U.S. patent application number 12/185678 was filed with the patent office on 2009-04-16 for rna interference mediated inhibition of myostatin gene expression using short interfering nucleic acid (sina).
This patent application is currently assigned to Sirna Therapeutics, Inc.. Invention is credited to Leonid Beigelman, James McSwiggen.
Application Number | 20090099117 12/185678 |
Document ID | / |
Family ID | 46331963 |
Filed Date | 2009-04-16 |
United States Patent
Application |
20090099117 |
Kind Code |
A1 |
McSwiggen; James ; et
al. |
April 16, 2009 |
RNA INTERFERENCE MEDIATED INHIBITION OF MYOSTATIN GENE EXPRESSION
USING SHORT INTERFERING NUCLEIC ACID (siNA)
Abstract
This invention relates to compounds, compositions, and methods
useful for modulating myostatin (GDF8) gene expression using short
interfering nucleic acid (siNA) molecules. This invention also
relates to compounds, compositions, and methods useful for
modulating the expression and activity of other genes involved in
pathways of myostatin gene expression and/or activity by RNA
interference (RNAi) using small nucleic acid molecules. In
particular, the instant invention features small nucleic acid
molecules, such as short interfering nucleic acid (siNA), short
interfering RNA (siRNA), double stranded RNA (dsRNA), micro-RNA
(miRNA), and short hairpin RNA (shRNA) molecules and methods used
to modulate the expression of myostatin genes.
Inventors: |
McSwiggen; James; (Boulder,
CO) ; Beigelman; Leonid; (Brisbane, CA) |
Correspondence
Address: |
Sirna Therapeutics, Inc.
1700 Owens Street, 4th Floor
San Francisco
CA
94158
US
|
Assignee: |
Sirna Therapeutics, Inc.
San Francisco
CA
|
Family ID: |
46331963 |
Appl. No.: |
12/185678 |
Filed: |
August 4, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10879867 |
Jun 28, 2004 |
|
|
|
12185678 |
|
|
|
|
PCT/US04/16390 |
May 24, 2004 |
|
|
|
10879867 |
|
|
|
|
10826966 |
Apr 16, 2004 |
|
|
|
PCT/US04/16390 |
|
|
|
|
10757803 |
Jan 14, 2004 |
|
|
|
10826966 |
|
|
|
|
10720448 |
Nov 24, 2003 |
|
|
|
10757803 |
|
|
|
|
10693059 |
Oct 23, 2003 |
|
|
|
10720448 |
|
|
|
|
10444853 |
May 23, 2003 |
|
|
|
10693059 |
|
|
|
|
PCT/US03/05346 |
Feb 20, 2003 |
|
|
|
10444853 |
|
|
|
|
PCT/US03/05028 |
Feb 20, 2003 |
|
|
|
PCT/US03/05346 |
|
|
|
|
60358580 |
Feb 20, 2002 |
|
|
|
60363124 |
Mar 11, 2002 |
|
|
|
60386782 |
Jun 6, 2002 |
|
|
|
60406784 |
Aug 29, 2002 |
|
|
|
60408378 |
Sep 5, 2002 |
|
|
|
60409293 |
Sep 9, 2002 |
|
|
|
60440129 |
Jan 15, 2003 |
|
|
|
60358580 |
Feb 20, 2002 |
|
|
|
60363124 |
Mar 11, 2002 |
|
|
|
60386782 |
Jun 6, 2002 |
|
|
|
60406784 |
Aug 29, 2002 |
|
|
|
60408378 |
Sep 5, 2002 |
|
|
|
60409293 |
Sep 9, 2002 |
|
|
|
60440129 |
Jan 15, 2003 |
|
|
|
Current U.S.
Class: |
514/44R ;
536/24.5 |
Current CPC
Class: |
A61P 43/00 20180101;
C12N 2310/14 20130101; A61K 31/7125 20130101; C07H 21/02 20130101;
C12N 15/113 20130101; C12N 2310/3521 20130101; C12N 2310/321
20130101; C12N 2310/321 20130101; A61K 31/7105 20130101; A61K
31/712 20130101; C12N 2310/322 20130101; A61K 31/7115 20130101 |
Class at
Publication: |
514/44 ;
536/24.5 |
International
Class: |
A61K 31/7105 20060101
A61K031/7105; C07H 21/02 20060101 C07H021/02 |
Claims
1. A chemically modified nucleic acid molecule, wherein: (a) the
nucleic acid molecule comprises a sense strand and a separate
antisense strand, each strand having one or more pyrimidine
nucleotides and one or more purine nucleotides; (b) each strand of
the nucleic acid molecule is independently 18 to 27 nucleotides in
length; (c) an 18 to 27 nucleotide sequence of the antisense strand
is complementary to a human myostatin RNA sequence comprising SEQ
ID NO:441; (d) an 18 to 27 nucleotide sequence of the sense strand
is complementary to the antisense strand and comprises an 18 to 27
nucleotide sequence of the human RNA sequence; and (e) 50 percent
or more of the nucleotides in at least one strand comprise a
2-sugar modification, wherein the 2'-sugar modification of any of
the pyrimidine nucleotides differs from the 2'-sugar modification
of any of the purine nucleotides.
2. The nucleic acid molecule of claim 1, wherein 50 percent or more
of the nucleotides in each strand comprise a 2'-sugar
modification.
3. The nucleic acid molecule of claim 1, wherein the 2'-sugar
modification is selected from the group consisting of
2'-deoxy-2'-fluoro, 2'-O-methyl, and 2'-deoxy.
4. The nucleic acid of claim 3, wherein the 2'-deoxy-2'-fluoro
sugar modification is a pyrimidine modification.
5. The nucleic acid of claim 3, wherein the 2'-deoxy sugar
modification is a pyrimidine modification.
6. The nucleic acid of claim 3, wherein the 2'-O-methyl sugar
modification is a pyrimidine modification.
7. The nucleic acid molecule of claim 4, wherein said pyrimidine
modification is in the sense strand, the antisense strand, or both
the sense strand and antisense strand.
8. The nucleic acid molecule of claim 6, wherein said pyrimidine
modification is in the sense strand, the antisense strand, or both
the sense strand and antisense strand.
9. The nucleic acid molecule of claim 3, wherein the 2'-deoxy sugar
modification is a purine modification.
10. The nucleic acid molecule of claim 3, wherein the 2'-O-methyl
sugar modification is a purine modification.
11. The nucleic acid molecule of claim 9, wherein the purine
modification is in the sense strand.
12. The nucleic acid molecule of claim 10, wherein the purine
modification is in the antisense strand.
13. The nucleic acid molecule of claim 1, wherein the nucleic acid
molecule comprises ribonucleotides.
14. The nucleic acid molecule of claim 1, wherein the sense strand
includes a terminal cap moiety at the 5'-end, the 3'-end, or both
of the 5'- and 3'-ends.
15. The nucleic acid molecule of claim 14, wherein the terminal cap
moiety is an inverted deoxy abasic moiety.
16. The nucleic acid molecule of claim 1, wherein said nucleic acid
molecule includes one or more phosphorothioate internucleotide
linkages.
17. The nucleic acid molecule of claim 16, wherein one of the
phosphorothioate internucleotide linkages is at the 3'-end of the
antisense strand.
18. The nucleic acid molecule of claim 1, wherein the 5'-end of the
antisense strand includes a terminal phosphate group.
19. The nucleic acid molecule of claim 1, wherein the sense strand,
the antisense strand, or both the sense strand and the antisense
strand include a 3'-overhang.
20. A composition comprising the nucleic acid molecule of claim 1,
in a pharmaceutically acceptable carrier or diluent.
Description
[0001] This application is a continuation of U.S. patent
application Ser. No. 10/879,867, filed on Jun. 28, 2004, which is a
continuation-in-part of International Patent Application No.
PCT/US04/16390, filed May 24, 2004, which is a continuation-in-part
of U.S. patent application Ser. No. 10/826,966, filed Apr. 16,
2004, which is continuation-in-part of U.S. patent application Ser.
No. 10/757,803, filed Jan. 14, 2004, which is a
continuation-in-part of U.S. patent application Ser. No.
10/720,448, filed Nov. 24, 2003, which is a continuation-in-part of
U.S. patent application Ser. No. 10/693,059, filed Oct. 23, 2003,
which is a continuation-in-part of U.S. patent application Ser. No.
10/444,853, filed May 23, 2003, which is a continuation-in-part of
International Patent Application No. PCT/US03/05346, filed Feb. 20,
2003, and a continuation-in-part of International Patent
Application No. PCT/US03/05028, filed Feb. 20, 2003, both of which
claim the benefit of U.S. Provisional Application No. 60/358,580
filed Feb. 20, 2002, U.S. Provisional Application No. 60/363,124
filed Mar. 11, 2002, U.S. Provisional Application No. 60/386,782
filed Jun. 6, 2002, U.S. Provisional Application No. 60/406,784
filed Aug. 29, 2002, U.S. Provisional Application No. 60/408,378
filed Sep. 5, 2002, U.S. Provisional Application No. 60/409,293
filed Sep. 9, 2002, and U.S. Provisional Application No. 60/440,129
filed Jan. 15, 2003. The instant application claims the benefit of
all the listed applications, which are hereby incorporated by
reference herein in their entireties, including the drawings.
SEQUENCE LISTING
[0002] The sequence listing submitted via EFS, in compliance with
37 CFR .sctn.1.52(e)(5), is incorporated herein by reference. The
sequence listing text file submitted via EFS contains the file
"SequenceListing58USCNT", created on Aug. 4, 2008, which is 158,270
bytes in size.
FIELD OF THE INVENTION
[0003] The present invention relates to compounds, compositions,
and methods for the study, diagnosis, and treatment of traits,
diseases and conditions that respond to the modulation of myostatin
expression and/or activity. The present invention is also directed
to compounds, compositions, and methods relating to traits,
diseases and conditions that respond to the modulation of
expression and/or activity of genes involved in myostatin gene
expression pathways or other cellular processes that mediate the
maintenance or development of such traits, diseases and conditions.
Specifically, the invention relates to small nucleic acid
molecules, such as short interfering nucleic acid (siNA), short
interfering RNA (siRNA), double stranded RNA (dsRNA), micro-RNA
(miRNA), and short hairpin RNA (shRNA) molecules capable of
mediating RNA interference (RNAi) against myostatin gene
expression. Such small nucleic acid molecules are useful, for
example, in providing compositions for the treatment or prevention
of diseases and conditions associated with muscle atrophy, weakness
and/or degeneration, such as muscular dystrophy, myotonic
dystrophy, muscle wasting, sarcopenia, myalgias, myopathies,
hypotonis, cachexia, spinal cord injury, or muscle injury, for
treating or preventing obesity, diabetes (e.g., type I and type
II), and insulin resistance, or alternately for providing
compositions for muscle hypertrophy, including use for increased
strength, athleticism, bodybuilding, or cosmetic applications.
BACKGROUND OF THE INVENTION
[0004] The following is a discussion of relevant art pertaining to
RNAi. The discussion is provided only for understanding of the
invention that follows. The summary is not an admission that any of
the work described below is prior art to the claimed invention.
[0005] RNA interference refers to the process of sequence-specific
post-transcriptional gene silencing in animals mediated by short
interfering RNAs (siRNAs) (Zamore et al., 2000, Cell, 101, 25-33;
Fire et al., 1998, Nature, 391, 806; Hamilton et al., 1999,
Science, 286, 950-951; Lin et al., 1999, Nature, 402, 128-129;
Sharp, 1999, Genes & Dev., 13:139-141; and Strauss, 1999,
Science, 286, 886). The corresponding process in plants (Heifetz et
al., International PCT Publication No. WO 99/61631) is commonly
referred to as post-transcriptional gene silencing or RNA silencing
and is also referred to as quelling in fungi. The process of
post-transcriptional gene silencing is thought to be an
evolutionarily-conserved cellular defense mechanism used to prevent
the expression of foreign genes and is commonly shared by diverse
flora and phyla (Fire et al., 1999, Trends Genet., 15, 358). Such
protection from foreign gene expression may have evolved in
response to the production of double stranded RNAs (dsRNAs) derived
from viral infection or from the random integration of transposon
elements into a host genome via a cellular response that
specifically destroys homologous single stranded RNA or viral
genomic RNA. The presence of dsRNA in cells triggers the RNAi
response through a mechanism that has yet to be fully
characterized. This mechanism appears to be different from other
known mechanisms involving double stranded RNA-specific
ribonucleases, such as the interferon response that results from
dsRNA-mediated activation of protein kinase PKR and
2',5'-oligoadenylate synthetase resulting in non-specific cleavage
of mRNA by ribonuclease L (see for example U.S. Pat. Nos.
6,107,094; 5,898,031; Clemens et al., 1997, J. Interferon &
Cytokine Res., 17, 503-524; Adah et al., 2001, Curr. Med. Chem., 8,
1189).
[0006] The presence of long dsRNAs in cells stimulates the activity
of a ribonuclease III enzyme referred to as dicer (Bass, 2000,
Cell, 101, 235; Zamore et al., 2000, Cell, 101, 25-33; Hammond et
al., 2000, Nature, 404, 293). Dicer is involved in the processing
of the dsRNA into short pieces of dsRNA known as short interfering
RNAs (siRNAs) (Zamore et al., 2000, Cell, 101, 25-33; Bass, 2000,
Cell, 101, 235; Berstein et al., 2001, Nature, 409, 363). Short
interfering RNAs derived from dicer activity are typically about 21
to about 23 nucleotides in length and comprise about 19 base pair
duplexes (Zamore et al., 2000, Cell, 101, 25-33; Elbashir et al.,
2001, Genes Dev., 15, 188). Dicer has also been implicated in the
excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from
precursor RNA of conserved structure that are implicated in
translational control (Hutvagner et al., 2001, Science, 293, 834).
The RNAi response also features an endonuclease complex, commonly
referred to as an RNA-induced silencing complex (RISC), which
mediates cleavage of single stranded RNA having sequence
complementary to the antisense strand of the siRNA duplex. Cleavage
of the target RNA takes place in the middle of the region
complementary to the antisense strand of the siRNA duplex (Elbashir
et al., 2001, Genes Dev., 15, 188).
[0007] RNAi has been studied in a variety of systems. Fire et al.,
1998, Nature, 391, 806, were the first to observe RNAi in C.
elegans. Bahramian and Zarbl, 1999, Molecular and Cellular Biology,
19, 274-283 and Wianny and Goetz, 1999, Nature Cell Biol., 2, 70,
describe RNAi mediated by dsRNA in mammalian systems. Hammond et
al., 2000, Nature, 404, 293, describe RNAi in Drosophila cells
transfected with dsRNA. Elbashir et al., 2001, Nature, 411, 494 and
Tuschl et al., International PCT Publication No. WO 01/75164,
describe RNAi induced by introduction of duplexes of synthetic
21-nucleotide RNAs in cultured mammalian cells including human
embryonic kidney and HeLa cells. Recent work in Drosophila
embryonic lysates (Elbashir et al., 2001, EMBO J., 20, 6877 and
Tuschl et al., International PCT Publication No. WO 01/75164) has
revealed certain requirements for siRNA length, structure, chemical
composition, and sequence that are essential to mediate efficient
RNAi activity. These studies have shown that 21-nucleotide siRNA
duplexes are most active when containing 3'-terminal dinucleotide
overhangs. Furthermore, complete substitution of one or both siRNA
strands with 2'-deoxy (2'-H) or 2'-O-methyl nucleotides abolishes
RNAi activity, whereas substitution of the 3'-terminal siRNA
overhang nucleotides with 2'-deoxy nucleotides (2'-H) was shown to
be tolerated. Single mismatch sequences in the center of the siRNA
duplex were also shown to abolish RNAi activity. In addition, these
studies also indicate that the position of the cleavage site in the
target RNA is defined by the 5'-end of the siRNA guide sequence
rather than the 3'-end of the guide sequence (Elbashir et al.,
2001, EMBO J., 20, 6877). Other studies have indicated that a
5'-phosphate on the target-complementary strand of an siRNA duplex
is required for siRNA activity and that ATP is utilized to maintain
the 5'-phosphate moiety on the siRNA (Nykanen et al., 2001, Cell,
107, 309).
[0008] Studies have shown that replacing the 3'-terminal nucleotide
overhanging segments of a 21-mer siRNA duplex having two-nucleotide
3'-overhangs with deoxyribonucleotides does not have an adverse
effect on RNAi activity. Replacing up to four nucleotides on each
end of the siRNA with deoxyribonucleotides has been reported to be
well tolerated, whereas complete substitution with
deoxyribonucleotides results in no RNAi activity (Elbashir et al.,
2001, EMBO J., 20, 6877 and Tuschl et al., International PCT
Publication No. WO 01/75164). In addition, Elbashir et al., supra,
also report that substitution of siRNA with 2'-O-methyl nucleotides
completely abolishes RNAi activity. Li et al., International PCT
Publication No. WO 00/44914, and Beach et al., International PCT
Publication No. WO 01/68836 preliminarily suggest that siRNA may
include modifications to either the phosphate-sugar backbone or the
nucleoside to include at least one of a nitrogen or sulfur
heteroatom, however, neither application postulates to what extent
such modifications would be tolerated in siRNA molecules, nor
provides any further guidance or examples of such modified siRNA.
Kreutzer et al., Canadian Patent Application No. 2,359,180, also
describe certain chemical modifications for use in dsRNA constructs
in order to counteract activation of double stranded RNA-dependent
protein kinase PKR, specifically 2'-amino or 2'-O-methyl
nucleotides, and nucleotides containing a 2'-O or 4'-C methylene
bridge. However, Kreutzer et al. similarly fails to provide
examples or guidance as to what extent these modifications would be
tolerated in dsRNA molecules.
[0009] Parrish et al., 2000, Molecular Cell, 6, 1077-1087, tested
certain chemical modifications targeting the unc-22 gene in C.
elegans using long (>25 nt) siRNA transcripts. The authors
describe the introduction of thiophosphate residues into these
siRNA transcripts by incorporating thiophosphate nucleotide analogs
with T7 and T3 RNA polymerase and observed that RNAs with two
phosphorothioate modified bases also had substantial decreases in
effectiveness as RNAi. Further, Parrish et al. reported that
phosphorothioate modification of more than two residues greatly
destabilized the RNAs in vitro such that interference activities
could not be assayed. Id. at 1081. The authors also tested certain
modifications at the 2'-position of the nucleotide sugar in the
long siRNA transcripts and found that substituting deoxynucleotides
for ribonucleotides produced a substantial decrease in interference
activity, especially in the case of Uridine to Thymidine and/or
Cytidine to deoxy-Cytidine substitutions. Id. In addition, the
authors tested certain base modifications, including substituting,
in sense and antisense strands of the siRNA, 4-thiouracil,
5-bromouracil, 5-iodouracil, and 3-(aminoallyl)uracil for uracil,
and inosine for guanosine. Whereas 4-thiouracil and 5-bromouracil
substitution appeared to be tolerated, Parrish reported that
inosine produced a substantial decrease in interference activity
when incorporated in either strand. Parrish also reported that
incorporation of 5-iodouracil and 3-(aminoallyl)uracil in the
antisense strand resulted in a substantial decrease in RNAi
activity as well.
[0010] The use of longer dsRNA has been described. For example,
Beach et al., International PCT Publication No. WO 01/68836,
describes specific methods for attenuating gene expression using
endogenously-derived dsRNA. Tuschl et al., International PCT
Publication No. WO 01/75164, describe a Drosophila in vitro RNAi
system and the use of specific siRNA molecules for certain
functional genomic and certain therapeutic applications; although
Tuschl, 2001, Chem. Biochem., 2, 239-245, doubts that RNAi can be
used to cure genetic diseases or viral infection due to the danger
of activating interferon response. Li et al., International PCT
Publication No. WO 00/44914, describe the use of specific long (141
bp-488 bp) enzymatically synthesized or vector expressed dsRNAs for
attenuating the expression of certain target genes. Zernicka-Goetz
et al., International PCT Publication No. WO 01/36646, describe
certain methods for inhibiting the expression of particular genes
in mammalian cells using certain long (550 bp-714 bp),
enzymatically synthesized or vector expressed dsRNA molecules. Fire
et al., International PCT Publication No. WO 99/32619, describe
particular methods for introducing certain long dsRNA molecules
into cells for use in inhibiting gene expression in nematodes.
Plaetinck et al., International PCT Publication No. WO 00/01846,
describe certain methods for identifying specific genes responsible
for conferring a particular phenotype in a cell using specific long
dsRNA molecules. Mello et al., International PCT Publication No. WO
01/29058, describe the identification of specific genes involved in
dsRNA-mediated RNAi. Pachuck et al., International PCT Publication
No. WO 00/63364, describe certain long (at least 200 nucleotide)
dsRNA constructs. Deschamps Depaillette et al., International PCT
Publication No. WO 99/07409, describe specific compositions
consisting of particular dsRNA molecules combined with certain
anti-viral agents. Waterhouse et al., International PCT Publication
No. 99/53050 and 1998, PNAS, 95, 13959-13964, describe certain
methods for decreasing the phenotypic expression of a nucleic acid
in plant cells using certain dsRNAs. Driscoll et al., International
PCT Publication No. WO 01/49844, describe specific DNA expression
constructs for use in facilitating gene silencing in targeted
organisms.
[0011] Others have reported on various RNAi and gene-silencing
systems. For example, Parrish et al., 2000, Molecular Cell, 6,
1077-1087, describe specific chemically modified dsRNA constructs
targeting the unc-22 gene of C. elegans. Grossniklaus,
International PCT Publication No. WO 01/38551, describes certain
methods for regulating polycomb gene expression in plants using
certain dsRNAs. Churikov et al., International PCT Publication No.
WO 01/42443, describe certain methods for modifying genetic
characteristics of an organism using certain dsRNAs. Cogoni et al,
International PCT Publication No. WO 01/53475, describe certain
methods for isolating a Neurospora silencing gene and uses thereof.
Reed et al., International PCT Publication No. WO 01/68836,
describe certain methods for gene silencing in plants. Honer et
al., International PCT Publication No. WO 01/70944, describe
certain methods of drug screening using transgenic nematodes as
Parkinson's Disease models using certain dsRNAs. Deak et al.,
International PCT Publication No. WO 01/72774, describe certain
Drosophila-derived gene products that may be related to RNAi in
Drosophila. Arndt et al., International PCT Publication No. WO
01/92513 describe certain methods for mediating gene suppression by
using factors that enhance RNAi. Tuschl et al., International PCT
Publication No. WO 02/44321, describe certain synthetic siRNA
constructs. Pachuk et al., International PCT Publication No. WO
00/63364, and Satishchandran et al., International PCT Publication
No. WO 01/04313, describe certain methods and compositions for
inhibiting the function of certain polynucleotide sequences using
certain long (over 250 bp), vector expressed dsRNAs. Echeverri et
al., International PCT Publication No. WO 02/38805, describe
certain C. elegans genes identified via RNAi. Kreutzer et al.,
International PCT Publications Nos. WO 02/055692, WO 02/055693, and
EP 1144623 B1 describes certain methods for inhibiting gene
expression using dsRNA. Graham et al., International PCT
Publications Nos. WO 99/49029 and WO 01/70949, and AU 4037501
describe certain vector expressed siRNA molecules. Fire et al.,
U.S. Pat. No. 6,506,559, describe certain methods for inhibiting
gene expression in vitro using certain long dsRNA (299 bp-1033 bp)
constructs that mediate RNAi. Martinez et al., 2002, Cell, 110,
563-574, describe certain single stranded siRNA constructs,
including certain 5'-phosphorylated single stranded siRNAs that
mediate RNA interference in HeLa cells. Harborth et al., 2003,
Antisense & Nucleic Acid Drug Development, 13, 83-105, describe
certain chemically and structurally modified siRNA molecules. Chiu
and Rana, 2003, RNA, 9, 1034-1048, describe certain chemically and
structurally modified siRNA molecules. Woolf et al., International
PCT Publication Nos. WO 03/064626 and WO 03/064625 describe certain
chemically modified dsRNA constructs.
SUMMARY OF THE INVENTION
[0012] This invention relates to compounds, compositions, and
methods useful for modulating myostatin gene expression using short
interfering nucleic acid (siNA) molecules. This invention also
relates to compounds, compositions, and methods useful for
modulating the expression and activity of other genes involved in
pathways of myostatin gene expression and/or activity by RNA
interference (RNAi) using small nucleic acid molecules. In
particular, the instant invention features small nucleic acid
molecules, such as short interfering nucleic acid (siNA), short
interfering RNA (siRNA), double stranded RNA (dsRNA), micro-RNA
(miRNA), and short hairpin RNA (shRNA) molecules and methods used
to modulate the expression of myostatin genes.
[0013] An siNA of the invention can be unmodified or chemically
modified. An siNA of the instant invention can be chemically
synthesized, expressed from a vector or enzymatically synthesized.
The instant invention also features various chemically modified
synthetic short interfering nucleic acid (siNA) molecules capable
of modulating myostatin gene expression or activity in cells by RNA
interference (RNAi). The use of chemically modified siNA improves
various properties of native siNA molecules through increased
resistance to nuclease degradation in vivo and/or through improved
cellular uptake. Further, contrary to earlier published studies,
siNA having multiple chemical modifications retains its RNAi
activity. The siNA molecules of the instant invention provide
useful reagents and methods for a variety of therapeutic,
diagnostic, target validation, genomic discovery, genetic
engineering, and pharmacogenomic applications.
[0014] In one embodiment, the invention features one or more siNA
molecules and methods that independently or in combination modulate
the expression of myostatin genes encoding proteins, such as
proteins comprising myostatin, such as genes encoding sequences
comprising those sequences referred to by GenBank Accession Nos.
shown in Table I, referred to herein generally as myostatin but
also known as MSTN or Growth Differentiation Factor-8 (GDF-8). The
description below of the various aspects and embodiments of the
invention is provided with reference to exemplary
myostatin/MSTN/GDF-8 gene referred to herein as myostatin. However,
the various aspects and embodiments are also directed to other
myostatin genes, such as myostatin homolog genes, transcript
variants, and polymorphisms (e.g., single nucleotide polymorphism,
(SNPs)) associated with certain myostatin genes, for example genes
associated with diseases, traits, or conditions described herein or
otherwise known in the art. As such, the various aspects and
embodiments are also directed to other genes that are involved in
myostatin mediated pathways of signal transduction or gene
expression. These additional genes can be analyzed for target sites
using the methods described for myostatin genes herein. Thus, the
modulation of other genes and the effects of such modulation of the
other genes can be performed, determined, and measured as described
herein.
[0015] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a myostatin gene, wherein said siNA molecule
comprises about 18 to about 21 base pairs.
[0016] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that directs
cleavage of a myostatin RNA via RNA interference (RNAi), wherein
the double stranded siNA molecule comprises a first and a second
strand, each strand of the siNA molecule is about 18 to about 23
nucleotides in length, the first strand of the siNA molecule
comprises nucleotide sequence having sufficient complementarity to
the myostatin RNA for the siNA molecule to direct cleavage of the
myostatin RNA via RNA interference, and the second strand of said
siNA molecule comprises nucleotide sequence that is complementary
to the first strand.
[0017] In one embodiment, the invention features a chemically
synthesized double stranded short interfering nucleic acid (siNA)
molecule that directs cleavage of a myostatin RNA via RNA
interference (RNAi), wherein each strand of the siNA molecule is
about 18 to about 23 nucleotides in length; and one strand of the
siNA molecule comprises nucleotide sequence having sufficient
complementarity to the myostatin RNA for the siNA molecule to
direct cleavage of the myostatin RNA via RNA interference.
[0018] In one embodiment, the invention features an siNA molecule
that down-regulates expression of a myostatin gene, for example,
wherein the myostatin gene comprises myostatin encoding sequence.
In one embodiment, the invention features an siNA molecule that
down-regulates expression of a myostatin gene, for example, wherein
the myostatin gene comprises myostatin non-coding sequence or
regulatory elements involved in myostatin gene expression.
[0019] In one embodiment, an siNA of the invention is used to
inhibit the expression of a myostatin gene or a myostatin gene
family, wherein the genes or gene family sequences share sequence
homology. Such homologous sequences can be identified as is known
in the art, for example using sequence alignments. siNA molecules
can be designed to target such homologous sequences, for example
using perfectly complementary sequences or by incorporating
non-canonical base pairs, for example mismatches and/or wobble base
pairs that can provide additional target sequences. In instances
where mismatches are identified, non-canonical base pairs (for
example, mismatches and/or wobble bases) can be used to generate
siNA molecules that target more than one gene sequence. In a
non-limiting example, non-canonical base pairs such as UU and CC
base pairs are used to generate siNA molecules that are capable of
targeting sequences for differing myostatin targets that share
sequence homology (e.g., other myostatin encoding sequences). As
such, one advantage of using siNAs of the invention is that a
single siNA can be designed to include nucleic acid sequence that
is complementary to the nucleotide sequence that is conserved
between the homologous genes. In this approach, a single siNA can
be used to inhibit expression of more than one gene instead of
using more than one siNA molecule to target the different
genes.
[0020] In one embodiment, the invention features an siNA molecule
having RNAi activity against myostatin RNA, wherein the siNA
molecule comprises a sequence complementary to any RNA having
myostatin encoding sequence, such as those sequences having GenBank
Accession Nos. shown in Table I. In another embodiment, the
invention features an siNA molecule having RNAi activity against
myostatin RNA, wherein the siNA molecule comprises a sequence
complementary to an RNA having variant myostatin encoding sequence,
for example other mutant myostatin genes not shown in Table I but
known in the art to be associated with neuronal apoptosis. Chemical
modifications as shown in Tables III and IV or otherwise described
herein can be applied to any siNA construct of the invention. In
another embodiment, an siNA molecule of the invention includes a
nucleotide sequence that can interact with nucleotide sequence of a
myostatin gene and thereby mediate silencing of myostatin gene
expression, for example, wherein the siNA mediates regulation of
myostatin gene expression by cellular processes that modulate the
chromatin structure or methylation patterns of the myostatin gene
and prevent transcription of the myostatin gene.
[0021] In one embodiment, siNA molecules of the invention are used
to down regulate or inhibit the expression of myostatin proteins
arising from myostatin haplotype polymorphisms that are associated
with a disease or condition, (e.g., muscle catabolism, muscle
atrophy, muscle weakness etc.). Analysis of myostatin genes, or
myostatin protein or RNA levels can be used to identify subjects
with such polymorphisms or those subjects who are at risk of
developing traits, conditions, or diseases described herein. These
subjects are amenable to treatment, for example, treatment with
siNA molecules of the invention and any other composition useful in
treating diseases or conditions related to myostatin gene
expression. As such, analysis of myostatin protein or RNA levels
can be used to determine treatment type and the course of therapy
in treating a subject. Monitoring of myostatin protein or RNA
levels can be used to predict treatment outcome and to determine
the efficacy of compounds and compositions that modulate the level
and/or activity of certain myostatin proteins associated with a
trait, condition, or disease.
[0022] In one embodiment of the invention an siNA molecule
comprises an antisense strand comprising a nucleotide sequence that
is complementary to a nucleotide sequence or a portion thereof
encoding a myostatin protein. The siNA further comprises a sense
strand, wherein said sense strand comprises a nucleotide sequence
of a myostatin gene or a portion thereof.
[0023] In another embodiment, an siNA molecule comprises an
antisense region comprising a nucleotide sequence that is
complementary to a nucleotide sequence encoding a myostatin protein
or a portion thereof. The siNA molecule further comprises a sense
region, wherein said sense region comprises a nucleotide sequence
of a myostatin gene or a portion thereof.
[0024] In another embodiment, the invention features an siNA
molecule comprising a nucleotide sequence in the antisense region
of the siNA molecule that is complementary to a nucleotide sequence
or portion of sequence of a myostatin gene. In another embodiment,
the invention features an siNA molecule comprising a region, for
example, the antisense region of the siNA construct, complementary
to a sequence comprising a myostatin gene sequence or a portion
thereof.
[0025] In one embodiment, the antisense region of myostatin siNA
constructs comprises a sequence complementary to sequence having
any of SEQ ID NOs. 1-157 or 315-322. In one embodiment, the
antisense region of myostatin constructs comprises sequence having
any of SEQ ID NOs. 158-314, 331-338, 347-354, 363-370, 379-386,
395-418, 420, 422, 424, 427, 429, 431, 433, or 436. In another
embodiment, the sense region of myostatin constructs comprises
sequence having any of SEQ ID NOs. 1-157, 315-330, 339-346,
355-362, 371-378, 387-394, 419, 421, 423, 425, 426, 428, 430, 432,
434, or 435.
[0026] In one embodiment, an siNA molecule of the invention can
comprise any of SEQ ID Nos 1-436. The sequences shown in SEQ ID
NOs: 1-436 are not limiting. An siNA molecule of the invention can
comprise any contiguous myostatin sequence (e.g., about 18 to about
25, or about 18, 19, 20, 21, 22, 23, 24, or 25 contiguous myostatin
nucleotides).
[0027] In yet another embodiment, the invention features an siNA
molecule comprising a sequence, for example, the antisense sequence
of the siNA construct, complementary to a sequence or portion of
sequence comprising sequence represented by GenBank Accession Nos.
shown in Table I. Chemical modifications in Tables III and IV and
described herein can be applied to any siNA construct of the
invention.
[0028] In one embodiment of the invention an siNA molecule
comprises an antisense strand having about 19 to about 29 (e.g.,
about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29) nucleotides,
wherein the antisense strand is complementary to a RNA sequence
encoding a myostatin protein, and wherein said siNA further
comprises a sense strand having about 19 to about 29 (e.g., about
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29) nucleotides, and
wherein said sense strand and said antisense strand are distinct
nucleotide sequences with at least about 19 complementary
nucleotides.
[0029] In another embodiment of the invention an siNA molecule of
the invention comprises an antisense region having about 19 to
about 29 (e.g., about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or
29) nucleotides, wherein the antisense region is complementary to a
RNA sequence encoding a myostatin protein, and wherein said siNA
further comprises a sense region having about 19 to about 29 (e.g.,
about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29) nucleotides,
wherein said sense region and said antisense region comprise a
linear molecule with at least about 19 complementary
nucleotides.
[0030] In one embodiment, an siNA molecule of the invention has
RNAi activity that modulates expression of RNA encoded by a
myostatin gene. Because myostatin genes can share some degree of
sequence homology with each other, siNA molecules can be designed
to target a class of myostatin genes or alternately specific
myostatin genes (e.g., myostatin polymorphic variants) by selecting
sequences that are either shared amongst different myostatin
targets or alternatively that are unique for a specific myostatin
target (e.g., DNA or RNA encoding myostatin). Therefore, in one
embodiment, the siNA molecule can be designed to target conserved
regions of myostatin RNA sequences having homology among several
myostatin gene variants so as to target a class of myostatin genes
with one siNA molecule. Accordingly, in one embodiment, the siNA
molecule of the invention modulates the expression of one or both
myostatin alleles in a subject. In another embodiment, the siNA
molecule can be designed to target a sequence that is unique to a
specific myostatin RNA sequence (e.g., a single myostatin allele or
myostatin single nucleotide polymorphism (SNP)) due to the high
degree of specificity that the siNA molecule requires to mediate
RNAi activity.
[0031] In one embodiment, nucleic acid molecules of the invention
that act as mediators of the RNA interference gene silencing
response are double stranded nucleic acid molecules. In another
embodiment, the siNA molecules of the invention consist of duplex
nucleic acid molecules containing about 19 base pairs between
oligonucleotides comprising about 19 to about 25 (e.g., about 19,
20, 21, 22, 23, 24, or 25) nucleotides. In yet another embodiment,
siNA molecules of the invention comprise duplex nucleic acid
molecules with overhanging ends of about 1 to about 3 (e.g., about
1, 2, or 3) nucleotides, for example, about 21-nucleotide duplexes
with about 19 base pairs and 3'-terminal mononucleotide,
dinucleotide, or trinucleotide overhangs.
[0032] In one embodiment, the invention features one or more
chemically modified siNA constructs having specificity for
myostatin expressing nucleic acid molecules, such as RNA encoding a
myostatin protein. In one embodiment, the invention features a RNA
based siNA molecule (e.g., an siNA comprising 2'-OH nucleotides)
having specificity for myostatin expressing nucleic acid molecules
that includes one or more chemical modifications described herein.
Non-limiting examples of such chemical modifications include
without limitation phosphorothioate internucleotide linkages,
2'-deoxyribonucleotides, 2'-O-methyl ribonucleotides,
2'-deoxy-2'-fluoro ribonucleotides, "universal base" nucleotides,
"acyclic" nucleotides, 5-C-methyl nucleotides, and terminal
glyceryl and/or inverted deoxy abasic residue incorporation. These
chemical modifications, when used in various siNA constructs (e.g.,
RNA based siNA constructs), are shown to preserve RNAi activity in
cells while at the same time, dramatically increasing the serum
stability of these compounds. Furthermore, contrary to the data
published by Parrish et al., supra, applicant demonstrates that
multiple (greater than one) phosphorothioate substitutions are
well-tolerated and confer substantial increases in serum stability
for modified siNA constructs.
[0033] In one embodiment, an siNA molecule of the invention
comprises modified nucleotides while maintaining the ability to
mediate RNAi. The modified nucleotides can be used to improve in
vitro or in vivo characteristics such as stability, activity,
and/or bioavailability. For example, an siNA molecule of the
invention can comprise modified nucleotides as a percentage of the
total number of nucleotides present in the siNA molecule. As such,
an siNA molecule of the invention can generally comprise about 5%
to about 100% modified nucleotides (e.g., about 5%, 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 95% or 100% modified nucleotides). The actual percentage of
modified nucleotides present in a given siNA molecule will depend
on the total number of nucleotides present in the siNA. If the siNA
molecule is single stranded, the percent modification can be based
upon the total number of nucleotides present in the single stranded
siNA molecules. Likewise, if the siNA molecule is double stranded,
the percent modification can be based upon the total number of
nucleotides present in the sense strand, antisense strand, or both
the sense and antisense strands.
[0034] One aspect of the invention features a double stranded short
interfering nucleic acid (siNA) molecule that down-regulates
expression of a myostatin gene. In one embodiment, the double
stranded siNA molecule comprises one or more chemical modifications
and each strand of the double stranded siNA is about 21 nucleotides
long. In one embodiment, the double stranded siNA molecule does not
contain any ribonucleotides. In another embodiment, the double
stranded siNA molecule comprises one or more ribonucleotides. In
one embodiment, each strand of the double stranded siNA molecule
comprises about 19 to about 29 (e.g., about 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, or 29) nucleotides, wherein each strand comprises
about 19 nucleotides that are complementary to the nucleotides of
the other strand. In one embodiment, one of the strands of the
double stranded siNA molecule comprises a nucleotide sequence that
is complementary to a nucleotide sequence or a portion thereof of
the myostatin gene, and the second strand of the double stranded
siNA molecule comprises a nucleotide sequence substantially similar
to the nucleotide sequence of the myostatin gene or a portion
thereof.
[0035] In another embodiment, the invention features a double
stranded short interfering nucleic acid (siNA) molecule that
down-regulates expression of a myostatin gene comprising an
antisense region, wherein the antisense region comprises a
nucleotide sequence that is complementary to a nucleotide sequence
of the myostatin gene or a portion thereof, and a sense region,
wherein the sense region comprises a nucleotide sequence
substantially similar to the nucleotide sequence of the myostatin
gene or a portion thereof. In one embodiment, the antisense region
and the sense region each comprise about 18 to about 23 (e.g. about
18, 19, 20, 21, 22, or 23) nucleotides, wherein the antisense
region comprises about 18 nucleotides that are complementary to
nucleotides of the sense region.
[0036] In another embodiment, the invention features a double
stranded short interfering nucleic acid (siNA) molecule that
down-regulates expression of a myostatin gene comprising a sense
region and an antisense region, wherein the antisense region
comprises a nucleotide sequence that is complementary to a
nucleotide sequence of RNA encoded by the myostatin gene or a
portion thereof and the sense region comprises a nucleotide
sequence that is complementary to the antisense region.
[0037] In one embodiment, an siNA molecule of the invention
comprises blunt ends, i.e., ends that do not include any
overhanging nucleotides. For example, an siNA molecule comprising
modifications described herein (e.g., comprising nucleotides having
Formulae I-VII or siNA constructs comprising "Stab 00"-"Stab 25"
(Table IV) or any combination thereof (see Table IV)) and/or any
length described herein can comprise blunt ends or ends with no
overhanging nucleotides.
[0038] In one embodiment, any siNA molecule of the invention can
comprise one or more blunt ends, i.e. where a blunt end does not
have any overhanging nucleotides. In one embodiment, the blunt
ended siNA molecule has a number of base pairs equal to the number
of nucleotides present in each strand of the siNA molecule. In
another embodiment, the siNA molecule comprises one blunt end, for
example wherein the 5'-end of the antisense strand and the 3'-end
of the sense strand do not have any overhanging nucleotides. In
another example, the siNA molecule comprises one blunt end, for
example wherein the 3'-end of the antisense strand and the 5'-end
of the sense strand do not have any overhanging nucleotides.
[0039] In another example, an siNA molecule comprises two blunt
ends, for example wherein the 3'-end of the antisense strand and
the 5'-end of the sense strand as well as the 5'-end of the
antisense strand and 3'-end of the sense strand do not have any
overhanging nucleotides. A blunt ended siNA molecule can comprise,
for example, from about 18 to about 30 nucleotides (e.g., about 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides).
Other nucleotides present in a blunt ended siNA molecule can
comprise, for example, mismatches, bulges, loops, or wobble base
pairs to modulate the activity of the siNA molecule to mediate RNA
interference.
[0040] By "blunt ends" is meant symmetric termini or termini of a
double stranded siNA molecule having no overhanging nucleotides.
The two strands of a double stranded siNA molecule align with each
other without over-hanging nucleotides at the termini. For example,
a blunt ended siNA construct comprises terminal nucleotides that
are complementary between the sense and antisense regions of the
siNA molecule.
[0041] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a myostatin gene, wherein the siNA molecule is
assembled from two separate oligonucleotide fragments wherein one
fragment comprises the sense region and the second fragment
comprises the antisense region of the siNA molecule. The sense
region can be connected to the antisense region via a linker
molecule, such as a polynucleotide linker or a non-nucleotide
linker.
[0042] In one embodiment, the invention features double stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a myostatin gene, wherein the siNA molecule comprises
about 18 to about 23 base pairs, and wherein each strand of the
siNA molecule comprises one or more chemical modifications. In
another embodiment, one of the strands of the double stranded siNA
molecule comprises a nucleotide sequence that is complementary to a
nucleotide sequence of a myostatin gene or a portion thereof, and
the second strand of the double stranded siNA molecule comprises a
nucleotide sequence substantially similar to the nucleotide
sequence or a portion thereof of the myostatin gene. In another
embodiment, one of the strands of the double stranded siNA molecule
comprises a nucleotide sequence that is complementary to a
nucleotide sequence of a myostatin gene or portion thereof, and the
second strand of the double stranded siNA molecule comprises a
nucleotide sequence substantially similar to the nucleotide
sequence or portion thereof of the myostatin gene. In another
embodiment, each strand of the siNA molecule comprises about 18 to
about 23 nucleotides, and each strand comprises at least about 18
nucleotides that are complementary to the nucleotides of the other
strand. The myostatin gene can comprise, for example, sequences
referred to in Table I.
[0043] In one embodiment, an siNA molecule of the invention
comprises no ribonucleotides. In another embodiment, an siNA
molecule of the invention comprises ribonucleotides.
[0044] In one embodiment, an siNA molecule of the invention
comprises an antisense region comprising a nucleotide sequence that
is complementary to a nucleotide sequence of a myostatin gene or a
portion thereof, and the siNA further comprises a sense region
comprising a nucleotide sequence substantially similar to the
nucleotide sequence of the myostatin gene or a portion thereof. In
another embodiment, the antisense region and the sense region each
comprise about 18 to about 23 nucleotides and the antisense region
comprises at least about 18 nucleotides that are complementary to
nucleotides of the sense region. The myostatin gene can comprise,
for example, sequences referred to in Table I.
[0045] In one embodiment, an siNA molecule of the invention
comprises a sense region and an antisense region, wherein the
antisense region comprises a nucleotide sequence that is
complementary to a nucleotide sequence of RNA encoded by a
myostatin gene, or a portion thereof, and the sense region
comprises a nucleotide sequence that is complementary to the
antisense region. In one embodiment, the siNA molecule is assembled
from two separate oligonucleotide fragments, wherein one fragment
comprises the sense region and the second fragment comprises the
antisense region of the siNA molecule. In another embodiment, the
sense region is connected to the antisense region via a linker
molecule. In another embodiment, the sense region is connected to
the antisense region via a linker molecule, such as a nucleotide or
non-nucleotide linker. The myostatin gene can comprise, for
example, sequences referred in to Table I.
[0046] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a myostatin gene comprising a sense region and an
antisense region, wherein the antisense region comprises a
nucleotide sequence that is complementary to a nucleotide sequence
of RNA encoded by the myostatin gene or a portion thereof and the
sense region comprises a nucleotide sequence that is complementary
to the antisense region, and wherein the siNA molecule has one or
more modified pyrimidine and/or purine nucleotides. In one
embodiment, the pyrimidine nucleotides in the sense region are
2'-O-methylpyrimidine nucleotides or 2'-deoxy-2'-fluoro pyrimidine
nucleotides and the purine nucleotides present in the sense region
are 2'-deoxy purine nucleotides. In another embodiment, the
pyrimidine nucleotides in the sense region are 2'-deoxy-2'-fluoro
pyrimidine nucleotides and the purine nucleotides present in the
sense region are 2'-O-methyl purine nucleotides. In another
embodiment, the pyrimidine nucleotides in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides and the purine
nucleotides present in the sense region are 2'-deoxy purine
nucleotides. In one embodiment, the pyrimidine nucleotides in the
antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides and
the purine nucleotides present in the antisense region are
2'-O-methyl or 2'-deoxy purine nucleotides. In another embodiment
of any of the above-described siNA molecules, any nucleotides
present in a non-complementary region of the sense strand (e.g.
overhang region) are 2'-deoxy nucleotides.
[0047] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a myostatin gene, wherein the siNA molecule is
assembled from two separate oligonucleotide fragments wherein one
fragment comprises the sense region and the second fragment
comprises the antisense region of the siNA molecule, and wherein
the fragment comprising the sense region includes a terminal cap
moiety at the 5'-end, the 3'-end, or both of the 5' and 3' ends of
the fragment. In one embodiment, the terminal cap moiety is an
inverted deoxy abasic moiety or glyceryl moiety. In one embodiment,
each of the two fragments of the siNA molecule comprise about 21
nucleotides.
[0048] In one embodiment, the invention features an siNA molecule
comprising at least one modified nucleotide, wherein the modified
nucleotide is a 2'-deoxy-2'-fluoro nucleotide. The siNA can be, for
example, of length between about 12 and about 36 nucleotides. In
one embodiment, all pyrimidine nucleotides present in the siNA are
2'-deoxy-2'-fluoro pyrimidine nucleotides. In one embodiment, the
modified nucleotides in the siNA include at least one
2'-deoxy-2'-fluoro cytidine or 2'-deoxy-2'-fluoro uridine
nucleotide. In another embodiment, the modified nucleotides in the
siNA include at least one 2'-deoxy-2'-fluoro cytidine and at least
one 2'-deoxy-2'-fluoro uridine nucleotides. In one embodiment, all
uridine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
uridine nucleotides. In one embodiment, all cytidine nucleotides
present in the siNA are 2'-deoxy-2'-fluoro cytidine nucleotides. In
one embodiment, all adenosine nucleotides present in the siNA are
2'-deoxy-2'-fluoro adenosine nucleotides. In one embodiment, all
guanosine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
guanosine nucleotides. The siNA can further comprise at least one
modified internucleotidic linkage, such as phosphorothioate
linkage. In one embodiment, the 2'-deoxy-2'-fluoronucleotides are
present at specifically selected locations in the siNA that are
sensitive to cleavage by ribonucleases, such as locations having
pyrimidine nucleotides.
[0049] In one embodiment, the invention features a method of
increasing the stability of an siNA molecule against cleavage by
ribonucleases comprising introducing at least one modified
nucleotide into the siNA molecule, wherein the modified nucleotide
is a 2'-deoxy-2'-fluoro nucleotide. In one embodiment, all
pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
pyrimidine nucleotides. In one embodiment, the modified nucleotides
in the siNA include at least one 2'-deoxy-2'-fluoro cytidine or
2'-deoxy-2'-fluoro uridine nucleotide. In another embodiment, the
modified nucleotides in the siNA include at least one
2'-deoxy-2'-fluoro cytidine and at least one 2'-deoxy-2'-fluoro
uridine nucleotides. In one embodiment, all uridine nucleotides
present in the siNA are 2'-deoxy-2'-fluoro uridine nucleotides. In
one embodiment, all cytidine nucleotides present in the siNA are
2'-deoxy-2'-fluoro cytidine nucleotides. In one embodiment, all
adenosine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
adenosine nucleotides. In one embodiment, all guanosine nucleotides
present in the siNA are 2'-deoxy-2'-fluoro guanosine nucleotides.
The siNA can further comprise at least one modified
internucleotidic linkage, such as phosphorothioate linkage. In one
embodiment, the 2'-deoxy-2'-fluoronucleotides are present at
specifically selected locations in the siNA that are sensitive to
cleavage by ribonucleases, such as locations having pyrimidine
nucleotides.
[0050] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a myostatin gene comprising a sense region and an
antisense region, wherein the antisense region comprises a
nucleotide sequence that is complementary to a nucleotide sequence
of RNA encoded by the myostatin gene or a portion thereof and the
sense region comprises a nucleotide sequence that is complementary
to the antisense region, and wherein the purine nucleotides present
in the antisense region comprise 2'-deoxy-purine nucleotides. In an
alternative embodiment, the purine nucleotides present in the
antisense region comprise 2'-O-methyl purine nucleotides. In either
of the above embodiments, the antisense region can comprise a
phosphorothioate internucleotide linkage at the 3' end of the
antisense region. Alternatively, in either of the above
embodiments, the antisense region can comprise a glyceryl
modification at the 3' end of the antisense region. In another
embodiment of any of the above-described siNA molecules, any
nucleotides present in a non-complementary region of the antisense
strand (e.g. overhang region) are 2'-deoxy nucleotides.
[0051] In one embodiment, the antisense region of an siNA molecule
of the invention comprises sequence complementary to a portion of a
myostatin transcript having sequence unique to a particular
myostatin disease, condition, or trait related allele, such as
sequence comprising a single nucleotide polymorphism (SNP)
associated with the disease specific disease, condition, or trait.
As such, the antisense region of an siNA molecule of the invention
can comprise sequence complementary to sequences that are unique to
a particular allele to provide specificity in mediating selective
RNAi against the disease, condition, or trait related allele.
[0052] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a myostatin gene, wherein the siNA molecule is
assembled from two separate oligonucleotide fragments wherein one
fragment comprises the sense region and the second fragment
comprises the antisense region of the siNA molecule. In another
embodiment about 19 nucleotides of each fragment of the siNA
molecule are base-paired to the complementary nucleotides of the
other fragment of the siNA molecule and wherein at least two 3'
terminal nucleotides of each fragment of the siNA molecule are not
base-paired to the nucleotides of the other fragment of the siNA
molecule. In one embodiment, each of the two 3' terminal
nucleotides of each fragment of the siNA molecule is a
2'-deoxy-pyrimidine nucleotide, such as a 2'-deoxy-thymidine. In
another embodiment, all 21 nucleotides of each fragment of the siNA
molecule are base-paired to the complementary nucleotides of the
other fragment of the siNA molecule. In another embodiment, about
19 nucleotides of the antisense region are base-paired to the
nucleotide sequence or a portion thereof of the RNA encoded by the
myostatin gene. In another embodiment, about 21 nucleotides of the
antisense region are base-paired to the nucleotide sequence or a
portion thereof of the RNA encoded by the myostatin gene. In any of
the above embodiments, the 5'-end of the fragment comprising said
antisense region can optionally includes a phosphate group.
[0053] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that inhibits the
expression of a myostatin RNA sequence (e.g., wherein said target
RNA sequence is encoded by a myostatin gene involved in the
myostatin pathway), wherein the siNA molecule does not contain any
ribonucleotides and wherein each strand of the double stranded siNA
molecule is about 18 to about 23 nucleotides long. Examples of
non-ribonucleotide containing siNA constructs are combinations of
stabilization chemistries shown in Table IV in any combination of
Sense/Antisense chemistries, such as Stab 7/8, Stab 7/11, Stab 8/8,
Stab 18/8, Stab 18/11, Stab 12/13, Stab 7/13, Stab 18/13, Stab
7/19, Stab 8/19, Stab 18/19, Stab 7/20, Stab 8/20, or Stab
18/20.
[0054] In one embodiment, the invention features a chemically
synthesized double stranded RNA molecule that directs cleavage of a
myostatin RNA via RNA interference, wherein each strand of said RNA
molecule is about 18 to about 23 nucleotides in length; one strand
of the RNA molecule comprises nucleotide sequence having sufficient
complementarity to the myostatin RNA for the RNA molecule to direct
cleavage of the myostatin RNA via RNA interference; and wherein at
least one strand of the RNA molecule comprises one or more
chemically modified nucleotides described herein, such as
deoxynucleotides, 2'-O-methyl nucleotides, 2'-deoxy-2'-fluoro
nucleotides, 2'-O-methoxyethyl nucleotides etc.
[0055] In one embodiment, the invention features a medicament
comprising an siNA molecule of the invention.
[0056] In one embodiment, the invention features an active
ingredient comprising an siNA molecule of the invention.
[0057] In one embodiment, the invention features the use of a
double stranded short interfering nucleic acid (siNA) molecule to
inhibit, down-regulate, or reduce expression of a myostatin gene,
wherein the siNA molecule comprises one or more chemical
modifications and each strand of the double stranded siNA is about
18 to about 28 or more (e.g., about 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, or 28 or more) nucleotides long.
[0058] In one embodiment, the invention features the use of a
double stranded short interfering nucleic acid (siNA) molecule that
inhibits, down-regulates, or reduces expression of a myostatin
gene, wherein one of the strands of the double stranded siNA
molecule is an antisense strand which comprises nucleotide sequence
that is complementary to nucleotide sequence of myostatin RNA or a
portion thereof, the other strand is a sense strand which comprises
nucleotide sequence that is complementary to a nucleotide sequence
of the antisense strand and wherein a majority of the pyrimidine
nucleotides present in the double stranded siNA molecule comprises
a sugar modification.
[0059] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that inhibits,
down-regulates, or reduces expression of a myostatin gene, wherein
one of the strands of the double stranded siNA molecule is an
antisense strand which comprises nucleotide sequence that is
complementary to nucleotide sequence of myostatin RNA or a portion
thereof, wherein the other strand is a sense strand which comprises
nucleotide sequence that is complementary to a nucleotide sequence
of the antisense strand and wherein a majority of the pyrimidine
nucleotides present in the double stranded siNA molecule comprises
a sugar modification.
[0060] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that inhibits,
down-regulates, or reduces expression of a myostatin gene, wherein
one of the strands of the double stranded siNA molecule is an
antisense strand which comprises nucleotide sequence that is
complementary to nucleotide sequence of myostatin RNA that encodes
a protein or portion thereof, the other strand is a sense strand
which comprises nucleotide sequence that is complementary to a
nucleotide sequence of the antisense strand and wherein a majority
of the pyrimidine nucleotides present in the double stranded siNA
molecule comprises a sugar modification. In one embodiment, each
strand of the siNA molecule comprises about 18 to about 29 or more
(e.g., about 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 or
more) nucleotides, wherein each strand comprises at least about 18
nucleotides that are complementary to the nucleotides of the other
strand. In one embodiment, the siNA molecule is assembled from two
oligonucleotide fragments, wherein one fragment comprises the
nucleotide sequence of the antisense strand of the siNA molecule
and a second fragment comprises nucleotide sequence of the sense
region of the siNA molecule. In one embodiment, the sense strand is
connected to the antisense strand via a linker molecule, such as a
polynucleotide linker or a non-nucleotide linker. In a further
embodiment, the pyrimidine nucleotides present in the sense strand
are 2'-deoxy-2'fluoro pyrimidine nucleotides and the purine
nucleotides present in the sense region are 2'-deoxy purine
nucleotides. In another embodiment, the pyrimidine nucleotides
present in the sense strand are 2'-deoxy-2'fluoro pyrimidine
nucleotides and the purine nucleotides present in the sense region
are 2'-O-methyl purine nucleotides. In still another embodiment,
the pyrimidine nucleotides present in the antisense strand are
2'-deoxy-2'-fluoro pyrimidine nucleotides and any purine
nucleotides present in the antisense strand are 2'-deoxy purine
nucleotides. In another embodiment, the antisense strand comprises
one or more 2'-deoxy-2'-fluoro pyrimidine nucleotides and one or
more 2'-O-methyl purine nucleotides. In another embodiment, the
pyrimidine nucleotides present in the antisense strand are
2'-deoxy-2'-fluoro pyrimidine nucleotides and any purine
nucleotides present in the antisense strand are 2'-O-methyl purine
nucleotides. In a further embodiment the sense strand comprises a
3'-end and a 5'-end, wherein a terminal cap moiety (e.g., an
inverted deoxy abasic moiety or inverted deoxy nucleotide moiety
such as inverted thymidine) is present at the 5'-end, the 3'-end,
or both of the 5' and 3' ends of the sense strand. In another
embodiment, the antisense strand comprises a phosphorothioate
internucleotide linkage at the 3' end of the antisense strand. In
another embodiment, the antisense strand comprises a glyceryl
modification at the 3' end. In another embodiment, the 5'-end of
the antisense strand optionally includes a phosphate group.
[0061] In any of the above-described embodiments of a double
stranded short interfering nucleic acid (siNA) molecule that
inhibits, down-regulates, or reduces expression of a myostatin
gene, wherein a majority of the pyrimidine nucleotides present in
the double stranded siNA molecule comprises a sugar modification,
each of the two strands of the siNA molecule can comprise about 21
nucleotides. In one embodiment, about 21 nucleotides of each strand
of the siNA molecule are base-paired to the complementary
nucleotides of the other strand of the siNA molecule. In another
embodiment, about 19 nucleotides of each strand of the siNA
molecule are base-paired to the complementary nucleotides of the
other strand of the siNA molecule, wherein at least two 3' terminal
nucleotides of each strand of the siNA molecule are not base-paired
to the nucleotides of the other strand of the siNA molecule. In
another embodiment, each of the two 3' terminal nucleotides of each
fragment of the siNA molecule is a 2'-deoxy-pyrimidine, such as
2'-deoxy-thymidine. In one embodiment, each strand of the siNA
molecule is base-paired to the complementary nucleotides of the
other strand of the siNA molecule. In one embodiment, about 19
nucleotides of the antisense strand are base-paired to the
nucleotide sequence of the myostatin RNA or a portion thereof. In
one embodiment, about 21 nucleotides of the antisense strand are
base-paired to the nucleotide sequence of the myostatin RNA or a
portion thereof.
[0062] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that inhibits,
down-regulates, or reduces expression of a myostatin gene, wherein
one of the strands of the double stranded siNA molecule is an
antisense strand which comprises nucleotide sequence that is
complementary to nucleotide sequence of myostatin RNA or a portion
thereof, the other strand is a sense strand which comprises
nucleotide sequence that is complementary to a nucleotide sequence
of the antisense strand and wherein a majority of the pyrimidine
nucleotides present in the double stranded siNA molecule comprises
a sugar modification, and wherein the 5'-end of the antisense
strand optionally includes a phosphate group.
[0063] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that inhibits,
down-regulates, or reduces expression of a myostatin gene, wherein
one of the strands of the double stranded siNA molecule is an
antisense strand which comprises nucleotide sequence that is
complementary to nucleotide sequence of myostatin RNA or a portion
thereof, the other strand is a sense strand which comprises
nucleotide sequence that is complementary to a nucleotide sequence
of the antisense strand and wherein a majority of the pyrimidine
nucleotides present in the double stranded siNA molecule comprises
a sugar modification, and wherein the nucleotide sequence or a
portion thereof of the antisense strand is complementary to a
nucleotide sequence of the untranslated region or a portion thereof
of the myostatin RNA.
[0064] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that inhibits,
down-regulates, or reduces expression of a myostatin gene, wherein
one of the strands of the double stranded siNA molecule is an
antisense strand which comprises nucleotide sequence that is
complementary to nucleotide sequence of myostatin RNA or a portion
thereof, wherein the other strand is a sense strand which comprises
nucleotide sequence that is complementary to a nucleotide sequence
of the antisense strand, wherein a majority of the pyrimidine
nucleotides present in the double stranded siNA molecule comprises
a sugar modification, and wherein the nucleotide sequence of the
antisense strand is complementary to a nucleotide sequence of the
myostatin RNA or a portion thereof that is present in the myostatin
RNA.
[0065] In one embodiment, the invention features a composition
comprising an siNA molecule of the invention in a pharmaceutically
acceptable carrier or diluent.
[0066] In a non-limiting example, the introduction of chemically
modified nucleotides into nucleic acid molecules provides a
powerful tool in overcoming potential limitations of in vivo
stability and bioavailability inherent to native RNA molecules that
are delivered exogenously. For example, the use of chemically
modified nucleic acid molecules can enable a lower dose of a
particular nucleic acid molecule for a given therapeutic effect
since chemically modified nucleic acid molecules tend to have a
longer half-life in serum. Furthermore, certain chemical
modifications can improve the bioavailability of nucleic acid
molecules by targeting particular cells or tissues and/or improving
cellular uptake of the nucleic acid molecule. Therefore, even if
the activity of a chemically modified nucleic acid molecule is
reduced as compared to a native nucleic acid molecule, for example,
when compared to an all-RNA nucleic acid molecule, the overall
activity of the modified nucleic acid molecule can be greater than
that of the native molecule due to improved stability and/or
delivery of the molecule. Unlike native unmodified siNA, chemically
modified siNA can also minimize the possibility of activating
interferon activity in humans.
[0067] In any of the embodiments of siNA molecules described
herein, the antisense region of an siNA molecule of the invention
can comprise a phosphorothioate internucleotide linkage at the
3'-end of said antisense region. In any of the embodiments of siNA
molecules described herein, the antisense region can comprise about
one to about five phosphorothioate internucleotide linkages at the
5'-end of said antisense region. In any of the embodiments of siNA
molecules described herein, the 3'-terminal nucleotide overhangs of
an siNA molecule of the invention can comprise ribonucleotides or
deoxyribonucleotides that are chemically modified at a nucleic acid
sugar, base, or backbone. In any of the embodiments of siNA
molecules described herein, the 3'-terminal nucleotide overhangs
can comprise one or more universal base ribonucleotides. In any of
the embodiments of siNA molecules described herein, the 3'-terminal
nucleotide overhangs can comprise one or more acyclic
nucleotides.
[0068] One embodiment of the invention provides an expression
vector comprising a nucleic acid sequence encoding at least one
siNA molecule of the invention in a manner that allows expression
of the nucleic acid molecule. Another embodiment of the invention
provides a mammalian cell comprising such an expression vector. The
mammalian cell can be a human cell. The siNA molecule of the
expression vector can comprise a sense region and an antisense
region. The antisense region can comprise sequence complementary to
a RNA or DNA sequence encoding myostatin and the sense region can
comprise sequence complementary to the antisense region. The siNA
molecule can comprise two distinct strands having complementary
sense and antisense regions. The siNA molecule can comprise a
single strand having complementary sense and antisense regions.
[0069] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule capable of
mediating RNA interference (RNAi) against myostatin inside a cell
or reconstituted in vitro system, wherein the chemical modification
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) nucleotides comprising a backbone modified internucleotide
linkage having Formula I:
##STR00001##
wherein each R1 and R2 is independently any nucleotide,
non-nucleotide, or polynucleotide which can be naturally-occurring
or chemically modified, each X and Y is independently O, S, N,
alkyl, or substituted alkyl, each Z and W is independently O, S, N,
alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, aralkyl, or
acetyl and wherein W, X, Y, and Z are optionally not all O. In
another embodiment, a backbone modification of the invention
comprises a phosphonoacetate and/or thiophosphonoacetate
internucleotide linkage (see for example Sheehan et al., 2003,
Nucleic Acids Research, 31, 4109-4118).
[0070] The chemically modified internucleotide linkages having
Formula I, for example, wherein any Z, W, X, and/or Y independently
comprises a sulphur atom, can be present in one or both
oligonucleotide strands of the siNA duplex, for example, in the
sense strand, the antisense strand, or both strands. The siNA
molecules of the invention can comprise one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, or more) chemically modified
internucleotide linkages having Formula I at the 3'-end, the
5'-end, or both of the 3' and 5'-ends of the sense strand, the
antisense strand, or both strands. For example, an exemplary siNA
molecule of the invention can comprise about 1 to about 5 or more
(e.g., about 1, 2, 3, 4, 5, or more) chemically modified
internucleotide linkages having Formula I at the 5'-end of the
sense strand, the antisense strand, or both strands. In another
non-limiting example, an exemplary siNA molecule of the invention
can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, or more) pyrimidine nucleotides with chemically modified
internucleotide linkages having Formula I in the sense strand, the
antisense strand, or both strands. In yet another non-limiting
example, an exemplary siNA molecule of the invention can comprise
one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more)
purine nucleotides with chemically modified internucleotide
linkages having Formula I in the sense strand, the antisense
strand, or both strands. In another embodiment, an siNA molecule of
the invention having internucleotide linkage(s) of Formula I also
comprises a chemically modified nucleotide or non-nucleotide having
any of Formulae I-VII.
[0071] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule capable of
mediating RNA interference (RNAi) against myostatin inside a cell
or reconstituted in vitro system, wherein the chemical modification
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) nucleotides or non-nucleotides having Formula II:
##STR00002##
wherein each R3, R4, R5, R6, R7, R8, R10, R11 and R12 is
independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl,
F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-5-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, or group having Formula I or II;
R9 is O, S, CH2, S.dbd.O, CHF, or CF2, and B is a nucleosidic base
such as adenine, guanine, uracil, cytosine, thymine,
2-aminoadenosine, 5-methylcytosine, 2,6-diaminopurine, or any other
non-naturally occurring base that can be complementary or
non-complementary to target RNA or a non-nucleosidic base such as
phenyl, naphthyl, 3-nitropyrrole, 5-nitroindole, nebularine,
pyridone, pyridinone, or any other non-naturally occurring
universal base that can be complementary or non-complementary to
target RNA.
[0072] The chemically modified nucleotide or non-nucleotide of
Formula II can be present in one or both oligonucleotide strands of
the siNA duplex, for example in the sense strand, the antisense
strand, or both strands. The siNA molecules of the invention can
comprise one or more chemically modified nucleotide or
non-nucleotide of Formula II at the 3'-end, the 5'-end, or both of
the 3' and 5'-ends of the sense strand, the antisense strand, or
both strands. For example, an exemplary siNA molecule of the
invention can comprise about 1 to about 5 or more (e.g., about 1,
2, 3, 4, 5, or more) chemically modified nucleotides or
non-nucleotides of Formula II at the 5'-end of the sense strand,
the antisense strand, or both strands. In anther non-limiting
example, an exemplary siNA molecule of the invention can comprise
about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more)
chemically modified nucleotides or non-nucleotides of Formula II at
the 3'-end of the sense strand, the antisense strand, or both
strands.
[0073] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule capable of
mediating RNA interference (RNAi) against myostatin inside a cell
or reconstituted in vitro system, wherein the chemical modification
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) nucleotides or non-nucleotides having Formula III:
##STR00003##
wherein each R3, R4, R5, R6, R7, R8, R10, R11 and R12 is
independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl,
F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-5-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, or group having Formula I or II;
R9 is O, S, CH2, S.dbd.O, CHF, or CF2, and B is a nucleosidic base
such as adenine, guanine, uracil, cytosine, thymine,
2-aminoadenosine, 5-methylcytosine, 2,6-diaminopurine, or any other
non-naturally occurring base that can be employed to be
complementary or non-complementary to target RNA or a
non-nucleosidic base such as phenyl, naphthyl, 3-nitropyrrole,
5-nitroindole, nebularine, pyridone, pyridinone, or any other
non-naturally occurring universal base that can be complementary or
non-complementary to target RNA.
[0074] The chemically modified nucleotide or non-nucleotide of
Formula III can be present in one or both oligonucleotide strands
of the siNA duplex, for example, in the sense strand, the antisense
strand, or both strands. The siNA molecules of the invention can
comprise one or more chemically modified nucleotide or
non-nucleotide of Formula III at the 3'-end, the 5'-end, or both of
the 3' and 5'-ends of the sense strand, the antisense strand, or
both strands. For example, an exemplary siNA molecule of the
invention can comprise about 1 to about 5 or more (e.g., about 1,
2, 3, 4, 5, or more) chemically modified nucleotide(s) or
non-nucleotide(s) of Formula III at the 5'-end of the sense strand,
the antisense strand, or both strands. In anther non-limiting
example, an exemplary siNA molecule of the invention can comprise
about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more)
chemically modified nucleotide or non-nucleotide of Formula III at
the 3'-end of the sense strand, the antisense strand, or both
strands.
[0075] In another embodiment, an siNA molecule of the invention
comprises a nucleotide having Formula II or III, wherein the
nucleotide having Formula II or III is in an inverted
configuration. For example, the nucleotide having Formula II or III
is connected to the siNA construct in a 3'-3',3'-2',2'-3', or 5'-5'
configuration, such as at the 3'-end, the 5'-end, or both of the 3'
and 5'-ends of one or both siNA strands.
[0076] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule capable of
mediating RNA interference (RNAi) against myostatin inside a cell
or reconstituted in vitro system, wherein the chemical modification
comprises a 5'-terminal phosphate group having Formula IV:
##STR00004##
wherein each X and Y is independently O, S, N, alkyl, substituted
alkyl, or alkylhalo; wherein each Z and W is independently O, S, N,
alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, aralkyl,
alkylhalo, or acetyl; and wherein W, X, Y and Z are not all O.
[0077] In one embodiment, the invention features an siNA molecule
having a 5'-terminal phosphate group having Formula IV on the
target-complementary strand, for example, a strand complementary to
a target RNA, wherein the siNA molecule comprises an all RNA siNA
molecule. In another embodiment, the invention features an siNA
molecule having a 5'-terminal phosphate group having Formula IV on
the target-complementary strand wherein the siNA molecule also
comprises about 1 to about 3 (e.g., about 1, 2, or 3) nucleotide
3'-terminal nucleotide overhangs having about 1 to about 4 (e.g.,
about 1, 2, 3, or 4) deoxyribonucleotides on the 3'-end of one or
both strands. In another embodiment, a 5'-terminal phosphate group
having Formula IV is present on the target-complementary strand of
an siNA molecule of the invention, for example an siNA molecule
having chemical modifications having any of Formulae I-VII.
[0078] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule capable of
mediating RNA interference (RNAi) against myostatin inside a cell
or reconstituted in vitro system, wherein the chemical modification
comprises one or more phosphorothioate internucleotide linkages.
For example, in a non-limiting example, the invention features a
chemically modified short interfering nucleic acid (siNA) having
about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate
internucleotide linkages in one siNA strand. In yet another
embodiment, the invention features a chemically modified short
interfering nucleic acid (siNA) individually having about 1, 2, 3,
4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages in
both siNA strands. The phosphorothioate internucleotide linkages
can be present in one or both oligonucleotide strands of the siNA
duplex, for example in the sense strand, the antisense strand, or
both strands. The siNA molecules of the invention can comprise one
or more phosphorothioate internucleotide linkages at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the sense strand, the
antisense strand, or both strands. For example, an exemplary siNA
molecule of the invention can comprise about 1 to about 5 or more
(e.g., about 1, 2, 3, 4, 5, or more) consecutive phosphorothioate
internucleotide linkages at the 5'-end of the sense strand, the
antisense strand, or both strands. In another non-limiting example,
an exemplary siNA molecule of the invention can comprise one or
more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more)
pyrimidine phosphorothioate internucleotide linkages in the sense
strand, the antisense strand, or both strands. In yet another
non-limiting example, an exemplary siNA molecule of the invention
can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, or more) purine phosphorothioate internucleotide linkages in
the sense strand, the antisense strand, or both strands.
[0079] In one embodiment, the invention features an siNA molecule,
wherein the sense strand comprises one or more, for example, about
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate
internucleotide linkages, and/or one or more (e.g., about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl,
2'-deoxy-2'-fluoro, and/or about one or more (e.g., about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides,
and optionally a terminal cap molecule at the 3'-end, the 5'-end,
or both of the 3'- and 5'-ends of the sense strand; and wherein the
antisense strand comprises about 1 to about 10 or more,
specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more
phosphorothioate internucleotide linkages, and/or one or more
(e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy,
2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified
nucleotides, and optionally a terminal cap molecule at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the antisense strand.
In another embodiment, one or more, for example about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense
and/or antisense siNA strand are chemically modified with 2'-deoxy,
2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without
one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more, phosphorothioate internucleotide linkages and/or a terminal
cap molecule at the 3'-end, the 5'-end, or both of the 3'- and
5'-ends, being present in the same or different strand.
[0080] In another embodiment, the invention features an siNA
molecule, wherein the sense strand comprises about 1 to about 5,
specifically about 1, 2, 3, 4, or 5 phosphorothioate
internucleotide linkages, and/or one or more (e.g., about 1, 2, 3,
4, 5, or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and/or
one or more (e.g., about 1, 2, 3, 4, 5, or more) universal base
modified nucleotides, and optionally a terminal cap molecule at the
3-end, the 5'-end, or both of the 3'- and 5'-ends of the sense
strand; and wherein the antisense strand comprises about 1 to about
5 or more, specifically about 1, 2; 3, 4, 5, or more
phosphorothioate internucleotide linkages, and/or one or more
(e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy,
2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified
nucleotides, and optionally a terminal cap molecule at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the antisense strand.
In another embodiment, one or more, for example about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense
and/or antisense siNA strand are chemically modified with 2'-deoxy,
2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without
about 1 to about 5 or more, for example about 1, 2, 3, 4, 5, or
more phosphorothioate internucleotide linkages and/or a terminal
cap molecule at the 3'-end, the 5'-end, or both of the 3'- and
5'-ends, being present in the same or different strand.
[0081] In one embodiment, the invention features an siNA molecule,
wherein the antisense strand comprises one or more, for example,
about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate
internucleotide linkages, and/or about one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl,
2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5,
6, 7, 8, 9, 10 or more) universal base modified nucleotides, and
optionally a terminal cap molecule at the 3'-end, the 5'-end, or
both of the 3'- and 5'-ends of the sense strand; and wherein the
antisense strand comprises about 1 to about 10 or more,
specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more
phosphorothioate internucleotide linkages, and/or one or more
(e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy,
2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified
nucleotides, and optionally a terminal cap molecule at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the antisense strand.
In another embodiment, one or more, for example about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense
and/or antisense siNA strand are chemically modified with 2'-deoxy,
2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without
one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or
more phosphorothioate internucleotide linkages and/or a terminal
cap molecule at the 3'-end, the 5'-end, or both of the 3' and
5'-ends, being present in the same or different strand.
[0082] In another embodiment, the invention features an siNA
molecule, wherein the antisense strand comprises about 1 to about 5
or more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate
internucleotide linkages, and/or one or more (e.g., about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl,
2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5,
6, 7, 8, 9, 10 or more) universal base modified nucleotides, and
optionally a terminal cap molecule at the 3'-end, the 5'-end, or
both of the 3'- and 5'-ends of the sense strand; and wherein the
antisense strand comprises about 1 to about 5 or more, specifically
about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide
linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8,
9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and/or
one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more)
universal base modified nucleotides, and optionally a terminal cap
molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends
of the antisense strand. In another embodiment, one or more, for
example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine
nucleotides of the sense and/or antisense siNA strand are
chemically modified with 2'-deoxy, 2'-O-methyl and/or
2'-deoxy-2'-fluoro nucleotides, with or without about 1 to about 5,
for example, about 1, 2, 3, 4, 5 or more phosphorothioate
internucleotide linkages and/or a terminal cap molecule at the
3'-end, the 5'-end, or both of the 3'- and 5'-ends, being present
in the same or different strand.
[0083] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule having
about 1 to about 5 or more (specifically about 1, 2, 3, 4, 5 or
more) phosphorothioate internucleotide linkages in each strand of
the siNA molecule.
[0084] In another embodiment, the invention features an siNA
molecule comprising 2'-5' internucleotide linkages. The 2'-5'
internucleotide linkage(s) can be at the 3'-end, the 5'-end, or
both of the 3'- and 5'-ends of one or both siNA sequence strands.
In addition, the 2'-5' internucleotide linkage(s) can be present at
various other positions within one or both siNA sequence strands,
for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including
every internucleotide linkage of a pyrimidine nucleotide in one or
both strands of the siNA molecule can comprise a 2'-5'
internucleotide linkage, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more including every internucleotide linkage of a purine nucleotide
in one or both strands of the siNA molecule can comprise a 2'-5'
internucleotide linkage.
[0085] In another embodiment, a chemically modified siNA molecule
of the invention comprises a duplex having two strands, one or both
of which can be chemically modified, wherein each strand is about
18 to about 27 (e.g., about 18, 19, 20, 21, 22, 23, 24, 25, 26, or
27) nucleotides in length, wherein the duplex has about 18 to about
23 (e.g., about 18, 19, 20, 21, 22, or 23) base pairs, and wherein
the chemical modification comprises a structure having any of
Formulae I-VII. For example, an exemplary chemically modified siNA
molecule of the invention comprises a duplex having two strands,
one or both of which can be chemically modified with a chemical
modification having any of Formulae I-VII or any combination
thereof, wherein each strand consists of about 21 nucleotides, each
having a 2-nucleotide 3'-terminal nucleotide overhang, and wherein
the duplex has about 19 base pairs. In another embodiment, an siNA
molecule of the invention comprises a single stranded hairpin
structure, wherein the siNA is about 36 to about 70 (e.g., about
36, 40, 45, 50, 55, 60, 65, or 70) nucleotides in length having
about 18 to about 23 (e.g., about 18, 19, 20, 21, 22, or 23) base
pairs, and wherein the siNA can include a chemical modification
comprising a structure having any of Formulae I-VII or any
combination thereof. For example, an exemplary chemically modified
siNA molecule of the invention comprises a linear oligonucleotide
having about 42 to about 50 (e.g., about 42, 43, 44, 45, 46, 47,
48, 49, or 50) nucleotides that is chemically modified with a
chemical modification having any of Formulae I-VII or any
combination thereof, wherein the linear oligonucleotide forms a
hairpin structure having about 19 base pairs and a 2-nucleotide
3'-terminal nucleotide overhang. In another embodiment, a linear
hairpin siNA molecule of the invention contains a stem loop motif,
wherein the loop portion of the siNA molecule is biodegradable. For
example, a linear hairpin siNA molecule of the invention is
designed such that degradation of the loop portion of the siNA
molecule in vivo can generate a double stranded siNA molecule with
3'-terminal overhangs, such as 3'-terminal nucleotide overhangs
comprising about 2 nucleotides.
[0086] In another embodiment, an siNA molecule of the invention
comprises a hairpin structure, wherein the siNA is about 25 to
about 50 (e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,
36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50)
nucleotides in length having about 3 to about 25 (e.g., about 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, or 25) base pairs, and wherein the siNA can include one or
more chemical modifications comprising a structure having any of
Formulae I-VII or any combination thereof. For example, an
exemplary chemically modified siNA molecule of the invention
comprises a linear oligonucleotide having about 25 to about 35
(e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35)
nucleotides that is chemically modified with one or more chemical
modifications having any of Formulae I-VII or any combination
thereof, wherein the linear oligonucleotide forms a hairpin
structure having about 3 to about 23 (e.g., about 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23) base
pairs and a 5'-terminal phosphate group that can be chemically
modified as described herein (for example a 5'-terminal phosphate
group having Formula IV). In another embodiment, a linear hairpin
siNA molecule of the invention contains a stem loop motif, wherein
the loop portion of the siNA molecule is biodegradable. In one
embodiment, a linear hairpin siNA molecule of the invention
comprises a loop portion comprising a non-nucleotide linker.
[0087] In another embodiment, an siNA molecule of the invention
comprises an asymmetric hairpin structure, wherein the siNA is
about 25 to about 50 (e.g., about 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
or 50) nucleotides in length having about 3 to about 20 (e.g.,
about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
or 20) base pairs, and wherein the siNA can include one or more
chemical modifications comprising a structure having any of
Formulae I-VII or any combination thereof. For example, an
exemplary chemically modified siNA molecule of the invention
comprises a linear oligonucleotide having about 25 to about 35
(e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35)
nucleotides that is chemically modified with one or more chemical
modifications having any of Formulae I-VII or any combination
thereof, wherein the linear oligonucleotide forms an asymmetric
hairpin structure having about 3 to about 18 (e.g., about 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18) base pairs and a
5'-terminal phosphate group that can be chemically modified as
described herein (for example a 5'-terminal phosphate group having
Formula IV). In one embodiment, an asymmetric hairpin siNA molecule
of the invention contains a stem loop motif, wherein the loop
portion of the siNA molecule is biodegradable. In another
embodiment, an asymmetric hairpin siNA molecule of the invention
comprises a loop portion comprising a non-nucleotide linker.
[0088] In another embodiment, an siNA molecule of the invention
comprises an asymmetric double stranded structure having separate
polynucleotide strands comprising sense and antisense regions,
wherein the antisense region is about 16 to about 25 (e.g., about
16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides in length,
wherein the sense region is about 3 to about 18 (e.g., about 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18) nucleotides
in length, wherein the sense region and the antisense region have
at least 3 complementary nucleotides, and wherein the siNA can
include one or more chemical modifications comprising a structure
having any of Formulae I-VII or any combination thereof. For
example, an exemplary chemically modified siNA molecule of the
invention comprises an asymmetric double stranded structure having
separate polynucleotide strands comprising sense and antisense
regions, wherein the antisense region is about 18 to about 22
(e.g., about 18, 19, 20, 21, or 22) nucleotides in length and
wherein the sense region is about 3 to about 15 (e.g., about 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15) nucleotides in length,
wherein the sense region the antisense region have at least 3
complementary nucleotides, and wherein the siNA can include one or
more chemical modifications comprising a structure having any of
Formulae I-VII or any combination thereof. In another embodiment,
the asymmetric double stranded siNA molecule can also have a
5'-terminal phosphate group that can be chemically modified as
described herein (for example a 5'-terminal phosphate group having
Formula IV).
[0089] In another embodiment, an siNA molecule of the invention
comprises a circular nucleic acid molecule, wherein the siNA is
about 38 to about 70 (e.g., about 38, 40, 45, 50, 55, 60, 65, or
70) nucleotides in length having about 18 to about 23 (e.g., about
18, 19, 20, 21, 22, or 23) base pairs, and wherein the siNA can
include a chemical modification, which comprises a structure,
having any of Formulae I-VII or any combination thereof. For
example, an exemplary chemically modified siNA molecule of the
invention comprises a circular oligonucleotide having about 42 to
about 50 (e.g., about 42, 43, 44, 45, 46, 47, 48, 49, or 50)
nucleotides that is chemically modified with a chemical
modification having any of Formulae I-VII or any combination
thereof, wherein the circular oligonucleotide forms a dumbbell
shaped structure having about 19 base pairs and 2 loops.
[0090] In another embodiment, a circular siNA molecule of the
invention contains two loop motifs, wherein one or both loop
portions of the siNA molecule is biodegradable. For example, a
circular siNA molecule of the invention is designed such that
degradation of the loop portions of the siNA molecule in vivo can
generate a double stranded siNA molecule with 3'-terminal
overhangs, such as 3'-terminal nucleotide overhangs comprising
about 2 nucleotides.
[0091] In one embodiment, an siNA molecule of the invention
comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) abasic moiety, for example a compound having Formula
V:
##STR00005##
wherein each R3, R4, R5, R6, R7, R8, R10, R11, R12, and R13 is
independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl,
F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-5-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, or group having Formula I or II;
R9 is O, S, CH2, S.dbd.O, CHF, or CF2.
[0092] In one embodiment, an siNA molecule of the invention
comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) inverted abasic moiety, for example a compound having
Formula VI:
##STR00006##
wherein each R3, R4, R5, R6, R7, R8, R10, R11, R12, and R13 is
independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl,
F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-5-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, or group having Formula I or II;
R9 is O, S, CH2, S.dbd.O, CHF, or CF2, and either R5, R3, R8 or R13
serves as a point of attachment to the siNA molecule of the
invention.
[0093] In another embodiment, an siNA molecule of the invention
comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) substituted polyalkyl moieties, for example a compound
having Formula VII:
##STR00007##
wherein each n is independently an integer from 1 to 12, each R1,
R2 and R3 is independently H, OH, alkyl, substituted alkyl, alkaryl
or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl,
N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-SH,
alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH,
alkyl-5-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl,
aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, or a group having Formula I, and
R1, R2 or R3 serves as points of attachment to the siNA molecule of
the invention.
[0094] In another embodiment, the invention features a compound
having Formula VII,
[0095] wherein R1 and R2 are hydroxyl (OH) groups, n=1, and R3
comprises O and is the point of attachment to the 3'-end, the
5'-end, or both of the 3' and 5'-ends of one or both strands of a
double stranded siNA molecule of the invention or to a single
stranded siNA molecule of the invention. This modification is
referred to herein as "glyceryl" (for example modification 6 in
FIG. 10).
[0096] In another embodiment, a chemically modified nucleoside or
non-nucleoside (e.g. a moiety having any of Formula V, VI or VII)
of the invention is at the 3'-end, the 5'-end, or both of the 3'
and 5'-ends of an siNA molecule of the invention. For example,
chemically modified nucleoside or non-nucleoside (e.g., a moiety
having Formula V, VI or VII) can be present at the 3'-end, the
5'-end, or both of the 3' and 5'-ends of the antisense strand, the
sense strand, or both antisense and sense strands of the siNA
molecule. In one embodiment, the chemically modified nucleoside or
non-nucleoside (e.g., a moiety having Formula V, VI or VII) is
present at the 5'-end and 3'-end of the sense strand and the 3'-end
of the antisense strand of a double stranded siNA molecule of the
invention. In one embodiment, the chemically modified nucleoside or
non-nucleoside (e.g., a moiety having Formula V, VI or VII) is
present at the terminal position of the 5'-end and 3'-end of the
sense strand and the 3'-end of the antisense strand of a double
stranded siNA molecule of the invention. In one embodiment, the
chemically modified nucleoside or non-nucleoside (e.g., a moiety
having Formula V, VI or VII) is present at the two terminal
positions of the 5'-end and 3'-end of the sense strand and the
3'-end of the antisense strand of a double stranded siNA molecule
of the invention. In one embodiment, the chemically modified
nucleoside or non-nucleoside (e.g., a moiety having Formula V, VI
or VII) is present at the penultimate position of the 5'-end and
3'-end of the sense strand and the 3'-end of the antisense strand
of a double stranded siNA molecule of the invention. In addition, a
moiety having Formula VII can be present at the 3'-end or the
5'-end of a hairpin siNA molecule as described herein.
[0097] In another embodiment, an siNA molecule of the invention
comprises an abasic residue having Formula V or VI, wherein the
abasic residue having Formula VI or VI is connected to the siNA
construct in a 3'-3',3'-2',2'-3', or 5'-5' configuration, such as
at the 3'-end, the 5'-end, or both of the 3' and 5'-ends of one or
both siNA strands.
[0098] In one embodiment, an siNA molecule of the invention
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) locked nucleic acid (LNA) nucleotides, for example, at the
5'-end, the 3'-end, both of the 5' and 3'-ends, or any combination
thereof, of the siNA molecule.
[0099] In another embodiment, an siNA molecule of the invention
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) acyclic nucleotides, for example, at the 5'-end, the
3'-end, both of the 5' and 3'-ends, or any combination thereof, of
the siNA molecule.
[0100] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising a sense region, wherein any (e.g., one or more
or all) pyrimidine nucleotides present in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the sense
region are 2'-deoxy purine nucleotides (e.g., wherein all purine
nucleotides are 2'-deoxy purine nucleotides or alternately a
plurality of purine nucleotides are 2'-deoxy purine
nucleotides).
[0101] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising a sense region, wherein any (e.g., one or more
or all) pyrimidine nucleotides present in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the sense
region are 2'-deoxy purine nucleotides (e.g., wherein all purine
nucleotides are 2'-deoxy purine nucleotides or alternately a
plurality of purine nucleotides are 2'-deoxy purine nucleotides),
wherein any nucleotides comprising a 3'-terminal nucleotide
overhang that are present in said sense region are 2'-deoxy
nucleotides.
[0102] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising a sense region, wherein any (e.g., one or more
or all) pyrimidine nucleotides present in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the sense
region are 2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides).
[0103] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising a sense region, wherein any (e.g., one or more
or all) pyrimidine nucleotides present in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), wherein any (e.g.,
one or more or all) purine nucleotides present in the sense region
are 2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides), and wherein any nucleotides comprising a 3'-terminal
nucleotide overhang that are present in said sense region are
2'-deoxy nucleotides.
[0104] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising an antisense region, wherein any (e.g., one or
more or all) pyrimidine nucleotides present in the antisense region
are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the
antisense region are 2'-O-methyl purine nucleotides (e.g., wherein
all purine nucleotides are 2'-O-methyl purine nucleotides or
alternately a plurality of purine nucleotides are 2'-O-methyl
purine nucleotides).
[0105] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising an antisense region, wherein any (e.g., one or
more or all) pyrimidine nucleotides present in the antisense region
are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), wherein any (e.g.,
one or more or all) purine nucleotides present in the antisense
region are 2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides), and wherein any nucleotides comprising a 3'-terminal
nucleotide overhang that are present in said antisense region are
2'-deoxy nucleotides.
[0106] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising an antisense region, wherein any (e.g., one or
more or all) pyrimidine nucleotides present in the antisense region
are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the
antisense region are 2'-deoxy purine nucleotides (e.g., wherein all
purine nucleotides are 2'-deoxy purine nucleotides or alternately a
plurality of purine nucleotides are 2'-deoxy purine
nucleotides).
[0107] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention comprising an antisense region, wherein any (e.g., one or
more or all) pyrimidine nucleotides present in the antisense region
are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
(e.g., one or more or all) purine nucleotides present in the
antisense region are 2'-O-methyl purine nucleotides (e.g., wherein
all purine nucleotides are 2'-O-methyl purine nucleotides or
alternately a plurality of purine nucleotides are 2'-O-methyl
purine nucleotides).
[0108] In one embodiment, the invention features a chemically
modified short interfering nucleic acid (siNA) molecule of the
invention capable of mediating RNA interference (RNAi) against
myostatin inside a cell or reconstituted in vitro system comprising
a sense region, wherein one or more pyrimidine nucleotides present
in the sense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides
(e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides or alternately a plurality of pyrimidine
nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and one
or more purine nucleotides present in the sense region are 2'-deoxy
purine nucleotides (e.g., wherein all purine nucleotides are
2'-deoxy purine nucleotides or alternately a plurality of purine
nucleotides are 2'-deoxy purine nucleotides), and an antisense
region, wherein one or more pyrimidine nucleotides present in the
antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides
(e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides or alternately a plurality of pyrimidine
nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and one
or more purine nucleotides present in the antisense region are
2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides). The sense region and/or the antisense region can have
a terminal cap modification, such as any modification described
herein or shown in FIG. 10, that is optionally present at the
3'-end, the 5'-end, or both of the 3' and 5'-ends of the sense
and/or antisense sequence. The sense and/or antisense region can
optionally further comprise a 3'-terminal nucleotide overhang
having about 1 to about 4 (e.g., about 1, 2, 3, or 4)
2'-deoxynucleotides. The overhang nucleotides can further comprise
one or more (e.g., about 1, 2, 3, 4 or more) phosphorothioate,
phosphonoacetate, and/or thiophosphonoacetate internucleotide
linkages. Non-limiting examples of these chemically modified siNAs
are shown in FIGS. 4 and 5 and Tables III and IV herein. In any of
these described embodiments, the purine nucleotides present in the
sense region are alternatively 2'-O-methyl purine nucleotides
(e.g., wherein all purine nucleotides are 2'-O-methyl purine
nucleotides or alternately a plurality of purine nucleotides are
2'-O-methyl purine nucleotides) and one or more purine nucleotides
present in the antisense region are 2'-O-methyl purine nucleotides
(e.g., wherein all purine nucleotides are 2'-O-methyl purine
nucleotides or alternately a plurality of purine nucleotides are
2'-O-methyl purine nucleotides). Also, in any of these embodiments,
one or more purine nucleotides present in the sense region are
alternatively purine ribonucleotides (e.g., wherein all purine
nucleotides are purine ribonucleotides or alternately a plurality
of purine nucleotides are purine ribonucleotides) and any purine
nucleotides present in the antisense region are 2'-O-methyl purine
nucleotides (e.g., wherein all purine nucleotides are 2'-O-methyl
purine nucleotides or alternately a plurality of purine nucleotides
are 2'-O-methyl purine nucleotides). Additionally, in any of these
embodiments, one or more purine nucleotides present in the sense
region and/or present in the antisense region are alternatively
selected from the group consisting of 2'-deoxy nucleotides, locked
nucleic acid (LNA) nucleotides, 2'-methoxyethyl nucleotides,
4'-thionucleotides, and 2'-O-methyl nucleotides (e.g., wherein all
purine nucleotides are selected from the group consisting of
2'-deoxy nucleotides, locked nucleic acid (LNA) nucleotides,
2'-methoxyethyl nucleotides, 4'-thionucleotides, and 2'-O-methyl
nucleotides or alternately a plurality of purine nucleotides are
selected from the group consisting of 2'-deoxy nucleotides, locked
nucleic acid (LNA) nucleotides, 2'-methoxyethyl nucleotides,
4'-thionucleotides, and 2'-O-methyl nucleotides).
[0109] In another embodiment, any modified nucleotides present in
the siNA molecules of the invention, preferably in the antisense
strand of the siNA molecules of the invention, but also optionally
in the sense and/or both antisense and sense strands, comprise
modified nucleotides having properties or characteristics similar
to naturally occurring ribonucleotides. For example, the invention
features siNA molecules including modified nucleotides having a
Northern conformation (e.g., Northern pseudorotation cycle, see for
example Saenger, Principles of Nucleic Acid Structure,
Springer-Verlag ed., 1984). As such, chemically modified
nucleotides present in the siNA molecules of the invention,
preferably in the antisense strand of the siNA molecules of the
invention, but also optionally in the sense and/or both antisense
and sense strands, are resistant to nuclease degradation while at
the same time maintaining the capacity to mediate RNAi.
Non-limiting examples of nucleotides having a Northern
configuration include locked nucleic acid (LNA) nucleotides (e.g.,
2'-O, 4'-C-methylene-(D-ribofuranosyl) nucleotides);
2'-methoxyethoxy (MOE) nucleotides; 2'-methyl-thio-ethyl,
2'-deoxy-2'-fluoro nucleotides, 2'-deoxy-2'-chloro nucleotides,
2'-azido nucleotides, and 2'-O-methyl nucleotides.
[0110] In one embodiment, the sense strand of a double stranded
siNA molecule of the invention comprises a terminal cap moiety,
(see for example FIG. 10) such as an inverted deoxyabasic moiety,
at the 3'-end, 5'-end, or both 3' and 5'-ends of the sense
strand.
[0111] In one embodiment, the invention features a chemically
modified short interfering nucleic acid molecule (siNA) capable of
mediating RNA interference (RNAi) against myostatin inside a cell
or reconstituted in vitro system, wherein the chemical modification
comprises a conjugate covalently attached to the chemically
modified siNA molecule. Non-limiting examples of conjugates
contemplated by the invention include conjugates and ligands
described in Vargeese et al., U.S. Ser. No. 10/427,160, filed Apr.
30, 2003, incorporated by reference herein in its entirety,
including the drawings. In another embodiment, the conjugate is
covalently attached to the chemically modified siNA molecule via a
biodegradable linker. In one embodiment, the conjugate molecule is
attached at the 3'-end of either the sense strand, the antisense
strand, or both strands of the chemically modified siNA molecule.
In another embodiment, the conjugate molecule is attached at the
5'-end of either the sense strand, the antisense strand, or both
strands of the chemically modified siNA molecule. In yet another
embodiment, the conjugate molecule is attached both the 3'-end and
5'-end of either the sense strand, the antisense strand, or both
strands of the chemically modified siNA molecule, or any
combination thereof. In one embodiment, a conjugate molecule of the
invention comprises a molecule that facilitates delivery of a
chemically modified siNA molecule into a biological system, such as
a cell. In another embodiment, the conjugate molecule attached to
the chemically modified siNA molecule is a polyethylene glycol,
human serum albumin, or a ligand for a cellular receptor that can
mediate cellular uptake. Examples of specific conjugate molecules
contemplated by the instant invention that can be attached to
chemically modified siNA molecules are described in Vargeese et
al., U.S. Ser. No. 10/201,394, filed Jul. 22, 2002 incorporated by
reference herein. The type of conjugates used and the extent of
conjugation of siNA molecules of the invention can be evaluated for
improved pharmacokinetic profiles, bioavailability, and/or
stability of siNA constructs while at the same time maintaining the
ability of the siNA to mediate RNAi activity. As such, one skilled
in the art can screen siNA constructs that are modified with
various conjugates to determine whether the siNA conjugate complex
possesses improved properties while maintaining the ability to
mediate RNAi, for example in animal models as are generally known
in the art.
[0112] In one embodiment, the invention features a short
interfering nucleic acid (siNA) molecule of the invention, wherein
the siNA further comprises a nucleotide, non-nucleotide, or mixed
nucleotide/non-nucleotide linker that joins the sense region of the
siNA to the antisense region of the siNA. In one embodiment, a
nucleotide linker of the invention can be a linker of .gtoreq.2
nucleotides in length, for example about 3, 4, 5, 6, 7, 8, 9, or 10
nucleotides in length. In another embodiment, the nucleotide linker
can be a nucleic acid aptamer. By "aptamer" or "nucleic acid
aptamer" as used herein is meant a nucleic acid molecule that binds
specifically to a target molecule wherein the nucleic acid molecule
has a sequence that comprises a sequence recognized by the target
molecule in its natural setting. Alternately, an aptamer can be a
nucleic acid molecule that binds to a target molecule where the
target molecule does not naturally bind to a nucleic acid. The
target molecule can be any molecule of interest. For example, the
aptamer can be used to bind to a ligand-binding domain of a
protein, thereby preventing interaction of the naturally occurring
ligand with the protein. This is a non-limiting example and those
in the art will recognize that other embodiments can be readily
generated using techniques generally known in the art. (See, for
example, Gold et al., 1995, Annu. Rev. Biochem., 64, 763; Brody and
Gold, 2000, J. Biotechnol., 74, 5; Sun, 2000, Curr. Opin. Mol.
Ther., 2, 100; Kusser, 2000, J. Biotechnol., 74, 27; Hermann and
Patel, 2000, Science, 287, 820; and Jayasena, 1999, Clinical
Chemistry, 45, 1628.)
[0113] In yet another embodiment, a non-nucleotide linker of the
invention comprises abasic nucleotide, polyether, polyamine,
polyamide, peptide, carbohydrate, lipid, polyhydrocarbon, or other
polymeric compounds (e.g. polyethylene glycols such as those having
between 2 and 100 ethylene glycol units). Specific examples include
those described by Seela and Kaiser, Nucleic Acids Res. 1990,
18:6353 and Nucleic Acids Res. 1987, 15:3113; Cload and Schepartz,
J. Am. Chem. Soc. 1991, 113:6324; Richardson and Schepartz, J. Am.
Chem. Soc. 1991, 113:5109; Ma et al., Nucleic Acids Res. 1993,
21:2585 and Biochemistry 1993, 32:1751; Durand et al., Nucleic
Acids Res. 1990, 18:6353; McCurdy et al., Nucleosides &
Nucleotides 1991, 10:287; Jschke et al., Tetrahedron Lett. 1993,
34:301; Ono et al., Biochemistry 1991, 30:9914; Arnold et al.,
International Publication No. WO 89/02439; Usman et al.,
International Publication No. WO 95/06731; Dudycz et al.,
International Publication No. WO 95/11910 and Ferentz and Verdine,
J. Am. Chem. Soc. 1991, 113:4000, all hereby incorporated by
reference herein. A "non-nucleotide" further means any group or
compound that can be incorporated into a nucleic acid chain in the
place of one or more nucleotide units, including either sugar
and/or phosphate substitutions, and allows the remaining bases to
exhibit their enzymatic activity. The group or compound can be
abasic in that it does not contain a commonly recognized nucleotide
base, such as adenosine, guanine, cytosine, uracil or thymine, for
example at the C1 position of the sugar.
[0114] In one embodiment, the invention features a short
interfering nucleic acid (siNA) molecule capable of mediating RNA
interference (RNAi) inside a cell or reconstituted in vitro system,
wherein one or both strands of the siNA molecule that are assembled
from two separate oligonucleotides do not comprise any
ribonucleotides. For example, an siNA molecule can be assembled
from a single oligonucleotide where the sense and antisense regions
of the siNA comprise separate oligonucleotides that do not have any
ribonucleotides (e.g., nucleotides having a 2'-OH group) present in
the oligonucleotides. In another example, an siNA molecule can be
assembled from a single oligonucleotide where the sense and
antisense regions of the siNA are linked or circularized by a
nucleotide or non-nucleotide linker as described herein, wherein
the oligonucleotide does not have any ribonucleotides (e.g.,
nucleotides having a 2'-OH group) present in the oligonucleotide.
Applicant has surprisingly found that the presence of
ribonucleotides (e.g., nucleotides having a 2'-hydroxyl group)
within the siNA molecule is not required or essential to support
RNAi activity. As such, in one embodiment, all positions within the
siNA can include chemically modified nucleotides and/or
non-nucleotides such as nucleotides and or non-nucleotides having
Formula I, II, III, IV, V, VI, or VII or any combination thereof to
the extent that the ability of the siNA molecule to support RNAi
activity in a cell is maintained.
[0115] In one embodiment, an siNA molecule of the invention is a
single stranded siNA molecule that mediates RNAi activity in a cell
or reconstituted in vitro system comprising a single stranded
polynucleotide having complementarity to a target nucleic acid
sequence. In another embodiment, the single stranded siNA molecule
of the invention comprises a 5'-terminal phosphate group. In
another embodiment, the single stranded siNA molecule of the
invention comprises a 5'-terminal phosphate group and a 3'-terminal
phosphate group (e.g., a 2',3'-cyclic phosphate). In another
embodiment, the single stranded siNA molecule of the invention
comprises about 19 to about 29 (e.g., about 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, or 29) nucleotides. In yet another embodiment, the
single stranded siNA molecule of the invention comprises one or
more chemically modified nucleotides or non-nucleotides described
herein. For example, all the positions within the siNA molecule can
include chemically modified nucleotides such as nucleotides having
any of Formulae I-VII, or any combination thereof to the extent
that the ability of the siNA molecule to support RNAi activity in a
cell is maintained.
[0116] In one embodiment, an siNA molecule of the invention is a
single stranded siNA molecule that mediates RNAi activity in a cell
or reconstituted in vitro system comprising a single stranded
polynucleotide having complementarity to a target nucleic acid
sequence, wherein one or more pyrimidine nucleotides present in the
siNA are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein
all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any
purine nucleotides present in the antisense region are 2'-O-methyl
purine nucleotides (e.g., wherein all purine nucleotides are
2'-O-methyl purine nucleotides or alternately a plurality of purine
nucleotides are 2'-O-methyl purine nucleotides), and a terminal cap
modification, such as any modification described herein or shown in
FIG. 10, that is optionally present at the 3'-end, the 5'-end, or
both of the 3' and 5'-ends of the antisense sequence. The siNA
optionally further comprises about 1 to about 4 or more (e.g.,
about 1, 2, 3, 4 or more) terminal 2'-deoxynucleotides at the
3'-end of the siNA molecule, wherein the terminal nucleotides can
further comprise one or more (e.g., 1, 2, 3, 4 or more)
phosphorothioate, phosphonoacetate, and/or thiophosphonoacetate
internucleotide linkages, and wherein the siNA optionally further
comprises a terminal phosphate group, such as a 5'-terminal
phosphate group. In any of these embodiments, any purine
nucleotides present in the antisense region are alternatively
2'-deoxy purine nucleotides (e.g., wherein all purine nucleotides
are 2'-deoxy purine nucleotides or alternately a plurality of
purine nucleotides are 2'-deoxy purine nucleotides). Also, in any
of these embodiments, any purine nucleotides present in the siNA
(i.e., purine nucleotides present in the sense and/or antisense
region) can alternatively be locked nucleic acid (LNA) nucleotides
(e.g., wherein all purine nucleotides are LNA nucleotides or
alternately a plurality of purine nucleotides are LNA nucleotides).
Also, in any of these embodiments, any purine nucleotides present
in the siNA are alternatively 2'-methoxyethyl purine nucleotides
(e.g., wherein all purine nucleotides are 2'-methoxyethyl purine
nucleotides or alternately a plurality of purine nucleotides are
2'-methoxyethyl purine nucleotides). In another embodiment, any
modified nucleotides present in the single stranded siNA molecules
of the invention comprise modified nucleotides having properties or
characteristics similar to naturally occurring ribonucleotides. For
example, the invention features siNA molecules including modified
nucleotides having a Northern conformation (e.g., Northern
pseudorotation cycle, see for example Saenger, Principles of
Nucleic Acid Structure, Springer-Verlag ed., 1984). As such,
chemically modified nucleotides present in the single stranded siNA
molecules of the invention are preferably resistant to nuclease
degradation while at the same time maintaining the capacity to
mediate RNAi.
[0117] In one embodiment, the invention features a method for
modulating the expression of a myostatin gene within a cell
comprising: (a) synthesizing an siNA molecule of the invention,
which can be chemically modified, wherein one of the siNA strands
comprises a sequence complementary to RNA of the myostatin gene;
and (b) introducing the siNA molecule into a cell under conditions
suitable to modulate the expression of the myostatin gene in the
cell.
[0118] In one embodiment, the invention features a method for
modulating the expression of a myostatin gene within a cell
comprising: (a) synthesizing an siNA molecule of the invention,
which can be chemically modified, wherein one of the siNA strands
comprises a sequence complementary to RNA of the myostatin gene and
wherein the sense strand sequence of the siNA comprises a sequence
identical or substantially similar to the sequence of the target
RNA; and (b) introducing the siNA molecule into a cell under
conditions suitable to modulate the expression of the myostatin
gene in the cell.
[0119] In another embodiment, the invention features a method for
modulating the expression of more than one myostatin gene within a
cell comprising: (a) synthesizing siNA molecules of the invention,
which can be chemically modified, wherein one of the siNA strands
comprises a sequence complementary to RNA of the myostatin genes;
and (b) introducing the siNA molecules into a cell under conditions
suitable to modulate the expression of the myostatin genes in the
cell.
[0120] In another embodiment, the invention features a method for
modulating the expression of two or more myostatin genes within a
cell comprising: (a) synthesizing one or more siNA molecules of the
invention, which can be chemically modified, wherein the siNA
strands comprise sequences complementary to RNA of the myostatin
genes and wherein the sense strand sequences of the siNAs comprise
sequences identical or substantially similar to the sequences of
the target RNAs; and (b) introducing the siNA molecules into a cell
under conditions suitable to modulate the expression of the
myostatin genes in the cell.
[0121] In another embodiment, the invention features a method for
modulating the expression of more than one myostatin gene within a
cell comprising: (a) synthesizing an siNA molecule of the
invention, which can be chemically modified, wherein one of the
siNA strands comprises a sequence complementary to RNA of the
myostatin gene and wherein the sense strand sequence of the siNA
comprises a sequence identical or substantially similar to the
sequences of the target RNAs; and (b) introducing the siNA molecule
into a cell under conditions suitable to modulate the expression of
the myostatin genes in the cell.
[0122] In one embodiment, siNA molecules of the invention are used
as reagents in ex vivo applications. For example, siNA reagents are
introduced into tissue or cells that are transplanted into a
subject for therapeutic effect. The cells and/or tissue can be
derived from an organism or subject that later receives the
explant, or can be derived from another organism or subject prior
to transplantation. The siNA molecules can be used to modulate the
expression of one or more genes in the cells or tissue, such that
the cells or tissue obtain a desired phenotype or are able to
perform a function when transplanted in vivo. In one embodiment,
certain target cells from a patient are extracted. These extracted
cells are contacted with siNAs targeting a specific nucleotide
sequence within the cells under conditions suitable for uptake of
the siNAs by these cells (e.g. using delivery reagents such as
cationic lipids, liposomes and the like or using techniques such as
electroporation to facilitate the delivery of siNAs into cells).
The cells are then reintroduced back into the same patient or other
patients. In one embodiment, the invention features a method of
modulating the expression of a myostatin gene in a tissue explant
comprising: (a) synthesizing an siNA molecule of the invention,
which can be chemically modified, wherein one of the siNA strands
comprises a sequence complementary to RNA of the myostatin gene;
and (b) introducing the siNA molecule into a cell of the tissue
explant derived from a particular organism under conditions
suitable to modulate the expression of the myosiatin gene in the
tissue explant. In another embodiment, the method further comprises
introducing the tissue explant back into the organism the tissue
was derived from or into another organism under conditions suitable
to modulate the expression of the myostatin gene in that
organism.
[0123] In one embodiment, the invention features a method of
modulating the expression of a myostatin gene in a tissue explant
comprising: (a) synthesizing an siNA molecule of the invention,
which can be chemically modified, wherein one of the siNA strands
comprises a sequence complementary to RNA of the myostatin gene and
wherein the sense strand sequence of the siNA comprises a sequence
identical or substantially similar to the sequence of the target
RNA; and (b) introducing the siNA molecule into a cell of the
tissue explant derived from a particular organism under conditions
suitable to modulate the expression of the myostatin gene in the
tissue explant. In another embodiment, the method further comprises
introducing the tissue explant back into the organism the tissue
was derived from or into another organism under conditions suitable
to modulate the expression of the myostatin gene in that
organism.
[0124] In another embodiment, the invention features a method of
modulating the expression of more than one myostatin gene in a
tissue explant comprising: (a) synthesizing siNA molecules of the
invention, which can be chemically modified, wherein one of the
siNA strands comprises a sequence complementary to RNA of the
myostatin genes; and (b) introducing the siNA molecules into a cell
of the tissue explant derived from a particular organism under
conditions suitable to modulate the expression of the myostatin
genes in the tissue explant. In another embodiment, the method
further comprises introducing the tissue explant back into the
organism the tissue was derived from or into another organism under
conditions suitable to modulate the expression of the myostatin
genes in that organism.
[0125] In one embodiment, the invention features a method of
modulating the expression of a myostatin gene in a subject or
organism comprising: (a) synthesizing an siNA molecule of the
invention, which can be chemically modified, wherein one of the
siNA strands comprises a sequence complementary to RNA of the
myostatin gene; and (b) introducing the siNA molecule into the
subject or organism under conditions suitable to modulate the
expression of the myostatin gene in the subject or organism. The
level of myostatin protein or RNA can be determined using various
methods well-known in the art.
[0126] In another embodiment, the invention features a method of
modulating the expression of more than one myostatin gene in a
subject or organism comprising: (a) synthesizing siNA molecules of
the invention, which can be chemically modified, wherein one of the
siNA strands comprises a sequence complementary to RNA of the
myostatin genes; and (b) introducing the siNA molecules into the
subject or organism under conditions suitable to modulate the
expression of the myostatin genes in the subject or organism. The
level of myostatin protein or RNA can be determined as is known in
the art.
[0127] In one embodiment, the invention features a method for
modulating the expression of a myostatin gene within a cell
comprising: (a) synthesizing an siNA molecule of the invention,
which can be chemically modified, wherein the siNA comprises a
single stranded sequence having complementarity to RNA of the
myostatin gene; and (b) introducing the siNA molecule into a cell
under conditions suitable to modulate the expression of the
myostatin gene in the cell.
[0128] In another embodiment, the invention features a method for
modulating the expression of more than one myostatin gene within a
cell comprising: (a) synthesizing siNA molecules of the invention,
which can be chemically modified, wherein the siNA comprises a
single stranded sequence having complementarity to RNA of the
myostatin gene; and (b) contacting the cell in vitro or in vivo
with the siNA molecule under conditions suitable to modulate the
expression of the myostatin genes in the cell.
[0129] In one embodiment, the invention features a method of
modulating the expression of a myostatin gene in a tissue explant
comprising: (a) synthesizing an siNA molecule of the invention,
which can be chemically modified, wherein the siNA comprises a
single stranded sequence having complementarity to RNA of the
myostatin gene; and (b) contacting a cell of the tissue explant
derived from a particular organism with the siNA molecule under
conditions suitable to modulate the expression of the myostatin
gene in the tissue explant. In another embodiment, the method
further comprises introducing the tissue explant back into the
organism the tissue was derived from or into another organism under
conditions suitable to modulate the expression of the myostatin
gene in that organism.
[0130] In another embodiment, the invention features a method of
modulating the expression of more than one myostatin gene in a
tissue explant comprising: (a) synthesizing siNA molecules of the
invention, which can be chemically modified, wherein the siNA
comprises a single stranded sequence having complementarity to RNA
of the myostatin gene; and (b) introducing the siNA molecules into
a cell of the tissue explant derived from a particular organism
under conditions suitable to modulate the expression of the
myostatin genes in the tissue explant. In another embodiment, the
method further comprises introducing the tissue explant back into
the organism the tissue was derived from or into another organism
under conditions suitable to modulate the expression of the
myostatin genes in that organism.
[0131] In one embodiment, the invention features a method of
modulating the expression of a myostatin gene in a subject or
organism comprising: (a) synthesizing an siNA molecule of the
invention, which can be chemically modified, wherein the siNA
comprises a single stranded sequence having complementarity to RNA
of the myostatin gene; and (b) introducing the siNA molecule into
the subject or organism under conditions suitable to modulate the
expression of the myostatin gene in the subject or organism.
[0132] In another embodiment, the invention features a method of
modulating the expression of more than one myostatin gene in a
subject or organism comprising: (a) synthesizing siNA molecules of
the invention, which can be chemically modified, wherein the siNA
comprises a single stranded sequence having complementarity to RNA
of the myostatin gene; and (b) introducing the siNA molecules into
the subject or organism under conditions suitable to modulate the
expression of the myostatin genes in the subject or organism.
[0133] In one embodiment, the invention features a method of
modulating the expression of a myostatin gene in a subject or
organism comprising contacting the subject or organism with an siNA
molecule of the invention under conditions suitable to modulate the
expression of the myostatin gene in the subject or organism.
[0134] In one embodiment, the invention features a method for
preventing or treating diseases and conditions associated with
muscle atrophy, weakness and/or degeneration, such as muscular
dystrophy, myotonic dystrophy, myotonia congentia, poliomyelitis,
amyotrophic lateral sclerosis (ALS or Lou Gehrig's disease),
Guillain-Barre syndrome, muscle wasting (e.g., age or HIV related),
sarcopenia, myalgias, myopathies, hypotonis, hypotonia, cachexia,
spinal cord injury, or muscle injury in a subject or organism
comprising contacting the subject or organism with an siNA molecule
of the invention under conditions suitable to modulate the
expression of a myostatin gene in the subject or organism. In one
embodiment, the siNA is administered to the subject or organism
prophylactically to prevent, inhibit or reduce muscle atrophy,
weakness and/or degeneration associated with muscular dystrophy,
myotonic dystrophy, myotonia congentia, poliomyelitis, amyotrophic
lateral sclerosis (ALS or Lou Gehrig's disease), Guillain-Barre
syndrome, muscle wasting, sarcopenia, myalgias, myopathies,
hypotonis, cachexia, spinal cord injury, or muscle injury in the
subject or organism.
[0135] In one embodiment, the invention features a method for
preventing or treating obesity, diabetes (e.g., type I and type
II), and insulin resistance in a subject or organism comprising
contacting the subject or organism with an siNA molecule of the
invention under conditions suitable to modulate the expression of a
myostatin gene in the subject or organism.
[0136] In one embodiment, the invention features a method for
preventing or treating muscular dystrophy (e.g., Becker's muscular
dystrophy, Duchenne muscular dystrophy, facioscapulohumeral
muscular dystrophy, limb-girdle muscular dystrophy, Emery-Dreifuss
muscular dystrophy, myotonic dystrophy, or myotonia congenita) in a
subject or organism comprising contacting the subject or organism
with an siNA molecule of the invention under conditions suitable to
modulate the expression of a myostatin gene in the subject or
organism. In one embodiment, the siNA is administered to the
subject or organism prophylactically to prevent, inhibit or reduce
muscular atrophy, muscle wasting (e.g., age or HIV related), muscle
degradation and/or muscle weakness associated with muscular
dystrophy. In one embodiment, the siNA is administered to the
subject or organism therapeutically to prevent, inhibit, reduce, or
reverse muscular atrophy, muscle wasting (e.g., age or HIV
related), muscle degradation and/or muscle weakness associated with
muscular dystrophy.
[0137] In one embodiment, the invention features a method for
preventing or treating muscle wasting disease or sarcopenia (e.g.,
age or HIV related) in a subject or organism comprising contacting
the subject or organism with an siNA molecule of the invention
under conditions suitable to modulate the expression of a myostatin
gene in the subject or organism.
[0138] In one embodiment, the invention features a method for
preventing or treating poliomyelitis in a subject or organism
comprising contacting the subject or organism with an siNA molecule
of the invention under conditions suitable to modulate the
expression of a myostatin gene in the subject or organism.
[0139] In one embodiment, the invention features a method for
preventing or treating amyotrophic lateral sclerosis (ALS or Lou
Gehrig's disease) in a subject or organism comprising contacting
the subject or organism with an siNA molecule of the invention
under conditions suitable to modulate the expression of a myostatin
gene in the subject or organism.
[0140] In one embodiment, the invention features a method for
preventing or treating Guillain-Barre syndrome in a subject or
organism comprising contacting the subject or organism with an siNA
molecule of the invention under conditions suitable to modulate the
expression of a myostatin gene in the subject or organism.
[0141] In one embodiment, the invention features a method for
preventing or treating myalgia (e.g., polymyalgia, fibromyalgia) in
a subject or organism comprising contacting the subject or organism
with an siNA molecule of the invention under conditions suitable to
modulate the expression of a myostatin gene in the subject or
organism.
[0142] In one embodiment, the invention features a method for
preventing or treating myopathy (e.g., Mitochondrial myopathies,
Myotubular Myopathy, Nemaline Myopathy, Multicore Myopathy,
Cardiomyopathy, Dermatomyositis, Inclusion Body Myositis) in a
subject or organism comprising contacting the subject or organism
with an siNA molecule of the invention under conditions suitable to
modulate the expression of a myostatin gene in the subject or
organism.
[0143] In one embodiment, the invention features a method for
preventing or treating hypotonis or hypotonia in a subject or
organism comprising contacting the subject or organism with an siNA
molecule of the invention under conditions suitable to modulate the
expression of a myostatin gene in the subject or organism.
[0144] In one embodiment, the invention features a method for
preventing or treating cachexia in a subject or organism comprising
contacting the subject or organism with an siNA molecule of the
invention under conditions suitable to modulate the expression of a
myostatin gene in the subject or organism.
[0145] In one embodiment, the invention features a method for
preventing or treating muscle atrophy associated with spinal cord
injury in a subject or organism comprising contacting the subject
or organism with an siNA molecule of the invention under conditions
suitable to modulate the expression of a myostatin gene in the
subject or organism.
[0146] In one embodiment, the invention features a method for
preventing or treating muscle injury in a subject or organism
comprising contacting the subject or organism with an siNA molecule
of the invention under conditions suitable to modulate the
expression of a myostatin gene in the subject or organism.
[0147] In one embodiment, the invention features a method for
inducing or promoting muscle hypertrophy in a subject or organism
comprising contacting the subject or organism with an siNA molecule
of the invention under conditions suitable to modulate the
expression of a myostatin gene in the subject or organism.
[0148] In one embodiment, the invention features a method for
inducing or promoting muscle strength in a subject or organism
comprising contacting the subject or organism with an siNA molecule
of the invention under conditions suitable to modulate the
expression of a myostatin gene in the subject or organism.
[0149] In one embodiment, the invention features a method for
improving athletic performance in a subject or organism comprising
contacting the subject or organism with an siNA molecule of the
invention under conditions suitable to modulate the expression of a
myostatin gene in the subject or organism.
[0150] In one embodiment, the invention features a method for
preventing muscle atrophy in an astronaut subject comprising
contacting the subject with an siNA molecule of the invention under
conditions suitable to modulate the expression of a myostatin gene
in the subject or organism.
[0151] In one embodiment, the invention features a method for
inducing muscle hyperthropy in livestock organisms (e.g., cattle,
swine, and/or poultry) comprising contacting the organism with an
siNA molecule of the invention under conditions suitable to
modulate the expression of a myostatin gene in the subject or
organism.
[0152] In another embodiment, the invention features a method of
modulating the expression of more than one myostatin genes in a
subject or organism comprising contacting the subject or organism
with one or more siNA molecules of the invention under conditions
suitable to modulate the expression of the myostatin genes in the
subject or organism.
[0153] The siNA molecules of the invention can be designed to down
regulate or inhibit target (e.g., myostatin) gene expression
through RNAi targeting of a variety of RNA molecules. In one
embodiment, the siNA molecules of the invention are used to target
various RNAs corresponding to a target gene. Non-limiting examples
of such RNAs include messenger RNA (mRNA), alternate RNA splice
variants of target gene(s), post-transcriptionally modified RNA of
target gene(s), pre-mRNA of target gene(s), and/or RNA templates.
If alternate splicing produces a family of transcripts that are
distinguished by usage of appropriate exons, the instant invention
can be used to inhibit gene expression through the appropriate
exons to specifically inhibit or to distinguish among the functions
of gene family members. For example, a protein that contains an
alternatively spliced transmembrane domain can be expressed in both
membrane bound and secreted forms. Use of the invention to target
the exon containing the transmembrane domain can be used to
determine the functional consequences of pharmaceutical targeting
of membrane bound as opposed to the secreted form of the protein.
Non-limiting examples of applications of the invention relating to
targeting these RNA molecules include therapeutic pharmaceutical
applications, pharmaceutical discovery applications, molecular
diagnostic and gene function applications, and gene mapping, for
example using single nucleotide polymorphism mapping with siNA
molecules of the invention. Such applications can be implemented
using known gene sequences or from partial sequences available from
an expressed sequence tag (EST).
[0154] In another embodiment, the siNA molecules of the invention
are used to target conserved sequences corresponding to a gene
family or gene families such as myostatin family genes. As such,
siNA molecules targeting multiple myostatin targets can provide
increased therapeutic effect. In addition, siNA can be used to
characterize pathways of gene function in a variety of
applications. For example, the present invention can be used to
inhibit the activity of target gene(s) in a pathway to determine
the function of uncharacterized gene(s) in gene function analysis,
mRNA function analysis, or translational analysis. The invention
can be used to determine potential target gene pathways involved in
various diseases and conditions toward pharmaceutical development.
The invention can be used to understand pathways of gene expression
involved in, for example, muscle hypertrophy, muscle atrophy,
degradation, or weakness.
[0155] In one embodiment, siNA molecule(s) and/or methods of the
invention are used to down regulate the expression of gene(s) that
encode RNA referred to by Genbank Accession Nos., for example,
myostatin genes encoding RNA sequence(s) referred to herein by
Genbank Accession number, for example, Genbank Accession Nos. shown
in Table I.
[0156] In one embodiment, the invention features a method
comprising: (a) generating a library of siNA constructs having a
predetermined complexity; and (b) assaying the siNA constructs of
(a) above, under conditions suitable to determine RNAi target sites
within the target RNA sequence. In one embodiment, the siNA
molecules of (a) have strands of a fixed length, for example, about
23 nucleotides in length. In another embodiment, the siNA molecules
of (a) are of differing length, for example having strands of about
19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25)
nucleotides in length. In one embodiment, the assay can comprise a
reconstituted in vitro siNA assay as described herein. In another
embodiment, the assay can comprise a cell culture system in which
target RNA is expressed. In another embodiment, fragments of target
RNA are analyzed for detectable levels of cleavage, for example by
gel electrophoresis, Northern blot analysis, or RNAse protection
assays, to determine the most suitable target site(s) within the
target RNA sequence. The target RNA sequence can be obtained as is
known in the art, for example, by cloning and/or transcription for
in vitro systems, and by cellular expression in in vivo
systems.
[0157] In one embodiment, the invention features a method
comprising: (a) generating a randomized library of siNA constructs
having a predetermined complexity, such as of 4.sup.N, where N
represents the number of base paired nucleotides in each of the
siNA construct strands (e.g., for an siNA construct having 21
nucleotide sense and antisense strands with 19 base pairs, the
complexity would be 4.sup.19); and (b) assaying the siNA constructs
of (a) above, under conditions suitable to determine RNAi target
sites within the target myostatin RNA sequence. In another
embodiment, the siNA molecules of (a) have strands of a fixed
length, for example about 23 nucleotides in length. In yet another
embodiment, the siNA molecules of (a) are of differing length, for
example having strands of about 19 to about 25 (e.g., about 19, 20,
21, 22, 23, 24, or 25) nucleotides in length. In one embodiment,
the assay can comprise a reconstituted in vitro siNA assay as
described in Example 7 herein. In another embodiment, the assay can
comprise a cell culture system in which target RNA is expressed. In
another embodiment, fragments of myostatin RNA are analyzed for
detectable levels of cleavage, for example, by gel electrophoresis,
Northern blot analysis, or RNAse protection assays, to determine
the most suitable target site(s) within the target myostatin RNA
sequence. The target myostatin RNA sequence can be obtained as is
known in the art, for example, by cloning and/or transcription for
in vitro systems, and by cellular expression in in vivo
systems.
[0158] In another embodiment, the invention features a method
comprising: (a) analyzing the sequence of a RNA target encoded by a
target gene; (b) synthesizing one or more sets of siNA molecules
having sequence complementary to one or more regions of the RNA of
(a); and (c) assaying the siNA molecules of (b) under conditions
suitable to determine RNAi targets within the target RNA sequence.
In one embodiment, the siNA molecules of (b) have strands of a
fixed length, for example about 23 nucleotides in length. In
another embodiment, the siNA molecules of (b) are of differing
length, for example having strands of about 19 to about 25 (e.g.,
about 19, 20, 21, 22, 23, 24, or 25) nucleotides in length. In one
embodiment, the assay can comprise a reconstituted in vitro siNA
assay as described herein. In another embodiment, the assay can
comprise a cell culture system in which target RNA is expressed.
Fragments of target RNA are analyzed for detectable levels of
cleavage, for example by gel electrophoresis, Northern blot
analysis, or RNAse protection assays, to determine the most
suitable target site(s) within the target RNA sequence. The target
RNA sequence can be obtained as is known in the art, for example,
by cloning and/or transcription for in vitro systems, and by
expression in in vivo systems.
[0159] By "target site" is meant a sequence within a target RNA
that is "targeted" for cleavage mediated by an siNA construct which
contains sequences within its antisense region that are
complementary to the target sequence.
[0160] By "detectable level of cleavage" is meant cleavage of
target RNA (and formation of cleaved product RNAs) to an extent
sufficient to discern cleavage products above the background of
RNAs produced by random degradation of the target RNA. Production
of cleavage products from 1-5% of the target RNA is sufficient to
detect above the background for most methods of detection.
[0161] In one embodiment, the invention features a composition
comprising an siNA molecule of the invention, which can be
chemically modified, in a pharmaceutically acceptable carrier or
diluent. In another embodiment, the invention features a
pharmaceutical composition comprising siNA molecules of the
invention, which can be chemically modified, targeting one or more
genes in a pharmaceutically acceptable carrier or diluent. In
another embodiment, the invention features a method for diagnosing
a disease or condition in a subject comprising administering to the
subject a composition of the invention under conditions suitable
for the diagnosis of the disease or condition in the subject. In
another embodiment, the invention features a method for treating or
preventing a disease, trait or condition in a subject, comprising
administering to the subject a composition of the invention under
conditions suitable for the treatment or prevention of the disease,
trait, or condition in the subject, alone or in conjunction with
one or more other therapeutic compounds. In yet another embodiment,
the invention features a method for preventing or treating
myopathic diseases, injuries, or conditions in a subject comprising
administering to the subject a composition of the invention under
conditions suitable for the prevention or treatment of the
myopathic disease, injury, or condition in the subject.
[0162] In another embodiment, the invention features a method for
validating a myostatin gene target, comprising: (a) synthesizing an
siNA molecule of the invention, which can be chemically modified,
wherein one of the siNA strands includes a sequence complementary
to RNA of a myostatin target gene; (b) introducing the siNA
molecule into a cell, tissue, or organism under conditions suitable
for modulating expression of the myostatin target gene in the cell,
tissue, or organism; and (c) determining the function of the gene
by assaying for any phenotypic change in the cell, tissue, or
organism.
[0163] In another embodiment, the invention features a method for
validating a myostatin target comprising: (a) synthesizing an siNA
molecule of the invention, which can be chemically modified,
wherein one of the siNA strands includes a sequence complementary
to RNA of a myostatin target gene; (b) introducing the siNA
molecule into a biological system under conditions suitable for
modulating expression of the myostatin target gene in the
biological system; and (c) determining the function of the gene by
assaying for any phenotypic change in the biological system.
[0164] By "biological system" is meant, material, in a purified or
unpurified form, from biological sources, including but not limited
to human or animal, wherein the system comprises the components
required for RNAi activity. The term "biological system" includes,
for example, a cell, tissue, or organism, or extract thereof. The
term biological system also includes reconstituted RNAi systems
that can be used in an in vitro setting.
[0165] By "phenotypic change" is meant any detectable change to a
cell that occurs in response to contact or treatment with a nucleic
acid molecule of the invention (e.g., siNA). Such detectable
changes include, but are not limited to, changes in shape, size,
apoptosis, proliferation, motility, protein expression or RNA
expression or other physical or chemical changes as can be assayed
by methods known in the art. The detectable change can also include
expression of reporter genes/molecules such as Green Florescent
Protein (GFP) or various tags that are used to identify an
expressed protein or any other cellular component that can be
assayed.
[0166] In one embodiment, the invention features a kit containing
an siNA molecule of the invention, which can be chemically
modified, that can be used to modulate the expression of a
myostatin target gene in a biological system, including, for
example, in a cell, tissue, or organism. In another embodiment, the
invention features a kit containing more than one siNA molecule of
the invention, which can be chemically modified, that can be used
to modulate the expression of more than one myostatin target gene
in a biological system, including, for example, in a cell, tissue,
or organism.
[0167] In one embodiment, the invention features a cell containing
one or more siNA molecules of the invention, which can be
chemically modified. In another embodiment, the cell containing an
siNA molecule of the invention is a mammalian cell. In yet another
embodiment, the cell containing an siNA molecule of the invention
is a human cell.
[0168] In one embodiment, the synthesis of an siNA molecule of the
invention, which can be chemically modified, comprises: (a)
synthesis of two complementary strands of the siNA molecule; (b)
annealing the two complementary strands together under conditions
suitable to obtain a double stranded siNA molecule. In another
embodiment, synthesis of the two complementary strands of the siNA
molecule is by solid phase oligonucleotide synthesis. In yet
another embodiment, synthesis of the two complementary strands of
the siNA molecule is by solid phase tandem oligonucleotide
synthesis.
[0169] In one embodiment, the invention features a method for
synthesizing an siNA duplex molecule comprising: (a) synthesizing a
first oligonucleotide sequence strand of the siNA molecule, wherein
the first oligonucleotide sequence strand comprises a cleavable
linker molecule that can be used as a scaffold for the synthesis of
the second oligonucleotide sequence strand of the siNA; (b)
synthesizing the second oligonucleotide sequence strand of siNA on
the scaffold of the first oligonucleotide sequence strand, wherein
the second oligonucleotide sequence strand further comprises a
chemical moiety than can be used to purify the siNA duplex; (c)
cleaving the linker molecule of (a) under conditions suitable for
the two siNA oligonucleotide strands to hybridize and form a stable
duplex; and (d) purifying the siNA duplex utilizing the chemical
moiety of the second oligonucleotide sequence strand. In one
embodiment, cleavage of the linker molecule in (c) above takes
place during deprotection of the oligonucleotide, for example,
under hydrolysis conditions using an alkylamine base such as
methylamine. In one embodiment, the method of synthesis comprises
solid phase synthesis on a solid support such as controlled pore
glass (CPG) or polystyrene, wherein the first sequence of (a) is
synthesized on a cleavable linker, such as a succinyl linker, using
the solid support as a scaffold. The cleavable linker in (a) used
as a scaffold for synthesizing the second strand can comprise
similar reactivity as the solid support derivatized linker, such
that cleavage of the solid support derivatized linker and the
cleavable linker of (a) takes place concomitantly. In another
embodiment, the chemical moiety of (b) that can be used to isolate
the attached oligonucleotide sequence comprises a trityl group, for
example a dimethoxytrityl group, which can be employed in a
trityl-on synthesis strategy as described herein. In yet another
embodiment, the chemical moiety, such as a dimethoxytrityl group,
is removed during purification, for example, using acidic
conditions.
[0170] In a further embodiment, the method for siNA synthesis is a
solution phase synthesis or hybrid phase synthesis wherein both
strands of the siNA duplex are synthesized in tandem using a
cleavable linker attached to the first sequence which acts a
scaffold for synthesis of the second sequence. Cleavage of the
linker under conditions suitable for hybridization of the separate
siNA sequence strands results in formation of the double stranded
siNA molecule.
[0171] In another embodiment, the invention features a method for
synthesizing an siNA duplex molecule comprising: (a) synthesizing
one oligonucleotide sequence strand of the siNA molecule, wherein
the sequence comprises a cleavable linker molecule that can be used
as a scaffold for the synthesis of another oligonucleotide
sequence; (b) synthesizing a second oligonucleotide sequence having
complementarity to the first sequence strand on the scaffold of
(a), wherein the second sequence comprises the other strand of the
double stranded siNA molecule and wherein the second sequence
further comprises a chemical moiety than can be used to isolate the
attached oligonucleotide sequence; (c) purifying the product of (b)
utilizing the chemical moiety of the second oligonucleotide
sequence strand under conditions suitable for isolating the
full-length sequence comprising both siNA oligonucleotide strands
connected by the cleavable linker and under conditions suitable for
the two siNA oligonucleotide strands to hybridize and form a stable
duplex. In one embodiment, cleavage of the linker molecule in (c)
above takes place during deprotection of the oligonucleotide, for
example, under hydrolysis conditions. In another embodiment,
cleavage of the linker molecule in (c) above takes place after
deprotection of the oligonucleotide. In another embodiment, the
method of synthesis comprises solid phase synthesis on a solid
support such as controlled pore glass (CPG) or polystyrene, wherein
the first sequence of (a) is synthesized on a cleavable linker,
such as a succinyl linker, using the solid support as a scaffold.
The cleavable linker in (a) used as a scaffold for synthesizing the
second strand can comprise similar reactivity or differing
reactivity as the solid support derivatized linker, such that
cleavage of the solid support derivatized linker and the cleavable
linker of (a) takes place either concomitantly or sequentially. In
one embodiment, the chemical moiety of (b) that can be used to
isolate the attached oligonucleotide sequence comprises a trityl
group, for example a dimethoxytrityl group.
[0172] In another embodiment, the invention features a method for
making a double stranded siNA molecule in a single synthetic
process comprising: (a) synthesizing an oligonucleotide having a
first and a second sequence, wherein the first sequence is
complementary to the second sequence, and the first oligonucleotide
sequence is linked to the second sequence via a cleavable linker,
and wherein a terminal 5'-protecting group, for example, a
5'-O-dimethoxytrityl group (5'-O-DMT) remains on the
oligonucleotide having the second sequence; (b) deprotecting the
oligonucleotide whereby the deprotection results in the cleavage of
the linker joining the two oligonucleotide sequences; and (c)
purifying the product of (b) under conditions suitable for
isolating the double stranded siNA molecule, for example using a
trityl-on synthesis strategy as described herein.
[0173] In another embodiment, the method of synthesis of siNA
molecules of the invention comprises the teachings of Scaringe et
al., U.S. Pat. Nos. 5,889,136; 6,008,400; and 6,111,086,
incorporated by reference herein in their entirety.
[0174] In one embodiment, the invention features siNA constructs
that mediate RNAi against myostatin, wherein the siNA construct
comprises one or more chemical modifications, for example, one or
more chemical modifications having any of Formulae I-VII or any
combination thereof that increases the nuclease resistance of the
siNA construct.
[0175] In another embodiment, the invention features a method for
generating siNA molecules with increased nuclease resistance
comprising (a) introducing nucleotides having any of Formula I-VII
or any combination thereof into an siNA molecule, and (b) assaying
the siNA molecule of step (a) under conditions suitable for
isolating siNA molecules having increased nuclease resistance.
[0176] In one embodiment, the invention features siNA constructs
that mediate RNAi against myostatin, wherein the siNA construct
comprises one or more chemical modifications described herein that
modulates the binding affinity between the sense and antisense
strands of the siNA construct.
[0177] In another embodiment, the invention features a method for
generating siNA molecules with increased binding affinity between
the sense and antisense strands of the siNA molecule comprising (a)
introducing nucleotides having any of Formula I-VII or any
combination thereof into an siNA molecule, and (b) assaying the
siNA molecule of step (a) under conditions suitable for isolating
siNA molecules having increased binding affinity between the sense
and antisense strands of the siNA molecule.
[0178] In one embodiment, the invention features siNA constructs
that mediate RNAi against myostatin, wherein the siNA construct
comprises one or more chemical modifications described herein that
modulates the binding affinity between the antisense strand of the
siNA construct and a complementary target RNA sequence within a
cell.
[0179] In one embodiment, the invention features siNA constructs
that mediate RNAi against myostatin, wherein the siNA construct
comprises one or more chemical modifications described herein that
modulates the binding affinity between the antisense strand of the
siNA construct and a complementary target DNA sequence within a
cell.
[0180] In another embodiment, the invention features a method for
generating siNA molecules with increased binding affinity between
the antisense strand of the siNA molecule and a complementary
target RNA sequence comprising (a) introducing nucleotides having
any of Formula I-VII or any combination thereof into an siNA
molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules having increased
binding affinity between the antisense strand of the siNA molecule
and a complementary target RNA sequence.
[0181] In another embodiment, the invention features a method for
generating siNA molecules with increased binding affinity between
the antisense strand of the siNA molecule and a complementary
target DNA sequence comprising (a) introducing nucleotides having
any of Formula I-VII or any combination thereof into an siNA
molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules having increased
binding affinity between the antisense strand of the siNA molecule
and a complementary target DNA sequence.
[0182] In one embodiment, the invention features siNA constructs
that mediate RNAi against myostatin, wherein the siNA construct
comprises one or more chemical modifications described herein that
modulate the polymerase activity of a cellular polymerase capable
of generating additional endogenous siNA molecules having sequence
homology to the chemically modified siNA construct.
[0183] In another embodiment, the invention features a method for
generating siNA molecules capable of mediating increased polymerase
activity of a cellular polymerase capable of generating additional
endogenous siNA molecules having sequence homology to a chemically
modified siNA molecule comprising (a) introducing nucleotides
having any of Formula I-VII or any combination thereof into an siNA
molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules capable of
mediating increased polymerase activity of a cellular polymerase
capable of generating additional endogenous siNA molecules having
sequence homology to the chemically modified siNA molecule.
[0184] In one embodiment, the invention features chemically
modified siNA constructs that mediate RNAi against myostatin in a
cell, wherein the chemical modifications do not significantly
effect the interaction of siNA with a target RNA molecule, DNA
molecule and/or proteins or other factors that are essential for
RNAi in a manner that would decrease the efficacy of RNAi mediated
by such siNA constructs.
[0185] In another embodiment, the invention features a method for
generating siNA molecules with improved RNAi activity against
myostatin comprising (a) introducing nucleotides having any of
Formula I-VII or any combination thereof into an siNA molecule, and
(b) assaying the siNA molecule of step (a) under conditions
suitable for isolating siNA molecules having improved RNAi
activity.
[0186] In yet another embodiment, the invention features a method
for generating siNA molecules with improved RNAi activity against
myostatin target RNA comprising (a) introducing nucleotides having
any of Formula I-VII or any combination thereof into an siNA
molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules having improved
RNAi activity against the target RNA.
[0187] In yet another embodiment, the invention features a method
for generating siNA molecules with improved RNAi activity against
myostatin target DNA comprising (a) introducing nucleotides having
any of Formula I-VII or any combination thereof into an siNA
molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules having improved
RNAi activity against the target DNA.
[0188] In one embodiment, the invention features siNA constructs
that mediate RNAi against myostatin, wherein the siNA construct
comprises one or more chemical modifications described herein that
modulates the cellular uptake of the siNA construct.
[0189] In another embodiment, the invention features a method for
generating siNA molecules against myostatin with improved cellular
uptake comprising (a) introducing nucleotides having any of Formula
I-VII or any combination thereof into an siNA molecule, and (b)
assaying the siNA molecule of step (a) under conditions suitable
for isolating siNA molecules having improved cellular uptake.
[0190] In one embodiment, the invention features siNA constructs
that mediate RNAi against myostatin, wherein the siNA construct
comprises one or more chemical modifications described herein that
increases the bioavailability of the siNA construct, for example,
by attaching polymeric conjugates such as polyethyleneglycol or
equivalent conjugates that improve the pharmacokinetics of the siNA
construct, or by attaching conjugates that target specific tissue
types or cell types in vivo. Non-limiting examples of such
conjugates are described in Vargeese et al., U.S. Ser. No.
10/201,394 incorporated by reference herein.
[0191] In one embodiment, the invention features a method for
generating siNA molecules of the invention with improved
bioavailability comprising (a) introducing a conjugate into the
structure of an siNA molecule, and (b) assaying the siNA molecule
of step (a) under conditions suitable for isolating siNA molecules
having improved bioavailability. Such conjugates can include
ligands for cellular receptors, such as peptides derived from
naturally occurring protein ligands; protein localization
sequences, including cellular ZIP code sequences; antibodies;
nucleic acid aptamers; vitamins and other co-factors, such as
folate and N-acetylgalactosamine; polymers, such as
polyethyleneglycol (PEG); phospholipids; cholesterol; polyamines,
such as spermine or spermidine; and others.
[0192] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence is chemically
modified in a manner that it can no longer act as a guide sequence
for efficiently mediating RNA interference and/or be recognized by
cellular proteins that facilitate RNAi.
[0193] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein the second sequence is designed or
modified in a manner that prevents its entry into the RNAi pathway
as a guide sequence or as a sequence that is complementary to a
target nucleic acid (e.g., RNA) sequence. Such design or
modifications are expected to enhance the activity of siNA and/or
improve the specificity of siNA molecules of the invention. These
modifications are also expected to minimize any off-target effects
and/or associated toxicity.
[0194] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence is incapable of
acting as a guide sequence for mediating RNA interference.
[0195] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence does not have a
terminal 5'-hydroxyl (5'-OH) or 5'-phosphate group.
[0196] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence comprises a
terminal cap moiety at the 5'-end of said second sequence. In one
embodiment, the terminal cap moiety comprises an inverted abasic,
inverted deoxy abasic, inverted nucleotide moiety, a group shown in
FIG. 10, an alkyl or cycloalkyl group, a heterocycle, or any other
group that prevents RNAi activity in which the second sequence
serves as a guide sequence or template for RNAi.
[0197] In one embodiment, the invention features a double stranded
short interfering nucleic acid (siNA) molecule that comprises a
first nucleotide sequence complementary to a target RNA sequence or
a portion thereof, and a second sequence having complementarity to
said first sequence, wherein said second sequence comprises a
terminal cap moiety at the 5'-end and 3'-end of said second
sequence. In one embodiment, each terminal cap moiety individually
comprises an inverted abasic, inverted deoxy abasic, inverted
nucleotide moiety, a group shown in FIG. 10, an alkyl or cycloalkyl
group, a heterocycle, or any other group that prevents RNAi
activity in which the second sequence serves as a guide sequence or
template for RNAi.
[0198] In one embodiment, the invention features a method for
generating siNA molecules of the invention with improved
specificity for down regulating or inhibiting the expression of a
target nucleic acid (e.g., a DNA or RNA such as a gene or its
corresponding RNA), comprising (a) introducing one or more chemical
modifications into the structure of an siNA molecule, and (b)
assaying the siNA molecule of step (a) under conditions suitable
for isolating siNA molecules having improved specificity. In
another embodiment, the chemical modification used to improve
specificity comprises terminal cap modifications at the 5'-end,
3'-end, or both 5' and 3'-ends of the siNA molecule. The terminal
cap modifications can comprise, for example, structures shown in
FIG. 10 (e.g. inverted deoxyabasic moieties) or any other chemical
modification that renders a portion of the siNA molecule (e.g. the
sense strand) incapable of mediating RNA interference against an
off target nucleic acid sequence. In a non-limiting example, an
siNA molecule is designed such that only the antisense sequence of
the siNA molecule can serve as a guide sequence for RISC mediated
degradation of a corresponding target RNA sequence. This can be
accomplished by rendering the sense sequence of the siNA inactive
by introducing chemical modifications to the sense strand that
preclude recognition of the sense strand as a guide sequence by
RNAi machinery. In one embodiment, such chemical modifications
comprise any chemical group at the 5'-end of the sense strand of
the siNA, or any other group that serves to render the sense strand
inactive as a guide sequence for mediating RNA interference. These
modifications, for example, can result in a molecule where the
5'-end of the sense strand no longer has a free 5'-hydroxyl (5'-OH)
or a free 5'-phosphate group (e.g., phosphate, diphosphate,
triphosphate, cyclic phosphate etc.). Non-limiting examples of such
siNA constructs are described herein, such as "Stab 9/10", "Stab
7/8", "Stab 7/19", "Stab 17/22", "Stab 9/22", "Stab 23/24", and
"Stab 24/25" chemistries and variants thereof (see Table IV)
wherein the 5'-end and 3'-end of the sense strand of the siNA do
not comprise a hydroxyl group or phosphate group.
[0199] In one embodiment, the invention features a method for
generating siNA molecules of the invention with improved
specificity for down regulating or inhibiting the expression of a
target nucleic acid (e.g., a DNA or RNA such as a gene or its
corresponding RNA), comprising introducing one or more chemical
modifications into the structure of an siNA molecule that prevent a
strand or portion of the siNA molecule from acting as a template or
guide sequence for RNAi activity. In one embodiment, the inactive
strand or sense region of the siNA molecule is the sense strand or
sense region of the siNA molecule, i.e. the strand or region of the
siNA that does not have complementarity to the target nucleic acid
sequence. In one embodiment, such chemical modifications comprise
any chemical group at the 5'-end of the sense strand or region of
the siNA that does not comprise a 5'-hydroxyl (5'-OH) or
5'-phosphate group, or any other group that serves to render the
sense strand or sense region inactive as a guide sequence for
mediating RNA interference. Non-limiting examples of such siNA
constructs are described herein, such as "Stab 9/10", "Stab 7/8",
"Stab 7/19", "Stab 17/22", "Stab 17/22", "Stab 23/24", and "Stab
24/25" chemistries and variants thereof (see Table IV) wherein the
5'-end and 3'-end of the sense strand of the siNA do not comprise a
hydroxyl group or phosphate group.
[0200] In one embodiment, the invention features a method for
screening siNA molecules that are active in mediating RNA
interference against a target nucleic acid sequence comprising (a)
generating a plurality of unmodified siNA molecules, (b) screening
the siNA molecules of step (a) under conditions suitable for
isolating siNA molecules that are active in mediating RNA
interference against the target nucleic acid sequence, and (c)
introducing chemical modifications (e.g. chemical modifications as
described herein or as otherwise known in the art) into the active
siNA molecules of (b). In one embodiment, the method further
comprises re-screening the chemically modified siNA molecules of
step (c) under conditions suitable for isolating chemically
modified siNA molecules that are active in mediating RNA
interference against the target nucleic acid sequence.
[0201] In one embodiment, the invention features a method for
screening chemically modified siNA molecules that are active in
mediating RNA interference against a target nucleic acid sequence
comprising (a) generating a plurality of chemically modified siNA
molecules (e.g. siNA molecules as described herein or as otherwise
known in the art), and (b) screening the siNA molecules of step (a)
under conditions suitable for isolating chemically modified siNA
molecules that are active in mediating RNA interference against the
target nucleic acid sequence.
[0202] The term "ligand" refers to any compound or molecule, such
as a drug, peptide, hormone, or neurotransmitter that is capable of
interacting with another compound, such as a receptor, either
directly or indirectly. The receptor that interacts with a ligand
can be present on the surface of a cell or can alternately be an
intercellular receptor. Interaction of the ligand with the receptor
can result in a biochemical reaction, or can simply be a physical
interaction or association.
[0203] In another embodiment, the invention features a method for
generating siNA molecules of the invention with improved
bioavailability comprising (a) introducing an excipient formulation
to an siNA molecule, and (b) assaying the siNA molecule of step (a)
under conditions suitable for isolating siNA molecules having
improved bioavailability. Such excipients include polymers such as
cyclodextrins, lipids, cationic lipids, polyamines, phospholipids,
nanoparticles, receptors, ligands, and others.
[0204] In another embodiment, the invention features a method for
generating siNA molecules of the invention with improved
bioavailability comprising (a) introducing nucleotides having any
of Formulae I-VII or any combination thereof into an siNA molecule,
and (b) assaying the siNA molecule of step (a) under conditions
suitable for isolating siNA molecules having improved
bioavailability.
[0205] In another embodiment, polyethylene glycol (PEG) can be
covalently attached to siNA compounds of the present invention. The
attached PEG can be any molecular weight, preferably from about
2,000 to about 50,000 daltons (Da).
[0206] The present invention can be used alone or as a component of
a kit having at least one of the reagents necessary to carry out
the in vitro or in vivo introduction of RNA to test samples and/or
subjects. For example, preferred components of the kit include an
siNA molecule of the invention and a vehicle that promotes
introduction of the siNA into cells of interest as described herein
(e.g., using lipids and other methods of transfection known in the
art, see for example Beigelman et al, U.S. Pat. No. 6,395,713). The
kit can be used for target validation, such as in determining gene
function and/or activity, or in drug optimization, and in drug
discovery (see for example Usman et al., U.S. Ser. No. 60/402,996).
Such a kit can also include instructions to allow a user of the kit
to practice the invention.
[0207] The term "short interfering nucleic acid", "siNA", "short
interfering RNA", "siRNA", "short interfering nucleic acid
molecule", "short interfering oligonucleotide molecule", or
"chemically modified short interfering nucleic acid molecule" as
used herein refers to any nucleic acid molecule capable of
inhibiting or down regulating gene expression or viral replication,
for example by mediating RNA interference "RNAi" or gene silencing
in a sequence-specific manner; see for example Zamore et al., 2000,
Cell, 101, 25-33; Bass, 2001, Nature, 411, 428-429; Elbashir et
al., 2001, Nature, 411, 494-498; and Kreutzer et al., International
PCT Publication No. WO 00/44895; Zernicka-Goetz et al.,
International PCT Publication No. WO 01/36646; Fire, International
PCT Publication No. WO 99/32619; Plaetinck et al., International
PCT Publication No. WO 00/01846; Mello and Fire, International PCT
Publication No. WO 01/29058; Deschamps-Depaillette, International
PCT Publication No. WO 99/07409; and Li et al., International PCT
Publication No. WO 00/44914; Allshire, 2002, Science, 297,
1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein,
2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297,
2232-2237; Hutvagner and Zamore, 2002, Science, 297, 2056-60;
McManus et al., 2002, RNA, 8, 842-850; Reinhart et al., 2002, Gene
& Dev., 16, 1616-1626; and Reinhart & Bartel, 2002,
Science, 297, 1831). Non limiting examples of siNA molecules of the
invention are shown in FIGS. 4-6, and Tables II and III herein. For
example the siNA can be a double stranded polynucleotide molecule
comprising self-complementary sense and antisense regions, wherein
the antisense region comprises nucleotide sequence that is
complementary to nucleotide sequence in a target nucleic acid
molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. The siNA can be assembled from two
separate oligonucleotides, where one strand is the sense strand and
the other is the antisense strand, wherein the antisense and sense
strands are self-complementary (i.e. each strand comprises
nucleotide sequence that is complementary to nucleotide sequence in
the other strand; such as where the antisense strand and sense
strand form a duplex or double stranded structure, for example
wherein the double stranded region is about 19 base pairs); the
antisense strand comprises nucleotide sequence that is
complementary to nucleotide sequence in a target nucleic acid
molecule or a portion thereof and the sense strand comprises
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. Alternatively, the siNA is assembled
from a single oligonucleotide, where the self-complementary sense
and antisense regions of the siNA are linked by means of a nucleic
acid based or non-nucleic acid-based linker(s). The siNA can be a
polynucleotide with a duplex, asymmetric duplex, hairpin or
asymmetric hairpin secondary structure, having self-complementary
sense and antisense regions, wherein the antisense region comprises
nucleotide sequence that is complementary to nucleotide sequence in
a separate target nucleic acid molecule or a portion thereof and
the sense region having nucleotide sequence corresponding to the
target nucleic acid sequence or a portion thereof. The siNA can be
a circular single stranded polynucleotide having two or more loop
structures and a stem comprising self-complementary sense and
antisense regions, wherein the antisense region comprises
nucleotide sequence that is complementary to nucleotide sequence in
a target nucleic acid molecule or a portion thereof and the sense
region having nucleotide sequence corresponding to the target
nucleic acid sequence or a portion thereof, and wherein the
circular polynucleotide can be processed either in vivo or in vitro
to generate an active siNA molecule capable of mediating RNAi. The
siNA can also comprise a single stranded polynucleotide having
nucleotide sequence complementary to nucleotide sequence in a
target nucleic acid molecule or a portion thereof (for example,
where such siNA molecule does not require the presence within the
siNA molecule of nucleotide sequence corresponding to the target
nucleic acid sequence or a portion thereof), wherein the single
stranded polynucleotide can further comprise a terminal phosphate
group, such as a 5'-phosphate (see for example Martinez et al.,
2002, Cell., 110, 563-574 and Schwarz et al., 2002, Molecular Cell,
10, 537-568), or 5',3'-diphosphate. In certain embodiments, the
siNA molecule of the invention comprises separate sense and
antisense sequences or regions, wherein the sense and antisense
regions are covalently linked by nucleotide or non-nucleotide
linkers molecules as is known in the art, or are alternately
non-covalently linked by ionic interactions, hydrogen bonding, van
der waals interactions, hydrophobic interactions, and/or stacking
interactions. In certain embodiments, the siNA molecules of the
invention comprise nucleotide sequence that is complementary to
nucleotide sequence of a target gene. In another embodiment, the
siNA molecule of the invention interacts with nucleotide sequence
of a target gene in a manner that causes inhibition of expression
of the target gene. As used herein, siNA molecules need not be
limited to those molecules containing only RNA, but further
encompasses chemically modified nucleotides and non-nucleotides. In
certain embodiments, the short interfering nucleic acid molecules
of the invention lack 2'-hydroxy (2'-OH) containing nucleotides.
Applicant describes in certain embodiments short interfering
nucleic acids that do not require the presence of nucleotides
having a 2'-hydroxy group for mediating RNAi and as such, short
interfering nucleic acid molecules of the invention optionally do
not include any ribonucleotides (e.g., nucleotides having a 2'-OH
group). Such siNA molecules that do not require the presence of
ribonucleotides within the siNA molecule to support RNAi can
however have an attached linker or linkers or other attached or
associated groups, moieties, or chains containing one or more
nucleotides with 2'-OH groups. Optionally, siNA molecules can
comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the
nucleotide positions. The modified short interfering nucleic acid
molecules of the invention can also be referred to as short
interfering modified oligonucleotides "siMON." As used herein, the
term siNA is meant to be equivalent to other terms used to describe
nucleic acid molecules that are capable of mediating sequence
specific RNAi, for example short interfering RNA (siRNA), double
stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA),
short interfering oligonucleotide, short interfering nucleic acid,
short interfering modified oligonucleotide, chemically modified
siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and
others. In addition, as used herein, the term RNAi is meant to be
equivalent to other terms used to describe sequence specific RNA
interference, such as post transcriptional gene silencing,
translational inhibition, or epigenetics. For example, siNA
molecules of the invention can be used to epigenetically silence
genes at both the post-transcriptional level and the
pre-transcriptional level. In a non-limiting example, epigenetic
regulation of gene expression by siNA molecules of the invention
can result from siNA mediated modification of chromatin structure
or methylation pattern to alter gene expression (see, for example,
Verdel et al., 2004, Science, 303, 672-676; Pal-Bhadra et al.,
2004, Science, 303, 669-672; Allshire, 2002, Science, 297,
1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein,
2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297,
2232-2237).
[0208] In one embodiment, an siNA molecule of the invention is a
duplex forming oligonucleotide "DFO", (see for example FIGS. 14-15
and Vaish et al., U.S. Ser. No. 10/727,780 filed Dec. 3, 2003 and
International PCT Application No. US04/16390, filed May 24,
2004).
[0209] In one embodiment, an siNA molecule of the invention is a
multifunctional siNA, (see for example FIGS. 16-22 and Jadhav et
al., U.S. Ser. No. 60/543,480 filed Feb. 10, 2004 and International
PCT Application No. US04/16390, filed May 24, 2004). The
multifunctional siNA of the invention can comprise sequence
targeting, for example, two regions of myostatin RNA (see for
example target sequences in Tables II and III).
[0210] By "asymmetric hairpin" as used herein is meant a linear
siNA molecule comprising an antisense region, a loop portion that
can comprise nucleotides or non-nucleotides, and a sense region
that comprises fewer nucleotides than the antisense region to the
extent that the sense region has enough complementary nucleotides
to base pair with the antisense region and form a duplex with loop.
For example, an asymmetric hairpin siNA molecule of the invention
can comprise an antisense region having length sufficient to
mediate RNAi in a cell or in vitro system (e.g. about 19 to about
22, or about 19, 20, 21, or 22 nucleotides) and a loop region
comprising about 4 to about 8 (e.g., about 4, 5, 6, 7, or 8)
nucleotides, and a sense region having about 3 to about 18 (e.g.,
about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18)
nucleotides that are complementary to the antisense region. The
asymmetric hairpin siNA molecule can also comprise a 5'-terminal
phosphate group that can be chemically modified. The loop portion
of the asymmetric hairpin siNA molecule can comprise nucleotides,
non-nucleotides, linker molecules, or conjugate molecules as
described herein.
[0211] By "asymmetric duplex" as used herein is meant an siNA
molecule having two separate strands comprising a sense region and
an antisense region, wherein the sense region comprises fewer
nucleotides than the antisense region to the extent that the sense
region has enough complementary nucleotides to base pair with the
antisense region and form a duplex. For example, an asymmetric
duplex siNA molecule of the invention can comprise an antisense
region having length sufficient to mediate RNAi in a cell or in
vitro system e.g. about 19 to about 22 (e.g. about 19, 20, 21, or
22) nucleotides and a sense region having about 3 to about 18
(e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
or 18) nucleotides that are complementary to the antisense
region.
[0212] By "modulate" is meant that the expression of the gene, or
level of RNA molecule or equivalent RNA molecules encoding one or
more proteins or protein subunits, or activity of one or more
proteins or protein subunits is up regulated or down regulated,
such that expression, level, or activity is greater than or less
than that observed in the absence of the modulator. For example,
the term "modulate" can mean "inhibit," but the use of the word
"modulate" is not limited to this definition.
[0213] By "inhibit", "down-regulate", or "reduce", it is meant that
the expression of the gene, or level of RNA molecules or equivalent
RNA molecules encoding one or more proteins or protein subunits, or
activity of one or more proteins or protein subunits, is reduced
below that observed in the absence of the nucleic acid molecules
(e.g., siNA) of the invention. In one embodiment, inhibition,
down-regulation or reduction with an siNA molecule is below that
level observed in the presence of an inactive or attenuated
molecule. In another embodiment, inhibition, down-regulation, or
reduction with siNA molecules is below that level observed in the
presence of, for example, an siNA molecule with scrambled sequence
or with mismatches. In another embodiment, inhibition,
down-regulation, or reduction of gene expression with a nucleic
acid molecule of the instant invention is greater in the presence
of the nucleic acid molecule than in its absence. In one
embodiment, inhibition, down regulation, or reduction of gene
expression is associated with post transcriptional silencing, such
as RNAi mediated cleavage of a target nucleic acid molecule (e.g.
RNA) or inhibition of translation. In one embodiment, inhibition,
down regulation, or reduction of gene expression is associated with
pretranscriptional silencing.
[0214] By "gene", or "target gene", is meant, a nucleic acid that
encodes an RNA, for example, nucleic acid sequences including, but
not limited to, structural genes encoding a polypeptide. A gene or
target gene can also encode a functional RNA (fRNA) or non-coding
RNA (ncRNA), such as small temporal RNA (stRNA), micro RNA (miRNA),
small nuclear RNA (snRNA), short interfering RNA (siRNA), small
nucleolar RNA (snRNA), ribosomal RNA (rRNA), transfer RNA (tRNA)
and precursor RNAs thereof. Such non-coding RNAs can serve as
target nucleic acid molecules for siNA mediated RNA interference in
modulating the activity of fRNA or ncRNA involved in functional or
regulatory cellular processes. Aberrant FRNA or ncRNA activity
leading to disease can therefore be modulated by siNA molecules of
the invention. siNA molecules targeting fRNA and ncRNA can also be
used to manipulate or alter the genotype or phenotype of an
organism or cell, by intervening in cellular processes such as
genetic imprinting, transcription, translation, or nucleic acid
processing (e.g., transamination, methylation etc.). The target
gene can be a gene derived from a cell, an endogenous gene, a
transgene, or exogenous genes such as genes of a pathogen, for
example a virus, which is present in the cell after infection
thereof. The cell containing the target gene can be derived from or
contained in any organism, for example a plant, animal, protozoan,
virus, bacterium, or fungus. Non-limiting examples of plants
include monocots, dicots, or gymnosperms. Non-limiting examples of
animals include vertebrates or invertebrates. Non-limiting examples
of fungi include molds or yeasts. For a review, see for example
Snyder and Gerstein, 2003, Science, 300, 258-260.
[0215] By "non-canonical base pair" is meant any non-Watson Crick
base pair, such as mismatches and/or wobble base pairs, including
flipped mismatches, single hydrogen bond mismatches, trans-type
mismatches, triple base interactions, and quadruple base
interactions. Non-limiting examples of such non-canonical base
pairs include, but are not limited to, AC reverse Hoogsteen, AC
wobble, AU reverse Hoogsteen, GU wobble, AA N7 amino, CC
2-carbonyl-amino(H1)-N3-amino(H2), GA sheared, UC 4-carbonyl-amino,
UU imino-carbonyl, AC reverse wobble, AU Hoogsteen, AU reverse
Watson Crick, CG reverse Watson Crick, GC N3-amino-amino N3, AA
N1-amino symmetric, AA N7-amino symmetric, GA N7-N1 amino-carbonyl,
GA+ carbonyl-amino N7-N1, GG N1-carbonyl symmetric, GG N3-amino
symmetric, CC carbonyl-amino symmetric, CC N3-amino symmetric, UU
2-carbonyl-imino symmetric, UU 4-carbonyl-imino symmetric, AA
amino-N3, AA N1-amino, AC amino 2-carbonyl, AC N3-amino, AC
N7-amino, AU amino-4-carbonyl, AU N1-imino, AU N3-imino, AU
N7-imino, CC carbonyl-amino, GA amino-N1, GA amino-N7, GA
carbonyl-amino, GA N3-amino, GC amino-N3, GC carbonyl-amino, GC
N3-amino, GC N7-amino, GG amino-N7, GG carbonyl-imino, GG N7-amino,
GU amino-2-carbonyl, GU carbonyl-imino, GU imino-2-carbonyl, GU
N7-imino, psiU imino-2-carbonyl, UC 4-carbonyl-amino, UC
imino-carbonyl, UU imino-4-carbonyl, AC C2-H--N3, GA carbonyl-C2-H,
UU imino-4-carbonyl 2 carbonyl-C5-H, AC amino(A) N3(C)-carbonyl, GC
imino amino-carbonyl, Gpsi imino-2-carbonyl amino-2-carbonyl, and
GU imino amino-2-carbonyl base pairs.
[0216] By "myostatin" as used herein is meant, any
growth/differentiation factor 8 (GDF8) protein, peptide, or
polypeptide having GDF8/myostatin activity (e.g., control and
maintenance of muscle mass), such as encoded by Genbank Accession
Nos. shown in Table I. The term myostatin also refers to nucleic
acid sequences encoding any GDF8/myostatin protein, peptide, or
polypeptide having GDF8 myostatin activity, such as control and
maintenance of muscle mass. The term "myostatin" is also meant to
include other myostatin sequences, such as other growth
differentiation factor isoforms, mutant GDF8/myostatin genes,
splice variants of GDF8/myostatin genes, and/or GDF8/myostatin gene
polymorphisms.
[0217] By "homologous sequence" is meant, a nucleotide sequence
that is shared by one or more polynucleotide sequences, such as
genes, gene transcripts and/or non-coding polynucleotides. For
example, a homologous sequence can be a nucleotide sequence that is
shared by two or more genes encoding related but different
proteins, such as different members of a gene family, different
protein epitopes, different protein isoforms or completely
divergent genes, such as a cytokine and its corresponding
receptors. A homologous sequence can be a nucleotide sequence that
is shared by two or more non-coding polynucleotides, such as
noncoding DNA or RNA, regulatory sequences, introns, and sites of
transcriptional control or regulation. Homologous sequences can
also include conserved sequence regions shared by more than one
polynucleotide sequence. Homology does not need to be perfect
homology (e.g., 100%), as partially homologous sequences are also
contemplated by the instant invention (e.g., 99%, 98%, 97%, 96%,
95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%,
82%, 81%, 80% etc.).
[0218] By "conserved sequence region" is meant, a nucleotide
sequence of one or more regions in a polynucleotide does not vary
significantly between generations or from one biological system or
organism to another biological system or organism. The
polynucleotide can include both coding and non-coding DNA and
RNA.
[0219] By "sense region" is meant a nucleotide sequence of an siNA
molecule having complementarity to an antisense region of the siNA
molecule. In addition, the sense region of an siNA molecule can
comprise a nucleic acid sequence having homology with a target
nucleic acid sequence.
[0220] By "antisense region" is meant a nucleotide sequence of an
siNA molecule having complementarity to a target nucleic acid
sequence. In addition, the antisense region of an siNA molecule can
optionally comprise a nucleic acid sequence having complementarity
to a sense region of the siNA molecule.
[0221] By "target nucleic acid" is meant any nucleic acid sequence
whose expression or activity is to be modulated. The target nucleic
acid can be DNA or RNA.
[0222] By "complementarity" is meant that a nucleic acid can form
hydrogen bond(s) with another nucleic acid sequence by either
traditional Watson-Crick or other non-traditional types. In
reference to the nucleic molecules of the present invention, the
binding free energy for a nucleic acid molecule with its
complementary sequence is sufficient to allow the relevant function
of the nucleic acid to proceed, e.g., RNAi activity. Determination
of binding free energies for nucleic acid molecules is well known
in the art (see, e.g., Turner et al., 1987, CSH Symp. Quant. Biol.
LII pp. 123-133; Frier et al., 1986, Proc. Nat. Acad. Sci. USA
83:9373-9377; Turner et al., 1987, J. Am. Chem. Soc.
109:3783-3785). A percent complementarity indicates the percentage
of contiguous residues in a nucleic acid molecule that can form
hydrogen bonds (e.g., Watson-Crick base pairing) with a second
nucleic acid sequence (e.g., 5, 6, 7, 8, 9, or 10 nucleotides out
of a total of 10 nucleotides in the first oligonucleotide being
based paired to a second nucleic acid sequence having 10
nucleotides represents 50%, 60%, 70%, 80%, 90%, and 100%
complementary respectively). "Perfectly complementary" means that
all the contiguous residues of a nucleic acid sequence will
hydrogen bond with the same number of contiguous residues in a
second nucleic acid sequence.
[0223] In one embodiment, siNA molecules of the invention that down
regulate or reduce myostatin gene expression are used for treating
diseases and conditions associated with muscular atrophy, muscle
weakness, muscle dysfunction, or muscle destruction, including
muscular dystrophy, myotonic dystrophy, myotonia congentia,
poliomyelitis, amyotrophic lateral sclerosis (ALS or Lou Gehrig's
disease), Guillain-Barre syndrome, muscle wasting, sarcopenia,
myalgias, myopathies, hypotonis, hypotonia, cachexia, spinal cord
injury, or muscle injury, or alternately for muscle hypertrophy,
including use for increased strength, athleticism, bodybuilding,
prevention of muscle atrophy (e.g., in astronauts), or cosmetic
applications in a subject or organism.
[0224] In one embodiment, siNA molecules of the invention that down
regulate or reduce myostatin gene expression are used for treating
or preventing obesity, diabetes (e.g., type I or type II),
cardiovascular disease, and/or insulin resistance in a subject or
organism.
[0225] By "muscular dystrophy" is meant any disease, disorder, or
condition characterized by dystrophic loss of muscle mass or
function, including Becker's muscular dystrophy, Duchenne muscular
dystrophy, facioscapulohumeral muscular dystrophy, limb-girdle
muscular dystrophy, Emery-Dreifuss muscular dystrophy, myotonic
dystrophy, and/or myotonia congenita.
[0226] By "spinal cord injury" is meant, any injury to the spinal
cord, including traumatic, degenerative or infectious spinal cord
injuries involving inflammation, compression, tearing, severing,
shearing, mechanical disruption, transection, extradural pathology,
or distraction of neural elements of the spinal cord and resulting
motor deficits resulting from such injury. The term "spinal cord
injury" or "SCl" also encompasses anterior cord syndrome,
Brown-Sequard syndrome, central cord syndrome, conus medullaris
syndrome, and cauda equina syndrome and infectious conditions such
as meningitis, infections involving the spinal canal including
epidural abscesses (infection in the epidural space), meningitis
(infection of the meninges), subdural abscesses (infections of the
subdural space), and intramedullary abscesses (infections within
the spinal cord).
[0227] In one embodiment of the present invention, each sequence of
an siNA molecule of the invention is independently about 18 to
about 24 nucleotides in length, in specific embodiments about 18,
19, 20, 21, 22, 23, or 24 nucleotides in length. In another
embodiment, the siNA duplexes of the invention independently
comprise about 17 to about 23 base pairs (e.g., about 17, 18, 19,
20, 21, 22, or 23). In yet another embodiment, siNA molecules of
the invention comprising hairpin or circular structures are about
35 to about 55 (e.g., about 35, 40, 45, 50 or 55) nucleotides in
length, or about 38 to about 44 (e.g., about 38, 39, 40, 41, 42,
43, or 44) nucleotides in length and comprising about 16 to about
22 (e.g., about 16, 17, 18, 19, 20, 21 or 22) base pairs. Exemplary
siNA molecules of the invention are shown in Table II. Exemplary
synthetic siNA molecules of the invention are shown in Table III
and/or FIGS. 4-5.
[0228] As used herein "cell" is used in its usual biological sense,
and does not refer to an entire multicellular organism, e.g.,
specifically does not refer to a human. The cell can be present in
an organism, e.g., birds, plants and mammals such as humans, cows,
sheep, apes, monkeys, swine, dogs, and cats. The cell can be
prokaryotic (e.g., bacterial cell) or eukaryotic (e.g., mammalian
or plant cell). The cell can be of somatic or germ line origin,
totipotent or pluripotent, dividing or non-dividing. The cell can
also be derived from or can comprise a gamete or embryo, a stem
cell, or a fully differentiated cell.
[0229] The siNA molecules of the invention are added directly, or
can be complexed with cationic lipids, packaged within liposomes,
or otherwise delivered to target cells or tissues (e.g., scalp hair
follicles). The nucleic acid or nucleic acid complexes can be
locally administered to relevant tissues ex vivo, or in vivo
through direct dermal application, transdermal application, or
injection, with or without their incorporation in biopolymers. In
particular embodiments, the nucleic acid molecules of the invention
comprise sequences shown in Tables II-III and/or FIGS. 4-5.
Examples of such nucleic acid molecules consist essentially of
sequences defined in these tables and figures. Furthermore, the
chemically modified constructs described in Table IV can be applied
to any siNA sequence of the invention.
[0230] In another aspect, the invention provides mammalian cells
containing one or more siNA molecules of this invention. The one or
more siNA molecules can independently be targeted to the same or
different sites.
[0231] By "RNA" is meant a molecule comprising at least one
ribonucleotide residue. By "ribonucleotide" is meant a nucleotide
with a hydroxyl group at the 2' position of a .beta.-D-ribofuranose
moiety. The terms include double stranded RNA, single stranded RNA,
isolated RNA such as partially purified RNA, essentially pure RNA,
synthetic RNA, recombinantly produced RNA, as well as altered RNA
that differs from naturally occurring RNA by the addition,
deletion, substitution and/or alteration of one or more
nucleotides. Such alterations can include addition of
non-nucleotide material, such as to the end(s) of the siNA or
internally, for example at one or more nucleotides of the RNA.
Nucleotides in the RNA molecules of the instant invention can also
comprise non-standard nucleotides, such as non-naturally occurring
nucleotides or chemically synthesized nucleotides or
deoxynucleotides. These altered RNAs can be referred to as analogs
or analogs of naturally-occurring RNA.
[0232] By "subject" is meant an organism, which is a donor or
recipient of explanted cells or the cells themselves. "Subject"
also refers to an organism to which the nucleic acid molecules of
the invention can be administered. A subject can be a mammal or
mammalian cells, including a human or human cells.
[0233] The term "phosphorothioate" as used herein refers to an
internucleotide linkage having Formula I, wherein Z and/or W
comprise a sulfur atom. Hence, the term phosphorothioate refers to
both phosphorothioate and phosphorodithioate internucleotide
linkages.
[0234] The term "phosphonoacetate" as used herein refers to an
internucleotide linkage having Formula I, wherein Z and/or W
comprise an acetyl or protected acetyl group.
[0235] The term "thiophosphonoacetate" as used herein refers to an
internucleotide linkage having Formula I, wherein Z comprises an
acetyl or protected acetyl group and W comprises a sulfur atom or
alternately W comprises an acetyl or protected acetyl group and Z
comprises a sulfur atom.
[0236] The term "universal base" as used herein refers to
nucleotide base analogs that form base pairs with each of the
natural DNA/RNA bases with little discrimination between them.
Non-limiting examples of universal bases include C-phenyl,
C-naphthyl and other aromatic derivatives, inosine, azole
carboxamides, and nitroazole derivatives such as 3-nitropyrrole,
4-nitroindole, 5-nitroindole, and 6-nitroindole as known in the art
(see for example Loakes, 2001, Nucleic Acids Research, 29,
2437-2447).
[0237] The term "acyclic nucleotide" as used herein refers to any
nucleotide having an acyclic ribose sugar.
[0238] The nucleic acid molecules of the instant invention,
individually, or in combination or in conjunction with other drugs,
can be used for preventing or treating diseases and conditions
associated with muscular atrophy, muscle weakness, muscle
dysfunction, or muscle destruction, including muscular dystrophy,
myotonic dystrophy, myotonia congentia, poliomyelitis, amyotrophic
lateral sclerosis (ALS or Lou Gehrig's disease), Guillain-Barre
syndrome, muscle wasting (e.g., age or HIV related), sarcopenia,
myalgias, myopathies, hypotonis, hypotonia, cachexia, spinal cord
injury, or muscle injury in a subject or organism. The nucleic acid
molecules of the instant invention, individually, or in combination
or in conjunction with other drugs, can be used for preventing or
treating obesity, diabetes, cardiovascular disease, or insulin
resistance in a subject or organism. Alternately the nucleic acid
molecules of the instant invention, individually, or in combination
or in conjunction with other drugs, can be used for promoting
muscle hypertrophy, including use for increased strength,
athleticism, bodybuilding, prevention of muscle atrophy (e.g., in
astronauts), or cosmetic applications in a subject or organism. For
example, the siNA molecules can be administered to a subject or can
be administered to other appropriate cells evident to those skilled
in the art, individually or in combination with one or more drugs
under conditions suitable for the treatment.
[0239] In one embodiment, the siNA molecules can be used in
combination with other known treatments to prevent or treat
diseases and conditions associated with muscular atrophy, muscle
weakness, muscle dysfunction, or muscle destruction, including
muscular dystrophy, myotonic dystrophy, myotonia congentia,
poliomyelitis, amyotrophic lateral sclerosis (ALS or Lou Gehrig's
disease), Guillain-Barre syndrome, muscle wasting, sarcopenia,
myalgias, myopathies, hypotonis, hypotonia, cachexia, spinal cord
injury, or muscle injury in a subject or organism. In one
embodiment, the siNA molecules can be used in combination with
other known treatments to treat obesity, diabetes, cardiovascular
disease, or insulin resistance in a subject or organism.
Alternately the siNA molecules can be used in combination with
other known treatments to promote muscle hypertrophy, including use
for increased strength, athleticism, bodybuilding, prevention of
muscle atrophy (e.g., in astronauts), or cosmetic applications in a
subject or organism. For example, the described molecules could be
used in combination with one or more known compounds, treatments,
or procedures to promote or maintain muscle hypertrophy or muscle
growth as are known in the art, including anabolic and androgenic
steroid compounds and/or growth factors.
[0240] In one embodiment, the invention features an expression
vector comprising a nucleic acid sequence encoding at least one
siNA molecule of the invention, in a manner which allows expression
of the siNA molecule. For example, the vector can contain
sequence(s) encoding both strands of an siNA molecule comprising a
duplex. The vector can also contain sequence(s) encoding a single
nucleic acid molecule that is self-complementary and thus forms an
siNA molecule. Non-limiting examples of such expression vectors are
described in Paul et al., 2002, Nature Biotechnology, 19, 505;
Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497; Lee et
al., 2002, Nature Biotechnology, 19, 500; and Novina et al., 2002,
Nature Medicine, advance online publication doi: 10.1038/nm725.
[0241] In another embodiment, the invention features a mammalian
cell, for example, a human cell, including an expression vector of
the invention.
[0242] In yet another embodiment, the expression vector of the
invention comprises a sequence for an siNA molecule having
complementarity to a RNA molecule referred to by a Genbank
Accession numbers, for example Genbank Accession Nos. shown in
Table I.
[0243] In one embodiment, an expression vector of the invention
comprises a nucleic acid sequence encoding two or more siNA
molecules, which can be the same or different.
[0244] In another aspect of the invention, siNA molecules that
interact with target RNA molecules and down-regulate gene encoding
target RNA molecules (for example target RNA molecules referred to
by Genbank Accession numbers herein) are expressed from
transcription units inserted into DNA or RNA vectors. The
recombinant vectors can be DNA plasmids or viral vectors. siNA
expressing viral vectors can be constructed based on, but not
limited to, adeno-associated virus, retrovirus, adenovirus, or
alphavirus. The recombinant vectors capable of expressing the siNA
molecules can be delivered as described herein, and persist in
target cells. Alternatively, viral vectors can be used that provide
for transient expression of siNA molecules. Such vectors can be
repeatedly administered as necessary. Once expressed, the siNA
molecules bind and down-regulate gene function or expression via
RNA interference (RNAi). Delivery of siNA expressing vectors can be
systemic, such as by intravenous or intramuscular administration,
by administration to target cells ex-planted from a subject
followed by reintroduction into the subject, or by any other means
that would allow for introduction into the desired target cell.
[0245] By "vectors" is meant any nucleic acid- and/or viral-based
technique used to deliver a desired nucleic acid.
[0246] Other features and advantages of the invention will be
apparent from the following description of the preferred
embodiments thereof, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0247] FIG. 1 shows a non-limiting example of a scheme for the
synthesis of siNA molecules. The complementary siNA sequence
strands, strand 1 and strand 2, are synthesized in tandem and are
connected by a cleavable linkage, such as a nucleotide succinate or
abasic succinate, which can be the same or different from the
cleavable linker used for solid phase synthesis on a solid support.
The synthesis can be either solid phase or solution phase, in the
example shown, the synthesis is a solid phase synthesis. The
synthesis is performed such that a protecting group, such as a
dimethoxytrityl group, remains intact on the terminal nucleotide of
the tandem oligonucleotide. Upon cleavage and deprotection of the
oligonucleotide, the two siNA strands spontaneously hybridize to
form an siNA duplex, which allows the purification of the duplex by
utilizing the properties of the terminal protecting group, for
example by applying a trityl on purification method wherein only
duplexes/oligonucleotides with the terminal protecting group are
isolated.
[0248] FIG. 2 shows a MALDI-TOF mass spectrum of a purified siNA
duplex synthesized by a method of the invention. The two peaks
shown correspond to the predicted mass of the separate siNA
sequence strands. This result demonstrates that the siNA duplex
generated from tandem synthesis can be purified as a single entity
using a simple trityl-on purification methodology.
[0249] FIG. 3 shows a non-limiting proposed mechanistic
representation of target RNA degradation involved in RNAi. Double
stranded RNA (dsRNA), which is generated by RNA-dependent RNA
polymerase (RdRP) from foreign single stranded RNA, for example
viral, transposon, or other exogenous RNA, activates the DICER
enzyme that in turn generates siNA duplexes. Alternately, synthetic
or expressed siNA can be introduced directly into a cell by
appropriate means. An active siNA complex forms which recognizes a
target RNA, resulting in degradation of the target RNA by the RISC
endonuclease complex or in the synthesis of additional RNA by
RNA-dependent RNA polymerase (RdRP), which can activate DICER and
result in additional siNA molecules, thereby amplifying the RNAi
response.
[0250] FIG. 4A-F shows non-limiting examples of chemically modified
siNA constructs of the present invention. In the figure, N stands
for any nucleotide (adenosine, guanosine, cytosine, uridine, or
optionally thymidine, for example thymidine can be substituted in
the overhanging regions designated by parenthesis (N N). Various
modifications are shown for the sense and antisense strands of the
siNA constructs. The antisense strand of constructs A-F comprise
sequence complementary to any target nucleic acid sequence of the
invention. Furthermore, when a glyceryl moiety (L) is present at
the 3'-end of the antisense strand for any construct shown in FIG.
4 A-F, the modified internucleotide linkage is optional.
[0251] FIG. 4A: The sense strand comprises 21 nucleotides wherein
the two terminal 3'-nucleotides are optionally base paired and
wherein all nucleotides present are ribonucleotides except for (N
N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. The antisense strand comprises 21 nucleotides,
optionally having a 3'-terminal glyceryl moiety wherein the two
terminal 3'-nucleotides are optionally complementary to the target
RNA sequence, and wherein all nucleotides present are
ribonucleotides except for (N N) nucleotides, which can comprise
ribonucleotides, deoxynucleotides, universal bases, or other
chemical modifications described herein. A modified internucleotide
linkage, such as a phosphorothioate, phosphorodithioate or other
modified internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the antisense
strand.
[0252] FIG. 4B: The sense strand comprises 21 nucleotides wherein
the two terminal 3'-nucleotides are optionally base paired and
wherein all pyrimidine nucleotides that may be present are
2'deoxy-2'-fluoro modified nucleotides and all purine nucleotides
that may be present are 2'-O-methyl modified nucleotides except for
(N N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. The antisense strand comprises 21 nucleotides,
optionally having a 3'-terminal glyceryl moiety and wherein the two
terminal 3'-nucleotides are optionally complementary to the target
RNA sequence, and wherein all pyrimidine nucleotides that may be
present are 2'-deoxy-2'-fluoro modified nucleotides and all purine
nucleotides that may be present are 2'-O-methyl modified
nucleotides except for (N N) nucleotides, which can comprise
ribonucleotides, deoxynucleotides, universal bases, or other
chemical modifications described herein. A modified internucleotide
linkage, such as a phosphorothioate, phosphorodithioate or other
modified internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the sense and
antisense strand.
[0253] FIG. 4C: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-O-methyl or
2'-deoxy-2'-fluoro modified nucleotides except for (N N)
nucleotides, which can comprise ribonucleotides, deoxynucleotides,
universal bases, or other chemical modifications described herein.
The antisense strand comprises 21 nucleotides, optionally having a
3'-terminal glyceryl moiety and wherein the two terminal
3'-nucleotides are optionally complementary to the target RNA
sequence, and wherein all pyrimidine nucleotides that may be
present are 2'-deoxy-2'-fluoro modified nucleotides except for (N
N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. A modified internucleotide linkage, such as a
phosphorothioate, phosphorodithioate or other modified
internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the antisense
strand.
[0254] FIG. 4D: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides except for (N N) nucleotides, which can
comprise ribonucleotides, deoxynucleotides, universal bases, or
other chemical modifications described herein and wherein and all
purine nucleotides that may be present are 2'-deoxy nucleotides.
The antisense strand comprises 21 nucleotides, optionally having a
3'-terminal glyceryl moiety and wherein the two terminal
3'-nucleotides are optionally complementary to the target RNA
sequence, wherein all pyrimidine nucleotides that may be present
are 2'-deoxy-2'-fluoro modified nucleotides and all purine
nucleotides that may be present are 2'-O-methyl modified
nucleotides except for (N N) nucleotides, which can comprise
ribonucleotides, deoxynucleotides, universal bases, or other
chemical modifications described herein. A modified internucleotide
linkage, such as a phosphorothioate, phosphorodithioate or other
modified internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the antisense
strand.
[0255] FIG. 4E: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides except for (N N) nucleotides, which can
comprise ribonucleotides, deoxynucleotides, universal bases, or
other chemical modifications described herein. The antisense strand
comprises 21 nucleotides, optionally having a 3'-terminal glyceryl
moiety and wherein the two terminal 3'-nucleotides are optionally
complementary to the target RNA sequence, and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides and all purine nucleotides that may be present
are 2'-O-methyl modified nucleotides except for (N N) nucleotides,
which can comprise ribonucleotides, deoxynucleotides, universal
bases, or other chemical modifications described herein. A modified
internucleotide linkage, such as a phosphorothioate,
phosphorodithioate or other modified internucleotide linkage as
described herein, shown as "s", optionally connects the (N N)
nucleotides in the antisense strand.
[0256] FIG. 4F: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides except for (N N) nucleotides, which can
comprise ribonucleotides, deoxynucleotides, universal bases, or
other chemical modifications described herein and wherein and all
purine nucleotides that may be present are 2'-deoxy nucleotides.
The antisense strand comprises 21 nucleotides, optionally having a
3'-terminal glyceryl moiety and wherein the two terminal
3'-nucleotides are optionally complementary to the target RNA
sequence, and having one 3'-terminal phosphorothioate
internucleotide linkage and wherein all pyrimidine nucleotides that
may be present are 2'-deoxy-2'-fluoro modified nucleotides and all
purine nucleotides that may be present are 2'-deoxy nucleotides
except for (N N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. A modified internucleotide linkage, such as a
phosphorothioate, phosphorodithioate or other modified
internucleotide linkage as described herein, shown as "s",
optionally connects the (N N) nucleotides in the antisense
strand.
[0257] FIG. 5A-F shows non-limiting examples of specific chemically
modified siNA sequences of the invention. A-F applies the chemical
modifications described in FIG. 4A-F to a myostatin siNA sequence.
Such chemical modifications can be applied to any myostatin
sequence and/or myostatin polymorphism sequence.
[0258] FIG. 6 shows non-limiting examples of different siNA
constructs of the invention. The examples shown (constructs 1, 2,
and 3) have 19 representative base pairs; however, different
embodiments of the invention include any number of base pairs
described herein. Bracketed regions represent nucleotide overhangs,
for example, comprising about 1, 2, 3, or 4 nucleotides in length,
preferably about 2 nucleotides. Constructs 1 and 2 can be used
independently for RNAi activity. Construct 2 can comprise a
polynucleotide or non-nucleotide linker, which can optionally be
designed as a biodegradable linker. In one embodiment, the loop
structure shown in construct 2 can comprise a biodegradable linker
that results in the formation of construct 1 in vivo and/or in
vitro. In another example, construct 3 can be used to generate
construct 2 under the same principle wherein a linker is used to
generate the active siNA construct 2 in vivo and/or in vitro, which
can optionally utilize another biodegradable linker to generate the
active siNA construct I in vivo and/or in vitro. As such, the
stability and/or activity of the siNA constructs can be modulated
based on the design of the siNA construct for use in vivo or in
vitro and/or in vitro.
[0259] FIG. 7A-C is a diagrammatic representation of a scheme
utilized in generating an expression cassette to generate siNA
hairpin constructs.
[0260] FIG. 7A: A DNA oligomer is synthesized with a 5'-restriction
site (R1) sequence followed by a region having sequence identical
(sense region of siNA) to a predetermined myostatin target
sequence, wherein the sense region comprises, for example, about
19, 20, 21, or 22 nucleotides (N) in length, which is followed by a
loop sequence of defined sequence (X), comprising, for example,
about 3 to about 10 nucleotides.
[0261] FIG. 7B: The synthetic construct is then extended by DNA
polymerase to generate a hairpin structure having
self-complementary sequence that will result in an siNA transcript
having specificity for a myostatin target sequence and having
self-complementary sense and antisense regions.
[0262] FIG. 7C: The construct is heated (for example to about
95.degree. C.) to linearize the sequence, thus allowing extension
of a complementary second DNA strand using a primer to the
3'-restriction sequence of the first strand. The double stranded
DNA is then inserted into an appropriate vector for expression in
cells. The construct can be designed such that a 3'-terminal
nucleotide overhang results from the transcription, for example, by
engineering restriction sites and/or utilizing a poly-U termination
region as described in Paul et al., 2002, Nature Biotechnology, 29,
505-508.
[0263] FIG. 8A-C is a diagrammatic representation of a scheme
utilized in generating an expression cassette to generate double
stranded siNA constructs.
[0264] FIG. 8A: A DNA oligomer is synthesized with a 5'-restriction
(R1) site sequence followed by a region having sequence identical
(sense region of siNA) to a predetermined myostatin target
sequence, wherein the sense region comprises, for example, about
19, 20, 21, or 22 nucleotides (N) in length, and which is followed
by a 3'-restriction site (R2) which is adjacent to a loop sequence
of defined sequence (X).
[0265] FIG. 8B: The synthetic construct is then extended by DNA
polymerase to generate a hairpin structure having
self-complementary sequence.
[0266] FIG. 8C: The construct is processed by restriction enzymes
specific to R1 and R2 to generate a double stranded DNA which is
then inserted into an appropriate vector for expression in cells.
The transcription cassette is designed such that a U6 promoter
region flanks each side of the dsDNA which generates the separate
sense and antisense strands of the siNA. Poly T termination
sequences can be added to the constructs to generate U overhangs in
the resulting transcript.
[0267] FIG. 9A-E is a diagrammatic representation of a method used
to determine target sites for siNA mediated RNAi within a
particular target nucleic acid sequence, such as messenger RNA.
[0268] FIG. 9A: A pool of siNA oligonucleotides are synthesized
wherein the antisense region of the siNA constructs has
complementarity to target sites across the target nucleic acid
sequence, and wherein the sense region comprises sequence
complementary to the antisense region of the siNA.
[0269] FIGS. 9B&C: (FIG. 9B) The sequences are pooled and are
inserted into vectors such that (FIG. 9C) transfection of a vector
into cells results in the expression of the siNA.
[0270] FIG. 9D: Cells are sorted based on phenotypic change that is
associated with modulation of the target nucleic acid sequence.
[0271] FIG. 9E: The siNA is isolated from the sorted cells and is
sequenced to identify efficacious target sites within the target
nucleic acid sequence.
[0272] FIG. 10 shows non-limiting examples of different
stabilization chemistries (1-10) that can be used, for example, to
stabilize the 3'-end of siNA sequences of the invention, including
(1) [3-3']-inverted deoxyribose; (2) deoxyribonucleotide; (3)
[5'-3']-3'-deoxyribonucleotide; (4) [5'-3']-ribonucleotide; (5)
[5'-3']-3'-O-methyl ribonucleotide; (6) 3'-glyceryl; (7)
[3'-5']-3'-deoxyribonucleotide; (8) [3'-3']-deoxyribonucleotide;
(9) [5'-2']-deoxyribonucleotide; and (10)
[5-3']-dideoxyribonucleotide. In addition to modified and
unmodified backbone chemistries indicated in the figure, these
chemistries can be combined with different backbone modifications
as described herein, for example, backbone modifications having
Formula I. In addition, the 2'-deoxy nucleotide shown 5' to the
terminal modifications shown can be another modified or unmodified
nucleotide or non-nucleotide described herein, for example
modifications having any of Formulae I-VII or any combination
thereof.
[0273] FIG. 11 shows a non-limiting example of a strategy used to
identify chemically modified siNA constructs of the invention that
are nuclease resistance while preserving the ability to mediate
RNAi activity. Chemical modifications are introduced into the siNA
construct based on educated design parameters (e.g. introducing
2'-modifications, base modifications, backbone modifications,
terminal cap modifications etc). The modified construct in tested
in an appropriate system (e.g. human serum for nuclease resistance,
shown, or an animal model for PK/delivery parameters). In parallel,
the siNA construct is tested for RNAi activity, for example in a
cell culture system such as a luciferase reporter assay). Lead siNA
constructs are then identified which possess a particular
characteristic while maintaining RNAi activity, and can be further
modified and assayed once again. This same approach can be used to
identify siNA-conjugate molecules with improved pharmacokinetic
profiles, delivery, and RNAi activity.
[0274] FIG. 12 shows non-limiting examples of phosphorylated siNA
molecules of the invention, including linear and duplex constructs
and asymmetric derivatives thereof.
[0275] FIG. 13 shows non-limiting examples of chemically modified
terminal phosphate groups of the invention.
[0276] FIG. 14A shows a non-limiting example of methodology used to
design self complementary DFO constructs utilizing palidrome and/or
repeat nucleic acid sequences that are identified in a target
nucleic acid sequence. (i) A palindrome or repeat sequence is
identified in a nucleic acid target sequence. (ii) A sequence is
designed that is complementary to the target nucleic acid sequence
and the palindrome sequence. (iii) An inverse repeat sequence of
the non-palindrome/repeat portion of the complementary sequence is
appended to the 3'-end of the complementary sequence to generate a
self complementary DFO molecule comprising sequence complementary
to the nucleic acid target. (iv) The DFO molecule can self-assemble
to form a double stranded oligonucleotide. FIG. 14B shows a
non-limiting representative example of a duplex forming
oligonucleotide sequence. FIG. 14C shows a non-limiting example of
the self assembly schematic of a representative duplex forming
oligonucleotide sequence. FIG. 14D shows a non-limiting example of
the self assembly schematic of a representative duplex forming
oligonucleotide sequence followed by interaction with a target
nucleic acid sequence resulting in modulation of gene
expression.
[0277] FIG. 15 shows a non-limiting example of the design of self
complementary DFO constructs utilizing palidrome and/or repeat
nucleic acid sequences that are incorporated into the DFO
constructs that have sequence complementary to any target nucleic
acid sequence of interest. Incorporation of these palindrome/repeat
sequences allow the design of DFO constructs that form duplexes in
which each strand is capable of mediating modulation of target gene
expression, for example by RNAi. First, the target sequence is
identified. A complementary sequence is then generated in which
nucleotide or non-nucleotide modifications (shown as X or Y) are
introduced into the complementary sequence that generate an
artificial palindrome (shown as XYXYXY in the Figure). An inverse
repeat of the non-palindrome/repeat complementary sequence is
appended to the 3'-end of the complementary sequence to generate a
self complementary DFO comprising sequence complementary to the
nucleic acid target. The DFO can self-assemble to form a double
stranded oligonucleotide.
[0278] FIG. 16 shows non-limiting examples of multifunctional siNA
molecules of the invention comprising two separate polynucleotide
sequences that are each capable of mediating RNAi directed cleavage
of differing target nucleic acid sequences. FIG. 16A shows a
non-limiting example of a multifunctional siNA molecule having a
first region that is complementary to a first target nucleic acid
sequence (complementary region 1) and a second region that is
complementary to a second target nucleic acid sequence
(complementary region 2), wherein the first and second
complementary regions are situated at the 3'-ends of each
polynucleotide sequence in the multifunctional siNA. The dashed
portions of each polynucleotide sequence of the multifunctional
siNA construct have complementarity with regard to corresponding
portions of the siNA duplex, but do not have complementarity to the
target nucleic acid sequences. FIG. 16B shows a non-limiting
example of a multifunctional siNA molecule having a first region
that is complementary to a first target nucleic acid sequence
(complementary region 1) and a second region that is complementary
to a second target nucleic acid sequence (complementary region 2),
wherein the first and second complementary regions are situated at
the 5'-ends of each polynucleotide sequence in the multifunctional
siNA. The dashed portions of each polynucleotide sequence of the
multifunctional siNA construct have complementarity with regard to
corresponding portions of the siNA duplex, but do not have
complementarity to the target nucleic acid sequences.
[0279] FIG. 17 shows non-limiting examples of multifunctional siNA
molecules of the invention comprising a single polynucleotide
sequence comprising distinct regions that are each capable of
mediating RNAi directed cleavage of differing target nucleic acid
sequences. FIG. 17A shows a non-limiting example of a
multifunctional siNA molecule having a first region that is
complementary to a first target nucleic acid sequence
(complementary region 1) and a second region that is complementary
to a second target nucleic acid sequence (complementary region 2),
wherein the second complementary region is situated at the 3'-end
of the polynucleotide sequence in the multifunctional siNA. The
dashed portions of each polynucleotide sequence of the
multifunctional siNA construct have complementarity with regard to
corresponding portions of the siNA duplex, but do not have
complementarity to the target nucleic acid sequences. FIG. 17B
shows a non-limiting example of a multifunctional siNA molecule
having a first region that is complementary to a first target
nucleic acid sequence (complementary region 1) and a second region
that is complementary to a second target nucleic acid sequence
(complementary region 2), wherein the first complementary region is
situated at the 5'-end of the polynucleotide sequence in the
multifunctional siNA. The dashed portions of each polynucleotide
sequence of the multifunctional siNA construct have complementarity
with regard to corresponding portions of the siNA duplex, but do
not have complementarity to the target nucleic acid sequences. In
one embodiment, these multifunctional siNA constructs are processed
in vivo or in vitro to generate multifunctional siNA constructs as
shown in FIG. 16.
[0280] FIG. 18 shows non-limiting examples of multifunctional siNA
molecules of the invention comprising two separate polynucleotide
sequences that are each capable of mediating RNAi directed cleavage
of differing target nucleic acid sequences and wherein the
multifunctional siNA construct further comprises a self
complementary, palindrome, or repeat region, thus enabling shorter
bifuctional siNA constructs that can mediate RNA interference
against differing target nucleic acid sequences. FIG. 18A shows a
non-limiting example of a multifunctional siNA molecule having a
first region that is complementary to a first target nucleic acid
sequence (complementary region 1) and a second region that is
complementary to a second target nucleic acid sequence
(complementary region 2), wherein the first and second
complementary regions are situated at the 3'-ends of each
polynucleotide sequence in the multifunctional siNA, and wherein
the first and second complementary regions further comprise a self
complementary, palindrome, or repeat region. The dashed portions of
each polynucleotide sequence of the multifunctional siNA construct
have complementarity with regard to corresponding portions of the
siNA duplex, but do not have complementarity to the target nucleic
acid sequences. FIG. 18B shows a non-limiting example of a
multifunctional siNA molecule having a first region that is
complementary to a first target nucleic acid sequence
(complementary region 1) and a second region that is complementary
to a second target nucleic acid sequence (complementary region 2),
wherein the first and second complementary regions are situated at
the 5'-ends of each polynucleotide sequence in the multifunctional
siNA, and wherein the first and second complementary regions
further comprise a self complementary, palindrome, or repeat
region. The dashed portions of each polynucleotide sequence of the
multifunctional siNA construct have complementarity with regard to
corresponding portions of the siNA duplex, but do not have
complementarity to the target nucleic acid sequences.
[0281] FIG. 19 shows non-limiting examples of multifunctional siNA
molecules of the invention comprising a single polynucleotide
sequence comprising distinct regions that are each capable of
mediating RNAi directed cleavage of differing target nucleic acid
sequences and wherein the multifunctional siNA construct further
comprises a self complementary, palindrome, or repeat region, thus
enabling shorter bifunctional siNA constructs that can mediate RNA
interference against differing target nucleic acid sequences. FIG.
19A shows a non-limiting example of a multifunctional siNA molecule
having a first region that is complementary to a first target
nucleic acid sequence (complementary region 1) and a second region
that is complementary to a second target nucleic acid sequence
(complementary region 2), wherein the second complementary region
is situated at the 3'-end of the polynucleotide sequence in the
multifunctional siNA, and wherein the first and second
complementary regions further comprise a self complementary,
palindrome, or repeat region. The dashed portions of each
polynucleotide sequence of the multifunctional siNA construct have
complementarity with regard to corresponding portions of the siNA
duplex, but do not have complementarity to the target nucleic acid
sequences. FIG. 19B shows a non-limiting example of a
multifunctional siNA molecule having a first region that is
complementary to a first target nucleic acid sequence
(complementary region 1) and a second region that is complementary
to a second target nucleic acid sequence (complementary region 2),
wherein the first complementary region is situated at the 5'-end of
the polynucleotide sequence in the multifunctional siNA, and
wherein the first and second complementary regions further comprise
a self complementary, palindrome, or repeat region. The dashed
portions of each polynucleotide sequence of the multifunctional
siNA construct have complementarity with regard to corresponding
portions of the siNA duplex, but do not have complementarity to the
target nucleic acid sequences. In one embodiment, these
multifunctional siNA constructs are processed in vivo or in vitro
to generate multifunctional siNA constructs as shown in FIG.
18.
[0282] FIG. 20 shows a non-limiting example of how multifunctional
siNA molecules of the invention can target two separate target
nucleic acid molecules, such as separate RNA molecules encoding
differing proteins, for example, a cytokine and its corresponding
receptor, differing viral strains, a virus and a cellular protein
involved in viral infection or replication, or differing proteins
involved in a common or divergent biologic pathway that is
implicated in the maintenance of progression of disease. Each
strand of the multifunctional siNA construct comprises a region
having complementarity to separate target nucleic acid molecules.
The multifunctional siNA molecule is designed such that each strand
of the siNA can be utilized by the RISC complex to initiate RNA
interference mediated cleavage of its corresponding target. These
design parameters can include destabilization of each end of the
siNA construct (see for example Schwarz et al., 2003, Cell, 115,
199-208). Such destabilization can be accomplished for example by
using guanosine-cytidine base pairs, alternate base pairs (e.g.,
wobbles), or destabilizing chemically modified nucleotides at
terminal nucleotide positions as is known in the art.
[0283] FIG. 21 shows a non-limiting example of how multifunctional
siNA molecules of the invention can target two separate target
nucleic acid sequences within the same target nucleic acid
molecule, such as alternate coding regions of a RNA, coding and
non-coding regions of a RNA, or alternate splice variant regions of
a RNA. Each strand of the multifunctional siNA construct comprises
a region having complementarity to the separate regions of the
target nucleic acid molecule. The multifunctional siNA molecule is
designed such that each strand of the siNA can be utilized by the
RISC complex to initiate RNA interference mediated cleavage of its
corresponding target region. These design parameters can include
destabilization of each end of the siNA construct (see for example
Schwarz et al., 2003, Cell, 115, 199-208). Such destabilization can
be accomplished for example by using guanosine-cytidine base pairs,
alternate base pairs (e.g., wobbles), or destabilizing chemically
modified nucleotides at terminal nucleotide positions as is known
in the art.
DETAILED DESCRIPTION OF THE INVENTION
Mechanism of Action of Nucleic Acid Molecules of the Invention
[0284] The discussion that follows discusses the proposed mechanism
of RNA interference mediated by short interfering RNA as is
presently known, and is not meant to be limiting and is not an
admission of prior art. Applicant demonstrates herein that
chemically modified short interfering nucleic acids possess similar
or improved capacity to mediate RNAi as do siRNA molecules and are
expected to possess improved stability and activity in vivo;
therefore, this discussion is not meant to be limiting only to
siRNA and can be applied to siNA as a whole. By "improved capacity
to mediate RNAi" or "improved RNAi activity" is meant to include
RNAi activity measured in vitro and/or in vivo where the RNAi
activity is a reflection of both the ability of the siNA to mediate
RNAi and the stability of the siNAs of the invention. In this
invention, the product of these activities can be increased in
vitro and/or in vivo compared to an all RNA siRNA or an siNA
containing a plurality of ribonucleotides. In some cases, the
activity or stability of the siNA molecule can be decreased (i.e.,
less than ten-fold), but the overall activity of the siNA molecule
is enhanced in vitro and/or in vivo.
[0285] RNA interference refers to the process of sequence specific
post-transcriptional gene silencing in animals mediated by short
interfering RNAs (siRNAs) (Fire et al., 1998, Nature, 391, 806).
The corresponding process in plants is commonly referred to as
post-transcriptional gene silencing or RNA silencing and is also
referred to as quelling in fungi. The process of
post-transcriptional gene silencing is thought to be an
evolutionarily-conserved cellular defense mechanism used to prevent
the expression of foreign genes which is commonly shared by diverse
flora and phyla (Fire et al., 1999, Trends Genet., 15, 358). Such
protection from foreign gene expression may have evolved in
response to the production of double stranded RNAs (dsRNAs) derived
from viral infection or the random integration of transposon
elements into a host genome via a cellular response that
specifically destroys homologous single stranded RNA or viral
genomic RNA. The presence of dsRNA in cells triggers the RNAi
response though a mechanism that has yet to be fully characterized.
This mechanism appears to be different from the interferon response
that results from dsRNA-mediated activation of protein kinase PKR
and 2',5'-oligoadenylate synthetase resulting in non-specific
cleavage of mRNA by ribonuclease L.
[0286] The presence of long dsRNAs in cells stimulates the activity
of a ribonuclease III enzyme referred to as Dicer. Dicer is
involved in the processing of the dsRNA into short pieces of dsRNA
known as short interfering RNAs (siRNAs) (Berstein et al., 2001,
Nature, 409, 363). Short interfering RNAs derived from Dicer
activity are typically about 21 to about 23 nucleotides in length
and comprise about 19 base pair duplexes. Dicer has also been
implicated in the excision of 21- and 22-nucleotide small temporal
RNAs (stRNAs) from precursor RNA of conserved structure that are
implicated in translational control (Hutvagner et al., 2001,
Science, 293, 834). The RNAi response also features an endonuclease
complex containing an siRNA, commonly referred to as an RNA-induced
silencing complex (RISC), which mediates cleavage of single
stranded RNA having sequence homologous to the siRNA. Cleavage of
the target RNA takes place in the middle of the region
complementary to the guide sequence of the siRNA duplex (Elbashir
et al., 2001, Genes Dev., 15, 188). In addition, RNA interference
can also involve small RNA (e.g., micro-RNA or miRNA) mediated gene
silencing, presumably though cellular mechanisms that regulate
chromatin structure and thereby prevent transcription of target
gene sequences (see for example Allshire, 2002, Science, 297,
1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein,
2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297,
2232-2237). As such, siNA molecules of the invention can be used to
mediate gene silencing via interaction with RNA transcripts or
alternately by interaction with particular gene sequences, wherein
such interaction results in gene silencing either at the
transcriptional level or post-transcriptional level.
[0287] RNAi has been studied in a variety of systems. Fire et al.,
1998, Nature, 391, 806, were the first to observe RNAi in C.
elegans. Wianny and Goetz, 1999, Nature Cell Biol., 2, 70, describe
RNAi mediated by dsRNA in mouse embryos. Hammond et al., 2000,
Nature, 404, 293, describe RNAi in Drosophila cells transfected
with dsRNA. Elbashir et al., 2001, Nature, 411, 494, describe RNAi
induced by introduction of duplexes of synthetic 21-nucleotide RNAs
in cultured mammalian cells including human embryonic kidney and
HeLa cells. Recent work in Drosophila embryonic lysates has
revealed certain requirements for siRNA length, structure, chemical
composition, and sequence that are essential to mediate efficient
RNAi activity. These studies have shown that 21 nucleotide siRNA
duplexes are most active when containing two 2-nucleotide
3'-terminal nucleotide overhangs. Furthermore, substitution of one
or both siRNA strands with 2'-deoxy or 2'-O-methyl nucleotides
abolishes RNAi activity, whereas substitution of 3'-terminal siRNA
nucleotides with deoxy nucleotides was shown to be tolerated.
Mismatch sequences in the center of the siRNA duplex were also
shown to abolish RNAi activity. In addition, these studies also
indicate that the position of the cleavage site in the target RNA
is defined by the 5'-end of the siRNA guide sequence rather than
the 3'-end (Elbashir et al., 2001, EMBO J., 20, 6877). Other
studies have indicated that a 5'-phosphate on the
target-complementary strand of an siRNA duplex is required for
siRNA activity and that ATP is utilized to maintain the
5'-phosphate moiety on the siRNA (Nykanen et al., 2001, Cell, 107,
309); however, siRNA molecules lacking a 5'-phosphate are active
when introduced exogenously, suggesting that 5'-phosphorylation of
siRNA constructs may occur in vivo.
Synthesis of Nucleic Acid Molecules
[0288] Synthesis of nucleic acids greater than 100 nucleotides in
length is difficult using automated methods, and the therapeutic
cost of such molecules is prohibitive. In this invention, small
nucleic acid motifs ("small" refers to nucleic acid motifs no more
than 100 nucleotides in length, preferably no more than 80
nucleotides in length, and most preferably no more than 50
nucleotides in length; e.g., individual siNA oligonucleotide
sequences or siNA sequences synthesized in tandem) are preferably
used for exogenous delivery. The simple structure of these
molecules increases the ability of the nucleic acid to invade
targeted regions of protein and/or RNA structure. Exemplary
molecules of the instant invention are chemically synthesized, and
others can similarly be synthesized.
[0289] Oligonucleotides (e.g., certain modified oligonucleotides or
portions of oligonucleotides lacking ribonucleotides) are
synthesized using protocols known in the art, for example as
described in Caruthers et al., 1992, Methods in Enzymology 211,
3-19, Thompson et al., International PCT Publication No. WO
99/54459, Wincott et al., 1995, Nucleic Acids Res. 23, 2677-2684,
Wincott et al., 1997, Methods Mol. Bio., 74, 59, Brennan et al.,
1998, Biotechnol Bioeng., 61, 33-45, and Brennan, U.S. Pat. No.
6,001,311. All of these references are incorporated herein by
reference. The synthesis of oligonucleotides makes use of common
nucleic acid protecting and coupling groups, such as
dimethoxytrityl at the 5'-end, and phosphoramidites at the 3'-end.
In a non-limiting example, small scale syntheses are conducted on a
394 Applied Biosystems, Inc. synthesizer using a 0.2 .mu.mol scale
protocol with a 2.5 min coupling step for 2'-O-methylated
nucleotides and a 45 second coupling step for 2'-deoxy nucleotides
or 2'-deoxy-2'-fluoro nucleotides. Table V outlines the amounts and
the contact times of the reagents used in the synthesis cycle.
Alternatively, syntheses at the 0.2 .mu.mol scale can be performed
on a 96-well plate synthesizer, such as the instrument produced by
Protogene (Palo Alto, Calif.) with minimal modification to the
cycle. A 33-fold excess (60 .mu.L of 0.11 M=6.6 .mu.mol) of
2'-O-methyl phosphoramidite and a 105-fold excess of S-ethyl
tetrazole (60 .mu.L of 0.25 M=15 .mu.mol) can be used in each
coupling cycle of 2'-O-methyl residues relative to polymer-bound
5'-hydroxyl. A 22-fold excess (40 .mu.L of 0.11 M=4.4 .mu.mol) of
deoxy phosphoramidite and a 70-fold excess of S-ethyl tetrazole (40
.mu.L of 0.25 M=10 .mu.mol) can be used in each coupling cycle of
deoxy residues relative to polymer-bound 5'-hydroxyl. Average
coupling yields on the 394 Applied Biosystems, Inc. synthesizer,
determined by colorimetric quantitation of the trityl fractions,
are typically 97.5-99%. Other oligonucleotide synthesis reagents
for the 394 Applied Biosystems, Inc. synthesizer include the
following: detritylation solution is 3% TCA in methylene chloride
(ABI); capping is performed with 16% N-methyl imidazole in THF
(ABI) and 10% acetic anhydride/10% 2,6-lutidine in THF (ABI); and
oxidation solution is 16.9 mM I.sub.2, 49 mM pyridine, 9% water in
THF (PerSeptive Biosystems, Inc.). Burdick & Jackson Synthesis
Grade acetonitrile is used directly from the reagent bottle.
S-Ethyltetrazole solution (0.25 M in acetonitrile) is made up from
the solid obtained from American International Chemical, Inc.
Alternately, for the introduction of phosphorothioate linkages,
Beaucage reagent (3H-1,2-benzodithiol-3-one 1,1-dioxide, 0.05 M in
acetonitrile) is used.
[0290] Deprotection of the DNA-based oligonucleotides is performed
as follows: the polymer-bound trityl-on oligoribonucleotide is
transferred to a 4 mL glass screw top vial and suspended in a
solution of 40% aqueous methylamine (1 mL) at 65.degree. C. for 10
minutes. After cooling to -20.degree. C., the supernatant is
removed from the polymer support. The support is washed three times
with 1.0 mL of EtOH:MeCN:H2O/3:1:1, vortexed and the supernatant is
then added to the first supernatant. The combined supernatants,
containing the oligoribonucleotide, are dried to a white
powder.
[0291] The method of synthesis used for RNA including certain siNA
molecules of the invention follows the procedure as described in
Usman et al., 1987, J. Am. Chem. Soc., 109, 7845; Scaringe et al.,
1990, Nucleic Acids Res., 18, 5433; and Wincott et al., 1995,
Nucleic Acids Res. 23, 2677-2684 Wincott et al., 1997, Methods Mol.
Bio., 74, 59, and makes use of common nucleic acid protecting and
coupling groups, such as dimethoxytrityl at the 5'-end, and
phosphoramidites at the 3'-end. In a non-limiting example, small
scale syntheses are conducted on a 394 Applied Biosystems, Inc.
synthesizer using a 0.2 .mu.mol scale protocol with a 7.5 min
coupling step for alkylsilyl protected nucleotides and a 2.5 min
coupling step for 2'-O-methylated nucleotides. Table V outlines the
amounts and the contact times of the reagents used in the synthesis
cycle. Alternatively, syntheses at the 0.2 .mu.mol scale can be
done on a 96-well plate synthesizer, such as the instrument
produced by Protogene (Palo Alto, Calif.) with minimal modification
to the cycle. A 33-fold excess (60 .mu.L of 0.11 M=6.6 .mu.mol) of
2'-O-methyl phosphoramidite and a 75-fold excess of S-ethyl
tetrazole (60 .mu.L of 0.25 M=15 .mu.mol) can be used in each
coupling cycle of 2'-O-methyl residues relative to polymer-bound
5'-hydroxyl. A 66-fold excess (120 .mu.L of 0.11 M=13.2 .mu.mol) of
alkylsilyl-(ribo) protected phosphoramidite and a 150-fold excess
of S-ethyl tetrazole (120 .mu.L of 0.25 M=30 .mu.mol) can be used
in each coupling cycle of ribo residues relative to polymer-bound
5'-hydroxyl. Average coupling yields on the 394 Applied Biosystems,
Inc. synthesizer, determined by colorimetric quantitation of the
trityl fractions, are typically 97.5-99%. Other oligonucleotide
synthesis reagents for the 394 Applied Biosystems, Inc. synthesizer
include the following: detritylation solution is 3% TCA in
methylene chloride (ABI); capping is performed with 16% N-methyl
imidazole in THF (ABI) and 10% acetic anhydride/10% 2,6-lutidine in
THF (ABI); oxidation solution is 16.9 mM 12, 49 mM pyridine, 9%
water in THF (PerSeptive Biosystems, Inc.). Burdick & Jackson
Synthesis Grade acetonitrile is used directly from the reagent
bottle. S-Ethyltetrazole solution (0.25 M in acetonitrile) is made
up from the solid obtained from American International Chemical,
Inc. Alternately, for the introduction of phosphorothioate
linkages, Beaucage reagent (3H-1,2-benzodithiol-3-one 1,1-dioxide,
0.05 M in acetonitrile) is used.
[0292] Deprotection of the RNA is performed using either a two-pot
or one-pot protocol. For the two-pot protocol, the polymer-bound
trityl-on oligoribonucleotide is transferred to a 4 mL glass screw
top vial and suspended in a solution of 40% aq. methylamine (1 mL)
at 65.degree. C. for 10 min. After cooling to -20.degree. C., the
supernatant is removed from the polymer support. The support is
washed three times with 1.0 mL of EtOH:MeCN:H2O/3:1:1, vortexed and
the supernatant is then added to the first supernatant. The
combined supernatants, containing the oligoribonucleotide, are
dried to a white powder. The base deprotected oligoribonucleotide
is resuspended in anhydrous TEA/HF/NMP solution (300 .mu.L of a
solution of 1.5 mL N-methylpyrrolidinone, 750 .mu.L TEA and 1 mL
TEA.3HF to provide a 1.4 M HF concentration) and heated to
65.degree. C. After 1.5 h, the oligomer is quenched with 1.5 M
NH.sub.4HCO.sub.3.
[0293] Alternatively, for the one-pot protocol, the polymer-bound
trityl-on oligoribonucleotide is transferred to a 4 mL glass screw
top vial and suspended in a solution of 33% ethanolic
methylamine/DMSO:1/1 (0.8 mL) at 65.degree. C. for 15 minutes. The
vial is brought to room temperature TEA.3HF (0.1 mL) is added and
the vial is heated at 65.degree. C. for 15 minutes. The sample is
cooled at -20.degree. C. and then quenched with 1.5 M
NH.sub.4HCO.sub.3.
[0294] For purification of the trityl-on oligomers, the quenched
NH.sub.4HCO.sub.3 solution is loaded onto a C-18 containing
cartridge that had been prewashed with acetonitrile followed by 50
mM TEAA. After washing the loaded cartridge with water, the RNA is
detritylated with 0.5% TFA for 13 minutes. The cartridge is then
washed again with water, salt exchanged with 1 M NaCl and washed
with water again. The oligonucleotide is then eluted with 30%
acetonitrile.
[0295] The average stepwise coupling yields are typically >98%
(Wincott et al., 1995 Nucleic Acids Res. 23, 2677-2684). Those of
ordinary skill in the art will recognize that the scale of
synthesis can be adapted to be larger or smaller than the example
described above including but not limited to 96-well format.
[0296] Alternatively, the nucleic acid molecules of the present
invention can be synthesized separately and joined together
post-synthetically, for example, by ligation (Moore et al., 1992,
Science 256, 9923; Draper et al., International PCT publication No.
WO 93/23569; Shabarova et al., 1991, Nucleic Acids Research 19,
4247; Bellon et al., 1997, Nucleosides & Nucleotides, 16, 951;
Bellon et al., 1997, Bioconjugate Chem. 8, 204), or by
hybridization following synthesis and/or deprotection.
[0297] The siNA molecules of the invention can also be synthesized
via a tandem synthesis methodology as described in Example 1
herein, wherein both siNA strands are synthesized as a single
contiguous oligonucleotide fragment or strand separated by a
cleavable linker which is subsequently cleaved to provide separate
siNA fragments or strands that hybridize and permit purification of
the siNA duplex. The linker can be a polynucleotide linker or a
non-nucleotide linker. The tandem synthesis of siNA as described
herein can be readily adapted to both multiwell/multiplate
synthesis platforms such as 96 well or similarly larger multi-well
platforms. The tandem synthesis of siNA as described herein can
also be readily adapted to large scale synthesis platforms
employing batch reactors, synthesis columns and the like.
[0298] An siNA molecule can also be assembled from two distinct
nucleic acid strands or fragments wherein one fragment includes the
sense region and the second fragment includes the antisense region
of the RNA molecule.
[0299] The nucleic acid molecules of the present invention can be
modified extensively to enhance stability by modification with
nuclease resistant groups, for example, 2'-amino, 2'-C-allyl,
2'-fluoro, 2'-O-methyl, 2'-H (for a review see Usman and Cedergren,
1992, TIBS 17, 34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31,
163). siNA constructs can be purified by gel electrophoresis using
general methods or can be purified by high pressure liquid
chromatography (HPLC; see Wincott et al., supra, the totality of
which is hereby incorporated herein by reference) and re-suspended
in water.
[0300] In another aspect of the invention, siNA molecules of the
invention are expressed from transcription units inserted into DNA
or RNA vectors. The recombinant vectors can be DNA plasmids or
viral vectors. siNA expressing viral vectors can be constructed
based on, but not limited to, adeno-associated virus, retrovirus,
adenovirus, or alphavirus. The recombinant vectors capable of
expressing the siNA molecules can be delivered as described herein,
and persist in target cells. Alternatively, viral vectors can be
used that provide for transient expression of siNA molecules.
Optimizing Activity of the Nucleic Acid Molecule of the
Invention.
[0301] Chemically synthesizing nucleic acid molecules with
modifications (base, sugar and/or phosphate) can prevent their
degradation by serum ribonucleases, which can increase their
potency (see e.g., Eckstein et al., International Publication No.
WO 92/07065; Perrault et al., 1990 Nature 344, 565; Pieken et al.,
1991, Science 253, 314; Usman and Cedergren, 1992, Trends in
Biochem. Sci. 17, 334; Usman et al., International Publication No.
WO 93/15187; and Rossi et al., International Publication No. WO
91/03162; Sproat, U.S. Pat. No. 5,334,711; Gold et al., U.S. Pat.
No. 6,300,074; and Burgin et al., supra; all of which are
incorporated by reference herein). All of the above references
describe various chemical modifications that can be made to the
base, phosphate and/or sugar moieties of the nucleic acid molecules
described herein. Modifications that enhance their efficacy in
cells, and removal of bases from nucleic acid molecules to shorten
oligonucleotide synthesis times and reduce chemical requirements
are desired.
[0302] There are several examples in the art describing sugar, base
and phosphate modifications that can be introduced into nucleic
acid molecules with significant enhancement in their nuclease
stability and efficacy. For example, oligonucleotides are modified
to enhance stability and/or enhance biological activity by
modification with nuclease resistant groups, for example, 2'-amino,
2'-C-allyl, 2'-fluoro, 2'-O-methyl, 2'-O-allyl, 2'-H, nucleotide
base modifications (for a review see Usman and Cedergren, 1992,
TIBS. 17, 34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31, 163;
Burgin et al., 1996, Biochemistry, 35, 14090). Sugar modification
of nucleic acid molecules have been extensively described in the
art (see Eckstein et al., International Publication PCT No. WO
92/07065; Perrault et al. Nature, 1990, 344, 565-568; Pieken et al.
Science, 1991, 253, 314-317; Usman and Cedergren, Trends in
Biochem. Sci., 1992, 17, 334-339; Usman et al. International
Publication PCT No. WO 93/15187; Sproat, U.S. Pat. No. 5,334,711
and Beigelman et al., 1995, J. Biol. Chem., 270, 25702; Beigelman
et al., International PCT publication No. WO 97/26270; Beigelman et
al., U.S. Pat. No. 5,716,824; Usman et al., U.S. Pat. No.
5,627,053; Woolf et al., International PCT Publication No. WO
98/13526; Thompson et al., U.S. Ser. No. 60/082,404 which was filed
on Apr. 20, 1998; Karpeisky et al., 1998, Tetrahedron Lett., 39,
1131; Earnshaw and Gait, 1998, Biopolymers (Nucleic Acid Sciences),
48, 39-55; Verma and Eckstein, 1998, Annu. Rev. Biochem., 67,
99-134; and Burlina et al., 1997, Bioorg. Med. Chem., 5, 1999-2010;
all of the references are hereby incorporated in their totality by
reference herein). Such publications describe general methods and
strategies to determine the location of incorporation of sugar,
base and/or phosphate modifications and the like into nucleic acid
molecules without modulating catalysis, and are incorporated by
reference herein. In view of such teachings, similar modifications
can be used as described herein to modify the siNA nucleic acid
molecules of the instant invention so long as the ability of siNA
to promote RNAi is cells is not significantly inhibited.
[0303] While chemical modification of oligonucleotide
internucleotide linkages with phosphorothioate, phosphorodithioate,
and/or 5'-methylphosphonate linkages improves stability, excessive
modifications can cause some toxicity or decreased activity.
Therefore, when designing nucleic acid molecules, the amount of
these internucleotide linkages should be minimized. The reduction
in the concentration of these linkages should lower toxicity,
resulting in increased efficacy and higher specificity of these
molecules.
[0304] Short interfering nucleic acid (siNA) molecules having
chemical modifications that maintain or enhance activity are
provided. Such a nucleic acid is also generally more resistant to
nucleases than an unmodified nucleic acid. Accordingly, the in
vitro and/or in vivo activity should not be significantly lowered.
In cases in which modulation is the goal, therapeutic nucleic acid
molecules delivered exogenously should optimally be stable within
cells until translation of the target RNA has been modulated long
enough to reduce the levels of the undesirable protein. This period
of time varies between hours to days depending upon the disease
state. Improvements in the chemical synthesis of RNA and DNA
(Wincott et al., 1995, Nucleic Acids Res. 23, 2677; Caruthers et
al., 1992, Methods in Enzymology 211, 3-19 (incorporated by
reference herein)) have expanded the ability to modify nucleic acid
molecules by introducing nucleotide modifications to enhance their
nuclease stability, as described above.
[0305] In one embodiment, nucleic acid molecules of the invention
include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more) G-clamp nucleotides. A G-clamp nucleotide is a modified
cytosine analog wherein the modifications confer the ability to
hydrogen bond both Watson-Crick and Hoogsteen faces of a
complementary guanine within a duplex, see for example Lin and
Matteucci, 1998, J. Am. Chem. Soc., 120, 8531-8532. A single
G-clamp analog substitution within an oligonucleotide can result in
substantially enhanced helical thermal stability and mismatch
discrimination when hybridized to complementary oligonucleotides.
The inclusion of such nucleotides in nucleic acid molecules of the
invention results in both enhanced affinity and specificity to
nucleic acid targets, complementary sequences, or template strands.
In another embodiment, nucleic acid molecules of the invention
include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more) LNA "locked nucleic acid" nucleotides such as a 2',4'-C
methylene bicyclo nucleotide (see for example Wengel et al.,
International PCT Publication No. WO 00/66604 and WO 99/14226).
[0306] In another embodiment, the invention features conjugates
and/or complexes of siNA molecules of the invention. Such
conjugates and/or complexes can be used to facilitate delivery of
siNA molecules into a biological system, such as a cell. The
conjugates and complexes provided by the instant invention can
impart therapeutic activity by transferring therapeutic compounds
across cellular membranes, altering the pharmacokinetics, and/or
modulating the localization of nucleic acid molecules of the
invention. The present invention encompasses the design and
synthesis of novel conjugates and complexes for the delivery of
molecules, including, but not limited to, small molecules, lipids,
cholesterol, phospholipids, nucleosides, nucleotides, nucleic
acids, antibodies, toxins, negatively charged polymers and other
polymers, for example proteins, peptides, hormones, carbohydrates,
polyethylene glycols, or polyamines, across cellular membranes. In
general, the transporters described are designed to be used either
individually or as part of a multi-component system, with or
without degradable linkers. These compounds are expected to improve
delivery and/or localization of nucleic acid molecules of the
invention into a number of cell types originating from different
tissues, in the presence or absence of serum (see Sullenger and
Cech, U.S. Pat. No. 5,854,038). Conjugates of the molecules
described herein can be attached to biologically active molecules
via linkers that are biodegradable, such as biodegradable nucleic
acid linker molecules.
[0307] The term "biodegradable linker" as used herein, refers to a
nucleic acid or non-nucleic acid linker molecule that is designed
as a biodegradable linker to connect one molecule to another
molecule, for example, a biologically active molecule to an siNA
molecule of the invention or the sense and antisense strands of an
siNA molecule of the invention. The biodegradable linker is
designed such that its stability can be modulated for a particular
purpose, such as delivery to a particular tissue or cell type. The
stability of a nucleic acid-based biodegradable linker molecule can
be modulated by using various chemistries, for example combinations
of ribonucleotides, deoxyribonucleotides, and chemically modified
nucleotides, such as 2'-O-methyl, 2'-fluoro, 2'-amino, 2'-O-amino,
2'-C-allyl, 2'-O-allyl, and other 2'-modified or base modified
nucleotides. The biodegradable nucleic acid linker molecule can be
a dimer, trimer, tetramer or longer nucleic acid molecule, for
example, an oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, or
can comprise a single nucleotide with a phosphorus-based linkage,
for example, a phosphoramidate or phosphodiester linkage. The
biodegradable nucleic acid linker molecule can also comprise
nucleic acid backbone, nucleic acid sugar, or nucleic acid base
modifications.
[0308] The term "biodegradable" as used herein, refers to
degradation in a biological system, for example, enzymatic
degradation or chemical degradation.
[0309] The term "biologically active molecule" as used herein
refers to compounds or molecules that are capable of eliciting or
modifying a biological response in a system. Non-limiting examples
of biologically active siNA molecules either alone or in
combination with other molecules contemplated by the instant
invention include therapeutically active molecules such as
antibodies, cholesterol, hormones, antivirals, peptides, proteins,
chemotherapeutics, small molecules, vitamins, co-factors,
nucleosides, nucleotides, oligonucleotides, enzymatic nucleic
acids, antisense nucleic acids, triplex forming oligonucleotides,
2,5-A chimeras, siNA, dsRNA, allozymes, aptamers, decoys and
analogs thereof. Biologically active molecules of the invention
also include molecules capable of modulating the pharmacokinetics
and/or pharmacodynamics of other biologically active molecules, for
example, lipids and polymers such as polyamines, polyamides,
polyethylene glycol and other polyethers.
[0310] The term "phospholipid" as used herein, refers to a
hydrophobic molecule comprising at least one phosphorus group. For
example, a phospholipid can comprise a phosphorus-containing group
and saturated or unsaturated alkyl group, optionally substituted
with OH, COOH, oxo, amine, or substituted or unsubstituted aryl
groups.
[0311] Therapeutic nucleic acid molecules (e.g., siNA molecules)
delivered exogenously optimally are stable within cells until
reverse transcription of the RNA has been modulated long enough to
reduce the levels of the RNA transcript. The nucleic acid molecules
are resistant to nucleases in order to function as effective
intracellular therapeutic agents. Improvements in the chemical
synthesis of nucleic acid molecules described in the instant
invention and in the art have expanded the ability to modify
nucleic acid molecules by introducing nucleotide modifications to
enhance their nuclease stability as described above.
[0312] In yet another embodiment, siNA molecules having chemical
modifications that maintain or enhance enzymatic activity of
proteins involved in RNAi are provided. Such nucleic acids are also
generally more resistant to nucleases than unmodified nucleic
acids. Thus, in vitro and/or in vivo the activity should not be
significantly lowered.
[0313] Use of the nucleic acid-based molecules of the invention
will lead to better treatments by affording the possibility of
combination therapies (e.g., multiple siNA molecules targeted to
different genes; nucleic acid molecules coupled with known small
molecule modulators; or intermittent treatment with combinations of
molecules, including different motifs and/or other chemical or
biological molecules). The treatment of subjects with siNA
molecules can also include combinations of different types of
nucleic acid molecules, such as enzymatic nucleic acid molecules
(ribozymes), allozymes, antisense, 2,5-A oligoadenylate, decoys,
and aptamers.
[0314] In another aspect an siNA molecule of the invention
comprises one or more 5' and/or a 3'-cap structure, for example, on
only the sense siNA strand, the antisense siNA strand, or both siNA
strands.
[0315] By "cap structure" is meant chemical modifications, which
have been incorporated at either terminus of the oligonucleotide
(see, for example, Adamic et al., U.S. Pat. No. 5,998,203,
incorporated by reference herein). These terminal modifications
protect the nucleic acid molecule from exonuclease degradation, and
may help in delivery and/or localization within a cell. The cap may
be present at the 5'-terminus (5'-cap) or at the 3'-terminal
(3'-cap) or may be present on both termini. In non-limiting
examples, the 5'-cap includes, but is not limited to, glyceryl,
inverted deoxy abasic residue (moiety); 4',5'-methylene nucleotide;
1-(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide;
carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide;
L-nucleotides; alpha-nucleotides; modified base nucleotide;
phosphorodithioate linkage; threo-pentofuranosyl nucleotide;
acyclic 3',4'-seco nucleotide; acyclic 3,4-dihydroxybutyl
nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3'-3'-inverted
nucleotide moiety; 3'-3'-inverted abasic moiety; 3'-2'-inverted
nucleotide moiety; 3'-2'-inverted abasic moiety; 1,4-butanediol
phosphate; 3'-phosphoramidate; hexylphosphate; aminohexyl
phosphate; 3'-phosphate; 3'-phosphorothioate; phosphorodithioate;
or bridging or non-bridging methylphosphonate moiety. Non-limiting
examples of cap moieties are shown in FIG. 10.
[0316] Non-limiting examples of the 3'-cap include, but are not
limited to, glyceryl, inverted deoxy abasic residue (moiety),
4',5'-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide;
4'-thio nucleotide, carbocyclic nucleotide; 5'-amino-alkyl
phosphate; 1,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate;
6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl
phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide;
alpha-nucleotide; modified base nucleotide; phosphorodithioate;
threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide;
3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide,
5'-5'-inverted nucleotide moiety; 5'-5'-inverted abasic moiety;
5'-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate;
5'-amino; bridging and/or non-bridging 5'-phosphoramidate,
phosphorothioate and/or phosphorodithioate, bridging or non
bridging methylphosphonate and 5''-mercapto moieties (for more
details see Beaucage and Iyer, 1993, Tetrahedron 49, 1925;
incorporated by reference herein).
[0317] By the term "non-nucleotide" is meant any group or compound
which can be incorporated into a nucleic acid chain in the place of
one or more nucleotide units, including either sugar and/or
phosphate substitutions, and allows the remaining bases to exhibit
their enzymatic activity. The group or compound is abasic in that
it does not contain a commonly recognized nucleotide base, such as
adenosine, guanine, cytosine, uracil or thymine and therefore lacks
a base at the 1'-position.
[0318] An "alkyl" group refers to a saturated aliphatic
hydrocarbon, including straight-chain, branched-chain, and cyclic
alkyl groups. Preferably, the alkyl group has 1 to 12 carbons. More
preferably, it is a lower alkyl of from 1 to 7 carbons, more
preferably 1 to 4 carbons. The alkyl group can be substituted or
unsubstituted. When substituted the substituted group(s) is
preferably, hydroxyl, cyano, alkoxy, .dbd.O, .dbd.S, NO.sub.2 or
N(CH.sub.3).sub.2, amino, or SH. The term also includes alkenyl
groups that are unsaturated hydrocarbon groups containing at least
one carbon-carbon double bond, including straight-chain,
branched-chain, and cyclic groups. Preferably, the alkenyl group
has 1 to 12 carbons. More preferably, it is a lower alkenyl of from
1 to 7 carbons, more preferably 1 to 4 carbons. The alkenyl group
may be substituted or unsubstituted. When substituted the
substituted group(s) is preferably, hydroxyl, cyano, alkoxy,
.dbd.O, .dbd.S, NO.sub.2, halogen, N(CH.sub.3).sub.2, amino, or SH.
The term "alkyl" also includes alkynyl groups that have an
unsaturated hydrocarbon group containing at least one carbon-carbon
triple bond, including straight-chain, branched-chain, and cyclic
groups. Preferably, the alkynyl group has 1 to 12 carbons. More
preferably, it is a lower alkynyl of from 1 to 7 carbons, more
preferably 1 to 4 carbons. The alkynyl group may be substituted or
unsubstituted: When substituted the substituted group(s) is
preferably, hydroxyl, cyano, alkoxy, .dbd.O, .dbd.S, NO.sub.2 or
N(CH.sub.3).sub.2, amino or SH.
[0319] Such alkyl groups can also include aryl, alkylaryl,
carbocyclic aryl, heterocyclic aryl, amide and ester groups. An
"aryl" group refers to an aromatic group that has at least one ring
having a conjugated pi electron system and includes carbocyclic
aryl, heterocyclic aryl and biaryl groups, all of which may be
optionally substituted. The preferred substituent(s) of aryl groups
are halogen, trihalomethyl, hydroxyl, SH, OH, cyano, alkoxy, alkyl,
alkenyl, alkynyl, and amino groups. An "alkylaryl" group refers to
an alkyl group (as described above) covalently joined to an aryl
group (as described above). Carbocyclic aryl groups are groups
wherein the ring atoms on the aromatic ring are all carbon atoms.
The carbon atoms are optionally substituted. Heterocyclic aryl
groups are groups having from 1 to 3 heteroatoms as ring atoms in
the aromatic ring and the remainder of the ring atoms are carbon
atoms. Suitable heteroatoms include oxygen, sulfur, and nitrogen,
and suitable heterocyclic groups include furanyl, thienyl, pyridyl,
pyrrolyl, N-lower alkyl pyrrolo, pyrimidyl, pyrazinyl, imidazolyl
and the like, all optionally substituted. An "amide" refers to an
--C(O)--NH--R, where R is either alkyl, aryl, alkylaryl or
hydrogen. An "ester" refers to an --C(O)--OR', where R is either
alkyl, aryl, alkylaryl or hydrogen.
[0320] "Nucleotide" as used herein, and as recognized in the art,
includes natural bases (standard), and modified bases well known in
the art. Such bases are generally located at the 1' position of a
nucleotide sugar moiety. Nucleotides generally comprise a base,
sugar and a phosphate group. The nucleotides can be unmodified or
modified at the sugar, phosphate and/or base moiety, (also referred
to interchangeably as nucleotide analogs, modified nucleotides,
non-natural nucleotides, non-standard nucleotides and other; see,
for example, Usman and McSwiggen, supra; Eckstein et al.,
International PCT Publication No. WO 92/07065; Usman et al.,
International PCT Publication No. WO 93/15187; Uhlman & Peyman,
supra, all are hereby incorporated by reference herein). There are
several examples of modified nucleic acid bases known in the art as
summarized by Limbach et al., 1994, Nucleic Acids Res. 22, 2183.
Some of the non-limiting examples of base modifications that can be
introduced into nucleic acid molecules include, inosine, purine,
pyridin-4-one, pyridin-2-one, phenyl, pseudouracil,
2,4,6-trimethoxy benzene, 3-methyl uracil, dihydrouridine,
naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine),
5-alkyluridines (e.g., ribothymidine), 5-halouridine (e.g.,
5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g.
6-methyluridine), propyne, and others (Burgin et al., 1996,
Biochemistry, 35, 14090; Uhlman & Peyman, supra). By "modified
bases" in this aspect is meant nucleotide bases other than adenine,
guanine, cytosine and uracil at 1' position or their
equivalents.
[0321] In one embodiment, the invention features modified siNA
molecules, with phosphate backbone modifications comprising one or
more phosphorothioate, phosphorodithioate, methylphosphonate,
phosphotriester, morpholino, amidate carbamate, carboxymethyl,
acetamidate, polyamide, sulfonate, sulfonamide, sulfamate,
formacetal, thioformacetal, and/or alkylsilyl, substitutions. For a
review of oligonucleotide backbone modifications, see Hunziker and
Leumann, 1995, Nucleic Acid Analogues: Synthesis and Properties, in
Modern Synthetic Methods, VCH, 331-417, and Mesmaeker et al., 1994,
Novel Backbone Replacements for Oligonucleotides, in Carbohydrate
Modifications in Antisense Research, ACS, 24-39.
[0322] By "abasic" is meant sugar moieties lacking a base or having
other chemical groups in place of a base at the 1' position, see
for example Adamic et al., U.S. Pat. No. 5,998,203.
[0323] By "unmodified nucleoside" is meant one of the bases
adenine, cytosine, guanine, thymine, or uracil joined to the 1'
carbon of .beta.-D-ribo-furanose.
[0324] By "modified nucleoside" is meant any nucleotide base which
contains a modification in the chemical structure of an unmodified
nucleotide base, sugar and/or phosphate. Non-limiting examples of
modified nucleotides are shown by Formulae I-VII and/or other
modifications described herein.
[0325] In connection with 2'-modified nucleotides as described for
the present invention, by "amino" is meant 2'--NH.sub.2 or
2'-O--NH.sub.2, which can be modified or unmodified. Such modified
groups are described, for example, in Eckstein et al., U.S. Pat.
No. 5,672,695 and Matulic-Adamic et al., U.S. Pat. No. 6,248,878,
which are both incorporated by reference in their entireties.
[0326] Various modifications to nucleic acid siNA structure can be
made to enhance the utility of these molecules. Such modifications
will enhance shelf-life, half-life in vitro, stability, and ease of
introduction of such oligonucleotides to the target site, e.g., to
enhance penetration of cellular membranes, and confer the ability
to recognize and bind to targeted cells.
Administration of Nucleic Acid Molecules
[0327] An siNA molecule of the invention can be adapted for use to
treat or prevent diseases, traits, or conditions associated with
muscular atrophy, muscle weakness, muscle dysfunction, or muscle
destruction, including muscular dystrophy, myotonic dystrophy,
myotonia congentia, poliomyelitis, amyotrophic lateral sclerosis
(ALS or Lou Gehrig's disease), Guillain-Barre syndrome, muscle
wasting (e.g., age or HIV related), sarcopenia, myalgias,
myopathies, hypotonis, hypotonia, cachexia, spinal cord injury, or
muscle injury, or any other related trait, disease or condition
that is related to or will respond to the levels of myostatin in a
cell or tissue, alone or in combination with other therapies.
Nucleic acid molecules of the invention can also be adapted to
treat or prevent obesity, diabetes (e.g., type I and type II), and
insulin resistance in a subject. Alternately the nucleic acid
molecules of the instant invention, individually, or in combination
or in conjunction with other drugs, can be adapted for use to
promote muscle hypertrophy, including use for increased strength,
athleticism, bodybuilding, prevention of muscle atrophy (e.g., in
astronauts), or cosmetic applications in a subject or organism. For
example, an siNA molecule can comprise a delivery vehicle,
including liposomes, for administration to a subject, carriers and
diluents and their salts, and/or can be present in pharmaceutically
acceptable formulations. Methods for the delivery of nucleic acid
molecules are described in Akhtar et al., 1992, Trends Cell Bio.,
2, 139; Delivery Strategies for Antisense Oligonucleotide
Therapeutics, ed. Akhtar, 1995, Maurer et al., 1999, Mol. Membr.
Biol., 16, 129-140; Hofland and Huang, 1999, Handb. Exp.
Pharmacol., 137, 165-192; and Lee et al., 2000, ACS Symp. Ser.,
752, 184-192, all of which are incorporated herein by reference.
Beigelman et al., U.S. Pat. No. 6,395,713 and Sullivan et al., PCT
WO 94/02595 further describe the general methods for delivery of
nucleic acid molecules. These protocols can be utilized for the
delivery of virtually any nucleic acid molecule. Nucleic acid
molecules can be administered to cells by a variety of methods
known to those of skill in the art, including, but not restricted
to, encapsulation in liposomes, by iontophoresis, or by
incorporation into other vehicles, such as biodegradable polymers,
hydrogels, cyclodextrins (see for example Gonzalez et al., 1999,
Bioconjugate Chem., 10, 1068-1074; Wang et al., International PCT
publication Nos. WO 03/47518 and WO 03/46185),
poly(lactic-co-glycolic)acid (PLGA) and PLCA microspheres (see for
example U.S. Pat. No. 6,447,796 and US Patent Application
Publication No. US 2002130430), biodegradable nanocapsules, and
bioadhesive microspheres, or by proteinaceous vectors (O'Hare and
Normand, International PCT Publication No. WO 00/53722). In another
embodiment, the nucleic acid molecules of the invention can also be
formulated or complexed with polyethyleneimine and derivatives
thereof, such as
polyethyleneimine-polyethyleneglycol-N-acetylgalactosamine
(PEI-PEG-GAL) or
polyethyleneimine-polyethyleneglycol-tri-N-acetylgalactosamine
(PEI-PEG-triGAL) derivatives.
[0328] In one embodiment, an siNA molecule of the invention is
complexed with membrane disruptive agents such as those described
in U.S. Patent Application Publication No. 20010007666,
incorporated by reference herein in its entirety including the
drawings. In another embodiment, the membrane disruptive agent or
agents and the siNA molecule are also complexed with a cationic
lipid or helper lipid molecule, such as those lipids described in
U.S. Pat. No. 6,235,310, incorporated by reference herein in its
entirety including the drawings.
[0329] In one embodiment, an siNA molecule of the invention is
complexed with delivery systems as described in U.S. Patent
Application Publication No. 2003077829 and International PCT
Publication Nos. WO 00/03683 and WO 02/087541, all incorporated by
reference herein in their entirety including the drawings.
[0330] In one embodiment, the invention features the use of methods
to deliver the nucleic acid molecules of the instant invention to
muscle tissue. Non limiting examples of such methods as are known
in the art are described for example in Wells et al., 2003, FEBS
Lett., 552, 145-9; Murakami et al., 2003, Muscle Nerve., 27,
237-41; Lu et al., 2003, Nature Medicine., 9, 1009-14; Rando et
al., 2000, PNAS, 97, 5363-8; and Gollins et al., 2003, Gene Ther.,
10, 504-12; Yuasa et al., 2002, Gene Ther., 23, 1576-88; Liu et al,
2001, Mol Ther., 4, 45-51; and Fassati et al., 1997, J Clin
Invest., 100, 620-8.
[0331] In one embodiment, dermal delivery systems of the invention
include, for example, aqueous and nonaqueous gels, creams, multiple
emulsions, microemulsions, liposomes, ointments, aqueous and
nonaqueous solutions, lotions, aerosols, hydrocarbon bases and
powders, and can contain excipients such as solubilizers,
permeation enhancers (e.g., fatty acids, fatty acid esters, fatty
alcohols and amino acids), and hydrophilic polymers (e.g.,
polycarbophil and polyvinylpyrolidone). In one embodiment, the
pharmaceutically acceptable carrier is a liposome or a transdermal
enhancer. Examples of liposomes which can be used in this invention
include the following: (1) CellFectin, 1:1.5 (M/M) liposome
formulation of the cationic lipid
N,NI,NII,NIII-tetramethyl-N,NI,NII,NIII-tetrapalmit-y-spermine and
dioleoyl phosphatidylethanolamine (DOPE) (GIBCO BRL); (2)
Cytofectin GSV, 2:1 (M/M) liposome formulation of a cationic lipid
and DOPE (Glen Research); (3) DOTAP
(N-[1-(2,3-dioleoyloxy)-N,N,N-tri-methyl-ammoniummethylsulfate)
(Boehringer Manheim); and (4) Lipofectamine, 3:1 (M/M) liposome
formulation of the polycationic lipid DOSPA and the neutral lipid
DOPE (GIBCO BRL).
[0332] In one embodiment, siNA molecules of the invention are
formulated or complexed with polyethylenimine (e.g., linear or
branched PEI) and/or polyethylenimine derivatives, including for
example grafted PEIs such as galactose PEI, cholesterol PEI,
antibody derivatized PEI, and polyethylene glycol PEI (PEG-PEI)
derivatives thereof (see for example Ogris et al., 2001, AAPA Pharm
Sci, 3, 1-11; Furgeson et al., 2003, Bioconjugate Chem., 14,
840-847; Kunath et al., 2002, Pharmaceutical Research, 19, 810-817;
Choi et al., 2001, Bull. Korean Chem. Soc., 22, 46-52; Bettinger et
al., 1999, Bioconjugate Chem., 10, 558-561; Peterson et al., 2002,
Bioconjugate Chem., 13, 845-854; Erbacher et al., 1999, Journal of
Gene Medicine Preprint, 1, 1-18; Godbey et al., 1999., PNAS USA,
96, 5177-5181; Godbey et al., 1999, Journal of Controlled Release,
60, 149-160; Diebold et al., 1999, Journal of Biological Chemistry,
274, 19087-19094; Thomas and Klibanov, 2002, PNAS USA, 99,
14640-14645; and Sagara, U.S. Pat. No. 6,586,524, incorporated by
reference herein.
[0333] In one embodiment, an siNA molecule of the invention
comprises a bioconjugate, for example a nucleic acid conjugate as
described in Vargeese et al., U.S. Ser. No. 10/427,160, filed Apr.
30, 2003; U.S. Pat. No. 6,528,631; U.S. Pat. No. 6,335,434; U.S.
Pat. No. 6,235,886; U.S. Pat. No. 6,153,737; U.S. Pat. No.
5,214,136; U.S. Pat. No. 5,138,045, all incorporated by reference
herein.
[0334] In one embodiment, the invention features a pharmaceutical
composition comprising one or more nucleic acid(s) of the invention
in an acceptable carrier, such as a stabilizer, buffer, and the
like. The polynucleotides of the invention can be administered
(e.g., RNA, DNA or protein) and introduced to a subject by any
standard means, with or without stabilizers, buffers, and the like,
to form a pharmaceutical composition. When it is desired to use a
liposome delivery mechanism, standard protocols for formation of
liposomes can be followed. The compositions of the present
invention can also be formulated and used as creams, gels, sprays,
oils and other suitable compositions for topical, dermal, or
transdermal administration as is known in the art.
[0335] The present invention also includes pharmaceutically
acceptable formulations of the compounds described. These
formulations include salts of the above compounds, e.g., acid
addition salts, for example, salts of hydrochloric, hydrobromic,
acetic acid, and benzene sulfonic acid.
[0336] A pharmacological composition or formulation refers to a
composition or formulation in a form suitable for administration,
e.g., systemic or local administration, into a cell or subject,
including for example a human. Suitable forms, in part, depend upon
the use or the route of entry, for example oral, transdermal, or by
injection. Such forms should not prevent the composition or
formulation from reaching a target cell (i.e., a cell to which the
negatively charged nucleic acid is desirable for delivery). For
example, pharmacological compositions injected into the blood
stream should be soluble. Other factors are known in the art, and
include considerations such as toxicity and forms that prevent the
composition or formulation from exerting its effect.
[0337] In one embodiment, siNA molecules of the invention are
administered to a subject by systemic administration in a
pharmaceutically acceptable composition or formulation. By
"systemic administration" is meant in vivo systemic absorption or
accumulation of drugs in the blood stream followed by distribution
throughout the entire body. Administration routes that lead to
systemic absorption include, without limitation: intravenous,
subcutaneous, intraperitoneal, inhalation, oral, intrapulmonary and
intramuscular. Each of these administration routes exposes the siNA
molecules of the invention to an accessible diseased tissue. The
rate of entry of a drug into the circulation has been shown to be a
function of molecular weight or size. The use of a liposome or
other drug carrier comprising the compounds of the instant
invention can potentially localize the drug, for example, in
certain tissue types, such as the tissues of the reticular
endothelial system (RES). A liposome formulation that can
facilitate the association of drug with the surface of cells, such
as, lymphocytes and macrophages is also useful. This approach can
provide enhanced delivery of the drug to target cells by taking
advantage of the specificity of macrophage and lymphocyte immune
recognition of abnormal cells.
[0338] By "pharmaceutically acceptable formulation" or
"pharmaceutically acceptable composition" is meant, a composition
or formulation that allows for the effective distribution of the
nucleic acid molecules of the instant invention in the physical
location most suitable for their desired activity. Non-limiting
examples of agents suitable for formulation with the nucleic acid
molecules of the instant invention include: P-glycoprotein
inhibitors (such as Pluronic P85),; biodegradable polymers, such as
poly (DL-lactide-coglycolide) microspheres for sustained release
delivery (Emerich, D F et al, 1999, Cell Transplant, 8, 47-58); and
loaded nanoparticles, such as those made of polybutylcyanoacrylate.
Other non-limiting examples of delivery strategies for the nucleic
acid molecules of the instant invention include material described
in Boado et al., 1998, J. Pharm. Sci., 87, 1308-1315; Tyler et al.,
1999, FEBS Lett., 421, 280-284; Pardridge et al., 1995, PNAS USA.,
92, 5592-5596; Boado, 1995, Adv. Drug Delivery Rev., 15, 73-107;
Aldrian-Herrada et al., 1998, Nucleic Acids Res., 26, 4910-4916;
and Tyler et al., 1999, PNAS USA., 96, 7053-7058.
[0339] The invention also features the use of the composition
comprising surface-modified liposomes containing poly (ethylene
glycol) lipids (PEG-modified, or long-circulating liposomes or
stealth liposomes). These formulations offer a method for
increasing the accumulation of drugs in target tissues. This class
of drug carriers resists opsonization and elimination by the
mononuclear phagocytic system (MPS or RES), thereby enabling longer
blood circulation times and enhanced tissue exposure for the
encapsulated drug (Lasic et al. Chem. Rev. 1995, 95, 2601-2627;
Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011). Such
liposomes have been shown to accumulate selectively in tumors,
presumably by extravasation and capture in the neovascularized
target tissues (Lasic et al., Science 1995, 267, 1275-1276; Oku et
al., 1995, Biochim. Biophys. Acta, 1238, 86-90). The
long-circulating liposomes enhance the pharmacokinetics and
pharmacodynamics of DNA and RNA, particularly compared to
conventional cationic liposomes which are known to accumulate in
tissues of the MPS (Liu et al., J. Biol. Chem. 1995, 42,
24864-24870; Choi et al., International PCT Publication No. WO
96/10391; Ansell et al., International PCT Publication No. WO
96/10390; Holland et al., International PCT Publication No. WO
96/10392). Long-circulating liposomes are also likely to protect
drugs from nuclease degradation to a greater extent compared to
cationic liposomes, based on their ability to avoid accumulation in
metabolically aggressive MPS tissues such as the liver and
spleen.
[0340] The present invention also includes compositions prepared
for storage or administration that include a pharmaceutically
effective amount of the desired compounds in a pharmaceutically
acceptable carrier or diluent. Acceptable carriers or diluents for
therapeutic use are well known in the pharmaceutical art, and are
described, for example, in Remington's Pharmaceutical Sciences,
Mack Publishing Co. (A. R. Gennaro edit. 1985), hereby incorporated
by reference herein. For example, preservatives, stabilizers, dyes
and flavoring agents can be provided. These include sodium
benzoate, sorbic acid and esters of p-hydroxybenzoic acid. In
addition, antioxidants and suspending agents can be used.
[0341] A pharmaceutically effective dose is that dose required to
prevent, inhibit the occurrence, or treat (alleviate a symptom to
some extent, preferably all of the symptoms) of a disease state.
The pharmaceutically effective dose depends on the type of disease,
the composition used, the route of administration, the type of
mammal being treated, the physical characteristics of the specific
mammal under consideration, concurrent medication, and other
factors that those skilled in the medical arts will recognize.
Generally, an amount between 0.1 mg/kg and 100 mg/kg body
weight/day of active ingredients is administered dependent upon
potency of the negatively charged polymer.
[0342] The nucleic acid molecules of the invention and formulations
thereof can be administered orally, topically, parenterally, by
inhalation or spray, or rectally in dosage unit formulations
containing conventional non-toxic pharmaceutically acceptable
carriers, adjuvants and/or vehicles. The term parenteral as used
herein includes percutaneous, subcutaneous, intravascular (e.g.,
intravenous), intramuscular, or intrathecal injection or infusion
techniques and the like. In addition, there is provided a
pharmaceutical formulation comprising a nucleic acid molecule of
the invention and a pharmaceutically acceptable carrier. One or
more nucleic acid molecules of the invention can be present in
association with one or more non-toxic pharmaceutically acceptable
carriers and/or diluents and/or adjuvants, and if desired other
active ingredients. The pharmaceutical compositions containing
nucleic acid molecules of the invention can be in a form suitable
for oral use, for example, as tablets, troches, lozenges, aqueous
or oily suspensions, dispersible powders or granules, emulsion,
hard or soft capsules, or syrups or elixirs.
[0343] Compositions intended for oral use can be prepared according
to any method known to the art for the manufacture of
pharmaceutical compositions and such compositions can contain one
or more such sweetening agents, flavoring agents, coloring agents
or preservative agents in order to provide pharmaceutically elegant
and palatable preparations. Tablets contain the active ingredient
in admixture with non-toxic pharmaceutically acceptable excipients
that are suitable for the manufacture of tablets. These excipients
can be, for example, inert diluents; such as calcium carbonate,
sodium carbonate, lactose, calcium phosphate or sodium phosphate;
granulating and disintegrating agents, for example, corn starch, or
alginic acid; binding agents, for example starch, gelatin or
acacia; and lubricating agents, for example magnesium stearate,
stearic acid or talc. The tablets can be uncoated or they can be
coated by known techniques. In some cases such coatings can be
prepared by known techniques to delay disintegration and absorption
in the gastrointestinal tract and thereby provide a sustained
action over a longer period. For example, a time delay material
such as glyceryl monosterate or glyceryl distearate can be
employed.
[0344] Formulations for oral use can also be presented as hard
gelatin capsules wherein the active ingredient is mixed with an
inert solid diluent, for example, calcium carbonate, calcium
phosphate or kaolin, or as soft gelatin capsules wherein the active
ingredient is mixed with water or an oil medium, for example peanut
oil, liquid paraffin or olive oil.
[0345] Aqueous suspensions contain the active materials in a
mixture with excipients suitable for the manufacture of aqueous
suspensions. Such excipients are suspending agents, for example
sodium carboxymethylcellulose, methylcellulose,
hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone,
gum tragacanth and gum acacia; dispersing or wetting agents can be
a naturally-occurring phosphatide, for example, lecithin, or
condensation products of an alkylene oxide with fatty acids, for
example polyoxyethylene stearate, or condensation products of
ethylene oxide with long chain aliphatic alcohols, for example
heptadecaethyleneoxycetanol, or condensation products of ethylene
oxide with partial esters derived from fatty acids and a hexitol
such as polyoxyethylene sorbitol monooleate, or condensation
products of ethylene oxide with partial esters derived from fatty
acids and hexitol anhydrides, for example polyethylene sorbitan
monooleate. The aqueous suspensions can also contain one or more
preservatives, for example ethyl, or n-propyl p-hydroxybenzoate,
one or more coloring agents, one or more flavoring agents, and one
or more sweetening agents, such as sucrose or saccharin.
[0346] Oily suspensions can be formulated by suspending the active
ingredients in a vegetable oil, for example arachis oil, olive oil,
sesame oil or coconut oil, or in a mineral oil such as liquid
paraffin. The oily suspensions can contain a thickening agent, for
example beeswax, hard paraffin or cetyl alcohol. Sweetening agents
and flavoring agents can be added to provide palatable oral
preparations. These compositions can be preserved by the addition
of an anti-oxidant such as ascorbic acid
[0347] Dispersible powders and granules suitable for preparation of
an aqueous suspension by the addition of water provide the active
ingredient in admixture with a dispersing or wetting agent,
suspending agent and one or more preservatives. Suitable dispersing
or wetting agents or suspending agents are exemplified by those
already mentioned above. Additional excipients, for example
sweetening, flavoring and coloring agents, can also be present.
[0348] Pharmaceutical compositions of the invention can also be in
the form of oil-in-water emulsions. The oily phase can be a
vegetable oil or a mineral oil or mixtures of these. Suitable
emulsifying agents can be naturally-occurring gums, for example gum
acacia or gum tragacanth, naturally-occurring phosphatides, for
example soy bean, lecithin, and esters or partial esters derived
from fatty acids and hexitol, anhydrides, for example sorbitan
monooleate, and condensation products of the said partial esters
with ethylene oxide, for example polyoxyethylene sorbitan
monooleate. The emulsions can also contain sweetening and flavoring
agents.
[0349] Syrups and elixirs can be formulated with sweetening agents,
for example glycerol, propylene glycol, sorbitol, glucose or
sucrose. Such formulations can also contain a demulcent, a
preservative and flavoring and coloring agents. The pharmaceutical
compositions can be in the form of a sterile injectable aqueous or
oleaginous suspension. This suspension can be formulated according
to the known art using those suitable dispersing or wetting agents
and suspending agents that have been mentioned above. The sterile
injectable preparation can also be a sterile injectable solution or
suspension in a non-toxic parentally acceptable diluent or solvent,
for example as a solution in 1,3-butanediol. Among the acceptable
vehicles and solvents that can be employed are water, Ringer's
solution and isotonic sodium chloride solution. In addition,
sterile, fixed oils are conventionally employed as a solvent or
suspending medium. For this purpose, any bland fixed oil can be
employed including synthetic mono- or diglycerides. In addition,
fatty acids such as oleic acid find use in the preparation of
injectables.
[0350] The nucleic acid molecules of the invention can also be
administered in the form of suppositories, e.g., for rectal
administration of the drug. These compositions can be prepared by
mixing the drug with a suitable non-irritating excipient that is
solid at ordinary temperatures but liquid at the rectal temperature
and will therefore melt in the rectum to release the drug. Such
materials include cocoa butter and polyethylene glycols.
[0351] Nucleic acid molecules of the invention can be administered
parenterally in a sterile medium. The drug, depending on the
vehicle and concentration used, can either be suspended or
dissolved in the vehicle. Advantageously, adjuvants such as local
anesthetics, preservatives and buffering agents can be dissolved in
the vehicle.
[0352] Dosage levels of the order of from about 0.1 mg to about 140
mg per kilogram of body weight per day are useful in the treatment
of the above-indicated conditions (about 0.5 mg to about 7 g per
subject per day). The amount of active ingredient that can be
combined with the carrier materials to produce a single dosage form
varies depending upon the host treated and the particular mode of
administration. Dosage unit forms generally contain between from
about 1 mg to about 500 mg of an active ingredient.
[0353] It is understood that the specific dose level for any
particular subject depends upon a variety of factors including the
activity of the specific compound employed, the age, body weight,
general health, sex, diet, time of administration, route of
administration, and rate of excretion, drug combination and the
severity of the particular disease undergoing therapy.
[0354] For administration to non-human animals, the composition can
also be added to the animal feed or drinking water. It can be
convenient to formulate the animal feed and drinking water
compositions so that the animal takes in a therapeutically
appropriate quantity of the composition along with its diet. It can
also be convenient to present the composition as a premix for
addition to the feed or drinking water.
[0355] The nucleic acid molecules of the present invention can also
be administered to a subject in combination with other therapeutic
compounds to increase the overall therapeutic effect. The use of
multiple compounds to treat an indication can increase the
beneficial effects while reducing the presence of side effects.
[0356] Alternatively, certain siNA molecules of the instant
invention can be expressed within cells from eukaryotic promoters
(e.g., Izant and Weintraub, 1985, Science, 229, 345; McGarry and
Lindquist, 1986, Proc. Natl. Acad. Sci., USA 83, 399; Scanlon et
al., 1991, Proc. Natl. Acad. Sci. USA, 88, 10591-5; Kashani-Sabet
et al., 1992, Antisense Res. Dev., 2, 3-15; propulic et al., 1992,
J. Virol., 66, 1432-41; Weerasinghe et al., 1991, J. Virol., 65,
5531-4; Ojwang et al., 1992, Proc. Natl. Acad. Sci. USA, 89,
10802-6; Chen et al., 1992, Nucleic Acids Res., 20, 4581-9; Sarver
et al., 1990 Science, 247, 1222-1225; Thompson et al., 1995,
Nucleic Acids Res., 23, 2259; Good et al., 1997, Gene Therapy, 4,
45. Those skilled in the art realize that any nucleic acid can be
expressed in eukaryotic cells from the appropriate DNA/RNA vector.
The activity of such nucleic acids can be augmented by their
release from the primary transcript by a enzymatic nucleic acid
(Draper et al., PCT WO 93/23569, and Sullivan et al., PCT WO
94/02595; Ohkawa et al., 1992, Nucleic Acids Symp. Ser., 27, 15-6;
Taira et al., 1991, Nucleic Acids Res., 19, 5125-30; Ventura et
al., 1993, Nucleic Acids Res., 21, 3249-55; Chowrira et al., 1994,
J. Biol. Chem., 269, 25856.
[0357] In another aspect of the invention, RNA molecules of the
present invention can be expressed from transcription units (see
for example Couture et al., 1996, TIG., 12, 510) inserted into DNA
or RNA vectors. The recombinant vectors can be DNA plasmids or
viral vectors. siNA expressing viral vectors can be constructed
based on, but not limited to, adeno-associated virus, retrovirus,
adenovirus, or alphavirus. In another embodiment, pol III based
constructs are used to express nucleic acid molecules of the
invention (see for example Thompson, U.S. Pats. Nos. 5,902,880 and
6,146,886). The recombinant vectors capable of expressing the siNA
molecules can be delivered as described above, and persist in
target cells. Alternatively, viral vectors can be used that provide
for transient expression of nucleic acid molecules. Such vectors
can be repeatedly administered as necessary. Once expressed, the
siNA molecule interacts with the target mRNA and generates an RNAi
response. Delivery of siNA molecule expressing vectors can be
systemic, such as by intravenous or intra-muscular administration,
by administration to target cells ex-planted from a subject
followed by reintroduction into the subject, or by any other means
that would allow for introduction into the desired target cell (for
a review see Couture et al., 1996, TIG., 12, 510).
[0358] In one aspect the invention features an expression vector
comprising a nucleic acid sequence encoding at least one siNA
molecule of the instant invention. The expression vector can encode
one or both strands of an siNA duplex, or a single
self-complementary strand that self hybridizes into an siNA duplex.
The nucleic acid sequences encoding the siNA molecules of the
instant invention can be operably linked in a manner that allows
expression of the siNA molecule (see for example Paul et al., 2002,
Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature
Biotechnology, 19, 497; Lee et al., 2002, Nature Biotechnology, 19,
500; and Novina et al., 2002, Nature Medicine, advance online
publication doi: 10.1038/nm725).
[0359] In another aspect, the invention features an expression
vector comprising: a) a transcription initiation region (e.g.,
eukaryotic pol I, II or III initiation region); b) a transcription
termination region (e.g., eukaryotic pol I, II or III termination
region); and c) a nucleic acid sequence encoding at least one of
the siNA molecules of the instant invention, wherein said sequence
is operably linked to said initiation region and said termination
region in a manner that allows expression and/or delivery of the
siNA molecule. The vector can optionally include an open reading
frame (ORF) for a protein operably linked on the 5' side or the
3'-side of the sequence encoding the siNA of the invention; and/or
an intron (intervening sequences).
[0360] Transcription of the siNA molecule sequences can be driven
from a promoter for eukaryotic RNA polymerase I (pol I), RNA
polymerase II (pol II), or RNA polymerase III (pol III).
Transcripts from pol II or pol III promoters are expressed at high
levels in all cells; the levels of a given pol II promoter in a
given cell type depends on the nature of the gene regulatory
sequences (enhancers, silencers, etc.) present nearby. Prokaryotic
RNA polymerase promoters are also used, providing that the
prokaryotic RNA polymerase enzyme is expressed in the appropriate
cells (Elroy-Stein and Moss, 1990, Proc. Natl. Acad. Sci. USA, 87,
6743-7; Gao and Huang 1993, Nucleic Acids Res., 21, 2867-72; Lieber
et al., 1993, Methods Enzymol., 217, 47-66; Zhou et al., 1990, Mol.
Cell. Biol., 10, 4529-37). Several investigators have demonstrated
that nucleic acid molecules expressed from such promoters can
function in mammalian cells (e.g. Kashani-Sabet et al., 1992,
Antisense Res. Dev., 2, 3-15; Ojwang et al., 1992, Proc. Natl.
Acad. Sci. USA, 89, 10802-6; Chen et al., 1992, Nucleic Acids Res.,
20, 4581-9; Yu et al., 1993, Proc. Natl. Acad. Sci. USA, 90,
6340-4; L'Huillier et al., 1992, EMBO J., 11, 4411-8; Lisziewicz et
al., 1993, Proc. Natl. Acad. Sci. U.S. A, 90, 8000-4; Thompson et
al., 1995, Nucleic Acids Res., 23, 2259; Sullenger & Cech,
1993, Science, 262, 1566). More specifically, transcription units
such as the ones derived from genes encoding U6 small nuclear
(snRNA), transfer RNA (tRNA) and adenovirus VA RNA are useful in
generating high concentrations of desired RNA molecules such as
siNA in cells (Thompson et al., supra; Couture and Stinchcomb,
1996, supra; Noonberg et al., 1994, Nucleic Acid Res., 22, 2830;
Noonberg et al., U.S. Pat. No. 5,624,803; Good et al., 1997, Gene
Ther., 4, 45; Beigelman et al., International PCT Publication No.
WO 96/18736. The above siNA transcription units can be incorporated
into a variety of vectors for introduction into mammalian cells,
including but not restricted to, plasmid DNA vectors, viral DNA
vectors (such as adenovirus or adeno-associated virus vectors), or
viral RNA vectors (such as retroviral or alphavirus vectors) (for a
review see Couture and Stinchcomb, 1996, supra).
[0361] In another aspect the invention features an expression
vector comprising a nucleic acid sequence encoding at least one of
the siNA molecules of the invention in a manner that allows
expression of that siNA molecule. The expression vector comprises
in one embodiment; a) a transcription initiation region; b) a
transcription termination region; and c) a nucleic acid sequence
encoding at least one strand of the siNA molecule, wherein the
sequence is operably linked to the initiation region and the
termination region in a manner that allows expression and/or
delivery of the siNA molecule.
[0362] In another embodiment the expression vector comprises: a) a
transcription initiation region; b) a transcription termination
region; c) an open reading frame; and d) a nucleic acid sequence
encoding at least one strand of an siNA molecule, wherein the
sequence is operably linked to the 3'-end of the open reading frame
and wherein the sequence is operably linked to the initiation
region, the open reading frame and the termination region in a
manner that allows expression and/or delivery of the siNA molecule.
In yet another embodiment, the expression vector comprises: a) a
transcription initiation region; b) a transcription termination
region; c) an intron; and d) a nucleic acid sequence encoding at
least one siNA molecule, wherein the sequence is operably linked to
the initiation region, the intron and the termination region in a
manner which allows expression and/or delivery of the nucleic acid
molecule.
[0363] In another embodiment, the expression vector comprises: a) a
transcription initiation region; b) a transcription termination
region; c) an intron; d) an open reading frame; and e) a nucleic
acid sequence encoding at least one strand of an siNA molecule,
wherein the sequence is operably linked to the 3'-end of the open
reading frame and wherein the sequence is operably linked to the
initiation region, the intron, the open reading frame and the
termination region in a manner which allows expression and/or
delivery of the siNA molecule.
Myostatin Biology and Biochemistry
[0364] Myostatin, also known as MSTN, Growth/Differentiation Factor
8, and GDF8, is a member of the transforming growth factor-beta
superfamily which encompasses a large number of growth and
differentiation factors that play important roles in regulating
embryonic development and in maintaining tissue homeostasis in
adult animals. Myostatin is a member of this superfamily with a
role in the control and maintenance of skeletal muscle mass. The
myostatin gene is expressed specifically in developing and adult
skeletal muscle. The gene encodes a 376-amino acid polypeptide that
contains all the sequence hallmarks of the TGF-beta superfamily.
During early stages of embryogenesis, myostatin expression is
restricted to the myotome compartment of developing somites. At
later stages and in adult animals, myostatin is expressed in many
different muscles throughout the body. Myostatin is transcribed as
a 3.1-kb mRNA species that encodes a 335-amino acid precursor
protein. Myostatin is expressed uniquely in human skeletal muscle
as a 26-kD mature glycoprotein (myostatin-immunoreactive protein)
and is secreted into the plasma. Myostatin immunoreactivity is
detectable in human skeletal muscle in both type 1 and type 2
muscle fibers.
[0365] Several investigations have studied the role of myostatin in
muscle modeling. Myostatin expression correlates inversely with
fat-free mass in humans. Increased expression of the myostatin gene
is associated with weight loss in men with AIDS wasting syndrome.
Gonzalez-Cadavid et al., 1998, PNAS, 95, 14938-14943 examined the
expression of myostatin in skeletal muscle and serum of healthy and
HIV-infected men. The serum and intramuscular concentrations of
myostatin-immunoreactive protein were increased in HIV-infected men
with weight loss compared with healthy men and correlated inversely
with fat-free mass index. Zimmers et al., 2002, Science, 296,
1486-1488, induced cachexia in mice by systemically administered
myostatin. Systemic overexpression of myostatin in adult mice was
found to induce profound muscle and fat loss without diminution of
nutrient intake. This effect is similar to that seen in human
cachexia syndromes, and suggests that myostatin can be a useful
pharmacologic target in clinical settings such as cachexia, where
muscle growth is desired. Schuelke et al., 2004, N. Engl. J. Med.,
350, 2682-88, describe a young male with a loss of function
mutation in the myostatin gene characterized by profound muscle
hypertrophy and increased strength compared to similar aged
subjects or the general population.
[0366] The role of myostatin has been studied in various animals.
McPerron et al., 1997, Nature, 387, 83-90, disrupted the myostatin
gene by gene targeting in mice. Myostatin-null animals were
significantly larger than wildtype animals and showed a large and
widespread increase in skeletal muscle mass. Individual muscles of
mutant animals weighed 2 to 3 times more than those of wildtype
animals, and the increase in mass appeared to result from a
combination of muscle cell hyperplasia and hypertrophy. The authors
suggested that myostatin functions specifically as a negative
regulator of skeletal muscle growth. Furthermore, Lin et al., 2002,
Biochem. Biophys. Res. Commun., 291, 701-706, observed increased
skeletal muscle mass in a myostatin-null mouse model compared to
wildtype animals as early as 4 weeks of age. The mutant mice showed
reduced production and secretion of leptin which was associated
with reduced fat deposition. The reduced adipogenesis in the
knockout mice suggests that myostatin is involved in regulating
adiposity as well as muscularity. Several cattle breeds have been
observed to show exceptional muscle development commonly referred
to as `double-muscled.` Double-muscled animals are characterized by
an increase in muscle mass of about 20%, due to general skeletal
muscle hyperplasia, or an increase in the number of muscle fibers
rather than in their individual diameter. Grobet et al., 1997,
Nature Genet. 17, 71-74, used a positional candidate approach to
demonstrate that a mutation in the bovine gene which encodes
myostatin is responsible for the double-muscled phenotype. The
authors found an 11-bp deletion in the coding sequence for the
bioactive C-terminal domain of the protein causing the muscular
hypertrophy in these animals.
[0367] Bogdanovich et al., 2002, Nature, 420, 418-421, tested the
ability of inhibition of myostatin in vivo to ameliorate the
dystrophic phenotype in the mdx mouse model of Duchenne muscular
dystrophy (DMD). The authors blocked endogenous myostatin in mdx
mice by intraperitoneal injections of blocking antibodies for 3
months and found increase in body weight, muscle mass, muscle size,
and absolute muscle strength along with a significant decrease in
muscle degeneration and concentrations of serum creatine kinase.
The authors concluded that myostatin blockade provides a novel,
pharmacologic strategy for treatment of diseases associated with
muscle wasting such as DMD, and circumvents the major problems
associated with conventional gene therapy in these disorders.
Furthermore, in myostatin null mice (Mstn -/-) crossed with mdx
mice, a model for Duchenne and Becker muscular dystrophy, Wagner et
al., 2002, Ann. Neurol, 52, 832-836, found increased muscle mass,
increased body weight, increased muscle fiber size, and increased
strength compared to Mstn +/+/mdx mice. There was also a reduction
in the extent of muscle fibrosis in these mice. The authors noted
that although the loss of myostatin does not correct the primary
defect in the mdx mice, it may ameliorate some features of the
dystrophic phenotype.
[0368] Based upon the current understanding of myostatin, the
modulation of myostatin and related genes is instrumental in the
development of new treatments for diseases, traits and conditions
associated with muscular atrophy, muscle weakness, muscle
dysfunction, or muscle destruction, such as muscular dystrophy,
myotonic dystrophy, myotonia congentia, poliomyelitis, amyotrophic
lateral sclerosis (ALS or Lou Gehrig's disease), Guillain-Barre
syndrome, muscle wasting, sarcopenia, myalgias, myopathies,
hypotonis, hypotonia, cachexia, spinal cord injury, or muscle
injury. Nucleic acid molecules of the invention are also useful in
treating or preventing obesity, diabetes (e.g., type I and type
II), and insulin resistance. As such, there exists a need for
selective inhibitors for myostatin in this regard. Modulation of
myostatin using small interfering nucleic acid (siNA) mediated RNAi
represents a novel approach to the treatment and prevention of such
diseases, traits, and conditions, and for other applications that
benefit from muscle hypertrophy, such as for use for increased
strength, athleticism, bodybuilding, prevention of muscle atrophy
(e.g., in astronauts), or cosmetic applications in a subject or
organism, or for generating improved livestock.
EXAMPLES
[0369] The following are non-limiting examples showing the
selection, isolation, synthesis and activity of nucleic acids of
the instant invention.
Example 1
Tandem Synthesis of siNA Constructs
[0370] Exemplary siNA molecules of the invention are synthesized in
tandem using a cleavable linker, for example, a succinyl-based
linker. Tandem synthesis as described herein is followed by a
one-step purification process that provides RNAi molecules in high
yield. This approach is highly amenable to siNA synthesis in
support of high throughput RNAi screening, and can be readily
adapted to multi-column or multi-well synthesis platforms.
[0371] After completing a tandem synthesis of an siNA oligo and its
complement in which the 5'-terminal dimethoxytrityl (5'-O-DMT)
group remains intact (trityl on synthesis), the oligonucleotides
are deprotected as described above. Following deprotection, the
siNA sequence strands are allowed to spontaneously hybridize. This
hybridization yields a duplex in which one strand has retained the
5'-O-DMT group while the complementary strand comprises a terminal
5'-hydroxyl. The newly formed duplex behaves as a single molecule
during routine solid-phase extraction purification (Trityl-On
purification) even though only one molecule has a dimethoxytrityl
group. Because the strands form a stable duplex, this
dimethoxytrityl group (or an equivalent group, such as other trityl
groups or other hydrophobic moieties) is all that is required to
purify the pair of oligos, for example, by using a C18
cartridge.
[0372] Standard phosphoramidite synthesis chemistry is used up to
the point of introducing a tandem linker, such as an inverted deoxy
abasic succinate or glyceryl succinate linker (see FIG. 1) or an
equivalent cleavable linker. A non-limiting example of linker
coupling conditions that can be used includes a hindered base such
as diisopropylethylamine (DIPA) and/or DMAP in the presence of an
activator reagent such as
Bromotripyrrolidinophosphoniumhexafluororophosphate (PyBrOP). After
the linker is coupled, standard synthesis chemistry is utilized to
complete synthesis of the second sequence leaving the terminal the
5'-O-DMT intact. Following synthesis, the resulting oligonucleotide
is deprotected according to the procedures described herein and
quenched with a suitable buffer, for example with 50 mM NaOAc or
1.5M NH.sub.4H.sub.2CO.sub.3.
[0373] Purification of the siNA duplex can be readily accomplished
using solid phase extraction, for example, using a Waters C18
SepPak Ig cartridge conditioned with 1 column volume (CV) of
acetonitrile, 2 CV H2O, and 2 CV 50 mM NaOAc. The sample is loaded
and then washed with 1 CV H2O or 50 mM NaOAc. Failure sequences are
eluted with 1 CV 14% ACN (Aqueous with 50 mM NaOAc and 50 mM NaCl).
The column is then washed, for example with 1 CV H2O followed by
on-column detritylation, for example by passing 1 CV of 1% aqueous
trifluoroacetic acid (TFA) over the column, then adding a second CV
of 1% aqueous TFA to the column and allowing to stand for
approximately 10 minutes. The remaining TFA solution is removed and
the column washed with H2O followed by 1 CV 1M NaCl and additional
H2O. The siNA duplex product is then eluted, for example, using 1
CV 20% aqueous CAN.
[0374] FIG. 2 provides an example of MALDI-TOF mass spectrometry
analysis of a purified siNA construct in which each peak
corresponds to the calculated mass of an individual siNA strand of
the siNA duplex. The same purified siNA provides three peaks when
analyzed by capillary gel electrophoresis (CGE), one peak
presumably corresponding to the duplex siNA, and two peaks
presumably corresponding to the separate siNA sequence strands. Ion
exchange HPLC analysis of the same siNA contract only shows a
single peak. Testing of the purified siNA construct using a
luciferase reporter assay described below demonstrated the same
RNAi activity compared to siNA constructs generated from separately
synthesized oligonucleotide sequence strands.
Example 2
Identification of Potential siNA Target Sites in any RNA
Sequence
[0375] The sequence of an RNA target of interest, such as a viral
or human mRNA transcript, is screened for target sites, for example
by using a computer folding algorithm. In a non-limiting example,
the sequence of a gene or RNA gene transcript derived from a
database, such as Genbank, is used to generate siNA targets having
complementarity to the target. Such sequences can be obtained from
a database, or can be determined experimentally as known in the
art. Target sites that are known, for example, those target sites
determined to be effective target sites based on studies with other
nucleic acid molecules, for example ribozymes or antisense, or
those targets known to be associated with a disease or condition
such as those sites containing mutations or deletions, can be used
to design siNA molecules targeting those sites. Various parameters
can be used to determine which sites are the most suitable target
sites within the target RNA sequence. These parameters include but
are not limited to secondary or tertiary RNA structure, the
nucleotide base composition of the target sequence, the degree of
homology between various regions of the target sequence, or the
relative position of the target sequence within the RNA transcript.
Based on these determinations, any number of target sites within
the RNA transcript can be chosen to screen siNA molecules for
efficacy, for example by using in vitro RNA cleavage assays, cell
culture, or animal models. In a non-limiting example, anywhere from
1 to 1000 target sites are chosen within the transcript based on
the size of the siNA construct to be used. High throughput
screening assays can be developed for screening siNA molecules
using methods known in the art, such as with multi-well or
multi-plate assays to determine efficient reduction in target gene
expression.
Example 3
Selection of siNA Molecule Target Sites in a RNA
[0376] The following non-limiting steps can be used to carry out
the selection of siNAs targeting a given gene sequence or
transcript.
[0377] 1. The target sequence is parsed in silico into a list of
all fragments or subsequences of a particular length, for example
23 nucleotide fragments, contained within the target sequence. This
step is typically carried out using a custom Perl script, but
commercial sequence analysis programs such as Oligo, MacVector, or
the GCG Wisconsin Package can be employed as well.
[0378] 2. In some instances the siNAs correspond to more than one
target sequence; such would be the case for example in targeting
different transcripts of the same gene, targeting different
transcripts of more than one gene, or for targeting both the human
gene and an animal homolog. In this case, a subsequence list of a
particular length is generated for each of the targets, and then
the lists are compared to find matching sequences in each list. The
subsequences are then ranked according to the number of target
sequences that contain the given subsequence; the goal is to find
subsequences that are present in most or all of the target
sequences. Alternately, the ranking can identify subsequences that
are unique to a target sequence, such as a mutant target sequence.
Such an approach would enable the use of siNA to target
specifically the mutant sequence and not effect the expression of
the normal sequence.
[0379] 3. In some instances the siNA subsequences are absent in one
or more sequences while present in the desired target sequence;
such would be the case if the siNA targets a gene with a paralogous
family member that is to remain untargeted. As in case 2 above, a
subsequence list of a particular length is generated for each of
the targets, and then the lists are compared to find sequences that
are present in the target gene but are absent in the untargeted
paralog.
[0380] 4. The ranked siNA subsequences can be further analyzed and
ranked according to GC content. A preference can be given to sites
containing 30-70% GC, with a further preference to sites containing
40-60% GC.
[0381] 5. The ranked siNA subsequences can be further analyzed and
ranked according to self-folding and internal hairpins. Weaker
internal folds are preferred; strong hairpin structures are to be
avoided.
[0382] 6. The ranked siNA subsequences can be further analyzed and
ranked according to whether they have runs of GGG or CCC in the
sequence. GGG (or even more Gs) in either strand can make
oligonucleotide synthesis problematic and can potentially interfere
with RNAi activity, so it is avoided whenever better sequences are
available. CCC is searched in the target strand because that will
place GGG in the antisense strand.
[0383] 7. The ranked siNA subsequences can be further analyzed and
ranked according to whether they have the dinucleotide UU (uridine
dinucleotide) on the 3'-end of the sequence, and/or AA on the
5'-end of the sequence (to yield 3' UU on the antisense sequence).
These sequences allow one to design siNA molecules with terminal TT
thymidine dinucleotides.
[0384] 8. Four or five target sites are chosen from the ranked list
of subsequences as described above. For example, in subsequences
having 23 nucleotides, the right 21 nucleotides of each chosen
23-mer subsequence are then designed and synthesized for the upper
(sense) strand of the siNA duplex, while the reverse complement of
the left 21 nucleotides of each chosen 23-mer subsequence are then
designed and synthesized for the lower (antisense) strand of the
siNA duplex (see Tables II and III). If terminal TT residues are
desired for the sequence (as described in paragraph 7), then the
two 3' terminal nucleotides of both the sense and antisense strands
are replaced by TT prior to synthesizing the oligos.
[0385] 9. The siNA molecules are screened in an in vitro, cell
culture or animal model system to identify the most active siNA
molecule or the most preferred target site within the target RNA
sequence.
[0386] 10. Other design considerations can be used when selecting
target nucleic acid sequences, see, for example, Reynolds et al.,
2004, Nature Biotechnology Advanced Online Publication, 1 Feb.
2004, doi:10.1038/nbt936 and Ui-Tei et al., 2004, Nucleic Acids
Research, 32, doi: 10. 1093/nar/gkh247.
[0387] In an alternate approach, a pool of siNA constructs specific
to a myostatin target sequence is used to screen for target sites
in cells expressing myostatin RNA, such as C2C12 cells. The general
strategy used in this approach is shown in FIG. 9. A non-limiting
example of such as pool is a pool comprising sequences having SEQ
ID NOs. 1-436. Cultured C2C12 cells are transfected with the pool
of siNA constructs and cells that demonstrate a phenotype
associated with myostatin inhibition are sorted. The pool of siNA
constructs can be expressed from transcription cassettes inserted
into appropriate vectors (see for example FIG. 7 and FIG. 8). The
siNA from cells demonstrating a positive phenotypic change (e.g.,
decreased proliferation, decreased myostatin mRNA levels or
decreased myostatin protein expression), are sequenced to determine
the most suitable target site(s) within the target myostatin RNA
sequence.
Example 4
Myostatin Targeted siNA Design
[0388] siNA target sites were chosen by analyzing sequences of the
myostatin RNA target and optionally prioritizing the target sites
on the basis of folding (structure of any given sequence analyzed
to determine siNA accessibility to the target), by using a library
of siNA molecules as described in Example 3, or alternately by
using an in vitro siNA system as described in Example 6 herein.
siNA molecules were designed that could bind each target and are
optionally individually analyzed by computer folding to assess
whether the siNA molecule can interact with the target sequence.
Varying the length of the siNA molecules can be chosen to optimize
activity. Generally, a sufficient number of complementary
nucleotide bases are chosen to bind to, or otherwise interact with,
the target RNA, but the degree of complementarity can be modulated
to accommodate siNA duplexes or varying length or base composition.
By using such methodologies, siNA molecules can be designed to
target sites within any known RNA sequence, for example those RNA
sequences corresponding to the any gene transcript.
[0389] Chemically modified siNA constructs are designed to provide
nuclease stability for systemic administration in vivo and/or
improved pharmacokinetic, localization, and delivery properties
while preserving the ability to mediate RNAi activity. Chemical
modifications as described herein are introduced synthetically
using synthetic methods described herein and those generally known
in the art. The synthetic siNA constructs are then assayed for
nuclease stability in serum and/or cellular/tissue extracts (e.g.
liver extracts). The synthetic siNA constructs are also tested in
parallel for RNAi activity using an appropriate assay, such as a
luciferase reporter assay as described herein or another suitable
assay that can quantity RNAi activity. Synthetic siNA constructs
that possess both nuclease stability and RNAi activity can be
further modified and re-evaluated in stability and activity assays.
The chemical modifications of the stabilized active siNA constructs
can then be applied to any siNA sequence targeting any chosen RNA
and used, for example, in target screening assays to pick lead siNA
compounds for therapeutic development (see for example FIG.
11).
Example 5
Chemical Synthesis and Purification of siNA
[0390] siNA molecules can be designed to interact with various
sites in the RNA message, for example, target sequences within the
RNA sequences described herein. The sequence of one strand of the
siNA molecule(s) is complementary to the target site sequences
described above. The siNA molecules can be chemically synthesized
using methods described herein. Inactive siNA molecules that are
used as control sequences can be synthesized by scrambling the
sequence of the siNA molecules such that it is not complementary to
the target sequence. Generally, siNA constructs can by synthesized
using solid phase oligonucleotide synthesis methods as described
herein (see for example Usman et al., U.S. Pat. Nos. 5,804,683;
5,831,071; 5,998,203; 6,117,657; 6,353,098; 6,362,323; 6,437,117;
6,469,158; Scaringe et al., U.S. Pat. Nos. 6,111,086; 6,008,400;
6,111,086 all incorporated by reference herein in their
entirety).
[0391] In a non-limiting example, RNA oligonucleotides are
synthesized in a stepwise fashion using the phosphoramidite
chemistry as is known in the art. Standard phosphoramidite
chemistry involves the use of nucleosides comprising any of
5'-O-dimethoxytrityl, 2'-O-tert-butyldimethylsilyl,
3'-O-2-Cyanoethyl N,N-diisopropylphos-phoroamidite groups, and
exocyclic amine protecting groups (e.g. N6-benzoyl adenosine, N4
acetyl cytidine, and N2-isobutyryl guanosine). Alternately,
2'-O-Silyl Ethers can be used in conjunction with acid-labile
2'-O-orthoester protecting groups in the synthesis of RNA as
described by Scaringe supra. Differing 2' chemistries can require
different protecting groups, for example 2'-deoxy-2'-amino
nucleosides can utilize N-phthaloyl protection as described by
Usman et al., U.S. Pat. No. 5,631,360, incorporated by reference
herein in its entirety).
[0392] During solid phase synthesis, each nucleotide is added
sequentially. (3'- to 5'-direction) to the solid support-bound
oligonucleotide. The first nucleoside at the 3'-end of the chain is
covalently attached to a solid support (e.g., controlled pore glass
or polystyrene) using various linkers. The nucleotide precursor, a
rib nucleoside phosphoramidite, and activator are combined
resulting in the coupling of the second nucleoside phosphoramidite
onto the 5'-end of the first nucleoside. The support is then washed
and any unreacted 5'-hydroxyl groups are capped with a capping
reagent such as acetic anhydride to yield inactive 5'-acetyl
moieties. The trivalent phosphorus linkage is then oxidized to a
more stable phosphate linkage. At the end of the nucleotide
addition cycle, the 5'-O-protecting group is cleaved under suitable
conditions (e.g., acidic conditions for trityl-based groups and
Fluoride for silyl-based groups). The cycle is repeated for each
subsequent nucleotide.
[0393] Modification of synthesis conditions can be used to optimize
coupling efficiency, for example by using differing coupling times,
differing reagent/phosphoramidite concentrations, differing contact
times, differing solid supports and solid support linker
chemistries depending on the particular chemical composition of the
siNA to be synthesized. Deprotection and purification of the siNA
can be performed as is generally described in Deprotection and
purification of the siNA can be performed as is generally described
in Usman et al., U.S. Pat. No. 5,831,071, U.S. Pat. No. 6,353,098,
U.S. Pat. No. 6,437,117, and Bellon et al., U.S. Pat. No.
6,054,576, U.S. Pat. No. 6,162,909, U.S. Pat. No. 6,303,773, or
Scaringe supra, incorporated by reference herein in their
entireties. Additionally, deprotection conditions can be modified
to provide the best possible yield and purity of siNA constructs.
For example, applicant has observed that oligonucleotides
comprising 2'-deoxy-2'-fluoro nucleotides can degrade under
inappropriate deprotection conditions. Such oligonucleotides are
deprotected using aqueous methylamine at about 35.degree. C. for 30
minutes. If the 2'-deoxy-2'-fluoro containing oligonucleotide also
comprises ribonucleotides, after deprotection with aqueous
methylamine at about 35.degree. C. for 30 minutes, TEA-HF is added
and the reaction maintained at about 65.degree. C. for an
additional 15 minutes.
Example 6
RNAi In Vitro Assay to Assess siNA Activity
[0394] An in vitro assay that recapitulates RNAi in a cell-free
system is used to evaluate siNA constructs targeting myostatin RNA
targets. The assay comprises the system described by Tuschl et al.,
1999, Genes and Development, 13, 3191-3197 and Zamore et al., 2000,
Cell, 101, 25-33 adapted for use with myostatin target RNA. A
Drosophila extract derived from syncytial blastoderm is used to
reconstitute RNAi activity in vitro. Target RNA is generated via in
vitro transcription from an appropriate myostatin expressing
plasmid using T7 RNA polymerase or via chemical synthesis as
described herein. Sense and antisense siNA strands (for example 20
uM each) are annealed by incubation in buffer (such as 100 mM
potassium acetate, 30 mM HEPES-KOH, pH 7.4, 2 mM magnesium acetate)
for 1 minute at 90.degree. C. followed by 1 hour at 37.degree. C.,
then diluted in lysis buffer (for example 100 mM potassium acetate,
30 mM HEPES-KOH at pH 7.4, 2 mM magnesium acetate). Annealing can
be monitored by gel electrophoresis on an agarose gel in TBE buffer
and stained with ethidium bromide. The Drosophila lysate is
prepared using zero to two-hour-old embryos from Oregon R flies
collected on yeasted molasses agar that are dechorionated and
lysed. The lysate is centrifuged and the supernatant isolated. The
assay comprises a reaction mixture containing 50% lysate [vol/vol],
RNA (10-50 pM final concentration), and 10% [vol/vol] lysis buffer
containing siNA (10 nM final concentration). The reaction mixture
also contains 10 mM creatine phosphate, 10 ug/ml creatine
phosphokinase, 100 um GTP, 100 uM UTP, 100 uM CTP, 500 uM ATP, 5 mM
DTT, 0.1 U/uL RNasin (Promega), and 100 uM of each amino acid. The
final concentration of potassium acetate is adjusted to 100 mM. The
reactions are pre-assembled on ice and preincubated at 25.degree.
C. for 10 minutes before adding RNA, then incubated at 25.degree.
C. for an additional 60 minutes. Reactions are quenched with 4
volumes of 1.25.times. Passive Lysis Buffer (Promega). Target RNA
cleavage is assayed by RT-PCR analysis or other methods known in
the art and are compared to control reactions in which siNA is
omitted from the reaction.
[0395] Alternately, internally-labeled target RNA for the assay is
prepared by in vitro transcription in the presence of
[alpha-.sup.32P] CTP, passed over a G50 Sephadex column by spin
chromatography and used as target RNA without further purification.
Optionally, target RNA is 5'-.sup.32P-end labeled using T4
polynucleotide kinase enzyme. Assays are performed as described
above and target RNA and the specific RNA cleavage products
generated by RNAi are visualized on an autoradiograph of a gel. The
percentage of cleavage is determined by PHOSPHOR IMAGER.RTM.
(autoradiography) quantitation of bands representing intact control
RNA or RNA from control reactions without siNA and the cleavage
products generated by the assay.
[0396] In one embodiment, this assay is used to determine target
sites in the myostatin RNA target for siNA mediated RNAi cleavage,
wherein a plurality of siNA constructs are screened for RNAi
mediated cleavage of the myostatin RNA target, for example, by
analyzing the assay reaction by electrophoresis of labeled target
RNA, or by Northern blotting, as well as by other methodology well
known in the art.
Example 7
Nucleic Acid Inhibition of Myostatin Target RNA In Vitro
[0397] siNA molecules targeted to the human myostatin RNA are
designed and synthesized as described above. These nucleic acid
molecules can be tested for cleavage activity in vivo, for example,
using the following procedure. The target sequences and the
nucleotide location within the myostatin RNA are given in Table II
and III.
[0398] Two formats are used to test the efficacy of siNAs targeting
myostatin. First, the reagents are tested in cell culture, for
example using C2C12 cells to determine the extent of RNA and
protein inhibition. siNA reagents (e.g.; see Tables II and III) are
selected against the myostatin target as described herein. RNA
inhibition is measured after delivery of these reagents by a
suitable transfection agent to, for example, C2C12 cells. Relative
amounts of target RNA are measured versus actin using real-time PCR
monitoring of amplification (e.g., ABI 7700 Taqman.RTM.). A
comparison is made to a mixture of oligonucleotide sequences made
to unrelated targets or to a randomized siNA control with the same
overall length and chemistry, but randomly substituted at each
position. Primary and secondary lead reagents are chosen for the
target and optimization performed. After an optimal transfection
agent concentration is chosen, a RNA time-course of inhibition is
performed with the lead siNA molecule. In addition, a cell-plating
format can be used to determine RNA inhibition.
Delivery of siNA to Cells
[0399] Cells (e.g., C2C12) are seeded, for example, at
1.times.10.sup.5 cells per well of a six-well dish in EGM-2
(BioWhittaker) the day before transfection. siNA (final
concentration, for example 20 nM) and cationic lipid (e.g., final
concentration 2 .mu.g/ml) are complexed in EGM basal media (Bio
Whittaker) at 37.degree. C. for 30 minutes in polystyrene tubes.
Following vortexing, the complexed siNA is added to each well and
incubated for the times indicated. For initial optimization
experiments, cells are seeded, for example, at 1.times.10.sup.3 in
96 well plates and siNA complex added as described. Efficiency of
delivery of siNA to cells is determined using a fluorescent siNA
complexed with lipid. Cells in 6-well dishes are incubated with
siNA for 24 hours, rinsed with PBS and fixed in 2% paraformaldehyde
for 15 minutes at room temperature. Uptake of siNA is visualized
using a fluorescent microscope.
TAQMAN.RTM. (Real-Time PCR Monitoring of Amplification) and
Lightcycler Quantification of mRNA
[0400] Total RNA is prepared from cells following siNA delivery,
for example, using Qiagen RNA purification kits for 6-well or
Rneasy extraction kits for 96-well assays. For TAQMAN.RTM. analysis
(real-time PCR monitoring of amplification), dual-labeled probes
are synthesized with the reporter dye, FAM or JOE, covalently
linked at the 5'-end and the quencher dye TAMRA conjugated to the
3'-end. One-step RT-PCR amplifications are performed on, for
example, an ABI PRISM 7700 Sequence Detector using 50 .mu.l
reactions consisting of 10 .mu.l total RNA, 100 nM forward primer,
900 nM reverse primer, 100 nM probe, 1.times. TaqMan PCR reaction
buffer (PE-Applied Biosystems), 5.5 mM MgCl.sub.2, 300 .mu.M each
dATP, dCTP, dGTP, and dTTP, 10 U RNase Inhibitor (Promega), 1.25 U
AMPLITAQ GOLD.RTM. (DNA polymerase) (PE-Applied Biosystems) and 10
U M-MLV Reverse Transcriptase (Promega). The thermal cycling
conditions can consist of 30 minutes at 48.degree. C., 10 minutes
at 95.degree. C., followed by 40 cycles of 15 seconds at 95.degree.
C. and 1 minute at 60.degree. C. Quantitation of mRNA levels is
determined relative to standards generated from serially diluted
total cellular RNA (300, 100, 33, 11 ng/r.times.n) and normalizing
to .beta.-actin or GAPDH mRNA in parallel TAQMAN.RTM. reactions
(real-time PCR monitoring of amplification). For each gene of
interest an upper and lower primer and a fluorescently labeled
probe are designed. Real time incorporation of SYBR Green I dye
into a specific PCR product can be measured in glass capillary
tubes using a lightcyler. A standard curve is generated for each
primer pair using control cRNA. Values are represented as relative
expression to GAPDH in each sample.
Western Blotting
[0401] Nuclear extracts can be prepared using a standard micro
preparation technique (see for example Andrews and Faller, 1991,
Nucleic Acids Research, 19, 2499). Protein extracts from
supernatants are prepared, for example using TCA precipitation. An
equal volume of 20% TCA is added to the cell supernatant, incubated
on ice for 1 hour and pelleted by centrifugation for 5 minutes.
Pellets are washed in acetone, dried and resuspended in water.
Cellular protein extracts are run on a 10% Bis-Tris NuPage (nuclear
extracts) or 4-12% Tris-Glycine (supernatant extracts)
polyacrylamide gel and transferred onto nitro-cellulose membranes.
Non-specific binding can be blocked by incubation, for example,
with 5% non-fat milk for 1 hour followed by primary antibody for 16
hour at 4.degree. C. Following washes, the secondary antibody is
applied, for example (1:10,000 dilution) for 1 hour at room
temperature and the signal detected with SuperSignal reagent
(Pierce).
Example 8
Models Useful to Evaluate the Down-Regulation of Myostatin Gene
Expression
Cell Culture
[0402] There are numerous cell culture systems that can be used to
analyze reduction of myostatin levels either directly or indirectly
by measuring downstream effects. For example, cultured C2C12 cells
can be used in cell culture experiments to assess the efficacy of
nucleic acid molecules of the invention. As such, cells treated
with nucleic acid molecules of the invention (e.g., siNA) targeting
myostatin RNA would be expected to have decreased myostatin
expression capacity compared to matched control nucleic acid
molecules having a scrambled or inactive sequence. In a
non-limiting example, C2C12 cells are cultured and myostatin
expression is quantified, for example by time-resolved immuno
fluorometric assay myostatin messenger-RNA expression is
quantitated with RT-PCR. Untreated cells are compared to cells
treated with siNA molecules transfected with a suitable reagent,
for example a cationic lipid such as lipofectamine, and myostatin
protein and RNA levels are quantitated. Dose response assays are
then performed to establish dose dependent inhibition of myostatin
expression.
[0403] In several cell culture systems, cationic lipids have been
shown to enhance the bioavailability of oligonucleotides to cells
in culture (Bennet, et al., 1992, Mol. Pharmacology, 41,
1023-1033). In one embodiment, siNA molecules of the invention are
complexed with cationic lipids for cell culture experiments. siNA
and cationic lipid mixtures are prepared in serum-free DMEM
immediately prior to addition to the cells. DMEM plus additives are
warmed to room temperature (about 20-25.degree. C.) and cationic
lipid is added to the final desired concentration and the solution
is vortexed briefly. siNA molecules are added to the final desired
concentration and the solution is again vortexed briefly and
incubated for 10 minutes at room temperature. In dose response
experiments, the RNA/lipid complex is serially diluted into DMEM
following the 10 minute incubation.
Animal Models
[0404] Evaluating the efficacy of myostatin agents in animal models
is an important prerequisite to human clinical trials. Lead
anti-myostatin siNA molecules chosen from in vitro assays can be
further tested in the following model. Bogdanovich et al., 2002,
Nature, 420, 418-421, tested the ability of inhibition of myostatin
in vivo to ameliorate the dystrophic phenotype in the mdx mouse
model of Duchenne muscular dystrophy (DMD). The authors blocked
endogenous myostatin in mdx mice by intraperitoneal injections of
blocking antibodies for 3 months and found increase in body weight,
muscle mass, muscle size, and absolute muscle strength along with a
significant decrease in muscle degeneration and concentrations of
serum creatine kinase. The authors concluded that myostatin
blockade provides a novel, pharmacologic strategy for treatment of
diseases associated with muscle wasting such as DMD, and
circumvents the major problems associated with conventional gene
therapy in these disorders. Furthermore, in myostatin null mice
(Mstn -/-) crossed with mdx mice, a model for Duchenne and Becker
muscular dystrophy, Wagner et al., 2002, Ann. Neurol, 52, 832-836,
found increased muscle mass, increased body weight, increased
muscle fiber size, and increased strength compared to Mstn +/+/mdx
mice. There was also a reduction in the extent of muscle fibrosis
in these mice. The authors noted that although the loss of
myostatin does not correct the primary defect in the mdx mice, it
may ameliorate some features of the dystrophic phenotype.
[0405] As such, these models can be used in evaluating the efficacy
of siNA molecules of the invention in preventing muscle atrophy and
wasting associated with myopathic or dystrophic diseases and
constions. These models and others can similarly be used to
evaluate the safety and efficacy of siNA molecules of the invention
in a pre-clinical setting.
Example 9
RNAi Mediated Inhibition of Myostatin RNA Expression
[0406] siNA constructs (Table III) are tested for efficacy in
reducing myostatin RNA expression in C2C12 cells. The siNA
transfection mixtures are added to cells to give a final siNA
concentration of 25 nM in a volume of 150 .mu.l. Each siNA
transfection mixture is added to 3 wells for triplicate siNA
treatments. Cells are incubated at 37.degree. C. for 24 h in the
continued presence of the siNA transfection mixture. At 24 h, RNA
is prepared from each well of treated cells. The supernatants with
the transfection mixtures are first removed and discarded, then the
cells are lysed and RNA prepared from each well. Target gene
expression following treatment is evaluated by RT-PCR for the
target gene and for a control gene (36B4, an RNA polymerase
subunit) for normalization. The triplicate data is averaged and the
standard deviations determined for each treatment. Normalized data
are graphed and the percent reduction of target mRNA by active
siNAs in comparison to their respective inverted control siNAs was
determined.
Example 10
Indications
[0407] The siNA molecules of the invention can be used to prevent,
inhibit, treat or prevent treat or prevent diseases, traits, or
conditions associated with muscular atrophy, muscle weakness,
muscle dysfunction, or muscle destruction, including muscular
dystrophy, myotonic dystrophy, myotonia congentia, poliomyelitis,
amyotrophic lateral sclerosis (ALS or Lou Gehrig's disease),
Guillain-Barre syndrome, muscle wasting (e.g., age or HIV related),
sarcopenia, myalgias, myopathies, hypotonis, hypotonia, cachexia,
spinal cord injury, or muscle injury, or any other related trait,
disease or condition that is related to or will respond to the
levels of myostatin in a cell or tissue, alone or in combination
with other therapies. Nucleic acid molecules of the invention can
also be adapted to treat or prevent obesity, diabetes (e.g., type I
and type II), and insulin resistance in a subject. Alternately the
nucleic acid molecules of the instant invention, individually, or
in combination or in conjunction with other drugs, can be adapted
for use to promote muscle hypertrophy, including use for increased
strength, athleticism, bodybuilding, prevention of muscle atrophy
(e.g., in astronauts), or cosmetic applications in a subject or
organism. In one embodiment, siNA molecules of the invention are
used in combination with anabolic or androgenic agents as are known
in the art.
Example 11
Diagnostic Uses
[0408] The siNA molecules of the invention can be used in a variety
of diagnostic applications, such as in the identification of
molecular targets (e.g., RNA) in a variety of applications, for
example, in clinical, industrial, environmental, agricultural
and/or research settings. Such diagnostic use of siNA molecules
involves utilizing reconstituted RNAi systems, for example, using
cellular lysates or partially purified cellular lysates. siNA
molecules of this invention can be used as diagnostic tools to
examine genetic drift and mutations within diseased cells or to
detect the presence of endogenous or exogenous, for example viral,
RNA in a cell. The close relationship between siNA activity and the
structure of the target RNA allows the detection of mutations in
any region of the molecule, which alters the base-pairing and
three-dimensional structure of the target RNA. By using multiple
siNA molecules described in this invention, one can map nucleotide
changes, which are important to RNA structure and function in
vitro, as well as in cells and tissues. Cleavage of target RNAs
with siNA molecules can be used to inhibit gene expression and
define the role of specified gene products in the progression of
disease or infection. In this manner, other genetic targets can be
defined as important mediators of the disease. These experiments
will lead to better treatment of the disease progression by
affording the possibility of combination therapies (e.g., multiple
siNA molecules targeted to different genes, siNA molecules coupled
with known small molecule inhibitors, or intermittent treatment
with combinations siNA molecules and/or other chemical or
biological molecules). Other in vitro uses of siNA molecules of
this invention are well known in the art, and include detection of
the presence of mRNAs associated with a disease, infection, or
related condition. Such RNA is detected by determining the presence
of a cleavage product after treatment with an siNA using standard
methodologies, for example, fluorescence resonance emission
transfer (FRET).
[0409] In a specific example, siNA molecules that cleave only
wild-type or mutant forms of the target RNA are used for the assay.
The first siNA molecules (i.e., those that cleave only wild-type
forms of target RNA) are used to identify wild-type RNA present in
the sample and the second siNA molecules (i.e., those that cleave
only mutant forms of target RNA) are used to identify mutant RNA in
the sample. As reaction controls, synthetic substrates of both
wild-type and mutant RNA are cleaved by both siNA molecules to
demonstrate the relative siNA efficiencies in the reactions and the
absence of cleavage of the "non-targeted" RNA species. The cleavage
products from the synthetic substrates also serve to generate size
markers for the analysis of wild-type and mutant RNAs in the sample
population. Thus, each analysis requires two siNA molecules, two
substrates and one unknown sample, which is combined into six
reactions. The presence of cleavage products is determined using an
RNase protection assay so that full-length and cleavage fragments
of each RNA can be analyzed in one lane of a polyacrylamide gel. It
is not absolutely required to quantify the results to gain insight
into the expression of mutant RNAs and putative risk of the desired
phenotypic changes in target cells. The expression of mRNA whose
protein product is implicated in the development of the phenotype
(i.e., disease related or infection related) is adequate to
establish risk. If probes of comparable specific activity are used
for both transcripts, then a qualitative comparison of RNA levels
is adequate and decreases the cost of the initial diagnosis. Higher
mutant form to wild-type ratios are correlated with higher risk
whether RNA levels are compared qualitatively or
quantitatively.
[0410] All patents and publications mentioned in the specification
are indicative of the levels of skill of those skilled in the art
to which the invention pertains. All references cited in this
disclosure are incorporated by reference to the same extent as if
each reference had been incorporated by reference in its entirety
individually.
[0411] One skilled in the art would readily appreciate that the
present invention is well adapted to carry out the objects and
obtain the ends and advantages mentioned, as well as those inherent
therein. The methods and compositions described herein as presently
representative of preferred embodiments are exemplary and are not
intended as limitations on the scope of the invention. Changes
therein and other uses will occur to those skilled in the art,
which are encompassed within the spirit of the invention, are
defined by the scope of the claims.
[0412] It will be readily apparent to one skilled in the art that
varying substitutions and modifications can be made to the
invention disclosed herein without departing from the scope and
spirit of the invention. Thus, such additional embodiments are
within the scope of the present invention and the following claims.
The present invention teaches one skilled in the art to test
various combinations and/or substitutions of chemical modifications
described herein toward generating nucleic acid constructs with
improved activity for mediating RNAi activity. Such improved
activity can comprise improved stability, improved bioavailability,
and/or improved activation of cellular responses mediating RNAi.
Therefore, the specific embodiments described herein are not
limiting and one skilled in the art can readily appreciate that
specific combinations of the modifications described herein can be
tested without undue experimentation toward identifying siNA
molecules with improved RNAi activity.
[0413] The invention illustratively described herein suitably can
be practiced in the absence of any element or elements, limitation
or limitations that are not specifically disclosed herein. Thus,
for example, in each instance herein any of the terms "comprising",
"consisting essentially of", and "consisting of" may be replaced
with either of the other two terms. The terms and expressions which
have been employed are used as terms of description and not of
limitation, and there is no intention that in the use of such terms
and expressions of excluding any equivalents of the features shown
and described or portions thereof, but it is recognized that
various modifications are possible within the scope of the
invention claimed. Thus, it should be understood that although the
present invention has been specifically disclosed by preferred
embodiments, optional features, modification and variation of the
concepts herein disclosed may be resorted to by those skilled in
the art, and that such modifications and variations are considered
to be within the scope of this invention as defined by the
description and the appended claims.
[0414] In addition, where features or aspects of the invention are
described in terms of Markush groups or other grouping of
alternatives, those skilled in the art will recognize that the
invention is also thereby described in terms of any individual
member or subgroup of members of the Markush group or other
group.
TABLE-US-00001 TABLE I Myostatin/GDF8 Accession Numbers NM_005259
Homo sapiens growth differentiation factor 8 (GDF8), mRNA
gi|4885258|ref|NM_005259.1|[4885258] AF104922 Homo sapiens
myostatin (GDF8) mRNA, complete cds
gi|4028595|gb|AF104922.1|AF104922[4028595] AC073120 Homo sapiens
BAC clone RP11-612D17 from 2, complete sequence
gi|15638891|gb|AC073120.5|[15638891] AF019627 Homo sapiens
myostatin (MSTN) mRNA, complete cds
gi|2623581|gb|AF019627.1|AF019627[2623581] AF019619 Papio hamadryas
myostatin (MSTN) mRNA, complete cds
gi|2623565|gb|AF019619.1|AF019619[2623565] AY055750 Macaca
fascicularis myostatin mRNA, complete cds
gi|16506527|gb|AY055750.1|[16506527] AY208121 Sus scrofa myostatin
gene, complete cds gi|34484364|gb|AY208121.1|[34484364] AF097584
Equus caballus myostatin (MSTN) gene, partial cds
gi|4588100|gb|AF097584.1|AF097584[4588100] AF266758 Ovis aries
myostatin (MSTN) gene, exons 2 and 3 and partial cds
gi|8575725|gb|AF266758.1|AF266758[8575725] AY032689 Capra hircus
myostatin (MSTN) gene, exons 2 and 3 and partial cds
gi|13989958|gb|AY032689.1|[13989958] AJ237920 Sus scrofa MSTN gene,
exons 2 and 3, partial
gi|4585631|emb|AJ237920.1|SSC237920[4585631]
TABLE-US-00002 TABLE II Myostatin/GDF8 siNA and Target Sequences
Myostatin/GDF8 NM_005259 Seq Seq Seq Pos Seq ID UPos Upper seq ID
LPos Lower seq ID 3 AUUCACUGGUGUGGCAAGU 1 3 AUUCACUGGUGUGGCAAGU 1
21 ACUUGCCACACCAGUGAAU 158 21 UUGUCUCUCAGACUGUACA 2 21
UUGUCUCUCAGACUGUACA 2 39 UGUACAGUCUGAGAGACAA 159 39
AUGCAUUAAAAUUUUGCUU 3 39 AUGCAUUAAAAUUUUGCUU 3 57
AAGCAAAAUUUUAAUGGAU 160 57 UGGCAUUACUCAAAAGCAA 4 57
UGGCAUUACUCAAAAGCAA 4 75 UUGCUUUUGAGUAAUGCCA 161 75
AAAGAAAAGUAAAAGGAAG 5 75 AAAGAAAAGUAAAAGGAAG 5 93
CUUCCUUUUACUUUUCUUU 162 93 GAAACAAGAACAAGAAAAA 6 93
GAAACAAGAACAAGAAAAA 6 111 UUUUUCUUGUUCUUGUUUC 163 111
AAGAUUAUAUUGAUUUUAA 7 111 AAGAUUAUAUUGAUUUUAA 7 129
UUAAAAUCAAUAUAAUCUU 164 129 AAAUCAUGCAAAAACUGCA 8 129
AAAUCAUGCAAAAACUGCA 8 147 UGCAGUUUUUGCAUGAUUU 165 147
AACUCUGUGUUUAUAUUUA 9 147 AACUCUGUGUUUAUAUUUA 9 165
UAAAUAUAAACACAGAGUU 166 165 ACCUGUUUAUGCUGAUUGU 10 165
ACCUGUUUAUGCUGAUUGU 10 183 ACAAUCAGCAUAAACAGGU 167 183
UUGCUGGUCCAGUGGAUCU 11 183 UUGCUGGUCCAGUGGAUCU 11 201
AGAUCCACUGGACCAGCAA 168 201 UAAAUGAGAACAGUGAGCA 12 201
UAAAUGAGAACAGUGAGCA 12 219 UGCUCACUGUUCUCAUUUA 169 219
AAAAAGAAAAUGUGGAAAA 13 219 AAAAAGAAAAUGUGGAAAA 13 237
UUUUCCACAUUUUCUUUUU 170 237 AAGAGGGGCUGUGUAAUGC 14 237
AAGAGGGGCUGUGUAAUGC 14 255 GCAUUACACAGCCCCUCUU 171 255
CAUGUACUUGGAGACAAAA 15 255 CAUGUACUUGGAGACAAAA 15 273
UUUUGUCUCCAAGUACAUG 172 273 ACACUAAAUCUUCAAGAAU 16 273
ACACUAAAUCUUCAAGAAU 16 291 AUUCUUGAAGAUUUAGUGU 173 291
UAGAAGCCAUUAAGAUACA 17 291 UAGAAGCCAUUAAGAUACA 17 309
UGUAUCUUAAUGGCUUCUA 174 309 AAAUCCUCAGUAAACUUCG 18 309
AAAUCOUCAGUAAACUUCG 18 327 CGAAGUUUACUGAGGAUUU 175 327
GUCUGGAAACAGCUCCUAA 19 327 GUCUGGAAACAGCUCCUAA 19 345
UUAGGAGCUGUUUCCAGAC 176 345 ACAUCAGCAAAGAUGUUAU 20 345
ACAUCAGCAAAGAUGUUAU 20 363 AUAACAUCUUUGCUGAUGU 177 363
UAAGACAACUUUUACCCAA 21 363 UAAGACAACUUUUACCCAA 21 381
UUGGGUAAAAGUUGUCUUA 178 381 AAGCUCCUCCACUCCGGGA 22 381
AAGCUCCUCCACUCCGGGA 22 399 UCCCGGAGUGGAGGAGCUU 179 399
AACUGAUUGAUCAGUAUGA 23 399 AACUGAUUGAUCAGUAUGA 23 417
UCAUACUGAUCAAUCAGUU 180 417 AUGUCCAGAGGGAUGACAG 24 417
AUGUCCAGAGGGAUGACAG 24 435 CUGUCAUCCCUCUGGACAU 181 435
GCAGCGAUGGCUCUUUGGA 25 435 GCAGCGAUGGCUCUUUGGA 25 453
UCCAAAGAGCCAUCGCUGC 182 453 AAGAUGACGAUUAUCACGC 26 453
AAGAUGACGAUUAUCACGC 26 471 GCGUGAUAAUCGUCAUCUU 183 471
CUACAACGGAAACAAUCAU 27 471 CUACAACGGAAACAAUCAU 27 489
AUGAUUGUUUCCGUUGUAG 184 489 UUACCAUGCCUACAGAGUC 28 489
UUACCAUGCCUACAGAGUC 28 507 GACUCUGUAGGCAUGGUAA 185 507
CUGAUUUUCUAAUGCAAGU 29 507 CUGAUUUUCUAAUGCAAGU 29 525
ACUUGCAUUAGAAAAUCAG 186 525 UGGAUGGAAAACCCAAAUG 30 525
UGGAUGGAAAACCCAAAUG 30 543 CAUUUGGGUUUUCCAUCCA 187 543
GUUGCUUCUUUAAAUUUAG 31 543 GUUGCUUCUUUAAAUUUAG 31 561
CUAAAUUUAAAGAAGCAAC 188 561 GCUCUAAAAUACAAUACAA 32 561
GCUCUAAAAUACAAUACAA 32 579 UUGUAUUGUAUUUUAGAGC 189 579
AUAAAGUAGUAAAGGCCCA 33 579 AUAAAGUAGUAAAGGCCCA 33 597
UGGGCCUUUACUACUUUAU 190 597 AACUAUGGAUAUAUUUGAG 34 597
AACUAUGGAUAUAUUUGAG 34 615 CUCAAAUAUAUCCAUAGUU 191 615
GACCOGUOGAGACUCCUAC 35 615 GACCCGUCGAGACUCCUAC 35 633
GUAGGAGUCUCGACGGGUC 192 633 CAACAGUGUUUGUGCAAAU 36 633
CAACAGUGUUUGUGCAAAU 36 651 AUUUGCACAAACACUGUUG 193 651
UCCUGAGACUCAUCAAACC 37 651 UCCUGAGACUCAUCAAACC 37 669
GGUUUGAUGAGUCUCAGGA 194 669 CUAUGAAAGACGGUACAAG 38 669
CUAUGAAAGACGGUACAAG 38 687 CUUGUACCGUCUUUCAUAG 195 687
GGUAUACUGGAAUCCGAUC 39 687 GGUAUACUGGAAUCCGAUC 39 705
GAUCGGAUUCCAGUAUACC 196 705 CUCUGAAACUUGACAUGAA 40 705
CUCUGAAACUUGACAUGAA 40 723 UUCAUGUCAAGUUUCAGAG 197 723
ACCCAGGCACUGGUAUUUG 41 723 ACCCAGGCACUGGUAUUUG 41 741
CAAAUACCAGUGCCUGGGU 198 741 GGCAGAGCAUUGAUGUGAA 42 741
GGCAGAGCAUUGAUGUGAA 42 759 UUCACAUCAAUGCUCUGCC 199 759
AGACAGUGUUGCAAAAUUG 43 759 AGACAGUGUUGCAAAAUUG 43 777
CAAUUUUGCAACACUGUCU 200 777 GGCUCAAACAACCUGAAUC 44 777
GGCUCAAACAACCUGAAUC 44 795 GAUUCAGGUUGUUUGAGCC 201 795
CCAACUUAGGCAUUGAAAU 45 795 CCAACUUAGGCAUUGAAAU 45 813
AUUUCAAUGCCUAAGUUGG 202 813 UAAAAGCUUUAGAUGAGAA 46 813
UAAAAGCUUUAGAUGAGAA 46 831 UUCUCAUCUAAAGCUUUUA 203 831
AUGGUCAUGAUCUUGCUGU 47 831 AUGGUCAUGAUCUUGCUGU 47 849
ACAGCAAGAUCAUGACCAU 204 849 UAACCUUCCCAGGACCAGG 48 849
UAACCUUCCCAGGACCAGG 48 867 CCUGGUCCUGGGAAGGUUA 205 867
GAGAAGAUGGGCUGAAUCC 49 867 GAGAAGAUGGGCUGAAUCC 49 885
GGAUUCAGCCCAUCUUCUC 206 885 CGUUUUUAGAGGUCAAGGU 50 885
CGUUUUUAGAGGUCAAGGU 50 903 ACCUUGACCUCUAAAAACG 207 903
UAACAGACACACCAAAAAG 51 903 UAACAGACACACCAAAAAG 51 921
CUUUUUGGUGUGUCUGUUA 208 921 GAUCCAGAAGGGAUUUUGG 52 921
GAUCCAGAAGGGAUUUUGG 52 939 CCAAAAUCCCUUCUGGAUC 209 939
GUCUUGACUGUGAUGAGCA 53 939 GUCUUGACUGUGAUGAGCA 53 957
UGCUCAUCACAGUCAAGAC 210 957 ACUCAACAGAAUCACGAUG 54 957
ACUCAACAGAAUCACGAUG 54 975 CAUCGUGAUUCUGUUGAGU 211 975
GCUGUCGUUACCCUCUAAC 55 975 GCUGUCGUUACCCUCUAAC 55 993
GUUAGAGGGUAACGACAGC 212 993 CUGUGGAUUUUGAAGCUUU 56 993
CUGUGGAUUUUGAAGCUUU 56 1011 AAAGCUUCAAAAUCCACAG 213 1011
UUGGAUGGGAUUGGAUUAU 57 1011 UUGGAUGGGAUUGGAUUAU 57 1029
AUAAUCCAAUCCCAUCCAA 214 1029 UCGCUCCUAAAAGAUAUAA 58 1029
UCGCUCCUAAAAGAUAUAA 58 1047 UUAUAUCUUUUAGGAGCGA 215 1047
AGGCCAAUUACUGCUCUGG 59 1047 AGGCCAAUUACUGCUCUGG 59 1065
CCAGAGCAGUAAUUGGCCU 216 1065 GAGAGUGUGAAUUUGUAUU 60 1065
GAGAGUGUGAAUUUGUAUU 60 1083 AAUACAAAUUCACACUCUC 217 1083
UUUUACAAAAAUAUCCUCA 61 1083 UUUUACAAAAAUAUCCUCA 61 1101
UGAGGAUAUUUUUGUAAAA 218 1101 AUACUCAUCUGGUACACCA 62 1101
AUACUCAUCUGGUACACCA 62 1119 UGGUGUACCAGAUGAGUAU 219 1119
AAGCAAACCCCAGAGGUUC 63 1119 AAGCAAACCCCAGAGGUUC 63 1137
GAACCUCUGGGGUUUGCUU 220 1137 CAGCAGGCCCUUGCUGUAC 64 1137
CAGCAGGCCCUUGCUGUAC 64 1155 GUACAGCAAGGGCCUGCUG 221 1155
CUCCCACAAAGAUGUCUCC 65 1155 CUCCCACAAAGAUGUCUCC 65 1173
GGAGACAUCUUUGUGGGAG 222 1173 CAAUUAAUAUGCUAUAUUU 66 1173
CAAUUAAUAUGCUAUAUUU 66 1191 AAAUAUAGCAUAUUAAUUG 223 1191
UUAAUGGCAAAGAACAAAU 67 1191 UUAAUGGCAAAGAACAAAU 67 1209
AUUUGUUCUUUGCCAUUAA 224 1209 UAAUAUAUGGGAAAAUUCC 68 1209
UAAUAUAUGGGAAAAUUCC 68 1227 GGAAUUUUCCCAUAUAUUA 225 1227
CAGCGAUGGUAGUAGACCG 69 1227 CAGCGAUGGUAGUAGACCG 69 1245
CGGUCUACUACCAUGGCUG 226 1245 GCUGUGGGUGCUCAUGAGA 70 1245
GCUGUGGGUGCUCAUGAGA 70 1263 UCUCAUGAGCACCCACAGC 227 1263
AUUUAUAUUAAGCGUUCAU 71 1263 AUUUAUAUUAAGCGUUCAU 71 1281
AUGAACGCUUAAUAUAAAU 228 1281 UAACUUCCUAAAACAUGGA 72 1281
UAACUUCCUAAAACAUGGA 72 1299 UCCAUGUUUUAGGAAGUUA 229 1299
AAGGUUUUCCCCUCAACAA 73 1299 AAGGUUUUCCCCUCAACAA 73 1317
UUGUUGAGGGGAAAACCUU 230 1317 AUUUUGAAGCUGUGAAAUU 74 1317
AUUUUGAAGCUGUGAAAUU 74 1335 AAUUUCACAGCUUCAAAAU 231 1335
UAAGUACCACAGGCUAUAG 75 1335 UAAGUACCACAGGCUAUAG 75 1353
CUAUAGCCUGUGGUACUUA 232 1353 GGCCUAGAGUAUGCUACAG 76 1353
GGCCUAGAGUAUGCUACAG 76 1371 CUGUAGCAUACUCUAGGCC 233 1371
GUCACUUAAGCAUAAGCUA 77 1371 GUCACUUAAGCAUAAGCUA 77 1389
UAGCUUAUGCUUAAGUGAC 234 1389 ACAGUAUGUAAACUAAAAG 78 1389
ACAGUAUGUAAACUAAAAG 78 1407 CUUUUAGUUUACAUACUGU 235 1407
GGGGGAAUAUAUGCAAUGG 79 1407 GGGGGAAUAUAUGCAAUGG 79 1425
CCAUUGCAUAUAUUCCCCC 236 1425 GUUGGCAUUUAACCAUCCA 80 1425
GUUGGCAUUUAACCAUCCA 80 1443 UGGAUGGUUAAAUGCCAAC 237 1443
AAACAAAUCAUACAAGAAA 81 1443 AAACAAAUCAUACAAGAAA 81 1461
UUUCUUGUAUGAUUUGUUU 238
1461 AGUUUUAUGAUUUCCAGAG 82 1461 AGUUUUAUGAUUUCCAGAG 82 1479
CUCUGGAAAUCAUAAAACU 239 1479 GUUUUUGAGCUAGAAGGAG 83 1479
GUUUUUGAGCUAGAAGGAG 83 1497 CUCCUUCUAGCUCAAAAAC 240 1497
GAUCAAAUUACAUUUAUGU 84 1497 GAUCAAAUUACAUUUAUGU 84 1515
ACAUAAAUGUAAUUUGAUC 241 1515 UUCCUAUAUAUUACAACAU 85 1515
UUCCUAUAUAUUACAACAU 85 1533 AUGUUGUAAUAUAUAGGAA 242 1533
UCGGCGAGGAAAUGAAAGC 86 1533 UCGGCGAGGAAAUGAAAGC 86 1551
GCUUUCAUUUCCUCGCCGA 243 1551 CGAUUCUCCUUGAGUUCUG 87 1551
CGAUUCUCCUUGAGUUCUG 87 1569 CAGAACUCAAGGAGAAUCG 244 1569
GAUGAAUUAAAGGAGUAUG 88 1569 GAUGAAUUAAAGGAGUAUG 88 1587
CAUACUCCUUUAAUUCAUC 245 1587 GCUUUAAAGUCUAUUUCUU 89 1587
GCUUUAAAGUCUAUUUCUU 89 1605 AAGAAAUAGACUUUAAAGC 246 1605
UUAAAGUUUUGUUUAAUAU 90 1605 UUAAAGUUUUGUUUAAUAU 90 1623
AUAUUAAACAAAACUUUAA 247 1623 UUUACAGAAAAAUCCACAU 91 1623
UUUACAGAAAAAUCCACAU 91 1641 AUGUGGAUUUUUCUGUAAA 248 1641
UACAGUAUUGGUAAAAUGC 92 1641 UACAGUAUUGGUAAAAUGC 92 1659
GCAUUUUACCAAUACUGUA 249 1659 CAGGAUUGUUAUAUACCAU 93 1659
CAGGAUUGUUAUAUACCAU 93 1677 AUGGUAUAUAACAAUCCUG 250 1677
UCAUUCGAAUCAUCCUUAA 94 1677 UCAUUCGAAUCAUCCUUAA 94 1695
UUAAGGAUGAUUCGAAUGA 251 1695 AACACUUGAAUUUAUAUUG 95 1695
AACACUUGAAUUUAUAUUG 95 1713 CAAUAUAAAUUCAAGUGUU 252 1713
GUAUGGUAGUAUACUUGGU 96 1713 GUAUGGUAGUAUACUUGGU 96 1731
ACCAAGUAUACUACCAUAC 253 1731 UAAGAUAAAAUUCCACAAA 97 1731
UAAGAUAAAAUUCCACAAA 97 1749 UUUGUGGAAUUUUAUCUUA 254 1749
AAAUAGGGAUGGUGCAGCA 98 1749 AAAUAGGGAUGGUGCAGCA 98 1767
UGCUGCACCAUCCCUAUUU 255 1767 AUAUGCAAUUUCCAUUCCU 99 1767
AUAUGCAAUUUCCAUUCCU 99 1785 AGGAAUGGAAAUUGCAUAU 256 1785
UAUUAUAAUUGACACAGUA 100 1785 UAUUAUAAUUGACACAGUA 100 1803
UACUGUGUCAAUUAUAAUA 257 1803 ACAUUAACAAUCCAUGCCA 101 1803
ACAUUAACAAUCCAUGCCA 101 1821 UGGCAUGGAUUGUUAAUGU 258 1821
AACGGUGCUAAUACGAUAG 102 1821 AACGGUGCUAAUACGAUAG 102 1839
CUAUCGUAUUAGCACCGUU 259 1839 GGCUGAAUGUCUGAGGCUA 103 1839
GGCUGAAUGUCUGAGGCUA 103 1857 UAGCCUCAGACAUUCAGGC 260 1857
ACCAGGUUUAUCACAUAAA 104 1857 ACCAGGUUUAUCACAUAAA 104 1875
UUUAUGUGAUAAACCUGGU 261 1875 AAAACAUUCAGUAAAAUAG 105 1875
AAAACAUUCAGUAAAAUAG 105 1893 CUAUUUUACUGAAUGUUUU 262 1893
GUAAGUUUCUCUUUUCUUC 106 1893 GUAAGUUUCUCUUUUCUUC 106 1911
GAAGAAAAGAGAAACUUAC 263 1911 CAGGGGCAUUUUCCUACAC 107 1911
CAGGGGCAUUUUCCUACAC 107 1929 GUGUAGGAAAAUGCCCCUG 264 1929
CCUCCAAAUGAGGAAUGGA 108 1929 CCUCCAAAUGAGGAAUGGA 108 1947
UCCAUUCCUCAUUUGGAGG 265 1947 AUUUUCUUUAAUGUAAGAA 109 1947
AUUUUCUUUAAUGUAAGAA 109 1965 UUCUUACAUUAAAGAAAAU 266 1965
AGAAUCAUUUUUCUAGAGG 110 1965 AGAAUCAUUUUUCUAGAGG 110 1983
CCUCUAGAAAAAUGAUUCU 267 1983 GUUGGCUUUCAAUUCUGUA 111 1983
GUUGGCUUUCAAUUCUGUA 111 2001 UACAGAAUUGAAAGCCAAC 268 2001
AGCAUACUUGGAGAAACUG 112 2001 AGCAUACUUGGAGAAACUG 112 2019
CAGUUUCUCCAAGUAUGCU 269 2019 GCAUUAUCUUAAAAGGCAG 113 2019
GCAUUAUCUUAAAAGGCAG 113 2037 CUGGCUUUUAAGAUAAUGC 270 2037
GUCAAAUGGUGUUUGUUUU 114 2037 GUCAAAUGGUGUUUGUUUU 114 2055
AAAACAAACACCAUUUGAC 271 2055 UUAUCAAAAUGUCAAAAUA 115 2055
UUAUCAAAAUGUCAAAAUA 115 2073 UAUUUUGACAUUUUGAUAA 272 2073
AACAUACUUGGAGAAGUAU 116 2073 AACAUACUUGGAGAAGUAU 116 2091
AUACUUCUCCAAGUAUGUU 273 2091 UGUAAUUUUGUCUUUGGAA 117 2091
UGUAAUUUUGUCUUUGGAA 117 2109 UUCCAAAGACAAAAUUACA 274 2109
AAAUUACAACACUGCCUUU 118 2109 AAAUUACAACACUGCCUUU 118 2127
AAAGGCAGUGUUGUAAUUU 275 2127 UGCAACACUGCAGUUUUUA 119 2127
UGCAACACUGCAGUUUUUA 119 2145 UAAAAACUGCAGUGUUGCA 276 2145
AUGGUAAAAUAAUAGAAAU 120 2145 AUGGUAAAAUAAUAGAAAU 120 2163
AUUUCUAUUAUUUUACCAU 277 2163 UGAUCGACUCUAUCAAUAU 121 2163
UGAUCGACUCUAUCAAUAU 121 2181 AUAUUGAUAGAGUCGAUCA 278 2181
UUGUAUAAAAAGACUGAAA 122 2181 UUGUAUAAAAAGACUGAAA 122 2199
UUUCAGUCUUUUUAUACAA 279 2199 ACAAUGCAUUUAUAUAAUA 123 2199
ACAAUGCAUUUAUAUAAUA 123 2217 UAUUAUAUAAAUGCAUUGU 280 2217
AUGUAUACAAUAUUGUUUU 124 2217 AUGUAUACAAUAUUGUUUU 124 2235
AAAACAAUAUUGUAUACAU 281 2235 UGUAAAUAAGUGUCUCCUU 125 2235
UGUAAAUAAGUGUCUCCUU 125 2253 AAGGAGACACUUAUUUACA 282 2253
UUUUUAUUUACUUUGGUAU 126 2253 UUUUUAUUUACUUUGGUAU 126 2271
AUACCAAAGUAAAUAAAAA 283 2271 UAUUUUUACACUAAGGACA 127 2271
UAUUUUUACACUAAGGACA 127 2289 UGUCCUUAGUGUAAAAAUA 284 2289
AUUUCAAAUUAAGUACUAA 128 2289 AUUUCAAAUUAAGUACUAA 128 2307
UUAGUACUUAAUUUGAAAU 285 2307 AGGCACAAAGACAUGUCAU 129 2307
AGGCACAAAGACAUGUCAU 129 2325 AUGACAUGUCUUUGUGCCU 286 2325
UGCAUCACAGAAAAGCAAC 130 2325 UGCAUCACAGAAAAGCAAC 130 2343
GUUGCUUUUCUGUGAUGCA 287 2343 CUACUUAUAUUUCAGAGCA 131 2343
CUACUUAUAUUUCAGAGCA 131 2361 UGCUCUGAAAUAUAAGUAG 288 2361
AAAUUAGCAGAUUAAAUAG 132 2361 AAAUUAGCAGAUUAAAUAG 132 2379
CUAUUUAAUCUGCUAAUUU 289 2379 GUGGUCUUAAAACUCCAUA 133 2379
GUGGUCUUAAAACUCCAUA 133 2397 UAUGGAGUUUUAAGACCAC 290 2397
AUGUUAAUGAUUAGAUGGU 134 2397 AUGUUAAUGAUUAGAUGGU 134 2415
ACCAUCUAAUCAUUAACAU 291 2415 UUAUAUUACAAUCAUUUUA 135 2415
UUAUAUUACAAUCAUUUUA 135 2433 UAAAAUGAUUGUAAUAUAA 292 2433
AUAUUUUUUUACAUGAUUA 136 2433 AUAUUUUUUUACAUGAUUA 136 2451
UAAUCAUGUAAAAAAAUAU 293 2451 AACAUUCACUUAUGGAUUC 137 2451
AACAUUCACUUAUGGAUUC 137 2469 GAAUCCAUAAGUGAAUGUU 294 2469
CAUGAUGGCUGUAUAAAGU 138 2469 CAUGAUGGCUGUAUAAAGU 138 2487
ACUUUAUACAGCCAUCAUG 295 2487 UGAAUUUGAAAUUUCAAUG 139 2487
UGAAUUUGAAAUUUCAAUG 139 2505 CAUUGAAAUUUCAAAUUCA 296 2505
GGUUUACUGUCAUUGUGUU 140 2505 GGUUUACUGUCAUUGUGUU 140 2523
AACACAAUGACAGUAAACC 297 2523 UUAAAUCUCAACGUUCCAU 141 2523
UUAAAUCUCAACGUUCCAU 141 2541 AUGGAACGUUGAGAUUUAA 298 2541
UUAUUUUAAUACUUGCAAA 142 2541 UUAUUUUAAUACUUGCAAA 142 2559
UUUGCAAGUAUUAAAAUAA 299 2559 AAACAUUACUAAGUAUACC 143 2559
AAACAUUACUAAGUAUACC 143 2577 GGUAUACUUAGUAAUGUUU 300 2577
CAAAAUAAUUGACUCUAUU 144 2577 CAAAAUAAUUGACUCUAUU 144 2595
AAUAGAGUCAAUUAUUUUG 301 2595 UAUCUGAAAUGAAGAAUAA 145 2595
UAUCUGAAAUGAAGAAUAA 145 2613 UUAUUCUUCAUUUCAGAUA 302 2613
AACUGAUGCUAUCUCAACA 146 2613 AACUGAUGCUAUCUCAACA 146 2631
UGUUGAGAUAGCAUCAGUU 303 2631 AAUAACUGUUACUUUUAUU 147 2631
AAUAACUGUUACUUUUAUU 147 2649 AAUAAAAGUAACAGUUAUU 304 2649
UUUAUAAUUUGAUAAUGAA 148 2649 UUUAUAAUUUGAUAAUGAA 148 2667
UUCAUUAUCAAAUUAUAAA 305 2667 AUAUAUUUCUGCAUUUAUU 149 2667
AUAUAUUUCUGCAUUUAUU 149 2685 AAUAAAUGCAGAAAUAUAU 306 2685
UUACUUCUGUUUUGUAAAU 150 2685 UUACUUCUGUUUUGUAAAU 150 2703
AUUUACAAAACAGAAGUAA 307 2703 UUGGGAUUUUGUUAAUCAA 151 2703
UUGGGAUUUUGUUAAUCAA 151 2721 UUGAUUAACAAAAUCCCAA 308 2721
AAUUUAUUGUACUAUGACU 152 2721 AAUUUAUUGUACUAUGACU 152 2739
AGUCAUAGUACAAUAAAUU 309 2739 UAAAUGAAAUUAUUUCUUA 153 2739
UAAAUGAAAUUAUUUCUUA 153 2757 UAAGAAAUAAUUUCAUUUA 310 2757
ACAUCUAAUUUGUAGAAAC 154 2757 ACAUCUAAUUUGUAGAAAC 154 2775
GUUUCUACAAAUUAGAUGU 311 2775 CAGUAUAAGUUAUAUUAAA 155 2775
CAGUAUAAGUUAUAUUAAA 155 2793 UUUAAUAUAACUUAUACUG 312 2793
AGUGUUUUCACAUUUUUUU 156 2793 AGUGUUUUCACAUUUUUUU 156 2811
AAAAAAAUGUGAAAACACU 313 2803 CAUUUUUUUGAAAGACAAA 157 2803
CAUUUUUUUGAAAGACAAA 157 2821 UUUGUCUUUCAAAAAAAUG 314 The 3'-ends of
the Upper sequence and the Lower sequence of the siNA construct can
include an overhang sequence, for example about 1, 2, 3, or 4
nucleotides in length, preferably 2 nucleotides in length, wherein
the overhanging sequence of the lower sequence is optionally
complementary to a portion of the target sequence. The upper
sequence is also referred to as the sense strand, whereas the lower
sequence is also referred to as the antisense strand. The upper and
lower sequences in the Table can further comprise a chemical
modification having Formulae I-VII or any combination thereof.
TABLE-US-00003 TABLE III Myostatin/GDF8 Synthetic Modified siNA
constructs Target Seq Seq Pos Target ID Cmpd# Aliases Sequence ID 7
ACUGGUGUGGCAAGUUGUCUCUC 315 GDF8:9U21 sense siNA
UGGUGUGGCAAGUUGUCUCTT 323 321 AACUUCGUCUGGAAACAGCUCCU 316
GDF8:323U21 sense siNA CUUCGUCUGGAAACAGCUCTT 324 330
UGGAAACAGCUCCUAACAUCAGC 317 GDF8:332U21 sense siNA
GAAACAGCUCCUAACAUCATT 325 522 AAGUGGAUGGAAAACCCAAAUGU 318
GDF8:524U21 sense siNA GUGGAUGGAAAACCCAAAUTT 326 871
AGAUGGGCUGAAUCCGUUUUUAG 319 GDF8:873U21 sense siNA
AUGGGCUGAAUCCGUUUUUTT 327 1416 UAUGCAAUGGUUGGCAUUUAACC 320
GDF8:1418U21 sense siNA UGCAAUGGUUGGCAUUUAATT 328 1425
GUUGGCAUUUAACCAUCCAAACA 321 GDF8:1427U21 sense siNA
UGGCAUUUAACCAUCCAAATT 329 1926 ACACCUCCAAAUGAGGAAUGGAU 322
GDF8:1928U21 sense siNA ACCUCCAAAUGAGGAAUGGTT 330 7
ACUGGUGUGGCAAGUUGUCUCUC 315 GDF8:27L21 antisense siNA (9C)
GAGACAACUUGCCACACCATT 331 321 AACUUCGUCUGGAAACAGCUCCU 316
GDF8:341L21 antisense siNA GAGCUGUUUCCAGACGAAGTT 332 (323C) 330
UGGAAACAGCUCCUAACAUCAGC 317 GDF8:350L21 antisense siNA
UGAUGUUAGGAGCUGUUUCTT 333 (332C) 522 AAGUGGAUGGAAAACCCAAAUGU 318
GDF8:542L21 antisense siNA AUUUGGGUUUUCCAUCCACTT 334 (524C) 871
AGAUGGGCUGAAUCCGUUUUUAG 319 GDF8:891L21 antisense siNA
AAAAACGGAUUCAGCCCAUTT 335 (873C) 1416 UAUGCAAUGGUUGGCAUUUAACC 320
GDF8:1436L21 antisense siNA UUAAAUGCCAACCAUUGCATT 336 (1418C) 1425
GUUGGCAUUUAACCAUCCAAACA 321 GDF8:1445L21 antisense siNA
UUUGGAUGGUUAAAUGCCATT 337 (1427C) 1926 ACACCUCCAAAUGAGGAAUGGAU 322
GDF8:1946L21 antisense siNA CCAUUCCUCAUUUGGAGGUTT 338 (1928C) 7
ACUGGUGUGGCAAGUUGUCUCUC 315 GDF8:9U21 sense siNA stab04 B
uGGuGuGGcAAGuuGucucTT B 339 321 AACUUCGUCUGGAAACAGCUCCU 316
GDF8:323U21 sense siNA stab04 B cuucGucuGGAAAcAGcucTT B 34C 33C
UGGAAACAGCUCCUAACAUCAGC 317 GDF8:332U21 sense siNA stab04 B
GAAAcAGcuccuAAcAucATT B 341 522 AAGUGGAUGGAAAACCCAAAUGU 318
GDF8:524U21 sense siNA stab04 B GuGGAuGGAAAAcccAAAuTT B 342 871
AGAUGGGCUGAAUCCGUUUUUAG 319 GDF8:873U21 sense siNA stab04 B
AuGGGcuGAAuccGuuuuuTT B 343 1416 UAUGCAAUGGUUGGCAUUUAACC 320
GDF8:1418U21 sense siNA stab04 B uGcAAuGGuuGGcAuuuAATT B 344 1425
GUUGGCAUUUAACCAUCCAAACA 321 GDF8:1427U21 sense siNA stab04 B
uGGcAuuuAAccAuccAAATT B 345 1926 ACACCUCCAAAUGAGGAAUGGAU 322
GDF8:1928U21 sense siNA stab04 B AccuccAAAuGAGGAAuGGTT B 346 7
ACUGGUGUGGCAAGUUGUCUCUC 315 GDF8:27L21 antisense siNA (9C)
GAGAcAAcuuGccAcAccATsT 347 stab05 321 AACUUCGUCUGGAAACAGCUCCU 316
GDF8:341L21 antisense siNA GAGcuGuuuccAGAcGAAGTsT 348 (323C) stab05
33 CUGGAAACAGCUCCUAACAUCAGC 317 GDF8:35CL21 antisense siNA
uGAuGuuAGGAGcuGuuucTsT 349 (332C) stab05 522
AAGUGGAUGGAAAACCCAAAUGU 318 GDF8:542L21 antisense siNA
AuuuGGGuuuuccAuccAcTsT 350 (524C) stab05 871
AGAUGGGCUGAAUCGGUUUUUAG 319 GDF8:891L21 antisense siNA
AAAAAcGGAuucAGcccAuTsT 351 (873C) stab05 1416
UAUGCAAUGGUUGGCAUUUAACC 320 GDF8:1436L21 antisense siNA
uuAAAuGccAAccAuuGcATsT 352 (1418C) stab05 1425
GUUGGCAUUUAACCAUCCAAACA 321 GDF8:1445L21 antisense siNA
uuuGGAuGGuuAAAuGccATsT 353 1926 ACACCUCCAAAUGAGGAAUGGAU 322
GDF8:1946L21 antisense siNA ccAuuccucAuuuGGAGGuTsT 354 (1928C)
stab05 7 ACUGGUGUGGCAAGUUGUCUCUC 315 GDF8:9U21 sense siNA stab07 B
uGGuGuGGcAAGuuGucucTT B 355 321 AACUUCGUCUGGAAACAGCUCCU 316
GDF8:323U21 sense siNA stab07 B cuucGucuGGAAAcAGcucTT B 356 330
UGGAAACAGCUCCUAACAUCAGC 317 GDF8:332U21 sense siNA stab07 B
GAAAcAGcuccuAAcAucATT B 357 522 AAGUGGAUGGAAAACCCAAAUGU 318
GDF8:524U21 sense siNA stab07 B GuGGAuGGAAAAcccAAAuTT B 358 871
AGAUGGGCUGAAUCCGUUUUUAG 319 GDF8:873U21 sense siNA stab07 B
AuGGGcuGAAuccGuuuuuTT B 359 1416 UAUGCAAUGGUUGGCAUUUAACC 320
GDF8:1418U21 sense siNA stab07 B uGcAAuGGuuGGcAuuuAATT B 360 1425
GUUGGCAUUUAACCAUCCAAACA 321 GDF8:1427U21 sense siNA stab07 B
uGGcAuuuAAccAuccAAATT B 361 1926 ACACCUCCAAAUGAGGAAUGGAU 322
GDF8:1928U21 sense siNA stab07 B AccuccAAAuGAGGAAuGGTT B 362 7
ACUGGUGUGGCAAGUUGUCUCUC 315 GDF8:27L21 antisense siNA (9C)
GAGAcAAcuuGccAcAccATsT 363 stab11 321 AACUUCGUCUGGAAACAGCUCCU 316
GDF8:341L21 antisense siNA GAGcuGuuuccAGAcGAAGTsT 364 (323C) stab11
330 UGGAAACAGCUCCUAACAUCAGC 317 GDF8:350L21 antisense siNA
uGAuGuuAGGAGcuGuuucTsT 365 (332C) stab11 522
AAGUGGAUGGAAAACCCAAAUGU 318 GDF8:542L21 antisense siNA
AuuuGGGuuuuccAuccAcTsT 366 (524C) stab11 871
AGAUGGGCUGAAUCCGUUUUUAG 319 GDF8:891L21 antisense siNA
AAAAAcGGAuucAGcccAuTsT 367 (873C) stab11 1416
UAUGCAAUGGUUGGCAUUUAACC 320 GDF8:1436L21 antisense siNA
uuAAAuGccAAccAuuGcATsT 368 (1418C) stab11 1425
GUUGGCAUUUAACCAUCCAAACA 321 GDF8:1445L21 antisense siNA
uuuGGAuGGuuAAAuGccATsT 369 (1427C) stab11 1926
ACACCUCCAAAUGAGGAAUGGAU 322 GDF8:1946L21 antisense siNA
ccAuuccucAuuuGGAGGuTsT 370 (1928C) stab11 7 ACUGGUGUGGCAAGUUGUCUCUC
315 GDF8:9U21 sense siNA stab18 B uGGuGuGGcAAGuuGucucTT B 371 321
AACUUCGUCUGGAAACAGCUCCU 316 GDF8:323U21 sense siNA stab18 B
cuucGucuGGAAAcAGcucTT B 372 330 UGGAAACAGCUCCUAACAUCAGC 317
GDF8:332U21 sense siNA stab18 B GAAAcAGcuccuAAcAucATT B 373 522
AAGUGGAUGGAAAACCCAAAUGU 318 GDF8:524U21 sense siNA stab18 B
GuGGAuGGAAAAcccAAAuTT B 374 871 AGAUGGGCUGAAUCCGUUUUUAG 319
GDF8:873U21 sense siNA stab18 B AuGGGcuGAAuccGuuuuuTT B 375 1416
UAUGCAAUGGUUGGCAUUUAACC 320 GDF8:1418U21 sense siNA stab18 B
uGcAAuGGuuGGcAuuuAATT B 376 1425 GUUGGCAUUUAACCAUCCAAACA 321
GDF8:1427U21 sense siNA stab18 B uGGcAuuuAAccAuccAAATT B 377 1926
ACACCUCCAAAUGAGGAAUGGAU 322 GDF8:1928U21 sense siNA stab18 B
AccuccAAAuGAGGAAuGGTT B 378 7 ACUGGUGUGGCAAGUUGUCUCUC 315
GDF8:27L21 antisense siNA (9C) GAGAcAAcuuGccAcAccATsT 379 stab08
321 AACUUCGUCUGGAAACAGCUCCU 316 GDF8:341121 antisense siNA
GAGcuGuuuccAGAcGAAGTsT 380 (323C) stab08 330
UGGAAACAGCUCCUAACAUCAGC 317 GDF8:350L21 antisense siNA
uGAuGuuAGGAGcuGuuucTsT 381 (332C) stab08 522
AAGUGGAUGGAAAACCCAAAUGU 318 GDF8:542L21 antisense siNA
AuuuGGGuuuuccAuccAcTsT 382 (524C) stab08 871
AGAUGGGCUGAAUCCGUUUUUAG 319 GDF8:891L21 antisense siNA
AAAAAcGGAuucAGcccAuTsT 383 (873C) stab08 1416
UAUGCAAUGGUUGGCAUUUAACC 320 GDF8:1436L21 antisense siNA
uuAAAuGccAAccAuuGcATsT 384 (1418C) stab08 1425
GUUGGCAUUUAACCAUCCAAACA 321 GDF8:1445L21 antisense siNA
uuuGGAuGGuuAAAuGccATsT 385 (1427C) stab08 1926
ACACCUCCAAAUGAGGAAUGGAU 322 GDF8:1946L21 antisense siNA
ccAuuocucAuuuGGAGGuTsT 386 (1928C) stab08 7 ACUGGUGUGGCAAGUUGUCUCUC
315 37277 GDF8:9U21 sense siNA stab09 B UGGUGUGGCAAGUUGUCUCTT B 387
321 AACUUCGUCUGGAAACAGCUCCU 316 37278 GDF8:323U21 sense siNA stab09
B CUUCGUCUGGAAACAGCUCTT B 388 330 UGGAAACAGCUCCUAACAUCAGC 317 37279
GDF8:332U21 sense siNA stab09 B GAAACAGCUCCUAACAUCATT B 389 522
AAGUGGAUGGAAAACCCAAAUGU 318 37280 GDF8:524U21 sense siNA stab09 B
GUGGAUGGAAAACCCAAAUTT B 39C 871 AGAUGGGCUGAAUCCGUUUUUAG 319 37281
GDF8:873U21 sense siNA stab09 B AUGGGCUGAAUCCGUUUUUTT B 391 1416
UAUGCAAUGGUUGGCAUUUAACC 320 37282 GDF8:1418U21 sense siNA stab09 B
UGCAAUGGUUGGCAUUUAATT B 392 1425 GUUGGCAUUUAACCAUCCAAACA 321 37283
GDF8:1427U21 sense siNA stab09 B UGGCAUUUAACCAUCCAAATT B 393 1926
ACACCUCCAAAUGAGGAAUGGAU 322 37284 GDF8:1928U21 sense siNA stab09
B
ACCUCCAAAUGAGGAAUGGTT B 394 7 ACUGGUGUGGCAAGUUGUCUCUC 315
GDF8:27L21 antisense siNA (9C) GAGACAACUUGCCACACCATsT 395 stab10
321 AACUUCGUCUGGAAACAGCUCCU 316 GDF8:341L21 antisense siNA
GAGCUGUUUCCAGACGAAGTsT 396 (323C) stab10 330
UGGAAACAGCUCCUAACAUCAGC 317 GDF8:350L21 antisense siNA
UGAUGUUAGGAGCUGUUUCTsT 397 (332C) stab10 522
AAGUGGAUGGAAAACCCAAAUGU 318 GDF8:542L21 antisense siNA
AUUUGGGUUUUCCAUCCACTsT 398 (524C) stab10 871
AGAUGGGCUGAAUCCGUUUUUAG 319 GDF8:891121 antisense siNA
AAAAACGGAUUCAGCCCAUTsT 399 (873C) stab10 1416
UAUGCAAUGGUUGGCAUUUAACC 320 GDF8:1436L21 antisense siNA
UUAAAUGCCAACCAUUGCATsT 400 (1418C) stab10 1425
GUUGGCAUUUAACCAUCCAAACA 321 GDF8:1445L21 antisense siNA
UUUGGAUGGUUAAAUGCCATsT 401 (1427C) stab10 1926
ACACCUCCAAAUGAGGAAUGGAU 322 GDF8:1946L21 antisense siNA
CCAUUCCUCAUUUGGAGGUTsT 402 (1928C) stab10 7 ACUGGUGUGGCAAGUUGUCUCUC
315 GDF8:27L21 antisense siNA (9C) GAGAcAAcuuGccAcAccATT B 403
stab19 321 AACUUCGUCUGGAAACAGCUCCU 316 GDF8:341121 antisense siNA
GAGcuGuuuccAGAcGAAGTT B 404 (323C) stab19 330
UGGAAACAGCUCCUAACAUCAGC 317 GDF8:350L21 antisense siNA
uGAuGuuAGGAGcuGuuucTT B 405 (332C) stab19 522
AAGUGGAUGGAAAACCCAAAUGU 318 GDF8:542L21 antisense siNA
AuuuGGGuuuuccAuccAcTT B 406 (524C) stab19 871
AGAUGGGCUGAAUCCGUUUUUAG 319 GDF8:891121 antisense siNA
AAAAAcGGAuucAGcccAuTT B 407 (873C) stab19 1416
UAUGCAAUGGUUGGCAUUUAACC 320 GDF8:1436L21 antisense siNA
uuAAAuGccAAccAuuGcATT B 408 1425 GUUGGCAUUUAACCAUCCAAACA 321
GDF8:1445L21 antisense siNA uuuGGAuGGuuAAAuGccATT B 409 (1427C)
stab19 1926 ACACCUCCAAAUGAGGAAUGGAU 322 GDF8:1946L21 antisense siNA
ccAuuccucAuuuGGAGGuTT B 410 (1928C) stab19 7
ACUGGUGUGGCAAGUUGUCUCUC 315 37285 GDF8:27L21 antisense siNA (9C)
GAGACAACUUGCCACACCATT B 411 stab22 321 AACUUCGUCUGGAAACAGCUCCU 316
37286 GDF8:341121 antisense siNA GAGCUGUUUCCAGACGAAGTT B 412 (323C)
stab22 330 UGGAAACAGCUCCUAACAUCAGC 317 37287 GDF8:350121 antisense
siNA UGAUGUUAGGAGCUGUUUCTT B 413 (332C) stab22 522
AAGUGGAUGGAAAACCCAAAUGU 318 37288 GDF8:542121 antisense siNA
AUUUGGGUUUUCCAUCCACTT B 414 (524C) stab22 871
AGAUGGGCUGAAUCCGUUUUUAG 319 37289 GDF8:891121 antisense siNA
AAAAACGGAUUCAGCCCAUTT B 415 (873C) stab22 1416
UAUGCAAUGGUUGGCAUUUAACC 320 3729C GDF8:1436L21 antisense siNA
UUAAAUGCCAACCAUUGCATT B 416 (1418C) stab22 1425
GUUGGCAUUUAACCAUCCAAACA 321 37291 GDF8:1445L21 antisense siNA
UUUGGAUGGUUAAAUGCCATT B 417 (1427C) stab22 1926
ACACCUCCAAAUGAGGAAUGGAU 322 37292 GDF8:1946L21 antisense siNA
CCAUUCCUCAUUUGGAGGUTT B 418 (1928C) stab22 Uppercase =
ribonucleotide T = thymidine s = phosphorothioate linkage G = deoxy
Guanosine G = 2'-O-methyl Guanosine u, c = 2'-deoxy-2'-fluoro U, C
B = inverted deoxy abasic A = deoxy Adenosine A = 2'-O-methyl
Adenosine
TABLE-US-00004 TABLE IV Non-limiting examples of Stabilization
Chemistries for chemically modified siNA constructs Chem- Pu- istry
pyrimidine rine cap p = S Strand "Stab Ribo Ribo TT at 3'- S/AS 00"
ends "Stab Ribo Ribo -- 5 at 5'-end S/AS 1" 1 at 3'-end "Stab Ribo
Ribo -- All linkages Usually AS 2" "Stab 2'-fluoro Ribo -- 4 at
5'-end Usually S 3" 4 at 3'-end "Stab 2'-fluoro Ribo 5' and 3'- --
Usually S 4" ends "Stab 2'-fluoro Ribo -- 1 at 3'-end Usually AS 5"
"Stab 2'-O-Methyl Ribo 5' and 3'- -- Usually S 6" ends "Stab
2'-fluoro 2'- 5' and 3'- -- Usually S 7" deoxy ends "Stab 2'-fluoro
2'-O- -- 1 at 3'-end Usually AS 8" Methyl "Stab Ribo Ribo 5' and
3'- -- Usually S 9" ends "Stab Ribo Ribo -- 1 at 3'-end Usually AS
10" "Stab 2'-fluoro 2'- -- 1 at 3'-end Usually AS 11" deoxy "Stab
2'-fluoro LNA 5' and 3'- Usually S 12" ends "Stab 2'-fluoro LNA 1
at 3'-end Usually AS 13" "Stab 2'-fluoro 2'- 2 at 5'-end Usually AS
14" deoxy 1 at 3'-end "Stab 2'-deoxy 2'- 2 at 5'-end Usually AS 15"
deoxy 1 at 3'-end "Stab Ribo 2'-O- 5' and 3'- Usually S 16" Methyl
ends "Stab 2'-O-Methyl 2'-O- 5' and 3'- Usually S 17" Methyl ends
"Stab 2'-fluoro 2'-O- 5' and 3'- Usually S 18" Methyl ends "Stab
2'-fluoro 2'-O- 3'-end Usually AS 19" Methyl "Stab 2'-fluoro 2'-
3'-end Usually AS 20" deoxy "Stab 2'-fluoro Ribo 3'-end Usually AS
21" "Stab Ribo Ribo 3'-end Usually AS 22" "Stab 2'-fluoro* 2'- 5'
and 3'- Usually S 23" deoxy* ends "Stab 2'-fluoro* 2'-O- -- 1 at
3'-end Usually AS 24" Methyl* "Stab 2'-fluoro* 2'-O- -- 1 at 3'-end
Usually AS 25" Methyl* CAP = any terminal cap, see for example FIG.
10. All Stab 00-25 chemistries can comprise 3'-terminal thymidine
(TT) residues All Stab 00-25 chemistries typically comprise about
21 nucleotides, but can vary as described herein. S = sense strand
AS = antisense strand *Stab 23 has single ribonucleotide adjacent
to 3'-CAP *Stab 24 has single ribonucleotide at 5'-terminus *Stab
25 has three ribonucleotides at 5'-terminus
TABLE-US-00005 TABLE V A. 2.5 .mu.mol Synthesis Cycle ABI 394
Instrument Reagent Equivalents Amount Wait Time* DNA Wait Time*
2'-O-methyl Wait Time*RNA Phosphoramidites 6.5 163 .mu.L 45 sec 2.5
min 7.5 min S-Ethyl Tetrazole 23.8 238 .mu.L 45 sec 2.5 min 7.5 min
Acetic Anhydride 100 233 .mu.L 5 sec 5 sec 5 sec N-Methyl 186 233
.mu.L 5 sec 5 sec 5 sec Imidazole TCA 176 2.3 mL 21 sec 21 sec 21
sec Iodine 11.2 1.7 mL 45 sec 45 sec 45 sec Beaucage 12.9 645 .mu.L
100 sec 300 sec 300 sec Acetonitrile NA 6.67 mL NA NA NA B. 0.2
.mu.mol Synthesis Cycle ABI 394 Instrument Reagent Equivalents
Amount Wait Time* DNA Wait Time* 2'-O-methyl Wait Time*RNA
Phosphoramidites 15 31 .mu.L 45 sec 233 sec 465 sec S-Ethyl
Tetrazole 38.7 31 .mu.L 45 sec 233 min 465 sec Acetic Anhydride 655
124 .mu.L 5 sec 5 sec 5 sec N-Methyl 1245 124 .mu.L 5 sec 5 sec 5
sec Imidazole TCA 700 732 .mu.L 10 sec 10 sec 10 sec Iodine 20.6
244 .mu.L 15 sec 15 sec 15 sec Beaucage 7.7 232 .mu.L 100 sec 300
sec 300 sec Acetonitrile NA 2.64 mL NA NA NA C. 0.2 .mu.mol
Synthesis Cycle 96 well Instrument Equivalents: DNA/ Amount:
DNA/2'-O- Wait Time* 2'-O- Reagent 2'-O-methyl/Ribo methyl/Ribo
Wait Time* DNA methyl Wait Time* Ribo Phosphoramidites 22/33/66
40/60/120 .mu.L 60 sec 180 sec 360 sec S-Ethyl Tetrazole 70/105/210
40/60/120 .mu.L 60 sec 180 min 360 sec Acetic Anhydride 265/265/265
50/50/50 .mu.L 10 sec 10 sec 10 sec N-Methyl 502/502/502 50/50/50
.mu.L 10 sec 10 sec 10 sec Imidazole TCA 238/475/475 250/500/500
.mu.L 15 sec 15 sec 15 sec Iodine 6.8/6.8/6.8 80/80/80 .mu.L 30 sec
30 sec 30 sec Beaucage 34/51/51 80/120/120 100 sec 200 sec 200 sec
Acetonitrile NA 1150/1150/1150 .mu.L NA NA NA Wait time does not
include contact time during delivery. Tandem synthesis utilizes
double coupling of linker molecule
Sequence CWU 1
1
441119RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 1auucacuggu guggcaagu 19219RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 2uugucucuca gacuguaca
19319RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 3augcauuaaa auuuugcuu 19419RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 4uggcauuacu caaaagcaa
19519RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 5aaagaaaagu aaaaggaag 19619RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 6gaaacaagaa caagaaaaa
19719RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 7aagauuauau ugauuuuaa 19819RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 8aaaucaugca aaaacugca
19919RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 9aacucugugu uuauauuua 191019RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 10accuguuuau gcugauugu
191119RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 11uugcuggucc aguggaucu 191219RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 12uaaaugagaa cagugagca
191319RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 13aaaaagaaaa uguggaaaa 191419RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 14aagaggggcu guguaaugc
191519RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 15cauguacuug gagacaaaa 191619RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 16acacuaaauc uucaagaau
191719RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 17uagaagccau uaagauaca 191819RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 18aaauccucag uaaacuucg
191919RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 19gucuggaaac agcuccuaa 192019RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 20acaucagcaa agauguuau
192119RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 21uaagacaacu uuuacccaa 192219RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 22aagcuccucc acuccggga
192319RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 23aacugauuga ucaguauga 192419RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 24auguccagag ggaugacag
192519RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 25gcagcgaugg cucuuugga 192619RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 26aagaugacga uuaucacgc
192719RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 27cuacaacgga aacaaucau 192819RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 28uuaccaugcc uacagaguc
192919RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 29cugauuuucu aaugcaagu 193019RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 30uggauggaaa acccaaaug
193119RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 31guugcuucuu uaaauuuag 193219RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 32gcucuaaaau acaauacaa
193319RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 33auaaaguagu aaaggccca 193419RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 34aacuauggau auauuugag
193519RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 35gacccgucga gacuccuac 193619RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 36caacaguguu ugugcaaau
193719RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 37uccugagacu caucaaacc 193819RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 38cuaugaaaga cgguacaag
193919RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 39gguauacugg aauccgauc 194019RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 40cucugaaacu ugacaugaa
194119RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 41acccaggcac ugguauuug 194219RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 42ggcagagcau ugaugugaa
194319RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 43agacaguguu gcaaaauug 194419RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 44ggcucaaaca accugaauc
194519RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 45ccaacuuagg cauugaaau 194619RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 46uaaaagcuuu agaugagaa
194719RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 47auggucauga ucuugcugu 194819RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 48uaaccuuccc aggaccagg
194919RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 49gagaagaugg gcugaaucc 195019RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 50cguuuuuaga ggucaaggu
195119RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 51uaacagacac accaaaaag 195219RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 52gauccagaag ggauuuugg
195319RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 53gucuugacug ugaugagca 195419RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 54acucaacaga aucacgaug
195519RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 55gcugucguua cccucuaac 195619RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 56cuguggauuu ugaagcuuu
195719RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 57uuggauggga uuggauuau 195819RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 58ucgcuccuaa aagauauaa
195919RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 59aggccaauua cugcucugg 196019RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 60gagaguguga auuuguauu
196119RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 61uuuuacaaaa auauccuca 196219RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 62auacucaucu gguacacca
196319RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 63aagcaaaccc cagagguuc 196419RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 64cagcaggccc uugcuguac
196519RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 65cucccacaaa gaugucucc 196619RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 66caauuaauau gcuauauuu
196719RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 67uuaauggcaa agaacaaau 196819RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 68uaauauaugg gaaaauucc
196919RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 69cagcgauggu aguagaccg 197019RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 70gcugugggug cucaugaga
197119RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 71auuuauauua agcguucau 197219RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 72uaacuuccua aaacaugga
197319RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 73aagguuuucc ccucaacaa 197419RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 74auuuugaagc ugugaaauu
197519RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 75uaaguaccac aggcuauag 197619RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 76ggccuagagu augcuacag
197719RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 77gucacuuaag cauaagcua 197819RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 78acaguaugua aacuaaaag
197919RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 79gggggaauau augcaaugg 198019RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 80guuggcauuu aaccaucca
198119RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 81aaacaaauca uacaagaaa 198219RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 82aguuuuauga uuuccagag
198319RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 83guuuuugagc uagaaggag 198419RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 84gaucaaauua cauuuaugu
198519RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 85uuccuauaua uuacaacau 198619RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 86ucggcgagga aaugaaagc
198719RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 87cgauucuccu ugaguucug 198819RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 88gaugaauuaa aggaguaug
198919RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 89gcuuuaaagu cuauuucuu 199019RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 90uuaaaguuuu guuuaauau
199119RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 91uuuacagaaa aauccacau 199219RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 92uacaguauug guaaaaugc
199319RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 93caggauuguu auauaccau 199419RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 94ucauucgaau cauccuuaa
199519RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 95aacacuugaa uuuauauug 199619RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 96guaugguagu auacuuggu
199719RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 97uaagauaaaa uuccacaaa 199819RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 98aaauagggau ggugcagca
199919RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 99auaugcaauu uccauuccu 1910019RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 100uauuauaauu
gacacagua 1910119RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 101acauuaacaa uccaugcca
1910219RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 102aacggugcua auacgauag 1910319RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 103ggcugaaugu
cugaggcua 1910419RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 104accagguuua ucacauaaa
1910519RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 105aaaacauuca guaaaauag 1910619RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 106guaaguuucu
cuuuucuuc 1910719RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 107caggggcauu uuccuacac
1910819RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 108ccuccaaaug aggaaugga 1910919RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 109auuuucuuua
auguaagaa 1911019RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 110agaaucauuu uucuagagg
1911119RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 111guuggcuuuc aauucugua 1911219RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 112agcauacuug
gagaaacug 1911319RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 113gcauuaucuu aaaaggcag
1911419RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 114gucaaauggu guuuguuuu 1911519RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 115uuaucaaaau
gucaaaaua 1911619RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 116aacauacuug gagaaguau
1911719RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 117uguaauuuug ucuuuggaa 1911819RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 118aaauuacaac
acugccuuu 1911919RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 119ugcaacacug caguuuuua
1912019RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 120augguaaaau aauagaaau 1912119RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 121ugaucgacuc
uaucaauau 1912219RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 122uuguauaaaa agacugaaa
1912319RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 123acaaugcauu uauauaaua 1912419RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 124auguauacaa
uauuguuuu 1912519RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 125uguaaauaag ugucuccuu
1912619RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region
126uuuuuauuua cuuugguau 1912719RNAArtificial SequenceSynthetic
Target Sequence/siNA sense region 127uauuuuuaca cuaaggaca
1912819RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 128auuucaaauu aaguacuaa 1912919RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 129aggcacaaag
acaugucau 1913019RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 130ugcaucacag aaaagcaac
1913119RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 131cuacuuauau uucagagca 1913219RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 132aaauuagcag
auuaaauag 1913319RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 133guggucuuaa aacuccaua
1913419RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 134auguuaauga uuagauggu 1913519RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 135uuauauuaca
aucauuuua 1913619RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 136auauuuuuuu acaugauua
1913719RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 137aacauucacu uauggauuc 1913819RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 138caugauggcu
guauaaagu 1913919RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 139ugaauuugaa auuucaaug
1914019RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 140gguuuacugu cauuguguu 1914119RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 141uuaaaucuca
acguuccau 1914219RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 142uuauuuuaau acuugcaaa
1914319RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 143aaacauuacu aaguauacc 1914419RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 144caaaauaauu
gacucuauu 1914519RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 145uaucugaaau gaagaauaa
1914619RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 146aacugaugcu aucucaaca 1914719RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 147aauaacuguu
acuuuuauu 1914819RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 148uuuauaauuu gauaaugaa
1914919RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 149auauauuucu gcauuuauu 1915019RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 150uuacuucugu
uuuguaaau 1915119RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 151uugggauuuu guuaaucaa
1915219RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 152aauuuauugu acuaugacu 1915319RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 153uaaaugaaau
uauuucuua 1915419RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 154acaucuaauu uguagaaac
1915519RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 155caguauaagu uauauuaaa 1915619RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 156aguguuuuca
cauuuuuuu 1915719RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 157cauuuuuuug aaagacaaa
1915819RNAArtificial SequenceSynthetic siNA antisense region
158acuugccaca ccagugaau 1915919RNAArtificial SequenceSynthetic siNA
antisense region 159uguacagucu gagagacaa 1916019RNAArtificial
SequenceSynthetic siNA antisense region 160aagcaaaauu uuaaugcau
1916119RNAArtificial SequenceSynthetic siNA antisense region
161uugcuuuuga guaaugcca 1916219RNAArtificial SequenceSynthetic siNA
antisense region 162cuuccuuuua cuuuucuuu 1916319RNAArtificial
SequenceSynthetic siNA antisense region 163uuuuucuugu ucuuguuuc
1916419RNAArtificial SequenceSynthetic siNA antisense region
164uuaaaaucaa uauaaucuu 1916519RNAArtificial SequenceSynthetic siNA
antisense region 165ugcaguuuuu gcaugauuu 1916619RNAArtificial
SequenceSynthetic siNA antisense region 166uaaauauaaa cacagaguu
1916719RNAArtificial SequenceSynthetic siNA antisense region
167acaaucagca uaaacaggu 1916819RNAArtificial SequenceSynthetic siNA
antisense region 168agauccacug gaccagcaa 1916919RNAArtificial
SequenceSynthetic siNA antisense region 169ugcucacugu ucucauuua
1917019RNAArtificial SequenceSynthetic siNA antisense region
170uuuuccacau uuucuuuuu 1917119RNAArtificial SequenceSynthetic siNA
antisense region 171gcauuacaca gccccucuu 1917219RNAArtificial
SequenceSynthetic siNA antisense region 172uuuugucucc aaguacaug
1917319RNAArtificial SequenceSynthetic siNA antisense region
173auucuugaag auuuagugu 1917419RNAArtificial SequenceSynthetic siNA
antisense region 174uguaucuuaa uggcuucua 1917519RNAArtificial
SequenceSynthetic siNA antisense region 175cgaaguuuac ugaggauuu
1917619RNAArtificial SequenceSynthetic siNA antisense region
176uuaggagcug uuuccagac 1917719RNAArtificial SequenceSynthetic siNA
antisense region 177auaacaucuu ugcugaugu 1917819RNAArtificial
SequenceSynthetic siNA antisense region 178uuggguaaaa guugucuua
1917919RNAArtificial SequenceSynthetic siNA antisense region
179ucccggagug gaggagcuu 1918019RNAArtificial SequenceSynthetic siNA
antisense region 180ucauacugau caaucaguu 1918119RNAArtificial
SequenceSynthetic siNA antisense region 181cugucauccc ucuggacau
1918219RNAArtificial SequenceSynthetic siNA antisense region
182uccaaagagc caucgcugc 1918319RNAArtificial SequenceSynthetic siNA
antisense region 183gcgugauaau cgucaucuu 1918419RNAArtificial
SequenceSynthetic siNA antisense region 184augauuguuu ccguuguag
1918519RNAArtificial SequenceSynthetic siNA antisense region
185gacucuguag gcaugguaa 1918619RNAArtificial SequenceSynthetic siNA
antisense region 186acuugcauua gaaaaucag 1918719RNAArtificial
SequenceSynthetic siNA antisense region 187cauuuggguu uuccaucca
1918819RNAArtificial SequenceSynthetic siNA antisense region
188cuaaauuuaa agaagcaac 1918919RNAArtificial SequenceSynthetic siNA
antisense region 189uuguauugua uuuuagagc 1919019RNAArtificial
SequenceSynthetic siNA antisense region 190ugggccuuua cuacuuuau
1919119RNAArtificial SequenceSynthetic siNA antisense region
191cucaaauaua uccauaguu 1919219RNAArtificial SequenceSynthetic siNA
antisense region 192guaggagucu cgacggguc 1919319RNAArtificial
SequenceSynthetic siNA antisense region 193auuugcacaa acacuguug
1919419RNAArtificial SequenceSynthetic siNA antisense region
194gguuugauga gucucagga 1919519RNAArtificial SequenceSynthetic siNA
antisense region 195cuuguaccgu cuuucauag 1919619RNAArtificial
SequenceSynthetic siNA antisense region 196gaucggauuc caguauacc
1919719RNAArtificial SequenceSynthetic siNA antisense region
197uucaugucaa guuucagag 1919819RNAArtificial SequenceSynthetic siNA
antisense region 198caaauaccag ugccugggu 1919919RNAArtificial
SequenceSynthetic siNA antisense region 199uucacaucaa ugcucugcc
1920019RNAArtificial SequenceSynthetic siNA antisense region
200caauuuugca acacugucu 1920119RNAArtificial SequenceSynthetic siNA
antisense region 201gauucagguu guuugagcc 1920219RNAArtificial
SequenceSynthetic siNA antisense region 202auuucaaugc cuaaguugg
1920319RNAArtificial SequenceSynthetic siNA antisense region
203uucucaucua aagcuuuua 1920419RNAArtificial SequenceSynthetic siNA
antisense region 204acagcaagau caugaccau 1920519RNAArtificial
SequenceSynthetic siNA antisense region 205ccugguccug ggaagguua
1920619RNAArtificial SequenceSynthetic siNA antisense region
206ggauucagcc caucuucuc 1920719RNAArtificial SequenceSynthetic siNA
antisense region 207accuugaccu cuaaaaacg 1920819RNAArtificial
SequenceSynthetic siNA antisense region 208cuuuuuggug ugucuguua
1920919RNAArtificial SequenceSynthetic siNA antisense region
209ccaaaauccc uucuggauc 1921019RNAArtificial SequenceSynthetic siNA
antisense region 210ugcucaucac agucaagac 1921119RNAArtificial
SequenceSynthetic siNA antisense region 211caucgugauu cuguugagu
1921219RNAArtificial SequenceSynthetic siNA antisense region
212guuagagggu aacgacagc 1921319RNAArtificial SequenceSynthetic siNA
antisense region 213aaagcuucaa aauccacag 1921419RNAArtificial
SequenceSynthetic siNA antisense region 214auaauccaau cccauccaa
1921519RNAArtificial SequenceSynthetic siNA antisense region
215uuauaucuuu uaggagcga 1921619RNAArtificial SequenceSynthetic siNA
antisense region 216ccagagcagu aauuggccu 1921719RNAArtificial
SequenceSynthetic siNA antisense region 217aauacaaauu cacacucuc
1921819RNAArtificial SequenceSynthetic siNA antisense region
218ugaggauauu uuuguaaaa 1921919RNAArtificial SequenceSynthetic siNA
antisense region 219ugguguacca gaugaguau 1922019RNAArtificial
SequenceSynthetic siNA antisense region 220gaaccucugg gguuugcuu
1922119RNAArtificial SequenceSynthetic siNA antisense region
221guacagcaag ggccugcug 1922219RNAArtificial SequenceSynthetic siNA
antisense region 222ggagacaucu uugugggag 1922319RNAArtificial
SequenceSynthetic siNA antisense region 223aaauauagca uauuaauug
1922419RNAArtificial SequenceSynthetic siNA antisense region
224auuuguucuu ugccauuaa 1922519RNAArtificial SequenceSynthetic siNA
antisense region 225ggaauuuucc cauauauua 1922619RNAArtificial
SequenceSynthetic siNA antisense region 226cggucuacua ccaucgcug
1922719RNAArtificial SequenceSynthetic siNA antisense region
227ucucaugagc acccacagc 1922819RNAArtificial SequenceSynthetic siNA
antisense region 228augaacgcuu aauauaaau 1922919RNAArtificial
SequenceSynthetic siNA antisense region 229uccauguuuu aggaaguua
1923019RNAArtificial SequenceSynthetic siNA antisense region
230uuguugaggg gaaaaccuu 1923119RNAArtificial SequenceSynthetic siNA
antisense region 231aauuucacag cuucaaaau 1923219RNAArtificial
SequenceSynthetic siNA antisense region 232cuauagccug ugguacuua
1923319RNAArtificial SequenceSynthetic siNA antisense region
233cuguagcaua cucuaggcc 1923419RNAArtificial SequenceSynthetic siNA
antisense region 234uagcuuaugc uuaagugac 1923519RNAArtificial
SequenceSynthetic siNA antisense region 235cuuuuaguuu acauacugu
1923619RNAArtificial SequenceSynthetic siNA antisense region
236ccauugcaua uauuccccc 1923719RNAArtificial SequenceSynthetic siNA
antisense region 237uggaugguua aaugccaac 1923819RNAArtificial
SequenceSynthetic siNA antisense region 238uuucuuguau gauuuguuu
1923919RNAArtificial SequenceSynthetic siNA antisense region
239cucuggaaau cauaaaacu 1924019RNAArtificial SequenceSynthetic siNA
antisense region 240cuccuucuag cucaaaaac 1924119RNAArtificial
SequenceSynthetic siNA antisense region 241acauaaaugu aauuugauc
1924219RNAArtificial SequenceSynthetic siNA antisense region
242auguuguaau auauaggaa 1924319RNAArtificial SequenceSynthetic siNA
antisense region 243gcuuucauuu ccucgccga 1924419RNAArtificial
SequenceSynthetic siNA antisense region 244cagaacucaa ggagaaucg
1924519RNAArtificial SequenceSynthetic siNA antisense region
245cauacuccuu uaauucauc 1924619RNAArtificial SequenceSynthetic siNA
antisense region 246aagaaauaga cuuuaaagc 1924719RNAArtificial
SequenceSynthetic siNA antisense region 247auauuaaaca aaacuuuaa
1924819RNAArtificial SequenceSynthetic siNA antisense region
248auguggauuu uucuguaaa 1924919RNAArtificial SequenceSynthetic siNA
antisense region 249gcauuuuacc aauacugua 1925019RNAArtificial
SequenceSynthetic siNA antisense region 250augguauaua acaauccug
1925119RNAArtificial SequenceSynthetic siNA antisense region
251uuaaggauga uucgaauga
1925219RNAArtificial SequenceSynthetic siNA antisense region
252caauauaaau ucaaguguu 1925319RNAArtificial SequenceSynthetic siNA
antisense region 253accaaguaua cuaccauac 1925419RNAArtificial
SequenceSynthetic siNA antisense region 254uuuguggaau uuuaucuua
1925519RNAArtificial SequenceSynthetic siNA antisense region
255ugcugcacca ucccuauuu 1925619RNAArtificial SequenceSynthetic siNA
antisense region 256aggaauggaa auugcauau 1925719RNAArtificial
SequenceSynthetic siNA antisense region 257uacuguguca auuauaaua
1925819RNAArtificial SequenceSynthetic siNA antisense region
258uggcauggau uguuaaugu 1925919RNAArtificial SequenceSynthetic siNA
antisense region 259cuaucguauu agcaccguu 1926019RNAArtificial
SequenceSynthetic siNA antisense region 260uagccucaga cauucagcc
1926119RNAArtificial SequenceSynthetic siNA antisense region
261uuuaugugau aaaccuggu 1926219RNAArtificial SequenceSynthetic siNA
antisense region 262cuauuuuacu gaauguuuu 1926319RNAArtificial
SequenceSynthetic siNA antisense region 263gaagaaaaga gaaacuuac
1926419RNAArtificial SequenceSynthetic siNA antisense region
264guguaggaaa augccccug 1926519RNAArtificial SequenceSynthetic siNA
antisense region 265uccauuccuc auuuggagg 1926619RNAArtificial
SequenceSynthetic siNA antisense region 266uucuuacauu aaagaaaau
1926719RNAArtificial SequenceSynthetic siNA antisense region
267ccucuagaaa aaugauucu 1926819RNAArtificial SequenceSynthetic siNA
antisense region 268uacagaauug aaagccaac 1926919RNAArtificial
SequenceSynthetic siNA antisense region 269caguuucucc aaguaugcu
1927019RNAArtificial SequenceSynthetic siNA antisense region
270cugccuuuua agauaaugc 1927119RNAArtificial SequenceSynthetic siNA
antisense region 271aaaacaaaca ccauuugac 1927219RNAArtificial
SequenceSynthetic siNA antisense region 272uauuuugaca uuuugauaa
1927319RNAArtificial SequenceSynthetic siNA antisense region
273auacuucucc aaguauguu 1927419RNAArtificial SequenceSynthetic siNA
antisense region 274uuccaaagac aaaauuaca 1927519RNAArtificial
SequenceSynthetic siNA antisense region 275aaaggcagug uuguaauuu
1927619RNAArtificial SequenceSynthetic siNA antisense region
276uaaaaacugc aguguugca 1927719RNAArtificial SequenceSynthetic siNA
antisense region 277auuucuauua uuuuaccau 1927819RNAArtificial
SequenceSynthetic siNA antisense region 278auauugauag agucgauca
1927919RNAArtificial SequenceSynthetic siNA antisense region
279uuucagucuu uuuauacaa 1928019RNAArtificial SequenceSynthetic siNA
antisense region 280uauuauauaa augcauugu 1928119RNAArtificial
SequenceSynthetic siNA antisense region 281aaaacaauau uguauacau
1928219RNAArtificial SequenceSynthetic siNA antisense region
282aaggagacac uuauuuaca 1928319RNAArtificial SequenceSynthetic siNA
antisense region 283auaccaaagu aaauaaaaa 1928419RNAArtificial
SequenceSynthetic siNA antisense region 284uguccuuagu guaaaaaua
1928519RNAArtificial SequenceSynthetic siNA antisense region
285uuaguacuua auuugaaau 1928619RNAArtificial SequenceSynthetic siNA
antisense region 286augacauguc uuugugccu 1928719RNAArtificial
SequenceSynthetic siNA antisense region 287guugcuuuuc ugugaugca
1928819RNAArtificial SequenceSynthetic siNA antisense region
288ugcucugaaa uauaaguag 1928919RNAArtificial SequenceSynthetic siNA
antisense region 289cuauuuaauc ugcuaauuu 1929019RNAArtificial
SequenceSynthetic siNA antisense region 290uauggaguuu uaagaccac
1929119RNAArtificial SequenceSynthetic siNA antisense region
291accaucuaau cauuaacau 1929219RNAArtificial SequenceSynthetic siNA
antisense region 292uaaaaugauu guaauauaa 1929319RNAArtificial
SequenceSynthetic siNA antisense region 293uaaucaugua aaaaaauau
1929419RNAArtificial SequenceSynthetic siNA antisense region
294gaauccauaa gugaauguu 1929519RNAArtificial SequenceSynthetic siNA
antisense region 295acuuuauaca gccaucaug 1929619RNAArtificial
SequenceSynthetic siNA antisense region 296cauugaaauu ucaaauuca
1929719RNAArtificial SequenceSynthetic siNA antisense region
297aacacaauga caguaaacc 1929819RNAArtificial SequenceSynthetic siNA
antisense region 298auggaacguu gagauuuaa 1929919RNAArtificial
SequenceSynthetic siNA antisense region 299uuugcaagua uuaaaauaa
1930019RNAArtificial SequenceSynthetic siNA antisense region
300gguauacuua guaauguuu 1930119RNAArtificial SequenceSynthetic siNA
antisense region 301aauagaguca auuauuuug 1930219RNAArtificial
SequenceSynthetic siNA antisense region 302uuauucuuca uuucagaua
1930319RNAArtificial SequenceSynthetic siNA antisense region
303uguugagaua gcaucaguu 1930419RNAArtificial SequenceSynthetic siNA
antisense region 304aauaaaagua acaguuauu 1930519RNAArtificial
SequenceSynthetic siNA antisense region 305uucauuauca aauuauaaa
1930619RNAArtificial SequenceSynthetic siNA antisense region
306aauaaaugca gaaauauau 1930719RNAArtificial SequenceSynthetic siNA
antisense region 307auuuacaaaa cagaaguaa 1930819RNAArtificial
SequenceSynthetic siNA antisense region 308uugauuaaca aaaucccaa
1930919RNAArtificial SequenceSynthetic siNA antisense region
309agucauagua caauaaauu 1931019RNAArtificial SequenceSynthetic siNA
antisense region 310uaagaaauaa uuucauuua 1931119RNAArtificial
SequenceSynthetic siNA antisense region 311guuucuacaa auuagaugu
1931219RNAArtificial SequenceSynthetic siNA antisense region
312uuuaauauaa cuuauacug 1931319RNAArtificial SequenceSynthetic siNA
antisense region 313aaaaaaaugu gaaaacacu 1931419RNAArtificial
SequenceSynthetic siNA antisense region 314uuugucuuuc aaaaaaaug
1931523RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 315acuggugugg caaguugucu cuc 2331623RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 316aacuucgucu
ggaaacagcu ccu 2331723RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 317uggaaacagc uccuaacauc agc
2331823RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 318aaguggaugg aaaacccaaa ugu 2331923RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 319agaugggcug
aauccguuuu uag 2332023RNAArtificial SequenceSynthetic Target
Sequence/siNA sense region 320uaugcaaugg uuggcauuua acc
2332123RNAArtificial SequenceSynthetic Target Sequence/siNA sense
region 321guuggcauuu aaccauccaa aca 2332223RNAArtificial
SequenceSynthetic Target Sequence/siNA sense region 322acaccuccaa
augaggaaug gau 2332321DNAArtificial SequenceSynthetic siNA sense
region 323ugguguggca aguugucucn n 2132421DNAArtificial
SequenceSynthetic siNA sense region 324cuucgucugg aaacagcucn n
2132521DNAArtificial SequenceSynthetic siNA sense region
325gaaacagcuc cuaacaucan n 2132621DNAArtificial SequenceSynthetic
siNA sense region 326guggauggaa aacccaaaun n 2132721DNAArtificial
SequenceSynthetic siNA sense region 327augggcugaa uccguuuuun n
2132821DNAArtificial SequenceSynthetic siNA sense region
328ugcaaugguu ggcauuuaan n 2132921DNAArtificial SequenceSynthetic
siNA sense region 329uggcauuuaa ccauccaaan n 2133021DNAArtificial
SequenceSynthetic siNA sense region 330accuccaaau gaggaauggn n
2133121DNAArtificial SequenceSynthetic siNA antisense region
331gagacaacuu gccacaccan n 2133221DNAArtificial SequenceSynthetic
siNA antisense region 332gagcuguuuc cagacgaagn n
2133321DNAArtificial SequenceSynthetic siNA antisense region
333ugauguuagg agcuguuucn n 2133421DNAArtificial SequenceSynthetic
siNA antisense region 334auuuggguuu uccauccacn n
2133521DNAArtificial SequenceSynthetic siNA antisense region
335aaaaacggau ucagcccaun n 2133621DNAArtificial SequenceSynthetic
siNA antisense region 336uuaaaugcca accauugcan n
2133721DNAArtificial SequenceSynthetic siNA antisense region
337uuuggauggu uaaaugccan n 2133821DNAArtificial SequenceSynthetic
siNA antisense region 338ccauuccuca uuuggaggun n
2133921DNAArtificial SequenceSynthetic siNA sense region
339ugguguggca aguugucuct t 2134021RNAArtificial SequenceSynthetic
siNA sense region 340cuucgucugg aaacagcucn n 2134121RNAArtificial
SequenceSynthetic siNA sense region 341gaaacagcuc cuaacaucan n
2134221RNAArtificial SequenceSynthetic siNA sense region
342guggauggaa aacccaaaun n 2134321RNAArtificial SequenceSynthetic
siNA sense region 343augggcugaa uccguuuuun n 2134421RNAArtificial
SequenceSynthetic siNA sense region 344ugcaaugguu ggcauuuaan n
2134521RNAArtificial SequenceSynthetic siNA sense region
345uggcauuuaa ccauccaaan n 2134621RNAArtificial SequenceSynthetic
siNA sense region 346accuccaaau gaggaauggn n 2134721RNAArtificial
SequenceSynthetic siNA antisense region 347gagacaacuu gccacaccan n
2134821RNAArtificial SequenceSynthetic siNA antisense region
348gagcuguuuc cagacgaagn n 2134921RNAArtificial SequenceSynthetic
siNA antisense region 349ugauguuagg agcuguuucn n
2135021RNAArtificial SequenceSynthetic siNA antisense region
350auuuggguuu uccauccacn n 2135121RNAArtificial SequenceSynthetic
siNA antisense region 351aaaaacggau ucagcccaun n
2135221RNAArtificial SequenceSynthetic siNA antisense region
352uuaaaugcca accauugcan n 2135321RNAArtificial SequenceSynthetic
siNA antisense region 353uuuggauggu uaaaugccan n
2135421RNAArtificial SequenceSynthetic siNA antisense region
354ccauuccuca uuuggaggun n 2135521RNAArtificial SequenceSynthetic
siNA sense region 355ugguguggca aguugucucn n 2135621RNAArtificial
SequenceSynthetic siNA sense region 356cuucgucugg aaacagcucn n
2135721RNAArtificial SequenceSynthetic siNA sense region
357gaaacagcuc cuaacaucan n 2135821RNAArtificial SequenceSynthetic
siNA sense region 358guggauggaa aacccaaaun n 2135921RNAArtificial
SequenceSynthetic siNA sense region 359augggcugaa uccguuuuun n
2136021RNAArtificial SequenceSynthetic siNA sense region
360ugcaaugguu ggcauuuaan n 2136121RNAArtificial SequenceSynthetic
siNA sense region 361uggcauuuaa ccauccaaan n 2136221RNAArtificial
SequenceSynthetic siNA sense region 362accuccaaau gaggaauggn n
2136321RNAArtificial SequenceSynthetic siNA antisense region
363gagacaacuu gccacaccan n 2136421RNAArtificial SequenceSynthetic
siNA antisense region 364gagcuguuuc cagacgaagn n
2136521RNAArtificial SequenceSynthetic siNA antisense region
365ugauguuagg agcuguuucn n 2136621RNAArtificial SequenceSynthetic
siNA antisense region 366auuuggguuu uccauccacn n
2136721RNAArtificial SequenceSynthetic siNA antisense region
367aaaaacggau ucagcccaun n 2136821RNAArtificial SequenceSynthetic
siNA antisense region 368uuaaaugcca accauugcan n
2136921RNAArtificial SequenceSynthetic siNA antisense region
369uuuggauggu uaaaugccan n 2137021RNAArtificial SequenceSynthetic
siNA antisense region 370ccauuccuca uuuggaggun n
2137121RNAArtificial SequenceSynthetic siNA sense region
371ugguguggca aguugucucn n 2137221RNAArtificial SequenceSynthetic
siNA sense region 372cuucgucugg aaacagcucn n 2137321RNAArtificial
SequenceSynthetic siNA sense region 373gaaacagcuc cuaacaucan n
2137421RNAArtificial SequenceSynthetic siNA sense region
374guggauggaa aacccaaaun n 2137521RNAArtificial SequenceSynthetic
siNA sense region 375augggcugaa uccguuuuun n 2137621RNAArtificial
SequenceSynthetic siNA sense region 376ugcaaugguu ggcauuuaan n
2137721RNAArtificial SequenceSynthetic siNA sense region
377uggcauuuaa
ccauccaaan n 2137821RNAArtificial SequenceSynthetic siNA sense
region 378accuccaaau gaggaauggn n 2137921RNAArtificial
SequenceSynthetic siNA antisense region 379gagacaacuu gccacaccan n
2138021RNAArtificial SequenceSynthetic siNA antisense region
380gagcuguuuc cagacgaagn n 2138121RNAArtificial SequenceSynthetic
siNA antisense region 381ugauguuagg agcuguuucn n
2138221RNAArtificial SequenceSynthetic siNA antisense region
382auuuggguuu uccauccacn n 2138321RNAArtificial SequenceSynthetic
siNA antisense region 383aaaaacggau ucagcccaun n
2138421RNAArtificial SequenceSynthetic siNA antisense region
384uuaaaugcca accauugcan n 2138521RNAArtificial SequenceSynthetic
siNA anitsense region 385uuuggauggu uaaaugccan n
2138621RNAArtificial SequenceSynthetic siNA antisense region
386ccauuccuca uuuggaggun n 2138721RNAArtificial SequenceSynthetic
siNA sense region 387ugguguggca aguugucucn n 2138821RNAArtificial
SequenceSynthetic siNA sense region 388cuucgucugg aaacagcucn n
2138921RNAArtificial SequenceSynthetic siNA sense region
389gaaacagcuc cuaacaucan n 2139021RNAArtificial SequenceSynthetic
siNA sense region 390guggauggaa aacccaaaun n 2139121RNAArtificial
SequenceSynthetic siNA sense region 391augggcugaa uccguuuuun n
2139221RNAArtificial SequenceSynthetic siNA sense region
392ugcaaugguu ggcauuuaan n 2139321RNAArtificial SequenceSynthetic
siNA sense region 393uggcauuuaa ccauccaaan n 2139421RNAArtificial
SequenceSynthetic siNA sense region 394accuccaaau gaggaauggn n
2139521RNAArtificial SequenceSynthetic siNA antisense region
395gagacaacuu gccacaccan n 2139621RNAArtificial SequenceSynthetic
siNA antisense region 396gagcuguuuc cagacgaagn n
2139721RNAArtificial SequenceSynthetic siNA antisense region
397ugauguuagg agcuguuucn n 2139821RNAArtificial SequenceSynthetic
siNA antisense region 398auuuggguuu uccauccacn n
2139921RNAArtificial SequenceSynthetic siNA antisense region
399aaaaacggau ucagcccaun n 2140021RNAArtificial SequenceSynthetic
siNA antisense region 400uuaaaugcca accauugcan n
2140121RNAArtificial SequenceSynthetic siNA antisense region
401uuuggauggu uaaaugccan n 2140221RNAArtificial SequenceSynthetic
siNA antisense region 402ccauuccuca uuuggaggun n
2140321RNAArtificial SequenceSynthetic siNA antisense region
403gagacaacuu gccacaccan n 2140421RNAArtificial SequenceSynthetic
siNA antisense region 404gagcuguuuc cagacgaagn n
2140521RNAArtificial SequenceSynthetic siNA antisense region
405ugauguuagg agcuguuucn n 2140621RNAArtificial SequenceSynthetic
siNA antisense region 406auuuggguuu uccauccacn n
2140721RNAArtificial SequenceSynthetic siNA antisense region
407aaaaacggau ucagcccaun n 2140821RNAArtificial SequenceSynthetic
siNA antisense region 408uuaaaugcca accauugcan n
2140921RNAArtificial SequenceSynthetic siNA antisense region
409uuuggauggu uaaaugccan n 2141021RNAArtificial SequenceSynthetic
siNA antisense region 410ccauuccuca uuuggaggun n
2141121RNAArtificial SequenceSynthetic siNA antisense region
411gagacaacuu gccacaccan n 2141221RNAArtificial SequenceSynthetic
siNA antisense region 412gagcuguuuc cagacgaagn n
2141321RNAArtificial SequenceSynthetic siNA antisense region
413ugauguuagg agcuguuucn n 2141421RNAArtificial SequenceSynthetic
siNA antisense region 414auuuggguuu uccauccacn n
2141521RNAArtificial SequenceSynthetic siNA antisense region
415aaaaacggau ucagcccaun n 2141621RNAArtificial SequenceSynthetic
siNA antisense region 416uuaaaugcca accauugcan n
2141721RNAArtificial SequenceSynthetic siNA antisense region
417uuuggauggu uaaaugccan n 2141821RNAArtificial SequenceSynthetic
siNA antisense region 418ccauuccuca uuuggaggun n
2141921DNAArtificial SequenceSynthetic siNA sense region
419nnnnnnnnnn nnnnnnnnnn n 2142021DNAArtificial SequenceSynthetic
siNA antisense region 420nnnnnnnnnn nnnnnnnnnn n
2142121RNAArtificial SequenceSynthetic siNA sense region
421nnnnnnnnnn nnnnnnnnnn n 2142221RNAArtificial SequenceSynthetic
siNA antisense region 422nnnnnnnnnn nnnnnnnnnn n
2142321RNAArtificial SequenceSynthetic siNA sense region
423nnnnnnnnnn nnnnnnnnnn n 2142421RNAArtificial SequenceSynthetic
siNA antisense region 424nnnnnnnnnn nnnnnnnnnn n
2142521RNAArtificial SequenceSynthetic siNA sense region
425nnnnnnnnnn nnnnnnnnnn n 2142621RNAArtificial SequenceSynthetic
siNA sense region 426nnnnnnnnnn nnnnnnnnnn n 2142721RNAArtificial
SequenceSynthetic siNA antisense region 427nnnnnnnnnn nnnnnnnnnn n
2142821RNAArtificial SequenceSynthetic siNA sense region
428aacauacuug gagaaguaun n 2142921RNAArtificial SequenceSynthetic
siNA antisense region 429auacuucucc aaguauguun n
2143021RNAArtificial SequenceSynthetic siNA sense region
430aacauacuug gagaaguaun n 2143121RNAArtificial SequenceSynthetic
siNA antisense region 431auacuucucc aaguauguun n
2143221RNAArtificial SequenceSynthetic siNA sense region
432aacauacuug gagaaguaun n 2143321RNAArtificial SequenceSynthetic
siNA antisense region 433auacuucucc aaguauguun n
2143421RNAArtificial SequenceSynthetic siNA sense region
434aacauacuug gagaaguaun n 2143521RNAArtificial SequenceSynthetic
siNA sense region 435aacauacuug gagaaguaun n 2143621RNAArtificial
SequenceSynthetic siNA antisense region 436auacuucucc aaguauguun n
2143714RNAArtificial SequenceSynthetic Target Sequence
437auauaucuau uucg 1443814RNAArtificial SequenceSynthetic
Complement to Target Sequence 438cgaaauagua uaua
1443922RNAArtificial SequenceSynthetic appended target/complement
439cgaaauagua uauacuauuu cg 2244024DNAArtificial SequenceSynthetic
Duplex forming oligonucleotide 440cgaaauagua uauacuauuu cgnn
244412823RNAHomo sapiens 441agauucacug guguggcaag uugucucuca
gacuguacau gcauuaaaau uuugcuuggc 60auuacucaaa agcaaaagaa aaguaaaagg
aagaaacaag aacaagaaaa aagauuauau 120ugauuuuaaa aucaugcaaa
aacugcaacu cuguguuuau auuuaccugu uuaugcugau 180uguugcuggu
ccaguggauc uaaaugagaa cagugagcaa aaagaaaaug uggaaaaaga
240ggggcugugu aaugcaugua cuuggagaca aaacacuaaa ucuucaagaa
uagaagccau 300uaagauacaa auccucagua aacuucgucu ggaaacagcu
ccuaacauca gcaaagaugu 360uauaagacaa cuuuuaccca aagcuccucc
acuccgggaa cugauugauc aguaugaugu 420ccagagggau gacagcagcg
auggcucuuu ggaagaugac gauuaucacg cuacaacgga 480aacaaucauu
accaugccua cagagucuga uuuucuaaug caaguggaug gaaaacccaa
540auguugcuuc uuuaaauuua gcucuaaaau acaauacaau aaaguaguaa
aggcccaacu 600auggauauau uugagacccg ucgagacucc uacaacagug
uuugugcaaa uccugagacu 660caucaaaccu augaaagacg guacaaggua
uacuggaauc cgaucucuga aacuugacau 720gaacccaggc acugguauuu
ggcagagcau ugaugugaag acaguguugc aaaauuggcu 780caaacaaccu
gaauccaacu uaggcauuga aauaaaagcu uuagaugaga auggucauga
840ucuugcugua accuucccag gaccaggaga agaugggcug aauccguuuu
uagaggucaa 900gguaacagac acaccaaaaa gauccagaag ggauuuuggu
cuugacugug augagcacuc 960aacagaauca cgaugcuguc guuacccucu
aacuguggau uuugaagcuu uuggauggga 1020uuggauuauc gcuccuaaaa
gauauaaggc caauuacugc ucuggagagu gugaauuugu 1080auuuuuacaa
aaauauccuc auacucaucu gguacaccaa gcaaacccca gagguucagc
1140aggcccuugc uguacuccca caaagauguc uccaauuaau augcuauauu
uuaauggcaa 1200agaacaaaua auauauggga aaauuccagc gaugguagua
gaccgcugug ggugcucaug 1260agauuuauau uaagcguuca uaacuuccua
aaacauggaa gguuuucccc ucaacaauuu 1320ugaagcugug aaauuaagua
ccacaggcua uaggccuaga guaugcuaca gucacuuaag 1380cauaagcuac
aguauguaaa cuaaaagggg gaauauaugc aaugguuggc auuuaaccau
1440ccaaacaaau cauacaagaa aguuuuauga uuuccagagu uuuugagcua
gaaggagauc 1500aaauuacauu uauguuccua uauauuacaa caucggcgag
gaaaugaaag cgauucuccu 1560ugaguucuga ugaauuaaag gaguaugcuu
uaaagucuau uucuuuaaag uuuuguuuaa 1620uauuuacaga aaaauccaca
uacaguauug guaaaaugca ggauuguuau auaccaucau 1680ucgaaucauc
cuuaaacacu ugaauuuaua uuguauggua guauacuugg uaagauaaaa
1740uuccacaaaa auagggaugg ugcagcauau gcaauuucca uuccuauuau
aauugacaca 1800guacauuaac aauccaugcc aacggugcua auacgauagg
cugaaugucu gaggcuacca 1860gguuuaucac auaaaaaaca uucaguaaaa
uaguaaguuu cucuuuucuu caggggcauu 1920uuccuacacc uccaaaugag
gaauggauuu ucuuuaaugu aagaagaauc auuuuucuag 1980agguuggcuu
ucaauucugu agcauacuug gagaaacugc auuaucuuaa aaggcaguca
2040aaugguguuu guuuuuauca aaaugucaaa auaacauacu uggagaagua
uguaauuuug 2100ucuuuggaaa auuacaacac ugccuuugca acacugcagu
uuuuauggua aaauaauaga 2160aaugaucgac ucuaucaaua uuguauaaaa
agacugaaac aaugcauuua uauaauaugu 2220auacaauauu guuuuguaaa
uaagugucuc cuuuuuuauu uacuuuggua uauuuuuaca 2280cuaaggacau
uucaaauuaa guacuaaggc acaaagacau gucaugcauc acagaaaagc
2340aacuacuuau auuucagagc aaauuagcag auuaaauagu ggucuuaaaa
cuccauaugu 2400uaaugauuag augguuauau uacaaucauu uuauauuuuu
uuacaugauu aacauucacu 2460uauggauuca ugauggcugu auaaagugaa
uuugaaauuu caaugguuua cugucauugu 2520guuuaaaucu caacguucca
uuauuuuaau acuugcaaaa acauuacuaa guauaccaaa 2580auaauugacu
cuauuaucug aaaugaagaa uaaacugaug cuaucucaac aauaacuguu
2640acuuuuauuu uauaauuuga uaaugaauau auuucugcau uuauuuacuu
cuguuuugua 2700aauugggauu uuguuaauca aauuuauugu acuaugacua
aaugaaauua uuucuuacau 2760cuaauuugua gaaacaguau aaguuauauu
aaaguguuuu cacauuuuuu ugaaagacaa 2820aaa 2823
* * * * *