U.S. patent application number 11/805883 was filed with the patent office on 2008-12-04 for gastrointestinal proliferative factor and uses thereof.
This patent application is currently assigned to Nuvelo, Inc.. Invention is credited to Bryan J. Boyle, Walter Funk, Makoto Kakitani, Takeshi Oshima, Eun Ju Park, Y. Tom Tang, Kazuma Tomizuka, Mikio Yagi.
Application Number | 20080300183 11/805883 |
Document ID | / |
Family ID | 34830487 |
Filed Date | 2008-12-04 |
United States Patent
Application |
20080300183 |
Kind Code |
A1 |
Boyle; Bryan J. ; et
al. |
December 4, 2008 |
Gastrointestinal proliferative factor and uses thereof
Abstract
The invention relates to pharmaceutical compositions comprising
gastrointestinal proliferative factor (GIPF) polynucleotides and
polypeptides. The invention further relates to the therapeutic use
of GIPF to prevent or treat conditions or disorders associated with
the degeneration of the epithelial mucosa.
Inventors: |
Boyle; Bryan J.; (Santa
Clara, CA) ; Funk; Walter; (Hayward, CA) ;
Kakitani; Makoto; (Takasaki, JP) ; Oshima;
Takeshi; (Maebashi, JP) ; Park; Eun Ju; (Los
Altos, CA) ; Tang; Y. Tom; (San Jose, CA) ;
Yagi; Mikio; (Saitama, JP) ; Tomizuka; Kazuma;
(Takasaki, JP) |
Correspondence
Address: |
ROBINS & PASTERNAK
1731 EMBARCADERO ROAD, SUITE 230
PALO ALTO
CA
94303
US
|
Assignee: |
Nuvelo, Inc.
Kirin Pharma Kabushiki Kaisha
|
Family ID: |
34830487 |
Appl. No.: |
11/805883 |
Filed: |
May 24, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11046644 |
Jan 27, 2005 |
|
|
|
11805883 |
|
|
|
|
60539605 |
Jan 27, 2004 |
|
|
|
60619241 |
Oct 15, 2004 |
|
|
|
Current U.S.
Class: |
514/8.9 |
Current CPC
Class: |
G01N 33/5088 20130101;
C12N 2799/022 20130101; C12N 2800/30 20130101; A61P 43/00 20180101;
A01K 67/0275 20130101; A01K 2267/01 20130101; A61K 38/1709
20130101; A01K 2217/072 20130101; A61P 29/00 20180101; A61P 1/00
20180101; A61K 48/005 20130101; C07K 14/475 20130101; A01K 2227/105
20130101; C12N 15/8509 20130101 |
Class at
Publication: |
514/12 |
International
Class: |
A61K 38/16 20060101
A61K038/16; A61P 1/00 20060101 A61P001/00 |
Claims
1. A method of stimulating epithelial cell proliferation in a
mammalian subject in need thereof comprising administering to the
subject a therapeutically effective amount of a composition
comprising a polypeptide with epithelial cell proliferation
stimulating activity, wherein said polypeptide comprises (i) an
amino acid sequence with at least 90% sequence identity to the
amino acid sequence of SEQ ID NO:4, or (ii) a fragment thereof.
2. The method of claim 1, wherein the polypeptide comprises an
amino acid sequence with at least 90% sequence identity to SEQ ID
NO:10.
3. The method of claim 2, wherein the polypeptide consists of the
amino acid sequence of SEQ ID NO:10.
4. The method of claim 1, wherein the method comprises stimulating
epithelial cell proliferation in the oral or gastrointestinal
tract.
5. The method of claim 4, wherein the method comprises stimulating
epithelial cell proliferation in the esophagus.
6. The method of claim 4, wherein the method comprises stimulating
epithelial cell proliferation in the small intestine.
7. The method of claim 4, wherein the method comprises stimulating
epithelial cell proliferation in the large intestine.
8. The method of claim 4, wherein the method comprises stimulating
epithelial cell proliferation in the stomach.
9. The method of claim 4, wherein the method comprises stimulating
epithelial cell proliferation in the oral cavity.
10. The method of claim 4, wherein the subject has undergone or
will undergo radiation therapy or chemotherapy.
11. The method of claim 1, wherein the mammalian subject is a
human.
12. A method of treating a gastrointestinal disorder or oral
mucosal disorder in a mammalian subject in need thereof comprising
administering to the subject a therapeutically effective amount of
a composition comprising a polypeptide with epithelial cell
proliferation stimulating activity, wherein said polypeptide
comprises (i) an amino acid sequence with at least 90% sequence
identity to the amino acid sequence of SEQ ID NO:4, or (ii) a
fragment thereof.
13. The method of claim 12, wherein the polypeptide comprises an
amino acid sequence with at least 90% sequence identity to SEQ ID
NO:10.
14. The method of claim 13, wherein the polypeptide consists of the
amino acid sequence of SEQ ID NO:10.
15. The method of claim 12, wherein the disorder is mucositis,
inflammatory bowel disease, or short bowel syndrome.
Description
RELATED APPLICATIONS
[0001] This application is a divisional application of U.S. patent
application Ser. No. 11/046,644, filed Jan. 27, 2005 from which
priority is claimed pursuant to 35 U.S.C. .sctn.120, and claims
benefit under 35 U.S.C. .sctn.119(e) of U.S. Provisional
Application No. 60/539,605, filed Jan. 27, 2004 and U.S.
Provisional Application No. 60/619,241, filed Oct. 15, 2004, which
applications are hereby incorporated by reference in their
entireties.
1. BACKGROUND
[0002] 1.1 Field of the Invention
[0003] The present invention relates generally to compositions that
comprise gastrointestinal proliferation factor polypeptides and
polynucleotides, and methods for using the same.
[0004] 1.2 Sequence Listing
[0005] A sequence listing is provided.
[0006] 1.3 Background
[0007] Ionizing radiation therapy and cytotoxic chemotherapy
produce injuries to the oral and gastrointestinal mucosa, which
remain significant problems for patients undergoing antineoplastic
treatments. Mucositis is the inflammation of the mucous membranes
and is a particularly common problem in this patient population due
to the use of chemotherapy and radiation therapy used with curative
or palliative intent. The mucosal injuries to the gastrointestinal
tract seen with radiation and chemotherapy (to these areas) include
the destruction of crypt cells, a decrease in villous height and
ulceration and necrosis of the gastrointestinal epithelium
(Berthrong M, World J Surg 10:155-170 (1986)), which underlie
disorders including gastrointestinal mucositis and enterocolitis.
To the patients this can mean abdominal pain, bloody diarrhea,
malabsorption and in some cases bacterial translocation (Guzman et
al., J Surg Res 46:104-107 (1989)). In addition, chemotherapy and
ionizing radiation can affect other mucous membranes including
those of the oropharynx and lips, and those of the esophagus. It is
well known that combined modality therapy of concurrent radiation
and chemotherapy can produce highly symptomatic stomatitis in
patients with head and neck cancer, and esophagitis in patients
with small cell lung cancer.
Chemotherapy and radiation therapy cause injury to the oral and
gastrointestinal mucosa through direct and indirect toxicity. The
mechanism for direct mucositis is nonspecific cell killing of
rapidly dividing basal epithelial cells that results in epithelial
thinning, inflammation, decreased cell renewal, and ultimately
ulceration. These painful lesions also produce an increased risk
for local and systemic infection. Indirect mucotoxicity is a
byproduct of chemotherapy-induced myelosuppression, which permits
bacterial and viral infections at the site of direct mucosal
injury. The severity of these effects may preclude dose escalation,
delay treatment, and warrant dose reductions, thus limiting the
effectiveness of cancer therapy.
[0008] Prophylaxis and therapy for chemotherapy and radiation
therapy-induced (mucosal) gastrointestinal injuries (mucositis)
commonly entails prescription of suboptimal doses of chemotherapy
or radiotherapy, a downward dose modification in subsequent
treatment courses following toxicity, or the use of specific
antidotes such as leucovorin after moderate-dose or high-dose
methotrexate (Allegra CJ. Antifolates. In: Chabner and Collins,
eds. Cancer Chemotherapy: Principles and Practice. Philadelphia,
Pa. JP Lippincoft Co; 1990:110-153.)
[0009] Injury to the gastrointestinal mucosa is also associated
with chronic inflammatory disorders of the gastrointestinal tract,
which are collectively referred to as inflammatory bowel disease.
Cytokine-based therapies are available for the treatment of
inflammatory bowel disease (Bouma and Strober Nature Rev 3:521-533
(2003)). However, resection of the small intestine is often
indicated in patients with inflammatory bowel disease such as
Crohn's disease. Surgical resection of the small intestine may also
be necessary following traumatic injury, vascular accidents, and
cancer. Surgical resection that leaves less than 200 cm of viable
small bowel places a patient at risk for developing short-bowel
syndrome (SBS). SBS is a disorder that is clinically defined by
malabsorption, diarrhea, fluid and electrolyte disturbances, and
malnutrition. The management of patients with SBS frequently
requires long-term, if not life long use of parenteral nutrition
(DiBaise et al., Am J Gastroenterol 99:1823-1832 (2004)).
[0010] Thus, there is a need to find agents that may be used
prophylactically or therapeutically to increase the tolerance to
antineoplastic treatments, to advance current therapies for
treating inflammatory bowel disease, and to restore the digestive
and absorptive processes that are compromised following surgical
resection of the intestine.
2. SUMMARY OF THE INVENTION
[0011] The present invention is based, in part, on the discovery
that GastroIntestinal Proliferative Factor (GIPF) induces the
proliferation of epithelial cells of the gastrointestinal tract.
Thus, compositions comprising GIPF, fragments or analogs thereof,
may be used for the treatment of conditions where epithelialization
is desirable, such as for the treatment of gastrointestinal
disorders including chemotherapy and radiation therapy-induced
mucositis, mucositis of the oropharynx, lips and esophagus,
inflammatory bowel disease, and other conditions including wounds,
burns, ophthalmic disorders, and any disorder where stimulation of
epithelial cell proliferation or regeneration is desired.
[0012] Accordingly, in one embodiment, the invention is directed to
a composition comprising a therapeutically effective amount of a
GIPF polypeptide and a pharmaceutically acceptable carrier.
[0013] The compositions of the present invention include isolated
polynucleotides encoding GIPF polypeptides, including recombinant
DNA molecules, and cloned genes or degenerate variants thereof,
especially naturally occurring variants such as allelic variants.
Specifically, the polynucleotides of the present invention are
based on a GIPF polynucleotide isolated from a cDNA library
prepared from human fetal skin mRNA (SEQ ID NO: 2).
[0014] The compositions of the present invention also include
vectors such as expression vectors containing the polynucleotides
of the invention, cells genetically engineered to contain such
polynucleotides and cells genetically engineered to express such
polynucleotides.
[0015] The compositions of the invention comprise isolated
polynucleotides that include, but are not limited to, a GIPF
polynucleotide, a fragment, or variant thereof; a polynucleotide
comprising the full length protein coding sequence of SEQ ID NO: 2
or 3 (for example, SEQ ID NO: 4; GIPFwt); a polynucleotide
comprising the V5-His-tagged protein coding sequence of SEQ ID NO:
5 (for example SEQ ID NO: 6; GIPFt); a polynucleotide comprising
the nucleotide sequence of the dominant mature protein coding
sequence of SEQ ID NO: 9 (for example SEQ ID NO: 10); a
polynucleotide comprising the nucleotide sequence of the mature
protein coding sequence of SEQ ID NO: 11 (for example SEQ ID NO:
12); a polynucleotide comprising the nucleotide sequence of the
thrombospondin domain of SEQ ID NO: 13 (for example SEQ ID NO: 14);
a polynucleotide of SEQ ID NO: 15 comprising the nucleotide
sequence that encodes a dominant mature protein sequence that lacks
the furin cleavage site (for example SEQ ID NO: 16); the
polynucleotide of SEQ ID NO: 17 comprising the nucleotide sequence
that encodes a GIPF polypeptide that comprises a mutated furin
cleavage site (SEQ ID NO: 18); and polynucleotides that encode GIPF
polypeptides that comprise varying lengths of the full-length GIPF
(SEQ ID NOs: 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104 and
177). The polynucleotide compositions of the present invention also
include, but are not limited to, a polynucleotide that hybridizes
under stringent hybridization conditions to (a) the complement of
any of the nucleotide sequences set forth in SEQ ID NO: 2, 3, 5, 9,
11, 13, 15, 17, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104 or
177; (b) a nucleotide sequence encoding any of SEQ ID NO: 4, 6, 8,
10, 12, 14, 16, 18, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105
or 178; a polynucleotide which is an variant (e.g., an allelic
variant) of any polynucleotides recited above having at least 70%
(e.g., 75%, 80%, 85%, 90%, 92%, 94%, 96%, 98%, or 99%)
polynucleotide sequence identity to the polynucleotides; a
polynucleotide which encodes a species homolog (e.g., an ortholog)
of any of the polypeptides recited above; or a polynucleotide that
encodes a polypeptide comprising a specific domain or truncation of
the polypeptide of SEQ ID NO: 4 or 6.
[0016] This invention further provides cloning or expression
vectors comprising at least a fragment of the polynucleotides set
forth above and host cells or organisms transformed with these
expression vectors. Useful vectors include plasmids, cosmids,
lambda phage derivatives, phagemids, and the like, that are well
known in the art. Accordingly, the invention also provides a vector
including a polynucleotide of the invention and a host cell
containing the polynucleotide. In general, the vector contains an
origin of replication functional in at least one organism,
convenient restriction endonuclease sites, and a selectable marker
for the host cell. Vectors according to the invention include
expression vectors, replication vectors, probe generation vectors,
and sequencing vectors. A host cell according to the invention can
be a prokaryotic or eukaryotic cell and can be a unicellular
organism or part of a multicellular organism.
[0017] The pharmaceutical compositions of the present invention
include polypeptides comprising, but not limited to, an isolated
polypeptide selected from the group comprising the amino acid
sequence of SEQ ID NO: 4, 6, 10, 12, 14, 16, 18, 85, 87, 89, 91,
93, 95, 97, 99, 101, 103, 105 or 178. Polypeptides of the invention
also include polypeptides with biological activity that are encoded
by (a) any of the polynucleotides having a nucleotide sequence set
forth in the SEQ ID NO: 2, 3, 5, 9, 11, 13, 15, 17, 84, 86, 88, 90,
92, 94, 96, 98, 100, 102, 104, 177 above; or (b) polynucleotides
that hybridize to the complement of the polynucleotides of (a)
under stringent hybridization conditions. Biologically or
immunologically active analogs of any of the protein sequences
listed as SEQ ID NO: 4, 6, 10, 12, 14, 16, 18, 85, 87, 89, 91, 93,
95, 97, 99, 101, 103, 105 or 178, and substantial equivalents
thereof that retain biological are also contemplated. The
polypeptides of the invention may be wholly or partially chemically
synthesized but are preferably produced by recombinant means using
the genetically engineered cells (e.g. host cells) of the
invention. The invention includes polypeptides that are at least
85%, 90%, 92%, 94%, 96%, 98%, or 99% identical to any of SEQ ID NO:
4, 6, 10, 12, 14, 16, 18, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103,
105 and 178. The invention also includes polypeptides that differ
in sequence from any of SEQ ID NO: 4, 6, 10, 12, 14, 16, 18, 85,
87, 89, 91, 93, 95, 97, 99, 101, 103, 105 and 178 and at 20, 15,
10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid residues. The amino acid
changes can be conservative or non-conservative.
[0018] The invention also relates to methods for producing a GIPF
polypeptide comprising culturing host cells comprising an
expression vector containing at least a fragment of a GIPF
polynucleotide encoding the GIPF polypeptide of the invention in a
suitable culture medium under conditions permitting expression of
the desired polypeptide, and purifying the protein or peptide from
the culture or from the host cells. Preferred embodiments include
those in which the protein produced by such a process is a mature
or dominant mature form of the protein.
[0019] The polypeptides according to the invention can be used in a
variety of conventional procedures and methods that are currently
applied to other proteins. For example, a polypeptide of the
invention can be used to generate an antibody that specifically
binds the polypeptide. Such antibodies, particularly monoclonal
antibodies, are useful for detecting or quantifying the polypeptide
in tissue.
[0020] In further embodiments, the subject invention is directed to
a method of stimulating epithelial cell proliferation. The method
comprises contacting epithelial cells with a composition that
includes a therapeutically effective amount of a GIPF polypeptide,
fragment or analog thereof, and a pharmaceutically acceptable
carrier. Specifically, a subject in need of stimulation (including
cytoprotection, proliferation and/or differentiation) of epithelial
cells will be administered therapeutically-effective or
prophylactically-effective amounts of GIPF protein, fragments or
analogs thereof.
[0021] In all the methods described, epithelial cells may be
contacted with the GIPF polypeptides in vitro or in vivo.
[0022] Methods are also provided for preventing, treating, or
ameliorating a medical condition which comprises the step of
administering to a mammalian subject a therapeutically effective
amount of a composition comprising a peptide of the present
invention and a pharmaceutically acceptable carrier.
[0023] In particular, the GIPF polypeptides of the invention may be
used to induce the proliferation and/or differentiation of
gastrointestinal crypt cells to regenerate the epithelial layer of
the alimentary tract. Thus, the GIPF polypeptides and
polynucleotides of the invention may be used in the treatment of
chemotherapy or radiation therapy-induced mucositis and
enterocolitis, and inflammatory bowel disease. They may also be
used in the treatment of diseases, and other conditions including
wounds, burns, ophthalmic disorders, and any disorder where
stimulation of epithelial cell proliferation or regeneration is
desired.
[0024] Polynucleotides and polypeptides of the invention may also
be used as markers of differentiation and development of
gastrointestinal epithelium.
[0025] The methods of the invention also provide methods for the
treatment of disorders as recited herein which comprise the
administration of a therapeutically effective amount of a
composition comprising a polynucleotide or polypeptide of the
invention and a pharmaceutically acceptable carrier to a mammalian
subject exhibiting symptoms or tendencies related to disorders as
recited herein. In addition, the invention encompasses methods for
treating diseases or disorders as recited herein comprising the
step of administering a composition comprising compounds and other
substances that modulate the overall activity of the target gene
products and a pharmaceutically acceptable carrier. Compounds and
other substances can effect such modulation either on the level of
target gene/protein expression or target protein activity.
Specifically, methods are provided for preventing, treating or
ameliorating a medical condition, including mucositis and
inflammatory bowel disease, wounds, which comprises administering
to a mammalian subject, including but not limited to humans, a
therapeutically effective amount of a composition comprising a
polypeptide of the invention or a therapeutically effective amount
of a composition comprising a binding partner of GIPF polypeptides
of the invention. The mechanics of the particular condition or
pathology will dictate whether the polypeptides of the invention or
binding partners of these would be beneficial to the individual in
need of treatment.
[0026] The invention further provides methods for manufacturing
medicaments useful in the above-described methods.
[0027] The present invention further relates to methods for
detecting the presence of the polynucleotides or polypeptides of
the invention in a sample (e.g., tissue or sample). Such methods
can, for example, be utilized as part of prognostic and diagnostic
evaluation of disorders as recited herein and for the
identification of subjects exhibiting a predisposition to such
conditions.
[0028] The invention provides a method for detecting a polypeptide
of the invention in a sample comprising contacting the sample with
a compound that binds to and forms a complex with the polypeptide
under conditions and for a period sufficient to form the complex
and detecting formation of the complex, so that if a complex is
formed, the polypeptide is detected.
[0029] The invention also provides kits comprising polynucleotide
probes and/or monoclonal antibodies, and optionally quantitative
standards, for carrying out methods of the invention. Furthermore,
the invention provides methods for evaluating the efficacy of
drugs, and monitoring the progress of patients, involved in
clinical trials for the treatment of disorders as recited
above.
[0030] The invention also provides methods for the identification
of compounds that modulate (i.e., increase or decrease) the
expression or activity of the polynucleotides and/or polypeptides
of the invention. Such methods can be utilized, for example, for
the identification of compounds that can enhance the therapeutic
activity of the GIPF polypeptides, and ameliorate symptoms of
disorders as recited herein. Such methods can include, but are not
limited to, assays for identifying compounds and other substances
that interact with (e.g., bind to) the polypeptides of the
invention.
[0031] The invention provides a method for identifying a compound
that binds to the polypeptide of the present invention comprising
contacting the compound with the polypeptide under conditions and
for a time sufficient to form a polypeptide/compound complex and
detecting the complex, so that if the polypeptide/compound complex
is detected, a compound that binds to the polypeptide is
identified.
[0032] Also provided is a method for identifying a compound that
binds to the polypeptide comprising contacting the compound with
the polypeptide in a cell for a time sufficient to form a
polypeptide/compound complex wherein the complex drives expression
of a reporter gene sequence in the cell and detecting the complex
by detecting reporter gene sequence expression so that if the
polypeptide/compound complex is detected a compound that binds to
the polypeptide is identified.
[0033] Another embodiment of the invention provides gene therapy by
delivery of GIPF polypeptides for the treatment of conditions or
disorders recited herein.
[0034] In a related embodiment, the invention is directed to use of
a vector comprising a gene encoding a GIPF polypeptide operably
associated with an expression control sequence that provides for
expression of the GIPF polypeptide in the manufacture of a
medicament for treating disorders as recited herein. More
particularly, the invention provides for use of an adenoviral
vector of the invention, e.g., as set out below, in the manufacture
of a medicament for treating mucositis or inflammatory bowel
disease.
[0035] In addition to the foregoing methods and uses, the invention
provides a novel virus vector comprising a gene encoding a GIPF
polypeptide operably associated with an expression control
sequence. In a preferred embodiment, the virus vector is an
adenovirus vector. The virus vectors of the invention can provide a
gene encoding any GIPF polypeptide, as set forth above.
[0036] The invention further provides a pharmaceutical composition
comprising any of the virus vectors of the invention and a
pharmaceutically acceptable carrier.
[0037] In yet another aspect, the invention concerns a transgene
construct comprising a nucleic acid encoding a native human GIPF
protein, analog or a fragment thereof, under the control of
transcriptional regulatory sequences directing its expression to
B-cells. The transgene construct preferably comprises a B-cell
specific promoter, such as an immunoglobulin kappa chain
promoter.
[0038] In another aspect, the invention concerns a transgenic
non-human mammal that produces in its B-cells detectable levels of
a native human GIPF protein, analog or a fragment thereof, wherein
said transgenic mammal has stably integrated into its genome a
nucleic acid sequence encoding a native human GIPF protein, analog
or a fragment thereof having the biological activity of native
human GIPF, operably linked to transcriptional regulatory sequences
directing its expression to B-cells. The transcriptional regulatory
sequences preferably comprise a B-cell specific promoter, such as
the immunoglobulin kappa chain promoter. Without limitation, the
non-human transgenic mammal may, for example, be mouse, rat,
rabbit, pig, sheep, goat or cattle.
[0039] In another aspect the invention concerns a method of
screening drug candidates for the treatment of a disease or
disorder recited herein comprising (a) administering a drug
candidate to a transgenic mouse that expresses in its B-cells a
GIPF polypeptide, and develops intestinal distension associated
with hyperproliferation of epithelial cells, and (b) evaluating the
effect of the candidate drug on the hyperproliferation of the
epithelial cells. The drug candidates may modulate (i.e. increase
or decrease) the expression or activity of the polynucleotides
and/or polypeptides of the invention.
[0040] The invention also includes a method of treating or
ameliorating a medical condition, including mucositis and
inflammatory bowel disease, and wounds, which comprises
administering to a mammalian subject, including but not limited to
humans, a therapeutically effective amount of a GIPF polypeptide
together with a cytokine.
[0041] In another aspect the invention includes pharmaceutical
compositions comprising a polypeptide of the invention, a second
therapeutic agent, e.g., a cytokine, and a pharmaceutically
acceptable carrier.
The invention features, a composition comprising a therapeutically
effective amount of a GIPF polypeptide, fragment, or analog
thereof, and a pharmaceutically acceptable carrier.
[0042] The invention also features a pharmaceutical composition
comprising a polypeptide comprising a biologically active fragment
of GIPF and a pharmaceutically acceptable carrier. In various
embodiments, the GIPF is human GIPF; and the polypeptide comprises
a biologically active fragment of the polypeptide of SEQ ID
NO:4.
[0043] In another embodiment the invention features a
pharmaceutical composition comprising a polypeptide comprising a
polypeptide fragment of SEQ ID NO:4 wherein the polypeptide
fragment comprises an amino acid sequence selected from the group
consisting of SEQ ID NO: 10, 12, 14, 16, 18, 85, 87, 89, 91, 93,
95, 97, 99, 101, 103, 105, and 178.
[0044] In various embodiments of the compositions and methods, the
polypeptide is glycosylated; the polypeptide is not glycosylated;
the polypeptide stimulates epithelial cell proliferation; and the
polypeptide comprises an amino acid sequence that is at least 80%
identical to the amino acid sequence of SEQ ID NO:4.
[0045] The invention also features: a method of stimulating
epithelial cell proliferation in a subject comprising administering
to said subject a composition comprising a GIPF polypeptide,
fragment or analog thereof and a carrier; a method of treatment
comprising administering to a mammalian subject in need thereof a
therapeutically effective amount of a composition comprising a GIPF
polypeptide and a pharmaceutically acceptable carrier; a method of
treating mucositis, inflammatory bowel disease, or short bowel
syndrome comprising administering to a mammalian subject in need
thereof a therapeutically effective amount of a composition
comprising a GIPF polypeptide and a pharmaceutically acceptable
carrier; a method for stimulating epithelial cell proliferation in
the gastrointestinal tract of a patient, the method comprising
administering a therapeutically effective amount of a composition
comprising a GIPF polypeptide and a pharmaceutically acceptable
carrier. In various embodiments: epithelial cell proliferation in
the esophagus is stimulated, epithelial cell proliferation in the
small intestine is stimulated; epithelial cell proliferation in the
large intestine is stimulated; epithelial cell proliferation in the
oral cavity is stimulated and epithelial cell proliferation in the
stomach is stimulated.
[0046] The invention also features a method for treating a patient
at risk for damage to epithelial cells lining at least a portion of
the gastrointestinal tract, the method comprising administering a
therapeutically effective amount of a composition comprising a GIPF
polypeptide and a pharmaceutically acceptable carrier. In certain
embodiments: the patient has undergone or will undergo radiation
therapy and the patient has undergone or will undergo
chemotherapy.
[0047] The invention includes a method for treating a patient that
has undergone radiation therapy or chemotherapy comprising
administering a therapeutically effective amount of a composition
comprising a GIPF polypeptide and a pharmaceutically acceptable
carrier.
[0048] In other embodiments, the invention features an adenoviral
vector comprising a gene encoding GIPF operably associated with an
expression control sequence as well as a pharmaceutical composition
comprising such a vector.
[0049] In other embodiments, the invention features a method of
stimulating epithelial cell proliferation in a subject comprising
administering to said subject the pharmaceutical composition
comprising features an adenoviral vector comprising a gene encoding
GIPF operably associated with an expression control sequence.
[0050] The invention also features a transgene construct comprising
a nucleic acid encoding a GIPF protein, wherein said nucleic acid
is operably linked to transcriptional regulatory sequences
directing its expression in B-cells. In certain embodiments, the
transgene construct comprises a B-cell specific promoter.
[0051] The invention also features a transgenic mouse that produces
in its B-cells cells detectable levels of a native human GIPF
protein, wherein said transgenic mouse has stably integrated into
its genome a nucleic acid sequence encoding a GIPF protein,
operably linked to transcriptional regulatory sequences directing
its expression to B-cells. In some embodiments, the transcriptional
regulatory sequences comprise a B-cell promoter.
[0052] The invention features a method of identifying a drug
candidate for the treatment of mucositis, inflammatory bowel
disease or short bowel syndrome, comprising:
[0053] (a) administering a test compound to a transgenic mouse that
expresses in its B-cells a recombinant GIPF polypeptide and
exhibits increased intestinal epithelial cell proliferation
compared to an otherwise identical mouse not expressing a
recombinant GIPF polypeptide intestinal epithelial cell
proliferation; and
[0054] (b) evaluating the effect of said test compound on
intestinal epithelial cell proliferation, wherein an increase in
intestinal cell proliferation identifies the test compound as a
drug candidate for the treatment of mucositis, inflammatory bowel
disease or short bowel syndrome. In certain embodiments, the
intestinal epithelial cell is a crypt cell.
[0055] The invention also features: an isolated polynucleotide
selected from the group consisting of SEQ ID NO: 9, 11, 13, 15, 17,
84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and 104; an isolated
polynucleotide encoding a polypeptide with biological activity,
said polynucleotide having greater than about 95% sequence identity
to polynucleotide selected from the group consisting of SEQ ID NO:
9, 11, 13, 15, 17, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and
104.
[0056] The invention also features: an isolated polypeptide
selected from the group consisting of SEQ ID NO: 12, 14, 16, 18,
85, 87, 89, 91, 93, 95, 97, 99, 101, 103, and 105; and an isolated
polypeptide comprising an amino acid sequence which is at least 95%
identical to the amino acid sequence selected from the group
consisting of SEQ ID NO: 12, 14, 16, 18, 85, 87, 89, 91, 93, 95,
97, 99, 101, 103, and 105.
[0057] The invention further features an expression vector
comprising expression regulatory elements operatively linked to a
polynucleotide of SEQ ID NO: 5, 9, 11, 13, 15, 17, 84, 86, 88, 90,
92, 94, 96, 98, 100, 102, and 104.
[0058] The invention also features a host cell transformed or
transfected with a polynucleotide of SEQ ID NO: 5, 9, 11, 13, 15,
17, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104 or 177. In some
embodiments the cell is prokaryotic, in others it is
eukaryotic.
[0059] The invention also features a method for producing a
polypeptide comprising the amino acid sequence of SEQ ID NO: 12,
14, 16, 18, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, or 105, the
method comprising:
[0060] (a) culturing an isolated cell comprising a nucleic acid
molecule encoding a polypeptide of SEQ ID NO: 12, 14, 16, 18, 85,
87, 89, 91, 93, 95, 97, 99, 101, 103, or 105 in culture medium
under conditions suitable for expressing the polypeptide; and
[0061] (b) purifying the polypeptide from the cell or the culture
medium.
The invention features a method for producing a pharmaceutical
composition comprising a polypeptide comprising the amino acid
sequence of SEQ ID NO: 12, 14, 16, 18, 85, 87, 89, 91, 93, 95, 97,
99, 101, 103, 105 or 178, the method comprising
[0062] (a) culturing an isolated cell comprising a nucleic acid
molecule encoding a polypeptide of SEQ ID NO: 12, 14, 16, 18, 85,
87, 89, 91, 93, 95, 97, 99, 101, 103, 105, or 178 in culture medium
under conditions suitable for expressing the polypeptide;
[0063] (b) purifying the polypeptide from the cell or the culture
medium; and
[0064] (c) combining the purified polypeptide with a
pharmaceutically acceptable carrier.
[0065] The invention features a method for producing a
pharmaceutical composition comprising a polypeptide comprising the
amino acid sequence of SEQ ID NO: 12, 14, 16, 18, 85, 87, 89, 91,
93, 95, 97, 99, 101, 103, 105 or 178, the method comprising
[0066] (a) synthesizing comprising a polypeptide comprising the
amino acid sequence of SEQ ID NO: 12, 14, 16, 18, 85, 87, 89, 91,
93, 95, 97, 99, 101, 103, 105 or 178;
[0067] (b) purifying the polypeptide; and
[0068] (c) combining the purified polypeptide with a
pharmaceutically acceptable carrier.
[0069] The invention also features an expression vector construct
comprising a nucleic acid encoding a GIPF protein, wherein the
nucleic acid is operably linked to transcriptional regulatory
sequences directing expression of the GIPF protein in intestinal
epithelial cells.
[0070] In another aspect the invention includes a transgenic mouse
that produces in its intestinal epithelial cells detectable levels
of a GIPF protein, wherein said transgenic mouse has stably
integrated into its genome a nucleic acid sequence encoding a GIPF
protein, wherein the nucleic acid sequence encoding the GIPF
protein is operably linked to transcriptional regulatory sequences
directing expression of the GIPF protein in intestinal epithelial
cells.
[0071] In another aspect the invention features an expression
vector construct comprising a nucleic acid encoding a GIPF protein
and a Wnt3a protein, wherein the nucleic acid is operably linked to
transcriptional regulatory sequences directing its expression in
intestinal epithelial cells.
[0072] The invention also features a transgenic mouse that produces
in its intestinal epithelial cells detectable levels of a native
GIPF and Wnt3a protein, wherein said transgenic mouse has stably
integrated into its genome a nucleic acid sequence encoding a GIPF
protein, operably linked to transcriptional regulatory sequences
directing expression of the GIPF protein in intestinal epithelial
cells.
[0073] In some embodiments the transgenic mouse exhibits intestinal
distension.
[0074] Additional aspects and advantages of the invention will be
apparent to those skilled in the art upon consideration of the
following description, which details the practice of the
invention.
3. BRIEF DESCRIPTION OF THE DRAWINGS
[0075] FIG. 1 depicts the DNA sequence (SEQ ID NO: 2) (A) and
corresponding amino acid sequence for the full-length GIPF (SEQ ID
NO: 4) (B). SEQ ID NO: 2 includes the 5 prime and 3 prime
untranslated regions in conjunction with the open reading
frame.
[0076] FIG. 2 depicts the expression of GIPF mRNA in tissues from
human (A) and mouse (B).
[0077] FIG. 3 is a schematic representation of the GIPF
polypeptides of the compositions of the invention. The numbers that
are underlined correspond to the SEQ ID NOs of the polypeptides,
and the remaining numbers are the SEQ ID NOs of the encoding
polynucleotide sequences.
[0078] FIG. 4A shows the BLASTP amino acid sequence alignment
between the GIPF protein encoded by SEQ ID NO: 2 or 3 (i.e. SEQ ID
NO: 4) and human stem cell growth factor A1 SEQ ID NO: 23 (SEQ ID
NO: 10 from PCT WO 01/77169 A2), indicates that the two sequences
share 63% similarity over amino acid residues 10 through 251 of SEQ
ID NO: 4 and amino acid residues 11 through 257 of SEQ ID NO: 23,
and 46% identity over the amino acid residues 10 through 251 of SEQ
ID NO: 4 and amino acid residues 11 through 257 of SEQ ID NO:
23.
[0079] FIG. 4B shows the BLASTP amino acid sequence alignment
between the GIPF protein encoded by SEQ ID NO: 2 or 3 (i.e. SEQ ID
NO: 4) GIPF polypeptide and a specific region of human
thrombospondin 1 (amino acid residues 501 through 657 of SwissProt
accession number P07996; SEQ ID NO: 28). The figure indicates that
the two sequences share 36% similarity and 26% identity over amino
acid residues 14 through 166 of SEQ ID NO: 4 and amino acid
residues 501 through 657 of SEQ ID NO: 28, wherein A=Alanine,
C=Cysteine, D=Aspartic Acid, E=Glutamic Acid, F=Phenylalanine,
G=Glycine, H=Histidine, I=Isoleucine, K=Lysine, L=Leucine,
M=Methionine, N=Asparagine, P=Proline, Q=Glutamine, R=Arginine,
S=Serine, T=Threonine, V=Valine, W=Tryptophan, Y=Tyrosine. Gaps are
presented as dashes.
[0080] FIGS. 5A-5R depicts the steps of the method used to generate
the GIPF-knock-in (GIPF-KI) vector of the invention. A preferred
method for generating transgenic mice that express GIPF in their B
cells is also described.
[0081] FIG. 6 depicts the location of the probe utilized in
Southern blot analysis to select ES clones resulting from
homologous recombination, as well as the EcoRI digest fragment
sizes of mouse genomic DNA that has undergone homologous or
non-homologous recombination.
[0082] FIG. 7 shows the gross pathology of the intestinal tract of
the GIPF-KI mice: control (A) GIPF-KI (B).
[0083] FIG. 8 H&E staining of transverse sections of small
intestine of GIPF-KI (A) and control chimeric (B) mice,
respectively.
[0084] FIG. 9 shows H&E staining of the intestinal sections of
FIG. 8 seen under higher magnification. Panels A and C correspond
to the GIPF-KI section seen in panel A of FIG. 8, and panels B and
D correspond to the intestinal section derived from a control
chimeric mouse seen in panel B of FIG. 8.
[0085] FIG. 10 shows Ki67 staining of cross-sections of the small
intestine from a control chimeric mouse (A and C), and from a
GIPF-KI mouse (B and D).
[0086] FIG. 11 Cross-sections of small intestine derived from a
control mouse (A and C), and from a mouse treated with
1.times.10.sup.10 viral particles (VP). The sections were obtained
three days following injection of the empty or GIPF adenovirus,
respectively.
[0087] FIG. 12 Cross-sections of small intestine derived from
control (A and C), and from a mouse treated with 1.times.10.sup.10
viral particles (VP) (FIGS. 12 B and D). The sections were obtained
five days following injection of the empty or GIPF adenovirus,
respectively.
[0088] FIG. 13 Incorporation of BrdU into proliferating crypt cells
of the small intestine of control mice (A and C) and mice treated
with 1.times.10.sup.10 viral particles (VP) (B and D).
[0089] FIG. 14 Ki67 staining of proliferating crypt cells of the
small intestine of control (A and C) and GIPF-adenovirus-treated
mice (B and D).
[0090] FIG. 15 H&E staining of cross sections derived from the
small intestine of control mice (A and C) and mice that had been
treated with GIPF-adenovirus at 1.times.10.sup.9 viral particles (B
and D).
[0091] FIG. 16 H&E staining of cross-sections derived from the
colon of control (A and C) and GIPF-adenovirus-treated mice (B and
D).
[0092] FIG. 17 Solubility requirements of native V5-His-tagged GIPF
protein purified from CHO cells.
[0093] FIG. 18 Pharmacokinetics of V5-His-tagged GIPF protein in
mouse serum.
[0094] FIG. 19 H&E staining of cross sections derived from the
small intestine of control mice (A and C) and mice that had been
treated with purified GIPF protein (B and D).
[0095] FIG. 20 Incorporation of BrdU into proliferating crypt cells
of the small intestine of control mice (A and C) and mice that had
been treated with purified GIPF protein (B and D).
[0096] FIG. 21 H&E staining of cross sections derived from the
colon of control mice (A) and mice that had been treated with
purified GIPF protein (B).
[0097] FIG. 22 Incorporation of BrdU into proliferating crypt cells
of the colon of control mice (A and C) and mice that had been
treated with purified GIPF protein (B and D).
[0098] FIG. 23 H&E staining of cross sections derived from the
small intestine of non-irradiated mice (A), irradiated mice treated
with saline (B), KGF (C) or GIPFwt (D).
[0099] FIG. 24 Effect of 5-FU on the size of tumors in control mice
and mice receiving GIPFwt.
[0100] FIG. 25 Effect of GIPF on the gross pathology of the small
intestine and colon of normal (E and F) and tumor-bearing mice
(A-D).
[0101] FIG. 26 H&E staining of cross sections derived from the
small intestine and colon of normal and tumor-bearing mice that had
received 5-FU and/or GIPF.
[0102] FIG. 27 Micromorphometry measurements of the villus height
and crypt depth show the effect of GIPF on the intestinal
epithelium of mice that received 5-FU.
[0103] FIG. 28 Ki67 staining of proliferating epithelial cells of
the ventral tongue of control mice (A and B), and mice treated with
KGF or GIPF (C-E) and submitted to total body irradiation.
[0104] FIG. 29 Ki67 staining of proliferating epithelial cells of
the dorsal tongue of control mice (A and B), and mice treated with
KGF or GIPF (C and D) and submitted to total body irradiation.
[0105] FIG. 30 Proliferative index of ventral tongue epithelium
from mice treated with KGF or GIPF and submitted to total body
irradiation.
[0106] FIG. 31 H&E staining of sections derived from the tongue
of mice treated with GIPF and submitted to total body
irradiation.
[0107] FIG. 32 Effect of GIPF on the inflammatory bowel disease
activity index (IBDAI) of mice with DSS-iduced colitis.
[0108] FIG. 33 Effect of GIPF on the score for animal body weight
in mice with DSS-induced colitis.
[0109] FIG. 34 Effect of GIPF on the score for stool consistency in
mice with DSS-induced colitis.
[0110] FIG. 35 Effect of GIPF on the score for rectal bleeding in
mice with DSS-induced colitis.
[0111] FIG. 36 Effect of GIPF on the gross pathology of the small
intestine and colon of control and DSS-treated mice.
[0112] FIG. 37 H&E staining of cross sections derived from the
small intestine and colon of mice that had received DSS and/or
GIPF.
[0113] FIG. 38 Micromorphometry measurements of the villus height
and crypt depth show the effect of GIPF on the intestinal
epithelium of mice with DSS-induced colitis.
[0114] FIG. 39 Incorporation of BrdU into proliferating crypt cells
of the small intestine and colon of mice that had received DSS
and/or GIPF.
[0115] FIG. 40 Effect of GIPF on the proliferation of the small
intestinal epithelium of mice with DSS-induced colitis.
[0116] FIG. 41 Effect of GIPF on the stabilization of
.beta.-catenin in human endocrinic and kidney epithelial cells.
GIPF induced the dose-dependent (A) and time-dependent (B)
stabilization of .beta.-catenin in HEK293 cells. The stabilizing
effect of GIPF is not disrupted by boiling (C).
[0117] FIG. 42 Effect of GIPF on the phosphorylation of
GSK3.beta..
[0118] FIG. 43 Schematic representation GIPF polypeptide analogs
designed to determine the ability of various regions of GIPF in
stabilizing .beta.-catenin. The fragment numbers 1-11 respectively
correspond to polypeptide SEQ ID NOs; 85, 87, 89, 91, 93, 95, 97,
99, 101, 103, and 105.
[0119] FIG. 44 Stabilization of .beta.-catenin by the GIPF analogs
depicted in FIG. 43.
[0120] FIG. 45 Comparison of the activity of human and mouse GIPF
on the gross pathology of mouse intestines.
[0121] FIG. 46 Effect of GIPF on intestinal crypt depth.
[0122] FIG. 47 Effect of GIPF on the stabilization of
.beta.-catenin in isolated crypt cells.
[0123] FIG. 48 Effect of GIPF on body weight of animals with
TNBS-induced colitis.
[0124] FIG. 49 Effect of GIPF on the colitis score in animals with
TNBS-induced colitis.
[0125] FIG. 50 Effect of GIPF on chronic colitis induced by
DSS.
[0126] FIG. 51 Effect of GIPF on villus height and crypt depth in
animals with DSS-induced chronic colitis.
[0127] FIG. 52 Effect of GIPF on the crypt proliferative index of
animals with DSS-induced chronic colitis.
[0128] FIG. 53 Effect of GIPF on the survival of crypts following
irradiation.
[0129] FIG. 54 A-N Diagrammatic representation of the construction
of a transgene for the villin-driven expression of GIPF in the
epithelium of transgenic mice.
[0130] FIG. 55 Embryonic expression of GIPF in the intestinal
epithelium and liver of transgenic mice.
[0131] FIG. 56 Stabilization of .beta.-catenin in transgenic mice
that express GIPF.
[0132] FIG. 57 H&E staining of sections of the small intestine
of transgenic mice that express GIPF.
[0133] FIG. 58 A-C Diagrammatic representation of the construction
of a transgene for the villin-driven expression of GIPF and Wnt3a
in transgenic mice.
[0134] FIG. 59 Embryonic expression of GIPF and Wnt3a in the small
and large intestine of transgenic mice.
[0135] FIG. 60 Stabilization of .beta.-catenin in transgenic mice
that express GIPF and Wnt3a.
[0136] FIG. 61 H&E staining of sections of the small intestine
of a transgenic mouse embryo that expresses GIPF and Wnt3a.
[0137] FIG. 62 A-K Diagrammatic representation of the construction
of the RS-KO vector.
[0138] FIG. 63 Genomic map of wild type and recombinant RS-KO
clones.
[0139] FIG. 64 A-K Diagrammatic representation of the construction
of a knock-in vector pCk m4 KI for the expression of GIPF deletion
mutant (SEQ ID NO: 91) in transgenic mice.
[0140] FIG. 65 A-C Diagrammatic representation of the construction
of a knock-in vector pPS m4 KI for the expression of GIPF deletion
mutant (SEQ ID NO: 91) in transgenic mice.
[0141] FIG. 66 Genomic map of wild type and recombinant Ck m4 KI
clones.
[0142] FIG. 67 Genomic map of wild type and recombinant PS m4 KI
clones.
[0143] FIG. 68 A-C Diagrammatic representation of the construction
of a knock-in vector pCk VR KI for the expression of GIPF variant
(SEQ ID NO: 177; GenBank Accession Number AK098225) in transgenic
mice.
[0144] FIG. 69 A-C Diagrammatic representation of the construction
of a knock-in vector pPS VR KI for the expression of GIPF variant
(SEQ ID NO: 177; GenBank Accession Number AK098225) in transgenic
mice.
[0145] FIG. 70 Genomic map of wild type and recombinant Ck VR KI
clones.
[0146] FIG. 71 Genomic map of wild type and recombinant PS VR KI
clones.
[0147] FIG. 72 Comparison of small and large intestines of control
and transgenic mice expressing the GIPF deletion mutant SEQ ID NO:
91.
[0148] FIG. 73 H&E staining of cross-sections of small
intestine from transgenic mice expressing GIPF deletion mutant SEQ
ID NO: 91 (low magnification).
[0149] FIG. 74 H&E staining of cross-sections of small
intestine from transgenic mice expressing GIPF deletion mutant SEQ
ID NO: 91 (high magnification).
[0150] FIG. 75 Stabilization of Axin-2 in transgenic mice that
express GIPF deletion mutant SEQ ID NO: 91.
[0151] FIG. 76 Comparison of small and large intestines of control
and transgenic mice (PSVR KI) expressing GIPF variant (SEQ ID NO:
177; GenBank Accession Number AK098225) to that of a control
animal.
[0152] FIG. 77 H&E staining of cross-sections of small
intestine from control and transgenic mice (PSVR KI) expressing
GIPF variant (SEQ ID NO: 177; GenBank Accession Number AK098225)
(low magnification).
[0153] FIG. 78 H&E staining of cross-sections of small
intestine from control and transgenic mice (PSVR KI) expressing
GIPF variant (SEQ ID NO: 177; GenBank Accession Number AK098225)
(high magnification).
[0154] FIG. 79 Stabilization of Axin-2 in control and transgenic
mice that express GIPF variant (SEQ ID NO: 177; GenBank Accession
Number AK098225).
[0155] FIG. 80 H&E staining of sections from the large
intestine of control animal and an animal in which chronic IBD was
induced by T-cell transfer (example 37).
4. DETAILED DESCRIPTION OF THE INVENTION
[0156] The polypeptides of the invention are depicted in FIG. 3,
and are described in detail below.
[0157] The GIPF polypeptide of SEQ ID NO: 4 is a 263-amino acid
protein with a predicted molecular mass of approximately 29 kDa
unglycosylated. SEQ ID NO:2 is a cDNA encoding GIPF polypeptide.
The initial methionine starts at position 603 of SEQ ID NO: 2 and
the putative stop codon begins at position 1392 of SEQ ID NO: 2.
Protein database searches with the BLAST algorithm (Altschul S. F.
et al., J. Mol. Evol. 36:290-300 (1993) and Altschul S. F. et al.,
J. Mol. Biol. 21:403-10 (1990), herein incorporated by reference)
indicate that SEQ ID NO: 4 is homologous to SEQ ID NO: 23 Stem Cell
Growth Factor A-1 (SEQ ID NO: 10 from PCT WO 01/77169 A2) (FIG.
4A), and human thrombospondin 1 (SEQ ID NO: 28) (FIG. 4B).
[0158] A predicted approximately twenty-residue signal peptide (SEQ
ID NO: 8) extends from residue 1 to residue 20 of SEQ ID NO: 4. The
extracellular portion is useful on its own. The signal peptide
region was predicted using the Neural Network Signal P VI.I program
(Nielsen et al., Int. J. Neural Syst. 8:581-599 (1997)),
incorporated herein by reference) and/or using Neural Network
SignalP VI.I program (Nielsen et al, (1997) Int. J. Neural Syst. 8,
581-599). One of skill in the art will recognize that the actual
cleavage site may be different than that predicted by the computer
program. SEQ ID NO: 10 is the GIPF polypeptide of SEQ ID NO: 4 that
lacks the putative signal peptide (SEQ ID NO: 8).
[0159] Two species of polypeptides derived from SEQ ID NO: 4 have
been cloned and purified in mammalian cell culture. SEQ ID NO: 10
is the polypeptide form purified from cellular medium of Chinese
Hamster Ovary (CHO) cells that are transfected with a vector
construct comprising nucleotide sequence of SEQ ID NO: 3. The
polypeptide of SEQ ID NO: 10 is herein known as the dominant mature
form of GIPF. SEQ ID NO: 9 is a nucleotide sequence that encodes
the polypeptide of SEQ ID NO: 10. The N-terminal sequence for this
polypeptide form was determined through Edman degradation
sequencing (Speicher, D. W. Methods 6: 248-261 (1994); Tempst et
al., Methods 6: 248-261 (1994)). SEQ ID NO: 12 is the mature
polypeptide form isolated from the cellular medium of human
embryonic kidney 293 cells that are transfected with a vector
construct comprising SEQ ID NO: 3. SEQ ID NO: 11 is a corresponding
nucleotide sequence that encodes the polypeptide of SEQ ID NO: 12.
Through Edman degradation sequencing, it has been determined that
the polypeptide of SEQ ID NO: 12 lacks the first 31 amino acid
residues of SEQ ID NO: 4. The 31 amino acid peptide comprises a
consensus site (SEQ ID NO: 20) for furin protease cleavage (Zhou et
al., J Biol Chem 274:20745-20748 (1999), herein incorporated by
reference in its entirety).
[0160] Using the Pfam software program (Sonnhammer et al., Nucleic
Acids Res., Vol. 26(1) pp. 320-322 (1998) herein incorporated by
reference) the GIPF polypeptide (SEQ ID NO: 4) was examined for
domains with homology to known peptide domains. GIPF polypeptide of
SEQ ID NO: 4 is expected to have a thrombospondin type 1 domain
(SEQ ID NO: 14 encoded by the nucleotide sequence of SEQ ID NO 13).
The Pfam score for the thrombospondin type 1 domain contained
within SEQ ID NO: 4 is 0.0034, and is predicted to be from amino
acid residue 151 through 206 of SEQ ID NO: 4. The thrombospondin
domain may be useful on its own.
[0161] Other forms of GIPF include a polypeptide having the amino
acid sequence of SEQ ID NO:4 except that the valine at position 50
of SEQ ID NO:4 is replaced by an isoleucine (GIPF-I; SEQ ID
NO:______). Another form of GIPF-I has the amino acid sequence of
SEQ ID NO:10 except that the valine at position 30 of SEQ ID NO:10
is replaced by an isoleucine (SEQ ID NO:______). A third form of
GIPF-I has the amino acid sequence of SEQ ID NO:12 except that the
valine at position 19 of SEQ ID NO:12 is replaced by an isoleucine
(SEQ ID NO:______). Yet another form of GIPF includes the amino
acid sequence common to SEQ ID NO:4 and SEQ ID NO:178. Thus, this
polypeptide ahas the amino acid sequence of amino acids 33-263 of
SEQ ID NO:4 (SEQ ID NO:______).
[0162] Using eMATRIX software package (Stanford University,
Stanford, Calif.) (Wu et al., J. Comp. Biol., vol. 6, pp. 219-235
(1999), herein incorporated by reference), GIPF polypeptide of SEQ
ID NO: 4 is expected to have domains outlined in the table below,
wherein A=Alanine, C=Cysteine, D=Aspartic Acid, E=Glutamic Acid,
F=Phenylalanine, G=Glycine, H=Histidine, I=Isoleucine, K=Lysine,
L=Leucine, M=Methionine, N=Asparagine, P=Proline, Q=Glutamine,
R=Arginine, S=Serine, T=Threonine, V=Valine, W=Tryptophan,
Y=Tyrosine:
TABLE-US-00001 SEQ ID Identification eMATRIX domain Amino acid NO:
p value No. name Sequence (position) 24 8.63e-10 IPB001862A
Membrane attack PAQCEMSEWSPWGP complex CS (145-160)
components/perforin/ complement C9 25 9.03e-10 IPB002174A
Furin-like cysteine GKRQRRISAEGSQACA rich region KGCELCSEVNGCLKCS
(26-57) 26 9.80e-08 IPB000433 ZZ Zinc finger IEHCEACFSHNFCTKC
signature KP (99-115)
[0163] In order to control the production of either the dominant
mature or the mature polypeptide form that was predominantly
produced by CHO and/or 293 cells (SEQ ID NO: 10 and SEQ ID NO: 12,
respectively), synthetic constructs have been made. SEQ ID NO: 16
is a nucleotide sequence included in a vector system that results
in the expression of a polypeptide (SEQ ID NO: 16) in which the
predicted signal peptide (SEQ ID NO: 8) adjoins the predominant
mature form produced in 293 cells (SEQ ID NO: 10). SEQ ID NO: 17 is
a nucleotide construct produced by site-directed mutagenesis
(Weiner et al., Gene 126:35-41 (1993)) to contain a mutation in the
furin-protease cleavage consensus site (SEQ ID NO: 22). This
mutation changes the first arginine (R) residue of SEQ ID NO: 20 to
a glutamine (Q). The arginine to glutamine mutation enables the
production of the dominant mature form of GIPF by 293 cells (SEQ ID
NO: 10).
[0164] Thrombospondins are a family of extracellular matrix
proteins that are involved in cell-cell and cell-matrix
communication (Lawler et al., Curr. Opin. Cell Bio. 12:634-640
(2000)). More than five different thrombospondins are known with
distinct patterns of tissue distribution. Some tissues like heart,
cartilage, and brain express most of the thrombospondin gene
products. Thrombospondin-1 is a major constituent of blood
platelets. Thrombospondin-1 appears to function at the cell surface
to bring together membrane proteins and cytokines and other soluble
factors. Membrane proteins that bind thrombospondin-1 include
integrins, integrin-associated protein (CD47), CD36, proteoglycans.
Transforming growth factor .beta. (TGFf.beta.) and platelet-derived
growth factor also bind thrombospondin-1.
[0165] Thrombospondin-1 is a large protein with many distinct
domains. It contains a globular domain at both amino and carboxy
terminus, a region of homology with procollagen, and three types of
repeated sequence motifs termed thrombospondin (TSP) type 1, type
2, and type 3 repeats. TSP1 repeats have been found in various
different proteins including, complement components (C6, C7, C8A
etc.) extracellular matrix proteins like ADAMTS, mindin, axonal
guidance molecule like F-spondin semaphorins, and also SCO-spondin,
and TRAP proteins of Plasmodium.
[0166] Thrombospondin type 1 (TSP1) repeat can activate TGFf.beta.
epithelial tissues which are involved in regulation of cell growth,
differentiation, adhesion, migration, and death. TSP1 is further
involved in protein binding, heparin binding, cell attachment,
neurite outgrowth, inhibition of proliferation, inhibition of
angiogenesis, and activation of apoptosis. TSP1 domains of
Plasmodium circumsporozoite (CS) protein and TRAP proteins are
implicated in salivary gland invasion by the sporozoite.
[0167] TSP1 sequences are characterized by conserved cysteines,
closely spaced tryptophans, and a cluster of basic residues.
Spatial configuration of TSP1 sequences shows two .beta.-sheet
domains which are shown to bind heparin (Kilpelainen et al (200) J.
Biol Chem. 275, 13564-13570, incorporated herein by reference). A
similar spatial fold has been described for heparin-binding growth
associated molecule (HB-GAM). HB-GAM is identical to mitogenic and
neurite outgrowth-promoting protein pleitrophin; osteoblast
specific factor-1; heparin-binding neurotrophic factor; and heparin
affin regulatory peptide. Expression of HB-GAM was shown to be
associated with extracellular matrix of axonal tracts and synapses,
and also with basement membranes outside of brain and in the
cartilage matrix. Recently, N-syndecan has been shown to be a
receptor for HB-GAM in brain and has been suggested to play roles
in regulation of hippocampal long-term potentiation, a form of
brain plasticity implicated in memory and learning. Therefore, TSP1
containing proteins may act as growth promoters and may exhibit
GIPF activities.
[0168] In addition, thrombospondin, synthesized in bone marrow and
deposited within the extracellular matrix, functions as a
cytoadhesion molecule for primary pluripotent progenitor cells, as
well as for hematopoietic progenitor cells committed to erythroid,
granulocytic, and megakaryocytic lineages. Thus thrombospondins may
be important in blood cell development (Long and Dixit (1990) Blood
75, 2311-2318, incorporated herein by reference).
[0169] GIPF polypeptides and polynucleotides of the invention may
be used to induce proliferation or differentiation of
gastrointestinal crypt cells. They may also be used in the
treatment of conditions where epithelialization is required, such
as for the treatment of gastrointestinal disorders including
chemotherapy and radiation therapy-induced mucositis, mucositis of
the oropharynx, lips and esophagus, inflammatory bowel disease, and
other conditions including wounds, burns, ophthalmic disorders, and
any disorder where stimulation of epithelial cell proliferation or
regeneration is desired. The polynucleotides and polypeptides of
the invention may further be utilized to generate new tissues and
organs that may aid patients in need of transplanted tissues.
4.1 DEFINITIONS
[0170] In describing the present invention the following terms will
be employed and are intended to be defined as indicated below.
[0171] It must be noted that as used herein and in the appended
claims, the singular forms "a", "an" and "the" include plural
references unless the context clearly dictates otherwise.
[0172] The term "GIPF" refers to the "gastrointestinal
proliferative factor" that is particularly active on epithelial
cells.
[0173] In accordance with the present invention, the term "GIPF
protein(s)" or "GIPF polypeptide(s) refers to the full-length
protein defined by amino acids Met.sup.1 to Ala.sup.263 (SEQ ID NO:
4), fragments and analogs thereof.
[0174] The term "full-length GIPF," "long form of GIPF", "wild type
GIPF", or "native GIPF" as used herein all refer to the polypeptide
that contains 263 amino acid residues (SEQ ID NO: 4), as shown in
FIG. 1B.
[0175] The term "GIPFwt" or "hGIPF" refer to the human wild type,
full-length GIPF polypeptide (SEQ ID NO: 4); the term "GIPFt"
refers to the V5His6-tagged polypeptide of human GIPF (SEQ ID NO:
6); and "mGIPFt" refers to the V5His6-tagged GIPF from mouse (SEQ
ID NO: 69).
[0176] The term "fragment" refers to a polypeptide derived from the
native GIPF that does not include the entire sequence of GIPF. Such
a fragment may be a truncated version of the full-length molecule,
for example SEQ ID NO: 9, and 12, as well as an internally deleted
polypeptide, for example SEQ ID NO: 16. A GIPF fragment may have
GIPF bioactivity as determined by the effect of GIPF on the
proliferation of epithelial cells in vitro and/or in vivo, as
described herein.
[0177] The term "analog" refers to derivatives of the reference
molecule. The analog may retain biological activity, as described
above. In general, the term "analog" refers to compounds having a
native polypeptide sequence and structure with one or more amino
acid additions, substitutions (generally conservative in nature)
and/or deletions, relative to the native molecule, so long as the
modifications do not destroy activity. SEQ ID NO: 18 is an example
of a GIPF analog. Preferably, the analog has at least the same
biological activity as the parent molecule, and may even display
enhanced activity over the parent molecule. Methods for making
polypeptide analogs are known in the art. Particularly preferred
analogs include substitutions that are conservative in nature,
i.e., those substitutions that take place within a family of amino
acids that are related in their side chains. Specifically, amino
acids are generally divided into four families: (1) acidic:
aspartate and glutamate; (2) basic: lysine, arginine, histidine;
(3) non-polar: alanine, valine, leucine, isoleucine, proline,
phenylalanine, methionine, tryptophan; and (4) uncharged polar:
glycine, asparagine, glutamine, cysteine, serine, threonine,
tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes
classified as aromatic amino acids. For example, it is reasonably
predictable that an isolated replacement of leucine with isoleucine
or valine, an aspartate with a glutamate, a threonine with a
serine, or a similar conservative replacement of an amino acid with
a structurally related amino acid will preserve the biological
activity of GIPF.
[0178] Guidance in determining which amino acid residues may be
replaced, added or deleted without abolishing activities of
interest, may be found by comparing the sequence of the particular
polypeptide with that of homologous peptides and minimizing the
number of amino acid sequence changes made in regions of high
homology (conserved regions) or by replacing amino acids with
consensus sequence.
[0179] Alternatively, recombinant analogs encoding these same or
similar polypeptides may be synthesized or selected by making use
of the "redundancy" in the genetic code. Various codon
substitutions, such as the silent changes which produce various
restriction sites, may be introduced to optimize cloning into a
plasmid or viral vector or expression in a particular prokaryotic
or eukaryotic system. Mutations in the polynucleotide sequence may
be reflected in the polypeptide or domains of other peptides added
to the polypeptide to modify the properties of any part of the
polypeptide, to change characteristics such as ligand-binding
affinities, interchain affinities, or degradation/turnover
rate.
[0180] Preferably, amino acid "substitutions" are the result of
replacing one amino acid with another amino acid having similar
structural and/or chemical properties, i.e., conservative amino
acid replacements. "Conservative" amino acid substitutions may be
made on the basis of similarity in polarity, charge, solubility,
hydrophobicity, hydrophilicity, and/or the amphipathic nature of
the residues involved. For example, nonpolar (hydrophobic) amino
acids include alanine, leucine, isoleucine, valine, proline,
phenylalanine, tryptophan, and methionine; polar neutral amino
acids include glycine, serine, threonine, cysteine, tyrosine,
asparagine, and glutamine; positively charged (basic) amino acids
include arginine, lysine, and histidine; and negatively charged
(acidic) amino acids include aspartic acid and glutamic acid.
"Insertions" or "deletions" are preferably in the range of about 1
to 20 amino acids, more preferably 1 to 10 amino acids. The
variation allowed may be experimentally determined by
systematically making insertions, deletions, or substitutions of
amino acids in a polypeptide molecule using recombinant DNA
techniques and assaying the resulting recombinant variants for
activity.
[0181] Alternatively, where alteration of function is desired,
insertions, deletions or non-conservative alterations can be
engineered to produce altered polypeptides. Such alterations can,
for example, alter one or more of the biological functions or
biochemical characteristics of the polypeptides of the invention.
For example, such alterations may change polypeptide
characteristics such as ligand-binding affinities, interchain
affinities, or degradation/turnover rate. Further, such alterations
can be selected so as to generate polypeptides that are better
suited for expression, scale up and the like in the host cells
chosen for expression. For example, cysteine residues can be
deleted or substituted with another amino acid residue in order to
eliminate disulfide bridges.
[0182] The term "derivative" refers to polypeptides chemically
modified by such techniques as ubiquitination, labeling (e.g., with
radionuclides or various enzymes), covalent polymer attachment such
as pegylation (derivatization with polyethylene glycol) and
insertion or substitution by chemical synthesis of amino acids such
as ornithine, which do not normally occur in human proteins.
[0183] The terms "polypeptide" and "protein" refer to a polymer of
amino acid residues and are not limited to a minimum length of the
product. The terms also include, unless otherwise indicated,
modifications of the polypeptide that do not change the sequence of
amino acids, for example, glycosylated, acetylated and
phosphorylated forms. A polypeptide or protein, for purposes of the
present invention, may be synthetically or recombinantly produced,
as well as isolated from natural sources.
[0184] By "purified" and "isolated" is meant, when referring to a
polypeptide or polynucleotide, that the indicated molecule is
present in the substantial absence of other biological
macromolecules of the same type. The term "purified" as used herein
preferably means at least 75% by weight, more preferably at least
85% by weight, more preferably still at least 95% by weight, and
most preferably at least 98% by weight, of biological
macromolecules of the same type are present in the sample. In one
embodiment, the polynucleotide or polypeptide is purified such that
it constitutes at least 95% by weight of the indicated biological
macromolecules present but water, buffers, and other small
molecules, especially molecules having a molecular weight of less
than 1000 daltons, can be present.
[0185] An "isolated polynucleotide which encodes a particular
polypeptide" refers to a nucleic acid molecule which is
substantially free of other nucleic acid molecules that do not
encode the subject polypeptide; however, the molecule may include
some additional bases or moieties which do not deleteriously affect
the basic characteristics of the composition.
[0186] The term "naturally occurring polypeptide" refers to
polypeptides produced by cells that have not been genetically
engineered and specifically contemplates various polypeptides
arising from post-translational modifications of the polypeptide
including, but not limited to, acetylation, carboxylation,
glycosylation, phosphorylation, lipidation and acylation.
[0187] The term "translated protein coding portion" means a
sequence which encodes for the full length protein which may
include any leader sequence or a processing sequence.
[0188] The term "dominant mature protein coding sequence" refers to
a sequence which encodes a peptide or protein without any
leader/signal sequence. The "dominant mature protein portion"
refers to that portion of the protein without the leader/signal
sequence. The "mature" form refers to a GIPF polypeptide that lacks
the leader/signal sequence and the furin cleavage site. The peptide
may have the leader sequence and/or the furin cleavage site removed
during processing in the cell or the protein may have been produced
synthetically or using a polynucleotide only encoding for the
mature protein coding sequence. It is contemplated that the mature
or dominant mature protein portion may or may not include an
initial methionine residue. The initial methionine is often removed
during processing of the peptide.
[0189] The term "isolated" as used herein refers to a nucleic acid
or polypeptide separated from at least one other component (e.g.,
nucleic acid or polypeptide) present with the nucleic acid or
polypeptide in its natural source. In one embodiment, the nucleic
acid or polypeptide is found in the presence of (if anything) only
a solvent, buffer, ion, or other components normally present in a
solution of the same. The terms "isolated" and "purified" do not
encompass nucleic acids or polypeptides present in their natural
source.
[0190] The term "recombinant," when used herein to refer to a
polypeptide or protein, means that a polypeptide or protein is
derived from recombinant (e.g., microbial, insect, or mammalian)
expression systems. "Microbial" refers to recombinant polypeptides
or proteins made in bacterial or fungal (e.g., yeast) expression
systems. As a product, "recombinant microbial" defines a
polypeptide or protein essentially free of native endogenous
substances and unaccompanied by associated native glycosylation.
Polypeptides or proteins expressed in most bacterial cultures,
e.g., E. coli, will be free of glycosylation modifications;
polypeptides or proteins expressed in yeast will have a
glycosylation pattern in general different from those expressed in
mammalian cells.
[0191] By a "recombinant polypeptide" is intended a polypeptide
which has been prepared by recombinant DNA techniques as described
herein. In general, the gene coding for the desired polypeptide is
cloned and then expressed in transformed organisms, as described
farther below. The host organism expresses the foreign gene to
produce the polypeptide under expression conditions. Alternatively,
the promoter controlling expression of an endogenous polypeptide
can be altered to render a recombinant polypeptide.
[0192] The term "active" refers to those forms of the polypeptide
that retain the biologic and/or immunologic activities of any
naturally occurring polypeptide. According to the invention, the
terms "biologically active" or "biological activity" refer to a
protein or peptide having structural, regulatory or biochemical
functions of a naturally occurring molecule. Likewise "biologically
active" or "biological activity" refers to the capability of the
natural, recombinant or synthetic GIPF peptide, or any peptide
thereof, to induce a specific biological response in appropriate
animals or cells and to bind with specific antibodies.
[0193] The term "secreted" includes a protein that is transported
across or through a membrane, including transport as a result of
signal sequences in its amino acid sequence when it is expressed in
a suitable host cell. "Secreted" proteins include without
limitation proteins secreted wholly (e.g., soluble proteins) or
partially (e.g., receptors) from the cell in which they are
expressed. "Secreted" proteins also include without limitation
proteins that are transported across the membrane of the
endoplasmic reticulum. "Secreted" proteins are also intended to
include proteins containing non-typical signal sequences (e.g.
Interleukin-1 Beta, see Krasney, P. A. and Young, P. R. (1992)
Cytokine 4(2):134-143) and factors released from damaged cells
(e.g. Interleukin-1 Receptor Antagonist, see Arend, W. P. et. al.
(1998) Annu. Rev. Immunol. 16:27-55)
[0194] The term "polynucleotide" or "nucleic acid molecule" as used
herein refers to a polymeric form of nucleotides of any length,
either ribonucleotides or deoxyribonucleotides. This term refers
only to the primary structure of the molecule and thus includes
double- and single-stranded DNA and RNA. It also includes known
types of modifications, for example, labels which are known in the
art, methylation, "caps", substitution of one or more of the
naturally occurring nucleotides with an analog, internucleotide
modifications such as, for example, those with uncharged linkages
(e.g., methyl phosphonates, phosphotriesters, phosphoamidates,
carbamates, etc.) and with charged linkages (e.g.,
phosphorothioates, phosphorodithioates, etc.), those containing
pendant moieties, such as, for example proteins (including for
e.g., nucleases, toxins, antibodies, signal peptides,
poly-L-lysine, etc.), those with intercalators (e.g., acridine,
psoralen, etc.), those containing chelates (e.g., metals,
radioactive metals, boron, oxidative metals, etc.), those
containing alkylators, those with modified linkages (e.g., alpha
anomeric nucleic acids, etc.), as well as unmodified forms of the
polynucleotide. Generally, nucleic acid segments provided by this
invention may be assembled from fragments of the genome and short
oligonucleotide linkers, or from a series of oligonucleotides, or
from individual nucleotides, to provide a synthetic nucleic acid
which is capable of being expressed in a recombinant
transcriptional unit comprising regulatory elements derived from a
microbial or viral operon, or a eukaryotic gene.
[0195] The terms "oligonucleotide fragment" or a "polynucleotide
fragment", "portion," or "segment" or "probe" or "primer" are used
interchangeably and refer to a sequence of nucleotide residues
which are at least about 5 nucleotides, more preferably at least
about 7 nucleotides, more preferably at least about 9 nucleotides,
more preferably at least about 11 nucleotides and most preferably
at least about 17 nucleotides. The fragment is preferably less than
about 500 nucleotides, preferably less than about 200 nucleotides,
more preferably less than about 100 nucleotides, more preferably
less than about 50 nucleotides and most preferably less than 30
nucleotides. Preferably the probe is from about 6 nucleotides to
about 200 nucleotides, preferably from about 15 to about 50
nucleotides, more preferably from about 17 to 30 nucleotides and
most preferably from about 20 to 25 nucleotides. Preferably the
fragments can be used in polymerase chain reaction (PCR), various
hybridization procedures or microarray procedures to identify or
amplify identical or related parts of mRNA or DNA molecules. A
fragment or segment may uniquely identify each polynucleotide
sequence of the present invention. Preferably the fragment
comprises a sequence substantially similar to a portion of SEQ ID
NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 84, 86, 88, 90, 92, 94, 96, 98,
100, 102, 104 or 177.
[0196] Probes may, for example, be used to determine whether
specific mRNA molecules are present in a cell or tissue or to
isolate similar nucleic acid sequences from chromosomal DNA as
described by Walsh et al. (Walsh, P. S. et al., 1992, PCR Methods
Appl 1:241-250). They may be labeled by nick translation, Klenow
fill-in reaction, PCR, or other methods well known in the art.
Probes of the present invention, their preparation and/or labeling
are elaborated in Sambrook, J. et al., 1989, Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory, NY; or Ausubel,
F. M. et al., 1989, Current Protocols in Molecular Biology, John
Wiley & Sons, New York N.Y., both of which are incorporated
herein by reference in their entirety.
[0197] The nucleic acid sequences of the present invention also
include the sequence information from any of the nucleic acid
sequences of SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 84, 86, 88,
90, 92, 94, 96, 98, 100, 102, 104 or 177. The sequence information
can be a segment of SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 84,
86, 88, 90, 92, 94, 96, 98, 100, 102, 104 or 177 that uniquely
identifies or represents the sequence information of SEQ ID NO: 1,
2, 5, 7, 9, 11, 13, 15, 17, 84, 86, 88, 90, 92, 94, 96, 98, 100,
102, 104 or 177. One such segment can be a twenty-mer nucleic acid
sequence because the probability that a twenty-mer is fully matched
in the human genome is 1 in 300. In the human genome, there are
three billion base pairs in one set of chromosomes. Because
4.sup.20 possible twenty-mers exist, there are 300 times more
twenty-mers than there are base pairs in a set of human
chromosomes. Using the same analysis, the probability for a
seventeen-mer to be fully matched in the human genome is
approximately 1 in 5. When these segments are used in arrays for
expression studies, fifteen-mer segments can be used. The
probability that the fifteen-mer is fully matched in the expressed
sequences is also approximately one in five because expressed
sequences comprise less than approximately 5% of the entire genome
sequence.
[0198] Similarly, when using sequence information for detecting a
single mismatch, a segment can be a twenty-five mer. The
probability that the twenty-five mer would appear in a human genome
with a single mismatch is calculated by multiplying the probability
for a full match (1/4.sup.25) times the increased probability for
mismatch at each nucleotide position (3.times.25). The probability
that an eighteen mer with a single mismatch can be detected in an
array for expression studies is approximately one in five. The
probability that a twenty-mer with a single mismatch can be
detected in a human genome is approximately one in five.
[0199] The term "open reading frame," ORF, means a series of
nucleotide triplets coding for amino acids without any termination
codons and is a sequence translatable into protein.
[0200] The terms "operably linked" or "operably associated" refer
to functionally related nucleic acid sequences. For example, a
promoter is operably associated or operably linked with a coding
sequence if the promoter controls the transcription of the coding
sequence. While operably linked nucleic acid sequences can be
contiguous and in the same reading frame, certain genetic elements
e.g. repressor genes are not contiguously linked to the coding
sequence but still control transcription/translation of the coding
sequence.
[0201] The terms "recombinant DNA molecule," or "recombinant
polynucleotide" are used herein to refer to a polynucleotide of
genomic, cDNA, semisynthetic, or synthetic origin which, by virtue
of its origin or manipulation: (1) is not associated with all or a
portion of a polynucleotide with which it is associated in nature,
(2) is linked to a polynucleotide other than that to which it is
linked in nature, or (3) does not occur in nature. Thus, the term
encompasses "synthetically derived" nucleic acid molecules.
[0202] The terms "complementary" or "complementarity" refer to the
natural binding of polynucleotides by base pairing. For example,
the sequence 5'-AGT-3' binds to the complementary sequence
3'-TCA-5'. Complementarity between two single-stranded molecules
may be "partial" such that only some of the nucleic acids bind or
it may be "complete" such that total complementarity exists between
the single stranded molecules. The degree of complementarity
between the nucleic acid strands has significant effects on the
efficiency and strength of the hybridization between the nucleic
acid strands.
[0203] The term "stringent" is used to refer to conditions that are
commonly understood in the art as stringent. Stringent conditions
can include highly stringent conditions (i.e., hybridization to
filter-bound DNA in 0.5 M NaHPO.sub.4, 7% sodium dodecyl sulfate
(SDS), 1 mM EDTA at 65.degree. C., and washing in
0.1.times.SSC/0.1% SDS at 68.degree. C.), and moderately stringent
conditions (i.e., washing in 0.2.times.SSC/0.1% SDS at 42.degree.
C.). Other exemplary hybridization conditions are described herein
in the examples.
[0204] In instances of hybridization of deoxyoligonucleotides,
additional exemplary stringent hybridization conditions include
washing in 6.times.SSC/0.05% sodium pyrophosphate at 37.degree. C.
(for 14-base oligonucleotides), 48.degree. C. (for 17-base
oligonucleotides), 55.degree. C. (for 20-base oligonucleotides),
and 60.degree. C. (for 23-base oligonucleotides).
[0205] As used herein, "substantially equivalent" can refer both to
nucleotide and amino acid sequences, for example a mutant sequence,
that varies from a reference sequence by one or more substitutions,
deletions, or additions, the net effect of which does not result in
an adverse functional dissimilarity between the reference and
subject sequences. Typically, such a substantially equivalent
sequence varies from one of those listed herein by no more than
about 35% (i.e., the number of individual residue substitutions,
additions, and/or deletions in a substantially equivalent sequence,
as compared to the corresponding reference sequence, divided by the
total number of residues in the substantially equivalent sequence
is about 0.35 or less). Such a sequence is said to have 65%
sequence identity to the listed sequence. In one embodiment, a
substantially equivalent, e.g., mutant, sequence of the invention
varies from a listed sequence by no more than 30% (70% sequence
identity); in a variation of this embodiment, by no more than 25%
(75% sequence identity); and in a further variation of this
embodiment, by no more than 20% (80% sequence identity) and in a
further variation of this embodiment, by no more than 10% (90%
sequence identity) and in a further variation of this embodiment,
by no more that 5% (95% sequence identity). Substantially
equivalent, e.g., mutant, amino acid sequences according to the
invention preferably have at least 80% sequence identity with a
listed amino acid sequence, more preferably at least 90% sequence
identity. Substantially equivalent nucleotide sequence of the
invention can have lower percent sequence identities, taking into
account, for example, the redundancy or degeneracy of the genetic
code. Preferably, nucleotide sequence has at least about 65%
identity, more preferably at least about 75% identity, and most
preferably at least about 95% identity. For the purposes of the
present invention, sequences having substantially equivalent
biological activity and substantially equivalent expression
characteristics are considered substantially equivalent. For the
purposes of determining equivalence, truncation of the mature
sequence (e.g., via a mutation which creates a spurious stop codon)
should be disregarded. Sequence identity may be determined, e.g.,
using the Jotun Hein method (Hein, J. (1990) Methods Enzymol.
183:626-645). Identity between sequences can also be determined by
other methods known in the art, e.g. by varying hybridization
conditions.
[0206] The term "vector" refers to a nucleic acid molecule capable
of transporting another nucleic acid to which it has been linked.
The term "expression vector" includes plasmids, cosmids or phages
capable of synthesizing the GIPF protein encoded by the respective
recombinant gene carried by the vector. Preferred vectors are those
capable of autonomous replication and expression of nucleic acids
to which they are linked.
[0207] The term "transformation" means introducing DNA into a
suitable host cell so that the DNA is replicable, either as an
extrachromosomal element, or by chromosomal integration.
[0208] The term "transfection" refers to the taking up of an
expression vector by a suitable host cell, whether or not any
coding sequences are in fact expressed. The term "infection" refers
to the introduction of nucleic acids into a suitable host cell by
use of a virus or viral vector.
[0209] The term "transcriptional regulatory elements" and
transcriptional regulatory sequences" are used interchangeably to
refer to DNA sequences necessary for the expression of an operably
linked coding sequence in a particular organism. The control
sequences that are suitable for prokaryotes, for example, include a
promoter, optionally an operator sequence, and a ribosome binding
site. Eukaryotic cells are known to utilize promoters, enhancers,
splicing signals and polyadenylation signals. These terms are
intended to encompass all elements that promote or regulate
transcription, including promoters, core elements required for
basic interaction of RNA polymerase and transcription factors,
upstream elements, enhancers, and response elements (Lewin, "Genes
V" (Oxford University Press, Oxford) pages 847-873).
[0210] A coding sequence is "under the control" of transcriptional
and translational control sequences in a cell when RNA polymerase
transcribes the coding sequence into mRNA, which is then optionally
trans-RNA spliced and translated into the protein encoded by the
coding sequence.
[0211] The term "tissue-specific promoter" means a nucleotide
sequence that serves as a promoter, i.e. regulates expression of a
selected DNA sequence operably linked to the promoter, and which
effects the expression of the selected DNA sequence in specific
cells, such as B-cells. In an illustrative embodiment, gene
constructs utilizing B-cell specific promoters can be used to
preferentially direct expression of a GIPF protein or protein
fragment in B-cells.
[0212] The term "expression modulating fragment," EMF, means a
series of nucleotides that modulates the expression of an operably
linked ORF or another EMF.
[0213] As used herein, a sequence is said to "modulate the
expression of an operably linked sequence" when the expression of
the sequence is altered by the presence of the EMF. EMFs include,
but are not limited to, promoters, and promoter modulating
sequences (inducible elements). One class of EMFs is nucleic acid
fragments which induce the expression of an operably linked ORF in
response to a specific regulatory factor or physiological
event.
[0214] The term "recombinant expression vehicle or vector" refers
to a plasmid or phage or virus or vector, for expressing a
polypeptide from a DNA (RNA) sequence. An expression vehicle can
comprise a transcriptional unit comprising an assembly of (1) a
genetic element or elements having a regulatory role in gene
expression, for example, promoters or enhancers, (2) a structural
or coding sequence which is transcribed into mRNA and translated
into protein, and (3) appropriate transcription initiation and
termination sequences. Structural units intended for use in yeast
or eukaryotic expression systems preferably include a leader
sequence enabling extracellular secretion of translated protein by
a host cell. Alternatively, where recombinant protein is expressed
without a leader or transport sequence, it may include an amino
terminal methionine residue. This residue may or may not be
subsequently cleaved from the expressed recombinant protein to
provide a final product.
[0215] The term "recombinant expression system" means host cells
which have stably integrated a recombinant transcriptional unit
into chromosomal DNA or carry the recombinant transcriptional unit
extrachromosomally. Recombinant expression systems as defined
herein will express heterologous polypeptides or proteins upon
induction of the regulatory elements linked to the DNA segment or
synthetic gene to be expressed. This term also means host cells
which have stably integrated a recombinant genetic element or
elements having a regulatory role in gene expression, for example,
promoters or enhancers. Recombinant expression systems as defined
herein will express polypeptides or proteins endogenous to the cell
upon induction of the regulatory elements linked to the endogenous
DNA segment or gene to be expressed. The cells can be prokaryotic
or eukaryotic.
[0216] The term "transgene" refers to a nucleic acid sequence which
is partly or entirely heterologous i.e. foreign, to the transgenic
animal or cell into which it is introduced, or, is homologous to an
endogenous gene of the transgenic animal or cell into which it is
introduced, but which is designed to be inserted, or is inserted
into the animal's genome in such a way as to alter the genome of
the cell into which it is inserted. e.g. it is inserted at a
location which differs from that of the natural gene). A transgene
can be operably linked to one or more transcriptional regulatory
sequences and any other nucleic acids, such as introns, that may be
necessary for optimal expression of a selected nucleic acid.
[0217] Accordingly, a "transgene construct" refers to a nucleic
acid which includes a transgene, and optionally such other nucleic
acid sequences as transcriptionally regulatory sequences,
polyadenylation sites, replication origins, marker genes etc. which
may be useful in the general manipulation of the transgene for
insertion in the genome of a host organism.
[0218] The term "transgenic" is used herein as an adjective to
describe the property, for example, of an animal or construct, of
harboring a transgene. For instance, as used herein, a "transgenic
organism" is any animal, preferably a non-human mammal, in which
one or more of the cells of the animal contain heterologous nucleic
acids introduced by way of human intervention, such as by
transgenic techniques known in the art. The nucleic acid is
introduced into the cell, directly, or indirectly by introduction
into a precursor of the cell, by way of a deliberate genetic
manipulation, such as by microinjection or by infection with a
recombinant virus. The nucleic acid may be integrated within a
chromosome, or it may be extrachromosomally replicating DNA. In the
transgenic animals described herein, the transgene causes cells to
express or overexpress GIPF proteins.
[0219] The term "pluripotent" refers to the capability of a cell to
differentiate into a number of differentiated cell types that are
present in an adult organism. A pluripotent cell is restricted in
its differentiation capability in comparison to a totipotent
cell.
[0220] The term "embryonic stem cells (ES)" refers to a cell that
can give rise to many differentiated cell types in an embryo or an
adult, including the germ cells. The term "germ line stem cells
(GSCs)" refers to stem cells derived from primordial stem cells
that provide a steady and continuous source of germ cells for the
production of gametes. The term "primordial germ cells (PGCs)"
refers to a small population of cells set aside from other cell
lineages particularly from the yolk sac, mesenteries, or gonadal
ridges during embryogenesis that have the potential to
differentiate into germ cells and other cells. PGCs are the source
from which GSCs and ES cells are derived. The PGCs, the GSCs and
the ES cells are capable of self-renewal. Thus these cells not only
populate the germ line and give rise to a plurality of terminally
differentiated cells that comprise the adult specialized organs,
but are able to regenerate themselves. The term "totipotent" refers
to the capability of a cell to differentiate into all of the cell
types of an adult organism. The term "pluripotent" refers to the
capability of a cell to differentiate into a number of
differentiated cell types that are present in an adult organism. A
pluripotent cell is restricted in its differentiation capability in
comparison to a totipotent cell.
[0221] The terms "founder line" and "founder animal" refer to those
animals that are the mature product of the embryos to which the
transgene was added i.e. those animals that grew from the embryos
into which DNA was inserted and that were implanted into one or
more surrogate hosts.
[0222] The terms "progeny" and "progeny of the transgenic animal"
refer to any and all offspring of every generation subsequent to
the originally transformed mammals.
[0223] The term "non-human mammal" refers to all members of the
class Mammalia except humans. "Mammal" refers tot any animal
classified as a mammal, including humans, domestic and farm
animals, and zoo, sports, or pet animals, such as a mouse, rat,
rabbit, pig, sheep, goat, cattle and higher primates.
[0224] The terms "treat" or "treatment" refer to both therapeutic
and prophylactic or preventative measures, wherein the object is to
prevent or lessen an undesired physiological change or condition,
such as chemotherapy or radiation therapy-induced mucositis. For
the purposes of this invention, beneficial or desired clinical
results include, but are not limited to alleviation of symptoms,
diminishment of extent of the disease, stabilized state of the
disease, whether detectable or undetectable.
[0225] A "disorder" is any condition that would benefit from
treatment with a molecule identified using the transgenic animal
model of the invention. This includes chronic and acute disorders
or diseases including those pathological conditions which
predispose the mammal to the disorder in question. Non-limiting
examples of disorders to be treated herein include mucositis,
inflammatory bowel disease and skin lesions. A preferred disorder
to be treated in accordance with the present invention is
mucositis.
[0226] "Inflammatory bowel disease (IBD)" herein refers to
idiopathic or chronic inflammatory disease of either or both the
small intestine and large bowel, and includes Crohn's disease,
ulcerative colitis, IBD caused by infectious agents, and antibiotic
associated IBD.
[0227] "Mucositis" herein refers to inflammation of the mucous
membranes of the alimentary tract including the oropharynx and
lips, esophagus, and large and small intestine.
[0228] "Short Bowel Syndrome" or "SBS" herein refers to a condition
of nutritional malabsorption resulting from anatomical or
functional loss of a significant length of the small intestine.
[0229] The terms "effective amount" or "pharmaceutically effective
amount" refer to a nontoxic but sufficient amount of the agent to
provide the desired biological result. That result can be reduction
and/or alleviation of the signs, symptoms, or causes of a disease,
or any other desired alteration of a biological system. For
example, an effective amount of a GIPF fragment for use with the
present methods is an amount sufficient to stimulate epithelial
cell stimulation or proliferation, and preferably an amount
sufficient to cause increased regeneration of the gastrointestinal
epithelium in a subject suffering from chemotherapy or radiation
therapy-induced mucositis, inflammatory bowel disease, or other
disorders where epithelial cell proliferation is desired. Such
amounts are described below. An appropriate "effective" amount in
any individual case may be determined by one of ordinary skill in
the art using routine experimentation.
[0230] By "pharmaceutically acceptable" or "pharmacologically
acceptable" is meant a material which is not biologically or
otherwise undesirable, i.e., the material may be administered to an
individual without causing any undesirable biological effects or
interacting in a deleterious manner with any of the components of
the composition in which it is contained.
[0231] By "physiological pH" or a "pH in the physiological range"
is meant a pH in the range of approximately 7.0 to 8.0 inclusive.
Preferred physiological pH is in the range of approximately 7.2 to
7.6 inclusive.
[0232] As used herein, the term "subject" encompasses mammals and
non-mammals. Examples of mammals include, but are not limited to,
any member of the Mammalia class: humans, non-human primates such
as chimpanzees, and other apes and monkey species; farm animals
such as cattle, horses, sheep, goats, swine; domestic animals such
as rabbits, dogs, and cats; laboratory animals including rodents,
such as rats, mice and guinea pigs, and the like. Examples of
non-mammals include, but are not limited to, birds, fish and the
like. The term does not denote a particular age or gender.
4.2 COMPOSITIONS OF THE INVENTION
[0233] 4.2.1 Nucleic Acid Compositions
[0234] The invention is based on the discovery that compositions
comprising the epithelial cell growth factor polypeptide, GIPF, and
the polynucleotides encoding the GIPF polypeptide stimulate the
growth and proliferation of intestinal epithelial cells including
crypt cells. Therefore, the use of these compositions for the
diagnosis and treatment of conditions wherein stimulation of
epithelial cell proliferation or regeneration is desired, is
contemplated.
[0235] The isolated polynucleotides of the invention include, but
are not limited to a polynucleotide comprising any of the
nucleotide sequences of SEQ ID NO: 2, 3, 5, 7, 9, 11, 13, 15, 17,
84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104 or 177; a
polynucleotide comprising the full length protein coding sequence
of SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 84, 86, 88, 90, 92, 94,
96, 98, 100, 102, 104 or 177; (for example coding for SEQ ID NO: 4,
6, 8, 10, 12, 14, 16, 18, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103,
105 or 178); and a polynucleotide comprising the nucleotide
sequence encoding the mature and dominant mature protein coding
sequence of the polypeptide of SEQ ID NO: 4. The polynucleotides of
the present invention also include, but are not limited to, a
polynucleotide that hybridizes under stringent conditions to (a)
the complement of any of the nucleotides sequences of SEQ ID NO: 2,
3, 5, 7, 9, 11, 13, 15, 17, 84, 86, 88, 90, 92, 94, 96, 98, 100,
102, 104 or 177; (b) a polynucleotide encoding any one of the
polypeptides of SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 85, 87, 89,
91, 93, 95, 97, 99, 101, 103, 105 or 178; (c) a polynucleotide
which is an allelic variant of any polynucleotides recited above;
(d) a polynucleotide which encodes a species homolog of any of the
proteins recited above; or (e) a polynucleotide that encodes a
polypeptide comprising a specific domain or truncation of the
polypeptides of SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 85, 87, 89,
91, 93, 95, 97, 99, 101, 103, 105 or 178. Domains of interest
include extracellular, transmembrane, or cytoplasmic domains, or
combinations thereof; and catalytic and substrate binding
domains.
[0236] The polynucleotides of the invention include naturally
occurring or wholly or partially synthetic DNA, e.g., cDNA and
genomic DNA, and RNA, e.g., mRNA. The polynucleotides may include
all of the coding region of the cDNA or may represent a portion of
the coding region of the cDNA.
[0237] The present invention also provides compositions comprising
genes corresponding to the cDNA sequences disclosed herein. The
corresponding genes can be isolated in accordance with known
methods using the sequence information disclosed herein. Such
methods include the preparation of probes or primers from the
disclosed sequence information for identification and/or
amplification of genes in appropriate genomic libraries or other
sources of genomic materials. Further 5' and 3' sequence can be
obtained using methods known in the art. For example, full length
cDNA or genomic DNA that corresponds to any of the polynucleotide
of SEQ ID NO: 2 can be obtained by screening appropriate cDNA or
genomic DNA libraries under suitable hybridization conditions using
any of the polynucleotides of SEQ ID NO: 2, 3, 5, 7, 9, 11, 13, 15,
17, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104 or 177 or a
portion thereof as a probe. Alternatively, the polynucleotides of
SEQ ID NO: 2, 3, 5, 7, 9, 11, 13, 15, 17, 84, 86, 88, 90, 92, 94,
96, 98, 100, 102, 104 or 177 may be used as the basis for suitable
primer(s) that allow identification and/or amplification of genes
in appropriate genomic DNA or cDNA libraries.
[0238] The nucleic acid sequences of the invention can be assembled
from ESTs and sequences (including cDNA and genomic sequences)
obtained from one or more public databases, such as dbEST, gbpri,
and UniGene. The EST sequences can provide identifying sequence
information, representative fragment or segment information, or
novel segment information for the full-length gene.
[0239] The polynucleotides of the invention also provide
polynucleotides including nucleotide sequences that are
substantially equivalent to the polynucleotides recited above.
Polynucleotides according to the invention can have, e.g., at least
about 65%, at least about 70%, at least about 75%, at least about
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more typically
at least about 90%, 91%, 92%, 93%, or 94% and even more typically
at least about 95%, 96%, 97%, 98% or 99% sequence identity to a
polynucleotide recited above.
[0240] Included within the scope of the nucleic acid sequences of
the invention are nucleic acid sequence fragments that hybridize
under stringent conditions to any of the nucleotide sequences of
SEQ ID NO: 1, 6, 8, 10, 12, 14, 17, 84, 86, 88, 90, 92, 94, 96, 98,
100, 102, 104 or 177, or complements thereof, which fragment is
greater than about 5 nucleotides, preferably 7 nucleotides, more
preferably greater than 9 nucleotides and most preferably greater
than 17 nucleotides. Fragments of, e.g. 15, 17, or 20 nucleotides
or more that are selective for (i.e. specifically hybridize to any
one of the polynucleotides of the invention) are contemplated.
Probes capable of specifically hybridizing to a polynucleotide can
differentiate polynucleotide sequences of the invention from other
polynucleotide sequences in the same family of genes or can
differentiate human genes from genes of other species, and are
preferably based on unique nucleotide sequences.
[0241] The sequences falling within the scope of the present
invention are not limited to these specific sequences, but also
include allelic and species variations thereof. Allelic and species
variations can be routinely determined by comparing the sequence
provided in SEQ ID NO: 2, 3, 5, 7, 9, 11, 13, 15, 17, 84, 86, 88,
90, 92, 94, 96, 98, 100, 102, 104 or 177, a representative fragment
thereof, or a nucleotide sequence at least 90% identical,
preferably 95% identical, to SEQ ID NO: 2, 3, 5, 7, 9, 11, 13, 15,
17, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104 or 177 with a
sequence from another isolate of the same species. Furthermore, to
accommodate codon variability, the invention includes nucleic acid
molecules coding for the same amino acid sequences as do the
specific ORFs disclosed herein. In other words, in the coding
region of an ORF, substitution of one codon for another codon that
encodes the same amino acid is expressly contemplated.
[0242] The nearest neighbor result for the nucleic acids of the
present invention can be obtained by searching a database using an
algorithm or a program. Preferably, a BLAST which stands for Basic
Local Alignment Search Tool is used to search for local sequence
alignments (Altshul, S. F. J Mol. Evol. 36 290-300 (1993) and
Altschul S. F. et al. J. Mol. Biol. 21:403-410 (1990))
[0243] Species homologs (or orthologs) of the disclosed
polynucleotides and proteins are also provided by the present
invention. Species homologs may be isolated and identified by
making suitable probes or primers from the sequences provided
herein and screening a suitable nucleic acid source from the
desired species.
[0244] The invention also encompasses allelic variants of the
disclosed polynucleotides or proteins; that is, naturally-occurring
alternative forms of the isolated polynucleotide which also encodes
proteins which are identical, homologous or related to that encoded
by the polynucleotides.
[0245] The nucleic acid sequences of the invention are further
directed to sequences which encode analogs of the described nucleic
acids. These amino acid sequence analogs may be prepared by methods
known in the art by introducing appropriate nucleotide changes into
a native or variant polynucleotide. There are two variables in the
construction of amino acid sequence variants: the location of the
mutation and the nature of the mutation. Nucleic acids encoding the
amino acid sequence analogs are preferably constructed by mutating
the polynucleotide to encode an amino acid sequence that does not
occur in nature. These nucleic acid alterations can be made at
sites that differ in the nucleic acids from different species
(variable positions) or in highly conserved regions (constant
regions). Sites at such locations will typically be modified in
series, e.g., by substituting first with conservative choices
(e.g., hydrophobic amino acid to a different hydrophobic amino
acid) and then with more distant choices (e.g., hydrophobic amino
acid to a charged amino acid), and then deletions or insertions may
be made at the target site. Amino acid sequence deletions generally
range from about 1 to 30 residues, preferably about 1 to 10
residues, and are typically contiguous. Amino acid insertions
include amino- and/or carboxyl-terminal fusions ranging in length
from one to one hundred or more residues, as well as intrasequence
insertions of single or multiple amino acid residues. Intrasequence
insertions may range generally from about 1 to 10 amino residues,
preferably from 1 to 5 residues. Examples of terminal insertions
include the heterologous signal sequences necessary for secretion
or for intracellular targeting in different host cells and
sequences such as poly-histidine sequences useful for purifying the
expressed protein.
[0246] In a preferred method, polynucleotides encoding the novel
amino acid sequences are changed via site-directed mutagenesis.
This method uses oligonucleotide sequences to alter a
polynucleotide to encode the desired amino acid variant, as well as
sufficient adjacent nucleotides on both sides of the changed amino
acid to form a stable duplex on either side of the site being
changed. In general, the techniques of site-directed mutagenesis
are well known to those of skill in the art and this technique is
exemplified by publications such as, Edelman et al., DNA 2:183
(1983). A versatile and efficient method for producing
site-specific changes in a polynucleotide sequence was published by
Zoller and Smith, Nucleic Acids Res. 10:6487-6500 (1982). PCR may
also be used to create amino acid sequence variants of the novel
nucleic acids. When small amounts of template DNA are used as
starting material, primer(s) that differs slightly in sequence from
the corresponding region in the template DNA can generate the
desired amino acid variant. PCR amplification results in a
population of product DNA fragments that differ from the
polynucleotide template encoding the polypeptide at the position
specified by the primer. The product DNA fragments replace the
corresponding region in the plasmid and this gives a polynucleotide
encoding the desired amino acid variant.
[0247] A further technique for generating amino acid variants is
the cassette mutagenesis technique described in Wells et al., Gene
34:315 (1985); and other mutagenesis techniques well known in the
art, such as, for example, the techniques in Sambrook et al.,
supra, and Current Protocols in Molecular Biology, Ausubel et al.
Due to the inherent degeneracy of the genetic code, other DNA
sequences which encode substantially the same or a functionally
equivalent amino acid sequence may be used in the practice of the
invention for the cloning and expression of these novel nucleic
acids. Such DNA sequences include those which are capable of
hybridizing to the appropriate novel nucleic acid sequence under
stringent conditions.
[0248] Polynucleotides encoding preferred polypeptide truncations
of the invention can be used to generate polynucleotides encoding
chimeric or fusion proteins comprising one or more domains of the
invention and heterologous protein sequences.
[0249] The polynucleotides of the invention additionally include
the complement of any of the polynucleotides recited above. The
polynucleotide can be DNA (genomic, cDNA, amplified, or synthetic)
or RNA. Methods and algorithms for obtaining such polynucleotides
are well known to those of skill in the art and can include, for
example, methods for determining hybridization conditions that can
routinely isolate polynucleotides of the desired sequence
identities.
[0250] In accordance with the invention, polynucleotide sequences
comprising the dominant mature or mature protein coding sequences,
coding for any one of SEQ ID NO: 6 or 8, or functional equivalents
thereof, may be used to generate recombinant DNA molecules that
direct the expression of that nucleic acid, or a functional
equivalent thereof, in appropriate host cells. Also included are
the cDNA inserts of any of the clones identified herein.
[0251] A polynucleotide according to the invention can be joined to
any of a variety of other nucleotide sequences by well-established
recombinant DNA techniques (see Sambrook J et al. (1989) Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, NY).
Useful nucleotide sequences for joining to polynucleotides include
an assortment of vectors, e.g., plasmids, cosmids, lambda phage
derivatives, phagemids, and the like, that are well known in the
art. Accordingly, the invention also provides a vector including a
polynucleotide of the invention and a host cell containing the
polynucleotide. In general, the vector contains an origin of
replication functional in at least one organism, convenient
restriction endonuclease sites, and a selectable marker for the
host cell. Vectors according to the invention include expression
vectors, replication vectors, probe generation vectors, and
sequencing vectors. A host cell according to the invention can be a
prokaryotic or eukaryotic cell and can be a unicellular organism or
part of a multicellular organism.
[0252] The present invention further provides recombinant
constructs comprising a nucleic acid having any of the nucleotide
sequences of SEQ ID NO: 2, 3, 5, 7, 9, 11, 13, 15, 17, 84, 86, 88,
90, 92, 94, 96, 98, 100, 102, 104 or 177 or a fragment thereof or
any other GIPF polynucleotides. In one embodiment, the recombinant
constructs of the present invention comprise a vector, such as a
plasmid or viral vector, into which a nucleic acid having any of
the nucleotide sequences of SEQ ID NO: 2, 3, 5, 7, 9, 11, 13, 15,
17, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104 or 177 or a
fragment thereof is inserted. In the case of a vector comprising
one of the ORFs of the present invention, the vector may further
comprise regulatory sequences, including for example, a promoter,
operably linked to the ORF. Large numbers of suitable vectors and
promoters are known to those of skill in the art and are
commercially available for generating the recombinant constructs of
the present invention. The following vectors are provided by way of
example. Bacterial: pBs, phagescript, PsiX174, pBluescript SK, pBs
KS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene); pTrc99A, pKK223-3,
pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLneo, pSV2cat,
pOG44, PXTI, pSG (Stratagene) pSVK3, pBPV, pMSG, and pSVL
(Pharmacia). In one embodiment, the nucleic acid of SEQ ID NO: 3 is
inserted in the CKP2KI vector of the invention as described in the
examples.
[0253] The isolated polynucleotide of the invention may be operably
linked to an expression control sequence such as the pMT2 or pED
expression vectors disclosed in Kaufman et al., Nucleic Acids Res.
19, 4485-4490 (1991), in order to produce the protein
recombinantly. Many suitable expression control sequences are known
in the art. General methods of expressing recombinant proteins are
also known and are exemplified in R. Kaufman, Methods in Enzymology
185, 537-566 (1990). As defined herein "operably linked" means that
the isolated polynucleotide of the invention and an expression
control sequence are situated within a vector or cell in such a way
that the protein is expressed by a host cell which has been
transformed (transfected) with the ligated
polynucleotide/expression control sequence.
[0254] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are pKK232-8 and pCM7.
Particular named bacterial promoters include lac, lacZ, T3, T7,
gpt, lambda PR, and trc. Eukaryotic promoters include CMV immediate
early, HSV thymidine kinase, early and late SV40, LTRs from
retrovirus, and mouse metallothionein-1. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art. Generally, recombinant expression
vectors will include origins of replication and selectable markers
permitting transformation of the host cell, e.g., the ampicillin
resistance gene of E. coli and S. cerevisiae TRP1 gene, and a
promoter derived from a highly expressed gene to direct
transcription of a downstream structural sequence. Such promoters
can be derived from operons encoding glycolytic enzymes such as
3-phosphoglycerate kinase (PGK), a-factor, acid phosphatase, or
heat shock proteins, among others. The heterologous structural
sequence is assembled in appropriate phase with translation
initiation and termination sequences, and preferably, a leader
sequence capable of directing secretion of translated protein into
the periplasmic space or extracellular medium. Optionally, the
heterologous sequence can encode a fusion protein including an
amino terminal identification peptide imparting desired
characteristics, e.g., stabilization or simplified purification of
expressed recombinant product. Useful expression vectors for
bacterial use are constructed by inserting a structural DNA
sequence encoding a desired protein together with suitable
translation initiation and termination signals in operable reading
phase with a functional promoter. The vector will comprise one or
more phenotypic selectable markers and an origin of replication to
ensure maintenance of the vector and to, if desirable, provide
amplification within the host. Suitable prokaryotic hosts for
transformation include E. coli, Bacillus subtilis, Salmonella
typhimurium and various species within the genera Pseudomonas,
Streptomyces, and Staphylococcus, although others may also be
employed as a matter of choice.
[0255] As a representative but non-limiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEM 1 (Promega Biotech, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed. Following
transformation of a suitable host strain and growth of the host
strain to an appropriate cell density, the selected promoter is
induced or derepressed by appropriate means (e.g., temperature
shift or chemical induction) and cells are cultured for an
additional period. Cells are typically harvested by centrifugation,
disrupted by physical or chemical means, and the resulting crude
extract retained for further purification.
[0256] In addition to the use of expression vectors in the practice
of the present invention, the present invention further includes
novel expression vectors comprising promoter elements operatively
linked to polynucleotide sequences encoding a protein of interest.
One example of such a vector is the pcDNA/vector, which is
described in Example 8.
[0257] 4.2.2 Hosts
[0258] The present invention further provides host cells
genetically engineered with the vectors of this invention, which
may be, for example, a cloning vector or an expression vector that
contain the polynucleotides of the invention. For example, such
host cells may contain nucleic acids of the invention introduced
into the host cell using known transformation, transfection or
infection methods. The vector may be, for example, in the form of a
plasmid, a viral particle, a phage etc. The engineered host cells
can be cultured in conventional nutrient media modified as
appropriate for activating promoters, selecting transformants or
amplifying GIPF genes. The culture conditions, such as temperature,
pH, and the like, are those previously used with the host cell
selected for expression, and will be apparent to the ordinarily
skilled artisan. The present invention still further provides host
cells genetically engineered to express the polynucleotides of the
invention, wherein such polynucleotides are in operative
association with a regulatory sequence heterologous to the host
cell which drives expression of the polynucleotides in the
cell.
[0259] The host cell can be a higher eukaryotic host cell, such as
a mammalian cell, a lower eukaryotic host cell, such as a yeast
cell, or the host cell can be a prokaryotic cell, such as a
bacterial cell. Introduction of the recombinant construct into the
host cell can be effected by calcium phosphate transfection, DEAE,
dextran mediated transfection, or electroporation (Davis, L. et
al., Basic Methods in Molecular Biology (1986)). The host cells
containing one of polynucleotides of the invention, can be used in
conventional manners to produce the gene product encoded by the
isolated fragment (in the case of an ORF) or can be used to produce
a heterologous protein under the control of the EMF.
[0260] Any host/vector system can be used to express one or more of
the GIPF polypeptides. These include, but are not limited to,
eukaryotic hosts such as HeLa cells, Cv-1 cell, COS cells, and Sf9
cells, as well as prokaryotic host such as E. coli and B. subtilis.
The most preferred cells are those which do not normally express
the particular polypeptide or protein or which expresses the
polypeptide or protein at low natural level. Mature proteins can be
expressed in mammalian cells, yeast, bacteria, or other cells under
the control of appropriate promoters. Cell-free translation systems
can also be employed to produce such proteins using RNAs derived
from the DNA constructs of the present invention. Appropriate
cloning and expression vectors for use with prokaryotic and
eukaryotic hosts are described by Sambrook, et al., in Molecular
Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor,
N.Y. (1989), the disclosure of which is hereby incorporated by
reference.
[0261] Various mammalian cell culture systems can be employed to
express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell tines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter, and
also any necessary ribosome binding sites, polyadenylation site,
splice donor and acceptor sites, transcriptional termination
sequences, and 5' flanking nontranscribed sequences. DNA sequences
derived from the SV40 viral genome, for example, SV40 origin, early
promoter, enhancer, splice, and polyadenylation sites may be used
to provide the required nontranscribed genetic elements.
Recombinant polypeptides and proteins produced in bacterial culture
are usually isolated by initial extraction from cell pellets,
followed by one or more salting-out, aqueous ion exchange or size
exclusion chromatography steps. Protein refolding steps can be
used, as necessary, in completing configuration of the mature
protein. Finally, high performance liquid chromatography (HPLC) can
be employed for final purification steps. Microbial cells employed
in expression of proteins can be disrupted by any convenient
method, including freeze-thaw cycling, sonication, mechanical
disruption, or use of cell lysing agents.
[0262] A number of types of cells may act as suitable host cells
for expression of the protein. Mammalian host cells include, for
example, monkey COS cells, human epidermal A431 cells, human
Colo205 cells, 3T3 cells, CV-1 cells, other transformed primate
cell lines, normal diploid cells, cell strains derived from in
vitro culture of primary tissue, primary explants, HeLa cells,
mouse L cells, BHK, HL-60, U937, HaK or Jurkat cells. Preferably,
GIPF proteins are expressed in Chinese Hamster Ovary (CHO) cells,
and human embryonic kidney 293 cells.
[0263] Alternatively, it may be possible to produce the protein in
lower eukaryotes such as yeast or in prokaryotes such as bacteria.
Potentially suitable yeast strains include Saccharomyces
cerevisiae, Schizosaccharomyces pombe, Kluyveromyces strains,
Candida, Pichia pastoris or any yeast strain capable of expressing
heterologous proteins. Potentially suitable bacterial strains
include Escherichia coli, Bacillus subtilis, Salmonella
typhimurium, or any bacterial strain capable of expressing
heterologous proteins. If the protein is made in yeast or bacteria,
it may be necessary to modify the protein produced therein, for
example by phosphorylation or glycosylation of the appropriate
sites, in order to obtain the functional protein. Such covalent
attachments may be accomplished using known chemical or enzymatic
methods.
[0264] 4.2.3 Chimeric and Fusion Proteins
[0265] The invention also provides GIPF chimeric or fusion
proteins. As used herein, a GIPF "chimeric protein" or "fusion
protein" comprises a GIPF polypeptide operatively-linked to a
non-GIPF polypeptide. A "GIPF polypeptide" refers to a polypeptide
having an amino acid sequence corresponding to a GIPF protein,
whereas a "non-GIPF polypeptide" refers to a polypeptide having an
amino acid sequence corresponding to a protein that is not
substantially homologous to the GIPF protein, e.g., a protein that
is different from the GIPF protein and that is derived from the
same or a different organism. Within a GIPF fusion protein the GIPF
polypeptide can correspond to all or a portion of a GIPF protein.
In one embodiment, a GIPF fusion protein comprises at least one
biologically active portion of a GIPF protein. In another
embodiment, a GIPF fusion protein comprises at least two
biologically active portions of a GIPF protein. In yet another
embodiment, a GIPF fusion protein comprises at least three
biologically active portions of a GIPF protein. Within the fusion
protein, the term "operatively-linked" is intended to indicate that
the GIPF polypeptide and the non-GIPF polypeptide are fused
in-frame with one another. The non-GIPF polypeptide can be fused to
the N-terminus or C-terminus of the GIPF polypeptide.
[0266] In one embodiment, the fusion protein is a GST-GIPF fusion
protein in which the GIPF sequences are fused to the C-terminus of
the GST (glutathione S-transferase) sequences. Such fusion proteins
can facilitate the purification of recombinant GIPF polypeptides.
In another embodiment, the fusion protein is a GIPF protein
containing a heterologous signal sequence at its N-terminus. In
certain host cells (e.g., mammalian host cells), expression and/or
secretion of GIPF can be increased through use of a heterologous
signal sequence. Preferably, the GIPF polypeptide is fused with a
V5-His tag for easy detection with an anti-V5 antibody and for
rapid purification as described in the examples.
[0267] A GIPF chimeric or fusion protein of the invention can be
produced by standard recombinant DNA techniques. For example, DNA
fragments coding for the different polypeptide sequences are
ligated together in-frame in accordance with conventional
techniques, e.g., by employing blunt-ended or stagger-ended termini
for ligation, restriction enzyme digestion to provide for
appropriate termini, filling-in of cohesive ends as appropriate,
alkaline phosphatase treatment to avoid undesirable joining, and
enzymatic ligation. In another embodiment, the fusion gene can be
synthesized by conventional techniques including automated DNA
synthesizers. Alternatively, PCR amplification of gene fragments
can be carried out using anchor primers that give rise to
complementary overhangs between two consecutive gene fragments that
can subsequently be annealed and reamplified to generate a chimeric
gene sequence (see, e.g., Ausubel, et al. (eds.) CURRENT PROTOCOLS
IN MOLECULAR BIOLOGY, John Wiley & Sons, 1992). Moreover, many
expression vectors are commercially available that already encode a
fusion moiety (e.g., a GST polypeptide). A GIPF-encoding nucleic
acid can be cloned into such an expression vector such that the
fusion moiety is linked in-frame to the GIPF protein.
[0268] 4.2.4 Polypeptide Compositions
[0269] The pharmaceutical compositions of the invention comprise
isolated GIPF polypeptides that include, but are not limited to, a
polypeptide comprising: the amino acid sequence set forth as any
one of SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 85, 87, 89, 91, 93,
95, 97, 99, 101, 103, 105 or 178, or an amino acid sequence encoded
by any one of the nucleotide sequences SEQ ID NO: 2, 3, 5, 7, 9,
11, 13, 15, 17, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104 or
177. Polypeptides of the invention also include polypeptides
preferably with biological or immunological activity that are
encoded by: (a) a polynucleotide having any one of the nucleotide
sequences set forth in SEQ ID NO: 2, 3, 5, 7, 9, 11, 13, 15, 17,
84, 86, 88, 90, 92, 94, 96, 98, 100, 102, or 104 or (b)
polynucleotides encoding any one of the amino acid sequences set
forth as SEQ ID NO:4, 6, 8, 10, 12, 14, 16, 18, 85, 87, 89, 91, 93,
95, 97, 99, 101, 103, 105 or 178 or (c) polynucleotides that
hybridize to the complement of the polynucleotides of either (a) or
(b) under stringent hybridization conditions. The invention also
provides biologically active or immunologically active variants of
any of the amino acid sequences set forth as SEQ ID NO: 4, 6, 8,
10, 12, 14, 16, 18, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105
or 178; and "substantial equivalents" thereof (e.g., with at least
about 65%, at least about 70%, at least about 75%, at least about
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more typically
at least about 90%, 91%, 92%, 93%, or 94% and even more typically
at least about 95%, 96%, 97%, 98% or 99%, most typically at least
about 99% amino acid identity) that retain biological activity.
Polypeptides encoded by allelic variants may have a similar,
increased, or decreased activity compared to polypeptides
comprising SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 85, 87, 89, 91,
93, 95, 97, 99, 101, 103, 105 or 178.
[0270] Fragments of the proteins of the present invention which are
capable of exhibiting biological activity are also encompassed by
the present invention. Fragments of the protein may be in linear
form or they may be cyclized using known methods, for example, as
described in H. U. Saragovi, et al., Bio/Technology 10, 773-778
(1992) and in R. S. McDowell, et al., J. Amer. Chem. Soc. 114,
9245-9253 (1992), both of which are incorporated herein by
reference. Such fragments may be fused to carrier molecules such as
immunoglobulins for many purposes, including increasing the valency
of protein binding sites.
[0271] The present invention also provides both full-length and
dominant mature forms (for example, without a signal sequence or
precursor sequence) or mature forms (for example, lacking the
signal sequence and the furin cleavage site) of the disclosed
proteins. The protein coding sequence is identified in the sequence
listing by translation of the disclosed nucleotide sequences. The
mature form of such protein may be obtained by expression of a
full-length polynucleotide in a suitable mammalian cell or other
host cell. The sequence of the mature form of the protein is also
determinable from the amino acid sequence of the full-length
form.
[0272] Protein compositions of the present invention may further
comprise an acceptable carrier, such as a hydrophilic, e.g.,
pharmaceutically acceptable, carrier.
[0273] The present invention further provides isolated polypeptides
encoded by the nucleic acid fragments of the present invention or
by degenerate variants of the nucleic acid fragments of the present
invention. By "degenerate variant" is intended nucleotide fragments
which differ from a nucleic acid fragment of the present invention
(e.g., an ORF) by nucleotide sequence but, due to the degeneracy of
the genetic code, encode an identical polypeptide sequence.
Preferred nucleic acid fragments of the present invention are the
ORFs that encode proteins.
[0274] A variety of methodologies known in the art can be utilized
to obtain any one of the isolated polypeptides or proteins of the
present invention. At the simplest level, the amino acid sequence
can be synthesized using commercially available peptide
synthesizers. The synthetically-constructed protein sequences, by
virtue of sharing primary, secondary or tertiary structural and/or
conformational characteristics with proteins may possess biological
properties in common therewith, including protein activity. This
technique is particularly useful in producing small peptides and
fragments of larger polypeptides. Fragments are useful, for
example, in generating antibodies against the native polypeptide.
Thus, they may be employed as biologically active or immunological
substitutes for natural, purified proteins in screening of
therapeutic compounds and in immunological processes for the
development of antibodies.
[0275] The polypeptides and proteins of the present invention can
alternatively be purified from cells which have been altered to
express the desired polypeptide or protein. As used herein, a cell
is said to be altered to express a desired polypeptide or protein
when the cell, through genetic manipulation, is made to produce a
polypeptide or protein which it normally does not produce or which
the cell normally produces at a lower level. One skilled in the art
can readily adapt procedures for introducing and expressing either
recombinant or synthetic sequences into eukaryotic or prokaryotic
cells in order to generate a cell which produces one of the
polypeptides or proteins of the present invention.
[0276] The invention also relates to methods for producing a
polypeptide comprising growing a culture of host cells of the
invention in a suitable culture medium, and purifying the protein
from the cells or the culture in which the cells are grown. For
example, the methods of the invention include a process for
producing a polypeptide in which a host cell containing a suitable
expression vector that includes a polynucleotide of the invention
is cultured under conditions that allow expression of the encoded
polypeptide. The polypeptide can be recovered from the culture,
conveniently from the culture medium, or from a lysate prepared
from the host cells and further purified. Preferred embodiments
include those in which the protein produced by such process is a
full length or mature form of the protein.
[0277] In an alternative method, the polypeptide or protein is
purified from bacterial cells which are transformed with
GIPF-encoding DNA to produce the polypeptide or protein. One
skilled in the art can readily follow known methods for isolating
polypeptides and proteins in order to obtain one of the isolated
polypeptides or proteins of the present invention. These include,
but are not limited to, immunochromatography, HPLC, size-exclusion
chromatography, ion-exchange chromatography, and immuno-affinity
chromatography. See, e.g., Scopes, Protein Purification: Principles
and Practice, Springer-Verlag (1994); Sambrook, et al., in
Molecular Cloning: A Laboratory Manual; Ausubel et al., Current
Protocols in Molecular Biology. Polypeptide fragments that retain
biological/immunological activity include fragments comprising
greater than about 100 amino acids, or greater than about 200 amino
acids, and fragments that encode specific protein domains.
[0278] The purified polypeptides can be used in in vitro binding
assays which are well known in the art to identify molecules which
bind to the polypeptides. These molecules include but are not
limited to, for e.g., small molecules, molecules from combinatorial
libraries, antibodies or other proteins. The molecules identified
in the binding assay are then tested for antagonist or agonist
activity in in vivo tissue culture or animal models that are well
known in the art. In brief, the molecules are titrated into a
plurality of cell cultures or animals and then tested for either
cell/animal death or prolonged survival of the animal/cells.
[0279] The protein of the invention may also be expressed as a
product of transgenic animals, e.g., as a component of the milk of
transgenic cows, goats, pigs, or sheep which are characterized by
somatic or germ cells containing a nucleotide sequence encoding the
protein.
[0280] The proteins provided herein also include proteins
characterized by amino acid sequences similar to those of purified
proteins but into which modification are naturally provided or
deliberately engineered. For example, modifications, in the peptide
or DNA sequence, can be made by those skilled in the art using
known techniques. Modifications of interest in the protein
sequences may include the alteration, substitution, replacement,
insertion or deletion of a selected amino acid residue in the
coding sequence. For example, one or more of the cysteine residues
may be deleted or replaced with another amino acid to alter the
conformation of the molecule. Techniques for such alteration,
substitution, replacement, insertion or deletion are well known to
those skilled in the art (see, e.g., U.S. Pat. No. 4,518,584).
Preferably, such alteration, substitution, replacement, insertion
or deletion retains the desired activity of the protein. Regions of
the protein that are important for the protein function can be
determined by various methods known in the art including the
alanine-scanning method which involved systematic substitution of
single or strings of amino acids with alanine, followed by testing
the resulting alanine-containing variant for biological activity.
This type of analysis determines the importance of the substituted
amino acid(s) in biological activity. Regions of the protein that
are important for protein function may be determined by the eMATRIX
program.
[0281] Other fragments and derivatives of the sequences of proteins
which would be expected to retain protein activity in whole or in
part and are useful for screening or other immunological
methodologies may also be easily made by those skilled in the art
given the disclosures herein. Such modifications are encompassed by
the present invention.
[0282] The protein may also be produced by operably linking the
isolated polynucleotide of the invention to suitable control
sequences in one or more insect expression vectors, and employing
an insect expression system. Materials and methods for
baculovirus/insect cell expression systems are commercially
available in kit form from, e.g., Invitrogen, San Diego, Calif.,
U.S.A. (the MaxBat.TM. kit), and such methods are well known in the
art, as described in Summers and Smith, Texas Agricultural
Experiment Station Bulletin No. 1555 (1987), incorporated herein by
reference. As used herein, an insect cell capable of expressing a
polynucleotide of the present invention is "transformed."
[0283] The protein of the invention may be prepared by culturing
transformed host cells under culture conditions suitable to express
the recombinant protein. The resulting expressed protein may then
be purified from such culture (i.e., from culture medium or cell
extracts) using known purification processes, such as gel
filtration and ion exchange chromatography. The purification of the
protein may also include an affinity column containing agents which
will bind to the protein; one or more column steps over such
affinity resins as concanavalin A-agarose, Heparin-Toyopearl.TM. or
Cibacrom blue 3GA Sepharose.TM.; one or more steps involving
hydrophobic interaction chromatography using such resins as phenyl
ether, butyl ether, or propyl ether; or immunoaffinity
chromatography.
[0284] Alternatively, the protein of the invention may also be
expressed in a form which will facilitate purification. For
example, it may be expressed as a fusion protein, such as those of
maltose binding protein (MBP), glutathione-S-transferase (GST) or
thioredoxin (TRX), or as a His tag. Kits for expression and
purification of such fusion proteins are commercially available
from New England BioLab (Beverly, Mass.), Pharmacia (Piscataway,
N.J.) and Invitrogen, respectively. The protein can also be tagged
with an epitope and subsequently purified by using a specific
antibody directed to such epitope. One such epitope ("FLAG.RTM.")
is commercially available from Kodak (New Haven, Conn.).
[0285] Finally, one or more reverse-phase high performance liquid
chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media,
e.g., silica gel having pendant methyl or other aliphatic groups,
can be employed to further purify the protein. Some or all of the
foregoing purification steps, in various combinations, can also be
employed to provide a substantially homogeneous isolated
recombinant protein. The protein thus purified is substantially
free of other mammalian proteins and is defined in accordance with
the present invention as an "isolated protein."
[0286] The polypeptides of the invention include GIPF analogs. This
embraces fragments of GIPF polypeptide, as well as GIPF
polypeptides which comprise one or more amino acids deleted,
inserted, or substituted. Also, analogs of the GIPF polypeptide of
the invention embrace fusions of the GIPF polypeptides or
modifications of the GIPF polypeptides, wherein the GIPF
polypeptide or analog is fused to another moiety or moieties, e.g.,
targeting moiety or another therapeutic agent. Such analogs may
exhibit improved properties such as activity and/or stability.
Examples of moieties which may be fused to the GIPF polypeptide or
an analog include, for example, targeting moieties which provide
for the delivery of polypeptide to the small intestine, e.g.,
antibodies to the small intestine, or antibodies to receptor and
ligands expressed on gastrointestinal cells. Other moieties which
may be fused to GIPF polypeptide include therapeutic agents which
are used for treatment, for example cytokines or other medications,
of gastrointestinal disorders, and other conditions as recited
herein.
[0287] 4.2.5 Gene Therapy
[0288] The invention provides gene therapy to treat the diseases
cited herein. Delivery of a functional gene encoding polypeptides
of the invention to appropriate cells is effected ex vivo, in situ,
or in vivo by use of vectors, and more particularly viral vectors
(e.g., adenovirus, adeno-associated virus, or a retrovirus), or ex
vivo by use of physical DNA transfer methods (e.g., liposomes or
chemical treatments). See, for example, Anderson, Nature,
supplement to vol. 392, no. 6679, pp. 25-20 (1998). For additional
reviews of gene therapy technology see Friedmann, Science, 244:
1275-1281 (1989); Verma, Scientific American: 68-84 (1990); and
Miller, Nature, 357: 455-460 (1992).
[0289] As discussed above, a "vector" is any means for the transfer
of a nucleic acid according to the invention into a host cell.
Preferred vectors are viral vectors, such as retroviruses, herpes
viruses, adenoviruses and adeno-associated viruses. Thus, a gene or
nucleic acid sequence encoding a GIPF protein or polypeptide domain
fragment thereof is introduced in vivo, ex vivo, or in vitro using
a viral vector or through direct introduction of DNA. Expression in
targeted tissues can be effected by targeting the transgenic vector
to specific cells, such as with a viral vector or a receptor
ligand, or by using a tissue-specific promoter, or both.
[0290] Viral vectors commonly used for in vivo or ex vivo targeting
and therapy procedures are DNA-based vectors and retroviral
vectors. Methods for constructing and using viral vectors are known
in the art [see, e.g., Miller and Rosman, BioTechniques 7:980-990
(1992)]. Preferably, the viral vectors are replication defective,
that is, they are unable to replicate autonomously in the target
cell. In general, the genome of the replication defective viral
vectors which are used within the scope of the present invention
lack at least one region which is necessary for the replication of
the virus in the infected cell. These regions can either be
eliminated (in whole or in part), be rendered non-functional by any
technique known to a person skilled in the art. These techniques
include the total removal, substitution (by other sequences, in
particular by the inserted nucleic acid), partial deletion or
addition of one or more bases to an essential (for replication)
region. Such techniques may be performed in vitro (on the isolated
DNA) or in situ, using the techniques of genetic manipulation or by
treatment with mutagenic agents. Preferably, the replication
defective virus retains the sequences of its genome which are
necessary for encapsulating the viral particles.
[0291] DNA viral vectors include an attenuated or defective DNA
virus, such as but not limited to herpes simplex virus (HSV),
papillomavirus, Epstein-Barr virus (EBV), adenovirus,
adeno-associated virus (AAV), and the like. Defective viruses,
which entirely or almost entirely lack viral genes, are preferred.
Defective virus is not infective after introduction into a cell.
Use of defective viral vectors allows for administration to cells
in a specific, localized area, without concern that the vector can
infect other cells. Thus, a specific tissue can be specifically
targeted. Examples of particular vectors include, but are not
limited to, a defective herpes virus 1 (HSV1) vector [Kaplitt et
al., Molec. Cell. Neurosci. 2:320-330 (1991)], defective herpes
virus vector lacking a glyco-protein L gene [Patent Publication RD
371005 A], or other defective herpes virus vectors [International
Patent Publication No. WO 94/21807, published Sep. 29, 1994;
International Patent Publication No. WO 92/05263, published Apr. 2,
1994]; an attenuated adenovirus vector, such as the vector
described by Stratford-Perricaudet et al. [J. Clin. Invest.
90:626-630 (1992); see also La Salle et al., Science 259:988-990
(1993)]; and a defective adeno-associated virus vector [Samulski et
al., J. Virol. 61:3096-3101 (1987); Samulski et al., J. Virol.
63:3822-3828 (1989); Lebkowski et al., Mol. Cell. Biol. 8:3988-3996
(1988)].
[0292] Preferably, for in vivo administration, an appropriate
immunosuppressive treatment is employed in conjunction with the
viral vector, e.g., adenovirus vector, to avoid immuno-deactivation
of the viral vector and transfected cells. For example,
immunosuppressive cytokines, such as interleukin-12 (IL-12),
interferon-.gamma. (IFN-.gamma.), or anti-CD4 antibody, can be
administered to block humoral or cellular immune responses to the
viral vectors [see, e.g., Wilson, Nature Medicine (1995)]. In
addition, it is advantageous to employ a viral vector that is
engineered to express a minimal number of antigens.
[0293] In a preferred embodiment, the vector is an adenovirus
vector. As shown in the Examples, the adenovirus vector has shown
itself to be particularly effective for delivery of the GIPF
polypeptide, as shown by the unexpectedly efficient effects of
stimulating intestinal epithelial cell proliferation resulting in
marked, diffuse thickening of the mucosa by crypt epithelial
hyperplasia and a marked increase in crypt length and complex
branching. Adenoviruses are eukaryotic DNA viruses that can be
modified to efficiently deliver a nucleic acid of the invention to
a variety of cell types. Various serotypes of adenovirus exist. Of
these serotypes, preference is given, within the scope of the
present invention, to using type 2 or type 5 human adenoviruses (Ad
2 or Ad 5) or adenoviruses of animal origin (see WO94/26914). Those
adenoviruses of animal origin which can be used within the scope of
the present invention include adenoviruses of canine, bovine,
murine (example: May 1, Beard et al., Virology 75 (1990) 81),
ovine, porcine, avian, and simian (example: SAV) origin.
[0294] Preferably, the replication defective adenoviral vectors of
the invention comprise the ITRs, an encapsidation sequence and the
nucleic acid of interest. Still more preferably, at least the E1
region of the adenoviral vector is non-functional. Other regions
may also be modified, in particular the E3 region (WO95/02697), the
E2 region (WO94/28938), the E4 region (WO94/28152, WO94/12649 and
WO95/02697), or in any of the late genes L1-L5.
[0295] In a preferred embodiment, the adenoviral vector has a
deletion in the E1 and E3 region. Examples of E1-deleted
adenoviruses are disclosed in EP 185,573, the contents of which are
incorporated herein by reference.
[0296] The replication defective recombinant adenoviruses according
to the invention can be prepared by any technique known to the
person skilled in the art (Levrero et al., Gene 101 (1991) 195, EP
185 573; Graham, EMBO J. 3 (1984) 2917). In particular, they can be
prepared by homologous recombination between an adenovirus and a
plasmid which carries, inter alia, the DNA sequence of interest.
The homologous recombination is effected following cotransfection
of the said adenovirus and plasmid into an appropriate cell line.
The cell line which is employed should preferably (i) be
transformable by the said elements, and (ii) contain the sequences
which are able to complement the part of the genome of the
replication defective adenovirus, preferably in integrated form in
order to avoid the risks of recombination. Examples of cell lines
which may be used are the human embryonic kidney cell line 293
(Graham et al., J. Gen. Virol. 36 (1977) 59) which contains the
left-hand portion of the genome of an Ad5 adenovirus (12%)
integrated into its genome, and cell lines which are able to
complement the E1 and E4 functions, as described in applications
WO94/26914 and WO95/02697. Recombinant adenoviruses are recovered
and purified using standard molecular biological techniques, which
are well known to one of ordinary skill in the art.
[0297] Promoters that may be used in the present invention include
both constitutive promoters and regulated (inducible) promoters.
The promoter may be naturally responsible for the expression of the
nucleic acid. It may also be from a heterologous source. In
particular, it may be promoter sequences of eukaryotic or viral
genes. For example, it may be promoter sequences derived from the
genome of the cell which it is desired to infect. Likewise, it may
be promoter sequences derived from the genome of a virus, including
the adenovirus used. In this regard, there may be mentioned, for
example, the promoters of the E1A, MLP, CMV and RSV genes and the
like.
[0298] In addition, the promoter may be modified by addition of
activating or regulatory sequences or sequences allowing a
tissue-specific or predominant expression (enolase and GFAP
promoters and the like). Moreover, when the nucleic acid does not
contain promoter sequences, it may be inserted, such as into the
virus genome downstream of such a sequence.
[0299] Some promoters useful for practice of this invention are
ubiquitous promoters (e.g., HPRT, vimentin, actin, tubulin),
intermediate filament promoters (e.g., desmin, neurofilaments,
keratin, GFAP), therapeutic gene promoters (e.g., MDR type, CFTR,
factor VIII), tissue-specific promoters (e.g., actin promoter in
smooth muscle cells), promoters which are preferentially activated
in dividing cells, promoters which respond to a stimulus (e.g.,
steroid hormone receptor, retinoic acid receptor),
tetracycline-regulated transcriptional modulators, cytomegalovirus
immediate-early, retroviral LTR, metallothionein, SV-40, E1a, and
MLP promoters. Tetracycline-regulated transcriptional modulators
and CMV promoters are described in WO 96/01313, U.S. Pat. Nos.
5,168,062 and 5,385,839, the contents of which are incorporated
herein by reference.
[0300] Thus, the promoters which may be used to control gene
expression include, but are not limited to, the cytomegalovirus
(CMV) promoter, the SV40 early promoter region (Benoist and
Chambon, 1981, Nature 290:304-310), the promoter contained in the
3' long terminal repeat of Rous sarcoma virus (Yamamoto, et al.,
1980, Cell 22:787-797), the herpes thymidine kinase promoter
(Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445),
the regulatory sequences of the metallothionein gene (Brinster et
al., 1982, Nature 296:39-42); prokaryotic expression vectors such
as the b-lactamase promoter (Villa-Kamaroff, et al., 1978, Proc.
Natl. Acad. Sci. U.S.A. 75:3727-3731), or the tac promoter (DeBoer,
et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25); see also
"Useful proteins from recombinant bacteria" in Scientific American,
1980, 242:74-94; promoter elements from yeast or other fungi such
as the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter,
PGK (phosphoglycerol kinase) promoter, alkaline phosphatase
promoter; and the animal transcriptional control regions, which
exhibit tissue specificity and have been utilized in transgenic
animals: elastase I gene control region which is active in
pancreatic acinar cells (Swift et al., 1984, Cell 38:639-646;
Ornitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol.
50:399-409; MacDonald, 1987, Hepatology 7:425-515); insulin gene
control region which is active in pancreatic beta cells (Hanahan,
1985, Nature 315:115-122), immunoglobulin gene control region which
is active in lymphoid cells (Grosschedl et al., 1984, Cell
38:647-658; Adames et al., 1985, Nature 318:533-538; Alexander et
al., 1987, Mol. Cell. Biol. 7:1436-1444), mouse mammary tumor virus
control region which is active in testicular, breast, lymphoid and
mast cells (Leder et al., 1986, Cell 45:485-495), albumin gene
control region which is active in liver (Pinkert et al., 1987,
Genes and Devel. 1:268-276), alpha-fetoprotein gene control region
which is active in liver (Krumlauf et al., 1985, Mol. Cell. Biol.
5:1639-1648; Hammer et al., 1987, Science 235:53-58), alpha
1-antitrypsin gene control region which is active in the liver
(Kelsey et al., 1987, Genes and Devel. 1:161-171), beta-globin gene
control region which is active in myeloid cells (Mogram et al.,
1985, Nature 315:338-340; Kollias et al., 1986, Cell 46:89-94),
myelin basic protein gene control region which is active in
oligodendrocyte cells in the brain (Readhead et al., 1987, Cell
48:703-712), myosin light chain-2 gene control region which is
active in skeletal muscle (Sani, 1985, Nature 314:283-286), and
gonadotropic releasing hormone gene control region which is active
in the hypothalamus (Mason et al., 1986, Science
234:1372-1378).
[0301] Introduction of any one of the nucleotides of the present
invention or a gene encoding the polypeptides of the present
invention can also be accomplished with extrachromosomal substrates
(transient expression) or artificial chromosomes (stable
expression). Cells may also be cultured ex vivo in the presence of
proteins of the present invention in order to proliferate or to
produce a desired effect on or activity in such cells. Treated
cells can then be introduced in vivo for therapeutic purposes. In
addition to the use of viral vectors in the practice of the present
invention, the present invention further includes a novel vector
comprising operator and promoter elements operatively linked to
polynucleotide sequences encoding a protein of interest. The novel
adenoviral vector is the pAdenoVator-CMV5-Intron vector, which is
described in detail in Examples.
[0302] 4.2.6 Transgenic Animals
[0303] The polynucleotides of the present invention also make
possible the development of chimeric animals that specifically
express GIPF polypeptides in B cells. Such animals are useful as
models for studying the in vivo activities of polypeptide as well
as for studying modulators of the polypeptides of the invention. A
preferred embodiment of the invention relates to a transgenic
knock-in (KI) mouse model that was designed to determine the
biological function of GIPF in a rapid manner. The transgenic KI
animal model is described in International Application
PCT/JP02/11236, and published as WO2003/041495. The transgenic
model relates to a GIPF transgene that encodes the B-cell specific
expression of GIPF under the control of the immunoglobulin kappa
light chain promoter. The transgene is introduced into TT2F ES
cells, which contain intact immunoglobulin heavy and light chain
loci, and the ES cells that contain the GIPF transgene are
implanted into mice that lack both alleles for the antibody heavy
chain (IgH-KOAH.sup.-/-) (Kitamura et al., Nature 350:423-426
(1991), herein incorporated by reference in its entirety). Thus,
the expression of the immunoglobulin kappa light chains can only
occur in functional B cells that are derived from the ES cells that
express the IG chains (WO 00/10383; EP 1106061A1). Similarly, the
expression of GIPF by B-cells occurs only in the GIPF-KI chimeric
mice. The transgenic animal model of the invention thus allows for
a speedy phenotypic analysis of chimeric animals, rather than
heterozygous or homozygous animals containing transgenes
transmitted through the germline. In addition, the expression of
the transgene is restricted to B cells, which secrete the GIPF
protein into the animal's circulation, thus exposing every tissue
to GIPF, and allowing for a rapid assessment of the biological
effect of GIPF, or any other encoded polypeptide. It is intended
that the transgenic system of the present invention can be used for
expressing and assessing the biological function of any
polypeptide. Another advantage of the transgenic model of the
invention relates to the temporal expression of the transgene. The
activity of the kappa light chain promoter begins at approximately
14 days post-gestation and the remarkable elevation of circulating
immunoglobulin concentration is observed after weaning, thus
avoiding any potentially deleterious effects that GIPF might have
on the early development of the mouse. An exemplary embodiment of
the transgenic animal of the invention is described in the
Examples.
[0304] 4.2.6.1 General Method of Making Transgenic Non-Human
Mammals
[0305] The transgenic animals of the present invention all include
within a plurality of their cells a transgene of the present
invention, which transgene alters the phenotype of the "host cell"
with respect to the specific expression of GIPF by B cells, which
secrete GIPF polypeptides into the circulation of the transgenic
animal. Various aspects of transgenic animal technology are well
known in the art, and are described in detail in literature, such
as Hogan et al., Manipulating the Mouse Embryo (Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y., [1986]). Although the making
of transgenic animals is illustrated herein with reference to
transgenic mice, this is only for illustrative purpose, and is not
to be construed as limiting the scope of the invention. This
specific disclosure can be readily adapted by those skilled in the
art to incorporate GIPF transgene sequences into any non-human
mammal utilizing the methods and materials described below. Animals
suitable for transgenic experiments can be obtained from standard
commercial sources such as Taconic (Germantown, N.Y.).
A. Transgene Construct
[0306] Construction of transgenes can be accomplished using any
suitable genetic engineering techniques well known in the art,
including, without limitation, the standard techniques of
restriction endonuclease digestion, ligation, transformation,
plasmid purification, DNA sequencing etc as described in Sambrook
et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor
Laboratory, N.Y., (1989)).
[0307] The transgenes of the present invention are typically
operably linked to transcriptional regulatory sequences, such as
promoters and/or enhancers, to regulate expression of the transgene
in a particular manner. In certain embodiments, the useful
transcriptional regulatory sequences are those that are highly
regulated with respect to activity, both temporally and spatially.
Thus, the promoters of choice can be those that are active only in
particular tissues or cell types. Promoters/enhancers which may be
used to control the expression of the transgene in vivo include,
but are not limited to, the human cytomegalovirus (CMV)
promoter/enhancer (Karasuyama et al., J. Exp. Med. 169: 13 [1989]),
the human .beta.-actin promoter (Gunning et al., Proc. Natl. Acad.
Sci. USA 84: 4831-4835 [1987]), the glucocorticoid-inducible
promoter present in the mouse mammary tumor virus long terminal
repeat (MMTV LTR) (Kiessig et al., Mol. Cell. Biol. 4: 1354-1362
[1984]), the long terminal repeat sequences of Moloney murine
leukemia virus (MuLV LTR) (Weiss et al. [1985] RNA Tumor Viruses,
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.), the SV40
early or late region promoter (Benoist et al. Nature 290: 304-310
[1981]; Templeton et al. Mol. Cell. Biol., 4: 817 [1984]; and
Sprague et al., J. Virol., 45: 773 [1983]), the promoter contained
in the 3' long terminal repeat of Rous sarcoma virus (RSV)
(Yamamoto et al., Cell 22: 787-797 [1980]), the herpes simplex
virus (HSV) thymidine kinase promoter/enhancer (Wagner et al. Proc.
Natl. Acad. Sci. USA 82: 3567-71 [1981]), metallothionein (MT)
promoter (Palmiter et al., Nature 300: 611-615 [1982]), and the
herpes simplex virus LAT promoter (Wolfe et al. Nature Genetics 1:
379-384 [1992]). Preferably the promoter is the P2 promoter of the
immunoglobulin kappa light chain (REF).
[0308] In addition to the transgene and the transcriptional
regulatory sequence, the vectors useful for preparing the
transgenes of this invention typically contain one or more other
elements useful for optimizing expression of the transgene in the
host animal. Thus, the transgene construct may include
transcription termination elements, such as to direct
polyadenylation of an mRNA transcript, as well as intronic
sequences. For example, the transgene can be flanked at its 3' end
by SV40 sequences (SV40 intron/pA) which add the transcription
termination and polyadenylation signals to the transgene
transcript. In yet other embodiments, the transgene can include
intron sequences. In many instances, the expression of a transgene
is increased by the presence of one or more introns in the coding
sequence.
[0309] In still other embodiments, the transgene construct may
include additional elements which facilitate its manipulation in
cells (e.g., in bacterial cells) prior to insertion in the intended
recipient cell. For instance, the vector may include origin of
replication elements for amplification in prokaryotic cells.
Moreover, the transgene construct may contain selectable markers
for isolating cells, either from the recipient animal, or cells
generated as intermediate in making the transgenic animal (i.e.,
bacterial cells used for amplifying the construct or ES cells used
for introducing the transgene). Selectable marker genes may encode
proteins necessary for the survival and/or growth of transfected
cells under selective culture conditions. Typical selection marker
genes encode proteins that, for example: (i) confer resistance to
antibiotics or other toxins, e.g., ampicillin, tetracycline or
kanamycin for prokaryotic host cells, and neomycin, hygromycin or
methotrexate for mammalian cells; or (ii) complement auxotrophic
deficiencies of the cell.
B. Cells Used for Introduction of Transgene
[0310] In an exemplary embodiment, the "transgenic non-human
mammals" of the invention are produced by introducing GIPF
transgene into the germline of the non-human mammal. Embryonal
target cells at various developmental stages can be used to
introduce GIPF transgene. Different methods are used depending on
the stage of development of the embryonal target cell. The specific
line(s) of any animal used to practice this invention are selected
for general good health, good embryo yields, good pronuclear
visibility in the embryo, and good reproductive fitness.
[0311] In one embodiment, the transgene construct is introduced
into a single stage embryo. Generally, the female animals are
superovulated by hormone treatment, mated and fertilized eggs are
recovered. For example, in case of mice, females six weeks of age
are induced to superovulate with a 5 IU injection (0.1 ml, i.p.) of
pregnant mare serum gonadotropin (PMSG; Sigma) followed 48 hours
later by a 5 IU injection (0.1 ml, i.p.) of human chorionic
gonadotropin (hCG; Sigma). FVB strain of mice are used in this
case. Females are then mated immediately with a stud male
overnight. Such females are next examined for copulation plugs.
Those that have mated are euthanized by CO.sub.2 asphyxiation or
cervical dislocation and embryos are recovered from excised
oviducts and placed in Dulbecco's phosphate buffered saline with
0.5% bovine serum albumin (BSA; Sigma). Surrounding cumulus cells
are removed with hyaluronidase (1 mg/ml). Pronuclear embryos are
then washed and placed in Earle's balanced salt solution containing
0.5% BSA (EBSS) in a 37.5.degree. C. incubator with a humidified
atmosphere at 5% CO.sub.2, 95% air until the time of injection.
[0312] Normally, fertilized embryos are incubated in suitable media
until the pronuclei appear. At about this time, the transgene is
introduced into the female or male pronucleus as described below.
In some species such as mice, the male pronucleus is preferred. For
example, the exogenous genetic material is added to the early male
pronucleus, as soon as possible after the formation of the male
pronucleus, which is when the male and female pronuclei are well
separated and both are located close to the cell membrane.
Alternatively, the exogenous genetic material could be added to the
nucleus of the sperm after it has been induced to undergo
decondensation. Sperm containing the exogenous genetic material can
then be added to the ovum or the decondensed sperm could be added
to the ovum with the transgene constructs being added as soon as
possible thereafter.
[0313] In addition to similar biological considerations, physical
ones also govern the amount (e.g., volume) of exogenous genetic
material, which can be added to the nucleus of the zygote, or to
the genetic material which forms a part of the zygote nucleus.
Generally, the volume of exogenous genetic material inserted will
not exceed about 10 picoliters. The physical effects of addition
must not be so great as to physically destroy the viability of the
zygote. The biological limit of the number and variety of DNA
sequences will vary depending upon the particular zygote and
functions of the exogenous genetic material and will be readily
apparent to one skilled in the art, because the genetic material,
including the exogenous genetic material, of the resulting zygote
must be biologically capable of initiating and maintaining the
differentiation and development of the zygote into a functional
organism.
[0314] The number of copies of the transgene constructs which are
added to the zygote is dependent upon the total amount of exogenous
genetic material added and will be the amount which enables the
genetic transformation to occur. Theoretically only one copy is
required; however, generally, numerous copies are utilized, for
example, 1,000-20,000 copies of the transgene construct, in order
to insure that one copy is functional.
C. Methods of Introducing Transgene
[0315] Each transgene construct to be inserted into the cell must
first be in the linear form since the frequency of recombination is
higher with linear molecules of DNA as compared to the circular
molecules. Therefore, if the construct has been inserted into a
vector, linearization is accomplished by digesting the DNA with a
suitable restriction endonuclease selected to cut only within the
vector sequence and not within the transgene sequence.
[0316] Introduction of the transgene into the embryo may be
accomplished by any means known in the art so long as it is not
destructive to the cell, nuclear membrane or other existing
cellular or genetic structures. Some of the widely used methods
include microinjection, electroporation, or lipofection. Following
introduction of the transgene, the embryo may be incubated in vitro
for varying amounts of time, or reimplanted into the surrogate
host, or both. One common method is to incubate the embryos in
vitro for about 1-7 days, depending on the species, and then
reimplant them into the surrogate host.
[0317] The zygote is the best target for introducing the transgene
construct by microinjection method. In the mouse, the male
pronucleus reaches the size of approximately 20 micrometers in
diameter which allows reproducible injection of 1-2 pl of DNA
solution. The use of zygotes as a target for gene transfer has a
major advantage in that in most cases the injected DNA will be
incorporated into the host gene before the first cleavage (Brinster
et al. Proc. Natl. Acad. Sci. USA 82: 4438-4442 (1985)). As a
consequence, all cells of the transgenic animal will carry the
incorporated transgene. This will in general also be reflected in
the efficient transmission of the transgene to offspring of the
founder since 50% of the germ cells will harbor the transgene.
[0318] Retroviral infection can also be used to introduce transgene
into a non-human mammal. The developing non-human embryo can be
cultured in vitro to the blastocyst stage. During this time, the
blastomeres can be targets for retroviral infection (Jaenich, R.
Proc. Natl. Acad. Sci. USA 73: 1260-1264 (1976)). Efficient
infection of the blastomeres is obtained by enzymatic treatment to
remove the zona pellucida (Manipulating the Mouse Embryo, Hogan
eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
(1986)). The viral vector system used to introduce the transgene is
typically a replication-defective retrovirus carrying the transgene
(Jahner et al. Proc. Natl. Acad. Sci. USA 82: 6927-6931 (1985)).
Van der Putten et al. Proc. Natl. Acad. Sci. USA 82: 6148-6152
(1985)). Transfection is easily and efficiently obtained by
culturing the blastomeres on a monolayer of virus-producing cells
(Van der Putten, supra; Stewart et al. EMBO J. 6: 383-388 (1987)).
Alternatively, infection can be performed at a later stage. Virus
or virus-producing cells can also be injected into the blastocoele
(Jahner et al. Nature 298: 623-628 (1982)). Most of the founders
will be mosaic for the transgene since incorporation occurs only in
a subset of the cells which formed the transgenic animal. Further,
the founder may contain various retroviral insertions of the
transgene at different positions in the genome which generally will
segregate in the offspring. In addition, it is also possible to
introduce transgenes into the germ line by intrauterine retroviral
infection of the midgestation embryo (Jahner et al. (1982)
supra).
[0319] Insertion of the transgene construct into the ES cells can
be accomplished using a variety of methods well known in the art
including for example, electroporation, microinjection, and calcium
phosphate treatment. A preferred method of insertion is
electroporation, in which the ES cells and the transgene construct
DNA are exposed to an electric pulse using an electroporation
machine and following the manufacturer's guidelines for use. After
electroporation, the ES cells are typically allowed to recover
under suitable incubation conditions. The cells are then screened
for the presence of the transgene.
D. Implantation of Embryos
[0320] Pseudopregnant, foster or surrogate mothers are prepared for
the purpose of implanting embryos, which have been modified by
introducing the transgene. Such foster mothers are typically
prepared by mating with vasectomized males of the same species. The
stage of the pseudopregnant foster mother is important for
successful implantation, and it is species dependent. For mice,
this stage is about 2-3 days pseudopregnant. Recipient females are
mated at the same time as donor females. Although the following
description relates to mice, it can be adapted for any other
non-human mammal by those skilled in the art. At the time of embryo
transfer, the recipient females are anesthetized with an
intraperitoneal injection of 0.015 ml of 2.5% avertin per gram of
body weight. The oviducts are exposed by a single midline dorsal
incision. An incision is then made through the body wall directly
over the oviduct. The ovarian bursa is then torn with watchmaker's
forceps. Embryos to be transferred are placed in DPBS (Dulbecco's
phosphate buffered saline) and in the tip of a transfer pipet
(about 10 to 12 embryos). The pipet tip is inserted into the
infundibulum and the embryos transferred. After the transfer, the
incision is closed by two sutures. The number of embryos implanted
into a particular host will vary by species, but will usually be
comparable to the number of offspring the species naturally
produces.
[0321] Where the ES cell have been used to introduce the transgene,
the transformed ES cells are incorporated into the embryo as
described earlier, and the embryos may be implanted into the uterus
of a pseudopregnant foster mother for gestation.
E. Screening for the Presence or Expression of Transgene
[0322] Transgenic offspring of the surrogate host may be screened
for the presence and/or expression of the transgene by any suitable
method. Offspring that are born to the foster mother may be
screened initially for mosaic coat color where the coat color
selection strategy (as described above) has been employed.
Alternatively, or additionally, screening is often accomplished by
Southern blot or PCR of DNA prepared from tail tissue, using a
probe that is complementary to at least a portion of the transgene.
Western blot analysis or immunohistochemistry using an antibody
against the protein encoded by the transgene may be employed as an
alternative or additional method for screening for the presence of
the transgene product. Alternatively, the tissues or cells believed
to express the transgene at the highest levels are tested for the
RNA expression of the transgene using Northern analysis or
RT-PCR.
[0323] Alternative or additional methods for evaluating the
presence of the transgene include, without limitation, suitable
biochemical assays such as enzyme and/or immunological assays,
histological stains for particular marker or enzyme activities,
flow cytometric analysis, and the like. Analysis of the blood may
also be useful to detect the presence of the transgene product in
the blood, as well as to evaluate the effect of the transgene on
the levels of various types of blood cells and other blood
constituents.
F. Breeding of the Transgenic Animals
[0324] Progeny of the transgenic animals may be obtained by mating
the transgenic animal with a suitable partner, or by in vitro
fertilization of eggs and/or sperm obtained from the transgenic
animal. Where mating with a partner is to be performed, the partner
may or may not be transgenic; where it is transgenic, it may
contain the same or a different transgene, or both. Alternatively,
the partner may be a parental line. Where in vitro fertilization is
used, the fertilized embryo may be implanted into a surrogate host
or incubated in vitro, or both. Using either method, the progeny
may be evaluated for the presence of the transgene using methods
described above, or other appropriate methods. Typically, crossing
and backcrossing is accomplished by mating siblings or a parental
strain with an offspring, depending on the goal of each particular
step in the breeding process.
[0325] A preferred embodiment of the invention relates to mice that
lack both alleles for antibody heavy chain (IgH-KOAH.sup.-/-), and
have very low levels of circulating antibodies (Kitamura et al.,
Nature 350:423-426 (1991)). In one aspect, the invention concerns a
transgenic non-human mammal that produces in its B-cells GIPF
protein or a fragment thereof. The transgenic mammal has stably
integrated into its genome a nucleic acid sequence encoding GIPF or
a fragment thereof having the biological activity of the native
protein, operably linked to transcriptional regulatory sequences
directing its expression in B-cells. The transcriptional regulatory
sequences preferably comprise a B-cell specific promoter, such as
the immunoglobulin kappa chain promoter. Without limitation, the
non-human transgenic mammal may, for example, be mouse, rat,
rabbit, pig, goat, goat or cattle.
[0326] 4.2.7 Crypt Cell and Tissue Growth Activity
[0327] The GIPF polypeptide of the invention exhibits growth factor
activity and is involved in the proliferation and differentiation
of intestinal crypt cells. GIPF may also exhibit growth factor
activity on other epithelial cells of the gastrointestinal tract.
Administration of the polypeptide of the invention to crypt cells
in vivo or ex vivo may maintain and expand cell populations in a
totipotential state which would be useful for re-engineering
damaged or diseased tissues, transplantation, manufacture of
bio-pharmaceuticals and the development of bio-sensors. The ability
to produce large quantities of human cells has important working
applications for the production of human proteins which currently
must be obtained from non-human sources or donors, implantation of
cells to treat tissues for grafting such gastrointestinal
cells.
[0328] It is contemplated that multiple different exogenous growth
factors and/or cytokines may be administered in combination with
the polypeptide of the invention to achieve the desired effect,
including any of the growth factors listed herein, other stem cell
maintenance factors, and specifically including stem cell factor
(SCF), leukemia inhibitory factor (LIF), Flt-3 ligand (Flt-3L), any
of the interleukins, recombinant soluble IL-6 receptorfused to
IL-6, macrophage inflammatory protein 1-alpha (MIP-1-alpha), G-CSF,
GM-CSF, thrombopoietin (TPO), platelet factor 4 (PF-4),
platelet-derived growth factor (PDGF), neural growth factors, basic
fibroblast growth factor (bFGF), keratinocyte growth factor-2
(KGF2), and glucagons-like peptide 2 (GLP-2).
[0329] Intestinal epithelial cells including crypt cells can be
transfected with a polynucleotide of the invention to induce
autocrine expression of the polypeptide of the invention. This will
allow for generation of undifferentiated cell lines that are useful
as is or that can then be differentiated into the desired mature
cell types. These stable cell lines can also serve as a source of
undifferentiated mRNA to create cDNA libraries and templates for
polymerase chain reaction experiments. These studies would allow
for the isolation and identification of differentially expressed
genes in crypt cell populations that regulate crypt proliferation
and/or maintenance.
[0330] Expansion and maintenance of epithelial stem cell
populations will be useful in the treatment of many pathological
conditions. For example, polypeptides of the present invention may
be used to manipulate crypt cells in culture to give rise to
gastrointestinal epithelial cells that can be used to augment or
replace cells damaged by illness, autoimmune disease, accidental
damage or genetic disorders, inflammation caused by ionizing
radiation, chemotherapy, infection and inflammation.
[0331] Expression of the polypeptide of the invention and its
effect on crypt cells can also be manipulated to achieve controlled
differentiation of the crypt cells into more differentiated cell
types. A broadly applicable method of obtaining pure populations of
a specific differentiated cell type from undifferentiated stem cell
populations involves the use of a cell-type specific promoter
driving a selectable marker
[0332] In vitro cultures of intestinal epithelial cells including
crypt cells can be used to determine if the polypeptide of the
invention exhibits growth factor activity. Crypt cells are isolated
from disaggregated colonic crypts from human and murine colonic
mucosa, and the clonogenic activity of GIPF can be assessed using
the method described by Whitehead et al., Gastroenterology
117:858-865 (1999), which is herein incorporated by reference in
its entirety. Growth factor activity may be assed in the presence
of the polypeptide of the invention alone or in combination with
other growth factors or cytokines.
[0333] The compositions of the present invention may also be useful
for proliferation of intestinal epithelial cells including crypt
cells and for regeneration of oral and gastrointestinal tissue,
i.e. for the treatment of injuries sustained by the epithelial
layer which involve degeneration, death or trauma to epithelial
crypt cells. More specifically, a composition may be used in the
treatment of diseases of the gastrointestinal tract as recited
herein.
[0334] Compositions of the invention may also be useful to promote
better or faster closure of non-healing wounds, including without
limitation pressure ulcers, ulcers associated with vascular
insufficiency, surgical and traumatic wounds, and the like. Assays
for wound healing activity include, without limitation, those
described in: Winter, Epidermal Wound Healing, pp. 71-112 (Maibach,
H. I. and Rovee, D. T., eds.), Year Book Medical Publishers, Inc.,
Chicago, as modified by Eaglstein and Mertz, J. Invest. Dermatol
71:382-84 (1978).
[0335] 4.2.8 Immunomodulatory Activity
[0336] A polypeptide of the present invention may exhibit activity
relating to regulation of immune system components including, but
not limited to cytokine production and/or activity, and/or cells of
the immune system. A polynucleotide of the invention can encode a
polypeptide exhibiting such attributes. Regulation of cytokines
and/or cells of the immune system may include increasing and/or
decreasing levels of cytokines or numbers of particular cells of
the immune system.
[0337] With such immunomodulatory activity, polypeptides of the
invention may be used to treat various immune disorders. These
disorders include, but are not limited to inflammatory bowel
disease (IBD), which includes ulcerative colitis and/or Crohn's
disease, and mucositis as a consequence of anti-cancer therapies
including radiation treatment and/or chemotherapy. The cause of
these immune disorders may be, for example, idiopathic (i.e. of
unknown cause), genetic, by infectious agents (eg. viruses,
bacteria, fungi), and/or by damage induced by anti-cancer therapies
(eg. radiation therapy and/or chemotherapy).
[0338] Modulation of immune responses and/or components of the
immune system may be accomplished in a number of ways.
Down-regulation may be in the form of inhibiting or blocking an
immune response already in progress or may involve preventing the
induction of an immune response. The functions of activated T cells
may be inhibited by suppressing T cell responses or by inducing
specific tolerance in T cells, or both. Immunosuppression of T cell
responses is generally an active, non-antigen-specific, process
that requires continuous exposure of the T cells to the suppressive
agent. Tolerance, which involves inducing non-responsiveness or
anergy in T cells, is distinguishable from immunosuppression in
that it is generally antigen-specific and persists after exposure
to the tolerizing agent has ceased. Operationally, tolerance can be
demonstrated by the lack of a T cell response upon reexposure to
specific antigen in the absence of tolerizing agent.
[0339] Inflammatory bowel disease is almost always mediated by one
of two pathways: excessive T helper 1 (Th1)-cell response
associated with high levels of IL-12, IFN-gamma, and/or TNF or
excessive T helper 2 (Th2)-cell response associated with high
levels of IL-4, IL-5, and/or IL-13 (Bouma et al., herein
incorporated by reference in its entirety). Therefore a mechanism
through which polypeptides of the invention could mediate
immunomodulatory activity in disease treatment would be to
down-regulate the numbers of Th1 and/or Th2 cell populations.
Alternatively, another activity could be to decrease the levels of
cytokines (eg. IL-12, IFN-gamma, TNF, IL-4, IL-5, and/or IL-13)
that are associated with and/or mediate the inflammatory
response.
[0340] The activity of the polypeptide of the present invention
may, among other means, be measured by the following methods:
[0341] Assays for T-cell or thymocyte proliferation include without
limitation those described in: Current Protocols in Immunology, Ed
by J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach,
W. Strober, Pub. Greene Publishing Associates and
Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte
Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Takai
et al., J. Immunol. 137:3494-3500, 1986; Bertagnolli et al., J.
Immunol. 145:1706-1712, 1990; Bertagnolli et al., Cellular
Immunology 133:327-341, 1991; Bertagnolli, et al., I. Immunol.
149:3778-3783, 1992; Bowman et al., I. Immunol. 152:1756-1761,
1994.
[0342] Assays for cytokine production and/or proliferation of
spleen cells, lymph node cells or thymocytes include, without
limitation, those described in: Polyclonal T cell stimulation,
Kruisbeek, A. M. and Shevach, E. M. In Current Protocols in
Immunology. J. E. e.a. Coligan eds. Vol 1 pp. 3.12.1-3.12.14, John
Wiley and Sons, Toronto. 1994; and Measurement of mouse and human
interferon-.gamma., Schreiber, R. D. In Current Protocols in
Immunology. J. E. e.a. Coligan eds. Vol 1 pp. 6.8.1-6.8.8, John
Wiley and Sons, Toronto. 1994.
[0343] Assays for T-cell clone responses to antigens (which will
identify, among others, proteins that affect APC-T cell
interactions as well as direct T-cell effects by measuring
proliferation and cytokine production) include, without limitation,
those described in: Current Protocols in Immunology, Ed by J. E.
Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach, W
Strober, Pub. Greene Publishing Associates and Wiley-Interscience
(Chapter 3, In Vitro assays for Mouse Lymphocyte Function; Chapter
6, Cytokines and their cellular receptors; Chapter 7, Immunologic
studies in Humans); Weinberger et al., Proc. Natl. Acad. Sci. USA
77:6091-6095, 1980; Weinberger et al., Eur. J. Immun. 11:405-411,
1981; Takai et al., J. Immunol. 137:3494-3500, 1986; Takai et al.,
J. Immunol. 140:508-512, 1988.)
[0344] 4.2.9 Chemotactic/Chemokinetic Activity
[0345] A polypeptide of the present invention may be involved in
chemotactic or chemokinetic activity for mammalian cells,
including, for example, monocytes, fibroblasts, neutrophils,
T-cells, mast cells, eosinophils, epithelial and/or endothelial
cells. A polynucleotide of the invention can encode a polypeptide
exhibiting such attributes. Chemotactic and chemokinetic receptor
activation can be used to mobilize or attract a desired cell
population to a desired site of action. Chemotactic or chemokinetic
compositions (e.g. proteins, antibodies, binding partners, or
modulators of the invention) provide particular advantages in
treatment of wounds and other trauma to tissues, as well as in
treatment of localized infections. For example, attraction of
lymphocytes, monocytes or neutrophils to tumors or sites of
infection may result in improved immune responses against a tumor
or an infecting agent.
[0346] A protein or peptide has chemotactic activity for a
particular cell population if it can stimulate, directly or
indirectly, the directed orientation or movement of such cell
population. Preferably, the protein or peptide has the ability to
directly stimulate directed movement of cells. Whether a particular
protein has chemotactic activity for a population of cells can be
readily determined by employing such protein or peptide in any
known assay for cell chemotaxis.
[0347] Assays for chemotactic activity (which will identify
proteins that induce or prevent chemotaxis) consist of assays that
measure the ability of a protein to induce the migration of cells
across a membrane as well as the ability of a protein to induce the
adhesion of one cell population to another cell population.
Suitable assays for movement and adhesion include, without
limitation, those described in: Current Protocols in Immunology, Ed
by J. E. Coligan, A. M. Kruisbeek, D. H. Marguiles, E. M. Shevach,
W. Strober, Pub. Greene Publishing Associates and
Wiley-Interscience (Chapter 6.12, Measurement of alpha and beta
Chemokines 6.12.1-6.12.28; Taub et al. J. Clin. Invest.
95:1370-1376, 1995; Lind et al. APMIS 103:140-146, 1995; Muller et
al Eur. J. Immunol. 25:1744-1748; Gruberetal. J. of Immunol.
152:5860-5867, 1994; Johnston et al. J. of Immunol. 153:1762-1768,
1994.
[0348] 4.2.10 Drug Screening
[0349] The transgenic non-human mammals and their progeny of the
present invention provide several important uses that will be
readily apparent to one of ordinary skill in the art. The
transgenic animals are particularly useful in screening compounds
that modulate (i.e. increase or decrease) the activity of the GIPF
polypeptides. Screening for a useful compound involves
administering the candidate compound over a range of doses to the
transgenic animal, and assaying at various time points for the
effect(s) of the compound on the activity of the GIPF protein. The
compound may be administered prior to or at the onset of abdominal
distension. Administration may be oral, or by suitable injection,
depending on the chemical nature of the compound being evaluated.
The cellular response to the compound is evaluated over time using
appropriate biochemical and/or histological assays.
[0350] Sources for test compounds that may be screened for ability
to bind to or modulate (i.e., increase or decrease) the activity of
polypeptides of the invention include (1) inorganic and organic
chemical libraries, (2) natural product libraries, and (3)
combinatorial libraries comprised of either random or mimetic
peptides, oligonucleotides or organic molecules.
[0351] Chemical libraries may be readily synthesized or purchased
from a number of commercial sources, and may include structural
analogs of known compounds or compounds that are identified as
"hits" or "leads" via natural product screening.
[0352] The sources of natural product libraries are microorganisms
(including bacteria and fungi), animals, plants or other
vegetation, or marine organisms, and libraries of mixtures for
screening may be created by: (1) fermentation and extraction of
broths from soil, plant or marine microorganisms or (2) extraction
of the organisms themselves. Natural product libraries include
polyketides, non-ribosomal peptides, and (non-naturally occurring)
variants thereof. For a review, see Science 282:63-68 (1998).
[0353] Combinatorial libraries are composed of large numbers of
peptides, oligonucleotides or organic compounds and can be readily
prepared by traditional automated synthesis methods, PCR, cloning
or proprietary synthetic methods. Of particular interest are
peptide and oligonucleotide combinatorial libraries. Still other
libraries of interest include peptide, protein, peptidomimetic,
multiparallel synthetic collection, recombinatorial, and
polypeptide libraries. For a review of combinatorial chemistry and
libraries created therefrom, see Myers, Curr. Opin. Biotechnol.
8:701-707 (1997). For reviews and examples of peptidomimetic
libraries, see Al-Obeidi et al., Mol. Biotechnol, 9(3):205-23
(1998); Hruby et al., Curr Opin Chem Biol, 1(1):114-19 (1997);
Dorner et al., Bioorg Med Chem, 4(5):709-15 (1996) (alkylated
dipeptides).
[0354] 4.3 Diseases Amenable to GIPF Therapy
[0355] In one aspect, the present invention provides pharmaceutical
reagents and methods useful for treating diseases and conditions
wherein epithelialization is desired. GIPF polypeptides are useful
to increase cytoprotection, proliferation and/or differentiation of
epithelial cells of the oral and gastrointestinal tract.
Specifically, GIPF polypeptides are useful to treat or prevent
diseases or conditions that include without limitation
gastrointestinal diseases, mucositis of the gastrointestinal tract,
mucositis of the oropharynx, lips and esophagus (oral mucositis),
inflammatory bowel disease, short bowel syndrome, gastric and
duodenal ulcers, erosions of the gastrointestinal tract including
erosive gastritis, esophagitis, esophageal reflux and other
conditions including wounds, burns, ophthalmic disorders, and any
disorder where stimulation of epithelial cell proliferation or
regeneration is desired. Treatment of diseases that result in
insufficient production of mucus throughout the oral and
gastrointestinal tract is also contemplated.
[0356] Mucositis, which includes oral and gastrointestinal
mucositis, is a complication of some cancer therapies in which the
lining of the digestive system becomes inflamed. GIPF is useful for
preventing and/or ameliorating the degeneration of the mucosa of
the alimentary tract that is caused by chemotherapy and/or
radiation therapy given to a patient for the treatment of cancer,
or is given as an adjuvant therapy following the removal of a
tumor. Exemplary chemotherapeutic agents include, without
limitation, BCNU, busulfan, carboplatin, cyclophosphamide,
tannorubicin, doxorubicin, etoposide, 5-fluorouracil, gemcitabine,
ifophamide, irinotecan, melphalan, methotrexate, navelbine,
topotecan, and taxol, and exemplary treatment regimens include
without limitation, BEAM (busulfan, etoposide, cytosine,
arabinoside, methotrexate); cyclophosphamide and total body
irradiation; cyclophosphamine, total body irradiation and
etoposide; cyclophosphamide and busulfan; and 5-fluorouracil with
leucovorin or levamisole. Treatment, pretreatment or post-treatment
with GIPF is useful to generate a cytoprotective effect or
regeneration or both, for example, of the mucosa of the small
intestine and colon, allowing increased dosages of therapies while
reducing their potential side effects.
[0357] Inflammatory bowel disease that can be treated with GIPF
includes general inflammatory bowel disease that is characterized
by chronic, relapsing, inflammatory disorders of unknown origin,
Crohn's disease, dysplasia associated with inflammatory bowel
disease, intermediate colitis, ulcerative colitis; non-infectious
colitis including active colitis, antibiotic-associated colitis,
collagenous colitis, diversion colitis, eosinophilic colitis, graft
versus host disease, granulomatous colitis, ischaemic colitis,
hemorrhagic colitis, malacoplakia, necrotizing enterocolitis,
radiation enterocolitis, typhlitis; infectious colitis including
adenovirus and amebic colitis, balantidiasis, HSV/AIDS associated
colitis, and colitis caused by trypanosomes, E. coli, Mycobacterium
avium intracellulare, Sotavirus, Salmonella, Shigella,
Campylobacter jejuni, Clostridium, Botulinum, and colitis
associated with schistosomiasis, spirochetosis, syphilis,
trichuriasis, tuberculosis typhoid fever, Vibrio cholera, and
Yersinia.
[0358] Short bowel syndrome is a group of problems affecting people
who have had half or more of their small intestine removed. The
most common reason for removing part of the small intestine is to
treat Crohn's disease. In addition, surgical resection of part of
the intestine may be required to remove cancerous growths. Diarrhea
is the main symptom of short bowel syndrome. Other symptoms include
cramping, bloating, and heartburn. Many people with short bowel
syndrome are malnourished because their remaining small intestine
is unable to absorb enough water, vitamins, and other nutrients
from food. They may also become dehydrated, which can be life
threatening. Problems associated with dehydration and malnutrition
include weakness, fatigue, depression, weight loss, bacterial
infections, and food sensitivities. Short bowel syndrome is treated
through changes in diet, intravenous feeding, vitamin and mineral
supplements, and medicine to relieve symptoms. GIPF polypeptides
may be useful to increase the proliferation of the unresected
intestinal tissue, thereby increasing the absorptive surface area
of the intestine, and ameliorate the symptoms associated with short
bowel syndrome.
[0359] The cytoprotective and/or regenerative activity of GIPF
polypeptides can be tested in in vivo models of radiation induced
mucositis (Withers and Elkind, Int J Radiat 17:261-267 (1970),
herein incorporated by reference) in in vivo chemotherapy-induced
mucositis (Soris et al., Oral Surg Oral Med Oral Pathol 69:437-443
(1990); Moore, Cancer Chemother Pharmacol 15:11-15 (1985); Farell
et al., Cell Prolif 35:78-85 (2002), all of which are incorporated
by reference in their entirety); in a dextran sulfate sodium (DSS)
model of colitis and small intestinal ulceration or inflammation
(Jeffers et al., Gastroenterology 123:1151-1162 (2002), Han et al.,
Am J Physiol Gastrointest Liver Physiol 279:G1011-G1022 (2000); and
in a surgical model of short bowel syndrome (SBS) (Scott et al. Am
J Physiol G911-G921 (1998); Helmrath et al., J Am Coll Surg
183:441-449 (1996)), herein incorporated by reference in their
entirety).
[0360] Comparisons of GIPF mRNA and protein expression levels
between diseased cells, tissue and corresponding normal samples are
made to determine if the subject is responsive to GIPF therapy.
Methods for detecting and quantifying the expression of GIPF
polypeptide mRNA or protein use standard nucleic acid and protein
detection and quantitation techniques that are well known in the
art and are described in Sambrook, et al., Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory, NY (1989) or
Ausubel, et al., Current Protocols in Molecular Biology, John Wiley
& Sons, New York, N.Y. (1989), both of which are incorporated
herein by reference in their entirety. Standard methods for the
detection and quantification of GIPF mRNA include in situ
hybridization using labeled GIPF riboprobes (Gemou-Engesaeth, et
al., Pediatrics 109: E24-E32 (2002), herein incorporated by
reference in its entirety), Northern blot and related techniques
using GIPF polynucleotide probes (Kunzli, et al., Cancer 94: 228
(2002), herein incorporated by reference in its entirety, herein
incorporated by reference in its entirety), RT-PCR analysis using
GIPF-specific primers (Angchaiskisiri, et al., Blood 99:130
(2002)), and other amplification detection methods, such as
branched chain DNA solution hybridization assay (Jardi, et al., J.
Viral Hepat. 8:465-471 (2001), herein incorporated by reference in
its entirety), transcription-mediated amplification (Kimura, et
al., J. Clin. Microbiol. 40:439-445 (2002)), microarray products,
such as oligos, cDNAs, and monoclonal antibodies, and real-time PCR
(Simpson, et al., Molec. Vision, 6:178-183 (2000), herein
incorporated by reference in its entirety). Standard methods for
the detection and quantification of GIPF protein include western
blot analysis (Sambrook, et al., Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory, NY (1989), Ausubel, et al.,
Current Protocols in Molecular Biology, John Wiley & Sons, New
York, N.Y. (1989)), immunocytochemistry (Racila, et al., Proc.
Natl. Acad. Sci. USA 95:4589-4594 (1998) supra), and a variety of
immunoassays, including enzyme-linked immunosorbant assay (ELISA),
radioimmuno assay (RIA), and specific enzyme immunoassay (EIA)
(Sambrook, et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory, NY (1989), Ausubel, et al., Current
Protocols in Molecular Biology, John Wiley & Sons, New York,
N.Y. (1989)).
[0361] The diseases and conditions treatable by methods of the
present invention preferably occur in mammals. Mammals include, for
example, humans and other primates, as well as pet or companion
animals such as dogs and cats, laboratory animals such as rats,
mice and rabbits, and farm animals such as horses, pigs, sheep, and
cattle.
[0362] 4.3.1 Therapeutic Methods
[0363] The compositions (including polypeptide fragments, analogs,
variants and antibodies or other binding partners or modulators
including antisense polynucleotides) of the invention have numerous
applications in a variety of therapeutic methods. Examples of
therapeutic applications include, but are not limited to, those
exemplified herein.
[0364] One embodiment of the invention is the administration of an
effective amount of GIPF polypeptides or other composition of the
invention to individuals affected by a disease or disorder that can
be treated the peptides of the invention. While the mode of
administration is not particularly important, parenteral
administration is preferred. Exemplary modes of administration are
to deliver a subcutaneous or intravenous bolus. The dosage of GIPF
polypeptides or other composition of the invention will normally be
determined by the prescribing physician. It is to be expected that
the dosage will vary according to the age, weight, condition and
response of the individual patient. Typically, the amount of
polypeptide administered per dose will be in the range of about
0.01 .mu.g/kg to 100 mg/kg of body weight, with the preferred dose
being about 0.1 .mu.g/kg to 10 mg/kg of patient body weight. For
parenteral administration, GIPF polypeptides of the invention will
be formulated in an injectable form combined with a
pharmaceutically acceptable parenteral vehicle. Such vehicles are
well known in the art and examples include water, saline, Ringer's
solution, dextrose solution, and solutions consisting of small
amounts of the human serum albumin. The vehicle may contain minor
amounts of additives that maintain the isotonicity and stability of
the polypeptide or other active ingredient. The preparation of such
solutions is within the skill of the art.
[0365] 4.3.2 Pharmaceutical Formulations
[0366] A protein or other composition of the present invention
(from whatever source derived, including without limitation from
recombinant and non-recombinant sources and including antibodies
and other binding partners of the polypeptides of the invention)
may be administered to a patient in need, by itself, or in
pharmaceutical compositions where it is mixed with suitable
carriers or excipient(s) at doses to treat or ameliorate a variety
of disorders. Such a composition may optionally contain (in
addition to protein or other active ingredient and a carrier)
diluents, fillers, salts, buffers, stabilizers, solubilizers, and
other materials well known in the art. The term "pharmaceutically
acceptable" means a non-toxic material that does not interfere with
the effectiveness of the biological activity of the active
ingredient(s). The characteristics of the carrier will depend on
the route of administration. The pharmaceutical composition of the
invention may also contain cytokines, lymphokines, or other
hematopoietic factors and various growth factors such as any of the
FGFs, epidermal growth factor (EGF), platelet-derived growth factor
(PDGF), transforming growth factors (TGF-.alpha. and TGF-.beta.),
insulin-like growth factor (IGF), keratinocyte growth factor (KGF),
and the like, as well as cytokines described herein.
[0367] The pharmaceutical composition may further contain other
agents which either enhance the activity of the protein or other
active ingredient or complement its activity or use in treatment.
Such additional factors and/or agents may be included in the
pharmaceutical composition to produce a synergistic effect with
protein or other active ingredient of the invention, or to minimize
side effects. Conversely, protein or other active ingredients of
the present invention may be included in formulations of the
particular cytokine, lymphokine, other hematopoietic factor,
thrombolytic or anti-thrombotic factor, or anti-inflammatory agent
to minimize side effects of the clotting factor, cytokine,
lymphokine, other hematopoietic factor, thrombolytic or
anti-thrombotic factor, or anti-inflammatory agent (such as IL-1
Ra, IL-1 Hy1, IL-1 Hy2, anti-TNF, corticosteroids,
immunosuppressive agents). A protein of the present invention may
be active in multimers (e.g., heterodimers or homodimers) or
complexes with itself or other proteins. As a result,
pharmaceutical compositions of the invention may comprise a protein
of the invention in such multimeric or complexed form.
[0368] As an alternative to being included in a pharmaceutical
composition of the invention including a first protein, a second
protein or a therapeutic agent may be concurrently administered
with the first protein (e.g., at the same time, or at differing
times provided that therapeutic concentrations of the combination
of agents is achieved at the treatment site). Techniques for
formulation and administration of the compounds of the instant
application may be found in "Remington's Pharmaceutical Sciences,"
Mack Publishing Co., Easton, Pa., latest edition. A therapeutically
effective dose further refers to that amount of the compound
sufficient to result in amelioration of symptoms, e.g., treatment,
healing, prevention or amelioration of the relevant medical
condition, or an increase in rate of treatment, healing, prevention
or amelioration of such conditions. When applied to an individual
active ingredient, administered alone, a therapeutically effective
dose refers to that ingredient alone. When applied to a
combination, a therapeutically effective dose refers to combined
amounts of the active ingredients that result in the therapeutic
effect, whether administered in combination, serially or
simultaneously.
[0369] In practicing the method of treatment or use of the present
invention, a therapeutically effective amount of protein or other
active ingredient of the present invention is administered to a
mammal having a condition to be treated. Protein or other active
ingredient of the present invention may be administered in
accordance with the method of the invention either alone or in
combination with other therapies such as treatments employing
cytokines, lymphokines or other hematopoietic factors. When
co-administered with one or more cytokines, lymphokines or other
hematopoietic factors, protein or other active ingredient of the
present invention may be administered either simultaneously with
the cytokine(s), lymphokine(s), other hematopoietic factor(s),
thrombolytic or anti-thrombotic factors, or sequentially. If
administered sequentially, the attending physician will decide on
the appropriate sequence of administering protein or other active
ingredient of the present invention in combination with
cytokine(s), lymphokine(s), other hematopoietic factor(s),
thrombolytic or anti-thrombotic factors.
[0370] 4.3.3 Routes of Administration
[0371] Suitable routes of administration may, for example, include
oral, rectal, transmucosal, or intestinal administration;
parenteral delivery, including intramuscular, subcutaneous,
intramedullary injections, as well as intrathecal, direct
intraventricular, intravenous, intraperitoneal, intranasal, or
intraocular injections. Administration of protein or other active
ingredient of the present invention used in the pharmaceutical
composition or to practice the method of the present invention can
be carried out in a variety of conventional ways, such as oral
ingestion, inhalation, topical application or cutaneous,
subcutaneous, intraperitoneal (IP), parenteral or intravenous
injection. Intravenous administration to the patient is
preferred.
[0372] Alternatively, one may administer the compound in a local
rather than systemic manner, for example, via injection of the
compound directly into the tissue, often in a depot or sustained
release formulation.
[0373] In another embodiment, the implantation of cells producing
GIPF (cell therapy) into a subject in need of proliferation and/or
stimulation of epithelial cells is contemplated. Cells that do not
normally express GIPF or that express low levels of GIPF may be
modified to produce therapeutic levels of GIPF by transformation
with a polynucleotide that encodes GIPF. The cells may be of the
same species as the subject, or may be derived from a different
species. Preferably, the cells are derived from the subject in need
of GIPF therapy. Human or nonhuman cells may be implanted in a
subject using a biocompatible, semi-permeable polymeric enclosure
to allow release of GIPF protein, or may be implanted directly
without encapsulation.
[0374] In another embodiment, in vivo gene therapy is contemplated.
A nucleotide sequence encoding GIPF is introduced directly into a
subject for secretion of the protein to prevent or treat the
diseases as recited herein. The nucleotide encoding GIPF may be
injected directly into the tissue to be treated, or it may be
delivered into the cells of the affected tissue by a viral vector
e.g. adenovirus vector or retrovirus vector. Physical transfer of
appropriate vectors containing a GIPF-encoding nucleic acid may
also be achieved by methods including liposome-mediated transfer,
direct injection of naked DNA, receptor-mediated transfer, or
microparticle bombardment.
[0375] The polypeptides of the invention are administered by any
route that delivers an effective dosage to the desired site of
action. The determination of a suitable route of administration and
an effective dosage for a particular indication is within the level
of skill in the art. Preferably for wound treatment, one
administers the therapeutic compound directly to the site. Suitable
dosage ranges for the polypeptides of the invention can be
extrapolated from these dosages or from similar studies in
appropriate animal models. Dosages can then be adjusted as
necessary by the clinician to provide maximal therapeutic
benefit.
[0376] 4.3.4 Compositions/Formulations
[0377] Pharmaceutical compositions for use in accordance with the
present invention thus may be formulated in a conventional manner
using one or more physiologically acceptable carriers comprising
excipients and auxiliaries which facilitate processing of the
active compounds into preparations which can be used
pharmaceutically. These pharmaceutical compositions may be
manufactured in a manner that is itself known, e.g., by means of
conventional mixing, dissolving, granulating, dragee-making,
levigating, emulsifying, encapsulating, entrapping or lyophilizing
processes. Proper formulation is dependent upon the route of
administration chosen. When a therapeutically effective amount of
protein or other active ingredient of the present invention is
administered orally, protein or other active ingredient of the
present invention will be in the form of a tablet, capsule, powder,
solution or elixir. When administered in tablet form, the
pharmaceutical composition of the invention may additionally
contain a solid carrier such as a gelatin or an adjuvant. The
tablet, capsule, and powder contain from about 5 to 95% protein or
other active ingredient of the present invention, and preferably
from about 25 to 90% protein or other active ingredient of the
present invention. When administered in liquid form, a liquid
carrier such as water, petroleum, oils of animal or plant origin
such as peanut oil, mineral oil, soybean oil, or sesame oil, or
synthetic oils may be added. The liquid form of the pharmaceutical
composition may further contain physiological saline solution,
dextrose or other saccharide solution, or glycols such as ethylene
glycol, propylene glycol or polyethylene glycol. When administered
in liquid form, the pharmaceutical composition contains from about
0.5 to 90% by weight of protein or other active ingredient of the
present invention, and preferably from about 1 to 50% protein or
other active ingredient of the present invention.
[0378] When a therapeutically effective amount of protein or other
active ingredient of the present invention is administered by
intravenous, cutaneous or subcutaneous injection, protein or other
active ingredient of the present invention will be in the form of a
pyrogen-free, parenterally acceptable aqueous solution. The
preparation of such parenterally acceptable protein or other active
ingredient solutions, having due regard to pH, isotonicity,
stability, and the like, is within the skill in the art. A
preferred pharmaceutical composition for intravenous, cutaneous, or
subcutaneous injection should contain, in addition to protein or
other active ingredient of the present invention, an isotonic
vehicle such as Sodium Chloride Injection, Ringer's Injection,
Dextrose Injection, Dextrose and Sodium Chloride Injection,
Lactated Ringer's Injection, or other vehicle as known in the art.
The pharmaceutical composition of the present invention may also
contain stabilizers, preservatives, buffers, antioxidants, or other
additives known to those of skill in the art. For injection, the
agents of the invention may be formulated in aqueous solutions,
preferably in physiologically compatible buffers such as Hanks's
solution, Ringer's solution, or physiological saline buffer. For
transmucosal administration, penetrants appropriate to the barrier
to be permeated are used in the formulation. Such penetrants are
generally known in the art.
[0379] For oral administration, the compounds can be formulated
readily by combining the active compounds with pharmaceutically
acceptable carriers well known in the art. Such carriers enable the
compounds of the invention to be formulated as tablets, pills,
dragees, capsules, liquids, gels, syrups, slurries, suspensions and
the like, for oral ingestion by a patient to be treated.
Pharmaceutical preparations for oral use can be obtained solid
excipient, optionally grinding a resulting mixture, and processing
the mixture of granules, after adding suitable auxiliaries, if
desired, to obtain tablets or dragee cores. Suitable excipients
are, in particular, fillers such as sugars, including lactose,
sucrose, mannitol, or sorbitol; cellulose preparations such as, for
example, maize starch, wheat starch, rice starch, potato starch,
gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose,
and/or polyvinylpyrrolidone (PVP). If desired, disintegrating
agents may be added, such as the cross-linked polyvinyl
pyrrolidone, agar, or alginic acid or a salt thereof such as sodium
alginate. Dragee cores are provided with suitable coatings. For
this purpose, concentrated sugar solutions may be used, which may
optionally contain gum arabic, talc, polyvinyl pyrrolidone,
carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer
solutions, and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
[0380] Pharmaceutical preparations which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. All formulations for oral administration
should be in dosages suitable for such administration. For buccal
administration, the compositions may take the form of tablets or
lozenges formulated in conventional manner.
[0381] For administration by inhalation, the compounds for use
according to the present invention are conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebuliser, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of, e.g., gelatin for use in an inhaler or insufflator
may be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch. The compounds may
be formulated for parenteral administration by injection, e.g., by
bolus injection or continuous infusion. Formulations for injection
may be presented in unit dosage form, e.g., in ampules or in
multi-dose containers, with an added preservative. The compositions
may take such forms as suspensions, solutions or emulsions in oily
or aqueous vehicles, and may contain formulatory agents such as
suspending, stabilizing and/or dispersing agents.
[0382] Pharmaceutical formulations for parenteral administration
include aqueous solutions of the active compounds in water-soluble
form. Additionally, suspensions of the active compounds may be
prepared as appropriate oily injection suspensions. Suitable
lipophilic solvents or vehicles include fatty oils such as sesame
oil, or synthetic fatty acid esters, such as ethyl oleate or
triglycerides, or liposomes. Aqueous injection suspensions may
contain substances which increase the viscosity of the suspension,
such as sodium carboxymethyl cellulose, sorbitol, or dextran.
Optionally, the suspension may also contain suitable stabilizers or
agents which increase the solubility of the compounds to allow for
the preparation of highly concentrated solutions. Alternatively,
the active ingredient may be in powder form for constitution with a
suitable vehicle, e.g., sterile pyrogen-free water, before use.
[0383] The compounds may also be formulated in rectal compositions
such as suppositories or retention enemas, e.g., containing
conventional suppository bases such as cocoa butter or other
glycerides. In addition to the formulations described previously,
the compounds may also be formulated as a depot preparation. Such
long acting formulations may be administered by implantation (for
example subcutaneously or intramuscularly) or by intramuscular
injection. Thus, for example, the compounds may be formulated with
suitable polymeric or hydrophobic materials (for example as an
emulsion in an acceptable oil) or ion exchange resins, or as
sparingly soluble derivatives, for example, as a sparingly soluble
salt.
[0384] A pharmaceutical carrier for the hydrophobic compounds of
the invention is a co-solvent system comprising benzyl alcohol, a
nonpolar surfactant, a water-miscible organic polymer, and an
aqueous phase. The co-solvent system may be the VPD co-solvent
system. VPD is a solution of 3% w/v benzyl alcohol, 8% w/v of the
nonpolar surfactant polysorbate 80, and 65% w/v polyethylene glycol
300, made up to volume in absolute ethanol. The VPD co-solvent
system (VPD:5W) consists of VPD diluted 1:1 with a 5% dextrose in
water solution. This co-solvent system dissolves hydrophobic
compounds well, and itself produces low toxicity upon systemic
administration. Naturally, the proportions of a co-solvent system
may be varied considerably without destroying its solubility and
toxicity characteristics. Furthermore, the identity of the
co-solvent components may be varied: for example, other
low-toxicity nonpolar surfactants may be used instead of
polysorbate 80; the fraction size of polyethylene glycol may be
varied; other biocompatible polymers may replace polyethylene
glycol, e.g. polyvinyl pyrrolidone; and other sugars or
polysaccharides may substitute for dextrose. Alternatively, other
delivery systems for hydrophobic pharmaceutical compounds may be
employed. Liposomes and emulsions are well known examples of
delivery vehicles or carriers for hydrophobic drugs. Certain
organic solvents such as dimethylsulfoxide also may be employed,
although usually at the cost of greater toxicity. Additionally, the
compounds may be delivered using a sustained-release system, such
as semipermeable matrices of solid hydrophobic polymers containing
the therapeutic agent. Various types of sustained-release materials
have been established and are well known by those skilled in the
art. Sustained-release capsules may, depending on their chemical
nature, release the compounds for a few weeks up to over 100 days.
Depending on the chemical nature and the biological stability of
the therapeutic reagent, additional strategies for protein or other
active ingredient stabilization may be employed.
[0385] The pharmaceutical compositions also may comprise suitable
solid or gel phase carriers or excipients. Examples of such
carriers or excipients include but are not limited to calcium
carbonate, calcium phosphate, various sugars, starches, cellulose
derivatives, gelatin, and polymers such as polyethylene glycols.
Many of the active ingredients of the invention may be provided as
salts with pharmaceutically compatible counter ions. Such
pharmaceutically acceptable base addition salts are those salts
which retain the biological effectiveness and properties of the
free acids and which are obtained by reaction with inorganic or
organic bases such as sodium hydroxide, magnesium hydroxide,
ammonia, trialkylamine, dialkylamine, monoalkylamine, dibasic amino
acids, sodium acetate, potassium benzoate, triethanol amine and the
like.
[0386] The pharmaceutical composition of the invention may be in
the form of a complex of the protein(s) or other active ingredient
of present invention along with protein or peptide antigens. The
protein and/or peptide antigen will deliver a stimulatory signal to
both B and T lymphocytes. B lymphocytes will respond to antigen
through their surface immunoglobulin receptor. T lymphocytes will
respond to antigen through the T cell receptor (TCR) following
presentation of the antigen by MHC proteins. MHC and structurally
related proteins including those encoded by class I and class II
MHC genes on host cells will serve to present the peptide
antigen(s) to T lymphocytes. The antigen components could also be
supplied as purified MHC-peptide complexes alone or with
co-stimulatory molecules that can directly signal T cells.
Alternatively antibodies able to bind surface immunoglobulin and
other molecules on B cells as well as antibodies able to bind the
TCR and other molecules on T cells can be combined with the
pharmaceutical composition of the invention.
[0387] The pharmaceutical composition of the invention may be in
the form of a liposome in which protein of the present invention is
combined, in addition to other pharmaceutically acceptable
carriers, with amphipathic agents such as lipids which exist in
aggregated form as micelles, insoluble monolayers, liquid crystals,
or lamellar layers in aqueous solution. Suitable lipids for
liposomal formulation include, without limitation, monoglycerides,
diglycerides, sulfatides, lysolecithins, phospholipids, saponin,
bile acids, and the like. Preparation of such liposomal
formulations is within the level of skill in the art, as disclosed,
for example, in U.S. Pat. Nos. 4,235,871; 4,501,728; 4,837,028; and
4,737,323, all of which are incorporated herein by reference.
[0388] The amount of protein or other active ingredient of the
present invention in the pharmaceutical composition of the present
invention will depend upon the nature and severity of the condition
being treated, and on the nature of prior treatments which the
patient has undergone. Ultimately, the attending physician will
decide the amount of protein or other active ingredient of the
present invention with which to treat each individual patient.
Initially, the attending physician will administer low doses of
protein or other active ingredient of the present invention and
observe the patient's response. Larger doses of protein or other
active ingredient of the present invention may be administered
until the optimal therapeutic effect is obtained for the patient,
and at that point the dosage is not increased further. It is
contemplated that the various pharmaceutical compositions used to
practice the method of the present invention should contain about
0.01 .mu.g to about 100 mg (preferably about 0.1 .mu.g to about 10
mg, more preferably about 0.1 .mu.g to about 1 mg) of protein or
other active ingredient of the present invention per kg body
weight. For compositions of the present invention which are useful
for bone, cartilage, tendon or ligament regeneration, the
therapeutic method includes administering the composition
topically, systematically, or locally as an implant or device. When
administered, the therapeutic composition for use in this invention
is, of course, in a pyrogen-free, physiologically acceptable form.
Further, the composition may desirably be encapsulated or injected
in a viscous form for delivery to the site of bone, cartilage or
tissue damage. Topical administration may be suitable for wound
healing and tissue repair. Therapeutically useful agents other than
a protein or other active ingredient of the invention which may
also optionally be included in the composition as described above,
may alternatively or additionally, be administered simultaneously
or sequentially with the composition in the methods of the
invention. Preferably for bone and/or cartilage formation, the
composition would include a matrix capable of delivering the
protein-containing or other active ingredient-containing
composition to the site of bone and/or cartilage damage, providing
a structure for the developing bone and cartilage and optimally
capable of being resorbed into the body. Such matrices may be
formed of materials presently in use for other implanted medical
applications.
[0389] The choice of matrix material is based on biocompatibility,
biodegradability, mechanical properties, cosmetic appearance and
interface properties. The particular application of the
compositions will define the appropriate formulation. Potential
matrices for the compositions may be biodegradable and chemically
defined calcium sulfate, tricalcium phosphate, hydroxyapatite,
polylactic acid, polyglycolic acid and polyanhydrides. Other
potential materials are biodegradable and biologically
well-defined, such as bone or dermal collagen. Further matrices are
comprised of pure proteins or extracellular matrix components.
Other potential matrices are nonbiodegradable and chemically
defined, such as sintered hydroxyapatite, bioglass, aluminates, or
other ceramics. Matrices may be comprised of combinations of any of
the above mentioned types of material, such as polylactic acid and
hydroxyapatite or collagen and tricalcium phosphate. The
bioceramics may be altered in composition, such as in
calcium-aluminate-phosphate and processing to alter pore size,
particle size, particle shape, and biodegradability. Presently
preferred is a 50:50 (mole weight) copolymer of lactic acid and
glycolic acid in the form of porous particles having diameters
ranging from 150 to 800 microns. In some applications, it will be
useful to utilize a sequestering agent, such as carboxymethyl
cellulose or autologous blood clot, to prevent the protein
compositions from disassociating from the matrix.
[0390] A preferred family of sequestering agents is cellulosic
materials such as alkylcelluloses (including
hydroxyalkylcelluloses), including methylcellulose, ethylcellulose,
hydroxyethyl cellulose, hydroxypropylcellulose,
hydroxypropyl-methylcellulose, and carboxymethylcellulose, the most
preferred being cationic salts of carboxymethylcellulose (CMC).
Other preferred sequestering agents include hyaluronic acid, sodium
alginate, poly(ethylene glycol), polyoxyethylene oxide,
carboxyvinyl polymer and poly(vinyl alcohol). The amount of
sequestering agent useful herein is 0.5-20 wt %, preferably 1-10 wt
% based on total formulation weight, which represents the amount
necessary to prevent desorption of the protein from the polymer
matrix and to provide appropriate handling of the composition, yet
not so much that the progenitor cells are prevented from
infiltrating the matrix, thereby providing the protein the
opportunity to assist the osteogenic activity of the progenitor
cells. In further compositions, proteins or other active ingredient
of the invention may be combined with other agents beneficial to
the treatment of the bone and/or cartilage defect, wound, or tissue
in question. These agents include various growth factors such as
epidermal growth factor (EGF), platelet derived growth factor
(PDGF), transforming growth factors (TGF-.alpha. and TGF-.beta.),
and insulin-like growth factor (IGF).
[0391] The therapeutic compositions are also presently valuable for
veterinary applications. Particularly domestic animals and
thoroughbred horses, in addition to humans, are desired patients
for such treatment with proteins or other active ingredient of the
present invention. The dosage regimen of a protein-containing
pharmaceutical composition to be used in tissue regeneration will
be determined by the attending physician considering various
factors which modify the action of the proteins, e.g., amount of
tissue weight desired to be formed, the site of damage, the
condition of the damaged tissue, the size of a wound, type of
damaged tissue (e.g., bone), the patient's age, sex, and diet, the
severity of any infection, time of administration and other
clinical factors. The dosage may vary with the type of matrix used
in the reconstitution and with inclusion of other proteins in the
pharmaceutical composition. For example, the addition of other
known growth factors, such as IGF I (insulin like growth factor 1),
to the final composition, may also effect the dosage. Progress can
be monitored by periodic assessment of tissue/bone growth and/or
repair, for example, X-rays, histomorphometric determinations and
tetracycline labeling.
[0392] Polynucleotides of the present invention can also be used
for gene therapy. Such polynucleotides can be introduced either in
vivo or ex vivo into cells for expression in a mammalian subject.
Polynucleotides of the invention may also be administered by other
known methods for introduction of nucleic acid into a cell or
organism (including, without limitation, in the form of viral
vectors or naked DNA). Cells may also be cultured ex vivo in the
presence of proteins of the present invention in order to
proliferate or to produce a desired effect on or activity in such
cells. Treated cells can then be introduced in vivo for therapeutic
purposes.
[0393] 4.3.5 Effective Dosage
[0394] Pharmaceutical compositions suitable for use in the present
invention include compositions wherein the active ingredients are
contained in an effective amount to achieve its intended purpose.
More specifically, a therapeutically effective amount means an
amount effective to prevent development of or to alleviate the
existing symptoms of the subject being treated. Determination of
the effective amount is well within the capability of those skilled
in the art, especially in light of the detailed disclosure provided
herein. For any compound used in the method of the invention, the
therapeutically effective dose can be estimated initially from
appropriate in vitro assays. For example, a dose can be formulated
in animal models to achieve a circulating concentration range that
can be used to more accurately determine useful doses in humans.
For example, a dose can be formulated in animal models to achieve a
circulating concentration range that includes the IC.sub.50 as
determined in cell culture (i.e., the concentration of the test
compound which achieves a half-maximal inhibition of the protein's
biological activity). Such information can be used to more
accurately determine useful doses in humans.
[0395] A therapeutically effective dose refers to that amount of
the compound that results in amelioration of symptoms or a
prolongation of survival in a patient. Toxicity and therapeutic
efficacy of such compounds can be determined by standard
pharmaceutical procedures in cell cultures or experimental animals,
e.g., for determining the LD.sub.50 (the dose lethal to 50% of the
population) and the ED.sub.50 (the dose therapeutically effective
in 50% of the population). The dose ratio between toxic and
therapeutic effects is the therapeutic index and it can be
expressed as the ratio between LD.sub.50 and ED.sub.50. Compounds
which exhibit high therapeutic indices are preferred. The data
obtained from these cell culture assays and animal studies can be
used in formulating a range of dosage for use in human. The dosage
of such compounds lies preferably within a range of circulating
concentrations that include the ED.sub.50 with little or no
toxicity. The dosage may vary within this range depending upon the
dosage form employed and the route of administration utilized. The
exact formulation, route of administration and dosage can be chosen
by the individual physician in view of the patient's condition.
See, e.g., Fingl et al., 1975, in "The Pharmacological Basis of
Therapeutics", Ch. 1 p. 1. Dosage amount and interval may be
adjusted individually to provide plasma levels of the active moiety
which are sufficient to maintain the desired effects, or minimal
effective concentration (MEC). The MEC will vary for each compound
but can be estimated from in vitro data. Dosages necessary to
achieve the MEC will depend on individual characteristics and route
of administration. However, HPLC assays or bioassays can be used to
determine plasma concentrations.
[0396] Dosage intervals can also be determined using MEC value.
Compounds should be administered using a regimen which maintains
plasma levels above the MEC for 10-90% of the time, preferably
between 30-90% and most preferably between 50-90%. In cases of
local administration or selective uptake, the effective local
concentration of the drug may not be related to plasma
concentration.
[0397] An exemplary dosage regimen for polypeptides or other
compositions of the invention will be in the range of about 0.01
.mu.g/kg to 100 mg/kg of body weight daily, with the preferred dose
being about 0.1 .mu.g/kg to 25 mg/kg of patient body weight daily,
varying in adults and children. Dosing may be once daily, or
equivalent doses may be delivered at longer or shorter
intervals.
[0398] The amount of composition administered will, of course, be
dependent on the subject being treated, on the subject's age and
weight, the severity of the affliction, the manner of
administration and the judgment of the prescribing physician.
[0399] 4.3.6 Diagnostic Assays And Kits
[0400] The present invention further provides methods to identify
the presence or expression of one of the ORFs of the present
invention, or homolog thereof, in a test sample, using a nucleic
acid probe or antibodies of the present invention, optionally
conjugated or otherwise associated with a suitable label.
[0401] In general, methods for detecting a polynucleotide of the
invention can comprise contacting a sample with a compound that
binds to and forms a complex with the polynucleotide for a period
sufficient to form the complex, and detecting the complex, so that
if a complex is detected, a polynucleotide of the invention is
detected in the sample. Such methods can also comprise contacting a
sample under stringent hybridization conditions with nucleic acid
primers that anneal to a polynucleotide of the invention under such
conditions, and amplifying annealed polynucleotides, so that if a
polynucleotide is amplified, a polynucleotide of the invention is
detected in the sample.
[0402] In general, methods for detecting a polypeptide of the
invention can comprise contacting a sample with a compound that
binds to and forms a complex with the polypeptide for a period
sufficient to form the complex, and detecting the complex, so that
if a complex is detected, a polypeptide of the invention is
detected in the sample.
[0403] In detail, such methods comprise incubating a test sample
with one or more of the antibodies or one or more of the nucleic
acid probes of the present invention and assaying for binding of
the nucleic acid probes or antibodies to components within the test
sample.
[0404] Conditions for incubating a nucleic acid probe or antibody
with a test sample vary. Incubation conditions depend on the format
employed in the assay, the detection methods employed, and the type
and nature of the nucleic acid probe or antibody used in the assay.
One skilled in the art will recognize that any one of the commonly
available hybridization, amplification or immunological assay
formats can readily be adapted to employ the nucleic acid probes or
antibodies of the present invention. Examples of such assays can be
found in Chard, T., An Introduction to Radioimmunoassay and Related
Techniques, Elsevier Science Publishers, Amsterdam, The Netherlands
(1986); Bullock, G. R. et al., Techniques in Immunocytochemistry,
Academic Press, Orlando, Fla. Vol. 1 (1982), Vol. 2 (1983), Vol. 3
(1985); Tijssen, P., Practice and Theory of immunoassays:
Laboratory Techniques in Biochemistry and Molecular Biology,
Elsevier Science Publishers, Amsterdam, The Netherlands (1985). The
test samples of the present invention include cells, protein or
membrane extracts of cells, or biological fluids such as sputum,
blood, serum, plasma, or urine. The test sample used in the
above-described method will vary based on the assay format, nature
of the detection method and the tissues, cells or extracts used as
the sample to be assayed. Methods for preparing protein extracts or
membrane extracts of cells are well known in the art and can be
readily be adapted in order to obtain a sample which is compatible
with the system utilized.
[0405] In another embodiment of the present invention, kits are
provided which contain the necessary reagents to carry out the
assays of the present invention. Specifically, the invention
provides a compartment kit to receive, in close confinement, one or
more containers which comprises: (a) a first container comprising
one of the probes or antibodies of the present invention; and (b)
one or more other containers comprising one or more of the
following: wash reagents, reagents capable of detecting presence of
a bound probe or antibody.
[0406] In detail, a compartment kit includes any kit in which
reagents are contained in separate containers. Such containers
include small glass containers, plastic containers or strips of
plastic or paper. Such containers allows one to efficiently
transfer reagents from one compartment to another compartment such
that the samples and reagents are not cross-contaminated, and the
agents or solutions of each container can be added in a
quantitative fashion from one compartment to another. Such
containers will include a container which will accept the test
sample, a container which contains the antibodies used in the
assay, containers which contain wash reagents (such as phosphate
buffered saline, Tris-buffers, etc.), and containers which contain
the reagents used to detect the bound antibody or probe. Types of
detection reagents include labeled nucleic acid probes, labeled
secondary antibodies, or in the alternative, if the primary
antibody is labeled, the enzymatic, or antibody binding reagents
which are capable of reacting with the labeled antibody. One
skilled in the art will readily recognize that the disclosed probes
and antibodies of the present invention can be readily incorporated
into one of the established kit formats which are well known in the
art.
[0407] 4.3.7 Screening Assays
[0408] Using the isolated proteins and polynucleotides of the
invention, the present invention further provides methods of
obtaining and identifying modulatory agents which bind to a
polypeptide encoded by an ORF corresponding to the nucleotide
sequence set forth in SEQ ID NO: 2, 3, 5, 9, 11, 13, 15, 17, 84,
86, 88, 90, 92, 94, 96, 98, 100, 102, 104 or 177, or bind to a
specific domain of the polypeptide encoded by the nucleic acid. In
detail, said method comprises the steps of:
[0409] (a) contacting an agent with an isolated protein encoded by
an ORF of the present invention, or nucleic acid of the invention;
and
[0410] (b) determining whether the agent binds to said protein or
said nucleic acid.
[0411] The modulatory agents may increase or decrease the
proliferative activity of GIPF on epithelial cells.
[0412] In general, such methods for identifying compounds that bind
to a polynucleotide of the invention can comprise contacting a
compound with a polynucleotide of the invention for a time
sufficient to form a polynucleotide/compound complex, and detecting
the complex, so that if a polynucleotide/compound complex is
detected, a compound that binds to a polynucleotide of the
invention is identified.
[0413] Likewise, in general, therefore, such methods for
identifying compounds that bind to a polypeptide of the invention
can comprise contacting a compound with a polypeptide of the
invention for a time sufficient to form a polypeptide/compound
complex, and detecting the complex, so that if a
polypeptide/compound complex is detected, a compound that binds to
a polynucleotide of the invention is identified.
[0414] Methods for identifying compounds that bind to a polypeptide
of the invention can also comprise contacting a compound with a
polypeptide of the invention in a cell for a time sufficient to
form a polypeptide/compound complex, wherein the complex drives
expression of a target gene sequence in the cell, and detecting the
complex by detecting reporter gene sequence expression, so that if
a polypeptide/compound complex is detected, a compound that binds a
polypeptide of the invention is identified.
[0415] Compounds identified via such methods can include compounds
which modulate the activity of a polypeptide of the invention (that
is, increase or decrease its activity, relative to activity
observed in the absence of the compound). Alternatively, compounds
identified via such methods can include compounds which modulate
the expression of a polynucleotide of the invention (that is,
increase or decrease expression relative to expression levels
observed in the absence of the compound). Compounds, such as
compounds identified via the methods of the invention, can be
tested using standard assays well known to those of skill in the
art for their ability to modulate activity/expression.
[0416] The agents screened in the above assay can be, but are not
limited to, peptides, carbohydrates, vitamin derivatives, or other
pharmaceutical agents. The agents can be selected and screened at
random or rationally selected or designed using protein modeling
techniques.
[0417] For random screening, agents such as peptides,
carbohydrates, pharmaceutical agents and the like are selected at
random and are assayed for their ability to bind to the protein
encoded by the ORF of the present invention. Alternatively, agents
may be rationally selected or designed. As used herein, an agent is
said to be "rationally selected or designed" when the agent is
chosen based on the configuration of the particular protein. For
example, one skilled in the art can readily adapt currently
available procedures to generate peptides, pharmaceutical agents
and the like, capable of binding to a specific peptide sequence, in
order to generate rationally designed antipeptide peptides, for
example see Hurby et al., Application of Synthetic Peptides:
Antisense Peptides," In Synthetic Peptides, A User's Guide, W.H.
Freeman, NY (1992), pp. 289-307, and Kaspczak et al., Biochemistry
28:9230-8 (1989), or pharmaceutical agents, or the like.
[0418] In addition to the foregoing, one class of agents of the
present invention, as broadly described, can be used to control
gene expression through binding to one of the ORFs or EMFs of the
present invention. As described above, such agents can be randomly
screened or rationally designed/selected. Targeting the ORF or EMF
allows a skilled artisan to design sequence specific or element
specific agents, modulating the expression of either a single ORF
or multiple ORFs which rely on the same EMF for expression control.
One class of DNA binding agents are agents which contain base
residues which hybridize or form a triple helix formation by
binding to DNA or RNA. Such agents can be based on the classic
phosphodiester, ribonucleic acid backbone, or can be a variety of
sulfhydryl or polymeric derivatives which have base attachment
capacity.
[0419] Agents suitable for use in these methods usually contain 20
to 40 bases and are designed to be complementary to a region of the
gene involved in transcription (triple helix--see Lee et al., Nucl.
Acids Res. 6:3073 (1979); Cooney et al., Science 241:456 (1988);
and Dervan et al., Science 251:1360 (1991)) or to the mRNA itself
(antisense--Okano, J. Neurochem. 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988)). Triple helix-formation
optimally results in a shut-off of RNA transcription from DNA,
while antisense RNA hybridization blocks translation of an mRNA
molecule into polypeptide. Both techniques have been demonstrated
to be effective in model systems. Information contained in the
sequences of the present invention is necessary for the design of
an antisense or triple helix oligonucleotide and other DNA binding
agents.
[0420] Agents which bind to a protein encoded by one of the ORFs of
the present invention can be used as a diagnostic agent. Agents
which bind to a protein encoded by one of the ORFs of the present
invention can be formulated using known techniques to generate a
pharmaceutical composition.
5. EXAMPLES
Example 1
Isolation of SEQ ID NO: 1 from a Human cDNA Library
[0421] The novel nucleic acid of SEQ ID NO: 1 was obtained from a
human cDNA library prepared from fetal skin (Invitrogen), using
standard PCR, sequencing by hybridization sequence signature
analysis, and Sanger sequencing techniques. The inserts of the
library were amplified with PCR using primers specific for vector
sequences flanking the inserts. These samples were spotted onto
nylon membranes and interrogated with oligonucleotide probes to
give sequence signatures. The clones were clustered into groups of
similar or identical sequences, and a single representative clone
was selected from each group for gel sequencing. The 5' sequence of
the amplified insert was then deduced using the reverse M13
sequencing primer in a typical Sanger sequencing protocol. PCR
products were purified and subjected to fluorescent dye terminator
cycle sequencing. Single-pass gel sequencing was done using a 377
Applied Biosystems (ABI) sequencer. The insert of SEQ ID NO: 1 was
described as a novel sequence in international publication WO
03/(029405).
Example 2
Assemblage of SEQ ID NO: 2
[0422] The nucleic acid (SEQ ID NO: 2) of the invention was
assembled from sequences that were obtained from a cDNA library by
methods described in Example 1 above, and in some cases obtained
from one or more public databases. The final sequence was assembled
using the EST sequences as seed. Then a recursive algorithm was
used to extend the seed into an extended assemblage, by pulling
additional sequences from different databases (i.e. Nuvelo's
database containing EST sequences, dbEST version 124, gbpri 124,
and UniGene version 124) that belong to this assemblage. The
algorithm terminated when there were no additional sequences from
the above databases that would extend the assemblage. Inclusion of
component sequences into the assemblage was based on a BLASTN hit
to the extending assemblage with BLAST score greater than 300 and
percent identity greater than 95%.
[0423] Using PHRAP (Univ. of Washington) or CAP4 (Paracel), a
full-length gene cDNA sequence and its corresponding protein
sequence were generated from the assemblage. Any frame shifts and
incorrect stop codons were corrected by hand editing. During
editing, the sequence was checked using FASTY and BLAST against
Genbank (i.e. dbEST version 124, gbpri 124, UniGene version 124,
Genpept release 124). Other computer programs which may have been
used in the editing process were phredphrap and Consed (University
of Washington) and ed-ready, ed-ext and cg-zip-2 (Hyseq, Inc.). The
full-length nucleotide and amino acid sequences are shown in the
Sequence Listing as SEQ ID NOS: 2 and 4, respectively.
[0424] In order to express GIPF (SEQ ID NO: 4), the full-length
GIPF DNA was PCR amplified from Marathon-ready cDNA libraries
(Clontech). The primary PCR product was further amplified using
nested PCR primers that generated GIPF polypeptide when expressed
in suitable cell lines, as described below.
Example 3
Expression of GIPF in Murine and Human Tissues
[0425] A. Tissue Distribution of GIPF mRNA:
[0426] FIG. 2 shows the relative expression of GIPF mRNA that was
derived from human (A) and murine (B) tissues.
[0427] Total mRNA was derived from the tissues indicated in FIG. 2
according to the protocol provided by the manufacturer (Qiagen,
Valencia, Calif.). The RNA was subjected to quantitative real-time
PCR (TaqMan) (Simpson et al., Molec Vision 6:178-183 (2000)) to
determine the relative expression of GIPF in the tissues shown. The
forward and reverse primers that were used in the PCR reactions of
human RNA were: 5' GACCATGCTGCCTGCTCTGACAC 3' (forward; SEQ ID NO:
29), and 5' CACCCGCCTCCTTGCTCTCC 3' (reverse; SEQ ID NO: 30),
respectively; and the forward and reverse primers that were used in
the PCR reactions of murine RNA were: 5' GGGGGAGACCACACCACCTGCT 3'
(SEQ ID NO: 31), and 5' TTGGACCTCGGCTCCTTGCTGTTC 3' (SEQ ID NO:
32), respectively. DNA sequences encoding Elongation Factor 1,
.beta.-actin, and ATP synthase 6 were used as a positive control
and normalization factors in all samples. All assays were performed
in triplicate with the resulting values averaged.
[0428] The Y axis shows the number of copies of GIPF mRNA per cell
assuming that each cell has 400,000 mRNA transcripts of a median
length of 1.2 Kb, and that 2% of the total RNA in a cell is mRNA.
FIG. 2 shows that GIPF mRNA is expressed at low levels in all the
tissues tested. The highest levels of GIPF mRNA were seen in mouse
skin, lung, ovary and brain, and in human small intestine, skin,
skin, ovary, testis, and breast.
B. Tissue Distribution of GIPF Protein:
[0429] Expression of GIPF in human tissue samples was detected
using rabbit polyclonal anti-GIPF antibodies (Table 1). The rabbit
polyclonal antibodies were generated by immunizing rabbits with a
peptide that was predicted to be immunogenic, and having amino acid
sequence Glu Ser Lys Glu Ala Gly Ala Gly Ser Arg Arg Arg Lys Gly
Gln (SEQ ID NO: 67). Anti-GIPF antibody was affinity purified from
rabbit serum using GIPF peptide coupled to Affi-Gel 10 (Bio-Rad),
and stored in phosphate-buffered saline with 0.1% sodium azide.
Tissue samples of adrenal gland, bladder, breast, colon, kidney,
liver, lung, ovary, pancreas, placenta, prostate, skin, small
intestine, spleen, stomach, testis, thyroid, tonsil and uterus were
prepared for immunohistochemical analysis (IHC) (LifeSpan
Biosciences, Inc., Seattle, Wash.) by fixing tissues in 10%
formalin, embedding in paraffin, and sectioning using standard
techniques. Sections were probed using the GIPF-specific antibody
and visualized with a biotin-conjugated anti-rabbit secondary using
AEC as substrate.
[0430] The cellular localization of GIPF in human tissues is shown
in Table 1. The most intense staining was seen in the cytoplasm of
a subset of pancreatic islet cells and in the cytoplasm of
intraepithelial neuroendocrine cells of the intestine and stomach.
Prominent staining was also present in the adrenal cortex, gastric
foveolar epithelium, and renal tubular epithelium. Lymphocytes were
frequently positive and showed predominantly nuclear staining. In
the skin, focal positivity was present in the stratum granulosum
and in pilosebaceous units. A few cell types showed less intense
cytoplasmic and nuclear staining, including respiratory epithelium,
type II pneumocytes, prostatic epithelium, and breast epithelium.
Focal faint nuclear staining was present in hepatocytes, colonic
epithelium, placental trophoblasts, breast epithelium, ovary, and
thyroid follicular epithelium.
Ganglion cells showed blush staining, while other cell types
including glandular epithelium, smooth muscle, endothelium,
intravascular neutrophils, and fibroblasts tested negative for
GIPF.
TABLE-US-00002 TABLE 1 Organ/Tissue Subcellular Location Staining
Adrenal gland, epithelium Nuclear and cytosolic Focal, moderate
Bladder, epithelium Nuclear and cytosolic Light Breast, epithelium
Nuclear and cytosolic Moderate Colon, epithelium Nuclear and
cytosolic Moderate Colon, neuroendocrine Nuclear and cytosolic
Faint cells Kidney cortex, glomeruli Nuclear Light Kidney cortext,
epithelium Cytosolic Moderate Kidney medulla, glomeruli Nuclear
Strong Kidney medulla, epithelium Cytosolic Moderate Liver,
hepatocytes Nuclear Moderate Lung, respiratory Nuclear and
cytosolic Moderate epithelium Lung, type II pneumocytes
Predominantly nuclear Moderate Lung, alveolar Predominantly nuclear
Moderate macrophages Ovary, epithelium Nuclear Moderate Pancreas,
islets of Cytosolic Strong Langerhans Placenta, trophoblasts
Nuclear Light Prostate, epithelium Nuclear Moderate Skin, epidermal
layer Cytosolic Focal Small intestine, Cytosolic, punctate Strong
neuroendocrine cells nuclear Small intestine, Predominantly nuclear
Moderate inflammatory cells Spleen, lymphocytes Predominantly
nuclear Strong Stomach, neuroendocrine Nuclear and cytosolic Focal,
moderate to cells strong Stomach, epithelium Nuclear and cytosolic
Moderate to strong Testis, Leydig cells Cytosolic Light, sporadic
Thymus, lymphocytes Nuclear and cytosolic Moderate Thyroid,
follicular Nuclear Light epithelium Tonsil, lymphocytes Nuclear and
cytosolic Moderate Uterus, endometrial stroma Nuclear Moderate,
sporadic
Example 4
Transgenic GIPF Animals
A. Construction of the GIPF-KI Vector.
[0431] The construction of the transgene GIPF-knock-in (GIPF-KI)
vector (FIG. 5A) was performed according to the method described
below, and depicted in FIGS. 5B-5R.
[0432] The DNA encoding the mouse Immunoglobulin kappa Constant
region (IgC.kappa.) and the proximal region was obtained by
amplification of two fragments as follows:
[0433] FIG. 5B Preparation of IQC.kappa. Fragment 1.
[0434] The forward (igkc1; SEQ ID NO: 34) and reverse (igkc2; SEQ
ID NO: 35) primers for PCR were synthesized based on the sequence
of the mouse Immunoglobulin kappa Constant region (IgC.kappa.) and
the proximal region that was obtained from GenBank (gi: V00777; SEQ
ID NO: 33), and used to amplify the DNA that encodes fragment 1 of
the IgC.kappa. fragment 1. igkc1:
ATCTCGAGGAACCACTTTCCTGAGGACACAGTGATAGG (SEQ ID NO: 34) was prepared
by adding a Xho I recognition sequence at 5' end site, and igkc2:
ATGAATTCCTAACACTCATTCCTGTTGAAGCTCTTGAC (SEQ ID NO: 35) was prepared
by adding an EcoR I recognition sequence at 5' end site. PCR was
carried out using 25 ng of a clone of pBluescript SK II (+), which
contains the mouse Constant and Joining regions (WO 00/10383), and
served as template. The PCR product was digested with restriction
enzymes EcoR I and Xho I and ligated into pBluescript II KS(-)
vector (Stratagene) that was pre-digested with the restriction
enzymes EcoR I and Xho I. The resulting plasmid pIgC.kappa.A
contained the designated cDNA sequence of the mouse IgC.kappa.
fragment 1 with no substitution in nucleotide sequence within the
region between Xho I and EcoR I.
[0435] FIG. 5C Preparation of IgC.kappa. Fragment 2.
[0436] The forward (igkc3; SEQ ID NO: 36) and reverse (igkc4; SEQ
ID NO: 37) primers for PCR were synthesized based on the sequence
of the mouse downstream region of Immunoglobulin kappa Constant
region (IgC.kappa.) that was obtained from GenBank (gi: V00777; SEQ
ID NO: 33), and used to amplify the DNA that encodes IgC.kappa.
fragment 2. Igkc3: ATGAATTCAGACAAAGGTCCTGAGACGCCACC (SEQ ID NO:36)
was prepared by adding an EcoR I recognition sequence at 5'end
site, and igkc4: ATGGATCCTCGAGTCGACTGGATTTCAGGGCAACTAAACATT (SEQ ID
NO:37) was prepared by adding BamH I, Xho I, and Sal I recognition
sequence at 5' end site. PCR was carried out using 25 ng of the
clone of pBluescript SK II (+) that contains the mouse Constant and
Joining regions, and served as template (WO 00/10383). The PCR
product was digested with restriction enzymes EcoR I and BamH I and
ligated into the pIgC.kappa.A vector (see above), pre-digested with
the restriction enzymes EcoR I and BamH I. The resulting plasmid
pIgC.kappa.AB contained the designated cDNA fragments 1 and 2
derived from the mouse Immunoglobulin Constant region with no
substitution in nucleotide sequence within the region between EcoR
I and BamH I.
[0437] FIG. 5D Insertion of Puromycin Gene into pIgC.kappa.AB
[0438] The Lox-P Puro plasmid (WO 00/10383) was digested with
restriction enzymes EcoR/and Xho I and treated with T4DNA
polymerase. The resulting fragment was ligated into pIgC.kappa.AB
vector (see above) pre-digested with the restriction enzyme Sal I
and treated with T4DNA polymerase. After verifying the connecting
regions between pIgC.kappa.AB and the Lox-P Puro fragment, the
plasmid pIgC.kappa.ABP was obtained.
[0439] FIG. 5E Insertion of IRES cDNA into pIgC.kappa. ABP
[0440] The following forward (iresfw; SEQ ID NO:38) and reverse
(iresrv; SEQ ID NO: 39) primers for PCR were synthesized based on
the sequence of the IRES region of the pIREShyg plasmid (Clontech).
iresfw: ATGAATTCGCCCCTCTCCCTCCCCCCCCCCTA (SEQ ID NO: 38) was
prepared by adding an EcoR I recognition sequence at 5' end site,
and iresrv: ATGAATTCGTCGACTTGTGGCAAGCTTATCATCGTGTT (SEQ ID NO: 39)
was prepared by adding EcoR/and Sal I recognition sequences at the
5'end site. PCR was carried out using 150 ng of pIREShyg plasmid
(Clontech) as a template. The PCR product was digested with the
restriction enzyme EcoR I and ligated into the pGEM-T vector
(Promega) which had been digested in advance with the restriction
enzyme EcoR I. The plasmid IRES-Sal/pGEM was obtained that
contained the designated cDNA sequence with no substitutions in
nucleotide sequence. The IRES-Sal/pGEM plasmid was digested with
restriction enzyme EcoR/and ligated into the pIgC.kappa.ABP plasmid
(see above) which had been digested in advance with the restriction
enzyme EcoR I. After verifying the sequence of connecting regions
between pIgC.kappa. ABP and IRES-Sal, the plasmid pIgC.kappa. ABP
IRES was obtained.
[0441] FIG. 5F Construction of PAC.kappa. Sal Plasmid
[0442] The IgCk KO vector (WO 00/10383) was digested with
restriction enzyme Sac II and then partially digested with
restriction enzyme EcoRI. A 14.6 Kb band that lacked the LoxP-PGK
Puro region was isolated and ligated with a SaclI/EcoRI compatible
linker generated by annealing the following two oligonucleotides
(Sal1 plus and Sal1 minus), in order to replace the LoxP-PGKPuro
region with a Sal I restriction site. After sequence verification
the p.DELTA.C.kappa.Sal plasmid was obtained. Sal1 plus: 5'
AGTCGACA 3' (SEQ ID NO: 40) and Sal1 minus: 5'AATTTGTCGACTGC 3'
(SEQ ID NO: 41).
[0443] FIG. 5G Construction of PKI.kappa. Plasmid
[0444] The pIgC.kappa.ABP IRES plasmid was digested with the
restriction enzyme Xho I and the resulting fragment consisting of C
region, IRES and loxP-Puromycin was ligated with
p.DELTA.C.kappa.Sal vector (see above) which had been digested in
advance with the restriction enzyme Sal I. After sequence
verification the PKI.kappa. plasmid was obtained.
[0445] FIG. 5H Preparation of pIgC.kappa..DELTA. IRES Fragment
[0446] The pIgC.kappa.ABPIRES plasmid was partially digested with
restriction enzymes EcoR I and Bgl II and the resulting
pIgC.kappa..DELTA. IRES fragment that lacked a portion of the IRES
gene was isolated.
[0447] FIG. 5I Preparation of Mouse P2 Promoter Fragment by PCR
[0448] The following primers for PCR were synthesized based on the
sequence of the mouse Immunoglobulin kappa promoter obtained from
GenBank (gi: aj231225; SEQ ID NO: 42). P2F:
CCCAAGCTTTGGTGATTATTCAGAGTAGTTTTAGATGAGTGCAT (SEQ ID NO: 43) was
prepared by adding a Hind III recognition sequence at 5' end site,
and
[0449] P2R:ACGCGTCGACTTTGTCTTTGAACTTTGGTCCCTAGCTAATTACTA (SEQ ID
NO: 44) was prepared by adding a Sal I recognition sequence at 5'
end site. PCR was carried out using 25 ng of mouse genomic DNA as a
template (genomic DNA from TT2F ES cells). The PCR product was
digested with restriction enzymes Hind III and Sal I and ligated
into pBluescript II KS-vector (Stratagene) which had been digested
in advance with the restriction enzymes Hind III and Sal I. After
sequence verification, the resulting plasmid was digested with the
restriction enzymes Hind III and Sal and a Hind III-Sal I fragment
containing the mouse P2 promoter fragment was isolated.
[0450] FIG. 5J. Preparation of Partial C.kappa. polyA Fragment by
PCR
[0451] The following primers for PCR were synthesized based on
sequence of the mouse Immunoglobulin kappa polyA region obtained
from GenBank (gi:v00777)
PPF:ACGCGTCGACGCGGCCGGCCGCGCTAGCAGACAAAGGTCCTGAGACGCCAC
CACCAGCTCCCC (SEQ ID NO: 45) was prepared by adding Sal I, Fse I,
and Nhe I recognition sequence at 5' end site, and PPR:
GAAGATCTCAAGTGCAAAGACTCACTTTATTGAATATTTTCTG (SEQ ID NO: 46) was
prepared by adding a Bgl II recognition sequence at 5' end site.
PCR was carried out using 25 ng of mouse genomic DNA as a template
(genomic DNA from TT2F ES cells). The PCR product was digested with
restriction enzymes Sal I and Bgl II and ligated into the psp72
vector (Promega KK) which had been digested in advance with the
restriction enzymes Sal I and Bgl II. After sequence verification,
the purified plasmid was digested with the restriction enzymes Sal
I and Bgl II, to generate the "partial Ck polyA fragment".
[0452] FIG. 5K. Preparation of Total C.kappa. PolyA Fragment by
PCR.
[0453] The following primers for PCR were synthesized based on
sequence of the mouse Immunoglobulin kappa polyA region obtained
from GenBank (gi:v00777): TPF:
GGAATTCAGACAAAGGTCCTGAGACGCCACCACCAGCTCCCC (SEQ ID NO: 47) was
prepared by adding an EcoR I recognition sequence at 5' end site,
and TPR: CCCAAGCTTGCCTCCTCAAACCTACCATGGCCCAGAGAAATAAG (SEQ ID NO:
48) was prepared by adding a Hind III recognition sequence at 5'
end site. PCR was carried out using 25 ng of mouse genomic DNA as a
template (genomic DNA from TT2F ES cells). The PCR product was
digested with restriction enzymes EcoR I and Hind III and ligated
into pBluescript II KS-vector (Stratagene) which had been digested
in advance with the restriction enzymes EcoR I and Hind III. After
sequence verification the plasmid was digested with the restriction
enzymes EcoR I and Hind III, to generate the "total Ck polyA
fragment".
[0454] FIG. 5L. Construction of DNA Fragment A that Consists of
Total C.kappa. polyA Fragment, P2 Promoter Fragment, and Partial Ck
polyA Fragment.
[0455] The "total C.kappa. poly A fragment", "P2 promoter
fragment", and "partial C.kappa. poly A fragment" generated as
described above were ligated in the described order into
pBluescript II KS-vector (Stratagene) which had been digested in
advance with the restriction enzymes EcoR I and Bgl II. After
sequence verification, the purified plasmid was digested with the
restriction enzymes EcoR I and Bgl II, to generate "DNA fragment
A".
[0456] FIG. 5M. Construction of PlgC.kappa..DELTA. IRES ProA
Plasmid
[0457] "DNA fragment A" was ligated into the "pIgC.kappa. A IRES
fragment" isolated as described above. After sequence verification
the plasmid pIgC.kappa. A IRES ProA was obtained.
[0458] FIG. 5N. Construction of C.kappa. P2H Plasmid
[0459] pIgC.kappa..DELTA. IRES ProA plasmid was digested with Xho I
and the main fragment that contained the upstream genomic region of
mouse IgC.kappa., mouse IgC.kappa., DNA fragment A and Lox-P Puro
thus isolated, was ligated with p.DELTA.C.kappa. Sal which had been
digested in advance with the restriction enzyme Sal I. After
sequence verification the plasmid C.kappa. P2H was obtained.
[0460] FIG. 5O. Construction of C.kappa. 5' Genomic Plasmid
[0461] The following primers for PCR were synthesized based on
sequence of a DNA segment containing the mouse immunoglobulin kappa
J and C region genes obtained from GenBank (gi: v00777). 5GF:
ATAAGAATGCGGCCGCCTCAGAGCAAATGGGTTCTACAGGCCTAACAACCT (SEQ ID NO: 49)
was prepared by adding a Not I recognition sequence at 5'end site,
and 5GR: CCGGAATTCCTAACACTCATTCCTGTTGAAGCTCTTGACAATGG, (SEQ ID NO:
50) was prepared by adding an EcoR I recognition sequence at 5'end
site. PCR was carried out using 25 ng of mouse genomic DNA (genomic
DNA from TT2F ES cells as a template). The PCR product was digested
with restriction enzymes Not I and EcoR I and ligated with
pBluescript II KS-vector (Stratagene) which had been digested in
advance with the restriction enzymes Not I and EcoR I. After
sequence verification, the C.kappa. 5' genomic plasmid was
obtained.
[0462] FIG. 5P. Construction of C.kappa. P2 KI.DELTA. DT
Plasmid
[0463] The C.kappa. P2H plasmid was digested with EcoR I and Xho I
and a 11 Kb was obtained and was ligated into the C.kappa. 5'
genomic plasmid which had been digested in advance with the
restriction enzymes EcoR I and Xho I. After sequence verification
the C.kappa. P2 KI.DELTA. DT plasmid was obtained.
[0464] FIG. 5Q. Construction of C.kappa. P2 KI Vector
[0465] The DT-A fragment was isolated from the pKI.kappa. plasmid
using restriction enzymes Xho I and Kpn I, and was ligated into the
C.kappa. P2 KI.DELTA. DT plasmid which has been digested in advance
with the restriction enzymes Xho I and Kpn I. After sequence
verification the CKP2 KI vector was obtained.
[0466] FIG. 5R. Assembly of the GIPF-KI Vector.
A GIPF cDNA fragment was amplified using the following primers for
PCR, which were synthesized based on the sequence of human GIPF
cDNA (SEQ ID NO: 2). SA3F: ACGCGTCGACCCACATGCGGCTTGGGCTGTGTGT (SEQ
ID NO: 51) was prepared by adding a Sal I recognition sequence and
Kozak sequence at 5' end site, and SA3R:
ACGCGTCGACGTCGACCTAGGCAGGCCCTG (SEQ ID NO: 52) was prepared by
adding a Sal I recognition sequence at 5' end site. PCR was carried
out using a pool of Marathon-Ready cDNA (fetal skin and fetal lung,
BD Biosciences CLONTECH) as a template. The PCR product was
digested with restriction enzyme Sal and ligated with pBluescript
II KS-vector (Stratagene) which has been digested in advance with
the restriction enzyme Sal I. After sequence verification a clone
was obtained and verified to contain the correct GIPF cDNA sequence
with no substitution in nucleotide sequence. The clone was digested
with restriction enzyme Sal I, and the GIPF cDNA fragment was
purified and ligated into CK P2 KI vector, which had been digested
in advance with the restriction enzyme Sal I. After sequence
verification, the GIPF-KI vector, was obtained (FIG. 5A).
B. Generation of GIPF-KI Transgenic Mice
[0467] General procedures for obtaining mouse embryos, cultivation,
injection of the ES cells into the embryos, transplantation to the
uteri of foster mothers were carried out in accordance with the
method described in Aizawa Shinichi, "Biomanual Series 8, Gene
Targeting", published by Yodosha, 1995.
[0468] The GIPF-KI vector was linearized with Not I and transferred
into C57BL/6.times.CBA F1 derived mouse TT2F ES cells ((Uchida,
1995), Lifetech oriental) by electroporation according to the
method described by Shinichi Aizawa, "Biomanual Series 8, Gene
Targeting", published by Yodosha, 1995. The electroporated ES cells
were suspended in 20 ml of ES medium [DMEM (GIBCO), 18% FCS
(GIBCO), 0.1 mM 2-mercaptoethanol (GIBCO), 1000 U/ml LIF (leukemia
inhibitory factor, CHEMICON International, Inc.)] and inoculated
into two 100 mm tissue culture plastic plates (Corning) into which
feeder cells (Invitrogen) were seeded in advance. After one day,
the medium was replaced with a medium containing 0.75 g/ml of
puromycin (Sigma). Seven to nine days thereafter, a total of 119
colonies formed were picked up. Each colony was grown up to
confluence in a 12-well plate, and then four fifths of the culture
was suspended in 0.2 ml of cryopreservation medium [ES medium+10%
DMSO (Sigma)] and stored frozen at -80.degree. C. The remaining one
fifth was inoculated into a 12-well gelatin coated plate and
cultured for 2 days. Then, genomic DNA was isolated using the
Puregene DNA Isolation Kit (Gentra System). Genomic DNA isolated
from puromycin resistant TT2F cells was digested with restriction
enzyme EcoR I (Takara Shuzo) and then subjected to 0.8% agarose gel
electrophoresis. Separated DNA fragments were transferred to a
membrane (GeneScreen, NEN.TM. Life Science Products) and then
hybridization was carried out using the DNA fragment as probe
prepared from 3' region of IgJ.kappa.-C.kappa.genomic DNA (Xho
I-EcoR I, 1.3 Kb (SEQ ID NO: 67): WO 00/10383, Example No. 48). The
band pattern of untargeted ES clone shows one band of MW of about
15 Kb and targeted ES clone shows two bands of MW of about 15 Kb
and 13.4 Kb (FIG. 6). Two out of 48 targeted ES clones #10, 12 were
selected after Southern analysis (rate of homologues recombination
was about 4.2%). The selected ES clones were also tested by
karyotype analysis according to the method described by Shinichi
Aizawa, "Biomanual Series 8, Gene Targeting", published by Yodosha,
1995. Two ES clones #10, 12 that showed normal karyotype were used
for implantation into embryos.
[0469] The cells in a frozen stock of the targeted ES cell clones
#10, 12 were thawed, started to culture and injected into 8-cell
stage embryos obtained by mating a male and a female mouse of
Immunoglobulin heavy chain knock out mouse strain (Tomizuka et. al.
Proc. Natl. Acad. Sci. USA, 97: 722-727, 2000); the injection rate
was 10-12 cells per embryo. After the embryos were cultured
overnight in the medium for ES cells to develop into blastocysts,
about ten of the TT2F cell-injected embryos were transplanted to
each side of the uterus of a foster mother ICR mouse (CREA JAPAN,
INC.), which had been subjected to a pseudopregnant treatment for
2.5 days. As a result of transplantation of a total of 120 injected
embryos, 24 offspring mice were born. Chimerism in the offspring
was determined by the extent of TT2F cell-derived agouti coat color
(dark brown) in the host embryo (ICR)-derived albino coat color.
Out of the 24 offspring, 11 mice (knock-in mice) were recognized to
have partial agouti coat color, indicating the contribution of the
ES cells. Genomic DNA isolated from the tails of Knock-in mice was
used for PCR analysis. The following two primers for PCR were
synthesized based on sequence of GIPF-KI vector: SACF:
CTGACTAGACTCTATCTTGC (SEQ ID NO: 53), and SACR:
CCACGGAGACCACTCGCTCATT (SEQ ID NO: 54).
PCR was carried out using 25 ng of mouse tail genomic DNA as a
template. The resulting reaction solution was subjected to 0.8%
agarose gel electrophoresis, and 606 bp band was detected. Normal
TT2F cell clones were used for control chimeric mice
production.
[0470] Mice were kept under a 12/12-hour dark/light cycle (lights
on at 8:00 am) and received 5 .mu.m filtered water and CE-2 food
(CLEA JAPAN, INC.) ad libitum. Male mice were housed individually
after weaning period.
Example 5
Evaluation of the Biological Activity of GIPF Using Transgenic
GIPF-KI Mice
[0471] The gross pathological changes and the histological changes
of the small intestine and colon from the transgenic mice described
above was evaluated as follows.
[0472] GIPF transgenic KI mice demonstrated auxetic growth of small
intestine starting at the age of 4 weeks and significant abdominal
distension during development. FIG. 7 shows that 15 week old GIPF
transgenic KI mice had marked intestinal distension and increased
small intestinal mass when compared to the corresponding control KI
mouse. Histo-pathological evaluation, using hematoxylin and eosin
(H&E) staining (Issacson, P. G., and Wright, D. H., 1983) was
done on paraffin embedded sections (5 .mu.m thick) of various
tissues including liver, spleen, lung, kidney, heart, small
intestine and large intestine. H&E sections of small intestine
were shown in FIG. 8 (low magnification) and FIG. 9 (high
magnification). A histopathology report was provided by IDEXX
Laboratories, Inc. and is described below.
[0473] The only significant difference between the histologic
appearance of the tissues from the control and the knock-in mouse
was found in the small intestine. This change consisted of a
marked, diffuse thickening of the mucosa by crypt epithelial
hyperplasia with a marked increased in crypt length and complexity
of branching. The crypts were lined by plump columnar epithelial
cells with basophilic cytoplasm and basally-located large ovoid
heterochromatic nuclei with frequent mitoses. Numerous apoptotic
bodies were scattered throughout the crypt epithelium, suggesting
an increased rate of cell turnover. The crypt epithelial cells also
commonly differentiated into both Paneth cells and mucus-secreting
goblet cells throughout the length of the crypts. The villous
epithelium was not significantly altered. Similar changes were seen
in the small intestinal mucosa associated with the Peyer's patch.
The intestinal mucosa normally externally lines and may form small
invaginations into the lymphoid tissue of the Peyer's patch. In the
GIPF-KI mice, the hyperplastic changes were also seen on the
surface and in invaginations, where they were associated with mild
acute inflammation and accumulations of necrotic cells within
crypts, i.e. crypt microabscesses. This Peyer's patch was sectioned
tangentially therefore the amount and character of lymphoid tissue
was difficult to evaluate. However, there were small numbers of
plasma cells indicating transformation of B-lymphocytes into
antibody-producing cells. There were no other visible alterations
in lymphoid or inflammatory cell populations in the intestine or
other tissues.
[0474] To measure intestinal epithelial cell proliferation in KI
mice, immunohistochemistry using monoclonal rat anti-mouse Ki67
antigen (Dako Ltd., High Wycombe, UK) was performed on paraffin
embedded sections of small intestine of control and GIPF KI mice
according to manufacturer's instruction and the method previously
described (Scholzen, T. et al. 2000). As shown in FIG. 10, GIPF KI
mice demonstrated increased Ki67 positive epithelial cells in the
small intestine suggesting increased proliferation by GIPF protein
expression.
[0475] Three of the GIPF-KI mice were harvested at 12 months. These
12 month-old mice displayed the typical abdominal distention and
increased intestinal mass seen in younger animals. H&E sections
were prepared in various tissues including spleen, liver, adrenal,
kidney, thymus, heart, lung, small intestine, large intestine,
stomach and brain.
[0476] Histology of sections from the small intestine of the 12
month old GIPF-KI mice showed that GIPF had induced a marked
increase in crypt length and to the same extent as that seen in 15
weeks old GIPF-KI animals. In addition, histological analysis of
sections from other organs revealed that over the extended period
of 12 months GIPF did not display any apparent tumorigenic
activity. Spontaneous tumorigenesis was sometimes observed in some
mice irregardless of whether the mice were normal or KI transgenic
animals. A low incidence of hepatic adenomas was observed in 12
month-old control mice.
Example 6
The GIPF Adenoviral Vector
[0477] The GIPF cDNA (SEQ ID NO: 2) was cloned into pAdenoVator
CMV5-Intron using NheI and XbaI sites in multi-cloning sites (MCS)
to generate V5His6 tagged GIPF recombinant adenovirus.
pAdenoVator-CMV5-Intron was obtained by modification of pAdenoVator
CMV5-IRES-GFP (Qbiogene, Carlsbad, Calif., U.S.A).
pAdenoVator-CMV5-IRES-GFP was digested with SpeI to remove its MCS,
IRES and GFP and ligated with PCR amplified Intron-MCS-V5His-BGH
polyA from pcDNA/Intron vector using primers:
5'-CACCCCTAGGTCAATATTGGCCATTAGC-3' (SEQ ID NO: 55) and
5'-CACCCCT-AGGTAGGCATCCCCAGCATGC-3' (SEQ ID NO: 56).
[0478] Transformation of linearized transfer vector into bacterial
cells, BJ5183, (Qbiogene, Carlsbad, Calif., U.S.A) which carry
AdEasy-1 plasmid that encode Adenovirus-5 genome (E1/E3 deleted)
was performed by electroporation according to the manufacturer's
instructions. Recombinant adenovirus was generated and amplified in
QBI-293A cells (Qbiogene, Carlsbad, Calif., U.S.A) and purified by
CsCl banding as previously described (Garnier, A., J. Cote et al.
1994). Recombinant protein expression by 293A cells that had been
infected with the recombinant adenovirus was measured by Western
analysis using anti-V5 antibody (Invitrogene Inc., Carlsbad,
Calif.). The titer of CsCl purified recombinant viruses was
measured using the Adeno-X rapid titer kit (BD biosciences, Palo
Alto, U.S.A.) according to the manufacturer's protocols. Briefly, a
viral stock was tested by infecting 293A cells with serial
dilutions of the recombinant adenovirus stock followed by fixation
and staining of the transduced cells with mouse anti-hexon antibody
48 hours after infection. The signal was detected with a goat
anti-mouse antibody conjugated to horseradish peroxidase and
developed with metal-enhanced 3,3'-diaminobenzidine
tetrahydro-chloride (DAB).
Example 7
Administration of GIPF Adenovirus as a Model to Evaluate the
Biological Activity of GIPF
[0479] The GIPF recombinant adenovirus was administered to normal
mice to determine the effect of GIPF on the intestinal and colonic
epithelium, and to confirm that the phenotype observed in the GIPF
transgenic mice could be established in a non-transgenic animal.
Prior to injection of adenovirus, BALB/C mice, 6-8 weeks of age,
were anesthetized using isoflurane. 1.times.10.sup.10 viral
particles per mouse were injected through retro-orbital vein. The
same titer of control virus (empty virus) or PBS alone were used as
controls. Mice were sacrificed on day 3 or day 5 after virus
injection (n=3 for all group). 4 hours before sacrifice, 1 mg of
bromodeoxyuridine (BrdU) was injected intraperitoneally (IP) to
determine in vivo proliferation of epithelial cells. Various
tissues including small intestine, colon, spleen, liver and bone
marrow were collected and fixed in formaline. Paraffin embedded
sections were stained with hematoxylin and eosin (H&E) for
histological evaluation. Sections were also processed for BrdU
immunohistochemistry according to the manufacturer's instruction
(Oncogene Research product, Boston, U.S.A.) as previously described
(McKinley, J. N. et al. 2000). Immunohistochemistry using
monoclonal rat anti-mouse Ki67 antigen (Dako Ltd., High Wycombe,
UK) was also performed to assess the proliferation of intestinal
epithelial cells according to manufacturer's instruction and the
method previously described (Scholzen, T. et al. 2000).
[0480] H&E staining of sections from the small intestine that
had been sacrificed 3 days following the adenovirus injection (FIG.
11) show that the small intestine of mice that had received the
GIPF adenovirus was significantly altered, and displayed the same
histological characteristics seen in the GIPF transgenic mice
(FIGS. 8 and 9). The histological changes caused by GIPF included a
marked, diffuse thickening of the mucosa by crypt epithelial
hyperplasia with a marked increased in crypt length and complexity
of branching. The crypts were lined by plump columnar epithelial
cells with basophilic cytoplasm and basally-located large ovoid
heterochromatic nuclei with frequent mitoses. The crypt epithelial
cells also commonly differentiated into both Paneth cells and
mucus-secreting goblet cells throughout the length of the crypts.
The effect of GIPF on crypt epithelial proliferation was further
enhanced in 5 days after virus injection which was shown in FIG.
12. To evaluate the effect of GIPF on the proliferation of
intestinal epithelial cells, BrdU incorporation and Ki67
immuno-staining were performed on small intestinal sections of
control and mice that had received GIPF adenovirus. As shown in
FIGS. 13 and 14, the mice that had received the GIPF adenovirus had
small intestinal crypts that had significantly more BrdU and Ki67
positive cells, respectively. The biological effect of GIPF on the
proliferation of crypt epithelial cells was also observed at a
lower viral dose of 1.times.10.sup.9 viral particles per mouse
(FIG. 15). In addition to the effect seen in the small intestine,
GIPF also induced crypt epithelial hyperplasia with a marked
increased in crypt length and an increased number and size of
Goblet cells in the colon (FIG. 16).
Example 8
Expression Vectors Encoding GIPF and GIPF Analogs
[0481] The cDNA encoding GIPF (SEQ ID NO: 3) was cloned into
pcDNA/Intron vector using KpnI and XbaI sites to generate wild type
and carboxy-terminal V5His6-tagged GIPF (SEQ ID NO: 5). The
mammalian expression vector pcDNA/Intron was obtained by
genetically modifying the pcDNA3.1TOPO vector (Invitrogene Inc.,
Carlsbad, Calif.) by introducing an engineered chimeric intron
derived from the pCI mammalian expression vector (Promega, Madison,
Wis.). pCI was digested with BGIII and KpnI, and the intron
sequence was cloned into pcDNA3.1, which had been digested with
BgIII and KpnI. The GIPF ORF of SEQ ID NO: 2 (SEQ ID NO: 3) was
first cloned into pcDNA3.1N5His-TOPO (Invitrogen) by PCR using the
following forward 5' CACCATGCGGCTTGGGCTGTCTC 3' (SEQ ID NO: 57)
reverse 5' GGCAGGCCCTGCAGATGTGAGTG 3' (SEQ ID NO: 58), and the
KpnI-XbaI insert from pcDNA 3.1N5His-TOPO that contains the entire
GIPF ORF was ligated into the modified pcDNA/Intron vector to
generate pcDNA/Intron construct.
[0482] Analogs of the full-length GIPF protein were generated as
follows. Mutation of the predicted consensus furin cleavage sites
(amino acid 28 R/Q) of GIPF in pcDNA/Intron was performed by site
directed mutagenesis using primers
5'-GATCAAGGGGAAACAGCAGAGGCGGATCAG-3' (SEQ ID NO: 59) and
5'-CTGATCCGCCTCTGCTGTTTCCCCTTGATC-3' (SEQ ID NO: 60). The GIPF
deletion mutant (deleted amino acid residues 21-31) (SEQ ID NO: 16)
was generated using the stitching method. The deletion was
introduced by PCR amplification of two fragments using primers
set1: 5'-CACCGCTAGCCTCGAGAATTCACGCGTG-3' (SEQ ID NO: 61) and
phospho 5'-GCTGATGGTGAGGTGCGTC-3' (SEQ ID NO: 62), set2: phospho
5'-ATCAGTGCCGAGGGGAGCCAG-3' (SEQ ID NO: 63) and
5'-GCCCTCTAGAGCGGCAGGCCCTGCAGATG-3' (SEQ ID NO: 64) followed by
ligation of the two fragments. The GIPF cDNA carrying deletion of
amino acids 21-31 was amplified by PCR using the forward and
reverse primers of SEQ ID NO: 61 and 64, respectively, digested
with NheI and XbaI, and subcloned into pcDNA/Intron vector using
NheI and XbaI sites in its multicloning sites. Sequences were
confirmed for both mutants.
[0483] The thrombospondin (TSP) domain (nt 451 to nt 618 of the ORF
of GIPF (SEQ ID NO: 13) was also cloned into pcDNA/Intron vector
for mammalian expression. The cDNA encoding the TSP domain was
amplified by PCR using NheI forward primer:
CCGGCTAGCCACCATGGCGCAATGTGAAATGA (SEQ ID NO: 65) and NotI reverse
primer: CCATGCGGCCGCCCTCCTCACTGTGCACCT (SEQ ID NO: 66). NheI and
NotI restriction enzymes digested PCR product was ligated into NheI
and NotI digested pcDNA/Intron vector. To generate recombinant
adenovirus, the TSP domain from PCR amplification described above
was cloned into pAdenoVator-CMV5-Intron using NheI and NotI
restriction enzymes. The sequence of the PCR-amplified TSP domain
was confirmed.
[0484] Other analogs that lack various portions of the furin-like
cysteine-rich region of GIPF are described in Example 19.
[0485] The biological activity of the GIPF analogs described above
was assessed in vivo and in vitro using methods described in the
examples below. The biological activity of the GIPF analogs is
assessed using the GIPF transgenic model.
Example 9
Purification of Recombinant GIPF
A. Expression and Purification GIPFt in Eukaryotic Cells:
[0486] V5-His-tagged GIPF (GIPFt) (SEQ ID NO: 5) was expressed in
HEK293 and CHO cells and purified as follows:
[0487] A stable cell culture of HEK293 cells that had been
transfected with the GIPF pcDNA/Intron construct comprising the DNA
encoding the V5-His-tagged GIPF polypeptide (SEQ ID NO: 5) was
grown in serum free 293 free-style media (GIBCO). A suspension
culture was seeded at cell density of 1 million cells/ml, and
harvested after 4-6 days. The level of the V5-His-tagged GIPF that
had been secreted into the culture medium was assayed by ELISA.
[0488] A stable cell culture of CHO cells that had been transformed
with a pDEF 2S vector comprising nucleotide sequence that encodes a
V5-His tagged GIPF (SEQ ID NO: 5) was grown in serum free
EX-CELL302 media (JRH). The expression vector contains DNA sequence
that encodes DHFR, which allows for positive selection and
amplification in the presence of methotrexate (MTX). The level of
the V5-His-tagged GIPF that had been secreted into the culture
medium was assayed by ELISA.
[0489] The media containing the secreted GIPF protein was harvested
and frozen at -80.degree. C. The media was thawed at 4.degree. C.,
and protease inhibitors, EDTA and Pefabloc (Roche, Basel,
Switzerland) were added at a final concentration of 1 mM each to
prevent degradation of GIPF. The media were filtered through a 0.22
.mu.m PES filter (Corning), and concentrated 10-fold using TFF
system (Pall Filtron) with a 10 kDa molecular weight cut-off
membrane. The buffers of the concentrated media were exchanged with
20 mM sodium phosphate, 0.5M NaCl, pH 7. The addition of 0.5 M NaCl
in the phosphate buffer is crucial to keep full solubility of
V5-His tagged GIPF at pH 7 during purification. Following
ultrafiltration and diafiltration, a mammalian protease inhibitor
cocktail (Sigma) was added to a final dilution of 1:500 (v/v).
[0490] A HiTrap Ni.sup.2+-chelating affinity column (Pharmacia) was
equilibrated with 20 mM sodium phosphate, pH 7, 0.5 M NaCl. The
buffer-exchanged media was filtered with 0.22 .mu.m PES filter and
loaded onto Ni.sup.2+-chelating affinity column. The Ni.sup.2+
Column was washed with 10 column volumes (CV) of 20 mM imidazole
for 10 Column Volume and protein was eluted with a gradient of 20
mM to 300 mM imidazole over 35 CV. The fractions were analyzed by
SDS-PAGE and Western blot. Fractions containing V5-His tagged GIPF
were analyzed and pooled to yield a GIPF protein solution that was
between 75-80% pure.
[0491] The buffer containing the GIPF protein isolated using the
Ni.sup.2+ column was exchanged with 20 mM sodium phosphate, 0.3 M
Arginine, pH 7 to remove the NaCl. NaCl was replaced with 0.3 M Arg
in the phosphate buffer to maintain full solubility of V5-His
tagged GIPF protein during the subsequent purification steps. The
GIPF protein isolated using the Ni.sup.2+ column was loaded onto a
SP Sepharose high performance cation exchange column (Pharmacia,
Piscataway, N.J.) that had been equilibrated with 20 mM sodium
phosphate, 0.3 M Arginine, pH 7. The column was washed with 0.1 M
NaCl for 8 CV, and eluted with a gradient of 0.1 M to 1 M NaCl over
30 CV. Fractions containing V5-His tagged GIPF were pooled to yield
a protein solution that was between 90-95% pure.
[0492] The buffer of the pooled fractions was exchanged with 20 mM
sodium phosphate, pH 7, 0.15 M NaCl, the protein was concentrated
to 1 or 2 mg/mL, and passed through a sterile 0.22 .mu.m filter.
The pure GIPF preparation was stored at -80.degree. C.
[0493] The protein yield obtained at the end of ach purification
step was analyzed and quantified by ELISA, protein Bradford assay
and HPLC. The percent recovery of GIPFt protein was determined at
every step of the purification process, and is shown in Table 2
below.
TABLE-US-00003 TABLE 2 Steps Step Recovery Overall Recovery Media
100% 100% Concentration/Diafiltration Ni-chelating Affinity 65% 65%
SP Cation Exchange 80% 52% Final Formulation and 95% 49% filter
[0494] SDS-PAGE analysis of the purified GIPF protein was performed
under reducing and non-reducing conditions, and showed that the
V5-His tagged GIPF protein derived from both CHO and 293 cells
exists as a monomer. GIPF protein is glycosylated and migrates on
SDS-PAGE under non-reducing conditions with molecular weight (MW)
of approximately 42 kDa. There is slight difference in the MW of
the GIPF protein purified from CHO cells and that purified from
HEK293 cells. This difference may be explained by the extent to
which GIPF is glycosylated in different cell types. N-terminal
sequence analysis showed that HEK293 cells produced two forms of
the polypeptide: the dominant mature form (SEQ ID NO: 10) which
corresponds to the GIPF protein of SEQ ID NO: 4 that lacks the
signal sequence, and the mature form (SEQ ID NO: 12), which
corresponds to the GIPF protein of SEQ ID NO: 4 that lacks both the
signal peptide and the furin cleavage sequence. The two forms
separated well on the SP column, and were expressed at a ratio of
mature to dominant mature forms of approximately 1:2.
[0495] The effect of NaCl and Arginine (Arg) on the solubility of
the GIPF protein at pH 7 was determined, and is shown in FIG. 17 A.
It was determined that in the absence of 0.3M Arg a 50% loss of
protein was incurred during the purification.
FIG. 17 B shows the solubility of purified protein in PBS (20 mM
sodium phosphate, 0.15 M NaCl, pH 7). GIPF protein remains in
solution at concentrations of up to 8 mg/mL at 4.degree. C., pH7,
for 7 days.
[0496] In summary, the purification of V5-His-tagged GIPF from
cultures of HEK293 or CHO cells was performed by 1) concentrating
and diafiltering the GIPF protein present in the culture media, 2)
performing Ni.sup.2+-chelating affinity chromatography, and 3) SP
cation exchange chromatography. The purification process yields a
GIPF protein that is >90% pure. The overall recovery of the
current purification process is approximately 50%. Addition of 0.5
M NaCl to the buffer during the purification process of media
diafiltration and Ni column is crucial to keep GIPF fully soluble
at pH 7. For binding GIPF onto the SP column, NaCl was removed, and
0.3 M Arg was added to maintain high solubility and increase
protein recovery. The addition of 0.5 M NaCl and 0.3 Arg during the
first and second purification steps showed to increase the overall
recovery by at least from 25% to 50%.
[0497] The dominant mature and mature forms of the V5His-tagged
GIPF were used to test the biological activity of GIPF the in vivo
setting described in Example 10. The protein purified by the method
of this example consistently induced significant proliferation of
intestinal crypt epithelial cells, which underlies the distension
of the small intestine of the mice that were administered the
purified GIPF protein.
B. Expression and Purification of GIPFwt in Eukaryotic Cells:
[0498] The untagged, wild type GIPF protein (GIPFwt; SEQ ID NO: 4)
was expressed and purified in a manner similar to that described
for the tagged GIPF protein. A stable cell culture of HEK293 cells
that had been transfected with the pcDNA/Intron vector comprising
the DNA (SEQ ID NO: 3) encoding the full-length GIPF polypeptide
(GIPFwt) (SEQ ID NO: 4) was adapted to grow in suspension and grown
in serum-free 293 free-style medium (GIBCO) in the presence of 25
.mu.g/ml geneticin.
[0499] Cell culture growth in spinner: For small-scale production
in spinners, an aliquot of a frozen stock of cells was grown and
expanded in 293 free-style media with addition of 0.5% Fetal Bovine
Serum (FBS). Cells were seeded and expanded in spinners at cell
density of 0.3-0.5 million/mL for each passage. When enough cells
are accumulated and cell density reaches 1 million cells/mL for
production, the media was exchanged with serum-free 293 free-style
media to remove 0.5% FBS, and harvested after 6 days. The initial
cell viability was between 80-90% and it decreased to 30% at the
time of harvest. The level of GIFPwt that had been secreted into
the culture medium was assayed by ELISA and western. Growth of
GIPFwt in the spinners yielded 1.2-1.5 mg/l.
[0500] Cell Culture Growth in Bioreactors--Fed-batch mode was used
for large-scale production in bioreactors. A serum-free adapted
suspension culture of HEK293 cells was seeded at cell density of
0.2-0.4 million/ml when passage of cells. Cells were grown in serum
free 293 free-style medium and expanded from 50-500 ml shake flasks
to 20-50 stir tanks for inoculation of a 2001 and 5001 bioreactor.
When enough cells were accumulated, the cells were inoculated into
a bioreactor at a density of 0.2-0.4 million cells/ml. When the
cell density reached 1 million cells/ml, vitamins and MEM amino
acids (GIBCO) were added to boost and support the growth. Cells
were harvested from the bioreactor after 6-7 days when the cell
viability had decreased to 25-30%. The level of GIPFwt that had
been secreted into the culture medium was assayed by ELISA and
western. Western analysis of the secreted GIPF showed that no
degradation of the protein had occurred. Western analysis was
performed using a purified anti-GIPF polyclonal antibody, and the
detection of the protein by ELISA was performed using a purified
chicken anti-GIPF polyclonal antibody as the capture antibody, and
the rabbit anti-GIPF polyclonal antibody as the detection antibody.
The rabbit and chicken polyclonal antibodies were raised against
the whole protein. Growth of GIPFwt in the bioreactors yielded
2.6-3 mg/l.
[0501] Ultrafiltration-Diafiltration--the medium containing the
secreted GIPFwt protein was harvested by centrifugation. Protease
inhibitors 1 mM EDTA and 0.2 mM Pefabloc (Roche, Basel,
Switzerland) were added to prevent degradation of GIPF. The medium
was filtered through a 0.22 .mu.m PES filter (Corning), and
concentrated 10-fold using TFF system (Pall Filtron) or
hollow-fiber system (Spectrum) with 10 kDa cut-off membrane. The
buffer of the concentrated medium was exchanged with 20 mM sodium
phosphate, 0.3 M Arg, pH 7. The addition of 0.3 M Arg in the
phosphate buffer is crucial to keep GIPFwt fully soluble at pH 7
during purification. After ultrafiltration and diafiltration, a
mammalian protease inhibitor cocktail (Sigma) was added at 1:500
(v/v) dilution.
[0502] Q anion exchange chromatography--an anion exchange Q
sepharose HP column (Amersham) was equilibrated with 20 mM sodium
phosphate (NaP) buffer at pH7.0 and containing 0.3 M Arg. The
10-fold concentrated and buffer-exchanged medium was filtered with
0.22 .mu.m PES filter and loaded onto the Q sepharose column to
bind impurities and nucleic acids.
[0503] SP cation exchange chromatography: the Q-sepharose flow
through containing GIPFwt was collected and loaded onto a cation
exchange SP sepharose HP (Amersham), which bound the GIPF protein.
The SP sepharose column was washed with 15 column volumes (CV) of
20 mM NaP, 0.3 M Arg, 0.1 M NaCl, pH 7, and GIPF was eluted with a
gradient of 0.1 M to 0.7 M NaCl over 40 column volumes. The
fractions were analyzed by SDS-PAGE and Western blot. Fractions
containing GIPFwt were analyzed and pooled. The buffer of the
pooled fractions was exchanged with 20 mM sodium phosphate, pH 7,
0.15 M NaCl. The purity of the purified protein was determined to
be 92-95% when analyzed by Coomassie staining of an SDS-gel. The
protein was concentrated to 1 mg/ml, and passed through a sterile
0.22 .mu.m filter and stored at -80.degree. C.
[0504] The yield obtained at the end of each step in the
purification process was quantified by ELISA and by the Bradford
assay, and the percent recovery of GIPF protein was calculated as
shown in Table 3.
TABLE-US-00004 TABLE 3 Steps Step Recovery Overall Recovery Media
100% 100% Concentration/Diafiltration Q Anion Exchange 95% 95% SP
Cation Exchange 75% 71% Final Formulation and filter 98% 70% 48%
(dominant mature form only)
[0505] The endotoxin level of the final formulated GIPF protein
solution was analyzed using chromogenic LAL (Limulus Amebocyte
Lysate) assay kit (Charles River), and determined to be 0.24 EU per
mg of GIPF.
C. Expression and Purification GIPFt in Yeast:
[0506] GIPFt was expressed and purified from a yeast culture, and
the biological activity compared to that of GIPFt that had been
purified from the HEK 293 cell culture described above.
[0507] The nucleotide sequence encoding GIPFt (SEQ ID NO: 5) was
cloned into a Pichia expression vector pPICZ.alpha.A which contains
a yeast .alpha.-factor secretion signal sequence. The Pichia
Pastoris wild type X-33 strain was used to express GIPFt. The
protocols for the use of the Pichia vectors, expression and
purification of recombinant proteins are available from Invitrogen
Life Technologies (Carlsbad, Calif., USA), and are also described
in "Pichia Protocols: Methods in Molecular Biology" (D. R. Higgins
and J. Cregg eds., The Humana Press, Totowa, N.J. 1998)).
[0508] Briefly, GIPFt was purified using the SP cation exchange
chromatography followed by affinity chromatography on an IMAC
Ni.sup.2+ column. The Ni.sup.2+ column was washed with 20 mM
imidazole, and GIPF was eluted in a 20-300 mM imidazole gradient
over 30 column volumes. SDS-PAGE of the purified product displayed
a broad and smeared protein band of about 50 kDa, indicating that
GIPFt is glycosylated to varying degrees. The biological activity
analyzed in vitro and in vivo as described in Examples 17 and 20,
respectively.
[0509] GIPFt protein that was expressed in Pichia pastoris induced
the proliferation of the mouse intestinal epithelium, and
stabilized .beta.-catenin, albeit to a lesser extent than that
obtained with the GIPF protein that was purified from HEK293 cells
(data not shown).
D. Purification of the Murine Ortholog of GIPF-mGIPFt:
[0510] SEQ ID NO: 68, which encodes the mouse ortholog of the human
GIPF, was cloned into the pcDNA/Intron vector to express a V5-His
tagged protein mGIPFt. The tagged mouse protein was expressed in
HEK 293 cells, and purified according to the method described above
for the purification of the human GIPFt protein. The protein was
purified to 80% purity, and was formulated in PBS. The biological
activity of mGIPFt was analyzed in vivo and in vitro, and shown to
possess the same proliferative properties as human GIPF (Example
20).
E. Characteristics of Purified Recombinant GIPF
[0511] SDS-PAGE analysis of the purified GIPF proteins (GIFPt and
GIPFwt) was performed under reducing and non-reducing conditions,
and showed that the V5-His tagged GIPF proteins derived from 293
cells exists as a monomer. GIPFt and GIPFwt proteins are
glycosylated and migrate on SDS-PAGE under non-reducing conditions
with a molecular weight (MW) of approximately 42 kDa and 38 kDa,
respectively. Matrix-assisted laser desorption/ionization mass
spectroscopy (MALDI) showed that the respective molecular weights
for GIPFt and GIPFwt are 37.8 kDa and 32.9 kDa., while the
theoretical molecular weight for GIPFt and GIPF wt that lack the
signal peptide is 30.2 kDa and 26.8 kDa, respectively. The
discrepancy in the molecular weights suggested that it might have
been accounted for by the glycosylation of the protein.
Subsequently, complete deglycosylation of N-linked and O-linked
oligosaccharides was performed using N- and O-glycanase (Prozyme,
San Leandro, Calif., USA) according to the manufacturer's
instructions. SDS-PAGE analysis of the deglycosylated protein
resulted in a decrease in apparent molecular weight of 4-5 kDa.
Deglycosylation did not affect the biological activity of GIPF when
assayed in vitro and in vivo as described in Examples 17 and 20,
respectively (data not shown).
[0512] Protein stability--To test the activity of GIPF following
denaturation, GIPF was boiled for 5 minutes, and rapidly cooled on
ice. GIPF retained full activity was determined in vitro (see
Example 17) and in vivo (see Example 21). These findings indicate
that GIPF is a stable protein.
[0513] Capping of Cysteine residues--Reduction and alkylation of
cysteine residues was performed to abolish the activity of GIPF.
Reduction of the disulfide bonds of GIPF (1 mg/ml) was obtained by
incubating GIPF in 30 mM DTT, pH 8, at 37.degree. C. for 1 hr.
Subsequently, the free sulfhydryls were by S-carboxymethylation
with 20 mM Iodoacetamide at 37.degree. C. in dark for 30 minutes
(Crestfield A M; Moore S; Stein W H. J. Biol. Chem. 1963; 238,
622). The reaction was stopped by freezing, and excess DTT and
Iodoacetamide were removed by dialysis against PBS. The biological
activity of capped GIPF was analyzed using both in vitro and in
vivo assays. The biological activity of GIPF was obliterated by
capping (see Examples 17 and 20).
[0514] N-terminal sequence analysis showed that HEK293 cells
produced two forms of either the GIPFt or GIPFwt polypeptide: the
dominant mature form (SEQ ID NO: 10) which corresponds to the GIPF
protein of SEQ ID NO: 4 that lacks the signal sequence, and the
mature form (SEQ ID NO: 12), which corresponds to the GIPF protein
of SEQ ID NO: 4 that lacks both the signal peptide and the furin
cleavage sequence. The two forms separated well on the SP column,
and were expressed at a ratio of mature to dominant mature forms of
approximately 1:2. While both the dominant mature and mature forms
of GIPFt induce proliferation of intestinal crypt cells in vivo,
the dominant mature form was used to test the therapeutic effect of
GIPF in the animal models of disease described in Examples 11, 12,
13, and 14. CHO cells express only the dominant mature form of
GIPF.
[0515] Mutagenesis of Furin cleavage site (Arg.sup.28->Gln)--To
show that the mature form of GIPF produced from HEK 293 cells
occurs from the natural processing by furin protease, the conserved
sequence of the furin cleavage site was mutated to replace
Arg.sup.28QRR by Gln.sup.28-QRR. The mutant protein (SEQ ID NO: 18)
was expressed in HEK293 cells and purified according to the method
used for the purification of GIFPt (Example 9A). N-terminal
sequencing of the purified protein confirmed that only the dominant
mature form was expressed in the culture. This finding confirms
that the mature form is generated as a result of proteolytic
cleavage by cellular furin protease activity. In addition, the
overall recovery of the purified dominant mature form increased
from 50% to 68%.
[0516] In summary, the purification processes yield a GIPFt protein
that is >90% pure, and a GIPFwt that is 92-95% pure. The overall
recovery of the dominant mature form of GIPF using either
purification processes is approximately 50%. However, the yield can
be increased by expressing a protein that has a mutated furin
cleavage site. Addition of 0.5 M NaCl to the buffer during the
purification process of media diafiltration and Ni column is
crucial to keep GIPF fully soluble at pH 7. For binding GIPF onto
the SP column, NaCl was removed, and 0.3 M Arg was added to
maintain high solubility and increase protein recovery.
[0517] The dominant mature and mature forms of GIPFt and GIFP wt
were used to test the biological activity of GIPF in vivo. The
proteins purified by the methods of this example consistently
induced significant proliferation of intestinal crypt epithelial
cells, which underlies the distension of the small intestine of the
mice that were administered the purified GIPF protein.
[0518] The biological activity of GIPF was unaffected by
deglycosylation or boiling, but was obliterated by capping cysteine
residues with iodoacetamide.
Example 10
In Vivo Biological Testing of Recombinant GIPF Protein Expressed In
HEK293 and Cho Cells
[0519] The in vivo biological effects of GIPFt protein that was
derived from HEK293 and CHO cells were evaluated in normal mice as
follows.
[0520] The pharmacokinetics (PK) of recombinant GIPF V5His6-tagged
protein (GIPFt) were determined in mice. 6-8 weeks old BALB/c mice
were injected i.v. via the tail vein with single dose of either 40
mg/KG GIPFt protein or formulation buffer as control. Blood was
withdrawn at 0, 30 min, 1 hr, 3 hr, 6 hr and 24 hr after injection
and serum protein level at each time point was analyzed by Western
analysis using anti V5 antibody (Invitrogene Inc., Carlsbad,
Calif.) (FIG. 18A). FIG. 18A shows that no significant degradation
of serum GIPF protein was detected. The half-life of GIPF protein
in serum was calculated by semi logarithmic plot of the protein
concentration after injection using Positope (Invitrogene Inc.,
Carlsbad, Calif.) as a standard V5 tagged protein, and was
estimated to be 5.3 hours (FIG. 18B).
[0521] To investigate whether purified recombinant GIPFt protein
could generate a phenotype similar to that observed in the GIPF
knock-in mice and in the mice that had been injected with
recombinant adenovirus, 6-8 weeks old BALB/c mice were injected
daily through tail vein with either 4 mg/KG GIPFt protein or
formulation buffer as control for 7 days. Mice were sacrificed on
day 8 at 24 hours after last injection. Four hours prior to being
sacrificed, 1 mg of bromodeoxyuridine (BrdU) was injected ip to
determine the in vivo proliferative activity of GIPF. Various
tissues including small intestine, colon, spleen, liver and bone
marrow were collected and fixed in formaline. Paraffin embedded
sections were stained with hematoxylin and eosin for histological
evaluation. Sections were also processed for BrdU
immunohistochemistry according to the manufacturer's instruction
(Oncogene Research product, Boston, U.S.A.) and previously
described (McKinley, J. N. et al. 2000). In all experiments, at
least 3 animals were analyzed per group and experiments were
repeated at least twice.
[0522] H&E staining of gastrointestinal sections showed that
significant proliferation of intestinal crypt epithelial cells in
the small intestine and colon was seen in the mice that had
received GIPF (FIGS. 19 and 21, respectively). This result is
consistent with the results obtained in the transgenic GIPF
knock-in mice, and in the mice that received GIPF adenovirus (see
Examples above) The proliferative effect of GIPF protein was
confirmed by assaying BrdU incorporation in both small intestine
(FIG. 20) and colon (FIG. 22).
Example 11
Prophylactic Effect of GIPF on Radiation-Induced Mucositis
[0523] The efficacy of GIPF as a prophylactic and therapeutic agent
was tested in an animal model of radiation-induced mucositis.
[0524] Forty eight adult male BDF1 mice, aged 10-12 weeks, were
used. On delivery from the supplier and prior to the experiment,
the animals were housed for two weeks in individually ventilated
cages on a 12 hour light:dark cycle to stabilize the circadian
rhythm. Animals were allowed food and water ad libitum.
The animals were divided into 8 groups of 6 animals, and were
treated as follows: 1. Injected with 2 mg/kg GIPF iv at 72, 48, and
24 hours prior to being exposed to 13 Gy X-ray (whole body); 2.
Injected with 5 mg/kg GIPF iv at 72, 48, and 24 hours prior to
being exposed to 13 Gy X-ray (whole body); 3. Injected with 125
.mu.g KGF iv at 72, 48, and 24 hours prior to being exposed to 13
Gy X-ray (whole body); 4. Injected with saline vehicle iv at 72,
48, and 24 hours prior to being exposed to 13 Gy X-ray (whole
body); 5. Untreated, non-irradiated controls; 6. Injected with 2
mg/kg GIPF iv 24, 48, and 72 hours post irradiation with 13 Gy
X-rays (whole body); 7. Injected with 5 mg/kg GIPF iv 24, 48, and
72 hours post irradiation with 13 Gy X-rays (whole body); 8.
Injected with saline iv at 24, 48, and 72 hours post irradiation
with 13 Gy X-rays (whole body).
[0525] All injections were given at 15:00 hours. Intestinal damage
was induced using a single dose of 13 Gy X-irradiation (delivered
at 0.7 Gy/min) at 15:00.
[0526] Four days after irradiation the animals were culled. The
small intestine was removed and fixed in Carnoy's fixative prior to
processing for histological analysis. Transverse sections 3 .mu.m
thick were cut and stained with haematoxylin and eosin. Immediately
after sacrifice the duodenum, mid colon, liver, lung, tongue,
spleen, stomach and pancreas were also removed and fixed in formal
saline overnight prior to storage in 70% ethanol.
[0527] For each animal ten intestinal circumferences were analyzed
(60 per group)--a circumference is equivalent to a given length of
intestine and therefore a convenient baseline unit of length. The
number of surviving crypts per circumference were scored and the
average per group determined (Table 4). Only crypts containing 10
or more strongly H&E stained cells (excluding Paneth cells) and
only intact circumferences not containing Peyers patches were
scored.
[0528] The average crypt width (measured at its widest point) was
also measured in order to correct for scoring errors due to crypt
size difference. The correction is applied thus:
Corrected number of crypts circumference = Mean crypt width in
untreated control Mean crypt width in treated animal .times. Mean
number of surviving crypts in treatment group ##EQU00001##
All the animals survived the treatment and exhibited no obvious
adverse effects. FIG. 23 A-D shows sections from the small
intestine from the animals the untreated group 5 (A), the saline
pre-treated group 4 (B), the KGF-treated group 3 (C) and the
GIPF-treated group 2 (D). Foci of regeneration (surviving crypts
with one or more clonogenic cells) are clearly visible in the
tissue section from the saline-treated animals (group 4) (FIG. 23B)
Other than these foci the mesenchyme is entirely denuded, and these
animals would have developed diarrhea and died due to the mucositis
if they had been allowed to live beyond four days post irradiation.
GIPF afforded protection of the intestinal architecture (FIG. 23 D)
in a manner comparable to the to that provided by KGF (FIG. 23
C.).
TABLE-US-00005 TABLE 4 No. of crypts/ Crypt Width Corrected crypts/
Experimental Circumference (.mu.m) Circumference Group (Mean .+-.
SD) (Mean .+-. SD) (Mean .+-. SD) 1. 12.96 .+-. 4.9 51.98 .+-. 5.4
7.4 .+-. 3.3 2. 15.4 .+-. 4.9 45.03 .+-. 2.8 10.1 .+-. 3.3 3. 22.1
.+-. 3.8 54.46 .+-. 2.1 12.0 .+-. 1.2 4. 7.2 .+-. 2.6 55.27 .+-.
6.4 3.8 .+-. 1.2 5. 109.1 .+-. 5.3 29.56 .+-. 3.0 6. 10.7 .+-. 4.5
57.16 .+-. 3.9 5.5 .+-. 2.3 7. 10.6 .+-. 4.1 55.50 .+-. 4.7 5.6
.+-. 2.1 8. 9.4 .+-. 1.9 56.85 .+-. 6.9 5.0 .+-. 1.4
[0529] It is immediately obvious that pre-treatment with GIPF
increased considerably the number of crypts that survived the 13 Gy
irradiation. Pre-treatment with GIPF at a dose of 2 mg/kg (group 1)
increased survival by 1.95 fold that of the crypts from the
untreated group 4 (also known as the protection factor), and the
GIPF dose of 5 mg/kg (group 2) further increased crypt survival by
2.66 fold. This is extremely impressive and almost comparable with
the effect seen with treatment with the known optimal dosing of KGF
(group 3), which increased crypt survival by 3.16 fold.
[0530] Therefore, GIPF was shown to protect the epithelium of the
small intestine from the injurious effects of irradiation, and
could be used as a potent prophylactic in patients for whom
radiation therapy has been indicated.
Example 12
Chemotherapy-Induced Mucositis Model
[0531] The efficacy of the recombinant human GIPF (GIPFwt) in
treating chemotherapy-induced mucositis was evaluated in healthy
and in tumor-bearing mice. The experimental protocol was based on
that previously described by Boushey et al. (Cancer Res 61:687-693
(2001)).
[0532] One million CT26 murine colon carcinoma cells (ATCC,
Manassas, Va., USA) were injected sc into syngeneic female BALB/c
mice, and the tumors were allowed to develop for 5 days. Healthy
and tumor-bearing animals were divided into experimental groups of
6 mice each and treated as follows:
1. tumor bearing mice, vehicle (50% DMSO) injected ip from day 1 to
day 5, saline injected iv from day 0 to day 7 (TVS) 2. tumor
bearing mice, vehicle (50% DMSO) injected ip from day 1 to day 5,
50 .mu.g GIPF in 100 .mu.l saline injected iv daily from day 0 to
day 7 (TVG); 3. tumor bearing mice, 50 mg/kg 5-FU injected ip from
day 1 to day 5, saline injected iv from day 0 to day 7 (TDS); 4.
tumor bearing mice, 50 mg/kg 5-FU injected ip from day 1 to day 5,
50 .mu.g GIPF in 100 .mu.l saline injected iv from day 0 to day 7
(TDG); 5. healthy mice, 50 mg/kg 5-FU injected ip from day 1 to day
5, saline injected iv from day 0 to day 7 (NDS); 6. healthy mice,
50 mg/kg 5-FU injected ip from day 1 to day 5, 50 .mu.g GIPF in 100
.mu.l saline injected iv from day 0 to day 7 (NDG).
[0533] On days 0, 2, 4, 6, and 8 measurements of animal body
weight, severity of diarrhea, and size of the tumors were recorded.
A diarrhea score of 0-3 reflected a corresponding worsening of the
symptom from 0 being normal to 3 being severe. The change in body
weight was calculated as the percent body weight of that of the
untreated group. The length, width and height of the tumor were
measured with calipers, and the volume of the tumor was calculated
as (length.times.width.times.height)/2.
[0534] All animals were euthanized on day 8. The large and small
intestine were removed and weighed, their length was measured, and
the diameter of the mid-jejenum was recorded. A segment (1 cm) of
the mid-jejenum was excised about 14-15 cm from the pylorus, and a
segment (1 cm) of the transverse colon was excised at about 4 cm
from the ileocaecal junction. The bowel segments were flushed and
fixed using 10% neutral buffered formalin for histological
analysis. Histological examination and morphometry of the mucosa
were performed on tissue sections using the ImagePro Software
(Imagepro, Ltd., Ashford, Middlesex, UK).
[0535] The effect of GIPFwt on the severity of diarrhea, body
weight and tumor size are summarized as follows:
TABLE-US-00006 Diarrhea score (mean .+-. SD): Body weight (% of
untreated) Group 3 TDS 2.83 .+-. 0.41 74.7 .+-. 5.2 Group 4 TDG
0.33 .+-. 0.52 85.1 .+-. 5.7 Group 5 NDS 3 .+-. 0 73.2 .+-. 4.3
Group 6 NDG 0.5 .+-. 0.55 87.0 .+-. 6.0 Tumor volume (mean .+-. SD;
mm.sup.3): Group 1 TVS 95.8 .+-. 8.1 Group 2 TVG 95.1 .+-. 4.2
Group 3 TDS 21.8 .+-. 3.0; p < 0.05 Group 4 TDG 16.7 .+-. 8.6; p
< 0.05
[0536] GIPF reduced significantly the severity of the diarrhea
caused by 5-FU in the healthy and the tumor-bearing mice of groups
6 and 4, respectively, when compared to the scores for the normal
and tumor-bearing mice of groups 5 and 3, which did not receive
GIPF. Similarly, GIPF reduced the loss of body weight that the
5-FU-treated animals experienced.
[0537] The tumors from the untreated tumor-bearing mice (group 1)
were similar in size to those from the GIPF-treated tumor-bearing
mice (group 2). Thus, GIPF did not affect the growth of the tumor.
As expected, 5-FU reduced the size of the tumors in the mice of
group 3, and it also reduced the size of the tumors of the mice of
group 4 Thus, GIPF did not impede the activity of 5-FU in reducing
the size of the tumors (FIG. 24).
[0538] The effect of GIPF on the gross appearance of the intestines
is shown in FIG. 25, and the corresponding measurement of
intestinal diameter, weight and length are given in Table 5. The
intestines of the normal and tumor-bearing mice that had received
5-FU was atrophied (FIG. 25E), and numerous lesions associated with
bleeding were observed, while the appearance of the intestines from
the mice that had received GIPF was overtly normal and accompanied
by the typical distension due to the proliferative effect of GIPF
on the in intestinal epithelium (FIGS. 25 B, C, D, and F).
TABLE-US-00007 TABLE 5 CT26 tumor-bearing mice Group 1 Group 2
Group 3 Group 4 Diameter 2.66 .+-. 0.15 3.65 .+-. 0.21* 2.53 .+-.
0.15 3.58 .+-. 0.14.sup.# Midjejenum (mm) Weight Small bowel 1.16
.+-. 0.09 1.47 .+-. 0.14* 0.90 .+-. 0.01 1.51 .+-. 0.13.sup.# (g)
Large bowel 0.32 .+-. 0.02 0.38 .+-. 0.02* 0.25 .+-. 0.03 0.39 .+-.
0.02.sup.# (g) Length Small bowel 35.2 .+-. 2.0 40.5 .+-. 1.0* 30.2
.+-. 1.3 39.7 .+-. 2.1.sup.# (cm) Large bowel 8.7 .+-. 0.3 9.7 .+-.
0.3* 6.3 .+-. 0.3 9.5 .+-. 0.5.sup.# (cm) Normal mice Group 5 Group
6 Diameter 2.38 .+-. 0.13 3.44 .+-. 0.13** Midjejenum (mm) Weight
Small bowel (g) 0.88 .+-. 0.08 1.43 .+-. 0.13** Large bowel (g)
0.25 .+-. 0.02 0.38 .+-. 0.04** Length Small bowel (cm) 30.3 .+-.
1.9 39.3 .+-. 1.0** Large bowel (cm) 6.9 .+-. 0.9 9.7 .+-. 1.0** *P
< 0.05 (ANOVA, group 2 vs group 1) .sup.#P < 0.05 (ANOVA,
group4 vs group 3) **P < 0.05 (ANOVA, group 6 vs group 4)
[0539] Histological analysis of intestinal sections of the small
intestine and colon of all experimental groups showed that GIPF
preserved the intestinal architecture of the mice that had received
5-FU by preventing the massive damage to the villi and crypt
compartments of the intestinal mucosa caused by 5-FU (FIG. 26),
FIG. 26 A shows the effects of 5-FU on the small intestine, and
FIG. 26B shows the effects of 5-FU on the colon. Micromorphometry
measurements of villus height and crypt depth in the midjejenum
confirm that the effect of GIPF is significant (FIG. 27),
[0540] GIPF protects that small intestine and colon from the
deleterious effects of 5-FU, and it does not hinder the therapeutic
effects of 5-FU. Therefore, GIPF may be used in conjunction with
chemotherapeutic agents to reduce the deleterious side-effects of
antineoplastic therapies.
Example 13
Prophylactic Effect of GIPF on Chemotherapy and Radiation-Induced
Oral Mucositis
[0541] The effect of GIPF on the proliferation of the dorsal
(buccal) and ventral epithelium of the tongue was studied in mice
that had been subjected to X-ray irradiation or dosed with 5-FU, as
described in Examples 11 and 12, respectively.
[0542] Immunohistochemistry using monoclonal rat anti-mouse Ki67
antigen (Dako Ltd., High Wycombe, UK) was performed, according to
manufacturer's instruction and the method previously described
(Scholzen, T. et al. 2000), on paraffin embedded sections of tongue
from non-irradiated and irradiated mice (groups 1, 2, and 3 in
Example 11).
[0543] GIPF visibly increased the number of nuclei that stained for
Ki67 in the ventral and dorsal tongue epithelium of irradiated
animals when compared to that from animals that were not given GIPF
(FIGS. 28 and 29). The epithelial proliferative index, which is
calculated as the percent ventral epithelial cells that stained
positive for Ki67, confirmed that GIPF reduced significantly the
loss of cellularity caused by the radiation to the ventral tongue
epithelium (FIGS. 30).
Histological analysis of sections from the tongue of animals that
had been treated with 5-FU (groups 2-6 in Example 12) shows that
GIPF maintains the morphology of the dorsal and ventral epithelial
layers in normal and tumor-bearing animals that had been treated
with 5-FU (FIG. 31).
[0544] The epithelial layer of the tongue from all animals that had
been treated with GIPF was remarkably less damaged by 5-FU than
that of the experimental animals that had not received GIPF.
[0545] Therefore, GIPF may be used as a therapeutic agent for the
treatment and/or prevention of chemotherapy and radiation
therapy-induced oral mucositis. Quantitative animal models of oral
mucositis (e.g. Wardly et al., Arch Oral Biol 43:567-577 (1998);
Potten et al., Cell Prolif 35:32-47 (2002)) can be used to study
further the therapeutic properties of GIPF, when administered in
combination with other cytotoxic agent to further assess the
potential role of GIPF in reducing the severity of the cellular
depletion and to increase the rate of regeneration of the
epithelial layers of the oral and intestinal epithelium.
Example 14
Therapeutic Effect of GIPF on Dextran Sulfate Sodium-Induced
Colitis
[0546] The efficacy of recombinant human GIPF (GIPFwt) in treating
colitis was tested in a mouse model of dextran sulfate sodium
(DSS)-induced colitis, and compared to that the efficacy of GLP-2
(L'Heureux and Brubaker J Pharmacol Exp Ther 306:347-354 (2003);
Kriegelstein et al., J Clin Invest 110:1773-1782 (2002); Siegmund
et al., J Pharmacol Exp Ther 296:99-105 (2001)).
[0547] Six to eight-week old female BALB/c mice (Charles River
Laboratories, Wilmington, Mass., USA) were housed in ventilated
cages and acclimated for one week to a 12 hour light:dark cycle.
Twenty four mice having similar body weight (approximately 20 g;
<5% variance) were housed in 4 cages and fed ad libitum a 4% DSS
(v/w) drinking solution for 7 days.
[0548] On day 7, the body weight of each animal was recorded, and
the scores for loss in body weight, the consistency of stools, and
anal bleeding were determined as shown in Table 6 below.
TABLE-US-00008 TABLE 6 Occult/Gross Rectal SCORE Weight Loss (%)
Stool Consistency bleeding 0 None Normal Normal 1 0-5% 2 5-10%
Loose Hemoccult 3 10-20% 4 >20% Diarrhea Gross
[0549] The scores were used to calculate the IBD activity index
(IBDAI), which was used as an indicator of the severity of the
colitis, and is calculated as the average of the scores given for
the tabulated parameters. The scores for weight loss, stool
consistency, and rectal bleeding were determined daily, and the
IBDAI was recorded daily for the duration of the experiment.
[0550] On day 7, the 4% (v/w) DSS drinking solution was substituted
with a 1% (v/w) DSS solution to maintain the disease activity
without exacerbating the effect of the DSS. Sixteen of the DSS-fed
animals were selected for consistent and comparable disease
activity, and were dived into groups of 4 animals and were treated
as follows: [0551] 1. Water, saline injected iv daily (10 am) for 7
days [0552] 2. DSS (1%) for 7 days, saline injected iv daily (10
am) for 7 days [0553] 3. DSS (1%) for 7 days, 100 .mu.g GIPF
injected daily iv (10 am) for 7 days [0554] 4. DSS (1%) for 7 days,
50 .mu.g GIPF injected daily iv (10 am) for 7 days [0555] 5. DSS
(1%) for 7 days, 10 .mu.g GLP-2 injected sc twice daily (10 am and
6 pm) for 7 days.
[0556] The GIPF protein used in these experiments was the human
recombinant GIPF protein (SEQ ID NO: 4; GIPFwt), which was
expressed and purified according to the method described in Example
9. The analog of GLP-2, h[Gly.sup.2]GLP-2 was synthesized and
purchased from Biosource International (Camarillo, Calif.,
USA).
[0557] On day 14, food was removed from the cages to allow for
purging of the intestine, and the animals were culled by cervical
dislocation. All animals were injected with 4 mg/0.1 ml BrdU two
hours prior to sacrifice. The large and small intestine were
removed and weighed, their length was measured, and the diameter of
the mid-jejenum was recorded. A segment (1 cm) of the mid-jejenum
was excised about 14-15 cm from the pylorus, and a segment (1 cm)
of the transverse colon was excised at about 4 cm from the
ileocaecal junction. The bowel segments were flushed and fixed
using 10% neutral buffered formalin for histological analysis.
Histological examination and morphometry of the mucosa were
performed on tissue sections using the Imagepro Software (Imagepro,
Ltd., Ashford, Middlesex, UK). The IBDIAs for the mice of
experimental groups 2-5 are shown in FIG. 32, and the corresponding
scores for weight loss, stool consistency and rectal bleeding are
shown in FIGS. 33, 34, and 35, respectively. These data show that
GIPF afforded a therapeutic effect by reducing the severity of the
colitis as early as day 11. By day 14, the GIPF-treated mice of
groups 3 and 4 had significantly lower IBDIA (1.75 and 1.83,
respectively) than the untreated mice of group 2 (3.75). GLP-2 had
a moderate effect on the severity of the colitis, and by day 14 it
reduced the IBDAI of the DSS-treated mice to 3.25.
[0558] An example of the gross pathology of the intestine and colon
of the mice from groups 1, 2, 3, and 5 is shown in FIG. 36. Animals
receiving DSS with saline developed severe colitis that was
typically associated with atrophy, hyperemia, and diarrhea when
compared to the control group. The small and large intestine of the
animals that were treated with GIPF showed some distension, and
were remarkably similar to those of the control group. These
findings indicate that GIPF may be used as an effective therapeutic
agent for the treatment of inflammatory bowel disease. While GLP-2
afforded some therapeutic effect, the small and large intestine
from this group seemed marginally less injured than that from the
animals in the control group. The significance of the changes is
reflected by the measurements of the small and large intestines
shown below in Table 7.
TABLE-US-00009 TABLE 7 Group 1 Group 2 Group 3 Group 4 Group 5
Diameter Midjejenum (mm) 2.25 .+-. 0.09 1.72 .+-. 0.05* 2.50 .+-.
0.18.sup.# 2.23 .+-. 0.10# 1.97 .+-. 0.04** Weight Small bowel (g)
0.94 .+-. 0.06 0.78 .+-. 0.05* 0.91 .+-. 0.09.sup.# 0.89 .+-.
0.05.sup.# 0.88 .+-. 0.07 Large bowel (g) 0.26 .+-. 0.02 0.18 .+-.
0.01* 0.23 .+-. 0.01.sup.# 0.22 .+-. 0.01.sup.# 0.18 .+-. 0.01
Length Small bowel (cm) 32.0 .+-. 1.4 26.6 .+-. 0.9* 31.1 .+-.
0.9.sup.# 30.3 .+-. 0.6.sup.# 28.9 .+-. 0.8** Large bowel (cm) 7.3
.+-. 0.3 4.9 .+-. 0.5* 6.6 .+-. 0.5.sup.# 6.4 .+-. 0.3.sup.# 5.4
.+-. 0.6 *P < 0.05 (ANOVA, group 2 vs group 1) .sup.#P < 0.05
(ANOVA, groups 3 or 4 vs group 2) **P < 0.05 (ANOVA, group 5 vs
group 2)
[0559] H & E staining of paraffin embedded sections showed that
DSS caused massive infiltration by inflammatory cells and
disintegration of the villus and crypt compartments of the mucosa
of the small intestine and colon (FIG. 37). Consistent with the
observations of the gross pathology described above, GIPF reversed
the effects caused by DSS, and restored the intestinal architecture
of the crypts and villi. The crypts of the GIPF-treated animals
were distended when compared to those from the control group. GLP-2
afforded some therapeutic effect, albeit to a far lesser level than
GIPF (data not shown). Micromorphometry of the villi and crypts
(FIG. 38) confirmed that the curative effect of GIPF was reflected
by a significant restoration of the villus height and the crypt
depth, which had been severely destroyed by the colitis. The repair
of the mucosal architecture by GIPF was underscored by a
significant proliferation of crypt cells (FIGS. 39 and 40). The
crypt proliferative index, which is calculated as the percent crypt
cells that stained positive for BrdU, was significantly greater in
the DSS-treated mice that received GIPFwt than in the DSS-treated
mice that were injected with saline (P<0.05) (FIG. 40).
Example 15
Therapeutic Effect of GIPF Following Massive Intestinal
Resection
[0560] The effect of GIPF in augmenting the adaptive response to
massive intestinal resectionis tested in a rat animal model of
short bowel syndrome (SBS). The animal model used in the study of
the effects of enterorophic agents has been described (Scott et al.
Am J Physiol G911-G921 (1998); Helmrath et al., J Am Coll Surg
183:441-449 (1996)), and the experimental protocol is herein
incorporated by reference).
[0561] The animals are divided into a resected group that will have
a 75% surgical resection of the midjejenunoileum, a sham-resected
operated control group in which the intestine is sectioned and
reanastomosed, and an unoperated control group. The animals are
administered saline or GIPF at a dose of 2 mg/Kg. The 75%
intestinal resection is chosen to maximize any adaptive response,
and retention of equal portions of the proximal jejunumnum and
distal ileum is based on the nutritional implications of removing
the specialized absorptive capacity of the terminal ileum for
vitamin B12 and bile acids and the ileal brake. In the rat, the
retention of 25% of the small intestine inclusive of a portion of
distal ileum, is sufficient to allow resected animals to achieve
the same growth rate as control animals.
[0562] The metabolic, morphological, histological, and functional
response of the gut to resection and treatment with GIPF is
assessed during the course of the experiment and also as end-point
analysis on Day 10. Food intake and growth, gross and microscopic
small intestinal morphology, and functional evaluation of mucosal
absorptive characteristics are evaluated as described (Scott et
al., supra).
[0563] GIPF significantly increases the food consumption and
reduces the loss in body weight that typically accompanies
resection of the small bowel. GIPF also increased the length of the
remnant intestine, its diameter, wet weight, and mucosal wet
weight, and increases the absorptive capacity of the remnant small
intestine. H&E staining of cross-sections of the small
intestine shows that GIPF elongates both the villus height and
crypt depth, and increases crypt cell proliferation in the gut of
the animals with resected small intestines. Thus, GIPF reduces the
effects of bowel resection by augmenting intestinal adaptation.
Example 16
Effect of GIPF on the Proliferation of Tumor Cells
[0564] GIPF induces a strong proliferative effect on intestinal
crypt epithelial cells in vivo. To investigate the proliferative
effect on in vitro, the effect of recombinant GIPFwt was tested on
the proliferation of various tumor and normal cell lines in
vitro.
The rate of cell proliferation of the following cell lines (ATCC)
was measured by assaying the incorporation of
.sup.3H-thymidine:
TABLE-US-00010 Caco-2 human colorectal adenocarcinoma; epithelial
COLO205 human ascites from metastatic colorectal adenocarcinoma;
epithelial HCC70 human mammary gland ductal carcinoma; epithelial
HCT116 Human colorectal carcinoma; epithelial HT-29 Human
colorectal adenocarcinoma; epithelial IEC-18 Rat ileum; epithelial
IEC-6 rat small intestine; epithelial LS513 human caecum;
colorectal carcinoma; epithelial MCF7 human pleural effusion from
metastatic breast adenocarcinoma; epithelial NCI-H1373 human lung
adenocarcinoma PC-3 human bone metastasis from prostate
adenocarcinoma; epithelial SCC-25 Human tongue squamous cell
carcinoma SCC-4 Human tongue squamous cell carcinoma SK-BR-3 Human
pleural effusion from metastatic colon adenocarcinoma; epithelial
SK-MES-1 Human pleural effusion from metastatic squamous cell lung
carcinoma; epithelial SW620 Human lymph node metastasis from
colorectal adenocarcinoma; epithelial T84 Human lung metastasis
from colorectal carcinoma; epithelial 293 Human fetal kidney;
epithelial
Cells were seeded at 10,000-50,000 cells per well, and depending on
cell lines and treated with scaled doses of GIPFwt (1.37-1000
ng/ml). The rate of proliferation of the GIPF-treated cells was
compared to that of untreated cells, or cells that were grown in
10% complete media (growth media, 2.5% dialyzed FBS, and
pen/strep). The cells were incubated for 48 hours at 37.degree. C.,
and pulsed with 0.5 .mu.Ci .sup.3H-thymidine for the last 20-24
hours of incubation. Cells were harvested, the amount of
.sup.3H-thymidine that had been incorporated was determined, and
the results determined from duplicate samples of replicate
experiments.
[0565] GIPFwt did not affect the rate of proliferation of most of
the tumor cells that were tested. An increase in the rate of
proliferation was induced only at the higher doses of GIPF in
IEC28, T84, HCT116, and HT29 cells. The extent of the proliferation
was less than 40% of rate of the untreated cells.
[0566] Therefore, these findings indicate that GIPF may not
exacerbate the rate of proliferation of tumors existing in vivo,
and GIPF may be used for treating cancer patients who are suffering
from mucositis caused by antineoplastic therapies.
Example 17
Effect of GIPF on Intracellular Signaling
[0567] The wnt/.beta.-catenin signaling pathway plays a pivotal
role in development and homeostasis. In the small intestine, wnt
signaling is known to play a critical role as a regulator of
intestinal crypt proliferation by stabilizing .beta.-catenin, which
subsequently induces the transactivation of T-cell factor (TCF)
target genes (Wetering et al., Cell 111:241-250 (2002); Batle et
al., Cell, 111:251-263, (2002); Perreault et al., J Biol Chem
276:43328-43333 (2001); Booth et al., Nat Med 8:1360-1361
(2002)).
[0568] To evaluate the effect of GIPF on the wnt/.beta.-catenin
signaling pathway, the stabilization of .beta.-catenin was measured
in various cultured cell lines. Cells were seeded at 1 million
cells/well for a 6-well plate in Dulbecco's modified Eagle's medium
supplemented with 10% FBS. The following day, cells were grown in
serum-free medium, and treated either with GIPF at 50 ng/ml or
LiCl.sub.2 (positive control) at 10 mM in low serum conditions
(0.1% FBS). Cytoplasmic fractions were prepared as described by
Haertel-Weismann et al., (J Biol Chem 175:32046-32051 (2000)). The
proteins were resolved by gradient (4-20%) SDS-PAGE, and the level
of .beta.-catenin was assessed using a .beta.-catenin rabbit
antibody (Abcam) that was visualized using a peroxidase conjugated
secondary antibody (Cell Signaling).
[0569] Among tested cell lines, GIPF induced the stabilization of
.beta.-catenin in a human endocrinic L cell line (NCI-H716, data
not shown), and in HEK 293 cells in a dose-dependent and
time-related manner (FIGS. 41A and B, respectively). Consistent
with the findings described in Example 18, boiling GIPF did not
affect its ability to stabilize .beta.-catenin, but, the effect was
abolished by treatment with proteinase K, and by reduction with DTT
(FIG. 41 C).
[0570] To further investigate the signaling pathway through which
GIPF leads to the accumulation of .beta.-catenin, the activity of
GSK3.beta. was analyzed in HEK293 cells. In the canonical wnt
signaling pathway, Wnt activates .beta.-catenin by inhibiting
GSK3.beta., which would otherwise phosphorylate .beta.-catenin and
mark it for destruction by the proteosome.
[0571] GIPF increased the phosphorylation of GSK3.beta. in HEK 293
cells in a time-dependent manner (FIG. 42). These data indicated
that GIPF may activate .beta.-catenin by canonical wnt signaling
pathway by inhibiting .beta.-catenin phosphorylation by GSK3.
However, GIPF did not induce the stabilization of p-catenin in
other cell lines including the mouse epithelial cell line C57MG in
which Wnt3A has been shown to have a potent effect on induces
.beta.-catenin activation. Furthermore, Dickkopf-1 (Dkk1), which is
a potent inhibitor of the Wnt signaling pathway (Kuhnert, PNAS
101:266-271, 2004), did not completely inhibit .beta.-catenin
stabilization by GIPF in 293 cells (data not shown). These data
suggest that GIPF may stabilize .beta.-catenin via a pathway that
is distinct from the known canonical Wnt/.beta.-catenin
pathway.
Example 18
Effect of GIPF on the Expression of .beta.-Catenin Target Genes
[0572] Accumulation .beta.-catenin results in its translocation to
the nucleus where it associates with transcription factors of the
TCF/LEF family. Due to its transactivating ability the
.beta.-catenin-transcription-factor-complex binds to DNA and
activates wnt target genes. To further investigate GIPF-induced
.beta.-catenin signaling, we determined the activation of down
stream target genes in HEK293 and NCI-H716 cells by quantitative
PCR.
[0573] 1.times.10.sup.6 HEK-293 cells and 2.times.10.sup.6 NCI-H716
cells (ATCC) were seeded in 6-well plates and allowed to attach 6
hrs in complete media. Cells were then changed to 0.1% FBS Assay
media and incubated overnight. The day of the assay, treatments
were added to the cells in an additional 1 ml of Assay media. Cells
were incubated for 8 hours at 37.degree. C./5% CO2 with either 20
mMLiCl (Sigma), 10 ng/ml Wnt-3A (R&D Systems), 250 ng/ml GIPFt,
or 250 ng/ml capped GIPF protein. A well of untreated cells,
maintained in Assay media, was included as a background for gene
expression. Total RNA was isolated from both cell types using
RNeasy Mini kit and DNasel kit (Qiagen), quality and concentration
of the total RNA was quantified. For each sample, 4 ug of total RNA
was primed at 70.degree. C. for 3 mins with 3 ug Random Hexamers
and 2 mM each dNTP. Reactions were cooled on ice for 1 min.
Reaction volume was brought to 22 ul with 5.times.M-MLV Buffer
(Promega), 25 mM MgCl.sub.2, 0.1 M DTT and RNaseOut (Invitrogen).
Upon addition of 400 units M-MLV Reverse Transcriptase (Promega)
the reactions were incubated 10 mins at 23.degree. C., 50 mins at
42.degree. C., and 5 mins at 70.degree. C. to terminate the
reaction. cDNA was then diluted and treated with 1 unit of RNaseH
(Invitrogen) to digest remaining RNA. OD260 nm quantified cDNA
concentration. For each 10 ul quantitative SYBR Green PCR reaction,
2 ul cDNA (440 ng) was used, in conjunction with 1.25 .mu.M of each
forward and reverse primer, and 2.times.SYBR Green mastermix
(Eurogentec). Reactions were performed in triplicate. Primers for
Quantitative PCR were designed for the following human
.beta.-catenin target genes: Axin-2 (SEQ ID NOs: 70 and 71), CD44
(SEQ ID NOs 72 and 73), EpherinB2 (SEQ ID NOs: 74 and 75), c-myc
(SEQ ID NOs: 76 and 77), Proglucagon (SEQ ID NOs: 78 and 79), and
Cox-2 (SEQ ID NOs: 80 and 81). Human EF1 (SEQ ID NOs: 82 and 83)
was used as housekeeping gene to standardize expression levels.
[0574] GIPF increased the expression of Axin-2 in HEK-293 and
NCI-H716 cells, and caused the upregulation of CD44 and EphrinB2 to
levels that were greater than resulting from stimulation with Wnt3A
or Lithium. The expression levels of Cox-2, c-myc and proglucagon
genes were not affected by GIPF (data not shown).
[0575] These data provided insight into the mechanisms involved in
GIPF-induced target gene activation. Further studies are performed
to elucidate the events downstream of GIPF signaling.
Example 19
In Vitro Assay for the Activity of GIFP
[0576] Eleven deletion mutants of GIPF (SEQ ID NOs: 84, 86, 88, 90,
92, 94, 96, 98, 100, 102, and 104) were subcloned into the
pIntron/IgK vector, and transiently expressed in HEK293 cells. The
position of each of the encoded polypeptide fragments (SEQ ID NOs:
85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105 and 178) within the
full-length GIPF polypeptide is shown in FIG. 43. The mammalian
expression vector pIntron/IgK was obtained by genetically modifying
the pSectag vector (Invitrogene Inc., Carlsbad, Calif.) by
introducing an engineered chimeric intron derived from the pCI
mammalian expression vector (Promega, Madison, Wis.). pcDNA/Intron
vector was digested with BGIII and NheI, and the intron sequence
was cloned into pSectag, which had been digested with BgIII and
NheI. The forward and reverse primers used to amplify and subclone
the polynucleotide fragments correspond to SEQ ID NOs: 106-119, as
indicated in the sequence listing. The forward primer of SEQ ID NO:
106 was used with the reverse primers for fragments 1-7 (primer SEQ
ID NOs: 107-113; the forward primer of SEQ ID NO: 114 was used with
the reverse primers for fragments 8-10 (SEQ ID NOs: 115-117).
[0577] The polypeptide fragments were transiently expressed in HEK
293 cells and the activity of the fragments in stabilizing
.beta.-catenin was assayed as described in Example 17. The
polypeptide fragment of SEQ ID NO: 91 induced the greatest
stabilization of .beta.-catenin when compared to the activity
displayed by the other fragments tested. This finding suggests that
the furin-like cysteine-rich domain of GIPF may be essential for
mediating the proliferative activity of GIPF. However, the activity
of the polypeptide of SEQ ID NO: 91 was lower than that of the
full-length GIPF (FIG. 44). Therefore, other portions of the GIPF
protein are necessary to enable the maximum stabilization of
.beta.-catenin.
Example 20
Rapid In Vivo Assay for the Activity of Recombinant GIFP
[0578] A rapid in vivo assay was developed to test the test the
bioactivity of purified GIPF.
[0579] The activity of human and mouse GIPF (GIPFwt and mGIPFt) was
tested in mice that had been grouped and treated as follows:
[0580] 1. Saline, injected i.v.
[0581] 2. GIPFwt, injected 100 .mu.g i.v.
[0582] 3. GIPFwt, injected 50 .mu.g i.v.
[0583] 4. mGIPFt, injected 100 .mu.g i.v.
[0584] 5. mGIPFt, injected 50 .mu.g i.v.
[0585] 6. GIPFwt, boiled, injected 100 .mu.g i.v.
[0586] 7. GIPFwt, capped, injected 100 .mu.g i.v.
[0587] 8. GIPFwt, injected 100 .mu.g s.c.
[0588] Twenty four female BALB/c mice were used in the experiments.
GIPF was injected daily for three days. Animals were sacrificed on
day 4. Prior to being sacrificed, 0.5 ml of blood was collected for
hematological analysis, and two hours prior to being sacrificed,
all animals were injected i.p with 0.4 ml of a 1 mg/ml solution of
BrdU. The small intestine and colon were dissected, measured as
described above, and segments of midjejenum and colon processed for
histological analysis as described in previous Examples.
[0589] The results are shown in FIG. 45. The distension of the
intestines from the mice that had received mouse GIPF protein,
mGIPFt, was comparable to that induced by the human GIPFwt. In
addition, the phenotype of the intestines of the mice that received
GIPFwt via subcutaneous administration was comparable to that of
the mice that had received GIPFwt via the i.v. route. As previously
noted, boiling of GIPFwt does not affect its ability to cause the
distension of the intestine. These findings were consistent with
the measurements of length, weight, and diameter of the intestines
from all animal groups (Table 8).
TABLE-US-00011 TABLE 8 Diameter (mm) Weight (g) Weight (g) Length
(cm) Length (cm) midjejenum Small bowel Large bowel Small bowel
Large bowel Animal Group Mean .+-. SD Mean .+-. SD Mean .+-. SD
Mean .+-. SD Mean .+-. SD 1 2.31 .+-. 0.15 0.90 .+-. 0.04 0.24 .+-.
0.03 29.5 .+-. 1.5 6.7 .+-. 0.3 2 3.64 .+-. 0.14* 1.34 .+-. 0.10*
0.33 .+-. 0.02* 36.0 .+-. 1.3* 8.5 .+-. 0.5* 3 3.55 .+-. 0.12* 1.32
.+-. 0.07* 0.32 .+-. 0.03* 36.5 .+-. 0.5* 8.7 .+-. 0.3* 4 3.68 .+-.
0.06* 1.39 .+-. 0.05* 0.35 .+-. 0.02* 37.8 .+-. 0.8* 8.8 .+-. 0.3*
5 3.45 .+-. 0.09* 1.23 .+-. 0.04* 0.33 .+-. 0.01* 36.5 .+-. 0.5*
8.5 .+-. 0.5* 6 3.07 .+-. 0.12* 1.25 .+-. 0.06* 0.34 .+-. 0.01*
35.5 .+-. 0.5* 8.3 .+-. 0.3* 7 2.28 .+-. 0.11 0.88 .+-. 0.07 0.21
.+-. 0.03 31.0 .+-. 1.3 6.3 .+-. 0.3 8 3.03 .+-. 0.10* 1.12 .+-.
0.04* 0.28 .+-. 0.02* 34.2 .+-. 0.8* 7.8 .+-. 0.3* *P < 0.05
(ANOVA, groups 1-8 vs group 1)
[0590] All hematological results were within the normal range for
the animals, thus indicating that GIFP did not produce any
immediate adverse effects. The effect of GIPFwt and mGIPFt on
villus height and crypt depth showed that GIPF significantly
increased crypt depth in healthy mice after the 3-day regimen. In
contrast to the effect of GIPF on increasing the villus height in
the intestine of diseased animals, GIPF did not affect the height
of the villi from normal, healthy animals. (FIG. 46).
[0591] These data show that the proliferative effect of the human
recombinant GIPF is not the result of an ectopic effect. In
addition, GIPF exhibits its biological activity whether it is
administered intravenously of subcutaneously.
Example 21
In Vitro Assays for the Activity of GIPF in Isolated Crypt
Cells
[0592] The effect of GIPF on signaling and proliferation of crypt
epithelial cells, was assayed in isolated mouse colonic crypt cells
according to the method of Fujimoteo, et al., (Fujimoto et al.,
Gastroenterology 117:858-865 (2002)).
[0593] Colons were dissected from mice and sterilized in a 0.04%
sodium hypochlorite solution for 15 minutes. After rinsing in PBS,
colons were incubated in the DTT/EDTA solution (0.5 mM DTT, 3 mM
EDTA in PBS) for 90 min at room temperature. After the incubation,
the tissue was washed once in PBS and 10 ml of PBS was added. The
tube was shaken vigorously to liberate the crypts from the
submucosa. The PBS containing the crypts was transferred to a
centrifuge tube and the shaking step was repeated until the crypt
yield diminished. The crypts were centrifuged gently (400 rpm for 5
min) and washed with fresh PBS. The crypts were resuspended in 20
ml of 0.3% pancreatin (Sigma) in PBS and incubated for 90 min at
room temperature shaking every 10 minutes for first 30 minutes and
every 30 minutes there after. At the end of the incubation, an
equal volume of PBS was added and the crypts were centrifuged at
1000 rpm for 5 min and washed with EDTA/DTT solution 1-2 more times
until all mucous was removed. Crypt cells were resuspended in
1.times. media (RPMI 1640 supplemented with 5% FCS, glutamine,
NaHCO.sub.3, insulin, transferrine, selenium,
penicillin/streptomycin). Cell clumps were broken up using 21G then
23G needles with syringe. Cells were counted and used to assay for
the stabilization of .beta.-catenin; for determining the
proliferative activity by incorporation of .sup.3H-thymidine; and
for testing the ability of GIPF to affect the clonogenicity of
crypt cells.
A. The effect of GIPF on the activation of p-catenin in vivo was
studied in crypt cells that had been isolated from Balb/c mice 6
hours after they had been injected i.v. with 100 .mu.g of GIPFwt,
as described above.
[0594] As shown in FIG. 47, GIPFwt induced significant
stabilization of .beta.-catenin in the cytosol from isolated crypt
cells when compared to that seen in the crypt cells from the
control mice. FIG. 47A shows the level of non-phosphorylated active
.beta.-catenin, and FIG. 47B shows the level of total p-catenin
present in the cytosol. The non-phosphorylated .beta.-catenin was
recognized by a .beta.-catenin antibody that was purchased from
Upstate (Waltham, Mass., USA), while the total .beta.-catenin level
was assayed using an antibody from Abcam (Cambridge, Mass., USA),
which recognizes both the phosphorylated and non-phosphorylated
protein. This result indicates that GIPF-induced crypt epithelial
cell proliferation in mice may be mediated .beta.-catenin
signaling.
B. The effect of GIPFwt on the proliferation of isolated crypt
cells was assayed in vitro for the incorporation of
.sup.3H-thymidine. The results showed that GIPFwt protein increased
the proliferation of isolated crypt cells in a dose-dependent
manner.
[0595] Therefore, the GIPF induces proliferation of isolated crypt
cells by stabilizing .beta.-catenin, and the isolated intestinal
cells may be used to elucidate the signaling pathways that underlie
the proliferative effect of GIPF.
C. The clonogenic assay described by Whitehead et al. (Whitehead et
al. Gastroenterology, 117:858-865 (1999)) is performed to study the
ability of GIPF in controlling the proliferation and/or
differentiation of the intestinal mucosa. In brief, an underlay
containing an equal mixture of 1% agar and 2.times.RPMI medium plus
10% FBS is added to 35 mm dishes. Isolated colonic crypt cells are
added to top layer media (equal parts of 0.8% agarose and
2.times.RPMI medium plus 10% FBS) at 50,000 cells per ml and 2 ml
of cell suspension is aliquoted into each well. The plates are
incubated in the presence of GIPF at 50, 100, and 200 ng/ml for 3-4
weeks at 37.degree. C. After the incubation, the plates are
examined and the number of colonies are counted. Colonies are
defined as aggregates of more than 40 cells.
[0596] GIPF stimulates colony formation. The clonogenic assay is
used to test the proliferative activity of GIPF and GIPF analogs in
vitro.
Example 22
Effect of GIPF on TNBS-Induced Colitis
[0597] The hapten agent 2,4,6-trinitrobenzenesulfonic acid (TNBS)
induces a chronic colitis that is characterized by severe,
transmural inflammation associated with diarrhea, rectal prolapse,
and weight loss. These clinical and histopathological features
indicate that TNBS-induced colitis mimics important characteristics
of human Crohn's disease (Neurath et al., J Exp Med 182:1281-1290
(1995)).
[0598] The therapeutic effect of GIPF was tested in mice with
TNBS-induced colitis. Intestinal inflammation was induced in 6-8
week-old female BALBc mice (group 2) by a single rectal
administration of 1 mg TNBS, as described by Neurath et al, supra).
A control animal group (Group 1) received rectal administration of
vehicle alone (45% ethanol). The therapeutic effect of hGIPF was
tested by administering subcutaneous daily doses of 100 .mu.g
(group 3) or 50 .mu.g (group 4) hGIPF (4 mg/kg or 2 mg/kg) to
animals that had received TNBS for 3 days. The mice were sacrificed
after 7 days, and the induction of colitis by TNBS was assessed.
hGIPF significantly reduced the loss of body weight induced by TNBS
in the animals of group 2 (FIG. 48). hGIPF also reduced the severe
diarrhea, ulceration, bleeding and atrophy of the colon that the
TNBS-treated animals of groups 2 suffered (data not shown).
[0599] Histologic changes were evaluated in H&E stained
paraffin-embedded sections of the colon from the control and TNBS
groups. hGIPF reduced the TNBS-induced transmural infiltration and
mucosal crypt structural disintegration in the mouse colon (FIG.
49). The graph in FIG. 49 represents the effect of hGIPF determined
by the histological grading of colonic colitis as follows:
TABLE-US-00012 Histological (microscopic) grading of colonic
colitis SCORE CRITERIA 0 Normal 1 Low level of (occasional)
leukocyte infiltration, no structural changes 2 Moderate leukocyte
infiltration in lamina pripria, surface epithelial lesion, no
ulceration 3 High leukocyte infiltration with inflammatory cells
extending into the submucosa, mucosal erosion, focal ulceration,
moderate thickening of the colon wall 4 Very high leukocyte
infiltration with transmural inflammation, extensive mucosal
damage, loss of goblet cells, high vascular density, thickening of
the colon wall, ulceration
[0600] In addition, hGIPF diminished the increase in TNBS-induced
myeloperoxidase, which is a hallmark of neutrophil infiltration in
the mouse colon. GIPF treatment significantly reduces the
TNBS-induced diarrhea, inflammation and thickening of the colon
wall, and loss of goblet cells, relative to the animals that are
not treated with GIPF. Therefore, GIPF may potentially be used as a
therapeutic to treat patients with Crohns disease.
Example 23
Therapeutic Effect of GIPF on Chronic Dextran Sulfate
Sodium-Induced Colitis in Mice
[0601] The efficacy of recombinant human GIPF (GIPFwt) in treating
colitis was tested in a mouse model of chronic dextran sulfate
sodium (DSS)-induced colitis (L'Heureux and Brubaker J Pharmacol
Exp Ther 306:347-354 (2003); Kriegelstein et al., Clin Invest
110:1773-1782 (2002); Siegmund et al., J Pharmacol Exp Ther
296:99-105 (2001)).
[0602] Six to eight-week old female BALB/c mice (Charles River
Laboratories, Wilmington, Mass., USA) were housed in ventilated
cages and acclimated for one week to a 12 hour light:dark cycle.
Mice were fed 4% DSS (v/w) in drinking water from Day 0 to 7 to
induce colitis. From Day 7 to Day 21, mice were given water without
DSS to induce the 1.sup.st remission phase. From Day 21 to Day 28,
mice were again given 4% DSS to induce the 1.sup.st relapse phase.
From Day 28 to Day 35, mice were again given water without DSS to
induce the 2.sup.nd remission phase. On Day 35, mice were
randomized into various experimental groups and GIPF therapy was
started on Day 35 and continued to Day 42. Mice were monitored
daily from Day 35 to Day 42 for signs of disease activity. On Day
42, the experiment was terminated, the mice were sacrificed and
intestinal tissue was harvested for analysis.
[0603] GIPF significantly reduced DSS-induced colitis in mice in a
dose-dependent fashion as reflected by a significant decrease in
the inflammatory bowel disease activity index (IBDAI) (FIG. 50;
*P<0.05 (ANOVA, DSS/Saline vs. DSS/hGIPF groups); #P<0.05
(ANOVA, DSS/Saline vs. DSS/KGF); **P<0.05 (ANOVA, DSS/Saline vs.
DSS/GLP-2)). The definition of IBDAI is given in Example 14.
H&E stained sections of the small intestine and colon showed
that hGIPF prevented the DSS-induced damage to the intestinal
mucosa of the mice, and reversed the DSS-induced shortening of the
villus height and crypt depth (FIG. 51). GIPF also superseded the
suppressive effect of DSS on the proliferation of crypt cells in
the small intestine (FIG. 52; *P<0.05 (ANOVA, DSS/Saline vs.
Water/Saline); #P<0.05 (ANOVA, DSS/hGIPF vs. DSS/Saline)
**P<0.05 (ANOVA, DSS/KGF vs. DSS/Saline); ##P<0.05 (ANOVA,
DSS/GLP-2 vs. DSS/Saline)). The crypt proliferative index is
defined in Example 14.
[0604] In summary, therapeutic treatment of GIPF significantly
reduces chronic DSS-induced colitis in mice, indicating that GIPF
may be a potentially useful therapy to treat human inflammatory
bowel disease.
Example 24
Reduction of 5-FU-Induced Toxicity by hGIPF
[0605] The efficacy of hGIPF in reducing the gastrointestinal
toxicity of 5-FU was evaluated in normal BDF-1 mice.
[0606] Mice were divided into the following groups:
[0607] 1) Vehicle injected with saline treatment
[0608] 2) 5-FU injected with saline treatment
[0609] 3) 5-FU injected with GIPF treatment
[0610] Female BDF-1 mice, at age of 11-13-week, were given daily
subcutaneous injections of either saline or 100 .mu.g per dose
hGIPF beginning at Day-3. From Day 0 to Day 4, each mouse was
injected intraperitoneally with a dose of 50 mg/kg of 5FU for 4
consecutive days. Mice were monitored for body weight, occurrence
of diarrhea, and mortality on a daily basis.
[0611] GIPF treatment significantly reduced 5-FU-induced
gastrointestinal toxicity, including reducing maximum body weight
loss, diarrhea score, and mortality (Table 9), thus indicating that
GIPF is effective in reducing chemotherapy-induced gastrointestinal
toxicity in mice.
TABLE-US-00013 TABLE 9 Toxicity Maximum TREAT- weight Diarrhea
Mortality Survival 5-FU MENT loss (%) score (%) Time (day) YES NO
33.1 .+-. 3.6 2.8 .+-. 0.5 92 8.5 .+-. 1.2 YES hGIPF 12.5 .+-. 6.9*
0.9 .+-. 0.6* 8.3 10.0 .+-. 0.0* YES KGF 16.8 .+-. 7.9* 1.7 .+-.
0.8* 25 9.0 .+-. 1.0 YES GLP-2 17.4 .+-. 8.3* 1.9 .+-. 0.8 42 8.4
.+-. 1.1 *P < 0.05 (ANOVA, 5-FU/hGIPF, 5-FU/KGF or 5-FU/GLP-2
vs. 5_FU/saline
Example 25
In Vivo GIPF Activity in a Non-Human Primate
[0612] A repeat-dose study of the activity of GIPF was performed in
Cynomolgus monkeys to determine the activity of GIPF in a non-human
primate.
[0613] Nine female non-naive, monkeys were screened for health by
SNBL USA (Everett, Wash., USA) staff veterinarian or a veterinary
technician and underwent hematology and serum chemistry screening.
Of the nine female animals confirmed healthy, 8 were selected and
assigned to the study groups. The animals, which were previously
quarantined, were acclimated to the study room at the SNBL USA
facility for a minimum of 14 days prior to initiation of the
study.
Protocol: Eight females were assigned to four treatment groups as
outlined in the table below and dosed via intravenous bolus
injection of GIPF protein once daily for three days. On the fourth
day, all animals were administered one intravenous bolus injection
of bromodeoxy uridine (BrdU) (50 mg/kg) approximately 4 hours prior
to necropsy. Select tissues were collected at necropsy.
TABLE-US-00014 Study Design Dose Dose Levels Concentration volume
Animal Group (mg/kg) (mg/mL) (mL/kg) number 1 0 mg/kg 0 3.3 mL/kg 2
(control) 2 0.1 mg/kg 1.5 mg/mL 0.067 mL/kg 2 3 1.0 mg/kg 1.5 mg/mL
0.67 mL/kg 2 4 5.0 mg/kg 1.5 mg/mL 3.3 mL/kg 2
Observations and Examination: Clinical observations were made
during acclimation and throughout the study as follows. Mortality
and stool checks were performed once daily in the morning and
clinical observations for general health and appearance were
performed once daily in the afternoon beginning at the start of
acclimation to the end of in-life. Additional clinical observations
were performed, if necessary and recorded. A staff veterinarian or
veterinary technician evaluated each animal if clinical
observations indicate a declining condition and the Study Director
were notified.
[0614] Blood sample collection: Blood was collected once during
acclimation and once on the day of necropsy before administration
of BrdU for hematology and serum chemistry.
[0615] Gross pathology examination: At necropsy, the external
surfaces of the body, all orifices, and the cranial, thoracic, and
abdominal cavities and their contents were examined. Organ Weight
and histopathology examination were performed macroscopically,
collected and preserved in 10% neutral buffered formalin for
histopathologic examination. Examined tissues are listed below.
TABLE-US-00015 Brain Large Intestine.sup.a Small Intestine.sup.a
brain stem cecum jejunum cerebellum colon duodenum cerebrum rectum
ileum Spleen Liver Tongue
[0616] Tissue proliferation assay by using BrdU IHC:
paraffin-embedded sections were prepared for BrdU assay.
[0617] Result: Gross pathological examination at necropsy found no
obvious changes in examined organs suggesting no acute toxicity of
hGIPF in this treatment regimen. In addition, hematology and serum
chemistry on blood samples collected before and after hGIPF
treatment demonstrated no changes in blood cell components as well
as tested serum biochemistry parameters.
[0618] There appears to be a dose-related increase in the length of
the small intestine. Average intestinal length (in cm) for groups
1, 2, 3, and 4 was 120.65, 122.555, 133.350, and 142.875
respectively. In addition, as summarized in the table below (Table
10), microscopic evaluation of histology of individual tissues
demonstrated crypt hyperplasia of duodenum, jejunum and ileum in
all GIPF treated groups. Hyperplasia of crypts was also observed in
cecum, colon and rectum in a dose related manner. This result
suggests that hGIPF has a proliferative effect on crypt epithelial
cells of monkey intestine that is consistent with that observed in
mouse and rat.
[0619] To confirm the proliferative effect of hGIPF,
immunohistochemistry was performed to analyze the incorporation of
BrdU in the small and large intestine. hGIPF increases BrdU
positive proliferation index in both small intestine and colon.
[0620] These finding show that hGIPF increases the proliferation of
the crypt epithelium in a non-human primate.
[0621] Individual Histopathology Findings
[0622] Grade
[0623] _: No abnormal changes
[0624] .+-.: Very slight
[0625] +: slight
[0626] 2+: Moderate
[0627] 3+: Marked
TABLE-US-00016 TABLE 10 Individual Histopathology Findings in
Female Cynomolgus Monkeys Groups (animal number) 1 2 3 4 Tissue
Findings #1 #2 #1 #2 #1 #2 #1 #2 Duodenum Crypt - - - .+-. .+-.
.+-. + 2+ hyperplasia Jejunum Crypt - - .+-. .+-. .+-. .+-. .+-. +
hyperplasia Ileum Crypt - - - .+-. + .+-. + + hyperplasia Cecum
Crypt - - - - .+-. .+-. + + hyperplasia, increased - - - - - - .+-.
+ gland length Colon Crypt - - - - .+-. .+-. .+-. + hyperplasia,
increased - - - - - - - .+-. gland length Rectum Crypt - - - - .+-.
+ .+-. + hyperplasia Liver -- - - - - - - - - Spleen -- - - - - - -
- - Cerebrum -- - - - - - - - - Cerebellum -- - - - - - - - - Brain
stem -- - - - - - - - -
Example 26
Adsorption Distribution Metabolism Excretion (ADME) Study Using
Radioactively Labeled .sup.125I-hGIPF Protein
[0628] Study aim: To determine the plasma pharmacokinetics and
tissue distribution of [.sup.125I]-hGIPF in mice. Protein labeling:
hGIPF protein was labeled with [.sup.125I] by IODO-GEN labeling
method (Amersham). The initial specific activity upon labeling was
35 uCi/ug (1020 Ci/mmol). Labeled protein was further purified
prior to injection into mice. Animals: male CD-1.RTM.
[Crl:CD-1.RTM. (ICR) BR mice were acclimated for 7 days prior to
the injection and housed individually in clean suspended wire-mesh
cages. The cages were elevated above cage-board or other suitable
material, changed at least three times each week. Each mouse was
given a 1.67 mg/kg dose of hGIPF that contained 3 .mu.Ci of
.sup.125I-hGIPF protein. After receiving the radiolabeled dose,
animals that were scheduled for collection of urine and feces were
housed individually in metabolism units.
Study Design:
TABLE-US-00017 [0629] Number of Total Animals Number Samples Dosage
Dosage Times of per Time of Group Collected Level Volume Euthanasia
Point Animals 1 Blood and 1.67 mg/kg 10 mL/kg 5, and 30 min 3 18
Tissues and 1, 3, 6, and 24 hr post-dosing 2 Urine, Feces, 1.67
mg/kg 10 mL/kg 24 hr post- 3 3 Tissues and dosing Carcass
[0630] All animals received for this study were treated with sodium
iodide to block uptake by the thyroid of free iodide derived from
the labeled test article. An oral (gavage) administration of 0.1 mL
of 1% NaI solution was given at approximately 48, 24 and 1 hours
before dosing with the radiolabeled protein. Each animal received a
single dose of [.sup.125I]-hGIPF that was administered via an
intravenous injection. The animals were divided into two groups and
analyzed as outlined in the Study Design above. At the indicated
times for euthanasia, blood samples were collected, and the
cellular fraction and plasma were separated for analysis. Tissue
samples of liver, kidney, lung, tongue, spleen, brain, esophagus,
stomach, small intestine, large intestine, and large intestine
including its contents were collected, and the incorporation of
[.sup.125I]-hGIPF in the tissues was determined.
[0631] Analyses for the incorporation of .sup.125I-hGIPF was
performed by gamma counting in a DPC GAMMA-C12 multicrystal gamma
counter according to WIL Standard Operating Procedures. The results
of gamma counting were corrected for isotopic half-life.
Calculations of the amounts of radioactivity in various materials
generated in the study were performed using programs of the WIL
Toxicology Data Management System or spreadsheets according to WIL
Standard Operating Procedures. Generally, only descriptive
statistics (e.g., totals, arithmetic means, standard deviations,
standard errors, coefficients of variation, percentages) were used.
Where possible, standard pharmacokinetic parameters (e.g.,
C.sub.max, t.sub.max, AUC (Area Under the Curve), T.sub.1/2
(half-life)) were calculated using standard pharmacokinetic
equations.
Results: The data showing the concentration and the kinetics of
[.sup.125I]-hGIPF in mouse plasma, red blood cells, liver, kidney,
lung, heart, brain, spleen, esophagus, stomach, small intestine,
and large intestine are shown in Tables 11-14.
TABLE-US-00018 TABLE 11 CONCENTRATION AND KINETICS OF
[.sup.125I]-hGIPF EQUIVALENTS IN MOUSE PLASMA AND RED BLOOD CELLS
FOLLOWING INTRAVENOUS ADMINISTRATION AT 1.67 MG/KG Plasma Red Blood
Cells Time (ng/g) (ng/g) (hr) (Mean .+-. SD) (Mean .+-. SD) 0.083
11145 (113) 2745 0.5 3894 (485) 2121 1 2506 (490) 1658 3 1347 (68)
971 6 476 (204) 295 24 60 (7) 23 C.sub.max (ng/g) 11145 2745
t.sub.max (h) 0.083 0.083 AUC.sub.0-24 (ng-h/g) 16607 9458 Terminal
Phase Kinetics (Linear Regression of Log Concentration vs. Time
from 3-24 hr) Slope (b) -0.05939 -0.07225 Y-Intercept (ng) 1517.75
1161.79 Coefficient of Determination (r.sup.2) 0.960 0.967
Elimination Rate Constant (h.sup.-1) 0.1367 0.1664 Half-life (h) 5
4 N = 3 except 24 h, N = 6.
TABLE-US-00019 TABLE 12 CONCENTRATION AND KINETICS OF
[.sup.125I]-hGIPF EQUIVALENTS IN MOUSE LIVER, KIDNEY, LUNG, HEART,
BRAIN, AND SPLEEN FOLLOWING INTRAVENOUS ADMINISTRATION AT 1.67
MG/KG Liver Kidney Lungs Tongue Brain Spleen (ng/g) (ng/g) (ng/g)
(ng/g) (ng/g) (ng/g) (Mean .+-. SD) (Mean .+-. SD) (Mean .+-. SD)
(Mean .+-. SD) (Mean .+-. SD) (Mean .+-. SD) 0.083 hr 9104 (959)
24581 (5032) 3332 (462) 1157 (88) 141 (25) 1956 (354) 0.5 hr 4982
(1319) 21283 (4731) 1997 (375) 1124 (202) 105 (28) 1905 (663) 1 hr
3635 (413) 17039 (1543) 1575 (375) 1044 (292) 95 (18) 1380 (106) 3
hr 2706 (185) 13445 (1084) 633 (450) 588 (32) 51 (7) 840 (74) 6 hr
1757 (213) 8933 (800) 337 (106) 227 (91) 17 (9) 457 (193) 24 hr 875
(75) 4707 (485) 63 (13) 35 (7) 5 (3) 157 (49) C.sub.max (ng/g) 9104
24581 3332 1157 141 1955.54 t.sub.max (h) 0.083 0.083 0.083 0.083
0.083 0.083 AUC.sub.0-24 (ng- 42191 206968 9404 6282 554 11400 h/g)
Terminal Phase Kinetics (Linear Regression of log Concentration vs.
Time from 3-24 hr) Slope (b) -0.02106 -0.01953 -0.04512 -0.05344
-0.04209 -0.03164 Y-Intercept 2742.03 13559.24 746.08 649.87 47.18
873.39 (ng) Coefficient of 0.936 0.932 0.982 0.958 0.883 0.947
Determination (r.sup.2) Elimination 0.0485 0.0450 0.1039 0.1230
0.0969 0.0728 Rate Constant (h.sup.-1) Half-life (h) 14 15 7 6 7 10
N = 3 except 24 h, N = 6.
TABLE-US-00020 TABLES 13 A AND B CONCENTRATION AND KINETICS OF
[.sup.125I]-hGIPF EQUIVALENTS IN MOUSE ESOPHAGUS, STOMACH, SMALL
INTESTINE, AND LARGE INTESTINE FOLLOWING INTRAVENOUS ADMINISTRATION
AT 1.67 MG/KG Small Intestine Large Intestine Esophagus (ng/g)
Stomach (ng/g) (ng/g) (ng/g) (Mean .+-. SD) (Mean .+-. SD) (Mean
.+-. SD) (Mean .+-. SD) A 0.083 hr 1560 (321) 1960 (166) 1117 (135)
1016 (150) 0.5 hr 1743 (178) 2855 (1140) 1191 (423) 910 (135) 1 hr
1666 (743) 5545 (3546) 1053 (369) 1006 (189) 3 hr 1199 (330) 3678
(2047) 664 (28) 694 (141) 6 hr 350 (63) 1021 (475) 222 (110) 383
(175) 24 hr 48 (43) 106 (40) 32 (6) 74 (13) C.sub.max (ng/g) 1743
5545 1191 1016 t.sub.max (h) 0.5 1 0.5 0.083 AUC.sub.0-24 (ng-h/g)
10372 29604 6421 8344 B Terminal Phase Kinetics (Linear Regression
of log Concentration vs. Time from 3-24 hr) Slope (b) -0.06022
-0.06683 -0.05745 -0.04408 Y-Intercept (ng) 1247.25 3997.67 715.76
822.73 Coefficient of 0.936 0.947 0.948 0.984 Determination
(r.sup.2) Elimination Rate 0.1387 0.1539 0.1323 0.1015 Constant
(h.sup.-1) Half-life (h) 5 5 5 7 **N = 3 except 24 h, N = 6.
TABLE-US-00021 TABLES 14 A AND B RECOVERY OF hGIPF EQUIVALENTS FROM
MICE 24 HOURS AFTER IV ADMINISTRATION AT 1.67 MG/KG A %
GIPF/Intestinal Total Anim. No. % GIPF/Tissues Contents %
GIPF/Urine % GIPF/Feces % GIPF/Carcass Recovery.dagger. 1 7.43 0.13
85.70 3.48 1.87 98.6 2 7.61 0.13 76.70 3.12 1.82 89.4 3 7.03 0.32
87.47 3.53 1.76 100.1 Mean: 7.35 0.19 83.29 3.38 1.82 96.0 SD: 0.30
0.11 5.77 0.23 0.06 5.81 B As expected, the earliest T.sub.max and
the greatest C.sub.max were observed in highly perfused tissues
i.e. liver, kidney, spleen and lung, and the longest half life was
seen in kidney and liver (Table 11). Tissues Liver Small Int. Colon
Brain Spleen Lung Kidney Stomach Esoph. Tongue Sum 2.39 0.07 0.06
0.01 0.02 0.02 4.83 0.03 0.01 0.01 7.43 2.13 0.10 0.06 0.00 0.02
0.02 5.17 0.10 0.00 0.01 7.61 2.64 0.07 0.04 0.01 0.02 0.02 4.21
0.03 0.00 0.01 7.03 .dagger.Sum of tissues, GI contents, urine
including cage rinse, feces, and carcass
[0632] The tissues of the gastrointestinal tract including
esophagus, stomach and small intestine each displayed a protracted
T.sub.max (Table 12). Table 13 A shows the percent recovery of
radiolabeled GIPF in tissues from various organs and in the
intestinal contents, urine, feces and carcass of animals 24 hours
after administration of radiolabeled hGIPF. The recovery of hGIPF
from individual organ tissues is given in Table 13B. The data show
that the distribution of radiolabeled hGIPF is unusually high for
organs of the gastrointestinal tract following administration via
the intravenous route, thus suggesting that hGIPF may have a high
affinity for gastrointestinal tissues.
Example 27
Irradiation-Induced Mucositis
Evaluation of Optimal Treatment Regimen
[0633] The objective of this study was to define a therapeutic
protocol that would provide the maximum prophylactic effect of GIPF
against irradiation-induced mucositis.
[0634] Adult male BDF-1 mice 10.about.12 weeks of age at the time
of use. The animals were housed for 1 week on a 12 hr light/dark
cycle and were allowed food and water ad libitum throughout.
Animals were randomly divided into 6 groups of 5 animals each
(total 30 mice) and were treated as follows: [0635] 1. Untreated,
unirradiated control. [0636] 2. 4 mg/kg hGIPF iv at 3, 2, 1 day
prior to 13 Gy X-ray exposure (whole body irradiation). [0637] 3. 4
mg/kg hGIPF iv at 4, 3, 2 days prior to 13 Gy X-ray exposure (whole
body irradiation). [0638] 4. 4 mg/kg hGIPF iv 5, 4, 3 days prior to
13 Gy X-ray exposure (whole body irradiation). [0639] 5. 4 mg/kg
hGIPF iv 6, 5, 4 days prior to 13 Gy X-ray exposure (whole body
irradiation). [0640] 6. saline iv 72, 48, 24 hours prior to 13 Gy
X-ray exposure (whole body irradiation).
[0641] Animals were exposed to whole body irradiation with single
dose of 13 Gy X-ray delivered at 2.7 Gy/min. Animals were inspected
daily after irradiation.
[0642] 4 days after irradiation the animals were sacrificed. Two
hours prior to sacrifice, animals were injected with 4 mg BrdU in a
volume of 0.4 ml. Upon dissection, the length and weight of small
and large intestine were measured and .about.1 cm of tissue
segments of the small intestine (mid-jejunum), colon (transverse
colon), tongue, esophagus and stomach were fixed in 10%
formaline.
[0643] Cross sections of the small intestine were analyzed for BrdU
uptake. The number of surviving crypts per section were scored and
the average per group determined. Only crypts containing 10 or more
strongly H&E stained cells (excluding Paneth cells) and only
intact sections devoid of Peyers patches were scored.
The average crypt width (measured at its widest point) was also
measured in order to correct for scoring errors due to crypt size
difference. The correction is applied thus:
Corrected number of crypts cross section = Mean crypt width in
untreated control Mean crypt width in treated animal .times. Mean
number of surviving crypts in treatment group ##EQU00002##
Results: The effect of hGIPF on the survival of crypts following
exposure to radiation is shown in FIG. 53. The data show that hGIPF
significantly reduced radiation-induced intestinal mucositis when
hGIPF was administered to the animals at 24 hr or 48 hr prior to
the total body irradiation (Table 15).
[0644] These findings confirm that hGIPF may be used as a
prophylactic to offset the deleterious effects of radiation-induced
intestinal mucositis, and that dosing at 24 hours prior to total
body irradiation provides the greatest protection to the intestinal
crypts.
TABLE-US-00022 TABLE 15 hGIPF therapy Irradiation dose Treatment
hGIPF protection (Gy) GIPF (mg/kg/day) schedule factor (mean .+-.
SD) 13 None None 1.0 .+-. 0.5 13 4 Day -3 to -1 15.8 .+-. 6.2* 13 4
Day -4 to -2 9.4 .+-. 6.8* 13 4 Day -5 to -3 4.8 .+-. 3.3 13 4 Day
-6 to -4 5.3 .+-. 4.4 *P < 0.05 (ANOVA, 13 Gy/hGIPF vs. 13
Gy/Saline)
Example 28
Cell Lineage-Dependent Proliferation Assay in Mouse Small
Intestine
[0645] The effect of hGIPF on intestinal crypts was studied to
determine whether the effect of hGIPF prior to the onset of
morphological changes occurs by affecting either of both the stem
cells and the transitional proliferating cells of the crypt.
[0646] Animals were randomly divided into the following groups:
[0647] 1. PBS (1 mouse per group): 1, 3, 6, 12, 24 or 48 hr after
injection [0648] 2. hGIPF (2 mice per group, 100 ug single
injection): 1, 3, 6, 12, 24 or 48 hr after injection Each animal
was injected with BrdU (4 mg/kg) 2 hour prior to sacrifice. Crypt
depth, crypt proliferation index, and cell positional proliferation
analysis were performed in mid jejunal sections of small intestine.
The crypt proliferative index was measured by BrdU
immunohistochemistry at the indicated times (3, 6, 12, 24 and 48
hours) after single injection of hGIPF (100 ug). 40 crypts from 2
mice were analyzed for BrdU incorporation and the results are given
as the mean.+-.SD (*P<0.01, ANOVA). Results: As shown in Table
16, hGIPF increased proliferation of small intestinal crypt cells
as early as 3 hours and the proliferation reached a peak at 24
hours following hGIPF treatment. hGIPF-induced crypt proliferation
was reversed within 48 hours. In addition, positional analysis of
the BrdU positive cells (Potten et al., Int J Exp Path 78:219-243
(1997)) demonstrated a significant increase in the proliferation of
crypt cells at position 3.about.5 (from the bottom of crypts where
stem cells are located) as well as upper part of the crypts.
[0649] These data suggest that hGIPF may affect both stem cells and
the dividing transit cell population.
TABLE-US-00023 TABLE 16 % BrdU positive cells % BrdU positive cells
TIME (hr) PBS control group hGIPF group 3 38.0 .+-. 12.47 47.7 .+-.
8.38 6 36.45 .+-. 8.33 49.75 .+-. 11.3 12 39.16 .+-. 8.57 51.24
.+-. 9.86 24 36.55 .+-. 9.62 74.97 .+-. 9.0 48 33.0 .+-. 5.32 19.5
.+-. 6.5
Example 29
Effect of hGIPF on the Differentiation and Migration Crypt
Cells
[0650] The number of Goblet and Paneth cells was scored following
treatment of mice with hGIPF to determine whether hGIPF affects the
population and distribution of these cell types in the small
intestine.
[0651] Alcian blue staining was performed to visualize Goblet cells
in mid jejunal sections from PBS and hGIPF-treated mice (n=3).
Animals were given daily injections of hGIPF (100 ug) or PBS for 3
or 7 days. To visualize Paneth cells, immunohistochemistry (IHC)
was performed on the mid jejunal sections of the same animals using
anti-lysozyme antibody.
Results: Immunohistochemical analysis and Alcian blue staining of
small intestine demonstrated no significant changes in Paneth cells
and Goblet cells numbers in the small intestine of hGIPF treated
mice. hGIPF did not affect the maturation and migration of
differentiated cells along the crypt/villus axis.
Example 30
Transgenic Chimaeric Mice that Express hGIPF in Intestinal
Epithelial Cells
1. Preparation of Long Fragment of Mouse Villin Gene Promoter (FIG.
54A)
[0652] Villin, an actin bundling protein found in the apical brush
border of absorptive tissues, is one of the first structural genes
to be transcriptionally activated in the embryonic intestinal
endoderm. In the adult, villin is broadly expressed in every cell
of the intestinal epithelium on both the vertical axis (crypt to
villus tip) and the horizontal axis (duodenum through colon) of the
intestine. Madison et al. documented that a 12.4 kb region of the
mouse villin gene drives high level expression of two different
reporter genes (LacZ and Cre recombinase) within the entire
intestinal epithelium of transgenic mice (J. Biol. Chem. 277, p
33275-33283, 2002). To generate transgenic chimaeric mice
expressing human GIPF in intestinal epithelial cells we constructed
a expression vector in which the GIPF cDNA is linked to this
transcriptional regulatory sequences directing its expression in
intestinal epithelial cells.
[0653] Nucleotide sequence information of upstream region of mouse
villin gene was obtained from public database (ensembl). Mouse BAC
(RP23-278N11; GenBank Accession Number: AC098570) DNA was digested
with EcoRI and BamHI (Roche) and subjected to 0.8% agarose gel
electrophoresis to isolate an approximately 11 kb fragment.
Following the digestion of pBluescriptIISK(-) (STRATAGENE) with
EcoRI and BamHI (Roche), the vector fragment was isolated by 0.8%
agarose gel electrophoresis and treated with calf intestine
alkaline phosphatase to dephosphorylate its both ends. The above
approximately 11 kb DNA fragment was ligated to the
dephosphorylated vector fragment and the ligation mixture was
transfected to XL10-Gold Ultracompetenet Cells (STRATAGENE). DNA
samples prepared from the resultant transformants was subjected to
PCR amplification using the primer set described below (SEQ ID NO:
120 and 121). Sequence analysis of the amplified fragment showed
the inclusion of an approximately 11.2 kb of mouse villin gene
promoter fragment (pPvil 11.2). The pPvil 11.2 was digested with
the restriction enzymes, ClaI and BamHI, and the reaction mixture
was subjected to 0.8% agarose gel electrophoresis to isolate
approximately 11.2 kb fragment.
TABLE-US-00024 PvilEIBI-FW1 (SEQ ID NO: 120)
GATCAGCAGCTGGAACAAACACAG PviLEIBI-RV1 (SEQ ID NO: 121)
TGCACAATCAGTCAATCAACAGAGC
(2) Preparation of Short Fragment of Mouse Villin Gene Promoter
(FIG. 54B)
[0654] Based on the nucleotide sequence of mouse villin gene
upstream region obtained from the public database (ensembl), two
synthetic DNAs were synthesized (SEQ ID NO: 122 and 123).
TABLE-US-00025 PvilBI-FW (SEQ ID NO: 122)
GGCGGATCCCTGAGTTGGAGGCCAGTTTGG PvilBI-NcoIXbalRV (SEQ ID NO: 123)
GCTCTAGACCATGGTGGACGAGCCTAGAGGAGAAGGCAT
[0655] KOD-puls (TOYOBO) was used for the PCR reaction. The PCR
reaction mixture contained 10 pmole of each primer and mouse BAC
(RP23-278N11; GenBank Accession Number: AC098570) DNA as a
template. This PCR amplification was performed using an initial
denaturing incubation at 94.degree. C. for two minutes. Then 30
cycles of denaturation, annealing and amplification were performed
by incubation at 94.degree. C. for 15 sec and 68.degree. C. for two
minutes. A PCR product (approximately 1.9 kb) was purified by 0.8%
agarose gel electrophoresis and QIAquick Gel Extraction Kit
(QIAGEN). Following the digestion of an isolated PCR product with
BamHI and XbaI, the digested fragment was purified by 0.8% agarose
gel electrophoresis and QIA quick Gel Extraction Kit (QIAGEN). The
purified fragment was ligated to pBluescriptIISK(-) (STRATAGENE)
that was digested with XhoI and XbaI, and treated with calf
intestine alkaline phosphatase to dephosphorylate its both ends.
The ligation mixture was transfected to DH5.alpha. and the DNA
samples prepared from the resultant transformants were analyzed by
nucleotide sequencing to confirm the structure of inserted
fragment. The clone including a fragment with a correct nucleotide
sequence was digested with NcoI. Following the treatment of
digested fragment with Klenow fragment (TAKARA BIO) for blunting
its both ends, it was further digested with XbaI and purified by
0.8% agarose gel electrophoresis. The resultant fragment was
treated with E. Coli C.sub.7-5 alkaline phosphatase to
dephosphorylate its both ends.
(3) Preparation of GIPF Fragment (FIG. 54C)
TABLE-US-00026 [0656] Hy01XhlSphlFW (SEQ ID NO: 124)
CCGCTCGAGGCATGCGGCTTGGGCTGTGTGTGGTGGCCCTG Hy01BgXb-RV (SEQ ID NO:
125) GCTCTAGAAGATCTCTAGGCAGGCCCTGCAGATGTGAGTGGCCC
[0657] KOD-puls-(TOYOBO) was used for the PCR reaction. The PCR
reaction mixture contained 10 pmole of each primer (SEQ ID NO: 124
and 125) and the GIPF cDNA as a template. This PCR amplification
was performed using an initial denaturing incubation at 94.degree.
C. for three minutes. Then 30 cycles of denaturation, annealing and
amplification were performed by incubation at 94.degree. C. for 15
sec and 68.degree. C. for two minutes. A PCR product (approximately
800 bp) was purified by electrophoresis using 0.8% agar and
QIAquick Gel Extraction Kit (QIAGEN). Following the digestion of
isolated PCR product with XhoI and XbaI, it was ligated to
pBluescriptIISK(-) that was digested with XhoI and XbaI, and
treated with calf intestine alkaline phosphatase to dephosphorylate
its both ends. The ligation mixture was transfected to DH5.alpha.
and the DNA samples prepared from the resultant transformants were
analyzed by nucleotide sequencing to confirm the structure of
inserted fragment. The clone including a fragment with a correct
nucleotide sequence was digested with SphI. Following the treatment
of digested fragment with Blunting high (TOYOBO) for blunting its
both ends, it was further digested with XbaI and purified by 0.8%
agarose gel electrophoresis.
(4) Construction of pPvil 2-01 (FIG. 54D)
[0658] The GIPF fragment prepared in (3) was ligated to pPvil2
prepared in (2), and the ligation mixture was transfected to
DH5.alpha.. The DNA samples prepared from the resultant
transformants were analyzed by nucleotide sequencing to confirm the
structure of inserted fragment. The clone including a fragment with
a correct nucleotide sequence was selected (pPvil 2-01).
(5) Preparation of pIRES-GFP (FIG. 54E)
[0659] Following the digestion of pIRES2-EGFP (BD Bioscience
Clontech) with EcoRI and NotI, the fragment including the IRES-GFP
region was purified by 0.8% agarose gel electrophoresis and QIA
quick Gel Extraction Kit (QIAGEN). The purified fragment (IRES-GFP)
was ligated to pcDNA3 (Invitrogen) that was digested with XhoI and
XbaI, and treated with calf intestine alkaline phosphatase to
dephosphorylate its both ends. The ligation mixture was transfected
to DH5.alpha. and the DNA samples prepared from the resultant
transformants were analyzed by nucleotide sequencing to confirm the
structure of inserted fragment. The clone including a fragment with
a correct nucleotide sequence was selected (pIRES-GFP).
(6) Construction of pUC119 IRES-GFP (FIG. 54F)
[0660] Following the digestion of pIRES-GFP with BamHI and XbaI,
the fragment including the IRES-GFP region was purified by 0.8%
agarose gel electrophoresis and QIA quick Gel Extraction Kit
(QIAGEN). The purified fragment (IRES-GFP) was ligated to pUC119
that was digested with BamHI and XbaI, and treated with calf
intestine alkaline phosphatase to dephosphorylate its both ends.
The ligation mixture was transfected to DH5.alpha. and the DNA
samples prepared from the resultant transformants were analyzed by
nucleotide sequencing to confirm the structure of inserted
fragment. The clone including a fragment with a correct nucleotide
sequence was selected (pUC119 IRES-GFP).
(7) Construction of pUC119 IRES-GFP+As (FIG. 54G)
[0661] The DNA fragment prepared by annealing of synthesized
oligonucleotides described below (SEQ ID NO: 126 and 127) was
ligated to pUC119 IRES-GFP that was digested with EcoRI and BamHI,
and treated with calf intestine alkaline phosphatase to
dephosphorylate its both ends. The ligation mixture was transfected
to DH5.alpha. and the DNA samples prepared from the resultant
transformants were analyzed by nucleotide sequencing to confirm the
structure of inserted fragment. The clone including a fragment with
a correct nucleotide sequence was selected (pUC119
IRES-GFP+As).
TABLE-US-00027 El-BIAscl-(BI) S AATTCGGATCCGGCGCGCC (SEQ ID NO:
126) El-BIAscl-(BI) AS GATCGGCGCGCCGGATCCG (SEQ ID NO: 127)
(8) Construction of pUC119 IRES-GFP+loxP (FIG. 54H)
[0662] The DNA fragment prepared by annealing of synthesized
oligonucleotides described below (SEQ ID NO: 128 and 129) was
ligated to pUC119 IRES-GFP+As that was digested with NotI and XhoI,
and treated with calf intestine alkaline phosphatase to
dephosphorylate its both ends. The ligation mixture was transfected
to DH5.alpha. and the DNA samples prepared from the resultant
transformants were analyzed by nucleotide sequencing to confirm the
structure of inserted fragment. The clone including a fragment with
a correct nucleotide sequence was selected (pUC119
IRES-GFP+loxP).
TABLE-US-00028 Nt-PmloxP-Xh S (SEQ ID NO: 128)
GGCCGTTTAAACATAACTTCGTATAATGTATGCTATACGAAGTTATC Nt-PmloxP-Xh AS
(SEQ ID NO: 129)
TCGAGATAACTTCGTATAGCATACATTATACGAAGTTATGTTTAAAC
(9) Preparation of Bovine Growth Hormone (BGH) PolyA Fragment (FIG.
54I)
TABLE-US-00029 [0663] BGHpAFW (SEQ ID NO: 130)
CGGGATCCGTTTAAACCTGTGCCTTCTAGTTGCCAGCGATC BGHpARV (SEQ ID NO: 131)
CGGATATCCCATAGAGCCCACCGCATCCCCAGC
[0664] KOD-puls-(TOYOBO) was used for the PCR reaction. The PCR
reaction mixture contained. 10 pmole of each primer (SEQ ID NO: 130
and 131) and the IRES-GFP fragment prepared in (6) as a template.
This PCR amplification was performed using an initial denaturing
incubation at 94.degree. C. for three minutes. Then 30 cycles of
denaturation, annealing and amplification were performed by
incubation at 94.degree. C. for 15 sec and 68.degree. C. for two
minutes. A PCR product (approximately 0.2 kb) was purified by 0.8%
agarose gel electrophoresis and QIAquick Gel Extraction Kit
(QIAGEN). Following the digestion of isolated PCR product with
BamHI and EcoRV, it was ligated to pBluescriptIISK(-) that was
digested with BamHI and EcoRV, and treated with calf intestine
alkaline phosphatase to dephosphorylate its both ends. The ligation
mixture was transfected to DH5.alpha. and the DNA samples prepared
from the resultant transformants were analyzed by nucleotide
sequencing to confirm the structure of inserted fragment. The clone
including a fragment with a correct nucleotide sequence was
digested with PmeI and EcoRV, and the fragment including the bovine
growth hormone (BGH) polyA region was purified by electrophoresis
using 0.8% agar and QIAquick Gel Extraction Kit (QIAGEN).
(10) Preparation of DNA Fragment Including IRES-GFP, Bovine Growth
Hormone PolyA and loxP Sequences (FIG. 54J)
[0665] The pUC119 IRES-GFP+loxP was digested with PmeI and purified
by 0.8% agarose gel electrophoresis. The BGH polyA fragment
prepared in (9) was ligated to the purified pUC119 IRES-GFP+loxP
vector that was treated with calf intestine alkaline phosphatase to
dephosphorylate its both ends. The ligation mixture was transfected
to DH5.alpha. and the DNA samples prepared from the resultant
transformants were analyzed by nucleotide sequencing to confirm the
structure of inserted fragment. The clone including a BGH polyA
fragment in a same direction to coding sequence of GFP was selected
(pIRES-GFP+pA). The pIRES-GFP+pA was digested with BamHI and XbaI,
and the fragment including the IRES-GFP, bovine growth hormone
polyA and loxP sequences was purified by electrophoresis using 0.8%
agar and QIAquick Gel Extraction Kit (QIAGEN).
(11) Construction of pPvil 2-01GFP (FIG. 54K)
[0666] The DNA fragment including the IRES-GFP, bovine growth
hormone polyA and loxP sequences [see (10)] was ligated to
pPvil2GIPF that was digested with BgIII and XbaI, and treated with
calf intestine alkaline phosphatase to dephosphorylate its both
ends. The ligation mixture was transfected to DH5.alpha. and the
DNA samples prepared from the resultant transformants were analyzed
by nucleotide sequencing to confirm the structure of inserted
fragment. The clone including a fragment with a correct nucleotide
sequence was selected (pPvil 2-01 GFP).
(12) Construction of pPv-Total (FIG. 54L)
[0667] The approximately 11.2 kb of long fragment of mouse Villin
gene promoter [see (1)] was ligated to pPvil2-01 GFP that was
digested with BgIII and ClaI, and treated with E. coli C75 alkaline
phosphatase to dephosphorylate its both ends. The ligation mixture
was transfected to XL10-Gold Ultracompetent Cells (STRATAGENE) and
the DNA samples prepared from the resultant transformants were
analyzed by nucleotide sequencing to confirm the structure of
inserted fragment. The clone including the fragment with a correct
nucleotide sequence was selected (pPv-total).
(13) Construction of pLoxP-STneoR (FIG. 54M)
[0668] The pLoxP-STneo described in WO 00/10383 was digested with
XhoI and treated with Blunting high (TOYOBO) for blunting its both
ends. The resultant DNA fragment including loxP-Neo.sup.r-loxP unit
was purified by 0.8% agarose gel electrophoresis. The DNA fragment
prepared by annealing of synthesized oligonucleotides described
below (SEQ ID NO: 132 and 133) was ligated to pBlueLAB (WO
00/10383) that was digested with PacI and FseI, and purified by
0.8% agarose gel electrophoresis. The ligation mixture was
transfected to DH5.alpha. and the DNA samples prepared from the
resultant transformants were analyzed by nucleotide sequencing to
confirm the structure of inserted fragment. The clone including a
fragment with a correct nucleotide sequence was selected
(pBlueLAB2). The above DNA fragment including loxP-Neo.sup.r-loxP
unit was ligated to the pBlueLAB2 vector that was digested with
EcoRV, and was treated with calf intestine alkaline phosphatase to
dephosphorylate its both ends. The ligation mixture was transfected
to DH5.alpha. and the DNA samples prepared from the resultant
transformants were analyzed by nucleotide sequencing to confirm the
structure of inserted fragment. The clone including the fragment in
an opposite direction to pLoxP-STneo (WO 00/10383) was selected
(pLoxP-STneoR).
TABLE-US-00030 AsiSl-S (SEQ ID NO: 132)
.quadrature.TAACCGCGATCGCGGCCGG AsiSl-AS (SEQ ID NO: 133)
.quadrature.CCGCGATCGCCCTTAAT
(14) Construction of pPv01GFP (FIG. 54N)
[0669] The pPv-total plasmid DNA was digested with restriction
enzymes, ClaI and XhoI, and the DNA fragment including Pv-GIPF unit
was purified by 0.8% agarose gel electrophoresis. The purified DNA
fragment was ligated to pLoxP-StneoR that was digested with ClaI
and XhoI, and treated with calf intestine alkaline phosphatase to
dephosphorylate its both ends. The ligation mixture was transfected
to XL10-Gold Ultracompetent Cells (STRATAGENE) and the DNA samples
prepared from the resultant transformants were analyzed by
nucleotide sequencing to confirm the structure of inserted
fragment. The clone including a fragment with a correct nucleotide
sequence was selected (pPv01 GFP).
(15) Preparation of pPv01GFP Plasmid DNA for Electroporation to
Mouse ES Cells
[0670] The plasmid DNA of pPv01GFP (60 .mu.g) was digested with
ClaI in the reaction mixture containing 1 mM spermidine (pH7.0,
Sigma) for 5 hours at 37.degree. C. The reaction mixture was then
subjected to phenol/chloroform extraction and ethanol precipitation
(0.3M NaHCO.sub.3) for 16 hours at -20.degree. C. The linearized
vector fragment was dissolved in HBS buffer (0.5 .mu.g/.mu.l) and
used for the following electroporation experiments.
(16) Production of Transgenic Chimaeric Mice Expressing Human GIPF
and GFP in Intestinal Epithelial Cells
[0671] General procedures for obtaining mouse embryos, cultivation,
injection of the ES cells into the embryos, transplantation to the
uteri of foster mothers were carried out in accordance with the
method described in Shinichi Aizawa, "Biomanual Series 8, Gene
Targeting", published by Yodosha, 1995.
[0672] The linearized pPv01GFP vector was transfect into
C57BL/6.times.CBA F1 strain derived mouse TT2F ES cells ((Uchida,
1995), Lifetech oriental) by electroporation according to the
method described by Shinichi Aizawa, "Biomanual Series 8, Gene
Targeting", published by Yodosha, 1995. The electroporated ES cells
were suspended in 20 ml of ES medium and inoculated into two 100 mm
tissue culture plastic plates (Corning) into which feeder cells
were seeded in advance. After one day, the medium was replaced with
a medium containing a 200 .mu.g/ml of G418 (Invitrogen). Seven to
nine days thereafter, a total of 24 colonies for each vector were
picked up. Each colonies was grown up to confluence in a 12-well
plate, and then four fifth of the culture was suspended in 0.2 ml
of cryopreservation medium (ES medium+10% DMSO (Sigma)) and stored
frozen at -80.degree. C. The remaining one fifth was inoculated
into a 12-well gelatin coated plate and cultured for 2 days. Then,
genomic DNA was isolated using the Puregene DNA Isolation Kit
(Gentra System). Genomic DNA isolated from G418 resistant TT2F
cells was digested with restriction enzymes EcoRI and XhoI and then
subjected to 0.8% agarose gel electrophoresis. Using EcoRI-XhoI
digestion, retention of an intact expression unit including Villin
promoter, human GIPF cDNA, GFP cDNA and BGH polyA sequences of
pPv01GFP in the G418-resistant clones can be determined by the
detection of an approximately 16 kb band. Separated DNA fragments
were transferred to a membrane (Gene Screen, NEN Life science
Products) and then hybridization was carried out using the DNA
fragment as probe prepared from IRES region of pPV01GFP [see (13)]
by PCR using a primer set as described below (SEQ ID NO: 134 and
135) (IRESprobeF1, R1). We selected the ES clones that showed a
single 16 kb band in the Southern blotting. The selected ES clones
were also tested by karyotype analysis according to the method
described in Shinichi Aizawa, "Biomanual Series 8, Gene Targeting",
published by Yodosha, 1995. One ES clone, #2, that showed normal
karyotype were used for injection into embryos.
TABLE-US-00031 IRESprobeF1 (SEQ ID NO: 134): CTAACGTTACTGGCCGAAGC
IRESprobeR1 (SEQ ID NO: 135): ATTATCATCGTGTTTTTCAAAGGAA
[0673] The cells in a frozen stock of the transfected ES cell
clones #2 were thawed, started to culture and injected into 8 cell
stage embryos obtained by mating a male and a female mouse of
MCH(ICR) mouse strain (CREA JAPAN, INC.); the injection rate was
10-12 cells per embryo. After the embryos were cultured overnight
in the medium for ES cells to develop into blastocysts, about ten
of the ES cell-injected embryos were transplanted to each side of
the uterus of a foster mother ICR mouse (CREA JAPAN, INC.), which
had been subjected to a pseudopregnant treatment for 2.5 days.
Contribution of the TT2F (agouti) ES clone-derived tissues in host
embryo (albino) derived tissues can be determined eye pigmentation
in embryos and coat color in viable offspring.
(17) Expression of Human GIPF-GFP mRNA in Transgenic Chimaeric
Mice
[0674] Total RNA samples were prepared from intestinal tract of
pPv01 GFP/TT2F-#2 derived chimaeras at various developmental stages
(E13.5, E16.5, E19.5, day 3, day 7) and were subjected to
semi-quantitative RT-PCR analysis to examine GIPF-GFP mRNA
expression. First-strand cDNA was synthesized with Superscript III
(Invitrogen) using random hexamers and 500 ng of total RNA
extracted from the intestinal tract of pPv01GFP/TT2F-#2 derived
chimaeras and control TT2F-derived chimaeras by using Isogen
(Nippon Gene) and RNasy Mini (QIAGEN). Semi-quantitative RT-PCR
analysis was carried out using the cDNA at specific annealing
temperatures for each primer pair. PCR products were
electrophoresed on 2% agar gels and stained with ethidium bromide.
The integrity of RNA was controlled by the amplification of cDNA
generated by the murine GAPDH. The nucleotide sequences and
annealing temperature of primer sets for GIPF (Pv01RT F1, R1; SEQ
ID NO: 136 and 137), Axin 2 (Axin2 F, R; SEQ ID NO: 138 and 139))
and mGAPDH (mGAP DH5, 3; SEQ ID NO: 140 and 141) are listed
below.
TABLE-US-00032 Pv01RT F1 (SEQ ID NO: 136) GCTCTGACAGCAAGGAGACG
Pv01RT R1 (60.degree. C.) (SEQ ID NO: 137) CCCTAGGAATGCTCGTCAAG
Axin2 F(MUS) (SEQ ID NO: 138) CAGGAGCCTCACCCTTCG Axin2 R(MUS)
(60.degree. C.) (SEQ ID NO: 139) ACGCCGAGGTGCTTGCCC mGAPDH5 (SEQ ID
NO: 140) CACCATGGAGAAGGCCGGGGCCCAC mGAPDH3 (65.degree. C.) (SEQ ID
NO: 141) ATCATACTTGGCAGGTTTCTCCAGG
[0675] As shown in FIG. 55, the GIPF-GFP transcripts were
detectable at E13.5 in intestinal tract of pPv01GFP/TT2F-#2 derived
chimaeras and not detected in in all the liver samples examined,
which is well consistent with the previous study (Madison et al.,
J. Biol. Chem. 277, p 33275-33283, 2002) describing that expression
of transgene driven by 13 kb villin promoter is first detectable in
the embryonic hindgut and midgut at 12.5 dpc., and the expression
is largely specific for intestinal epithelium. It is also evident
that the expression level of GIPF-GFP transcripts is gradually
elevated with age during the course of development. Eek-hoon et al.
reported that endogenous Axin2 mRNA expression could be induced by
activation of the Wnt signaling pathway (Mol. Cell. Biol. 22,
1172-1183, 2002). It is also known that the Wnt signaling play a
critical role in the development of intestinal tract. We therefore
examined Axin2 expression in intestinal tract of pPv01GFP/TT2F-#2
derived chimaeras. The result (FIG. 55) shows that the elevated
expression of Axin2 mRNA is apparent at day 3 and 7 when compared
to the control chimaeras, suggesting that the expression of human
GIPF results in activation Wnt signaling pathway in intestinal
tract of newborn.
(18) Stabilization of .beta.-Catenin in Intestinal Tract of
Transgenic Chimaeric Mice
[0676] To evaluate the effect of GIPF on the Wnt/.beta.-catenin
signaling pathway, the stabilization of .beta.-catenin was measured
in small intestine and colon sampled from pPv01GFP/TT2F-#2 derived
chimaeras at day 10. The procedure for .beta.-catenin stabilization
assay is described in Example 17. As shown in FIG. 56, the
expression of GIPF strongly induced the stabilization of
.beta.-catenin in both small intestine and colon sampled from
pPv01GFP/TT2F-#2 (Pv01#2) derived chimaeras when compared to the
control chimaeras (wild-type).
(19) Evaluation of Phenotypic Changes in Intestinal Tract of
Transgenic Chimaeric Mice
[0677] Newborn pPv01GFP/TT2F-#2 derived chimaeric pups showed a
significant abdominal distention at day 3 and the extent of this
phenotype gradually intensified with age. Visual inspection of day
3 chimaeras at necropsy showed a remarkable enlargement in diameter
throughout the small intestine, associated with augmented surface
vascularisation. Whole embryos, pups or gastrointestinal tracts
were fixed in Bouin solution. Paraffin embedded sections were
stained with hematoxiyline and eosin (H&E) for histological
evaluation. As shown FIG. 57, histopathological analysis of H&E
sections from pPv01GFP/TT2F-#2 (Pv01#2) revealed increase in number
of crypts and branching from embryonic day 19.5 (E 19.5) to day 14
(d14) compared to control.
Example 31
Transgenic Chimaeric Mice that Express GIPF and Wnt3a in Intestinal
Epithelial Cells
(1) Preparation of Wnt3a Fragment (FIG. 58A)
TABLE-US-00033 [0678] Wnt3aFW (SEQ ID NO: 142)
.quadrature.CGGGATCCCCATGGCTCCTCTGGGATACCTCTTAGTGCT Wnt3aRV (SEQ ID
NO: 143) .quadrature.GCTCTAGAGTTTAAACCTACTTGCAGGTGTGCACGTCATAG
[0679] KOD-puls-(TOYOBO) was used for the PCR reaction. The PCR
reaction mixture contained 10 pmole of each primer (SEQ ID NO: 142
and 143) and the human Wnt3a cDNA as a template. This PCR
amplification was performed using an initial denaturing incubation
at 94.degree. C. for three minutes. Then 30 cycles of denaturation,
annealing and amplification were performed by incubation at
94.degree. C. for 15 sec and 68.degree. C. for two minutes. A PCR
product (approximately 1.06 kb) was purified by 0.8% agarose gel
electrophoresis and QIAquick Gel Extraction Kit (QIAGEN). Following
the digestion of isolated PCR product with BamHI and EcoRV, it was
ligated to pBluescriptIISK(-) that was digested with BamHI and
XbaI, and treated with calf intestine alkaline phosphatase to
dephosphorylate its both ends. The ligation mixture was transfected
to DH5.alpha. and the DNA samples prepared from the resultant
transformants were analyzed by nucleotide sequencing to confirm the
structure of inserted fragment. The clone including a fragment with
a correct nucleotide sequence was digested with NcoI and PmeI, and
the fragment including the Wnt3a cDNA was purified by
electrophoresis using 0.8% agar and QIAquick Gel Extraction Kit
(QIAGEN).
(2) Preparation of IRES/Wnt3a+pA Fragment (FIG. 58B)
[0680] The pIRES/GFP+pA plasmid DNA [see Example 30-(13)] was
digested with NcoI and PmeI, and the vector fragment including
without the GFP coding sequence was purified by 0.8% agarose gel
electrophoresis. The fragment including the Wnt3a cDNA [see (1)]
was ligated to purified vector fragment that was treated with E.
coli C.sub.7-5 alkaline phosphatase to dephosphorylate its both
ends. The ligation mixture was transfected to DH5.alpha. and the
DNA samples prepared from the resultant transformants were analyzed
by nucleotide sequencing to confirm the structure of inserted
fragment. The clone including a fragment with a correct nucleotide
sequence (pIRES/Wnt3a+pA) was digested with AscI and XhoI, and the
DNA fragment including the IRES/Wnt3a+pA unit was purified by 0.8%
agarose gel electrophoresis and QIAquick Gel Extraction Kit
(QIAGEN).
(3) Construction of pPv01Wnt3a (FIG. 58C)
[0681] The pPv01GFP plasmid DNA [see Example 30-(13)] was digested
with restriction enzymes, AscI and XhoI, and the digested reaction
mixture was subjected to 0.8% agarose gel electrophoresis. The
vector fragment without the IRES/GFP+pA region was isolated and
treated with calf intestine alkaline phosphatase to dephosphorylate
its both ends. The ligation mixture of IRES/Wnt3a+pA fragment [see
(2)] and the above vector fragment was transfected to XL10-Gold
Ultracompetent cells (STRATAGENE). The DNA samples prepared from
the resultant transformants were analyzed by nucleotide sequencing
to confirm the structure of inserted fragment. The clone including
a fragment with a correct nucleotide sequence was selected
(pPv01Wnt3a).
(4) Preparation of pPv01Wnt3a Plasmid DNA for Electroporation to
Mouse ES Cells
[0682] The plasmid DNA of pPv01Wnt3a (60 .mu.g) was digested with
ClaI in the reaction mixture containing 1 mM spermidine (pH7.0,
Sigma) for 5 hours at 37.degree. C. The reaction mixture was then
subjected to phenol/chloroform extraction and ethanol precipitation
(0.3M NaHCO.sub.3) for 16 hours at -20.degree. C. The linearized
vector fragment was dissolved in HBS buffer (0.5 .mu.g/ul) and used
for the following electroporation experiments.
(5) Production of Transgenic Chimaeric Mice Expressing Human GIPF
and Wnt3a in Intestinal Epithelial Cells
[0683] General procedures for obtaining mouse embryos, cultivation,
injection of the ES cells into the embryos, transplantation to the
uteri of foster mothers were carried out in accordance with the
method described in Shinichi Aizawa, "Biomanual Series 8, Gene
Targeting", published by Yodosha, 1995.
[0684] The linearized pPv01Wnt3a vector was transfect into
C57BL/6.times.CBA F1 strain derived mouse TT2F ES cells ((Uchida,
1995), Lifetech oriental) by electroporation according to the
method described by Shinichi Aizawa, "Biomanual Series 8, Gene
Targeting", published by Yodosha, 1995. The electroporated ES cells
were suspended in 20 ml of ES medium and inoculated into two 100 mm
tissue culture plastic plates (Corning) into which feeder cells
were seeded in advance. After one day, the medium was replaced with
a medium containing a 200 .mu.g/ml of G418 (Invitrogen). Seven to
nine days thereafter, a total of 24 colonies for each vector were
picked up. Each colonies was grown up to confluence in a 12-well
plate, and then four fifth of the culture was suspended in 0.2 ml
of cryopreservation medium (ES medium+10% DMSO (Sigma)) and stored
frozen at -80.degree. C. The remaining one fifth was inoculated
into a 12-well gelatin coated plate and cultured for 2 days. Then,
genomic DNA was isolated using the Puregene DNA Isolation Kit
(Gentra System). Genomic DNA isolated from G418 resistant TT2F
cells was digested with restriction enzymes EcoRI and XhoI and then
subjected to 0.8% agarose gel electrophoresis. Using EcoRI-XhoI
digestion, retention of an intact expression unit including Villin
promoter, human GIPF cDNA, Wnt3a cDNA and BGH polyA sequences of
pPv01Wnt3a in the G418-resistant clones can be determined by the
detection of an approximately 16 kb band. Separated DNA fragments
were transferred to a membrane (Gene Screen, NEN Life science
Products) and then hybridization was carried out using the DNA
fragment as probe prepared from IRES region of pPV01GFP [see
Example 30-(13)] by PCR using a primer set described in Example
30-(16) (IRESprobeF1, R1). We selected the clones that showed a
single 16 kb band in the Southern blotting. The selected ES clones
were also tested by karyotype analysis according to the method
described in Shinichi Aizawa, "Biomanual Series 8, Gene Targeting",
published by Yodosha, 1995. Two ES clone, #7 and #13 that showed
normal karyotype were used for injection into embryos.
[0685] The cells in a frozen stock of the transfected ES cell
clones #7 and #13 were thawed, started to culture and injected into
8 cell stage embryos obtained by mating a male and a female mouse
of MCH(ICR) mouse strain (CREA JAPAN, INC.); the injection rate was
10-12 cells per embryo. After the embryos were cultured overnight
in the medium for ES cells to develop into blastocysts, about ten
of the ES cell-injected embryos were transplanted to each side of
the uterus of a foster mother ICR mouse (CREA JAPAN, INC.), which
had been subjected to a pseudopregnant treatment for 2.5 days.
Contribution of the TT2F (agouti) ES clone-derived tissues in host
embryo (albino) derived tissues can be determined eye pigmentation
in embryos and coat color in viable offspring.
(6) Expression of Human GIPF/Wnt3a mRNA in Transgenic Chimaeric
Mice
[0686] Total RNA samples were prepared from intestinal tract of
pPv01Wnt3a/TT2F-#7, and #13 derived newborn chimaeras and were
subjected to semi-quantitative RT-PCR analysis to examine GIPF-GFP
mRNA expression. First-strand cDNA was synthesized with Superscript
III (Invitrogen) using random hexamers and 500 ng of total RNA
extracted from the intestinal tract of pPv01Wnt3a/TT2F-#7, and #13
derived chimaeras and control TT2F-derived chimaeras by using
Isogen (Nippon Gene) and RNasy Mini (QIAGEN). Semi-quantitative
RT-PCR analysis was carried out using the cDNA at specific
annealing temperatures for each primer pair. PCR products were
electrophoresed on 2% agar gels and stained with ethidium bromide.
The integrity of RNA was controlled by the amplification of cDNA
generated by the murine GAPDH. The nucleotide sequences and
annealing temperature of primer sets for GIPF (Pv01RT F1, R1), Axin
2 (Axin2 F, R) and mGAPDH (mGAPDH5, 3) are listed below.
TABLE-US-00034 Pv01RT F1 (SEQ ID NO: 136) GCTCTGACAGCAAGGAGACG
Pv01RT R1 (60.degree. C.) (SEQ ID NO: 137) CCCTAGGAATGCTCGTCAAG
Axin2 F(MUS) (SEQ ID NO: 138) CAGGAGCCTCACCCTTCG Axin2 R(MUS)
(60.degree. C.) (SEQ ID NO: 139) ACGCCGAGGTGCTTGCCC mGAPDH5 (SEQ ID
NO: 140) CACCATGGAGAAGGCCGGGGCCCAC mGAPDH3 (65.degree. C.) (SEQ ID
NO: 141) ATCATACTTGGCAGGTTTCTCCAGG
[0687] As shown in FIG. 59, the GIPF-Wnt3a transcripts were
detectable in intestinal tissues of pPv01Wnt3a/TT2F-#7 and -#13
derived from newborn chimaeras (Pv01Wnt3a: 1 to 4). The result
(FIG. 59) also shows that the elevated expression of Axin2 mRNA is
apparent when compared to the control chimaeras (TT2F: 5 and
6).
(7) Stabilization of .beta.-Catenin in Intestinal Tract of
Transgenic Chimaeric Mice
[0688] To evaluate the effect of GIPF on the Wnt/.beta.-catenin
signaling pathway, the stabilization of .beta.-catenin was measured
in small intestine and colon sampled from pPv01Wnt3a/TT2F-#7 and
-#13 derived chimaeras. The procedure for .beta.-catenin
stabilization assay is described in Example 17. As shown in FIG.
60, the co-expression of GIPF and Wnt3a induced the stabilization
of .beta.-catenin in duodenum and colon sampled from
pPv01Wnt3a/TT2F-#7 embryo (E20.5: 1 and 2) when compared to the
control chimaeras (wild-type: 3 and 4).
(8) Evaluation of Phenotypic Changes in Intestinal Tract of
Transgenic Chimaeric Mice
[0689] Newborn pPv01Wnt3a/TT2F-#7 and -#13 derived chimaeric pups
showed a significant abdominal distention. Visual inspection of
newborn chimaeras at necropsy showed a remarkable enlargement in
diameter throughout the small intestine, associated with augmented
surface vascularisation. Whole embryos, pups or gastrointestinal
tracts were fixed in Bouin solution. Paraffin embedded sections
were stained with hematoxiyline and eosin (H&E) for
histological evaluation. As shown FIG. 61, histopathological
analysis of H&E sections from pPv01Wnt3a/TT2F-#13 embryonic day
20.5 embryo (E 20.5) revealed increase in number of villous cells,
irregular branching and hyperplasia of villi. The extent of these
phenotypes were stronger than those of pPv01GFP/TT2F-#2 derived
chimaeras [Example 30-(19)], suggesting the enhancement of GIPF
action by Wnt3a expression.
Example 32
RS-KO Mouse ES Cells
A. Construction of the RS-KO Vector
[0690] The construction of the RS-KO vector (FIG. 62A) was
performed according to the method described below, and depicted in
FIGS. 62B-1K.
[0691] FIG. 62B Addition of the new restriction sites (NruI, SgrAI,
and AscI) to pBluescript II SK(-) (Stratagene).
The oligo DNA fragments (SEQ ID NO: 144 and 145) for the addition
of the new restriction sites in pBluescript II SK(-) were
synthesized.
TABLE-US-00035 (SEQ ID NO: 144) LinkA1:TCGAGTCGCGACACCGGCGGGCGCGCCC
(SEQ ID NO: 145) LinkA2:TCGAGGGCGCGCCCGCCGGTGTCGCGAC
[0692] The prepared LinkA1 and LinkA2 were ligated into pBluescript
II SK(-) that was pre-digested with the restriction enzymes SalI
and XhoI. The resulting plasmid pBlueLA contained the newly added
restriction sites (NruI, SgrAI, and AscI).
[0693] FIG. 62C Addition of the New Restriction Sites (PacI, FseI,
and SalI) to pBlueLA.
The oligo DNA fragments (SEQ ID NO: 146 and 147) for the addition
of the new restriction sites in pBlueLA were synthesized.
TABLE-US-00036 SEQ ID NO: 146)
LinkB1:GGCCGCTTAATTAAGGCCGGCCGTCGACG.quadrature. SEQ ID NO: 147)
LinkB2:AATTCGTCGACGGCCGGCCTTAATTAAGC.quadrature.
[0694] The prepared LinkB1 and LinkB2 were ligated into pBlueLA
that was pre-digested with the restriction enzymes NotI and EcoRI.
The resulting plasmid pBlueLAB contained the newly added
restriction sites (PacI, FseI, and SalI).
[0695] FIG. 62D Preparation of LoxP-Neo-B Fragment [0696]
LoxP-Neo-B fragment was prepared by T4 DNA polymerase treatment of
LoxP-Neo that was obtained from Xho/digestion of pLoxP-STneo (WO
00/10383).
[0697] FIG. 62E Preparation of pBlueLAB-LoxP-Neo Plasmid
LoxP-Neo-B fragment was ligated into pBlueLAB that was pre-digested
with the restriction enzyme EcoRV. The resulting plasmid
pBlueLAB-LoxP-Neo contained LoxP-Neo-B fragment.
[0698] FIG. 62F Preparation of DT-A Fragment
pMC1 DT-A.quadrature.GIBCO BRL.quadrature. was digested with XhoI
and SalI, and the resulting DT-A fragment was separated and
recovered from agarose gel electrophoresis.
[0699] FIG. 62G Preparation of pBlueLAB-LoxP-Neo-DT-A Plasmid
DT-A fragment was ligated into pBlueLAB-LoxP-Neo that was
pre-digested with the restriction enzyme XhoI. The resulting
plasmid pBlueLAB-LoxP-Neo-DT-A contained DT-A fragment.
[0700] FIG. 62H Preparation of 3'Genomic Region of RS Element
The forward (RS3'FW2; SEQ ID NO: 148) and reverse (RS3'RV3; SEQ ID
NO: 149) primers for PCR were synthesized based on the sequence of
the mouse obtained from GenBank (Accession
Number.quadrature.AC090291), and used to amplify the DNA of 3'
genomic region of RS element. RS3'FW2:
TTGGCGCGCCCTCCCTAGGACTGCAGTTGAGCTCAGATTTGA (SEQ ID NO: 148) was
prepared by adding a AscI recognition sequence at 5' end site, and
RS3'RV3: CCGCTCGAGTCTTACTGTCTCAGCAACAATAATATAAACAGGGG (SEQ ID NO:
149) was prepared by adding a XhoI recognition sequence at 5' end
site. PCR was carried out using BAC clone RP23-43514 (GenBank
Accession Number AC090291) as template. The PCR product was
digested with restriction enzymes AscI and XhoI, and ligated into
pBlueLAB that was pre-digested with the restriction enzymes AscI
and XhoI. The resulting plasmid contained the designated DNA
sequence of 3'genomic region of RS element with no substitution in
nucleotide sequence within the region between AscI and XhoI was
treated with AscI and XhoI and then the 3'genomic region of RS
element (about 2 Kb) was obtained.
[0701] FIG. 62I Insertion of 3'Genomic Region of RS Element into
pBlueLAB-LoxP-Neo-DT-A
The 3'genomic region of RS element was ligated into
pBlueLAB-LoxP-Neo-DT-A that was pre-digested with AscI and XhoI.
After verifying the connecting regions between
pBlueLAB-LoxP-Neo-DT-A and the 3'genomic region of RS element, the
plasmid pBlueLAB-LoxP-Neo-DT-A-3'RS was obtained.
[0702] FIG. 62J Preparation of 5'Genomic Region of Mouse RS
Element
The forward (RS5'FW3; SEQ ID NO: 150) and the reverse (RS5'RV3; SEQ
ID NO: 151) primers for PCR were synthesized based on the sequence
of the mouse obtained from GenBank (Accession Number AC090291), and
used to amplify the DNA of 5'genomic region of RS element. RS5'FW3:
ATAAGTGCGGCCGCAAAGCTGGTGGGTTAAGACTATCTCGTGAAGTG (SEQ ID NO: 150)
was prepared by adding a NotI recognition sequence at 5' end site,
and RS5'RV3: ACGCGTCGACTCACAGGTTGGTCCCTCTCTGTGTGTGGTTGCTGT (SEQ ID
NO: 151) was prepared by adding a SalI recognition sequence at 5'
end site. PCR was carried out using BAC clone RP23-43514 (GenBank
Accession Number AC090291) as template. The PCR product was
digested with restriction enzymes NotI and SalI, and ligated into
pBlueLAB that was pre-digested with the restriction enzymes NotI
and SalI. The resulting plasmid contained the designated DNA
sequence of 5'genomic region of RS element with no substitution in
nucleotide sequence within the region between NotI and SalI was
treated with NotI and SalI and then the 5'genomic region of RS
element (about 5 Kb) was obtained.
[0703] FIG. 62K Insertion of 5'Genomic Region of RS Element into
pBlueLAB-LoxP-Neo-DT-A-3'RS
The 5'genomic region of RS element was ligated into
pBlueLAB-LoxP-Neo-DT-A-3'RS that was pre-digested with NotI and
SalI. After verifying the connecting regions between
pBlueLAB-LoxP-Neo-DT-A-3'RS and the 5'genomic region of RS element,
the RS-KO vector was constructed.
B. Preparation of RS-KO Mouse ES Cells
[0704] General procedures for obtaining mouse embryos and
cultivation were carried out in accordance with the method
described in Aizawa Shinichi, "Biomanual Series 8, Gene Targeting",
published by Yodosha, 1995. The RS-KO vector was linearized with
Not I and transferred into C57BL/6.times.CBA F1 derived mouse TT2F
ES cells ((Uchida, 1995), Lifetech oriental) by electroporation
according to the method described by Shinichi Aizawa, "Biomanual
Series 8, Gene Targeting", published by Yodosha, 1995. The
electroporated ES cells were suspended in 20 ml of ES medium [DMEM
(GIBCO), 18% FBS (GIBCO), 0.1 mM 2-mercaptoethanol (GIBCO), 1000
U/ml LIF (leukemia inhibitory factor, CHEMICON International,
Inc.)] and inoculated into two 100 mm tissue culture plastic plates
(Corning) into which feeder cells (Invitrogen) were seeded in
advance. After one day, the medium was replaced with a medium
containing 0.75 g/ml of puromycin (Sigma). Seven days thereafter,
puromycin resistant colonies formed were picked up. Each colony was
grown up to confluence in a 24-well plate, and then two third of
the culture was suspended in 0.2 ml of cryopreservation medium
[FBS+10% DMSO (Sigma)] and stored frozen at -80.degree. C. The
remaining one third was inoculated into a 12-well gelatin coated
plate and cultured for 2 days. Then, genomic DNA was isolated using
the Puregene DNA Isolation Kit (Gentra System).
[0705] 3'KO-probe for Southern analysis was prepared as follows.
RS3' Southern FW1 (SEQ ID NO: 152) and RS3' Southern RV2 (SEQ ID
NO: 153) primers were synthesized based on the sequence of the
mouse obtained from GenBank (Accession Number AC090291), and used
to amplify about 600 mer long DNA fragment of 3' genomic region of
RS element.
TABLE-US-00037 SEQ ID NO: 152) RS3'Southern FW1:
TCTTACTAGAGTTCTCACTAGCTCT.quadrature. SEQ ID NO: 153) RS3'Southern
RV2: GGAACCAAAGAATGAGGAAGCTGTT.quadrature.
[0706] Genomic DNA isolated from puromycin resistant TT2F cells was
digested with restriction enzyme EcoR I (Takara Shuzo) and then
subjected to 0.8% agarose gel electrophoresis.
[0707] Separated DNA fragments were transferred to a membrane
(GeneScreen, NEN.TM. Life Science Products) and then hybridization
was carried out using the DNA fragment as probe prepared from 3'
genomic region of RS element DNA (3'KO-probe). The band pattern of
untargeted ES clone shows one band of MW of about 5.7 Kb and
targeted ES clone shows two bands of MW of about 5.7 Kb and 7.4 Kb
(FIG. 63). The selected RS-KO mouse ES clones were also tested by
karyotype analysis according to the method described by Shinichi
Aizawa, "Biomanual Series 8, Gene Targeting", published by Yodosha,
1995. The RS-KO mouse ES clones that showed normal karyotype were
used for further experiments.
Example 33
Transgenic GIPF Deletion Mutant Animals
A. Construction of the pCk m4 KI Vector.
[0708] The construction of the GIPF deletion mutant 4 Ck knock-in
(pCk m4 KI) vector (FIG. 64A) was performed according to the method
described below, and depicted in FIGS. 64B-64K.
[0709] FIG. 64B Preparation of Ck P2 KI+AS KI
The oligo DNA fragments (SEQ ID NO: 154 and 155) for the addition
of the new restriction sites in Ck P2 KI were synthesized.
TABLE-US-00038 (SEQ ID NO: 154) Ascl top linker: GGCCAGGCGCGCCTTGC
(SEQ ID NO: 155) Ascl bottom linker: GGCCGCAAGGCGCGCCT
The prepared AscI top linker and AscI bottom linker were ligated
into Ck P2 KI that was pre-digested with the restriction enzyme
NotI. The resulting plasmid Ck P2 KI+AS KI contained the newly
added restriction site (AscI).
[0710] FIG. 64C Preparation of pBlueLAB+Nh
The oligo DNA fragments (SEQ ID NO: 156 and 157) for the addition
of the new restriction sites in pBlueLAB were synthesized.
TABLE-US-00039 (SEQ ID NO: 156) Pac-Nhe-Fse S: TAAGGGCTAGCTAGGGCCGG
(SEQ ID NO: 157) Pac-Nhe-Fse AS: CCCTAGCTAGCCCTTAAT
The prepared Pac-Nhe-Fse S and Pac-Nhe-Fse AS were ligated into
pBlueLAB that was pre-digested with the restriction enzymes PacI
and FseI. The resulting plasmid pBlueLAB+Nh contained the newly
added restriction site (NheI).
[0711] FIG. 64D Preparation of pBlueLAB+NhHp
The oligo DNA fragments (SEQ ID NO: 158 and 159) for the addition
of the new restriction sites in pBlueLAB+Nh were synthesized.
TABLE-US-00040 S/HpaI/Hd-S: TCGAGTTAAC (SEQ ID NO: 158)
S/HpaI/Hd-AS: AGCTGTTAAC (SEQ ID NO: 159)
[0712] The prepared S/HpaI/Hd-S and S/HpaI/Hd-AS were ligated into
pBlueLAB+Nh that was pre-digested with the restriction enzymes SalI
and HindIII. The resulting plasmid pBlueLAB+NhHp contained the
newly added restriction site (HpaI).
[0713] FIG. 64E Preparation of pCkpAP2
pCkP2+As KI was digested with HpaI and NheI, and the resulting 952
bp fragment was separated and recovered from agarose gel
electrophoresis. The 952 bp fragment was ligated into pBlueLAB+NhHp
that was pre-digested with the restriction enzymes HpaI and NheI.
The resulting plasmid pCkpAP2 contained the 952 bp fragment.
[0714] FIG. 64F Preparation of pCkpAMCS
The oligo DNA fragments (SEQ ID NO: 160 and 161) for the addition
of the new restriction sites in pCkpAP2 were synthesized.
TABLE-US-00041 (SEQ ID NO: 160) SPFNlinker-S:
AGCTGTCGACTTAATTAAGGCCGGCCG (SEQ ID NO: 161) SPFNlinker-AS:
CTAGCGGCCGGCCTTAATTAAGTCGAC
[0715] The prepared SPFNlinker-S and SPFNlinker-AS were ligated
into CkpAMCS that was pre-digested with the restriction enzymes
HindIII and NheI. The resulting plasmid CkpAMCS contained the newly
added restriction site (PacI).
[0716] FIG. 64G Preparation of pCkP2.DELTA.P
pCkpAMCS was digested with HpaI and NheI, and the resulting about
700 bp long fragment was separated and recovered from agarose gel
electrophoresis. The 700 bp fragment was ligated into pCkP2+As KI
that was pre-digested with the restriction enzymes HpaI and NheI.
The resulting plasmid pCkP2.DELTA.P contained the 700 bp
fragment.
[0717] FIG. 64H Preparation of pBS+PFN
The oligo DNA fragments (SEQ ID NO: 162 and 163) for the addition
of the new restriction sites in pBluescript II SK (-) were
synthesized.
TABLE-US-00042 (SEQ ID NO: 162) S/PFN/Hd-S:
TCGACTTAATTAAGGCCGGCCCTAGCTAGCA (SEQ ID NO: 163) S/PFN/Hd-AS:
AGCTTGCTAGCTAGGGCCGGCCTTAATTAAG
The prepared S/PFN/Hd-S and S/PFN/Hd-AS were ligated into
pBluescript II SK(-) that was pre-digested with the restriction
enzymes SalI and HindIII. The resulting plasmid pBSnPFN contained
the newly added restriction sites (PacI, FseI, and NheI).
[0718] FIG. 64I Preparation of pPSs3.8
The forward (PsecSP FW1; SEQ ID NO: 164) and reverse (PsecSP RV;
SEQ ID NO: 165) primers for PCR were synthesized based on the
sequence of the mouse obtained from GenBank (Accession Number
K02159), and used to amplify the DNA of promoter and leader
sequence coding region of IgK. The leader sequence coding region
contained intrinsic intron sequence. PsecSP FW1:
CCTTAATTAAAGTTATGTGTCCTAGAGGGCTGCAAACTCAAGATC (SEQ ID NO: 164) was
prepared by adding a PacI recognition sequence at 5' end site, and
PsecSP RV: TTGGCCGGCCTTGGCGCCAGTGGAACCTGGAATGATAAACACAAAGATTATTG
(SEQ ID NO: 165) was prepared by adding a FseI recognition sequence
at Send site. PCR was carried out using the mouse genome from TT2F
ES cells ((Uchida, 1995), Lifetech oriental) as template. The PCR
product was digested with restriction enzymes PacI and FseI, and
ligated into pBS.quadrature.PFN that was pre-digested with the
restriction enzymes PacI and FseI. The resulting plasmid pPSs3.8
contained the DNA fragment of promoter and leader sequence coding
region of IgK.
[0719] FIG. 64J Preparation of m4(+SP) and m4(-SP)
The forward (Sal kozak GIPF F; SEQ ID NO: 166) and reverse (GIPF m4
RV Fse; SEQ ID NO: 167) primers for PCR were synthesized based on
the sequence of the deletion mutant #4 (FIG. 43; SEQ ID NO: 91) and
used to amplify the DNA of leader sequence of GIPF and deletion
mutant #4 sequence of GIPF. Sal kozak GIPF F: MG CGT CGA CCA CCA
TGC GGC TTG GGC TGT GTG (SEQ ID NO: 166) was prepared by adding a
SalI recognition sequence at 5' end site, and GIPF m4 RV Fse: ATG
GCC GGC CCT ACA TGG TGC CAT TGG CAG (SEQ ID NO: 167) was prepared
by adding a FseI recognition sequence at 5' end site. PCR was
carried out using the GIPF KI vector as template. The PCR product
was digested with restriction enzymes SalI and FseI, and then the
m4(+SP) fragment was obtained.
[0720] The forward (Hy01(-SP) FW; SEQ ID NO: 168) and reverse (GIPF
m4 RV Fse; SEQ ID NO:169) primers for PCR were synthesized based on
the sequence of the deletion mutant #4 (FIG. 43; SEQ ID NO: 91) and
used to amplify the DNA of deletion mutant#4 sequence of GIPF.
Hy01(-SP) FW: AGCCGGGGGATCAAGGGGAAAAGGCAGAGG (SEQ ID NO: 168) was
prepared by adding a phosphoric acid at 5' end site, and GIPF m4 RV
Fse: ATG GCC GGC CCT ACA TGG TGC CAT TGG CAG (SEQ ID NO: 169) was
prepared by adding a FseI recognition sequence at 5' end site. PCR
was carried out using the GIPF KI vector as template. The PCR
product was digested with restriction enzyme FseI, and then the
m4(-SP) fragment was obtained.
[0721] FIG. 64K Construction of pCk m4 KI Vector
The m4(+SP) fragment was ligated into pCkP2+As KI that was
pre-digested with the restriction enzymes SalI and FseI. The
resulting pCk m4 KI vector contained the m4(+SP) fragment, that was
used for the generation of the GIPF deletion mutant mice. B.
Construction of the pPSm4 KI Vector. The construction of the GIPF
deletion mutant 4 PS knock-in (pPS m4 KI) vector (FIG. 65A) was
performed according to the method described below, and depicted in
FIGS. 65B-65C.
[0722] FIG. 65B Preparation of pPSs3.8 m4
The m4(-SP) fragment was ligated into pPSs3.8 that was pre-digested
with the restriction enzymes SfoI and FseI. The resulting pPSs3.8
m4 contained the m4(-SP) fragment.
[0723] FIG. 65C Construction of pPSm4 KI Vector
pPSs3.8 m4 was digested with PacI and FseI, and the resulting about
1.2 Kb long fragment was separated and recovered from agarose gel
electrophoresis. The 1.2 Kb fragment was ligated into CkP2.DELTA.P
that was pre-digested with the restriction enzymes PacI and FseI.
The resulting pPSm4 KI vector contained the 1.2 Kb fragment, that
was used for the generation of the GIPF deletion mutant mice.
C. Generation of GIPF Deletion Mutant Mice
[0724] General procedures for obtaining mouse embryos, cultivation,
injection of the ES cells into the embryos, transplantation to the
uteri of foster mothers were carried out in accordance with the
method described in Aizawa Shinichi, "Biomanual Series 8, Gene
Targeting", published by Yodosha, 1995.
[0725] The pCkm4 KI vector and pPSm4 KI vector were linearized with
NotI and transferred into RS-KO mouse ES cells by electroporation
according to the method described by Shinichi Aizawa, "Biomanual
Series 8, Gene Targeting", published by Yodosha, 1995. The
electroporated RS-KO mouse ES cells were suspended in 20 ml of ES
medium [DMEM (GIBCO), 18% FBS (GIBCO), 0.1 mM 2-mercaptoethanol
(GIBCO), 1000 U/ml LIF (leukemia inhibitory factor, CHEMICON
International, Inc.)] and inoculated into two 100 mm tissue culture
plastic plates (Corning) into which feeder cells (Invitrogen) were
seeded in advance. After one day, the medium was replaced with a
medium containing 0.75 g/ml of puromycin (Sigma). Seven to nine
days thereafter, 24 colonies formed from pCkm4 KI vector
electroporated RS-KO mouse ES cells and 24 colonies formed from
pPSm4 KI vector electroporated RS-KO mouse ES cells were picked up,
respectively. Each colony was grown up to confluence in a 12-well
plate, and then two third of the culture was suspended in 0.2 ml of
cryopreservation medium [FBS+10% DMSO (Sigma)] and stored frozen at
-80.degree. C. The remaining one third was inoculated into a
12-well gelatin coated plate and cultured for 2 days. Then, genomic
DNA was isolated using the Puregene DNA Isolation Kit (Gentra
System). Genomic DNA isolated from puromycin resistant RS-KO mouse
ES cells was digested with restriction enzyme EcoR I (Takara Shuzo)
and then subjected to 0.8% agarose gel electrophoresis. Separated
DNA fragments were transferred to a membrane (GeneScreen, NEN.TM.
Life Science Products) and then hybridization was carried out using
the DNA fragment as probe prepared from 3' region of
IgJ.kappa.-C.kappa.genomic DNA (Xho 1-EcoR I, 1.3 Kb (SEQ ID NO:
67): WO 00/10383, Example No. 48). The band pattern of untargeted
ES clone shows one band of MW of 15.6 Kb. pCkm4 KI targeted RS-KO
mouse ES clone shows two bands of MW of 15.6 Kb and 12.9 Kb and
pPSm4 KI targeted RS-KO mouse ES clone shows two bands of MW of
15.6 Kb and 12.5 Kb, respectively (FIGS. 66 and 67). One out of 10
pCkm4 KI targeted RS-KO mouse ES clones #3 was selected after
Southern analysis (rate of homologues recombination was about
41.7%) and one out of 7 pPSm4 KI targeted RS-KO mouse ES clone #7
was selected after Southern analysis (rate of homologues
recombination was about 29.2%). The selected ES clones were also
tested by karyotype analysis according to the method described by
Shinichi Aizawa, "Biomanual Series 8, Gene Targeting", published by
Yodosha, 1995. One clone #3 of pCkm4 KI targeted RS-KO mouse ES
clones and one clone #7 of pPSm4 KI targeted RS-KO mouse ES clones
that showed normal karyotype were used for implantation into
embryos, respectively.
[0726] The cells in a frozen stock of the pCkm4 KI targeted RS-KO
mouse ES cell clone #3 and the pPSm4 KI targeted RS-KO mouse ES
cell clone #7 were thawed, started to culture and injected into
8-cell stage embryos obtained by mating a male and a female mouse
of Immunoglobulin heavy chain knock out mouse strain (Tomizuka et.
Al. Proc. Natl. Acad. Sci. USA, 97: 722-727, 2000); the injection
rate was 10-12 cells per embryo. After the embryos were cultured
overnight in the medium for ES cells to develop into blastocysts,
about ten of the ES cell-injected embryos were transplanted to each
side of the uterus of a foster mother ICR mouse (CREA JAPAN, INC.),
which had been subjected to a pseudopregnant treatment for 2.5
days. As a result of transplantation of each of 80 injected
embryos, 15 and 20 offspring mice were born, respectively.
Chimerism in the offspring was determined by the extent of TT2F
cell-derived agouti coat color (dark brown) in the host embryo
(ICR)-derived albino coat color. Out of the 15 offspring, 9 mice
(pCkm4 knock-in mice) were recognized to have partial agouti coat
color, indicating the contribution of the RS-KO mouse ES cells and
out of the 20 offspring, 16 mice (pPSm4 knock-in mice) were
recognized to have partial agouti coat color, indicating the
contribution of the RS-KO mouse ES cells. GIPF deletion mutant mice
were obtained same as described above from the other clones of the
pCkm4 KI targeted RS-KO mouse ES cells and the pPSm4 KI targeted
RS-KO mouse ES cells.
[0727] Mice were kept under a 12/12-hour dark/light cycle (lights
on at 8:00 am) and received 5 .mu.m filtered water and CE-2 food
(CLEA JAPAN, INC.) ad libitum. Male mice were housed individually
after weaning period.
Example 34
Transgenic GIPF Variant Animals
A. Construction of the pCk VR KI Vector.
[0728] The construction of the GIPF variant Ck knock-in (pCk VR KI)
vector (FIG. 68A) was performed according to the method described
below, and depicted in FIGS. 68B-68C.
[0729] FIG. 6B Preparation of GIPF variant with kozak (VR+kz) and
GIPF variant (VR).
The forward (VR Ck Fw; SEQ ID NO: 171) and reverse (VR KI Rv; SEQ
ID NO: 171) primers for PCR were synthesized based on the sequence
of GenBank (Accession Number AK098225), and used to amplify the DNA
of GIPF variant with kozak at 5' end site. VR Ck Fw: ACG CGT CGA
CCA CCA TGA TAT TCC GAG TCA GTG C (SEQ ID NO: 170) was prepared by
adding a SalI recognition sequence at 5' end site, and VR KI Rv:
GGC CGG CCC TAG GCA GGC CCT GCA GAT GTG AGT GG (SEQ ID NO: 171) was
prepared by adding a FseI recognition sequence at 5' end site. PCR
was carried out using the GIPF KI vector as template. The PCR
product was digested with restriction enzymes SalI and FseI, and
then VR+kz was obtained. The forward (VR Fw; SEQ ID NO: 172) and
reverse (VR KI Rv; SEQ ID NO: 173) primers for PCR were synthesized
based on the sequence of GenBank (Accession Number AK098225), and
used to amplify the DNA of GIPF variant. VR Fw: ATG ATA TTC CGA GTC
AGT GCC GAG GGG AGC CAG (SEQ ID NO: 172) was prepared by adding a
phosphoric acid at 5' end site, and VR KI Rv: GGC CGG CCC TAG GCA
GGC CCT GCA GAT GTG AGT GG (SEQ ID NO: 173) was prepared by adding
a FseI recognition sequence at 5' end site. PCR was carried out
using the GIPF KI vector as template. The PCR product was digested
with restriction enzyme FseI, and then the VR was obtained.
[0730] FIG. 68C Construction of pCk VR KI Vector
The VR+kz was ligated into pCkP2+As KI that was pre-digested with
the restriction enzymes SalI and FseI. The resulting pCk VR KI
vector contained the VR+kz, that was used for the generation of the
GIPF variant mice.
B. Construction of the pPS VR KI Vector.
[0731] The construction of the GIPF variant PS knock-in (pPS VR KI)
vector (FIG. 69A) was performed according to the method described
below, and depicted in FIGS. 69B-69C.
[0732] FIG. 69B Preparation of pPSs3.8VR
The VR was ligated into pPSs3.8 that was pre-digested with the
restriction enzymes SfoI and FseI. The resulting pPSs3.8VR
contained the VR.
[0733] FIG. 69C Construction of pPS VR KI Vector
pPSs3.8VR was digested with SalI and FseI, and the resulting about
1.5 Kb long fragment was separated and recovered from agarose gel
electrophoresis. The 1.5 Kb fragment was ligated into
.quadrature.CkP2.DELTA.P that was pre-digested with the restriction
enzymes SalI and FseI. The resulting pPS VR KI vector contained the
1.5 Kb fragment, that was used for the generation of the GIPF
variant mice.
C. Generation of GIPF Variant Mice
[0734] General procedures for obtaining mouse embryos, cultivation,
injection of the ES cells into the embryos, transplantation to the
uteri of foster mothers were carried out in accordance with the
method described in Aizawa Shinichi, "Biomanual Series 8, Gene
Targeting", published by Yodosha, 1995.
[0735] The pCkVR KI vector and pPSVR KI vector were linearized with
Not I and transferred into RS-KO mouse ES cells by electroporation
according to the method described by Shinichi Aizawa, "Biomanual
Series 8, Gene Targeting", published by Yodosha, 1995. The
electroporated RS-KO mouse ES cells were suspended in 20 ml of ES
medium [DMEM (GIBCO), 18% FBS (GIBCO), 0.1 mM 2-mercaptoethanol
(GIBCO), 1000 U/ml LIF (leukemia inhibitory factor, CHEMICON
International, Inc.)] and inoculated into two 100 mm tissue culture
plastic plates (Corning) into which feeder cells (Invitrogen) were
seeded in advance. After one day, the medium was replaced with a
medium containing 0.75 g/ml of puromycin (Sigma). Seven to nine
days thereafter, 24 colonies formed from pCkVR KI vector
electroporated RS-KO mouse ES cells and 24 colonies formed from
pPSVR KI vector electroporated RS-KO mouse ES cells were picked up,
respectively. Each colony was grown up to confluence in a 12-well
plate, and then two third of the culture was suspended in 0.2 ml of
cryopreservation medium [FBS+10% DMSO (Sigma)] and stored frozen at
-80.degree. C. The remaining one third was inoculated into a
12-well gelatin coated plate and cultured for 2 days. Then, genomic
DNA was isolated using the Puregene DNA Isolation Kit (Gentra
System). Genomic DNA isolated from puromycin resistant RS-KO mouse
ES cells was digested with restriction enzyme EcoR I (Takara Shuzo)
and then subjected to 0.8% agarose gel electrophoresis. Separated
DNA fragments were transferred to a membrane (GeneScreen, NEN.TM.
Life Science Products) and then hybridization was carried out using
the DNA fragment as probe prepared from 3' region of
IgJ.kappa.-C.kappa.genomic DNA (Xho I-EcoR I, 1.3 Kb (SEQ ID NO:
67): WO 00/10383, Example No. 48). The band pattern of untargeted
ES clone shows one band of MW of 15.6 Kb. pCkVR KI targeted RS-KO
mouse ES clone shows two bands of MW of 15.6 Kb and 13.1 Kb and
pPSVR KI targeted RS-KO mouse ES clone shows two bands of MW of
15.6 Kb and 12.9 Kb, respectively (FIGS. 70 and 71). One out of 12
pCkVR KI targeted RS-KO mouse ES clones #3 was selected after
Southern analysis (rate of homologues recombination was about
37.5%) and one out of 8 PPSVR KI targeted RS-KO mouse ES clone #14
was selected after Southern analysis (rate of homologues
recombination was about 25%). The selected ES clones were also
tested by karyotype analysis according to the method described by
Shinichi Aizawa, "Biomanual Series 8, Gene Targeting", published by
Yodosha, 1995. One clone #3 of pCkVR KI targeted RS-KO mouse ES
clones and one clone #14 of PPSVR KI targeted RS-KO mouse ES clones
that showed normal karyotype were used for implantation into
embryos, respectively.
[0736] The cells in a frozen stock of the pCkVR KI targeted RS-KO
mouse ES cell clone #3 and the pPSVR KI targeted RS-KO mouse ES
cell clone #14 were thawed, started to culture and injected into
8-cell stage embryos obtained by mating a male and a female mouse
of Immunoglobulin heavy chain knock out mouse strain (Tomizuka et.
Al. Proc. Natl. Acad. Sci. USA, 97: 722-727, 2000); the injection
rate was 10-12 cells per embryo. After the embryos were cultured
overnight in the medium for ES cells to develop into blastocysts,
about ten of the ES cell-injected embryos were transplanted to each
side of the uterus of a foster mother ICR mouse (CREA JAPAN, INC.),
which had been subjected to a pseudopregnant treatment for 2.5
days. As a result of transplantation of each of 220 injected
embryos, 68 and 60 offspring mice were born, respectively.
Chimerism in the offspring was determined by the extent of TT2F
cell-derived agouti coat color (dark brown) in the host embryo
(ICR)-derived albino coat color. Out of the 68 offspring, 47 mice
(pCkVR knock-in mice) were recognized to have partial agouti coat
color, indicating the contribution of the RS-KO mouse ES cells and
out of the 60 offspring, 38 mice (PPSVR knock-in mice) were
recognized to have partial agouti coat color, indicating the
contribution of the RS-KO mouse ES cells. GIPF variant mice were
obtained same as described above from the other clones of the pCkVR
KI targeted RS-KO mouse ES cells and the pPSVR KI targeted RS-KO
mouse ES cells.
[0737] Mice were kept under a 12/12-hour dark/light cycle (lights
on at 8:00 am) and received 5 .mu.m filtered water and CE-2 food
(CLEA JAPAN, INC.) ad libitum. Male mice were housed individually
after weaning period.
Example 35
Evaluation of the Biological Activity of GIPF Deletion Mutant Using
Transgenic GIPF Deletion Mutant-KI Mice
[0738] The gross pathological changes and the histological changes
of the small intestine and colon from the transgenic mice described
above were evaluated as follows. GIPF deletion mutant-KI (Ckm4-KI
and PSm4-KI) mice were harvested at 4 weeks of age. Gross
appearance of GIPF deletion mutant-KI gastrointestinal tract showed
little difference compared to control (FIG. 72). For
histopathological evaluation, gastrointestinal tract were removed
and fixed in formalin. Paraffin embedded sections were stained with
hematoxiyline and eosin (H&E) for histological evaluation.
H&E sections of small intestine were shown FIG. 73 (low
magnification) and FIG. 74 (high magnification).
[0739] H&E sections from GIPF deletion mutant-KI mouse small
intestine revealed mild increase of crypt length and number
compared to control. The increase of crypt length and number in
PSm4-KI was tended to be greater than Ckm4-KI.
[0740] Expression of GIPF deletion mutant #4 gene expression and
the induction of .beta.-catenin targeted Axin-2 gene expression
were analyzed using small intestine and colon samples derived from
GIPF deletion mutant-KI mice. 50 mg of ileum, colon and liver
samples were removed and rapidly froze by use of liquid nitrogen.
Frozen sections were homogenized with 1 ml of ISOGEN (NIPPON GENE)
and total RNA was extracted under the recommended conditions. To
remove genomic DNA, the RNA solution was treated with DNase (WAKO;
Deoxyribonuclease RT grade) at 37.degree. C. for 15 mins. Then
total RNA was purified with RNasy Mini (QIAGEN) under the
recommended conditions. For each sample, cDNA was synthesized from
500 ng of total RNA using Super Script III (Invitrogen) under the
recommended conditions. Then cDNA was treated with 1 unit of RNaseH
(Invitrogen) at 37.degree. C. for 20 mins to digest remaining RNA.
PCR was carried out using synthesized cDNA as a template. The
following two primers were used detection of GIPF deletion mutant:
PSm4RT F1: ATCAAGGGGAAAAGGCAGAG (SEQ ID NO: 174), and CkpolyA R2:
CGCTTGTGGGGAAGCCTCCAAGACC (SEQ ID NO: 175). For detection of
Axin-2, following two primers were used: Axin2 F (MUS):
CAGGAGCCTCACCCTTCG (SEQ ID NO: 138), and Axin2 R (MUS):
ACGCCGAGGTGCTTGCCC (SEQ ID NO: 139). Mouse GAPDH primers: mGAPDH5:
CACCATGGAGAAGGCCGGGGCCCAC (SEQ ID NO: 140), and mGAPDH3:
ATCATACTTGGCAGGTTTCTCCAGG (SEQ ID NO: 141) were used for the
detection of housekeeping gene expression. The reaction mixture of
PCR was prepared by adding sterilized distilled water to 2.5 ul of
10.times.LA PCR Buffer II (Takara Shuzo), 4 ul of 2.5 mM each dNTP
Mixture (Takara Shuzo), 0.5 ul of 10 mM each primer, 2 ul of
10.times. cDNA diluted with sterilized distilled water and 0.5 ul
of LA Taq (Takara Shuzo) to make 25 ul. For detection of GIPF
deletion mutant and Axin-2, reaction mixture of PCR was incubated
at 94.degree. C. for 2 mins, reaction of 33 cycles was carried out,
with 94.degree. C. for 30 seconds, 60.degree. C. for 30 seconds and
72.degree. C. for 30 seconds. For detection of GAPDH, reaction
mixture of PCR was incubated at 94.degree. C. for 2 mins, reaction
of 22 cycles was carried out, with 94.degree. C. for 30 seconds,
65.degree. C. for 30 seconds and 72.degree. C. for 30 seconds.
[0741] GIPF deletion mutant gene expression was detected in ileum
and colon from PSm4-KI mice. The expression level of Axin-2 was
increased in PSm4-KI mice compared to control (FIG. 75). This data
suggested that deletion mutant form of GIPF had activity to induce
.beta.-catenin targeted gene expression and responsible for
activation of down stream of .beta.-catenin signaling pathway.
[0742] Thus it suggested that GIPF deletion mutant #4 had activity
to stimulate .beta.-catenin signaling pathway.
Example 36
Evaluation of the Biological Activity of GIPF Variant Using
Transgenic GIPF Variant-KI Mice
[0743] The gross pathological changes and the histological changes
of the small intestine and colon from the transgenic mice described
above were evaluated as follows. GIPF variant-KI (CkVR-KI and
PSVR-KI) mice were harvested at 4 weeks of age. Gross appearance of
harvested PSVR-KI showed that they had remarkable intestinal
distension and increased small intestinal mass when compared to
control mouse (FIG. 76). For histopathological evaluation,
gastrointestinal tract were removed and fixed in formalin. Paraffin
embedded sections were stained with hematoxiyline and eosin
(H&E) for histological evaluation. H&E sections of small
intestine were shown FIG. 77 (low magnification) and FIG. 78 (high
magnification).
[0744] H&E sections from small intestine revealed remarkable
difference between PSVR-KI and control. As shown FIG. 76, crypt
cell hyperplasia of PSVR-KI demonstrated increased in crypt length
and number of Paneth cells compared to control mouse. On the other
hand, CkVR-KI did not show obvious intestinal distention or
increase of crypt length (data not shown). The difference of
observed phenotypes between CkVR-KI and PSVR-KI was estimated
because of the difference of their KI-vector structure.
[0745] Expression of GIPF variant gene expression and the induction
of .beta.-catenin targeted Axin-2 gene expression were analyzed
using small intestine and colon samples derived from GIPF
variant-KI mice. 50 mg of ileum, colon and liver samples were
removed and rapidly froze by use of liquid nitrogen. Frozen
sections were homogenized with 1 ml of ISOGEN (NIPPON GENE) and
total RNA was extracted under the recommended conditions. To remove
genomic DNA, the RNA solution was treated with DNase (WAKO;
Deoxyribonuclease RT grade) at 37.degree. C. for 15 mins. Then
total RNA was purified with RNasy Mini (QIAGEN) under the
recommended conditions. For each sample, cDNA was synthesized from
500 ng of total RNA using Super Script III (Invitrogen) under the
recommended conditions. Then cDNA was treated with 1 unit of RNaseH
(Invitrogen) at 37.degree. C. for 20 mins to digest remaining RNA.
PCR was carried out using synthesized cDNA as a template. The
following two primers were used detection of GIPF variant: PSFLJRT
F1: ATAACTTCTGCACCAAGTGTAAGGA (SEQ ID NO: 176), and CkpolyA R2:
CGCTTGTGGGGAAGCCTCCAAGACC (SEQ ID NO: 175). For detection of
Axin-2, following two primers were used: Axin2 F (MUS):
CAGGAGCCTCACCCTTCG (SEQ ID NO: 138), and Axin2 R (MUS):
ACGCCGAGGTGCTTGCCC (SEQ ID NO: 139). Mouse GAPDH primers: mGAPDH5:
CACCATGGAGAAGGCCGGGGCCCAC (SEQ ID NO: 140), and mGAPDH3:
ATCATACTTGGCAGGTTTCTCCAGG (SEQ ID NO: 141) were used for the
detection of housekeeping gene expression. The reaction mixture of
PCR was prepared by adding sterilized distilled water to 2.5 ul of
10.times.LA PCR Buffer II (Takara Shuzo), 4 ul of 2.5 mM each dNTP
Mixture (Takara Shuzo), 0.5 ul of 10 mM each primer, 2 ul of
10.times. cDNA diluted with sterilized distilled water and 0.5 ul
of LA Taq (Takara Shuzo) to make 25 ul. For detection of GIPF
variant and Axin-2, reaction mixture of PCR was incubated at
94.degree. C. for 2 mins, reaction of 33 cycles was carried out,
with 94.degree. C. for 30 seconds, 60.degree. C. for 30 seconds and
72.degree. C. for 30 seconds. For detection of GAPDH, reaction
mixture of PCR was incubated at 94.degree. C. for 2 mins, reaction
of 23 cycles was carried out, with 94.degree. C. for 30 seconds,
65.degree. C. for 30 seconds and 72.degree. C. for 30 seconds.
[0746] GIPF variant gene expression was detected in ileum and colon
from PSVR-KI mice. The expression level of Axin-2 was increased in
PSVR-KI mouse compared to control (FIG. 79). This data suggested
that GIPF variant had activity to induce .beta.-catenin targeted
gene expression and responsible for activation of down stream of
.beta.-catenin signaling pathway.
[0747] Thus it indicated that GIPF variant had activity to
stimulate .beta.-catenin signaling pathway.
Example 37
CD4+CD45RB.sup.high T-Cell Transfer Model
[0748] Induction of chronic intestinal inflammation similar to
inflammatory bowel disease by transferring CD4+CD45RB.sup.high T
lymphocyte subsets to immunodeficient SCID mice was reported by
Aranda et al., (J Immunol 158:3464-3473). Accordingly, the
therapeutic efficacy of GIPF to immunologically induced colitis was
tested in a CD4+CD45RB.sup.high T-cell transferred model as
follows.
[0749] Adult female C.B-17/Icr Crj-scid/scid mice (CHARLES RIVER
JAPAN, INC.), aged 7 weeks were used. On delivery from the supplier
and prior to experiment, the animals were housed for two weeks in
individually ventilated cages on a 12 hour light:dark cycle to
atbilize the circadian rhythm. Animals were allowed to food and
water ad libitum.
[0750] At the day cell transfer (day 0), CD4+CD45RB.sup.high
T-cells were collected form spleens of 20 BALB/c female mice.
Splenocytes were suspended in 2% FBS, 2 mM EDTA, PBS sorting buffer
and CD4 positive cells were sorted by FACS (Becton Dickinson FACS
Aria). Then sorted CD4 positive cells were resuspended in sorting
buffer to 2.times.10.sup.7 cells/ml and CD4 positive and
CD45RB.sup.high cell fraction was gated. Collected
CD4+CD45RB.sup.high T-cells were centrifuged and suspended in 6 ml
of PBS to 1.1.times.10.sup.6 cells/ml. 4.5.times.10.sup.5
cells/mouse of CD4+CD45RB.sup.high T-cells were transferred to 13
female C.B-17/Icr Crj-scid/scid mice by ip injection. [0751] After
T-cell transfer, serum amyloid A(SAA) concentration was monitored
for inflammation progress. Also, progression of colitis was
monitored by reduction of body weight, stool consistency and occult
blood test. SAA concentration was increased from 7 days after
transfer and inflammatory was elucidated in T-cell transferred
mice. 12 days after T-cell transfer, loose stool and occult blood
positive individuals were appeared. 30 days after T-cell transfer,
diarrhea and gross bleeding were observed in T-cell transferred
mice. Further 40 days, body weight loss was observed in T-cell
transferred mice. From day 61 after T-cell transfer, 100 ug/dose
GIPF was injected iv for 3 days to 4 of T-cell transferred mice.
Also PBS was injected iv for 3 days to 3 of T-cell transferred mice
as negative control. At 70 days after T-cell transfer, these
animals were sacrificed. The intestine was removed and fixed in
formalin. Paraffin embedded sections were stained with hematoxylin
and eosin (H&E) for histological evaluation. [0752] As shown
FIG. 80, H&E staining of sections from the large intestine that
injected 100 ug/dose of GIPF showed clear gland structures,
increased in the number of mitotic cell and less necrotic cell
debris compared to PBS injected mice. The histopathological changes
in large intestinal mucosa caused by T-cell trfansfer were actually
reduced by GIPF injection. Therefore, GIPF may be used for treating
patients suffering from mucositis caused by inflammatory bowel
disease including Crohn's disease.
Sequence CWU 1
1
1781380DNAHomo sapiens 1ttcccgggtc gacttcacgc gtcggaggaa gggaggccag
ggccggcggg agaatgccaa 60caggaacctg gccaggaagg agagcaagga ggcgggtgct
ggctctcgaa gacgcaaggg 120gcagcaacag cagcagcagc aagggacagt
ggggccactc acatctgcag ggcctgccta 180gggacactgt ccagcctcca
ggcccatgca gaaagagttc agtgctactc tgcgtgattc 240aagctttcct
gaactggaac gtcgggggca aagcatacac acacactcca atccatccat
300gcatacacag acacaagaca cacacgctca aacccctgtc cacatataca
accatacata 360cttgcacatg tgtgttcatg 38022339DNAHomo sapiens
2cgggtcgacg atttcgtcgc gccctcgccc ctcccgggcc tgcccccgtc gcgactggca
60gcacgaagct gagattgtgg tttcctggtg attcaggtgg gagtgggcca gaagatcacc
120gctggcaagg actggtgttt gtcaactgta aggactcatg gaacagatct
accagggatt 180ctcagacctt agtttgagaa atgctgcaat taaaggcaaa
tcctatcact ctgagtgatc 240gctttggtgt cgaggcaatc aaccataaag
ataaatgcaa atatggaaat tgcataacag 300tactcagtat taaggttggt
ttttggagta gtccctgctg acgtgacaaa aagatctctc 360atatgatatt
ccgaggtatc tttgaggaag tctctctttg aggacctccc tttgagctga
420tggagaactg ggctccccac accctctctg tccccagctg agattatggt
ggatttgggc 480tacggcccag gcctgggcct cctgctgctg acccagcccc
agaggtgtta gcaagagccg 540tgtgctatcc accctccccg agaccacccc
tccgaccagg ggcctggagc tggcgcgtga 600ctatgcggct tgggctgtgt
gtggtggccc tggttctgag ctggacgcac ctcaccatca 660gcagccgggg
gatcaagggg aaaaggcaga ggcggatcag tgccgagggg agccaggcct
720gtgccaaagg ctgtgagctc tgctctgaag tcaacggctg cctcaagtgc
tcacccaagc 780tgttcatcct gctggagagg aacgacatcc gccaggtggg
cgtctgcttg ccgtcctgcc 840cacctggata cttcgacgcc cgcaaccccg
acatgaacaa gtgcatcaaa tgcaagatcg 900agcactgtga ggcctgcttc
agccataact tctgcaccaa gtgtaaggag ggcttgtacc 960tgcacaaggg
ccgctgctat ccagcttgtc ccgagggctc ctcagctgcc aatggcacca
1020tggagtgcag tagtcctgcg caatgtgaaa tgagcgagtg gtctccgtgg
gggccctgct 1080ccaagaagca gcagctctgt ggtttccgga ggggctccga
ggagcggaca cgcagggtgc 1140tacatgcccc tgtgggggac catgctgcct
gctctgacac caaggagacc cggaggtgca 1200cagtgaggag agtgccgtgt
cctgaggggc agaagaggag gaagggaggc cagggccggc 1260gggagaatgc
caacaggaac ctggccagga aggagagcaa ggaggcgggt gctggctctc
1320gaagacgcaa ggggcagcaa cagcagcagc agcaagggac agtggggcca
ctcacatctg 1380cagggcctgc ctagggacac tgtccagcct ccaggcccat
gcagaaagag ttcagtgcta 1440ctctgcgtga ttcaagcttt cctgaactgg
aacgtcgggg gcaaagcata cacacacact 1500ccaatccatc catgcataca
cagacacaag acacacacgc tcaaacccct gtccacatat 1560acaaccatac
atacttgcac atgtgtgttc atgtacacac gcagacacag acaccacaca
1620cacacataca cacacacaca cacacgcaca cctgaggcca ccagaagaca
cttccatccc 1680tcgggcccag cagtacacac ttggtttcca gagctcccag
tggacatgtc agagacaaca 1740cttcccagca tctgagacca aactgcagag
gggagccttc tggagaagct gctgggatcg 1800gaccagccac tgtggcagat
gggagccaag cttgaggact gctggtggcc tgggaagaaa 1860ccttcttccc
atcctgttca gcactcccag ctgtgtgact ttatcgttgg agagtattgt
1920taccttccag gatacatatc agggttaacc tgactttgaa aactgcttaa
aggtttattt 1980caaattaaaa caaaaaaatc aacgacagca gtagacacag
gcaccacatt cctttgcagg 2040gtgtgagggt ttggcgaggt atgcgtagga
gcaagaaggg acagggaatt tcaagagacc 2100ccaaatagcc tgctcagtag
agggtcatgc agacaaggaa gaaaacttag gggctgctct 2160gacggtggta
aacaggctgt ctatatcctt gttactcaga gcatggcccg gcagcagtgt
2220tgtcacaggg cagcttgtta ggaatgataa tctcaggtct cattccagac
ctggagagcc 2280atgagtctaa attttaagat tcctgatgat tggcatgtta
cccaaatttg agaagtgct 23393789DNAHomo sapiens 3atgcggcttg ggctgtgtgt
ggtggccctg gttctgagct ggacgcacct caccatcagc 60agccggggga tcaaggggaa
aaggcagagg cggatcagtg ccgaggggag ccaggcctgt 120gccaaaggct
gtgagctctg ctctgaagtc aacggctgcc tcaagtgctc acccaagctg
180ttcatcctgc tggagaggaa cgacatccgc caggtgggcg tctgcttgcc
gtcctgccca 240cctggatact tcgacgcccg caaccccgac atgaacaagt
gcatcaaatg caagatcgag 300cactgtgagg cctgcttcag ccataacttc
tgcaccaagt gtaaggaggg cttgtacctg 360cacaagggcc gctgctatcc
agcttgtccc gagggctcct cagctgccaa tggcaccatg 420gagtgcagta
gtcctgcgca atgtgaaatg agcgagtggt ctccgtgggg gccctgctcc
480aagaagcagc agctctgtgg tttccggagg ggctccgagg agcggacacg
cagggtgcta 540catgcccctg tgggggacca tgctgcctgc tctgacacca
aggagacccg gaggtgcaca 600gtgaggagag tgccgtgtcc tgaggggcag
aagaggagga agggaggcca gggccggcgg 660gagaatgcca acaggaacct
ggccaggaag gagagcaagg aggcgggtgc tggctctcga 720agacgcaagg
ggcagcaaca gcagcagcag caagggacag tggggccact cacatctgca 780gggcctgcc
7894263PRTHomo sapiens 4Met Arg Leu Gly Leu Cys Val Val Ala Leu Val
Leu Ser Trp Thr His1 5 10 15Leu Thr Ile Ser Ser Arg Gly Ile Lys Gly
Lys Arg Gln Arg Arg Ile 20 25 30Ser Ala Glu Gly Ser Gln Ala Cys Ala
Lys Gly Cys Glu Leu Cys Ser 35 40 45Glu Val Asn Gly Cys Leu Lys Cys
Ser Pro Lys Leu Phe Ile Leu Leu 50 55 60Glu Arg Asn Asp Ile Arg Gln
Val Gly Val Cys Leu Pro Ser Cys Pro65 70 75 80Pro Gly Tyr Phe Asp
Ala Arg Asn Pro Asp Met Asn Lys Cys Ile Lys 85 90 95Cys Lys Ile Glu
His Cys Glu Ala Cys Phe Ser His Asn Phe Cys Thr 100 105 110Lys Cys
Lys Glu Gly Leu Tyr Leu His Lys Gly Arg Cys Tyr Pro Ala 115 120
125Cys Pro Glu Gly Ser Ser Ala Ala Asn Gly Thr Met Glu Cys Ser Ser
130 135 140Pro Ala Gln Cys Glu Met Ser Glu Trp Ser Pro Trp Gly Pro
Cys Ser145 150 155 160Lys Lys Gln Gln Leu Cys Gly Phe Arg Arg Gly
Ser Glu Glu Arg Thr 165 170 175Arg Arg Val Leu His Ala Pro Val Gly
Asp His Ala Ala Cys Ser Asp 180 185 190Thr Lys Glu Thr Arg Arg Cys
Thr Val Arg Arg Val Pro Cys Pro Glu 195 200 205Gly Gln Lys Arg Arg
Lys Gly Gly Gln Gly Arg Arg Glu Asn Ala Asn 210 215 220Arg Asn Leu
Ala Arg Lys Glu Ser Lys Glu Ala Gly Ala Gly Ser Arg225 230 235
240Arg Arg Lys Gly Gln Gln Gln Gln Gln Gln Gln Gly Thr Val Gly Pro
245 250 255Leu Thr Ser Ala Gly Pro Ala 2605927DNAArtificial
sequenceGIPF V5His tag 5atgcggcttg ggctgtgtgt ggtggccctg gttctgagct
ggacgcacct caccatcagc 60agccggggga tcaaggggaa aaggcagagg cggatcagtg
ccgaggggag ccaggcctgt 120gccaaaggct gtgagctctg ctctgaagtc
aacggctgcc tcaagtgctc acccaagctg 180ttcatcctgc tggagaggaa
cgacatccgc caggtgggcg tctgcttgcc gtcctgccca 240cctggatact
tcgacgcccg caaccccgac atgaacaagt gcatcaaatg caagatcgag
300cactgtgagg cctgcttcag ccataacttc tgcaccaagt gtaaggaggg
cttgtacctg 360cacaagggcc gctgctatcc agcttgtccc gagggctcct
cagctgccaa tggcaccatg 420gagtgcagta gtcctgcgca atgtgaaatg
agcgagtggt ctccgtgggg gccctgctcc 480aagaagcagc agctctgtgg
tttccggagg ggctccgagg agcggacacg cagggtgcta 540catgcccctg
tgggggacca tgctgcctgc tctgacacca aggagacccg gaggtgcaca
600gtgaggagag tgccgtgtcc tgaggggcag aagaggagga agggaggcca
gggccggcgg 660gagaatgcca acaggaacct ggccaggaag gagagcaagg
aggcgggtgc tggctctcga 720agacgcaagg ggcagcaaca gcagcagcag
caagggacag tggggccact cacatctgca 780gggcctgcca agggcaattc
tgcagatatc cagcacagtg gcggccgctc gagtctagag 840ggcccgcggt
tcgaaggtaa gcctatccct aaccctctcc tcggtctcga ttctacgcgt
900accggtcatc atcaccatca ccattga 9276308PRTArtificial sequenceGIPF
V5His tag 6Met Arg Leu Gly Leu Cys Val Val Ala Leu Val Leu Ser Trp
Thr His1 5 10 15Leu Thr Ile Ser Ser Arg Gly Ile Lys Gly Lys Arg Gln
Arg Arg Ile 20 25 30Ser Ala Glu Gly Ser Gln Ala Cys Ala Lys Gly Cys
Glu Leu Cys Ser 35 40 45Glu Val Asn Gly Cys Leu Lys Cys Ser Pro Lys
Leu Phe Ile Leu Leu 50 55 60Glu Arg Asn Asp Ile Arg Gln Val Gly Val
Cys Leu Pro Ser Cys Pro65 70 75 80Pro Gly Tyr Phe Asp Ala Arg Asn
Pro Asp Met Asn Lys Cys Ile Lys 85 90 95Cys Lys Ile Glu His Cys Glu
Ala Cys Phe Ser His Asn Phe Cys Thr 100 105 110Lys Cys Lys Glu Gly
Leu Tyr Leu His Lys Gly Arg Cys Tyr Pro Ala 115 120 125Cys Pro Glu
Gly Ser Ser Ala Ala Asn Gly Thr Met Glu Cys Ser Ser 130 135 140Pro
Ala Gln Cys Glu Met Ser Glu Trp Ser Pro Trp Gly Pro Cys Ser145 150
155 160Lys Lys Gln Gln Leu Cys Gly Phe Arg Arg Gly Ser Glu Glu Arg
Thr 165 170 175Arg Arg Val Leu His Ala Pro Val Gly Asp His Ala Ala
Cys Ser Asp 180 185 190Thr Lys Glu Thr Arg Arg Cys Thr Val Arg Arg
Val Pro Cys Pro Glu 195 200 205Gly Gln Lys Arg Arg Lys Gly Gly Gln
Gly Arg Arg Glu Asn Ala Asn 210 215 220Arg Asn Leu Ala Arg Lys Glu
Ser Lys Glu Ala Gly Ala Gly Ser Arg225 230 235 240Arg Arg Lys Gly
Gln Gln Gln Gln Gln Gln Gln Gly Thr Val Gly Pro 245 250 255Leu Thr
Ser Ala Gly Pro Ala Lys Gly Asn Ser Ala Asp Ile Gln His 260 265
270Ser Gly Gly Arg Ser Ser Leu Glu Gly Pro Arg Phe Glu Gly Lys Pro
275 280 285Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Arg Thr Gly
His His 290 295 300His His His His305760DNAHomo sapiensCDS(1)..(60)
7atg cgg ctt ggg ctg tgt gtg gtg gcc ctg gtt ctg agc tgg acg cac
48Met Arg Leu Gly Leu Cys Val Val Ala Leu Val Leu Ser Trp Thr His1
5 10 15ctc acc atc agc 60Leu Thr Ile Ser 20820PRTHomo sapiens 8Met
Arg Leu Gly Leu Cys Val Val Ala Leu Val Leu Ser Trp Thr His1 5 10
15Leu Thr Ile Ser 209732DNAHomo sapiensCDS(1)..(729) 9agc cgg ggg
atc aag ggg aaa agg cag agg cgg atc agt gcc gag ggg 48Ser Arg Gly
Ile Lys Gly Lys Arg Gln Arg Arg Ile Ser Ala Glu Gly1 5 10 15agc cag
gcc tgt gcc aaa ggc tgt gag ctc tgc tct gaa gtc aac ggc 96Ser Gln
Ala Cys Ala Lys Gly Cys Glu Leu Cys Ser Glu Val Asn Gly 20 25 30tgc
ctc aag tgc tca ccc aag ctg ttc atc ctg ctg gag agg aac gac 144Cys
Leu Lys Cys Ser Pro Lys Leu Phe Ile Leu Leu Glu Arg Asn Asp 35 40
45atc cgc cag gtg ggc gtc tgc ttg ccg tcc tgc cca cct gga tac ttc
192Ile Arg Gln Val Gly Val Cys Leu Pro Ser Cys Pro Pro Gly Tyr Phe
50 55 60gac gcc cgc aac ccc gac atg aac aag tgc atc aaa tgc aag atc
gag 240Asp Ala Arg Asn Pro Asp Met Asn Lys Cys Ile Lys Cys Lys Ile
Glu65 70 75 80cac tgt gag gcc tgc ttc agc cat aac ttc tgc acc aag
tgt aag gag 288His Cys Glu Ala Cys Phe Ser His Asn Phe Cys Thr Lys
Cys Lys Glu 85 90 95ggc ttg tac ctg cac aag ggc cgc tgc tat cca gct
tgt ccc gag ggc 336Gly Leu Tyr Leu His Lys Gly Arg Cys Tyr Pro Ala
Cys Pro Glu Gly 100 105 110tcc tca gct gcc aat ggc acc atg gag tgc
agt agt cct gcg caa tgt 384Ser Ser Ala Ala Asn Gly Thr Met Glu Cys
Ser Ser Pro Ala Gln Cys 115 120 125gaa atg agc gag tgg tct ccg tgg
ggg ccc tgc tcc aag aag cag cag 432Glu Met Ser Glu Trp Ser Pro Trp
Gly Pro Cys Ser Lys Lys Gln Gln 130 135 140ctc tgt ggt ttc cgg agg
ggc tcc gag gag cgg aca cgc agg gtg cta 480Leu Cys Gly Phe Arg Arg
Gly Ser Glu Glu Arg Thr Arg Arg Val Leu145 150 155 160cat gcc cct
gtg ggg gac cat gct gcc tgc tct gac acc aag gag acc 528His Ala Pro
Val Gly Asp His Ala Ala Cys Ser Asp Thr Lys Glu Thr 165 170 175cgg
agg tgc aca gtg agg aga gtg ccg tgt cct gag ggg cag aag agg 576Arg
Arg Cys Thr Val Arg Arg Val Pro Cys Pro Glu Gly Gln Lys Arg 180 185
190agg aag gga ggc cag ggc cgg cgg gag aat gcc aac agg aac ctg gcc
624Arg Lys Gly Gly Gln Gly Arg Arg Glu Asn Ala Asn Arg Asn Leu Ala
195 200 205agg aag gag agc aag gag gcg ggt gct ggc tct cga aga cgc
aag ggg 672Arg Lys Glu Ser Lys Glu Ala Gly Ala Gly Ser Arg Arg Arg
Lys Gly 210 215 220cag caa cag cag cag cag caa ggg aca gtg ggg cca
ctc aca tct gca 720Gln Gln Gln Gln Gln Gln Gln Gly Thr Val Gly Pro
Leu Thr Ser Ala225 230 235 240ggg cct gcc tag 732Gly Pro
Ala10243PRTHomo sapiens 10Ser Arg Gly Ile Lys Gly Lys Arg Gln Arg
Arg Ile Ser Ala Glu Gly1 5 10 15Ser Gln Ala Cys Ala Lys Gly Cys Glu
Leu Cys Ser Glu Val Asn Gly 20 25 30Cys Leu Lys Cys Ser Pro Lys Leu
Phe Ile Leu Leu Glu Arg Asn Asp 35 40 45Ile Arg Gln Val Gly Val Cys
Leu Pro Ser Cys Pro Pro Gly Tyr Phe 50 55 60Asp Ala Arg Asn Pro Asp
Met Asn Lys Cys Ile Lys Cys Lys Ile Glu65 70 75 80His Cys Glu Ala
Cys Phe Ser His Asn Phe Cys Thr Lys Cys Lys Glu 85 90 95Gly Leu Tyr
Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu Gly 100 105 110Ser
Ser Ala Ala Asn Gly Thr Met Glu Cys Ser Ser Pro Ala Gln Cys 115 120
125Glu Met Ser Glu Trp Ser Pro Trp Gly Pro Cys Ser Lys Lys Gln Gln
130 135 140Leu Cys Gly Phe Arg Arg Gly Ser Glu Glu Arg Thr Arg Arg
Val Leu145 150 155 160His Ala Pro Val Gly Asp His Ala Ala Cys Ser
Asp Thr Lys Glu Thr 165 170 175Arg Arg Cys Thr Val Arg Arg Val Pro
Cys Pro Glu Gly Gln Lys Arg 180 185 190Arg Lys Gly Gly Gln Gly Arg
Arg Glu Asn Ala Asn Arg Asn Leu Ala 195 200 205Arg Lys Glu Ser Lys
Glu Ala Gly Ala Gly Ser Arg Arg Arg Lys Gly 210 215 220Gln Gln Gln
Gln Gln Gln Gln Gly Thr Val Gly Pro Leu Thr Ser Ala225 230 235
240Gly Pro Ala11696DNAHomo sapiensCDS(1)..(696) 11atc agt gcc gag
ggg agc cag gcc tgt gcc aaa ggc tgt gag ctc tgc 48Ile Ser Ala Glu
Gly Ser Gln Ala Cys Ala Lys Gly Cys Glu Leu Cys1 5 10 15tct gaa gtc
aac ggc tgc ctc aag tgc tca ccc aag ctg ttc atc ctg 96Ser Glu Val
Asn Gly Cys Leu Lys Cys Ser Pro Lys Leu Phe Ile Leu 20 25 30ctg gag
agg aac gac atc cgc cag gtg ggc gtc tgc ttg ccg tcc tgc 144Leu Glu
Arg Asn Asp Ile Arg Gln Val Gly Val Cys Leu Pro Ser Cys 35 40 45cca
cct gga tac ttc gac gcc cgc aac ccc gac atg aac aag tgc atc 192Pro
Pro Gly Tyr Phe Asp Ala Arg Asn Pro Asp Met Asn Lys Cys Ile 50 55
60aaa tgc aag atc gag cac tgt gag gcc tgc ttc agc cat aac ttc tgc
240Lys Cys Lys Ile Glu His Cys Glu Ala Cys Phe Ser His Asn Phe
Cys65 70 75 80acc aag tgt aag gag ggc ttg tac ctg cac aag ggc cgc
tgc tat cca 288Thr Lys Cys Lys Glu Gly Leu Tyr Leu His Lys Gly Arg
Cys Tyr Pro 85 90 95gct tgt ccc gag ggc tcc tca gct gcc aat ggc acc
atg gag tgc agt 336Ala Cys Pro Glu Gly Ser Ser Ala Ala Asn Gly Thr
Met Glu Cys Ser 100 105 110agt cct gcg caa tgt gaa atg agc gag tgg
tct ccg tgg ggg ccc tgc 384Ser Pro Ala Gln Cys Glu Met Ser Glu Trp
Ser Pro Trp Gly Pro Cys 115 120 125tcc aag aag cag cag ctc tgt ggt
ttc cgg agg ggc tcc gag gag cgg 432Ser Lys Lys Gln Gln Leu Cys Gly
Phe Arg Arg Gly Ser Glu Glu Arg 130 135 140aca cgc agg gtg cta cat
gcc cct gtg ggg gac cat gct gcc tgc tct 480Thr Arg Arg Val Leu His
Ala Pro Val Gly Asp His Ala Ala Cys Ser145 150 155 160gac acc aag
gag acc cgg agg tgc aca gtg agg aga gtg ccg tgt cct 528Asp Thr Lys
Glu Thr Arg Arg Cys Thr Val Arg Arg Val Pro Cys Pro 165 170 175gag
ggg cag aag agg agg aag gga ggc cag ggc cgg cgg gag aat gcc 576Glu
Gly Gln Lys Arg Arg Lys Gly Gly Gln Gly Arg Arg Glu Asn Ala 180 185
190aac agg aac ctg gcc agg aag gag agc aag gag gcg ggt gct ggc tct
624Asn Arg Asn Leu Ala Arg Lys Glu Ser Lys Glu Ala Gly Ala Gly Ser
195 200 205cga aga cgc aag ggg cag caa cag cag cag cag caa ggg aca
gtg ggg 672Arg Arg Arg Lys Gly Gln Gln Gln Gln Gln Gln Gln Gly Thr
Val Gly 210 215 220cca ctc aca tct gca ggg cct gcc 696Pro Leu Thr
Ser Ala Gly Pro Ala225 23012232PRTHomo sapiens 12Ile Ser Ala Glu
Gly Ser Gln Ala Cys Ala Lys Gly Cys Glu Leu Cys1 5 10 15Ser Glu Val
Asn Gly Cys Leu Lys Cys Ser Pro Lys Leu Phe Ile Leu 20 25
30Leu Glu Arg Asn Asp Ile Arg Gln Val Gly Val Cys Leu Pro Ser Cys
35 40 45Pro Pro Gly Tyr Phe Asp Ala Arg Asn Pro Asp Met Asn Lys Cys
Ile 50 55 60Lys Cys Lys Ile Glu His Cys Glu Ala Cys Phe Ser His Asn
Phe Cys65 70 75 80Thr Lys Cys Lys Glu Gly Leu Tyr Leu His Lys Gly
Arg Cys Tyr Pro 85 90 95Ala Cys Pro Glu Gly Ser Ser Ala Ala Asn Gly
Thr Met Glu Cys Ser 100 105 110Ser Pro Ala Gln Cys Glu Met Ser Glu
Trp Ser Pro Trp Gly Pro Cys 115 120 125Ser Lys Lys Gln Gln Leu Cys
Gly Phe Arg Arg Gly Ser Glu Glu Arg 130 135 140Thr Arg Arg Val Leu
His Ala Pro Val Gly Asp His Ala Ala Cys Ser145 150 155 160Asp Thr
Lys Glu Thr Arg Arg Cys Thr Val Arg Arg Val Pro Cys Pro 165 170
175Glu Gly Gln Lys Arg Arg Lys Gly Gly Gln Gly Arg Arg Glu Asn Ala
180 185 190Asn Arg Asn Leu Ala Arg Lys Glu Ser Lys Glu Ala Gly Ala
Gly Ser 195 200 205Arg Arg Arg Lys Gly Gln Gln Gln Gln Gln Gln Gln
Gly Thr Val Gly 210 215 220Pro Leu Thr Ser Ala Gly Pro Ala225
23013168DNAHomo sapiensCDS(1)..(168) 13agc gag tgg tct ccg tgg ggg
ccc tgc tcc aag aag cag cag ctc tgt 48Ser Glu Trp Ser Pro Trp Gly
Pro Cys Ser Lys Lys Gln Gln Leu Cys1 5 10 15ggt ttc cgg agg ggc tcc
gag gag cgg aca cgc agg gtg cta cat gcc 96Gly Phe Arg Arg Gly Ser
Glu Glu Arg Thr Arg Arg Val Leu His Ala 20 25 30cct gtg ggg gac cat
gct gcc tgc tct gac acc aag gag acc cgg agg 144Pro Val Gly Asp His
Ala Ala Cys Ser Asp Thr Lys Glu Thr Arg Arg 35 40 45tgc aca gtg agg
aga gtg ccg tgt 168Cys Thr Val Arg Arg Val Pro Cys 50 551456PRTHomo
sapiens 14Ser Glu Trp Ser Pro Trp Gly Pro Cys Ser Lys Lys Gln Gln
Leu Cys1 5 10 15Gly Phe Arg Arg Gly Ser Glu Glu Arg Thr Arg Arg Val
Leu His Ala 20 25 30Pro Val Gly Asp His Ala Ala Cys Ser Asp Thr Lys
Glu Thr Arg Arg 35 40 45Cys Thr Val Arg Arg Val Pro Cys 50
5515756DNAArtificial sequenceGIPF +sigP-furin 15atg cgg ctt ggg ctg
tgt gtg gtg gcc ctg gtt ctg agc tgg acg cac 48Met Arg Leu Gly Leu
Cys Val Val Ala Leu Val Leu Ser Trp Thr His1 5 10 15ctc acc atc agc
atc agt gcc gag ggg agc cag gcc tgt gcc aaa ggc 96Leu Thr Ile Ser
Ile Ser Ala Glu Gly Ser Gln Ala Cys Ala Lys Gly 20 25 30tgt gag ctc
tgc tct gaa gtc aac ggc tgc ctc aag tgc tca ccc aag 144Cys Glu Leu
Cys Ser Glu Val Asn Gly Cys Leu Lys Cys Ser Pro Lys 35 40 45ctg ttc
atc ctg ctg gag agg aac gac atc cgc cag gtg ggc gtc tgc 192Leu Phe
Ile Leu Leu Glu Arg Asn Asp Ile Arg Gln Val Gly Val Cys 50 55 60ttg
ccg tcc tgc cca cct gga tac ttc gac gcc cgc aac ccc gac atg 240Leu
Pro Ser Cys Pro Pro Gly Tyr Phe Asp Ala Arg Asn Pro Asp Met65 70 75
80aac aag tgc atc aaa tgc aag atc gag cac tgt gag gcc tgc ttc agc
288Asn Lys Cys Ile Lys Cys Lys Ile Glu His Cys Glu Ala Cys Phe Ser
85 90 95cat aac ttc tgc acc aag tgt aag gag ggc ttg tac ctg cac aag
ggc 336His Asn Phe Cys Thr Lys Cys Lys Glu Gly Leu Tyr Leu His Lys
Gly 100 105 110cgc tgc tat cca gct tgt ccc gag ggc tcc tca gct gcc
aat ggc acc 384Arg Cys Tyr Pro Ala Cys Pro Glu Gly Ser Ser Ala Ala
Asn Gly Thr 115 120 125atg gag tgc agt agt cct gcg caa tgt gaa atg
agc gag tgg tct ccg 432Met Glu Cys Ser Ser Pro Ala Gln Cys Glu Met
Ser Glu Trp Ser Pro 130 135 140tgg ggg ccc tgc tcc aag aag cag cag
ctc tgt ggt ttc cgg agg ggc 480Trp Gly Pro Cys Ser Lys Lys Gln Gln
Leu Cys Gly Phe Arg Arg Gly145 150 155 160tcc gag gag cgg aca cgc
agg gtg cta cat gcc cct gtg ggg gac cat 528Ser Glu Glu Arg Thr Arg
Arg Val Leu His Ala Pro Val Gly Asp His 165 170 175gct gcc tgc tct
gac acc aag gag acc cgg agg tgc aca gtg agg aga 576Ala Ala Cys Ser
Asp Thr Lys Glu Thr Arg Arg Cys Thr Val Arg Arg 180 185 190gtg ccg
tgt cct gag ggg cag aag agg agg aag gga ggc cag ggc cgg 624Val Pro
Cys Pro Glu Gly Gln Lys Arg Arg Lys Gly Gly Gln Gly Arg 195 200
205cgg gag aat gcc aac agg aac ctg gcc agg aag gag agc aag gag gcg
672Arg Glu Asn Ala Asn Arg Asn Leu Ala Arg Lys Glu Ser Lys Glu Ala
210 215 220ggt gct ggc tct cga aga cgc aag ggg cag caa cag cag cag
cag caa 720Gly Ala Gly Ser Arg Arg Arg Lys Gly Gln Gln Gln Gln Gln
Gln Gln225 230 235 240ggg aca gtg ggg cca ctc aca tct gca ggg cct
gcc 756Gly Thr Val Gly Pro Leu Thr Ser Ala Gly Pro Ala 245
25016252PRTArtificial sequenceSynthetic Construct 16Met Arg Leu Gly
Leu Cys Val Val Ala Leu Val Leu Ser Trp Thr His1 5 10 15Leu Thr Ile
Ser Ile Ser Ala Glu Gly Ser Gln Ala Cys Ala Lys Gly 20 25 30Cys Glu
Leu Cys Ser Glu Val Asn Gly Cys Leu Lys Cys Ser Pro Lys 35 40 45Leu
Phe Ile Leu Leu Glu Arg Asn Asp Ile Arg Gln Val Gly Val Cys 50 55
60Leu Pro Ser Cys Pro Pro Gly Tyr Phe Asp Ala Arg Asn Pro Asp Met65
70 75 80Asn Lys Cys Ile Lys Cys Lys Ile Glu His Cys Glu Ala Cys Phe
Ser 85 90 95His Asn Phe Cys Thr Lys Cys Lys Glu Gly Leu Tyr Leu His
Lys Gly 100 105 110Arg Cys Tyr Pro Ala Cys Pro Glu Gly Ser Ser Ala
Ala Asn Gly Thr 115 120 125Met Glu Cys Ser Ser Pro Ala Gln Cys Glu
Met Ser Glu Trp Ser Pro 130 135 140Trp Gly Pro Cys Ser Lys Lys Gln
Gln Leu Cys Gly Phe Arg Arg Gly145 150 155 160Ser Glu Glu Arg Thr
Arg Arg Val Leu His Ala Pro Val Gly Asp His 165 170 175Ala Ala Cys
Ser Asp Thr Lys Glu Thr Arg Arg Cys Thr Val Arg Arg 180 185 190Val
Pro Cys Pro Glu Gly Gln Lys Arg Arg Lys Gly Gly Gln Gly Arg 195 200
205Arg Glu Asn Ala Asn Arg Asn Leu Ala Arg Lys Glu Ser Lys Glu Ala
210 215 220Gly Ala Gly Ser Arg Arg Arg Lys Gly Gln Gln Gln Gln Gln
Gln Gln225 230 235 240Gly Thr Val Gly Pro Leu Thr Ser Ala Gly Pro
Ala 245 25017789DNAArtificial sequenceGIPF - mutated furin cleavage
site 17atg cgg ctt ggg ctg tgt gtg gtg gcc ctg gtt ctg agc tgg acg
cac 48Met Arg Leu Gly Leu Cys Val Val Ala Leu Val Leu Ser Trp Thr
His1 5 10 15ctc acc atc agc agc cgg ggg atc aag ggg aaa cag cag agg
cgg atc 96Leu Thr Ile Ser Ser Arg Gly Ile Lys Gly Lys Gln Gln Arg
Arg Ile 20 25 30agt gcc gag ggg agc cag gcc tgt gcc aaa ggc tgt gag
ctc tgc tct 144Ser Ala Glu Gly Ser Gln Ala Cys Ala Lys Gly Cys Glu
Leu Cys Ser 35 40 45gaa gtc aac ggc tgc ctc aag tgc tca ccc aag ctg
ttc atc ctg ctg 192Glu Val Asn Gly Cys Leu Lys Cys Ser Pro Lys Leu
Phe Ile Leu Leu 50 55 60gag agg aac gac atc cgc cag gtg ggc gtc tgc
ttg ccg tcc tgc cca 240Glu Arg Asn Asp Ile Arg Gln Val Gly Val Cys
Leu Pro Ser Cys Pro65 70 75 80cct gga tac ttc gac gcc cgc aac ccc
gac atg aac aag tgc atc aaa 288Pro Gly Tyr Phe Asp Ala Arg Asn Pro
Asp Met Asn Lys Cys Ile Lys 85 90 95tgc aag atc gag cac tgt gag gcc
tgc ttc agc cat aac ttc tgc acc 336Cys Lys Ile Glu His Cys Glu Ala
Cys Phe Ser His Asn Phe Cys Thr 100 105 110aag tgt aag gag ggc ttg
tac ctg cac aag ggc cgc tgc tat cca gct 384Lys Cys Lys Glu Gly Leu
Tyr Leu His Lys Gly Arg Cys Tyr Pro Ala 115 120 125tgt ccc gag ggc
tcc tca gct gcc aat ggc acc atg gag tgc agt agt 432Cys Pro Glu Gly
Ser Ser Ala Ala Asn Gly Thr Met Glu Cys Ser Ser 130 135 140cct gcg
caa tgt gaa atg agc gag tgg tct ccg tgg ggg ccc tgc tcc 480Pro Ala
Gln Cys Glu Met Ser Glu Trp Ser Pro Trp Gly Pro Cys Ser145 150 155
160aag aag cag cag ctc tgt ggt ttc cgg agg ggc tcc gag gag cgg aca
528Lys Lys Gln Gln Leu Cys Gly Phe Arg Arg Gly Ser Glu Glu Arg Thr
165 170 175cgc agg gtg cta cat gcc cct gtg ggg gac cat gct gcc tgc
tct gac 576Arg Arg Val Leu His Ala Pro Val Gly Asp His Ala Ala Cys
Ser Asp 180 185 190acc aag gag acc cgg agg tgc aca gtg agg aga gtg
ccg tgt cct gag 624Thr Lys Glu Thr Arg Arg Cys Thr Val Arg Arg Val
Pro Cys Pro Glu 195 200 205ggg cag aag agg agg aag gga ggc cag ggc
cgg cgg gag aat gcc aac 672Gly Gln Lys Arg Arg Lys Gly Gly Gln Gly
Arg Arg Glu Asn Ala Asn 210 215 220agg aac ctg gcc agg aag gag agc
aag gag gcg ggt gct ggc tct cga 720Arg Asn Leu Ala Arg Lys Glu Ser
Lys Glu Ala Gly Ala Gly Ser Arg225 230 235 240aga cgc aag ggg cag
caa cag cag cag cag caa ggg aca gtg ggg cca 768Arg Arg Lys Gly Gln
Gln Gln Gln Gln Gln Gln Gly Thr Val Gly Pro 245 250 255ctc aca tct
gca ggg cct gcc 789Leu Thr Ser Ala Gly Pro Ala
26018263PRTArtificial sequenceSynthetic Construct 18Met Arg Leu Gly
Leu Cys Val Val Ala Leu Val Leu Ser Trp Thr His1 5 10 15Leu Thr Ile
Ser Ser Arg Gly Ile Lys Gly Lys Gln Gln Arg Arg Ile 20 25 30Ser Ala
Glu Gly Ser Gln Ala Cys Ala Lys Gly Cys Glu Leu Cys Ser 35 40 45Glu
Val Asn Gly Cys Leu Lys Cys Ser Pro Lys Leu Phe Ile Leu Leu 50 55
60Glu Arg Asn Asp Ile Arg Gln Val Gly Val Cys Leu Pro Ser Cys Pro65
70 75 80Pro Gly Tyr Phe Asp Ala Arg Asn Pro Asp Met Asn Lys Cys Ile
Lys 85 90 95Cys Lys Ile Glu His Cys Glu Ala Cys Phe Ser His Asn Phe
Cys Thr 100 105 110Lys Cys Lys Glu Gly Leu Tyr Leu His Lys Gly Arg
Cys Tyr Pro Ala 115 120 125Cys Pro Glu Gly Ser Ser Ala Ala Asn Gly
Thr Met Glu Cys Ser Ser 130 135 140Pro Ala Gln Cys Glu Met Ser Glu
Trp Ser Pro Trp Gly Pro Cys Ser145 150 155 160Lys Lys Gln Gln Leu
Cys Gly Phe Arg Arg Gly Ser Glu Glu Arg Thr 165 170 175Arg Arg Val
Leu His Ala Pro Val Gly Asp His Ala Ala Cys Ser Asp 180 185 190Thr
Lys Glu Thr Arg Arg Cys Thr Val Arg Arg Val Pro Cys Pro Glu 195 200
205Gly Gln Lys Arg Arg Lys Gly Gly Gln Gly Arg Arg Glu Asn Ala Asn
210 215 220Arg Asn Leu Ala Arg Lys Glu Ser Lys Glu Ala Gly Ala Gly
Ser Arg225 230 235 240Arg Arg Lys Gly Gln Gln Gln Gln Gln Gln Gln
Gly Thr Val Gly Pro 245 250 255Leu Thr Ser Ala Gly Pro Ala
2601912DNAHomo sapiensCDS(1)..(12) 19agg cag agg cgg 12Arg Gln Arg
Arg1204PRTHomo sapiens 20Arg Gln Arg Arg12112DNAArtificial
sequencemutated furin protease cleavage site 21cag cag agg cgg
12Gln Gln Arg Arg1224PRTArtificial sequenceSynthetic Construct
22Gln Gln Arg Arg123272PRTHomo sapiens 23Met His Leu Arg Leu Ile
Ser Trp Leu Phe Ile Ile Leu Asn Phe Met1 5 10 15Glu Tyr Ile Gly Ser
Gln Asn Ala Ser Arg Gly Arg Arg Gln Arg Arg 20 25 30Met His Pro Asn
Val Ser Gln Gly Cys Gln Gly Gly Cys Ala Thr Cys 35 40 45Ser Asp Tyr
Asn Gly Cys Leu Ser Cys Lys Pro Arg Leu Phe Phe Ala 50 55 60Leu Glu
Arg Ile Gly Met Lys Gln Ile Gly Val Cys Leu Ser Ser Cys65 70 75
80Pro Ser Gly Tyr Tyr Gly Thr Arg Tyr Pro Asp Ile Asn Lys Cys Thr
85 90 95Lys Cys Lys Ala Asp Cys Asp Thr Cys Phe Asn Lys Asn Phe Cys
Thr 100 105 110Lys Cys Lys Ser Gly Phe Tyr Leu His Leu Gly Lys Cys
Leu Asp Asn 115 120 125Cys Pro Glu Gly Leu Glu Ala Asn Asn His Thr
Met Glu Cys Val Ser 130 135 140Ile Val His Cys Glu Val Ser Glu Trp
Asn Pro Trp Ser Pro Cys Thr145 150 155 160Lys Lys Gly Lys Thr Cys
Gly Phe Lys Arg Gly Thr Glu Thr Arg Val 165 170 175Arg Glu Ile Ile
Gln His Pro Ser Ala Lys Gly Asn Leu Cys Pro Pro 180 185 190Thr Asn
Glu Thr Arg Lys Cys Thr Val Gln Arg Lys Lys Cys Gln Lys 195 200
205Gly Glu Arg Gly Lys Lys Gly Arg Glu Arg Lys Arg Lys Lys Pro Asn
210 215 220Lys Gly Glu Ser Lys Glu Ala Ile Pro Asp Ser Lys Ser Leu
Glu Ser225 230 235 240Ser Lys Glu Ile Pro Glu Gln Arg Glu Asn Lys
Gln Gln Gln Lys Lys 245 250 255Arg Lys Val Gln Asp Lys Gln Lys Ser
Val Ser Val Ser Thr Val His 260 265 2702416PRTHomo sapiens 24Pro
Ala Gln Cys Glu Met Ser Glu Trp Ser Pro Trp Gly Pro Cys Ser1 5 10
152532PRTHomo sapiens 25Gly Lys Arg Gln Arg Arg Ile Ser Ala Glu Gly
Ser Gln Ala Cys Ala1 5 10 15Lys Gly Cys Glu Leu Cys Ser Glu Val Asn
Gly Cys Leu Lys Cys Ser 20 25 302617PRTHomo sapiens 26Ile Glu His
Cys Glu Ala Cys Phe Ser His Asn Phe Cys Thr Lys Cys1 5 10
15Lys274PRTHomo sapiens 27Asn Gly Thr Met1281170PRTHomo sapiens
28Met Gly Leu Ala Trp Gly Leu Gly Val Leu Phe Leu Met His Val Cys1
5 10 15Gly Thr Asn Arg Ile Pro Glu Ser Gly Gly Asp Asn Ser Val Phe
Asp 20 25 30Ile Phe Glu Leu Thr Gly Ala Ala Arg Lys Gly Ser Gly Arg
Arg Leu 35 40 45Val Lys Gly Pro Asp Pro Ser Ser Pro Ala Phe Arg Ile
Glu Asp Ala 50 55 60Asn Leu Ile Pro Pro Val Pro Asp Asp Lys Phe Gln
Asp Leu Val Asp65 70 75 80Ala Val Arg Thr Glu Lys Gly Phe Leu Leu
Leu Ala Ser Leu Arg Gln 85 90 95Met Lys Lys Thr Arg Gly Thr Leu Leu
Ala Leu Glu Arg Lys Asp His 100 105 110Ser Gly Gln Val Phe Ser Val
Val Ser Asn Gly Lys Ala Gly Thr Leu 115 120 125Asp Leu Ser Leu Thr
Val Gln Gly Lys Gln His Val Val Ser Val Glu 130 135 140Glu Ala Leu
Leu Ala Thr Gly Gln Trp Lys Ser Ile Thr Leu Phe Val145 150 155
160Gln Glu Asp Arg Ala Gln Leu Tyr Ile Asp Cys Glu Lys Met Glu Asn
165 170 175Ala Glu Leu Asp Val Pro Ile Gln Ser Val Phe Thr Arg Asp
Leu Ala 180 185 190Ser Ile Ala Arg Leu Arg Ile Ala Lys Gly Gly Val
Asn Asp Asn Phe 195 200 205Gln Gly Val Leu Gln Asn Val Arg Phe Val
Phe Gly Thr Thr Pro Glu 210 215 220Asp Ile Leu Arg Asn Lys Gly Cys
Ser Ser Ser Thr Ser Val Leu Leu225 230 235 240Thr Leu Asp Asn Asn
Val Val Asn Gly Ser Ser Pro Ala Ile Arg Thr 245 250 255Asn Tyr Ile
Gly His Lys Thr Lys Asp Leu Gln Ala Ile Cys Gly Ile 260 265 270Ser
Cys Asp Glu Leu Ser Ser Met Val Leu Glu Leu Arg Gly Leu Arg 275 280
285Thr Ile Val Thr Thr Leu Gln Asp Ser Ile Arg Lys Val Thr Glu Glu
290 295 300Asn Lys Glu Leu Ala Asn Glu Leu Arg Arg Pro Pro Leu Cys
Tyr His305 310 315 320Asn Gly Val Gln Tyr Arg Asn Asn Glu Glu Trp
Thr Val Asp Ser Cys
325 330 335Thr Glu Cys His Cys Gln Asn Ser Val Thr Ile Cys Lys Lys
Val Ser 340 345 350Cys Pro Ile Met Pro Cys Ser Asn Ala Thr Val Pro
Asp Gly Glu Cys 355 360 365Cys Pro Arg Cys Trp Pro Ser Asp Ser Ala
Asp Asp Gly Trp Ser Pro 370 375 380Trp Ser Glu Trp Thr Ser Cys Ser
Thr Ser Cys Gly Asn Gly Ile Gln385 390 395 400Gln Arg Gly Arg Ser
Cys Asp Ser Leu Asn Asn Arg Cys Glu Gly Ser 405 410 415Ser Val Gln
Thr Arg Thr Cys His Ile Gln Glu Cys Asp Lys Arg Phe 420 425 430Lys
Gln Asp Gly Gly Trp Ser His Trp Ser Pro Trp Ser Ser Cys Ser 435 440
445Val Thr Cys Gly Asp Gly Val Ile Thr Arg Ile Arg Leu Cys Asn Ser
450 455 460Pro Ser Pro Gln Met Asn Gly Lys Pro Cys Glu Gly Glu Ala
Arg Glu465 470 475 480Thr Lys Ala Cys Lys Lys Asp Ala Cys Pro Ile
Asn Gly Gly Trp Gly 485 490 495Pro Trp Ser Pro Trp Asp Ile Cys Ser
Val Thr Cys Gly Gly Gly Val 500 505 510Gln Lys Arg Ser Arg Leu Cys
Asn Asn Pro Thr Pro Gln Phe Gly Gly 515 520 525Lys Asp Cys Val Gly
Asp Val Thr Glu Asn Gln Ile Cys Asn Lys Gln 530 535 540Asp Cys Pro
Ile Asp Gly Cys Leu Ser Asn Pro Cys Phe Ala Gly Val545 550 555
560Lys Cys Thr Ser Tyr Pro Asp Gly Ser Trp Lys Cys Gly Ala Cys Pro
565 570 575Pro Gly Tyr Ser Gly Asn Gly Ile Gln Cys Thr Asp Val Asp
Glu Cys 580 585 590Lys Glu Val Pro Asp Ala Cys Phe Asn His Asn Gly
Glu His Arg Cys 595 600 605Glu Asn Thr Asp Pro Gly Tyr Asn Cys Leu
Pro Cys Pro Pro Arg Phe 610 615 620Thr Gly Ser Gln Pro Phe Gly Gln
Gly Val Glu His Ala Thr Ala Asn625 630 635 640Lys Gln Val Cys Lys
Pro Arg Asn Pro Cys Thr Asp Gly Thr His Asp 645 650 655Cys Asn Lys
Asn Ala Lys Cys Asn Tyr Leu Gly His Tyr Ser Asp Pro 660 665 670Met
Tyr Arg Cys Glu Cys Lys Pro Gly Tyr Ala Gly Asn Gly Ile Ile 675 680
685Cys Gly Glu Asp Thr Asp Leu Asp Gly Trp Pro Asn Glu Asn Leu Val
690 695 700Cys Val Ala Asn Ala Thr Tyr His Cys Lys Lys Asp Asn Cys
Pro Asn705 710 715 720Leu Pro Asn Ser Gly Gln Glu Asp Tyr Asp Lys
Asp Gly Ile Gly Asp 725 730 735Ala Cys Asp Asp Asp Asp Asp Asn Asp
Lys Ile Pro Asp Asp Arg Asp 740 745 750Asn Cys Pro Phe His Tyr Asn
Pro Ala Gln Tyr Asp Tyr Asp Arg Asp 755 760 765Asp Val Gly Asp Arg
Cys Asp Asn Cys Pro Tyr Asn His Asn Pro Asp 770 775 780Gln Ala Asp
Thr Asp Asn Asn Gly Glu Gly Asp Ala Cys Ala Ala Asp785 790 795
800Ile Asp Gly Asp Gly Ile Leu Asn Glu Arg Asp Asn Cys Gln Tyr Val
805 810 815Tyr Asn Val Asp Gln Arg Asp Thr Asp Met Asp Gly Val Gly
Asp Gln 820 825 830Cys Asp Asn Cys Pro Leu Glu His Asn Pro Asp Gln
Leu Asp Ser Asp 835 840 845Ser Asp Arg Ile Gly Asp Thr Cys Asp Asn
Asn Gln Asp Ile Asp Glu 850 855 860Asp Gly His Gln Asn Asn Leu Asp
Asn Cys Pro Tyr Val Pro Asn Ala865 870 875 880Asn Gln Ala Asp His
Asp Lys Asp Gly Lys Gly Asp Ala Cys Asp His 885 890 895Asp Asp Asp
Asn Asp Gly Ile Pro Asp Asp Lys Asp Asn Cys Arg Leu 900 905 910Val
Pro Asn Pro Asp Gln Lys Asp Ser Asp Gly Asp Gly Arg Gly Asp 915 920
925Ala Cys Lys Asp Asp Phe Asp His Asp Ser Val Pro Asp Ile Asp Asp
930 935 940Ile Cys Pro Glu Asn Val Asp Ile Ser Glu Thr Asp Phe Arg
Arg Phe945 950 955 960Gln Met Ile Pro Leu Asp Pro Lys Gly Thr Ser
Gln Asn Asp Pro Asn 965 970 975Trp Val Val Arg His Gln Gly Lys Glu
Leu Val Gln Thr Val Asn Cys 980 985 990Asp Pro Gly Leu Ala Val Gly
Tyr Asp Glu Phe Asn Ala Val Asp Phe 995 1000 1005Ser Gly Thr Phe
Phe Ile Asn Thr Glu Arg Asp Asp Asp Tyr Ala 1010 1015 1020Gly Phe
Val Phe Gly Tyr Gln Ser Ser Ser Arg Phe Tyr Val Val 1025 1030
1035Met Trp Lys Gln Val Thr Gln Ser Tyr Trp Asp Thr Asn Pro Thr
1040 1045 1050Arg Ala Gln Gly Tyr Ser Gly Leu Ser Val Lys Val Val
Asn Ser 1055 1060 1065Thr Thr Gly Pro Gly Glu His Leu Arg Asn Ala
Leu Trp His Thr 1070 1075 1080Gly Asn Thr Pro Gly Gln Val Arg Thr
Leu Trp His Asp Pro Arg 1085 1090 1095His Ile Gly Trp Lys Asp Phe
Thr Ala Tyr Arg Trp Arg Leu Ser 1100 1105 1110His Arg Pro Lys Thr
Gly Phe Ile Arg Val Val Met Tyr Glu Gly 1115 1120 1125Lys Lys Ile
Met Ala Asp Ser Gly Pro Ile Tyr Asp Lys Thr Tyr 1130 1135 1140Ala
Gly Gly Arg Leu Gly Leu Phe Val Phe Ser Gln Glu Met Val 1145 1150
1155Phe Phe Ser Asp Leu Lys Tyr Glu Cys Arg Asp Pro 1160 1165
11702923DNAArtificial sequenceforward primer 29gaccatgctg
cctgctctga cac 233020DNAArtificial sequencereverse primer
30cacccgcctc cttgctctcc 203122DNAArtificial sequenceforward primer
31gggggagacc acaccacctg ct 223224DNAArtificial sequencereverse
primer 32ttggacctcg gctccttgct gttc 24335495DNAMus
musculusmisc_feature(1)..(5495)n= G, A, T, or C 33cttatctttc
tcctttatta acggttgctg ttgtatccat aactcaattc caaaggatat 60aaaccttaac
atatagatat aattttgtgt accttctatg aaacagcatt aaagcaaaga
120agttcaaata gaaagactgg cttagttatt attaactaag agatgctagt
gagttctaaa 180ttaataccat ttaaaattta taatttgcag aattaccacc
accaccacca ctcagcccag 240gaaaagttac aaagaactgg ctgtaccatt
tgtttgtttt cctccttttt agagttcttt 300tatttatgtg tgagtgaatg
ccatgtactt gtggatgcag aggctgtcag attccttgca 360gctggagtaa
cagacagttg tgagctactt atagtactag aactaagatc ctatggaaga
420gcagcgagtg ccactaactg ctgagccacc tctccagccc atttctttat
ttttcaatga 480acaaataata agcagtccta tgtgacatgc ttctaaagca
aaagatataa tatttagtat 540tatatacatt aataataaaa tacattatct
tctaagaatt gaagtctcaa ctatgaaaat 600cagcagttct ctgtcagaga
agcccaagcg cttccacgca tgcttggaga gggggttaag 660ctttcgccta
cccactgctc tgttcctctt cagtgaggag ggtttttgta cagccagaca
720gtggagtact accactgtgg tggacgttcg gtggaggcac caagctggaa
atcaaacgta 780agtagaatcc aaagtctctt tcttccgttg tctatgtctg
tggcttctat gtctaaaaat 840gatgtataaa atcttactct gaaaccagat
tctggcactc tccaaggcaa agatacagag 900taactccgta agcaaagctg
ggaataggct agacatgttc tctggagaat gaatgccagt 960gtaataatta
acacaagtga tagtttcaga aatgctcaaa gaagcagggt agcctgccct
1020agacaaacct ttactcggtg ctcagaccat gctcagtttt tgtatggggg
ttgagtgaag 1080ggacaccagt gtgtgtacac gttcggaggg gggaccaagc
tggaaataaa acgtaagtag 1140tcttctcaac tcttgttcac taagtctaac
cttgttaagt tgttctttgt tgtgtgtttt 1200tcttaaggag atttcaggga
tttagcaaat tccattctca gatcaggtgt taaggaggga 1260aaactgtccc
acaagaggtt ggaatgattt tcaggctaaa ttttaggctt tctaaaccaa
1320agtaactaaa ctaggggaag agggataatt gtctacctag ggagggtttt
gtggaggtaa 1380agttaaaata aatcactgta aatcacattc agtgatggga
ccagactgga aataaaacct 1440aagtacattt ttgctcaact gcttgtgaag
ttttggtccc attgtgtcct ttgtatgagt 1500ttgtggtgta cattagataa
atgaactatt ccttgtaacc caaaacttaa atagaagaga 1560accaaaaatc
tagctactgt acaagctgag caaacagact gacctcatgt cagatttgtg
1620ggagaaatga gaaaggaaca gtttttctct gaacttagcc tatctaactg
gatcgcctca 1680ggcaggtttt tgtaaagggg ggcgcagtga tatgaatcac
tgtgattcac gttcggctcg 1740gggacaaagt tggaaataaa acgtaagtag
acttttgctc atttacttgt gacgttttgg 1800ttctgtttgg gtaacttgtg
tgaatttgtg acattttggc taaatgagcc attcctggca 1860acctgtgcat
caatagaaga tcccccagaa aagagtcagt gtgaaagctg agcgaaaaac
1920tcgtcttagg cttctgagac cagttttgta aggggaatgt agaagaaaga
gctgggcttt 1980tcctctgaat ttggcccatc tagttggact ggcttcacag
gcaggttttt gtagagaggg 2040gcatgtcata gtcctcactg tggctcacgt
tcggtgctgg gaccaagctg gagctgaaac 2100gtaagtacac ttttctcatc
tttttttatg tgtaagacac aggttttcat gttaggagtt 2160aaagtcagtt
cagaaaatct tgagaaaatg gagagggctc attatcagtt gacgtggcat
2220acagtgtcag attttctgtt tatcaagcta gtgagattag gggcaaaaag
aggctttagt 2280tgagaggaaa gtaattaata ctatggtcac catccaagag
attggatcgg agaataagca 2340tgagtagtta ttgagatctg ggtctgactg
caggtagcgt ggtcttctag acgtttaagt 2400gggagatttg gaggggatga
ggaatgaagg aacttcagga tagaaaaggg ctgaagtcaa 2460gttcagctcc
taaaatggat gtgggagcaa actttgaaga taaactgaat gacccagagg
2520atgaaacagc gcagatcaaa gaggggccta gagctctgag aagagaagga
gactcatccg 2580tgttgagttt ccacaagtac tgtcttgagt tttgcaataa
aagtgggata gcagagttga 2640gtgtnagccg tanagtatac tctcttttgt
ctcctaagat ttttatgact acaaaaatca 2700gtagtatgtc ctgaaataat
cattaagctg tttgaaagta tgactgcttg ccatgtagat 2760accatggctt
gctgaatgat cagaagaggt gtgactctta ttctaaaatt tgtcacaaaa
2820tgtcaaaatg agagactctg taggaacgag tcccttgaca gacagctgca
aggggttttt 2880ttcctttgtc tcatttctac atgaaagtaa atttgaaatg
atcntttttt attataagag 2940tagaaataca gttgggtttg aactatatgt
tttaatnggc cncacggttt tgtaagacat 3000ttggtccttt gttttcccag
ttattactcg attgtaattt tatatcgcca gcantggtct 3060gaaacggtnn
nnnncgcaac ctcttcgttt actaactggg tgaccttcgg ctgtgccagc
3120catttggcgt tcaccctgcc gcnggccnat gagaaccccc gcggtagnnc
ccttgctccg 3180cgggaaccac tttcctgagg acacagtgat aggaacagag
ccactaatct gaagagaaca 3240gagatgtgac agactacact aatgtgagaa
aaacaaggaa agggtgactt attggagatt 3300tcagaaataa aatgcattta
ttattatatt cccttattta atttctattg ggaattagaa 3360agggcataaa
ctgctttatc cagtgttata ttaaaagctt aatgtatata atcttttaga
3420ggtaaaatct acagccagca aaagtcatgg taaatattct ttgactgaac
tctcactaaa 3480ctcctctaaa ttatatgtca tattaactgg ttaaattaat
ataaatttgt gacatgacct 3540taactggtta ggtaggatat ttttcttcat
gcaaaaatat gactaataat aatttagcac 3600aaaaatattt cccaatactt
taattctgtg atagaaaaat gtttaactca gctactataa 3660tcccataatt
ttgaaaacta tttattagct tttgtgtttg acccttccct gccaaaggca
3720actatttaag gaccctttaa aactcttgaa actactttag agtcattaag
ttatttaacc 3780acttttaatt actttaaaat gatgtcaatt cccttttaac
tattaattta ttttaagggg 3840ggaaaggctg ctcataattc tattgttttt
cttggtaaag aactctcagt ttctgtttta 3900ctacctctgt cacccaagag
ttggcatctc aacagagggg actttccgag agccatctgg 3960cagttgctta
agatcagaag tgaagtctgc cagttcctcc taggcaggtg gcccagatta
4020cagttgacct gttctggtgt ggctaaaaat tgtcccatgt ggttacaaac
cattagacca 4080gggtctgatg aattgctcag aatatttctg gacacccaaa
tacagaccct ggcttaaggc 4140ctgtccatac agtaggttta gcttggctac
accaaaggaa gccatacaga ggctaatatc 4200agagtattct tggaagagac
aggagaaaat gaaagccagt ttctgctctt accttatgtg 4260cttgtgttca
gactcccaaa catcaggagt gtcagtaaac tggtctgaat ctctgtctga
4320agcatggaac tgaaaagaat gtagtttcag ggaagaaagg caatagaagg
aagcctgaga 4380atatcttcaa agggtcagac tcnnnaattt actttctaaa
gaagtagcta ggaactaggg 4440aataacttag aaacaacaag attgtatata
tgtgcatcct ggcccattgt tccttatctg 4500tagggataag cgtgcttttt
tgtgtgttgt atataacata actgtttaca cataatacac 4560tgaaatggag
cccttccttg ttacttcata ccatcctctg tgcttccttc ctcaggggct
4620gatgctgcac caactgtatc catcttccca ccatccagtg agcagttaac
atctggaggt 4680gcctcagtcg tgtgcttctt gaacaacttc taccccaaag
acatcaatgt caagtggaag 4740attgatggca gtgaacgaca aaatggcgtc
ctgaacagtt ggactgatca ggacagcaaa 4800gacagcacct acagcatgag
cagcaccctc acgttgacca aggacgagta tgaacgacat 4860aacagctata
cctgtgaggc cactcacaag acatcaactt cacccattgt caagagcttc
4920aacaggaatg agtgttagag acaaaggtcc tgagacgcca ccaccagctc
cccagctcca 4980tcctatcttc ccttctaagg tcttggaggc ttccccacaa
gcgacctacc actgttgcgg 5040tgctccaaac ctcctcccca cctccttctc
ctcctcctcc ctttccttgc cttttatcat 5100gctaatattt gcagaaaata
ttcaataaag tgagtctttg cacttgagat ctctgtcttt 5160cttactaaat
ggtagtaatc agttgttttt ccagttacct gggtttctct tctaaagaag
5220ttnaatgttt agttgccctg aaatccacca cacttaaagg ataaataaaa
ccctccactt 5280gccctggttg gctgtccact acatggcagt cctttctaag
gttcacgagt actattcatg 5340gcttatttct ctggccatgg taggtttgag
gaggcatacc tcctagtttt cttcccctaa 5400gtcgtcaaag tcctgaaggg
ggacagtctt tacaagcaca tgttctgnnc tgattcaacc 5460tacccagtaa
acttggcgaa gcagtagcat catta 54953438DNAArtificial sequenceforward
primer 34atctcgagga accactttcc tgaggacaca gtgatagg
383538DNAArtificial sequencereverse primer 35atgaattcct aacactcatt
cctgttgaag ctcttgac 383632DNAArtificial sequenceforward primer
36atgaattcag acaaaggtcc tgagacgcca cc 323742DNAArtificial
sequencereverse primer 37atggatcctc gagtcgactg gatttcaggg
caactaaaca tt 423832DNAArtificial sequenceforward primer
38atgaattcgc ccctctccct cccccccccc ta 323938DNAArtificial
sequencereverse primer 39atgaattcgt cgacttgtgg caagcttatc atcgtgtt
38408DNAArtificial sequenceoligonucleotide 40agtcgaca
84114DNAArtificial sequenceoligonucleotide 41aatttgtcga ctgc
1442798DNAMus musculus 42tggtgattat tcagagtagt tttagatgag
tgcatcttca tgaatctcca gcccatattc 60tcccatgtgt ttatcagtta agaactgact
agactctatc ttgctatttg catattacat 120tttcagtaac cacaaatatc
tcacagttgg tttatagcaa agtacttatg agaatagtag 180taattagcta
gggaccaaag ttcaaagaca aaatggattt tcaagtgcag attttcagct
240tcctgctaat cagtgcctca ggtaacagag ggcagggaat ttgagatcag
aatccaacca 300aaattatttt ccctggggaa tttgagtcta aaatacagtt
ttttcatttt ctttcatctg 360aatgttgggt ggtataaaat tatttttgta
tctctatttc tactaatccc tctctctcta 420ttttgctttt ttctagtcat
actgtccaga ggacaaattg ttctcaccca gtctccagca 480atcatgtctg
catctccagg ggagaaggtc accatgacct gcagtgccag ctcaagtgta
540agttacatgt actggtacca gcagaagcca ggatcctccc ccagactcct
gatttatgac 600acatccaacc tggcttctgg agtccctgtt cgcttcagtg
gcagtgggtc tgggacctct 660tactctctca caatcagccg aatggaggct
gaagatgctg ccacttatta ctgccagcag 720tggagtagtt acccacccac
acagtgatac agactggaac aaaaaccctc taagtcctta 780gggtctagct acttcctc
7984344DNAArtificial sequenceforward primer 43cccaagcttt ggtgattatt
cagagtagtt ttagatgagt gcat 444445DNAArtificial sequencereverse
primer 44acgcgtcgac tttgtctttg aactttggtc cctagctaat tacta
454563DNAArtificial sequenceforward primer 45acgcgtcgac gcggccggcc
gcgctagcag acaaaggtcc tgagacgcca ccaccagctc 60ccc
634643DNAArtificial sequencereverse primer 46gaagatctca agtgcaaaga
ctcactttat tgaatatttt ctg 434742DNAArtificial sequenceforward
primer 47ggaattcaga caaaggtcct gagacgccac caccagctcc cc
424843DNAArtificial sequencereverse primer 48ccaagcttgc ctcctcaaac
ctaccatggc ccagagaaat aag 434951DNAArtificial sequenceforward
primer 49ataagaatgc ggccgcctca gagcaaatgg gttctacagg cctaacaacc t
515044DNAArtificial sequencereverse primer 50ccggaattcc taacactcat
tcctgttgaa gctcttgaca atgg 445134DNAArtificial sequenceforward
primer 51acgcgtcgac ccacatgcgg cttgggctgt gtgt 345230DNAArtificial
sequencereverse primer 52acgcgtcgac gtcgacctag gcaggccctg
305320DNAArtificial sequenceforward primer 53ctgactagac tctatcttgc
205422DNAArtificial sequencereverse primer 54ccacggagac cactcgctca
tt 225528DNAArtificial sequenceforward primer 55cacccctagg
tcaatattgg ccattagc 285628DNAArtificial sequencereverse primer
56cacccctagg taggcatccc cagcatgc 285723DNAArtificial
sequenceforward primer 57caccatgcgg cttgggctgt ctc
235823DNAArtificial sequencereverse primer 58ggcaggccct gcagatgtga
gtg 235930DNAArtificial sequenceforward primer 59gatcaagggg
aaacagcaga ggcggatcag 306030DNAArtificial sequencereverse primer
60ctgatccgcc tctgctgttt ccccttgatc 306128DNAArtificial
sequenceforward primer 61caccgctagc ctcgagaatt cacgcgtg
286219DNAArtificial sequencereverse primer 62gctgatggtg aggtgcgtc
196321DNAArtificial sequenceforward primer 63atcagtgccg aggggagcca
g 216429DNAArtificial sequencereverse primer 64gccctctaga
gcggcaggcc ctgcagatg 296531DNAArtificial
sequenceforward primer 65ccggctagcc accatggcgc aatgtgaaat g
316630DNAArtificial sequencereverse primer 66ccatgcggcc gccctcctca
ctgtgcacct 306715PRTArtificial sequenceGIPF immunopeptide 67Glu Ser
Lys Glu Ala Gly Ala Gly Ser Arg Arg Arg Lys Gly Gln1 5 10
1568798DNAMus musculusCDS(61)..(795) 68atgcggcttg ggctgtgcgt
ggtggccctg gttctgagct ggacacacat cgccgtgggc 60agc cgg ggg atc aag
ggc aag aga cag agg cgg atc agt gct gag ggg 108Ser Arg Gly Ile Lys
Gly Lys Arg Gln Arg Arg Ile Ser Ala Glu Gly1 5 10 15agc caa gcc tgc
gcc aag ggc tgt gag ctc tgt tca gaa gtc aac ggt 156Ser Gln Ala Cys
Ala Lys Gly Cys Glu Leu Cys Ser Glu Val Asn Gly 20 25 30tgc ctc aag
tgc tcg ccc aag ctc ttc att ctg ctg gag agg aac gac 204Cys Leu Lys
Cys Ser Pro Lys Leu Phe Ile Leu Leu Glu Arg Asn Asp 35 40 45atc cgc
cag gtg ggc gtc tgc ctg ccg tcc tgc cca cct gga tac ttt 252Ile Arg
Gln Val Gly Val Cys Leu Pro Ser Cys Pro Pro Gly Tyr Phe 50 55 60gat
gcc cgc aac ccc gac atg aac aaa tgc atc aaa tgc aag atc gag 300Asp
Ala Arg Asn Pro Asp Met Asn Lys Cys Ile Lys Cys Lys Ile Glu65 70 75
80cac tgt gag gcc tgc ttc agc cac aac ttc tgc acc aag tgt cag gag
348His Cys Glu Ala Cys Phe Ser His Asn Phe Cys Thr Lys Cys Gln Glu
85 90 95gcc ttg tac tta cac aag ggc cgc tgc tat cca gcc tgc cct gag
ggc 396Ala Leu Tyr Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu
Gly 100 105 110tct aca gcc gct aac agc acc atg gag tgc ggc agt cct
gca caa tgt 444Ser Thr Ala Ala Asn Ser Thr Met Glu Cys Gly Ser Pro
Ala Gln Cys 115 120 125gaa atg agc gag tgg tcc ccg tgg gga ccc tgc
tcc aag aag agg aag 492Glu Met Ser Glu Trp Ser Pro Trp Gly Pro Cys
Ser Lys Lys Arg Lys 130 135 140ctg tgc ggt ttc cgg aag gga tcg gaa
gag cgg aca cgc aga gtg ctc 540Leu Cys Gly Phe Arg Lys Gly Ser Glu
Glu Arg Thr Arg Arg Val Leu145 150 155 160cat gct ccc ggg gga gac
cac acc acc tgc tcc gac acc aaa gag acc 588His Ala Pro Gly Gly Asp
His Thr Thr Cys Ser Asp Thr Lys Glu Thr 165 170 175cgc aag tgt acc
gtg cgc agg acg ccc tgc cca gag ggg cag aag agg 636Arg Lys Cys Thr
Val Arg Arg Thr Pro Cys Pro Glu Gly Gln Lys Arg 180 185 190agg aag
ggg ggc cag ggc cgg agg gag aat gcc aac agg cat ccg gcc 684Arg Lys
Gly Gly Gln Gly Arg Arg Glu Asn Ala Asn Arg His Pro Ala 195 200
205agg aag aac agc aag gag ccg agg tcc aac tct cgg aga cac aaa ggg
732Arg Lys Asn Ser Lys Glu Pro Arg Ser Asn Ser Arg Arg His Lys Gly
210 215 220caa cag cag cca cag cca ggg aca aca ggg cca ctc aca tca
gta gga 780Gln Gln Gln Pro Gln Pro Gly Thr Thr Gly Pro Leu Thr Ser
Val Gly225 230 235 240cct acc tgg gca cag tga 798Pro Thr Trp Ala
Gln 24569245PRTMus musculus 69Ser Arg Gly Ile Lys Gly Lys Arg Gln
Arg Arg Ile Ser Ala Glu Gly1 5 10 15Ser Gln Ala Cys Ala Lys Gly Cys
Glu Leu Cys Ser Glu Val Asn Gly 20 25 30Cys Leu Lys Cys Ser Pro Lys
Leu Phe Ile Leu Leu Glu Arg Asn Asp 35 40 45Ile Arg Gln Val Gly Val
Cys Leu Pro Ser Cys Pro Pro Gly Tyr Phe 50 55 60Asp Ala Arg Asn Pro
Asp Met Asn Lys Cys Ile Lys Cys Lys Ile Glu65 70 75 80His Cys Glu
Ala Cys Phe Ser His Asn Phe Cys Thr Lys Cys Gln Glu 85 90 95Ala Leu
Tyr Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu Gly 100 105
110Ser Thr Ala Ala Asn Ser Thr Met Glu Cys Gly Ser Pro Ala Gln Cys
115 120 125Glu Met Ser Glu Trp Ser Pro Trp Gly Pro Cys Ser Lys Lys
Arg Lys 130 135 140Leu Cys Gly Phe Arg Lys Gly Ser Glu Glu Arg Thr
Arg Arg Val Leu145 150 155 160His Ala Pro Gly Gly Asp His Thr Thr
Cys Ser Asp Thr Lys Glu Thr 165 170 175Arg Lys Cys Thr Val Arg Arg
Thr Pro Cys Pro Glu Gly Gln Lys Arg 180 185 190Arg Lys Gly Gly Gln
Gly Arg Arg Glu Asn Ala Asn Arg His Pro Ala 195 200 205Arg Lys Asn
Ser Lys Glu Pro Arg Ser Asn Ser Arg Arg His Lys Gly 210 215 220Gln
Gln Gln Pro Gln Pro Gly Thr Thr Gly Pro Leu Thr Ser Val Gly225 230
235 240Pro Thr Trp Ala Gln 2457019DNAArtificial sequenceforward
primer 70gtgtgaggtc cacggaaac 197120DNAArtificial sequencereverse
primer 71ggtgcaaaga catagccaga 207220DNAArtificial sequenceforward
primer 72gcaaacaaca caggggtgta 207320DNAArtificial sequencereverse
primer 73ggcaggtctg tgactgatgt 207420DNAArtificial sequenceforward
primer 74tatgcagaac tgcgatttcc 207522DNAArtificial sequencereverse
primer 75ccaatttgtc tcctatctgt gg 227619DNAArtificial
sequenceforward primer 76tgctccatga ggagacacc 197719DNAArtificial
sequencereverse primer 77cctgcctctt ttccacaga 197820DNAArtificial
sequenceforward primer 78caacgttccc ttcaagacac 207919DNAArtificial
sequencereverse primer 79cgcttgtcct cgttcatct 198020DNAArtificial
sequenceforward primer 80ctcaacaccg gaatttttga 208120DNAArtificial
sequencereverse primer 81aattgcattt cgaaggaagg 208223DNAArtificial
sequenceforward primer 82gtagattcgg gcaagtccac cac
238322DNAArtificial sequencereverse primer 83ttcccatctc agcagcctcc
tt 2284105DNAHomo sapiensCDS(1)..(105) 84agc cgg ggg atc aag ggg
aaa agg cag agg cgg atc agt gcc gag ggg 48Ser Arg Gly Ile Lys Gly
Lys Arg Gln Arg Arg Ile Ser Ala Glu Gly1 5 10 15agc cag gcc tgt gcc
aaa ggc tgt gag ctc tgc tct gaa gtc aac ggc 96Ser Gln Ala Cys Ala
Lys Gly Cys Glu Leu Cys Ser Glu Val Asn Gly 20 25 30tgc ctc aag
105Cys Leu Lys 358535PRTHomo sapiens 85Ser Arg Gly Ile Lys Gly Lys
Arg Gln Arg Arg Ile Ser Ala Glu Gly1 5 10 15Ser Gln Ala Cys Ala Lys
Gly Cys Glu Leu Cys Ser Glu Val Asn Gly 20 25 30Cys Leu Lys
3586180DNAHomo sapiensCDS(1)..(180) 86agc cgg ggg atc aag ggg aaa
agg cag agg cgg atc agt gcc gag ggg 48Ser Arg Gly Ile Lys Gly Lys
Arg Gln Arg Arg Ile Ser Ala Glu Gly1 5 10 15agc cag gcc tgt gcc aaa
ggc tgt gag ctc tgc tct gaa gtc aac ggc 96Ser Gln Ala Cys Ala Lys
Gly Cys Glu Leu Cys Ser Glu Val Asn Gly 20 25 30tgc ctc aag tgc tca
ccc aag ctg ttc atc ctg ctg gag agg aac gac 144Cys Leu Lys Cys Ser
Pro Lys Leu Phe Ile Leu Leu Glu Arg Asn Asp 35 40 45atc cgc cag gtg
ggc gtc tgc ttg ccg tcc tgc cca 180Ile Arg Gln Val Gly Val Cys Leu
Pro Ser Cys Pro 50 55 608760PRTHomo sapiens 87Ser Arg Gly Ile Lys
Gly Lys Arg Gln Arg Arg Ile Ser Ala Glu Gly1 5 10 15Ser Gln Ala Cys
Ala Lys Gly Cys Glu Leu Cys Ser Glu Val Asn Gly 20 25 30Cys Leu Lys
Cys Ser Pro Lys Leu Phe Ile Leu Leu Glu Arg Asn Asp 35 40 45Ile Arg
Gln Val Gly Val Cys Leu Pro Ser Cys Pro 50 55 6088270DNAHomo
sapiensCDS(1)..(270) 88agc cgg ggg atc aag ggg aaa agg cag agg cgg
atc agt gcc gag ggg 48Ser Arg Gly Ile Lys Gly Lys Arg Gln Arg Arg
Ile Ser Ala Glu Gly1 5 10 15agc cag gcc tgt gcc aaa ggc tgt gag ctc
tgc tct gaa gtc aac ggc 96Ser Gln Ala Cys Ala Lys Gly Cys Glu Leu
Cys Ser Glu Val Asn Gly 20 25 30tgc ctc aag tgc tca ccc aag ctg ttc
atc ctg ctg gag agg aac gac 144Cys Leu Lys Cys Ser Pro Lys Leu Phe
Ile Leu Leu Glu Arg Asn Asp 35 40 45atc cgc cag gtg ggc gtc tgc ttg
ccg tcc tgc cca cct gga tac ttc 192Ile Arg Gln Val Gly Val Cys Leu
Pro Ser Cys Pro Pro Gly Tyr Phe 50 55 60gac gcc cgc aac ccc gac atg
aac aag tgc atc aaa tgc aag atc gag 240Asp Ala Arg Asn Pro Asp Met
Asn Lys Cys Ile Lys Cys Lys Ile Glu65 70 75 80cac tgt gag gcc tgc
ttc agc cat aac ttc 270His Cys Glu Ala Cys Phe Ser His Asn Phe 85
908990PRTHomo sapiens 89Ser Arg Gly Ile Lys Gly Lys Arg Gln Arg Arg
Ile Ser Ala Glu Gly1 5 10 15Ser Gln Ala Cys Ala Lys Gly Cys Glu Leu
Cys Ser Glu Val Asn Gly 20 25 30Cys Leu Lys Cys Ser Pro Lys Leu Phe
Ile Leu Leu Glu Arg Asn Asp 35 40 45Ile Arg Gln Val Gly Val Cys Leu
Pro Ser Cys Pro Pro Gly Tyr Phe 50 55 60Asp Ala Arg Asn Pro Asp Met
Asn Lys Cys Ile Lys Cys Lys Ile Glu65 70 75 80His Cys Glu Ala Cys
Phe Ser His Asn Phe 85 9090360DNAHomo sapiensCDS(1)..(360) 90agc
cgg ggg atc aag ggg aaa agg cag agg cgg atc agt gcc gag ggg 48Ser
Arg Gly Ile Lys Gly Lys Arg Gln Arg Arg Ile Ser Ala Glu Gly1 5 10
15agc cag gcc tgt gcc aaa ggc tgt gag ctc tgc tct gaa gtc aac ggc
96Ser Gln Ala Cys Ala Lys Gly Cys Glu Leu Cys Ser Glu Val Asn Gly
20 25 30tgc ctc aag tgc tca ccc aag ctg ttc atc ctg ctg gag agg aac
gac 144Cys Leu Lys Cys Ser Pro Lys Leu Phe Ile Leu Leu Glu Arg Asn
Asp 35 40 45atc cgc cag gtg ggc gtc tgc ttg ccg tcc tgc cca cct gga
tac ttc 192Ile Arg Gln Val Gly Val Cys Leu Pro Ser Cys Pro Pro Gly
Tyr Phe 50 55 60gac gcc cgc aac ccc gac atg aac aag tgc atc aaa tgc
aag atc gag 240Asp Ala Arg Asn Pro Asp Met Asn Lys Cys Ile Lys Cys
Lys Ile Glu65 70 75 80cac tgt gag gcc tgc ttc agc cat aac ttc tgc
acc aag tgt aag gag 288His Cys Glu Ala Cys Phe Ser His Asn Phe Cys
Thr Lys Cys Lys Glu 85 90 95ggc ttg tac ctg cac aag ggc cgc tgc tat
cca gct tgt ccc gag ggc 336Gly Leu Tyr Leu His Lys Gly Arg Cys Tyr
Pro Ala Cys Pro Glu Gly 100 105 110tcc tca gct gcc aat ggc acc atg
360Ser Ser Ala Ala Asn Gly Thr Met 115 12091120PRTHomo sapiens
91Ser Arg Gly Ile Lys Gly Lys Arg Gln Arg Arg Ile Ser Ala Glu Gly1
5 10 15Ser Gln Ala Cys Ala Lys Gly Cys Glu Leu Cys Ser Glu Val Asn
Gly 20 25 30Cys Leu Lys Cys Ser Pro Lys Leu Phe Ile Leu Leu Glu Arg
Asn Asp 35 40 45Ile Arg Gln Val Gly Val Cys Leu Pro Ser Cys Pro Pro
Gly Tyr Phe 50 55 60Asp Ala Arg Asn Pro Asp Met Asn Lys Cys Ile Lys
Cys Lys Ile Glu65 70 75 80His Cys Glu Ala Cys Phe Ser His Asn Phe
Cys Thr Lys Cys Lys Glu 85 90 95Gly Leu Tyr Leu His Lys Gly Arg Cys
Tyr Pro Ala Cys Pro Glu Gly 100 105 110Ser Ser Ala Ala Asn Gly Thr
Met 115 12092450DNAHomo sapiensCDS(1)..(450) 92agc cgg ggg atc aag
ggg aaa agg cag agg cgg atc agt gcc gag ggg 48Ser Arg Gly Ile Lys
Gly Lys Arg Gln Arg Arg Ile Ser Ala Glu Gly1 5 10 15agc cag gcc tgt
gcc aaa ggc tgt gag ctc tgc tct gaa gtc aac ggc 96Ser Gln Ala Cys
Ala Lys Gly Cys Glu Leu Cys Ser Glu Val Asn Gly 20 25 30tgc ctc aag
tgc tca ccc aag ctg ttc atc ctg ctg gag agg aac gac 144Cys Leu Lys
Cys Ser Pro Lys Leu Phe Ile Leu Leu Glu Arg Asn Asp 35 40 45atc cgc
cag gtg ggc gtc tgc ttg ccg tcc tgc cca cct gga tac ttc 192Ile Arg
Gln Val Gly Val Cys Leu Pro Ser Cys Pro Pro Gly Tyr Phe 50 55 60gac
gcc cgc aac ccc gac atg aac aag tgc atc aaa tgc aag atc gag 240Asp
Ala Arg Asn Pro Asp Met Asn Lys Cys Ile Lys Cys Lys Ile Glu65 70 75
80cac tgt gag gcc tgc ttc agc cat aac ttc tgc acc aag tgt aag gag
288His Cys Glu Ala Cys Phe Ser His Asn Phe Cys Thr Lys Cys Lys Glu
85 90 95ggc ttg tac ctg cac aag ggc cgc tgc tat cca gct tgt ccc gag
ggc 336Gly Leu Tyr Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu
Gly 100 105 110tcc tca gct gcc aat ggc acc atg gag tgc agt agt cct
gcg caa tgt 384Ser Ser Ala Ala Asn Gly Thr Met Glu Cys Ser Ser Pro
Ala Gln Cys 115 120 125gaa atg agc gag tgg tct ccg tgg ggg ccc tgc
tcc aag aag cag cag 432Glu Met Ser Glu Trp Ser Pro Trp Gly Pro Cys
Ser Lys Lys Gln Gln 130 135 140ctc tgt ggt ttc cgg agg 450Leu Cys
Gly Phe Arg Arg145 15093150PRTHomo sapiens 93Ser Arg Gly Ile Lys
Gly Lys Arg Gln Arg Arg Ile Ser Ala Glu Gly1 5 10 15Ser Gln Ala Cys
Ala Lys Gly Cys Glu Leu Cys Ser Glu Val Asn Gly 20 25 30Cys Leu Lys
Cys Ser Pro Lys Leu Phe Ile Leu Leu Glu Arg Asn Asp 35 40 45Ile Arg
Gln Val Gly Val Cys Leu Pro Ser Cys Pro Pro Gly Tyr Phe 50 55 60Asp
Ala Arg Asn Pro Asp Met Asn Lys Cys Ile Lys Cys Lys Ile Glu65 70 75
80His Cys Glu Ala Cys Phe Ser His Asn Phe Cys Thr Lys Cys Lys Glu
85 90 95Gly Leu Tyr Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu
Gly 100 105 110Ser Ser Ala Ala Asn Gly Thr Met Glu Cys Ser Ser Pro
Ala Gln Cys 115 120 125Glu Met Ser Glu Trp Ser Pro Trp Gly Pro Cys
Ser Lys Lys Gln Gln 130 135 140Leu Cys Gly Phe Arg Arg145
15094540DNAHomo sapiensCDS(1)..(540) 94agc cgg ggg atc aag ggg aaa
agg cag agg cgg atc agt gcc gag ggg 48Ser Arg Gly Ile Lys Gly Lys
Arg Gln Arg Arg Ile Ser Ala Glu Gly1 5 10 15agc cag gcc tgt gcc aaa
ggc tgt gag ctc tgc tct gaa gtc aac ggc 96Ser Gln Ala Cys Ala Lys
Gly Cys Glu Leu Cys Ser Glu Val Asn Gly 20 25 30tgc ctc aag tgc tca
ccc aag ctg ttc atc ctg ctg gag agg aac gac 144Cys Leu Lys Cys Ser
Pro Lys Leu Phe Ile Leu Leu Glu Arg Asn Asp 35 40 45atc cgc cag gtg
ggc gtc tgc ttg ccg tcc tgc cca cct gga tac ttc 192Ile Arg Gln Val
Gly Val Cys Leu Pro Ser Cys Pro Pro Gly Tyr Phe 50 55 60gac gcc cgc
aac ccc gac atg aac aag tgc atc aaa tgc aag atc gag 240Asp Ala Arg
Asn Pro Asp Met Asn Lys Cys Ile Lys Cys Lys Ile Glu65 70 75 80cac
tgt gag gcc tgc ttc agc cat aac ttc tgc acc aag tgt aag gag 288His
Cys Glu Ala Cys Phe Ser His Asn Phe Cys Thr Lys Cys Lys Glu 85 90
95ggc ttg tac ctg cac aag ggc cgc tgc tat cca gct tgt ccc gag ggc
336Gly Leu Tyr Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu Gly
100 105 110tcc tca gct gcc aat ggc acc atg gag tgc agt agt cct gcg
caa tgt 384Ser Ser Ala Ala Asn Gly Thr Met Glu Cys Ser Ser Pro Ala
Gln Cys 115 120 125gaa atg agc gag tgg tct ccg tgg ggg ccc tgc tcc
aag aag cag cag 432Glu Met Ser Glu Trp Ser Pro Trp Gly Pro Cys Ser
Lys Lys Gln Gln 130 135 140ctc tgt ggt ttc cgg agg ggc tcc gag gag
cgg aca cgc agg gtg cta 480Leu Cys Gly Phe Arg Arg Gly Ser Glu Glu
Arg Thr Arg Arg Val Leu145 150 155 160cat gcc cct gtg ggg gac cat
gct gcc tgc tct gac acc aag gag acc 528His Ala Pro Val Gly Asp
His Ala Ala Cys Ser Asp Thr Lys Glu Thr 165 170 175cgg agg tgc aca
540Arg Arg Cys Thr 18095180PRTHomo sapiens 95Ser Arg Gly Ile Lys
Gly Lys Arg Gln Arg Arg Ile Ser Ala Glu Gly1 5 10 15Ser Gln Ala Cys
Ala Lys Gly Cys Glu Leu Cys Ser Glu Val Asn Gly 20 25 30Cys Leu Lys
Cys Ser Pro Lys Leu Phe Ile Leu Leu Glu Arg Asn Asp 35 40 45Ile Arg
Gln Val Gly Val Cys Leu Pro Ser Cys Pro Pro Gly Tyr Phe 50 55 60Asp
Ala Arg Asn Pro Asp Met Asn Lys Cys Ile Lys Cys Lys Ile Glu65 70 75
80His Cys Glu Ala Cys Phe Ser His Asn Phe Cys Thr Lys Cys Lys Glu
85 90 95Gly Leu Tyr Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu
Gly 100 105 110Ser Ser Ala Ala Asn Gly Thr Met Glu Cys Ser Ser Pro
Ala Gln Cys 115 120 125Glu Met Ser Glu Trp Ser Pro Trp Gly Pro Cys
Ser Lys Lys Gln Gln 130 135 140Leu Cys Gly Phe Arg Arg Gly Ser Glu
Glu Arg Thr Arg Arg Val Leu145 150 155 160His Ala Pro Val Gly Asp
His Ala Ala Cys Ser Asp Thr Lys Glu Thr 165 170 175Arg Arg Cys Thr
18096630DNAHomo sapiensCDS(1)..(630) 96agc cgg ggg atc aag ggg aaa
agg cag agg cgg atc agt gcc gag ggg 48Ser Arg Gly Ile Lys Gly Lys
Arg Gln Arg Arg Ile Ser Ala Glu Gly1 5 10 15agc cag gcc tgt gcc aaa
ggc tgt gag ctc tgc tct gaa gtc aac ggc 96Ser Gln Ala Cys Ala Lys
Gly Cys Glu Leu Cys Ser Glu Val Asn Gly 20 25 30tgc ctc aag tgc tca
ccc aag ctg ttc atc ctg ctg gag agg aac gac 144Cys Leu Lys Cys Ser
Pro Lys Leu Phe Ile Leu Leu Glu Arg Asn Asp 35 40 45atc cgc cag gtg
ggc gtc tgc ttg ccg tcc tgc cca cct gga tac ttc 192Ile Arg Gln Val
Gly Val Cys Leu Pro Ser Cys Pro Pro Gly Tyr Phe 50 55 60gac gcc cgc
aac ccc gac atg aac aag tgc atc aaa tgc aag atc gag 240Asp Ala Arg
Asn Pro Asp Met Asn Lys Cys Ile Lys Cys Lys Ile Glu65 70 75 80cac
tgt gag gcc tgc ttc agc cat aac ttc tgc acc aag tgt aag gag 288His
Cys Glu Ala Cys Phe Ser His Asn Phe Cys Thr Lys Cys Lys Glu 85 90
95ggc ttg tac ctg cac aag ggc cgc tgc tat cca gct tgt ccc gag ggc
336Gly Leu Tyr Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu Gly
100 105 110tcc tca gct gcc aat ggc acc atg gag tgc agt agt cct gcg
caa tgt 384Ser Ser Ala Ala Asn Gly Thr Met Glu Cys Ser Ser Pro Ala
Gln Cys 115 120 125gaa atg agc gag tgg tct ccg tgg ggg ccc tgc tcc
aag aag cag cag 432Glu Met Ser Glu Trp Ser Pro Trp Gly Pro Cys Ser
Lys Lys Gln Gln 130 135 140ctc tgt ggt ttc cgg agg ggc tcc gag gag
cgg aca cgc agg gtg cta 480Leu Cys Gly Phe Arg Arg Gly Ser Glu Glu
Arg Thr Arg Arg Val Leu145 150 155 160cat gcc cct gtg ggg gac cat
gct gcc tgc tct gac acc aag gag acc 528His Ala Pro Val Gly Asp His
Ala Ala Cys Ser Asp Thr Lys Glu Thr 165 170 175cgg agg tgc aca gtg
agg aga gtg ccg tgt cct gag ggg cag aag agg 576Arg Arg Cys Thr Val
Arg Arg Val Pro Cys Pro Glu Gly Gln Lys Arg 180 185 190agg aag gga
ggc cag ggc cgg cgg gag aat gcc aac agg aac ctg gcc 624Arg Lys Gly
Gly Gln Gly Arg Arg Glu Asn Ala Asn Arg Asn Leu Ala 195 200 205agg
aag 630Arg Lys 21097210PRTHomo sapiens 97Ser Arg Gly Ile Lys Gly
Lys Arg Gln Arg Arg Ile Ser Ala Glu Gly1 5 10 15Ser Gln Ala Cys Ala
Lys Gly Cys Glu Leu Cys Ser Glu Val Asn Gly 20 25 30Cys Leu Lys Cys
Ser Pro Lys Leu Phe Ile Leu Leu Glu Arg Asn Asp 35 40 45Ile Arg Gln
Val Gly Val Cys Leu Pro Ser Cys Pro Pro Gly Tyr Phe 50 55 60Asp Ala
Arg Asn Pro Asp Met Asn Lys Cys Ile Lys Cys Lys Ile Glu65 70 75
80His Cys Glu Ala Cys Phe Ser His Asn Phe Cys Thr Lys Cys Lys Glu
85 90 95Gly Leu Tyr Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu
Gly 100 105 110Ser Ser Ala Ala Asn Gly Thr Met Glu Cys Ser Ser Pro
Ala Gln Cys 115 120 125Glu Met Ser Glu Trp Ser Pro Trp Gly Pro Cys
Ser Lys Lys Gln Gln 130 135 140Leu Cys Gly Phe Arg Arg Gly Ser Glu
Glu Arg Thr Arg Arg Val Leu145 150 155 160His Ala Pro Val Gly Asp
His Ala Ala Cys Ser Asp Thr Lys Glu Thr 165 170 175Arg Arg Cys Thr
Val Arg Arg Val Pro Cys Pro Glu Gly Gln Lys Arg 180 185 190Arg Lys
Gly Gly Gln Gly Arg Arg Glu Asn Ala Asn Arg Asn Leu Ala 195 200
205Arg Lys 21098615DNAHomo sapiensCDS(1)..(615) 98aag ctg ttc atc
ctg ctg gag agg aac gac atc cgc cag gtg ggc gtc 48Lys Leu Phe Ile
Leu Leu Glu Arg Asn Asp Ile Arg Gln Val Gly Val1 5 10 15tgc ttg ccg
tcc tgc cca cct gga tac ttc gac gcc cgc aac ccc gac 96Cys Leu Pro
Ser Cys Pro Pro Gly Tyr Phe Asp Ala Arg Asn Pro Asp 20 25 30atg aac
aag tgc atc aaa tgc aag atc gag cac tgt gag gcc tgc ttc 144Met Asn
Lys Cys Ile Lys Cys Lys Ile Glu His Cys Glu Ala Cys Phe 35 40 45agc
cat aac ttc tgc acc aag tgt aag gag ggc ttg tac ctg cac aag 192Ser
His Asn Phe Cys Thr Lys Cys Lys Glu Gly Leu Tyr Leu His Lys 50 55
60ggc cgc tgc tat cca gct tgt ccc gag ggc tcc tca gct gcc aat ggc
240Gly Arg Cys Tyr Pro Ala Cys Pro Glu Gly Ser Ser Ala Ala Asn
Gly65 70 75 80acc atg gag tgc agt agt cct gcg caa tgt gaa atg agc
gag tgg tct 288Thr Met Glu Cys Ser Ser Pro Ala Gln Cys Glu Met Ser
Glu Trp Ser 85 90 95ccg tgg ggg ccc tgc tcc aag aag cag cag ctc tgt
ggt ttc cgg agg 336Pro Trp Gly Pro Cys Ser Lys Lys Gln Gln Leu Cys
Gly Phe Arg Arg 100 105 110ggc tcc gag gag cgg aca cgc agg gtg cta
cat gcc cct gtg ggg gac 384Gly Ser Glu Glu Arg Thr Arg Arg Val Leu
His Ala Pro Val Gly Asp 115 120 125cat gct gcc tgc tct gac acc aag
gag acc cgg agg tgc aca gtg agg 432His Ala Ala Cys Ser Asp Thr Lys
Glu Thr Arg Arg Cys Thr Val Arg 130 135 140aga gtg ccg tgt cct gag
ggg cag aag agg agg aag gga ggc cag ggc 480Arg Val Pro Cys Pro Glu
Gly Gln Lys Arg Arg Lys Gly Gly Gln Gly145 150 155 160cgg cgg gag
aat gcc aac agg aac ctg gcc agg aag gag agc aag gag 528Arg Arg Glu
Asn Ala Asn Arg Asn Leu Ala Arg Lys Glu Ser Lys Glu 165 170 175gcg
ggt gct ggc tct cga aga cgc aag ggg cag caa cag cag cag cag 576Ala
Gly Ala Gly Ser Arg Arg Arg Lys Gly Gln Gln Gln Gln Gln Gln 180 185
190caa ggg aca gtg ggg cca ctc aca tct gca ggg cct gcc 615Gln Gly
Thr Val Gly Pro Leu Thr Ser Ala Gly Pro Ala 195 200 20599205PRTHomo
sapiens 99Lys Leu Phe Ile Leu Leu Glu Arg Asn Asp Ile Arg Gln Val
Gly Val1 5 10 15Cys Leu Pro Ser Cys Pro Pro Gly Tyr Phe Asp Ala Arg
Asn Pro Asp 20 25 30Met Asn Lys Cys Ile Lys Cys Lys Ile Glu His Cys
Glu Ala Cys Phe 35 40 45Ser His Asn Phe Cys Thr Lys Cys Lys Glu Gly
Leu Tyr Leu His Lys 50 55 60Gly Arg Cys Tyr Pro Ala Cys Pro Glu Gly
Ser Ser Ala Ala Asn Gly65 70 75 80Thr Met Glu Cys Ser Ser Pro Ala
Gln Cys Glu Met Ser Glu Trp Ser 85 90 95Pro Trp Gly Pro Cys Ser Lys
Lys Gln Gln Leu Cys Gly Phe Arg Arg 100 105 110Gly Ser Glu Glu Arg
Thr Arg Arg Val Leu His Ala Pro Val Gly Asp 115 120 125His Ala Ala
Cys Ser Asp Thr Lys Glu Thr Arg Arg Cys Thr Val Arg 130 135 140Arg
Val Pro Cys Pro Glu Gly Gln Lys Arg Arg Lys Gly Gly Gln Gly145 150
155 160Arg Arg Glu Asn Ala Asn Arg Asn Leu Ala Arg Lys Glu Ser Lys
Glu 165 170 175Ala Gly Ala Gly Ser Arg Arg Arg Lys Gly Gln Gln Gln
Gln Gln Gln 180 185 190Gln Gly Thr Val Gly Pro Leu Thr Ser Ala Gly
Pro Ala 195 200 205100432DNAHomo sapiensCDS(1)..(432) 100ctg cac
aag ggc cgc tgc tat cca gct tgt ccc gag ggc tcc tca gct 48Leu His
Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu Gly Ser Ser Ala1 5 10 15gcc
aat ggc acc atg gag tgc agt agt cct gcg caa tgt gaa atg agc 96Ala
Asn Gly Thr Met Glu Cys Ser Ser Pro Ala Gln Cys Glu Met Ser 20 25
30gag tgg tct ccg tgg ggg ccc tgc tcc aag aag cag cag ctc tgt ggt
144Glu Trp Ser Pro Trp Gly Pro Cys Ser Lys Lys Gln Gln Leu Cys Gly
35 40 45ttc cgg agg ggc tcc gag gag cgg aca cgc agg gtg cta cat gcc
cct 192Phe Arg Arg Gly Ser Glu Glu Arg Thr Arg Arg Val Leu His Ala
Pro 50 55 60gtg ggg gac cat gct gcc tgc tct gac acc aag gag acc cgg
agg tgc 240Val Gly Asp His Ala Ala Cys Ser Asp Thr Lys Glu Thr Arg
Arg Cys65 70 75 80aca gtg agg aga gtg ccg tgt cct gag ggg cag aag
agg agg aag gga 288Thr Val Arg Arg Val Pro Cys Pro Glu Gly Gln Lys
Arg Arg Lys Gly 85 90 95ggc cag ggc cgg cgg gag aat gcc aac agg aac
ctg gcc agg aag gag 336Gly Gln Gly Arg Arg Glu Asn Ala Asn Arg Asn
Leu Ala Arg Lys Glu 100 105 110agc aag gag gcg ggt gct ggc tct cga
aga cgc aag ggg cag caa cag 384Ser Lys Glu Ala Gly Ala Gly Ser Arg
Arg Arg Lys Gly Gln Gln Gln 115 120 125cag cag cag caa ggg aca gtg
ggg cca ctc aca tct gca ggg cct gcc 432Gln Gln Gln Gln Gly Thr Val
Gly Pro Leu Thr Ser Ala Gly Pro Ala 130 135 140101144PRTHomo
sapiens 101Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu Gly Ser
Ser Ala1 5 10 15Ala Asn Gly Thr Met Glu Cys Ser Ser Pro Ala Gln Cys
Glu Met Ser 20 25 30Glu Trp Ser Pro Trp Gly Pro Cys Ser Lys Lys Gln
Gln Leu Cys Gly 35 40 45Phe Arg Arg Gly Ser Glu Glu Arg Thr Arg Arg
Val Leu His Ala Pro 50 55 60Val Gly Asp His Ala Ala Cys Ser Asp Thr
Lys Glu Thr Arg Arg Cys65 70 75 80Thr Val Arg Arg Val Pro Cys Pro
Glu Gly Gln Lys Arg Arg Lys Gly 85 90 95Gly Gln Gly Arg Arg Glu Asn
Ala Asn Arg Asn Leu Ala Arg Lys Glu 100 105 110Ser Lys Glu Ala Gly
Ala Gly Ser Arg Arg Arg Lys Gly Gln Gln Gln 115 120 125Gln Gln Gln
Gln Gly Thr Val Gly Pro Leu Thr Ser Ala Gly Pro Ala 130 135
140102366DNAHomo sapiensCDS(1)..(366) 102tgc agt agt cct gcg caa
tgt gaa atg agc gag tgg tct ccg tgg ggg 48Cys Ser Ser Pro Ala Gln
Cys Glu Met Ser Glu Trp Ser Pro Trp Gly1 5 10 15ccc tgc tcc aag aag
cag cag ctc tgt ggt ttc cgg agg ggc tcc gag 96Pro Cys Ser Lys Lys
Gln Gln Leu Cys Gly Phe Arg Arg Gly Ser Glu 20 25 30gag cgg aca cgc
agg gtg cta cat gcc cct gtg ggg gac cat gct gcc 144Glu Arg Thr Arg
Arg Val Leu His Ala Pro Val Gly Asp His Ala Ala 35 40 45tgc tct gac
acc aag gag acc cgg agg tgc aca gtg agg aga gtg ccg 192Cys Ser Asp
Thr Lys Glu Thr Arg Arg Cys Thr Val Arg Arg Val Pro 50 55 60tgt cct
gag ggg cag aag agg agg aag gga ggc cag ggc cgg cgg gag 240Cys Pro
Glu Gly Gln Lys Arg Arg Lys Gly Gly Gln Gly Arg Arg Glu65 70 75
80aat gcc aac agg aac ctg gcc agg aag gag agc aag gag gcg ggt gct
288Asn Ala Asn Arg Asn Leu Ala Arg Lys Glu Ser Lys Glu Ala Gly Ala
85 90 95ggc tct cga aga cgc aag ggg cag caa cag cag cag cag caa ggg
aca 336Gly Ser Arg Arg Arg Lys Gly Gln Gln Gln Gln Gln Gln Gln Gly
Thr 100 105 110gtg ggg cca ctc aca tct gca ggg cct gcc 366Val Gly
Pro Leu Thr Ser Ala Gly Pro Ala 115 120103122PRTHomo sapiens 103Cys
Ser Ser Pro Ala Gln Cys Glu Met Ser Glu Trp Ser Pro Trp Gly1 5 10
15Pro Cys Ser Lys Lys Gln Gln Leu Cys Gly Phe Arg Arg Gly Ser Glu
20 25 30Glu Arg Thr Arg Arg Val Leu His Ala Pro Val Gly Asp His Ala
Ala 35 40 45Cys Ser Asp Thr Lys Glu Thr Arg Arg Cys Thr Val Arg Arg
Val Pro 50 55 60Cys Pro Glu Gly Gln Lys Arg Arg Lys Gly Gly Gln Gly
Arg Arg Glu65 70 75 80Asn Ala Asn Arg Asn Leu Ala Arg Lys Glu Ser
Lys Glu Ala Gly Ala 85 90 95Gly Ser Arg Arg Arg Lys Gly Gln Gln Gln
Gln Gln Gln Gln Gly Thr 100 105 110Val Gly Pro Leu Thr Ser Ala Gly
Pro Ala 115 120104228DNAHomo sapiensCDS(1)..(228) 104cgc cag gtg
ggc gtc tgc ttg ccg tcc tgc cca cct gga tac ttc gac 48Arg Gln Val
Gly Val Cys Leu Pro Ser Cys Pro Pro Gly Tyr Phe Asp1 5 10 15gcc cgc
aac ccc gac atg aac aag tgc atc aaa tgc aag atc gag cac 96Ala Arg
Asn Pro Asp Met Asn Lys Cys Ile Lys Cys Lys Ile Glu His 20 25 30tgt
gag gcc tgc ttc agc cat aac ttc tgc acc aag tgt aag gag ggc 144Cys
Glu Ala Cys Phe Ser His Asn Phe Cys Thr Lys Cys Lys Glu Gly 35 40
45ttg tac ctg cac aag ggc cgc tgc tat cca gct tgt ccc gag ggc tcc
192Leu Tyr Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu Gly Ser
50 55 60tca gct gcc aat ggc acc atg gag tgc agt agt cct 228Ser Ala
Ala Asn Gly Thr Met Glu Cys Ser Ser Pro65 70 7510576PRTHomo sapiens
105Arg Gln Val Gly Val Cys Leu Pro Ser Cys Pro Pro Gly Tyr Phe Asp1
5 10 15Ala Arg Asn Pro Asp Met Asn Lys Cys Ile Lys Cys Lys Ile Glu
His 20 25 30Cys Glu Ala Cys Phe Ser His Asn Phe Cys Thr Lys Cys Lys
Glu Gly 35 40 45Leu Tyr Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro
Glu Gly Ser 50 55 60Ser Ala Ala Asn Gly Thr Met Glu Cys Ser Ser
Pro65 70 7510626DNAArtificial sequenceforward primer 106caccgctagc
agccggggga tcaagg 2610728DNAArtificial sequencereverse primer
107cacgcggccg ctcttgaggc agccgttg 2810829DNAArtificial
sequencereverse primer 108cacgcggccg cttgggcagg acggcaagc
2910931DNAArtificial sequencereverse primer 109cacgcggccg
ctgaagttat ggctgaagca g 3111030DNAArtificial sequencereverse primer
110cacgcggccg ctcatggtgc cattggcagc 3011130DNAArtificial
sequencereverse primer 111cacgcggccg ctcctccgga aaccacagag
3011230DNAArtificial sequencereverse primer 112cacgcggccg
cttgtgcacc tccgggtctc 3011329DNAArtificial sequencereverse primer
113cacgcggccg ctcttcctgg ccaggttcc 2911429DNAArtificial
sequenceforward primer 114caccgctagc aagctgttca tcctgctgg
2911529DNAArtificial sequencereverse primer 115cacgcggccg
ctggcaggcc ctgcagatg 2911627DNAArtificial sequenceforward primer
116caccgctagc ctgcacaagg gccgctg 2711727DNAArtificial
sequenceforward primer 117caccgctagc tgcagtagtc ctgcgca
2711827DNAArtificial sequenceforward primer 118caccgctagc
cgccaggtgg gcgtctg 2711929DNAArtificial sequencereverse primer
119cacgcggccg ctaggactac tgcactcca 2912024DNAArtificial
sequenceForward primer
120gatcagcagc tggaacaaac acag 2412125DNAArtificial sequenceReverse
primer 121tgcacaatca gtcaatcaac agagc 2512230DNAArtificial
sequenceoligonucleotide 122ggcggatccc tgagttggag gccagtttgg
3012339DNAArtificial sequenceoligonucleotide 123 123gctctagacc
atggtggacg agcctagagg agaaggcat 3912441DNAArtificial
sequenceForward primer 124ccgctcgagg catgcggctt gggctgtgtg
tggtggccct g 4112544DNAArtificial sequenceReverse primer
125gctctagaag atctctaggc aggccctgca gatgtgagtg gccc
4412619DNAArtificial sequenceOligonucleotide 126aattcggatc
cggcgcgcc 1912719DNAArtificial sequenceoligonucleotide
127gatcggcgcg ccggatccg 1912847DNAArtificial
sequenceoligonucleotide 128ggccgtttaa acataacttc gtataatgta
tgctatacga agttatc 4712947DNAArtificial sequenceoligonucleotide
129tcgagataac ttcgtatagc atacattata cgaagttatg tttaaac
4713041DNAforward primeroligonucleotide 130cgggatccgt ttaaacctgt
gccttctagt tgccagccat c 4113133DNAArtificial sequencereverse primer
131cggatatccc atagagccca ccgcatcccc agc 3313219DNAArtificial
sequenceoligonucleotide 132taaccgcgat cgcggccgg
1913317DNAArtificial sequenceoligonucleotide 133ccgcgatcgc ccttaat
1713420DNAArtificial sequenceforward primer 134ctaacgttac
tggccgaagc 2013525DNAArtificial sequencereverse primer
135attatcatcg tgtttttcaa aggaa 2513620DNAArtificial sequenceforward
primer 136gctctgacac caaggagacc 2013720DNAArtificial
sequencereverse primer 137ccctaggaat gctcgtcaag
2013818DNAArtificial sequenceforward primer 138caggagcctc acccttcg
1813918DNAArtificial sequencereverse primer 139acgccgaggt gcttgccc
1814025DNAArtificial sequenceforward primer 140caccatggag
aaggccgggg cccac 2514125DNAArtificial sequencereverse primer
141atcatacttg gcaggtttct ccagg 2514239DNAArtificial sequenceforward
primer 142cgggatcccc atggctcctc tcggatacct cttagtgct
3914341DNAArtificial sequencereverse primer 143gctctagagt
ttaaacctac ttgcaggtgt gcacgtcata g 4114428DNAArtificial
sequenceoligonucleotide 144tcgagtcgcg acaccggcgg gcgcgccc
2814528DNAArtificial sequenceoligonucleotide 145tcgagggcgc
gcccgccggt gtcgcgac 2814629DNAArtificial sequenceoligonucleotide
146ggccgcttaa ttaaggccgg ccgtcgacg 2914729DNAArtificial
sequenceoligonucleotide 147aattcgtcga cggccggcct taattaagc
2914842DNAArtificial sequenceforward primer 148ttggcgcgcc
ctccctagga ctgcagttga gctcagattt ga 4214944DNAArtificial
sequencereverse primer 149ccgctcgagt cttactgtct cagcaacaat
aatataaaca gggg 4415049DNAArtificial sequenceforward primer
150ataagaatgc ggccgcaaag ctggtgggtt aagactatct cgtgaagtg
4915145DNAArtificial sequencereverse primer 151acgcgtcgac
tcacaggttg gtccctctct gtgtgtggtt gctgt 4515225DNAArtificial
sequenceforward primer 152tcttactaga gttctcacta gctct
2515325DNAArtificial sequencereverse primer 153ggaaccaaag
aatgaggaag ctgtt 2515417DNAArtificial sequenceoligonucleotide
154ggccaggcgc gccttgc 1715517DNAArtificial sequenceolignucleotide
155ggccgcaagg cgcgcct 1715620DNAArtificial sequenceoligonucleotide
156taagggctag ctagggccgg 2015718DNAArtificial
sequenceoligonucleotide 157ccctagctag cccttaat 1815810DNAArtificial
sequenceoligonucleotide 158tcgagttaac 1015910DNAArtificial
sequenceoligonucleotide 159agctgttaac 1016027DNAArtificial
sequenceoligonucleotide 160agctgtcgac ttaattaagg ccggccg
2716127DNAArtificial sequenceoligonucleotide 161ctagcggccg
gccttaatta agtcgac 2716231DNAArtificial sequenceoligonucleotide
162tcgacttaat taaggccggc cctagctagc a 3116331DNAArtificial
sequenceoligonucleotide 163agcttgctag ctagggccgg ccttaattaa g
3116445DNAArtificial sequenceforward primer 164ccttaattaa
agttatgtgt cctagagggc tgcaaactca agatc 4516553DNAArtificial
sequencereverse primer 165ttggccggcc ttggcgccag tggaacctgg
aatgataaac acaaagatta ttg 5316633DNAArtificial sequenceforward
primer 166aagcgtcgac caccatgcgg cttgggctgt gtg 3316730DNAArtificial
sequencereverse primer 167atggccggcc ctacatggtg ccattggcag
3016830DNAArtificial sequenceforward primer 168agccggggga
tcaaggggaa aaggcagagg 3016930DNAArtificial sequencereverse primer
169atggccggcc ctacatggtg ccattggcag 3017034DNAArtificial
sequenceforward primer 170acgcgtcgac caccatgata ttccgagtca gtgc
3417135DNAArtificial sequencereverse primer 171ggccggccct
aggcaggccc tgcagatgtg agtgg 3517233DNAArtificial sequenceforward
primer 172atgatattcc gagtcagtgc cgaggggagc cag 3317335DNAArtificial
sequencereverse primer 173ggccggccct aggcaggccc tgcagatgtg agtgg
3517420DNAArtificial sequenceforward primer 174atcaagggga
aaaggcagag 2017525DNAArtificial sequencereverse primer
175cgcttgtggg gaagcctcca agacc 2517625DNAArtificial sequenceforward
primer 176ataacttctg caccaagtgt aagga 251772333DNAHomo
sapiensCDS(219)..(926) 177aggcgagccg ggcgcccagg acagtcccgc
agcgggcggg tgagcgggcc gcgccctcgc 60ccctcccggg cctgcccccg tcgcgactgg
cagcacgaag ctgagattgt ggtttcctgg 120tgattcaggt gggagtgggc
cagaagatca ccgctggcaa ggactgggtt ggtttttgga 180gtagtccctg
ctgacgtgac aaaaagatct ctcatatg ata ttc cga gtc agt gcc 236 Ile Phe
Arg Val Ser Ala 1 5gag ggg agc cag gcc tgt gcc aaa ggc tgt gag ctc
tgc tct gaa gtc 284Glu Gly Ser Gln Ala Cys Ala Lys Gly Cys Glu Leu
Cys Ser Glu Val 10 15 20aac ggc tgc ctc aag tgc tca ccc aag ctg ttc
atc ctg ctg gag agg 332Asn Gly Cys Leu Lys Cys Ser Pro Lys Leu Phe
Ile Leu Leu Glu Arg 25 30 35aac gac atc cgc cag gtg ggc gtc tgc ttg
ccg tcc tgc cca cct gga 380Asn Asp Ile Arg Gln Val Gly Val Cys Leu
Pro Ser Cys Pro Pro Gly 40 45 50tac ttc gac gcc cgc aac ccc gac atg
aac aag tgc atc aaa tgc aag 428Tyr Phe Asp Ala Arg Asn Pro Asp Met
Asn Lys Cys Ile Lys Cys Lys55 60 65 70atc gag cac tgt gag gcc tgc
ttc agc cat aac ttc tgc acc aag tgt 476Ile Glu His Cys Glu Ala Cys
Phe Ser His Asn Phe Cys Thr Lys Cys 75 80 85aag gag ggc ttg tac ctg
cac aag ggc cgc tgc tat cca gct tgt ccc 524Lys Glu Gly Leu Tyr Leu
His Lys Gly Arg Cys Tyr Pro Ala Cys Pro 90 95 100gag ggc tcc tca
gct gcc aat ggc acc atg gag tgc agt agt cct gcg 572Glu Gly Ser Ser
Ala Ala Asn Gly Thr Met Glu Cys Ser Ser Pro Ala 105 110 115caa tgt
gaa gtg agc gag tgg tct ccg tgg ggg ccc tgc tcc aag aag 620Gln Cys
Glu Val Ser Glu Trp Ser Pro Trp Gly Pro Cys Ser Lys Lys 120 125
130cag cag ctc tgt ggt ttc cgg agg ggc tcc gag gag cgg aca cgc agg
668Gln Gln Leu Cys Gly Phe Arg Arg Gly Ser Glu Glu Arg Thr Arg
Arg135 140 145 150gtg cta cat gcc cct gtg ggg gac cat gct gcc tgc
tct gac acc aag 716Val Leu His Ala Pro Val Gly Asp His Ala Ala Cys
Ser Asp Thr Lys 155 160 165gag acc cgg agg tgc aca gtg agg aga gtg
ccg tgt cct gag ggg cag 764Glu Thr Arg Arg Cys Thr Val Arg Arg Val
Pro Cys Pro Glu Gly Gln 170 175 180aag agg agg aag gga ggc cag ggc
cgg cgg gag aat gcc aac agg aac 812Lys Arg Arg Lys Gly Gly Gln Gly
Arg Arg Glu Asn Ala Asn Arg Asn 185 190 195ctg gcc agg aag gag agc
aag gag gcg ggt gct ggc tct cga aga cgc 860Leu Ala Arg Lys Glu Ser
Lys Glu Ala Gly Ala Gly Ser Arg Arg Arg 200 205 210aag ggg cag caa
cag cag cag cag caa ggg aca gtg ggg cca ctc aca 908Lys Gly Gln Gln
Gln Gln Gln Gln Gln Gly Thr Val Gly Pro Leu Thr215 220 225 230tct
gca ggg cct gcc tag ggacactgtc cagcctccag gcccatgcag 956Ser Ala Gly
Pro Ala 235aaagagttca gtgctactct gcgtgattca agctttcctg aactggaacg
tcgggggcaa 1016agcatacaca cacactccaa tccatccatg catacacaga
cacaagacac acacgctcaa 1076acccctgtcc acatatacaa ccatacatac
ttgcacatgt gtgttcatgt acacacgcag 1136acacagacac cacacacaca
catacacaca cacacacaca cacacacctg aggccaccag 1196aagacacttc
catccctcgg gcccagcagt acacacttgg tttccagagc tcccagtgga
1256catgtcagag acaacacttc ccagcatctg agaccaaact gcagagggga
gccttctgga 1316gaagctgctg ggatcggacc agccactgtg gcagatggga
gccaagcttg aggactgctg 1376gtgacctggg aagaaacctt cttcccatcc
tgttcagcac tcccagctgt gtgactttat 1436cgttggagag tattgttacc
cttccaggat acatatcagg gttaacctga ctttgaaaac 1496tgcttaaagg
tttatttcaa attaaaacaa aaaaatcaac gacagcagta gacacaggca
1556ccacattcct ttgcagggtg tgagggtttg gcgaggtatg cgtaggagca
agaagggaca 1616gggaatttca agagacccca aatagcctgc tcagtagagg
gtcatgcaga caaggaagaa 1676aacttagggg ctgctctgac ggtggtaaac
aggctgtcta tatccttgtt actcagagca 1736tggcccggca gcagtgttgt
cacagggcag cttgttagga atgagaatct caggtctcat 1796tccagacctg
gtgagccaga gtctaaattt taagattcct gatgattggc atgttaccca
1856aatttgagaa gtgctgctgt aattcccctt aaaggacggg agaaagggcc
ccggccatct 1916tgcagcagga gggattctgg tcagctataa aggaggactt
tccatctggg agaggcagaa 1976tctatatact gaagggctag tggcactgcc
aggggaaggg agtgcgtagg cttccagtga 2036tggttgggga caatcctgcc
caaaggcagg gcagtggatg gaataactcc ttgtggcatt 2096ctgaagtgtg
tgccaggctc tggactaggt gctaggtttc cagggaggag ccaaacacgg
2156gccttgctct tgtggagctt agaggttggt ggggaagaaa ataggcatgc
accaaggaat 2216cgtacaaaca catatataac tacaaaagga tggtgccaag
ggcaggtgac cactggcatc 2276tatgcttagc tatgaaagtg aataaagcag
aataaaaata aaatactttc tctcagg 2333178235PRTHomo sapiens 178Ile Phe
Arg Val Ser Ala Glu Gly Ser Gln Ala Cys Ala Lys Gly Cys1 5 10 15Glu
Leu Cys Ser Glu Val Asn Gly Cys Leu Lys Cys Ser Pro Lys Leu 20 25
30Phe Ile Leu Leu Glu Arg Asn Asp Ile Arg Gln Val Gly Val Cys Leu
35 40 45Pro Ser Cys Pro Pro Gly Tyr Phe Asp Ala Arg Asn Pro Asp Met
Asn 50 55 60Lys Cys Ile Lys Cys Lys Ile Glu His Cys Glu Ala Cys Phe
Ser His65 70 75 80Asn Phe Cys Thr Lys Cys Lys Glu Gly Leu Tyr Leu
His Lys Gly Arg 85 90 95Cys Tyr Pro Ala Cys Pro Glu Gly Ser Ser Ala
Ala Asn Gly Thr Met 100 105 110Glu Cys Ser Ser Pro Ala Gln Cys Glu
Val Ser Glu Trp Ser Pro Trp 115 120 125Gly Pro Cys Ser Lys Lys Gln
Gln Leu Cys Gly Phe Arg Arg Gly Ser 130 135 140Glu Glu Arg Thr Arg
Arg Val Leu His Ala Pro Val Gly Asp His Ala145 150 155 160Ala Cys
Ser Asp Thr Lys Glu Thr Arg Arg Cys Thr Val Arg Arg Val 165 170
175Pro Cys Pro Glu Gly Gln Lys Arg Arg Lys Gly Gly Gln Gly Arg Arg
180 185 190Glu Asn Ala Asn Arg Asn Leu Ala Arg Lys Glu Ser Lys Glu
Ala Gly 195 200 205Ala Gly Ser Arg Arg Arg Lys Gly Gln Gln Gln Gln
Gln Gln Gln Gly 210 215 220Thr Val Gly Pro Leu Thr Ser Ala Gly Pro
Ala225 230 235
* * * * *