-deoxy nucleotides.
[0049] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a TNF and/or TNF receptor gene, wherein the siNA
molecule is assembled from two separate oligonucleotide fragments
wherein one fragment comprises the sense region and the second
fragment comprises the antisense region of the siNA molecule, and
wherein the fragment comprising the sense region includes a
terminal cap moiety at the 5'-end, the 3'-end, or both of the 5'
and 3' ends of the fragment. In one embodiment, the terminal cap
moiety is an inverted deoxy abasic moiety or glyceryl moiety. In
one embodiment, each of the two fragments of the siNA molecule
independently comprise about 15 to about 30 (e.g. about 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides.
In another embodiment, each of the two fragments of the siNA
molecule independently comprise about 15 to about 40 (e.g. about
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
23, 33, 34, 35, 36, 37, 38, 39, or 40) nucleotides. In a
non-limiting example, each of the two fragments of the siNA
molecule comprise about 21 nucleotides.
[0050] In one embodiment, the invention features a siNA molecule
comprising at least one modified nucleotide, wherein the modified
nucleotide is a 2'-deoxy-2'-fluoro nucleotide. The siNA can be, for
example, about 15 to about 40 nucleotides in length. In one
embodiment, all pyrimidine nucleotides present in the siNA are
2'-deoxy-2'-fluoro pyrimidine nucleotides. In one embodiment, the
modified nucleotides in the siNA include at least one
2'-deoxy-2'-fluoro cytidine or 2'-deoxy-2'-fluoro uridine
nucleotide. In another embodiment, the modified nucleotides in the
siNA include at least one 2'-fluoro cytidine and at least one
2'-deoxy-2'-fluoro uridine nucleotides. In one embodiment, all
uridine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
uridine nucleotides. In one embodiment, all cytidine nucleotides
present in the siNA are 2'-deoxy-2'-fluoro cytidine nucleotides. In
one embodiment, all adenosine nucleotides present in the siNA are
2'-deoxy-2'-fluoro adenosine nucleotides. In one embodiment, all
guanosine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
guanosine nucleotides. The siNA can further comprise at least one
modified internucleotidic linkage, such as phosphorothioate
linkage. In one embodiment, the 2'-deoxy-2'-fluoronucleotides are
present at specifically selected locations in the siNA that are
sensitive to cleavage by ribonucleases, such as locations having
pyrimidine nucleotides.
[0051] In one embodiment, the invention features a method of
increasing the stability of a siNA molecule against cleavage by
ribonucleases comprising introducing at least one modified
nucleotide into the siNA molecule, wherein the modified nucleotide
is a 2'-deoxy-2'-fluoro nucleotide. In one embodiment, all
pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
pyrimidine nucleotides. In one embodiment, the modified nucleotides
in the siNA include at least one 2'-deoxy-2'-fluoro cytidine or
2'-deoxy-2'-fluoro uridine nucleotide. In another embodiment, the
modified nucleotides in the siNA include at least one 2'-fluoro
cytidine and at least one 2'-deoxy-2'-fluoro uridine nucleotides.
In one embodiment, all uridine nucleotides present in the siNA are
2'-deoxy-2'-fluoro uridine nucleotides. In one embodiment, all
cytidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
cytidine nucleotides. In one embodiment, all adenosine nucleotides
present in the siNA are 2'-deoxy-2'-fluoro adenosine
nucleotides.
[0052] In one embodiment, all guanosine nucleotides present in the
siNA are 2'-deoxy-2'-fluoro guanosine nucleotides. The siNA can
further comprise at least one modified internucleotidic linkage,
such as phosphorothioate linkage. In one embodiment, the
2'-deoxy-2'-fluoronucleotides are present at specifically selected
locations in the siNA that are sensitive to cleavage by
ribonucleases, such as locations having pyrimidine nucleotides. In
one embodiment, the invention features a double-stranded short
interfering nucleic acid (siNA) molecule that down-regulates
expression of a TNF and/or TNF receptor gene comprising a sense
region and an antisense region, wherein the antisense region
comprises a nucleotide sequence that is complementary to a
nucleotide sequence of RNA encoded by the TNF and/or TNF receptor
gene or a portion thereof and the sense region comprises a
nucleotide sequence that is complementary to the antisense region,
and wherein the purine nucleotides present in the antisense region
comprise 2'-deoxy-purine nucleotides. In an alternative embodiment,
the purine nucleotides present in the antisense region comprise
2'-O-methyl purine nucleotides. In either of the above embodiments,
the antisense region can comprise a phosphorothioate
internucleotide linkage at the 3' end of the antisense region.
Alternatively, in either of the above embodiments, the antisense
region can comprise a glyceryl modification at the 3' end of the
antisense region. In another embodiment of any of the
above-described siNA molecules, any nucleotides present in a
non-complementary region of the antisense strand (e.g. overhang
region) are 2'-deoxy nucleotides.
[0053] In one embodiment, the antisense region of a siNA molecule
of the invention comprises sequence complementary to a portion of a
TNF and/or TNF receptor transcript having sequence unique to a
particular TNF and/or TNF receptor disease related allele, such as
sequence comprising a single nucleotide polymorphism (SNP)
associated with the disease specific allele. As such, the antisense
region of a siNA molecule of the invention can comprise sequence
complementary to sequences that are unique to a particular allele
to provide specificity in mediating selective RNAi against the
disease, condition, or trait related allele.
[0054] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a TNF and/or TNF receptor gene, wherein the siNA
molecule is assembled from two separate oligonucleotide fragments
wherein one fragment comprises the sense region and the second
fragment comprises the antisense region of the siNA molecule. In
another embodiment, the siNA molecule is a double stranded nucleic
acid molecule, where each strand is about 21 nucleotides long and
where about 19 nucleotides of each fragment of the siNA molecule
are base-paired to the complementary nucleotides of the other
fragment of the siNA molecule, wherein at least two 3' terminal
nucleotides of each fragment of the siNA molecule are not
base-paired to the nucleotides of the other fragment of the siNA
molecule. In another embodiment, the siNA molecule is a double
stranded nucleic acid molecule, where each strand is about 19
nucleotide long and where the nucleotides of each fragment of the
siNA molecule are base-paired to the complementary nucleotides of
the other fragment of the siNA molecule to form at least about 15
(e.g., 15, 16, 17, 18, or 19) base pairs, wherein one or both ends
of the siNA molecule are blunt ends. In one embodiment, each of the
two 3' terminal nucleotides of each fragment of the siNA molecule
is a 2'-deoxy-pyrimidine nucleotide, such as a 2'-deoxy-thymidine.
In another embodiment, all nucleotides of each fragment of the siNA
molecule are base-paired to the complementary nucleotides of the
other fragment of the siNA molecule. In another embodiment, the
siNA molecule is a double stranded nucleic acid molecule of about
19 to about 25 base pairs having a sense region and an antisense
region, where about 19 nucleotides of the antisense region are
base-paired to the nucleotide sequence or a portion thereof of the
RNA encoded by the TNF and/or TNF receptor gene. In another
embodiment, about 21 nucleotides of the antisense region are
base-paired to the nucleotide sequence or a portion thereof of the
RNA encoded by the TNF and/or TNF receptor gene. In any of the
above embodiments, the 5'-end of the fragment comprising said
antisense region can optionally include a phosphate group.
[0055] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits the
expression of a TNF and/or TNF receptor RNA sequence (e.g., wherein
said target RNA sequence is encoded by a TNF and/or TNF receptor
gene involved in the TNF and/or TNF receptor pathway), wherein the
siNA molecule does not contain any ribonucleotides and wherein each
strand of the double-stranded siNA molecule is about 15 to about 30
nucleotides. In one embodiment, the siNA molecule is 21 nucleotides
in length. Examples of non-ribonucleotide containing siNA
constructs are combinations of stabilization chemistries shown in
Table IV in any combination of Sense/Antisense chemistries, such as
Stab 7/8, Stab 7/11, Stab 8/8, Stab 18/8, Stab 18/11, Stab 12/13,
Stab 7/13, Stab 18/13, Stab 7/19, Stab 8/19, Stab 18/19, Stab 7/20,
Stab 8/20, Stab 18/20, Stab 7/32, Stab 8/32, or Stab 18/32 (e.g.,
any siNA having Stab 7, 8, 11, 12, 13, 14, 15, 17, 18, 19, 20, or
32 sense or antisense strands or any combination thereof).
[0056] In one embodiment, the invention features a chemically
synthesized double stranded RNA molecule that directs cleavage of a
TNF and/or TNF receptor RNA via RNA interference, wherein each
strand of said RNA molecule is about 15 to about 30 nucleotides in
length; one strand of the RNA molecule comprises nucleotide
sequence having sufficient complementarity to the TNF and/or TNF
receptor RNA for the RNA molecule to direct cleavage of the TNF
and/or TNF receptor RNA via RNA interference; and wherein at least
one strand of the RNA molecule optionally comprises one or more
chemically modified nucleotides described herein, such as without
limitation deoxynucleotides, 2'-O-methyl nucleotides,
2'-deoxy-2'-fluoro nucleotides, 2'-O-methoxyethyl nucleotides
etc.
[0057] In one embodiment, the invention features a medicament
comprising a siNA molecule of the invention.
[0058] In one embodiment, the invention features an active
ingredient comprising a siNA molecule of the invention.
[0059] In one embodiment, the invention features the use of a
double-stranded short interfering nucleic acid (siNA) molecule to
inhibit, down-regulate, or reduce expression of a TNF and/or TNF
receptor gene, wherein the siNA molecule comprises one or more
chemical modifications and each strand of the double-stranded siNA
is independently about 15 to about 30 or more (e.g., about 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 or more)
nucleotides long. In one embodiment, the siNA molecule of the
invention is a double stranded nucleic acid molecule comprising one
or more chemical modifications, where each of the two fragments of
the siNA molecule independently comprise about 15 to about 40 (e.g.
about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 23, 33, 34, 35, 36, 37, 38, 39, or 40) nucleotides and
where one of the strands comprises at least 15 nucleotides that are
complementary to nucleotide sequence of TNF and/or TNF receptor
encoding RNA or a portion thereof. In a non-limiting example, each
of the two fragments of the siNA molecule comprise about 21
nucleotides. In another embodiment, the siNA molecule is a double
stranded nucleic acid molecule comprising one or more chemical
modifications, where each strand is about 21 nucleotide long and
where about 19 nucleotides of each fragment of the siNA molecule
are base-paired to the complementary nucleotides of the other
fragment of the siNA molecule, wherein at least two 3' terminal
nucleotides of each fragment of the siNA molecule are not
base-paired to the nucleotides of the other fragment of the siNA
molecule. In another embodiment, the siNA molecule is a double
stranded nucleic acid molecule comprising one or more chemical
modifications, where each strand is about 19 nucleotide long and
where the nucleotides of each fragment of the siNA molecule are
base-paired to the complementary nucleotides of the other fragment
of the siNA molecule to form at least about 15 (e.g., 15, 16, 17,
18, or 19) base pairs, wherein one or both ends of the siNA
molecule are blunt ends. In one embodiment, each of the two 3'
terminal nucleotides of each fragment of the siNA molecule is a
2'-deoxy-pyrimidine nucleotide, such as a 2'-deoxy-thymidine. In
another embodiment, all nucleotides of each fragment of the siNA
molecule are base-paired to the complementary nucleotides of the
other fragment of the siNA molecule. In another embodiment, the
siNA molecule is a double stranded nucleic acid molecule of about
19 to about 25 base pairs having a sense region and an antisense
region and comprising one or more chemical modifications, where
about 19 nucleotides of the antisense region are base-paired to the
nucleotide sequence or a portion thereof of the RNA encoded by the
TNF and/or TNF receptor gene. In another embodiment, about 21
nucleotides of the antisense region are base-paired to the
nucleotide sequence or a portion thereof of the RNA encoded by the
TNF and/or TNF receptor gene. In any of the above embodiments, the
5'-end of the fragment comprising said antisense region can
optionally include a phosphate group.
[0060] In one embodiment, the invention features the use of a
double-stranded short interfering nucleic acid (siNA) molecule that
inhibits, down-regulates, or reduces expression of a TNF and/or TNF
receptor gene, wherein one of the strands of the double-stranded
siNA molecule is an antisense strand which comprises nucleotide
sequence that is complementary to nucleotide sequence of TNF and/or
TNF receptor RNA or a portion thereof, the other strand is a sense
strand which comprises nucleotide sequence that is complementary to
a nucleotide sequence of the antisense strand and wherein a
majority of the pyrimidine nucleotides present in the
double-stranded siNA molecule comprises a sugar modification.
[0061] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits,
down-regulates, or reduces expression of a TNF and/or TNF receptor
gene, wherein one of the strands of the double-stranded siNA
molecule is an antisense strand which comprises nucleotide sequence
that is complementary to nucleotide sequence of TNF and/or TNF
receptor RNA or a portion thereof, wherein the other strand is a
sense strand which comprises nucleotide sequence that is
complementary to a nucleotide sequence of the antisense strand and
wherein a majority of the pyrimidine nucleotides present in the
double-stranded siNA molecule comprises a sugar modification.
[0062] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits,
down-regulates, or reduces expression of a TNF and/or TNF receptor
gene, wherein one of the strands of the double-stranded siNA
molecule is an antisense strand which comprises nucleotide sequence
that is complementary to nucleotide sequence of TNF and/or TNF
receptor RNA that encodes a protein or portion thereof, the other
strand is a sense strand which comprises nucleotide sequence that
is complementary to a nucleotide sequence of the antisense strand
and wherein a majority of the pyrimidine nucleotides present in the
double-stranded siNA molecule comprises a sugar modification. In
one embodiment, each strand of the siNA molecule comprises about 15
to about 30 or more (e.g., about 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, or 30 or more) nucleotides, wherein
each strand comprises at least about 15 nucleotides that are
complementary to the nucleotides of the other strand. In one
embodiment, the siNA molecule is assembled from two oligonucleotide
fragments, wherein one fragment comprises the nucleotide sequence
of the antisense strand of the siNA molecule and a second fragment
comprises nucleotide sequence of the sense region of the siNA
molecule. In one embodiment, the sense strand is connected to the
antisense strand via a linker molecule, such as a polynucleotide
linker or a non-nucleotide linker. In a further embodiment, the
pyrimidine nucleotides present in the sense strand are
2'-deoxy-2'fluoro pyrimidine nucleotides and the purine nucleotides
present in the sense region are 2'-deoxy purine nucleotides. In
another embodiment, the pyrimidine nucleotides present in the sense
strand are 2'-deoxy-2'fluoro pyrimidine nucleotides and the purine
nucleotides present in the sense region are 2'-O-methyl purine
nucleotides. In still another embodiment, the pyrimidine
nucleotides present in the antisense strand are 2'-deoxy-2'-fluoro
pyrimidine nucleotides and any purine nucleotides present in the
antisense strand are 2'-deoxy purine nucleotides. In another
embodiment, the antisense strand comprises one or more
2'-deoxy-2'-fluoro pyrimidine nucleotides and one or more
2'-O-methyl purine nucleotides. In another embodiment, the
pyrimidine nucleotides present in the antisense strand are
2'-deoxy-2'-fluoro pyrimidine nucleotides and any purine
nucleotides present in the antisense strand are 2'-O-methyl purine
nucleotides. In a further embodiment the sense strand comprises a
3'-end and a 5'-end, wherein a terminal cap moiety (e.g., an
inverted deoxy abasic moiety or inverted deoxy nucleotide moiety
such as inverted thymidine) is present at the 5'-end, the 3'-end,
or both of the 5' and 3' ends of the sense strand. In another
embodiment, the antisense strand comprises a phosphorothioate
internucleotide linkage at the 3' end of the antisense strand. In
another embodiment, the antisense strand comprises a glyceryl
modification at the 3' end. In another embodiment, the 5'-end of
the antisense strand optionally includes a phosphate group.
[0063] In any of the above-described embodiments of a
double-stranded short interfering nucleic acid (siNA) molecule that
inhibits expression of a TNF and/or TNF receptor gene, wherein a
majority of the pyrimidine nucleotides present in the
double-stranded siNA molecule comprises a sugar modification, each
of the two strands of the siNA molecule can comprise about 15 to
about 30 or more (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, or 30 or more) nucleotides. In one
embodiment, about 15 to about 30 or more (e.g., about 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more)
nucleotides of each strand of the siNA molecule are base-paired to
the complementary nucleotides of the other strand of the siNA
molecule. In another embodiment, about 15 to about 30 or more
(e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, or 30 or more) nucleotides of each strand of the siNA
molecule are base-paired to the complementary nucleotides of the
other strand of the siNA molecule, wherein at least two 3' terminal
nucleotides of each strand of the siNA molecule are not base-paired
to the nucleotides of the other strand of the siNA molecule. In
another embodiment, each of the two 3' terminal nucleotides of each
fragment of the siNA molecule is a 2'-deoxy-pyrimidine, such as
2'-deoxy-thymidine. In one embodiment, each strand of the siNA
molecule is base-paired to the complementary nucleotides of the
other strand of the siNA molecule. In one embodiment, about 15 to
about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, or 30) nucleotides of the antisense strand are
base-paired to the nucleotide sequence of the TNF and/or TNF
receptor RNA or a portion thereof. In one embodiment, about 18 to
about 25 (e.g., about 18, 19, 20, 21, 22, 23, 24, or 25)
nucleotides of the antisense strand are base-paired to the
nucleotide sequence of the TNF and/or TNF receptor RNA or a portion
thereof.
[0064] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits
expression of a TNF and/or TNF receptor gene, wherein one of the
strands of the double-stranded siNA molecule is an antisense strand
which comprises nucleotide sequence that is complementary to
nucleotide sequence of TNF and/or TNF receptor RNA or a portion
thereof, the other strand is a sense strand which comprises
nucleotide sequence that is complementary to a nucleotide sequence
of the antisense strand and wherein a majority of the pyrimidine
nucleotides present in the double-stranded siNA molecule comprises
a sugar modification, and wherein the 5'-end of the antisense
strand optionally includes a phosphate group.
[0065] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits
expression of a TNF and/or TNF receptor gene, wherein one of the
strands of the double-stranded siNA molecule is an antisense strand
which comprises nucleotide sequence that is complementary to
nucleotide sequence of TNF and/or TNF receptor RNA or a portion
thereof, the other strand is a sense strand which comprises
nucleotide sequence that is complementary to a nucleotide sequence
of the antisense strand and wherein a majority of the pyrimidine
nucleotides present in the double-stranded siNA molecule comprises
a sugar modification, and wherein the nucleotide sequence or a
portion thereof of the antisense strand is complementary to a
nucleotide sequence of the untranslated region or a portion thereof
of the TNF and/or TNF receptor RNA.
[0066] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits
expression of a TNF and/or TNF receptor gene, wherein one of the
strands of the double-stranded siNA molecule is an antisense strand
which comprises nucleotide sequence that is complementary to
nucleotide sequence of TNF and/or TNF receptor RNA or a portion
thereof, wherein the other strand is a sense strand which comprises
nucleotide sequence that is complementary to a nucleotide sequence
of the antisense strand, wherein a majority of the pyrimidine
nucleotides present in the double-stranded siNA molecule comprises
a sugar modification, and wherein the nucleotide sequence of the
antisense strand is complementary to a nucleotide sequence of the
TNF and/or TNF receptor RNA or a portion thereof that is present in
the TNF and/or TNF receptor RNA.
[0067] In one embodiment, the invention features a composition
comprising a siNA molecule of the invention in a pharmaceutically
acceptable carrier or diluent.
[0068] In a non-limiting example, the introduction of
chemically-modified nucleotides into nucleic acid molecules
provides a powerful tool in overcoming potential limitations of in
vivo stability and bioavailability inherent to native RNA molecules
that are delivered exogenously. For example, the use of
chemically-modified nucleic acid molecules can enable a lower dose
of a particular nucleic acid molecule for a given therapeutic
effect since chemically-modified nucleic acid molecules tend to
have a longer half-life in serum. Furthermore, certain chemical
modifications can improve the bioavailability of nucleic acid
molecules by targeting particular cells or tissues and/or improving
cellular uptake of the nucleic acid molecule. Therefore, even if
the activity of a chemically-modified nucleic acid molecule is
reduced as compared to a native nucleic acid molecule, for example,
when compared to an all-RNA nucleic acid molecule, the overall
activity of the modified nucleic acid molecule can be greater than
that of the native molecule due to improved stability and/or
delivery of the molecule. Unlike native unmodified siNA,
chemically-modified siNA can also minimize the possibility of
activating interferon activity in humans.
[0069] In any of the embodiments of siNA molecules described
herein, the antisense region of a siNA molecule of the invention
can comprise a phosphorothioate internucleotide linkage at the
3'-end of said antisense region. In any of the embodiments of siNA
molecules described herein, the antisense region can comprise about
one to about five phosphorothioate internucleotide linkages at the
5'-end of said antisense region. In any of the embodiments of siNA
molecules described herein, the 3'-terminal nucleotide overhangs of
a siNA molecule of the invention can comprise ribonucleotides or
deoxyribonucleotides that are chemically-modified at a nucleic acid
sugar, base, or backbone. In any of the embodiments of siNA
molecules described herein, the 3'-terminal nucleotide overhangs
can comprise one or more universal base ribonucleotides. In any of
the embodiments of siNA molecules described herein, the 3'-terminal
nucleotide overhangs can comprise one or more acyclic
nucleotides.
[0070] One embodiment of the invention provides an expression
vector comprising a nucleic acid sequence encoding at least one
siNA molecule of the invention in a manner that allows expression
of the nucleic acid molecule. Another embodiment of the invention
provides a mammalian cell comprising such an expression vector. The
mammalian cell can be a human cell. The siNA molecule of the
expression vector can comprise a sense region and an antisense
region. The antisense region can comprise sequence complementary to
a RNA or DNA sequence encoding TNF and/or TNF receptor and the
sense region can comprise sequence complementary to the antisense
region. The siNA molecule can comprise two distinct strands having
complementary sense and antisense regions. The siNA molecule can
comprise a single strand having complementary sense and antisense
regions.
[0071] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
capable of mediating RNA interference (RNAi) against TNF and/or TNF
receptor inside a cell or reconstituted in vitro system, wherein
the chemical modification comprises one or more (e.g., about 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides comprising a backbone
modified internucleotide linkage having Formula I:
##STR00001##
wherein each R1 and R2 is independently any nucleotide,
non-nucleotide, or polynucleotide which can be naturally-occurring
or chemically-modified, each X and Y is independently O, S, N,
alkyl, or substituted alkyl, each Z and W is independently O, S, N,
alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, aralkyl, or
acetyl and wherein W, X, Y, and Z are optionally not all 0. In
another embodiment, a backbone modification of the invention
comprises a phosphonoacetate and/or thiophosphonoacetate
internucleotide linkage (see for example Sheehan et al., 2003,
Nucleic Acids Research, 31, 4109-4118).
[0072] The chemically-modified internucleotide linkages having
Formula I, for example, wherein any Z, W, X, and/or Y independently
comprises a sulphur atom, can be present in one or both
oligonucleotide strands of the siNA duplex, for example, in the
sense strand, the antisense strand, or both strands. The siNA
molecules of the invention can comprise one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, or more) chemically-modified
internucleotide linkages having Formula I at the 3'-end, the
5'-end, or both of the 3' and 5'-ends of the sense strand, the
antisense strand, or both strands. For example, an exemplary siNA
molecule of the invention can comprise about 1 to about 5 or more
(e.g., about 1, 2, 3, 4, 5, or more) chemically-modified
internucleotide linkages having Formula I at the 5'-end of the
sense strand, the antisense strand, or both strands. In another
non-limiting example, an exemplary siNA molecule of the invention
can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, or more) pyrimidine nucleotides with chemically-modified
internucleotide linkages having Formula I in the sense strand, the
antisense strand, or both strands. In yet another non-limiting
example, an exemplary siNA molecule of the invention can comprise
one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more)
purine nucleotides with chemically-modified internucleotide
linkages having Formula I in the sense strand, the antisense
strand, or both strands. In another embodiment, a siNA molecule of
the invention having internucleotide linkage(s) of Formula I also
comprises a chemically-modified nucleotide or non-nucleotide having
any of Formulae I-VII.
[0073] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
capable of mediating RNA interference (RNAi) against TNF and/or TNF
receptor inside a cell or reconstituted in vitro system, wherein
the chemical modification comprises one or more (e.g., about 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides or non-nucleotides
having Formula II:
##STR00002##
wherein each R3, R4, R5, R6, R7, R8, R10, R11 and R12 is
independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl,
F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-5-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalklylamino, substituted silyl, or group having Formula I or
II; R9 is O, S, CH2, S.dbd.O, CHF, or CF2, and B is a nucleosidic
base such as adenine, guanine, uracil, cytosine, thymine,
2-aminoadenosine, 5-methylcytosine, 2,6-diaminopurine, or any other
non-naturally occurring base that can be complementary or
non-complementary to target RNA or a non-nucleosidic base such as
phenyl, naphthyl, 3-nitropyrrole, 5-nitroindole, nebularine,
pyridone, pyridinone, or any other non-naturally occurring
universal base that can be complementary or non-complementary to
target RNA.
[0074] The chemically-modified nucleotide or non-nucleotide of
Formula II can be present in one or both oligonucleotide strands of
the siNA duplex, for example in the sense strand, the antisense
strand, or both strands. The siNA molecules of the invention can
comprise one or more chemically-modified nucleotides or
non-nucleotides of Formula II at the 3'-end, the 5'-end, or both of
the 3' and 5'-ends of the sense strand, the antisense strand, or
both strands. For example, an exemplary siNA molecule of the
invention can comprise about 1 to about 5 or more (e.g., about 1,
2, 3, 4, 5, or more) chemically-modified nucleotides or
non-nucleotides of Formula II at the 5'-end of the sense strand,
the antisense strand, or both strands. In anther non-limiting
example, an exemplary siNA molecule of the invention can comprise
about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more)
chemically-modified nucleotides or non-nucleotides of Formula II at
the 3'-end of the sense strand, the antisense strand, or both
strands.
[0075] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
capable of mediating RNA interference (RNAi) against TNF and/or TNF
receptor inside a cell or reconstituted in vitro system, wherein
the chemical modification comprises one or more (e.g., about 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides or non-nucleotides
having Formula III:
##STR00003##
wherein each R3, R4, R5, R6, R7, R8, R10, R11 and R12 is
independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl,
F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-5-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalklylamino, substituted silyl, or group having Formula I or
II; R9 is O, S, CH2, S.dbd.O, CHF, or CF2, and B is a nucleosidic
base such as adenine, guanine, uracil, cytosine, thymine,
2-aminoadenosine, 5-methylcytosine, 2,6-diaminopurine, or any other
non-naturally occurring base that can be employed to be
complementary or non-complementary to target RNA or a
non-nucleosidic base such as phenyl, naphthyl, 3-nitropyrrole,
5-nitroindole, nebularine, pyridone, pyridinone, or any other
non-naturally occurring universal base that can be complementary or
non-complementary to target RNA.
[0076] The chemically-modified nucleotide or non-nucleotide of
Formula III can be present in one or both oligonucleotide strands
of the siNA duplex, for example, in the sense strand, the antisense
strand, or both strands. The siNA molecules of the invention can
comprise one or more chemically-modified nucleotides or
non-nucleotides of Formula III at the 3'-end, the 5'-end, or both
of the 3' and 5'-ends of the sense strand, the antisense strand, or
both strands. For example, an exemplary siNA molecule of the
invention can comprise about 1 to about 5 or more (e.g., about 1,
2, 3, 4, 5, or more) chemically-modified nucleotide(s) or
non-nucleotide(s) of Formula III at the 5'-end of the sense strand,
the antisense strand, or both strands. In anther non-limiting
example, an exemplary siNA molecule of the invention can comprise
about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more)
chemically-modified nucleotide or non-nucleotide of Formula III at
the 3'-end of the sense strand, the antisense strand, or both
strands.
[0077] In another embodiment, a siNA molecule of the invention
comprises a nucleotide having Formula II or III, wherein the
nucleotide having Formula II or III is in an inverted
configuration. For example, the nucleotide having Formula II or III
is connected to the siNA construct in a 3'-3',3'-2',2'-3', or 5'-5'
configuration, such as at the 3'-end, the 5'-end, or both of the 3'
and 5'-ends of one or both siNA strands.
[0078] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
capable of mediating RNA interference (RNAi) against TNF and/or TNF
receptor inside a cell or reconstituted in vitro system, wherein
the chemical modification comprises a 5'-terminal phosphate group
having Formula IV:
##STR00004##
wherein each X and Y is independently O, S, N, alkyl, substituted
alkyl, or alkylhalo; wherein each Z and W is independently O, S, N,
alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, aralkyl,
alkylhalo, or acetyl; and wherein W, X, Y and Z are not all O.
[0079] In one embodiment, the invention features a siNA molecule
having a 5'-terminal phosphate group having Formula IV on the
target-complementary strand, for example, a strand complementary to
a target RNA, wherein the siNA molecule comprises an all RNA siNA
molecule. In another embodiment, the invention features a siNA
molecule having a 5'-terminal phosphate group having Formula IV on
the target-complementary strand wherein the siNA molecule also
comprises about 1 to about 3 (e.g., about 1, 2, or 3) nucleotide
3'-terminal nucleotide overhangs having about 1 to about 4 (e.g.,
about 1, 2, 3, or 4) deoxyribonucleotides on the 3'-end of one or
both strands. In another embodiment, a 5'-terminal phosphate group
having Formula IV is present on the target-complementary strand of
a siNA molecule of the invention, for example a siNA molecule
having chemical modifications having any of Formulae I-VII.
[0080] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
capable of mediating RNA interference (RNAi) against TNF and/or TNF
receptor inside a cell or reconstituted in vitro system, wherein
the chemical modification comprises one or more phosphorothioate
internucleotide linkages. For example, in a non-limiting example,
the invention features a chemically-modified short interfering
nucleic acid (siNA) having about 1, 2, 3, 4, 5, 6, 7, 8 or more
phosphorothioate internucleotide linkages in one siNA strand. In
yet another embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA)
individually having about 1, 2, 3, 4, 5, 6, 7, 8 or more
phosphorothioate internucleotide linkages in both siNA strands. The
phosphorothioate internucleotide linkages can be present in one or
both oligonucleotide strands of the siNA duplex, for example in the
sense strand, the antisense strand, or both strands. The siNA
molecules of the invention can comprise one or more
phosphorothioate internucleotide linkages at the 3'-end, the
5'-end, or both of the 3'- and 5'-ends of the sense strand, the
antisense strand, or both strands. For example, an exemplary siNA
molecule of the invention can comprise about 1 to about 5 or more
(e.g., about 1, 2, 3, 4, 5, or more) consecutive phosphorothioate
internucleotide linkages at the 5'-end of the sense strand, the
antisense strand, or both strands. In another non-limiting example,
an exemplary siNA molecule of the invention can comprise one or
more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more)
pyrimidine phosphorothioate internucleotide linkages in the sense
strand, the antisense strand, or both strands. In yet another
non-limiting example, an exemplary siNA molecule of the invention
can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, or more) purine phosphorothioate internucleotide linkages in
the sense strand, the antisense strand, or both strands.
[0081] In one embodiment, the invention features a siNA molecule,
wherein the sense strand comprises one or more, for example, about
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate
internucleotide linkages, and/or one or more (e.g., about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl,
2'-deoxy-2'-fluoro, and/or about one or more (e.g., about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides,
and optionally a terminal cap molecule at the 3'-end, the 5'-end,
or both of the 3'- and 5'-ends of the sense strand; and wherein the
antisense strand comprises about 1 to about 10 or more,
specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more
phosphorothioate internucleotide linkages, and/or one or more
(e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy,
2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified
nucleotides, and optionally a terminal cap molecule at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the antisense strand.
In another embodiment, one or more, for example about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense
and/or antisense siNA strand are chemically-modified with 2'-deoxy,
2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without
one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more, phosphorothioate internucleotide linkages and/or a terminal
cap molecule at the 3'-end, the 5'-end, or both of the 3'- and
5'-ends, being present in the same or different strand.
[0082] In another embodiment, the invention features a siNA
molecule, wherein the sense strand comprises about 1 to about 5,
specifically about 1, 2, 3, 4, or 5 phosphorothioate
internucleotide linkages, and/or one or more (e.g., about 1, 2, 3,
4, 5, or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and/or
one or more (e.g., about 1, 2, 3, 4, 5, or more) universal base
modified nucleotides, and optionally a terminal cap molecule at the
3-end, the 5'-end, or both of the 3'- and 5'-ends of the sense
strand; and wherein the antisense strand comprises about 1 to about
5 or more, specifically about 1, 2, 3, 4, 5, or more
phosphorothioate internucleotide linkages, and/or one or more
(e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy,
2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified
nucleotides, and optionally a terminal cap molecule at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the antisense strand.
In another embodiment, one or more, for example about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense
and/or antisense siNA strand are chemically-modified with 2'-deoxy,
2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without
about 1 to about 5 or more, for example about 1, 2, 3, 4, 5, or
more phosphorothioate internucleotide linkages and/or a terminal
cap molecule at the 3'-end, the 5'-end, or both of the 3'- and
5'-ends, being present in the same or different strand.
[0083] In one embodiment, the invention features a siNA molecule,
wherein the sense strand comprises one or more, for example, about
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate
internucleotide linkages, and/or about one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl,
2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5,
6, 7, 8, 9, 10 or more) universal base modified nucleotides, and
optionally a terminal cap molecule at the 3'-end, the 5'-end, or
both of the 3'- and 5'-ends of the sense strand; and wherein the
antisense strand comprises about 1 to about 10 or more,
specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more
phosphorothioate internucleotide linkages, and/or one or more
(e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy,
2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified
nucleotides, and optionally a terminal cap molecule at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the antisense strand.
In another embodiment, one or more, for example about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense
and/or antisense siNA strand are chemically-modified with 2'-deoxy,
2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without
one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or
more phosphorothioate internucleotide linkages and/or a terminal
cap molecule at the 3'-end, the 5'-end, or both of the 3' and
5'-ends, being present in the same or different strand.
[0084] In another embodiment, the invention features a siNA
molecule, wherein the sense strand comprises about 1 to about 5 or
more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate
internucleotide linkages, and/or one or more (e.g., about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl,
2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5,
6, 7, 8, 9, 10 or more) universal base modified nucleotides, and
optionally a terminal cap molecule at the 3'-end, the 5'-end, or
both of the 3'- and 5'-ends of the sense strand; and wherein the
antisense strand comprises about 1 to about 5 or more, specifically
about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide
linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8,
9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and/or
one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more)
universal base modified nucleotides, and optionally a terminal cap
molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends
of the antisense strand. In another embodiment, one or more, for
example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine
nucleotides of the sense and/or antisense siNA strand are
chemically-modified with 2'-deoxy, 2'-O-methyl and/or
2'-deoxy-2'-fluoro nucleotides, with or without about 1 to about 5,
for example about 1, 2, 3, 4, 5 or more phosphorothioate
internucleotide linkages and/or a terminal cap molecule at the
3'-end, the 5'-end, or both of the 3'- and 5'-ends, being present
in the same or different strand.
[0085] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
having about 1 to about 5 or more (specifically about 1, 2, 3, 4, 5
or more) phosphorothioate internucleotide linkages in each strand
of the siNA molecule.
[0086] In another embodiment, the invention features a siNA
molecule comprising 2'-5' internucleotide linkages. The 2'-5'
internucleotide linkage(s) can be at the 3'-end, the 5'-end, or
both of the 3'- and 5'-ends of one or both siNA sequence strands.
In addition, the 2'-5' internucleotide linkage(s) can be present at
various other positions within one or both siNA sequence strands,
for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including
every internucleotide linkage of a pyrimidine nucleotide in one or
both strands of the siNA molecule can comprise a 2'-5'
internucleotide linkage, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more including every internucleotide linkage of a purine nucleotide
in one or both strands of the siNA molecule can comprise a 2'-5'
internucleotide linkage.
[0087] In another embodiment, a chemically-modified siNA molecule
of the invention comprises a duplex having two strands, one or both
of which can be chemically-modified, wherein each strand is
independently about 15 to about 30 (e.g., about 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides in
length, wherein the duplex has about 15 to about 30 (e.g., about
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30)
base pairs, and wherein the chemical modification comprises a
structure having any of Formulae I-VII. For example, an exemplary
chemically-modified siNA molecule of the invention comprises a
duplex having two strands, one or both of which can be
chemically-modified with a chemical modification having any of
Formulae I-VII or any combination thereof, wherein each strand
consists of about 21 nucleotides, each having a 2-nucleotide
3'-terminal nucleotide overhang, and wherein the duplex has about
19 base pairs. In another embodiment, a siNA molecule of the
invention comprises a single stranded hairpin structure, wherein
the siNA is about 36 to about 70 (e.g., about 36, 40, 45, 50, 55,
60, 65, or 70) nucleotides in length having about 15 to about 30
(e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, or 30) base pairs, and wherein the siNA can include a
chemical modification comprising a structure having any of Formulae
I-VII or any combination thereof. For example, an exemplary
chemically-modified siNA molecule of the invention comprises a
linear oligonucleotide having about 42 to about 50 (e.g., about 42,
43, 44, 45, 46, 47, 48, 49, or 50) nucleotides that is
chemically-modified with a chemical modification having any of
Formulae I-VII or any combination thereof, wherein the linear
oligonucleotide forms a hairpin structure having about 19 to about
21 (e.g., 19, 20, or 21) base pairs and a 2-nucleotide 3'-terminal
nucleotide overhang. In another embodiment, a linear hairpin siNA
molecule of the invention contains a stem loop motif, wherein the
loop portion of the siNA molecule is biodegradable. For example, a
linear hairpin siNA molecule of the invention is designed such that
degradation of the loop portion of the siNA molecule in vivo can
generate a double-stranded siNA molecule with 3'-terminal
overhangs, such as 3'-terminal nucleotide overhangs comprising
about 2 nucleotides.
[0088] In another embodiment, a siNA molecule of the invention
comprises a hairpin structure, wherein the siNA is about 25 to
about 50 (e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,
36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50)
nucleotides in length having about 3 to about 25 (e.g., about 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, or 25) base pairs, and wherein the siNA can include one or
more chemical modifications comprising a structure having any of
Formulae I-VII or any combination thereof. For example, an
exemplary chemically-modified siNA molecule of the invention
comprises a linear oligonucleotide having about 25 to about 35
(e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35)
nucleotides that is chemically-modified with one or more chemical
modifications having any of Formulae I-VII or any combination
thereof, wherein the linear oligonucleotide forms a hairpin
structure having about 3 to about 25 (e.g., about 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or
25) base pairs and a 5'-terminal phosphate group that can be
chemically modified as described herein (for example a 5'-terminal
phosphate group having Formula IV). In another embodiment, a linear
hairpin siNA molecule of the invention contains a stem loop motif,
wherein the loop portion of the siNA molecule is biodegradable. In
one embodiment, a linear hairpin siNA molecule of the invention
comprises a loop portion comprising a non-nucleotide linker.
[0089] In another embodiment, a siNA molecule of the invention
comprises an asymmetric hairpin structure, wherein the siNA is
about 25 to about 50 (e.g., about 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
or 50) nucleotides in length having about 3 to about 25 (e.g.,
about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, or 25) base pairs, and wherein the siNA can
include one or more chemical modifications comprising a structure
having any of Formulae I-VII or any combination thereof. For
example, an exemplary chemically-modified siNA molecule of the
invention comprises a linear oligonucleotide having about 25 to
about 35 (e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or
35) nucleotides that is chemically-modified with one or more
chemical modifications having any of Formulae I-VII or any
combination thereof, wherein the linear oligonucleotide forms an
asymmetric hairpin structure having about 3 to about 25 (e.g.,
about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, or 25) base pairs and a 5'-terminal phosphate
group that can be chemically modified as described herein (for
example a 5'-terminal phosphate group having Formula IV). In one
embodiment, an asymmetric hairpin siNA molecule of the invention
contains a stem loop motif, wherein the loop portion of the siNA
molecule is biodegradable. In another embodiment, an asymmetric
hairpin siNA molecule of the invention comprises a loop portion
comprising a non-nucleotide linker.
[0090] In another embodiment, a siNA molecule of the invention
comprises an asymmetric double stranded structure having separate
polynucleotide strands comprising sense and antisense regions,
wherein the antisense region is about 15 to about 30 (e.g., about
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30)
nucleotides in length, wherein the sense region is about 3 to about
25 (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides in length,
wherein the sense region and the antisense region have at least 3
complementary nucleotides, and wherein the siNA can include one or
more chemical modifications comprising a structure having any of
Formulae I-VII or any combination thereof. For example, an
exemplary chemically-modified siNA molecule of the invention
comprises an asymmetric double stranded structure having separate
polynucleotide strands comprising sense and antisense regions,
wherein the antisense region is about 18 to about 23 (e.g., about
18, 19, 20, 21, 22, or 23) nucleotides in length and wherein the
sense region is about 3 to about 15 (e.g., about 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, or 15) nucleotides in length, wherein the
sense region the antisense region have at least 3 complementary
nucleotides, and wherein the siNA can include one or more chemical
modifications comprising a structure having any of Formulae I-VII
or any combination thereof. In another embodiment, the asymmetric
double stranded siNA molecule can also have a 5'-terminal phosphate
group that can be chemically modified as described herein (for
example a 5'-terminal phosphate group having Formula IV).
[0091] In another embodiment, a siNA molecule of the invention
comprises a circular nucleic acid molecule, wherein the siNA is
about 38 to about 70 (e.g., about 38, 40, 45, 50, 55, 60, 65, or
70) nucleotides in length having about 15 to about 30 (e.g., about
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30)
base pairs, and wherein the siNA can include a chemical
modification, which comprises a structure having any of Formulae
I-VII or any combination thereof. For example, an exemplary
chemically-modified siNA molecule of the invention comprises a
circular oligonucleotide having about 42 to about 50 (e.g., about
42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides that is
chemically-modified with a chemical modification having any of
Formulae I-VII or any combination thereof, wherein the circular
oligonucleotide forms a dumbbell shaped structure having about 19
base pairs and 2 loops.
[0092] In another embodiment, a circular siNA molecule of the
invention contains two loop motifs, wherein one or both loop
portions of the siNA molecule is biodegradable. For example, a
circular siNA molecule of the invention is designed such that
degradation of the loop portions of the siNA molecule in vivo can
generate a double-stranded siNA molecule with 3'-terminal
overhangs, such as 3'-terminal nucleotide overhangs comprising
about 2 nucleotides.
[0093] In one embodiment, a siNA molecule of the invention
comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) abasic moiety, for example a compound having Formula
V:
##STR00005##
[0094] wherein each R3, R4, R5, R6, R7, R8, R10, R11, R12, and R13
is independently H, OH, alkyl, substituted alkyl, alkaryl or
aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-5-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalklylamino, substituted silyl, or group having Formula I or
II; R9 is O, S, CH2, S.dbd.O, CHF, or CF2.
[0095] In one embodiment, a siNA molecule of the invention
comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) inverted abasic moiety, for example a compound having
Formula VI:
##STR00006##
wherein each R3, R4, R5, R6, R7, R8, R10, R11, R12, and R13 is
independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl,
F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-5-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalklylamino, substituted silyl, or group having Formula I or
II; R9 is O, S, CH2, S.dbd.O, CHF, or CF2, and either R2, R3, R8 or
R13 serve as points of attachment to the siNA molecule of the
invention.
[0096] In another embodiment, a siNA molecule of the invention
comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) substituted polyalkyl moieties, for example a compound
having Formula VII:
##STR00007##
wherein each n is independently an integer from 1 to 12, each R1,
R2 and R3 is independently H, OH, alkyl, substituted alkyl, alkaryl
or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl,
N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH,
alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH,
alkyl-5-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl,
aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalklylamino, substituted silyl, or a group having Formula I,
and R1, R2 or R3 serves as points of attachment to the siNA
molecule of the invention.
[0097] In another embodiment, the invention features a compound
having Formula VII, wherein R1 and R2 are hydroxyl (OH) groups,
n=1, and R3 comprises 0 and is the point of attachment to the
3'-end, the 5'-end, or both of the 3' and 5'-ends of one or both
strands of a double-stranded siNA molecule of the invention or to a
single-stranded siNA molecule of the invention. This modification
is referred to herein as "glyceryl" (for example modification 6 in
FIG. 10).
[0098] In another embodiment, a chemically modified nucleoside or
non-nucleoside (e.g. a moiety having any of Formula V, VI or VII)
of the invention is at the 3'-end, the 5'-end, or both of the 3'
and 5'-ends of a siNA molecule of the invention. For example,
chemically modified nucleoside or non-nucleoside (e.g., a moiety
having Formula V, VI or VII) can be present at the 3'-end, the
5'-end, or both of the 3' and 5'-ends of the antisense strand, the
sense strand, or both antisense and sense strands of the siNA
molecule. In one embodiment, the chemically modified nucleoside or
non-nucleoside (e.g., a moiety having Formula V, VI or VII) is
present at the 5'-end and 3'-end of the sense strand and the 3'-end
of the antisense strand of a double stranded siNA molecule of the
invention. In one embodiment, the chemically modified nucleoside or
non-nucleoside (e.g., a moiety having Formula V, VI or VII) is
present at the terminal position of the 5'-end and 3'-end of the
sense strand and the 3'-end of the antisense strand of a double
stranded siNA molecule of the invention. In one embodiment, the
chemically modified nucleoside or non-nucleoside (e.g., a moiety
having Formula V, VI or VII) is present at the two terminal
positions of the 5'-end and 3'-end of the sense strand and the
3'-end of the antisense strand of a double stranded siNA molecule
of the invention. In one embodiment, the chemically modified
nucleoside or non-nucleoside (e.g., a moiety having Formula V, VI
or VII) is present at the penultimate position of the 5'-end and
3'-end of the sense strand and the 3'-end of the antisense strand
of a double stranded siNA molecule of the invention. In addition, a
moiety having Formula VII can be present at the 3'-end or the
5'-end of a hairpin siNA molecule as described herein.
[0099] In another embodiment, a siNA molecule of the invention
comprises an abasic residue having Formula V or VI, wherein the
abasic residue having Formula VI or VI is connected to the siNA
construct in a 3'-3',3'-2',2'-3', or 5'-5' configuration, such as
at the 3'-end, the 5'-end, or both of the 3' and 5'-ends of one or
both siNA strands.
[0100] In one embodiment, a siNA molecule of the invention
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) locked nucleic acid (LNA) nucleotides, for example, at the
5'-end, the 3'-end, both of the 5' and 3'-ends, or any combination
thereof, of the siNA molecule.
[0101] In another embodiment, a siNA molecule of the invention
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) acyclic nucleotides, for example, at the 5'-end, the
3'-end, both of the 5' and 3'-ends, or any combination thereof, of
the siNA molecule.
[0102] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention comprising a sense region, wherein any (e.g., one
or more or all) pyrimidine nucleotides present in the sense region
are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the sense
region are 2'-deoxy purine nucleotides (e.g., wherein all purine
nucleotides are 2'-deoxy purine nucleotides or alternately a
plurality of purine nucleotides are 2'-deoxy purine
nucleotides).
[0103] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention comprising a sense region, wherein any (e.g., one
or more or all) pyrimidine nucleotides present in the sense region
are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the sense
region are 2'-deoxy purine nucleotides (e.g., wherein all purine
nucleotides are 2'-deoxy purine nucleotides or alternately a
plurality of purine nucleotides are 2'-deoxy purine nucleotides),
wherein any nucleotides comprising a 3'-terminal nucleotide
overhang that are present in said sense region are 2'-deoxy
nucleotides.
[0104] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention comprising a sense region, wherein any (e.g., one
or more or all) pyrimidine nucleotides present in the sense region
are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the sense
region are 2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides).
[0105] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention comprising a sense region, wherein any (e.g., one
or more or all) pyrimidine nucleotides present in the sense region
are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), wherein any (e.g.,
one or more or all) purine nucleotides present in the sense region
are 2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides), and wherein any nucleotides comprising a 3'-terminal
nucleotide overhang that are present in said sense region are
2'-deoxy nucleotides.
[0106] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention comprising an antisense region, wherein any (e.g.,
one or more or all) pyrimidine nucleotides present in the antisense
region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein
all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the
antisense region are 2'-O-methyl purine nucleotides (e.g., wherein
all purine nucleotides are 2'-O-methyl purine nucleotides or
alternately a plurality of purine nucleotides are 2'-O-methyl
purine nucleotides).
[0107] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention comprising an antisense region, wherein any (e.g.,
one or more or all) pyrimidine nucleotides present in the antisense
region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein
all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), wherein any (e.g.,
one or more or all) purine nucleotides present in the antisense
region are 2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides), and wherein any nucleotides comprising a 3'-terminal
nucleotide overhang that are present in said antisense region are
2'-deoxy nucleotides.
[0108] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention comprising an antisense region, wherein any (e.g.,
one or more or all) pyrimidine nucleotides present in the antisense
region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein
all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the
antisense region are 2'-deoxy purine nucleotides (e.g., wherein all
purine nucleotides are 2'-deoxy purine nucleotides or alternately a
plurality of purine nucleotides are 2'-deoxy purine
nucleotides).
[0109] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention comprising an antisense region, wherein any (e.g.,
one or more or all) pyrimidine nucleotides present in the antisense
region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein
all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the
antisense region are 2'-O-methyl purine nucleotides (e.g., wherein
all purine nucleotides are 2'-O-methyl purine nucleotides or
alternately a plurality of purine nucleotides are 2'-O-methyl
purine nucleotides).
[0110] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention capable of mediating RNA interference (RNAi)
against TNF and/or TNF receptor inside a cell or reconstituted in
vitro system comprising a sense region, wherein one or more
pyrimidine nucleotides present in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and one or more
purine nucleotides present in the sense region are 2'-deoxy purine
nucleotides (e.g., wherein all purine nucleotides are 2'-deoxy
purine nucleotides or alternately a plurality of purine nucleotides
are 2'-deoxy purine nucleotides), and an antisense region, wherein
one or more pyrimidine nucleotides present in the antisense region
are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and one or more
purine nucleotides present in the antisense region are 2'-O-methyl
purine nucleotides (e.g., wherein all purine nucleotides are
2'-O-methyl purine nucleotides or alternately a plurality of purine
nucleotides are 2'-O-methyl purine nucleotides). The sense region
and/or the antisense region can have a terminal cap modification,
such as any modification described herein or shown in FIG. 10, that
is optionally present at the 3'-end, the 5'-end, or both of the 3'
and 5'-ends of the sense and/or antisense sequence. The sense
and/or antisense region can optionally further comprise a
3'-terminal nucleotide overhang having about 1 to about 4 (e.g.,
about 1, 2, 3, or 4) 2'-deoxynucleotides. The overhang nucleotides
can further comprise one or more (e.g., about 1, 2, 3, 4 or more)
phosphorothioate, phosphonoacetate, and/or thiophosphonoacetate
internucleotide linkages. Non-limiting examples of these
chemically-modified siNAs are shown in FIGS. 4 and 5 and Tables III
and IV herein. In any of these described embodiments, the purine
nucleotides present in the sense region are alternatively
2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine nucleotides)
and one or more purine nucleotides present in the antisense region
are 2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides). Also, in any of these embodiments, one or more purine
nucleotides present in the sense region are alternatively purine
ribonucleotides (e.g., wherein all purine nucleotides are purine
ribonucleotides or alternately a plurality of purine nucleotides
are purine ribonucleotides) and any purine nucleotides present in
the antisense region are 2'-O-methyl purine nucleotides (e.g.,
wherein all purine nucleotides are 2'-O-methyl purine nucleotides
or alternately a plurality of purine nucleotides are 2'-O-methyl
purine nucleotides). Additionally, in any of these embodiments, one
or more purine nucleotides present in the sense region and/or
present in the antisense region are alternatively selected from the
group consisting of 2'-deoxy nucleotides, locked nucleic acid (LNA)
nucleotides, 2'-methoxyethyl nucleotides, 4'-thionucleotides, and
2'-O-methyl nucleotides (e.g., wherein all purine nucleotides are
selected from the group consisting of 2'-deoxy nucleotides, locked
nucleic acid (LNA) nucleotides, 2'-methoxyethyl nucleotides,
4'-thionucleotides, and 2'-O-methyl nucleotides or alternately a
plurality of purine nucleotides are selected from the group
consisting of 2'-deoxy nucleotides, locked nucleic acid (LNA)
nucleotides, 2'-methoxyethyl nucleotides, 4'-thionucleotides, and
2'-O-methyl nucleotides).
[0111] In another embodiment, any modified nucleotides present in
the siNA molecules of the invention, preferably in the antisense
strand of the siNA molecules of the invention, but also optionally
in the sense and/or both antisense and sense strands, comprise
modified nucleotides having properties or characteristics similar
to naturally occurring ribonucleotides. For example, the invention
features siNA molecules including modified nucleotides having a
Northern conformation (e.g., Northern pseudorotation cycle, see for
example Saenger, Principles of Nucleic Acid Structure,
Springer-Verlag ed., 1984). As such, chemically modified
nucleotides present in the siNA molecules of the invention,
preferably in the antisense strand of the siNA molecules of the
invention, but also optionally in the sense and/or both antisense
and sense strands, are resistant to nuclease degradation while at
the same time maintaining the capacity to mediate RNAi.
Non-limiting examples of nucleotides having a northern
configuration include locked nucleic acid (LNA) nucleotides (e.g.,
2'-0,4'-C-methylene-(D-ribofuranosyl) nucleotides);
2'-methoxyethoxy (MOE) nucleotides; 2'-methyl-thio-ethyl,
2'-deoxy-2'-fluoro nucleotides, 2'-deoxy-2'-chloro nucleotides,
2'-azido nucleotides, and 2'-O-methyl nucleotides.
[0112] In one embodiment, the sense strand of a double stranded
siNA molecule of the invention comprises a terminal cap moiety,
(see for example FIG. 10) such as an inverted deoxyabasic moiety,
at the 3'-end, 5'-end, or both 3' and 5'-ends of the sense
strand.
[0113] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid molecule (siNA)
capable of mediating RNA interference (RNAi) against TNF and/or TNF
receptor inside a cell or reconstituted in vitro system, wherein
the chemical modification comprises a conjugate covalently attached
to the chemically-modified siNA molecule. Non-limiting examples of
conjugates contemplated by the invention include conjugates and
ligands described in Vargeese et al., U.S. Ser. No. 10/427,160,
filed Apr. 30, 2003, incorporated by reference herein in its
entirety, including the drawings. In another embodiment, the
conjugate is covalently attached to the chemically-modified siNA
molecule via a biodegradable linker. In one embodiment, the
conjugate molecule is attached at the 3'-end of either the sense
strand, the antisense strand, or both strands of the
chemically-modified siNA molecule. In another embodiment, the
conjugate molecule is attached at the 5'-end of either the sense
strand, the antisense strand, or both strands of the
chemically-modified siNA molecule. In yet another embodiment, the
conjugate molecule is attached both the 3'-end and 5'-end of either
the sense strand, the antisense strand, or both strands of the
chemically-modified siNA molecule, or any combination thereof. In
one embodiment, a conjugate molecule of the invention comprises a
molecule that facilitates delivery of a chemically-modified siNA
molecule into a biological system, such as a cell. In another
embodiment, the conjugate molecule attached to the
chemically-modified siNA molecule is a polyethylene glycol, human
serum albumin, or a ligand for a cellular receptor that can mediate
cellular uptake. Examples of specific conjugate molecules
contemplated by the instant invention that can be attached to
chemically-modified siNA molecules are described in Vargeese et
al., U.S. Ser. No. 10/201,394, filed Jul. 22, 2002 incorporated by
reference herein. The type of conjugates used and the extent of
conjugation of siNA molecules of the invention can be evaluated for
improved pharmacokinetic profiles, bioavailability, and/or
stability of siNA constructs while at the same time maintaining the
ability of the siNA to mediate RNAi activity. As such, one skilled
in the art can screen siNA constructs that are modified with
various conjugates to determine whether the siNA conjugate complex
possesses improved properties while maintaining the ability to
mediate RNAi, for example in animal models as are generally known
in the art.
[0114] In one embodiment, the invention features a short
interfering nucleic acid (siNA) molecule of the invention, wherein
the siNA further comprises a nucleotide, non-nucleotide, or mixed
nucleotide/non-nucleotide linker that joins the sense region of the
siNA to the antisense region of the siNA. In one embodiment, a
nucleotide linker of the invention can be a linker of >2
nucleotides in length, for example about 3, 4, 5, 6, 7, 8, 9, or 10
nucleotides in length. In another embodiment, the nucleotide linker
can be a nucleic acid aptamer. By "aptamer" or "nucleic acid
aptamer" as used herein is meant a nucleic acid molecule that binds
specifically to a target molecule wherein the nucleic acid molecule
has sequence that comprises a sequence recognized by the target
molecule in its natural setting. Alternately, an aptamer can be a
nucleic acid molecule that binds to a target molecule where the
target molecule does not naturally bind to a nucleic acid. The
target molecule can be any molecule of interest. For example, the
aptamer can be used to bind to a ligand-binding domain of a
protein, thereby preventing interaction of the naturally occurring
ligand with the protein. This is a non-limiting example and those
in the art will recognize that other embodiments can be readily
generated using techniques generally known in the art. (See, for
example, Gold et al., 1995, Annu. Rev. Biochem., 64, 763; Brody and
Gold, 2000, J. Biotechnol., 74, 5; Sun, 2000, Curr. Opin. Mol.
Ther., 2, 100; Kusser, 2000, J. Biotechnol., 74, 27; Hermann and
Patel, 2000, Science, 287, 820; and Jayasena, 1999, Clinical
Chemistry, 45, 1628.)
[0115] In yet another embodiment, a non-nucleotide linker of the
invention comprises abasic nucleotide, polyether, polyamine,
polyamide, peptide, carbohydrate, lipid, polyhydrocarbon, or other
polymeric compounds (e.g. polyethylene glycols such as those having
between 2 and 100 ethylene glycol units). Specific examples include
those described by Seela and Kaiser, Nucleic Acids Res. 1990,
18:6353 and Nucleic Acids Res. 1987, 15:3113; Cload and Schepartz,
J. Am. Chem. Soc. 1991, 113:6324; Richardson and Schepartz, J. Am.
Chem. Soc. 1991, 113:5109; Ma et al., Nucleic Acids Res. 1993,
21:2585 and Biochemistry 1993, 32:1751; Durand et al., Nucleic
Acids Res. 1990, 18:6353; McCurdy et al., Nucleosides &
Nucleotides 1991, 10:287; Jschke et al., Tetrahedron Lett. 1993,
34:301; Ono et al., Biochemistry 1991, 30:9914; Arnold et al.,
International Publication No. WO 89/02439; Usman et al.,
International Publication No. WO 95/06731; Dudycz et al.,
International Publication No. WO 95/11910 and Ferentz and Verdine,
J. Am. Chem. Soc. 1991, 113:4000, all hereby incorporated by
reference herein. A "non-nucleotide" further means any group or
compound that can be incorporated into a nucleic acid chain in the
place of one or more nucleotide units, including either sugar
and/or phosphate substitutions, and allows the remaining bases to
exhibit their enzymatic activity. The group or compound can be
abasic in that it does not contain a commonly recognized nucleotide
base, such as adenosine, guanine, cytosine, uracil or thymine, for
example at the C1 position of the sugar.
[0116] In one embodiment, the invention features a short
interfering nucleic acid (siNA) molecule capable of mediating RNA
interference (RNAi) inside a cell or reconstituted in vitro system,
wherein one or both strands of the siNA molecule that are assembled
from two separate oligonucleotides do not comprise any
ribonucleotides. For example, a siNA molecule can be assembled from
a single oligonucleotide where the sense and antisense regions of
the siNA comprise separate oligonucleotides that do not have any
ribonucleotides (e.g., nucleotides having a 2'-OH group) present in
the oligonucleotides. In another example, a siNA molecule can be
assembled from a single oligonucleotide where the sense and
antisense regions of the siNA are linked or circularized by a
nucleotide or non-nucleotide linker as described herein, wherein
the oligonucleotide does not have any ribonucleotides (e.g.,
nucleotides having a 2'-OH group) present in the oligonucleotide.
Applicant has surprisingly found that the presence of
ribonucleotides (e.g., nucleotides having a 2'-hydroxyl group)
within the siNA molecule is not required or essential to support
RNAi activity. As such, in one embodiment, all positions within the
siNA can include chemically modified nucleotides and/or
non-nucleotides such as nucleotides and or non-nucleotides having
Formula I, II, III, IV, V, VI, or VII or any combination thereof to
the extent that the ability of the siNA molecule to support RNAi
activity in a cell is maintained.
[0117] In one embodiment, a siNA molecule of the invention is a
single stranded siNA molecule that mediates RNAi activity in a cell
or reconstituted in vitro system comprising a single stranded
polynucleotide having complementarity to a target nucleic acid
sequence. In another embodiment, the single stranded siNA molecule
of the invention comprises a 5'-terminal phosphate group. In
another embodiment, the single stranded siNA molecule of the
invention comprises a 5'-terminal phosphate group and a 3'-terminal
phosphate group (e.g., a 2',3'-cyclic phosphate). In another
embodiment, the single stranded siNA molecule of the invention
comprises about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides. In yet
another embodiment, the single stranded siNA molecule of the
invention comprises one or more chemically modified nucleotides or
non-nucleotides described herein. For example, all the positions
within the siNA molecule can include chemically-modified
nucleotides such as nucleotides having any of Formulae I-VII, or
any combination thereof to the extent that the ability of the siNA
molecule to support RNAi activity in a cell is maintained.
[0118] In one embodiment, a siNA molecule of the invention is a
single stranded siNA molecule that mediates RNAi activity in a cell
or reconstituted in vitro system comprising a single stranded
polynucleotide having complementarity to a target nucleic acid
sequence, wherein one or more pyrimidine nucleotides present in the
siNA are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein
all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
purine nucleotides present in the antisense region are 2'-O-methyl
purine nucleotides (e.g., wherein all purine nucleotides are
2'-O-methyl purine nucleotides or alternately a plurality of purine
nucleotides are 2'-O-methyl purine nucleotides), and a terminal cap
modification, such as any modification described herein or shown in
FIG. 10, that is optionally present at the 3'-end, the 5'-end, or
both of the 3' and 5'-ends of the antisense sequence. The siNA
optionally further comprises about 1 to about 4 or more (e.g.,
about 1, 2, 3, 4 or more) terminal 2'-deoxynucleotides at the
3'-end of the siNA molecule, wherein the terminal nucleotides can
further comprise one or more (e.g., 1, 2, 3, 4 or more)
phosphorothioate, phosphonoacetate, and/or thiophosphonoacetate
internucleotide linkages, and wherein the siNA optionally further
comprises a terminal phosphate group, such as a 5'-terminal
phosphate group. In any of these embodiments, any purine
nucleotides present in the antisense region are alternatively
2'-deoxy purine nucleotides (e.g., wherein all purine nucleotides
are 2'-deoxy purine nucleotides or alternately a plurality of
purine nucleotides are 2'-deoxy purine nucleotides). Also, in any
of these embodiments, any purine nucleotides present in the siNA
(i.e., purine nucleotides present in the sense and/or antisense
region) can alternatively be locked nucleic acid (LNA) nucleotides
(e.g., wherein all purine nucleotides are LNA nucleotides or
alternately a plurality of purine nucleotides are LNA nucleotides).
Also, in any of these embodiments, any purine nucleotides present
in the siNA are alternatively 2'-methoxyethyl purine nucleotides
(e.g., wherein all purine nucleotides are 2'-methoxyethyl purine
nucleotides or alternately a plurality of purine nucleotides are
2'-methoxyethyl purine nucleotides). In another embodiment, any
modified nucleotides present in the single stranded siNA molecules
of the invention comprise modified nucleotides having properties or
characteristics similar to naturally occurring ribonucleotides. For
example, the invention features siNA molecules including modified
nucleotides having a Northern conformation (e.g., Northern
pseudorotation cycle, see for example Saenger, Principles of
Nucleic Acid Structure, Springer-Verlag ed., 1984). As such,
chemically modified nucleotides present in the single stranded siNA
molecules of the invention are preferably resistant to nuclease
degradation while at the same time maintaining the capacity to
mediate RNAi.
[0119] In one embodiment, a siNA molecule of the invention
comprises chemically modified nucleotides or non-nucleotides (e.g.,
having any of Formulae I-VII, such as 2'-deoxy, 2'-deoxy-2'-fluoro,
or 2'-O-methyl nucleotides) at alternating positions within one or
more strands or regions of the siNA molecule. For example, such
chemical modifications can be introduced at every other position of
a RNA based siNA molecule, starting at either the first or second
nucleotide from the 3'-end or 5'-end of the siNA. In a non-limiting
example, a double stranded siNA molecule of the invention in which
each strand of the siNA is 21 nucleotides in length is featured
wherein positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 of each
strand are chemically modified (e.g., with compounds having any of
Formulae I-VII, such as such as 2'-deoxy, 2'-deoxy-2'-fluoro, or
2'-O-methyl nucleotides). In another non-limiting example, a double
stranded siNA molecule of the invention in which each strand of the
siNA is 21 nucleotides in length is featured wherein positions 2,
4, 6, 8, 10, 12, 14, 16, 18, and 20 of each strand are chemically
modified (e.g., with compounds having any of Formulae I-VII, such
as such as 2'-deoxy, 2'-deoxy-2'-fluoro, or 2'-O-methyl
nucleotides). Such siNA molecules can further comprise terminal cap
moieties and/or backbone modifications as described herein.
[0120] In one embodiment, the invention features a method for
modulating the expression of a TNF and/or TNF receptor gene within
a cell comprising: (a) synthesizing a siNA molecule of the
invention, which can be chemically-modified, wherein one of the
siNA strands comprises a sequence complementary to RNA of the TNF
and/or TNF receptor gene; and (b) introducing the siNA molecule
into a cell under conditions suitable to modulate the expression of
the TNF and/or TNF receptor gene in the cell.
[0121] In one embodiment, the invention features a method for
modulating the expression of a TNF and/or TNF receptor gene within
a cell comprising: (a) synthesizing a siNA molecule of the
invention, which can be chemically-modified, wherein one of the
siNA strands comprises a sequence complementary to RNA of the TNF
and/or TNF receptor gene and wherein the sense strand sequence of
the siNA comprises a sequence identical or substantially similar to
the sequence of the target RNA; and (b) introducing the siNA
molecule into a cell under conditions suitable to modulate the
expression of the TNF and/or TNF receptor gene in the cell.
[0122] In another embodiment, the invention features a method for
modulating the expression of more than one TNF and/or TNF receptor
gene within a cell comprising: (a) synthesizing siNA molecules of
the invention, which can be chemically-modified, wherein one of the
siNA strands comprises a sequence complementary to RNA of the TNF
and/or TNF receptor genes; and (b) introducing the siNA molecules
into a cell under conditions suitable to modulate the expression of
the TNF and/or TNF receptor genes in the cell.
[0123] In another embodiment, the invention features a method for
modulating the expression of two or more TNF and/or TNF receptor
genes within a cell comprising: (a) synthesizing one or more siNA
molecules of the invention, which can be chemically-modified,
wherein the siNA strands comprise sequences complementary to RNA of
the TNF and/or TNF receptor genes and wherein the sense strand
sequences of the siNAs comprise sequences identical or
substantially similar to the sequences of the target RNAs; and (b)
introducing the siNA molecules into a cell under conditions
suitable to modulate the expression of the TNF and/or TNF receptor
genes in the cell.
[0124] In another embodiment, the invention features a method for
modulating the expression of more than one TNF and/or TNF receptor
gene within a cell comprising: (a) synthesizing a siNA molecule of
the invention, which can be chemically-modified, wherein one of the
siNA strands comprises a sequence complementary to RNA of the TNF
and/or TNF receptor gene and wherein the sense strand sequence of
the siNA comprises a sequence identical or substantially similar to
the sequences of the target RNAs; and (b) introducing the siNA
molecule into a cell under conditions suitable to modulate the
expression of the TNF and/or TNF receptor genes in the cell.
[0125] In one embodiment, siNA molecules of the invention are used
as reagents in ex vivo applications. For example, siNA reagents are
introduced into tissue or cells that are transplanted into a
subject for therapeutic effect. The cells and/or tissue can be
derived from an organism or subject that later receives the
explant, or can be derived from another organism or subject prior
to transplantation. The siNA molecules can be used to modulate the
expression of one or more genes in the cells or tissue, such that
the cells or tissue obtain a desired phenotype or are able to
perform a function when transplanted in vivo. In one embodiment,
certain target cells from a patient are extracted. These extracted
cells are contacted with siNAs targeting a specific nucleotide
sequence within the cells under conditions suitable for uptake of
the siNAs by these cells (e.g. using delivery reagents such as
cationic lipids, liposomes and the like or using techniques such as
electroporation to facilitate the delivery of siNAs into cells).
The cells are then reintroduced back into the same patient or other
patients. In one embodiment, the invention features a method of
modulating the expression of a TNF and/or TNF receptor gene in a
tissue explant comprising: (a) synthesizing a siNA molecule of the
invention, which can be chemically-modified, wherein one of the
siNA strands comprises a sequence complementary to RNA of the TNF
and/or TNF receptor gene; and (b) introducing the siNA molecule
into a cell of the tissue explant derived from a particular
organism under conditions suitable to modulate the expression of
the TNF and/or TNF receptor gene in the tissue explant. In another
embodiment, the method further comprises introducing the tissue
explant back into the organism the tissue was derived from or into
another organism under conditions suitable to modulate the
expression of the TNF and/or TNF receptor gene in that
organism.
[0126] In one embodiment, the invention features a method of
modulating the expression of a TNF and/or TNF receptor gene in a
tissue explant comprising: (a) synthesizing a siNA molecule of the
invention, which can be chemically-modified, wherein one of the
siNA strands comprises a sequence complementary to RNA of the TNF
and/or TNF receptor gene and wherein the sense strand sequence of
the siNA comprises a sequence identical or substantially similar to
the sequence of the target RNA; and (b) introducing the siNA
molecule into a cell of the tissue explant derived from a
particular organism under conditions suitable to modulate the
expression of the TNF and/or TNF receptor gene in the tissue
explant. In another embodiment, the method further comprises
introducing the tissue explant back into the organism the tissue
was derived from or into another organism under conditions suitable
to modulate the expression of the TNF and/or TNF receptor gene in
that organism.
[0127] In another embodiment, the invention features a method of
modulating the expression of more than one TNF and/or TNF receptor
gene in a tissue explant comprising: (a) synthesizing siNA
molecules of the invention, which can be chemically-modified,
wherein one of the siNA strands comprises a sequence complementary
to RNA of the TNF and/or TNF receptor genes; and (b) introducing
the siNA molecules into a cell of the tissue explant derived from a
particular organism under conditions suitable to modulate the
expression of the TNF and/or TNF receptor genes in the tissue
explant. In another embodiment, the method further comprises
introducing the tissue explant back into the organism the tissue
was derived from or into another organism under conditions suitable
to modulate the expression of the TNF and/or TNF receptor genes in
that organism.
[0128] In one embodiment, the invention features a method of
modulating the expression of a TNF and/or TNF receptor gene in a
subject or organism comprising: (a) synthesizing a siNA molecule of
the invention, which can be chemically-modified, wherein one of the
siNA strands comprises a sequence complementary to RNA of the TNF
and/or TNF receptor gene; and (b) introducing the siNA molecule
into the subject or organism under conditions suitable to modulate
the expression of the TNF and/or TNF receptor gene in the subject
or organism. The level of TNF and/or TNF receptor protein or RNA
can be determined using various methods well-known in the art.
[0129] In another embodiment, the invention features a method of
modulating the expression of more than one TNF and/or TNF receptor
gene in a subject or organism comprising: (a) synthesizing siNA
molecules of the invention, which can be chemically-modified,
wherein one of the siNA strands comprises a sequence complementary
to RNA of the TNF and/or TNF receptor genes; and (b) introducing
the siNA molecules into the subject or organism under conditions
suitable to modulate the expression of the TNF and/or TNF receptor
genes in the subject or organism. The level of TNF and/or TNF
receptor protein or RNA can be determined as is known in the
art.
[0130] In one embodiment, the invention features a method for
modulating the expression of a TNF and/or TNF receptor gene within
a cell comprising: (a) synthesizing a siNA molecule of the
invention, which can be chemically-modified, wherein the siNA
comprises a single stranded sequence having complementarity to RNA
of the TNF and/or TNF receptor gene; and (b) introducing the siNA
molecule into a cell under conditions suitable to modulate the
expression of the TNF and/or TNF receptor gene in the cell.
[0131] In another embodiment, the invention features a method for
modulating the expression of more than one TNF and/or TNF receptor
gene within a cell comprising: (a) synthesizing siNA molecules of
the invention, which can be chemically-modified, wherein the siNA
comprises a single stranded sequence having complementarity to RNA
of the TNF and/or TNF receptor gene; and (b) contacting the cell in
vitro or in vivo with the siNA molecule under conditions suitable
to modulate the expression of the TNF and/or TNF receptor genes in
the cell.
[0132] In one embodiment, the invention features a method of
modulating the expression of a TNF and/or TNF receptor gene in a
tissue explant comprising: (a) synthesizing a siNA molecule of the
invention, which can be chemically-modified, wherein the siNA
comprises a single stranded sequence having complementarity to RNA
of the TNF and/or TNF receptor gene; and (b) contacting a cell of
the tissue explant derived from a particular subject or organism
with the siNA molecule under conditions suitable to modulate the
expression of the TNF and/or TNF receptor gene in the tissue
explant. In another embodiment, the method further comprises
introducing the tissue explant back into the subject or organism
the tissue was derived from or into another subject or organism
under conditions suitable to modulate the expression of the TNF
and/or TNF receptor gene in that subject or organism.
[0133] In another embodiment, the invention features a method of
modulating the expression of more than one TNF and/or TNF receptor
gene in a tissue explant comprising: (a) synthesizing siNA
molecules of the invention, which can be chemically-modified,
wherein the siNA comprises a single stranded sequence having
complementarity to RNA of the TNF and/or TNF receptor gene; and (b)
introducing the siNA molecules into a cell of the tissue explant
derived from a particular subject or organism under conditions
suitable to modulate the expression of the TNF and/or TNF receptor
genes in the tissue explant. In another embodiment, the method
further comprises introducing the tissue explant back into the
subject or organism the tissue was derived from or into another
subject or organism under conditions suitable to modulate the
expression of the TNF and/or TNF receptor genes in that subject or
organism.
[0134] In one embodiment, the invention features a method of
modulating the expression of a TNF and/or TNF receptor gene in a
subject or organism comprising: (a) synthesizing a siNA molecule of
the invention, which can be chemically-modified, wherein the siNA
comprises a single stranded sequence having complementarity to RNA
of the TNF and/or TNF receptor gene; and (b) introducing the siNA
molecule into the subject or organism under conditions suitable to
modulate the expression of the TNF and/or TNF receptor gene in the
subject or organism.
[0135] In another embodiment, the invention features a method of
modulating the expression of more than one TNF and/or TNF receptor
gene in a subject or organism comprising: (a) synthesizing siNA
molecules of the invention, which can be chemically-modified,
wherein the siNA comprises a single stranded sequence having
complementarity to RNA of the TNF and/or TNF receptor gene; and (b)
introducing the siNA molecules into the subject or organism under
conditions suitable to modulate the expression of the TNF and/or
TNF receptor genes in the subject or organism.
[0136] In one embodiment, the invention features a method of
modulating the expression of a TNF and/or TNF receptor gene in a
subject or organism comprising contacting the subject or organism
with a siNA molecule of the invention under conditions suitable to
modulate the expression of the TNF and/or TNF receptor gene in the
subject or organism.
[0137] In one embodiment, the invention features a method for
treating or preventing an inflammatory disease, disorder, or
condition in a subject or organism comprising contacting the
subject or organism with a siNA molecule of the invention under
conditions suitable to modulate the expression of the TNF and/or
TNF receptor gene in the subject or organism.
[0138] In one embodiment, the invention features a method for
treating or preventing a neurological disease, disorder, or
condition in a subject or organism comprising contacting the
subject or organism with a siNA molecule of the invention under
conditions suitable to modulate the expression of the TNF and/or
TNF receptor gene in the subject or organism.
[0139] In one embodiment, the invention features a method for
treating or preventing a cardiovascular disease, disorder, or
condition in a subject or organism comprising contacting the
subject or organism with a siNA molecule of the invention under
conditions suitable to modulate the expression of the TNF and/or
TNF receptor gene in the subject or organism. In one embodiment,
the invention features a method for treating or preventing an
autoimmune disease, disorder, and/or condition in a subject or
organism comprising contacting the subject or organism with a siNA
molecule of the invention under conditions suitable to modulate the
expression of the TNF and/or TNF receptor gene in the subject or
organism.
[0140] In another embodiment, the invention features a method of
modulating the expression of more than one TNF and/or TNF receptor
genes in a subject or organism comprising contacting the subject or
organism with one or more siNA molecules of the invention under
conditions suitable to modulate the expression of the TNF and/or
TNF receptor genes in the subject or organism.
[0141] The siNA molecules of the invention can be designed to down
regulate or inhibit target (e.g., TNF and/or TNF receptor) gene
expression through RNAi targeting of a variety of RNA molecules. In
one embodiment, the siNA molecules of the invention are used to
target various RNAs corresponding to a target gene. Non-limiting
examples of such RNAs include messenger RNA (mRNA), alternate RNA
splice variants of target gene(s), post-transcriptionally modified
RNA of target gene(s), pre-mRNA of target gene(s), and/or RNA
templates. If alternate splicing produces a family of transcripts
that are distinguished by usage of appropriate exons, the instant
invention can be used to inhibit gene expression through the
appropriate exons to specifically inhibit or to distinguish among
the functions of gene family members. For example, a protein that
contains an alternatively spliced transmembrane domain can be
expressed in both membrane bound and secreted forms. Use of the
invention to target the exon containing the transmembrane domain
can be used to determine the functional consequences of
pharmaceutical targeting of membrane bound as opposed to the
secreted form of the protein. Non-limiting examples of applications
of the invention relating to targeting these RNA molecules include
therapeutic pharmaceutical applications, pharmaceutical discovery
applications, molecular diagnostic and gene function applications,
and gene mapping, for example using single nucleotide polymorphism
mapping with siNA molecules of the invention. Such applications can
be implemented using known gene sequences or from partial sequences
available from an expressed sequence tag (EST).
[0142] In another embodiment, the siNA molecules of the invention
are used to target conserved sequences corresponding to a gene
family or gene families such as TNF and/or TNF receptor family
genes. As such, siNA molecules targeting multiple TNF and/or TNF
receptor targets can provide increased therapeutic effect. In
addition, siNA can be used to characterize pathways of gene
function in a variety of applications. For example, the present
invention can be used to inhibit the activity of target gene(s) in
a pathway to determine the function of uncharacterized gene(s) in
gene function analysis, mRNA function analysis, or translational
analysis. The invention can be used to determine potential target
gene pathways involved in various diseases and conditions toward
pharmaceutical development. The invention can be used to understand
pathways of gene expression involved in, for example cancer,
proliferative, inflammatory, respiratory, neurological,
cardiovascular and/or autoimmune disorders and conditions.
[0143] In one embodiment, siNA molecule(s) and/or methods of the
invention are used to down regulate the expression of gene(s) that
encode RNA referred to by Genbank Accession, for example, TNF
and/or TNF receptor genes encoding RNA sequence(s) referred to
herein by Genbank Accession number, for example, Genbank Accession
Nos. shown in Table I.
[0144] In one embodiment, the invention features a method
comprising: (a) generating a library of siNA constructs having a
predetermined complexity; and (b) assaying the siNA constructs of
(a) above, under conditions suitable to determine RNAi target sites
within the target RNA sequence. In one embodiment, the siNA
molecules of (a) have strands of a fixed length, for example, about
23 nucleotides in length. In another embodiment, the siNA molecules
of (a) are of differing length, for example having strands of about
15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, or 30) nucleotides in length. In one
embodiment, the assay can comprise a reconstituted in vitro siNA
assay as described herein. In another embodiment, the assay can
comprise a cell culture system in which target RNA is expressed. In
another embodiment, fragments of target RNA are analyzed for
detectable levels of cleavage, for example by gel electrophoresis,
northern blot analysis, or RNAse protection assays, to determine
the most suitable target site(s) within the target RNA sequence.
The target RNA sequence can be obtained as is known in the art, for
example, by cloning and/or transcription for in vitro systems, and
by cellular expression in in vivo systems.
[0145] In one embodiment, the invention features a method
comprising: (a) generating a randomized library of siNA constructs
having a predetermined complexity, such as of 4.sup.N, where N
represents the number of base paired nucleotides in each of the
siNA construct strands (e.g. for a siNA construct having 21
nucleotide sense and antisense strands with 19 base pairs, the
complexity would be 4.sup.19); and (b) assaying the siNA constructs
of (a) above, under conditions suitable to determine RNAi target
sites within the target TNF and/or TNF receptor RNA sequence. In
another embodiment, the siNA molecules of (a) have strands of a
fixed length, for example about 23 nucleotides in length. In yet
another embodiment, the siNA molecules of (a) are of differing
length, for example having strands of about 15 to about 30 (e.g.,
about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
or 30) nucleotides in length. In one embodiment, the assay can
comprise a reconstituted in vitro siNA assay as described in
Example 6 herein. In another embodiment, the assay can comprise a
cell culture system in which target RNA is expressed. In another
embodiment, fragments of TNF and/or TNF receptor RNA are analyzed
for detectable levels of cleavage, for example, by gel
electrophoresis, northern blot analysis, or RNAse protection
assays, to determine the most suitable target site(s) within the
target TNF and/or TNF receptor RNA sequence. The target TNF and/or
TNF receptor RNA sequence can be obtained as is known in the art,
for example, by cloning and/or transcription for in vitro systems,
and by cellular expression in in vivo systems.
[0146] In another embodiment, the invention features a method
comprising: (a) analyzing the sequence of a RNA target encoded by a
target gene; (b) synthesizing one or more sets of siNA molecules
having sequence complementary to one or more regions of the RNA of
(a); and (c) assaying the siNA molecules of (b) under conditions
suitable to determine RNAi targets within the target RNA sequence.
In one embodiment, the siNA molecules of (b) have strands of a
fixed length, for example about 23 nucleotides in length. In
another embodiment, the siNA molecules of (b) are of differing
length, for example having strands of about 15 to about 30 (e.g.,
about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
or 30) nucleotides in length. In one embodiment, the assay can
comprise a reconstituted in vitro siNA assay as described herein.
In another embodiment, the assay can comprise a cell culture system
in which target RNA is expressed. Fragments of target RNA are
analyzed for detectable levels of cleavage, for example by gel
electrophoresis, northern blot analysis, or RNAse protection
assays, to determine the most suitable target site(s) within the
target RNA sequence. The target RNA sequence can be obtained as is
known in the art, for example, by cloning and/or transcription for
in vitro systems, and by expression in in vivo systems.
[0147] By "target site" is meant a sequence within a target RNA
that is "targeted" for cleavage mediated by a siNA construct which
contains sequences within its antisense region that are
complementary to the target sequence.
[0148] By "detectable level of cleavage" is meant cleavage of
target RNA (and formation of cleaved product RNAs) to an extent
sufficient to discern cleavage products above the background of
RNAs produced by random degradation of the target RNA. Production
of cleavage products from 1-5% of the target RNA is sufficient to
detect above the background for most methods of detection.
[0149] In one embodiment, the invention features a composition
comprising a siNA molecule of the invention, which can be
chemically-modified, in a pharmaceutically acceptable carrier or
diluent. In another embodiment, the invention features a
pharmaceutical composition comprising siNA molecules of the
invention, which can be chemically-modified, targeting one or more
genes in a pharmaceutically acceptable carrier or diluent. In
another embodiment, the invention features a method for diagnosing
a disease or condition in a subject comprising administering to the
subject a composition of the invention under conditions suitable
for the diagnosis of the disease or condition in the subject. In
another embodiment, the invention features a method for treating or
preventing a disease or condition in a subject, comprising
administering to the subject a composition of the invention under
conditions suitable for the treatment or prevention of the disease
or condition in the subject, alone or in conjunction with one or
more other therapeutic compounds. In yet another embodiment, the
invention features a method for treating or preventing cancer,
proliferative, inflammatory, respiratory, neurological,
cardiovascular and/or autoimmune diseases, disorders and conditions
in a subject or organism comprising administering to the subject a
composition of the invention under conditions suitable for the
treatment or prevention of cancer, proliferative, inflammatory,
respiratory, neurological, cardiovascular and/or autoimmune
diseases, disorders and conditions in the subject or organism.
[0150] In another embodiment, the invention features a method for
validating a TNF and/or TNF receptor gene target, comprising: (a)
synthesizing a siNA molecule of the invention, which can be
chemically-modified, wherein one of the siNA strands includes a
sequence complementary to RNA of a TNF and/or TNF receptor target
gene; (b) introducing the siNA molecule into a cell, tissue,
subject, or organism under conditions suitable for modulating
expression of the TNF and/or TNF receptor target gene in the cell,
tissue, subject, or organism; and (c) determining the function of
the gene by assaying for any phenotypic change in the cell, tissue,
subject, or organism.
[0151] In another embodiment, the invention features a method for
validating a TNF and/or TNF receptor target comprising: (a)
synthesizing a siNA molecule of the invention, which can be
chemically-modified, wherein one of the siNA strands includes a
sequence complementary to RNA of a TNF and/or TNF receptor target
gene; (b) introducing the siNA molecule into a biological system
under conditions suitable for modulating expression of the TNF
and/or TNF receptor target gene in the biological system; and (c)
determining the function of the gene by assaying for any phenotypic
change in the biological system.
[0152] By "biological system" is meant, material, in a purified or
unpurified form, from biological sources, including but not limited
to human or animal, wherein the system comprises the components
required for RNAi activity. The term "biological system" includes,
for example, a cell, tissue, subject, or organism, or extract
thereof. The term biological system also includes reconstituted
RNAi systems that can be used in an in vitro setting.
[0153] By "phenotypic change" is meant any detectable change to a
cell that occurs in response to contact or treatment with a nucleic
acid molecule of the invention (e.g., siNA). Such detectable
changes include, but are not limited to, changes in shape, size,
proliferation, motility, protein expression or RNA expression or
other physical or chemical changes as can be assayed by methods
known in the art. The detectable change can also include expression
of reporter genes/molecules such as Green Florescent Protein (GFP)
or various tags that are used to identify an expressed protein or
any other cellular component that can be assayed.
[0154] In one embodiment, the invention features a kit containing a
siNA molecule of the invention, which can be chemically-modified,
that can be used to modulate the expression of a TNF and/or TNF
receptor target gene in a biological system, including, for
example, in a cell, tissue, subject, or organism. In another
embodiment, the invention features a kit containing more than one
siNA molecule of the invention, which can be chemically-modified,
that can be used to modulate the expression of more than one TNF
and/or TNF receptor target gene in a biological system, including,
for example, in a cell, tissue, subject, or organism.
[0155] In one embodiment, the invention features a cell containing
one or more siNA molecules of the invention, which can be
chemically-modified. In another embodiment, the cell containing a
siNA molecule of the invention is a mammalian cell. In yet another
embodiment, the cell containing a siNA molecule of the invention is
a human cell.
[0156] In one embodiment, the synthesis of a siNA molecule of the
invention, which can be chemically-modified, comprises: (a)
synthesis of two complementary strands of the siNA molecule; (b)
annealing the two complementary strands together under conditions
suitable to obtain a double-stranded siNA molecule. In another
embodiment, synthesis of the two complementary strands of the siNA
molecule is by solid phase oligonucleotide synthesis. In yet
another embodiment, synthesis of the two complementary strands of
the siNA molecule is by solid phase tandem oligonucleotide
synthesis.
[0157] In one embodiment, the invention features a method for
synthesizing a siNA duplex molecule comprising: (a) synthesizing a
first oligonucleotide sequence strand of the siNA molecule, wherein
the first oligonucleotide sequence strand comprises a cleavable
linker molecule that can be used as a scaffold for the synthesis of
the second oligonucleotide sequence strand of the siNA; (b)
synthesizing the second oligonucleotide sequence strand of siNA on
the scaffold of the first oligonucleotide sequence strand, wherein
the second oligonucleotide sequence strand further comprises a
chemical moiety than can be used to purify the siNA duplex; (c)
cleaving the linker molecule of (a) under conditions suitable for
the two siNA oligonucleotide strands to hybridize and form a stable
duplex; and (d) purifying the siNA duplex utilizing the chemical
moiety of the second oligonucleotide sequence strand. In one
embodiment, cleavage of the linker molecule in (c) above takes
place during deprotection of the oligonucleotide, for example,
under hydrolysis conditions using an alkylamine base such as
methylamine. In one embodiment, the method of synthesis comprises
solid phase synthesis on a solid support such as controlled pore
glass (CPG) or polystyrene, wherein the first sequence of (a) is
synthesized on a cleavable linker, such as a succinyl linker, using
the solid support as a scaffold. The cleavable linker in (a) used
as a scaffold for synthesizing the second strand can comprise
similar reactivity as the solid support derivatized linker, such
that cleavage of the solid support derivatized linker and the
cleavable linker of (a) takes place concomitantly. In another
embodiment, the chemical moiety of (b) that can be used to isolate
the attached oligonucleotide sequence comprises a trityl group, for
example a dimethoxytrityl group, which can be employed in a
trityl-on synthesis strategy as described herein. In yet another
embodiment, the chemical moiety, such as a dimethoxytrityl group,
is removed during purification, for example, using acidic
conditions.
[0158] In a further embodiment, the method for siNA synthesis is a
solution phase synthesis or hybrid phase synthesis wherein both
strands of the siNA duplex are synthesized in tandem using a
cleavable linker attached to the first sequence which acts a
scaffold for synthesis of the second sequence. Cleavage of the
linker under conditions suitable for hybridization of the separate
siNA sequence strands results in formation of the double-stranded
siNA molecule.
[0159] In another embodiment, the invention features a method for
synthesizing a siNA duplex molecule comprising: (a) synthesizing
one oligonucleotide sequence strand of the siNA molecule, wherein
the sequence comprises a cleavable linker molecule that can be used
as a scaffold for the synthesis of another oligonucleotide
sequence; (b) synthesizing a second oligonucleotide sequence having
complementarity to the first sequence strand on the scaffold of
(a), wherein the second sequence comprises the other strand of the
double-stranded siNA molecule and wherein the second sequence
further comprises a chemical moiety than can be used to isolate the
attached oligonucleotide sequence; (c) purifying the product of (b)
utilizing the chemical moiety of the second oligonucleotide
sequence strand under conditions suitable for isolating the
full-length sequence comprising both siNA oligonucleotide strands
connected by the cleavable linker and under conditions suitable for
the two siNA oligonucleotide strands to hybridize and form a stable
duplex. In one embodiment, cleavage of the linker molecule in (c)
above takes place during deprotection of the oligonucleotide, for
example, under hydrolysis conditions. In another embodiment,
cleavage of the linker molecule in (c) above takes place after
deprotection of the oligonucleotide. In another embodiment, the
method of synthesis comprises solid phase synthesis on a solid
support such as controlled pore glass (CPG) or polystyrene, wherein
the first sequence of (a) is synthesized on a cleavable linker,
such as a succinyl linker, using the solid support as a scaffold.
The cleavable linker in (a) used as a scaffold for synthesizing the
second strand can comprise similar reactivity or differing
reactivity as the solid support derivatized linker, such that
cleavage of the solid support derivatized linker and the cleavable
linker of (a) takes place either concomitantly or sequentially. In
one embodiment, the chemical moiety of (b) that can be used to
isolate the attached oligonucleotide sequence comprises a trityl
group, for example a dimethoxytrityl group.
[0160] In another embodiment, the invention features a method for
making a double-stranded siNA molecule in a single synthetic
process comprising: (a) synthesizing an oligonucleotide having a
first and a second sequence, wherein the first sequence is
complementary to the second sequence, and the first oligonucleotide
sequence is linked to the second sequence via a cleavable linker,
and wherein a terminal 5'-protecting group, for example, a
5'-O-dimethoxytrityl group (5'-O-DMT) remains on the
oligonucleotide having the second sequence; (b) deprotecting the
oligonucleotide whereby the deprotection results in the cleavage of
the linker joining the two oligonucleotide sequences; and (c)
purifying the product of (b) under conditions suitable for
isolating the double-stranded siNA molecule, for example using a
trityl-on synthesis strategy as described herein.
[0161] In another embodiment, the method of synthesis of siNA
molecules of the invention comprises the teachings of Scaringe et
al., U.S. Pat. Nos. 5,889,136; 6,008,400; and 6,111,086,
incorporated by reference herein in their entirety.
[0162] In one embodiment, the invention features siNA constructs
that mediate RNAi against TNF and/or TNF receptor, wherein the siNA
construct comprises one or more chemical modifications, for
example, one or more chemical modifications having any of Formulae
I-VII or any combination thereof that increases the nuclease
resistance of the siNA construct.
[0163] In another embodiment, the invention features a method for
generating siNA molecules with increased nuclease resistance
comprising (a) introducing nucleotides having any of Formula I-VII
or any combination thereof into a siNA molecule, and (b) assaying
the siNA molecule of step (a) under conditions suitable for
isolating siNA molecules having increased nuclease resistance.
[0164] In another embodiment, the invention features a method for
generating siNA molecules with improved toxicologic profiles (e.g.,
have attenuated or no immunostimulatory properties) comprising (a)
introducing nucleotides having any of Formula I-VII (e.g., siNA
motifs referred to in Table IV) or any combination thereof into a
siNA molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules having improved
toxicologic profiles.
[0165] In another embodiment, the invention features a method for
generating siNA molecules that do not stimulate an interferon
response (e.g., no interferon response or attenuated interferon
response) in a cell, subject, or organism, comprising (a)
introducing nucleotides having any of Formula I-VII (e.g., siNA
motifs referred to in Table IV) or any combination thereof into a
siNA molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules that do not
stimulate an interferon response.
[0166] By "improved toxicologic profile", is meant that the
chemically modified siNA construct exhibits decreased toxicity in a
cell, subject, or organism compared to an unmodified siNA or siNA
molecule having fewer modifications or modifications that are less
effective in imparting improved toxicology. In a non-limiting
example, siNA molecules with improved toxicologic profiles are
associated with a decreased or attenuated immunostimulatory
response in a cell, subject, or organism compared to an unmodified
siNA or siNA molecule having fewer modifications or modifications
that are less effective in imparting improved toxicology. In one
embodiment, a siNA molecule with an improved toxicological profile
comprises no ribonucleotides. In one embodiment, a siNA molecule
with an improved toxicological profile comprises less than 5
ribonucleotides (e.g., 1, 2, 3, or 4 ribonucleotides). In one
embodiment, a siNA molecule with an improved toxicological profile
comprises Stab 7, Stab 8, Stab 11, Stab 12, Stab 13, Stab 16, Stab
17, Stab 18, Stab 19, Stab 20, Stab 23, Stab 24, Stab 25, Stab 26,
Stab 27, Stab 28, Stab 29, Stab 30, Stab 31, Stab 32 or any
combination thereof (see Table IV). In one embodiment, the level of
immunostimulatory response associated with a given siNA molecule
can be measured as is known in the art, for example by determining
the level of PKR/interferon response, proliferation, B-cell
activation, and/or cytokine production in assays to quantitate the
immunostimulatory response of particular siNA molecules (see, for
example, Leifer et al., 2003, J Immunother. 26, 313-9; and U.S.
Pat. No. 5,968,909, incorporated in its entirety by reference).
[0167] In one embodiment, the invention features siNA constructs
that mediate RNAi against TNF and/or TNF receptor, wherein the siNA
construct comprises one or more chemical modifications described
herein that modulates the binding affinity between the sense and
antisense strands of the siNA construct.
[0168] In another embodiment, the invention features a method for
generating siNA molecules with increased binding affinity between
the sense and antisense strands of the siNA molecule comprising (a)
introducing nucleotides having any of Formula I-VII or any
combination thereof into a siNA molecule, and (b) assaying the siNA
molecule of step (a) under conditions suitable for isolating siNA
molecules having increased binding affinity between the sense and
antisense strands of the siNA molecule.
[0169] In one embodiment, the invention features siNA constructs
that mediate RNAi against TNF and/or TNF receptor, wherein the siNA
construct comprises one or more chemical modifications described
herein that modulates the binding affinity between the antisense
strand of the siNA construct and a complementary target RNA
sequence within a cell.
[0170] In one embodiment, the invention features siNA constructs
that mediate RNAi against TNF and/or TNF receptor, wherein the siNA
construct comprises one or more chemical modifications described
herein that modulates the binding affinity between the antisense
strand of the siNA construct and a complementary target DNA
sequence within a cell.
[0171] In another embodiment, the invention features a method for
generating siNA molecules with increased binding affinity between
the antisense strand of the siNA molecule and a complementary
target RNA sequence comprising (a) introducing nucleotides having
any of Formula I-VII or any combination thereof into a siNA
molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules having increased
binding affinity between the antisense strand of the siNA molecule
and a complementary target RNA sequence.
[0172] In another embodiment, the invention features a method for
generating siNA molecules with increased binding affinity between
the antisense strand of the siNA molecule and a complementary
target DNA sequence comprising (a) introducing nucleotides having
any of Formula I-VII or any combination thereof into a siNA
molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules having increased
binding affinity between the antisense strand of the siNA molecule
and a complementary target DNA sequence.
[0173] In one embodiment, the invention features siNA constructs
that mediate RNAi against TNF and/or TNF receptor, wherein the siNA
construct comprises one or more chemical modifications described
herein that modulate the polymerase activity of a cellular
polymerase capable of generating additional endogenous siNA
molecules having sequence homology to the chemically-modified siNA
construct.
[0174] In another embodiment, the invention features a method for
generating siNA molecules capable of mediating increased polymerase
activity of a cellular polymerase capable of generating additional
endogenous siNA molecules having sequence homology to a
chemically-modified siNA molecule comprising (a) introducing
nucleotides having any of Formula I-VII or any combination thereof
into a siNA molecule, and (b) assaying the siNA molecule of step
(a) under conditions suitable for isolating siNA molecules capable
of mediating increased polymerase activity of a cellular polymerase
capable of generating additional endogenous siNA molecules having
sequence homology to the chemically-modified siNA molecule.
[0175] In one embodiment, the invention features
chemically-modified siNA constructs that mediate RNAi against TNF
and/or TNF receptor in a cell, wherein the chemical modifications
do not significantly effect the interaction of siNA with a target
RNA molecule, DNA molecule and/or proteins or other factors that
are essential for RNAi in a manner that would decrease the efficacy
of RNAi mediated by such siNA constructs.
[0176] In another embodiment, the invention features a method for
generating siNA molecules with improved RNAi activity against TNF
and/or TNF receptor comprising (a) introducing nucleotides having
any of Formula I-VII or any combination thereof into a siNA
molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules having improved
RNAi activity.
[0177] In yet another embodiment, the invention features a method
for generating siNA molecules with improved RNAi activity against
TNF and/or TNF receptor target RNA comprising (a) introducing
nucleotides having any of Formula I-VII or any combination thereof
into a siNA molecule, and (b) assaying the siNA molecule of step
(a) under conditions suitable for isolating siNA molecules having
improved RNAi activity against the target RNA.
[0178] In yet another embodiment, the invention features a method
for generating siNA molecules with improved RNAi activity against
TNF and/or TNF receptor target DNA comprising (a) introducing
nucleotides having any of Formula I-VII or any combination thereof
into a siNA molecule, and (b) assaying the siNA molecule of step
(a) under conditions suitable for isolating siNA molecules having
improved RNAi activity against the target DNA.
[0179] In one embodiment, the invention features siNA constructs
that mediate RNAi against TNF and/or TNF receptor, wherein the siNA
construct comprises one or more chemical modifications described
herein that modulates the cellular uptake of the siNA
construct.
[0180] In another embodiment, the invention features a method for
generating siNA molecules against TNF and/or TNF receptor with
improved cellular uptake comprising (a) introducing nucleotides
having any of Formula I-VII or any combination thereof into a siNA
molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules having improved
cellular uptake.
[0181] In one embodiment, the invention features siNA constructs
that mediate RNAi against TNF and/or TNF receptor, wherein the siNA
construct comprises one or more chemical modifications described
herein that increases the bioavailability of the siNA construct,
for example, by attaching polymeric conjugates such as
polyethyleneglycol or equivalent conjugates that improve the
pharmacokinetics of the siNA construct, or by attaching conjugates
that target specific tissue types or cell types in vivo.
Non-limiting examples of such conjugates are described in Vargeese
et al., U.S. Ser. No. 10/201,394 incorporated by reference
herein.
[0182] In one embodiment, the invention features a method for
generating siNA molecules of the invention with improved
bioavailability comprising (a) introducing a conjugate into the
structure of a siNA molecule, and (b) assaying the siNA molecule of
step (a) under conditions suitable for isolating siNA molecules
having improved bioavailability. Such conjugates can include
ligands for cellular receptors, such as peptides derived from
naturally occurring protein ligands; protein localization
sequences, including cellular ZIP code sequences; antibodies;
nucleic acid aptamers; vitamins and other co-factors, such as
folate and N-acetylgalactosamine; polymers, such as
polyethyleneglycol (PEG); phospholipids; cholesterol; polyamines,
such as spermine or spermidine; and others.
[0183] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence is chemically
modified in a manner that it can no longer act as a guide sequence
for efficiently mediating RNA interference and/or be recognized by
cellular proteins that facilitate RNAi.
[0184] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein the second sequence is designed or
modified in a manner that prevents its entry into the RNAi pathway
as a guide sequence or as a sequence that is complementary to a
target nucleic acid (e.g., RNA) sequence. Such design or
modifications are expected to enhance the activity of siNA and/or
improve the specificity of siNA molecules of the invention. These
modifications are also expected to minimize any off-target effects
and/or associated toxicity.
[0185] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence is incapable of
acting as a guide sequence for mediating RNA interference.
[0186] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence does not have a
terminal 5'-hydroxyl (5'-OH) or 5'-phosphate group.
[0187] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence comprises a
terminal cap moiety at the 5'-end of said second sequence. In one
embodiment, the terminal cap moiety comprises an inverted abasic,
inverted deoxy abasic, inverted nucleotide moiety, a group shown in
FIG. 10, an alkyl or cycloalkyl group, a heterocycle, or any other
group that prevents RNAi activity in which the second sequence
serves as a guide sequence or template for RNAi.
[0188] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence comprises a
terminal cap moiety at the 5'-end and 3'-end of said second
sequence. In one embodiment, each terminal cap moiety individually
comprises an inverted abasic, inverted deoxy abasic, inverted
nucleotide moiety, a group shown in FIG. 10, an alkyl or cycloalkyl
group, a heterocycle, or any other group that prevents RNAi
activity in which the second sequence serves as a guide sequence or
template for RNAi.
[0189] In one embodiment, the invention features a method for
generating siNA molecules of the invention with improved
specificity for down regulating or inhibiting the expression of a
target nucleic acid (e.g., a DNA or RNA such as a gene or its
corresponding RNA), comprising (a) introducing one or more chemical
modifications into the structure of a siNA molecule, and (b)
assaying the siNA molecule of step (a) under conditions suitable
for isolating siNA molecules having improved specificity. In
another embodiment, the chemical modification used to improve
specificity comprises terminal cap modifications at the 5'-end,
3'-end, or both 5' and 3'-ends of the siNA molecule. The terminal
cap modifications can comprise, for example, structures shown in
FIG. 10 (e.g. inverted deoxyabasic moieties) or any other chemical
modification that renders a portion of the siNA molecule (e.g. the
sense strand) incapable of mediating RNA interference against an
off target nucleic acid sequence. In a non-limiting example, a siNA
molecule is designed such that only the antisense sequence of the
siNA molecule can serve as a guide sequence for RISC mediated
degradation of a corresponding target RNA sequence. This can be
accomplished by rendering the sense sequence of the siNA inactive
by introducing chemical modifications to the sense strand that
preclude recognition of the sense strand as a guide sequence by
RNAi machinery. In one embodiment, such chemical modifications
comprise any chemical group at the 5'-end of the sense strand of
the siNA, or any other group that serves to render the sense strand
inactive as a guide sequence for mediating RNA interference. These
modifications, for example, can result in a molecule where the
5'-end of the sense strand no longer has a free 5'-hydroxyl (5'-OH)
or a free 5'-phosphate group (e.g., phosphate, diphosphate,
triphosphate, cyclic phosphate etc.). Non-limiting examples of such
siNA constructs are described herein, such as "Stab 9/10", "Stab
7/8", "Stab 7/19", "Stab 17/22", "Stab 23/24", "Stab 24/25", and
"Stab 24/26" (e.g., any siNA having Stab 7, 9, 17, 23, or 24 sense
strands) chemistries and variants thereof (see Table IV) wherein
the 5'-end and 3'-end of the sense strand of the siNA do not
comprise a hydroxyl group or phosphate group.
[0190] In one embodiment, the invention features a method for
generating siNA molecules of the invention with improved
specificity for down regulating or inhibiting the expression of a
target nucleic acid (e.g., a DNA or RNA such as a gene or its
corresponding RNA), comprising introducing one or more chemical
modifications into the structure of a siNA molecule that prevent a
strand or portion of the siNA molecule from acting as a template or
guide sequence for RNAi activity. In one embodiment, the inactive
strand or sense region of the siNA molecule is the sense strand or
sense region of the siNA molecule, i.e. the strand or region of the
siNA that does not have complementarity to the target nucleic acid
sequence. In one embodiment, such chemical modifications comprise
any chemical group at the 5'-end of the sense strand or region of
the siNA that does not comprise a 5'-hydroxyl (5'-OH) or
5'-phosphate group, or any other group that serves to render the
sense strand or sense region inactive as a guide sequence for
mediating RNA interference. Non-limiting examples of such siNA
constructs are described herein, such as "Stab 9/10", "Stab 7/8",
"Stab 7/19", "Stab 17/22", "Stab 23/24", "Stab 24/25", and "Stab
24/26" (e.g., any siNA having Stab 7, 9, 17, 23, or 24 sense
strands) chemistries and variants thereof (see Table IV) wherein
the 5'-end and 3'-end of the sense strand of the siNA do not
comprise a hydroxyl group or phosphate group.
[0191] In one embodiment, the invention features a method for
screening siNA molecules that are active in mediating RNA
interference against a target nucleic acid sequence comprising (a)
generating a plurality of unmodified siNA molecules, (b) screening
the siNA molecules of step (a) under conditions suitable for
isolating siNA molecules that are active in mediating RNA
interference against the target nucleic acid sequence, and (c)
introducing chemical modifications (e.g. chemical modifications as
described herein or as otherwise known in the art) into the active
siNA molecules of (b). In one embodiment, the method further
comprises re-screening the chemically modified siNA molecules of
step (c) under conditions suitable for isolating chemically
modified siNA molecules that are active in mediating RNA
interference against the target nucleic acid sequence.
[0192] In one embodiment, the invention features a method for
screening chemically modified siNA molecules that are active in
mediating RNA interference against a target nucleic acid sequence
comprising (a) generating a plurality of chemically modified siNA
molecules (e.g. siNA molecules as described herein or as otherwise
known in the art), and (b) screening the siNA molecules of step (a)
under conditions suitable for isolating chemically modified siNA
molecules that are active in mediating RNA interference against the
target nucleic acid sequence.
[0193] The term "ligand" refers to any compound or molecule, such
as a drug, peptide, hormone, or neurotransmitter, that is capable
of interacting with another compound, such as a receptor, either
directly or indirectly. The receptor that interacts with a ligand
can be present on the surface of a cell or can alternately be an
intercellular receptor. Interaction of the ligand with the receptor
can result in a biochemical reaction, or can simply be a physical
interaction or association.
[0194] In another embodiment, the invention features a method for
generating siNA molecules of the invention with improved
bioavailability comprising (a) introducing an excipient formulation
to a siNA molecule, and (b) assaying the siNA molecule of step (a)
under conditions suitable for isolating siNA molecules having
improved bioavailability. Such excipients include polymers such as
cyclodextrins, lipids, cationic lipids, polyamines, phospholipids,
nanoparticles, receptors, ligands, and others.
[0195] In another embodiment, the invention features a method for
generating siNA molecules of the invention with improved
bioavailability comprising (a) introducing nucleotides having any
of Formulae I-VII or any combination thereof into a siNA molecule,
and (b) assaying the siNA molecule of step (a) under conditions
suitable for isolating siNA molecules having improved
bioavailability.
[0196] In another embodiment, polyethylene glycol (PEG) can be
covalently attached to siNA compounds of the present invention. The
attached PEG can be any molecular weight, preferably from about
2,000 to about 50,000 daltons (Da).
[0197] The present invention can be used alone or as a component of
a kit having at least one of the reagents necessary to carry out
the in vitro or in vivo introduction of RNA to test samples and/or
subjects. For example, preferred components of the kit include a
siNA molecule of the invention and a vehicle that promotes
introduction of the siNA into cells of interest as described herein
(e.g., using lipids and other methods of transfection known in the
art, see for example Beigelman et al, U.S. Pat. No. 6,395,713). The
kit can be used for target validation, such as in determining gene
function and/or activity, or in drug optimization, and in drug
discovery (see for example Usman et al., U.S. Ser. No. 60/402,996).
Such a kit can also include instructions to allow a user of the kit
to practice the invention.
[0198] The term "short interfering nucleic acid", "siNA", "short
interfering RNA", "siRNA", "short interfering nucleic acid
molecule", "short interfering oligonucleotide molecule", or
"chemically-modified short interfering nucleic acid molecule" as
used herein refers to any nucleic acid molecule capable of
inhibiting or down regulating gene expression or viral replication,
for example by mediating RNA interference "RNAi" or gene silencing
in a sequence-specific manner; see for example Zamore et al., 2000,
Cell, 101, 25-33; Bass, 2001, Nature, 411, 428-429; Elbashir et
al., 2001, Nature, 411, 494-498; and Kreutzer et al., International
PCT Publication No. WO 00/44895; Zernicka-Goetz et al.,
International PCT Publication No. WO 01/36646; Fire, International
PCT Publication No. WO 99/32619; Plaetinck et al., International
PCT Publication No. WO 00/01846; Mello and Fire, International PCT
Publication No. WO 01/29058; Deschamps-Depaillette, International
PCT Publication No. WO 99/07409; and Li et al., International PCT
Publication No. WO 00/44914; Allshire, 2002, Science, 297,
1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein,
2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297,
2232-2237; Hutvagner and Zamore, 2002, Science, 297, 2056-60;
McManus et al., 2002, RNA, 8, 842-850; Reinhart et al., 2002, Gene
& Dev., 16, 1616-1626; and Reinhart & Bartel, 2002,
Science, 297, 1831). Non limiting examples of siNA molecules of the
invention are shown in FIGS. 4-6, and Tables II and III herein. For
example the siNA can be a double-stranded polynucleotide molecule
comprising self-complementary sense and antisense regions, wherein
the antisense region comprises nucleotide sequence that is
complementary to nucleotide sequence in a target nucleic acid
molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. The siNA can be assembled from two
separate oligonucleotides, where one strand is the sense strand and
the other is the antisense strand, wherein the antisense and sense
strands are self-complementary (i.e. each strand comprises
nucleotide sequence that is complementary to nucleotide sequence in
the other strand; such as where the antisense strand and sense
strand form a duplex or double stranded structure, for example
wherein the double stranded region is about 15 to about 30, e.g.,
about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or
30 base pairs; the antisense strand comprises nucleotide sequence
that is complementary to nucleotide sequence in a target nucleic
acid molecule or a portion thereof and the sense strand comprises
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof (e.g., about 15 to about 25 or more
nucleotides of the siNA molecule are complementary to the target
nucleic acid or a portion thereof). Alternatively, the siNA is
assembled from a single oligonucleotide, where the
self-complementary sense and antisense regions of the siNA are
linked by means of a nucleic acid based or non-nucleic acid-based
linker(s). The siNA can be a polynucleotide with a duplex,
asymmetric duplex, hairpin or asymmetric hairpin secondary
structure, having self-complementary sense and antisense regions,
wherein the antisense region comprises nucleotide sequence that is
complementary to nucleotide sequence in a separate target nucleic
acid molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. The siNA can be a circular
single-stranded polynucleotide having two or more loop structures
and a stem comprising self-complementary sense and antisense
regions, wherein the antisense region comprises nucleotide sequence
that is complementary to nucleotide sequence in a target nucleic
acid molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof, and wherein the circular
polynucleotide can be processed either in vivo or in vitro to
generate an active siNA molecule capable of mediating RNAi. The
siNA can also comprise a single stranded polynucleotide having
nucleotide sequence complementary to nucleotide sequence in a
target nucleic acid molecule or a portion thereof (for example,
where such siNA molecule does not require the presence within the
siNA molecule of nucleotide sequence corresponding to the target
nucleic acid sequence or a portion thereof), wherein the single
stranded polynucleotide can further comprise a terminal phosphate
group, such as a 5'-phosphate (see for example Martinez et al.,
2002, Cell., 110, 563-574 and Schwarz et al., 2002, Molecular Cell,
10, 537-568), or 5',3'-diphosphate. In certain embodiments, the
siNA molecule of the invention comprises separate sense and
antisense sequences or regions, wherein the sense and antisense
regions are covalently linked by nucleotide or non-nucleotide
linkers molecules as is known in the art, or are alternately
non-covalently linked by ionic interactions, hydrogen bonding, van
der waals interactions, hydrophobic interactions, and/or stacking
interactions. In certain embodiments, the siNA molecules of the
invention comprise nucleotide sequence that is complementary to
nucleotide sequence of a target gene. In another embodiment, the
siNA molecule of the invention interacts with nucleotide sequence
of a target gene in a manner that causes inhibition of expression
of the target gene. As used herein, siNA molecules need not be
limited to those molecules containing only RNA, but further
encompasses chemically-modified nucleotides and non-nucleotides. In
certain embodiments, the short interfering nucleic acid molecules
of the invention lack 2'-hydroxy (2'-OH) containing nucleotides.
Applicant describes in certain embodiments short interfering
nucleic acids that do not require the presence of nucleotides
having a 2'-hydroxy group for mediating RNAi and as such, short
interfering nucleic acid molecules of the invention optionally do
not include any ribonucleotides (e.g., nucleotides having a 2'-OH
group). Such siNA molecules that do not require the presence of
ribonucleotides within the siNA molecule to support RNAi can
however have an attached linker or linkers or other attached or
associated groups, moieties, or chains containing one or more
nucleotides with 2'-OH groups. Optionally, siNA molecules can
comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the
nucleotide positions. The modified short interfering nucleic acid
molecules of the invention can also be referred to as short
interfering modified oligonucleotides "siMON." As used herein, the
term siNA is meant to be equivalent to other terms used to describe
nucleic acid molecules that are capable of mediating sequence
specific RNAi, for example short interfering RNA (siRNA),
double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA
(shRNA), short interfering oligonucleotide, short interfering
nucleic acid, short interfering modified oligonucleotide,
chemically-modified siRNA, post-transcriptional gene silencing RNA
(ptgsRNA), and others. In addition, as used herein, the term RNAi
is meant to be equivalent to other terms used to describe sequence
specific RNA interference, such as post transcriptional gene
silencing, translational inhibition, or epigenetics. For example,
siNA molecules of the invention can be used to epigenetically
silence genes at both the post-transcriptional level and the
pre-transcriptional level. In a non-limiting example, epigenetic
regulation of gene expression by siNA molecules of the invention
can result from siNA mediated modification of chromatin structure
or methylation pattern to alter gene expression (see, for example,
Verdel et al., 2004, Science, 303, 672-676; Pal-Bhadra et al.,
2004, Science, 303, 669-672; Allshire, 2002, Science, 297,
1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein,
2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297,
2232-2237).
[0199] In one embodiment, a siNA molecule of the invention is a
duplex forming oligonucleotide "DFO", (see for example FIGS. 14-15
and Vaish et al., U.S. Ser. No. 10/727,780 filed Dec. 3, 2003 and
International PCT Application No. US04/16390, filed May 24,
2004).
[0200] In one embodiment, a siNA molecule of the invention is a
multifunctional siNA, (see for example FIGS. 16-21 and Jadhav et
al., U.S. Ser. No. 60/543,480 filed Feb. 10, 2004 and International
PCT Application No. US04/16390, filed May 24, 2004). The
multifunctional siNA of the invention can comprise sequence
targeting, for example, two regions of TNF and/or TNF receptor RNA
(see for example target sequences in Tables II and III).
[0201] By "asymmetric hairpin" as used herein is meant a linear
siNA molecule comprising an antisense region, a loop portion that
can comprise nucleotides or non-nucleotides, and a sense region
that comprises fewer nucleotides than the antisense region to the
extent that the sense region has enough complementary nucleotides
to base pair with the antisense region and form a duplex with loop.
For example, an asymmetric hairpin siNA molecule of the invention
can comprise an antisense region having length sufficient to
mediate RNAi in a cell or in vitro system (e.g. about 15 to about
30, or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, or 30 nucleotides) and a loop region comprising about 4 to
about 12 (e.g., about 4, 5, 6, 7, 8, 9, 10, 11, or 12) nucleotides,
and a sense region having about 3 to about 25 (e.g., about 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, or 25) nucleotides that are complementary to the antisense
region. The asymmetric hairpin siNA molecule can also comprise a
5'-terminal phosphate group that can be chemically modified. The
loop portion of the asymmetric hairpin siNA molecule can comprise
nucleotides, non-nucleotides, linker molecules, or conjugate
molecules as described herein.
[0202] By "asymmetric duplex" as used herein is meant a siNA
molecule having two separate strands comprising a sense region and
an antisense region, wherein the sense region comprises fewer
nucleotides than the antisense region to the extent that the sense
region has enough complementary nucleotides to base pair with the
antisense region and form a duplex. For example, an asymmetric
duplex siNA molecule of the invention can comprise an antisense
region having length sufficient to mediate RNAi in a cell or in
vitro system (e.g. about 15 to about 30, or about 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides) and
a sense region having about 3 to about 25 (e.g., about 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, or 25) nucleotides that are complementary to the antisense
region.
[0203] By "modulate" is meant that the expression of the gene, or
level of RNA molecule or equivalent RNA molecules encoding one or
more proteins or protein subunits, or activity of one or more
proteins or protein subunits is up regulated or down regulated,
such that expression, level, or activity is greater than or less
than that observed in the absence of the modulator. For example,
the term "modulate" can mean "inhibit," but the use of the word
"modulate" is not limited to this definition.
[0204] By "inhibit", "down-regulate", or "reduce", it is meant that
the expression of the gene, or level of RNA molecules or equivalent
RNA molecules encoding one or more proteins or protein subunits, or
activity of one or more proteins or protein subunits, is reduced
below that observed in the absence of the nucleic acid molecules
(e.g., siNA) of the invention. In one embodiment, inhibition,
down-regulation or reduction with an siNA molecule is below that
level observed in the presence of an inactive or attenuated
molecule. In another embodiment, inhibition, down-regulation, or
reduction with siNA molecules is below that level observed in the
presence of, for example, an siNA molecule with scrambled sequence
or with mismatches. In another embodiment, inhibition,
down-regulation, or reduction of gene expression with a nucleic
acid molecule of the instant invention is greater in the presence
of the nucleic acid molecule than in its absence. In one
embodiment, inhibition, down regulation, or reduction of gene
expression is associated with post transcriptional silencing, such
as RNAi mediated cleavage of a target nucleic acid molecule (e.g.
RNA) or inhibition of translation. In one embodiment, inhibition,
down regulation, or reduction of gene expression is associated with
pretranscriptional silencing.
[0205] By "gene", or "target gene", is meant a nucleic acid that
encodes an RNA, for example, nucleic acid sequences including, but
not limited to, structural genes encoding a polypeptide. A gene or
target gene can also encode a functional RNA (FRNA) or non-coding
RNA (ncRNA), such as small temporal RNA (stRNA), micro RNA (miRNA),
small nuclear RNA (snRNA), short interfering RNA (siRNA), small
nucleolar RNA (snRNA), ribosomal RNA (rRNA), transfer RNA (tRNA)
and precursor RNAs thereof. Such non-coding RNAs can serve as
target nucleic acid molecules for siNA mediated RNA interference in
modulating the activity of fRNA or ncRNA involved in functional or
regulatory cellular processes. Aberrant fRNA or ncRNA activity
leading to disease can therefore be modulated by siNA molecules of
the invention. siNA molecules targeting fRNA and ncRNA can also be
used to manipulate or alter the genotype or phenotype of a subject,
organism or cell, by intervening in cellular processes such as
genetic imprinting, transcription, translation, or nucleic acid
processing (e.g., transamination, methylation etc.). The target
gene can be a gene derived from a cell, an endogenous gene, a
transgene, or exogenous genes such as genes of a pathogen, for
example a virus, which is present in the cell after infection
thereof. The cell containing the target gene can be derived from or
contained in any organism, for example a plant, animal, protozoan,
virus, bacterium, or fungus. Non-limiting examples of plants
include monocots, dicots, or gymnosperms. Non-limiting examples of
animals include vertebrates or invertebrates. Non-limiting examples
of fungi include molds or yeasts. For a review, see for example
Snyder and Gerstein, 2003, Science, 300, 258-260.
[0206] By "non-canonical base pair" is meant any non-Watson Crick
base pair, such as mismatches and/or wobble base pairs, including
flipped mismatches, single hydrogen bond mismatches, trans-type
mismatches, triple base interactions, and quadruple base
interactions. Non-limiting examples of such non-canonical base
pairs include, but are not limited to, AC reverse Hoogsteen, AC
wobble, AU reverse Hoogsteen, GU wobble, AA N7 amino, CC
2-carbonyl-amino(H1)-N-3-amino(H2), GA sheared, UC
4-carbonyl-amino, UU imino-carbonyl, AC reverse wobble, AU
Hoogsteen, AU reverse Watson Crick, CG reverse Watson Crick, GC
N3-amino-amino N3, AA N1-amino symmetric, AA N.sup.7-amino
symmetric, GA N7-N1 amino-carbonyl, GA+ carbonyl-amino N7-N1, GG
N1-carbonyl symmetric, GG N3-amino symmetric, CC carbonyl-amino
symmetric, CC N3-amino symmetric, UU 2-carbonyl-imino symmetric, UU
4-carbonyl-imino symmetric, AA amino-N3, AA N1-amino, AC amino
2-carbonyl, AC N3-amino, AC N.sup.7-amino, AU amino-4-carbonyl, AU
N1-imino, AU N3-imino, AU N7-imino, CC carbonyl-amino, GA amino-N1,
GA amino-N7, GA carbonyl-amino, GA N3-amino, GC amino-N3, GC
carbonyl-amino, GC N3-amino, GC N7-amino, GG amino-N7, GG
carbonyl-imino, GG N7-amino, GU amino-2-carbonyl, GU
carbonyl-imino, GU imino-2-carbonyl, GU N7-imino, psiU
imino-2-carbonyl, UC 4-carbonyl-amino, UC imino-carbonyl, UU
imino-4-carbonyl, AC C2-H--N3, GA carbonyl-C2-H, UU
imino-4-carbonyl 2 carbonyl-C5-H, AC amino(A) N3(C)-carbonyl, GC
imino amino-carbonyl, Gpsi imino-2-carbonyl amino-2-carbonyl, and
GU imino amino-2-carbonyl base pairs.
[0207] By "TNF" or "tumor necrosis factor" as used herein is meant,
any tumor necrosis factor protein, peptide, or polypeptide having
any tumor necrosis factor activity, such as encoded by TNF Genbank
Accession Nos. shown in Table I. The term "TNF" also refers to
nucleic acid sequences encoding any tumor necrosis factor protein,
peptide, or polypeptide having TNF activity. The term "TNF" is also
meant to include other TNF encoding sequence, such as other TNF
isoforms, mutant TNF genes, splice variants of TNF genes, and TNF
gene polymorphisms. TNF receptor
[0208] By "TNF receptor" or "tumor necrosis factor receptor" as
used herein is meant, any tumor necrosis factor receptor protein,
peptide, or polypeptide having any tumor necrosis factor receptor
activity, such as encoded by TNF receptor Genbank Accession Nos.
shown in Table I. The term "TNF receptor" also refers to nucleic
acid sequences encoding any tumor necrosis factor receptor protein,
peptide, or polypeptide having TNF receptor activity. The term "TNF
receptor" is also meant to include other TNF receptor encoding
sequence, such as other TNF receptor isoforms, mutant TNF receptor
genes, splice variants of TNF receptor genes, and TNF receptor gene
polymorphisms.
[0209] By "homologous sequence" is meant, a nucleotide sequence
that is shared by one or more polynucleotide sequences, such as
genes, gene transcripts and/or non-coding polynucleotides. For
example, a homologous sequence can be a nucleotide sequence that is
shared by two or more genes encoding related but different
proteins, such as different members of a gene family, different
protein epitopes, different protein isoforms or completely
divergent genes, such as a cytokine and its corresponding
receptors. A homologous sequence can be a nucleotide sequence that
is shared by two or more non-coding polynucleotides, such as
noncoding DNA or RNA, regulatory sequences, introns, and sites of
transcriptional control or regulation. Homologous sequences can
also include conserved sequence regions shared by more than one
polynucleotide sequence. Homology does not need to be perfect
homology (e.g., 100%), as partially homologous sequences are also
contemplated by the instant invention (e.g., 99%, 98%, 97%, 96%,
95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%,
82%, 81%, 80% etc.).
[0210] By "conserved sequence region" is meant, a nucleotide
sequence of one or more regions in a polynucleotide does not vary
significantly between generations or from one biological system,
subject, or organism to another biological system, subject, or
organism. The polynucleotide can include both coding and non-coding
DNA and RNA.
[0211] By "sense region" is meant a nucleotide sequence of a siNA
molecule having complementarity to an antisense region of the siNA
molecule. In addition, the sense region of a siNA molecule can
comprise a nucleic acid sequence having homology with a target
nucleic acid sequence.
[0212] By "antisense region" is meant a nucleotide sequence of a
siNA molecule having complementarity to a target nucleic acid
sequence. In addition, the antisense region of a siNA molecule can
optionally comprise a nucleic acid sequence having complementarity
to a sense region of the siNA molecule.
[0213] By "target nucleic acid" is meant any nucleic acid sequence
whose expression or activity is to be modulated. The target nucleic
acid can be DNA or RNA.
[0214] By "complementarity" is meant that a nucleic acid can form
hydrogen bond(s) with another nucleic acid sequence by either
traditional Watson-Crick or other non-traditional types. In
reference to the nucleic molecules of the present invention, the
binding free energy for a nucleic acid molecule with its
complementary sequence is sufficient to allow the relevant function
of the nucleic acid to proceed, e.g., RNAi activity. Determination
of binding free energies for nucleic acid molecules is well known
in the art (see, e.g., Turner et al., 1987, CSH Symp. Quant. Biol.
LII pp. 123-133; Frier et al., 1986, Proc. Nat. Acad. Sci. USA
83:9373-9377; Turner et al., 1987, J. Am. Chem. Soc.
109:3783-3785). A percent complementarity indicates the percentage
of contiguous residues in a nucleic acid molecule that can form
hydrogen bonds (e.g., Watson-Crick base pairing) with a second
nucleic acid sequence (e.g., 5, 6, 7, 8, 9, or 10 nucleotides out
of a total of 10 nucleotides in the first oligonucleotide being
based paired to a second nucleic acid sequence having 10
nucleotides represents 50%, 60%, 70%, 80%, 90%, and 100%
complementary respectively). "Perfectly complementary" means that
all the contiguous residues of a nucleic acid sequence will
hydrogen bond with the same number of contiguous residues in a
second nucleic acid sequence. In one embodiment, a siNA molecule of
the invention comprises about 15 to about 30 or more (e.g., about
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30
or more) nucleotides that are complementary to one or more target
nucleic acid molecules or a portion thereof.
[0215] In one embodiment, siNA molecules of the invention that down
regulate or reduce TNF and/or TNF receptor gene expression are used
for preventing or treating cancer, proliferative, inflammatory,
respiratory, neurological, cardiovascular and/or autoimmune
diseases, disorders, and/or conditions in a subject or
organism.
[0216] In one embodiment, the siNA molecules of the invention are
used to treat cancer, proliferative, inflammatory, respiratory,
neurological, cardiovascular and/or autoimmune diseases, disorders,
and/or conditions in a subject or organism.
[0217] By "proliferative disease" or "cancer" as used herein is
meant, any disease, condition, trait, genotype or phenotype
characterized by unregulated cell growth or replication as is known
in the art; including AIDS related cancers such as Kaposi's
sarcoma; breast cancers; bone cancers such as Osteosarcoma,
Chondrosarcomas, Ewing's sarcoma, Fibrosarcomas, Giant cell tumors,
Adamantinomas, and Chordomas; Brain cancers such as Meningiomas,
Glioblastomas, Lower-Grade Astrocytomas, Oligodendrocytomas,
Pituitary Tumors, Schwannomas, and Metastatic brain cancers;
cancers of the head and neck including various lymphomas such as
mantle cell lymphoma, non-Hodgkins lymphoma, adenoma, squamous cell
carcinoma, laryngeal carcinoma, gallbladder and bile duct cancers,
cancers of the retina such as retinoblastoma, cancers of the
esophagus, gastric cancers, multiple myeloma, ovarian cancer,
uterine cancer, thyroid cancer, testicular cancer, endometrial
cancer, melanoma, colorectal cancer, lung cancer, bladder cancer,
prostate cancer, lung cancer (including non-small cell lung
carcinoma), pancreatic cancer, sarcomas, Wilms' tumor, cervical
cancer, head and neck cancer, skin cancers, nasopharyngeal
carcinoma, liposarcoma, epithelial carcinoma, renal cell carcinoma,
gallbladder adeno carcinoma, parotid adenocarcinoma, endometrial
sarcoma, multidrug resistant cancers; and proliferative diseases
and conditions, such as neovascularization associated with tumor
angiogenesis, macular degeneration (e.g., wet/dry AMD), corneal
neovascularization, diabetic retinopathy, neovascular glaucoma,
myopic degeneration and other proliferative diseases and conditions
such as restenosis and polycystic kidney disease, and any other
cancer or proliferative disease, condition, trait, genotype or
phenotype that can respond to the modulation of disease related
gene expression in a cell or tissue, alone or in combination with
other therapies.
[0218] By "inflammatory disease" or "inflammatory condition" as
used herein is meant any disease, condition, trait, genotype or
phenotype characterized by an inflammatory or allergic process as
is known in the art, such as inflammation, acute inflammation,
chronic inflammation, respiratory disease, atherosclerosis,
restenosis, asthma, allergic rhinitis, atopic dermatitis, septic
shock, rheumatoid arthritis, inflammatory bowl disease,
inflammatory pelvic disease, pain, ocular inflammatory disease,
celiac disease, Leigh Syndrome, Glycerol Kinase Deficiency,
Familial eosinophilia (FE), autosomal recessive spastic ataxia,
laryngeal inflammatory disease; Tuberculosis, Chronic
cholecystitis, Bronchiectasis, Silicosis and other pneumoconioses,
and any other inflammatory disease, condition, trait, genotype or
phenotype that can respond to the modulation of disease related
gene expression in a cell or tissue, alone or in combination with
other therapies.
[0219] By "autoimmune disease" or "autoimmune condition" as used
herein is meant, any disease, condition, trait, genotype or
phenotype characterized by autoimmunity as is known in the art,
such as multiple sclerosis, diabetes mellitus, lupus, celiac
disease, Crohn's disease, ulcerative colitis, Guillain-Barre
syndrome, scleroderms, Goodpasture's syndrome, Wegener's
granulomatosis, autoimmune epilepsy, Rasmussen's encephalitis,
Primary biliary sclerosis, Sclerosing cholangitis, Autoimmune
hepatitis, Addison's disease, Hashimoto's thyroiditis,
Fibromyalgia, Menier's syndrome; transplantation rejection (e.g.,
prevention of allograft rejection) pernicious anemia, rheumatoid
arthritis, systemic lupus erythematosus, dermatomyositis, Sjogren's
syndrome, lupus erythematosus, multiple sclerosis, myasthenia
gravis, Reiter's syndrome, Grave's disease, and any other
autoimmune disease, condition, trait, genotype or phenotype that
can respond to the modulation of disease related gene expression in
a cell or tissue, alone or in combination with other therapies.
[0220] By "neurologic disease" or "neurological disease" is meant
any disease, disorder, or condition affecting the central or
peripheral nervous system, including ADHD, AIDS-Neurological
Complications, Absence of the Septum Pellucidum, Acquired
Epileptiform Aphasia, Acute Disseminated Encephalomyelitis,
Adrenoleukodystrophy, Agenesis of the Corpus Callosum, Agnosia,
Aicardi Syndrome, Alexander Disease, Alpers' Disease, Alternating
Hemiplegia, Alzheimer's Disease, Amyotrophic Lateral Sclerosis,
Anencephaly, Aneurysm, Angelman Syndrome, Angiomatosis, Anoxia,
Aphasia, Apraxia, Arachnoid Cysts, Arachnoiditis, Arnold-Chiari
Malformation, Arteriovenous Malformation, Aspartame, Asperger
Syndrome, Ataxia Telangiectasia, Ataxia, Attention
Deficit-Hyperactivity Disorder, Autism, Autonomic Dysfunction, Back
Pain, Barth Syndrome, Batten Disease, Behcet's Disease, Bell's
Palsy, Benign Essential Blepharospasm, Benign Focal Amyotrophy,
Benign Intracranial Hypertension, Bernhardt-Roth Syndrome,
Binswanger's Disease, Blepharospasm, Bloch-Sulzberger Syndrome,
Brachial Plexus Birth Injuries, Brachial Plexus Injuries,
Bradbury-Eggleston Syndrome, Brain Aneurysm, Brain Injury, Brain
and Spinal Tumors, Brown-Sequard Syndrome, Bulbospinal Muscular
Atrophy, Canavan Disease, Carpal Tunnel Syndrome, Causalgia,
Cavernomas, Cavernous Angioma, Cavernous Malformation, Central
Cervical Cord Syndrome, Central Cord Syndrome, Central Pain
Syndrome, Cephalic Disorders, Cerebellar Degeneration, Cerebellar
Hypoplasia, Cerebral Aneurysm, Cerebral Arteriosclerosis, Cerebral
Atrophy, Cerebral Beriberi, Cerebral Gigantism, Cerebral Hypoxia,
Cerebral Palsy, Cerebro-Oculo-Facio-Skeletal Syndrome,
Charcot-Marie-Tooth Disorder, Chiari Malformation, Chorea,
Choreoacanthocytosis, Chronic Inflammatory Demyelinating
Polyneuropathy (CIDP), Chronic Orthostatic Intolerance, Chronic
Pain, Cockayne Syndrome Type II, Coffin Lowry Syndrome, Coma,
including Persistent Vegetative State, Complex Regional Pain
Syndrome, Congenital Facial Diplegia, Congenital Myasthenia,
Congenital Myopathy, Congenital Vascular Cavernous Malformations,
Corticobasal Degeneration, Cranial Arteritis, Craniosynostosis,
Creutzfeldt-Jakob Disease, Cumulative Trauma Disorders, Cushing's
Syndrome, Cytomegalic Inclusion Body Disease (CIBD),
Cytomegalovirus Infection, Dancing Eyes-Dancing Feet Syndrome,
Dandy-Walker Syndrome, Dawson Disease, De Morsier's Syndrome,
Dejerine-Klumpke Palsy, Dementia-Multi-Infarct,
Dementia-Subcortical, Dementia With Lewy Bodies, Dermatomyositis,
Developmental Dyspraxia, Devic's Syndrome, Diabetic Neuropathy,
Diffuse Sclerosis, Dravet's Syndrome, Dysautonomia, Dysgraphia,
Dyslexia, Dysphagia, Dyspraxia, Dystonias, Early Infantile
Epileptic Encephalopathy, Empty Sella Syndrome, Encephalitis
Lethargica, Encephalitis and Meningitis, Encephaloceles,
Encephalopathy, Encephalotrigeminal Angiomatosis, Epilepsy, Erb's
Palsy, Erb-Duchenne and Dejerine-Klumpke Palsies, Fabry's Disease,
Fahr's Syndrome, Fainting, Familial Dysautonomia, Familial
Hemangioma, Familial Idiopathic Basal Ganglia Calcification,
Familial Spastic Paralysis, Febrile Seizures (e.g., GEFS and GEFS
plus), Fisher Syndrome, Floppy Infant Syndrome, Friedreich's
Ataxia, Gaucher's Disease, Gerstmann's Syndrome,
Gerstmann-Straussler-Scheinker Disease, Giant Cell Arteritis, Giant
Cell Inclusion Disease, Globoid Cell Leukodystrophy,
Glossopharyngeal Neuralgia, Guillain-Barre Syndrome, HTLV-1
Associated Myelopathy, Hallervorden-Spatz Disease, Head Injury,
Headache, Hemicrania Continua, Hemifacial Spasm, Hemiplegia
Alterans, Hereditary Neuropathies, Hereditary Spastic Paraplegia,
Heredopathia Atactica Polyneuritiformis, Herpes Zoster Oticus,
Herpes Zoster, Hirayama Syndrome, Holoprosencephaly, Huntington's
Disease, Hydranencephaly, Hydrocephalus--Normal Pressure,
Hydrocephalus, Hydromyelia, Hypercortisolism, Hypersomnia,
Hypertonia, Hypotonia, Hypoxia, Immune-Mediated Encephalomyelitis,
Inclusion Body Myositis, Incontinentia Pigmenti, Infantile
Hypotonia, Infantile Phytanic Acid Storage Disease, Infantile
Refsum Disease, Infantile Spasms, Inflammatory Myopathy, Intestinal
Lipodystrophy, Intracranial Cysts, Intracranial Hypertension,
Isaac's Syndrome, Joubert Syndrome, Kearns-Sayre Syndrome,
Kennedy's Disease, Kinsbourne syndrome, Kleine-Levin syndrome,
Klippel Feil Syndrome, Klippel-Trenaunay Syndrome (KTS),
Kluiver-Bucy Syndrome, Korsakoff s Amnesic Syndrome, Krabbe
Disease, Kugelberg-Welander Disease, Kuru, Lambert-Eaton Myasthenic
Syndrome, Landau-Kleffner Syndrome, Lateral Femoral Cutaneous Nerve
Entrapment, Lateral Medullary Syndrome, Learning Disabilities,
Leigh's Disease, Lennox-Gastaut Syndrome, Lesch-Nyhan Syndrome,
Leukodystrophy, Levine-Critchley Syndrome, Lewy Body Dementia,
Lissencephaly, Locked-In Syndrome, Lou Gehrig's Disease,
Lupus--Neurological Sequelae, Lyme Disease--Neurological
Complications, Machado-Joseph Disease, Macrencephaly,
Megalencephaly, Melkersson-Rosenthal Syndrome, Meningitis, Menkes
Disease, Meralgia Paresthetica, Metachromatic Leukodystrophy,
Microcephaly, Migraine, Miller Fisher Syndrome, Mini-Strokes,
Mitochondrial Myopathies, Mobius Syndrome, Monomelic Amyotrophy,
Motor Neuron Diseases, Moyamoya Disease, Mucolipidoses,
Mucopolysaccharidoses, Multi-Infarct Dementia, Multifocal Motor
Neuropathy, Multiple Sclerosis, Multiple System Atrophy with
Orthostatic Hypotension, Multiple System Atrophy, Muscular
Dystrophy, Myasthenia--Congenital, Myasthenia Gravis,
Myelinoclastic Diffuse Sclerosis, Myoclonic Encephalopathy of
Infants, Myoclonus, Myopathy--Congenital, Myopathy--Thyrotoxic,
Myopathy, Myotonia Congenita, Myotonia, Narcolepsy,
Neuroacanthocytosis, Neurodegeneration with Brain Iron
Accumulation, Neurofibromatosis, Neuroleptic Malignant Syndrome,
Neurological Complications of AIDS, Neurological Manifestations of
Pompe Disease, Neuromyelitis Optica, Neuromyotonia, Neuronal Ceroid
Lipofuscinosis, Neuronal Migration Disorders,
Neuropathy--Hereditary, Neurosarcoidosis, Neurotoxicity, Nevus
Cavernosus, Niemann-Pick Disease, O'Sullivan-McLeod Syndrome,
Occipital Neuralgia, Occult Spinal Dysraphism Sequence, Ohtahara
Syndrome, Olivopontocerebellar Atrophy, Opsoclonus Myoclonus,
Orthostatic Hypotension, Overuse Syndrome, Pain--Chronic,
Paraneoplastic Syndromes, Paresthesia, Parkinson's Disease,
Parmyotonia Congenita, Paroxysmal Choreoathetosis, Paroxysmal
Hemicrania, Parry-Romberg, Pelizaeus-Merzbacher Disease, Pena
Shokeir II Syndrome, Perineural Cysts, Periodic Paralyses,
Peripheral Neuropathy, Periventricular Leukomalacia, Persistent
Vegetative State, Pervasive Developmental Disorders, Phytanic Acid
Storage Disease, Pick's Disease, Piriformis Syndrome, Pituitary
Tumors, Polymyositis, Pompe Disease, Porencephaly, Post-Polio
Syndrome, Postherpetic Neuralgia, Postinfectious Encephalomyelitis,
Postural Hypotension, Postural Orthostatic Tachycardia Syndrome,
Postural Tachycardia Syndrome, Primary Lateral Sclerosis, Prion
Diseases, Progressive Hemifacial Atrophy, Progressive Locomotor
Ataxia, Progressive Multifocal Leukoencephalopathy, Progressive
Sclerosing Poliodystrophy, Progressive Supranuclear Palsy,
Pseudotumor Cerebri, Pyridoxine Dependent and Pyridoxine Responsive
Siezure Disorders, Ramsay Hunt Syndrome Type I, Ramsay Hunt
Syndrome Type II, Rasmussen's Encephalitis and other autoimmune
epilepsies, Reflex Sympathetic Dystrophy Syndrome, Refsum
Disease--Infantile, Refsum Disease, Repetitive Motion Disorders,
Repetitive Stress Injuries, Restless Legs Syndrome,
Retrovirus-Associated Myelopathy, Rett Syndrome, Reye's Syndrome,
Riley-Day Syndrome, SUNCT Headache, Sacral Nerve Root Cysts, Saint
Vitus Dance, Salivary Gland Disease, Sandhoff Disease, Schilder's
Disease, Schizencephaly, Seizure Disorders, Septo-Optic Dysplasia,
Severe Myoclonic Epilepsy of Infancy (SMEI), Shaken Baby Syndrome,
Shingles, Shy-Drager Syndrome, Sjogren's Syndrome, Sleep Apnea,
Sleeping Sickness, Soto's Syndrome, Spasticity, Spina Bifida,
Spinal Cord Infarction, Spinal Cord Injury, Spinal Cord Tumors,
Spinal Muscular Atrophy, Spinocerebellar Atrophy,
Steele-Richardson-Olszewski Syndrome, Stiff-Person Syndrome,
Striatonigral Degeneration, Stroke, Sturge-Weber Syndrome, Subacute
Sclerosing Panencephalitis, Subcortical Arteriosclerotic
Encephalopathy, Swallowing Disorders, Sydenham Chorea, Syncope,
Syphilitic Spinal Sclerosis, Syringohydromyelia, Syringomyelia,
Systemic Lupus Erythematosus, Tabes Dorsalis, Tardive Dyskinesia,
Tarlov Cysts, Tay-Sachs Disease, Temporal Arteritis, Tethered
Spinal Cord Syndrome, Thomsen Disease, Thoracic Outlet Syndrome,
Thyrotoxic Myopathy, Tic Douloureux, Todd's Paralysis, Tourette
Syndrome, Transient Ischemic Attack, Transmissible Spongiform
Encephalopathies, Transverse Myelitis, Traumatic Brain Injury,
Tremor, Trigeminal Neuralgia, Tropical Spastic Paraparesis,
Tuberous Sclerosis, Vascular Erectile Tumor, Vasculitis including
Temporal Arteritis, Von Economo's Disease, Von Hippel-Lindau
disease (VHL), Von Recklinghausen's Disease, Wallenberg's Syndrome,
Werdnig-Hoffman Disease, Wernicke-Korsakoff Syndrome, West
Syndrome, Whipple's Disease, Williams Syndrome, Wilson's Disease,
X-Linked Spinal and Bulbar Muscular Atrophy, and Zellweger
Syndrome.
[0221] By "respiratory disease" is meant, any disease or condition
affecting the respiratory tract, such as asthma, chronic
obstructive pulmonary disease or "COPD", allergic rhinitis,
sinusitis, pulmonary vasoconstriction, inflammation, allergies,
impeded respiration, respiratory distress syndrome, cystic
fibrosis, pulmonary hypertension, pulmonary vasoconstriction,
emphysema, and any other respiratory disease, condition, trait,
genotype or phenotype that can respond to the modulation of disease
related gene expression in a cell or tissue, alone or in
combination with other therapies.
[0222] By "cardiovascular disease" is meant and disease or
condition affecting the heart and vasculature, including but not
limited to, coronary heart disease (CHD), cerebrovascular disease
(CVD), aortic stenosis, peripheral vascular disease,
atherosclerosis, arteriosclerosis, myocardial infarction (heart
attack), cerebrovascular diseases (stroke), transient ischaemic
attacks (TIA), angina (stable and unstable), atrial fibrillation,
arrhythmia, vavular disease, and/or congestive heart failure.
[0223] In one embodiment of the present invention, each sequence of
a siNA molecule of the invention is independently about 15 to about
30 nucleotides in length, in specific embodiments about 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides
in length. In another embodiment, the siNA duplexes of the
invention independently comprise about 15 to about 30 base pairs
(e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, or 30). In another embodiment, one or more strands of the
siNA molecule of the invention independently comprises about 15 to
about 30 nucleotides (e.g., about 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, or 30) that are complementary to a
target nucleic acid molecule. In yet another embodiment, siNA
molecules of the invention comprising hairpin or circular
structures are about 35 to about 55 (e.g., about 35, 40, 45, 50 or
55) nucleotides in length, or about 38 to about 44 (e.g., about 38,
39, 40, 41, 42, 43, or 44) nucleotides in length and comprising
about 15 to about 25 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, or 25) base pairs. Exemplary siNA molecules of the
invention are shown in Table II. Exemplary synthetic siNA molecules
of the invention are shown in Table III and/or FIGS. 4-5.
[0224] As used herein "cell" is used in its usual biological sense,
and does not refer to an entire multicellular organism, e.g.,
specifically does not refer to a human. The cell can be present in
an organism, e.g., birds, plants and mammals such as humans, cows,
sheep, apes, monkeys, swine, dogs, and cats. The cell can be
prokaryotic (e.g., bacterial cell) or eukaryotic (e.g., mammalian
or plant cell). The cell can be of somatic or germ line origin,
totipotent or pluripotent, dividing or non-dividing. The cell can
also be derived from or can comprise a gamete or embryo, a stem
cell, or a fully differentiated cell.
[0225] The siNA molecules of the invention are added directly, or
can be complexed with cationic lipids, packaged within liposomes,
or otherwise delivered to target cells or tissues. The nucleic acid
or nucleic acid complexes can be locally administered to relevant
tissues ex vivo, or in vivo through direct dermal application,
transdermal application, or injection, with or without their
incorporation in biopolymers. In particular embodiments, the
nucleic acid molecules of the invention comprise sequences shown in
Tables II-III and/or FIGS. 4-5. Examples of such nucleic acid
molecules consist essentially of sequences defined in these tables
and figures. Furthermore, the chemically modified constructs
described in Table IV can be applied to any siNA sequence of the
invention.
[0226] In another aspect, the invention provides mammalian cells
containing one or more siNA molecules of this invention. The one or
more siNA molecules can independently be targeted to the same or
different sites.
[0227] By "RNA" is meant a molecule comprising at least one
ribonucleotide residue. By "ribonucleotide" is meant a nucleotide
with a hydroxyl group at the 2' position of a .beta.-D-ribofuranose
moiety. The terms include double-stranded RNA, single-stranded RNA,
isolated RNA such as partially purified RNA, essentially pure RNA,
synthetic RNA, recombinantly produced RNA, as well as altered RNA
that differs from naturally occurring RNA by the addition,
deletion, substitution and/or alteration of one or more
nucleotides. Such alterations can include addition of
non-nucleotide material, such as to the end(s) of the siNA or
internally, for example at one or more nucleotides of the RNA.
Nucleotides in the RNA molecules of the instant invention can also
comprise non-standard nucleotides, such as non-naturally occurring
nucleotides or chemically synthesized nucleotides or
deoxynucleotides. These altered RNAs can be referred to as analogs
or analogs of naturally-occurring RNA.
[0228] By "subject" is meant an organism, which is a donor or
recipient of explanted cells or the cells themselves. "Subject"
also refers to an organism to which the nucleic acid molecules of
the invention can be administered. A subject can be a mammal or
mammalian cells, including a human or human cells.
[0229] The term "phosphorothioate" as used herein refers to an
internucleotide linkage having Formula I, wherein Z and/or W
comprise a sulfur atom. Hence, the term phosphorothioate refers to
both phosphorothioate and phosphorodithioate internucleotide
linkages.
[0230] The term "phosphonoacetate" as used herein refers to an
internucleotide linkage having Formula I, wherein Z and/or W
comprise an acetyl or protected acetyl group.
[0231] The term "thiophosphonoacetate" as used herein refers to an
internucleotide linkage having Formula I, wherein Z comprises an
acetyl or protected acetyl group and W comprises a sulfur atom or
alternately W comprises an acetyl or protected acetyl group and Z
comprises a sulfur atom.
[0232] The term "universal base" as used herein refers to
nucleotide base analogs that form base pairs with each of the
natural DNA/RNA bases with little discrimination between them.
Non-limiting examples of universal bases include C-phenyl,
C-naphthyl and other aromatic derivatives, inosine, azole
carboxamides, and nitroazole derivatives such as 3-nitropyrrole,
4-nitroindole, 5-nitroindole, and 6-nitroindole as known in the art
(see for example Loakes, 2001, Nucleic Acids Research, 29,
2437-2447).
[0233] The term "acyclic nucleotide" as used herein refers to any
nucleotide having an acyclic ribose sugar, for example where any of
the ribose carbons (C1, C2, C3, C4, or C5), are independently or in
combination absent from the nucleotide.
[0234] The nucleic acid molecules of the instant invention,
individually, or in combination or in conjunction with other drugs,
can be used to for preventing or treating cancer, proliferative,
inflammatory, respiratory, neurologic, cardiovascular and/or
autoimmune diseases, conditions, or disorders in a subject or
organism.
[0235] For example, the siNA molecules can be administered to a
subject or can be administered to other appropriate cells evident
to those skilled in the art, individually or in combination with
one or more drugs under conditions suitable for the treatment.
[0236] In a further embodiment, the siNA molecules can be used in
combination with other known treatments to prevent or treat cancer,
proliferative, inflammatory, respiratory, neurologic,
cardiovascular and/or autoimmune diseases, conditions, or disorders
in a subject or organism. For example, the described molecules
could be used in combination with one or more known compounds,
treatments, or procedures to prevent or treat cancer,
proliferative, inflammatory, respiratory, neurologic,
cardiovascular and/or autoimmune diseases, conditions, or disorders
in a subject or organism as are known in the art.
[0237] In one embodiment, the invention features an expression
vector comprising a nucleic acid sequence encoding at least one
siNA molecule of the invention, in a manner which allows expression
of the siNA molecule. For example, the vector can contain
sequence(s) encoding both strands of a siNA molecule comprising a
duplex. The vector can also contain sequence(s) encoding a single
nucleic acid molecule that is self-complementary and thus forms a
siNA molecule. Non-limiting examples of such expression vectors are
described in Paul et al., 2002, Nature Biotechnology, 19, 505;
Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497; Lee et
al., 2002, Nature Biotechnology, 19, 500; and Novina et al., 2002,
Nature Medicine, advance online publication doi: 10.1038/nm725.
[0238] In another embodiment, the invention features a mammalian
cell, for example, a human cell, including an expression vector of
the invention.
[0239] In yet another embodiment, the expression vector of the
invention comprises a sequence for a siNA molecule having
complementarity to a RNA molecule referred to by a Genbank
Accession numbers, for example Genbank Accession Nos. shown in
Table I.
[0240] In one embodiment, an expression vector of the invention
comprises a nucleic acid sequence encoding two or more siNA
molecules, which can be the same or different.
[0241] In another aspect of the invention, siNA molecules that
interact with target RNA molecules and down-regulate gene encoding
target RNA molecules (for example target RNA molecules referred to
by Genbank Accession numbers herein) are expressed from
transcription units inserted into DNA or RNA vectors. The
recombinant vectors can be DNA plasmids or viral vectors. siNA
expressing viral vectors can be constructed based on, but not
limited to, adeno-associated virus, retrovirus, adenovirus, or
alphavirus. The recombinant vectors capable of expressing the siNA
molecules can be delivered as described herein, and persist in
target cells. Alternatively, viral vectors can be used that provide
for transient expression of siNA molecules. Such vectors can be
repeatedly administered as necessary. Once expressed, the siNA
molecules bind and down-regulate gene function or expression via
RNA interference (RNAi). Delivery of siNA expressing vectors can be
systemic, such as by intravenous or intramuscular administration,
by administration to target cells ex-planted from a subject
followed by reintroduction into the subject, or by any other means
that would allow for introduction into the desired target cell.
[0242] By "vectors" is meant any nucleic acid- and/or viral-based
technique used to deliver a desired nucleic acid.
[0243] Other features and advantages of the invention will be
apparent from the following description of the preferred
embodiments thereof, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0244] FIG. 1 shows a non-limiting example of a scheme for the
synthesis of siNA molecules. The complementary siNA sequence
strands, strand 1 and strand 2, are synthesized in tandem and are
connected by a cleavable linkage, such as a nucleotide succinate or
abasic succinate, which can be the same or different from the
cleavable linker used for solid phase synthesis on a solid support.
The synthesis can be either solid phase or solution phase, in the
example shown, the synthesis is a solid phase synthesis. The
synthesis is performed such that a protecting group, such as a
dimethoxytrityl group, remains intact on the terminal nucleotide of
the tandem oligonucleotide. Upon cleavage and deprotection of the
oligonucleotide, the two siNA strands spontaneously hybridize to
form a siNA duplex, which allows the purification of the duplex by
utilizing the properties of the terminal protecting group, for
example by applying a trityl on purification method wherein only
duplexes/oligonucleotides with the terminal protecting group are
isolated.
[0245] FIG. 2 shows a MALDI-TOF mass spectrum of a purified siNA
duplex synthesized by a method of the invention. The two peaks
shown correspond to the predicted mass of the separate siNA
sequence strands. This result demonstrates that the siNA duplex
generated from tandem synthesis can be purified as a single entity
using a simple trityl-on purification methodology.
[0246] FIG. 3 shows a non-limiting proposed mechanistic
representation of target RNA degradation involved in RNAi.
Double-stranded RNA (dsRNA), which is generated by RNA-dependent
RNA polymerase (RdRP) from foreign single-stranded RNA, for example
viral, transposon, or other exogenous RNA, activates the DICER
enzyme that in turn generates siNA duplexes. Alternately, synthetic
or expressed siNA can be introduced directly into a cell by
appropriate means. An active siNA complex forms which recognizes a
target RNA, resulting in degradation of the target RNA by the RISC
endonuclease complex or in the synthesis of additional RNA by
RNA-dependent RNA polymerase (RdRP), which can activate DICER and
result in additional siNA molecules, thereby amplifying the RNAi
response.
[0247] FIG. 4A-F shows non-limiting examples of chemically-modified
siNA constructs of the present invention. In the figure, N stands
for any nucleotide (adenosine, guanosine, cytosine, uridine, or
optionally thymidine, for example thymidine can be substituted in
the overhanging regions designated by parenthesis (N N). Various
modifications are shown for the sense and antisense strands of the
siNA constructs.
[0248] FIG. 4A: The sense strand comprises 21 nucleotides wherein
the two terminal 3'-nucleotides are optionally base paired and
wherein all nucleotides present are ribonucleotides except for (N
N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. The antisense strand comprises 21 nucleotides,
optionally having a 3'-terminal glyceryl moiety wherein the two
terminal 3'-nucleotides are optionally complementary to the target
RNA sequence, and wherein all nucleotides present are
ribonucleotides except for (N N) nucleotides, which can comprise
ribonucleotides, deoxynucleotides, universal bases, or other
chemical modifications described herein. A modified internucleotide
linkage, such as a phosphorothioate, phosphorodithioate or other
modified internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the antisense
strand.
[0249] FIG. 4B: The sense strand comprises 21 nucleotides wherein
the two terminal 3'-nucleotides are optionally base paired and
wherein all pyrimidine nucleotides that may be present are
2'deoxy-2'-fluoro modified nucleotides and all purine nucleotides
that may be present are 2'-O-methyl modified nucleotides except for
(N N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. The antisense strand comprises 21 nucleotides,
optionally having a 3'-terminal glyceryl moiety and wherein the two
terminal 3'-nucleotides are optionally complementary to the target
RNA sequence, and wherein all pyrimidine nucleotides that may be
present are 2'-deoxy-2'-fluoro modified nucleotides and all purine
nucleotides that may be present are 2'-O-methyl modified
nucleotides except for (N N) nucleotides, which can comprise
ribonucleotides, deoxynucleotides, universal bases, or other
chemical modifications described herein. A modified internucleotide
linkage, such as a phosphorothioate, phosphorodithioate or other
modified internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the sense and
antisense strand.
[0250] FIG. 4C: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-O-methyl or
2'-deoxy-2'-fluoro modified nucleotides except for (N N)
nucleotides, which can comprise ribonucleotides, deoxynucleotides,
universal bases, or other chemical modifications described herein.
The antisense strand comprises 21 nucleotides, optionally having a
3'-terminal glyceryl moiety and wherein the two terminal
3'-nucleotides are optionally complementary to the target RNA
sequence, and wherein all pyrimidine nucleotides that may be
present are 2'-deoxy-2'-fluoro modified nucleotides except for (N
N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. A modified internucleotide linkage, such as a
phosphorothioate, phosphorodithioate or other modified
internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the antisense
strand.
[0251] FIG. 4D: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides except for (N N) nucleotides, which can
comprise ribonucleotides, deoxynucleotides, universal bases, or
other chemical modifications described herein and wherein and all
purine nucleotides that may be present are 2'-deoxy nucleotides.
The antisense strand comprises 21 nucleotides, optionally having a
3'-terminal glyceryl moiety and wherein the two terminal
3'-nucleotides are optionally complementary to the target RNA
sequence, wherein all pyrimidine nucleotides that may be present
are 2'-deoxy-2'-fluoro modified nucleotides and all purine
nucleotides that may be present are 2'-O-methyl modified
nucleotides except for (N N) nucleotides, which can comprise
ribonucleotides, deoxynucleotides, universal bases, or other
chemical modifications described herein. A modified internucleotide
linkage, such as a phosphorothioate, phosphorodithioate or other
modified internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the antisense
strand.
[0252] FIG. 4E: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides except for (N N) nucleotides, which can
comprise ribonucleotides, deoxynucleotides, universal bases, or
other chemical modifications described herein. The antisense strand
comprises 21 nucleotides, optionally having a 3'-terminal glyceryl
moiety and wherein the two terminal 3'-nucleotides are optionally
complementary to the target RNA sequence, and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides and all purine nucleotides that may be present
are 2'-O-methyl modified nucleotides except for (N N) nucleotides,
which can comprise ribonucleotides, deoxynucleotides, universal
bases, or other chemical modifications described herein. A modified
internucleotide linkage, such as a phosphorothioate,
phosphorodithioate or other modified internucleotide linkage as
described herein, shown as "s", optionally connects the (N N)
nucleotides in the antisense strand.
[0253] FIG. 4F: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides except for (N N) nucleotides, which can
comprise ribonucleotides, deoxynucleotides, universal bases, or
other chemical modifications described herein and wherein and all
purine nucleotides that may be present are 2'-deoxy nucleotides.
The antisense strand comprises 21 nucleotides, optionally having a
3'-terminal glyceryl moiety and wherein the two terminal
3'-nucleotides are optionally complementary to the target RNA
sequence, and having one 3'-terminal phosphorothioate
internucleotide linkage and wherein all pyrimidine nucleotides that
may be present are 2'-deoxy-2'-fluoro modified nucleotides and all
purine nucleotides that may be present are 2'-deoxy nucleotides
except for (N N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. A modified internucleotide linkage, such as a
phosphorothioate, phosphorodithioate or other modified
internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the antisense strand.
The antisense strand of constructs A-F comprise sequence
complementary to any target nucleic acid sequence of the invention.
Furthermore, when a glyceryl moiety (L) is present at the 3'-end of
the antisense strand for any construct shown in FIG. 4 A-F, the
modified internucleotide linkage is optional.
[0254] FIG. 5A-F shows non-limiting examples of specific
chemically-modified siNA sequences of the invention. A-F applies
the chemical modifications described in FIG. 4A-F to a TNF receptor
siNA sequence. Such chemical modifications can be applied to any
TNF and/or TNF receptor sequence and/or TNF and/or TNF receptor
polymorphism sequence.
[0255] FIG. 6 shows non-limiting examples of different siNA
constructs of the invention. The examples shown (constructs 1, 2,
and 3) have 19 representative base pairs; however, different
embodiments of the invention include any number of base pairs
described herein. Bracketed regions represent nucleotide overhangs,
for example, comprising about 1, 2, 3, or 4 nucleotides in length,
preferably about 2 nucleotides. Constructs 1 and 2 can be used
independently for RNAi activity. Construct 2 can comprise a
polynucleotide or non-nucleotide linker, which can optionally be
designed as a biodegradable linker. In one embodiment, the loop
structure shown in construct 2 can comprise a biodegradable linker
that results in the formation of construct 1 in vivo and/or in
vitro. In another example, construct 3 can be used to generate
construct 2 under the same principle wherein a linker is used to
generate the active siNA construct 2 in vivo and/or in vitro, which
can optionally utilize another biodegradable linker to generate the
active siNA construct 1 in vivo and/or in vitro. As such, the
stability and/or activity of the siNA constructs can be modulated
based on the design of the siNA construct for use in vivo or in
vitro and/or in vitro.
[0256] FIG. 7A-C is a diagrammatic representation of a scheme
utilized in generating an expression cassette to generate siNA
hairpin constructs.
[0257] FIG. 7A: A DNA oligomer is synthesized with a 5'-restriction
site (R1) sequence followed by a region having sequence identical
(sense region of siNA) to a predetermined TNF and/or TNF receptor
target sequence, wherein the sense region comprises, for example,
about 19, 20, 21, or 22 nucleotides (N) in length, which is
followed by a loop sequence of defined sequence (X), comprising,
for example, about 3 to about 10 nucleotides.
[0258] FIG. 7B: The synthetic construct is then extended by DNA
polymerase to generate a hairpin structure having
self-complementary sequence that will result in a siNA transcript
having specificity for a TNF and/or TNF receptor target sequence
and having self-complementary sense and antisense regions.
[0259] FIG. 7C: The construct is heated (for example to about
95.degree. C.) to linearize the sequence, thus allowing extension
of a complementary second DNA strand using a primer to the
3'-restriction sequence of the first strand. The double-stranded
DNA is then inserted into an appropriate vector for expression in
cells. The construct can be designed such that a 3'-terminal
nucleotide overhang results from the transcription, for example, by
engineering restriction sites and/or utilizing a poly-U termination
region as described in Paul et al., 2002, Nature Biotechnology, 29,
505-508.
[0260] FIG. 8A-C is a diagrammatic representation of a scheme
utilized in generating an expression cassette to generate
double-stranded siNA constructs.
[0261] FIG. 8A: A DNA oligomer is synthesized with a 5'-restriction
(R1) site sequence followed by a region having sequence identical
(sense region of siNA) to a predetermined TNF and/or TNF receptor
target sequence, wherein the sense region comprises, for example,
about 19, 20, 21, or 22 nucleotides (N) in length, and which is
followed by a 3'-restriction site (R2) which is adjacent to a loop
sequence of defined sequence (X).
[0262] FIG. 8B: The synthetic construct is then extended by DNA
polymerase to generate a hairpin structure having
self-complementary sequence.
[0263] FIG. 8C: The construct is processed by restriction enzymes
specific to R1 and R2 to generate a double-stranded DNA which is
then inserted into an appropriate vector for expression in cells.
The transcription cassette is designed such that a U6 promoter
region flanks each side of the dsDNA which generates the separate
sense and antisense strands of the siNA. Poly T termination
sequences can be added to the constructs to generate U overhangs in
the resulting transcript.
[0264] FIG. 9A-E is a diagrammatic representation of a method used
to determine target sites for siNA mediated RNAi within a
particular target nucleic acid sequence, such as messenger RNA.
[0265] FIG. 9A: A pool of siNA oligonucleotides are synthesized
wherein the antisense region of the siNA constructs has
complementarity to target sites across the target nucleic acid
sequence, and wherein the sense region comprises sequence
complementary to the antisense region of the siNA.
[0266] FIGS. 9B&C: (FIG. 9B) The sequences are pooled and are
inserted into vectors such that (FIG. 9C) transfection of a vector
into cells results in the expression of the siNA.
[0267] FIG. 9D: Cells are sorted based on phenotypic change that is
associated with modulation of the target nucleic acid sequence.
[0268] FIG. 9E: The siNA is isolated from the sorted cells and is
sequenced to identify efficacious target sites within the target
nucleic acid sequence.
[0269] FIG. 10 shows non-limiting examples of different
stabilization chemistries (1-10) that can be used, for example, to
stabilize the 3'-end of siNA sequences of the invention, including
(1) [3-3']-inverted deoxyribose; (2) deoxyribonucleotide; (3)
[5'-3']-3'-deoxyribonucleotide; (4) [5'-3']-ribonucleotide; (5)
[5'-3']-3'-O-methyl ribonucleotide; (6) 3'-glyceryl; (7)
[3'-5']-3'-deoxyribonucleotide; (8) [3'-3']-deoxyribonucleotide;
(9) [5'-2']-deoxyribonucleotide; and (10)
[5-3']-dideoxyribonucleotide. In addition to modified and
unmodified backbone chemistries indicated in the figure, these
chemistries can be combined with different backbone modifications
as described herein, for example, backbone modifications having
Formula I. In addition, the 2'-deoxy nucleotide shown 5' to the
terminal modifications shown can be another modified or unmodified
nucleotide or non-nucleotide described herein, for example
modifications having any of Formulae I-VII or any combination
thereof.
[0270] FIG. 11 shows a non-limiting example of a strategy used to
identify chemically modified siNA constructs of the invention that
are nuclease resistance while preserving the ability to mediate
RNAi activity. Chemical modifications are introduced into the siNA
construct based on educated design parameters (e.g. introducing
2'-modifications, base modifications, backbone modifications,
terminal cap modifications etc). The modified construct in tested
in an appropriate system (e.g. human serum for nuclease resistance,
shown, or an animal model for PK/delivery parameters). In parallel,
the siNA construct is tested for RNAi activity, for example in a
cell culture system such as a luciferase reporter assay). Lead siNA
constructs are then identified which possess a particular
characteristic while maintaining RNAi activity, and can be further
modified and assayed once again. This same approach can be used to
identify siNA-conjugate molecules with improved pharmacokinetic
profiles, delivery, and RNAi activity.
[0271] FIG. 12 shows non-limiting examples of phosphorylated siNA
molecules of the invention, including linear and duplex constructs
and asymmetric derivatives thereof.
[0272] FIG. 13 shows non-limiting examples of chemically modified
terminal phosphate groups of the invention.
[0273] FIG. 14A shows a non-limiting example of methodology used to
design self complementary DFO constructs utilizing palindrome
and/or repeat nucleic acid sequences that are identified in a
target nucleic acid sequence. (i) A palindrome or repeat sequence
is identified in a nucleic acid target sequence. (ii) A sequence is
designed that is complementary to the target nucleic acid sequence
and the palindrome sequence. (iii) An inverse repeat sequence of
the non-palindrome/repeat portion of the complementary sequence is
appended to the 3'-end of the complementary sequence to generate a
self complementary DFO molecule comprising sequence complementary
to the nucleic acid target. (iv) The DFO molecule can self-assemble
to form a double stranded oligonucleotide. FIG. 14B shows a
non-limiting representative example of a duplex forming
oligonucleotide sequence. FIG. 14C shows a non-limiting example of
the self assembly schematic of a representative duplex forming
oligonucleotide sequence.
[0274] FIG. 14D shows a non-limiting example of the self assembly
schematic of a representative duplex forming oligonucleotide
sequence followed by interaction with a target nucleic acid
sequence resulting in modulation of gene expression.
[0275] FIG. 15 shows a non-limiting example of the design of self
complementary DFO constructs utilizing palindrome and/or repeat
nucleic acid sequences that are incorporated into the DFO
constructs that have sequence complementary to any target nucleic
acid sequence of interest. Incorporation of these palindrome/repeat
sequences allow the design of DFO constructs that form duplexes in
which each strand is capable of mediating modulation of target gene
expression, for example by RNAi. First, the target sequence is
identified. A complementary sequence is then generated in which
nucleotide or non-nucleotide modifications (shown as X or Y) are
introduced into the complementary sequence that generate an
artificial palindrome (shown as XYXYXY in the Figure). An inverse
repeat of the non-palindrome/repeat complementary sequence is
appended to the 3'-end of the complementary sequence to generate a
self complementary DFO comprising sequence complementary to the
nucleic acid target. The DFO can self-assemble to form a double
stranded oligonucleotide.
[0276] FIG. 16 shows non-limiting examples of multifunctional siNA
molecules of the invention comprising two separate polynucleotide
sequences that are each capable of mediating RNAi directed cleavage
of differing target nucleic acid sequences. FIG. 16A shows a
non-limiting example of a multifunctional siNA molecule having a
first region that is complementary to a first target nucleic acid
sequence (complementary region 1) and a second region that is
complementary to a second target nucleic acid sequence
(complementary region 2), wherein the first and second
complementary regions are situated at the 3'-ends of each
polynucleotide sequence in the multifunctional siNA. The dashed
portions of each polynucleotide sequence of the multifunctional
siNA construct have complementarity with regard to corresponding
portions of the siNA duplex, but do not have complementarity to the
target nucleic acid sequences. FIG. 16B shows a non-limiting
example of a multifunctional siNA molecule having a first region
that is complementary to a first target nucleic acid sequence
(complementary region 1) and a second region that is complementary
to a second target nucleic acid sequence (complementary region 2),
wherein the first and second complementary regions are situated at
the 5'-ends of each polynucleotide sequence in the multifunctional
siNA. The dashed portions of each polynucleotide sequence of the
multifunctional siNA construct have complementarity with regard to
corresponding portions of the siNA duplex, but do not have
complementarity to the target nucleic acid sequences.
[0277] FIG. 17 shows non-limiting examples of multifunctional siNA
molecules of the invention comprising a single polynucleotide
sequence comprising distinct regions that are each capable of
mediating RNAi directed cleavage of differing target nucleic acid
sequences. FIG. 17A shows a non-limiting example of a
multifunctional siNA molecule having a first region that is
complementary to a first target nucleic acid sequence
(complementary region 1) and a second region that is complementary
to a second target nucleic acid sequence (complementary region 2),
wherein the second complementary region is situated at the 3'-end
of the polynucleotide sequence in the multifunctional siNA. The
dashed portions of each polynucleotide sequence of the
multifunctional siNA construct have complementarity with regard to
corresponding portions of the siNA duplex, but do not have
complementarity to the target nucleic acid sequences. FIG. 17B
shows a non-limiting example of a multifunctional siNA molecule
having a first region that is complementary to a first target
nucleic acid sequence (complementary region 1) and a second region
that is complementary to a second target nucleic acid sequence
(complementary region 2), wherein the first complementary region is
situated at the 5'-end of the polynucleotide sequence in the
multifunctional siNA. The dashed portions of each polynucleotide
sequence of the multifunctional siNA construct have complementarity
with regard to corresponding portions of the siNA duplex, but do
not have complementarity to the target nucleic acid sequences. In
one embodiment, these multifunctional siNA constructs are processed
in vivo or in vitro to generate multifunctional siNA constructs as
shown in FIG. 16.
[0278] FIG. 18 shows non-limiting examples of multifunctional siNA
molecules of the invention comprising two separate polynucleotide
sequences that are each capable of mediating RNAi directed cleavage
of differing target nucleic acid sequences and wherein the
multifunctional siNA construct further comprises a self
complementary, palindrome, or repeat region, thus enabling shorter
bifunctional siNA constructs that can mediate RNA interference
against differing target nucleic acid sequences. FIG. 18A shows a
non-limiting example of a multifunctional siNA molecule having a
first region that is complementary to a first target nucleic acid
sequence (complementary region 1) and a second region that is
complementary to a second target nucleic acid sequence
(complementary region 2), wherein the first and second
complementary regions are situated at the 3'-ends of each
polynucleotide sequence in the multifunctional siNA, and wherein
the first and second complementary regions further comprise a self
complementary, palindrome, or repeat region. The dashed portions of
each polynucleotide sequence of the multifunctional siNA construct
have complementarity with regard to corresponding portions of the
siNA duplex, but do not have complementarity to the target nucleic
acid sequences. FIG. 18B shows a non-limiting example of a
multifunctional siNA molecule having a first region that is
complementary to a first target nucleic acid sequence
(complementary region 1) and a second region that is complementary
to a second target nucleic acid sequence (complementary region 2),
wherein the first and second complementary regions are situated at
the 5'-ends of each polynucleotide sequence in the multifunctional
siNA, and wherein the first and second complementary regions
further comprise a self complementary, palindrome, or repeat
region. The dashed portions of each polynucleotide sequence of the
multifunctional siNA construct have complementarity with regard to
corresponding portions of the siNA duplex, but do not have
complementarity to the target nucleic acid sequences.
[0279] FIG. 19 shows non-limiting examples of multifunctional siNA
molecules of the invention comprising a single polynucleotide
sequence comprising distinct regions that are each capable of
mediating RNAi directed cleavage of differing target nucleic acid
sequences and wherein the multifunctional siNA construct further
comprises a self complementary, palindrome, or repeat region, thus
enabling shorter bifunctional siNA constructs that can mediate RNA
interference against differing target nucleic acid sequences. FIG.
19A shows a non-limiting example of a multifunctional siNA molecule
having a first region that is complementary to a first target
nucleic acid sequence (complementary region 1) and a second region
that is complementary to a second target nucleic acid sequence
(complementary region 2), wherein the second complementary region
is situated at the 3'-end of the polynucleotide sequence in the
multifunctional siNA, and wherein the first and second
complementary regions further comprise a self complementary,
palindrome, or repeat region. The dashed portions of each
polynucleotide sequence of the multifunctional siNA construct have
complementarity with regard to corresponding portions of the siNA
duplex, but do not have complementarity to the target nucleic acid
sequences. FIG. 19B shows a non-limiting example of a
multifunctional siNA molecule having a first region that is
complementary to a first target nucleic acid sequence
(complementary region 1) and a second region that is complementary
to a second target nucleic acid sequence (complementary region 2),
wherein the first complementary region is situated at the 5'-end of
the polynucleotide sequence in the multifunctional siNA, and
wherein the first and second complementary regions further comprise
a self complementary, palindrome, or repeat region. The dashed
portions of each polynucleotide sequence of the multifunctional
siNA construct have complementarity with regard to corresponding
portions of the siNA duplex, but do not have complementarity to the
target nucleic acid sequences. In one embodiment, these
multifunctional siNA constructs are processed in vivo or in vitro
to generate multifunctional siNA constructs as shown in FIG.
18.
[0280] FIG. 20 shows a non-limiting example of how multifunctional
siNA molecules of the invention can target two separate target
nucleic acid molecules, such as separate RNA molecules encoding
differing proteins, for example, a cytokine and its corresponding
receptor, differing viral strains, a virus and a cellular protein
involved in viral infection or replication, or differing proteins
involved in a common or divergent biologic pathway that is
implicated in the maintenance of progression of disease. Each
strand of the multifunctional siNA construct comprises a region
having complementarity to separate target nucleic acid molecules.
The multifunctional siNA molecule is designed such that each strand
of the siNA can be utilized by the RISC to initiate RNA
interference mediated cleavage of its corresponding target. These
design parameters can include destabilization of each end of the
siNA construct (see for example Schwarz et al., 2003, Cell, 115,
199-208). Such destabilization can be accomplished for example by
using guanosine-cytidine base pairs, alternate base pairs (e.g.,
wobbles), or destabilizing chemically modified nucleotides at
terminal nucleotide positions as is known in the art.
[0281] FIG. 21 shows a non-limiting example of how multifunctional
siNA molecules of the invention can target two separate target
nucleic acid sequences within the same target nucleic acid
molecule, such as alternate coding regions of a RNA, coding and
non-coding regions of a RNA, or alternate splice variant regions of
a RNA. Each strand of the multifunctional siNA construct comprises
a region having complementarity to the separate regions of the
target nucleic acid molecule. The multifunctional siNA molecule is
designed such that each strand of the siNA can be utilized by the
RISC to initiate RNA interference mediated cleavage of its
corresponding target region. These design parameters can include
destabilization of each end of the siNA construct (see for example
Schwarz et al., 2003, Cell, 115, 199-208). Such destabilization can
be accomplished for example by using guanosine-cytidine base pairs,
alternate base pairs (e.g., wobbles), or destabilizing chemically
modified nucleotides at terminal nucleotide positions as is known
in the art.
[0282] FIG. 22 shows a non-limiting example of reduction of TNF
receptor mRNA in HeLa cells mediated by chemically modified siNAs
that target TNF receptor mRNA. HeLa cells were transfected with
0.25 ug/well of lipid complexed with 25 nM siNA. Active stabilized
siNA constructs (see Tables III and IV) were compared to untreated
cells, matched chemistry irrelevant siNA control constructs (IC),
and cells transfected with lipid alone (transfection control). As
shown in the figure, the siNA constructs significantly reduce TNF
receptor RNA expression.
DETAILED DESCRIPTION OF THE INVENTION
Mechanism of Action of Nucleic Acid Molecules of the Invention
[0283] The discussion that follows discusses the proposed mechanism
of RNA interference mediated by short interfering RNA as is
presently known, and is not meant to be limiting and is not an
admission of prior art. Applicant demonstrates herein that
chemically-modified short interfering nucleic acids possess similar
or improved capacity to mediate RNAi as do siRNA molecules and are
expected to possess improved stability and activity in vivo;
therefore, this discussion is not meant to be limiting only to
siRNA and can be applied to siNA as a whole. By "improved capacity
to mediate RNAi" or "improved RNAi activity" is meant to include
RNAi activity measured in vitro and/or in vivo where the RNAi
activity is a reflection of both the ability of the siNA to mediate
RNAi and the stability of the siNAs of the invention. In this
invention, the product of these activities can be increased in
vitro and/or in vivo compared to an all RNA siRNA or a siNA
containing a plurality of ribonucleotides. In some cases, the
activity or stability of the siNA molecule can be decreased (i.e.,
less than ten-fold), but the overall activity of the siNA molecule
is enhanced in vitro and/or in vivo.
[0284] RNA interference refers to the process of sequence specific
post-transcriptional gene silencing in animals mediated by short
interfering RNAs (siRNAs) (Fire et al., 1998, Nature, 391, 806).
The corresponding process in plants is commonly referred to as
post-transcriptional gene silencing or RNA silencing and is also
referred to as quelling in fungi. The process of
post-transcriptional gene silencing is thought to be an
evolutionarily-conserved cellular defense mechanism used to prevent
the expression of foreign genes which is commonly shared by diverse
flora and phyla (Fire et al., 1999, Trends Genet., 15, 358). Such
protection from foreign gene expression may have evolved in
response to the production of double-stranded RNAs (dsRNAs) derived
from viral infection or the random integration of transposon
elements into a host genome via a cellular response that
specifically destroys homologous single-stranded RNA or viral
genomic RNA. The presence of dsRNA in cells triggers the RNAi
response though a mechanism that has yet to be fully characterized.
This mechanism appears to be different from the interferon response
that results from dsRNA-mediated activation of protein kinase PKR
and 2',5'-oligoadenylate synthetase resulting in non-specific
cleavage of mRNA by ribonuclease L.
[0285] The presence of long dsRNAs in cells stimulates the activity
of a ribonuclease III enzyme referred to as Dicer. Dicer is
involved in the processing of the dsRNA into short pieces of dsRNA
known as short interfering RNAs (siRNAs) (Berstein et al., 2001,
Nature, 409, 363). Short interfering RNAs derived from Dicer
activity are typically about 21 to about 23 nucleotides in length
and comprise about 19 base pair duplexes. Dicer has also been
implicated in the excision of 21- and 22-nucleotide small temporal
RNAs (stRNAs) from precursor RNA of conserved structure that are
implicated in translational control (Hutvagner et al., 2001,
Science, 293, 834). The RNAi response also features an endonuclease
complex containing a siRNA, commonly referred to as an RNA-induced
silencing complex (RISC), which mediates cleavage of
single-stranded RNA having sequence homologous to the siRNA.
Cleavage of the target RNA takes place in the middle of the region
complementary to the guide sequence of the siRNA duplex (Elbashir
et al., 2001, Genes Dev., 15, 188). In addition, RNA interference
can also involve small RNA (e.g., micro-RNA or miRNA) mediated gene
silencing, presumably though cellular mechanisms that regulate
chromatin structure and thereby prevent transcription of target
gene sequences (see for example Allshire, 2002, Science, 297,
1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein,
2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297,
2232-2237). As such, siNA molecules of the invention can be used to
mediate gene silencing via interaction with RNA transcripts or
alternately by interaction with particular gene sequences, wherein
such interaction results in gene silencing either at the
transcriptional level or post-transcriptional level.
[0286] RNAi has been studied in a variety of systems. Fire et al.,
1998, Nature, 391, 806, were the first to observe RNAi in C.
elegans. Wianny and Goetz, 1999, Nature Cell Biol., 2, 70, describe
RNAi mediated by dsRNA in mouse embryos. Hammond et al., 2000,
Nature, 404, 293, describe RNAi in Drosophila cells transfected
with dsRNA. Elbashir et al., 2001, Nature, 411, 494, describe RNAi
induced by introduction of duplexes of synthetic 21-nucleotide RNAs
in cultured mammalian cells including human embryonic kidney and
HeLa cells. Recent work in Drosophila embryonic lysates has
revealed certain requirements for siRNA length, structure, chemical
composition, and sequence that are essential to mediate efficient
RNAi activity. These studies have shown that 21 nucleotide siRNA
duplexes are most active when containing two 2-nucleotide
3'-terminal nucleotide overhangs. Furthermore, substitution of one
or both siRNA strands with 2'-deoxy or 2'-O-methyl nucleotides
abolishes RNAi activity, whereas substitution of 3'-terminal siRNA
nucleotides with deoxy nucleotides was shown to be tolerated.
Mismatch sequences in the center of the siRNA duplex were also
shown to abolish RNAi activity. In addition, these studies also
indicate that the position of the cleavage site in the target RNA
is defined by the 5'-end of the siRNA guide sequence rather than
the 3'-end (Elbashir et al., 2001, EMBO J., 20, 6877). Other
studies have indicated that a 5'-phosphate on the
target-complementary strand of a siRNA duplex is required for siRNA
activity and that ATP is utilized to maintain the 5'-phosphate
moiety on the siRNA (Nykanen et al., 2001, Cell, 107, 309);
however, siRNA molecules lacking a 5'-phosphate are active when
introduced exogenously, suggesting that 5'-phosphorylation of siRNA
constructs may occur in vivo.
Synthesis of Nucleic Acid Molecules
[0287] Synthesis of nucleic acids greater than 100 nucleotides in
length is difficult using automated methods, and the therapeutic
cost of such molecules is prohibitive. In this invention, small
nucleic acid motifs ("small" refers to nucleic acid motifs no more
than 100 nucleotides in length, preferably no more than 80
nucleotides in length, and most preferably no more than 50
nucleotides in length; e.g., individual siNA oligonucleotide
sequences or siNA sequences synthesized in tandem) are preferably
used for exogenous delivery. The simple structure of these
molecules increases the ability of the nucleic acid to invade
targeted regions of protein and/or RNA structure. Exemplary
molecules of the instant invention are chemically synthesized, and
others can similarly be synthesized.
[0288] Oligonucleotides (e.g., certain modified oligonucleotides or
portions of oligonucleotides lacking ribonucleotides) are
synthesized using protocols known in the art, for example as
described in Caruthers et al., 1992, Methods in Enzymology 211,
3-19, Thompson et al., International PCT Publication No. WO
99/54459, Wincott et al., 1995, Nucleic Acids Res. 23, 2677-2684,
Wincott et al., 1997, Methods Mol. Bio., 74, 59, Brennan et al.,
1998, Biotechnol Bioeng., 61, 33-45, and Brennan, U.S. Pat. No.
6,001,311. All of these references are incorporated herein by
reference. The synthesis of oligonucleotides makes use of common
nucleic acid protecting and coupling groups, such as
dimethoxytrityl at the 5'-end, and phosphoramidites at the 3'-end.
In a non-limiting example, small scale syntheses are conducted on a
394 Applied Biosystems, Inc. synthesizer using a 0.2 .mu.mol scale
protocol with a 2.5 min coupling step for 2'-O-methylated
nucleotides and a 45 second coupling step for 2'-deoxy nucleotides
or 2'-deoxy-2'-fluoro nucleotides. Table V outlines the amounts and
the contact times of the reagents used in the synthesis cycle.
Alternatively, syntheses at the 0.2 .mu.mol scale can be performed
on a 96-well plate synthesizer, such as the instrument produced by
Protogene (Palo Alto, Calif.) with minimal modification to the
cycle. A 33-fold excess (60 .mu.L of 0.11 M=6.6 .mu.mol) of
2'-O-methyl phosphoramidite and a 105-fold excess of S-ethyl
tetrazole (60 .mu.L of 0.25 M=15 .mu.mol) can be used in each
coupling cycle of 2'-O-methyl residues relative to polymer-bound
5'-hydroxyl. A 22-fold excess (40 .mu.L of 0.11 M=4.4 .mu.mol) of
deoxy phosphoramidite and a 70-fold excess of S-ethyl tetrazole (40
.mu.L of 0.25 M=10 .mu.mol) can be used in each coupling cycle of
deoxy residues relative to polymer-bound 5'-hydroxyl. Average
coupling yields on the 394 Applied Biosystems, Inc. synthesizer,
determined by colorimetric quantitation of the trityl fractions,
are typically 97.5-99%. Other oligonucleotide synthesis reagents
for the 394 Applied Biosystems, Inc. synthesizer include the
following: detritylation solution is 3% TCA in methylene chloride
(ABI); capping is performed with 16% N-methyl imidazole in THF
(ABI) and 10% acetic anhydride/10% 2,6-lutidine in THF (ABI); and
oxidation solution is 16.9 mM I.sub.2, 49 mM pyridine, 9% water in
THF (PerSeptive Biosystems, Inc.). Burdick & Jackson Synthesis
Grade acetonitrile is used directly from the reagent bottle.
S-Ethyltetrazole solution (0.25 M in acetonitrile) is made up from
the solid obtained from American International Chemical, Inc.
Alternately, for the introduction of phosphorothioate linkages,
Beaucage reagent (3H-1,2-Benzodithiol-3-one 1,1-dioxide, 0.05 M in
acetonitrile) is used.
[0289] Deprotection of the DNA-based oligonucleotides is performed
as follows: the polymer-bound trityl-on oligoribonucleotide is
transferred to a 4 mL glass screw top vial and suspended in a
solution of 40% aqueous methylamine (1 mL) at 65.degree. C. for 10
minutes. After cooling to -20.degree. C., the supernatant is
removed from the polymer support. The support is washed three times
with 1.0 mL of EtOH:MeCN:H2O/3:1:1, vortexed and the supernatant is
then added to the first supernatant. The combined supernatants,
containing the oligoribonucleotide, are dried to a white
powder.
[0290] The method of synthesis used for RNA including certain siNA
molecules of the invention follows the procedure as described in
Usman et al., 1987, J. Am. Chem. Soc., 109, 7845; Scaringe et al.,
1990, Nucleic Acids Res., 18, 5433; and Wincott et al., 1995,
Nucleic Acids Res. 23, 2677-2684 Wincott et al., 1997, Methods Mol.
Bio., 74, 59, and makes use of common nucleic acid protecting and
coupling groups, such as dimethoxytrityl at the 5'-end, and
phosphoramidites at the 3'-end. In a non-limiting example, small
scale syntheses are conducted on a 394 Applied Biosystems, Inc.
synthesizer using a 0.2 .mu.mol scale protocol with a 7.5 min
coupling step for alkylsilyl protected nucleotides and a 2.5 min
coupling step for 2'-O-methylated nucleotides. Table V outlines the
amounts and the contact times of the reagents used in the synthesis
cycle. Alternatively, syntheses at the 0.2 .mu.mol scale can be
done on a 96-well plate synthesizer, such as the instrument
produced by Protogene (Palo Alto, Calif.) with minimal modification
to the cycle. A 33-fold excess (60 .mu.L of 0.11 M=6.6 .mu.mol) of
2'-O-methyl phosphoramidite and a 75-fold excess of S-ethyl
tetrazole (60 .mu.L of 0.25 M=15 .mu.mol) can be used in each
coupling cycle of 2'-O-methyl residues relative to polymer-bound
5'-hydroxyl. A 66-fold excess (120 .mu.L of 0.11 M=13.2 .mu.mol) of
alkylsilyl (ribo) protected phosphoramidite and a 150-fold excess
of S-ethyl tetrazole (120 .mu.L of 0.25 M=30 .mu.mol) can be used
in each coupling cycle of ribo residues relative to polymer-bound
5'-hydroxyl. Average coupling yields on the 394 Applied Biosystems,
Inc. synthesizer, determined by colorimetric quantitation of the
trityl fractions, are typically 97.5-99%. Other oligonucleotide
synthesis reagents for the 394 Applied Biosystems, Inc. synthesizer
include the following: detritylation solution is 3% TCA in
methylene chloride (ABI); capping is performed with 16% N-methyl
imidazole in THF (ABI) and 10% acetic anhydride/10% 2,6-lutidine in
THF (ABI); oxidation solution is 16.9 mM I.sub.2, 49 mM pyridine,
9% water in THF (PerSeptive Biosystems, Inc.). Burdick &
Jackson Synthesis Grade acetonitrile is used directly from the
reagent bottle. S-Ethyltetrazole solution (0.25 M in acetonitrile)
is made up from the solid obtained from American International
Chemical, Inc. Alternately, for the introduction of
phosphorothioate linkages, Beaucage reagent
(3H-1,2-Benzodithiol-3-one 1,1-dioxide 0.05 M in acetonitrile) is
used.
[0291] Deprotection of the RNA is performed using either a two-pot
or one-pot protocol. For the two-pot protocol, the polymer-bound
trityl-on oligoribonucleotide is transferred to a 4 mL glass screw
top vial and suspended in a solution of 40% aq. methylamine (1 mL)
at 65.degree. C. for 10 min. After cooling to -20.degree. C., the
supernatant is removed from the polymer support. The support is
washed three times with 1.0 mL of EtOH:MeCN:H.sub.2O/3:1:1,
vortexed and the supernatant is then added to the first
supernatant. The combined supernatants, containing the
oligoribonucleotide, are dried to a white powder. The base
deprotected oligoribonucleotide is resuspended in anhydrous
TEA/HF/NMP solution (300 .mu.L of a solution of 1.5 mL
N-methylpyrrolidinone, 750 .mu.L TEA and 1 mL TEA.3HF to provide a
1.4 M HF concentration) and heated to 65.degree. C. After 1.5 h,
the oligomer is quenched with 1.5 M NH.sub.4HCO.sub.3.
[0292] Alternatively, for the one-pot protocol, the polymer-bound
trityl-on oligoribonucleotide is transferred to a 4 mL glass screw
top vial and suspended in a solution of 33% ethanolic
methylamine/DMSO:1/1 (0.8 mL) at 65.degree. C. for 15 minutes. The
vial is brought to room temperature TEA.3HF (0.1 mL) is added and
the vial is heated at 65.degree. C. for 15 minutes. The sample is
cooled at -20.degree. C. and then quenched with 1.5 M
NH.sub.4HCO.sub.3.
[0293] For purification of the trityl-on oligomers, the quenched
NH.sub.4HCO.sub.3 solution is loaded onto a C-18 containing
cartridge that had been prewashed with acetonitrile followed by 50
mM TEAA. After washing the loaded cartridge with water, the RNA is
detritylated with 0.5% TFA for 13 minutes. The cartridge is then
washed again with water, salt exchanged with 1 M NaCl and washed
with water again. The oligonucleotide is then eluted with 30%
acetonitrile.
[0294] The average stepwise coupling yields are typically >98%
(Wincott et al., 1995 Nucleic Acids Res. 23, 2677-2684). Those of
ordinary skill in the art will recognize that the scale of
synthesis can be adapted to be larger or smaller than the example
described above including but not limited to 96-well format.
[0295] Alternatively, the nucleic acid molecules of the present
invention can be synthesized separately and joined together
post-synthetically, for example, by ligation (Moore et al., 1992,
Science 256, 9923; Draper et al., International PCT publication No.
WO 93/23569; Shabarova et al., 1991, Nucleic Acids Research 19,
4247; Bellon et al., 1997, Nucleosides & Nucleotides, 16, 951;
Bellon et al., 1997, Bioconjugate Chem. 8, 204), or by
hybridization following synthesis and/or deprotection.
[0296] The siNA molecules of the invention can also be synthesized
via a tandem synthesis methodology as described in Example 1
herein, wherein both siNA strands are synthesized as a single
contiguous oligonucleotide fragment or strand separated by a
cleavable linker which is subsequently cleaved to provide separate
siNA fragments or strands that hybridize and permit purification of
the siNA duplex. The linker can be a polynucleotide linker or a
non-nucleotide linker. The tandem synthesis of siNA as described
herein can be readily adapted to both multiwell/multiplate
synthesis platforms such as 96 well or similarly larger multi-well
platforms. The tandem synthesis of siNA as described herein can
also be readily adapted to large scale synthesis platforms
employing batch reactors, synthesis columns and the like.
[0297] A siNA molecule can also be assembled from two distinct
nucleic acid strands or fragments wherein one fragment includes the
sense region and the second fragment includes the antisense region
of the RNA molecule.
[0298] The nucleic acid molecules of the present invention can be
modified extensively to enhance stability by modification with
nuclease resistant groups, for example, 2'-amino, 2'-C-allyl,
2'-fluoro, 2'-O-methyl, 2'-H (for a review see Usman and Cedergren,
1992, TIBS 17, 34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31,
163). siNA constructs can be purified by gel electrophoresis using
general methods or can be purified by high pressure liquid
chromatography (HPLC; see Wincott et al., supra, the totality of
which is hereby incorporated herein by reference) and re-suspended
in water.
[0299] In another aspect of the invention, siNA molecules of the
invention are expressed from transcription units inserted into DNA
or RNA vectors. The recombinant vectors can be DNA plasmids or
viral vectors. siNA expressing viral vectors can be constructed
based on, but not limited to, adeno-associated virus, retrovirus,
adenovirus, or alphavirus. The recombinant vectors capable of
expressing the siNA molecules can be delivered as described herein,
and persist in target cells. Alternatively, viral vectors can be
used that provide for transient expression of siNA molecules.
Optimizing Activity of the Nucleic Acid Molecule of the
Invention.
[0300] Chemically synthesizing nucleic acid molecules with
modifications (base, sugar and/or phosphate) can prevent their
degradation by serum ribonucleases, which can increase their
potency (see e.g., Eckstein et al., International Publication No.
WO 92/07065; Perrault et al., 1990 Nature 344, 565; Pieken et al.,
1991, Science 253, 314; Usman and Cedergren, 1992, Trends in
Biochem. Sci. 17, 334; Usman et al., International Publication No.
WO 93/15187; and Rossi et al., International Publication No. WO
91/03162; Sproat, U.S. Pat. No. 5,334,711; Gold et al., U.S. Pat.
No. 6,300,074; and Burgin et al., supra; all of which are
incorporated by reference herein). All of the above references
describe various chemical modifications that can be made to the
base, phosphate and/or sugar moieties of the nucleic acid molecules
described herein. Modifications that enhance their efficacy in
cells, and removal of bases from nucleic acid molecules to shorten
oligonucleotide synthesis times and reduce chemical requirements
are desired.
[0301] There are several examples in the art describing sugar, base
and phosphate modifications that can be introduced into nucleic
acid molecules with significant enhancement in their nuclease
stability and efficacy. For example, oligonucleotides are modified
to enhance stability and/or enhance biological activity by
modification with nuclease resistant groups, for example, 2'-amino,
2'-C-allyl, 2'-fluoro, 2'-O-methyl, 2'-O-allyl, 2'-H, nucleotide
base modifications (for a review see Usman and Cedergren, 1992,
TIBS. 17, 34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31, 163;
Burgin et al., 1996, Biochemistry, 35, 14090). Sugar modification
of nucleic acid molecules have been extensively described in the
art (see Eckstein et al., International Publication PCT No. WO
92/07065; Perrault et al. Nature, 1990, 344, 565-568; Pieken et al.
Science, 1991, 253, 314-317; Usman and Cedergren, Trends in
Biochem. Sci., 1992, 17, 334-339; Usman et al. International
Publication PCT No. WO 93/15187; Sproat, U.S. Pat. No. 5,334,711
and Beigelman et al., 1995, J. Biol. Chem., 270, 25702; Beigelman
et al., International PCT publication No. WO 97/26270; Beigelman et
al., U.S. Pat. No. 5,716,824; Usman et al., U.S. Pat. No.
5,627,053; Woolf et al., International PCT Publication No. WO
98/13526; Thompson et al., U.S. Ser. No. 60/082,404 which was filed
on Apr. 20, 1998; Karpeisky et al., 1998, Tetrahedron Lett., 39,
1131; Earnshaw and Gait, 1998, Biopolymers (Nucleic Acid Sciences),
48, 39-55; Verma and Eckstein, 1998, Annu. Rev. Biochem., 67,
99-134; and Burlina et al., 1997, Bioorg. Med. Chem., 5, 1999-2010;
all of the references are hereby incorporated in their totality by
reference herein). Such publications describe general methods and
strategies to determine the location of incorporation of sugar,
base and/or phosphate modifications and the like into nucleic acid
molecules without modulating catalysis, and are incorporated by
reference herein. In view of such teachings, similar modifications
can be used as described herein to modify the siNA nucleic acid
molecules of the instant invention so long as the ability of siNA
to promote RNAi is cells is not significantly inhibited.
[0302] While chemical modification of oligonucleotide
internucleotide linkages with phosphorothioate, phosphorodithioate,
and/or 5'-methylphosphonate linkages improves stability, excessive
modifications can cause some toxicity or decreased activity.
Therefore, when designing nucleic acid molecules, the amount of
these internucleotide linkages should be minimized. The reduction
in the concentration of these linkages should lower toxicity,
resulting in increased efficacy and higher specificity of these
molecules.
[0303] Short interfering nucleic acid (siNA) molecules having
chemical modifications that maintain or enhance activity are
provided. Such a nucleic acid is also generally more resistant to
nucleases than an unmodified nucleic acid. Accordingly, the in
vitro and/or in vivo activity should not be significantly lowered.
In cases in which modulation is the goal, therapeutic nucleic acid
molecules delivered exogenously should optimally be stable within
cells until translation of the target RNA has been modulated long
enough to reduce the levels of the undesirable protein. This period
of time varies between hours to days depending upon the disease
state. Improvements in the chemical synthesis of RNA and DNA
(Wincott et al., 1995, Nucleic Acids Res. 23, 2677; Caruthers et
al., 1992, Methods in Enzymology 211, 3-19 (incorporated by
reference herein)) have expanded the ability to modify nucleic acid
molecules by introducing nucleotide modifications to enhance their
nuclease stability, as described above.
[0304] In one embodiment, nucleic acid molecules of the invention
include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more) G-clamp nucleotides. A G-clamp nucleotide is a modified
cytosine analog wherein the modifications confer the ability to
hydrogen bond both Watson-Crick and Hoogsteen faces of a
complementary guanine within a duplex, see for example Lin and
Matteucci, 1998, J. Am. Chem. Soc., 120, 8531-8532. A single
G-clamp analog substitution within an oligonucleotide can result in
substantially enhanced helical thermal stability and mismatch
discrimination when hybridized to complementary oligonucleotides.
The inclusion of such nucleotides in nucleic acid molecules of the
invention results in both enhanced affinity and specificity to
nucleic acid targets, complementary sequences, or template strands.
In another embodiment, nucleic acid molecules of the invention
include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more) LNA "locked nucleic acid" nucleotides such as a 2',4'-C
methylene bicyclo nucleotide (see for example Wengel et al.,
International PCT Publication No. WO 00/66604 and WO 99/14226).
[0305] In another embodiment, the invention features conjugates
and/or complexes of siNA molecules of the invention. Such
conjugates and/or complexes can be used to facilitate delivery of
siNA molecules into a biological system, such as a cell. The
conjugates and complexes provided by the instant invention can
impart therapeutic activity by transferring therapeutic compounds
across cellular membranes, altering the pharmacokinetics, and/or
modulating the localization of nucleic acid molecules of the
invention. The present invention encompasses the design and
synthesis of novel conjugates and complexes for the delivery of
molecules, including, but not limited to, small molecules, lipids,
cholesterol, phospholipids, nucleosides, nucleotides, nucleic
acids, antibodies, toxins, negatively charged polymers and other
polymers, for example proteins, peptides, hormones, carbohydrates,
polyethylene glycols, or polyamines, across cellular membranes. In
general, the transporters described are designed to be used either
individually or as part of a multi-component system, with or
without degradable linkers. These compounds are expected to improve
delivery and/or localization of nucleic acid molecules of the
invention into a number of cell types originating from different
tissues, in the presence or absence of serum (see Sullenger and
Cech, U.S. Pat. No. 5,854,038). Conjugates of the molecules
described herein can be attached to biologically active molecules
via linkers that are biodegradable, such as biodegradable nucleic
acid linker molecules.
[0306] The term "biodegradable linker" as used herein, refers to a
nucleic acid or non-nucleic acid linker molecule that is designed
as a biodegradable linker to connect one molecule to another
molecule, for example, a biologically active molecule to a siNA
molecule of the invention or the sense and antisense strands of a
siNA molecule of the invention. The biodegradable linker is
designed such that its stability can be modulated for a particular
purpose, such as delivery to a particular tissue or cell type. The
stability of a nucleic acid-based biodegradable linker molecule can
be modulated by using various chemistries, for example combinations
of ribonucleotides, deoxyribonucleotides, and chemically-modified
nucleotides, such as 2'-O-methyl, 2'-fluoro, 2'-amino, 2'-O-amino,
2'-C-allyl, 2'-O-allyl, and other 2'-modified or base modified
nucleotides. The biodegradable nucleic acid linker molecule can be
a dimer, trimer, tetramer or longer nucleic acid molecule, for
example, an oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, or
can comprise a single nucleotide with a phosphorus-based linkage,
for example, a phosphoramidate or phosphodiester linkage. The
biodegradable nucleic acid linker molecule can also comprise
nucleic acid backbone, nucleic acid sugar, or nucleic acid base
modifications.
[0307] The term "biodegradable" as used herein, refers to
degradation in a biological system, for example, enzymatic
degradation or chemical degradation.
[0308] The term "biologically active molecule" as used herein
refers to compounds or molecules that are capable of eliciting or
modifying a biological response in a system. Non-limiting examples
of biologically active siNA molecules either alone or in
combination with other molecules contemplated by the instant
invention include therapeutically active molecules such as
antibodies, cholesterol, hormones, antivirals, peptides, proteins,
chemotherapeutics, small molecules, vitamins, co-factors,
nucleosides, nucleotides, oligonucleotides, enzymatic nucleic
acids, antisense nucleic acids, triplex forming oligonucleotides,
2,5-A chimeras, siNA, dsRNA, allozymes, aptamers, decoys and
analogs thereof. Biologically active molecules of the invention
also include molecules capable of modulating the pharmacokinetics
and/or pharmacodynamics of other biologically active molecules, for
example, lipids and polymers such as polyamines, polyamides,
polyethylene glycol and other polyethers.
[0309] The term "phospholipid" as used herein, refers to a
hydrophobic molecule comprising at least one phosphorus group. For
example, a phospholipid can comprise a phosphorus-containing group
and saturated or unsaturated alkyl group, optionally substituted
with OH, COOH, oxo, amine, or substituted or unsubstituted aryl
groups.
[0310] Therapeutic nucleic acid molecules (e.g., siNA molecules)
delivered exogenously optimally are stable within cells until
reverse transcription of the RNA has been modulated long enough to
reduce the levels of the RNA transcript. The nucleic acid molecules
are resistant to nucleases in order to function as effective
intracellular therapeutic agents. Improvements in the chemical
synthesis of nucleic acid molecules described in the instant
invention and in the art have expanded the ability to modify
nucleic acid molecules by introducing nucleotide modifications to
enhance their nuclease stability as described above.
[0311] In yet another embodiment, siNA molecules having chemical
modifications that maintain or enhance enzymatic activity of
proteins involved in RNAi are provided. Such nucleic acids are also
generally more resistant to nucleases than unmodified nucleic
acids. Thus, in vitro and/or in vivo the activity should not be
significantly lowered.
[0312] Use of the nucleic acid-based molecules of the invention
will lead to better treatments by affording the possibility of
combination therapies (e.g., multiple siNA molecules targeted to
different genes; nucleic acid molecules coupled with known small
molecule modulators; or intermittent treatment with combinations of
molecules, including different motifs and/or other chemical or
biological molecules). The treatment of subjects with siNA
molecules can also include combinations of different types of
nucleic acid molecules, such as enzymatic nucleic acid molecules
(ribozymes), allozymes, antisense, 2,5-A oligoadenylate, decoys,
and aptamers.
[0313] In another aspect a siNA molecule of the invention comprises
one or more 5' and/or a 3'-cap structure, for example, on only the
sense siNA strand, the antisense siNA strand, or both siNA
strands.
[0314] By "cap structure" is meant chemical modifications, which
have been incorporated at either terminus of the oligonucleotide
(see, for example, Adamic et al., U.S. Pat. No. 5,998,203,
incorporated by reference herein). These terminal modifications
protect the nucleic acid molecule from exonuclease degradation, and
may help in delivery and/or localization within a cell. The cap may
be present at the 5'-terminus (5'-cap) or at the 3'-terminal
(3'-cap) or may be present on both termini. In non-limiting
examples, the 5'-cap includes, but is not limited to, glyceryl,
inverted deoxy abasic residue (moiety); 4',5'-methylene nucleotide;
1-(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide;
carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide;
L-nucleotides; alpha-nucleotides; modified base nucleotide;
phosphorodithioate linkage; threo-pentofuranosyl nucleotide;
acyclic 3',4'-seco nucleotide; acyclic 3,4-dihydroxybutyl
nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3'-3'-inverted
nucleotide moiety; 3'-3'-inverted abasic moiety; 3'-2'-inverted
nucleotide moiety; 3'-2'-inverted abasic moiety; 1,4-butanediol
phosphate; 3'-phosphoramidate; hexylphosphate; aminohexyl
phosphate; 3'-phosphate; 3'-phosphorothioate; phosphorodithioate;
or bridging or non-bridging methylphosphonate moiety. Non-limiting
examples of cap moieties are shown in FIG. 10.
[0315] Non-limiting examples of the 3'-cap include, but are not
limited to, glyceryl, inverted deoxy abasic residue (moiety),
4',5'-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide;
4'-thio nucleotide, carbocyclic nucleotide; 5'-amino-alkyl
phosphate; 1,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate;
6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl
phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide;
alpha-nucleotide; modified base nucleotide; phosphorodithioate;
threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide;
3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide,
5'-5'-inverted nucleotide moiety; 5'-5'-inverted abasic moiety;
5'-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate;
5'-amino; bridging and/or non-bridging 5'-phosphoramidate,
phosphorothioate and/or phosphorodithioate, bridging or non
bridging methylphosphonate and 5'-mercapto moieties (for more
details see Beaucage and Iyer, 1993, Tetrahedron 49, 1925;
incorporated by reference herein).
[0316] By the term "non-nucleotide" is meant any group or compound
which can be incorporated into a nucleic acid chain in the place of
one or more nucleotide units, including either sugar and/or
phosphate substitutions, and allows the remaining bases to exhibit
their enzymatic activity. The group or compound is abasic in that
it does not contain a commonly recognized nucleotide base, such as
adenosine, guanine, cytosine, uracil or thymine and therefore lacks
a base at the 1'-position.
[0317] An "alkyl" group refers to a saturated aliphatic
hydrocarbon, including straight-chain, branched-chain, and cyclic
alkyl groups. Preferably, the alkyl group has 1 to 12 carbons. More
preferably, it is a lower alkyl of from 1 to 7 carbons, more
preferably 1 to 4 carbons. The alkyl group can be substituted or
unsubstituted. When substituted the substituted group(s) is
preferably, hydroxyl, cyano, alkoxy, .dbd.O, .dbd.S, NO.sub.2 or
N(CH.sub.3).sub.2, amino, or SH. The term also includes alkenyl
groups that are unsaturated hydrocarbon groups containing at least
one carbon-carbon double bond, including straight-chain,
branched-chain, and cyclic groups. Preferably, the alkenyl group
has 1 to 12 carbons. More preferably, it is a lower alkenyl of from
1 to 7 carbons, more preferably 1 to 4 carbons. The alkenyl group
may be substituted or unsubstituted. When substituted the
substituted group(s) is preferably, hydroxyl, cyano, alkoxy,
.dbd.O, .dbd.S, NO.sub.2, halogen, N(CH.sub.3).sub.2, amino, or SH.
The term "alkyl" also includes alkynyl groups that have an
unsaturated hydrocarbon group containing at least one carbon-carbon
triple bond, including straight-chain, branched-chain, and cyclic
groups. Preferably, the alkynyl group has 1 to 12 carbons. More
preferably, it is a lower alkynyl of from 1 to 7 carbons, more
preferably 1 to 4 carbons. The alkynyl group may be substituted or
unsubstituted. When substituted the substituted group(s) is
preferably, hydroxyl, cyano, alkoxy, .dbd.O, .dbd.S, NO.sub.2 or
N(CH.sub.3).sub.2, amino or SH.
[0318] Such alkyl groups can also include aryl, alkylaryl,
carbocyclic aryl, heterocyclic aryl, amide and ester groups. An
"aryl" group refers to an aromatic group that has at least one ring
having a conjugated pi electron system and includes carbocyclic
aryl, heterocyclic aryl and biaryl groups, all of which may be
optionally substituted. The preferred substituent(s) of aryl groups
are halogen, trihalomethyl, hydroxyl, SH, OH, cyano, alkoxy, alkyl,
alkenyl, alkynyl, and amino groups. An "alkylaryl" group refers to
an alkyl group (as described above) covalently joined to an aryl
group (as described above). Carbocyclic aryl groups are groups
wherein the ring atoms on the aromatic ring are all carbon atoms.
The carbon atoms are optionally substituted. Heterocyclic aryl
groups are groups having from 1 to 3 heteroatoms as ring atoms in
the aromatic ring and the remainder of the ring atoms are carbon
atoms. Suitable heteroatoms include oxygen, sulfur, and nitrogen,
and include furanyl, thienyl, pyridyl, pyrrolyl, N-lower alkyl
pyrrolo, pyrimidyl, pyrazinyl, imidazolyl and the like, all
optionally substituted. An "amide" refers to an --C(O)--NH--R,
where R is either alkyl, aryl, alkylaryl or hydrogen. An "ester"
refers to an --C(O)--OR', where R is either alkyl, aryl, alkylaryl
or hydrogen.
[0319] By "nucleotide" as used herein is as recognized in the art
to include natural bases (standard), and modified bases well known
in the art. Such bases are generally located at the 1' position of
a nucleotide sugar moiety. Nucleotides generally comprise a base,
sugar and a phosphate group. The nucleotides can be unmodified or
modified at the sugar, phosphate and/or base moiety, (also referred
to interchangeably as nucleotide analogs, modified nucleotides,
non-natural nucleotides, non-standard nucleotides and other; see,
for example, Usman and McSwiggen, supra; Eckstein et al.,
International PCT Publication No. WO 92/07065; Usman et al.,
International PCT Publication No. WO 93/15187; Uhlman & Peyman,
supra, all are hereby incorporated by reference herein). There are
several examples of modified nucleic acid bases known in the art as
summarized by Limbach et al., 1994, Nucleic Acids Res. 22, 2183.
Some of the non-limiting examples of base modifications that can be
introduced into nucleic acid molecules include, inosine, purine,
pyridin-4-one, pyridin-2-one, phenyl, pseudouracil,
2,4,6-trimethoxy benzene, 3-methyl uracil, dihydrouridine,
naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine),
5-alkyluridines (e.g., ribothymidine), 5-halouridine (e.g.,
5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g.
6-methyluridine), propyne, and others (Burgin et al., 1996,
Biochemistry, 35, 14090; Uhlman & Peyman, supra). By "modified
bases" in this aspect is meant nucleotide bases other than adenine,
guanine, cytosine and uracil at 1 position or their
equivalents.
[0320] In one embodiment, the invention features modified siNA
molecules, with phosphate backbone modifications comprising one or
more phosphorothioate, phosphorodithioate, methylphosphonate,
phosphotriester, morpholino, amidate carbamate, carboxymethyl,
acetamidate, polyamide, sulfonate, sulfonamide, sulfamate,
formacetal, thioformacetal, and/or alkylsilyl, substitutions. For a
review of oligonucleotide backbone modifications, see Hunziker and
Leumann, 1995, Nucleic Acid Analogues: Synthesis and Properties, in
Modern Synthetic Methods, VCH, 331-417, and Mesmaeker et al., 1994,
Novel Backbone Replacements for Oligonucleotides, in Carbohydrate
Modifications in Antisense Research, ACS, 24-39.
[0321] By "abasic" is meant sugar moieties lacking a base or having
other chemical groups in place of a base at the 1' position, see
for example Adamic et al., U.S. Pat. No. 5,998,203.
[0322] By "unmodified nucleoside" is meant one of the bases
adenine, cytosine, guanine, thymine, or uracil joined to the 1
carbon of .beta.-D-ribo-furanose.
[0323] By "modified nucleoside" is meant any nucleotide base which
contains a modification in the chemical structure of an unmodified
nucleotide base, sugar and/or phosphate. Non-limiting examples of
modified nucleotides are shown by Formulae I-V11 and/or other
modifications described herein.
[0324] In connection with 2'-modified nucleotides as described for
the present invention, by "amino" is meant 2'--NH.sub.2 or
2'-O--NH.sub.2, which can be modified or unmodified. Such modified
groups are described, for example, in Eckstein et al., U.S. Pat.
No. 5,672,695 and Matulic-Adamic et al., U.S. Pat. No. 6,248,878,
which are both incorporated by reference in their entireties.
[0325] Various modifications to nucleic acid siNA structure can be
made to enhance the utility of these molecules. Such modifications
will enhance shelf-life, half-life in vitro, stability, and ease of
introduction of such oligonucleotides to the target site, e.g., to
enhance penetration of cellular membranes, and confer the ability
to recognize and bind to targeted cells.
Administration of Nucleic Acid Molecules
[0326] A siNA molecule of the invention can be adapted for use to
prevent or treat cancer, proliferative, inflammatory, respiratory,
neurologic, cardiovascular and/or autoimmune diseases, conditions,
or disorders, and/or any other trait, disease, disorder or
condition that is related to or will respond to the levels of TNF
and/or TNF receptor in a cell or tissue, alone or in combination
with other therapies. For example, a siNA molecule can comprise a
delivery vehicle, including liposomes, for administration to a
subject, carriers and diluents and their salts, and/or can be
present in pharmaceutically acceptable formulations. Methods for
the delivery of nucleic acid molecules are described in Akhtar et
al., 1992, Trends Cell Bio., 2, 139; Delivery Strategies for
Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995, Maurer et
al., 1999, Mol. Membr. Biol., 16, 129-140; Hofland and Huang, 1999,
Handb. Exp. Pharmacol., 137, 165-192; and Lee et al., 2000, ACS
Symp. Ser., 752, 184-192, all of which are incorporated herein by
reference. Beigelman et al., U.S. Pat. No. 6,395,713 and Sullivan
et al., PCT WO 94/02595 further describe the general methods for
delivery of nucleic acid molecules. These protocols can be utilized
for the delivery of virtually any nucleic acid molecule. Nucleic
acid molecules can be administered to cells by a variety of methods
known to those of skill in the art, including, but not restricted
to, encapsulation in liposomes, by iontophoresis, or by
incorporation into other vehicles, such as biodegradable polymers,
hydrogels, cyclodextrins (see for example Gonzalez et al., 1999,
Bioconjugate Chem., 10, 1068-1074; Wang et al., International PCT
publication Nos. WO 03/47518 and WO 03/46185),
poly(lactic-co-glycolic)acid (PLGA) and PLCA microspheres (see for
example U.S. Pat. No. 6,447,796 and US Patent Application
Publication No. US 2002130430), biodegradable nanocapsules, and
bioadhesive microspheres, or by proteinaceous vectors (O'Hare and
Normand, International PCT Publication No. WO 00/53722). In another
embodiment, the nucleic acid molecules of the invention can also be
formulated or complexed with polyethyleneimine and derivatives
thereof, such as
polyethyleneimine-polyethyleneglycol-N-acetylgalactosamine
(PEI-PEG-GAL) or
polyethyleneimine-polyethyleneglycol-tri-N-acetylgalactosamine
(PEI-PEG-triGAL) derivatives. In one embodiment, the nucleic acid
molecules of the invention are formulated as described in United
States Patent Application Publication No. 20030077829, incorporated
by reference herein in its entirety.
[0327] In one embodiment, the nucleic acid/vehicle combination is
locally delivered by direct injection or by use of an infusion
pump. Direct injection of the nucleic acid molecules of the
invention, whether subcutaneous, intramuscular, or intradermal, can
take place using standard needle and syringe methodologies, or by
needle-free technologies such as those described in Conry et al.,
1999, Clin. Cancer Res., 5, 2330-2337 and Barry et al.,
International PCT Publication No. WO 99/31262. The molecules of the
instant invention can be used as pharmaceutical agents.
Pharmaceutical agents prevent, modulate the occurrence, or treat
(alleviate a symptom to some extent, preferably all of the
symptoms) of a disease state in a subject.
[0328] In one embodiment, a siNA molecule of the invention is
complexed with membrane disruptive agents such as those described
in U.S. Patent Application Publication No. 20010007666,
incorporated by reference herein in its entirety including the
drawings. In another embodiment, the membrane disruptive agent or
agents and the siNA molecule are also complexed with a cationic
lipid or helper lipid molecule, such as those lipids described in
U.S. Pat. No. 6,235,310, incorporated by reference herein in its
entirety including the drawings.
[0329] In one embodiment, a siNA molecule of the invention is
complexed with delivery systems as described in U.S. Patent
Application Publication No. 2003077829 and International PCT
Publication Nos. WO 00/03683 and WO 02/087541, all incorporated by
reference herein in their entirety including the drawings.
[0330] In one embodiment, the nucleic acid molecules of the
invention are administered via pulmonary delivery, such as by
inhalation of an aerosol or spray dried formulation administered by
an inhalation device or nebulizer, providing rapid local uptake of
the nucleic acid molecules into relevant pulmonary tissues. Solid
particulate compositions containing respirable dry particles of
micronized nucleic acid compositions can be prepared by grinding
dried or lyophilized nucleic acid compositions, and then passing
the micronized composition through, for example, a 400 mesh screen
to break up or separate out large agglomerates. A solid particulate
composition comprising the nucleic acid compositions of the
invention can optionally contain a dispersant which serves to
facilitate the formation of an aerosol as well as other therapeutic
compounds. A suitable dispersant is lactose, which can be blended
with the nucleic acid compound in any suitable ratio, such as a 1
to 1 ratio by weight.
[0331] Aerosols of liquid particles comprising a nucleic acid
composition of the invention can be produced by any suitable means,
such as with a nebulizer (see for example U.S. Pat. No. 4,501,729).
Nebulizers are commercially available devices which transform
solutions or suspensions of an active ingredient into a therapeutic
aerosol mist either by means of acceleration of a compressed gas,
typically air or oxygen, through a narrow venturi orifice or by
means of ultrasonic agitation. Suitable formulations for use in
nebulizers comprise the active ingredient in a liquid carrier in an
amount of up to 40% w/w preferably less than 20% w/w of the
formulation. The carrier is typically water or a dilute aqueous
alcoholic solution, preferably made isotonic with body fluids by
the addition of, for example, sodium chloride or other suitable
salts. Optional additives include preservatives if the formulation
is not prepared sterile, for example, methyl hydroxybenzoate,
anti-oxidants, flavorings, volatile oils, buffering agents and
emulsifiers and other formulation surfactants. The aerosols of
solid particles comprising the active composition and surfactant
can likewise be produced with any solid particulate aerosol
generator. Aerosol generators for administering solid particulate
therapeutics to a subject produce particles which are respirable,
as explained above, and generate a volume of aerosol containing a
predetermined metered dose of a therapeutic composition at a rate
suitable for human administration. One illustrative type of solid
particulate aerosol generator is an insufflator. Suitable
formulations for administration by insufflation include finely
comminuted powders which can be delivered by means of an
insufflator. In the insufflator, the powder, e.g., a metered dose
thereof effective to carry out the treatments described herein, is
contained in capsules or cartridges, typically made of gelatin or
plastic, which are either pierced or opened in situ and the powder
delivered by air drawn through the device upon inhalation or by
means of a manually-operated pump. The powder employed in the
insufflator consists either solely of the active ingredient or of a
powder blend comprising the active ingredient, a suitable powder
diluent, such as lactose, and an optional surfactant. The active
ingredient typically comprises from 0.1 to 100 w/w of the
formulation. A second type of illustrative aerosol generator
comprises a metered dose inhaler. Metered dose inhalers are
pressurized aerosol dispensers, typically containing a suspension
or solution formulation of the active ingredient in a liquified
propellant. During use these devices discharge the formulation
through a valve adapted to deliver a metered volume to produce a
fine particle spray containing the active ingredient. Suitable
propellants include certain chlorofluorocarbon compounds, for
example, dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane and mixtures thereof. The formulation can
additionally contain one or more co-solvents, for example, ethanol,
emulsifiers and other formulation surfactants, such as oleic acid
or sorbitan trioleate, anti-oxidants and suitable flavoring agents.
Other methods for pulmonary delivery are described in, for example
US Patent Application No. 20040037780, and U.S. Pat. Nos.
6,592,904; 6,582,728; 6,565,885.
[0332] In one embodiment, the invention features the use of methods
to deliver the nucleic acid molecules of the instant invention to
the central nervous system and/or peripheral nervous system.
Experiments have demonstrated the efficient in vivo uptake of
nucleic acids by neurons. As an example of local administration of
nucleic acids to nerve cells, Sommer et al., 1998, Antisense Nuc.
Acid Drug Dev., 8, 75, describe a study in which a 15mer
phosphorothioate antisense nucleic acid molecule to c-fos is
administered to rats via microinjection into the brain. Antisense
molecules labeled with tetramethylrhodamine-isothiocyanate (TRITC)
or fluorescein isothiocyanate (FITC) were taken up by exclusively
by neurons thirty minutes post-injection. A diffuse cytoplasmic
staining and nuclear staining was observed in these cells. As an
example of systemic administration of nucleic acid to nerve cells,
Epa et al., 2000, Antisense Nuc. Acid Drug Dev., 10, 469, describe
an in vivo mouse study in which
beta-cyclodextrin-adamantane-oligonucleotide conjugates were used
to target the p75 neurotrophin receptor in neuronally
differentiated PC12 cells. Following a two week course of IP
administration, pronounced uptake of p75 neurotrophin receptor
antisense was observed in dorsal root ganglion (DRG) cells. In
addition, a marked and consistent down-regulation of p75 was
observed in DRG neurons. Additional approaches to the targeting of
nucleic acid to neurons are described in Broaddus et al., 1998, J.
Neurosurg., 88(4), 734; Karle et al., 1997, Eur. J. Pharmocol.,
340(2/3), 153; Bannai et al., 1998, Brain Research, 784(1,2), 304;
Rajakumar et al., 1997, Synapse, 26(3), 199; Wu-pong et al., 1999,
BioPharm, 12(1), 32; Bannai et al., 1998, Brain Res. Protoc., 3(1),
83; Simantov et al., 1996, Neuroscience, 74(1), 39. Nucleic acid
molecules of the invention are therefore amenable to delivery to
and uptake by cells that express repeat expansion allelic variants
for modulation of RE gene expression. The delivery of nucleic acid
molecules of the invention, targeting RE is provided by a variety
of different strategies. Traditional approaches to CNS delivery
that can be used include, but are not limited to, intrathecal and
intracerebroventricular administration, implantation of catheters
and pumps, direct injection or perfusion at the site of injury or
lesion, injection into the brain arterial system, or by chemical or
osmotic opening of the blood-brain barrier. Other approaches can
include the use of various transport and carrier systems, for
example though the use of conjugates and biodegradable polymers.
Furthermore, gene therapy approaches, for example as described in
Kaplitt et al., U.S. Pat. No. 6,180,613 and Davidson, WO 04/013280,
can be used to express nucleic acid molecules in the CNS.
[0333] In one embodiment, nucleic acid molecules of the invention
are administered to the central nervous system (CNS) or peripheral
nervous system (PNS). Experiments have demonstrated the efficient
in vivo uptake of nucleic acids by neurons. As an example of local
administration of nucleic acids to nerve cells, Sommer et al.,
1998, Antisense Nuc. Acid Drug Dev., 8, 75, describe a study in
which a 15mer phosphorothioate antisense nucleic acid molecule to
c-fos is administered to rats via microinjection into the brain.
Antisense molecules labeled with
tetramethylrhodamine-isothiocyanate (TRITC) or fluorescein
isothiocyanate (FITC) were taken up by exclusively by neurons
thirty minutes post-injection. A diffuse cytoplasmic staining and
nuclear staining was observed in these cells. As an example of
systemic administration of nucleic acid to nerve cells, Epa et al.,
2000, Antisense Nuc. Acid Drug Dev., 10, 469, describe an in vivo
mouse study in which beta-cyclodextrin-adamantane-oligonucleotide
conjugates were used to target the p75 neurotrophin receptor in
neuronally differentiated PC12 cells. Following a two week course
of IP administration, pronounced uptake of p75 neurotrophin
receptor antisense was observed in dorsal root ganglion (DRG)
cells. In addition, a marked and consistent down-regulation of p75
was observed in DRG neurons. Additional approaches to the targeting
of nucleic acid to neurons are described in Broaddus et al., 1998,
J. Neurosurg., 88(4), 734; Karle et al., 1997, Eur. J. Pharmocol.,
340(2/3), 153; Bannai et al., 1998, Brain Research, 784(1,2), 304;
Rajakumar et al., 1997, Synapse, 26(3), 199; Wu-pong et al., 1999,
BioPharm, 12(1), 32; Bannai et al., 1998, Brain Res. Protoc., 3(1),
83; Simantov et al., 1996, Neuroscience, 74(1), 39. Nucleic acid
molecules of the invention are therefore amenable to delivery to
and uptake by cells in the CNS and/or PNS.
[0334] The delivery of nucleic acid molecules of the invention to
the CNS is provided by a variety of different strategies.
Traditional approaches to CNS delivery that can be used include,
but are not limited to, intrathecal and intracerebroventricular
administration, implantation of catheters and pumps, direct
injection or perfusion at the site of injury or lesion, injection
into the brain arterial system, or by chemical or osmotic opening
of the blood-brain barrier. Other approaches can include the use of
various transport and carrier systems, for example though the use
of conjugates and biodegradable polymers. Furthermore, gene therapy
approaches, for example as described in Kaplitt et al., U.S. Pat.
No. 6,180,613 and Davidson, WO 04/013280, can be used to express
nucleic acid molecules in the CNS.
[0335] In one embodiment, delivery systems of the invention
include, for example, aqueous and nonaqueous gels, creams, multiple
emulsions, microemulsions, liposomes, ointments, aqueous and
nonaqueous solutions, lotions, aerosols, hydrocarbon bases and
powders, and can contain excipients such as solubilizers,
permeation enhancers (e.g., fatty acids, fatty acid esters, fatty
alcohols and amino acids), and hydrophilic polymers (e.g.,
polycarbophil and polyvinylpyrolidone). In one embodiment, the
pharmaceutically acceptable carrier is a liposome or a transdermal
enhancer. Examples of liposomes which can be used in this invention
include the following: (1) CellFectin, 1:1.5 (M/M) liposome
formulation of the cationic lipid
N,NI,NII,NIII-tetramethyl-N,NI,NII,NIII-tetrapalmit-y-spermine and
dioleoyl phosphatidylethanolamine (DOPE) (GIBCO BRL); (2)
Cytofectin GSV, 2:1 (M/M) liposome formulation of a cationic lipid
and DOPE (Glen Research); (3)
DOTAP(N-[1-(2,3-dioleoyloxy)-N,N,N-tri-methyl-ammoniummethylsulfate)
(Boehringer Manheim); and (4) Lipofectamine, 3:1 (M/M) liposome
formulation of the polycationic lipid DOSPA and the neutral lipid
DOPE (GIBCO BRL).
[0336] In one embodiment, delivery systems of the invention include
patches, tablets, suppositories, pessaries, gels and creams, and
can contain excipients such as solubilizers and enhancers (e.g.,
propylene glycol, bile salts and amino acids), and other vehicles
(e.g., polyethylene glycol, fatty acid esters and derivatives, and
hydrophilic polymers such as hydroxypropylmethylcellulose and
hyaluronic acid).
[0337] In one embodiment, siNA molecules of the invention are
formulated or complexed with polyethylenimine (e.g., linear or
branched PEI) and/or polyethylenimine derivatives, including for
example grafted PEIs such as galactose PEI, cholesterol PEI,
antibody derivatized PEI, and polyethylene glycol PEI (PEG-PEI)
derivatives thereof (see for example Ogris et al., 2001, AAPA
PharmSci, 3, 1-11; Furgeson et al., 2003, Bioconjugate Chem., 14,
840-847; Kunath et al., 2002, Pharmaceutical Research, 19, 810-817;
Choi et al., 2001, Bull. Korean Chem. Soc., 22, 46-52; Bettinger et
al., 1999, Bioconjugate Chem., 10, 558-561; Peterson et al., 2002,
Bioconjugate Chem., 13, 845-854; Erbacher et al., 1999, Journal of
Gene Medicine Preprint, 1, 1-18; Godbey et al., 1999., PNAS USA,
96, 5177-5181; Godbey et al., 1999, Journal of Controlled Release,
60, 149-160; Diebold et al., 1999, Journal of Biological Chemistry,
274, 19087-19094; Thomas and Klibanov, 2002, PNAS USA, 99,
14640-14645; and Sagara, U.S. Pat. No. 6,586,524, incorporated by
reference herein.
[0338] In one embodiment, a siNA molecule of the invention
comprises a bioconjugate, for example a nucleic acid conjugate as
described in Vargeese et al., U.S. Ser. No. 10/427,160, filed Apr.
30, 2003; U.S. Pat. No. 6,528,631; U.S. Pat. No. 6,335,434; U.S.
Pat. No. 6,235,886; U.S. Pat. No. 6,153,737; U.S. Pat. No.
5,214,136; U.S. Pat. No. 5,138,045, all incorporated by reference
herein.
[0339] Thus, the invention features a pharmaceutical composition
comprising one or more nucleic acid(s) of the invention in an
acceptable carrier, such as a stabilizer, buffer, and the like. The
polynucleotides of the invention can be administered (e.g., RNA,
DNA or protein) and introduced to a subject by any standard means,
with or without stabilizers, buffers, and the like, to form a
pharmaceutical composition. When it is desired to use a liposome
delivery mechanism, standard protocols for formation of liposomes
can be followed. The compositions of the present invention can also
be formulated and used as creams, gels, sprays, oils and other
suitable compositions for topical, dermal, or transdermal
administration as is known in the art.
[0340] The present invention also includes pharmaceutically
acceptable formulations of the compounds described. These
formulations include salts of the above compounds, e.g., acid
addition salts, for example, salts of hydrochloric, hydrobromic,
acetic acid, and benzene sulfonic acid.
[0341] A pharmacological composition or formulation refers to a
composition or formulation in a form suitable for administration,
e.g., systemic or local administration, into a cell or subject,
including for example a human. Suitable forms, in part, depend upon
the use or the route of entry, for example oral, transdermal, or by
injection. Such forms should not prevent the composition or
formulation from reaching a target cell (i.e., a cell to which the
negatively charged nucleic acid is desirable for delivery). For
example, pharmacological compositions injected into the blood
stream should be soluble. Other factors are known in the art, and
include considerations such as toxicity and forms that prevent the
composition or formulation from exerting its effect.
[0342] In one embodiment, siNA molecules of the invention are
administered to a subject by systemic administration in a
pharmaceutically acceptable composition or formulation. By
"systemic administration" is meant in vivo systemic absorption or
accumulation of drugs in the blood stream followed by distribution
throughout the entire body. Administration routes that lead to
systemic absorption include, without limitation: intravenous,
subcutaneous, intraperitoneal, inhalation, oral, intrapulmonary and
intramuscular. Each of these administration routes exposes the siNA
molecules of the invention to an accessible diseased tissue. The
rate of entry of a drug into the circulation has been shown to be a
function of molecular weight or size. The use of a liposome or
other drug carrier comprising the compounds of the instant
invention can potentially localize the drug, for example, in
certain tissue types, such as the tissues of the reticular
endothelial system (RES). A liposome formulation that can
facilitate the association of drug with the surface of cells, such
as, lymphocytes and macrophages is also useful. This approach can
provide enhanced delivery of the drug to target cells by taking
advantage of the specificity of macrophage and lymphocyte immune
recognition of abnormal cells.
[0343] By "pharmaceutically acceptable formulation" or
"pharmaceutically acceptable composition" is meant, a composition
or formulation that allows for the effective distribution of the
nucleic acid molecules of the instant invention in the physical
location most suitable for their desired activity. Non-limiting
examples of agents suitable for formulation with the nucleic acid
molecules of the instant invention include: P-glycoprotein
inhibitors (such as Pluronic P85); biodegradable polymers, such as
poly (DL-lactide-coglycolide) microspheres for sustained release
delivery (Emerich, D F et al, 1999, Cell Transplant, 8, 47-58); and
loaded nanoparticles, such as those made of polybutylcyanoacrylate.
Other non-limiting examples of delivery strategies for the nucleic
acid molecules of the instant invention include material described
in Boado et al., 1998, J. Pharm. Sci., 87, 1308-1315; Tyler et al.,
1999, FEBS Lett., 421, 280-284; Pardridge et al., 1995, PNAS USA.,
92, 5592-5596; Boado, 1995, Adv. Drug Delivry Rev., 15, 73-107;
Aldrian-Herrada et al., 1998, Nucleic Acids Res., 26, 4910-4916;
and Tyler et al., 1999, PNAS USA., 96, 7053-7058.
[0344] The invention also features the use of the composition
comprising surface-modified liposomes containing poly(ethylene
glycol) lipids (PEG-modified, or long-circulating liposomes or
stealth liposomes). These formulations offer a method for
increasing the accumulation of drugs in target tissues. This class
of drug carriers resists opsonization and elimination by the
mononuclear phagocytic system (MPS or RES), thereby enabling longer
blood circulation times and enhanced tissue exposure for the
encapsulated drug (Lasic et al. Chem. Rev. 1995, 95, 2601-2627;
Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011). Such
liposomes have been shown to accumulate selectively in tumors,
presumably by extravasation and capture in the neovascularized
target tissues (Lasic et al., Science 1995, 267, 1275-1276; Oku et
al., 1995, Biochim. Biophys. Acta, 1238, 86-90). The
long-circulating liposomes enhance the pharmacokinetics and
pharmacodynamics of DNA and RNA, particularly compared to
conventional cationic liposomes which are known to accumulate in
tissues of the MPS (Liu et al., J. Biol. Chem. 1995, 42,
24864-24870; Choi et al., International PCT Publication No. WO
96/10391; Ansell et al., International PCT Publication No. WO
96/10390; Holland et al., International PCT Publication No. WO
96/10392). Long-circulating liposomes are also likely to protect
drugs from nuclease degradation to a greater extent compared to
cationic liposomes, based on their ability to avoid accumulation in
metabolically aggressive MPS tissues such as the liver and
spleen.
[0345] The present invention also includes compositions prepared
for storage or administration that include a pharmaceutically
effective amount of the desired compounds in a pharmaceutically
acceptable carrier or diluent. Acceptable carriers or diluents for
therapeutic use are well known in the pharmaceutical art, and are
described, for example, in Remington's Pharmaceutical Sciences,
Mack Publishing Co. (A. R. Gennaro edit. 1985), hereby incorporated
by reference herein. For example, preservatives, stabilizers, dyes
and flavoring agents can be provided. These include sodium
benzoate, sorbic acid and esters of p-hydroxybenzoic acid. In
addition, antioxidants and suspending agents can be used.
[0346] A pharmaceutically effective dose is that dose required to
prevent, inhibit the occurrence, or treat (alleviate a symptom to
some extent, preferably all of the symptoms) of a disease state.
The pharmaceutically effective dose depends on the type of disease,
the composition used, the route of administration, the type of
mammal being treated, the physical characteristics of the specific
mammal under consideration, concurrent medication, and other
factors that those skilled in the medical arts will recognize.
Generally, an amount between 0.1 mg/kg and 100 mg/kg body
weight/day of active ingredients is administered dependent upon
potency of the negatively charged polymer.
[0347] The nucleic acid molecules of the invention and formulations
thereof can be administered orally, topically, parenterally, by
inhalation or spray, or rectally in dosage unit formulations
containing conventional non-toxic pharmaceutically acceptable
carriers, adjuvants and/or vehicles. The term parenteral as used
herein includes percutaneous, subcutaneous, intravascular (e.g.,
intravenous), intramuscular, or intrathecal injection or infusion
techniques and the like. In addition, there is provided a
pharmaceutical formulation comprising a nucleic acid molecule of
the invention and a pharmaceutically acceptable carrier. One or
more nucleic acid molecules of the invention can be present in
association with one or more non-toxic pharmaceutically acceptable
carriers and/or diluents and/or adjuvants, and if desired other
active ingredients. The pharmaceutical compositions containing
nucleic acid molecules of the invention can be in a form suitable
for oral use, for example, as tablets, troches, lozenges, aqueous
or oily suspensions, dispersible powders or granules, emulsion,
hard or soft capsules, or syrups or elixirs.
[0348] Compositions intended for oral use can be prepared according
to any method known to the art for the manufacture of
pharmaceutical compositions and such compositions can contain one
or more such sweetening agents, flavoring agents, coloring agents
or preservative agents in order to provide pharmaceutically elegant
and palatable preparations. Tablets contain the active ingredient
in admixture with non-toxic pharmaceutically acceptable excipients
that are suitable for the manufacture of tablets. These excipients
can be, for example, inert diluents; such as calcium carbonate,
sodium carbonate, lactose, calcium phosphate or sodium phosphate;
granulating and disintegrating agents, for example, corn starch, or
alginic acid; binding agents, for example starch, gelatin or
acacia; and lubricating agents, for example magnesium stearate,
stearic acid or talc. The tablets can be uncoated or they can be
coated by known techniques. In some cases such coatings can be
prepared by known techniques to delay disintegration and absorption
in the gastrointestinal tract and thereby provide a sustained
action over a longer period. For example, a time delay material
such as glyceryl monosterate or glyceryl distearate can be
employed.
[0349] Formulations for oral use can also be presented as hard
gelatin capsules wherein the active ingredient is mixed with an
inert solid diluent, for example, calcium carbonate, calcium
phosphate or kaolin, or as soft gelatin capsules wherein the active
ingredient is mixed with water or an oil medium, for example peanut
oil, liquid paraffin or olive oil.
[0350] Aqueous suspensions contain the active materials in a
mixture with excipients suitable for the manufacture of aqueous
suspensions. Such excipients are suspending agents, for example
sodium carboxymethylcellulose, methylcellulose,
hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone,
gum tragacanth and gum acacia; dispersing or wetting agents can be
a naturally-occurring phosphatide, for example, lecithin, or
condensation products of an alkylene oxide with fatty acids, for
example polyoxyethylene stearate, or condensation products of
ethylene oxide with long chain aliphatic alcohols, for example
heptadecaethyleneoxycetanol, or condensation products of ethylene
oxide with partial esters derived from fatty acids and a hexitol
such as polyoxyethylene sorbitol monooleate, or condensation
products of ethylene oxide with partial esters derived from fatty
acids and hexitol anhydrides, for example polyethylene sorbitan
monooleate. The aqueous suspensions can also contain one or more
preservatives, for example ethyl, or n-propyl p-hydroxybenzoate,
one or more coloring agents, one or more flavoring agents, and one
or more sweetening agents, such as sucrose or saccharin.
[0351] Oily suspensions can be formulated by suspending the active
ingredients in a vegetable oil, for example arachis oil, olive oil,
sesame oil or coconut oil, or in a mineral oil such as liquid
paraffin. The oily suspensions can contain a thickening agent, for
example beeswax, hard paraffin or cetyl alcohol. Sweetening agents
and flavoring agents can be added to provide palatable oral
preparations. These compositions can be preserved by the addition
of an anti-oxidant such as ascorbic acid
[0352] Dispersible powders and granules suitable for preparation of
an aqueous suspension by the addition of water provide the active
ingredient in admixture with a dispersing or wetting agent,
suspending agent and one or more preservatives. Suitable dispersing
or wetting agents or suspending agents are exemplified by those
already mentioned above. Additional excipients, for example
sweetening, flavoring and coloring agents, can also be present.
[0353] Pharmaceutical compositions of the invention can also be in
the form of oil-in-water emulsions. The oily phase can be a
vegetable oil or a mineral oil or mixtures of these. Suitable
emulsifying agents can be naturally-occurring gums, for example gum
acacia or gum tragacanth, naturally-occurring phosphatides, for
example soy bean, lecithin, and esters or partial esters derived
from fatty acids and hexitol, anhydrides, for example sorbitan
monooleate, and condensation products of the said partial esters
with ethylene oxide, for example polyoxyethylene sorbitan
monooleate. The emulsions can also contain sweetening and flavoring
agents.
[0354] Syrups and elixirs can be formulated with sweetening agents,
for example glycerol, propylene glycol, sorbitol, glucose or
sucrose. Such formulations can also contain a demulcent, a
preservative and flavoring and coloring agents. The pharmaceutical
compositions can be in the form of a sterile injectable aqueous or
oleaginous suspension. This suspension can be formulated according
to the known art using those suitable dispersing or wetting agents
and suspending agents that have been mentioned above. The sterile
injectable preparation can also be a sterile injectable solution or
suspension in a non-toxic parentally acceptable diluent or solvent,
for example as a solution in 1,3-butanediol. Among the acceptable
vehicles and solvents that can be employed are water, Ringer's
solution and isotonic sodium chloride solution. In addition,
sterile, fixed oils are conventionally employed as a solvent or
suspending medium. For this purpose, any bland fixed oil can be
employed including synthetic mono- or diglycerides. In addition,
fatty acids such as oleic acid find use in the preparation of
injectables.
[0355] The nucleic acid molecules of the invention can also be
administered in the form of suppositories, e.g., for rectal
administration of the drug. These compositions can be prepared by
mixing the drug with a suitable non-irritating excipient that is
solid at ordinary temperatures but liquid at the rectal temperature
and will therefore melt in the rectum to release the drug. Such
materials include cocoa butter and polyethylene glycols.
[0356] Nucleic acid molecules of the invention can be administered
parenterally in a sterile medium. The drug, depending on the
vehicle and concentration used, can either be suspended or
dissolved in the vehicle. Advantageously, adjuvants such as local
anesthetics, preservatives and buffering agents can be dissolved in
the vehicle.
[0357] Dosage levels of the order of from about 0.1 mg to about 140
mg per kilogram of body weight per day are useful in the treatment
of the above-indicated conditions (about 0.5 mg to about 7 g per
subject per day). The amount of active ingredient that can be
combined with the carrier materials to produce a single dosage form
varies depending upon the host treated and the particular mode of
administration. Dosage unit forms generally contain between from
about 1 mg to about 500 mg of an active ingredient.
[0358] It is understood that the specific dose level for any
particular subject depends upon a variety of factors including the
activity of the specific compound employed, the age, body weight,
general health, sex, diet, time of administration, route of
administration, and rate of excretion, drug combination and the
severity of the particular disease undergoing therapy.
[0359] For administration to non-human animals, the composition can
also be added to the animal feed or drinking water. It can be
convenient to formulate the animal feed and drinking water
compositions so that the animal takes in a therapeutically
appropriate quantity of the composition along with its diet. It can
also be convenient to present the composition as a premix for
addition to the feed or drinking water.
[0360] The nucleic acid molecules of the present invention can also
be administered to a subject in combination with other therapeutic
compounds to increase the overall therapeutic effect. The use of
multiple compounds to treat an indication can increase the
beneficial effects while reducing the presence of side effects.
[0361] In one embodiment, the invention comprises compositions
suitable for administering nucleic acid molecules of the invention
to specific cell types. For example, the asialoglycoprotein
receptor (ASGPr) (Wu and Wu, 1987, J. Biol. Chem. 262, 4429-4432)
is unique to hepatocytes and binds branched galactose-terminal
glycoproteins, such as asialoorosomucoid (ASOR). In another
example, the folate receptor is overexpressed in many cancer cells.
Binding of such glycoproteins, synthetic glycoconjugates, or
folates to the receptor takes place with an affinity that strongly
depends on the degree of branching of the oligosaccharide chain,
for example, triatennary structures are bound with greater affinity
than biatenarry or monoatennary chains (Baenziger and Fiete, 1980,
Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257,
939-945). Lee and Lee, 1987, Glycoconjugate J., 4, 317-328,
obtained this high specificity through the use of
N-acetyl-D-galactosamine as the carbohydrate moiety, which has
higher affinity for the receptor, compared to galactose. This
"clustering effect" has also been described for the binding and
uptake of mannosyl-terminating glycoproteins or glycoconjugates
(Ponpipom et al., 1981, J. Med. Chem., 24, 1388-1395). The use of
galactose, galactosamine, or folate based conjugates to transport
exogenous compounds across cell membranes can provide a targeted
delivery approach to, for example, the treatment of liver disease,
cancers of the liver, or other cancers. The use of bioconjugates
can also provide a reduction in the required dose of therapeutic
compounds required for treatment. Furthermore, therapeutic
bioavailability, pharmacodynamics, and pharmacokinetic parameters
can be modulated through the use of nucleic acid bioconjugates of
the invention. Non-limiting examples of such bioconjugates are
described in Vargeese et al., U.S. Ser. No. 10/201,394, filed Aug.
13, 2001; and Matulic-Adamic et al., U.S. Ser. No. 60/362,016,
filed Mar. 6, 2002.
[0362] Alternatively, certain siNA molecules of the instant
invention can be expressed within cells from eukaryotic promoters
(e.g., Izant and Weintraub, 1985, Science, 229, 345; McGarry and
Lindquist, 1986, Proc. Natl. Acad. Sci., USA 83, 399; Scanlon et
al., 1991, Proc. Natl. Acad. Sci. USA, 88, 10591-5; Kashani-Sabet
et al., 1992, Antisense Res. Dev., 2, 3-15; propulic et al., 1992,
J. Virol., 66, 1432-41; Weerasinghe et al., 1991, J. Virol., 65,
5531-4; Ojwang et al., 1992, Proc. Natl. Acad. Sci. USA, 89,
10802-6; Chen et al., 1992, Nucleic Acids Res., 20, 4581-9; Sarver
et al., 1990 Science, 247, 1222-1225; Thompson et al., 1995,
Nucleic Acids Res., 23, 2259; Good et al., 1997, Gene Therapy, 4,
45. Those skilled in the art realize that any nucleic acid can be
expressed in eukaryotic cells from the appropriate DNA/RNA vector.
The activity of such nucleic acids can be augmented by their
release from the primary transcript by a enzymatic nucleic acid
(Draper et al., PCT WO 93/23569, and Sullivan et al., PCT WO
94/02595; Ohkawa et al., 1992, Nucleic Acids Symp. Ser., 27, 15-6;
Taira et al., 1991, Nucleic Acids Res., 19, 5125-30; Ventura et
al., 1993, Nucleic Acids Res., 21, 3249-55; Chowrira et al., 1994,
J. Biol. Chem., 269, 25856.
[0363] In another aspect of the invention, RNA molecules of the
present invention can be expressed from transcription units (see
for example Couture et al., 1996, TIG., 12, 510) inserted into DNA
or RNA vectors. The recombinant vectors can be DNA plasmids or
viral vectors. siNA expressing viral vectors can be constructed
based on, but not limited to, adeno-associated virus, retrovirus,
adenovirus, or alphavirus. In another embodiment, pol III based
constructs are used to express nucleic acid molecules of the
invention (see for example Thompson, U.S. Pats. Nos. 5,902,880 and
6,146,886). The recombinant vectors capable of expressing the siNA
molecules can be delivered as described above, and persist in
target cells. Alternatively, viral vectors can be used that provide
for transient expression of nucleic acid molecules. Such vectors
can be repeatedly administered as necessary. Once expressed, the
siNA molecule interacts with the target mRNA and generates an RNAi
response. Delivery of siNA molecule expressing vectors can be
systemic, such as by intravenous or intra-muscular administration,
by administration to target cells ex-planted from a subject
followed by reintroduction into the subject, or by any other means
that would allow for introduction into the desired target cell (for
a review see Couture et al., 1996, TIG., 12, 510).
[0364] In one aspect the invention features an expression vector
comprising a nucleic acid sequence encoding at least one siNA
molecule of the instant invention. The expression vector can encode
one or both strands of a siNA duplex, or a single
self-complementary strand that self hybridizes into a siNA duplex.
The nucleic acid sequences encoding the siNA molecules of the
instant invention can be operably linked in a manner that allows
expression of the siNA molecule (see for example Paul et al., 2002,
Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature
Biotechnology, 19, 497; Lee et al., 2002, Nature Biotechnology, 19,
500; and Novina et al., 2002, Nature Medicine, advance online
publication doi: 10. 1038/nm725).
[0365] In another aspect, the invention features an expression
vector comprising: a) a transcription initiation region (e.g.,
eukaryotic pol I, II or III initiation region); b) a transcription
termination region (e.g., eukaryotic pol I, II or III termination
region); and c) a nucleic acid sequence encoding at least one of
the siNA molecules of the instant invention, wherein said sequence
is operably linked to said initiation region and said termination
region in a manner that allows expression and/or delivery of the
siNA molecule. The vector can optionally include an open reading
frame (ORF) for a protein operably linked on the 5' side or the
3'-side of the sequence encoding the siNA of the invention; and/or
an intron (intervening sequences).
[0366] Transcription of the siNA molecule sequences can be driven
from a promoter for eukaryotic RNA polymerase I (pol I), RNA
polymerase II (po III), or RNA polymerase III (po III). Transcripts
from pol II or pol III promoters are expressed at high levels in
all cells; the levels of a given pol II promoter in a given cell
type depends on the nature of the gene regulatory sequences
(enhancers, silencers, etc.) present nearby. Prokaryotic RNA
polymerase promoters are also used, providing that the prokaryotic
RNA polymerase enzyme is expressed in the appropriate cells
(Elroy-Stein and Moss, 1990, Proc. Natl. Acad. Sci. USA, 87,
6743-7; Gao and Huang 1993, Nucleic Acids Res., 21, 2867-72; Lieber
et al., 1993, Methods Enzymol., 217, 47-66; Zhou et al., 1990, Mol.
Cell. Biol., 10, 4529-37). Several investigators have demonstrated
that nucleic acid molecules expressed from such promoters can
function in mammalian cells (e.g. Kashani-Sabet et al., 1992,
Antisense Res. Dev., 2, 3-15; Ojwang et al., 1992, Proc. Natl.
Acad. Sci. USA, 89, 10802-6; Chen et al., 1992, Nucleic Acids Res.,
20, 4581-9; Yu et al., 1993, Proc. Natl. Acad. Sci. USA, 90,
6340-4; L'Huillier et al., 1992, EMBO J., 11, 4411-8; Lisziewicz et
al., 1993, Proc. Natl. Acad. Sci. U.S. A, 90, 8000-4; Thompson et
al., 1995, Nucleic Acids Res., 23, 2259; Sullenger & Cech,
1993, Science, 262, 1566). More specifically, transcription units
such as the ones derived from genes encoding U6 small nuclear
(snRNA), transfer RNA (tRNA) and adenovirus VA RNA are useful in
generating high concentrations of desired RNA molecules such as
siNA in cells (Thompson et al., supra; Couture and Stinchcomb,
1996, supra; Noonberg et al., 1994, Nucleic Acid Res., 22, 2830;
Noonberg et al., U.S. Pat. No. 5,624,803; Good et al., 1997, Gene
Ther., 4, 45; Beigelman et al., International PCT Publication No.
WO 96/18736. The above siNA transcription units can be incorporated
into a variety of vectors for introduction into mammalian cells,
including but not restricted to, plasmid DNA vectors, viral DNA
vectors (such as adenovirus or adeno-associated virus vectors), or
viral RNA vectors (such as retroviral or alphavirus vectors) (for a
review see Couture and Stinchcomb, 1996, supra).
[0367] In another aspect the invention features an expression
vector comprising a nucleic acid sequence encoding at least one of
the siNA molecules of the invention in a manner that allows
expression of that siNA molecule. The expression vector comprises
in one embodiment; a) a transcription initiation region; b) a
transcription termination region; and c) a nucleic acid sequence
encoding at least one strand of the siNA molecule, wherein the
sequence is operably linked to the initiation region and the
termination region in a manner that allows expression and/or
delivery of the siNA molecule.
[0368] In another embodiment the expression vector comprises: a) a
transcription initiation region; b) a transcription termination
region; c) an open reading frame; and d) a nucleic acid sequence
encoding at least one strand of a siNA molecule, wherein the
sequence is operably linked to the 3'-end of the open reading frame
and wherein the sequence is operably linked to the initiation
region, the open reading frame and the termination region in a
manner that allows expression and/or delivery of the siNA molecule.
In yet another embodiment, the expression vector comprises: a) a
transcription initiation region; b) a transcription termination
region; c) an intron; and d) a nucleic acid sequence encoding at
least one siNA molecule, wherein the sequence is operably linked to
the initiation region, the intron and the termination region in a
manner which allows expression and/or delivery of the nucleic acid
molecule.
[0369] In another embodiment, the expression vector comprises: a) a
transcription initiation region; b) a transcription termination
region; c) an intron; d) an open reading frame; and e) a nucleic
acid sequence encoding at least one strand of a siNA molecule,
wherein the sequence is operably linked to the 3'-end of the open
reading frame and wherein the sequence is operably linked to the
initiation region, the intron, the open reading frame and the
termination region in a manner which allows expression and/or
delivery of the siNA molecule.
TNF/TNF Receptor Biology and Biochemistry
[0370] The identification and cloning of the cytokines have
provided a wealth of data on endogenous immunological and
inflammatory mediators, and their role in host defense against
infection (van Deuren et al., 1992, J. Pathol., 168, 349-356).
Cytokines also have been associated with pathology due to
over-expression or inappropriate production. Cytokine cascades are
implicated in the tissue damage that occurs during gram negative
septic shock (Parrillo, 1993, N. Engl. J. Med., 328, 1471-1477), in
the joint inflammation and tissue destruction that occurs during
rheumatoid arthritis (Harris, 1990, N. Engl. J. Med., 322, 1277),
and in a positive feedback loop between cytokine production and the
replication of human immunodeficiency virus (HIV) (Fauci, 1990,
Lymphokine Res., 9, 527-531). A common thread interweaving these
pathological conditions is their association with abnormally high
levels of the proinflammatory cytokine tumor necrosis factor alpha
(TNF-alpha).
[0371] Tumor necrosis factor-alpha (TNF-alpha) is a protein,
secreted by activated leukocytes, that is a potent mediator of
inflammatory reactions. Injection of TNF-alpha. into experimental
animals can simulate the symptoms of systemic and local
inflammatory diseases, such as septic shock or rheumatoid
arthritis.
[0372] TNF-alpha was initially described as a factor secreted by
activated macrophages, which mediates the destruction of solid
tumors in mice (Old, 1985, Science, 230, 4225-4231). TNF-alpha
subsequently was found to be identical to cachectin, an agent
responsible for the weight loss and wasting syndrome associated
with tumors and chronic infections (Beutler, et al., 1985, Nature,
316, 552-554). The cDNA and the genomic locus for TNF-alpha have
been cloned and found to be related to TNF-beta (Shakhov et al.,
1990, J. Exp. Med., 171, 35-47). Both TNF-alpha and TNF-beta bind
to the same receptors and have nearly identical biological
activities. The two TNF receptors have been found on most cell
types examined (Smith, et al., 1990, Science, 248, 1019-1023).
TNF-alpha secretion has been detected from monocytes/macrophages,
CD4+ and CD8+ T-cells, B-cells, lymphokine activated killer cells,
neutrophils, astrocytes, endothelial cells, smooth muscle cells, as
well as various non-hematopoietic tumor cell lines (for a review,
see Turestskaya et al., 1991 in Tumor Necrosis Factor: Structure,
Function, and Mechanism of Action B. B. Aggarwal, J. Vilcek, Eds.
Marcel Dekker, Inc., pp. 35-60). TNF-alpha is regulated
transcriptionally and translationally, and requires proteolytic
processing at the plasma membrane in order to be secreted (Kriegler
et al., 1988, Cell, 53, 45-53). Once secreted, the serum half life
of TNF-alpha is approximately 30 minutes. The tight regulation of
TNF-alpha is important due to the extreme toxicity of this
cytokine. Increasing evidence indicates that overproduction of
TNF-alpha during infections can lead to severe systemic toxicity
and death (Tracey & Cerami, 1992, Am. J. Trop. Med. Hyg., 47,
2-7).
[0373] Sullivan et al., U.S. Pat. No. 5,811,300, describe enzymatic
nucleic acid molecules targeting TNF-alpha. Sioud et al., 1992, J.
Mol. Biol., 223, 831 and Sioud, WO 94/10301; describe certain
antisense and ribozymes targeting TNF-alpha.
[0374] The use of small interfering nucleic acid molecules
targeting TNF genes therefore provides a class of novel therapeutic
agents that can be used in the treatment of septic shock,
rheumatoid arthritis, HIV and AIDS, psoriasis, inflammatory or
autoimmune disorders or any other disease or condition that
responds to modulation of TNF superfamily genes.
EXAMPLES
[0375] The following are non-limiting examples showing the
selection, isolation, synthesis and activity of nucleic acids of
the instant invention.
Example 1
Tandem Synthesis of siNA Constructs
[0376] Exemplary siNA molecules of the invention are synthesized in
tandem using a cleavable linker, for example, a succinyl-based
linker. Tandem synthesis as described herein is followed by a
one-step purification process that provides RNAi molecules in high
yield. This approach is highly amenable to siNA synthesis in
support of high throughput RNAi screening, and can be readily
adapted to multi-column or multi-well synthesis platforms.
[0377] After completing a tandem synthesis of a siNA oligo and its
complement in which the 5'-terminal dimethoxytrityl (5'-O-DMT)
group remains intact (trityl on synthesis), the oligonucleotides
are deprotected as described above. Following deprotection, the
siNA sequence strands are allowed to spontaneously hybridize. This
hybridization yields a duplex in which one strand has retained the
5'-O-DMT group while the complementary strand comprises a terminal
5'-hydroxyl. The newly formed duplex behaves as a single molecule
during routine solid-phase extraction purification (Trityl-On
purification) even though only one molecule has a dimethoxytrityl
group. Because the strands form a stable duplex, this
dimethoxytrityl group (or an equivalent group, such as other trityl
groups or other hydrophobic moieties) is all that is required to
purify the pair of oligos, for example, by using a C18
cartridge.
[0378] Standard phosphoramidite synthesis chemistry is used up to
the point of introducing a tandem linker, such as an inverted deoxy
abasic succinate or glyceryl succinate linker (see FIG. 1) or an
equivalent cleavable linker. A non-limiting example of linker
coupling conditions that can be used includes a hindered base such
as diisopropylethylamine (DIPA) and/or DMAP in the presence of an
activator reagent such as
Bromotripyrrolidinophosphoniumhexafluororophosphate (PyBrOP). After
the linker is coupled, standard synthesis chemistry is utilized to
complete synthesis of the second sequence leaving the terminal the
5'-O-DMT intact. Following synthesis, the resulting oligonucleotide
is deprotected according to the procedures described herein and
quenched with a suitable buffer, for example with 50 mM NaOAc or
1.5M NH.sub.4H.sub.2CO.sub.3.
[0379] Purification of the siNA duplex can be readily accomplished
using solid phase extraction, for example, using a Waters C18
SepPak 1 g cartridge conditioned with 1 column volume (CV) of
acetonitrile, 2 CV H2O, and 2 CV 50 mM NaOAc. The sample is loaded
and then washed with 1 CV H2O or 50 mM NaOAc. Failure sequences are
eluted with 1 CV 14% ACN (Aqueous with 50 mM NaOAc and 50 mM NaCl).
The column is then washed, for example with 1 CV H2O followed by
on-column detritylation, for example by passing 1 CV of 1% aqueous
trifluoroacetic acid (TFA) over the column, then adding a second CV
of 1% aqueous TFA to the column and allowing to stand for
approximately 10 minutes. The remaining TFA solution is removed and
the column washed with H20 followed by 1 CV 1M NaCl and additional
H2O. The siNA duplex product is then eluted, for example, using 1
CV 20% aqueous CAN.
[0380] FIG. 2 provides an example of MALDI-TOF mass spectrometry
analysis of a purified siNA construct in which each peak
corresponds to the calculated mass of an individual siNA strand of
the siNA duplex. The same purified siNA provides three peaks when
analyzed by capillary gel electrophoresis (CGE), one peak
presumably corresponding to the duplex siNA, and two peaks
presumably corresponding to the separate siNA sequence strands. Ion
exchange HPLC analysis of the same siNA contract only shows a
single peak. Testing of the purified siNA construct using a
luciferase reporter assay described below demonstrated the same
RNAi activity compared to siNA constructs generated from separately
synthesized oligonucleotide sequence strands.
Example 2
Identification of Potential siNA Target Sites in any RNA
Sequence
[0381] The sequence of an RNA target of interest, such as a viral
or human mRNA transcript, is screened for target sites, for example
by using a computer folding algorithm. In a non-limiting example,
the sequence of a gene or RNA gene transcript derived from a
database, such as Genbank, is used to generate siNA targets having
complementarity to the target. Such sequences can be obtained from
a database, or can be determined experimentally as known in the
art. Target sites that are known, for example, those target sites
determined to be effective target sites based on studies with other
nucleic acid molecules, for example ribozymes or antisense, or
those targets known to be associated with a disease or condition
such as those sites containing mutations or deletions, can be used
to design siNA molecules targeting those sites. Various parameters
can be used to determine which sites are the most suitable target
sites within the target RNA sequence. These parameters include but
are not limited to secondary or tertiary RNA structure, the
nucleotide base composition of the target sequence, the degree of
homology between various regions of the target sequence, or the
relative position of the target sequence within the RNA transcript.
Based on these determinations, any number of target sites within
the RNA transcript can be chosen to screen siNA molecules for
efficacy, for example by using in vitro RNA cleavage assays, cell
culture, or animal models. In a non-limiting example, anywhere from
1 to 1000 target sites are chosen within the transcript based on
the size of the siNA construct to be used. High throughput
screening assays can be developed for screening siNA molecules
using methods known in the art, such as with multi-well or
multi-plate assays to determine efficient reduction in target gene
expression.
Example 3
Selection of siNA Molecule Target Sites in a RNA
[0382] The following non-limiting steps can be used to carry out
the selection of siNAs targeting a given gene sequence or
transcript. [0383] 1. The target sequence is parsed in silico into
a list of all fragments or subsequences of a particular length, for
example 23 nucleotide fragments, contained within the target
sequence. This step is typically carried out using a custom Perl
script, but commercial sequence analysis programs such as Oligo,
MacVector, or the GCG Wisconsin Package can be employed as well.
[0384] 2. In some instances the siNAs correspond to more than one
target sequence; such would be the case for example in targeting
different transcripts of the same gene, targeting different
transcripts of more than one gene, or for targeting both the human
gene and an animal homolog. In this case, a subsequence list of a
particular length is generated for each of the targets, and then
the lists are compared to find matching sequences in each list. The
subsequences are then ranked according to the number of target
sequences that contain the given subsequence; the goal is to find
subsequences that are present in most or all of the target
sequences. Alternately, the ranking can identify subsequences that
are unique to a target sequence, such as a mutant target sequence.
Such an approach would enable the use of siNA to target
specifically the mutant sequence and not effect the expression of
the normal sequence. [0385] 3. In some instances the siNA
subsequences are absent in one or more sequences while present in
the desired target sequence; such would be the case if the siNA
targets a gene with a paralogous family member that is to remain
untargeted. As in case 2 above, a subsequence list of a particular
length is generated for each of the targets, and then the lists are
compared to find sequences that are present in the target gene but
are absent in the untargeted paralog. [0386] 4. The ranked siNA
subsequences can be further analyzed and ranked according to GC
content. A preference can be given to sites containing 30-70% GC,
with a further preference to sites containing 40-60% GC. [0387] 5.
The ranked siNA subsequences can be further analyzed and ranked
according to self-folding and internal hairpins. Weaker internal
folds are preferred; strong hairpin structures are to be avoided.
[0388] 6. The ranked siNA subsequences can be further analyzed and
ranked according to whether they have runs of GGG or CCC in the
sequence. GGG (or even more Gs) in either strand can make
oligonucleotide synthesis problematic and can potentially interfere
with RNAi activity, so it is avoided whenever better sequences are
available. CCC is searched in the target strand because that will
place GGG in the antisense strand. [0389] 7. The ranked siNA
subsequences can be further analyzed and ranked according to
whether they have the dinucleotide UU (uridine dinucleotide) on the
3'-end of the sequence, and/or AA on the 5'-end of the sequence (to
yield 3' UU on the antisense sequence). These sequences allow one
to design siNA molecules with terminal TT thymidine dinucleotides.
[0390] 8. Four or five target sites are chosen from the ranked list
of subsequences as described above. For example, in subsequences
having 23 nucleotides, the right 21 nucleotides of each chosen
23-mer subsequence are then designed and synthesized for the upper
(sense) strand of the siNA duplex, while the reverse complement of
the left 21 nucleotides of each chosen 23-mer subsequence are then
designed and synthesized for the lower (antisense) strand of the
siNA duplex (see Tables II and III). If terminal TT residues are
desired for the sequence (as described in paragraph 7), then the
two 3' terminal nucleotides of both the sense and antisense strands
are replaced by TT prior to synthesizing the oligos. [0391] 9. The
siNA molecules are screened in an in vitro, cell culture or animal
model system to identify the most active siNA molecule or the most
preferred target site within the target RNA sequence. [0392] 10.
Other design considerations can be used when selecting target
nucleic acid sequences, see, for example, Reynolds et al., 2004,
Nature Biotechnology Advanced Online Publication, 1 Feb. 2004,
doi:10.1038/nbt936 and Ui-Tei et al., 2004, Nucleic Acids Research,
32, doi: 10.1093/nar/gkh247.
[0393] In an alternate approach, a pool of siNA constructs specific
to a TNF and/or TNF receptor target sequence is used to screen for
target sites in cells expressing TNF and/or TNF receptor RNA, such
as such human lung A549 cells or vascular endothelial cells (e.g.,
HUVEC cells). The general strategy used in this approach is shown
in FIG. 9. A non-limiting example of such is a pool comprising
sequences having any of SEQ ID NOs. 1-368. Cells expressing TNF
and/or TNF receptor are transfected with the pool of siNA
constructs and cells that demonstrate a phenotype associated with
TNF and/or TNF receptor inhibition are sorted. The pool of siNA
constructs can be expressed from transcription cassettes inserted
into appropriate vectors (see for example FIG. 7 and FIG. 8). The
siNA from cells demonstrating a positive phenotypic change (e.g.,
decreased proliferation, decreased TNF and/or TNF receptor mRNA
levels or decreased TNF and/or TNF receptor protein expression),
are sequenced to determine the most suitable target site(s) within
the target TNF and/or TNF receptor RNA sequence.
Example 4
TNF and/or TNF Receptor Targeted siNA Design
[0394] siNA target sites were chosen by analyzing sequences of the
TNF and/or TNF receptor RNA target and optionally prioritizing the
target sites on the basis of folding (structure of any given
sequence analyzed to determine siNA accessibility to the target),
by using a library of siNA molecules as described in Example 3, or
alternately by using an in vitro siNA system as described in
Example 6 herein. siNA molecules were designed that could bind each
target and are optionally individually analyzed by computer folding
to assess whether the siNA molecule can interact with the target
sequence. Varying the length of the siNA molecules can be chosen to
optimize activity. Generally, a sufficient number of complementary
nucleotide bases are chosen to bind to, or otherwise interact with,
the target RNA, but the degree of complementarity can be modulated
to accommodate siNA duplexes or varying length or base composition.
By using such methodologies, siNA molecules can be designed to
target sites within any known RNA sequence, for example those RNA
sequences corresponding to the any gene transcript.
[0395] Chemically modified siNA constructs are designed to provide
nuclease stability for systemic administration in vivo and/or
improved pharmacokinetic, localization, and delivery properties
while preserving the ability to mediate RNAi activity. Chemical
modifications as described herein are introduced synthetically
using synthetic methods described herein and those generally known
in the art. The synthetic siNA constructs are then assayed for
nuclease stability in serum and/or cellular/tissue extracts (e.g.
liver extracts). The synthetic siNA constructs are also tested in
parallel for RNAi activity using an appropriate assay, such as a
luciferase reporter assay as described herein or another suitable
assay that can quantity RNAi activity. Synthetic siNA constructs
that possess both nuclease stability and RNAi activity can be
further modified and re-evaluated in stability and activity assays.
The chemical modifications of the stabilized active siNA constructs
can then be applied to any siNA sequence targeting any chosen RNA
and used, for example, in target screening assays to pick lead siNA
compounds for therapeutic development (see for example FIG.
11).
Example 5
Chemical Synthesis and Purification of siNA
[0396] siNA molecules can be designed to interact with various
sites in the RNA message, for example, target sequences within the
RNA sequences described herein. The sequence of one strand of the
siNA molecule(s) is complementary to the target site sequences
described above. The siNA molecules can be chemically synthesized
using methods described herein. Inactive siNA molecules that are
used as control sequences can be synthesized by scrambling the
sequence of the siNA molecules such that it is not complementary to
the target sequence. Generally, siNA constructs can by synthesized
using solid phase oligonucleotide synthesis methods as described
herein (see for example Usman et al., U.S. Pat. Nos. 5,804,683;
5,831,071; 5,998,203; 6,117,657; 6,353,098; 6,362,323; 6,437,117;
6,469,158; Scaringe et al., U.S. Pat. Nos. 5,889,136; 6,008,400;
6,111,086 all incorporated by reference herein in their
entirety).
[0397] In a non-limiting example, RNA oligonucleotides are
synthesized in a stepwise fashion using the phosphoramidite
chemistry as is known in the art. Standard phosphoramidite
chemistry involves the use of nucleosides comprising any of
5'-O-dimethoxytrityl, 2'-O-tert-butyldimethylsilyl,
3'-O-2-Cyanoethyl N,N-diisopropylphos-phoroamidite groups, and
exocyclic amine protecting groups (e.g. N6-benzoyl adenosine, N4
acetyl cytidine, and N2-isobutyryl guanosine). Alternately,
2'-O--Silyl Ethers can be used in conjunction with acid-labile
2'-O-orthoester protecting groups in the synthesis of RNA as
described by Scaringe supra. Differing 2' chemistries can require
different protecting groups, for example 2'-deoxy-2'-amino
nucleosides can utilize N-phthaloyl protection as described by
Usman et al., U.S. Pat. No. 5,631,360, incorporated by reference
herein in its entirety).
[0398] During solid phase synthesis, each nucleotide is added
sequentially (3'- to 5'-direction) to the solid support-bound
oligonucleotide. The first nucleoside at the 3'-end of the chain is
covalently attached to a solid support (e.g., controlled pore glass
or polystyrene) using various linkers. The nucleotide precursor, a
ribonucleoside phosphoramidite, and activator are combined
resulting in the coupling of the second nucleoside phosphoramidite
onto the 5'-end of the first nucleoside. The support is then washed
and any unreacted 5'-hydroxyl groups are capped with a capping
reagent such as acetic anhydride to yield inactive 5'-acetyl
moieties. The trivalent phosphorus linkage is then oxidized to a
more stable phosphate linkage. At the end of the nucleotide
addition cycle, the 5'-O-protecting group is cleaved under suitable
conditions (e.g., acidic conditions for trityl-based groups and
Fluoride for silyl-based groups). The cycle is repeated for each
subsequent nucleotide.
[0399] Modification of synthesis conditions can be used to optimize
coupling efficiency, for example by using differing coupling times,
differing reagent/phosphoramidite concentrations, differing contact
times, differing solid supports and solid support linker
chemistries depending on the particular chemical composition of the
siNA to be synthesized. Deprotection and purification of the siNA
can be performed as is generally described in Usman et al., U.S.
Pat. No. 5,831,071, U.S. Pat. No. 6,353,098, U.S. Pat. No.
6,437,117, and Bellon et al., U.S. Pat. No. 6,054,576, U.S. Pat.
No. 6,162,909, U.S. Pat. No. 6,303,773, or Scaringe supra,
incorporated by reference herein in their entireties. Additionally,
deprotection conditions can be modified to provide the best
possible yield and purity of siNA constructs. For example,
applicant has observed that oligonucleotides comprising
2'-deoxy-2'-fluoro nucleotides can degrade under inappropriate
deprotection conditions. Such oligonucleotides are deprotected
using aqueous methylamine at about 35.degree. C. for 30 minutes. If
the 2'-deoxy-2'-fluoro containing oligonucleotide also comprises
ribonucleotides, after deprotection with aqueous methylamine at
about 35.degree. C. for 30 minutes, TEA-HF is added and the
reaction maintained at about 65.degree. C. for an additional 15
minutes.
Example 6
RNAi In Vitro Assay to Assess siNA Activity
[0400] An in vitro assay that recapitulates RNAi in a cell-free
system is used to evaluate siNA constructs targeting TNF and/or TNF
receptor RNA targets. The assay comprises the system described by
Tuschl et al., 1999, Genes and Development, 13, 3191-3197 and
Zamore et al., 2000, Cell, 101, 25-33 adapted for use with TNF
and/or TNF receptor target RNA. A Drosophila extract derived from
syncytial blastoderm is used to reconstitute RNAi activity in
vitro. Target RNA is generated via in vitro transcription from an
appropriate TNF and/or TNF receptor expressing plasmid using T7 RNA
polymerase or via chemical synthesis as described herein. Sense and
antisense siNA strands (for example 20 uM each) are annealed by
incubation in buffer (such as 100 mM potassium acetate, 30 mM
HEPES-KOH, pH 7.4, 2 mM magnesium acetate) for 1 minute at
90.degree. C. followed by 1 hour at 37.degree. C., then diluted in
lysis buffer (for example 100 mM potassium acetate, 30 mM HEPES-KOH
at pH 7.4, 2 mM magnesium acetate). Annealing can be monitored by
gel electrophoresis on an agarose gel in TBE buffer and stained
with ethidium bromide. The Drosophila lysate is prepared using zero
to two-hour-old embryos from Oregon R flies collected on yeasted
molasses agar that are dechorionated and lysed. The lysate is
centrifuged and the supernatant isolated. The assay comprises a
reaction mixture containing 50% lysate [vol/vol], RNA (10-50 pM
final concentration), and 10% [vol/vol] lysis buffer containing
siNA (10 nM final concentration). The reaction mixture also
contains 10 mM creatine phosphate, 10 ug/ml creatine phosphokinase,
100 um GTP, 100 uM UTP, 100 uM CTP, 500 uM ATP, 5 mM DTT, 0.1 U/uL
RNasin (Promega), and 100 uM of each amino acid. The final
concentration of potassium acetate is adjusted to 100 mM. The
reactions are pre-assembled on ice and preincubated at 25.degree.
C. for 10 minutes before adding RNA, then incubated at 25.degree.
C. for an additional 60 minutes. Reactions are quenched with 4
volumes of 1.25.times.Passive Lysis Buffer (Promega). Target RNA
cleavage is assayed by RT-PCR analysis or other methods known in
the art and are compared to control reactions in which siNA is
omitted from the reaction.
[0401] Alternately, internally-labeled target RNA for the assay is
prepared by in vitro transcription in the presence of
[alpha-.sup.32P] CTP, passed over a G50 Sephadex column by spin
chromatography and used as target RNA without further purification.
Optionally, target RNA is 5'-.sup.32P-end labeled using T4
polynucleotide kinase enzyme. Assays are performed as described
above and target RNA and the specific RNA cleavage products
generated by RNAi are visualized on an autoradiograph of a gel. The
percentage of cleavage is determined by PHOSPHOR IMAGER.RTM.
(autoradiography) quantitation of bands representing intact control
RNA or RNA from control reactions without siNA and the cleavage
products generated by the assay.
[0402] In one embodiment, this assay is used to determine target
sites in the TNF and/or TNF receptor RNA target for siNA mediated
RNAi cleavage, wherein a plurality of siNA constructs are screened
for RNAi mediated cleavage of the TNF and/or TNF receptor RNA
target, for example, by analyzing the assay reaction by
electrophoresis of labeled target RNA, or by northern blotting, as
well as by other methodology well known in the art.
Example 7
Nucleic Acid Inhibition of TNF and/or TNF Receptor Target RNA
[0403] siNA molecules targeted to the human TNF and/or TNF receptor
RNA are designed and synthesized as described above. These nucleic
acid molecules can be tested for cleavage activity in vivo, for
example, using the following procedure. The target sequences and
the nucleotide location within the TNF and/or TNF receptor RNA are
given in Tables II and III.
[0404] Two formats are used to test the efficacy of siNAs targeting
TNF and/or TNF receptor. First, the reagents are tested in cell
culture using, for example, A549, HeLa, or HUVEC cells, to
determine the extent of RNA and protein inhibition. siNA reagents
(e.g.; see Tables II and III) are selected against the TNF and/or
TNF receptor target as described herein. RNA inhibition is measured
after delivery of these reagents by a suitable transfection agent
to, for example, cultured A549, HeLa, or HUVEC cells. Relative
amounts of target RNA are measured versus actin using real-time PCR
monitoring of amplification (eg., ABI 7700 TAQMAN.RTM.). A
comparison is made to a mixture of oligonucleotide sequences made
to unrelated targets or to a randomized siNA control with the same
overall length and chemistry, but randomly substituted at each
position. Primary and secondary lead reagents are chosen for the
target and optimization performed. After an optimal transfection
agent concentration is chosen, a RNA time-course of inhibition is
performed with the lead siNA molecule. In addition, a cell-plating
format can be used to determine RNA inhibition.
Delivery of siNA to Cells
[0405] Cells such as endothelial cells (e.g. HUVEC cells), HeLa or
A549 cells are seeded, for example, at 1.times.10.sup.5 cells per
well of a six-well dish in EGM-2 (BioWhittaker) the day before
transfection. siNA (final concentration, for example 20 nM) and
cationic lipid (e.g., final concentration 2 .mu.g/ml) are complexed
in EGM basal media (Bio Whittaker) at 37.degree. C. for 30 minutes
in polystyrene tubes. Following vortexing, the complexed siNA is
added to each well and incubated for the times indicated. For
initial optimization experiments, cells are seeded, for example, at
1.times.10.sup.3 in 96 well plates and siNA complex added as
described. Efficiency of delivery of siNA to cells is determined
using a fluorescent siNA complexed with lipid. Cells in 6-well
dishes are incubated with siNA for 24 hours, rinsed with PBS and
fixed in 2% paraformaldehyde for 15 minutes at room temperature.
Uptake of siNA is visualized using a fluorescent microscope.
TAQMAN.RTM. (Real-Time PCR Monitoring of Amplification) and
Lightcycler Quantification of mRNA
[0406] Total RNA is prepared from cells following siNA delivery,
for example, using Qiagen RNA purification kits for 6-well or
Rneasy extraction kits for 96-well assays. For TAQMAN.RTM. analysis
(real-time PCR monitoring of amplification), dual-labeled probes
are synthesized with the reporter dye, FAM or JOE, covalently
linked at the 5'-end and the quencher dye TAMRA conjugated to the
3'-end. One-step RT-PCR amplifications are performed on, for
example, an ABI PRISM 7700 Sequence Detector using 50 PI reactions
consisting of 10 .mu.l total RNA, 100 nM forward primer, 900 nM
reverse primer, 100 nM probe, 1.times. TaqMan PCR reaction buffer
(PE-Applied Biosystems), 5.5 mM MgCl.sub.2, 300 mM each dATP, dCTP,
dGTP, and dTTP, IOU RNase Inhibitor (Promega), 1.25 U AMPLITAQ
GOLD.RTM. (DNA polymerase) (PE-Applied Biosystems) and IOU M-MLV
Reverse Transcriptase (Promega). The thermal cycling conditions can
consist of 30 minutes at 48.degree. C., 10 minutes at 95.degree.
C., followed by 40 cycles of 15 seconds at 95.degree. C. and 1
minute at 60.degree. C. Quantitation of mRNA levels is determined
relative to standards generated from serially diluted total
cellular RNA (300, 100, 33, 11 ng/r.times.n) and normalizing to
.beta.-actin or GAPDH mRNA in parallel TAQMAN.RTM. reactions
(real-time PCR monitoring of amplification). For each gene of
interest an upper and lower primer and a fluorescently labeled
probe are designed. Real time incorporation of SYBR Green I dye
into a specific PCR product can be measured in glass capillary
tubes using a lightcyler. A standard curve is generated for each
primer pair using control cRNA. Values are represented as relative
expression to GAPDH in each sample.
Western Blotting
[0407] Nuclear extracts can be prepared using a standard micro
preparation technique (see for example Andrews and Faller, 1991,
Nucleic Acids Research, 19, 2499). Protein extracts from
supernatants are prepared, for example using TCA precipitation. An
equal volume of 20% TCA is added to the cell supernatant, incubated
on ice for 1 hour and pelleted by centrifugation for 5 minutes.
Pellets are washed in acetone, dried and resuspended in water.
Cellular protein extracts are run on a 10% Bis-Tris NuPage (nuclear
extracts) or 4-12% Tris-Glycine (supernatant extracts)
polyacrylamide gel and transferred onto nitro-cellulose membranes.
Non-specific binding can be blocked by incubation, for example,
with 5% non-fat milk for 1 hour followed by primary antibody for 16
hour at 4.degree. C. Following washes, the secondary antibody is
applied, for example (1:10,000 dilution) for 1 hour at room
temperature and the signal detected with SuperSignal reagent
(Pierce).
Example 8
Animal Models Useful to Evaluate the Down-Regulation of TNF and/or
TNF Receptor Gene Expression
[0408] Evaluating the efficacy of anti-TNF and/or TNF receptor
agents in animal models is an important prerequisite to human
clinical trials. There are several different classes of animal
models including transgenic and knockout mice, canine and rat
models, and xenografts available to assay nucleic acid molecules of
the invention for in vivo efficacy.
[0409] For example, a transgenic mouse model carrying and
expressing wild-type and 3'-modified human tumor necrosis factor
(hTNF-alpha, cachectin) transgenes has been described (Keffer et
al., 1991, EMBO J., 10, 4025-31). Endotoxin-responsive and
macrophage-specific hTNF gene expression can be established in
transgenic mice. Transgenic mice carrying 3'-modified hTNF
transgenes show deregulated patterns of expression and develop
chronic inflammatory polyarthritis. Treatment of these arthritic
mice with a monoclonal antibody against human TNF completely
prevents development of this disease. Transgenic mice which
predictably develop arthritis represent a useful genetic model to
study the effect of siNA molecules of the invention in
down-regulating TNF expression in the treatment of arthritis.
[0410] Another example of a useful in vivo model is a mouse model
of multiple sclerosis induced by experimental autoimmune
encephalomyelitis (Youssef et al., 2002, Nature, 420, 78-84). These
mice display both chronic and relapsing paralysis with upregulation
of pro-inflammatory cytokines, including TNF-alpha. As such, these
mice can be used to assay siNA molecules of the invention for
efficacy in modulation TNF expression and potential abrogation of
cytokine mediated neurotoxicity in autoimmune disorders, such as
multiple sclerosis (MS).
Example 9
RNAi Mediated Inhibition of TNF and/or TNF Receptor Expression
[0411] siNA constructs (Table III) are tested for efficacy in
reducing TNF and/or TNF receptor RNA expression in, for example,
HUVEC, HeLa, or A549 cells. Cells are plated approximately 24 hours
before transfection in 96-well plates at 5,000-7,500 cells/well,
100 .mu.l/well, such that at the time of transfection cells are
70-90% confluent. For transfection, annealed siNAs are mixed with
the transfection reagent (Lipofectamine 2000, Invitrogen) in a
volume of 50 .mu.l/well and incubated for 20 minutes at room
temperature. The siNA transfection mixtures are added to cells to
give a final siNA concentration of 25 nM in a volume of 150 .mu.l.
Each siNA transfection mixture is added to 3 wells for triplicate
siNA treatments. Cells are incubated at 37.degree. for 24 hours in
the continued presence of the siNA transfection mixture. At 24
hours, RNA is prepared from each well of treated cells. The
supernatants with the transfection mixtures are first removed and
discarded, then the cells are lysed and RNA prepared from each
well. Target gene expression following treatment is evaluated by
RT-PCR for the target gene and for a control gene (36B4, an RNA
polymerase subunit) for normalization. The triplicate data is
averaged and the standard deviations determined for each treatment.
Normalized data are graphed and the percent reduction of target
mRNA by active siNAs in comparison to their respective inverted
control siNAs is determined.
[0412] In a non-limiting example, chemically modified siNA
constructs (Table III) were tested for efficacy as described above
in reducing TNF receptor RNA expression in HeLa cells. Active siNAs
were evaluated compared to untreated cells, a matched chemistry
irrelevant control (IC), and a transfection control. Results are
summarized in FIG. 22. FIG. 22 shows results for chemically
modified siNA constructs targeting various sites in TNF receptor
mRNA. As shown in FIG. 22, the active siNA constructs provide
significant inhibition of TNF receptor gene expression in cell
culture experiments as determined by levels of TNF receptor mRNA
when compared to appropriate controls.
Example 10
Indications
[0413] The present body of knowledge in TNF/TNF receptor research
indicates the need for methods to assay TNF/TNF receptor activity
and for compounds that can regulate TNF/TNF receptor expression for
research, diagnostic, and therapeutic use. As described herein, the
nucleic acid molecules of the present invention can be used in
assays to diagnose disease state related of TNF/TNF receptor
levels. In addition, the nucleic acid molecules can be used to
treat disease state related to TNF/TNF receptor levels.
[0414] Particular conditions and disease states that can be
associated with TNF/TNF receptor expression modulation include, but
are not limited to, cancer, proliferative, inflammatory,
respiratory, neurologic, cardiovascular and/or autoimmune diseases,
conditions, or disorders, and any other diseases or conditions that
are related to or will respond to the levels of TNF/TNF receptor in
a cell or tissue, alone or in combination with other therapies.
[0415] The use of immunomodulators, anti-inflammatory compounds,
surgery, radiation treatments and chemotherapeutics such as
Gemcytabine and cyclophosphamide are non-limiting examples of
chemotherapeutic agents that can be combined with or used in
conjunction with the nucleic acid molecules (e.g. siNA molecules)
of the instant invention. Those skilled in the art will recognize
that other anti-cancer, immunomodulatory, and anti-inflammatory
compounds and therapies can be similarly be readily combined with
the nucleic acid molecules of the instant invention (e.g. siNA
molecules) and are hence within the scope of the instant invention.
Such compounds and therapies are well known in the art (see for
example Cancer: Principles and Pranctice of Oncology, Volumes 1 and
2, eds Devita, V. T., Hellman, S., and Rosenberg, S. A., J. B.
Lippincott Company, Philadelphia, USA; incorporated herein by
reference) and include, without limitations, folates, antifolates,
pyrimidine analogs, fluoropyrimidines, purine analogs, adenosine
analogs, topoisomerase I inhibitors, anthrapyrazoles, retinoids,
antibiotics, anthacyclins, platinum analogs, alkylating agents,
nitrosoureas, plant derived compounds such as vinca alkaloids,
epipodophyllotoxins, tyrosine kinase inhibitors, taxols, radiation
therapy, surgery, nutritional supplements, gene therapy,
radiotherapy, for example 3D-CRT, immunotoxin therapy, for example
ricin, and monoclonal antibodies. Specific examples of
chemotherapeutic compounds that can be combined with or used in
conjuction with the nucleic acid molecules of the invention
include, but are not limited to, Paclitaxel; Docetaxel;
Methotrexate; Doxorubin; Edatrexate; Vinorelbine; Tomaxifen;
Leucovorin; 5-fluoro uridine (5-FU); lonotecan; Cisplatin;
Carboplatin; Amsacrine; Cytarabine; Bleomycin; Mitomycin C;
Dactinomycin; Mithramycin; Hexamethylmelamine; Dacarbazine;
L-asperginase; Nitrogen mustard; Melphalan, Chlorambucil; Busulfan;
Ifosfamide; 4-hydroperoxycyclophosphamide; Thiotepa; Irinotecan
(CAMPTOSAR.RTM., CPT-11, Camptothecin-11, Campto) Tamoxifen;
Herceptin; IMC C225; ABX-EGF; and combinations thereof. The above
list provides non-limiting examples of compounds and/or methods
that can be combined with or used in conjunction with the nucleic
acid molecules (e.g. siNA) of the instant invention. Those skilled
in the art will recognize that other drug compounds and therapies
can be similarly be readily combined with the nucleic acid
molecules of the instant invention (e.g., siNA molecules) are hence
within the scope of the instant invention.
Example 11
Diagnostic Uses
[0416] The siNA molecules of the invention can be used in a variety
of diagnostic applications, such as in the identification of
molecular targets (e.g., RNA) in a variety of applications, for
example, in clinical, industrial, environmental, agricultural
and/or research settings. Such diagnostic use of siNA molecules
involves utilizing reconstituted RNAi systems, for example, using
cellular lysates or partially purified cellular lysates. siNA
molecules of this invention can be used as diagnostic tools to
examine genetic drift and mutations within diseased cells or to
detect the presence of endogenous or exogenous, for example viral,
RNA in a cell. The close relationship between siNA activity and the
structure of the target RNA allows the detection of mutations in
any region of the molecule, which alters the base-pairing and
three-dimensional structure of the target RNA. By using multiple
siNA molecules described in this invention, one can map nucleotide
changes, which are important to RNA structure and function in
vitro, as well as in cells and tissues. Cleavage of target RNAs
with siNA molecules can be used to inhibit gene expression and
define the role of specified gene products in the progression of
disease or infection. In this manner, other genetic targets can be
defined as important mediators of the disease. These experiments
will lead to better treatment of the disease progression by
affording the possibility of combination therapies (e.g., multiple
siNA molecules targeted to different genes, siNA molecules coupled
with known small molecule inhibitors, or intermittent treatment
with combinations siNA molecules and/or other chemical or
biological molecules). Other in vitro uses of siNA molecules of
this invention are well known in the art, and include detection of
the presence of mRNAs associated with a disease, infection, or
related condition. Such RNA is detected by determining the presence
of a cleavage product after treatment with a siNA using standard
methodologies, for example, fluorescence resonance emission
transfer (FRET).
[0417] In a specific example, siNA molecules that cleave only
wild-type or mutant forms of the target RNA are used for the assay.
The first siNA molecules (i.e., those that cleave only wild-type
forms of target RNA) are used to identify wild-type RNA present in
the sample and the second siNA molecules (i.e., those that cleave
only mutant forms of target RNA) are used to identify mutant RNA in
the sample. As reaction controls, synthetic substrates of both
wild-type and mutant RNA are cleaved by both siNA molecules to
demonstrate the relative siNA efficiencies in the reactions and the
absence of cleavage of the "non-targeted" RNA species. The cleavage
products from the synthetic substrates also serve to generate size
markers for the analysis of wild-type and mutant RNAs in the sample
population. Thus, each analysis requires two siNA molecules, two
substrates and one unknown sample, which is combined into six
reactions. The presence of cleavage products is determined using an
RNase protection assay so that full-length and cleavage fragments
of each RNA can be analyzed in one lane of a polyacrylamide gel. It
is not absolutely required to quantify the results to gain insight
into the expression of mutant RNAs and putative risk of the desired
phenotypic changes in target cells. The expression of mRNA whose
protein product is implicated in the development of the phenotype
(i.e., disease related or infection related) is adequate to
establish risk. If probes of comparable specific activity are used
for both transcripts, then a qualitative comparison of RNA levels
is adequate and decreases the cost of the initial diagnosis. Higher
mutant form to wild-type ratios are correlated with higher risk
whether RNA levels are compared qualitatively or
quantitatively.
[0418] All patents and publications mentioned in the specification
are indicative of the levels of skill of those skilled in the art
to which the invention pertains. All references cited in this
disclosure are incorporated by reference to the same extent as if
each reference had been incorporated by reference in its entirety
individually.
[0419] One skilled in the art would readily appreciate that the
present invention is well adapted to carry out the objects and
obtain the ends and advantages mentioned, as well as those inherent
therein. The methods and compositions described herein as presently
representative of preferred embodiments are exemplary and are not
intended as limitations on the scope of the invention. Changes
therein and other uses will occur to those skilled in the art,
which are encompassed within the spirit of the invention, are
defined by the scope of the claims.
[0420] It will be readily apparent to one skilled in the art that
varying substitutions and modifications can be made to the
invention disclosed herein without departing from the scope and
spirit of the invention. Thus, such additional embodiments are
within the scope of the present invention and the following claims.
The present invention teaches one skilled in the art to test
various combinations and/or substitutions of chemical modifications
described herein toward generating nucleic acid constructs with
improved activity for mediating RNAi activity. Such improved
activity can comprise improved stability, improved bioavailability,
and/or improved activation of cellular responses mediating RNAi.
Therefore, the specific embodiments described herein are not
limiting and one skilled in the art can readily appreciate that
specific combinations of the modifications described herein can be
tested without undue experimentation toward identifying siNA
molecules with improved RNAi activity.
[0421] The invention illustratively described herein suitably can
be practiced in the absence of any element or elements, limitation
or limitations that are not specifically disclosed herein. The
terms and expressions which have been employed are used as terms of
description and not of limitation, and there is no intention that
in the use of such terms and expressions of excluding any
equivalents of the features shown and described or portions
thereof, but it is recognized that various modifications are
possible within the scope of the invention claimed. Thus, it should
be understood that although the present invention has been
specifically disclosed by preferred embodiments, optional features,
modification and variation of the concepts herein disclosed may be
resorted to by those skilled in the art, and that such
modifications and variations are considered to be within the scope
of this invention as defined by the description and the appended
claims.
[0422] In addition, where features or aspects of the invention are
described in terms of Markush groups or other grouping of
alternatives, those skilled in the art will recognize that the
invention is also thereby described in terms of any individual
member or subgroup of members of the Markush group or other
group.
TABLE-US-00001 TABLE I TNF Accession Numbers Accession TNF
Superfamily NM_000595 Homo sapiens lymphotoxin alpha (TNF
superfamily, member 1) (LTA), mRNA. NM_000594 Homo sapiens tumor
necrosis factor (TNF superfamily, member 2) (TNF), mRNA NM_002341
Homo sapiens lymphotoxin beta (TNF superfamily, member 3) (LTB),
transcript variant 1, mRNA. NM_009588 Homo sapiens lymphotoxin beta
(TNF superfamily, member 3) (LTB), transcript variant 2, mRNA.
NM_003326 Homo sapiens tumor necrosis factor (ligand) superfamily,
member 4 (tax-transcriptionally activated glycoprotein 1, 34 kD)
(TNFS4) mRNA. NM_000074 Homo sapiens tumor necrosis factor (ligand)
superfamily, member 5 (hyper-IgM syndrome) (TNFSF5), mRNA NM_000639
Homo sapiens tumor necrosis factor (ligand) superfamily, member 6
(TNFSF6), mRNA. NM_001252 Homo sapiens tumor necrosis factor
(ligand) superfamily, member 7 (TNFSF7), mRNA. NM_001244 Homo
sapiens tumor necrosis factor (ligand) superfamily, member 8
(TNFSF8), mRNA NM_003811 Homo sapiens tumor necrosis factor
(ligand) superfamily, member 9 (TNFSF9), mRNA. NM_003810 Homo
sapiens tumor necrosis factor (ligand) superfamily, member 10
(TNFSF10), mRNA NM_003701 Homo sapiens tumor necrosis factor
(ligand) superfamily, member 11 (TNFSF11), transcript variant 1,
mRNA NM_033012 Homo sapiens tumor necrosis factor (ligand)
superfamily, member 11 (TNFSF11), transcript variant 2, mRNA
NM_003809 Homo sapiens tumor necrosis factor (ligand) superfamily,
member 12 (TNFSF12), mRNA. NM_003808 Homo sapiens tumor necrosis
factor (ligand) superfamily, member 13 (TNFSF13), mRNA NM_006573
Homo sapiens tumor necrosis factor (ligand) superfamily, member 13b
(TNFSF13B), mRNA NM_003807 Homo sapiens tumor necrosis factor
(ligand) superfamily, member 14 (TNFSF14), mRNA NM_005118 Homo
sapiens tumor necrosis factor (ligand) superfamily, member 15
(TNFSF15), mRNA NM_005092 Homo sapiens tumor necrosis factor
(ligand) superfamily, member 18 (TNFSF18), mRNA. TNF Receptor
Superfamily NM_001065 Homo sapiens tumor necrosis factor receptor
superfamily, member 1A (TNFRSF1A), mRNA NM_001066 Homo sapiens
tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B),
mRNA NM_002342 Homo sapiens lymphotoxin beta receptor (TNFR
superfamily, member 3) (LTBR), mRNA. NM_003327 Homo sapiens tumor
necrosis factor receptor superfamily, member 4 (TNFRSF4), mRNA.
NM_001250 Homo sapiens tumor necrosis factor receptor superfamily,
member 5 (TNFRSF5), mRNA. NM_000043 Homo sapiens tumor necrosis
factor receptor superfamily, member 6 (TNFRSF6), mRNA. NM_032957
Homo sapiens tumor necrosis factor receptor superfamily, member 6b,
decoy (TNFRSF6B), transcript variant 1, mRNA. NM_016434 Homo
sapiens tumor necrosis factor receptor superfamily, member 6b,
decoy (TNFRSF6B), transcript variant 2, mRNA. NM_015647 Homo
sapiens tumor necrosis factor receptor superfamily, member 6b,
decoy (TNFRSF6B), transcript variant 3, mRNA. NM_032945 Homo
sapiens tumor necrosis factor receptor superfamily, member 6b,
decoy (TNFRSF6B), transcript variant M68C, mRNA. NM_003823 Homo
sapiens tumor necrosis factor receptor superfamily, member 6b,
decoy (TNFRSF6B), transcript variant M68E, mRNA. NM_001242 Homo
sapiens tumor necrosis factor receptor superfamily, member 7
(TNFRSF7), mRNA. NM_001243 Homo sapiens tumor necrosis factor
receptor superfamily, member 8 (TNFRSF8), mRNA. NM_001561 Homo
sapiens tumor necrosis factor receptor superfamily, member 9
(TNFRSF9), mRNA. NM_003844 Homo sapiens tumor necrosis factor
receptor superfamily, member 10a (TNFRSF10A), mRNA. NM_003842 Homo
sapiens tumor necrosis factor receptor superfamily, member 10b
(TNFRSF10B), mRNA NM_003839 Homo sapiens tumor necrosis factor
receptor superfamily, member 11a, activator of NFKB (TNFRSF11A),
mRNA NM_002546 Homo sapiens tumor necrosis factor receptor
superfamily, member 11b (osteoprotegerin) (TNFRSF11B), mRNA.
NM_003790 Homo sapiens tumor necrosis factor receptor superfamily,
member 12 (translocating chain-association membrane protein)
(TNFRSF12), mRNA NM_012452 Homo sapiens tumor necrosis factor
receptor superfamily, member 13B (TNFRSF13B), mRNA NM_052945 Homo
sapiens tumor necrosis factor receptor superfamily, member 13C
(TNFRSF13C), mRNA NM_003820 Homo sapiens tumor necrosis factor
receptor superfamily, member 14 (herpesvirus entry mediator)
(TNFRSF14), mRNA NM_001192 Homo sapiens tumor necrosis factor
receptor superfamily, member 17 (TNFRSF17), mRNA. NM_004195 Homo
sapiens tumor necrosis factor receptor superfamily, member 18
(TNFRSF18), mRNA. NM_018647 Homo sapiens tumor necrosis factor
receptor superfamily, member 19 (TNFRSF19), mRNA. NM_032871 Homo
sapiens tumor necrosis factor receptor superfamily, member 19-like
(TNFRSF19L), mRNA. NM_014452 Homo sapiens tumor necrosis factor
receptor superfamily, member 21 (TNFRSF21), mRNA.
TABLE-US-00002 TABLE II TNF Receptor siNA AND TARGET SEQUENCES TNFR
NM_001065 Pos Target Sequence Seq ID UPos Upper seq Seq ID LPos
Lower seq Seq ID 3 UGUUGCAACACUGCCUCAC 1 3 UGUUGCAACACUGCCUCAC 1 21
GUGAGGCAGUGUUGCAACA 124 21 CUCUUCCCCUCCCACCUUC 2 21
CUCUUCCCCUCCCACCUUC 2 39 GAAGGUGGGAGGGGAAGAG 125 39
CUCUCCCCUCCUCUCUGCU 3 39 CUCUCCCCUCCUCUCUGCU 3 57
AGCAGAGAGGAGGGGAGAG 126 57 UUUAAUUUUCUCAGAAUUC 4 57
UUUAAUUUUCUCAGAAUUC 4 75 GAAUUCUGAGAAAAUUAAA 127 75
CUCUGGACUGAGGOUCCAG 5 75 CUCUGGACUGAGGCUCCAG 5 93
CUGGAGCCUCAGUCCAGAG 128 93 GUUCUGGCCUUUGGGGUUC 6 93
GUUCUGGCCUUUGGGGUUC 6 111 GAACCCCAAAGGCCAGAAC 129 111
CAAGAUCACUGGGACCAGG 7 111 CAAGAUCACUGGGACCAGG 7 129
CCUGGUCCCAGUGAUCUUG 130 129 GCCGUGAUCUCUAUGCCCG 8 129
GCCGUGAUCUCUAUGCCCG 8 147 CGGGCAUAGAGAUCACGGC 131 147
GAGUCUCAACCCUCAACUG 9 147 GAGUCUCAACCCUCAACUG 9 165
CAGUUGAGGGUUGAGACUC 132 165 GUCACCCCAAGGCACUUGG 10 165
GUCACCCCAAGGCACUUGG 10 183 CCAAGUGCCUUGGGGUGAC 133 183
GGACGUCCUGGACAGACCG 11 183 GGACGUCCUGGACAGACCG 11 201
CGGUCUGUCCAGGACGUCC 134 201 GAGUCCCGGGAAGCCCCAG 12 201
GAGUCCCGGGAAGCCCCAG 12 219 CUGGGGCUUCCCGGGACUC 135 219
GCACUGCCGCUGCCACACU 13 219 GCACUGCCGCUGCCACACU 13 237
AGUGUGGCAGCGGCAGUGC 136 237 UGCCCUGAGCCCAAAUGGG 14 237
UGCCCUGAGCCCAAAUGGG 14 255 CCCAUUUGGGCUCAGGGCA 137 255
GGGAGUGAGAGGCCAUAGC 15 255 GGGAGUGAGAGGCCAUAGC 15 273
GCUAUGGCCUCUCACUCCC 138 273 CUGUCUGGCAUGGGCCUCU 16 273
CUGUCUGGCAUGGGCCUCU 16 291 AGAGGCCCAUGCCAGACAG 139 291
UCCACCGUGCCUGACCUGC 17 291 UCCACCGUGCCUGACCUGC 17 309
GCAGGUCAGGCACGGUGGA 140 309 CUGCUGCCACUGGUGCUCC 18 309
CUGCUGCCACUGGUGCUCC 18 327 GGAGCACCAGUGGCAGCAG 141 327
CUGGAGCUGUUGGUGGGAA 19 327 CUGGAGCUGUUGGUGGGAA 19 345
UUCCCACCAACAGCUCCAG 142 345 AUAUACCCCUCAGGGGUUA 20 345
AUAUACCCCUCAGGGGUUA 20 363 UAACCCCUGAGGGGUAUAU 143 363
AUUGGACUGGUCCCUCACC 21 363 AUUGGACUGGUCCCUCACC 21 381
GGUGAGGGACCAGUCCAAU 144 381 CUAGGGGACAGGGAGAAGA 22 381
CUAGGGGACAGGGAGAAGA 22 399 UCUUCUCCCUGUCCCCUAG 145 399
AGAGAUAGUGUGUGUCCCC 23 399 AGAGAUAGUGUGUGUCCCC 23 417
GGGGACACACACUAUCUCU 146 417 CAAGGAAAAUAUAUCCACC 24 417
CAAGGAAAAUAUAUCCACC 24 435 GGUGGAUAUAUUUUCCUUG 147 435
CCUCAAAAUAAUUCGAUUU 25 435 CCUCAAAAUAAUUCGAUUU 25 453
AAAUCGAAUUAUUUUGAGG 148 453 UGCUGUACCAAGUGCCACA 26 453
UGCUGUACCAAGUGCCACA 26 471 UGUGGCACUUGGUACAGCA 149 471
AAAGGAACCUACUUGUACA 27 471 AAAGGAACCUACUUGUACA 27 489
UGUACAAGUAGGUUCCUUU 150 489 AAUGACUGUCCAGGCCCGG 28 489
AAUGACUGUCCAGGCCCGG 28 507 CCGGGCCUGGACAGUCAUU 151 507
GGGCAGGAUACGGACUGCA 29 507 GGGCAGGAUACGGACUGCA 29 525
UGCAGUCCGUAUCCUGCCC 152 525 AGGGAGUGUGAGAGCGGCU 30 525
AGGGAGUGUGAGAGCGGCU 30 543 AGCCGCUCUCACACUCCCU 153 543
UCCUUCACCGCUUCAGAAA 31 543 UCCUUCACCGCUUCAGAAA 31 561
UUUCUGAAGCGGUGAAGGA 154 561 AACCACCUCAGACACUGCC 32 561
AACCACCUCAGACACUGCC 32 579 GGCAGUGUCUGAGGUGGUU 155 579
CUCAGCUGCUCCAAAUGCC 33 579 CUCAGCUGCUCCAAAUGCC 33 597
GGCAUUUGGAGCAGCUGAG 156 597 CGAAAGGAAAUGGGUCAGG 34 597
CGAAAGGAAAUGGGUCAGG 34 615 CCUGACCCAUUUCCUUUCG 157 615
GUGGAGAUCUCUUCUUGCA 35 615 GUGGAGAUCUCUUCUUGCA 35 633
UGCAAGAAGAGAUCUCCAC 158 633 ACAGUGGACCGGGACACCG 36 633
ACAGUGGACCGGGACACCG 36 651 CGGUGUCCCGGUCCACUGU 159 651
GUGUGUGGCUGCAGGAAGA 37 651 GUGUGUGGCUGCAGGAAGA 37 669
UCUUCCUGCAGCCACACAC 160 669 AACCAGUACCGGCAUUAUU 38 669
AACCAGUACCGGCAUUAUU 38 687 AAUAAUGCCGGUACUGGUU 161 687
UGGAGUGAAAACCUUUUCC 39 687 UGGAGUGAAAACCUUUUCC 39 705
GGAAAAGGUUUUCACUCCA 162 705 CAGUGCUUCAAUUGCAGCC 40 705
CAGUGCUUCAAUUGCAGCC 40 723 GGCUGCAAUUGAAGCACUG 163 723
CUCUGCCUCAAUGGGACCG 41 723 CUCUGCCUCAAUGGGACCG 41 741
CGGUCCCAUUGAGGCAGAG 164 741 GUGCACCUCUCCUGCCAGG 42 741
GUGCACCUCUCCUGCCAGG 42 759 CCUGGOAGGAGAGGUGOAC 165 759
GAGAAACAGAACACCGUGU 43 759 GAGAAACAGAACACCGUGU 43 777
ACACGGUGUUCUGUUUCUC 166 777 UGCACCUGCCAUGCAGGUU 44 777
UGCACCUGCCAUGCAGGUU 44 795 AACCUGCAUGGCAGGUGCA 167 795
UUCUUUCUAAGAGAAAACG 45 795 UUCUUUCUAAGAGAAAACG 45 813
CGUUUUCUCUUAGAAAGAA 168 813 GAGUGUGUCUCCUGUAGUA 46 813
GAGUGUGUCUCCUGUAGUA 46 831 UACUACAGGAGACACACUC 169 831
AACUGUAAGAAAAGCCUGG 47 831 AACUGUAAGAAAAGCCUGG 47 849
CCAGGCUUUUCUUACAGUU 170 849 GAGUGCACGAAGUUGUGCC 48 849
GAGUGCACGAAGUUGUGCC 48 867 GGCACAACUUCGUGCACUC 171 867
CUACCCCAGAUUGAGAAUG 49 867 CUACCCCAGAUUGAGAAUG 49 885
CAUUCUCAAUCUGGGGUAG 172 885 GUUAAGGGCACUGAGGACU 50 885
GUUAAGGGCACUGAGGACU 50 903 AGUCCUCAGUGCCCUUAAC 173 903
UCAGGCACCACAGUGCUGU 51 903 UCAGGCACCACAGUGCUGU 51 921
ACAGCACUGUGGUGCCUGA 174 921 UUGCCCCUGGUCAUUUUCU 52 921
UUGCCCCUGGUCAUUUUCU 52 939 AGAAAAUGACCAGGGGCAA 175 939
UUUGGUCUUUGCCUUUUAU 53 939 UUUGGUCUUUGCCUUUUAU 53 957
AUAAAAGGCAAAGACCAAA 176 957 UCCCUCCUCUUCAUUGGUU 54 957
UCCCUCCUCUUCAUUGGUU 54 975 AACCAAUGAAGAGGAGGGA 177 975
UUAAUGUAUCGCUACCAAC 55 975 UUAAUGUAUCGCUACCAAC 55 993
GUUGGUAGCGAUACAUUAA 178 993 CGGUGGAAGUCCAAGCUCU 56 993
CGGUGGAAGUCCAAGCUCU 56 1011 AGAGCUUGGACUUCCACCG 179 1011
UACUCCAUUGUUUGUGGGA 57 1011 UACUCCAUUGUUUGUGGGA 57 1029
UCCCACAAACAAUGGAGUA 180 1029 AAAUCGACACCUGAAAAAG 58 1029
AAAUCGACACCUGAAAAAG 58 1047 CUUUUUCAGGUGUCGAUUU 181 1047
GAGGGGGAGCUUGAAGGAA 59 1047 GAGGGGGAGCUUGAAGGAA 59 1065
UUCCUUCAAGCUCCCCCUC 182 1065 ACUACUACUAAGCCCCUGG 60 1065
ACUACUACUAAGCCCCUGG 60 1083 CCAGGGGCUUAGUAGUAGU 183 1083
GCCCCAAACCCAAGCUUCA 61 1083 GCCCCAAACCCAAGCUUCA 61 1101
UGAAGCUUGGGUUUGGGGC 184 1101 AGUCCCACUCCAGGCUUCA 62 1101
AGUCCCACUCCAGGCUUCA 62 1119 UGAAGCCUGGAGUGGGACU 185 1119
ACCCCCACCCUGGGCUUCA 63 1119 ACCCCCACCCUGGGCUUCA 63 1137
UGAAGCCCAGGGUGGGGGU 186 1137 AGUCCCGUGCCCAGUUCCA 64 1137
AGUCCCGUGCCCAGUUCCA 64 1155 UGGAACUGGGCACGGGACU 187 1155
ACCUUCACCUCCAGCUCCA 65 1155 ACCUUCACCUCCAGCUCCA 65 1173
UGGAGCUGGAGGUGAAGGU 188 1173 ACCUAUACCCCCGGUGACU 66 1173
ACCUAUACCCCCGGUGACU 66 1191 AGUCACCGGGGGUAUAGGU 189 1191
UGUCCCAACUUUGCGGCUC 67 1191 UGUCCCAACUUUGCGGCUC 67 1209
GAGCCGCAAAGUUGGGACA 190 1209 CCCCGCAGAGAGGUGGCAC 68 1209
CCCCGCAGAGAGGUGGCAC 68 1227 GUGCCACCUCUCUGCGGGG 191 1227
CCACCCUAUCAGGGGGCUG 69 1227 CCACCCUAUCAGGGGGCUG 69 1245
CAGCCCCCUGAUAGGGUGG 192 1245 GACCCCAUCCUUGCGACAG 70 1245
GACCCCAUCCUUGCGACAG 70 1263 CUGUCGCAAGGAUGGGGUC 193 1263
GCCCUCGCCUCCGACCCCA 71 1263 GCCCUCGCCUCCGACCCCA 71 1281
UGGGGUCGGAGGCGAGGGC 194 1281 AUCCCCAACCCCCUUCAGA 72 1281
AUCCCCAACCCCCUUCAGA 72 1299 UCUGAAGGGGGUUGGGGAU 195 1299
AAGUGGGAGGACAGCGCCC 73 1299 AAGUGGGAGGACAGCGCCC 73 1317
GGGCGCUGUCCUCCCACUU 196 1317 CACAAGCCACAGAGCCUAG 74 1317
CACAAGCCACAGAGCCUAG 74 1335 CUAGGCUCUGUGGCUUGUG 197 1335
GACACUGAUGACCCCGCGA 75 1335 GACACUGAUGACCCCGCGA 75 1353
UCGCGGGGUCAUCAGUGUC 198 1353 ACGCUGUACGCCGUGGUGG 76 1353
ACGCUGUACGCCGUGGUGG 76 1371 CCACCACGGCGUACAGCGU 199 1371
GAGAACGUGCCCCCGUUGC 77 1371 GAGAACGUGCCCCCGUUGC 77 1389
GCAACGGGGGCACGUUCUC 200 1389 CGCUGGAAGGAAUUCGUGC 78 1389
CGCUGGAAGGAAUUCGUGC 78 1407 GCACGAAUUCCUUCCAGCG 201 1407
CGGCGCCUAGGGCUGAGCG 79 1407 CGGCGCCUAGGGCUGAGCG 79 1425
CGCUCAGCCCUAGGCGCCG 202 1425 GACCACGAGAUCGAUCGGC 80 1425
GACCACGAGAUCGAUCGGC 80 1443 GCCGAUCGAUCUCGUGGUC 203 1443
CUGGAGCUGCAGAACGGGC 81 1443 CUGGAGCUGCAGAACGGGC 81 1461
GCCCGUUCUGCAGCUCCAG 204 1461 CGCUGCCUGCGCGAGGCGC 82 1461
CGCUGCCUGCGCGAGGCGC 82 1479
GCGCCUCGCGCAGGCAGCG 205 1479 CAAUACAGCAUGCUGGCGA 83 1479
CAAUACAGCAUGCUGGCGA 83 1497 UCGCCAGCAUGCUGUAUUG 206 1497
ACCUGGAGGCGGCGCACGC 84 1497 ACCUGGAGGCGGCGCACGC 84 1515
GCGUGCGCCGCCUCCAGGU 207 1515 CCGCGGCGCGAGGCCACGC 85 1515
CCGCGGCGCGAGGCCACGC 85 1533 GCGUGGCCUCGCGCCGCGG 208 1533
CUGGAGCUGCUGGGACGCG 86 1533 CUGGAGCUGCUGGGACGCG 86 1551
CGCGUCCCAGCAGCUCCAG 209 1551 GUGCUCCGCGACAUGGACC 87 1551
GUGCUCCGCGACAUGGACC 87 1569 GGUCCAUGUCGCGGAGCAC 210 1569
CUGCUGGGCUGCCUGGAGG 88 1569 CUGCUGGGCUGCCUGGAGG 88 1587
CCUCCAGGCAGCCCAGCAG 211 1587 GACAUCGAGGAGGCGCUUU 89 1587
GACAUCGAGGAGGCGCUUU 89 1605 AAAGCGCCUCCUCGAUGUC 212 1605
UGCGGCCCCGCCGCCCUCC 90 1605 UGCGGCCCCGCCGCCCUCC 90 1623
GGAGGGCGGCGGGGCCGCA 213 1623 CCGCCCGCGCCCAGUCUUC 91 1623
CCGCCCGCGCCCAGUCUUC 91 1641 GAAGACUGGGCGCGGGCGG 214 1641
CUCAGAUGAGGCUGCGCCC 92 1641 CUCAGAUGAGGCUGCGCCC 92 1659
GGGCGCAGCCUCAUCUGAG 215 1659 CCUGCGGGCAGCUCUAAGG 93 1659
CCUGCGGGCAGCUCUAAGG 93 1677 CCUUAGAGCUGCCCGCAGG 216 1677
GACCGUCCUGCGAGAUCGC 94 1677 GACCGUCCUGCGAGAUCGC 94 1695
GCGAUCUCGCAGGACGGUC 217 1695 CCUUCCAACCCCACUUUUU 95 1695
CCUUCCAACCCCACUUUUU 95 1713 AAAAAGUGGGGUUGGAAGG 218 1713
UUCUGGAAAGGAGGGGUCC 96 1713 UUCUGGAAAGGAGGGGUCC 96 1731
GGACCCCUCCUUUCCAGAA 219 1731 CUGCAGGGGCAAGCAGGAG 97 1731
CUGCAGGGGCAAGCAGGAG 97 1749 CUCCUGCUUGCCCCUGCAG 220 1749
GCUAGCAGCCGCCUACUUG 98 1749 GCUAGCAGCCGCCUACUUG 98 1767
CAAGUAGGCGGCUGCUAGC 221 1767 GGUGCUAACCCCUCGAUGU 99 1767
GGUGCUAACCCCUCGAUGU 99 1785 ACAUCGAGGGGUUAGCACC 222 1785
UACAUAGCUUUUCUCAGCU 100 1785 UACAUAGCUUUUCUCAGCU 100 1803
AGCUGAGAAAAGCUAUGUA 223 1803 UGCCUGCGCGCCGCCGACA 101 1803
UGCCUGCGCGCCGCCGACA 101 1821 UGUCGGCGGCGCGCAGGCA 224 1821
AGUCAGCGCUGUGCGCGCG 102 1821 AGUCAGCGCUGUGCGCGCG 102 1839
CGCGCGCACAGCGCUGACU 225 1839 GGAGAGAGGUGCGCCGUGG 103 1839
GGAGAGAGGUGCGCCGUGG 103 1857 CCACGGCGCACCUCUCUCC 226 1857
GGCUCAAGAGCCUGAGUGG 104 1857 GGCUCAAGAGCCUGAGUGG 104 1875
CCACUCAGGCUCUUGAGCC 227 1875 GGUGGUUUGCGAGGAUGAG 105 1875
GGUGGUUUGCGAGGAUGAG 105 1893 CUCAUCCUCGCAAACCACC 228 1893
GGGACGCUAUGCCUCAUGC 106 1893 GGGACGCUAUGCCUCAUGC 106 1911
GCAUGAGGCAUAGCGUCCC 229 1911 CCCGUUUUGGGUGUCCUCA 107 1911
CCCGUUUUGGGUGUCCUCA 107 1929 UGAGGACACCCAAAACGGG 230 1929
ACCAGCAAGGCUGCUCGGG 108 1929 ACCAGCAAGGCUGCUCGGG 108 1947
CCCGAGCAGCCUUGCUGGU 231 1947 GGGCCCCUGGUUCGUCCCU 109 1947
GGGCCCCUGGUUCGUCCCU 109 1965 AGGGACGAACCAGGGGCCC 232 1965
UGAGCCUUUUUCACAGUGC 110 1965 UGAGCCUUUUUCACAGUGC 110 1983
GCACUGUGAAAAAGGCUCA 233 1983 CAUAAGCAGUUUUUUUUGU 111 1983
CAUAAGCAGUUUUUUUUGU 111 2001 ACAAAAAAAACUGCUUAUG 234 2001
UUUUUGUUUUGUUUUGUUU 112 2001 UUUUUGUUUUGUUUUGUUU 112 2019
AAACAAAACAAAACAAAAA 235 2019 UUGUUUUUAAAUCAAUCAU 113 2019
UUGUUUUUAAAUCAAUCAU 113 2037 AUGAUUGAUUUAAAAACAA 236 2037
UGUUACACUAAUAGAAACU 114 2037 UGUUACACUAAUAGAAACU 114 2055
AGUUUCUAUUAGUGUAACA 237 2055 UUGGCACUCCUGUGCCCUC 115 2055
UUGGCACUCCUGUGCCCUC 115 2073 GAGGGCACAGGAGUGCCAA 238 2073
CUGCCUGGACAAGCACAUA 116 2073 CUGCCUGGACAAGCACAUA 116 2091
UAUGUGCUUGUCCAGGCAG 239 2091 AGCAAGCUGAACUGUCCUA 117 2091
AGCAAGCUGAACUGUCCUA 117 2109 UAGGACAGUUCAGCUUGCU 240 2109
AAGGCAGGGGCGAGCACGG 118 2109 AAGGCAGGGGCGAGCACGG 118 2127
CCGUGCUCGCCCCUGCCUU 241 2127 GAACAAUGGGGCCUUCAGC 119 2127
GAACAAUGGGGCCUUCAGC 119 2145 GCUGAAGGCCCCAUUGUUC 242 2145
CUGGAGCUGUGGACUUUUG 120 2145 CUGGAGCUGUGGACUUUUG 120 2163
CAAAAGUCCACAGCUCCAG 243 2163 GUACAUACACUAAAAUUCU 121 2163
GUACAUACACUAAAAUUCU 121 2181 AGAAUUUUAGUGUAUGUAC 244 2181
UGAAGUUAAAGCUCUGCUC 122 2181 UGAAGUUAAAGCUCUGCUC 122 2199
GAGCAGAGCUUUAACUUCA 245 2199 CUUGGAAAAAAAAAAAAAA 123 2199
CUUGGAAAAAAAAAAAAAA 123 2217 UUUUUUUUUUUUUUCCAAG 246 The 3'-ends of
the Upper sequence and the Lower sequence of the siNA construct can
include an overhang sequence, for example about 1, 2, 3, or 4
nucleotides in length, preferably 2 nucleotides in length, wherein
the overhanging sequence of the lower sequence is optionally
complementary to a portion of the target sequence. The upper
sequence is also referred to as the sense strand, whereas the lower
sequence is also referred to as the antisense strand. The upper and
lower sequences in the Table can further comprise a chemical
modification having Formulae I-VII, such as exemplary siNA
constructs shown in FIGS. 4 and 5, or having modifications
described in Table IV or any combination thereof.
TABLE-US-00003 TABLE III TNF Receptor Synthetic Modified siNA
Constructs Target Seq Seq Pos Target ID Cmpd# Aliases Sequence ID
72 AUUCUCUGGACUGAGGCUCCAGU 247 TNFR:74U21 sense siNA
UCUCUGGACUGAGGCUCCATT 255 257 GAGUGAGAGGCCAUAGCUGUCUG 248
TNFR:259U21 sense siNA GUGAGAGGCCAUAGCUGUCTT 256 552
GCUUCAGAAAACCACCUCAGACA 249 TNFR:554U21 sense siNA
UUCAGAAAACCACCUCAGATT 257 606 AUGGGUCAGGUGGAGAUCUCUUC 250
TNFR:608U21 sense siNA GGGUCAGGUGGAGAUCUCUTT 258 663
AGGAAGAACCAGUACCGGCAUUA 251 TNFR:665U21 sense siNA
GAAGAACCAGUACCGGCAUTT 259 699 CUUUUCCAGUGCUUCAAUUGCAG 252
TNFR:701U21 sense siNA UUUCCAGUGCUUCAAUUGCTT 260 834
UGUAAGAAAAGCCUGGAGUGCAC 253 TNFR:836U21 sense siNA
UAAGAAAAGCCUGGAGUGCTT 261 2093 CAAGCUGAACUGUCCUAAGGCAG 254
TNFR:2095U21 sense siNA AGCUGAACUGUCCUAAGGCTT 262 72
AUUCUCUGGACUGAGGCUCCAGU 247 TNFR:92L21 antisense siNA (74C)
UGGAGCCUCAGUCCAGAGATT 263 257 GAGUGAGAGGCCAUAGCUGUCUG 248
TNFR:277L21 antisense siNA GACAGCUAUGGCCUCUCACTT 264 (259C) 552
GCUUCAGAAAACCACCUCAGACA 249 TNFR:572L21 antisense siNA
UCUGAGGUGGUUUUCUGAATT 265 (554C) 606 AUGGGUCAGGUGGAGAUCUCUUC 250
TNFR:626L21 antisense siNA AGAGAUCUCCACCUGACCCTT 266 (608C) 663
AGGAAGAACCAGUACCGGCAUUA 251 TNFR:683L21 antisense siNA
AUGCCGGUACUGGUUCUUCTT 267 (665C) 699 CUUUUCCAGUGCUUCAAUUGCAG 252
TNFR:719L21 antisense siNA GCAAUUGAAGCACUGGAAATT 268 (701C) 834
UGUAAGAAAAGCCUGGAGUGCAC 253 TNFR:854L21 antisense siNA
GCACUCCAGGCUUUUCUUATT 269 (835C) 2093 CAAGCUGAACUGUCCUAAGGCAG 254
TNFR:2113L21 antisense siNA GCCUUAGGACAGUUCAGCUTT 270 (2095C) 72
AUUCUCUGGACUGAGGCUCCAGU 247 TNFR:74U21 sense siNA stab04 B
ucucuGGAcuGAGGcuccATT B 271 257 GAGUGAGAGGCCAUAGCUGUCUG 248
TNFR:259U21 sense siNA stab04 B GuGAGAGGccAuAGcuGucTT B 272 552
GCUUCAGAAAACCACCUCAGACA 249 TNFR:554U21 sense siNA stab04 B
uucAGAAAAccAccucAGATT B 273 606 AUGGGUCAGGUGGAGAUCUCUUC 250
TNFR:608U21 sense siNA stab04 B GGGucAGGuGGAGAucucuTT B 274 663
AGGAAGAACCAGUACCGGCAUUA 251 TNFR:665U21 sense siNA stab04 B
GAAGAAccAGuAccGGcAuTT B 275 699 CUUUUCCAGUGCUUCAAUUGCAG 252
TNFR:701U21 sense siNA stab04 B uuuccAGuGcuucAAuuGcTT B 276 834
UGUAAGAAAAG00UGGAGUGCAC 253 TNFR:836U21 sense siNA stab04 B
uAAGAAAAGccuGGAGuGcTT B 277 2093 CAAGCUGAACUGUCCUAAGGCAG 254
TNFR:2095U21 sense siNA stab04 B AGcuGAAcuGuccuAAGGcTT B 278 72
AUUCUCUGGACUGAGGCUCCAGU 247 TNFR:92L21 antisense siNA (74C)
uGGAGccucAGuccAGAGATsT 279 stab05 257 GAGUGAGAGGCCAUAGCUGUCUG 248
TNFR:277L21 antisense siNA GAcAGcuAuGGccucucAcTsT 280 (259C) stab05
552 GCUUCAGAAAACCACCUCAGACA 249 TNFR:572L21 antisense siNA
ucuGAGGuGGuuuucuGAATsT 281 (554C) stab05 606
AUGGGUCAGGUGGAGAUCUCUUC 250 TNFR:626L21 antisense siNA
AGAGAucuccAccuGAcccTsT 282 (608C) stab05 663
AGGAAGAACCAGUACCGGCAUUA 251 TNFR:683L21 antisense siNA
AuGccGGuAcuGGuucuucTsT 283 (665C) stab05 699
CUUUUCCAGUGCUUCAAUUGCAG 252 TNFR:719L21 antisense siNA
GcAAuuGAAGcAcuGGAAATsT 284 (701C) stab05 834
UGUAAGAAAAGCCUGGAGUGCAC 253 TNFR:854L21 antisense siNA
GcAcuccAGGcuuuucuuATsT 285 (836C) stab05 2093
CAAGCUGAACUGUCCUAAGGCAG 254 TNFR:2113L21 antisense siNA
GccuuAGGAcAGuucAGcuTsT 286 (2095C) stab05 72
AUUCUCUGGACUGAGGCUCCAGU 247 TNFR:74U21 sense siNA stab07 B
ucucuGGAcuGAGGcuccATT B 287 257 GAGUGAGAGGCCAUAGCUGUCUG 248
TNFR:259U21 sense siNA stab07 B GuGAGAGGccAuAGcuGucTT B 288 552
GCUUCAGAAAACCACCUCAGACA 249 TNFR:554U21 sense siNA stab07 B
uucAGAAAAccAccucAGATT B 289 606 AUGGGUCAGGUGGAGAUCUCUUC 250
TNFR:608U21 sense siNA stab07 B GGGucAGGuGGAGAucucuTT B 290 663
AGGAAGAACCAGUACCGGCAUUA 251 TNFR:665U21 sense siNA stab07 B
GAAGAAccAGuAccGGcAuTT B 291 699 CUUUUCCAGUGCUUCAAUUGCAG 252
TNFR:701U21 sense siNA stab07 B uuuccAGuGcuucAAuuGcTT B 292 834
UGUAAGAAAAGCCUGGAGUGCAC 253 TNFR:836U21 sense siNA stab07 B
uAAGAAAAGccuGGAGuGcTT B 293 2093 CAAGCUGAACUGUCCUAAGGCAG 254
TNFR:2095U21 sense siNA stab07 B AGcuGAAcuGuccuAAGGcTT B 294 72
AUUCUCUGGACUGAGGCUCCAGU 247 TNFR:92L21 antisense siNA (74C)
uGGAGccucAGuccAGAGATsT 295 stab11 257 GAGUGAGAGGCCAUAGCUGUCUG 248
TNFR:277L21 antisense siNA GAcAGcuAuGGccucucAcTsT 296 (259C) stab11
552 GCUUCAGAAAACCACCUCAGACA 249 TNFR:572L21 antisense siNA
ucuGAGGuGGuuuucuGAATsT 297 (554C) stab11 606
AUGGGUCAGGUGGAGAUCUCUUC 250 TNFR:626L21 antisense siNA
AGAGAucuccAccuGAcccTsT 298 (608C) stab11 663
AGGAAGAACCAGUACCGGCAUUA 251 TNFR:683L21 antisense siNA
AuGccGGuAcuGGuucuucTsT 299 (665C) stab11 699
CUUUUCCAGUGCUUCAAUUGCAG 252 TNFR:719L21 antisense siNA
GcAAuuGAAGcAcuGGAAATsT 300 (701C) stab11 834
UGUAAGAAAAGCCUGGAGUGCAC 253 TNFR:854L21 antisense siNA
GcAcuccAGGcuuuucuuATsT 301 (836C) stab11 2093
CAAGCUGAACUGUCCUAAGGCAG 254 TNFR:2113L21 antisense siNA
GccuuAGGAcAGuucAGcuTsT 302 (2095C) stab11 72
AUUCUCUGGACUGAGGCUCCAGU 247 TNFR:74U21 sense siNA stab18 B
ucucuGGAcuGAGGcuccATT B 303 257 GAGUGAGAGGCCAUAGCUGUCUG 248
TNFR:259U21 sense siNA stab18 B GuGAGAGGccAuAGcuGucTT B 304 552
GCUUCAGAAAACCACCUCAGACA 249 TNFR:554U21 sense siNA stab18 B
uucAGAAAAccAccucAGATT B 305 606 AUGGGUCAGGUGGAGAUCUCUUC 250
TNFR:608U21 sense siNA stab18 B GGGucAGGuGGAGAucucuTT B 306 663
AGGAAGAACCAGUACCGGCAUUA 251 TNFR:665U21 sense siNA stab18 B
GAAGAAccAGuAccGGcAuTT B 307 699 CUUUUCCAGUGCUUCAAUUGCAG 252
TNFR:701U21 sense siNA stab18 B uuuccAGuGcuucAAuuGcTT B 308 834
UGUAAGAAAAGCCUGGAGUGCAC 253 TNFR:836U21 sense siNA stab18 B
uAAGAAAAGccuGGAGuGcTT B 309 2093 CAAGCUGAACUGUCCUAAGGCAG 254
TNFR:2095U21 sense siNA stab18 B AGcuGAAcuGuccuAAGGcTT B 310 72
AUUCUCUGGACUGAGGCUCCAGU 247 TNFR:92L21 antisense siNA (74C)
uGGAGccucAGuccAGAGATsT 311 stab08 257 GAGUGAGAGGCCAUAGCUGUCUG 248
TNFR:277L21 antisense siNA GAcAGcuAuGGccucucAcTsT 312 (259C) stab08
552 GCUUCAGAAAACCACCUCAGACA 249 TNFR:572L21 antisense siNA
ucuGAGGuGGuuuucuGAATsT 313 (554C) stab08 606
AUGGGUCAGGUGGAGAUCUCUUC 250 TNFR:626L21 antisense siNA
AGAGAucuccAccuGAcccTsT 314 (608C) stab08 663
AGGAAGAACCAGUACCGGCAUUA 251 TNFR:683L21 antisense siNA
AuGccGGuAcuGGuucuucTsT 315 (665C) stab08 699
CUUUUCCAGUGCUUCAAUUGCAG 252 TNFR:683L21 antisense siNA
GcAAuuGAAGcAcuGGAAATsT 316 (665C) stab08 834
UGUAAGAAAAGCCUGGAGUGCAC 253 TNFR:854L21 antisense siNA
GcAcuccAGGcuuuucuuATsT 317 (836C) stab08 2093
CAAGCUGAACUGUCCUAAGGCAG 254 TNFR:2113L21 antisense siNA
GccuuAGGAcAGuucAGcuTsT 318 (2095C) stab08 72
AUUCUCUGGACUGAGGCUCCAGU 247 37245 TNFR:74U21 sense siNA stab09 B
UCUCUGGACUGAGGCUCCATT B 319 257 GAGUGAGAGGCCAUAGCUGUCUG 248 37246
TNFR:259U21 sense siNA stab09 B GUGAGAGGCCAUAGCUGUCTT B 320 552
GCUUCAGAAAACCACCUCAGACA 249 37247 TNFR:554U21 sense siNA stab09 B
UUCAGAAAACCACCUCAGATT B 321 606 AUGGGUCAGGUGGAGAUCUCUUC 250 37248
TNFR:608U21 sense siNA stab09 B GGGUCAGGUGGAGAUCUCUTT B 322 663
AGGAAGAACCAGUACCGGCAUUA 251 37249 TNFR:665U21 sense siNA stab09 B
GAAGAACCAGUACCGGCAUTT B 323 699 CUUUUCCAGUGCUUCAAUUGCAG 252 37250
TNFR:701U21 sense siNA stab09 B UUUCCAGUGOUUCAAUUGCTT B 324 834
UGUAAGAAAAGCCUGGAGUGCAC 253 37251 TNFR:836U21 sense siNA stab09 B
UAAGAAAAGCCUGGAGUGCTT B 325
2093 CAAGCUGAACUGUCCUAAGGCAG 254 37252 TNFR:2095U21 sense siNA
stab09 B AGCUGAACUGUCCUAAGGCTT B 326 72 AUUCUCUGGACUGAGGCUCCAGU 247
TNFR:92L21 antisense siNA (74C) UGGAGCCUCAGUCCAGAGATsT 327 stab10
257 GAGUGAGAGGCCAUAGCUGUCUG 248 TNFR:277L21 antisense siNA
GACAGCUAUGGCCUCUCACTsT 328 (259C) stab10 552
GCUUCAGAAAACCACCUCAGACA 249 TNFR:572L21 antisense siNA
UCUGAGGUGGUUUUCUGAATsT 329 (554C) stab10 606
AUGGGUCAGGUGGAGAUCUCUUC 250 TNFR:626L21 antisense siNA
AGAGAUCUCCACCUGACCCTsT 330 (608C) stab10 663
AGGAAGAACCAGUACCGGCAUUA 251 TNFR:626L21 antisense siNA
AUGCCGGUACUGGUUCUUCTsT 331 (608C) stab10 699
CUUUUCCAGUGCUUCAAUUGCAG 252 TNFR:719L21 antisense siNA
GCAAUUGAAGCACUGGAAATsT 332 (701C) stab10 834
UGUAAGAAAAGCCUGGAGUGCAC 253 TNFR:854L21 antisense siNA
GCACUCCAGGCUUUUCUUATsT 333 (836C) stab10 2093
CAAGCUGAACUGUCCUAAGGCAG 254 TNFR:2113L21 antisense siNA
GCCUUAGGACAGUUCAGCUTsT 334 (2095C) stab10 72
AUUCUCUGGACUGAGGCUCCAGU 247 TNFR:92L21 antisense siNA (74C)
uGGAGccucAGuccAGAGATT B 335 stab 19 257 GAGUGAGAGGCCAUAGCUGUCUG 248
TNFR:277L21 antisense siNA GAcAGcuAuGGccucucAcTT B 336 (259C) stab
19 552 GCUUCAGAAAACCACCUCAGACA 249 TNFR:572L21 antisense siNA
ucuGAGGuGGuuuucuGAATT B 337 (554C) stab 19 606
AUGGGUCAGGUGGAGAUCUCUUC 250 TNFR:626L21 antisense siNA
AGAGAucuccAccuGAcccTT B 338 (608C) stab 19 663
AGGAAGAACCAGUACCGGCAUUA 251 TNFR:683L21 antisense siNA
AuGccGGuAcuGGuucuucTT B 339 (665C) stab 19 699
CUUUUCCAGUGCUUCAAUUGCAG 252 TNFR:719L21 antisense siNA
GcAAuuGAAGcAcuGGAAATT B 340 (701C) stab 19 834
UGUAAGAAAAGCCUGGAGUGCAC 253 TNFR:854L21 antisense siNA
GcAcuccAGGcuuuucuuATT B 341 (836C) stab19 2093
CAAGCUGAACUGUCCUAAGGCAG 254 TNFR:2113L21 antisense siNA
GccuuAGGAcAGuucAGcuTT B 342 (2095C) stab 19 72
AUUCUCUGGACUGAGGCUCCAGU 247 37253 TNFR:92L21 antisense siNA (74C)
UGGAGCCUCAGUCCAGAGATT B 343 stab22 257 GAGUGAGAGGCCAUAGCUGUCUG 248
37254 TNFR:277L21 antisense siNA GACAGCUAUGGCCUCUCACTT B 344 (259C)
stab22 552 GCUUCAGAAAACCACCUCAGACA 249 37255 TNFR:572L21 antisense
siNA UCUGAGGUGGUUUUCUGAATT B 345 (554C) stab22 606
AUGGGUCAGGUGGAGAUCUCUUC 250 37256 TNFR:626L21 antisense siNA
AGAGAUCUCCACCUGACCCTT B 346 (608C) stab22 663
AGGAAGAACCAGUACCGGCAUUA 251 37257 TNFR:683L21 antisense siNA
AUGCCGGUACUGGUUCUUCTT B 347 (665C) stab22 699
CUUUUCCAGUGCUUCAAUUGCAG 252 37258 TNFR:719L21 antisense siNA
GCAAUUGAAGCACUGGAAATT B 348 (836C) stab22 834
UGUAAGAAAAGCCUGGAGUGCAC 253 37259 TNFR:854L21 antisense siNA
GCACUCCAGGCUUUUCUUATT B 349 (836C) stab22 2093
CAAGCUGAACUGUCCUAAGGCAG 254 37260 TNFR:2113L21 antisense siNA
GCCUUAGGACAGUUCAGCUTT B 350 (2095C) stab22 Uppercase =
ribonucleotide u, c = 2'-deoxy-2'-fluoro U, C T = thymidine B =
inverted deoxy abasic s = phosphorothioate linkage A = deoxy
Adenosine G = deoxy Guanosine G = 2'-C-methyl Guanosine A =
2'-C-methyl Adenosine
TABLE-US-00004 TABLE IV Non-limiting examples of Stabilization
Chemistries for chemically modified siNA constructs Chemistry
pyrimidine Purine cap p = S Strand "Stab 00" Ribo Ribo S/AS "Stab
1" Ribo Ribo -- 5 at 5'-end S/AS 1 at 3'-end "Stab 2" Ribo Ribo --
All Usually AS linkages "Stab 3" 2'-fluoro Ribo -- 4 at 5'-end
Usually S 4 at 3'-end "Stab 4" 2'-fluoro Ribo 5' and 3'- -- Usually
S ends "Stab 5" 2'-fluoro Ribo -- 1 at 3'-end Usually AS "Stab 6"
2'-O- Ribo 5' and 3'- -- Usually S Methyl ends "Stab 7" 2'-fluoro
2'-deoxy 5' and 3'- -- Usually S ends "Stab 8" 2'-fluoro 2'-O- -- 1
at 3'-end S/AS Methyl "Stab 9" Ribo Ribo 5' and 3'- -- Usually S
ends "Stab 10" Ribo Ribo -- 1 at 3'-end Usually AS "Stab 11"
2'-fluoro 2'-deoxy -- 1 at 3'-end Usually AS "Stab 12" 2'-fluoro
LNA 5' and 3'- Usually S ends "Stab 13" 2'-fluoro LNA 1 at 3'-end
Usually AS "Stab 14" 2'-fluoro 2'-deoxy 2 at 5'-end Usually AS 1 at
3'-end "Stab 15" 2'-deoxy 2'-deoxy 2 at 5'-end Usually AS 1 at
3'-end "Stab 16" Ribo 2'-O- 5' and 3'- Usually S Methyl ends "Stab
17" 2'-O- 2'-O- 5' and 3'- Usually S Methyl Methyl ends "Stab 18"
2'-fluoro 2'-O- 5' and 3'- Usually S Methyl ends "Stab 19"
2'-fluoro 2'-O- 3'-end S/AS Methyl "Stab 20" 2'-fluoro 2'-deoxy
3'-end Usually AS "Stab 21" 2'-fluoro Ribo 3'-end Usually AS "Stab
22" Ribo Ribo 3'-end Usually AS "Stab 23" 2'-fluoro* 2'-deoxy* 5'
and 3'- Usually S ends "Stab 24" 2'-fluoro* 2'-O- -- 1 at 3'-end
S/AS Methyl* "Stab 25" 2'-fluoro* 2'-O- -- 1 at 3'-end S/AS Methyl*
"Stab 26" 2'-fluoro* 2'-O- -- S/AS Methyl* "Stab 27" 2'-fluoro*
2'-O- 3'-end S/AS Methyl* "Stab 28" 2'-fluoro* 2'-O- 3'-end S/AS
Methyl* "Stab 29" 2'-fluoro* 2'-O- 1 at 3'-end S/AS Methyl* "Stab
30" 2'-fluoro* 2'-O- S/AS Methyl* "Stab 31" 2'-fluoro* 2'-O- 3'-end
S/AS Methyl* "Stab 32" 2'-fluoro 2'-O- S/AS Methyl CAP = any
terminal cap, see for example FIG. 10. All Stab 00-32 chemistries
can comprise 3'-terminal thymidine (TT) residues All Stab 00-32
chemistries typically comprise about 21 nucleotides, but can vary
as described herein. S = sense strand AS = antisense strand *Stab
23 has a single ribonucleotide adjacent to 3'-CAP *Stab 24 and Stab
28 have a single ribonucleotide at 5'-terminus *Stab 25, Stab 26,
and Stab 27 have three ribonucleotides at 5'-terminus *Stab 29,
Stab 30, and Stab 31, any purine at first three nucleotide
positions from 5'-terminus are ribonucleotides p = phosphorothioate
linkage
TABLE-US-00005 TABLE V Reagent Equivalents Amount Wait Time* DNA
Wait Time* 2'-O-methyl Wait Time* RNA A. 2.5 .mu.mol Synthesis
Cycle ABI 394 Instrument Phosphoramidites 6.5 163 .mu.L 45 sec 2.5
min 7.5 min S-Ethyl Tetrazole 23.8 238 .mu.L 45 sec 2.5 min 7.5 min
Acetic Anhydride 100 233 .mu.L 5 sec 5 sec 5 sec N-Methyl 186 233
.mu.L 5 sec 5 sec 5 sec Imidazole TCA 176 2.3 mL 21 sec 21 sec 21
sec Iodine 11.2 1.7 mL 45 sec 45 sec 45 sec Beaucage 12.9 645 .mu.L
100 sec 300 sec 300 sec Acetonitrile NA 6.67 mL NA NA NA B. 0.2
.mu.mol Synthesis Cycle ABI 394 Instrument Phosphoramidites 15 31
.mu.L 45 sec 233 sec 465 sec S-Ethyl Tetrazole 38.7 31 .mu.L 45 sec
233 min 465 sec Acetic Anhydride 655 124 .mu.L 5 sec 5 sec 5 sec
N-Methyl 1245 124 .mu.L 5 sec 5 sec 5 sec Imidazole TCA 700 732
.mu.L 10 sec 10 sec 10 sec Iodine 20.6 244 .mu.L 15 sec 15 sec 15
sec Beaucage 7.7 232 .mu.L 100 sec 300 sec 300 sec Acetonitrile NA
2.64 mL NA NA NA C. 0.2 .mu.mol Synthesis Cycle 96 well Instrument
Equivalents: DNA/ Amount: DNA/2'-O- Wait Time* 2'-O- Reagent
2'-O-methyl/Ribo methyl/Ribo Wait Time* DNA methyl Wait Time* Ribo
Phosphoramidites 22/33/66 40/60/120 .mu.L 60 sec 180 sec 360 sec
S-Ethyl Tetrazole 70/105/210 40/60/120 .mu.L 60 sec 180 min 360 sec
Acetic Anhydride 265/265/265 50/50/50 .mu.L 10 sec 10 sec 10 sec
N-Methyl 502/502/502 50/50/50 .mu.L 10 sec 10 sec 10 sec Imidazole
TCA 238/475/475 250/500/500 .mu.L 15 sec 15 sec 15 sec Iodine
6.8/6.8/6.8 80/80/80 .mu.L 30 sec 30 sec 30 sec Beaucage 34/51/51
80/120/120 100 sec 200 sec 200 sec Acetonitrile NA 1150/1150/1150
.mu.L NA NA NA Wait time does not include contact time during
delivery. Tandem synthesis utilizes double coupling of linker
molecule
Sequence CWU 1
1
373119RNAArtificial SequenceSynthetic 1uguugcaaca cugccucac
19219RNAArtificial SequenceSynthetic 2cucuuccccu cccaccuuc
19319RNAArtificial SequenceSynthetic 3cucuccccuc cucucugcu
19419RNAArtificial SequenceSynthetic 4uuuaauuuuc ucagaauuc
19519RNAArtificial SequenceSynthetic 5cucuggacug aggcuccag
19619RNAArtificial SequenceSynthetic 6guucuggccu uugggguuc
19719RNAArtificial SequenceSynthetic 7caagaucacu gggaccagg
19819RNAArtificial SequenceSynthetic 8gccgugaucu cuaugcccg
19919RNAArtificial SequenceSynthetic 9gagucucaac ccucaacug
191019RNAArtificial SequenceSynthetic 10gucaccccaa ggcacuugg
191119RNAArtificial SequenceSynthetic 11ggacguccug gacagaccg
191219RNAArtificial SequenceSynthetic 12gagucccggg aagccccag
191319RNAArtificial SequenceSynthetic 13gcacugccgc ugccacacu
191419RNAArtificial SequenceSynthetic 14ugcccugagc ccaaauggg
191519RNAArtificial SequenceSynthetic 15gggagugaga ggccauagc
191619RNAArtificial SequenceSynthetic 16cugucuggca ugggccucu
191719RNAArtificial SequenceSynthetic 17uccaccgugc cugaccugc
191819RNAArtificial SequenceSynthetic 18cugcugccac uggugcucc
191919RNAArtificial SequenceSynthetic 19cuggagcugu uggugggaa
192019RNAArtificial SequenceSynthetic 20auauaccccu cagggguua
192119RNAArtificial SequenceSynthetic 21auuggacugg ucccucacc
192219RNAArtificial SequenceSynthetic 22cuaggggaca gggagaaga
192319RNAArtificial SequenceSynthetic 23agagauagug ugugucccc
192419RNAArtificial SequenceSynthetic 24caaggaaaau auauccacc
192519RNAArtificial SequenceSynthetic 25ccucaaaaua auucgauuu
192619RNAArtificial SequenceSynthetic 26ugcuguacca agugccaca
192719RNAArtificial SequenceSynthetic 27aaaggaaccu acuuguaca
192819RNAArtificial SequenceSynthetic 28aaugacuguc caggcccgg
192919RNAArtificial SequenceSynthetic 29gggcaggaua cggacugca
193019RNAArtificial SequenceSynthetic 30agggagugug agagcggcu
193119RNAArtificial SequenceSynthetic 31uccuucaccg cuucagaaa
193219RNAArtificial SequenceSynthetic 32aaccaccuca gacacugcc
193319RNAArtificial SequenceSynthetic 33cucagcugcu ccaaaugcc
193419RNAArtificial SequenceSynthetic 34cgaaaggaaa ugggucagg
193519RNAArtificial SequenceSynthetic 35guggagaucu cuucuugca
193619RNAArtificial SequenceSynthetic 36acaguggacc gggacaccg
193719RNAArtificial SequenceSynthetic 37guguguggcu gcaggaaga
193819RNAArtificial SequenceSynthetic 38aaccaguacc ggcauuauu
193919RNAArtificial SequenceSynthetic 39uggagugaaa accuuuucc
194019RNAArtificial SequenceSynthetic 40cagugcuuca auugcagcc
194119RNAArtificial SequenceSynthetic 41cucugccuca augggaccg
194219RNAArtificial SequenceSynthetic 42gugcaccucu ccugccagg
194319RNAArtificial SequenceSynthetic 43gagaaacaga acaccgugu
194419RNAArtificial SequenceSynthetic 44ugcaccugcc augcagguu
194519RNAArtificial SequenceSynthetic 45uucuuucuaa gagaaaacg
194619RNAArtificial SequenceSynthetic 46gagugugucu ccuguagua
194719RNAArtificial SequenceSynthetic 47aacuguaaga aaagccugg
194819RNAArtificial SequenceSynthetic 48gagugcacga aguugugcc
194919RNAArtificial SequenceSynthetic 49cuaccccaga uugagaaug
195019RNAArtificial SequenceSynthetic 50guuaagggca cugaggacu
195119RNAArtificial SequenceSynthetic 51ucaggcacca cagugcugu
195219RNAArtificial SequenceSynthetic 52uugccccugg ucauuuucu
195319RNAArtificial SequenceSynthetic 53uuuggucuuu gccuuuuau
195419RNAArtificial SequenceSynthetic 54ucccuccucu ucauugguu
195519RNAArtificial SequenceSynthetic 55uuaauguauc gcuaccaac
195619RNAArtificial SequenceSynthetic 56cgguggaagu ccaagcucu
195719RNAArtificial SequenceSynthetic 57uacuccauug uuuguggga
195819RNAArtificial SequenceSynthetic 58aaaucgacac cugaaaaag
195919RNAArtificial SequenceSynthetic 59gagggggagc uugaaggaa
196019RNAArtificial SequenceSynthetic 60acuacuacua agccccugg
196119RNAArtificial SequenceSynthetic 61gccccaaacc caagcuuca
196219RNAArtificial SequenceSynthetic 62agucccacuc caggcuuca
196319RNAArtificial SequenceSynthetic 63acccccaccc ugggcuuca
196419RNAArtificial SequenceSynthetic 64agucccgugc ccaguucca
196519RNAArtificial SequenceSynthetic 65accuucaccu ccagcucca
196619RNAArtificial SequenceSynthetic 66accuauaccc ccggugacu
196719RNAArtificial SequenceSynthetic 67ugucccaacu uugcggcuc
196819RNAArtificial SequenceSynthetic 68ccccgcagag agguggcac
196919RNAArtificial SequenceSynthetic 69ccacccuauc agggggcug
197019RNAArtificial SequenceSynthetic 70gaccccaucc uugcgacag
197119RNAArtificial SequenceSynthetic 71gcccucgccu ccgacccca
197219RNAArtificial SequenceSynthetic 72auccccaacc cccuucaga
197319RNAArtificial SequenceSynthetic 73aagugggagg acagcgccc
197419RNAArtificial SequenceSynthetic 74cacaagccac agagccuag
197519RNAArtificial SequenceSynthetic 75gacacugaug accccgcga
197619RNAArtificial SequenceSynthetic 76acgcuguacg ccguggugg
197719RNAArtificial SequenceSynthetic 77gagaacgugc ccccguugc
197819RNAArtificial SequenceSynthetic 78cgcuggaagg aauucgugc
197919RNAArtificial SequenceSynthetic 79cggcgccuag ggcugagcg
198019RNAArtificial SequenceSynthetic 80gaccacgaga ucgaucggc
198119RNAArtificial SequenceSynthetic 81cuggagcugc agaacgggc
198219RNAArtificial SequenceSynthetic 82cgcugccugc gcgaggcgc
198319RNAArtificial SequenceSynthetic 83caauacagca ugcuggcga
198419RNAArtificial SequenceSynthetic 84accuggaggc ggcgcacgc
198519RNAArtificial SequenceSynthetic 85ccgcggcgcg aggccacgc
198619RNAArtificial SequenceSynthetic 86cuggagcugc ugggacgcg
198719RNAArtificial SequenceSynthetic 87gugcuccgcg acauggacc
198819RNAArtificial SequenceSynthetic 88cugcugggcu gccuggagg
198919RNAArtificial SequenceSynthetic 89gacaucgagg aggcgcuuu
199019RNAArtificial SequenceSynthetic 90ugcggccccg ccgcccucc
199119RNAArtificial SequenceSynthetic 91ccgcccgcgc ccagucuuc
199219RNAArtificial SequenceSynthetic 92cucagaugag gcugcgccc
199319RNAArtificial SequenceSynthetic 93ccugcgggca gcucuaagg
199419RNAArtificial SequenceSynthetic 94gaccguccug cgagaucgc
199519RNAArtificial SequenceSynthetic 95ccuuccaacc ccacuuuuu
199619RNAArtificial SequenceSynthetic 96uucuggaaag gaggggucc
199719RNAArtificial SequenceSynthetic 97cugcaggggc aagcaggag
199819RNAArtificial SequenceSynthetic 98gcuagcagcc gccuacuug
199919RNAArtificial SequenceSynthetic 99ggugcuaacc ccucgaugu
1910019RNAArtificial SequenceSynthetic 100uacauagcuu uucucagcu
1910119RNAArtificial SequenceSynthetic 101ugccugcgcg ccgccgaca
1910219RNAArtificial SequenceSynthetic 102agucagcgcu gugcgcgcg
1910319RNAArtificial SequenceSynthetic 103ggagagaggu gcgccgugg
1910419RNAArtificial SequenceSynthetic 104ggcucaagag ccugagugg
1910519RNAArtificial SequenceSynthetic 105ggugguuugc gaggaugag
1910619RNAArtificial SequenceSynthetic 106gggacgcuau gccucaugc
1910719RNAArtificial SequenceSynthetic 107cccguuuugg guguccuca
1910819RNAArtificial SequenceSynthetic 108accagcaagg cugcucggg
1910919RNAArtificial SequenceSynthetic 109gggccccugg uucgucccu
1911019RNAArtificial SequenceSynthetic 110ugagccuuuu ucacagugc
1911119RNAArtificial SequenceSynthetic 111cauaagcagu uuuuuuugu
1911219RNAArtificial SequenceSynthetic 112uuuuuguuuu guuuuguuu
1911319RNAArtificial SequenceSynthetic 113uuguuuuuaa aucaaucau
1911419RNAArtificial SequenceSynthetic 114uguuacacua auagaaacu
1911519RNAArtificial SequenceSynthetic 115uuggcacucc ugugcccuc
1911619RNAArtificial SequenceSynthetic 116cugccuggac aagcacaua
1911719RNAArtificial SequenceSynthetic 117agcaagcuga acuguccua
1911819RNAArtificial SequenceSynthetic 118aaggcagggg cgagcacgg
1911919RNAArtificial SequenceSynthetic 119gaacaauggg gccuucagc
1912019RNAArtificial SequenceSynthetic 120cuggagcugu ggacuuuug
1912119RNAArtificial SequenceSynthetic 121guacauacac uaaaauucu
1912219RNAArtificial SequenceSynthetic 122ugaaguuaaa gcucugcuc
1912319RNAArtificial SequenceSynthetic 123cuuggaaaaa aaaaaaaaa
1912419RNAArtificial SequenceSynthetic 124gugaggcagu guugcaaca
1912519RNAArtificial SequenceSynthetic 125gaagguggga ggggaagag
1912619RNAArtificial SequenceSynthetic 126agcagagagg aggggagag
1912719RNAArtificial SequenceSynthetic 127gaauucugag aaaauuaaa
1912819RNAArtificial SequenceSynthetic 128cuggagccuc aguccagag
1912919RNAArtificial SequenceSynthetic 129gaaccccaaa ggccagaac
1913019RNAArtificial SequenceSynthetic 130ccugguccca gugaucuug
1913119RNAArtificial SequenceSynthetic 131cgggcauaga gaucacggc
1913219RNAArtificial SequenceSynthetic 132caguugaggg uugagacuc
1913319RNAArtificial SequenceSynthetic 133ccaagugccu uggggugac
1913419RNAArtificial SequenceSynthetic 134cggucugucc aggacgucc
1913519RNAArtificial SequenceSynthetic 135cuggggcuuc ccgggacuc
1913619RNAArtificial SequenceSynthetic 136aguguggcag cggcagugc
1913719RNAArtificial SequenceSynthetic 137cccauuuggg cucagggca
1913819RNAArtificial SequenceSynthetic 138gcuauggccu cucacuccc
1913919RNAArtificial SequenceSynthetic 139agaggcccau gccagacag
1914019RNAArtificial SequenceSynthetic 140gcaggucagg cacggugga
1914119RNAArtificial SequenceSynthetic 141ggagcaccag uggcagcag
1914219RNAArtificial SequenceSynthetic 142uucccaccaa cagcuccag
1914319RNAArtificial SequenceSynthetic 143uaaccccuga gggguauau
1914419RNAArtificial SequenceSynthetic 144ggugagggac caguccaau
1914519RNAArtificial SequenceSynthetic 145ucuucucccu guccccuag
1914619RNAArtificial SequenceSynthetic 146ggggacacac acuaucucu
1914719RNAArtificial SequenceSynthetic 147gguggauaua uuuuccuug
1914819RNAArtificial SequenceSynthetic 148aaaucgaauu auuuugagg
1914919RNAArtificial SequenceSynthetic 149uguggcacuu gguacagca
1915019RNAArtificial SequenceSynthetic 150uguacaagua gguuccuuu
1915119RNAArtificial SequenceSynthetic 151ccgggccugg acagucauu
1915219RNAArtificial SequenceSynthetic 152ugcaguccgu auccugccc
1915319RNAArtificial SequenceSynthetic 153agccgcucuc acacucccu
1915419RNAArtificial SequenceSynthetic 154uuucugaagc ggugaagga
1915519RNAArtificial SequenceSynthetic 155ggcagugucu gaggugguu
1915619RNAArtificial SequenceSynthetic 156ggcauuugga gcagcugag
1915719RNAArtificial SequenceSynthetic 157ccugacccau uuccuuucg
1915819RNAArtificial SequenceSynthetic 158ugcaagaaga gaucuccac
1915919RNAArtificial SequenceSynthetic 159cggugucccg guccacugu
1916019RNAArtificial SequenceSynthetic 160ucuuccugca gccacacac
1916119RNAArtificial SequenceSynthetic 161aauaaugccg
guacugguu 1916219RNAArtificial SequenceSynthetic 162ggaaaagguu
uucacucca 1916319RNAArtificial SequenceSynthetic 163ggcugcaauu
gaagcacug 1916419RNAArtificial SequenceSynthetic 164cggucccauu
gaggcagag 1916519RNAArtificial SequenceSynthetic 165ccuggcagga
gaggugcac 1916619RNAArtificial SequenceSynthetic 166acacgguguu
cuguuucuc 1916719RNAArtificial SequenceSynthetic 167aaccugcaug
gcaggugca 1916819RNAArtificial SequenceSynthetic 168cguuuucucu
uagaaagaa 1916919RNAArtificial SequenceSynthetic 169uacuacagga
gacacacuc 1917019RNAArtificial SequenceSynthetic 170ccaggcuuuu
cuuacaguu 1917119RNAArtificial SequenceSynthetic 171ggcacaacuu
cgugcacuc 1917219RNAArtificial SequenceSynthetic 172cauucucaau
cugggguag 1917319RNAArtificial SequenceSynthetic 173aguccucagu
gcccuuaac 1917419RNAArtificial SequenceSynthetic 174acagcacugu
ggugccuga 1917519RNAArtificial SequenceSynthetic 175agaaaaugac
caggggcaa 1917619RNAArtificial SequenceSynthetic 176auaaaaggca
aagaccaaa 1917719RNAArtificial SequenceSynthetic 177aaccaaugaa
gaggaggga 1917819RNAArtificial SequenceSynthetic 178guugguagcg
auacauuaa 1917919RNAArtificial SequenceSynthetic 179agagcuugga
cuuccaccg 1918019RNAArtificial SequenceSynthetic 180ucccacaaac
aauggagua 1918119RNAArtificial SequenceSynthetic 181cuuuuucagg
ugucgauuu 1918219RNAArtificial SequenceSynthetic 182uuccuucaag
cucccccuc 1918319RNAArtificial SequenceSynthetic 183ccaggggcuu
aguaguagu 1918419RNAArtificial SequenceSynthetic 184ugaagcuugg
guuuggggc 1918519RNAArtificial SequenceSynthetic 185ugaagccugg
agugggacu 1918619RNAArtificial SequenceSynthetic 186ugaagcccag
ggugggggu 1918719RNAArtificial SequenceSynthetic 187uggaacuggg
cacgggacu 1918819RNAArtificial SequenceSynthetic 188uggagcugga
ggugaaggu 1918919RNAArtificial SequenceSynthetic 189agucaccggg
gguauaggu 1919019RNAArtificial SequenceSynthetic 190gagccgcaaa
guugggaca 1919119RNAArtificial SequenceSynthetic 191gugccaccuc
ucugcgggg 1919219RNAArtificial SequenceSynthetic 192cagcccccug
auagggugg 1919319RNAArtificial SequenceSynthetic 193cugucgcaag
gaugggguc 1919419RNAArtificial SequenceSynthetic 194uggggucgga
ggcgagggc 1919519RNAArtificial SequenceSynthetic 195ucugaagggg
guuggggau 1919619RNAArtificial SequenceSynthetic 196gggcgcuguc
cucccacuu 1919719RNAArtificial SequenceSynthetic 197cuaggcucug
uggcuugug 1919819RNAArtificial SequenceSynthetic 198ucgcgggguc
aucaguguc 1919919RNAArtificial SequenceSynthetic 199ccaccacggc
guacagcgu 1920019RNAArtificial SequenceSynthetic 200gcaacggggg
cacguucuc 1920119RNAArtificial SequenceSynthetic 201gcacgaauuc
cuuccagcg 1920219RNAArtificial SequenceSynthetic 202cgcucagccc
uaggcgccg 1920319RNAArtificial SequenceSynthetic 203gccgaucgau
cucgugguc 1920419RNAArtificial SequenceSynthetic 204gcccguucug
cagcuccag 1920519RNAArtificial SequenceSynthetic 205gcgccucgcg
caggcagcg 1920619RNAArtificial SequenceSynthetic 206ucgccagcau
gcuguauug 1920719RNAArtificial SequenceSynthetic 207gcgugcgccg
ccuccaggu 1920819RNAArtificial SequenceSynthetic 208gcguggccuc
gcgccgcgg 1920919RNAArtificial SequenceSynthetic 209cgcgucccag
cagcuccag 1921019RNAArtificial SequenceSynthetic 210gguccauguc
gcggagcac 1921119RNAArtificial SequenceSynthetic 211ccuccaggca
gcccagcag 1921219RNAArtificial SequenceSynthetic 212aaagcgccuc
cucgauguc 1921319RNAArtificial SequenceSynthetic 213ggagggcggc
ggggccgca 1921419RNAArtificial SequenceSynthetic 214gaagacuggg
cgcgggcgg 1921519RNAArtificial SequenceSynthetic 215gggcgcagcc
ucaucugag 1921619RNAArtificial SequenceSynthetic 216ccuuagagcu
gcccgcagg 1921719RNAArtificial SequenceSynthetic 217gcgaucucgc
aggacgguc 1921819RNAArtificial SequenceSynthetic 218aaaaaguggg
guuggaagg 1921919RNAArtificial SequenceSynthetic 219ggaccccucc
uuuccagaa 1922019RNAArtificial SequenceSynthetic 220cuccugcuug
ccccugcag 1922119RNAArtificial SequenceSynthetic 221caaguaggcg
gcugcuagc 1922219RNAArtificial SequenceSynthetic 222acaucgaggg
guuagcacc 1922319RNAArtificial SequenceSynthetic 223agcugagaaa
agcuaugua 1922419RNAArtificial SequenceSynthetic 224ugucggcggc
gcgcaggca 1922519RNAArtificial SequenceSynthetic 225cgcgcgcaca
gcgcugacu 1922619RNAArtificial SequenceSynthetic 226ccacggcgca
ccucucucc 1922719RNAArtificial SequenceSynthetic 227ccacucaggc
ucuugagcc 1922819RNAArtificial SequenceSynthetic 228cucauccucg
caaaccacc 1922919RNAArtificial SequenceSynthetic 229gcaugaggca
uagcguccc 1923019RNAArtificial SequenceSynthetic 230ugaggacacc
caaaacggg 1923119RNAArtificial SequenceSynthetic 231cccgagcagc
cuugcuggu 1923219RNAArtificial SequenceSynthetic 232agggacgaac
caggggccc 1923319RNAArtificial SequenceSynthetic 233gcacugugaa
aaaggcuca 1923419RNAArtificial SequenceSynthetic 234acaaaaaaaa
cugcuuaug 1923519RNAArtificial SequenceSynthetic 235aaacaaaaca
aaacaaaaa 1923619RNAArtificial SequenceSynthetic 236augauugauu
uaaaaacaa 1923719RNAArtificial SequenceSynthetic 237aguuucuauu
aguguaaca 1923819RNAArtificial SequenceSynthetic 238gagggcacag
gagugccaa 1923919RNAArtificial SequenceSynthetic 239uaugugcuug
uccaggcag 1924019RNAArtificial SequenceSynthetic 240uaggacaguu
cagcuugcu 1924119RNAArtificial SequenceSynthetic 241ccgugcucgc
cccugccuu 1924219RNAArtificial SequenceSynthetic 242gcugaaggcc
ccauuguuc 1924319RNAArtificial SequenceSynthetic 243caaaagucca
cagcuccag 1924419RNAArtificial SequenceSynthetic 244agaauuuuag
uguauguac 1924519RNAArtificial SequenceSynthetic 245gagcagagcu
uuaacuuca 1924619RNAArtificial SequenceSynthetic 246uuuuuuuuuu
uuuuccaag 1924723RNAArtificial SequenceSynthetic 247auucucugga
cugaggcucc agu 2324823RNAArtificial SequenceSynthetic 248gagugagagg
ccauagcugu cug 2324923RNAArtificial SequenceSynthetic 249gcuucagaaa
accaccucag aca 2325023RNAArtificial SequenceSynthetic 250augggucagg
uggagaucuc uuc 2325123RNAArtificial SequenceSynthetic 251aggaagaacc
aguaccggca uua 2325223RNAArtificial SequenceSynthetic 252cuuuuccagu
gcuucaauug cag 2325323RNAArtificial SequenceSynthetic 253uguaagaaaa
gccuggagug cac 2325423RNAArtificial SequenceSynthetic 254caagcugaac
uguccuaagg cag 2325521DNAArtificial SequenceSynthetic 255ucucuggacu
gaggcuccat t 2125621DNAArtificial SequenceSynthetic 256gugagaggcc
auagcuguct t 2125721DNAArtificial SequenceSynthetic 257uucagaaaac
caccucagat t 2125821DNAArtificial SequenceSynthetic 258gggucaggug
gagaucucut t 2125921DNAArtificial SequenceSynthetic 259gaagaaccag
uaccggcaut t 2126021DNAArtificial SequenceSynthetic 260uuuccagugc
uucaauugct t 2126121DNAArtificial SequenceSynthetic 261uaagaaaagc
cuggagugct t 2126221DNAArtificial SequenceSynthetic 262agcugaacug
uccuaaggct t 2126321DNAArtificial SequenceSynthetic 263uggagccuca
guccagagat t 2126421DNAArtificial SequenceSynthetic 264gacagcuaug
gccucucact t 2126521DNAArtificial SequenceSynthetic 265ucugaggugg
uuuucugaat t 2126621DNAArtificial SequenceSynthetic 266agagaucucc
accugaccct t 2126721DNAArtificial SequenceSynthetic 267augccgguac
ugguucuuct t 2126821DNAArtificial SequenceSynthetic 268gcaauugaag
cacuggaaat t 2126921DNAArtificial SequenceSynthetic 269gcacuccagg
cuuuucuuat t 2127021DNAArtificial SequenceSynthetic 270gccuuaggac
aguucagcut t 2127121DNAArtificial SequenceSynthetic 271ucucuggacu
gaggcuccat t 2127221DNAArtificial SequenceSynthetic 272gugagaggcc
auagcuguct t 2127321DNAArtificial SequenceSynthetic 273uucagaaaac
caccucagat t 2127421DNAArtificial SequenceSynthetic 274gggucaggug
gagaucucut t 2127521DNAArtificial SequenceSynthetic 275gaagaaccag
uaccggcaut t 2127621DNAArtificial SequenceSynthetic 276uuuccagugc
uucaauugct t 2127721DNAArtificial SequenceSynthetic 277uaagaaaagc
cuggagugct t 2127821DNAArtificial SequenceSynthetic 278agcugaacug
uccuaaggct t 2127921DNAArtificial SequenceSynthetic 279uggagccuca
guccagagat t 2128021DNAArtificial SequenceSynthetic 280gacagcuaug
gccucucact t 2128121DNAArtificial SequenceSynthetic 281ucugaggugg
uuuucugaat t 2128221DNAArtificial SequenceSynthetic 282agagaucucc
accugaccct t 2128321DNAArtificial SequenceSynthetic 283augccgguac
ugguucuuct t 2128421DNAArtificial SequenceSynthetic 284gcaauugaag
cacuggaaat t 2128521DNAArtificial SequenceSynthetic 285gcacuccagg
cuuuucuuat t 2128621DNAArtificial SequenceSynthetic 286gccuuaggac
aguucagcut t 2128721DNAArtificial SequenceSynthetic 287ucucuggacu
gaggcuccat t 2128821DNAArtificial SequenceSynthetic 288gugagaggcc
auagcuguct t 2128921DNAArtificial SequenceSynthetic 289uucagaaaac
caccucagat t 2129021DNAArtificial SequenceSynthetic 290gggucaggug
gagaucucut t 2129121DNAArtificial SequenceSynthetic 291gaagaaccag
uaccggcaut t 2129221DNAArtificial SequenceSynthetic 292uuuccagugc
uucaauugct t 2129321DNAArtificial SequenceSynthetic 293uaagaaaagc
cuggagugct t 2129421DNAArtificial SequenceSynthetic 294agcugaacug
uccuaaggct t 2129521DNAArtificial SequenceSynthetic 295uggagccuca
guccagagat t 2129621DNAArtificial SequenceSynthetic 296gacagcuaug
gccucucact t 2129721DNAArtificial SequenceSynthetic 297ucugaggugg
uuuucugaat t 2129821DNAArtificial SequenceSynthetic 298agagaucucc
accugaccct t 2129921DNAArtificial SequenceSynthetic 299augccgguac
ugguucuuct t 2130021DNAArtificial SequenceSynthetic 300gcaauugaag
cacuggaaat t 2130121DNAArtificial SequenceSynthetic 301gcacuccagg
cuuuucuuat t 2130221DNAArtificial SequenceSynthetic 302gccuuaggac
aguucagcut t 2130321DNAArtificial SequenceSynthetic 303ucucuggacu
gaggcuccat t 2130421DNAArtificial SequenceSynthetic 304gugagaggcc
auagcuguct t 2130521DNAArtificial SequenceSynthetic 305uucagaaaac
caccucagat t 2130621DNAArtificial SequenceSynthetic 306gggucaggug
gagaucucut t 2130721DNAArtificial SequenceSynthetic 307gaagaaccag
uaccggcaut t 2130821DNAArtificial SequenceSynthetic 308uuuccagugc
uucaauugct t 2130921DNAArtificial SequenceSynthetic 309uaagaaaagc
cuggagugct t 2131021DNAArtificial SequenceSynthetic 310agcugaacug
uccuaaggct t 2131121DNAArtificial SequenceSynthetic 311uggagccuca
guccagagat t
2131221DNAArtificial SequenceSynthetic 312gacagcuaug gccucucact t
2131321DNAArtificial SequenceSynthetic 313ucugaggugg uuuucugaat t
2131421DNAArtificial SequenceSynthetic 314agagaucucc accugaccct t
2131521DNAArtificial SequenceSynthetic 315augccgguac ugguucuuct t
2131621DNAArtificial SequenceSynthetic 316gcaauugaag cacuggaaat t
2131721DNAArtificial SequenceSynthetic 317gcacuccagg cuuuucuuat t
2131821DNAArtificial SequenceSynthetic 318gccuuaggac aguucagcut t
2131921DNAArtificial SequenceSynthetic 319ucucuggacu gaggcuccat t
2132021DNAArtificial SequenceSynthetic 320gugagaggcc auagcuguct t
2132121DNAArtificial SequenceSynthetic 321uucagaaaac caccucagat t
2132221DNAArtificial SequenceSynthetic 322gggucaggug gagaucucut t
2132321DNAArtificial SequenceSynthetic 323gaagaaccag uaccggcaut t
2132421DNAArtificial SequenceSynthetic 324uuuccagugc uucaauugct t
2132521DNAArtificial SequenceSynthetic 325uaagaaaagc cuggagugct t
2132621DNAArtificial SequenceSynthetic 326agcugaacug uccuaaggct t
2132721DNAArtificial SequenceSynthetic 327uggagccuca guccagagat t
2132821DNAArtificial SequenceSynthetic 328gacagcuaug gccucucact t
2132921DNAArtificial SequenceSynthetic 329ucugaggugg uuuucugaat t
2133021DNAArtificial SequenceSynthetic 330agagaucucc accugaccct t
2133121DNAArtificial SequenceSynthetic 331augccgguac ugguucuuct t
2133221DNAArtificial SequenceSynthetic 332gcaauugaag cacuggaaat t
2133321DNAArtificial SequenceSynthetic 333gcacuccagg cuuuucuuat t
2133421DNAArtificial SequenceSynthetic 334gccuuaggac aguucagcut t
2133521DNAArtificial SequenceSynthetic 335uggagccuca guccagagat t
2133621DNAArtificial SequenceSynthetic 336gacagcuaug gccucucact t
2133721DNAArtificial SequenceSynthetic 337ucugaggugg uuuucugaat t
2133821DNAArtificial SequenceSynthetic 338agagaucucc accugaccct t
2133921DNAArtificial SequenceSynthetic 339augccgguac ugguucuuct t
2134021DNAArtificial SequenceSynthetic 340gcaauugaag cacuggaaat t
2134121DNAArtificial SequenceSynthetic 341gcacuccagg cuuuucuuat t
2134221DNAArtificial SequenceSynthetic 342gccuuaggac aguucagcut t
2134321DNAArtificial SequenceSynthetic 343uggagccuca guccagagat t
2134421DNAArtificial SequenceSynthetic 344gacagcuaug gccucucact t
2134521DNAArtificial SequenceSynthetic 345ucugaggugg uuuucugaat t
2134621DNAArtificial SequenceSynthetic 346agagaucucc accugaccct t
2134721DNAArtificial SequenceSynthetic 347augccgguac ugguucuuct t
2134821DNAArtificial SequenceSynthetic 348gcaauugaag cacuggaaat t
2134921DNAArtificial SequenceSynthetic 349gcacuccagg cuuuucuuat t
2135021DNAArtificial SequenceSynthetic 350gccuuaggac aguucagcut t
2135121DNAArtificial SequenceSynthetic 351nnnnnnnnnn nnnnnnnnnn
2135221DNAArtificial SequenceSynthetic 352nnnnnnnnnn nnnnnnnnnn
2135321DNAArtificial SequenceSynthetic 353nnnnnnnnnn nnnnnnnnnn
2135421DNAArtificial SequenceSynthetic 354nnnnnnnnnn nnnnnnnnnn
2135521DNAArtificial SequenceSynthetic 355nnnnnnnnnn nnnnnnnnnn
2135621DNAArtificial SequenceSynthetic 356nnnnnnnnnn nnnnnnnnnn
2135721DNAArtificial SequenceSynthetic 357nnnnnnnnnn nnnnnnnnnn
2135821DNAArtificial SequenceSynthetic 358nnnnnnnnnn nnnnnnnnnn
2135921DNAArtificial SequenceSynthetic 359nnnnnnnnnn nnnnnnnnnn
2136021DNAArtificial SequenceSynthetic 360gacucagcgc ugagaucaat
2136121DNAArtificial SequenceSynthetic 361uugaucucag cgcugaguct
2136221DNAArtificial SequenceSynthetic 362gacucagcgc ugagaucaat
2136321DNAArtificial SequenceSynthetic 363uugaucucag cgcugaguct
2136421DNAArtificial SequenceSynthetic 364gacucagcgc ugagaucaat
2136521DNAArtificial SequenceSynthetic 365uugaucucag cgcugaguct
2136621DNAArtificial SequenceSynthetic 366gacucagcgc ugagaucaat t
2136721DNAArtificial SequenceSynthetic 367gacucagcgc ugagaucaat
2136821DNAArtificial SequenceSynthetic 368uugaucucag cgcugaguct
2136914RNAArtificial SequenceSynthetic target Sequence/duplex
forming oligonucleotide 369auauaucuau uucg 1437014RNAArtificial
SequenceSynthetic complementary Sequence/duplex forming
oligonucleotide 370cgaaauagau auau 1437122RNAArtificial
SequenceSynthetic self Complementary duplex construct 371cgaaauag
auauau cuauuucg 2237224DNAArtificial SequenceSynthetic duplex
forming oligonucleotide 372cgaaauagau auaucuauuu cgtt
243732161RNAHomo Sapiens 373cggcccagug aucuugaacc ccaaaggcca
gaacuggagc cucaguccag agaauucuga 60gaaaauuaaa gcagagagga ggggagagau
cacugggacc aggccgugau cucuaugccc 120gagucucaac ccucaacugu
caccccaagg cacuugggac guccuggaca gaccgagucc 180cgggaagccc
cagcacugcc gcugccacac ugcccugagc ccaaaugggg gagugagagg
240ccauagcugu cuggcauggg ccucuccacc gugccugacc ugcugcugcc
gcuggugcuc 300cuggagcugu uggugggaau auaccccuca gggguuauug
gacugguccc ucaccuaggg 360gacagggaga agagagauag uguguguccc
caaggaaaau auauccaccc ucaaaauaau 420ucgauuugcu guaccaagug
ccacaaagga accuacuugu acaaugacug uccaggcccg 480gggcaggaua
cggacugcag ggagugugag agcggcuccu ucaccgcuuc agaaaaccac
540cucagacacu gccucagcug cuccaaaugc cgaaaggaaa ugggucaggu
ggagaucucu 600ucuugcacag uggaccggga caccgugugu ggcugcagga
agaaccagua ccggcauuau 660uggagugaaa accuuuucca gugcuucaau
ugcagccucu gccucaaugg gaccgugcac 720cucuccugcc aggagaaaca
gaacaccgug ugcaccugcc augcagguuu cuuucuaaga 780gaaaacgagu
gugucuccug uaguaacugu aagaaaagcc uggagugcac gaaguugugc
840cuaccccaga uugagaaugu uaagggcacu gaggacucag gcaccacagu
gcuguugccc 900cuggucauuu ucuuuggucu uugccuuuua ucccuccucu
ucauugguuu aauguaucgc 960uaccaacggu ggaaguccaa gcucuacucc
auuguuugug ggaaaucgac accugaaaaa 1020gagggggagc uugaaggaac
uacuacuaag ccccuggccc caaacccaag cuucaguccc 1080acuccaggcu
ucacccccac ccugggcuuc agucccgugc ccaguuccac cuucaccucc
1140agcuccaccu auacccccgg ugacuguccc aacuuugcgg cuccccgcag
agagguggca 1200ccacccuauc agggggcuga ccccauccuu gcgacagccc
ucgccuccga ccccaucccc 1260aacccccuuc agaaguggga ggacagcgcc
cacaagccac agagccuaga cacugaugac 1320cccgcgacgc uguacgccgu
gguggagaac gugcccccgu ugcgcuggaa ggaauucgug 1380cggcgccuag
ggcugagcga ccacgagauc gaucggcugg agcugcagaa cgggcgcugc
1440cugcgcgagg cgcaauacag caugcuggcg accuggaggc ggcgcacgcc
gcggcgcgag 1500gccacgcugg agcugcuggg acgcgugcuc cgcgacaugg
accugcuggg cugccuggag 1560gacaucgagg aggcgcuuug cggccccgcc
gcccucccgc ccgcgcccag ucuucucaga 1620ugaggcugcg ccccugcggg
cagcucuaag gaccguccug cgagaucgcc uuccaacccc 1680acuuuuuucu
ggaaaggagg gguccugcag gggcaagcag gagcuagcag ccgccuacuu
1740ggugcuaacc ccucgaugua cauagcuuuu cucagcugcc ugcgcgccgc
cgacagucag 1800cgcugugcgc gcggagagag gugcgccgug ggcucaagag
ccugaguggg ugguuugcga 1860ggaugaggga cgcuaugccu caugcccguu
uugggugucc ucaccagcaa ggcugcucgg 1920gggccccugg uucgucccug
agccuuuuuc acagugcaua agcaguuuuu uuuguuuuug 1980uuuuguuuug
uuuuguuuuu aaaucaauca uguuacacua auagaaacuu ggcacuccug
2040ugcccucugc cuggacaagc acauagcaag cugaacuguc cuaaggcagg
ggcgagcacg 2100gaacaauggg gccuucagcu ggagcugugg acuuuuguac
auacacuaaa auucugaagu 2160u 2161
* * * * *