U.S. patent application number 11/820768 was filed with the patent office on 2008-02-14 for transgenic ungulates capable of human antibody production.
Invention is credited to Philippe Collas, Richard A. Goldsby, Isao Ishida, Poothappillai Kasinathan, Yoshimi Kuroiwa, Barbara Osborne, James M. Robl, Eddie Sullivan, Kazuma Tomizuka.
Application Number | 20080040821 11/820768 |
Document ID | / |
Family ID | 32046219 |
Filed Date | 2008-02-14 |
United States Patent
Application |
20080040821 |
Kind Code |
A1 |
Robl; James M. ; et
al. |
February 14, 2008 |
Transgenic ungulates capable of human antibody production
Abstract
The invention features novel methods for the production of large
quantities of xenogenous antibodies, such as human antibodies.
Preferably, this result is effected by inactivation of IgM heavy
chain expression and, optionally, by inactivation of Ig light chain
expression, and by the further introduction of an artificial
chromosome which results in the expression of xenogenous antibodies
(e.g., non-bovine antibodies), preferably human antibodies.
Inventors: |
Robl; James M.; (Brandon,
SD) ; Collas; Philippe; (Oslo, NO) ; Sullivan;
Eddie; (Tea, SD) ; Kasinathan; Poothappillai;
(Sioux Falls, SD) ; Goldsby; Richard A.;
(Leverett, MA) ; Kuroiwa; Yoshimi; (Sioux Falls,
SD) ; Tomizuka; Kazuma; (Takasaki, JP) ;
Ishida; Isao; (Isehara-shi, JP) ; Osborne;
Barbara; (Leverett, MA) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Family ID: |
32046219 |
Appl. No.: |
11/820768 |
Filed: |
June 20, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10441503 |
May 19, 2003 |
|
|
|
11820768 |
Jun 20, 2007 |
|
|
|
09988115 |
Nov 16, 2001 |
7074983 |
|
|
11820768 |
Jun 20, 2007 |
|
|
|
09714185 |
Nov 17, 2000 |
|
|
|
11820768 |
Jun 20, 2007 |
|
|
|
10032191 |
Dec 21, 2001 |
7253334 |
|
|
10441503 |
|
|
|
|
60381531 |
May 17, 2002 |
|
|
|
60311625 |
Aug 9, 2001 |
|
|
|
60256458 |
Dec 20, 2000 |
|
|
|
60166410 |
Nov 19, 1999 |
|
|
|
60258151 |
Dec 22, 2000 |
|
|
|
Current U.S.
Class: |
800/6 ; 435/325;
800/14; 800/17 |
Current CPC
Class: |
A01K 67/0273 20130101;
A01K 2267/01 20130101; A01K 2217/00 20130101; C12N 2800/208
20130101; A01K 67/0275 20130101; C12N 15/8771 20130101; C07K 16/42
20130101; C07K 2317/21 20130101; C12N 2799/025 20130101; A01K
67/0278 20130101; C12N 15/8509 20130101; C07K 16/00 20130101; A01K
2207/15 20130101 |
Class at
Publication: |
800/006 ;
435/325; 800/014; 800/017 |
International
Class: |
A01K 67/027 20060101
A01K067/027; C12N 5/10 20060101 C12N005/10 |
Claims
1. A transgenic ungulate whose genome comprises a mutation in an
endogenous immunoglobulin (Ig) heavy chain or Ig light chain locus,
said mutation reducing the expression of said Ig heavy chain or Ig
light chain.
2. The ungulate of claim 1, wherein said mutation reduces the
expression of functional IgM heavy chain.
3. The ungulate of claim 1, wherein said mutation substantially
eliminates the expression of said Ig heavy chain or said Ig light
chain.
4. The ungulate of claim 1, wherein said mutation is
hemizygous.
5. The ungulate of claim 1, wherein said mutation is
homozygous.
6. The ungulate of claim 1, wherein said mutation is an insertion
of a positive selection marker into said endogenous locus.
7. The ungulate of claim 6, wherein said positive selection marker
is an antibiotic resistance gene.
8. The ungulate of claim 7, wherein each allele comprises the same
antibiotic resistance gene.
9. The ungulate of claim 7, wherein each allele comprises a
different antibiotic resistance gene.
10. The ungulate of claim 6, wherein said positive selection marker
is operably linked to a xenogenous promoter.
11. The ungulate of claim 1, wherein said mutation is an insertion
of a transcription termination sequence into said endogenous
loci.
12. The ungulate of claim 11, wherein said transcription
termination sequence is inserted downstream of the initial ATG
codon in exon 2 of an endogenous mu heavy chain locus.
13. The ungulate of claim 1, comprising one or more nucleic acids
comprising one or more transgenes and expressing an mRNA or protein
encoded by said transgene(s).
14. The ungulate of claim 1, the cells of said ungulate further
comprising one or more chromosomal fragments comprising one or
more, all or part of an unrearranged xenogenous Ig locus which
undergoes rearrangement and expresses one or more xenogenous Ig
molecules in B-cells.
15. The ungulate of claim 14, wherein said molecule is an antibody
protein.
16. The ungulate of claim 15, wherein said antibody protein is a
human antibody protein.
17. The ungulate of claim 1, wherein said ungulate is a pig.
18. An isolated ungulate somatic cell comprising a mutation in an
endogenous immunoglobulin (Ig) heavy chain or Ig light chain locus,
said mutation reducing the expression of said Ig heavy chain or Ig
light chain.
19. The cell of claim 18, comprising a mutation in both alleles of
said IgM heavy chain or said light chain.
20. The cell of claim 18, wherein said mutation is a transcription
termination sequence.
21. The cell of claim 20, wherein said transcription termination
sequence is inserted downstream of the initial ATG codon in exon 2
of an endogenous mu heavy chain locus.
22. The cell of claim 18, further comprising one or more
chromosomal fragments comprising one or more, all or part of a
xenogenous Ig locus.
23. The cell of claim 18, wherein said cell is a fetal fibroblast
or a B-cell.
24. The cell of claim 18, wherein said ungulate is a pig.
25. A method of producing antibodies, said method comprising the
steps of: (a) administering one or more antigens of interest to an
ungulate whose genome comprises a mutation in an endogenous
immunoglobulin (Ig) heavy chain or Ig light chain locus and the
cells of said ungulate further comprising a chromosomal fragment or
fragments comprising an unrearranged human light chain locus and an
unrearranged human heavy chain locus, wherein the loci undergo
rearrangement resulting in the production of human antibody
proteins specific for said one or more antigens; and (b) recovering
said human antibodies from said ungulate.
26. The method of claim 25, wherein said mutation is an insertion
of a transcription termination sequence into said endogenous
locus.
27. The method of claim 26, wherein said transcription termination
sequence is inserted downstream of the initial ATG codon in exon 2
of an endogenous mu heavy chain locus.
28. A method of producing antibodies, said method comprising
recovering human antibodies from an ungulate whose genome comprises
a mutation in an endogenous immunoglobulin (Ig) heavy chain or Ig
light chain locus and the cells of said ungulate further comprising
a chromosomal fragment comprising a human antibody gene locus,
wherein said antibody gene locus undergoes rearrangement resulting
in the production of human antibodies.
29. The method of claim 28, wherein said mutation is a
transcription termination sequence into said endogenous locus.
30. The method of claim 29, wherein said transcription termination
sequence is inserted downstream of the initial ATG codon in exon 2
of an endogenous mu heavy chain locus.
31. The method of claims 25 or 28, wherein said antibodies are
directed against a desired antigen.
32. The method of claims 25 or 28, wherein said antibodies are
polyclonal.
33. The method of claims 25 or 28, wherein said antibodies are
recovered from the serum of said ungulate.
34. The method of claims 25 or 28, wherein said ungulate is a
pig.
35. A method for producing a transgenic ungulate having reduced
expression of an endogenous Ig heavy chain or Ig light chain locus,
said method comprising the steps of: (a) incubating a permeabilized
cell of claim 18 in an extract from a mitotic somatic cell or
oocyte under conditions that allow chromatin condensation and
nuclear envelope breakdown in said permeabilized cell; (b)
inserting said cell formed in step (a) into a nucleated or
enucleated ungulate oocyte, thereby forming a reconstituted oocyte;
and (c) transferring said reconstituted oocyte or an embryo formed
from said reconstituted oocyte into the uterus of a host ungulate
under conditions that allow said reconstituted oocyte or said
embryo to develop into a fetus.
36. The method of claim 35, wherein, prior to step (b), said cell
is incubated under conditions that allow the membrane of said cell
to reseal.
37. The method of claim 35, wherein said cell is purified from said
extract prior to insertion into said oocyte.
38. The method of claim 35, wherein said fetus develops into a
viable offspring.
39. The method of claim 38, further comprising mating two offspring
to produce a transgenic ungulate whose genome comprises mutations
in both alleles of an endogenous immunoglobulin (Ig) heavy chain or
Ig light chain locus.
40. The method of claim 35, wherein said oocyte from step (b) is
cultured under conditions that allow cell division and one of the
resulting cells is recloned one or more times.
41. The method of claim 35, wherein said permeabilized cell and
said oocyte are from the same species.
42. The method of claim 35, wherein said permeabilized cell is a
fibroblast, epithelial cell, neural cell, epidermal cell,
keratinocyte, hematopoietic cell, melanocyte, chondrocyte,
macrophage, monocyte, fibroblast, muscle cell, embryonic stem cell,
embryonic germ cell, fetal cell, placental cell, a cell of the
female reproductive system, or embryonic cell.
43. The method of claim 35, wherein said mutation in said
endogenous locus of said ungulate somatic cell of claim 18 is an
insertion of a transcription termination sequence into said
endogenous locus.
44. The method of claim 43, wherein said transcription termination
sequence is inserted downstream of the initial ATG codon in exon 2
of an endogenous mu heavy chain locus.
45. The method of claim 35, wherein said ungulate is a pig.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of Ser. No. 10/441,503,
filed May 19, 2003 which claims the benefit of U.S. provisional
application 60/381,531, filed May 17, 2002, and U.S. provisional
application 60/425,056 filed Nov. 8, 2002, which are each hereby
incorporated by reference. U.S. application Ser. No. 10/441,503 is
also a continuation-in part of U.S. utility application Ser. No.
09/988,115, filed Nov. 16, 2001, which claims the benefit of U.S.
provisional patent application 60/311,625, filed Aug. 9, 2001 and
U.S. provisional patent application 60/256,458, filed Dec. 20,
2000, and is a continuation-in-part of U.S. utility application
Ser. No. 09/714,185, filed Nov. 17, 2000, which claims the benefit
of U.S. provisional patent application 60/166,410, filed Nov. 19,
1999. Additionally, this application is a continuation-in part of
U.S. utility application Ser. No. 10/032,191, filed Dec. 21, 2001,
which claims the benefit of 60/258,151, filed Dec. 22, 2000.
BACKGROUND OF THE INVENTION
[0002] In general, the invention provides a genetically modified
ungulate that contains either part or all of a xenogenous antibody
gene locus, which undergoes rearrangement and expresses a diverse
population of antibody molecules. In particular, the xenogenous
antibody gene may be of human origin. In addition, the present
invention provides for an ungulate in which expression of the
endogenous antibody genes is either reduced or eliminated. The
genetic modifications in the ungulate (for example, bovine) are
made using a combination of nuclear transfer and molecular
techniques. These cloned, transgenic ungulate (e.g., bovines)
provide a replenishable, theoretically infinite supply of
xenogenous polyclonal antibodies, particularly human antibodies,
which have use, e.g., as therapeutics, diagnostics and for
purification purposes. The invention also features methods for
reducing the amount of endogenous antibody in non-human mammals,
such as ungulates, that express both endogenous and xenogenous
antibody. These methods increase the percentage of xenogenous
B-cells and xenogenous antibody expressed by the mammals.
[0003] In 1890, Shibasaburo Kitazato and Emil Behring reported an
experiment with extraordinary results; particularly, they
demonstrated that immunity can be transferred from one animal to
another by taking serum from an immune animal and injecting it into
a non-immune one. This landmark experiment laid the foundation for
the introduction of passive immunization into clinical practice.
Today, the preparation and use of human immunoglobulin (Ig) for
passive immunization is standard medical practice. In the United
States alone, there is a $1,400,000,000 per annum market for human
Ig, and each year more than 16 metric tons of human antibody is
used for intravenous antibody therapy. Comparable levels of
consumption exist in the economies of most highly industrialized
countries, and the demand can be expected to grow rapidly in
developing countries. Currently, human antibody for passive
immunization is obtained from the pooled serum of human donors.
This means that there is an inherent limitation in the amount of
human antibody available for therapeutic and prophylactic usage.
Already, the demand exceeds the supply and severe shortfalls in
availability have been routine. Thus improved methods are needed to
generate human antibody that is free of non-human antibody for
clinical applications.
[0004] For example, improved methods and enhanced transgenic
animals that produce polyclonal antibodies of a desired species
(e.g., human Igs) in the bloodstream and which produce an array of
different antibodies which are specific to a desired antigen would
be highly desirable. Most especially, the production of human Igs
in ungulates, such as cows, would be particularly beneficial given
that (1) cows could produce large quantities of antibody, (2) cows
could be immunized with human or other pathogens and (3) cows could
be used to make human antibodies against human antigens. The
availability of large quantities of polyclonal antibodies would be
advantageous for treatment and prophylaxis for infectious disease,
modulation of the immune system, removal of undesired human cells
such as cancer cells, and modulation of specific human
molecules.
SUMMARY OF THE INVENTION
[0005] Transgenic ungulates expressing a xenogenous antibody and/or
expressing decreased levels of functional, endogenous antibody In a
first aspect, the invention provides a transgenic ungulate (e.g., a
bovine) having one or more nucleic acids encoding all or part of a
xenogenous immunoglobulin (Ig) gene which undergoes rearrangement
and expresses more than one xenogenous Ig protein. In a preferred
embodiment, the nucleic acid encoding all or part of a xenogenous
Ig gene is human. Preferably, the nucleic acid encodes a xenogenous
antibody, such as a human antibody or a polyclonal antibody. In
various embodiments, the Ig chain or antibody is expressed in serum
and/or milk.
[0006] In another aspect, the invention features a transgenic
ungulate (e.g., a bovine) having a mutation that reduces the
expression of an endogenous antibody. Preferably, the mutation
reduces the expression of functional IgM heavy chain or
substantially eliminates the expression of functional IgM heavy
chain. In some embodiments, a transcription termination sequence is
inserted in an endogenous mu heavy chain nucleic acid (e.g.,
inserted downstream of the initial ATG codon in exon 2). In other
preferred embodiments, the mutation reduces the expression of
functional Ig light chain or substantially eliminates the
expression of functional Ig light chain. In yet other preferred
embodiments, the mutation reduces the expression of functional IgM
heavy chain and functional Ig light chain, or the mutation
substantially eliminates the expression of functional IgM heavy
chain and functional Ig light chain. In another preferred
embodiment, the ungulate has one or more nucleic acids encoding all
or part of a xenogenous Ig gene which undergoes rearrangement and
expresses more than one xenogenous Ig molecule, such as a
xenogenous antibody protein.
[0007] Cells from transgenic ungulates expressing a xenogenous
antibody and/or expressing decreased levels of functional,
endogenous antibody The invention also provides cells obtained from
any of the ungulates (e.g., bovines) of the invention or cells that
are useful in the production of any of the ungulates of the
invention.
[0008] Accordingly, in another aspect, the invention features an
ungulate somatic cell (e.g., a bovine somatic cell) having one or
more nucleic acids encoding all or part of a xenogenous Ig gene
that is capable of undergoing rearrangement and expressing one or
more xenogenous Ig molecules in B cells. Preferably, the nucleic
acid encoding all or part of a xenogenous Ig gene expresses a
xenogenous antibody protein. Exemplary ungulate cells include fetal
fibroblasts and B-cells.
[0009] In another aspect, the invention features an ungulate
somatic cell (e.g., a bovine somatic cell) having a mutation in a
nucleic acid encoding an Ig heavy and/or light chain. In preferred
embodiments, the cell has a mutation in one or both alleles of the
IgM heavy chain or the Ig light chain. In some embodiments, a
transcription termination sequence is inserted in an endogenous mu
heavy chain nucleic acid (e.g., inserted downstream of the initial
ATG codon in exon 2) or Ig light chain nucleic acid. In some
embodiments, a transcription termination sequence is inserted in an
endogenous mu heavy chain nucleic acid (e.g., inserted downstream
of the initial ATG codon in exon 2) or Ig light chain nucleic acid.
Exemplary mutations include nonsense and deletion mutations. In
preferred embodiments, the cell also has one or more nucleic acids
encoding all or part of a xenogenous Ig gene that is capable of
undergoing rearrangement and expressing one or more xenogenous Ig
molecules in B cells. Preferably, the nucleic acids encoding all or
part of a xenogenous Ig gene expresses a xenogenous antibody, such
as an antibody protein from another genus (e.g., a human antibody).
Exemplary ungulate cells include fetal fibroblasts and B-cells.
[0010] In another aspect, the invention features a hybridoma formed
from the fusion of an ungulate B-cell of the invention with a
myeloma cell. Preferably, the hybridoma secretes an exogenous
antibody, such as a human antibody.
[0011] Methods for producing xenogenous antibodies in transgenic
ungulates The invention also provides methods for producing
antibodies using an ungulate (e.g., a bovine embryo, fetus, calf,
or adult) of the invention. One such method involves administering
one or more antigens of interest to an ungulate (e.g., a bovine
embryo, fetus, calf, or adult) having one or more nucleic acids
encoding a xenogenous antibody gene locus. The nucleic acid
segments in the gene locus undergo rearrangement resulting in the
production of antibodies specific for the antigen, and the
antibodies are recovered from the ungulate. The antibodies may be
monoclonal or polyclonal. Monoclonal and polyclonal antibodies
against particular antigens have a variety of uses; for example,
they may be used as ingredients in prophylactic or therapeutic
compositions for infection of pathogenic microorganisms such as
bacteria or viruses. In various embodiments, the antibodies are
recovered from the serum or milk of the ungulate. In preferred
embodiments, the ungulate has a mutation that reduces the
expression of an endogenous antibody, that reduces the expression
of functional IgM heavy chain, or that reduces the expression of
functional Ig light chain. In some embodiments, a transcription
termination sequence is inserted in an endogenous mu heavy chain
nucleic acid (e.g., inserted downstream of the initial ATG codon in
exon 2) or Ig light chain nucleic acid.
[0012] In a related aspect, the invention features another method
of producing antibodies. This method involves recovering xenogenous
antibodies from an ungulate (e.g., a bovine embryo, fetus, calf, or
adult) having nucleic acid encoding a xenogenous antibody gene
locus. The nucleic acid segments in the gene locus undergo
rearrangement resulting in the production of xenogenous antibody
proteins. In particular embodiments, the light chain of the
antibodies and/or the heavy chain of the antibodies is encoded by a
human nucleic acid. The antibodies may be monoclonal or polyclonal.
In particular embodiments, polyclonal antibodies, such as IgG
antibodies generated without immunization of the ungulate with a
specific antigen, are used as a therapeutic substitute for IVIG
(intravenous immunoglobulin) produced from human serum. In various
embodiments, the antibodies are recovered from the serum or milk of
the ungulate. Preferably, the ungulate has a mutation that reduces
the expression of an endogenous antibody, reduces the expression of
functional IgM heavy chain, or reduces the expression of functional
Ig light chain. Preferably, a transcription termination sequence is
inserted in an endogenous mu heavy chain nucleic acid (e.g.,
inserted downstream of the initial ATG codon in exon 2) or Ig light
chain nucleic acid.
[0013] Methods for producing transgenic ungulates The invention
also provides methods for producing transgenic ungulates (e.g.,
bovine embryos, fetuses, calves, or adults). These methods may be
used to produce transgenic ungulates having a desired mutation or
having a desired xenogenous nucleic acid.
[0014] In one such aspect, the invention features a method of
producing a transgenic ungulate (e.g., bovine embryos, fetuses,
calves, or adults) that involves inserting a cell, a chromatin mass
from a cell, or a nucleus from a cell into an oocyte. The cell
includes a first mutation in an endogenous antibody heavy chain
and/or light chain nucleic acid. The oocyte or an embryo formed
from the oocyte is transferred into the uterus of a host ungulate,
preferably under conditions that allow the oocyte or the embryo to
develop into a fetus. Preferably, the fetus develops into a viable
offspring. In some embodiments, the cell includes one or more
nucleic acids encoding all or part of a xenogenous Ig gene that is
capable of undergoing rearrangement and expressing one or more
xenogenous Ig molecules in B cells. Preferably, a transcription
termination sequence is inserted in an endogenous mu heavy chain
nucleic acid (e.g., inserted downstream of the initial ATG codon in
exon 2) or Ig light chain nucleic acid of the cell.
[0015] In various embodiments of the above aspect, the method also
includes isolating a cell from the embryo, the fetus, or an
offspring produced from the fetus and introducing a second mutation
in an endogenous antibody heavy chain and/or light chain nucleic
acid in the cell. The cell, a chromatin mass from the cell, or a
nucleus from the cell is inserted into an oocyte, and the oocyte or
an embryo formed from the oocyte is transferred into the uterus of
a host ungulate under conditions that allow the oocyte or the
embryo to develop into a fetus.
[0016] In yet another aspect, the invention features another method
of producing a transgenic ungulate (e.g., a bovine embryo, fetus,
calf, or adult). This method involves inserting a cell having one
or more xenogenous nucleic acids, a chromatin mass from the cell,
or a nucleus from the cell into an oocyte. The xenogenous nucleic
acid encodes all or part of a xenogenous Ig gene, and the gene is
capable of undergoing rearrangement and expressing more than one
xenogenous Ig molecule in B cells. The oocyte or an embryo formed
from the oocyte is transferred into the uterus of a host ungulate,
preferably under conditions that allow the oocyte or the embryo to
develop into a fetus. Preferably, the fetus develops into a viable
offspring. Preferably, the nucleic acid encoding all or part of a
xenogenous Ig gene encodes a xenogenous antibody. In other
preferred embodiments, the antibody is a polyclonal antibody. In
yet other preferred embodiments, the immunoglobulin chain or
antibody is expressed in serum and/or milk. In some embodiments,
the donor cell has a mutation in an endogenous antibody heavy chain
and/or light chain nucleic acid, such as an insertion of a
transcription termination sequence.
[0017] Methods for reducing the amount of undesired endogenous
antibody in an ungulate that expresses both endogenous and
xenogenous antibody and methods for producing xenogenous antibody
in the ungulate The invention also features improved methods for
producing primarily or only xenogenous antibody in a non-human
mammal, such as an ungulate (e.g., a bovine). In particular, these
methods involve administering a compound that inhibits endogenous
B-cell activity or that destroys endogenous B-cells, such as an
anti-IgM or anti-Ig antibody, to a mammal that expresses both
endogenous and xenogenous antibody in an amount sufficient to
reduce the activity or amount of endogenous B-cells or antibody.
These compounds may be administered during the normal period of
development of the mammal's immune system (i.e., during the
embryonic, fetal, or postnatal stage) or after this period of
immune system development. Preferably, antibodies that inhibit
endogenous B-cells or antibodies do not substantially inhibit
xenogenous B-cells or fully xenogenous antibodies. The resulting
monoclonal or polyclonal xenogenous antibodies have a variety of
uses; for example, they may be used as ingredients in prophylactic
or therapeutic compositions for infection of pathogenic
microorganisms such as bacteria or viruses.
[0018] Accordingly, in one aspect, the invention provides a method
of reducing the quantity or activity of endogenous antibody in a
non-human mammal (e.g., an ungulate). This method involves
administering an antibody that is reactive with a fully or
partially endogenous antibody to an ungulate (e.g., a bovine)
expressing both an endogenous antibody and a xenogenous antibody in
an amount sufficient to reduce the quantity and/or activity of the
fully or partially endogenous antibody. In a preferred embodiment,
the antibody is administered prior to colostrum.
[0019] In a related aspect, the invention provides a method of
producing a xenogenous antibody in a non-human mammal (e.g., an
ungulate). This method involves administering an antibody that is
reactive with a fully or partially endogenous antibody to an
ungulate (e.g., a bovine) expressing both an endogenous antibody
and a xenogenous antibody in an amount sufficient to reduce the
quantity or activity of the fully or partially endogenous antibody.
The xenogenous antibody is recovered from the ungulate. In
preferred embodiments, the xenogenous antibody is recovered from
the serum or milk of the ungulate. In other preferred embodiment,
some or all of the xenogenous antibodies are fully xenogenous
antibodies. In a preferred embodiment, the antibody is administered
prior to colostrum.
[0020] In another related aspect, the invention provides another
method of producing a xenogenous antibody in a non-human mammal
(e.g., an ungulate). This method involves inserting a cell,
nucleus, or chromatin mass into an enucleated oocyte, thereby
forming a nuclear transfer oocyte. The cell, nucleus, or chromatin
mass has a nucleic acid encoding a first xenogenous antibody and a
nucleic acid encoding a second antibody reactive with an endogenous
antibody. The nuclear transfer oocyte or an embryo formed from the
nuclear transfer oocyte is transferred to the uterus of a host
mammal under conditions that allow it to develop into a fetus or
live offspring. The fetus or offspring expresses the xenogenous
first antibody and the second antibody, and the second antibody
reduces the quantity and/or activity of the endogenous antibody.
Preferably, the second antibody is expressed under the control of a
liver-specific promoter. Some preferred second antibodies react
with endogenous IgM or endogenous immunoglobulin molecules. The
xenogenous antibody is preferably recovered from the ungulate. In
preferred embodiments, the xenogenous antibody is recovered from
the serum or milk of the ungulate. In other preferred embodiment,
some or all of the xenogenous antibodies are fully xenogenous
antibodies
[0021] Methods for cloning non-human mammals using cells from two
embryos in which cells from a nuclear transfer embryo are
preferentially incorporated into the resulting fetal tissue and
cells from another embryo are preferentially incorporated into the
resulting placental tissue to promote viability of the fetus The
invention also provides improved methods for cloning non-human
mammals. These mammals are formed by combining cells from a nuclear
transfer first embryo (e.g., an embryo formed by inserting a cell,
nucleus, or chromatin mass into an enucleated oocyte) with cells
from an in vitro fertilized, naturally-occurring, or
parthenogenetically activated second embryo. This resulting
chimeric embryo is transferred to the uterus of a host mammal under
conditions that allow it to develop into a fetus or live offspring.
At least some of the cells from the second embryo are preferably
incorporated into placental tissue and promote the viability of the
resulting chimeric embryo. Preferably, the majority of the cells
and their progeny from the nuclear transfer first embryo, rather
than from the second embryo, are incorporated into fetal tissue of
the resulting chimeric embryo. Thus, the majority of the cells in
the fetus or offspring from this chimeric embryo preferably have a
genome that is substantially identity or identical to that of the
nuclear transfer embryo first embryo rather than to that of the
second embryo. To reduce the number of cells and their progeny from
the second embryo that are incorporated into the fetal tissue or
offspring, an antibody that is reactive with an antigen from the
second embryo is administered to the chimeric embryo, fetus, or
offspring in an amount sufficient to reduce the quantity and/or
activity of cells from the second embryo that are incorporated into
the fetus or offspring.
[0022] Accordingly, in one aspect the invention provides a method
of cloning a non-human mammal. This method involves inserting a
cell, nucleus, or chromatin mass into an oocyte, thereby forming a
first embryo. One or more cells from the first embryo are contacted
with one or more cells from a second embryo (e.g., an in vitro
fertilized embryo, naturally-occurring embryo, or
parthenogenetically activated embryo), thereby forming a third
embryo. The third embryo is transferred into the uterus of a host
mammal under conditions that allow the third embryo to develop into
a fetus or live offspring. An antibody that is reactive with an
antigen (e.g., a B-cell or germ cell antigen) from the second
embryo is administered to the third embryo, fetus, or offspring in
an amount sufficient to reduce the quantity and/or activity of
cells from the second embryo that are incorporated into the third
embryo, fetus, or offspring.
[0023] In a related aspect, the invention provides another method
of cloning a non-human mammal. This method involves incubating a
permeabilized cell in a reprogramming media under conditions that
allow the removal of a factor from a nucleus, chromatin mass, or
chromosome of the permeabilized cell or the addition of a factor
from the reprogramming media to the nucleus, chromatin mass, or
chromosome, thereby forming a reprogrammed cell. The reprogrammed
cell is inserted into an oocyte, thereby forming a first embryo.
One or more cells from the first embryo are contacted with one or
more cells from a second embryo (e.g., an in vitro fertilized
embryo, naturally-occurring embryo, or parthenogenetically
activated embryo), thereby forming a third embryo. The third embryo
is transferred into the uterus of a host mammal under conditions
that allow the third embryo to develop into a fetus or live
offspring. An antibody that is reactive with an antigen from the
second embryo is administered to the third embryo, fetus, or
offspring in an amount sufficient to reduce the quantity and/or
activity of cells from the second embryo that are incorporated into
the third embryo, fetus, or offspring.
[0024] The invention also provides methods for generating chimeric
fetuses or offspring in which cells from one of the initial embryos
used to produce the chimeric fetus or offspring have a nucleic acid
encoding a xenogenous antibody (e.g., a human antibody).
Additionally, cells from the aforementioned initial embryo or
another initial embryo have a nucleic acid encoding an antibody
that is reactive with an endogenous antibody (e.g., an antibody
naturally produced by cells from any of the initial embryos used to
generate the chimeric fetus or offspring) and that reduces the
amount or activity of an endogenous antibody in the resulting fetus
or offspring.
[0025] In one such aspect, the invention features a method of
cloning a non-human mammal. This method involves inserting a cell,
nucleus, or chromatin mass into an oocyte, thereby forming a first
embryo. The cell, nucleus, or chromatin mass has a nucleic acid
encoding a xenogenous first antibody and a nucleic acid encoding a
second antibody reactive with an endogenous antibody. One or more
cells from the first embryo are contacted with one or more cells
from a second embryo (e.g., an in vitro fertilized embryo,
naturally-occurring embryo, or parthenogenetically activated
embryo), thereby forming a third embryo. The third embryo is
transferred into the uterus of a host mammal under conditions that
allow the third embryo to develop into a fetus or live offspring.
The resulting fetus or offspring expresses the xenogenous first
antibody and the second antibody, and the second antibody reduces
the quantity and/or activity of an endogenous antibody. Preferably,
the second antibody is expressed under the control of a
liver-specific promoter. Some preferred second antibodies react
with endogenous IgM or endogenous immunoglobulin molecules.
[0026] In a related aspect, the invention provides another method
of cloning a non-human mammal. This method involves incubating a
permeabilized cell in a reprogramming media under conditions that
allow the removal of a factor from a nucleus, chromatin mass, or
chromosome of the permeabilized cell or the addition of a factor
from the reprogramming media to the nucleus, chromatin mass, or
chromosome, thereby forming a reprogrammed cell. The cell has a
nucleic acid encoding a xenogenous first antibody and a nucleic
acid encoding a second antibody reactive with an endogenous
antibody. The reprogrammed cell is inserted into an oocyte, thereby
forming a first embryo. One or more cells from the first embryo are
contacted with one or more cells from a second embryo (e.g., an in
vitro fertilized embryo, naturally-occurring embryo, or
parthenogenetically activated embryo), thereby forming a third
embryo. The third embryo is transferred into the uterus of a host
mammal under conditions that allow the third embryo to develop into
a fetus or live offspring. The resulting fetus or offspring
expresses the xenogenous first antibody and the second antibody,
and the second antibody reduces the quantity and/or activity of an
endogenous antibody. Preferably, the second antibody is expressed
under the control of a liver-specific promoter. Some preferred
second antibodies react with endogenous IgM or endogenous
immunoglobulin molecules.
[0027] In preferred embodiments of any of the above cloning
methods, the first embryo comprises one or more nucleic acids
encoding all or part of a xenogenous immunoglobulin (Ig) gene which
undergoes rearrangement and expresses at least one xenogenous Ig
molecule in B-cells. In other preferred embodiments, the first
embryo comprises one or more nucleic acids encoding all or part of
a rearranged xenogenous immunoglobulin gene which expresses at
least one xenogenous Ig molecule in B-cells. In some embodiments,
the first embryo or second embryo comprises a mutation that reduces
the expression of an endogenous antibody. In other preferred
embodiments, the antibody is reactive with an antigen expressed on
the surface of B-cells or germ cells, such as an antibody or a cell
surface protein or receptor. In some embodiments, the administered
antibody is an anti-IgM or anti-immunoglobulin antibody. In a
preferred embodiment, the antibody is administered prior to
colostrum.
[0028] Preferred ungulates for use in above methods Exemplary
ungulates include members of the orders Perissodactyla and
Artiodactyla, such as any member of the genus Bos. Other preferred
ungulates include sheep, big-horn sheep, goats, buffalos,
antelopes, oxen, horses, donkeys, mule, deer, elk, caribou, water
buffalo, camels, llama, alpaca, pigs, and elephants. In preferred
embodiments, the recipient ungulate is less than 50, 40, 30, 20,
10, 7, 5, 4, 3, 2, or 1 week old. In various embodiments, the
antibody is administered to a fetus during the first, second or
third trimester. In yet other preferred embodiments, a fetus is
allowed to develop until a chosen time in a pregnant or host
mammal, and then the fetus is surgically removed or labor is
induced using standard methods. For example, a viable fetus may be
removed by Caesarian section, or labor may be artificially induced
1, 2, 3, 5, 10, 15, 20, or more days prior to the normal term of
the fetus. These young recipient ungulates may have a naturally
suppressed immune system, thereby minimizing or preventing an
adverse immune response to the administered antibody which reduces
endogenous antibodies. Other preferred ungulates naturally or
spontaneously have an immune system that is less responsive than
normal.
[0029] Preferred ungulates that express a xenogenous antibody
contain naturally arranged segments of human chromosomes (e.g.,
human chromosomal fragments) or artificial chromosomes that
comprise artificially engineered human chromosome fragments (i.e.,
the fragments may be rearranged relative to the human genome).
Preferred ungulates have one or more nucleic acids having a
xenogenous antibody gene locus (e.g., a nucleic acid encoding all
or part of a xenogenous immunoglobulin (Ig) gene which undergoes
rearrangement and expresses at least one xenogenous Ig molecule).
Preferably, the nucleic acid has unrearranged antibody light chain
nucleic acid segments in which all of the nucleic acid segments
encoding a V gene segment are separated from all of the nucleic
acid segments encoding a J gene segment by one or more nucleotides.
Other preferred nucleic acid have unrearranged antibody heavy chain
nucleic acid segments in which either (i) all of the nucleic acid
segments encoding a V gene segment are separated from all of the
nucleic acid segments encoding a D gene segment by one or more
nucleotides and/or (ii) all of the nucleic acid segments encoding a
D gene segment are separated from all of the nucleic acid segments
encoding a J gene segment by one or more nucleotides.
[0030] Other preferred ungulates have one or more nucleic acids
encoding all or part of a rearranged xenogenous immunoglobulin (Ig)
gene which expresses at least one xenogenous Ig molecule. In some
embodiments, the nucleic acid is contained within a chromosome
fragment. The nucleic acid may be integrated into a chromosome of
the ungulate or maintained in the ungulate cell independently from
the host chromosome.
[0031] In other preferred embodiments of any methods of the
invention, the light chain of the antibodies and/or the heavy chain
of the xenogenous antibodies is encoded by a human nucleic acid. In
preferred embodiments, the heavy chain is a mu heavy chain, and the
light chain is a lambda or kappa light chain. In other preferred
embodiments, the nucleic acid encoding the xenogenous
immunoglobulin chain or antibody is in its unrearranged form. In
other preferred embodiments, more than one class of xenogenous
antibody is produced by the ungulate. In various embodiments, more
than one different xenogenous Ig or antibody is produced by the
ungulate. The xenogenous antibody may be a polyclonal or monoclonal
antibody.
[0032] Preferred methods of generating ungulates for use in above
methods In particular embodiments for the generation of transgenic
ungulates that express xenogenous antibodies, the ungulate is
produced by inserting a cell having one or more xenogenous nucleic
acids into an oocyte. The xenogenous nucleic acid encodes all or
part of a xenogenous Ig gene, and the gene is capable of undergoing
rearrangement and expressing more than one xenogenous Ig molecule
in B-cells. The oocyte or an embryo formed from the oocyte is
transferred into the uterus of a host ungulate under conditions
that allow the oocyte or the embryo to develop into a fetus.
Preferably, the fetus develops into a viable offspring. Preferably,
the nucleic acid encoding all or part of a xenogenous Ig gene
encodes a xenogenous antibody. In other preferred embodiments, the
antibody is a polyclonal antibody. In yet other preferred
embodiments, the immunoglobulin chain or antibody is expressed in
serum and/or milk. In various embodiments, the nucleic acid is
contained in a chromosome fragment, such as a .DELTA.HAC or a
.DELTA..DELTA.HAC. The nucleic acid can be maintained in an
ungulate cell independently from the host chromosome or integrated
into a chromosome of the cell. Preferably, the nucleic acid is
substantially human. In other embodiments, the xenogenous antibody
is an antibody from another genus, such as a human antibody.
Preferably, the ungulate is a bovine, ovine, porcine, or
caprine.
[0033] We have previously disclosed a variety of improved methods
for cloning mammals that may be used to clone mammals for use in
the methods of the present invention (U.S. Ser. No. 10/032,191,
filed Dec. 21, 2001 and PCT/US01/50406, filed Dec. 21, 2001). In
particular, these methods involve the condensation of a donor
nucleus into a chromatin mass to allow the release of nuclear
components such as transcription factors that may promote the
transcription of genes that are undesirable for the development of
the nuclear transplant embryo into a viable offspring. In a related
method, a permeabilized cell is incubated with a reprogramming
media (e.g., a cell extract) to allow the addition or removal of
factors from the cell, and then the plasma membrane of the
permeabilized cell is resealed to enclose the desired factors and
restore the membrane integrity of the cell. If desired, the steps
of any of these methods may be repeated one or more times or
different reprogramming methods may be performed sequentially to
increase the extent of reprogramming, resulting in greater
viability of the cloned fetuses.
[0034] In preferred embodiments that involve the use of these
improved cloning methods, the ungulate (e.g., bovine embryo, fetus,
calf, or adult) is produced using a method that involves (a)
incubating a donor nucleus (e.g., a nucleus that has a nucleic acid
encoding a xenogenous antibody) that preferably has less than four
sets of homologous chromosomes (i.e., has fewer than two pairs of
complete chromatids) under conditions that allow formation of a
chromatin mass without causing DNA replication, (b) inserting the
chromatin mass into an enucleated oocyte, thereby forming a nuclear
transfer oocyte and (c) transferring the nuclear transfer oocyte or
an embryo formed from the nuclear transfer oocyte into the uterus
of a host mammal, preferably under conditions that allow the
nuclear transfer oocyte or embryo to develop into a fetus. In a
preferred embodiment, the donor nucleus is incubated with a
reprogramming media (e.g., a cell extract) under conditions that
allow nuclear or cytoplasmic components such as transcription
factors, repressor proteins, or chromatin remodeling proteins to be
added to, or removed from, the nucleus or resulting chromatin mass.
Preferably, the donor nucleus is contacted with one or more of the
following under conditions that allow formation of a chromatin
mass: a mitotic extract in the presence or absence of an anti-NuMA
antibody, a detergent and/or salt solution, or a protein kinase
solution. In other preferred embodiments, the reconstituted oocyte
or the resulting embryo expresses lamin A, lamin C, or NuMA protein
at a level that is less than 5 fold greater than the corresponding
level expressed by a control oocyte or a control embryo with the
same number of cells and from the same species.
[0035] In other preferred embodiments, the method for generating
the ungulate (e.g., bovine embryo, fetus, calf, or adult) involves
incubating a permeabilized cell (e.g., a cell that has a nucleic
acid encoding a xenogenous antibody) with a reprogramming media
(e.g., a cell extract) under conditions that allow the removal of a
factor (e.g., a nuclear or cytoplasmic component such as a
transcription factor) from a nucleus, chromatin mass, or chromosome
of the permeabilized cell or the addition of a factor to the
nucleus, chromatin mass, or chromosome, thereby forming a
reprogrammed cell. The reprogrammed cell is inserted into an
enucleated oocyte, and the resulting oocyte or an embryo formed
from the oocyte is transferred into the uterus of a host mammal,
preferably under conditions that allow the oocyte or embryo to
develop into a fetus. In preferred embodiments, the permeabilized
cell is contacted with one or more of the following under
conditions that allow formation of a chromatin mass: a mitotic
extract in the presence or absence of an anti-NuMA antibody, a
detergent and/or salt solution, or a protein kinase solution. In
yet another preferred embodiment, the permeabilized cell is
incubated with an interphase reprogramming media (e.g., an
interphase cell extract). In still another preferred embodiment,
the nucleus in the permeabilized cell remains membrane-bounded, and
the chromosomes in the nucleus do not condense during incubation
with this interphase reprogramming media. In certain embodiments,
incubating the permeabilized cell in the reprogramming media does
not cause DNA replication or only causes DNA replication in less
than 50, 40, 30, 20, 10, or 5% of the cells. In other embodiments,
incubating the permeabilized cell in the reprogramming media causes
DNA replication in at least 60, 70, 80, 90, 95, or 100% of the
cells. In various embodiments, the permeabilized cell is formed by
incubating an intact cell with a protease such as trypsin, a
detergent, such as digitonin, or a bacterial toxin, such as
Streptolysin O. In a preferred embodiment, the reprogrammed cell is
not incubated under conditions that allow the membrane of the
reprogrammed cell to reseal prior to insertion into the oocyte. In
yet another preferred embodiment, the reprogrammed cell is
incubated under conditions that allow the membrane of the
reprogrammed cell to reseal prior to insertion into the oocyte. In
other preferred embodiments, the reconstituted oocyte or the
resulting embryo expresses lamin A, lamin C, or NuMA protein at a
level that is less than 5 fold greater than the corresponding level
expressed by a control oocyte or a control embryo with the same
number of cells and from the same species.
Preferred Methods for Generating Chimeric Ungulates for Use in
Above Methods
[0036] Other preferred ungulates are chimeric ungulates or
ungulates produced using cells from two or more embryos. For
example, cells from a nuclear transfer embryo (e.g., an embryo
formed by inserting a cell, nucleus, or chromatin mass into an
enucleated oocyte) can be combined with cells from an in vitro
fertilized, naturally-occurring, or parthenogenetically activated
embryo. Preferably, the majority of the cells and their progeny
from the nuclear transfer embryo are incorporated into fetal tissue
of the resulting chimeric embryo. At least some of the cells and
their progeny from the second embryo are preferably incorporated
into placental tissue and promote the viability of the resulting
chimeric embryo.
[0037] In preferred embodiments, the nuclear transfer embryo has a
nucleic acid encoding a xenogenous antibody. Preferably, an
antibody is administered to the resulting embryo, fetus, or
offspring that inhibits the endogenous B-cells or antibodies
produced by cells derived from either initial embryo but does not
substantially inhibit the xenogenous B-cells or antibodies.
[0038] Accordingly, in various preferred embodiments, the ungulate
(e.g., bovine embryo, fetus, calf, or adult) is produced by
inserting a cell, nucleus, or chromatin mass (e.g., a cell,
nucleus, or chromatin mass having one or more nucleic acids
encoding a xenogenous antibody) into an oocyte, thereby forming a
first embryo. One or more cells from the first embryo are contacted
with one or more cells from a second embryo, thereby forming a
third embryo. The second embryo is an in vitro fertilized embryo,
naturally-occurring embryo, or parthenogenetically activated
embryo. The third embryo is transferred into the uterus of a host
mammal under conditions that allow the third embryo to develop into
a fetus.
[0039] In one embodiment, at least one of the first embryo and the
second embryo is a compaction embryo. In another embodiment, the
first embryo and the second embryo are at different cell-stages.
The first embryo and the donor cell used to produce the second
embryo can be from the same species or from different genuses or
species. Preferably, at least 10, 20, 30, 40, 50, 60, 70, 80, 90,
95, or 100% cells in the trophectoderm or placental tissue of the
fetus are derived from the second embryo, or at least 30, 40, 50,
60, 70, 80, 90, 95, or 100% cells in the inner cell mass or fetal
tissue of the fetus are derived from the first embryo. In other
preferred embodiments, the first embryo or the third embryo
expresses lamin A, lamin C, or NuMA protein at a level that is less
than 5 fold greater than the corresponding level expressed by a
control embryo with the same number of cells and from the same
species.
[0040] In still other embodiments, the ungulate (e.g., bovine
embryo, fetus, calf, or adult) is generated by contacting a donor
nucleus (e.g., a nucleus that encodes a xenogenous antibody) with a
reprogramming media (e.g., cell extract) under conditions that
allow formation of a chromatin mass, and inserting the chromatin
mass into an enucleated oocyte, thereby forming a first embryo. One
or more cells from the first embryo are contacted with one or more
cells from an in vitro fertilized, naturally-occurring, or
parthenogenetically activated second embryo, forming a third
embryo. The third embryo is transferred into the uterus of a host
mammal under conditions that allow the third embryo to develop into
a fetus. In a preferred embodiment, the chromatin mass is formed by
contacting a donor nucleus that has less than four sets of
homologous chromosomes with a reprogramming media under conditions
that allow formation of a chromatin mass without causing DNA
replication. Preferably, the donor nucleus is contacted with one or
more of the following under conditions that allow formation of a
chromatin mass: a mitotic extract in the presence or absence of an
anti-NuMA antibody, a detergent and/or salt solution, or a protein
kinase solution.
[0041] In various embodiments, both the first embryo and the second
embryo are compaction embryos; both the first embryo and the second
embryo are precompaction embryos, or one of the embryos is a
compaction embryo and the other embryo is a precompaction embryo.
The first embryo and the second embryo can be at different
cell-stages or at the same cell-stage. The first embryo and the
donor nucleus used to produce the second embryo can be from the
same species or from different genuses or species. Preferably, at
least 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or 100% cells in the
trophectoderm or placental tissue of the fetus are derived from the
second embryo, or at least 30, 40, 50, 60, 70, 80, 90, 95, or 100%
cells in the inner cell mass or fetal tissue of the fetus are
derived from the first embryo. In other preferred embodiments, the
first embryo or the third embryo expresses lamin A, lamin C, or
NuMA protein at a level that is less than 5 fold greater than the
corresponding level expressed by a control embryo with the same
number of cells and from the same species.
[0042] In another related aspect, the invention features yet
another method of cloning a mammal (e.g., bovine embryo, fetus,
calf, or adult). This method involves incubating a permeabilized
cell (e.g., a cell that has a nucleic acid encoding a xenogenous
antibody) in a reprogramming media (e.g., cell extract) under
conditions that allow the removal of a factor from a nucleus,
chromatin mass, or chromosome of the permeabilized cell or the
addition of a factor from the reprogramming media to the nucleus,
chromatin mass, or chromosome, thereby forming a reprogrammed cell.
The reprogrammed cell is inserted into an enucleated oocyte,
thereby forming a first embryo. One or more cells from the first
embryo are contacted with one or more cells from an in vitro
fertilized, naturally-occurring, or parthenogenetically activated
second embryo, forming a third embryo. The third embryo is
transferred into the uterus of a host mammal under conditions that
allow the third embryo to develop into a fetus. In a preferred
embodiment, the permeabilized cell is incubated with a
reprogramming media (e.g., a cell extract) under conditions that
allow nuclear or cytoplasmic components such as transcription
factors to be added to, or removed from, the nucleus or resulting
chromatin mass. In other preferred embodiments, the permeabilized
cell is contacted with one or more of the following under
conditions that allow formation of a chromatin mass: a mitotic
extract in the presence or absence of an anti-NuMA antibody, a
detergent and/or salt solution, or a protein kinase solution. In
yet another preferred embodiment, the permeabilized cell is
incubated with an interphase reprogramming media (e.g., an
interphase cell extract). In still another preferred embodiment,
the nucleus in the permeabilized cell remains membrane-bounded, and
the chromosomes in the nucleus do not condense during incubation
with this interphase reprogramming media. In some embodiments,
incubating the permeabilized cell in the reprogramming media does
not cause DNA replication or only causes DNA replication in less
than 50, 40, 30, 20, 10, or 5% of the cells. In other embodiments,
incubating the permeabilized cell in the reprogramming media causes
DNA replication in at least 60, 70, 80, 90, 95, or 100% of the
cells. In various embodiments, the permeabilized cell is formed by
incubating an intact cell with a protease such as trypsin, a
detergent, such as digitonin, or a bacterial toxin, such as
Streptolysin O. In yet another preferred embodiment, the
reprogrammed cell is incubated under conditions that allow the
membrane of the reprogrammed cell to reseal prior to insertion into
the oocyte. In various embodiments, both the first embryo and the
second embryo are compaction embryos; both the first embryo and the
second embryo are precompaction embryos, or one of the embryos is a
compaction embryo and the other embryo is a precompaction embryo.
The first embryo and the second embryo can be at different
cell-stages or at the same cell-stage. The first embryo and the
donor cell used to produce the second embryo can be from the same
species or from different genuses or species. Preferably, at least
10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or 100% cells in the
trophectoderm or placental tissue of the fetus are derived from the
second embryo, or at least 30, 40, 50, 60, 70, 80, 90, 95, or 100%
cells in the inner cell mass or fetal tissue of the fetus are
derived from the first embryo. In other preferred embodiments, the
first embryo or the third embryo expresses lamin A, lamin C, or
NuMA protein at a level that is less than 5 fold greater than the
corresponding level expressed by a control embryo with the same
number of cells and from the same species.
[0043] In preferred embodiments of any of the above aspects
involving ungulates produced using cells from two embryos, part or
all of the zona pellucida of the first embryo or second embryo is
removed before the cells from each embryo are contacted. In one
embodiment, the cells from the first and second embryos are
contacted by being placed adjacent to each other in solution or on
a solid support. In another embodiment, standard techniques are
used to inject cells from the first embryo into the second embryo.
The cells can be injected into any region of the second embryo,
such as the periphery of the embryo between the zona pellucida and
the embryo itself. Exemplary naturally occurring embryos include
embryos that are surgically or nonsurgically removed from a
pregnant mammal (e.g., a bovine) using standard methods. Exemplary
in vitro fertilized embryos include intra-cytoplasmic sperm
injection embryos generated using standard methods. It is also
contemplated that cells from more than two embryos (e.g., cells
from 3, 4, 5, 6, or more embryos) can be combined to form a
chimeric embryo for generation of a cloned mammal.
[0044] Preferred embodiments for generating ungulates for use in
above methods In preferred embodiments of any of the above aspects,
the reprogramming media (e.g., a cell extract) is modified by the
enrichment or depletion of a factor, such as a DNA
methyltransferase, histone deacetylase, histone, protamine, nuclear
lamin, transcription factor, activator, or repressor. In other
preferred embodiments, the level of expression of NuMA or AKAP95
protein in the oocyte or chimeric embryo is at least 2, 5, 10, or
20-fold greater in the nucleus than in the cytoplasm. In yet other
embodiments, at least 30, 40, 50, 60, 70, 80, 90, or 100% of the
AKAP95 protein in the oocyte or chimeric embryo is extracted with a
solution of 0.1% Triton X-100, 1 mg/ml DNase I, and either 100 mM
or 300 mM NaCl. Preferably, the chromatin mass is purified from the
reprogramming media (e.g., extract) prior to insertion into the
enucleated oocyte. In another preferred embodiment, inserting the
chromatin mass into the enucleated oocyte involves contacting the
chromatin mass and the oocyte with a fusogenic compound under
conditions that allow the chromatin mass to enter the oocyte. In
yet another preferred embodiment, the fetus develops into a viable
offspring. Preferably, at least 1, 3, 5, 10, 20, 30, 40, 50, 60,
70, 80, or 90% of the nuclear transfer oocytes or embryos develop
into viable offspring. In this method, the oocyte containing the
chromatin mass or reprogrammed cell may be cultured under
conditions that allow cell division and one of the resulting cells
may be recloned one or more times. The donor nucleus, donor
chromatin mass, or donor cell and the oocyte used in the method may
be from the same species, or they may be from different species or
genuses. The mammal may be a human or non-human mammal, and the
oocyte may be fertilized or unfertilized. Preferably the donor
nucleus, chromatin mass, or permeabilized cell is from a G.sub.1 or
G.sub.0 phase cell. In addition, the genomic DNA of the cloned
embryo, fetus, or mammal is preferably substantially identical to
that of the donor cell. It is also contemplated that the chromatin
mass or reprogrammed cell may be inserted into an embryo for the
production of a chimeric embryo, fetus, or mammal containing a
mixture of cells with DNA substantially identical to that of the
chromatin mass or reprogrammed cell and cells with DNA
substantially identical to that of the naturally-occurring cells in
the embryo. It is also contemplated that a nucleated oocyte may be
used in the methods of the invention.
[0045] The reprogramming media used in any of the aspects of the
invention may or may not contain exogenous nucleotides. In other
preferred embodiments, a chromatin mass in a reprogramming media or
formed in a permeabilized cell is contacted with a vector having a
nucleic acid encoding a gene of interest under conditions that
allow random integration or homologous recombination between the
nucleic acid in the vector and the corresponding nucleic acid in
the genome of the chromatin mass, resulting in the alteration of
the genome of the chromatin mass. Due to the lack of an intact
plasma membrane and the lack of a nuclear membrane, a chromatin
mass in a permeabilized cell or in solution may be easier to
genetically modify than a naturally-occurring cell. Examples of
cells that may be used to generate reprogramming extracts include
embryonic stem cells and adult stem cells from brain, blood, bone
marrow, pancreas, liver, skin, or any other organ or tissue. Other
exemplary reprogramming cell extracts include oocyte extracts
(e.g., bovine or sea urchin oocyte extracts) and male germ cell
extracts (e.g., spermatogonia, spermatocyte, spermatid, or sperm
extracts from vertebrates, invertebrates, or mammals such as
bovine). The donor or permeabilized cell can be non-immortalized or
naturally, spontaneously, or genetically immortalized. The donor
cell, permeabilized cell, recipient cell, or cytoplast can be from
a source of any age, such as an embryo, fetus, youth, or adult
mammal. Cells from younger sources may have acquired fewer
spontaneous mutations and may have a longer life-span after
insertion into an oocyte.
[0046] Preferred ungulates with reduced levels of endogenous
antibody for use in above methods The methods of the present
invention may also be used with an ungulate (e.g., a bovine) that
has a mutation that reduces the expression of an endogenous
antibody. Thus, less administered antibody is required to eliminate
this lower initial level of endogenous antibody. Preferably, the
mutation reduces the expression of functional IgM heavy chain or
substantially eliminates the expression of functional IgM heavy
chain. In other preferred embodiments, the mutation reduces the
expression of functional Ig light chain or substantially eliminates
the expression of functional Ig light chain. In yet other preferred
embodiments, the mutation reduces the expression of functional IgM
heavy chain and functional Ig light chain, or the mutation
substantially eliminates the expression of functional IgM heavy
chain and functional Ig light chain. In some embodiments, a
transcription termination sequence is inserted in an endogenous mu
heavy chain nucleic acid (e.g., inserted downstream of the initial
ATG codon in exon 2) or Ig light chain nucleic acid. Preferably,
the ungulate also has a mutation in one or both alleles of an
endogenous nucleic acid encoding alpha-(1,3)-galactosyltransferase,
prion protein, and/or J chain. In other preferred embodiments, the
ungulate has a nucleic acid encoding an exogenous J chain, such as
a human J chain. Preferably, the mutation reduces or eliminates the
expression of the endogenous alpha-(1,3)-galactosyltransferase
enzyme, galactosyl(.alpha.1,3)galactose epitope, prion protein,
and/or J chain. Preferably, the ungulate produces human Ig.lamda.
or IgM molecules containing human J chain.
[0047] Preferably, a transgenic ungulate with one or more mutations
in an endogenous gene or genes is produced by inserting a cell, a
chromatin mass from a cell, or a nucleus from a cell into an
oocyte. The cell has a first mutation in an endogenous gene that is
not naturally expressed by the cell. The oocyte or an embryo formed
from the oocyte is transferred into the uterus of a host ungulate
under conditions that allow the oocyte or the embryo to develop
into a fetus. Preferably, the fetus develops into a viable
offspring.
[0048] Preferred methods of generating ungulates with a mutation,
such as a mutation that leads to reduced levels of endogenous
antibody, for use in the above methods In other preferred
embodiments, the first mutation is introduced into the cell by
inserting a nucleic acid comprising a cassette which includes a
promoter operably linked to a nucleic acid encoding a selectable
marker and operably linked to one or more nucleic acids having
substantial sequence identity to the endogenous gene to be mutated,
whereby the cassette is integrated into one endogenous allele of
the gene. In other preferred embodiments, the mutation is
introduced in the cell by inserting into the cell a nucleic acid
comprising a first cassette which includes a first promoter
operably linked to a nucleic acid encoding a first selectable
marker and operably linked to a first nucleic acid having
substantial sequence identity to the endogenous gene to be mutated,
whereby the first cassette is integrated into a first endogenous
allele of the gene producing a first transgenic cell. Into the
first transgenic cell is inserted a nucleic acid comprising a
second cassette which includes a second promoter operably linked to
a nucleic acid encoding a second selectable marker and operably
linked to a second nucleic acid having substantial sequence
identity to the gene. The second selectable marker differs from the
first selectable marker, and the second cassette is integrated into
a second endogenous allele of the gene producing a second
transgenic cell. In still other preferred embodiments, a cell is
isolated from the embryo, the fetus, or an offspring produced from
the fetus, and another mutation is introduced into a gene of the
cell. A second round of nuclear transfer is then performed using
the resulting cell, a chromatin mass from the cell, or a nucleus
from the cell to produce a transgenic ungulate with two or more
mutations. The mutations are in the same or different alleles of a
gene or are in different genes. The cell used in the first or
optional second round of nuclear transfer encodes a xenogenous
antibody. In particular embodiments, the cell includes one or more
nucleic acids encoding all or part of a xenogenous Ig gene that is
capable of undergoing rearrangement and expressing one or more
xenogenous Ig molecules in B-cells. In preferred embodiments, the
cell that is mutated is a fibroblast (e.g., a fetal fibroblast).
Preferably, the endogenous gene that is mutated is operably linked
to an endogenous promoter that is not active in a fibroblast. In
other preferred embodiments, the endogenous promoter operably
linked to the endogenous gene that is mutated is less than 80, 70,
60, 50, 40, 30, 20, 10% as active as an endogenous promoter
operably linked to a endogenous housekeeping gene such as GAPDH.
Promoter activity may be measured using any standard assay, such as
assays that measure the level of mRNA or protein encoded by the
gene (see, for example, Ausubel et al. Current Protocols in
Molecular Biology, volume 2, p. 11.13.1-11.13.3, John Wiley &
Sons, 1995). This method for generating a transgenic ungulate has
the advantage of allowing a gene that is not expressed in the donor
cell (i.e., the cell that is the source of the genetic material
used for nuclear transfer) to be mutated.
[0049] Preferably, the transgenic ungulate with a mutation in an
endogenous antibody gene is produced by inserting a cell, a
chromatin mass from a cell, or a nucleus from a cell into an
oocyte. The cell includes a first mutation in an endogenous
antibody heavy chain and/or light chain nucleic acid. The oocyte or
an embryo formed from the oocyte is transferred into the uterus of
a host ungulate under conditions that allow the oocyte or the
embryo to develop into a fetus. Preferably, the fetus develops into
a viable offspring. Preferably, the cell used in the production of
the transgenic ungulate has a mutation in one or both alleles of an
endogenous nucleic acid encoding alpha-(1,3)-galactosyltransferase,
prion protein, and/or J chain. In other preferred embodiments, the
cell has a nucleic acid encoding an exogenous J chain, such as a
human J chain. Preferably, the method for producing the transgenic
ungulate also includes isolating a cell from the embryo, the fetus,
or an offspring produced from the fetus and introducing a second
mutation (e.g., an insertion of a transcription termination
sequence) in an endogenous antibody heavy chain and/or light chain
nucleic acid in the cell. The cell, a chromatin mass from the cell,
or a nucleus from the cell is inserted into an oocyte, and the
oocyte or an embryo formed from the oocyte is transferred into the
uterus of a host ungulate under conditions that allow the oocyte or
the embryo to develop into a fetus. The cell used in the first or
optional second round of nuclear transfer encodes a xenogenous
antibody.
[0050] In other embodiments for the production of the above
transgenic ungulates, the cell used for generation of the
transgenic ungulate is prepared by a method that includes inserting
into the cell a nucleic acid having a cassette which includes a
promoter operably linked to a nucleic acid encoding a selectable
marker and operably linked to one or more nucleic acids having
substantial sequence identity to the antibody heavy chain or light
chain nucleic acid. The cassette is integrated into one endogenous
allele of the antibody heavy chain or light chain nucleic acid.
[0051] In other embodiments, the cell is produced by inserting into
the cell a nucleic acid having a first cassette which includes a
first promoter operably linked to a nucleic acid encoding a first
selectable marker and operably linked to a first nucleic acid
having substantial sequence identity to the antibody heavy chain or
light chain nucleic acid. The first cassette is integrated into a
first endogenous allele of the antibody heavy chain or light chain
nucleic acid producing a first transgenic cell. Into the first
transgenic cell is inserted a nucleic acid having a second cassette
which includes a second promoter operably linked to a nucleic acid
encoding a second selectable marker and operably linked to a second
nucleic acid having substantial sequence identity to the antibody
heavy chain or light chain nucleic acid. The second selectable
marker differs from the first selectable marker. The second
cassette is integrated into a second endogenous allele of the
antibody heavy chain or light chain nucleic acid producing a second
transgenic cell.
[0052] In various embodiments of the invention, the nucleic acid
used to mutate an endogenous ungulate nucleic acid (e.g., a
knockout cassette which includes a promoter operably linked to a
nucleic acid encoding a selectable marker and operably linked to a
nucleic acid having substantial sequence identity to the gene to be
mutated) is not contained in a viral vector, such as an adenoviral
vector or an adeno-associated viral vector. For example, the
nucleic acid may be contained in a plasmid or artificial chromosome
that is inserted into an ungulate cell, using a standard method
such as transfection or lipofection that does not involve viral
infection of the cell. In yet another embodiment, the nucleic acid
used to mutate an endogenous ungulate nucleic acid (e.g., a
knockout cassette which includes a promoter operably linked to a
nucleic acid encoding a selectable marker and operably linked to a
nucleic acid having substantial sequence identity to the gene to be
mutated) is contained in a viral vector, such as an adenoviral
vector or an adeno-associated viral vector. According to this
embodiment, a virus containing the viral vector is used to infect
an ungulate cell, resulting in the insertion of a portion or the
entire viral vector into the ungulate cell.
[0053] Preferred administered antibodies for use in above methods
to eliminate undesired endogenous antibodies Preferred administered
antibodies include anti-IgM antibodies and antibodies reactive with
a polyclonal mixture of endogenous ungulate antibodies. The
administered antibody may be monoclonal or polyclonal. In some
embodiments, the administered antibody is a bifunctional antibody,
a fragment of an antibody, or a modified antibody. In certain
embodiments, the administered antibody is covalently linked to a
toxin (e.g., diphtheria toxin, maytansinoids, CC-1065,
anthracycline, or taxane), or a radiolabel. In some embodiments,
the antibody is administered intravenously to the ungulate.
Preferably, at least 0.25, 0.5, 1.0, 1.5, 2, 10, 20, or 50 grams of
the antibody is administered in one or multiple doses to the
ungulate. In other embodiments, between 1 and 10 mg, 10 and 25 mg,
25 and 50 mg, 10 and 100 mg, 50 and 100 mg, or 100 to 500 mg of the
antibody is administered in one or multiple doses to an ungulate
fetus. If desired, the antibody may be administered in a
pharmaceutically acceptable diluent, carrier, or excipient such as
saline, buffered saline, dextrose, water, glycerol, ethanol, or a
combination thereof.
[0054] In preferred embodiments, the administered antibody
originates from an ungulate of a different genus or species as the
recipient ungulate. In other preferred embodiments, the antibody is
a bifunctional antibody. Still other preferred antibodies include
those having, or consisting of, a ScFv, Fab, or F(ab').sub.2
fragment. Other examples of preferred antibodies include
derivatized antibodies encoded by a fusion nucleic acid that has
been modified through gene fusion technology so that the nucleic
acid encoding the antibody or a fragment of the antibody is
operably linked to a nucleic acid encoding a toxin or affinity tag.
The covalently linked group in the derivatized antibody many be
attached to the amino-terminus, carboxy-terminus, or between the
amino- and carboxy-termini, of the antibody or antibody fragment.
By "affinity tag" is meant a peptide, protein, or compound that
binds another peptide, protein, or compound. In a preferred
embodiment, the affinity tag is used for purification or
immobilization of the derivatized antibody. In another preferred
embodiment, the affinity tag or toxin is used to target the
antibody to a specific cell, tissue, or organ system in vivo.
[0055] Preferred embodiments of above aspects Preferably, a
transgenic cell or ungulate of the invention has an insertion of a
positive selection marker (e.g., an antibiotic resistance gene)
into an endogenous nucleic acid encoding an immunoglobulin,
alpha-(1,3)-galactosyltransferase, prion protein, or J chain.
Desirably, the positive selection marker is operably linked to a
xenogenous promoter. In some embodiments, each allele has an
insertion of the same antibiotic resistance gene or a different
antibiotic resistance gene. Preferably, a transcription termination
sequence is inserted into an endogenous nucleic acid encoding an
immunoglobulin, alpha-(1,3)-galactosyltransferase, prion protein,
or J chain. For example, the transcription termination sequence may
be inserted downstream of the initial ATG codon in exon 2 of an
endogenous mu heavy chain nucleic acid. In preferred embodiments,
the cell or ungulate has one or more nucleic acids comprising one
or more transgenes and expressing an mRNA or protein encoded by the
transgene(s).
[0056] Preferably, the ungulate antiserum or milk has polyclonal
human immunoglobulins. Preferably, the antiserum or milk is from a
bovine, ovine, porcine, or caprine. In another preferred
embodiment, the Igs are directed against a desired antigen. In
preferred embodiments, the antiserum is used as intravenous
immunoglobulin (IVIG) for the treatment or prevention of disease in
humans. In another preferred embodiment, an antigen of interest is
administered to the ungulate and Igs directed against the antigen
are produced by the ungulate. Preferably, the nucleic acid segments
in the xenogenous immunoglobulin gene locus rearrange, and
xenogenous antibodies reactive with the antigen of interest are
produced. Preferably, the antiserum and/or milk contains at least
2, 5, 10, 20, or 50 fold more fully xenogenous antibody than fully
or partially endogenous antibody, or contains no fully or partially
endogenous antibody. If desired, hybridomas and monoclonal
antibodies can be produced using xenogenous B-cells derived from
the above-described transgenic ungulates (for example, transgenic
bovines). It is also contemplated that xenogenous antibodies (e.g.,
human antibodies) isolated from ungulates may be subsequently
chemically modified so that they are covalently linked to a toxin,
therapeutically active compound, enzyme, cytokine, radiolabel,
fluorescent label, or affinity tag. If desired, the fluorescent or
radiolabel may be used for imaging of the antibody in vitro or in
vivo.
[0057] In preferred embodiments of any of the methods of the
invention, the ungulate used in the method has a subpopulation of
B-cells that express fully xenogenous antibody (i.e., expresses
antibody with fully xenogenous heavy and light chains). Preferably,
the amount of endogenous, functional antibody is decreased by at
least 10, 25, 50, 75, 90, 95, or 100%, and/or the amount of
xenogenous, functional antibody is decreased by less than 75, 50,
25, or 10%. In other preferred embodiments, the decrease in the
amount of endogenous, functional antibody is at least 2, 5, 10, 20,
30, or 50-fold greater than the decrease in the amount of
xenogenous, functional antibody. In another preferred embodiment,
endogenous antibody is substantially eliminated from the ungulate.
Preferably, B-cells that express only endogenous antibody or that
express both endogenous and xenogenous antibody molecules (e.g.,
heavy and light chains) are substantially eliminated from the
ungulate. In other preferred embodiments, the number and/or
activity of endogenous B-cells expressing endogenous antibody is
inhibited by at least 25, 50, 75, 90, or 95%. Preferably, the
antibody is administered to the ungulate during or after the normal
period of immune system development of the ungulate. For example,
the antibody may be administered during the fetal, embryonic, or
postnatal stage of the recipient ungulate.
[0058] Preferred donor cells for use in generating ungulates used
in the above methods Examples of preferred donor cells include
differentiated cells such as epithelial cells, neural cells,
epidermal cells, keratinocytes, hematopoietic cells, melanocytes,
chondrocytes, B-lymphocytes, T-lymphocytes, erythrocytes,
macrophages, monocytes, fibroblasts, and muscle cells; and
undifferentiated cells such as embryonic cells (e.g., stem cells
and embryonic germ cells). In another preferred embodiment, the
cell is from the female reproductive system, such as a mammary
gland, ovarian cumulus, granulosa, or oviductal cell. Other
preferred cells include fetal cells and placental cells. Preferred
cells also include those from any organ, such as the bladder,
brain, esophagus, fallopian tube, heart, intestines, gallbladder,
kidney, liver, lung, ovaries, pancreas, prostate, spinal cord,
spleen, stomach, testes, thymus, thyroid, trachea, ureter, urethra,
and uterus. In yet another preferred embodiment, the nucleus,
permeabilized cell, or chromosomes are from a transgenic cell or
mammal or contain a mutation not found in the donor cell or not
found in a naturally-occurring cell.
[0059] Preferred transgenic donor nuclei and donor cells encode
proteins that confer improved resistance to disease or parasites in
the cloned mammal. Alternatively, the donor nuclei or donor cells
may be engineered so that the cloned mammal produces a recombinant
product, such as the production of a human protein in the urine,
blood, or milk of a bovine. For example, proteins may be expressed
in the urine of cattle by inserting a polynucleotide sequence
encoding a human protein under the control of an uroplakin
promoter. Examples of therapeutic proteins that may be produced in
the milk of cloned bovines include human clotting factors such as
any of factors I to XIII (Voet and Voet, Biochemistry, John Wiley
& Sons, New York, 1990). These heterologous proteins may be
expressed under the control of a prolactin promoter or any other
promoter suitable for expression in the milk of a bovine.
Recombinant proteins from these or other tissues or fluids may be
purified using standard purification methods (see, for example,
Ausubel et al., supra).
[0060] Cell permeabilization methods In another aspect, the
invention features a method of permeabilizing a cell or a
population of cells. This method involves incubating one or more
cells with one or more proteases (e.g., trypsin) under conditions
that allow the permeabilization of the cell (e.g., the
permeabilization of the plasma membrane). Preferred concentrations
of protease include between 0.1 and 10 mg/ml protease, such as
between 0.1 and 1 mg/ml, 1 and 5 mg/ml, and 5 and 10 mg/ml
protease. In some embodiments, electroporation, digitonin, saponin,
and/or mechanical shear is used. Examples of cells that can be
permeabilized using this method include germ, somatic, embryonic,
fetal, adult, differentiated, and undifferentiated cells. Other
exemplary cells include any of the cells listed in the above
section as preferred donor cells. In some embodiments, the cells
are incubated with the protease for at least 1, 5, 10, 30, or 60
minutes or between 1 and 60 minutes (e.g., between 1 and 10
minutes). In some embodiments, the permeabilized cells are placed
in a reprogramming media (e.g., a mitotic or interphase extract)
after permeabilization. In preferred embodiments, the cells are
resealed after incubation in the extract and used in one of the
cloning methods described herein.
[0061] Definitions As used herein, by "artificial chromosome" is
meant a mammalian chromosome or fragment thereof which has an
artificial modification such as the addition of a selectable
marker, the addition of a cloning site, the deletion of one or more
nucleotides, the substitution of one or more nucleotides, and the
like. By "human artificial chromosome (HAC)" is meant an artificial
chromosome generated from one or more human chromosome(s). An
artificial chromosome can be maintained in the host cell
independently from the endogenous chromosomes of the host cell. In
this case, the HAC can stably replicate and segregate along side
endogenous chromosomes. Alternatively, it may be translocated to,
or inserted into, an endogenous chromosome of the host cell. Two or
more artificial chromosomes can be introduced to the host cell
simultaneously or sequentially. For example, artificial chromosomes
derived from human chromosome #14 (comprising the Ig heavy chain
gene), human chromosome #2 (comprising the Ig kappa chain gene),
and human chromosome #22 (comprising the Ig lambda chain gene) can
be introduced. Alternatively, an artificial chromosome(s)
comprising both a xenogenous Ig heavy chain gene and Ig light chain
gene, such as .DELTA.HAC or .DELTA..DELTA.HAC, may be introduced.
Preferably, the heavy chain loci and the light chain loci are on
different chromosome arms (i.e., on different side of the
centromere). In still other preferred embodiments, the total size
of the HAC is less than or equal to approximately 10, 9, 8, or 7
megabases.
[0062] By "a nucleic acid in its pre-arranged or unrearranged form"
is meant a nucleic acid that has not undergone V(D)J recombination.
In preferred embodiments, all of the nucleic acid segments encoding
a V gene segment of an antibody light chain are separated from all
of the nucleic acid segments encoding a J gene segment by one or
more nucleotides. Preferably, all of the nucleic acid segments
encoding a V gene segment of an antibody heavy chain are separated
from all of the nucleic acid segments encoding a D gene segment by
one or more nucleotides, and/or all of the nucleic acid segments
encoding a D gene segment of an antibody heavy chain are separated
from all of the nucleic acid segments encoding a J gene segment by
one or more nucleotides. Preferably, a nucleic acid in its
unrearranged form is substantially human. In other preferred
embodiments, the nucleic acid is at least 70, 80, 90, 95, or 99%
identical to the corresponding region of a naturally-occurring
nucleic acid from a human.
[0063] By "chromatin mass" is meant more than one chromosome not
enclosed by a membrane. Preferably, the chromatin mass contains all
of the chromosomes of a cell. An artificially induced chromatin
mass containing condensed chromosomes may be formed by exposure of
a nucleus to a mitotic reprogramming media (e.g., a mitotic
extract) as described herein. Alternatively, an artificially
induced chromatin mass containing decondensed or partially
condensed chromosomes may be generated by exposure of a nucleus to
one of the following, as described herein: a mitotic extract
containing an anti-NuMA antibody, a detergent and/or salt solution,
or a protein kinase solution. A chromatin mass may contain discrete
chromosomes that are not physically touching each other or may
contain two or more chromosomes that are in physical contact.
[0064] If desired, the level of chromosome condensation may be
determined using standard methods by measuring the intensity of
staining with the DNA stain, DAPI. As chromosomes condense, this
staining intensity increases. Thus, the staining intensity of the
chromosomes may be compared to the staining intensity for
decondensed chromosomes in interphase (designated 0% condensed) and
maximally condensed chromosomes in mitosis (designated 100%
condensed). Based on this comparison, the percent of maximal
condensation may be determined. Preferred condensed chromatin
masses are at least 50, 60, 70, 80, 90, or 100% condensed.
Preferred decondensed or partially condensed chromatin masses are
less than 50, 40, 30, 20, or 10% condensed.
[0065] By "nucleus" is meant a membrane-bounded organelle
containing most or all of the DNA of a cell. The DNA is packaged
into chromosomes in a decondensed form. Preferably, the membrane
encapsulating the DNA includes one or two lipid bilayers or has
nucleoporins.
[0066] By "nucleus that has less than four sets of homologous
chromosomes" is meant a nucleus that has a DNA content of less than
4n, where "n" is the number of chromosomes found in the normal
haploid chromosome set of a mammal of a particular genus or
species. Such a nucleus does not have four copies of each gene or
genetic locus. Preferably, the nucleus is diploid and thus has two
sets of homologous chromosomes but has less than two complete pairs
of chromatids.
[0067] By "pronucleus" is meant a haploid nucleus resulting from
meiosis or a nuclear transfer pronucleus. The female pronucleus is
the nucleus of the oocyte or ovum before fusion with the male
pronucleus. The male pronucleus is the sperm nucleus after it has
entered the oocyte or ovum at fertilization but before fusion with
the female pronucleus. A nuclear transfer pronucleus is a
pronucleus (e.g., a diploid pronucleus) that forms after
introduction of a donor cell, nucleus, or chromatin mass into an
oocyte. The nuclear transfer pronucleus has less than four sets of
homologous chromosomes.
[0068] By "donor cell" is meant a cell from which a nucleus or
chromatin mass is derived, or a permeabilized cell.
[0069] By "permeabilization" is meant the formation of pores in the
plasma membrane or the partial or complete removal of the plasma
membrane.
[0070] By "reprogramming media" is meant a solution that allows the
removal of a factor from a cell, nucleus, chromatin mass, or
chromosome or the addition of a factor from the solution to the
cell, nucleus, chromatin mass, or chromosome. Preferably, the
addition or removal of a factor increases or decreases the level of
expression of an mRNA or protein in the donor cell, chromatin mass,
or nucleus or in a cell containing the reprogrammed chromatin mass
or nucleus. In another embodiment, incubating a permeabilized cell,
chromatin mass, or nucleus in the reprogramming media alters a
phenotype of the permeabilized cell or a cell containing the
reprogrammed chromatin mass or nucleus relative to the phenotype of
the donor cell. In yet another embodiment, incubating a
permeabilized cell, chromatin mass, or nucleus in the reprogramming
media causes the permeabilized cell or a cell containing the
reprogrammed chromatin mass or nucleus to gain or lose an activity
relative to the donor cell.
[0071] Exemplary reprogramming media include solutions, such as
buffers, that do not contain biological molecules such as proteins
or nucleic acids. Such solutions are useful for the removal of one
or more factors from a nucleus, chromatin mass, or chromosome.
Other preferred reprogramming medias are extracts, such as cellular
extracts from cell nuclei, cell cytoplasm, or a combination
thereof. Exemplary cell extracts include extracts from oocytes
(e.g., mammalian, vertebrate, or invertebrate oocytes), male germ
cells (mammalian, vertebrate, or invertebrate germ cells such as
spermatogonia, spermatocyte, spermatid, or sperm), and stem cells
(e.g., adult or embryonic stem cells). Yet other reprogramming
media are solutions or extracts to which one or more
naturally-occurring or recombinant factors (e.g., nucleic acids or
proteins such as DNA methyltransferases, histone deacetylases,
histones, protamines, nuclear lamins, transcription factors,
activators, repressors, chromatin remodeling proteins, growth
factors, interleukins, cytokines, or other hormones) have been
added, or extracts from which one or more factors have been
removed. Still other reprogramming media include solutions of
detergent (e.g., 0.01% to 0.1%, 0.1% to 0.5%, or 0.5% to 2% ionic
or non-ionic detergent such as one or more of the following
detergents: SDS, Triton X-100, Triton X-114, CHAPS,
Na-deoxycholate, n-octyl glucoside, Nonidet P40, IGEPAL, Tween 20,
Tween 40, or Tween 80), salt (e.g., .about.0.1, 0.15, 0.25, 0.5,
0.75, 1, 1.5, or 2 M NaCl or KCl), polyamine (e.g., .about.1 .mu.M,
10 .mu.M, 100 .mu.M, 1 mM or 10 mM spermine, spermidine, protamine,
or poly-L-lysine), a protein kinase (e.g., cyclin-dependent kinase
1, protein kinase C, protein kinase A, MAP kinase,
calcium/calmodulin-dependent kinase, CK1 casein kinase, or CK2
casein kinase), and/or a phosphatase inhibitor (e.g., .about.10
.mu.M, 100 .mu.M, 1 mM, 10 mM, 50 mM, 100 mM of one or more of the
following inhibitors: Na-orthovanadate, Na-pyrophosphate,
Na-fluoride, NIPP1, inhibitor 2, PNUTS, SDS22, AKAP149, or ocadaic
acid). In some embodiments, the reprogramming medium contains an
anti-NuMA antibody. If desired, multiple reprogramming media may be
used simultaneously or sequentially to reprogram a donor cell,
nucleus, or chromatin mass.
[0072] By "interphase reprogramming media" is meant a media (e.g.,
an interphase cell extract) that induces chromatin decondensation
and nuclear envelope formation.
[0073] By "mitotic reprogramming media" is meant a media (e.g., a
mitotic cell extract) that induces chromatin condensation and
nuclear envelope breakdown.
[0074] By "reprogrammed cell" is meant a cell that has been exposed
to a reprogramming media. Preferably, at least 1, 5, 10, 15, 20,
25, 50, 75, 100, 150, 200, 300, or more mRNA or protein molecules
are expressed in the reprogrammed cell that are not expressed in
the donor or permeabilized cell. In another preferred embodiment,
the number of mRNA or protein molecules that are expressed in the
reprogrammed cell, but not expressed in the donor or permeabilized
cell, is between 1 and 5, 5 and 10, 10 and 25, 25 and 50, 50 and
75, 75 and 100, 100 and 150, 150 and 200, or 200 and 300,
inclusive. Preferably, at least 1, 5, 10, 15, 20, 25, 50, 75, 100,
150, 200, 300, or more mRNA or protein molecules are expressed in
the donor or permeabilized cell that are not expressed in the
reprogrammed cell. In yet another preferred embodiment, the number
of mRNA or protein molecules that are expressed in the donor or
permeabilized cell, but not expressed in the reprogrammed cell, is
between 1 and 5, 5 and 10, 10 and 25, 25 and 50, 50 and 75, 75 and
100, 100 and 150, 150 and 200, or 200 and 300, inclusive. In still
another preferred embodiment, these mRNA or protein molecules are
expressed in both the donor cell (i.e., the donor or permeabilized
starting cell) and the reprogrammed cell, but the expression levels
in these cells differ by at least 2, 5, 10, or 20-fold, as measured
using standard assays (see, for example, Ausubel et al., Current
Protocols in Molecular Biology, John Wiley & Sons, New York,
2000).
[0075] By "addition of a factor" is meant the binding of a factor
to chromatin, a chromosome, or a component of the nuclear envelope,
such as the nuclear membrane or nuclear matrix. Alternatively, the
factor is imported into the nucleus so that it is bounded or
encapsulated by the nuclear envelope. Preferably, the amount of
factor that is bound to a chromosome or located in the nucleus
increases by at least 25, 50, 75, 100, 200, or 500%.
[0076] By "removal of a factor" is meant the dissociation of a
factor from chromatin, a chromosome, or a component of the nuclear
envelope, such as the nuclear membrane or nuclear matrix.
Alternatively, the factor is exported out of the nucleus so that it
is no longer bounded or encapsulated by the nuclear envelope.
Preferably, the amount of factor that is bound to a chromosome or
located in the nucleus decreases by at least 25, 50, 75, 100, 200,
or 500%.
[0077] By "enrichment or depletion of a factor" is meant the
addition or removal of a naturally-occurring or recombinant factor
by at least 20, 40, 60, 80, or 100% of the amount of the factor
originally present in an reprogramming media (e.g., a cell
extract). Alternatively, a naturally-occurring or recombinant
factor that is not naturally present in the reprogramming media may
be added. Preferred factors include proteins such as DNA
methyltransferases, histone deacetylases, histones, protamines,
nuclear lamins, transcription factors, activators, and repressors;
membrane vesicles, and organelles. In one preferred embodiment, the
factor is purified prior to being added to the reprogramming media,
as described below. Alternatively, one of the purification methods
described below may be used to remove an undesired factor from the
reprogramming media.
[0078] By "recloned" is meant used in a second round of cloning. In
particular, a cell from an embryo, fetus, or adult generated from
the methods of the invention may be incubated in a mitotic
reprogramming media (e.g., a mitotic cell extract) to form a
chromatin mass for insertion into an enucleated oocyte, as
described above. Alternatively, the cell may be permeabilized,
incubated in a reprogramming media, and inserted into an enucleated
oocyte, as described above. Performing two or more rounds of
cloning may result in additional reprogramming of the donor
chromatin mass or donor cell, thereby increasing the chance of
generating a viable offspring after the last round of cloning.
[0079] By "nuclear transfer" is meant inserting a nucleus or a cell
containing a nucleus into an oocyte. Any appropriate method may be
used for this insertion into an oocyte, such as microinjection,
electroporation, or cell fusion. In some embodiments, the nucleus
is formed from a chromatin mass or a cell containing a chromatin
mass, as described herein.
[0080] By "chromatin transfer" is meant inserting a chromatin mass
or a cell containing a chromatin mass into an oocyte. Any
appropriate method may be used for this insertion into an oocyte,
such as microinjection, electroporation, or cell fusion. In some
embodiments, the chromatin mass is formed by incubating a nucleus
or a cell containing a nucleus in a reprogramming media, as
described herein.
[0081] By "viable offspring" is meant a mammal that survives ex
utero. Preferably, the mammal is alive for at least one second, one
minute, one hour, one day, one week, one month, six months, or one
year from the time it exits the maternal host. The mammal does not
require the circulatory system of an in utero environment for
survival.
[0082] By "nuclear transfer oocyte" or "nuclear transplant oocyte"
is meant an oocyte in which a donor cell, nucleus, or chromatin
mass is inserted or fused. An embryo formed from the oocyte is
referred to as a "nuclear transfer" or "nuclear transplant"
embryo.
[0083] By "embryo" or "embryonic" is meant a developing cell mass
that has not implanted into the uterine membrane of a maternal
host. Hence, the term "embryo" may refer to a fertilized oocyte; an
oocyte containing a donor chromatin mass, nucleus, or reprogrammed
cell; a pre-blastocyst stage developing cell mass; or any other
developing cell mass that is at a stage of development prior to
implantation into the uterine membrane of a maternal host and prior
to formation of a genital ridge. An embryo may represent multiple
stages of cell development. For example, a one cell embryo can be
referred to as a zygote; a solid spherical mass of cells resulting
from a cleaved embryo can be referred to as a morula, and an embryo
having a blastocoel can be referred to as a blastocyst. An
"embryonic cell" is a cell isolated from or contained in an
embryo.
[0084] By "cells derived from an embryo" is meant cells that result
from the cell division of cells in the embryo.
[0085] By "chimeric embryo" is meant an embryo formed from cells
from two or more embryos. The resulting fetus or offspring can have
cells that are derived from only one of the initial embryos or
cells derived from more than one of the initial embryos. If
desired, the percentage of cells from each embryo that are
incorporated into the placental tissue and into the fetal tissue
can be determined using standard FISH analysis or analysis of a
membrane dye added to one embryo.
[0086] By "chimeric ungulate" is meant an ungulate formed from
cells from two or more embryos. The ungulate can have cells that
are derived from only one of the initial embryos or cells derived
from more than one of the initial embryos. If desired, the
percentage of cells from each embryo that are incorporated into the
placental tissue and into the fetal tissue can be determined using
standard FISH analysis or analysis of a membrane dye added to one
embryo.
[0087] By "precompaction embryo" is meant an embryo prior to
compaction. A precompaction embryo expresses essentially no
E-cadherin on the surface of its blastomeres. Preferred
precompaction embryos express at least 3, 5, 10, 20, 30, or 40-fold
less E-cadherin than a fully compacted embryo of the same species,
or express no E-cadherin.
[0088] By "compaction embryo" is meant an embryo undergoing
compaction or following compaction. The blastomeres of a compaction
embryo express E-cadherin on their surface. This E-cadherin
expression can be measuring using standard methods with an
anti-E-cadherin antibody. E-cadherin increases the adherence
between blastomeres. Preferred compaction embryos include embryos
in which the compaction process is completed. Other preferred
compaction embryos express at least 3, 5, 10, 20, 30, or 40-fold
more E-cadherin than a precompaction embryo of the same
species.
[0089] By "fetus" is meant a developing cell mass that has
implanted into the uterine membrane of a maternal host. A fetus may
have defining features such as a genital ridge which is easily
identified by a person of ordinary skill in the art. A "fetal cell"
is any cell isolated from or contained in a fetus.
[0090] By "parthenogenesis" or "parthenogenetic activation" is
meant development of an oocyte or ovum without fusion of its
nucleus with a male pronucleus to form a zygote. For example, an
oocyte can be induced to divide without fertilization.
[0091] By "zona pellucida" is meant a translucent, elastic,
noncellular layer surrounding the oocyte or ovum of many
mammals.
[0092] By "trophectoderm" is meant the outermost layer of cells
surrounding the blastocoel during the blastocyst stage of mammalian
embryonic development. Trophectoderm gives rise to most or all of
the placental tissue upon further development.
[0093] By "inner cell mass" is meant the cells surrounded by the
trophectoderm. The inner cell mass cells give rise to most of the
fetal tissues upon further development.
[0094] By "mRNA or protein specific for one cell type" is meant an
mRNA or protein that is expressed in one cell type at a level that
is at least 10, 20, 50, 75, or 100 fold greater than the expression
level in all other cell types. Preferably, the mRNA or protein is
only expressed in one cell type.
[0095] By "mutation" is meant an alteration in a
naturally-occurring or reference nucleic acid sequence, such as an
insertion, deletion, frameshift mutation, silent mutation, nonsense
mutation, or missense mutation. Preferably, the amino acid sequence
encoded by the nucleic acid sequence has at least one amino acid
alteration from a naturally-occurring sequence. Examples of
recombinant DNA techniques for altering the genomic sequence of a
cell, embryo, fetus, or mammal include inserting a DNA sequence
from another organism (e.g., a human) into the genome, deleting one
or more DNA sequences, and introducing one or more base mutations
(e.g., site-directed or random mutations) into a target DNA
sequence. Examples of methods for producing these modifications
include retroviral insertion, artificial chromosome techniques,
gene insertion, random insertion with tissue specific promoters,
homologous recombination, gene targeting, transposable elements,
and any other method for introducing foreign DNA. All of these
techniques are well known to those skilled in the art of molecular
biology (see, for example, Ausubel et al., supra). Chromatin
masses, chromosomes, and nuclei from transgenic cells containing
modified DNA or donor transgenic cells may be used in the methods
of the invention.
[0096] By "immortalized" is meant capable of undergoing at least
25, 50, 75, 90, or 95% more cell divisions than a
naturally-occurring control cell of the same cell type, genus, and
species as the immortalized cell or than the donor cell from which
the immortalized cell was derived. Preferably, an immortalized cell
is capable of undergoing at least 2, 5, 10, or 20-fold more cell
divisions than the control cell. More preferably, the immortalized
cell is capable of undergoing an unlimited number of cell
divisions. Examples of immortalized cells include cells that
naturally acquire a mutation in vivo or in vitro that alters their
normal growth-regulating process. Still other preferred
immortalized cells include cells that have been genetically
modified to express an oncogene, such as ras, myc, abl, bcl2, or
neu, or that have been infected with a transforming DNA or RNA
virus, such as Epstein Barr virus or SV40 virus (Kumar et al.,
Immunol. Lett. 65:153-159, 1999; Knight et al., Proc. Nat. Acad.
Sci. USA 85:3130-3134, 1988; Shammah et al., J. Immunol. Methods
160-19-25, 1993; Gustafsson and Hinkula, Hum. Antibodies Hybridomas
5:98-104, 1994; Kataoka et al., Differentiation 62:201-211, 1997;
Chatelut et al., Scand. J. Immunol. 48:659-666, 1998). Cells can
also be genetically modified to express the telomerase gene (Roques
et al., Cancer Res. 61:8405-8507, 2001).
[0097] By "non-immortalized" is meant not immortalized as described
above.
[0098] By "fusogenic compound" is meant a compound that increases
the probability that a chromatin mass or nucleus is inserted into a
recipient cell when located adjacent to the cell. For example, the
fusogenic compound may increase the affinity of a chromatin mass or
a nucleus for the plasma membrane of a cell. The fusogenic compound
may also promote the joining of the nuclear membrane of a nucleus
with the plasma membrane of a cell.
[0099] By "substantially identical" is meant having a sequence that
is at least 60, 70, 80, 90, or 100% identical to that of another
sequence. Sequence identity is typically measured using sequence
analysis software with the default parameters specified therein
(e.g., Sequence Analysis Software Package of the Genetics Computer
Group, University of Wisconsin Biotechnology Center, 1710
University Avenue, Madison, Wis. 53705). This software program
matches similar sequences by assigning degrees of homology to
various substitutions, deletions, and other modifications.
[0100] By "reducing the quantity and/or activity of endogenous
antibody" is meant reducing the amount of endogenous antibodies
produced by a B-cell or a population of B-cells. This reduction in
the amount of endogenous antibodies may be due to a decrease in the
amount of endogenous antibodies produced per B-cell, a decrease in
the number of functional endogenous B-cells, or a combination
thereof. Preferably, the amount of an endogenous antibody secreted
by a B-cell or expressed on the surface of a B-cell expressing or
secreting endogenous antibody is reduced by at least 25, 50, 75,
90, or 95%. In another preferred embodiment, the number of
endogenous B-cells in a sample from the recipient mammal, such as a
blood sample, is reduced by at least 25, 50, 75, 90, or 95%.
[0101] By "substantially eliminated" is meant a decrease of at
least 75, 80, 95, or 100%. In preferred embodiments, an ungulate in
which B-cells that express fully or partially endogenous antibody
are substantially eliminated has an undetectable amount of these
B-cells. In other preferred embodiments, an ungulate in which fully
or partially endogenous antibodies are substantially eliminated has
an undetectable amount of these antibodies.
[0102] By "mammal with an immune system that is less responsive
than normal" is meant a recipient mammal that naturally or
spontaneously has an innate or adaptive immune system that is less
active than normal. For example, the recipient mammal may have
fewer B-cells, fewer Ig molecules expressed on the surface of
B-cells, fewer antibody molecules secreted by B-cells, fewer
T-cells, fewer cytokine molecules produced by T-cells exposed to an
antigen or mitogen, less cytotoxic activity or proliferation of
T-cells in response to an antigen or mitogen, or fewer antibody or
cytokine molecules produced in response to administration of an
antigen, based on standard methods such as those described herein.
Preferably, the number of any of the above cells or immunoglobulins
or the level of any of the above activities in a recipient mammal
is less than the average number of cells or immunoglobulins or the
average level of activity for mammals of the same genius, species,
and age. In other preferred embodiments, the number of any of these
cells or immunoglobulins or the level of any of these activities in
a recipient mammal is less 90, 80, 70, 60, 50, 40, 30, or 20% of
the corresponding number of cells or immunoglobulins or the
corresponding level of activity in another mammal of the same
genus, species, and age. Any of these assays may also be used to
identify the mammals in a population of potential recipient mammals
with the least active immune systems.
[0103] By "fully endogenous antibody" is meant an antibody that has
an amino acid sequence that consists entirely of sequence
endogenous to the host organism. If desired, the amount of fully
endogenous antibody in a sample from a transgenic ungulate may be
measured by determining the amount of antibody in the sample that
(i) reacts with an antibody (e.g., anti-bovine immunoglobulin
antibody) reactive with endogenous antibody but (ii) does not react
with an antibody (e.g., anti-human immunoglobulin antibody)
reactive with xenogenous antibody. If desired, the antibody
reactive with endogenous antibody (e.g., anti-bovine immunoglobulin
antibody) that is used in this assay is preabsorbed against
xenogenous (e.g., human) immunoglobulin to ensure that antibodies
which cross react with xenogenous antibody are removed. Similarly,
the antibody reactive with xenogenous antibody (e.g., anti-human
immunoglobulin antibody) that is used in this assay is preabsorbed
against endogenous (e.g., bovine) immunoglobulin to ensure that
antibodies which cross react with endogenous antibody are
removed.
[0104] By "fully xenogenous antibody" is meant an antibody that has
an amino acid sequence that consists entirely of sequence
xenogenous to the host organism (e.g., human sequence). If desired,
the amount of fully xenogenous antibody in a sample from a
transgenic ungulate may be measured by determining the amount of
antibody in the sample that (i) reacts with an antibody (e.g.,
anti-human immunoglobulin antibody) reactive with xenogenous
antibody but (ii) does not react with an antibody (e.g.,
anti-bovine immunoglobulin antibody) reactive with endogenous
antibody.
[0105] By "partially endogenous antibody" or "partially xenogenous
antibody" is meant an antibody that has a segment (e.g., a region
of an antibody heavy or light chain or an entire heavy or light
chain) that consists of endogenous antibody sequence and a segment
(e.g., a region of an antibody heavy or light chain or an entire
heavy or light chain) that consists of xenogenous antibody
sequence. If desired, the amount of partially xenogenous or
partially endogenous antibody in a sample from a transgenic
ungulate may be measured by determining the amount of antibody in
the sample that (i) reacts with an antibody (e.g., anti-human
immunoglobulin antibody) reactive with xenogenous antibody and (ii)
reacts with an antibody (e.g., anti-bovine immunoglobulin antibody)
reactive with endogenous antibody.
[0106] By "modified antibody" is meant an antibody having an
altered amino acid sequence so that fewer antibodies and/or immune
responses are elicited against the modified antibody when it is
administered to an ungulate. For example, the constant region of
the antibody may be replaced with the constant region from a bovine
antibody. For the use of the antibody in a mammal other than a
bovine, an antibody may be converted to that species format.
[0107] By "bifunctional antibody" is meant an antibody that
includes an antibody or a fragment of an antibody covalently linked
to a different antibody or a different fragment of an antibody. In
one preferred embodiment, both antibodies or fragments bind to
different epitopes expressed on the same antigen. Other preferred
bifunctional antibodies bind to two different antigens, such as to
both an antibody light chain and an antibody heavy chain. Standard
molecular biology techniques such as those described herein may be
used to operably link two nucleic acids so that the fusion nucleic
acid encodes a bifunctional antibody.
[0108] By "fragment" is meant a polypeptide having a region of
consecutive amino acids that is identical to the corresponding
region of an antibody of the invention but is less than the
full-length sequence. The fragment has the ability to bind the same
antigen as the corresponding antibody based on standard assays,
such as those described herein. Preferably, the binding of the
fragment to the antigen is at least 20, 40, 60, 80, or 90% of that
of the corresponding antibody.
[0109] By "purified" is meant separated from other components that
naturally accompany it. Typically, a factor is substantially pure
when it is at least 50%, by weight, free from proteins, antibodies,
and naturally-occurring organic molecules with which it is
naturally associated. Preferably, the factor is at least 75%, more
preferably, at least 90%, and most preferably, at least 99%, by
weight, pure. A substantially pure factor may be obtained by
chemical synthesis, separation of the factor from natural sources,
or production of the factor in a recombinant host cell that does
not naturally produce the factor. Proteins, vesicles, and
organelles may be purified by one skilled in the art using standard
techniques such as those described by Ausubel et al. (Current
Protocols in Molecular Biology, John Wiley & Sons, New York,
2000). The factor is preferably at least 2, 5, or 10 times as pure
as the starting material, as measured using polyacrylamide gel
electrophoresis, column chromatography, optical density, HPLC
analysis, or western analysis (Ausubel et al., supra). Preferred
methods of purification include immunoprecipitation, column
chromatography such as immunoaffinity chromatography, magnetic bead
immunoaffinity purification, and panning with a plate-bound
antibody.
[0110] By "specifically binding a protein" is meant binding to the
protein (e.g., an endogenous ungulate antibody), but not
substantially binding to other molecules (e.g., endogenous proteins
other than antibodies or xenogenous antibodies) in a sample, e.g.,
a biological sample, that naturally includes the protein.
Preferably, the amount antibody bound to an endogenous antibody is
at least 50%, 100%, 200%, 500%, or 1,000% greater than the amount
of antibody bound to an exogenous antibody under the same
conditions.
[0111] By "specifically binding mu heavy chain" is meant binding
substantially more mu heavy chain than any other molecule in a
sample. Preferably, the amount of antibody bound to an endogenous
mu heavy chain is at least 50%, 100%, 200%, 500%, or 1,000% greater
than the amount of antibody bound to any other immunoglobulin
molecule under the same conditions. In other preferred embodiments,
the binding affinity of the antibody for IgM molecules, which
contain mu heavy chain, is at least 2, 5, 10, 20, or 30 fold
greater than the binding affinity for IgG molecules, which doe not
contain mu heavy chain.
[0112] By "specifically binding lambda chain" is meant binding
substantially more lambda light chain than any other molecule in a
sample. Preferably, the amount of antibody bound to an endogenous
lambda light chain is at least 50%, 100%, 200%, 500%, or 1,000%
greater than the amount of antibody bound to any other
immunoglobulin molecule under the same conditions. In other
preferred embodiments, the antibody binds both IgG and IgM
molecules, which both contain lambda light chain.
[0113] Advantages The present invention provides a number of
advantages related to the production of xenogenous antibodies in
transgenic ungulates. For example, the methods described herein
have been used to express human antibody protein in transgenic
bovines. Polyclonal human antibodies that are reactive with a
specific antigen that was administered to the transgenic bovines
have also been produced. Given these promising results, a skilled
artisan would appreciate that the methods described herein can be
used to generate other transgenic ungulates that express desired
human antibodies (e.g., antibodies reactive with specific antigens
or antibody mixtures for use as therapeutic substitute for
IVIG).
[0114] The present methods also provide a simple technique for
eliminating undesired antibodies in transgenic ungulates that also
express desired xenogenous antibodies (e.g., human antibodies). By
reducing the amount of endogenous antibody, these steps greatly
simplify the purification of xenogenous antibodies from the blood
or milk of the transgenic ungulates.
[0115] In ungulates, precursor cells only differentiate to form
B-cells during the first half development. Thus, eliminating all of
the endogenous B-cells that are present in the ungulate after this
stage of development should prevent any additional endogenous
B-cells from being formed because precursor cells are no longer
differentiating into B-cells. Therefore, a single dose of
administered antibody may be sufficient to eliminate all of the
endogenous B-cells in an ungulate. If all of the endogenous B-cells
were not eliminated, additional doses of antibody may be
administered.
[0116] Other features and advantages of the invention will be
apparent from the following detailed description and from the
claims.
BRIEF DESCRIPTION OF THE DRAWING
[0117] The application file contains drawings executed in color
(FIGS. 31, 34A, 34C, 36A, 36B, and 42-45). Copies of this patent or
patent application with color drawings will be provided by the
Office upon request and payment of the necessary fee.
[0118] FIG. 1A contains an overview of the procedures used to
produce a cow that contains an Ig knockout and human artificial
chromosome. The time line in FIG. 1A is based on an estimated 18
months to prepare the Ig knockout vector and generate knockout
cells, 2 months to generate fetuses from the knockout cells, 9
months to perform subsequent knockouts, 9 months of gestation for
calves to be born, 12 months before embryos can be produced from
calves, and 6 months to perform the HAC transfers.
[0119] FIG. 1B contains an overview of the methods used to produce
a cow that contains a mutation in an endogenous Ig gene and
contains .DELTA.HAC or .DELTA..DELTA.HAC. For the time line in FIG.
1B, it is estimated that 250 colonies are screened per week for a
total of 3,000 colonies in 3 months to isolate male and female
knockout cells. It is assumed that one or more knockout colonies
are produced per 1,500 colonies. Homozygous knockout ungulates may
be produced by (1) introducing a second Ig mutation in an isolated
knockout cell before nuclear transfer, (2) introducing a second Ig
mutation in a cell obtained from a embryo, fetus (e.g., fetus at
.about.60 gestation days), or offspring produced from a first round
of nuclear transfer and using the resulting homozygous cell as the
donor cell in a second round of nuclear transfer, or (3) mating
hemizygous ungulates. In FIGS. 1A and 1B, "Homo" denotes
homozygous; "Hemi" denotes hemizygous; "H" denotes heavy chain; "L"
denotes light chain; "HAC" denotes human artificial chromosome;
"HAC 1" denotes either HAC; and "HAC2" denotes a second HAC.
[0120] FIG. 2A contains a mu (IgM heavy chain) knockout construct
according to the invention. FIG. 2B is a restriction map of
immunoglobulin loci from a Holstein cattle.
[0121] FIGS. 3A and 3B contain schematic illustrations of construct
"pSTneoB" and "pLoxP-STneoB" that were used to produce the mu
knockout DNA construct, which is illustrated in FIG. 3C. FIG. 3D is
the polynucleotide sequence of the 1.5 kb region of the genomic
bovine mu heavy chain locus that was used as the first region of
homology in the mu knockout construct (SEQ ID NO: 47). FIG. 3E is
the polynucleotide sequence of the 3.1 kb region of the genomic
bovine mu heavy chain locus that was used as the second region of
homology in the mu knockout construct (SEQ ID NO: 48). In this
sequence, each "n" represents any nucleotide or no nucleotide. The
region of consecutive "n" nucleotides represents an approximately
0.9 to 1.0 kb region for which the polynucleotide sequence has not
been determined. FIG. 3F is a schematic illustration of a puromycin
resistant, bovine mu heavy chain knockout construct. FIG. 3G is the
polynucleotide sequence of a bovine kappa light chain cDNA (SEQ ID
NO: 60). All or part of this sequence may be used in a kappa light
chain knockout construct. Additionally, this kappa light chain may
be used to isolate a genomic kappa light chain sequence for use in
a kappa light chain knockout construct.
[0122] FIG. 4 is a schematic illustration of the construction of
.DELTA.HAC and .DELTA..DELTA.HAC.
[0123] FIG. 5 is a picture of an agarose gel showing the presence
of genomic DNA encoding human heavy and light chains in .DELTA.HAC
fetuses.
[0124] FIG. 6 is a picture of an agarose gel showing the expression
of human Cmu exons 3 and 4 in a .DELTA.HAC fetus at 77 gestational
days (fetus #5996).
[0125] FIG. 7 is a picture of an agarose gel showing the
rearrangement of endogenous bovine heavy chain in .DELTA.HAC fetus
#5996
[0126] FIG. 8 is a picture of an agarose gel showing the expression
of rearranged human heavy chain in .DELTA.HAC fetus #5996.
[0127] FIG. 9 is a picture of an agarose gel showing the expression
of the spliced constant region from the human heavy chain locus in
.DELTA.HAC fetus #5996
[0128] FIG. 10 is a picture of an agarose gel showing the
expression of rearranged human heavy chain in .DELTA.HAC fetus
#5996.
[0129] FIG. 11A is the polynucleotide sequence of a rearranged
human heavy chain transcript from .DELTA.HAC fetus #5996 (SEQ ID
NO: 49). FIG. 11B is a sequence alignment of a region of this
sequence ("Query") with a human anti-pneumococcal antibody
("Sbjct") (SEQ ID NOs: 50 and 51, respectively). For the query
sequence from .DELTA.HAC fetus #5996, only those nucleotides that
differ from the corresponding nucleotides of the human
anti-pneumococcal antibody sequence are shown.
[0130] FIGS. 12A and 12B are two additional polynucleotide
sequences (SEQ ID NOs: 52 and 54) and their deduced amino acid
sequences (SEQ ID NOs: 53 and 55, respectively) of rearranged human
heavy chain transcripts from .DELTA.HAC fetus #5996.
[0131] FIG. 13 is a picture of an agarose gel demonstrating that
.DELTA..DELTA.HAC fetus #5580 contains both human heavy and light
chain immunoglobulin loci.
[0132] FIG. 14 is a picture of an agarose gel demonstrating that
.DELTA..DELTA.HAC fetuses #5442A, and 5442B contain both human
heavy and light chain loci.
[0133] FIG. 15 is a picture of an agarose gel showing the
expression of the spliced mu constant region from the human heavy
chain locus in .DELTA..DELTA.HAC fetus #5542A.
[0134] FIG. 16 is a picture of an agarose gel showing the
rearrangement and expression of the human heavy chain locus in
.DELTA..DELTA.HAC fetus #5868A.
[0135] FIG. 17 is a picture of an agarose gel showing rearrangement
and expression of the human Ig lambda locus in .DELTA..DELTA.HAC
fetuses #5442A and 5442B.
[0136] FIG. 18 is a picture of an agarose gel showing rearrangement
and expression of the human Ig lambda locus in .DELTA..DELTA.HAC
fetus #5442A.
[0137] FIG. 19 is a picture of an agarose gel showing rearrangement
and expression of the human Ig lambda locus in .DELTA..DELTA.HAC
fetus #5868A.
[0138] FIG. 20 is a polynucleotide sequence and the corresponded
deduced amino acid sequence of a rearranged human light chain
transcript from .DELTA..DELTA.HAC fetus #5442A (SEQ ID NOs: 56 and
57, respectively).
[0139] FIG. 21 is another polynucleotide sequence and the
corresponding deduced amino acid sequence of a rearranged human
light chain transcript from .DELTA..DELTA.HAC fetus #5442A (SEQ ID
NOs: 58 and 59, respectively).
[0140] FIGS. 22A-22H are graphs of a FACS analysis of expression of
human lambda light chain and bovine heavy chain proteins by
.DELTA..DELTA.HAC fetuses #5442A (FIGS. 22A-22D) and 5442B (FIGS.
22E-22H). Lymphocytes from the spleens of these fetuses were
reacted with a phycoerytherin labeled anti-human lambda antibody
(FIGS. 22C and 22D), a FITC labeled anti-bovine IgM antibody (FIGS.
22D and 22H), or no antibody (FIGS. 22A, 22B, (22E, and 22F) and
then analyzed on a FASCalibur cell sorter. The percent of cells
that were labeled with one of the antibodies is displayed beneath
each histogram.
[0141] FIG. 23 is a schematic illustration of the
.alpha.-(1,3)-galactosyltransferase knockout vector used to insert
a puromycin resistance gene and a transcription termination
sequence into the endogenous .alpha.-(1,3)-galactosyltransferase
gene in bovine cells.
[0142] FIG. 24 is a schematic illustration of a BamHI-XhoI fragment
containing exons 2, 3, and 4 that was used as a backbone for the
AAV targeting vector. A neomycin resistance marker was used for
insertional mutagenesis of the locus by insertion into exon 4. The
location of the annealing sites for the PCR primers that were used
for subsequent confirmation of appropriate targeting is
indicated.
[0143] FIG. 25 is a schematic illustration of the construction of
an adeno-associated viral construct designed to remove endogenous
bovine IgH sequence.
[0144] FIG. 26 is a picture of an agarose gel showing the PCR
analysis of individually transduced clones for appropriate
targeting events. The vector used in this experiment is shown in
FIG. 24. PCR products indicative of appropriate targeting are
marked with asterisks.
[0145] FIG. 27 is a table listing pregnancy rates for HAC carrying
embryos.
[0146] FIGS. 28A-28J are pictures of FACS analysis of peripheral
blood lymphocytes from either experimental fetuses injected with an
anti-bovine IgM antibody (das6) to inhibit B-cell development or
control fetuses. FIGS. 28A-28E are pictures of the FACS analysis
performed using an anti-bovine IgM antibody to detect IgM molecules
expressed on the surface of B-cells. As illustrated in FIG. 28A and
FIG. 2B, approximately 19.82 to 26.61% of the peripheral blood
lymphocytes from the control fetuses expressed IgM. In contrast,
7.78, 11.80, or 3.95% of the peripheral blood lymphocytes from the
three fetuses injected with the anti-bovine IgM antibody expressed
IgM (FIGS. 28C-28E, respectively). FIGS. 28F-28J are pictures of
the FACS analysis performed using an anti-bovine light chain
antibody (das10) to detect antibody light chain molecules expressed
on the surface of B-cells. As illustrated in FIG. 28F and FIG. 28G,
approximately 12.43 to 29.47% of the peripheral blood lymphocytes
from the control fetuses expressed antibody light chain molecules.
In contrast, 2.54, 13.77, or 3.99% of the peripheral blood
lymphocytes from the three fetuses injected with the anti-bovine
IgM antibody expressed antibody light chain molecules (FIGS.
28H-28J, respectively).
[0147] FIGS. 29A and 29B illustrate the immunodetection of nuclear
envelope and nuclear matrix proteins in bovine preimplantation
embryos. FIG. 29A is a picture of in vitro-fertilized bovine
embryos at the pronuclear and 8-cell stage examined using the same
antibodies. Arrows in FIG. 29A to anti-NuMA and anti-AKAP95
labeling in the female pronucleus of pronuclear stage embryos.
Insets in FIG. 29A are pictures of DNA labeled with 0.1 .mu.g/ml
Hoechst 33342 (bars, 20 .mu.m). FIG. 29B is the immunoblotting
analysis of bovine fibroblasts (upper rows) and pronuclear stage
embryos (lower rows). Molecular weight markers are shown in kDa on
the right of FIG. 29B.
[0148] FIG. 30 illustrates the dynamics of the nuclear envelope,
NuMA, and AKAP95 during premature chromatin condensation and
pronuclear assembly in nuclear transplant embryos. FIG. 30 is a
picture of bovine donor fibroblasts (Donor cell), nuclear
transplant embryos at the premature chromatin condensation stage
(three hours post-fusion), nuclear transplant embryos at the
pronuclear stage (19 hours post-fusion), and parthenogenetic
pronuclear stage embryos activated as described herein. Disassembly
of the donor nucleus and assembly of the new pronuclei were
monitored at the premature chromatin condensation stage three hours
post injection "hpi" ("PCC") and seven hours post injection ("NT
PN"), using anti-lamin B, lamins A/C, NuMA, and AKAP95 antibodies.
Female pronuclei formed after parthenogenetic activation of MII
oocytes with 10 mM SrCl.sub.2 were also analyzed five hours after
start of activation treatment ("Parth. PN"). Lamins A/C were
assembled in pronuclei of bovine pronuclear stage nuclear
transplant embryos. DNA was counterstained with 0.1 .mu.g/ml
Hoechst 33342. TRITC refers to labeling with TRITC-conjugated
secondary antibodies (bars, 20 .mu.m).
[0149] FIG. 31 is a graph demonstrating that AKAP95 is more
strongly anchored in pronuclei of nuclear transplant embryos
compared to parthenogenetic embryos. This graph shows the relative
percent of unextracted lamin B, AKAP95, and DNA labeling in
pronuclei of parthenotes, nuclear transplant embryos, and somatic
donor nuclei after in situ extraction with 0.1% Triton X-100 and 1
mg/ml DNAse I together with 100 or 300 mM NaCl for 30 minutes at
room temperature prior to fixation with 3% paraformaldehyde.
Localization of B-type lamins (red) and AKAP95 (green) was examined
by double immunofluorescence. Fluorescence labeling intensity in
each channel--red, (lamin B), blue (DNA), and green (AKAP95)--was
quantified. The reference value (100% unextracted) represents
relative amounts of B-type lamins, DNA, and AKAP95 staining in
embryos or cells permeabilized with 0.1% Triton X-100 only prior to
fixation. Approximately 30 embryos were examined in each group.
[0150] FIG. 32 demonstrates that lamins A/C are transcribed de novo
upon pronuclear reconstitution in nuclear transplant embryos. FIG.
32 is a picture of bovine pronuclear nuclear transplant embryos
produced by fibroblast fusion and oocyte activation with either 5
.mu.M ionomycin for four minutes followed by 10 .mu.g/ml
cycloheximide/2.5 .mu.g/ml cytochalasin D for four hours (b', -),
ionomycin/cycloheximide/cytochalasin D as in (b') followed by an
additional nine hours of culture with 10 .mu.g/ml cycloheximide
(b'', CHX) or incubation as in (b') together with 1 .mu.g/ml
actinomycin D during the entire activation treatment (b''').
Anti-lamin B (rabbit polyclonal) and anti-lamins A/C (mAb)
antibodies were used on the same preparations. Insets are pictures
of DNA labeling with 0.1 .mu.g/ml Hoechst 33342 (bars, 20
.mu.m).
[0151] FIG. 33 is a graph of chromosome condensation and nuclear
envelope breakdown in mitotic cytoplasmic extract (M-S15), mitotic
cytosolic extract (M-S200), and oocyte extract (MII-S15) (n=300-400
nuclei examined in 3-5 replicates).
[0152] FIGS. 34A-34C are sets of pictures of immunofluorescence
analysis of purified input bovine fibroblast nuclei (FIG. 34A) and
condensed chromatin produced in mitotic cytosolic extract (FIG.
634) and oocyte extract (FIG. 34C). The indicated nuclear markers
were examined. DNA was counterstained with propidium iodide (red)
(bars, 10 .mu.m).
[0153] FIG. 35 is a set of pictures of immunofluorescence analysis
of condensed chromatin obtained in oocytes following conventional
nuclear transplant (NT) or nuclear injection (NI) methods and
following injection of chromatin masses into oocytes (CT) using the
methods of the present invention. Both detectable lamins B and A/C
appear to be solubilized (bar, 10 .mu.m).
[0154] FIGS. 36A and 36B are sets of pictures of immunofluorescence
analysis of pronuclei resulting from chromatin transfer, nuclear
transplant, or nuclear injection. Embryos were fixed at 19 hours
post nuclear transplant, nuclear injection, or chromatin transfer
and labeled. Control parthenogenetic pronuclei (Part.) were also
examined.
[0155] FIG. 36A shows the analysis of lamins A/C and B. FIG. 36B
shows the analysis of AKAP95 and NuMA. Lamins A/C (green label)
only appear in nuclear transplant and nuclear injection pronuclei
(bars, 30 .mu.m).
[0156] FIG. 37 is a diagram of a procedure for production of cloned
Tc calves. Construction of HAC is shown with hChr22 and hChr14
regions containing Ig.lamda. and IgH genes and the position of the
neo selection marker. From a CHO clone, the HAC was transferred
into fetal bovine fibroblasts by means of a MMCT technique. Tc
fibroblasts were fused with an enucleated oocyte for nuclear
transfer. The reconstituted Tc embryos were cultured in vitro to
the blastocyst stage then implanted into recipient cows. Around 60
days of gestation Tc fetuses were recovered; fibroblast cell lines
were reestablished, evaluated and used for further nuclear
transfer. Recloned Tc embryos were transferred to recipients to
produce Tc calves.
[0157] FIGS. 38A-38D illustrate the analysis of Tc fetuses. G418
selection of regenerated Tc fibroblast line and control
non-transgenic fibroblasts (FIG. 38A). Genomic PCR of IgH and Igl
loci in Tc fetuses and controls. The three fetuses, #5968 (lane 1),
#6032 (lane 2) and #6045 (lane 3) were derived from .DELTA.HAC
fibroblasts, fetus #5580 (lane 4) was from .DELTA..DELTA.HAC
fibroblasts. As a control, a non-transgenic fetus (lane N) was
recovered and evaluated (FIG. 38B). In all Tc fetuses and a
positive control human liver DNA sample (lane P), both human IgH
and Igl loci were detected by PCR, but not in the negative control
(lane N). Rearranged and expressed human Ig.mu. and Ig.lamda.
transcripts amplified by RT-PCR from negative control
non-transgenic bovine spleen (lane N), from brain (lane 1), liver
(lane 2) and spleen (lane 3) of cloned Tc fetus and positive
control human spleen (lane P) (FIG. 38C). A representative
nucleotide and deduced amino acid sequence of human Ig.mu. and
Ig.lamda. transcripts amplified by RT-PCR from a cloned Tc fetus
recovered at 91 days (FIG. 38D). RT-PCR was carried out as
described (Kuroiwa et al., Nature Biotech 18:1086-1090, 2000). For
human Ig.mu. transcripts, VH1/5 BACK, VH3 BACK, and VH4BACK were
used as a 5' primers and C.mu.-2 was used as a 3' primer. For human
Ig.lamda. transcripts, V.lamda.1LEA1, V.lamda.2MIX and V.lamda.3MIX
were used as 5' primers, and C.lamda.MIX was used as a 3' primer.
The amplified cDNAs were subcloned using a TA cloning kit
(Invitrogen) and sequenced using a DNA autosequencer (ABI3700
system).
[0158] FIGS. 39A-39C are pictures illustrating the analysis of
cloned Tc calves. Four cloned Tc calves; male calf (#50) from cell
line #6045 and female calves (#1064, #1065, #1066) from cell line
#5968 (FIG. 39A). Genomic PCR of IgH and Ig.lamda. loci from PBLs
from cloned Tc calves and controls; calf #1064 (lane 1), #1065
(lane 2), #1066 (lane 3), #50 (lane 4), #1067 (lane 5) and #1068
(lane 6) (FIG. 39B). In all the Tc calves and positive control
human liver DNA (lane P) both human IgH and Ig.lamda. loci were
detected by genomic PCR, but not in a negative control,
non-transgenic calf (lane N). FISH analysis in metaphase chromosome
spreads in a cell showing a single signal and a cell showing a
double signal (FIG. 39C). Arrows indicate location of HACs amongst
surrounding bovine chromosomes. HAC painting was done using
digoxigenin labeled human COT-1 DNA as a probe and detected with an
anti-digoxigenin-rhodamine.
[0159] FIGS. 40A and 40B are schematic diagrams of an IgM knockout
vector with a puromycin-resistance gene and a strategy for
identifying correctly targeted cells using this vector,
respectively. FIGS. 40C and 40D are schematic diagrams of an IgM
knockout vector with a neomycin-resistance gene and a strategy for
identifying correctly targeted cells using this vector,
respectively.
[0160] FIG. 41 is a bar graph illustrating the effect of immunizing
a .DELTA.HAC transgenic animal with DNP-KLH. In particular,
adjuvant-stimulated immunization of HAC-transchromosomal cattle
generates a polyclonal, antigen-specific response to the immunizing
antigen. The reaction of the antibody to different epitopes of the
immunizing antigen demonstrates that HAC transchromosomal animals
can recognize multiple epitopes of a complex antigen. A .DELTA.HAC
1066 bovine was immunized subcutaneously with 400 ug of an
exemplary antigen, DNP-KLH, 2,4 dinitrophenylated keyhole limpet
hemocyanin, and Complete Freund's Adjuvant. The animal was then
immunized a second time with 400 ug of DNP-KLH, without any
adjuvant. Serum was collected from the immunized animal and
analyzed for reactivity with both hapten and carrier components of
the exemplary antigen, DNP-BSA and KLH, respectively. Such a
pattern of reactivity is characteristic of a polyclonal antibody
that is made up of a mixture of antibodies that recognize multiple
and different epitopes of a complex antigen. Human immunoglobulin
was affinity purified from collected sera using a bovine-anti-human
Ig column. Equimolar concentrations of affinity purified human Ig
from .DELTA.HAC 1066 was tested using solid phase ELISA for
reactivity with DNP-BSA, KLH, or BSA (negative control). A species
specific bovine anti-human biotinylated polyclonal antibody was
used as the detection reagent. Equimolar concentrations of
commercially produced human Ig and bovine Ig were analyzed in
parallel as negative controls. Optical densities at 405 nm were
taken and graphed for all samples. Only human Ig from a .DELTA.HAC
animal immunized with DNP-KLH (1066) demonstrated specific
reactivity to antigen. Commercially produced bovine Ig and human Ig
did not react with DNP-KLH and resembled background levels. A
PBS-BSA plate was also used as a negative control and showed no
reactivity.
[0161] FIG. 42 is a picture of a gel illustrating the purification
of human antibodies from HAC serum. In particular, fully human
antibodies can be purified from the serum of HAC transchromosomal
cattle. Furthermore, the presence of mu and gamma heavy chains
demonstrates that the HAC undergoes class switching and that the
cloned transchromosomic host supports class switching at the human
heavy chains locus.
[0162] Human antibody from .DELTA.HAC 82 was affinity purified
using a bovine anti-human Ig column and applied to a denaturing
protein gel for western analysis. Duplicate blots with equal
amounts (1 ug), of all samples were analyzed in parallel. Western
blot analysis was performed using two detection reagents in
independent duplicate blots. The two polyclonal species specific
reagents used were (i) biotinylated bovine anti-human Ig and (ii)
biotinylated horse anti-bovine Ig. The following controls were
applied to each gel: human IgG, IgM, and a mixture of bovine Ig
from commercial sources. When probed with bovine anti-human Ig, the
purified human Ig from a .DELTA.HAC animal produced bands which
migrated at molecular weights that matches those of both human
heavy chains, .mu. and .gamma. as well as human light chain. This
bovine anti-human detecting reagent reacts specifically with human
Ig without cross-reacting with bovine Ig. In the preparation of
human Ig from the .DELTA.HAC animal, bovine Ig was not detected
using the horse anti-bovine reagent (detection limits of this
reagent are greater than or equal to 50 ng bovine Ig). This horse
anti-bovine detecting reagent reacts specifically with bovine Ig
without cross-reacting with human Ig. The observation of human IgM
and IgG in the HAC human Ig preparation demonstrates Ig
class-switching capabilities. In 1 ug of HAC human Ig, no
significant levels of bovine Ig determinants were observed above
the detection limit of this reagent.
[0163] FIG. 43 illustrates that the HAC-encoded human light chains
(lambda) are bound to human mu chains and human gamma chains. This
result demonstrates that the xenogeneic B cells of
HAC-transchromosomal animals are capable of assembling human heavy
and light chains. In particular, purified human Ig from .DELTA.HAC
82 show both human .gamma. and .mu. liked directly to human .lamda.
chains. Human antibody from .DELTA.HAC 82 was affinity purified
using a bovine anti-human Ig column. Equimolar concentrations (100
ng/ml) of purified HAC human Ig were tested in two solid-phase
ELISAs. The capture reagent for Plate A was a purified monoclonal
mouse anti-human .mu. Ig, and the capture reagent for Plate B was a
mouse anti-human .gamma. Ig, both coated at a concentration of 10
ug/ml. As controls for each assay, equimolar concentrations of
commercially produced purified bovine Ig and human Ig (100 ng/ml)
were analyzed in parallel. The detecting reagent for both assays
was a biotinylated monoclonal mouse anti-human .lamda.. In each
assay, human Ig from .DELTA.HAC 82 exhibited levels above
background (e.g., levels above bovine IgG/M and BSA Plate C). Both
monoclonal reagents are specific for their recognized human heavy
chain class and do not cross-react with bovine Ig.
[0164] FIG. 44 illustrates that human mu, gamma, and light chains
are found in human Ig purified from a HAC-transchromosomal calf in
which an antigen-specific human antibody response has been induced.
In particular, purified human antibodies from DNP-KLH immunized HAC
serum was characterized. Human antibody from .DELTA.HAC 1066 was
affinity purified using a bovine anti-human Ig column and then
analyzed via western for human Ig. Approximately 1 ug (1.times.)
and 5 ug (5.times.) of human Ig from the DNP-KLH immunized animal
resolved on a PAGE gel. The commercially produced human IgG and IgM
(1 ug each) were analyzed in parallel analysis. The polyclonal
species-specific reagent, biotinylated bovine anti-human Ig, was
used to detect human Ig. Human Ig from the .DELTA.HAC 1066 animal
yield bands which migrate at a molecular weight that corresponds to
those of both human heavy chains .mu. and .gamma. as well as human
light chain. The presence of .mu. and .gamma. demonstrates the
capacity of the HAC-resident human heavy chain locus undergo class
switching and the ability of HAC transchromosomal cattle to effect
class switching of this human Ig locus. This detection reagent
reacts specifically with human Ig without cross-reacting with
bovine Ig.
[0165] FIG. 45 illustrates the SLOT procedure. In step one, donor
fibroblasts are reversibly permeabilized for 30 minutes with 500
ng/ml SLO. In step two, permeabilized cells are washed and
incubated in a mitotic extract containing an ATP-regenerating
system to elicit chromosome condensation and promote removal of
nuclear components (arrows). In step three, the extract is removed,
and the cells are optionally resealed in culture with 2 mM
CaCl.sub.2 for two hours. In step four, cells are fused to
enucleated recipient oocytes, and in step five, oocytes are
activated as for NT to elicit pronuclear formation and
development.
DETAILED DESCRIPTION
[0166] Methods for producing ungulates that express xenogenous
antibodies Various approaches may be used to produce ungulates that
express xenogenous (e.g., human) antibodies. These approaches
include, for example, the insertion of a human artificial
chromosome (HAC) containing both heavy and light chain
immunoglobulin genes into an ungulate or the insertion of human
B-cells or B-cell precursors into an ungulate during its fetal
stage or after it is born (e.g., an immune deficient or immune
suppressed ungulate) (see, for example, WO 01/35735, filed Nov. 17,
2000, US 02/08645, filed Mar. 20, 2002). In either case, both human
antibody producing B-cells and ungulate antibody-producing B-cells
may be present in the ungulate. In an ungulate containing a HAC, a
single B-cell may produce an antibody that contains a combination
of ungulate and human heavy and light chain proteins.
[0167] Standard methods can be used to introduce a desired nucleic
acid which contains genes (preferably, entire gene loci) for
producing antibodies of a particular species (e.g., a human) into a
donor cell for use in generating a transgenic ungulate that
expresses both xenogenous and endogenous antibodies. Preferably,
human artificial chromosomes are used, such as those disclosed in
WO 97/07671 (EP 0843961) and WO00/10383 (EP 1106061). These human
artificial chromosomes also are described in a corresponding issued
Japanese patent JP 30300092. Both of these applications are
incorporated by reference in their entirety herein. Also, the
construction of artificial human chromosomes that contain and
express human immunoglobulin genes is disclosed in Shen et al.,
Hum. Mol. Genet. 6(8):1375-1382 (1997); Kuroiwa et al., Nature
Biotechnol. 18(10):1086-1090 (2000); Loupert et al., Chromosome
107(4):255-259 (1998); WO00/10383 (EP 1106061); WO98/24893;
WO96/33735; WO 97/13852; WO98/24884; WO97/07671 (EP 0843961); U.S.
Pat. No. 5,877,397; U.S. Pat. No. 5,874,299; U.S. Pat. No.
5,814,318; U.S. Pat. No. 5,789,650; U.S. Pat. No. 5,770,429; U.S.
Pat. No. 5,661,016; U.S. Pat. No. 5,633,425; U.S. Pat. No.
5,625,126; U.S. Pat. No. 5,569,825; and U.S. Pat. No. 5,545,806;
all of which are incorporated by reference in their entirety
herein. Human artificial chromosomes may also be utilized to
introduce xenogenous antibody genes into wild-type animal cells;
this is accomplished using the methods described above.
Introduction of artificial chromosome into animal cells, especially
fetal fibroblast cells can be performed by microcell fusion as
described herein.
[0168] In an alternative to the use of human artificial chromosome,
nucleic acid encoding immunoglobulin genes may be integrated into
the chromosome using a YAC vector, BAC vector, or cosmid vector.
Vectors comprising xenogenous Ig genes (WO98/24893, WO96/33735, WO
97/13852, WO98/24884; U.S. Pat. No. 5,849,992 issued Dec. 15, 1998
to Meade et al., and U.S. Pat. No. 5,827,690 issued Oct. 27, 1998
to Meade et al.) can be introduced to fetal fibroblasts cells using
known methods, such as electroporation, lipofection, fusion with a
yeast spheroplast comprising a YAC vector, and the like. Further,
vectors comprising xenogenous Ig genes can be targeted to the
endogenous Ig gene loci of the fetal fibroblast cells, resulting in
the simultaneous introduction of the xenogenous Ig gene and the
disruption of the endogenous Ig gene.
[0169] Integration of a nucleic acid encoding a xenogenous
immunoglobulin gene may also be carried out as described in the
patents by Lonberg et al. (supra). In the "knockin" construct used
for the insertion of xenogenous immunoglobulin genes into a
chromosome of a host ungulate, one or more immunoglobulin genes and
an antibiotic resistance gene may be operably-linked to a promoter
which is active in the cell type transfected with the construct.
For example, a constitutively active, inducible, or tissue specific
promoter may be used to activate transcription of the integrated
antibiotic resistance gene, allowing transfected cells to be
selected based on their resulting antibiotic resistance.
Alternatively, a knockin construct in which the knockin cassette
containing the Ig gene(s) and the antibiotic resistance gene is not
operably-linked to a promoter may be used. In this case, cells in
which the knockin cassette integrates downstream of an endogenous
promoter may be selected based on the resulting expression of the
antibiotic resistance marker under the control of the endogenous
promoter. These selected cells may be used in the nuclear transfer
procedures described herein to generate a transgenic ungulate
containing a xenogenous immunoglobulin gene integrated into a host
chromosome.
[0170] Using similar methodologies, it is possible to produce and
insert artificial chromosomes containing genes for expression of Ig
of different species such as dog, cat, other ungulates, non-human
primates among other species. As discussed above, and as known in
the art, immunoglobulin genes of different species are well known
to exhibit substantial sequence homology across different
species.
[0171] Once it has been determined that the inserted artificial
chromosome, for example, a human artificial chromosome, has been
stably introduced into a cell line, e.g., a bovine fetal
fibroblast, it is utilized as a donor for nuclear transfer. This
may be determined by PCR methods. The resulting transgenic calves
comprise a stably introduced nucleic acid, such as a human
artificial chromosome. After calves have been obtained which
include the stably incorporated nucleic acid (for example, human
artificial chromosome), the animals are tested to determine whether
they express human Ig genes in response to immunization and
affinity maturation.
[0172] Modifications of the overall procedure described above may
also be performed. For example, to reduce the amount of endogenous
antibody expressed by the resulting transgenic ungulate, one or
more endogenous Ig genes may be inactivated in the donor cell
before or after insertion of the xenogenous nucleic aicd. Further,
an animal retaining xenogenous Ig genes may be mated with an animal
in which an endogenous Ig gene is inactivated.
[0173] Alternative methods for generating an ungulate that
expresses both endogenous and xenogenous antibodies involve
remodeling the donor genetic material before it is inserted into a
recipient oocyte to form the transgenic ungulate. Remodeling refers
to any morphological change that improves development of the
resulting nuclear transplant oocyte over that derived from either
transferring whole cells or intact nuclei into a recipient oocyte.
Reprogramming is achieved by incubating a donor nucleus that
contains a xenogenous immunoglobulin nucleic acid in a
reprogramming media (e.g., a mitotic extract, detergent and/or salt
solution, or protein kinase solution) resulting in nuclear envelope
dissolution and possibly chromatin condensation. This nuclear
envelope breakdown and chromatin condensation allows the release of
transcription regulatory proteins that were attached to the
chromosomes and that would otherwise promote the transcription of
genes undesirable for oocyte, embryo, or fetus development.
Additional regulatory proteins may be removed by purifying the
chromatin mass prior to transferring it into a recipient oocyte.
Alternatively, specific regulatory proteins that are released from
the chromosomes may be immunodepleted or otherwise removed from the
reprogrammed media (e.g., a cell extract) to prevent them from
re-binding the chromosomes. After nuclear transfer, new proteins
from the oocyte cytoplasm may be bound to the chromosomes during
decondensation of the chromatin and nuclear envelope formation in
the oocyte. These proteins promote the transcription of genes that
allow the oocyte to develop into a viable offspring.
[0174] Another cloning method that can be used to produce the
transgenic ungulate involves reprogramming a permeabilized cell
(i.e., a cell containing a xenogenous immunoglobulin nucleic acid)
by incubating it in a reprogramming media (e.g., a cell extract) to
allow the addition or removal of factors from the cell. The plasma
membrane of the permeabilized cell is preferably resealed to
enclose the desired factors and restore the membrane integrity of
the cell. The reprogrammed cell is then transferred into a
recipient oocyte for the production of a cloned mammal. This
cloning method has been used to produce fetuses without a
xenogenous immunoglobulin nucleic acid that have survived past day
60. Preliminary results indicate that fetal survival between day 40
and day 60 is higher for fetuses formed using this method (7/10;
70%) than for conventional nuclear transfer fetuses (8/16; 50%).
Similar results are expected for fetuses with a xenogenous
immunoglobulin nucleic acid.
[0175] The methods of the invention can also be used to reduce the
amount of endogenous antibodies produced by ungulates derived from
chimeric embryos that have genes for both xenogenous and endogenous
antibodies. Chimeric embryos in which the majority of the placental
tissue is from one genetic source and the majority of the fetal
tissue is from another genetic source can be generated. These
chimeric embryos may have fewer placental abnormalities and thus
may have an increased survival rate. In one such method, cells from
an in vitro fertilized or naturally-occurring embryo are contacted
with cells from an embryo that has a nucleic acid encoding a
xenogenous antibody and that is produced using traditional nuclear
transfer methods or any of the other cloning methods described
herein. For example, cells from an in vitro fertilized embryo can
be injected into the periphery of a nuclear transfer embryo (e.g.,
between the zona pellucida and the embryo itself). This method was
used to produce chimeric embryos without xenogenous antibody genes
that had a 67% survival rate at day 40 compared to a 25% survival
rate for control nuclear transfer embryos. Similar results are
expected using cells from nuclear transfer embryos that have a
xenogenous antibody gene. In an alternative method, cells from a
precompaction, in vitro fertilized or naturally-occurring embryo
are incubated with cells from a precompaction nuclear transfer
embryo under conditions that allow cells from each embryo to
reorganize to produce a single chimeric embryo (Wells and Powell,
Cloning 2:9-22, 2000). In both methods, the cells from the in vitro
fertilized or naturally-occurring embryo are preferentially
incorporated into the placenta, and the cells from the nuclear
transfer method are preferentially incorporated into the fetal
tissue.
[0176] Sequential manipulation of a donor cell (e.g., a bovine
fetal fibroblast cell) is useful for generating a human
antibody-producing bovine, with or without mating offspring.
Sequential manipulation of a donor cell includes the process of (i)
manipulation of a donor cell, (ii) nuclear transfer or chromatin
transfer, (iii) generation of a fetus, and (iv) isolation of a
donor cell from the fetus, such as a fetal fibroblast. In one
particular embodiment, a heavy chain hemizygous KO fetal fibroblast
is used as a donor cell in nuclear or chromatin transfer cloning
methods. A cell from the resulting fetus is modified to generate a
heavy chain homozygous KO fetal fibroblast. This fibroblast is used
as a donor cell in nuclear or chromatin transfer methods, and a
fibroblast from the resulting fetus is genetically modified to
generate a light chain hemizygous KO fetal fibroblast. After
nuclear or chromatin transfer, a fibroblast is genetically modified
to produce a light chain homozygous KO fetal fibroblast, which is
then used as a donor cell in nuclear or chromatin transfer. A HAC
is introduced into a fibroblast from the resulting fetus, and the
HAC-containing fibroblast is used in nuclear or chromatin transfer
to generate a calf that produces human antibodies.
[0177] With respect to the practical production of human
antibodies, inactivation of bovine light chain nucleic acids is
typically not required because the desired fully human antibodies
can be separated from undesired antibodies with bovine light chains
using a bovine anti-human IgL affinity column. Also, our recent
data suggests that the amount of chimeric molecules (e.g.,
antibodies with both bovine and human sequences) may be much less
than that of fully human antibodies. If inactivation of bovine
light chain nucleic acids is desired, bovine lambda light chain can
be mutated using the methods described herein.
[0178] Methods for producing xenogenous antibodies in ungulates and
eliminating undesired endogenous antibodies As discussed above, the
present invention also relates to the production of a transgenic
ungulate, preferably a transgenic cow, wherein (i) endogenous Ig
expression has been reduced by administering an antibody that
inhibits endogenous B-cells or antibodies and (ii) a nucleic acid
(e.g., an artificial chromosome) has been stably introduced that
comprises genes which are necessary for the production of
functional antibodies of another species, (e.g., human). Thereby, a
transgenic animal may be obtained that does not produce its
endogenous antibodies, but which instead produces antibodies of
another species. Any non-endogenous antibodies may be produced
including, without limitation, human, non-human primate, dog, cat,
mouse, rat, or guinea pig antibodies.
[0179] In particular, a compound that reduces the production of
endogenous antibodies by B-cells or that reduces the number of
functional, endogenous B-cells may be administered to a non-human
mammal (e.g., an ungulate). This immunodepletion can be performed
by injecting the ungulate with either monoclonal or polyclonal
antibodies against endogenous IgM heavy and/or endogenous light
chains (e.g., lambda and/or kappa light chains). B-cells expressing
either endogenous heavy or light chain proteins on their surface
are susceptible to either humoral or cell-mediated elimination,
apoptosis, or antibody-mediated cytotoxin uptake. The population of
fully xenogenous (e.g., human) antibody expressing B-cells may then
expand to maintain antibody levels. For example, we demonstrated
that the injection of an anti-bovine IgM antibody into fetuses
reduced the number of peripheral blood B-cells. These compounds may
be administered during the normal period of development of the
mammal's immune system (e.g., during the fetal, embryonic, or
postnatal stage) or after this period to inhibit the development of
endogenous B-cells in the ungulate.
[0180] This method is preferably applied to ungulates that express
both endogenous and xenogenous antibodies to increase the
percentage of xenogenous antibody produced by the ungulate.
Reducing the amount of ungulate and ungulate/xenogenous chimeric
antibody molecules produced enhances the quantity of human antibody
production and simplify purification of fully human antibody from
ungulate blood or milk. For example, a polyclonal antibody against
bovine antibodies can be injected into a bovine expressing some
fully bovine, some fully human, and some bovine/human chimeric
antibody molecules to deplete bovine and bovine/human chimeric
antibody producing B-cells. The bovine would then be enriched for
production of fully human antibodies.
[0181] State of the art prior to present invention While human Ig
has been expressed in mice, it was unpredictable whether human Ig
will be fractionally rearranged and expressed in bovines, or other
ungulates, because of differences in antibody gene structure,
antibody production mechanism, and B-cell function. In particular,
unlike mice, cattle and sheep differ from humans in their
immunophysiology (Lucier et al., J. Immunol. 161: 5438, 1998; Parng
et al., J. Immunol. 157:5478, 1996; and Butler, Rev. Sci. Tech.
17:43, 2000). For example antibody gene diversification in bovines
and ovines relies much more on gene conversion than gene
rearrangement as in humans and mice. Also, the primary location of
B-cells in humans and mice is in the bone marrow, whereas in
bovines and ovines B-cells are located in the illeal Peyer's patch.
Consequently, it would have been difficult, if not impossible,
prior to the present invention, to predict whether immunoglobulin
rearrangement and diversification of a human immunoglobulin loci
would take place within the bovine (or other ungulate) B-cell
lineage. In addition, it would also have been unpredictable whether
a bovine would be able to survive, i.e., elicit its normal immune
functions, in the absence of its endogenous Ig or with interference
from human antibodies. For example, it was not certain if bovine
B-cells expressing human Ig would correctly migrate to the illeal
Peyer's Patch in bovines because this does not happen in humans.
Also, it is not clear if human Fc receptor function; which mediates
complement activation, induction of cytokine release, and antigen
removal; would be normal in a bovine system. It was unpredictable
whether such ungulates would survive because it is uncertain
whether human Igs will be functionally expressed, or expressed in
sufficient amounts to provide for adequate immune responses. Also,
it was uncertain whether human chromosomes will be stably
maintained in transgenic ungulates.
[0182] Still further, it was uncertain whether ungulate (for
example, bovine) B-cells will be able to express or properly
rearrange human or other non-endogenous Igs. It was also
unpredictable whether allelic exclusion in transgenic ungulates
would produce desired B-cells that express fully xenogenous
antibody. This desired, fully xenogenous antibody is not eliminated
from the ungulate when the methods described herein are used to
administer an antibody to eliminate undesired, endogenous antibody.
In contrast, if this allelic exclusion does not occur, the ungulate
would express only partially xenogenous or fully endogenous
antibodies. In this latter case, an antibody administered to the
ungulate to eliminate endogenous antibodies might eliminate the
partially xenogenous antibodies as well as the fully endogenous
antibodies.
[0183] While the approaches to be utilized in the invention have
been described above, the techniques that are utilized are
described in greater detail below. These examples are provided to
illustrate the invention, and should not be construed as limiting.
In particular, while these examples focus on transgenic bovines,
the methods described may be used to produce and test any
transgenic ungulate.
EXAMPLE 1
Introduction and Rearrangement of HAC
Summary of Procedures for Insertion of HACs
[0184] For the generation of ungulates that express xenogenous
antibody and that optionally have a mutation in an endogenous
antibody gene, standard methods may be used to insert a nucleic
acid encoding a xenogenous antibody (e.g., a HAC) into a cell. If
desired, one or more endogenous antibody genes may be mutated in
the cell. The cell is then used in standard nuclear transfer
procedures to produce the desired transgenic ungulate, as described
in more detail below.
[0185] Essentially, male and female bovine fetal fibroblast cell
lines containing human artificial chromosome sequences (e.g.,
#14fg., #2fg., and #22fg.) are obtained and selected and used to
produce cloned calves from these lines.
[0186] For example, HACs derived from human chromosome #14
("#14fg," comprising the Ig heavy chain gene), human chromosome #2
("#2fg," comprising the Ig kappa chain gene) and human chromosome
#22 ("#22fg," comprising the Ig lambda chain gene) can be
introduced simultaneously or successively.
[0187] The transmission of these chromosome fragments is tested by
mating a male #14fg. animal to female #2fg. and #22fg. animals and
evaluating offspring. If transmission is successful then the two
lines are mated to produce a line containing all three chromosome
fragments.
[0188] Also, #14fg., #2fg., and #22fg. chromosome fragments may be
inserted into fetal cells (e.g., transgenic Homo H/L fetal cells)
and used to generate cloned calves or cross transgenic HAC calves
with other transgenic calves (e.g., Homo H/L calves).
Alternatively, other HACs, such as .DELTA.HAC or .DELTA..DELTA.HAC,
may be introduced as described below or introduced using any other
chromosome transfer method.
[0189] Rationale Germline transmission of HACs should be useful for
introducing the HACs into the animals (e.g., Ig knockout animals)
and in propagating animals in production herds. The concern in
propagation of HACs through the germline is incomplete pairing of
chromosomal material during meiosis. However, germline transmission
has been successful in mice as shown by Tomizuka et al. (Proc.
Natl. Acad. Sci. USA, 97:722, 2000).
[0190] The strategy outlined in FIG. 1A consists of inserting
#14fg. into a male line of cells and #2fg. and #22fg. each into
female cell lines. Calves retaining a HAC are produced and germline
transmission can be tested both through females and males. Part of
the resulting offspring (.about.25%) should contain both heavy and
light chain HACs. Further crossing should result in a line of
calves containing all three chromosomal fragments. These animals
are optionally used for crossing with transgenic animals (e.g.,
Homo H/L animals), produced from fetal cells as previously
described.
[0191] Experimental Design Cells are obtained from the original
screening of cell lines. These may be Holstein or different lines
than those used above. This allows crossing while maintaining as
much genetic variation in the herd as possible. Introduction of
HACs into cell lines and selection of positive cell lines is then
effected. Selected cell lines are used for nuclear transfer and
calves are produced. Starting at 12 months of age semen and eggs
are collected, fertilized, and transferred into recipient animals.
Cell samples are taken for DNA marker analysis and karyotyping.
Beginning at birth, blood samples are taken and analyzed for the
presence of human Ig proteins.
[0192] As indicated above, HACs are also optionally transferred
into Homo H/L cell lines using the procedures developed in the
above experiments.
[0193] The following examples are additionally provided as further
exemplification of the invention.
Exemplary Procedures for Insertion of HACs
[0194] Additional experiments were carried out to demonstrate that
xenogenous (e.g., human) immunoglobulin heavy chain (mu) and lambda
light chain may be produced by a bovine host, either alone or in
combination. In addition, these experiments demonstrated that the
human immunoglobulin chains were rearranged and that polyclonal
sera was obtained. In these procedures, immunoglobulin-expressing
genes were introduced into bovine fibroblasts using human
artificial chromosomes. The fibroblasts were then utilized for
nuclear transfer, and fetuses were obtained and analyzed for
antibody production. These procedures and results are described in
more detail below.
[0195] HAC Constructs The human artificial chromosomes (HACs) were
constructed using a previously described chromosome-cloning system
(Kuroiwa et al., Nature Biotech. 18: 1086-1090, 2000). Briefly, for
the construction of .DELTA.HAC, the previously reported human
chromosome 22 fragment (hChr22) containing a loxP sequence
integrated at the HCF2 locus was truncated at the AP000344 locus by
telomere-directed chromosomal truncation (Kuroiwa et al., Nucleic
Acid Res., 26: 3447-3448, 1998). Next, cell hybrids were formed by
fusing the DT40 cell clone containing the above hChr22 fragment
(hCF22) truncated at the AP000344 locus with a DT40 cell clone
(denoted "R clone") containing the stable and
germline-transmittable human minichromosome SC20 vector. The SC20
vector was generated by inserting a loxP sequence at the RNR2 locus
of the S20 fragment. The SC20 fragment is a naturally-occurring
fragment derived from human chromosome 14 that includes the entire
region of the human Ig heavy chain gene (Tomizuka et al., Proc.
Natl. Acad. Sci. USA 97:722, 2000). The resulting DT40 cell hybrids
contained both hChr fragments. The DT40 hybrids were transfected
with a Cre recombinase-expression vector to induce
Cre/loxP-mediated chromosomal translocation between hCF22 and the
SC20 vector. The stable transfectants were analyzed using nested
PCR to confirm the cloning of the 2.5 megabase hChr22 region,
defined by the HCF2 and AP000344 loci, into the loxP-cloning site
in the SC20 vector. The PCR-positive cells which were expected to
contain .DELTA.HAC were then isolated by FACS sorting based on the
fluorescence of the encoded green fluorescent protein. Fluorescent
in situ hybridization (FISH) analysis of the sorted cells was also
used to confirm the presence of .DELTA.HAC, which contains the 2.5
megabase hChr22 insert.
[0196] Similarly, .DELTA..DELTA.HAC was also constructed using this
chromosome-cloning system. The hChr22 fragment was truncated at the
AP000344 locus, and then the loxP sequence was integrated into the
AP000553 locus by homologous recombination in DT40 cells. The
resulting cells were then fused with the R clone containing the
SC20 minichromosome vector. The cell hybrids were transfection with
a Cre-expression vector to allow Cre/loxP-mediated chromosomal
translocation. The generation of .DELTA..DELTA.HAC, which contains
the 1.5 megabase hChr22 insert, defined by the AP000553 and
AP000344 loci, was confirmed by PCR and FISH analyses.
[0197] The functionality of .DELTA.HAC and .DELTA..DELTA.HAC in
vivo was assessed by the generation of chimeric mice containing
these HACs. These HACs were individually introduced into mouse
embryonic stem (ES) cells, which were then used for the generation
of chimeric mice using standard procedures (Japanese patent number
2001-142371; filed May 11, 2000). The resulting mice had a high
degree of chimerism (85-100% of coat color), demonstrating a high
level of pluripotency of the ES cells containing these HACs and the
mitotic stability of these HACs in vivo. Furthermore, .DELTA.HAC
was transmitted through the germline of the .DELTA.HAC chimeric
mouse to the next offspring, demonstrating the meiotic stability of
this HAC.
[0198] Chicken DT40 cells retaining these HACs have been deposited
under the Budapest treaty on May 9, 2001 in the International
Patent Organism Depository, National Institute of Advanced
Industrial Science and Technology, Tsukuba Central 6, 1-1, Higashi
1-Chome Tsukuba-shi, Ibaraki-ken, 305-8566 Japan. The depository
numbers are as follows: .DELTA.HAC (FERM BP-7582),
.DELTA..DELTA.HAC (FERM BP-7581), and SC20 fragment (FERM BP-7583).
Chicken DT40 cells retaining these HACs have also been deposited in
the Food Industry Research and Development Institute (FIRDI) in
Taiwan. The depository numbers and dates are as follows: .DELTA.HAC
(CCRC 960144; Nov. 9, 2001), .DELTA..DELTA.HAC (CCRC 960145; Nov.
9, 2001), and SC20 fragment (the cell line was deposited under the
name SC20 (D); CCRC 960099; Aug. 18, 1999).
[0199] The 2.5 megabase (Mb) hChr22 insert in .DELTA.HAC is
composed of the following BAC contigs, which are listed by Genbank
accession number: AC002470, AC002472, AP000550, AP000551, AP000552,
AP000556, AP000557, AP000558, AP000553, AP000554, AP000555, D86995,
D87019, D87012, D88268, D86993, D87004, D87022, D88271, D88269,
D87000, D86996, D86989, D88270, D87003, D87018, D87016, D86999,
D87010, D87009, D87011, D87013, D87014, D86991, D87002, D87006,
D86994, D87007, D87015, D86998, D87021, D87024, D87020, D87023,
D87017, AP000360, AP00361, AP000362, AC000029, AC000102, U07000,
AP000343, and AP000344. The 1.5 Mb hChr22 insert in
.DELTA..DELTA.HAC is composed of the following BAC contigs:
AP000553, AP000554, AP000555, D86995, D87019, D87012, D88268,
D86993, D87004, D87022, D88271, D88269, D87000, D86996, D86989,
D88270, D87003, D87018, D87016, D86999, D87010, D87009, D87011,
D87013, D87014, D86991, D87002, D87006, D86994, D87007, D87015,
D86998, D87021, D87024, D87020, D87023, D87017, AP000360, AP00361,
AP000362, AC000029, AC000102, U07000, AP000343, and AP000344
(Dunham et al, Nature 402:489-499, 1999).
[0200] Generation of Bovine Fetal Fibroblasts To generate bovine
fetal fibroblasts, day 45 to 60 fetuses were collected from
disease-tested Holstein or Jersey cows housed at Trans Ova (Iowa),
in which the pedigree of the male and female parents were
documented for three consecutive generations. The collected fetuses
were shipped on wet ice to Hematech's Worcester Molecular Biology
Division for the generation of primary fetal fibroblasts. Following
arrival, the fetus(es) were transferred to a non-tissue culture
grade, 100 mm plastic petri dish in a tissue culture hood. Using
sterile forceps and scissors, the extraembryonic membrane and
umbilical cord were removed from the fetus. After transferring the
fetus to a new plastic petri dish, the head, limbs and internal
organs were removed. The eviscerated fetus was transferred to a
third petri dish containing approximately 10 ml of fetus rinse
solution composed of: 125 ml 1.times. Dulbecco's-PBS (D-PBS) with
Ca.sup.2+ and Mg.sup.2+ (Gibco-BRL, cat #.14040); 0.5 ml Tylosine
Tartrate (8 mg/ml, Sigma, cat #.T-3397); 2 ml
Penicillin-Streptomycin (Sigma, cat #.P-3539); and 1 ml of
Fungizone (Gibco-BRL, cat #.15295-017) (mixed and filtered through
a 0.2 .mu.m nylon filter unit [Nalgene, cat #.150-0020).
[0201] The fetus was washed an additional three times with the
fetus rinse solution to remove traces of blood, transferred to a 50
ml conical tissue culture tube, and finely minced into small pieces
with a sterile scalpel. The tissue pieces were washed once with
1.times.D-PBS without Ca.sup.2+ and Mg.sup.2+ (Gibco-BRL, cat
#.14190). After the tissue pieces settled to the bottom of the
tube, the supernatant was removed and replaced with approximately
30 ml of cell dissociation buffer (Gibco-BRL, cat #.13151-014). The
tube was inverted several times to allow mixing and incubated at
38.5.degree. C./5% CO.sub.2 for 20 minutes in a tissue culture
incubator. Following settling of the tissue to the bottom of the
tube, the supernatant is removed and replaced with an equivalent
volume of fresh cell dissociation buffer. The tissue and cell
dissociation buffer mixture was transferred to a sterile, 75 ml
glass trypsinizing flask (Wheaton Science Products, cat #.355393)
containing a 24 mm, round-ended, spin bar. The flask was
transferred to a 38.5.degree. C./5% CO.sub.2 tissue culture
incubator, positioned on a magnetic stir plate, and stirred at a
sufficient speed to allow efficient mixing for approximately 20
minutes. The flask was transferred to a tissue culture hood; the
tissue pieces allowed to settle, followed by removal of the
supernatant and harvesting of the dissociated cells by
centrifugation at 1,200 rpm for five minutes. The cell pellet was
re-suspended in a small volume of complete fibroblast culture media
composed of: 440 ml alpha MEM (BioWhittaker, cat #.12-169F); 50 ml
irradiated fetal bovine serum; 5 ml GLUTAMAX-I supplement
(Gibco-BRL, cat #.25050-061); 5 ml Penicillin-Streptomycin (Sigma,
cat #.P-3539); 1.4 ml 2-mercaptoethanol (Gibco-BRL, cat
#.21985-023) (all components except the fetal bovine serum were
mixed were filtered through 0.2 .mu.m nylon filter unit [Nalgene,
cat #.151-4020]), and stored on ice. The dissociation process was
repeated three additional times with an additional 30 ml of cell
dissociation solution during each step. Cells were pooled; washed
in complete fibroblast media; passed sequentially through 23 and 26
gauge needles, and finally through a 70 .mu.m cell strainer (B-D
Falcon, cat #.352350) to generate a single cell suspension. Cell
density and viability were determined by counting in a
hemacytometer in the presence of trypan blue (0.4% solution, Sigma,
cat #.T-8154).
[0202] Primary fibroblasts were expanded at 38.5.degree. C./5%
CO.sub.2 in complete fibroblast media at a cell density of
1.times.10.sup.6 viable cells per T75 cm.sup.2 tissue culture
flask. After 3 days of culture or before the cells reached
confluency, the fibroblasts were harvested by rinsing the flask
once with 1.times.D-PBS (without Ca.sup.2+ and Mg.sup.2+) and
incubating with 10 ml of cell dissociation buffer for 5 to 10
minutes at room temperature. Detachment of cells was visually
monitored using an inverted microscope. At this step, care was
taken to ensure that cell clumps were disaggregated by pipetting
up-and-down. After washing and quantitation, the dissociated
fibroblasts were ready for use in gene targeting experiments. These
cells could also be cryopreserved for long-term storage.
[0203] Introduction of HACs into Bovine Fetal Fibroblasts
.DELTA.HAC and .DELTA..DELTA.HAC were transferred from the DT40
cell hybrids to Chinese hamster ovary (CHO) cells using
microcell-mediated chromosome transfer (MMCT) (Kuroiwa et al.
Nature Biotech. 18: 1086-1090, 2000). The CHO clone containing
.DELTA.HAC ("D15 clone") was cultured in F12 (Gibco) medium
supplemented with 10% FBS (Gibco), 1 mg/ml of G418, and 0.2 mg/ml
of hygromycin B at 37.degree. C. and 5% CO.sub.2. The D15 clone was
expanded into twelve T25 flasks. When the confluency reached
80-90%, colcemid (Sigma) was added to the medium at a final
concentration of 0.1 .mu.g/ml. After three days, the medium was
exchanged with DMEM (Gibco) supplemented with 10 .mu.g/ml of
cytochalacin B (Sigma). The flasks were centrifuged for 60 minutes
at 8,000 rpm to collect microcells. The microcells were purified
through 8, 5, and 3-.mu.m filters (Costar) and then resuspended in
DMEM medium. The microcells were used for fusion with bovine
fibroblasts as described below.
[0204] Bovine fetal fibroblasts were cultured in .alpha.-MEM
(Gibco) medium supplemented with 10% FBS (Gibco) at 37.degree. C.
and 5% CO.sub.2. The fibroblasts were expanded in a T175 flask.
When the confluency reached 70-80%, the cells were detached from
the flask with 0.05% trypsin. The fibroblast cells were washed
twice with DMEM medium and then overlayed on the microcell
suspension. After the microcell-fibroblast suspension was
centrifuged for five minutes at 1,500 rpm, PEG1500 (Roche) was
added to the pellet according to the manufacturer's protocol to
enable fusion of the microcells with the bovine fibroblasts. After
fusion, the fused cells were plated into six 24-well plates and
cultured in .alpha.-MEM medium supplemented with 10% FBS for 24
hours. The medium was then exchanged with medium containing 0.7
mg/ml of G418. After growth in the presence of the G418 antibiotic
for about two weeks, the G418 resistant, fused cells were selected.
These G418-resistant clones were used for nuclear transfer, as
described below.
[0205] Similarly, .DELTA..DELTA.HAC from the CHO clone C13 was
transferred into bovine fetal fibroblasts by means of MMCT. The
selected G418-resistant clones were used for nuclear transfer.
[0206] Nuclear Transfer Activation and Embryo Culture The nuclear
transfer procedure was carried out essentially as described earlier
(Cibelli et al., Science 1998: 280:1256-1258). In vitro matured
oocytes were enucleated about 18-20 hours post maturation (hpm) and
chromosome removal was confirmed by bisBenzimide (Hoechst 33342,
Sigma) labeling under UV light. These cytoplast-donor cell couplets
were fused, by using single electrical pulse of 2.4 kV/cm for 20
.mu.sec (Electrocell manipulator 200, Genetronics, San Diego,
Calif.). After 3-4 hrs, a random sub-set of 25% of the total
transferred couplets was removed, and the fusion was confirmed by
bisBenzimide labeling of the transferred nucleus. At 30 hpm
reconstructed oocytes and controls were activated with calcium
ionophore (5 .mu.M) for 4 minutes (Cal Biochem, San Diego, Calif.)
and 10 .mu.g Cycloheximide and 2.5 .mu.g Cytochalasin D (Sigma) in
ACM culture medium for 6 hours as described earlier (Lin et al.,
Mol. Reprod. Dev. 1998: 49:298-307; Presicce et al., Mol. Reprod.
Dev. 1994:38:380-385). After activation eggs were washed in HEPES
buffered hamster embryo culture medium (HECM-Hepes) five times and
placed in culture in 4-well tissue culture plates containing
irradiated mouse fetal fibroblasts and 0.5 ml of embryo culture
medium covered with 0.2 ml of embryo tested mineral oil (Sigma).
Twenty five to 50 embryos were placed in each well and incubated at
38.5.degree. C. in a 5% CO.sub.2 in air atmosphere. On day four 10%
FCS was added to the culture medium.
[0207] Embryo Transfer Day 7 and 8 nuclear transfer blastocysts
were transferred into day 6 and 7 synchronized recipient heifers,
respectively. Recipient animals were synchronized using a single
injection of Lutalyse (Pharmacia & Upjohn, Kalamazoo, Mich.)
followed by estrus detection. The recipients were examined on day
30 and day 60 after embryo transfer by ultrasonography for the
presence of conceptus and thereafter every 30 days by rectal
palpation until 270 days. The retention of a HAC in these bovine
fetuses is summarized in Table 1 and is described in greater detail
in the sections below. TABLE-US-00001 TABLE 1 Summary of HAC
retention in bovine fetuses Recip/ HAC Cell Fetus NT Recovery
Retention HAC Clone No. Date Date Fetal Age H L .DELTA..DELTA. 4-12
5580 2/14 4/13 58 + + .DELTA..DELTA. 2-14 5848 2/15 4/13 57 - -
.DELTA..DELTA. 4-12 5868A 2/14 6/13 119 + + .DELTA..DELTA. 4-12
5868B 2/14 6/13 119 + + .DELTA..DELTA. 4-12 5542A 2/14 5/16 91 + +
.DELTA..DELTA. 4-12 5542B 2/14 5/16 91 + + .DELTA..DELTA. 4-12 5174
2/14 5/16 91 (abnormal) nd nd .DELTA..DELTA. 4-12 6097 2/14 Remains
160 (7/24) nd nd .DELTA. 4-8 6032 1/31 3/30 58 + + .DELTA. 2-13
5983 2/2 3/30 56 - - .DELTA. 4-2 5968 2/2 3/30 56 + + .DELTA. 2-22
6045 2/2 3/30 56 + + .DELTA. 4-8 5846 1/31 4/20 79 - - .DELTA. 2-13
6053 2/2 4/27 84 + - .DELTA. 4-2 5996 2/1 4/20 77 + -
[0208] Introduction of a HAC containing a fragment of human
chromosome #14 The SC20 fragment, a human chromosome #14 fragment
("hchr.14fg", containing the Ig heavy chain gene), was introduced
into fetal fibroblast cells in substantially the same manner as
described above. Any other standard chromosome transfer method may
also be used to insert this HAC or another HAC containing a human
Ig gene into donor cells. The resulting donor cells may be used in
standard nuclear transfer techniques, such as those described
above, to generate transgenic ungulates with the HAC.
[0209] The pregnancy status of the 28 recipients to whom cloned
embryos were transferred from cells containing the hchr.14fg was
checked by ultrasonography. The results are summarized in Table
2.
[0210] If desired, a cell from the resulting HAC fetus or HAC
offspring can be used in a second round of nuclear transfer to
generate additional cloned offspring. Cells from the initial HAC
fetus or HAC offspring may also be frozen to form a cell line to be
used as a source of donor cells for the generation of additional
HAC ungulates. TABLE-US-00002 TABLE 2 Pregnancy at 40 days using
donor cells containing hchr.14fg No of recips Pregnancy at 40 days
Clone ID transferred (%) 2-1 08 03 (38) 4-2 10 00 (00) 4-1 05 00
(00) 4-1 03 01 (33) 2-1 02 01 (50) Total 28 05 (18)
[0211] The pregnancy rates were lower than anticipated. This is
believed to be attributable to extremely abnormally hot weather
during embryo transfer.
[0212] As illustrated in FIG. 27, pregnancy rates for HAC carrying
embryos appear to be equivalent to non-transgenic cloned
pregnancies. One recipient carrying a .DELTA..DELTA.HAC calf gave
birth recently to a live healthy calf. Others will be born over the
next several months.
Demonstration of Rearrangement and Expression of Human Heavy Chain
Locus in a .DELTA.HAC Bovine Fetus
[0213] Cloned .DELTA.HAC-transgenic bovine fetuses were removed at
various gestational days and analyzed for the presence,
rearrangement, and expression of the human immunoglobulin loci.
Analysis of genomic DNA and cDNA obtained by RT-PCR from spleen and
nonlymphoid tissues (liver and brain) of one of these fetuses
indicated the presence, rearrangement, and expression of the
.DELTA.HAC.
[0214] Presence of Human Heavy and/or Light Chain in .DELTA.HAC
Fetuses To determine whether the human heavy and light chains were
retained in .DELTA.HAC fetuses, liver DNA was isolated from
.DELTA.HAC fetuses and analyzed by PCR for the presence of genomic
DNA encoding human heavy and light chains.
[0215] For the detection of genomic heavy chain DNA, the following
primers were used: VH3-F 5'-AGTGAGATAAGCAGTGGATG-3' (SEQ ID NO: 1)
and VH3-R 5'-CTTGTGCTACTCCCATCACT-3' (SEQ ID NO: 2). The primers
used for detection of lambda light chain DNA were IgL-F
5'-GGAGACCACCAAACCCTCCAAA-3' (SEQ ID NO: 3) and IgL-R
5'-GAGAGTTGCAGAAGGGGTYGACT-3' (SEQ ID NO: 4). The PCR reaction
mixtures contained 18.9 .mu.l water, 3 .mu.l of 10.times.Ex Taq
buffer, 4.8 .mu.l of dNTP mixture, 10 pmol forward primer and 10
pmol of reverse primer, 1 .mu.l of genomic DNA, and 0.3 .mu.l of Ex
Taq. Thirty-eight cycles of PCR were performed by incubating the
reaction mixtures at the following conditions: 85.degree. C. for
three minutes, 94.degree. C. for one minute, 98.degree. C. for 10
seconds, 56.degree. C. for 30 seconds, and 72.degree. C. for 30
seconds.
[0216] As shown in FIG. 5, fetuses #5968, 6032 and 6045 each
contained both human heavy chain (.mu.) and light chain () loci.
Fetus #5996 contained only the human heavy chain locus. Fetus #5983
did not contain the human heavy chain and may not have contained
the human light chain. Fetus #5846 did not contain either human
sequence. Thus, fetuses #5983 and 5846 may not have retained the
HAC. These results suggested that .DELTA.HAC can be stably retained
up to gestational day 58 in bovines.
[0217] Presence of Human Cmu Exons in .DELTA.HAC Fetus #5996
Primers specific for a mRNA transcript including portions of Cmu 3
and Cmu 4 were used to determine whether .DELTA.HAC was present and
expressing transcripts encoding the constant region of the human mu
locus of fetus #5996.
[0218] For this RT-PCR analysis of the genomic constant region of
the human mu heavy chain, primers "CH3-F1"
(5'accacctatgacagcgtgac-3', SEQ ID NO: 5) and "CH4-R2"
(5'-gtggcagcaagtagacatcg-3', SEQ ID NO: 6) were used to generate a
RT-PCR product of 350 base pairs. This PCR amplification was
performed by an initial denaturing incubation at 95.degree. C. for
five minutes. Then, 35 cycles of denaturation, annealing, and
amplification were performed by incubation at 95.degree. C. for one
minute, 59.degree. C. for one minute, and 72.degree. C. for two
minutes. Then, the reaction mixtures were incubated at 72.degree.
C. for 10 minutes. Rearranged bovine heavy chain was detected using
primers I7L and P9, as described below (FIG. 7). As an internal
control, levels of GAPDH RNA was detected using primers "GAPDH
forward" (5'-gtcatcatctctgccccttctg-3', SEQ ID NO: 7) and "GAPDH
reverse" (5'-aacaacttcttgatgtcatcat-3', SEQ ID NO: 8). For this
amplification of GAPDH RNA, samples were incubated at 95.degree. C.
for five minutes, followed by 35 cycles of incubation at 95.degree.
C. for one minute, 55.degree. C. for one minute, and 72.degree. C.
for two minutes. Then, the mixtures were incubated at 72.degree. C.
for seven minutes.
[0219] This analysis showed that RT-PCR analysis of the spleen of
fetus #5996 produced a band (lane 3) matching the amplification
products generated using control human spleen cDNA (lane 4) and
cDNA obtained from a .DELTA.HAC chimeric mouse (lane 5) (FIG. 6).
No such band was detected in nonlymphoid tissues: bovine liver
(lane 1) or bovine brain (lane 2). The capacity of these tissues to
support RT-PCR was shown by the successful amplification of the
housekeeping gene, GADPH, in both liver (lane 10 of FIG. 6) and
brain (lane 6 of FIG. 7).
[0220] Rearrangement of Bovine Heavy Chain Locus by 77 Gestational
Days The .DELTA.HAC fetus #5996 was tested to determine whether it
had undergone the developmental processes necessary for the
expression and activation of the recombination system required for
immunoglobulin heavy chain locus rearrangement. For this analysis,
standard RT-PCR analysis was performed to detect the presence of
mRNA transcripts encoding mu-VH rearrangements. RNA isolated from
the spleen, liver, and brain of fetus #5996 was analyzed by RT-PCR
using primers "17L" (5'-ccctcctctttgtgctgtca-3', SEQ ID NO: 9) and
"P9" (5'-caccgtgctctcatcggatg-3', SEQ ID NO: 10). The PCR reaction
mixtures were incubated at 95.degree. C. for 3 minutes, and then 35
cycles of denaturation, annealing, and amplification were performed
using the following conditions: 95.degree. C. for one minute,
58.degree. C. for one minute, and 72.degree. C. for two minutes.
The reaction mixture was then incubated at 72.degree. C. for 10
minutes.
[0221] Lane 5 of FIG. 7 shows that a product of the size expected
for amplification of a rearranged bovine heavy chain (450 base
pairs) was obtained. This product migrated to a position equivalent
to that of a control bovine Cmu heavy chain cDNA known to contain
sequences corresponding to rearranged bovine heavy chain
transcripts (lane 7). As expected, the rearranged heavy chain was
expressed in the spleen (lane 5), but absent from the brain (lane
2) and liver (lane 3) at this point in development.
[0222] Rearrangement and Expression of the Human Heavy Chain locus
in the .DELTA.HAC Fetus #5996 The rearrangement and expression of
the human heavy chain locus was demonstrated by the amplification
of a segment of DNA including portions of Cmu and VH regions.
Primers specific for RNA transcripts including portions of Cmu
(Cmu1) and VH (VH3-30) were used to determine if RNA transcripts
containing rearranged human Cmu-VDJ sequences were present (FIG.
8).
[0223] For this RT-PCR analysis, primers "Cmu1"
(5'-caggtgcagctggtggagtctgg-3', SEQ ID NO: 11) and "VH3-30"
(5'caggagaaagtgatggagtc-3', SEQ ID NO: 12) were used to produce a
RT-PCR product of 450 base pairs. This RT-PCR was performed by
incubating reaction mixtures at 95.degree. for 3 minutes, followed
by 40 cycles of incubation at 95.degree. for 30 minutes, 69.degree.
for 30 minutes, and 72.degree. for 45 minutes, and one cycle of
incubation at 72.degree. for 10 minutes. This RT-PCR product was
then reamplified with the same primers by one cycle of incubation
at 95.degree. C. for three minute, 40 cycles of incubation at
95.degree. C. for one minute, 59.degree. C. for one minute,
72.degree. C. for one minute, and one cycle of incubation at
72.degree. C. for 10 minutes. As an internal control, RT-PCR
amplification of GAPDH was performed as described above.
[0224] The gel in FIG. 8 shows that RT-PCR analysis of the spleen
from fetus #5996 produced a band (lane 5) matching the
amplification products generated using human spleen cDNA (lane 4)
or .DELTA.HAC chimeric mouse spleen cDNA (lane 1). No such band was
detected in bovine liver (lane 2) or bovine brain (lane 3). As a
positive control, amplification of GADPH RNA (lanes 8 and 9) showed
the capacity of these tissues to support RT-PCR.
[0225] Rearrangement and expression of the human heavy chain region
in fetus #5996 was also demonstrated by RT-PCR analysis using
primers CH3-F3 (5'-GGAGACCACCAAACCCTCCAAA-3', SEQ ID NO: 13) and
CH4-R2 (5'-GTGGCAGCAAGTAGACATCG-3', SEQ ID NO: 14). These PCR
reaction mixtures contained 18.9 .mu.l water, 3 .mu.l of
10.times.Ex Taq buffer, 4.8 .mu.l of dNTP mixture, 10 pmol forward
primer, 10 pmol of reverse primer, 1 .mu.l of cDNA, and 0.3 .mu.l
of Ex Taq. Forty PCR cycles were performed by incubating the
reaction mixtures under the following conditions: 85.degree. C. for
three minutes, 94.degree. C. for one minute, 98.degree. C. for 10
seconds, 60.degree. C. for 30 seconds, and 72.degree. C. for 30
seconds.
[0226] As shown in lanes 6 and 7 of FIG. 9, an amplified sequence
from the spleen of fetus #5996 was the same size as the spliced
constant region fragments from the two positive controls: a sample
from a human spleen (lane 8) and a .DELTA.HAC chimeric mouse spleen
(lane 9). As expected, the negative controls from a normal mouse
spleen and a bovine spleen did not contain an amplified sequence
(lanes 1 and 2). Samples from the liver and brain of fetus #5996
did not contain an amplified spliced sequence of the same size as
the spliced human mu heavy chain constant region fragments but did
contain a amplified sequence of an unspliced genomic fragment
derived from genomic DNA contaminating the RNA sample (lanes 3, 4,
and 5).
[0227] VDJ Rearrangement of the Human Heavy Chain Locus in a
.DELTA.HAC Fetus RT-PCR analysis was also performed to further
demonstrate VDJ rearrangement in the heavy chain locus in
.DELTA.HAC fetus #5996. Nested RT-PCR was performed using primer
Cmu-1 (5'-CAGGAGAAAGTGATGGAGTC-3', SEQ ID NO: 15) for the first
reaction, primer Cmu-2 (5'-AGGCAGCCAACGGCCACGCT-3', SEQ ID NO: 16)
for the second reaction, and primer VH3-30.3
(5'-CAGGTGCAGCTGGTGGAGTCTGG-3', SEQ ID NO: 17) for both reactions.
The RT-PCR reaction mixtures contained 18.9 .mu.l water, 3 .mu.l of
10.times.Ex Taq buffer, 4.8 .mu.l of dNTP mixture, 10 pmol forward
primer, 10 pmol of reverse primer, 1 .mu.l of cDNA, and 0.3 .mu.l
of Ex Taq. The RT-PCR was performed using 38 cycles under the
following conditions for the first reaction: 85.degree. C. for
three minutes, 94.degree. C. for one minute, 98.degree. C. for 10
seconds, 65.degree. C. for 30 seconds, and 72.degree. C. for 30
seconds. For the second reaction, 38 cycles were performed under
the following conditions: 85.degree. C. for three minutes,
94.degree. C. for one minute, 98.degree. C. for 10 seconds,
65.degree. C. for 30 seconds, and 72.degree. C. for 30 seconds
using primers VH3-30.3 and Cmu-2 (5'-AGGCAGCCAACGGCCACGCT-3', SEQ
ID NO: 16).
[0228] As shown in lanes 6 and 7 of FIG. 10, RT-PCR analysis of the
spleen of fetus #5996 produced a heavy chain band of the same size
as the positive controls in lanes 8 and 9. Samples from the liver
and brain of fetus #5996 contained some contaminating rearranged
DNA (lanes 3 and 5). The negative controls in lanes 1 and 2
produced bands of the incorrect size.
[0229] Verification Of .DELTA.HAC Rearrangement By Sequencing The
cDNA obtained by reverse transcription of RNA from the spleen of
the .DELTA.HAC fetus #5996 was amplified with primers specific for
rearranged human mu and run on an agarose gel. The band produced by
amplification with the Cmu1-VH3-30 primer pair was excised from the
gel. The amplified cDNA was recovered from the band and cloned. DNA
from a resulting clone that was PCR-positive for rearranged human
mu was purified and sequenced (FIG. 11A).
[0230] The sequence from this .DELTA.HAC fetus is greater than 95%
homologous to over 20 known human heavy chain sequences. For
example, the mu chain of a human anti-pneumococcal antibody is 97%
homologous to a region of this sequence (FIG. 11B).
[0231] Additional sequences from rearranged human heavy chains were
also obtained by RT-PCR analysis of the spleen of fetus #5996 using
primers Cmu-1 and VH3-30.3, followed by reamplification using
primers Cmu-2 and VH3-30.3. The RT-PCR products were purified using
CHROMA SPIN column (CLONETECH) and cloned into the pCR2.1
TA-cloning vector (Invitrogen) according to manufacturer's
protocol. The Dye Terminator sequence reaction (ABI Applied System)
was performed in a 10 .mu.l volume reaction mixture composed of
BigDye Terminator reaction mixture (3 .mu.l), template plasmid (200
ng), and the Cmu-2 primer (1.6 pmol). The sequencing reaction was
performed using a ABI 3700 sequencer. For this analysis,
twenty-five cycles were conducted under the following conditions:
96.degree. C. for one minute, 96.degree. C. for 10 seconds,
55.degree. C. for five seconds, and 60.degree. C. for four
minutes.
[0232] At least two rearranged human heavy chain transcripts were
identified, which were VH3-11/D7-27/JH3/C.mu. and
VH3-33/D6-19/JH2/C.mu. (FIGS. 12A and 12B). These results
demonstrate that VDJ rearrangement of the human mu heavy chain
locus occurs in the .DELTA.HAC in the spleen of fetus #5996. The
identification of more than one rearranged heavy chain sequence
from the same fetus also demonstrates the ability of .DELTA.HAC
fetuses to generate diverse human immunoglobulin sequences.
Rearrangement and Expression of Human Heavy and Light Chain Loci in
.DELTA..DELTA.HAC Fetus
[0233] Cloned fetuses derived from bovine fetal fibroblasts
transchromosomal for the .DELTA..DELTA.HAC were removed from
recipient cows at various gestational days. The fetuses were
analyzed for the presence and rearrangement of the HAC-borne human
immunoglobulin heavy and lambda light chain loci. Studies of
genomic DNA from these tissues indicated the presence of the human
immunoglobulin heavy and light chains in some of the fetuses.
Examination of cDNA derived from the spleens of these fetuses
indicated rearrangement and expression of the immunoglobulin heavy
and light chain loci in some of these fetuses. FACS analysis also
demonstrated the expression of human lambda light chain protein on
the surface of splenic lymphocytes in two of the fetuses.
[0234] Presence of Human Heavy and Light Chain Loci in
.DELTA..DELTA.HAC Fetuses To determine whether .DELTA..DELTA.HAC
fetuses retained the human heavy and light chain loci, PCR analysis
was performed on genomic DNA from the liver of 58 day fetus #5580,
57 day fetus #5848, and 91 day fetuses #5442A and 5442B. The PCR
primers used for detection of the heavy chain loci were VH3-F
(5'-AGTGAGATAAGCAGTGGATG-3', SEQ ID NO: 18) and VH3-R
(5'-CTTGTGCTACTCCCATCACT-3', SEQ ID NO: 19), and the primers used
for the detection of the light chain were IgL-F
(5'-GGAGACCACCAAACCCTCCAAA-3', SEQ ID NO: 20) and IgL-R
(5'-GAGAGTTGCAGAAGGGGTYGACT-3', SEQ ID NO: 21). The PCR reaction
mixtures contained 18.9 .mu.l water, 3 ul of 10.times.Ex Taq
buffer, 4.8 .mu.l of dNTP mixture, 10 pmol forward primer, 10 pmol
of reverse primer, 1 .mu.l of genomic DNA, and 0.3 ul of Ex Taq.
Thirty-eight PCR cycles were performed as follows: 85.degree. C.
for three minutes, 94.degree. C. for one minute, 98.degree. C. for
10 seconds, 56.degree. C. for 30 seconds, and 72.degree. C. for 30
seconds (FIGS. 13 and 14).
[0235] As illustrated in FIGS. 13 and 14, positive control 58 day
fetus #5580 contained both human heavy and light chain
immunoglobulin loci. Additionally, the 91 day fetuses #5442A and
5442B also contained both heavy and light chain loci (FIG. 14). In
contrast, fetus #5848 did not contain either human loci and may not
have contained .DELTA..DELTA.HAC. These results suggested that
.DELTA..DELTA.HAC can be stably retained up to gestational day 91
in bovine.
[0236] Rearrangement and Expression of Human Heavy Chain Locus in
.DELTA..DELTA.HAC Fetus #5442A RT-PCR was used to detect expression
of rearranged human heavy chain RNA transcripts in
.DELTA..DELTA.HAC fetus #5542A. The RT-PCR primers used were CH3-F3
(5'-GGAGACCACCAAACCCTCCAAA-3', SEQ ID NO: 22) and CH4-R2
(5'-GAGAGTTGCAGAAGGGGTGACT-3', SEQ ID NO: 23). The RT-PCR reaction
mixtures contained 18.9 .mu.l water, 3 .mu.l of 10.times.Ex Taq
buffer, 4.8 .mu.l of dNTP mixture, 10 pmol forward primer, 10 pmol
of reverse primer, 1 .mu.l of cDNA, and 0.3 .mu.l of Ex Taq. Forty
cycles of RT-PCR cycles were performed as follows: 85.degree. C.
for three minutes, 94.degree. C. for one minute, 98.degree. C. for
10 seconds, 60.degree. C. for 30 seconds, and 72.degree. C. for 30
seconds.
[0237] Lanes 4 and 5 of FIG. 15 contained amplified spliced mu
heavy chain constant region sequences from the spleen of fetus
#5442A that are similar in size to that of the positive control
samples. These results indicate that fetus #5442A expressed a
rearranged mu heavy chain transcript in its spleen. Faint bands
were also seen in the region of the unspliced genomic sequence,
which are amplified from genomic DNA contaminated in the RNA
sample. Control samples from the liver and brain of fetus #5442A
did not produce a band of the size expected for an amplified
rearranged heavy chain sequence.
[0238] Rearrangement and Expression of Human Heavy Chain Locus in
.DELTA..DELTA.HAC Fetus #5868A RT-PCR was used to detect expression
of rearranged human heavy chain RNA transcripts in the spleen of a
.DELTA..DELTA.HAC fetus at 119 gestational days (fetus #5868A). The
primers used for this analysis were VH30-3
(5'-caggtgcagctggtggagtctgg-3', SEQ ID NO: 24) and CM-1
(5'-caggagaaagtgatggagtc-3', SEQ ID NO: 25). Additionally, primers
"GAPDH up" (5'-gtcatcatctctgccccttctg-3', SEQ ID NO: 26) and "GAPDH
down" (5'-aacaacttcttgatgtcatcat-3', SEQ ID NO: 27) were used to
amplify GAPDH control transcripts. For this PCR analysis, the
reaction mixture was incubated at 95.degree. C. for five minutes
and then multiple cycles of denaturation, annealing, and
amplification were performed by incubation at 95.degree. C. for one
minute, 58.degree. C. for one minute, and 72.degree. C. for two
minutes. Then, the mixture was incubated at 72.degree. C. for 10
minutes.
[0239] Lane 3 of FIG. 16 contains the RT-PCR product produced from
this analysis of .DELTA..DELTA.HAC fetus #5868A. This RT-PCR
product was the size expected for the amplification of a rearranged
human heavy chain (470 base pairs) and migrated to the same
position in the gel as the control cDNA known to contain sequences
corresponding to rearranged human heavy chain transcripts. As
controls, both .DELTA..DELTA.HAC fetus #5868A fetal spleen cDNA and
normal bovine cDNA samples generated a product when amplified with
GAPDH primers, demonstrating the capacity of the cDNA to support
amplification (lanes 7 and 8).
[0240] Rearrangement and Expression of Human Lambda Locus in
.DELTA..DELTA.HAC Fetuses #5442A and 5442B Primers specific for
amplification of a transcript including portions of human lambda
were used to detect RNA transcripts from a rearranged human lambda
light chain locus.
[0241] For the RT-PCR analysis shown in FIG. 17, an equimolar
mixture of primers C.lamda.1 (5'-GGGAATTCGGGTAGAAGTTCACTGATCAG-3',
SEQ ID NO: 28), C.lamda.2-3 (5'-GGGAATTCGGGTAGAAGTCACTTATGAG-3',
SEQ ID NO: 29), and C.lamda.7 (5'-GGGAATTCGGGTAGAAGTCACTTACGAG-3',
SEQ ID NO: 30) was used with primer V.lamda.1 LEA1
(5'-CCCAAGCTTRCCKGSTYYCCTCTCCTC-3', SEQ ID NO: 31). The RT-PCR
reaction mixtures contained 18.9 .mu.l water, 3 .mu.l of
10.times.Ex Taq buffer, 4.8 .mu.l of dNTP mixture, 10 pmol forward
primer, 10 pmol of reverse primer, 1 .mu.l of cDNA and 0.3 .mu.l of
Ex Taq. The RT-PCR conditions were as follows: 40 cycles of
85.degree. C. for three minutes, 94.degree. C. for one minute,
98.degree. C. for 10 seconds, 60.degree. C. for 30 seconds, and
72.degree. C. for one minute.
[0242] As shown in FIG. 18, this RT-PCR analysis was also performed
using an equimolar mixture of primers V.lamda.3LEA1
(5'-CCCCCAAGCTTGCCTGGACCCCTCTCTGG-3'; SEQ ID NO:32), V.lamda.3JLEAD
(5'-ATCGGCAAAGCTTGGACCCCTCTCTGGCTCAC-3', SEQ ID NO: 33),
V.lamda.BACK4 (5'-CCCCCAAGCTTCTCGGCGTCCTTGCTTAC-3', SEQ ID NO: 34)
and an equimolar mixture of primers C.lamda.1
(5'-GGGAATTCGGGTAGAAGTTCACTGATCAG-3', SEQ ID NO: 35) C.lamda.2-3
(5'-GGGAATTCGGGTAGAAGTCACTTATGAG-3', SEQ ID NO: 36) and C.lamda.7
(5'-GGGAATTCGGGTAGAAGTCACTTACGAG-3', SEQ ID NO: 37). The RT-PCR
reaction conditions were the same as those described above for FIG.
7.
[0243] Lanes 6 and 7 of FIG. 17 and lanes 4 and 5 of FIG. 18
contained RT-PCR products from the spleen of fetus #5442A that are
similar in size to the positive control bands, indicating the
presence of rearranged light chain RNA transcripts in this fetus.
The spleen sample from fetus #5442B produced very weak bands of the
appropriate size which are not visible in the picture. This RT-PCR
product indicates that fetus #5442B also expressed a rearranged
light chain immunoglobulin transcript in its spleen. As expected,
samples from the brain of fetuses #5442A and 5442B did not express
human rearranged lambda light chain transcripts.
[0244] Rearrangement and Expression of Human Lambda Locus in
.DELTA..DELTA.HAC Fetus #5868A RNA transcripts from a rearranged
human lambda light chain locus were also detected in
.DELTA..DELTA.HAC fetus #5868A. For this analysis, primers specific
for amplification of a transcript including portions of human
lambda were used to detect .DELTA..DELTA.HAC-encoded expression of
transcripts encoding portions of a rearranged human lambda locus.
Primer VL1 LEAI (5'-cccccaagcttRccKgStYYcctctcctc-3'; SEQ ID NO:38)
and an equimolar mixture of primers CL1
(5'-gggaattcgggtagaagtcactgatcag-3'; SEQ ID NO:39), CL2-3
(5'-gggaattcgggtagaagtcacttatgag-3'; SEQ ID NO:40), and CL7
(5'-gggaattcgggtagaagtcacttacgag-3'; SEQ ID NO:41) were used for
this analysis. For this RT-PCR reaction, the reaction mixtures were
incubated at 95.degree. C. for 5 minutes and then multiple cycles
of denaturation, annealing, and amplification were performed by
incubation at 95.degree. C. for one minute, 60.degree. C. for one
minute, and 72.degree. C. for two minutes. Then, the mixtures were
incubated at 72.degree. C. for 10 minutes.
[0245] This analysis demonstrated that spleen cDNA from
.DELTA..DELTA.HAC #5868A (lane 4 of FIG. 19) produced a RT-PCR
product of the same size as the TC mouse spleen cDNA (lane 6)
positive control. No such RT-PCR product was detected using either
brain or liver cDNA from .DELTA..DELTA.HAC #5868A (lanes 2 and 3,
respectively). The capacity of each of these tissues to support
RT-PCR was shown by successful amplification of the housekeeping
gene, GAPDH using primers "GAPDH up" and "GAPDH down" (lanes 8 and
10).
[0246] Verification of .DELTA..DELTA.HAC Rearrangement by
Sequencing RT-PCR analysis was performed on a spleen sample from
fetus #5442A using an equimolar mixture of primers C.lamda.1,
C.lamda.2-3, and C.lamda.7 with primer V.lamda.1LEA1, or an
equimolar mixture of primers V.lamda.3LEA1, V.lamda.3JLEAD, and
V.lamda.BACK4 and an equimolar mixture of primers C.lamda.1,
C.lamda.2-3, and C.lamda.7. The PCR products were purified using a
CHROMA SPIN column (CLONETECH) and cloned into the pCR2.1
TA-cloning vector (Invitrogen), according to manufacturer's
protocol. The Dye Terminator sequence reaction (ABI Applied System)
was carried out using the C.lamda.1, C.lamda.2-3, and C.lamda.7
primers in an equimolar mixture. Twenty-five cycles were performed
at 96.degree. C. for one minute, 96.degree. C. for 10 seconds,
55.degree. C. for five seconds, and 60.degree. C. for four minutes.
The 10 .mu.l reaction mixture contained BigDye Terminator reaction
mixture (3 .mu.l), template plasmid (200 ng), and the C.lamda.1,
C.lamda.2-3, and C.lamda.7 primers (1.6 pmol). The reaction mixture
was analyzed using a ABI 3700 sequencer.
[0247] At least two rearranged human lambda light chain transcripts
were identified (V1-17/JL3/C.lamda. and V2-13/JL2/C.lamda.). These
results demonstrate that VJ rearrangement of human lambda light
chain genes occurs in the .DELTA..DELTA.HAC in the spleen of fetus
#5442A (FIGS. 20 and 21).
[0248] FACS Analysis of Expression of Human Lambda Light Chain and
Bovine Heavy Chain in .DELTA..DELTA.HAC Fetus #5442A and 5442B
Splenic lymphocytes from .DELTA..DELTA.HAC Fetus #5442A and 5442B
were analyzed for the expression of human lambda light chain and
bovine heavy chain proteins. These cells were reacted with a
phycoerytherin labeled anti-human lambda antibody (FIGS. 22C and
22D), a FITC labeled anti-bovine IgM antibody (FIGS. 22D and 22H),
or no antibody (FIGS. 22A, 22B, 22E, and 22F) for 20 minutes at
4.degree. C. Cells were then washed twice with PBS plus 2% FCS and
analyzed on a FASCalibur cell sorter. The percent of cells reacting
with the antibody was calculated using the non antibody controls to
electronically set the gates. These percentages are displayed
beneath each histogram. Fetus #5442A (FIGS. 22A-22D) and fetus
#5442B (FIGS. 22E-22H) expressed both human lambda light chain
protein and bovine heavy chain protein.
Expression of Human Antibody Protein in HAC Calves
[0249] As described above, a novel procedure was developed for
producing transchromosomic (Tc) calves (FIG. 37). This method
overcame the limitations due to the limited life span of only about
35 population doublings for primary bove fibroblasts and the
requirement for a large DNA insert to be introduced and maintained
in the donor cells. In particular, a human artificial chromosome
(HAC) vector was used to introduce both the entire unrearranged
human Ig heavy (IgH) and lambda light chain (Ig.lamda.) loci into
bovine primary fibroblasts. Selected fibroblast clones were
rejuvenated and expanded by producing cloned fetuses. Cloned fetal
cells were selected and recloned to produce four healthy, Tc calves
that functionally rearranged both heavy and light chain human Ig
loci and produced human polyclonal antibodies. These results
demonstrate the feasibility of using HAC vectors for production of
transgenic livestock. More importantly, Tc cattle containing human
Ig genes may be used to produce novel human polyclonal therapeutics
with applications ranging from the prevention of antibiotic
resistant infections to combating bioterrorism. This method is
described in more detail below.
[0250] HACs were introduced into bovine fetal fibroblasts from CHO
clones using the MMCT technique described herein. The fibroblasts
were placed under selection for the neo gene marker on the HAC
vector with G418 (700 .mu.g/ml) until colonies began to appear.
Complete antibiotic selection and DNA-based screening was avoided
at this step to minimize cell divisions prior to nuclear transfer.
Colonies were picked on the basis of growth and morphology and
nuclear transfer was carried out as previously described (Lucier et
al., J. Immunol 161:5438-5444, 1998). Because the cells were only
useful for nuclear transfer for a few days, final selection was
done after rejuvenation and expansion of cells by production of
cloned fetuses.
[0251] Development to the blastocyst stage ranged from 17 to 21%
and pregnancy at 40 days ranged from 22 to 50% with no differences
among cell lines. At 56 to 58-days, four .DELTA.HAC and two
.DELTA..DELTA.HAC fetuses were recovered and fibroblast cell lines
were regenerated and cryopreserved for further analysis and nuclear
transfer. Retention of the HACs in the fibroblast lines derived
from the fetuses collected at 56 to 58-days and seven additional
fetuses collected between 77 and 19-days was evaluated by
G418-resistance (FIG. 38A) and genomic PCR of IgH and Ig.lamda.
loci (FIG. 38B). Nine of 13 fetuses were resistant to G418 and
eight of them showed the presence of both human IgH and Ig.lamda.
loci. Three .DELTA.HAC (#5968, #6032 and #6045) and one
.DELTA..DELTA.HAC (#5580) positive 56 to 58-day fetuses were used
for recloning and production of offspring. Five positive 77 to
119-day fetuses were evaluated for expression and rearrangement of
the human Ig loci by RT-PCR analysis, followed by sequencing of the
amplified products. Human IgH and Ig.lamda. genes were expressed
(FIG. 38C) in all fetuses and showed evidence of proper V(D)J
recombination (FIG. 38D).
[0252] Recloned .DELTA.HAC cell lines produced one male (from cell
line #6045) and 5 female (from cell lines #5968 and #6032) calves
from 37 recipients (16%, FIG. 39A). The two calves derived from
cell line #6032 died within 48 hours after birth. One calf was born
from non-regenerated .DELTA..DELTA.HAC cells. All five live calves
were healthy and phenotypically normal. Retention of the HAC was
confirmed in all the calves by G418 selection, genomic PCR and
fluorescent in situ hybridization (FISH) analyses (FIGS. 39B and
39C). Results of FISH analysis indicated that the HAC was retained
as an independent chromosome and the proportion of cells retaining
the HAC was 78 to 100%. No obvious differences were observed in
retention rates between peripheral blood lymphocytes (PBLs, 91%)
and fibroblasts (87%) however, donor cell line #6045 may have had a
higher retention rate than donor cell line #5968 (97% and 86%,
respectively). Interestingly, retention rate in the Tc bovine may
be higher than we previously observed in mouse. To determine
whether the human Ig loci were rearranged and expressed in calves
as well as in fetuses, we performed RT-PCR analysis on PBLs. We
observed the expression of both human IgH and Ig.lamda. genes in
the PBLs and the diversity of the human IgH and Ig.lamda.
repertoire was determined by sequence analysis (Table 3). A
representative set of the sequences showed a wide utilization of
V.sub.H/V.lamda., D.sub.H and J.sub.H/J.lamda. segments distributed
over the loci. In the Ig.lamda. transcripts, the frequent
utilization of V segments from V.sub.H1 and V.sub.H3 was observed,
which is similar to the usage of V.sub.H segments in human.
Addition of non-germline nucleotides (N-addition), as well as
nucleotide deletion, was also observed in both IgH and Ig.lamda.
transcripts. This produced a high degree of diversification in the
third complementarity determining regions (CDR3s) of both heavy and
light chains. Furthermore, human Ig protein was detected at levels
ranging from 13 to 258 ng/ml (Ig expression is typically very low
to undetectable in newborn calves) in blood samples collected prior
to colostrum feeding in 5 of the seven calves as determined by
solid phase ELISA. These data indicate that the HAC transfer can be
accomplished efficiently in primary cells using a recloning
strategy and that human Ig genes carried by the HAC can be properly
processed and expressed with a high degree of diversity in Tc
calves.
[0253] The results of this study demonstrate that a combination of
chromosome-cloning, chromosome transfer and somatic cell recloning
technologies can be used to produce healthy calves retaining a HAC
vector carrying Mb-sized genomic transgenes. Furthermore, these
technologies were used to demonstrate the transfer and retention of
the entire loci for both the human IgH and Ig.lamda. genes in
cattle. Interestingly, both loci were demonstrated to have
undergone proper processing and express functionally rearranged
human immunoglobulin genes in a species with substantially
different immunophysiology than either the human or mouse. This HAC
system may be useful for the expression of a variety of complex
human proteins (e.g., hemoglobulin) or large collections of
proteins for pharmaceutical applications. For example, the Tc
calves produced in this study, which retain both the human IgH and
Ig.lamda. loci, are useful for production of human polyclonal
antibodies. Human polyclonal antibodies are currently only
available from human blood or plasma donors. Consequently, there
are limitations in supply and application of human polyclonal
products. Tc cows may be hyperimmunized to produce large quantities
of novel polyclonal therapeutics for treatment of a wide variety of
human diseases.
[0254] Table 3. Repertoire analysis of human immunoglobulin heavy
and lambda chain transcripts in cloned Tc calves. Human .mu. and
.lamda.-specific mRNAs were amplified by RT-PCR, cloned and
sequenced. Nucleotide sequences of V(D)J junctions of each of 10
independent .mu. and .lamda. clones are shown, divided into
V.sub.H/V.lamda., D.sub.H, J.sub.H/J.lamda. and N segments, as
identified by homology to published germline sequences (Ig-BLAST).
TABLE-US-00003 Human .mu. Nucleotide Sequences V.sub.H N D.sub.H N
J.sub.H 6-1 0 D5-24 3 JH3 TACTGTGCA----- AGAGATG AGA
-ATGCTTTTGATGTC 3-33 8 D6-13 3 JH4 ATTACTGTGCGA---- AGAACAAA
ATAGCAGCAGCTGGTAC GAT ----CTTTGACTACT 3-15 4 D6-19 4 JH1
ACTGTACCACAGA TCTG ATAGCAGTGGCTGGTAC TGGG ------TACTTCCAGCA 3-66 2
D2-2 0 JH3 TACTGTGCGAG--- TC GTAGTACCAGCTGCTAT GATGCTTTTGATGTCT
3-21 6 D2-21 8 JH4 TTACTGTGCGAG--- TTTTGG GTGGTGGT CACATTTA
--------GACTACTGGGG 4-39 8 D3-10 3 JH4 ACTGTGCGAGACA TGAAAAAC
TTCGGGGAGTTAT AAT ---------CTACTGGGGCC 1-69 7 D6-13 1 JH4
TTACTGTGCGAG--- GGGGATG GCAGCAGCTGGTAC C -------GACTACTGGGGC 1-8 0
D2-2 12 JH2 ACTGTGCGAGAG- ATTGTAGTAGTACCAGCTGC CAAGATCGTAAG
----TGGTACTTCGAT 1-18 0 D5-24 15 JH4 TTACTGTGC------ GAGATGG
GTTTTTGATCCCCAG -----TTTGACTACTGG 3-20 4 D7-27 1 JH3 TCACTGTGCGAGAA
TTTT ACTGGGGA T GATGCTTTTGATGTCT
[0255] TABLE-US-00004 HUMAN .lamda. NUCLEOTIDE SEQUENCES V.lamda. N
J.lamda. 1-17 AGCCTGAGTGGTC-- 2 (TT) J.lamda.3 --------TTCGGCGGAGGG
2-13 CAGTGGTAACCATCT 0 J.lamda.2 ---GGTATTCGGCGGAGG 1-19
CAGCCTGAGTGCTG- 0 J.lamda.1 -----TCTTCGGAACTGGG 5-2 AGCAACTTCGTGTA-
2 (TA) J.lamda.3 ------GTTCGGCGGAGAG 1-7 GGTAGTAGCACTT-- 1 (C) J3
--------TCGGCGGAGGGA 2-13 CAGTGGTAACCAT-- 0 J.lamda.1
-TATGTCTTCGGAACTG 2-1 GACAGCAGCACT--- 0 J.lamda.1 -TATGTCTTCGGAACTG
1-2 GGCAGCAACAATTTC 1 (G) J.lamda.1 --ATGTCTTCGGAACTG 1-4
AGCAGCAGCACTC-- 2 (GT) J.lamda.3 -------TTCGGCGGAGG 1-4
AGCAGCAGCACTC--- 0 J.lamda.1 ----------GGAACTGGGA
Characterization of Human Antibody Produced in HAC Calves
[0256] HAC transgenic calves produced as described above were
examined for their production of human antibody using a solid phase
ELISA assay (FIGS. 41-44). Among forty-two calves examined, all
forty-two calves had an antibody titer that was higher than
background. The highest human Ig level shown in Table 4 is 10000
ng/ml. Because Ig levels fluctuate, Ig levels tested on other days
or later in development may yield much higher values. Seven calves
had a level of at least 2000 ng/ml. These results demonstrate that
fully human antibodies can be purified from the serum of HAC
transchromosomal cattle (FIG. 42). Furthermore, the presence of mu
and gamma heavy chains demonstrates that the HAC undergoes class
switching at the human heavy chain locus within a transchromosomal
ungulate (e.g., a bovine). The HAC-encoded human light chains
(lambda) are bound to human mu chains and to human gamma chains
(FIG. 43). This result demonstrates that the xenogeneic B cells of
HAC-transchromosomal animals are capable of assembling human heavy
and light chains.
[0257] Adjuvant-stimulated immunization of HAC-transchromosomal
cattle generates a polyclonal, antigen-specific response to the
immunizing antigen (FIG. 41). The reaction of the antibody to
different epitopes of the immunizing antigen demonstrates that HAC
transchromosomal animals can recognize multiple epitopes of a
complex antigen. Human mu, gamma, and light chains were found in
human Ig purified from a HAC-transchromosomal calf in which an
antigen-specific human antibody response was induced (FIG. 44).
TABLE-US-00005 TABLE 4 Human Ig Levels in HAC Transgenic Animals
ANIMAL HUMAN IG IDENTIFICATION LEVEL IN Number NUMBER ng/ml 1 100
10000 2 104 4000 3 1098 4000 4 1075 3000 5 1163 3000 6 82 2556 7
1076 2000 8 68 497 9 1098 403 10 1064 258 11 1093 253 12 1065 210
13 71 160 14 80 141 15 1075 134 16 1076 100 17 73 98 18 72 93 19
1066 70 20 67 69 21 50 55 22 86 48 23 1094 33 24 77 30 25 89 30 26
88 30 27 1077 29 28 74 25 29 1098 25 30 1079 24 31 91 22 32 1081 21
33 76 20 34 66 17 35 90 17 36 1076 16 37 1088 15 38 87 15 39 95 15
40 1092 13 41 1068 13 42 1090 12
[0258] Table 4 contains measurements of the human Ig levels (ng/ml)
produced by HAC animals. The measurements were performed using a
solid phase ELISA assay with a highly specific polyclonal bovine
anti-human antibody as a capture reagent and polyclonal bovine
anti-human antibody conjugated to biotin as the detection
reagent.
EXAMPLE 2
Evidence for Nuclear Reprogramming Deficiencies in Traditional
Bovine Nuclear Transplant Embryos
[0259] Traditional nuclear transplant techniques generally produce
a low percentage of live births. As described below, this in
efficiency may be due to, at least in part, the inability of the
reconstituted oocyte to reprogram the donor cell or donor nucleus
to promote the transcription of genes desirable for development of
the oocyte and to inhibit the transcription of genes undesirable
for development. Examples below describe improved cloning methods
that can be used to produce transgenic ungulates expressing
xenogenous antibodies in the methods of the present invention.
[0260] Distribution of Nuclear Envelope, Nuclear Matrix and
Chromatin-Matrix Interface Components during Bovine Preimplantation
Development To determine the distribution of nuclear envelope
(B-type and A/C-type lamins), nuclear matrix (NuMA), and
chromatin-matrix interface (AKAP95) components in preimplantation
embryos, bovine embryos were produced by in vitro fertilization
(IVF) and examined by immunofluorescence analysis. Bovine in vitro
fertilization was performed as described previously (Collas et al.,
Mol. Reprod. Devel. 34:212-223, 1993). Briefly, frozen-thawed
bovine sperm from a single bull was layered on top of a 45-90%
Percoll gradient and centrifuged for 30 minutes at 700.times.g. The
concentration of sperm in the pellet was determined, and the sperm
was diluted such that the final concentration at fertilization was
10.sup.6 sperm/ml. At 22 hours post maturation, oocytes were washed
three times in TL HEPES and placed in 480 .mu.l fertilization
medium. Twenty .mu.l sperm suspension were added at 10.sup.6
sperm/ml for 50 oocytes. Embryos were placed in culture in
four-well tissue culture plates containing a monolayer of mouse
fetal fibroblasts in 0.5 ml of embryo culture medium covered with
0.3 ml of embryo tested mineral oil (Sigma). Between 25 and 50
embryos were placed in each well and incubated at 38.5.degree. C.
in a 5% CO.sub.2 air atmosphere. Fertilization rates were over 90%
as determined by pronuclear development.
[0261] For the immunofluorescence analysis of these in vitro
fertilized bovine embryos, anti-human lamin B antibodies were
obtained from Dr. Jean-Claude Courvalin, CNRS, Paris, France.
Anti-lamins A/C monoclonal antibodies were purchased from
Santa-Cruz Biotechnology, and anti-NuMA antibodies were obtained
from Transduction Laboratories. Anti-rat AKAP95 affinity-purified
rabbit polyclonal antibodies were obtained from Upstate
Biotechnologies. The in vitro fertilized bovine embryos were
settled onto poly-L-lysine-coated glass coverslips, fixed with 3%
paraformaldehyde for 15 minutes, and permeabilized with 0.1% Triton
X-100 for 15 minutes (Collas et al., J. Cell Biol. 135:1715-1725,
1996). The proteins were blocked with 2% BSA in PBS/0.01% Tween 20
(PBST) for 15 minutes. Primary antibodies (anti-AKAP95, anti-lamin
B, anti-LBR, anti-NuMA, and anti-lamins A/C) and secondary
antibodies were incubated each for 30 minutes and used at a 1:100
dilution in PBST-BSA. DNA was counterstained with 0.1 .mu.g/ml
Hoechst 33342 incorporated in the antifade mounting medium. Samples
were mounted onto slides and coverslips sealed with nail polish.
Immunofluorescence observations were made on an Olympus BX60
epifluorescence microscope and photographs were taken with a JVC
CCD camera and AnalySIS software. Images were processed using the
Aldus Photostyler software. Relative quantification of fluorescence
signals was performed using the AnalySIS quantification program.
Data were expressed as mean relative fluorescence intensities.
[0262] Immunofluorescence analysis of bovine embryos showed that
B-type lamins were detected at the nuclear periphery (FIG. 29A).
Lamins A/C, however, were not detected at the pronuclear or 8-cell
stage. This failure to detect lamins A/C at these early cell stages
is expected for a marker of differentiated cells (Guilli et al.,
EMBO J. 6:3795-3799, 1987). The nuclear matrix structural protein,
NuMA, was detected in all the stages that were examined (FIG. 29A).
However, in bovine pronuclear stage embryos, NuMA labeling was
restricted to the female pronucleus (FPN), the smallest of both
pronuclei (FIG. 29A arrows). AKAP95, which was recently
characterized in early mouse embryos (Bomar et al., 2002 manuscript
submitted) and detected using affinity-purified anti-rat AKAP95
antibodies, was also restricted to the female pronucleus (FIG.
29A). Nevertheless, intranuclear distribution of AKAP95 was
observed in nuclei of all blastomeres in subsequent developmental
stages (FIG. 29A).
[0263] Specificity of immunofluorescence labeling was verified by
Western blot analysis of bovine primary fetal fibroblasts and
pronuclear stage in vitro fertilized embryos (FIG. 29B). For this
analysis, proteins were resolved by 10% SDS-PAGE at 40 mA per gel.
Proteins were electrophoretically transferred onto a nitrocellulose
membrane in transfer buffer (25 mM Tris HCl, pH 8.3, 192 mM
glycine, 20% methanol, and 0.1% SDS) at 100 V for one hour.
Membranes were washed for 10 minutes with Tris-buffered saline
(TBS; i.e., 140 mM NaCl, 2.7 mM KCl, and 25 mM Tris-HCl at pH 8.0),
blocked for one hour with TBST (TBS with 0.05% Tween-20) containing
5% milk, and incubated for 1.5 hours with the following primary
antibodies: anti-AKAP95 (1:250 dilution), anti-lamin B (1:1000),
anti-LBR (1:500), anti-NuMA (1:500), and anti-lamins A/C (1:500).
Blots were washed twice for 10 minutes in TBST and incubated for
one hour with horse radish peroxidase (HRP)-conjugated secondary
antibodies. Blots were washed twice for 10 minutes in TBS and
developed using enhanced chemiluminescence (ECL, Amersham).
[0264] All proteins were detected at their expected apparent
M.sub.r: 68 kDa (B-type lamins), 70 and 60 kDa (lamins A and C,
respectively), .about.180 kDa (NuMA), and 95 kDa (AKAP95).
Altogether, these results indicate that preimplantation bovine
embryos express nuclear structural proteins that can be detected
with cross-reacting antibodies. Notably, lamins A/C are not
immunologically detected in bovine preimplantation embryos. Because
lamins A/C are expressed in somatic cells (FIG. 29B), they
potentially constitute molecular markers for nuclear reprogramming
in nuclear transplant embryos.
[0265] Dynamics of Nuclear Envelope, Numa, and AKAP95 in Nuclear
Transplant Bovine Embryos The dynamics of nuclear envelope and
nuclear matrix structures was examined during traditional nuclear
transplantation procedure in bovine. These structures were
investigated using antibodies to lamins A/C and B, NuMA, and
AKAP95, respectively. To determine the dynamics of these markers
during nuclear remodeling, bovine nuclear transplant embryos were
produced using primary fetal fibroblasts, which were isolated as
described previously, as the donor cells (Kasinathan et al., Biol.
Reprod. 64:1487-1493, 2001). Briefly, cells were harvested from
bovine fetuses by trypsinization using 0.08% trypsin and 0.02% EDTA
in PBS (trypsin-EDTA). Cells were seeded in a T75 culture flask
(Corning) in .alpha.-MEM (Gibco) supplemented with 10% fetal bovine
serum (FBS; Hyclone), 0.15 g/ml glutamine (Sigma), 0.003%
.beta.-mercaptoethanol (Gibco), and an antibiotic-antimycotic
(Gibco). On day three after seeding, cells were harvested with
trypsin-EDTA and frozen in .alpha.-MEM/DMSO. G1 cells were isolated
as described previously (Kasinathan et al., Biol. Reprod.
64:1487-1493, 2001). Briefly, 24 hours before isolation,
5.0.times.10.sup.5 cells were plated in a T75 flask containing 10
ml of MEM/FBS. The following day, the plates were washed with PBS,
the culture medium was replaced for 1-2 hours, and the plates were
shaken for 30-60 seconds on a Vortex at medium speed. The medium
was removed, centrifuged at 500.times.g for five minutes, and the
pellet was resuspended in 250 .mu.l of MEM/FBS. Cell doublets
attached by a cytoplasmic bridge were selected using a micropipette
and used for nuclear transfer.
[0266] Bovine nuclear transfer was carried out as described earlier
(Kasinathan et al., Biol. Reprod. 64:1487-1493, 2001). In
vitro-matured oocytes were enucleated 18-20 hours post-maturation.
After transferring G1 donor cells into the perivitelline space,
they were fused using a single electrical pulse of 2.4 kV/cm for 20
microseconds (Electrocell Manipulator 200, Genetronics). At 28-30
hours post maturation (i.e., 28-30 hours after oocytes were placed
in maturation medium after collection from ovaries and at least two
hours after fusion with donor cells) reconstructed oocytes and
parthenogenetic controls were activated with calcium ionophore (5
.mu.M) for four minutes (Cal Biochem) followed by 10 .mu.g
cycloheximide and 2.5 .mu.g cytochalasin D (Sigma) in ACM medium
(100 mM NaCl, 3 mM KCl, 0.27 mM CaCl.sub.2, 25 mM NaHCO.sub.3, 1 mM
sodium lactate, 0.4 mM pyruvate, 1 mM L-glutamine, 3 mg/ml BSA, 1%
BME amino acids, and 1% MEM nonessential amino acids, for five
hours (Liu et al., Mol. Reprod. Dev. 49:298-307, 1998). After
activation, nuclear transplant embryos or oocytes eggs were washed
five times and co-cultured with mouse fetal fibroblasts at
38.5.degree. C. in a 5% CO.sub.2 atmosphere.
[0267] Reconstituted embryos were activated using standard methods,
and three hours post-fusion, embryos at the premature chromatin
condensation (PCC) stage were fixed with paraformaldehyde and
analyzed by immunofluorescence using antibodies to lamins A/C,
lamin B, NuMA, and AKAP95 (FIG. 30, PCC). Furthermore, groups of
nuclear transplant embryos that were allowed to progress to the
pronuclear (PN) stage (i.e., 15 hour post-fusion bovine embryos)
were analyzed similarly (FIG. 30, nuclear transplant-PN). As
controls, parthenogenetic oocytes activated as described herein
were also examined at the pronuclear stage (FIG. 30, Parth.
PN).
[0268] As expected, somatic donor cells (bovine fetal fibroblasts,
FIG. 30) expressed all markers with a distribution anticipated from
the literature. At the premature chromatin condensation stage,
distinct condensed chromosome masses were evidenced by DNA staining
with Hoechst 33342. Lamins A/C and B were not detected on or near
the condensed chromosomes (FIG. 30, PCC), presumably as a result of
their dispersal in the egg cytoplasm. Some labeled NuMA was
detected; this NuMA was presumably associated with the spindle
poles maintaining the condensed chromosomes. AKAP95, in contrast,
was associated with the condensed (PCC) chromosomes. This result is
reminiscent of AKAP95 labeling in mitotic human cells (Collas et
al., J. Cell Biol. 147:1167-1180, 1999; Steen et al., J. Cell Biol.
150:1251-1262, 2000). At the pronuclear stage, all markers were
detected. Lamins A/C were present at the pronuclear envelope (FIG.
2, nuclear transplant-PN). This contrasted with their absence from
the envelope of control parthenote pronuclei (FIG. 30) and from the
envelope of fertilized pronuclei (FIG. 29A). Lamin B was detected
in nuclear transplant pronuclei, as in control pronuclei. Likewise,
NuMA and AKAP95 decorated the nuclear interior except for the
nucleoli. NuMA labeling was consistently brighter in nuclear
transplant pronuclei than in control parthenogenetic pronuclei
(compare nuclear transplant PN and Parth. PN, FIG. 30).
Collectively, these observations indicate that pronuclei of nuclear
transplant embryos reassemble the somatic nuclear markers lamins A
and C and display strong NuMA staining.
[0269] Differential Anchoring of AKAP95 in Pronuclei of
Parthenogenetic Embryos and Nuclear Transplant Embryos The A-kinase
anchoring protein AKAP95 is a nuclear protein implicated in mitotic
chromosome condensation. For use as another molecular marker
affecting reprogramming of somatic nuclei after nuclear transplant,
the intranuclear anchoring properties of AKAP95 were characterized
in bovine nuclear transplant pronuclear stage embryos formed from
fetal fibroblasts. Anchoring of AKAP95 in pronuclei from
parthenogenetic embryos and nuclei of somatic donor cells was also
examined.
[0270] Intranuclear anchoring of AKAP95 in pronuclear embryos was
examined in situ by extraction of embryos with 0.1% Triton X-100, 1
mg/ml DNAse 1, and either 100 or 300 mM NaCl for 30 minutes at room
temperature. As noted above, male pronuclei did not harbor any
AKAP95. In contrast, a significant amount of AKAP95 and DNA was
resistant to DNAse 1 and 300 mM NaCl in pronuclei of nuclear
transplant embryos, and in donor nuclei in bovine (FIG. 31). B-type
lamins were not extracted by DNAse 1 and 300 mM NaCl in parthenote
or nuclear transplant pronuclei (FIG. 31), suggesting that
alterations in AKAP95 and DNA distributions did not result from
gross changes in nuclear architecture. These data indicate that, as
in somatic nuclei, AKAP95 is more tightly anchored to intranuclear
structures in nuclear transplant pronuclei than in parthenogenetic
pronuclei in the bovine. Whether this association imposes
constraints on DNA organization or results from altered genome
organization in nuclear transplant embryos remains to be
determined. As DNAse I-resistant DNA is transcriptionally silent,
incomplete remodeling of AKAP95 anchoring after nuclear
transplantation likely impairs expression of developmentally
important genes.
[0271] Transcriptional Misregulation of Lamins A/C in Nuclear
Transplant Bovine Embryos A striking observation was that lamins
A/C reassemble at the periphery of pronuclei in bovine nuclear
transplant embryos, whereas this somatic-specific marker is absent
from in vitro fertilized, and parthenogenetic pronuclei. Thus, we
investigated whether reassembly of lamins A/C resulted from (i)
re-targeting of somatic lamins disassembled at the premature
chromatin condensation stage (FIG. 30), (ii) translation and
assembly of lamins from a pool of maternal lamin A/C mRNA, or (iii)
de novo transcription of the somatic lamin A (LMNA) gene in nuclear
transplant pronuclei.
[0272] To distinguish between these possibilities, bovine nuclear
transplant embryos were produced by either the "traditional"
nuclear transplant procedure as described herein, nuclear
transplant followed by activation of reconstituted embryos with the
protein synthesis inhibitor cycloheximide (CHX), or by nuclear
transplant followed by activation in the presence of the RNA
polymerase II (PolII) inhibitor actinomycin D (ActD) to inhibit de
novo transcription. For culturing bovine nuclear transplant embryos
in cycloheximide, oocytes were activated after nuclear transfer as
described above except that oocytes were incubated for 14 hours in
cycloheximide (CHX). At 14 hours after activation, oocytes were
washed five times and placed in ACM culture medium containing 15
.mu.g/ml Hoechst 33342 (Sigma) for one hour. After incubation,
pronuclear development was observed by epifluorescence microscopy.
Pronuclear embryos were then fixed in 3% paraformaldehyde in PBS,
washed, and mounted on slides. For culturing bovine nuclear
transplant oocytes in actinomycin D, oocytes were activated after
nuclear transfer as described above except 5 .mu.g/ml actinomycin D
(ActD) was added to the cycloheximide incubation step. After five
hours, eggs were washed five times and placed in ACM culture medium
containing 5 .mu.g/ml actinomycin D. At 14 hours after activation,
eggs were washed five times and placed in ACM culture medium
containing 15 .mu.g/ml Hoechst 33342 (Sigma) for one hour. After
incubation, pronuclear development was observed by epifluorescence
microscopy. Pronuclear stage embryos were fixed in 3%
paraformaldehyde in PBS, washed, and mounted on slides.
[0273] Lamin B assembly around nuclear transplant pronuclei was not
affected by either protein or RNA synthesis inhibition. This result
indicates that lamin B was reassembled from either a previously
disassembled somatic pool and/or from a large pool of lamin B in
the oocyte cytoplasm. Lamins A/C, which were detected in nuclear
transplant pronuclei (FIG. 30), were absent from nuclei reformed
after activation with cycloheximide. This result indicates that
lamins A/C assembly requires de novo protein synthesis and that
these lamins are not re-targeted from a disassembled somatic pool
brought into the oocyte by donor nucleus injection or cell fusion.
Furthermore, lamins A/C are not reassembled when embryos are
activated in the presence of actinomycin D. This result indicates
that lamins A/C reassembly in nuclear transplant pronuclei results
from de novo transcription of the LMNA gene in the reconstituted
pronucleus. NuMA, which was detected in nuclear transplant
pronuclei, is not reassembled in pronuclei of nuclear transplant
embryos activated with cycloheximide, but is faintly detected in
pronuclei of actinomycin D-treated nuclear transplant embryos. This
finding strongly suggests that NuMA reassembly in nuclear
transplant pronuclei requires de novo translation that occurs, at
least in part, from a pool of maternal NuMA mRNA. The consistent
observation that anti-NuMA labeling is weaker in pronuclei of
actinomycin D-treated nuclear transplant embryos compared to
control untreated nuclear transplant embryos (compare b' and b'''
in FIG. 32) suggests that part of NuMA assembly in nuclear
transplant pronuclei results from de novo transcription of the NuMA
gene at the pronuclear stage.
[0274] Collectively, these results indicate that the LMNA gene is
not turned off upon nuclear remodeling after nuclear
transplantation. Similarly, the NuMA gene apparently remains active
in pronuclear nuclear transplant embryos. It is likely that
transient inactivation of these genes takes place during premature
chromatin condensation, as anticipated from the highly condensed
nature of the chromatin (FIG. 30). These results clearly illustrate
incomplete nuclear reprogramming in nuclear transplant embryos
produced under the conditions described herein. As discussed
earlier for AKAP95, we propose that the persistence of lamins A/C
in nuclear transplant pronuclei affects gene expression, such as
expression of developmentally important genes. The previously
reported interactions of lamins A and C with chromatin proteins and
DNA, and the association of these lamins with transcription factors
also support this hypothesis.
EXAMPLE 3
Exemplary Nuclear Reprogramming Deficiencies in Traditional Bovine
Nuclear Transplant Embryos
[0275] Exemplary differences between naturally-occurring embryos
and traditional nuclear transfer embryos are also described below.
These differences include differences in pronuclear assembly of
differentiated cell-specific A-type nuclear lamins, enhanced
pronuclear NuMA and TATA binding protein concentrations, and
increased sensitivity of nuclear matrix-chromatin interface
component AKAP95 and DNA to extraction with detergent, DNAse, and
salt.
[0276] For these studies, bovine fetal fibroblast cell lines were
established as described previously (Kasinathan et al., Nat.
Biotechnol. 19:1176-1178, 2001 and Kasinathan et al., Biol. Reprod.
64:1487-1493, 2001). G1-phase fibroblast doublets were isolated
from cultures using a previously described shake-off method
(Kasinathan et al., Nat. Biotechnol. 19:1176-1178, 2001). In vitro
fertilization with in vitro-matured oocytes was carried out as
described previously (Collas et al., Mol. Reprod. Dev. 34:224-231,
1993). For nuclear transplantation (NT) and oocyte activation,
nuclear transplantation using G1-phase donor cells was performed at
.about.20 hours post-maturation (hpm) as reported previously
(Kasinathan et al., Nat. Biotechnol. 19:1176-1178, 2001 and
Kasinathan et al., Biol. Reprod. 64:1487-1493, 2001). Reconstituted
embryos were activated at 28-30 hpm (T=0) with 5 .mu.M calcium
ionophore for four minutes followed by 10 .mu.g/ml CHX and 2.5
.mu.g/ml cytochalasin D for five hours. Embryos were washed and
co-cultured with mouse fetal fibroblasts (Kasinathan et al., Biol.
Reprod. 64:1487-1493, 2001). When reconstituted embryos were
cultured in CHX, oocytes were activated as above and cultured with
2.5 .mu.g/ml CHX for another nine hours (total, 14 hours in CHX).
Embryos were washed thoroughly and cultured as described
(Kasinathan et al., Biol. Reprod. 64:1487-1493, 2001). When
reconstituted embryos were exposed to ActD, oocytes were activated
as above except that 5 .mu.g/ml ActD was added to the five hour CHX
incubation step.
[0277] For immunological analysis, cells, oocytes, embryos, nuclei,
and chromatin masses were settled onto poly-L-lysine-coated
coverslips, fixed with 3% paraformaldehyde for 15 minutes, and
permeabilized with 0.1% Triton X-100 for 15 minutes. Proteins were
blocked using PBS/2% BSA/0.01% Tween 20. Primary and secondary
antibodies (1:100 dilution) were incubated each for 30 minutes. In
particular, rabbit polyclonal antibodies against a peptide of human
lamin B were used (Chaudhary et al., J. Cell Biol. 122:295-306,
1993). Goat anti-lamin B polyclonal antibodies, anti-lamin A/C
monoclonal antibodies, and anti-TBP antibodies from Santa-Cruz
Biotechnology were also used. Anti-NuMA monoclonal antibodies were
from Transduction Laboratories, and anti-rat AKAP95
affinity-purified polyclonal antibodies were from Upstate
Biotechnologies. DNA was counterstained with 0.1 .mu.g/ml Hoechst
33342. Photographs were taken with a JVC CCD camera, and
quantification of immunofluorescence intensity was performed using
the AnalySIS software. Data were expressed as a mean .+-.SD
fluorescence intensity relative to a control in at least three
replicates. For in situ extractions, embryos and cells settled on
coverslips were incubated for 15 minutes with 0.1% Triton X-100, 1
mg/ml DNAse I, and 300 mM NaCl in Tris-HCl (pH 7.2) prior to
immunofluorescence analysis. For immunoblotting, 100 embryos were
dissolved in 20 .mu.l SDS sample buffer, proteins resolved by 10%
SDS-PAGE, and analyzed with the following antibodies: anti-lamin B,
1:1,000; anti-lamin A/C, 1:250; anti-NuMA, 1:500; anti-AKAP95,
1:250.
[0278] Based on the above immunological analysis, the distribution
of A/C- and B-type lamins, NuMA and AKAP95 was characterized in
bovine fetal fibroblasts commonly used for NT. In in vitro-produced
bovine preimplantation embryos, lamin B was detected at the nuclear
periphery as early as the pronuclear (PN) stage. Lamin A/C was
absent, as expected from a marker of differentiated cells. NuMA and
AKAP95 were restricted to the female pronucleus at the pronuclear
stage but decorated all nuclei in subsequent stages. Specificity of
immunofluorescence data was verified on immunoblots.
[0279] The dynamics of lamins A/C and B, NuMA, and AKAP95 was
examined during morphological nuclear remodeling associated with
transplantation of bovine fibroblasts into enucleated oocytes by
electrofusion (Kasinathan et al. Biol. Reprod. 64:1487-1493, 2001).
Donor nuclei underwent premature chromatin condensation (PCC)
within three hours of fusion. Nuclear lamins and NuMA were
redistributed in the oocyte cytoplasm and were absent from PCC
chromosomes. AKAP95 was associated with PCC chromosomes, a property
reminiscent of mitotic cells. Fourteen hours after start of
activation treatment of recipient oocytes, NT embryos displayed
fully developed pronuclei. However, in contrast to pronuclei of
parthenogenetic or fertilized embryos, essentially all NT pronuclei
expressed strong lamin A/C and NuMA immunoreactivity, two
characteristics of the somatic donor cells.
[0280] Recipient oocyte activation in the presence of 10 .mu.g/ml
of the protein synthesis inhibitor cycloheximide (CHX) or 5
.mu.g/ml of the RNA polymerase (Pol) II inhibitor actinomycin D
(ActD), both compatible with pronuclear formation, inhibited
pronuclear lamin A/C assembly. This result indicates that assembly
of these somatic lamins results from transcription of the somatic
lamin A (LAMA) gene. Lamin B assembly was not perturbed by CHX or
ActD, indicating that it was re-targeted from a disassembled
somatic pool and/or from a maternal pool of B-type lamins.
Essentially no NuMA was detected after CHX exposure; however, 40%
of NuMA immunoreactivity in NT pronuclei was detected after ActD
treatment. This result suggests that NuMA assembles as a result of
translation from maternal mRNA and of de novo transcription. As
lamin A/C and NuMA are abnormally transcribed in NT pronuclei,
these proteins can be used as markers to determine the ability of
nuclear transfer methods to reprogram the donor genetic
material.
[0281] As discussed above, the intranuclear anchoring properties of
AKAP95, a structural multivalent protein of the nuclear
matrix-chromatin interface (Collas et al., J. Cell Biol.
147:1167-1179, 1999) and enriched in hypoacetylated chromatin, can
also be used as a marker for reprogramming of donor genetic
material. AKAP95 was the only marker investigated that was detected
in somatic donor nuclei on PCC chromosomes and in NT pronuclei with
a labeling intensity similar to that of parthenotes and PN embryos.
AKAP95 association with NT pronuclei was maintained by inhibition
of protein or RNA synthesis. Thus, a major fraction of PN AKAP95 in
NT embryos is of somatic origin. AKAP95 anchoring was examined by
extraction of NT embryos, parthenotes, and donor fibroblasts with
0.1% Triton X-100, 1 mg/ml DNAse 1 and 300 mM NaCl. In parthenotes,
90% of AKAP95 and DNA were extracted; however, 35% of AKAP95 in NT
pronuclei resisted extraction. Sensitivity of AKAP95 and DNA to
DNAse I and NaCl resembled that of fibroblast nuclei. Lamin B was
not extracted under these conditions, indicating that differences
in AKAP95 and DNA extractability did not result from gross
alterations in nuclear architecture. These results imply that NT
pronuclei are characterized by tight anchoring of AKAP95 and
restricted DNA accessibility to DNAse I. Thus, pronuclei produced
by somatic NT appear to display structural abnormalities as a
result of incomplete morphological remodeling of donor nuclei
and/or transcriptional misregulation of somatic genes.
EXAMPLE 4
Additional Exemplary Nuclear Reprogramming Deficiencies in
Traditional Bovine Nuclear Transplant Embryos
[0282] As described above, expression patterns in Nuclear
Transplant (NT) embryos were compared to those in in vitro-produced
(IVP) preimplantation embryos. For this comparison, in vitro
fertilization was performed, and embryos were cultured as
previously described (Collas et al., Mol. Reprod. Dev. 34:224-231,
1993 and Kasinathan et al., Biol. Reprod. 64:1487-1493, 2001). NT
was carried out by fusing donor bovine fetal fibroblasts to
enucleated oocytes (Kasinathan et al., Nat. Biotechnol.
19:1176-1178, 2001 and Kasinathan et al., Biol. Reprod.
64:1487-1493, 2001). Recipient oocytes were activated at 28-30
hours post-maturation (hpm) with 5 .mu.M calcium ionophore for 4
minutes followed by 10 .mu.g/ml CHX and 2.5 .mu.g/ml cytochalasin D
for 5 hours and washed. Embryos were co-cultured with mouse fetal
fibroblasts (Kasinathan et al., Biol. Reprod. 64:1487-1493, 2001).
For CHX treatment, oocytes were activated as above and embryos were
cultured with 2.5 .mu.g/ml CHX for another nine hours before
culture. For ActD treatment, oocytes were activated as above except
that 5 .mu.g/ml ActD was added to the five-hour CHX incubation step
and embryos were maintained in 5 .mu.g/ml ActD for another nine
hours prior to culture. NT embryos were cultured to the blastocyst
stage in vitro, and two embryos were transferred per recipient
female. Pregnancies were monitored by ultrasonography, and
C-sections were performed. Calves were scored by veterinarians
within 24 hours of birth.
[0283] For analysis of protein levels in NT and IVP embryos,
anti-lamin B polyclonal antibodies, anti-lamin A/C monoclonal
antibodies, and anti-TBP polyclonal or monoclonal antibodies from
Santa-Cruz Biotechnology were used. Anti-AKAP95 antibodies were
from Upstate Biotechnologies. Immunofluorescence analysis was
performed as described (Bomar et al., J. Cell Sci. 115:2931-2940,
2002). Briefly, cells and embryos were settled onto
poly-L-lysine-coated coverslips, fixed with 3% paraformaldehyde for
15 minutes, permeabilized with 0.1% Triton X-100 for 15 minutes,
and proteins were blocked in PBS/2% BSA/0.01% Tween 20. Samples
were incubated with primary and secondary antibodies (1:100
dilutions) each for 30 minutes. DNA was counterstained with 0.1
.mu.g/ml Hoechst 33342. Photographs were taken with a JVC CCD
camera, and quantification of immunofluorescence intensity
performed using the AnalySIS software. When indicated, samples were
extracted on coverslips with a cocktail of 1% Triton X-100, 1 mg/ml
DNAse I, and 300 mM NaCl in Tris-HCl (pH 7.2) for 15 minutes prior
to immunofluorescence analysis. For immunoblotting, protein samples
(30 .mu.g) were resolved by 10% SDS-PAGE, blotted onto
nitrocellulose, and probed with indicated antibodies.
[0284] Dynamics of the donor nucleus in nuclear transplant embryos
To investigate the dynamics of somatic nuclei during bovine nuclear
transplantation (NT), the distribution of two structural components
of the nuclear envelope, the ubiquitously expressed B-type lamins
(referred to as lamin B) and the differentiated cell-specific
A-type lamins (lamin A/C) was examined (Gruenbaum et al., J.
Struct. Biol. 129:313-323, 2000). Nuclear lamins anchor nuclear
membranes to chromatin and have been suggested to promote nuclear
expansion after (pro)nuclear reconstitution in vitro. Lamins have
also been shown to be essential for cell survival, as failure to
assemble B-type lamins leads to cell death. As a marker of the
transcription machinery, the dynamics of the TATA-binding protein,
TBP, a transcription factor for virtually all genes, was analyzed.
Perinuclear distribution of lamin B and colocalization of TBP with
DNA in bovine fetal fibroblasts and in in vitro-produced (IVP)
preimplantation embryos were consistent with observations in other
species (Holy et al., Dev. Biol. 168:464-478, 1995; Houliston et
al., Development 102:271-278, 1988; and Worrad et al., Development
120:2347-2357, 1994). Lamin A/C was not detected during
preimplantation development as expected from a marker of
differentiated cells. Specificity of immunofluorescence labeling
was verified on immunoblots.
[0285] Following transplantation of fibroblast nuclei into
enucleated oocytes, both lamins A/C and B were disassembled from
the prematurely condensed chromosomes, while TBP remained
associated with the chromosomes. Fourteen hours after initiation of
activation of the recipient oocytes, all NT embryos contained fully
developed pronuclei with perinuclear lamin B labeling and TBP
co-localized with DNA. However, in contrast to IVP embryos, 95-99%
of NT embryos displayed lamin A/C expression as early as the
pronuclear stage, and expression persisted during early development
(see below). Relative amounts of immunolabeled lamin B, lamin A/C,
and TBP in pronuclei of NT and IVP embryos were quantified by
measuring the ratio of secondary antibody fluorescence intensity to
that of DNA (Hoechst 33342) to account for DNA content (haploid vs
diploid) in the nuclei examined. Whereas relative amounts of lamin
B were similar in pronuclei of NT and IVP embryos, relative mounts
of lamin A/C and TBP were higher in NT pronuclei than in male (MPN)
or female (FPN) pronuclei in IVP embryos.
[0286] TBP, DNA, and A-type lamins in pronuclei of NT embryos
Higher amounts of TBP in NT pronuclei was associated with a greater
resistance to in situ extraction with a combination of detergent
(1% Triton X-100), nuclease (1 mg/ml DNAse 1), and salt (0.3 M
NaCl). Quantification of immunofluorescence labeling intensity in
extracted embryos relative to that of non-extracted controls shows
that .about.35% of TBP remained unextracted in male (MPN) or female
(FPN) pronuclei of IVP embryos. However, TBP of NT pronuclei
displayed strong resistance to extraction as in fibroblast nuclei.
Similarly, DNA of NT pronuclei displayed a 4.5-fold increase in
resistance to extraction under these conditions compared to
pronuclei of IVP embryos, suggestive of a more compact chromatin
organization.
[0287] To determine the origin of lamin B, lamin A/C, and TBP in
pronuclei of NT embryos, recipient oocytes were activated in the
presence of the RNA polymerase (Pol) II inhibitor actinomycin D
(ActD; 5 .mu.g/ml) or with the protein synthesis inhibitor
cycloheximide (CHX; 10 .mu.g/ml) (Knott et al., Biol. Reprod.
66:1095-1103, 2002) as described herein. Assembly of lamin A/C,
lamin B, and TBP was examined by densitometric analysis of
immunofluorescently labeled pronuclear embryos. Both inhibitors
prevented pronuclear lamin A/C assembly, suggesting that assembly
of these somatic lamins in NT embryos resulted from transcription
of the lamin A gene at the pronuclear stage. Lamin B assembly was
not perturbed by CHX or ActD treatment, suggesting that lamin B was
assembled from somatic lamins solubilized in the oocyte cytoplasm
after NT and/or from a maternal pool of lamins. Similar amounts of
TBP were detected in untreated embryos or after inhibition of RNA
or protein synthesis. As TBP associates with condensed chromosomes
during PCC, and since the metaphase II oocyte cytoplasm is devoid
of detectable TBP, TBP of somatic origin probably remains
associated with the donor genome during NT. Thus, in addition to
expressing A-type lamins, pronuclei of NT embryos display higher
amounts and enhanced intranuclear anchoring of TBP.
EXAMPLE 5
Use of Reprogrammed Donor Chromatin Masses to Clone Mammals
[0288] To overcome the problem of incomplete reprogramming in
traditional nuclear transfer embryos that was demonstrated above,
new methods were developed to more efficiently reprogram donor
chromatin prior to nuclear transfer (PCT/US01/50406, filed Dec. 21,
2001). These methods involve incubating a nucleus (e.g., a nucleus
that encodes a xenogenous antibody) from a donor cell in a
reprogramming media (e.g., a cell extract) that results in nuclear
envelope dissolution and possibly chromatin condensation. This
nuclear envelope breakdown and chromatin condensation allows the
release of transcription regulatory proteins that were attached to
the chromosomes and that would otherwise promote the transcription
of genes undesirable for oocyte, embryo, or fetus development.
Additionally, regulatory proteins from the reprogramming media may
bind the chromatin mass and promote the transcription of genes
desirable for development.
[0289] To generate an ungulate expressing a xenogenous antibody,
the donor nucleus or chromatin mass can be modified before, during,
or after reprogramming by insertion of one or more nucleic acids
encoding a xenogenous antibody. If desired, a cell from the cloned
fetus or the cloned offspring can be used in a second round of
nuclear transfer to generate additional cloned offspring. Cells
from the initial cloned fetus or cloned offspring may also be
frozen to form a cell line to be used as a source of donor cells
for the generation of additional cloned ungulates.
[0290] Bulk Preparation of Donor Nuclei for Use in Cloning As many
as several million nuclei may be isolated from synchronized or
unsynchronized cell populations in culture. The cell populations
may be synchronized naturally or chemically. Preferably, at least
40, 60, 80, 90, or 100% of the cells in a population are arrested
in G.sub.o or G.sub.1 phase. To accomplish this, cells may be
incubated, for example, in low serum, such as 5%, 2%, or 0% serum,
for 1, 2, 3, or more days to increase the percentage of cells in
G.sub.o phase. To synchronize cells in G.sub.1, the cells may be
grown to confluence as attached cells and then incubated in 0.5-1
.mu.g/ml nocodazole (Sigma Chemicals, St. Louis, Mo.) for 17-20
hours, as described previously (see, for example, Collas et al., J.
Cell Biol. 147:1167-1180, 1999 and references therein). The flasks
containing the attached cells are shaken vigorously by repeatedly
tapping the flasks with one hand, resulting in the detachment of
mitotic cells and G.sub.1 phase doublets. The G.sub.1 phase
doublets are pairs of elongated cells at the end of the division
process that are still connected by a thin bridge. Detached G.sub.1
phase doublets may be isolated from the media based on this
characteristic doublet structure. The G.sub.1 phase doublets may
remain attached or may divide into two separate cells after
isolation.
[0291] The synchronized or unsynchronized cells are harvested in
phosphate buffered saline (PBS) using standard procedures, and
several washing steps are performed to transfer the cells from
their original media into a hypotonic buffer (10 mM HEPES, pH 7.5,
2 mM MgCl.sub.2, 25 mM KCl, 1 mM DTT, 10 .mu.M aprotinin, 10 .mu.M
leupeptin, 10 .mu.M pepstatin A, 10 .mu.M soybean trypsin
inhibitor, and 100 .mu.M PMSF). For example, the cells may be
washed with 50 ml of PBS and pelleted by centrifugation at
500.times.g for 10 minutes at 4.degree. C. The PBS supernatant is
decanted, and the pelleted cells are resuspended in 50 ml of PBS
and centrifuged, as described above. After this centrifugation, the
pelleted cells are resuspended in 20-50 volumes of ice-cold
hypotonic buffer and centrifuged at 500.times.g for 10 min at
4.degree. C. The supernatant is again discarded and approximately
20 volumes of hypotonic buffer are added to the cell pellet. The
cells are carefully resuspended in this buffer and incubated on ice
for at least one hour, resulting in the gradual swelling of the
cells.
[0292] To allow isolation of the nuclei from the cells, the cells
are lysed using standard procedures. For example, 2-5 ml of the
cell suspension may be transferred to a glass homogenizer and
Dounce homogenized using an initial 10-20 strokes of a
tight-fitting pestle. Alternatively, the cell suspension is
homogenized using a motorized mixer (e.g., Ultraturrax). If
desired, cell lysis may be monitored using phase contrast
microscopy at 40-fold magnification. During this homogenization,
the nuclei should remain intact and most or preferably all of the
originally attached cytoplasmic components such as vesicles,
organelles, and proteins should be released from the nuclei. If
necessary, 1-20 .mu.g/ml of the cytoskeletal inhibitors,
cytochalasin B or cytochalasin D, may be added to the
aforementioned hypotonic buffer to facilitate this process.
Homogenization is continued as long as necessary to lyse the cells
and release cytoplasmic components from the nuclei. For some cell
types, as many as 100, 150, or more strokes may be required. The
lysate is then transferred into a 15 ml conical tube on ice, and
the cell lysis procedure is repeated with the remainder of the
suspension of swollen cells. Sucrose from a 2 M stock solution made
in hypotonic buffer is added to the cell lysate (e.g., 1/8 volume
of 2 M stock solution is added to the lysate), resulting in a final
concentration of 250 mM sucrose. This solution is mixed by
inversion, and the nuclei are pelleted by centrifugation at
400.times.g in a swing out rotor for 10 to 40 minutes at 4.degree.
C. The supernatant is then discarded, and the pelleted nuclei are
resuspended in 10-20 volumes of nuclear buffer (10 mM HEPES, pH
7.5, 2 mM MgCl.sub.2, 250 mM sucrose, 25 mM KCl, 1 mM DTT, 10 .mu.M
aprotinin, 10 .mu.M leupeptin, 10 .mu.M pepstatin A, 10 .mu.M
soybean trypsin inhibitor, and 100 .mu.M PMSF). The nuclei are
sedimented and resuspended in 1-2 volumes of nuclear buffer, as
described above. The freshly isolated nuclei may either be used
immediately for in vitro reprogramming and nuclear transfer as
described below or stored for later use. For storage, the nuclei
are diluted in nuclear buffer to a concentration of approximately
10.sup.6/ml. Glycerol (2.4 volumes of 100% glycerol) is added and
mixed well by gentle pipetting. The suspension is aliquoted into
100-500 .mu.l volumes in 1.5-ml tubes on ice, immediately frozen in
a methanol-dry ice bath, and stored at -80.degree. C. Prior to use,
aliquots of the nuclei are thawed on ice or at room temperature.
One volume of ice cold nuclear buffer is added, and the solution is
centrifuged at 1,000.times.g for 15 minutes in a swing out rotor.
The pelleted nuclei are resuspended in 100-500 .mu.l nuclear buffer
and centrifuged as described above. The pelleted nuclei are then
resuspended in a minimal volume of nuclear buffer and stored on ice
until use.
[0293] Preparation of Mitotic Extract or Media for Use in
Reprogramming Donor Genetic Material For the preparation of a
mitotic extract, a somatic cell line (e.g., fibroblasts) is
synchronized in mitosis by incubation in 0.5-1 .mu.g/ml nocodazole
for 17-20 hours (e.g., Collas et al., J. Cell Biol. 147:1167-1180,
1999 and references therein) and the mitotic cells are detached by
vigorous shaking, as described above. The detached G.sub.1 phase
doublets may be discarded, or they may be allowed to remain with
the mitotic cells which constitute the majority off the detached
cells (typically at least 80%). The harvested detached cells are
centrifuged at 500.times.g for 10 minutes in a 10 ml conical tube
at 4.degree. C. Several cell pellets are pooled, resuspended in a
total volume of 50 ml of cold PBS, and centrifuged at 500.times.g
for 10 minutes at 4.degree. C. This PBS washing step is repeated.
The cell pellet is resuspended in approximately 20 volumes of
ice-cold cell lysis buffer (20 mM HEPES, pH 8.2, 5 mM MgCl.sub.2,
10 mM EDTA, 1 mM DTT, 10 .mu.M aprotinin, 10 .mu.M leupeptin, 10
.mu.M pepstatin A, 10 .mu.M soybean trypsin inhibitor, 100 .mu.M
PMSF, and optionally 20 .mu.g/ml cytochalasin B), and the cells are
sedimented by centrifugation at 800.times.g for 10 minutes at
4.degree. C. The supernatant is discarded, and the cell pellet is
carefully resuspended in no more than one volume of cell lysis
buffer. The cells are incubated on ice for one hour to allow
swelling of the cells. The cells are lysed by either sonication
using a tip sonicator or Dounce homogenization using a glass mortar
and pestle. Cell lysis is performed until at least 90% of the cells
and nuclei are lysed, which may be assessed using phase contrast
microscopy. The sonication time required to lyse at least 90% of
the cells and nuclei may vary depending on the type of cell used to
prepare the extract.
[0294] The cell lysate is placed in a 1.5-ml centrifuge tube and
centrifuged at 10,000 to 15,000.times.g for 15 minutes at 4.degree.
C. using a table top centrifuge. The tubes are removed from the
centrifuge and immediately placed on ice. The supernatant is
carefully collected using a 200 .mu.l pipette tip, and the
supernatant from several tubes is pooled and placed on ice. This
supernatant is the "mitotic cytoplasmic" or "MS15" extract. This
cell extract may be aliquoted into 50 .mu.l or 10 .mu.l volumes of
extract per tube on ice, depending on whether the regular or
micromethod for generation of chromatin masses will be used. The
extracts are immediately flash-frozen on liquid nitrogen and stored
at -80.degree. C. until use. Alternatively, the cell extract is
placed in an ultracentrifuge tube on ice (e.g., fitted for an SW55
Ti rotor; Beckman). If necessary, the tube is overlayed with
mineral oil to the top. The extract is centrifuged at
200,000.times.g for three hours at 4.degree. C. to sediment
membrane vesicles contained in the MS15 extract. At the end of
centrifugation, the oil is discarded. The supernatant is carefully
collected, pooled if necessary, and placed in a cold 1.5 ml tube on
ice. This supernatant is referred to as "MS200" or "mitotic
cytosolic" extract. The extract is aliquoted and frozen as
described for the MS15 extract.
[0295] If desired, the extract can be enriched with additional
nuclear factors. For example, nuclei can be purified from cells of
the cell type from which the reprogramming extract is derived or
from cells of any other cell type and lysed by sonication as
described above. The nuclear factors are extracted by a 10-60
minute incubation in nuclear buffer containing NaCl or KCl at a
concentration of 0.15-800 mM under agitation. The lysate is
centrifuged to sediment unextractable components. The supernatant
containing the extracted factors of interest is dialyzed to
eliminate the NaCl or KCl. The dialyzed nuclear extract is
aliquoted and stored frozen. This nuclear extract is added at
various concentrations to the whole cell extract described above
prior to adding the nuclei for reprogramming.
[0296] Mitotic extracts can also be prepared from germ cells, such
as oocytes or male germ cells. For example, metaphase II oocytes
that are naturally arrested at this stage can be harvested, washed,
and lysed as described above for the generation of an oocyte
extract. To prepare a male germ cell extract, germ cells are
isolated from testes obtained from the abattoir by mincing the
organ and by differential centrifugation of the harvested cells on
a sucrose or percoll gradient. Germ cells are separated from
somatic (Leydig and Sertoli) cells, washed by suspension, and
sedimentation in PBS. The cells are then washed once in ice-sold
cell lysis buffer as described above and lysed by sonication. The
lysate is cleared by centrifugation at 15,000.times.g for 15
minutes at 4.degree. C., and the supernatant (i.e., the germ cell
extract) is aliquoted and snap-frozen in liquid nitrogen.
[0297] As an alternative to a cell extract, a reprogramming media
can also be formed by adding one or more naturally-occurring or
recombinant factors (e.g., nucleic acids or proteins such as DNA
methyltransferases, histone deacetylases, histones, protamines,
nuclear lamins, transcription factors, activators, repressors,
chromatin remodeling proteins, growth factors, interleukins,
cytokines, or other hormones) to a solution, such as a buffer.
Preferably, one or more of the factors are specific for oocytes or
stem cells.
[0298] Formation of Condensed Chromatin Masses by Exposure of
Nuclei to a Mitotic Extract or Media An aliquot of MS15 or MS200
extract or the mitotic media is thawed on ice. An ATP-generating
system (0.6 .mu.l) is added to 20 .mu.l of extract or media and
mixed by vortexing. For the preparation of the ATP-generating
system, equal proportions of 100 mM ATP stock, 1 M creatine
phosphate, and 2.5 mg/ml creatine kinase stock solutions
(100.times.) made in H.sub.2O are mixed and stored on ice until
use. After addition of the ATP generating system to the extract,
the final concentrations are 1 mM ATP, 10 mM creatine phosphate,
and 25 .mu.g/ml creatine kinase.
[0299] The nuclei suspension is added to the extract or media at a
concentration of 1 .mu.l nuclei per 10 .mu.l of extract or media,
mixed well by pipetting, and incubated in a 30, 33, 35, 37, or
39.degree. C. water bath. The tube containing the mixture is tapped
gently at regular intervals to prevent chromosomes from clumping at
the bottom of the tube. Nuclear envelope breakdown and chromosome
condensation is monitored at regular intervals, such as every 15
minutes, under a microscope. When the nuclear envelope has broken
down and chromosomes have started to condense, the procedure for
recovery of chromatin masses from the extract or media is
started.
[0300] Formation of Decondensed Chromatin Masses by Exposure of
Nuclei to a Mitotic Extract or Media and Anti-Numa Antibodies
Alternatively, chromatin masses that are not condensed or only
partially condensed may be formed by performing the above procedure
after pre-loading the isolated nuclei with an antibody to the
nuclear matrix protein NuMA (Steen et al., J. Cell Biol. 149,
531-536, 2000). This procedure allows the removal of nuclear
components from chromatin by the dissolution of the nuclear
membrane surrounding the donor nuclei; however, the condensation
step is inhibited by addition of the anti-NuMA antibody. Preventing
chromosome condensation may reduce the risk of chromosome breakage
or loss while the chromosomes are incubated in the mitotic
extract.
[0301] For this procedure, purified cell nuclei (2,000
nuclei/.mu.l) are permeabilized in 500 .mu.l nuclear buffer
containing 0.75 .mu.g/ml lysolecithin for 15 minutes at room
temperature. Excess lysolecithin is quenched by adding 1 ml of 3%
BSA made in nuclear buffer and incubating for 5 minutes on ice. The
nuclei are then sedimented and washed once in nuclear buffer. The
nuclei are resuspended at 2,000 nuclei/.mu.l in 100 .mu.l nuclear
buffer containing an anti-NuMA antibody (1:40 dilution;
Transduction Laboratories). After a one hour incubation on ice with
gentle agitation, the nuclei are sedimented at 500.times.g through
1 M sucrose for 20 minutes. The nuclei are then resuspended in
nuclear buffer and added to a mitotic extract or media containing
an ATP regenerating system, as described in the previous section.
Optionally, the anti-NuMA antibody may be added to the extract or
media to further prevent chromosome condensation.
[0302] Formation of Decondensed Chromatin Masses by Exposure of
Nuclei to a Detergent and/or Salt Solution or to A Protein Kinase
Solution Chromatin masses that are not condensed or only partially
condensed may also be formed by exposure to a detergent or protein
kinase. Detergent may be used to solubilize nuclear components that
are either unbound or loosely bound to the chromosomes in the
nucleus, resulting in the removal of the nuclear envelope. For this
procedure, purified cell nuclei (2,000-10,000 nuclei/.mu.l) are
incubated in nuclear buffer supplemented with a detergent, such as
0.1% to 0.5% Triton X-100 or NP-40. To facilitate removal of the
nuclear envelope, additional salt, such as NaCl, may be added to
the buffer at a concentration of approximately 0.1, 0.15, 0.25,
0.5, 0.75, or 1 M. After a 30-60 minute incubation on ice with
gentle shaking, the nuclei are sedimented by centrifugation at
1,000.times.g in a swing-out rotor for 10-30 minutes, depending on
the total volume. The pelleted nuclei are resuspended in 0.5 to 1
ml nuclear buffer and sedimented as described above. This washing
procedure is repeated twice to ensure complete removal of the
detergent and extra salt.
[0303] Alternatively, the nuclear envelope may be removed using
recombinant or naturally-occurring protein kinases, alone or in
combination. Preferably, the protein kinases are purified using
standard procedures or obtained in purified form from commercial
sources. These kinases may phosphorylate components of the nuclear
membrane, nuclear matrix, or chromatin, resulting in removal of the
nuclear envelope (see, for example, Collas and Courvalin, Trends
Cell Biol. 10: 5-8, 2000). Preferred kinases include
cyclin-dependent kinase 1 (CDK1), protein kinase C (PKC), protein
kinase A (PKA), MAP kinase, calcium/calmodulin-dependent kinase
(CamKII), and CK1 casein kinase, or CK2 casein kinase. For this
method, approximately 20,000 purified nuclei are incubated in 20
.mu.l of phosphorylation buffer at room temperature in a 1.5 ml
centrifuge tube. A preferred phosphorylation buffer for CDK1
(Upstate Biotechnology) contains 200 mM NaCl, 50 mM Tris-HCl (pH
7.2-7.6), 10 mM MgSO.sub.4, 80 mM .beta.-glycerophosphate, 5 mM
EGTA, 100 .mu.M ATP, and 1 mM DTT. For PKC, a preferred buffer
contains 200 mM NaCl, 50 mM Tris-HCl (pH 7.2-7.6), 10 mM
MgSO.sub.4, 100 .mu.M CaCl.sub.2, 40 .mu.g/ml phosphatidylserine,
20 .mu.M diacylglycerol, 100 .mu.M ATP, and 1 mM DTT. If both PKC
and CDK1 are used simultaneously, the CDK1 phosphorylation buffer
supplemented with 40 .mu.g/ml phosphatidylserine and 20 .mu.M
diacylglycerol is used. A preferred phosphorylation buffer for PKA
includes 200 mM NaCl, 10 mM MgSO4, 10 mM Tris, pH 7.0, 1 mM EDTA,
and 100 .mu.M ATP. For MAP kinase, the PKA phosphorylation buffer
supplemented with 10 mM CaCl.sub.2, and 1 mM DTT may be used. For
CamKII, either PKA buffer supplemented with 1 mM DTT or a Cam
Kinase assay kit from Upstate Biotechnology (Venema et al. J. Biol.
Chem. 272: 28187-90, 1997) is used.
[0304] The phosphorylation reaction is initiated by adding a
protein kinase to a final amount of 25-100 ng. The reaction is
incubated at room temperature for up to one hour. Nuclear envelope
breakdown may be monitored by microscopy during this incubation,
such as at 15 minute intervals. After nuclear envelope breakdown,
nuclei are washed three times, as described above for the removal
of the detergent solution.
[0305] Recovery of Chromatin Masses from the Media, Extract,
Detergent and/or Salt Solution, or Protein Kinase Solution The
extract or solution containing the condensed, partially condensed,
or not condensed chromatin masses is placed under an equal volume
of 1 M sucrose solution made in nuclear buffer. The chromatin
masses are sedimented by centrifugation at 1,000.times.g for 10-30
minutes depending on the sample volume in a swing out rotor at
4.degree. C. The supernatant is discarded, and the pelleted
chromatin masses are carefully resuspended by pipetting in 0.1-1.0
ml nuclear buffer or lipofusion buffer (150 mM NaCl, 10 .mu.M
aprotinin, 10 .mu.M leupeptin, 10 .mu.M pepstatin A, 10 .mu.M
soybean trypsin inhibitor, and 100 .mu.M PMSF in either 20 mM HEPES
around pH 7.0 or pH 7.5 or 20 mM MES around pH 6.2) and centrifuged
at 1,000.times.g for 10-30 minutes. The supernatant is discarded,
and the pelleted chromatin masses are resuspended in nuclear buffer
or lipofusion buffer and stored on ice until use. Each chromatin
mass is transferred to a 20 .mu.l drop of HEPES-buffered medium
under oil in a micromanipulation dish. One chromatin mass is
inserted into each enucleated oocyte, as described below.
[0306] Micromethod for Preparation of Chromatin Masses A 10-20
.mu.l drop of MS15 or MS200 extract or mitotic media containing an
ATP generating system, a detergent and/or salt solution, or a
protein kinase solution as described above is placed in a petri
dish. A 50-.mu.l drop of isolated G.sub.1 phase cell doublets or
G.sub.0 phase cells in culture medium, a separate 50 .mu.l "lysis"
drop of HEPES- or bicarbonate-buffered medium containing 0.1%
Triton X-100 or NP-40 for use in facilitating cell lysis, and a
50-.mu.l drop of oocyte injection medium is then added. Each of
these drops is covered with CO.sub.2 equilibrated mineral oil. A 50
.mu.l "wash drop" of culture medium is also added to the petri dish
for use in washing the lysed cells or nuclei.
[0307] Cells are transferred to the lysis drop using a
micropipette. The cell membranes are lysed in the pipette by gentle
repeated aspirations. When the cell is lysed, the lysate is gently
expelled into the wash drop, and the nucleus is immediately
reaspirated to remove detergent. Optionally, the nuclei may be
permeabilized and incubated with anti-NuMA antibodies prior to
being added to the mitotic extract or media. The nucleus is then
expelled into the drop of MS15, MS200, or media, detergent and/or
salt solution, or protein kinase solution. Nuclear breakdown and
chromosome condensation is monitored as described above. Once the
nuclear envelope has broken down and, if a mitotic extract without
anti-NuMA antibodies was used, the chromosomes have started to
condense, a single intact chromatin mass is isolated with a
micropipette and transferred to an enucleated recipient oocyte, as
described below.
[0308] Enucleation of Oocytes Preferably, the recipient oocyte is a
metaphase II stage oocyte. At this stage, the oocyte may be
activated or is already sufficiently activated to treat the
introduced chromatin mass as it does a fertilizing sperm. For
enucleatation of the oocyte, part or preferably all of the DNA in
the oocyte is removed or inactivated. This destruction or removal
of the DNA in the recipient oocyte prevents the genetic material of
the oocyte from contributing to the growth and development of the
cloned mammal. One method for destroying the pronucleus of the
oocyte is exposure to ultraviolet light (Gurdon, in Methods in Cell
Biology, Xenopus Laevis:--Practical Uses in cell and Molecular
Biology, Kay and Peng, eds., Academic Press, California, volume
36:pages 299-309, 1991). Alternatively, the oocyte pronucleus may
be surgically removed by any standard technique (see, for example,
McGrath and Solter, Science 220:1300-1319, 1983). In one possible
method, a needle is placed into the oocyte, and the nucleus is
aspirated into the inner space of the needle. The needle may then
be removed from the oocyte without rupturing the plasma membrane
(U.S. Pat. Nos. 4,994,384 and 5,057,420).
[0309] Lipofusion for Insertion of Chromatin Masses into Oocytes
Chromatin may be introduced into recipient oocytes by lipofusion as
described below or by standard microinjection or electrofusion
techniques (see, for example, U.S. Pat. Nos. 4,994,384 and
5,945,577). The following lipofusion method may also be used in
other applications to insert chromosomes into other recipient
cells.
[0310] Chromatin masses are isolated from the mitotic extract,
detergent and/or salt solution, or protein kinase solution by
centrifugation, and then washed with lipofusion buffer, as
described above. The chromatin masses may be in stored in ice-cold
lipofusion buffer until use. Alternatively, the chromatin masses
are aliquoted, frozen in liquid nitrogen or in a methanol-dry ice
bath, and stored frozen at -80.degree. C. The lipofusion solution
is prepared by mixing one or more fusogenic reagents with the
lipofusion buffer in respective proportions ranging from 5:1 to
1:10 approximately. The fusogenic reagents consist of, but are not
limited to, polyethylene glycol (PEG) and lipophilic compounds such
as Lipofectin.RTM., Lipofectamin.RTM., DOTAP.RTM.
{N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylamonium
methylsulfate; C.sub.43H.sub.83NO.sub.8S}, DOSPA.RTM.
{2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanamin-
ium trifluoroacetate}, and DOPE.RTM. (dioleoyl
phosphatidylethanolamine).
[0311] Other preferred lipids include neutral and monovalent or
multivalent cationic lipids, such as those containing quaternary
ammonium groups. Additional preferred lipids have a cholesterol
moiety such as that formed from the reaction of the hydroxyl group
in cholesterol with a group in the lipid. Still other preferred
lipids have a saturated or unsaturated fatty acid that preferably
contains between 5 and 10, 10 and 15, 15 and 20, or 20 and 30
carbon atoms, inclusive. These lipids may be synthesized using
standard chemical synthesis techniques, obtained from
naturally-occurring sources, or purchased from commercially
available source (Summers et al., Biophys J. 71(6):3199-206, 1996;
Nabekura et al., Pharm Res. 13(7): 1069-72, 1996; Walter et al.,
Biophys J. 66(2 Pt 1):366-376, 1994; Yang et al., Biosci Rep.
13(3):143-157, 1993; Walter and Siegel, Biochemistry.
6:32(13):3271-3281, 1993). Other preferred fusogenic compounds are
phospholipids such as membrane vesicle fractions from sea urchin
eggs or any other source (Collas and Poccia, J. of Cell Science
109, 1275:1283, 1996). Preferably, contacting chromosomes with the
membrane vesicle fraction does not result in the chromosomes being
encapsulated by an intact membrane.
[0312] For example, a cationic lipid, such as DOTAP.RTM., may be
used at a concentration of approximately 0.1 to 30 .mu.g/ml in
lipofusion buffer. Alternatively, a liposome formulation consisting
of a mixture of a cationic lipid and a neutral lipid, such as
DOPE.RTM., may be used.
[0313] The chromatin masses, either freshly prepared or frozen and
thawed, are mixed with the lipofusion solution to allow coating of
the chromatin masses with the compound. Incubation takes place at a
temperature of 20-30.degree. C. for a period of approximately 10-30
minutes. Microdrops containing the chromatin masses in the
lipofusion solution are placed under CO.sub.2 equilibrated mineral
oil. A drop containing the enucleated recipient oocytes is also
prepared. The chromatin masses coated with the lipofusion reagent
are picked up in a micropipette and inserted in the perivitellin
space, between the oocyte cytoplasm and the zona pellucida. The
chromatin mass is placed next to the oocyte membrane to ensure
contact with the oocyte. The chromatin mass-oocyte complexes are
maintained at a temperature of 20-30.degree. C., and fusion is
monitored under the microscope. Once fusion has occurred,
reconstituted oocytes are activated as described below.
[0314] Activation Culturing and Transplantation of Reconstituted
Oocytes To prevent polar body extrusion and chromosome loss, the
oocyte may be activated in the presence of cytochalasin B, or
cytochalasin B may be added immediately after activation (Wakayama
et al., PNAS 96:14984-14989, 1999; Wakayama et al., Nature Genetics
24:108-109, 2000). Either electrical or non-electrical means may be
used for activating reconstituted oocytes. Electrical techniques
for activating cells are well known in the art (see, for example,
U.S. Pat. Nos. 4,994,384 and 5,057,420). Non-electrical means for
activating cells may include any method known in the art that
increases the probability of cell division. Examples of
non-electrical means for activating an oocyte include incubating
the oocyte in the presence of ethanol; inositol trisphosphate;
Ca.sup.++ ionophore and a protein kinase inhibitors; a protein
synthesis inhibitor; phorbol esters; thapsigargin, or any component
of sperm. Other non-electrical methods for activation include
subjecting the oocyte to cold shock or mechanical stress.
Alternatively, one to three hours after nuclear transfer, oocytes
may be incubated for approximately six hours in medium containing
Sr.sup.2+ to activate them and cytochalasin B to prevent
cytokinesis and polar body extrusion (Wakayama et al., PNAS
96:14984-14989, 1999; Wakayama et al., Nature Genetics 24:108-109,
2000). Depending on the type of mammal cloned, the preferred length
of activation may vary. For example, in domestic animals such as
cattle, the oocyte activation period generally ranges from about
16-52 hours or preferably about 28-42 hours.
[0315] After activation, the oocyte is placed in culture medium for
an appropriate amount of time to allow development of the resulting
embryo. At the two cell stage or a later stage, the embryo is
transferred into a foster recipient female for development to term.
For bovine species, the embryos are typically cultured to the
blastocyst stage (e.g., for approximately 6-8 days) before being
transferred to maternal hosts. For other cloned animals, an
appropriate length for in vitro culturing is known by one skilled
in the art or may be determined by routine experimentation.
[0316] Methods for implanting embryos into the uterus of a mammal
are also well known in the art. Preferably, the developmental stage
of the embryo is correlated with the estrus cycle of the host
mammal. Once the embryo is placed in the uterus of the mammal, the
embryo may develop to term. Alternatively, the embryo is allowed to
develop in the uterus until a chosen time, and then the embryo (or
fetus) is removed using standard surgical methods to determine its
health and viability. Embryos from one species may be placed into
the uterine environment of an animal from another species. For
example, bovine embryos can develop in the oviducts of sheep (Stice
and Keefer, Biology of Reproduction 48: 715-719, 1993). Any
cross-species relationship between embryo and uterus may be used in
the methods of the invention.
[0317] Lipofusion of Nuclei with Oocytes or Other Recipient Cells
The lipofusion solution is prepared by mixing one or more fusogenic
reagents with lipofusion buffer in respective proportions ranging
from approximately 5:1 to 1:10, as described above. Nuclei, either
freshly prepared or frozen and thawed as described above, are mixed
with the lipofusion solution to allow coating of the nuclei with
the compound. Incubation takes place at a temperature of
20-30.degree. C. for a period of approximately 10-30 minutes.
Microdrops containing nuclei in the lipofusion solution are placed
under CO.sub.2 equilibrated mineral oil. A drop containing the
recipient cell, preferably an enucleated cell, is also prepared.
Enucleated recipient cells are prepared by physically removing the
chromosomes or the nucleus by micromanipulation or by damaging the
genetic material by exposure to UV light, as described above. For
insertion into oocytes, the nuclei coated with the lipofusion
reagent are picked up in a micropipette and inserted in the
perivitellin space, between the oocyte cytoplasm and the zona
pellucida. For insertion into other recipient cells, the coated
nuclei are preferably placed next to the cell membrane to ensure
contact with the cell. The nucleus-cell complexes are maintained at
a temperature of 20-30.degree. C., and fusion is monitored using a
microscope. Once fusion has occurred, reconstituted oocytes are
activated as described above.
EXAMPLE 6
Use of Reprogrammed Permeabilized Cells to Clone Mammals
[0318] Cells may also be reprogrammed without requiring the
isolation of nuclei or chromatin masses from the cells. In this
method, cells are permeabilized and then incubated in an interphase
or mitotic reprogramming media under conditions that allow the
exchange of factors between the media (e.g., a cell extract) and
the cells. If an interphase media is used, the nuclei in the cells
remain membrane-bounded; if a mitotic media is used, nuclear
envelope breakdown and chromatin condensation may occur. After the
nuclei are reprogrammed by incubation in this media, the plasma
membrane is preferably resealed, forming an intact reprogrammed
cell that contains desired factors from the media. If desired, the
media can be enriched with additional nuclear factors as described
herein. The reprogrammed cells are then fused with recipient
oocytes, and embryos formed from the reconstituted oocytes are
inserted into maternal recipient mammals for the generation of
cloned mammals. For the production of an ungulate expressing a
xenogenous antibody, the donor cells are modified before, during,
or after programming by the insertion of a nucleic acid encoding a
xenogenous antibody. If desired, a cell from the cloned fetus or
the cloned offspring can be used in a second round of nuclear
transfer to generate additional cloned offspring. Cells from the
initial cloned fetus or cloned offspring may also be frozen to form
a cell line to be used as a source of donor cells for the
generation of additional cloned ungulates.
[0319] Permeabilization of Cells Cells that may be reprogrammed
using this procedure include unsynchronized cells and cells
synchronized in G.sub.o, G.sub.1, S, G.sub.2, or M phase or a
combination of these phases. The cells are permeabilized using any
standard procedure, such as permeabilization with digitonin or
Streptolysin O. Briefly, cells are harvested using standard
procedures and washed with PBS. For digitonin permeabilization,
cells are resuspended in culture medium containing digitonin at a
concentration of approximately 0.001-0.1% and incubated on ice for
10 minutes. For permeabilization with Streptolysin O, cells are
incubated in Streptolysin O solution (see, for example, Maghazachi
et al., FASEB J. 11:765-74, 1997, and references therein) for
.about.15, 30, or 60 minutes at room temperature. After either
incubation, the cells are washed by centrifugation at 400.times.g
for 10 minutes. This washing step is repeated twice by resuspension
and sedimentation in PBS. Cells are kept in PBS at room temperature
until use. Preferably, the permeabilized cells are immediately
added to the interphase or mitotic media for reprogramming, as
described below.
[0320] Preparation of the Reprogramming Media To Prepare an
Interphase reprogramming extract, interphase cultured cells are
harvested using standard methods and washed by centrifugation at
500.times.g for 10 minutes in a 10 ml conical tube at 4.degree. C.
The supernatant is discarded, and the cell pellet is resuspended in
a total volume of 50 ml of cold PBS. The cells are centrifuged at
500.times.g for 10 minutes at 4.degree. C. This washing step is
repeated, and the cell pellet is resuspended in approximately 20
volumes of ice-cold interphase cell lysis buffer (20 mM HEPES, pH
8.2, 5 mM MgCl.sub.2, 1 mM DTT, 10 .mu.M aprotinin, 10 .mu.M
leupeptin, 10 .mu.M pepstatin A, 10 .mu.M soybean trypsin
inhibitor, 100 .mu.M PMSF, and optionally 20 .mu.g/ml cytochalasin
B). The cells are sedimented by centrifugation at 800.times.g for
10 minutes at 4.degree. C. The supernatant is discarded, and the
cell pellet is carefully resuspended in no more than one volume of
interphase cell lysis buffer. The cells are incubated on ice for
one hour to allow swelling of the cells. The cells are lysed by
either sonication using a tip sonicator or Dounce homogenization
using a glass mortar and pestle. Cell lysis is performed until at
least 90% of the cells and nuclei are lysed, which may be assessed
using phase contrast microscopy. The sonication time required to
lyse at least 90% of the cells and nuclei may vary depending on the
type of cell used to prepare the extract.
[0321] The cell lysate is placed in a 1.5-ml centrifuge tube and
centrifuged at 10,000 to 15,000.times.g for 15 minutes at 4.degree.
C. using a table top centrifuge. The tubes are removed from the
centrifuge and immediately placed on ice. The supernatant is
carefully collected using a 200 .mu.l pipette tip, and the
supernatant from several tubes is pooled and placed on ice. This
supernatant is the "interphase cytoplasmic" or "IS15" extract. This
cell extract may be aliquoted into 20 .mu.l volumes of extract per
tube on ice and immediately flash-frozen on liquid nitrogen and
stored at -80.degree. C. until use. Alternatively, the cell extract
is placed in an ultracentrifuge tube on ice (e.g., fitted for an
SW55 Ti rotor; Beckman). If necessary, the tube is overlayed with
mineral oil to the top. The extract is centrifuged at
200,000.times.g for three hours at 4.degree. C. to sediment
membrane vesicles contained in the IS15 extract. At the end of
centrifugation, the oil is discarded. The supernatant is carefully
collected, pooled if necessary, and placed in a cold 1.5 ml tube on
ice. This supernatant is referred to as "IS200" or "interphase
cytosolic" extract. The extract is aliquoted and frozen as
described for the IS15 extract.
[0322] If desired, the extract can be enriched with additional
nuclear factors. For example, nuclei can be purified from cells of
the cell type from which the reprogramming extract is derived or
from cells of any other cell type and lysed by sonication as
described above. The nuclear factors are extracted by a 10-60
minute incubation in nuclear buffer containing NaCl or KCl at a
concentration of 0.15-800 mM under agitation. The lysate is
centrifuged to sediment unextractable components. The supernatant
containing the extracted factors of interest is dialyzed to
eliminate the NaCl or KCl. The dialyzed nuclear extract is
aliquoted and stored frozen. This nuclear extract is added at
various concentrations to the whole cell extract described above
prior to adding the cells for reprogramming.
[0323] Interphase extracts can also be prepared from germ cells,
such as oocytes or male germ cells. For example, oocytes are
activated as described above and cultured for five hours to allow
entry into interphase. Oocytes are then treated as described herein
for metaphase II oocyte extracts except that EDTA is omitted from
the lysis buffer. Male germ cell extracts can be prepared as
described herein.
[0324] As an alternative to a cell extract, a reprogramming media
can also be formed by adding one or more naturally-occurring or
recombinant factors (e.g., nucleic acids or proteins such as DNA
methyltransferases, histone deacetylases, histones, protamines,
nuclear lamins, transcription factors, activators, repressors,
chromatin remodeling proteins, growth factors, interleukins,
cytokines, or other hormones) to a solution, such as a buffer.
Preferably, one or more of the factors are specific for oocytes or
stem cells.
[0325] Reprogramming of Cells in a Media The permeabilized cells
are suspended in an interphase reprogramming media described above
or one of the mitotic reprogramming medias described herein at a
concentration of approximately 100-1,000 cells/.mu.l. The ATP
generating system and GTP are added to the extract as described
above, and the reaction is incubated at 30-37.degree. C. for up to
two hours to promote translocation of factors from the extract into
the cell and active nuclear uptake or chromosome-binding of
factors. The reprogrammed cells are centrifuged at 800.times.g,
washed by resuspension, and centrifuged at 400.times.g in PBS. If
desired, the cells are resuspended in culture medium containing
20-30% fetal calf serum (FCS), RPMI1640 containing 2 mM CaCl.sub.2
(added from a 1 M stock in H.sub.2O), or in .alpha.-MEM medium
containing 2 mM CaCl.sub.2 and incubated for 1-3 hours at
37.degree. C. in a regular cell culture incubator to allow
resealing of the cell membrane. The cells are then washed in
regular warm culture medium (10% FCS) and cultured further using
standard culturing conditions. Alternatively, the reprogrammed
permeabilized cells may be used for genetic transfer to oocytes
without resealing the cell membrane.
[0326] Alternative Method of Reprogramming Permeabilized Cells on
Coverslips Instead of in Solution Alternatively, the cells can be
permeabilized while placed on coverslips to minimize the handling
of the cells and to eliminate the centrifugation of the cells,
thereby maximizing the viability of the cells. Cells (e.g.,
fibroblasts) are grown on 16-mm poly-L-lysine-coated coverslips in
RPMI1640 to 50,000-100,000 cells/coverslip in 12-well plates. Cells
are permeabilized in 200 ng/ml Streptolysin O in Ca.sup.2+-free
Hanks Balanced Salt Solution (Gibco-BRL) for 50 minutes at
37.degree. C. in regular atmosphere. If desired, the percent of
cells that are permeabilized under these conditions can be measured
based on propidium iodide uptake. Streptolysin O is aspirated;
coverslips are overlaid with 80-100 .mu.l of reprogramming media;
and the cells are incubated for thirty minutes to one hour at
37.degree. C. in CO.sub.2 atmosphere. The reprogramming media
preferably contains the ATP generating system and 1 mM each of ATP,
CTP, GTP and UTP. To optionally reseal plasma membranes,
.alpha.-MEM medium containing 2 mM CaCl.sub.2, medium containing
20-30% fetal calf serum, or RPMI1640 containing 2 mM CaCl.sub.2 is
added to the wells, and the cells are incubated for two hours at
37.degree. C. Alternatively, the plasma membrane is not
resealed.
[0327] Effect of Various Streptolysin O Treatments on the
Percentage of Permeabilized and Resealed Cells To assess the
percent of permeabilized and resealed cells, dose and time
titrations of Streptolysin O incubation were performed (Table 5).
Permeabilization of cells was assessed by uptake of 0.1 .mu.g/ml of
the DNA stain propidium iodide at the end of Streptolysin O
treatment. Resealing was assessed similarly at the end of the
resealing treatment in a separate group of cells. TABLE-US-00006
TABLE 5 Permeabilization and resealing of Streptolysin O
(SLO)-treated bovine fibroblasts Permeabilization Resealing ng/ml
SLO N % pemeabilized +/- sd N % Resealed +/- sd 0 563 1 +/- 2.8 560
89.9 +/- 4.9 100 404 48.6 +/- 4.2 810 86.1 +/- 8.3 200 548 79.2 +/-
1.4 478 84.9 +/- 1.5 500 495 88.7 +/- 1.6 526 87.6 +/- 0.5 1000 425
84.9 +/- 0.7 544 86.4 +/- 1.4 2000 315 96.6 +/- 2.2 425 10.7 +/- 1
4000 200 99 +/- 1.4 200 11.2 +/- 5.3
[0328] Assessment of Viability of Bovine Fibroblasts Permeabilized
with Streptolysin O Treatment and Exposed to Mitotic Extract TUNEL
analysis was performed to evaluate apoptosis in cells permeabilized
with 0 or 500 ng/ml Streptolysin O and resealed, or in cells
permeabilized with Streptolysin O, exposed to mitotic extract for
30 or 60 minutes, and resealed. TUNEL-positive cells are cells
undergoing apoptosis (i.e., cell death). The data show that
Streptolysin O itself does not induce apoptosis (Table 6). Exposure
of Streptolysin O-treated cells to the mitotic extract for 60
minutes, but not 30 minutes, induces a 10% increase in apoptotic
rate, based on TUNEL analysis (Table 6). Based on these data, a
30-minute incubation of donor cells in the extract is more
preferable than a 60 minute incubation. Thirty minute incubations
were shown by immunofluorescence analysis of cells to induce
nuclear envelope breakdown in the majority of nuclei examined
(.about.90%, n>100).
[0329] Additionally, purified nuclei incubated in extract and
washed in either buffer N or TL-HEPES and sucrose as described
herein for the chromatin transfer method do not undergo apoptosis
(2/34 and 3/47 TUNEL positive, respectively). TABLE-US-00007 TABLE
6 TUNEL analysis of Streptolysin O and Streptolysin O plus
extract-treated bovine fibroblasts ng/ml SLO N % TUNEL pos. +/- sd
0-Input cells 400 7.7 +/- 1.7 0 800 6.5 +/- 0.17 500 892 7.3 +/-
3.41 0 + extract 30' 400 5.5 +/- 1.12 500 + extract 30' 400 8.2 +/-
1.1 0 + extract 60' 784 6.5 +/- 4.0 500 + extract 60' 691 16.9 +/-
1.9
The permeabilization method chosen for these cloning methods was
500 ng/ml SLO for 30 minutes at 38.degree. C. The resealing method
chosen for forming an intact membrane surrounding the reprogrammed
cells was a two hour incubation in .alpha.-MEM medium containing 2
mM CaCl.sub.2.
[0330] Alternatively Cell Permeabilized Method using a Protease
such as Trypsin In an exemplary cell permeabilization method using
a protease, cells (e.g., fibroblasts) are grown to confluency in a
35 mm plate overnight. The fibroblasts are removed from the plate
using the normal trypsin-EDTA (0.5%-5.3 mM) procedure for five
minutes. The fibroblasts are washed in PBS and then resuspended in
1 ml TL Hepes. One ml of 3 mg/ml protease in TL Hepes is added to 1
ml of cell suspension (final protease concentration is 1.5 mg/ml)
and incubated at room temperature for one minute. The cells are
washed in 10 ml HBSS and resuspended in 1 ml HBSS and counted.
Approximately 10.sup.5 cells in minimal volume are used for mitotic
extract incubation. Forty ul of MS-15 mitotic extract is placed on
the cells for 30 minutes at 37.degree. C. Cells are then washed in
TL Hepes and used in one of the nuclear transfer procedures
described herein.
[0331] These cells show signs of permeabilization because after
incubation in the mitotic extract, 70-80% of the cells have
undergone nuclear envelope breakdown and premature chromosome
condensation, indicating that MPF (maturation promoting factor)
from the extract or some component of MPF has traversed the
membrane. This cell permeabilization method can be used with a
variety of proteases such as trypsin and with a variety of germ,
somatic, embryonic, fetal, adult, differentiated, and
undifferentiated cells.
[0332] Formation Activation, Culturing, and Transplantation of
Reconstituted Oocytes The reprogrammed cells are inserted into, or
fused with, recipient oocytes using standard microinjection or
electrofusion techniques (see, for example, U.S. Pat. Nos.
4,994,384 and 5,945,577). For example, the cells can be placed next
to the oocytes in standard cell medium in the presence or absence
of sucrose (e.g., 2.5% sucrose), and the cells can be drawn into an
injection pipette. The pipette is then aspirated a few times to
lyse the cells and remove cytoplasmic components from the nucleus
which is then injected into the oocyte. The reconstituted oocytes
are then activated, cultured, and transplanted into maternal
recipient mammals using standard methods such as those described
herein to produce cloned mammals.
EXAMPLE 7
Evidence for More Complete Nuclear Reprogramming Using Two Novel
Cloning Procedures: Chromatin Transfer (CT) and Streptolysin
O-Transfer (SLOT)
[0333] As illustrated above, incomplete nuclear remodeling and
reprogramming occurs in traditional nuclear transplant pronuclear
stage embryos. This finding was demonstrated by the assembly of
lamins A/C in the nuclear envelope of pronuclear nuclear transplant
embryos and excess NuMA immunofluorescence labeling. More complete
nuclear reprogramming was achieved using the chromatin mass
transfer method and the cell permeabilization and reprogramming
method (also referred to as SLOT) described herein.
[0334] In particular, the cloning methods of the present invention
produced embryos with protein expression patterns that more closely
resembled in vitro fertilized embryos than cloned embryos produced
using traditional cloning methods. As described herein, chromatin
transfer embryos expressed much less lamin A/C protein than
traditional nuclear transfer embryos. Lamins A/C are
somatic-specific components of the nuclear lamina that are
naturally expressed in differentiated cells, but not expressed in
embryos. Because of the reported interaction of lamins with
transcription factors, chromatin proteins, and DNA, it is likely
that the expression of lamins A/C in traditional nuclear transfer
embryos promotes the expression of proteins specific for somatic
cells that are undesirable for embryo development. Thus, the
chromatin transfer embryos of the present invention may express
fewer undesirable somatic-specific proteins than traditional
nuclear transfer embryos. Additionally, the chromatin transfer
embryos had expression patterns for NuMA, a main component of the
nuclear matrix that is implicated in transcriptional regulation,
that more closely resembled in vitro fertilized embryos than
traditional nuclear transplant embryos. This result also indicates
that chromatin transfer embryos are more efficiently reprogrammed
than traditional nuclear transplant embryos.
[0335] Assessment of In Vitro Nuclear Breakdown of Bovine
Fibroblast Nuclei Incubated in a Mitotic Extract and
Characterization of the Resulting Chromatin Masses Extracts
prepared from mitotic bovine fibroblasts consistently supported
breakdown of .about.80% of input purified fibroblast nuclei (FIG.
33). An extract from metaphase II oocytes (i.e., an extract from
oocytes naturally arrested in metaphase II prior to fertilization)
also successfully supported nuclear breakdown (75% of nuclei within
30 minutes).
[0336] Input interphase nuclei (FIG. 34A), chromatin masses
obtained from nuclei incubated in a MS15 mitotic extract (FIG.
34B), and chromatin masses obtained from nuclei incubated in an
oocyte extract (FIG. 34C) were examined for the expression of the
following markers: lamin B receptor (LBR), an integral protein of
the inner nuclear membrane (membrane marker); lamin B, a ubiquitous
component of the nuclear lamina; lamins A/C, a somatic-specific
component of the nuclear lamina present only in differentiated
cells and absent in embryos; NuMA, a main component of the nuclear
matrix; AKAP95, a PKA-anchoring protein of the nucleus; and DNA.
Both somatic cytosolic MS15 and oocyte MS15 extracts induced
solubilization of lamin B, lamins A/C, LBR, and NuMA in .about.100%
of chromatin units examined (FIGS. 34B and 34C). As expected,
AKAP95 remained associated with chromosomes, as observed previously
in mitotic human cells (Collas et al., J. Cell Biol. 147:1167-1180,
1999). This result was also described herein for bovine nuclear
transplant embryos at the premature chromatin condensation stage.
Both the mitotic extract and the oocyte extract appeared to be as
efficient as intact oocytes in promoting nuclear envelope
solubilization, regardless of the method used, i.e., traditional
nuclear transplant, nuclear injection (NI), or chromatin transfer
(FIG. 35).
[0337] Comparison of Pronuclear Embryos Produced by Chromatin
Transfer and Pronuclei from Nuclear Transplant and Nuclear
Injection Embryos To generate chromatin transfer embryos, in
vitro-matured oocytes were enucleated about 18-20 hours post
maturation. Nuclei from interphase bovine fetal fibroblasts were
incubated in a MS15 mitotic extract that was prepared from bovine
fetal cells as described herein. Chromatin masses were isolated
from the extract when after nuclear envelope breakdown had occurred
and before chromatin condensation was completed. In particular, the
chromatin masses were isolated when the chromatin was approximately
50-60% condensed, compared to the level of condensation of
chromosomes in interphase (designated 0% condensed) and the maximum
level of condensation of chromosomes in mitosis (designated 100%
condensed.) At this stage, individual chromosomes in the chromatin
mass could not be distinguished and the edges of the chromatin mass
had an irregular shape. Chromatin masses that had been isolated
from the mitotic extract were placed in a microdrop of TL HEPES
with 2.5% sucrose along with enucleated oocytes. The sucrose was
added to the buffer to minimize damage to the oocytes from the
subsequent injection procedure. Chromatin masses were injected into
the oocytes using a beveled microinjection pipette using a Burleigh
Piezo Drill (Fishers, N.Y.) (frequency 2 Hz for 75 microseconds at
an amplitude of 70 V). Typically multiple pulses, such as 2, 3, 4,
or 5 pulses, were performed so that the needle sufficiently
penetrated the oocyte for injection. After injection, oocytes were
washed in serial dilutions of TL HEPES in sucrose to minimize
osmotic shock. At 28-30 hours post maturation (i.e., 28-30 hours
after oocytes were placed in maturation medium after collection
from ovaries, which is also at least two hours after injection of
chromatin masses), reconstructed oocytes and controls for
parthenogenetic development were activated with calcium ionophore
(5 .mu.M) for four minutes (Cal Biochem, San Diego, Calif.) and 10
.mu.g/ml cycloheximide and 2.5 .mu.g/ml cytochalasin D (Sigma) in
ACM culture medium [100 mM NaCl, 3 mM KCl, 0.27 mM CaCl.sub.2, 25
mM NaHCO.sub.3, 1 mM sodium lactate, 0.4 mM pyruvate, 1 mM
L-glutamine, 3 mg/ml BSA (fatty acid free), 1% BME amino acids, and
1% MEM nonessential amino acids (Sigma)], for five hours as
described earlier (Liu et al., Mol. Reprod. Dev. 49:298-307, 1998).
After activation, eggs were washed five times and placed in culture
in four-well tissue culture plates containing mouse fetal
fibroblasts and 0.5 ml of embryo culture medium covered with 0.3 ml
of embryo tested mineral oil (Sigma). Between 25 and 50 embryos
were placed in each well and incubated at 38.5.degree. C. in a 5%
CO.sub.2 air atmosphere. If desired, calcium (e.g., .about.0.5,
1.0, 1.5, 2.0, 2.5, 3, 3.5, 5 mM, or more CaCl.sub.2) can be added
to the culture medium for .about.0.5, 1.0, 1.5, 2.0, 2.5, 3.0, or
more hours to promote resealing of the oocyte after injection. The
resealed oocytes are likely to have increased survival rates due to
the intact layer surrounding the oocytes when they are implanted
into the recipient mammal using the standard methods described
herein.
[0338] Nuclear injection embryos were formed as described above for
chromatin transfer embryos, except that interphase bovine fetal
fibroblasts nuclei that had not been incubated in an extract were
injected into the oocytes instead of chromatin masses. Nuclear
transplant embryos were generated using the conventional methods
described herein.
[0339] Nuclear transplant, nuclear injection, and chromatin
transfer pronuclei reassemble lamin B (FIG. 36A, red label) and
AKAP95 (FIG. 36B, red label) as anticipated. Nuclear transplant and
nuclear injection pronuclei also reassemble lamins A/C, a
somatic-specific component (FIG. 36A, green label), consistent with
the results reported above for nuclear transplant embryos. However,
chromatin transfer pronuclei and control parthenote pronuclei do
not reassemble lamins A/C (FIG. 36A). Nuclear transplant pronuclei
also contain NuMA (green label), unlike most chromatin transfer or
parthenote pronuclei (FIG. 36B, green label). A proportion of
parthenote nuclei and chromatin transfer nuclei assemble a low
level of NuMA, as reported above.
[0340] In vitro disassembly of nuclei followed by chromatin
transfer results in pronuclei that are morphologically similar to
control parthenote pronuclei. In contrast, nuclear transplant and
nuclear injection pronuclei harbor somatic-specific components
(lamins A/C and extensive NuMA labeling). This result is indicative
of incomplete nuclear remodeling after traditional nuclear
transplant or nuclear injection procedures. As described above,
lamins A/C detected in nuclear transplant and nuclear injection
pronuclei originate from lamins transcribed de novo at the
pronuclear stage. Because nuclear lamins and possibly NuMA are
implicated in transcription regulation and disease in humans,
persistence of lamins A/C in conventional nuclear transplant
pronuclei might be indicative of improper functional reprogramming.
We conclude that in vitro nuclear disassembly and chromatin
transfer produces more normal pronuclei than traditional nuclear
transplant or nuclear injection.
[0341] Cloning Efficiency using Reprogrammed Chromatin Masses or
Permeabilized Cells as Donor Source As described herein, a novel
cloning procedure denoted "SLOT" was developed that involves
Streptolysin O (SLO)-induced permeabilization of primary fetal
bovine fibroblasts, exposure of permeabilized cells to a
reprogramming media (e.g., a mitotic extract) for 30 minutes,
optionally resealing of the fibroblasts with 2 mM calcium in
culture, and transfer of the chromatin into oocytes using standard
cell fusion methods.
[0342] For this cloning method, a vial of Streptolysin O (Sigma
S-5265; 25,000 units stored in store powder form at 4.degree. C.)
was dissolved in 400 .mu.l H.sub.2O and mixed well. All contents
were transferred to a 15-ml conical tube, and then 3.6 ml H.sub.2O
was added and mixed by vortexing. Aliquots of 10 .mu.l were frozen
at -20.degree. C. at a stock concentration of 0.062 U/.mu.l. Cells
(.about.100,000) were suspended in 100 .mu.l HBSS (Gibco BRL, cat.
No. 14170-120) at room temperature. These cells were confluent, and
thus .about.80-85% of the cells were in G1 phase, and the majority
of the other cells were in S phase. Streptolysin O stock solution
(5 .mu.l) (i.e., 500 ng/ml or 0.3 U/.mu.l final concentration) was
added, and the mixture was incubated at 38.degree. C. for 25
minutes in a water bath. The tube was gently tapped 2-3 times
during incubation to ensure that the cells remained in suspension.
Room temperature PBS (200 .mu.l) was added and mixed well by gentle
pipetting. The cells were centrifuged cells at 5,000 rpm for five
minutes at room temperature in a table top centrifuge. All the
supernatant was discarded. At this stage, the pellet is small and
may not be clearly visible. Mitotic extract containing the
ATP-generating system (40 .mu.l, "MS15") was added and mixed well.
The extract was prepared during the centrifugation of the cells by
thawing one vial of 40 .mu.l extract and adding 1.2 .mu.l of
ATP-generating system, mixing well, and incubating at room
temperature. This mitotic extract was the same extract used for the
generation of chromatin masses in the section above. The mixture
was incubated at 38.degree. C. in water bath for 30 minutes, and
the tube was occasionally gently tapped. Room temperature resealing
medium (RM, 500 .mu.L) (complete .alpha.-MEM [Bio-Whittaker] medium
supplemented with CaCl.sub.2 to 2 mM from a 1 M stock) was added.
The tube was left open and incubated in a CO.sub.2 incubator for
two hours with occasional tapping of the tube to ensure that the
cells remained in suspension. The cells were centrifuged at 5,000
rpm for five minutes at room temperature in a table top centrifuge.
The cell pellet was resuspended in 100 .mu.l of room temperature TL
HEPES (Bio-Whittaker, cat. No. 04-616F), and another 900 .mu.l TL
HEPES was added. The nuclear transfer was performed using standard
procedures. Oocytes were activated and transferred to recipient
mammals as described in the previous section for chromatin
transfer.
[0343] The development of embryos formed using this SLOT method and
the chromatin transfer method of the present invention is
summarized in Table 7. Development to the blastocyst stage was
slightly lower for SLOT embryos compared to conventional nuclear
transfer embryos. The differences between SLOT and nuclear transfer
development at the blastocyst stage could be due to the effect of
using a greater percentage of cells in the G1 phase of the cell
cycle for nuclear transfer than for SLOT. The survival rate was
lower for chromatin transfer embryos, which is expected for an
invasive procedure.
[0344] Pregnancy rates were comparable for nuclear transfer and
SLOT embryos at 40 days of gestation (Table 7). Survival from 40
days of pregnancy to 60 days tended to be higher for SLOT embryos
than for nuclear transfer embryos produced using conventional
methods. TABLE-US-00008 TABLE 7 Development of chromatin transfer
(CT), nuclear transplant, and SLOT- produced bovine embryo clones
No. No. No. No. Survived No. Survived PN stage No. Cleaved
Blastocysts No. 40 day 40-60 days/total transferred (%) (%) (%) (%)
Preg. (%) (%) CT 1503 736 (49) 355 (23.5) 81 (5.3) 3 0 ND SLOT 1884
1802 (97) ND 575 (30.5) 156 (8.3) 24/65 (37) 7/10 (70) nuclear 1821
1682 (92) ND 764 (41.9) 235 (12.9) 39/103 (36) 8/16 (50)
transplant
[0345] As noted above, the survival rate for chromatin transfer
embryos may be increased by incubating the reconstituted oocytes in
calcium for a few hours to allow the oocytes to reseal prior to be
inserted into recipient mammals. Survival rates for SLOT embryos
may also be increased by reducing the amount of time between when
the cells are taken out of culture and when they are fused with
oocytes. For example, the length of time for the incubation in
Streptolysin O, the incubation in the reprogramming medium, and/or
the incubation in the resealing medium may be decreased. In
particular, the incubation in the resealing medium may be decreased
to approximately one hour or less. This shortened resealing
treatment may be performed in the presence of 2 mM calcium as
described above or in the presence of a higher concentration of
calcium (e.g., .about.2.5, 3.0, 3.5, 4.0, 4.5, 5.0, or 6.0 mM
calcium) to increase the rate of resealing. By reducing the amount
of time the cells are treated prior to being fused with oocytes,
the cells are less likely to enter S phase and begin DNA
replication which reduces the survival rate of the reconstituted
oocyte.
EXAMPLE 8
Evidence for More Complete Nuclear Reprogramming Using Chromatin
Transfer (CT)
[0346] As discussed above, a strategy was developed to enhance
remodeling of donor nuclei, promote repression of somatic genes,
and produce embryos with a pronuclear architecture similar to that
of fertilized zygotes. In a particular example of this general
chromatin transfer method, isolated intact bovine fibroblast nuclei
were incubated in a cytoplasmic extract of mitotic bovine
fibroblasts in the presence of an ATP-generating system, which was
required to drive nuclear disassembly.
[0347] To generate a mitotic reprogramming extract for conversion
of donor nuclei into chromatin masses, fibroblasts were
synchronized in mitosis with 0.5 .mu.g/ml nocodazole for 18 hours,
harvested by mitotic shake-off, and washed twice in ice-cold PBS
and once in ice-cold cell lysis buffer (20 mM Hepes, pH 8.2, 5 mM
MgCl.sub.2, 10 mM EDTA, 1 mM DTT, and protease inhibitors) (Collas
et al., J. Cell Biol. 147:1167-1179, 1999). Packed cells were
resuspended one volume of cell lysis buffer, allowed to swell on
ice for one hour and Dounce-homogenized on ice using a tight
fitting pestle until all cells were lysed. The lysate was
centrifuged at 15,000.times.g for 15 minutes at 4.degree. C., and
the supernatant (mitotic extract) was collected, aliquoted, and
snap-frozen in liquid nitrogen and stored at -80.degree. C.
[0348] To generate donor chromatin, unsynchronized confluent
fibroblasts were harvested, washed, and resuspended in .about.20
volumes of ice-cold hypotonic nuclear isolation buffer (10 mM
Hepes, pH 7.5, 2 mm MgCl.sub.2, 25 mM KCl, 1 mm DTT, and a cocktail
of protease inhibitors) (Collas et al., J. Cell Biol.
147:1167-1179, 1999). After one hour on ice, cells were
Dounce-homogenized with a tight-fitting pestle. Sucrose was added
from a 2 M stock to a concentration of 250 mM and nuclei sedimented
at 400.times.g for 10 minutes at 4.degree. C. Nuclei were washed in
nuclear isolation buffer (same buffer as above but with 250 mM
sucrose) and were either used fresh or frozen in nuclear isolation
buffer/70% glycerol (Collas et al., J. Cell Biol. 147:1167-1179,
1999).
[0349] For reprogramming, isolated fibroblast nuclei were incubated
in 40 .mu.l of mitotic extract containing an ATP-generating system
(1 mM ATP, 10 mM creatine phosphate, and 25 .mu.g/ml creatine
kinase) at 4,000 nuclei/.mu.l for 30 minutes in a 38.degree. C.
H.sub.2O bath. Nuclear envelope breakdown and chromatin
condensation were monitored by phase contrast microscopy. At the
end of incubation, the reaction mix was diluted with 500 .mu.l TL
Hepes containing 2.5% sucrose, and chromatin was recovered by
sedimentation at 2,000.times.g for five minutes. Chromatin masses
were resuspended in TL Hepes/sucrose and transferred to TL
Hepes/sucrose under mineral oil together with enucleated oocytes.
Individual chromatin masses were injected into in vitro-matured
oocytes enucleated at 20 hpm with a beveled microinjection pipette
using a Burleigh Piezo Drill (Fishers, N.Y.) (2 Hz, 2 .mu.s, 70 V).
After injection, oocytes were washed in serial dilutions of sucrose
in TL Hepes to minimize osmotic shock and cultured. At 28 hpm,
reconstructed oocytes and parthenogenetic controls were activated
as described for NT and cultured ((Kasinathan et al., Nat.
Biotechnol. 19:1176-1178, 2001 and Kasinathan et al., Biol. Reprod.
64:1487-1493, 2001). For nuclear injections (NI), purified
fibroblast nuclei were exposed to cell lysis buffer instead of
mitotic extract and injected into enucleated oocytes as for CT.
[0350] As a result of reprogramming, lamin A/C, lamin B, and NuMA
were readily disassembled, while AKAP95 remained associated with
condensed chromosomes. TUNEL analysis showed that no apoptosis
occurred in the extract. Similar nuclear breakdown studies with
human HeLa nuclei and mitotic extracts indicated that condensed
chromatin masses were capable of supporting nuclear reconstitution
(Steen et al., J. Cell Biol. 150:1251-1562, 2000) and transcription
in interphase cytoplasm. Thus, in vitro nuclear disassembly
produces condensed chromatin capable of reforming functional
nuclei. Condensed fibroblast chromatin was recovered by
sedimentation, and individual chromatin masses were injected into
enucleated recipient oocytes. After recovery in culture, oocytes
were activated as described herein for NT oocytes. To control for
artifacts generated by handling of nuclei, intact nuclei exposed to
extract buffer alone were also injected.
[0351] NI produced pronuclei which, like NT pronuclei, contained
lamins A/C and B, NuMA, and AKAP95. CT resulted in PN formation in
over 80% of embryos that survived injection and activation
(.about.50% of oocytes injected, n>2,000). However, CT pronuclei
displayed no detectable lamin A/C and a 3-fold reduction of
anti-NuMA immunolabeling compared to NT and NI pronuclei. This
pattern was similar to that of parthenogenetic pronuclei.
Extractability of AKAP95 and DNA with Triton X-100/DNAse I/NaCl as
described above was enhanced 8-fold in CT pronuclei compared to NT
pronuclei, reflecting a beneficial effect of CT on pronuclear
AKAP95 anchoring and DNAse I accessibility. As chromatin-bound
AKAP95 co-fractionates with primarily transcriptionally repressed
(hypoacetylated) chromatin, this result suggests that CT enhances
formation of euchromatin upon PN assembly.
[0352] The dynamics of the TATA binding protein, TBP, was examined
during fibroblast donor nucleus remodeling by NT and CT procedures
carried out in parallel. TBP facilitates assembly of the general
transcription machinery for virtually all genes (Sharp et al., Cell
68:819-821, 1992). TBP co-localized with AKAP95 and DNA in donor
fibroblast nuclei. PCC chromosomes obtained after NT contained
5-fold more TBP than chromosomes condensed in mitotic extract, as
shown by TBP/AKAP95 and TBP/DNA fluorescence intensity ratios. TPB
labeling intensity of chromosomes condensed in vitro resembled that
of mitotic fibroblasts. At the PN stage, TBP was barely detectable
in CT embryos but displayed strong immunoreactivity in NT and NI
embryos. Pronuclear TBP in NT embryos was of somatic origin because
inhibition of transcription or translation maintained strong TBP
labeling. Pronuclear TBP concentration in the mouse has been shown
to increase during progression through interphase (Worrad et al.,
Development 120:2347-2357, 1994). However, the similarity in
kinetics of PN formation from PCC- or in vitro-condensed chromatin
between reconstructed NT and CT embryos indicated that the enhanced
TBP concentration in NT pronuclei was not due to more a advanced
cell cycle stage. Thus, in vitro disassembly of donor nuclei
promotes dissociation of TBP from the chromatin, such that
resulting CT pronuclei contain .about.10-fold less TBP than NT
pronuclei at the same stage of reconstitution.
[0353] Thus, five structural and functional markers of incomplete
reprogramming by NT include pronuclear assembly of lamins A/C,
enhanced pronuclear NuMA and TBP concentrations, and increased
sensitivity of AKAP95 and DNA to extraction with detergent, DNAse,
and salt. In contrast, B-type lamins, essential for proper nuclear
reformation and cell survival (Steen et al., J. Cell Biol.
153:621-626, 2001) appear to assemble normally in NT pronuclei,
although we were not able to determine whether the pool of
assembled B-type lamins was of somatic (and therefore re-targeted)
or of maternal origin. The LMNA gene remains active in NT
pronuclei, resulting in the assembly of differentiated
cell-specific A-type lamins. Through interactions with chromatin
and the transcription machinery, nuclear lamins have been suggested
to participate in transcription regulation (Cohen et al., Trends
Biochem. Sci. 26:41-47, 2001); thus, assembly of the correct set(s)
of nuclear lamins is most likely critical for proper pronuclear
function in NT embryos.
[0354] In the present methods, somatic nuclear components are
dispersed in the extract and typically do not come in contact with
the oocyte cytoplasm. This prohibits re-targeting of
somatic-specific molecules to the developing nucleus, such as
B-type lamins whose composition may differ from that of maternal
lamins (Cohen et al., Trends Biochem. Sci. 26:41-47, 2001). In
vitro chromatin condensation may also promote release of DNA-bound
factors such as chromatin remodeling enzymes (Sif et al., Genes
Devel. 12:2842-2851, 1998) and transcription factors, thereby
"stripping" the donor genome of potentially inhibitory somatic
components. In particular, TBP removal may result in inactivation
of somatic-specific genes in reconstituted CT pronuclei and
duplicate the low transcriptional activity of the male pronucleus
after fertilization (Poccia et al., Trends Biochem. Sci.
17:223-227, 1992).
[0355] An implication of removing factors from the donor nucleus is
that loading of maternal components onto chromatin and remodeling
into a physiological pronucleus may be facilitated. CT increases
the sensitivity of AKAP95 and DNA to nucleases and salt. DNAse
I-resistant DNA is mostly transcriptionally silent; thus,
incomplete remodeling of AKAP95 anchoring by NT may impair
expression of developmentally important genes, such as genes
involved in placental development, maintenance of late pregnancy
and post-natal survival of cloned animals.
[0356] The following characteristics of CT oocytes indicate that
nuclear transfer of a chromatin mass incubated in a mitotic extract
significantly improves the functional characteristics of the
resulting reconstituted oocyte. A nuclear matrix protein that is
expressed at high levels by somatic donor cells, NuMA, was
expressed 3-fold less in CT pronuclei (i.e., pronuclei formed after
introduction of a chromatin mass into an oocyte) than in NT
pronuclei. This result indicates that the level of NuMA in CT
oocytes is more similar to the level of NuMA in naturally-occurring
oocytes than in NT oocytes. CT pronuclei also expressed 10-fold
less of the general transcription factor TBP than NT pronuclei.
This removal of TBP from the donor chromatin mass by incubation in
the mitotic extract may result in inactivation of undesired,
somatic-specific genes in the resulting CT oocyte. Lamin A/C, a
nuclear envelope protein that is specific for differentiated cells
and is not detected in in vitro fertilized or parthenogenically
activated oocytes, was also not detected in CT pronuclei but was
detected in NT pronuclei. Because nuclear lamins may regulate
transcription, the lack of detectable lamin A/C in CT pronuclei may
result in more appropriate regulation of transcription in CT
oocytes than in NT oocytes. The sensitivity of AKAP95, a structural
protein of the nuclear matrix-chromatin interface which is enriched
in transcriptionally repressed (hypoacetylated) chromatin, and DNA
to extraction with detergent, DNase, and salt was measured in the
pronuclei to characterize the anchoring of AKAP95 to DNA and to
characterize DNA accessibility in the pronuclei. Extractability was
enhanced 8-fold in CT pronuclei compared to NT pronuclei,
reflecting a beneficial effect of incubation of a donor chromatin
mass in a mitotic extract on AKAP95 anchoring and morphological
remodeling of the donor DNA. Because AKAP95 and DNase I-resistant
DNA is associated with transcriptionally repressed or silent DNA,
the increased sensitivity of AKAP95 and DNA to nucleases, salt, and
detergent suggests that CT oocytes may have increased expression of
developmentally important genes.
[0357] Similar results are expected with donor nuclei from cells
with one or more mutations in an endogenous immunoglobulin or prion
gene.
EXAMPLE 9
Evidence for More Complete Nuclear Reprogramming Using Streptolysin
O-Transfer (SLOT)
[0358] The reprogramming of a chromatin mass during incubation of a
permeabilized cell in a mitotic extract using SLOT was also
demonstrated. In this study, the expression of a nuclear matrix
protein that is expressed at high levels by somatic donor cells,
NuMA, and the expression of a nuclear envelope protein that is
specific for differentiated cells, lamin A/C, was compared for
oocytes produced using SLOT and oocytes produced using traditional
nuclear transfer of a cell containing a nucleus that has not been
incubated in an extract ("NT"). Fourteen hours after activation,
the SLOT pronuclei (i.e., pronuclei formed after introduction of a
donor cell containing a chromatin mass into an oocyte) expressed
significantly less NuMA and lamin A/C than NT pronuclei (n=15-20
embryos/marker in three replicates). These results demonstrate that
reconstituted SLOT oocytes are more efficiently reprogrammed than
NT oocytes and more closely resemble naturally-occurring,
fertilized oocytes. Because nuclear lamins may regulate
transcription, the significantly lower level of lamin A/C in SLOT
pronuclei may result in more appropriate regulation of
transcription in SLOT oocytes than in NT oocytes.
[0359] In addition to reducing the expression of undesired factors
in the resulting oocyte, SLOT increases the viability of the
resulting fetuses compared to traditional nuclear transfer methods
(Table 8). Thus, the many structural and functional differences of
SLOT donor cells substantially improve the ability of the
reconstituted oocytes to form non-human embryos and non-human
mammals. TABLE-US-00009 TABLE 8 Development of bovine embryos
produced using permeabilized donor cells with a chromatin mass
("SLOT") compared to bovine embryos produced using donor cells with
a nucleus ("NT") No. No. of No. 40 day No. 90 day transferred
Recipients Preg. (%) Preg. (%) SLOT 1955 59 29/59 (49) 14/59 (24)
NT 1885 95 44/95 (46) 16/95 (17)
[0360] Similar results are expected with donor cells with one or
more mutations in an endogenous immunoglobulin or prion gene.
EXAMPLE 10
Exemplary Evidence for More Complete Nuclear Reprogramming Using
Streptolysin O-Transfer (SLOT)
[0361] As described above, a novel in vitro nuclear remodeling
system has been developed. The system involves permeabilization of
the donor cell, induction of chromatin condensation in a mitotic
cell extract, and washing of the permeabilized cell to remove
nuclear factors solubilized during condensation of the chromatin.
Pronuclei of bovine chromatin transplant embryos exhibit an
expression pattern of several markers that closely resembles that
of normal embryos as opposed to nuclear transplant embryos, which
resemble somatic cells. Eight healthy calves were produced using
this chromatin transfer system. Chromatin transfer shows trends of
increased survival to term, lower incidence of large calves, and
significantly enhanced survival after birth. The results
demonstrate the successful manipulation of a somatic donor nucleus
prior to transplantation. As described further below, the
disassembly of a somatic nucleus in a mitotic extract followed by
transfer of the condensed chromatin into an oocyte enhances nuclear
remodeling and shows evidence of improved development and viability
of clones. This procedure can be used to further characterize the
mechanism of nuclear reprogramming, if desired.
[0362] A chromatin transfer strategy To alleviate defects
identified in pronuclear NT embryos, fibroblast nuclei were
manipulated in vitro prior to transfer into recipient oocytes. This
SLOT system is outlined in FIG. 45. For generation of a mitotic
extract, fibroblasts were synchronized in mitosis with 1 .mu.g/ml
nocodazole for 18 hours, harvested by mitotic shake-off, and washed
twice in phosphate buffered saline and once in cell lysis buffer
(20 mM Hepes, pH 8.2, 5 mM MgCl.sub.2, 10 mM EDTA, 1 mM DTT and
protease inhibitors). Sedimented cells were resuspended in one
volume of ice-cold cell lysis buffer, allowed to swell on ice for
one hour, and Dounce-homogenized using a tight-fitting glass
pestle. The lysate was centrifuged at 15,000.times.g for 15 minutes
at 4.degree. C. and the supernatant (mitotic extract) was
aliquoted, frozen in liquid nitrogen, and stored at -80.degree. C.
Fresh or frozen extracts were used without noticeable differences
on efficiency of nuclear breakdown.
[0363] Bovine fetal fibroblasts from confluent cultures were washed
in Ca.sup.2+/Mg.sup.2+-free Hank's Balanced Salt Solution (HBSS)
and permeabilized by incubation of 100,000 cells in suspension with
31.2 U Streptolysin O (SLO; Sigma) in 100 .mu.l HBSS for 30 minutes
in an approximately 38.5.degree. C. H.sub.2O bath. Permeabilization
was assessed by uptake of the membrane impermeant DNA stain,
propidium iodide (0.1 .mu.g/ml). Permeabilized fibroblasts were
sedimented, washed, and incubated in 40 .mu.l mitotic extract
containing an ATP-generating system (1 mM ATP, 10 mM creatine
phosphate, and 25 .mu.g/ml creatine kinase) for 30-45 minutes at
approximately 38.5.degree. C. to promote nuclear disassembly and
removal of nuclear components. Aliquots were labeled with 0.1
.mu.g/ml Hoechst 33342 to monitor chromatin condensation. After the
incubation, fibroblasts were recovered from the extract by
sedimentation and washed. The reaction mixture was diluted with 500
.mu.l Alpha MEM/10% fetal bovine serum (Gibco-BRL) containing 2 mM
CaCl.sub.2 for membrane resealing, and the cells were cultured for
two hours at 38.5.degree. C. (Hkelien et al., Nat. Biotechnol.
20:460-466, 2002). Resealing was monitored by propidium iodide
uptake. Resealed cells were fused with in vitro-matured oocytes
that had been enucleated at 20 hpm; oocytes were activated at 28
hpm, and embryos cultured as described herein for NT.
[0364] SLOT embryos were cultured to the blastocyst stage in vitro,
and two embryos were transferred per recipient female. Pregnancies
were monitored by ultrasonography, and C-sections were performed.
Calves were scored by veterinarians within 24 hours of birth.
[0365] Breakdown of fibroblast nuclei in mitotic extract The
mitotic extract consisted of a 15,000.times.g supernatant from a
lysate of mitotic bovine fibroblasts and contained an
ATP-regenerating system. The extract did not induce apoptosis, as
judged by the absence of proteolysis of poly(ADP)ribosyl polymerase
(PARP) and DNA fragmentation characteristic of apoptotic
fibroblasts. Thus, the extract was suitable to promote remodeling
of somatic nuclei.
[0366] The extract elicited ATP-dependent condensation of
chromosomes, disassembly of A/C and B-type lamins from chromatin as
judged by cytoplasmic labeling of these lamins, and removal of TBP
from chromatin. These events were confirmed by immunoblotting
analysis of condensed chromatin purified from the fibroblasts after
recovery from the mitotic extract. In this experiment, the A-kinase
anchoring protein AKAP95 was used as a marker of a nuclear
component that remains associated with the condensed chromosomes,
as normally occurs at mitosis (Collas et al., J. Cell Biol.
147:1167-1180, 1999). Histone H4 was used as a protein loading
control in the gel. Disassembly of nuclear lamins and TBP from
chromatin in mitotic extract was dependent on an ATP-regenerating
system and was reminiscent of that occurring in mitotic cells.
Furthermore, immunoblotting analysis of whole permeabilized
fibroblasts (as opposed to isolated chromatin) after exposure to
mitotic extract showed that a fraction of solubilized lamin A/C and
all detectable TBP were eliminated from the cells and/or
proteolysed. Lastly, a control extract from interphase fibroblasts
or cell lysis buffer alone both containing an ATP-regenerating
system failed to promote nuclear disassembly, indicating that
nuclear breakdown was ATP-dependent and specific for the mitotic
extract. Permeabilized fibroblasts exposed to mitotic extract and
resealed with CaCl.sub.2 could be cultured over several passages,
indicating that membrane permeabilization, incubation of the
permeabilized cells in the extract, and membrane resealing were
viable procedures.
[0367] Characterization of nuclei in embryos produced by chromatin
transfer Fusion of resealed fibroblasts to recipient oocytes
occurred as efficiently (over 70%) as with non-permeabilized cells.
The donor chromatin was in a condensed form at the time of
introduction into oocytes. In contrast, chromatin of fibroblasts
used for NT was still decondensed within 30 minutes of fusion.
Thus, resealing of mitotic extract-treated fibroblasts with
CaCl.sub.2 prior to transfer into oocytes did not promote nuclear
reformation in the donor cells. This observation was supported by
the absence of a nuclear envelope around the condensed chromatin in
SLOT embryos immediately after fusion, as judged by
immunofluorescence analysis of several lamina and inner nuclear
membrane proteins.
[0368] Immunolabeling of nuclear lamins and TBP in nuclei of SLOT
and NT embryos and immunolabeling intensity of these markers
relative to DNA fluorescence intensity was performed. Perinuclear
lamin B labeling intensity was similar in SLOT and NT pronuclei.
Remarkably however, in contrast to NT pronuclei, lamin A/C was
undetected in pronuclei and up to at least the 8-16-cell stage in
SLOT embryos. SLOT pronuclei also displayed a 4-fold reduction in
TBP labeling compared to NT pronuclei. Pronuclear TBP concentration
in the mouse has been shown to increase during progression through
interphase (Worrad et al., Development 120:2347-2357, 1994).
However, as kinetics of pronuclear formation from PCC- or in
vitro-condensed chromatin were similar in NT and SLOT embryos, it
is unlikely, albeit not formally excluded, that enhanced TBP
concentration in NT pronuclei was due to a more advanced cell cycle
stage. Resistance of TBP to extraction with 1% Triton X-100, 1
mg/ml DNAse I, and 0.3 M NaCl was decreased by over 2-fold,
indicating a weaker association of TBP with intranuclear ligands.
Likewise, resistance of DNA to DNAse I was reduced nearly 4-fold in
SLOT pronuclei, suggesting that SLOT favors the establishment of a
looser chromatin configuration in pronuclei. Thus, disassembly of
fibroblast nuclei in mitotic extract followed by transfer of the
condensed chromatin into oocytes enhanced morphological remodeling
of the donor nuclei and alleviated defects detected in pronuclei of
NT embryos.
[0369] Chromatin transfer produces healthy clones SLOT resulted in
development to term of cloned embryos. Pregnancy rates following
transfer of blastocysts into recipient females were significantly
higher at 40 days for SLOT embryos than for NT embryos (P=0.02;
Fisher's Test), and the trend was maintained up to development to
term (12/59 and 23/211 calves born, respectively; P=0.05).
Additionally, SLOT enhanced survival rate of clones beyond 24 hours
post-partum (10/59 and 17/211, respectively; P=0.04).
[0370] Health of NT and SLOT clones born was evaluated by scoring
animals and placentas on a scale of 1 (normal) to 5 (grossly
abnormal). Placental scores included parameters such as placental
edema, cotyledon number, size and morphology, color of amniotic
fluids, morphology of uterus, and umbilicus. Animal scores included
functional evaluation and general appearance of respiratory,
cardiovascular, digestive, urinary, muscular, skeletal and nervous
systems. Box plot analyses show that scores of animals and
placentas derived from NT were more dispersed that those produced
by SLOT. Mean birth weight of SLOT and NT clones was not
significantly different; however, the proportion of SLOT calves
over 45 kg at birth was lower (P=0.02; Fisher) than that of NT
animals. Altogether, these results indicate that chromatin transfer
produces live offspring and shows evidence of improved development
and viability.
[0371] In comparison with NT and despite the limited number of SLOT
offspring produced (n=8), SLOT significantly enhances pregnancy
rates at 40 days (P=0.02) and survival of calves born beyond 24
hours (P=0.04). A trend towards an improvement in the health of
animals produced by SLOT is also reflected in box plot analyses.
Furthermore, the lower incidence of large (over 45 kg) calves
produced by SLOT has practical and economical implications on
animal management.
[0372] Several nuclear defects have been identified in NT embryos,
including assembly of lamin A/C, enhanced pronuclear TBP content
and increased resistance of DNA to DNAse I. These defects may
result from incomplete remodeling of the fibroblast nuclei and/or
from misregulation of expression of differentiated cell-specific
(e.g., lamin A) genes. Remodeling of nuclei in vitro and
transplantation of condensed chromatin into oocytes alleviates
these defects.
[0373] Remodeling nuclei through SLOT increases DNA sensitivity to
DNAse I and may promote the formation of transcriptionally active
(or potentially active) chromatin. This effect may in turn
facilitate expression of developmentally important genes, such as
genes involved in placental development, maintenance of late
pregnancy, and post-natal survival. SLOT also induces repression of
lamin A gene expression in cloned embryos. In vitro and in vivo
manipulations of nuclear lamina composition have shown that failure
to assemble a correct set of lamins invariably leads to apoptosis
(Steen et al., J. Cell Biol. 153:621-626, 2001). Moreover, as
lamins interact with DNA, chromatin and the transcription
machinery, proper lamina reconstitution is likely to be essential
for normal nuclear function (Gruenbaum et al., J. Struct. Biol.
129:313-323, 2000 and Cohen et al., Trends Biochem. Sci. 26:41-47,
2001) in cloned embryos.
[0374] Chromatin condensation at mitosis or in vitro is associated
with the release of DNA-bound components such as chromatin
remodeling enzymes, transcription factors (e.g., TBP), or other
potentially inhibitory somatic components. Removal of TBP from
donor somatic chromatin may facilitate repression or
down-regulation of somatic-specific genes in SLOT embryos, which
may impair development. An implication of removing factors from the
donor nucleus is that loading of maternal components onto chromatin
and subsequent remodeling into a physiological pronucleus may be
facilitated.
[0375] In conclusion, it is possible to directly remodel a somatic
nucleus in a cell extract and produce live offspring. In vitro
manipulation of nuclei for cloning or transdifferentiation purposes
(Landsverk et al., EMBO Rep. 3:384-389, 2002 and Hkelien et al.,
Nat. Biotechnol. 20:460-466, 2002) is a useful tool for optional
further investigation of the mechanisms of nuclear reprogramming.
Chromatin transfer shows evidence of improved development to term
and viability of clones. Additional manipulation of the system
might lead to further improvements in the efficiency of mammalian
cloning.
EXAMPLE 11
Additional Evidence for More Complete Nuclear Reprogramming Using
Streptolysin O-Transfer (SLOT)
[0376] The SLOT method described above produced improved results
when the donor permeabilized cells were are not resealed prior to
genetic transfer. Additionally, use of donor cells in G.sub.1 phase
instead of confluent cells may result in increased viability of the
reconstituted oocyte and resulting embryo. These experiments are
described further below.
[0377] Preparation of buffers for experiments below A 1 molar DTT
solution was prepared by placing 1 ml H.sub.2O in an eppendorf
tube, adding 154 mg refrigerated DTT, and mixing well by vortexing.
The solution was aliquoted into 10 .mu.l volumes and frozen at
-20.degree. C. Aliquots can be thawed and re-frozen several times.
A 100 ml volume of cell lysis buffer for preparation of cell
extracts for nuclear assembly/disassembly assays contained NaCl (50
mM, 1 ml of 5 M stock), MgCl.sub.2, (5 mM, 0.5 ml of 1 M stock),
Hepes, pH 8.2 (20 mM, 2 ml of 1 M stock, pH 8.2), and H.sub.2O
(96.5 ml). The buffer was aliquoted and stored at 4.degree. C.
There was a drop of .about.1 pH unit upon lysate preparation. For
preparation of mitotic extracts, 10 mM EGTA was added (1 ml of a 1
M stock) and 95.5 ml H.sub.2O was added instead of 96.5 ml. Prior
to use, the following were added: DTT (1 .mu.l/ml solution, 1 M
stock at -20.degree. C., 1 mM final concentration), PMSF (10
.mu.l/ml solution 100 mM stock, 1 mM final concentration), CAL mix
(10 .mu.l CAL cocktail at -20.degree. C. per ml solution, i.e., a
final concentration of 10 .mu.g/ml each of chymostatin, aprotinin,
and leupeptin), Pepstatin A (10 .mu.l stock at -20.degree. C. per
ml solution, 10 .mu.g/ml final concentration), and Cytochalasin D
(1 .mu.l/ml from 1 mg/ml stock at -20.degree. C., 1 .mu.g/ml final
concentration). For the nocodazole 1000.times. stock solution, 1
mg/ml of nocodazole in DMSO was prepared and stored in 160 .mu.l
aliquots.
[0378] To prepare Streptolysin O stock (SLO), a vial of SLO (Sigma
S-5265; 25,000 units stored as a powder at 4.degree. C.) was
dissolved in 400 .mu.l H.sub.2O and mixed well. The entire content
was transferred to a 1.5-ml conical tube, divided into 10 .mu.l
aliquots, and frozen at -20.degree. C. The stock concentration was
"10.times.." To prepare the protease solution, 3 ml TL Hepes and 9
mg Protease (Sigma P-8811) were added to a 15 ml conical tube and
mixed by vortexing. The solution was filtered through a 0.22 um
syringe filter directly into TL Hepes. Because the cells doubled
the volume, the final concentration was 1.5 mg/ml. For HECM Hepes,
NaCl (114 mM, 6.662 g), KCl (3.2 mM, 0.239 g), CaCl.sub.2 2H.sub.2O
(2.0 mM, 0.294 g), MgCl.sub.2 6H.sub.2O (0.5 mM, 0.102 g),
Pen/Strep (10 ml, Sigma P3539 Pen/Strep, 100 U/ml and 100 ug/ml
final concentration), Phenol Red (5 ug/ml, 1 ml), and H.sub.2O (in
a sufficient amount to increase the total volume to 990 ml) were
combined. Then, 100.times.A.A. (10 ml), Na lactate (10 mM, 1.44
ml), Na pyruvate (0.1 mM, 0.011 g), NaHCO.sub.3 (2 mM, 0.168 g),
and HEPES (10 mM, 2.38 g) were added. The final solution had an
osmolarity of 260-270 mOsM. Then, 3 g bovine serum albumin
(Fraction V) was added, and the pH was adjusted to 7.4. The
solution was filtered through a 0.22 uM filter and stored at
4.degree. C.
[0379] For preparation of the ATP stock solution (Sigma A3377: 100
mM Stock, 100.times.), H.sub.2O (1 ml) and ATP (0.055 g) were
combined, and 10 .mu.l aliquots were frozen at -20.degree. C. For
preparation of creatine phosphate (Sigma P7936: 1 M stock,
100.times.), H.sub.2O (1 ml) and creatine phosphate (0.255 g) were
combined, and 10 .mu.l aliquots were frozen at -20.degree. C. To
prepare creatine kinase (Sigma C3755: 2.5 mg/ml stock, 100.times.),
H.sub.2O (1 ml) and creatine kinase (0.0025 g) were combined, and
10 .mu.l aliquots were frozen at -20.degree. C. For preparation of
the ATP-generating system, equal proportions of 100 mM ATP stock, 1
M creatine phosphate, and 2.5 mg/ml creatine kinase stock solutions
(100.times.) were made using H.sub.2O, mixed, and stored as a
frozen solution. The ATP generating system was kept on ice until
use. The ATP generating system (1.2 .mu.l) was added to the extract
(40 .mu.l), and the solution was mixed by vortexing. The final
concentration of the ATP generating system in the extract was 1 mM
ATP, 10 mM creatine phosphate, and 25 .mu.g/ml creatine kinase.
[0380] Preparation of mitotic extract One vial of 1.5 to 2 million
cells was thawed. Cells were split into two T75 flasks and grown
for two days or until they were confluent. The cells were passaged
in 6-8 T75 flasks and grown to confluency. The cells were
trypsinized and counted using a hemocytometer, and 3 million cells
were added to each of as many T150 flasks as could be used with the
number of cells available. The cell line (e.g., fibroblasts such as
primary fibroblasts, epithelial cells, or immortalized and
disease-free cells such as MDBK cells) was synchronized at 70-80%
confluency in mitosis with 0.5-1 .mu.g/ml nocodazole for 17-20
hours using standard procedures (e.g., Collas et al., J. Cell Biol.
147:1167-1180, 1999 and references therein). The synchronized cells
were harvested by mitotic shake-off. Each flask containing cells
was shaken vigorously by repeatedly tapping it with one hand. The
mitotic cells detached and floated in the culture medium. The
harvested cells were centrifuged at 500.times.g for 10 minutes in a
50 ml conical tube at 4.degree. C. The supernatant was discarded,
and the cell pellets were resuspended in a total of 50 ml of cold
phosphate buffered saline/Ca/Mg Free (PBS). If desired, several
cell pellets can be pooled into a single 50 ml tube. The cells were
centrifuged at 500.times.g for 10 minutes at 4.degree. C., and the
above washing step was repeated. The volume of the cell pellet was
determined, and the cell pellet was resuspended in approximately 20
volumes of ice-cold cell lysis buffer containing protease
inhibitors (i.e., DTT and PMSF).
[0381] Then, the cells were sedimented at 500.times.g for five
minutes at 4.degree. C. The supernatant was discarded, and the cell
pellet volume was determined. The cell pellet was resuspended in no
more than one volume of cell lysis buffer containing all of the
protease inhibitors. The cells were incubated on ice for one hour
to allow swelling of the cells. Using a tip sonicator, the cell
suspension was sonicated until all cells were broken open. Cell
lysis was monitored under a phase contrast microscope. Desirably,
90% of the cells were lysed before proceeding to the next step.
Sonication can be prolonged as long as necessary; the sonication
time varies with the cell type used to prepare the extract.
Alternatively, cells are lysed by Dounce homogenization using a
glass mortar and pestle (homogenizer), desirably until at least 90%
of the cells are lysed. The cell lysate was placed in a 1.5-ml
centrifuge tube and centrifuged at .about.15,000.times.g for 15
minutes at 4.degree. C. using a table top refrigerated centrifuge.
The centrifuge was placed in a cold room or refrigerator and
allowed to equilibrate. The tubes were removed from the centrifuge
and immediately placed on ice. The supernatant was carefully
collected using a 200 .mu.l pipette tip. This supernatant is the
mitotic cytoplasmic extract. The extract was placed in another tube
on ice. Extracts collected from several tubes were pooled.
[0382] Two alternatives exist at this stage. The cell extract was
aliquoted into tubes on ice, 41 .mu.l of extract per tube. The
extract was immediately snap-frozen in liquid nitrogen and stored
in a -80.degree. C. freezer until use. Such extracts prepared from
a 15,000.times.g centrifugation are called MS15 (or mitotic
cytoplasmic extract). Alternatively, the MS15 extract is placed in
an ultracentrifuge tube on ice (e.g., fitted for an SW55 Ti rotor;
Beckman). The tube is overlayed with mineral oil to the top if
necessary to prevent collapsing of the tube upon
ultracentrifugation. The extract was centrifuged at 200,000.times.g
for three hours at 4.degree. C. to sediment membrane vesicles
contained in the MS15. At the end of centrifugation, the oil was
discarded. The supernatant was carefully collected and placed in a
cold 1.5-ml tube on ice. Several supernatants were used if
necessary. This supernatant is referred to as MS200 (or mitotic
cytosolic extract). The MS200 extract was aliquoted and frozen as
described for the M515 extract.
[0383] Chromatin Transfer On the day before the cloning procedure,
one 35 mm Nunc was prepared with 1 million fibroblast cells, or six
T75 flasks containing 500,000 cells were prepared for shake-off. On
the morning of the cloning procedure, the Alpha MEM with 15% FBS
irradiated, complete media in all flasks was changed to remove
debris and dead cells. Prior to performing the cell
permeabilization and mitotic extract reaction, the lowest
concentration of SLO necessary to permeabilize 80-90% of the cells
was determined by serial dilution of the SLO stock solution (e.g.,
dilutions of 1.times., 0.5.times., 0.3.times., and 0.1.times.),
incubating for 30 minutes at approximately 38.5.degree. C. in a
water bath, and then staining with propidium iodide.
[0384] The cells were dissociated from confluent culture or newly
transfected cell culture using trypsin or cell dissociation buffer,
placed in 15 ml conical tube, and washed once by centrifugation
using Hank's Balanced Salt Solution, Ca/Mg free (HBSS). The cell
pellet was resuspended in 1 ml HBSS, and the cells were counted to
determine the concentration. Approximately 50,000-100,000 cells
were suspended in 100 .mu.l HBSS (Gibco BRL, cat. No. 14170-120) at
room temperature. The 5 .mu.l SLO stock solution at the previously
determined concentration was added. The mixture was incubated at
approximately 38.5.degree. C. for 30 minutes in a water bath. The
tube was gently tapped 2-3 times during incubation to ensure that
the cells remained in suspension. A 200 .mu.l volume of room
temperature PBS (Ca/Mg free) was added and mixed well by gentle
pipetting. The cells were centrifuged at 500.times.g for five
minutes at room temperature in table top centrifuge. All of the
supernatant was discarded. The pellet was small and may not be
clearly visible.
[0385] A 40 .mu.l volume of mitotic extract containing the
ATP-generating system was added, and the solution was mixed well.
The extract was prepared during the 30 minute incubation above. One
vial of 40 .mu.l extract was thawed and added to 1.2 .mu.l of
ATP-generating system. The solution was mixed well and kept at room
temperature. The mixture was incubated at 38.5.degree. C. in a
water bath for 30 minutes, and the tube was occasionally gently
tapped. A 500 .mu.l volume of room temperature complete media
(Alpha MEM+15% Fetal calf serum) was added and stored in an
approximately 38.5.degree. C. incubator with the lid open until
use. The cells were centrifuged at 500.times.g for five minutes at
room temperature in a table top centrifuge. The cell pellet was
resuspended in 1 ml room temperature TL Hepes and transferred to a
15 ml conical tube. A 1 ml volume of 3 mg/ml Protease in TL Hepes
(filtered) was added for a final protease concentration on the
cells of 1.5 mg/ml, and the mixture was incubated for 30 seconds.
TL Hepes was added to fill the 15 ml conical tube, and the tube was
capped and centrifuged at 2300 rpm for five minutes. TL Hepes was
removed from cells, and 150 ul of TL Hepes was added to cells. The
tube was labeled for the appropriate cell line and placed on a
warming stage.
[0386] During the time that the cells were being prepared, the
manipulation station was prepared for cell transfer using an
appropriately sized cell transfer pipette. Approximately 50
enucleated oocytes were placed into a 50 ul drop of TL Hepes under
heavy mineral oil in a 100 mm dish. The washed cells were placed in
a drop with enucleated oocytes. Enough cells were used for genetic
transfer to all oocytes. Care was taken to avoid using so many
cells that they sterically blocked the manipulation tools. One
enucleated oocyte was placed on the holder, and one cell was placed
in the perivitellin space under the zona, such that the cell was
touching the plasma membrane of the oocyte. To facilitate fusion,
the cell was placed adjacent to, or opposite to the polar body.
After all enucleated oocytes had cells transferred to them, oocytes
were removed from the microdrop and placed in a pre-warmed 35 mm
dish of HECM Hepes for fusion.
[0387] Results Comparing the results in Table 10 below for donor
cells in which the membrane was not resealed prior to genetic
transfer with the results for donor cells in which the membrane was
resealed prior to genetic transfer indicates that increased cloning
efficiency may be obtained by not resealing the permeabilized cell
membrane. Additionally, Table 10 demonstrates that the use of donor
cells in G.sub.1 phase instead of confluent cells may result in
increased viability of the reconstituted oocyte and resulting
embryo. The data in Table 9 was obtained using an extract from
bovine primary fibroblasts and donor bovine fetal fibroblasts. MDBK
cells have also been successfully used to generate reprogramming
extracts. TABLE-US-00010 TABLE 9 Embryo development with HAC cell
lines: NT Vs SLOT with resealed donor cells Pregnancy at Treatment
Total No Blast (%) Recips 40 d (%) 60 d (%) 90 d (%) 120 d (%) 150
d (%) HAC NTs 8872 1124 (18) 508 170 (34) 89 (18) 82 (16) 76 (15)
72 (14) HAC SLOTs 2709 223 (12) 91 42 (46) 22 (24) 19 (21) 18 (20)
17 (19) Total 11581 1347 (17) 599 212 (35) 111 (19) 101 (17) 94
(16) 89 (15)
[0388] TABLE-US-00011 TABLE 10 Embryo development with .DELTA.HAC
and .DELTA..DELTA.HAC cell lines: confluent donor cells (CTC) vs
G.sub.1 donor cells (CTD) without resealing of donor cell membranes
Preg Preg Treatment Total No Blast (%) Recips 40 d (%) 60 d (%)
.DELTA.HAC CTC 1729 185 (15) 68 14/39 (36) 5/13 (38) .DELTA.HAC CTD
1177 181 (22) 68 25/44 (56) 5/22 (33) .DELTA..DELTA.HAC CTC 1230
147 (17) 60 .DELTA..DELTA.HAC CTD 521 95 (26) 29 Total 4657 608
(19) 225
EXAMPLE 12
Methods for the Generation of Chimeric Mammals
[0389] Many spontaneous abortions that occur using traditional
methods to clone mammals are thought to result from placental
abnormalities rather than from problems with the fetus. Thus,
methods have been developed to produce chimeric embryos with
placental tissue primarily from one origin (e.g., an in vitro
fertilized, naturally-occurring, or parthenogenetically activated
embryo) and fetal tissue primarily from another origin (e.g., a
nuclear transfer embryo encoding a xenogenous antibody). Chimeric
embryos with placental tissue derived primarily from cells from in
vitro fertilized, naturally-occurring, or parthenogenetically
activated embryos may better resemble naturally-occurring placental
tissue and result in increased production of viable offspring.
[0390] Preferably, the majority of the cells of the offspring are
derived from cells from the nuclear transfer embryo and thus have a
genome that is substantially identical to that of the donor cell
used to generate the nuclear transfer embryo.
[0391] In one such method, cells from an in vitro fertilized embryo
are injected into the periphery of a compaction embryo encoding a
xenogenous antibody (e.g., between the zona pellucida and the
embryo itself) that was produced using traditional nuclear transfer
methods or any of the other cloning methods described herein. In an
alternative method, cells from a precompaction, in vitro fertilized
embryo are incubated with cells from a precompaction embryo
encoding a xenogenous antibody produced using one of the cloning
methods of the present invention (e.g., using a reprogrammed
chromatin mass or a permeabilized cell as the donor source) under
conditions that allow cells from each embryo to reorganize to
produce a single chimeric embryo (Wells and Powell, Cloning 2:9-22,
2000). In both methods, the cells from the in vitro fertilized
embryo are preferentially incorporated into the placenta, and the
cells from the nuclear transfer method are preferentially
incorporated into the fetal tissue. These methods are described
further below. These results were generated using nuclear transfer
embryos that do not contain a xenogenous antibody gene; however,
similar results are expected for nuclear transfer embryos
containing a xenogenous antibody gene.
[0392] Isolation of G1 Fibroblasts For the isolation of G1
fibroblasts as donor cells to produce nuclear transfer embryos, the
previously described "shake off" method was used (Kasinathan et
al., Nature biotech. 19:1176-1178, 2001). Briefly, 24 hours prior
to isolation, 5.0.times.10.sup.5 cells were plated onto 100 mm
tissue culture plates containing 10 ml of .alpha.-MEM plus FCS. The
following day, plates were washed with PBS, and the culture medium
was replaced for one to two hours before isolation. The plates were
then shaken for 30-60 seconds on a Vortex-Genie 2 (Fisher
Scientific, Houston, Tex., medium speed). The medium was removed,
spun at 500.times.g for five minutes, and the pellet was
re-suspended in 250 .mu.l of MEM plus FCS. This cell suspension
consisted of newly divided cell doublets attached by a cytoplasmic
bridge, some single cells, and metaphase or anaphase cells. The
cell doublets attached by a cytoplasmic bridge were used as donor
cells for nuclear transfer.
[0393] Nuclear Transplantation, Activation, and Embryo Culture The
nuclear transfer procedure using the isolated G1 fibroblasts was
performed essentially as previously described (Cibelli et al.,
Nature Biotech. 16(7):642-646, 1998; Kasinathan et al., Biol.
Reprod. 64(5):1487-1493, 2000). In vitro matured oocytes were
enucleated about 18-20 hours post maturation, and chromosome
removal was confirmed by bisBenzimide (Hoechst 33342, Sigma)
labeling under UV light. These cytoplast-donor cell couplets were
fused using a single electrical pulse of 2.4 kV/cm for 20
microseconds (Electrocell manipulator 200, Genetronics, San Diego,
Calif.). At 30 hours past maturation, reconstructed oocytes and
controls were activated with calcium ionophore (5 .mu.M) for four
minutes (Cal Biochem, San Diego, Calif.) and 10 .mu.g cycloheximide
and 2.5 .mu.g cytochalasin D (Sigma) in ACM culture medium (100 mM
NaCl, 3 mM KCl, 0.27 Mm CaCl.sub.2, 25 mM NaHCO.sub.3, 1 mM sodium
lactate, 0.4 mM Pyruvate, 1 mM L-glutamine, 3 mg/ml BSA (fatty acid
free), 1% BME amino acids, and 1% MEM nonessential amino acids; all
from Sigma) for six hours as described previously (Liu et al., Mol.
Reprod. Dev. 49:298-307, 1998; Presicce et al., Mol. Reprod. Dev.
38:380-385, 1994). After activation, eggs were washed in HEPES
buffered hamster embryo culture medium (HECM-HEPES, 114 mM NaCl,
3.2 mM KCl, 2 mM CaCl.sub.2, 10 mM Sodium Lactate, 0.1 mM sodium
pyruvate, 2 mM NaHCO.sub.3, 10 mM HEPES, and 1% BME amino acids;
Sigma) five times and placed in culture in 4-well tissue culture
plates containing mouse fetal fibroblasts and 0.5 ml of embryo
culture medium covered with 0.2 ml of embryo tested mineral oil
(Sigma). Twenty five to 50 embryos were placed in each well and
incubated at 38.5.degree. C. in a 5% CO.sub.2 in air atmosphere. On
day four, 10% FCS was added to the culture medium. On days seven
and eight, development to the blastocyst stage was recorded.
[0394] Bovine In vitro Fertilization In vitro fertilization was
performed as described earlier to produce bovine in vitro
fertilized embryos (Collas et al., Mol. Reprod. Dev. 34:224-231,
1993). A 45% and 90% isotonic Percoll gradient was prepared with
sperm TL stock (Parrish et al., Theriogenology 24:537-549, 1985).
Frozen-thawed bovine sperm from a single bull was layered on top of
the gradient and centrifuged for 30 minutes at 700.times.g (2000
rpm using a 6.37 inch tip radius). The concentration of sperm in
the pellet was determined, and the sperm was diluted in sperm TL
(sperm TL stock, 1 mM pyruvate, 6 mg/ml BSA, and 1% PS) such that
the final concentration at fertilization was 10.sup.6 sperm/ml. At
22 hours post maturation, oocytes were wash three times in TL HEPES
and placed in 480 ul of fertilization TL (Bavister et al., Biol.
Reprod. 28:235-247, 1983) in Nunc wells containing 6 mg/ml BSA, 0.2
mM pyruvate, 20 uM penicillamine, 10 uM hypotaurine, 1 mM
epinephrine (Leibfried et al., J. Reprod. Fertil. 66:87-93, 1982),
and 0.004 ug/ml heparin. Twenty microliters of sperm were added to
generate a final concentration of 10.sup.6 sperm/ml to 50 oocytes.
Culture conditions were the same as those described above for
nuclear transfer. Fertilization rates were over 90% based on
pronuclear development.
[0395] Chimeric Nuclear Transfer Embryos In vitro fertilized
embryos at 8-cell stage (6-12 blastomeres) were harvested at
approximately 96 hours post fertilization, prior to compaction. The
zona pellucida was removed with protease (3 mg/ml in TL-HEPES). The
zona dissolution was carefully monitored using a dissecting
microscope. When the zona first appeared to dissolve (.about.two
minutes), the embryos were removed and washed in TL-HEPES and
transferred to 30 mm petri dishes containing Hank's balanced salt
solution and incubated at 37.5.degree. C. for 30 minutes. The
blastomeres from these precompaction embryos were transferred into
microdrops (50 .mu.l) of TL-HEPES under mineral oil in 100 mm
petridish. Nuclear transfer embryos on day four at the 8-16 cell
stage were selected and transferred into the same microdrops
containing the blastomeres. These nuclear transfer embryos included
both precompaction embryos (e.g., 8 cell stage embryos) and
compaction embryos (e.g., 16 stage embryos). Then 4-6 blastomeres
were transferred into the nuclear transfer embryos with the beveled
micro pipette (35 .mu.m diameter) using standard micromanipulation
techniques. After transferring the blastomeres, the embryos were
cultured as described for nuclear transfer embryos.
[0396] On days seven and eight, the development to blastocyst of
the chimeric embryos was evaluated. The blastocysts were also
analyzed for the presence of the membrane dye DiI that was added to
the cells from the in vitro fertilized embryo before they were
injected into the nuclear transfer embryo. The cells were labeled
on day four and observed on day seven. This dye is maintained for a
few cell divisions in the progeny of the originally dyed cells,
allowing the chimeric embryo to be analyzed after a few cell
divisions. Based on this analysis, cells from the in vitro
fertilized embryo were incorporated into the chimeric embryo. If
desired, fluorescence in situ hybridization (FISH) with a probe
specific for a nucleic acid in either the in vitro fertilized
embryo or the nuclear transfer embryo can be performed using
standard methods (see, for example, Ausubel et al., Current
Protocols in Molecular Biology, John Wiley & Sons, New York,
pp. 14.7.1-14.7.12, 1995). This FISH analysis can be used to
determine the distribution of cells derived from each embryo in the
chimeric embryo (e.g., to determine what percent of the cells are
incorporated into the inner cell mass and what percent are
incorporated into the trophectoderm) while it is cultured in vitro
and in the fetus or the offspring generated from the embryo.
Alternatively, a reporter gene such as green fluorescent protein
can be added to cells from one of the embryos and used to monitor
the incorporation of the cells into the placenta and various fetal
tissues of the chimeric embryo.
[0397] Embryo Transfer Days seven and eight, nuclear transfer
blastocysts of grade 1 and 2, derived from nuclear transfer embryos
and chimeric nuclear transfer embryos were transferred into day six
and seven synchronized recipient heifers. Recipients were
synchronized using a single injection of Lutalyse (Parmacia &
Upjohn, Kalamazoo, Mich.) followed by estrus detection. The
recipients were examined on days 30 and 60 after embryo transfer by
ultrasonography for the presence of conceptus and thereafter every
30 days by rectal palpation until 240 days. The pregnancy results
at day 40 for the chimeric embryos and for control embryos produced
by fusing a transgenic bovine fibroblast with an oocyte are
compared in Table 11. These results indicate that a greater number
of chimeric embryos survived until day 40. TABLE-US-00012 TABLE 11
Embryo transfers and pregnancies Control Nuclear transfers Chimeric
Nuclear Transfers 40 day 40 day Implant No of recipients Pregnancy
No of recipients Pregnancy First 2 1 2 1 Second 6 1 4 3 Total 8 2
(25%) 6 4 (67%)
[0398] Alternative Methods for Production of Chimeric Embryos
Standard methods can be used to modify the above method for
producing chimeric embryos. For example, a naturally-occurring
embryo can be surgically isolated from a mammal (e.g., a bovine) or
an oocyte can be parthenogenetically activated using standard
techniques and used instead of the in vitro fertilized embryo. If
desired, fewer cells from the in vitro fertilized,
naturally-occurring, or parthenogenetically activated embryos
(e.g., 1, 2, 3, 4, or 5 cells) can be injected into the nuclear
transfer embryo to reduce the percent of the injected cells and
their progeny that become incorporated into fetal tissue.
Alternatively, more cells (e.g., 6, 7, 8, 9, 10, 11 or more cells)
can be injected to increase the percent of the injected cells and
their progeny that are incorporated into placental tissue.
Moreover, cells from embryos in other cell stages can be used. For
example, in vitro fertilized, naturally-occurring, or
parthenogenetically activated embryos at the 4, 8, 16, 32, 64, 128,
256, 512, or later cell stage can be injected into nuclear transfer
embryos at the 4, 8, 16, 32, 64, 128, 256, 512, or later cell
stage. The injected cells and the nuclear transfer embryo can be at
the same cell stage or at different cell stages. In one embodiment,
the in vitro fertilized, naturally-occurring, or
parthenogenetically activated embryo has increased ploidy (e.g., a
DNA content of 4n) relative to the nuclear transfer embryo, which
further biases the injected cells to the trophectoderm (i.e., the
outermost layer of cells of the embryo that primarily forms the
placental tissue). If desired, all or part of the zona pellucida
can be kept surrounding the injected cells, rather than removed
prior to injection.
[0399] In other alternative methods, cells from a precompaction or
compaction in vitro fertilized, naturally-occurring, or parthenote
embryo are incubated with cells from a precompaction nuclear
transfer embryo under conditions that allow cells from each embryo
to reorganize to produce a single chimeric embryo (Wells and
Powell, Cloning 2:9-22, 2000). Cells from in vitro fertilized,
naturally-occurring, or parthenote embryo are expected to
contribute primarily to the trophectoderm and eventually to the
placental tissue, and cells from the nuclear transfer embryo are
expected to contribute primarily to the inner cell mass and
eventually to the fetal tissue. Cells from both embryos can be at
the same cell stage or at different cell stages, and the same or
different numbers of cells from each embryo can be combined to form
the aggregation embryo.
[0400] If desired, a cell from the resulting cloned fetus or the
cloned offspring can be used in a second round of nuclear transfer
to generate additional cloned offspring. Cells from the initial
cloned fetus or cloned offspring may also be frozen to form a cell
line to be used as a source of donor cells for the generation of
additional cloned ungulates.
Optional Elimination of Cells from Non-Transgenic Embryo
[0401] If desired, to reduce further the number of cells and their
progeny from the an in vitro fertilized, naturally-occurring, or
parthenogenetically activated embryo that are incorporated into the
fetal tissue or offspring, an antibody that is reactive with an
antigen (e.g., a B-cell or germ cell antigen, a cell-surface
antigen, or any antigen present in or on cells from the fertilized,
naturally-occurring, or parthenogenetically activated embryo but
not present in or on cells from the nuclear transfer embryo) from
the in vitro fertilized, naturally-occurring, or
parthenogenetically activated embryo is administered to the
chimeric embryo, fetus, or offspring in an amount sufficient to
reduce the quantity and/or activity of cells from the in vitro
fertilized, naturally-occurring, or parthenogenetically activated
embryo that are incorporated into the fetus or offspring. In
preferred embodiments, between 1 and 10 mg, 10 and 25 mg, 25 and 50
mg, 10 and 100 mg, 50 and 100 mg, or 100 to 500 mg of the antibody
is administered in one or multiple doses to the fetus. Preferably,
at least 0.25, 0.5, 1.0, 1.5, or 2 grams of the antibody is
administered in one or multiple doses to the offspring. Preferably,
the antibody is administered prior to colostrum.
[0402] In another method for generating chimeric fetuses or
offspring, cells from one of the initial embryos used to produce
the chimeric fetus or offspring have a nucleic acid encoding a
xenogenous antibody (e.g., a human antibody). Additionally, cells
from the aforementioned initial embryo or another initial embryo
have a nucleic acid encoding an antibody that is reactive with an
endogenous antibody (e.g., an antibody naturally produced by cells
from any of the initial embryos used to generate the chimeric fetus
or offspring) and that reduces the amount or activity of an
endogenous antibody in the resulting fetus or offspring.
[0403] The nucleic acid encoding the antibody reactive with an
endogenous antibody can be obtained using standard molecular
biology techniques. For example, an mRNA from a B-cell producing an
antibody reactive with ungulate antibodies can be
reverse-transcribed, and the resulting cDNA can be inserted into
the donor cell, nucleus, or chromatin mass used to form one of the
initial embryos. In some embodiments, the cDNA is inserted into the
HAC containing a xenogenous immunoglobulin nucleic acid, and the
HAC is inserted into the donor cell, nucleus, or chromatin mass
using the methods described herein. If desired, the cDNA can be
placed under the control of a cell-specific promoter, such as a
liver-specific promoter.
[0404] In one such method, a cell, nucleus, or chromatin mass is
inserted into an oocyte, thereby forming a first embryo. The cell,
nucleus, or chromatin mass has a nucleic acid encoding a xenogenous
first antibody and a nucleic acid encoding a second antibody
reactive with an endogenous antibody. One or more cells from the
first embryo are contacted with one or more cells from a second
embryo (e.g., an in vitro fertilized embryo, naturally-occurring
embryo, or parthenogenetically activated embryo), thereby forming a
third embryo. The third embryo is transferred into the uterus of a
host mammal under conditions that allow the third embryo to develop
into a fetus or live offspring. The resulting fetus or offspring
expresses the xenogenous first antibody and the second antibody,
and the second antibody reduces the quantity and/or activity of an
endogenous antibody.
[0405] In a related method, a permeabilized cell is incubated in a
reprogramming media under conditions that allow the removal of a
factor from a nucleus, chromatin mass, or chromosome of the
permeabilized cell or the addition of a factor from the
reprogramming media to the nucleus, chromatin mass, or chromosome,
thereby forming a reprogrammed cell. The cell has a nucleic acid
encoding a xenogenous first antibody and a nucleic acid encoding a
second antibody reactive with an endogenous antibody. The
reprogrammed cell is inserted into an oocyte, thereby forming a
first embryo. One or more cells from the first embryo are contacted
with one or more cells from a second embryo (e.g., an in vitro
fertilized embryo, naturally-occurring embryo, or
parthenogenetically activated embryo), thereby forming a third
embryo. The third embryo is transferred into the uterus of a host
mammal under conditions that allow the third embryo to develop into
a fetus or live offspring. The resulting fetus or offspring
expresses the xenogenous first antibody and the second antibody,
and the second antibody reduces the quantity and/or activity of an
endogenous antibody.
EXAMPLE 13
Transgenic Ungulates Producing Xenogenous Antibodies that have a
Mutation in One or More Endogenous Antibodies
[0406] The expression of endogenous antibodies may be further
reduced by mutating one or more endogenous antibody genes. By
increasing the number of functional xenogenous immunoglobulin heavy
or light chain genes relative to the number of functional
endogenous heavy or light chain genes, the percentage of B-cells
expressing xenogenous antibodies should increase. If desired, an
antibody may be administered to eliminate the residual endogenous
B-cells and antibodies as described below.
[0407] To generate these transgenic ungulates, .DELTA.HAC or
.DELTA..DELTA.HAC transgenic ungulates may be mated with transgenic
ungulates containing a mutation in one or both alleles of an
endogenous immunoglobulin chain (e.g., a mu heavy chain or a lambda
or kappa light chain). If desired, the resulting transgenic
ungulates may be mated with (i) transgenic ungulates containing a
mutation in one or both alleles of an endogenous
alpha-(1,3)-galactosyltransferase, prion, and/or J chain nucleic
acid or (ii) transgenic ungulates containing an exogenous J chain
nucleic acid (e.g., human J chain). Alternatively, a cell (e.g., a
fetal fibroblast) from a .DELTA.HAC or .DELTA..DELTA.HAC transgenic
fetus may be genetically modified by the mutation of one or more
endogenous immunoglobulin genes. In another possible method,
.DELTA.HAC or .DELTA..DELTA.HAC is introduced into a cell (e.g., a
fetal fibroblast) in which endogenous immunoglobulins (mu heavy
and/or lambda light chains) are hemizygously or homozygously
inactivated. In any of the above methods, the cells may also be
genetically modified by (i) the introduction of a mutation,
preferably a knockout mutation, into one or both alleles of an
endogenous alpha-(1,3)-galactosyltransferase, prion, and/or J chain
nucleic acid or (ii) the introduction of an exogenous J chain
nucleic acid. The resulting transgenic cell may then be used in
nuclear transfer procedures to generate the desired transgenic
ungulates. Exemplary methods are described below.
[0408] DNA Constructs The mu heavy chain (FIG. 2A), lambda light
chain, kappa light chain, alpha-(1,3)-galactosyltransferase, prion,
and/or J chain knockout constructs described above may be used.
Alternatively, the puromycin resistant mu heavy chain construct
described below may be used (FIG. 3F). This knockout construct was
designed to remove the 4 main coding exons of the bovine mu heavy
chain locus but leave the transmembrane domain intact, resulting in
the inactivation of the mu heavy chain locus.
[0409] The puromycin resistant construct was assembled as follows.
A 4.4 kilobase XhoI fragment containing the region immediately
proximal to coding exon 1 was inserted into the XhoI site of
pBluescript II SK+. Plasmid pPGKPuro, which contains a puromycin
resistant gene, was obtained from Dr. Peter W. Laird, Whitehead
Institute, USA. A 1.7 Kb XhoI fragment containing a puromycin
resistance gene was subcloned adjacent to, and downstream of, the
4.4 Kb fragment into the SalI site present in the polylinker
region. This 1.7 Kb puromycin marker replaces the coding exons CH1,
CH2, CH3 and CH4 of the bovine immunoglobulin heavy chain locus. An
XbaI fragment containing a 4.6 Kb region of the mu locus that is
downstream of these four exons in the wild-type genomic sequence
was added to this construct for use as the second region of
homology.
[0410] To generate the final targeting construct, a subclone of
this construct was generated by cutting the three assembled
fragments with NotI and MluI The MluI restriction digestion
truncates the 4.6 Kb fragment down to 1.4 Kb. The NotI site lies in
the polylinker and does not cut into the subcloned DNA itself. The
MluI site was filled in with a Klenow fragment to generate a blunt
end, and the NotI/filled in MluI fragment was subcloned into a
fresh pBluescript II SK+ vector using the NotI and SmaI sites
present in the pBluescript vector. For gene targeting, the final
vector is linearized with NotI.
[0411] Gene Targeting by Electroporation and Drug Selection of
Transfected Fibroblasts For electroporation, a single cell
suspension of 1.times.10.sup.7 bovine fetal fibroblasts (e.g,
fibroblasts obtained as described in Example 1 from a .DELTA.HAC or
.DELTA..DELTA.HAC transgenic fetus) that had undergone a limited
number of population doublings is centrifuged at 1200 rpm for five
minutes and re-suspended in 0.8 ml of serum-free Alpha-MEM medium.
The re-suspended cells are transferred to a 0.4 cm electroporation
cuvette (Invitrogen, cat #.P460-50). Next, 30 .mu.g of a
restriction enzyme-linearized, gene targeting vector DNA is added,
and the contents of the cuvette are mixed using a 1 ml pipette,
followed by a two minute incubation step at room temperature. The
cuvette is inserted into the shocking chamber of a Gene Pulser II
electroporation system (Biorad) and then electroporated at 1000
volts and 50 .mu.F. The cuvette is quickly transferred to a tissue
culture hood and the electroporated cells are pipetted into
approximately 30 ml of complete fibroblast medium. The cells are
equally distributed into thirty 100 mm tissue culture dishes
(Corning, cat #.431079), gently swirled to evenly distribute the
cells, and incubated at 38.5.degree. C./5% CO.sub.2 for 16 to 24
hours The media is removed by aspiration and replaced with complete
fibroblast medium containing the selection drug of choice. The
media is changed every two days and continued for a total time
period of 7 to 14 days. During the drug selection process,
representative plates are visually monitored to check for cell
death and colony formation. Negative control plates are set up that
contained fibroblasts that are electroporated in the absence of the
gene targeting vector and should yield no colonies during the drug
selection process.
[0412] Picking of Drug Resistant Fibroblast Colonies and Expansion
of Cells Following completion of the drug selection step (usually 7
to 14 days), the drug resistant colonies are macroscopically
visible and ready for transfer to 48 well tissue culture plates for
expansion. To assist in the transferring process, individual
colonies are circled on the bottom of the tissue culture plate
using a colored marker (Sharpie). Tissue culture plates containing
colonies are washed 2.times. with 1.times.D-PBS (without Ca.sup.2+
and Mg.sup.2+) and then 5 ml of a 1:5 dilution of the cell
dissociation buffer is added per plates. Following a 3 to five
minute room temperature incubation step, individual colonies start
to detach from the bottom of the tissue culture dish. Before the
colonies detached, they are individually transferred to a single
well of a 48 well tissue culture plate using a P200 pipetmen and an
aerosol barrier pipette tip (200 or 250 .mu.l). Following transfer,
the colony is completely dissociated by pipetting up-and-down and 1
ml of complete fibroblast medium is added. To ensure that the cells
are drug resistant, drug selection is continued throughout the 48
well stage. The transferred colonies are cultured at 38.5.degree.
C./5% CO.sub.2 and visually monitored using an inverted microscope.
Two to seven days later, wells that are approaching confluency are
washed two times with 1.times.D-PBS (without Ca.sup.2+ and
Mg.sup.2+) and detached from the bottom of the well by the addition
of 0.2 ml of cell dissociation buffer, followed by a five minutes
room temperature incubation step. Following detachment, the cells
are further dissociated by pipetting up-and-down using a P1000
pipetmen and an aerosol pipette tip (1000 .mu.l). Approximately 75%
of the dissociated fibroblasts are transferred to an individual
well of a 24 well tissue culture plate to expand further for
subsequent PCR analysis and the remaining 25% is transferred to a
single well of a second 24 well plate for expansion and eventually
used for somatic cell nuclear transfer experiments. When cells in
the plate containing 75% of the original cells expanded to near
confluency, DNA is isolated from that clone for genetic
analysis.
[0413] DNA Preparation The procedure used to isolate DNA for
genetic analyses is adapted from Laird et al, Nucleic Acids
Research, 1991, Volume 19, No. 15. In particular, once a particular
clone has attained near-confluency in one well of a 24 well plate,
culture medium is aspirated from that well and the adherent cells
are washed twice with PBS. The PBS is aspirated off and replaced
with 0.2 ml buffer to lyse the cells and digest excess protein from
the DNA to be isolated. This buffer is composed of 100 mM Tris-HCl
(pH 8.5), 5 mM EDTA, 0.2% SDS, 200 mM NaCl and 100 ug/ml proteinase
K. The 24 well plate is returned to the tissue culture incubator
for a minimum of three hours to allow the release of the DNA and
digestion of protein. The viscous product of this procedure is
transferred to a 1.5 ml microcentrifuge tube and 0.2 ml of
isopropanol added to precipitate the DNA. The precipitate is
recovered by centrifugation, the DNA pellet is rinsed with 70%
ethanol, and after air-drying, the pellet is resuspended in 25-50
ul of buffer containing 10 mM Tris, pH 8, and 1 mM EDTA. This DNA
is used for PCR analyses of clones.
[0414] Screening of Clones Two different approaches are used to
screen clones, both employing the polymerase chain reaction (PCR).
All approaches described in this section are adaptable to the
targeting of any other gene, the only difference being the
sequences of the primers used for genetic analysis.
[0415] According to the first approach, two separate pairs of
primers are used to independently amplify products of stable
transfection. One pair of primers is used to detect the presence of
the targeting vector in the genome of a clone, regardless of the
site of integration. The primers are designed to anneal to DNA
sequences both present in the targeting vector. The intensity of
the PCR product from this PCR reaction may be correlated with the
number of copies of the targeting vector that have integrated into
the genome. Thus, cells containing only one copy of the targeting
vector tend to result in less intense bands from the PCR reaction.
The other pair of primers is designed to detect only those copies
of the vector that integrated at the desired locus. In this case,
one primer is designed to anneal within the targeting vector and
the other is designed to anneal to sequences specific to the locus
being targeted, which are not present in the targeting vector. In
this case, a PCR product is only detected if the targeting vector
has integrated directly next to the site not present in the
targeting vector, indicating a desired targeting event. If product
is detected, the clone is used for nuclear transfer.
[0416] For the neomycin resistant heavy chain knockout construct,
primers Neo1 (5'-CTT GAA GAC GAA AGG GCC TCG TGA TAC GCC-3', SEQ ID
NO: 42) and IN2521 (5'-CTG AGA CTT CCT TTC ACC CTC CAG GCA CCG-3',
SEQ ID NO: 43) are used to detect the presence of the targeting
vector in cells, regardless of the location of integration. Primers
Neo1 and OUT3570 (5'-CGA TGA ATG CCC CAT TTC ACC CAA GTC TGT C-3',
SEQ ID NO: 44) are used to specifically amplify only those copies
of the targeting construct that integrated into the mu heavy chain
locus.
[0417] For these PCR reactions to analyze the integration of the
neomycin resistant heavy chain knockout construct, a Qiagen PCR kit
is used. The PCR reaction mixture contains 1 pmole of each primer,
5 ul of 10.times. reaction buffer, 10 .mu.l of Q solution, 5 .mu.l
of DNA, and 1 .mu.l of dNTP solution. The reaction mixture is
brought to a total volume of 50 ul with H.sub.2O. This PCR
amplification is performed using an initial denaturing incubation
at 94.degree. C. for two minutes. Then, 30 cycles of denaturation,
annealing, and amplification are performed by incubation at
94.degree. C. for 45 seconds, 60.degree. C. for 45 seconds, and
72.degree. C. for two minutes. Then, the reaction mixture is
incubated at 72.degree. C. for five minutes and at 4.degree. C.
until the mixture is removed from the PCR machine.
[0418] In the alternative approach, a single primer set is used to
amplify the targeted locus and the size of the PCR products is
diagnostic for correct targeting. One primer is designed to anneal
to a region of the locus not present in the targeting vector and
the other primer is designed to anneal to a site present in the
targeting vector but also present in the wild type locus. In this
case, there is no detection of targeting vector that had integrated
at undesirable sites in the genome. Because the region deleted by
the targeting vector is different in size from the drug selection
marker inserted in its place, the size of the product depended on
whether the locus amplified is of wild-type genotype or of targeted
genotype. Amplification of DNA from clones containing incorrect
insertions or no insertions at all of the targeting vector results
in a single PCR product of expected size for the wild type locus.
Amplification of DNA from clones containing a correctly targeted
("knocked out") allele results in two PCR products, one
representing amplification of the wild type allele and one of
altered, predictable size due to the replacement of some sequence
in the wild-type allele with the drug resistance marker, which is
of different length from the sequence it replaced.
[0419] For the puromycin resistant heavy chain knockout construct,
primers Shortend (5'-CTG AGC CAA GCA GTG GCC CCG AG-3', SEQ ID NO:
45) and Longend (5'-GGG CTG AGA CTG GGT GAA CAG AAG GG-3', SEQ ID
NO: 46) are used. This pair of primers amplifies both the wild-type
heavy chain locus and loci that have been appropriately targeted by
the puromycin construct. The size difference between the two bands
is approximately 0.7 Kb. The presence of the shorter band is
indicative of appropriate targeting.
[0420] For this PCR reaction to analyze the integration of the
puromycing resistant heavy chain knockout construct, a Promega
Master Mix kit is used. The PCR reaction mixture contains 1 pmole
of each primer, 2.5 .mu.l of DNA, and 25 .mu.l of 2.times. Promega
Master Mix. The reaction mixture is brought to a total volume of 50
.mu.l with H.sub.2O. This PCR amplification is performed using an
initial denaturing incubation at 94.degree. C. for two minutes.
Then, 30 cycles of denaturation, annealing, and amplification are
performed by incubation at 94.degree. C. for 45 seconds, 60.degree.
C. for 45 seconds, and 72.degree. C. for two minutes. Then, the
reaction mixture is incubated at 72.degree. C. for five minutes and
at 4.degree. C. until the mixture is removed from the PCR
machine.
[0421] First Round of Nuclear Transfer Selected fibroblast cells in
which an immunoglobulin gene has been inactivated may be used for
nuclear transfer as described in Example 1 to generate a transgenic
ungulate containing a mutation in an endogenous immunoglobulin gene
and containing a HAC encoding a xenogenous immunoglobulin gene.
Alternatively, nuclear transfer may be performed using standard
methods to insert a nucleus or chromatin mass (i.e., one or more
chromosomes not enclosed by a membrane) from a selected transgenic
fibroblast into an enucleated oocyte (U.S. Ser. No. 60/258,151;
filed Dec. 22, 2000). These methods may also be used for cells in
which an endogenous alpha-(1,3)-galactosyltransferase, prion,
and/or J chain nucleic acid has been mutated.
[0422] Second Round of Mutagenesis and Nuclear Transfer If desired,
a cell (e.g., a fetal fibroblast) may be obtained from a transgenic
ungulate generated from the first round of nuclear transfer.
Another round of gene targeting may be performed as described above
to inactivate the second allele of the gene inactivated in the
first round of targeting. Alternatively, another immunoglobulin
(e.g., mu heavy chain, lambda light chain, kappa light chain, or J
chain), alpha-(1,3)-galactosyltransferase, or prion gene may be
inactivated in this round of targeting. For this second round of
targeting, either a higher concentration of antibiotic may be used
or a knockout construct with a different antibiotic resistance
marker may be used. Antibiotic resistance cells may be selected as
described above. The selected cells may be used in a second round
of nuclear transfer as described above to generate, for example, a
transgenic ungulate containing two mutations in endogenous
immunoglobulin genes and containing a HAC encoding a xenogenous
immunoglobulin gene. Alternatively, the selected antibiotic
resistant cells may first be treated to isolate G1 phase cells as
described below, which are used for the second round of nuclear
transfer.
[0423] For isolation of G1 cells for nuclear transfer,
5.0.times.10.sup.5 cells are plated onto 100 mm tissue culture
plates containing 10 ml of .alpha.-MEM+FCS, twenty four hours prior
to isolation. The following day, plates are washed with PBS and the
culture medium is replaced for 1-2 hours before isolation. The
plates are then shaken for 30-60 seconds on a Vortex-Genie 2
(Fisher Scientific, Houston, Tex., medium speed), the medium is
removed, spun at 1000 G for five minutes and the pellet is
re-suspended in 250 .mu.l of MEM+FCS. Newly divided cell doublets
attached by a cytoplasmic bridge, are then selected, as these cells
are in early G1. This isolation procedure is referred to as the
"shake off" method.
EXAMPLE 14
Additional Methods to Mutate Endogenous Immunoglobulin Genes
[0424] In some embodiments of the present approach, xenogenous
immunoglobulin production is accomplished essentially by the
combined use of homologous recombination techniques, introduction
of artificial chromosomes carrying entire xenogenous Ig loci,
nuclear transfer, and administration of an antibody to eliminate
endogenous antibody. More specifically, the process preferably
involves the targeted disruption of one or both alleles of the IgM
heavy chain gene, and optionally one or both alleles of the Ig
light chain gene, although xenogenous antibody production can also
be accomplished in wild-type animals (i.e., animals without Ig
knock outs). Gene knock outs may be effected by sequential
homologous recombination, then another mating procedure. In a
preferred embodiment, this is effected by initially effecting
targeted disruption of one allele of the IgM heavy chain gene of a
male or female ungulate (for example, bovine) fetal fibroblast in
tissue culture using a suitable homologous recombination vector.
The use of fetal fibroblasts is preferred over some other somatic
cells as these cells are readily propagated and genetically
manipulated in tissue culture. However, the use of fetal
fibroblasts is not essential to the invention, and indeed other
cell lines may be substituted therefor with equivalent results.
[0425] This process, of course, entails constructing a DNA
construct having regions of homology to the targeted IgM heavy
chain allele such that the construct upon integration into an IgM
heavy chain allele in the ungulate genome disrupts the expression
thereof. An exemplary vector for carrying out such targeted
disruption of an IgM allele is described in the example which
follows. In this regard, methods for constructing vectors that
provide for homologous recombination at a targeted site are well
known to those skilled in the art. Moreover, in the present
instance, the construction of a suitable vector is within the level
of skill in the art, given especially that the sequence of the
bovine IgM heavy chain and Ig lambda light chain genes are known,
as are the sequences of immunoglobulin genes from other ungulates
(see below) In order to facilitate homologous recombination, the
vectors used to effect homologous recombination and inactivation of
the IgM gene, respectively, comprise portions of DNA that exhibit
substantial sequence identity to the ungulate IgM heavy and Ig
light chain genes. Preferably, these sequences possessing at least
98% sequence identity, more preferably, at least 99% sequence
identity, and still more preferably will be isogenic with the
targeted gene loci to facilitate homologous recombination and
targeted deletion or inactivation.
[0426] Typically, and preferably the construct will comprise a
marker gene that provides for selection of desired homologous
recombinants, for example, fibroblast cells, wherein the IgM heavy
chain gene and/or Ig light chain gene has been effectively
disrupted. Exemplary marker genes include antibiotic resistance
markers, drug resistance markers, and green fluorescent protein,
among others. A preferred construct is shown in FIG. 2A and
starting materials used to make this construct in FIGS. 3A and 3B.
Other constructs containing two regions of homology to an
endogenous immunoglobulin gene, which flank a positive selection
marker (e.g., an antibiotic resistance gene) that is operably
linked to a promoter, may be generated using standard molecular
biology techniques and used in the methods of the present
invention.
[0427] The mu knockout construct shown in FIGS. 2A and 3C was
designed to remove the exons encoding the bovine immunoglobulin
heavy chain constant region, designated as "C-mu exons 1-4" and the
two exons encoding the transmembrane domain, designated "TM
exons".
[0428] To construct this vector, the region designated as "1", an
Xba1-Xho1 fragment from the genomic mu heavy chain bovine sequence,
was subcloned into the commercial DNA vector, pBluescript
(Stratagene, La Jolla, Calif.), previously cut with the enzymes
XbaI and XhoI. Once this fragment was cloned, there was a NotI
restriction enzyme recognition sequence adjacent to the Xba1 site,
used to insert a NotI fragment of approximately 3.5 Kb. This
fragment contains a neomycin resistance marker, described further
below. If desired, other mu knock out constructs may be constructed
using the genomic mu heavy chain sequence from another ungulate
breed, species, or genus (e.g., the mu heavy chain sequence
deposited as Genbank accession number U63637 from a Swiss
Bull/Holstein cross).
[0429] Once fragment "1" and the neomycin resistance marker were
joined together into pBluescript, there remained a Sac1 site
adjacent to the neomycin resistance marker. The new construct was
linearized with Sac1 and converted to a blunt end by filling in the
sticky ends left from the Sac1 digest, using DNA polymerase.
[0430] The fragment designated "2" was isolated as an XhoI-BstI1071
fragment and converted to a blunt-ended fragment by filling in the
sticky ends left from the Xho1 and BstI1071 enzymes, using DNA
polymerase.
[0431] Once finished, the final construct contained region 2, the
neomycin resistance marker and region 1, respectively.
[0432] For transfection of bovine fibroblasts, the construct was
digested with the restriction enzyme, Kpn1 (two Kpn1 sites are
shown in the diagram) and the DNA fragment was used for homologous
recombination.
[0433] The neomycin resistance construct was assembled as follows.
A construct designated "pSTneoB" (Katoh et al., Cell Struct. Funct.
12:575, 1987; Japanese Collection of Research Biologicals (JCRB)
deposit number: VE039) was designed to contain a neomycin
resistance gene under the control of an SV40 promoter and TK
enhancer upstream of the coding region. Downstream of the coding
region is an SV40 terminator sequence. The neo cassette was excised
from "pSTneoB" as a XhoI fragment. After the ends of the fragment
were converted to blunt ends using standard molecular biology
techniques, the blunt ended fragment was cloned into the EcoRV site
in the vector, pBS246 (Gibco/Life Technologies). This site is
flanked by loxP sites. The new construct, designated
"pLoxP-STNeoR", was used to generate the mu knockout DNA construct.
The desired fragment of this construct is flanked by loxP sites and
NotI sites, which were originally present in the pBS246 cloning
vector. The desired NotI fragment, which contains loxP-neo-loxP,
was used for replacement of the immunoglobulin mu constant region
exons. The SV40 promoter operably linked to the neomycin resistance
gene activates the transcription of the neomycin resistance gene,
allowing cells in which the desired NotI fragment has replaced the
mu constant region exons to be selected based on their resulting
antibiotic resistance.
[0434] After a cell line is obtained in which the IgM heavy chain
allele has been effectively disrupted, it is used as a nuclear
transfer donor to produce a cloned ungulate fetus (for example, a
cloned bovine fetus) and eventually a fetus or animal wherein one
of the IgM heavy alleles is disrupted. Thereafter, a second round
of gene targeted disruption can be effected using somatic cells
derived therefrom, e.g., fibroblasts, in order to produce cells in
which the second IgM heavy chain allele is inactivated, using a
similar vector, but containing a different selectable marker.
[0435] Preferably, concurrent to the first targeted gene
disruption, a second ungulate (for example, bovine) somatic cell
line is also genetically modified, which similarly may be of male
or female origin. If the first cell line manipulated is male, it is
preferable to modify a female cell line; vice versa if the first
cell line manipulated is female, it is preferable to select a male
cell line. Again, preferably, the manipulated cells comprise
ungulate (for example, bovine) fetal fibroblasts.
[0436] In a preferred embodiment, the female fetal fibroblast is
genetically modified so as to introduce a targeted disruption of
one allele of the Ig lambda light chain gene. This method similarly
is carried out using a vector having regions of homology to the
ungulate (for example, bovine) Ig lambda light chain, and a
selectable marker, which DNA construct is designed such that upon
integration and homologous recombination with the endogenous Ig
light chain results in disruption (inactivation) of the targeted Ig
lambda light gene.
[0437] Once a female fibroblast cell line is selected having the
desired targeted disruption, it similarly is utilized as a donor
cell for nuclear transfer or the DNA from such cell line is used as
a donor for nuclear transfer.
[0438] Alternatively, this cell may be subjected to a second round
of homologous recombination to inactivate the second Ig lambda
light chain using a similar DNA construct to that used to disrupt
the first allele, but containing a different selectable marker.
[0439] Methods for effecting nuclear transfer, and particularly for
the production of cloned bovines and cloned transgenic bovines have
been reported and are described in U.S. Pat. No. 5,945,577 issued
to Stice et al. and assigned to University of Massachusetts. Still,
alternatively the nuclear transfer techniques disclosed in WO
95/16670; WO 96/07732; WO 97/07669; or WO 97/07668, (collectively,
Roslin Methods) may be used. The Roslin methods differ from the
University of Massachusetts techniques in that they use quiescent
rather than proliferating donor cells. All of these patents are
incorporated by reference herein in their entirety. These nuclear
transfer procedures will produce a transgenic cloned fetus which
can be used to produce a cloned transgenic bovine offspring, for
example, an offspring which comprises a targeted disruption of at
least one allele of the Ig light chain gene and/or IgM gene. After
such cell lines have been created, they can be utilized to produce
a male and female heavy and light chain hemizygous knockout (M and
F Hemi H/L) fetus and offspring. Moreover, these techniques are not
limited to use for the production of transgenic bovines; the above
techniques may be used for nuclear transfer of other ungulates as
well.
[0440] Following nuclear transfer, production of desired animals
may be affected either by mating the ungulates or by secondary gene
targeting using the homologous targeting vector previously
described.
[0441] As noted previously, a further object of the invention
involves creating male and female heavy and light chain hemizygous
knockouts wherein such hemizygous knockouts are produced using the
cell lines already described. This may be affected either by mating
of the offspring produced according to the above described methods,
wherein an offspring which comprises a disrupted allele of the IgM
heavy chain gene is mated with another offspring which comprises a
disrupted allele of the Ig light chain. Alternatively, this may be
affected by secondary gene targeting by manipulating a cell which
is obtained from an offspring produced according to the
above-described procedures. This will comprise effecting by
homologous recombination targeted disruption of an allele of the
IgM heavy chain gene or allele of the Ig light chain. After a cell
line is produced which comprises a male and female heavy and light
chain hemizygous knockout (M and F Hemi H/L) it will be used to
produce a fetus or calf which comprises such a knockout. As noted,
this is effected either by mating or secondary gene targeting.
[0442] Once the male and female heavy and light chain hemizygous
knockouts are obtained, cells from these animals may be utilized to
create homozygous knockout (Homo H/L) fetuses. Again, this is
affected either by sequential gene targeting or mating.
Essentially, if affected by mating, this will involve mating the
male heavy and light chain hemizygous knockout with a female heavy
and light chain hemizygous knockout and selection of an offspring
which comprises a homozygous knockout. Alternatively, the cells
from the hemizygous knockout described above may be manipulated in
tissue culture, so as to knock out the other allele of the IgM or
Ig light chain (lambda) gene. Secondary gene targeting may be
preferred to mating as this may provide for more rapid results,
especially given that the gestation period of ungulates, such as
bovines, is relatively long.
Knockout Procedures to Produce Transgenic Ungulates that Express
Human Igs
[0443] Approaches for the production of Homo H/L fetuses or calves
are summarized in FIG. 1. There are three schemes outlined therein.
The first relies on successive knockouts in regenerated fetal cell
lines. This approach is the technically most difficult and has the
highest level of risk but as noted above potentially yields faster
results than breeding approaches. The other two schemes rely on
breeding animals. In the second scheme, only single knockouts of
heavy and light chain genes are required in male and female cell
lines, respectively. This scheme does not rely on regeneration of
cell lines and is technically the simplest approach but takes the
longest for completion. Scheme 3 is an intermediate between schemes
1 and 2. In all schemes only Homo H/L fetuses are generated because
of potential difficulties in survival and maintenance of Homo H/L
knockout calves. If necessary, passive immunotherapy can be used to
increase the survival of Homo H/L knockout calves.
[0444] Experimental Design The present invention preferably
involves the production of a hemizygous male heavy chain knockout
(M Hemi H) and a hemizygous female light chain knockout (F Hemi L)
and the production of 40 day fetuses from these targeted deletions.
The cells from the embryos are harvested, and one allele of the
light locus is targeted in the M Hemi H cells and one allele of the
heavy chain locus is targeted in the F Hemi L cells resulting in
cells with hemizygous deletions of both the H and L loci (Hemi
H/L). These cells are used to derive 40 day fetuses from which
fibroblasts are isolated.
[0445] The M Hemi H/L fibroblasts are targeted with the other H
chain allele to create M Homo H/Hemi L, and the F Hemi H/L are
targeted with the other L chain allele to create F Homo L/Hemi H.
In order to create homozygous deletions, higher drug concentrations
are used to drive homozygous targeting. However, it is possible
that this approach may not be successful and that breeding may be
necessary. An exemplary strategy which relies on cre/lox targeting
of the selection cassette allows the same selective systems to be
used for more than one targeted deletion. These fibroblasts are
cloned and 40 day fetuses harvested and fibroblast cells isolated.
The fetal cells from this cloning are targeted to produce
homozygous deletions of either the H or L loci resulting in M Homo
H/L and F Homo H/L fetal fibroblasts. These fibroblasts are cloned
and 40 day fetuses derived and fibroblasts isolated. The Homo H/L
fetal fibroblasts are then used for incorporation of the HAC
optionally by the use of breeding procedures.
[0446] Library Construction Fetal fibroblast cells are used to
construct a genomic library. Although it is reported to be
significant that the targeting construct be isogenic with the cells
used for cloning, it is not essential to the invention. For
example, isogenic, substantially isogenic, or nonisogenic
constructs may be used to produce a mutation in an endogenous
immunoglobulin gene. In one possible method, Holstein cattle, which
genetically contain a high level of inbreeding compared to other
cattle breeds, are used. We have not detected any polymorphisms in
immunoglobulin genes among different animals. This suggests that
sequence homology should be high and that targeting with
nonisogenic constructs should be successful.
[0447] A library is constructed from one male cell line and one
female cell line at the same time that the "clonability" testing is
being conducted. It is envisioned that at the end of the process, a
library will be produced and a number of different fetal cell lines
will be tested and one cell line chosen as the best for cloning
purposes.
[0448] Genomic libraries are constructed using high molecular
weight DNA isolated from the fetal fibroblast cells. DNA is size
fractionated and high molecular weight DNA between 20-23 Kb is
inserted into the lambda phage vector LambdaZap or LambdaFix. The
inventors have had excellent success with Stratagene prepared
libraries. Therefore, DNA is isolated and the size selected DNA is
sent to Stratagene for library preparation. To isolate clones
containing bovine heavy and light chains, radiolabeled IgM cDNA and
radiolabeled light chain cDNA is used. Additionally, light chain
genomic clones are isolated in case it is necessary to delete the
locus. Each fetal cell library is screened for bovine heavy and
light chain containing clones. It is anticipated that screening
approximately 10.sup.5-10.sup.6 plaques should lead to the
isolation of clones containing either the heavy chain or light
chain locus. Once isolated, both loci are subcloned into
pBluescript and restriction mapped. A restriction map of these loci
in Holsteins is provided in FIG. 2B (Knight et al. J Immunol
140(10):3654-9, 1988). Additionally, a map from the clones obtained
is made and used to assemble the targeting construct.
[0449] Production of Targeting Constructs Once the heavy and light
chain genes are isolated, constructs are made. The IgM construct is
made by deleting the IgM constant region membrane domain. As shown
by Rajewsky and colleagues in mice, deletion of the membrane domain
of IgM results in a block in B-cell development since surface IgM
is a required signal for continued B-cell development (Kitamura et
al., Nature 350:423-6). Thus homozygous IgM cattle lack B-cells.
This should not pose a problem since in the present strategy no
live births of animals lacking functional Ig are necessary.
However, if necessary, passive immunotherapy may be used to improve
the survival of the animals until the last step when the human Ig
loci are introduced.
[0450] An exemplary targeting construct used to effect knockout of
the IgM heavy chain allele is shown below in FIG. 2A. For the heavy
chain, the membrane IgM domain is replaced with a neomycin cassette
flanked by lox P sites. The attached membrane domain is spliced
together with the neo cassette such that the membrane domain has a
TAG stop codon inserted immediately 5' to the lox P site ensuring
that the membrane domain is inactivated. This is placed at the 5'
end of the targeting construct with approximately 5-6 kilobases of
3' chromosomal DNA.
[0451] If increasing drug concentrations does not allow deletion of
the second allele of either IgM heavy or light chains, the cre/lox
system (reviewed in Sauer, 1998, Methods 14:381-392) is used to
delete the selectable marker. As described below, the cre/lox
system allows the targeted deletion of the selectable marker. All
selectable markers are flanked with loxP sequences to facilitate
deletion of these markers if this should be necessary.
[0452] The light chain construct contains the bovine lambda chain
constant region (e.g., the lambda light chain constant region found
in Genbank accession number AF396698 or any other ungulate lambda
light chain constant region) and a puromycin resistance gene
cassette flanked by lox P sites and will replace the bovine gene
with a puromycin cassette flanked by lox P sites. Approximately 5-6
kilobases of DNA 3' to the lambda constant region gene will be
replaced 3' to the puromycin resistance gene. The puromycin
resistance gene will carry lox P sites at both 5' and 3' ends to
allow for deletion if necessary. Due to the high degree of homology
between ungulate antibody genes, the bovine lambda light chain
sequence in Genbank accession number AF396698 is expected to
hybridize to the genomic lambda light chain sequence from a variety
of ungulates and thus may be used in standard methods to isolate
various ungulate lambda light chain genomic sequences. These
genomic sequences may be used in standard methods, such as those
described herein, to generate knockout constructs to inactivate
endogenous lambda light chains in any ungulate.
[0453] A kappa light chain knockout construct may be constructed
similarly using the bovine kappa light chain sequence in FIG. 3G or
any other ungulate kappa light chain sequence. This bovine kappa
light chain may be used as a hybridization probe to isolate genomic
kappa light chain sequences from a variety of ungulates. These
genomic sequences may be used in standard methods, such as those
described herein, to generate knockout constructs to inactivate
endogenous kappa light chains in any ungulate.
[0454] Additional ungulate genes may be optionally mutated or
inactivated. For example, the endogenous ungulate Ig J chain gene
may be knocked out to prevent the potential antigenicity of the
ungulate Ig J chain in the antibodies of the invention that are
administered to humans. For the construction of the targeting
vector, the cDNA sequence of the bovine Ig J chain region found in
Genbank accession number U02301 may be used. This cDNA sequence may
be used as a probe to isolate the genomic sequence of bovine Ig J
chain from a BAC library such as RPC1-42 (BACPAC in Oakland,
Calif.) or to isolate the genomic sequence of the J chain from any
other ungulate. Additionally, the human J chain coding sequence may
be introduced into the ungulates of present invention for the
functional expression of human Ig.lamda. and IgM molecules. The
cDNA sequence of human J chain is available from Genbank accession
numbers AH002836, M12759, and M12378. This sequence may be inserted
into an ungulate fetal fibroblast using standard methods, such as
those described herein. For example, the human J chain nucleic acid
in a HAC, YAC vector, BAC vector, cosmid vector, or knockin
construct may be integrated into an endogenous ungulate chromosome
or maintained independently of endogenous ungulate chromosomes. The
resulting transgenic ungulate cells may be used in the nuclear
transfer methods described herein to generate the desired ungulates
that have a mutation that reduces or eliminates the expression of
functional ungulate J chain and that contain a xenogenous nucleic
acid that expresses human J chain.
[0455] Additionally, the ungulate
.alpha.-(1,3)-galactosyltransferase gene may be mutated to reduce
or eliminate expression of the galactosyl(.alpha.1,3)galactose
epitope that is produced by the .alpha.-(1,3)-galactosyltransferase
enzyme. If human antibodies produced by the ungulates of the
present invention are modified by this carbohydrate epitope, these
glycosylated antibodies may be inactivated or eliminated, when
administered as therapeutics to humans, by antibodies in the
recipients that are reactive with the carbohydrate epitope. To
eliminate this possible immune response to the carbohydrate
epitope, the sequence of bovine alpha-(1,3)-galactosyltransferase
gene may be used to design a knockout construct to inactive this
gene in ungulates (Genbank accession number J04989; Joziasse et
al., J. Biol. Chem. 264(24):14290-7, 1989). This bovine sequence or
the procine alpha-(1,3)-galactosyltransferase sequence disclosed in
U.S. Pat. Nos. 6,153,428 and 5,821,117 may be used to obtain the
genomic alpha-(1,3)-galactosyltransferase sequence from a variety
of ungulates to generate other ungulates with reduced or eliminated
expression of the galactosyl(.alpha.1,3)galactose epitope.
[0456] If desired, the ungulate prion gene may be mutated or
inactivated to reduce the potential risk of an infection such as
bovine spongiform encephalopathy (BSE). For the construction of the
targeting vector, the genomic DNA sequence of the bovine prion gene
may be used (Genbank accession number AJ298878). Alternatively,
this genomic prion sequence may be used to isolate the genomic
prion sequence from other ungulates. The prior gene may be
inactivated using standard methods, such as those described herein
or those suggested for knocking out the
alpha-(1,3)-galactosyltransferase gene or prion gene in sheep
(Denning et al., Nature Biothech., 19: 559-562, 2001).
[0457] For targeting the second allele of each locus, it may be
necessary to assemble a new targeting construct containing a
different selectable marker, if the first selectable marker remains
in the cell. As described in Table 12, a variety of selection
strategies are available and may be compared and the appropriate
selection system chosen. Initially, the second allele is targeted
by raising the drug concentration (for example, by doubling the
drug concentration). If that is not successful, a new targeting
construct may be employed.
[0458] The additional mutations or the gene inactivation mentioned
above may be incorporated into the ungulates of the present
invention using various methodologies. Once a transgenic ungulate
cell line is generated for each desired mutation, crossbreeding may
be used to incorporate these additional mutations into the
ungulates of the present invention. Alternatively, fetal fibroblast
cells which have these additional mutations can be used as the
starting material for the knockout of endogenous Ig genes and/or
the introduction of xenogenous Ig genes. Also, fetal fibroblast
cells having a knockout mutation in endogenous Ig genes and/or
containing xenogenous Ig genes can be uses as a starting material
for these additional mutations or inactivations.
[0459] Targeted Deletion of Ig Loci Targeting constructs are
introduced into embryonic fibroblasts, e.g., by electroporation.
The cells which incorporate the targeting vector are selected by
the use of the appropriate antibiotic. Clones that are resistant to
the drug of choice will be selected for growth. These clones are
then subjected to negative selection with gancyclovir, which will
select those clones which have integrated appropriately.
Alternatively, clones that survive the drug selection are selected
by PCR. It is estimated that it will be necessary to screen at
least 500-1000 clones to find an appropriately targeted clone. The
inventors' estimation is based on Kitamura (Kitamura et al., Nature
350:423-6, 1991) who found that when targeting the membrane domain
of IgM heavy chain constant region approximately 1 in 300 neo
resistant clones were properly targeted. Thus, it is proposed to
pool clones into groups of 10 clones in a 96 well plate and screen
pools of 10 clones for the targeted clones of choice. Once a
positive is identified, single clones isolated from the pooled
clone will be screened. This strategy should enable identification
of the targeted clone.
[0460] Because fibroblasts move in culture it is difficult to
distinguish individual clones when more than approximately ten
clones are produced per dish. Further, strategies may be developed
for clonal propagation with high efficiency transfection. Several
reasonable strategies, such as dilution cloning, may be used.
[0461] Cre/Lox Excision of the Drug Resistance Marker As shown
above, exemplary targeting constructs contain selectable markers
flanked by loxP sites to facilitate the efficient deletion of the
marker using the cre/lox system. Fetal fibroblasts carrying the
targeting vector are transfected via electroporation with a Cre
containing plasmid. A recently described Cre plasmid that contains
a GFPcre fusion gene [Gagneten S. et al., Nucleic Acids Res
25:3326-31 (1997)] may be used. This allows the rapid selection of
all clones that contain Cre protein. These cells are selected
either by FACS sorting or by manual harvesting of green fluorescing
cells via micromanipulation. Cells that are green are expected to
carry actively transcribed Cre recombinase and hence delete the
drug resistance marker. Cells selected for Cre expression are
cloned and clones analyzed for the deletion of the drug resistance
marker via PCR analysis. Those cells that are determined to have
undergone excision are grown to small clones, split and one aliquot
is tested in selective medium to ascertain with certainty that the
drug resistance gene has been deleted. The other aliquot is used
for the next round of targeted deletion. TABLE-US-00013 TABLE 12
Selectable markers and drugs for selection Gene Drug Neo.sup.r
G418.sup.1 Hph Hygromycin B.sup.2 Puro Puromycin.sup.3 Ecogpt
Mycophenolic acid.sup.4 Bsr Blasticidin S.sup.5 HisD
Histidinol.sup.6 DT-A Diphtheria toxin.sup.7 .sup.1Southern PJ,
Berg P. 1982. Transformation of mammalian cells to antibiotic
resistance with a bacterial gene under control of the SV40 early
region promoter. J Mol AppI Genet 1: 327-41. .sup.2Santerre RF,
Allen NE, Hobbs JN Jr, Rao RN, Schmidt RJ. 1984. Expression of
prokaryotic genes for hygromycin B and G418 resistance as
dominant-selection markers in mouse L cells. Gene 30: 147-56.
.sup.3Wirth M, Bode J, Zettlmeissl G, Hauser H. 1988. Isolation of
overproducing recombinant mammalian cell lines by a fast and simple
selection procedure. Gene 73: 419-26. .sup.4Drews RE, Kolker MT,
Sachar DS, Moran GP, Schnipper LE. 1996. Passage to nonselective
media transiently alters growth of mycophenolic acid-resistant
mammalian cells expressing the escherichia coli xanthine-guanine
phosphoribosyltransferase gene: implications for sequential
selection strategies. Anal Biochem 235: 215-26. .sup.5Karreman C.
1998. New positive/negative selectable markers for mammalian cells
on the basis of Blasticidin deaminase-thymidine kinase fusions.
Nucleic Acids Res 26: 2508-10. .sup.6Hartman SC, Mulligan RG. 1988.
Two dominant-acting selectable markers for gene transfer studies in
mammalian cells. Proc Natl Acad Sci USA 85: 8047-51. .sup.7Yagi T,
Nada S., Watanabe N, Tamemoto H, Kohmura N, Ikawa Y, Aizawa S.
1993. A novel negative selection for homologous recombinants using
diphtheria toxin A fragment gene. Anal Biochem 214: 77-86.
Application of Targeting Strategies to Altering Immunoglobulin
Genes of Other Ungulates
[0462] To alter immunoglobulin genes of other ungulates, targeting
vectors are designed to contain three main regions. The first
region is homologous to the locus to be targeted. The second region
is a drug selection marker that specifically replaces a portion of
the targeted locus. The third region, like the first region, is
homologous to the targeted locus but is not contiguous with the
first region in the wild type genome. Homologous recombination
between the targeting vector and the desired wild type locus
results in deletion of locus sequences between the two regions of
homology represented in the targeting vector and replacement of
that sequence with a drug resistance marker. In preferred
embodiments, the total size of the two regions of homology is
approximately 6 kilobases, and the size of the second region that
replaces a portion of the targeted locus is approximately 2
kilobases. This targeting strategy is broadly useful for a wide
range of species from prokaryotic cells to human cells. The
uniqueness of each vector used is in the locus chosen for gene
targeting procedures and the sequences employed in that strategy.
This approach may be used in all ungulates, including, without
limitation, goats (Capra hircus), sheep (Ovis aries), and the pig
(Sus scrufa), as well as cattle (Bos taurus).
[0463] The use of electroporation for targeting specific genes in
the cells of ungulates may also be broadly used in ungulates. The
general procedure described herein is adaptable to the introduction
of targeted mutations into the genomes of other ungulates.
Modification of electroporation conditions (voltage and
capacitance) may be employed to optimize the number of
transfectants obtained from other ungulates.
[0464] In addition, the strategy used herein to target the heavy
chain locus in cattle (i.e., removal of all coding exons and
intervening sequences using a vector containing regions homologous
to the regions immediately flanking the removed exons) may also be
used equally well in other ungulates. For example, extensive
sequence analysis has been performed on the immunoglobulin heavy
chain locus of sheep (Ovis aries), and the sheep locus is highly
similar to the bovine locus in both structure and sequence (Genbank
accession numbers Z71572, Z49180 through Z49188, M60441, M60440,
AF172659 through AF172703). In addition to the large number of cDNA
sequences reported for rearranged Ovis aries immunoglobulin chains,
genomic sequence information has been reported for the heavy chain
locus, including the heavy chain 5' enhancer (Genbank accession
number Z98207), the 3' mu switch region (Z98680) and the 5' mu
switch region (Z98681). The complete mRNA sequence for the sheep
secreted form of the heavy chain has been deposited as accession
number X59994. This deposit contains the entire sequence of four
coding exons, which are very homologous to the corresponding bovine
sequence.
[0465] Information on the sheep locus was obtained from Genbank and
used to determine areas of high homology with bovine sequence for
the design of primers used for PCR analysis. Because non-isogenic
DNA was used to target bovine cells, finding areas of high homology
with sheep sequence was used as an indicator that similar
conservation of sequences between breeds of cow was likely. Given
the similarity between the sequences and structures of the bovine
and ovine immunoglobulin loci, it would be expected that the
targeting strategies used to remove bovine immunoglobulin loci
could be successfully applied to the ovine system. In addition,
existing information on the pig (Sus scrofa, accession number
S42881) and the goat (Capra hircus, accession number AF140603),
indicates that the immunoglobulin loci of both of these species are
also sufficiently similar to the bovine loci to utilize the present
targeting strategies.
EXAMPLE 15
Bovine IgM Knockout
Removal of Exons 1-4 of Mu Heavy Chain Locus
[0466] The following procedures were used to generate bovine
fibroblast cell lines in which one allele of the immunoglobulin
heavy chain (mu) locus is disrupted by homologous recombination. A
DNA construct for effecting an IgM knockout was generated by the
removal of exons 1-4 of the Mu locus (corresponds to IgM heavy
chain gene) which were replaced with a copy of a neomycin
resistance gene. Using this construct, neomycin resistant cell
lines have been obtained which were successfully used in nuclear
transfer procedures, and blastocysts from these cell lines have
been implanted into recipient cows. Additionally, some of these
blastocysts were tested to confirm that targeted insertion occurred
appropriately in the mu locus using PCR procedures. Blastocysts
resulting from nuclear transfer procedures from several of the cell
lines obtained indicated that heterozygous IgM-KO fetuses were in
gestation. Additionally, both male and female cell lines that
comprise a single IgM heavy chain (mu) knockout have been produced.
It is anticipated that mating of animals cloned from these cell
lines will give rise to progeny wherein both copies of mu are
inactivated. These procedures are discussed in greater detail
below.
[0467] DNA Construct The DNA used in all transfections described in
this document was generated as follows. The four main exons
(excluding the transmembrane domain exons), CH1-4, are flanked by
an XhoI restriction site at the downstream (CH4) end and an XbaI
site at the upstream (CH1) end. The construct used for the
transfection procedure consisted of 1.5 kb of genomic sequence
downstream of the XhoI site and 3.1 Kb of genomic sequence upstream
of the XbaI site (FIGS. 3D and 3E). These sequences were isolated
as described herein from a Holstein cow from a dairy herd in
Massachusetts. A neomycin resistance marker was inserted between
these two fragments on a 3.5 Kb fragment, replacing 2.4 Kb of DNA,
originally containing CH1-4, from the originating genomic sequence.
The backbone of the vector was pBluescriptII SK+ (Stratagene) and
the insert of 8.1 Kb was purified and used for transfection of
bovine fetal fibroblasts. This construct is shown in FIGS. 3A-3C.
Other mu knockout constructs containing other homologous regions
and/or containing another antibiotic resistance gene may also be
constructed using standard methods and used to mutate an endogenous
mu heavy chain gene.
[0468] Transfection/Knockout Procedures Transfection of fetal
bovine was performed using a commercial reagent, Superfect
Transfection Reagent (Qiagen, Valencia, Calif., USA), Catalog
Number 301305.
[0469] Bovine fibroblasts were generated from disease-tested male
Charlais cattle at Hematech's Kansas facility and sent to
Hematech's Worcester Molecular Biology Labs for use in all
experiments described. Any other ungulate breed, genus, or species
may be used as the source of donor cells (e.g., somatic cells such
as fetal fibroblasts). The donor cells are genetically modified to
contain a mutation that reduces or eliminates the expression of
functional, endogenous Ig.
[0470] The medium used for culture of bovine fetal fibroblasts
consisted of the following components: 500 ml Alpha MEM
(Bio-Whittaker #12-169F); 50 ml fetal calf serum (Hy-Clone
#A-1111-D); 2 ml antibiotic/antimyotic (Gibco/BRL #15245-012); 1.4
ml 2-mercaptoethanol (Gibco/BRL #21985-023); 5.0 ml L-Glutamine
(Sigma Chemical #G-3126); and 0.5 ml tyrosine tartrate (Sigma
Chemical #T-6134)
[0471] On the day prior to transfection procedures, cells were
seeded in 60 mm tissue culture dishes with a targeted confluency of
40-80% as determined by microscopic examination.
[0472] On the day of transfection, 5 .mu.g of DNA, brought to a
total volume of 150 .mu.l in serum-free, antibiotic-free medium,
was mixed with 20 .mu.l of Superfect transfection reagent and
allowed to sit at room temperature for 5-10 minutes for
DNA-Superfect complex formation. While the complex formation was
taking place, medium was removed from the 60 mm tissue culture dish
containing bovine fibroblasts to be transfected, and cells were
rinsed once with 4 ml of phosphate-buffered saline. One milliliter
of growth medium was added to the 170 .mu.l DNA/Superfect mixture
and immediately transferred to the cells in the 60 mm dish. Cells
were incubated at 38.5.degree. C., 50% carbon dioxide for 2.5
hours. After incubation of cells with the DNA/Superfect complexes,
medium was aspirated off and cells were washed four times with 4 ml
PBS. Five ml of complete medium were added and cultures were
incubated overnight at 38.5.degree. C., 5% CO.sub.2. Cells were
then washed once with PBS and incubated with one ml of 0.3% trypsin
in PBS at 37.degree. C. until cells were detached from the plate,
as determined by microscopic observation. Cells from each 60 mm
dish were split into 24 wells of a 24 well tissue culture plate
(41.7 ul/well). One milliliter of tissue culture medium was added
to each well and plates were allowed to incubate for 24 hours at
38.5.degree. C. and 5% CO.sub.2 for 24 hours.
[0473] During all transfection procedures, sham transfections were
performed using a Superfect/PBS mixture containing no DNA, as none
of those cells would be expected to contain the neomycin resistance
gene and all cells would be expected to die after addition of G418
to the tissue culture medium. This served as a negative control for
positive selection of cells that received DNA.
[0474] After the 24 hour incubation, one more milliliter of tissue
culture medium containing 400 .mu.g G418 was added to each well,
bringing the final G418 concentration to 200 .mu.g/ml. Cells were
placed back into the incubator for 7 days of G418 selection. During
that period, both transfected and sham transfection plates were
monitored for cell death and over 7 days, the vast majority of
wells from the sham transfections contained few to no live cells
while plates containing cells that received the DNA showed
excellent cell growth.
[0475] After the 7 day selection period, the cells from wells at
90-100% confluency were detached using 0.2 ml 0.3% trypsin in PBS
and were transferred to 35 mm tissue culture plates for expansion
and incubated until they became at least 50% confluent, at which
point, cells were trypsinized with 0.6 ml 0.3% trypsin in PBS. From
each 35 mm tissue culture plate, 0.3 ml of the 0.6 ml cell
suspension was transferred to a 12.5 cm.sup.2 tissue culture flask
for further expansion. The remaining 0.3 ml was reseeded in 35 mm
dishes and incubated until they attained a minimal confluency of
approximately 50%, at which point cells from those plates were
processed for extraction of DNA for PCR analysis. Flasks from each
line were retained in the incubator until they had undergone these
analyses and were either terminated if they did not contain the
desired DNA integration or kept for future nuclear transfer and
cryopreservation.
[0476] Screening for targeted integrations As described above the
DNA source for screening of transfectants containing the DNA
construct was a 35 mm tissue culture dish containing a passage of
cells to be analyzed. DNA was prepared as follows and is adapted
from a procedure published by Laird et al. (Laird et al.,
"Simplified mammalian DNA isolation procedure", Nucleic Acids
Research, 19:4293). Briefly, DNA was prepared as follows. A cell
lysis buffer was prepared with the following components: 100 mM
Tris-HCl buffer, pH 8.5; 5 mM EDTA, pH 8.0; 0.2% sodium dodecyl
sulfate; 200 mM NaCl; and 100 ug/ml Proteinase K.
[0477] Medium was aspirated from each 35 mm tissue culture dish and
replaced with 0.6 ml of the above buffer. Dishes were placed back
into the incubator for three hours, during which time cell lysis
and protein digestion were allowed to occur. Following this
incubation, the lysate was transferred to a 1.5 ml microfuge tube
and 0.6 ml of isopropanol was added to precipitate the DNA. Tubes
were shaken thoroughly by inversion and allowed to sit at room
temperature for 3 hours, after which the DNA precipitates were spun
down in a microcentrifuge at 13,000 rpm for ten minutes. The
supernatant from each tube was discarded and the pellets were
rinsed with 70% ethanol once. The 70% ethanol was aspirated off and
the DNA pellets were allowed to air-dry. Once dry, each pellet was
resuspended in 30-50 ul of Tris (10 mM)-EDTA (1 mM) buffer, pH 7.4
and allowed to hydrate and solubilize overnight. 5-7 microliters of
each DNA solution was used for each polymerase chain reaction (PCR)
procedure.
[0478] Two separate PCR procedures were used to analyze
transfectants. The first procedure used two primers that were
expected to anneal to sites that are both located within the DNA
used for transfection. The first primer sequence is homologous to
the neomycin resistance cassette of the DNA construct and the
second is located approximately 0.5 Kb away, resulting in a short
PCR product of 0.5 Kb. In particular, primers Neo1 (5'-CTT GAA GAC
GAA AGG GCC TCG TGA TAC GCC-3', SEQ ID NO: 42) and IN2521 (5'-CTG
AGA CTT CCT TTC ACC CTC CAG GCA CCG-3', SEQ ID NO: 43) were used. A
Qiagen PCR kit was used for this PCR reaction. The PCR reaction
mixture contained 1 pmole of each primer, 5 ul of 10.times.
reaction buffer, 10 ul of Q solution, 5 ul of DNA, and 1 ul of dNTP
solution. The reaction mixture was brought to a total volume of 50
ul with H.sub.2O. This PCR amplification was performed using an
initial denaturing incubation at 94.degree. C. for two minutes.
Then, 30 cycles of denaturation, annealing, and amplification were
performed by incubation at 94.degree. C. for 45 seconds, 60.degree.
C. for 45 seconds, and 72.degree. C. for two minutes. Then, the
reaction mixture was incubated at 72.degree. C. for five minutes
and at 4.degree. C. until the mixture was removed from the PCR
machine. Alternatively, any other primers that are homologous to
the region of the knockout construct that integrates into the
genome of the cells may be used in a standard PCR reaction under
appropriate reaction conditions to verify that cells surviving G418
selection were resistant as a result of integration of the DNA
construct.
[0479] Because only a small percentage of transfectants would be
expected to contain a DNA integration in the desired location (the
Mu locus), another pair of primers was used to determine not only
that the DNA introduced was present in the genome of the
transfectants but also that it was integrated in the desired
location. The PCR procedure used to detect appropriate integration
was performed using one primer located within the neomycin
resistance cassette of the DNA construct and one primer that would
be expected to anneal over 1.8 Kb away, but only if the DNA had
integrated at the appropriate site of the IgM locus (since the
homologous region was outside the region included in the DNA
construct used for transfection). The primer was designed to anneal
to the DNA sequence immediately adjacent to those sequences
represented in the DNA construct if it were to integrate in the
desired location (DNA sequence of the locus, both within the region
present in the DNA construct and adjacent to them in the genome was
previously determined). In particular, primers Neo1 and OUT3570
(5'-CGA TGA ATG CCC CAT TTC ACC CAA GTC TGT C-3', SEQ ID NO: 44)
were used for this analysis. This PCR reaction was performed using
a Qiagen PCR kit as described above for the first PCR reaction to
confirm the integration of the targeting construct into the cells.
Alternatively, this PCR analysis may be performed using any
appropriate reaction conditions with any other primer that is
homologous to a region of the knockout construct that integrates
into the genome of the cells and any other primer that is
homologous to a region in the genome of the cells that is upstream
or downstream of the site of integration.
[0480] Using these methods, 135 independent 35 mm plates were
screened for targeted integration of the DNA construct into the
appropriate locus. Of those, DNA from eight plates was determined
to contain an appropriately targeted DNA construct and of those,
three were selected for use in nuclear transfer procedures. Those
cells lines were designated as "8-1C", "5-3C" and "10-1C". Leftover
blastocysts not used for transfer into recipient cows were used to
extract DNA which was subjected to additional PCR analysis. This
analysis was effective using a nested PCR procedure using primers
that were also used for initial screening of transfected lines.
[0481] As noted above, three cell lines were generated using the
gene targeting construct designed to remove exons 1-4 of the mu
locus. These lines all tested positive for targeted insertions
using a PCR based test and were used for nuclear transfers.
Leftover blastocysts resulting from those nuclear transfers were
screened by PCR testing the appropriately targeted construct. The
following frequencies of positive blastocysts were obtained:
Cell Line 8-1C: 6/8
Cell Line 10-1C: 2/16
Cell Line 5-3C: 0/16
[0482] Although at forty days of gestation, 11 total pregnancies
were detected by ultrasound, by day 60, 7 fetuses had died. The
remaining 4 fetuses were processed to regenerate new fetal
fibroblasts and remaining organs were used to produce small tissue
samples for PCR analysis. The results of the analyses are
below:
Line 8-1C: two fetuses, one fetus positive for targeted insertion
by PCR
Line 10-1C: one fetus, positive for targeted insertion by PCR
Line 5-3C: one fetus, negative for targeted insertion by PCR
[0483] Surprisingly, although the frequency of 10-1C blastocysts
testing positive for targeted insertion was only 2/16, the one
viable 60-day fetus obtained from that cell line was positive as
determined by PCR. A positive fetus from 8-1C was also obtained.
Southern blot analysis of DNA of all tissue samples is being
effected to verify that the construct not only targeted correctly
at one end (which is determined by PCR of the shorter region of
homology present in the original construct) but also at the other
end. Based on results to date, it is believed that two heavy chain
knockout fetuses from two independent integration events have been
produced. Also, since these fetuses were derived from two different
lines, at least one is likely to have integrated construct
correctly at both ends. Once the Southern blot analyses have
confirmed appropriate targeting of both ends of targeting
construct, further nuclear transfers will be performed to generate
additional fetuses which will be carried to term.
[0484] Nuclear Transfer and Embryo Transfer Nuclear transfers were
performed with the K/O cell line (8-1-C (18)) and eight embryos
were produced. A total of six embryos from this batch were
transferred to three disease free recipients at Trans Ova Genetics
("TOG"; Iowa).
[0485] Frozen embryos have been transferred to ten disease free
recipients to obtain disease free female fibroblast cell lines.
Fetal recoveries are scheduled after confirming the pregnancies at
35-40 days.
[0486] Pregnancy Diagnosis and Fetal Recovery Pregnancy status of
the eighteen recipients transferred with cloned embryos from
knockout fetal cells was checked by ultrasonography. The results
are summarized below. TABLE-US-00014 TABLE 13 Pregnancy at 40 days
using mu heavy chain knockout donor cells Clone ID No of recips
transferred Pregnancy at 40 days (%) 8-1-0C 5 4 (80) 10-1-C 6 4
(67) 5-3-C 5 3 (60) Total 16 11 (69)
[0487] Pregnancy Diagnosis Pregnancy status of the three recipients
to whom cloned embryos were transferred from knockout cells (8-1C)
was checked; one was open and the other two required reconfirmation
after one month.
[0488] Fetal Recoveries and Establishment of Cell Lines Eleven
pregnancies with the K/O embryos at 40 days were obtained. Four
live fetuses were removed out of these at 60 days. Cell lines were
established from all four and cryopreserved for future use. Also we
collected and snap froze tissue samples from the fetuses and sent
them to Hematech molecular biology laboratory for PCR/Southern blot
analysis.
[0489] All four of the cell lines were male. In order to secure a
female cell line, cell lines were established and cryopreserved for
future establishment of K/O cells from the fetuses (six) collected
at 55 days of gestation from the pregnancies established at Trans
Ova Genetics with disease free recipients. Recently, the existence
of a female cell line containing a mu knockout was confirmed. This
female cell line may be used to produce cloned animals which may be
mated with animals generated from the male cell lines, and progeny
screened for those that contain the double mu knockout.
[0490] If desired, a cell from the resulting knockout fetus or
knockout offspring can be used in a second round of nuclear
transfer to generate additional cloned offspring. Cells from the
initial knockout fetus or knockout offspring may also be frozen to
form a cell line to be used as a source of donor cells for the
generation of additional knockout ungulates.
Insertion of Transcription Termination Sequence into Mu Heavy Chain
Locus
[0491] Bovine fibroblast cell lines in which one allele of Ig.mu.
locus is mutated by insertion of a transcription termination
sequence were generated by homologous recombination. In particular,
transcription of functional, full-length Ig.mu. mRNA was prevented
by inserting a neomycin or puromycin-resistance gene (neo or puro,
described herein) and a transcription termination cassette (STOP)
in exon 2. Thus, the resulting immature Ig.mu. transcripts lack the
functional domain. For this method, a DNA targeting construct
containing a puro gene (i.e., the C.mu.KOpuro vector) was
electroporated into bovine fibroblast cell lines, and then
puromycin-resistant colonies were isolated. Based on PCR analysis,
homologous recombination in exon 2 occurred in some colonies. Thus,
bovine fibroblast cell lines in which one allele of the Ig.mu.
locus is mutated were generated. From the hemizygously mutated
(hemi-Ig.mu.KO) fibroblasts, three fetuses in which one allele of
the Ig.mu. locus is mutated were generated and the hemi-Ig.mu.KO
fibroblasts were reestablished. Then, a DNA targeting construct
containing a neo gene (i.e., the C.mu.KOneo vector) was
electroporated into the hemi-Ig.mu.KO fibroblasts, and
neomycin-resistant colonies were isolated. Based on PCR analysis,
homologous recombination in exon 2 of the remaining allele occurred
in some colonies. Thus, bovine fibroblast cell lines in which both
alleles of the Ig.mu. locus are mutated were generated. From the
homozygously mutated (homo-Ig.mu.KO) fibroblasts, five fetuses in
which both alleles of Ig.mu. locus are mutated were generated, and
the homo-Ig.mu.KO fibroblasts were reestablished. In this way,
bovine fibroblast cell lines in which both alleles of Ig.mu.locus
are mutated (homo-Ig.mu.KO) were generated. Alternatively,
homo-Ig.mu.KO fibroblasts can be generated using the same knockout
vector that was used to produce hemizygous knockout cells and a
higher concentration of antibiotic to select for homozygous
knockout cells. Homo-Ig.mu.KO calves can be generated from the
homo-Ig.mu.KO fibroblast cell lines, using either standard nuclear
transfer methods or any of the nuclear or chromatin transfer
methods described herein.
[0492] These methods are described further below.
[0493] Construction of Ig.mu. KO vectors The Ig.mu. KO vectors were
generated as follows (FIGS. 40A-40D). To isolate genomic DNA around
exon 2 of the Ig.mu. gene, a DNA probe was amplified by PCR using
the following primer pair 5'-TGGTCACTCCAAGTGAGTCG-3' (SEQ ID NO:
69) and 5'-TGGAGTGAAATCAGGTGAAGG-3' (SEQ ID NO: 70). Using this
probe, a bovine (Holstein) genomic .lamda. phage library was
screened, and four positive .lamda. phage clones were identified.
One clone out of the four clones was analyzed further by
restriction mapping. The 9 kilobases of XhoI-BamHI genomic fragment
containing all of the C.mu. exons was subcloned into pBluescript II
SK(-) in which the KpnI site is already replaced with SrfI site.
Then, both the puro and STOP cassettes were inserted at the BglII
site, which is just located in exon 2 of C.mu.. The orientation of
both puro and STOP cassettes was a sense strand-orientation
relative to the Ig.mu. gene. A diphtheria toxin gene (DT-A, Gibco)
was then added to the Not I site in the pBluescript II SK(-). DT-A
was inserted in forward orientation relative to the
puromycin-resistance gene in the targeting cassette to kill cells
in which the targeting cassette was randomly integrated in the
genome (pBC.mu..DELTA.KOpuro vector). Similarly, another KO vector
containing neo gene was constructed (pBC.mu..DELTA.NKOneo vector).
In some embodiments, the vector contains a stretch of DNA adjacent
to the DT-A negative selection marker to protect the negative
selection marker from a possible nuclease attack.
[0494] Transfection/Knockout Procedures Transfection of fetal
fibroblast cell lines (Holstein) was performed using the following
standard electroporation protocol. The medium used to culture the
bovine fetal fibroblasts contained 500 ml Alpha MEM (Gibco,
12561-049), 50 ml fetal calf serum (Hy-Clone #ABL13080), 5 ml
penicillin-streptomycin (SIGMA), and 1 ml 2-mercaptoethanol
(Gibco/BRL #21985-023). On the day prior to transfection, cells
were seeded on a T175 tissue culture flask with a confluency of
80-100%, as determined by microscopic examination. On the day of
transfection, about 10.sup.7 bovine fibroblasts cells were
trypsinized and washed once with alpha-MEM medium. After
resuspension of the cells in 800 .mu.l of alpha-MEM, 30 .mu.g of
the Srf I-digested KO vector (pB.C.mu..DELTA.KOpuro vector)
dissolved in Hepes buffer saline (HBS) containing 1 mM spermidine
was added to the cell suspension and mixed well by pipetting. The
cell-DNA suspension was transferred into an electroporation cuvette
and electroporated at 550 V and 50 .mu.F. After that, the
electroporated cells were plated onto thirty 48-well plates with
the alpha-MEM medium supplemented with the serum. After a 48
hour-culture, the medium was replaced with medium containing 1
.mu.g/ml of puromycin, and the cells were cultured for 2-3 weeks to
select puromycin resistant cells. After selection, all colonies
which reached close to 100% confluency were divided into two
replica plates (24-well and 48-well plates): one for genomic DNA
extraction, and the other plate for nuclear transfer. Genomic DNA
was extracted from the colonies to screen for the desired
homologous recombination events by PCR.
[0495] Screening for targeted integrations As described above, the
genomic DNA was independently extracted from each 24-well using the
PUREGENE DNA isolation Kit (Gentra SYSTEMS) according to the
manufacture's protocol. Each genomic DNA sample was resuspended in
20 .mu.l of 10 mM Tris-Cl (pH8.0) and 1 mM EDTA (EDTA). Screening
by PCR was performed using the following primer pair "F14"
(5'-ccacaaaggaaaaagctgcactgctatac-3'; SEQ ID NO: 71) and "R14"
(5'-tgtgggatcaggaggtcagatagacatc-3'; SEQ ID NO: 72). The sequence
of one primer is located in the KO vector, and the sequence of the
other primer is located just outside of the integrated vector in
the targeted endogenous locus (FIGS. 40A and 40B). Therefore, the
expected PCR product is detected only when the KO vector is
integrated into the targeted locus by homologous recombination. The
PCR reaction mixtures contained 17.9 .mu.l water, 3 .mu.l of
10.times.LA PCR buffer II (Mg.sup.2+ plus), 4.8 .mu.l of dNTP
mixture, 10 pmol of forward primer, 10 pmol of reverse primer, 2
.mu.l of genomic DNA, and 0.3 .mu.l of LA Taq. Forty cycles of PCR
were performed by incubating the reaction mixtures under the
following conditions: 85.degree. C. for three minutes, 94.degree.
C. for one minute, 98.degree. C. for 10 seconds, and 68.degree. C.
for five minutes. After PCR, the reaction mixtures were analyzed by
electrophoresis. Out of 423 screened clones, two clones (#147 and
#384) generated the expected PCR products. The identity of these
PCR products was confirmed by sequencing. Based on the presence of
a polymorphic marker, the KO vector was integrated into "allele A"
and "allele B" of C.mu. exon 2 in clones #384 and #147,
respectively. These two clones were used as donor cells to generate
fetuses as described below.
[0496] Chromatin transfer In vitro-matured oocytes were enucleated
at 20 hpm. Bovine Ig mu knockout clones were trypsinized and washed
in Ca/Mg Hank's Balanced Salt Solution (HBSS) and permeabilized by
incubation of 50,000-100,000 cells in 31.25 units Streptolysin O
(SLO-Sigma, St. Louis, Mo.) in 100 .mu.l for 30 minutes in a
37.degree. C. H.sub.2O bath. Cell samples were incubated with
propidium iodide and observed by florescent microscopy to monitor
permeabilization based on uptake of the dye.
[0497] Permeabilized fibroblasts were washed, pelleted, and
incubated in 40 .mu.l of mitotic extract prepared from MDBK cells
containing an ATP-generating system (1 mM ATP, 10 mM creatine
phosphate, and 25 .mu.g/ml creatine kinase) for 30 minutes in a
37.degree. C. H.sub.2O bath. Cell samples were stained with Hoechst
33342 and observed by florescent microscopy to monitor chromatin
condensation. At the end of incubation, the reaction mix was
diluted with 500 .mu.l cell culture media (Alpha MEM with 10% FBS).
These cells were pelleted and resuspended in TL Hepes and used for
chromatin transfer in enucleated oocytes as described herein. Three
fetuses (#2184-1, 2184-2, 3287) were determined to be hemizygous
Ig.mu. KO fetuses in which the puroKO vector is integrated into one
allele of the Ig.mu. gene. Fetuses #2184-1 and 2184-2 were derived
from clone #384, and fetus #3287 was derived from clone #147. Thus,
three bovine fibroblast cell lines in which one allele of the
Ig.mu. locus is mutated by the KO vector were successfully
generated. TABLE-US-00015 TABLE 14 Pregnancies, fetal recovery, and
cell lines with hemizygous Ig.mu. KO clones derived from primary
Holstein fibroblast cell line 6939 No of Ig.mu. Clone Total
Blastocyst No of Pregnant at 40 d Pregnant at 60 d No of fetuses
hemizygous ID CTs (%) recipients (%) (%) recovered KO fetuses 147
188 20 (15) 14 7 (50) 2 (14) 2 (14) 1 (#3287) 384 234 35 (22) 16 8
(50) 4 (25) 7* (25) 2 (#2184-1, #2184-2) Total 422 55 (19) 30 15
(50) 6 (20) 9 (30) 3 *Three sets of twins. Three correctly targeted
hemizygous Ig.mu. KO fetuses were identified (2184-1, 2184-2 and
3287).
[0498] 2.sup.nd Transfection/Knockout Procedures Transfection of
the hemi-Ig.mu.KO fetal fibroblast cell lines was performed using a
similar method. Clone #3287 in which the puroKO vector is
integrated into the "allele B" was extensively used for obtaining
homo-Ig.mu.KO clones. The medium used to culture the bovine fetal
fibroblasts contained 500 ml Alpha MEM (Gibco, 12561-049), 50 ml
fetal calf serum (Hy-Clone #ABL13080), 5 ml penicillin-streptomycin
(SIGMA), and 1 ml 2-mercaptoethanol (Gibco/BRL #21985-023). On the
day prior to transfection, cells were seeded on a T175 tissue
culture flask with a confluency of 80-100%, as determined by
microscopic examination. On the day of transfection, about 10.sup.7
bovine fibroblasts cells were trypsinized and washed once with
alpha-MEM medium. After resuspension of the cells in 800 .mu.l of
alpha-MEM, 30 .mu.g of the Srf I-digested KO vector
(pBC.mu..DELTA.NKOneo vector) dissolved in HBS containing 1 mM
spermidine was added to the cell suspension and mixed well by
pipetting. The cell-DNA suspension was transferred into an
electroporation cuvette and electroporated at 550 V and 50.degree.
F. After that, the electroporated cells were plated onto thirty
48-well plates with the alpha-MEM medium supplemented with the
serum. After a 48 hour culture, the medium was replaced with medium
containing 500 .mu.g/ml of G418, and the cells were cultured for
2-3 weeks to select G418 resistant cells. After selection, all
colonies that reached close to 100% confluency were divided into
two replica plates (24-well and 48-well plates): one plate for
genomic DNA extraction, and the other plate for nuclear transfer.
Genomic DNA was extracted from the colonies to screen for the
desired homologous recombination events by PCR.
[0499] Screening for homozygously targeted integrations As
described above, the genomic DNA was independently extracted from
each 24-well independently using the PUREGENE DNA isolation Kit
(Gentra SYSTEMS) according to the manufacture's protocol. Each
genomic DNA sample was resuspended in 20 .mu.l of 10 mM Tris-Cl
(pH8.0) and 1 mM EDTA (EDTA). Screening by PCR was performed using
the following primer pair "neoF3"
(5'-TTTGGTCCTGTAGTTTGCTAACACACCC-3'; SEQ ID NO: 73) and "neoR3"
(5'-GGATCAGTGCCTATCACTCCAGGTTG-3'; SEQ ID NO: 74). The sequence of
one primer is located in the KO vector, and the sequence of the
other primer is located just outside of the integrated vector in
the targeted endogenous locus (FIGS. 40C and 40D). Therefore, the
expected PCR product is detected only when the KO vector is
integrated into the targeted locus by homologous recombination. The
PCR reaction mixtures contained 17.9 .mu.l water, 3 .mu.l of
10.times.LA PCR buffer II (Mg.sup.2+ plus), 4.8 .mu.l of dNTP
mixture, 10 pmol of forward primer, 10 pmol of reverse primer, 2
.mu.l of genomic DNA, and 0.3 .mu.l of LA Taq. Forty cycles of PCR
were performed by incubating the reaction mixtures under the
following conditions: 85.degree. C. for three minutes, 94.degree.
C. for one minute, 98.degree. C. for 10 seconds, and 68.degree. C.
for seven minutes. After PCR, the reaction mixtures were analyzed
by electrophoresis. Out of 569 screened clones, seven clones (#76,
91, 184, 442, 458, 496, and 527) produced the expected PCR
products, which were confirmed by sequencing. Based on the presence
of a polymorphic marker, the KO vector integrated into "allele A"
of C.mu. exon 2 in all the clones except #184. Thus, the puroKO
vector and the neoKO vector integrated into "allele B" and "allele
A," respectively, of six homozygous Ig.mu. KO clones. Four clones
(#76, 91, 442, 458) were used as donor cells to generate fetuses as
described below.
[0500] Chromatin transfer In vitro-matured oocytes were enucleated
at 20 hpm. Bovine Ig mu knockout clones were trypsinized and washed
in Ca/Mg Hank's Balanced Salt Solution (HBSS) and permeabilized by
incubation of 50,000-100,000 cells in 31.25 units Streptolysin O
(SLO-Sigma, St. Louis, Mo.) in 100 .mu.l for 30 minutes in a
37.degree. C. H.sub.2O bath. Cell samples were incubated with
propidium iodide and observed by florescent microscopy to monitor
permeabilization based on uptake of the dye.
[0501] Permeabilized fibroblasts were washed, pelleted, and
incubated in 40 .mu.l of mitotic extract prepared from MDBK cells
containing an ATP-generating system (1 mM ATP, 10 mM creatine
phosphate, and 25 .mu.g/ml creatine kinase) for 30 minutes in a
37.degree. C. H.sub.2O bath. Cell samples were stained with Hoechst
33342 and observed by florescent microscopy to monitor chromatin
condensation. At the end of incubation, the reaction mix was
diluted with 500 .mu.l cell culture media (Alpha MEM with 10% FBS).
These cells were pelleted and resuspended in TL Hepes and used for
chromatin transfer in enucleated oocytes as described herein. Five
fetuses (#4658, 3655, 5109, 5139, and 4554) from clone #75 and
three fetuses (#4039-2, 5133-2, and 5112) from clone #91 are
homozygous Ig.mu. KO fetuses in which the puroKO vector and the
neoKO vector are integrated into "allele B" and "allele A,"
respectively. Thus, eight bovine fibroblast cell lines in which
both alleles of the Ig.mu. locus are mutated by the KO vectors were
successfully generated. TABLE-US-00016 TABLE 15 Embryo development
and transfers with homozygous Ig.mu. clones from hemizygous line
3287 No of No of No of IgM Total Blastocysts recipients Pregnant at
40 d fetuses homozygous Clone ID CTs (%) implanted (%) recovered KO
fetuses 91 1019 254 (36) 53 18 (34) 14* 3 442 249 50 (29) 06 5 (83)
7* 0 496 240 70 (42) 0 0 (0) 0 0 76 141 20 (20) 09 6 (67) 5 5 458
32 2 (09) 01 1 (100) 1 0 Total 1681 396 (34) 69 30 (43) 27 8 Two
sets of twins were produced with each clone. Eight correctly
targeted homozygous Ig.mu. KO fetuses identified (#4658, 3655,
5109, 5139, 4554, 4039-2, 5133-2, and 5112).
EXAMPLE 16
Optional Immunodepletion of Endogenous Antibodies
Production of Antibodies Reactive with Endogenous Ungulate
Antibodies
[0502] For the preparation of polyclonal antibodies reactive with
endogenous ungulate antibodies or B-cells, one or more ungulate
antibodies (e.g., polyclonal ungulate immunoglobulin, IgG, or IgM),
fragments of ungulate antibody proteins (e.g., mu heavy chain,
kappa light chain, or lambda light chain), or fusion proteins
containing defined portions of ungulate antibodies can be purified
from natural sources (e.g., serum samples or cultures of ungulate
B-cells) or synthesized in, e.g., mammalian, insect, or bacterial
cells by expression of corresponding DNA sequences contained in a
suitable cloning vehicle. Fusion proteins are commonly used as a
source of antigen for producing antibodies. Alternatively, mixtures
of ungulate antibodies, such as polyclonal ungulate immunoglobulin,
can be used as the antigen source. The ungulate antibodies can be
optionally purified, and then coupled to a carrier protein, mixed
with Freund's adjuvant to enhance stimulation of the antigenic
response in an inoculated animal, and injected into other
ungulates, rabbits, mice, or other laboratory animals. Primary
immunizations are carried out with Freund's complete adjuvant and
subsequent immunizations performed with Freund's incomplete
adjuvant. Following booster injections at bi-weekly intervals, the
inoculated animals are then bled and the sera isolated. The sera is
used directly or is purified prior to use by various methods,
including affinity chromatography employing reagents such as
Protein A-Sepharose, antigen-Sepharose, and anti-horse-1
g-Sepharose. Antibody titers can be monitored by Western blot and
immunoprecipitation analyses using ungulate antibodies. Immune sera
can be affinity purified using ungulate antibodies coupled to
beads. Antiserum specificity can be determined using a panel of
xenogenous antibodies (e.g., human antibodies), ungulate IgG, and
ungulate IgM molecules.
[0503] Alternatively, monoclonal antibodies are produced by
removing the spleen from the inoculated animal, homogenizing the
spleen tissue, and suspending the spleen cells suspended in
phosphate buffered saline (PBS). The spleen cells serve as a source
of lymphocytes, some of which produce antibody of the appropriate
specificity. These cells are then fused with permanently growing
myeloma partner cells, and the products of the fusion plated into a
number of tissue culture wells in the presence of selective agents,
such as hypoxanthine, aminopterine, and thymidine (Mocikat, J.
Immunol. Methods 225:185-189, 1999; Jonak et al., Hum. Antibodies
Hybridomas 3:177-185, 1992; Srikumaran et al., Science 220:522,
1983. The wells can then be screened by ELISA to identify those
containing cells making antibody capable of binding to ungulate
antibodies, fragments, or mutants thereof. These cells can then be
re-plated and, after a period of growth, the wells containing these
cells can be screened again to identify antibody-producing cells.
Several cloning procedures can be carried out until over 90% of the
wells contain single clones that are positive for specific antibody
production. From this procedure, a stable line of clones that
produce the antibody can be established. The monoclonal antibody
can then be purified by affinity chromatography using Protein A
Sepharose and ion-exchange chromatography, as well as variations
and combinations of these techniques. Once produced, monoclonal
antibodies are also tested for specific ungulate antibody
recognition by ELISA, Western blot, and/or immunoprecipitation
analysis (see, e.g., Kohler et al., Nature 256:495, 1975; Kohler et
al., European Journal of Immunology 6:511, 1976; Kohler et al.,
European Journal of Immunology 6:292, 1976; Hammerling et al., In
Monoclonal Antibodies and T Cell Hybridomas, Elsevier, New York,
N.Y., 1981; Ausubel et al., supra).
[0504] As an alternate or adjunct immunogen to an ungulate
antibody, peptides corresponding to relatively unique hydrophilic
regions of an ungulate antibody can be generated and coupled to
keyhole limpet hemocyanin (KLH) through an introduced C-terminal
lysine. Antiserum to each of these peptides can be similarly
affinity-purified on peptides conjugated to BSA, and specificity
tested by ELISA and Western blotting using peptide conjugates, and
by Western blotting and immunoprecipitation using xenogenous and
ungulate antibodies.
[0505] Antibodies of the invention can be produced using ungulate
antibody amino acid sequences that do not reside within highly
conserved regions, and that appear likely to be antigenic, as
evaluated by criteria such as those provided by the Peptide
Structure Program (Genetics Computer Group Sequence Analysis
Package, Program Manual for the GCG Package, Version 7, 1991) using
the algorithm of Jameson et al., CABIOS 4:181, 1988. These
fragments can be generated by standard techniques, e.g., by the
PCR, and cloned into any appropriate expression vector. For
example, GST fusion proteins can be expressed in E. coli and
purified using a glutathione-agarose affinity matrix (Ausubel et
al., supra). To generate horse polyclonal antibodies, and to
minimize the potential for obtaining antisera that is non-specific,
or exhibits low-affinity binding to an ungulate antibody, two or
three fusions may be generated for each fragment injected into a
separate animal. Antisera are raised by injections in series,
preferably including at least three booster injections.
[0506] In addition to intact monoclonal and polyclonal
anti-ungulate antibodies, various genetically engineered antibodies
and antibody fragments (e.g., F(ab')2, Fab', Fab, Fv, and sFv
fragments) can be produced using standard methods. Truncated
versions of monoclonal antibodies, for example, can be produced by
recombinant methods in which plasmids are generated that express
the desired monoclonal antibody fragment(s) in a suitable host.
[0507] Ladner (U.S. Pat. Nos. 4,946,778 and 4,704,692) describes
methods for preparing single polypeptide chain antibodies. Ward et
al., Nature 341:544-546, 1989, describes the preparation of heavy
chain variable domain which have high antigen-binding affinities.
McCafferty et al., Nature 348:552-554, 1990, show that complete
antibody V domains can be displayed on the surface of fd
bacteriophage, that the phage bind specifically to antigen, and
that rare phage (one in a million) can be isolated after affinity
chromatography. Boss et al., U.S. Pat. No. 4,816,397, describes
various methods for producing immunoglobulins, and immunologically
functional fragments thereof, that include at least the variable
domains of the heavy and light chains in a single host cell.
Cabilly et al., U.S. Pat. No. 4,816,567, describes methods for
preparing chimeric antibodies. In addition, the antibodies can be
coupled to compounds, such as toxins or radiolabels. An exemplary
anti-bovine light chain antibody has been previously described
(Goldsby et al., Vet. Immunol. Immunopath. 17: 25, 1987).
Exemplary Methods for Producing Equine Antibodies that are Reactive
with Bovine Antibodies
[0508] Antibodies against bovine immunoglobulin can be made in many
species, including the equine, caprine, ovine, porcine, or bovine.
A purified sample of bovine antibody is emulsified in an adjuvant
solution such as alum or Freund's adjuvant in a ratio of 3 parts
adjuvant solution to 1 part antibody. The solution is injected
subcutaneously in each shoulder and in each side of the neck of the
horse. Each site of injection receives 0.25 mg of antibody. A
second boost of emulsified antibody adjuvant solution is similarly
given at one month after the first immunization. Additional boosts
can be given to maintain high antibody titers.
[0509] The horse is bled starting at two weeks after the first
boost. Bleeding is performed using standard methods which consist
of restraining the horse in an appropriate shoot and inserting a
needle into the jugular vein which runs beneath the skin on either
side of the esophagus. The total blood volume is approximately 6%
of body weight and 15% of the blood volume can be collected every
two weeks.
[0510] Blood is allowed to clot, and the sample is spun in a
centrifuge to separate the clot. The liquid serum fraction is
decanted. Alternatively, clotting is prevented with either heparin
or EDTA, and the cells fraction is pelleted by centrifugation and
the plasma is decanted. Several standard methods can be used to
prepare a partially purified sample of antibody from either plasma
or serum. Exemplary methods include the standard Kohn fractionation
system, affinity chromatography with Staphylococcus aureous protein
A, and ion exchange chromatography.
[0511] Equine antibody may be preabsorbed against human
immunoglobulin to ensure that equine antibodies which cross react
with human antibody are removed. This step can be performed using
standard procedures such as passing the equine antibody fraction
through an affinity column made by attaching human immunoglobulin
to a solid support. This step ensures that administration of the
equine antibody to a bovine expressing human antibody does not
eliminate the desired B-cells expressing human antibody.
[0512] Alternatively, if human expressing B-cells are eliminated by
the equine antibody, B-cells or B-cell precursors from another
animal (e.g., a human) can be administered to the bovine during its
fetal stage or after it is born (see, for example, WO 01/35735,
filed Nov. 17, 2000).
Exemplary Methods for Immunodepleting Endogenous Ungulate
Antibodies
[0513] B-cell immunodepletion may be performed by injecting the
ungulate (e.g., a bovine, such as a newborn calf), with equine
immunoglobulin against bovine antibody. Immediately after birth the
calf is either intravenously infused with between 1 mg and 1 gram
(e.g., between 10 and 100 mg) of antibody or the antibody is given
orally. Antibody is preferably given up to 12 hours prior to
nursing or administration of colostrum. Additionally or
alternatively, the antibody is administered after nursing or
administration of colostrum.
[0514] The success of immunodepletion of bovine antibody expressing
B-cells can be monitored by several methods. Blood samples can be
collected and B-cells can be analyzed by FACS to determine the
proportion of B-cells producing bovine antibodies, human
antibodies, or chimeric bovine/human antibodies. In this assay,
fluorescently labeled anti-bovine Ig antibodies are used to bind Ig
molecules expressed on the surface of the B-cells, and the number
of B-cells labeled with these antibodies is determined using FACS.
The amount of antibodies secreted by B-cells is determined using a
standard ELISA capture assay with an anti-bovine Ig antibody.
Similar methods can be used to measure human antibody levels.
Blood, milk, or lymph samples may be taken at various time points,
such as 1, 2, or 3 times a week, to measure the residual endogenous
B-cell activity. Preferably, the amount of endogenous antibodies
secreted by B-cells, is reduced by at least 25, 50, 75, or 90%
compared to the corresponding amount in the absence of treatment
with an antibody reactive with endogenous B-cells or endogenous
antibody. Achieving this level of inhibition may require a few
days, a few weeks, or longer depending upon the dose and dosing
frequency of the particular compound that is administered to the
calves. If necessary, larger doses or more frequent dosing schemes
than those mentioned above may also be used to further reduce the
level of endogenous B-cell activity or to cause the desired
reduction in activity to be achieved sooner. As the bovine
antibodies derived from colostrums are depleted, the level of human
antibody should increase.
[0515] Additional immunodepletion can be performed to further
reduce the population B-cells expressing of bovine antibody. As the
animal grows, substantially higher amounts of antibody are required
to ensure successful B-cell depletion.
[0516] For the isolation of the xenogenous antibodies, blood, milk,
or lymph samples are taken from the calves at multiple intervals,
such as every day for 1, 3, 5, 7, 14, or more days, and used in
standard methods for the purification of the xenogenous antibody.
If desired, blood samples may also be analyzed for continued
inhibition of the production of endogenous antibodies by the
calves.
Inhibition of B-Cell Development in Fetuses
[0517] An anti-bovine IgM antibody (das6) was injected into fetuses
to demonstrate the ability of an antibody to inhibit the
development of B-cells in fetuses. Similar results are expected for
fetuses that contain a nucleic acid encoding a xenogenous antibody.
Three fetuses at day 75 of gestation were injected with 1.5 mg of
the anti-bovine IgM antibody. For this injection, the standard
surgical procedure described above was used to inject the antibody
into the peritoneal cavity of the fetuses. A similar injection
procedure was performed on two control fetuses, which were injected
with either 3.times.10.sup.7 fetal liver cells (FIGS. 28A and 28F)
or 1.8.times.10.sup.7 mouse bone marrow cells (FIGS. 28B and 28G),
which should not affect the number of B-cells in the fetuses. After
approximately 41 days, the three experimental and two control
fetuses were removed from the pregnant cows. Standard methods were
used to isolate peripheral blood lymphocytes from blood samples
from each of the fetuses.
[0518] To determine the percentage of peripheral blood lymphocytes
that were B-cells, these lymphocytes were analyzed using standard
FACS analysis for the expression of either IgM or antibody light
chain molecules, which are both expressed on the surface of
B-cells. As illustrated in FIG. 28A and FIG. 28B, approximately
19.82 to 26.61% of the peripheral blood lymphocytes from the
control fetuses expressed IgM. In contrast, only 7.78, 11.80, or
3.95% of the peripheral blood lymphocytes from the three fetuses
injected with the anti-bovine IgM antibody expressed IgM (FIGS.
28C-28E, respectively). As illustrated in FIG. 28F and FIG. 28G,
approximately 12.43 to 29.47% of the peripheral blood lymphocytes
from the control fetuses expressed antibody light chain molecules.
For the three fetuses injected with the anti-bovine IgM antibody,
2.54, 13.77, or 3.99% of the peripheral blood lymphocytes expressed
antibody light chain molecules (FIGS. 28H-28J, respectively). These
results indicate that the injection of the anti-bovine IgM antibody
reduced the number of B-cells in the peripheral blood of the
fetuses.
Fetal Cell Transplant Procedures for Tolerization in Ungulates and
Subsequent Administration of an Antibody to Inhibit the Production
of Endogenous Antibodies
[0519] If desired, ungulate fetuses can be tolerized to proteins or
cells from the same genus or species used to generate the antibody
that is later administered to eliminate endogenous antibody. This
tolerization should reduce or prevent any adverse reaction to the
administered, foreign antibody. In one tolerization technique,
fetuses in pregnant cows are injected with a combination of equine
marrow cells (2 to 3 mls of 2.times.10.sup.7 cells/ml) and
approximately 1-5 mg of equine serum proteins, such as of IgM, IgD,
IgG, IgE, or IgA on day 75 (2.5 months) of gestation. These cells
and proteins may be obtained from commercial sources or isolated
using standard cell purification techniques (such as FACS sorting)
or standard protein purification techniques (see, for example,
Ausubel et al., supra). The injection of equine bone marrow cells
into the fetus may be performed by exposing the gravid uterus of
the pregnant cow via flank incision. This procedure is done using
appropriate anesthetics and analgesics. Alternatively, the mouse
cells and proteins may be administered using transvaginal
ultrasound, which is minimally invasive. As these cells propagate
and integrate into the fetus, tolerance to equine cells is induced
in the developing animal.
[0520] If desired, one or more fetuses may be recovered during
gestation using standard Caesarian techniques to determine whether
T-cells from the fetus proliferate or produce cytokines in response
to equine antigens and to determine whether B-cells secrete
anti-equine antibodies.
[0521] Alternatively, these equine proteins or cells may be
administered after birth of the calves. Preferred postnatal routes
of administration include parenteral, intravenous, intraarterial,
intraventricular, subcutaneous, and intramuscular
administration.
[0522] The live calves may be immediately injected with an equine
antibody (e.g., an anti-IgM antibody) or held until later
administration, such as administration at 1, 2, 4, 6, 8, 10, 12, or
14 months of age. The calves are injected with equine antibody in
one or more sites, and the remaining xenogenous antibodies are
purified from blood, milk, or lymph samples from the calves, as
described above. If desired, blood samples may also be analyzed to
evaluate serum mouse Ig levels, bovine Ig levels, white blood cell
levels, and other markers of animal health.
[0523] As an alternative to the above method of injecting equine
cells into a fetus to induce tolerization, equine embryonic cells
may be injected into a bovine preimplantation embryo to form a
germ-line chimera (see, for example, Bradley et al., Nature
309:225-256, 1984). The preimplantation embryo may be an embryo in
a pregnant cow or an embryo that is cultured in vitro and then
transferred to a maternal host, as described below.
EXAMPLE 17
Transgenic Ungulates Having Reduced
.alpha.-1,3-Galactosyltransferase Activity
[0524] If desired, transgenic ungulates in which
.alpha.-1,3-galactosyltransferase is mutated can be generated to
prevent undesired glycosylation of xenogenous antibodies with a
galactose .alpha.(1,3)-galactose epitope. Bovine fibroblast cell
lines in which one allele of the .alpha.-1,3-galactosyltransferase
locus is mutated were generated by homologous recombination. The
DNA construct for generating the .alpha.-galactosyltransferase
knockout cells was used to prevent transcription of functional,
full-length .alpha.-galactosyltransferase mRNA by inserting both a
puromycin-resistance gene (puro, described herein) and a
transcription termination cassette (STOP) in exon 9 which contains
the catalytic domain. Thus, the resulting immature
.alpha.-galactosyltransferase transcripts lack the catalytic
domain. The DNA construct (i.e., the .alpha.-galactosyltransferase
KO vector) was electroporated into three independent bovine
fibroblast cell lines, and then puromycin-resistant colonies were
isolated. Based on PCR analysis, homologous recombination in the
exon 9 region occurred in some colonies. Thus, bovine fibroblast
cell lines in which one allele of .alpha.1,3-galactosyltransferase
locus is mutated were generated. If desired, the second allele can
be mutated by using the same knockout vector and a higher
concentration of antibiotic to select for homozygous knockout cells
or using another knockout vector with a different antibiotic
resistance gene. This method may also be applied to cells from
other ungulates to generate transgenic cells for use in the nuclear
transfer methods described herein to produce transgenic ungulates
of the present invention.
[0525] These methods are described further below.
[0526] Construction of an .alpha.-1,3-galactosyltransferase KO
vector The .alpha.-1,3-galactosyltransferase KO vector was
generated as follows (FIG. 23). To isolate genomic DNA around exon
9 of the .alpha.-1,3-galactosyltransferase gene, a DNA probe was
amplified by PCR using the following primer pair
5'-gatgatgtctccaggatgcc-3' (SEQ ID NO: 61) and
5'-gacaagcttaatatccgcagg-3' (SEQ ID NO: 62). Using this probe, a
bovine genomic .lamda. phage library was screened, and 7 positive
.lamda. phage clones were identified. One clone, which contained
DNA from a male Charolais bovine fibroblast cell, was analyzed
further by restriction mapping. The Not I-Xho I genomic fragment
containing exon 9 was subcloned into pBluescript II SK(-) in which
the Kpn I site had already been replaced with Srf I, and then both
puro and STOP cassettes were inserted at the Avi I site in the Not
1-Xho I genomic fragment which is 5' to the catalytic domain. The
orientation of both puro and STOP cassettes was a sense
strand-orientation relative to the
.alpha.-1,3-galactosyltransferase gene. DT-A diphtheria toxin gene
(DT-A, Gibco) was also added to Not I site of the vector construct.
DT-A was inserted in forward orientation relative to the
puromycin-resistance gene in the targeting cassette to kill cells
in which the targeting cassette was randomly integrated in the
genome.
[0527] Transfection/Knockout Procedures Transfection of three fetal
fibroblasts cell lines (two from a male Jersey bovine and one from
a female Jersey bovine) was performed using a standard
electroporation protocol as follows. The medium used to culture the
bovine fetal fibroblasts contained 500 ml Alpha MEM (Gibco,
12561-049), 50 ml fetal calf serum (Hy-Clone #ABL13080), 5 ml
penicillin-streptomycin (SIGMA), and 1 ml 2-mercaptoethanol
(Gibco/BRL #21985-023). On the day prior to transfection, cells
were seeded on a T175 tissue culture flask with a targeted
confluency of 80-100%, as determined by microscopic examination. On
the day of transfection, about 10.sup.7 bovine fibroblasts cells
were trypsinized and washed once with alpha-MEM medium. After
resuspension of the cells in 800 .mu.l of alpha-MEM, 30 .mu.g of
the Srf I-digested DNA was added to the cell suspension and mixed
well by pipetting. The cell-DNA suspension was transferred into an
electroporation cuvette and electroporated at 1,000 V and 50 .mu.F.
After that, the electroporated cells were plated onto twenty
24-well plates with the alpha-MEM medium supplemented with the
serum. After a 48 hour-culture, the medium was replaced with medium
containing 1 .mu.g/ml of puromycin, and the cells were cultured for
2-3 weeks to select puromycin resistant cells. After selection, all
colonies which reached close to 100% confluency were picked, and
genomic DNA was extracted from the colonies to screen for the
desired homologous recombination events by PCR.
[0528] Screening for targeted integrations As described above, the
genomic DNA was extracted from each 24-well independently using the
PUREGENE DNA isolation Kit (Gentra SYSTEMS) according to the
manufacture's protocol. Each genomic DNA sample was resuspended in
20 .mu.l of 10 mM Tris-Cl (p H8.0) and 1 mM EDTA (EDTA). Screening
by PCR was performed using the following primer pair
5'-aagaagagaaaggtagaagaccccaaggac-3' (SEQ ID NO: 63) and
5'-cctgggtatagacaggtgggtattgtgc-3' (SEQ ID NO: 64). The sequence of
one primer is located in the alpha-1,3-galactosyltransferase KO
vector, and the sequence of the other primer is located just
outside of the integrated vector in the targeted endogenous locus
(FIG. 23). Therefore, the expected PCR product should be detected
only when the KO vector is integrated into the targeted locus by
homologous recombination.
[0529] The PCR reaction mixtures contained 18.9 .mu.l water, 3
.mu.l of 10.times.LA PCR buffer II (Mg.sup.2+ plus), 4.8 .mu.l of
dNTP mixture, 10 pmol forward primer, 10 pmol of reverse primer, 1
.mu.l of genomic DNA, and 0.3 .mu.l of LA Taq. Forty cycles of PCR
were performed by incubating the reaction mixtures at the following
conditions: 85.degree. C. for three minutes, 94.degree. C. for one
minute, 98.degree. C. for 10 seconds, and 68.degree. C. for 15
minutes. After PCR, the reaction mixtures were analyzed by
electrophoresis. Puromycin-resistant clones which generated PCR
products of the expected size were selected (FIG. 23). Thus, bovine
fibroblast cell lines in which one allele of the
.alpha.-1,3-galactosyltransferase locus is mutated by the KO vector
were successfully generated.
EXAMPLE 18
Alternative Method for Producing Transgenic Ungulates Using
Adeno-Associated Viruses to Mutate an Endogenous Gene
[0530] Adeno-associated virus (AAV) can be used for specific
replacement of targeted sequences present in the genome of cells
(Inoue et al., Mol. Ther. 3(4):526-530, 2001); Hirata et al., J.
Virol. 74(10):16536-42, 2000); Inoue et al., J. Virol.
73(9):7376-80, 1999); and Russell et al., Nat. Genet. 18(4):325-30,
1998)). The gene targeting rate is highly efficient in comparison
to more conventional gene targeting approaches. AAV has a broad
range of host and tissue specificities, including specificity for
both bovine and human skin fibroblasts. Thus, AAV can be used to
produce transgenic ungulate cells containing one or more mutations
in an endogenous immunoglobulin (e.g., mu heavy chain, lambda light
chain, kappa light chain, or J chain),
alpha-(1,3)-galactosyltransferase, or prion gene. These transgenic
cells can then be used in the nuclear transfer methods described
herein to produce transgenic ungulates of the present
invention.
[0531] Using AAV resulted in homologous recombination of the bovine
immunoglobulin heavy chain locus at higher frequencies than
previously obtained using traditional gene targeting strategies
(i.e., electroporation and lipofection procedures). In the first
round of gene targeting experiments, five appropriately targeted
fibroblast clones were obtained out of 73 stable transductants
containing the DNA introduced through an AAV vector.
[0532] These experiments were carried out as follows.
[0533] AAV Knockout Vectors AAV constructs can disrupt a gene
either by simple insertion of foreign sequences or replacement of
endogenous sequences with new sequence present in the AAV vector.
FIG. 24 shows an AAV construct in which all four coding exons of
the bovine immunoglobulin heavy chain mu constant region are
present on a 2822 base pair BamHI-XhoI fragment. A 1.16 Kb fragment
containing a neomycin resistance marker present in the commercially
available vector, pMC1Neo, was inserted into a SacII site present
in exon 4 of the mu heavy chain locus from a Holstein bovine. This
locus is the one contained in the phage clone isolated to generate
the knockout vector described herein. To generate the AVV vector,
the SacII site in the mu heavy chain locus was filled in to create
blunt ends, which were then ligated to blunt SalI linkers (New
England Biolabs). Then, the XhoI fragment of pMC1Neo, which
contains the neomycin resistance gene, was ligated to the SalI site
added to the locus through the Sail linker. This ligation can be
performed because the XhoI and SalI restriction sites have
compatible ends. This knockout vector causes a disruptional
insertion of the neomycin resistance gene into the endogenous mu
heavy chain gene, thereby inactivating the mu heavy chain gene.
This gene inactivation occurs without deleting regions of the
endogenous mu locus.
[0534] An alternative vector was designed to remove exons 3 and 4
from the endogenous locus during targeting, resulting in the
replacement of these two exons with a functional copy of the
neomycin resistance gene (FIG. 25). This construct was generated
using PCR amplification of genomic DNA from a female Jersey bovine.
In particular, the 3' region of homology was amplified using the
following primers: 5' GGGGTCTAGAgcagacactacactgatgggcccttggtcc 3'
(SEQ ID NO: 65), which adds a XbaI restriction site, and 5'
GGGGAAGCTTcgtgtccctggtcctgtctgacacag 3' (SEQ ID NO: 66), which adds
a HindIII restriction site. The 5' region of homology was amplified
with primers 5' GGGGCTCGAGgtcggcgaaggatggggggaggtg 3' (SEQ ID NO:
67), which adds a XhoI restriction site, and 5'
GGGGGGTACCgctgggctgagctgggcagagtggg 3' (SEQ ID NO: 68), which adds
a KpnI restriction site. The capitalized nucleotides in these
primer sequences are nucleotides that do not anneal to the mu heavy
chain locus but are included in the primers to add restriction
sites to facilitate later subcloning steps. The first four guanines
are added to separate the restriction sites from the very end of
the primers because restriction enzymes do not cleave sites that
are at the very end of primers as well as internal sites. The 5'
region of homology is 1.5 Kb long and contains exons 1 and 2. The
5' region of homology also contains the first 25 nucleotides of
exon 3 to maintain the splice acceptor site of exon 3. The splice
acceptor site allows exon 3 to be used for splicing and thus
prevents the possible splicing of exons 1 and 2 to the downstream
transmembrane domain to form an aberrant membrane-bound product.
The 3' region of homology is 1.24 Kb long and contains the region
immediately downstream of exon 4.
[0535] For the construct shown in FIG. 24, the targeting cassette
was inserted into the AAV vector reported by Ryan et al. (J. of
Virology 70:1542-1553, 1996), which contains viral long terminal
repeat (LTR) sequences, using standard methods. The AAV vector was
packaged into capsids using the TtetA2 packaging cell line as
previously described (Inoue and Russell, 1998, J. Virol.
72:7024-7031, 1998) and purified as previously described
(Zolotukhin et al., Gene Therapy, 6: 973-985, 1999). For the
construct shown in FIG. 25, the above method or any other standard
method can be used to insert the targeting cassette into the AAV
vector described by Ryan et al. or any other AAV vector (such as a
commercially available vector from Stratagene) and generate viruses
containing the vector.
[0536] Transduction procedures Fibroblasts from a female Jersey
bovine were seeded into one well of a 48 well tissue culture plate
at 40,000 cells per well and cultured in complete medium at
38.5.degree. C. and 5% CO.sub.2 until cells attached to the bottom
surface of the well. Once cells adhered, the medium was removed and
replaced with 0.2 ml of fresh medium containing AAV particles with
the vector shown in FIG. 24 at a multiplicity of infection (MOI) of
500-20,000 particles/cell. The MOI was chosen based on pilot
experiments that determined the resulting numbers of colonies and
the spacing of the colonies during the drug selection phase. Plates
were incubated overnight. After this incubation, the transduced
wells were rinsed with calcium and magnesium-free PBS and detached
from the wells using either trypsin or the cell dissociation buffer
described above. A uniform cell suspension was obtained by gentle
pipetting of the detached cells, and the cells from the well were
redistributed among ten 100 mm tissue culture dishes. Dishes were
incubated with complete medium overnight.
[0537] Following this incubation of the 100 mm dishes, the medium
was replaced with selective medium containing G418 at a
concentration of 350 micrograms/ml. Selective medium was changed
every 2-3 days until colonies were macroscopically visible on the
surface of the dish. At that point, individual colonies were picked
and transferred into their own vessels.
[0538] Regions containing colonies were marked on the outer surface
of the tissue culture dish. Once all colonies were circled, medium
was aspirated off the plates, and the plates were washed three
times with calcium and magnesium-free PBS. After washing, the
plates were flooded with a 1:25 dilution of 1.times. trypsin and
allowed to sit at room temperature until the colonies had visibly
begun to detach from the surface of the plate. Plates were kept
stationary to prevent detached colonies from floating to another
location of the plate. A pipette tip was used to pick up cell
clumps in a volume of 50 microliters, and the contents of the
pipette tip were transferred into one well of a 24 well tissue
culture plate. Once all colonies were transferred, complete medium
containing G418 was added, and the isolated clones were allowed to
proliferate to near confluency.
[0539] When an individual well was close to confluency, it was
washed twice with calcium and magnesium free PBS. Cells were
detached using 0.2 ml of cell dissociation buffer. Of this cell
suspension, 20 .mu.l was transferred to a new 24 well plate, and
the remaining cells were allowed to reattach to the surface of the
original 24 well plate following the addition of 2.0 ml of complete
medium. The original plate was incubated to 100% confluency. The
new plate serves as a source of appropriately targeted cells for
future bovine cloning procedures.
[0540] When a well from the original 24 well plate became 100%
confluent, the medium was removed, and the cells were washed once
with PBS. PBS was removed and replaced with a cell lysis buffer
adopted from Laird et al. (Nucleic Acids Res. 19:4293, 1991).
Briefly, 0.2 ml of lysis buffer containing 200 mM NaCl, 100 mM
Tris-HCl pH 8.5, 5 mM EDTA, 0.2% SDS, and 100 ug/ml proteinase K
was added to the well. The plate was returned to the incubator for
between three hours and overnight. The viscous cell lysate was then
transferred to a microfuge tube. An equal volume of isopropanol was
added to precipitate DNA. Following a 10 minute spin in a
microfuge, the supernatant was discarded, and the pellet was washed
once with 0.5 ml of 70% ethanol. After removal of the ethanol, the
DNA pellet was air-dried and resuspended in 35 microliters of TE
buffer (10 mM Tris pH 8 and 1 mM EDTA). Aliquots of 3 .mu.l were
used for PCR analysis.
[0541] PCR analysis DNA samples from drug resistant clones
transduced with AAV particles were screened for appropriate
targeting of the vector using PCR analysis. This screening strategy
used one primer that anneals within the DNA encoding the drug
selection marker and another primer that anneals within the
targeted locus, but outside the sequence present in the AAV
targeting particles. PCR products are only detected if the AAV
targeting DNA has integrated into the desired location of the
endogenous genome.
[0542] Results from a single targeting experiment using these AAV
particles are shown in FIG. 26. Based on this analysis, five out of
73 independent clones contained the appropriate targeted vector
DNA.
[0543] This method may also be used with the AAV vector shown in
FIG. 25 or with any other appropriate adenovirus or
adeno-associated viral vector. If desired, the second mu heavy
chain allele can be mutated in the isolated colonies by transducing
them with an AAV vector with a different antibiotic resistance gene
(i.e., a gene other than a neomycin resistance gene). To select the
resulting homozygous knockout cells, the infected cells are
cultured in the presence of the corresponding antibiotic.
Alternatively, the isolated colonies can be transduced with an AAV
vector containing a neomycin resistance gene and cultured in the
presence of a high concentration of antibiotic (i.e., a
concentration of antibiotic that kills heterozygous knockout cells
but not homozygous knockout cells).
EXAMPLE 19
Testing for Human Ig Expression
[0544] Testing calves retaining a HAC or other nucleic acid
encoding a xenogenous antibody may begin shortly after birth and
includes evaluation for (1) xenogenous Ig expression, (2) response
to immunization, (3) affinity maturation, and (4) transmission of
the HACs to offspring.
[0545] Human Ig expression may be monitored by bleeding the animals
and assaying for the presence of human heavy and light chain
expression by ELISA, RT-PCR, or FACS analysis (see, for example, WO
01/35735, filed Nov. 17, 2000). Once it has been determined that
the animals produce human Ig, animals are immunized with tetanus
toxoid in adjuvant. Animals are bled once a week following
immunization and responses to antigen determined via ELISA or FACS
and compared to pre-bleeds collected before immunization. One month
after the initial immunization, animals are boosted with an aqueous
form of the antigen. One week following the boost, the animals are
bled and response to antigen is measured via ELISA or FACS and
compared to the prebleed. The ELISA or FACS assay permits
measurement of most of the titer of the response as well as the
heavy chain isotypes produced. This data allows a determination of
an increase in antibody titer as well as the occurrence of class
switching. Estimates of average affinity are also measured to
determine if affinity maturation occurs during the response to
antigen.
[0546] After the transgenic bovines have been obtained as described
above, they are utilized to produce transgenic Igs, preferably
human, but potentially that of other species, e.g. dog, cat,
non-human primate, other ungulates such as sheep, pig, goat,
murines such as mouse, rat, guinea pig, rabbit, etc. As noted, Ig
genes are known to be conserved across species.
Transgenic Antisera and Milk Containing Xenogenous Antibodies
[0547] The bovine (or other ungulate) yields transgenic antisera
directed to whatever antigen(s) it is endogenously exposed, or to
exogenously administered antigen(s). For example, antigens may be
administered to the ungulate to produce desired antibodies reactive
with the antigens, including antigens such as pathogens (for
example, bacteria, viruses, protozoans, yeast, or fungi), tumor
antigens, receptors, enzymes, cytokines, etc. Exemplary pathogens
for antibody production include, without limitation, hepatitis
virus (for example, hepatitis C), immunodeficiency virus (for
example, HIV), herpes virus, parvovirus, enterovirus, ebola virus,
rabies virus, measles virus, vaccinia virus, Streptococcus (for
example, Streptococcus pneumoniae), Haemophilus (for example,
Haemophilus influenza), Neisseria (for example, Neisseria
meningitis), Coryunebacterium diptheriae, Haemophilus (for example,
Haemophilus pertussis), Clostridium (for example, Clostridium
botulinium), Staphylococcus, Pseudomonas (for example, Pseudomonas
aeruginosa), and respiratory syncytial virus (RSV).
[0548] One or more pathogens may be administered to a transgenic
ungulate to generate hyperimmune serum useful for the prevention,
stabilization, or treatment of a specific disease. For example,
pathogens associated with respiratory infection in children may be
administered to a transgenic ungulate to generate antiserum
reactive with these pathogens (e.g., Streptococcus pneumoniae,
Haemophilus influenza, and/or Neissaria meningitis). These
pathogens may optionally be treated to reduce their toxicity (e.g.,
by exposure to heat or chemicals such as formaldehyde) prior to
administration to the ungulate.
[0549] For the generation of broad spectrum Ig, a variety of
pathogens (e.g., multiple bacterial and/or viral pathogens) may be
administered to a transgenic ungulate. This hyperimmune serum may
be used to prevent, stabilize, or treat infection in mammals (e.g.,
humans) and is particularly useful for treating mammals with
genetic or acquired immunodeficiencies.
[0550] In addition, antibodies produced by the methods of the
invention may be used to suppress the immune system, for example,
to treat neuropathies, as well as to eliminate particular human
cells and modulate specific molecules. For example, anti-idiotypic
antibodies (i.e., antibodies which inhibit other antibodies) and
antibodies reactive with T-cells, B-cells, or cytokines may be
useful for the treatment of autoimmune disease or neuropathy (e.g.,
neuropathy due to inflammation). These antibodies may be obtained
from transgenic ungulates that have not been administered an
antigen, or they may be obtained from transgenic ungulates that
have been administered an antigen such as a B-cell, T-cell, or
cytokine (e.g., TNF.alpha.).
[0551] Transgenic antisera generated from transgenic ungulates that
have not been administered an antigen may be used to manufacture
pharmaceuticals comprising human polyclonal antibodies, preferably
human IgG molecules. These human antibodies may be used in place of
antibodies isolated from humans as Intravenous Immunoglobulin
(IVIG) therapeutics.
[0552] Transgenic antiserum may optionally be enriched for
antibodies reactive against one or more antigens of interest. For
example, the antiserum may be purified using standard techniques
such as those described by Ausubel et al. (Current Protocols in
Molecular Biology, volume 2, p. 11.13.1-11.13.3, John Wiley &
Sons, 1995). Preferred methods of purification include
precipitation using antigen or antibody coated beads, column
chromatography such as affinity chromatography, magnetic bead
affinity purification, and panning with a plate-bound antigen.
Additionally, the transgenic antiserum may be contacted with one or
more antigens of interest, and the antibodies that bind an antigen
may be separated from unbound antibodies based on the increased
size of the antibody/antigen complex. Protein A and/or protein G
may also be used to purify IgG molecules. If the expression of
endogenous antibodies is not eliminated, protein A and/or an
antibody against human Ig light chain lambda (Pharmingen) may be
used to separate desired human antibodies from endogenous ungulate
antibodies or ungulate/human chimeric antibodies. Protein A has
higher affinity for human Ig heavy chain than for bovine Ig heavy
chain and may be used to separate desired Ig molecules containing
two human heavy chains from other antibodies containing one or two
ungulate heavy chains. An antibody against human Ig light chain
lambda may be used to separate desired Ig molecules having two
human Ig lambda chains from those having one or two ungulate Ig
light chains. Additionally or alternatively, one or more antibodies
that are specific for ungulate Ig heavy or light chains may be used
in a negative selection step to remove Ig molecules containing one
or two ungulate heavy and/or light chains.
[0553] The resultant antisera may itself be used for passive
immunization against an antigen. Alternatively, the antisera has
diagnostic, prophylactic, or purification use, e.g. for attaining
purification of antigens.
[0554] Alternatively, after antisera administration, B-cells may be
isolated from the transgenic bovine and used for hybridoma
preparation. For example, standard techniques may be used to fuse a
B-cell from a transgenic ungulate with a myeloma to produce a
hybridoma secreting a monoclonal antibody of interest (Mocikat, J.
Immunol. Methods 225:185-189, 1999; Jonak et al., Hum. Antibodies
Hybridomas 3:177-185, 1992; Srikumaran et al., Science 220:522,
1983). Preferred hybridomas include those generated from the fusion
of a B-cell with a myeloma from a mammal of the same genus or
species as the transgenic ungulate. Other preferred myelomas are
from a Balb/C mouse or a human. In this instance, hybridomas are
provided that make xenogenous monoclonal antibodies against a
particular antigen. For example, this technology may be used to
produce human, cat, dog, etc. (dependent upon the specific
artificial chromosome) monoclonal antibodies that are specific to
pathogens. Methods for selecting hybridomas that produce antibodies
having desirable properties, i.e., enhanced binding affinity,
avidity, are well known.
[0555] Alternatively, a B-cell from a transgenic ungulate may be
genetically modified to express an oncogene, such as ras, myc, abl,
bcl2, or neu, or infected with a transforming DNA or RNA virus,
such as Epstein Barr virus or SV40 virus (Kumar et al., Immunol.
Lett. 65:153-159, 1999; Knight et al., Proc. Nat. Acad. Sci. USA
85:3130-3134, 1988; Shammah et al., J. Immunol. Methods 160-19-25,
1993; Gustafsson and Hinkula, Hum. Antibodies Hybridomas 5:98-104,
1994; Kataoka et al., Differentiation 62:201-211, 1997; Chatelut et
al., Scand. J. Immunol. 48:659-666, 1998). The resulting
immortalized B-cells may also be used to produce a theoretically
unlimited amount of antibody. Because Ig is also secreted into the
milk of ungulates, ungulate milk may also be used as a source of
xenogenous antibodies.
EXAMPLE 20
Optional Evaluation of Pain, Discomfort, and Overall Health of
Ungulates
[0556] If desired, the ungulates used in the methods of the
invention may be evaluated for signs of pain or discomfort from the
administered antibody. Standard clinical chemistry analyses may be
performed on blood samples from the mammals. White blood cell
counts and red blood cell counts may also be determined and
compared to clinical norms. Respiration, heart rate, and
temperature are determined on a weekly basis. Food and water intake
is measured. In addition, daily behavioral observations are made
and recorded on a score chart. The score chart includes
observations of activity, watery or dry eyes and nose, and signs of
diarrhea. Periodic estimates (e.g., weekly) of the amount of
xenogenous and endogenous antibody may be made.
Other Embodiments
[0557] From the foregoing description, it will be apparent that
variations and modifications may be made to the invention described
herein to adopt it to various usages and conditions. Such
embodiments are also within the scope of the following claims.
[0558] All publications mentioned in this specification are herein
incorporated by reference to the same extent as if each independent
publication or patent application was specifically and individually
indicated to be incorporated by reference.
Sequence CWU 0
0
SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 99 <210>
SEQ ID NO 1 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 1 agtgagataa gcagtggatg 20 <210> SEQ ID NO 2
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 2 cttgtgctac
tcccatcact 20 <210> SEQ ID NO 3 <211> LENGTH: 22
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 3 ggagaccacc aaaccctcca aa 22
<210> SEQ ID NO 4 <211> LENGTH: 23 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 4 gagagttgca gaaggggtyg act 23 <210> SEQ ID NO 5
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 5 accacctatg
acagcgtgac 20 <210> SEQ ID NO 6 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 6 gtggcagcaa gtagacatcg 20 <210>
SEQ ID NO 7 <211> LENGTH: 22 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 7 gtcatcatct ctgccccttc tg 22 <210> SEQ ID NO 8
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 8 aacaacttct
tgatgtcatc at 22 <210> SEQ ID NO 9 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 9 ccctcctctt tgtgctgtca 20 <210>
SEQ ID NO 10 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 10 caccgtgctc tcatcggatg 20 <210> SEQ ID NO 11
<211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 11 caggtgcagc
tggtggagtc tgg 23 <210> SEQ ID NO 12 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 12 caggagaaag tgatggagtc 20
<210> SEQ ID NO 13 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 13 ggagaccacc aaaccctcca aa 22 <210> SEQ ID NO 14
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 14 gtggcagcaa
gtagacatcg 20 <210> SEQ ID NO 15 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 15 caggagaaag tgatggagtc 20
<210> SEQ ID NO 16 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 16 aggcagccaa cggccacgct 20 <210> SEQ ID NO 17
<211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 17 caggtgcagc
tggtggagtc tgg 23 <210> SEQ ID NO 18 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 18 agtgagataa gcagtggatg 20
<210> SEQ ID NO 19 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 19 cttgtgctac tcccatcact 20 <210> SEQ ID NO 20
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 20 ggagaccacc
aaaccctcca aa 22 <210> SEQ ID NO 21 <211> LENGTH:
23
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 21 gagagttgca gaaggggtyg act 23
<210> SEQ ID NO 22 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 22 ggagaccacc aaaccctcca aa 22 <210> SEQ ID NO 23
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 23 gagagttgca
gaaggggtga ct 22 <210> SEQ ID NO 24 <211> LENGTH: 23
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 24 caggtgcagc tggtggagtc tgg 23
<210> SEQ ID NO 25 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 25 caggagaaag tgatggagtc 20 <210> SEQ ID NO 26
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 26 gtcatcatct
ctgccccttc tg 22 <210> SEQ ID NO 27 <211> LENGTH: 22
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 27 aacaacttct tgatgtcatc at 22
<210> SEQ ID NO 28 <211> LENGTH: 29 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 28 gggaattcgg gtagaagttc actgatcag 29 <210> SEQ ID
NO 29 <211> LENGTH: 28 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic primer <400> SEQUENCE: 29
gggaattcgg gtagaagtca cttatgag 28 <210> SEQ ID NO 30
<211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 30 gggaattcgg
gtagaagtca cttacgag 28 <210> SEQ ID NO 31 <211> LENGTH:
27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 31 cccaagcttr cckgstyycc tctcctc 27
<210> SEQ ID NO 32 <211> LENGTH: 29 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 32 cccccaagct tgcctggacc cctctctgg 29 <210> SEQ ID
NO 33 <211> LENGTH: 32 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic primer <400> SEQUENCE: 33
atcggcaaag cttggacccc tctctggctc ac 32 <210> SEQ ID NO 34
<211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 34 cccccaagct
tctcggcgtc cttgcttac 29 <210> SEQ ID NO 35 <211>
LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic primer <400> SEQUENCE: 35 gggaattcgg gtagaagttc
actgatcag 29 <210> SEQ ID NO 36 <211> LENGTH: 28
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 36 gggaattcgg gtagaagtca cttatgag 28
<210> SEQ ID NO 37 <211> LENGTH: 28 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 37 gggaattcgg gtagaagtca cttacgag 28 <210> SEQ ID
NO 38 <211> LENGTH: 29 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic primer <400> SEQUENCE: 38
cccccaagct trcckgstyy cctctcctc 29 <210> SEQ ID NO 39
<211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 39 gggaattcgg
gtagaagtca ctgatcag 28 <210> SEQ ID NO 40 <211> LENGTH:
28 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 40 gggaattcgg gtagaagtca cttatgag 28
<210> SEQ ID NO 41 <211> LENGTH: 28 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 41 gggaattcgg gtagaagtca cttacgag 28 <210> SEQ ID
NO 42
<211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 42 cttgaagacg
aaagggcctc gtgatacgcc 30 <210> SEQ ID NO 43 <211>
LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic primer <400> SEQUENCE: 43 ctgagacttc ctttcaccct
ccaggcaccg 30 <210> SEQ ID NO 44 <211> LENGTH: 31
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 44 cgatgaatgc cccatttcac ccaagtctgt c
31 <210> SEQ ID NO 45 <211> LENGTH: 23 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic primer
<400> SEQUENCE: 45 ctgagccaag cagtggcccc gag 23 <210>
SEQ ID NO 46 <211> LENGTH: 26 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 46 gggctgagac tgggtgaaca gaaggg 26 <210> SEQ ID NO
47 <211> LENGTH: 1479 <212> TYPE: DNA <213>
ORGANISM: Bovine <400> SEQUENCE: 47 ggtaccgaaa ggcggccctg
aacattctgc agtgagggag ccgcactgag aaagctgctt 60 catcgccggg
agggagccag ccagctacga ttgtgagcac gctcacagtg cacacggcat 120
gtgcacggtc tcagcttaac caccttgaag gagtaactca ttaaagagcg tacgaatgca
180 ttgataaaat gcacctgaga caaattaatt tcttaaacat cgactttgaa
aatgaatata 240 agtgagcagt tgataggctc tgaatgaaat accttccaac
aggtgctgag aaccgccagg 300 agcagggaac ggactccccg tggagcccca
gaaggagcca gccctgatga tacctcggcc 360 ctgggccctc ctcacgctgg
gagagagcca gctcctgttg ttcatgcctg gcctgtggtt 420 ctttgtcgtc
atggccctca aacaagccca caggtcctgg cctgagtccc tcggcctgcg 480
tgcagccgcc ccctcccctg ctggaggcac cctgcctgcc gtggagcccc tcacccaacg
540 ttcccccgcc tgatgggttg ggccgcaaag gacaccgttt aaccagaact
gccttccagg 600 agcctactgc tgggaggcgg ccttctctgg gaccaggtcc
actccactcc cttggatagt 660 cactgtcagg cccctggtgg ccccacaaga
ggcgtcctgg gaagccccag tctccttcca 720 gcccctgaaa ttgcctccct
ggagagccag atcaccctca cccagctccc tcccctggcc 780 cccagggtct
cctctcccat cccaccgccc accctaccct ggcgttgccg tcacagctaa 840
cctgacctcc ctgggttcga gcgtgccgcc gcccctgtcg gcccccacct ggacccccgc
900 agcctatctc tgagggctaa tgcccctgtc ccctgccccg ctgccagctg
ccccctcttt 960 ccaggccttt cctccgtgcc tctccagtcc tgcacctccc
tgcagcttca cctgagactt 1020 cctttcaccc tccaggcacc gtcttctggc
ctgcaggtga ggtctcgcgc tccctcaggg 1080 cacgatgtgg ctgcacacac
accggccctc ctcccgagtc cctcctgcac acaccacgcg 1140 cacccgaggt
tgacaagccc tgccgtggtt gggattccgg gaatggcggc agagaggggc 1200
ggggtgtcct tggggctggt ggcagggtcc tcatggatgc acacagcggc cccggctcag
1260 gccaccttgg gaaaccagtc ctgggatctg caactcggcc atgttcctgc
atctggacca 1320 gccccaagac accaccccgg cgtggcgcca ctggcctggg
aggagacaca tgtccctttc 1380 ccatcagcaa tgggttcagc actaggatat
gcagcacaca ggagtgtggc ttgggggtaa 1440 aaaaaccttc acgaggaagc
ggtttcacaa aataaagta 1479 <210> SEQ ID NO 48 <211>
LENGTH: 3120 <212> TYPE: DNA <213> ORGANISM: Bovine
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (676)..(1625) <223> OTHER INFORMATION: n is a, c,
g, or t <400> SEQUENCE: 48 tctagaccca ccagcctcag ttgaggttaa
atggacccaa agcatctcaa caatttgccc 60 aagtcaagcc agctcaatgg
gttcccttct gttcacccag tctcagccca ccatggtaac 120 ccagcatacc
ccggttaagc ccaggctagc ccagcccagc tgagcccagc tcagctcagt 180
tcagcccagt tcaatccaga tcagcccaat ccaggccagc tcatcgagct cagttcagct
240 cagctcaacc ctctcagccc agctcacctg ctcagccaag ctaagcccag
ttcagcccag 300 ctcagcttaa cccagctcac ccactctgcc cagctcagcc
cagccctgct caactcagcc 360 cagcacagcc caacttggct cagctcagct
tagcccagct cagcccagct tacccactcc 420 gcccagctca aacagcccag
gtcagcccaa cctagctcag ttcagcccag ctcagcccag 480 cccagctcag
cccagctcac ccactctgcc cagctcaaca cagcccagct caacccagct 540
cagctcagtt cagcccagct cacccactct gcccagctca ggccagctca acccagccca
600 gcccagctca ctcattctgc caagctcagc ccagctcaac caggctcagc
tcagctcagc 660 tcagccctgc tgaccnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn 720 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 780 nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 840 nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 900
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
960 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn 1020 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn 1080 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 1140 nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 1200 nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 1260
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
1320 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn 1380 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn 1440 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 1500 nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 1560 nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 1620
nnnnngctca gctcagccca gctcagccca gcccagccca gctcacacac ttggcccacc
1680 tcagccactc cattcagctc agcccagctc aacccagctc agctcagctc
aacctagctc 1740 agccaagcta acccactcca cccagctcag cccagctcgc
ccactctgcc cagctcaacc 1800 cagctcagct cagcccagcc cagyccagcc
cagctcaccc actccatcca gcccagccca 1860 gcccagctga gcccagctca
actcagccta acccagctca gcccagccta acccagctca 1920 gcccagccca
accagctagc tgagcccagc tcagtgcagc tcaacccagc tcagctcagc 1980
tagcccagcc cagctcaacc tggctcaacc cggctcagcc cagctcacct gctgtaggtg
2040 gcctgaaccg cgaacacaga catgaaagcc cagtggttct gacgagaaag
ggtcagatcc 2100 tggaccatgg ccacggctaa aggccctggt ctgtggacac
tgcccagctg ggctcatccc 2160 tcccagcctc ttcccgcttc tcctcctggg
agcccgctcg ccccttcccc tggtgcctga 2220 cacctccatc ccgacaccag
gcccagctgg cccttctccc agctgtcagt caccactacc 2280 ctccactctg
ggtgaaaagc ttgttggaga ctttagcttc cctagagcat ctcacaggct 2340
gagacacact tgccaccctc agagagaggc cctgtctctg ctgagcaggc agcgctgctt
2400 ctctgggaga ggagagcctg ggcacacgtc cctgggtcct ggcctcctgg
gcacgtgcca 2460 tgggcctgag atcccgcccc gagtctaaaa gagtcctggt
gactaactgc tctctggcaa 2520 atgtcctcat taaaaaccac aggaaatgca
tcttatctga acctgctccc aattctgtct 2580 ttatcacaaa gttctgctga
gaaagaggat actctctagc acagagacca tctgaacccc 2640 aaagctgcat
tgaacaccta agtgtggacg caggaagtgg tccctgtggg tgtgaagcac 2700
cccggcatcg caggcagtag gtaaagacag attccctttc aagtagaaac aaaaacaact
2760 catacaaaca tccctgggca gtgagtctgg ctgcaccggc tcctggtccc
tggcatgtcc 2820 cctgggctct ctgacctggg cggattcctc cgaatccctt
cgctgtgtta actcgtgacc 2880 tgcctactgg cctgggggca gaggccaggc
ccacacgtcc ccaggtgtgg gcagtcccag 2940 gagacccccc agccttggcg
agcctgggga ctcagagcag agactgtccc tccagacggt 3000 cccaggcccc
gctgactgcc gccccaccgg gcatcctctc aatcccccag ctagtagtgt 3060
agcagagtaa ctcacgacga atgcccccgt ttcacccaag tctgtcctga gatgggtacc
3120 <210> SEQ ID NO 49 <211> LENGTH: 146 <212>
TYPE: DNA <213> ORGANISM: Bovine <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (24)..(24)
<223> OTHER INFORMATION: n is a, c, g, or t <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(129)..(129) <223> OTHER INFORMATION: n is a, c, g, or t
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (139)..(140) <223> OTHER INFORMATION: n is a, c, g,
or t <400> SEQUENCE: 49
gggaaggaag tcctgtgcga ccanccaacg gccacgctgc tcgtatccga cggggaattc
60 tcacaggaga cgagggggaa aagggttggg gcggatgcac tccctgagga
gacggtgacc 120 agggttccnt ggccccagnn gtcaaa 146 <210> SEQ ID
NO 50 <211> LENGTH: 167 <212> TYPE: DNA <213>
ORGANISM: Bovine <400> SEQUENCE: 50 tttgactact ggggccaggg
aaccctggtc accgtctcct cagggagtgc atccgcccca 60 acccttttcc
ccctcgtctc ctgtgagaat tccccgtcgg atacgagcag cgtggccgtt 120
ggctgcctcg cacaggactt ccttcccgac tccatcactt tctcctg 167 <210>
SEQ ID NO 51 <211> LENGTH: 147 <212> TYPE: DNA
<213> ORGANISM: Bovine <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (7)..(8) <223>
OTHER INFORMATION: n is a, c, g, or t <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (18)..(18)
<223> OTHER INFORMATION: n is a, c, g, or t <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(123)..(123) <223> OTHER INFORMATION: n is a, c, g, or t
<400> SEQUENCE: 51 tttgacnnct ggggccangg aaccctggtc
accgtctcct cagggagtgc atccgcccca 60 acccttttcc ccctcgtctc
ctgtgagaat tccccgtcgg atacgagcag cgtggccgtt 120 ggntgcgtcg
cacaggactt ccttccc 147 <210> SEQ ID NO 52 <211> LENGTH:
393 <212> TYPE: DNA <213> ORGANISM: Bovine <400>
SEQUENCE: 52 ggaggcttgg tcaagcctgg agggtccctg agactctcct gtgcagcctc
tggattcacc 60 ttcagtgact actacatgag ctggatccgc caggctccag
ggaaggggct ggagtgggtt 120 tcatacatta gtagtagtgg tagtaccata
tactacgcag actctgtgaa gggccgattc 180 accatctcca gggacaacgc
caagaactca ctgtatctgc aaatgaacag cctgagagcc 240 gaggacacgg
ctgtgtatta ctgtgcgaga ataactgggg atgcttttga tatctggggc 300
caagggacaa tggtcaccgt ctcttcaggg agtgcatccg ccccaaccct tttccccctc
360 gtctcctgtg agaattcccc gtcggatacg agc 393 <210> SEQ ID NO
53 <211> LENGTH: 131 <212> TYPE: PRT <213>
ORGANISM: Bovine <400> SEQUENCE: 53 Gly Gly Leu Val Lys Pro
Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala 1 5 10 15 Ser Gly Phe Thr
Phe Ser Asp Tyr Tyr Met Ser Trp Ile Arg Gln Ala 20 25 30 Pro Gly
Lys Gly Leu Glu Trp Val Ser Tyr Ile Ser Ser Ser Gly Ser 35 40 45
Thr Ile Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg 50
55 60 Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg
Ala 65 70 75 80 Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ile Thr Gly
Asp Ala Phe 85 90 95 Asp Ile Trp Gly Gln Gly Thr Met Val Thr Val
Ser Ser Gly Ser Ala 100 105 110 Ser Ala Pro Thr Leu Phe Pro Leu Val
Ser Cys Glu Asn Ser Pro Ser 115 120 125 Asp Thr Ser 130 <210>
SEQ ID NO 54 <211> LENGTH: 411 <212> TYPE: DNA
<213> ORGANISM: Bovine <400> SEQUENCE: 54 gtggagtctg
ggggaggctt ggtacagcct gggaggtccc tgagactctc ctgtgcagcg 60
tcaggattca ccttcaggaa ctttggcatg cactgggtcc gccaggctcc aggcaagggg
120 ctggagtggg tgacagttat atggtatgac ggaagtaatc aatactatat
agactccgtg 180 aagggccgat tcaccatctc cagagacaat tccaagaaca
tgttgtatct gcaaatgaac 240 agcctgagag ccgaggatac ggctgtgtat
tactgtgcga gagatcgcaa tggcctgaag 300 tacttcgatc tctggggccg
tggcaccctg gtcactgtct catcagggag tgcatccgcc 360 ccaacccttt
tccccctcgt ctcctgtgag aattccccgt cggatacgag c 411 <210> SEQ
ID NO 55 <211> LENGTH: 137 <212> TYPE: PRT <213>
ORGANISM: Bovine <400> SEQUENCE: 55 Val Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Arg Ser Leu Arg Leu 1 5 10 15 Ser Cys Ala Ala
Ser Gly Phe Thr Phe Arg Asn Phe Gly Met His Trp 20 25 30 Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Thr Val Ile Trp 35 40 45
Tyr Asp Gly Ser Asn Gln Tyr Tyr Ile Asp Ser Val Lys Gly Arg Phe 50
55 60 Thr Ile Ser Arg Asp Asn Ser Lys Asn Met Leu Tyr Leu Gln Met
Asn 65 70 75 80 Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
Arg Asp Arg 85 90 95 Asn Gly Leu Lys Tyr Phe Asp Leu Trp Gly Arg
Gly Thr Leu Val Thr 100 105 110 Val Ser Ser Gly Ser Ala Ser Ala Pro
Thr Leu Phe Pro Leu Val Ser 115 120 125 Cys Glu Asn Ser Pro Ser Asp
Thr Ser 130 135 <210> SEQ ID NO 56 <211> LENGTH: 441
<212> TYPE: DNA <213> ORGANISM: Bovine <400>
SEQUENCE: 56 accctcctca ctcactgtgc agggtcctgg gcccagtctg tgctgactca
gccaccctca 60 gcgtctggga cccccgggca gagggtcacc atctcttgtt
ctggaagcag ctccaacatc 120 ggaagtaatt atgtatactg gtaccagcag
ctcccaggaa cggcccccaa actcctcatc 180 tataggaata atcagcggcc
ctcaggggtc cctgaccgat tctctggctc caagtctggc 240 acctcagcct
ccctggccat cagtgggctc cggtccgagg atgaggctga ttattactgt 300
gcagcatggg atgacagcct gagtggtctt ttcggcggag ggaccaagct gaccgtccta
360 ggtcagccca aggctgcccc ctcggtcact ctgttcccac cctcctctga
ggagcttcaa 420 gccaacaagg ccacactggt g 441 <210> SEQ ID NO 57
<211> LENGTH: 147 <212> TYPE: PRT <213> ORGANISM:
Bovine <400> SEQUENCE: 57 Thr Leu Leu Thr His Cys Ala Gly Ser
Trp Ala Gln Ser Val Leu Thr 1 5 10 15 Gln Pro Pro Ser Ala Ser Gly
Thr Pro Gly Gln Arg Val Thr Ile Ser 20 25 30 Cys Ser Gly Ser Ser
Ser Asn Ile Gly Ser Asn Tyr Val Tyr Trp Tyr 35 40 45 Gln Gln Leu
Pro Gly Thr Ala Pro Lys Leu Leu Ile Tyr Arg Asn Asn 50 55 60 Gln
Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly 65 70
75 80 Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Arg Ser Glu Asp Glu
Ala 85 90 95 Asp Tyr Tyr Cys Ala Ala Trp Asp Asp Ser Leu Ser Gly
Leu Phe Gly 100 105 110 Gly Gly Thr Lys Leu Thr Val Leu Gly Gln Pro
Lys Ala Ala Pro Ser 115 120 125 Val Thr Leu Phe Pro Pro Ser Ser Glu
Glu Leu Gln Ala Asn Lys Ala 130 135 140 Thr Leu Val 145 <210>
SEQ ID NO 58 <211> LENGTH: 459 <212> TYPE: DNA
<213> ORGANISM: Bovine <400> SEQUENCE: 58 agttggaccc
ctctctggct cactctcttc actctttgca taggttctgt ggtttcttct 60
gagctgactc aggaccctgc tgtgtctgtg gccttgggac agacagtcag gatcacatgc
120 caaggagaca gcctcagaag ctattatgca agctggtacc agcagaagcc
aggacaagcc 180 cctgtacttg tcatctatgg taaaaacaac cggccctcag
ggatcccaga ccgattctct 240 ggctccagct caggaaacac agcttccttg
accatcactg gggctcaggc ggaggatgag 300 gctgactatt actgtaactc
ccgggacagc agtggtaacc atgtggtatt cggcggaggg 360 accaagctga
ccgtcctagg tcagcccaag gctgccccct cggtcactct gttcccaccc 420
tcctctgagg agcttcaagc caacaaggcc acactggtg 459 <210> SEQ ID
NO 59 <211> LENGTH: 153 <212> TYPE: PRT
<213> ORGANISM: Bovine <400> SEQUENCE: 59 Ser Trp Thr
Pro Leu Trp Leu Thr Leu Phe Thr Leu Cys Ile Gly Ser 1 5 10 15 Val
Val Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu 20 25
30 Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg Ser Tyr
35 40 45 Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val
Leu Val 50 55 60 Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro
Asp Arg Phe Ser 65 70 75 80 Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu
Thr Ile Thr Gly Ala Gln 85 90 95 Ala Glu Asp Glu Ala Asp Tyr Tyr
Cys Asn Ser Arg Asp Ser Ser Gly 100 105 110 Asn His Val Val Phe Gly
Gly Gly Thr Lys Leu Thr Val Leu Gly Gln 115 120 125 Pro Lys Ala Ala
Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu Glu 130 135 140 Leu Gln
Ala Asn Lys Ala Thr Leu Val 145 150 <210> SEQ ID NO 60
<211> LENGTH: 723 <212> TYPE: DNA <213> ORGANISM:
Bovine <400> SEQUENCE: 60 atgagattcc ctgctcagct cctggggctc
ctcctgctct gggtcccagg atccagtggg 60 gatgttgtgc tgacccagac
tcccctctcc ctgtctatca tccctggaga gacggtctcc 120 atctcctgca
agtctactca gagtctgaaa tatagtgatg gaaaaaccta tttgtactgg 180
cttcaacata aaccaggcca atcaccacag cttttgatct atgctgtttc cagccgttac
240 actggggtcc cagacaggtt cactggcagt gggtcagaaa cagatttcac
acttacgatc 300 aacagtgtgc aggctgagga tgttggagtc tattactgtc
ttcaaacaac atatgtccca 360 aatactttcg gccaaggaac caaggtagag
atcaaaaggt ctgatgctga gccatccgtc 420 ttcctcttca aaccatctga
tgagcagctg aagaccggaa ctgtctctgt cgtgtgcttg 480 gtgaatgatt
tctaccccaa agatatcaat gtcaagtgga aagtggatgg ggttactcag 540
agcagcagca acttccaaaa cagtttcaca gaccaggaca gcaagaaaag cacctacagc
600 ctcagcagca tcctgacact gcccagctca gagtaccaaa gccatgacgc
ctatacgtgt 660 gaggtcagcc acaagagcct gactaccacc ctcgtcaaga
gcttcagtaa gaacgagtgt 720 tag 723 <210> SEQ ID NO 61
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 61 gatgatgtct
ccaggatgcc 20 <210> SEQ ID NO 62 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 62 gacaagctta atatccgcag g 21
<210> SEQ ID NO 63 <211> LENGTH: 30 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 63 aagaagagaa aggtagaaga ccccaaggac 30 <210> SEQ ID
NO 64 <211> LENGTH: 28 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic primer <400> SEQUENCE: 64
cctgggtata gacaggtggg tattgtgc 28 <210> SEQ ID NO 65
<211> LENGTH: 40 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 65 ggggtctaga
gcagacacta cactgatggg cccttggtcc 40 <210> SEQ ID NO 66
<211> LENGTH: 36 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 66 ggggaagctt
cgtgtccctg gtcctgtctg acacag 36 <210> SEQ ID NO 67
<211> LENGTH: 34 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 67 ggggctcgag
gtcggcgaag gatgggggga ggtg 34 <210> SEQ ID NO 68 <211>
LENGTH: 35 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic primer <400> SEQUENCE: 68 ggggggtacc gctgggctga
gctgggcaga gtggg 35 <210> SEQ ID NO 69 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 69 tggtcactcc aagtgagtcg 20
<210> SEQ ID NO 70 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 70 tggagtgaaa tcaggtgaag g 21 <210> SEQ ID NO 71
<211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 71 ccacaaagga
aaaagctgca ctgctatac 29 <210> SEQ ID NO 72 <211>
LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic primer <400> SEQUENCE: 72 tgtgggatca ggaggtcaga
tagacatc 28 <210> SEQ ID NO 73 <211> LENGTH: 28
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 73 tttggtcctg tagtttgcta acacaccc 28
<210> SEQ ID NO 74 <211> LENGTH: 26 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 74 ggatcagtgc ctatcactcc aggttg 26 <210> SEQ ID NO
75 <211> LENGTH: 33 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 75 tactgtgcaa
gagatgagaa tgcttttgat gtc 33 <210> SEQ ID NO 76 <211>
LENGTH: 51 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens
<400> SEQUENCE: 76 attactgtgc gaagaacaaa atagcagcag
ctggtacgat ctttgactac t 51 <210> SEQ ID NO 77 <211>
LENGTH: 49 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 77 actgtaccac agatctgata gcagtggctg
gtactgggta cttccagca 49 <210> SEQ ID NO 78 <211>
LENGTH: 46 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 78 tactgtgcga gtcgtagtac cagctgctat
gatgcttttg atgtct 46 <210> SEQ ID NO 79 <211> LENGTH:
45 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 79 ttactgtgcg agttttgggt ggtggtcaca
tttagactac tgggg 45 <210> SEQ ID NO 80 <211> LENGTH: 48
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 80 actgtgcgag acatgaaaaa cttcggggag
ttataatcta ctggggcc 48 <210> SEQ ID NO 81 <211> LENGTH:
46 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 81 ttactgtgcg agggggatgg cagcagctgg
taccgactac tggggc 46 <210> SEQ ID NO 82 <211> LENGTH:
56 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 82 actgtgcgag agattgtagt agtaccagct
gccaagatcg taagtggtac ttcgat 56 <210> SEQ ID NO 83
<211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 83 ttactgtgcg agatgggttt
ttgatcccca gtttgactac tgg 43 <210> SEQ ID NO 84 <211>
LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 84 tcactgtgcg agaattttac tggggatgat
gcttttgatg tct 43 <210> SEQ ID NO 85 <211> LENGTH: 27
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 85 agcctgagtg gtcttttcgg cggaggg 27
<210> SEQ ID NO 86 <211> LENGTH: 30 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 86
cagtggtaac catctggtat tcggcggagg 30 <210> SEQ ID NO 87
<211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 87 cagcctgagt gctgtcttcg
gaactggg 28 <210> SEQ ID NO 88 <211> LENGTH: 29
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 88 agcaacttcg tgtatagttc ggcggagag 29
<210> SEQ ID NO 89 <211> LENGTH: 26 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 89
ggtagtagca cttctcggcg gaggga 26 <210> SEQ ID NO 90
<211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 90 cagtggtaac cattatgtct
tcggaactg 29 <210> SEQ ID NO 91 <211> LENGTH: 28
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 91 gacagcagca cttatgtctt cggaactg 28
<210> SEQ ID NO 92 <211> LENGTH: 31 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 92
ggcagcaaca atttcgatgt cttcggaact g 31 <210> SEQ ID NO 93
<211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 93 agcagcagca ctcgtttcgg cggagg
26 <210> SEQ ID NO 94 <211> LENGTH: 23 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
94 agcagcagca ctcggaactg gga 23 <210> SEQ ID NO 95
<211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Primer <400> SEQUENCE: 95 ccctcacaca
ccc 13 <210> SEQ ID NO 96 <211> LENGTH: 393 <212>
TYPE: DNA <213> ORGANISM: Bovine <400> SEQUENCE: 96
ggaggcttgg tcaagcctgg agggtccctg agactctcct gtgcagcctc tggattcacc
60 ttcagtgact actacatgag cctgatccgc caggctccag ggaaggggct
ggagtgggtt 120 tcatacatta gtagtagtgg tagtaccata tactacgcag
actctgtgaa gggccgattc 180 accatctcca gggacaacgc caagaactca
ctgtatctgc aaatgaacag cctgagagcc 240 gaggacacgg ctgtgtatta
ctgtgcgaga ataactgggg atgcttttga tatctggggc 300 caagggacaa
tggtcaccgt ctcttcaggg agtgcatccg ccccaaccct tttccccctc 360
gtctcctgtg agaattcccc gtcggatacg agc 393 <210> SEQ ID NO 97
<211> LENGTH: 131 <212> TYPE: PRT <213> ORGANISM:
Bovine <400> SEQUENCE: 97 Gly Gly Leu Val Lys Pro Gly Gly Ser
Leu Arg Leu Ser Cys Ala Ala 1 5 10 15 Ser Gly Phe Thr Phe Ser Asp
Tyr Tyr Met Ser Trp Ile Arg Gln Ala 20 25 30 Pro Gly Lys Gly Leu
Glu Trp Val Ser Tyr Ile Ser Ser Ser Gly Ser 35 40 45 Thr Ile Tyr
Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg 50 55 60 Asp
Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala 65 70
75 80 Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ile Thr Gly Asp Ala
Phe 85 90 95 Asp Ile Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser
Gly Ser Ala 100 105 110 Ser Ala Pro Thr Leu Phe Pro Leu Val Ser Cys
Glu Asn Ser Pro Ser 115 120 125
Asp Thr Ser 130 <210> SEQ ID NO 98 <211> LENGTH: 441
<212> TYPE: DNA <213> ORGANISM: Bovine <400>
SEQUENCE: 98 accctcctca ctcactgtgc agggtcctgg gccgagtctg tgctgactca
gccaccctca 60 gcgtctggga cccccgggca gagggtcacc atctcttgtt
ctggaagcag ctccaacatc 120 ggaagtaatt atgtatactg gtaccagcag
gtcccaggaa cggcccccaa actcctcatc 180 tataggaata atcagcggcc
ctcaggggtc cctgaccgat tctctggctc caagtctggc 240 acctcagcct
ccctggccat cagtgggctc cggtccgagg atgaggctga ttattactgt 300
gcagcatggg atgacagcct gagtggtctt ttcggcggag ggaccaagct gaccgtccta
360 ggtcagccca aggctgcccc ctcggtcact gtgttcccac cctcctctga
ggagcttcaa 420 gccaacaagg ccacactggt g 441 <210> SEQ ID NO 99
<211> LENGTH: 147 <212> TYPE: PRT <213> ORGANISM:
Bovine <400> SEQUENCE: 99 Thr Leu Leu Thr His Cys Ala Gly Ser
Trp Ala Gln Ser Val Leu Thr 1 5 10 15 Gly Pro Pro Ser Ala Ser Gly
Thr Pro Gly Gln Arg Val Thr Ile Ser 20 25 30 Cys Ser Gly Ser Ser
Ser Asn Ile Gly Ser Asn Tyr Val Tyr Trp Tyr 35 40 45 Gln Gln Leu
Pro Gly Thr Ala Pro Lys Leu Leu Ile Tyr Arg Asn Asn 50 55 60 Gln
Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly 65 70
75 80 Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Arg Ser Glu Asp Glu
Ala 85 90 95 Asp Tyr Tyr Cys Ala Ala Trp Asp Asp Ser Leu Ser Gly
Leu Phe Gly 100 105 110 Gly Gly Thr Lys Leu Thr Val Leu Gly Gly Pro
Lys Ala Ala Pro Ser 115 120 125 Val Thr Leu Phe Pro Pro Ser Ser Glu
Glu Leu Gln Ala Asn Lys Ala 130 135 140 Thr Leu Val 145
* * * * *