U.S. patent application number 12/109615 was filed with the patent office on 2008-09-11 for telomerase promoter sequences for screening telomerase modulators.
This patent application is currently assigned to Geron Corporation. Invention is credited to Robert Adams, William H. Andrews, Serge Lichtsteiner, Gregg B. Morin, Alain Philippe Vasserot.
Application Number | 20080220438 12/109615 |
Document ID | / |
Family ID | 46324352 |
Filed Date | 2008-09-11 |
United States Patent
Application |
20080220438 |
Kind Code |
A1 |
Morin; Gregg B. ; et
al. |
September 11, 2008 |
Telomerase Promoter Sequences for Screening Telomerase
Modulators
Abstract
Telomerase reverse transcriptase is part of the telomerase
complex responsible for maintaining telomere length and increasing
the replicative capacity of progenitor cells. Telomerase activity
is turned off in mature differentiated cells, but is turned back on
again in hyperplastic diseases, including many cancers. This
disclosure provides regulatory elements that promote transcription
in cells that express telomerase reverse transcriptase (TERT). The
disclosure also provides systems using TERT promoter sequences for
identifying compounds that can be used to modulate telomerase
expression
Inventors: |
Morin; Gregg B.; (Vancouver,
CA) ; Lichtsteiner; Serge; (Encinitas, CA) ;
Vasserot; Alain Philippe; (Carlsbad, CA) ; Adams;
Robert; (Redwood City, CA) ; Andrews; William H.;
(Reno, NV) |
Correspondence
Address: |
GERON CORPORATION;Attn. David J. Earp
230 CONSTITUTION DRIVE
MENLO PARK
CA
94025
US
|
Assignee: |
Geron Corporation
|
Family ID: |
46324352 |
Appl. No.: |
12/109615 |
Filed: |
April 25, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11411604 |
Apr 25, 2006 |
7378244 |
|
|
12109615 |
|
|
|
|
09615039 |
Jul 11, 2000 |
|
|
|
11411604 |
|
|
|
|
PCT/US00/03104 |
Feb 4, 2000 |
|
|
|
09615039 |
|
|
|
|
09244438 |
Feb 4, 1999 |
6777203 |
|
|
PCT/US00/03104 |
|
|
|
|
10325810 |
Dec 20, 2002 |
7199234 |
|
|
09244438 |
|
|
|
|
09402181 |
Sep 29, 1999 |
6610839 |
|
|
PCT/US97/17885 |
Oct 1, 1997 |
|
|
|
10325810 |
|
|
|
|
Current U.S.
Class: |
435/6.18 |
Current CPC
Class: |
C12Q 2600/136 20130101;
C12Q 2600/158 20130101; C12Q 1/6886 20130101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method for identifying a compound that binds to human genomic
DNA upstream of the translation initiation site for telomerase
reverse transcriptase, comprising: a) combining a compound with a
polynucleotide comprising 15 or more consecutive nucleotides of
SEQ. ID NO:1 between residue 44 and residue 15375; and b)
determining if the compound binds said polynucleotide.
2. The method of claim 1, wherein said polynucleotide comprises 50
or more consecutive nucleotides of SEQ. ID NO:1 between the Alu
sequences and the translation initiation site (position 13545).
3. The method of claim 1, wherein said polynucleotide: a) comprises
the sequence from position -117 to position -36 relative to the
translation initiation site of SEQ. ID NO:1; b) comprises the
sequence from position -239 to position -36 relative to the
translation initiation site of SEQ. ID NO:1; c) comprises the
sequence from position -117 to position +1 relative to the
translation initiation site of SEQ. ID NO:1; d) comprises the
sequence from position -239 to position +1 relative to the
translation initiation site of SEQ. ID NO:1; or e) hybridizes with
a polynucleotide complementary to a sequence having feature a), b),
c), or d) under stringent conditions, and has the characteristic of
binding a compound that can modulate telomerase expression.
4. The method of claim 1, wherein said polynucleotide comprises a
binding site for c-Myc, c-Myb, SRY, HNF-3.beta., HNF-5, TFIID-MBP,
NF.kappa.B, or E2F.
5. The method of claim 1, wherein said polynucleotide comprises a
TATA box, a CAAT box, or an E box.
6. The method of claim 1, which is a method for screening compounds
that may modulate telomerase expression, wherein a compound that
binds to human genomic DNA upstream of the translation start codon
for telomerase reverse transcriptase is identified as capable of
modulating telomerase expression.
7. The method of claim 6, whereby a compound is identified that
enhances expression of telomerase reverse transcriptase.
8. The method of claim 6 whereby a compound is identified that
inhibits expression of telomerase reverse transcriptase.
9. The method of claim 1, which is a method for screening a protein
that binds a transcription recognition sequence within SEQ. ID
NO:1.
10. The method of claim 1, which is a method for screening on
oligonucleotide that hybridizes to a transcription recognition
sequence within SEQ. ID NO:1.
11. The method of claim 1, which is a high throughput method for
screening small molecule drugs for their ability to modulate
telomerase expression.
12. The method of claim 2, wherein said nucleotides of SEQ. ID NO:1
are operably linked to a heterologous reporter sequence such as
luciferase, .beta.-glucuronidase, .beta.-galactosidase,
chloramphenicol acetyl transferase, or green fluorescent
protein.
13. The method of claim 12, comprising measuring binding of the
compound to the polynucleotide by determining expression of said
reporter sequence in the presence and absence of the compound.
14. The method of claim 1, comprising measuring binding of the
compound using a promoter affinity column or by
immunoprecipitation.
15. The method of claim 1, comprising measuring binding of the
compound to the polynucleotide by UV or chemical crosslinking.
16. The method of claim 1, comprising measuring binding of the
compound to the polynucleotide by a mobility shift DNA binding
assay, a methylation or uracil interference assay, DNAse or
hydroxyl radical footprint analysis, or fluorescence
polarization.
17. A method of obtaining a compound for regulating transcription
of telomerase reverse transcriptase in a cell, comprising producing
a compound identified as being able to modulate telomerase
expression by way of the method of claim 6.
18. A polynucleotide for use in a screening method according to
claim 1, comprising 50 or more consecutive nucleotides of SEQ. ID
NO:1 between residue 44 and residue 15375, which can bind an
activator or inhibitor of the expression of human telomerase
reverse transcriptase.
19. The polynucleotide of claim 18, which comprises a recognition
element listed in Table 1.
20. The polynucleotide of claim 18, bound to an activator or
inhibitor of the expression of human telomerase reverse
transcriptase.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of U.S. Ser. No.
09/615,039, filed Jul. 11, 2000 (Geron docket 019/251c) (pending);
which is a continuation of PCT/US00/03104 filed Feb. 4, 2000
designating the U.S. and published on Aug. 10, 2000 as WO 00/46355
(Geron docket 019/250PCT); which is a continuation-in-part of U.S.
Ser. No. 09/244,438, filed Feb. 4, 1999 (Docket 019/246p) (now U.S.
Pat. No. 6,777,203). This application is also a
continuation-in-part of U.S. Ser. No. 10/325,810, filed Dec. 20,
2002 (Docket 082/003) (pending); which is a continuation of U.S.
Ser. No. 09/402,181 (Docket 018/206US) (now U.S. Pat. No.
6,610,839); which was the U.S. National Stage of PCT/US97/17885,
filed Oct. 1, 1997, and published as WO 98/14593 on Apr. 9, 1998
(Docket 018/204PCT1).
[0002] The afore-listed priority applications are hereby
incorporated herein by reference in their entirety.
BACKGROUND
[0003] It has long been recognized that complete replication of the
ends of eukaryotic chromosomes requires specialized cell components
(Watson (1972) Nature New Biol. 239:197; Olovnikov (1973) J. Theor.
Biol. 41:181). Replication of a linear DNA strand by conventional
DNA polymerases requires an RNA primer, and can proceed only 5' to
3'. When the RNA primer bound at the extreme 5' ends of eukaryotic
chromosomal DNA strands is removed, a gap is introduced, leading to
a progressive shortening of daughter strands with each round of
replication. This shortening of telomeres, the protein-DNA
structures physically located on the ends of chromosomes, is
thought to account for the phenomenon of cellular senescence or
aging of normal human somatic cells in vitro and in vivo (Goldstein
(1990) Science 249:1129; Martin (1979) Lab. Invest. 23:86;
Goldstein (1969) Proc. Natl. Acad. Sci. USA 64:155; Schneider
(1976) Proc. Natl. Acad. Sci. USA, 73:3584; Harley (1990) Nature
345:458-460; Hastie (1990) Nature 346:866-868; Counter (1992) EMBO
J. 11:1921-1929; Bodnar (1998) Science 279:349-52).
[0004] The length and integrity of telomeres is thus related to
entry of a cell into a senescent stage. Moreover, the ability of a
cell to maintain (or increase) telomere length may allow a cell to
escape senescence.
[0005] The maintenance of telomeres is a function of a specific DNA
polymerase known as telomerase reverse transcriptase (TERT).
Telomerase is a ribonucleoprotein (RNP) that uses a portion of its
RNA moiety as a template for telomere repeat DNA synthesis (Morin
(1997) Eur. J. Cancer 33:750). Consistent with the relationship of
telomeres and TERT to the proliferative capacity of a cell,
telomerase activity can be detected in highly replicative cell
types such as stem cells. It is also active in an extraordinarily
diverse set of tumor tissues, but is active in normal somatic cell
cultures or normal tissues adjacent to a tumor (U.S. Pat. Nos.
5,629,154; 5,489,508; 5,648,215; and 5,639,613; Morin (1989) Cell
59:521; Shay (1997) Eur. J. Cancer 33:787; Kim (1994) Science
266:2011). Moreover, a correlation between the level of telomerase
activity in a tumor and the likely clinical outcome of the patient
has been reported (U.S. Pat. No. 5,639,613; Langford (1997) Hum.
Pathol. 28:416).
[0006] Telomerase activity has also been detected in human germ
cells, proliferating stem or progenitor cells, and activated
lymphocytes. In somatic stem or progenitor cells, and in activated
lymphocytes, telomerase activity is typically either very low or
only transiently expressed (Chiu (1996) Stem Cells 14:239; Bodnar
(1996) Exp. Cell Res. 228:58; Taylor (1996) J. Invest. Dermatol.
106:759).
[0007] The preceding summary is intended to introduce the field of
the present invention to the reader. The cited references in this
application are not to be construed as admitted prior art.
SUMMARY OF THE INVENTION
[0008] This disclosure explains that telomerase reverse
transcriptase (TERT) is an ideal target for treating human diseases
relating to cellular proliferation and senescence, such as cancer.
The cis-acting transcriptional control elements of the this
invention enable identification of trans-acting transcription
control factors. The discovery and characterization of a promoter
specific for TERT expressing cells has provided an opportunity to
develop important new disease therapies.
[0009] An embodiment of the invention is an isolated, synthetic, or
recombinant polynucleotide comprising a promoter sequence. A
desirable feature of the promoter is that it preferentially
promotes transcription of the genetic element in cells expressing
TERT, such as cancer cells and other cells that can undergo
extensive replication, such as stem cells. In some cases, the
promoter sequence comprises about 15, 50, 100, 150, 200, 250, 500,
1000, 2500 or 13,000 bases in SEQ ID NO:1 or SEQ ID NO:2, or a
nucleic acid molecule that hybridizes to such a portion of SEQ ID
NO:1 or SEQ ID NO:2 under stringent conditions. Prototype promoter
polynucleotides are human telomerase reverse transcriptase (hTERT)
promoter or a mouse telomerase reverse transcriptase (mTERT)
promoter, and variants thereof with the desired cell specificity,
such as may be determined according to the reporter assays provided
in this invention. In some cases, the promoter is distinct from
SEQ. ID NO:6 of WO98/14593 (hTERT), or SEQ. ID NO:5 of WO99/27113
(mTERT), by virtue of sequence variation or increased length in the
promoter region. Any feature of upstream or intron sequence that
affects the rate of transcription in a particular cell can affect
performance of the promoter.
[0010] A number of exemplary recombinant plasmids are provided that
have the characteristic of preferentially promoting transcription
in cells expressing TERT. One example (pGRN175 or phTERT175) is a
promoter from position -117 to position -36, numbered from the
translation initiation site (base 13545) of SEQ. ID NO:1--i.e.,
bases 13428-13509 of SEQ. ID NO:1. Another example (pGRN176 or
phTERT176) is a promoter from position -239 to position -36,
numbered from the translation initiation site (base 13545) of SEQ.
ID NO:1--i.e., bases 13306-13509 of SEQ. ID NO:1. Other examples
include pGRN316, a promoter from position -239 to +1 (bases
13306-13545 of SEQ. ID NO:1) and pGRN 350, a promoter from position
-117 to +1 (bases 13428-13545 of SEQ. ID NO:1). Thus, preferential
promotion in cells expressing TERT can be attained with a minimal
promoter that is no longer than about 82 bases in length.
[0011] Transcriptional regulatory sequences have been discovered
within the promoters of this invention, which provide methods for
regulating transcription. In another embodiment of the invention,
transcription of an encoding region under control of a promoter is
regulated by modulating a transcriptional regulatory element within
the promoter. The transcriptional regulatory element is modulated
by a factor that binds the regulatory sequence, exemplified by SP1,
SRY, HNF-3.beta., HNF-5, TFIID-MBP, E2F c-Myb, and particularly
c-Myc, which (as shown in Example 8) can in some circumstances be
modulated using a ligand for the estrogen receptor. Since c-Myc
binds to a regulatory sequence known as an E box, another
embodiment of the invention is a method for expressing a
polynucleotide in a cell, comprising transducing the cell with a
vector in which the polynucleotide is operably linked to an hTERT
promoter comprising an E box, and then treating the cell to
increase binding of a transcriptional regulatory factor such as
c-Myc to the E box. The invention also provides a method for
identifying such transcriptional regulatory sequences and
trans-acting factors.
[0012] Another embodiment of this invention is a promoter that
preferentially promotes transcription in TERT expressing cells,
operably linked to an encoding sequence--for example, an encoding
region for TERT, or an encoding region that is heterologous to the
promoter, operably linked by way of genetic recombination. The
encoded protein can be of any nature. In one example, the encoded
protein can be a toxin, or a protein like Herpes virus thymidine
kinase that renders a cell more susceptible to toxic effects of a
drug. Other suitable toxins are given later in the disclosure. In
another example, the encoded protein can be a reporter gene
detectable by a signal such as fluorescence, phosphorescence, or
enzymatic activity.
[0013] An embodiment of this invention of particular interest is an
oncolytic virus having a genome in which a promoter is operably
linked to a genetic element essential for replication of the virus.
This includes genes involved in any stage of the replicative cycle,
including replication of the genome, assembly of intact viral
particles, and any other critical step. The promoter preferentially
promotes transcription of the genetic element in cells expressing
TERT, thereby promoting replication of the virus. Replication of
the virus in a cancer cell leads to lysis of the cancer cell. In
general, oncolytic viruses are useful for treatment of any disease
associated with expression of TERT in cells at the disease
site.
[0014] Replication-conditional viruses of this invention include
but are not limited to adenovirus of any subtype, wherein the
adenovirus E1a region is placed under control of a promoter of this
invention. Since a wide variety of cancer cells and some other
types of hyperplasias overexpress TERT, oncolytic adenovirus
replicates in affected cells, leading to their eradication. It is
readily appreciated that other aspects of this invention can be
incorporated into oncolytic viruses--such as an encoding region for
a toxin or other protein that would compromise viability of the
cancer cell. The viruses are selected by using candidate
oncoviruses to infect a cell or a plurality of cells expressing
TERT and not expressing TERT, and then choosing candidates on the
basis of whether they preferentially kill the cells expressing
TERT.
[0015] Other embodiments of the invention are polynucleotide
sequence fragments obtained upstream from the hTERT encoding
region, variants, homologs, and hybridizing polynucleotides. These
products are of interest in part for cis-acting regulatory
functions of transcription, including not only promoter activity,
but also repressor activity, the binding of trans-acting regulatory
factors, and other functions described in the disclosure. Further
embodiments of this invention include cells and organisms
introduced with the polynucleotides, vectors, and viruses of this
invention; methods of treating medical conditions associated with
elevated TERT expression, and pharmaceutical compositions for the
treatment of such conditions.
[0016] A further understanding of the nature and advantages of the
invention will be appreciated from the disclosure that follows.
DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1 is a restriction map of lambda phage clone
.lamda.G.phi.5, used for obtaining the sequence about 15 kilobases
upstream from the translation initiation site. This region includes
the hTERT promoter.
[0018] FIG. 2 is a map showing features of an hTERT
promoter-reporter plasmid, Reporter plasmids have been used to
demonstrate that the promoter specifically promotes transcription
in cells expressing TERT, including cancer cells.
[0019] FIG. 3 is a sequence alignment, comparing regions of the
hTERT promoter (SEQ. ID NO:1) with that of mTERT (SEQ. ID NO:2).
Regions of homology were used to identify regulatory elements. FIG.
3(A) shows the position of conserved cis-acting transcriptional
regulatory motifs, including the E-box (the Myc/Max binding site,
indicated by shading) and the SP1 sites (underlined). The lower
panel illustrates the proximal sequences of the 2.5 kb hTERT and
E-box reporter constructs, including the region deleted in the
E-box reporter construct, as described in Example 8. FIG. 3(B)
shows the identification of other regulatory elements. The
numbering shown is calculated from the translation initiation
site.
[0020] FIG. 4 is a half tone reproduction of cell lines
photographed 7 days after infection with oncolytic virus. Top row:
uninfected cells (negative control). Middle row: cells infected
with oncolytic adenovirus, in which replication gene E1a is
operably linked to the hTERT promoter. Bottom row: cells infected
with adenovirus in which E1a is operably linked to the CMV promoter
(positive control).
[0021] The cells tested were as follows: FIG. 4(A): BJ (foreskin
fibroblast); IMR-90 (lung fibroblast); WI-38 (lung fibroblast);
cells of non-malignant origin. FIG. 4(B): A549 (lung carcinoma)
AsPC-1 and BxPC-3: (adenocarcinoma, pancreas). FIG. 4(C): DAOY
(medulloblastoma); HeLa (cervical carcinoma); HT1080
(fibrosarcoma). The results show that the hTERT-regulated oncolytic
virus specifically lyses cancer cells, in preference to cell lines
that don't express telomerase reverse transcriptase at a
substantial level. This is in contrast to oncolytic virus regulated
by a constitutive promoter like CMV promoter, which lyses cells
non-specifically.
[0022] FIG. 5 is a series of maps showing construction of oncolytic
adenovirus, made conditionally replicative by placing the E1a
replication under control of an hTERT promoter. The first construct
comprises the Inverted Terminal Repeat (ITR) from the adenovirus
(Ad2); followed by the hTERT medium-length promoter (pGRN176)
operably linked to the adenovirus E1a region; followed by the rest
of the adenovirus deleted for the E3 region (.DELTA.E3). This
construct was used in the virus infection experiments shown in FIG.
4. The second conditionally replicative adenovirus construct shown
in the Figure comprises an additional sequence in between the hTERT
promoter and the E1a region. The HI sequence is an artificial
intron engineered from adenovirus and immunoglobulin intron splice
sequences. The third adenovirus construct is similar, except that
the E1a region used is longer at the 5' end by 51 nucleotides.
DETAILED DESCRIPTION
[0023] The invention provides novel isolated polynucleotides
comprising cis-acting transcriptional control sequences of
telomerase reverse transcriptase genes. The polynucleotides of the
invention include those based on or derived from genomic sequences
of untranscribed, transcribed and intron regions of TERT genes,
including the human and mouse homolog. Cis-acting TERT
transcriptional control sequences include those that regulate and
modulate timing and rates of transcription of the TERT gene. The
TERT promoter sequences of the invention include cis-acting
elements such as promoters, enhancers, repressors, and
polynucleotide sequences that can bind factors that influence
transcription.
Isolating and Characterizing Human TERT Promoter Sequences
[0024] As described in Example 1, the hTERT promoter (SEQ ID NO:1)
was obtained by sequencing an insert from a lambda phage isolated
from a human genomic library. This lambda clone is designated
.lamda.G.phi.5 and has been deposited at the ATCC, under Accession
No. 98505. Lambda G.theta.5 contains a 15.3 kilobase pair (kbp)
insert including approximately 13,500 bases upstream from the hTERT
coding sequence. These hTERT promoter sequences were further
subcloned into plasmids. A NotI fragment (SEQ ID NO:1) from
.lamda.G.phi.5 containing the hTERT promoter sequences was
subcloned in opposite orientations into the NotI site of pUC
derived plasmids (designated pGRN142 and pGRN143, respectively, and
pGRN142 was sequenced.
[0025] In SEQ ID NO:1, the hTERT genomic insert begins at residue
44 and ends at residue 15375. The start of the cDNA from which it
was derived begins at residue 13490. The hTERT ATG translation
initiation codon starts at residue 13545. Untranscribed hTERT
promoter sequences lie downstream of residue 44 and upstream of the
encoding region, and may also reside in the first Intron. In
immortal cells, a reporter gene driven by a sequence upstream of
the TERT coding sequence drove expression as efficiently as the
positive control (containing an SV40 early promoter and enhancer).
Certain TERT promoter sequences of the invention also include
intron sequences.
Identification of Cis-Acting Transcriptional Regulatory Sequences
in the Human and Mouse TERT Promoter
[0026] To identify cis-acting transcriptional regulatory sequences
in human TERT and mouse TERT sequences 5' to their respective TERT
coding sequence, the human and mouse promoter sequences were
analyzed for sequence identity. Alignment of the first 300 bases
upstream of the human and mouse coding sequences indicated a number
of conserved regions, and putative cis-acting transcriptional
regulatory sequences were identified (FIG. 3(A)).
[0027] In particular, located at residues -34 to -29 upstream of
the human TERT translation start site (ATG, A at 13545 of SEQ ID
NO: 1) and at residues -32 to -27 upstream of the mouse TERT
translation start site (ATG) are highly conserved motifs. They
correspond to a cis-acting motif known to interact with c-Myc, the
so-called "E-box" or "Myc/Max binding site." Specifically, they are
highly conserved with respect to the core nucleotides that comprise
the E-box, nucleotides flanking the E-box and position of the E-box
relative to the translation start site. A second E-box was
identified at residues -242 to -237 upstream of the human TERT
translation start site. This second E-box was not conserved in the
mouse promoter. These observations support the finding that the
conserved Myc binding site, by interacting with c-Myc as a
trans-acting transcriptional regulatory factor, plays a major role
in TERT promoter regulation and telomerase expression.
[0028] Sequence alignment identified additional conserved
cis-acting transcriptional regulatory elements in the TERT gene
promoter. For example, two SP1 binding sites, located at residue
-168 to -159 and residue -133 to -121 relative to the TERT
translation start site were identified, which are highly conserved
between the mouse and human TERT promoters. Binding sites
(cis-acting sequences) for a number of other transcription factors,
including the sex determining region Y gene product (SRY), hepatic
nuclear factors 3-.beta. and 5, TFIID-MBP, E2F and c-Myb were also
found within this region of both the mouse and human promoters.
[0029] Further analysis of the human and mouse TERT promoter
sequences indicated other regions of sequence conservation. In
particular, a region with a high degree of sequence identity
between human and mouse promoter was found between residue -1106
and residue -1602 upstream of the human TERT translation start site
and residue -916 and residue -1340 upstream of the mouse TERT
translation start site (FIG. 3(B)). Thus, the invention provides
cis-acting sequences specific for the modulation of TERT
transcription. In a preferred embodiment, the methods of the
invention use these human and mouse TERT-specific transcriptional
regulatory motifs to identify and isolate TERT-specific, and other,
trans-acting transcriptional regulatory factors.
[0030] The invention also provides the reagents and methods for
screening and isolating trans-acting TERT transcriptional
regulatory factors. Alternative embodiments include novel in vitro
and cell-based in vivo assay systems to screen for TERT promoter
binding agents (trans-acting TERT transcriptional regulatory
factors) using the nucleic acids of the invention.
c-Myc is a Potent Activator of TERT Gene Transcription
[0031] Use of recombinant constructs comprising TERT promoter
sequences of the invention has, for the first time, demonstrated
that c-Myc acts as a potent activator of telomerase activity by
direct interaction with cis-acting regulatory sequences in the TERT
promoter. c-Myc acts through the rapid up-regulation of hTERT gene
expression (Example 8). Significantly, the studies demonstrate that
transcriptional activation of the hTERT promoter by c-Myc can be
abrogated by deletion or mutation of a single cis-acting regulatory
sequence, the "Myc/Max binding site," within the hTERT promoter.
Furthermore, the ability of an inducible c-Myc to enhance
expression of hTERT is resistant to inhibition of protein
synthesis.
TERT Promoter Used to Drive Heterologous Gene Sequences
[0032] The invention also provides constructs in which the TERT
promoter sequences of the invention are operably linked to a
heterologous gene (in a preferred embodiment, a structural gene).
In this way the heterologous gene is transcribed in the same cells
at the same time the natural TERT transcript would be expressed.
Thus, when the construct is expressed in a transformed cell or
transgenic (non-human) animal, the heterologous gene (and protein,
if the gene is a coding sequence) is expressed in the same temporal
pattern over the same cell range as the wild type, TERT
promoter-driven TERT gene.
[0033] These constructs are useful for TERT promoter-based assays,
for example, to identify biological modulators of TERT and
telomerase activity. In alternative embodiments, the heterologous
coding sequence operably linked to a TERT promoter of the invention
is a marker gene (e.g., alkaline phosphatase, SEAP;
.beta.-galactosidase), a modified TERT structural gene or a TERT
antisense, a therapeutic gene (e.g., a cytotoxic gene such as
thymidine kinase).
[0034] In a further embodiment, cytopathic viruses are provided, in
particular human cytopathic viruses, such as modified adenovirus or
Herpes virus. Viruses, such as adenovirus or Herpes virus require
essential virally encoded genes to proliferate and lyse specific
cells. If any one of these essential viral genes were modified such
that expression of the essential element would be driven by the
TERT promoter, proliferation of the virus, and its cytopathic
effects, would be restricted to telomerase-expressing cells, in
particular tumor cells.
DEFINITIONS
[0035] The following terms are defined infra to provide additional
guidance to one of skill in the practice of the invention.
[0036] The term "amplifying" as used herein incorporates its common
usage and refers to the use of any suitable amplification
methodology for generating or detecting recombinant or naturally
expressed nucleic acid. For example, the invention provides methods
and reagents (including specific oligonucleotide PCR primer pairs)
for amplifying naturally expressed or recombinant nucleic acids of
the invention in vivo or in vitro. An indication that two
polynucleotides are "substantially identical" can be obtained by
amplifying one of the polynucleotides with a pair of
oligonucleotide primers or pool of degenerate primers (e.g.,
fragments of an TERT promoter sequence) and then using the product
as a probe under stringent hybridization conditions to isolate the
second sequence (e.g., the TERT promoter sequence) from a genomic
library or to identify the second sequence in a Northern or
Southern blot.
[0037] As used herein, the term "TERT promoter" includes any TERT
genomic sequences capable of driving transcription in telomerase
activity positive cells. Thus, TERT promoters of the invention
include without limitation cis-acting transcriptional control
elements and regulatory sequences that are involved in regulating
or modulating the timing and/or rate of transcription of a TERT
gene. For example, the TERT promoter of the invention comprises
cis-acting transcriptional control elements, including enhancers,
promoters, transcription terminators, origins of replication,
chromosomal integration sequences, 5' and 3' untranslated regions,
exons and introns, which are involved in transcriptional
regulation. These cis-acting sequences typically interact with
proteins or other biomolecules to carry out (turn on/off, regulate,
modulate, etc.) transcription.
[0038] One of skill in the art will appreciate that the hTERT and
mTERT promoter sequences provided herein are exemplary only, and
that they may be used as a basis to produce numerous versions of
TERT promoters, i.e., promoters that are capable of driving
transcription in telomerase activity positive cells. For example,
while it is shown herein that a sequence comprising 2447
nucleotides of the disclosed hTERT promoter can drive expression in
this manner (pGRN350), one of skill in the art will appreciate that
such activity may be obtained using longer or shorter promoter
sequences. Furthermore, one of skill in the art will appreciate
that promoter sequences that vary from those sequences provided
herein by, for example, nucleotide additions, deletions or
substitutions may also be used to obtain expression in telomerase
activity positive cells. Such variants will share a specified
minimum level of structural (sequence) similarity to the disclosed
TERT promoter sequences, which similarity may be defined in terms
of either sequence identity to the disclosed TERT promoter
sequences, or the ability to hybridize to the disclosed sequences
at specified levels of hybridization stringency. For example,
variant TERT promoters include promoters that hybridize to the TERT
promoters disclosed herein (at 37.degree. C. in a buffer of 40%
formamide, 1 M NaCl, and 1% SDS, followed by a wash in 1.times.SSC
at 45.degree. C.), and which are capable of driving transcription
in telomerase activity positive cells. Other variant TERT promoters
include promoters that share at least about 80%, 90%, 95%, 98% or
100% sequence identity with the disclosed TERT promoters. Sequence
identity is calculated by first aligning the polynucleotide being
examined with the reference counterpart, and then counting the
number of residues shared between the sequences being compared as a
percentage of the region under examination. No penalty is imposed
for the presence of insertions or deletions, but insertions or
deletions are permitted only where clearly required to readjust the
alignment. The percentage is given in terms of residues in the
sequence being examined that are identical to residues in the
comparison or reference sequence.
[0039] The determination that a promoter is capable of driving
transcription in telomerase activity positive cells can be
routinely performed as described in Examples 2 and 5. Briefly, the
promoter to be tested is operably linked to a coding region that
encodes a detectable protein such as alkaline phosphatase or green
fluorescent protein. This construct is then introduced into
telomerase activity positive (TAP) and telomerase activity negative
(TAN) cells. Detection of the detectable protein in the TAP cells
but not in the TAN cells, or of an elevated level of the detectable
protein in the TAP compared to the TAN cells (preferably at least a
three-fold difference) indicates that the promoter is a TERT
promoter.
[0040] A promoter is said to "preferentially promote transcription"
in a cell having a particular phenotype if the level of
transcription is at least about 3-fold higher in cells of that
phenotype than cells that lack the phenotype. Promoters of this
invention preferentially promote transcription in cells expressing
TERT, including diseased cells where the disease is associated with
overexpression of TERT, such as cancer. There is preferential
transcription if the relative increase in cells expressing the
stated phenotype is at least about 3-fold, 10-fold, 30-fold or
100-fold higher compared with cells that don't have the phenotype,
in order of increasing preference. Promoters that show lower levels
of specificity in an assay where just two types of cells are
compared may be tested using a larger panel. One skilled in the art
will know that TERT positive cells include various types of cancer
cells, various types of progenitor cells and stem cells, and under
certain conditions, B and T lymphocytes. Suitable negative controls
include primary cultures and established cell lines of mature
differentiated cells of most tissue types.
[0041] In alternative embodiments, the TERT promoter sequence
comprises TERT sequences upstream of the translation start site
(ATG), for example, in one embodiment, the hTERT promoter comprises
residues 44 to 13545 of SEQ ID NO:1. Other embodiments include
sequences starting within about one to 5 nucleotides of a
translation start codon (for example in SEQ ID NO:1 or SEQ ID NO:2)
and ending at about 50, 100, 150, 200, 250, 500, 1000, 2500 or
13500 nucleotides upstream of the translation start codon. Such
embodiments can optionally include other regulatory sequences, such
as, exon and/or intron sequences. Another embodiment includes TERT
intron sequences with regulatory activity, as described in Example
2. hTERT promoters of the invention also include sequences
substantially identical (as defined herein) to an exemplary hTERT
promoter sequence of the invention, having the sequence set forth
by SEQ ID NO:1. Similarly, mTERT promoters of the invention also
include sequences substantially identical to an exemplary mTERT
promoter sequence of the invention, having the sequence set forth
by SEQ ID NO:2.
[0042] The term "heterologous" when used with reference to portions
of a nucleic acid, indicates that the nucleic acid comprises two or
more subsequences which are not found in the same relationship to
each other in nature. For instance, the nucleic acid is typically
recombinantly produced, having two or more sequences from unrelated
genes arranged in a manner not found in nature; such as a promoter
sequence of the invention operably linked to a polypeptide coding
sequence that, when operably linked, does not reform the naturally
occurring TERT gene. For example, the invention provides
recombinant constructs (expression cassettes, vectors, viruses, and
the like) comprising various combinations of promoters of the
invention, or subsequences thereof, and heterologous coding
sequences.
[0043] As used herein, "isolated," when referring to a molecule or
composition, such as an hTERT promoter sequence, means that the
molecule or composition is separated from at least one other
compound, such as a protein, DNA, RNA, or other contaminants with
which it is associated in vivo or in its naturally occurring state.
Thus, a nucleic acid sequence is considered isolated when it has
been isolated from any other component with which it is naturally
associated. An isolated composition can, however, also be
substantially pure. An isolated composition can be in a homogeneous
state. It can be in a dry or an aqueous solution. Purity and
homogeneity can be determined by analytical chemistry techniques
such as polyacrylamide gel electrophoresis (PAGE), agarose gel
electrophoresis or high pressure liquid chromatography (HPLC).
[0044] As used herein, the terms "nucleic acid" and
"polynucleotide" are used interchangeably, and include
oligonucleotides. They also refer to synthetic and/or non-naturally
occurring nucleic acids (including nucleic acid analogues or
modified backbone residues or linkages). The terms also refer to
deoxyribonucleotide or ribonucleotide oligonucleotides in either
single- or double-stranded form. The terms encompass nucleic acids
containing known analogues of natural nucleotides. The term also
encompasses nucleic acid-like structures with synthetic backbones.
DNA backbone analogues provided by the invention include
phosphodiester, phosphorothioate, phosphorodithioate,
methyl-phosphonate, phosphoramidate, alkyl phosphotriester,
sulfamate, 3'-thioacetal, methylene (methylimino), 3'-N-carbamate,
morpholino carbamate, and peptide nucleic acids (PNAs); see
Oligonucleotides and Analogues, a Practical Approach, edited by F.
Eckstein, IRL Press at Oxford University Press (1991); Antisense
Strategies, Annals of the New York Academy of Sciences, Volume 600,
Eds. Baserga and Denhardt (NYAS 1992); Milligan (1993) J. Med.
Chem. 36:1923-1937; Antisense Research and Applications (1993, CRC
Press). PNAs contain non-ionic backbones, such as N-(2-aminoethyl)
glycine units. Phosphorothioate linkages are described in WO
97/03211; WO 96/39154; Mata (1997) Toxicol. Appi. Pharmacol.
144:189-197. Other synthetic backbones encompassed by the term
include methyl-phosphonate linkages or alternating
methylphosphonate and phosphodiester linkages (Strauss-Soukup
(1997) Biochemistry 36:8692-8698), and benzyl-phosphonate linkages
(Samstag (1996) Antisense Nucleic Acid Drug Dev 6:153-156).
[0045] As used herein, the term "operably linked" refers to a
functional relationship between two or more nucleic acid segments.
Typically, it refers to the functional relationship of a
transcriptional regulatory sequence to a transcribed sequence. For
example, a TERT promoter sequence of the invention, including any
combination of cis-acting transcriptional control elements, is
operably linked to a coding sequence if it stimulates or modulates
the transcription of the coding sequence in an appropriate host
cell or other expression system. Generally, promoter
transcriptional regulatory sequences that are operably linked to a
transcribed sequence are physically contiguous to the transcribed
sequence, i.e., they are cis-acting. However, some transcriptional
regulatory sequences, such as enhancers, need not be physically
contiguous or located in close proximity to the coding sequences
whose transcription they enhance.
[0046] As used herein, "recombinant" refers to a polynucleotide
synthesized or otherwise manipulated in vitro, to methods of using
recombinant polynucleotides to produce gene products in cells or
other biological systems, or to a polypeptide ("recombinant
protein") encoded by a recombinant polynucleotide. "Recombinant
means" also encompass the ligation of nucleic acids having coding
or promoter sequences from different sources into an expression
cassette or vector for expression of a fusion protein; or,
inducible, constitutive expression of a protein (for example, a
TERT promoter of the invention operably linked to a heterologous
nucleotide, such as a polypeptide coding sequence).
[0047] As used herein, the "sequence" of a gene (unless
specifically stated otherwise) or nucleic acid refers to the order
of nucleotides in the polynucleotide, including either or both
strands of a double-stranded DNA molecule--the sequence of both the
coding strand and its complement, or of a single-stranded nucleic
acid molecule. For example, in alternative embodiments, the
promoter of the invention comprises untranscribed, untranslated,
and intron TERT sequences, as set forth in the exemplary SEQ ID
NO:1 and SEQ ID NO:2.
[0048] As used herein, the term "transcribable sequence" refers to
any sequence which, when operably linked to a cis-acting
transcriptional control element, such as the TERT promoters of the
invention, and when placed in the appropriate conditions, is
capable of being transcribed to generate RNA.
[0049] The terms "identical" or percent "identity," in the context
of two or more nucleic acids or polypeptide sequences, refer to two
or more sequences or subsequences that are the same or have a
specified percentage of nucleotides (or amino acid residues) that
are the same, when compared and aligned for maximum correspondence
over a comparison window, as measured using one of the following
sequence comparison algorithms or by manual alignment and visual
inspection. This definition also refers to the complement of a
sequence. For example, in alternative embodiments, nucleic acids
within the scope of the invention include those with a nucleotide
sequence identity that is at least about 60%, at least about
75-80%, about 90%, and about 95% of the exemplary TERT promoter
sequence set forth in SEQ ID NO:1 (including residues 44 to 13544
of SEQ ID NO:1) or SEQ ID NO:2, and the intron TERT sequences
capable of driving a reporter gene in telomerase positive cells.
Two sequences with these levels of identity are "substantially
identical." Thus, if a sequence has the requisite sequence identity
to a TERT promoter sequence or subsequence of the invention, it
also is a TERT promoter sequence within the scope of the invention.
Preferably, the percent identity exists over a region of the
sequence that is at least about 25 nucleotides in length, more
preferably over a region that is at least about 50-100 nucleotides
in length.
[0050] For sequence comparison, typically one sequence acts as a
reference sequence, to which test sequences are compared. When
using a sequence comparison algorithm, test and reference sequences
are entered into a computer, subsequence coordinates are
designated, if necessary, and sequence algorithm program parameters
are designated. Default program parameters can be used, or
alternative parameters can be designated. The sequence comparison
algorithm then calculates the percent sequence identity for the
test sequence(s) relative to the reference sequence, based on the
designated or default program parameters. A "comparison window", as
used herein, includes reference to a segment of any one of the
number of contiguous positions selected from the group consisting
of from 25 to 600, usually about 50 to about 200, more usually
about 100 to about 150 in which a sequence may be compared to a
reference sequence of the same number of contiguous positions after
the two sequences are optimally aligned. Alignment of sequences can
be conducted by the local homology algorithm of Smith &
Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment
algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970),
by the search for similarity method of Pearson & Lipman, Proc.
Natl. Acad. Sci. USA 85:2444 (1988), by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package, Genetics
Computer Group, 575 Science Dr., Madison, Wis.), or by manual
alignment and visual inspection.
[0051] One example of a useful algorithm is PILEUP. PILEUP creates
a multiple sequence alignment from a group of related sequences
using progressive, pair-wise alignments to show relationship and
percent sequence identity. It also plots a tree or dendrogram,
showing the clustering relationships used to create the alignment.
PILEUP uses a simplification of the progressive alignment method of
Feng & Doolittle, J. Mol. Evol. 35:351-360 (1987). The method
used is similar to the method described by Higgins & Sharp,
CABIOS 5:151-153 (1989). The program can align up to 300 sequences,
each of a maximum length of 5,000 nucleotides or amino acids. The
multiple alignment procedure begins with the pair-wise alignment of
the two most similar sequences, producing a cluster of two aligned
sequences. This cluster is then aligned to the next most related
sequence or cluster of aligned sequences. Two clusters of sequences
are aligned by a simple extension of the pair-wise alignment of two
individual sequences. The final alignment is achieved by a series
of progressive, pair-wise alignments. The program is run by
designating specific sequences and their amino acid or nucleotide
coordinates for regions of sequence comparison and by designating
the program parameters. Using PILEUP, a reference sequence is
compared to another sequence to determine the percent sequence
identity relationship (whether the second sequence is substantially
identical and within the scope of the invention) using the
following parameters: default gap weight (3.00), default gap length
weight (0.10), and weighted end gaps. PILEUP can be obtained from
the GCG sequence analysis software package (Devereaux (1984) Nucl.
Acids Res. 12:387-395).
[0052] Another example of algorithm that is suitable for
determining percent sequence identity is the BLAST algorithm, which
is described in Altschul (1990) J. Mol. Biol. 215:403-410. Software
for performing BLAST analyses is publicly available through the
National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/). This algorithm involves first
identifying high scoring sequence pairs (HSPs) by identifying short
words of length W in the query sequence, which either match or
satisfy some positive-valued threshold score T when aligned with a
word of the same length in a database sequence. T is referred to as
the neighborhood word score threshold (Altschul (1990) supra).
These initial neighborhood word hits act as seeds for initiating
searches to find longer HSPs containing them. The word hits are
then extended in both directions along each sequence for as far as
the cumulative alignment score can be increased. Cumulative scores
are calculated using, for nucleotide sequences, the parameters M
(reward score for a pair of matching residues; always >0) and N
(penalty score for mismatching residues, always <0). For amino
acid sequences, a scoring matrix is used to calculate the
cumulative score. Extension of the word hits in each direction are
halted when: the cumulative alignment score falls off by the
quantity X from its maximum achieved value; the cumulative score
goes to zero or below, due to the accumulation of one or more
negative-scoring residue alignments; or the end of either sequence
is reached. The BLAST algorithm parameters W, T, and X determine
the sensitivity and speed of the alignment. In one embodiment, to
determine if a nucleic acid sequence is within the scope of the
invention, the BLASTN program (for nucleotide sequences) is used
incorporating as defaults a word-length (W) of 11, an expectation
(E) of 10, M=5, N=4, and a comparison of both strands. For amino
acid sequences, the BLASTP program uses as default parameters a
word-length (W) of 3, an expectation (E) of 10, and the BLOSUM62
scoring matrix (Henikoff (1989) Proc. Natl. Acad. Sci. USA
89:10915).
[0053] The BLAST algorithm also performs a statistical analysis of
the similarity between two sequences (Karlin (1993) Proc. Natl.
Acad. Sci. USA 90:5873-5787). One measure of similarity provided by
the BLAST algorithm is the smallest sum probability (P(N)), which
provides an indication of the probability by which a match between
two nucleotide or amino acid sequences would occur by chance. For
example, a nucleic acid is considered similar to a reference
sequence if the smallest sum probability in a comparison of the
test nucleic acid to the reference nucleic acid is less than about
0.1, more preferably less than about 0.01, and most preferably less
than about 0.001.
[0054] The phrase "selectively (or specifically) hybridizes to"
refers to the binding, duplexing, or hybridizing of a molecule to a
particular nucleotide sequence under stringent hybridization
conditions when that sequence is present in a complex mixture (such
as total cellular or library DNA or RNA), wherein the particular
nucleotide sequence is detected at least twice background,
preferably 10 times background. In one embodiment, a nucleic acid
can be determined to be within the scope of the invention according
to its ability to hybridize under stringent conditions to another
nucleic acid (such as the exemplary sequences described
herein).
[0055] The phrase "stringent hybridization conditions" refers to
conditions under which a probe will primarily hybridize to its
target subsequence, typically in a complex mixture of nucleic acid,
but to no other sequences. Stringent conditions are
sequence-dependent and will be different in different
circumstances, depending on the length of the probe. Longer
sequences hybridize specifically at higher temperatures. An
extensive guide to the hybridization of nucleic acids is found in
Tijssen, Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Probes, "Overview of principles
of hybridization and the strategy of nucleic acid assays" (1993).
Generally, stringent conditions are selected to be about
5-10.degree. C. lower than the thermal melting point (Tm) for the
specific sequence at a defined ionic strength and pH. The Tm is the
temperature (under defined ionic strength, pH, and nucleic
concentration) at which 50% of the probes complementary to the
target hybridize to the target sequence at equilibrium (as the
target sequences are present in excess, at Tm, 50% of the probes
are occupied at equilibrium). Stringent conditions will be those in
which the salt concentration is less than about 1.0 M sodium ion,
typically about 0.01 to 1.0 M sodium ion concentration (or other
salts) at pH 7.0 to 8.3 and the temperature is at least about
30.degree. C. for short probes (.about.10 to about 50 nucleotides)
and at least about 60.degree. C. for long probes (greater than
about 50 nucleotides). Stringent conditions may also be achieved
with the addition of destabilizing agents such as formamide. For
selective or specific hybridization, a positive signal
(identification of a nucleic acid of the invention) is about 5-10
times background hybridization. "Stringent" hybridization
conditions that are used to identify substantially identical
nucleic acids within the scope of the invention include
hybridization in a buffer comprising 50% formamide, 5.times.SSC,
and 1% SDS at 42.degree. C., or hybridization in a buffer
comprising 5.times.SSC and 1% SDS at 65.degree. C., both with a
wash of 0.2.times.SSC and 0.1% SDS at 65.degree. C., for long
probes. For short probes, stringent hybridization conditions
include hybridization in a buffer comprising 50% formamide,
5.times.SSC and 1% SDS at room temperature or hybridization in a
buffer comprising 5.times.SSC and 1% SDS at 37.degree.
C.-42.degree. C., both with a wash of 0.2.times.SSC and 0.1% SDS at
37.degree. C.-42.degree. C. However, as is apparent to one of
ordinary skill in the art, hybridization conditions can be modified
depending on sequence composition. Moderately stringent
hybridization conditions include a hybridization in a buffer of 40%
formamide, 1 M NaCl, and 1% SDS at 37.degree. C., and a wash in
1.times.SSC at 45.degree. C. A positive hybridization is at least
twice background. Those of ordinary skill will readily recognize
that alternative hybridization and wash conditions can be utilized
to provide conditions of similar stringency.
General Techniques
[0056] The TERT promoter sequences of the invention and nucleic
acids used to practice this invention, whether RNA, cDNA, genomic
DNA, or hybrids thereof, may be isolated from a variety of sources,
genetically engineered, amplified, and/or expressed recombinantly.
Any recombinant expression system can be used, including,
bacterial, yeast, insect or mammalian systems. Alternatively, these
nucleic acids can be chemically synthesized in vitro. Techniques
for the manipulation of nucleic acids, such as subcloning into
expression vectors, labeling probes, sequencing, and hybridization
are well described in the scientific and patent literature.
Molecular Cloning: A Laboratory Manual (2nd Ed.), Vols. 1-3, Cold
Spring Harbor Laboratory, (1989) ("Sambrook"); Current Protocols In
Molecular Biology, Ausubel, Ed. John Wiley & Sons, Inc., New
York (1997) ("Ausubel"); Laboratory Techniques In Biochemistry And
Molecular Biology Hybridization With Nucleic Acid Probes, Part I.
Theory and Nucleic Acid Preparation, Tijssen, ed. Elsevier, N.Y.
(1993). Nucleic acids can be analyzed and quantified by any of a
number of techniques, including NMR, spectrophotometry,
radiography, electrophoresis, capillary electrophoresis, high
pressure liquid chromatography (HPLC), thin layer chromatography
(TLC), and hyperdiffusion chromatography, fluid or gel precipitin
reactions, immunodiffusion (single or double),
immunoelectrophoresis, radioimmunoassays (RIAs), enzyme-linked
immunosorbent assays (ELISAs), immuno-fluorescent assays, Southern
analysis, Northern analysis, dot-blot analysis, gel
electrophoresis, RT-PCR, quantitative PCR, other nucleic acid or
target or signal amplification methods, radiolabeling,
scintillation counting, and affinity chromatography.
Preparing hTERT Promoter Sequences
[0057] Certain embodiments of the invention are TERT promoters
comprising genomic sequences 5' (upstream) of an hTERT or mTERT
transcriptional start site, and intron sequences. TERT promoters
contain cis-acting transcriptional regulatory elements involved in
TERT message expression. It will be apparent that, in addition to
the nucleic acid sequences provided in hTERT SEQ ID NO:1 or mTERT
SEQ ID NO:2, additional TERT promoter sequences can be readily
obtained using routine molecular biological techniques. For
example, additional hTERT genomic (and promoter) sequence can be
obtained by screening a human genomic library using an hTERT
nucleic acid probe having a sequence or subsequence as set forth in
SEQ ID NO:1 (a nucleic acid sequence is within the scope of the
invention if it hybridizes under stringent conditions to an hTERT
promoter sequence of the invention). Additional hTERT or mTERT
genomic sequence can be readily identified by "chromosome walking"
techniques, as described by Hauser (1998) Plant J 16:117-125; Min
(1998) Biotechniques 24:398-400. Other useful methods for further
characterization of TERT promoter sequences include those general
methods described by Pang (1997) Biotechniques 22:1046-1048;
Gobinda (1993) PCR Meth. Applic. 2:318; Triglia (1988) Nucleic
Acids Res. 16:8186; Lagerstrom (1991) PCR Methods Applic. 1:111;
Parker (1991) Nucleic Acids Res. 19:3055.
[0058] In some embodiments, the promoter sequence comprises at
least about 15, 50, 100, 150, 200, 250, 500, 1000, 2500 or 13,000
bases in SEQ ID NO:1 or SEQ ID NO:2. Included is a nucleic acid
molecule comprising a TERT promoter, including but not limited to
hTERT or mTERT, optionally linked to a heterologous sequence. The
promoter may comprise about 100 to about 200, 200 to about 400, 400
to about 900, or 900 to about 2500, or 2500 to about 5000
nucleotides upstream of a translational start site. In other
embodiments, the promoter comprises a sequence that hybridizes with
SEQ. ID NO:1 or 2. Exemplary are promoter sequences that
preferentially promote transcription in cells expressing telomerase
reverse transcriptase. Such sequences can be readily identified
using the assays provided elsewhere in this disclosure and in the
Examples, in which candidate promoter sequences are operably linked
to the encoding region for a reporter protein, and then transfected
into cells with known TERT activity to determine the
specificity.
[0059] The invention provides oligonucleotide primers that can
amplify all or any specific region within the TERT promoter
sequence of the invention, including specific promoter and enhancer
subsequences. The nucleic acids of the invention can also be
generated or measured quantitatively using amplification
techniques. Using the TERT promoter sequences of the invention (as
in the exemplary hTERT SEQ ID NO:1 or mTERT SEQ ID NO:2), the
skilled artisan can select and design suitable oligonucleotide
amplification primers. Amplification methods include polymerase
chain reaction (PCR Protocols, A Guide To Methods And Applications,
ed. Innis, Academic Press, N.Y. (1990) and PCR Strategies (1995),
ed. Innis, Academic Press, Inc., N.Y., ligase chain reaction (LCR)
(Wu (1989) Genomics 4:560; Landegren (1988) Science 241:1077;
Barringer (1990) Gene 89:117); transcription amplification (Kwoh
(1989) Proc. Natl. Acad. Sci. USA, 86:1173); and, self-sustained
sequence replication (Guatelli (1990) Proc. Natl. Acad. Sci. USA,
87:1874); Q .beta.-replicase amplification (Smith (1997) J. Clin.
Microbiol. 35:1477-1491, automated Q-.beta. replicase amplification
assay; Burg (1996) Mol. Cell. Probes 10:257-271) and other RNA
polymerase mediated techniques (NASBA, Cangene, Mississauga,
Ontario); Berger (1987) Methods Enzymol. 152:307-316, Sambrook,
Ausubel, Mullis (1987) U.S. Pat. Nos. 4,683,195, and 4,683,202;
Arnheim (1990) C&EN 36-47; Lomell J. Clin. Chem., 35:1826
(1989); Van Brunt (1990) Biotechnology, 8:291-294; Wu (1989) Gene
4:560; Sooknanan (1995) Biotechnology 13:563-564. Once amplified,
TERT genomic DNA, TERT promoter sequences, and the like, can be
cloned, if desired, into any of a variety of vectors using routine
molecular biological methods; methods for cloning in vitro
amplified nucleic acids are described in Wallace, U.S. Pat. No.
5,426,039.
[0060] The invention includes TERT promoter sequences that have
been modified in a site-specific manner to alter, add to, or delete
some or all of the promoter's functions. For example, specific base
pairs can be modified to alter, increase or decrease the binding
affinity to trans-acting transcriptional regulatory factors, thus
modifying the relative level of transcriptional activation or
repression. Modifications can also change secondary structures of
specific subsequences, such as those associated with many
cis-acting transcriptional elements. Site-specific mutations can be
introduced into nucleic acids by a variety of conventional
techniques, well described in the scientific and patent literature.
Illustrative examples include site-directed mutagenesis by overlap
extension polymerase chain reaction (OE-PCR), as in Urban (1997)
Nucleic Acids Res. 25:2227-2228; Ke (1997) Nucleic Acids Res
25:3371-3372, and Chattopadhyay (1997) Biotechniques 22:1054-1056,
describing PCR-based site-directed mutagenesis "megaprimer" method;
Bohnsack (1997) Mol. Biotechnol. 7:181-188; Ailenberg (1997)
Biotechniques 22:624-626, describing site-directed mutagenesis
using a PCR-based staggered re-annealing method without restriction
enzymes; Nicolas (1997) Biotechniques 22:430-434, site-directed
mutagenesis using long primer-unique site elimination and
exonuclease III. Modified TERT promoter sequences of the invention
can be further produced by chemical modification methods. Belousov
(1997) Nucleic Acids Res. 25:3440-3444; Frenkel (1995) Free Radic.
Biol. Med. 19:373-380; Blommers (1994) Biochemistry
33:7886-7896.
[0061] The invention also provides antisense oligonucleotides
capable of binding TERT promoter regions which, at least in part,
modulate TERT transcription and telomerase activity. For example,
antisense oligonucleotides that form triplexes with promoter
regions inhibit the activity of that promoter. Joseph (1997)
Nucleic Acids Res. 25:2182-2188; Alunni-Fabbroni (1996)
Biochemistry 35:16361-16369; Olivas (1996) Nucleic Acids Res
24:1758-1764. Alternatively, antisense oligonucleotides that
hybridize to the promoter sequence can be used to inhibit promoter
activity.
[0062] For example, antisense polynucleotides of the invention can
comprise an antisense sequence of at least 7 to 10 to about 20 or
more nucleotides that specifically hybridize to a sequence
complementary to the TERT promoter sequences of the invention.
Alternatively, the antisense polynucleotide of the invention can be
from about 10 to about 50 nucleotides in length or from about 14 to
about 35 nucleotides in length. In other embodiments, they are less
than about 100 nucleotides or less than about 200 nucleotides. In
general, the antisense polynucleotide should be long enough to form
a stable duplex (or triplex) but, if desired, short enough,
depending on the mode of delivery, to be administered in vivo. The
minimum length of a polynucleotide required for specific
hybridization to a target sequence depends on several factors, such
as G/C content, positioning of mismatched bases (if any), degree of
uniqueness of the sequence as compared to the population of target
polynucleotides, and chemical nature of the nucleotides used in the
antisense reagent (methylphosphonate backbone, peptide nucleic
acid, phosphorothioate), among other factors. Methods relating to
antisense polynucleotides, are also described in Antisense RNA And
DNA, (1988), D. A. Melton, Ed., Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y.); Dagle (1991) Nucleic Acids Research 19:1805;
Kim (1998) J. Controlled Release 53:175-182; for antisense therapy.
Uhlmann (1990) Chem. Reviews 90:543-584; Poston (1998) J. Thorac.
Cardiovasc. Surg. 116:386-396 (ex vivo gene therapy); Haller (1998)
Kidney Int. 53:1550-1558; Nguyen (1998) Cancer Res 58:5673-7.
Identifying TERT Promoter Subsequences Bound by Transcriptional
Regulatory Factors
[0063] The invention provides means to identify and isolate
trans-acting transcriptional regulatory factors that are involved
in modulating the activity of the TERT promoter. Identification of
cis-acting motifs by sequence identity comparison can be a useful
initial means to identify promoter sequences bound by trans-acting
factors. The hTERT promoter contains the motif known to bind to
c-Myc (the "E-box" or "Myc/Max binding site"). Two SP1 binding
sites are located starting at residue -168 and starting at residue
-134. Other identified motifs include the sex determining region Y
gene product (SRY), hepatic nuclear factor 3-beta (HNF-3.beta.) and
hepatic nuclear factor 5 (HNF-5), TFIID-MBP, E2F and c-Myb
cis-acting transcriptional regulatory elements. To identify these
motifs, a variety of comparison algorithms can be used. Karas
(1996) Comput. Appl. Biosci. 12:441-6; Frech (1997) Pac Symp
Biocomput. 7:151-62; Brzma (1998) Genome Res 8:1202-1215; Tsunoda
(1998) Pac Symp Biocomput: 1998:252-63.
[0064] In addition to sequence identity analysis, TERT cis-acting
transcriptional regulatory elements can be identified by functional
assays, including promoter activity assays, DNase assays, binding
assays (mobility shift assays), and oligonucleotide affinity column
chromatography. After positive or tentative identification of a
cis-acting binding site in a TERT promoter, these sequences are
used to isolate the trans-acting transcriptional regulatory
factor(s). In a preferred embodiment, the trans-acting factors are
isolated using sequence-specific oligonucleotide affinity
chromatography, the oligonucleotides comprising TERT sequences of
the invention.
[0065] Another embodiment for identifying transcriptional
regulatory motifs involves modifying putative cis-acting regulatory
subsequences and assessing the change, if any, of the resultant
TERT promoter to modulate transcription. The modification can be
one or more residue deletions, residue substitutions, and chemical
alterations of nucleotides. The (modified) promoter can be operably
linked to TERT, a reporter gene, or any other transcribable
sequence. The relative increase or decrease the modification has on
transcriptional rates can be determined by measuring the ability of
the unaltered TERT promoter to transcriptionally activate the
reporter coding sequence under the same conditions as used to test
the modified promoter. An increase or decrease in the ability of
the modified TERT promoter to induce transcription as compared to
the unmodified promoter construct identifies a cis-acting
transcriptional regulatory sequence that is involved in the
modulation of TERT promoter activity.
[0066] The reporter gene can encode a fluorescent or phosphorescent
protein, or a protein possessing enzymatic activity. In alternative
embodiments, the detectable protein is firefly luciferase,
.alpha.-glucuronidase, .alpha.-galactosidase, chloramphenicol
acetyl transferase, green fluorescent protein, enhanced green
fluorescent protein, and the human secreted alkaline phosphatase.
Another embodiment tests the ability of these cis-acting elements
to bind soluble polypeptide trans-acting factors isolated from
different cellular compartments, particularly trans-acting factors
expressed in nuclei. For identification and isolation of factors
that stimulate transcription, nuclear extracts from cells that
express TERT are used.
[0067] Furthermore, once a cis-acting motif, or element, is
identified, it can be used to identify and isolate trans-acting
factors in a variety of cells and under different conditions (such
as cell proliferation versus cell senescence). Accordingly, the
invention provides a method for screening for trans-acting factors
that modulate TERT promoter activity under a variety of conditions,
developmental states, and cell types (including normal versus
immortal versus malignant phenotypes). The cis-acting
transcriptional regulatory sequences of the invention that modulate
TERT promoter activity can also be used as oligonucleotides which,
upon introduction into a cell, can bind trans-acting regulatory
factors to modulate TERT transcription in vivo. This results in
increased or decreased cell proliferative capacity for the
treatment of various diseases and conditions.
High Throughput Screening of Small Molecule Modulators of TERT
Transcription
[0068] The invention provides constructs and methods for screening
modulators, in a preferred embodiment, small molecule modulators,
of TERT promoter activity in vitro and in vivo. The invention
incorporates all assays available to screen for small molecule
modulators of TERT transcription. In a preferred embodiment, high
throughput assays are adapted and used with the novel TERT promoter
sequences and constructs provided by the invention. Schultz (1998)
Bioorg Med Chem Lett 8:2409-2414; Weller (1997) Mol. Divers.
3:61-70; Fernandes (1998) Curr Opin Chem Biol 2:597-603;
Sittampalam (1997) Curr Opin Chem Biol 1:384-91.
[0069] In alternative embodiments, recombinant constructs contain
hTERT promoter sequences driving a marker, such as an alkaline
phosphatase marker gene (SEAP) or a .sctn.-galactosidase gene.
Using a SEAP expressing construct of the invention, it was
demonstrated that a TERT promoter fragment of approximately 2.5 kb
is sufficient to activate and repress TERT transcription in
response to proliferation and/or growth arrest stimuli in a model
cell line, IDH4. Two cell clones, ID245-1 and ID245-16 whose SEAP
profiles closely matched telomerase activity after TERT
up-regulation by dexamethasone were selected and expanded for high
throughput screening of small molecule activators of
telomerase.
Treatment of Diseases Associated with Altered Telomerase
Expression
[0070] The present invention provides TERT promoter sequences
useful for the treatment of diseases and disease conditions. The
recombinant and synthetic nucleic acids comprising TERT promoter,
or TERT antisense complementary sequences, can be used to create or
elevate telomerase activity in a cell, as well as to inhibit
telomerase activity in cells in which it is not desired. In a
preferred embodiment, human TERT promoter sequences or antisense
sequences are used for the treatment of human diseases and disease
conditions.
[0071] Identification of cis-acting transcriptional regulatory
sequences by the invention further provides for the design of
targeted sequences that, as oligonucleotides, can modify TERT
promoter activity. In one embodiment, telomerase activity is
created or elevated by binding significant amounts of a
trans-acting transcriptional repressor or down-regulator with a
nucleic acid that binds specifically to the repressor. In another
embodiment, telomerase activity is down-regulated by antisense
oligonucleotides binding to promoter sequences. Similarly,
telomerase activity can be inhibited by binding significant amounts
of a trans-acting transcriptional activator or up-regulator with a
nucleic acid that binds specifically to the activator; or
telomerase activity is up-regulated by antisense oligonucleotides
binding to promoter sequences involved in telomerase repression.
Thus, inhibiting, activating or otherwise altering a telomerase
activity (telomerase catalytic activity, fidelity, processivity,
telomere binding, etc.) in a cell can be used to change the
proliferative capacity of the cell.
[0072] For example, reduction of telomerase activity in an immortal
cell, such as a malignant tumor cell, can render the cell mortal.
Conversely, increasing the telomerase activity in a cell line or a
mortal cell (most human somatic cells) can increase the
proliferative capacity of the cell. For example, expression of
hTERT protein in dermal fibroblasts, thereby increasing telomere
length, will result in increased fibroblast proliferative capacity.
Such expression can slow or reverse age-related degenerative
processes, such as the age-dependent slowing of wound closure (West
(1994) Arch. Derm. 130:87). Thus, in one aspect, the present
invention provides reagents and methods useful for treating
diseases and conditions characterized by the presence, absence, or
altered amount of human telomerase activity in a cell (where the
diseases and conditions are susceptible to treatment using the
compositions and methods disclosed herein). These diseases include,
e.g. cancers, other diseases of cell proliferation (particularly,
degenerative and aging processes and diseases of aging),
immunological disorders, infertility (or fertility).
TERT Promoter Operably Linked to Cellular Toxins
[0073] In one embodiment, the TERT promoter of the invention is
operably linked to a transcribable sequence that encodes a cellular
toxin. Polypeptide toxins that can be recombinantly generated
include ricin, abrin (Hughes (1996) Hum. Exp. Toxicol. 15:443-451),
diphtheria, gelonin (Rosenblum (1996) Cancer Immunol. Immunother.
42:115-121), Pseudomonas exotoxin A, tumor necrosis factor alpha
(TNF-.alpha.), Crotalus durissus terrificus toxin, Crotalus
adamenteus toxin, Naja naja toxin, and Naja mocambique toxin.
Rodriguez (1998) Prostate 34:259-269; Mauceri (1996) Cancer Res.
56:4311-4314. The cellular toxin can also be capable of inducing
apoptosis, such as the ICE-family of cysteine proteases, the Bcl-2
family of proteins, bax, bclXs and caspases. Favrot (1998) Gene
Ther. 5:728-739; McGill (1997) Front. Biosci. 2:D353-D379;
McDonnell (1995) Semin. Cancer Biol. 6:53-60.
[0074] Alternatively, the sequence under the control of the TERT
promoter can code for polypeptides having activity that is not
itself toxic to a cell, but which renders the cell sensitive to an
otherwise nontoxic drug, such as Herpes virus thymidine kinase
(HSV-TK). The HSV-TK is innocuous but converts the anti-herpetic
agent ganciclovir (GCV) to a toxic product that interferes with DNA
replication in proliferating cells. Delaney (1996) J. Neurosci.
16:6908-6918; Heyman (1989) Proc. Natl. Acad. Sci. USA
86:2698-2702. The art describes numerous other suitable toxic or
potentially toxic proteins and systems that may be applied in this
embodiment.
[0075] The methods of the invention, in addition to enabling the
specific killing of telomerase-positive cells, can also be used to
prevent transformation of telomerase negative cells to a telomerase
positive state. As shown in the examples below, an hTERT promoter
sequence can be operably linked to a reporter gene such that
activation of the promoter results in expression of the protein
encoded by the reporter gene. If, instead of a reporter protein,
the encoded protein is toxic to the cell, activation of the
promoter leads to cell morbidity or death.
Oncolytic Viruses and Toxins for Treating Cancer
[0076] The present invention provides methods and compositions for
reducing TERT promoter activity (and hence telomerase activity) in
immortal cells and tumor cells for treating cancer. Cancer cells
(malignant tumor cells) that express telomerase activity
(telomerase-positive cells) can be mortalized by decreasing or
inhibiting TERT promoter activity. Moreover, because measurable
telomerase activity levels correlate with disease characteristics
such as metastatic potential (U.S. Pat. Nos. 5,639,613; 5,648,215;
5,489,508; and Pandita (1996) Proc. Am. Ass. Cancer Res. 37:559),
any reduction in TERT promoter activity could reduce the aggressive
nature of a cancer to a more manageable disease state.
[0077] Taking advantage of this characteristic, in one embodiment
of the invention, a TERT promoter sequence is operably linked to a
gene encoding a toxin and introduced into a cell to kill the cell
(such as ricin, diphtheria, gelonin, Pseudomonas toxin, abrin). If
or when TERT transcriptional activators are expressed or activated
in the cell, the toxin will be expressed, resulting in specific
cell killing.
[0078] Alternatively, the TERT promoter-linked gene can encode a
protein having activity that is not itself toxic to a cell, but
which renders the cell sensitive to an otherwise nontoxic drug
(such as Herpes virus thymidine kinase).
[0079] In another embodiment, the invention takes advantage of the
fact that normal cytopathic viruses, in particular human cytopathic
viruses, such as adenovirus or Herpes virus, require essential
virally encoded genes to proliferate thereby lysing specific cells.
Based on the description that follows, those skilled in the art
will recognize that a number of different cytopathic viruses can be
adapted according to this invention. Cytopathic viruses are well
known in the art, and are described inter alia in publications by
Coffey, Toda, Chase, and Kramm, infra. Genes essential for
replication have been characterized in many such viruses. If an
essential replication gene of any of these viruses is driven by the
TERT promoter, proliferation of the virus and its cytopathic
effects would be restricted to tumor cells and other telomerase
expressing cells. For example, some essential genetic elements for
replication of adenovirus are the E4, E1a, E1b, and E2 regions, or
any of the late gene products. Essential genetic elements for
replication of HSV-1 include ICP6 and ICP4.
[0080] Accordingly, the invention provides constructs and methods
for killing telomerase positive cells (such as cancer cells)
wherein TERT promoter sequences of the invention are operably
linked to such essential replication genetic elements. For use in
human cells, human cytopathic viruses modified with hTERT promoter
sequences are preferred. Any one or more of the genes required for
the replication and packaging of the virus could be modified to be
driven by the TERT promoter. For instance, in one embodiment,
expression of the E1a gene of adenovirus, which is required for the
activation of expression of a cascade of adenoviral genes, is
placed under the control of the hTERT promoter.
[0081] Thus, expression of E1a, and hence downstream replication of
the virus, occurs only in those cells that express telomerase (such
as tumor cells). Likewise, a recombinant adenovirus of the
invention is designed so the adenoviral capsid genes are under the
control of a TERT promoter. While this construct replicates its DNA
in most cell types, it packages itself into active, infectious (and
cytotoxic) virus only in those cells that express telomerase. Thus,
when these constructs are used as cancer therapeutics, the
conditionally replicative virus only infects and yields a
productive infection in tumor cells (with no effect in "normal"
cells that do not express telomerase). Infection of normal cells
that do not express telomerase is expected to produce either no
virus or abortive production of the virus, depending on which gene
is driven by the TERT promoter. Thus, these recombinant viruses of
the invention allow the natural, yet tumor specific, amplification
of an oncolytic virus.
[0082] In alternative embodiments, many other elements are
incorporated into a TERT promoter restricted oncolytic virus or a
TERT promoter restricted replicative virus that is not lytic. Genes
encoding suicide genes, marker genes, apoptotic genes or cell cycle
regulators are incorporated in the TERT promoter restricted
conditionally replicative recombinant virus. Expression of these
elements in such a virus would assist the arrest of tumor growth.
In one embodiment, elements to be included within these
conditionally replicative viruses of the invention are structures
that inhibit telomerase activity. These telomerase inhibitors could
incorporate inhibitory oligonucleotides, dominant-negative
inhibitors of TERT, or the gene for any agent that would disrupt or
prevent TR/TERT assembly, interactions, or activity.
[0083] Other elements can also be included in the TERT promoter
restricted vectors of the invention. For example, small inhibitory
RNA molecules, preferably targeting cancer cells, such as RNA
targeting telomerase activity can be synthesized in vivo using a
recombinant adenovirus vector. Exemplary sequences are provided in
U.S. Pat. No. 5,858,777 and GB 20890.4. RNA production from the
adenovirus can be achieved by a variety of expression cassettes.
For cell growth inhibition purposes, RNA polymerase III expression
cassettes based on the structure of tRNA genes and other RNA
polymerase III transcripts, including the U6 snRNA gene, as well as
RNA polymerase II snRNP (U1, U2) transcripts are preferred due to
their ability to produce high levels of transcripts.
[0084] The hTERT promoter restricted viruses of the invention can
be designed to express inhibitory RNAs, as antisense molecules
complementary to several regions of the hTR molecule, including the
template region. The inhibitory RNAs can also mimic sequences
and/or structures present in the RNA component of telomerase (e.g.,
hTR), including potential binding site(s) for TERT or other
telomerase-associated proteins that might interact with the RNA
component. Other elements can also be designed to generate
inhibitory RNAs to target TERT mRNA by preventing its normal
processing, folding, modification, transport and/or
translation.
[0085] Other cytopathic viral vectors of the invention can be
designed to generate RNA molecules with sequences necessary for
cytoplasmic export and translation into peptides. The resulting
polypeptides or peptides can be designed to target telomerase
components or other molecules that are associated with telomerase
thereby influencing telomerase catalytic activity. The peptides
that inhibit telomerase will be produced at high level, paralleling
the amount of RNA. For example, peptides could be designed to mimic
the stretch of amino acids in hTERT involved in its binding to hTR,
thereby acting as competitors in the assembly of a functional
telomerase.
[0086] The TERT promoter restricted viral vectors of the invention
can also be designed to generate peptides or polypeptides for any
domain of TERT involved in interactions with other proteins and
disrupt contacts that are essential for telomerase function. Other
TERT promoter restricted viruses of the invention can be designed
to generate polypeptides to bind to telomere complexes and prevent
access and/or docking of telomerase or to generate immunogenic
peptides, in part TERT peptides.
[0087] Other TERT promoter restricted viral vectors of the
invention can be designed to generate polypeptides to mimic a
variety of apoptosis inducing agents observed during programmed
cell death and could result in the onset of apoptosis. TERT
promoter restricted viruses do not necessarily need to be
cytopathic. The TERT promoter conditionally restricted virus could
be used to amplify any sequences or any element in any TERT
expressing cell, such as a tumor cell.
[0088] Any of these embodiments can be provided with the
conditionally replicative viruses of the invention. The TERT
promoter constructs of the invention can also be used in gene
therapy vectors to prevent telomerase activation and result in
specific mortalization or death of telomerase-positive cells.
Similarly, these gene therapy methods may be used for treating a
genetic predilection for cancers.
Treatment of Other Conditions
[0089] The present invention also provides compositions and methods
useful for treatment of diseases and disease conditions (in
addition to cancers) characterized by under- or over-expression of
telomerase or TERT gene products. Examples include diseases of cell
proliferation, diseases resulting from cell senescence
(particularly processes and diseases of aging), immunological
disorders, infertility, and diseases of immune dysfunction. Certain
diseases of aging are characterized by cell senescence-associated
changes due to reduced telomere length (compared to younger cells),
resulting from the absence (or much lower levels) of telomerase
activity in the cell. Decreased telomere length and decreased
replicative capacity contribute to these diseases. Telomerase
activity (resulting in increased telomere length) can be
up-regulated by increasing TERT promoter activity in the cell.
[0090] The present invention, by providing methods and compositions
for modulating TERT promoter activity, also provides methods to
treat infertility. Human germline cells (spermatogonia cells, their
progenitors or descendants) are capable of indefinite proliferation
and characterized by high telomerase activity. Abnormal or
diminished levels of TERT gene products can result, in inadequate
or abnormal production of spermatozoa, leading to infertility or
disorders of reproduction. Accordingly, infertility associated with
altered telomerase activity can be treated using the methods and
compositions described herein to increase TERT promoter activity
levels. Similarly, because inhibition of telomerase may negatively
impact spermatogenesis, oogenesis, and sperm and egg viability, the
compositions of the invention capable of inhibiting hTERT promoter
activity can have contraceptive effects when used to reduce hTERT
levels in germline cells.
[0091] In a further embodiment, the invention provides methods and
composition useful for decreasing the proliferative potential of
telomerase-positive cells such as activated lymphocytes and
hematopoietic stem cells by reducing TERT promoter activity. Thus,
the invention provides means for effecting immunosuppression.
Conversely, the methods and reagents of the invention are useful in
immunostimulation by increasing TERT promoter activity (resulting
in increased proliferative potential) in immune cells, including
hematopoietic stem cells (that express a low level of telomerase or
no telomerase prior to therapeutic intervention).
Modulating TERT Promoter Activity
[0092] As is clear from the foregoing discussion, modulation of the
level of TERT promoter transcriptional activity (and thus, the
levels of telomerase or telomerase activity of a cell) can have a
profound effect on the proliferative potential of the cell, and so
has great utility in treatment of disease. This modulation can
either be a decrease or an increase in TERT promoter activity. The
promoter activity-modulatory nucleic acid molecules of the
invention can act through a number of mechanisms. However, the
invention is not limited to any particular mechanism of action.
[0093] For example, TERT promoter activity may be decreased or
increased by single stranded antisense sequences that directly bind
to TERT promoter sequences. This will result in decrease in
affinity or inhibition of trans-acting transcriptional regulatory
factors binding to critical TERT promoter sequences (TATA boxes,
CAAT boxes, and the like). When the cis-acting element bound by a
trans-acting factor has inhibitory activity, the binding of the
oligonucleotide would result in up-regulation of TERT
transcription. Conversely, if the promoter subsequence, when bound
by a trans-acting factor, has up-regulating activity, the binding
of the oligonucleotide would result in down-regulation of TERT
transcription. In another embodiment, double-stranded
oligonucleotides representing TERT promoter subsequences directly
bind trans-acting transcriptional modulatory elements, thus
preventing them from binding their corresponding cis-acting
elements. In summary, TERT promoter activity may be increased or
decreased through any of several mechanisms, or a combination of
mechanisms. These include any means apparent to those of skill upon
review of this disclosure.
[0094] The cis-acting transcriptional regulatory sequences of the
invention can also be used as oligonucleotides which, upon
introduction into a cell, can bind trans-acting regulatory factors
to modulate TERT transcription in vivo. These oligonucleotides can
be delivered to target cells through an appropriate delivery scheme
or they can be synthesized in vivo by recombinant expression
systems (vectors, viruses, and the like).
Oligonucleotides and Other Pharmaceutical Compositions
[0095] Antisense oligonucleotides which hybridize to TERT promoter
sequences will inhibit the binding of trans-acting transcriptional
regulatory agents to critical TERT promoter sequences. Furthermore,
the result will be activation or repression of TERT transcriptional
activity, depending on whether the promoter subsequence is
down-regulatory or up-regulatory, respectively. Thus, the invention
provides antisense oligonucleotides directed to the TERT promoter
(cis-acting) binding sites for c-Myc (the "E-box" or "Myc/Max
binding sites"), SP1, Y gene product (SRY), HNF-3p, HNF-5,
TFIID-MBP, E2F, c-Myb, TATA boxes, CAAT boxes, and other regulatory
elements.
[0096] TERT polynucleotides can be produced by direct chemical
synthesis. Chemical synthesis will typically be used to produce
oligonucleotides and polynucleotides containing nonstandard
nucleotides (probes, primers and antisense oligonucleotides)
although nucleic acids containing only standard nucleotides can
also be prepared. Direct chemical synthesis of nucleic acids can be
accomplished for example by the phosphotriester method of Narang
(1979) Meth. Enzymol. 68:90; the phosphodiester method of Brown
(1979) Meth. Enzymol. 68:109; the diethyl-phosphoramidite method of
Beaucage (1981) Tetra. Lett. 22:1859; and the solid support method
of U.S. Pat. No. 4,458,066. Chemical synthesis typically produces a
single stranded oligonucleotide, which may be converted into double
stranded DNA by hybridization with a complementary sequence, or by
polymerization with a DNA polymerase and an oligonucleotide primer
using the single strand as a template. One of skill will recognize
that while chemical synthesis of DNA is often limited to sequences
of less than about 100 or 150 bases, longer sequences may be
obtained by the ligation of shorter sequences or by more elaborate
synthetic methods. It will be appreciated that the polynucleotides
and oligonucleotides of the invention can be made using nonstandard
bases (other than adenine, cytidine, guanine, thymine, and uridine)
or nonstandard backbone structures to provide desirable properties
(increased nuclease-resistance, tighter binding, stability or a
desired Tm). Techniques for rendering oligonucleotides
nuclease-resistant include those described in PCT publication WO
94/12633. A wide variety of useful modified oligonucleotides may be
produced, including oligonucleotides having a peptide nucleic acid
(PNA) backbone (Nielsen (1991) Science 254:1497) or incorporating
2'-O-methyl ribonucleotides, phosphorothioate nucleotides, methyl
phosphonate nucleotides, phosphotriester nucleotides,
phosphorothioate nucleotides, and phosphoramidates. Still other
useful oligonucleotides may contain alkyl and halogen-substituted
sugar moieties comprising one of the following at the 2' position:
OH, SH, SCH.sub.3, F, OCN, OCH.sub.3OCH.sub.3,
OCH.sub.3O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nNH.sub.2 or
O(CH.sub.2).sub.nCH.sub.3 where n is from 1 to about 10; C1 to C10
lower alkyl, substituted lower alkyl, alkaryl or aralkyl; Cl; Br;
CN; CF.sub.3; OCF.sub.3; O-, S-, or N-alkyl; O-, S-, or N-alkenyl;
SOCH.sub.3; SO.sub.2CH.sub.3; ONO.sub.2; NO.sub.2; N.sub.3;
NH.sub.2; heterocycloalkyl; heterocycloalkaryl; amino-alkylamino;
polyalkylamino; substituted silyl; an RNA cleaving group; a
cholesteryl group; a folate group; a reporter group; an
intercalator; a group for improving the pharmacokinetic properties
of an oligonucleotide; or a group for improving the pharmacodynamic
properties of an oligonucleotide and other substituents having
similar properties. Folate, cholesterol or other groups which
facilitate oligonucleotide uptake, such as lipid analogs, may be
conjugated directly or via a linker at the 2' position of any
nucleoside or at the 3' or 5' position of the 3'-terminal or
5'-terminal nucleoside, respectively. One or more such conjugates
may be used. Oligonucleotides may also have sugar mimetics such as
cyclobutyls in place of the pentofuranosyl group. Other embodiments
may include at least one modified base form or "universal base"
such as inosine, or inclusion of other nonstandard bases such as
queosine and wybutosine as well as acetyl-, methyl-, thio- and
similarly modified forms of adenine, cytidine, guanine, thymine,
and uridine which are not as easily recognized by endogenous
endonucleases. The invention further provides oligonucleotides
having backbone analogues such as phosphodiester, phosphorothioate,
phosphorodithioate, methylphosphonate, phosphoramidate, alkyl
phosphotriester, sulfamate, 3'-thioacetal, methylene(methylimino),
3'-N-carbamate, morpholino carbamate, chiral-methyl phosphonates,
nucleotides with short chain alkyl or cycloalkyl intersugar
linkages, short chain heteroatomic or heterocyclic intersugar
("backbone") linkages, or CH.sub.2--NH--O--CH.sub.2,
CH.sub.2--N(CH.sub.3)--OCH.sub.2,
CH.sub.2--O--N(CH.sub.3)--CH.sub.2,
CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2 and
O--N(CH.sub.3)--CH.sub.2--CH.sub.2 backbones (where phosphodiester
is O--P--O--CH.sub.2), or mixtures of the same. Also useful are
oligonucleotides having morpholino backbone structures (U.S. Pat.
No. 5,034,506).
[0097] While the invention is not limited by any particular
mechanism, oligonucleotides of the invention can also bind to
double-stranded or duplex TERT promoter sequences. They can bind in
a folded region, forming a triple helix, or "triplex" nucleic acid.
Triple helix formation results in inhibition of TERT promoter
activity by, disrupting the secondary structure of the promoter
sequence, resulting in a new conformation which the trans-acting
factor cannot bind with sufficient affinity to have a
transcriptional-modifying effect. Alternatively, triple helix
formation (induced by the binding of the antisense oligonucleotide
of the invention) compromises the ability of the double helix to
open sufficiently for the binding of polymerases, transcription
factors, or regulatory trans-acting molecules to occur. Triplex
oligonucleotide and polynucleotide construction is described in
Cheng (1988) J. Biol. Chem. 263:15110; Ferrin (1991) Science
354:1494; Ramdas (1989) J. Biol. Chem. 264:17395; Strobel (1991)
Science 254:1639; Rigas (1986) Proc. Natl. Acad. Sci. U.S.A. 83:
9591) Carr, 1994, Molecular and Immunological Approaches, Futura
Publishing Co, Mt Kisco N.Y.; Rininsland (1997) Proc. Natl. Acad.
Sci. USA 94:5854; Perkins (1998) Biochemistry 37:11315-11322.
[0098] The therapeutic nucleic acids and methods of the invention
involve the administration of oligonucleotides or polynucleotides
that function to inhibit or stimulate TERT promoter activity under
in vivo physiological conditions. In one embodiment, these nucleic
acids are single stranded antisense sequences capable of binding to
promoter sequences. In an alternative embodiment, they are double
stranded nucleic acids capable of binding trans-acting
transcriptional regulatory factors. They should be sufficiently
stable under physiological conditions for a period of time to
obtain a therapeutic effect. Modified nucleic acids can be useful
in imparting such stability, as well as for targeting delivery of
the oligonucleotide to the desired tissue, organ, or cell. Oligo-
and poly-nucleotides can be delivered directly as a drug in a
suitable pharmaceutical formulation, or indirectly by means of
introducing a nucleic acid expression system that can recombinantly
generate the hTERT promoter modulating oligonucleotides into a
cell. In one embodiment, oligonucleotides directly bind to
cis-acting sequences or, alternatively, bind to trans-acting
regulatory factors. One embodiment exploits the fact that the TERT
promoter is only relatively active in a very limited range of cell
types, including, significantly, cancer cells.
[0099] Oligonucleotides or expression vectors can be administered
by liposomes, immunoliposomes, ballistics, direct uptake into
cells, and the like. For treatment of disease the oligonucleotides
of the invention are administered to a patient in a therapeutically
effective amount, which is an amount sufficient to ameliorate the
symptoms of the disease or modulate hTERT promoter activity
(thereby affecting telomerase activity) in the target cell. Methods
useful for delivery of oligonucleotides for therapeutic purposes
are described in U.S. Pat. No. 5,272,065. Telomerase activity can
be measured by TRAP assay or other suitable assay of telomerase
biological function, as discussed in detail in other
publication.
[0100] The invention provides pharmaceutical compositions that
comprise TERT promoter-containing nucleic acids (polynucleotides,
expression vectors, gene therapy constructs) alone or in
combination with at least one other agent, such as a stabilizing
compound, diluent, carrier, cell targeting agent, or another active
ingredient or agent. The therapeutic agents of the invention may be
administered in any sterile, biocompatible pharmaceutical carrier,
including, but not limited to, saline, buffered saline, dextrose,
and water. Any of these molecules can be administered to a patient
alone, or in combination with other agents, drugs or hormones, in
pharmaceutical compositions where it is mixed with suitable
excipients, adjuvants, and/or pharmaceutically acceptable
carriers.
[0101] The pharmaceutical compositions of the invention can be
administered by any means. Methods of parenteral delivery include
topical, intra-arterial, intramuscular (IM), subcutaneous (SC),
intramedullary, intrathecal, intraventricular, intravenous (IV),
intraperitoneal (IP), or intranasal administration. Further details
on techniques for formulation and administration may be found in
the latest edition of Remington's Pharmaceutical Sciences (Maack
Publishing Co, Easton Pa.); PCT publication WO 93/23572.
[0102] Pharmaceutical compositions of the invention include
TERT-containing nucleic acids in an effective amount to achieve the
intended purpose. "Therapeutically effective amount" or
"pharmacologically effective amount" are well recognized phrases
and refer to that amount of an agent effective to produce the
intended pharmacological result. For example, a therapeutically
effective amount is an amount sufficient to treat a disease or
condition or ameliorate the symptoms of the disease being treated.
Useful assays to ascertain an effective amount for a given
application includes measuring the effect on endogenous TERT
promoter activity and telomerase activity in a target cell. The
amount actually administered will be dependent upon the individual
to which treatment is to be applied, and will preferably be an
optimized amount such that the desired effect is achieved without
significant side effects. The therapeutically effective dose can be
estimated initially either in cell culture assays or in any
appropriate animal model. The animal model is also used to estimate
appropriate dosage ranges and routes of administration in humans.
Thus, the determination of a therapeutically effective dose is well
within the capability of those skilled in the art.
Cells Lines and Animals With Modified Promoter Sequences
[0103] Most vertebrate cells senesce after a finite number of
divisions in culture (.about.50 to 100 divisions). Certain variant
cells, however, are able to divide indefinitely in culture (e.g.,
HeLa cells, 293 cells) and, for this reason, are useful for
research and industrial applications. Usually these immortal cell
lines are derived from spontaneously arising tumors, or by
transformation by exposure to an oncogene, radiation or a
tumor-inducing virus or chemical. Unfortunately, a limited
selection of cell lines, especially human cell lines representing
differentiated cell function, is available. Moreover, many immortal
cell lines presently available are characterized by chromosomal
abnormalities (aneuploidy, gene rearrangements, or mutations).
Further, many long-established cell lines are relatively
undifferentiated. Thus, there is a need for the TERT promoter
activating compositions and methods of the invention to generate
new immortal cell lines, especially using cells of human origin,
where hTERT promoter activating compositions and methods are
preferred.
[0104] The "immortalized cells" of the invention are not limited to
those that proliferate indefinitely, but also include cells with
increased proliferative capacity compared to similar cells whose
TERT promoter has not been up-regulated. Depending on the cell
type, increased proliferative capacity may mean proliferation for
at least about 50, about 100, about 150, about 200, or about 400 or
more generations, or for at least about 3, about 6, about 12, about
18, about 24 or about 36 or more months in culture.
[0105] Uses for cells with increased proliferative capacity include
the production of natural proteins and recombinant proteins
(therapeutic polypeptides such as erythropoietin, human growth
hormone, insulin, and the like), or antibodies, for which a stable,
genetically normal cell line is preferred. Another use is for
replacement of diseased or damaged cells or tissue. For example,
autologous immune cells immortalized using an TERT promoter
sequence of the invention can be used for cell replacement in a
patient after aggressive cancer therapy, such as whole body
irradiation. Another use for immortalized cells is for ex vivo
production of "artificial" tissues or organs for therapeutic use.
Another use for such cells is for screening or validation of drugs,
such as telomerase-inhibiting drugs, or for use in production of
vaccines or biological reagents. Additional uses of the cells of
the invention will be apparent to those of skill.
[0106] The invention also provides non-human transgenic animals
comprising heterologous TERT or recombinant constructs comprising
endogenous TERT promoter. In a preferred embodiment, the transgenic
animals of the invention comprise a TERT promoter driving a
heterologous gene, such as a reporter gene coding sequence. In a
preferred embodiment, an hTERT promoter of the invention is
operably linked to a reporter gene in a transgenic mouse.
Alternatively, an mTERT promoter is operably linked to a reporter
gene in a transgenic mouse. These transgenic animals are very
useful as in vivo animal models to screen for modulators of TERT
transcriptional activity. The introduction of hTERT, mTERT or other
TERT promoters into animals to generate transgenic models is also
used to assess the consequences of mutations or deletions to the
transcriptional regulatory regions.
[0107] In one embodiment, the endogenous TERT gene in these mice is
still functional and wild-type (native) telomerase activity can
still exist. A TERT promoter of the invention is used to drive a
high level expression of an exogenous TERT construct, the
endogenously produced mTERT protein can be competitively replaced
with the introduced, exogenous TERT protein. This transgenic animal
(retaining a functional endogenous telomerase activity) is
preferred in situations where it is desirable to retain "normal,"
endogenous telomerase function and telomere structure. In other
situations, where it is desirable that all telomerase activity is
by the introduced exogenous TERT protein, a mTERT knockout line can
be used
[0108] Promoter function, and in a preferred embodiment, hTERT
promoter function, can be assessed with these transgenic animals.
Alterations of TERT promoters can be constructed that drive TERT or
a reporter gene to assess their function and expression pattern and
characteristics (the invention also provides constructs and animals
and methods for gene expression driven by a TERT promoter by
transient transfection).
[0109] In one embodiment, the TERT promoters and reagents of the
invention are used to create mouse cells and transgenic animals in
which the endogenous TERT promoter is deleted, modified,
supplemented or inhibited. For example, TERT promoter sequences can
be deleted, modified or inhibited on either one or both alleles.
The cells or animals can be reconstituted with a wild-type or
modified TERT promoter, or, in a preferred embodiment, an exogenous
TERT in the form of hTERT.
[0110] Construction of a "knockout" cell and animal is based on the
premise that the level of expression of a particular gene in a
mammalian cell can be decreased or completely abrogated by
introducing into the genome a new DNA sequence that serves to
interrupt some portion of the DNA sequence of the gene/promoter to
be suppressed. To prevent expression of endogenous promoter, simple
mutations that alter or disrupt the promoter can be suitable. To
up-regulate expression, a native TERT promoter can be substituted
with a heterologous or mutated TERT promoter that induces higher
levels of transcription, or with multiple copies of transgene TERT
promoters. Also, "gene trap insertion" can be used to disrupt a
host gene, and mouse embryonic stem (ES) cells can be used to
produce knockout transgenic animals, as described herein and in
Holzschu (1997) Transgenic Res 6: 97-106.
[0111] Vectors specifically designed for integration by homologous
recombination comprising TERT promoter sequences are also provided
by the invention. Important factors for optimizing homologous
recombination include the degree of sequence identity and length of
homology to chromosomal sequences. The specific sequence mediating
homologous recombination is also important, because integration
occurs much more easily in transcriptionally active DNA. Methods
and materials for constructing homologous targeting constructs are
described by Mansour (1988) Nature 336: 348; Bradley (1992)
Bio/Technology 10:534; U.S. Pat. Nos. 5,627,059; 5,487,992;
5,631,153; and 5,464,764.
[0112] In a preferred embodiment, cell and transgenic animal models
express TERT promoter (particularly, hTERT promoter) operably
linked to a reporter gene. The cell or animal can be a TERT
promoter "knockout" or it can retain endogenous TERT promoter
activity. The insertion of the TERT promoter-containing exogenous
sequence is typically by homologous recombination between
complementary nucleic acid sequences. Thus, the exogenous sequence,
which is typically an hTERT or mTERT promoter of this invention, is
some portion of the target gene to be modified, such as exon,
intron or transcriptional regulatory sequences, or any genomic
sequence which is able to affect the level of the target gene's
expression; or a combination thereof. The construct can also be
introduced into other locations in the genome. Gene targeting via
homologous recombination in pluripotential embryonic stem cells
allows one to modify precisely the genomic sequence of
interest.
[0113] In another embodiment, the introduced TERT promoter sequence
(modified or wild type) can replace or disrupt an endogenous TERT
promoter sequence. A newly introduced TERT promoter sequence can be
engineered to have greater or lesser transcriptional activity, be
responsive to new trans-acting transcriptional modulating agents,
and the like.
[0114] Disruption of an endogenous TERT promoter sequence typically
will decrease or abrogate ("knockout") the transcription of TERT.
In one embodiment, the TERT promoter "knockout" is prepared by
deletion or disruption by homologous recombination of the
endogenous hTERT promoter. Homologous recombination and other means
to alter (and "knockout") expression of endogenous sequences is
described in Moynahan (1996) Hum. Mol. Genet. 5:875; Moynahan
(1996) Hum. Mol. Genet. 5:875; Baudin (1993) Nucl. Acids Res.
21:3329; Wach (1994) Yeast 10:1793; Rothstein (1991) Methods
Enzymol. 194:281; Anderson (1995) Methods Cell Biol. 48:31; Pettitt
(1996) Development 122:4149-4157; Ramirez-Solis (1993) Methods
Enzymol. 225:855; Thomas (1987) Cell 51:503; Couldrey (1998) Dev.
Dyn. 212:284-292). Holzschu (1997) Transgenic Res 6:97-106; U.S.
Pat. Nos. 5,464,764; 5,631,153; 5,487,992; 5,627,059, and
5,272,071; WO 91/09955; WO 93/09222; WO 96/29411; WO 95/31560; WO
91/12650. Vectors useful in TERT gene therapy can be viral or
nonviral. They may comprise other regulatory or processing
sequences. Lyddiatt (1998) Curr Opin Biotechnol 9:177-85.
[0115] The invention provides for delivery of the expression
systems into cells or tissues in vitro or ex vivo. For ex vivo
therapy, vectors may be introduced into cells taken from the
patient and clonally propagated for autologous transplant back into
the same patient (U.S. Pat. Nos. 5,399,493 and 5,437,994. Cells
that can be targeted for TERT promoter gene therapy aimed at
increasing the telomerase activity of a target cell include, but
are not limited to, embryonic stem or germ cells, particularly
primate or human cells, hematopoietic stem cells (AIDS and
post-chemotherapy), vascular endothelial cells (cardiac and
cerebral vascular disease), skin fibroblasts and basal skin
keratinocytes (wound healing and burns), chondrocytes (arthritis),
brain astrocytes and microglial cells (Alzheimer's Disease),
osteoblasts (osteoporosis), retinal cells (eye diseases), and
pancreatic islet cells (Type I diabetes).
[0116] The exogenous sequence is typically inserted in a construct,
usually also with a marker gene to aid in the detection of the
knockout construct and/or a selection gene. The knockout construct
is inserted in a cell, typically an embryonic stem (ES) cell,
usually by homologous recombination. The resultant transformed cell
can be a single gene knockout (one haplotype) or a double gene
(homozygous) knockout. The knockout construct can be integrated
into one or several locations in the cell's genome due to the
random nature of homologous recombination events; however, the
recombination does occur between regions of sequence
complementarity. Typically, less than one to five percent of the ES
cells that take up the knockout construct will actually integrate
exogenous DNA in these regions of complementarity; thus,
identification and selection of cells with the desired phenotype is
usually necessary and a selection or marker sequence is usually
incorporated into the construct for this purpose. Cells which have
incorporated the construct are selected for prior to inserting the
genetically manipulated cell into a developing embryo; for example,
the cells are subjected to positive selection (using G418, for
example, to select for neomycin-resistance) and negative selection
(using, for example, FIAU to exclude cells lacking thymidine
kinase). Selection and marker techniques include antibiotic
resistance selection or .beta.-galactosidase marker expression as
described elsewhere in this disclosure.
[0117] After selection of manipulated cells with the desired
phenotype, such as complete or partial inability to express
endogenous TERT promoter, or, expression of the exogenous TERT
promoter (as hTERT promoter activity) the cells are inserted into a
mouse embryo. Insertion can be accomplished by a variety of
techniques, such as microinjection, in which about 10 to 30 cells
are collected into a micropipet and injected into embryos that are
at the proper stage of development to integrate the ES cell into
the developing embryonic blastocyst, at about the eight cell stage,
which for mice is about 3.5 days after fertilization. The embryos
are obtained by perfusing the uterus of pregnant females. After the
ES cell has been introduced into the embryo, it is implanted into
the uterus of a pseudopregnant foster mother, which is typically
prepared by mating with vascectomized males of the same species. In
mice, the optimal time to implant is about two to three days
pseudopregnant. Offspring are screened for integration of the TERT
nucleic acid sequences and the modified promoter activity
phenotype. Offspring that have the desired phenotype are crossed to
each other to generate a homozygous knockout. If it is unclear
whether germline cells of the offspring have modified promoter,
they can be crossed with a parental or other strain and the
offspring screened for heterozygosity of the desired trait. The
heterozygotes can be crossed with each other to produce mice
homozygous for modified TERT genomic sequence. Bijvoet (1998) Hum.
Mol. Genet. 7:53-62; Moreadith (1997) J. Mol. Med. 75:208-216; Tojo
(1995) Cytotechnology 19:161-165; Mudgett (1995) Methods Mol. Biol.
48:167-184; Longo (1997) Transgenic Res. 6:321-328; U.S. Pat. Nos.
5,616,491 (Mak, et al.); 5,464,764; 5,631,153; 5,487,992;
5,627,059; 5,272,071; and, WO 91/09955, WO 93/09222, WO 96/29411,
WO 95/31560, and WO 91/12650. Thus, the invention provides for the
use of the TERT promoter sequence-containing reagents of the
invention to produce "knockout" mouse cells and animals, transgenic
animals, and their progeny. These cells and animals can be further
reconstituted with wild type or modified endogenous mTERT promoter
or exogenous TERT promoter, such as hTERT.
[0118] The present invention further provides methods and reagents
for karyotype analysis, gene amplification detection, or other
chromosomal analysis using probes comprising the TERT promoter
sequences of the invention. In various embodiments, amplifications
(change in copy number), deletions, insertions, substitutions, or
changes in the chromosomal location (translocations) of TERT
promoter containing genes are detected. These can be correlated
with the presence of a pathological condition or a predisposition
to developing a pathological condition (such as cancer). Thus, this
information can be used in a diagnostic or prognostic manner. For
instance, a translocation event could indicate that activation of
TERT expression occurs in some cases by replacing all or part of
the TERT promoter with another promoter element that directs TERT
transcription in an inappropriate manner. Furthermore, the methods
and reagents of the invention can be used to inhibit this
inappropriate TERT activation.
[0119] Determining the chromosomal location of TERT promoter
sequence may also be useful for analysis of TERT gene repression in
normal somatic cells, for instance, whether the location is part of
non-expressing heterochromatin. Nuclease hypersensitivity assays
for distinguishing heterochromatin and euchromatin are described in
Wu (1979) Cell 16:797; Groudine (1982) Cell 30:131; Gross (1988)
Ann. Rev. Biochem. 57:159. Methods for analyzing karyotype are
discussed in Pinkel (1988) Proc. Natl. Acad. Sci. USA 85:9138; EPO
Pub. No. 430,402; Choo, ed., Methods In Molecular Biology Vol. 33:
In Situ Hybridization Protocols, Humana Press, Totowa, N.J., 1994;
Kallioniemi (1992) Science 258:818).
TERT Promoter Binding Proteins and Transcriptional Regulatory
Factors
[0120] In addition to the novel TERT promoter sequences and
identification of the cis-acting transcriptional regulatory
sequences contained therein, the invention provides for novel in
vitro and cell-based in vivo assay systems to screen for TERT
promoter binding proteins (trans-acting transcriptional regulatory
factors) using the nucleic acids of the invention. Many assays are
available that screen for nucleic acid binding proteins and all can
be adapted and used with the novel TERT sequences provided by the
invention.
[0121] One embodiment of the invention provides a method of
screening and isolating a TERT promoter binding compound by
contacting a TERT promoter sequence of the invention (particularly,
an identified cis-acting regulatory sequence) with a test compound
and measuring the ability of the test compound to bind the selected
nucleic acid. The test compound, can be any agent capable of
specifically binding to a TERT promoter activity, including
compounds available in combinatorial libraries, a cell extract, a
nuclear extract, a protein or peptide. If a TERT transcriptional
activating protein is the goal of the search, a cell with
telomerase activity is typically chosen.
[0122] Various techniques can be used to identify polypeptides
which specifically bind to TERT promoter; for example, mobility
shift DNA-binding assays, methylation and uracil interference
assays, DNase and hydroxyl radical footprinting analysis,
fluorescence polarization, and UV crosslinking or chemical
cross-linkers. For a general overview, see Ausubel (chapter 12,
DNA-Protein Interactions). One technique for isolating
co-associating proteins, including nucleic acid and DNA/RNA binding
proteins, includes use of UV crosslinking or chemical
cross-linkers, including cleavable cross-linkers dithiobis
(succinimidylpropionate) and 3,3'-dithiobis
(sulfosuccinimidyl-propionate). McLaughlin (1996) Am. J. Hum.
Genet. 59:561-569; Tang (1996) Biochemistry 35:8216-8225; Lingner
(1996) Proc. Natl. Acad. Sci. USA 93:10712; Chodosh (1986) Mol.
Cell. Biol 6:4723-4733. In many cases, there is a high likelihood
that a specific protein (or a related protein) may bind to an hTERT
promoter sequence, such as a Myc, NF-kappa B, EF2, Sp1, AP-1 or
CAAT box binding site. In these scenarios, where an antibody may
already be available or one can be easily generated,
co-immunoprecipitation analysis can be used to identify and isolate
TERT promoter-binding, trans-acting factors. The trans-acting
factor can be characterized by peptide sequence analysis. Once
identified, the function of the protein can be confirmed, for
example, by competition experiments, factor depletion experiments
using an antibody specific for the factor, or by competition with a
mutant factor.
[0123] Alternatively, TERT promoter-affinity columns can be
generated to screen for potential TERT binding proteins. In a
variation of this assay, TERT promoter subsequences are
biotinylated, reacted with a solution suspected of containing a
binding protein, and then reacted with a strepavidin affinity
column to isolate the nucleic acid or binding protein complex
(Grabowski (1986) Science 233:1294-1299; Chodosh (1986) supra). The
promoter-binding protein can then be conventionally eluted and
isolated. Mobility shift DNA-protein binding assay using no
denaturing polyacrylamide gel electrophoresis (PAGE) is an
extremely rapid and sensitive method for detecting specific
polypeptide binding to DNA (Chodosh (1986) supra, Carthew (1985)
Cell 43:439-448; Trejo (1997) J. Biol. Chem. 272:27411-27421;
Bayliss (1997) Nucleic Acids Res. 25:3984-3990).
[0124] Interference assays and DNase and hydroxyl radical
footprinting can be used to identify specific residues in the
nucleic acid protein-binding site. Bi (1997) J. Biol. Chem.
272:26562-26572; Karaoglu (1991) Nucleic Acids Res. 19:5293-5300.
Fluorescence polarization is a powerful technique for
characterizing macromolecular associations and can provide
equilibrium determinations of protein-DNA and protein-protein
interactions. This technique is particularly useful (and better
suited than electrophoretic methods) to study low affinity
protein-protein interactions. Lundblad (1996) Mol. Endocrinol.
10:607-612.
[0125] Proteins identified by these techniques can be further
separated on the basis of their size, net surface charge,
hydrophobicity and affinity for ligands. In addition, antibodies
raised against such proteins can be conjugated to column matrices
and the proteins immunopurified according to well known methods.
Scopes, R. K., Protein Purification: Principles and Practice, 2nd
ed., Springer Veriag, (1987).
[0126] Transcriptional regulatory sequences identified by
comparison of hTERT and mTERT sequences include the for
trans-acting factors c-Myc, SP1, SRY, HNF-39, HNF-5, TFIID-MBP, E2F
and c-Myb. Table 1 shows other transcriptional regulatory sequences
that have been identified upstream from the TERT encoding region by
comparison of the hTERT sequence with known regulatory motifs.
These elements are of interest in regulating transcription in the
cell types where the factors that bind to these elements are
present.
TABLE-US-00001 TABLE 1 Putative Recognition Elements Upstream from
the hTERT Encoding Region Position (relative FLANKING-RECOGNITION
SE- to transla- QUENCE`-FLANKING (embedded Site Name tion start) in
SEQ. ID NO: 1) AP-2 CS5/Rev -2995 GGGCA-GGGCAGGC-ACGAG HiNF-A RS
-2975 ATTTT-ATTTAGCTATTT-TATTT EcR-consensus -2889
TCTTG-GCTCACTGCAA-CCTCC (2) Sp1-IE-3.1 -2719 GTGAT-CCGCCC-ACCTC
ApoE B1 -2717 GATCC-GCCCACCTC-AGCCT HiNF-A RS -2659
GGCCT-ATTTAACCATTT-TAAAA EcR-consensus -2598
ATGGA-GTTCAATTTCC-CCTTT (2) AP-1 CS3/Rev -2584 CCCCT-TTACTCA-GGAGT
C/EBP CS1 -2555 ATATT-TTCTGTAAT-TCTTC E2A CS -2462
CAGGG-GCAGCTG-GGAGG Yi-consensus -2316 TCCAT-CCCTCCTACT-CTACT C/EBP
CS2 -2313 ATCCC-TCCTACTC-TACTG EcR-consensus -2302
TCTAC-TGGGATTGAGC-CCCTT (2)/Rev AP-2 CS4 -2278
TATCC-CCCCCCAGGG-GCAGA AP-2 CS4 -2277 ATCCC-CCCCCAGGGG-CAGAG PEA3
RS -2241 TGTGG-AGGAAG-GAATG PEA3 CS -2241 TGTGG-AGGAAG-GAATG
Keratinocyte -2178 GTTGG-TTTGTTT-GTTTT enhancer/Rev HNF-5 CS -2176
TGGTT-TGTTTGT-TTTGT Keratinocyte -2174 GTTTG-TTTGTTT-TGTTT
enhancer/Rev Keratinocyte -2169 TTTGT-TTTGTTT-TGAGA enhancer/Rev
C/EBP CS1/Rev -2103 CTTGG-CTTACTGCA-GCCTC INF 1 -2075
GGTTC-AAGTGA-TTCTC GCN4 CS2 -2074 GTTCA-AGTGATTCTC-CTGCT Sp1-IE-4/5
-2028 AGGCA-CCCGCC-ACCAT AP-2 CS4/Rev -1983 AGACG-GGGGTGGGGG-TGGGG
AP-2 CS5/Rev -1957 ATGTT-GGCCAGGC-TGGTC E2A CS -1888
GGATT-ACAGGTG-TGAGC PEA3 RS -1824 GAGGT-AGGAAG-CTCAC PEA3 CS -1824
GAGGT-AGGAAG-CTCAC NFI-NFI -1788 TTTTA-AGCCAAT-GATAG CTF/NF-1a
-1788 TTTTA-AGCCAAT-GATAG CTF/NF-1b -1788 TTTTA-AGCCAAT-GATAG PEA1
RS -1730 TGTGA-TGACTAA-GACAT AP-1 CS3 -1730 TGTGA-TGACTAA-GACAT
AP-1 CS4 -1730 TGTGA-TGACTAA-GACAT PEA3-uPA/Rev -1630
AGGCG-TTTCCT-CGCCA C/EBP CS1/Rev -1605 TGTTA-ATTACTCCA-GCATA NF-E1
CS1 -1594 CCAGC-ATAATCTT-CTGCT Sp1-IE-3.1 -1474 CCAAA-CCGCCC-CTTTG
HNF-5 site -1442 AATTC-ACAAACA-CAGCC NFkB CS4 -1404
ACTAA-GGGGATTTC-TAGAA SIF-consensus -1384 AGCGA-CCCGTA-ATCCT AP-2
CS5 -1319 AGGGT-GCGAGGCC-TGTTC PEA3-uPA/Rev -1280
AGCAA-TTTCCT-CCGGC PEA3 CS -1256 AAAGT-AGGAAA-GGTTA HNF-5 CS -1215
TTCATG-TGTTTGC-CGACC HSTF CS2 -1169 GAGAC-CCAGAAGTTTCTCG-CCCCT AP-2
CS5 -970 CCCGA-GGCTGCCC-TCCAC Sp1 CS2 -950 TGTGC-GGGCGG-GATGT SP1
CS3 -950 TGTGC-GGGCGG-GATGT E1A-F CS -946 CGGGC-GGGATGT-GACCA
Sp1-IE-3.1 -807 CGGGA-CCGCCC-CGGTG AP-1 CS3 -794
GTGGG-TGATTAA-CAGAT AP-2 CS5 -657 GTCCC-GCGTGCCC-GTCCA
SIF-consensus -652 GCGTG-CCCGTC-CAGGG AP-2 CS4 -620
GTTCG-TCCCCAGCCG-CGTCT GCF- -552 CCCGA-CGCCCCGCGT-CCGGA
consensus/Rev AP-2 CS5 -531 CTGGA-GGCAGCCC-TGGGT Sp1-NPY -452
CATGG-CCCCTCC-CTCGG Yi-consensus -435 GTTAC-CCCACAGCCT-AGGCC AP-2
CS4/Rev -358 GCGGC-GCGCGGGCGG-GGAAG Sp1 CS2 -354 CGCGC-GGGCGG-GGAAG
SP1 CS3 -354 CGCGC-GGGCGG-GGAAG Sp1-IE-3.1 -323 CGGGT-CCGCCC-GGAGC
E2A CS -314 CCGGA-GCAGCTG-CGCTG AP-2 CS5/Rev -298
GTCGG-GGCCAGGC-CGGGC AP-2 CS5 -297 TCGGG-GCCAGGCC-GGGCT AP-2
CS5/Rev -289 AGGCC-GGGCTCCC-AGTGG c-Myc binding -242
CTTCC-CACGTG-GCGGA site AP-2 CS5/Rev -217 GACCC-GGGCACCC-GTCCT
SIF-consensus -212 GGGCA-CCCGTC-CTGCC Sp1-ras1.1 -188
TTCCA-GCTCCGCCTC-CTCCG GC-box -188 TTCCA-GCTCCGCCTC-CTCCG (1)/Rev
Sp1 CS1/Rev -168 CGCGG-ACCCCGCCCC-GTCCC SP1-IE3/2/Rev -168
CGCGG-ACCCCGCCCC-GTCCC GC-box -168 CGCGG-ACCCCGCCCC-GTCCC (1)/Rev
Sp1-junD -166 CGGAC-CCCGCCCC-GTCCC Sp1-IE-3.1 -165
GGACC-CCGCCC-CGTCC SIF-consensus -161 CCCGC-CCCGTC-CCGAC Sp1-NPY
-151 CCCGA-CCCCTCC-CGGGT Sp1-NPY -127 CCAGC-CCCCTCC-GGGCC Sp1-NPY
-108 CCCAG-CCCCTCC-CCTTC GCF- -88 TCCGC-GGCCCCGCCC-TCTCC
consensus/Rev Yi-consensus -85 GCGGC-CCCGCCCTCT-CCTCG Sp1-IE-3.1
-84 CGGCC-CCGCCC-TCTCC c-Myc binding -34 CTGCG-CACGTG-GGAAG site
AP-2 CS5/Rev -13 GCCCC-GGCCACCC-CCGCG
[0127] The examples and detailed elaboration provided in this
disclosure are for illustrative purposes, and are not intended to
limit the invention. Modifications can be made by those skilled in
the art that are included within the spirit of this application and
scope of the appended claims.
EXAMPLES
Example 1
Cloning of .mu.G.phi.5 and Characterization of hTERT Genomic
Sequences
[0128] The following example details the cloning of the human hTERT
promoter.
[0129] A human genomic DNA library was screened by PCR and
hybridization to identify a genomic clone containing hTERT RNA
coding sequences. The library was a human fibroblast genomic
library made using DNA from W138 lung fibroblast cells (Stratagene,
Cat # 946204). In this fibroblast library, partial Sau3Al fragments
were ligated into the XhoI site of a commercial phage cloning
vector, Lambda FIX.RTM.. Vector (Stratagene, San Diego, Calif.),
with insert sizes ranging from approximately 9 kilobases (kb) to 22
kb.
[0130] The genomic library was divided into pools of 150,000 phage
each. Each pool screened by nested PCR, with the outer primer pair
TCP1.52 & TCP1.57; inner pair TCP1.49 & TCP1.50. These
primer pairs span a putative intron in the genomic DNA of hTERT and
ensured the PCR product was derived from a genomic source and not
from contamination by the hTERT cDNA clone. Positive pools were
further subdivided until a pool of 2000 phage was obtained. This
pool was plated at low density and screened via hybridization with
a DNA fragment encompassing a subset of hTERT cDNA, generated by
restriction digest with SphI and EcoRV.
[0131] Two positive clones were isolated and rescreened via nested
PCR. At rescreening, both clones were positive by PCR. One of the
lambda phage clones (designated "Gphi5" or "2G.phi.5") was digested
with NotI, revealing an insert size of approximately 20 kb.
Subsequent mapping indicated the insert size was 15 kb and that
phage 2G.phi.5 contains approximately 13 kb of DNA upstream from
the transcriptional start site (upstream from the cDNA
sequence).
[0132] FIG. 1 shows the structure of Phage 2G.phi.5, mapped by
restriction enzyme digestion and DNA sequencing.
Isolating, Subcloning and Sequencing the Genomic hTERT Insert
[0133] The phage DNA was digested with NcoI. This fragment was
cloned into the plasmid pBBS167. The resulting subclones were
screened by PCR to identify those containing sequences
corresponding to the 5' region of the hTERT cDNA. A subclone
(plasmid "pGRN140") containing a 9 kb NcoI fragment (with hTERT
gene sequence and about 4 to 5 kb of lambda vector sequence) was
partially sequenced to determine the orientation of the insert.
pGRN140 was digested using SalI to remove lambda vector sequences,
the resulting plasmid (with removed lambda sequences) designated
pGRN144. The pGRN144 insert was then sequenced.
[0134] A NotI fragment from .lamda.G.phi.5 (containing the complete
approximately 15 kbp genomic insert including the hTERT gene
promoter region) was inserted in the NotI site of plasmid pBBS185.
Two plasmids were isolated with their respective inserts oriented
in opposite directions. One resulted in the insert oriented with
the hTERT open reading frame (ORF) in the same orientation as the
plasmid's Lac promoter, designated pGRN 142; the second, pGRN
143.
[0135] SEQ. ID NO:1 is a listing of the sequence data obtained from
plasmid pGRN 142. Nucleotides 1-43 and 15376-15418 are plasmid
sequence. Thus, the genomic insert begins at residue 44 and ends at
residue 15375. The beginning of the cloned cDNA fragment
corresponds to residue 13490. There are Alu sequence elements
located .about.1700 base pairs upstream. The sequence of the hTERT
insert of pGRN 142 can now be obtained from GenBank
(http://www.ncbi.nlm.nih.gov/) under Accession PGRN142.INS
AF121948.
[0136] Numbering of hTERT residues for plasmids in the following
examples begins from the translation initiation codon, according to
standard practice in the field. The hTERT ATG codon (the
translation initiation site) begins at residue 13545 of SEQ. ID
NO:1. Thus, position--1, the first upstream residue, corresponds to
nucleotide 13544 in SEQ. ID NO:1.
Example 2
TERT Promoter-Driven Reporter Constructs
[0137] This example describes the construction of plasmids in which
reporter genes are operably linked to hTERT promoter sequences of
the invention. This also illustrates how the TERT promoter sequence
of the invention can analogously be operatively linked to
heterologous sequences, such as polypeptide coding sequences, for
expression in cells and tissues in vitro and in vivo and transgenic
animals. As will be evident to one skilled in the art, techniques
such as those illustrated in these examples can be used to test
other candidate sequences for ability to specifically promote
transcription in cells expressing TERT.
[0138] hTERT-linked reporter vectors of the invention have numerous
uses, including identification of specific cis-acting sequences and
trans-acting transcriptional regulatory factors. Importantly, these
hTERT-containing reporter constructs can be used for the screening
of agents capable of modulating (i.e., activating or inhibiting)
hTERT transcription. These studies can be conducted in vitro and in
vivo.
[0139] A number of reporter genes, such as firefly luciferase,
.beta.-glucuronidase, .beta.-galactosidase, chloramphenicol acetyl
transferase, and GFP are known and can be operably linked to hTERT
promoter. In this example, the human secreted alkaline phosphatase
(SEAP; ClonTech) was used. The SEAP reporter gene encodes a
truncated form of the placental enzyme which lacks the membrane
anchoring domain, thereby allowing the protein to be secreted
efficiently from transfected cells. Levels of SEAP activity
detected in the culture medium have been shown to be directly
proportional to changes in intracellular concentrations of SEAP
mRNA and protein. The chemiluminescence-based SEAP assay is about
10-fold more sensitive than similar assays using firefly luciferase
as the reporter enzyme. The SEAP activity can also be assayed with
a fluorescent substrate, which provides sensitivity comparable to
luciferase. Berger (1988) Gene 66:1; Cullen (1992) Meth. Enzymol.
216:362; Yang (1997) Biotechniques 23:1110-1114.
hTERT 5' Upstream and Intron Sequences have "Promoter" Activity
[0140] Experiments with reporter constructs comprising various
hTERT sequences of the invention identified cis-acting regions with
"promoter" transcriptional activating activity in both 5' upstream
and intron sequences. In brief, four constructs, pGRN148, pGRN150,
"pSEAP2 basic" (no promoter sequences negative control), and
"pSEAP2 control" (contains the SV40 early promoter and enhancer)
were constructed and transfected in triplicate into mortal and
immortal cells.
[0141] FIG. 2 shows the plan for construction of plasmid pGRN148.
Briefly, a Bgl2-Eco47111 fragment from pGRN144 (described above)
was digested and cloned into the BgIll-NruI site of pSeap2Basic
(ClonTech, San Diego, Calif.). A second reporter-promoter, plasmid
pGRN150 was made by inserting the BglII-Fspl fragment from pGRN144
into the BglII-NruI sites of pSEAP2. Plasmid pGRN173 was
constructed by using the EcoRV-Stul fragment from pGRN144. This
makes a promoter reporter plasmid that contains the promoter region
of hTERT from approximately 2.5 kb upstream from the start of the
hTERT ORF to just after the first intron within the coding region.
The initiating Met was mutated to Leu, so that the second ATG
following the promoter region would be the initiating ATG of the
SEAP ORF.
[0142] Use of the intron sequence allows identification of
regulatory sequences that may be present in the intron (the
invention provides transcriptional regulatory sequences from any
portion of the hTERT genomic sequence). In addition to the hTERT
derived pSEAP reporter constructs, a positive control vector and a
negative control vector were used. The negative control
(pSEAP2-Basic) is necessary to determine the background signal
associated with the DNA backbone of the vector. A positive control
is necessary to confirm transfection and expression of exogenous
DNA and to verify the presence of active SEAP in the culture media.
The positive control is the pSEAP2-Control vector (ClonTech) which
contains the SEAP structural gene under transcriptional control of
the SV40 promoter and enhancer.
[0143] Three constructs, the control, pGRN148 (which include hTERT
5' promoter sequences) and pGRN150, were transfected into a mortal
cell line, BJ cells, a human foreskin fibroblast line, Feng (1995)
Science 269:1236; and an immortal cell line, the human embryonic
kidney line 293; Graham (1977) J. Gen. Virol. 36:59. All
transfections were done in parallel with the two control
plasmids.
[0144] In immortal cells, pGRN148 and pGRN150 constructs appear to
drive SEAP expression as efficiently as the pSEAP2 positive control
(containing the SV40 early promoter and enhancer). In contrast, in
mortal cells only the pSEAP2 control gave detectable activity.
Similar results were obtained using another normal cell line (RPE,
or retinal pigmental epithelial cells; Aronson (1983) In vitro
19:642-650). In RPE cells transfected with pGRN150, the hTERT
promoter region was inactive while the pSEAP2 control plasmid was
active. These results indicate that, as expected, hTERT promoter
sequences are active in tumor cells but not in mortal cells.
Identification of the Tissue Specificity Elements of the hTERT
Promoter
[0145] The hTERT DNA promoter sequences were cloned into the
pSEAP2-Basic transcription reporter vector (ClonTech) to generate
the plasmids pGRN 148, 150, 175, 176, 181, 184, 261, 262, and 319.
Summarized below are details of the promoter plasmid construction
(nucleotide numbers refer to the number of nucleotides upstream of
the translation initiation site at 13545 of SEQ ID NO:1):
[0146] pEGFP-1. *Vector from ClonTech containing the Enhanced Green
Fluorescent Protein.
[0147] pGRN140. *NCO1 fragment containing hTERT upstream sequences
and the first intron of hTERT from .lamda.G.phi.5 into the NCO1
site of a pBBS167 (variant of pUC19 cloning vector with MCS, e.g.
ATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCC
CATGGCAGGCCTCGCGCGCGAGATCTCGGGCCCAATCGATGCCGCGGCGATATCGCTCGAGGAAG
CTTGGCACTGGCC (SEQ ID NO:3), and a chloramphenicol sensitive gene
between the F1ori and the Amp gene in the opposite orientation from
the Amp gene). The fragment is oriented so that the hTERT sequences
are in the same direction as the Lac promoter.
[0148] pGRN144. described above; SalI deletion of pGRN140 to remove
phage (lambda) sequences.
[0149] pGRN148: *BGL2-ECO.sub.47111 fragment from pGRN144
containing hTERT upstream sequences (from position -51 to -2482)
into the BGL2-NRU1 sites of pSEAP2-Basic to make a hTERT
promoter/reporter plasmid.
[0150] pGRN150: *BGL2-FSP1 fragment from pGRN144 containing 2447 nt
of hTERT upstream sequences (from position -36 to -2482) into the
BGL2-NRU1 sites of pSEAP2 to make a hTERT promoter/reporter
plasmid.
[0151] pGRN175: *APA1(Klenow blunt)-SRF1 religation of pGRN150 to
delete most of the hTERT upstream sequences. This makes a
promoter/reporter plasmid that uses 82 nucleotides of hTERT
upstream sequences (from position -36 to -117).
[0152] pGRN176: *PML1-SRF1 religation of pGRN150 to delete most of
the hTERT upstream sequences. This makes a promoter/reporter
plasmid that uses 204 nucleotides of hTERT upstream sequences (from
position -36 to -239).
[0153] pGRN181: *APA1 digestion and religation of pGRN150 to delete
all APA1 sites but one. This makes a promoter/reporter plasmid that
comprises from -36 to -114 and -1076 to -2482 of the hTERT upstream
sequences.
[0154] pGRN184: *XBA1(partial, Klenow fill)-ECOR1 digest and
religation of pGRN150 to make a deletion of the hTERT promoter
sequences. This makes a promoter/reporter plasmid that expresses a
region from -1391 to -2484 of the hTERT upstream sequences.
[0155] pGRN213. *FSP1 fragment containing the CatS gene and the F1
ORI plus part of the AmpR gene into the FSP1 sites of pSEAP2-Basic
such that the orientation reconstructs the AmpR gene.
[0156] pGRN244: *SAL1-NOT1 fragment from pSEAP2-Basic containing
the SEAP region into the SAL1-NOT1 sites of pEGFP-1. This
modification adds a selectable marker to the vector.
[0157] pGRN245: *SAL1-NOT1 fragment from pGRN176 containing the
hTERT-promoter/SEAP region into the SAL1-NOT1 sites of pEGFP-1.
This modification adds a dominant selectable marker to the
vector.
[0158] pGRN246: *SAL1-NOT1 fragment from pGRN176 containing the
hTERT-promoter/SEAP region into the SAL1-NOT1 sites of pEGFP-1.
This modification adds a dominant selectable marker to the
vector.
[0159] pGRN248*SAL1-NOT1 fragment from pGRN175 containing the hTERT
promoter/SEAP region into the SalI-NotI sites of pEGFP-1. This
modification adds a dominant selectable marker to the vector.
[0160] pGRN259. *in vitro mutagenesis using RA94
(CCCGGCCACCCCCGCGAattCGCGCGCTCCCCGCTGC) SEQ ID NO:4) to introduce
an EcoRI site at the initiating met of hTERT in pGRN144. This
provides hTERT sequences from +1 to -2482 that can be cloned into a
vector using EcoRI and BglII.
[0161] pGRN260. *in vitro mutagenesis using RA91
(TTGTACTGAGAGTGCACCATATGCGGTGTGcatgcTACGTAAGAGGTTCCAACTTTCACCATAAT)
(SEQ ID NO:5) to delete several sites from the Chloramphenicol
region of pGRN213 to create a variant, more useful, MCS. This
creates a Mutagenesis version of pSEAP2-Basic with more unique
cloning sites in its MCS.
[0162] pGRN261: *BGL2-ECOR1 fragment from pGRN259 containing hTERT
upstream sequences into the BGL2-ECOR1 sites of pSEAP2-Basic. This
makes a promoter/reporter expression plasmid that contains from +1
to -2482 of the hTERT upstream sequences.
[0163] pGRN262: *BGL2-ECOR1 fragment from pGRN259 containing hTERT
upstream sequences into the BGL2-ECOR1 sites of pGRN260. This makes
a promoter/reporter expression and mutagenesis plasmid that
contains from +1 to -2482 of the hTERT upstream sequences.
[0164] pGRN294. *BbsI-XhoI fragment from pGRN142 containing hTERT
upstream sequences from -1667 to -3278 into the BbsI-XhoI sites of
pGRN259. This makes a vector containing the genomic upstream region
for hTERT from +1 to -3278 that can be cloned with EcoRI and
XhoI.
[0165] pGRN295: *ECOR1-XHO1 fragment from pGRN294 containing from
+1 to -3282 of hTERT upstream sequences into the ECOR1-XHO1 sites
of pGRN260. This makes a SEAP promoter/reporter/mutagenesis
plasmid.
[0166] pGRN296: *ECOR1-XHO1 fragment from pGRN294 containing from
+1 to -3282 of the hTERT upstream sequences into the ECOR1-XHO1
sites of pSEAP2-Basic. This makes a SEAP promoter/reporter
plasmid.
[0167] pGRN297. *RA96 (AATTGCGAAGCTTACG) (SEQ ID NO:6) and RA97
(AATTCGTAAGCTTCGC) (SEQ ID NO:7) annealed to make an oligo linker
into the ECOR1 sites of pGRN259 replacing the ECOR1 fragment of the
intron-exon region of pGRN259.
[0168] pGRN299: *XHO1-HIND3 fragment from pGRN298 containing from
+1 to -3282 of the hTERT upstream sequences into the XHO1-HIND3
sites of pGL2-Basic. This makes a Luciferase promoter/reporter
plasmid with about 3.3 Kb of hTERT promoter sequences.
[0169] pGRN300: *XHO1-SAC1 fragment from pGRN142 containing hTERT
upstream sequences into the XHO1-SAC1 sites of pGRN299 such that
the resulting construct contains from +1 to -5124 of the hTERT
upstream sequences. This creates an hTERT promoter/reporter
construct using Luciferase as a reporter.
[0170] pGRN310: *SAC1 fragment from pGRN142 containing hTERT
upstream sequences into the SAC1 site of pGRN300 such that the
resulting construct contains +1 to -7984 of the hTERT upstream
sequences. This creates an hTERT promoter/reporter construct using
Luciferase as a reporter.
[0171] pGRN311. *SPE1 fragment from pGRN142 containing from -4773
to -13501 of the hTERT upstream sequences into the SPE1 site of
pGRN300 such that the orientation reconstructs the genomic region.
This makes a Luciferase promoter reporter plasmid that contains the
entire pGRN142 upstream genomic region of hTERT plus a 365 bp
region of genomic DNA from the middle of the 13.5 Kb genomic region
repeated upstream of the T7 promoter.
[0172] pGRN312: *BGL2-FSP1 fragment from pGRN144 into the
BGL2-HIND3 (Klenow filled) sites of pGL2-Basic. This makes a
Luciferase promoter/reporter version of pGRN150.
[0173] pGRN313: *KPN1-NOT1 digested pGRN311 blunted with T4
polymerase and religated. This makes a Luciferase promoter/reporter
plasmid using from +1 to -13501 of the hTERT upstream
sequences.
[0174] pGRN316: *oligo RA101 (5'-TAGGTACCGAGCTCTTACGCGTGC
TAGCCCCACGTGGCGGA GGGACTGGGGACCCGGGCA-3') (SEQ ID NO:8) used for in
vitro mutagenesis to delete the genomic sequence from pGRN262
between the SRF1 site and the first PML1 site. This makes a
promoter-reporter plasmid containing hTERT upstream sequences from
+1 to -239.
[0175] pGRN317: *oligo RA100
(5'-TAGGTACCGAGCTCTTACGCGTGCTAGCCCCTCGCTGG CGTCCCT
GCACCCTGGGAGCGC-3') (SEQ ID NO:9) used for in vitro mutagenesis to
delete the genomic sequence from pGRN262 between the SRF1 site and
next to the last APAL site. This makes a promoter-reporter plasmid
containing hTERT upstream sequences from +1 to -397.
[0176] pGRN319: *RA107 (5'-CGTCCTGCTGCGCACtcaGGAAGCCCTGGCCCC-3')
(SEQ ID NO:10) used for in vitro mutagenesis to inactivate the `B`
class E-box just proximal to the hTERT initiating met in pGRN262.
This changes the CACGTG (SEQ ID NO:11) to CACTCA (SEQ ID NO:12).
Also COD1941 (5'-GATGAATGCTCATGATTCCGTATGGCA-3') (SEQ ID NO:13) was
used to switch from CatR to CatS introducing a BSPH1 site and
COD2866 (5'-CAGCATCTTTTACTTTCACCAGCGTTTCTGGGTG CGCAAAA
ACAGGAAGGCAAAATGCC-3') (SEQ ID NO:14) was used to select from AmpS
to AmpR introducing an FSP1 site. In summary, pGRN319 carries a
mutation in the E-box.
[0177] pGRN350: *RA104
(5'-TAGGTACCGAGCTCTTACGCGTGCTAGCCCCTCCCAGCCCCTC CCCT
TCCTTTCCGCGGC-3') (SEQ ID NO:15) used for in vitro mutagenesis to
delete the genomic sequence from pGRN262 between the SRF1 site and
the last APAL site before the ATG of the hTERT open reading frame
(orf). This makes a promoter-reporter plasmid containing hTERT
upstream sequences from +1 to -117.
[0178] pGRN351: *SAC2 fragment from pGRN319 into the SAC2 sites of
pGRN350 such that the SEAP orf is recreated. This makes a
"deactivated E-box" version of pGRN350.
[0179] pGRN352: *RA122 (5'-GACCGCGCTTCCCACtcaGCGGAG GGACTGGGG-3')
(SEQ ID NO:16) used for in vitro mutagenesis to "deactivate" the
penultimate class "B" E-box before the translation start site of
hTERT.
[0180] The pSEAP2-Basic plasmid lacks eukaryotic promoter and
enhancer sequences. This vector contains the SV40 late
polyadenylation signal inserted downstream of the SEAP coding
sequences to ensure proper and efficient processing of the
transcript in eukaryotic cells. It also contains a synthetic
transcription blocker (TB), composed of adjacent polyadenylation
and transcription pause sites to reduce background transcription.
As noted above, the SEAP reporter gene encodes a truncated form of
the placental enzyme which lacks the membrane anchoring domain,
thereby allowing the protein to be efficiently secreted from
transfected cells.
[0181] Levels of SEAP activity detected in the culture medium have
been shown to be directly proportional to changes in intracellular
concentrations of SEAP mRNA. The chemiluminescent SEAP substrate
CSPD.TM. (ClonTech) was used to detect secreted SEAP. Use of this
substrate enables monitoring of the expression of the SEAP reporter
gene through simple, sensitive, non-radioactive assays of secreted
phosphatase activity. This chemiluminescent assay can detect as
little as 10-13 g of SEAP protein. The assay is linear over a 104
fold range of enzyme concentrations. This makes the assay (and
these vectors) particularly well-suited for comparative
analyses.
[0182] In addition to the hTERT derived pSEAP reporter constructs,
a positive control vector (pSEAP2-Control vector) and a negative
control vector (pSEAP2-Basic) were used. The promoter constructs
(pGRN 150, 175, 176) and the control vectors were transfected into
immortal (HEK 293) and mortal (BJ fibroblast, RPE, HUVEC) cells
48-72 hours after transfection. The culture media was collected and
assayed for SEAP activity. The SEAP activity was detected using the
chemiluminescent assay from CLONTECH, Great EscAPe.TM. SEAP
Chemiluminescence Kit, according to the manufacturer's protocol.
The transfections were performed in triplicate. The culture media
from each transfection was collected after 48-72 hours and assayed
in triplicate. The background values obtained by transfection of
the negative control (pSEAP2-Basic) vector was subtracted from the
values obtained with the test constructs. The average of nine
measurements was used and plotted for each of the constructs.
Experimental Results in Immortal and Mortal Cell Lines
[0183] The results of the assays show that while the hTERT promoter
constructs are capable of driving the expression of the reporter
SEAP gene in immortal cells, the same constructs are silent in all
mortal cells tested. The pSEAP2-Control vector however is active in
all cell types regardless of their mortal or immortal status and
the pSEAP2-Basic vector is silent in all cells assayed.
hTERT Promoter Driving Thymidine Kinase Expression In vitro
[0184] The invention provides constructs comprising heterologous
coding sequences operably linked to hTERT promoter sequences. In
one embodiment, hTERT coding sequences are operably linked to
Herpes simplex virus thymidine kinase ("HSV-TK") coding sequences.
HSV-TK is an enzyme that is capable of converting innocuous
prodrugs, e.g. ganciclovir, into toxic metabolites that interfere
with the cellular replication of proliferating cells (such as
cancer cells, which have active hTERT promoter activity).
Controlling thymidine kinase (TK) expression by subordinating it to
the hTERT promoter restricts TK expression to cells where the hTERT
promoter is normally active. This prevents TK expression in
"normal" cells, where the hTERT promoter is usually silent.
[0185] The ability of the hTERT promoter to specifically drive the
expression of the TK gene in tumor cells was tested using a variety
of constructs: One construct, designated pGRN266, contains an
EcoRI-FseI PCR fragment with the TK gene cloned into the EcoRI-FseI
sites of pGRN263. pGRN263, containing approximately 2.5 kb of hTERT
promoter sequence, is similar to pGRN150, but contains a neomycin
gene as selection marker. pGRN267 contains an EcoRI-FseI PCR
fragment with the TK gene cloned into the EcoRI-FseI sites of
pGRN264. pGRN264, containing approximately 210 bp of hTERT promoter
sequence, is similar to pGRN176, but contains a neomycin gene as
selection marker. pGRN268 contains an EcoRI-XbaI PCR fragment with
the TK gene cloned into the EcoRI-XbaI (unmethylated) sites of
pGRN265. pGRN265, containing approximately 90 bp of hTERT promoter
sequence, is similar to pGRN175, but contains a neomycin gene as
selection marker.
[0186] These hTERT promoter/TK constructs, pGRN266, pGRN267 and
pGRN268, were re-introduced into mammalian cells and TK/+stable
clones (and/or mass populations) were selected. Ganciclovir
treatment in vitro of the TK/+ cells resulted in selective
destruction of all tumor lines tested, including 143B, 293, HT1080,
Bxpc-3, DAOY and NIH3T3. Significantly, ganciclovir treatment had
no effect on normal BJ cells. This clearly demonstrates the
tumor-specificity of all three hTERT promoter fragments used in
these experiments.
Example 3
Direct In vivo hTERT Promoter Suicide Gene Therapy
[0187] The invention provides reagents and methods for treating
diseases involving unwanted cell proliferation by in vivo gene
therapy. To demonstrate the efficacy of this aspect of the
invention, the reagents of the invention were used to treat cancer
(of human origin) in an art-accepted animal model. A human cancer
cell, the osteosarcoma cell line 143B, which normally expresses the
telomerase gene, was transfected with a plasmid containing the TK
gene driven by the hTERT promoter.
[0188] Specifically, sequences -36 to -2482 upstream of the
translation start site of SEQ ID NO:1 were used to drive the TK
gene. The plasmid also contained the neomycin phosphotransferase
gene. After transfection of cells with the plasmid, G418 resistant
clones expressing TK were selected. Two hundred thousand of the
parental or TK expressing 143B cells were injected subcutaneously
in the flank of Balb/c nude (nu/nu) mice to establish tumors. Four
to 11 days after tumor implantation the mice were injected IP with
75 mg/kg ganciclovir (GCV) or saline twice daily. Tumor growth was
monitored every 3-4 days. When GCV was administered either at 4 or
at 11 days post tumor implantation to these tumor bearing animals,
TK mediated cell lysis and retarded tumor growth was observed. Such
inhibition of tumor cell growth is not observed when saline is
administered or if the parental 143B tumor (143BP) is treated with
either saline or GCV. Forty-five days after tumor implantation,
only the animals implanted with the TK+143B clone and treated with
GCV showed 100% survival. In the other groups all but one animal
died from massive tumor burden.
[0189] These data indicate that the hTERT promoter is sufficient to
drive TK gene expression both in vivo. It also shows that the
reagents and methods of the invention can be used to promote tumor
regression in vivo in subjects (including humans) carrying
pre-established tumors.
Example 4
Oncolytic Viruses Under Control of the hTERT Promoter
[0190] As discussed earlier the invention provides "conditionally
replicating" oncolytic virus constructs in which hTERT promoter
sequences of the invention are operably linked to essential virally
encoded genes. Use of hTERT promoter sequences of the invention
ensures the virus will only be productively expressed in cells with
telomerase activity. Thus, constructs can be used therapeutically
to lyse only cells that express telomerase, such as immortal or
cancer cells. Proliferation of the virus and its cytopathic effects
is thus restricted to tumor cells. Details of the construction of
an exemplary hTERT promoter driven, conditionally replicating
oncolytic virus follows. In this embodiment, the hTERT promoter
replaces the normal E1a promoter to create a virus which will only
replicate in telomerase expressing cells.
[0191] Plasmid pBR/ITR/549-Clal containing nucleotides 1-356 (Ad2
ITR and packaging signals) and 549-920 (a portion of the E1a coding
sequence) of Adenovirus 2 (Ad2) linked using a polylinker was built
using standard molecular biology procedures in the bacterial
plasmid pBR322. In pBR/ITR/TB+phTERT176-E1A and
pBR/ITRrTB+phTERT316-E1A, the normal E1a promoter (Ad2 357-548) has
been replaced with the hTERT promoter. Ad2 sequences from 916-10680
are added to these plasmids to recreate the expression elements of
the 5' end of the virus.
[0192] These plasmids (pBR/ITR/TB+phTERT176-10680 and
pBR/ITR/TB+phTERT316-10680) are transfected into a telomerase
expressing human cell line along with an adenoviral DNA fragment
containing Ad2 sequences 10681-35937. Recombinant plaques are
scored and selected 7-21 days post transduction. The hTERT promoter
E1a containing Ad2 is propagated and produced for use employing
standard schemes for recombinant Ad2 amplification and
manufacturing. (Graham and Prevec, 1991, in Methods in Molecular
Biology, Chapter 11, Ed E. J. Murray, The Human Press Inc.,
Clifton, N. J.; Kanegae et al., Jpn J Med Sci Biol, 1994,
47(3):157-66). Because the E1a gene is driven by the hTERT
promoter, which is not normally expressed by most somatic cells,
recombinant Ad2 genome will only replicate and be packaged into
virus particles in cells expressing telomerase.
Example 5
htERT Promoter Sequences Driving an Alkaline Phosphatase Reporter
Gene for High Throughput Screening
[0193] The invention provides constructs and promoter-based assays
to identify small molecule activators and/or repressors of hTERT
and telomerase activity. To this end, fragments of the hTERT
promoter were cloned into plasmids expressing a secreted form of
alkaline phosphatase and a selection marker. The SEAP constructs
(pGRN244, pGRN245, pGRN246 and pGRN248) were re-introduced into
normal human cells and into immortal cell lines. After selection of
stable clones having integrated the hTERT promoter/SEAP constructs,
RT-PCR was used to determine the levels of SEAP mRNAs. In 293
cells, the levels of SEAP mRNA were elevated and comparable to the
levels of endogenous hTERT, whereas in BJ cells, the levels of SEAP
mRNA were virtually undetectable and closely matched the levels of
the endogenous hTERT in these cells.
[0194] These results indicate that hTERT promoter/SEAP constructs
can be used to engineer cells suitable for promoter-based assays
and to screen for chemical and/or biological activators and/or
repressors of telomerase in normal and tumor cells. pGRN244,
pGRN245, pGRN246 and pGRN248 were re-introduced into BJ and 293
cells. SEAP activity and mRNA levels were determined in these cells
as criteria for clone selection. Several 293 and BJ lines were
selected and two BJ/pGRN245 clones were expanded for high
throughput screening. These constructs were also introduced into
IDH4 cells, which are immortal lung fibroblasts that express the
SV40 large T antigen under the control of the
dexamethasone-inducible MMTV promoter. IDH4 cells are telomerase
positive and proliferate in the presence of dexamethasone. However,
these cells can be induced into a senescent, telomerase negative
stage after dexamethasone removal. Upon re-addition of
dexamethasone, the cells return to an immortal phenotype and
re-activate telomerase.
[0195] pGRN244, pGRN245, pGRN246 and pGRN248 were transfected into
IDH4 cells. SEAP activity was shown to parallel telomerase activity
in the different clones, whereas no significant fluctuation of SEAP
activity was observed with the control plasmid. These results
indicate that a fragment of approximately 2.5 kb of hTERT promoter
sequence (pGRN245) contains sufficient sequence elements to support
both activation and repression in response to proliferation and/or
growth arrest stimuli that control telomerase activity in IDH4
cells. Two clones, ID245-1 and ID245-16 whose SEAP profile closely
matched telomerase activity during drug treatment, were selected
and expanded for high throughput screening of small molecule
activators of telomerase.
Example 6
hTERT Promoter Sequences Driving a R-galactosidase Reporter Gene to
Identify Biological Regulators of hTERT and Telomerase activity
[0196] The invention also provides constructs and promoter-based
assays to identify biological modulators of hTERT and telomerase
activity. An exemplary construct of this aspect of the invention is
pGRN353 containing a BglII-HindIII fragment from pGRN297 with
approximately 2.5 kb of hTERT promoter sequences cloned into the
BglII-HindIII sites of .beta.-gal-Basic (ClonTech). pGRN353 or
similar constructs are re-introduced into BJ cells by
co-transfection with a plasmid containing a hygromycin gene as
selection marker. Clonal cell lines and/or mass populations are
established and used to screen retroviral based cDNA libraries for
genes or fragments of genes that can activate the hTERT promoter.
pGRN353 or similar constructs are also re-introduced into 143B and
293 cells to screen retroviral libraries to identify sequences that
can repress the hTERT promoter.
Example 7
Identifying Trans-Acting Transcriptional Regulatory Elements
[0197] The promoter-reporter (and other) vectors of the invention
are also used to identify trans-acting transcriptional regulatory
elements. As noted supra, plasmids in which reporter genes are
operably linked to hTERT promoter sequences are extremely useful
for identification of trans-acting transcriptional modulatory
agents and for the screening of potential hTERT promoter-modulating
drugs (including biological agents and small molecules). Both
transient and stable transfection techniques can be used. In one
embodiment, stable transformants of pGRN148 are made in telomerase
negative and telomerase positive cells by cotransfection with a
eukaryotic selectable marker (such as neo), according to Ausubel,
supra.
[0198] The resulting cell lines are used for screening of putative
telomerase trans-acting transcriptional modulatory agents, for
example, by comparing hTERT-promoter-driven expression in the
presence and absence of the test compound (the putative
trans-acting transcriptional modulating agent). Additional
promoter-reporter vectors (including the constructs described
herein, as variations thereof) are similarly used to identify and
isolate trans-acting factors binding to cis-acting transcriptional
regulatory elements, such as, Myc, Sp1, TATA box binding protein,
AP-1, CREB, CAAT binding factor and factors binding to hormone
response elements (e.g., GRE). The identification and isolation of
such trans-acting regulatory sequences provide for further methods
and reagents for modulating the transcription and translation of
telomerase.
Example 8
c-Myc Acts as a Potent Activator of the TERT Promoter by Direct
Interaction with Cis-Acting Regulatory Sequences
[0199] Use of recombinant constructs comprising TERT promoter
sequences of the invention has, for the first time, demonstrated
that c-Myc acts as a potent activator of telomerase activity by
direct interaction with cis-acting regulatory sequences in the TERT
promoter. Significantly, the studies of the invention also show
that transcriptional activation of the hTERT promoter by c-Myc can
be abrogated by deletion or mutation of a single cis-acting
regulatory sequence, the "Myc/Max binding site."
[0200] To determine whether experimental induction of c-Myc can
lead to the de novo activation of telomerase in primary human
cells, pre-senescent IMR90 cultures engineered to express the mouse
ecotropic receptor (Serrano et al. (1997) Cell 88, 593-602) were
transduced with either the PBABE retroviral vector or one encoding
a hormone inducible c-Myc-Estrogen Receptor (cMycER) fusion protein
(Eilers et al., 1989 Nature 340, 66-68; Littlewood (1995) Nucl.
Acids Res. 23, 1686-1690). IMR90 cultures do not possess detectable
telomerase activity or TERT gene expression (Nakamura et al., 1997;
Meyerson et al., 1997).
[0201] Retroviral Infection The mouse ecotropic receptor was
transduced into IMR90 fibroblasts and all subsequent transductions
with ecotropic retrovirus were carried out according to Serrano et
al. (1997). pBABE-MycER and PBABE vector control viruses were
harvested from stable expressing.sub.--2 cell lines.
[0202] Cell Culture: IMR90 cells were grown in Dulbecco's Modified
Eagle Medium (DMEM) (Gibco/BRL) supplemented with 10% fetal bovine
serum (FBS), 0.29 mg/mL L-glutamine, 0.03% penicillin and
streptomycin, and 25 .mu.g/mL gentamycin sulfate. For the Myc
induction studies in IMR90 cells, MycER transduced cells were
exposed to 2 .mu.M 4-OHT for 24, 48 and 72 hours. For the promoter
studies NIH 3T3 cells were exposed to 1 .mu.M 4-OHT for 24 and 72
hours. In all cases uninduced controls were treated with an
equivalent volume of ethanol, the solvent for 4-OHT.
[0203] Telomerase Assays: Telomerase activity was measured by a
modified telomerase repeat amplification protocol using the
TRAPeze.TM. telomerase detection kit (Oncor, Gaithersburg, Md.)
(Kim et al., 1994). Genomic DNA was obtained from vector control or
MycER transduced IMR90 fibroblasts. TRAP assays were performed on
lysates equivalent to 1000 cells for all samples, with 293T cell
lysates serving as a positive control for telomerase activity. PCR
internal controls from each experiment were amplified equally.
Inactivation of lysate was for 5 minutes at 85.degree. C. prior to
the TRAP assay.
[0204] In the MycER system, the Myc moiety exists in a latent form
bound in a complex with HSP-90 through its ER fusion (Eilers et
al., 1989; Littlewood et al., 1995). Upon treatment with
4-hydroxy-tamoxifen (4-OHT), the MycER protein is liberated from
HSP-90, resulting in a Myc over-expression phenotype (Eilers et
al., 1989; Littlewood et al., 1995). Employing this cell culture
system, 4-OHT treatment of MycER-transduced IMR90 cultures resulted
in the marked and sustained activation of telomerase to a level at
or above that detected in lysates derived from an equivalent number
of telomerase-positive 293T tumor cells, as assayed by the
sensitive TRAP assay. In contrast, untreated MycER-transduced or
4-OHT-treated pBABE-transduced IMR90 cultures remained telomerase
negative. Western blot analysis confirmed abundant MycER protein
levels in the MycER-transduced cultures in the presence or absence
of 4-OHT.
[0205] Notably, enforced expression of oncogenes such as H-Ras, and
cellular modulators of the Rb and p53 pathways (E7, cyclin D1,
Mdm2, dominant-negative p53) have not been found to be capable of
influencing telomerase activity in IMR90 cells (Wang et al.,
1998).
c-Myc Enhancement of hTERT Transcription Requires the Presence of a
Cis-Acting Promoter Element: the Proximal Myc-Binding E-Box
[0206] hTERT Reporter Construction: The pGRN150 (E box deleted),
pGRN261 (2.5 kbp hTERT reporter) are described above. NIH 3T3 cells
were grown in Dulbecco's Modified Eagle Medium (DMEM) (Gibco/BRL)
supplemented with 10% fetal bovine serum (FBS), 0.29 mg/mL
L-glutamine, 0.03% penicillin and streptomycin, and 25 .mu.g/mL
gentamycin sulfate. NIH 3T3 cells were transfected using
LipoFectamine.TM. reagent (Life Sciences) with 100 ng of a promoter
reporter, and 200 ng of pCMX-.beta.-Galactosidase which served as
an internal control for transfection efficiency. Transfected cells
were allowed to recover for 6 hours in complete DMEM and then
treated with 1 .mu.M 4-OHT or ethanol for 36 hours prior to
analysis of secreted alkaline phosphatase activity using the Great
EscAPe.TM. assay (ClonTech). .beta.-galactosidase activity was
assayed by incubation of whole cell extracts with 400 .mu.g/ml ONPG
in buffer containing 60 mM Na2HPO.sub.4, 40 mM NaH2PO.sub.4, 10 mM
KCl and 1 mM MgSO.sub.4 and relative transfection efficiencies
determined by reading absorbance at 415 nm.
[0207] Expression of endogenous hTERT following exposure to 4-OHT
(or solvent alone) was measured at various times in the presence of
1 .mu.M cyclohexamide in IMR90 fibroblasts transduced with MycER.
Reverse transcription of RNA derived from each sample followed by
PCR and Southern blotting of the amplified products was carried out
as described above. Glyceraldehyde-6-phosphate dehydrogenase
(GAPDH) was amplified from the same reverse transcription products
as an internal semi-quantitative control and visualized by ethidium
bromide staining. Low level expression of hTERT mRNA was detected
in uninduced samples after very long exposures; however, the level
of hTERT mRNA did not change over time in the uninduced
samples.
[0208] The activity of the hTERT promoter was dramatically enhanced
by c-Myc-ER in NIH 3T3 cells. The ability of c-Myc-ER to enhance
hTERT promoter activity was dependent upon sequences in the hTERT
promoter that included an evolutionarily conserved Myc binding site
(E-box).
[0209] To determine whether the increased telomerase activity
induced by activation of c-Myc-ER was a result of increased
transcription of the hTERT gene we initially examined the effect of
4-OHT induction of c-Myc-ER activity upon hTERT promoter sequences
placed upstream of the secreted alkaline phosphatase reporter gene.
The hTERT promoter contains two putative Myc-binding sites
positioned at -242 and -34 relative to the ATG initiation
codon.
[0210] NIH 3T3 cells engineered to express c-Myc-ER stably were
transfected with constructs containing a secreted alkaline
phosphatase reporter under the control of a 2.5 kb fragment of the
hTERT promoter, a 2.5 kb fragment of the hTERT promoter lacking the
proximal E-box, or a promoterless reporter construct.
[0211] The basal activity of the wild-type hTERT promoter and that
of the hTERT promoter lacking the proximal E-box were equivalent
and approximately 3 fold higher than the activity of the
promoterless reporter. Induction of c-Myc-ER activity with 1 .mu.M
4-OHT enhanced the activity of the 2.5 kb hTERT promoter
approximately 10 fold. By contrast, the activity of the promoter
lacking the proximal E-box was not significantly affected by
induction of c-Myc-ER. Similarly, the promoterless reporter was not
affected by induction of c-Myc-ER. Clearly, this shows that
transcription of a heterologous encoding region can be regulated by
modulating a transcriptional regulatory element such as c-Myc
within the promoter region, which in turn is modulated by a ligand
for the estrogen receptor.
[0212] To further confirm the role of the proximal E-box in
regulating the hTERT promoter we tested the effect of changing the
E-box from CACGTG to CACTCA. The mutation in the E-box reduced the
promoter activity due to 4-OHT stimulation to the equivalent of the
E-box deletion and 10-fold below the wild-type promoter. This
demonstrates that c-Myc-ER is not able to significantly activate an
hTERT promoter with an attenuated E-box at -34 and that the E-box
at -242 is not able to significantly mediate c-Myc activation.
These results suggest that the ability of c-Myc to stimulate the
hTERT promoter is mediated via the -34 E-box.
hTERT is a Direct Target of c-Myc Regulated Transcription
[0213] To confirm the ability of c-Myc to stimulate transcription
of the hTERT gene directly, we assayed for hTERT gene expression in
MycER-transduced cultures of IMR90 cells 0, 1, 3 and 9 hours
following the addition of 4-OHT. The cultures were treated with
cyclohexamide for 30 minutes prior to addition of 4-OHT to prevent
de novo protein synthesis. hTERT expression was undetectable at the
zero hour time point for the Myc transduced cultures. Pretreatment
of these cells with cyclohexamide alone had no effect on expression
of hTERT mRNA. Induction of the c-Myc-ER activity by treatment with
2 M 4-OHT in the presence of 1 cyclohexamide led to a rapid
increase in expression of hTERT message. hTERT expression was
detected by 1 hour post-induction, and increased 3 and 9 hours post
induction. By contrast, cells treated with solvent alone were not
induced to express hTERT. Furthermore, the expression level of
GAPDH was similar at all time points in cells treated with 4-OHT or
solvent alone.
[0214] These observations strongly suggest that Myc acts directly
upon the hTERT promoter to enhance transcription of the hTERT
gene.
[0215] Lack of Equivalence of Myc and TERT in Cellular
Transformation.
[0216] To further explore the functional implications of Myc
induction of telomerase activity in primary cells, we examined
whether TERT could substitute for c-Myc as an immortalizing agent
in the rat embryonic fibroblast (REF) cooperation assay. In this
assay, co-transfection of Myc and activated RAS (H-RASG12V) effects
the malignant transformation of early passage REFs. This
cooperative activity can be quantified by monitoring the number of
transformed foci appearing in the monolayer 7 to 10 days
post-transfection. In two separate experiments, various
combinations of the expression constructs encoding c-Myc,
H-RASG12V, TERT, or vector control were introduced into early
passage REFs. Strong cooperative activity was observed in the RAS
and Myc co-transfections as evidenced by an average of 34 foci per
10 cm plate; while Ras alone generated between 0 and 3 foci per
plate; consistent with previous findings that an immortalizing
agent and activated RAS are required for efficient transformation
of primary rodent cells (Land et al., 1983). By contrast,
co-transfection of TERT and RAS did not generate transformed foci
counts above that scored for the RAS alone controls. These results
indicate that expression of hTERT is insufficient to account for
the immortalizing function of Myc in a rat embryonic fibroblast
(REF) cooperative assay.
[0217] Effect of c-Myc-ER on the activity of the hTERT promoter in
NIH3T3 cells was determined by detection of secreted alkaline
phosphatase activity. Cells were treated with 4-OHT for 36 hours.
Uninduced cells were treated with solvent alone for 36 hours. The
detected secreted alkaline phosphatase activity was corrected for
transfection efficiency in each case using 1-galactosidase.
Example 9
Cloning of Mouse TERT Promoter
[0218] The following example details the cloning of the mouse mTERT
promoter. mTERT Construction: A hybridization probe (nucleotides
1586-1970) of the mTERT cDNA (pGRN188) was used to identify a
recombinant phage (mTERT1) from a 129SV mouse genomic phage library
(Stratagene). An 8 kb HindIII fragment of mTERT1 that hybridized to
the 1586-1970 probe was subcloned into pBluescript.TM. 11
KS+(Stratagene) to generate clone B2.18. The regions encompassing
the initiator and promoter were sequenced.
[0219] The mTERT upstream sequence is listed in SEQ. ID NO:2 The
sequence can be obtained on GenBank under Accession B2.18
AF121949.
[0220] FIG. 3 shows the alignment of homologous portions of the
human and mouse promoter sequences. The sequences were aligned
using the GAP program from the Wisconsin GCG package, using a value
of 48 for gap creation and a value of 3 for gap extension. Using a
small portion of the coding region (.about.450 bases) was found to
improve the initial alignment.
Conservation of Human and Mouse TERT Promoters
[0221] To determine whether the ability of c-Myc to enhance
telomerase activity was mediated through increased transcription of
the hTERT gene, we compared the sequences of the human and mouse
TERT promoters. Alignment of the first 300 bases of the human and
mouse promoters indicates a number of conserved regions. In
particular, the Myc/Max binding site (E-box) located at -34 of the
human promoter and at -32 of the mouse promoter, are highly
conserved. A second E-box was identified at -242 of the human
promoter; however, this site was not conserved in the mouse
promoter. These observations raised the possibility that the
conserved Myc binding site in particular might play a role in the
regulation of hTERT expression by c-Myc
Example 10
Exemplary Oncolytic Virus
[0222] Based on the principles illustrated in Example 4, the
following experiment was done as a model for an oncolytic virus
based on the Ad2 type adenovirus. A construct was made in which the
adenovirus E1a replication gene was placed under control of the
hTERT promoter, which should activate transcription in
telomerase-expressing cancer cells. As a positive control, a
similar construct was made in which E1a was placed under control of
the CMV promoter, which should activate transcription in any
cell.
[0223] Reagents were obtained as follows. pBR322, restriction
enzymes: NEB, Beverly, Mass. Adenovirus Type 2 (Ad2), tissue
culture reagents: Gibco/BRL, Grand Island, N.Y. Profection
Mammalian Transfection Systems Promega, Madison, Wis. Tumor and
Normal Cell lines: ATCC, Manassas, Va., except BJ line, which was
obtained from J. Smith, U. of Texas Southwestern Medical
Center.
[0224] Briefly, a pBR322-based plasmid was constructed which
contains the Adenovirus Type 2 genome with deletions from 356-548
nt (E1a promoter region) and 27971-30937 nt (E3). A multiple
cloning region was inserted at the point of deletion of the E1a
promoter, and hTERT promoter (-239 to -36 nt) or CMV promoter (-524
to -9 nt) was subsequently cloned. Numbering of the CMV sequence is
in accordance with Akrigg et al., Virus Res 2:107, 1985. Numbering
of the Ad2 sequence is in accordance with "DNA Tumor Viruses:
Molecular Biology of Tumor Viruses", J. Tooze ed., Cold Spring
Harbor Laboratory, NY.
[0225] These plasmid DNAs were digested with SnaBI to liberate
ITRs, then phenol-chloroform extracted, precipitated and
transfected into 293A cells for propagation of the virus. Several
rounds of plaque purifications were performed using A549 cells, and
a final isolate was expanded on these same cells. Viruses were
titered by plaque assay on 293A cells, and tested for the presence
of 5' WT Ad sequences by PCR. DNA was isolated from viruses by HIRT
extraction.
[0226] The hTERT promoter construct was designated AdphTERT-E1dIE3.
The CMV promoter construct was designated AdCMV-E1dIE3.
[0227] FIG. 4 shows the effect of these viruses on normal and
cancer-derived cell lines. Each cell line was plated at 5.times.10
in a 48-well format and infected at an MOI=20, .about.24 h post
plating. The cells were then cultured over a period of 17-48 days,
and fed every fourth day. The pictures shown in the Figure were
taken 7 days after infection. The top row shows the results of
cells that were not virally infected (negative control). The middle
row shows the results of cells infected with oncolytic adenovirus,
in which replication gene E1a is operably linked to the hTERT
promoter. The bottom row shows the results of cells infected with
adenovirus in which E1a is operably linked to the CMV promoter
(positive control). Results are summarized in Table 2:
TABLE-US-00002 TABLE 2 Effect of Oncolytic Virus on Cancerous and
Non-cancerous Cells Uninfected Lysis by Lysis by Cell cell
AdphTERT- AdCMV- Line Origin Culture Conditions Lysis E1dIE3 E1dIE3
BJ foreskin fibroblast 90% DMEM/M199 + FIG. 4 (A) NO NO YES 10% FBS
IMR lung fibroblast 90% DMEM/M199 + FIG. 4 (A) NO NO YES 10% FBS
WI-38 lung fibroblast 90% DMEM/M199 + FIG. 4 (A) NO NO YES 10% FBS
+ 5 .mu.g mL gentamicin A549 lung carcinoma 90% RPMI + FIG. 4 (B)
NO YES YES 10% FBS AsPC-1 adenocarcinoma, 90% RPMI + FIG. 4 (B) NO
YES YES pancreas 10% FBS BxPC-3 adenocarcinoma, 90% EMEM + FIG. 4
(B) NO YES YES pancreas 10% FBS DAOY medulloblastoma 90% EMEM +
FIG. 4 (C) NO YES YES 10% FBS HeLa: cervical 90% EMEM + FIG. 4 (C)
NO YES YES carcinoma 10% FBS HT1080 fibrosarcoma 90% EMEM + FIG. 4
(C) NO YES YES 10% FBS
[0228] All cell lines tested were efficiently lysed by AdCMV-E1dIE3
by day 17 post-infection. All tumor lines were lysed by
AdphTERT-E1dIE3 in a similar, but slightly delayed time-frame,
while normal lines showed no signs of cytopathic effect and
remained healthy out to 6 weeks post-infection.
[0229] In a parallel experiment, each cell line was infected with
an adenovirus containing the gene encoding the green fluorescent
protein as a visual marker (MOI=100), to determine relative
transduction efficiency of these cells by adenovirus vectors. The
cell lines exhibited a wide range of transduction efficiencies
(.about.1-2% to 100%). Even cells that are transduced poorly can be
efficiently eradicated with the hTERT controlled adenovirus.
[0230] Together, the results confirm that a oncolytic virus can be
constructed by placing a genetic element essential for replication
of the virus under control of an hTERT promoter. Replication and
lysis occurs in cancer cells, but not in differentiated
non-malignant cells.
[0231] FIG. 5 is a map of the oncolytic adenovirus used in the
infection experiment shown in FIG. 4. It comprises the Inverted
Terminal Repeat (ITR) from the adenovirus (Ad2); followed by the
hTERT medium-length promoter (phTERT176) operably linked to the
adenovirus E1a region; followed by the rest of the adenovirus
deleted for the E3 region (AE3). Shown underneath are some modified
constructs. The middle construct comprises an additional sequence
in between the hTERT promoter and the E1a region. The HI sequence
is an artificial intron engineered from adenovirus and
immunoglobulin intron splice donor and acceptor sequences. It is
thought that placing an intron in the hTERT promoter adenovirus
replication gene cassette will promote processing and transport of
heteronuclear RNA, thereby facilitating formation of the replicated
viral particles. The third adenovirus construct is similar, except
that the E1a region used is longer at the 5' end by 51 nucleotides.
It is thought that this may also promote more efficient conditional
replication of the oncolytic virus.
REFERENCES
[0232] 1. Bello-Fernandez. (1993). Proc Natl Acad Sci USA. 90,
7804-8. [0233] 2. Bishop (1991). C.S.H. Symp. Quant. Biol. 56,
99-107. [0234] 3. Bodnar (1996). Expt. Cell Res. 228, 58-64. [0235]
4. Bodnar (1998). Science 279, 349-52. [0236] 5. Chase (1998)
Nature Biotechnol. 16, 444-448. [0237] 6. Coffey (1998) Science
282:1332-1334 [0238] 7. Counter (1992). EMBO J. 11, 1921-1929.
[0239] 8. Eilers (1989). Nature 340, 66-68. [0240] 9. Eilers
(1991). EMBO J. 10, 133-41. [0241] 10. Fujimoto.(1997). Biochem.
& Biophys. Res. Comm. 241, 775-781. [0242] 11. Galaktionov
(1996). Nature 382, 511-7 [0243] 12. Grandori (1996). EMBO J. 15,
4344-57 [0244] 13. Grandori (1997). TIBS 22, 177-181. [0245] 14.
Greenberg, (1998) Oncogene 16, 1723-30. [0246] 15. Harley (1990).
Nature 345, 458-460. [0247] 16. Harrington. (1997). Genes Dev. 11,
3109-3115. [0248] 17. Hastie (1990) Nature 346, 866-868. [0249] 18.
Hiyama (1995). Nature Med. 1, 249-255. [0250] 19. Kilian (1997).
Hum. Mol. Genet. 6, 2011-2019. [0251] 20. Kim, (1994) Science 266,
2011-2015. [0252] 21. Kiyono (1998). Nature 396, 84-88. [0253] 22.
Klingelhutz (1996) Nature 380, 79-82. [0254] 23. Kramm (1997) Hum.
Gene Ther. 8, 2057-2068. [0255] 24. Land (1983) Nature 304,
596-602. [0256] 25. Lee (1997) Proc Natl Acad Sci USA 94, 12886-91.
[0257] 26. Marhin (1997) Oncogene 14, 2825-34. [0258] 27. Meyerson
(1997) Cell 90, 785-795. [0259] 28. Nakamura (1997) Science 277,
955-959. [0260] 29. Nakayama (1998) Nature Genet. 18, 65-68. [0261]
30. Reed (1986) Proc. Natl. Acad. Sci. USA 83, 3982-3986. [0262]
31. Schreiber-Agus (1995) Cell 80, 777-786. [0263] 32. Smith (1998)
Science 282, 1484-7. [0264] 33. Toda (1998) Human Gene Therapy 9,
2177-2185. [0265] 34. van Steensel (1997) Nature 385, 740-3. [0266]
35. Vaziri (1998) Curr. Biol. 8, 279-282. [0267] 36. Wagner. (1993)
Cell Growth Differ. 4, 879-83. [0268] 37. Wang. (1998) Genes Dev.
12, 1769-74. [0269] 38. Wright. (1995) Trends Cell Biol. 5,
293-297. [0270] 39. Xu (1997) Oncogene 15, 2589-2596.
BIOLOGICAL DEPOSIT
[0271] The lambda clone designated .lamda.G.phi.5 (from which SEQ.
ID NO:1 was determined) was deposited under terms of the Budapest
Treaty with the American Type Culture Collection (ATCC), 10801
University Blvd., Manassas, Va. 20110-2209 U.S.A., on Aug. 14,
1997, under Accession No. 98505.
SEQUENCE LISTING
[0272] SEQ. ID NO:1 (hTERT gene sequence in GenBank Accession
AF121948)
[0273] SEQ. ID NO:2 (mTERT sequence, GenBank Accession AF121949)
Sequence CWU 1
1
23115418DNAHomo sapiensHuman TERT promoter 1gcggccgcga gctctaatac
gactcactat agggcgtcga ctcgatcaat ggaagatgag 60gcattgccga agaaaagatt
aatggatttg aacacacagc aacagaaact acatgaagtg 120aaacacagga
aaaaaaagat aaagaaacga aaagaaaagg gcatcagtga gcttcagcag
180aagttccatc ggccttacat atgtgtaagc agaggccctg taggagcaga
ggcaggggga 240aaatacttta agaaataatg tctaaaagtt tttcaaatat
gaggaaaaac ataaaaccac 300agatccaaga agctcaacaa aacaaagcac
aagaaacagg aagaaattaa aagttatatc 360acagtcaaat tgctgaaaac
cagcaacaaa gagaatatct taagagtatc agaggaaaag 420agattaatga
caggccaaga aacaatgaaa acaatacaga tttcttgtag gaaacacaag
480acaaaagaca ttttttaaaa ccaaaaggaa aaaaaatgct acattaaaat
gttttttacc 540cactgaaagt atatttcaaa acatatttta ggccaggctt
ggtggctcac acctgtaatc 600ccagcacttt gggaggccaa ggtgggtgga
tcgcttaagg tcaggagttc gagaccagcc 660tggccaatat agcgaaaccc
catctgtact aaaaacacaa aaattagctg ggtgtggtga 720cacatgcctg
taatcccagg tactcaggag gctaaggcag gagaattgct tgaactggga
780ggcagaggtg gtgagccaag attgcaccag tgcactccag ccttggtgac
agagtgaaac 840tccatctcaa aaacaaacaa acaaaataca tatacataaa
tatatatgca catatatata 900catatataaa tatatataca catatataaa
tctatataca tatatacata tatacacata 960tataaatcta tatacatata
tatacatata taatatattt acatatataa atatatacat 1020atataaatat
acatatataa atacatatat aaatatacat atataaatat acatatataa
1080atatacatat ataaatatat acatatataa atatacatat ataaatatat
atacatatat 1140aaatatataa atatacaagt atatacaaat atatacatat
ataaatgtat atacgtatat 1200acatatatat ataaatatat aaaaaaactt
ttggctgggc acctttccaa atctcatggc 1260acatataagt ctcatggtaa
cctcaaataa aaaaacatat aacagataca ccaaaaataa 1320aaaccaataa
attaaatcat gccaccagaa gaaattacct tcactaaaag gaacacagga
1380aggaaagaaa gaaggaagag aagaccatga aacaaccaga aaacaaacaa
caaaacagca 1440ggagtaattc ctgacttatc aataataatg ctgggtgtaa
atggactaaa ctctccaatc 1500aaaagacata gagtggctga atggacgaaa
aaaacaagac tcaataatct gttgcctaca 1560agaatatact tcacctataa
agggacacat agactgaaaa taaaaggaag gaaaaatatt 1620ctatgcaaat
ggaaaccaaa aaaagaacag aactagctac acttatatca gacaaaatag
1680atttcaagac aaaaagtaca aaaagagaca aagtaattat ataataataa
agcaaaaaga 1740tataacaatt gtgaatttat atgcgcccaa cactgggaca
cccagatata tacagcaaat 1800attattagaa ctaaggagag agagagatcc
ccatacaata atagctggag acttcacccc 1860gcttttagca ttggacagat
catccagaca gaaaatcaac caaaaaattg gacttaatct 1920ataatataga
acaaatgtac ctaattgatg tttacaagac atttcatcca gtagttgcag
1980aatatgcatt ttttcctcag catatggatc attctcaagg atagaccata
tattaggcca 2040cagaacaagc cattaaaaat tcaaaaaaat tgagccaggc
atgatggctt atgcttgtaa 2100ttacagcact ttggggaggg tgaggtggga
ggatgtcttg agtacaggag tttgagacca 2160gcctgggcaa aatagtgaga
ccctgtctct acaaactttt ttttttaatt agccaggcat 2220agtggtgtgt
gcctgtagtc ccagctactt aggaggctga agtgggagga tcacttgagc
2280ccaagagttc aaggctacgg tgagccatga ttgcaacacc acacaccagc
cttggtgaca 2340gaatgagacc ctgtctcaaa aaaaaaaaaa aaaattgaaa
taatataaag catcttctct 2400ggccacagtg gaacaaaacc agaaatcaac
aacaagagga attttgaaaa ctatacaaac 2460acatgaaaat taaacaatat
acttctgaat aaccagtgag tcaatgaaga aattaaaaag 2520gaaattgaaa
aatttattta agcaaatgat aacggaaaca taacctctca aaacccacgg
2580tatacagcaa aagcagtgct aagaaggaag tttatagcta taagcagcta
catcaaaaaa 2640gtagaaaagc caggcgcagt ggctcatgcc tgtaatccca
gcactttggg aggccaaggc 2700gggcagatcg cctgaggtca ggagttcgag
accagcctga ccaacacaga gaaaccttgt 2760cgctactaaa aatacaaaat
tagctgggca tggtggcaca tgcctgtaat cccagctact 2820cgggaggctg
aggcaggata accgcttgaa cccaggaggt ggaggttgcg gtgagccggg
2880attgcgccat tggactccag cctgggtaac aagagtgaaa ccctgtctca
agaaaaaaaa 2940aaaagtagaa aaacttaaaa atacaaccta atgatgcacc
ttaaagaact agaaaagcaa 3000gagcaaacta aacctaaaat tggtaaaaga
aaagaaataa taaagatcag agcagaaata 3060aatgaaactg aaagataaca
atacaaaaga tcaacaaaat taaaagttgg ttttttgaaa 3120agataaacaa
aattgacaaa cctttgccca gactaagaaa aaaggaaaga agacctaaat
3180aaataaagtc agagatgaaa aaagagacat tacaactgat accacagaaa
ttcaaaggat 3240cactagaggc tactatgagc aactgtacac taataaattg
aaaaacctag aaaaaataga 3300taaattccta gatgcataca acctaccaag
attgaaccat gaagaaatcc aaagcccaaa 3360cagaccaata acaataatgg
gattaaagcc ataataaaaa gtctcctagc aaagagaagc 3420ccaggaccca
atggcttccc tgctggattt taccaatcat ttaaagaaga atgaattcca
3480atcctactca aactattctg aaaaatagag gaaagaatac ttccaaactc
attctacatg 3540gccagtatta ccctgattcc aaaaccagac aaaaacacat
caaaaacaaa caaacaaaaa 3600aacagaaaga aagaaaacta caggccaata
tccctgatga atactgatac aaaaatcctc 3660aacaaaacac tagcaaacca
aattaaacaa caccttcgaa agatcattca ttgtgatcaa 3720gtgggattta
ttccagggat ggaaggatgg ttcaacatat gcaaatcaat caatgtgata
3780catcatccca acaaaatgaa gtacaaaaac tatatgatta tttcacttta
tgcagaaaaa 3840gcatttgata aaattctgca cccttcatga taaaaaccct
caaaaaacca ggtatacaag 3900aaacatacag gccaggcaca gtggctcaca
cctgcgatcc cagcactctg ggaggccaag 3960gtgggatgat tgcttgggcc
caggagtttg agactagcct gggcaacaaa atgagacctg 4020gtctacaaaa
aactttttta aaaaattagc caggcatgat ggcatatgcc tgtagtccca
4080gctagtctgg aggctgaggt gggagaatca cttaagccta ggaggtcgag
gctgcagtga 4140gccatgaaca tgtcactgta ctccagccta gacaacagaa
caagacccca ctgaataaga 4200agaaggagaa ggagaaggga gaaaggaggg
agaagggagg aggaggagaa ggaggaggtg 4260gaggagaagt ggaaggggaa
ggggaaggga aagaggaaga agaagaaaca tatttcaaca 4320taataaaagc
cctatatgac agaccgaggt agtattatga ggaaaaactg aaagcctttc
4380ctctaagatc tggaaaatga caagggccca ctttcaccac tgtgattcaa
catagtacta 4440gaagtcctag ctagagcaat cagataagag aaagaaataa
aaggcatcca aactggaaag 4500gaagaagtca aattatcctg tttgcagatg
atatgatctt atatctggaa aagacttaag 4560acaccactaa aaaactatta
gagctgaaat ttggtacagc aggatacaaa atcaatgtac 4620aaaaatcagt
agtatttcta tattccaaca gcaaacaatc tgaaaaagaa accaaaaaag
4680cagctacaaa taaaattaaa cagctaggaa ttaaccaaag aagtgaaaga
tctctacaat 4740gaaaactata aaatattgat aaaagaaatt gaagagggca
caaaaaaaga aaagatattc 4800catgttcata gattggaaga ataaatactg
ttaaaatgtc catactaccc aaagcaattt 4860acaaattcaa tgcaatccct
attaaaatac taatgacgtt cttcacagaa atagaagaaa 4920caattctaag
atttgtacag aaccacaaaa gacccagaat agccaaagct atcctgacca
4980aaaagaacaa aactggaagc atcacattac ctgacttcaa attatactac
aaagctatag 5040taacccaaac tacatggtac tggcataaaa acagatgaga
catggaccag aggaacagaa 5100tagagaatcc agaaacaaat ccatgcatct
acagtgaact catttttgac aaaggtgcca 5160agaacatact ttggggaaaa
gataatctct tcaataaatg gtgctggagg aactggatat 5220ccatatgcaa
aataacaata ctagaactct gtctctcacc atatacaaaa gcaaatcaaa
5280atggatgaaa ggcttaaatc taaaacctca aactttgcaa ctactaaaag
aaaacaccgg 5340agaaactctc caggacattg gagtgggcaa agacttcttg
agtaattccc tgcaggcaca 5400ggcaaccaaa gcaaaaacag acaaatggga
tcatatcaag ttaaaaagct tctgcccagc 5460aaaggaaaca atcaacaaag
agaagagaca acccacagaa tgggagaata tatttgcaaa 5520ctattcatct
aacaaggaat taataaccag tatatataag gagctcaaac tactctataa
5580gaaaaacacc taataagctg attttcaaaa ataagcaaaa gatctgggta
gacatttctc 5640aaaataagtc atacaaatgg caaacaggca tctgaaaatg
tgctcaacac cactgatcat 5700cagagaaatg caaatcaaaa ctactatgag
agatcatctc accccagtta aaatggcttt 5760tattcaaaag acaggcaata
acaaatgcca gtgaggatgt ggataaaagg aaacccttgg 5820acactgttgg
tgggaatgga aattgctacc actatggaga acagtttgaa agttcctcaa
5880aaaactaaaa ataaagctac catacagcaa tcccattgct aggtatatac
tccaaaaaag 5940ggaatcagtg tatcaacaag ctatctccac tcccacattt
actgcagcac tgttcatagc 6000agccaaggtt tggaagcaac ctcagtgtcc
atcaacagac gaatggaaaa agaaaatgtg 6060gtgcacatac acaatggagt
actacgcagc cataaaaaag aatgagatcc tgtcagttgc 6120aacagcatgg
ggggcactgg tcagtatgtt aagtgaaata agccaggcac agaaagacaa
6180acttttcatg ttctccctta cttgtgggag caaaaattaa aacaattgac
atagaaatag 6240aggagaatgg tggttctaga ggggtggggg acagggtgac
tagagtcaac aataatttat 6300tgtatgtttt aaaataacta aaagagtata
attgggttgt ttgtaacaca aagaaaggat 6360aaatgcttga aggtgacaga
taccccattt accctgatgt gattattaca cattgtatgc 6420ctgtatcaaa
atatctcatg tatgctatag atataaaccc tactatatta aaaattaaaa
6480ttttaatggc caggcacggt ggctcatgtc cataatccca gcactttggg
aggccgaggc 6540ggtggatcac ctgaggtcag gagtttgaaa ccagtctggc
caccatgatg aaaccctgtc 6600tctactaaag atacaaaaat tagccaggcg
tggtggcaca tacctgtagt cccaactact 6660caggaggctg agacaggaga
attgcttgaa cctgggaggc ggaggttgca gtgagccgag 6720atcatgccac
tgcactgcag cctgggtgac agagcaagac tccatctcaa aacaaaaaca
6780aaaaaaagaa gattaaaatt gtaattttta tgtaccgtat aaatatatac
tctactatat 6840tagaagttaa aaattaaaac aattataaaa ggtaattaac
cacttaatct aaaataagaa 6900caatgtatgt ggggtttcta gcttctgaag
aagtaaaagt tatggccacg atggcagaaa 6960tgtgaggagg gaacagtgga
agttactgtt gttagacgct catactctct gtaagtgact 7020taattttaac
caaagacagg ctgggagaag ttaaagaggc attctataag ccctaaaaca
7080actgctaata atggtgaaag gtaatctcta ttaattacca ataattacag
atatctctaa 7140aatcgagctg cagaattggc acgtctgatc acaccgtcct
ctcattcacg gtgctttttt 7200tcttgtgtgc ttggagattt tcgattgtgt
gttcgtgttt ggttaaactt aatctgtatg 7260aatcctgaaa cgaaaaatgg
tggtgatttc ctccagaaga attagagtac ctggcaggaa 7320gcaggtggct
ctgtggacct gagccacttc aatcttcaag ggtctctggc caagacccag
7380gtgcaaggca gaggcctgat gacccgagga caggaaagct cggatgggaa
ggggcgatga 7440gaagcctgcc tcgttggtga gcagcgcatg aagtgccctt
atttacgctt tgcaaagatt 7500gctctggata ccatctggaa aaggcggcca
gcgggaatgc aaggagtcag aagcctcctg 7560ctcaaaccca ggccagcagc
tatggcgccc acccgggcgt gtgccagagg gagaggagtc 7620aaggcacctc
gaagtatggc ttaaatcttt ttttcacctg aagcagtgac caaggtgtat
7680tctgagggaa gcttgagtta ggtgccttct ttaaaacaga aagtcatgga
agcacccttc 7740tcaagggaaa accagacgcc cgctctgcgg tcatttacct
ctttcctctc tccctctctt 7800gccctcgcgg tttctgatcg ggacagagtg
acccccgtgg agcttctccg agcccgtgct 7860gaggaccctc ttgcaaaggg
ctccacagac ccccgccctg gagagaggag tctgagcctg 7920gcttaataac
aaactgggat gtggctgggg gcggacagcg acggcgggat tcaaagactt
7980aattccatga gtaaattcaa cctttccaca tccgaatgga tttggatttt
atcttaatat 8040tttcttaaat ttcatcaaat aacattcagg agtgcagaaa
tccaaaggcg taaaacagga 8100actgagctat gtttgccaag gtccaaggac
ttaataacca tgttcagagg gatttttcgc 8160cctaagtact ttttattggt
tttcataagg tggcttaggg tgcaagggaa agtacacgag 8220gagaggactg
ggcggcaggg ctatgagcac ggcaaggcca ccggggagag agtccccggc
8280ctgggaggct gacagcagga ccactgaccg tcctccctgg gagctgccac
attgggcaac 8340gcgaaggcgg ccacgctgcg tgtgactcag gaccccatac
cggcttcctg ggcccaccca 8400cactaaccca ggaagtcacg gagctctgaa
cccgtggaaa cgaacatgac ccttgcctgc 8460ctgcttccct gggtgggtca
agggtaatga agtggtgtgc aggaaatggc catgtaaatt 8520acacgactct
gctgatgggg accgttcctt ccatcattat tcatcttcac ccccaaggac
8580tgaatgattc cagcaacttc ttcgggtgtg acaagccatg acaacactca
gtacaaacac 8640cactctttta ctaggcccac agagcacggc ccacacccct
gatatattaa gagtccagga 8700gagatgaggc tgctttcagc caccaggctg
gggtgacaac agcggctgaa cagtctgttc 8760ctctagacta gtagaccctg
gcaggcactc ccccagattc tagggcctgg ttgctgcttc 8820ccgagggcgc
catctgccct ggagactcag cctggggtgc cacactgagg ccagccctgt
8880ctccacaccc tccgcctcca ggcctcagct tctccagcag cttcctaaac
cctgggtggg 8940ccgtgttcca gcgctactgt ctcacctgtc ccactgtgtc
ttgtctcagc gacgtagctc 9000gcacggttcc tcctcacatg gggtgtctgt
ctccttcccc aacactcaca tgcgttgaag 9060ggaggagatt ctgcgcctcc
cagactggct cctctgagcc tgaacctggc tcgtggcccc 9120cgatgcaggt
tcctggcgtc cggctgcacg ctgacctcca tttccaggcg ctccccgtct
9180cctgtcatct gccggggcct gccggtgtgt tcttctgttt ctgtgctcct
ttccacgtcc 9240agctgcgtgt gtctctgtcc gctagggtct cggggttttt
ataggcatag gacgggggcg 9300tggtgggcca gggcgctctt gggaaatgca
acatttgggt gtgaaagtag gagtgcctgt 9360cctcacctag gtccacgggc
acaggcctgg ggatggagcc cccgccaggg acccgccctt 9420ctctgcccag
cacttttctg cccccctccc tctggaacac agagtggcag tttccacaag
9480cactaagcat cctcttccca aaagacccag cattggcacc cctggacatt
tgccccacag 9540ccctgggaat tcacgtgact acgcacatca tgtacacact
cccgtccacg accgaccccc 9600gctgttttat tttaatagct acaaagcagg
gaaatccctg ctaaaatgtc ctttaacaaa 9660ctggttaaac aaacgggtcc
atccgcacgg tggacagttc ctcacagtga agaggaacat 9720gccgtttata
aagcctgcag gcatctcaag ggaattacgc tgagtcaaaa ctgccacctc
9780catgggatac gtacgcaaca tgctcaaaaa gaaagaattt caccccatgg
caggggagtg 9840gttggggggt taaggacggt gggggcagca gctgggggct
actgcacgca ccttttacta 9900aagccagttt cctggttctg atggtattgg
ctcagttatg ggagactaac cataggggag 9960tggggatggg ggaacccgga
ggctgtgcca tctttgccat gcccgagtgt cctgggcagg 10020ataatgctct
agagatgccc acgtcctgat tcccccaaac ctgtggacag aacccgcccg
10080gccccagggc ctttgcaggt gtgatctccg tgaggaccct gaggtctggg
atccttcggg 10140actacctgca ggcccgaaaa gtaatccagg ggttctggga
agaggcgggc aggagggtca 10200gaggggggca gcctcaggac gatggaggca
gtcagtctga ggctgaaaag ggagggaggg 10260cctcgagccc aggcctgcaa
gcgcctccag aagctggaaa aagcggggaa gggaccctcc 10320acggagcctg
cagcaggaag gcacggctgg cccttagccc accagggccc atcgtggacc
10380tccggcctcc gtgccatagg agggcactcg cgctgccctt ctagcatgaa
gtgtgtgggg 10440atttgcagaa gcaacaggaa acccatgcac tgtgaatcta
ggattatttc aaaacaaagg 10500tttacagaaa catccaagga cagggctgaa
gtgcctccgg gcaagggcag ggcaggcacg 10560agtgatttta tttagctatt
ttattttatt tacttacttt ctgagacaga gttatgctct 10620tgttgcccag
gctggagtgc agcggcatga tcttggctca ctgcaacctc cgtctcctgg
10680gttcaagcaa ttctcgtgcc tcagcctccc aagtagctgg gatttcaggc
gtgcaccacc 10740acacccggct aattttgtat ttttagtaga gatgggcttt
caccatgttg gtcaggctga 10800tctcaaaatc ctgacctcag gtgatccgcc
cacctcagcc tcccaaagtg ctgggattac 10860aggcatgagc cactgcacct
ggcctattta accattttaa aacttccctg ggctcaagtc 10920acacccactg
gtaaggagtt catggagttc aatttcccct ttactcagga gttaccctcc
10980tttgatattt tctgtaattc ttcgtagact ggggatacac cgtctcttga
catattcaca 11040gtttctgtga ccacctgtta tcccatggga cccactgcag
gggcagctgg gaggctgcag 11100gcttcaggtc ccagtggggt tgccatctgc
cagtagaaac ctgatgtaga atcagggcgc 11160gagtgtggac actgtcctga
atctcaatgt ctcagtgtgt gctgaaacat gtagaaatta 11220aagtccatcc
ctcctactct actgggattg agccccttcc ctatcccccc ccaggggcag
11280aggagttcct ctcactcctg tggaggaagg aatgatactt tgttattttt
cactgctggt 11340actgaatcca ctgtttcatt tgttggtttg tttgttttgt
tttgagaggc ggtttcactc 11400ttgttgctca ggctggaggg agtgcaatgg
cgcgatcttg gcttactgca gcctctgcct 11460cccaggttca agtgattctc
ctgcttccgc ctcccatttg gctgggatta caggcacccg 11520ccaccatgcc
cagctaattt tttgtatttt tagtagagac gggggtgggg gtggggttca
11580ccatgttggc caggctggtc tcgaacttct gacctcagat gatccacctg
cctctgcctc 11640ctaaagtgct gggattacag gtgtgagcca ccatgcccag
ctcagaattt actctgttta 11700gaaacatctg ggtctgaggt aggaagctca
ccccactcaa gtgttgtggt gttttaagcc 11760aatgatagaa tttttttatt
gttgttagaa cactcttgat gttttacact gtgatgacta 11820agacatcatc
agcttttcaa agacacacta actgcaccca taatactggg gtgtcttctg
11880ggtatcagcg atcttcattg aatgccggga ggcgtttcct cgccatgcac
atggtgttaa 11940ttactccagc ataatcttct gcttccattt cttctcttcc
ctcttttaaa attgtgtttt 12000ctatgttggc ttctctgcag agaaccagtg
taagctacaa cttaactttt gttggaacaa 12060attttccaaa ccgccccttt
gccctagtgg cagagacaat tcacaaacac agccctttaa 12120aaaggcttag
ggatcactaa ggggatttct agaagagcga cccgtaatcc taagtattta
12180caagacgagg ctaacctcca gcgagcgtga cagcccaggg agggtgcgag
gcctgttcaa 12240atgctagctc cataaataaa gcaatttcct ccggcagttt
ctgaaagtag gaaaggttac 12300atttaaggtt gcgtttgtta gcatttcagt
gtttgccgac ctcagctaca gcatccctgc 12360aaggcctcgg gagacccaga
agtttctcgc cccttagatc caaacttgag caacccggag 12420tctggattcc
tgggaagtcc tcagctgtcc tgcggttgtg ccggggcccc aggtctggag
12480gggaccagtg gccgtgtggc ttctactgct gggctggaag tcgggcctcc
tagctctgca 12540gtccgaggct tggagccagg tgcctggacc ccgaggctgc
cctccaccct gtgcgggcgg 12600gatgtgacca gatgttggcc tcatctgcca
gacagagtgc cggggcccag ggtcaaggcc 12660gttgtggctg gtgtgaggcg
cccggtgcgc ggccagcagg agcgcctggc tccatttccc 12720accctttctc
gacgggaccg ccccggtggg tgattaacag atttggggtg gtttgctcat
12780ggtggggacc cctcgccgcc tgagaacctg caaagagaaa tgacgggcct
gtgtcaagga 12840gcccaagtcg cggggaagtg ttgcagggag gcactccggg
aggtcccgcg tgcccgtcca 12900gggagcaatg cgtcctcggg ttcgtcccca
gccgcgtcta cgcgcctccg tcctcccctt 12960cacgtccggc attcgtggtg
cccggagccc gacgccccgc gtccggacct ggaggcagcc 13020ctgggtctcc
ggatcaggcc agcggccaaa gggtcgccgc acgcacctgt tcccagggcc
13080tccacatcat ggcccctccc tcgggttacc ccacagccta ggccgattcg
acctctctcc 13140gctggggccc tcgctggcgt ccctgcaccc tgggagcgcg
agcggcgcgc gggcggggaa 13200gcgcggccca gacccccggg tccgcccgga
gcagctgcgc tgtcggggcc aggccgggct 13260cccagtggat tcgcgggcac
agacgcccag gaccgcgctt cccacgtggc ggagggactg 13320gggacccggg
cacccgtcct gccccttcac cttccagctc cgcctcctcc gcgcggaccc
13380cgccccgtcc cgacccctcc cgggtccccg gcccagcccc ctccgggccc
tcccagcccc 13440tccccttcct ttccgcggcc ccgccctctc ctcgcggcgc
gagtttcagg cagcgctgcg 13500tcctgctgcg cacgtgggaa gccctggccc
cggccacccc cgcgatgccg cgcgctcccc 13560gctgccgagc cgtgcgctcc
ctgctgcgca gccactaccg cgaggtgctg ccgctggcca 13620cgttcgtgcg
gcgcctgggg ccccagggct ggcggctggt gcagcgcggg gacccggcgg
13680ctttccgcgc gctggtggcc cagtgcctgg tgtgcgtgcc ctgggacgca
cggccgcccc 13740ccgccgcccc ctccttccgc caggtgggcc tccccggggt
cggcgtccgg ctggggttga 13800gggcggccgg ggggaaccag cgacatgcgg
agagcagcgc aggcgactca gggcgcttcc 13860cccgcaggtg tcctgcctga
aggagctggt ggcccgagtg ctgcagaggc tgtgcgagcg 13920cggcgcgaag
aacgtgctgg ccttcggctt cgcgctgctg gacggggccc gcgggggccc
13980ccccgaggcc ttcaccacca gcgtgcgcag ctacctgccc aacacggtga
ccgacgcact 14040gcgggggagc ggggcgtggg ggctgctgct gcgccgcgtg
ggcgacgacg tgctggttca 14100cctgctggca cgctgcgcgc tctttgtgct
ggtggctccc agctgcgcct accaggtgtg 14160cgggccgccg ctgtaccagc
tcggcgctgc cactcaggcc cggcccccgc cacacgctag 14220tggaccccga
aggcgtctgg gatgcgaacg ggcctggaac catagcgtca gggaggccgg
14280ggtccccctg ggcctgccag ccccgggtgc gaggaggcgc gggggcagtg
ccagccgaag 14340tctgccgttg cccaagaggc ccaggcgtgg cgctgcccct
gagccggagc ggacgcccgt 14400tgggcagggg tcctgggccc acccgggcag
gacgcgtgga ccgagtgacc gtggtttctg 14460tgtggtgtca cctgccagac
ccgccgaaga agccacctct ttggagggtg cgctctctgg 14520cacgcgccac
tcccacccat ccgtgggccg ccagcaccac gcgggccccc catccacatc
14580gcggccacca cgtccctggg acacgccttg tcccccggtg tacgccgaga
ccaagcactt 14640cctctactcc tcaggcgaca aggagcagct gcggccctcc
ttcctactca gctctctgag 14700gcccagcctg actggcgctc ggaggctcgt
ggagaccatc tttctgggtt ccaggccctg 14760gatgccaggg actccccgca
ggttgccccg cctgccccag cgctactggc aaatgcggcc 14820cctgtttctg
gagctgcttg ggaaccacgc gcagtgcccc tacggggtgc tcctcaagac
14880gcactgcccg ctgcgagctg cggtcacccc agcagccggt gtctgtgccc
gggagaagcc 14940ccagggctct gtggcggccc ccgaggagga ggacacagac
ccccgtcgcc tggtgcagct 15000gctccgccag cacagcagcc
cctggcaggt gtacggcttc gtgcgggcct gcctgcgccg 15060gctggtgccc
ccaggcctct ggggctccag gcacaacgaa cgccgcttcc tcaggaacac
15120caagaagttc atctccctgg ggaagcatgc caagctctcg ctgcaggagc
tgacgtggaa 15180gatgagcgtg cgggactgcg cttggctgcg caggagccca
ggtgaggagg tggtggccgt 15240cgagggccca ggccccagag ctgaatgcag
taggggctca gaaaaggggg caggcagagc 15300cctggtcctc ctgtctccat
cgtcacgtgg gcacacgtgg cttttcgctc aggacgtcga 15360gtggacacgg
tgatcgagtc gactcccttt agtgagggtt aattgagctc gcggccgc
1541827498DNAMus sp.Mouse TERT promoter 2aagcttccag caaaccagtt
agagctgagt tgatgctctg aagaagagaa aatgtagaga 60cggtactgaa caaataatgt
ctgggcaaac ctcagacatg aaaatggaag acgtggaaat 120ccagagaact
ctgagggaaa ataaaacaca actccaggtc atcacgggac tcatcaaact
180gctgaggtgc agccacagag aaaaatctta aaatagccta gaacgatgca
tgacacataa 240agcacagaga agacgaagct gagtctgtct tgtaggaaca
acttgagaag acctaaacca 300ctgcaatgag tgcattctgc taacttagaa
tttgctaccc agttcagatc caaaaagggt 360ttcacaaagt tcaacacaaa
acagtagcag gagtggctaa gggggacaca ctgataggaa 420ttcagagaag
tagggaatgc tcatatgggg acattacaaa atgtactttc atgttgctta
480aatcatttta attgtcaacc acatcaagct aaataatgct ttgaggttca
taacatttgg 540agattatgtc tacactagca gagaaggcac caataacatc
ccaattgcta gattctcata 600gaatcatgag tcacaatggc agagacaggt
tctgagagtg tgtccttgtt gtaaacagta 660tgctctacaa actaagttgg
ctgcaatatc actaggcagt gttgtcccat aagacaacta 720tcacatatgt
ggtccagtga tgaccaaagc atcttttagc attttgcaaa tgaagctcaa
780atcgaatatg actaagctca tgcagtacaa atcaaaggta cactgggata
gtttaaaaga 840tacatacttg tactggttag ttttgtgtca gcttgacaca
gctggagtta tcacagagaa 900aagagcttca gttgaggaaa ttcctccatg
agatccagct atagggcatt ttctcaatta 960gtgatcaagg ggggaaggcc
ccttgtgggt gggaccatct ctgggctggt agtcttggtt 1020ctataagaga
gcaggctgag caagccagga gaagcaagcc agtaaagaac atccctccat
1080ggcttctgca tcagctcctg ctccctgacc tgcttgagtt ccagttctaa
cttctttcag 1140tgatgaacag caatgtggaa atgaaagctg aataaaccct
ttcctcccca ttttgcttct 1200tggtcatgat gtttgtgcag gaatagaaac
cctgactaag acaatactat aaaccctaaa 1260agttgtaaac caaacacatg
tgtttccatt aagccatcgt agaacaataa gtactcaacc 1320ccaagtcaca
taactataat cccagccttt gaaaaccggg atcaggaatt caaggctagc
1380ctcatctata tgtaagatta aagcctgttt gggctgcatg agactttgtt
tcaaaaaaaa 1440aaaaaaaaaa gcaaacaggc aaaaacaaac acaagacaag
acagatgtaa aatgaaggag 1500gggtagatgg gtcaagtaga aaatagcata
ggaaacgagt caagtataga agaggtggta 1560gtaaccagat catgcagaag
gactcaaggc catctcctca cagtggctta ggtaggcctt 1620cctctgctct
tgagcagggg cagagttgcc gctttaagga ggggatcagt cacctttaag
1680aactgaaaag ctgaacagtc ttctcaagtc agaagccagt ggcttcatct
tacacctctc 1740ttccttccct tgctactcat attggatctg atgatttgcc
caacttggaa gaaacatctc 1800ttctgaaggg tttcacagac accccatctt
tccgagaaag gaccgcatag gctggccatc 1860cctgtgctta caaaaggaat
aattaagaaa cttaattcca taagcaaata caacctttcc 1920aagccccaag
tggatgattt tatcttactg tttttttata tctcatcaaa taacttccaa
1980gggctcaaaa atccaaagat gtaaaaaagg aactgagctc tgtttgccaa
gccatgagga 2040ttaaataatg acattcaaag agatttttgt gccctaagta
ctttttattg gttttcatag 2100atggtttaat gtgcaagatg aagcaaacag
agatgggagt ggtatcagca tggattaagg 2160tggcagttgt gagggagggg
tactgagaga acaggacaag gtaacctatc taaggagagg 2220ccaagttggc
aagtgccagg gacttctaag cccagaacta gtacacattc cttaggtgct
2280gtttgggaag tcagggagtc accagccttg ggatctataa aagtgcatgg
tggcattcac 2340tcacatactt cctgagctgt tcgatgttga tgaagtcgtg
ggtatgagac tgttgtgtca 2400gtgacaaact atgtaaatga gaatgattgt
ttccatcttg accactaaga cgtaaaccgg 2460ttccagtgat ctccaaacat
ggcaagctac agcagagcag cagccccatc cagagccttg 2520ccctggttct
gaatggggga gaatccagtg ggagtcggtt gctgccagca tgttggggta
2580gaaggctgga gcatgacagg tccccgagga tttcctgctt cctatatggg
tagggatact 2640tgaggtcctc tcttctacct ccttccctgc agggtttata
acctctacca ctgtctgtct 2700ctgggatagc tcctagggtg cagcccctcc
ccaaaaaggc ctctccctgg cctcatgtct 2760ctaagaacag ctttctaaag
caggcctgtt acacaaaggc tcccttttcc tggcttcatc 2820gttgctggta
gacaacttcc actcgttttc cacttcagtt tcttctactc tgttgttatt
2880tgattctgat gcttgaaccc agggttgtgt agtcagcaag tgctaccccc
tccctcctct 2940tctttgtttt tttgaggcag ggtctcattt tgcccaagtg
gacctaaatt tcagcatgta 3000gctggcctgg ttttgaatgc cttctcatcc
tgcctctact tcccaagagt agcttacaag 3060tgtgcaccac catgccccgc
gatattctta tttttgagac tgttttctat gctggtttct 3120ttggggaact
acactaaggt agcttacaag tgtgcaccac catgccccgc gatattctta
3180tttttgagac tgttttctat gctggtttct ttggggaact acactaaggt
agcttcattg 3240ttggcataaa tttctcagtt caggcccata tctcctaagt
agcagaacta agcaaatctc 3300aaacaaaccc ctcaaaaaga ctgatgtcca
ctaaacggac ttctaaaata gctcctgtaa 3360tcctgagcat ttacaaggcg
gcagacctcc tataagggag taaatatgaa aacgcgcctg 3420ttcaaatgct
aggtcggtgg atagaagcaa tttcctcaga aagctgaagg caccaaaggt
3480tatatttgtt agcatttcag tgtttgccaa actcagctac agtagagatc
acagattccc 3540tatttcccag agattcaaaa ttcagcagcc cctctctaac
tatggctcag agtcgtgtca 3600ttacatatgc cccaacaaca acccccaccc
ctatcctacc cccgcctcac acgtgcaagt 3660actatcacag ttgccaacct
agcagagctg ccatcctaag gtcgaggtcg ccgctttggc 3720tgtgtgcaca
ggcaagcgcc ctcacccaat ggccctggcc ttgctatggg tgcgtgagtt
3780gagatgatgc tctggactct gaggtgaagg ccactggaac agtgaaaaaa
gctaacgcag 3840ggcttttacc tagtcccctt cctttggtgg tgggtgttta
cggaacatat ttgggatctg 3900agtgtatggt cgcaccacaa taaagcctta
acctatatag tagaatttca gctgtaatca 3960ttaagaactg agattgccac
cacccacctc actgtctgtg tcaaccacag caggctggag 4020cagtcagctc
aggaacaggc aaaaccttag gtccctccgc ctacctaacc ttcaatacat
4080caaggatagg cttctttgct tgcccaaacc tcgccccagt ctagaccacc
tggggattcc 4140cagctcaggg cgaaaaggaa gcccgagaag cattctgtag
agggaaatcc tgcatgagtg 4200cgcccccttt cgttactcca acacatccag
caaccactga acttggccgg ggaacacacc 4260tggtcctcat gcaccagcat
tgtgaccatc aacggaaaag tactattgct gcgaccccgc 4320cccttccgct
acaacgcttg gtccgcctga atcccgcccc ttcctccgtt cccagcctca
4380tctttttcgt cgtggactct cagtggcctg ggtcctggct gttttctaag
cacacccttg 4440catcttggtt cccgcacgtg ggaggcccat cccggccttg
agcacaatga cccgcgctcc 4500tcgttgcccc gcggtgcgct ctctgctgcg
cagccgatac cgggaggtgt ggccgctggc 4560aacctttgtg cggcgcctgg
ggcccgaggg caggcggctt gtgcaacccg gggacccgaa 4620gatctaccgc
actttggttg cccaatgcct agtgtgcatg cactggggct cacagcctcc
4680acctgccgac ctttccttcc accaggtggg cctccaggcg ggatccccat
gggtcagggg 4740cggaaagccg ggaggacgtg ggatagtgcg tctagctcat
gtgtcaagac cctcttctcc 4800ttaccaggtg tcatccctga aagagctggt
ggccagggtt gtgcagagac tctgcgagcg 4860caacgagaga aacgtgctgg
cttttggctt tgagctgctt aacgaggcca gaggcgggcc 4920tcccatggcc
ttcactagta gcgtgcgtag ctacttgccc aacactgtta ttgagaccct
4980gcgtgtcagt ggtgcatgga tgctactgtt gagccgagtg ggcgacgacc
tgctggtcta 5040cctgctggca cactgtgctc tttatcttct ggtgcccccc
agctgtgcct accaggtgtg 5100tgggtctccc ctgtaccaaa tttgtgccac
cacggatatc tggccctctg tgtccgctag 5160ttacaggccc acccgacccg
tgggcaggaa tttcactaac cttaggttct tacaacagat 5220caagagcagt
agtcgccagg aagcaccgaa acccctggcc ttgccatctc gaggtacaaa
5280gaggcatctg agtctcacca gtacaagtgt gccttcagct aagaaggcca
gatgctatcc 5340tgtcccgaga gtggaggagg gaccccacag gcaggtgcta
ccaaccccat caggcaaatc 5400atgggtgcca agtcctgctc ggtcccccga
ggtgcctact gcagagaaag atttgtcttc 5460taaaggaaag gtgtctgacc
tgagtctctc tgggtcggtg tgctgtaaac acaagcccag 5520ctccacatct
ctgctgtcac caccccgcca aaatgccttt cagctcaggc catttattga
5580gaccagacat ttcctttact ccaggggaga tggccaagag cgtctaaacc
cctcattcct 5640actcagcaac ctccagccta acttgactgg ggccaggaga
ctggtggaga tcatctttct 5700gggctcaagg cctaggacat caggaccact
ctgcaggaca caccgtctat cgcgtcgata 5760ctggcagatg cggcccctgt
tccaacagct gctggtgaac catgcagagt gccaatatgt 5820cagactcctc
aggtcacatt gcaggtttcg aacagcaaac caacaggtga cagatgcctt
5880gaacaccagc ccaccgcacc tcatggattt gctccgcctg cacagcagtc
cctggcaggt 5940atatggtttt cttcgggcct gtctctgcaa ggtggtgtct
gctagtctct ggggtaccag 6000gcacaatgag cgccgcttct ttaagaactt
aaagaagttc atctcgttgg ggaaatacgg 6060caagctatca ctgcaggaac
tgatgtggaa gatgaaagta gaggattgcc actggctccg 6120cagcagcccg
ggtgagcatg gctggtctcc agctgaatgc attaggggcc cagaaaaggg
6180agacaatggg tggcagtaac ccaggtcccc agtggtgtgg tggctttatg
cagtccgtgg 6240ttggatgagt tccatcttat ggtctctgac tccaagctcc
ctccagctcg ccttgcacaa 6300actaagattc ttgtccaagc cctgggcagg
ttctcagggc tggggacatt gtggtgaaca 6360gataagcaga cggggagcat
ggtggatagg agttctggca cagtgcacca gagagagtct 6420ggaagcgcta
gtgagagcta atgtaagggc ccgtggttcg ccaaagaatg ataaccccgg
6480actcaaatag tatgccaaag caaggagcat ttcattctgc agaaatcaag
catgcaggtg 6540gggggggggg gttgctctca ttccaagatg gagagacaac
caagtataga ttttaagggg 6600atcgggggcc tttatcttac tccatctcta
ggggcattcc attactgggg catggggttg 6660gaggttggaa actgttaatg
gggaggtctg gaaacttgct gccccattgt ccttgcttca 6720ggctaggtag
ctgagtagct tctaatggca ggatagtttc tgactagctg tctaaagtct
6780ggggtgtttg tttttttgtt ttttctagta acttacttgc ctgaacttgc
tcagttttta 6840ggcctggtct cctggactgc caatttgaag cctattaagg
agtcagcctg tctcactact 6900ccaggttatc tataatcccc ctgtagaacg
gtacctcact gataacaatg acagaccaac 6960ataggaaccc actatccttg
tggtgcatga gtttcaaagg ttcttctggt cctcccagtg 7020tgcagatcca
tgcttaagct atggtcctcc cagtgtgcag atccgtgctt aagctatggt
7080cttgcagctg ctcgatctac aaagggtagg gtgaacgaag gaaagataaa
tgaaaaaaaa 7140aaaactgttt cctacagtga agatcgctgc cccatcttag
ctatgagaag ggactgggga 7200gtggagcctg gtgcataaaa gaggattgtg
ttacttggaa ggctgcagag cctggactcc 7260tgtgccctcc ttgcctggtt
ttctgggttt aatgttgagg ttggccctct gtagtcacta 7320cctgacccct
tccctttcag ccaaccctcc ggttacaccc tgtgcatgta tggaaggggc
7380caaacgccct atcctgctct cccttcccca aaattcttag gatattaaca
acttatgggg 7440aaaagatggt agagctatgt ttacccacca tgtacttggg
aagctccgaa gtaagctt 74983144DNAArtificial SequenceNCO1 fragment
containing hTERT upstream sequencesand the first intron of hTERT
from lambdaGPhi5 into the NCO1 site of a pBBS167 (variant of pUC
cloning vector with MCS) 3atgaccatga ttacgaattc gagctcggta
cccggggatc ctctagagtc gacctgcagg 60catgcccatg gcaggcctcg cgcgcgagat
ctcgggccca atcgatgccg cggcgatatc 120gctcgaggaa gcttggcact ggcc
144437DNAArtificial SequenceDescription of Artificial Sequence RA94
4cccggccacc cccgcgaatt cgcgcgctcc ccgctgc 37565DNAArtificial
SequenceDescription of Artificial Sequence RA91 5ttgtactgag
agtgcaccat atgcggtgtg catgctacgt aagaggttcc aactttcacc 60ataat
65616DNAArtificial SequenceDescription of Artificial Sequence RA96
6aattgcgaag cttacg 16716DNAArtificial SequenceDescription of
Artificial Sequence RA97 7aattcgtaag cttcgc 16860DNAArtificial
SequenceDescription of Artificial Sequence oligo RA101 8taggtaccga
gctcttacgc gtgctagccc cacgtggcgg agggactggg gacccgggca
60958DNAArtificial SequenceDescription of Artificial Sequence oligo
RA100 9taggtaccga gctcttacgc gtgctagccc ctcgctggcg tccctgcacc
ctgggagc 581033DNAArtificial SequenceDescription of Artificial
Sequence RA107 10cgtcctgctg cgcactcagg aagccctggc ccc
33116DNAArtificial SequenceDescription of Artificial Sequence 'B'
class E-Box just proximal to the hTERT initiating Met in pGRN262
11cacgtg 6126DNAArtificial SequenceDescription of Artificial
Sequence changed 'B' class E-Box just proximal to the hTERT
initiating Met in pGRN262 12cactca 61325DNAArtificial
SequenceDescription of Artificial Sequence COD1941 13gatgaatgct
catgattccg tatgg 251457DNAArtificial SequenceDescription of
Artificial Sequence COD2866 14cagcatcttt tactttcacc agcgtttctg
ggtgcgcaaa aacaggaagg caaaatg 571558DNAArtificial
SequenceDescription of Artificial Sequence RA104 15taggtaccga
gctcttacgc gtgctagccc ctcccagccc ctccccttcc tttccgcg
581633DNAArtificial SequenceDescription of Artificial Sequence
RA122 16gaccgcgctt cccactcagc ggagggactg ggg 3317298DNAHomo
sapiensHuman TERT promoter 17caggccgggc tcccagtgga ttcgcgggca
cagacgccca ggaccgcgct tcccacgtgg 60cggagggact ggggacccgg gcacccgtcc
tgccccttca ccttccagct ccgcctcctc 120cgcgcggacc ccgccccgtc
ccgacccctc ccgggtcccc ggcccagccc cctccgggcc 180ctcccagccc
ctccccttcc tttccgcggc cccgccctct cctcgcggcg cgagtttcag
240gcagcgctgc gtcctgctgc gcacgtggga agccctggcc ccggccaccc ccgcgatg
29818262DNAMus sp.Mouse TERT promoter 18cagcaaccac tgaacttggc
cggggaacac acctggtcct catgcaccag cattgtgacc 60atcaacggaa aagtactatt
gctgcgaccc cgccccttcc gctacaacgc ttggtccgcc 120tgaatcccgc
cccttcctcc gttcccagcc tcatcttttt cgtcgtggac tctcagtggc
180ctgggtcctg gctgttttct aagcacaccc ttgcatcttg gttcccgcac
gtgggaggcc 240catcccggcc ttgagcacaa tg 2621977DNAHomo sapiensHuman
TERT promoter 19ctcgcggcgc gagtttcagg cagcgctgcg tcctgctgcg
cacgtgggaa gccctggccc 60cggccacccc cgcgatg 772089DNAArtificial
SequenceDescription of Artificial Sequence E-box reporter construct
20ctcgcggcgc gagtttcagg cagcgctgcg tcctgctgcg cacgtgggaa gccctggccc
60cggccacccc cgcgaattcg cccaccatg 892156DNAArtificial
SequenceDescription of Artificial Sequence E-box reporter construct
(with portion deleted) 21ctcgcggcgc gagtttcagg cagcgctgcg
tcctgctgcc gaattcgccc accatg 5622497DNAHomo sapiensHuman TERT
promoter 22actccagcat aatcttctgc ttccatttct tctcttccct cttttaaaat
tgtgttttct 60atgttggctt ctctgcagag aaccagtgta agctacaact taacttttgt
tggaacaaat 120tttccaaacc gcccctttgc cctagtggca gagacaattc
acaaacacag ccctttaaaa 180aggcttaggg atcactaagg ggatttctag
aagagcgacc cgtaatccta agtatttaca 240agacgaggct aacctccagc
gagcgtgaca gcccagggag ggtgcgaggc ctgttcaaat 300gctagctcca
taaataaagc aatttcctcc ggcagtttct gaaagtagga aaggttacat
360ttaaggttgc gtttgttagc atttcagtgt ttgccgacct cagctacagc
atccctgcaa 420ggcctcggga gacccagaag tttctcgccc cttagatcca
aacttgagca acccggagtc 480tggattcctg ggaagtc 49723425DNAMus sp.Mouse
TERT promoter 23caagtgtgca ccaccatgcc ccgcgatatt cttatttttg
agactgtttt ctatgctggt 60ttctttgggg aactacacta aggtagcttc attgttggca
taaatttctc agttcaggcc 120catatctcct aagtagcaga actaagcaaa
tctcaaacaa acccctcaaa aagactgatg 180tccactaaac ggacttctaa
aatagctcct gtaatcctga gcatttacaa ggcggcagac 240ctcctataag
ggagtaaata tgaaaacgcg cctgttcaaa tgctaggtcg gtggatagaa
300gcaatttcct cagaaagctg aaggcaccaa aggttatatt tgttagcatt
tcagtgtttg 360ccaaactcag ctacagtaga gatcacagat tccctatttc
ccagagattc aaaattcagc 420agccc 425
* * * * *
References