U.S. patent application number 12/175392 was filed with the patent office on 2009-07-30 for rna interference mediated inhibition of intercellular adhesion molecule (icam) gene expression using short interfering nucelic acid (sina).
This patent application is currently assigned to Sirna Therapeutics, Inc.. Invention is credited to Leonid Beigelman, James McSwiggen.
Application Number | 20090192105 12/175392 |
Document ID | / |
Family ID | 56291073 |
Filed Date | 2009-07-30 |
United States Patent
Application |
20090192105 |
Kind Code |
A1 |
McSwiggen; James ; et
al. |
July 30, 2009 |
RNA INTERFERENCE MEDIATED INHIBITION OF INTERCELLULAR ADHESION
MOLECULE (ICAM) GENE EXPRESSION USING SHORT INTERFERING NUCELIC
ACID (siNA)
Abstract
This invention relates to compounds, compositions, and methods
useful for modulating intercellular adhesion molecule (ICAM) gene
expression using short interfering nucleic acid (siNA) molecules.
This invention also relates to compounds, compositions, and methods
useful for modulating the expression and activity of other genes
involved in pathways of ICAM gene expression and/or activity by RNA
interference (RNAi) using small nucleic acid molecules. In
particular, the instant invention features small nucleic acid
molecules, such as short interfering nucleic acid (siNA), short
interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA
(miRNA), and short hairpin RNA (shRNA) molecules and methods used
to modulate the expression of ICAM genes.
Inventors: |
McSwiggen; James; (Boulder,
CO) ; Beigelman; Leonid; (Brisbane, CA) |
Correspondence
Address: |
Sirna Therapeutics, Inc.
1700 Owens Street, 4th Floor
San Francisco
CA
94158
US
|
Assignee: |
Sirna Therapeutics, Inc.
San Francisco
CA
|
Family ID: |
56291073 |
Appl. No.: |
12/175392 |
Filed: |
July 17, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10923181 |
Aug 20, 2004 |
|
|
|
12175392 |
|
|
|
|
10800487 |
Mar 15, 2004 |
|
|
|
10923181 |
|
|
|
|
PCT/US04/16390 |
May 24, 2004 |
|
|
|
10800487 |
|
|
|
|
10826966 |
Apr 16, 2004 |
|
|
|
PCT/US04/16390 |
|
|
|
|
10757803 |
Jan 14, 2004 |
|
|
|
10826966 |
|
|
|
|
10720448 |
Nov 24, 2003 |
|
|
|
10757803 |
|
|
|
|
10693059 |
Oct 23, 2003 |
|
|
|
10720448 |
|
|
|
|
10444853 |
May 23, 2003 |
|
|
|
10693059 |
|
|
|
|
PCT/US03/05346 |
Feb 20, 2003 |
|
|
|
10444853 |
|
|
|
|
PCT/US03/05028 |
Feb 20, 2003 |
|
|
|
PCT/US03/05346 |
|
|
|
|
60358580 |
Feb 20, 2002 |
|
|
|
60358580 |
Feb 20, 2002 |
|
|
|
60363124 |
Mar 11, 2002 |
|
|
|
60363124 |
Mar 11, 2002 |
|
|
|
60386782 |
Jun 6, 2002 |
|
|
|
60386782 |
Jun 6, 2002 |
|
|
|
60406784 |
Aug 29, 2002 |
|
|
|
60406784 |
Aug 29, 2002 |
|
|
|
60408378 |
Sep 5, 2002 |
|
|
|
60408378 |
Sep 5, 2002 |
|
|
|
60409293 |
Sep 9, 2002 |
|
|
|
60409293 |
Sep 9, 2002 |
|
|
|
60440129 |
Jan 15, 2003 |
|
|
|
60440129 |
Jan 15, 2003 |
|
|
|
Current U.S.
Class: |
514/44R ;
536/24.5 |
Current CPC
Class: |
C07H 21/04 20130101;
A61P 27/16 20180101; A61P 29/00 20180101; A61P 17/00 20180101; C12N
2310/344 20130101; A61P 21/00 20180101; A61K 31/7105 20130101; A61P
1/16 20180101; A61P 37/06 20180101; C12N 2320/51 20130101; A61K
31/712 20130101; A61P 37/00 20180101; C07H 21/02 20130101; A61P
19/02 20180101; A61P 31/10 20180101; A61P 31/20 20180101; A61P
25/28 20180101; C12N 2310/317 20130101; A61P 13/12 20180101; A61P
19/00 20180101; A61K 31/711 20130101; A61P 3/10 20180101; A61P
31/16 20180101; A61P 37/02 20180101; A61K 31/7125 20130101; A61P
11/06 20180101; A61P 37/04 20180101; A61K 47/50 20170801; C12N
2310/14 20130101; A61K 31/713 20130101; A61P 35/00 20180101; A61P
3/00 20180101; A61P 13/10 20180101; A61K 31/7088 20130101; C12N
15/1138 20130101; A61P 17/02 20180101; A61P 27/02 20180101; A61P
31/18 20180101; A61P 13/08 20180101; A61P 31/04 20180101; A61P
31/12 20180101; A61P 35/02 20180101; C12N 2310/346 20130101; A61P
31/14 20180101; C12N 2310/315 20130101; A61K 31/7115 20130101; A61P
25/00 20180101; A61P 31/22 20180101; A61P 1/04 20180101; A61P 25/02
20180101; A61P 31/00 20180101; A61K 38/00 20130101; A61P 1/00
20180101; A61P 37/08 20180101; C12N 15/8218 20130101; A61P 43/00
20180101; C12N 2310/321 20130101; C12N 2310/3521 20130101; C12N
2310/322 20130101; C12N 2310/3533 20130101 |
Class at
Publication: |
514/44 ;
536/24.5 |
International
Class: |
A61K 31/7105 20060101
A61K031/7105; C07H 21/02 20060101 C07H021/02 |
Claims
1. A chemically modified nucleic acid molecule, wherein: (a) the
nucleic acid molecule comprises a sense strand and a separate
antisense strand, each strand having one or more pyrimidine
nucleotides and one or more purine nucleotides; (b) each strand of
the nucleic acid molecule is independently 18 to 27 nucleotides in
length; (c) an 18 to 27 nucleotide sequence of the antisense strand
is complementary to a human ICAM RNA sequence comprising SEQ ID
NO:459; (d) an 18 to 27 nucleotide sequence of the sense strand is
complementary to the antisense strand and comprises an 18 to 27
nucleotide sequence of the human RNA sequence; and (e) 50 percent
or more of the nucleotides in each strand comprise a 2'-sugar
modification, wherein the 2'-sugar modification of any of the
pyrimidine nucleotides differs from the 2'-sugar modification of
any of the purine nucleotides.
2. The nucleic acid molecule of claim 1, wherein the 2'-sugar
modification of any of the purine nucleotides in the sense strand
differs from the 2'-sugar modification of any of the purine
nucleotides in the antisense strand
3. The nucleic acid molecule of claim 1, wherein the 2'-sugar
modification is selected from the group consisting of
2'-deoxy-2'-fluoro, 2'-O-methyl, and 2'-deoxy.
4. The nucleic acid of claim 3, wherein the 2'-deoxy-2'-fluoro
sugar modification is a pyrimidine modification.
5. The nucleic acid of claim 3, wherein the 2'-deoxy sugar
modification is a pyrimidine modification.
6. The nucleic acid of claim 3, wherein the 2'-O-methyl sugar
modification is a pyrimidine modification.
7. The nucleic acid molecule of claim 4, wherein said pyrimidine
modification is in the sense strand, the antisense strand, or both
the sense strand and antisense strand.
8. The nucleic acid molecule of claim 6, wherein said pyrimidine
modification is in the sense strand, the antisense strand, or both
the sense strand and antisense strand.
9. The nucleic acid molecule of claim 3, wherein the 2'-deoxy sugar
modification is a purine modification.
10. The nucleic acid molecule of claim 3, wherein the 2'-O-methyl
sugar modification is a purine modification.
11. The nucleic acid molecule of claim 9, wherein the purine
modification is in the sense strand.
12. The nucleic acid molecule of claim 10, wherein the purine
modification is in the antisense strand.
13. The nucleic acid molecule of claim 1, wherein the nucleic acid
molecule comprises ribonucleotides.
14. The nucleic acid molecule of claim 1, wherein the sense strand
includes a terminal cap moiety at the 5'-end, the 3'-end, or both
of the 5'- and 3'-ends.
15. The nucleic acid molecule of claim 14, wherein the terminal cap
moiety is an inverted deoxy abasic moiety.
16. The nucleic acid molecule of claim 1, wherein said nucleic acid
molecule includes one or more phosphorothioate internucleotide
linkages.
17. The nucleic acid molecule of claim 16, wherein one of the
phosphorothioate internucleotide linkages is at the 3'-end of the
antisense strand.
18. The nucleic acid molecule of claim 1, wherein the 5'-end of the
antisense strand includes a terminal phosphate group.
19. The nucleic acid molecule of claim 1, wherein the sense strand,
the antisense strand, or both the sense strand and the antisense
strand include a 3'-overhang.
20. A composition comprising the nucleic acid molecule of claim 1,
in a pharmaceutically acceptable carrier or diluent.
Description
[0001] This application is a continuation of U.S. patent
application Ser. No. 10/923,181, filed Aug. 20, 2004, which is a
continuation-in-part of U.S. patent application Ser. No.
10/800,487, filed Mar. 15, 2004, and parent U.S. patent application
Ser. No. 10/923,181 is also a continuation-in-part of International
Patent Application No. PCT/US04/16390, filed May 24, 2004, which is
a continuation-in-part of U.S. patent application Ser. No.
10/826,966, filed Apr. 16, 2004, which is continuation-in-part of
U.S. patent application Ser. No. 10/757,803, filed Jan. 14, 2004,
which is a continuation-in-part of U.S. patent application Ser. No.
10/720,448, filed Nov. 24, 2003, which is a continuation-in-part of
U.S. patent application Ser. No. 10/693,059, filed Oct. 23, 2003,
which is a continuation-in-part of U.S. patent application Ser. No.
10/444,853, filed May 23, 2003, which is a continuation-in-part of
International Patent Application No. PCT/US03/05346, filed Feb. 20,
2003, and a continuation-in-part of International Patent
Application No. PCT/US03/05028, filed Feb. 20, 2003, both of which
claim the benefit of U.S. Provisional Application No. 60/358,580
filed Feb. 20, 2002, U.S. Provisional Application No. 60/363,124
filed Mar. 11, 2002, U.S. Provisional Application No. 60/386,782
filed Jun. 6, 2002, U.S. Provisional Application No. 60/406,784
filed Aug. 29, 2002, U.S. Provisional Application No. 60/408,378
filed Sep. 5, 2002, U.S. Provisional Application No. 60/409,293
filed Sep. 9, 2002, and U.S. Provisional Application No. 60/440,129
filed Jan. 15, 2003. The instant application claims the benefit of
all the listed applications, which are hereby incorporated by
reference herein in their entireties, including the drawings.
SEQUENCE LISTING
[0002] The sequence listing submitted via EFS, in compliance with
37 CFR .sctn. 1.52(e)(5), is incorporated herein by reference. The
sequence listing text file submitted via EFS contains the file
"SequenceListing53USCNT", created on Jul. 17, 2008, which is
163,808, bytes in size.
FIELD OF THE INVENTION
[0003] The present invention relates to compounds, compositions,
and methods for the study, diagnosis, and treatment of traits,
diseases and conditions that respond to the modulation of
intercellular adhesion molecule (ICAM) gene expression and/or
activity. The present invention is also directed to compounds,
compositions, and methods relating to traits, diseases and
conditions that respond to the modulation of expression and/or
activity of genes involved in ICAM gene expression pathways or
other cellular processes that mediate the maintenance or
development of such traits, diseases and conditions. Specifically,
the invention relates to small nucleic acid molecules, such as
short interfering nucleic acid (siNA), short interfering RNA
(siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short
hairpin RNA (shRNA) molecules capable of mediating RNA interference
(RNAi) against ICAM gene expression. Such small nucleic acid
molecules are useful, for example, in providing compositions for
treatment of traits, diseases and conditions that can respond to
modulation of ICAM expression in a subject, such as inflammatory,
autoimmune, cancer and proliferative diseases, disorders, or
conditions.
BACKGROUND OF THE INVENTION
[0004] The following is a discussion of relevant art pertaining to
RNAi. The discussion is provided only for understanding of the
invention that follows. The summary is not an admission that any of
the work described below is prior art to the claimed invention.
[0005] RNA interference refers to the process of sequence-specific
post-transcriptional gene silencing in animals mediated by short
interfering RNAs (siRNAs) (Zamore et al., 2000, Cell, 101, 25-33;
Fire et al., 1998, Nature, 391, 806; Hamilton et al., 1999,
Science, 286, 950-951; Lin et al., 1999, Nature, 402, 128-129;
Sharp, 1999, Genes & Dev., 13:139-141; and Strauss, 1999,
Science, 286, 886). The corresponding process in plants (Heifetz et
al., International PCT Publication No. WO 99/61631) is commonly
referred to as post-transcriptional gene silencing or RNA silencing
and is also referred to as quelling in fungi. The process of
post-transcriptional gene silencing is thought to be an
evolutionarily-conserved cellular defense mechanism used to prevent
the expression of foreign genes and is commonly shared by diverse
flora and phyla (Fire et al., 1999, Trends Genet., 15, 358). Such
protection from foreign gene expression may have evolved in
response to the production of double-stranded RNAs (dsRNAs) derived
from viral infection or from the random integration of transposon
elements into a host genome via a cellular response that
specifically destroys homologous single-stranded RNA or viral
genomic RNA. The presence of dsRNA in cells triggers the RNAi
response through a mechanism that has yet to be fully
characterized. This mechanism appears to be different from other
known mechanisms involving double-stranded RNA-specific
ribonucleases, such as the interferon response that results from
dsRNA-mediated activation of protein kinase PKR and
2',5'-oligoadenylate synthetase resulting in non-specific cleavage
of mRNA by ribonuclease L (see for example U.S. Pat. Nos.
6,107,094; 5,898,031; Clemens et al., 1997, J. Interferon &
Cytokine Res., 17, 503-524; Adah et al., 2001, Curr. Med. Chem., 8,
1189).
[0006] The presence of long dsRNAs in cells stimulates the activity
of a ribonuclease III enzyme referred to as dicer (Bass, 2000,
Cell, 101, 235; Zamore et al., 2000, Cell, 101, 25-33; Hammond et
al., 2000, Nature, 404, 293). Dicer is involved in the processing
of the dsRNA into short pieces of dsRNA known as short interfering
RNAs (siRNAs) (Zamore et al., 2000, Cell, 101, 25-33; Bass, 2000,
Cell, 101, 235; Berstein et al., 2001, Nature, 409, 363). Short
interfering RNAs derived from dicer activity are typically about 21
to about 23 nucleotides in length and comprise about 19 base pair
duplexes (Zamore et al., 2000, Cell, 101, 25-33; Elbashir et al.,
2001, Genes Dev., 15, 188). Dicer has also been implicated in the
excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from
precursor RNA of conserved structure that are implicated in
translational control (Hutvagner et al., 2001, Science, 293, 834).
The RNAi response also features an endonuclease complex, commonly
referred to as an RNA-induced silencing complex (RISC), which
mediates cleavage of single-stranded RNA having sequence
complementary to the antisense strand of the siRNA duplex. Cleavage
of the target RNA takes place in the middle of the region
complementary to the antisense strand of the siRNA duplex (Elbashir
et al., 2001, Genes Dev., 15, 188).
[0007] RNAi has been studied in a variety of systems. Fire et al.,
1998, Nature, 391, 806, were the first to observe RNAi in C.
elegans. Bahramian and Zarbl, 1999, Molecular and Cellular Biology,
19, 274-283 and Wianny and Goetz, 1999, Nature Cell Biol., 2, 70,
describe RNAi mediated by dsRNA in mammalian systems. Hammond et
al., 2000, Nature, 404, 293, describe RNAi in Drosophila cells
transfected with dsRNA. Elbashir et al., 2001, Nature, 411, 494 and
Tuschl et al., International PCT Publication No. WO 01/75164,
describe RNAi induced by introduction of duplexes of synthetic
21-nucleotide RNAs in cultured mammalian cells including human
embryonic kidney and HeLa cells. Recent work in Drosophila
embryonic lysates (Elbashir et al., 2001, EMBO J., 20, 6877 and
Tuschl et al., International PCT Publication No. WO 01/75164) has
revealed certain requirements for siRNA length, structure, chemical
composition, and sequence that are essential to mediate efficient
RNAi activity. These studies have shown that 21-nucleotide siRNA
duplexes are most active when containing 3'-terminal dinucleotide
overhangs. Furthermore, complete substitution of one or both siRNA
strands with 2'-deoxy (2'-H) or 2'-O-methyl nucleotides abolishes
RNAi activity, whereas substitution of the 3'-terminal siRNA
overhang nucleotides with 2'-deoxy nucleotides (2'-H) was shown to
be tolerated. Single mismatch sequences in the center of the siRNA
duplex were also shown to abolish RNAi activity. In addition, these
studies also indicate that the position of the cleavage site in the
target RNA is defined by the 5'-end of the siRNA guide sequence
rather than the 3'-end of the guide sequence (Elbashir et al.,
2001, EMBO J., 20, 6877). Other studies have indicated that a
5'-phosphate on the target-complementary strand of an siRNA duplex
is required for siRNA activity and that ATP is utilized to maintain
the 5'-phosphate moiety on the siRNA (Nykanen et al., 2001, Cell,
107, 309).
[0008] Studies have shown that replacing the 3'-terminal nucleotide
overhanging segments of a 21-mer siRNA duplex having two-nucleotide
3'-overhangs with deoxyribonucleotides does not have an adverse
effect on RNAi activity. Replacing up to four nucleotides on each
end of the siRNA with deoxyribonucleotides has been reported to be
well tolerated, whereas complete substitution with
deoxyribonucleotides results in no RNAi activity (Elbashir et al.,
2001, EMBO J., 20, 6877 and Tuschl et al., International PCT
Publication No. WO 01/75164). In addition, Elbashir et al., supra,
also report that substitution of siRNA with 2'-O-methyl nucleotides
completely abolishes RNAi activity. Li et al., International PCT
Publication No. WO 00/44914, and Beach et al., International PCT
Publication No. WO 01/68836 preliminarily suggest that siRNA may
include modifications to either the phosphate-sugar backbone or the
nucleoside to include at least one of a nitrogen or sulfur
heteroatom, however, neither application postulates to what extent
such modifications would be tolerated in siRNA molecules, nor
provides any further guidance or examples of such modified siRNA.
Kreutzer et al., Canadian Patent Application No. 2,359,180, also
describe certain chemical modifications for use in dsRNA constructs
in order to counteract activation of double-stranded RNA-dependent
protein kinase PKR, specifically 2'-amino or 2'-O-methyl
nucleotides, and nucleotides containing a 2'-O or 4'-C methylene
bridge. However, Kreutzer et al. similarly fails to provide
examples or guidance as to what extent these modifications would be
tolerated in dsRNA molecules.
[0009] Parrish et al., 2000, Molecular Cell, 6, 1077-1087, tested
certain chemical modifications targeting the unc-22 gene in C.
elegans using long (>25 nt) siRNA transcripts. The authors
describe the introduction of thiophosphate residues into these
siRNA transcripts by incorporating thiophosphate nucleotide analogs
with T7 and T3 RNA polymerase and observed that RNAs with two
phosphorothioate modified bases also had substantial decreases in
effectiveness as RNAi. Further, Parrish et al. reported that
phosphorothioate modification of more than two residues greatly
destabilized the RNAs in vitro such that interference activities
could not be assayed. Id. at 1081. The authors also tested certain
modifications at the 2'-position of the nucleotide sugar in the
long siRNA transcripts and found that substituting deoxynucleotides
for ribonucleotides produced a substantial decrease in interference
activity, especially in the case of Uridine to Thymidine and/or
Cytidine to deoxy-Cytidine substitutions. Id. In addition, the
authors tested certain base modifications, including substituting,
in sense and antisense strands of the siRNA, 4-thiouracil,
5-bromouracil, 5-iodouracil, and 3-(aminoallyl)uracil for uracil,
and inosine for guanosine. Whereas 4-thiouracil and 5-bromouracil
substitution appeared to be tolerated, Parrish reported that
inosine produced a substantial decrease in interference activity
when incorporated in either strand. Parrish also reported that
incorporation of 5-iodouracil and 3-(aminoallyl)uracil in the
antisense strand resulted in a substantial decrease in RNAi
activity as well.
[0010] The use of longer dsRNA has been described. For example,
Beach et al., International PCT Publication No. WO 01/68836,
describes specific methods for attenuating gene expression using
endogenously-derived dsRNA. Tuschl et al., International PCT
Publication No. WO 01/75164, describe a Drosophila in vitro RNAi
system and the use of specific siRNA molecules for certain
functional genomic and certain therapeutic applications; although
Tuschl, 2001, Chem. Biochem., 2, 239-245, doubts that RNAi can be
used to cure genetic diseases or viral infection due to the danger
of activating interferon response. Li et al., International PCT
Publication No. WO 00/44914, describe the use of specific long (141
bp-488 bp) enzymatically synthesized or vector expressed dsRNAs for
attenuating the expression of certain target genes. Zernicka-Goetz
et al., International PCT Publication No. WO 01/36646, describe
certain methods for inhibiting the expression of particular genes
in mammalian cells using certain long (550 bp-714 bp),
enzymatically synthesized or vector expressed dsRNA molecules. Fire
et al., International PCT Publication No. WO 99/32619, describe
particular methods for introducing certain long dsRNA molecules
into cells for use in inhibiting gene expression in nematodes.
Plaetinck et al., International PCT Publication No. WO 00/01846,
describe certain methods for identifying specific genes responsible
for conferring a particular phenotype in a cell using specific long
dsRNA molecules. Mello et al., International PCT Publication No. WO
01/29058, describe the identification of specific genes involved in
dsRNA-mediated RNAi. Pachuck et al., International PCT Publication
No. WO 00/63364, describe certain long (at least 200 nucleotide)
dsRNA constructs. Deschamps Depaillette et al., International PC7
Publication No. WO 99/07409, describe specific compositions
consisting of particular dsRNA molecules combined with certain
anti-viral agents. Waterhouse et al., International PCT Publication
No. 99/53050 and 1998, PNAS, 95, 13959-13964, describe certain
methods for decreasing the phenotypic expression of a nucleic acid
in plant cells using certain dsRNAs. Driscoll et al., International
PCT Publication No. WO 01/49844, describe specific DNA expression
constructs for use in facilitating gene silencing in targeted
organisms.
[0011] Others have reported on various RNAi and gene-silencing
systems. For example, Parrish et al., 2000, Molecular Cell, 6,
1077-1087, describe specific chemically modified dsRNA constructs
targeting the unc-22 gene of C. elegans. Grossniklaus,
International PCT Publication No. WO 01/38551, describes certain
methods for regulating polycomb gene expression in plants using
certain dsRNAs. Churikov et al., International PCT Publication No.
WO 01/42443, describe certain methods for modifying genetic
characteristics of an organism using certain dsRNAs. Cogoni et al.,
International PCT Publication No. WO 01/53475, describe certain
methods for isolating a Neurospora silencing gene and uses thereof.
Reed et al., International PCT Publication No. WO 01/68836,
describe certain methods for gene silencing in plants. Honer et
al., International PCT Publication No. WO 01/70944, describe
certain methods of drug screening using transgenic nematodes as
Parkinson's Disease models using certain dsRNAs. Deak et al.,
International PCT Publication No. WO 01/72774, describe certain
Drosophila-derived gene products that may be related to RNAi in
Drosophila. Arndt et al., International PCT Publication No. WO
01/92513 describe certain methods for mediating gene suppression by
using factors that enhance RNAi. Tuschl et al., International PCT
Publication No. WO 02/44321, describe certain synthetic siRNA
constructs. Pachuk et al., International PCT Publication No. WO
00/63364, and Satishchandran et al., International PCT Publication
No. WO 01/04313, describe certain methods and compositions for
inhibiting the function of certain polynucleotide sequences using
certain long (over 250 bp), vector expressed dsRNAs. Echeverri et
al., International PCT Publication No. WO 02/38805, describe
certain C. elegans genes identified via RNAi. Kreutzer et al.,
International PCT Publications Nos. WO 02/055692, WO 02/055693, and
EP 1144623 B1 describes certain methods for inhibiting gene
expression using dsRNA. Graham et al., International PCT
Publications Nos. WO 99/49029 and WO 01/70949, and AU 4037501
describe certain vector expressed siRNA molecules. Fire et al.,
U.S. Pat. No. 6,506,559, describe certain methods for inhibiting
gene expression in vitro using certain long dsRNA (299 bp-1033 bp)
constructs that mediate RNAi. Martinez et al., 2002, Cell, 110,
563-574, describe certain single-stranded siRNA constructs,
including certain 5'-phosphorylated single-stranded siRNAs that
mediate RNA interference in HeLa cells. Harborth et al., 2003,
Antisense & Nucleic Acid Drug Development, 13, 83-105, describe
certain chemically and structurally modified siRNA molecules. Chiu
and Rana, 2003, RNA, 9, 1034-1048, describe certain chemically and
structurally modified siRNA molecules. Woolf et al., International
PCT Publication Nos. WO 03/064626 and WO 03/064625 describe certain
chemically modified dsRNA constructs.
[0012] Dretschmer-Kazemi Far et al., 2003, Nucleic Acids Research,
31, 4417-4424, and Vickers et al., 2003, Journal of Biological
Chemistry, 278, 7108-7118, describe certain siRNA molecules
targeting particular sites in ICAM-1 mRNA for target site
accessibility studies. Min et al., International PCT Publication
No. WO 03/104456, generally describe certain siRNA molecules
targeting ICAM-1 in immune cells to modulate T-cell activity.
Tuschl et al., International PCT Publication No. WO 03/099298,
generally describe certain siRNA molecules targeting ICAM. Reich et
al., International PCT Publication No. WO 04/065546, generally
describe certain siRNA molecules targeting ICAM.
SUMMARY OF THE INVENTION
[0013] This invention relates to compounds, compositions, and
methods useful for modulating intercellular adhesion molecule
(ICAM) gene expression using short interfering nucleic acid (siNA)
molecules. This invention also relates to compounds, compositions,
and methods useful for modulating the expression and activity of
other genes involved in pathways of ICAM gene expression and/or
activity by RNA interference (RNAi) using small nucleic acid
molecules. In particular, the instant invention features small
nucleic acid molecules, such as short interfering nucleic acid
(siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA),
micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and
methods used to modulate the expression of ICAM genes.
[0014] An siNA of the invention can be unmodified or chemically
modified. An siNA of the instant invention can be chemically
synthesized, expressed from a vector or enzymatically synthesized.
The instant invention also features various chemically modified
synthetic short interfering nucleic acid (siNA) molecules capable
of modulating ICAM gene expression or activity in cells by RNA
interference (RNAi). The use of chemically modified siNA improves
various properties of native siNA molecules through increased
resistance to nuclease degradation in vivo and/or through improved
cellular uptake. Further, contrary to earlier published studies,
siNA having multiple chemical modifications retains its RNAi
activity. The siNA molecules of the instant invention provide
useful reagents and methods for a variety of therapeutic,
veterinary, diagnostic, target validation, genomic discovery,
genetic engineering, and pharmacogenomic applications.
[0015] In one embodiment, the invention features one or more siNA
molecules and methods that independently or in combination modulate
the expression of ICAM genes encoding proteins, such as proteins
comprising ICAM associated with the maintenance and/or development
of inflammatory, autoimmune, cancer and proliferative diseases,
traits, conditions and disorders, such as genes encoding sequences
comprising those sequences referred to by GenBank Accession Nos.
shown in Table I, referred to herein generally as intercellular
adhesion molecule or ICAM. The description below of the various
aspects and embodiments of the invention is provided with reference
to an exemplary ICAM gene referred to herein as ICAM. However, the
various aspects and embodiments are also directed to other ICAM
genes, such as homolog genes and transcript variants, and
polymorphisms (e.g., single nucleotide polymorphism, (SNPs))
associated with certain ICAM genes. As such, the various aspects
and embodiments are also directed to other genes that are involved
in ICAM mediated pathways of signal transduction or gene expression
that are involved, for example, in the maintenance or development
of diseases, traits, or conditions described herein. These
additional genes can be analyzed for target sites using the methods
described for ICAM genes herein. Thus, the modulation of other
genes and the effects of such modulation of the other genes can be
performed, determined, and measured as described herein.
[0016] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of an ICAM gene, wherein said siNA molecule comprises
about 15 to about 28 base pairs.
[0017] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that directs
cleavage of an ICAM RNA via RNA interference (RNAi), wherein the
double-stranded siNA molecule comprises a first and a second
strand, each strand of the siNA molecule is about 18 to about 28
nucleotides in length, the first strand of the siNA molecule
comprises nucleotide sequence having sufficient complementarity to
the ICAM RNA for the siNA molecule to direct cleavage of the ICAM
RNA via RNA interference, and the second strand of said siNA
molecule comprises nucleotide sequence that is complementary to the
first strand.
[0018] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that directs
cleavage of an ICAM RNA via RNA interference (RNAi), wherein the
double-stranded siNA molecule comprises a first and a second
strand, each strand of the siNA molecule is about 18 to about 23
nucleotides in length, the first strand of the siNA molecule
comprises nucleotide sequence having sufficient complementarity to
the ICAM RNA for the siNA molecule to direct cleavage of the ICAM
RNA via RNA interference, and the second strand of said siNA
molecule comprises nucleotide sequence that is complementary to the
first strand.
[0019] In one embodiment, the invention features a chemically
synthesized double-stranded short interfering nucleic acid (siNA)
molecule that directs cleavage of an ICAM RNA via RNA interference
(RNAi), wherein each strand of the siNA molecule is about 18 to
about 28 nucleotides in length; and one strand of the siNA molecule
comprises nucleotide sequence having sufficient complementarity to
the ICAM RNA for the siNA molecule to direct cleavage of the ICAM
RNA via RNA interference.
[0020] In one embodiment, the invention features a chemically
synthesized double-stranded short interfering nucleic acid (siNA)
molecule that directs cleavage of an ICAM RNA via RNA interference
(RNAi), wherein each strand of the siNA molecule is about 18 to
about 23 nucleotides in length; and one strand of the siNA molecule
comprises nucleotide sequence having sufficient complementarity to
the ICAM RNA for the siNA molecule to direct cleavage of the ICAM
RNA via RNA interference.
[0021] In one embodiment, the invention features an siNA molecule
that down-regulates expression of an ICAM gene, for example,
wherein the ICAM gene comprises ICAM encoding sequence. In one
embodiment, the invention features an siNA molecule that
down-regulates expression of an ICAM gene, for example, wherein the
ICAM gene comprises ICAM non-coding sequence or regulatory elements
involved in ICAM gene expression.
[0022] In one embodiment, an siNA of the invention is used to
inhibit the expression of ICAM genes or an ICAM gene family (e.g.,
ICAM superfamily genes), wherein the genes or gene family sequences
share sequence homology. Such homologous sequences can be
identified as is known in the art, for example using sequence
alignments. siNA molecules can be designed to target such
homologous sequences, for example using perfectly complementary
sequences or by incorporating non-canonical base pairs, for example
mismatches and/or wobble base pairs that can provide additional
target sequences. In instances where mismatches are identified,
non-canonical base pairs (for example, mismatches and/or wobble
bases) can be used to generate siNA molecules that target more than
one gene sequence. In a non-limiting example, non-canonical base
pairs such as UU and CC base pairs are used to generate siNA
molecules that are capable of targeting sequences for differing
ICAM targets that share sequence homology. As such, one advantage
of using siNAs of the invention is that a single siNA can be
designed to include nucleic acid sequence that is complementary to
the nucleotide sequence that is conserved between the homologous
genes. In this approach, a single siNA can be used to inhibit
expression of more than one gene instead of using more than one
siNA molecule to target the different genes.
[0023] In one embodiment, the invention features an siNA molecule
having RNAi activity against ICAM RNA, wherein the siNA molecule
comprises a sequence complementary to any RNA having ICAM encoding
sequence, such as those sequences having GenBank Accession Nos.
shown in Table I. In another embodiment, the invention features an
siNA molecule having RNAi activity against ICAM RNA, wherein the
siNA molecule comprises a sequence complementary to an RNA having
variant ICAM encoding sequence, for example other mutant ICAM genes
not shown in Table I but known in the art to be associated with the
maintenance and/or development of inflammatory, autoimmune, cancer
and proliferative diseases, disorders, and/or conditions. Chemical
modifications as shown in Tables III and IV or otherwise described
herein can be applied to any siNA construct of the invention. In
another embodiment, an siNA molecule of the invention includes a
nucleotide sequence that can interact with nucleotide sequence of
an ICAM gene and thereby mediate silencing of ICAM gene expression,
for example, wherein the siNA mediates regulation of ICAM gene
expression by cellular processes that modulate the chromatin
structure or methylation patterns of the ICAM gene and prevent
transcription of the ICAM gene.
[0024] In one embodiment, siNA molecules of the invention are used
to down regulate or inhibit the expression of ICAM proteins arising
from ICAM haplotype polymorphisms that are associated with a
disease or condition, (e.g., inflammatory, autoimmune, cancer and
proliferative diseases, disorders, and/or conditions). Analysis of
ICAM genes, or ICAM protein or RNA levels can be used to identify
subjects with such polymorphisms or those subjects who are at risk
of developing traits, conditions, or diseases described herein.
These subjects are amenable to treatment, for example, treatment
with siNA molecules of the invention and any other composition
useful in treating diseases related to ICAM gene expression. As
such, analysis of ICAM protein or RNA levels can be used to
determine treatment type and the course of therapy in treating a
subject. Monitoring of ICAM protein or RNA levels can be used to
predict treatment outcome and to determine the efficacy of
compounds and compositions that modulate the level and/or activity
of certain ICAM proteins associated with a trait, condition, or
disease.
[0025] In one embodiment of the invention an siNA molecule
comprises an antisense strand comprising a nucleotide sequence that
is complementary to a nucleotide sequence or a portion thereof
encoding an ICAM protein. The siNA further comprises a sense
strand, wherein said sense strand comprises a nucleotide sequence
of an ICAM gene or a portion thereof.
[0026] In another embodiment, an siNA molecule comprises an
antisense region comprising a nucleotide sequence that is
complementary to a nucleotide sequence encoding an ICAM protein or
a portion thereof. The siNA molecule further comprises a sense
region, wherein said sense region comprises a nucleotide sequence
of an ICAM gene or a portion thereof.
[0027] In another embodiment, the invention features an siNA
molecule comprising a nucleotide sequence in the antisense region
of the siNA molecule that is complementary to a nucleotide sequence
or portion of sequence of an ICAM gene. In another embodiment, the
invention features an siNA molecule comprising a region, for
example, the antisense region of the siNA construct, complementary
to a sequence comprising an ICAM gene sequence or a portion
thereof.
[0028] In one embodiment, the antisense region of ICAM siNA
constructs comprises a sequence complementary to sequence having
any of SEQ ID NOs. 1-166, 333-348, 357-364, 373-380, 389-396,
405-412, 437, 439, 441, 443, 444, 446, 448, 450, 452, or 453. In
one embodiment, the antisense region of ICAM constructs comprises
sequence having any of SEQ ID NOs. 167-332, 349-356, 365-372,
381-388, 397404, 413-436, 438, 440, 442, 445, 447, 449, 451, or
454. In another embodiment, the sense region of ICAM constructs
comprises sequence having any of SEQ ID NOs. 1-166, 333-348,
357-364, 373-380, 389-396, 405-412, 437, 439, 441, 443, 444, 446,
448, 450, 452, or 453.
[0029] In one embodiment, an siNA molecule of the invention
comprises any of SEQ ID NOs. 1-454. The sequences shown in SEQ ID
NOs: 1-454 are not limiting. An siNA molecule of the invention can
comprise any contiguous ICAM sequence (e.g., about 15 to about 25
or more, or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or
more contiguous ICAM nucleotides).
[0030] In yet another embodiment, the invention features an siNA
molecule comprising a sequence, for example, the antisense sequence
of the siNA construct, complementary to a sequence or portion of
sequence comprising sequence represented by GenBank Accession Nos.
shown in Table I. Chemical modifications in Tables III and IV and
described herein can be applied to any siNA construct of the
invention.
[0031] In one embodiment of the invention an siNA molecule
comprises an antisense strand having about 15 to about 30 (e.g.,
about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
or 30) nucleotides, wherein the antisense strand is complementary
to a RNA sequence or a portion thereof encoding an ICAM protein,
and wherein said siNA further comprises a sense strand having about
15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, or 30) nucleotides, and wherein said sense
strand and said antisense strand are distinct nucleotide sequences
where at least about 15 nucleotides in each strand are
complementary to the other strand.
[0032] In another embodiment of the invention an siNA molecule of
the invention comprises an antisense region having about 15 to
about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, or 30) nucleotides, wherein the antisense region is
complementary to a RNA sequence encoding an ICAM protein, and
wherein said siNA further comprises a sense region having about 15
to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, or 30) nucleotides, wherein said sense region
and said antisense region are comprised in a linear molecule where
the sense region comprises at least about 15 nucleotides that are
complementary to the antisense region.
[0033] In one embodiment, an siNA molecule of the invention has
RNAi activity that modulates expression of RNA encoded by an ICAM
gene. Because ICAM (e.g., ICAM superfamily) genes can share some
degree of sequence homology with each other, siNA molecules can be
designed to target a class of ICAM genes or alternately specific
ICAM genes (e.g., polymorphic variants) by selecting sequences that
are either shared amongst different ICAM targets or alternatively
that are unique for a specific ICAM target. Therefore, in one
embodiment, the siNA molecule can be designed to target conserved
regions of ICAM RNA sequences having homology among several ICAM
gene variants so as to target a class of ICAM genes with one siNA
molecule. Accordingly, in one embodiment, the siNA molecule of the
invention modulates the expression of one or both ICAM alleles in a
subject. In another embodiment, the siNA molecule can be designed
to target a sequence that is unique to a specific ICAM RNA sequence
(e.g., a single ICAM allele or ICAM single nucleotide polymorphism
(SNP)) due to the high degree of specificity that the siNA molecule
requires to mediate RNAi activity.
[0034] In one embodiment, nucleic acid molecules of the invention
that act as mediators of the RNA interference gene silencing
response are double-stranded nucleic acid molecules. In another
embodiment, the siNA molecules of the invention consist of duplex
nucleic acid molecules containing about 15 to about 30 base pairs
between oligonucleotides comprising about 15 to about 30 (e.g.,
about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
or 30) nucleotides. In yet another embodiment, siNA molecules of
the invention comprise duplex nucleic acid molecules with
overhanging ends of about 1 to about 3 (e.g., about 1, 2, or 3)
nucleotides, for example, about 21-nucleotide duplexes with about
19 base pairs and 3'-terminal mononucleotide, dinucleotide, or
trinucleotide overhangs. In yet another embodiment, siNA molecules
of the invention comprise duplex nucleic acid molecules with blunt
ends, where both ends are blunt, or alternatively, where one of the
ends is blunt.
[0035] In one embodiment, the invention features one or more
chemically modified siNA constructs having specificity for ICAM
expressing nucleic acid molecules, such as RNA encoding an ICAM
protein. In one embodiment, the invention features a RNA based siNA
molecule (e.g., an siNA comprising 2'-OH nucleotides) having
specificity for ICAM expressing nucleic acid molecules that
includes one or more chemical modifications described herein.
Non-limiting examples of such chemical modifications include
without limitation phosphorothioate internucleotide linkages,
2'-deoxyribonucleotides, 2'-O-methyl ribonucleotides,
2'-deoxy-2'-fluoro ribonucleotides, "universal base" nucleotides,
"acyclic" nucleotides, 5-C-methyl nucleotides, and terminal
glyceryl and/or inverted deoxy abasic residue incorporation. These
chemical modifications, when used in various siNA constructs,
(e.g., RNA based siNA constructs), are shown to preserve RNAi
activity in cells while at the same time, dramatically increasing
the serum stability of these compounds. Furthermore, contrary to
the data published by Parrish et al., supra, applicant demonstrates
that multiple (greater than one) phosphorothioate substitutions are
well-tolerated and confer substantial increases in serum stability
for modified siNA constructs.
[0036] In one embodiment, an siNA molecule of the invention
comprises modified nucleotides while maintaining the ability to
mediate RNAi. The modified nucleotides can be used to improve in
vitro or in vivo characteristics such as stability, activity,
and/or bioavailability. For example, an siNA molecule of the
invention can comprise modified nucleotides as a percentage of the
total number of nucleotides present in the siNA molecule. As such,
an siNA molecule of the invention can generally comprise about 5%
to about 100% modified nucleotides (e.g., about 5%, 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 95% or 100% modified nucleotides). The actual percentage of
modified nucleotides present in a given siNA molecule will depend
on the total number of nucleotides present in the siNA. If the siNA
molecule is single-stranded, the percent modification can be based
upon the total number of nucleotides present in the single-stranded
siNA molecules. Likewise, if the siNA molecule is double-stranded,
the percent modification can be based upon the total number of
nucleotides present in the sense strand, antisense strand, or both
the sense and antisense strands.
[0037] One aspect of the invention features a double-stranded short
interfering nucleic acid (siNA) molecule that down-regulates
expression of an ICAM gene. In one embodiment, the double-stranded
siNA molecule comprises one or more chemical modifications and each
strand of the double-stranded siNA is about 21 nucleotides long. In
one embodiment, the double-stranded siNA molecule does not contain
any ribonucleotides. In another embodiment, the double-stranded
siNA molecule comprises one or more ribonucleotides. In one
embodiment, each strand of the double-stranded siNA molecule
independently comprises about 15 to about 30 (e.g., about 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30)
nucleotides, wherein each strand comprises about 15 to about 30
(e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, or 30) nucleotides that are complementary to the
nucleotides of the other strand. In one embodiment, one of the
strands of the double-stranded siNA molecule comprises a nucleotide
sequence that is complementary to a nucleotide sequence or a
portion thereof of the ICAM gene, and the second strand of the
double-stranded siNA molecule comprises a nucleotide sequence
substantially similar to the nucleotide sequence of the ICAM gene
or a portion thereof.
[0038] In another embodiment, the invention features a
double-stranded short interfering nucleic acid (siNA) molecule that
down-regulates expression of an ICAM gene comprising an antisense
region, wherein the antisense region comprises a nucleotide
sequence that is complementary to a nucleotide sequence of the ICAM
gene or a portion thereof, and a sense region, wherein the sense
region comprises a nucleotide sequence substantially similar to the
nucleotide sequence of the ICAM gene or a portion thereof. In one
embodiment, the antisense region and the sense region independently
comprise about 15 to about 30 (e.g. about 15, 16; 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, wherein the
antisense region comprises about 15 to about 30 (e.g. about 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30)
nucleotides that are complementary to nucleotides of the sense
region.
[0039] In another embodiment, the invention features a
double-stranded short interfering nucleic acid (siNA) molecule that
down-regulates expression of an ICAM gene comprising a sense region
and an antisense region, wherein the antisense region comprises a
nucleotide sequence that is complementary to a nucleotide sequence
of RNA encoded by the ICAM gene or a portion thereof and the sense
region comprises a nucleotide sequence that is complementary to the
antisense region.
[0040] In one embodiment, an siNA molecule of the invention
comprises blunt ends, i.e., ends that do not include any
overhanging nucleotides. For example, an siNA molecule comprising
modifications described herein (e.g., comprising nucleotides having
Formulae I-VII or siNA constructs comprising "Stab 00"-"Stab 32".
(Table IV) or any combination thereof (see Table IV)) and/or any
length described herein can comprise blunt ends or ends with no
overhanging nucleotides.
[0041] In one embodiment, any siNA molecule of the invention can
comprise one or more blunt ends, i.e. where a blunt end does not
have any overhanging nucleotides. In one embodiment, the blunt
ended siNA molecule has a number of base pairs equal to the number
of nucleotides present in each strand of the siNA molecule. In
another embodiment, the siNA molecule comprises one blunt end, for
example wherein the 5'-end of the antisense strand and the 3'-end
of the sense strand do not have any overhanging nucleotides. In
another example, the siNA molecule comprises one blunt end, for
example wherein the 3'-end of the antisense strand and the 5'-end
of the sense strand do not have any overhanging nucleotides. In
another example, an siNA molecule comprises two blunt ends, for
example wherein the 3'-end of the antisense strand and the 5'-end
of the sense strand as well as the 5'-end of the antisense strand
and 3'-end of the sense strand do not have any overhanging
nucleotides. A blunt ended siNA molecule can comprise, for example,
from about 15 to about 30 nucleotides (e.g., about 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides).
Other nucleotides present in a blunt ended siNA molecule can
comprise, for example, mismatches, bulges, loops, or wobble base
pairs to modulate the activity of the siNA molecule to mediate RNA
interference.
[0042] By "blunt ends" is meant symmetric termini or termini of a
double-stranded siNA molecule having no overhanging nucleotides.
The two strands of a double-stranded siNA molecule align with each
other without over-hanging nucleotides at the termini. For example,
a blunt ended siNA construct comprises terminal nucleotides that
are complementary between the sense and antisense regions of the
siNA molecule.
[0043] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of an ICAM gene, wherein the siNA molecule is assembled
from two separate oligonucleotide fragments wherein one fragment
comprises the sense region and the second fragment comprises the
antisense region of the siNA molecule. The sense region can be
connected to the antisense region via a linker molecule, such as a
polynucleotide linker or a non-nucleotide linker.
[0044] In one embodiment, the invention features double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of an ICAM gene, wherein the siNA molecule comprises
about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, or 30) base pairs, and wherein each
strand of the siNA molecule comprises one or more chemical
modifications. In another embodiment, one of the strands of the
double-stranded siNA molecule comprises a nucleotide sequence that
is complementary to a nucleotide sequence of an ICAM gene or a
portion thereof, and the second strand of the double-stranded siNA
molecule comprises a nucleotide sequence substantially similar to
the nucleotide sequence or a portion thereof of the ICAM gene. In
another embodiment, one of the strands of the double-stranded siNA
molecule comprises a nucleotide sequence that is complementary to a
nucleotide sequence of an ICAM gene or portion thereof, and the
second strand of the double-stranded siNA molecule comprises a
nucleotide sequence substantially similar to the nucleotide
sequence or portion thereof of the ICAM gene. In another
embodiment, each strand of the siNA molecule comprises about 15 to
about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, or 30) nucleotides, and each strand comprises at
least about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides that are
complementary to the nucleotides of the other strand. The ICAM gene
can comprise, for example, sequences referred to in Table 1.
[0045] In one embodiment, an siNA molecule of the invention
comprises no ribonucleotides. In another embodiment, an siNA
molecule of the invention comprises ribonucleotides.
[0046] In one embodiment, an siNA molecule of the invention
comprises an antisense region comprising a nucleotide sequence that
is complementary to a nucleotide sequence of an ICAM gene or a
portion thereof, and the siNA further comprises a sense region
comprising a nucleotide sequence substantially similar to the
nucleotide sequence of the ICAM gene or a portion thereof. In
another embodiment, the antisense region and the sense region each
comprise about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides and the
antisense region comprises at least about 15 to about 30 (e.g.
about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
or 30) nucleotides that are complementary to nucleotides of the
sense region. The ICAM gene can comprise, for example, sequences
referred to in Table I. In another embodiment, the siNA is a
double-stranded nucleic acid molecule, where each of the two
strands of the siNA molecule independently comprise about 15 to
about 40 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 31, 23, 33, 34, 35, 36, 37, 38, 39, or 40)
nucleotides, and where one of the strands of the siNA molecule
comprises at least about 15 (e.g. about 15, 16, 17, 18, 19, 20, 21,
22, 23, 24 or 25 or more) nucleotides that are complementary to the
nucleic acid sequence of the ICAM gene or a portion thereof.
[0047] In one embodiment, an siNA molecule of the invention
comprises a sense region and an antisense region, wherein the
antisense region comprises a nucleotide sequence that is
complementary to a nucleotide sequence of RNA encoded by an ICAM
gene, or a portion thereof, and the sense region comprises a
nucleotide sequence that is complementary to the antisense region.
In one embodiment, the siNA molecule is assembled from two separate
oligonucleotide fragments, wherein one fragment comprises the sense
region and the second fragment comprises the antisense region of
the siNA molecule. In another embodiment, the sense region is
connected to the antisense region via a linker molecule. In another
embodiment, the sense region is connected to the antisense region
via a linker molecule, such as a nucleotide or non-nucleotide
linker. The ICAM gene can comprise, for example, sequences referred
in to Table I.
[0048] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of an ICAM gene comprising a sense region and an
antisense region, wherein the antisense region comprises a
nucleotide sequence that is complementary to a nucleotide sequence
of RNA encoded by the ICAM gene or a portion thereof and the sense
region comprises a nucleotide sequence that is complementary to the
antisense region, and wherein the siNA molecule has one or more
modified pyrimidine and/or purine nucleotides. In one embodiment,
the pyrimidine nucleotides in the sense region are
2'-O-methylpyrimidine nucleotides or 2'-deoxy-2'-fluoro pyrimidine
nucleotides and the purine nucleotides present in the sense region
are 2'-deoxy purine nucleotides. In another embodiment, the
pyrimidine nucleotides in the sense region are 2'-deoxy-2'-fluoro
pyrimidine nucleotides and the purine nucleotides present in the
sense region are 2'-O-methyl purine nucleotides. In another
embodiment, the pyrimidine nucleotides in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides and the purine
nucleotides present in the sense region are 2'-deoxy purine
nucleotides. In one embodiment, the pyrimidine nucleotides in the
antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides and
the purine nucleotides present in the antisense region are
2'-O-methyl or 2'-deoxy purine nucleotides. In another embodiment
of any of the above-described siNA molecules, any nucleotides
present in a non-complementary region of the sense strand (e.g.
overhang region) are 2'-deoxy nucleotides.
[0049] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of an ICAM gene, wherein the siNA molecule is assembled
from two separate oligonucleotide fragments wherein one fragment
comprises the sense region and the second fragment comprises the
antisense region of the siNA molecule, and wherein the fragment
comprising the sense region includes a terminal cap moiety at the
5'-end, the 3'-end, or both of the 5' and 3' ends of the fragment.
In one embodiment, the terminal cap moiety is an inverted deoxy
abasic moiety or glyceryl moiety. In one embodiment, each of the
two fragments of the siNA molecule independently comprise about 15
to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, or 30) nucleotides. In another embodiment, each of
the two fragments of the siNA molecule independently comprise about
15 to about 40 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, 30, 31, 23, 33, 34, 35, 36, 37, 38, 39, or 40)
nucleotides. In a non-limiting example, each of the two fragments
of the siNA molecule comprise about 21 nucleotides.
[0050] In one embodiment, the invention features an siNA molecule
comprising at least one modified nucleotide, wherein the modified
nucleotide is a 2'-deoxy-2'-fluoro nucleotide.
[0051] The siNA can be, for example, about 15 to about 40
nucleotides in length. In one embodiment, all pyrimidine
nucleotides present in the siNA are 2'-deoxy-2'-fluoro pyrimidine
nucleotides. In one embodiment, the modified nucleotides in the
siNA include at least one 2'-deoxy-2'-fluoro cytidine or
2'-deoxy-2'-fluoro uridine nucleotide. In another embodiment, the
modified nucleotides in the siNA include at least one
2'-deoxy-2'-fluoro cytidine and at least one 2'-deoxy-2'-fluoro
uridine nucleotides. In one embodiment, all uridine nucleotides
present in the siNA are 2'-deoxy-2'-fluoro uridine nucleotides. In
one embodiment, all cytidine nucleotides present in the siNA are
2'-deoxy-2'-fluoro cytidine nucleotides. In one embodiment, all
adenosine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
adenosine nucleotides. In one embodiment, all guanosine nucleotides
present in the siNA are 2'-deoxy-2'-fluoro guanosine nucleotides.
The siNA can further comprise at least one modified
internucleotidic linkage, such as phosphorothioate linkage. In one
embodiment, the 2'-deoxy-2'-fluoronucleotides are present at
specifically selected locations in the siNA that are sensitive to
cleavage by ribonucleases, such as locations having pyrimidine
nucleotides.
[0052] In one embodiment, the invention features a method of
increasing the stability of an siNA molecule against cleavage by
ribonucleases comprising introducing at least one modified
nucleotide into the siNA molecule, wherein the modified nucleotide
is a 2'-deoxy-2'-fluoro nucleotide. In one embodiment, all
pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
pyrimidine nucleotides. In one embodiment, the modified nucleotides
in the siNA include at least one 2'-deoxy-2'-fluoro cytidine or
2'-deoxy-2'-fluoro uridine nucleotide. In another embodiment, the
modified nucleotides in the siNA include at least one
2'-deoxy-2'-fluoro cytidine and at least one 2'-deoxy-2'-fluoro
uridine nucleotides. In one embodiment, all uridine nucleotides
present in the siNA are 2'-deoxy-2'-fluoro uridine nucleotides. In
one embodiment, all cytidine nucleotides present in the siNA are
2'-deoxy-2'-fluoro cytidine nucleotides. In one embodiment, all
adenosine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
adenosine nucleotides. In one embodiment, all guanosine nucleotides
present in the siNA are 2'-deoxy-2'-fluoro guanosine nucleotides.
The siNA can further comprise at least one modified
internucleotidic linkage, such as phosphorothioate linkage. In one
embodiment, the 2'-deoxy-2'-fluoronucleotides are present at
specifically selected locations in the siNA that are sensitive to
cleavage by ribonucleases, such as locations having pyrimidine
nucleotides.
[0053] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of an ICAM gene comprising a sense region and an
antisense region, wherein the antisense region comprises a
nucleotide sequence that is complementary to a nucleotide sequence
of RNA encoded by the ICAM gene or a portion thereof and the sense
region comprises a nucleotide sequence that is complementary to the
antisense region, and wherein the purine nucleotides present in the
antisense region comprise 2'-deoxy-purine nucleotides. In an
alternative embodiment, the purine nucleotides present in the
antisense region comprise 2'-O-methyl purine nucleotides. In either
of the above embodiments, the antisense region can comprise a
phosphorothioate internucleotide linkage at the 3' end of the
antisense region. Alternatively, in either of the above
embodiments, the antisense region can comprise a glyceryl
modification at the 3' end of the antisense region. In another
embodiment of any of the above-described siNA molecules, any
nucleotides present in a non-complementary region of the antisense
strand (e.g. overhang region) are 2'-deoxy nucleotides.
[0054] In one embodiment, the antisense region of an siNA molecule
of the invention comprises sequence complementary to a portion of
an ICAM transcript having sequence unique to a particular ICAM
disease related allele, such as sequence comprising a single
nucleotide polymorphism (SNP) associated with the disease specific
allele. As such, the antisense region of an siNA molecule of the
invention can comprise sequence complementary to sequences that are
unique to a particular allele to provide specificity in mediating
selective RNAi against the disease, condition, or trait related
allele.
[0055] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of an ICAM gene, wherein the siNA molecule is assembled
from two separate oligonucleotide fragments wherein one fragment
comprises the sense region and the second fragment comprises the
antisense region of the siNA molecule. In another embodiment, the
siNA molecule is a double-stranded nucleic acid molecule, where
each strand is about 21 nucleotides long and where about 19
nucleotides of each fragment of the siNA molecule are base-paired
to the complementary nucleotides of the other fragment of the siNA
molecule, wherein at least two 3' terminal nucleotides of each
fragment of the siNA molecule are not base-paired to the
nucleotides of the other fragment of the siNA molecule. In another
embodiment, the siNA molecule is a double-stranded nucleic acid
molecule, where each strand is about 19 nucleotide long and where
the nucleotides of each fragment of the siNA molecule are
base-paired to the complementary nucleotides of the other fragment
of the siNA molecule to form at least about 15 (e.g., 15, 16, 17,
18, or 19) base pairs, wherein one or both ends of the siNA
molecule are blunt ends. In one embodiment, each of the two 3'
terminal nucleotides of each fragment of the siNA molecule is a
2'-deoxy-pyrimidine nucleotide, such as a 2'-deoxy-thymidine. In
another embodiment, all nucleotides of each fragment of the siNA
molecule are base-paired to the complementary nucleotides of the
other fragment of the siNA molecule. In another embodiment, the
siNA molecule is a double-stranded nucleic acid molecule of about
19 to about 25 base pairs having a sense region and an antisense
region, where about 19 nucleotides of the antisense region are
base-paired to the nucleotide sequence or a portion thereof of the
RNA encoded by the ICAM gene. In another embodiment, about 21
nucleotides of the antisense region are base-paired to the
nucleotide sequence or a portion thereof of the RNA encoded by the
ICAM gene. In any of the above embodiments, the 5'-end of the
fragment comprising said antisense region can optionally include a
phosphate group.
[0056] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits the
expression of an ICAM RNA sequence (e.g., wherein said target RNA
sequence is encoded by an ICAM gene involved in the ICAM pathway),
wherein the siNA molecule does not contain any ribonucleotides and
wherein each strand of the double-stranded siNA molecule is about
15 to about 30 nucleotides. In one embodiment, the siNA molecule is
21 nucleotides in length. Examples of non-ribonucleotide containing
siNA constructs are combinations of stabilization chemistries shown
in Table IV in any combination of Sense/Antisense chemistries, such
as Stab 7/8, Stab 7/11, Stab 8/8, Stab 18/8, Stab 18/11, Stab
12/13, Stab 7/13, Stab 18/13, Stab 7/19, Stab 8/19, Stab 18/19,
Stab 7/20, Stab 8/20, Stab 18/20, Stab 7/32, Stab 8/32, or Stab
18/32 (e.g., any siNA having Stab 7, 8, 11, 12, 13, 14, 15, 17, 18,
19, 20, or 32 sense or antisense strands or any combination
thereof).
[0057] In one embodiment, the invention features a chemically
synthesized double-stranded RNA molecule that directs cleavage of
an ICAM RNA via RNA interference, wherein each strand of said RNA
molecule is about 15 to about 30 nucleotides in length; one strand
of the RNA molecule comprises nucleotide sequence having sufficient
complementarity to the ICAM RNA for the RNA molecule to direct
cleavage of the ICAM RNA via RNA interference; and wherein at least
one strand of the RNA molecule optionally comprises one or more
chemically modified nucleotides described herein, such as without
limitation deoxynucleotides, 2'-O-methyl nucleotides,
2'-deoxy-2'-fluoro nucleotides, 2'-O-methoxyethyl nucleotides
etc.
[0058] In one embodiment, the invention features a medicament
comprising an siNA molecule of the invention.
[0059] In one embodiment, the invention features an active
ingredient comprising an siNA molecule of the invention.
[0060] In one embodiment, the invention features the use of a
double-stranded short interfering nucleic acid (siNA) molecule to
inhibit, down-regulate, or reduce expression of an ICAM gene,
wherein the siNA molecule comprises one or more chemical
modifications and each strand of the double-stranded siNA is
independently about 15 to about 30 or more (e.g., about 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 or more)
nucleotides long. In one embodiment, the siNA molecule of the
invention is a double-stranded nucleic acid molecule comprising one
or more chemical modifications, where each of the two fragments of
the siNA molecule independently comprise about 15 to about 40 (e.g.
about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 23, 33, 34, 35, 36, 37, 38, 39, or 40) nucleotides and
where one of the strands comprises at least 15 nucleotides that are
complementary to nucleotide sequence of ICAM encoding RNA or a
portion thereof. In a non-limiting example, each of the two
fragments of the siNA molecule comprise about 21 nucleotides. In
another embodiment, the siNA molecule is a double-stranded nucleic
acid molecule comprising one or more chemical modifications, where
each strand is about 21 nucleotide long and where about 19
nucleotides of each fragment of the siNA molecule are base-paired
to the complementary nucleotides of the other fragment of the siNA
molecule, wherein at least two 3' terminal nucleotides of each
fragment of the siNA molecule are not base-paired to the
nucleotides of the other fragment of the siNA molecule. In another
embodiment, the siNA molecule is a double-stranded nucleic acid
molecule comprising one or more chemical modifications, where each
strand is about 19 nucleotide long and where the nucleotides of
each fragment of the siNA molecule are base-paired to the
complementary nucleotides of the other fragment of the siNA
molecule to form at least about 15 (e.g., 15, 16, 17, 18, or 19)
base pairs, wherein one or both ends of the siNA molecule are blunt
ends. In one embodiment, each of the two 3' terminal nucleotides of
each fragment of the siNA molecule is a 2'-deoxy-pyrimidine
nucleotide, such as a 2'-deoxy-thymidine. In another embodiment,
all nucleotides of each fragment of the siNA molecule are
base-paired to the complementary nucleotides of the other fragment
of the siNA molecule. In another embodiment, the siNA molecule is a
double-stranded nucleic acid molecule of about 19 to about 25 base
pairs having a sense region and an antisense region and comprising
one or more chemical modifications, where about 19 nucleotides of
the antisense region are base-paired to the nucleotide sequence or
a portion thereof of the RNA encoded by the ICAM gene. In another
embodiment, about 21 nucleotides of the antisense region are
base-paired to the nucleotide sequence or a portion thereof of the
RNA encoded by the ICAM gene. In any of the above embodiments, the
5'-end of the fragment comprising said antisense region can
optionally include a phosphate group.
[0061] In one embodiment, the invention features the use of a
double-stranded short interfering nucleic acid (siNA) molecule that
inhibits, down-regulates, or reduces expression of an ICAM gene,
wherein one of the strands of the double-stranded siNA molecule is
an antisense strand which comprises nucleotide sequence that is
complementary to nucleotide sequence of ICAM RNA or a portion
thereof, the other strand is a sense strand which comprises
nucleotide sequence that is complementary to a nucleotide sequence
of the antisense strand and wherein a majority of the pyrimidine
nucleotides present in the double-stranded siNA molecule comprises
a sugar modification.
[0062] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits,
down-regulates, or reduces expression of an ICAM gene, wherein one
of the strands of the double-stranded siNA molecule is an antisense
strand which comprises nucleotide sequence that is complementary to
nucleotide sequence of ICAM RNA or a portion thereof, wherein the
other strand is a sense strand which comprises nucleotide sequence
that is complementary to a nucleotide sequence of the antisense
strand and wherein a majority of the pyrimidine nucleotides present
in the double-stranded siNA molecule comprises a sugar
modification.
[0063] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits,
down-regulates, or reduces expression of an ICAM gene, wherein one
of the strands of the double-stranded siNA molecule is an antisense
strand which comprises nucleotide sequence that is complementary to
nucleotide sequence of ICAM RNA that encodes a protein or portion
thereof, the other strand is a sense strand which comprises
nucleotide sequence that is complementary to a nucleotide sequence
of the antisense strand and wherein a majority of the pyrimidine
nucleotides present in the double-stranded siNA molecule comprises
a sugar modification. In one embodiment, each strand of the siNA
molecule comprises about 15 to about 30 or more (e.g., about 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or
more) nucleotides, wherein each strand comprises at least about 15
nucleotides that are complementary to the nucleotides of the other
strand. In one embodiment, the siNA molecule is assembled from two
oligonucleotide fragments, wherein one fragment comprises the
nucleotide sequence of the antisense strand of the siNA molecule
and a second fragment comprises nucleotide sequence of the sense
region of the siNA molecule. In one embodiment, the sense strand is
connected to the antisense strand via a linker molecule, such as a
polynucleotide linker or a non-nucleotide linker. In a further
embodiment, the pyrimidine nucleotides present in the sense strand
are 2'-deoxy-2'fluoro pyrimidine nucleotides and the purine
nucleotides present in the sense region are 2'-deoxy purine
nucleotides. In another embodiment, the pyrimidine nucleotides
present in the sense strand are 2'-deoxy-2'fluoro pyrimidine
nucleotides and the purine nucleotides present in the sense region
are 2'-O-methyl purine nucleotides. In still another embodiment,
the pyrimidine nucleotides present in the antisense strand are
2'-deoxy-2'-fluoro pyrimidine nucleotides and any purine
nucleotides present in the antisense strand are 2'-deoxy purine
nucleotides. In another embodiment, the antisense strand comprises
one or more 2'-deoxy-2'-fluoro pyrimidine nucleotides and one or
more 2'-O-methyl purine nucleotides. In another embodiment, the
pyrimidine nucleotides present in the antisense strand are
2'-deoxy-2'-fluoro pyrimidine nucleotides and any purine
nucleotides present in the antisense strand are 2'-O-methyl purine
nucleotides. In a further embodiment the sense strand comprises a
3'-end and a 5'-end, wherein a terminal cap moiety (e.g., an
inverted deoxy abasic moiety or inverted deoxy nucleotide moiety
such as inverted thymidine) is present at the 5'-end, the 3'-end,
or both of the 5' and 3' ends of the sense strand. In another
embodiment, the antisense strand comprises a phosphorothioate
internucleotide linkage at the 3' end of the antisense strand. In
another embodiment, the antisense strand comprises a glyceryl
modification at the 3' end. In another embodiment, the 5'-end of
the antisense strand optionally includes a phosphate group.
[0064] In any of the above-described embodiments of a
double-stranded short interfering nucleic acid (siNA) molecule that
inhibits expression of a ICAM gene, wherein a majority of the
pyrimidine nucleotides present in the double-stranded siNA molecule
comprises a sugar modification, each of the two strands of the siNA
molecule can comprise about 15 to about 30 or more (e.g., about 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or
more) nucleotides. In one embodiment, about 15 to about 30 or more
(e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, or 30 or more) nucleotides of each strand of the siNA
molecule are base-paired to the complementary nucleotides of the
other strand of the siNA molecule. In another embodiment, about 15
to about 30 or more (e.g., about 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, or 30 or more) nucleotides of each
strand of the siNA molecule are base-paired to the complementary
nucleotides of the other strand of the siNA molecule, wherein at
least two 3' terminal nucleotides of each strand of the siNA
molecule are not base-paired to the nucleotides of the other strand
of the siNA molecule. In another embodiment, each of the two 3'
terminal nucleotides of each fragment of the siNA molecule is a
2'-deoxy-pyrimidine, such as 2'-deoxy-thymidine. In one embodiment,
each strand of the siNA molecule is base-paired to the
complementary nucleotides of the other strand of the siNA molecule.
In one embodiment, about 15 to about 30 (e.g., about 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides
of the antisense strand are base-paired to the nucleotide sequence
of the ICAM RNA or a portion thereof. In one embodiment, about 18
to about 25 (e.g., about 18, 19, 20, 21, 22, 23, 24, or 25)
nucleotides of the antisense strand are base-paired to the
nucleotide sequence of the ICAM RNA or a portion thereof.
[0065] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits
expression of a ICAM gene, wherein one of the strands of the
double-stranded siNA molecule is an antisense strand which
comprises nucleotide sequence that is complementary to nucleotide
sequence of ICAM RNA or a portion thereof, the other strand is a
sense strand which comprises nucleotide sequence that is
complementary to a nucleotide sequence of the antisense strand and
wherein a majority of the pyrimidine nucleotides present in the
double-stranded siNA molecule comprises a sugar modification, and
wherein the 5'-end of the antisense strand optionally includes a
phosphate group.
[0066] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits
expression of a ICAM gene, wherein one of the strands of the
double-stranded siNA molecule is an antisense strand which
comprises nucleotide sequence that is complementary to nucleotide
sequence of ICAM RNA or a portion thereof, the other strand is a
sense strand which comprises nucleotide sequence that is
complementary to a nucleotide sequence of the antisense strand and
wherein a majority of the pyrimidine nucleotides present in the
double-stranded siNA molecule comprises a sugar modification, and
wherein the nucleotide sequence or a portion thereof of the
antisense strand is complementary to a nucleotide sequence of the
untranslated region or a portion thereof of the ICAM RNA.
[0067] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits
expression of a ICAM gene, wherein one of the strands of the
double-stranded siNA molecule is an antisense strand which
comprises nucleotide sequence that is complementary to nucleotide
sequence of ICAM RNA or a portion thereof, wherein the other strand
is a sense strand which comprises nucleotide sequence that is
complementary to a nucleotide sequence of the antisense strand,
wherein a majority of the pyrimidine nucleotides present in the
double-stranded siNA molecule comprises a sugar modification, and
wherein the nucleotide sequence of the antisense strand is
complementary to a nucleotide sequence of the ICAM RNA or a portion
thereof that is present in the ICAM RNA.
[0068] In one embodiment, the invention features a composition
comprising an siNA molecule of the invention in a pharmaceutically
acceptable carrier or diluent.
[0069] In a non-limiting example, the introduction of chemically
modified nucleotides into nucleic acid molecules provides a
powerful tool in overcoming potential limitations of in vivo
stability and bioavailability inherent to native RNA molecules that
are delivered exogenously. For example, the use of chemically
modified nucleic acid molecules can enable a lower dose of a
particular nucleic acid molecule for a given therapeutic effect
since chemically modified nucleic acid molecules tend to have a
longer half-life in serum. Furthermore, certain chemical
modifications can improve the bioavailability of nucleic acid
molecules by targeting particular cells or tissues and/or improving
cellular uptake of the nucleic acid molecule. Therefore, even if
the activity of a chemically modified nucleic acid molecule is
reduced as compared to a native nucleic acid molecule, for example,
when compared to an all-RNA nucleic acid molecule, the overall
activity of the modified nucleic acid molecule can be greater than
that of the native molecule due to improved stability and/or
delivery of the molecule. Unlike native unmodified siNA, chemically
modified siNA can also minimize the possibility of activating
interferon activity in humans.
[0070] In any of the embodiments of siNA molecules described
herein, the antisense region of an siNA molecule of the invention
can comprise a phosphorothioate internucleotide linkage at the
3'-end of said antisense region. In any of the embodiments of siNA
molecules described herein, the antisense region can comprise about
one to about five phosphorothioate internucleotide linkages at the
5'-end of said antisense region. In any of the embodiments of siNA
molecules described herein, the 3'-terminal nucleotide overhangs of
an siNA molecule of the invention can comprise ribonucleotides or
deoxyribonucleotides that are chemically modified at a nucleic acid
sugar, base, or backbone. In any of the embodiments of siNA
molecules described herein, the 3'-terminal nucleotide overhangs
can comprise one or more universal base ribonucleotides. In any of
the embodiments of siNA molecules described herein, the 3'-terminal
nucleotide overhangs can comprise one or more acyclic
nucleotides.
[0071] One embodiment of the invention provides an expression
vector comprising a nucleic acid sequence encoding at least one
siNA molecule of the invention in a manner that allows expression
of the nucleic acid molecule. Another embodiment of the invention
provides a mammalian cell comprising such an expression vector. The
mammalian cell can be a human cell. The siNA molecule of the
expression vector can comprise a sense region and an antisense
region. The antisense region can comprise sequence complementary to
a RNA or DNA sequence encoding ICAM and the sense region can
comprise sequence complementary to the antisense region. The siNA
molecule can comprise two distinct strands having complementary
sense and antisense regions. The siNA molecule can comprise a
single strand having complementary sense and antisense regions.
[0072] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule capable of
mediating RNA interference (RNAi) against ICAM inside a cell or
reconstituted in vitro system, wherein the chemical modification
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) nucleotides comprising a backbone modified internucleotide
linkage having Formula I:
##STR00001##
wherein each R1 and R2 is independently any nucleotide,
non-nucleotide, or polynucleotide which can be naturally-occurring
or chemically modified, each X and Y is independently O, S, N,
alkyl, or substituted alkyl, each Z and W is independently O, S, N,
alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, aralkyl, or
acetyl and wherein W, X, Y, and Z are optionally not all O. In
another embodiment, a backbone modification of the invention
comprises a phosphonoacetate and/or thiophosphonoacetate
internucleotide linkage (see for example Sheehan et al., 2003,
Nucleic Acids Research, 31, 4109-4118).
[0073] The chemically modified internucleotide linkages having
Formula I, for example, wherein any Z, W, X, and/or Y independently
comprises a sulphur atom, can be present in one or both
oligonucleotide strands of the siNA duplex, for example, in the
sense strand, the antisense strand, or both strands. The siNA
molecules of the invention can comprise one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, or more) chemically modified
internucleotide linkages having Formula I at the 3'-end, the
5'-end, or both of the 3' and 5'-ends of the sense strand, the
antisense strand, or both strands. For example, an exemplary siNA
molecule of the invention can comprise about 1 to about 5 or more
(e.g., about 1, 2, 3, 4, 5, or more) chemically modified
internucleotide linkages having Formula I at the 5'-end of the
sense strand, the antisense strand, or both strands. In another
non-limiting example, an exemplary siNA molecule of the invention
can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, or more) pyrimidine nucleotides with chemically modified
internucleotide linkages having Formula I in the sense strand, the
antisense strand, or both strands. In yet another non-limiting
example, an exemplary siNA molecule of the invention can comprise
one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more)
purine nucleotides with chemically modified internucleotide
linkages having Formula I in the sense strand, the antisense
strand, or both strands. In another embodiment, an siNA molecule of
the invention having internucleotide linkage(s) of Formula I also
comprises a chemically modified nucleotide or non-nucleotide having
any of Formulae I-VII.
[0074] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule capable of
mediating RNA interference (RNAi) against ICAM inside a cell or
reconstituted in vitro system, wherein the chemical modification
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) nucleotides or non-nucleotides having Formula II:
##STR00002##
wherein each R3, R4, R5, R6, R7, R8, R10, R11 and R12 is
independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl,
F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-5-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, or group having Formula I or II;
R9 is O, S, CH2, S.dbd.O, CHF, or CF2, and B is a nucleosidic base
such as adenine, guanine, uracil, cytosine, thymine,
2-aminoadenosine, 5-methylcytosine, 2,6-diaminopurine, or any other
non-naturally occurring base that can be complementary or
non-complementary to target RNA or a non-nucleosidic base such as
phenyl, naphthyl, 3-nitropyrrole, 5-nitroindole, nebularine,
pyridone, pyridinone, or any other non-naturally occurring
universal base that can be complementary or non-complementary to
target RNA.
[0075] The chemically modified nucleotide or non-nucleotide of
Formula II can be present in one or both oligonucleotide strands of
the siNA duplex, for example in the sense strand, the antisense
strand, or both strands. The siNA molecules of the invention can
comprise one or more chemically modified nucleotides or
non-nucleotides of Formula II at the 3'-end, the 5'-end, or both of
the 3' and 5'-ends of the sense strand, the antisense strand, or
both strands. For example, an exemplary siNA molecule of the
invention can comprise about 1 to about 5 or more (e.g., about 1,
2, 3, 4, 5, or more) chemically modified nucleotides or
non-nucleotides of Formula II at the 5'-end of the sense strand,
the antisense strand, or both strands. In another non-limiting
example, an exemplary siNA molecule of the invention can comprise
about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more)
chemically modified nucleotides or non-nucleotides of Formula II at
the 3'-end of the sense strand, the antisense strand, or both
strands.
[0076] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule capable of
mediating RNA interference (RNAi) against ICAM inside a cell or
reconstituted in vitro system, wherein the chemical modification
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) nucleotides or non-nucleotides having Formula III:
##STR00003##
wherein each R3, R4, R5, R6, R7, R8, R10, R11 and R12 is
independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl,
F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-5-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, or group having Formula I or II;
R9 is O, S, CH2, S.dbd.O, CHF, or CF2, and B is a nucleosidic base
such as adenine, guanine, uracil, cytosine, thymine,
2-aminoadenosine, 5-methylcytosine, 2,6-diaminopurine, or any other
non-naturally occurring base that can be employed to be
complementary or non-complementary to target RNA or a
non-nucleosidic base such as phenyl, naphthyl, 3-nitropyrrole,
5-nitroindole, nebularine, pyridone, pyridinone, or any other
non-naturally occurring universal base that can be complementary or
non-complementary to target RNA.
[0077] The chemically modified nucleotide or non-nucleotide of
Formula III can be present in one or both oligonucleotide strands
of the siNA duplex, for example, in the sense strand, the antisense
strand, or both strands. The siNA molecules of the invention can
comprise one or more chemically modified nucleotides or
non-nucleotides of Formula III at the 3'-end, the 5'-end, or both
of the 3' and 5'-ends of the sense strand, the antisense strand, or
both strands. For example, an exemplary siNA molecule of the
invention can comprise about 1 to about 5 or more (e.g., about 1,
2, 3, 4, 5, or more) chemically modified nucleotide(s) or
non-nucleotide(s) of Formula III at the 5'-end of the sense strand,
the antisense strand, or both strands. In another non-limiting
example, an exemplary siNA molecule of the invention can comprise
about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more)
chemically modified nucleotide or non-nucleotide of Formula III at
the 3'-end of the sense strand, the antisense strand, or both
strands.
[0078] In another embodiment, an siNA molecule of the invention
comprises a nucleotide having Formula II or III, wherein the
nucleotide having Formula II or III is in an inverted
configuration. For example, the nucleotide having Formula II or III
is connected to the siNA construct in a 3'-3',3'-2',2'-3', or 5'-5'
configuration, such as at the 3'-end, the 5'-end, or both of the 3'
and 5'-ends of one or both siNA strands.
[0079] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule capable of
mediating RNA interference (RNAi) against ICAM inside a cell or
reconstituted in vitro system, wherein the chemical modification
comprises a 5'-terminal phosphate group having Formula IV:
##STR00004##
wherein each X and Y is independently O, S, N, alkyl, substituted
alkyl, or alkylhalo; wherein each Z and W is independently O, S, N,
alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, aralkyl,
alkylhalo, or acetyl; and wherein W, X, Y and Z are not all O.
[0080] In one embodiment, the invention features an siNA molecule
having a 5'-terminal phosphate group having Formula IV on the
target-complementary strand, for example, a strand complementary to
a target RNA, wherein the siNA molecule comprises an all RNA siNA
molecule. In another embodiment, the invention features an siNA
molecule having a 5'-terminal phosphate group having Formula IV on
the target-complementary strand wherein the siNA molecule also
comprises about 1 to about 3 (e.g., about 1, 2, or 3) nucleotide
3'-terminal nucleotide overhangs having about 1 to about 4 (e.g.,
about 1, 2, 3, or 4) deoxyribonucleotides on the 3'-end of one or
both strands. In another embodiment, a 5'-terminal phosphate group
having Formula IV is present on the target-complementary strand of
an siNA molecule of the invention, for example an siNA molecule
having chemical modifications having any of Formulae I-VII.
[0081] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule capable of
mediating RNA interference (RNAi) against ICAM inside a cell or
reconstituted in vitro system, wherein the chemical modification
comprises one or more phosphorothioate internucleotide linkages.
For example, in a non-limiting example, the invention features a
chemically modified short interfering nucleic acid (siNA) having
about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate
internucleotide linkages in one siNA strand. In yet another
embodiment, the invention features a chemically modified short
interfering nucleic acid (siNA) individually having about 1, 2, 3,
4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages in
both siNA strands. The phosphorothioate internucleotide linkages
can be present in one or both oligonucleotide strands of the siNA
duplex, for example in the sense strand, the antisense strand, or
both strands. The siNA molecules of the invention can comprise one
or more phosphorothioate internucleotide linkages at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the sense strand, the
antisense strand, or both strands. For example, an exemplary siNA
molecule of the invention can comprise about 1 to about 5 or more
(e.g., about 1, 2, 3, 4, 5, or more) consecutive phosphorothioate
internucleotide linkages at the 5'-end of the sense strand, the
antisense strand, or both strands. In another non-limiting example,
an exemplary siNA molecule of the invention can comprise one or
more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more)
pyrimidine phosphorothioate internucleotide linkages in the sense
strand, the antisense strand, or both strands. In yet another
non-limiting example, an exemplary siNA molecule of the invention
can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, or more) purine phosphorothioate internucleotide linkages in
the sense strand, the antisense strand, or both strands.
[0082] In one embodiment, the invention features an siNA molecule,
wherein the sense strand comprises one or more, for example, about
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate
internucleotide linkages, and/or one or more (e.g., about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl,
2'-deoxy-2'-fluoro, and/or about one or more (e.g., about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides,
and optionally a terminal cap molecule at the 3'-end, the 5'-end,
or both of the 3'- and 5'-ends of the sense strand; and wherein the
antisense strand comprises about 1 to about 10 or more,
specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more
phosphorothioate internucleotide linkages, and/or one or more
(e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy,
2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified
nucleotides, and optionally a terminal cap molecule at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the antisense strand.
In another embodiment, one or more, for example about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense
and/or antisense siNA strand are chemically modified with 2'-deoxy,
2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without
one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more, phosphorothioate internucleotide linkages and/or a terminal
cap molecule at the 3'-end, the 5'-end, or both of the 3'- and
5'-ends, being present in the same or different strand.
[0083] In another embodiment, the invention features an siNA
molecule, wherein the sense strand comprises about 1 to about 5,
specifically about 1, 2, 3, 4, or 5 phosphorothioate
internucleotide linkages, and/or one or more (e.g., about 1, 2, 3,
4, 5, or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and/or
one or more (e.g., about 1, 2, 3, 4, 5, or more) universal base
modified nucleotides, and optionally a terminal cap molecule at the
3-end, the 5'-end, or both of the 3'- and 5'-ends of the sense
strand; and wherein the antisense strand comprises about 1 to about
5 or more, specifically about 1, 2, 3, 4, 5, or more
phosphorothioate internucleotide linkages, and/or one or more
(e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy,
2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified
nucleotides, and optionally a terminal cap molecule at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the antisense strand.
In another embodiment, one or more, for example about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense
and/or antisense siNA strand are chemically modified with 2'-deoxy,
2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without
about 1 to about 5 or more, for example about 1, 2, 3, 4, 5, or
more phosphorothioate internucleotide linkages and/or a terminal
cap molecule at the 3'-end, the 5'-end, or both of the 3'- and
5'-ends, being present in the same or different strand.
[0084] In one embodiment, the invention features an siNA molecule,
wherein the antisense strand comprises one or more, for example,
about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate
internucleotide linkages, and/or about one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl,
2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5,
6, 7, 8, 9, 10 or more) universal base modified nucleotides, and
optionally a terminal cap molecule at the 3'-end, the 5'-end, or
both of the 3'- and 5'-ends of the sense strand; and wherein the
antisense strand comprises about 1 to about 10 or more,
specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more
phosphorothioate internucleotide linkages, and/or one or more
(e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy,
2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified
nucleotides, and optionally a terminal cap molecule at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the antisense strand.
In another embodiment, one or more, for example about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense
and/or antisense siNA strand are chemically modified with 2'-deoxy,
2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without
one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or
more phosphorothioate internucleotide linkages and/or a terminal
cap molecule at the 3'-end, the 5'-end, or both of the 3' and
5'-ends, being present in the same or different strand.
[0085] In another embodiment, the invention features an siNA
molecule, wherein the antisense strand comprises about 1 to about 5
or more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate
internucleotide linkages, and/or one or more (e.g., about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl,
2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5,
6, 7, 8, 9, 10 or more) universal base modified nucleotides, and
optionally a terminal cap molecule at the 3'-end, the 5'-end, or
both of the 3'- and 5'-ends of the sense strand; and wherein the
antisense strand comprises about 1 to about 5 or more, specifically
about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide
linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8,
9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and/or
one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more)
universal base modified nucleotides, and optionally a terminal cap
molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends
of the antisense strand. In another embodiment, one or more, for
example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine
nucleotides of the sense and/or antisense siNA strand are
chemically modified with 2'-deoxy, 2'-O-methyl and/or
2'-deoxy-2'-fluoro nucleotides, with or without about 1 to about 5,
for example about 1, 2, 3, 4, 5 or more phosphorothioate
internucleotide linkages and/or a terminal cap molecule at the
3'-end, the 5'-end, or both of the 3'- and 5'-ends, being present
in the same or different strand.
[0086] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule having
about 1 to about 5 or more (specifically about 1, 2, 3, 4, 5 or
more) phosphorothioate internucleotide linkages in each strand of
the siNA molecule.
[0087] In another embodiment, the invention features an siNA
molecule comprising 2'-5' internucleotide linkages. The 2'-5'
internucleotide linkage(s) can be at the 3'-end, the 5'-end, or
both of the 3'- and 5'-ends of one or both siNA sequence strands.
In addition, the 2'-5' internucleotide linkage(s) can be present at
various other positions within one or both siNA sequence strands,
for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including
every internucleotide linkage of a pyrimidine nucleotide in one or
both strands of the siNA molecule can comprise a 2'-5'
internucleotide linkage, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more including every internucleotide linkage of a purine nucleotide
in one or both strands of the siNA molecule can comprise a 2'-5'
internucleotide linkage.
[0088] In another embodiment, a chemically modified siNA molecule
of the invention comprises a duplex having two strands, one or both
of which can be chemically modified, wherein each strand is
independently about 15 to about 30 (e.g., about 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides in
length, wherein the duplex has about 15 to about 30 (e.g., about
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30)
base pairs, and wherein the chemical modification comprises a
structure having any of Formulae I-VII. For example, an exemplary
chemically modified siNA molecule of the invention comprises a
duplex having two strands, one or both of which can be chemically
modified with a chemical modification having any of Formulae I-VII
or any combination thereof, wherein each strand consists of about
21 nucleotides, each having a 2-nucleotide 3'-terminal nucleotide
overhang, and wherein the duplex has about 19 base pairs. In
another embodiment, an siNA molecule of the invention comprises a
single-stranded hairpin structure, wherein the siNA is about 36 to
about 70 (e.g., about 36, 40, 45, 50, 55, 60, 65, or 70)
nucleotides in length having about 15 to about 30 (e.g., about 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) base
pairs, and wherein the siNA can include a chemical modification
comprising a structure having any of Formulae I-VII or any
combination thereof. For example, an exemplary chemically modified
siNA molecule of the invention comprises a linear oligonucleotide
having about 42 to about 50 (e.g., about 42, 43, 44, 45, 46, 47,
48, 49, or 50) nucleotides that is chemically modified with a
chemical modification having any of Formulae I-VII or any
combination thereof, wherein the linear oligonucleotide forms a
hairpin structure having about 19 to about 21 (e.g., 19, 20, or 21)
base pairs and a 2-nucleotide 3'-terminal nucleotide overhang. In
another embodiment, a linear hairpin siNA molecule of the invention
contains a stem loop motif, wherein the loop portion of the siNA
molecule is biodegradable. For example, a linear hairpin siNA
molecule of the invention is designed such that degradation of the
loop portion of the siNA molecule in vivo can generate a
double-stranded siNA molecule with 3'-terminal overhangs, such as
3'-terminal nucleotide overhangs comprising about 2
nucleotides.
[0089] In another embodiment, an siNA molecule of the invention
comprises a hairpin structure, wherein the siNA is about 25 to
about 50 (e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,
36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50)
nucleotides in length having about 3 to about 25 (e.g., about 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, or 25) base pairs, and wherein the siNA can include one or
more chemical modifications comprising a structure having any of
Formulae I-VII or any combination thereof. For example, an
exemplary chemically modified siNA molecule of the invention
comprises a linear oligonucleotide having about 25 to about 35
(e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35)
nucleotides that is chemically modified with one or more chemical
modifications having any of Formulae I-VII or any combination
thereof, wherein the linear oligonucleotide forms a hairpin
structure having about 3 to about 25 (e.g., about 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or
25) base pairs and a 5'-terminal phosphate group that can be
chemically modified as described herein (for example a 5'-terminal
phosphate group having Formula IV). In another embodiment, a linear
hairpin siNA molecule of the invention contains a stem loop motif,
wherein the loop portion of the siNA molecule is biodegradable. In
one_embodiment, a linear hairpin siNA molecule of the invention
comprises a loop portion comprising a non-nucleotide linker.
[0090] In another embodiment, an siNA molecule of the invention
comprises an asymmetric hairpin structure, wherein the siNA is
about 25 to about 50 (e.g., about 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
or 50) nucleotides in length having about 3 to about 25 (e.g.,
about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, or 25) base pairs, and wherein the siNA can
include one or more chemical modifications comprising a structure
having any of Formulae I-VII or any combination thereof. For
example, an exemplary chemically modified siNA molecule of the
invention comprises a linear oligonucleotide having about 25 to
about 35 (e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or
35) nucleotides that is chemically modified with one or more
chemical modifications having any of Formulae I-VII or any
combination thereof, wherein the linear oligonucleotide forms an
asymmetric hairpin structure having about 3 to about 25 (e.g.,
about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, or 25) base pairs and a 5'-terminal phosphate
group that can be chemically modified as described herein (for
example a 5'-terminal phosphate group having Formula IV). In one
embodiment, an asymmetric hairpin siNA molecule of the invention
contains a stem loop motif, wherein the loop portion of the siNA
molecule is biodegradable. In another embodiment, an asymmetric
hairpin siNA molecule of the invention comprises a loop portion
comprising a non-nucleotide linker.
[0091] In another embodiment, an siNA molecule of the invention
comprises an asymmetric double-stranded structure having separate
polynucleotide strands comprising sense and antisense regions,
wherein the antisense region is about 15 to about 30 (e.g., about
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30)
nucleotides in length, wherein the sense region is about 3 to about
25 (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides in length,
wherein the sense region and the antisense region have at least 3
complementary nucleotides, and wherein the siNA can include one or
more chemical modifications comprising a structure having any of
Formulae I-VII or any combination thereof. For example, an
exemplary chemically modified siNA molecule of the invention
comprises an asymmetric double-stranded structure having separate
polynucleotide strands comprising sense and antisense regions,
wherein the antisense region is about 18 to about 23 (e.g., about
18, 19, 20, 21, 22, or 23) nucleotides in length and wherein the
sense region is about 3 to about 15 (e.g., about 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, or 15) nucleotides in length, wherein the
sense region the antisense region have at least 3 complementary
nucleotides, and wherein the siNA can include one or more chemical
modifications comprising a structure having any of Formulae I-VII
or any combination thereof. In another embodiment, the asymmetric
double-stranded siNA molecule can also have a 5'-terminal phosphate
group that can be chemically modified as described herein (for
example a 5'-terminal phosphate group having Formula IV).
[0092] In another embodiment, an siNA molecule of the invention
comprises a circular nucleic acid molecule, wherein the siNA is
about 38 to about 70 (e.g., about 38, 40, 45, 50, 55, 60, 65, or
70) nucleotides in length having about 15 to about 30 (e.g., about
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30)
base pairs, and wherein the siNA can include a chemical
modification, which comprises a structure having any of Formulae
I-VII or any combination thereof. For example, an exemplary
chemically modified siNA molecule of the invention comprises a
circular oligonucleotide having about 42 to about 50 (e.g., about
42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides that is
chemically modified with a chemical modification having any of
Formulae I-VII or any combination thereof, wherein the circular
oligonucleotide forms a dumbbell shaped structure having about 19
base pairs and 2 loops.
[0093] In another embodiment, a circular siNA molecule of the
invention contains two loop motifs, wherein one or both loop
portions of the siNA molecule is biodegradable. For example, a
circular siNA molecule of the invention is designed such that
degradation of the loop portions of the siNA molecule in vivo can
generate a double-stranded siNA molecule with 3'-terminal
overhangs, such as 3'-terminal nucleotide overhangs comprising
about 2 nucleotides.
[0094] In one embodiment, an siNA molecule of the invention
comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) abasic moiety, for example a compound having Formula
V:
##STR00005##
wherein each R3, R4, R5, R6, R7, R8, R10, R11, R12, and R13 is
independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl,
F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-5-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, or group having Formula I or II;
R9 is O, S, CH2, S.dbd.O, CHF, or CF2.
[0095] In one embodiment, an siNA molecule of the invention
comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) inverted abasic moiety, for example a compound having
Formula VI:
##STR00006##
wherein each R3, R4, R5, R6, R7, R8, R10, R11, R12, and R13 is
independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl,
F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-5-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, or group having Formula I or II;
R9 is O, S, CH2, S.dbd.O, CHF, or CF2, and either R5, R3, R8 or R13
serves as a point of attachment to the siNA molecule of the
invention.
[0096] In another embodiment, an siNA molecule of the invention
comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) substituted polyalkyl moieties, for example a compound
having Formula VII:
##STR00007##
wherein each n is independently an integer from 1 to 12, each R1,
R2 and R3 is independently H, OH, alkyl, substituted alkyl, alkaryl
or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl,
N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH,
alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH,
alkyl-5-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl,
aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, or a group having Formula I, and
R1, R2 or R3 serves as points of attachment to the siNA molecule of
the invention.
[0097] In another embodiment, the invention features a compound
having Formula VII, wherein R1 and R2 are hydroxyl (OH) groups,
n=1, and R3 comprises 0 and is the point of attachment to the
3'-end, the 5'-end, or both of the 3' and 5'-ends of one or both
strands of a double-stranded siNA molecule of the invention or to a
single-stranded siNA molecule of the invention. This modification
is referred to herein as "glyceryl" (for example modification 6 in
FIG. 10).
[0098] In another embodiment, a chemically modified nucleoside or
non-nucleoside (e.g. a moiety having any of Formula V, VI or VII)
of the invention is at the 3'-end, the 5'-end, or both of the 3'
and 5'-ends of an siNA molecule of the invention. For example,
chemically modified nucleoside or non-nucleoside (e.g., a moiety
having Formula V, VI or VII) can be present at the 3'-end, the
5'-end, or both of the 3' and 5'-ends of the antisense strand, the
sense strand, or both antisense and sense strands of the siNA
molecule. In one embodiment, the chemically modified nucleoside or
non-nucleoside (e.g., a moiety having Formula V, VI or VII) is
present at the 5'-end and 3'-end of the sense strand and the 3'-end
of the antisense strand of a double-stranded siNA molecule of the
invention. In one embodiment, the chemically modified nucleoside or
non-nucleoside (e.g., a moiety having Formula V, VI or VII) is
present at the terminal position of the 5'-end and 3'-end of the
sense strand and the 3'-end of the antisense strand of a
double-stranded siNA molecule of the invention. In one embodiment,
the chemically modified nucleoside or non-nucleoside (e.g., a
moiety having Formula V, VI or VII) is present at the two terminal
positions of the 5'-end and 3'-end of the sense strand and the
3'-end of the antisense strand of a double-stranded siNA molecule
of the invention. In one embodiment, the chemically modified
nucleoside or non-nucleoside (e.g., a moiety having Formula V, VI
or VII) is present at the penultimate position of the 5'-end and
3'-end of the sense strand and the 3'-end of the antisense strand
of a double-stranded siNA molecule of the invention. In addition, a
moiety having Formula VII can be present at the 3'-end or the
5'-end of a hairpin siNA molecule as described herein.
[0099] In another embodiment, an siNA molecule of the invention
comprises an abasic residue having Formula V or VI, wherein the
abasic residue having Formula VI or VI is connected to the siNA
construct in a 3'-3',3'-2',2'-3', or 5'-5' configuration, such as
at the 3'-end, the 5'-end, or both of the 3' and 5'-ends of one or
both siNA strands.
[0100] In one embodiment, an siNA molecule of the invention
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) locked nucleic acid (LNA) nucleotides, for example, at the
5'-end, the 3'-end, both of the 5' and 3'-ends, or any combination
thereof, of the siNA molecule.
[0101] In another embodiment, an siNA molecule of the invention
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) acyclic nucleotides, for example, at the 5'-end, the
3'-end, both of the 5' and 3'-ends, or any combination thereof, of
the siNA molecule.
[0102] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising a sense region, wherein any (e.g., one or more
or all) pyrimidine nucleotides present in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the sense
region are 2'-deoxy purine nucleotides (e.g., wherein all purine
nucleotides are 2'-deoxy purine nucleotides or alternately a
plurality of purine nucleotides are 2'-deoxy purine
nucleotides).
[0103] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising a sense region, wherein any (e.g., one or more
or all) pyrimidine nucleotides present in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the sense
region are 2'-deoxy purine nucleotides (e.g., wherein all purine
nucleotides are 2'-deoxy purine nucleotides or alternately a
plurality of purine nucleotides are 2'-deoxy purine nucleotides),
wherein any nucleotides comprising a 3'-terminal nucleotide
overhang that are present in said sense region are 2'-deoxy
nucleotides.
[0104] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising a sense region, wherein any (e.g., one or more
or all) pyrimidine nucleotides present in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the sense
region are 2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides).
[0105] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising a sense region, wherein any (e.g., one or more
or all) pyrimidine nucleotides present in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), wherein any (e.g.,
one or more or all) purine nucleotides present in the sense region
are 2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides), and wherein any nucleotides comprising a 3'-terminal
nucleotide overhang that are present in said sense region are
2'-deoxy nucleotides.
[0106] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising an antisense region, wherein any (e.g., one or
more or all) pyrimidine nucleotides present in the antisense region
are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the
antisense region are 2'-O-methyl purine nucleotides (e.g., wherein
all purine nucleotides are 2'-O-methyl purine nucleotides or
alternately a plurality of purine nucleotides are 2'-O-methyl
purine nucleotides).
[0107] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising an antisense region, wherein any (e.g., one or
more or all) pyrimidine nucleotides present in the antisense region
are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), wherein any (e.g.,
one or more or all) purine nucleotides present in the antisense
region are 2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides), and wherein any nucleotides comprising a 3'-terminal
nucleotide overhang that are present in said antisense region are
2'-deoxy nucleotides.
[0108] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising an antisense region, wherein any (e.g., one or
more or all) pyrimidine nucleotides present in the antisense region
are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the
antisense region are 2'-deoxy purine nucleotides (e.g., wherein all
purine nucleotides are 2'-deoxy purine nucleotides or alternately a
plurality of purine nucleotides are 2'-deoxy purine
nucleotides).
[0109] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising an antisense region, wherein any (e.g., one or
more or all) pyrimidine nucleotides present in the antisense region
are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the
antisense region are 2'-O-methyl purine nucleotides (e.g., wherein
all purine nucleotides are 2'-O-methyl purine nucleotides or
alternately a plurality of purine nucleotides are 2'-O-methyl
purine nucleotides).
[0110] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention capable of mediating RNA interference (RNAi) against ICAM
inside a cell or reconstituted in vitro system comprising a sense
region, wherein one or more pyrimidine nucleotides present in the
sense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g.,
wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides or alternately a plurality of pyrimidine
nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and one
or more purine nucleotides present in the sense region are 2'-deoxy
purine nucleotides (e.g., wherein all purine nucleotides are
2'-deoxy purine nucleotides or alternately a plurality of purine
nucleotides are 2'-deoxy purine nucleotides), and an antisense
region, wherein one or more pyrimidine nucleotides present in the
antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides
(e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides or alternately a plurality of pyrimidine
nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and one
or more purine nucleotides present in the antisense region are
2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides). The sense region and/or the antisense region can have
a terminal cap modification, such as any modification described
herein or shown in FIG. 10, that is optionally present at the
3'-end, the 5'-end, or both of the 3' and 5'-ends of the sense
and/or antisense sequence. The sense and/or antisense region can
optionally further comprise a 3'-terminal nucleotide overhang
having about 1 to about 4 (e.g., about 1, 2, 3, or 4)
2'-deoxynucleotides. The overhang nucleotides can further comprise
one or more (e.g., about 1, 2, 3, 4 or more) phosphorothioate,
phosphonoacetate, and/or thiophosphonoacetate internucleotide
linkages. Non-limiting examples of these chemically modified siNAs
are shown in FIGS. 4 and 5 and Tables III and IV herein. In any of
these described embodiments, the purine nucleotides present in the
sense region are alternatively 2'-O-methyl purine nucleotides
(e.g., wherein all purine nucleotides are 2'-O-methyl purine
nucleotides or alternately a plurality of purine nucleotides are
2'-O-methyl purine nucleotides) and one or more purine nucleotides
present in the antisense region are 2'-O-methyl purine nucleotides
(e.g., wherein all purine nucleotides are 2'-O-methyl purine
nucleotides or alternately a plurality of purine nucleotides are
2'-O-methyl purine nucleotides). Also, in any of these embodiments,
one or more purine nucleotides present in the sense region are
alternatively purine ribonucleotides (e.g., wherein all purine
nucleotides are purine ribonucleotides or alternately a plurality
of purine nucleotides are purine ribonucleotides) and any purine
nucleotides present in the antisense region are 2'-O-methyl purine
nucleotides (e.g., wherein all purine nucleotides are 2'-O-methyl
purine nucleotides or alternately a plurality of purine nucleotides
are 2'-O-methyl purine nucleotides). Additionally, in any of these
embodiments, one or more purine nucleotides present in the sense
region and/or present in the antisense region are alternatively
selected from the group consisting of 2'-deoxy nucleotides, locked
nucleic acid (LNA) nucleotides, 2'-methoxyethyl nucleotides,
4'-thionucleotides, and 2'-O-methyl nucleotides (e.g., wherein all
purine nucleotides are selected from the group consisting of
2'-deoxy nucleotides, locked nucleic acid (LNA) nucleotides,
2'-methoxyethyl nucleotides, 4'-thionucleotides, and 2'-O-methyl
nucleotides or alternately a plurality of purine nucleotides are
selected from the group consisting of 2'-deoxy nucleotides, locked
nucleic acid (LNA) nucleotides, 2'-methoxyethyl nucleotides,
4'-thionucleotides, and 2'-O-methyl nucleotides).
[0111] In another embodiment, any modified nucleotides present in
the siNA molecules of the invention, preferably in the antisense
strand of the siNA molecules of the invention, but also optionally
in the sense and/or both antisense and sense strands, comprise
modified nucleotides having properties or characteristics similar
to naturally occurring ribonucleotides. For example, the invention
features siNA molecules including modified nucleotides having a
Northern conformation (e.g., Northern pseudorotation cycle, see for
example Saenger, Principles of Nucleic Acid Structure,
Springer-Verlag ed., 1984). As such, chemically modified
nucleotides present in the siNA molecules of the invention,
preferably in the antisense strand of the siNA molecules of the
invention, but also optionally in the sense and/or both antisense
and sense strands, are resistant to nuclease degradation while at
the same time maintaining the capacity to mediate RNAi.
Non-limiting examples of nucleotides having a Northern
configuration include locked nucleic acid (LNA) nucleotides (e.g.,
2'-O, 4'-C-methylene-(D-ribofuranosyl) nucleotides);
2'-methoxyethoxy (MOE) nucleotides; 2'-methyl-thio-ethyl,
2'-deoxy-2'-fluoro nucleotides, 2'-deoxy-2'-chloro nucleotides,
2'-azido nucleotides, and 2'-O-methyl nucleotides.
[0112] In one embodiment, the sense strand of a double-stranded
siNA molecule of the invention comprises a terminal cap moiety,
(see for example FIG. 10) such as an inverted deoxyabasic moiety,
at the 3'-end, 5'-end, or both 3' and 5'-ends of the sense
strand.
[0113] In one embodiment, the invention features a chemically
modified short interfering nucleic acid molecule (siNA) capable of
mediating RNA interference (RNAi) against ICAM inside a cell or
reconstituted in vitro system, wherein the chemical modification
comprises a conjugate covalently attached to the chemically
modified siNA molecule. Non-limiting examples of conjugates
contemplated by the invention include conjugates and ligands
described in Vargeese et al., U.S. Ser. No. 10/427,160, filed Apr.
30, 2003, incorporated by reference herein in its entirety,
including the drawings. In another embodiment, the conjugate is
covalently attached to the chemically modified siNA molecule via a
biodegradable linker. In one embodiment, the conjugate molecule is
attached at the 3'-end of either the sense strand, the antisense
strand, or both strands of the chemically modified siNA molecule.
In another embodiment, the conjugate molecule is attached at the
5'-end of either the sense strand, the antisense strand, or both
strands of the chemically modified siNA molecule. In yet another
embodiment, the conjugate molecule is attached both the 3'-end and
5'-end of either the sense strand, the antisense strand, or both
strands of the chemically modified siNA molecule, or any
combination thereof. In one embodiment, a conjugate molecule of the
invention comprises a molecule that facilitates delivery of a
chemically modified siNA molecule into a biological system, such as
a cell. In another embodiment, the conjugate molecule attached to
the chemically modified siNA molecule is a polyethylene glycol,
human serum albumin, or a ligand for a cellular receptor that can
mediate cellular uptake. Examples of specific conjugate molecules
contemplated by the instant invention that can be attached to
chemically modified siNA molecules are described in Vargeese et
al., U.S. Ser. No. 10/201,394, filed Jul. 22, 2002 incorporated by
reference herein. The type of conjugates used and the extent of
conjugation of siNA molecules of the invention can be evaluated for
improved pharmacokinetic profiles, bioavailability, and/or
stability of siNA constructs while at the same time maintaining the
ability of the siNA to mediate RNAi activity. As such, one skilled
in the art can screen siNA constructs that are modified with
various conjugates to determine whether the siNA conjugate complex
possesses improved properties while maintaining the ability to
mediate RNAi, for example in animal models as are generally known
in the art.
[0114] In one embodiment, the invention features a short
interfering nucleic acid (siNA). molecule of the invention, wherein
the siNA further comprises a nucleotide, non-nucleotide, or mixed
nucleotide/non-nucleotide linker that joins the sense region of the
siNA to the antisense region of the siNA. In one embodiment, a
nucleotide linker of the invention can be a linker of .gtoreq.2
nucleotides in length, for example about 3, 4, 5, 6, 7, 8, 9, or 10
nucleotides in length. In another embodiment, the nucleotide linker
can be a nucleic acid aptamer. By "aptamer" or "nucleic acid
aptamer" as used herein is meant a nucleic acid molecule that binds
specifically to a target molecule wherein the nucleic acid molecule
has a sequence that comprises a sequence recognized by the target
molecule in its natural setting. Alternately, an aptamer can be a
nucleic acid molecule that binds to a target molecule where the
target molecule does not naturally bind to a nucleic acid. The
target molecule can be any molecule of interest. For example, the
aptamer can be used to bind to a ligand-binding domain of a
protein, thereby preventing interaction of the naturally occurring
ligand with the protein. This is a non-limiting example and those
in the art will recognize that other embodiments can be readily
generated using techniques generally known in the art. (See, for
example, Gold et al., 1995, Annu. Rev. Biochem., 64, 763; Brody and
Gold, 2000, J. Biotechnol., 74, 5; Sun, 2000, Curr. Opin. Mol.
Ther., 2, 100; Kusser, 2000, J. Biotechnol., 74, 27; Hermann and
Patel, 2000, Science, 287, 820; and Jayasena, 1999, Clinical
Chemistry, 45, 1628.)
[0115] In yet another embodiment, a non-nucleotide linker of the
invention comprises abasic nucleotide, polyether, polyamine,
polyamide, peptide, carbohydrate, lipid, polyhydrocarbon, or other
polymeric compounds (e.g. polyethylene glycols such as those having
between 2 and 100 ethylene glycol units). Specific examples include
those described by Seela and Kaiser, Nucleic Acids Res. 1990,
18:6353 and Nucleic Acids Res. 1987, 15:3113; Cload and Schepartz,
J. Am. Chem. Soc. 1991, 113:6324; Richardson and Schepartz, J. Am.
Chem. Soc. 1991, 113:5109; Ma et al., Nucleic Acids Res. 1993,
21:2585 and Biochemistry 1993, 32:1751; Durand et al., Nucleic
Acids Res. 1990, 18:6353; McCurdy et al., Nucleosides &
Nucleotides 1991, 10:287; Jschke et al., Tetrahedron Lett. 1993,
34:301; Ono et al., Biochemistry 1991, 30:9914; Arnold et al.,
International Publication No. WO 89/02439; Usman et al.,
International Publication No. WO 95/06731; Dudycz et al.,
International Publication No. WO 95/11910 and Ferentz and Verdine,
J. Am. Chem. Soc. 1991, 113:4000, all hereby incorporated by
reference herein. A "non-nucleotide" further means any group or
compound that can be incorporated into a nucleic acid chain in the
place of one or more nucleotide units, including either sugar
and/or phosphate substitutions, and allows the remaining bases to
exhibit their enzymatic activity. The group or compound can be
abasic in that it does not contain a commonly recognized nucleotide
base, such as adenosine, guanine, cytosine, uracil or thymine, for
example at the C1 position of the sugar.
[0116] In one embodiment, the invention features a short
interfering nucleic acid (siNA) molecule capable of mediating RNA
interference (RNAi) inside a cell or reconstituted in vitro system,
wherein one or both strands of the siNA molecule that are assembled
from two separate oligonucleotides do not comprise any
ribonucleotides. For example, an siNA molecule can be assembled
from a single oligonucleotide where the sense and antisense regions
of the siNA comprise separate oligonucleotides that do not have any
ribonucleotides (e.g., nucleotides having a 2'-OH group) present in
the oligonucleotides. In another example, an siNA molecule can be
assembled from a single oligonculeotide where the sense and
antisense regions of the siNA are linked or circularized by a
nucleotide or non-nucleotide linker as described herein, wherein
the oligonucleotide does not have any ribonucleotides (e.g.,
nucleotides having a 2'-OH group) present in the oligonucleotide.
Applicant has surprisingly found that the presence of
ribonucleotides (e.g., nucleotides having a 2'-hydroxyl group)
within the siNA molecule is not required or essential to support
RNAi activity. As such, in one embodiment, all positions within the
siNA can include chemically modified nucleotides and/or
non-nucleotides such as nucleotides and or non-nucleotides having
Formula I, II, III, IV, V, VI, or VII or any combination thereof to
the extent that the ability of the siNA molecule to support RNAi
activity in a cell is maintained.
[0117] In one embodiment, an siNA molecule of the invention is a
single-stranded siNA molecule that mediates RNAi activity in a cell
or reconstituted in vitro system comprising a single-stranded
polynucleotide having complementarity to a target nucleic acid
sequence. In another embodiment, the single-stranded siNA molecule
of the invention comprises a 5'-terminal phosphate group. In
another embodiment, the single-stranded siNA molecule of the
invention comprises a 5'-terminal phosphate group and a 3'-terminal
phosphate group (e.g., a 2',3'-cyclic phosphate). In another
embodiment, the single-stranded siNA molecule of the invention
comprises about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides. In yet
another embodiment, the single-stranded siNA molecule of the
invention comprises one or more chemically modified nucleotides or
non-nucleotides described herein. For example, all the positions
within the siNA molecule can include chemically modified
nucleotides such as nucleotides having any of Formulae I-VII, or
any combination thereof to the extent that the ability of the siNA
molecule to support RNAi activity in a cell is maintained.
[0118] In one embodiment, an siNA molecule of the invention is a
single-stranded siNA molecule that mediates RNAi activity in a cell
or reconstituted in vitro system comprising a single-stranded
polynucleotide having complementarity to a target nucleic acid
sequence, wherein one or more pyrimidine nucleotides present in the
siNA are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein
all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
purine nucleotides present in the antisense region are 2'-O-methyl
purine nucleotides (e.g., wherein all purine nucleotides are
2'-O-methyl purine nucleotides or alternately a plurality of purine
nucleotides are 2'-O-methyl purine nucleotides), and a terminal cap
modification, such as any modification described herein or shown in
FIG. 10, that is optionally present at the 3'-end and/or the
5'-end. The siNA optionally further comprises about 1 to about 4 or
more (e.g., about 1, 2, 3, 4 or more) terminal 2'-deoxynucleotides
at the 3'-end of the siNA molecule, wherein the terminal
nucleotides can further comprise one or more (e.g., 1, 2, 3, 4 or
more) phosphorothioate, phosphonoacetate, and/or
thiophosphonoacetate internucleotide linkages, and wherein the siNA
optionally further comprises a terminal phosphate group, such as a
5'-terminal phosphate group. In any of these embodiments, any
purine nucleotides present in the antisense region are
alternatively 2'-deoxy purine nucleotides (e.g., wherein all purine
nucleotides are 2'-deoxy purine nucleotides or alternately a
plurality of purine nucleotides are 2'-deoxy purine nucleotides).
Also, in any of these embodiments, any purine nucleotides present
in the siNA (i.e., purine nucleotides present in the sense and/or
antisense region) can alternatively be locked nucleic acid (LNA)
nucleotides (e.g., wherein all purine nucleotides are LNA
nucleotides or alternately a plurality of purine nucleotides are
LNA nucleotides). Also, in any of these embodiments, any purine
nucleotides present in the siNA are alternatively 2'-methoxyethyl
purine nucleotides (e.g., wherein all purine nucleotides are
2'-methoxyethyl purine nucleotides or alternately a plurality of
purine nucleotides are 2'-methoxyethyl purine nucleotides). In
another embodiment, any modified nucleotides present in the
single-stranded siNA molecules of the invention comprise modified
nucleotides having properties or characteristics similar to
naturally occurring ribonucleotides. For example, the invention
features siNA molecules including modified nucleotides having a
Northern conformation (e.g., Northern pseudorotation cycle, see for
example Saenger, Principles of Nucleic Acid Structure,
Springer-Verlag ed., 1984). As such, chemically modified
nucleotides present in the single-stranded siNA molecules of the
invention are preferably resistant to nuclease degradation while at
the same time maintaining the capacity to mediate RNAi.
[0119] In one embodiment, an siNA molecule of the invention
comprises chemically modified nucleotides or non-nucleotides (e.g.,
having any of Formulae I-VII, such as 2'-deoxy, 2'-deoxy-2'-fluoro,
or 2'-O-methyl nucleotides) at alternating positions within one or
more strands or regions of the siNA molecule. For example, such
chemical modifications can be introduced at every other position of
a RNA based siNA molecule, starting at either the first or second
nucleotide from the 3'-end or 5'-end of the siNA. In a non-limiting
example, a double-stranded siNA molecule of the invention in which
each strand of the siNA is 21 nucleotides in length is featured
wherein positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 of each
strand are chemically modified (e.g., with compounds having any of
Formulae I-VII, such as such as 2'-deoxy, 2'-deoxy-2'-fluoro, or
2'-O-methyl nucleotides). In another non-limiting example, a
double-stranded siNA molecule of the invention in which each strand
of the siNA is 21 nucleotides in length is featured wherein
positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 of each strand are
chemically modified (e.g., with compounds having any of Formulae
I-VII, such as such as 2'-deoxy, 2'-deoxy-2'-fluoro, or 2'-O-methyl
nucleotides). Such siNA molecules can further comprise terminal cap
moieties and/or backbone modifications as described herein.
[0120] In one embodiment, the invention features a method for
modulating the expression of an ICAM gene within a cell comprising:
(a) synthesizing an siNA molecule of the invention, which can be
chemically modified, wherein one of the siNA strands comprises a
sequence complementary to RNA of the ICAM gene; and (b) introducing
the siNA molecule into a cell under conditions suitable to modulate
the expression of the ICAM gene in the cell.
[0121] In one embodiment, the invention features a method for
modulating the expression of an ICAM gene within a cell comprising:
(a) synthesizing an siNA molecule of the invention, which can be
chemically modified, wherein one of the siNA strands comprises a
sequence complementary to RNA of the ICAM gene and wherein the
sense strand sequence of the siNA comprises a sequence identical or
substantially similar to the sequence of the target RNA; and (b)
introducing the siNA molecule into a cell under conditions suitable
to modulate the expression of the ICAM gene in the cell.
[0122] In another embodiment, the invention features a method for
modulating the expression of more than one ICAM gene within a cell
comprising: (a) synthesizing siNA molecules of the invention, which
can be chemically modified, wherein one of the siNA strands
comprises a sequence complementary to RNA of the ICAM genes; and
(b) introducing the siNA molecules into a cell under conditions
suitable to modulate the expression of the ICAM genes in the
cell.
[0123] In another embodiment, the invention features a method for
modulating the expression of two or more ICAM genes within a cell
comprising: (a) synthesizing one or more siNA molecules of the
invention, which can be chemically modified, wherein the siNA
strands comprise sequences complementary to RNA of the ICAM genes
and wherein the sense strand sequences of the siNAs comprise
sequences identical or substantially similar to the sequences of
the target RNAs; and (b) introducing the siNA molecules into a cell
under conditions suitable to modulate the expression of the ICAM
genes in the cell.
[0124] In another embodiment, the invention features a method for
modulating the expression of more than one ICAM gene within a cell
comprising: (a) synthesizing an siNA molecule of the invention,
which can be chemically modified, wherein one of the siNA strands
comprises a sequence complementary to RNA of the ICAM gene and
wherein the sense strand sequence of the siNA comprises a sequence
identical or substantially similar to the sequences of the target
RNAs; and (b) introducing the siNA molecule into a cell under
conditions suitable to modulate the expression of the ICAM genes in
the cell.
[0125] In one embodiment, siNA molecules of the invention are used
as reagents in ex vivo applications. For example, siNA reagents are
introduced into tissue or cells that are transplanted into a
subject for therapeutic effect. The cells and/or tissue can be
derived from an organism or subject that later receives the
explant, or can be derived from another organism or subject prior
to transplantation. The siNA molecules can be used to modulate the
expression of one or more genes in the cells or tissue, such that
the cells or tissue obtain a desired phenotype or are able to
perform a function when transplanted in vivo. In one embodiment,
certain target cells from a patient are extracted. These extracted
cells are contacted with siNAs targeting a specific nucleotide
sequence within the cells under conditions suitable for uptake of
the siNAs by these cells (e.g. using delivery reagents such as
cationic lipids, liposomes and the like or using techniques such as
electroporation to facilitate the delivery of siNAs into cells).
The cells are then reintroduced back into the same patient or other
patients. In one embodiment, the invention features a method of
modulating the expression of an ICAM gene in a tissue explant
comprising: (a) synthesizing an siNA molecule of the invention,
which can be chemically modified, wherein one of the siNA strands
comprises a sequence complementary to RNA of the ICAM gene; and (b)
introducing the siNA molecule into a cell of the tissue explant
derived from a particular organism under conditions suitable to
modulate the expression of the ICAM gene in the tissue explant. In
another embodiment, the method further comprises introducing the
tissue explant back into the organism the tissue was derived from
or into another organism under conditions suitable to modulate the
expression of the ICAM gene in that organism.
[0126] In one embodiment, the invention features a method of
modulating the expression of an ICAM gene in a tissue explant
comprising: (a) synthesizing an siNA molecule of the invention,
which can be chemically modified, wherein one of the siNA strands
comprises a sequence complementary to RNA of the ICAM gene and
wherein the sense strand sequence of the siNA comprises a sequence
identical or substantially similar to the sequence of the target
RNA; and (b) introducing the siNA molecule into a cell of the
tissue explant derived from a particular organism under conditions
suitable to modulate the expression of the ICAM gene in the tissue
explant. In another embodiment, the method further comprises
introducing the tissue explant back into the organism the tissue
was derived from or into another organism under conditions suitable
to modulate the expression of the ICAM gene in that organism.
[0127] In another embodiment, the invention features a method of
modulating the expression of more than one ICAM gene in a tissue
explant comprising: (a) synthesizing siNA molecules of the
invention, which can be chemically modified, wherein one of the
siNA strands comprises a sequence complementary to RNA of the ICAM
genes; and (b) introducing the siNA molecules into a cell of the
tissue explant derived from a particular organism under conditions
suitable to modulate the expression of the ICAM genes in the tissue
explant. In another embodiment, the method further comprises
introducing the tissue explant back into the organism the tissue
was derived from or into another organism under conditions suitable
to modulate the expression of the ICAM genes in that organism.
[0128] In one embodiment, the invention features a method of
modulating the expression of an ICAM gene in a subject or organism
comprising: (a) synthesizing an siNA molecule of the invention,
which can be chemically modified, wherein one of the siNA strands
comprises a sequence complementary to RNA of the ICAM gene; and (b)
introducing the siNA molecule into the subject or organism under
conditions suitable to modulate the expression of the ICAM gene in
the subject or organism. The level of ICAM protein or RNA can be
determined using various methods well-known in the art.
[0129] In another embodiment, the invention features a method of
modulating the expression of more than one ICAM gene in a subject
or organism comprising: (a) synthesizing siNA molecules of the
invention, which can be chemically modified, wherein one of the
siNA strands comprises a sequence complementary to RNA of the ICAM
genes; and (b) introducing the siNA molecules into the subject or
organism under conditions suitable to modulate the expression of
the ICAM genes in the subject or organism. The level of ICAM
protein or RNA can be determined as is known in the art.
[0130] In one embodiment, the invention features a method for
modulating the expression of an ICAM gene within a cell comprising:
(a) synthesizing an siNA molecule of the invention, which can be
chemically modified, wherein the siNA comprises a single-stranded
sequence having complementarity to RNA of the ICAM gene; and (b)
introducing the siNA molecule into a cell under conditions suitable
to modulate the expression of the ICAM gene in the cell.
[0131] In another embodiment, the invention features a method for
modulating the expression of more than one ICAM gene within a cell
comprising: (a) synthesizing siNA molecules of the invention, which
can be chemically modified, wherein the siNA comprises a
single-stranded sequence having complementarity to RNA of the ICAM
gene; and (b) contacting the cell in vitro or in vivo with the siNA
molecule under conditions suitable to modulate the expression of
the ICAM genes in the cell.
[0132] In one embodiment, the invention features a method of
modulating the expression of an ICAM gene in a tissue explant
comprising: (a) synthesizing an siNA molecule of the invention,
which can be chemically modified, wherein the siNA comprises a
single-stranded sequence having complementarity to RNA of the ICAM
gene; and (b) contacting a cell of the tissue explant derived from
a particular subject or organism with the siNA molecule under
conditions suitable to modulate the expression of the ICAM gene in
the tissue explant. In another embodiment, the method further
comprises introducing the tissue explant back into the subject or
organism the tissue was derived from or into another subject or
organism under conditions suitable to modulate the expression of
the ICAM gene in that subject or organism.
[0133] In another embodiment, the invention features a method of
modulating the expression of more than one ICAM gene in a tissue
explant comprising: (a) synthesizing siNA molecules of the
invention, which can be chemically modified, wherein the siNA
comprises a single-stranded sequence having complementarity to RNA
of the ICAM gene; and (b) introducing the siNA molecules into a
cell of the tissue explant derived from a particular subject or
organism under conditions suitable to modulate the expression of
the ICAM genes in the tissue explant. In another embodiment, the
method further comprises introducing the tissue explant back into
the subject or organism the tissue was derived from or into another
subject or organism under conditions suitable to modulate the
expression of the ICAM genes in that subject or organism.
[0134] In one embodiment, the invention features a method of
modulating the expression of an ICAM gene in a subject or organism
comprising: (a) synthesizing an siNA molecule of the invention,
which can be chemically modified, wherein the siNA comprises a
single-stranded sequence having complementarity to RNA of the ICAM
gene; and (b) introducing the siNA molecule into the subject or
organism under conditions suitable to modulate the expression of
the ICAM gene in the subject or organism.
[0135] In another embodiment, the invention features a method of
modulating the expression of more than one ICAM gene in a subject
or organism comprising: (a) synthesizing siNA molecules of the
invention, which can be chemically modified, wherein the siNA
comprises a single-stranded sequence having complementarity to RNA
of the ICAM gene; and (b) introducing the siNA molecules into the
subject or organism under conditions suitable to modulate the
expression of the ICAM genes in the subject or organism.
[0136] In one embodiment, the invention features a method of
modulating the expression of an ICAM gene in a subject or organism
comprising contacting the subject or organism with an siNA molecule
of the invention under conditions suitable to modulate the
expression of the ICAM gene in the subject or organism.
[0137] In one embodiment, the invention features a method for
treating or preventing an inflammatory, disease, disorder, or
condition in a subject or organism comprising contacting the
subject or organism with an siNA molecule of the invention under
conditions suitable to modulate the expression of the ICAM gene in
the subject or organism.
[0138] In one embodiment, the invention features a method for
treating or preventing an autoimmune disease, disorder, and/or
condition in a subject or organism comprising contacting the
subject or organism with an siNA molecule of the invention under
conditions suitable to modulate the expression of the ICAM gene in
the subject or organism.
[0139] In one embodiment, the invention features a method for
treating or preventing a proliferative disease, disorder, and/or
condition in a subject or organism comprising contacting the
subject or organism with an siNA molecule of the invention under
conditions suitable to modulate the expression of the ICAM gene in
the subject or organism.
[0140] In one embodiment, the invention features a method for
treating or preventing cancer in a subject or organism comprising
contacting the subject or organism with an siNA molecule of the
invention under conditions suitable to modulate the expression of
the ICAM gene in the subject or organism.
[0141] In another embodiment, the invention features a method of
modulating the expression of more than one ICAM genes in a subject
or organism comprising contacting the subject or organism with one
or more siNA molecules of the invention under conditions suitable
to modulate the expression of the ICAM genes in the subject or
organism.
[0142] The siNA molecules of the invention can be designed to down
regulate or inhibit target (e.g., ICAM) gene expression through
RNAi targeting of a variety of RNA molecules. In one embodiment,
the siNA molecules of the invention are used to target various RNAs
corresponding to a target gene. Non-limiting examples of such RNAs
include messenger RNA (mRNA), alternate RNA splice variants of
target gene(s), post-transcriptionally modified RNA of target
gene(s), pre-mRNA of target gene(s), and/or RNA templates. If
alternate splicing produces a family of transcripts that are
distinguished by usage of appropriate exons, the instant invention
can be used to inhibit gene expression through the appropriate
exons to specifically inhibit or to distinguish among the functions
of gene family members. For example, a protein that contains an
alternatively spliced transmembrane domain can be expressed in both
membrane bound and secreted forms. Use of the invention to target
the exon containing the transmembrane domain can be used to
determine the functional consequences of pharmaceutical targeting
of membrane bound as opposed to the secreted form of the protein.
Non-limiting examples of applications of the invention relating to
targeting these RNA molecules include therapeutic pharmaceutical
applications, pharmaceutical discovery applications, molecular
diagnostic and gene function applications, and gene mapping, for
example using single nucleotide polymorphism mapping with siNA
molecules of the invention. Such applications can be implemented
using known gene sequences or from partial sequences available from
an expressed sequence tag (EST).
[0143] In another embodiment, the siNA molecules of the invention
are used to target conserved sequences corresponding to a gene
family or gene families such as ICAM family genes. As such, siNA
molecules targeting multiple ICAM targets can provide increased
therapeutic effect. In addition, siNA can be used to characterize
pathways of gene function in a variety of applications. For
example, the present invention can be used to inhibit the activity
of target gene(s) in a pathway to determine the function of
uncharacterized gene(s) in gene function analysis, mRNA function
analysis, or translational analysis. The invention can be used to
determine potential target gene pathways involved in various
diseases and conditions toward pharmaceutical development. The
invention can be used to understand pathways of gene expression
involved in, for example inflammatory, autoimmune, cancer and
proliferative diseases, disorders and conditions.
[0144] In one embodiment, siNA molecule(s) and/or methods of the
invention are used to down regulate the expression of gene(s) that
encode RNA referred to by Genbank Accession numbers, for example,
ICAM genes encoding RNA sequence(s) referred to herein by Genbank
Accession number, for example, Genbank Accession Nos. shown in
Table I.
[0145] In one embodiment, the invention features a method
comprising: (a) generating a library of siNA constructs having a
predetermined complexity; and (b) assaying the siNA constructs of
(a) above, under conditions suitable to determine RNAi target sites
within the target RNA sequence. In one embodiment, the siNA
molecules of (a) have strands of a fixed length, for example, about
23 nucleotides in length. In another embodiment, the siNA molecules
of (a) are of differing length, for example having strands of about
15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, or 30) nucleotides in length. In one
embodiment, the assay can comprise a reconstituted in vitro siNA
assay as described herein. In another embodiment, the assay can
comprise a cell culture system in which target RNA is expressed. In
another embodiment, fragments of target RNA are analyzed for
detectable levels of cleavage, for example by gel electrophoresis,
Northern blot analysis, or RNAse protection assays, to determine
the most suitable target site(s) within the target RNA sequence.
The target RNA sequence can be obtained as is known in the art, for
example, by cloning and/or transcription for in vitro systems, and
by cellular expression in in vivo systems.
[0146] In one embodiment, the invention features a method
comprising: (a) generating a randomized library of siNA constructs
having a predetermined complexity, such as of 4.sup.N, where N
represents the number of base paired nucleotides in each of the
siNA construct strands (e.g., for an siNA construct having 21
nucleotide sense and antisense strands with 19 base pairs, the
complexity would be 4.sup.19); and (b) assaying the siNA constructs
of (a) above, under conditions suitable to determine RNAi target
sites within the target ICAM RNA sequence. In another embodiment,
the siNA molecules of (a) have strands of a fixed length, for
example about 23 nucleotides in length. In yet another embodiment,
the siNA molecules of (a) are of differing length, for example
having strands of about 15 to about 30 (e.g., about 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides in
length. In one embodiment, the assay can comprise a reconstituted
in vitro siNA assay as described in Example 6 herein. In another
embodiment, the assay can comprise a cell culture system in which
target RNA is expressed. In another embodiment, fragments of ICAM
RNA are analyzed for detectable levels of cleavage, for example, by
gel electrophoresis, Northern blot analysis, or RNAse protection
assays, to determine the most suitable target site(s) within the
target ICAM RNA sequence. The target ICAM RNA sequence can be
obtained as is known in the art, for example, by cloning and/or
transcription for in vitro systems, and by cellular expression in
in vivo systems.
[0147] In another embodiment, the invention features a method
comprising: (a) analyzing the sequence of a RNA target encoded by a
target gene; (b) synthesizing one or more sets of siNA molecules
having sequence complementary to one or more regions of the RNA of
(a); and (c) assaying the siNA molecules of (b) under conditions
suitable to determine RNAi targets within the target RNA sequence.
In one embodiment, the siNA molecules of (b) have strands of a
fixed length, for example about 23 nucleotides in length.
[0148] In another embodiment, the siNA molecules of (b) are of
differing length, for example having strands of about 15 to about
30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, or 30) nucleotides in length. In one embodiment, the assay
can comprise a reconstituted in vitro siNA assay as described
herein. In another embodiment, the assay can comprise a cell
culture system in which target RNA is expressed. Fragments of
target RNA are analyzed for detectable levels of cleavage, for
example by gel electrophoresis, Northern blot analysis, or RNAse
protection assays, to determine the most suitable target site(s)
within the target RNA sequence. The target RNA sequence can be
obtained as is known in the art, for example, by cloning and/or
transcription for in vitro systems, and by expression in in vivo
systems.
[0149] By "target site" is meant a sequence within a target RNA
that is "targeted" for cleavage mediated by an siNA construct which
contains sequences within its antisense region that are
complementary to the target sequence.
[0150] By "detectable level of cleavage" is meant cleavage of
target RNA (and formation of cleaved product RNAs) to an extent
sufficient to discern cleavage products above the background of
RNAs produced by random degradation of the target RNA. Production
of cleavage products from 1-5% of the target RNA is sufficient to
detect above the background for most methods of detection.
[0151] In one embodiment, the invention features a composition
comprising an siNA molecule of the invention, which can be
chemically modified, in a pharmaceutically acceptable carrier or
diluent. In another embodiment, the invention features a
pharmaceutical composition comprising siNA molecules of the
invention, which can be chemically modified, targeting one or more
genes in a pharmaceutically acceptable carrier or diluent. In
another embodiment, the invention features a method for diagnosing
a disease or condition in a subject comprising administering to the
subject a composition of the invention under conditions suitable
for the diagnosis of the disease or condition in the subject. In
another embodiment, the invention features a method for treating or
preventing a disease or condition in a subject, comprising
administering to the subject a composition of the invention under
conditions suitable for the treatment or prevention of the disease
or condition in the subject, alone or in conjunction with one or
more other therapeutic compounds. In yet another embodiment, the
invention features a method for treating or preventing
inflammatory, autoimmune, cancer and proliferative diseases,
disorders and conditions in a subject or organism comprising
administering to the subject a composition of the invention under
conditions suitable for the treatment or prevention of
inflammatory, autoimmune, cancer and proliferative diseases,
disorders and conditions in the subject or organism.
[0152] In another embodiment, the invention features a method for
validating an ICAM gene target, comprising: (a) synthesizing an
siNA molecule of the invention, which can be chemically modified,
wherein one of the siNA strands includes a sequence complementary
to RNA of an ICAM target gene; (b) introducing the siNA molecule
into a cell, tissue, subject, or organism under conditions suitable
for modulating expression of the ICAM target gene in the cell,
tissue, subject, or organism; and (c) determining the function of
the gene by assaying for any phenotypic change in the cell, tissue,
subject, or organism.
[0153] In another embodiment, the invention features a method for
validating an ICAM target comprising: (a) synthesizing an siNA
molecule of the invention, which can be chemically modified,
wherein one of the siNA strands includes a sequence complementary
to RNA of an ICAM target gene; (b) introducing the siNA molecule
into a biological system under conditions suitable for modulating
expression of the ICAM target gene in the biological system; and
(c) determining the function of the gene by assaying for any
phenotypic change in the biological system.
[0154] By "biological system" is meant, material, in a purified or
unpurified form, from biological sources, including but not limited
to human or animal, wherein the system comprises the components
required for RNAi activity. The term "biological system" includes,
for example, a cell, tissue, subject, or organism, or extract
thereof. The term biological system also includes reconstituted
RNAi systems that can be used in an in vitro setting.
[0155] By "phenotypic change" is meant any detectable change to a
cell that occurs in response to contact or treatment with a nucleic
acid molecule of the invention (e.g., siNA). Such detectable
changes include, but are not limited to, changes in shape, size,
proliferation, motility, protein expression or RNA expression or
other physical or chemical changes as can be assayed by methods
known in the art. The detectable change can also include expression
of reporter genes/molecules such as Green Florescent Protein (GFP)
or various tags that are used to identify an expressed protein or
any other cellular component that can be assayed.
[0156] In one embodiment, the invention features a kit containing
an siNA molecule of the invention, which can be chemically
modified, that can be used to modulate the expression of an ICAM
target gene in a biological system, including, for example, in a
cell, tissue, subject, or organism. In another embodiment, the
invention features a kit containing more than one siNA molecule of
the invention, which can be chemically modified, that can be used
to modulate the expression of more than one ICAM target gene in a
biological system, including, for example, in a cell, tissue,
subject, or organism.
[0157] In one embodiment, the invention features a cell containing
one or more siNA molecules of the invention, which can be
chemically modified. In another embodiment, the cell containing an
siNA molecule of the invention is a mammalian cell. In yet another
embodiment, the cell containing an siNA molecule of the invention
is a human cell.
[0158] In one embodiment, the synthesis of an siNA molecule of the
invention, which can be chemically modified, comprises: (a)
synthesis of two complementary strands of the siNA molecule; (b)
annealing the two complementary strands together under conditions
suitable to obtain a double-stranded siNA molecule. In another
embodiment, synthesis of the two complementary strands of the siNA
molecule is by solid phase oligonucleotide synthesis. In yet
another embodiment, synthesis of the two complementary strands of
the siNA molecule is by solid phase tandem oligonucleotide
synthesis.
[0159] In one embodiment, the invention features a method for
synthesizing an siNA duplex molecule comprising: (a) synthesizing a
first oligonucleotide sequence strand of the siNA molecule, wherein
the first oligonucleotide sequence strand comprises a cleavable
linker molecule that can be used as a scaffold for the synthesis of
the second oligonucleotide sequence strand of the siNA; (b)
synthesizing the second oligonucleotide sequence strand of siNA on
the scaffold of the first oligonucleotide sequence strand, wherein
the second oligonucleotide sequence strand further comprises a
chemical moiety than can be used to purify the siNA duplex; (c)
cleaving the linker molecule of (a) under conditions suitable for
the two siNA oligonucleotide strands to hybridize and form a stable
duplex; and (d) purifying the siNA duplex utilizing the chemical
moiety of the second oligonucleotide sequence strand. In one
embodiment, cleavage of the linker molecule in (c) above takes
place during deprotection of the oligonucleotide, for example,
under hydrolysis conditions using an alkylamine base such as
methylamine. In one embodiment, the method of synthesis comprises
solid phase synthesis on a solid support such as controlled pore
glass (CPG) or polystyrene, wherein the first sequence of (a) is
synthesized on a cleavable linker, such as a succinyl linker, using
the solid support as a scaffold. The cleavable linker in (a) used
as a scaffold for synthesizing the second strand can comprise
similar reactivity as the solid support derivatized linker, such
that cleavage of the solid support derivatized linker and the
cleavable linker of (a) takes place concomitantly. In another
embodiment, the chemical moiety of (b) that can be used to isolate
the attached oligonucleotide sequence comprises a trityl group, for
example a dimethoxytrityl group, which can be employed in a
trityl-on synthesis strategy as described herein. In yet another
embodiment, the chemical moiety, such as a dimethoxytrityl group,
is removed during purification, for example, using acidic
conditions.
[0160] In a further embodiment, the method for siNA synthesis is a
solution phase synthesis or hybrid phase synthesis wherein both
strands of the siNA duplex are synthesized in tandem using a
cleavable linker attached to the first sequence which acts a
scaffold for synthesis of the second sequence. Cleavage of the
linker under conditions suitable for hybridization of the separate
siNA sequence strands results in formation of the double-stranded
siNA molecule.
[0161] In another embodiment, the invention features a method for
synthesizing an siNA duplex molecule comprising: (a) synthesizing
one oligonucleotide sequence strand of the siNA molecule, wherein
the sequence comprises a cleavable linker molecule that can be used
as a scaffold for the synthesis of another oligonucleotide
sequence; (b) synthesizing a second oligonucleotide sequence having
complementarity to the first sequence strand on the scaffold of
(a), wherein the second sequence comprises the other strand of the
double-stranded siNA molecule and wherein the second sequence
further comprises a chemical moiety than can be used to isolate the
attached oligonucleotide sequence; (c) purifying the product of (b)
utilizing the chemical moiety of the second oligonucleotide
sequence strand under conditions suitable for isolating the
full-length sequence comprising both siNA oligonucleotide strands
connected by the cleavable linker and under conditions suitable for
the two siNA oligonucleotide strands to hybridize and form a stable
duplex. In one embodiment, cleavage of the linker molecule in (c)
above takes place during deprotection of the oligonucleotide, for
example, under hydrolysis conditions. In another embodiment,
cleavage of the linker molecule in (c) above takes place after
deprotection of the oligonucleotide. In another embodiment, the
method of synthesis comprises solid phase synthesis on a solid
support such as controlled pore glass (CPG) or polystyrene, wherein
the first sequence of (a) is synthesized on a cleavable linker,
such as a succinyl linker, using the solid support as a scaffold.
The cleavable linker in (a) used as a scaffold for synthesizing the
second strand can comprise similar reactivity or differing
reactivity as the solid support derivatized linker, such that
cleavage of the solid support derivatized linker and the cleavable
linker of (a) takes place either concomitantly or sequentially. In
one embodiment, the chemical moiety of (b) that can be used to
isolate the attached oligonucleotide sequence comprises a trityl
group, for example a dimethoxytrityl group.
[0162] In another embodiment, the invention features a method for
making a double-stranded siNA molecule in a single synthetic
process comprising: (a) synthesizing an oligonucleotide having a
first and a second sequence, wherein the first sequence is
complementary to the second sequence, and the first oligonucleotide
sequence is linked to the second sequence via a cleavable linker,
and wherein a terminal 5'-protecting group, for example, a
5'-O-dimethoxytrityl group (5'-O-DMT) remains on the
oligonucleotide having the second sequence; (b) deprotecting the
oligonucleotide whereby the deprotection results in the cleavage of
the linker joining the two oligonucleotide sequences; and (c)
purifying the product of (b) under conditions suitable for
isolating the double-stranded siNA molecule, for example using a
trityl-on synthesis strategy as described herein.
[0163] In another embodiment, the method of synthesis of siNA
molecules of the invention comprises the teachings of Scaringe et
al., U.S. Pat. Nos. 5,889,136; 6,008,400; and 6,111,086,
incorporated by reference herein in their entirety.
[0164] In one embodiment, the invention features siNA constructs
that mediate RNAi against ICAM, wherein the siNA construct
comprises one or more chemical modifications, for example, one or
more chemical modifications having any of Formulae I-VII or any
combination thereof that increases the nuclease resistance of the
siNA construct.
[0165] In another embodiment, the invention features a method for
generating siNA molecules with increased nuclease resistance
comprising (a) introducing nucleotides having any of Formula I-VII
or any combination thereof into an siNA molecule, and (b) assaying
the siNA molecule of step (a) under conditions suitable for
isolating siNA molecules having increased nuclease resistance.
[0166] In another embodiment, the invention features a method for
generating siNA molecules with improved toxicologic profiles (e.g.,
have attenuated or no immunostimulatory properties) comprising (a)
introducing nucleotides having any of Formula I-VII (e.g., siNA
motifs referred to in Table IV) or any combination thereof into an
siNA molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules having improved
toxicologic profiles.
[0167] In another embodiment, the invention features a method for
generating siNA molecules that do not stimulate an interferon
response (e.g., no interferon response or attenuated interferon
response) in a cell, subject, or organism, comprising (a)
introducing nucleotides having any of Formula I-VII (e.g., siNA
motifs referred to in Table IV) or any combination thereof into an
siNA molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules that do not
stimulate an interferon response.
[0168] By "improved toxicologic profile", is meant that the
chemically modified siNA construct exhibits decreased toxicity in a
cell, subject, or organism compared to an unmodified siNA or siNA
molecule having fewer modifications or modifications that are less
effective in imparting improved toxicology. In a non-limiting
example, siNA molecules with improved toxicologic profiles are
associated with a decreased or attenuated immunostimulatory
response in a cell, subject, or organism compared to an unmodified
siNA or siNA molecule having fewer modifications or modifications
that are less effective in imparting improved toxicology. In one
embodiment, an siNA molecule with an improved toxicological profile
comprises no ribonucleotides. In one embodiment, an siNA molecule
with an improved toxicological profile comprises less than 5
ribonucleotides (e.g., 1, 2, 3, or 4 ribonucleotides). In one
embodiment, an siNA molecule with an improved toxicological profile
comprises Stab 7, Stab 8, Stab 11, Stab 12, Stab 13, Stab 16, Stab
17, Stab 18, Stab 19, Stab 20, Stab 23, Stab 24, Stab 25, Stab 26,
Stab 27, Stab 28, Stab 29, Stab 30, Stab 31, Stab 32 or any
combination thereof (see Table IV). In one embodiment, the level of
immunostimulatory response associated with a given siNA molecule
can be measured as is known in the art, for example by determining
the level of PKR/interferon response, proliferation, B-cell
activation, and/or cytokine production in assays to quantitate the
immunostimulatory response of particular siNA molecules (see, for
example, Leifer et al., 2003, J. Immunother. 26, 313-9; and U.S.
Pat. No. 5,968,909, incorporated in its entirety by reference).
[0169] In one embodiment, the invention features siNA constructs
that mediate RNAi against ICAM, wherein the siNA construct
comprises one or more chemical modifications described herein that
modulates the binding affinity between the sense and antisense
strands of the siNA construct.
[0170] In another embodiment, the invention features a method for
generating siNA molecules with increased binding affinity between
the sense and antisense strands of the siNA molecule comprising (a)
introducing nucleotides having any of Formula I-VII or any
combination thereof into an siNA molecule, and (b) assaying the
siNA molecule of step (a) under conditions suitable for isolating
siNA molecules having increased binding affinity between the sense
and antisense strands of the siNA molecule.
[0171] In one embodiment, the invention features siNA constructs
that mediate RNAi against ICAM, wherein the siNA construct
comprises one or more chemical modifications described herein that
modulates the binding affinity between the antisense strand of the
siNA construct and a complementary target RNA sequence within a
cell.
[0172] In one embodiment, the invention features siNA constructs
that mediate RNAi against ICAM, wherein the siNA construct
comprises one or more chemical modifications described herein that
modulates the binding affinity between the antisense strand of the
siNA construct and a complementary target DNA sequence within a
cell.
[0173] In another embodiment, the invention features a method for
generating siNA molecules with increased binding affinity between
the antisense strand of the siNA molecule and a complementary
target RNA sequence comprising (a) introducing nucleotides having
any of Formula I-VII or any combination thereof into an siNA
molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules having increased
binding affinity between the antisense strand of the siNA molecule
and a complementary target RNA sequence.
[0174] In another embodiment, the invention features a method for
generating siNA molecules with increased binding affinity between
the antisense strand of the siNA molecule and a complementary
target DNA sequence comprising (a) introducing nucleotides having
any of Formula I-VII or any combination thereof into an siNA
molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules having increased
binding affinity between the antisense strand of the siNA molecule
and a complementary target DNA sequence.
[0175] In one embodiment, the invention features siNA constructs
that mediate RNAi against ICAM, wherein the siNA construct
comprises one or more chemical modifications described herein that
modulate the polymerase activity of a cellular polymerase capable
of generating additional endogenous siNA molecules having sequence
homology to the chemically modified siNA construct.
[0176] In another embodiment, the invention features a method for
generating siNA molecules capable of mediating increased polymerase
activity of a cellular polymerase capable of generating additional
endogenous siNA molecules having sequence homology to a chemically
modified siNA molecule comprising (a) introducing nucleotides
having any of Formula I-VII or any combination thereof into an siNA
molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules capable of
mediating increased polymerase activity of a cellular polymerase
capable of generating additional endogenous siNA molecules having
sequence homology to the chemically modified siNA molecule.
[0177] In one embodiment, the invention features chemically
modified siNA constructs that mediate RNAi against ICAM in a cell,
wherein the chemical modifications do not significantly effect the
interaction of siNA with a target RNA molecule, DNA molecule and/or
proteins or other factors that are essential for RNAi in a manner
that would decrease the efficacy of RNAi mediated by such siNA
constructs.
[0178] In another embodiment, the invention features a method for
generating siNA molecules with improved RNAi activity against ICAM
comprising (a) introducing nucleotides having any of Formula I-VII
or any combination thereof into an siNA molecule, and (b) assaying
the siNA molecule of step (a) under conditions suitable for
isolating siNA molecules having improved RNAi activity.
[0179] In yet another embodiment, the invention features a method
for generating siNA molecules with improved RNAi activity against
ICAM target RNA comprising (a) introducing nucleotides having any
of Formula I-VII or any combination thereof into an siNA molecule,
and (b) assaying the siNA molecule of step (a) under conditions
suitable for isolating siNA molecules having improved RNAi activity
against the target RNA.
[0180] In yet another embodiment, the invention features a method
for generating siNA molecules with improved RNAi activity against
ICAM target DNA comprising (a) introducing nucleotides having any
of Formula I-VII or any combination thereof into an siNA molecule,
and (b) assaying the siNA molecule of step (a) under conditions
suitable for isolating siNA molecules having improved RNAi activity
against the target DNA.
[0181] In one embodiment, the invention features siNA constructs
that mediate RNAi against ICAM, wherein the siNA construct
comprises one or more chemical modifications described herein that
modulates the cellular uptake of the siNA construct.
[0182] In another embodiment, the invention features a method for
generating siNA molecules against ICAM with improved cellular
uptake comprising (a) introducing nucleotides having any of Formula
I-VII or any combination thereof into an siNA molecule, and (b)
assaying the siNA molecule of step (a) under conditions suitable
for isolating siNA molecules having improved cellular uptake.
[0183] In one embodiment, the invention features siNA constructs
that mediate RNAi against ICAM, wherein the siNA construct
comprises one or more chemical modifications described herein that
increases the bioavailability of the siNA construct, for example,
by attaching polymeric conjugates such as polyethyleneglycol or
equivalent conjugates that improve the pharmacokinetics of the siNA
construct, or by attaching conjugates that target specific tissue
types or cell types in vivo. Non-limiting examples of such
conjugates are described in Vargeese et al., U.S. Ser. No.
10/201,394 incorporated by reference herein.
[0184] In one embodiment, the invention features a method for
generating siNA molecules of the invention with improved
bioavailability comprising (a) introducing a conjugate into the
structure of an siNA molecule, and (b) assaying the siNA molecule
of step (a) under conditions suitable for isolating siNA molecules
having improved bioavailability. Such conjugates can include
ligands for cellular receptors, such as peptides derived from
naturally occurring protein ligands; protein localization
sequences, including cellular ZIP code sequences; antibodies;
nucleic acid aptamers; vitamins and other co-factors, such as
folate and N-acetylgalactosamine; polymers, such as
polyethyleneglycol (PEG); phospholipids; cholesterol; polyamines,
such as spermine or spermidine; and others.
[0185] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence is chemically
modified in a manner that it can no longer act as a guide sequence
for efficiently mediating RNA interference and/or be recognized by
cellular proteins that facilitate RNAi.
[0186] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein the second sequence is designed or
modified in a manner that prevents its entry into the RNAi pathway
as a guide sequence or as a sequence that is complementary to a
target nucleic acid (e.g., RNA) sequence. Such design or
modifications are expected to enhance the activity of siNA and/or
improve the specificity of siNA molecules of the invention. These
modifications are also expected to minimize any off-target effects
and/or associated toxicity.
[0187] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence is incapable of
acting as a guide sequence for mediating RNA interference.
[0188] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence does not have a
terminal 5'-hydroxyl (5'-OH) or 5'-phosphate group.
[0189] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence comprises a
terminal cap moiety at the 5'-end of said second sequence. In one
embodiment, the terminal cap moiety comprises an inverted abasic,
inverted deoxy abasic, inverted nucleotide moiety, a group shown in
FIG. 10, an alkyl or cycloalkyl group, a heterocycle, or any other
group that prevents RNAi activity in which the second sequence
serves as a guide sequence or template for RNAi.
[0190] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence comprises a
terminal cap moiety at the 5'-end and 3'-end of said second
sequence. In one embodiment, each terminal cap moiety individually
comprises an inverted abasic, inverted deoxy abasic, inverted
nucleotide moiety, a group shown in FIG. 10, an alkyl or cycloalkyl
group, a heterocycle, or any other group that prevents RNAi
activity in which the second sequence serves as a guide sequence or
template for RNAi.
[0191] In one embodiment, the invention features a method for
generating siNA molecules of the invention with improved
specificity for down regulating or inhibiting the expression of a
target nucleic acid (e.g., a DNA or RNA such as a gene or its
corresponding RNA), comprising (a) introducing one or more chemical
modifications into the structure of an siNA molecule, and (b)
assaying the siNA molecule of step (a) under conditions suitable
for isolating siNA molecules having improved specificity. In
another embodiment, the chemical modification used to improve
specificity comprises terminal cap modifications at the 5'-end,
3'-end, or both 5' and 3'-ends of the siNA molecule. The terminal
cap-modifications can comprise, for example, structures shown in
FIG. 10 (e.g. inverted deoxyabasic moieties) or any other chemical
modification that renders a portion of the siNA molecule (e.g. the
sense strand) incapable of mediating RNA interference against an
off target nucleic acid sequence. In a non-limiting example, an
siNA molecule is designed such that only the antisense sequence of
the siNA molecule can serve as a guide sequence for RISC mediated
degradation of a corresponding target RNA sequence. This can be
accomplished by rendering the sense sequence of the siNA inactive
by introducing chemical modifications to the sense strand that
preclude recognition of the sense strand as a guide sequence by
RNAi machinery. In one embodiment, such chemical modifications
comprise any chemical group at the 5'-end of the sense strand of
the siNA, or any other group that serves to render the sense strand
inactive as a guide sequence for mediating RNA interference. These
modifications, for example, can result in a molecule where the
5'-end of the sense strand no longer has a free 5'-hydroxyl (5'-OH)
or a free 5'-phosphate group (e.g., phosphate, diphosphate,
triphosphate, cyclic phosphate etc.). Non-limiting examples of such
siNA constructs are described herein, such as "Stab 9/10", "Stab
7/8", "Stab 7/19", "Stab 17/22", "Stab 23/24", "Stab 24/25", and
"Stab 24/26" (e.g., any siNA having Stab 7, 9, 17, 23, or 24 sense
strands) chemistries and variants thereof (see Table IV) wherein
the 5'-end and 3'-end of the sense strand of the siNA do not
comprise a hydroxyl group or phosphate group.
[0192] In one embodiment, the invention features a method for
generating siNA molecules of the invention with improved
specificity for down regulating or inhibiting the expression of a
target nucleic acid (e.g., a DNA or RNA such as a gene or its
corresponding RNA), comprising introducing one or more chemical
modifications into the structure of an siNA molecule that prevent a
strand or portion of the siNA molecule from acting as a template or
guide sequence for RNAi activity. In one embodiment, the inactive
strand or sense region of the siNA molecule is the sense strand or
sense region of the siNA molecule, i.e. the strand or region of the
siNA that does not have complementarity to the target nucleic acid
sequence. In one embodiment, such chemical modifications comprise
any chemical group at the 5'-end of the sense strand or region of
the siNA that does not comprise a 5'-hydroxyl (5'-OH) or
5'-phosphate group, or any other group that serves to render the
sense strand or sense region inactive as a guide sequence for
mediating RNA interference. Non-limiting examples of such siNA
constructs are described herein, such as "Stab 9/10", "Stab 7/8",
"Stab 7/19", "Stab 17/22", "Stab 23/24", "Stab 24/25", and "Stab
24/26" (e.g., any siNA having Stab 7, 9, 17, 23, or 24 sense
strands) chemistries and variants thereof (see Table IV) wherein
the 5'-end and 3'-end of the sense strand of the siNA do not
comprise a hydroxyl group or phosphate group.
[0193] In one embodiment, the invention features a method for
screening siNA molecules that are active in mediating RNA
interference against a target nucleic acid sequence comprising (a)
generating a plurality of unmodified siNA molecules, (b) screening
the siNA molecules of step (a) under conditions suitable for
isolating siNA molecules that are active in mediating RNA
interference against the target nucleic acid sequence, and (c)
introducing chemical modifications (e.g. chemical modifications as
described herein or as otherwise known in the art) into the active
siNA molecules of (b). In one embodiment, the method further
comprises re-screening the chemically modified siNA molecules of
step (c) under conditions suitable for isolating chemically
modified siNA molecules that are active in mediating RNA
interference against the target nucleic acid sequence.
[0194] In one embodiment, the invention features a method for
screening chemically modified siNA molecules that are active in
mediating RNA interference against a target nucleic acid sequence
comprising (a) generating a plurality of chemically modified siNA
molecules (e.g. siNA molecules as described herein or as otherwise
known in the art), and (b) screening the siNA molecules of step (a)
under conditions suitable for isolating chemically modified siNA
molecules that are active in mediating RNA interference against the
target nucleic acid sequence.
[0195] The term "ligand" refers to any compound or molecule, such
as a drug, peptide, hormone, or neurotransmitter that is capable of
interacting with another compound, such as a receptor, either
directly or indirectly. The receptor that interacts with a ligand
can be present on the surface of a cell or can alternately be an
intercellular receptor. Interaction of the ligand with the receptor
can result in a biochemical reaction, or can simply be a physical
interaction or association.
[0196] In another embodiment, the invention features a method for
generating siNA molecules of the invention with improved
bioavailability comprising (a) introducing an excipient formulation
to an siNA molecule, and (b) assaying the siNA molecule of step (a)
under conditions suitable for isolating siNA molecules having
improved bioavailability. Such excipients include polymers such as
cyclodextrins, lipids, cationic lipids, polyamines, phospholipids,
nanoparticles, receptors, ligands, and others.
[0197] In another embodiment, the invention features a method for
generating siNA molecules of the invention with improved
bioavailability comprising (a) introducing nucleotides having any
of Formulae I-VII or any combination thereof into an siNA molecule,
and (b) assaying the siNA molecule of step (a) under conditions
suitable for isolating siNA molecules having improved
bioavailability.
[0198] In another embodiment, polyethylene glycol (PEG) can be
covalently attached to siNA compounds of the present invention. The
attached PEG can be any molecular weight, preferably from about
2,000 to about 50,000 daltons (Da).
[0199] The present invention can be used alone or as a component of
a kit having at least one of the reagents necessary to carry out
the in vitro or in vivo introduction of RNA to test samples and/or
subjects. For example, preferred components of the kit include an
siNA molecule of the invention and a vehicle that promotes
introduction of the siNA into cells of interest as described herein
(e.g., using lipids and other methods of transfection known in the
art, see for example Beigelman et al, U.S. Pat. No. 6,395,713). The
kit can be used for target validation, such as in determining gene
function and/or activity, or in drug optimization, and in drug
discovery (see for example Usman et al., U.S. Ser. No. 60/402,996).
Such a kit can also include instructions to allow a user of the kit
to practice the invention.
[0200] The term "short interfering nucleic acid", "siNA", "short
interfering RNA", "siRNA", "short interfering nucleic acid
molecule", "short interfering oligonucleotide molecule", or
"chemically modified, short interfering nucleic acid molecule" as
used herein refers to any nucleic acid molecule capable of
inhibiting or down regulating gene expression or viral replication,
for example by mediating RNA interference "RNAi" or gene silencing
in a sequence-specific manner; see for example Zamore et al., 2000,
Cell, 101, 25-33; Bass, 2001, Nature, 411, 428-429; Elbashir et
al., 2001, Nature, 411, 494-498; and Kreutzer et al., International
PCT Publication No. WO 00/44895; Zernicka-Goetz et al.,
International PCT Publication No. WO 01/36646; Fire, International
PCT Publication No. WO 99/32619; Plaetinck et al., International
PCT Publication No. WO 00/01846; Mello and Fire, International PCT
Publication No. WO 01/29058; Deschamps-Depaillette, International
PCT Publication No. WO 99/07409; and Li et al., International PCT
Publication No. WO 00/44914; Allshire, 2002, Science, 297,
1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein,
2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297,
2232-2237; Hutvagner and Zamore, 2002, Science, 297, 2056-60;
McManus et al., 2002, RNA, 8, 842-850; Reinhart et al., 2002, Gene
& Dev., 16, 1616-1626; and Reinhart & Bartel, 2002,
Science, 297, 1831). Non limiting examples of siNA molecules of the
invention are shown in FIGS. 4-6, and Tables II and III herein. For
example the siNA can be a double-stranded polynucleotide molecule
comprising self-complementary sense and antisense regions, wherein
the antisense region comprises nucleotide sequence that is
complementary to nucleotide sequence in a target nucleic acid
molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. The siNA can be assembled from two
separate oligonucleotides, where one strand is the sense strand and
the other is the antisense strand, wherein the antisense and sense
strands are self-complementary (i.e. each strand comprises
nucleotide sequence that is complementary to nucleotide sequence in
the other strand; such as where the antisense strand and sense
strand form a duplex or double-stranded structure, for example
wherein the double-stranded region is about 15 to about 30, e.g.,
about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or
30 base pairs; the antisense strand comprises nucleotide sequence
that is complementary to nucleotide sequence in a target nucleic
acid molecule or a portion thereof and the sense strand comprises
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof (e.g., about 15 to about 25 or more
nucleotides of the siNA molecule are complementary to the target
nucleic acid or a portion thereof). Alternatively, the siNA is
assembled from a single oligonucleotide, where the
self-complementary sense and antisense regions of the siNA are
linked by means of a nucleic acid based or non-nucleic acid-based
linker(s). The siNA can be a polynucleotide with a duplex,
asymmetric duplex, hairpin or asymmetric hairpin secondary
structure, having self-complementary sense and antisense regions,
wherein the antisense region comprises nucleotide sequence that is
complementary to nucleotide sequence in a separate target nucleic
acid molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. The siNA can be a circular
single-stranded polynucleotide having two or more loop structures
and a stem comprising self-complementary sense and antisense
regions, wherein the antisense region comprises nucleotide sequence
that is complementary to nucleotide sequence in a target nucleic
acid molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof, and wherein the circular
polynucleotide can be processed either in vivo or in vitro to
generate an active siNA molecule capable of mediating RNAi. The
siNA can also comprise a single-stranded polynucleotide having
nucleotide sequence complementary to nucleotide sequence in a
target nucleic acid molecule or a portion thereof (for example,
where such siNA molecule does not require the presence within the
siNA molecule of nucleotide sequence corresponding to the target
nucleic acid sequence or a portion thereof), wherein the
single-stranded polynucleotide can further comprise a terminal
phosphate group, such as a 5'-phosphate (see for example Martinez
et al., 2002, Cell., 110, 563-574 and Schwarz et al., 2002,
Molecular Cell, 10, 537-568), or 5',3'-diphosphate. In certain
embodiments, the siNA molecule of the invention comprises separate
sense and antisense sequences or regions, wherein the sense and
antisense regions are covalently linked by nucleotide or
non-nucleotide linkers molecules as is known in the art, or are
alternately non-covalently linked by ionic interactions, hydrogen
bonding, van der waals interactions, hydrophobic interactions,
and/or stacking interactions. In certain embodiments, the siNA
molecules of the invention comprise nucleotide sequence that is
complementary to nucleotide sequence of a target gene. In another
embodiment, the siNA molecule of the invention interacts with
nucleotide sequence of a target gene in a manner that causes
inhibition of expression of the target gene. As used herein, siNA
molecules need not be limited to those molecules containing only
RNA, but further encompasses chemically modified nucleotides and
non-nucleotides. In certain embodiments, the short interfering
nucleic acid molecules of the invention lack 2'-hydroxy (2'-OH)
containing nucleotides. Applicant describes in certain embodiments
short interfering nucleic acids that do not require the presence of
nucleotides having a 2'-hydroxy group for mediating RNAi and as
such, short interfering nucleic acid molecules of the invention
optionally do not include any ribonucleotides (e.g., nucleotides
having a 2'-OH group). Such siNA molecules that do not require the
presence of ribonucleotides within the siNA molecule to support
RNAi can however have an attached linker or linkers or other
attached or associated groups, moieties, or chains containing one
or more nucleotides with 2'-OH groups. Optionally, siNA molecules
can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of
the nucleotide positions. The modified short interfering nucleic
acid molecules of the invention can also be referred to as short
interfering modified oligonucleotides "siMON." As used herein, the
term siNA is meant to be equivalent to other terms used to describe
nucleic acid molecules that are capable of mediating sequence
specific RNAi, for example short interfering RNA (siRNA),
double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA
(shRNA), short interfering oligonucleotide, short interfering
nucleic acid, short interfering modified oligonucleotide,
chemically modified siRNA, post-transcriptional gene silencing RNA
(ptgsRNA), and others. In addition, as used herein, the term RNAi
is meant to be equivalent to other terms used to describe sequence
specific RNA interference, such as post transcriptional gene
silencing, translational inhibition, or epigenetics. For example,
siNA molecules of the invention can be used to epigenetically
silence genes at both the post-transcriptional level and the
pre-transcriptional level. In a non-limiting example, epigenetic
regulation of gene expression by siNA molecules of the invention
can result from siNA mediated modification of chromatin structure
or methylation pattern to alter gene expression (see, for example,
Verdel et al., 2004, Science, 303, 672-676; Pal-Bhadra et al.,
2004, Science, 303, 669-672; Allshire, 2002, Science, 297,
1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein,
2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297,
2232-2237).
[0201] In one embodiment, an siNA molecule of the invention is a
duplex forming oligonucleotide "DFO", (see for example FIGS. 14-15
and Vaish et al., U.S. Ser. No. 10/727,780 filed Dec. 3, 2003 and
International PCT Application No. US04/16390, filed May 24,
2004).
[0202] In one embodiment, an siNA molecule of the invention is a
multifunctional siNA, (see for example FIGS. 16-21 and Jadhav et
al., U.S. Ser. No. 60/543,480 filed Feb. 10, 2004 and International
PCT Application No. US04/16390, filed May 24, 2004). The
multifunctional siNA of the invention can comprise sequence
targeting, for example, two regions of ICAM RNA (see for example
target sequences in Tables II and III).
[0203] By "asymmetric hairpin" as used herein is meant a linear
siNA molecule comprising an antisense region, a loop portion that
can comprise nucleotides or non-nucleotides, and a sense region
that comprises fewer nucleotides than the antisense region to the
extent that the sense region has enough complementary nucleotides
to base pair with the antisense region and form a duplex with loop.
For example, an asymmetric hairpin siNA molecule of the invention
can comprise an antisense region having length sufficient to
mediate RNAi in a cell or in vitro system (e.g. about 15 to about
30, or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, or 30 nucleotides) and a loop region comprising about 4 to
about 12 (e.g., about 4, 5, 6, 7, 8, 9, 10, 11, or 12) nucleotides,
and a sense region having about 3 to about 25 (e.g., about 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, or 25) nucleotides that are complementary to the antisense
region. The asymmetric hairpin siNA molecule can also comprise a
5'-terminal phosphate group that can be chemically modified. The
loop portion of the asymmetric hairpin siNA molecule can comprise
nucleotides, non-nucleotides, linker molecules, or conjugate
molecules as described herein.
[0204] By "asymmetric duplex" as used herein is meant an siNA
molecule having two separate strands comprising a sense region and
an antisense region, wherein the sense region comprises fewer
nucleotides than the antisense region to the extent that the sense
region has enough complementary nucleotides to base pair with the
antisense region and form a duplex. For example, an asymmetric
duplex siNA molecule of the invention can comprise an antisense
region having length sufficient to mediate RNAi in a cell or in
vitro system (e.g. about 15 to about 30, or about 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides) and
a sense region having about 3 to about 25 (e.g., about 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, or 25) nucleotides that are complementary to the antisense
region.
[0205] By "modulate" is meant that the expression of the gene, or
level of RNA molecule or equivalent RNA molecules encoding one or
more proteins or protein subunits, or activity of one or more
proteins or protein subunits is up regulated or down regulated,
such that expression, level, or activity is greater than or less
than that observed in the absence of the modulator. For example,
the term "modulate" can mean "inhibit," but the use of the word
"modulate" is not limited to this definition.
[0206] By "inhibit", "down-regulate", or "reduce", it is meant that
the expression of the gene, or level of RNA molecules or equivalent
RNA molecules encoding one or more proteins or protein subunits, or
activity of one or more proteins or protein subunits, is reduced
below that observed in the absence of the nucleic acid molecules
(e.g., siNA) of the invention. In one embodiment, inhibition,
down-regulation or reduction with an siNA molecule is below that
level observed in the presence of an inactive or attenuated
molecule. In another embodiment, inhibition; down-regulation, or
reduction with siNA molecules is below that level observed in the
presence of, for example, an siNA molecule with scrambled sequence
or with mismatches. In another embodiment, inhibition,
down-regulation, or reduction of gene expression with a nucleic
acid molecule of the instant invention is greater in the presence
of the nucleic acid molecule than in its absence. In one
embodiment, inhibition, down regulation, or reduction of gene
expression is associated with post transcriptional silencing, such
as RNAi mediated cleavage of a target nucleic acid molecule (e.g.
RNA) or inhibition of translation. In one embodiment, inhibition,
down regulation, or reduction of gene expression is associated with
pretranscriptional silencing.
[0207] By "gene", or "target gene", is meant a nucleic acid that
encodes an RNA, for example, nucleic acid sequences including, but
not limited to, structural genes encoding a polypeptide. A gene or
target gene can also encode a functional RNA (fRNA) or non-coding
RNA (ncRNA), such as small temporal RNA (stRNA), micro RNA (miRNA),
small nuclear RNA (snRNA), short interfering RNA (siRNA), small
nucleolar RNA (snRNA), ribosomal RNA (rRNA), transfer RNA (tRNA)
and precursor RNAs thereof. Such non-coding RNAs can serve as
target nucleic acid molecules for siNA mediated RNA interference in
modulating the activity of fRNA or ncRNA involved in functional or
regulatory cellular processes. Aberrant fRNA or ncRNA activity
leading to disease can therefore be modulated by siNA molecules of
the invention. siNA molecules targeting fRNA and ncRNA can also be
used to manipulate or alter the genotype or phenotype of a subject,
organism or cell, by intervening in cellular processes such as
genetic imprinting, transcription, translation, or nucleic acid
processing (e.g., transamination, methylation etc.). The target
gene can be a gene derived from a cell, an endogenous gene, a
transgene, or exogenous genes such as genes of a pathogen, for
example a virus, which is present in the cell after infection
thereof. The cell containing the target gene can be derived from or
contained in any organism, for example a plant, animal, protozoan,
virus, bacterium, or fungus. Non-limiting examples of plants
include monocots, dicots, or gymnosperms. Non-limiting examples of
animals include vertebrates or invertebrates. Non-limiting examples
of fungi include molds or yeasts. For a review, see for example
Snyder and Gerstein, 2003, Science, 300, 258-260.
[0208] By "non-canonical base pair" is meant any non-Watson Crick
base pair, such as mismatches and/or wobble base pairs, including
flipped mismatches, single hydrogen bond mismatches, trans-type
mismatches, triple base interactions, and quadruple base
interactions. Non-limiting examples of such non-canonical base
pairs include, but are not limited to, AC reverse Hoogsteen, AC
wobble, AU reverse Hoogsteen, GU wobble, AA N7 amino, CC
2-carbonyl-amino(H1)-N-3-amino(H2), GA sheared, UC
4-carbonyl-amino, UU imino-carbonyl, AC reverse wobble, AU
Hoogsteen, AU reverse Watson Crick, CG reverse Watson Crick, GC
N3-amino-amino N3, AA N1-amino symmetric, AA N7-amino symmetric, GA
N7-N1 amino-carbonyl, GA+ carbonyl-amino N7-N1, GG N1-carbonyl
symmetric, GG N3-amino symmetric, CC carbonyl-amino symmetric, CC
N3-amino symmetric, UU 2-carbonyl-imino symmetric, UU
4-carbonyl-imino symmetric, AA amino-N3, AA N1-amino, AC amino
2-carbonyl, AC N3-amino, AC N7-amino, AU amino-4-carbonyl, AU
N1-imino, AU N3-imino, AU N7-imino, CC carbonyl-amino, GA amino-N1,
GA amino-N7, GA carbonyl-amino, GA N3-amino, GC amino-N3, GC
carbonyl-amino, GC N3-amino, GC N7-amino, GG amino-N7, GG
carbonyl-imino, GG N7-amino, GU amino-2-carbonyl, GU
carbonyl-imino, GU imino-2-carbonyl, GU N7-imino, psiU
imino-2-carbonyl, UC 4-carbonyl-amino, UC imino-carbonyl, UU
imino-4-carbonyl, AC C2-H--N3, GA carbonyl-C2-H, UU
imino-4-carbonyl 2 carbonyl-C5-H, AC amino(A) N3(C)-carbonyl, GC
imino amino-carbonyl, Gpsi imino-2-carbonyl amino-2-carbonyl, and
GU imino amino-2-carbonyl base pairs.
[0209] By "ICAM," or "intercellular adhesion molecule" as used
herein is meant, any intercellular adhesion molecule (e.g., ICAM-1)
protein, peptide, or polypeptide having any ICAM activity, such as
encoded by ICAM Genbank Accession Nos. shown in Table I. The term
ICAM also refers to nucleic acid sequences encoding any ICAM
protein, peptide, or polypeptide having ICAM activity. The term
"ICAM" is also meant to include other ICAM encoding sequence, such
as other ICAM isoforms, mutant ICAM genes, splice variants of ICAM
genes, and ICAM gene polymorphisms.
[0210] By "homologous sequence" is meant, a nucleotide sequence
that is shared by one or more polynucleotide sequences, such as
genes, gene transcripts and/or non-coding polynucleotides. For
example, a homologous sequence can be a nucleotide sequence that is
shared by two or more genes encoding related but different
proteins, such as different members of a gene family, different
protein epitopes, different protein isoforms or completely
divergent genes, such as a cytokine and its corresponding
receptors. A homologous sequence can be a nucleotide sequence that
is shared by two or more non-coding polynucleotides, such as
noncoding DNA or RNA, regulatory sequences, introns, and sites of
transcriptional control or regulation. Homologous sequences can
also include conserved sequence regions shared by more than one
polynucleotide sequence. Homology does not need to be perfect
homology (e.g., 100%), as partially homologous sequences are also
contemplated by the instant invention (e.g., 99%, 98%, 97%, 96%,
95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%,
82%, 81%, 80% etc.).
[0211] By "conserved sequence region" is meant, a nucleotide
sequence of one or more regions in a polynucleotide does not vary
significantly between generations or from one biological system,
subject, or organism to another biological system, subject, or
organism. The polynucleotide can include both coding and non-coding
DNA and RNA.
[0212] By "sense region" is meant a nucleotide sequence of an siNA
molecule having complementarity to an antisense region of the siNA
molecule. In addition, the sense region of an siNA molecule can
comprise a nucleic acid sequence having homology with a target
nucleic acid sequence.
[0213] By "antisense region" is meant a nucleotide sequence of an
siNA molecule having complementarity to a target nucleic acid
sequence. In addition, the antisense region of an siNA molecule can
optionally comprise a nucleic acid sequence having complementarity
to a sense region of the siNA molecule.
[0214] By "target nucleic acid" is meant any nucleic acid sequence
whose expression or activity is to be modulated. The target nucleic
acid can be DNA or RNA.
[0215] By "complementarity" is meant that a nucleic acid can form
hydrogen bond(s) with another nucleic acid sequence by either
traditional Watson-Crick or other non-traditional types. In
reference to the nucleic molecules of the present invention, the
binding free energy for a nucleic acid molecule with its
complementary sequence is sufficient to allow the relevant function
of the nucleic acid to proceed, e.g., RNAi activity. Determination
of binding free energies for nucleic acid molecules is well known
in the art (see, e.g., Turner et al., 1987, CSH Symp. Quant. Biol.
LII pp. 123-133; Frier et al., 1986, Proc. Nat. Acad. Sci. USA
83:9373-9377; Turner et al., 1987, J. Am. Chem. Soc.
109:3783-3785). A percent complementarity indicates the percentage
of contiguous residues in a nucleic acid molecule that can form
hydrogen bonds (e.g., Watson-Crick base pairing) with a second
nucleic acid sequence (e.g., 5, 6, 7, 8, 9, or 10 nucleotides out
of a total of 10 nucleotides in the first oligonucleotide being
based paired to a second nucleic acid sequence having 10
nucleotides represents 50%, 60%, 70%, 80%, 90%, and 100%
complementary respectively). "Perfectly complementary" means that
all the contiguous residues of a nucleic acid sequence will
hydrogen bond with the same number of contiguous residues in a
second nucleic acid sequence. In one embodiment, an siNA molecule
of the invention comprises about 15 to about 30 or more (e.g.,
about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
or 30 or more) nucleotides that are complementary to one or more
target nucleic acid molecules or a portion thereof.
[0216] In one embodiment, siNA molecules of the invention that down
regulate or reduce ICAM gene expression are used for preventing or
treating inflammatory, autoimmune, cancer and proliferative
diseases, disorders, and/or conditions in a subject or
organism.
[0217] In one embodiment, the siNA molecules of the invention are
used to treat inflammatory, autoimmune, cancer and proliferative
diseases, disorders, and/or conditions in a subject or
organism.
[0218] By "proliferative disease" or "cancer" as used herein is
meant, any disease, condition, trait, genotype or phenotype
characterized by unregulated cell growth or replication as is known
in the art; including leukemias, for example, acute myelogenous
leukemia (AML), chronic myelogenous leukemia (CML), acute
lymphocytic leukemia (ALL), and chronic lymphocytic leukemia, AIDS
related cancers such as Kaposi's sarcoma; breast cancers; bone
cancers such as Osteosarcoma, Chondrosarcomas, Ewing's sarcoma,
Fibrosarcomas, Giant cell tumors, Adamantinomas, and Chordomas;
Brain cancers such as Meningiomas, Glioblastomas, Lower-Grade
Astrocytomas, Oligodendrocytomas, Pituitary Tumors, Schwannomas,
and Metastatic brain cancers; cancers of the head and neck
including various lymphomas such as mantle cell lymphoma,
non-Hodgkins lymphoma, adenoma, squamous cell carcinoma, laryngeal
carcinoma, gallbladder and bile duct cancers, cancers of the retina
such as retinoblastoma, cancers of the esophagus, gastric cancers,
multiple myeloma, ovarian cancer, uterine cancer, thyroid cancer,
testicular cancer, endometrial cancer, melanoma, colorectal cancer,
lung cancer, bladder cancer, prostate cancer, lung cancer
(including non-small cell lung carcinoma), pancreatic cancer,
sarcomas, Wilms' tumor, cervical cancer, head and neck cancer, skin
cancers, nasopharyngeal carcinoma, liposarcoma, epithelial
carcinoma, renal cell carcinoma, gallbladder adeno carcinoma,
parotid adenocarcinoma, endometrial sarcoma, multidrug resistant
cancers; and proliferative diseases and conditions, such as
neovascularization associated with tumor angiogenesis, macular
degeneration (e.g., wet/dry AMD), corneal neovascularization,
diabetic retinopathy, neovascular glaucoma, myopic degeneration and
other proliferative diseases and conditions such as restenosis and
polycystic kidney disease, and any other cancer or proliferative
disease, condition, trait, genotype or phenotype that can respond
to the modulation of disease related gene expression in a cell or
tissue, alone or in combination with other therapies.
[0219] By "inflammatory disease" or "inflammatory condition" as
used herein is meant any disease, condition, trait, genotype or
phenotype characterized by an inflammatory or allergic process as
is known in the art, such as inflammation, acute inflammation,
chronic inflammation, respiratory disease, atherosclerosis,
restenosis, asthma, allergic rhinitis, atopic dermatitis, septic
shock, rheumatoid arthritis, inflammatory bowl disease,
inflammatory pelvic disease, pain, ocular inflammatory disease,
celiac disease, Leigh Syndrome, Glycerol Kinase Deficiency,
Familial eosinophilia (FE), autosomal recessive spastic ataxia,
laryngeal inflammatory disease; Tuberculosis, Chronic
cholecystitis, Bronchiectasis, Silicosis and other pneumoconioses,
neurological disease, respiratory disease, and any other
inflammatory disease, condition, trait, genotype or phenotype that
can respond to the modulation of disease related gene expression in
a cell or tissue, alone or in combination with other therapies.
[0220] By "autoimmune disease" or "autoimmune condition" as used
herein is meant, any disease, condition, trait, genotype or
phenotype characterized by autoimmunity as is known in the art,
such as multiple sclerosis, diabetes mellitus, lupus, celiac
disease, Crohn's disease, ulcerative colitis, Guillain-Barre
syndrome, scleroderms, Goodpasture's syndrome, Wegener's
granulomatosis, autoimmune epilepsy, Rasmussen's encephalitis,
Primary biliary sclerosis, Sclerosing cholangitis, Autoimmune
hepatitis, Addison's disease, Hashimoto's thyroiditis,
Fibromyalgia, Menier's syndrome; transplantation rejection (e.g.,
prevention of allograft rejection) pernicious anemia, rheumatoid
arthritis, systemic lupus erythematosus, dermatomyositis, Sjogren's
syndrome, lupus erythematosus, multiple sclerosis, myasthenia
gravis, Reiter's syndrome, Grave's disease, and any other
autoimmune disease, condition, trait, genotype or phenotype that
can respond to the modulation of disease related gene expression in
a cell or tissue, alone or in combination with other therapies.
[0221] By "neurological disease" or "neurological disease" is meant
any disease, disorder, or condition affecting the central or
peripheral nervous system, including ADHD, AIDS--Neurological
Complications, Absence of the Septum Pellucidum, Acquired
Epileptiform Aphasia, Acute Disseminated Encephalomyelitis,
Adrenoleukodystrophy, Agenesis of the Corpus Callosum, Agnosia,
Aicardi Syndrome, Alexander Disease, Alpers' Disease, Alternating
Hemiplegia, Alzheimer's Disease, Amyotrophic Lateral Sclerosis,
Anencephaly, Aneurysm, Angelman Syndrome, Angiomatosis, Anoxia,
Aphasia, Apraxia, Arachnoid Cysts, Arachnoiditis, Arnold-Chiari
Malformation, Arteriovenous Malformation, Aspartame, Asperger
Syndrome, Ataxia Telangiectasia, Ataxia, Attention
Deficit-Hyperactivity Disorder, Autism, Autonomic Dysfunction, Back
Pain, Barth Syndrome, Batten Disease, Behcet's Disease, Bell's
Palsy, Benign Essential Blepharospasm, Benign Focal Amyotrophy,
Benign Intracranial Hypertension, Bernhardt-Roth Syndrome,
Binswanger's Disease, Blepharospasm, Bloch-Sulzberget Syndrome,
Brachial Plexus Birth Injuries, Brachial Plexus Injuries,
Bradbury-Eggleston Syndrome, Brain Aneurysm, Brain Injury, Brain
and Spinal Tumors, Brown-Sequard Syndrome, Bulbospinal Muscular
Atrophy, Canavan Disease, Carpal Tunnel Syndrome, Causalgia,
Cavernomas, Cavernous Angioma, Cavernous Malformation, Central
Cervical Cord Syndrome, Central Cord Syndrome, Central Pain
Syndrome, Cephalic Disorders, Cerebellar Degeneration, Cerebellar
Hypoplasia, Cerebral Aneurysm, Cerebral Arteriosclerosis, Cerebral
Atrophy, Cerebral Beriberi, Cerebral Gigantism, Cerebral Hypoxia,
Cerebral Palsy, Cerebro-Oculo-Facio-Skeletal Syndrome,
Charcot-Marie-Tooth Disorder, Chiari Malformation, Chorea,
Choreoacanthocytosis, Chronic Inflammatory Demyelinating
Polyneuropathy (CIDP), Chronic Orthostatic Intolerance, Chronic
Pain, Cockayne Syndrome Type II, Coffin Lowry Syndrome, Coma,
including Persistent Vegetative State, Complex Regional Pain
Syndrome, Congenital Facial Diplegia, Congenital Myasthenia,
Congenital Myopathy, Congenital Vascular Cavernous Malformations,
Corticobasal Degeneration, Cranial Arteritis, Craniosynostosis,
Creutzfeldt-Jakob Disease, Cumulative Trauma Disorders, Cushing's
Syndrome, Cytomegalic Inclusion Body Disease (CIBD),
Cytomegalovirus Infection, Dancing Eyes-Dancing Feet Syndrome,
Dandy-Walker Syndrome, Dawson Disease, De Morsier's Syndrome,
Dejerine-Klumpke Palsy, Dementia--Multi-Infarct,
Dementia--Subcortical, Dementia With Lewy Bodies, Dermatomyositis,
Developmental Dyspraxia, Devic's Syndrome, Diabetic Neuropathy,
Diffuse Sclerosis, Dravet's Syndrome, Dysautonomia, Dysgraphia,
Dyslexia, Dysphagia, Dyspraxia, Dystonias, Early Infantile
Epileptic Encephalopathy, Empty Sella Syndrome, Encephalitis
Lethargica, Encephalitis and Meningitis, Encephaloceles,
Encephalopathy, Encephalotrigeminal Angiomatosis, Epilepsy, Erb's
Palsy, Erb-Duchenne and Dejerine-Klumpke Palsies, Fabry's Disease,
Fahr's Syndrome, Fainting, Familial Dysautonomia, Familial
Hemangioma, Familial Idiopathic Basal Ganglia Calcification,
Familial Spastic Paralysis, Febrile Seizures (e.g., GEFS and GEFS
plus), Fisher Syndrome, Floppy Infant Syndrome, Friedreich's
Ataxia, Gaucher's Disease, Gerstmann's Syndrome,
Gerstmann-Straussler-Scheinker Disease, Giant Cell Arteritis, Giant
Cell Inclusion Disease, Globoid Cell Leukodystrophy,
Glossopharyngeal Neuralgia, Guillain-Barre Syndrome, HTLV-1
Associated Myelopathy, Hallervorden-Spatz Disease, Head Injury,
Headache, Hemicrania Continua, Hemifacial Spasm, Hemiplegia
Alterans, Hereditary Neuropathies, Hereditary Spastic Paraplegia,
Heredopathia Atactica Polyneuritiformis, Herpes Zoster Oticus,
Herpes Zoster, Hirayama Syndrome, Holoprosencephaly, Huntington's
Disease, Hydranencephaly, Hydrocephalus--Normal Pressure,
Hydrocephalus, Hydromyelia, Hypercortisolism, Hypersomnia,
Hypertonia, Hypotonia, Hypoxia, Immune-Mediated Encephalomyelitis,
Inclusion Body Myositis, Incontinentia Pigmenti, Infantile
Hypotonia, Infantile Phytanic Acid Storage Disease, Infantile
Refsum Disease, Infantile Spasms, Inflammatory Myopathy, Intestinal
Lipodystrophy, Intracranial Cysts, Intracranial Hypertension,
Isaac's Syndrome, Joubert Syndrome, Kearns-Sayre Syndrome,
Kennedy's Disease, Kinsbourne syndrome, Kleine-Levin syndrome,
Klippel Feil Syndrome, Klippel-Trenaunay Syndrome (KTS),
Kliver-Bucy Syndrome, Korsakoffs Amnesic Syndrome, Krabbe Disease,
Kugelberg-Welander Disease, Kuru, Lambert-Eaton Myasthenic
Syndrome, Landau-Kleffner Syndrome, Lateral Femoral Cutaneous Nerve
Entrapment, Lateral Medullary Syndrome, Learning Disabilities,
Leigh's Disease, Lennox-Gastaut Syndrome, Lesch-Nyhan Syndrome,
Leukodystrophy, Levine-Critchley Syndrome, Lewy Body Dementia,
Lissencephaly, Locked-In Syndrome, Lou Gehrig's Disease,
Lupus--Neurological Sequelae, Lyme Disease--Neurological
Complications, Machado-Joseph Disease, Macrencephaly,
Megalencephaly, Melkersson-Rosenthal Syndrome, Meningitis, Menkes
Disease, Meralgia Paresthetica, Metachromatic Leukodystrophy,
Microcephaly, Migraine, Miller Fisher Syndrome, Mini-Strokes,
Mitochondrial Myopathies, Mobius Syndrome, Monomelic Amyotrophy,
Motor Neuron Diseases, Moyamoya Disease, Mucolipidoses,
Mucopolysaccharidoses, Multi-Infarct Dementia, Multifocal Motor
Neuropathy, Multiple Sclerosis, Multiple System Atrophy with
Orthostatic Hypotension, Multiple System Atrophy, Muscular
Dystrophy, Myasthenia--Congenital, Myasthenia Gravis,
Myelinoclastic Diffuse Sclerosis, Myoclonic Encephalopathy of
Infants, Myoclonus, Myopathy--Congenital, Myopathy--Thyrotoxic,
Myopathy, Myotonia Congenita, Myotonia, Narcolepsy,
Neuroacanthocytosis, Neurodegeneration with Brain Iron
Accumulation, Neurofibromatosis, Neuroleptic Malignant Syndrome,
Neurological Complications of AIDS, Neurological Manifestations of
Pompe Disease, Neuromyelitis Optica, Neuromyotonia, Neuronal Ceroid
Lipofuscinosis, Neuronal Migration Disorders,
Neuropathy--Hereditary, Neurosarcoidosis, Neurotoxicity, Nevus
Cavernosus, Niemann-Pick Disease, O'Sullivan-McLeod Syndrome,
Occipital Neuralgia, Occult Spinal Dysraphism Sequence, Ohtahara
Syndrome, Olivopontocerebellar Atrophy, Opsoclonus Myoclonus,
Orthostatic Hypotension, Overuse Syndrome, Pain--Chronic,
Paraneoplastic Syndromes, Paresthesia, Parkinson's Disease,
Parmyotonia Congenita, Paroxysmal Choreoathetosis, Paroxysmal
Hemicrania, Parry-Romberg, Pelizaeus-Merzbacher Disease, Pena
Shokeir II Syndrome, Perineural Cysts, Periodic Paralyses,
Peripheral Neuropathy, Periventricular Leukomalacia, Persistent
Vegetative State, Pervasive Developmental Disorders, Phytanic Acid
Storage Disease, Pick's Disease, Piriformis Syndrome, Pituitary
Tumors, Polymyositis, Pompe Disease, Porencephaly, Post-Polio
Syndrome, Postherpetic Neuralgia, Postinfectious Encephalomyelitis,
Postural Hypotension, Postural Orthostatic Tachycardia Syndrome,
Postural Tachycardia Syndrome, Primary Lateral Sclerosis, Prion
Diseases, Progressive Hemifacial Atrophy, Progressive Locomotor
Ataxia, Progressive Multifocal Leukoencephalopathy, Progressive
Sclerosing Poliodystrophy, Progressive Supranuclear Palsy,
Pseudotumor Cerebri, Pyridoxine Dependent and Pyridoxine Responsive
Siezure Disorders, Ramsay Hunt Syndrome Type I, Ramsay Hunt
Syndrome Type II, Rasmussen's Encephalitis and other autoimmune
epilepsies, Reflex Sympathetic Dystrophy Syndrome, Refsum
Disease--Infantile, Refsum Disease, Repetitive Motion Disorders,
Repetitive Stress Injuries, Restless Legs Syndrome,
Retrovirus-Associated Myelopathy, Rett Syndrome, Reye's Syndrome,
Riley-Day Syndrome, SUNCT Headache, Sacral Nerve Root Cysts, Saint
Vitus Dance, Salivary Gland Disease, Sandhoff Disease, Schilder's
Disease, Schizencephaly, Seizure Disorders, Septo-Optic Dysplasia,
Severe Myoclonic Epilepsy of Infancy (SMEI), Shaken Baby Syndrome,
Shingles, Shy-Drager Syndrome, Sjogren's Syndrome, Sleep Apnea,
Sleeping Sickness, Soto's Syndrome, Spasticity, Spina Bifida,
Spinal Cord Infarction, Spinal Cord Injury, Spinal Cord Tumors,
Spinal Muscular Atrophy, Spinocerebellar Atrophy,
Steele-Richardson-Olszewski Syndrome, Stiff-Person Syndrome,
Striatonigral Degeneration, Stroke, Sturge-Weber Syndrome, Subacute
Sclerosing Panencephalitis, Subcortical Arteriosclerotic
Encephalopathy, Swallowing Disorders, Sydenham Chorea, Syncope,
Syphilitic Spinal Sclerosis, Syringohydromyelia, Syringomyelia,
Systemic Lupus Erythematosus, Tabes Dorsalis, Tardive Dyskinesia,
Tarlov Cysts, Tay-Sachs Disease, Temporal Arteritis, Tethered
Spinal Cord Syndrome, Thomsen Disease, Thoracic Outlet Syndrome,
Thyrotoxic Myopathy, Tic Douloureux, Todd's Paralysis, Tourette
Syndrome, Transient Ischemic Attack, Transmissible Spongiform
Encephalopathies, Transverse Myelitis, Traumatic Brain Injury,
Tremor, Trigeminal Neuralgia, Tropical Spastic Paraparesis,
Tuberous Sclerosis, Vascular Erectile Tumor, Vasculitis including
Temporal Arteritis, Von Economo's Disease, Von Hippel-Lindau
disease (VHL), Von Recklinghausen's Disease, Wallenberg's Syndrome,
Werdnig-Hoffman Disease, Wemicke-Korsakoff Syndrome, West Syndrome,
Whipple's Disease, Williams Syndrome, Wilson's Disease, X-Linked
Spinal and Bulbar Muscular Atrophy, and Zellweger Syndrome.
[0222] By "respiratory disease" is meant, any disease or condition
affecting the respiratory tract, such as asthma, chronic
obstructive pulmonary disease or "COPD", allergic rhinitis,
sinusitis, pulmonary vasoconstriction, inflammation, allergies,
impeded respiration, respiratory distress syndrome, cystic
fibrosis, pulmonary hypertension, pulmonary vasoconstriction,
emphysema, and any other respiratory disease, condition, trait,
genotype or phenotype that can respond to the modulation of disease
related gene expression in a cell or tissue, alone or in
combination with other therapies.
[0223] In one embodiment of the present invention, each sequence of
an siNA molecule of the invention is independently about 15 to
about 30 nucleotides in length, in specific embodiments about 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30
nucleotides in length. In another embodiment, the siNA duplexes of
the invention independently comprise about 15 to about 30 base
pairs (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, or 30). In another embodiment, one or more strands of
the siNA molecule of the invention independently comprises about 15
to about 30 nucleotides (e.g., about 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, or 30) that are complementary to a
target nucleic acid molecule. In yet another embodiment, siNA
molecules of the invention comprising hairpin or circular
structures are about 35 to about 55 (e.g., about 35, 40, 45, 50 or
55) nucleotides in length, or about 38 to about 44 (e.g., about 38,
39, 40, 41, 42, 43, or 44) nucleotides in length and comprising
about 15 to about 25 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, or 25) base pairs. Exemplary siNA molecules of the
invention are shown in Table II. Exemplary synthetic siNA molecules
of the invention are shown in Table III and/or FIGS. 4-5.
[0224] As used herein "cell" is used in its usual biological sense,
and does not refer to an entire multicellular organism, e.g.,
specifically does not refer to a human. The cell can be present in
an organism, e.g., birds, plants and mammals such as humans, cows,
sheep, apes, monkeys, swine, dogs, and cats. The cell can be
prokaryotic (e.g., bacterial cell) or eukaryotic (e.g., mammalian
or plant cell). The cell can be of somatic or germ line origin,
totipotent or pluripotent, dividing or non-dividing. The cell can
also be derived from or can comprise a gamete or embryo, a stem
cell, or a fully differentiated cell.
[0225] The siNA molecules of the invention are added directly, or
can be complexed with cationic lipids, packaged within liposomes,
or otherwise delivered to target cells or tissues. The nucleic acid
or nucleic acid complexes can be locally administered to relevant
tissues ex vivo, or in vivo through direct dermal application,
transdermal application, or injection, with or without their
incorporation in biopolymers. In particular embodiments, the
nucleic acid molecules of the invention comprise sequences shown in
Tables II-III and/or FIGS. 4-5. Examples of such nucleic acid
molecules consist essentially of sequences defined in these tables
and figures. Furthermore, the chemically modified constructs
described in Table IV can be applied to any siNA sequence of the
invention.
[0226] In another aspect, the invention provides mammalian cells
containing one or more siNA molecules of this invention. The one or
more siNA molecules can independently be targeted to the same or
different sites.
[0227] By "RNA" is meant a molecule comprising at least one
ribonucleotide residue. By "ribonucleotide" is meant a nucleotide
with a hydroxyl group at the 2' position of a .beta.-D-ribofuranose
moiety. The terms include double-stranded RNA, single-stranded RNA,
isolated RNA such as partially purified RNA, essentially pure RNA,
synthetic RNA, recombinantly produced RNA, as well as altered RNA
that differs from naturally occurring RNA by the addition,
deletion, substitution and/or alteration of one or more
nucleotides. Such alterations can include addition of
non-nucleotide material, such as to the end(s) of the siNA or
internally, for example at one or more nucleotides of the RNA.
Nucleotides in the RNA molecules of the instant invention can also
comprise non-standard nucleotides, such as non-naturally occurring
nucleotides or chemically synthesized nucleotides or
deoxynucleotides. These altered RNAs can be referred to as analogs
or analogs of naturally-occurring RNA.
[0228] By "subject" is meant an organism, which is a donor or
recipient of explanted cells or the cells themselves. "Subject"
also refers to an organism to which the nucleic acid molecules of
the invention can be administered. A subject can be a mammal or
mammalian cells, including a human or human cells.
[0229] The term "phosphorothioate" as used herein refers to an
internucleotide linkage having Formula I, wherein Z and/or W
comprise a sulfur atom. Hence, the term phosphorothioate refers to
both phosphorothioate and phosphorodithioate internucleotide
linkages.
[0230] The term "phosphonoacetate" as used herein refers to an
internucleotide linkage having Formula I, wherein Z and/or W
comprise an acetyl or protected acetyl group.
[0231] The term "thiophosphonoacetate" as used herein refers to an
internucleotide linkage having Formula I, wherein Z comprises an
acetyl or protected acetyl group and W comprises a sulfur atom or
alternately W comprises an acetyl or protected acetyl group and Z
comprises a sulfur atom.
[0232] The term "universal base" as used herein refers to
nucleotide base analogs that form base pairs with each of the
natural DNA/RNA bases with little discrimination between them.
Non-limiting examples of universal bases include C-phenyl,
C-naphthyl and other aromatic derivatives, inosine, azole
carboxamides, and nitroazole derivatives such as 3-nitropyrrole,
4-nitroindole, 5-nitroindole, and 6-nitroindole as known in the art
(see for example Loakes, 2001, Nucleic Acids Research, 29,
2437-2447).
[0233] The term "acyclic nucleotide" as used herein refers to any
nucleotide having an acyclic ribose sugar.
[0234] The nucleic acid molecules of the instant invention,
individually, or in combination or in conjunction with other drugs,
can be used to for preventing or treating inflammatory, autoimmune,
cancer and proliferative diseases, conditions, or disorders in a
subject or organism.
[0235] For example, the siNA molecules can be administered to a
subject or can be administered to other appropriate cells evident
to those skilled in the art, individually or in combination with
one or more drugs under conditions suitable for the treatment.
[0236] In a further embodiment, the siNA molecules can be used in
combination with other known treatments to prevent or treat
inflammatory, autoimmune, cancer and proliferative diseases,
conditions, or disorders in a subject or organism. For example, the
described molecules could be used in combination with one or more
known compounds, treatments, or procedures to prevent or treat
inflammatory, autoimmune, cancer and proliferative diseases,
conditions, or disorders in a subject or organism as are known in
the art.
[0237] In one embodiment, the invention features an expression
vector comprising a nucleic acid sequence encoding at least one
siNA molecule of the invention, in a manner which allows expression
of the siNA molecule. For example, the vector can contain
sequence(s) encoding both strands of an siNA molecule comprising a
duplex. The vector can also contain sequence(s) encoding a single
nucleic acid molecule that is self-complementary and thus forms an
siNA molecule. Non-limiting examples of such expression vectors are
described in Paul et al., 2002, Nature Biotechnology, 19, 505;
Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497; Lee et
al., 2002, Nature Biotechnology, 19, 500; and Novina et al., 2002,
Nature Medicine, advance online publication doi:10.1038/nm725.
[0238] In another embodiment, the invention features a mammalian
cell, for example, a human cell, including an expression vector of
the invention.
[0239] In yet another embodiment, the expression vector of the
invention comprises a sequence for an siNA molecule having
complementarity to a RNA molecule referred to by a Genbank
Accession numbers, for example Genbank Accession Nos. shown in
Table I.
[0240] In one embodiment, an expression vector of the invention
comprises a nucleic acid sequence encoding two or more siNA
molecules, which can be the same or different.
[0241] In another aspect of the invention, siNA molecules that
interact with target RNA molecules and down-regulate gene encoding
target RNA molecules (for example target RNA molecules referred to
by Genbank Accession numbers herein) are expressed from
transcription units inserted into DNA or RNA vectors. The
recombinant vectors can be DNA plasmids or viral vectors. siNA
expressing viral vectors can be constructed based on, but not
limited to, adeno-associated virus, retrovirus, adenovirus, or
alphavirus. The recombinant vectors capable of expressing the siNA
molecules can be delivered as described herein, and persist in
target cells. Alternatively, viral vectors can be used that provide
for transient expression of siNA molecules. Such vectors can be
repeatedly administered as necessary. Once expressed, the siNA
molecules bind and down-regulate gene function or expression via
RNA interference (RNAi). Delivery of siNA expressing vectors can be
systemic, such as by intravenous or intramuscular administration,
by administration to target cells ex-planted from a subject
followed by reintroduction into the subject, or by any other means
that would allow for introduction into the desired target cell.
[0242] By "vectors" is meant any nucleic acid- and/or viral-based
technique used to deliver a desired nucleic acid.
[0243] Other features and advantages of the invention will be
apparent from the following description of the preferred
embodiments thereof, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0244] FIG. 1 shows a non-limiting example of a scheme for the
synthesis of siNA molecules. The complementary siNA sequence
strands, strand 1 and strand 2, are synthesized in tandem and are
connected by a cleavable linkage, such as a nucleotide succinate or
abasic succinate, which can be the same or different from the
cleavable linker used for solid phase synthesis on a solid support.
The synthesis can be either solid phase or solution phase, in the
example shown, the synthesis is a solid phase synthesis. The
synthesis is performed such that a protecting group, such as a
dimethoxytrityl group, remains intact on the terminal nucleotide of
the tandem oligonucleotide. Upon cleavage and deprotection of the
oligonucleotide, the two siNA strands spontaneously hybridize to
form an siNA duplex, which allows the purification of the duplex by
utilizing the properties of the terminal protecting group, for
example by applying a trityl on purification method wherein only
duplexes/oligonucleotides with the terminal protecting group are
isolated.
[0245] FIG. 2 shows a MALDI-TOF mass spectrum of a purified siNA
duplex synthesized by a method of the invention. The two peaks
shown correspond to the predicted mass of the separate siNA
sequence strands. This result demonstrates that the siNA duplex
generated from tandem synthesis can be purified as a single entity
using a simple trityl-on purification methodology.
[0246] FIG. 3 shows a non-limiting proposed mechanistic
representation of target RNA degradation involved in RNAi.
Double-stranded RNA (dsRNA), which is generated by RNA-dependent
RNA polymerase (RdRP) from foreign single-stranded RNA, for example
viral, transposon, or other exogenous RNA, activates the DICER
enzyme that in turn generates siNA duplexes. Alternately, synthetic
or expressed siNA can be introduced directly into a cell by
appropriate means. An active siNA complex forms which recognizes a
target RNA, resulting in degradation of the target RNA by the RISC
endonuclease complex or in the synthesis of additional RNA by RNA
dependent RNA polymerase (RdRP), which can activate DICER and
result in additional siNA molecules, thereby amplifying the RNAi
response.
[0247] FIG. 4A-F shows non-limiting examples of chemically modified
siNA constructs of the present invention. In the figure, N stands
for any nucleotide (adenosine, guanosine, cytosine, uridine, or
optionally thymidine, for example thymidine can be substituted in
the overhanging regions designated by parenthesis (N N). Various
modifications are shown for the sense and antisense strands of the
siNA constructs. The antisense strand of constructs A-F comprise
sequence complementary to any target nucleic acid sequence of the
invention. Furthermore, when a glyceryl moiety (L) is present at
the 3'-end of the antisense strand for any construct shown in FIG.
4 A-F, the modified internucleotide linkage is optional.
[0248] FIG. 4A: The sense strand comprises 21 nucleotides wherein
the two terminal 3'-nucleotides are optionally base paired and
wherein all nucleotides present are ribonucleotides except for (N
N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. The antisense strand comprises 21 nucleotides,
optionally having a 3'-terminal glyceryl moiety wherein the two
terminal 3'-nucleotides are optionally complementary to the target
RNA sequence, and wherein all nucleotides present are
ribonucleotides except for (N N) nucleotides, which can comprise
ribonucleotides, deoxynucleotides, universal bases, or other
chemical modifications described herein. A modified internucleotide
linkage, such as a phosphorothioate, phosphorodithioate or other
modified internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the antisense
strand.
[0249] FIG. 4B: The sense strand comprises 21 nucleotides wherein
the two terminal 3'-nucleotides are optionally base paired and
wherein all pyrimidine nucleotides that may be present are
2'deoxy-2'-fluoro modified nucleotides and all purine nucleotides
that may be present are 2'-O-methyl modified nucleotides except for
(N N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. The antisense strand comprises 21 nucleotides,
optionally having a 3'-terminal glyceryl moiety and wherein the two
terminal 3'-nucleotides are optionally complementary to the target
RNA sequence, and wherein all pyrimidine nucleotides that may be
present are 2'-deoxy-2'-fluoro modified nucleotides and all purine
nucleotides that may be present are 2'-O-methyl modified
nucleotides except for (N N) nucleotides, which can comprise
ribonucleotides, deoxynucleotides, universal bases, or other
chemical modifications described herein. A modified internucleotide
linkage, such as a phosphorothioate, phosphorodithioate or other
modified internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the sense and
antisense strand.
[0250] FIG. 4C: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-O-methyl or
2'-deoxy-2'-fluoro modified nucleotides except for (N N)
nucleotides, which can comprise ribonucleotides, deoxynucleotides,
universal bases, or other chemical modifications described herein.
The antisense strand comprises 21 nucleotides, optionally having a
3'-terminal glyceryl moiety and wherein the two terminal
3'-nucleotides are optionally complementary to the target RNA
sequence, and wherein all pyrimidine nucleotides that may be
present are 2'-deoxy-2'-fluoro modified nucleotides except for (N
N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. A modified internucleotide linkage, such as a
phosphorothioate, phosphorodithioate or other modified
internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the antisense
strand.
[0251] FIG. 4D: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides except for (N N) nucleotides, which can
comprise ribonucleotides, deoxynucleotides, universal bases, or
other chemical modifications described herein and wherein and all
purine nucleotides that may be present are 2'-deoxy nucleotides.
The antisense strand comprises 21 nucleotides, optionally having a
3'-terminal glyceryl moiety and wherein the two terminal
3'-nucleotides are optionally complementary to the target RNA
sequence, wherein all pyrimidine nucleotides that may be present
are 2'-deoxy-2'-fluoro modified nucleotides and all purine
nucleotides that may be present are 2'-O-methyl modified
nucleotides except for (N N) nucleotides, which can comprise
ribonucleotides, deoxynucleotides, universal bases, or other
chemical modifications described herein. A modified internucleotide
linkage, such as a phosphorothioate, phosphorodithioate or other
modified internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the antisense
strand.
[0252] FIG. 4E: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides except for (N N) nucleotides, which can
comprise ribonucleotides, deoxynucleotides, universal bases, or
other chemical modifications described herein. The antisense strand
comprises 21 nucleotides, optionally having a 3'-terminal glyceryl
moiety and wherein the two terminal 3'-nucleotides are optionally
complementary to the target RNA sequence, and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides and all purine nucleotides that may be present
are 2'-O-methyl modified nucleotides except for (N N) nucleotides,
which can comprise ribonucleotides, deoxynucleotides, universal
bases, or other chemical modifications described herein. A modified
internucleotide linkage, such as a phosphorothioate,
phosphorodithioate or other modified internucleotide linkage as
described herein, shown as "s", optionally connects the (N N)
nucleotides in the antisense strand.
[0253] FIG. 4F: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides except for (N N) nucleotides, which can
comprise ribonucleotides, deoxynucleotides, universal bases, or
other chemical modifications described herein and wherein and all
purine nucleotides that may be present are 2'-deoxy nucleotides.
The antisense strand comprises 21 nucleotides, optionally having a
3'-terminal glyceryl moiety and wherein the two terminal
3'-nucleotides are optionally complementary to the target RNA
sequence, and having one 3'-terminal phosphorothioate
internucleotide linkage and wherein all pyrimidine nucleotides that
may be present are 2'-deoxy-2'-fluoro modified nucleotides and all
purine nucleotides that may be present are 2'-deoxy nucleotides
except for (N N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. A modified internucleotide linkage, such as a
phosphorothioate, phosphorodithioate or other modified
internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the antisense
strand.
[0254] FIG. 5A-F shows non-limiting examples of specific chemically
modified siNA sequences of the invention. A-F applies the chemical
modifications described in FIG. 4A-F to an ICAM siNA sequence. Such
chemical modifications can be applied to any ICAM sequence and/or
ICAM polymorphism sequence.
[0255] FIG. 6 shows non-limiting examples of different siNA
constructs of the invention. The examples shown (constructs 1, 2,
and 3) have 19 representative base pairs; however, different
embodiments of the invention include any number of base pairs
described herein. Bracketed regions represent nucleotide overhangs,
for example, comprising about 1, 2, 3, or 4 nucleotides in length,
preferably about 2 nucleotides. Constructs 1 and 2 can be used
independently for RNAi activity. Construct 2 can comprise a
polynucleotide or non-nucleotide linker, which can optionally be
designed as a biodegradable linker. In one embodiment, the loop
structure shown in construct 2 can comprise a biodegradable linker
that results in the formation of construct 1 in vivo and/or in
vitro. In another example, construct 3 can be used to generate
construct 2 under the same principle wherein a linker is used to
generate the active siNA construct 2 in vivo and/or in vitro, which
can optionally utilize another biodegradable linker to generate the
active siNA construct 1 in vivo and/or in vitro. As such, the
stability and/or activity of the siNA constructs can be modulated
based on the design of the siNA construct for use in vivo or in
vitro and/or in vitro.
[0256] FIG. 7A-C is a diagrammatic representation of a scheme
utilized in generating an expression cassette to generate siNA
hairpin constructs.
[0257] FIG. 7A: A DNA oligomer is synthesized with a 5'-restriction
site (R1) sequence followed by a region having sequence identical
(sense region of siNA) to a predetermined ICAM target sequence,
wherein the sense region comprises, for example, about 19, 20, 21,
or 22 nucleotides (N) in length, which is followed by a loop
sequence of defined sequence (X), comprising, for example, about 3
to about 10 nucleotides.
[0258] FIG. 7B: The synthetic construct is then extended by DNA
polymerise to generate a hairpin structure having
self-complementary sequence that will result in an siNA transcript
having specificity for an ICAM target sequence and having
self-complementary sense and antisense regions.
[0259] FIG. 7C: The construct is heated (for example to about
95.degree. C.) to linearize the sequence, thus allowing extension
of a complementary second DNA strand using a primer to the
3'-restriction sequence of the first strand. The double-stranded
DNA is then inserted into an appropriate vector for expression in
cells. The construct can be designed such that a 3'-terminal
nucleotide overhang results from the transcription, for example, by
engineering restriction sites and/or utilizing a poly-U termination
region as described in Paul et al., 2002, Nature Biotechnology, 29,
505-508.
[0260] FIG. 8A-C is a diagrammatic representation of a scheme
utilized in generating an expression cassette to generate
double-stranded siNA constructs.
[0261] FIG. 8A: A DNA oligomer is synthesized with a 5'-restriction
(R1) site sequence followed by a region having sequence identical
(sense region of siNA) to a predetermined ICAM target sequence,
wherein the sense region comprises, for example, about 19, 20, 21,
or 22 nucleotides (N) in length, and which is followed by a
3'-restriction site (R2) which is adjacent to a loop sequence of
defined sequence (X).
[0262] FIG. 8B: The synthetic construct is then extended by DNA
polymerase to generate a hairpin structure having
self-complementary sequence.
[0263] FIG. 8C: The construct is processed by restriction enzymes
specific to R1 and R2 to generate a double-stranded DNA which is
then inserted into an appropriate vector for expression in cells.
The transcription cassette is designed such that a U6 promoter
region flanks each side of the dsDNA which generates the separate
sense and antisense strands of the siNA. Poly T termination
sequences can be added to the constructs to generate U overhangs in
the resulting transcript.
[0264] FIG. 9A-E is a diagrammatic representation of a method used
to determine target sites for siNA mediated RNAi within a
particular target nucleic acid sequence, such as messenger RNA.
[0265] FIG. 9A: A pool of siNA oligonucleotides are synthesized
wherein the antisense region of the siNA constructs has
complementarity to target sites across the target nucleic acid
sequence, and wherein the sense region comprises sequence
complementary to the antisense region of the siNA.
[0266] FIGS. 9B&C: (FIG. 9B) The sequences are pooled and are
inserted into vectors such that (FIG. 9C) transfection of a vector
into cells results in the expression of the siNA.
[0267] FIG. 9D: Cells are sorted based on phenotypic change that is
associated with modulation of the target nucleic acid sequence.
[0268] FIG. 9E: The siNA is isolated from the sorted cells and is
sequenced to identify efficacious target sites within the target
nucleic acid sequence.
[0269] FIG. 10 shows non-limiting examples of different
stabilization chemistries (1-10) that can be used, for example, to
stabilize the 3'-end of siNA sequences of the invention, including
(1) [3-3']-inverted deoxyribose; (2) deoxyribonucleotide; (3)
[5'-3']-3'-deoxyribonucleotide; (4) [5'-3']-ribonucleotide; (5)
[5'-3']-3'-O-methyl ribonucleotide; (6) 3'-glyceryl; (7)
[3'-5']-3'-deoxyribonucleotide; (8) [3'-3']-deoxyribonucleotide;
(9) [5'-2']-deoxyribonucleotide; and (10)
[5-3']-dideoxyribonucleotide. In addition to modified and
unmodified backbone chemistries indicated in the figure, these
chemistries can be combined with different backbone modifications
as described herein, for example, backbone modifications having
Formula I. In addition, the 2'-deoxy nucleotide shown 5' to the
terminal modifications shown can be another modified or unmodified
nucleotide or non-nucleotide described herein, for example
modifications having any of Formulae I-VII or any combination
thereof.
[0270] FIG. 11 shows a non-limiting example of a strategy used to
identify chemically modified siNA constructs of the invention that
are nuclease resistance while preserving the ability to mediate
RNAi activity. Chemical modifications are introduced into the siNA
construct based on educated design parameters (e.g. introducing
2'-modifications, base modifications, backbone modifications,
terminal cap modifications etc). The modified construct in tested
in an appropriate system (e.g. human serum for nuclease resistance,
shown, or an animal model for PK/delivery parameters). In parallel,
the siNA construct is tested for RNAi activity, for example in a
cell culture system such as a luciferase reporter assay). Lead siNA
constructs are then identified which possess a particular
characteristic while maintaining RNAi activity, and can be further
modified and assayed once again. This same approach can be used to
identify siNA-conjugate molecules with improved pharmacokinetic
profiles, delivery, and RNAi activity.
[0271] FIG. 12 shows non-limiting examples of phosphorylated siNA
molecules of the invention, including linear and duplex constructs
and asymmetric derivatives thereof.
[0272] FIG. 13 shows non-limiting examples of chemically modified
terminal phosphate groups of the invention.
[0273] FIG. 14A shows a non-limiting example of methodology used to
design self complementary DFO constructs utilizing palidrome and/or
repeat nucleic acid sequences that are identified in a target
nucleic acid sequence. (i) A palindrome or repeat sequence is
identified in a nucleic acid target sequence. (ii) A sequence is
designed that is complementary to the target nucleic acid sequence
and the palindrome sequence. (iii) An inverse repeat sequence of
the non-palindrome/repeat portion of the complementary sequence is
appended to the 3'-end of the complementary sequence to generate a
self complementary DFO molecule comprising sequence complementary
to the nucleic acid target. (iv) The DFO molecule can self-assemble
to form a double-stranded oligonucleotide. FIG. 14B shows a
non-limiting representative example of a duplex forming
oligonucleotide sequence. FIG. 14C shows a non-limiting example of
the self assembly schematic of a representative duplex forming
oligonucleotide sequence. FIG. 14D shows a non-limiting example of
the self assembly schematic of a representative duplex forming
oligonucleotide sequence followed by interaction with a target
nucleic acid sequence resulting in modulation of gene
expression.
[0274] FIG. 15 shows a non-limiting example of the design of self
complementary DFO constructs utilizing palidrome and/or repeat
nucleic acid sequences that are incorporated into the DFO
constructs that have sequence complementary to any target nucleic
acid sequence of interest. Incorporation of these palindrome/repeat
sequences allow the design of DFO constructs that form duplexes in
which each strand is capable of mediating modulation of target gene
expression, for example by RNAi. First, the target sequence is
identified. A complementary sequence is then generated in which
nucleotide or non-nucleotide modifications (shown as X or Y) are
introduced into the complementary sequence that generate an
artificial palindrome (shown as XYXYXY in the Figure). An inverse
repeat of the non-palindrome/repeat complementary sequence is
appended to the 3'-end of the complementary sequence to generate a
self complementary DFO comprising sequence complementary to the
nucleic acid target. The DFO can self-assemble to form a
double-stranded oligonucleotide.
[0275] FIG. 16 shows non-limiting examples of multifunctional siNA
molecules of the invention comprising two separate polynucleotide
sequences that are each capable of mediating RNAi directed cleavage
of differing target nucleic acid sequences. FIG. 16A shows a
non-limiting example of a multifunctional siNA molecule having a
first region that is complementary to a first target nucleic acid
sequence (complementary region 1) and a second region that is
complementary to a second target nucleic acid sequence
(complementary region 2), wherein the first and second
complementary regions are situated at the 3'-ends of each
polynucleotide sequence in the multifunctional siNA. The dashed
portions of each polynucleotide sequence of the multifunctional
siNA construct have complementarity with regard to corresponding
portions of the siNA duplex, but do not have complementarity to the
target nucleic acid sequences. FIG. 16B shows a non-limiting
example of a multifunctional siNA molecule having a first region
that is complementary to a first target nucleic acid sequence
(complementary region 1) and a second region that is complementary
to a second target nucleic acid sequence (complementary region 2),
wherein the first and second complementary regions are situated at
the 5'-ends of each polynucleotide sequence in the multifunctional
siNA. The dashed portions of each polynucleotide sequence of the
multifunctional siNA construct have complementarity with regard to
corresponding portions of the siNA duplex, but do not have
complementarity to the target nucleic acid sequences.
[0276] FIG. 17 shows non-limiting examples of multifunctional siNA
molecules of the invention comprising a single polynucleotide
sequence comprising distinct regions that are each capable of
mediating RNAi directed cleavage of differing target nucleic acid
sequences. FIG. 17A shows a non-limiting example of a
multifunctional siNA molecule having a first region that is
complementary to a first target nucleic acid sequence
(complementary region 1) and a second region that is complementary
to a second target nucleic acid sequence (complementary region 2),
wherein the second complementary region is situated at the 3'-end
of the polynucleotide sequence in the multifunctional siNA. The
dashed portions of each polynucleotide sequence of the
multifunctional siNA construct have complementarity with regard to
corresponding portions of the siNA duplex, but do not have
complementarity to the target nucleic acid sequences. FIG. 17B
shows a non-limiting example of a multifunctional siNA molecule
having a first region that is complementary to a first target
nucleic acid sequence (complementary region 1) and a second region
that is complementary to a second target nucleic acid sequence
(complementary region 2), wherein the first complementary region is
situated at the 5'-end of the polynucleotide sequence in the
multifunctional siNA. The dashed portions of each polynucleotide
sequence of the multifunctional siNA construct have complementarity
with regard to corresponding portions of the siNA duplex, but do
not have complementarity to the target nucleic acid sequences. In
one embodiment, these multifunctional siNA constructs are processed
in vivo or in vitro to generate multifunctional siNA constructs as
shown in FIG. 16.
[0277] FIG. 18 shows non-limiting examples of multifunctional siNA
molecules of the invention comprising two separate polynucleotide
sequences that are each capable of mediating RNAi directed cleavage
of differing target nucleic acid sequences and wherein the
multifunctional siNA construct further comprises a self
complementary, palindrome, or repeat region, thus enabling shorter
bifunctional siNA constructs that can mediate RNA interference
against differing target nucleic acid sequences. FIG. 18A shows a
non-limiting example of a multifunctional siNA molecule having a
first region that is complementary to a first target nucleic acid
sequence (complementary region 1) and a second region that is
complementary to a second target nucleic acid sequence
(complementary region 2), wherein the first and second
complementary regions are situated at the 3'-ends of each
polynucleotide sequence in the multifunctional siNA, and wherein
the first and second complementary regions further comprise a self
complementary, palindrome, or repeat region. The dashed portions of
each polynucleotide sequence of the multifunctional siNA construct
have complementarity with regard to corresponding portions of the
siNA duplex, but do not have complementarity to the target nucleic
acid sequences. FIG. 18B shows a non-limiting example of a
multifunctional siNA molecule having a first region that is
complementary to a first target nucleic acid sequence
(complementary region 1) and a second region that is complementary
to a second target nucleic acid sequence (complementary region 2),
wherein the first and second complementary regions are situated at
the 5'-ends of each polynucleotide sequence in the multifunctional
siNA, and wherein the first and second complementary regions
further comprise a self complementary, palindrome, or repeat
region. The dashed portions of each polynucleotide sequence of the
multifunctional siNA construct have complementarity with regard to
corresponding portions of the siNA duplex, but do not have
complementarity to the target nucleic acid sequences.
[0278] FIG. 19 shows non-limiting examples of multifunctional siNA
molecules of the invention comprising a single polynucleotide
sequence comprising distinct regions that are each capable of
mediating RNAi directed cleavage of differing target nucleic acid
sequences and wherein the multifunctional siNA construct further
comprises a self complementary, palindrome, or repeat region, thus
enabling shorter bifunctional siNA constructs that can mediate RNA
interference against differing target nucleic acid sequences. FIG.
19A shows a non-limiting example of a multifunctional siNA molecule
having a first region that is complementary to a first target
nucleic acid sequence (complementary region 1) and a second region
that is complementary to a second target nucleic acid sequence
(complementary region 2), wherein the second complementary region
is situated at the 3'-end of the polynucleotide sequence in the
multifunctional siNA, and wherein the first and second
complementary regions further comprise a self complementary,
palindrome, or repeat region. The dashed portions of each
polynucleotide sequence of the multifunctional siNA construct have
complementarity with regard to corresponding portions of the siNA
duplex, but do not have complementarity to the target nucleic acid
sequences. FIG. 19B shows a non-limiting example of a
multifunctional siNA molecule having a first region that is
complementary to a first target nucleic acid sequence
(complementary region 1) and a second region that is complementary
to a second target nucleic acid sequence (complementary region 2),
wherein the first complementary region is situated at the 5'-end of
the polynucleotide sequence in the multifunctional siNA, and
wherein the first and second complementary regions further comprise
a self complementary, palindrome, or repeat region. The dashed
portions of each polynucleotide sequence of the multifunctional
siNA construct have complementarity with regard to corresponding
portions of the siNA duplex, but do not have complementarity to the
target nucleic acid sequences. In one embodiment, these
multifunctional siNA constructs are processed in vivo or in vitro
to generate multifunctional siNA constructs as shown in FIG.
18.
[0279] FIG. 20 shows a non-limiting example of how multifunctional
siNA molecules of the invention can target two separate target
nucleic acid molecules, such as separate RNA molecules encoding
differing proteins, for example, a cytokine and its corresponding
receptor, differing viral strains, a virus and a cellular protein
involved in viral infection or replication, or differing proteins
involved in a common or divergent biologic pathway that is
implicated in the maintenance of progression of disease. Each
strand of the multifunctional siNA construct comprises a region
having complementarity to separate target nucleic acid molecules.
The multifunctional siNA molecule is designed such that each strand
of the siNA can be utilized by the RISC complex to initiate RNA
interference mediated cleavage of its corresponding target. These
design parameters can include destabilization of each end of the
siNA construct (see for example Schwarz et al., 2003, Cell, 115,
199-208). Such destabilization can be accomplished for example by
using guanosine-cytidine base pairs, alternate base pairs (e.g.,
wobbles), or destabilizing chemically modified nucleotides at
terminal nucleotide positions as is known in the art.
[0280] FIG. 21 shows a non-limiting example of how multifunctional
siNA molecules of the invention can target two separate target
nucleic acid sequences within the same target nucleic acid
molecule, such as alternate coding regions of a RNA, coding and
non-coding regions of a RNA, or alternate splice variant regions of
a RNA. Each strand of the multifunctional siNA construct comprises
a region having complementarity to the separate regions of the
target nucleic acid molecule. The multifunctional siNA molecule is
designed such that each strand of the siNA can be utilized by the
RISC complex to initiate RNA interference mediated cleavage of its
corresponding target region. These design parameters can include
destabilization of each end of the siNA construct (see for example
Schwarz et al., 2003, Cell, 115, 199-208). Such destabilization can
be accomplished for example by using guanosine-cytidine base pairs,
alternate base pairs (e.g., wobbles), or destabilizing chemically
modified nucleotides at terminal nucleotide positions as is known
in the art.
[0281] FIG. 22 shows a non-limiting example of reduction of ICAM-1
mRNA in HepG2 cells mediated by chemically modified siNAs that
target ICAM-1 mRNA. HepG2 cells were transfected with 0.25 ug/well
of lipid complexed with 25 nM siNA. Active siNA constructs (solid
bars) comprising various stabilization chemistries (see Tables III
and IV) were compared to untreated cells, matched chemistry
irrelevant siNA control construct (32072/32075), and cells
transfected with lipid alone (transfection control). As shown in
the figure, the siNA constructs significantly reduce ICAM-1 RNA
expression.
DETAILED DESCRIPTION OF THE INVENTION
Mechanism of Action of Nucleic Acid Molecules of the Invention
[0282] The discussion that follows discusses the proposed mechanism
of RNA interference mediated by short interfering RNA as is
presently known, and is not meant to be limiting and is not an
admission of prior art. Applicant demonstrates herein that
chemically modified short interfering nucleic acids possess similar
or improved capacity to mediate RNAi as do siRNA molecules and are
expected to possess improved stability and activity in vivo;
therefore, this discussion is not meant to be limiting only to
siRNA and can be applied to siNA as a whole. By "improved capacity
to mediate RNAi" or "improved RNAi activity" is meant to include
RNAi activity measured in vitro and/or in vivo where the RNAi
activity is a reflection of both the ability of the siNA to mediate
RNAi and the stability of the siNAs of the invention. In this
invention, the product of these activities can be increased in
vitro and/or in vivo compared to an all RNA siRNA or an siNA
containing a plurality of ribonucleotides. In some cases, the
activity or stability of the siNA molecule can be decreased (i.e.,
less than ten-fold), but the overall activity of the siNA molecule
is enhanced in vitro and/or in vivo.
[0283] RNA interference refers to the process of sequence specific
post-transcriptional gene silencing in animals mediated by short
interfering RNAs (siRNAs) (Fire et al., 1998, Nature, 391, 806).
The corresponding process in plants is commonly referred to as
post-transcriptional gene silencing or RNA silencing and is also
referred to as quelling in fungi. The process of
post-transcriptional gene silencing is thought to be an
evolutionarily-conserved cellular defense mechanism used to prevent
the expression of foreign genes which is commonly shared by diverse
flora and phyla (Fire et al., 1999, Trends Genet., 15, 358). Such
protection from foreign gene expression may have evolved in
response to the production of double-stranded RNAs (dsRNAs) derived
from viral infection or the random integration of transposon
elements into a host genome via a cellular response that
specifically destroys homologous single-stranded RNA or viral
genomic RNA. The presence of dsRNA in cells triggers the RNAi
response though a mechanism that has yet to be fully characterized.
This mechanism appears to be different from the interferon response
that results from dsRNA-mediated activation of protein kinase PKR
and 2',5'-oligoadenylate synthetase resulting in non-specific
cleavage of mRNA by ribonuclease L.
[0284] The presence of long dsRNAs in cells stimulates the activity
of a ribonuclease III enzyme referred to as Dicer. Dicer is
involved in the processing of the dsRNA into short pieces of dsRNA
known as short interfering RNAs (siRNAs) (Berstein et al., 2001,
Nature, 409, 363). Short interfering RNAs derived from Dicer
activity are typically about 21 to about 23 nucleotides in length
and comprise about 19 base pair duplexes. Dicer has also been
implicated in the excision of 21- and 22-nucleotide small temporal
RNAs (stRNAs) from precursor RNA of conserved structure that are
implicated in translational control (Hutvagner et al., 2001,
Science, 293, 834). The RNAi response also features an endonuclease
complex containing an siRNA, commonly referred to as an RNA-induced
silencing complex (RISC), which mediates cleavage of
single-stranded RNA having sequence homologous to the siRNA.
Cleavage of the target RNA takes place in the middle of the region
complementary to the guide sequence of the siRNA duplex (Elbashir
et al., 2001, Genes Dev., 15, 188). In addition, RNA interference
can also involve small RNA (e.g., micro-RNA or miRNA) mediated gene
silencing, presumably though cellular mechanisms that regulate
chromatin structure and thereby prevent transcription of target
gene sequences (see for example Allshire, 2002, Science, 297,
1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein,
2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297,
2232-2237). As such, siNA molecules of the invention can be used to
mediate gene silencing via interaction with RNA transcripts or
alternately by interaction with particular gene sequences, wherein
such interaction results in gene silencing either at the
transcriptional level or post-transcriptional level.
[0285] RNAi has been studied in a variety of systems. Fire et al.,
1998, Nature, 391, 806, were the first to observe RNAi in C.
elegans. Wianny and Goetz, 1999, Nature Cell Biol., 2, 70, describe
RNAi mediated by dsRNA in mouse embryos. Hammond et al., 2000,
Nature, 404, 293, describe RNAi in Drosophila cells transfected
with dsRNA. Elbashir et al., 2001, Nature, 411, 494, describe RNAi
induced by introduction of duplexes of synthetic 21-nucleotide RNAs
in cultured mammalian cells including human embryonic kidney and
HeLa cells. Recent work in Drosophila embryonic lysates has
revealed certain requirements for siRNA length, structure, chemical
composition, and sequence that are essential to mediate efficient
RNAi activity. These studies have shown that 21 nucleotide siRNA
duplexes are most active when containing two 2-nucleotide
3'-terminal nucleotide overhangs. Furthermore, substitution of one
or both siRNA strands with 2'-deoxy or 2'-O-methyl nucleotides
abolishes RNAi activity, whereas substitution of 3'-terminal siRNA
nucleotides with deoxy nucleotides was shown to be tolerated.
Mismatch sequences in the center of the siRNA duplex were also
shown to abolish RNAi activity. In addition, these studies also
indicate that the position of the cleavage site in the target RNA
is defined by the 5'-end of the siRNA guide sequence rather than
the 3'-end (Elbashir et al., 2001, EMBO J., 20, 6877). Other
studies have indicated that a 5'-phosphate on the
target-complementary strand of an siRNA duplex is required for
siRNA activity and that ATP is utilized to maintain the
5'-phosphate moiety on the siRNA (Nykanen et al., 2001, Cell, 107,
309); however, siRNA molecules lacking a 5'-phosphate are active
when introduced exogenously, suggesting that 5'-phosphorylation of
siRNA constructs may occur in vivo.
Synthesis of Nucleic Acid Molecules
[0286] Synthesis of nucleic acids greater than 100 nucleotides in
length is difficult using automated methods, and the therapeutic
cost of such molecules is prohibitive. In this invention, small
nucleic acid motifs ("small" refers to nucleic acid motifs no more
than 100 nucleotides in length, preferably no more than 80
nucleotides in length, and most preferably no more than 50
nucleotides in length; e.g., individual siNA oligonucleotide
sequences or siNA sequences synthesized in tandem) are preferably
used for exogenous delivery. The simple structure of these
molecules increases the ability of the nucleic acid to invade
targeted regions of protein and/or RNA structure. Exemplary
molecules of the instant invention are chemically synthesized, and
others can similarly be synthesized.
[0287] Oligonucleotides (e.g., certain modified oligonucleotides or
portions of oligonucleotides lacking ribonucleotides) are
synthesized using protocols known in the art, for example as
described in Caruthers et al., 1992, Methods in Enzymology 211,
3-19, Thompson et al., International PCT Publication No. WO
99/54459, Wincott et al., 1995, Nucleic Acids Res. 23, 2677-2684,
Wincott et al., 1997, Methods Mol. Bio., 74, 59, Brennan et al.,
1998, Biotechnol Bioeng., 61, 3345, and Brennan, U.S. Pat. No.
6,001,311. All of these references are incorporated herein by
reference. The synthesis of oligonucleotides makes use of common
nucleic acid protecting and coupling groups, such as
dimethoxytrityl at the 5'-end, and phosphoramidites at the 3'-end.
In a non-limiting example, small scale syntheses are conducted on a
394 Applied Biosystems, Inc. synthesizer using a 0.2 .mu.mol scale
protocol with a 2.5 min coupling step for 2'-O-methylated
nucleotides and a 45 second coupling step for 2'-deoxy nucleotides
or 2'-deoxy-2'-fluoro nucleotides. Table V outlines the amounts and
the contact times of the reagents used in the synthesis cycle.
Alternatively, syntheses at the 0.2 .mu.mol scale can be performed
on a 96-well plate synthesizer, such as the instrument produced by
Protogene (Palo Alto, Calif.) with minimal modification to the
cycle. A 33-fold excess (60 .mu.L of 0.11 M=6.6 .mu.mol) of
2'-O-methyl phosphoramidite and a 105-fold excess of S-ethyl
tetrazole (60 .mu.L of 0.25 M=15 .mu.mol) can be used in each
coupling cycle of 2'-O-methyl residues relative to polymer-bound
5'-hydroxyl. A 22-fold excess (40 .mu.L of 0.11 M=4.4 .mu.mol) of
deoxy phosphoramidite and a 70-fold excess of S-ethyl tetrazole (40
.mu.L of 0.25 M=10 .mu.mol) can be used in each coupling cycle of
deoxy residues relative to polymer-bound 5'-hydroxyl. Average
coupling yields on the 394 Applied Biosystems, Inc. synthesizer,
determined by colorimetric quantitation of the trityl fractions,
are typically 97.5-99%. Other oligonucleotide synthesis reagents
for the 394 Applied Biosystems, Inc. synthesizer include the
following: detritylation solution is 3% TCA in methylene chloride
(ABI); capping is performed with 16% N-methyl imidazole in THF
(ABI) and 10% acetic anhydride/10% 2,6-lutidine in THF (ABI); and
oxidation solution is 16.9 mM 12, 49 mM pyridine, 9% water in THF
(PerSeptive Biosystems, Inc.). Burdick & Jackson Synthesis
Grade acetonitrile is used directly from the reagent bottle.
S-Ethyltetrazole solution (0.25 M in acetonitrile) is made up from
the solid obtained from American International Chemical, Inc.
Alternately, for the introduction of phosphorothioate linkages,
Beaucage reagent (3H-1,2-benzodithiol-3-one 1,1-dioxide, 0.05 M in
acetonitrile) is used.
[0288] Deprotection of the DNA-based oligonucleotides is performed
as follows: the polymer-bound trityl-on oligoribonucleotide is
transferred to a 4 mL glass screw top vial and suspended in a
solution of 40% aqueous methylamine (1 mL) at 65.degree. C. for 10
minutes. After cooling to -20.degree. C., the supernatant is
removed from the polymer support. The support is washed three times
with 1.0 mL of EtOH:MeCN:H.sub.2O/3:1:1, vortexed and the
supernatant is then added to the first supernatant. The combined
supernatants, containing the oligoribonucleotide, are dried to a
white powder.
[0289] The method of synthesis used for RNA including certain siNA
molecules of the invention follows the procedure as described in
Usman et al., 1987, J. Am. Chem. Soc., 109, 7845; Scaringe et al.,
1990, Nucleic Acids Res., 18, 5433; and Wincott et al., 1995,
Nucleic Acids Res. 23, 2677-2684 Wincott et al., 1997, Methods Mol.
Bio., 74, 59, and makes use of common nucleic acid protecting and
coupling groups, such as dimethoxytrityl at the 5'-end, and
phosphoramidites at the 3'-end. In a non-limiting example, small
scale syntheses are conducted on a 394 Applied Biosystems, Inc.
synthesizer using a 0.2 .mu.mol scale protocol with a 7.5 min
coupling step for alkylsilyl protected nucleotides and a 2.5 min
coupling step for 2'-O-methylated nucleotides. Table V outlines the
amounts and the contact times of the reagents used in the synthesis
cycle. Alternatively, syntheses at the 0.2 .mu.mol scale can be
done on a 96-well plate synthesizer, such as the instrument
produced by Protogene (Palo Alto, Calif.) with minimal modification
to the cycle. A 33-fold excess (60 .mu.L of 0.11 M=6.6 .mu.mol) of
2'-O-methyl phosphoramidite and a 75-fold excess of S-ethyl
tetrazole (60 .mu.L of 0.25 M=15 .mu.mol) can be used in each
coupling cycle of 2'-O-methyl residues relative to polymer-bound
5'-hydroxyl. A 66-fold excess (120 .mu.L of 0.11 M=13.2 .mu.mol) of
alkylsilyl (ribo) protected phosphoramidite and a 150-fold excess
of S-ethyl tetrazole (120 .mu.L of 0.25 M=30 .mu.mol) can be used
in each coupling cycle of ribo residues relative to polymer-bound
5'-hydroxyl. Average coupling yields on the 394 Applied Biosystems,
Inc. synthesizer, determined by colorimetric quantitation of the
trityl fractions, are typically 97.5-99%. Other oligonucleotide
synthesis reagents for the 394 Applied Biosystems, Inc. synthesizer
include the following: detritylation solution is 3% TCA in
methylene chloride (ABI); capping is performed with 16% N-methyl
imidazole in THF (ABI) and 10% acetic anhydride/10% 2,6-lutidine in
THF (ABI); oxidation solution is 16.9 mM 12, 49 mM pyridine, 9%
water in THF (PerSeptive Biosystems, Inc.). Burdick & Jackson
Synthesis Grade acetonitrile is used directly from the reagent
bottle. S-Ethyltetrazole solution (0.25 M in acetonitrile) is made
up from the solid obtained from American International Chemical,
Inc. Alternately, for the introduction of phosphorothioate
linkages, Beaucage reagent (3H-1,2-benzodithiol-3-one 1,1-dioxide,
0.05 M in acetonitrile) is used.
[0290] Deprotection of the RNA is performed using either a two-pot
or one-pot protocol. For the two-pot protocol, the polymer-bound
trityl-on oligoribonucleotide is transferred to a 4 mL glass screw
top vial and suspended in a solution of 40% aq. methylamine (1 mL)
at 65.degree. C. for 10 min. After cooling to -20.degree. C., the
supernatant is removed from the polymer support. The support is
washed three times with 1.0 mL of EtOH:MeCN:H.sub.2O/3:1:1,
vortexed and the supernatant is then added to the first
supernatant. The combined supernatants, containing the
oligoribonucleotide, are dried to a white powder. The base
deprotected oligoribonucleotide is resuspended in anhydrous
TEA/HF/NMP solution (300 .mu.L of a solution of 1.5 mL
N-methylpyrrolidinone, 750 .mu.L TEA and 1 mL TEA.cndot.3HF to
provide a 1.4 M HF concentration) and heated to 65.degree. C. After
1.5 h, the oligomer is quenched with 1.5 M NHR.sub.4HCO.sub.3.
[0291] Alternatively, for the one-pot protocol, the polymer-bound
trityl-on oligoribonucleotide is transferred to a 4 mL glass screw
top vial and suspended in a solution of 33% ethanolic
methylamine/DMSO:1/1 (0.8 mL) at 65.degree. C. for 15 minutes. The
vial is brought to room temperature TEA.cndot.3HF (0.1 mL) is added
and the vial is heated at 65.degree. C. for 15 minutes. The sample
is cooled at -20.degree. C. and then quenched with 1.5 M
NH.sub.4HCO.sub.3.
[0292] For purification of the trityl-on oligomers, the quenched
NH.sub.4HCO.sub.3 solution is loaded onto a C-18 containing
cartridge that had been prewashed with acetonitrile followed by 50
mM TEAA. After washing the loaded cartridge with water, the RNA is
detritylated with 0.5% TFA for 13 minutes. The cartridge is then
washed again with water, salt exchanged with 1 M NaCl and washed
with water again. The oligonucleotide is then eluted with 30%
acetonitrile.
[0293] The average stepwise coupling yields are typically >98%
(Wincott et al., 1995 Nucleic Acids Res. 23, 2677-2684). Those of
ordinary skill in the art will recognize that the scale of
synthesis can be adapted to be larger or smaller than the example
described above including but not limited to 96-well format.
[0294] Alternatively, the nucleic acid molecules of the present
invention can be synthesized separately and joined together
post-synthetically, for example, by ligation (Moore et al., 1992,
Science 256, 9923; Draper et al., International PCT publication No.
WO 93/23569; Shabarova et al., 1991, Nucleic Acids Research 19,
4247; Bellon et al., 1997, Nucleosides & Nucleotides, 16, 951;
Bellon et al., 1997, Bioconjugate Chem. 8, 204), or by
hybridization following synthesis and/or deprotection.
[0295] The siNA molecules of the invention can also be synthesized
via a tandem synthesis methodology as described in Example 1
herein, wherein both siNA strands are synthesized as a single
contiguous oligonucleotide fragment or strand separated by a
cleavable linker which is subsequently cleaved to provide separate
siNA fragments or strands that hybridize and permit purification of
the siNA duplex. The linker can be a polynucleotide linker or a
non-nucleotide linker. The tandem synthesis of siNA as described
herein can be readily adapted to both multiwell/multiplate
synthesis platforms such as 96 well or similarly larger multi-well
platforms. The tandem synthesis of siNA as described herein can
also be readily adapted to large scale synthesis platforms
employing batch reactors, synthesis columns and the like.
[0296] An siNA molecule can also be assembled from two distinct
nucleic acid strands or fragments wherein one fragment includes the
sense region and the second fragment includes the antisense region
of the RNA molecule.
[0297] The nucleic acid molecules of the present invention can be
modified extensively to enhance stability by modification with
nuclease resistant groups, for example, 2'-amino, 2'-C-allyl,
2'-fluoro, 2'-O-methyl, 2'-H (for a review see Usman and Cedergren,
1992, TIBS 17, 34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31,
163). siNA constructs can be purified by gel electrophoresis using
general methods or can be purified by high pressure liquid
chromatography (HPLC; see Wincott et al., supra, the totality of
which is hereby incorporated herein by reference) and re-suspended
in water.
[0298] In another aspect of the invention, siNA molecules of the
invention are expressed from transcription units inserted into DNA
or RNA vectors. The recombinant vectors can be DNA plasmids or
viral vectors. siNA expressing viral vectors can be constructed
based on, but not limited to, adeno-associated virus, retrovirus,
adenovirus, or alphavirus. The recombinant vectors capable of
expressing the siNA molecules can be delivered as described herein,
and persist in target cells. Alternatively, viral vectors can be
used that provide for transient expression of siNA molecules.
Optimizing Activity of the Nucleic Acid Molecule of the
Invention.
[0299] Chemically synthesizing nucleic acid molecules with
modifications (base, sugar and/or phosphate) can prevent their
degradation by serum ribonucleases, which can increase their
potency (see e.g., Eckstein et al., International Publication No.
WO 92/07065; Perrault et al., 1990 Nature 344, 565; Pieken et al.,
1991, Science 253, 314; Usman and Cedergren, 1992, Trends in
Biochem. Sci. 17, 334; Usman et al., International Publication No.
WO 93/15187; and Rossi et al., International Publication No. WO
91/03162; Sproat, U.S. Pat. No. 5,334,711; Gold et al., U.S. Pat.
No. 6,300,074; and Burgin et al., supra; all of which are
incorporated by reference herein). All of the above references
describe various chemical modifications that can be made to the
base, phosphate and/or sugar moieties of the nucleic acid molecules
described herein. Modifications that enhance their efficacy in
cells, and removal of bases from nucleic acid molecules to shorten
oligonucleotide synthesis times and reduce chemical requirements
are desired.
[0300] There are several examples in the art describing sugar, base
and phosphate modifications that can be introduced into nucleic
acid molecules with significant enhancement in their nuclease
stability and efficacy. For example, oligonucleotides are modified
to enhance stability and/or enhance biological activity by
modification with nuclease resistant groups, for example, 2'-amino,
2'-C-allyl, 2'-fluoro, 2'-O-methyl, 2'-O-allyl, 2'-H, nucleotide
base modifications (for a review see Usman and Cedergren, 1992,
TIBS. 17, 34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31, 163;
Burgin et al., 1996, Biochemistry, 35, 14090). Sugar modification
of nucleic acid molecules have been extensively described in the
art (see Eckstein et al., International Publication PCT No. WO
92/07065; Perrault et al. Nature, 1990, 344, 565-568; Pieken et al.
Science, 1991, 253, 314-317; Usman and Cedergren, Trends in
Biochem. Sci., 1992, 17, 334-339; Usman et al. International
Publication PCT No. WO 93/15187; Sproat, U.S. Pat. No. 5,334,711
and Beigelman et al., 1995, J. Biol. Chem., 270, 25702; Beigelman
et al., International PCT publication No. WO 97/26270; Beigelman et
al., U.S. Pat. No. 5,716,824; Usman et al., U.S. Pat. No.
5,627,053; Woolf et al., International PCT Publication No. WO
98/13526; Thompson et al., U.S. Ser. No. 60/082,404 which was filed
on Apr. 20, 1998; Karpeisky et al., 1998, Tetrahedron Lett., 39,
1131; Earnshaw and Gait, 1998, Biopolymers (Nucleic Acid Sciences),
48, 39-55; Verma and Eckstein, 1998, Annu. Rev. Biochem., 67,
99-134; and Burlina et al., 1997, Bioorg. Med. Chem., 5, 1999-2010;
all of the references are hereby incorporated in their totality by
reference herein). Such publications describe general methods and
strategies to determine the location of incorporation of sugar,
base and/or phosphate modifications and the like into nucleic acid
molecules without modulating catalysis, and are incorporated by
reference herein. In view of such teachings, similar modifications
can be used as described herein to modify the siNA nucleic acid
molecules of the instant invention so long as the ability of siNA
to promote RNAi is cells is not significantly inhibited.
[0301] While chemical modification of oligonucleotide
internucleotide linkages with phosphorothioate, phosphorodithioate,
and/or 5'-methylphosphonate linkages improves stability, excessive
modifications can cause some toxicity or decreased activity.
Therefore, when designing nucleic acid molecules, the amount of
these internucleotide linkages should be minimized. The reduction
in the concentration of these linkages should lower toxicity,
resulting in increased efficacy and higher specificity of these
molecules.
[0302] Short interfering nucleic acid (siNA) molecules having
chemical modifications that maintain or enhance activity are
provided. Such a nucleic acid is also generally more resistant to
nucleases than an unmodified nucleic acid. Accordingly, the in
vitro and/or in vivo activity should not be significantly lowered.
In cases in which modulation is the goal, therapeutic nucleic acid
molecules delivered exogenously should optimally be stable within
cells until translation of the target RNA has been modulated long
enough to reduce the levels of the undesirable protein. This period
of time varies between hours to days depending upon the disease
state. Improvements in the chemical synthesis of RNA and DNA
(Wincott et al., 1995, Nucleic Acids Res. 23, 2677; Caruthers et
al., 1992, Methods in Enzymology 211, 3-19 (incorporated by
reference herein)) have expanded the ability to modify nucleic acid
molecules by introducing nucleotide modifications to enhance their
nuclease stability, as described above.
[0303] In one embodiment, nucleic acid molecules of the invention
include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more) G-clamp nucleotides. A G-clamp nucleotide is a modified
cytosine analog wherein the modifications confer the ability to
hydrogen bond both Watson-Crick and Hoogsteen faces of a
complementary guanine within a duplex, see for example Lin and
Matteucci, 1998, J. Am. Chem. Soc., 120, 8531-8532. A single
G-clamp analog substitution within an oligonucleotide can result in
substantially enhanced helical thermal stability and mismatch
discrimination when hybridized to complementary oligonucleotides.
The inclusion of such nucleotides in nucleic acid molecules of the
invention results in both enhanced affinity and specificity to
nucleic acid targets, complementary sequences, or template strands.
In another embodiment, nucleic acid molecules of the invention
include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more) LNA "locked nucleic acid" nucleotides such as a 2',4'-C
methylene bicyclo nucleotide (see for example Wengel et al.,
International PCT Publication No. WO 00/66604 and WO 99/14226).
[0304] In another embodiment, the invention features conjugates
and/or complexes of siNA molecules of the invention. Such
conjugates and/or complexes can be used to facilitate delivery of
siNA molecules into a biological system, such as a cell. The
conjugates and complexes provided by the instant invention can
impart therapeutic activity by transferring therapeutic compounds
across cellular membranes, altering the pharmacokinetics, and/or
modulating the localization of nucleic acid molecules of the
invention. The present invention encompasses the design and
synthesis of novel conjugates and complexes for the delivery of
molecules, including, but not limited to, small molecules, lipids,
cholesterol, phospholipids, nucleosides, nucleotides, nucleic
acids, antibodies, toxins, negatively charged polymers and other
polymers, for example proteins, peptides, hormones, carbohydrates,
polyethylene glycols, or polyamines, across cellular membranes. In
general, the transporters described are designed to be used either
individually or as part of a multi-component system, with or
without degradable linkers. These compounds are expected to improve
delivery and/or localization of nucleic acid molecules of the
invention into a number of cell types originating from different
tissues, in the presence or absence of serum (see Sullenger and
Cech, U.S. Pat. No. 5,854,038). Conjugates of the molecules
described herein can be attached to biologically active molecules
via linkers that are biodegradable, such as biodegradable nucleic
acid linker molecules.
[0305] The term "biodegradable linker" as used herein, refers to a
nucleic acid or non-nucleic acid linker molecule that is designed
as a biodegradable linker to connect one molecule to another
molecule, for example, a biologically active molecule to an siNA
molecule of the invention or the sense and antisense strands of an
siNA molecule of the invention. The biodegradable linker is
designed such that its stability can be modulated for a particular
purpose, such as delivery to a particular tissue or cell type. The
stability of a nucleic acid-based biodegradable linker molecule can
be modulated by using various chemistries, for example combinations
of ribonucleotides, deoxyribonucleotides, and chemically modified
nucleotides, such as 2'-O-methyl, 2'-fluoro, 2'-amino, 2'-O-amino,
2'-C-allyl, 2'-O-allyl, and other 2'-modified or base modified
nucleotides. The biodegradable nucleic acid linker molecule can be
a dimer, trimer, tetramer or longer nucleic acid molecule, for
example, an oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, or
can comprise a single nucleotide with a phosphorus-based linkage,
for example, a phosphoramidate or phosphodiester linkage. The
biodegradable nucleic acid linker molecule can also comprise
nucleic acid backbone, nucleic acid sugar, or nucleic acid base
modifications.
[0306] The term "biodegradable" as used herein, refers to
degradation in a biological system, for example, enzymatic
degradation or chemical degradation.
[0307] The term "biologically active molecule" as used herein
refers to compounds or molecules that are capable of eliciting or
modifying a biological response in a system. Non-limiting examples
of biologically active siNA molecules either alone or in
combination with other molecules contemplated by the instant
invention include therapeutically active molecules such as
antibodies, cholesterol, hormones, antivirals, peptides, proteins,
chemotherapeutics, small molecules, vitamins, co-factors,
nucleosides, nucleotides, oligonucleotides, enzymatic nucleic
acids, antisense nucleic acids, triplex forming oligonucleotides,
2,5-A chimeras, siNA, dsRNA, allozymes, aptamers, decoys and
analogs thereof. Biologically active molecules of the invention
also include molecules capable of modulating the pharmacokinetics
and/or pharmacodynamics of other biologically active molecules, for
example, lipids and polymers such as polyamines, polyamides,
polyethylene glycol and other polyethers.
[0308] The term "phospholipid" as used herein, refers to a
hydrophobic molecule comprising at least one phosphorus group. For
example, a phospholipid can comprise a phosphorus-containing group
and saturated or unsaturated alkyl group, optionally substituted
with OH, COOH, oxo, amine, or substituted or unsubstituted aryl
groups.
[0309] Therapeutic nucleic acid molecules (e.g., siNA molecules)
delivered exogenously optimally are stable within cells until
reverse transcription of the RNA has been modulated long enough to
reduce the levels of the RNA transcript. The nucleic acid molecules
are resistant to nucleases in order to function as effective
intracellular therapeutic agents. Improvements in the chemical
synthesis of nucleic acid molecules described in the instant
invention and in the art have expanded the ability to modify
nucleic acid molecules by introducing nucleotide modifications to
enhance their nuclease stability as described above.
[0310] In yet another embodiment, siNA molecules having chemical
modifications that maintain or enhance enzymatic activity of
proteins involved in RNAi are provided. Such nucleic acids are also
generally more resistant to nucleases than unmodified nucleic
acids. Thus, in vitro and/or in vivo the activity should not be
significantly lowered.
[0311] Use of the nucleic acid-based molecules of the invention
will lead to better treatments by affording the possibility of
combination therapies (e.g., multiple siNA molecules targeted to
different genes; nucleic acid molecules coupled with known small
molecule modulators; or intermittent treatment with combinations of
molecules, including different motifs and/or other chemical or
biological molecules). The treatment of subjects with siNA
molecules can also include combinations of different types of
nucleic acid molecules, such as enzymatic nucleic acid molecules
(ribozymes), allozymes, antisense, 2,5-A oligoadenylate, decoys,
and aptamers.
[0312] In another aspect an siNA molecule of the invention
comprises one or more 5' and/or a 3'-cap structure, for example, on
only the sense siNA strand, the antisense siNA strand, or both siNA
strands.
[0313] By "cap structure" is meant chemical modifications, which
have been incorporated at either terminus of the oligonucleotide
(see, for example, Adamic et al., U.S. Pat. No. 5,998,203,
incorporated by reference herein). These terminal modifications
protect the nucleic acid molecule from exonuclease degradation, and
may help in delivery and/or localization within a cell. The cap may
be present at the 5'-terminus (5'-cap) or at the 3'-terminal
(3'-cap) or may be present on both termini. In non-limiting
examples, the 5'-cap includes, but is not limited to, glyceryl,
inverted deoxy abasic residue (moiety); 4',5'-methylene nucleotide;
1-(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide;
carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide;
L-nucleotides; alpha-nucleotides; modified base nucleotide;
phosphorodithioate linkage; threo-pentofuranosyl nucleotide;
acyclic 3',4'-seco nucleotide; acyclic 3,4-dihydroxybutyl
nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3'-3'-inverted
nucleotide moiety; 3'-3'-inverted abasic moiety; 3'-2'-inverted
nucleotide moiety; 3'-2'-inverted abasic moiety; 1,4-butanediol
phosphate; 3'-phosphoramidate; hexylphosphate; aminohexyl
phosphate; 3'-phosphate; 3'-phosphorothioate; phosphorodithioate;
or bridging or non-bridging methylphosphonate moiety. Non-limiting
examples of cap moieties are shown in FIG. 10.
[0314] Non-limiting examples of the 3'-cap include, but are not
limited to, glyceryl, inverted deoxy abasic residue (moiety),
4',5'-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide;
4'-thio nucleotide, carbocyclic nucleotide; 5'-amino-alkyl
phosphate; 1,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate;
6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl
phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide;
alpha-nucleotide; modified base nucleotide; phosphorodithioate;
threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide;
3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide,
5'-5'-inverted nucleotide moiety; 5'-5'-inverted abasic moiety;
5'-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate;
5'-amino; bridging and/or non-bridging 5'-phosphoramidate,
phosphorothioate and/or phosphorodithioate, bridging or non
bridging methylphosphonate and 5'-mercapto moieties (for more
details see Beaucage and Iyer, 1993, Tetrahedron 49, 1925;
incorporated by reference herein).
[0315] By the term "non-nucleotide" is meant any group or compound
which can be incorporated into a nucleic acid chain in the place of
one or more nucleotide units, including either sugar and/or
phosphate substitutions, and allows the remaining bases to exhibit
their enzymatic activity. The group or compound is abasic in that
it does not contain a commonly recognized nucleotide base, such as
adenosine, guanine, cytosine, uracil or thymine and therefore lacks
a base at the 1'-position.
[0316] An "alkyl" group refers to a saturated aliphatic
hydrocarbon, including straight-chain, branched-chain, and cyclic
alkyl groups. Preferably, the alkyl group has 1 to 12 carbons. More
preferably, it is a lower alkyl of from 1 to 7 carbons, more
preferably 1 to 4 carbons. The alkyl group can be substituted or
unsubstituted. When substituted the substituted group(s) is
preferably, hydroxyl, cyano, alkoxy, .dbd.O, .dbd.S, NO.sub.2 or
N(CH.sub.3).sub.2, amino, or SH. The term also includes alkenyl
groups that are unsaturated hydrocarbon groups containing at least
one carbon-carbon double bond, including straight-chain,
branched-chain, and cyclic groups. Preferably, the alkenyl group
has 1 to 12 carbons. More preferably, it is a lower alkenyl of from
1 to 7 carbons, more preferably 1 to 4 carbons. The alkenyl group
may be substituted or unsubstituted. When substituted the
substituted group(s) is preferably, hydroxyl, cyano, alkoxy,
.dbd.O, .dbd.S, NO.sub.2, halogen, N(CH.sub.3).sub.2, amino, or SH.
The term "alkyl" also includes alkynyl groups that have an
unsaturated hydrocarbon group containing at least one carbon-carbon
triple bond, including straight-chain, branched-chain, and cyclic
groups. Preferably, the alkynyl group has 1 to 12 carbons. More
preferably, it is a lower alkynyl of from 1 to 7 carbons, more
preferably 1 to 4 carbons. The alkynyl group may be substituted or
unsubstituted. When substituted the substituted group(s) is
preferably, hydroxyl, cyano, alkoxy, .dbd.O, .dbd.S, NO.sub.2 or
N(CH.sub.3).sub.2, amino or SH.
[0317] Such alkyl groups can also include aryl, alkylaryl,
carbocyclic aryl, heterocyclic aryl, amide and ester groups. An
"aryl" group refers to an aromatic group that has at least one ring
having a conjugated pi electron system and includes carbocyclic
aryl, heterocyclic aryl and biaryl groups, all of which may be
optionally substituted. The preferred substituent(s) of aryl groups
are halogen, trihalomethyl, hydroxyl, SH, OH, cyano, alkoxy, alkyl,
alkenyl, alkynyl, and amino groups. An "alkylaryl" group refers to
an alkyl group (as described above) covalently joined to an aryl
group (as described above). Carbocyclic aryl groups are groups
wherein the ring atoms on the aromatic ring are all carbon atoms.
The carbon atoms are optionally substituted. Heterocyclic aryl
groups are groups having from 1 to 3 heteroatoms as ring atoms in
the aromatic ring and the remainder of the ring atoms are carbon
atoms. Suitable heteroatoms include oxygen, sulfur, and nitrogen,
and include furanyl, thienyl, pyridyl, pyrrolyl, N-lower alkyl
pyrrolo, pyrimidyl, pyrazinyl, imidazolyl and the like, all
optionally substituted. An "amide" refers to an --C(O)--NH--R,
where R is either alkyl, aryl, alkylaryl or hydrogen. An "ester"
refers to an --C(O)--OR', where R is either alkyl, aryl, alkylaryl
or hydrogen.
[0318] "Nucleotide" as used herein, and as recognized in the art,
includes natural bases (standard), and modified bases well known in
the art. Such bases are generally located at the 1' position of a
nucleotide sugar moiety. Nucleotides generally comprise a base,
sugar and a phosphate group. The nucleotides can be unmodified or
modified at the sugar, phosphate and/or base moiety, (also referred
to interchangeably as nucleotide analogs, modified nucleotides,
non-natural nucleotides, non-standard nucleotides and other; see,
for example, Usman and McSwiggen, supra; Eckstein et al.,
International PCT Publication No. WO 92/07065; Usman et al.,
International PCT Publication No. WO 93/15187; Uhlman & Peyman,
supra, all are hereby incorporated by reference herein). There are
several examples of modified nucleic acid bases known in the art as
summarized by Limbach et al., 1994, Nucleic Acids Res. 22, 2183.
Some of the non-limiting examples of base modifications that can be
introduced into nucleic acid molecules include, inosine, purine,
pyridin-4-one, pyridin-2-one, phenyl, pseudouracil,
2,4,6-trimethoxy benzene, 3-methyl uracil, dihydrouridine,
naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine),
5-alkyluridines (e.g., ribothymidine), 5-halouridine (e.g.,
5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g.
6-methyluridine), propyne, and others (Burgin et al., 1996,
Biochemistry, 35, 14090; Uhlman & Peyman, supra). By "modified
bases" in this aspect is meant nucleotide bases other than adenine,
guanine, cytosine and uracil at 1' position or their
equivalents.
[0319] In one embodiment, the invention features modified siNA
molecules, with phosphate backbone modifications comprising one or
more phosphorothioate, phosphorodithioate, methylphosphonate,
phosphotriester, morpholino, amidate carbamate, carboxymethyl,
acetamidate, polyamide, sulfonate, sulfonamide, sulfamate,
formacetal, thioformacetal, and/or alkylsilyl, substitutions. For a
review of oligonucleotide backbone modifications, see Hunziker and
Leumann, 1995, Nucleic Acid Analogues: Synthesis and Properties, in
Modern Synthetic Methods, VCH, 331417, and Mesmaeker et al., 1994,
Novel Backbone Replacements for Oligonucleotides, in Carbohydrate
Modifications in Antisense Research, ACS, 24-39.
[0320] By "abasic" is meant sugar moieties lacking a base or having
other chemical groups in place of a base at the 1' position, see
for example Adamic et al., U.S. Pat. No. 5,998,203.
[0321] By "unmodified nucleoside" is meant one of the bases
adenine, cytosine, guanine, thymine, or uracil joined to the 1'
carbon of .beta.-D-ribo-furanose.
[0322] By "modified nucleoside" is meant any nucleotide base which
contains a modification in the chemical structure of an unmodified
nucleotide base, sugar and/or phosphate. Non-limiting examples of
modified nucleotides are shown by Formulae I-VII and/or other
modifications described herein.
[0323] In connection with 2'-modified nucleotides as described for
the present invention, by "amino" is meant 2'--NH.sub.2 or
2'-O--NH.sub.2, which can be modified or unmodified. Such modified
groups are described, for example, in Eckstein et al., U.S. Pat.
No. 5,672,695 and Matulic-Adamic et al., U.S. Pat. No. 6,248,878,
which are both incorporated by reference in their entireties.
[0324] Various modifications to nucleic acid siNA structure can be
made to enhance the utility of these molecules. Such modifications
will enhance shelf-life, half-life in vitro, stability, and ease of
introduction of such oligonucleotides to the target site, e.g., to
enhance penetration of cellular membranes, and confer the ability
to recognize and bind to targeted cells.
Administration of Nucleic Acid Molecules
[0325] An siNA molecule of the invention can be adapted for use to
prevent or treat inflammatory, autoimmune, cancer and proliferative
diseases, conditions, or disorders, and/or any other trait,
disease, disorder or condition that is related to or will respond
to the levels of ICAM in a cell or tissue, alone or in combination
with other therapies. For example, an siNA molecule can comprise a
delivery vehicle, including liposomes, for administration to a
subject, carriers and diluents and their salts, and/or can be
present in pharmaceutically acceptable formulations. Methods for
the delivery of nucleic acid molecules are described in Akhtar et
al., 1992, Trends Cell Bio., 2, 139; Delivery Strategies for
Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995, Maurer et
al., 1999, Mol. Membr. Biol., 16, 129-140; Hofland and Huang, 1999,
Handb. Exp. Pharmacol., 137, 165-192; and Lee et al., 2000, ACS
Symp. Ser., 752, 184-192, all of which are incorporated herein by
reference. Beigelman et al., U.S. Pat. No. 6,395,713 and Sullivan
et al., PCT WO 94/02595 further describe the general methods for
delivery of nucleic acid molecules. These protocols can be utilized
for the delivery of virtually any nucleic acid molecule. Nucleic
acid molecules can be administered to cells by a variety of methods
known to those of skill in the art, including, but not restricted
to, encapsulation in liposomes, by iontophoresis, or by
incorporation into other vehicles, such as biodegradable polymers,
hydrogels, cyclodextrins (see for example Gonzalez et al., 1999,
Bioconjugate Chem., 10, 1068-1074; Wang et al., International PCT
publication Nos. WO 03/47518 and WO 03/46185),
poly(lactic-co-glycolic)acid (PLGA) and PLCA microspheres (see for
example U.S. Pat. No. 6,447,796 and US Patent Application
Publication No. US 2002130430), biodegradable nanocapsules, and
bioadhesive microspheres, or by proteinaceous vectors (O'Hare and
Normand, International PCT Publication No. WO 00/53722).
Alternatively, the nucleic acid/vehicle combination is locally
delivered by direct injection or by use of an infusion pump. Direct
injection of the nucleic acid molecules of the invention, whether
subcutaneous, intramuscular, or intradermal, can take place using
standard needle and syringe methodologies, or by needle-free
technologies such as those described in Conry et al., 1999, Clin.
Cancer Res., 5, 2330-2337 and Barry et al., International PCT
Publication No. WO 99/31262. The molecules of the instant invention
can be used as pharmaceutical agents. Pharmaceutical agents
prevent, modulate the occurrence, or treat (alleviate a symptom to
some extent, preferably all of the symptoms) of a disease state in
a subject.
[0326] In another embodiment, the nucleic acid molecules of the
invention can also be formulated or complexed with
polyethyleneimine and derivatives thereof, such as
polyethyleneimine-polyethyleneglycol-N-acetylgalactosamine
(PEI-PEG-GAL) or
polyethyleneimine-polyethyleneglycol-tri-N-acetylgalactosamine.
(PEI-PEG-triGAL) derivatives. In one embodiment, the nucleic acid
molecules of the invention are formulated as described in United
States Patent Application Publication No. 20030077829, incorporated
by reference herein in its entirety.
[0327] In one embodiment, an siNA molecule of the invention is
complexed with membrane disruptive agents such as those described
in U.S. Patent Application Publication No. 20010007666,
incorporated by reference herein in its entirety including the
drawings. In another embodiment, the membrane disruptive agent or
agents and the siNA molecule are also complexed with a cationic
lipid or helper lipid molecule, such as those lipids described in
U.S. Pat. No. 6,235,310, incorporated by reference herein in its
entirety including the drawings.
[0328] In one embodiment, an siNA molecule of the invention is
complexed with delivery systems as described in U.S. Patent
Application Publication No. 2003077829 and International PCT
Publication Nos. WO 00/03683 and WO 02/087541, all incorporated by
reference herein in their entirety including the drawings.
[0329] In one embodiment, the nucleic acid molecules of the
invention are administered via pulmonary delivery, such as by
inhalation of an aerosol or spray dried formulation administered by
an inhalation device or nebulizer, providing rapid local uptake of
the nucleic acid molecules into relevant pulmonary tissues. Solid
particulate compositions containing respirable dry particles of
micronized nucleic acid compositions can be prepared by grinding
dried or lyophilized nucleic acid compositions, and then passing
the micronized composition through, for example, a 400 mesh screen
to break up or separate out large agglomerates. A solid particulate
composition comprising the nucleic acid compositions of the
invention can optionally contain a dispersant which serves to
facilitate the formation of an aerosol as well as other therapeutic
compounds. A suitable dispersant is lactose, which can be blended
with the nucleic acid compound in any suitable ratio, such as a 1
to 1 ratio by weight.
[0330] Aerosols of liquid particles comprising a nucleic acid
composition of the invention can be produced by any suitable means,
such as with a nebulizer (see for example U.S. Pat. No. 4,501,729).
Nebulizers are commercially available devices which transform
solutions or suspensions of an active ingredient into a therapeutic
aerosol mist either by means of acceleration of a compressed gas,
typically air or oxygen, through a narrow venturi orifice or by
means of ultrasonic agitation. Suitable formulations for use in
nebulizers comprise the active ingredient in a liquid carrier in an
amount of up to 40% w/w preferably less than 20% w/w of the
formulation. The carrier is typically water or a dilute aqueous
alcoholic solution, preferably made isotonic with body fluids by
the addition of, for example, sodium chloride or other suitable
salts. Optional additives include preservatives if the formulation
is not prepared sterile, for example, methyl hydroxybenzoate,
anti-oxidants, flavorings, volatile oils, buffering agents and
emulsifiers and other formulation surfactants. The aerosols of
solid particles comprising the active composition and surfactant
can likewise be produced with any solid particulate aerosol
generator. Aerosol generators for administering solid particulate
therapeutics to a subject produce particles which are respirable,
as explained above, and generate a volume of aerosol containing a
predetermined metered dose of a therapeutic composition at a rate
suitable for human administration. One illustrative type of solid
particulate aerosol generator is an insufflator. Suitable
formulations for administration by insufflation include finely
comminuted powders which can be delivered by means of an
insufflator. In the insufflator, the powder, e.g., a metered dose
thereof effective to carry out the treatments described herein, is
contained in capsules or cartridges, typically made of gelatin or
plastic, which are either pierced or opened in situ and the powder
delivered by air drawn through the device upon inhalation or by
means of a manually-operated pump. The powder employed in the
insufflator consists either solely of the active ingredient or of a
powder blend comprising the active ingredient, a suitable powder
diluent, such as lactose, and an optional surfactant. The active
ingredient typically comprises from 0.1 to 100 w/w of the
formulation. A second type of illustrative aerosol generator
comprises a metered dose inhaler. Metered dose inhalers are
pressurized aerosol dispensers, typically containing a suspension
or solution formulation of the active ingredient in a liquefied
propellant. During use these devices discharge the formulation
through a valve adapted to deliver a metered volume to produce a
fine particle spray containing the active ingredient. Suitable
propellants include certain chlorofluorocarbon compounds, for
example, dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane and mixtures thereof. The formulation can
additionally contain one or more co-solvents, for example, ethanol,
emulsifiers and other formulation surfactants, such as oleic acid
or sorbitan trioleate, anti-oxidants and suitable flavoring agents.
Other methods for pulmonary delivery are described in, for example
US Patent Application No. 20040037780, and U.S. Pat. Nos.
6,592,904; 6,582,728; 6,565,885.
[0331] In one embodiment, nucleic acid molecules of the invention
are administered to the central nervous system (CNS) or peripheral
nervous system (PNS). Experiments have demonstrated the efficient
in vivo uptake of nucleic acids by neurons. As an example of local
administration of nucleic acids to nerve cells, Sommer et al.,
1998, Antisense Nuc. Acid Drug Dev., 8, 75, describe a study in
which a 15mer phosphorothioate antisense nucleic acid molecule to
c-fos is administered to rats via microinjection into the brain.
Antisense molecules labeled with
tetramethylrhodamine-isothiocyanate (TRITC) or fluorescein
isothiocyanate-(FITC) were taken up by exclusively by neurons
thirty minutes post-injection. A diffuse cytoplasmic staining and
nuclear staining was observed in these cells. As an example of
systemic administration of nucleic acid to nerve cells, Epa et al.,
2000, Antisense Nuc. Acid Drug Dev., 10, 469, describe an in vivo
mouse study in which beta-cyclodextrin-adamantane-oligonucleotide
conjugates were used to target the p75 neurotrophin receptor in
neuronally differentiated PCl.sub.2 cells. Following a two week
course of IP administration, pronounced uptake of p75 neurotrophin
receptor antisense was observed in dorsal root ganglion (DRG)
cells. In addition, a marked and consistent down-regulation of p75
was observed in DRG neurons. Additional approaches to the targeting
of nucleic acid to neurons are described in Broaddus et al., 1998,
J. Neurosurg., 88(4), 734; Karle et al., 1997, Eur. J. Pharmocol.,
340(2/3), 153; Bannai et al., 1998, Brain Research, 784(1,2), 304;
Rajakumar et al., 1997, Synapse, 26(3), 199; Wu-pong et al., 1999,
BioPharm, 12(1), 32; Bannai et al., 1998, Brain Res. Protoc., 3(1),
83; Simantov et al., 1996, Neuroscience, 74(1), 39. Nucleic acid
molecules of the invention are therefore amenable to delivery to
and uptake by cells in the CNS and/or PNS.
[0332] The delivery of nucleic acid molecules of the invention to
the CNS is provided by a variety of different strategies.
Traditional approaches to CNS delivery that can be used include,
but are not limited to, intrathecal and intracerebroventricular
administration, implantation of catheters and pumps, direct
injection or perfusion at the site of injury or lesion, injection
into the brain arterial system, or by chemical or osmotic opening
of the blood-brain barrier. Other approaches can include the use of
various transport and carrier systems, for example though the use
of conjugates and biodegradable polymers. Furthermore, gene therapy
approaches, for example as described in Kaplitt et al., U.S. Pat.
No. 6,180,613 and Davidson, WO 04/013280, can be used to express
nucleic acid molecules in the CNS.
[0333] In one embodiment, delivery systems of the invention
include, for example, aqueous and nonaqueous gels, creams, multiple
emulsions, microemulsions, liposomes, ointments, aqueous and
nonaqueous solutions, lotions, aerosols, hydrocarbon bases and
powders, and can contain excipients such as solubilizers,
permeation enhancers (e.g., fatty acids, fatty acid esters, fatty
alcohols and amino acids), and hydrophilic polymers (e.g.,
polycarbophil and polyvinylpyrolidone). In one embodiment, the
pharmaceutically acceptable carrier is a liposome or a transdermal
enhancer. Examples of liposomes which can be used in this invention
include the following: (1) CellFectin, 1:1.5 (M/M) liposome
formulation of the cationic lipid
N,NI,NII,NIII-tetramethyl-N,NI,NII,NIII-tetrapalmit-y-spermine and
dioleoyl phosphatidylethanolamine (DOPE) (GIBCO BRL); (2)
Cytofectin GSV, 2:1 (M/M) liposome formulation of a cationic lipid
and DOPE (Glen Research); (3) DOTAP
(N-[1-(2,3-dioleoyloxy)-N,N,N-tri-methyl-ammoniummethylsulfate)
(Boehringer Manheim); and (4) Lipofectamine, 3:1 (M/M) liposome
formulation of the polycationic lipid DOSPA and the neutral lipid
DOPE (GIBCO BRL).
[0334] In one embodiment, delivery systems of the invention include
patches, tablets, suppositories, pessaries, gels and creams, and
can contain excipients such as solubilizers and enhancers (e.g.,
propylene glycol, bile salts and amino acids), and other vehicles
(e.g., polyethylene glycol, fatty acid esters and derivatives, and
hydrophilic polymers such as hydroxypropylmethylcellulose and
hyaluronic acid).
[0335] In one embodiment, siNA molecules of the invention are
formulated or complexed with polyethylenimine (e.g., linear or
branched PEI) and/or polyethylenimine derivatives, including for
example grafted PEls such as galactose PEI, cholesterol PEI,
antibody derivatized PEI, and polyethylene glycol PEI (PEG-PEI)
derivatives thereof (see for example Ogris et al., 2001, AAPA
PhamSci, 3, 1-11; Furgeson et al., 2003, Bioconjugate Chem., 14,
840-847; Kunath et al., 2002, Pharmaceutical Research, 19, 810-817;
Choi et al., 2001, Bull. Korean Chem. Soc., 22, 46-52; Bettinger et
al., 1999, Bioconjugate Chem., 10, 558-561; Peterson et al., 2002,
Bioconjugate Chem., 13, 845-854; Erbacher et al., 1999, Journal of
Gene Medicine Preprint, 1, 1-18; Godbey et al., 1999., PNAS USA,
96, 5177-5181; Godbey et al., 1999, Journal of Controlled Release,
60, 149-160; Diebold et al., 1999, Journal of Biological Chemistry,
274, 19087-19094; Thomas and Klibanov, 2002, PNAS USA, 99,
14640-14645; and Sagara, U.S. Pat. No. 6,586,524, incorporated by
reference herein.
[0336] In one embodiment, an siNA molecule of the invention
comprises a bioconjugate, for example a nucleic acid conjugate as
described in Vargeese et al., U.S. Ser. No. 10/427,160, filed Apr.
30, 2003; U.S. Pat. No. 6,528,631; U.S. Pat. No. 6,335,434; U.S.
Pat. No. 6,235,886; U.S. Pat. No. 6,153,737; U.S. Pat. No.
5,214,136; U.S. Pat. No. 5,138,045, all incorporated by reference
herein.
[0337] Thus, the invention features a pharmaceutical composition
comprising one or more nucleic acid(s) of the invention in an
acceptable carrier, such as a stabilizer, buffer, and the like. The
polynucleotides of the invention can be administered (e.g., RNA,
DNA or protein) and introduced to a subject by any standard means,
with or without stabilizers, buffers, and the like, to form a
pharmaceutical composition. When it is desired to use a liposome
delivery mechanism, standard protocols for formation of liposomes
can be followed. The compositions of the present invention can also
be formulated and used as creams, gels, sprays, oils and other
suitable compositions for topical, dermal, or transdermal
administration as is known in the art.
[0338] The present invention also includes pharmaceutically
acceptable formulations of the compounds described. These
formulations include salts of the above compounds, e.g., acid
addition salts, for example, salts of hydrochloric, hydrobromic,
acetic acid, and benzene sulfonic acid.
[0339] A pharmacological composition or formulation refers to a
composition or formulation in a form suitable for administration,
e.g., systemic or local administration, into a cell or subject,
including for example a human. Suitable forms, in part, depend upon
the use or the route of entry, for example oral, transdermal, or by
injection. Such forms should not prevent the composition or
formulation from reaching a target cell (i.e., a cell to which the
negatively charged nucleic acid is desirable for delivery). For
example, pharmacological compositions injected into the blood
stream should be soluble. Other factors are known in the art, and
include considerations such as toxicity and forms that prevent the
composition or formulation from exerting its effect.
[0340] In one embodiment, siNA molecules of the invention are
administered to a subject by systemic administration in a
pharmaceutically acceptable composition or formulation. By
"systemic administration" is meant in vivo systemic absorption or
accumulation of drugs in the blood stream followed by distribution
throughout the entire body. Administration routes that lead to
systemic absorption include, without limitation: intravenous,
subcutaneous, intraperitoneal, inhalation, oral, intrapulmonary and
intramuscular. Each of these administration routes exposes the siNA
molecules of the invention to an accessible diseased tissue. The
rate of entry of a drug into the circulation has been shown to be a
function of molecular weight or size. The use of a liposome or
other drug carrier comprising the compounds of the instant
invention can potentially localize the drug, for example, in
certain tissue types, such as the tissues of the reticular
endothelial system (RES). A liposome formulation that can
facilitate the association of drug with the surface of cells, such
as, lymphocytes and macrophages is also useful. This approach can
provide enhanced delivery of the drug to target cells by taking
advantage of the specificity of macrophage and lymphocyte immune
recognition of abnormal cells.
[0341] By "pharmaceutically acceptable formulation" or
"pharmaceutically acceptable composition" is meant, a composition
or formulation that allows for the effective distribution of the
nucleic acid molecules of the instant invention in the physical
location most suitable for their desired activity. Non-limiting
examples of agents suitable for formulation with the nucleic acid
molecules of the instant invention include: P-glycoprotein
inhibitors (such as Pluronic P85); biodegradable polymers, such as
poly (DL-lactide-coglycolide) microspheres for sustained release
delivery (Emerich, D F et al, 1999, Cell Transplant, 8, 47-58); and
loaded nanoparticles, such as those made of polybutylcyanoacrylate.
Other non-limiting examples of delivery strategies for the nucleic
acid molecules of the instant invention include material described
in Boado et al., 1998, J. Pharm. Sci., 87, 1308-1315; Tyler et al.,
1999, FEBS Lett., 421, 280-284; Pardridge et al., 1995, PNAS USA.,
92, 5592-5596; Boado, 1995, Adv. Drug Delivery Rev., 15, 73-107;
Aldrian-Herrada et al., 1998, Nucleic Acids Res., 26, 4910-4916;
and Tyler et al., 1999, PNAS USA., 96, 7053-7058.
[0342] The invention also features the use of the composition
comprising surface-modified liposomes containing poly (ethylene
glycol) lipids (PEG-modified, or long-circulating liposomes or
stealth liposomes). These formulations offer a method for
increasing the accumulation of drugs in target tissues. This class
of drug carriers resists opsonization and elimination by the
mononuclear phagocytic system (MPS or RES), thereby enabling longer
blood circulation times and enhanced tissue exposure for the
encapsulated drug (Lasic et al. Chem. Rev. 1995, 95, 2601-2627;
Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011). Such
liposomes have been shown to accumulate selectively in tumors,
presumably by extravasation and capture in the neovascularized
target tissues (Lasic et al., Science 1995, 267, 1275-1276; Oku et
al., 1995, Biochim. Biophys. Acta, 1238, 86-90). The
long-circulating liposomes enhance the pharmacokinetics and
pharmacodynamics of DNA and RNA, particularly compared to
conventional cationic liposomes which are known to accumulate in
tissues of the MPS (Liu et al., J. Biol. Chem. 1995, 42,
24864-24870; Choi et al., International PCT Publication No. WO
96/10391; Ansell et al., International PCT Publication No. WO
96/10390; Holland et al., International PCT Publication No. WO
96/10392). Long-circulating liposomes are also likely to protect
drugs from nuclease degradation to a greater extent compared to
cationic liposomes, based on their ability to avoid accumulation in
metabolically aggressive MPS tissues such as the liver and
spleen.
[0343] The present invention also includes compositions prepared
for storage or administration that include a pharmaceutically
effective amount of the desired compounds in a pharmaceutically
acceptable carrier or diluent. Acceptable carriers or diluents for
therapeutic use are well known in the pharmaceutical art, and are
described, for example, in Remington's Pharmaceutical Sciences,
Mack Publishing Co. (A. R. Gennaro edit. 1985), hereby incorporated
by reference herein. For example, preservatives, stabilizers, dyes
and flavoring agents can be provided. These include sodium
benzoate, sorbic acid and esters of p-hydroxybenzoic acid. In
addition, antioxidants and suspending agents can be used.
[0344] A pharmaceutically effective dose is that dose required to
prevent, inhibit the occurrence, or treat (alleviate a symptom to
some extent, preferably all of the symptoms) of a disease state.
The pharmaceutically effective dose depends on the type of disease,
the composition used, the route of administration, the type of
mammal being treated, the physical characteristics of the specific
mammal under consideration, concurrent medication, and other
factors that those skilled in the medical arts will recognize.
Generally, an amount between 0.1 mg/kg and 100 mg/kg body
weight/day of active ingredients is administered dependent upon
potency of the negatively charged polymer.
[0345] The nucleic acid molecules of the invention and formulations
thereof can be administered orally, topically, parenterally, by
inhalation or spray, or rectally in dosage unit formulations
containing conventional non-toxic pharmaceutically acceptable
carriers, adjuvants and/or vehicles. The term parenteral as used
herein includes percutaneous, subcutaneous, intravascular (e.g.,
intravenous), intramuscular, or intrathecal injection or infusion
techniques and the like. In addition, there is provided a
pharmaceutical formulation comprising a nucleic acid molecule of
the invention and a pharmaceutically acceptable carrier. One or
more nucleic acid molecules of the invention can be present in
association with one or more non-toxic pharmaceutically acceptable
carriers and/or diluents and/or adjuvants, and if desired other
active ingredients. The pharmaceutical compositions containing
nucleic acid molecules of the invention can be in a form suitable
for oral use, for example, as tablets, troches, lozenges, aqueous
or oily suspensions, dispersible powders or granules, emulsion,
hard or soft capsules, or syrups or elixirs.
[0346] Compositions intended for oral use can be prepared according
to any method known to the art for the manufacture of
pharmaceutical compositions and such compositions can contain one
or more such sweetening agents, flavoring agents, coloring agents
or preservative agents in order to provide pharmaceutically elegant
and palatable preparations. Tablets contain the active ingredient
in admixture with non-toxic pharmaceutically acceptable excipients
that are suitable for the manufacture of tablets. These excipients
can be, for example, inert diluents; such as calcium carbonate,
sodium carbonate, lactose, calcium phosphate or sodium phosphate;
granulating and disintegrating agents, for example, corn starch, or
alginic acid; binding agents, for example starch, gelatin or
acacia; and lubricating agents, for example magnesium stearate,
stearic acid or talc. The tablets can be uncoated or they can be
coated by known techniques. In some cases such coatings can be
prepared by known techniques to delay disintegration and absorption
in the gastrointestinal tract and thereby provide a sustained
action over a longer period. For example, a time delay material
such as glyceryl monosterate or glyceryl distearate can be
employed.
[0347] Formulations for oral use can also be presented as hard
gelatin capsules wherein the active ingredient is mixed with an
inert solid diluent, for example, calcium carbonate, calcium
phosphate or kaolin, or as soft gelatin capsules wherein the active
ingredient is mixed with water or an oil medium, for example peanut
oil, liquid paraffin or olive oil.
[0348] Aqueous suspensions contain the active materials in a
mixture with excipients suitable for the manufacture of aqueous
suspensions. Such excipients are suspending agents, for example
sodium carboxymethylcellulose, methylcellulose,
hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone,
gum tragacanth and gum acacia; dispersing or wetting agents can be
a naturally-occurring phosphatide, for example, lecithin, or
condensation products of an alkylene oxide with fatty acids, for
example polyoxyethylene stearate, or condensation products of
ethylene oxide with long chain aliphatic alcohols, for example
heptadecaethyleneoxycetanol, or condensation products of ethylene
oxide with partial esters derived from fatty acids and a hexitol
such as polyoxyethylene sorbitol monooleate, or condensation
products of ethylene oxide with partial esters derived from fatty
acids and hexitol anhydrides, for example polyethylene sorbitan
monooleate. The aqueous suspensions can also contain one or more
preservatives, for example ethyl, or n-propyl p-hydroxybenzoate,
one or more coloring agents, one or more flavoring agents, and one
or more sweetening agents, such as sucrose or saccharin.
[0349] Oily suspensions can be formulated by suspending the active
ingredients in a vegetable oil, for example arachis oil, olive oil,
sesame oil or coconut oil, or in a mineral oil such as liquid
paraffin. The oily suspensions can contain a thickening agent, for
example beeswax, hard paraffin or cetyl alcohol. Sweetening agents
and flavoring agents can be added to provide palatable oral
preparations. These compositions can be preserved by the addition
of an anti-oxidant such as ascorbic acid
[0350] Dispersible powders and granules suitable for preparation of
an aqueous suspension by the addition of water provide the active
ingredient in admixture with a dispersing or wetting agent,
suspending agent and one or more preservatives. Suitable dispersing
or wetting agents or suspending agents are exemplified by those
already mentioned above. Additional excipients, for example
sweetening, flavoring and coloring agents, can also be present.
[0351] Pharmaceutical compositions of the invention can also be in
the form of oil-in-water emulsions. The oily phase can be a
vegetable oil or a mineral oil or mixtures of these. Suitable
emulsifying agents can be naturally-occurring gums, for example gum
acacia or gum tragacanth, naturally-occurring phosphatides, for
example soy bean, lecithin, and esters or partial esters derived
from fatty acids and hexitol, anhydrides, for example sorbitan
monooleate, and condensation products of the said partial esters
with ethylene oxide, for example polyoxyethylene sorbitan
monooleate. The emulsions can also contain sweetening and flavoring
agents.
[0352] Syrups and elixirs can be formulated with sweetening agents,
for example glycerol, propylene glycol, sorbitol, glucose or
sucrose. Such formulations can also contain a demulcent, a
preservative and flavoring and coloring agents. The pharmaceutical
compositions can be in the form of a sterile injectable aqueous or
oleaginous suspension. This suspension can be formulated according
to the known art using those suitable dispersing or wetting agents
and suspending agents that have been mentioned above. The sterile
injectable preparation can also be a sterile injectable solution or
suspension in a non-toxic parentally acceptable diluent or solvent,
for example as a solution in 1,3-butanediol. Among the acceptable
vehicles and solvents that can be employed are water, Ringer's
solution and isotonic sodium chloride solution. In addition,
sterile, fixed oils are conventionally employed as a solvent or
suspending medium. For this purpose, any bland fixed oil can be
employed including synthetic mono- or diglycerides. In addition,
fatty acids such as oleic acid find use in the preparation of
injectables.
[0353] The nucleic acid molecules of the invention can also be
administered in the form of suppositories, e.g., for rectal
administration of the drug. These compositions can be prepared by
mixing the drug with a suitable non-irritating excipient that is
solid at ordinary temperatures but liquid at the rectal temperature
and will therefore melt in the rectum to release the drug. Such
materials include cocoa butter and polyethylene glycols.
[0354] Nucleic acid molecules of the invention can be administered
parenterally in a sterile medium. The drug, depending on the
vehicle and concentration used, can either be suspended or
dissolved in the vehicle. Advantageously, adjuvants such as local
anesthetics, preservatives and buffering agents can be dissolved in
the vehicle.
[0355] Dosage levels of the order of from about 0.1 mg to about 140
mg per kilogram of body weight per day are useful in the treatment
of the above-indicated conditions (about 0.5 mg to about 7 g per
subject per day). The amount of active ingredient that can be
combined with the carrier materials to produce a single dosage form
varies depending upon the host treated and the particular mode of
administration. Dosage unit forms generally contain between from
about 1 mg to about 500 mg of an active ingredient.
[0356] It is understood that the specific dose level for any
particular subject depends upon a variety of factors including the
activity of the specific compound employed, the age, body weight,
general health, sex, diet, time of administration, route of
administration, and rate of excretion, drug combination and the
severity of the particular disease undergoing therapy.
[0357] For administration to non-human animals, the composition can
also be added to the animal feed or drinking water. It can be
convenient to formulate the animal feed and drinking water
compositions so that the animal takes in a therapeutically
appropriate quantity of the composition along with its diet. It can
also be convenient to present the composition as a premix for
addition to the feed or drinking water.
[0358] The nucleic acid molecules of the present invention can also
be administered to a subject in combination with other therapeutic
compounds to increase the overall therapeutic effect. The use of
multiple compounds to treat an indication can increase the
beneficial effects while reducing the presence of side effects.
[0359] In one embodiment, the invention comprises compositions
suitable for administering nucleic acid molecules of the invention
to specific cell types. For example, the asialoglycoprotein
receptor (ASGPr) (Wu and Wu, 1987, J. Biol. Chem. 262, 4429-4432)
is unique to hepatocytes and binds branched galactose-terminal
glycoproteins, such as asialoorosomucoid (ASOR). In another
example, the folate receptor is overexpressed in many cancer cells.
Binding of such glycoproteins, synthetic glycoconjugates, or
folates to the receptor takes place with an affinity that strongly
depends on the degree of branching of the oligosaccharide chain,
for example, triatennary structures are bound with greater affinity
than biatennary or monoatennary chains (Baenziger and Fiete, 1980,
Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257,
939-945). Lee and Lee, 1987, Glycoconjugate J., 4, 317-328,
obtained this high specificity through the use of
N-acetyl-D-galactosamine as the carbohydrate moiety, which has
higher affinity for the receptor, compared to galactose. This
"clustering effect" has also been described for the binding and
uptake of mannosyl-terminating glycoproteins or glycoconjugates
(Ponpipom et al., 1981, J. Med. Chem., 24, 1388-1395). The use of
galactose, galactosamine, or folate based conjugates to transport
exogenous compounds across cell membranes can provide a targeted
delivery approach to, for example, the treatment of liver disease,
cancers of the liver, or other cancers. The use of bioconjugates
can also provide a reduction in the required dose of therapeutic
compounds required for treatment. Furthermore, therapeutic
bioavailability, pharmacodynamics, and pharmacokinetic parameters
can be modulated through the use of nucleic acid bioconjugates of
the invention. Non-limiting examples of such bioconjugates are
described in Vargeese et al., U.S. Ser. No. 10/201,394, filed Aug.
13, 2001; and Matulic-Adamic et al., U.S. Ser. No. 60/362,016,
filed Mar. 6, 2002.
[0360] Alternatively, certain siNA molecules of the instant
invention can be expressed within cells from eukaryotic promoters
(e.g., Izant and Weintraub, 1985, Science, 229, 345; McGarry and
Lindquist, 1986, Proc. Natl. Acad. Sci., USA 83, 399; Scanlon et
al., 1991, Proc. Natl. Acad. Sci. USA, 88, 10591-5; Kashani-Sabet
et al., 1992, Antisense Res. Dev., 2, 3-15; propulic et al., 1992,
J. Virol., 66, 143241; Weerasinghe et al., 1991, J. Virol., 65,
5531-4; Ojwang et al., 1992, Proc. Natl. Acad. Sci. USA, 89,
10802-6; Chen et al., 1992, Nucleic Acids Res., 20, 4581-9; Sarver
et al., 1990 Science, 247, 1222-1225; Thompson et al., 1995,
Nucleic Acids Res., 23, 2259; Good et al., 1997, Gene Therapy, 4,
45. Those skilled in the art realize that any nucleic acid can be
expressed in eukaryotic cells from the appropriate DNA/RNA vector.
The activity of such nucleic acids can be augmented by their
release from the primary transcript by a enzymatic nucleic acid
(Draper et al., PCT WO 93/23569, and Sullivan et al., PCT WO
94/02595; Ohkawa et al., 1992, Nucleic Acids Symp. Ser., 27, 15-6;
Taira et al., 1991, Nucleic Acids Res., 19, 5125-30; Ventura et
al., 1993, Nucleic Acids Res., 21, 3249-55; Chowrira et al., 1994,
J. Biol, Chem., 269, 25856.
[0361] In another aspect of the invention, RNA molecules of the
present invention can be expressed from transcription units (see
for example Couture et al., 1996, TIG., 12, 510) inserted into DNA
or RNA vectors. The recombinant vectors can be DNA plasmids or
viral vectors. siNA expressing viral vectors can be constructed
based on, but not limited to, adeno-associated virus, retrovirus,
adenovirus, or alphavirus. In another embodiment, pol III based
constructs are used to express nucleic acid molecules of the
invention (see for example Thompson, U.S. Pats. Nos. 5,902,880 and
6,146,886). The recombinant vectors capable of expressing the siNA
molecules can be delivered as described above, and persist in
target cells. Alternatively, viral vectors can be used that provide
for transient expression of nucleic acid molecules. Such vectors
can be repeatedly administered as necessary. Once expressed, the
siNA molecule interacts with the target mRNA and generates an RNAi
response. Delivery of siNA molecule expressing vectors can be
systemic, such as by intravenous or intra-muscular administration,
by administration to target cells ex-planted from a subject
followed by reintroduction into the subject, or by any other means
that would allow for introduction into the desired target cell (for
a review see Couture et al., 1996, TIG., 12, 510).
[0362] In one aspect the invention features an expression vector
comprising a nucleic acid sequence encoding at least one siNA
molecule of the instant invention. The expression vector can encode
one or both strands of an siNA duplex, or a single
self-complementary strand that self hybridizes into an siNA duplex.
The nucleic acid sequences encoding the siNA molecules of the
instant invention can be operably linked in a manner that allows
expression of the siNA molecule (see for example Paul et al., 2002,
Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature
Biotechnology, 19, 497; Lee et al., 2002, Nature Biotechnology, 19,
500; and Novina et al., 2002, Nature Medicine, advance online
publication doi: 10.1038/nm725).
[0363] In another aspect, the invention features an expression
vector comprising: a) a transcription initiation region (e.g.,
eukaryotic pol I, II or III initiation region); b) a transcription
termination region (e.g., eukaryotic pol I, II or III termination
region); and c) a nucleic acid sequence encoding at least one of
the siNA molecules of the instant invention, wherein said sequence
is operably linked to said initiation region and said termination
region in a manner that allows expression and/or delivery of the
siNA molecule. The vector can optionally include an open reading
frame (ORF) for a protein operably linked on the 5' side or the
3'-side of the sequence encoding the siNA of the invention; and/or
an intron (intervening sequences).
[0364] Transcription of the siNA molecule sequences can be driven
from a promoter for eukaryotic RNA polymerase I (pol I), RNA
polymerase II (pol II), or RNA polymerase III (pol III).
Transcripts from pol II or pol III promoters are expressed at high
levels in all cells; the levels of a given pol II promoter in a
given cell type depends on the nature of the gene regulatory
sequences (enhancers, silencers, etc.) present nearby. Prokaryotic
RNA polymerase promoters are also used, providing that the
prokaryotic RNA polymerase enzyme is expressed in the appropriate
cells (Elroy-Stein and Moss, 1990, Proc. Natl. Acad. Sci. U S A,
87, 6743-7; Gao and Huang 1993, Nucleic Acids Res., 21, 2867-72;
Lieber et al., 1993, Methods Enzymol., 217, 47-66; Zhou et al.,
1990, Mol. Cell. Biol., 10, 4529-37). Several investigators have
demonstrated that nucleic acid molecules expressed from such
promoters can function in mammalian cells (e.g. Kashani-Sabet et
al., 1992, Antisense Res. Dev., 2, 3-15; Ojwang et al., 1992, Proc.
Natl. Acad. Sci. USA, 89, 10802-6; Chen et al., 1992, Nucleic Acids
Res., 20, 4581-9; Yu et al., 1993, Proc. Natl. Acad. Sci. USA, 90,
6340-4; L'Huillier et al., 1992, EMBO J., 11, 4411-8; Lisziewicz et
al., 1993, Proc. Natl. Acad. Sci. U.S. A, 90, 8000-4; Thompson et
al., 1995, Nucleic Acids Res., 23, 2259; Sullenger & Cech,
1993, Science, 262, 1566). More specifically, transcription units
such as the ones derived from genes encoding U6 small nuclear
(snRNA), transfer RNA (tRNA) and adenovirus VA RNA are useful in
generating high concentrations of desired RNA molecules such as
siNA in cells (Thompson et al., supra; Couture and Stinchcomb,
1996, supra; Noonberg et al., 1994, Nucleic Acid Res., 22, 2830;
Noonberg et al., U.S. Pat. No. 5,624,803; Good et al., 1997, Gene
Ther., 4, 45; Beigelman et al., International PCT Publication No.
WO 96/18736. The above siNA transcription units can be incorporated
into a variety of vectors for introduction into mammalian cells,
including but not restricted to, plasmid DNA vectors, viral DNA
vectors (such as adenovirus or adeno-associated virus vectors), or
viral RNA vectors (such as retroviral or alphavirus vectors) (for a
review see Couture and Stinchcomb, 1996, supra).
[0365] In another aspect the invention features an expression
vector comprising a nucleic acid sequence encoding at least one of
the siNA molecules of the invention in a manner that allows
expression of that siNA molecule. The expression vector comprises
in one embodiment; a) a transcription initiation region; b) a
transcription termination region; and c) a nucleic acid sequence
encoding at least one strand of the siNA molecule, wherein the
sequence is operably linked to the initiation region and the
termination region in a manner that allows expression and/or
delivery of the siNA molecule.
[0366] In another embodiment the expression vector comprises: a) a
transcription initiation region; b) a transcription termination
region; c) an open reading frame; and d) a nucleic acid sequence
encoding at least one strand of an siNA molecule, wherein the
sequence is operably linked to the 3'-end of the open reading frame
and wherein the sequence is operably linked to the initiation
region, the open reading frame and the termination region in a
manner that allows expression and/or delivery of the siNA molecule.
In yet another embodiment, the expression vector comprises: a) a
transcription initiation region; b) a transcription termination
region; c) an intron; and d) a nucleic acid sequence encoding at
least one siNA molecule, wherein the sequence is operably linked to
the initiation region, the intron and the termination region in a
manner which allows expression and/or delivery of the nucleic acid
molecule.
[0367] In another embodiment, the expression vector comprises: a) a
transcription initiation region; b) a transcription termination
region; c) an intron; d) an open reading frame; and e) a nucleic
acid sequence encoding at least one strand of an siNA molecule,
wherein the sequence is operably linked to the 3'-end of the open
reading frame and wherein the sequence is operably linked to the
initiation region, the intron, the open reading frame and the
termination region in a manner which allows expression and/or
delivery of the siNA molecule.
Cellular Adhesion Molecule Biology and Biochemistry
[0368] The following discussion is adapted from R&D Systems,
Cytokine Mini Reviews, Adhesion Molecules I, first printed in
R&D Systems' 1996 catalog. Cell adhesion molecules (CAMs) are
cell surface proteins involved in cellular binding, usually
leukocytes, to each other, to endothelial cells, or to the
extracellular matrix. Specific signals produced in response to
wounding and/or infection control the expression and activation of
certain of these adhesion molecules. The interactions and responses
resulting from binding of these CAMs to their corresponding
receptors/ligands play important roles in the mediation of the
inflammatory and immune reactions that constitute one line of the
body's defense against these insults. Most of the CAMs
characterized thus far fall into three general families of
proteins: the immunoglobulin (Ig) superfamily, the integrin family,
or the selectin family.
[0369] The Ig superfamily of adhesion molecules, which includes
ICAM-1, ICAM-2, ICAM-3, VCAM-1, and MadCAM-1, bind to integrins on
leukocytes and mediate their flattening onto the blood vessel wall
with their subsequent extravasation into the surrounding tissue.
Chemokines such as MCP-1 and IL-8 cause a conformational change in
integrins so that they can bind to their corresponding ligands. The
integrin family of CAMS act as receptors for the ICAMs and VCAMs.
The integrins are heterodimeric proteins typically consisting of an
alpha and a beta chain that mediate leukocyte adherence to the
vascular endothelium or other cell-cell interactions. Different
sets of integrins are expressed by differing populations of
leukocytes to provide unique specificity for binding to different
types of CAMs expressed along the vascular endothelium.
[0370] The selectin family members, including L-Selectin,
P-Selectin, and E-Selectin, are involved in the adhesion of
leukocytes to activated endothelium. This adhesion is initiated by
weak interactions that produce a characteristic rolling pattern of
motion of the leukocytes on the endothelial surface. P-Selectin and
L-Selectin, acting together, have been implicated in mediating
these initial interactions. Stronger interactions, most likely
involving E-Selectin, follow the initial interactions, leading
eventually to extravasation through the blood vessel walls into
lymphoid tissues and sites of inflammation.
[0371] Other proteins are functionally classified as CAMs due to
involvement in strengthening the association of T cells with
antigen-presenting cells or target cells and/or in T cell
activation. Another type of adhesion molecule, CD44, has been
implicated in lymphocyte homing, in which lymphocytes recirculate
via the lymphatic system back into circulation so they are
continuously available for antigen presentation. At least twenty
different forms of CD44, arising from differential splicing of up
to ten alternative exons (v1-v10) have been identified thus far.
Variant forms of CD44 are suspected to play an important role in
tumor metastasis.
[0372] The use of small interfering nucleic acid molecules
targeting cellular adhesion molecules (e.g., ICAM-1), therefore
provides a class of novel therapeutic agents that can be used in
the treatment of diseases and conditions associated with cellular
adhesion, such as proliferative diseases and conditions and/or
cancer including breast cancer, cancers of the head and neck
including various lymphomas such as mantle cell lymphoma,
non-Hodgkins lymphoma, adenoma, squamous cell carcinoma, laryngeal
carcinoma, cancers of the retina, cancers of the esophagus,
multiple myeloma, ovarian cancer, uterine cancer, melanoma,
colorectal cancer, lung cancer, bladder cancer, prostate cancer,
glioblastoma, lung cancer (including non-small cell lung
carcinoma), pancreatic cancer, cervical cancer, head and neck
cancer, skin cancers, nasopharyngeal carcinoma, liposarcoma,
epithelial carcinoma, renal cell carcinoma, gallbladder adeno
carcinoma, parotid adenocarcinoma, endometrial sarcoma, multidrug
resistant cancers; and proliferative diseases and conditions, such
as neovascularization associated with tumor angiogenesis, macular
degeneration (e.g., wet/dry AMD), corneal neovascularization,
diabetic retinopathy, neovascular glaucoma, myopic degeneration and
other proliferative diseases and conditions such as restenosis and
polycystic kidney disease; inflammatory diseases and conditions
such as inflammation, acute inflammation, chronic inflammation,
atherosclerosis, restenosis, asthma, allergic rhinitis, atopic
dermatitis, septic shock, rheumatoid arthritis, inflammatory bowl
disease, inflammatory pelvic disease, pain, ocular inflammatory
disease, celiac disease, Leigh Syndrome, Glycerol Kinase
Deficiency, Familial eosinophilia (FE), autosomal recessive spastic
ataxia, laryngeal inflammatory disease; Tuberculosis, Chronic
cholecystitis, Bronchiectasis, Silicosis and other pneumoconioses;
autoimmune diseases and conditions such as multiple sclerosis,
diabetes mellitus, lupus, celiac disease, Crohn's disease,
ulcerative colitis, Guillain-Barre syndrome, scleroderms,
Goodpasture's syndrome, Wegener's granulomatosis, autoimmune
epilepsy, Rasmussen's encephalitis, Primary biliary sclerosis,
Sclerosing cholangitis, Autoimmune hepatitis Addison's disease,
Hashimoto's thyroiditis, fibromyalgia, Menier's syndrome; and
transplantation rejection (e.g., prevention of allograft rejection)
and any other diseases or conditions that are related to or will
respond to the levels of ICAM in a cell or tissue, alone or in
combination with other therapies.
EXAMPLES
[0373] The following are non-limiting examples showing the
selection, isolation, synthesis and activity of nucleic acids of
the instant invention.
Example 1
Tandem Synthesis of siNA Constructs
[0374] Exemplary siNA molecules of the invention are synthesized in
tandem using a cleavable linker, for example, a succinyl-based
linker. Tandem synthesis as described herein is followed by a
one-step purification process that provides RNAi molecules in high
yield. This approach is highly amenable to siNA synthesis in
support of high throughput RNAi screening, and can be readily
adapted to multi-column or multi-well synthesis platforms.
[0375] After completing a tandem synthesis of an siNA oligo and its
complement in which the 5'-terminal dimethoxytrityl (5'-O-DMT)
group remains intact (trityl on synthesis), the oligonucleotides
are deprotected as described above. Following deprotection, the
siNA sequence strands are allowed to spontaneously hybridize. This
hybridization yields a duplex in which one strand has retained the
5'-O-DMT group while the complementary strand comprises a terminal
5'-hydroxyl. The newly formed duplex behaves as a single molecule
during routine solid-phase extraction purification (Trityl-On
purification) even though only one molecule has a dimethoxytrityl
group. Because the strands form a stable duplex, this
dimethoxytrityl group (or an equivalent group, such as other trityl
groups or other hydrophobic moieties) is all that is required to
purify the pair of oligos, for example, by using a C18
cartridge.
[0376] Standard phosphoramidite synthesis chemistry is used up to
the point of introducing a tandem linker, such as an inverted deoxy
abasic succinate or glyceryl succinate linker (see FIG. 1) or an
equivalent cleavable linker. A non-limiting example of linker
coupling conditions that can be used includes a hindered base such
as diisopropylethylamine (DIPA) and/or DMAP in the presence of an
activator reagent such as
Bromotripyrrolidinophosphoniumhexafluororophosphate (PyBrOP). After
the linker is coupled, standard synthesis chemistry is utilized to
complete synthesis of the second sequence leaving the terminal the
5'-O-DMT intact. Following synthesis, the resulting oligonucleotide
is deprotected according to the procedures described herein and
quenched with a suitable buffer, for example with 50 mM NaOAc or
1.5M NH.sub.4H.sub.2CO.sub.3.
[0377] Purification of the siNA duplex can be readily accomplished
using solid phase extraction, for example, using a Waters C18
SepPak 1 g cartridge conditioned with 1 column volume (CV) of
acetonitrile, 2 CV H2O, and 2 CV 50 mM NaOAc. The sample is loaded
and then washed with 1 CV H2O or 50 mM NaOAc. Failure sequences are
eluted with 1 CV 14% ACN (Aqueous with 50 mM NaOAc and 50 mM NaCl).
The column is then washed, for example with 1 CV H.sub.2O followed
by on-column detritylation, for example by passing 1 CV of 1%
aqueous trifluoroacetic acid (TFA) over the column, then adding a
second CV of 1% aqueous TFA to the column and allowing to stand for
approximately 10 minutes. The remaining TFA solution is removed and
the column washed with H20 followed by 1 CV 1M NaCl and additional
H2O. The siNA duplex product is then eluted, for example, using 1
CV 20% aqueous CAN.
[0378] FIG. 2 provides an example of MALDI-TOF mass spectrometry
analysis of a purified siNA construct in which each peak
corresponds to the calculated mass of an individual siNA strand of
the siNA duplex. The same purified siNA provides three peaks when
analyzed by capillary gel electrophoresis (CGE), one peak
presumably corresponding to the duplex siNA, and two peaks
presumably corresponding to the separate siNA sequence strands. Ion
exchange HPLC analysis of the same siNA contract only shows a
single peak. Testing of the purified siNA construct using a
luciferase reporter assay described below demonstrated the same
RNAi activity compared to siNA constructs generated from separately
synthesized oligonucleotide sequence strands.
Example 2
Identification of Potential siNA Target Sites in any RNA
Sequence
[0379] The sequence of an RNA target of interest, such as a viral
or human mRNA transcript, is screened for target sites, for example
by using a computer folding algorithm. In a non-limiting example,
the sequence of a gene or RNA gene transcript derived from a
database, such as Genbank, is used to generate siNA targets having
complementarity to the target. Such sequences can be obtained from
a database, or can be determined experimentally as known in the
art. Target sites that are known, for example, those target sites
determined to be effective target sites based on studies with other
nucleic acid molecules, for example ribozymes or antisense, or
those targets known to be associated with a disease or condition
such as those sites containing mutations or deletions, can be used
to design siNA molecules targeting those sites. Various parameters
can be used to determine which sites are the most suitable target
sites within the target RNA sequence. These parameters include but
are not limited to secondary or tertiary RNA structure, the
nucleotide base composition of the target sequence, the degree of
homology between various regions of the target sequence, or the
relative position of the target sequence within the RNA transcript.
Based on these determinations, any number of target sites within
the RNA transcript can be chosen to screen siNA molecules for
efficacy, for example by using in vitro RNA cleavage assays, cell
culture, or animal models. In a non-limiting example, anywhere from
1 to 1000 target sites are chosen within the transcript based on
the size of the siNA construct to be used. High throughput
screening assays can be developed for screening siNA molecules
using methods known in the art, such as with multi-well or
multi-plate assays to determine efficient reduction in target gene
expression.
Example 3
Selection of siNA Molecule Target Sites in a RNA
[0380] The following non-limiting steps can be used to carry out
the selection of siNAs targeting a given gene sequence or
transcript.
[0381] 1. The target sequence is parsed in silico into a list of
all fragments or subsequences of a particular length, for example
23 nucleotide fragments, contained within the target sequence. This
step is typically carried out using a custom Perl script, but
commercial sequence analysis programs such as Oligo, MacVector, or
the GCG Wisconsin Package can be employed as well.
[0382] 2. In some instances the siNAs correspond to more than one
target sequence; such would be the case for example in targeting
different transcripts of the same gene, targeting different
transcripts of more than one gene, or for targeting both the human
gene and an animal homolog. In this case, a subsequence list of a
particular length is generated for each of the targets, and then
the lists are compared to find matching sequences in each list. The
subsequences are then ranked according to the number of target
sequences that contain the given subsequence; the goal is to find
subsequences that are present in most or all of the target
sequences. Alternately, the ranking can identify subsequences that
are unique to a target sequence, such as a mutant target sequence.
Such an approach would enable the use of siNA to target
specifically the mutant sequence and not effect the expression of
the normal sequence.
[0383] 3. In some instances the siNA subsequences are absent in one
or more sequences while present in the desired target sequence;
such would be the case if the siNA targets a gene with a paralogous
family member that is to remain untargeted. As in case 2 above, a
subsequence list of a particular length is generated for each of
the targets, and then the lists are compared to find sequences that
are present in the target gene but are absent in the untargeted
paralog.
[0384] 4. The ranked siNA subsequences can be further analyzed and
ranked according to GC content. A preference can be given to sites
containing 30-70% GC, with a further preference to sites containing
40-60% GC.
[0385] 5. The ranked siNA subsequences can be further analyzed and
ranked according to self-folding and internal hairpins. Weaker
internal folds are preferred; strong hairpin structures are to be
avoided.
[0386] 6. The ranked siNA subsequences can be further analyzed and
ranked according to whether they have runs of GGG or CCC in the
sequence. GGG (or even more Gs) in either strand can make
oligonucleotide synthesis problematic and can potentially interfere
with RNAi activity, so it is avoided whenever better sequences are
available. CCC is searched in the target strand because that will
place GGG in the antisense strand.
[0387] 7. The ranked siNA subsequences can be further analyzed and
ranked according to whether they have the dinucleotide UU (uridine
dinucleotide) on the 3'-end of the sequence, and/or AA on the
5'-end of the sequence (to yield 3' UU on the antisense sequence).
These sequences allow one to design siNA molecules with terminal TT
thymidine dinucleotides.
[0388] 8. Four or five target sites are chosen from the ranked list
of subsequences as described above. For example, in subsequences
having 23 nucleotides, the right 21 nucleotides of each chosen
23-mer subsequence are then designed and synthesized for the upper
(sense) strand of the siNA duplex, while the reverse complement of
the left 21 nucleotides of each chosen 23-mer subsequence are then
designed and synthesized for the lower (antisense) strand of the
siNA duplex (see Tables II and III). If terminal TT residues are
desired for the sequence (as described in paragraph 7), then the
two 3' terminal nucleotides of both the sense and antisense strands
are replaced by TT prior to synthesizing the oligos.
[0389] 9. The siNA molecules are screened in an in vitro, cell
culture or animal model system to identify the most active siNA
molecule or the most preferred target site within the target RNA
sequence.
[0390] 10. Other design considerations can be used when selecting
target nucleic acid sequences, see, for example, Reynolds et al.,
2004, Nature Biotechnology Advanced Online Publication, 1 Feb.
2004, doi:10.1038/nbt936 and Ui-Tei et al., 2004, Nucleic Acids
Research, 32, doi:10.1093/nar/gkh247.
[0391] In an alternate approach, a pool of siNA constructs specific
to an ICAM target sequence is used to screen for target sites in
cells expressing ICAM RNA, such as such endothelial cells (e.g.
HUVEC cells) or lymphocytes (e.g. T cells). The general strategy
used in this approach is shown in FIG. 9. A non-limiting example of
such is a pool comprising sequences having any of SEQ ID NOs:
1-454. Cells expressing ICAM are transfected with the pool of siNA
constructs and cells that demonstrate a phenotype associated with
ICAM inhibition are sorted. The pool of siNA constructs can be
expressed from transcription cassettes inserted into appropriate
vectors (see for example FIG. 7 and FIG. 8). The siNA from cells
demonstrating a positive phenotypic change (e.g., decreased
proliferation, decreased ICAM mRNA levels or decreased ICAM protein
expression), are sequenced to determine the most suitable target
site(s) within the target ICAM RNA sequence.
Example 4
ICAM Targeted siNA Design
[0392] siNA target sites were chosen by analyzing sequences of the
ICAM RNA target and optionally prioritizing the target sites on the
basis of folding (structure of any given sequence analyzed to
determine siNA accessibility to the target), by using a library of
siNA molecules as described in Example 3, or alternately by using
an in vitro siNA system as described in Example 6 herein. siNA
molecules were designed that could bind each target and are
optionally individually analyzed by computer folding to assess
whether the siNA molecule can interact with the target sequence.
Varying the length of the siNA molecules can be chosen to optimize
activity. Generally, a sufficient number of complementary
nucleotide bases are chosen to bind to, or otherwise interact with,
the target RNA, but the degree of complementarity can be modulated
to accommodate siNA duplexes or varying length or base composition.
By using such methodologies, siNA molecules can be designed to
target sites within any known RNA sequence, for example those RNA
sequences corresponding to the any gene transcript.
[0393] Chemically modified siNA constructs are designed to provide
nuclease stability for systemic administration in vivo and/or
improved pharmacokinetic, localization, and delivery properties
while preserving the ability to mediate RNAi activity. Chemical
modifications as described herein are introduced synthetically
using synthetic methods described herein and those generally known
in the art. The synthetic siNA constructs are then assayed for
nuclease stability in serum and/or cellular/tissue extracts (e.g.
liver extracts). The synthetic siNA constructs are also tested in
parallel for RNAi activity using an appropriate assay, such as a
luciferase reporter assay as described herein or another suitable
assay that can quantity RNAi activity. Synthetic siNA constructs
that possess both nuclease stability and RNAi activity can be
further modified and re-evaluated in stability and activity assays.
The chemical modifications of the stabilized active siNA constructs
can then be applied to any siNA sequence targeting any chosen RNA
and used, for example, in target screening assays to pick lead siNA
compounds for therapeutic development (see for example FIG.
11).
Example 5
Chemical Synthesis and Purification of siNA
[0394] siNA molecules can be designed to interact with various
sites in the RNA message, for example, target sequences within the
RNA sequences described herein. The sequence of one strand of the
siNA molecule(s) is complementary to the target site sequences
described above. The siNA molecules can be chemically synthesized
using methods described herein. Inactive siNA molecules that are
used as control sequences can be synthesized by scrambling the
sequence of the siNA molecules such that it is not complementary to
the target sequence. Generally, siNA constructs can by synthesized
using solid phase oligonucleotide synthesis methods as described
herein (see for example Usman et al., U.S. Pat. Nos. 5,804,683;
5,831,071; 5,998,203; 6,117,657; 6,353,098; 6,362,323; 6,437,117;
6,469,158; Scaringe et al., U.S. Pat. Nos. 6,111,086; 6,008,400;
6,111,086 all incorporated by reference herein in their
entirety).
[0395] In a non-limiting example, RNA oligonucleotides are
synthesized in a stepwise fashion using the phosphoramidite
chemistry as is known in the art. Standard phosphoramidite
chemistry involves the use of nucleosides comprising any of
5'-O-dimethoxytrityl, 2'-O-tert-butyldimethylsilyl,
3'-O-2-Cyanoethyl N,N-diisopropylphos-phoroamidite groups, and
exocyclic amine protecting groups (e.g. N6-benzoyl adenosine, N4
acetyl cytidine, and N2-isobutyryl guanosine). Alternately,
2'-O--Silyl Ethers can be used in conjunction with acid-labile
2'-O-orthoester protecting groups in the synthesis of RNA as
described by Scaringe supra. Differing 2' chemistries can require
different protecting groups, for example 2'-deoxy-2'-amino
nucleosides can utilize N-phthaloyl protection as described by
Usman et al., U.S. Pat. No. 5,631,360, incorporated by reference
herein in its entirety).
[0396] During solid phase synthesis, each nucleotide is added
sequentially (3'- to 5'-direction) to the solid support-bound
oligonucleotide. The first nucleoside at the 3'-end of the chain is
covalently attached to a solid support (e.g., controlled pore glass
or polystyrene) using various linkers. The nucleotide precursor, a
ribonucleoside phosphoramidite, and activator are combined
resulting in the coupling of the second nucleoside phosphoramidite
onto the 5'-end of the first nucleoside. The support is then washed
and any unreacted 5'-hydroxyl groups are capped with a capping
reagent such as acetic anhydride to yield inactive 5'-acetyl
moieties. The trivalent phosphorus linkage is then oxidized to a
more stable phosphate linkage. At the end of the nucleotide
addition cycle, the 5'-O-protecting group is cleaved under suitable
conditions (e.g., acidic conditions for trityl-based groups and
Fluoride for silyl-based groups). The cycle is repeated for each
subsequent nucleotide.
[0397] Modification of synthesis conditions can be used to optimize
coupling efficiency, for example by using differing coupling times,
differing reagent/phosphoramidite concentrations, differing contact
times, differing solid supports and solid support linker
chemistries depending on the particular chemical composition of the
siNA to be synthesized. Deprotection and purification of the siNA
can be performed as is generally described in Usman et al., U.S.
Pat. No. 5,831,071, U.S. Pat. No. 6,353,098, U.S. Pat. No.
6,437,117, and Bellon et al., U.S. Pat. No. 6,054,576, U.S. Pat.
No. 6,162,909, U.S. Pat. No. 6,303,773, or Scaringe supra,
incorporated by reference herein in their entireties. Additionally,
deprotection conditions can be modified to provide the best
possible yield and purity of siNA constructs. For example,
applicant has observed that oligonucleotides comprising
2'-deoxy-2'-fluoro nucleotides can degrade under inappropriate
deprotection conditions. Such oligonucleotides are deprotected
using aqueous methylamine at about 35.degree. C. for 30 minutes. If
the 2'-deoxy-2'-fluoro containing oligonucleotide also comprises
ribonucleotides, after deprotection with aqueous methylamine at
about 35.degree. C. for 30 minutes, TEA-HF is added and the
reaction maintained at about 65.degree. C. for an additional 15
minutes.
Example 6
RNAi in Vitro Assay to Assess siNA Activity
[0398] An in vitro assay that recapitulates RNAi in a cell-free
system is used to evaluate siNA constructs targeting ICAM RNA
targets. The assay comprises the system described by Tuschl et al.,
1999, Genes and Development, 13, 3191-3197 and Zamore et al., 2000,
Cell, 101, 25-33 adapted for use with ICAM target RNA. A Drosophila
extract derived from syncytial blastoderm is used to reconstitute
RNAi activity in vitro. Target RNA is generated via in vitro
transcription from an appropriate ICAM expressing plasmid using T7
RNA polymerase or via chemical synthesis as described herein. Sense
and antisense siNA strands (for example 20 uM each) are annealed by
incubation in buffer (such as 100 mM potassium acetate, 30 mM
HEPES-KOH, pH 7.4, 2 mM magnesium acetate) for 1 minute at
90.degree. C. followed by 1 hour at 37.degree. C., then diluted in
lysis buffer (for example 100 mM potassium acetate, 30 mM HEPES-KOH
at pH 7.4, 2 mM magnesium acetate). Annealing can be monitored by
gel electrophoresis on an agarose gel in TBE buffer and stained
with ethidium bromide. The Drosophila lysate is prepared using zero
to two-hour-old embryos from Oregon R flies collected on yeasted
molasses agar that are dechorionated and lysed. The lysate is
centrifuged and the supernatant isolated. The assay comprises a
reaction mixture containing 50% lysate [vol/vol], RNA (10-50 .mu.M
final concentration), and 10% [vol/vol] lysis buffer containing
siNA (10 nM final concentration). The reaction mixture also
contains 10 mM creatine phosphate, 10 ug/ml creatine phosphokinase,
100 um GTP, 100 uM UTP, 100 uM CTP, 500 uM ATP, 5 mM DTT, 0.1 U/uL
RNasin (Promega), and 100 uM of each amino acid. The final
concentration of potassium acetate is adjusted to 100 mM. The
reactions are pre-assembled on ice and preincubated at 25.degree.
C. for 10 minutes before adding RNA, then incubated at 25.degree.
C. for an additional 60 minutes. Reactions are quenched with 4
volumes of 1.25.times. Passive Lysis Buffer (Promega). Target RNA
cleavage is assayed by RT-PCR analysis or other methods known in
the art and are compared to control reactions in which siNA is
omitted from the reaction.
[0399] Alternately, internally-labeled target RNA for the assay is
prepared by in vitro transcription in the presence of
[alpha-.sup.32P] CTP, passed over a G50 Sephadex column by spin
chromatography and used as target RNA without further purification.
Optionally, target RNA is 5'-.sup.32P-end labeled using T4
polynucleotide kinase enzyme. Assays are performed as described
above and target RNA and the specific RNA cleavage products
generated by RNAi are visualized on an autoradiograph of a gel. The
percentage of cleavage is determined by PHOSPHOR IMAGER.RTM.
(autoradiography) quantitation of bands representing intact control
RNA or RNA from control reactions without siNA and the cleavage
products generated by the assay.
[0400] In one embodiment, this assay is used to determine target
sites in the ICAM RNA target for siNA mediated RNAi cleavage,
wherein a plurality of siNA constructs are screened for RNAi
mediated cleavage of the ICAM RNA target, for example, by analyzing
the assay reaction by electrophoresis of labeled target RNA, or by
Northern blotting, as well as by other methodology well known in
the art.
Example 7
Nucleic Acid Inhibition of ICAM Target RNA
[0401] siNA molecules targeted to the human ICAM RNA are designed
and synthesized as described above. These nucleic acid molecules
can be tested for cleavage activity in vivo, for example, using the
following procedure. The target sequences and the nucleotide
location within the ICAM RNA are given in Tables II and III.
[0402] Two formats are used to test the efficacy of siNAs targeting
ICAM. First, the reagents are tested in cell culture using, for
example, endothelial cells (e.g. HUVEC cells) or lymphocytes (e.g.
T cells), to determine the extent of RNA and protein inhibition.
siNA reagents (e.g.; see Tables II and III) are selected against
the ICAM target as described herein. RNA inhibition is measured
after delivery of these reagents by a suitable transfection agent
to, for example, endothelial cells (e.g. HUVEC cells) or
lymphocytes (e.g. T cells). Relative amounts of target RNA are
measured versus actin using real-time PCR monitoring of
amplification (e.g., ABI 7700 TAQMAN.RTM.). A comparison is made to
a mixture of oligonucleotide sequences made to unrelated targets or
to a randomized siNA control with the same overall length and
chemistry, but randomly substituted at each position. Primary and
secondary lead reagents are chosen for the target and optimization
performed. After an optimal transfection agent concentration is
chosen, a RNA time-course of inhibition is performed with the lead
siNA molecule. In addition, a cell-plating format can be used to
determine RNA inhibition.
Delivery of siNA to Cells
[0403] Cells such as endothelial cells (e.g. HUVEC cells) or
lymphocytes (e.g. T cells) are seeded, for example, at
1.times.10.sup.5 cells per well of a six-well dish in EGM-2
(BioWhittaker) the day before transfection. siNA (final
concentration, for example 20 nM) and cationic lipid (e.g., final
concentration 2 .mu.g/ml) are complexed in EGM basal media (Bio
Whittaker) at 37.degree. C. for 30 minutes in polystyrene tubes.
Following vortexing, the complexed siNA is added to each well and
incubated for the times indicated. For initial optimization
experiments, cells are seeded, for example, at 1.times.10.sup.3 in
96 well plates and siNA complex added as described. Efficiency of
delivery of siNA to cells is determined using a fluorescent siNA
complexed with lipid. Cells in 6-well dishes are incubated with
siNA for 24 hours, rinsed with PBS and fixed in 2% paraformaldehyde
for 15 minutes at room temperature. Uptake of siNA is visualized
using a fluorescent microscope.
TAQMAN.RTM. (Real-Time PCR Monitoring of Amplification) and
Lightcycler Quantification of mRNA
[0404] Total RNA is prepared from cells following siNA delivery,
for example, using Qiagen RNA purification kits for 6-well or
Rneasy extraction kits for 96-well assays. For TAQMAN.RTM. analysis
(real-time PCR monitoring of amplification), dual-labeled probes
are synthesized with the reporter dye, FAM or JOE, covalently
linked at the 5'-end and the quencher dye TAMRA conjugated to the
3'-end. One-step RT-PCR amplifications are performed on, for
example, an ABI PRISM 7700 Sequence Detector using 50 .mu.l
reactions consisting of 10 .mu.l total RNA, 100 nM forward primer,
900 nM reverse primer, 100 nM probe, 1.times. TaqMan PCR reaction
buffer (PE-Applied Biosystems), 5.5 mM MgCl.sub.2, 300 .mu.M each
dATP, dCTP, dGTP, and dTTP, 10 U RNase Inhibitor (Promega), 1.25 U
AMPLITAQ GOLD.RTM. (DNA polymerase) (PE-Applied Biosystems) and 10
U M-MLV Reverse Transcriptase (Promega). The thermal cycling
conditions can consist of 30 minutes at 48.degree. C., 10 minutes
at 95.degree. C., followed by 40 cycles of 15 seconds at 95.degree.
C. and 1 minute at 60.degree. C. Quantitation of mRNA levels is
determined relative to standards generated from serially diluted
total cellular RNA (300, 100, 33, 11 ng/r.times.n) and normalizing
to .beta.-actin or GAPDH mRNA in parallel TAQMAN.RTM. reactions
(real-time PCR monitoring of amplification). For each gene of
interest an upper and lower primer and a fluorescently labeled
probe are designed. Real time incorporation of SYBR Green I dye
into a specific PCR product can be measured in glass capillary
tubes using a lightcyler. A standard curve is generated for each
primer pair using control cRNA. Values are represented as relative
expression to GAPDH in each sample.
Western Blotting
[0405] Nuclear extracts can be prepared using a standard micro
preparation technique (see for example Andrews and Faller, 1991,
Nucleic Acids Research, 19, 2499). Protein extracts from
supernatants are prepared, for example using TCA precipitation. An
equal volume of 20% TCA is added to the cell supernatant, incubated
on ice for 1 hour and pelleted by centrifugation for 5 minutes.
Pellets are washed in acetone, dried and resuspended in water.
Cellular protein extracts are run on a 10% Bis-Tris NuPage (nuclear
extracts) or 4-12% Tris-Glycine (supernatant extracts)
polyacrylamide gel and transferred onto nitro-cellulose membranes.
Non-specific binding can be blocked by incubation, for example,
with 5% non-fat milk for 1 hour followed by primary antibody for 16
hour at 4.degree. C. Following washes, the secondary antibody is
applied, for example (1:10,000 dilution) for 1 hour at room
temperature and the signal detected with SuperSignal reagent
(Pierce).
Example 8
Animal Models Useful to Evaluate the Down-Regulation of ICAM Gene
Expression
[0406] Evaluating the efficacy of anti-ICAM agents in animal models
is an important prerequisite to human clinical trials. Moromizato
et al., 2000, Am. J. Pathol., 157, 1277-81, describe a mouse model
of corneal neovascularization that identifies ICAM-1 and CD-18 as
mediators of the inflammatory and VEGRF dependent corneal
neovascularization that follows limbal injury. Ambati et al., 2003,
Nature Medicine, 9, 1390-1397, describe an animal model of
age-related macular degeneration in senescent Ccl-2- or
Ccr-2-deficient mice in which ICAM involvement is implicated in AMD
as an inflammatory condition. Keramidaris et al., 2001, J Allergy
Clin Immunol., 107, 734-8, examined the roles of L-selectin and
ICAM-1 in lymphocyte migration to the lung during an allergic
inflammatory response in an animal model of asthma. Yacyshyn et
al., 1999, Curr Opin Mol. Ther., 1, 332-5, describe clinical and
animal models of ICAM-1 antisense inhibitors. Hersmann et al.,
1998, Cell Adhes Commun., 6, 69-82, describe an animal model
characterizing the expression of cell adhesion molecules and
cytokines in murine antigen-induced arthritis. Takahashi et al.,
1996, Pathobiology, 64, 269-74, describe the role of the
ICAM-1/LFA-1 pathway during the development of autoimmune
dacryoadenitis in an animal model for Sjogren's syndrome. All of
these models can be adapted for use for pre-clinical evaluation of
the efficacy of nucleic acid compositions of the invention in
modulating ICAM gene expression toward therapeutic use in treating
indications described herein.
Example 9
RNAi Mediated Inhibition of ICAM Expression
[0407] siNA constructs (Table III) are tested for efficacy in
reducing ICAM RNA expression in, for example, HUVEC cells. Cells
are plated approximately 24 hours before transfection in 96-well
plates at 5,000-7,500 cells/well, 100 .mu.l/well, such that at the
time of transfection cells are 70-90% confluent. For transfection,
annealed siNAs are mixed with the transfection reagent
(Lipofectamine 2000, Invitrogen) in a volume of 50 .mu.l/well and
incubated for 20 minutes at room temperature. The siNA transfection
mixtures are added to cells to give a final siNA concentration of
25 nM in a volume of 150 .mu.l. Each siNA transfection mixture is
added to 3 wells for triplicate siNA treatments. Cells are
incubated at 37.degree. for 24 hours in the continued presence of
the siNA transfection mixture. At 24 hours, RNA is prepared from
each well of treated cells. The supernatants with the transfection
mixtures are first removed and discarded, then the cells are lysed
and RNA prepared from each well. Target gene expression following
treatment is evaluated by RT-PCR for the target gene and for a
control gene (36B4, an RNA polymerase subunit) for normalization.
The triplicate data is averaged and the standard deviations
determined for each treatment. Normalized data are graphed and the
percent reduction of target mRNA by active siNAs in comparison to
their respective inverted control siNAs is determined.
[0408] In a non-limiting example, chemically modified siNA
constructs (Table III) were tested for efficacy as described above
in reducing ICAM-1 RNA expression in HepG2 cells. Active siNAs were
evaluated compared to untreated cells, matched chemistry irrelevant
control (32072/32075), and a transfection control. Results are
summarized in FIG. 22. FIG. 22 shows results for chemically
modified siNA constructs targeting various sites in ICAM-1 mRNA. As
shown in FIG. 22, the active siNA constructs provide significant
inhibition of ICAM-1 gene expression in cell culture experiments as
determined by levels of ICAM-1 mRNA when compared to appropriate
controls.
Example 10
Indications
[0409] The present body of knowledge in ICAM research indicates the
need for methods to assay ICAM activity and for compounds that can
regulate ICAM expression for research, diagnostic, and therapeutic
use. As described herein, the nucleic acid molecules of the present
invention can be used in assays to diagnose disease state related
of ICAM levels. In addition, the nucleic acid molecules can be used
to treat disease state related to ICAM levels.
[0410] Particular conditions and disease states that can be
associated with ICAM expression modulation include, but are not
limited to variety of disease and conditions such as proliferative
diseases and conditions and/or cancer including breast cancer,
cancers of the head and neck including various lymphomas such as
mantle cell lymphoma, non-Hodgkins lymphoma, adenoma, squamous cell
carcinoma, laryngeal carcinoma, cancers of the retina, cancers of
the esophagus, multiple myeloma, ovarian cancer, uterine cancer,
melanoma, colorectal cancer, lung cancer, bladder cancer, prostate
cancer, glioblastoma, lung cancer (including non-small cell lung
carcinoma), pancreatic cancer, cervical cancer, head and neck
cancer, skin cancers, nasopharyngeal carcinoma, liposarcoma,
epithelial carcinoma, renal cell carcinoma, gallbladder adeno
carcinoma, parotid adenocarcinoma, endometrial sarcoma, multidrug
resistant cancers; and proliferative diseases and conditions, such
as neovascularization associated with tumor angiogenesis, macular
degeneration (e.g., wet/dry AMD), corneal neovascularization,
diabetic retinopathy, neovascular glaucoma, myopic degeneration and
other proliferative diseases and conditions such as restenosis and
polycystic kidney disease; inflammatory diseases and conditions
such as inflammation, acute inflammation, chronic inflammation,
atherosclerosis, restenosis, asthma, allergic rhinitis, atopic
dermatitis, septic shock, rheumatoid arthritis, inflammatory bowl
disease, inflammatory pelvic disease, pain, ocular inflammatory
disease, celiac disease, deep dermal burn, Leigh Syndrome, Glycerol
Kinase Deficiency, Familial eosinophilia (FE), autosomal recessive
spastic ataxia, laryngeal inflammatory disease; Tuberculosis,
Chronic cholecystitis, Bronchiectasis, Silicosis and other
pneumoconioses; autoimmune diseases and conditions such as multiple
sclerosis, diabetes mellitus, lupus, celiac disease, Crohn's
disease, ulcerative colitis, Guillain-Barre syndrome, scleroderms,
Goodpasture's syndrome, Wegener's granulomatosis, autoimmune
epilepsy, Rasmussen's encephalitis, Primary biliary sclerosis,
Sclerosing cholangitis, Autoimmune hepatitis Addison's disease,
Hashimoto's thyroiditis, fibromyalgia, Menier's syndrome; and
transplantation rejection (e.g., prevention of allograft rejection)
and any other diseases or conditions ihat are related to or will
respond to the levels of ICAM in a cell or tissue, alone or in
combination with other therapies.
[0411] The use of statins, anti-inflammatory compounds,
immunomodulations, radiation treatments and chemotherapeutics as
are known in the art are non-limiting examples of chemotherapeutic
agents that can be combined with or used in conjunction with the
nucleic acid molecules (e.g. siNA molecules) of the instant
invention. Those skilled in the art will recognize that other
compounds and therapies can similarly be readily combined with the
nucleic acid molecules of the instant invention (e.g. siNA
molecules) and are hence within the scope of the instant invention.
Such compounds and therapies are well known in the art and include,
without limitation, Gemcytabine, cyclophosphamide, folates,
antifolates, pyrimidine analogs, fluoropyrimidines, purine analogs,
adenosine analogs, topoisomerase I inhibitors, anthrapyrazoles,
retinoids, antibiotics, anthacyclins, platinum analogs, alkylating
agents, nitrosoureas, plant derived compounds such as vinca
alkaloids, epipodophyllotoxins, tyrosine kinase inhibitors, taxols,
radiation therapy, surgery, nutritional supplements, gene therapy,
radiotherapy, for example 3D-CRT, immunotoxin therapy, for example
ricin, and monoclonal antibodies. Specific examples of
chemotherapeutic compounds that can be combined with or used in
conjunction with the nucleic acid molecules of the invention
include, but are not limited to, Paclitaxel; Docetaxel;
Methotrexate; Doxorubin; Edatrexate; Vinorelbine; Tamoxifen;
Leucovorin; 5-fluoro uridine (5-FU); lonotecan; Cisplatin;
Carboplatin; Amsacrine; Cytarabine; Bleomycin; Mitomycin C;
Dactinomycin; Mithramycin; Hexamethylmelamine; Dacarbazine;
L-asperginase; Nitrogen mustard; Melphalan, Chlorambucil; Busulfan;
Ifosfamide; 4-hydroperoxycyclophosphamide; Thiotepa; Irinotecan
(CAMPTOSAR.RTM., CPT-11, Camptothecin-11, Campto) Tamoxifen;
Herceptin; IMC C225; ABX-EGF; and combinations thereof. The above
list of compounds are non-limiting examples of compounds and/or
methods that can be combined with or used in conjunction with the
nucleic acid molecules (e.g. siNA) of the instant invention for
oncology and related diseases and disorders. Those skilled in the
art will recognize that other drug compounds and therapies can
similarly be readily combined with the nucleic acid molecules of
the instant invention (e.g., siNA molecules) for treatment of other
diseases and conditions, such as inflammatory, allergic, and
autoimmune diseases and conditions, and are hence within the scope
of the instant invention.
Example 11
Diagnostic Uses
[0412] The siNA molecules of the invention can be used in a variety
of diagnostic applications, such as in the identification of
molecular targets (e.g., RNA) in a variety of applications, for
example, in clinical, industrial, environmental, agricultural
and/or research settings. Such diagnostic use of siNA molecules
involves utilizing reconstituted RNAi systems, for example, using
cellular lysates or partially purified cellular lysates. siNA
molecules of this invention can be used as diagnostic tools to
examine genetic drift and mutations within diseased cells or to
detect the presence of endogenous or exogenous, for example viral,
RNA in a cell. The close relationship between siNA activity and the
structure of the target RNA allows the detection of mutations in
any region of the molecule, which alters the base-pairing and
three-dimensional structure of the target RNA. By using multiple
siNA molecules described in this invention, one can map nucleotide
changes, which are important to RNA structure and function in
vitro, as well as in cells and tissues. Cleavage of target RNAs
with siNA molecules can be used to inhibit gene expression and
define the role of specified gene products in the progression of
disease or infection. In this manner, other genetic targets can be
defined as important mediators of the disease. These experiments
will lead to better treatment of the disease progression by
affording the possibility of combination therapies (e.g., multiple
siNA molecules targeted to different genes, siNA molecules coupled
with known small molecule inhibitors, or intermittent treatment
with combinations siNA molecules and/or other chemical or
biological molecules). Other in vitro uses of siNA molecules of
this invention are well known in the art, and include detection of
the presence of mRNAs associated with a disease, infection, or
related condition. Such RNA is detected by determining the presence
of a cleavage product after treatment with an siNA using standard
methodologies, for example, fluorescence resonance emission
transfer (FRET).
[0413] In a specific example, siNA molecules that cleave only
wild-type or mutant forms of the target RNA are used for the assay.
The first siNA molecules (i.e., those that cleave only wild-type
forms of target RNA) are used to identify wild-type RNA present in
the sample and the second siNA molecules (i.e., those that cleave
only mutant forms of target RNA) are used to identify mutant RNA in
the sample. As reaction controls, synthetic substrates of both
wild-type and mutant RNA are cleaved by both siNA molecules to
demonstrate the relative siNA efficiencies in the reactions and the
absence of cleavage of the "non-targeted" RNA species. The cleavage
products from the synthetic substrates also serve to generate size
markers for the analysis of wild-type and mutant RNAs in the sample
population. Thus, each analysis requires two siNA molecules, two
substrates and one unknown sample, which is combined into six
reactions. The presence of cleavage products is determined using an
RNase protection assay so that full-length and cleavage fragments
of each RNA can be analyzed in one lane of a polyacrylamide gel. It
is not absolutely required to quantify the results to gain insight
into the expression of mutant RNAs and putative risk of the desired
phenotypic changes in target cells. The expression of mRNA whose
protein product is implicated in the development of the phenotype
(i.e., disease related or infection related) is adequate to
establish risk. If probes of comparable specific activity are used
for both transcripts, then a qualitative comparison of RNA levels
is adequate and decreases the cost of the initial diagnosis. Higher
mutant form to wild-type ratios are correlated with higher risk
whether RNA levels are compared qualitatively or
quantitatively.
[0414] All patents and publications mentioned in the specification
are indicative of the levels of skill of those skilled in the art
to which the invention pertains. All references cited in this
disclosure are incorporated by reference to the same extent as if
each reference had been incorporated by reference in its entirety
individually.
[0415] One skilled in the art would readily appreciate that the
present invention is well adapted to carry out the objects and
obtain the ends and advantages mentioned, as well as those inherent
therein. The methods and compositions described herein as presently
representative of preferred embodiments are exemplary and are not
intended as limitations on the scope of the invention. Changes
therein and other uses will occur to those skilled in the art,
which are encompassed within the spirit of the invention, are
defined by the scope of the claims.
[0416] It will be readily apparent to one skilled in the art that
varying substitutions and modifications can be made to the
invention disclosed herein without departing from the scope and
spirit of the invention. Thus, such additional embodiments are
within the scope of the present invention and the following claims.
The present invention teaches one skilled in the art to test
various combinations and/or substitutions of chemical modifications
described herein toward generating nucleic acid constructs with
improved activity for mediating RNAi activity. Such improved
activity can comprise improved stability, improved bioavailability,
and/or improved activation of cellular responses mediating RNAi.
Therefore, the specific embodiments described herein are not
limiting and one skilled in the art can readily appreciate that
specific combinations of the modifications described herein can be
tested without undue experimentation toward identifying siNA
molecules with improved RNAi activity.
[0417] The invention illustratively described herein suitably can
be practiced in the absence of any element or elements, limitation
or limitations that are not specifically disclosed herein. Thus,
for example, in each instance herein any of the terms "comprising",
"consisting essentially of", and "consisting of" may be replaced
with either of the other two terms. The terms and expressions which
have been employed are used as terms of description and not of
limitation, and there is no intention that in the use of such terms
and expressions of excluding any equivalents of the features shown
and described or portions thereof, but it is recognized that
various modifications are possible within the scope of the
invention claimed. Thus, it should be understood that although the
present invention has been specifically disclosed by preferred
embodiments, optional features, modification and variation of the
concepts herein disclosed may be resorted to by those skilled in
the art, and that such modifications and variations are considered
to be within the scope of this invention as defined by the
description and the appended claims.
[0418] In addition, where features or aspects of the invention are
described in terms of Markush groups or other grouping of
alternatives, those skilled in the art will recognize that the
invention is also thereby described in terms of any individual
member or subgroup of members of the Markush group or other
group.
TABLE-US-00001 TABLE I ICAM Accession Numbers NM_000201 Homo
sapiens intercellular adhesion molecule 1 (CD54), human rhinovirus
receptor (ICAM1), mRNA gi|4557877|ref|NM_000201.1|[4557877] J03132
Human intercellular adhesion molecule-1 (ICAM-1) mRNA, complete cds
gi|184534|gb|J03132.1|HUMICAMA1M[184534] BC015969 Homo sapiens
intercellular adhesion molecule 1 (CD54), human rhinovirus
receptor, mRNA (cDNA clone MGC: 2296 IMAGE: 3506766), complete cds
gi|33869582|gb|BC015969.2|[33869582] X06990 Human mRNA for
intercellular adhesion molecule-1 ICAM-1
gi|32614|emb|X06990.1|HSICAM1[32614] BT006854 Homo sapiens
intercellular adhesion molecule 1 (CD54), human rhinovirus receptor
mRNA, complete cds gi|30582546|gb|BT006854.1|[30582546] X59288 Homo
sapiens partial gene for intercellular adhesion molecule 1
(ICAM-1), exons 3-7 gi|32620|emb|X59288.1|HSICAM13[32620] AY225514
Homo sapiens intercellular adhesion molecule 1 (CD54), human
rhinovirus receptor (ICAM1) gene, complete cds
gi|28200672|gb|AY225514.1|[28200672] X59287 Homo sapiens partial
gene for intercellular adhesion molecule 1 (ICAM-1), exon 2
gi|32619|emb|X59287.1|HSICAM12[32619] U86814 Human intercelular
adhesion molecule 1 (ICAM-1) gene, partial cds
gi|1916283|gb|U86814.1|HSU86814[1916283] U09360 Human intercellular
adhesion molecule-1 gene, promoter region
gi|488077|gb|U09360.1|HSU09360[488077] X59286 Homo sapiens partial
gene for intercellular adhesion molecule 1, exon 1 (and joined CDS)
gi|32617|emb|X59286.1|HSICAM11[32617] M65001 Human intercellular
adhesion molecule 1 (ICAM-1) gene, exon 1
gi|184536|gb|M65001.1|HUMICAMAB[184536] X57151 Human ICAM-1 (CD54)
gene for intercellular adhesion molecule-1 (5' region, exon 1)
gi|32621|emb|X57151.1|HSICAM1G[32621] BC003097 Homo sapiens
intercellular adhesion molecule 2, mRNA (cDNA clone MGC: 1718
IMAGE: 3502827), complete cds gi|13111858|gb|BC003097.1|[13111858]
NM_000873 Homo sapiens intercellular adhesion molecule 2 (ICAM2),
mRNA gi|12545398|ref|NM_000873.2|[12545398] AY421098 Homo sapiens
ICAM2 gene, VIRTUAL TRANSCRIPT, partial sequence, genomic survey
sequence gi|39777055|gb|AY421098.1|[39777055] AF212826 Homo sapiens
intercellular adhesion molecule 2 (ICAM2) gene, partial cds
gi|6979645|gb|AF212826.1|AF212826[6979645] AH001485 Homo sapiens
intercellular adhesion molecule 2 (ICAM-2) gene
gi|184530|gb|AH001485.1|SEG_HUMICAM[184530] M32334 Homo sapiens
intercellular adhesion molecule 2 (ICAM-2) gene, exon 4
gi|184529|gb|M32334.1|HUMICAM4[184529] M32333 Homo sapiens
intercellular adhesion molecule 2 (ICAM-2) gene, exon 3
gi|184528|gb|M32333.1|HUMICAM3[184528] M32332 Homo sapiens
intercellular adhesion molecule 2 (ICAM-2) gene, exon 2
gi|184527|gb|M32332.1|HUMICAM2[184527] M32331 Homo sapiens
intercellular adhesion molecule 2 (ICAM-2) gene, exon 1
gi|184526|gb|M32331.1|HUMICAM1[184526] NM_174349 Bos taurus
intercellular adhesion molecule 3 (ICAM3), mRNA
gi|41386692|ref|NM_174349.1|[41386692] BC058903 Homo sapiens
intercellular adhesion molecule 3, mRNA (cDNA clone MGC: 64964
IMAGE: 5207143), complete cds gi|37748333|gb|BC058903.1|[37748333]
NM_021155 Homo sapiens CD209 antigen (CD209), mRNA
gi|22095359|ref|NM_021155.2|[22095359] NM_002162 Homo sapiens
intercellular adhesion molecule 3 (ICAM3), mRNA
gi|12545399|ref|NM_002162.2|[12545399] NM_022377 Homo sapiens
intercellular adhesion molecule 4, Landsteiner-Wiener blood group
(ICAM4), transcript variant 2, mRNA
gi|12545401|ref|NM_022377.1|[12545401] NM_001544 Homo sapiens
intercellular adhesion molecule 4, Landsteiner-Wiener blood group
(ICAM4), transcript variant 1, mRNA
gi|12545400|ref|NM_001544.2|[12545400] BC000046 Homo sapiens
intercellular adhesion molecule 4, Landsteiner-Wiener blood group,
mRNA (cDNA clone MGC: 2108 IMAGE: 3505509), complete cds
gi|37588945|gb|BC000046.2|[37588945] BC029364 Homo sapiens
intercellular adhesion molecule 4, Landsteiner-Wiener blood group,
transcript variant 1, mRNA (cDNA clone MGC: 32542 IMAGE: 4659161),
complete cds gi|20810185|gb|BC029364.1|[20810185] BC030132 Homo
sapiens intercellular adhesion molecule 5, telencephalin, mRNA
(cDNA clone IMAGE: 4299082), partial cds
gi|39644965|gb|BC030132.2|[39644965] BC026338 Homo sapiens
intercellular adhesion molecule 5, telencephalin, mRNA (cDNA clone
MGC: 26509 IMAGE: 4814795), complete cds
gi|20071180|gb|BC026338.1|[20071180] NM_003259 Homo sapiens
intercellular adhesion molecule 5, telencephalin (ICAM5), mRNA
gi|12545403|ref|NM_003259.2|[12545403] AF082802 Homo sapiens
telencephalin (ICAM5) gene, complete cds
gi|4050009|gb|AF082802.1|AF082802[4050009]
TABLE-US-00002 TABLE II ICAM1 siNA AND TARGET SEQUENCES ICAM1
NM_000201 Seq Seq Seq Pos Seq ID UPos Upper seq ID LPos Lower seq
ID 3 GCCCCAGUCGACGCUGAGC 1 3 GCCCCAGUCGACGCUGAGC 1 21
GCUCAGCGUCGACUGGGGC 167 21 CUCCUCUGCUACUCAGAGU 2 21
CUCCUCUGCUACUCAGAGU 2 39 ACUCUGAGUAGCAGAGGAG 168 39
UUGCAACCUCAGCCUCGCU 3 39 UUGCAACCUCAGCCUCGCU 3 57
AGCGAGGCUGAGGUUGCAA 169 57 UAUGGCUCCCAGCAGCCCC 4 57
UAUGGCUCCCAGCAGCCCC 4 75 GGGGCUGCUGGGAGCCAUA 170 75
CCGGCCCGCGCUGCCCGCA 5 75 CCGGCCCGCGCUGCCCGCA 5 93
UGCGGGCAGCGCGGGCCGG 171 93 ACUCCUGGUCCUGCUCGGG 6 93
ACUCCUGGUCCUGCUCGGG 6 111 CCCGAGCAGGACCAGGAGU 172 111
GGCUCUGUUCCCAGGACCU 7 111 GGCUCUGUUCCCAGGACCU 7 129
AGGUCCUGGGAACAGAGCC 173 129 UGGCAAUGCCCAGACAUCU 8 129
UGGCAAUGCCCAGACAUCU 8 147 AGAUGUCUGGGCAUUGCCA 174 147
UGUGUCCCCCUCAAAAGUC 9 147 UGUGUCCCCCUCAAAAGUC 9 165
GACUUUUGAGGGGGACACA 175 165 CAUCCUGCCCCGGGGAGGC 10 165
CAUCCUGCCCCGGGGAGGC 10 183 GCCUCCCCGGGGCAGGAUG 176 183
CUCCGUGCUGGUGACAUGC 11 183 CUCCGUGCUGGUGACAUGC 11 201
GCAUGUCACCAGCACGGAG 177 201 CAGCACCUCCUGUGACCAG 12 201
CAGCACCUCCUGUGACCAG 12 219 CUGGUCACAGGAGGUGCUG 178 219
GCCCAAGUUGUUGGGCAUA 13 219 GCCCAAGUUGUUGGGCAUA 13 237
UAUGCCCAACAACUUGGGC 179 237 AGAGACCCCGUUGCCUAAA 14 237
AGAGACCCCGUUGCCUAAA 14 255 UUUAGGCAACGGGGUCUCU 180 255
AAAGGAGUUGCUCCUGCCU 15 255 AAAGGAGUUGCUCCUGCCU 15 273
AGGCAGGAGCAACUCCUUU 181 273 UGGGAACAACCGGAAGGUG 16 273
UGGGAACAACCGGAAGGUG 16 291 CACCUUCCGGUUGUUCCCA 182 291
GUAUGAACUGAGCAAUGUG 17 291 GUAUGAACUGAGCAAUGUG 17 309
CACAUUGCUCAGUUCAUAC 183 309 GCAAGAAGAUAGCCAACCA 18 309
GCAAGAAGAUAGCCAACCA 18 327 UGGUUGGCUAUCUUCUUGC 184 327
AAUGUGCUAUUCAAACUGC 19 327 AAUGUGCUAUUCAAACUGC 19 345
GCAGUUUGAAUAGCACAUU 185 345 CCCUGAUGGGCAGUCAACA 20 345
CCCUGAUGGGCAGUCAACA 20 363 UGUUGACUGCCCAUCAGGG 186 363
AGCUAAAACCUUCCUCACC 21 363 AGCUAAAACCUUCCUCACC 21 381
GGUGAGGAAGGUUUUAGCU 187 381 CGUGUACUGGACUCCAGAA 22 381
CGUGUACUGGACUCCAGAA 22 399 UUCUGGAGUCCAGUACACG 188 399
ACGGGUGGAACUGGCACCC 23 399 ACGGGUGGAACUGGCACCC 23 417
GGGUGCCAGUUCCACCCGU 189 417 CCUCCCCUCUUGGCAGCCA 24 417
CCUCCCCUCUUGGCAGCCA 24 435 UGGCUGCCAAGAGGGGAGG 190 435
AGUGGGCAAGAACCUUACC 25 435 AGUGGGCAAGAACCUUACC 25 453
GGUAAGGUUCUUGCCCACU 191 453 CCUACGCUGCCAGGUGGAG 26 453
CCUACGCUGCCAGGUGGAG 26 471 CUCCACCUGGCAGCGUAGG 192 471
GGGUGGGGCACCCCGGGCC 27 471 GGGUGGGGCACCCCGGGCC 27 489
GGCCCGGGGUGCCCCACCC 193 489 CAACCUCACCGUGGUGCUG 28 489
CAACCUCACCGUGGUGCUG 28 507 CAGCACCACGGUGAGGUUG 194 507
GCUCCGUGGGGAGAAGGAG 29 507 GCUCCGUGGGGAGAAGGAG 29 525
CUCCUUCUCCCCACGGAGC 195 525 GCUGAAACGGGAGCCAGCU 30 525
GCUGAAACGGGAGCCAGCU 30 543 AGCUGGCUCCCGUUUCAGC 196 543
UGUGGGGGAGCCCGCUGAG 31 543 UGUGGGGGAGCCCGCUGAG 31 561
CUCAGCGGGCUCCCCCACA 197 561 GGUCACGACCACGGUGCUG 32 561
GGUCACGACCACGGUGCUG 32 579 CAGCACCGUGGUCGUGACC 198 579
GGUGAGGAGAGAUCACCAU 33 579 GGUGAGGAGAGAUCACCAU 33 597
AUGGUGAUCUCUCCUCACC 199 597 UGGAGCCAAUUUCUCGUGC 34 597
UGGAGCCAAUUUCUCGUGC 34 615 GCACGAGAAAUUGGCUCCA 200 615
CCGCACUGAACUGGACCUG 35 615 CCGCACUGAACUGGACCUG 35 633
CAGGUCCAGUUCAGUGCGG 201 633 GCGGCCCCAAGGGCUGGAG 36 633
GCGGCCCCAAGGGCUGGAG 36 651 CUCCAGCCCUUGGGGCCGC 202 651
GCUGUUUGAGAACACCUCG 37 651 GCUGUUUGAGAACACCUCG 37 669
CGAGGUGUUCUCAAACAGC 203 669 GGCCCCCUACCAGCUCCAG 38 669
GGCCCCCUACCAGCUCCAG 38 687 CUGGAGCUGGUAGGGGGCC 204 687
GACCUUUGUCCUGCCAGCG 39 687 GACCUUUGUCCUGCCAGCG 39 705
CGCUGGCAGGACAAAGGUC 205 705 GACUCCCCCACAACUUGUC 40 705
GACUCCCCCACAACUUGUC 40 723 GACAAGUUGUGGGGGAGUC 206 723
CAGCCCCCGGGUCCUAGAG 41 723 CAGCCCCCGGGUCCUAGAG 41 741
CUCUAGGACCCGGGGGCUG 207 741 GGUGGACACGCAGGGGACC 42 741
GGUGGACACGCAGGGGACC 42 759 GGUCCCCUGCGUGUCCACC 208 759
CGUGGUCUGUUCCCUGGAC 43 759 CGUGGUCUGUUCCCUGGAC 43 777
GUCCAGGGAACAGACCACG 209 777 CGGGCUGUUCCCAGUCUCG 44 777
CGGGCUGUUCCCAGUCUCG 44 795 CGAGACUGGGAACAGCCCG 210 795
GGAGGCCCAGGUCCACCUG 45 795 GGAGGCCCAGGUCCACCUG 45 813
CAGGUGGACCUGGGCCUCC 211 813 GGCACUGGGGGACCAGAGG 46 813
GGCACUGGGGGACCAGAGG 46 831 CCUCUGGUCCCCCAGUGCC 212 831
GUUGAACCCCACAGUCACC 47 831 GUUGAACCCCACAGUCACC 47 849
GGUGACUGUGGGGUUCAAC 213 849 CUAUGGCAACGACUCCUUC 48 849
CUAUGGCAACGACUCCUUC 48 867 GAAGGAGUCGUUGCCAUAG 214 867
CUCGGCCAAGGCCUCAGUC 49 867 CUCGGCCAAGGCCUCAGUC 49 885
GACUGAGGCCUUGGCCGAG 215 885 CAGUGUGACCGCAGAGGAC 50 885
CAGUGUGACCGCAGAGGAC 50 903 GUCCUCUGCGGUCACACUG 216 903
CGAGGGCACCCAGCGGCUG 51 903 CGAGGGCACCCAGCGGCUG 51 921
CAGCCGCUGGGUGCCCUCG 217 921 GACGUGUGCAGUAAUACUG 52 921
GACGUGUGCAGUAAUACUG 52 939 CAGUAUUACUGCACACGUC 218 939
GGGGAACCAGAGCCAGGAG 53 939 GGGGAACCAGAGCCAGGAG 53 957
CUCCUGGCUCUGGUUCCCC 219 957 GACACUGCAGACAGUGACC 54 957
GACACUGCAGACAGUGACC 54 975 GGUCACUGUCUGCAGUGUC 220 975
CAUCUACAGCUUUCCGGCG 55 975 CAUCUACAGCUUUCCGGCG 55 993
CGCCGGAAAGCUGUAGAUG 221 993 GCCCAACGUGAUUCUGACG 56 993
GCCCAACGUGAUUCUGACG 56 1011 CGUCAGAAUCACGUUGGGC 222 1011
GAAGCCAGAGGUCUCAGAA 57 1011 GAAGCCAGAGGUCUCAGAA 57 1029
UUCUGAGACCUCUGGCUUC 223 1029 AGGGACCGAGGUGACAGUG 58 1029
AGGGACCGAGGUGACAGUG 58 1047 CACUGUCACCUCGGUCCCU 224 1047
GAAGUGUGAGGCCCACCCU 59 1047 GAAGUGUGAGGCCCACCCU 59 1065
AGGGUGGGCCUCACACUUC 225 1065 UAGAGCCAAGGUGACGCUG 60 1065
UAGAGCCAAGGUGACGCUG 60 1083 CAGCGUCACCUUGGCUCUA 226 1083
GAAUGGGGUUCCAGCCCAG 61 1083 GAAUGGGGUUCCAGCCCAG 61 1101
CUGGGCUGGAACCCCAUUC 227 1101 GCCACUGGGCCCGAGGGCC 62 1101
GCCACUGGGCCCGAGGGCC 62 1119 GGCCCUCGGGCCCAGUGGC 228 1119
CCAGCUCCUGCUGAAGGCC 63 1119 CCAGCUCCUGCUGAAGGCC 63 1137
GGCCUUCAGCAGGAGCUGG 229 1137 CACCCCAGAGGACAACGGG 64 1137
CACCCCAGAGGACAACGGG 64 1155 CCCGUUGUCCUCUGGGGUG 230 1155
GCGCAGCUUCUCCUGCUCU 65 1155 GCGCAGCUUCUCCUGCUCU 65 1173
AGAGCAGGAGAAGCUGCGC 231 1173 UGCAACCCUGGAGGUGGCC 66 1173
UGCAACCCUGGAGGUGGCC 66 1191 GGCCACCUCCAGGGUUGCA 232 1191
CGGCCAGCUUAUACACAAG 67 1191 CGGCCAGCUUAUACACAAG 67 1209
CUUGUGUAUAAGCUGGCCG 233 1209 GAACCAGACCCGGGAGCUU 68 1209
GAACCAGACCCGGGAGCUU 68 1227 AAGCUCCCGGGUCUGGUUC 234 1227
UCGUGUCCUGUAUGGCCCC 69 1227 UCGUGUCCUGUAUGGCCCC 69 1245
GGGGCCAUACAGGACACGA 235 1245 CCGACUGGACGAGAGGGAU 70 1245
CCGACUGGACGAGAGGGAU 70 1263 AUCCCUCUCGUCCAGUCGG 236 1263
UUGUCCGGGAAACUGGACG 71 1263 UUGUCCGGGAAACUGGACG 71 1281
CGUCCAGUUUCCCGGACAA 237 1281 GUGGCCAGAAAAUUCCCAG 72 1281
GUGGCCAGAAAAUUCCCAG 72 1299 CUGGGAAUUUUCUGGCCAC 238 1299
GCAGACUCCAAUGUGCCAG 73 1299 GCAGACUCCAAUGUGCCAG 73 1317
CUGGCACAUUGGAGUCUGC 239 1317 GGCUUGGGGGAACCCAUUG 74 1317
GGCUUGGGGGAACCCAUUG 74 1335 CAAUGGGUUCCCCCAAGCC 240 1335
GCCCGAGCUCAAGUGUCUA 75 1335 GCCCGAGCUCAAGUGUCUA 75 1353
UAGACACUUGAGCUCGGGC 241 1353 AAAGGAUGGCACUUUCCCA 76 1353
AAAGGAUGGCACUUUCCCA 76 1371 UGGGAAAGUGCCAUCCUUU 242 1371
ACUGCCCAUCGGGGAAUCA 77 1371 ACUGCCCAUCGGGGAAUCA 77 1389
UGAUUCCCCGAUGGGCAGU 243 1389 AGUGACUGUCACUCGAGAU 78 1389
AGUGACUGUCACUCGAGAU 78 1407 AUCUCGAGUGACAGUCACU 244 1407
UCUUGAGGGCACCUACCUC 79 1407 UCUUGAGGGCACCUACCUC 79 1425
GAGGUAGGUGCCCUCAAGA 245 1425 CUGUCGGGCCAGGAGCACU 80 1425
CUGUCGGGCCAGGAGCACU 80 1443 AGUGCUCCUGGCCCGACAG 246 1443
UCAAGGGGAGGUCACCCGC 81 1443 UCAAGGGGAGGUCACCCGC 81 1461
GCGGGUGACCUCCCCUUGA 247
1461 CGAGGUGACCGUGAAUGUG 82 1461 CGAGGUGACCGUGAAUGUG 82 1479
CACAUUCACGGUCACCUCG 248 1479 GCUCUCCCCCCGGUAUGAG 83 1479
GCUCUCCCCCCGGUAUGAG 83 1497 CUCAUACCGGGGGGAGAGC 249 1497
GAUUGUCAUCAUCACUGUG 84 1497 GAUUGUCAUCAUCACUGUG 84 1515
CACAGUGAUGAUGACAAUC 250 1515 GGUAGCAGCCGCAGUCAUA 85 1515
GGUAGCAGCCGCAGUCAUA 85 1533 UAUGACUGCGGCUGCUACC 251 1533
AAUGGGCACUGCAGGCCUC 86 1533 AAUGGGCACUGCAGGCCUC 86 1551
GAGGCCUGCAGUGCCCAUU 252 1551 CAGCACGUACCUCUAUAAC 87 1551
CAGCACGUACCUCUAUAAC 87 1569 GUUAUAGAGGUACGUGCUG 253 1569
CCGCCAGCGGAAGAUCAAG 88 1569 CCGCCAGCGGAAGAUCAAG 88 1587
CUUGAUCUUCCGCUGGCGG 254 1587 GAAAUACAGACUACAACAG 89 1587
GAAAUACAGACUACAACAG 89 1605 CUGUUGUAGUCUGUAUUUC 255 1605
GGCCCAAAAAGGGACCCCC 90 1605 GGCCCAAAAAGGGACCCCC 90 1623
GGGGGUCCCUUUUUGGGCC 256 1623 CAUGAAACCGAACACACAA 91 1623
CAUGAAACCGAACACACAA 91 1641 UUGUGUGUUCGGUUUCAUG 257 1641
AGCCACGCCUCCCUGAACC 92 1641 AGCCACGCCUCCCUGAACC 92 1659
GGUUCAGGGAGGCGUGGCU 258 1659 CUAUCCCGGGACAGGGCCU 93 1659
CUAUCCCGGGACAGGGCCU 93 1677 AGGCCCUGUCCCGGGAUAG 259 1677
UCUUCCUCGGCCUUCCCAU 94 1677 UCUUCCUCGGCCUUCCCAU 94 1695
AUGGGAAGGCCGAGGAAGA 260 1695 UAUUGGUGGCAGUGGUGCC 95 1695
UAUUGGUGGCAGUGGUGCC 95 1713 GGCACCACUGCCACCAAUA 261 1713
CACACUGAACAGAGUGGAA 96 1713 CACACUGAACAGAGUGGAA 96 1731
UUCCACUCUGUUCAGUGUG 262 1731 AGACAUAUGCCAUGCAGCU 97 1731
AGACAUAUGCCAUGCAGCU 97 1749 AGCUGCAUGGCAUAUGUCU 263 1749
UACACCUACCGGCCCUGGG 98 1749 UACACCUACCGGCCCUGGG 98 1767
CCCAGGGCCGGUAGGUGUA 264 1767 GACGCCGGAGGACAGGGCA 99 1767
GACGCCGGAGGACAGGGCA 99 1785 UGCCCUGUCCUCCGGCGUC 265 1785
AUUGUCCUCAGUCAGAUAC 100 1785 AUUGUCCUCAGUCAGAUAC 100 1803
GUAUCUGACUGAGGACAAU 266 1803 CAACAGCAUUUGGGGCCAU 101 1803
CAACAGCAUUUGGGGCCAU 101 1821 AUGGCCCCAAAUGCUGUUG 267 1821
UGGUACCUGCACACCUAAA 102 1821 UGGUACCUGCACACCUAAA 102 1839
UUUAGGUGUGCAGGUACCA 268 1839 AACACUAGGCCACGCAUCU 103 1839
AACACUAGGCCACGCAUCU 103 1857 AGAUGCGUGGCCUAGUGUU 269 1857
UGAUCUGUAGUCACAUGAC 104 1857 UGAUCUGUAGUCACAUGAC 104 1875
GUCAUGUGACUACAGAUCA 270 1875 CUAAGCCAAGAGGAAGGAG 105 1875
CUAAGCCAAGAGGAAGGAG 105 1893 CUCCUUCCUCUUGGCUUAG 271 1893
GCAAGACUCAAGACAUGAU 106 1893 GCAAGACUCAAGACAUGAU 106 1911
AUCAUGUCUUGAGUCUUGC 272 1911 UUGAUGGAUGUUAAAGUCU 107 1911
UUGAUGGAUGUUAAAGUCU 107 1929 AGACUUUAACAUCCAUCAA 273 1929
UAGCCUGAUGAGAGGGGAA 108 1929 UAGCCUGAUGAGAGGGGAA 108 1947
UUCCCCUCUCAUCAGGCUA 274 1947 AGUGGUGGGGGAGACAUAG 109 1947
AGUGGUGGGGGAGACAUAG 109 1965 CUAUGUCUCCCCCACCACU 275 1965
GCCCCACCAUGAGGACAUA 110 1965 GCCCCACCAUGAGGACAUA 110 1983
UAUGUCCUCAUGGUGGGGC 276 1983 ACAACUGGGAAAUACUGAA 111 1983
ACAACUGGGAAAUACUGAA 111 2001 UUCAGUAUUUCCCAGUUGU 277 2001
AACUUGCUGCCUAUUGGGU 112 2001 AACUUGCUGCCUAUUGGGU 112 2019
ACCCAAUAGGCAGCAAGUU 278 2019 UAUGCUGAGGCCCACAGAC 113 2019
UAUGCUGAGGCCCACAGAC 113 2037 GUCUGUGGGCCUCAGCAUA 279 2037
CUUACAGAAGAAGUGGCCC 114 2037 CUUACAGAAGAAGUGGCCC 114 2055
GGGCCACUUCUUCUGUAAG 280 2055 CUCCAUAGACAUGUGUAGC 115 2055
CUCCAUAGACAUGUGUAGC 115 2073 GCUACACAUGUCUAUGGAG 281 2073
CAUCAAAACACAAAGGCCC 116 2073 CAUCAAAACACAAAGGCCC 116 2091
GGGCCUUUGUGUUUUGAUG 282 2091 CACACUUCCUGACGGAUGC 117 2091
CACACUUCCUGACGGAUGC 117 2109 GCAUCCGUCAGGAAGUGUG 283 2109
CCAGCUUGGGCACUGCUGU 118 2109 CCAGCUUGGGCACUGCUGU 118 2127
ACAGCAGUGCCCAAGCUGG 284 2127 UCUACUGACCCCAACCCUU 119 2127
UCUACUGACCCCAACCCUU 119 2145 AAGGGUUGGGGUCAGUAGA 285 2145
UGAUGAUAUGUAUUUAUUC 120 2145 UGAUGAUAUGUAUUUAUUC 120 2163
GAAUAAAUACAUAUCAUCA 286 2163 CAUUUGUUAUUUUACCAGC 121 2163
CAUUUGUUAUUUUACCAGC 121 2181 GCUGGUAAAAUAACAAAUG 287 2181
CUAUUUAUUGAGUGUCUUU 122 2181 CUAUUUAUUGAGUGUCUUU 122 2199
AAAGACACUCAAUAAAUAG 288 2199 UUAUGUAGGCUAAAUGAAC 123 2199
UUAUGUAGGCUAAAUGAAC 123 2217 GUUCAUUUAGCCUACAUAA 289 2217
CAUAGGUCUCUGGCCUCAC 124 2217 CAUAGGUCUCUGGCCUCAC 124 2235
GUGAGGCCAGAGACCUAUG 290 2235 CGGAGCUCCCAGUCCAUGU 125 2235
CGGAGCUCCCAGUCCAUGU 125 2253 ACAUGGACUGGGAGCUCCG 291 2253
UCACAUUCAAGGUCACCAG 126 2253 UCACAUUCAAGGUCACCAG 126 2271
CUGGUGACCUUGAAUGUGA 292 2271 GGUACAGUUGUACAGGUUG 127 2271
GGUACAGUUGUACAGGUUG 127 2289 CAACCUGUACAACUGUACC 293 2289
GUACACUGCAGGAGAGUGC 128 2289 GUACACUGCAGGAGAGUGC 128 2307
GCACUCUCCUGCAGUGUAC 294 2307 CCUGGCAAAAAGAUCAAAU 129 2307
CCUGGCAAAAAGAUCAAAU 129 2325 AUUUGAUCUUUUUGCCAGG 295 2325
UGGGGCUGGGACUUCUCAU 130 2325 UGGGGCUGGGACUUCUCAU 130 2343
AUGAGAAGUCCCAGCCCCA 296 2343 UUGGCCAACCUGCCUUUCC 131 2343
UUGGCCAACCUGCCUUUCC 131 2361 GGAAAGGCAGGUUGGCCAA 297 2361
CCCAGAAGGAGUGAUUUUU 132 2361 CCCAGAAGGAGUGAUUUUU 132 2379
AAAAAUCACUCCUUCUGGG 298 2379 UCUAUCGGCACAAAAGCAC 133 2379
UCUAUCGGCACAAAAGCAC 133 2397 GUGCUUUUGUGCCGAUAGA 299 2397
CUAUAUGGACUGGUAAUGG 134 2397 CUAUAUGGACUGGUAAUGG 134 2415
CCAUUACCAGUCCAUAUAG 300 2415 GUUCACAGGUUCAGAGAUU 135 2415
GUUCACAGGUUCAGAGAUU 135 2433 AAUCUCUGAACCUGUGAAC 301 2433
UACCCAGUGAGGCCUUAUU 136 2433 UACCCAGUGAGGCCUUAUU 136 2451
AAUAAGGCCUCACUGGGUA 302 2451 UCCUCCCUUCCCCCCAAAA 137 2451
UCCUCCCUUCCCCCCAAAA 137 2469 UUUUGGGGGGAAGGGAGGA 303 2469
ACUGACACCUUUGUUAGCC 138 2469 ACUGACACCUUUGUUAGCC 138 2487
GGCUAACAAAGGUGUCAGU 304 2487 CACCUCCCCACCCACAUAC 139 2487
CACCUCCCCACCCACAUAC 139 2505 GUAUGUGGGUGGGGAGGUG 305 2505
CAUUUCUGCCAGUGUUCAC 140 2505 CAUUUCUGCCAGUGUUCAC 140 2523
GUGAACACUGGCAGAAAUG 306 2523 CAAUGACACUCAGCGGUCA 141 2523
CAAUGACACUCAGCGGUCA 141 2541 UGACCGCUGAGUGUCAUUG 307 2541
AUGUCUGGACAUGAGUGCC 142 2541 AUGUCUGGACAUGAGUGCC 142 2559
GGCACUCAUGUCCAGACAU 308 2559 CCAGGGAAUAUGCCCAAGC 143 2559
CCAGGGAAUAUGCCCAAGC 143 2577 GCUUGGGCAUAUUCCCUGG 309 2577
CUAUGCCUUGUCCUCUUGU 144 2577 CUAUGCCUUGUCCUCUUGU 144 2595
ACAAGAGGACAAGGCAUAG 310 2595 UCCUGUUUGCAUUUCACUG 145 2595
UCCUGUUUGCAUUUCACUG 145 2613 CAGUGAAAUGCAAACAGGA 311 2613
GGGAGCUUGCACUAUUGCA 146 2613 GGGAGCUUGCACUAUUGCA 146 2631
UGCAAUAGUGCAAGCUCCC 312 2631 AGCUCCAGUUUCCUGCAGU 147 2631
AGCUCCAGUUUCCUGCAGU 147 2649 ACUGCAGGAAACUGGAGCU 313 2649
UGAUCAGGGUCCUGCAAGC 148 2649 UGAUCAGGGUCCUGCAAGC 148 2667
GCUUGCAGGACCCUGAUCA 314 2667 CAGUGGGGAAGGGGGCCAA 149 2667
CAGUGGGGAAGGGGGCCAA 149 2685 UUGGCCCCCUUCCCCACUG 315 2685
AGGUAUUGGAGGACUCCCU 150 2685 AGGUAUUGGAGGACUCCCU 150 2703
AGGGAGUCCUCCAAUACCU 316 2703 UCCCAGCUUUGGAAGGGUC 151 2703
UCCCAGCUUUGGAAGGGUC 151 2721 GACCCUUCCAAAGCUGGGA 317 2721
CAUCCGCGUGUGUGUGUGU 152 2721 CAUCCGCGUGUGUGUGUGU 152 2739
ACACACACACAGGCGGAUG 318 2739 UGUGUAUGUGUAGACAAGC 153 2739
UGUGUAUGUGUAGACAAGC 153 2757 GCUUGUCUACACAUACACA 319 2757
CUCUCGCUCUGUCACCCAG 154 2757 CUCUCGCUCUGUCACCCAG 154 2775
CUGGGUGACAGAGCGAGAG 320 2775 GGCUGGAGUGCAGUGGUGC 155 2775
GGCUGGAGUGCAGUGGUGC 155 2793 GCACCACUGCACUCCAGCC 321 2793
CAAUCAUGGUUCACUGCAG 156 2793 CAAUCAUGGUUCACUGCAG 156 2811
CUGCAGUGAACCAUGAUUG 322 2811 GUCUUGACCUUUUGGGCUC 157 2811
GUCUUGACCUUUUGGGCUC 157 2829 GAGCCCAAAAGGUCAAGAC 323 2829
CAAGUGAUCCUCCCACCUC 158 2829 CAAGUGAUCCUCCCACCUC 158 2847
GAGGUGGGAGGAUCACUUG 324 2847 CAGCCUCCUGAGUAGCUGG 159 2847
CAGCCUCCUGAGUAGCUGG 159 2865 CCAGCUACUCAGGAGGCUG 325 2865
GGACCAUAGGCUCACAACA 160 2865 GGACCAUAGGCUCACAACA 160 2883
UGUUGUGAGCCUAUGGUCC 326 2883 ACCACACCUGGCAAAUUUG 161 2883
ACCACACCUGGCAAAUUUG 161 2901 CAAAUUUGCCAGGUGUGGU 327 2901
GAUUUUUUUUUUUUUUUUC 162 2901 GAUUUUUUUUUUUUUUUUC 162 2919
GAAAAAAAAAAAAAAAAUC 328 2919 CAGAGACGGGGUCUCGCAA 163 2919
CAGAGACGGGGUCUCGCAA 163 2937 UUGCGAGACCCCGUCUCUG 329 2937
ACAUUGCCCAGACUUCCUU 164 2937 ACAUUGCCCAGACUUCCUU 164 2955
AAGGAAGUCUGGGCAAUGU 330 2955 UUGUGUUAGUUAAUAAAGC 165 2955
UUGUGUUAGUUAAUAAAGC 165 2973 GCUUUAUUAACUAACACAA 331
2966 AAUAAAGCUUUCUCAACUG 166 2966 AAUAAAGCUUUCUCAACUG 166 2984
CAGUUGAGAAAGCUUUAUU 332
[0419] The 3'-ends of the Upper sequence and the Lower sequence of
the siNA construct can include an overhang sequence, for example
about 1, 2, 3, or 4 nucleotides in length, preferably 2 nucleotides
in length, wherein the overhanging sequence of the lower sequence
is optionally complementary to a portion of the target sequence.
The upper sequence is also referred to as the sense strand, whereas
the lower sequence is also referred to as the antisense strand. The
upper and lower sequences in the Table can further comprise a
chemical modification having Formulae I-VII, such as exemplary siNA
constructs shown in FIGS. 4 and 5, or having modifications
described in Table IV or any combination thereof.
TABLE-US-00003 TABLE III ICAM1 Synthetic Modified siNA Constructs
Target Seq Seq Pos Target ID Cmpd# Aliases Sequence ID 953
AGGAGACACUGCAGACAGUGACC 333 ICAM1: 955U21 sense siNA
GAGACACUGCAGACAGUGATT 341 968 CAGUGACCAUCUACAGCUUUCCG 334 ICAM1:
970U21 sense siNA GUGACCAUCUACAGCUUUCTT 342 1550
UCAGCACGUACCUCUAUAACCGC 335 ICAM1: 1552U21 sense siNA
AGCACGUACCUCUAUAACCTT 343 1875 CUAAGCCAAGAGGAAGGAGCAAG 336 ICAM1:
1877U21 sense siNA AAGCCAAGAGGAAGGAGCATT 344 2587
UCCUCUUGUCCUGUUUGCAUUUC 337 ICAM1: 2589U21 sense siNA
CUCUUGUCCUGUUUGCAUUTT 345 2796 UCAUGGUUCACUGCAGUCUUGAC 338 ICAM1:
2798U21 sense siNA AUGGUUCACUGCAGUCUUGTT 346 2799
UGGUUCACUGCAGUCUUGACCUU 339 ICAM1: 2801U21 sense siNA
GUUCACUGCAGUCUUGACCTT 347 2869 CAUAGGCUCACAACACCACACCU 340 ICAM1:
2871U21 sense siNA UAGGCUCACAACACCACACTT 348 953
AGGAGACACUGCAGACAGUGACC 333 ICAM1: 973121 antisense
UCACUGUCUGCAGUGUCUCTT 349 siNA (955C) 968 CAGUGACCAUCUACAGCUUUCCG
334 ICAM1: 988L21 antisense GAAAGCUGUAGAUGGUCACTT 350 siNA (970C)
1550 UCAGCACGUACCUCUAUAACCGC 335 ICAM1: 1570L21 antisense
GGUUAUAGAGGUACGUGCUTT 351 siNA (1552C) 1875 CUAAGCCAAGAGGAAGGAGCAAG
336 ICAM1: 1895L21 antisense UGCUCCUUCCUCUUGGCUUTT 352 siNA (1877C)
2587 UCCUCUUGUCCUGUUUGCAUUUC 337 ICAM1: 2607L21 antisense
AAUGCAAACAGGACAAGAGTT 353 siNA (2589C) 2796 UCAUGGUUCACUGCAGUCUUGAC
338 ICAM1: 2816L21 antisense CAAGACUGCAGUGAACCAUTT 354 siNA (2798C)
2799 UGGUUCACUGCAGUCUUGACCUU 339 ICAM1: 2819L21 antisense
GGUCAAGACUGCAGUGAACTT 355 siNA (2801C) 2869 CAUAGGCUCACAACACCACACCU
340 ICAM1: 2889L21 antisense GUGUGGUGUUGUGAGCCUATT 356 siNA (2871C)
953 AGGAGACACUGCAGACAGUGACC 333 ICAM1: 955U21 sense siNA B
GAGAcAcuGcAGAcAGuGATT B 357 stab04 968 CAGUGACCAUCUACAGCUUUCCG 334
ICAM1: 970U21 sense siNA B GuGAccAucuAcAGcuuucTT B 358 stab04 1550
UCAGCACGUACCUCUAUAACCGC 335 ICAM1: 1552U21 sense siNA B
AGcAcGuAccucuAuAAccTT B 359 stab04 1875 CUAAGCCAAGAGGAAGGAGCAAG 336
ICAM1: 1877U21 sense siNA B AAGccAAGAGGAAGGAGcATT B 360 stab04 2587
UCCUCUUGUCCUGUUUGCAUUUC 337 ICAM1: 2589U21 sense siNA B
cucuuGuccuGuuuGcAuuTT B 361 stab04 2796 UCAUGGUUCACUGCAGUCUUGAC 338
ICAM1: 2798U21 sense siNA B AuGGuucAcuGcAGucuuGTT B 362 stab04 2799
UGGUUCACUGCAGUCUUGACCUU 339 ICAM1: 2801U21 sense siNA B
GuucAcuGcAGucuuGAccTT B 363 stab04 2869 CAUAGGCUCACAACACCACACCU 340
ICAM1: 2871U21 sense siNA B uAGGcucAcAAcAccAcAcTT B 364 stab04 953
AGGAGACACUGCAGACAGUGACC 333 ICAM1: 973L21 antisense siNA
ucAcuGucuGcAGuGucucTsT 365 (955C) stab05 968
CAGUGACCAUCUACAGCUUUCCG 334 ICAM1: 986L21 antisense siNA
GAAAGcuGuAGAuGGucAcTsT 366 (970C) stab05 1550
UCAGCACGUACCUCUAUAACCGC 335 ICAM1: 1570L21 antisense siNA
GGuuAuAGAGGuAcGuGcuTsT 367 (1552C) stab05 1875
CUAAGCCAAGAGGAAGGAGCAAG 336 ICAM1: 1895L21 antisense siNA
uGcuccuuccucuuGGcuuTsT 368 (1877C) stab05 2587
UCCUCUUGUCCUGUUUGCAUUUC 337 ICAM1: 2607L21 antisense siNA
AAuGcAAAcAGGAcAAGAGTsT 369 (2589C) stab05 2796
UCAUGGUUCACUGCAGUCUUGAC 338 ICAM1: 2816L21 antisense siNA
cAAGAcuGcAGuGAAccAuTsT 370 (2798C) stab05 2799
UGGUUCACUGCAGUCUUGACCUU 339 ICAM1: 2819L21 antisense siNA
GGucAAGAcuGcAGuGAAcTsT 371 (2801C) stab05 2869
CAUAGGCUCACAACACCACACCU 340 ICAM1: 2889L21 antisense siNA
GuGuGGuGuuGuGAGccuATsT 372 (2871C) stab05 953
AGGAGACACUGCAGACAGUGACC 333 ICAM1: 955U21 sense siNA B
GAGAcAcuGcAGAcAGuGATT B 373 stab07 968 CAGUGACCAUCUACAGCUUUCCG 334
ICAM1: 970U21 sense siNA B GuGAccAucuAcAGcuuucTT B 374 stab07 1550
UCAGCACGUACCUCUAUAACCGC 335 ICAM1: 1552U21 sense siNA B
AGcAcGuAccucuAuAAccTT B 375 stab07 1875 CUAAGCCAAGAGGAAGGAGCAAG 336
ICAM1: 1877U21 sense siNA B AAGccAAGAGGAAGGAGcATT B 376 stab07 2587
UCCUCUUGUCCUGUUUGCAUUUC 337 ICAM1: 2589U21 sense siNA B
cucuuGuccuGuuuGcAuuTT B 377 stab07 2796 UCAUGGUUCACUGCAGUCUUGAC 338
ICAM1: 2798U21 sense siNA B AuGGuucAcuGcAGucuuGTT B 378 stab07 2799
UGGUUCACUGCAGUCUUGACCUU 339 ICAM1: 2801U21 sense siNA B
GuucAcuGcAGucuuGAccTT B 379 stab07 2869 CAUAGGCUCACAACACCACACCU 340
ICAM1: 2871U21 sense siNA B uAGGcucAcAAcAccAcAcTT B 380 stab07 953
AGGAGACACUGCAGACAGUGACC 333 ICAM1: 973L21 antisense siNA
ucAcuGucuGcAGuGucucTsT 381 (955C) stab11 968
CAGUGACCAUCUACAGCUUUCCG 334 ICAM1: 988L21 antisense siNA
GAAAGcuGuAGAuGGucAcTsT 382 (970C) stab11 1550
UCAGCACGUACCUCUAUAACCGC 335 ICAM1: 1570L21 antisense siNA
GGuuAuAGAGGuAcGuGcuTsT 383 (1552C) stab11 1875
CUAAGCCAAGAGGAAGGAGCAAG 336 ICAM1: 1895L21 antisense siNA
uGcuccuuccucuuGGcuuTsT 384 (1877C) stab11 2587
UCCUCUUGUCCUGUUUGCAUUUC 337 ICAM1: 2607L21 antisense siNA
AAuGcAAAcAGGAcAAGAGTsT 385 (2589C) stab11 2796
UCAUGGUUCACUGCAGUCUUGAC 338 ICAM1: 2816L21 antisense siNA
cAAGAcuGcAGuGAAccAuTsT 386 (2798C) stab11 2799
UGGUUCACUGCAGUCUUGACCUU 339 ICAM1: 2819L21 antisense siNA
GGucAAGAcuGcAGuGAAcTsT 387 (2801C) stab11 2869
CAUAGGCUCACAACACCACACCU 340 ICAM1: 2889L21 antisense siNA
GuGuGGuGuuGuGAGccuATsT 388 (2871C) stab11 953
AGGAGACACUGCAGACAGUGACC 333 ICAM1: 955U21 sense siNA B
GAGAcAcuGcAGAcAGuGATT B 389 stab18 968 CAGUGACCAUCUACAGCUUUCCG 334
ICAM1: 970U21 sense siNA B GuGAccAucuAcAGcuuucTT B 390 stab18 1550
UCAGCACGUACCUCUAUAACCGC 335 ICAM1: 1552U21 sense siNA B
AGcAcGuAccucuAuAAccTT B 391 stab18 1875 CUAAGCCAAGAGGAAGGAGCAAG 336
ICAM1: 1877U21 sense siNA B AAGccAAGAGGAAGGAGcATT B 392 stab18 2587
UCCUCUUGUCCUGUUUGCAUUUC 337 ICAM1: 2589U21 sense siNA B
cucuuGuccuGuuuGcAuuTT B 393 stab18 2796 UCAUGGUUCACUGCAGUCUUGAC 338
ICAM1: 2798U21 sense siNA B AuGGuucAcuGcAGucuuGTT B 394 stab18 2799
UGGUUCACUGCAGUCUUGACCUU 339 ICAM1: 2801U21 sense siNA B
GuucAcuGcAGucuuGAccTT B 395 stab18 2869 CAUAGGCUCACAACACCACACCU 340
ICAM1: 2871U21 sense siNA B uAGGcucAcAAcAccAcAcTT B 396 stab18 953
AGGAGACACUGCAGACAGUGACC 333 ICAM1: 973L21 antisense siNA
ucAcuGucuGcAGuGucucTsT 397 (955C) stab08 968
CAGUGACCAUCUACAGCUUUCCG 334 ICAM1: 988L21 antisense siNA
GAAAGcuGuAGAuGGucAcTsT 398 (970C) stab08 1550
UCAGCACGUACCUCUAUAACCGC 335 ICAM1: 1570L21 antisense siNA
GGuuAuAGAGGuAcGuGcuTsT 399 (1552C) stab08 1875
CUAAGCCAAGAGGAAGGAGCAAG 336 ICAM1: 1895L21 antisense siNA
uGcuccuuccucuuGGcuuTsT 400 (1877C) stab08 2587
UCCUCUUGUCCUGUUUGCAUUUC 337 ICAM1: 2607L21 antisense siNA
AAuGcAAAcAGGAcAAGAGTsT 401 (2589C) stab08 2796
UCAUGGUUCACUGCAGUCUUGAC 338 ICAM1: 2816L21 antisense siNA
cAAGAcuGcAGuGAAccAuTsT 402 (2798C) stab08 2799
UGGUUCACUGCAGUCUUGACCUU 339 ICAM1: 2819L21 antisense siNA
GGucAAGAcuGcAGuGAAcTsT 403 (2801C) stab08 2869
CAUAGGCUCACAACACCACACCU 340 ICAM1: 2889L21 antisense siNA
GuGuGGuGuuGuGAGccuATsT 404 (2871C) stab08 953
AGGAGACACUGCAGACAGUGACC 333 37076 ICAM1: 955U21 sense siNA B
GAGACACUGCAGACAGUGATT B 405 stab09 968 CAGUGACCAUCUACAGCUUUCCG 334
37077 ICAM1: 970U21 sense siNA B GUGACCAUCUACAGCUUUCTT B 406 stab09
1550 UCAGCACGUACCUCUAUAACCGC 335 37078 ICAM1: 1552U21 sense siNA B
AGCACGUACCUCUAUAACCTT B 407 stab09 1875 CUAAGCCAAGAGGAAGGAGCAAG 336
37079 ICAM1: 1877U21 sense siNA B AAGCCAAGAGGAAGGAGCATT B 408
stab09 2587 UCCUCUUGUCCUGUUUGCAUUUC 337 37080 ICAM1: 2589U21 sense
siNA B CUCUUGUCCUGUUUGCAUUTT B 409 stab09 2796
UCAUGGUUCACUGCAGUCUUGAC 338 37081 ICAM1: 2798U21 sense siNA B
AUGGUUCACUGCAGUCUUGTT B 410 stab09 2799 UGGUUCACUGCAGUCUUGACCUU 339
37082 ICAM1: 2801U21 sense siNA B GUUCACUGCAGUCUUGACCTT B 411
stab09 2869 CAUAGGCUCACAACACCACACCU 340 37083 ICAM1: 2871U21 sense
siNA B UAGGCUCACAACACCACACTT B 412 stab09 953
AGGAGACACUGCAGACAGUGACC 333 ICAM1: 973L21 antisense siNA
UCACUGUCUGCAGUGUCUCTsT 413 (955C) stab10 968
CAGUGACCAUCUACAGCUUUCCG 334 ICAM1: 988L21 antisense siNA
GAAAGCUGUAGAUGGUCACTsT 414 (970C) stab10 1550
UCAGCACGUACCUCUAUAACCGC 335 ICAM1: 1570L21 antisense siNA
GGUUAUAGAGGUACGUGCUTsT 415 (1552C) stab10 1875
CUAAGCCAAGAGGAAGGAGCAAG 336 ICAM1: 1895L21 antisense siNA
UGCUCCUUCCUCUUGGCUUTsT 416 (1877C) stab10 2587
UCCUCUUGUCCUGUUUGCAUUUC 337 ICAM1: 2607L21 antisense siNA
AAUGCAAACAGGACAAGAGTsT 417 (2589C) stab10 2796
UCAUGGUUCACUGCAGUCUUGAC 338 ICAM1: 2816L21 antisense siNA
CAAGACUGCAGUGAACCAUTsT 418 (2798C) stab10 2799
UGGUUCACUGCAGUCUUGACCUU 339 ICAM1: 2819L21 antisense siNA
GGUCAAGACUGCAGUGAACTsT 419 (2801C) stab10 2869
CAUAGGCUCACAACACCACACCU 340 ICAM1: 2889L21 antisense siNA
GUGUGGUGUUGUGAGCCUATsT 420 (2871C) stab10 953
AGGAGACACUGCAGACAGUGACC 333 ICAM1: 973L21 antisense siNA
ucAcuGucuGcAGuGucucTT B 421 (955C) stab19 968
CAGUGACCAUCUACAGCUUUCCG 334 ICAM1: 988L21 antisense siNA
GAAAGcuGuAGAuGGucAcTT B 422 (970C) stab19 1550
UCAGCACGUACCUCUAUAACCGC 335 ICAM1: 1570L21 antisense siNA
GGuuAuAGAGGuAcGuGcuTT B 423 (1552C) stab19 1875
CUAAGCCAAGAGGAAGGAGCAAG 336 ICAM1: 1895L21 antisense siNA
uGcuccuuccucuuGGcuuTT B 424 (1877C) stab19 2587
UCCUCUUGUCCUGUUUGCAUUUC 337 ICAM1: 2607L21 antisense siNA
AAuGcAAAcAGGAcAAGAGTT B 425 (2589C) stab19 2796
UCAUGGUUCACUGCAGUCUUGAC 338 ICAM1: 2816L21 antisense siNA
cAAGAcuGcAGuGAAccAuTT B 426 (2798C) stab19 2799
UGGUUCACUGCAGUCUUGACCUU 339 ICAM1: 2819L21 antisense siNA
GGucAAGAcuGcAGuGAAcTT B 427 (2801C) stab19 2869
CAUAGGCUCACAACACCACACCU 340 ICAM1: 2889L21 antisense siNA
GuGuGGuGuuGuGAGccuATT B 428 (2871C) stab19 953
AGGAGACACUGCAGACAGUGACC 333 37084 ICAM1: 973L21 antisense siNA
UCACUGUCUGCAGUGUCUCTT B 429 (955C) stab22 968
CAGUGACCAUCUACAGCUUUCCG 334 37085 ICAM1: 988L21 antisense siNA
GAAAGCUGUAGAUGGUCACTT B 430 (970C) stab22 1550
UCAGCACGUACCUCUAUAACCGC 335 37086 ICAM1: 1570L21 antisense siNA
GGUUAUAGAGGUACGUGCUTT B 431 (1552C) stab22 1875
CUAAGCCAAGAGGAAGGAGCAAG 336 37087 ICAM1: 1895L21 antisense siNA
UGCUCCUUCCUCUUGGCUUTT B 432 (1877C) stab22 2587
UCCUCUUGUCCUGUUUGCAUUUC 337 37088 ICAM1: 2607L21 antisense siNA
AAUGCAAACAGGACAAGAGTT B 433 (2589C) stab22 2796
UCAUGGUUCACUGCAGUCUUGAC 338 37089 ICAM1: 2816L21 antisense siNA
CAAGACUGCAGUGAACCAUTT B 434 (2798C) stab22 2799
UGGUUCACUGCAGUCUUGACCUU 339 37090 ICAM1: 2819L21 antisense siNA
GGUCAAGACUGCAGUGAACTT B 435 (2801C) stab22 2869
CAUAGGCUCACAACACCACACCU 340 37091 ICAM1: 2889l21 antisense siNA
GUGUGGUGUUGUGAGCCUATT B 436 (2871C) stab22 Uppercase =
ribonucleotide u, c = 2'-deoxy-2'-fluoro U, C T = thymidine B =
inverted deoxy abasic s = phosphorothioate linkage A = deoxy
Adenosine G = deoxy Guanosine G = 2'-O-methyl Guanosine A =
2'-O-methyl Adenosine
TABLE-US-00004 TABLE IV Non-limiting examples of Stabilization
Chemistries for chemically modified siNA constructs Chem- Pu- istry
pyrimidine rine cap p = S Strand "Stab Ribo Ribo TT at 3'- S/AS 00"
ends "Stab Ribo Ribo -- 5 at 5'-end S/AS 1" 1 at 3'-end "Stab Ribo
Ribo -- All linkages Usually AS 2" "Stab 2'-fluoro Ribo -- 4 at
5'-end Usually S 3" 4 at 3'-end "Stab 2'-fluoro Ribo 5' and 3'- --
Usually S 4" ends "Stab 2'-fluoro Ribo -- 1 at 3'-end Usually AS 5"
"Stab 2'-O-Methyl Ribo 5' and 3'- -- Usually S 6" ends "Stab
2'-fluoro 2'- 5' and 3'- -- Usually S 7" deoxy ends "Stab 2'-fluoro
2'-O- -- 1 at 3'-end S/AS 8" Methyl "Stab Ribo Ribo 5' and 3'- --
Usually S 9" ends "Stab Ribo Ribo -- 1 at 3'-end Usually AS 10"
"Stab 2'-fluoro 2'- -- 1 at 3'-end Usually AS 11" deoxy "Stab
2'-fluoro LNA 5' and 3'- Usually S 12" ends "Stab 2'-fluoro LNA 1
at 3'-end Usually AS 13" "Stab 2'-fluoro 2'- 2 at 5'-end Usually AS
14" deoxy 1 at 3'-end "Stab 2'-deoxy 2'- 2 at 5'-end Usually AS 15"
deoxy 1 at 3'-end "Stab Ribo 2'-O- 5' and 3'- Usually S 16" Methyl
ends "Stab 2'-O-Methyl 2'-O- 5' and 3'- Usually S 17" Methyl ends
"Stab 2'-fluoro 2'-O- 5' and 3'- Usually S 18" Methyl ends "Stab
2'-fluoro 2'-O- 3'-end S/AS 19" Methyl "Stab 2'-fluoro 2'- 3'-end
Usually AS 20" deoxy "Stab 2'-fluoro Ribo 3'-end Usually AS 21"
"Stab Ribo Ribo 3'-end Usually AS 22" "Stab 2'-fluoro* 2'- 5' and
3'- Usually S 23" deoxy* ends "Stab 2'-fluoro* 2'-O- -- 1 at 3'-end
S/AS 24" Methyl* "Stab 2'-fluoro* 2'-O- -- 1 at 3'-end S/AS 25"
Methyl* "Stab 2'-fluoro* 2'-O- -- S/AS 26" Methyl* "Stab 2'-fluoro*
2'-O- 3'-end S/AS 27" Methyl* "Stab 2'-fluoro* 2'-O- 3'-end S/AS
28" Methyl* "Stab 2'-fluoro* 2'-O- 1 at 3'-end S/AS 29" Methyl*
"Stab 2'-fluoro* 2'-O- S/AS 30" Methyl* "Stab 2'-fluoro* 2'-O-
3'-end S/AS 31" Methyl* "Stab 2'-fluoro 2'-O- S/AS 32" Methyl CAP =
any terminal cap, see for example FIG. 10. All Stab 00-32
chemistries can comprise 3'-terminal thymidine (TT) residues All
Stab 00-32 chemistries typically comprise about 21 nucleotides, but
can vary as described herein. S = sense strand AS = antisense
strand *Stab 23 has a single ribonucleotide adjacent to 3'-CAP
*Stab 24 and Stab 28 have a single ribonucleotide at 5'-terminus
*Stab 25, Stab 26, and Stab 27 have three ribonucleotides at
5'-terminus *Stab 29, Stab 30, and Stab 31, any purine at first
three nucleotide positions from 5'-terminus are ribonucleotides p =
phosphorothioate linkage
TABLE-US-00005 TABLE V A. 2.5 .mu.mol Synthesis Cycle ABI 394
Instrument Reagent Equivalents Amount Wait Time* DNA Wait Time*
2'-O-methyl Wait Time*RNA Phosphoramidites 6.5 163 .mu.L 45 sec 2.5
min 7.5 min S-Ethyl Tetrazole 23.8 238 .mu.L 45 sec 2.5 min 7.5 min
Acetic Anhydride 100 233 .mu.L 5 sec 5 sec 5 sec N-Methyl 186 233
.mu.L 5 sec 5 sec 5 sec Imidazole TCA 176 2.3 mL 21 sec 21 sec 21
sec Iodine 11.2 1.7 mL 45 sec 45 sec 45 sec Beaucage 12.9 645 .mu.L
100 sec 300 sec 300 sec Acetonitrile NA 6.67 mL NA NA NA B. 0.2
.mu.mol Synthesis Cycle ABI 394 Instrument Reagent Equivalents
Amount Wait Time* DNA Wait Time* 2'-O-methyl Wait Time*RNA
Phosphoramidites 15 31 .mu.L 45 sec 233 sec 465 sec S-Ethyl
Tetrazole 38.7 31 .mu.L 45 sec 233 min 465 sec Acetic Anhydride 655
124 .mu.L 5 sec 5 sec 5 sec N-Methyl 1245 124 .mu.L 5 sec 5 sec 5
sec Imidazole TCA 700 732 .mu.L 10 sec 10 sec 10 sec Iodine 20.6
244 .mu.L 15 sec 15 sec 15 sec Beaucage 7.7 232 .mu.L 100 sec 300
sec 300 sec Acetonitrile NA 2.64 mL NA NA NA C. 0.2 .mu.mol
Synthesis Cycle 96 well Instrument Equivalents: DNA/ Amount:
DNA/2'-O- Wait Time* 2'-O- Reagent 2'-O-methyl/Ribo methyl/Ribo
Wait Time* DNA methyl Wait Time* Ribo Phosphoramidites 22/33/66
40/60/120 .mu.L 60 sec 180 sec 360 sec S-Ethyl Tetrazole 70/105/210
40/60/120 .mu.L 60 sec 180 min 360 sec Acetic Anhydride 265/265/265
50/50/50 .mu.L 10 sec 10 sec 10 sec N-Methyl 502/502/502 50/50/50
.mu.L 10 sec 10 sec 10 sec Imidazole TCA 238/475/475 250/500/500
.mu.L 15 sec 15 sec 15 sec Iodine 6.8/6.8/6.8 80/80/80 .mu.L 30 sec
30 sec 30 sec Beaucage 34/51/51 80/120/120 100 sec 200 sec 200 sec
Acetonitrile NA 1150/1150/1150 .mu.L NA NA NA Wait time does not
include contact time during delivery. Tandem synthesis utilizes
double coupling of linker molecule
Sequence CWU 1
1
459119RNAArtificial SequenceSynthetic target sequence/siNA sense
region 1gccccagucg acgcugagc 19219RNAArtificial SequenceSynthetic
target sequence/siNA sense region 2cuccucugcu acucagagu
19319RNAArtificial SequenceSynthetic target sequence/siNA sense
region 3uugcaaccuc agccucgcu 19419RNAArtificial SequenceSynthetic
target sequence/siNA sense region 4uauggcuccc agcagcccc
19519RNAArtificial SequenceSynthetic target sequence/siNA sense
region 5ccggcccgcg cugcccgca 19619RNAArtificial SequenceSynthetic
target sequence/siNA sense region 6acuccugguc cugcucggg
19719RNAArtificial SequenceSynthetic target sequence/siNA sense
region 7ggcucuguuc ccaggaccu 19819RNAArtificial SequenceSynthetic
target sequence/siNA sense region 8uggcaaugcc cagacaucu
19919RNAArtificial SequenceSynthetic target sequence/siNA sense
region 9uguguccccc ucaaaaguc 191019RNAArtificial SequenceSynthetic
target sequence/siNA sense region 10cauccugccc cggggaggc
191119RNAArtificial SequenceSynthetic target sequence/siNA sense
region 11cuccgugcug gugacaugc 191219RNAArtificial SequenceSynthetic
target sequence/siNA sense region 12cagcaccucc ugugaccag
191319RNAArtificial SequenceSynthetic target sequence/siNA sense
region 13gcccaaguug uugggcaua 191419RNAArtificial SequenceSynthetic
target sequence/siNA sense region 14agagaccccg uugccuaaa
191519RNAArtificial SequenceSynthetic target sequence/siNA sense
region 15aaaggaguug cuccugccu 191619RNAArtificial SequenceSynthetic
target sequence/siNA sense region 16ugggaacaac cggaaggug
191719RNAArtificial SequenceSynthetic target sequence/siNA sense
region 17guaugaacug agcaaugug 191819RNAArtificial SequenceSynthetic
target sequence/siNA sense region 18gcaagaagau agccaacca
191919RNAArtificial SequenceSynthetic target sequence/siNA sense
region 19aaugugcuau ucaaacugc 192019RNAArtificial SequenceSynthetic
target sequence/siNA sense region 20cccugauggg cagucaaca
192119RNAArtificial SequenceSynthetic target sequence/siNA sense
region 21agcuaaaacc uuccucacc 192219RNAArtificial SequenceSynthetic
target sequence/siNA sense region 22cguguacugg acuccagaa
192319RNAArtificial SequenceSynthetic target sequence/siNA sense
region 23acggguggaa cuggcaccc 192419RNAArtificial SequenceSynthetic
target sequence/siNA sense region 24ccuccccucu uggcagcca
192519RNAArtificial SequenceSynthetic target sequence/siNA sense
region 25agugggcaag aaccuuacc 192619RNAArtificial SequenceSynthetic
target sequence/siNA sense region 26ccuacgcugc cagguggag
192719RNAArtificial SequenceSynthetic target sequence/siNA sense
region 27ggguggggca ccccgggcc 192819RNAArtificial SequenceSynthetic
target sequence/siNA sense region 28caaccucacc guggugcug
192919RNAArtificial SequenceSynthetic target sequence/siNA sense
region 29gcuccguggg gagaaggag 193019RNAArtificial SequenceSynthetic
target sequence/siNA sense region 30gcugaaacgg gagccagcu
193119RNAArtificial SequenceSynthetic target sequence/siNA sense
region 31ugugggggag cccgcugag 193219RNAArtificial SequenceSynthetic
target sequence/siNA sense region 32ggucacgacc acggugcug
193319RNAArtificial SequenceSynthetic target sequence/siNA sense
region 33ggugaggaga gaucaccau 193419RNAArtificial SequenceSynthetic
target sequence/siNA sense region 34uggagccaau uucucgugc
193519RNAArtificial SequenceSynthetic target sequence/siNA sense
region 35ccgcacugaa cuggaccug 193619RNAArtificial SequenceSynthetic
target sequence/siNA sense region 36gcggccccaa gggcuggag
193719RNAArtificial SequenceSynthetic target sequence/siNA sense
region 37gcuguuugag aacaccucg 193819RNAArtificial SequenceSynthetic
target sequence/siNA sense region 38ggcccccuac cagcuccag
193919RNAArtificial SequenceSynthetic target sequence/siNA sense
region 39gaccuuuguc cugccagcg 194019RNAArtificial SequenceSynthetic
target sequence/siNA sense region 40gacuccccca caacuuguc
194119RNAArtificial SequenceSynthetic target sequence/siNA sense
region 41cagcccccgg guccuagag 194219RNAArtificial SequenceSynthetic
target sequence/siNA sense region 42gguggacacg caggggacc
194319RNAArtificial SequenceSynthetic target sequence/siNA sense
region 43cguggucugu ucccuggac 194419RNAArtificial SequenceSynthetic
target sequence/siNA sense region 44cgggcuguuc ccagucucg
194519RNAArtificial SequenceSynthetic target sequence/siNA sense
region 45ggaggcccag guccaccug 194619RNAArtificial SequenceSynthetic
target sequence/siNA sense region 46ggcacugggg gaccagagg
194719RNAArtificial SequenceSynthetic target sequence/siNA sense
region 47guugaacccc acagucacc 194819RNAArtificial SequenceSynthetic
target sequence/siNA sense region 48cuauggcaac gacuccuuc
194919RNAArtificial SequenceSynthetic target sequence/siNA sense
region 49cucggccaag gccucaguc 195019RNAArtificial SequenceSynthetic
target sequence/siNA sense region 50cagugugacc gcagaggac
195119RNAArtificial SequenceSynthetic target sequence/siNA sense
region 51cgagggcacc cagcggcug 195219RNAArtificial SequenceSynthetic
target sequence/siNA sense region 52gacgugugca guaauacug
195319RNAArtificial SequenceSynthetic target sequence/siNA sense
region 53ggggaaccag agccaggag 195419RNAArtificial SequenceSynthetic
target sequence/siNA sense region 54gacacugcag acagugacc
195519RNAArtificial SequenceSynthetic target sequence/siNA sense
region 55caucuacagc uuuccggcg 195619RNAArtificial SequenceSynthetic
target sequence/siNA sense region 56gcccaacgug auucugacg
195719RNAArtificial SequenceSynthetic target sequence/siNA sense
region 57gaagccagag gucucagaa 195819RNAArtificial SequenceSynthetic
target sequence/siNA sense region 58agggaccgag gugacagug
195919RNAArtificial SequenceSynthetic target sequence/siNA sense
region 59gaagugugag gcccacccu 196019RNAArtificial SequenceSynthetic
target sequence/siNA sense region 60uagagccaag gugacgcug
196119RNAArtificial SequenceSynthetic target sequence/siNA sense
region 61gaaugggguu ccagcccag 196219RNAArtificial SequenceSynthetic
target sequence/siNA sense region 62gccacugggc ccgagggcc
196319RNAArtificial SequenceSynthetic target sequence/siNA sense
region 63ccagcuccug cugaaggcc 196419RNAArtificial SequenceSynthetic
target sequence/siNA sense region 64caccccagag gacaacggg
196519RNAArtificial SequenceSynthetic target sequence/siNA sense
region 65gcgcagcuuc uccugcucu 196619RNAArtificial SequenceSynthetic
target sequence/siNA sense region 66ugcaacccug gagguggcc
196719RNAArtificial SequenceSynthetic target sequence/siNA sense
region 67cggccagcuu auacacaag 196819RNAArtificial SequenceSynthetic
target sequence/siNA sense region 68gaaccagacc cgggagcuu
196919RNAArtificial SequenceSynthetic target sequence/siNA sense
region 69ucguguccug uauggcccc 197019RNAArtificial SequenceSynthetic
target sequence/siNA sense region 70ccgacuggac gagagggau
197119RNAArtificial SequenceSynthetic target sequence/siNA sense
region 71uuguccggga aacuggacg 197219RNAArtificial SequenceSynthetic
target sequence/siNA sense region 72guggccagaa aauucccag
197319RNAArtificial SequenceSynthetic target sequence/siNA sense
region 73gcagacucca augugccag 197419RNAArtificial SequenceSynthetic
target sequence/siNA sense region 74ggcuuggggg aacccauug
197519RNAArtificial SequenceSynthetic target sequence/siNA sense
region 75gcccgagcuc aagugucua 197619RNAArtificial SequenceSynthetic
target sequence/siNA sense region 76aaaggauggc acuuuccca
197719RNAArtificial SequenceSynthetic target sequence/siNA sense
region 77acugcccauc ggggaauca 197819RNAArtificial SequenceSynthetic
target sequence/siNA sense region 78agugacuguc acucgagau
197919RNAArtificial SequenceSynthetic target sequence/siNA sense
region 79ucuugagggc accuaccuc 198019RNAArtificial SequenceSynthetic
target sequence/siNA sense region 80cugucgggcc aggagcacu
198119RNAArtificial SequenceSynthetic target sequence/siNA sense
region 81ucaaggggag gucacccgc 198219RNAArtificial SequenceSynthetic
target sequence/siNA sense region 82cgaggugacc gugaaugug
198319RNAArtificial SequenceSynthetic target sequence/siNA sense
region 83gcucuccccc cgguaugag 198419RNAArtificial SequenceSynthetic
target sequence/siNA sense region 84gauugucauc aucacugug
198519RNAArtificial SequenceSynthetic target sequence/siNA sense
region 85gguagcagcc gcagucaua 198619RNAArtificial SequenceSynthetic
target sequence/siNA sense region 86aaugggcacu gcaggccuc
198719RNAArtificial SequenceSynthetic target sequence/siNA sense
region 87cagcacguac cucuauaac 198819RNAArtificial SequenceSynthetic
target sequence/siNA sense region 88ccgccagcgg aagaucaag
198919RNAArtificial SequenceSynthetic target sequence/siNA sense
region 89gaaauacaga cuacaacag 199019RNAArtificial SequenceSynthetic
target sequence/siNA sense region 90ggcccaaaaa gggaccccc
199119RNAArtificial SequenceSynthetic target sequence/siNA sense
region 91caugaaaccg aacacacaa 199219RNAArtificial SequenceSynthetic
target sequence/siNA sense region 92agccacgccu cccugaacc
199319RNAArtificial SequenceSynthetic target sequence/siNA sense
region 93cuaucccggg acagggccu 199419RNAArtificial SequenceSynthetic
target sequence/siNA sense region 94ucuuccucgg ccuucccau
199519RNAArtificial SequenceSynthetic target sequence/siNA sense
region 95uauugguggc aguggugcc 199619RNAArtificial SequenceSynthetic
target sequence/siNA sense region 96cacacugaac agaguggaa
199719RNAArtificial SequenceSynthetic target sequence/siNA sense
region 97agacauaugc caugcagcu 199819RNAArtificial SequenceSynthetic
target sequence/siNA sense region 98uacaccuacc ggcccuggg
199919RNAArtificial SequenceSynthetic target sequence/siNA sense
region 99gacgccggag gacagggca 1910019RNAArtificial
SequenceSynthetic target sequence/siNA sense region 100auuguccuca
gucagauac 1910119RNAArtificial SequenceSynthetic target
sequence/siNA sense region 101caacagcauu uggggccau
1910219RNAArtificial SequenceSynthetic target sequence/siNA sense
region 102ugguaccugc acaccuaaa 1910319RNAArtificial
SequenceSynthetic target sequence/siNA sense region 103aacacuaggc
cacgcaucu 1910419RNAArtificial SequenceSynthetic target
sequence/siNA sense region 104ugaucuguag ucacaugac
1910519RNAArtificial SequenceSynthetic target sequence/siNA sense
region 105cuaagccaag aggaaggag 1910619RNAArtificial
SequenceSynthetic target sequence/siNA sense region 106gcaagacuca
agacaugau 1910719RNAArtificial SequenceSynthetic target
sequence/siNA sense region 107uugauggaug uuaaagucu
1910819RNAArtificial SequenceSynthetic target sequence/siNA sense
region 108uagccugaug agaggggaa 1910919RNAArtificial
SequenceSynthetic target sequence/siNA sense region 109aguggugggg
gagacauag 1911019RNAArtificial SequenceSynthetic target
sequence/siNA sense region 110gccccaccau gaggacaua
1911119RNAArtificial SequenceSynthetic target sequence/siNA sense
region 111acaacuggga aauacugaa 1911219RNAArtificial
SequenceSynthetic target sequence/siNA sense region 112aacuugcugc
cuauugggu 1911319RNAArtificial SequenceSynthetic target
sequence/siNA sense region 113uaugcugagg cccacagac
1911419RNAArtificial SequenceSynthetic target sequence/siNA sense
region 114cuuacagaag aaguggccc 1911519RNAArtificial
SequenceSynthetic target sequence/siNA sense region 115cuccauagac
auguguagc 1911619RNAArtificial SequenceSynthetic target
sequence/siNA sense region 116caucaaaaca caaaggccc
1911719RNAArtificial SequenceSynthetic target sequence/siNA sense
region 117cacacuuccu gacggaugc 1911819RNAArtificial
SequenceSynthetic target sequence/siNA sense region 118ccagcuuggg
cacugcugu 1911919RNAArtificial SequenceSynthetic target
sequence/siNA sense region 119ucuacugacc ccaacccuu
1912019RNAArtificial SequenceSynthetic target sequence/siNA sense
region 120ugaugauaug uauuuauuc 1912119RNAArtificial
SequenceSynthetic target sequence/siNA sense region 121cauuuguuau
uuuaccagc 1912219RNAArtificial SequenceSynthetic target
sequence/siNA sense region 122cuauuuauug agugucuuu
1912319RNAArtificial SequenceSynthetic target sequence/siNA sense
region 123uuauguaggc uaaaugaac 1912419RNAArtificial
SequenceSynthetic target sequence/siNA sense region 124cauaggucuc
uggccucac 1912519RNAArtificial SequenceSynthetic target
sequence/siNA sense region 125cggagcuccc aguccaugu
1912619RNAArtificial SequenceSynthetic target sequence/siNA sense
region
126ucacauucaa ggucaccag 1912719RNAArtificial SequenceSynthetic
target sequence/siNA sense region 127gguacaguug uacagguug
1912819RNAArtificial SequenceSynthetic target sequence/siNA sense
region 128guacacugca ggagagugc 1912919RNAArtificial
SequenceSynthetic target sequence/siNA sense region 129ccuggcaaaa
agaucaaau 1913019RNAArtificial SequenceSynthetic target
sequence/siNA sense region 130uggggcuggg acuucucau
1913119RNAArtificial SequenceSynthetic target sequence/siNA sense
region 131uuggccaacc ugccuuucc 1913219RNAArtificial
SequenceSynthetic target sequence/siNA sense region 132cccagaagga
gugauuuuu 1913319RNAArtificial SequenceSynthetic target
sequence/siNA sense region 133ucuaucggca caaaagcac
1913419RNAArtificial SequenceSynthetic target sequence/siNA sense
region 134cuauauggac ugguaaugg 1913519RNAArtificial
SequenceSynthetic target sequence/siNA sense region 135guucacaggu
ucagagauu 1913619RNAArtificial SequenceSynthetic target
sequence/siNA sense region 136uacccaguga ggccuuauu
1913719RNAArtificial SequenceSynthetic target sequence/siNA sense
region 137uccucccuuc cccccaaaa 1913819RNAArtificial
SequenceSynthetic target sequence/siNA sense region 138acugacaccu
uuguuagcc 1913919RNAArtificial SequenceSynthetic target
sequence/siNA sense region 139caccucccca cccacauac
1914019RNAArtificial SequenceSynthetic target sequence/siNA sense
region 140cauuucugcc aguguucac 1914119RNAArtificial
SequenceSynthetic target sequence/siNA sense region 141caaugacacu
cagcgguca 1914219RNAArtificial SequenceSynthetic target
sequence/siNA sense region 142augucuggac augagugcc
1914319RNAArtificial SequenceSynthetic target sequence/siNA sense
region 143ccagggaaua ugcccaagc 1914419RNAArtificial
SequenceSynthetic target sequence/siNA sense region 144cuaugccuug
uccucuugu 1914519RNAArtificial SequenceSynthetic target
sequence/siNA sense region 145uccuguuugc auuucacug
1914619RNAArtificial SequenceSynthetic target sequence/siNA sense
region 146gggagcuugc acuauugca 1914719RNAArtificial
SequenceSynthetic target sequence/siNA sense region 147agcuccaguu
uccugcagu 1914819RNAArtificial SequenceSynthetic target
sequence/siNA sense region 148ugaucagggu ccugcaagc
1914919RNAArtificial SequenceSynthetic target sequence/siNA sense
region 149caguggggaa gggggccaa 1915019RNAArtificial
SequenceSynthetic target sequence/siNA sense region 150agguauugga
ggacucccu 1915119RNAArtificial SequenceSynthetic target
sequence/siNA sense region 151ucccagcuuu ggaaggguc
1915219RNAArtificial SequenceSynthetic target sequence/siNA sense
region 152cauccgcgug ugugugugu 1915319RNAArtificial
SequenceSynthetic target sequence/siNA sense region 153uguguaugug
uagacaagc 1915419RNAArtificial SequenceSynthetic target
sequence/siNA sense region 154cucucgcucu gucacccag
1915519RNAArtificial SequenceSynthetic target sequence/siNA sense
region 155ggcuggagug caguggugc 1915619RNAArtificial
SequenceSynthetic target sequence/siNA sense region 156caaucauggu
ucacugcag 1915719RNAArtificial SequenceSynthetic target
sequence/siNA sense region 157gucuugaccu uuugggcuc
1915819RNAArtificial SequenceSynthetic target sequence/siNA sense
region 158caagugaucc ucccaccuc 1915919RNAArtificial
SequenceSynthetic target sequence/siNA sense region 159cagccuccug
aguagcugg 1916019RNAArtificial SequenceSynthetic target
sequence/siNA sense region 160ggaccauagg cucacaaca
1916119RNAArtificial SequenceSynthetic target sequence/siNA sense
region 161accacaccug gcaaauuug 1916219RNAArtificial
SequenceSynthetic target sequence/siNA sense region 162gauuuuuuuu
uuuuuuuuc 1916319RNAArtificial SequenceSynthetic target
sequence/siNA sense region 163cagagacggg gucucgcaa
1916419RNAArtificial SequenceSynthetic target sequence/siNA sense
region 164acauugccca gacuuccuu 1916519RNAArtificial
SequenceSynthetic target sequence/siNA sense region 165uuguguuagu
uaauaaagc 1916619RNAArtificial SequenceSynthetic target
sequence/siNA sense region 166aauaaagcuu ucucaacug
1916719RNAArtificial SequenceSynthetic siNA antisense region
167gcucagcguc gacuggggc 1916819RNAArtificial SequenceSynthetic siNA
antisense region 168acucugagua gcagaggag 1916919RNAArtificial
SequenceSynthetic siNA antisense region 169agcgaggcug agguugcaa
1917019RNAArtificial SequenceSynthetic siNA antisense region
170ggggcugcug ggagccaua 1917119RNAArtificial SequenceSynthetic siNA
antisense region 171ugcgggcagc gcgggccgg 1917219RNAArtificial
SequenceSynthetic siNA antisense region 172cccgagcagg accaggagu
1917319RNAArtificial SequenceSynthetic siNA antisense region
173agguccuggg aacagagcc 1917419RNAArtificial SequenceSynthetic siNA
antisense region 174agaugucugg gcauugcca 1917519RNAArtificial
SequenceSynthetic siNA antisense region 175gacuuuugag ggggacaca
1917619RNAArtificial SequenceSynthetic siNA antisense region
176gccuccccgg ggcaggaug 1917719RNAArtificial SequenceSynthetic siNA
antisense region 177gcaugucacc agcacggag 1917819RNAArtificial
SequenceSynthetic siNA antisense region 178cuggucacag gaggugcug
1917919RNAArtificial SequenceSynthetic siNA antisense region
179uaugcccaac aacuugggc 1918019RNAArtificial SequenceSynthetic siNA
antisense region 180uuuaggcaac ggggucucu 1918119RNAArtificial
SequenceSynthetic siNA antisense region 181aggcaggagc aacuccuuu
1918219RNAArtificial SequenceSynthetic siNA antisense region
182caccuuccgg uuguuccca 1918319RNAArtificial SequenceSynthetic siNA
antisense region 183cacauugcuc aguucauac 1918419RNAArtificial
SequenceSynthetic siNA antisense region 184ugguuggcua ucuucuugc
1918519RNAArtificial SequenceSynthetic siNA antisense region
185gcaguuugaa uagcacauu 1918619RNAArtificial SequenceSynthetic siNA
antisense region 186uguugacugc ccaucaggg 1918719RNAArtificial
SequenceSynthetic siNA antisense region 187ggugaggaag guuuuagcu
1918819RNAArtificial SequenceSynthetic siNA antisense region
188uucuggaguc caguacacg 1918919RNAArtificial SequenceSynthetic siNA
antisense region 189gggugccagu uccacccgu 1919019RNAArtificial
SequenceSynthetic siNA antisense region 190uggcugccaa gaggggagg
1919119RNAArtificial SequenceSynthetic siNA antisense region
191gguaagguuc uugcccacu 1919219RNAArtificial SequenceSynthetic siNA
antisense region 192cuccaccugg cagcguagg 1919319RNAArtificial
SequenceSynthetic siNA antisense region 193ggcccggggu gccccaccc
1919419RNAArtificial SequenceSynthetic siNA antisense region
194cagcaccacg gugagguug 1919519RNAArtificial SequenceSynthetic siNA
antisense region 195cuccuucucc ccacggagc 1919619RNAArtificial
SequenceSynthetic siNA antisense region 196agcuggcucc cguuucagc
1919719RNAArtificial SequenceSynthetic siNA antisense region
197cucagcgggc ucccccaca 1919819RNAArtificial SequenceSynthetic siNA
antisense region 198cagcaccgug gucgugacc 1919919RNAArtificial
SequenceSynthetic siNA antisense region 199auggugaucu cuccucacc
1920019RNAArtificial SequenceSynthetic siNA antisense region
200gcacgagaaa uuggcucca 1920119RNAArtificial SequenceSynthetic siNA
antisense region 201cagguccagu ucagugcgg 1920219RNAArtificial
SequenceSynthetic siNA antisense region 202cuccagcccu uggggccgc
1920319RNAArtificial SequenceSynthetic siNA antisense region
203cgagguguuc ucaaacagc 1920419RNAArtificial SequenceSynthetic siNA
antisense region 204cuggagcugg uagggggcc 1920519RNAArtificial
SequenceSynthetic siNA antisense region 205cgcuggcagg acaaagguc
1920619RNAArtificial SequenceSynthetic siNA antisense region
206gacaaguugu gggggaguc 1920719RNAArtificial SequenceSynthetic siNA
antisense region 207cucuaggacc cgggggcug 1920819RNAArtificial
SequenceSynthetic siNA antisense region 208gguccccugc guguccacc
1920919RNAArtificial SequenceSynthetic siNA antisense region
209guccagggaa cagaccacg 1921019RNAArtificial SequenceSynthetic siNA
antisense region 210cgagacuggg aacagcccg 1921119RNAArtificial
SequenceSynthetic siNA antisense region 211cagguggacc ugggccucc
1921219RNAArtificial SequenceSynthetic siNA antisense region
212ccucuggucc cccagugcc 1921319RNAArtificial SequenceSynthetic siNA
antisense region 213ggugacugug ggguucaac 1921419RNAArtificial
SequenceSynthetic siNA antisense region 214gaaggagucg uugccauag
1921519RNAArtificial SequenceSynthetic siNA antisense region
215gacugaggcc uuggccgag 1921619RNAArtificial SequenceSynthetic siNA
antisense region 216guccucugcg gucacacug 1921719RNAArtificial
SequenceSynthetic siNA antisense region 217cagccgcugg gugcccucg
1921819RNAArtificial SequenceSynthetic siNA antisense region
218caguauuacu gcacacguc 1921919RNAArtificial SequenceSynthetic siNA
antisense region 219cuccuggcuc ugguucccc 1922019RNAArtificial
SequenceSynthetic siNA antisense region 220ggucacuguc ugcaguguc
1922119RNAArtificial SequenceSynthetic siNA antisense region
221cgccggaaag cuguagaug 1922219RNAArtificial SequenceSynthetic siNA
antisense region 222cgucagaauc acguugggc 1922319RNAArtificial
SequenceSynthetic siNA antisense region 223uucugagacc ucuggcuuc
1922419RNAArtificial SequenceSynthetic siNA antisense region
224cacugucacc ucggucccu 1922519RNAArtificial SequenceSynthetic siNA
antisense region 225agggugggcc ucacacuuc 1922619RNAArtificial
SequenceSynthetic siNA antisense region 226cagcgucacc uuggcucua
1922719RNAArtificial SequenceSynthetic siNA antisense region
227cugggcugga accccauuc 1922819RNAArtificial SequenceSynthetic siNA
antisense region 228ggcccucggg cccaguggc 1922919RNAArtificial
SequenceSynthetic siNA antisense region 229ggccuucagc aggagcugg
1923019RNAArtificial SequenceSynthetic siNA antisense region
230cccguugucc ucuggggug 1923119RNAArtificial SequenceSynthetic siNA
antisense region 231agagcaggag aagcugcgc 1923219RNAArtificial
SequenceSynthetic siNA antisense region 232ggccaccucc aggguugca
1923319RNAArtificial SequenceSynthetic siNA antisense region
233cuuguguaua agcuggccg 1923419RNAArtificial SequenceSynthetic siNA
antisense region 234aagcucccgg gucugguuc 1923519RNAArtificial
SequenceSynthetic siNA antisense region 235ggggccauac aggacacga
1923619RNAArtificial SequenceSynthetic siNA antisense region
236aucccucucg uccagucgg 1923719RNAArtificial SequenceSynthetic siNA
antisense region 237cguccaguuu cccggacaa 1923819RNAArtificial
SequenceSynthetic siNA antisense region 238cugggaauuu ucuggccac
1923919RNAArtificial SequenceSynthetic siNA antisense region
239cuggcacauu ggagucugc 1924019RNAArtificial SequenceSynthetic siNA
antisense region 240caauggguuc ccccaagcc 1924119RNAArtificial
SequenceSynthetic siNA antisense region 241uagacacuug agcucgggc
1924219RNAArtificial SequenceSynthetic siNA antisense region
242ugggaaagug ccauccuuu 1924319RNAArtificial SequenceSynthetic siNA
antisense region 243ugauuccccg augggcagu 1924419RNAArtificial
SequenceSynthetic siNA antisense region 244aucucgagug acagucacu
1924519RNAArtificial SequenceSynthetic siNA antisense region
245gagguaggug cccucaaga 1924619RNAArtificial SequenceSynthetic siNA
antisense region 246agugcuccug gcccgacag 1924719RNAArtificial
SequenceSynthetic siNA antisense region 247gcgggugacc uccccuuga
1924819RNAArtificial SequenceSynthetic siNA antisense region
248cacauucacg gucaccucg 1924919RNAArtificial SequenceSynthetic siNA
antisense region 249cucauaccgg ggggagagc 1925019RNAArtificial
SequenceSynthetic siNA antisense region 250cacagugaug augacaauc
1925119RNAArtificial SequenceSynthetic siNA antisense region
251uaugacugcg gcugcuacc
1925219RNAArtificial SequenceSynthetic siNA antisense region
252gaggccugca gugcccauu 1925319RNAArtificial SequenceSynthetic siNA
antisense region 253guuauagagg uacgugcug 1925419RNAArtificial
SequenceSynthetic siNA antisense region 254cuugaucuuc cgcuggcgg
1925519RNAArtificial SequenceSynthetic siNA antisense region
255cuguuguagu cuguauuuc 1925619RNAArtificial SequenceSynthetic siNA
antisense region 256gggggucccu uuuugggcc 1925719RNAArtificial
SequenceSynthetic siNA antisense region 257uuguguguuc gguuucaug
1925819RNAArtificial SequenceSynthetic siNA antisense region
258gguucaggga ggcguggcu 1925919RNAArtificial SequenceSynthetic siNA
antisense region 259aggcccuguc ccgggauag 1926019RNAArtificial
SequenceSynthetic siNA antisense region 260augggaaggc cgaggaaga
1926119RNAArtificial SequenceSynthetic siNA antisense region
261ggcaccacug ccaccaaua 1926219RNAArtificial SequenceSynthetic siNA
antisense region 262uuccacucug uucagugug 1926319RNAArtificial
SequenceSynthetic siNA antisense region 263agcugcaugg cauaugucu
1926419RNAArtificial SequenceSynthetic siNA antisense region
264cccagggccg guaggugua 1926519RNAArtificial SequenceSynthetic siNA
antisense region 265ugcccugucc uccggcguc 1926619RNAArtificial
SequenceSynthetic siNA antisense region 266guaucugacu gaggacaau
1926719RNAArtificial SequenceSynthetic siNA antisense region
267auggccccaa augcuguug 1926819RNAArtificial SequenceSynthetic siNA
antisense region 268uuuaggugug cagguacca 1926919RNAArtificial
SequenceSynthetic siNA antisense region 269agaugcgugg ccuaguguu
1927019RNAArtificial SequenceSynthetic siNA antisense region
270gucaugugac uacagauca 1927119RNAArtificial SequenceSynthetic siNA
antisense region 271cuccuuccuc uuggcuuag 1927219RNAArtificial
SequenceSynthetic siNA antisense region 272aucaugucuu gagucuugc
1927319RNAArtificial SequenceSynthetic siNA antisense region
273agacuuuaac auccaucaa 1927419RNAArtificial SequenceSynthetic siNA
antisense region 274uuccccucuc aucaggcua 1927519RNAArtificial
SequenceSynthetic siNA antisense region 275cuaugucucc cccaccacu
1927619RNAArtificial SequenceSynthetic siNA antisense region
276uauguccuca ugguggggc 1927719RNAArtificial SequenceSynthetic siNA
antisense region 277uucaguauuu cccaguugu 1927819RNAArtificial
SequenceSynthetic siNA antisense region 278acccaauagg cagcaaguu
1927919RNAArtificial SequenceSynthetic siNA antisense region
279gucugugggc cucagcaua 1928019RNAArtificial SequenceSynthetic siNA
antisense region 280gggccacuuc uucuguaag 1928119RNAArtificial
SequenceSynthetic siNA antisense region 281gcuacacaug ucuauggag
1928219RNAArtificial SequenceSynthetic siNA antisense region
282gggccuuugu guuuugaug 1928319RNAArtificial SequenceSynthetic siNA
antisense region 283gcauccguca ggaagugug 1928419RNAArtificial
SequenceSynthetic siNA antisense region 284acagcagugc ccaagcugg
1928519RNAArtificial SequenceSynthetic siNA antisense region
285aaggguuggg gucaguaga 1928619RNAArtificial SequenceSynthetic siNA
antisense region 286gaauaaauac auaucauca 1928719RNAArtificial
SequenceSynthetic siNA antisense region 287gcugguaaaa uaacaaaug
1928819RNAArtificial SequenceSynthetic siNA antisense region
288aaagacacuc aauaaauag 1928919RNAArtificial SequenceSynthetic siNA
antisense region 289guucauuuag ccuacauaa 1929019RNAArtificial
SequenceSynthetic siNA antisense region 290gugaggccag agaccuaug
1929119RNAArtificial SequenceSynthetic siNA antisense region
291acauggacug ggagcuccg 1929219RNAArtificial SequenceSynthetic siNA
antisense region 292cuggugaccu ugaauguga 1929319RNAArtificial
SequenceSynthetic siNA antisense region 293caaccuguac aacuguacc
1929419RNAArtificial SequenceSynthetic siNA antisense region
294gcacucuccu gcaguguac 1929519RNAArtificial SequenceSynthetic siNA
antisense region 295auuugaucuu uuugccagg 1929619RNAArtificial
SequenceSynthetic siNA antisense region 296augagaaguc ccagcccca
1929719RNAArtificial SequenceSynthetic siNA antisense region
297ggaaaggcag guuggccaa 1929819RNAArtificial SequenceSynthetic siNA
antisense region 298aaaaaucacu ccuucuggg 1929919RNAArtificial
SequenceSynthetic siNA antisense region 299gugcuuuugu gccgauaga
1930019RNAArtificial SequenceSynthetic siNA antisense region
300ccauuaccag uccauauag 1930119RNAArtificial SequenceSynthetic siNA
antisense region 301aaucucugaa ccugugaac 1930219RNAArtificial
SequenceSynthetic siNA antisense region 302aauaaggccu cacugggua
1930319RNAArtificial SequenceSynthetic siNA antisense region
303uuuugggggg aagggagga 1930419RNAArtificial SequenceSynthetic siNA
antisense region 304ggcuaacaaa ggugucagu 1930519RNAArtificial
SequenceSynthetic siNA antisense region 305guaugugggu ggggaggug
1930619RNAArtificial SequenceSynthetic siNA antisense region
306gugaacacug gcagaaaug 1930719RNAArtificial SequenceSynthetic siNA
antisense region 307ugaccgcuga gugucauug 1930819RNAArtificial
SequenceSynthetic siNA antisense region 308ggcacucaug uccagacau
1930919RNAArtificial SequenceSynthetic siNA antisense region
309gcuugggcau auucccugg 1931019RNAArtificial SequenceSynthetic siNA
antisense region 310acaagaggac aaggcauag 1931119RNAArtificial
SequenceSynthetic siNA antisense region 311cagugaaaug caaacagga
1931219RNAArtificial SequenceSynthetic siNA antisense region
312ugcaauagug caagcuccc 1931319RNAArtificial SequenceSynthetic siNA
antisense region 313acugcaggaa acuggagcu 1931419RNAArtificial
SequenceSynthetic siNA antisense region 314gcuugcagga cccugauca
1931519RNAArtificial SequenceSynthetic siNA antisense region
315uuggcccccu uccccacug 1931619RNAArtificial SequenceSynthetic siNA
antisense region 316agggaguccu ccaauaccu 1931719RNAArtificial
SequenceSynthetic siNA antisense region 317gacccuucca aagcuggga
1931819RNAArtificial SequenceSynthetic siNA antisense region
318acacacacac acgcggaug 1931919RNAArtificial SequenceSynthetic siNA
antisense region 319gcuugucuac acauacaca 1932019RNAArtificial
SequenceSynthetic siNA antisense region 320cugggugaca gagcgagag
1932119RNAArtificial SequenceSynthetic siNA antisense region
321gcaccacugc acuccagcc 1932219RNAArtificial SequenceSynthetic siNA
antisense region 322cugcagugaa ccaugauug 1932319RNAArtificial
SequenceSynthetic siNA antisense region 323gagcccaaaa ggucaagac
1932419RNAArtificial SequenceSynthetic siNA antisense region
324gaggugggag gaucacuug 1932519RNAArtificial SequenceSynthetic siNA
antisense region 325ccagcuacuc aggaggcug 1932619RNAArtificial
SequenceSynthetic siNA antisense region 326uguugugagc cuauggucc
1932719RNAArtificial SequenceSynthetic siNA antisense region
327caaauuugcc agguguggu 1932819RNAArtificial SequenceSynthetic siNA
antisense region 328gaaaaaaaaa aaaaaaauc 1932919RNAArtificial
SequenceSynthetic siNA antisense region 329uugcgagacc ccgucucug
1933019RNAArtificial SequenceSynthetic siNA antisense region
330aaggaagucu gggcaaugu 1933119RNAArtificial SequenceSynthetic siNA
antisense region 331gcuuuauuaa cuaacacaa 1933219RNAArtificial
SequenceSynthetic siNA antisense region 332caguugagaa agcuuuauu
1933323RNAArtificial SequenceSynthetic target sequence/siNA sense
region 333aggagacacu gcagacagug acc 2333423RNAArtificial
SequenceSynthetic target sequence/siNA sense region 334cagugaccau
cuacagcuuu ccg 2333523RNAArtificial SequenceSynthetic target
sequence/siNA sense region 335ucagcacgua ccucuauaac cgc
2333623RNAArtificial SequenceSynthetic target sequence/siNA sense
region 336cuaagccaag aggaaggagc aag 2333723RNAArtificial
SequenceSynthetic target sequence/siNA sense region 337uccucuuguc
cuguuugcau uuc 2333823RNAArtificial SequenceSynthetic target
sequence/siNA sense region 338ucaugguuca cugcagucuu gac
2333923RNAArtificial SequenceSynthetic target sequence/siNA sense
region 339ugguucacug cagucuugac cuu 2334023RNAArtificial
SequenceSynthetic target sequence/siNA sense region 340cauaggcuca
caacaccaca ccu 2334121DNAArtificial SequenceSynthetic siNA sense
region 341gagacacugc agacagugat t 2134221DNAArtificial
SequenceSynthetic siNA sense region 342gugaccaucu acagcuuuct t
2134321DNAArtificial SequenceSynthetic siNA sense region
343agcacguacc ucuauaacct t 2134421DNAArtificial SequenceSynthetic
siNA sense region 344aagccaagag gaaggagcat t 2134521DNAArtificial
SequenceSynthetic siNA sense region 345cucuuguccu guuugcauut t
2134621DNAArtificial SequenceSynthetic siNA sense region
346augguucacu gcagucuugt t 2134721DNAArtificial SequenceSynthetic
siNA sense region 347guucacugca gucuugacct t 2134821DNAArtificial
SequenceSynthetic siNA sense region 348uaggcucaca acaccacact t
2134921DNAArtificial SequenceSynthetic siNA antisense region
349ucacugucug cagugucuct t 2135021DNAArtificial SequenceSynthetic
siNA antisense region 350gaaagcugua gauggucact t
2135121DNAArtificial SequenceSynthetic siNA antisense region
351gguuauagag guacgugcut t 2135221DNAArtificial SequenceSynthetic
siNA antisense region 352ugcuccuucc ucuuggcuut t
2135321DNAArtificial SequenceSynthetic siNA antisense region
353aaugcaaaca ggacaagagt t 2135421DNAArtificial SequenceSynthetic
siNA antisense region 354caagacugca gugaaccaut t
2135521DNAArtificial SequenceSynthetic siNA antisense region
355ggucaagacu gcagugaact t 2135621DNAArtificial SequenceSynthetic
siNA antisense region 356gugugguguu gugagccuat t
2135721DNAArtificial SequenceSynthetic siNA sense region
357gagacacugc agacagugat t 2135821DNAArtificial SequenceSynthetic
siNA sense region 358gugaccaucu acagcuuuct t 2135921DNAArtificial
SequenceSynthetic siNA sense region 359agcacguacc ucuauaacct t
2136021DNAArtificial SequenceSynthetic siNA sense region
360aagccaagag gaaggagcat t 2136121DNAArtificial SequenceSynthetic
siNA sense region 361cucuuguccu guuugcauut t 2136221DNAArtificial
SequenceSynthetic siNA sense region 362augguucacu gcagucuugt t
2136321DNAArtificial SequenceSynthetic siNA sense region
363guucacugca gucuugacct t 2136421DNAArtificial SequenceSynthetic
siNA sense region 364uaggcucaca acaccacact t 2136521DNAArtificial
SequenceSynthetic siNA antisense region 365ucacugucug cagugucuct t
2136621DNAArtificial SequenceSynthetic siNA antisense region
366gaaagcugua gauggucact t 2136721DNAArtificial SequenceSynthetic
siNA antisense region 367gguuauagag guacgugcut t
2136821DNAArtificial SequenceSynthetic siNA antisense region
368ugcuccuucc ucuuggcuut t 2136921DNAArtificial SequenceSynthetic
siNA antisense region 369aaugcaaaca ggacaagagt t
2137021DNAArtificial SequenceSynthetic siNA antisense region
370caagacugca gugaaccaut t 2137121DNAArtificial SequenceSynthetic
siNA antisense region 371ggucaagacu gcagugaact t
2137221DNAArtificial SequenceSynthetic siNA antisense region
372gugugguguu gugagccuat t 2137321DNAArtificial SequenceSynthetic
siNA sense region 373gagacacugc agacagugat t 2137421DNAArtificial
SequenceSynthetic siNA sense region 374gugaccaucu acagcuuuct t
2137521DNAArtificial SequenceSynthetic siNA sense region
375agcacguacc ucuauaacct t 2137621DNAArtificial SequenceSynthetic
siNA sense region 376aagccaagag gaaggagcat t 2137721DNAArtificial
SequenceSynthetic siNA sense region 377cucuuguccu
guuugcauut t 2137821DNAArtificial SequenceSynthetic siNA sense
region 378augguucacu gcagucuugt t 2137921DNAArtificial
SequenceSynthetic siNA sense region 379guucacugca gucuugacct t
2138021DNAArtificial SequenceSynthetic siNA sense region
380uaggcucaca acaccacact t 2138121DNAArtificial SequenceSynthetic
siNA antisense region 381ucacugucug cagugucuct t
2138221DNAArtificial SequenceSynthetic siNA antisense region
382gaaagcugua gauggucact t 2138321DNAArtificial SequenceSynthetic
siNA antisense region 383gguuauagag guacgugcut t
2138421DNAArtificial SequenceSynthetic siNA antisense region
384ugcuccuucc ucuuggcuut t 2138521DNAArtificial SequenceSynthetic
siNA antisense region 385aaugcaaaca ggacaagagt t
2138621DNAArtificial SequenceSynthetic siNA antisense region
386caagacugca gugaaccaut t 2138721DNAArtificial SequenceSynthetic
siNA antisense region 387ggucaagacu gcagugaact t
2138821DNAArtificial SequenceSynthetic siNA antisense region
388gugugguguu gugagccuat t 2138921DNAArtificial SequenceSynthetic
siNA sense region 389gagacacugc agacagugat t 2139021DNAArtificial
SequenceSynthetic siNA sense region 390gugaccaucu acagcuuuct t
2139121DNAArtificial SequenceSynthetic siNA sense region
391agcacguacc ucuauaacct t 2139221DNAArtificial SequenceSynthetic
siNA sense region 392aagccaagag gaaggagcat t 2139321DNAArtificial
SequenceSynthetic siNA sense region 393cucuuguccu guuugcauut t
2139421DNAArtificial SequenceSynthetic siNA sense region
394augguucacu gcagucuugt t 2139521DNAArtificial SequenceSynthetic
siNA sense region 395guucacugca gucuugacct t 2139621DNAArtificial
SequenceSynthetic siNA sense region 396uaggcucaca acaccacact t
2139721DNAArtificial SequenceSynthetic siNA antisense region
397ucacugucug cagugucuct t 2139821DNAArtificial SequenceSynthetic
siNA antisense region 398gaaagcugua gauggucact t
2139921DNAArtificial SequenceSynthetic siNA antisense region
399gguuauagag guacgugcut t 2140021DNAArtificial SequenceSynthetic
siNA antisense region 400ugcuccuucc ucuuggcuut t
2140121DNAArtificial SequenceSynthetic siNA antisense region
401aaugcaaaca ggacaagagt t 2140221DNAArtificial SequenceSynthetic
siNA antisense region 402caagacugca gugaaccaut t
2140321DNAArtificial SequenceSynthetic siNA antisense region
403ggucaagacu gcagugaact t 2140421DNAArtificial SequenceSynthetic
siNA antisense region 404gugugguguu gugagccuat t
2140521DNAArtificial SequenceSynthetic siNA sense region
405gagacacugc agacagugat t 2140621DNAArtificial SequenceSynthetic
siNA sense region 406gugaccaucu acagcuuuct t 2140721DNAArtificial
SequenceSynthetic siNA sense region 407agcacguacc ucuauaacct t
2140821DNAArtificial SequenceSynthetic siNA sense region
408aagccaagag gaaggagcat t 2140921DNAArtificial SequenceSynthetic
siNA sense region 409cucuuguccu guuugcauut t 2141021DNAArtificial
SequenceSynthetic siNA sense region 410augguucacu gcagucuugt t
2141121DNAArtificial SequenceSynthetic siNA sense region
411guucacugca gucuugacct t 2141221DNAArtificial SequenceSynthetic
siNA sense region 412uaggcucaca acaccacact t 2141321DNAArtificial
SequenceSynthetic siNA antisense region 413ucacugucug cagugucuct t
2141421DNAArtificial SequenceSynthetic siNA antisense region
414gaaagcugua gauggucact t 2141521DNAArtificial SequenceSynthetic
siNA antisense region 415gguuauagag guacgugcut t
2141621DNAArtificial SequenceSynthetic siNA antisense region
416ugcuccuucc ucuuggcuut t 2141721DNAArtificial SequenceSynthetic
siNA antisense region 417aaugcaaaca ggacaagagt t
2141821DNAArtificial SequenceSynthetic siNA antisense region
418caagacugca gugaaccaut t 2141921DNAArtificial SequenceSynthetic
siNA antisense region 419ggucaagacu gcagugaact t
2142021DNAArtificial SequenceSynthetic siNA antisense region
420gugugguguu gugagccuat t 2142121DNAArtificial SequenceSynthetic
siNA antisense region 421ucacugucug cagugucuct t
2142221DNAArtificial SequenceSynthetic siNA antisense region
422gaaagcugua gauggucact t 2142321DNAArtificial SequenceSynthetic
siNA antisense region 423gguuauagag guacgugcut t
2142421DNAArtificial SequenceSynthetic siNA antisense region
424ugcuccuucc ucuuggcuut t 2142521DNAArtificial SequenceSynthetic
siNA antisense region 425aaugcaaaca ggacaagagt t
2142621DNAArtificial SequenceSynthetic siNA antisense region
426caagacugca gugaaccaut t 2142721DNAArtificial SequenceSynthetic
siNA antisense region 427ggucaagacu gcagugaact t
2142821DNAArtificial SequenceSynthetic siNA antisense region
428gugugguguu gugagccuat t 2142921DNAArtificial SequenceSynthetic
siNA antisense region 429ucacugucug cagugucuct t
2143021DNAArtificial SequenceSynthetic siNA antisense region
430gaaagcugua gauggucact t 2143121DNAArtificial SequenceSynthetic
siNA antisense region 431gguuauagag guacgugcut t
2143221DNAArtificial SequenceSynthetic siNA antisense region
432ugcuccuucc ucuuggcuut t 2143321DNAArtificial SequenceSynthetic
siNA antisense region 433aaugcaaaca ggacaagagt t
2143421DNAArtificial SequenceSynthetic siNA antisense region
434caagacugca gugaaccaut t 2143521DNAArtificial SequenceSynthetic
siNA antisense region 435ggucaagacu gcagugaact t
2143621DNAArtificial SequenceSynthetic siNA antisense region
436gugugguguu gugagccuat t 2143721DNAArtificial SequenceSynthetic
siNA sense region 437nnnnnnnnnn nnnnnnnnnn n 2143821RNAArtificial
SequenceSynthetic siNA antisense region 438nnnnnnnnnn nnnnnnnnnn n
2143921RNAArtificial SequenceSynthetic siNA sense region
439nnnnnnnnnn nnnnnnnnnn n 2144021RNAArtificial SequenceSynthetic
siNA antisense region 440nnnnnnnnnn nnnnnnnnnn n
2144121RNAArtificial SequenceSynthetic siNA sense region
441nnnnnnnnnn nnnnnnnnnn n 2144221RNAArtificial SequenceSynthetic
siNA antisense region 442nnnnnnnnnn nnnnnnnnnn n
2144321RNAArtificial SequenceSynthetic siNA sense region
443nnnnnnnnnn nnnnnnnnnn n 2144421RNAArtificial SequenceSynthetic
siNA sense region 444nnnnnnnnnn nnnnnnnnnn n 2144521RNAArtificial
SequenceSynthetic siNA antisense region 445nnnnnnnnnn nnnnnnnnnn n
2144621DNAArtificial SequenceSynthetic siNA sense region
446gcaagacuca agacaugaut t 2144721DNAArtificial SequenceSynthetic
siNA antisense region 447aucaugucuu gagucuugct t
2144821DNAArtificial SequenceSynthetic siNA sense region
448gcaagacuca agacaugaut t 2144921DNAArtificial SequenceSynthetic
siNA antisense region 449aucaugucuu gagucuugct t
2145021DNAArtificial SequenceSynthetic siNA sense region
450gcaagacuca agacaugaut t 2145121DNAArtificial SequenceSynthetic
siNA antisense region 451aucaugucuu gagucuugct t
2145221DNAArtificial SequenceSynthetic siNA sense region
452gcaagacuca agacaugaut t 2145321DNAArtificial SequenceSynthetic
siNA sense region 453gcaagacuca agacaugaut t 2145421DNAArtificial
SequenceSynthetic siNA antisense region 454aucaugucuu gagucuugct t
2145514RNAArtificial SequenceSynthetic target sequence/duplex
forming oligonucleotide 455auauaucuau uucg 1445614RNAArtificial
SequenceSynthetic complementary sequence/duplex forming
oligonucleotide 456cgaaauagau 1445723RNAArtificial
SequenceSynthetic self complementary duplex construct 457cgaaaauaga
uauaucuauu ucg 2345824DNAArtificial SequenceSynthetic duplex
forming oligonucleotide 458cgaaauagau auaucuauuu cgtt
244592986RNAHomo sapiens 459gcgccccagu cgacgcugag cuccucugcu
acucagaguu gcaaccucag ccucgcuaug 60gcucccagca gcccccggcc cgcgcugccc
gcacuccugg uccugcucgg ggcucuguuc 120ccaggaccug gcaaugccca
gacaucugug ucccccucaa aagucauccu gccccgggga 180ggcuccgugc
uggugacaug cagcaccucc ugugaccagc ccaaguuguu gggcauagag
240accccguugc cuaaaaagga guugcuccug ccugggaaca accggaaggu
guaugaacug 300agcaaugugc aagaagauag ccaaccaaug ugcuauucaa
acugcccuga ugggcaguca 360acagcuaaaa ccuuccucac cguguacugg
acuccagaac ggguggaacu ggcaccccuc 420cccucuuggc agccaguggg
caagaaccuu acccuacgcu gccaggugga ggguggggca 480ccccgggcca
accucaccgu ggugcugcuc cguggggaga aggagcugaa acgggagcca
540gcuguggggg agcccgcuga ggucacgacc acggugcugg ugaggagaga
ucaccaugga 600gccaauuucu cgugccgcac ugaacuggac cugcggcccc
aagggcugga gcuguuugag 660aacaccucgg cccccuacca gcuccagacc
uuuguccugc cagcgacucc cccacaacuu 720gucagccccc ggguccuaga
gguggacacg caggggaccg uggucuguuc ccuggacggg 780cuguucccag
ucucggaggc ccagguccac cuggcacugg gggaccagag guugaacccc
840acagucaccu auggcaacga cuccuucucg gccaaggccu cagucagugu
gaccgcagag 900gacgagggca cccagcggcu gacgugugca guaauacugg
ggaaccagag ccaggagaca 960cugcagacag ugaccaucua cagcuuuccg
gcgcccaacg ugauucugac gaagccagag 1020gucucagaag ggaccgaggu
gacagugaag ugugaggccc acccuagagc caaggugacg 1080cugaaugggg
uuccagccca gccacugggc ccgagggccc agcuccugcu gaaggccacc
1140ccagaggaca acgggcgcag cuucuccugc ucugcaaccc uggagguggc
cggccagcuu 1200auacacaaga accagacccg ggagcuucgu guccuguaug
gcccccgacu ggacgagagg 1260gauuguccgg gaaacuggac guggccagaa
aauucccagc agacuccaau gugccaggcu 1320ugggggaacc cauugcccga
gcucaagugu cuaaaggaug gcacuuuccc acugcccauc 1380ggggaaucag
ugacugucac ucgagaucuu gagggcaccu accucugucg ggccaggagc
1440acucaagggg aggucacccg cgaggugacc gugaaugugc ucuccccccg
guaugagauu 1500gucaucauca cugugguagc agccgcaguc auaaugggca
cugcaggccu cagcacguac 1560cucuauaacc gccagcggaa gaucaagaaa
uacagacuac aacaggccca aaaagggacc 1620cccaugaaac cgaacacaca
agccacgccu cccugaaccu aucccgggac agggccucuu 1680ccucggccuu
cccauauugg uggcaguggu gccacacuga acagagugga agacauaugc
1740caugcagcua caccuaccgg cccugggacg ccggaggaca gggcauuguc
cucagucaga 1800uacaacagca uuuggggcca ugguaccugc acaccuaaaa
cacuaggcca cgcaucugau 1860cuguagucac augacuaagc caagaggaag
gagcaagacu caagacauga uugauggaug 1920uuaaagucua gccugaugag
aggggaagug gugggggaga cauagcccca ccaugaggac 1980auacaacugg
gaaauacuga aacuugcugc cuauugggua ugcugaggcc cacagacuua
2040cagaagaagu ggcccuccau agacaugugu agcaucaaaa cacaaaggcc
cacacuuccu 2100gacggaugcc agcuugggca cugcugucua cugaccccaa
cccuugauga uauguauuua 2160uucauuuguu auuuuaccag cuauuuauug
agugucuuuu auguaggcua aaugaacaua 2220ggucucuggc cucacggagc
ucccagucca ugucacauuc aaggucacca gguacaguug 2280uacagguugu
acacugcagg agagugccug gcaaaaagau caaauggggc ugggacuucu
2340cauuggccaa ccugccuuuc cccagaagga gugauuuuuc uaucggcaca
aaagcacuau 2400auggacuggu aaugguucac agguucagag auuacccagu
gaggccuuau uccucccuuc 2460cccccaaaac ugacaccuuu guuagccacc
uccccaccca cauacauuuc ugccaguguu 2520cacaaugaca cucagcgguc
augucuggac augagugccc agggaauaug cccaagcuau 2580gccuuguccu
cuuguccugu uugcauuuca cugggagcuu gcacuauugc agcuccaguu
2640uccugcagug aucagggucc ugcaagcagu ggggaagggg gccaagguau
uggaggacuc 2700ccucccagcu uuggaagggu cauccgcgug ugugugugug
uguaugugua gacaagcucu 2760cgcucuguca cccaggcugg agugcagugg
ugcaaucaug guucacugca gucuugaccu 2820uuugggcuca agugauccuc
ccaccucagc cuccugagua gcugggacca uaggcucaca 2880acaccacacc
uggcaaauuu gauuuuuuuu uuuuuuuuca gagacggggu cucgcaacau
2940ugcccagacu uccuuugugu uaguuaauaa agcuuucuca acugcc 2986
* * * * *