U.S. patent application number 11/519734 was filed with the patent office on 2008-02-14 for protein.
Invention is credited to Janne Brunstedt, Jorn Dalgaard Mikkelsen, Henrik Pedersen, Jorn Borch Soe.
Application Number | 20080038404 11/519734 |
Document ID | / |
Family ID | 32117585 |
Filed Date | 2008-02-14 |
United States Patent
Application |
20080038404 |
Kind Code |
A1 |
Brunstedt; Janne ; et
al. |
February 14, 2008 |
Protein
Abstract
A fungal wild-type lipolytic enzyme having a higher ratio of
activity on polar lipids compared with triglycerides, wherein the
enzyme preferably has a phospholipid:triglyceride activity ratio of
at least 4. Preferably, the lipolytic enzyme according to the
present invention has a glycolipid:triglyceride hydrolyzing
activity ratio of at least 1.5. In one embodiment, the fungal
lipolytic enzyme according to the present invention comprises an
amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID No. 2 or SEQ
ID No. 4 or SEQ ID No. 6 or an amino acid sequence which has at
least 90% identity thereto. The present invention further
encompasses a nucleic acid encoding a fungal lipolytic enzyme,
which nucleic acid is selected from the group consisting of: (a) a
nucleic acid comprising a nucleotide shown in SEQ ID No. 3, SEQ ID
No. 5 or SEQ ID No. 7; (b) a nucleic acid which is related to the
nucleotide sequence of SEQ ID No. 3, SEQ ID No. 5 or SEQ ID No. 7
by the degeneration of the genetic code; and (c) nucleic acid
comprising a nucleotide sequence which has at least 90% identity
with the nucleotide sequence shown in SEQ ID No. 3, SEQ ID No. 5 or
SEQ ID No. 7.
Inventors: |
Brunstedt; Janne; (Roskilde,
DK) ; Mikkelsen; Jorn Dalgaard; (Hvidovre, DK)
; Pedersen; Henrik; (Ostbirk, DK) ; Soe; Jorn
Borch; (Tilst, DK) |
Correspondence
Address: |
FROMMER LAWRENCE & HAUG
745 FIFTH AVENUE- 10TH FL.
NEW YORK
NY
10151
US
|
Family ID: |
32117585 |
Appl. No.: |
11/519734 |
Filed: |
September 12, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/IB05/00875 |
Mar 10, 2005 |
|
|
|
11519734 |
Sep 12, 2006 |
|
|
|
60559149 |
Apr 2, 2004 |
|
|
|
Current U.S.
Class: |
426/32 ; 426/33;
426/34; 426/37; 426/42; 426/47; 426/48; 426/52; 426/7; 435/195;
536/23.2 |
Current CPC
Class: |
C12Y 301/01 20130101;
A23D 7/02 20130101; A21D 8/042 20130101; A23L 7/109 20160801; A23L
7/111 20160801; C12P 7/62 20130101; A23C 19/0328 20130101; A23L
7/107 20160801; A23K 50/75 20160501; A23L 27/60 20160801; A23K
20/189 20160501; C12N 9/18 20130101; C12P 19/44 20130101; C11B
3/003 20130101; A23L 29/06 20160801 |
Class at
Publication: |
426/032 ;
426/033; 426/034; 426/037; 426/042; 426/047; 426/048; 426/052;
426/007; 435/195; 536/023.2 |
International
Class: |
A21D 8/04 20060101
A21D008/04; A23C 9/12 20060101 A23C009/12; A23D 7/00 20060101
A23D007/00; A23D 9/00 20060101 A23D009/00; A23G 3/34 20060101
A23G003/34; A23L 1/105 20060101 A23L001/105; A23L 1/212 20060101
A23L001/212; A23L 1/22 20060101 A23L001/22; A23L 1/24 20060101
A23L001/24; A23L 1/322 20060101 A23L001/322; A23L 1/39 20060101
A23L001/39; C07H 21/04 20060101 C07H021/04; C12N 9/02 20060101
C12N009/02 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 12, 2004 |
GB |
0405637.0 |
Claims
1. A fungal lipolytic enzyme wherein: (i) the fungal lipolytic
enzyme is a wild-type lipolytic enzyme having a higher ratio of
activity on polar lipids compared with triglycerides; or (ii) the
fungal lipolytic enzyme comprises an amino acid sequence as shown
in SEQ ID No. 1 or SEQ ID No. 2 or an amino acid sequence which has
at least 90% identity thereto.
2. A fungal lipolytic enzyme according to claim 1 wherein the
enzyme has a phospholipid:triglyceride hydrolysing activity ratio
of at least 4.
3. A fungal lipolytic enzyme according to claim 1 wherein the
enzyme has a glycolipid:triglyceride hydrolysing activity ratio of
at least 1.5.
4. A fungal lipolytic enzyme according to claim 1 or claim 4
wherein the enzyme is obtainable from a filamentous fungus
5. A fungal lipolytic enzyme according to claim 4 wherein the
enzyme is obtainable from Fusarium spp.
6. A fungal lipolytic enzyme according to claim 5, wherein the
enzyme is obtainable from Fusarium heterosporum.
7. A fungal lipolytic enzyme according to claim 6 wherein the
enzyme is obtainable from Fusarium heterosporum CBS 782.83.
8. A nucleotide sequence encoding a fungal lipolytic enzyme
according to claim 1.
9. A nucleic acid encoding a fungal lipolytic enzyme, which nucleic
acid is selected from the group consisting of: a) a nucleic acid
comprising a nucleotide sequence shown in SEQ ID No. 3; b) a
nucleic acid which is related to the nucleotide sequence of SEQ ID
No. 3 by the degeneration of the genetic code; and c) a nucleic
acid comprising a nucleotide sequence which has at least 90%
identity with the nucleotide sequence shown in SEQ ID No. 3.
10. A method of making a foodstuff comprising adding the fungal
lipolytic enzyme according to claim 1 to one or more ingredients of
the foodstuff.
11. A method of making a baked product comprising adding a fungal
lipolytic enzyme according to claim 1 to a dough and baking the
dough to make the baked product.
12. A method according to claim 10 wherein the foodstuff is one or
more of: egg or an egg-based product; a baked product;
confectionery; a frozen product; a dairy product including a
cheese; a mousse; a whipped vegetable cream; an edible oil and fat;
an aerated and non-aerated whipped product; an oil-in-water
emulsions and water-in-oil emulsions; margarine; shortening, a
spread, including low fat and very low fat spreads; a dressing;
mayonnaise; a dip; a cream based sauce; a cream based soup; a
beverage; a spice emulsion and a sauce.
13. A method of preparing a lyso-phospholipid comprising treating a
phospholipid with the fungal lipolytic enzyme according to claim 1
to produce the lyso-phospholipid.
14. A method of preparing a lyso-glycolipid comprising treating a
glycolipid with a fungal lipolytic enzyme according to claim 1 to
produce a lyso glycolipid.
15. A process of enzymatic degumming of vegetable or edible oils,
comprising treating the edible or vegetable oil with a fungal
lipolytic enzyme according to claim 1 so as to hydrolyse a major
part of the polar lipids present therein.
16. A foodstuff obtained by the method according to claim 10.
17. A baked product obtained by the method of claim 11.
Description
REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of International
Patent Application PCT/IB2005/000875 filed Mar. 10, 2005 and
published as WO 2005/087918 on Sep. 22, 2005, which claims priority
from GB Application No. 0405637.0 filed Mar. 12, 2004 and U.S.
Provisional Patent Application No. 60/559,149 filed Apr. 2,
2004.
[0002] Each of the above referenced applications, and each document
cited in this text ("application cited documents") and each
document cited or referenced in each of the application cited
documents, and any manufacturer's specifications or instructions
for any products mentioned in this text and in any document
incorporated into this text, are hereby incorporated herein by
reference; and, technology in each of the documents incorporated
herein by reference can be used in the practice of this
invention.
[0003] It is noted that in this disclosure, terms such as
"comprises", "comprised", "comprising", "contains", "containing"
and the like can have the meaning attributed to them in U.S. Patent
law; e.g., they can mean "includes", "included", "including" and
the like. Terms such as "consisting essentially of" and "consists
essentially of" have the meaning attributed to them in U.S. Patent
law, e.g., they allow for the inclusion of additional ingredients
or steps that do not detract from the novel or basic
characteristics of the invention, i.e., they exclude additional
unrecited ingredients or steps that detract from novel or basic
characteristics of the invention, and they exclude ingredients or
steps of the prior art, such as documents in the art that are cited
herein or are incorporated by reference herein, especially as it is
a goal of this document to define embodiments that are patentable,
e.g., novel, nonobvious, inventive, over the prior art, e.g., over
documents cited herein or incorporated by reference herein. And,
the terms "consists of" and "consisting of" have the meaning
ascribed to them in U.S. Patent law; namely, that these terms are
closed ended.
FIELD OF THE INVENTION
[0004] The present invention relates to novel fungal lipolytic
enzymes and to one or more polynucleotides encoding one or more
novel fungal lipolytic enzymes. The invention also relates to
methods of producing fungal lipolytic enzymes, and uses thereof.
The present invention further relates to the preparation of an
improved foodstuff, in particular to the preparation of improved
bakery products. Specifically, the invention provides novel fungal
lipolytic enzymes, which enzymes are capable of conferring improved
characteristics to food products, including bakery products.
TECHNICAL BACKGROUND
[0005] The beneficial use of lipolytic enzymes (E.C. 3.1.1.x) in
food and/or feed industrial applications has been known for many
years.
[0006] For instance, in EP 0 585 988 it is claimed that lipase
addition to dough resulted in an improvement in the antistaling
effect. It is suggested that a lipase obtained from Rhizopus
arrhizus when added to dough can improve the quality of the
resultant bread when used in combination with shortening/fat.
WO94/04035 teaches that an improved bread softness can be obtained
by adding a lipase to dough without the addition of any additional
fat/oil to the dough. Castello, P. ESEGP 89-10 December 1999
Helsinki, shows that exogenous lipases can modify bread volume.
[0007] The substrate for lipases in wheat flour is 1.5-3%
endogenous wheat lipids, which are a complex mixture of polar and
non-polar lipids. The polar lipids can be divided into glycolipids
and phospholipids. These lipids are built up of glycerol esterified
with two fatty acids and a polar group. The polar group contributes
to surface activity of these lipids. Enzymatic cleavage of one of
the fatty acids in these lipids leads to lipids with a much higher
surface activity. It is well known that emulsifiers, such as DATEM,
with high surface activity are very functional when added to
dough.
[0008] Lipolytic enzymes hydrolyse one or more of the fatty acids
from lipids present in the food which can result in the formation
of powerful emulsifier molecules within the foodstuff which provide
commercially valuable functionality. The molecules which contribute
the most significant emulsifier characteristics are the partial
hydrolysis products, such as lyso-phospholipids, lyso-glycolipids
and mono-glyceride molecules. The polar lipid hydrolysis products,
namely lyso-phospholipids and lyso-glycolipids, are particularly
advantageous. In bread making, such in situ derived emulsifiers can
give equivalent functionality as added emulsifiers, such as
DATEM.
[0009] However, the activity of lipolytic enzymes has also been
found to result in accumulation of free fatty acids, which can lead
to detrimental functionality in the foodstuff. This inherent
activity of lipolytic enzymes limits their functionality.
[0010] The negative effect on bread volume is often explained by
overdosing. Overdosing can lead to a decrease in gluten elasticity
which results in a dough which is too stiff and thus results in
reduced volumes. In addition, or alternatively, such lipases can
degrade shortening, oil or milk fat added to the dough, resulting
in off-flavour in the dough and baked product. Overdosing and
off-flavour have been attributed to the accumulation of free fatty
acids in the dough, particularly short chain fatty acids.
[0011] The presence of high levels of free fatty acids (FFA) in raw
materials or food products is generally recognised as a quality
defect and food processors and customers will usually include a
maximum FFA level in the food specifications. The resulting effects
of excess FFA levels can be in organoleptic and/or functional
defects.
[0012] In EP 1 193 314, the inventors discovered that the use of
lipolytic enzymes active on glycolipids was particularly beneficial
in applications in bread making, as the partial hydrolysis products
the lyso-glycolipids were found to have very high emulsifier
functionality, apparently resulting in a higher proportion of
positive emulsifier functionality compared to the detrimental
accumulation of free fatty acids. However, the enzymes were also
found to have significant non-selective activity on triglycerides
which resulted in unnecessarily high free fatty acid.
[0013] This problem of high triglyceride activity was addressed in
WO 02/094123, where the inventors discovered that by selecting
lipolytic enzymes which were active on the polar lipids
(glycolipids and phospholipids) in a dough, but substantially not
active on triglycerides or 1-mono-glycerides, an improved
functionality could be achieved.
[0014] A commercially preferred source of lipase enzymes is
filamentous fungi, such as Aspergillus spp. and Fusarium spp.
Lipases isolated from filamentous fungi have been found to have
industrially applicable characteristics and also have been found to
be routine to express in heterologous production systems, such as
in Aspergillus oryzae, Fusarium and yeast.
[0015] A lipase from Fusarium oxysporum was identified in EP 0 130
064, and the application of F. oxysporum lipases in food
applications has been suggested in Hoshino et al. (1992) Biosci.
Biotech. Biochem 56: 660-664.
[0016] EP 0 869 167 describes the cloning and expression of a
Fusarium oxysporum lipase and its use in baking. The enzyme is
described as having phospholipase activity. This enzyme is now sold
by Novozymes A/S (Denmark) as Lipopan F.TM..
[0017] WO 02/00852 discloses five lipase enzymes and their encoding
polynucleotides, isolated from F. venenatum, F. sulphureum, A.
berkeleyanum, F. culmorum and F. solani. All five enzymes are
described as having triacylglycerol hydrolysing activity,
phospholipase and galactolipase activity. Three of the enzymes have
equivalent activity to the F. oxysporum enzyme taught in EP 0 869
167: F. venenatum, F. sulphureum, F. culmorum.
[0018] Therefore, it is apparent that some Fusarium lipases,
including Lipopan F.TM. have been found to have side activity on
polar lipids, including phospholipids and glycolipids. Although
described as a phospholipase in EP 0 869 167, the lipase from
Fusarium oxysporum has high lipase activity. The enzyme also has
glycolipase activity. However, despite the significant activity on
polar lipids, the functionality achieved by use of the enzyme is
limited due to the high lipase (i.e. triglyceride) activity.
[0019] Nagao et al (J. Biochem 116 (1994) 536-540) describes a
lipase from F. heterosporum; which enzyme predominantly functions
as a lipase (E.C. 3.1.1.3) to hydrolyse triglycerides. This is very
different from the enzymes according to the present invention.
[0020] Lipolytic enzyme variants, with specific amino acid
substitutions and fusions, have been produced some of which have an
enhanced activity on the polar lipids compared to the wild-type
parent enzymes. WO01/39602 describes such a variant, referred to as
SP979, which is a fusion of the Thermomyces lanuginosus lipase, and
the Fusarium oxysporum lipase described in EP 0 869 167. This
variant has been found to have a significantly high ratio of
activity on phospholipids and glycolipids compared to
triglycerides.
[0021] However, prior to the present invention, natural fungal
lipolytic enzymes, particularly from Fusarium spp., having a high
ratio of activity on polar lipids compared with triglycerides had
not been taught.
SUMMARY OF THE INVENTION
[0022] In a broad aspect the present invention relates to a fungal
lipolytic enzyme having a higher ratio of activity on polar lipids
(phospholipids and/or glycolipids) as compared with triglycerides,
in particular a higher ratio of activity on glycolipids as compared
with triglycerides.
[0023] In a further broad aspect the present invention relates to a
wild-type fungal lipolytic enzyme having a higher ratio of activity
on polar lipids (phospholipids and/or glycolipids) as compared with
triglycerides, in particular a higher ratio of activity on
glycolipids as compared with triglycerides.
[0024] In a yet further broad aspect the present invention relates
to a nucleic acid encoding a novel fungal lipolytic enzyme as
taught herein.
[0025] In one broad aspect the present invention relates to a
method of preparing a foodstuff, preferably an egg-based foodstuff,
the method comprising adding a fungal lipolytic enzyme of the
present invention to one or more ingredients of the foodstuff.
[0026] The present invention relates to a method of preparing a
dough, the method comprising adding a fungal lipolytic enzyme of
the present invention to one or more ingredients of the dough and
mixing to form a dough.
[0027] Another broad aspect of the present invention relates to a
method of preparing a baked product from a dough, the method
comprising adding a fungal lipolytic enzyme of the present
invention to the dough.
[0028] There is also provided a method of preparing a fungal
lipolytic enzyme according to the present invention, the method
comprising transforming a host cell with a recombinant nucleic acid
comprising a nucleotide sequence coding for the fungal lipolytic
enzyme, the host cell being capable of expressing the nucleotide
sequence coding for the polypeptide of the fungal lipolytic enzyme,
cultivating the transformed host cell under conditions where the
nucleic acid is expressed and harvesting the fungal lipolytic
enzyme.
[0029] In a further broad aspect, the invention provides a
lipolytic enzyme which retains activity at low temperatures, i.e.
is a low temperature lipolytic enzyme.
[0030] Aspects of the present invention are presented in the claims
and in the following commentary.
[0031] Other aspects concerning the nucleotide sequences which can
be used in the present invention include: a construct comprising
the sequences of the present invention; a vector comprising the
sequences for use in the present invention; a plasmid comprising
the sequences for use in the present invention; a transformed cell
comprising the sequences for use in the present invention; a
transformed tissue comprising the sequences for use in the present
invention; a transformed organ comprising the sequences for use in
the present invention; a transformed host comprising the sequences
for use in the present invention; a transformed organism comprising
the sequences for use in the present invention. The present
invention also encompasses methods of expressing the nucleotide
sequence for use in the present invention using the same, such as
expression in a host cell; including methods for transferring same.
The present invention further encompasses methods of isolating the
nucleotide sequence, such as isolating from a host cell.
[0032] Other aspects concerning the amino acid sequence for use in
the present invention include: a construct encoding the amino acid
sequences for use in the present invention; a vector encoding the
amino acid sequences for use in the present invention; a plasmid
encoding the amino acid sequences for use in the present invention;
a transformed cell expressing the amino acid sequences for use in
the present invention; a transformed tissue expressing the amino
acid sequences for use in the present invention; a transformed
organ expressing the amino acid sequences for use in the present
invention; a transformed host expressing the amino acid sequences
for use in the present invention; a transformed organism expressing
the amino acid sequences for use in the present invention. The
present invention also encompasses methods of purifying the amino
acid sequence for use in the present invention using the same, such
as expression in a host cell; including methods of transferring
same, and then purifying said sequence.
[0033] For the ease of reference, these and further aspects of the
present invention are now discussed under appropriate section
headings. However, the teachings under each section are not
necessarily limited to each particular section.
DETAILED DISCLOSURE OF INVENTION
[0034] In one aspect, the present invention provides a wild-type
fungal lipolytic enzyme having a higher ratio of activity on polar
lipids compared with triglycerides.
[0035] In one aspect, the present invention provides a fungal
lipolytic enzyme comprising an amino acid sequence as shown as SEQ
ID No. 1, SEQ ID No. 2, SEQ ID No. 4, or SEQ ID No. 6 or an amino
acid sequence which has at least 90% identity thereto.
[0036] In a further aspect the present invention provides a nucleic
acid encoding a fungal lipolytic enzyme comprising an amino acid
sequence as shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 4 or
SEQ ID No. 6 or an amino acid sequence which has at least 90%
identity therewith.
[0037] SEQ ID No. 1 is shown in FIG. 37, SEQ ID No. 2 is shown in
FIG. 38, SEQ ID No. 4 is shown in FIG. 40 and SEQ ID No. 6 is shown
in FIG. 42.
[0038] In a further aspect the present invention provides a nucleic
acid encoding a fungal lipolytic enzyme, which nucleic acid is
selected from the group consisting of: [0039] a) a nucleic acid
comprising a nucleotide sequence shown in SEQ ID No. 3, SEQ ID No.
5 or SEQ ID No. 7; [0040] b) a nucleic acid which is related to the
nucleotide sequence of SEQ ID No. 3, SEQ ID No. 5 or SEQ ID No. 7
by the degeneration of the genetic code; and [0041] c) a nucleic
acid comprising a nucleotide sequence which has at least 90%
identity with the nucleotide sequence shown in SEQ ID No. 3, SEQ ID
No. 5 or SEQ ID No. 7.
[0042] SEQ ID No. 3 is shown in FIG. 39; SEQ ID No. 5 is shown in
FIG. 41; and SEQ ID No. 7 is shown in FIG. 43.
[0043] In another aspect the present invention provides the use of
a fungal lipolytic enzyme according to the present invention in the
manufacture of a foodstuff, such as for instance a dough, a baked
product, an egg, an egg-based product, a noodle product, a cheese
product, a tortilla product, an animal feed product, a vegetable
oil or an edible oil. Advantageously, the addition of an enzyme of
the present invention to the foodstuff may lead to improved
emulsification with lower accumulation of free fatty acids.
[0044] In a further aspect the present invention provides the use
of a fungal lipolytic enzyme according to the present invention in
the manufacture of a dough and/or a baked product, comprising
adding said lipolytic enzyme to a dough, and (optionally) baking
the dough to make a baked product for one or more of the following:
reducing stickiness of the dough; improving machinability of the
dough; reducing blistering during baking of the baked product;
improving bread volume and/or softness; prolonging shelf life of
the baked product and/or dough; improving antistaling effect of the
baked product and/or dough; improving crumb structure of the baked
product; reducing pore heterogeneity of the baked product;
improving pore homogeneity of the baked product; reducing mean pore
size of the baked product; enhancing the gluten index of the dough;
improving flavour and/or odour of the baked product, improving the
colour of the crust of the baked product.
[0045] Advantageously, the enzyme according to the present
invention may have a higher activity than conventional lipolytic
enzymes at a low pH and so may be more advantageously suited for
use in a low pH sour dough environment than conventional lipolytic
enzymes.
[0046] In another aspect of the present invention there is provided
a method of making a dough and/or a baked product comprising adding
a fungal lipolytic enzyme according to the present invention to a
dough and (optionally) baking the dough to make the baked
product.
[0047] In a further aspect of the present invention provides the
use of a fungal lipolytic enzyme according to the present invention
in the manufacture of egg-based products for improving texture,
reducing mean particle size, reducing mean particle distribution,
improving heat stability, improving microwave performance and/or
stability.
[0048] In another aspect of the present invention, there is
provided a method of treating egg or egg-based product, which
method comprises adding a fungal lipolytic enzyme according to the
present invention to an egg or egg-based product.
[0049] In another aspect of the invention, there is provided a
method of making noodles, or a noodle dough or a noodle-based
product, which method comprises adding a fungal lipolytic enzyme
according to the present invention to the noodle, noodle dough or
noodle-based product.
[0050] In one aspect of the present invention, there is provided a
use of a fungal lipolytic enzyme according to the present invention
in the manufacture of a noodle or a noodle-based product for one or
more of improving colour/yellowness, stabilising colour
characteristics, reducing brightness, reducing fat content,
improving texture and bite (chewiness), reducing water activity,
reducing breakage, increasing core firmness and improving shape
retention during processing
[0051] In another aspect of the invention, there is provided a
method of making a tortilla or tortilla dough, which method
comprises adding a fungal lipolytic enzyme according to the present
invention to the tortilla or tortilla dough
[0052] A further aspect of the present invention provides the use
of a fungal lipolytic enzyme according to the present invention in
the manufacture of a tortilla or a tortilla dough for improving the
rollability of a tortilla, increasing pliability of a tortilla,
improving antistaling properties of the tortilla and/or tortilla
dough, improving softness and/or reducing off-flavour in the
tortilla and/or tortilla dough.
[0053] The functionality of the lipolytic enzyme in tortilla and/or
noodles may be improved by combination with emulsifiers such as
DATEM.
[0054] In another aspect of the invention, there is provided a
method of treating milk, cheese milk, cheese or a cheese-based
product, which method comprises adding a fungal lipolytic enzyme
according to the present invention to the cheese or cheese-based
product.
[0055] The present invention yet further provides use of a fungal
lipolytic enzyme according to the present invention in the
manufacture of a cheese or a cheese-based product for one or more
of improving flavour, texture and/or stability, decreasing in the
oiling-off effect in cheese and/or to increase cheese yield in
cheese production.
[0056] In another aspect of the invention, there is provided a
method of treating animal feed, which method comprises adding a
fungal lipolytic enzyme according to the present invention to the
animal feed.
[0057] The present invention further provides the use of a fungal
lipolytic enzyme according to the present invention in the
manufacture of animal feed for enhancing one or more of: feed
utilisation and/or conversion efficiency, body weight gain,
digestibility nitrogen uptake, metabolisability of dry matter and
palatability.
[0058] In a further aspect of the present invention provides the
use of a fungal lipolytic enzyme according to the present invention
in a process of preparing a lyso-phospholipid, for example
lysolecithin by treatment of a phospholipid (e.g. lecithin) with
the enzyme to produce the partial hydrolysis product, i.e. the
lyso-phospholipid.
[0059] In another aspect of the present invention there is provided
a process of preparing a lyso-phospholipid, for example
lysolecithin, which process comprises treating a phospholipid (e.g.
lecithin) with the fungal lipolytic enzyme according to the present
invention.
[0060] In a further aspect of the present invention provides the
use of a fungal lipolytic enzyme according to the present invention
in a process of preparing a lyso-glycolipid, (for example
digalactosyl monoglyceride (DGMG) or monogalactosyl monoglyceride
(MGMG)) by treatment of a glycolipid (e.g. digalactosyl diglyceride
(DGDG) or monogalactosyl diglyceride (MGDG)) with the lipolytic
enzyme according to the present invention to produce the partial
hydrolysis product, i.e. the lyso-glycolipid.
[0061] In a yet further aspect there is provided a process of
preparing a lyso-glycolipid (for example digalactosyl monoglyceride
(DGMG) or monogalactosyl monoglyceride (MGMG)), which process
comprising treating a glycolipid (e.g. digalactosyl diglyceride
(DGDG) or monogalactosyl diglyceride (MGDG)) with a fungal
lipolytic enzyme according to the present invention.
[0062] The present invention also provides a process of enzymatic
degumming of vegetable or edible oils, comprising treating the
edible or vegetable oil with fungal lipolytic enzyme according to
the present invention so as to hydrolyse a major part of the polar
lipids (e.g. phospholipid and/or glycolipid).
[0063] For the avoidance of doubt, a person of ordinary skill in
the art would be aware of methodology suitable for carrying out the
enzymatic treatment of edible oils (for instance see EP 0 869 167).
Known method may suitably be used when carrying out the present
invention, with the proviso that the known enzyme is replaced with
the enzyme according to the present invention.
[0064] In a further aspect the present invention provides the use
of a fungal lipolytic enzyme according to the present invention in
the manufacture of a vegetable oil or edible oil for reducing the
amount phospholipid in the vegetable oil or edible oil whilst
maintaining the triglyceride content of the oil and/or preventing
or reducing the accumulation of free fatty acids.
[0065] In a yet further aspect the present invention provides the
use of a fungal lipolytic enzyme according to the present invention
in a process comprising treatment of a phospholipid so as to
hydrolyse fatty acyl groups.
[0066] In another aspect the present invention provides the use of
a fungal lipolytic enzyme according to the present invention in a
process for reducing the content of a phospholipid in an edible
oil, comprising treating the oil with the fungal lipolytic enzyme
according to the present invention so as to hydrolyse a major part
of the phospholipid, and separating an aqueous phase containing the
hydrolysed phospholipid from the oil.
[0067] In a further aspect the invention provides a lipolytic
enzyme which retains activity at low temperatures, i.e. a low
temperature lipolytic enzyme. Further aspects of the invention
include the use of a low temperature lipolytic enzyme in the
methods and uses describes herein, i.e. of the fungal lipolytic
enzyme of the present invention.
[0068] Preferably, the fungal lipolytic enzyme according to the
present invention has a higher ratio of activity on polar lipids
(e.g. glycolipids and/or phospholipids) than on triglycerides.
[0069] Preferably, the fungal lipolytic enzyme according to the
present invention has a higher ratio of activity on phospholipids
than on triglycerides.
[0070] Preferably, the fungal lipolytic enzyme according to the
present invention has a higher ratio of activity on glycolipids
than on triglycerides.
[0071] Suitably, the fungal lipolytic enzyme according to the
present invention may have a higher ratio of activity on both
glycolipids and phospholipids than on triglycerides.
[0072] More preferably, the fungal lipolytic enzyme according to
the present invention has a higher ratio of activity on
digalactosyl diglyceride (DGDG) than on triglycerides.
[0073] Preferably the fungal lipolytic enzyme according to the
present invention hydrolyses DGDG or MGDG to DGMG or MGMG,
respectively.
[0074] The term "higher ratio of activity on polar lipids" as
referred to herein means that the fungal lipolytic enzyme according
to the present invention has a polar lipid:triglyceride hydrolysing
activity ratio which is higher when compared with a commercial
enzyme Lipopan F.TM. (Novozymes A/S, Denmark).
[0075] The term "polar lipids" as used herein means phospholipids
and/or glycolipids. Preferably, the term "polar lipids" as used
herein means both phospholipids and glycolipids.
[0076] The terms "higher ratio of activity on glycolipids" and
"higher ratio of activity of phospholipids" as referred to herein
means that the fungal lipolytic enzyme according to the present
invention has a glycolipid:triglyceride hydrolysing activity ratio
or a phospholipid:triglyceride hydrolysing activity ratio,
respectively, which is higher than the corresponding ratio achieved
with the commercial enzyme Lipopan F.TM. (Novozymes A/S,
Denmark).
[0077] Preferably, the lipolytic enzyme according to the present
invention may have a polar lipid:triglyceride hydrolysing activity
ratio of at least 4. Suitably, the polar lipid:triglyceride
hydrolysing activity ratio may be greater than 5. Suitably, the
polar lipid:triglyceride hydrolysing activity ratio may be greater
than 8, preferably greater than 9, more preferably greater than 10,
even more preferably greater than 15.
[0078] Preferably, the fungal lipolytic enzyme according to the
present invention may have a phospholipid:triglyceride hydrolysing
activity ratio of at least 4. Suitably, the polar
lipid:triglyceride hydrolysing activity ratio may be greater than
5. Suitably, the polar lipid:triglyceride hydrolysing activity
ratio may be greater than 8, preferably greater than 9, more
preferably greater than 10, even more preferably greater than
15.
[0079] Preferably, the fungal lipolytic enzyme according to the
present invention may have a glycolipid:triglyceride hydrolysing
activity ratio of at least 1.5, preferably at least 1.8, preferably
at least 2, preferably at least 3, preferably at least 4. Suitably,
the glycolipid:triglyceride hydrolysing activity ratio may be
greater than 4. Suitably, the glycolipid:triglyceride hydrolysing
activity ratio may be greater than 5.
[0080] In a further aspect the present invention provides a fungal
lipolytic enzyme having a polar lipid:triglyceride hydrolysing
activity ratio of at least 4. Suitably, the polar
lipid:triglyceride hydrolysing activity ratio may be greater than
5. Suitably, the polar lipid:triglyceride hydrolysing activity
ratio may be greater than 8, preferably greater than 9, more
preferably greater than 10, even more preferably greater than
15.
[0081] In another aspect the present invention provides a fungal
lipolytic enzyme having a phospholipid:triglyceride hydrolysing
activity ratio of at least 4. Suitably, the polar
lipid:triglyceride hydrolysing activity ratio may be greater than
5. Suitably, the polar lipid:triglyceride hydrolysing activity
ratio may be greater than 8, preferably greater than 9, more
preferably greater than 10, even more preferably greater than
15.
[0082] In a yet further aspect, the present invention provides a
fungal lipolytic enzyme having a glycolipid:triglyceride
hydrolysing activity ratio of at least 1.5, preferably at least
1.8, preferably at least 2, preferably at least 3, preferably at
least 4, preferably greater than 5, preferably greater than 10,
preferably greater than 15.
[0083] Preferably the fungal lipolytic enzyme according to the
present invention has at least 1.5 times more activity against
polar lipids (e.g. phospholipase A2 (E.C. 3.1.1.4) activity and/or
phospholipase A1 (E.C. 3.1.1.32) activity and/or glycolipase (E.C.
3.1.1.26) activity) as compared with triglyceride lipase activity
(E.C. 3.1.1.3), more preferably at least 2-times, more preferably
at least 3-times, more preferably at least 4-times.
[0084] Preferably the fungal lipolytic enzyme according to the
present invention has at least 1.5 times more glycolipase (E.C.
3.1.1.26) activity as compared with triglyceride lipase activity
(E.C. 3.1.1.3), more preferably at least 2-times, more preferably
at least 3-times, more preferably at least 4-times.
[0085] Preferably at the dosage that provides the optimal bread
volume using the minibaking assay detailed in example 3, the ratio
of hydrolysis of DGDG to triglyceride (TG) ratio is at least 1.7%,
preferably at least 1.8%, preferably at least 2% preferably at
least 3%, preferably at least 4%, preferably at least 5%,
preferably at least 10%, preferably at least 20%, preferably at
least 40%, preferably at least 50%.
[0086] The term "glycolipase activity" as used herein encompasses
"galactolipase activity".
[0087] The glycolipase activity, phospholipase activity and
triacylglyceride lipase activity of an enzyme can be determined
using the assays presented hereinbelow.
Determination of Galactolipase Activity (Glycolipase Activity
Assay):
Substrate:
[0088] 0.6% digalactosyldiglyceride (Sigma D 4651), 0.4% Triton-X
100 (Sigma X-100) and 5 mM CaCl.sub.2 was dissolved in 0.05M HEPES
buffer pH 7.
Assay Procedure:
[0089] 400 .mu.L substrate was added to an 1.5 mL Eppendorf tube
and placed in an Eppendorf Thermomixer at 37.degree. C. for 5
minutes. At time t=0 min, 50 .mu.L enzyme solution was added. Also
a blank with water instead of enzyme was analyzed. The sample was
mixed at 10*100 rpm in an Eppendorf Thermomixer at 37.degree. C.
for 10 minutes. At time t=10 min the Eppendorf tube was placed in
another thermomixer at 99.degree. C. for 10 minutes to stop the
reaction.
[0090] Free fatty acid in the samples was analyzed by using the
NEFA C kit from WAKO GmbH.
[0091] Enzyme activity GLU at pH 7 was calculated as micromoles of
fatty acid produced per minute under assay conditions.
Determination of Phospholipase Activity (Phospholipase Activity
Assay):
[0092] Phospholipase activity was measured using two different
methods which give comparable results. Either of these methods can
be used to determine phospholipase activity in accordance with the
present invention. Preferably, the PLU assay is used for
determining the phospholipase activity of any enzyme.
"PLU Assay" for Determination of Phospholipase Activity
Substrate:
[0093] 0.6% L-.alpha. Phosphatidylcholine 95% Plant (Avanti
#441601), 0.4% Triton-X 100 (Sigma X-100) and 5 mM CaCl.sub.2 was
dissolved in 0.05M HEPES buffer pH 7.
Assay Procedure:
[0094] 400 .mu.L substrate was added to an 1.5 mL Eppendorf tube
and placed in an Eppendorf Thermomixer at 37.degree. C. for 5
minutes. At time t=0 min, 50 .mu.L enzyme solution was added. Also
a blank with water instead of enzyme was analyzed. The sample was
mixed at 10*100 rpm in an Eppendorf Thermomixer at 37.degree. C.
for 10 minutes. At time t=10 min the Eppendorf tube was placed in
another thermomixer at 99.degree. C. for 10 minutes to stop the
reaction.
[0095] Free fatty acid in the samples was analyzed by using the
NEFA C kit from WAKO GmbH.
[0096] Enzyme activity PLU-7 at pH 7 was calculated as micromoles
of fatty acid produced per minute under assay conditions
"TIPU Assay" for Determination of Phospholipase Activity
[0097] 1 TIPU (Titration Phospholipase Unit) is defined as the
amount of enzyme, which liberates 1 .mu.mol free fatty acid per
minute at the assay conditions.
[0098] Phospholipase A1 and A2 catalyse the conversion of lecithin
to lyso-lecithin with release of the free fatty acid from position
1 and 2, respectively. Phospholipase activity can be determined by
continuous titration of the fatty acids liberated from lecithin
during enzymation, since the consumption of alkali equals the
amount of fatty acid liberated.
Substrate:
[0099] 4% lecithin, 4% Triton-X 100, and 6 mM CaCl2: 12 g lecithin
powder (Avanti Polar Lipids #44160) and 12 g Triton-X 100 (Merck
108643) was dispersed in approx. 200 ml demineralised water during
magnetic stirring. 3.0 ml 0.6 M CaCl2 (p.a. Merck 1.02382) was
added. The volume was adjusted to 300 mL with demineralised water
and the emulsion was homogenised using an Ultra Thurax. The
substrate was prepared freshly every day.
Assay Procedure:
[0100] An enzyme solution was prepared to give a slope on the
titration curve between 0.06 and 0.18 ml/min with an addition of
300 .mu.L enzyme.
[0101] A control sample of known activity is included.
[0102] The samples were dissolved in demineralised water and
stirred for 15 min. at 300 rpm. 25.00 ml substrate was
thermostatted to 37.0.degree. C. for 10-15 minutes before pH was
adjusted to 7.0 with 0.05 M NaOH. 300 .mu.L enzyme solution was
added to the substrate and the continuous titration with 0.05 M
NaOH was carried out using a pH-Stat titrator (Phm 290, Mettler
Toledo). Two activity determinations are made on each scaling.
After 8 minutes the titration is stopped and the slope of the
titration curve is calculated between 5 and 7 minutes. The
detection limit is 3 TIPU/ml enzyme solution.
Calculations:
[0103] The phospholipase activity (TIPU/g enzyme) was calculated in
the following way: TIPU .times. / .times. g = .alpha. N 10 6
.times. .mu. .times. .times. mol mol 10 - 3 .times. I ml V 1 m V 2
= .alpha. N 10 3 V 1 m V 2 ##EQU1## Where: .alpha. is the slope of
the titration curve between 5 and 7 minutes of reaction time
(ml/min) N is the normality of the NaOH used (mol/l) V1 is the
volume in which the enzyme is dissolved (ml) m is the amount of
enzyme added to V1 (g) V2 is the volume of enzyme solution added to
the substrate (ml) Determination of Triacylglyceride Lipase
Activity: Assay Based on Triglyceride (Tributyrin) as Substrate
(LIPU):
[0104] Lipase activity based on tributyrin is measured according to
Food Chemical Codex, Forth Edition, National Academy Press, 1996, p
803, with the modifications that the sample is dissolved in
deionized water instead of glycine buffer, and the pH stat set
point is 5.5 instead of 7.
[0105] 1 LIPU is defined as the quantity of enzyme which can
liberate 1 mol butyric acid per minute under assay conditions.
[0106] Based on the assays for activity on galactolipid (GLU),
phospholipid (PLU) and triglyceride (LIPU) it is possible to
calculate the ratios PLU/LIPU and GLU/LIPU.
[0107] The analysis of Lipopan F.TM. and a lipolytic enzyme
according to the present invention derived from Fusarium
heterosporum (sample 209) (see Example 3) gave the following
results.
[0108] The relative activity ratios for Lipopan F.TM. and Sample
209 are TABLE-US-00001 Lipopan F Sample 209
Phospholipid/triglyceride PLU/LIPU 3 9 Galactolipid/triglyceride
GLU/LIPU 1 4
[0109] Suitably the terms "synergy" or "synergistic effect" as used
herein means that the combination produces a better effect than
when each component (i.e. enzyme) is used separately. Synergy may
be determined by making a product, e.g. a dough and/or baked
product, with the addition of each component (i.e. enzyme)
separately and in combination, and comparing the effects.
[0110] The term "fungal lipolytic enzyme" as used herein means that
the naturally-occurring source of the enzyme is a fungus. For the
avoidance of doubt, however, this term may include a fungal enzyme
which is isolated from a fungus, one which is expressed in a fungal
host (either the native or non-native fungus) or one which is
expressed in a non-fungal host (e.g. in a bacterial or yeast for
instance).
[0111] Preferably, the fungal lipolytic enzyme according to the
present invention is a wild type enzyme.
[0112] The terms "natural" and "wild type" as used herein mean a
naturally-occurring enzyme. That is to say an enzyme expressed from
the endogenous genetic code and isolated from its endogenous host
organism and/or a heterologously produced enzyme which has not been
mutated (i.e. does not contain amino acid deletions, additions or
substitutions) when compared with the mature protein sequence
(after co- and post-translational cleavage events) endogenously
produced. Natural and wild-type proteins of the present invention
may be encoded by codon optimised polynucleotides for heterologous
expression, and may also comprise a non-endogenous signal peptide
selected for expression in that host.
[0113] The term "non-endogenous signal peptide" as used herein
means a signal peptide not naturally present in the nascent
polypeptide chain of the lipolytic enzyme prior to co-translational
cleavage. In the lipolytic enzyme according to the present
invention, part or whole of the non-endogenous signal peptide, for
example a pro-peptide, may remain attached to the mature
polypeptide--this is encompassed by the term "wild-type" as used
herein.
[0114] As mentioned above, the terms "natural" and "wild type" as
used herein mean a naturally-occurring enzyme. However, this does
not exclude the use of a synthetic or chemically synthesised
polypeptide comprising of the same polypeptide sequence as the
naturally occurring mature lipolytic enzyme.
[0115] The term "variant" as used herein means a protein expressed
from a non-endogenous genetic code resulting in one or more amino
acid alterations (i.e. amino acid deletions, additions or
substitutions) when compared with the natural or wild-type sequence
within the mature protein sequence.
[0116] Preferably the fungal lipolytic enzyme according to the
present invention is a lipolytic enzyme which retains activity at a
low temperature, i.e. is a low temperature lipolytic enzyme.
[0117] The term "a low temperature lipolytic enzyme" means an
enzyme which has significant activity at 5-15.degree. C.,
preferably an enzyme which has significant activity at 10.degree.
C.
[0118] In one embodiment the low temperature lipolytic enzyme
according to the present invention is not a lipolytic enzyme
comprising the amino acid sequence motif GDSX as disclosed in
WO2004/064987 wherein X is one or more of the following amino acid
residues: L, A, V, I, F, Y, H, Q, T, N, M or S.
[0119] A low temperature lipolytic enzyme according to the present
invention may be an enzyme which has a relative activity of at
least 5%, preferably at least 7%, more preferably at least 10%, on
lecithin substrate at 10.degree. C., at a pH within 20% of the
optimal pH of the lipolytic enzyme, as determined by the
determination of free fatty acids by the NEFA C method (see Example
5, performed at pH 7). Example 6 provides a method for determining
the pH optima for a lipolytic enzyme.
[0120] A low temperature lipolytic enzyme according to the present
invention may be an enzyme which has a relative activity of at
least 10%, preferably at least 15%, more preferably at least 20%,
more preferably at least 25% and most preferably at least 30% on
lecithin substrated at 20.degree. C., at a pH within 20% of the
optimal pH of the lipolytic enzyme, as determined by the
determination of free fatty acids by the NEFA C method (see Example
5, performed at pH 7). Example 6 provides a method for determining
the pH optima for a lipolytic enzyme.
[0121] A low temperature lipolytic enzyme according to the present
invention may also show significant activity of egg yolk lecithin
at 5.degree. C., characterised in that it is capable of releasing
at least 1%, preferably at least 1.5%, more preferably at least 2%
of free fatty acid after a reaction time of 480 minutes at an
enzyme dosage equivalent to 20 U/g egg yolk, using the assay
described in Example 9 and illustrated in FIGS. 24 and 25.
[0122] Preferably, the fungal lipolytic enzyme according to the
present invention may be obtainable (preferably obtained) from a
filamentous fungus. More preferably, the fungal lipolytic enzyme is
obtainable (preferably obtained) from Fusarium spp. Preferably, the
fungal lipolytic enzyme according to the present invention may be
obtainable (preferably obtained) from Fusarium heterosporum or
Fusarium semitectum. Suitably, the fungal lipolytic enzyme
according to the present invention may be obtainable (preferably
obtained) from Fusarium heterosporum (CBS 782.83) or Fusarium
semitectum (IBT 9507).
[0123] Thus in one aspect, preferably the lipolytic enzyme
according to the present invention is a filamentous fungal
lipolytic enzyme, preferably a filamentous fungal wild-type
lipolytic enzyme.
[0124] Preferably, the fungal lipolytic enzyme according to the
present invention comprises an amino acid sequence which has at
least 90%, preferably at least 95%, preferably at least 98%,
preferably at least 99% identity with the amino acid sequence shown
as SEQ ID No. 1 or SEQ ID No. 2, SEQ ID No. 4 or SEQ ID No. 6.
[0125] Preferably, the nucleic acid encoding the fungal lipolytic
enzyme according to the present invention comprises a nucleotide
sequence which has at least 90%, preferably at least 95%,
preferably at least 98%, preferably at least 99% identity with the
nucleotide sequence shown in SEQ ID No. 3, SEQ ID No. 5 or SEQ ID
No. 7.
[0126] Preferably, the fungal lipolytic enzyme according to the
present invention is not a fusion protein comprising an amino acid
sequence from a Thermomyces protein or part thereof fused with an
amino acid sequence from a Fusarium protein or part thereof. In
particular, preferably the fungal lipolytic enzyme according to the
present invention is not a fusion protein comprising an amino acid
sequence from a Thermomyces lanuginosa protein or a part thereof
fused with an amino acid sequence from a Fusarium oxysporum protein
or part thereof.
[0127] Preferably, the fungal lipolytic enzyme according to the
present invention is not obtained from Thermomyces lanuginosa
and/or is not a variant of an enzyme obtained from Thermomyces
lanuginosa.
[0128] Preferably, the fungal lipolytic enzyme according to the
present invention is isolated from a fermentation broth of Fusarium
heterosporum CBS 782.83 or Fusarium semitectum (IBT 9507).
[0129] Suitably, the enzyme may be purified by liquid
chromatography.
[0130] The amino acid sequence of the purified fungal lipolytic
enzyme may be determined by Edman degradation and MALDI-TOF
analysis.
[0131] A partly purified lipolytic enzyme from Fusarium
heterosporum CBS 782.83 has been tested in mini scale baking tests
and in pilot scale baking tests with very good results.
[0132] The baking effects of the fungal lipolytic enzyme from F.
heterosporum CBS 782.83 were found to be superior to Lipopan F.TM.
and this correlated to a increased ratio of activity on polar
lipids, in particular glycolipids, such as digalactosyl diglyceride
(DGDG), compared to triglycerides.
[0133] Additionally, a lipolytic enzyme from Fusarium semitectum
IBT 9507 has been tested for activity on flour lipids in dough
slurry with very good results.
[0134] The lipolytic enzyme from F. semitectum IBT 9507 was shown
to have significant activity on galactolipids in a dough and
relatively less activity on triglyceride compared with Lipopan
F.TM..
[0135] Suitably, the term "foodstuff" as used herein means a
substance which is suitable for human and/or animal
consumption.
[0136] Suitably, the term "foodstuff" as used herein may mean a
foodstuff in a form which is ready for consumption. Alternatively
or in addition, however, the term foodstuff as used herein may mean
one or more food materials which are used in the preparation of a
foodstuff. By way of example only, the term foodstuff encompasses
both baked goods produced from dough as well as the dough used in
the preparation of said baked goods.
[0137] In a preferred aspect the present invention provides a
foodstuff as defined above wherein the foodstuff is selected from
one or more of the following: eggs, egg-based products, including
but not limited to mayonnaise, salad dressings, sauces, ice creams,
egg powder, modified egg yolk and products made therefrom; baked
goods, including breads, cakes, sweet dough products, laminated
doughs, liquid batters, muffins, doughnuts, biscuits, crackers and
cookies; confectionery, including chocolate, candies, caramels,
halawa, gums, including sugar free and sugar sweetened gums, bubble
gum, soft bubble gum, chewing gum and puddings; frozen products
including sorbets, preferably frozen dairy products, including ice
cream and ice milk; dairy products, including cheese, butter, milk,
coffee cream, whipped cream, custard cream, milk drinks and
yoghurts; mousses, whipped vegetable creams; edible oils and fats,
aerated and non-aerated whipped products, oil-in-water emulsions,
water-in-oil emulsions, margarine, shortening and spreads including
low fat and very low fat spreads; dressings, mayonnaise, dips,
cream based sauces, cream based soups, beverages, spice emulsions
and sauces.
[0138] In one aspect the foodstuff in accordance with the present
invention may be a dough product or a baked product, such as a
bread, a fried product, a snack, cakes, pies, brownies, cookies,
noodles, instant noodles, tortillas, snack items such as crackers,
graham crackers, pretzels, and potato chips, and pasta.
[0139] In another aspect, the foodstuff in accordance with the
present invention may be an animal feed.
[0140] In one aspect preferably the foodstuff is selected from one
or more of the following: eggs, egg-based products, including
mayonnaise, salad dressings, sauces, ice cream, egg powder,
modified egg yolk and products made therefrom.
[0141] In some of the applications mentioned herein, particularly
the food applications, such as the bakery applications, the
lipolytic enzyme according to the present invention may be used
with one or more conventional emulsifiers, including for example
monoglycerides, diacetyl tartaric acid esters of mono- and
diglycerides of fatty acids, sodium stearoyl lactylate (SSL) and
lecithins.
[0142] The lipolytic enzyme according to the present invention is
especially preferred in bread recipes with added fat; this is
considered to be due to the low activity of the lipolytic enzyme
according to the present invention on triglycerides which results
in a reduced free fatty acid accumulation and, with respect to
short chain triglycerides, reduced or avoidance of off odour.
[0143] In the present context, the term "added fat" is used to
indicate no lipid or fat is added to the flour dough.
[0144] In addition or alternatively, the enzyme according to the
present invention may be used with one or more other suitable food
grade enzymes. Thus, it is within the scope of the present
invention that, in addition to the lipolytic enzyme of the present
invention, at least one further enzyme may be added to the baked
product and/or the dough. Such further enzymes include starch
degrading enzymes such as endo- or exoamylases, pullulanases,
debranching enzymes, hemicellulases including xylanases,
cellulases, oxidoreductases, e.g. glucose oxidase, pyranose
oxidase, sulfhydryl oxidase or a carbohydrate oxidase such as one
which oxidises maltose, for example hexose oxidase (HOX), lipases,
phospholipases and hexose oxidase, proteases, and acyltransferases
(such as those described in WO04/064987 for instance).
[0145] It is particularly preferred that the lipolytic enzyme of
the invention is used in combination with alpha amylases in
producing food products. In particular, the amylase may be a
non-maltogenic amylase, such as a polypeptide having non-maltogenic
exoamylase activity, in particular, glucan
1,4-alpha-maltotetrahydrolase (EC 3.2. 1.60) activity (as disclosed
in WO05/003339). A suitable non-maltogenic amylase is commercially
available as Powersoft.TM. (available from Danisco A/S, Denmark).
Maltogenic amylases such as Novamyl.TM. (Novozymes A/S, Denmark)
may also be used. In one embodiment, the combined use of alpha
amylases and the lipolytic enzyme of the invention may be used in a
dough, and/or the production of a baked product, such as bread,
cakes, doughnuts, cake doughnuts or bagels. The combination of
alpha amylases and the lipolytic enzyme of the invention is also
considered as preferable for use in methods of production of
tortillas, such as wheat and/or maize tortillas.
[0146] In another preferred embodiment, the lipolytic enzyme
according to the present invention may be used in combination with
a xylanase in producing food products. GRINDAMYL.TM. and POWERBake
7000 are examples of commercially available xylanase enzymes
available from Danisco A/S. Other examples of xylanase enzymes may
be found in WO03/020923 and WO01/42433
[0147] Preferably, the lipolytic enzyme according to the present
invention may be used in combination with a xylanase and an alpha
amylase. Suitably the alpha amylase may be a maltogenic, or a
non-maltogenic alpha amylase (such as GRINDAMYL.TM. or POWERSoft,
commercially available from Danisco A/S), or a combination
thereof.
[0148] The lipolytic enzyme of the invention can also preferably be
used in combination with an oxidising enzyme, such as a maltose
oxidising enzyme (MOX), for example hexose oxidase (HOX). Suitable
methods are described in WO03/099016. Commercially available
maltose oxidising enzymes GRINDAMYL.TM. and SUREBake are available
from Danisco A/S.
[0149] Optionally an alpha-amylase, such as a non-maltogenic
exoamylase and/or a maltogenic amylases, and/or a maltose oxidising
enzyme (MOX) in combination with the enzyme according to the
present invention may be used in methods of preparing a dough, a
baked product, tortilla, cake, instant noodle/fried snack food, or
a dairy product such as cheese.
[0150] The lipolytic enzyme according to the present invention is
typically included in the foodstuff or other composition by methods
known in the art. Such methods include adding the lipolytic enzyme
directly to the foodstuff or composition, addition of the lipolytic
enzyme in combination with a stabilizer and/or carrier, and
addition of a mixture comprising the lipolytic enzyme and a
stabilizer and/or carrier.
[0151] Suitable stabilizers for use with the present invention
include but is not limited to inorganic salts (such as NaCl,
ammonium sulphate), sorbitol, emulsifiers and detergents (such as
Tween 20, Tween 80, Panodan AB100 without triglycerides,
polyglycerolester, sorbitanmonoleate), oil (such as rape seed oil,
sunflower seed oil and soy oil), pectin, trehalose and
glycerol.
[0152] Suitable carriers for use with the present invention include
but is not limited to starch, ground wheat, wheat flour, NaCl and
citrate.
[0153] Gluten index may be measured by means of a Glutomatic 2200
from Perten Instruments (Sweden). To measure the gluten index:
immediately after proofing, 15 g of dough may be scaled and placed
in the Glutomatic and washed with 500 ml 2% NaCl solution for 10
min. The washed dough may then be transferred to a Gluten Index
Centrifuge 2015 and the two gluten fractions scaled and the gluten
index calculated according to the following equation: Gluten
index=(weight of gluten remaining on the sieve.times.100)/total
weight of gluten
[0154] Preferably the gluten index in the dough is increased by at
least 5%, relative to a dough without addition of the polypeptide,
the gluten index may be determined by means of a Glutomatic 2200
apparatus mentioned above
[0155] Further preferable aspects are presented in the accompanying
claims and the in the following description and examples.
Advantages
[0156] Surprisingly and unexpectedly it has been found that fungal
lipolytic enzymes according to the present invention have a much
higher ratio of activity on polar lipids (phospholipids and/or
glycolipids):triglycerides, compared with previously identified
lipolytic enzymes (particularly LipopanF.TM.) from fungi. This is
particularly surprising because prior to the present invention none
of the known wild type lipolytic enzymes from fungi showed this
activity. Although research had been carried out to investigate
lipolytic enzyme variants (i.e. ones which had been exposed to
non-natural mutagenesis and/or in some other way altered), it had
not been envisaged that a natural, wild-type enzyme from fungi
could have possessed these highly beneficial characteristics.
[0157] The enzymes identified have been found to have superior
functionality when used in baking applications. The use of the
fungal lipolytic enzyme according to the present invention
advantageously results in significantly improved properties to the
dough and/or baked products compared with other lipolytic enzymes
from fungi, particularly LipopanF.TM..
[0158] Advantageously lipolytic enzyme which retains activity at
lower temperatures, i.e. a low temperature lipolytic enzyme, may be
suitable for use in low temperature applications, thus removing the
need to heat a substrate. This may be of particular advantage in
applications such as enzymatic treatment of egg yolk, enzymatic
degumming of edible oils, and in treatment of milk or dairy
products, for example treatment of cheese milk prior to cheese
manufacture. A further advantage of using a low temperature
lipolytic enzyme may be found in foodstuffs and/or animal feeds,
where the retention of significant activity at low operating
temperatures allows for enzymatic treatment to be performed with
reduced risk of microbial, particularly bacterial, contamination.
In addition, when the stability of the enzyme is greater at lower
temperatures; this allows for efficient dosage of enzyme and longer
effective working life of the enzyme in industrial
applications.
Technical Effects
[0159] For baked products, such as bread, steam buns and US white
pan bread, for example, the addition of a lipolytic enzyme of the
present invention may result in one or more of the following:
improved bread volume and softness, prolonged shelf life and/or an
antistaling effect, improved crumb structure, reduced pore
heterogeneity, reduced mean pore size, enhanced gluten index,
improved flavour and/or odour, and improved colour of the
crust.
[0160] Advantageously, the enzyme according to the present
invention may be used to replace emulsifiers in foodstuffs, such as
dough and/or baked products.
[0161] The lipolytic enzyme according to the present invention may
have synergy with emulsifiers such as DATEM, SSL, CSL,
monoglyceride, polysorbates and Tween. Thus, the lipolytic enzyme
according to the present invention may be used in combination with
one or more emulsifiers. Advantageously, the use of the lipolytic
enzyme according to the present invention in combination with one
or more emulsifiers may reduce the overall amount of emulsifier
used compared with the amount needed when no enzyme according to
the present invention is used.
[0162] The lipolytic enzyme according to the present invention may
also have synergy with hydrocolloids, Guar, xanthum and pectin, and
with maltose oxidising enzymes such as hexose oxidase.
[0163] For doughnuts, cake doughnuts, bagels, snack cakes and
muffins, for example, the use of a lipolytic enzyme of the present
invention may result in a synergistic effect when used in
combination with one or more of alpha-amylases, maltogenic
alpha-amylase and non-maltogenic alpha-amylase.
[0164] For cakes, sponge cakes and palm cakes, for example, the use
of the lipolytic enzyme of the present invention may result in a
synergistic effect when used in combination with one or more of
hydrocolloids such as Guar, and/or one or more emulsifiers such as
DATEM.
[0165] For biscuits, for example, use of a lipolytic enzyme
according to the present invention confers improved rollability and
handling properties, particularly when cold (cold rollability).
[0166] Advantageously, in mayonnaise and other egg-based products,
for example, use of a lipolytic enzyme according to the present
invention may lead to improved texture, reduced mean particle size,
and/or reduced mean particle distribution, improved heat stability,
improved microwave performance and/or stability.
[0167] In cakes, use of the present invention advantageously leads
to improved softness, volume, improved keeping properties and shelf
life.
[0168] For noodles or noodle-products, e.g. instant noodles, for
example, the lipolytic enzyme of the present invention may confer
one or more of the following characteristics: improved
colour/yellowness, more stable colour characteristics, reduced
brightness, reduced fat content, improved texture and bite
(chewiness), reduced water activity, reduced breakage, increased
core firmness and improved shape retention during processing.
[0169] Preferably, the lipolytic enzyme of the present invention
may be used to reduce the fat content of a noodle or a noodle
product, for instance an instant noodle.
[0170] In tortilla, for example, use of the enzyme according to the
present invention may result in one or more of the following:
reduced rollability of the tortilla, for instance by increasing
pliability, improved antistaling properties, improving softness
and/or reducing off flavour.
[0171] Advantageously, improved rollability and/or pliability may
lead to a reduced likelihood of the tortilla splitting when
rolled.
[0172] In cheese and/or cheese-based products, for example, the use
of the enzyme according to the present invention may result in one
or more of the following: an improved flavour, texture and/or
stability, a decrease in the oiling-off effect in cheese and/or an
increase in cheese yield.
[0173] The term "oiling off effect" as used herein refers to the
free oil released when cheese is melted.
[0174] The lipolytic enzyme according to the present invention may
be used to produce a low fat cheese. Advantageously, the enzyme of
the present invention may stabilise fat in milk and/or may enhance
flavour.
[0175] One advantageous of the present invention is that the enzyme
functions (and indeed has a high functionality) at a low
temperature. This can have a number of advantages depending upon
the use to which the enzyme is put. For instance, in cheese
manufacture this functionality may reduce the risk of microbial
contamination and microbial growth during enzymatic treatment. The
reason for this may be that the cheese can remain chilled during
the enzymatic treatment. Thus, the lipolytic enzyme according of
the present invention may be particularly suitable for maturation
of cheese at low temperature for improved flavour.
[0176] In animal feed, for example, the enzyme according to the
present invention advantageously may result in one or more the
following: enhanced feed utilisation/conversion efficiency within
the animal, improved body weight gain of the animal, improved
digestibility of the feed, improved nitrogen uptake by the animal,
e.g. from the feed, improved metabolisability of dry matter of the
feed and improved palatability of feed.
[0177] In degumming of an edible oil, such as a vegetable oil, the
lipolytic enzyme of the present invention has a high activity at
low temperature. This advantageously may reduce the requirement to
heat oil prior to or during enzyme treatment. This has the
advantageous effect of reducing the amount of energy needed effect
the treatment. The enzyme according to the present invention may
improve selectivity the reduction of phospholipids compared with
triglycerides. The enzyme according to the present invention in an
edible oil (such as a vegetable oil) may there have reduced
hydrolytic activity on triglycerides compared to phospholipids.
This may lead to less of the triglyceride being hydrolysed
(compared with a conventional/phospholipase enzyme) and this may
lead to fewer losses in the oil yield and/or a reduced free fatty
acid accumulation in the oil (compared with a conventional
lipolytic/phospholipase enzyme).
Uses
[0178] The enzyme according to the present invention has many
applications.
[0179] In particular, the fungal lipolytic enzymes according to the
present invention may be useful in the preparation of a
foodstuff.
[0180] For example, the fungal lipolytic enzymes according to the
present invention may be particularly useful in the treatment of
egg or egg-based products.
[0181] Phospholipases, particularly phospholipase A2 (E.C.
3.1.1.4), have been used for many years for the treatment of egg or
egg-based products (see U.S. Pat. No. 4,034,124 and Dutihl &
Groger 1981 J. Sci. Food Agric. 32, 451-458, for example). The
phospholipase activity during the treatment of egg or egg-based
products results in the accumulation of polar lysolecithin, which
can act as an emulsifier.
[0182] Treatment of egg or egg-based products with a fungal
lipolytic enzyme according to the present invention can improve the
stability, thermal stability under heat treatment such as
pasteurisation and result in substantial thickening. Egg-based
products may include, but are not limited to cakes, mayonnaise,
salad dressings, sauces, ice creams and the like.
[0183] The fungal lipolytic enzymes according to the present
invention are particularly useful in the preparation of baked
products, such as those prepared from a dough, including breads,
cakes, sweet dough products, laminated doughs, liquid batters,
muffins, doughnuts, biscuits, crackers and cookies.
[0184] The fungal lipolytic enzymes according to the present
invention may also be used in bread-improving additive, e.g. dough
compositions, dough additive, dough conditioners, pre-mixes and
similar preparations conventionally added to the flour and/or the
dough during processes for making bread or other baked products to
provide improved properties to the bread or other baked
products.
[0185] Thus, the present invention further relates to a
bread-improving composition and/or a dough-improving composition
comprising a fungal lipolytic enzyme according to the present
invention; and also to a dough or baked product comprising such a
bread-improving and/or dough-improving composition.
[0186] The bread-improving composition and/or dough-improving
composition may comprise, in addition to a fungal lipolytic enzyme
according to the present invention, other substances, which
substances are conventionally used in baking to improve the
properties of dough and/or baked products.
[0187] The bread-improving composition and/or dough-improving
composition may comprise one or more conventional baking agents,
such as one or more of the following constituents:
[0188] A milk powder, gluten, an emulsifier, granulated fat, an
oxidant, an amino acid, a sugar, a salt, flour or starch.
[0189] Examples of suitable emulsifiers are: monoglycerides,
diacetyl tartaric acid esters of mono- and diglycerides of fatty
acids, sugar esters, sodium stearoyl lactylate (SSL) and
lecithins.
[0190] The bread and/or dough improving composition may further
comprise another enzyme, such as one or more other suitable food
grade enzymes, including starch degrading enzymes such as endo- or
exoamylases, pullulanases, debranching enzymes, hemicellulases
including xylanases, cellulases, oxidoreductases, e.g. glucose
oxidase, pyranose oxidase, sulfhydryl oxidase or a carbohydrate
oxidase such as one which oxidises maltose, for example hexose
oxidase (HOX), lipases, phospholipases and hexose oxidase,
proteases and acyltransferases (such as those described in
WO04/064987 for instance).
[0191] The term "improved properties" as used herein means any
property which may be improved by the action of the fungal
lipolytic enzymes of the present invention. In particular, the use
of a fungal lipolytic enzyme according to the present invention
results in one or more of the following characteristics: increased
volume of the baked product; improved crumb structure of the baked
product; anti-staling properties in the baked product; increased
strength, increased stability, reduced stickiness and/or improved
machinability of the dough.
[0192] The improved properties are evaluated by comparison with a
dough and/or a baked product prepared without addition of the
lipolytic enzyme according to the present invention.
[0193] The term "baked product" as used herein includes a product
prepared from a dough. Examples of baked products (whether of
white, light or dark type) which may be advantageously produced by
the present invention include one or more of the following: bread
(including white, whole-meal and rye bread), typically in the form
of loaves or rolls or toast, French baguette-type bread, pitta
bread, tortillas, tacos, cakes, pancakes, biscuits, crisp bread,
pasta, noodles and the like.
[0194] The dough in accordance with the present invention may be a
leavened dough or a dough to be subjected to leavening. The dough
may be leavened in various ways such as by adding sodium
bicarbonate or the like, or by adding a suitable yeast culture such
as a culture of Saccharomyces cerevisiae (baker's yeast).
[0195] The present invention further relates to the use of fungal
lipolytic enzymes in accordance with the present invention to
produce a pasta dough, preferably prepared from durum flour or a
flour of comparable quality.
[0196] The fungal lipolytic enzymes according to the present
invention are suitable for use in the enzymatic degumming of
vegetable or edible oils. In processing of vegetable or edible oil
the edible or vegetable oil is treated with a fungal lipolytic
enzyme according to the present invention so as to hydrolyse a
major part of the polar lipids (e.g. phospholipid and/or
glycolipid). Preferably, the fatty acyl groups are hydrolysed from
the polar lipids. The degumming process typically results in the
reduction of the content of the polar lipids, particularly of
phospholipids, in an edible oil due to hydrolysis of a major part
(i.e. more than 50%) of the polar lipid, e.g. glycolipid and/or
phospholipid. Typically, the aqueous phase containing the
hydrolysed polar lipid (e.g. phospholipid and/or glycolipid) is
separated from the oil. Suitably, the edible or vegetable oil may
initially (pre-treatment with the enzyme according to the present
invention) have a phosphorus content of 50-250 ppm.
[0197] Furthermore, the present invention is directed to the use of
a lipolytic enzyme according to the present invention for treatment
of cheese products.
[0198] The lipolytic enzyme according to the present invention is
also particularly suitable for use in the preparation of an animal
feed.
[0199] As the skilled person is aware, the term "degumming" as used
herein means the refining of oil by converting phosphatides (such
as lecithin, phosphoholipids and occluded oil) into hydratable
phosphatides. Oil which has been degummed is more fluid and thus
has better handling properties than oil which has not been
degummed.
[0200] The following table is merely for general guidance and
provides an overview of the dosage level for a lipolytic enzyme
according to the present invention which may be needed in different
applications. The table further provides guidance in respect of the
dosage level for a lipolytic enzyme according to the present
invention when used in combination with an emulsifier for example.
Of course, as would be apparent to the person of ordinary skill in
the art optimisation of enzyme dosage, reaction temperature and
reaction time may be readily determined, using routine
experimentation, for any given application. TABLE-US-00002
"Optimal" Optimal dosage in Dosage range, dosage, TIPU/ combination
with TIPU/KG Application kg of flour emulsifier of flour Crusty
rolls 400 120 300-800 Straight dough 400 120 300-800 toast bread
Straight dough long 120 75-250 fermentation High speed mixing - 120
300-800 Tweedy procedure US sponge & 120 75-400 dough pan bread
on top of DATEM Wheat tortilla 700 Contains 400-2500 emulsifiers
Cakes - sponge 2000 Contains cake 1000-4000 cakes emulsifiers
Retarded dough (24 120 Contains 75-250 hours) emulsifiers Steam
buns 200 150-500 Instant fried 200-10,000 noodles
Isolated
[0201] In one aspect, preferably the sequence is in an isolated
form. The term "isolated" means that the sequence is at least
substantially free from at least one other component with which the
sequence is naturally associated in nature and as found in
nature.
Purified
[0202] In one aspect, preferably the sequence is in a purified
form. The term "purified" means that the sequence is in a
relatively pure state--e.g. at least about 90% pure, or at least
about 95% pure or at least about 98% pure.
Nucleotide Sequence
[0203] The scope of the present invention encompasses nucleotide
sequences encoding enzymes having the specific properties as
defined herein.
[0204] The term "nucleotide sequence" as used herein refers to an
oligonucleotide sequence or polynucleotide sequence, and variants,
homologues, fragments and derivatives thereof (such as portions
thereof). The nucleotide sequence may be of genomic or synthetic or
recombinant origin, which may be double-stranded or single-stranded
whether representing the sense or anti-sense strand.
[0205] The term "nucleotide sequence" in relation to the present
invention includes genomic DNA, cDNA, synthetic DNA, and RNA.
Preferably it means DNA, more preferably cDNA sequence coding for
the present invention.
[0206] In a preferred embodiment, the nucleotide sequence when
relating to and when encompassed by the per se scope of the present
invention does not include the native nucleotide sequence according
to the present invention when in its natural environment and when
it is linked to its naturally associated sequence(s) that is/are
also in its/their natural environment. For ease of reference, we
shall call this preferred embodiment the "non-native nucleotide
sequence". In this regard, the term "native nucleotide sequence"
means an entire nucleotide sequence that is in its native
environment and when operatively linked to an entire promoter with
which it is naturally associated, which promoter is also in its
native environment. However, the amino acid sequence encompassed by
scope the present invention can be isolated and/or purified post
expression of a nucleotide sequence in its native organism.
Preferably, however, the amino acid sequence encompassed by scope
of the present invention may be expressed by a nucleotide sequence
in its native organism but wherein the nucleotide sequence is not
under the control of the promoter with which it is naturally
associated within that organism.
Preparation of the Nucleotide Sequence
[0207] Typically, the nucleotide sequence encompassed by scope of
the present invention is prepared using recombinant DNA techniques
(i.e. recombinant DNA). However, in an alternative embodiment of
the invention, the nucleotide sequence could be synthesised, in
whole or in part, using chemical methods well known in the art (see
Caruthers M H et al., (1980) Nuc Acids Res Symp Ser 215-23 and Horn
T et al., (1980) Nuc Acids Res Symp Ser 225-232).
[0208] A nucleotide sequence encoding an enzyme which has the
specific properties as defined herein may be identified and/or
isolated and/or purified from any cell or organism producing said
enzyme. Various methods are well known within the art for the
identification and/or isolation and/or purification of nucleotide
sequences. By way of example, PCR amplification techniques to
prepare more of a sequence may be used once a suitable sequence has
been identified and/or isolated and/or purified.
[0209] By way of further example, a genomic DNA and/or cDNA library
may be constructed using chromosomal DNA or messenger RNA from the
organism producing the enzyme. If the amino acid sequence of the
enzyme or a part of the amino acid sequence of the enzyme is known,
labelled oligonucleotide probes may be synthesised and used to
identify enzyme-encoding clones from the genomic library prepared
from the organism. Alternatively, a labelled oligonucleotide probe
containing sequences homologous to another known enzyme gene could
be used to identify enzyme-encoding clones. In the latter case,
hybridisation and washing conditions of lower stringency are
used.
[0210] Alternatively, enzyme-encoding clones could be identified by
inserting fragments of genomic DNA into an expression vector, such
as a plasmid, transforming enzyme-negative bacteria with the
resulting genomic DNA library, and then plating the transformed
bacteria onto agar plates containing a substrate for the enzyme
(e.g. maltose for a glucosidase (maltase) producing enzyme),
thereby allowing clones expressing the enzyme to be identified.
[0211] In a yet further alternative, the nucleotide sequence
encoding the enzyme may be prepared synthetically by established
standard methods, e.g. the phosphoroamidite method described by
Beucage S. L. et al., (1981) Tetrahedron Letters 22, p 1859-1869,
or the method described by Matthes et al., (1984) EMBO J. 3, p
801-805. In the phosphoroamidite method, oligonucleotides are
synthesised, e.g. in an automatic DNA synthesiser, purified,
annealed, ligated and cloned in appropriate vectors.
[0212] The nucleotide sequence may be of mixed genomic and
synthetic origin, mixed synthetic and cDNA origin, or mixed genomic
and cDNA origin, prepared by ligating fragments of synthetic,
genomic or cDNA origin (as appropriate) in accordance with standard
techniques. Each ligated fragment corresponds to various parts of
the entire nucleotide sequence. The DNA sequence may also be
prepared by polymerase chain reaction (PCR) using specific primers,
for instance as described in U.S. Pat. No. 4,683,202 or in Saiki R
K et al., (Science (1988) 239, pp 487-491).
[0213] Due to degeneracy in the genetic code, nucleotide sequences
may be readily produced in which the triplet codon usage, for some
or all of the amino acids encoded by the original nucleotide
sequence, has been changed thereby producing a nucleotide sequence
with low homology to the original nucleotide sequence but which
encodes the same, or a variant, amino acid sequence as encoded by
the original nucleotide sequence. For example, for most amino acids
the degeneracy of the genetic code is at the third position in the
triplet codon (wobble position) (for reference see Stryer, Lubert,
Biochemistry, Third Edition, Freeman Press, ISBN 0-7167-1920-7)
therefore, a nucleotide sequence in which all triplet codons have
been "wobbled" in the third position would be about 66% identical
to the original nucleotide sequence. However, the amended
nucleotide sequence would encode for the same, or a variant,
primary amino acid sequence as the original nucleotide
sequence.
[0214] Therefore, the present invention further relates to any
nucleotide sequence that has alternative triplet codon usage for at
least one amino acid encoding triplet codon, but which encodes the
same, or a variant, polypeptide sequence as the polypeptide
sequence encoded by the original nucleotide sequence.
[0215] Furthermore, specific organisms typically have a bias as to
which triplet codons are used to encode amino acids. Preferred
codon usage tables are widely available, and can be used to prepare
codon optimised genes. Such codon optimisation techniques are
routinely used to optimise expression of transgenes in a
heterologous host.
Amino Acid Sequences
[0216] The scope of the present invention also encompasses amino
acid sequences of enzymes having the specific properties as defined
herein.
[0217] As used herein, the term "amino acid sequence" is synonymous
with the term "polypeptide" and/or the term "protein". In some
instances, the term "amino acid sequence" is synonymous with the
term "peptide". In some instances, the term "amino acid sequence"
is synonymous with the term "enzyme".
[0218] The amino acid sequence may be prepared/isolated from a
suitable source, or it may be made synthetically or it may be
prepared by use of recombinant DNA techniques.
[0219] The enzyme encompassed in the present invention may be used
in conjunction with other enzymes. Thus the present invention also
covers a combination of enzymes wherein the combination comprises
the enzyme of the present invention and another enzyme, which may
be another enzyme according to the present invention.
[0220] Preferably the amino acid sequence when relating to and when
encompassed by the per se scope of the present invention is not a
native enzyme. In this regard, the term "native enzyme" means an
entire enzyme that is in its native environment and when it has
been expressed by its native nucleotide sequence.
Identity/Homology
[0221] The present invention also encompasses the use of homologues
of any amino acid sequence of an enzyme or of any nucleotide
sequence encoding such an enzyme.
[0222] Here, the term "homologue" means an entity having a certain
homology with the amino acid sequences and the nucleotide
sequences. Here, the term "homology" can be equated with
"identity". These terms will be used interchangeably herein.
[0223] In the present context, a homologous amino acid sequence is
taken to include an amino acid sequence which may be at least 92%
identical, preferably at least 95, 96, 97, 98 or 99% identical to
the sequence. Typically, the homologues will comprise the same
active sites etc.--e.g. as the subject amino acid sequence.
Although homology can also be considered in terms of similarity
(i.e. amino acid residues having similar chemical
properties/functions), in the context of the present invention it
is preferred to express homology in terms of sequence identity.
[0224] Preferably, an homologous amino acid sequence according to
the present invention is one which has at least 90% identity, more
preferably at least 95, 96, 97, 98 or 99% identity, over a region
of at least 30, more preferably 40, contiguous amino acids.
[0225] In the present context, an homologous nucleotide sequence is
taken to include a nucleotide sequence which may be at least 92%
identical, preferably at least 95, 96, 97, 98 or 99% identical to a
nucleotide sequence encoding an enzyme of the present invention
(the subject sequence). Typically, the homologues will comprise the
same sequences that code for the active sites etc. as the subject
sequence. Although homology can also be considered in terms of
similarity (i.e. amino acid residues having similar chemical
properties/functions), in the context of the present invention it
is preferred to express homology in terms of sequence identity.
[0226] Preferably, an homologous nucleotide sequence according to
the present invention is one which has at least 90% identity, more
preferably at least 95, 96, 97, 98 or 99% identity, over a region
of at least 30, preferably 40, more preferably 60 contiguous
nucleotides.
[0227] For the amino acid sequences and the nucleotide sequences,
homology comparisons can be conducted by eye, or more usually, with
the aid of readily available sequence comparison programs. These
commercially available computer programs can calculate % homology
between two or more sequences.
[0228] % homology may be calculated over contiguous sequences, i.e.
one sequence is aligned with the other sequence and each amino acid
in one sequence is directly compared with the corresponding amino
acid in the other sequence, one residue at a time. This is called
an "ungapped" alignment. Typically, such ungapped alignments are
performed only over a relatively short number of residues.
[0229] Although this is a very simple and consistent method, it
fails to take into consideration that, for example, in an otherwise
identical pair of sequences, one insertion or deletion will cause
the following amino acid residues to be put out of alignment, thus
potentially resulting in a large reduction in % homology when a
global alignment is performed. Consequently, most sequence
comparison methods are designed to produce optimal alignments that
take into consideration possible insertions and deletions without
penalising unduly the overall homology score. This is achieved by
inserting "gaps" in the sequence alignment to try to maximise local
homology.
[0230] However, these more complex methods assign "gap penalties"
to each gap that occurs in the alignment so that, for the same
number of identical amino acids, a sequence alignment with as few
gaps as possible--reflecting higher relatedness between the two
compared sequences--will achieve a higher score than one with many
gaps. "Affine gap costs" are typically used that charge a
relatively high cost for the existence of a gap and a smaller
penalty for each subsequent residue in the gap. This is the most
commonly used gap scoring system. High gap penalties will of course
produce optimised alignments with fewer gaps. Most alignment
programs allow the gap penalties to be modified. However, it is
preferred to use the default values when using such software for
sequence comparisons. For example when using the GCG Wisconsin
Bestfit package the default gap penalty for amino acid sequences is
-12 for a gap and -4 for each extension.
[0231] Calculation of maximum % homology therefore firstly requires
the production of an optimal alignment, taking into consideration
gap penalties. A suitable computer program for carrying out such an
alignment is the GCG Wisconsin Bestfit package (Devereux et al 1984
Nuc. Acids Research 12 p 387). Examples of other software than can
perform sequence comparisons include, but are not limited to, the
BLAST package (see Ausubel et al., 1999 Short Protocols in
Molecular Biology, 4.sup.th Ed--Chapter 18), FASTA (Altschul et
al., 1990 J. Mol. Biol. 403-410) and the GENEWORKS suite of
comparison tools. Both BLAST and FASTA are available for offline
and online searching (see Ausubel et al., 1999, Short Protocols in
Molecular Biology, pages 7-58 to 7-60).
[0232] However, for some applications, it is preferred to use the
GCG Bestfit program. A new tool, called BLAST 2 Sequences is also
available for comparing protein and nucleotide sequence (see FEMS
Microbiol Lett 1999 174(2): 247-50; FEMS Microbiol Lett 1999
177(1): 187-8 and tatiana@ncbi.nlm.nih.gov).
[0233] Although the final % homology can be measured in terms of
identity, the alignment process itself is typically not based on an
all-or-nothing pair comparison. Instead, a scaled similarity score
matrix is generally used that assigns scores to each pairwise
comparison based on chemical similarity or evolutionary distance.
An example of such a matrix commonly used is the BLOSUM62
matrix--the default matrix for the BLAST suite of programs. GCG
Wisconsin programs generally use either the public default values
or a custom symbol comparison table if supplied (see user manual
for further details). For some applications, it is preferred to use
the public default values for the GCG package, or in the case of
other software, the default matrix, such as BLOSUM62.
[0234] Alternatively, percentage homologies may be calculated using
the multiple alignment feature in DNASIS.TM. (Hitachi Software),
based on an algorithm, analogous to CLUSTAL (Higgins D G &
Sharp P M (1988), Gene 73(1), 237-244).
[0235] Once the software has produced an optimal alignment, it is
possible to calculate % homology, preferably % sequence identity.
The software typically does this as part of the sequence comparison
and generates a numerical result.
[0236] The sequences may also have deletions, insertions or
substitutions of amino acid residues which produce a silent change
and result in a functionally equivalent substance. Deliberate amino
acid substitutions may be made on the basis of similarity in amino
acid properties (such as polarity, charge, solubility,
hydrophobicity, hydrophilicity, and/or the amphipathic nature of
the residues) and it is therefore useful to group amino acids
together in functional groups. Amino acids can be grouped together
based on the properties of their side chain alone. However it is
more useful to include mutation data as well. The sets of amino
acids thus derived are likely to be conserved for structural
reasons. These sets can be described in the form of a Venn diagram
(Livingstone C. D. and Barton G. J. (1993) "Protein sequence
alignments: a strategy for the hierarchical analysis of residue
conservation" Comput. Appl Biosci. 9: 745-756) (Taylor W.R. (1986)
"The classification of amino acid conservation" J. Theor. Biol.
119; 205-218). Conservative substitutions may be made, for example
according to the table below which describes a generally accepted
Venn diagram grouping of amino acids. TABLE-US-00003 SET SUB-SET
Hydrophobic F W Y H K M I L V A G C Aromatic F W Y H Aliphatic I L
V Polar W Y H K R E D C S T N Q Charged H K R E D Positively H K R
charged Negatively E D charged Small V C A G S P T N D Tiny A G
S
[0237] The present invention also encompasses homologous
substitution (substitution and replacement are both used herein to
mean the interchange of an existing amino acid residue, with an
alternative residue) that may occur i.e. like-for-like substitution
such as basic for basic, acidic for acidic, polar for polar etc.
Non-homologous substitution may also occur i.e. from one class of
residue to another or alternatively involving the inclusion of
unnatural amino acids such as ornithine (hereinafter referred to as
Z), diaminobutyric acid ornithine (hereinafter referred to as B),
norleucine ornithine (hereinafter referred to as O), pyriylalanine,
thienylalanine, naphthylalanine and phenylglycine.
[0238] Replacements may also be made by unnatural amino acids.
[0239] Variant amino acid sequences may include suitable spacer
groups that may be inserted between any two amino acid residues of
the sequence including alkyl groups such as methyl, ethyl or propyl
groups in addition to amino acid spacers such as glycine or
.beta.-alanine residues. A further form of variation, involves the
presence of one or more amino acid residues in peptoid form, will
be well understood by those skilled in the art. For the avoidance
of doubt, "the peptoid form" is used to refer to variant amino acid
residues wherein the .alpha.-carbon substituent group is on the
residue's nitrogen atom rather than the .alpha.-carbon. Processes
for preparing peptides in the peptoid form are known in the art,
for example Simon R J et al., PNAS (1992) 89(20), 9367-9371 and
Horwell D C, Trends Biotechnol. (1995) 13(4), 132-134.
[0240] The nucleotide sequences for use in the present invention
may include within them synthetic or modified nucleotides. A number
of different types of modification to oligonucleotides are known in
the art. These include methylphosphonate and phosphorothioate
backbones and/or the addition of acridine or polylysine chains at
the 3' and/or 5' ends of the molecule. For the purposes of the
present invention, it is to be understood that the nucleotide
sequences described herein may be modified by any method available
in the art. Such modifications may be carried out in order to
enhance the in vivo activity or life span of nucleotide sequences
of the present invention.
[0241] The present invention also encompasses the use of nucleotide
sequences that are complementary to the sequences presented herein,
or any derivative, fragment or derivative thereof. If the sequence
is complementary to a fragment thereof then that sequence can be
used as a probe to identify similar coding sequences in other
organisms etc.
[0242] Polynucleotides which are not 100% homologous to the
sequences of the present invention but fall within the scope of the
invention can be obtained in a number of ways. Other variants of
the sequences described herein may be obtained for example by
probing DNA libraries made from a range of individuals, for example
individuals from different populations. In addition, other
homologues may be obtained and such homologues and fragments
thereof in general will be capable of selectively hybridising to
the sequences shown in the sequence listing herein. Such sequences
may be obtained by probing cDNA libraries made from or genomic DNA
libraries from other species, and probing such libraries with
probes comprising all or part of any one of the sequences in the
attached sequence listings under conditions of medium to high
stringency. Similar considerations apply to obtaining species
homologues and allelic variants of the polypeptide or nucleotide
sequences of the invention.
[0243] Variants and strain/species homologues may also be obtained
using degenerate PCR which will use primers designed to target
sequences within the variants and homologues encoding conserved
amino acid sequences within the sequences of the present invention.
Conserved sequences can be predicted, for example, by aligning the
amino acid sequences from several variants/homologues. Sequence
alignments can be performed using computer software known in the
art. For example the GCG Wisconsin PileUp program is widely
used.
[0244] The primers used in degenerate PCR will contain one or more
degenerate positions and will be used at stringency conditions
lower than those used for cloning sequences with single sequence
primers against known sequences.
[0245] Alternatively, such polynucleotides may be obtained by site
directed mutagenesis of characterised sequences. This may be useful
where for example silent codon sequence changes are required to
optimise codon preferences for a particular host cell in which the
polynucleotide sequences are being expressed. Other sequence
changes may be desired in order to introduce restriction enzyme
recognition sites, or to alter the property or function of the
polypeptides encoded by the polynucleotides.
[0246] Polynucleotides (nucleotide sequences) of the invention may
be used to produce a primer, e.g. a PCR primer, a primer for an
alternative amplification reaction, a probe e.g. labelled with a
revealing label by conventional means using radioactive or
non-radioactive labels, or the polynucleotides may be cloned into
vectors. Such primers, probes and other fragments will be at least
15, preferably at least 20, for example at least 25, 30 or 40
nucleotides in length, and are also encompassed by the term
polynucleotides of the invention as used herein.
[0247] Polynucleotides such as DNA polynucleotides and probes
according to the invention may be produced recombinantly,
synthetically, or by any means available to those of skill in the
art. They may also be cloned by standard techniques.
[0248] In general, primers will be produced by synthetic means,
involving a stepwise manufacture of the desired nucleic acid
sequence one nucleotide at a time. Techniques for accomplishing
this using automated techniques are readily available in the
art.
[0249] Longer polynucleotides will generally be produced using
recombinant means, for example using a PCR (polymerase chain
reaction) cloning techniques. The primers may be designed to
contain suitable restriction enzyme recognition sites so that the
amplified DNA can be cloned into a suitable cloning vector.
Biologically Active
[0250] Preferably, the variant sequences etc. are at least as
biologically active as the sequences presented herein.
[0251] As used herein "biologically active" refers to a sequence
having a similar structural function (but not necessarily to the
same degree), and/or similar regulatory function (but not
necessarily to the same degree), and/or similar biochemical
function (but not necessarily to the same degree) of the naturally
occurring sequence.
Hybridisation
[0252] The present invention also encompasses sequences that are
complementary to the nucleic acid sequences of the present
invention or sequences that are capable of hybridising either to
the sequences of the present invention or to sequences that are
complementary thereto.
[0253] The term "hybridisation" as used herein shall include "the
process by which a strand of nucleic acid joins with a
complementary strand through base pairing" as well as the process
of amplification as carried out in polymerase chain reaction (PCR)
technologies.
[0254] The present invention also encompasses the use of nucleotide
sequences that are capable of hybridising to the sequences that are
complementary to the sequences presented herein, or any derivative,
fragment or derivative thereof.
[0255] The term "variant" also encompasses sequences that are
complementary to sequences that are capable of hybridising to the
nucleotide sequences presented herein.
[0256] Preferably, the term "variant" encompasses sequences that
are complementary to sequences that are capable of hybridising
under stringent conditions (e.g. 50.degree. C. and 0.2.times.SSC
{1.times.SSC=0.15 M NaCl, 0.015 M Na.sub.3citrate pH 7.0}) to the
nucleotide sequences presented herein.
[0257] More preferably, the term "variant" encompasses sequences
that are complementary to sequences that are capable of hybridising
under high stringent conditions (e.g. 65.degree. C. and
0.1.times.SSC {1.times.SSC=0.15 M NaCl, 0.015 M Na.sub.3citrate pH
7.0}) to the nucleotide sequences presented herein.
[0258] The present invention also relates to nucleotide sequences
that can hybridise to the nucleotide sequences of the present
invention (including complementary sequences of those presented
herein).
[0259] The present invention also relates to nucleotide sequences
that are complementary to sequences that can hybridise to the
nucleotide sequences of the present invention (including
complementary sequences of those presented herein).
[0260] Also included within the scope of the present invention are
polynucleotide sequences that are capable of hybridising to the
nucleotide sequences presented herein under conditions of
intermediate to maximal stringency.
[0261] In a preferred aspect, the present invention covers
nucleotide sequences that can hybridise to the nucleotide sequence
of the present invention, or the complement thereof, under
stringent conditions (e.g. 50.degree. C. and 0.2.times.SSC).
[0262] In a more preferred aspect, the present invention covers
nucleotide sequences that can hybridise to the nucleotide sequence
of the present invention, or the complement thereof, under high
stringent conditions (e.g. 65.degree. C. and 0.1.times.SSC).
Recombinant
[0263] In one aspect the sequence for use in the present invention
is a recombinant sequence--i.e. a sequence that has been prepared
using recombinant DNA techniques.
[0264] These recombinant DNA techniques are within the capabilities
of a person of ordinary skill in the art. Such techniques are
explained in the literature, for example, J. Sambrook, E. F.
Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory
Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory
Press.
Synthetic
[0265] In one aspect the sequence for use in the present invention
is a synthetic sequence--i.e. a sequence that has been prepared by
in vitro chemical or enzymatic synthesis. It includes, but is not
limited to, sequences made with optimal codon usage for host
organisms--such as the methylotrophic yeasts Pichia and
Hansenula.
Expression of Enzymes
[0266] The nucleotide sequence for use in the present invention may
be incorporated into a recombinant replicable vector. The vector
may be used to replicate and express the nucleotide sequence, in
enzyme form, in and/or from a compatible host cell.
[0267] Expression may be controlled using control sequences e.g.
regulatory sequences.
[0268] The enzyme produced by a host recombinant cell by expression
of the nucleotide sequence may be secreted or may be contained
intracellularly depending on the sequence and/or the vector used.
The coding sequences may be designed with signal sequences which
direct secretion of the substance coding sequences through a
particular prokaryotic or eukaryotic cell membrane.
Expression Vector
[0269] The term "expression vector" means a construct capable of in
vivo or in vitro expression.
[0270] Preferably, the expression vector is incorporated into the
genome of a suitable host organism. The term "incorporated"
preferably covers stable incorporation into the genome.
[0271] The nucleotide sequence of the present invention may be
present in a vector in which the nucleotide sequence is operably
linked to regulatory sequences capable of providing for the
expression of the nucleotide sequence by a suitable host
organism.
[0272] The vectors for use in the present invention may be
transformed into a suitable host cell as described below to provide
for expression of a polypeptide of the present invention.
[0273] The choice of vector e.g. a plasmid, cosmid, or phage vector
will often depend on the host cell into which it is to be
introduced.
[0274] The vectors for use in the present invention may contain one
or more selectable marker genes such as a gene which confers
antibiotic resistance e.g. ampicillin, kanamycin, chloramphenicol
or tetracyclin resistance. Alternatively, the selection may be
accomplished by co-transformation (as described in WO91/17243).
[0275] Vectors may be used in vitro, for example for the production
of RNA or used to transfect, transform, transduce or infect a host
cell.
[0276] Thus, in a further embodiment, the invention provides a
method of making nucleotide sequences of the present invention by
introducing a nucleotide sequence of the present invention into a
replicable vector, introducing the vector into a compatible host
cell, and growing the host cell under conditions which bring about
replication of the vector.
[0277] The vector may further comprise a nucleotide sequence
enabling the vector to replicate in the host cell in question.
Examples of such sequences are the origins of replication of
plasmids pUC19, pACYC177, pUB110, pE194, pAMB1 and pIJ702.
Regulatory Sequences
[0278] In some applications, the nucleotide sequence for use in the
present invention is operably linked to a regulatory sequence which
is capable of providing for the expression of the nucleotide
sequence, such as by the chosen host cell. By way of example, the
present invention covers a vector comprising the nucleotide
sequence of the present invention operably linked to such a
regulatory sequence, i.e. the vector is an expression vector.
[0279] The term "operably linked" refers to a juxtaposition wherein
the components described are in a relationship permitting them to
function in their intended manner. A regulatory sequence "operably
linked" to a coding sequence is ligated in such a way that
expression of the coding sequence is achieved under condition
compatible with the control sequences.
[0280] The term "regulatory sequences" includes promoters and
enhancers and other expression regulation signals.
[0281] The term "promoter" is used in the normal sense of the art,
e.g. an RNA polymerase binding site.
[0282] Enhanced expression of the nucleotide sequence encoding the
enzyme of the present invention may also be achieved by the
selection of heterologous regulatory regions, e.g. promoter,
secretion leader and terminator regions.
[0283] Preferably, the nucleotide sequence according to the present
invention is operably linked to at least a promoter.
[0284] Examples of suitable promoters for directing the
transcription of the nucleotide sequence in a bacterial, fungal or
yeast host are well known in the art.
Constructs
[0285] The term "construct"--which is synonymous with terms such as
"conjugate", "cassette" and "hybrid"--includes a nucleotide
sequence for use according to the present invention directly or
indirectly attached to a promoter.
[0286] An example of an indirect attachment is the provision of a
suitable spacer group such as an intron sequence, such as the
Sh1-intron or the ADH intron, intermediate the promoter and the
nucleotide sequence of the present invention. The same is true for
the term "fused" in relation to the present invention which
includes direct or indirect attachment. In some cases, the terms do
not cover the natural combination of the nucleotide sequence coding
for the protein ordinarily associated with the wild type gene
promoter and when they are both in their natural environment.
[0287] The construct may even contain or express a marker, which
allows for the selection of the genetic construct.
[0288] For some applications, preferably the construct of the
present invention comprises at least the nucleotide sequence of the
present invention operably linked to a promoter.
Host Cells
[0289] The term "host cell"--in relation to the present invention
includes any cell that comprises either the nucleotide sequence or
an expression vector as described above and which is used in the
recombinant production of an enzyme having the specific properties
as defined herein.
[0290] Thus, a further embodiment of the present invention provides
host cells transformed or transfected with a nucleotide sequence
that expresses the enzyme of the present invention. The cells will
be chosen to be compatible with the said vector and may for example
be prokaryotic (for example bacterial), fungal, yeast or plant
cells. Preferably, the host cells are not human cells.
[0291] Examples of suitable bacterial host organisms are gram
positive or gram negative bacterial species.
[0292] Depending on the nature of the nucleotide sequence encoding
the enzyme of the present invention, and/or the desirability for
further processing of the expressed protein, eukaryotic hosts such
as yeasts or other fungi may be preferred. In general, yeast cells
are preferred over fungal cells because they are easier to
manipulate. However, some proteins are either poorly secreted from
the yeast cell, or in some cases are not processed properly (e.g.
hyperglycosylation in yeast). In these instances, a different
fungal host organism should be selected.
[0293] The use of suitable host cells--such as yeast, fungal and
plant host cells--may provide for post-translational modifications
(e.g. myristoylation, glycosylation, truncation, lapidation and
tyrosine, serine or threonine phosphorylation) as may be needed to
confer optimal biological activity on recombinant expression
products of the present invention.
[0294] The host cell may be a protease deficient or protease minus
strain.
[0295] The genotype of the host cell may be modified to improve
expression.
[0296] Examples of host cell modifications include protease
deficiency, supplementation of rare tRNA's, and modification of the
reductive potential in the cytoplasm to enhance disulphide bond
formation.
[0297] For example, the host cell E. coli may overexpress rare
tRNA's to improve expression of heterologous proteins as
exemplified/described in Kane (Curr Opin Biotechnol (1995), 6,
494-500 "Effects of rare codon clusters on high-level expression of
heterologous proteins in E. coli"). The host cell may be deficient
in a number of reducing enzymes thus favouring formation of stable
disulphide bonds as exemplified/described in Bessette (Proc Natl
Acad Sci USA (1999), 96, 13703-13708 "Efficient folding of proteins
with multiple disulphide bonds in the Escherichia coli
cytoplasm").
Organism
[0298] The term "organism" in relation to the present invention
includes any organism that could comprise the nucleotide sequence
coding for the enzyme according to the present invention and/or
products obtained therefrom, and/or wherein a promoter can allow
expression of the nucleotide sequence according to the present
invention when present in the organism.
[0299] Suitable organisms may include a prokaryote, fungus, yeast
or a plant.
[0300] The term "transgenic organism" in relation to the present
invention includes any organism that comprises the nucleotide
sequence coding for the enzyme according to the present invention
and/or the products obtained therefrom, and/or wherein a promoter
can allow expression of the nucleotide sequence according to the
present invention within the organism. Preferably the nucleotide
sequence is incorporated in the genome of the organism.
[0301] The term "transgenic organism" does not cover native
nucleotide coding sequences in their natural environment when they
are under the control of their native promoter which is also in its
natural environment.
[0302] Therefore, the transgenic organism of the present invention
includes an organism comprising any one of, or combinations of, the
nucleotide sequence coding for the enzyme according to the present
invention, constructs according to the present invention, vectors
according to the present invention, plasmids according to the
present invention, cells according to the present invention,
tissues according to the present invention, or the products
thereof.
[0303] For example the transgenic organism may also comprise the
nucleotide sequence coding for the enzyme of the present invention
under the control of a heterologous promoter.
Transformation of Host Cells/Organism
[0304] As indicated earlier, the host organism can be a prokaryotic
or a eukaryotic organism. Examples of suitable prokaryotic hosts
include E. coli and Bacillus subtilis.
[0305] Teachings on the transformation of prokaryotic hosts is well
documented in the art, for example see Sambrook et al (Molecular
Cloning: A Laboratory Manual, 2nd edition, 1989, Cold Spring Harbor
Laboratory Press). If a prokaryotic host is used then the
nucleotide sequence may need to be suitably modified before
transformation--such as by removal of introns.
[0306] Filamentous fungi cells may be transformed using various
methods known in the art--such as a process involving protoplast
formation and transformation of the protoplasts followed by
regeneration of the cell wall in a manner known. The use of
Aspergillus as a host microorganism is described in EP 0 238
023.
[0307] Another host organism can be a plant. A review of the
general techniques used for transforming plants may be found in
articles by Potrykus (Annu Rev Plant Physiol Plant Mol Biol [1991]
42:205-225) and Christou (Agro-Food-Industry Hi-Tech March/April
1994 17-27). Further teachings on plant transformation may be found
in EP-A-0449375.
[0308] General teachings on the transformation of fungi, yeasts and
plants are presented in following sections.
Transformed Fungus
[0309] A host organism may be a fungus--such as a filamentous
fungus. Examples of suitable such hosts include any member
belonging to the genera Thermomyces, Acremonium, Aspergillus,
Penicillium, Mucor, Neurospora, Trichoderma and the like.
[0310] Teachings on transforming filamentous fungi are reviewed in
U.S. Pat. No. 5,741,665 which states that standard techniques for
transformation of filamentous fungi and culturing the fungi are
well known in the art. An extensive review of techniques as applied
to N. crassa is found, for example in Davis and de Serres, Methods
Enzymol (1971) 17A: 79-143.
[0311] Further teachings on transforming filamentous fungi are
reviewed in U.S. Pat. No. 5,674,707.
[0312] In one aspect, the host organism can be of the genus
Aspergillus, such as Aspergillus niger.
[0313] A transgenic Aspergillus according to the present invention
can also be prepared by following, for example, the teachings of
Turner G. 1994 (Vectors for genetic manipulation. In: Martinelli S.
D., Kinghorn J. R. (Editors) Aspergillus: 50 years on. Progress in
industrial microbiology vol 29. Elsevier Amsterdam 1994. pp.
641-666).
[0314] Gene expression in filamentous fungi has been reviewed in
Punt et al. (2002) Trends Biotechnol 2002 May; 20(5):200-6, Archer
& Peberdy Crit Rev Biotechnol (1997) 17(4):273-306.
Transformed Yeast
[0315] In another embodiment, the transgenic organism can be a
yeast.
[0316] A review of the principles of heterologous gene expression
in yeast are provided in, for example, Methods Mol Biol (1995),
49:341-54, and Curr Opin Biotechnol (1997) October; 8(5):554-60
[0317] In this regard, yeast--such as the species Saccharomyces
cerevisiae or Pichia pastoris (see FEMS Microbiol Rev (2000
24(1):45-66), may be used as a vehicle for heterologous gene
expression.
[0318] A review of the principles of heterologous gene expression
in Saccharomyces cerevisiae and secretion of gene products is given
by E Hinchcliffe E Kenny (1993, "Yeast as a vehicle for the
expression of heterologous genes", Yeasts, Vol 5, Anthony H Rose
and J Stuart Harrison, Eds., 2nd edition, Academic Press Ltd.).
[0319] For the transformation of yeast, several transformation
protocols have been developed. For example, a transgenic
Saccharomyces according to the present invention can be prepared by
following the teachings of Hinnen et al., (1978, Proceedings of the
National Academy of Sciences of the USA 75, 1929); Beggs, J D
(1978, Nature, London, 275, 104); and Ito, H et al (1983, J
Bacteriology 153, 163-168).
[0320] The transformed yeast cells may be selected using various
selective markers--such as auxotrophic markers dominant antibiotic
resistance markers.
Transformed Plants/Plant Cells
[0321] A host organism suitable for the present invention may be a
plant. A review of the general techniques may be found in articles
by Potrykus (Annu Rev Plant Physiol Plant Mol Biol [1991]
42:205-225) and Christou (Agro-Food-Industry Hi-Tech March/April
1994 17-27).
Culturing and Production
[0322] Host cells transformed with the nucleotide sequence of the
present invention may be cultured under conditions conducive to the
production of the encoded enzyme and which facilitate recovery of
the enzyme from the cells and/or culture medium.
[0323] The medium used to cultivate the cells may be any
conventional medium suitable for growing the host cell in questions
and obtaining expression of the enzyme.
[0324] The protein produced by a recombinant cell may be displayed
on the surface of the cell.
[0325] The enzyme may be secreted from the host cells and may
conveniently be recovered from the culture medium using well-known
procedures.
Secretion
[0326] Often, it is desirable for the enzyme to be secreted from
the expression host into the culture medium from where the enzyme
may be more easily recovered. According to the present invention,
the secretion leader sequence may be selected on the basis of the
desired expression host. Hybrid signal sequences may also be used
with the context of the present invention.
[0327] Typical examples of heterologous secretion leader sequences
are those originating from the fungal amyloglucosidase (AG) gene
(glaA--both 18 and 24 amino acid versions e.g. from Aspergillus),
the a-factor gene (yeasts e.g. Saccharomyces, Kluyveromyces and
Hansenula) or the .alpha.-amylase gene (Bacillus).
[0328] By way of example, the secretion of heterologous proteins in
E. coli is reviewed in Methods Enzymol (1990) 182:132-43.
Detection
[0329] A variety of protocols for detecting and measuring the
expression of the amino acid sequence are known in the art.
Examples include enzyme-linked immunosorbent assay (ELISA),
radioimmunoassay (RIA) and fluorescent activated cell sorting
(FACS).
[0330] A wide variety of labels and conjugation techniques are
known by those skilled in the art and can be used in various
nucleic and amino acid assays.
[0331] A number of companies such as Pharmacia Biotech (Piscataway,
N.J.), Promega (Madison, Wis.), and US Biochemical Corp (Cleveland,
Ohio) supply commercial kits and protocols for these
procedures.
[0332] Suitable reporter molecules or labels include those
radionuclides, enzymes, fluorescent, chemiluminescent, or
chromogenic agents as well as substrates, cofactors, inhibitors,
magnetic particles and the like. Patents teaching the use of such
labels include U.S. Pat. No. 3,817,837; U.S. Pat. No. 3,850,752;
U.S. Pat. No. 3,939,350; U.S. Pat. No. 3,996,345; U.S. Pat. No.
4,277,437; U.S. Pat. No. 4,275,149 and U.S. Pat. No. 4,366,241.
[0333] Also, recombinant immunoglobulins may be produced as shown
in U.S. Pat. No. 4,816,567.
Fusion Proteins
[0334] The amino acid sequence for use according to the present
invention may be produced as a fusion protein, for example to aid
in extraction and purification. Examples of fusion protein partners
include glutathione-S-transferase (GST), 6.times.His, GAL4 (DNA
binding and/or transcriptional activation domains) and
(.beta.-galactosidase). It may also be convenient to include a
proteolytic cleavage site between the fusion protein partner and
the protein sequence of interest to allow removal of fusion protein
sequences.
[0335] Preferably, the fusion protein will not hinder the activity
of the protein sequence.
[0336] Gene fusion expression systems in E. coli have been reviewed
in Curr Opin Biotechnol (1995) 6(5):501-6.
[0337] In another embodiment of the invention, the amino acid
sequence may be ligated to a heterologous sequence to encode a
fusion protein. For example, for screening of peptide libraries for
agents capable of affecting the substance activity, it may be
useful to encode a chimeric substance expressing a heterologous
epitope that is recognised by a commercially available
antibody.
Large Scale Application
[0338] In one preferred embodiment of the present invention, the
amino acid sequence is used for large scale applications.
[0339] Preferably the amino acid sequence is produced in a quantity
of from 1 g per litre to about 2 g per litre of the total cell
culture volume after cultivation of the host organism.
[0340] Preferably the amino acid sequence is produced in a quantity
of from 100 mg per litre to about 900 mg per litre of the total
cell culture volume after cultivation of the host organism.
[0341] Preferably the amino acid sequence is produced in a quantity
of from 250 mg per litre to about 500 mg per litre of the total
cell culture volume after cultivation of the host organism.
Food
[0342] The composition of the present invention may be used as--or
in the preparation of--a food. Here, the term "food" is used in a
broad sense--and covers food for humans as well as food for animals
(i.e. a feed). In a preferred aspect, the food is for human
consumption.
[0343] The food may be in the form of a solution or as a
solid--depending on the use and/or the mode of application and/or
the mode of administration.
Food Ingredient
[0344] The composition of the present invention may be used as a
food ingredient.
[0345] As used herein the term "food ingredient" includes a
formulation, which is or can be added to functional foods or
foodstuffs and includes formulations which can be used at low
levels in a wide variety of products that require, for example,
acidifying or emulsifying.
[0346] The food ingredient may be in the form of a solution or as a
solid--depending on the use and/or the mode of application and/or
the mode of administration.
Food Products
[0347] The composition of the present invention can be used in the
preparation of food products such as one or more of: confectionery
products, dairy products, poultry products, fish products and
bakery products.
[0348] The present invention also provides a method of preparing a
food or a food ingredient, the method comprising admixing a
lipolytic enzyme according to the present invention with another
food ingredient.
EXAMPLES
[0349] The present invention will now be described, by way of
example only, in which reference may be made to the following
figures:
[0350] FIG. 1 shows profiles of lipase activity (indicated by
hatched areas, marked as pool B) and protein (broken line) obtained
after IEC chromatography.
[0351] FIG. 2 shows purified fungal lipolytic enzyme (lane 3-5)
applied to a gel (NU-PAGE, 4-12%, Mes-buffer, prepared as described
by the manufacturer, Novex, USA), which was then commassie
stained.
[0352] FIG. 3 shows chromatogram #61.
[0353] FIG. 4 shows SDS-PAGE of fractions from the Butyl Sepharose
column (P: Pool #172-174 100 U/mL diluted 1:10; Std=standard
protein series).
[0354] FIG. 5 shows mini baking experiments with 1) Chr #61 frac.
9. 2) Pool #172-#174. 3) Chr. #61 frac. 14. 4) Control. 5) Lipase
#3044.
[0355] FIG. 6 shows GLC analysis of dough lipids
digalactosyldiglyceride (DGDG) and digalactosylmonoglyceride (DGMG)
from BS8948-2
[0356] FIG. 7 shows alignment of amino acid sequences of all CBS
peptides to the lipase of the Japanese strain of F. heterosporum
(Nagao et al. 1994). Identical and similar (well-conserved) amino
acids are marked below the alignment with * and .cndot.,
respectively.
[0357] FIG. 8 shows a nucleotide sequence and translated amino acid
sequence of the synthetic F. heterosporum (CBS 782.83) lipolytic
enzyme gene fused to the synthetic alpha-signal sequence. The amino
acid sequence is presented above the nucleotide sequence. The
nucleotides containing the restriction enzyme sites Eco RI and Bam
HI are underlined and the translational start and stop codons are
double underlined. An arrowhead marks the position of the fusion
between the alpha-signal sequence and the lipolytic enzyme gene.
Arrows indicate the primers used for the assembly of the gene.
[0358] FIG. 9 shows a schematic representation of the Hansenula
expression vector pB14 containing the synthetic F. heterosporum
(CBS 782.83) lipolytic enzyme gene (LIPASE) fused to a synthetic
alpha-signal sequence (alpha ss). URA3,
orotidine-5'-phosphate-decarboxylase gene for uracil
complementation for selection in Hansenula. HARS, Autonomously
replicating sequence for replication in Hansenula. FMD-P, FMD
promoter for expression in Hansenula.
[0359] FIG. 10 shows phospholipase activity of selected Hansenula
polymorpha clones containing the synthetic F. heterosporum
lipolytic enzyme gene. Lecithin was used as substrate and the free
fatty acid was determined using the NEFA kit (Roche).
[0360] FIG. 11 shows a minibread baked with increased dosage (PLU)
of phospholipase sample 205 and Lipopan F.TM..
[0361] FIG. 12 shows GLC analysis of dough lipids.
DGDG=digalactosyldiglyceride. DGMG digalactosylmonoglyceride.
Sum=DGDG+DGMG (Example 3).
[0362] FIG. 13 shows a HPTLC chromatogram of A) References: 1.
Fractionated flour lipid, 2. Hydrolyzed DGDG, 3. DGDG. B) Lipids
extracted from dough: 4. Control, 5. 2000 PLU-7/kg sample 205, and
6.40 ppm Lipopan F.TM..
[0363] FIG. 14 shows GLC analysis of isomer
digalactosyl-monoglyceride in dough treated with a lipolytic enzyme
derived from Fusarium heterosporum.
[0364] FIG. 15 shows activity of lipolytic enzyme derived from
Fusarium heterosporum determined by 10 minutes of enzymation on
lecithin substrate, pH 7.0, at various temperatures and subsequent
determination of free fatty acids by the NEFA C method.
[0365] FIG. 16 shows activity of lipolytic enzyme derived from
Fusarium heterosporum determined after 30 minutes of incubation in
50 mM phosphate buffer at 3 TIPU/ml and various temperatures (50 mM
phosphate buffer, pH 7.0) by 10 minutes of enzymation on lecithin
substrate (without CaCl.sub.2) at 37.degree. C. and pH 7.0 and
subsequent determination of free fatty acids by the NEFA C
method.
[0366] FIG. 17 shows activity of lipolytic enzyme derived from
Fusarium heterosporum determined after 10 minutes of enzymation on
lecithin substrate (without CaCl.sub.2) at 37.degree. C. and
various pH (50 mM phosphate buffer) and subsequent determination of
free fatty acids by the NEFA C method.
[0367] FIG. 18 shows activity of lipolytic enzyme derived from
Fusarium heterosporum determined after 30 minutes of incubation in
50 mM phosphate buffer at 3 TIPU/ml and various pH (50 mM phosphate
buffer) by 10 minutes of enzymation on lecithin substrate (without
CaCl.sub.2) at 37.degree. C. and pH 7.0 and subsequent
determination of free fatty acids by the NEFA C method.
[0368] FIGS. 19a and 19b show the determination of the molecular
weight, as determined by SDS-PAGE, of a lipolytic enzyme derived
from Fusarium heterosporum
[0369] FIG. 20 depicts the temperature optimum for a lipolytic
enzyme according to the present invention. The enzyme reaction was
carried out at various temperatures.
[0370] FIG. 21 depicts the amount of lecithin in enzyme-modified
egg yolk as a function of reaction time at A: 30.degree. C., B:
40.degree. C., and C: 50.degree. C. The amount of lecithin was
analysed by LC/MS-MS and is expressed as percentage of egg
yolk.
[0371] FIG. 22 depicts the amount of lyso-lecithin in
enzyme-modified egg yolk as a function or reaction time at A:
30.degree. C., B: 40.degree. C., and C: 50.degree. C. The amount of
lyso-lecithin was analysed by LC/MS-MS and is expressed as
percentage of egg yolk.
[0372] FIG. 23 depicts the amount of free fatty acid in enzyme
modified egg yolk as a function of reaction time at A: 30.degree.
C., B: 40.degree. C., and C: 50.degree. C. The amount of free fatty
acid was analysed by the NEFA C method and is expressed as
percentage of egg yolk.
[0373] FIG. 24 depicts the enzymatic conversion of egg yolk with a
lipolytic enzyme according to the present invention (Example 4).
The amounts of lyso-lecithin (A), free fatty acid (B), and lecithin
(C) as a function of reaction time. The error bars indicate the
standard deviation of the double determinations (n=2). The amount
of lecithin and lysolecithin were determined by LC/MS-MS and the
amount of free fatty acid was determined by the NEFA C method.
Results are expressed as percentage of egg yolk.
[0374] FIG. 25 depicts the enzymatic conversion of egg yolk with
Lecitase.RTM. Ultra phospholipase from Novozymes A/S (Example 4).
The amounts of lyso-lecithin (A), free fatty acid (B), and lecithin
(C) as a function of reaction time. The error bars indicate the
standard deviation of the double determinations (n=2). The amount
of lecithin and lysolecithin were determined by LC/MS-MS and the
amount of free fatty acid was determined by the NEFA C method.
Results are expressed as percentage of egg yolk.
[0375] FIG. 26 shows TLC analysis (the solvent was
chloroform:methanol:water (65:24:4)) of lipid extract from modified
egg yolk (Example 4). 1: PC and LPC standard. 2: Lipolytic enzyme
according to the present invention, 10.degree. C., 240 min. 3:
Lipolytic enzyme according to the present invention, 20.degree. C.,
240 min. 4: Lipolytic enzyme according to the present invention,
53.degree. C., 240 min. 5: Lipolytic enzyme according to the
present invention, 20.degree. C., 1440 min. 6: Lecitase.RTM. Ultra,
10.degree. C., 4 h. 7: Lecitase.RTM. Ultra, 20.degree. C., 240 min.
8: Lecitase.RTM. Ultra, 53.degree. C., 4 h. 9: Lecitase.RTM. Ultra,
20.degree. C., 1440 min. 10: Control sample. The compounds listed
to the left of the TLC plate are cholesterol (C), triacylglyceride
(TG), diacylglyceride (DG), free fatty acid (FFA),
monoacylglyceride (MG), phosphatidylethanolamine (PE),
phosphatidylcholine (PC), lyso-phosphatidylethanolamine (LPE), and
lyso-phosphatidylcholine (LPC).
[0376] FIG. 27 depicts the relation between change in lyso-lecithin
and free fatty acid content during enzymation of egg yolk with a
lipolytic enzyme according to the present invention and
Lecitase.RTM. Ultra phospholipases, respectively (Example 4). The
results are based on a molar weight of lyso-lecithin of 523 and a
molar weight of free fatty acids of 283. Free fatty acid was
determined by the NEFA C method. lysolecithin and lecithin was
determined by LC/MS-MS.
[0377] FIG. 28 shows HPTLC analysis (the solvent was
p-ether:MTBE:acetic acid (50:50:1)) of lipid extract from modified
egg yolk (Example 4). The compounds listed to the left of the TLC
plate are triacylglyceride (TG), free fatty acid (FFA), 1,3
diacylglyceride (1,3 DG), 1,2 diacylglyceride (1,2 DG),cholesterol
(C), monoacylglyceride (MG), phosphatidylethanolamine (PE),
phosphatidylcholine (PC), lyso-phosphatidylethanolamine (LPE), and
lyso-phosphatidylcholine (LPC).
[0378] FIG. 29 shows TLC analysis (solvent IV) of mayonnaise made
with enzyme-modified egg yolk from Sanofa A/S (Example 5).
[0379] FIG. 30 shows mayonnaise prepared from enzyme-modified egg
yolk from Sanofa A/S heat-treated in a microwave oven (Example 5).
Sample 1 was a control with water added instead of enzyme solution,
sample 2 contained 30 U/g lipolytic enzyme according to the present
invention, and sample 3 contained 30 U/g Lecitase.RTM. Ultra.
[0380] FIG. 31 shows the specific bread volume of hard crusty rolls
baked with different concentrations of a lipolytic enzyme according
to the present invention alone or in combination with Panodan.RTM.
M2020 DATEM emulsifier and tested against a combination of Lipopan
F.TM. and DATEM as well as pure Lipopan F.TM. or pure DATEM.
[0381] FIG. 32 shows the specific bread volume of hard crusty rolls
baked with different concentrations of a lipolytic enzyme according
to the present invention alone or in combination with Panodan.RTM.
A2020 DATEM or SSL P 55 emulsifier and tested against a combination
of Lipopan F.TM.M/SSL P 55 or Lipopan.TM./DATEM as well as pure
Lipopan F, pure DATEM and pure SSL P 55.
[0382] FIG. 33 shows nucleotide sequence (SEQ ID No. 5) and deduced
amino acid sequence (SEQ ID No.4) of the F. semitectum (IBT 9507)
lipase cDNA. The deduced amino acid sequence is presented above the
nucleotide sequence. Arrows indicate the primers used for the
amplification of the cDNA.
[0383] FIG. 34 shows a schematic representation of the Hansenula
expression vector pDB14-alp-sem containing the F. semitectum lipase
gene (Lipase) fused to the .alpha.-signal sequence (alpha ss.).
AP(R), URA3, orotidine-5' phosphate-decarboxylase gene for uracil
complementation for selection. HARS, Autonomously replicating
sequence for replication in Hansenula. FMD-P, FMD promoter for
expression in Hansenula.
[0384] FIG. 35 shows phospholipase activity of a lipolytic enzyme
from Fusarium semitectum IBT9507 as a function of temperature.
[0385] FIG. 36 shows phospholipase activity of a lipolytic enzyme
from Fusarium semitectum IBT9507 as a function of pH.
[0386] FIG. 37 shows an amino acid sequence (SEQ ID No. 1) of a
fungal lipolytic enzyme derived from Fusarium heterosporum.
[0387] FIG. 38 shows an amino acid sequence of a fungal lipolytic
enzyme derived from Fusarium heterosporum comprising an N terminal
signal sequence (underlined) (SEQ ID No. 2).
[0388] FIG. 39 shows a nucleotide sequence (SEQ ID No. 3) encoding
a fungal lipolytic enzyme derived from Fusarium heterosporum in
accordance with the present invention.
[0389] FIG. 40 shows an amino acid sequence (SEQ ID No. 4) of a
lipolytic enzyme derived from Fusarium semitectum.
[0390] FIG. 41 shows a nucleotide sequence (SEQ ID NO. 5) encoding
a lipolytic enzyme derived from Fusarium semitectum.
[0391] FIG. 42 shows an amino acid sequence (SEQ ID No.6) of a
lipolytic enzyme derived from Fusarium heterosporum (EAEA is a
pro-peptide originally from the .alpha.-factor signal
sequence).
[0392] FIG. 43 shows a nucleotide sequence (SEQ ID No.7) of a
lipolytic enzyme derived from Fusarium heterosporum which includes
a .alpha.-factor signal sequence.
Example 1
Expression, Purification, Sequencing and Baking Trials of a
Fusarium heterosporum Lipolytic Enzyme
Fermentation
[0393] Fusarium heterosporum CBS 782.83 strain was obtained from
Centraalbureau voor Schimmelcultures (the Netherlands).
TABLE-US-00004 Growth media Glucose-yeast extract agar Yeast
extract 4 g/L KH.sub.2PO.sub.4 1 g/L MgSO.sub.4, 7H.sub.2O 0.5 g/L
Glucose 15 g/L Agar 20 g/L
[0394] Glucose was added after autoclaving
[0395] 1.4 Pre-Fermentation Medium TABLE-US-00005 Soy flour 50 g/L
Glucose monohydrate 50 g/L KH.sub.2PO.sub.4 2 g/L Na.sub.2HPO.sub.4
3 g/L Soy oil 1 g/L
[0396] The medium was prepared in 500 mL shake flasks with baffles
and 100 mL was added pr shake flask. The soy oil was added to each
flask separately.
[0397] Glucose was added after autoclaving. TABLE-US-00006
Production medium Peptone 10 g/L Tween TM-80 12 g/L MgSO.sub.4,
7H.sub.2O 2 g/L CaCl.sub.2, 2H.sub.2O 0.1 g/L
[0398] The medium was prepared in 500 mL shake flasks with baffles
and 100 mL was added pr shake flask. The Tween TM-80 was added to
each flask separately.
[0399] pH was adjusted to 6.0 before autoclaving.
Culture Conditions
[0400] Fusarium heterosporum CBS 782.83 was inoculated on
glucose-yeast extract agar plates, which were incubated at
24.degree. C. until development of spores.
[0401] A shake flask containing pre-fermentation medium was
inoculated with 4 cm.sup.2 of agar plate containing a well
sporulating culture. The shake flask was incubated at 30.degree. C.
and 200 RPM. After three days of growth, 30 production medium shake
flasks were each inoculated with 5 mL fermentation broth from the
pre-fermentation shake flask. The production medium shake flasks
were incubated at 30.degree. C. and 200 RPM.
[0402] Ten production medium shake flasks were harvested after 2, 3
and 4 days of growth. The biomass was removed by centrifugation
followed by sterile filtration of the supernatant through 0.2 .mu.m
filters (VacuCap 90 Filter Unit w/0.2 .mu.m Supor Membrane) from
Gelman Laboratory. After filtration, the filtrate was frozen at
-80.degree. C. and stored until analysis.
Analytical Procedures
[0403] Phospholipase activity was determined according to the "PLU
assay" previously described herein.
Application
TLC Analysis
[0404] TLC-plate was activated in a heat cupboard (110.degree. C.)
for 1/2 h.
[0405] 100 mL running buffer was poured into a chromatography
chamber with lid. The walls of the chamber were covered with filter
paper (Whatman 2) in order to saturate the chamber with the solvent
vapor.
[0406] The TLC-plate was placed in a frame and the sample was
applied onto the TLC plate 2 cm from the bottom. The TLC plate was
then placed in the TLC chamber with the chosen running buffer. When
the running buffer reached 14 cm from the bottom of the plate, the
TLC plate was taken out and dried in fume board, and then placed in
the heat cupboard at 110.degree. C. for 10 minutes.
[0407] The TLC-plate was then immersed in the developing reagent,
and dried in the heat cupboard at 110.degree. C. for 15 minutes
Running-Buffer:
[0408] Nr. IV: Chloroform:Methanol:H.sub.2O (65:25:4)
[0409] Nr. I: P-ether:methyl-tert-butyl ether (MTBE):Acetic acid
(60:40:1)
Developing Buffer (Vanadate-Buffer):
[0410] 32 g Na.sub.2CO.sub.3 ad 300 mL H.sub.2O (1M)
[0411] 18.2 g vanadate pentoxide (V.sub.2O.sub.5) was added and
dissolved during gentle heating and baked in a "BACO-LINE" oven for
6 minutes.
[0412] The solution was cooled to ambient.
[0413] Carefully 460 mL 2.5 M H.sub.2SO.sub.4. (460 mL H.sub.2O+61
mL H.sub.2SO.sub.4) is added
[0414] Water was added to 1000 mL.
Gas Chromatography
[0415] Perkin Elmer 8420 Capillary Gas Chromatography equipped with
WCOT fused silica column 12.5 m.times.0.25 mm ID.times.0.1 .mu.m 5%
phenyl-methyl-silicone (CP Sil 8 CB from Crompack).
[0416] Carrier: Helium.
[0417] Injection: 1.5 .mu.L with split.
[0418] Detector: FID 385.degree. C. TABLE-US-00007 Oven program: 1
2 3 4 Oven temperature [.degree. C.] 80 200 240 360 Isothermal,
time [min] 2 0 0 10 Temperature rate [.degree. C./min] 20 10 12
[0419] Sample preparation: 50 mg wheat lipid was dissolved in 12 mL
heptane:pyridine 2:1 containing an internal standard heptadecane, 2
mg/mL. 500 .mu.L of the sample was transferred to a crimp vial. 100
.mu.L MSTFA (N-Methyl-N-trimethylsilyl-trifluoracetamid) was added
and the reaction incubated for 15 minutes at 90.degree. C.
[0420] Calculation: Response factors for mono-di-triglycerides,
free fatty acid and galactolipids were determined from reference
mixtures of these components. Based on these response factors the
lipids in the dough were calculated.
Mini Baking Test.
[0421] The following ingredients were added to a 50 g Brabrender
mixing bowl and kneaded for 5 minutes at 30.degree. C.: flour 50 g,
dry yeast 10 g, sugar 0.8 g, salt 0.8 g, 70 ppm ascorbic acid and
water (to a dough consistency of 400 Brabender units). Resting time
was 10 min. at 34.degree. C. The dough was scaled 15 g per dough.
Then molded on a special device where the dough was rolled between
a wooden plate and a Plexiglas frame. The doughs were proofed in
tins for 45 min. at 34.degree. C., and baked in a Voss household
oven for 8 min. 225.degree. C.
[0422] After baking the breads were cooled to ambient temperature
and after 20 min. The breads were scaled and the volume was
determined by rape-seed displacement method. The breads were also
cut and crumb and crust evaluated.
Pilot Baking Tests (Hard Crust Rolls)
[0423] Flour, Danish reform 1500 g, Compressed Yeast 90 g, sugar 24
g, salt 24 g, water 400 Brabender units+2% were kneaded in a Hobart
mixer with hook for 2 minutes at low speed and 9 minutes at high
speed. The dough temperature was 26.degree. C. The dough was scaled
1350 gram. The dough was rested for 10 minutes at 30.degree. C. and
molded on a Fortuna molder. The dough was then proved for 45
minutes at 34.degree. C. The dough was baked in a Bago-oven for 18
minutes at 220.degree. C. and steamed for 12 seconds
[0424] After cooling, the rolls were scaled and the volume of the
rolls was measured by the rape seed displacement method. Specific
Bread Volume Specific .times. .times. volume = Volume .times.
.times. of .times. .times. the .times. .times. bread , ml weight
.times. .times. of .times. .times. the .times. .times. bread , gram
##EQU2## Results and Discussion Fermentation
[0425] The fermentation samples were analyzed for phospholipase
activity, and the results are shown in Table 1. TABLE-US-00008
TABLE 1 Results of fermentation ID Organism Sample label PLU-7 172
Fusarium heterosporum CBS 782.83 .sup.aMedium D. 35 day 2 173
Fusarium heterosporum CBS 782.83 Medium D. day 3 33 174 Fusarium
heterosporum CBS 782.83 Medium D. day 4 26 .sup.aMedium D =
production medium
[0426] It was seen that the phospholipase activity was almost
identical at days 2, 3 and 4, and all samples were therefore pooled
and named JBS-2254-97-3.
Purification and Sequencing
Purification of Phospholipase from Crude Extract Using Anion
Exchange Chromatography:
[0427] The column (Q-Sepharose FF, 1.5.times.2.8 cm, 5 mL gel) was
prepared as described by the manufacturer (Amersham Bio.), and then
equilibrated in 20 mM tris/HCl buffer, 0.1 M NaCl, pH 7.5 (buffer
A). The sample (15 mL) was added 0.1 M NaCl and applied to the
column at a flow rate of 3.5 mL/min. The lipolytic enzyme was
eluted with a linear gradient of 0-0.6 M NaCl in buffer A (See FIG.
1). Fractions of 3.5 mL were collected during the entire run. 10
.mu.L of each fraction were subjected to spot plate assay. Lipase
activity was determined by tributyrin and lecithin spot plate assay
(10 .mu.L of each fraction were transferred to the hole and the
plate was incubated at 40.degree. C. Formation of haloes in the
agarose gels takes place as a function of time. A blank without
enzyme was also added to one of the holes for comparison). The
fractions containing lipolytic activity was then subjected to
SDS-PAGE (See FIG. 2) and N-terminal analyses.
Enzymatic Fingerprinting by MALDI-TOF and Amino Acid Sequencing
[0428] The protein was reduced with Dithiothreitol and the cysteine
residues were protected by carboxymethylation using iodoacetamide.
The protein was cleaved by trypsin and the fragmentation pattern of
the tryptic peptides were examined by MALDI-TOF analysis. The
peptides were separated by chromatography on a
C.sub.18-reverse-phase HPLC column, and the degree of purification
was monitored by MALDI-TOF analysis. The amino acid sequence was
determined by Edman degradation as previously described in details
in TR6452.
[0429] The entire amino acid sequence of Fusarium heterosporum
lipolytic enzyme has been determined. The digestion with trypsin
gave very specific peptides where the MW (MALDI-TOF) could be
determined conclusively. The amino acid sequences for all the
peptides were also determined by Edman degradation. The amino acid
sequence determined by Edman degradation covers 99.64% of the
polypeptides chain of the F. heterosporum lipolytic enzyme.
[0430] Summary of the MALDI-TOF and Edman degradation studies is
shown in Table 2. TABLE-US-00009 TABLE 2 Enzymatic fingerprinting
and MW of the tryptic peptides from the Fusarium heterosporum
lipolytic enzyme, and determination of the entire amino acid
sequence by Edman degradation. Fusarium heterosporum Lipolytic
enzyme (2254-97-3) M + H M + H nr From Sequence calc obs 1 1-13
AVGVTSTDFTNFK 1387.5 2+ 14-33 FYIQHGAAAYCNSGTAAGAK 2059.2 2059.0 3+
34-59 ITCSNNGCPTIESNGVTVVASFTG 2701.9 SK 4+ 60-72 TGIGGYVSTDSSR
1300.4 5+ 73-73 K 147.2 6+ 74-80 EIVVAIR 780.0 780.0 7 81-86 GSSNIR
632.7 8+ 87-128 NWLTNLDFDQSDCSLVSGCGVHSG 4514.8 FQNAWAEISAQASAAVAK
9 129-130 AR 246.3 10 131-131 K 147.2 11 132-137 ANPSFK 663.8 12+
138-158 VVATGHSLGGAVATLSAANLR 1966.3 1966.1 13+ 159-173
AAGTPVDIYTYGAPR 1552.7 1552.6 14+ 174-192 VGNAALSAFISNQAGGEFR
1910.1 1910.0 15 193-197 VTHDK 599.7 16 198-202 DPVPR 583.7 17+
203-211 LPPLIFGYR 1076.3 1076.3 18+ 212-226 HTTPEYWLSGGGGDK 1605.7
19+ 227-235 VDYAISDVK 1010.1 20a 236-274 VCEGAANLMCNGGTLGLDIDAHLH
4231.5 4233.2 YFQATDACNAGGFSW* 20b+ 236-275
VCEGAANLMCNGGTLGLDIDAHLH 4387.7 4387.8 YFQATDACNAGGFSW*R +=
Confirmed by Edman sequencing *= oxidised Tryptophan Sequence
coverage = 99.64%
[0431] The complete amino acid sequence of Fusarium heterosporum
lipolytic enzyme is shown as SEQ ID No. 1 (see FIG. 37).
Application Trials
[0432] A pool of 2 litres from the three samples of F. heterosporum
(Table 1), labeled Pool #172-174, was concentrated by
ultrafiltration (10 kDa filter) on an Amicon Ultra Filtration unit.
250 ml of the retentate contained approx. 100 PLU-7/ml. The
retentate was adjusted to 1 M Ammonium-acetate and applied onto a
27 ml Butyl Sepharose column (2.5 cm id.) and eluted with A-buffer
1M NH.sub.4-acetate in 20 mM TEA pH 7.4 and B-buffer 20 mM TEA pH
7.4. The chromatogram (#61) from the purification is shown in FIG.
3.
[0433] Fractions from the chromatogram #61 were analyzed by
SDS-PAGE as shown in FIG. 4.
[0434] 10 mL fractions from this chromatography were collected and
analyzed for phospholipase activity as shown in Table 3. These
results indicate a quite high amount of phospholipase activity in
the fractions eluted in the main peak of the chromatogram. Small
amount of activity is not bound to the column but is eluted in the
front. Although the SDS gel did not run so nicely, it is observed
that the fractions contain several proteins but fraction 14 and 15
contain one main band, which is expected to be the fungal lipolytic
enzyme. TABLE-US-00010 TABLE 3 Chromatogram #61. PLU-7 Frac. 8 32
Frac. 9 89 Frac. 10 69 Frac. 11 51 Frac. 12 39 Frac. 13 81 Frac. 14
23 Frac. 15 17
[0435] Fraction 9 and fraction 14 from chromatogram #61 were used
for a mini baking test and also the non-purified pool #172-174 was
tested in mini baking test. Results from this baking experiment are
shown in Table 4. This clearly shows that purified lipolytic enzyme
from F. heterosporum CBS 782.83 gives very good baking results in
term of improved bread volume. Also the non-purified sample
contributed to a very nice bread volume. The crumb structure of the
breads were also improved very much by F. heterosporum lipolytic
enzyme as indicated in FIG. 5 and evaluated better than a lipase
from Pseudomonas cepacia #3044. TABLE-US-00011 TABLE 4 PLU-7/50 g
Sample Enzyme flour Bread volume, mL/g 1 Chr #61 frac 9 100 U 4.33
2 Pool #172-174 100 U 4.33 3 Chr #61 frac. 14 100 U 4.60 4 Control
0 3.29 5 Lipase, #3044 40 ppm 4.38
[0436] Dough from this mini-baking experiment were extracted with
water-saturated-butanol and the lipids were analysed by TLC. TLC
analysis confirmed that Lipase #3044 is more active on triglyceride
than the lipolytic enzyme from F. heterosporum samples. The amount
of free fatty acids (FFA), are also higher with lipase #3044. TLC
in solvent IV indicates a component (DGMG), which is clearly higher
in the samples of dough lipids treated with F. heterosporum
compared with a triglyceride hydrolysing lipase #3044.
[0437] The purified fractions from F. heterosporum were also tested
in pilot baking experiment with the results shown in Table 5.
TABLE-US-00012 TABLE 5 Use of purified chromatography fractions
from Fusarium heterosporum in pilot baking test and effects on
bread volume. Specific volume No. (ccm/g) 1 Control 5.11 2 500 U F.
het. Pool #172-#174 6.28 3 1000 U F. het Pool #172-#174 6.79 4 40
ppm #3044 (Pseudomonas) 5.27 5 2000 U F. het. Pool #172-#174 6.24 6
4000 U F. het. Pool #172-#174 4.95 7 1000 U 2254-97 C61 6.95 8 40
ppm #3016 (Lipopan F .TM.) 6.97
[0438] Dough from this baking test were extracted with
water-saturated-butanol and the dough lipids analyzed by GLC
analysis with results shown in Table 6. TABLE-US-00013 TABLE 6 GLC
analysis of dough lipids. GL FFA MGMG DAG DGMG MGDG DGDG TRI
Control 0.120 0.152 0.0015 0.0771 0.0195 0.0644 0.172 0.770 500 U
F. het. Pool #172-#174 0.121 0.250 0.012 0.059 0.057 0.030 0.139
0.792 1000 U F. het Pool #172-#174 0.121 0.277 0.018 0.056 0.087
0.010 0.102 0.738 40 ppm #3044 0.127 0.368 0.002 0.132 0.022 0.066
0.173 0.276 2000 U F. het. Pool #172-#174 0.122 0.320 0.018 0.060
0.119 0.013 0.062 0.723 4000 U F. het. Pool #172-#174 0.128 0.332
0.021 0.065 0.146 0.010 0.033 0.739 1000 U 2254-97 C61 0.125 0.287
0.019 0.067 0.088 0.016 0.099 0.655 40 ppm#3016 0.124 0.284 0.017
0.058 0.086 0.014 0.101 0.723 GL = glycerol. FFA = free fatty acid.
MGMG = monogalactosylmonoglyceride. DAG = Diglyceride. DGMG
digalactosylmonoglyceride. MGDG = monogalactosyldiglyceride. DGDG =
digalactosyldiglyceride. TRI = triglyceride.
[0439] The ratio of DGDG hydrolysis compared to triglyceride
hydrolysis is shown in Table 7.
[0440] The GLC analysis of galactolipids, are also illustrated
graphically in FIG. 6.
[0441] The GLC results confirm that the amount of DGMG produced in
dough by F. heterosporum is higher than the amount produced by 40
ppm Lipopan F (#3016). The results also indicate a higher degree of
hydrolysis of MGDG than DGDG. The results also indicate that the
amount of hydrolyzed triglyceride is low compared with a normal
triglyceride-hydrolyzing enzyme like #3044 from P. cepacia. The
pilot scale baking results and the lipid analysis confirmed that
the lipolytic enzyme from F. heterosporum CBS 782.83 has clear
hydrolytic activity on digalactosyldiglyceride (DGDG) and the
formation of digalactosylmonoglyceride (DGMG) in a dough.
TABLE-US-00014 TABLE 7 Ratio of DGDG hydrolysis compared to
triglyceride hydrolysis of purified chromatography fractions from
Fusarium heterosporum dTRI dDGDG dDGDG/dTRI Control 500 U F. het.
Pool #172-#174 0 0.033 n/a 1000 U F. het Pool #172-#174 0.032 0.07
2.19 40 ppm #3044 0.494 0 n/a 2000 U F. het. Pool #172-#174 0.047
0.11 2.34 4000 U F. het. Pool #172-#174 0.031 0.139 4.4 1000 U
2254-97 C61 0.115 0.073 0.63 40 ppm#3016 0.047 0.071 1.5
4. Conclusions
[0442] In this study, a fungal lipolytic enzyme from F.
heterosporum CBS 782.83 was produced by fermentation in shake
flasks. The enzyme was purified and the amino acid sequence was
determined. The enzyme has about 83% homology to a commercial
lipase from F. oxysporum (LipopanF.TM.). The enzyme gave very good
results in baking trial in terms of improved bread volume and
improved crumb structure. Lipid analysis from dough confirmed that
the enzyme was active on galactolipids during production of
galactomonoglycerides. Without any optimization of dosage, the
baking results indicate that the a fungal lipolytic enzyme from F.
heterosporum CBS 782.83 is at least equivalent to the commercial
enzyme LipopanF, and the comparative DGDG to triglycerides activity
indicate that this enzyme has a superior enzymatic activity in a
dough environment compared to LipopanF.TM..
Example 2
Construction and Expression of a Synthetic Gene Encoding a
Lipolytic Enzyme from Fusarium heterosporum (CBS 782.83) in
Hansenula polymorpha
[0443] The amino acid sequence of a fungal lipolytic enzyme
isolated from Fusarium heterosporum (CBS 782.83) was determined and
used to design and clone a synthetic lipolytic enzyme gene for
expression in Hansenula polymorpha. To favour high expression, the
codons of the synthetic gene were optimised to be in accordance
with the codon preferences of Hansenula polymorpha. A codon
optimised alpha-factor signal sequence was synthesised as Well and
cloned in front of the synthetic lipolytic enzyme gene. The
assembled construct was transferred into the expression vector pB14
and transformed into Hansenula polymorpha. pB14 is a plasmid
without genes conferring antibiotic resistance and can therefore be
used in production facilities.
[0444] A number of lipolytic enzyme producing Fusarium strains were
screened for activities with a high ratio of activity on of
galactolipids and/or phospholipids when compared to
triglycerides.
[0445] Several of the strains have been selected as producing
lipolytic enzymes of interest. Among these is the Fusarium
heterosporum (CBS 782.83). The lipolytic enzyme from this strain
has therefore been isolated and the amino acid sequence has been
determined. The amino acid sequence was back translated into a
nucleic acid sequence that was used to design and construct a
synthetic gene for expression in Hansenula polymorpha.
Experimental
[0446] The strain of Hansenula used in this study was the
uracil-auxotrophic Hansenula polymorpha strain RB11 (odc1) obtained
from Rhein Biotech GmbH (Dusseldorf, Germany).
Enzymatic Fingerprinting by MALDI-TOF and Amino Acid
Sequencing.
[0447] A protein having lipolytic enzyme activity was isolated from
Fusarium heterosporum (CBS 782.83). The protein was reduced with
dithiothreitol and the cysteine residues were protected by
carboxymethylation using iodoacetamide. The protein was cleaved by
trypsin and the fragmentation pattern of the tryptic peptides were
examined by MALDI-TOF analysis. The peptides were separated by
chromatography on a C.sub.18-reverse-phase HPLC column, and the
degree of purification was monitored by MALDI-TOF analysis. The
amino acid sequence was determined by Edman degradation as
previously described in details in TR6452.
Design and Construction of a Synthetic Lipolytic Enzyme Gene.
[0448] The amino acid sequences of the peptide fragments were
ordered by alignment with the Japanese strain of F. heterosporum
(Nagao et al. 1994). The complete amino acid sequence thus obtained
was back translated into a nucleic acid sequence to reveal all
possible codons. For each codon the codon most favourable for
expression in Hansenula polymorpha was chosen according to the
codon preference table of genes expressed in Hansenula polymorpha.
Synthetic oligonucleotides, each about 100 nucleotides long,
comprising the complete gene, were synthesised, and the gene was
assembled by PCR. For the final amplification of the gene was used
an upstream primer (alps.cbss) designed with the most 5'
nucleotides from the 3'-end of the alpha-factor signal sequence to
allow in frame fusion, and a downstream primer (cbss.t) designed
with a Bam HI restriction enzyme site for cloning purposes (Table
8).
[0449] A nucleotide sequence encoding the signal sequence from the
yeast alpha mating factor was similarly synthesised with favourable
codons by oligonucleotides and amplified by PCR. For the final
amplification of the alpha-signal sequence was used an upstream
primer (alpsynt) designed with an Eco RI restriction enzyme site
for cloning purposes, and a downstream primer (cbss.alps) designed
with the most 5' sequences from the 5'-end of the synthetic
lipolytic enzyme gene to allow in frame fusion (Table 8).
[0450] To fuse the synthetic alpha-factor signal sequence to the
synthetic lipolytic enzyme gene the two fragments were mixed and
re-amplified with the outer primers alpsynt and cbss.t (Table 8).
The PCR product was cloned into the vector pCR 2.1-TOPO
(Invitrogen) and the nucleotide sequence of the inserts were
determined using a BigDye Terminator v3.0 cycle sequencing kit
(Applied Biosystems) and an ABI Prism 3100 Genetic Analyzer
(Applied Biosystems). TABLE-US-00015 TABLE 8 Primer sequences used
for the amplification and assembly of the synthetic F. heterosporum
(CBS 782.83) lipolytic enzyme gene and the synthetic alpha-signal
sequence. The restriction enzyme sites introduced for cloning
purposes in each primer are underlined. The nucleotides included
allowing fusion of the synthetic lipolytic enzyme gene and the
synthetic alpha-signal are double underlined. Restric- Gene Primer
sequence tion site CBSLip 5'- 5'- None alps.cbss
TCCTTGGACAAGAGAGCCGTTGGAGTGACC TCTACTG 3'-cbss.t 5'- Bam HI
AGGATCCAATTCTCTCCATGGCCTATCTCCA GGAGAA ACCTCCG .alpha.-signal
5'-alpsynt 5'- Eco RI AGAATTCAAACGATGAGATTCCCATCCATC TTTACCG 3'-
5'- None cbss.alps AGGTCACTCCAACGGCTCTCTTGTCCAAGG AAACAC CTTCC
Expression of Lipolytic Enzyme in Hansenula Polymorpha.
[0451] To express the synthetic F. heterosporum (CBS 782.93)
lipolytic enzyme gene in Hansenula the combined alpha-signal
sequence/lipolytic enzyme gene was inserted behind the FMD-promoter
into the Hansenula expression vector pB14, a plasmid without genes
conferring antibiotic resistance. After conformation of the
expected structure of the assembled plasmid in E. coli, the plasmid
was transformed into competent Hansenula polymorpha cells by
electroporation. Transformants were selected on YND plates and
colonies were further selected for multiple integration of the gene
by 3 and 8 passages of 1:200 dilutions in liquid cultures of YND.
Finally, the selected cultures were stabilised by transferring
twice in YPD medium. To further select for high expressers each
cultures showing high level of expression were plated for single
colonies, which each were assayed for expression level.
[0452] To determine the level of expression of the lipolytic enzyme
gene the selected clones were grown in YPD with 1.8% glycerol and
0.2% glucose for 2 days at 24.degree. C.
Enzyme Activity
[0453] Samples of the culture medium were analysed for lipolytic
enzyme activity with Lecithin or DGDG as substrates and using the
NEFA Kit (Roche) scaled down to volumes suitable for micro titre
plates for determination of the liberated free fatty acids.
Results
Enzymatic Fingerprinting by MALDI-TOF and Amino Acid
Sequencing.
[0454] The entire amino acid sequence of Fusarium heterosporum
lipolytic enzyme has been determined (See SEQ ID No. 1--FIG. 37).
The digestion with trypsin gave very specific peptides where the MW
(MALDI-TOF) could be determined conclusively. The amino acid
sequences for all the peptides were also determined by Edman
degradation. The amino acid sequences determined by Edman
degradation covers 99.64% of the polypeptide chain of the F.
heterosporum (CBS 782.83) lipolytic enzyme. The amino acid
sequences of all peptides were aligned to the lipase of the
Japanese strain of F. heterosporum (Nagao et al. 1994 J. Biochem.
116: 536-540) thus revealing the order of the peptides identifying
the amino acid sequence of the mature protein. The alignment is
shown in FIG. 7. Summary of the MALDI-TOF and Edman degradation
studies is shown in Table 9 with the peptides order according to
the alignment with the Nagao sequence. TABLE-US-00016 TABLE 9
Enzymatic fingerprinting, MW determination of the entire amino acid
sequence by Edinan degradation of the tryplic peptides from the
Fusarium heterosporum (CBS 782.83) lipolytic enzyme. Fusarium
heterosporum Phospholipase (2254-97-3) Partial cleavage M + H M + H
M + H M + H Nr From Sequence calc obs Peptides calc obs 1 1-13
AVGVTSTDFTNFK 1387.5 2+ 14-33 FYIQHGAAAYCNSGTAAGAK 2059.2 2059 1 +
2 3427 3427 3+ 34-59 ITCSNNGCPTIESNGVTVVASFTGSK 2701.9 4+ 60-72
TGIGGYVSTDSSR 1300.4 3 + 4 + 5 4111 4112 5+ 73-73 K 147.2 6+ 74-80
EIYVAIR 780.0 780.0 4 + 5 + 6 2209 2209 7 81-86 GSSNIR 632.7 8+
87-128 NWLTNLDFDQSDCSLVSGCGVHSGFQ 4514.8 7 + 8 5129 5129
NAWAEISAQASAAVAK 9 129-130 AR 246.3 8 + 9 4743 4743 10 131-132 K
147.2 11 132-137 ANPSFK 663.8 12+ 138-158 VVATGHSLGGAVATLSAANLR
1966.3 1966 10 + 11 + 12 2739 2739 13+ 159-173 AAGTPVDIYTYGAPR
1552.7 1552 14+ 174-192 VGNAALSAFISNQAGGEFR 1910.1 1910 15 193-197
VTHDK 599.7 16 198-202 DPVPR 583.7 17+ 203-211 LPPLIFGYR 1076.3
1076 15 + 16 + 17 2221 2221 18+ 212-226 HTTPEYWLSGGGGDK 1605.7 19+
227-235 VDYAISDVK 1010.1 18 + 19 2596 2596 20a 236-274
VCEGAANLMCNGGTLGLDIDAH 4231.5 4232 LHYFQATDACNAGGFSW* 20b+ 236-275
VCEGAANLMCNGGTLGLDIDAHL 4387.7 4387 HYFQATDACNAGGFSW*R Peptide
sequences confirmed by Edman degradation are marked +. Oxidised
Tryptophan is marked by *. Sequence coverage = 99.64%
Identity to Other Fusarium Lipases
[0455] Alignments of the amino acid and nucleotide sequence of F.
heterosporum (CBS 782.83) lipolytic enzyme with sequences from
other Fusarium lipases show the relationships between some of the
Fusarium lipases (Table 10). TABLE-US-00017 TABLE 10 Amino acid and
nucleotide identity of F. heterosporum (CBS 782.83) lipolytic
enzyme compared to other Fusarium lipases. F. heterosporum F.
oxysporum LIPASE IDENTITIES (Nagao supra) (Lipopan F .TM.) F.
heterosporum (CBS 58.7% 85.1% 782.83) amino acid (SEQ ID No. 1) F.
heterosporum (CBS 61.8% 69.2% 782.83) nucleotide sequence (SEQ ID
No. 3)
[0456] Mixing and amplification by PCR of the synthetic
oligonucleotides for the lipolytic enzyme gene and the alpha-signal
sequence resulted in DNA fragments, which were cloned and
sequenced. Fragments containing the correct sequences were used to
assemble the complete gene by re-amplification using the primers
shown in Table 8. The assembled nucleotide sequence is shown in
FIG. 8 with its translated amino acid sequence, and the primers
used are indicated with arrows.
[0457] The DNA fragment containing the assembled gene construct was
transferred to the Hansenula expression vector pB14 using the
introduced restriction enzyme sites. The resulting plasmid
pB14-alps.cbss is schematically shown in FIG. 9.
Expression of Fungal Lipolytic Enzyme Activity in Selected
Clones.
[0458] The clones, which have been through the selection process,
were analysed for expression of lipolytic enzyme. 10-microlitre
samples of the supernatant of 2 day cultures were incubated with
either DGDG or lecithin for 10 minutes and 10 microlitres of these
reactions were analysed with the NEFA kit. The results after single
colony isolation of 3 of the clones are shown in FIG. 10.
[0459] The amino acid sequence of a lipolytic enzyme from a strain
of Fusarium heterosporum (CBS 782.83) has been determined and a
synthetic gene encoding this lipolytic enzyme has been constructed
and optimised for expression in Hansenula polymorpha. The gene that
encoded the mature enzyme was fused to a synthetic signal sequence
derived from the yeast mating alpha-factor. The combination of the
alpha-signal sequence with the FMD promoter of the Hansenula pB14
vector has previously been shown to be suitable for expression of
Fusarium lipases.
Example 3
Expression of a Fusarium heterosporum CBS 782.83 Lipolytic Enzyme
in Hansenula polymorpha and Characterization of the Product in
Baking Trials
[0460] The Hansenula polymorpha strain B14:8-3, 8 (DCDK0172),
containing a lipolytic enzyme-encoding gene from the filamentous
fungus Fusarium heterosporum CBS782.83, was fermented in the
fed-batch mode. After 160 hours of fermentation the phospholipase
activity reached 1200 U/mL. Based on the fermentations three
products were made and tested further. The products are named the
following: sample 205, -206 and -209.
[0461] A lipolytic enzyme sample 205 from F. heterosporum expressed
in H. polymorpha was tested in miniscale baking experiments. Dough
from the baking experiment was analyzed by GLC and HPTLC.
[0462] The baking results from mini scale baking confirm a very
strong improvement of lipolytic enzyme sample 205 on bread volume
and improvement of crumb structure. Lipolytic enzyme analysis
confirmed a strong hydrolytic activity of lipolytic enzyme sample
205 on digalactosyldiglyceride (DGDG) concomitant with the
accumulation of digalactosylmonoglyceride (DGMG).
[0463] The enzyme had only minor activity on triglycerides in the
dough.
[0464] Samples 206 and 209 were tested in pilot scale baking trials
and confirmed the good baking performance of the lipolytic enzymes
both with respect to increased bread volume and improved crumb
structure. From the baking trials it is indicated that sample 206
perform a bit better compared to sample 209 in a straight dough
procedure, however the two products have not been compared directly
to each other and more baking trials has to confirm this.
2. Experimental
Fermentation
Microorganism
[0465] The strain of H. polymorpha transformed with the plasmid
containing the lipolytic from F. heterosporum CBS 782.83 as
described in EXAMPLE 2 was used in this study. The promoter used in
the construct was the formate dehydrogenase promoter from H.
polymorpha.
Growth Media and Culture Conditions
YNB-Glycerol Medium
[0466] The medium used for preparation of inoculum for the
bioreactor fermentations and for growth in shake flasks contained:
1.7 g/L Yeast Nitrogen Base (DIFCO, Detroit, USA, 0335-15-9), 5 g/L
(NH.sub.4).sub.2SO.sub.4, 10 g/L glycerol, and 0.1 M
2-[N-Morpholino]ethanesulfonic acid (MES) as a buffer. The pH was
adjusted to 6.1 (the pKa of MES) with 4 M NaOH (before
autoclaving). Yeast Nitrogen Base and (NH.sub.4).sub.2SO.sub.4 were
filter-sterilized to the medium after autoclaving. This medium was
used for growth in shake flasks (250 mL medium in a shake flask
with a total volume of 500 mL).
YNB Agar
[0467] The defined medium used for plating of stock cultures (kept
at -80.degree. C. in 25% (w/v) glycerol) contained: 1.7 g/L Yeast
Nitrogen Base (DIFCO, Detroit, USA, 0335-15-9), 5 g/L
(NH.sub.4).sub.2SO.sub.4, 10 g/L glycerol, and 20 g/L agar (DIFCO,
Detroit, USA, 0140-01). Yeast Nitrogen Base and
(NH.sub.4).sub.2SO.sub.4 were filter-sterilized to the medium after
autoclaving.
YPD Medium
[0468] The rich medium was used for contamination check in the
fermentors. The medium contained: 10 g/L yeast extract, 10 g/L
peptone and 20 g/L glycerol.
Fermentations
[0469] Three fermentations were carried out in this study: HET0401,
HET0402 and HET0410, all with the strain described above. The
variations between the three fermentations are in the composition
of the batch medium and the feed medium. All other parameters were
identical for the three fermentations.
[0470] The batch medium (3 L) used for the fermentation in 6 L
fermentor contained: 13.3 g/L NH.sub.4H.sub.2PO.sub.4, 3.0 g/L
MgSO.sub.4.H.sub.2O, 3.3 g/L KCl, 0.3 g/L NaCl, 15 g/L glycerol,
and 3 mL/L ADD APT.RTM. Foamstop Sin 260 (ADD APT Chemicals AG,
Helmond, The Netherlands), 1.0 g/L CaCl.sub.2.2H.sub.2O, 67 mg/L
(NH.sub.4).sub.2Fe(SO.sub.4).sub.2.6H.sub.2O, 5 mg/L
CuSO.sub.4.5H.sub.2O, 20 mg/L ZnSO.sub.4.7H.sub.2O, 21 mg/L
MnSO.sub.4.H.sub.2O, and 67 mg/L EDTA), 0.65 mg/L
NiSO.sub.4.6H.sub.2O, 0.65 mg/L CoCl.sub.2, 0.65 mg/L
H.sub.3BO.sub.4, 0.65 mg/L KI, 0.65 mg/L
Na.sub.2MoO.sub.4.2H.sub.2O), 2 mg/L D-biotin and 0.67 g/L
thiaminchloride-hydrochloride.
[0471] In addition to the batch medium described above,
fermentation HET0402 contained 10 g/L peptone in the batch
medium.
[0472] In addition to the batch medium described above,
fermentation HET0410 contained 10 g/L Bacto tryptone in the batch
medium.
Feed Medium HET0401 and HET0402:
[0473] The feed medium contained 635 g/kg glycerol and 130 g/kg
formic acid.
Feed Medium HET0410:
[0474] The feed medium contained 570 g/kg glycerol, 120 g/kg formic
acid and 95 g/kg Bacto tryptone.
[0475] The pH was controlled by adding 25% (w/v)
NH.sub.3-water.
[0476] The fermentation was carried out in the fed-batch mode in an
in house build 6 L fermentor. The following fermentation conditions
were used: pH 5, aeration 1 vvm, temperature 26.degree. C., and
stirring from 400 to 700 rpm.
[0477] The fermentor was inoculated with 2*250 mL YNB-glycerol
culture grown at 25.degree. C. and 180 rpm, and with an OD-600 of
approximately 10.
[0478] The feed flow in the fermentation was controlled by the
accumulated CO.sub.2 evolution, and based on the following
equations: Feed-flow[g/h]=0, AcCO.sub.2<0.45
Feed-flow[g/h]=1.33VAccCO.sub.2,
0.45.ltoreq.AccCO.sub.2.ltoreq.3.25 Feed-flow[g/h]=4.33V,
3.25.ltoreq.AccCO.sub.2 V: The fermentation broth volume [L]
AccCO.sub.2: The accumulated CO.sub.2 evolution [moles] Harvest
[0479] The fermentations were harvested by centrifugation for 10
minutes at 16000.times.g followed by sterile filtration of the
supernatant through 0.2 .mu.m filters (VacuCap 90 Filter Unit w
0.8/0.2 .mu.m Supor Membrane) from Gelman Laboratory. The product
was kept at 4.degree. C. until use in baking trials.
Analytical Procedures
Determination of Lipase Activity
[0480] A fermentation sample (10 mL) was centrifuged 9000.times.g
for 10 minutes, and the supernatant was used for the analysis of
phospholipase activity according to the "PLU assay" taught
previously herein.
Biomass Growth
[0481] The biomass concentration in a culture fluid was determined
by centrifugation of 10 mL of culture fluid at 9000.times.g for 10
minutes in a pre weighed container. After centrifugation, the
supernatant was removed and the biomass was dried for 24 hours at
100.degree. C. and then weighed. The biomass concentration was
calculated as g dry weight of cells per L culture fluid.
Enzyme Characterisation and Mini Baking
Enzymes and Flour
[0482] Sample 205: Sample 7 (161 hours fermentation) from
HET0401
[0483] Phospholipase Lipopan F, #2938
[0484] Flour: Reform 2003055
Minibaking
[0485] The following ingredients were added to a 50 g Brabrender
mixing bowl and kneaded for 5 minutes at 30.degree. C.: flour 50 g,
dry yeast 10 g, sugar 0.8 g, salt 0.8 g, 70 ppm ascorbic acid and
water (to a dough consistency of 400 Brabender units). Resting time
was 10 min. at 34.degree. C. The dough was scaled 15 g per dough.
Then molded on a special device where the dough was rolled between
a wooden plate and a Plexiglas frame. The doughs were proofed in
tins for 45 min. at 34.degree. C., and baked in a Voss household
oven for 8 min. 225.degree. C.
[0486] After baking the breads were cooled to ambient temperature
and after 20 min. The breads were scaled and the volume was
determined by rape-seed displacement method. The breads were also
cut and crumb and crust evaluated
Lipid Extraction
[0487] 10 g of fully proofed dough was immediately frozen and
freeze dried. The freeze-dried dough was milled in a coffee mill
and passed through a 800 micron screen. 1.5 g freeze-dried dough
was scaled in a 15 mL centrifuge tube with screw lit. 7.5 ml water
saturated butanol (WSB) was added. The centrifuge tube was placed
in a boiling water bath for 10 min. The tubes were placed in a
Rotamix and turned at 45 rpm for 20 min. at ambient temperature.
Then place in boiling water bath again for 10 min. and turn on the
Rotamix for 30 min. at ambient temperature. The tubes were
centrifuged at 3500 g for 5 min. 5 ml supernatant was transferred
into a vial. WSB was evaporated to dryness under a steam of
nitrogen.
Gas Chromatography
[0488] Gas chromatography was performed as described under
analytical procedures in example 1 above.
HPTLC
[0489] Applicator: LINOMAT 5, CAMAG applicator.
[0490] HPTLC plate: 10.times.10 cm, Merck no. 1.05633
[0491] The plate is dried before use in an oven at 180.degree. C.
for 20-30 minutes.
[0492] Application: 1.0 .mu.L of a 1% solution in CHCl3:MeOH85:15
is applied to the HPTLC plate using LINOMAT 5 applicator.
Running-Buffer:
[0493] No. IV: Chloroform:Methanol:H.sub.2O (65:25:4)
[0494] No. I: P-ether:methyl-tert-butylether (MTBE):Acetic acid
(60:40:1)
[0495] Application/Elution time: 11 minutes for running buffer 1
and 18 minutes for running buffer IV.
[0496] The plate is dried in an oven at 180.degree. C. for 10
minutes, cooled and developed in 6% cupri acetate in 16%
H.sub.3PO.sub.4. Dried additional 10 minutes at 180.degree. C. and
evaluated directly.
Baking Trials
Products Tested:
[0497] #3016--Lipopan F containing 8700 LIPU/g TABLE-US-00018 ID
Strain/host Fermentation Sample 206 containing 390 LIPU/g F.
heterosporum/H. polymorpha HET0401 + HET0402 Sample 209 containing
950 LIPU/g F. heterosporum/H. polymorpha HET0410
Recipe:
[0498] Hard crusty rolls performed with Reform flour: 2003159
TABLE-US-00019 Bakers % Amount, g Flour-reform 2003159 100 2000
Water 58.5 1170 Compressed yeast 6 120 Salt 1.6 32 Sugar 1.6 32
Ascorbic acid 10 ppm 0.02 Standard alpha-amylase 90 ppm 0.180
GRINDAMYL .TM. A 1000
Baking Procedure: Diosna Mixer System [0499] Dry mix for 1 min slow
[0500] Mix 2 min slow+4 min fast [0501] Dough temperature:
26.degree. C. [0502] Scaling: 1350 g [0503] Resting: 10 min. at
30.degree. C. in heating cabinet [0504] Moulding: Fortuna 3/17/7
[0505] Proofing: 45 min. at 34.degree. C., 85% RH. [0506] Baking:
Bago oven: 13 min. at 220.degree. C., 13 sec. steam+5 min damper
open [0507] MIWE stone deck: prog. nr 1 [0508] After baking the
rolls are cooled for 25 min before weighing and measuring of volume
Results and Discussion Fermentation Physiology and Phospholipase
Production
[0509] The addition of tryptone to the batch and feed medium of
HET0410 resulted in a faster production of biomass and a higher
final level of biomass compared to HET0401-0402.
[0510] HET0401 and HET0402 are almost identical with respect to the
phospholipase activity development, whereas the phospholipase
productivity is significantly higher in HET0410.
Harvest
[0511] The fermentations were harvested after 168 hours
(HET0401-0402) and 161 hours (HET0410) of fermentation. The product
was kept at 4.degree. C. until use in baking trials. Some of the
product of HET0401 was named sample 205, and contained
approximately 700 PLU-7/mL. Some of the product from HET0401 and
HET0402 was pooled and named sample 206. This product contained
approximately 390 PLU-7/mL. The lower enzyme activity of sample 206
compared to the end product of HET0401 and HET0402 may be caused by
storage and sterile filtration. The product of HET0410 was named
sample 209 and contained approximately 950 PLU-7/mL.
Enzyme Characterization and Mini Baking
[0512] Lipolytic enzyme sample 205 from fermentation HET0401 was
tested in a minibaking experiment.
[0513] In different dosage and compared with a control and Lipopan
F.TM.. The specific bread volume of bread from this baking test is
shown in Table 11. Picture of the bread are shown in FIG. 11.
TABLE-US-00020 TABLE 11 Lipolytic enzyme from Fusarium heterosporum
(sample 205) in minibaking experiments. Effect on bread volume.
Dosage Bread volume Sample PLU-7/kg flour mL/g 205 0 3.56 205 200
U/kg 3.98 205 500 U/kg 4.87 205 1000 U/kg 5.05 205 1500 U/kg 5.13
205 2000 U/kg 4.82 205 5000 U/kg 5.05 205 10000 U/kg 4.51 Lipopan F
40 ppm 4.57
[0514] The baking results confirmed a very strong effect of sample
205 on improvement of bread volume, and the volume effect was
better than Lipopan F.TM. in a standard dosage of 40 ppm.
[0515] From FIG. 11 it is also seen that sample 205 contributes to
a strong improvement in crumb structure and color.
[0516] Fully proofed dough from this baking experiment was
freeze-dried and extracted with water saturated butanol, and the
isolated lipids analyzed by GLC and HPTLC.
[0517] The GLC analysis of the dough lipids (Table 12) confirms the
hydrolytic effect of lipolytic enzyme sample 205 on
digalactosyldiglyceride (DGDG) concomitant with an accumulation of
digalactosylmonoglyceride (DGMG). The activity of the enzyme on
DGMG is quite low because the total molar amount of DGDG (mmol
%=mmol/100 g freeze-dried dough) and DGMG (mmol %) remains constant
at increased enzyme dosage (FIG. 12). The GLC results also indicate
a very low activity of sample 205 on triglyceride. TABLE-US-00021
TABLE 12 GLC analysis of dough lipids. % % % % % % mmol % mmol %
mmol % Sample (S-) FFA MGMG DGMG MGDG DGDG TRI DGMG DGDG DGMG +
DGDG 0 U S-205 0.232 0.002 0.023 0.013 0.214 0.641 0.034 0.228
0.262 200 U S-205 0.321 0.007 0.050 0.038 0.193 0.660 0.074 0.205
0.279 500 U S-205 0.384 0.012 0.069 0.021 0.132 0.610 0.101 0.140
0.241 1000 U S-205 0.418 0.014 0.117 0.008 0.087 0.614 0.173 0.093
0.265 1500 U S-205 0.444 0.016 0.140 0.011 0.057 0.600 0.206 0.060
0.267 2000 U S-205 0.438 0.026 0.148 0.011 0.039 0.594 0.218 0.041
0.259 5000 U S-205 0.456 0.022 0.171 0.011 0.012 0.533 0.252 0.013
0.264 10000 U S-205 0.453 0.017 0.163 0.013 0.009 0.547 0.241 0.010
0.251 40 ppm Lipopan F 0.372 0.017 0.077 0.027 0.134 0.577 0.114
0.142 0.256 FFA = free fatty acid. MGMG =
monogalactosylmonoglyceride. DGMG digalactosylmonoglyceride. MGDG =
monogalactosyldiglyceride. DGDG = digalactosyldiglyceride. TRI =
triglyceride mmol % = mmol/100 g freeze-dried dough
[0518] Comparing the baking results and the lipid analysis it is
interesting to observe that the best baking effect is not obtained
by a complete hydrolysis of DGDG to DGMG, but the results indicate
that a partly hydrolysis of DGDG to DGMG may give the best baking
performance.
[0519] The high enzyme dosage produces more DGMG but also more free
fatty acid is produced which is expected to give a negative baking
effect, which might be another explanation why only a partly
hydrolysis of DGDG is preferable. Table 13 shows the ratio of DGDG
and triglycerides hydrolysis, calculated from Table 12. The results
illustrates that the best baking performance is obtained when at a
dosage where the ratio of DGDG to triglycerides activity is
greatest. TABLE-US-00022 TABLE 13 Ratio of DGDG and triglyceride
hydrolysis from GLC analysis of dough lipids. Bread volume Sample
(S) dTRI dDGDG dDGDG/dTRI mL/g 0 U S-205 3.56 200 U S-205 0 0.023
3.98 500 U S-205 0.031 0.088 2.84 4.87 1000 U S-205 0.027 0.135
0.030 5.05 1500 U S-205 0.041 0.168 4.1 5.13 2000 U S-205 0.047
0.187 3.98 4.82 5000 U S-205 0.108 0.215 1.99 5.05 10000 U S-205
0.094 0.218 2.3 4.51 40 ppm Lipopan F 0.064 0.086 1.34 4.57
[0520] Some of the lipid samples were also analyzed by HPTLC as
shown in FIG. 13. Sample 4, 5 and 6 are dough lipids from the
baking experiment. The HPTLC analysis confirms the hydrolysis of
DGDG and formation of DGMG by lipolytic enzyme sample 205.
[0521] The relative polar lipid:triglyceride activity ratio of
Lipopan F and Sample 209 using the assays taught hereinabove
are:
Phospholipid/triglyceride (PLU/LIPU)
[0522] Lipopan F=3 [0523] Sample 209=9 Galactolipid/triglyceride
(GLU/LIPU) [0524] Lipopan F=1 [0525] Sample 209=4
[0526] Fusarium heterosporum CBS 782.83 lipolytic enzyme gave very
strong effects in miniscale baking experiments with strong increase
in bread volume and improvement of crumb structure. Lipid analysis
confirms strong hydrolytic activity on DGDG in dough concomitant
with the accumulation of DGMG. Fusarium heterosporum CBS 782.83
lipolytic enzyme showed low activity on triglycerides in a
dough.
Example 4
Characterization of Activity on Lipid Substrates and Position
Specificity of a Fusarium heterosporum CBS 782.83 Lipolytic Enzyme
Expressed in Hansenula polymorpha
[0527] A lipolytic enzyme according to the present invention from
Fusarium heterosporum was expressed in Hansenula polymorpha as
described in Example 3.
Analytical Procedures
[0528] Phospholipase activity was determined using the PLU assay
described previously herein.
[0529] Galactolipase activity was determined using the
galactolipase assay described previously herein.
[0530] Activity on triglyceride (tributyrin) was determined using
the LIPU assay described previously herein.
Activity on Sunflower Oil (LUSol, pH-Stat pH 6):
Reagents:
[0531] 8.4 g gum arabic is dissolved in 100 ml deionized water and
100 ml 30 mM CaCl.sub.2 is added. 36 g sunflower oil is slowly
added during mixing with a Turrax mixer (20000 rpm)
Assay:
[0532] 20 ml sunflower oil emulsion in a beaker is equilibrated at
30.degree. C. for 5 min. pH is adjusted to 6.3-6.5 using a pH stat.
2 ml enzyme solution is added, and 0.05 N NaOH is continuously
added keeping the pH at 6.5 for 10 minutes. The slope of the curve
for the addition of 0.05 NaOH as a function of time is
calculated.
[0533] 1 LUSol is defined as the quantity of enzyme, which can
liberate 1 .mu.mol fatty acid per min. under assay conditions
[0534] The lipolytic enzyme was analysed for activity on different
substrates according to procedures mentioned above. The results are
shown in Table 14. TABLE-US-00023 TABLE 14 Activity of a lipolytic
enzyme Fusarium heterosporum according to the present invention on
different lipid substrates. Activity Substrate pH Temperature
UNIT/ml LIPU Tributyrin 5.5 30 754 LUSol Sunflower oil 6.5 30 48
PLU-7 Phosphatidylcholine 7 37 4650 GLU Digalactosyldiglyceride 7
37 1600
[0535] The lipolytic enzyme from Fusarium heterosporum expressed in
Hansenula polymorha hydrolysis primarily fatty acids in the sn-1
position of galactolipid and phospholipids in dough. The
specificity of the enzyme was investigated by adding different
concentrations of the enzyme to a bread dough. The fully proofed
dough was frozen and freeze dried, and the dough lipids were
extracted with water saturated butanol.
[0536] The dough lipids were analysed by GLC and HPLC analysis.
[0537] By GLC analysis it was possible to analyse digalactosyl
diglyceride (DGDG) and digalactosylmonoglyceride (DGMG). Further it
was possible to analyse the position isomers of digalactosyl
monoglyceride (1:digalactosyl 1-monoglyceride and 2: digalactosyl
2-monoglyceride, see structure below). These components were
separated and quantified by GLC. R1=H and R2=Fatty acyl ##STR1## 2:
R1=Fatty acyl and R2=H ##STR2##
[0538] In a baking test for production of hard crust rolls
different dosages of the lipolytic enzyme were added and
galactolipids in the fully proofed dough were analysed. The amount
of the isomer digalactosylmonoglycerides are shown in Table 15 and
illustrated graphically in FIG. 14. TABLE-US-00024 TABLE 15 Amount
of isomer digalactosylmonoglycerides in a baking test using
lipolytic enzyme from Fusarium heterosporum Digalactosyl
Digalactosyl Enzyme dosage 2-monoglyceride %, 1-monoglyceride %,
TIPU/kg flour based on dough dry weight based on dough dry weight 0
0.0102 0.0399 200 0.0092 0.0167 400 0.0071 0.0100 400 0.0067 0.0057
800 0.0103 0.0063 1000 0.0071 0.0060 1200 0.0081 0.0053 1500 0.0064
0.0057 2000 0.0084 0.0047
Conclusion
[0539] From the results in Table 15 and FIG. 14 it is concluded
that digalactosyl diglyceride is primarily hydrolysed in 1-position
during production of digalactosyl 2-monoglyceride. A smaller
increase in the amount of digalactosyl 1-monoglyceride is also
observed. It is well known that acyl migration from 2 to 1 position
of acyl fatty acid in lipids will occur. This acyl migration
depends on temperature and as a function of time an equilibrium
between digalactosyl-2-monoglyceride and digalactosyl
1-monoglyceride will occur. This phenomena explains the fact that a
small increase in digalactosyl 1-monoglyceride also is
observed.
Example 5
Determination of Temperature Optimum and Stability of Lipolytic
Enzyme Derived from Fusarium heterosporum
[0540] The enzyme activity of spray dried lipolytic enzyme derived
from F. Heterosporum and expressed in Hansenula Polymorpha was
determined at various temperatures according to PLU-7 with
modifications as described below. The substrate was an emulsion of
0.6% phosphatidylcholin, 0.4% Triton X-100, 6 mM CaCl.sub.2, and 50
mM HEPES, pH 7.0. The spray dried lipolytic enzyme ferment was
diluted with demineralised water to 3 TIPU/ml. 400 .mu.l of
substrate was thermostatted for 5 minutes at 10, 20, 30, 40, 50,
45, 50 and 60.degree. C. and 50 .mu.l sample was added. After
exactly 10 minutes, the enzymation was stopped by incubation at
99.degree. C. for another 10 minutes. Finally, the amount of free
fatty acids was determined by NEFA C method (Wako Chemicals GMbH,
Neuss, Germany). Colour reagent A and B was made according to
manufacturers protocol. 10 .mu.l redispersed extracted lipid and
100 .mu.l reagent A were pipetted to a microtiter plate and
incubated at 37.degree. C. for 10 minutes. 200 .mu.l reagent B was
added to the microtiter plate and incubated at 37.degree. C. for 10
minutes. The optical density at 540 nm was measured. The amount of
free fatty acid was determined, using the read absorbance and a
standard curve based on oleic acid. Results are shown in FIG.
15.
[0541] Enzyme stability of spray dried lipolytic enzyme ferment was
determined at various temperatures. Spray dried lipolytic enzyme
ferment was diluted with 50 mM phosphate buffer, pH 7.0 to 3
TIPU/ml. After 30 minutes of incubation at 20, 30, 37, 40 and
45.degree. C. the sample was stored on ice. Subsequently,
phospholipase activity was determined according to PLU-7 with
modifications as described below. The substrate was an emulsion of
0.6% phosphatidylcholin, 0.4% Triton X-100, and 50 mM phosphate
buffer. CaCl.sub.2 was left out to prevent precipitation of calcium
phosphate and does not affect the enzyme activity. 400 .mu.l of
substrate was thermostatted for 5 minutes at 37.degree. C. and 50
.mu.l sample was added. After exactly 10 minutes, the enzymation
was stopped by incubation at 99.degree. C. for another 10 minutes.
Finally, the amount of free fatty acids was determined by the NEFA
C method (Wako Chemicals GmbH, Neuss, Germany). Colour reagent A
and B was made according to manufacturer's protocol. 10 .mu.l
redispersed extracted lipid and 100 .mu.l reagent A were pipetted
to a microtiter plate and incubated at 37.degree. C. for 10
minutes. 200 .mu.l reagent B was added to the microtiter plate and
incubated at 37.degree. C. for 10 minutes. The optical density at
540 nm was measured. The amount of free fatty acid was determined
using the red absorbance and a standard curve based on oleic acid.
Results are shown in FIG. 16.
Example 6
Determination of pH Optimum and Stability of a Lipolytic Enzyme
Derived from Fusarium heterosporum
[0542] The enzyme activity of spray dried lipolytic enzyme derived
from F. heterosporum and expressed in Hansenula Polymorpha was
determined at various pH. The substrate was an emulsion of 0.6%
phosphatidylcholin, 0.4% Triton X-100, and 50 mM phosphate buffer
pH 4.0, 5.0, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0 and 10.0. CaCl.sub.2
was left out to prevent precipitation of calcium phosphate and does
not affect the enzyme activity. The spray dried lipolytic enzyme
ferment was diluted with demineralised water to 3 TIPU/ml. 400
.mu.l of substrate was thermostatted for 5 minutes at 37.degree. C.
and 50 .mu.l sample was added. After exactly 10 minutes, the
enzymation was stopped by incubation at 99.degree. C. for another
10 minutes. Finally, the amount of free fatty acids was determined
by NEFA C method (Wako Chemicals GMbH, Neuss, Germany). Colour
reagent A and B was made according to manufacturers protocol. 10
.mu.l redispersed extracted lipid and 100 .mu.l reagent A were
pipetted to a microtiter plate and incubated at 37.degree. C. for
10 minutes. 200 .mu.l reagent B was added to the microtiter plate
and incubated at 37.degree. C. for 10 minutes. The optical density
at 540 nm was measured. The amount of free fatty acid was
determined, using the read absorbance and a standard curve based on
oleic acid. Results are shown in FIG. [17].
[0543] The enzyme stability of spray dried lipolytic enzyme ferment
was determined at various pH. Spray dried lipolytic enzyme ferment
was diluted with 50 mM phosphate buffer at pH 4.0, 5.0, 6.0, 6.5,
7.0, 7.5, 8.0, 8.5, 9.0 and 10.0 to 3 TIPU/ml. After 30 minutes of
incubation at 37.degree. C. the sample was stored on ice.
Subsequently, the phospholipase activity was determined according
to PLU-7 with modifications as described below. The substrate was
an emulsion of 0.6% phosphatidylcholin, 0.4% Triton X-100, and 50
mM phosphate buffer, pH7. CaCl.sub.2 was left out to prevent
precipitation of calcium phosphate and does not affect the enzyme
activity. 400 .mu.l of substrate was thermostatted for 5 minutes at
37.degree. C. and 50 .mu.l sample was added. After exactly 10
minutes, the enzymation was stopped by incubation at 99.degree. C.
for another 10 minutes. Finally, the amount of free fatty acids was
determined by the NEFA C method (Wako Chemicals GmbH, Neuss,
Germany). Colour reagent A and B was made according to
manufacturers protocol. 10 .mu.l redispersed extracted lipid and
100 .mu.l reagent A were pipetted to a microtiter plate and
incubated at 37.degree. C. for 10 minutes. 200 .mu.l reagent B was
added to the microtiter plate and incubated at 37.degree. C. for 10
minutes. The optical density at 540 nm was measured. The amount of
free fatty acid was determined using the read absorbance and a
standard curve based on oleic acid. Results are shown in FIG.
18.
Example 7
Determination of Molecular Weight of Purified Lipolytic Enzyme
Derived from Fusarium heterosporum
[0544] Purified lipolytic enzyme according to the present invention
derived from Heterosporum Fusarium was run on an SDS-PAGE gel,
FIGS. 19a and 19b. Based on a Novex standard marker, the molecular
weight was calculated as shown in Table 15 TABLE-US-00025 TABLE 15
Determination of the molecular weight of the lipolytic enzyme
according to the present invention M.sub.w log Sample R.sub.f (kDa)
M.sub.w Calculations Novex 0.91 3.0 0.48 Log M.sub.w (kDa) = -5.30
R.sub.f.sup.3 + standard 0.82 6.0 0.78 7.50 R.sub.f.sup.2 - 5.00
R.sub.f + 2.7986 0.71 14 1.15 r.sup.2 = 0.9989 0.66 17 1.23 0.55 28
1.45 0.47 38 1.58 0.38 49 1.69 0.31 62 1.79 0.23 98 1.99 0.13 188
2.27 Lipolytic log M.sub.w = -5.30 0.52.sup.3 + enzyme 7.50
0.52.sup.2 - 5.00 0.52 + 0.52 according to 2.80- the present
M.sub.w = 29.9 kDa invention
[0545] The weight of the lipolytic enzyme was calculated to 29.9
kDa.
Example 8
Determination of the Isoelectrical Point (pI) of Lipolytic Enzyme
Derived from Fusarium heterosporum
[0546] The isoelectrical point (pI) of a lipolytic enzyme derived
from F. heterosporum was determined theoretically based on the
amino acid sequence SEQ ID NO. 6.
[0547] The calculation was made using the software Vector NTI Suite
9 from Informax (Invitrogen, CA, USA) and resulted in a pI of
6.40.
Example 9
Characterization of Enzymatic Conversion of Lecithin to
Lysolecithin in Egg Yolk at Different Temperatures by a Fusarium
heterosporum CBS 782.83 Lipolytic Enzyme
[0548] Lipolytic enzymes can convert lecithin (phosphatidylcholine)
to lyso-lecithin (lyso-phosphatidylcholine) with release of a free
fatty acid. Enzymatic conversion of lecithin to lyso-lecithin in
egg yolk creates better emulsifying properties because lysolecithin
is a better emulsifier than lecithin. Good emulsifying properties
of egg yolks are of importance when making heat stable mayonnaise
and other foods and food applications, such as, but not limited to,
cakes and maturation of cheese.
Enzyme Preparation:
[0549] A lipolytic enzyme from Fusarium heterosporum, CBS 782.83,
expressed in Hansenula polymorpha from fermentation HET0420 was
spray dried on wheat starch. The resulting enzyme preparation had a
phospholipase activity of 1265 U/g, determined by TIPU assay
previously described herein. A 10% (w/v) or 20% (w/v) enzyme stock
solution was prepared by dissolving the spray dried enzyme powder
in demineralised water. After 15 minutes of stirring, the solution
was centrifuged for five minutes at 1370.times.g. The supernatant
was used as the enzyme stock solution.
Enzymation:
[0550] Two different experiments were set up to determine the
optimal combination of enzyme dosage, reaction temperature and time
for the enzymatic conversion of lecithin to lyso-lecithin in egg
yolk. In the first, enzymation was carried out with a lipolytic
enzyme according to the present invention at the three following
temperatures: 30.degree. C., 40.degree. C. and 50.degree. C., each
with the four following dosages: 5 U/g egg yolk, 10 U/g egg yolk,
20 U/g egg yolk and 30 U/g egg yolk.
[0551] In the second experiment, enzymation was carried out for a
lipolytic enzyme according to the present invention and with
Lecitase.RTM. Ultra from Novozymes A/S (Denmark), respectively, at
the following five temperatures: 5.degree. C., 10.degree. C.,
15.degree. C., 20.degree. C., and 53.degree. C. with an enzyme
dosage of 30 U/g egg yolk. At 53.degree. C. the enzyme dosage of 60
U/g egg yolk was also tested.
[0552] In both experiments, 10.0 g pasteurised egg yolk from DanAEg
(Christiansfeld, Denmark) was transferred to a Wheaton tube and
placed in a heating block thermostatted to the appropriate
temperature. The samples were continuously mixed on a magnetic
stirrer. At time t=0 enzyme stock solution was added to the egg
yolk according to Table 16. Each experiment was made in duplicate.
1.0 g samples were taken from the egg yolk/enzyme solutions
according to Table 17. After incubation times according to Table
17, the enzymatic reaction in the samples was stopped by adding 7.5
ml organic solvent (CHCl.sub.3:MeOH, 2:1). TABLE-US-00026 TABLE 16
Enzyme stock solution was added to egg yolk to obtain different
enzyme dosages, including a control. Demineralised water was added
to a total of 2.35 ml to disregard any difference in volume upon
addition of different volumes of enzyme stock solution. Volume
enzyme Enzyme stock Volume Amount Enzyme activity of solution dem.
H.sub.2O Sample egg yolk activity stock solution added added
Control 10.0 g 0 U -- 0 ml 2.35 ml 10.0 g 50 U 127 U/ml 0.40 ml
1.95 ml Lipolytic 10.0 g 100 U 127 U/ml 0.80 ml 1.55 ml enzyme 10.0
g 200 U 127 U/ml 1.60 ml 0.75 ml 10.0 g 300 U 127 U/ml 2.35 ml 0 ml
10.0 g 600 U 253 U/ml 2.35 ml 0 ml Lecitase .RTM. 10.0 g 300 U 3620
U/ml 83 .mu.l 2.25 ml Ultra 10.0 g 300 U 3620 U/ml 165 .mu.l 2.20
ml
[0553] TABLE-US-00027 TABLE 17 Reaction times at sample extraction
in the different experiments. Reaction temper- Enzyme ature dosage
Reaction time (min) 5.degree. C., 30 U/g 60 120 240 360 480 1440 --
10.degree. C., 15.degree. C., 20.degree. C. 30.degree. C. 5, 10, 20
30 60 120 240 360 -- -- and 30 U/g 40.degree. C. 5, 10, 20 30 60
120 240 360 -- -- and 30 U/g 50.degree. C. 5, 10, 20 30 60 120 240
360 -- -- and 30 U/g 53.degree. C. 30 U/g 15 30 60 90 120 240 --
53.degree. C. 60 U/g 15 30 60 90 120 240 330
Lipid Extraction:
[0554] Addition of 7.5 ml organic solvent (CHCl.sub.3:MeOH, 2:1) to
the sample not only stopped the enzyme reaction but also extracted
the lipids. Furthermore, 0.2 ml demineralised H.sub.2O was added to
the sample before it was dispersed, using a Whirley mixer for 1
minute. The sample was then centrifuged for ten minutes at
110.times.g. Approximately 3 ml of the organic phase was
transferred to another tube and this extracted lipid was used for
various analyses. The samples were stored at -18.degree. C.
Determination of Free Fatty Acids:
[0555] 100 .mu.l of the extracted lipid solution was evaporated
under nitrogen at 50.degree. C. 1.0 ml demineralised H.sub.2O was
added and the lipid was dispersed using a Whirley mixer. The amount
of free fatty acid was determined using the NEFA C kit from WAKO
Chemicals GmbH (Neuss, Germany). Colour reagent A and B were made
according to manufacturers protocol. 10 .mu.l redispersed extracted
lipid and 100 .mu.l solution A were pippetted to a microtiter
plate. The plate was incubated at 37.degree. C. for 15 minutes. 200
.mu.l solution B was added to the microtiter plate, and the plate
was incubated at 37.degree. C. for 10 minutes. The optical density
at 540 nm was measured. The amount of free fatty acid was
determined, using the read absorbance and a standard curve based on
oleic acid.
Determination of Lecithin and Lyso-Lecithin by LC/MS-MS:
Materials
[0556] Acetone, methanol, chloroform were all from Lab Scan,
Dublin, Ireland, ethanol 96% was from De Danske Spritfabrikker, and
formic acid was from AppliChem, Darmstadt, Germany.
Instrumentals
[0557] The HPLC system consisted of a quarternary pump (G1311A), a
capillary pump (G1376A), an autosampler (G1377A), and a column
compartment (G1316A) all from Agilent Technologies (Waldbronn,
Germany). An Acurate.TM. flowsplitter (ACM-CU-CR) from LC Packings
(Amsterdam, Netherlands) was used to split the column effluent to
the mass spectrometer and to introduce polar make-up solvent. The
mass spectrometer was an LCQ Deca Ion Trap from Thermo Finnigan
(San Jose, Calif., USA).
[0558] The column was a Hypersil SI, 100.times.4.6 mm id, 5 .mu.m
from Thermo Hypersil-Keystone.
Chromatographic and MS Conditions
Mobile Phases
A: - - - not used
B: Chloroform
C: Methanol/Formic Acid (1000/0,190)
D: Chloroform/Methanol/Water/Formic Acid (300/550/150/0,190)
[0559] Make-up: Ethanol 96% TABLE-US-00028 Flow Time B C D [ml/min]
[min] [%] [%] [%] 0.6 0 40 60 0 0.6 2 0 0 100 0.6 8 0 0 100 0.6 9
40 60 0 0.6 16 40 60 0
[0560] The injection volume was 5 .mu.l and the column temperature
was 45.degree. C. TABLE-US-00029 Flow splitter ##STR3## LC-flow:
0.60 ml/min Make-up flow: 100 .mu.l/min ELSD/FC tubing: 100 cm
.times. 0.100 mm id (SS) MS tubing: 100 cm .times. 150 .mu.m
(FS-150-MS) Approximate split is 20:1
[0561] TABLE-US-00030 MS conditions MS parameter settings:
Parameter Value Capillary temp [.degree. C.] 325 Sheath gas flow 70
Auxiliary gas flow 4 Source ESI Polarity Positive Source voltage
[kV] 6.0 SIM micro Scans 5 SIM Max Ion Time [ms] 200
[0562] TABLE-US-00031 MS detector setting: Parameter Value Duration
[min] 15 Tune method LPC_544_SIM_00.LCQTune Scan Event 1 - SIM
Ranges Mass Interval LPC (16:0) - H.sup.+ 494.0-498.0 LPC (18:2) -
H.sup.+ 517.0-527.0; 541.0-549.0 PC (34:2) - H.sup.+ 778.0-786.0 PC
(36:4) - H.sup.+ 801.0-813.0
Standard and Sample Preparation
[0563] Lyso-phosphatidylcholine (LPC) (Egg, chicken) (89865) and
phosphatidylcholin (PC) (plant) (441601) were from Avanti Polar
Lipids, Inc, Alabaster, Ala., USA. A stock solution of PC and LPC
(10 mg/20 ml CHCl.sub.3/MeOH) was prepared. Dilutions hereof were
prepared to cover the concentrations from 50 .mu.g/ml to 2.5
.mu.g/ml.
[0564] 7.5 .mu.l lipid extract from 1 g of egg yolk was
reconstituted in 1.5 ml CHCl.sub.3:MeOH (1:1).
TLC Analysis:
[0565] The TLC analysis was carried out as described in Example
1.
[0566] For visualisation of the different glycerides, 2 .mu.l lipid
extract was applied in 3 mm bands to a HPTLC silica 60 plate
(Merck) by an automatic TLC sampler 4 (CAMAG). The silica plate was
placed in a horizontal developing chamber (CAMAG) with running
buffer I (P-ether:methyl tertiary butyl ether:acetic acid
(50:50:1)). 20 ml running buffer was used for the gas phase and 5
ml for the through and the plate was eluted until approx. 5 cm from
the application position. The plate was dried in a heating cupboard
(160.degree. C.) for 5 minutes. Finally, the TLC plate was immersed
in the developing reagent (6% Cu(CH.sub.3COO).sub.2 in 16% aqueous
H.sub.3PO.sub.4) and carbonised in a heating cupboard (160.degree.
C.) for 10 minutes.
Results
[0567] To determine the optimal combination of enzyme dosage,
reaction temperature and time for the enzymatic conversion of
lecithin to lyso-lecithin in egg yolk four different enzyme dosages
were tested at three different temperatures and five different
reaction times.
[0568] The four enzyme dosages used, 5 U/g, 10 U/g, 20 U/g, and 30
U/g, as well as the reaction times used, 30 minutes, 60 minutes,
120 minutes, 240 minutes, and 360 minutes, were based on initial
trials not covered herein. The three temperatures, 30.degree. C.,
40.degree. C., and 50.degree. C., were chosen based on the
temperature optimum curve for the lipolytic enzyme, see FIG.
20.
[0569] The amount of lecithin and lyso-lecithin in enzyme modified
egg yolk was analyzed by HPLC and depicted in FIG. 21 and FIG. 22
as a function of reaction time. In FIG. 23, the amount of free
fatty acid in enzyme modified egg yolk is depicted as a function of
reaction time.
[0570] The experiment shows that conversion of lecithin to
lyso-lecithin by a lipolytic enzyme according to the present
invention was optimal using 20 U/g egg yolk of the lipolytic enzyme
at 30.degree. C. for 120 minutes. The dosage of 20 U/g egg yolk is
chosen due to an observed decrease in LPC levels at 30 U/g egg yolk
from 120 minutes of reaction to 240 minutes of reaction.
[0571] Based on this result, it was examined whether the lipolytic
enzyme according to the present invention and Lecitase.RTM. Ultra
have an effect on egg yolk lipids at temperatures lower than
30.degree. C. and to compare their activities at 53.degree. C.,
which is the temperature currently used industrially for
Lecitase.RTM. Ultra.
[0572] The enzymatic conversion of lecithin to lyso-lecithin in egg
yolk was tested at five different temperatures (5.degree. C.,
10.degree. C., 15.degree. C., 20.degree. C., and 53.degree. C.) and
six different reaction times. An enzyme dosage of 30 U/g egg yolk
was tested because this would be the highest dosage of commercial
interest due to cost of the enzyme and because reaction rates were
expected to be low at the temperatures tested. All enzyme units
mentioned have been determined by TIPU. 30 U/g egg yolk is also the
recommended dosage of Lecitase.RTM. Ultra. In addition, a dosage of
60 U/g egg yolk was tested at 53.degree. C. The reaction times used
were 60 minutes, 120 minutes, 240 minutes, and 360 minutes, 480
minutes and 1440 minutes. However, at 53.degree. C. the reaction
times were 15 minutes, 30 minutes, 60 minutes, and 90 minutes, 120
minutes and 240 minutes. At 53.degree. C. using 60 U/g a sample was
also taken at 330 minutes of reaction.
[0573] In FIGS. 24 and 25 the amount of lyso-lecithin, free fatty
acid, and lecithin in enzyme-modified egg yolk is depicted as a
function of reaction time using the lipolytic enzyme according to
the present invention and Lecitase.RTM. Ultra phospholipases,
respectively. The lecithin and lyso-lecithin contents of the
samples were determined by LC-MS and the free fatty acid content
was determined by the NEFA C method. The amount of FFA in the
control samples (results not shown) and the sum of lyso-lecithin
and lecithin remained constant during the experiments shown in
FIGS. 24 and 25.
[0574] FIG. 24 shows the results of enzymation of egg yolk with the
lipolytic enzyme according to the present invention. At 53.degree.
C. the activity of the lipolytic enzyme ceased after 30 minutes of
reaction reaching a level of LPC of 1.7% (w/w) with 30 U/g egg yolk
(FIG. 24b). The levels of FFA were 1.0% (w/w) and 1.3% (w/w) with
30 U/g egg yolk and 60 U/g egg yolk, respectively. Using
Lecitase.RTM. Ultra, the amounts of LPC and FFA increased during
the period 15-240 minutes (FIG. 19), yielding 2.7% LPC (w/w) after
240 minutes of reaction with 30 U/g egg yolk. The levels of FFA
were 1.4% (w/w) and 2.1% (w/w) after 240 minutes of reaction using
30 and 60 U/g egg yolk, respectively. The activity of Lecitase.RTM.
Ultra ceased after 330 minutes of reaction using 60 U/g egg yolk.
The lipolytic enzyme of the present invention had a higher initial
reaction rate than Lecitase.RTM. Ultra.
[0575] At 20.degree. C. and 53.degree. C. the initial reaction
rates were similar with the lipolytic enzyme of the present
invention (FIG. 24). At temperatures 5-20.degree. C. the amount of
LPC and FFA increased during the experiment. Although at
temperatures below 20.degree. C. the initial velocity decreased
markedly with decreasing temperatures. At 20.degree. C. a LPC level
of 3.3% (w/w) and a FFA level of 1.6% (w/w) was reached after 60
minutes of reaction with 30 U/g egg yolk. This level was similar to
240 minutes of reaction at 53.degree. C. with Lecitase.RTM. Ultra.
It was not possible to resuspend the solvent-free lipid extract for
FFA analysis after 1440 of reaction at 20.degree. C. After 1440
minutes at 5.degree. C. and 10.degree. C. the samples with the
lipolytic enzyme had a high viscosity which made stirring
impossible. This was most likely due to crystallisation of FFA. The
decrease in LPC levels which was seen in TN 6642 at 30 U/g egg
yolk, 30.degree. C. from 120 to 240 minutes of reaction was not
observed in any of these experiments.
[0576] Enzymation of egg yolk with Lecitase.RTM. Ultra
phospholipase gives significantly decreasing initial velocities at
20.degree. C. and temperatures below compared to the initial
velocity of Lecitase.RTM. Ultra at 53.degree. C. (FIG. 25). At
20.degree. C. a LPC level of 3.0% (w/w) and a FFA level of 1.5%
(w/w) was reached after 1440 minutes of reaction with 30 U/g egg
yolk. This level was similar to 240 minutes of reaction at
53.degree. C.
[0577] FIG. 26 shows TLC analysis of extracted lipid from enzyme
modified egg yolk. This analysis confirmed the results from LC-MS
and showed that the lipolytic enzyme according to the present
invention and Lecitase.RTM. Ultra phospholipase increased the
amount of lyso-lecithin.
[0578] The enzymatic reaction, which is catalysed by lipolytic
enzymes, produces equivalent amounts of lyso-lecithin and free
fatty acids. A possible and unwanted side reaction is hydrolysis of
triacylglycerides. The relation between change in amount of
lyso-lecithin and free fatty acids during the enzymatic reaction is
shown in FIG. 27.
[0579] With Lecitase.RTM. Ultra there is a good correlation of
equivalent formation of lyso-lecithin and free fatty acids (FIG.
27). However, in most samples treated with Lecitase.RTM. Ultra
there was very little reaction. Enzymation of egg yolk with the
lipolytic enzyme of the present invention results in production of
more than one free fatty acid per lyso-lecithin formed at
lyso-lecithin levels above 40 mM and free fatty acid levels above
60 mM. The maximal conversion with Lecitase.RTM. Ultra is 30 mM
lyso-lecithin and 25 mM free fatty acid. Samples with a free fatty
acid to lyso-lecithin ratio below 0.8 or above 1.2 (n/n) and LPC
content above 1.0% (w/w) are shown in table 18. TABLE-US-00032
TABLE 18 Samples with free fatty acid (FFA) to lyso-lecithin (LPC)
ratios below 0.8 or above 1.2 (n/n) and LPC content above 1% (w/w).
The samples were treated with lipolytic enzyme or Lecitase .RTM.
Ultra. FFA was determined by the NEFA C method. LPC and PC was
determined by LC-MS. % Temp. Reaction .DELTA.FFA/.DELTA.LPC % LPC
FFA % PC Enzyme (.degree. C.) time (min) (n/n) (w/w) (w/w) (w/w)
Lipolytic 5 1440 1.99 3.0 2.9 2.0 enzyme Lipolytic 10 480 1.97 2.3
2.3 2.5 enzyme Lipolytic 15 480 1.48 4.1 3.5 0.6 enzyme Lipolytic
15 360 1.64 3.6 3.4 1.0 enzyme Lipolytic 15 1440 1.98 4.2 4.7 0.1
enzyme Lipolytic 20 60 0.67 3.3 1.6 2.0 enzyme Lipolytic 20 360
1.30 4.7 3.6 0.3 enzyme Lipolytic 20 480 1.43 5.0 4.1 0.3 enzyme
Lecitase .RTM. 20 1440 0.72 3.0 1.5 2.0 Ultra Lipolytic 53 15 0.69
1.5 0.9 3.7 enzyme Lipolytic 53 60 0.70 1.7 1.0 2.6 enzyme
Lipolytic 53 90 0.71 1.8 1.0 2.7 enzyme Lipolytic 53 240 0.72 1.7
1.0 2.8 enzyme Lipolytic 53 30 0.72 1.8 1.0 3.0 enzyme Lecitase
.RTM. 53 120 0.61 2.4 1.1 2.3 Ultra Lecitase .RTM. 53 60 0.62 1.6
0.9 2.9 Ultra
[0580] Samples with a free fatty acid to lyso-lecithin ratio above
1.2 (n/n) and LPC content above 1.0% (w/w) (FIG. 27) are generally
seen at prolonged reaction times or in samples containing less than
1.0% PC (w/w). The lipolytic enzyme sample at 15.degree. C. has
elevated free fatty acid to lyso-lecithin ratios in all samples.
This indicates that the enzymes change substrate specificity at
prolonged reaction times or when the content of PC is low. This
could be due to hydrolysis of phosphatidylethanolamine,
digalactosyl diacylglyceride, or triacylglycerides that are found
in egg yolk. Samples with a free fatty acid to lyso-lecithin ratio
below 0.8 (n/n) and LPC content above 1.0% (w/w) are generally seen
at a reaction temperature of 53.degree. C. (Table 18). This could
be explained by interesterifications.
[0581] FIG. 28 shows that the lipolytic enzyme of the present
invention does have hydrolytic activity on triacylglycerides and
1,3 diacylglycerides at prolonged reaction times or low
concentrations of PC. The accumulation of 1,2 diacylglycerides
shows that the lipase activity is 1,3-specific. The formation of
monoglycerides shows that Lecitase.RTM. Ultra had a hydrolytical
effect on tri- or diacylglycerides at 20.degree. C. It is not
possible to determine whether the lipolytic enzyme of the present
invention or Lecitase.RTM. Ultra phospholipase has the highest
degree of hydrolysis of triacylglycerides because the levels of
formation of LPC differ significantly. Lowering the enzyme dosage
and reaction time of lipolytic enzyme could reduce the hydrolysis.
Table 18A shows the reaction time, temperature and dosage applied
to the subjects of lanes 1-30 in FIG. 28. TABLE-US-00033 TABLE 18A
Lane number 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
Enzyme* B K K L B K K L B K K B K K K K L L L L B Reaction time (h)
8 24 24 8 24 24 8 24 4 6 8 24 4 6 8 24 Temperature (.degree. C.) 5
5 5 5 10 10 10 10 15 15 15 20 20 20 20 20 20 20 20 20 53 Dosage
(U/g) 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30
30 Lane number 22 23 24 25 26 27 28 29 30 Enzyme* K K K L L L B K L
Chol. PC LPC MG.DG FFA Mix Reaction time (h) 1 2 4 1 2 4 4 4
Temperature (.degree. C.) 53 53 53 53 53 53 53 53 53 Dosage (U/g)
30 30 30 30 30 30 60 60 60 *B: Blank, K: Lipolytic protein
according to the present invention, L: Lecitase .RTM. Ultra
phospholipase
[0582] It will be apparent to the skilled person that, using
routine experimentation, optimisation of enzyme dosage, reaction
temperature and reaction time may be readily determined for any
given food application.
Conclusion
[0583] Enzymation of egg yolk from DanAEg A/S of a lipolytic enzyme
according to the present invention and Lecitase.RTM. Ultra
phospholipases was carried out to determine the conversion of
lecithin to lyso-lecithin. This was done using an enzyme dosage 30
U/g egg yolk at five temperatures (5-20.degree. C., and 53.degree.
C.), and six different reaction times (60-1440 minutes, however at
53.degree. C., 15-240 min) was carried out to examine the enzyme
activity. 53.degree. C. is the temperature currently used in the
industry for modifying egg yolk with Lecitase.RTM. Ultra.
[0584] The lipolytic enzyme according to the present invention had
a higher initial reaction rate than Lecitase.RTM. Ultra at all
temperatures tested. At 53.degree. C. reaction with lipolytic
enzyme ceased after only 30 minutes of reaction. At a dosage of 30
U/g egg yolk at 53.degree. C. the LPC level was 1.7 and 2.7% (w/w)
with lipolytic enzyme and Lecitase.RTM. Ultra, respectively. A
level of 3.3% (w/w) LPC was reached after only 60 minutes of
reaction at 20.degree. C. with lipolytic enzyme.
[0585] At low temperatures (5-20.degree. C.) the conversion of
lecithin to lyso-lecithin with lipolytic enzyme was significantly
better than with Lecitase.RTM. Ultra. The reaction velocity of the
lipolytic enzyme was markedly lower at 10.degree. C. and below
compared to at 15.degree. C. and above. The lipolytic enzyme was
active at 5.degree. C. and formation of more than 2% (w/w)
lyso-lecithin was detectable after 24 hours of reaction. Also, the
samples with the lipolytic enzyme were more viscous at 10.degree.
C. and below compared to higher temperatures.
[0586] The lipolytic enzyme was found to change substrate
specificity and hydrolyse phosphatidyl-ethanolamine, digalactosyl
diacylglyceride, or triacylglycerides in addition to phospholipids
at prolonged reaction times or when the content of PC is low. This
may be avoided by using a lower enzyme dosage and shorter reaction
times and substantiates the need for thorough optimization of
conditions of treatment for each product in question. At 53.degree.
C. interesterifications can explain that less than one equivalent
free fatty acid per lyso-lecithin is produced with lipolytic enzyme
and Lecitase.RTM. Ultra.
[0587] In conclusion, the lipolytic enzyme according to the present
invention is a potential candidate for enzymation of egg yolk at
low temperatures. The observed activity at low temperatures is also
of interest in other applications.
Example 10
Production of Mayonnaise by Use of a Fusarium heterosporum CBS
782.83 Lipolytic Enzyme
Production of Mayonnaise:
[0588] 6.25 g lipolytic enzyme prepared as described in Example 4
was dissolved in 50 mL demineralised H.sub.2O corresponding to a
phospholipase activity of 150 U/mL. After 15 minutes of stirring,
the solution was centrifuged for five minutes at 1370.times.g. The
supernatant was used for enzymation of 150 g egg yolk from Sanofa
A/S according to Table 19. Another 150 g egg yolk from Sanofa A/S
was treated with Lecitase.RTM. Ultra (Novozymes A/S, Denmark)
according to Table. The enzymations were carried out at 30.degree.
C. for 180 minutes with slow agitation. Lipid extraction was
carried out as described in Example 4. TABLE-US-00034 TABLE 19
Enzymation of egg yolk from Sanofa A/S using lipolytic enzyme
according to the present invention and Lecitase .RTM. Ultra,
respectively. The lipolytic enzyme solution used had an activity of
150 U/mL, and the Lecitase .RTM. Ultra had a phospholipase activity
of 34500 U/mL. Lipolytic Lecitase .RTM. Dem Amount enzyme Ultra
H.sub.2O U/g egg Sample egg yolk added added added yolk Control 150
g 30.0 mL 0 Lipolytic 150 g 30.0 mL 30 enzyme Lecitase .RTM. 150 g
0.13 mL 29.9 mL 30 Ultra
[0589] Mayonnaise with enzyme-modified egg yolk from Sanofa A/S was
produced using a Koruma mixer (Disho V60/10). During processing the
mayonnaise was heated to 95.degree. C. for five minutes.
TABLE-US-00035 TABLE 20 Ingredients used to produce mayonnaise.
Mayonnaise Mayonnaise Mayonnaise Ingredient Control Lipolytic
enzyme Lecitase .RTM. Ultra Water 34.5% 34.5% 34.5% Oil 50.0% 50.0%
50.0% Salt 1.0% 1.0% 1.0% Sugar 3.0% 3.0% 3.0% Potassium Sorbate
0.1% 0.1% 0.1% Grindsted FF 1102 1.7% 1.7% 1.7% Egg yolk 1 4.23%
Egg yolk 2 4.23% Egg yolk 3 4.23% Vinegar 10% 4.00% 4.00% 4.00%
Mustard 1.50% 1.50% 1.50% Sum 100% 100% 100%
TLC-Analysis:
[0590] TLC analysis was carried out as described above.
Particle Size Determination in Mayonnaise:
[0591] 2.0 g mayonnaise sample was dissolved in 22.5 g 0.2% SDS and
stirred for minimum 30 minutes at 300 rpm. The particle size
distribution was then measured on a Malvern Mastersizer.
Results
[0592] For production of mayonnaise with enzyme-modified egg yolk,
egg yolk from Sanofa A/S was used. This egg yolk contained 8% salt
(compared to 0% in egg yolk from DanAEg). Initial trials (not
shown) showed that the higher salt concentration in egg yolk from
Sanofa A/S influenced the lipolytic activity and, therefore, an
enzyme dosage of 30 U/g was used instead of 20 U/g.
[0593] TLC analysis of extracted lipid from enzyme modified egg
yolk from Sanofa A/S (FIG. 29) showed that the lipolytic enzyme
according to the present invention reduced the amount of lecithin
concurrent with increasing the amount of lyso-lecithin (FIG. 29).
In comparison, the conversion of lecithin to lyso-lecithin when
using Lecitase.RTM. Ultra was negligible. The high conversion of
lecithin to lyso-lecithin shown by TLC correlated well with the
free fatty acid determination made on extracted lipid from enzyme
modified egg yolk from Sanofa A/S (Table 21). The amount of free
fatty acid liberated using lipolytic enzyme was 3.5 times higher
than the amount of free fatty acid liberated using Lecitase.RTM.
Ultra. TABLE-US-00036 TABLE 21 Amount of free fatty acid in enzyme
modified egg yolk from Sanofa A/S. The amount of free fatty acid
was analysed by the NEFA C method and is expressed as percentage of
egg yolk. Sample Free fatty acid (% (w/w)) Control 0.39 Lipolytic
enzyme 2.4 Lecitase .RTM. Ultra 0.68
[0594] The size distribution of oil droplets in mayonnaise was
analysed in order to evaluate the emulsification properties of the
differently enzyme-modified egg yolk from Sanofa A/S. As can be
seen in, the mayonnaise produced with egg yolk treated with the
lipolytic enzyme according to the present invention had the
smallest mean particle size as well as the narrowest particle size
distribution compared to mayonnaise produced with either
Lecitase.RTM. Ultra treated egg yolk or non-treated egg yolk. A
small mean particle size as well as a narrow particle size
distribution indicates good emulsification properties, hence the
egg yolk modified with lipolytic enzyme had the best emulsification
properties. TABLE-US-00037 TABLE 22 Particle size distribution in
mayonnaise made with enzyme modified egg yolk from Sanofa A/S. Mean
particle 10% quantile 90% quantile Sample size (.mu.m) (.mu.m)
(.mu.m) Control 13.7 2.0 21.5 Lipolytic enzyme 4.4 1.2 7.3 Lecitase
.RTM. Ultra 13.3 1.8 21.9
[0595] To evaluate the heat stability of emulsions made with enzyme
modified egg yolk from Sanofa A/S, the mayonnaises were heated in a
microwave oven for 4 seconds. As can be seen in FIG. 30, the
mayonnaises containing enzyme-modified egg yolk produced heat
stable emulsions, whereas the control containing non-treated egg
yolk separated upon the heat treatment in the microwave oven and
the emulsion was therefore not heat stable.
Conclusion
[0596] Results from TLC analysis and free fatty acid determination
of enzyme modified egg yolk from Sanofa A/S, and particle size
distribution and heat stability test of the mayonnaises produced
with the enzyme modified egg yolk from Sanofa A/S correlated well.
Egg yolk modified using a lipolytic enzyme according to the present
invention had the highest conversion rate of lecithin to
lyso-lecithin and the highest amount of free fatty acid. As
expected, this change in the lecithin:lyso-lecithin ratio resulted
in a mayonnaise, which was heat stable and had the most optimal
particle size distribution.
[0597] Using Lecitase.RTM. Ultra to modify egg yolk from Sanofa A/S
did not result in a very large change in the lecithin:lyso-lecithin
ratio or a high amount of free fatty acids. This less pronounced
conversion of lecithin to lyso-lecithin was reflected in the
particle size distribution of the mayonnaise, which was similar to
that of the non-modified egg yolk. The change in
lecithin:lyso-lecithin ratio that occurred using Lecitase.RTM.
Ultra was enough, though, to make the mayonnaise heat stable.
[0598] Egg yolk from Sanofa A/S modified with 30 U/g of lipolytic
enzyme at 30.degree. C. for 120 minutes showed a high conversion
rate of lecithin to lyso-lecithin, and the mayonnaise produced with
this egg yolk was heat stable and had an optimal particle size
distribution. In comparison, egg yolk from Sanofa A/S treated with
30 U/g Lecitase.RTM. Ultra at 30.degree. C. for 120 minutes showed
only a minor change in the lecithin:lysolecithin ratio, and the
mayonnaise produced had a particle size distribution similar to
mayonnaise with non-treated egg yolk, but it was in fact heat
stable. Hence the lipolytic enzyme according to the present
invention was superior to Lecitase.RTM. Ultra in the production of
mayonnaise.
Example 11
Application Test of a Lipolytic Enzyme Derived from Fusarium
heterosporum in Combination with Emulsifier for Preparation of Hard
Crusty Rolls
[0599] In this test ferments of lipolytic enzyme according to the
present invention and derived from Fusarium heterosporum was used
alone or in combination with Panodan.RTM. A2020 DATEM and
GRINDSTED.RTM. SSL P55, both emulsifiers from Danisco A/S, for the
baking of hard crusty rolls. The effect on specific bread volume
was compared to the effect of Lipopan F.TM. from Novozymes alone or
in combination with emulsifier on specific bread volume.
Application
[0600] Hard crusty rolls were baked using the following recipe and
baking procedure. TABLE-US-00038 Bakers Baking recipe Amount % of
flour Flour-Danish Reform 2004002 2000 g 100 Water 1140 g 57
Compressed yeast 120 g 6 Salt 32 g 1.6 Sugar 32 g 1.6 Ascorbic acid
0 ppm 0 Standard alpha amylase/GRINDAMYL .TM. A 75 ppm 0.150 1000
from Danisco A/S
Baking Procedure Diosna Mixer System [0601] 1. Dry mix for 1 min
slow [0602] 2. Mix 2 min slow+4 min fast [0603] 3. Dough
temperature: 26.degree. C. [0604] 4. Scaling of the dough: 1350 g
[0605] 5. Resting: 10 min. at 30.degree. C. in heating cabinet
[0606] 6. Moulding: Fortuna 3/17/7 molder [0607] 7. Proofing: 45
min. at 34.degree. C., 85% RH. [0608] 8. Baking in a Bago oven: 13
min. at 220.degree. C., 13 sec. steam+5 min damper open [0609] 9.
MIWE stone deck: prog. nr 1 [0610] 10. After baking the rolls are
cooled for 25 min before weighing. The volume of the rolls was
measured by the rape seed displacement method. Specific Bread
Volume:
[0611] Specific volume=Volume of the bread, ccm/weight of the
bread, g
[0612] Addition of spray dried lipolytic enzyme is based on flour.
The enzyme is added to flour after first mixing together with
water, ascorbic acid and compressed yeast. All other dry
ingredients are mixed in step 1.
Results
[0613] Spray dried lipolytic enzyme derived from Fusarium
heterosporum is used in combination with Panodan.RTM. M2020 DATEM
from Danisco A/S and tested against a combination of Lipopan
F.TM./DATEM as well as pure Lipopan F.TM. or pure DATEM. The
results are shown in Table 23 and FIG. 31. TABLE-US-00039 TABLE 23
Sample Amount Specific volume, g/ccm Control 5.89 Lipopan F .TM. 10
ppm 5.98 30 ppm 7.54 40 ppm 8.18 Lipolytic enzyme 96 ppm 6.07 191
ppm 6.2 287 ppm 7.06 383 ppm 8.13 478 ppm 8.01 PAN M2020 0.3% 7.89
0.15% 6.5 PAN M2020 + Lipolytic 0.15% 7.68 enzyme 96 ppm PAN M2020
+ Lipolytic 0.15% 8.29 enzyme 191 ppm PAN M2020 + Lipopan 0.15%
7.69 F .TM. 10 ppm
[0614] Freeze dried lipolytic enzyme derived from Fusarium
heterosporum was used in combination with Panodan.RTM. A2020 DATEM
and GRINDSTED.RTM. SSL P55 and tested against a combination of
Lipopan F.TM./SSL or Lipopan F.TM.M/DATEM as well as pure Lipopan
F.TM., pure DATEM and pure SSL.
[0615] The results are shown in Table 24 and FIG. 32 TABLE-US-00040
TABLE 24 Sample Amount Specific volume, g/ccm Control 5.98 0.3%
Panodan .RTM. A2020 0.3% 7.98 0.3% SSL P 55 0.3% 7.78 Lipopan F
.TM. 15 ppm 6.42 40 ppm 7.77 Lipopan F .TM. + 0.15% 15 ppm 8.44
Panodan .RTM. A2020 0.15% Lipopan F .TM. + 0.15% 15 ppm 8.62 SSL P
55 0.15% Lipolytic enzyme 43 ppm 5.93 86 ppm 6.43 Lipolytic enzyme
+ 0.15% 30 ppm 7.86 Panodan .RTM. A2020 0.15% Lipolytic enzyme +
0.15% 43 ppm 7.86 Panodan .RTM. A2020 0.15% Lipolytic enzyme +
GRINDSTED .RTM. 43 ppm 8.1 SSL P55 0.15%
Conclusion
[0616] The conclusion of Table 23 and FIG. 31 is that an optimal
dosage of spray dried lipolytic enzyme according to the present
invention is approximately 383 ppm lipolytic enzyme and that the
product can be used in a low dosage in combination with a low
dosage of the DATEM emulsifier. In a parallel experiment it was
shown that at dosages from 574 ppm to 1912 ppm lipolytic enzyme the
specific bread volume decreased (data not shown). The performance
of 383 ppm lipolytic enzyme according to the present invention is
similar to 40 ppm Lipopan F.TM.. When used in combination with
emulsifier the lipolytic enzyme according to the present invention
also performs on level with Lipopan F.TM.. According to
determination of phospholipase activity using the TIPU assay
described previously herein, 10 ppm Lipopan F.TM. is approx. 120
TIPU per kg flour and 96 ppm lipolytic enzyme of the present
invention correspond to 117 TIPU per kg flour.
[0617] In addition, based on the trial results of Table 24 and FIG.
32, we conclude that a lipolytic enzyme according to the present
invention can be used in combination with SSL as well as DATEM and
thereby boost the effect of a low emulsifier level. The
functionality of lipolytic enzyme according to the present
invention can be compared to the functionality of Lipopan F.TM.
when dosed equally. Again the optimal level of phospholipase
activity in combination with an emulsifier is determined to be
approx. 100-150 TIPU per kg flour.
[0618] Conclusively, an optimal dosage of the pure lipolytic enzyme
according to the present invention is around 500 TIPU per kg flour
and in combination with emulsifier the level of lipolytic enzyme
should be 1/5 to 1/4 of the optimal level of lipolytic enzyme,
meaning approx. 120 TIPU per kg flour.
Example 12
Application Test of a Lipolytic Enzyme Derived from Fusarium
heterosporum for Preparation of Wheat Tortilla
[0619] The effect of a lipolytic enzyme according to the present
invention and derived from Fusarium heterosporum on rollability of
wheat tortilla made with fumaric acid (US procedure) has been
tested as explained in the following example.
[0620] Wheat tortilla was baked using the ingredients in Table 25:
TABLE-US-00041 TABLE 25 Recipe for preparation of wheat tortilla.
Dosage Recipe: Type: (% of flour) Grams Flour Classic (no. 100 3000
2004068) Sugar 1.0 30 Fat (shortening, margarine, oil) Shortening
8.7 267 Salt 1.5 45 Potassium sorbate 0.3 9 Ca-propionate 0.3 9
Sodium bicarbonate 0.9 27 Acid Fumaric 0.8 24 Water 48 144
[0621] The procedure for making the wheat tortilla dough: [0622] 1.
Desired dough temperature: 32.degree. C. [0623] 2. Kneading is
conducted at ambient temperature in a Kemper mixer. [0624] 3. Place
all dry ingredients in mixer bowl (optionally including lipolytic
enzymes and/or emulsifiers). [0625] 4. Dry mix for 1 min. [0626] 5.
Add Water [0627] 6. Mixing: 11 min at speed 1 [0628] 7. Scaling:
1350 g.times.3 [0629] 8. Shaping: into dough balls on glimek
divider/rounder [0630] 9. Resting for 10 min at 32.degree. C.
[0631] 10. Baking: in a tortilla oven CFO 40, with the following
setting: Top: 230.degree. C., middle: 228.degree. C. and bottom:
160.degree. C. [0632] 11. Cooling: 12 min at 20.degree. C., 80%
RH
[0633] A lipolytic enzyme according to the present invention was
added to the dough at increasing concentrations (Trial no. 3-7).
For comparison, a control (Trial no. 1) and a trial with the
Panodan.RTM. 205 emulsifier from Danisco A/S (Trial no. 2) were
included. See Table 26.
[0634] The lipolytic enzyme, Panodan.RTM. 205, and L-cystein, when
added, are added to the first mixing process (steps 3 and 4 above).
L-cystein may be added to increase the extensibility of the dough
made and thereby improve the pressing process of the dough before
baking. TABLE-US-00042 TABLE 26 Trial set-up Ingredients PANODAN
.RTM. L'cystein Trial no. Lipolytic enzyme 205 (ppm) 1 10 2 1.03%
10 3 100 ppm 10 4 200 ppm 10 5 400 ppm 10 6 1200 ppm 10 7 2400 ppm
10
[0635] The tortillas are evaluated by means of a cold rollability
test performed at room temperature, where the tortilla is rolled
around different wooden sticks of different diameters, starting
with the wooden stick with the biggest diameter. The rollability is
indicated by the number of wooden sticks around which the tortilla
can be rolled without breaking. The higher the number the better
the rollability. TABLE-US-00043 Visual evaluation Penetration
Sample Rollability Force (g) 1-day 7 2-1-1 432 2-day 7 1-1-1 421
3-day 7 1-1-1 369 4-day 7 2-2-2 439 5-day 7 2-2-1 489 6-day 7 2-1-2
448 7-day 7 2-2-2 533
[0636] From the results we conclude that a dosage of 200 ppm or
more of a lipolytic protein according to the present invention
seems to give an improved rollability compared to the control
system. Using the TIPU assay described previously herein it was
determined that the level of activity needed in order to improve
the rollability (in a dosage of 200 ppm) corresponds to
approximately 650 TIPU units per kg flour. From the results it can
also be concluded that the force for making the penetration test is
increased at a higher level of lipolytic enzyme, meaning that the
resistance of the tortilla is improved. The penetration test is
conducted by use of the texture analyser TAXT2 produced by Stable
Micro System, where the force needed in order to penetrate/break
the tortilla is measured.
[0637] This equipment is set up with the following parameters:
TABLE-US-00044 Force is measured in Compression Pre-test Speed 10
mm/s Test Speed 2 mm/s Post Test Speed 10 mm/s Rupture Test Dist. 1
mm Distance 25 mm Force 1 g Time 5 sec Load Cell 5 kg Temperature
20-22 deg C. (room temperature)
Example 13
Molecular Cloning, Sequence Analysis and Heterologous Expression of
a Synthetic Gene Encoding a Lipolytic Enzyme from Fusarium
semitectum (IBT9507) in Hansenula polymorpha
[0638] A fragment of a F. semitectum lipolytic enzyme gene was
cloned from genomic DNA using PCR with primers designed from
conserved blocks of amino acids within aligned protein sequences of
lipolytic enzymes from different Fusarium strains. The degenerate
PCR primers were designed using the computer programs CODEHOP (Rose
et al. 2003 (Nucleic Acid Res., 18:3763-3766)).
[0639] To clone the ends of the gene the methods for 5'- and
3'-RACE (Frohman et al. 1988 Proc. Natl. Acad. Sci. USA
85:8998-9002) were used. Total RNA was isolated from a culture of
the F. semitectum strain induced with 1% sunflower oil and the
primers used were designed from the sequence of the gene fragment
obtained with the CODEHOP primers.
[0640] The three fragments obtained by the above procedures were
assembled in silico to reveal the full-length cDNA sequence.
Analysis of the 1236 nucleotides long cDNA sequence showed an open
reading frame comprising 352 amino acids (FIG. 33).
[0641] To express the F. semitectum lipolytic enzyme gene in
Hansenula the gene was furnished with a signal sequence form the
yeast .alpha. mating factor and inserted behind the FMD-promoter
into the Hansenula expression vector pB14. The resulting plasmid,
pB14-alp.sem (schematically shown in FIG. 34) was transformed into
competent Hansenula polymorpha cells by electroporation.
Transformants were selected on YND plates and colonies were further
selected for multiple integration of the gene by 10 passages of
1:200 dilutions in liquid cultures of YND. Finally, the selected
cultures were transferred twice in YPD medium.
[0642] To determine the level of expression of the lipolytic enzyme
gene the selected clones were grown in YPD with 1.8% glycerol and
0.2% glucose for 2 days at 37.degree. C.
Example 14
Determination of Optimum pH and Temperature for Activity of a
Fusarium semitectum Lipolytic Enzyme
[0643] A lipolytic enzyme according to the present invention from
Fusarium semitectum IBT 9507 and expressed in Hansenula polymorpha
as described in Example 8 was used in functional assays in dough
slurry for determination of phospholipase and galactolipase
activity and the activity of this enzyme was studied in relation to
variations in pH and temperature.
Analytical Procedures
Gas Chromatography
[0644] 0.8 gram Wheat flour is scaled in a 12 ml centrifuge tube
with lid. 1.5 ml water containing the enzyme is added. The sample
is mixed on a Whirley and placed in a heating cabinet at 30.degree.
C. for 60 minutes. 6 ml n-Butanol:Ethanol 9:1 is added, and the
sample is mixed again until the flour is finely distributed in the
solvent. The tubes are then placed in a water bath at 95.degree. C.
for 10 minutes. Then mixed again and placed on a rotation device 45
rpm, for 45 minutes. The sample is then centrifuged at 2000 g for
10 minutes and 2 ml supernatant is transferred to a 10 ml dram
glass. The solvent is evaporated at 70.degree. C. under a steam of
nitrogen. The isolated lipids are analysed by GLC.
[0645] Gas Chromatograph and Galactolipase activity assay were
performed as described in Example 1.
Temperature Optimum
Phospholipase Activity
[0646] For the determination of activity as a function of
temperature the Phospholipase assay was conducted as in Example 1
but the temperature was set at 30.degree. C., 37.degree. C.,
45.degree. C., 52.degree. C. or 60.degree. C.
PH Optimum
Phospholipase Activity
[0647] For the determination of activity as a function of pH the
Phospholipase assay was conducted as in Example 1 but the 0.6%
L-.alpha. Phosphatidylcholine 95% Plant (Avanti #441601) and 0.4%
Triton-X 100 (Sigma X-100) was dissolved in 0.05M phosphate buffer
pH 5, pH 6, pH 7, pH 8 or pH 9.
Results
[0648] A lipolytic enzyme according to the present invention from
Fusarium semitectum IBT9507 was analysed for phospholipase activity
PLU-7 and galactolipase activity GLU with results shown in table 27
TABLE-US-00045 TABLE 27 Enzyme activity of Fusarium semitectum.
Assay Activity Phospholipase 0.8 PLU-7/ml Galactolipase 1.3
GLU/ml
[0649] Fusarium semitectum EBT9507 was tested in dough slurry
experiments by adding 1 PLU-7 to 0.8 gram flour according to the
procedure mentioned. A control sample with water instead of enzyme
and a sample with Lipopan F.TM. was also prepared. Lipids extracted
from the dough was analysed by GLC with results shown in table 28.
TABLE-US-00046 TABLE 28 GLC of dough lipid, % based on flour
weight. Enzyme Dosage FFA % MGMG % DGMG % MGDG % DGDG % TRI %
Control 0 0.148 0.007 0.025 0.047 0.160 0.516 F. semitectum 1
PLU-7/g g flour 0.268 0.001 0.120 0.033 0.045 0.446 Lipopan F .TM.
1 PLU-7/g g flour 0.229 0.027 0.090 0.016 0.069 0.415 FFA = free
fatty acids MGMG = monogalactosylmonoglyceride, DGMG =
digalactosylmonoglyceride MGDG = monogalactosyldiglyceride, DGDG =
digalactosyldiglyceride, TRI = triglyceride.
[0650] The results in table 28 indicate that the lipase from F.
semitectum has significant activity on galactolipids, and relative
less activity on triglyceride compared with Lipopan F.TM..
[0651] Fusarium semitectum IBT9507 was also analysed with regard to
activity as a function of temperature (table 29) and pH (table 30).
TABLE-US-00047 TABLE 29 Phospholipase activity as a function of
temperature for F. semitectum. Temperature, .degree. C. Relative
activity, PLU 30 79 37 92 45 100 52 20 60 2
[0652] TABLE-US-00048 TABLE 30 Phospholipase activity as a function
of pH for F. semitectum. pH Relative activity, PLU 5 67 6 83 7 100
8 80 9 17
[0653] The activities listed in table 29 and 30 are also
illustrated graphically in FIGS. 35 and 36.
Conclusion
[0654] Lipolytic enzyme according to the present invention from
Fusarium semitectum has shown very strong activity on galactolipids
in dough and the activity on triglyceride is less than the
triglyceride activity of Lipopan F.TM.. Temperature optimum for
activity of this enzyme is approx. 45.degree. C. and the pH optimum
is 7.
Example 15
Use of a Lipolytic Enzyme According to the Present Invention in
Animal Feed
[0655] To assess the efficacy of a lipolytic enzyme according to
the present invention at various dose levels used in normal feed
for the full production period of broiler chickens.
Summary:
[0656] Preliminary results suggest that addition of a lipolytic
enzyme according to the present invention in the diets of broiler
chickens is an effective nutritional strategy to improve the
performance of the birds, to improve nutrient retention and to
reduce nitrogen excretion. Specifically, preliminary investigations
suggest that addition of a lipolytic enzyme according to the
present invention to the animal's diet improves the body weight
gain, feed conversion efficiency, and metabolisability of dry
matter and of nitrogen of the animal. TABLE-US-00049 Treatment
details Number of treatments 8 Replicates per Treatment 0-21 d, 13
replicates 22-42 d, 9 replicates Birds per Replicate 0-21 d, 8
birds/replicate (6 in large cage, 2 in small cage) 22-42 d, 2
birds/replicate (2 in large cage) Species of bird Broiler Breed of
bird Ross or Cobb Sex of bird Male Range of trial 0-42 days Diet
form (pellet/mash) Mash Diet Coccidiostat/Growth promoter None used
Age at which birds/feed are 0, 21 and 42 days/0, 21 and 42 days
weighed Stocking density (birds/m2) Lighting programme 23 h light
days 0-4, 16 h light days 4-21, 20 h light days 22-31 and 23 h
light days 32-42. House temperature programme House humidity
programme Vaccination programme Elancoban (starter ration)
Ventilation - Air changes/hr
[0657] TABLE-US-00050 Ingredients Starter (%) Finisher (%) Diet
formulation and feeding schedule Maize 55.55 59.22 Rye 5.00 9.00
SBM (48% CP) 33.47 24.79 Soy Oil 1.85 3.06 Salt 0.41 0.33 DL
Methionine 0.21 0.14 Lysine HCl 0.05 0.10 Limestone 1.18 1.15
Dicalcium Phosphate 1.48 1.41 Vit/Min 0.50 0.50 TiO2 0.30 0.30
TOTAL 100.00 100.00 Nutrient Provision (calculated) CP (%) 21.50
18.06 ME (kcal/kg) 3000.0 3125.0 ME (MJ/kg) 12.55 13.08 Calcium (%)
0.90 0.85 Phos (%) 0.68 0.63 Av. Phos (%) 0.40 0.38 Fat (%) 4.48
5.73 Fibre (%) 2.59 2.48 Met (%) 0.55 0.43 Cys (%) 0.36 0.32 Met +
Cys (%) 0.91 0.75 Lys (%) 1.20 1.00 Try (%) 0.25 0.20 Na (%) 0.18
0.15
[0658] The feed is prepared as a mash, either with or without a
lipolytic enzyme according to the present invention.
[0659] Diets and water are offered ad libitum. Test diets are fed
continuously throughout the trial period. The feed samples are
optionally supplemented with a lipolytic enzyme according to the
present invention at 330 g/tonne. The enzyme may be added as a dry
enzyme whilst mixing the feed.
[0660] Observations are taken at: TABLE-US-00051 Live weight (cage
basis): day 0, 21 and 42 Weight gain: 0-21 d, 22-42 d, 0-42days
Feed Intake: 0-21 d, 22-42 d, 0-42days FCR (food conversion rate):
0-21 d, 22-42 d, 0-42days Collection of ileal contents: day 21 and
42
[0661] Total cage weights for feed and birds are determined, as
well as total mortality weight and number of birds for each cage
per period analysed. Feed consumption per cage is determined
uncorrected for mortality. Feed conversion efficiency data is
determined as total consumption per live weight and total weight
(including mortality weight) basis.
[0662] Prior to the study start the animals are examined for signs
of ill health and injury. Any that appear to be in poor condition
are removed from the study.
[0663] Study animals are assigned to their treatment groups using a
randomisation technique. Animals and their storage pens are
uniquely identified before the start of administration of test
feed.
[0664] Data from the treated groups are compared with those of
their relevant control group using the appropriate statistical
tests and accepting a level of probability of less than 0.05 as
indicating significance.
[0665] Body weights, food intakes and food conversion rates are
analysed by analysis of variance and least significant difference
tests. TABLE-US-00052 Animals Treatment Number 2 Number of
replicates 13 to 21 days and 9 to 42 days Animals per replicate 8
to 21 days and 2 to 42 days Species of Animal Broiler Breed of
animal Ross Sex Male Age of test animals 0-42 d Weights of test
animals .about.40 g Diet/Housing Diet Information See above Diet
Form Mash Coccidiostat Starter None Coccidiostat Finisher None
Growth Promoter Starter None Growth Promoter Finisher None
[0666] Main Measurements made TABLE-US-00053 Variables weight gain,
feed conversion, nutrient digestibility When 0-21 d, 22-42 d
Enzymes/additives Enzymes used (1) Lipolytic enzyme from Fusarium
semitectum and/or Fusarium heterosporum - 330 g/Tonne
Example 16
Evaluation of the Effect of a Fusarium heterosporum CBS 782.83
Lipolytic Enzyme on Instant Noodle Duality Made from Chinese
Flour
Introduction
[0667] The instant noodle (IN) market has seen a phenomenal growth
in the last 5-8 years in SE Asia, and to some extent in Europe and
USA. This growth is evident even in regions that are traditionally
rice and/or pasta based markets (Food Navigator, 2000). The recent
popularity of IN can be mainly attributed to its very affordable
cost, convenience and clean production procedures.
[0668] Flour with an average protein content (9-11%), low ash value
(.about.0.50%), high L* (85) brightness and b* (>8.0) yellowness
and high starch paste viscosity (<750 BU) produces a
creamy/yellow coloured instant noodle (IN) and has the desired
mouth feel characteristics. There are several different types of
noodles consumed, each with specific flour quality characteristics
that impact on end product quality.
[0669] Meeting end user demands is challenging in the flour
industry owing to the large number of end products and wide range
of customer expectations. Specifically designed ingredients and
additives at the right doses play a very important role in
improving taste, texture, appearance, shelf life and/or nutritive
value of the final end product.
[0670] Whilst the importance of colour and texture of cooked IN
cannot be underestimated, customers are getting increasingly
discerning and health conscious and are seeking low fat
alternatives without compromising on quality.
[0671] A lipolytic enzyme according to the present invention was
tested on Chinese flour in order to evaluate the effect on fat
content of IN and study the changes to texture and colour during
processing.
Materials and Methods
[0672] The standard Agrifood Technology procedure for IN production
and an extended evaluation method was used for this project.
Chinese flour was used as the control flour and was run at the
start of each day. The protein content, moisture, ash, colour, wet
gluten and diastatic activity of the Chinese flour were measured
using AACC (American Association for Clinical Chemistry) approved
methods. Dough rheology tests included: farinogram, extensogram (45
min pull), alveogram and amylogram.
[0673] The IN production can be summarized as follows:
[0674] Each batch of IN was made from 350 g flour and mixed at low
speed during which 33 parts of aqueous salt solution containing 1%
sodium chloride and 0.2% alkaline salts (potassium carbonate:sodium
carbonate in the ratio 6:4) was gradually added. For dosed samples,
the flour was mixed thoroughly with the measured amount of
ingredient prior to the addition of the aqueous salty solution.
[0675] The crumbly dough was mixed for a further 4 minutes at
medium speed and sheeted 8 times. Sheeting commenced with a steel
compactor, followed by two plastic fluted rollers and finally by
five stainless steel smooth rollers, with a 30% reduction ratio
between each roll. The final dough sheet thickness was 1.35 mm. The
dough sheet was sheeted once more prior to cutting. The
differential in speed between the cutting rolls and the conveyor
belt resulted in tight curls being formed. The tightly curled
noodle strands were steamed for two minutes, fried in palm oil on
both sides at 180.degree. C. for 1 minute. The noodle blocks were
cooled and packed in clip seal bags for further analyses.
[0676] Samples were collected at several stages of production for
analyses. The colour and particle size of the crumb were measured
using the Minolta Chromameter and the vernier calipers,
respectively. The colour of the dough sheet and the final product
were recorded with the Minolta Chromameter and a digital photo was
taken of both (not shown). Water activity measurements were
conducted on the steamed noodles. Water activity may be measured by
determining the weight of the steamed noodles, both immediately
after steaming and after complete removal of water content by
drying in an oven at 90.degree. C.--the water content can then be
determined by dividing the weight difference before and after
drying by the weight after drying.
[0677] Optimal cooking time, cooking yield, cooking losses
(gravimetric method), colour and texture (firmness) of cooked
noodles were measured using standard Agrifood Technology procedures
known to a person skilled in the art. Texture profile analysis
(TPA) was also conducted on cooked noodle texture in order to
measure cohesiveness, springiness and chewiness.
[0678] Cohesiveness is defined as how well the product withstands a
second deformation relative to how it behaved under the first
deformation. It is measured as the area of work during the second
compression divided by the area of work during the first
compression and hence has no units of measurements. Cohesiveness,
in this instance relates to product `al-dente`, which is not a
desirable attribute for IN.
[0679] Springiness is defined as how well a product physically
springs back after it has been deformed during the first
compression. Springiness is measured in several ways, but most
typically, by the distance of the detected height of the product on
the second compression.
[0680] Chewiness only applies to solid products, and is calculated
as gumminess multiplied by springiness. Chewiness is mutually
exclusive with gumminess.
[0681] One noodle block representing each dosage rate was ground in
a coffee grinder and a homogenous sub sample was used for fat
analysis by acid hydrolysis method (alternative standard methods
for determining fat content may be used).
Results and Discussion
[0682] The protein content and colour (with respect to brightness,
L*) of the flour was within the acceptable range for the production
of instant noodles. The water absorption was slightly on the higher
end for IN production; however, as the noodle dough is quite
crumbly it did not impact machinability.
[0683] The flour had good single (extensogram) and bi-axial
(alveogram) extensibility, which would have a positive impact on
the eating qualities of the noodle. Peak viscosity of the
amylograph was 870 BU, which is desirable for IN.
[0684] Cooking loss of IN containing the second highest dose of
lipolytic enzyme was higher than the control and the 1N containing
the least amount of the lipolytic enzyme according to the present
invention. The fat content of IN with the highest amount of the
lipolytic enzyme was significantly lower than the control and the
experimental IN with the lowest amount of lipolytic enzyme.
Springiness and chewiness of some experimental IN were better than
the control. Based on this data, the lipolytic enzyme should be
investigated further at different dosages.
Conclusions
[0685] Some of the salient points that can be made from this study
are:
[0686] The addition to IN of a lipolytic enzyme according to the
present invention did not dramatically impact on crumb size, dough
stickiness, machinability or processing characteristics.
Importantly, increasing dosages of lipolytic enzyme resulted in a
reduction in fat content of 1N. Lipolytic enzyme improved noodle
firmness at increasing doses compared to control while cohesiveness
was not affected. Lipolytic enzyme had a positive effect on
yellowness of cooked noodles.
[0687] Thus, lipolytic enzyme reduced fat content in IN, improved
texture and increased yellowness of cooked noodles.
[0688] All publications mentioned in the above specification are
herein incorporated by reference. Various modifications and
variations of the described methods and system of the present
invention will be apparent to those skilled in the art without
departing from the scope and spirit of the present invention.
Although the present invention has been described in connection
with specific preferred embodiments, it should be understood that
the invention as claimed should not be unduly limited to such
specific embodiments. Indeed, various modifications of the
described modes for carrying out the invention which are obvious to
those skilled in biochemistry and biotechnology or related fields
are intended to be within the scope of the following claims.
[0689] The invention will now be further described by the following
numbered paragraphs:
[0690] 1. A fungal wild-type lipolytic enzyme having a higher ratio
of activity on polar lipids compared with triglycerides.
[0691] 2. A fungal lipolytic enzyme according to paragraph 1
wherein the enzyme has a phospholipid:kiglyceride hydrolysing
activity ratio of at least 4.
[0692] 3. A fungal lipolytic enzyme according to paragraph 1
wherein the enzyme has a glycolipid:kiglyceride hydrolysing
activity ratio of at least 1.5.
[0693] 4. A fungal lipolytic enzyme wherein the enzyme comprises an
amino acid sequence as shown in SEQ ID No. 1 or SEQ ID No. 2 or an
amino acid sequence which has at least 90% identity thereto.
[0694] 5. A fungal lipolytic enzyme according to any one of the
preceding paragraphs wherein the enzyme is obtainable from a
filamentous fungus
[0695] 6. A fungal lipolytic enzyme according to any one of the
preceding paragraphs wherein the enzyme is obtainable from Fusarium
spp.
[0696] 7. A fungal lipolytic enzyme according to paragraph 6,
wherein the enzyme is obtainable from Fusarium heterosporum.
[0697] 8. A fungal, lipolytic enzyme according to paragraph 7
wherein the enzyme is obtainable from Fusarium heterosporum CBS
782.83.
[0698] 9. A nucleotide sequence encoding a fungal lipolytic enzyme
according to any one of paragraphs 4-8.
[0699] 10. A nucleic acid encoding a fungal lipolytic enzyme, which
nucleic acid is selected from the group consisting of: a) a nucleic
acid comprising a nucleotide sequence shown in SEQ ID No. 3; b) a
nucleic acid which is related to Me nucleotide sequence of SEQ ID
No. 3 by the degeneration of the genetic code; and c) a nucleic
acid comprising a nucleotide sequence which has at least 90%
identity with the nucleotide sequence shown in SEQ ID No. 3.
[0700] 11. A method of making a foodstuff comprising adding the
fungal lipolytic enzyme according to any one of paragraphs 1-8 to
one or more ingredients of the foodstuff.
[0701] 12. A method of making a baked product comprising adding a
fungal lipolytic enzyme according to any one of paragraphs 1-8 to a
dough and baking the dough to make the baked product.
[0702] 13. A method according to paragraph 11 wherein the foodstuff
is one or more of: egg or an egg-based product; a baked product;
confectionery; a frozen product; a dairy product including a
cheese; a mousse; a whipped vegetable cream; an edible oil and fat;
an aerated and non-aerated whipped product; an oil-in-water
emulsions and water-in-oil emulsions; margarine; shortening, a
spread, including low fat and very low fat spreads; a dressing;
mayonnaise; a dip; a cream based sauce; a cream based soup; a
beverage; a spice emulsion and a sauce.
[0703] 14. A method of preparing a lyso-phospholipid comprising
treating a phospholipid with the fungal lipolytic enzyme according
to any one of paragraphs 1-8 to produce the lyso-phospholipid.
[0704] 15. A method of preparing a lyso-glycolipid comprising
treating a glycolipid with a fungal lipolytic enzyme according to
any one of paragraphs 1-8 to produce a lyso glycolipid.
[0705] 16. A process of enzymatic degumming of vegetable or edible
oils, comprising treating the edible or vegetable oil with a fungal
lipolytic enzyme according to any one of paragraphs 1-8 so as to
hydrolyse a major part of the polar lipids present therein.
[0706] 17. A foodstuff obtained by the method according to
paragraph 11.
[0707] 18. A baked product obtained by the method of paragraph
12.
[0708] 19. A fungal lipolytic enzyme as generally hereinbefore
described with reference to the description and drawings.
Sequence CWU 1
1
11 1 275 PRT Fusarium heterosporum 1 Ala Val Gly Val Thr Ser Thr
Asp Phe Thr Asn Phe Lys Phe Tyr Ile 1 5 10 15 Gln His Gly Ala Ala
Ala Tyr Cys Asn Ser Gly Thr Ala Ala Gly Ala 20 25 30 Lys Ile Thr
Cys Ser Asn Asn Gly Cys Pro Thr Ile Glu Ser Asn Gly 35 40 45 Val
Thr Val Val Ala Ser Phe Thr Gly Ser Lys Thr Gly Ile Gly Gly 50 55
60 Tyr Val Ser Thr Asp Ser Ser Arg Lys Glu Ile Val Val Ala Ile Arg
65 70 75 80 Gly Ser Ser Asn Ile Arg Asn Trp Leu Thr Asn Leu Asp Phe
Asp Gln 85 90 95 Ser Asp Cys Ser Leu Val Ser Gly Cys Gly Val His
Ser Gly Phe Gln 100 105 110 Asn Ala Trp Ala Glu Ile Ser Ala Gln Ala
Ser Ala Ala Val Ala Lys 115 120 125 Ala Arg Lys Ala Asn Pro Ser Phe
Lys Val Val Ala Thr Gly His Ser 130 135 140 Leu Gly Gly Ala Val Ala
Thr Leu Ser Ala Ala Asn Leu Arg Ala Ala 145 150 155 160 Gly Thr Pro
Val Asp Ile Tyr Thr Tyr Gly Ala Pro Arg Val Gly Asn 165 170 175 Ala
Ala Leu Ser Ala Phe Ile Ser Asn Gln Ala Gly Gly Glu Phe Arg 180 185
190 Val Thr His Asp Lys Asp Pro Val Pro Arg Leu Pro Pro Leu Ile Phe
195 200 205 Gly Tyr Arg His Thr Thr Pro Glu Tyr Trp Leu Ser Gly Gly
Gly Gly 210 215 220 Asp Lys Val Asp Tyr Ala Ile Ser Asp Val Lys Val
Cys Glu Gly Ala 225 230 235 240 Ala Asn Leu Met Cys Asn Gly Gly Thr
Leu Gly Leu Asp Ile Asp Ala 245 250 255 His Leu His Tyr Phe Gln Ala
Thr Asp Ala Cys Asn Ala Gly Gly Phe 260 265 270 Ser Trp Arg 275 2
360 PRT Fusarium heterosporum 2 Met Arg Phe Pro Ser Ile Phe Thr Ala
Val Leu Phe Ala Ala Ser Ser 1 5 10 15 Ala Leu Ala Ala Pro Val Asn
Thr Thr Thr Glu Asp Glu Thr Ala Gln 20 25 30 Ile Pro Ala Glu Ala
Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe 35 40 45 Asp Val Ala
Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Phe Leu 50 55 60 Phe
Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val 65 70
75 80 Ser Leu Asp Lys Arg Ala Val Gly Val Thr Ser Thr Asp Phe Thr
Asn 85 90 95 Phe Lys Phe Tyr Ile Gln His Gly Ala Ala Ala Tyr Cys
Asn Ser Gly 100 105 110 Thr Ala Ala Gly Ala Lys Ile Thr Cys Ser Asn
Asn Gly Cys Pro Thr 115 120 125 Ile Glu Ser Asn Gly Val Thr Val Val
Ala Ser Phe Thr Gly Ser Lys 130 135 140 Thr Gly Ile Gly Gly Tyr Val
Ser Thr Asp Ser Ser Arg Lys Glu Ile 145 150 155 160 Val Val Ala Ile
Arg Gly Ser Ser Asn Ile Arg Asn Trp Leu Thr Asn 165 170 175 Leu Asp
Phe Asp Gln Ser Asp Cys Ser Leu Val Ser Gly Cys Gly Val 180 185 190
His Ser Gly Phe Gln Asn Ala Trp Ala Glu Ile Ser Ala Gln Ala Ser 195
200 205 Ala Ala Val Ala Lys Ala Arg Lys Ala Asn Pro Ser Phe Lys Val
Val 210 215 220 Ala Thr Gly His Ser Leu Gly Gly Ala Val Ala Thr Leu
Ser Ala Ala 225 230 235 240 Asn Leu Arg Ala Ala Gly Thr Pro Val Asp
Ile Tyr Thr Tyr Gly Ala 245 250 255 Pro Arg Val Gly Asn Ala Ala Leu
Ser Ala Phe Ile Ser Asn Gln Ala 260 265 270 Gly Gly Glu Phe Arg Val
Thr His Asp Lys Asp Pro Val Pro Arg Leu 275 280 285 Pro Pro Leu Ile
Phe Gly Tyr Arg His Thr Thr Pro Glu Tyr Trp Leu 290 295 300 Ser Gly
Gly Gly Gly Asp Lys Val Asp Tyr Ala Ile Ser Asp Val Lys 305 310 315
320 Val Cys Glu Gly Ala Ala Asn Leu Met Cys Asn Gly Gly Thr Leu Gly
325 330 335 Leu Asp Ile Asp Ala His Leu His Tyr Phe Gln Ala Thr Asp
Ala Cys 340 345 350 Asn Ala Gly Gly Phe Ser Trp Arg 355 360 3 825
DNA Fusarium heterosporum 3 gccgttggag tgacctctac tgacttcact
aactttaagt tctacattca gcatggtgct 60 gccgcatact gtaactccgg
taccgccgca ggtgcaaaga tcacttgttc gaataacggt 120 tgccctacta
tcgagtccaa cggcgtgact gtggtcgcct ccttcactgg ttcgaagact 180
ggcatcggcg gttacgtgtc caccgatagc tcgagaaaag agatcgtggt cgcaatcaga
240 ggttccagca acatccggaa ttggctgact aatcttgact ttgaccagtc
cgactgttcc 300 cttgtttcgg gctgtggtgt tcactccggt ttccagaacg
cttgggccga gatctccgca 360 caggcctcgg ctgccgtggc aaaagctaga
aaggccaacc catccttcaa ggttgtcgcc 420 actggccact cgctcggcgg
cgctgtggcg accctgtccg ctgccaacct tcgagctgca 480 ggtactccag
tcgacatcta cacttatggt gcacctagag ttggcaacgc cgcactgtct 540
gctttcatct cgaaccaagc aggcggtgaa tttagagtca ctcacgacaa ggacccagtg
600 cctcggcttc cacctctgat cttcggttac agacacacta ccccagagta
ctggctgtca 660 ggtggcggcg gagacaaggt ggactacgca atctccgacg
tgaaggtctg cgagggagcc 720 gcaaacctca tgtgtaacgg cggtacactg
ggactggaca tcgacgcaca cttgcactac 780 ttccaggcaa ctgatgcttg
caacgccgga ggtttctcct ggaga 825 4 352 PRT Fusarium semitectum 4 Met
Arg Val Leu Ser Leu Leu Ser Val Ala Thr Phe Ala Val Ala Ser 1 5 10
15 Pro Leu Ser Val Glu Asp Tyr Ala Lys Ala Leu Asp Glu Arg Ala Val
20 25 30 Ala Val Ser Asn Gly Asp Phe Gly Asn Phe Lys Phe Tyr Ile
Gln His 35 40 45 Gly Ala Ala Ser Tyr Cys Asn Ser Asn Ala Ala Ala
Gly Ala Lys Ile 50 55 60 Thr Cys Gly Asn Asn Gly Cys Pro Thr Val
Gln Ser Asn Gly Ala Thr 65 70 75 80 Ile Val Ala Ser Phe Thr Gly Ser
Lys Thr Gly Ile Gly Gly Tyr Val 85 90 95 Ser Thr Asp Ser Ser Arg
Lys Glu Ile Val Leu Ser Val Arg Gly Ser 100 105 110 Ile Asn Ile Arg
Asn Trp Leu Thr Asn Leu Asp Phe Gly Gln Glu Asp 115 120 125 Cys Ser
Leu Thr Ser Gly Cys Gly Val His Ser Gly Phe Gln Asn Ala 130 135 140
Trp Lys Glu Ile Ser Ala Ala Ala Thr Ala Ala Val Ala Lys Ala Arg 145
150 155 160 Lys Ala Asn Pro Ser Phe Lys Val Ile Ala Thr Gly His Ser
Leu Gly 165 170 175 Gly Ala Val Ala Thr Leu Ala Gly Ala Asn Leu Arg
Val Gly Gly Thr 180 185 190 Pro Val Asp Ile Tyr Thr Tyr Gly Ser Pro
Arg Val Gly Asn Ser Gln 195 200 205 Leu Ala Gly Phe Ile Ser Asn Gln
Ala Gly Gly Glu Phe Arg Val Thr 210 215 220 Asn Ala Lys Asp Pro Val
Pro Arg Leu Pro Pro Leu Val Phe Gly Tyr 225 230 235 240 Arg His Thr
Ser Pro Glu Tyr Trp Leu Ser Gly Ala Gly Gly Asp Lys 245 250 255 Val
Asp Tyr Thr Ile Asn Asp Ile Lys Val Cys Glu Gly Ala Ala Asn 260 265
270 Leu Lys Cys Asn Gly Gly Thr Leu Gly Leu Asp Ile Asp Ala His Leu
275 280 285 His Tyr Phe Gln Glu Thr Asp Ala Cys Ser Gly Gly Gly Ile
Ser Trp 290 295 300 Arg Ser Arg Arg Tyr Arg Ser Ala Lys Arg Glu Asp
Ile Ser Glu Arg 305 310 315 320 Ala Ala Pro Met Thr Asp Ala Glu Leu
Glu Lys Lys Leu Asn Asn Tyr 325 330 335 Val Glu Met Asp Lys Glu Tyr
Val Lys Asn Asn Ala Ala Arg Thr Ser 340 345 350 5 1236 DNA Fusarium
semitectum 5 gggggggata tcttcgccag tttcagtgtt cagtatcctt tctgagggag
tcgcacttgt 60 cacagcttgt ctatcactta tacccttgat ccataccctt
gcctgtcaag atgcgtgtcc 120 tgtcactcct ctcagttgcc acctttgctg
tggccagtcc tctgagcgta gaggactacg 180 ccaaggctct cgatgaaaga
gctgttgctg tctccaacgg tgactttggt aacttcaagt 240 tctacatcca
gcacggtgct gcttcatact gcaactccaa tgccgcagct ggtgcaaaga 300
tcacctgtgg aaacaatggc tgtccaacag tccagtccaa cggtgctact atcgtcgcat
360 ccttcactgg ttccaagact ggcatcggcg gttacgtttc gaccgactct
tcacgaaagg 420 aaatcgtcct ctccgttcga ggcagcataa acattcgaaa
ctggctcacc aacctcgact 480 tcggccagga ggactgcagc ttgacctcag
gttgtggagt acacagcggt ttccagaatg 540 cctggaaaga gatttccgct
gcagcaaccg ctgctgtcgc aaaggcccgc aaggcgaacc 600 cttcgttcaa
ggtcattgcc acaggccact cccttggtgg tgccgtcgct acactcgccg 660
gcgcaaatct tcgagttggt ggaacacccg ttgacatcta cacctacggc tccccccgag
720 ttggaaactc ccagctcgct ggcttcatct cgaaccaagc tggtggagag
ttccgcgtta 780 ccaatgccaa ggaccctgtt cccagacttc cccctctggt
ctttggttac cgacacacat 840 cccccgagta ctggctgtct ggtgcgggag
gtgacaaggt tgactacacc atcaatgaca 900 tcaaggtctg tgagggtgct
gccaacctca agtgcaacgg tggaaccctt ggattggata 960 ttgatgctca
cctgcactac ttccaggaga ctgatgcttg ctctggtggc ggtatctctt 1020
ggagaagccg aagatacaga agcgccaagc gtgaggacat ctctgagagg gctgctccta
1080 tgacggatgc tgagcttgag aagaagctca acaactatgt cgagatggat
aaggagtatg 1140 tcaagaacaa tgccgcacgc acgtcatagt atgacattta
cgcagtaatg atataccacg 1200 aataataaga atcacaaaat aaaaaaaaaa aaaaaa
1236 6 279 PRT Fusarium heterosporum 6 Glu Ala Glu Ala Ala Val Gly
Val Thr Ser Thr Asp Phe Thr Asn Phe 1 5 10 15 Lys Phe Tyr Ile Gln
His Gly Ala Ala Ala Tyr Cys Asn Ser Gly Thr 20 25 30 Ala Ala Gly
Ala Lys Ile Thr Cys Ser Asn Asn Gly Cys Pro Thr Ile 35 40 45 Glu
Ser Asn Gly Val Thr Val Val Ala Ser Phe Thr Gly Ser Lys Thr 50 55
60 Gly Ile Gly Gly Tyr Val Ser Thr Asp Ser Ser Arg Lys Glu Ile Val
65 70 75 80 Val Ala Ile Arg Gly Ser Ser Asn Ile Arg Asn Trp Leu Thr
Asn Leu 85 90 95 Asp Phe Asp Gln Ser Asp Cys Ser Leu Val Ser Gly
Cys Gly Val His 100 105 110 Ser Gly Phe Gln Asn Ala Trp Ala Glu Ile
Ser Ala Gln Ala Ser Ala 115 120 125 Ala Val Ala Lys Ala Arg Lys Ala
Asn Pro Ser Phe Lys Val Val Ala 130 135 140 Thr Gly His Ser Leu Gly
Gly Ala Val Ala Thr Leu Ser Ala Ala Asn 145 150 155 160 Leu Arg Ala
Ala Gly Thr Pro Val Asp Ile Tyr Thr Tyr Gly Ala Pro 165 170 175 Arg
Val Gly Asn Ala Ala Leu Ser Ala Phe Ile Ser Asn Gln Ala Gly 180 185
190 Gly Glu Phe Arg Val Thr His Asp Lys Asp Pro Val Pro Arg Leu Pro
195 200 205 Pro Leu Ile Phe Gly Tyr Arg His Thr Thr Pro Glu Tyr Trp
Leu Ser 210 215 220 Gly Gly Gly Gly Asp Lys Val Asp Tyr Ala Ile Ser
Asp Val Lys Val 225 230 235 240 Cys Glu Gly Ala Ala Asn Leu Met Cys
Asn Gly Gly Thr Leu Gly Leu 245 250 255 Asp Ile Asp Ala His Leu His
Tyr Phe Gln Ala Thr Asp Ala Cys Asn 260 265 270 Ala Gly Gly Phe Ser
Trp Arg 275 7 1257 DNA Fusarium heterosporum 7 agaattcaaa
cgatgagatt cccatccatc tttaccgctg ttctgttcgc cgcttcctcc 60
gccctggctg ccccagtcaa cactaccact gaggacgaga ctgctcagat tccagctgag
120 gctgtcatcg gttactctga cctggagggt gacttcgatg ttgctgtttt
gccattctcc 180 aactccacca acaacggttt cttgttcatc aacactacca
ttgcctccat tgctgccaag 240 gaggaaggtg tttccttgga caagagagct
gttgctgtct ccaacggtga ctttggtaac 300 ttcaagttct acatccagca
cggtgctgct tcatactgca actccaatgc cgcagctggt 360 gcaaagatca
cctgtggaaa caatggctgt ccaacagtcc agtccaacgg tgctactatc 420
gtcgcatcct tcactggttc caagactggc atcggcggtt acgtttcgac cgactcttca
480 cgaaaggaaa tcgtcctctc cgttcgaggc agcataaaca ttcgaaactg
gctcaccaac 540 ctcgacttcg gccaggagga ctgcagcttg acctcaggtt
gtggagtaca cagcggtttc 600 cagaatgcct ggaaagagat ttccgctgca
gcaaccgctg ctgtcgcaaa ggcccgcaag 660 gcgaaccctt cgttcaaggt
cattgccaca ggccactccc ttggtggtgc cgtcgctaca 720 ctcgccggcg
caaatcttcg agttggtgga acacccgttg acatctacac ctacggctcc 780
ccccgagttg gaaactccca gctcgctggc ttcatctcga accaagctgg tggagagttc
840 cgcgttacca atgccaagga ccctgttccc agacttcccc ctctggtctt
tggttaccga 900 cacacatccc ccgagtactg gctgtctggt gcgggaggtg
acaaggttga ctacaccatc 960 aatgacatca aggtctgtga gggtgctgcc
aacctcaagt gcaacggtgg aacccttgga 1020 ttggatattg atgctcacct
gcactacttc caggagactg atgcttgctc tggtggcggt 1080 atctcttgga
gaagccgaag atacagaagc gccaagcgtg aggacatctc tgagagggct 1140
gctcctatga cggatgctga gcttgagaag aagctcaaca actatgtcga gatggataag
1200 gagtatgtca agaacaatgc cgcacgcacg tcatagtatg acatttacgc ggatcct
1257 8 37 DNA Artificial Sequence Oligonucleotide primer for CBSLip
8 tccttggaca agagagccgt tggagtgacc tctactg 37 9 44 DNA Artificial
Sequence Oligonucleotide primer for CBSLip 9 aggatccaat tctctccatg
gcctatctcc aggagaaacc tccg 44 10 37 DNA Artificial Sequence
Oligonucleotide primer for alpha-signal 10 agaattcaaa cgatgagatt
cccatccatc tttaccg 37 11 41 DNA Artificial Sequence Oligonucleotide
primer for alpha-signal 11 aggtcactcc aacggctctc ttgtccaagg
aaacaccttc c 41
* * * * *