U.S. patent application number 11/506518 was filed with the patent office on 2007-05-10 for methods and compositions for treating neurological disease.
Invention is credited to Neil Aronin, Muthiah Manoharan.
Application Number | 20070105803 11/506518 |
Document ID | / |
Family ID | 37562149 |
Filed Date | 2007-05-10 |
United States Patent
Application |
20070105803 |
Kind Code |
A1 |
Manoharan; Muthiah ; et
al. |
May 10, 2007 |
Methods and compositions for treating neurological disease
Abstract
This invention relates to methods and compositions for treating
neurological disease, and more particularly to methods of
delivering iRNA agents to neural cells for the treatment of
neurological diseases.
Inventors: |
Manoharan; Muthiah; (Weston,
MA) ; Aronin; Neil; (Newton, MA) |
Correspondence
Address: |
FISH & RICHARDSON PC
P.O. BOX 1022
MINNEAPOLIS
MN
55440-1022
US
|
Family ID: |
37562149 |
Appl. No.: |
11/506518 |
Filed: |
August 18, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60709985 |
Aug 18, 2005 |
|
|
|
60833234 |
Jul 25, 2006 |
|
|
|
Current U.S.
Class: |
514/44A |
Current CPC
Class: |
C12N 15/113 20130101;
C12N 2310/315 20130101; A61P 25/16 20180101; C12N 2320/32 20130101;
A61P 25/14 20180101; C12N 2310/3515 20130101; C12N 2310/14
20130101; C12N 2310/321 20130101; A61K 31/7088 20130101; A61P 25/28
20180101; C12Q 1/6883 20130101; A61P 21/04 20180101; C12Q 2600/136
20130101; A61K 47/554 20170801; C12Q 2600/178 20130101; C12N 15/111
20130101; C12Q 2600/158 20130101; A61P 25/00 20180101 |
Class at
Publication: |
514/044 |
International
Class: |
A61K 48/00 20060101
A61K048/00 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] The work described herein was carried out, at least in part,
using funds from the U.S. government under grant number 38194
awarded by the National Institutes of Health. The government may
therefore have certain rights in the invention.
Claims
1. A method of downregulating expression of a target gene in a
neural cell distal to the site of administration, the method
comprising contacting an iRNA agent with neural cells for a time
sufficient to allow uptake of the iRNA agent into the cells and
axonal transport of said iRNA, wherein (i) the iRNA agent comprises
a sense and an antisense strand that form an RNA duplex, (ii) the
iRNA agent comprises a lipophilic moiety, and (iii) the sequence of
the antisense strand of the iRNA agent comprises a nucleotide
sequence sufficiently complementary to a target sequence of about
18 to 25 nucleotides of an RNA expressed from the target gene.
2. The method of claim 1, wherein the lipophilic moiety is a
cholesterol.
3. The method of claim 1, wherein the lipophilic moiety is
conjugated to the sense strand.
4. The method of claim 1, wherein the lipophilic moiety is
conjugated to the 3' end of the sense strand.
5. The method of claim 1, wherein the antisense sequence differs by
no more than four nucleotides from an antisense sequence listed in
Table 2.
6. The method of claim 1, wherein the antisense strand is selected
from an antisense strand listed in Table 2.
7. The method of claim 1, wherein the iRNA agent further comprises
a phosphorothioate or a 2'-OMe modification.
8. The method of claim 1, wherein the iRNA agent is provided in a
solution that lacks a transfection reagent.
9. A method of treating a human comprising identifying a human
having or at risk for developing a neurological disorder, and
administering to the human an iRNA agent that targets a gene
expressed in a neural cell distal to the site of administration,
wherein the expression of the gene is associated with symptoms of
the neurological disorder, and wherein (i) the iRNA agent comprises
a sense and an antisense strand that form an RNA duplex, (ii) the
iRNA agent comprises a lipophilic moiety, and (iii) the antisense
strand of the iRNA agent comprises a nucleotide sequence
sufficiently complementary to a target sequence of about 18 to 25
nucleotides of an RNA expressed from the target gene.
10. The method of claim 9, wherein the lipophilic moiety is a
cholesterol.
11. The method of claim 9, wherein the lipophilic moiety is
conjugated to the sense strand.
12. The method of claim 9, wherein the lipophilic moiety is
conjugated to the 3' end of the sense strand.
13. The method of claim 9, wherein the iRNA agent further comprises
a phosphorothioate or a 2'-OMe modification.
14. The method of claim 9, wherein the antisense sequence differs
by no more than four nucleotides from an antisense sequence listed
in Table 2.
15. The method of claim 9, wherein the antisense strand is selected
from an antisense strand listed in Table 2.
16. The method of claim 9, wherein the antisense strand of the iRNA
agent comprises a sequence complementary to a sequence comprising a
polymorphism of a huntingtin (htt) RNA.
17. The method of claim 9, wherein the human carries a genetic
variation in a Parkin gene or a ubiquitin carboxy-terminal
hydrolase L1 (UCHL1) gene.
18. The method of claim 9, wherein the neurological disorder is
Huntington's disease.
19. The method of claim 9, wherein the neurological disorder is
Parkinson's disease.
20. The method of claim 9, wherein the neurological disorder is
Alzheimer's Disease, multiple system atrophy, or Lewy body
dementia.
21. The method of claim 7, wherein the iRNA agent comprises a
nucleotide overhang having 1 to 4 unpaired nucleotides.
22. The method of claim 9, wherein the iRNA agent is provided in a
solution that lacks a transfection reagent.
23. A method of reducing the amount of huntingtin (htt) RNA in a
neural cell of a subject, comprising: contacting the neural cell
with an iRNA agent, wherein said neural cell is distal to the site
of action and the iRNA agent comprises a sense and an antisense
strand, wherein the sense and the antisense strands form an RNA
duplex, wherein the antisense strand comprises a nucleotide
sequence that differs by no more than four nucleotides from an
antisense sequence listed in Table 2, and wherein the iRNA agent
comprises a lipophilic moiety.
24. The method of claim 23, wherein the iRNA agent further
comprises a phosphorothioate or a 2'-OMe modification.
25. The method of claim 23, wherein the iRNA agent comprises an
antisense strand comprising a sequence selected from the antisense
strands listed in Table 2.
26. The method of claim 23, wherein the iRNA agent comprises a
sense strand selected from the sense strands listed in Table 2.
27. The method of claim 23, wherein the iRNA agent comprises an
antisense strand comprising a sequence complementary to sequence
comprising a polymorphism of an htt RNA.
28. The method of claim 27, wherein the polymorphism is an A to C
at position 171 according to the sequence of GenBank Accession No.
NM.sub.--002111.
29. The method of claim 23, wherein the iRNA agent comprises a
nucleotide overhang having 1 to 4 unpaired nucleotides.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional
Application No. 60/709,985, filed Aug. 18, 2005; and to U.S.
Provisional Application No. 60/833,234, filed Jul. 25, 2006. The
contents of these provisional applications are hereby incorporated
by reference in their entirety.
FIELD
[0003] This invention relates to methods and compositions for
treating neurological disease, and more particularly to methods of
delivering iRNA agents to neural cells for the treatment of
neurological diseases.
BACKGROUND
[0004] RNA interference or "RNAi" is a term initially coined by
Fire and co-workers to describe the observation that
double-stranded RNA (dsRNA) can block gene expression when it is
introduced into worms (Fire et al., Nature 391:806-811, 1998).
Short dsRNA directs gene-specific, post-transcriptional silencing
in many organisms, including vertebrates, and has provided a new
tool for studying gene function.
SUMMARY
[0005] Aspects of the invention relate to compositions for treating
a neurological disorder, and methods of using those compositions.
In one aspect, the invention features a method of treating a
subject having, or at risk for developing a neurological disorder
by administering an iRNA agent that inhibits expression of a gene
expressed in neural cells. In one embodiment, the iRNA agent
includes a conjugate to facilitate uptake of the iRNA agent into
neural cells. In a preferred embodiment, the conjugate is a
lipophilic moiety, e.g., cholesterol. In another embodiment, the
iRNA agent inhibits expression of the gene expressed in a neural
cell that is involved in a neurological disease or disorder. In yet
another embodiment, the iRNA agent is used to treat a patient
having or at risk for developing a neurological disorder. In one
embodiment, the iRNA agent modified for enhanced uptake into neural
cells can inhibit, or decrease, expression of the huntingtin (htt)
gene in a human having or at risk for developing Huntington's
Disease (HD).
[0006] In a preferred embodiment, the subject is a mammal, such as
a human, e.g., a subject diagnosed as having, or at risk for
developing, a neurological disorder.
[0007] In one embodiment the sense strand of the iRNA agent can
include at least one mismatch within the antisense strand of the
oligonucleotide agent. The mismatch can confer an advantage on the
iRNA agent, such as by enhancing antisense strand selection by the
RNAi Induced Silencing Complex (RISC). In one embodiment, the
mismatch is at least 1, 2, 3, 4, or 5 nucleotides away from the
3'-terminal nucleotide of the sense strand.
[0008] In one embodiment, the iRNA agent includes an antisense
strand that is substantially complementary to a sequence encoded by
a region of the human htt gene including or overlapping a sequence
provided in GenBank Accession Number NM.sub.--002111 (Aug. 8,
2005).
[0009] In certain embodiments, the iRNA agents can target an htt
RNA and can include a sense and/or antisense sequence listed in
Table 1 or Table 2. In preferred embodiments, the iRNA agent
includes at least one modification in addition to the lipophilic
moiety for enhanced uptake into neural cells. The at least one
additional modification can be, e.g., a phosphorothioate or
2'O-methyl (2'OMe) modification. TABLE-US-00001 TABLE 1 iRNA Agents
targeting htt iRNA Agent ID Sequence.sup.a Strand.sup.b SEQ ID NO:
E1-4 5'-CCCUGGAAAAGCUGAUGACGG-chol S 3'-CUGGGACCUUUUCGACUACUU as
7246 5'-CCCUCAUCCACUGUGUGCCCU-chol S 3'-GAGGGAGUAGGUGACACACGU as
T2886C-6 5'-UGUGCUGACUCUGAGGAAAAG-chol S 3'-CUACACGACUGAGACUCCUUG
as E1-3 5'-CCCUGGAAAAGCUGAUGAAGG-chol S 3'-CUGGGACCUUUUCGACUACUU as
.sup.a"Chol" indicates cholesterol ligand; underlined nucleotides
are mismatched with respect to the antisense strand; bold
nucleotides represent SNP locations .sup.b"S" indicates sense
strand "as" indicates antisense strand
[0010] TABLE-US-00002 TABLE 2 siRNAs targeting Huntington
Oligonucleotide ligand conjugates ##STR1## 5'-(Cy-3) conjugate
##STR2## 3'-(Cy-3) conjugate ##STR3## 3'-Cholesterol conjugate
##STR4## 5'-(Cy-3), 3'-Cholesterol Conjugate Ligand building blocks
##STR5## 3'-(Cy-3) building block (CPG) ##STR6## 5'-(Cy-3) building
block ##STR7## Cholesterol conjugate building blocks Project/ Mass
Purity Target SEQ ID NO: ALN Seq. # Sequence 5'-3' Calc Found CGE
(%) htt 3005 5' CsCCUGGAAAAGCUGAUGACsGsG 3' 6822.3 6821.8 82.2 3006
5' UsUCAUCAGCUUUUCCAGGGsUsC 3' 6635.08 6634.63 85.6 htt 3007 5'
CsCsCUGGAAAAGCUGAUGAsCsGsG 3' 6854.43 6853.89 81.1 3008 5'
UsUsCAUCAGCUUUUCCAGGsGsUsC 3' 6667.21 6666.59 86.4 htt 3009 5'
UsGUGCUGACUCUGAGGAAAsAsG 3' 6824.27 6821.95 90.7 3010 5'
GsUUCCUCAGAGUCAGCACAsUsC 3' 6680.17 6979.8 88.2 htt 3011 5'
UsGsUGCUGACUCUGAGGAAsAsAsG 3' 6856.40 6856.13 90.2 3012 5'
GsUsUCCUCAGAGUCAGGACsAUC 3' 6712.30 6712.05 89.3 htt 3072 5' CsCC
U.sub.2'-OMeGG AAA AGC U.sub.2'-OMeGA U.sub.2'-OMeGA 6864.38
6863.79 87.9 CsGsG 3' htt 3073 5' U.sub.2'-OMesG U.sub.2'-Me GAC UC
U.sub.2'-OMeGAG 6880.38 6879.82 85.7 GAA AsAsG 3' htt 3076 5'
CCCUCAUCCACUGUGUGCCCU 3' 6520.8 6520.69 88.5 3077 5'
UGCACACAGUGGAUGAGGGAG 3' 6854.15 6853.92 86.3 htt 3108 5' -
CCACAUGAAGCAGCACGACUU-3' 6678.06 6677.93 89.1 3109 5'
AAGUCGUGCUGCUUCAUGUGG.sub.2'-OMeU.sub.2'-OMeC 3' 7345.37 7344.25
86.2 htt 3075 5' CsCCUGGAAAAGCUGAUGACsGsGs-Chol 3' 7542.37 7543.06
98.7 3112 5' Cy-3sCCCUGGAAAAGCUGAUGACsGsGs-Chol 3' 8363.08 8363
& 93.78 8179 htt 3137 5' CsCCUGGAAAAGCUGAUGACGsGs-Chot 3'
7526.30 7526.92 84.2 3142 5' CsCCUCAUCCACUGUGUGCCCsUs-Chol 3'
7273.06 7273.91 82.0 htt 3144 5' Cy-3sCsCCUCAUCCACUGUGUGCCCsUs-Chol
3' 7909.8 7961.3 89.0 3110 5' CCACAUGAAGCAGCACGACUU-Chol 3' 7382.06
7382.91 84.73 htt 3074 5' Cy-3-sCCCUGGAAAAGCUGAUGACsGsG 3' 7459.08
7458.07 78.43 htt 3111 5'
Cy-3-AAGUCGUGCUGCUUCAUGUGG.sub.2'-OMeU.sub.2'- 7981.37 7982.74 82.0
OMeC 3' htt 3112 5' Cy-3-sCCC UGG AAA AGC UGA UGA CsGsGs 8363.08
8363 & 93.78 Chol 3' 8179 3139 5'
Cy-3sCCCUGGAAAAGCUGAUGACGsGsChol 3' 8163.1 8165.0 89.2 htt 3143 5'
UsGCACACAGUGGAUGAGGGASGS-Cy-3 3' 7576.4 7577.0 81.2 3138 5'
UsUCAUCAGCUUUUCCAGGGUsCs-Cy-3 3' 7309.1 7308.3 86.0 `s` indicates
phosphorothioate; `N.sub.2'-OMe`, where N = A, C, G or U indicates
2'-O-methyl sugar modification; `Chol` stands for cholesterol
conjugate and `Cy-3` stands for a Cy3 conjugate (Cy3 Quasar
building blocks were purchased from Biosearch Technologies, Novato,
California).
[0011] In a preferred embodiment, the antisense strand of an iRNA
agent conjugated to a lipophilic agent has the sequence of an
antisense strand listed in Table 1 or Table 2, or differs from an
antisense strand listed in Table 1 or Table 2 by no more than 1, 2,
3, 4, or 5 nucleotides. In another preferred embodiment, the sense
strand of an iRNA agent conjugated to a lipophilic agent has the
sequence of an antisense strand listed in Table 1 or Table 2, or
differs from an antisense strand listed in Table 1 or Table 2 by no
more than 1, 2, 3, 4, or 5 nucleotides. In another preferred
embodiment, the antisense strand of the iRNA agent has at least one
modification described in Table 1 or Table 2 (e.g., a cholesterol,
2'-OMe, phosphorothioate, or Cy-3 modification). In another
preferred embodiment, the antisense strand will have the
modifications shown in Table 1 or Table 2. The antisense strand of
an iRNA agent can have one or fewer modifications, e.g., the type
shown in Table 1 or Table 2, or can have one or more additional
modifications, e.g., the type shown in Table 1 or Table 2. In
another preferred embodiment, the sense strand of the iRNA agent
has at least one modification described in Table 1 or Table 2
(e.g., a cholesterol, 2'-OMe, phosphorothioate, or Cy-3
modification). In another preferred embodiment, the sense strand
will have the modifications shown in Table 1 or Table 2. The sense
strand of an iRNA agent can have one or fewer modifications, e.g.,
the type shown in Table 1 or Table 2, or can have one or more
additional modifications, e.g., the type shown in Table 1 or Table
2.
[0012] In another embodiment, the iRNA agent targets an htt nucleic
acid. In one embodiment, the antisense strand of the iRNA agent
includes an antisense sequence described herein, e.g., an antisense
sequence listed in Table 1 or Table 2. In another embodiment, the
sense strand of the iRNA agent includes the nucleotide sequence of
a sense strand described herein, e.g., a sense sequence listed in
Table 1 or Table 2. In yet another embodiment, the antisense strand
of the iRNA agent overlaps an antisense sequence described herein,
e.g., an antisense sequence listed in Table 1 or Table 2, e.g., by
at least 1, 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, or 24 nucleotides. Likewise, the sense strand of the iRNA agent
overlaps a sense sequence described herein, e.g., a sense sequence
listed in Table 1 or Table 2, e.g., by at least 1, 5, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.
[0013] In a particularly preferred embodiment, the iRNA agent
targets a nucleic acid involved in a neurological disease. The iRNA
agent has an antisense strand complementary to a nucleotide
sequence of the target nucleic acid, and a sense strand
sufficiently complementary to hybridize to the antisense strand.
The iRNA agent also includes a liphophilic moiety that facilitates
its uptake into a neural cell. In a preferred embodiment, the
lipophilic moiety is a cholesterol. In another embodiment, the iRNA
agent includes a modification that improves the stability or
distribution of the iRNA agent in a biological sample. The iRNA
agents can further be in isolated form or can be part of a
pharmaceutical composition used for the methods described herein,
particularly as a pharmaceutical composition formulated for
delivery to a neural cell or formulated for parental
administration. The pharmaceutical compositions can contain one or
more iRNA agents, and in some embodiments, will contain two or more
iRNA agents. In one embodiment, the iRNA agent includes a
2'-modified nucleotide, e.g., a 2'-O-methylated nucleotide. In
another embodiment, the iRNA agent includes a phosphorothioate.
[0014] In another embodiment, the iRNA agent targets a wildtype
nucleic acid, e.g., a wildtype htt RNA, involved in the
pathogenesis of a neurological disorder, and in yet another
embodiment, the iRNA agent targets a polymorphism or mutation of
the nucleic acid. In certain embodiments, the iRNA agent can target
a sequence in a codon of the open reading frame, the 3'UTR or the
5'UTR of the mRNA transcript of the gene involved in the
neurological disorder. In one embodiment, the iRNA agent targets a
spliced isoform of mRNA.
[0015] In one embodiment, the human carries a form of the
huntingtin gene that includes an expanded CAG trinucleotide repeat,
i.e., more than 30 CAG trinucleotide repeats (e.g., 35, 40, 50, 60,
70, 80, 90, 100 or more CAG trinucleotide repeats), which results
in an abnormal form of the huntingtin polypeptide including an
expansion of the polypeptide's normal polyglutamine tract. In
another embodiment, the human is diagnosed with Huntington's
Disease (HD). In one embodiment, the human carries a polymorphism
or mutation in the huntingtin gene. For example, the human can
carry a polymorphism at position 171, e.g., an A171C polymorphism,
in the huntingtin gene according to the sequence numbering in
GenBank Accession No. NM.sub.--002111 (Aug. 8, 2005). In another
embodiment, the iRNA agent targets a nucleic acid that encodes a
polypeptide known to interact with the huntingtin protein. For
example, the iRNA agent can target a Huntingtin-associated
protein-1 (HAP-1) nucleic acid.
[0016] In a preferred embodiment, the iRNA agent modified for
enhanced uptake into neural cells does not target an
alpha-synuclein (SNCA) RNA.
[0017] In another embodiment, the iRNA agent modified for enhanced
uptake into neural cells, e.g., conjugated to a cholesterol, is at
least 21 nucleotides long and includes a sense RNA strand and an
antisense RNA strand, wherein the antisense RNA strand is 25 or
fewer nucleotides in length, and the duplex region of the iRNA
agent is 18-25 nucleotides in length. The iRNA agent may further
include a nucleotide overhang having 1 to 4 unpaired nucleotides,
and the unpaired nucleotides may have at least one phosphorothioate
dinucleotide linkage. The nucleotide overhang can be, e.g., at the
3' end of the antisense strand of the iRNA agent.
[0018] In one aspect, the invention features a method of down
regulating expression of a target gene in a neural cell. In one
embodiment the method includes contacting an iRNA agent with the
neural cell for a time sufficient to allow uptake of the iRNA agent
into the cell. In another embodiment, the iRNA agent includes a
sense strand and an antisense strand that form an RNA duplex. The
iRNA agent also comprises a lipophilic moiety, e.g., a cholesterol,
and the antisense strand of the iRNA agent comprises a nucleotide
sequence sufficiently complementary to a target sequence of about
18 to 25 nucleotides of an RNA expressed from the target gene. In a
preferred embodiment, the lipophilic moiety is conjugated to at
least one end of the sense strand, e.g., to the 3' end of the sense
strand. In another embodiment, the sense strand and the antisense
strand have a sequence selected from the sense and antisense
strands listed in Table 1 or Table 2.
[0019] In another aspect, the invention features a method of
treating a human that includes identifying a human diagnosed as
having or at risk for developing a neurological disorder, and
administering to the human an iRNA agent that targets a gene
expressed in a neural cell. In one embodiment, expression of the
gene is associated with symptoms of the neurological disorder. In
another embodiment, the iRNA agent includes a sense strand and an
antisense strand that form an RNA duplex, and the iRNA agent
includes a lipophilic moiety, e.g., a cholesterol. In another
embodiment, the antisense strand of the iRNA agent includes a
nucleotide sequence sufficiently complementary to a target sequence
of about 18 to 25 nucleotides of an RNA expressed from the target
gene. In a preferred embodiment, the lipophilic moiety is
conjugated to at least one end of the sense strand, e.g., to the 3'
end of the sense strand, and in another embodiment, the iRNA agent
includes a phosphorothioate or a 2' modification, e.g., a 2'OMe or
2'O-fluoro modification. In one embodiment, the sense and antisense
strands include a sequence selected from the sense and antisense
strands listed in Table 1 or Table 2.
[0020] In one embodiment, the antisense strand of the iRNA agent
includes a sequence complementary to a polymorphism of an htt RNA.
In another embodiment, the human has or is at risk for developing
Huntington's disease. In another embodiment, the human carries a
genetic variation in a Parkin gene or a ubiquitin carboxy-terminal
hydrolase L1 (UCHL1) gene, and the human has or is at risk for
developing Parkinson's disease. In another embodiment, the human
has or is at risk for developing Alzheimer's Disease, multiple
system atrophy, or Lewy body dementia.
[0021] In another aspect, the invention features a pharmaceutical
composition including an iRNA agent conjugated to a lipophilic
moiety for enhanced uptake into neural cells, e.g., conjugated to a
cholesterol molecule, and a pharmaceutically acceptable carrier.
Preferably, the iRNA agent targets a nucleic acid involved in a
neurological disease or disorder.
[0022] In a particularly preferred embodiment, the pharmaceutical
composition includes an iRNA agent targeting an htt nucleic acid
and a pharmaceutically acceptable carrier. The iRNA agent has an
antisense strand complementary to a nucleotide sequence of an htt
RNA, and a sense strand sufficiently complementary to hybridize to
the antisense strand. In one embodiment, the iRNA agent includes a
lipophilic moiety that facilitates its uptake into a neural cell.
In one embodiment, the lipophilic moiety is a ligand that includes
a cationic group. In another embodiment, the lipophilic moiety is
attached to one or both ends of one or both strands of the iRNA
agent. In a preferred embodiment, the lipophilic moiety is attached
to one end of the sense strand of the iRNA agent, and in another
preferred embodiment, the ligand is attached to the 3' end of the
sense strand. In certain embodiments, the lipophilic agent is, e.g,
cholesterol, vitamin E, vitamin K, vitamin A, folic acid or a
cationic dye, such as Cy3. In a preferred embodiment, the
lipophilic moiety is a cholesterol.
[0023] In another embodiment, the iRNA agent of the pharmaceutical
composition includes a modification that improves the stability or
distribution of the iRNA agent in a biological sample. The iRNA
agents can further be in isolated form or can be part of a
pharmaceutical composition used for the methods described herein,
particularly as a pharmaceutical composition formulated for
delivery to a neural cell or formulated for parental
administration. The pharmaceutical compositions can contain one or
more iRNA agents, and in some embodiments, will contain two or more
iRNA agents. In one embodiment, the iRNA agent includes a
2'-modified nucleotide, e.g., a 2'-O-methylated nucleotide. In
another embodiment the iRNA agent includes a phosphorothioate.
[0024] In a particularly preferred embodiment, htt RNA levels in a
neural cell are reduced by contacting the neural cell of the
subject with an iRNA agent modified for enhanced uptake into neural
cells. In a preferred embodiment, the ligand is a cholesterol.
[0025] In another aspect, the invention features a method of making
an iRNA agent that targets a nucleic acid expressed in neural cells
and that is modified for enhanced uptake into neural cells. The
method includes selecting a nucleotide sequence of between 18 and
25 nucleotides long from the nucleotide sequence of a target mRNA,
e.g., an htt mRNA, and synthesizing the iRNA agent. The sense
strand of the iRNA agent includes the nucleotide sequence selected
from the target RNA, and the antisense strand is sufficiently
complementary to hybridize to the sense strand. The method includes
incorporating at least one lipophilic moiety into the iRNA agent,
e.g., onto at least one end of the sense strand of the iRNA agent.
In a preferred embodiment, the lipophilic moiety is incorporated
onto the 3' end of the sense strand of the iRNA agent. In one
embodiment, a cationic dye, e.g., Cy3, is incorporated into at
least one strand of the iRNA agent, e.g., on the 3' or 5' end of
the iRNA agent. In one embodiment, more than one lipophilic moiety,
e.g., more than one different kind of lipophilic moiety is
incorporated into the iRNA agent. In certain embodiments, the iRNA
agent includes the ligand conjugates illustrated in Table 1 or
Table 2. In other embodiments the method of making the iRNA agent
includes use of the building blocks illustrated in Table 1 or Table
2. In yet other embodiments, the methods featured in the invention
include methods of making the iRNA agents listed in Table 1 or
Table 2, which target htt RNA. In one embodiment, the method
further includes administering the iRNA agent to a subject, e.g., a
mammalian subject, such as a human subject, such as a human having
or at risk for developing a neurological disease or disorder. In
one embodiment, the human has or is at risk for developing HD.
[0026] In another aspect, the invention features a method of
evaluating an iRNA agent, e.g., an iRNA agent conjugated with a
lipophilic agent for enhanced uptake into neural cells. The method
includes: providing a candidate iRNA agent modified for enhanced
uptake into neural cells, e.g., conjugated with a cholesterol
molecule and determining whether the iRNA agent is taken up into
neural cells. In one embodiment, the iRNA agent is conjugated with
a detectable marker, e.g., a fluorescent marker, such as Cy3 or
Cy5, and uptake into the cell is assayed by fluorescence. In
another embodiment e.g., by the use of one or more of the test
systems described herein, if said candidate agent modulates, e.g.,
inhibits, target gene expression.
[0027] In a preferred embodiment the method includes evaluating the
iRNA agent in a first test system; and, if a predetermined level of
gene expression is observed, evaluating the candidate in a second,
preferably different, test system. In a particularly preferred
embodiment the second test system includes administering the
candidate iRNA agent to a neural cell of an animal and evaluating
the effect of the candidate agent on target gene expression in the
animal.
[0028] A test system can include: contacting the candidate iRNA
agent with a target nucleic acid, e.g., a nucleic acid expressed in
neural cells, such as an htt RNA. The iRNA is preferably contacted
with the target nucleic acid in vitro, and it is determined whether
there is an interaction, e.g., binding of the candidate agent to
the target. The test system can include contacting the candidate
agent with a neural cell and evaluating modulation of neural gene
expression, e.g., htt gene expression. For example, this can
include contacting the candidate iRNA agent with a neural cell
capable of expressing htt RNA (from an endogenous gene or from an
exogenous construct) and evaluating the level of htt or htt RNA. In
a preferred embodiment, the candidate iRNA agent includes a
modification that enhances uptake of the candidate iRNA agent into
the neural cell. In a particularly preferred embodiment, the
modification is a cholesterol molecule, e.g., a cholesterol
attached to the sense strand of the iRNA agent, e.g., to the 3' end
of the sense strand. In another embodiment the test system can
include contacting the candidate agent with a cell which expresses
an RNA or protein from a portion of the neural gene linked to a
heterologous sequence, e.g., a marker protein, e.g., a fluorescent
protein such as GFP, which construct can be either chromosomal or
episomal, and determining the effect on RNA or protein levels. The
test system can also include contacting the candidate iRNA agent,
in vitro, with a tissue sample, e.g., a brain tissue sample, e.g.,
a slice or section, an optical tissue sample, or other sample which
includes neural tissue, and evaluating the level of neural
polypeptide or RNA, e.g., htt polypeptide or RNA. The test system
can include administering the candidate iRNA agent, in vivo, to an
animal, and evaluating the level of neural polypeptide or neural
RNA, e.g., htt polypeptide or htt RNA. In any of these, the effect
of the candidate agent on neural gene expression can include
comparing gene expression with a predetermined standard, e.g., with
control, e.g., an untreated cell, tissue or animal. Gene expression
can be compared, e.g., before and after contacting with the
candidate iRNA agent. The method allows determining whether the
iRNA agent is useful for inhibiting htt gene expression.
[0029] A "neural gene" is a gene expressed in neural cells. A
neural gene can be expressed exclusively in neural cells, or can be
expressed in other cell types in addition to the neural cell.
[0030] In one embodiment, neural gene expression can be evaluated
by a method to examine neural RNA levels (e.g., Northern blot
analysis, RT-PCR, or RNAse protection assay) or neural polypeptide
levels (e.g., Western blot, immunohistochemistry, or
autofluorescence assays (e.g., to detect GFP or luciferase
expression)).
[0031] A "neural cell" is a cell of the nervous system, e.g., the
peripheral or the central nervous system. A neural cell can be a
nerve cell (i.e., a neuron), e.g., a sensory neuron or a
motoneuron, or a glial cell. Exemplary neurons include dorsal root
ganglia of the spinal cord, spinal motor neurons, retinal bipolar
cells, cortical and striatal cells of the brain, hippocampal
pyramidal cells, and purkinje cells of the cerebellum. Exemplary
glial cells include oligodendrocytes and astrocytes of the central
nervous system, and the Schwann cells of the peripheral nervous
system.
[0032] By "enhanced uptake into neural cells" is meant that higher
levels of a modified iRNA agent are incorporated into a neural cell
than unmodified iRNA agent when the cells exposed to each type of
iRNA agent are treated under similar conditions, in in vitro or in
vivo conditions.
[0033] In one embodiment, e.g., as a second test, the agent is
administered to an animal, e.g., a mammal, such as a mouse, rat,
rabbit, human, or non-human primate, and the animal is monitored
for an effect of the agent. For example, a tissue of the animal,
e.g., a brain tissue, is examined for an effect of the agent on
neural gene expression. The tissue can be examined for the presence
of neural RNA and/or protein levels, for example. In one
embodiment, the animal is observed to monitor an improvement or
stabilization of a cognitive symptom. The agent can be administered
to the animal by any method, e.g., orally, or by intrathecal or
parenchymal injection, such as by stereoscopic injection into the
brain.
[0034] In a particularly preferred embodiment, the invention
features a method of evaluating an iRNA agent, e.g., an iRNA agent
described herein, that targets a nucleic acid expressed in neural
cells, e.g., an htt nucleic acid. The method includes providing an
iRNA agent that targets a nucleic acid expressed in neural cells
(e.g., an htt RNA); contacting the iRNA agent with a neural cell
containing and capable of expressing the nucleic acid; and
evaluating the effect of the iRNA agent on expression of the
nucleic acid, e.g., by comparing gene expression with a control,
e.g., in the cell. Gene expression can be compared, e.g., before
and after contacting the iRNA agent with the cell. The method
allows determining whether the iRNA agent is useful for inhibiting
gene expression. For example, the iRNA agent can be determined to
be useful for inhibiting neural gene expression if the iRNA agent
reduces expression by a predetermined amount, e.g., by 10, 25, 50,
75, or 90%, e.g., as compared with a predetermined reference value,
e.g., as compared with the amount of neural RNA or protein prior to
contacting the iRNA agent with the cell. The neural gene can be
endogenously or exogenously expressed.
[0035] The methods and compositions featured in the invention,
e.g., the methods and iRNA compositions to treat the neurological
disorders described herein, can be used with any dosage and/or
formulation described herein, as well as with any route of
administration described herein.
[0036] Thus, in another aspect, the invention features a method of
treating a subject by administering an agent which inhibits the
expression of a gene in a neural cell. In a preferred embodiment,
the subject is a mammal, such as a human, e.g., a subject diagnosed
as having, or at risk for developing a neurological disease or
disorder. Agents that inhibit neural gene expression include iRNA
agents and antisense molecules that target htt RNA.
[0037] A "substantially identical" sequence includes a region of
sufficient homology to the target gene, and is of sufficient length
in terms of nucleotides, that the iRNA agent (e.g., the iRNA agent
conjugated to a lipophilic moiety for enhanced uptake into neural
cells), or a fragment thereof, can mediate down regulation of the
target gene. A sequence of the iRNA agent that is substantially
identical to a target RNA is typically a sequence on the sense
strand of a double stranded iRNA agent.
[0038] A "substantially complementary" sequence includes a region
of sufficient complementarity to the target gene, and is of
sufficient length in terms of nucleotides, that the iRNA agent
(e.g., the iRNA agent conjugated to a lipophilic moiety for
enhanced uptake into neural cells), or a fragment thereof, can
mediate down regulation of the target gene. A sequence of the iRNA
agent that is substantially complementary to a target RNA is
typically a sequence on the antisense strand of a double stranded
iRNA agent. Thus, the iRNA agent is or includes a region which is
at least partially, and in some embodiments fully, complementary to
a target RNA transcript, e.g, an RNA transcript expressed in a
neural cell. It is not necessary that there be perfect
complementarity between the iRNA agent and the target, but the
correspondence must be sufficient to enable the iRNA agent, or a
cleavage product thereof, to direct sequence specific silencing,
e.g., by RNAi cleavage of the target RNA, e.g., mRNA.
Complementarity, or degree of homology with the target strand, is
most critical in the antisense strand. While perfect
complementarity, particularly in the antisense strand, is often
desired some embodiments can include, particularly in the antisense
strand, one or more but preferably 6, 5, 4, 3, 2, or fewer
mismatches (with respect to the target RNA). The mismatches,
particularly in the antisense strand, are most tolerated in the
terminal regions and if present are preferably in a terminal region
or regions, e.g., within 6, 5, 4, or 3 nucleotides of the 5' and/or
3' terminus. The sense strand need only be sufficiently
complementary with the antisense strand to maintain the overall
double strand character of the molecule.
[0039] An "RNA agent" as used herein, is an unmodified RNA,
modified RNA, or nucleoside surrogates, which are described herein
or are well known in the RNA synthetic art. While numerous modified
RNAs and nucleoside surrogates are described, preferred examples
include those which have greater resistance to nuclease degradation
than do unmodified RNAs. Preferred examples include those that have
a 2' sugar modification, a modification in a single strand
overhang, preferably a 3' single strand overhang, or, particularly
if single stranded, a 5' modification which includes one or more
phosphate groups or one or more analogs of a phosphate group.
[0040] An "iRNA agent" (abbreviation for "interfering RNA agent")
as used herein, is an RNA agent, which can downregulate the
expression of a target gene, preferably an endogenous or pathogen
target RNA expressed in a neural cell. While not wishing to be
bound by theory, an iRNA agent may act by one or more of a number
of mechanisms, including post-transcriptional cleavage of a target
mRNA sometimes referred to in the art as RNAi, or
pre-transcriptional or pre-translational mechanisms. An iRNA agent
is preferably a double stranded (ds) iRNA agent.
[0041] The details of one or more embodiments of the invention are
set forth in the accompanying drawings and the description below.
Other features, objects, and advantages of the invention will be
apparent from this description, and from the claims. This
application incorporates all cited references, patents, and patent
applications by references in their entirety for all purposes.
BRIEF DESCRIPTION OF DRAWINGS
[0042] FIGS. 1A-1D. Images of in situ staining for pathological
hallmarks of Huntington's disease found in mice treated with
lentivirus-mut-htt. Staining was by immunohistochemistry against
htt protein. FIG. 1A is an in situ stain of striatum tissue. FIGS.
1B, 1C and 1D are in situ stains of the striatum near the globus
pallidus. Scale bar=25 .mu.m.
[0043] FIGS. 2A-2F. Intrastriatal injection of
cholesterol-conjugated dsRNA AL-DP-1799 targeting huntingtin
changes pattern of cellular huntingtin-immunoreactivity in a mouse
model of Huntington's disease.
[0044] FIGS. 3A-3B. Intrastriatal injection of
cholesterol-conjugated dsRNA AL-DP-1799 targeting huntingtin
reduces size of huntingtin-immunoreactive inclusions in cortex and
striatum, and reduces neuropil aggregates in a mouse model of
Huntington's disease.
[0045] FIGS. 4A-4B. Intrastriatal injection of
cholesterol-conjugated dsRNA AL-DP-1799 targeting huntingtin
increases the number of huntingtin-immunoreactive cells in striatum
in a mouse model of Huntington's disease.
[0046] FIG. 5. Intrastriatal injection of cholesterol-conjugated
dsRNA AL-DP-1799 targeting huntingtin reduces abnormal clasping
behavior in a mouse model of Huntington's disease.
DETAILED DESCRIPTION
[0047] Double-stranded RNA (dsRNA) directs the sequence-specific
silencing of mRNA through a process known as RNA interference
(RNAi). The process occurs in a wide variety of organisms,
including mammals and other vertebrates.
[0048] It has been demonstrated that 21-23 nt fragments of dsRNA
are sequence-specific mediators of RNA silencing, e.g., by causing
RNA degradation. While not wishing to be bound by theory, it may be
that a molecular signal, which may be merely the specific length of
the fragments, present in these 21-23 nt fragments, recruits
cellular factors that mediate RNAi. Described herein are methods
for preparing and administering these 21-23 nt fragments, and other
iRNA agents, and their use for specifically inactivating gene
function in neural cells. The use of iRNA agents (or recombinantly
produced or chemically synthesized oligonucleotides of the same or
similar nature) enables the targeting of specific mRNAs for
silencing in mammalian cells. In addition, longer dsRNA agent
fragments can also be used, e.g., as described below.
[0049] Although, in mammalian cells, long dsRNAs can induce the
interferon response which is frequently deleterious, short dsRNAs
(sRNAs) do not trigger the interferon response, at least not to an
extent that is deleterious to the cell and host. In particular, the
length of the iRNA agent strands in an sRNA agent can be less than
31, 30, 28, 25, or 23 nt, e.g., sufficiently short to avoid
inducing a deleterious interferon response. Thus, the
administration of a composition of sRNA agent (e.g., formulated as
described herein) to a mammalian cell can be used to silence
expression of a target gene while circumventing the interferon
response. Further, use of a discrete species of iRNA agent can be
used to selectively target one allele of a target gene, e.g., in a
subject heterozygous for the allele.
[0050] Moreover, in one embodiment, a mammalian cell is treated
with an iRNA agent that disrupts a component of the interferon
response, e.g., dsRNA-activated protein kinase PKR. Such a cell can
be treated with a second iRNA agent that includes a sequence
complementary to a target RNA and that has a length that might
otherwise trigger the interferon response.
[0051] In a typical embodiment, the subject is a mammal such as a
cow, horse, mouse, rat, dog, pig, goat, or a primate. The subject
can be a dairy mammal (e.g., a cow, or goat) or other farmed animal
(e.g., a chicken, turkey, sheep, pig, fish, shrimp). In a much
preferred embodiment, the subject is a human, e.g., a normal
individual or an individual that has, is diagnosed with, or is
predicted to have a neurological disease or disorder.
[0052] A neurological disease or disorder is any disease or
disorder that affects the nervous system (the central or peripheral
nervous system). Exemplary neurological diseases and disorders
include Huntingtons's Disease (HD), Parkinson's Disease (PD),
Amyotropic Lateral Sclerosis (ALS), Alzheimer's Disease, Lewy body
dementia, Multiple System Atrophy, spinal and bulbar muscular
atrophy (Kennedy's disease), Tourette Syndrome, Autosomal dominant
spinocerebellar ataxia (SCA) (e.g., Type 1 SCA1, Type 2 SCA2, Type
3 (Machado-Joseph disease) SCA3/MJD, Type 6 SCA6, Type 7 SCA7, Type
8 SCA8, Friedreich's Ataxia and Dentatorubral pallidoluysian
atrophy DRPLA/Haw-River syndrome), schizophrenia, age associated
memory impairment, autism, attention-deficit disorder, bipolar
disorder, and depression.
[0053] Because oligonucleotide agent-mediated modulation persists
for several days after administering the oligonucleotide agent
composition, in many instances it is possible to administer the
composition with a frequency of less than once per day, or, for
some instances, only once for the entire therapeutic regimen. For
example, treatment of some cancerous neural cells may be mediated
by a single bolus administration, whereas a chronic viral infection
may require regular administration, e.g., once per week or once per
month. For example, treatment of an astrocytoma may be treated with
a single bolus administration of an iRNA agent conjugated to a
lipophilic agent.
Treatment of Neurological Diseases and Disorders
[0054] Any patient having a neurological disease or disorder is a
candidate for treatment with a method or composition described
herein. Presymptomatic subjects can also be candidates for
treatment with an iRNA agent targeted to neural cells. For example,
a presymptomatic human determined to be at risk for HD is a
candidate for treatment with an anti-htt iRNA agent conjugated to a
lipophilic molecule, e.g., a cholesterol molecule, for delivery to
neural cells. In one embodiment, a presymptomatic candidate is
identified by either or both of risk-factor profiling and
functional neuroimaging (e.g., by fluorodopa and positron emission
tomography). For example, the candidate subject can be identified
by risk-factor profiling followed by functional neuroimaging.
[0055] Individuals having a particular genotype are candidates for
treatment. In some embodiments the patient will carry a particular
genetic mutation that places the patient at increased risk for
developing a disorder of the nervous system, e.g., HD. For example,
an individual carrying a CAG trinucleotide expansion in htt (e.g.,
more than 36 repeats) is at increased risk for developing HD and is
a candidate for treatment with an iRNA agent featured in the
invention, e.g., conjugated to a cholesterol molecule for enhanced
uptake into neural cells. The iRNA agent preferably targets the htt
gene. In addition, a SNP in the htt gene has been found to be an
indicator of the presence of the expanded CAG repeat that triggers
HD. The SNP is an A to C polymorphism at position 171, according to
the numbering of GenBank Accession No. NM.sub.--0021 11. A human
carrying this SNP is therefore a candidate for treatment with an
iRNA agent featured in the invention, or is at least a candidate
for further genetic studies (such as for testing for the CAG repeat
expansion) which will further determine if the human is a candidate
for treatment with an iRNA agent targeting htt and modified for
enhanced delivery to neurons.
[0056] In another example, the non-genetic risk factors for PD
include age (e.g., over age 30, 35, 40, 45, or 50 years), gender
(men are generally have a higher risk than women), pesticide
exposure, heavy metal exposure, and head trauma. In general,
exogenous and endogenous factors that disrupt the ubiquitin
proteasomal pathway or more specifically inhibit the proteasome, or
which disrupt mitochondrial function, or which yield oxidative
stress can increase the risk of an individual for developing PD,
and can contribute to the pathogenesis of PD. These factors can be
considered when evaluating the risk profile of a candidate subject
for treatment with an iRNA agent modified for enhanced uptake into
a neural cell, e.g., conjugated to a cholesterol molecule.
Design and Selection of iRNA Agents
[0057] Candidate iRNA agents can be designed by performing, for
example, a gene walk analysis. Overlapping, adjacent, or closely
spaced candidate agents corresponding to all or some of the
transcribed region can be generated and tested. Each of the iRNA
agents can be tested and evaluated for the ability to down regulate
target gene expression (see below, "Evaluation of Candidate iRNA
agents").
[0058] An iRNA agent can be rationally designed based on sequence
information and desired characteristics. For example, an iRNA agent
can be designed according to the relative melting temperature of
the candidate duplex. Generally, the duplex will have a lower
melting temperature at the 5' end of the antisense strand than at
the 3' end of the antisense strand. This and other elements of
rational design are discussed in greater detail below (see, e.g.,
sections labeled ""Palindromes," "Asymmetry," and "Z-X-Y," and
"Differential Modification of Terminal Duplex Stability" and
"Other-than-Watson-Crick Pairing."
Evaluation of Candidate iRNA Agents
[0059] A candidate iRNA agent, e.g., a candidate iRNA agent
conjugated to a lipophilic moiety, can be evaluated for its ability
to be taken up into neural cells. For example, a candidate iRNA
agent conjugated to a lipophilic moiety is provided in a solution
that does not contain an additional lipophilic moiety or
transfection reagent to facilitate uptake into the cell.
"Transfection reagents" include ions or other substances which
substantially alter cell permeability to an oligonucleotide agent.
Exemplary transfecting agents include Lipofectamine.TM.
(Invitrogen, Carlsbad, Calif.), Lipofectamine 2000.TM.,
TransIT-TKO.TM. (Mirus, Madison, Wis.), FuGENE 6 (Roche,
Indianapolis, Ind.), polyethylenimine, X-tremeGENE Q2 (Roche,
Indianapolis, Ind.), DOTAP, DOSPER, Metafectene.TM. (Biontex,
Munich, Germany), or another transfection reagent.
[0060] The candidate iRNA agent conjugated to a lipophilic moiety
can be evaluated in a cell culture system, such as in a neural cell
culture. If a predetermined level of uptake into neural cells is
observed, the candidate iRNA agent can be evaluating in an animal,
e.g., in a mouse, rat, rabbit, dog, cat, or monkey. The cell
cultures can be mammalian cell cultures, such as mouse, rat or
human cell cultures. Exemplary neural cell cultures include
cortical cell lines, striatal cell lines (e.g., ST14A),
pheocromocytoma cell lines (e.g., PC12), neuroblastoma cell lines
(e.g., N2a), and the like. The cell cultures can be, for example,
non-tumor- or tumor-derived neuronal cell lines, and can be derived
from, for example, a glioma, glioblastoma, meduloblastoma,
retinoblastoma, or a neuroendocrine cell line. Exemplary cell lines
can be provided by the American Type Culture Collection (ATCC)
(Manassus, Va.).
[0061] A candidate iRNA agent that includes a lipophilic moiety,
e.g., a cholesterol, can include an antisense strand that is
substantially complementary to a target RNA in the neural cell,
e.g., an htt RNA, and the method of evaluating the iRNA agent can
include determining whether the agent decreases expression of the
target RNA in the cell.
[0062] A candidate iRNA agent that can be taken up into neural
cells can be further tested for uptake into a neural cell in vivo.
For example, following administration of the iRNA agent, such as by
direct injection into the animal, e.g., into the brain of the
animal, the tissue at the site of injection can be examined for
uptake of the iRNA agent. Detection of the iRNA agent can be
accomplished by a variety of methods. For example, if the iRNA
agent is labeled with a fluorescent molecule, such as Cy3, Cy5,
rhodamine or FITC label, uptake of the iRNA agent can be assayed by
monitoring for the uptake of the fluorescent label. Detection can
also be accomplished by in situ hybridization with an
oligonucleotide probe, e.g., to detect the presence of the iRNA.
Assays to detect target gene product (target RNA or protein) can
also be used to monitor uptake of the candidate iRNA agent into
neural cells. Detection can be, for example, by in situ
hybridization with an oligonucleotide probe to detect the target
RNA or by immunohistochemistry techniques to detect the target
polypeptide. Alternatively, target RNA or protein can be isolated
from the tissue containing the neural cells, and the RNA detected
by, e.g., Northern blot, RT-PCR, or RNAse protection assay, or the
target protein detected by Western blot analysis. If a decreased
level of RNA or protein is detected, it can be determined that a
sufficient amount of iRNA agent is entering the cell to cause the
observed decrease in RNA or protein expression.
[0063] For example, a candidate iRNA agent conjugated with a
lipophilic moiety can be provided, and contacted with a neural
cell, e.g., a neural cell that expresses a target gene, such as the
htt gene. The level of target gene expression prior to and
following contact with the candidate iRNA agent can be compared.
The target gene can be an endogenous or exogenous gene within the
cell. If it is determined that the amount of RNA or protein
expressed from the target gene is lower following contact with the
iRNA agent, then it can be concluded that the iRNA agent down
regulates target gene expression. The level of target RNA or
protein in the cell can be determined by any method desired. For
example, the level of target RNA can be determined by Northern blot
analysis, reverse transcription coupled with polymerase chain
reaction (RT-PCR), or RNAse protection assay. The level of protein
an be determined by, for example, Western blot analysis.
[0064] The iRNA agent conjugated with a lipophilic moiety, e.g., a
cholesterol, can be tested in an in vitro or/and in an in vivo
system. For example, the target gene or a fragment thereof can be
fused to a reporter gene on a plasmid. The plasmid can be
transfected into a cell, e.g., a neural cell, with a candidate iRNA
agent. The efficacy of the iRNA agent can be evaluated by
monitoring expression of the reporter gene. The reporter gene can
be monitored in vivo, such as by fluorescence or in situ
hybridization. Exemplary fluorescent reporter genes include but are
not limited to green fluorescent protein and luciferase. Expression
of the reporter gene can also be monitored by Northern blot,
RT-PCR, RNAse-protection assay, or Western blot analysis as
described above.
[0065] Efficacy of an iRNA agent conjugated to a lipophilic moiety,
e.g., cholesterol, can be tested in a mammalian cell line, e.g., a
mammalian neural cell line, such as a human neuroblastoma cell
line. For example, a cell line useful for testing efficacy of an
anti-htt iRNA agent is a striatal cell line, e.g. ST14A cell line.
Other mammalian neural cell lines that can take up an iRNA agent
conjugated with a lipophilic moiety include, e.g., neuronally
differentiated phaeochromocytomas (e.g., PC12 cells), primary
neuronal cultures (e.g., isolated from a mouse or rat and cultured
immediately), and neuroblastoma cell lines. Neuroblastoma cell
lines include BE(2)-M17, SH-SY5Y (both human) and N2a (mouse).
[0066] Controls include: [0067] (1) testing the efficacy and
specificity of an iRNA agent by assaying for a decrease in
expression of the target gene by, for example, comparison to
expression of an endogenous or exogenous off-target RNA or protein;
and [0068] (2) testing specificity of the effect on target gene
expression by administering a "nonfunctional" iRNA agent.
[0069] Nonfunctional control iRNA agents can: [0070] (a) target a
gene not expressed in the cell; [0071] (b) be of nonsensical
sequence (e.g., a scrambled version of the test iRNA); or [0072]
(c) have a sequence complementary to the target gene, but be known
by previous experiments to lack an ability to silence gene
expression.
[0073] A candidate iRNA agent conjugated to a lipophilic molecule
can include other modifications for nuclease resistance. Resistance
to a degradent can be evaluated as follows. A candidate modified
iRNA agent (and preferably a control molecule, usually one that
does not include the modification believed to be required for
nuclease resistance) can be exposed to degradative conditions,
e.g., exposed to a milieu, which includes a degradative agent,
e.g., a nuclease. E.g., one can use a biological sample, e.g., one
that is similar to a milieu, which might be encountered, in
therapeutic use, e.g., blood or a cellular fraction, e.g., a
cell-free homogenate or disrupted cells. The candidate and control
could then be evaluated for resistance to degradation by any of a
number of approaches. For example, the candidate and control could
be labeled, preferably prior to exposure, with, e.g., a radioactive
or enzymatic label, or a fluorescent label, such as Cy3 or Cy5.
Control and modified RNA's can be incubated with the degradative
agent, and optionally a control, e.g., an inactivated, e.g., heat
inactivated, degradative agent. A physical parameter, e.g., size,
of the modified and control molecules are then determined. They can
be determined by a physical method, e.g., by polyacrylamide gel
electrophoresis or a sizing column, to assess whether the molecule
has maintained its original length, or assessed functionally.
Alternatively, Northern blot analysis can be used to assay the
length of an unlabeled modified molecule.
[0074] A functional assay can also be used to evaluate the
candidate agent. A functional assay can be applied initially or
after an earlier non-functional assay, (e.g., assay for resistance
to degradation) to determine if the modification alters the ability
of the molecule to silence gene expression. For example, a cell,
e.g., a mammalian cell, such as a mouse or human cell, can be
co-transfected with a plasmid expressing a fluorescent protein,
e.g., GFP, and a candidate RNA agent homologous to the transcript
encoding the fluorescent protein. For example, a modified siRNA
homologous to the GFP mRNA can be assayed for the ability to
inhibit GFP expression by monitoring for a decrease in cell
fluorescence, as compared to a control cell, in which the
transfection did not include the candidate siRNA, e.g., controls
with no agent added and/or controls with a non-modified RNA added.
Efficacy of the candidate agent on gene expression can be assessed
by comparing cell fluorescence in the presence of the modified and
unmodified iRNA agents.
[0075] The effect of the modified iRNA agent on target RNA levels
can be verified by Northern blot to assay for a decrease in the
level of target mRNA, or by Western blot to assay for a decrease in
the level of target protein, as compared to a negative control.
Controls can include cells in which no agent is added and/or cells
in which a non-modified iRNA agent is added.
[0076] Assays can include time course experiments to monitor
stability and duration of silencing by an iRNA agent and monitoring
in dividing versus nondividing cells. Presumably in dividing cells,
the iRNA agent is diluted out over time, thus decreasing the
duration of the silencing effect. The implication is that dosage
will have to be adjusted in vivo, and/or an iRNA agent will have to
be administered more frequently to maintain the silencing effect.
To monitor nondividing cells, cells can be arrested by serum
withdrawal. Neurons are post-mitotic cells, and thus neural cells
are aptly suited for assaying the stability of iRNA agents, such as
an anti-htt iRNA agent, for use in therapeutic compositions for the
treatment of disorders of the nervous system, e.g., neurological
disorders, such as HD.
[0077] A candidate iRNA agent can also be evaluated for
cross-species reactivity. For example, cell lines derived from
different species (e.g., mouse vs. human) or in biological samples
(e.g., serum or tissue extracts) isolated from different species
can be transfected with a candidate iRNA agent conjugated to a
lipophilic moiety, e.g., cholesterol. The efficacy of the iRNA
agent can be determined for the cell from the different
species.
Stability Testing, Modification, and Retesting of iRNA Agents
[0078] A candidate iRNA agent conjugated with a lipophilic agent
for enhanced uptake into neural cells can be evaluated with respect
to its susceptibility to cleavage by an endonuclease or
exonuclease, such as when the iRNA agent is introduced into the
body of a subject. Methods can be employed to identify sites that
are susceptible to modification, particularly cleavage, e.g.,
cleavage by a component found in the body of a subject. The
component (e.g., an exonuclease or endonuclease) can be specific
for a particular area of the body, such as a particular tissue,
organ, or bodily fluid (e.g., blood, plasma, or serum). Sites in an
iRNA agent that are susceptible to cleavage, either by
endonucleolytic or exonucleolytic cleavage, in certain areas of the
body, may be resistant to cleavage in other areas of the body. An
exemplary method includes:
[0079] (1) determining the point or points at which a substance
present in the body of a subject, and preferably a component
present in a compartment of the body into which a therapeutic dsRNA
is to be introduced (this includes compartments into which the
therapeutic is directly introduced, e.g., the circulation, as well
as in compartments to which the therapeutic is eventually targeted;
in some cases, e.g, the eye or the brain the two are the same),
cleaves a dsRNA, e.g., an iRNA agent, and
[0080] (2) identifying one or more points of cleavage, e.g.,
endonucleolytic, exonucleolytic, or both, in the dsRNA. Optionally,
the method further includes providing an RNA modified to inhibit
cleavage at such sites.
[0081] These steps can be accomplished by using one or more of the
following assays: [0082] (i) (a) contacting a candidate dsRNA,
e.g., an iRNA agent, with a test agent (e.g., a biological agent),
[0083] (b) using a size-based assay, e.g., gel electrophoresis to
determine if the iRNA agent is cleaved. In a preferred embodiment a
time course is taken and a number of samples incubated for
different times are applied to the size-based assay. In preferred
embodiments, the candidate dsRNA is not labeled. The method can be
a "stains all" method. [0084] (ii) (a) supplying a candidate dsRNA,
e.g., an iRNA agent, which is radiolabeled; [0085] (b) contacting
the candidate dsRNA with a test agent, [0086] (c) using a
size-based assay, e.g., gel electrophoresis to determine if the
iRNA agent is cleaved. In a preferred embodiment a time course is
taken where a number of samples are incubated for different times
and applied to the size-based assay. In preferred embodiments, the
determination is made under conditions that allow determination of
the number of nucleotides present in a fragment. E.g., an incubated
sample is run on a gel having markers that allow assignment of the
length of cleavage products. The gel can include a standard that is
a "ladder" digestion. Either the sense or antisense strand can be
labeled. Preferably only one strand is labeled in a particular
experiment. The label can be incorporated at the 5' end, 3' end, or
at an internal position. Length of a fragment (and thus the point
of cleavage) can be determined from the size of the fragment based
on the ladder and mapping using a site-specific endonuclease such
as RNAse T1. [0087] (iii) fragments produced by any method, e.g.,
one of those above, can be analyzed by mass spectrometry. Following
contacting the iRNA with the test agent, the iRNA can be purified
(e.g., partially purified), such as by phenol-chloroform extraction
followed by precipitation. Liquid chromatography can then be used
to separate the fragments and mass spectrometry can be used to
determine the mass of each fragment. This allows determination of
the mechanism of cleavage, e.g., if by direct phosphate cleavage,
such as be 5' or 3' exonuclease cleavage, or mediated by the 2'OH
via formation of a cyclic phosphate.
[0088] More than one iRNA agent, e.g., anti-htt iRNA agent, can be
evaluated. The evaluation can be used to select a sequence for use
in a therapeutic iRNA agent. For example, it allows the selection
of a sequence having an optimal (usually minimized) number of sites
that are cleaved by a substance(s), e.g., an enzyme, present in the
relevant compartments of a subject's body. Two or more iRNA agent
candidates can be evaluated to select a sequence that is optimized.
For example, two or more candidates can be evaluated and the one
with optimum properties, e.g., fewer cleavage sites, selected.
[0089] The information relating to a site of cleavage can be used
to select a backbone atom, a sugar or a base, for modification,
e.g., a modification to decrease cleavage.
[0090] Exemplary modifications include modifications that inhibit
endonucleolytic degradation, including the modifications described
herein. Particularly favored modifications include: 2'
modification, e.g., provision of a 2' OMe moiety on a U in a sense
or antisense strand, but especially on a sense strand; modification
of the backbone, e.g., with the replacement of an O with an S, in
the phosphate backbone, e.g., the provision of a phosphorothioate
modification, on the U or the A or both, especially on an antisense
strand; replacement of the U with a C5 amino linker; replacement of
an A with a G (sequence changes are preferred to be located on the
sense strand and not the antisense strand); and modification of the
at the 2', 6', 7', or 8' position. Preferred embodiments are those
in which one or more of these modifications are present on the
sense but not the antisense strand, or embodiments where the
antisense strand has fewer of such modifications.
[0091] Exemplary modifications also include those that inhibit
degradation by exonucleases. Examples of modifications that inhibit
exonucleolytic degradation can be found herein. Particularly
favored modifications include: 2' modification, e.g., provision of
a 2' OMe moiety in a 3' overhang, e.g., at the 3' terminus (3'
terminus means at the 3' atom of the molecule or at the most 3'
moiety, e.g., the most 3' P or 2' position, as indicated by the
context); modification of the backbone, e.g., with the replacement
of a P with an S, e.g., the provision of a phosphorothioate
modification, or the use of a methylated P in a 3' overhang, e.g.,
at the 3' terminus; combination of a 2' modification, e.g.,
provision of a 2' O Me moiety and modification of the backbone,
e.g., with the replacement of a P with an S, e.g., the provision of
a phosphorothioate modification, or the use of a methylated P, in a
3' overhang, e.g., at the 3' terminus; modification with a 3'
alkyl; modification with an abasic pyrolidine in a 3' overhang,
e.g., at the 3' terminus; modification with naproxen, ibuprofen, or
other moieties which inhibit degradation at the 3' terminus.
[0092] These methods can be used to select and or optimize a
therapeutic iRNA agent conjugated with a lipophilic moiety, e.g.,
cholesterol, for enhanced uptake into neural cells.
[0093] The method can be used to evaluate a candidate iRNA agent
conjugated with a lipophilic moiety and that also includes a
modification that, for example, inhibits degradation, targets the
dsRNA molecule, or modulates hybridization. Such modifications are
described herein. A cleavage assay can be combined with an assay to
determine the ability of a modified or non-modified candidate to
silence the target. E.g., one might (optionally) test a candidate
to evaluate its ability to silence a target (or off-target
sequence), evaluate its susceptibility to cleavage, modify it
(e.g., as described herein, e.g., to inhibit degradation) to
produce a modified candidate, and test the modified candidate for
one or both of the ability to silence and the ability to resist
degradation. The procedure can be repeated. Modifications can be
introduced one at a time or in groups. A cell-based method can be
used to monitor the ability of the iRNA agent to silence. This can
be followed by a different method, e.g, a whole animal method, to
confirm activity.
[0094] A test agent refers to a biological agent, e.g., biological
sample, tissue extract or prep, serum, a known enzyme or other
molecule known to modify, e.g., cleave, a dsRNA, e.g., an
endonuclease. The test agent can be in a compartment of the body in
which the RNAi agent will be exposed. For example, for an iRNA
agent that is administered directly in to neural tissue (e.g., into
the brain or into the spinal cord) the test agent could be brain
tissue extract or spinal fluid. An iRNA agent that is to be
supplied directly to the eye can be incubated with an extract of
the eye.
In Vivo Testing
[0095] An iRNA agent conjugated with a lipophilic moiety and
identified as having an enhanced capability of entering neural
cells in culture can be tested for functionality in vivo in an
animal model (e.g., in a mammal, such as in mouse or rat). For
example, the iRNA agent can be administered to an animal, and the
iRNA agent evaluated with respect to its biodistribution, e.g., is
uptake into neural cells, its stability, and its ability to inhibit
expression of a target gene in the neural cells.
[0096] The iRNA agent can be administered to the animal model in
the same manner that it would be administered to a human. For
example, the iRNA agent can be injected directly into a target
region of the brain (e.g., into the cortex, the substantia nigra,
the globus pallidus, the hippocampus, or the striatum), and after a
period of time, the brain can be harvested and tissue slices
examined for distribution of the agent.
[0097] The iRNA agent can also be evaluated for its intracellular
distribution. The evaluation can include determining whether the
iRNA agent was taken up into the cell. The evaluation can also
include determining the stability (e.g., the half-life) of the iRNA
agent. Evaluation of an iRNA agent in vivo can be facilitated by
use of an iRNA agent conjugated to a traceable marker (e.g., a
fluorescent marker such as Cy3, Cy5, FITC, rhodamine, or
fluorescein; a radioactive label, such as .sup.32p, .sup.33p, or
.sup.3H; gold particles; or antigen particles for
immunohistochemistry).
[0098] An iRNA agent useful for monitoring biodistribution can lack
gene silencing activity in vivo. For example, the iRNA agent can
target a gene not present in the animal (e.g., an iRNA agent
injected into mouse can target luciferase), or an iRNA agent can
have a non-sense sequence, which does not target any gene, e.g.,
any endogenous gene). Localization/biodistribution of the iRNA can
be monitored by a traceable label attached to the iRNA agent, such
as a traceable agent described above
[0099] The iRNA agent conjugated to a lipophilic moiety can be
evaluated with respect to its ability to down regulate target gene
expression. Levels of target gene expression in vivo can be
measured, for example, by in situ hybridization, or by the
isolation of RNA from tissue prior to and following exposure to the
iRNA agent. Target RNA can be detected by any desired method,
including but not limited to RT-PCR, Northern blot, or RNAase
protection assay. Alternatively, or additionally, target gene
expression can be monitored by performing Western blot analysis on
tissue extracts treated with an iRNA agent.
[0100] An iRNA agent conjugated to a lipophilic agent for enhanced
uptake into neural cells can be tested in a mouse model for a
neurological disease. For example, an iRNA agent conjugated to a
lipophilic agent can be tested in a mouse model for HD, such as a
mouse carrying a wildtype copy of the human htt gene or in mouse
carrying a mutant human htt, e.g., an htt gene carrying an expanded
CAG repeat. A treated mouse model can be observed for a decrease in
symptoms associated with HD, e.g., a decrease in clasping. The
treated mouse can be assessed for other phentypes, e.g., expression
of DARPP protein in brain cells, such as in medium spiny neurons of
the brain. In one embodiment, such a secondary assay requires
dissection of the mouse brain for Western blot analysis or in situ
hybridization of brain tissue, including spiny neurons.
[0101] iRNA Chemistry
[0102] Described herein are isolated iRNA agents, e.g., dsRNA
molecules, that mediate RNAi. The iRNA agents are modified for
enhanced uptake into neural cells by their attachment to at least
one lipophilic moiety, e.g., a cholesterol molecule.
[0103] Generally, the iRNA agents featured in the invention should
include a region of sufficient homology to a target gene, e.g., a
target gene expressed in a neural cell, and be of sufficient length
in terms of nucleotides, such that the iRNA agent, or a fragment
thereof, can mediate down regulation of the target gene. It is not
necessary that there be perfect complementarity between the iRNA
agent and the target, but the correspondence must be sufficient to
enable the iRNA agent, or a cleavage product thereof, to direct
sequence specific silencing, e.g., by RNAi cleavage of the target
RNA, e.g., mRNA. Therefore, the iRNA agents featured in the instant
invention include agents comprising a sense strand and antisense
strand each comprising a sequence of at least 16, 17 or 18
nucleotides which is essentially identical, as defined below, to a
sequence of a gene expressed in a neural cell, except that not more
than 1, 2 or 3 nucleotides per strand, respectively, have been
substituted by other nucleotides (e.g., adenosine replaced by
uracil), while essentially retaining the ability to inhibit
expression of the target gene in a mammalian cell. Exemplary iRNA
agents may therefore possess at least 15 nucleotides identical to
the target gene sequence, but include 1, 2 or 3 base mismatches
with respect to either the target mRNA sequence or between the
sense and antisense strand are introduced. Mismatches to the target
mRNA sequenceparticularly in the antisense strand, are most
tolerated in the terminal regions and if present are preferably in
a terminal region or regions, e.g., within 6, 5, 4, or 3
nucleotides of the 5' and/or 3' terminus, most preferably within 6,
5, 4, or 3 nucleotides of the 5'-terminus of the sense strand or
the 3'-terminus of the antisense strand. The sense strand need only
be sufficiently complementary with the antisense strand to maintain
the over all double strand character of the molecule.
[0104] Single stranded regions of an iRNA agent will often be
modified or include nucleoside surrogates, e.g., the unpaired
region or regions of a hairpin structure, e.g., a region which
links two complementary regions, can have modifications or
nucleoside surrogates. Modifications to stabilize one or both of
the 3'- or 5'-terminus of an iRNA agent, e.g., against
exonucleases, or to favor the antisense sRNA agent to enter into
RISC are also favored. Modifications can include C3 (or C6, C7,
C12) amino linkers, thiol linkers, carboxyl linkers,
non-nucleotidic spacers (C3, C6, C9, C12, abasic, triethylene
glycol, hexaethylene glycol), special biotin or fluorescein
reagents that come as phosphoramidites and that have another
DMT-protected hydroxyl group, allowing multiple couplings during
RNA synthesis. As discussed elsewhere herein, an iRNA agent will
often be modified or include an SRMS in addition to the nucleotide
surrogate. An SRMS replaces a ribose sugar on a ribonucleotide with
another moiety, e.g., a non-carbohydrate (preferably cyclic)
carrier. SRMS' are described in greater detail below.
[0105] Although, in mammalian cells, long ds iRNA agents can induce
the interferon response which is frequently deleterious, short ds
iRNA agents do not trigger the interferon response, at least not to
an extent that is deleterious to the cell and host. The iRNA agents
of the present invention include molecules which are sufficiently
short that they do not trigger the interferon response in mammalian
cells. Thus, the administration of a composition of an iRNA agent
(e.g., formulated as described herein) to a mammalian cell can be
used to silence expression of a gene expressed in a neural cell,
e.g., the htt gene, while circumventing the interferon response.
Molecules that are short enough that they do not trigger an
interferon response are termed sRNA agents or shorter iRNA agents
herein. "sRNA agent or shorter iRNA agent" as used herein, refers
to an iRNA agent, e.g., a double stranded RNA agent or single
strand agent, that is sufficiently short that it does not induce a
deleterious interferon response in a human cell, e.g., it has a
duplexed region of less than 60 but preferably less than 50, 40, or
30 nucleotide pairs.
[0106] In addition to homology to target RNA and the ability to
down regulate a target gene, an iRNA agent will preferably have one
or more of the following properties: [0107] (1) it will be of the
Formula 1, 2, 3, or 4 described below; [0108] (2) if single
stranded it will have a 5' modification that includes one or more
phosphate groups or one or more analogs of a phosphate group;
[0109] (3) it will, despite modifications, even to a very large
number of bases, specifically base pair and form a duplex structure
with a homologous target RNA of sufficient thermodynamic stability
to allow modulation of the activity of the targeted RNA; [0110] (4)
it will, despite modifications, even to a very large number, or all
of the nucleosides, still have "RNA-like" properties, i.e., it will
possess the overall structural, chemical and physical properties of
an RNA molecule, even though not exclusively, or even partly, of
ribonucleotide-based content. For example, all of the nucleotide
sugars can contain e.g., 2'OMe, or 2' fluoro in place of 2'
hydroxyl. This deoxyribonucleotide-containing agent can still be
expected to exhibit RNA-like properties. While not wishing to be
bound by theory, the electronegative fluorine prefers an axial
orientation when attached to the C2' position of ribose. This
spatial preference of fluorine can, in turn, force the sugars to
adopt a C.sub.3'-endo pucker. This is the same puckering mode as
observed in RNA molecules and gives rise to the RNA-characteristic
A-family-type helix. Further, since fluorine is a good hydrogen
bond acceptor, it can participate in the same hydrogen bonding
interactions with water molecules that are known to stabilize RNA
structures. (Generally, it is preferred that a modified moiety at
the 2' sugar position will be able to enter into hydrogen-bonding
which is more characteristic of the 2'-OH moiety of a
ribonucleotide than the 2'-H moiety of a deoxyribonucleotide. A
preferred iRNA agent will: exhibit a C.sub.3'-endo pucker in all,
or at least 50, 75, 80, 85, 90, or 95% of its sugars; exhibit a
C.sub.3'-endo pucker in a sufficient amount of its sugars that it
can give rise to a the RNA-characteristic A-family-type helix; will
have no more than 20, 10, 5, 4, 3, 2, or 1 sugar which is not a
C.sub.3'-endo pucker structure. These limitations are particularly
preferably in the antisense strand; [0111] Preferred
2'-modifications with C3'-endo sugar pucker include:
[0112] 2'-OH, 2'-O-Me, 2'-O-methoxyethyl, 2'-O-aminopropyl,2'-F,
2'-O--CH2-CO--NHMe, 2'-O--CH2-CH2-O--CH2-CH2-N(Me)2, LNA [0113] (5)
regardless of the nature of the modification, and even though the
oligonucleotide agent can contain deoxynucleotides or modified
deoxynucleotides, it is preferred that DNA molecules, or any
molecule in which more than 50, 60, or 70% of the nucleotides in
the molecule are deoxyribonucleotides, or modified
deoxyribonucleotides which are deoxy at the 2' position, are
excluded from the definition of oligonucleotide agent.
[0114] A "ds iRNA agent" (abbreviation for "double stranded (ds)
iRNA agent") as used herein, is an iRNA agent which includes more
than one, and preferably two, strands in which interchain
hybridization can form a region of duplex structure.
[0115] The antisense strand of a double stranded iRNA agent should
be equal to or at least, 14, 15, 16 17, 18, 19, 25, 29, 40, or 50
nucleotides in length. It should be equal to or less than 60, 50,
40, or 30 nucleotides in length. Preferred ranges are 15 to 30, 17
to 25, 19 to 23, and 19 to21
[0116] The sense strand of a double stranded iRNA agent should be
equal to or at least 14, 15, 16 17, 18, 19, 25, 29, 40, or 50
nucleotides in length. It should be equal to or less than 60, 50,
40, or 30 nucleotides in length. Preferred ranges are 17 to 25, 19
to 23, and 19 to21 nucleotides in length.
[0117] The double strand portion of a double stranded iRNA agent
should be equal to or at least, 15, 16 17, 18, 19, 20, 21, 22, 23,
24, 25, 29, 40, or 50 nucleotide pairs in length. It should be
equal to or less than 60, 50, 40, or 30 nucleotide pairs in length.
Preferred ranges are 15 to 30, 17 to 25, 19 to 23, and 19 to 21
nucleotides pairs in length.
[0118] It may be desirable to modify one or both of the antisense
and sense strands of a double strand iRNA agent. In some cases they
will have the same modification or the same class of modification
but in other cases the sense and antisense strand will have
different modifications, e.g., in some cases it is desirable to
modify only the sense strand. It may be desirable to modify only
the sense strand, e.g., to inactivate it, e.g., the sense strand
can be modified in order to inactivate the sense strand and prevent
formation of an active iRNA agent/protein or RISC. This can be
accomplished by a modification which prevents 5'-phosphorylation of
the sense strand, e.g., by modification with a 5'-O-methyl
ribonucleotide (see Nykanen et al., (2001) ATP requirements and
small interfering RNA structure in the RNA interference pathway.
Cell 107, 309-321.) Other modifications which prevent
phosphorylation can also be used, e.g., simply substituting the
5'-OH by H rather than O-Me. Alternatively, a large bulky group may
be added to the 5'-phosphate turning it into a phosphodiester
linkage, though this may be less desirable as phosphodiesterases
can cleave such a linkage and release a functional sRNA 5'-end.
Antisense strand modifications include 5' phosphorylation as well
as any of the other 5' modifications discussed herein.
[0119] It is preferred that the sense and antisense strands be
chosen such that the ds iRNA agent includes a single strand or
unpaired region at one or both ends of the molecule. Thus, a ds
iRNA agent contains sense and antisense strands, preferably paired
to contain an overhang, e.g., one or two 5' or 3' overhangs but
preferably a 3' overhang of 2-3 nucleotides. Most embodiments will
have a 3' overhang. Preferred iRNA agents will have single-stranded
overhangs, preferably 3' overhangs, of 1 to 4, or preferably 2 or 3
nucleotides in length at each end. The overhangs can be the result
of one strand being longer than the other, or the result of two
strands of the same length being staggered. 5' ends are preferably
phosphorylated.
[0120] Preferred lengths for the duplexed region is between 15 and
30, most preferably 18, 19, 20, 21, 22, and 23 nucleotides in
length, e.g., in the iRNA agent range discussed above. iRNA agents
can resemble in length and structure the natural Dicer processed
products from long dsRNAs. Embodiments in which the two strands of
the sRNA agent are linked, e.g., covalently linked are also
included. Hairpin, or other single strand structures which provide
the required double stranded region, and preferably a 3' overhang
are also within the invention.
[0121] As used herein, the phrase "mediates RNAi" refers to the
ability of an agent to silence, in a sequence specific manner, a
target gene. "Silencing a target gene" means the process whereby a
neural cell containing and/or secreting a certain product of the
target gene when not in contact with the agent, will contain and/or
secret at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% less
of such gene product when contacted with the agent, as compared to
a similar neural cell which has not been contacted with the agent.
Such product of the target gene can, for example, be a messenger
RNA (mRNA), a protein, or a regulatory elementWhile not wishing to
be bound by theory, it is believed that silencing by the agents
described herein uses the RNAi machinery or process and a guide
RNA, e.g., an iRNA agent of 15 to 30 nucleotide pairs.
[0122] As used herein, the term "complementary" is used to indicate
a sufficient degree of complementarity such that stable and
specific binding occurs between a compound of the invention and a
target RNA molecule, e.g., an htt mRNA molecule. Specific binding
requires a sufficient degree of complementarity to avoid
non-specific binding of the oligomeric compound to non-target
sequences under conditions in which specific binding is desired,
i.e., under physiological conditions in the case of in vivo assays
or therapeutic treatment, or in the case of in vitro assays, under
conditions in which the assays are performed. The non-target
sequences typically differ by at least 4 nucleotides.
[0123] As used herein, an iRNA agent is "sufficiently
complementary" to a target RNA, e.g., a target mRNA (e.g., a target
htt mRNA) if the iRNA agent reduces the production of a protein
encoded by the target mRNA. The iRNA agent may also be "exactly
complementary" (excluding the SRMS containing subunit(s)) to a
target RNA, e.g., the target RNA and the iRNA agent can anneal,
preferably to form a hybrid made exclusively of Watson-Crick base
pairs in the region of exact complementarity. A "sufficiently
complementary" target RNA can include a region (e.g., of at least 7
nucleotides) that is exactly complementary to a target RNA, e.g.,
an htt RNA. Moreover, in some embodiments, the iRNA agent
specifically discriminates a single-nucleotide difference.
[0124] iRNA agents conjugated with a lipophilic agent for enhanced
uptake into neural cells include iRNA agents which have been
further modified, e.g., to improve efficacy, and polymers of
nucleoside surrogates. Unmodified RNA refers to a molecule in which
the components of the nucleic acid, namely sugars, bases, and
phosphate moieties, are the same or essentially the same as that
which occur in nature, preferably as occur naturally in the human
body. The art has referred to rare or unusual, but naturally
occurring, RNAs as modified RNAs, see, e.g., Limbach et al.,
Nucleic Acids Res. 22: 2183-2196, 1994. Such rare or unusual RNAs,
often termed modified RNAs are typically the result of a post
transcriptional modification and are within the term unmodified
RNA, as used herein. Modified RNA, as used herein, refers to a
molecule in which one or more of the components of the nucleic
acid, namely sugars, bases, and phosphate moieties, are different
from that which occur in nature, preferably different from that
which occurs in the human body. While they are referred to as
modified RNAs, they will of course, because of the modification,
include molecules that are not, strictly speaking, RNAs. Nucleoside
surrogates are molecules in which the ribophosphate backbone is
replaced with a non-ribophosphate construct that allows the bases
to the presented in the correct spatial relationship such that
hybridization is substantially similar to what is seen with a
ribophosphate backbone, e.g., non-charged mimics of the
ribophosphate backbone. Examples of all of the above are discussed
herein.
[0125] Much of the discussion below refers to single strand
molecules. However, it is understood that a ds iRNA agent, e.g., a
partially ds iRNA agent, is required or preferred. Thus, it is
understood that double stranded structures (e.g. where two separate
molecules are contacted to form the double stranded region or where
the double stranded region is formed by intramolecular pairing
(e.g., a hairpin structure)) made of the single stranded structures
described below are within the invention. Preferred lengths are
described elsewhere herein.
[0126] As nucleic acids are polymers of subunits or monomers, many
of the modifications described below occur at a position which is
repeated within a nucleic acid, e.g., a modification of a base, or
a phosphate moiety, or a non-linking O of a phosphate moiety. In
some cases the modification will occur at all of the subject
positions in the nucleic acid but in many, and in fact in most,
cases it will not. By way of example, a modification may only occur
at a 3' or 5' terminal position, may only occur in a terminal
region, e.g. at a position on a terminal nucleotide or in the last
2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur
in a double strand region, a single strand region, or in both. A
modification may occur only in the double strand region of an RNA
or may only occur in a single strand region of an RNA. The ligand
can be at attached at the 3' end, the 5' end, or at an internal
position, or at a combination of these positions. For example, the
ligand can be at the 3' end and the 5' end; at the 3' end and at
one or more internal positions; at the 5' end and at one or more
internal positions; or at the 3' end, the 5' end, and at one or
more internal positions. For example, a phosphorothioate
modification at a non-linking O position may only occur at one or
both termini, or may only occur in a terminal region, e.g., at a
position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10
nucleotides of a strand, or may occur in double strand and single
strand regions, particularly at termini. Similarly, a modification
may occur on the sense strand, antisense strand, or both strands.
In some cases, the sense and antisense strand will have the same
modifications or the same class of modifications, but in other
cases the sense and antisense strand will have different
modifications, e.g., in some cases it may be desirable to modify
only one strand, e.g. the sense strand. The 5' end can be
phosphorylated. In a particularly preferred embodiment, the sense
strand is modified at the 3' end by the addition of a
cholesterol.
[0127] In some embodiments it is particularly preferred, e.g., to
enhance stability, to include particular bases in overhangs, or to
include modified nucleotides or nucleotide surrogates, in single
strand overhangs, e.g., in a 5' or 3' overhang, or in both. E.g.,
it can be desirable to include purine nucleotides in overhangs. In
some embodiments all or some of the bases in a 3' or 5' overhang
will be modified, e.g., with a modification described herein.
Modifications can include, e.g., the use of modifications at the 2'
OH group of the ribose sugar, e.g., the use of
deoxyribonucleotides, e.g., deoxythymidine, instead of
ribonucleotides, and modifications in the phosphate group, e.g.,
phosphothioate modifications. Overhangs need not be homologous with
the target sequence. Modifications and nucleotide surrogates are
discussed below. ##STR8##
[0128] The scaffold presented above in Formula 1 represents a
portion of a ribonucleic acid. The basic components are the ribose
sugar, the base, the terminal phosphates, and phosphate
internucleotide linkers. Where the bases are naturally occurring
bases, e.g., adenine, uracil, guanine or cytosine, the sugars are
the unmodified 2' hydroxyl ribose sugar (as depicted) and W, X, Y,
and Z are all O, Formula 1 represents a naturally occurring
unmodified oligoribonucleotide.
[0129] Unmodified oligoribonucleotides may be less than optimal in
some applications, e.g., unmodified oligoribonucleotides can be
prone to degradation by e.g., cellular nucleases. Nucleases can
hydrolyze nucleic acid phosphodiester bonds. However, chemical
modifications to one or more of the above RNA components can confer
improved properties, and, e.g., can render oligoribonucleotides
more stable to nucleases. Unmodified oligoribonucleotides may also
be less than optimal in terms of offering tethering points for
attaching ligands or other moieties to an iRNA agent.
[0130] Modified nucleic acids and nucleotide surrogates can include
one or more of:
[0131] (i) alteration, e.g., replacement, of one or both of the
non-linking (X and Y) phosphate oxygens and/or of one or more of
the linking (W and Z) phosphate oxygens (When the phosphate is in
the terminal position, one of the positions W or Z will not link
the phosphate to an additional element in a naturally occurring
ribonucleic acid. However, for simplicity of terminology, except
where otherwise noted, the W position at the 5' end of a nucleic
acid and the terminal Z position at the 3' end of a nucleic acid,
are within the term "linking phosphate oxygens" as used
herein.);
[0132] (ii) alteration, e.g., replacement, of a constituent of the
ribose sugar, e.g., of the 2' hydroxyl on the ribose sugar, or
wholesale replacement of the ribose sugar with a structure other
than ribose, e.g., as described herein;
[0133] (iii) wholesale replacement of the phosphate moiety (bracket
I) with "dephospho" linkers;
[0134] (iv) modification or replacement of a naturally occurring
base;
[0135] (v) replacement or modification of the ribose-phosphate
backbone (bracket II);
[0136] (vi) modification of the 3' end or 5' end of the RNA, e.g.,
removal, modification or replacement of a terminal phosphate group
or conjugation of a moiety, e.g. a fluorescently labeled moiety, to
either the 3' or 5' end of RNA.
[0137] The terms replacement, modification, alteration, and the
like, as used in this context, do not imply any process limitation,
e.g., modification does not mean that one must start with a
reference or naturally occurring ribonucleic acid and modify it to
produce a modified ribonucleic acid but rather modified simply
indicates a difference from a naturally occurring molecule.
[0138] It is understood that the actual electronic structure of
some chemical entities cannot be adequately represented by only one
canonical form (i.e. Lewis structure). While not wishing to be
bound by theory, the actual structure can instead be some hybrid or
weighted average of two or more canonical forms, known collectively
as resonance forms or structures. Resonance structures are not
discrete chemical entities and exist only on paper. They differ
from one another only in the placement or "localization" of the
bonding and nonbonding electrons for a particular chemical entity.
It can be possible for one resonance structure to contribute to a
greater extent to the hybrid than the others. Thus, the written and
graphical descriptions of the embodiments of the present invention
are made in terms of what the art recognizes as the predominant
resonance form for a particular species. For example, any
phosphoroamidate (replacement of a nonlinking oxygen with nitrogen)
would be represented by X.dbd.O and Y.dbd.N in the above
figure.
[0139] Replacement of the Phosphate Group
[0140] The phosphate group can be replaced by non-phosphorus
containing connectors (cf. Bracket I in Formula 1 above). While not
wishing to be bound by theory, it is believed that since the
charged phosphodiester group is the reaction center in nucleolytic
degradation, its replacement with neutral structural mimics should
impart enhanced nuclease stability. Again, while not wishing to be
bound by theory, it can be desirable, in some embodiment, to
introduce alterations in which the charged phosphate group is
replaced by a neutral moiety.
[0141] Examples of moieties which can replace the phosphate group
include siloxane, carbonate, carboxymethyl, carbamate, amide,
thioether, ethylene oxide linker, sulfonate, sulfonamide,
thioformacetal, formacetal, oxime, methyleneimino,
methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo
and methyleneoxymethylimino. Preferred replacements include the
methylenecarbonylamino and methylenemethylimino groups.
[0142] Candidate modifications can be evaluated as described
below.
[0143] Replacement of Ribophosphate Backbone
[0144] Oligonucleotide-mimicking scaffolds can also be constructed
wherein the phosphate linker and ribose sugar are replaced by
nuclease resistant nucleoside or nucleotide surrogates (see Bracket
II of Formula 1 above). While not wishing to be bound by theory, it
is believed that the absence of a repetitively charged backbone
diminishes binding to proteins that recognize polyanions (e.g.
nucleases). Again, while not wishing to be bound by theory, it can
be desirable in some embodiment, to introduce alterations in which
the bases are tethered by a neutral surrogate backbone.
[0145] Examples include the mophilino, cyclobutyl, pyrrolidine and
peptide nucleic acid (PNA) nucleoside surrogates. A preferred
surrogate is a PNA surrogate.
[0146] Candidate modifications can be evaluated as described
below.
[0147] Terminal Modifications
[0148] The 3' and 5' ends of an oligonucleotide can be modified.
Such modifications can be at the 3' end, 5' end or both ends of the
molecule. They can include modification or replacement of an entire
terminal phosphate or of one or more of the atoms of the phosphate
group. E.g., the 3' and 5' ends of an oligonucleotide can be
conjugated to other functional molecular entities such as labeling
moieties, e.g., fluorophores (e.g., pyrene, TAMRA, fluorescein, Cy3
or Cy5 dyes) or protecting groups (based e.g., on sulfur, silicon,
boron or ester). The functional molecular entities can be attached
to the sugar through a phosphate group and/or a spacer. The
terminal atom of the spacer can connect to or replace the linking
atom of the phosphate group or the C-3' or C-5' O, N, S or C group
of the sugar. Alternatively, the spacer can connect to or replace
the terminal atom of a nucleotide surrogate (e.g., PNAs). These
spacers or linkers can include e.g., --(CH.sub.2).sub.n--,
--(CH.sub.2).sub.nN--, --(CH.sub.2).sub.nO--,
--(CH.sub.2).sub.nS--, O(CH.sub.2CH.sub.2O).sub.nCH.sub.2CH.sub.2OH
(e.g., n=3 or 6), abasic sugars, amide, carboxy, amine, oxyamine,
oxyimine, thioether, disulfide, thiourea, sulfonamide, or
morpholino, or biotin and fluorescein reagents. When a
spacer/phosphate-functional molecular entity-spacer/phosphate array
is interposed between two strands of iRNA agents, this array can
substitute for a hairpin RNA loop in a hairpin-type RNA agent. The
3' end can be an --OH group. While not wishing to be bound by
theory, it is believed that conjugation of certain moieties can
improve transport, hybridization, and specificity properties.
Again, while not wishing to be bound by theory, it may be desirable
to introduce terminal alterations that improve nuclease
resistance.
[0149] Other examples of terminal modifications include dyes,
intercalating agents (e.g. acridines), cross-linkers (e.g.
psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin),
polycyclic aromatic hydrocarbons (e.g., phenazine,
dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic
carriers (e.g., cholesterol, cholic acid, adamantane acetic acid,
1-pyrene butyric acid, dihydrotestosterone,
1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group,
hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl
group, palmitic acid, myristic acid,O3-(oleoyl)lithocholic acid,
O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and
peptide conjugates (e.g., antennapedia peptide, Tat peptide),
alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K),
MPEG, [MPEG].sub.2, polyamino, alkyl, substituted alkyl,
radiolabeled markers, enzymes, haptens (e.g. biotin),
transport/absorption facilitators (e.g., aspirin, vitamin E, folic
acid), synthetic ribonucleases (e.g., imidazole, bisimidazole,
histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+
complexes of tetraazamacrocycles).
[0150] Terminal modifications can be added for a number of reasons,
including as discussed elsewhere herein to modulate activity or to
modulate resistance to degradation. Preferred modifications include
the addition of a methylphosphonate at the 3'-most terminal
linkage; a 3' C5-aminoalkyl-dT; 3' cationic group; or another 3'
conjugate to inhibit 3'-5' exonucleolytic degradation.
[0151] Terminal modifications useful for modulating activity
include modification of the 5' end with phosphate or phosphate
analogs. E.g., in preferred embodiments iRNA agents, especially
antisense strands, are 5' phosphorylated or include a phosphoryl
analog at the 5' terminus. 5'-phosphate modifications include those
which are compatible with RISC mediated gene silencing. Suitable
modifications include: 5'-monophosphate ((HO)2(O)P--O-5');
5'-diphosphate ((HO)2(O)P--O--P(HO)(O)--O-5'); 5'-triphosphate
((HO)2(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5'); 5'-guanosine cap
(7-methylated or non-methylated)
(7m-G-O-5'-(HO)(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5'); 5'-adenosine
cap (Appp), and any modified or unmodified nucleotide cap structure
(N--O-5'-(HO)(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5');
5'-monothiophosphate (phosphorothioate; (HO)2(S)P--O-5');
5'-monodithiophosphate (phosphorodithioate; (HO)(HS)(S)P--O-5'),
5'-phosphorothiolate ((HO)2(O)P--S-5'); any additional combination
of oxgen/sulfur replaced monophosphate, diphosphate and
triphosphates (e.g. 5'-alpha-thiotriphosphate,
5'-gamma-thiotriphosphate, etc.), 5'-phosphoramidates
((HO)2(O)P--NH-5', (HO)(NH2)(O)P--O-5'), 5'-alkylphosphonates
(R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e.g.
RP(OH)(O)--O-5'-, (OH)2(O)P-5'-CH2-), 5'-alkyletherphosphonates
(R=alkylether=methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g.
RP(OH)(O)--O-5'-).
[0152] Terminal modifications can also be useful for monitoring
distribution, and in such cases the preferred groups to be added
include fluorophores, e.g., fluorescein or an Alexa dye, e.g.,
Alexa 488. Terminal modifications can also be useful for enhancing
uptake, useful modifications for this include cholesterol. Terminal
modifications can also be useful for cross-linking an RNA agent to
another moiety; modifications useful for this include mitomycin
C.
[0153] Enhanced Nuclease Resistance
[0154] An iRNA agent conjugated to a lipophilic moiety for enhanced
uptake into neural cells can have enhanced resistance to
nucleases.
[0155] For increased nuclease resistance and/or binding affinity to
the target, an iRNA agent, e.g., the sense and/or antisense strands
of the iRNA agent, can include, for example, 2'-modified ribose
units and/or phosphorothioate linkages. E.g., the 2' hydroxyl group
(OH) can be modified or replaced with a number of different "oxy"
or "deoxy" substituents.
[0156] Examples of "ox"-2' hydroxyl group modifications include
alkoxy or aryloxy (OR, e.g., R.dbd.H, alkyl, cycloalkyl, aryl,
aralkyl, heteroaryl or sugar); polyethyleneglycols (PEG),
O(CH.sub.2CH.sub.2O).sub.nCH.sub.2CH.sub.2OR; "locked" nucleic
acids (LNA) in which the 2' hydroxyl is connected, e.g., by a
methylene bridge, to the 4' carbon of the same ribose sugar;
O-AMINE and aminoalkoxy, O(CH.sub.2).sub.nAMINE, (e.g.,
AMINE=NH.sub.2; alkylamino, dialkylamino, heterocyclyl amino,
arylamino, diaryl amino, heteroaryl amino, or diheteroaryl amino,
ethylene diamine, polyamino). It is noteworthy that
oligonucleotides containing only the methoxyethyl group (MOE),
(OCH.sub.2CH.sub.2OCH.sub.3, a PEG derivative), exhibit nuclease
stabilities comparable to those modified with the robust
phosphorothioate modification.
[0157] "Deoxy" modifications include hydrogen (i.e. deoxyribose
sugars, which are of particular relevance to the overhang portions
of partially ds RNA); halo (e.g., fluoro); amino (e.g. NH.sub.2;
alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino,
heteroaryl amino, diheteroaryl amino, or amino acid);
NH(CH.sub.2CH.sub.2NH).sub.nCH.sub.2CH.sub.2-AMINE (AMINE=NH.sub.2;
alkylamino, dialkylamino, heterocyclyl amino, arylamino, diaryl
amino, heteroaryl amino,or diheteroaryl amino), --NHC(O)R (R=alkyl,
cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto;
alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl
and alkynyl, which may be optionally substituted with e.g., an
amino functionality.
[0158] Preferred substitutents are 2'-methoxyethyl, 2'-OCH3,
2'-O-allyl, 2'-C-allyl, and 2'-fluoro.
[0159] In certain aspects, nuclease resistance of iRNA agents is
enhanced by identifying nuclease-susceptible sites and modifying
such sites to inhibit cleavage. For example, the dinucleotides
5'-UA-3', 5' UG 3', 5'-CA-3', 5' UU-3', or 5'-CC-3' can serve as
cleavage sites. Enhanced nuclease resistance can therefore be
achieved by modifying the 5' nucleotide, resulting, for example, in
at least one 5'-uridine-adenine-3' (5'-UA-3') dinucleotide wherein
the uridine is a 2'-modified nucleotide; at least one
5'-uridine-guanine-3' (5'-UG-3') dinucleotide, wherein the
5'-uridine is a 2'-modified nucleotide; at least one
5'-cytidine-adenine-3' (5'-CA-3') dinucleotide, wherein the
5'-cytidine is a 2'-modified nucleotide; at least one
5'-uridine-uridine-3' (5'-UA-3') dinucleotide, wherein the
5'-uridine is a 2'-modified nucleotide; or at least one
5'-cytidine-cytidine-3' (5'-CC-3') dinucleotide, wherein the
5'-cytidine is a 2'-modified nucleotide. The iRNA agent can include
at least 2, at least 3, at least 4 or at least 5 of such
dinucleotides. In certain embodiments, all the pyrimidines of an
iRNA agent carry a 2'-modification, and the iRNA agent therefore
has enhanced resistance to endonucleases.
[0160] To maximize nuclease resistance, the 2' modifications can be
used in combination with one or more phosphate linker modifications
(e.g., phosphorothioate). The so-called "chimeric" oligonucleotides
are those that contain two or more different modifications.
[0161] The inclusion of furanose sugars in the oligonucleotide
backbone can also decrease endonucleolytic cleavage. An iRNA agent
can be further modified by including a 3' cationic group, or by
inverting the nucleoside at the 3'-terminus with a 3'-3' linkage.
In another alternative, the 3'-terminus can be blocked with an
aminoalkyl group, e.g., a 3' C5-aminoalkyl dT. Other 3' conjugates
can inhibit 3'-5' exonucleolytic cleavage. While not being bound by
theory, a 3' conjugate, such as naproxen or ibuprofen, may inhibit
exonucleolytic cleavage by sterically blocking the exonuclease from
binding to the 3'-end of oligonucleotide. Even small alkyl chains,
aryl groups, or heterocyclic conjugates or modified sugars
(D-ribose, deoxyribose, glucose etc.) can block
3'-5'-exonucleases.
[0162] Similarly, 5' conjugates can inhibit 5'-3' exonucleolytic
cleavage. While not being bound by theory, a 5' conjugate, such as
naproxen or ibuprofen, may inhibit exonucleolytic cleavage by
sterically blocking the exonuclease from binding to the 5'-end of
oligonucleotide. Even small alkyl chains, aryl groups, or
heterocyclic conjugates or modified sugars (D-ribose, deoxyribose,
glucose etc.) can block 3'-5'-exonucleases.
[0163] An iRNA agent can have increased resistance to nucleases
when a duplexed iRNA agent includes a single-stranded nucleotide
overhang on at least one end. In preferred embodiments, the
nucleotide overhang includes 1 to 4, preferably 2 to 3, unpaired
nucleotides. In a preferred embodiment, the unpaired nucleotide of
the single-stranded overhang that is directly adjacent to the
terminal nucleotide pair contains a purine base, and the terminal
nucleotide pair is a G-C pair, or at least two of the last four
complementary nucleotide pairs are G-C pairs. In further
embodiments, the nucleotide overhang may have 1 or 2 unpaired
nucleotides, and in an exemplary embodiment the nucleotide overhang
is 5'-GC-3'. In preferred embodiments, the nucleotide overhang is
on the 3'-end of the antisense strand. In one embodiment, the iRNA
agent includes the motif 5'-CGC-3' on the 3'-end of the antisense
strand, such that a 2-nt overhang 5'-GC-3' is formed.
[0164] Thus, an iRNA agent can include modifications so as to
inhibit degradation, e.g., by nucleases, e.g., endonucleases or
exonucleases, found in the body of a subject. These monomers are
referred to herein as NRMs, or Nuclease Resistance promoting
Monomers, the corresponding modifications as NRM modifications. In
many cases these modifications will modulate other properties of
the iRNA agent as well, e.g., the ability to interact with a
protein, e.g., a transport protein, e.g., serum albumin, or a
member of the RISC, or the ability of the first and second
sequences to form a duplex with one another or to form a duplex
with another sequence, e.g., a target molecule.
[0165] One or more different NRM modifications can be introduced
into an iRNA agent or into a sequence of an iRNA agent. An NRM
modification can be used more than once in a sequence or in an iRNA
agent.
[0166] NRM modifications include some which can be placed only at
the terminus and others which can go at any position. Generally,
these modifications can inhibit hybridization so it is preferable
to use them only in terminal regions, and preferable not to use
them at the cleavage site or in the cleavage region of a sequence
which targets a subject sequence or gene, particularly on the
antisense strand. They can be used anywhere in a sense strand,
provided that sufficient hybridization between the two strands of
the ds iRNA agent is maintained. In some embodiments it is
desirable to put the NRM at the cleavage site or in the cleavage
region of a sense strand, as it can minimize off-target
silencing.
[0167] In most cases, the NRM modifications will be distributed
differently depending on whether they are included on a sense or
antisense strand. If on an antisense strand, modifications which
interfere with or inhibit endonuclease cleavage should not be
inserted in the region which is subject to RISC mediated cleavage,
e.g., the cleavage site or the cleavage region. As used herein
cleavage site refers to the nucleotide on either side of the
cleavage site, on the target or on the iRNA agent strand which
hybridizes to it. Cleavage region means a nucleotide within 1, 2,
or 3 nucleotides of the cleavage site, in either direction.
[0168] Such modifications can be introduced into the terminal
regions, e.g., at the terminal position or with 2, 3, 4, or 5
positions of the terminus.
[0169] Ribose Mimics
[0170] The monomers and methods described herein can be used to
prepare an oligonucleotide agent, that incorporates a ribose
mimic.
[0171] Thus, an aspect of the invention features an iRNA agent that
includes a secondary hydroxyl group, which can increase efficacy
and/or confer nuclease resistance to the agent. Nucleases, e.g.,
cellular nucleases, can hydrolyze nucleic acid phosphodiester
bonds, resulting in partial or complete degradation of the nucleic
acid. The secondary hydroxy group confers nuclease resistance to an
iRNA agent by rendering the iRNA agent less prone to nuclease
degradation relative to an iRNA which lacks the modification. While
not wishing to be bound by theory, it is believed that the presence
of a secondary hydroxyl group on the iRNA agent can act as a
structural mimic of a 3' ribose hydroxyl group, thereby causing it
to be less susceptible to degradation.
[0172] The secondary hydroxyl group refers to an "OH" radical that
is attached to a carbon atom substituted by two other carbons and a
hydrogen. The secondary hydroxyl group that confers nuclease
resistance as described above can be part of any acyclic
carbon-containing group. The hydroxyl may also be part of any
cyclic carbon-containing group, and preferably one or more of the
following conditions is met (1) there is no ribose moiety between
the hydroxyl group and the terminal phosphate group or (2) the
hydroxyl group is not on a sugar moiety which is coupled to a base.
The hydroxyl group is located at least two bonds (e.g., at least
three bonds away, at least four bonds away, at least five bonds
away, at least six bonds away, at least seven bonds away, at least
eight bonds away, at least nine bonds away, at least ten bonds
away, etc.) from the terminal phosphate group phosphorus of the
iRNA agent. In preferred embodiments, there are five intervening
bonds between the terminal phosphate group phosphorus and the
secondary hydroxyl group.
[0173] Preferred iRNA agent delivery modules with five intervening
bonds between the terminal phosphate group phosphorus and the
secondary hydroxyl group have the following structure (see formula
Y below): ##STR9##
[0174] Referring to formula Y, A is an iRNA agent, including any
iRNA agent described herein. The iRNA agent may be connected
directly or indirectly (e.g., through a spacer or linker) to "W" of
the phosphate group. These spacers or linkers can include e.g.,
--(CH.sub.2).sub.n--, --(CH.sub.2).sub.nN--, --(CH.sub.2).sub.nO--,
--(CH.sub.2).sub.nS--, O(CH.sub.2CH.sub.2O).sub.nCH.sub.2CH.sub.2OH
(e.g., n=3 or 6), abasic sugars, amide, carboxy, amine, oxyamine,
oxyimine, thioether, disulfide, thiourea, sulfonamide, or
morpholino, or biotin and fluorescein reagents.
[0175] The iRNA agents can have a terminal phosphate group that is
unmodified (e.g., W, X, Y, and Z are O) or modified. In a modified
phosphate group, W and Z can be independently NH, O, or S; and X
and Y can be independently S, Se, BH.sub.3.sup.-, C.sub.1-C.sub.6
alkyl, C.sub.6-C.sub.10 aryl, H, O, O.sup.-, alkoxy or amino
(including alkylamino, arylamino, etc.). Preferably, W, X and Z are
O and Y is S.
[0176] R.sub.1 and R.sub.3 are each, independently, hydrogen; or
C.sub.1-C.sub.100 alkyl, optionally substituted with hydroxyl,
amino, halo, phosphate or sulfate and/or may be optionally inserted
with N, O, S, alkenyl or alkynyl.
[0177] R.sub.2 is hydrogen; C.sub.1-C.sub.100 alkyl, optionally
substituted with hydroxyl, amino, halo, phosphate or sulfate and/or
may be optionally inserted with N, O, S, alkenyl or alkynyl; or,
when n is 1, R.sub.2 may be taken together with R.sub.4 or R.sub.6
to form a ring of 5-12 atoms.
[0178] R.sub.4 is hydrogen; C.sub.1-C.sub.100 alkyl, optionally
substituted with hydroxyl, amino, halo, phosphate or sulfate and/or
may be optionally inserted with N, O, S, alkenyl or alkynyl; or,
when n is 1, R.sub.4 may be taken together with R.sub.2 or R.sub.5
to form a ring of 5-12 atoms.
[0179] R.sub.5 is hydrogen, C.sub.1-C.sub.100 alkyl optionally
substituted with hydroxyl, amino, halo, phosphate or sulfate and/or
may be optionally inserted with N, O, S, alkenyl or alkynyl; or,
when n is 1, R.sub.5 may be taken together with R.sub.4 to form a
ring of 5-12 atoms.
[0180] R.sub.6 is hydrogen, C.sub.1-C.sub.100 alkyl, optionally
substituted with hydroxyl, amino, halo, phosphate or sulfate and/or
may be optionally inserted with N, O, S, alkenyl or alkynyl, or,
when n is 1, R.sub.6 may be taken together with R.sub.2 to form a
ring of 6-10 atoms;
[0181] R.sub.7 is hydrogen, C.sub.1-C.sub.100 alkyl, or
C(O)(CH.sub.2).sub.qC(O)NHR.sub.9; T is hydrogen or a functional
group; n and q are each independently 1-100; R.sub.8 is
C.sub.1-C.sub.10 alkyl or C.sub.6-C.sub.10 aryl; and R.sub.9 is
hydrogen, C1-C10 alkyl, C6-C10 aryl or a solid support agent.
[0182] Preferred embodiments may include one of more of the
following subsets of iRNA agent delivery modules.
[0183] In one subset of RNAi agent delivery modules, A can be
connected directly or indirectly through a terminal 3' or 5' ribose
sugar carbon of the RNA agent.
[0184] In another subset of RNAi agent delivery modules, X, W, and
Z are O and Y is S.
[0185] In still yet another subset of RNAi agent delivery modules,
n is 1, and R.sub.2 and R.sub.6 are taken together to form a ring
containing six atoms and R.sub.4 and R.sub.5 are taken together to
form a ring containing six atoms. Preferably, the ring system is a
trans-decalin. For example, the RNAi agent delivery module of this
subset can include a compound of Formula (Y-1): ##STR10##
[0186] The functional group can be, for example, a targeting group
(e.g., a steroid or a carbohydrate), a reporter group (e.g., a
fluorophore), or a label (an isotopically labeled moiety).
[0187] The targeting group can further include protein binding
agents, endothelial cell targeting groups (e.g., RGD peptides and
mimetics), cancer cell targeting groups (e.g., folate Vitamin B12,
Biotin), bone cell targeting groups (e.g., bisphosphonates,
polyglutamates, polyaspartates), multivalent mannose (for e.g.,
macrophage testing), lactose, galactose, N-acetyl-galactosamine,
monoclonal antibodies, glycoproteins, lectins, melanotropin, or
thyrotropin.
[0188] As can be appreciated by the skilled artisan, methods of
synthesizing the compounds of the formulae herein will be evident
to those of ordinary skill in the art. The synthesized compounds
can be separated from a reaction mixture and further purified by a
method such as column chromatography, high pressure liquid
chromatography, or recrystallization. Additionally, the various
synthetic steps may be performed in an alternate sequence or order
to give the desired compounds. Synthetic chemistry transformations
and protecting group methodologies (protection and deprotection)
useful in synthesizing the compounds described herein are known in
the art and include, for example, those such as described in R.
Larock, Comprehensive Organic Transformations, VCH Publishers
(1989); T. W. Greene and P. G. M. Wuts, Protective Groups in
Organic Synthesis, 2d. Ed., John Wiley and Sons (1991); L. Fieser
and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis,
John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of
Reagents for Organic Synthesis, John Wiley and Sons (1995), and
subsequent editions thereof.
[0189] Sugar Replacement Modification Subunit
[0190] An iRNA agent modified for enhanced uptake into a neural
cell is coupled to a ligand, e.g., a lipophilic ligand. The ligand
can be attached to the oligonucleotide agent through a monomer,
e.g., a chemically modified monomer that is integrated into the
oligonucleotide agent. In a preferred embodiment, the coupling is
by a tether or a linker (or both) as described herein, and the
complex has the formula represented by:
Ligand-[linker].sub.optional-[tether].sub.optional-oligonucleotide
agent
[0191] While, in most cases, embodiments are described with respect
to an oligonucleotide agent including a number of nucleotides, the
invention includes monomeric subunits having the structure:
Ligand-[linker].sub.optional-[tether].sub.optional-monomer
[0192] Methods of making and incorporating the monomers into the
oligonucleotide agents and methods of using of those agents are
included in the invention.
[0193] In preferred embodiments, the sugar, e.g., the ribose sugar
of one or more of the nucleotides, (e.g., ribonucleotide,
deoxynucleotide, or modified nucleotide) subunits of an
oligonucleotide agent can be replaced with another moiety, e.g., a
non-carbohydrate (preferably cyclic) carrier. A nucleotide subunit
in which the sugar of the subunit has been so replaced is referred
to herein as a sugar replacement modification subunit (SRMS). This
is often referred to herein as a "tether." A cyclic carrier may be
a carbocyclic ring system, i.e., all ring atoms are carbon atoms or
a heterocyclic ring system, i.e., one or more ring atoms may be a
heteroatom, e.g., nitrogen, oxygen, or sulfur. The cyclic carrier
may be a monocyclic ring system, or may contain two or more rings,
e.g. fused rings. The cyclic carrier may be a fully saturated ring
system, or it may contain one or more double bonds.
[0194] The carriers further include (i) at least two "backbone
attachment points" and (ii) at least one "tethering attachment
point." A "backbone attachment point" as used herein refers to a
functional group, e.g. a hydroxyl group, or generally, a bond
available for, and that is suitable for incorporation of the
carrier into the backbone, e.g., the phosphate, or modified
phosphate, e.g., sulfur containing, backbone, of a ribonucleic
acid. A "tethering attachment point" as used herein refers to a
constituent ring atom of the cyclic carrier, e.g., a carbon atom or
a heteroatom (distinct from an atom which provides a backbone
attachment point), that connects a selected moiety. The moiety can
be, e.g., a ligand, e.g., a targeting or delivery moiety, or a
moiety which alters a physical property. One of the most preferred
moieties is a moiety which promotes entry into a cell, e.g., a
lipophilic moiety, e.g., cholesterol. While not wishing to be bound
by theory it is believed the attachment of a lipophilic agent
increases the lipophilicity of an oligonucleotide agent.
Optionally, the selected moiety is connected by an intervening
tether to the cyclic carrier. Thus, it will often include a
functional group, e.g., an amino group, or generally, provide a
bond, that is suitable for incorporation or tethering of another
chemical entity, e.g., a ligand to the constituent ring.
[0195] Incorporation of one or more SRMSs described herein into an
oligonucleotide agent, particularly when tethered to an appropriate
entity, can confer one or more new properties to the
oligonucleotide agent and/or alter, enhance or modulate one or more
existing properties in the oligonucleotide agent. E.g., it can
alter one or more of lipophilicity or nuclease resistance.
Incorporation of one or more SRMSs described herein into an
oligonucleotide agent can, particularly when the SRMS is tethered
to an appropriate entity, modulate, e.g., increase, binding
affinity of an oligonucleotide agent to a target RNA, e.g., a
pre-mRNA, mRNA, or miRNA of the subject or a pathogen of the
subject. Incorporation of one or more SRMSs can alter distribution,
target the oligonucleotide agent to a particular part of the body,
modify the interaction with nucleic acid binding proteins (e.g.,
during RISC formation and strand separation), or increase sequence
specificity, e.g, to inhibit off-site targeting.
[0196] Accordingly, in one aspect, the invention features, an
oligonucleotide agent preferably comprising at least one subunit
having the structure of formula (I): ##STR11##
[0197] wherein:
[0198] X is N(CO)R.sup.7, NR.sup.7 or CH.sub.2;
[0199] Y is NR.sup.8, O, S, CR.sup.9R.sup.10, or absent;
[0200] Z is CR.sup.11R.sup.12 or absent;
[0201] Each of R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.9, and
R.sup.10 is, independently, H, OR.sup.a, OR.sup.b,
(CH.sub.2).sub.nOR.sup.a, or (CH.sub.2).sub.nOR.sup.b, provided
that at least one of R.sup.1, R.sup.2, R.sup.3, R.sub.4, R.sub.9,
and R.sup.10 is OR.sup.a or R.sup.b and that at least one of
R.sup.1, R.sup.2, R.sup.3, R.sub.4, R.sub.9, and R.sup.10 is
(CH.sub.2).sub.nOR.sup.a, or (CH.sub.2).sub.nOR.sup.b (when the
SRMS is terminal, one of R.sup.1, R.sup.2, R.sup.3, R.sup.4, and
R.sup.10 will include R.sup.a and one will include R.sup.b; when
the SRMSS is internal, two of R.sup.1, R.sup.2, R.sup.3, R.sup.4,
R.sup.9, and R.sup.10 will each include an R.sup.b);further
provided that preferably OR.sup.a may only be present with
(CH.sub.2).sub.nOR.sup.b and (CH.sub.2).sub.nOR.sup.a may only be
present with OR.sup.b;
[0202] Each of R.sup.5, R.sup.6, R.sup.11, and R.sup.12 is,
independently, H, C.sub.1-C.sub.6 alkyl optionally substituted with
1-3 R.sup.13, or C(O)NHR.sup.7; or R.sup.5 and R.sup.11 together
are C.sub.3-C.sub.8 cycloalkyl optionally substituted with
R.sup.14;
[0203] R.sup.7 can be a ligand, e.g., R.sup.7 can be R.sup.d, or
R.sub.7 can be a ligand tethered indirectly to the carrier, e.g.,
through a tethering moiety, e.g., C.sub.1-C.sub.20 alkyl
substituted with NR.sup.cR.sup.d; or C.sub.1-C.sub.20 alkyl
substituted with NHC(O)R.sup.d;
[0204] R.sup.8 is C.sub.1-C.sub.6 alkyl;
[0205] R.sup.13 is hydroxy, C.sub.1-C.sub.4 alkoxy, or halo;
[0206] R.sup.4 is NR.sup.cR.sup.7;
[0207] R.sup.a is: ##STR12##
[0208] R.sup.b is: ##STR13##
[0209] Each of A and C is, independently, O or S;
[0210] B is OH, O.sup.-, or ##STR14##
[0211] R.sup.c is H or C.sub.1-C.sub.6 alkyl;
[0212] R.sup.d is H or a ligand, e.g., a lipophilic ligand, e.g.,
cholesterol; and
[0213] n is 1-4.
[0214] Embodiments can include one or more of the following
features:
[0215] R.sup.1 can be CH.sub.2OR.sup.a and R.sup.3 can be OR.sup.b;
or R.sup.1 can be CH.sub.2OR.sup.a and R.sup.9 can be OR.sup.b; or
R.sup.1 can be CH.sub.2OR.sup.a and R.sup.2 can be OR.sup.b.
[0216] R.sup.1 can be CH.sub.2OR.sup.b and R.sup.3 can be OR.sup.b;
or R.sup.1 can be CH.sub.2OR.sup.b and R.sup.9 can be OR.sup.b; or
R.sup.1 can be CH.sub.2OR.sup.b and R.sup.2 can be OR.sup.b; or
R.sup.1 can be CH.sub.2OR.sup.b and R.sup.3 can be OR.sup.a; or
R.sup.1 can be CH.sub.2OR.sup.b and R.sub.9 can be OR.sup.a; or
R.sup.1 can be CH.sub.2OR.sup.b and R.sup.2 can be OR.sup.a.
[0217] R.sup.1 can be OR.sup.a and R.sup.3 can be CH.sub.2OR.sup.b;
or R.sup.1 can be OR.sup.a and R.sup.9 can be CH.sub.2OR.sup.b; or
R.sup.1 can be OR.sup.a and R.sup.2 can be CH.sub.2OR.sup.b.
[0218] R.sup.1 can be OR.sup.b and R.sub.3 can be CH.sub.2OR.sup.b;
or R.sup.1 can be OR.sup.b and R.sub.9 can be CH.sub.2OR.sup.b; or
R.sup.1 can be OR.sup.b and R.sup.2 can be CH.sub.2OR.sup.b; or
R.sup.1 can be OR.sup.b and R.sup.3 can be CH.sub.2OR.sup.a; or
R.sup.1 can be OR.sup.b and R.sup.9 can be CH.sub.2OR.sup.a; or
R.sup.1 can be OR.sup.b and R.sup.2 can be CH.sub.2OR.sup.a.
[0219] R.sup.3 can be CH.sub.2OR.sup.a and R.sup.9 can be OR.sup.b;
or R.sup.3 can be CH.sub.2OR.sup.a and R.sup.4 can be OR.sup.b.
[0220] R.sup.3 can be CH.sub.2OR.sup.b and R.sup.9 can be OR.sup.b;
or R.sup.3 can be CH.sub.2OR.sup.b and R.sup.4 can be OR.sup.b; or
R.sub.3 can be CH.sub.2OR.sup.b and R.sup.9 can be OR.sup.a; or
R.sup.3 can be CH.sub.2OR.sup.b and R.sup.4 can be OR.sup.a.
[0221] R.sup.3 can be OR.sup.b and R.sup.9 can be CH.sub.2OR.sup.a;
or R.sup.3 can be OR.sup.b and R.sup.4 can be CH.sub.2OR.sup.a; or
R.sup.3 can be OR.sup.b and R.sup.9 can be CH.sub.2OR.sup.b; or
R.sup.3 can be OR.sup.b and R.sup.4 can be CH.sub.2OR.sup.b.
[0222] R.sup.3 can be OR.sup.a and R.sup.9 can be CH.sub.2OR.sup.b;
or R.sup.3 can be OR.sup.a and R.sup.4 can be CH.sub.2OR.sup.b.
[0223] R.sup.9 can be CH.sub.2OR.sup.a and R.sup.10 can be
OR.sup.b.
[0224] R.sup.9 can be CH.sub.2OR.sup.b and R.sup.10 can be
OR.sup.b; or R.sup.9 can be CH.sub.2OR.sup.b and R.sup.10 can be
OR.sup.a.
[0225] In a preferred embodiment the ribose is replaced with a
pyrroline scaffold or with a 4-hydroxyproline-derived scaffold, and
X is N(CO)R.sup.7 or NR.sup.7, Y is CR.sup.9R.sup.10, and Z is
absent.
[0226] R.sup.1 and R.sup.3 can be cis or R.sup.1 and R.sup.3 can be
trans.
[0227] n can be 1.
[0228] A can be O or S.
[0229] R.sup.1 can be (CH.sub.2).sub.nOR.sup.b and R.sup.3 can be
OR.sup.b; or R.sup.1 can be (CH.sub.2).sub.nOR.sup.a and R.sup.3
can be OR.sup.b.
[0230] R.sup.7 can be (CH.sub.2).sub.5NHR.sup.d or
(CH.sub.2).sub.5NHR.sup.d. R.sup.d can be chosen from a folic acid
radical; a cholesterol radical; a carbohydrate radical; a vitamin A
radical; a vitamin E radical; a vitamin K radical. Preferably,
R.sup.d is a cholesterol radical.
[0231] R.sup.1 can be OR.sup.b and R.sup.3 can be
(CH.sub.2).sub.nOR.sup.b; or R.sup.1 can be OR.sup.b and R.sup.3
can be (CH.sub.2).sub.nOR.sup.a; or R.sup.1 can be OR.sup.a and
R.sup.3 can be (CH.sub.2).sub.nOR.sup.b; or R.sup.1 can be
(CH.sub.2).sub.nOR.sup.b and R.sup.9 can be OR.sup.a.
[0232] R.sup.1 and R.sup.9 can be cis or R.sup.1 and R.sup.9 can be
trans.
[0233] R.sup.1 can be OR.sup.a and R.sup.9 can
be(CH.sub.2).sub.nOR.sup.b; or R.sup.1 can be
(CH.sub.2).sub.nOR.sup.b and R.sup.9 can be OR.sup.b; or R.sup.1
can be (CH.sub.2).sub.nOR.sup.a and R.sup.9 can be OR.sup.b; or
R.sup.1 can be OR.sup.b and R.sup.9 can be
(CH.sub.2).sub.nOR.sup.b; or R.sup.1 can be OR.sup.b and R.sup.9
can be(CH.sub.2).sub.nOR.sup.a.
[0234] R.sup.3 can be (CH.sub.2).sub.nOR.sup.b and R.sup.9 can be
OR.sup.a; or R.sup.3 can be (CH.sub.2).sub.nOR.sup.b and R.sup.9
can be OR.sup.b; or R.sup.3 can be (CH.sub.2).sub.nOR.sup.a and
R.sup.9 can be OR.sup.b; or R.sup.3 can be OR.sup.a and R.sup.9 can
be(CH.sub.2).sub.nOR.sup.b; R.sup.3 can be OR.sup.b and R.sup.9 can
be(CH.sub.2).sub.nOR.sup.b; or R.sup.3 can be OR.sup.b and R.sup.9
can be(CH.sub.2).sub.nOR.sup.a.
[0235] R.sup.3 and R.sup.9 can be cis or R.sup.3 and R.sup.9 can be
trans.
[0236] In other preferred embodiments the ribose is replaced with a
piperidine scaffold, and X is N(CO)R.sup.7 or NR.sup.7, Y is
CR.sup.9R.sup.10, and Z is CR.sup.11R.sup.12.
[0237] R.sup.9 can be (CH.sub.2).sub.nOR.sup.b and R.sup.10 can be
OR.sup.a.
[0238] n can be 1 or 2.
[0239] R.sup.9 can be (CH.sub.2).sub.nOR.sup.b and R.sup.10 can be
OR.sup.b; or R.sup.9 can be (CH.sub.2).sub.nOR.sup.a and R.sup.10
can be OR.sup.b.
[0240] A can be O or S.
[0241] R.sup.7 can be (CH.sub.2).sub.5NHR.sup.d or
(CH.sub.2).sub.5NHR.sup.d. R.sup.d can be selected from a folic
acid radical; a cholesterol radical; a carbohydrate radical; a
vitamin A radical; a vitamin E radical; a vitamin K radical.
Preferably, R.sup.d is a cholesterol radical.
[0242] R.sup.3 can be (CH.sub.2).sub.nOR.sup.b and R.sup.4 can be
OR.sup.a; or R.sup.3 can be (CH.sub.2).sub.nOR.sup.b and R.sup.4
can be OR.sup.b; or
[0243] R.sup.3 can be (CH.sub.2).sub.nOR.sup.a and R.sup.4 can be
OR.sup.b.
[0244] R.sup.1 can be (CH.sub.2).sub.nOR.sup.b and R.sup.2 can be
OR.sup.a; or R.sup.1 can be (CH.sub.2).sub.nOR.sup.b and R.sup.2
can be OR.sup.b; or R.sup.1 can be (CH.sub.2).sub.nOR.sup.a and
R.sup.2 can be OR.sup.b.
[0245] R.sup.3 can be (CH.sub.2).sub.nOR.sup.b and R.sup.9 can be
OR.sup.a.
[0246] R.sup.3 and R.sup.9 can be cis, or R.sup.3 and R.sup.9 can
be trans.
[0247] R.sup.3 can be (CH.sub.2).sub.nOR.sup.b and R.sup.9 can be
OR.sup.b; or R.sup.3 can be (CH.sub.2).sub.nOR.sup.b and R.sup.9
can be OR.sup.a; or R.sup.3 can be (CH.sub.2).sub.nOR.sup.a and
R.sup.9 can be OR.sup.b.
[0248] R.sup.1 can be (CH.sub.2).sub.nOR.sup.b and R.sup.3 can be
OR.sup.a.
[0249] R.sup.1 and R.sup.3 can be cis, or R.sup.1 and R.sup.3 can
be trans.
[0250] R.sup.3 can be OR.sup.a and R.sup.9 can be
(CH.sub.2).sub.nOR.sup.b.
[0251] R.sup.1 can be OR.sup.a and R.sup.3 can be
(CH.sub.2).sub.nOR.sup.b.
[0252] In other preferred embodiments the ribose is replaced with a
piperazine scaffold, and X is N(CO)R.sup.7 or NR.sup.7, Y is
NR.sup.8, and Z is CR.sup.11R.sup.12.
[0253] R.sup.1 can be (CH.sub.2).sub.nOR.sup.b and R.sup.3 can be
OR.sup.a.
[0254] R.sup.1 and R.sup.3 can be cis or R.sup.1 and R.sup.3 can be
trans.
[0255] n can be 1.
[0256] R.sup.1 can be (CH.sub.2).sub.nOR.sup.b and R.sup.3 can be
OR.sup.b; or R.sup.1 can be (CH.sub.2).sub.nOR.sup.a and R.sup.3
can be OR.sup.b.
[0257] A can be O or S, preferably S.
[0258] R.sup.7 can be (CH.sub.2).sub.5NHR.sup.d or
(CH.sub.2).sub.5NHR.sup.d. R.sup.d can be chosen from the group of
a folic acid radical; a cholesterol radical; a carbohydrate
radical; a vitamin A radical; a vitamin E radical; a vitamin K
radical. Preferably, R.sup.d is a cholesterol radical.
[0259] R.sup.8 can be CH.sub.3.
[0260] R.sup.1 can be OR.sup.a and R.sup.3 can be
(CH.sub.2).sub.nOR.sup.b.
[0261] In other preferred embodiments the ribose is replaced with a
morpholino scaffold, and X is N(CO)R.sup.7 or NR.sup.7, Y is O, and
Z is CR.sup.11R.sup.12.
[0262] R.sup.1 can be (CH.sub.2).sub.nOR.sup.b and R.sup.3 can be
OR.sup.a.
[0263] R.sup.1 and R.sup.3 can be cis, or R.sup.1 and R.sup.3 can
be trans.
[0264] n can be 1.
[0265] R.sup.1 can be (CH.sub.2).sub.nOR.sup.b and R.sup.3 can be
OR.sup.b; of R.sup.1 can be (CH.sub.2).sub.nOR.sup.a and R.sup.3
can be OR.sup.b.
[0266] A can be O or S.
[0267] R.sup.7 can be (CH.sub.2).sub.5NHR.sup.d or
(CH.sub.2).sub.5NHR.sup.d. R.sup.d can be chosen from the group of
a folic acid radical; a cholesterol radical; a carbohydrate
radical; a vitamin A radical; a vitamin E radical; a vitamin K
radical. Preferably, R.sup.d is a cholesterol radical.
[0268] R.sup.8 can be CH.sub.3.
[0269] R.sup.1 can be OR.sup.a and R.sup.3 can be
(CH.sub.2).sub.nOR.sup.b.
[0270] In other preferred embodiments the ribose is replaced with a
decalin scaffold, and X is CH.sub.2; Y is CR.sup.9R.sup.10; and Z
is CR.sup.11R.sup.12; and R.sup.5 and R.sup.11 together are C.sup.6
cycloalkyl.
[0271] R.sup.6 can be C(O)NHR.sup.7.
[0272] R.sup.12 can be hydrogen.
[0273] R.sup.6 and R.sup.12 can be trans.
[0274] R.sup.3 can be OR.sup.a and R.sup.9 can be
(CH.sub.2).sub.nOR.sup.b.
[0275] R.sup.3 and R.sup.9 can be cis, or R.sup.3 and R.sup.9 can
be trans.
[0276] n can be 1 or 2.
[0277] R.sup.3 can be OR.sup.b and R.sup.9 can be
(CH.sub.2).sub.nOR.sup.b; or R.sup.3 can be OR.sup.b and R.sup.9
can be (CH.sub.2).sub.nOR.sup.a.
[0278] A can be O or S.
[0279] R.sup.7 can be (CH.sub.2).sub.5NHR.sup.d or
(CH.sub.2).sub.5NHR.sup.d. R.sup.d can be chosen from the group of
a folic acid radical; a cholesterol radical; a carbohydrate
radical; a vitamin A radical; a vitamin E radical; a vitamin K
radical. Preferably, R.sup.d is a cholesterol radical.
[0280] In other preferred embodiments the ribose is replaced with a
decalin/indane scaffold, e.g., X is CH.sub.2; Y is
CR.sup.9R.sup.10; and Z is CR.sup.11R.sup.12 ; and R.sup.5 and
R.sup.11 together are C.sup.5 cycloalkyl.
[0281] R.sup.6 can be CH.sub.3.
[0282] R.sup.12 can be hydrogen.
[0283] R.sup.6 and R.sup.12 can be trans.
[0284] R.sup.3 can be OR.sup.a and R.sup.9 can be
(CH.sub.2).sub.nOR.sup.b.
[0285] R.sup.3 and R.sup.9 can be cis, or R.sup.3 and R.sup.9 can
be trans.
[0286] n can be 1 or 2.
[0287] R.sup.3 can be OR.sup.b and R.sup.9 can be
(CH.sub.2).sub.nOR.sup.a; or R.sup.3 can be OR.sup.b and R.sup.9
can be (CH.sub.2).sub.nOR.sup.a.
[0288] A can be O or S.
[0289] R.sup.14 can be N(CH3)R.sup.7. R.sup.7 can be
(CH.sub.2).sub.5NHR.sup.d or (CH.sub.2).sub.5NHR.sup.d. R.sup.d can
be chosen from the group of a folic acid radical; a cholesterol
radical; a carbohydrate radical; a vitamin A radical; a vitamin E
radical; a vitamin K radical. Preferably, R.sup.d is a cholesterol
radical.
[0290] In another aspect, this invention features an
oligonucleotide agent comprising at least one subunit having a
structure of formula (II): ##STR15##
[0291] X is N(CO)R.sup.7 or NR.sup.7;
[0292] Each of R.sup.1 and R.sup.2 is, independently, OR.sup.a,
OR.sup.b, (CH.sub.2).sub.nOR.sup.a, or (CH.sub.2).sub.nOR.sup.b,
provided that one of R.sup.1 and R.sup.2 is OR.sup.a or OR.sup.b
and the other is (CH.sub.2).sub.nOR.sup.a or
(CH.sub.2).sub.nOR.sup.b (when the SRMS is terminal, one of R.sup.1
or R.sup.2 will include R.sup.a and one will include R.sup.b; when
the SRMSS is internal, both R.sup.1 and R.sup.2 will each include
an R.sup.b);further provided that preferably OR.sup.a may only be
present with (CH.sub.2).sub.nOR.sup.b and (CH.sub.2).sub.nOR.sup.a
may only be present with OR.sup.b;
[0293] R.sup.7 is C.sub.1-C.sub.20 alkyl substituted with
NR.sup.cR.sup.d;
[0294] R.sup.8 is C.sub.1-C.sub.6 alkyl;
[0295] R.sup.13 is hydroxy, C.sub.1-C.sub.4 alkoxy, or halo;
[0296] R.sup.14 is NR.sup.cR.sup.7;
[0297] R.sup.a is: ##STR16##
[0298] R.sup.b is ##STR17##
[0299] Each of A and C is, independently, O or S;
[0300] B is OH, O.sup.-, or ##STR18##
[0301] R.sup.c is H or C.sub.1-C.sub.6 alkyl;
[0302] R.sup.d is H or a ligand; and
[0303] n is 1-4.
[0304] The oligonucleotide agent of the conjugate is substantially
single-stranded and comprises from about 12 to about 29 subunits,
preferably about 15 to about 25 subunits. An oligonucleotide agent
that is substantially single-stranded includes at least 60%, 70%,
80%, or 90% or more nucleotides that are not duplexed.
[0305] Embodiments can include one or more of the features
described above.
[0306] In a further aspect, this invention features an
oligonucleotide agent having at least one subunit comprising
formula (I) or formula (II).
[0307] In one aspect, this invention features an oligonucleotide
agent having at least two subunits comprising formula (I) and/or
formula (II).
[0308] In another aspect, this invention provides a method of
making an oligonucleotide agent described herein having at least
one subunit comprising formula (I) and/or (II). In a further
aspect, this invention provides a method of modulating expression
of a target gene. The method includes administering an
oligonucleotide agent described herein having at least one subunit
comprising formula (I) and/or (II) to a subject.
[0309] In one aspect, this invention features a pharmaceutical
composition having an oligonucleotide agent described herein having
at least one subunit comprising formula (I) and/or (II) and a
pharmaceutically acceptable carrier.
[0310] SRMSs or tethers described herein may be incorporated into
any oligonucleotide agent described herein. An oligonucleotide
agent may include one or more of the SRMSs described herein. An
SRMS can be introduced at one or more points in an oligonucleotide
agent. An SRMS can be placed at or near (within 1, 2, or 3
positions) the 3' or 5' end of the oligonucleotide. In some
embodiments, it is preferred to not have an SRMS at or near (within
1, 2, or 3 positions of) the 5' end of the oligonucleotide. An SRMS
can be internal, and will preferably be positioned in regions not
critical for binding to the target.
[0311] In an embodiment, an oligonucleotide agent may have an SRMS
at (or within 1, 2, or 3 positions of) the 3' end.
[0312] In another embodiment, an oligonucleotide agent may have an
SRMS at an internal position. In other embodiments, an
oligonucleotide agent may have an SRMS at the 3' end and an SRMS at
an internal position.
[0313] Other modifications to sugars, bases, or backbones described
herein can be incorporated into the oligonucleotide agents.
[0314] The oligonucleotide agents can take an architecture or
structure described herein.
[0315] The oligonucleotide agent can be selected to target any of a
broad spectrum of genes, including any of the genes described
herein.
[0316] In a preferred embodiment the oligonucleotide agent has an
architecture (architecture refers to one or more of the overall
length) described herein. In addition to the SRMS-containing bases
of the oligonucleotide agents described herein can include nuclease
resistant monomers (NRMs).
[0317] In another aspect, the invention features an oligonucleotide
agent to which is conjugated a lipophilic moiety, e.g.,
cholesterol, e.g., by conjugation to an SRMS of an oligonucleotide
agent. In a preferred embodiment, the lipophilic moiety enhances
entry of the oligonucleotide agent into a cell. In a preferred
embodiment, the cell is part of an organism, tissue, or cell line,
e.g., a primary cell line, immortalized cell line, or any type of
cell line disclosed herein. Thus, the conjugated oligonucleotide
agent can be used to inhibit expression of a target gene in an
organism, e.g., a mammal, e.g., a human, or to inhibit expression
of a target gene in a cell line or in cells which are outside an
organism.
[0318] The lipophilic moiety can be chosen, for example, from the
group consisting of a lipid, cholesterol, oleyl, retinyl,
cholesteryl residues, cholic acid, adamantane acetic acid, 1-pyrene
butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol,
geranyloxyhexyl group, hexadecylglycerol, borneol, menthol,
1,3-propanediol, heptadecyl group, palmitic acid, myristic
acid,O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid,
dimethoxytrityl, or phenoxazine. A preferred lipophilic moiety is
cholesterol.
[0319] The oligonucleotide agent can have at least one subunit
having formula (I) or formula (II) incorporated into it. The
oligonucleotide agent can have one or more of any of the features
described herein. For example, when the subunit is of formula (I),
R.sup.d can be cholesterol; X can be N(CO)R.sup.7 or NR.sup.7, Y
can be CR.sup.9R.sup.10, and Z can be absent, and R.sup.1 can be
(CH.sub.2).sub.nOR.sup.b and R.sup.3 can be OR.sup.a; X can be
N(CO)R.sup.7 or NR.sup.7, Y can be CR.sup.9R.sup.10, and Z can be
CR.sup.11R.sup.12, and R.sup.9 can be (CH.sub.2).sub.nOR.sup.b and
R.sup.10 can be OR.sup.a; X can be N(CO)R.sup.7 or NR.sup.7, Y can
be NR.sup.8, and Z can be CR.sup.11R.sup.12, and R.sup.1 can be
(CH.sub.2).sub.nOR.sup.b and R.sup.3 can be OR.sup.a; X can be
CH.sub.2; Y can be CR.sup.9R.sup.10; and Z can be
CR.sup.11R.sup.12, in which R.sup.6 can be C(O)NHR.sup.7; or X can
be CH.sub.2; Y can be CR.sup.9R.sup.10; and Z can be
CR.sup.11R.sup.12, in which R.sup.11 or R.sup.12 can be
C(O)NHR.sup.7 or R.sup.5 and R.sup.11 together can be C.sub.5 or
C.sub.6 cycloalkyl substituted with N(CH3)R.sup.7.
[0320] Tethered Ligands
[0321] A wide variety of entities can be tethered to an
oligonucleotide agent, e.g., to the carrier of a ligand-conjugated
monomer. Examples are described below in the context of a
ligand-conjugated monomer but that is only one preferred
embodiment. Entities can be coupled at other points to an
oligonucleotide agent.
[0322] A ligand tethered to an oligonucleotide agent (e.g., an
oligonucleotide agent targeting an miRNA) can have a favorable
effect on the agent. For example, the ligand can improve stability,
hybridization thermodynamics with a target nucleic acid, targeting
to a particular tissue or cell-type, or cell permeability, e.g., by
an endocytosis-dependent or -independent mechanism. Ligands and
associated modifications can also increase sequence specificity and
consequently decrease off-site targeting.
[0323] A tethered ligand can include one or more modified bases or
sugars that can function as intercalators. These are preferably
located in an internal region, such as in a bulge of a miRNA/target
duplex. The intercalator can be an aromatic, e.g., a polycyclic
aromatic or heterocyclic aromatic compound. A polycyclic
intercalator can have stacking capabilities, and can include
systems with 2, 3, or 4 fused rings. The universal bases described
herein can be included on a ligand.
[0324] In one embodiment, the ligand can include a cleaving group
that contributes to target gene inhibition by cleavage of the
target nucleic acid. The cleaving group can be, for example, a
bleomycin (e.g., bleomycin-A5, bleomycin-A2, or bleomycin-B2),
pyrene, phenanthroline (e.g., O-phenanthroline), a polyamine, a
tripeptide (e.g., lys-tyr-lys tripeptide), or metal ion chelating
group. The metal ion chelating group can include, e.g., an Lu(III)
or EU(III) macrocyclic complex, a Zn(II) 2,9-dimethylphenanthroline
derivative, a Cu(II) terpyridine, or acridine, which can promote
the selective cleavage of target RNA at the site of the bulge by
free metal ions, such as Lu(III). In some embodiments, a peptide
ligand can be tethered to a miRNA to promote cleavage of the target
RNA, e.g., at the bulge region. For example,
1,8-dimethyl-1,3,6,8,10,13-hexaazacyclotetradecane (cyclam) can be
conjugated to a peptide (e.g., by an amino acid derivative) to
promote target RNA cleavage.
[0325] A tethered ligand can be an aminoglycoside ligand, which can
cause an oligonucleotide agent to have improved hybridization
properties or improved sequence specificity. Exemplary
aminoglycosides include glycosylated polylysine, galactosylated
polylysine, neomycin B, tobramycin, kanamycin A, and acridine
conjugates of aminoglycosides, such as Neo-N-acridine,
Neo-S-acridine, Neo-C-acridine, Tobra-N-acridine, and
KanaA-N-acridine. Use of an acridine analog can increase sequence
specificity. For example, neomycin B has a high affinity for RNA as
compared to DNA, but low sequence-specificity. An acridine analog,
neo-S-acridine has an increased affinity for the HIV Rev-response
element (RRE). In some embodiments the guanidine analog (the
guanidinoglycoside) of an aminoglycoside ligand is tethered to an
oligonucleotide agent. In a guanidinoglycoside, the amine group on
the amino acid is exchanged for a guanidine group. Attachment of a
guanidine analog can enhance cell permeability of an
oligonucleotide agent, e.g., an oligonucleotide agent targeting an
miRNA or pre-miRNA.
[0326] A tethered ligand can be a poly-arginine peptide, peptoid or
peptidomimetic, which can enhance the cellular uptake of an
oligonucleotide agent.
[0327] Preferred moieties are ligands, which are coupled,
preferably covalently, either directly or indirectly via an
intervening tether, to the ligand-conjugated carrier. In preferred
embodiments, the ligand is attached to the carrier via an
intervening tether. As discussed above, the ligand or tethered
ligand may be present on the monomer when the monomer is
incorporated into the growing strand. In some embodiments, the
ligand may be incorporated into a "precursor" a ligand-conjugated
monomer subunit after a "precursor" a ligand-conjugated monomer has
been incorporated into the growing strand. For example, a monomer
having, e.g., an amino-terminated tether, e.g.,
TAP--(CH.sub.2).sub.nNH.sub.2 may be incorporated into a growing
oligonucleotide strand. In a subsequent operation, i.e., after
incorporation of the precursor monomer into the strand, a ligand
having an electrophilic group, e.g., a pentafluorophenyl ester or
aldehyde group, can subsequently be attached to the precursor
monomer subunit by coupling the electrophilic group of the ligand
with the terminal nucleophilic group of the precursor monomer
subunit tether.
[0328] In preferred embodiments, a ligand alters the distribution,
targeting or lifetime of an oligonucleotide agent into which it is
incorporated. In preferred embodiments a ligand provides an
enhanced affinity for a selected target, e.g, molecule, cell or
cell type, compartment, e.g., a cellular or organ compartment,
tissue, organ or region of the body, as, e.g., compared to a
species absent such a ligand.
[0329] Preferred ligands can improve transport, hybridization, and
specificity properties and may also improve nuclease resistance of
the resultant natural or modified oligoribonucleotide, or a
polymeric molecule comprising any combination of monomers described
herein and/or natural or modified ribonucleotides.
[0330] Ligands in general can include therapeutic modifiers, e.g.,
for enhancing uptake; diagnostic compounds or reporter groups e.g.,
for monitoring distribution; cross-linking agents;
nuclease-resistance conferring moieties; and natural or unusual
nucleobases. General examples include lipophiles, lipids, steroids
(e.g., uvaol, hecigenin, diosgenin), terpenes (e.g., triterpenes,
e.g., sarsasapogenin, Friedelin, epifriedelanol derivatized
lithocholic acid), vitamins (e.g., folic acid, vitamin A, biotin,
pyridoxal), carbohydrates, proteins, protein binding agents,
integrin targeting molecules,polycationics, peptides, polyamines,
and peptide mimics.
[0331] Ligands can include a naturally occurring substance, (e.g.,
human serum albumin (HSA), low-density lipoprotein (LDL), or
globulin); carbohydrate (e.g., a dextran, pullulan, chitin,
chitosan, inulin, cyclodextrin or hyaluronic acid); amino acid, or
a lipid. The ligand may also be a recombinant or synthetic
molecule, such as a synthetic polymer, e.g., a synthetic polyamino
acid. Examples of polyamino acids include polyamino acid is a
polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid,
styrene-maleic acid anhydride copolymer,
poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic
anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer
(HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA),
polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide
polymers, or polyphosphazine. Example of polyamines include:
polyethylenimine, polylysine (PLL), spermine, spermidine,
polyamine, pseudopeptide-polyamine, peptidomimetic polyamine,
dendrimer polyamine, arginine, amidine, protamine, cationic lipid,
cationic porphyrin, quaternary salt of a polyamine, or an alpha
helical peptide.
[0332] Ligands can also include targeting groups, e.g., a cell or
tissue targeting agent, e.g., a lectin, glycoprotein, lipid or
protein, e.g., an antibody, that binds to a specified cell type
such as a kidney cell. A targeting group can be a thyrotropin,
melanotropin, lectin, glycoprotein, surfactant protein A, Mucin
carbohydrate, multivalent lactose, multivalent galactose,
N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose,
multivalent fucose, glycosylated polyaminoacids, multivalent
galactose, transferrin, bisphosphonate, polyglutamate,
polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate,
vitamin B12, biotin, or an RGD peptide or RGD peptide mimetic.
[0333] Other examples of ligands include dyes, intercalating agents
(e.g. acridines and substituted acridines), cross-linkers (e.g.
psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin),
polycyclic aromatic hydrocarbons (e.g., phenazine,
dihydrophenazine, phenanthroline, pyrenes), lys-tyr-lys tripeptide,
aminoglycosides, guanidium aminoglycodies, artificial endonucleases
(e.g. EDTA), lipophilic molecules, e.g, cholesterol (and thio
analogs thereof), cholic acid, cholanic acid, lithocholic acid,
adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone,
glycerol (e.g., esters (e.g., mono, bis, or tris fatty acid esters,
e.g., C.sub.10, C.sub.11, C.sub.12, C.sub.13,C.sub.14, C.sub.15,
C.sub.16, C.sub.17, C.sub.18, C.sub.19, or C.sub.20 fatty acids)
and ethers thereof, e.g., C.sub.10, C.sub.11, C.sub.12, C.sub.13,
C.sub.14, C.sub.15, C.sub.16, C.sub.17, C.sub.18, C.sub.19, or
C.sub.20 alkyl; e.g., 1,3-bis-O(hexadecyl)glycerol,
1,3-bis-O(octaadecyl)glycerol), geranyloxyhexyl group,
hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl
group, palmitic acid, stearic acid (e.g., gyceryl distearate),
oleic acid, myristic acid,O3-(oleoyl)lithocholic acid,
O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and
peptide conjugates (e.g., antennapedia peptide, Tat peptide),
alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K),
MPEG, [MPEG].sub.2, polyamino, alkyl, substituted alkyl,
radiolabeled markers, enzymes, haptens (e.g. biotin),
transport/absorption facilitators (e.g., aspirin, naproxen, vitamin
E, folic acid), synthetic ribonucleases (e.g., imidazole,
bisimidazole, histamine, imidazole clusters, acridine-imidazole
conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl,
HRP, or AP.
[0334] Ligands can be proteins, e.g., glycoproteins, or peptides,
e.g., molecules having a specific affinity for a co-ligand, or
antibodies e.g., an antibody, that binds to a specified cell type
such as a cancer cell, endothelial cell, or bone cell. Ligands may
also include hormones and hormone receptors. They can also include
non-peptidic species, such as lipids, lectins, carbohydrates,
vitamins, cofactors, multivalent lactose, multivalent galactose,
N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose,
or multivalent fucose. The ligand can be, for example, a
lipopolysaccharide, an activator of p38 MAP kinase, or an activator
of NF-.kappa.B.
[0335] The ligand can be a substance, e.g, a drug, which can
increase the uptake of the oligonucleotide agent into the cell, for
example, by disrupting the cell's cytoskeleton, e.g., by disrupting
the cell's microtubules, microfilaments, and/or intermediate
filaments. The drug can be, for example, taxon, vincristine,
vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin
A, phalloidin, swinholide A, indanocine, or myoservin.
[0336] The ligand can increase the uptake of the oligonucleotide
agent into the cell by activating an inflammatory response, for
example. Exemplary ligands that would have such an effect include
tumor necrosis factor alpha (TNFalpha), interleukin-1 beta, or
gamma interferon.
[0337] In one aspect, the ligand is a lipid or lipid-based
molecule. Such a lipid or lipid-based molecule preferably binds a
serum protein, e.g., human serum albumin (HSA). An HSA binding
ligand allows for distribution of the conjugate to a target tissue,
e.g., a non-kidney target tissue of the body. For example, the
target tissue can be the liver, including parenchymal cells of the
liver. Other molecules that can bind HSA can also be used as
ligands. For example, neproxin or aspirin can be used. A lipid or
lipid-based ligand can (a) increase resistance to degradation of
the conjugate, (b) increase targeting or transport into a target
cell or cell membrane, and/or (c) can be used to adjust binding to
a serum protein, e.g., HSA.
[0338] A lipid based ligand can be used to modulate, e.g., control
the binding of the conjugate to a target tissue. For example, a
lipid or lipid-based ligand that binds to HSA more strongly will be
less likely to be targeted to the kidney and therefore less likely
to be cleared from the body. A lipid or lipid-based ligand that
binds to HSA less strongly can be used to target the conjugate to
the kidney.
[0339] In a preferred embodiment, the lipid based ligand binds HSA.
A lipid-based ligand can bind HSA with a sufficient affinity such
that the conjugate will be preferably distributed to a non-kidney
tissue. However, it is preferred that the affinity not be so strong
that the HSA-ligand binding cannot be reversed.
[0340] In another preferred embodiment, the lipid based ligand
binds HSA weakly or not at all, such that the conjugate will be
preferably distributed to the kidney. Other moieties that target to
kidney cells can also be used in place of or in addition to the
lipid based ligand.
[0341] In another aspect, the ligand is a moiety, e.g., a vitamin,
which is taken up by a target cell, e.g., a proliferating cell.
These are particularly useful for treating disorders characterized
by unwanted cell proliferation, e.g., of the malignant or
non-malignant type, e.g., cancer cells. Exemplary vitamins include
vitamin A, E, and K. Other exemplary vitamins include are B
vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or
other vitamins or nutrients taken up by cancer cells. Also included
are HSA and low density lipoprotein (LDL).
[0342] In another aspect, the ligand is a cell-permeation agent,
preferably a helical cell-permeation agent. Preferably, the agent
is amphipathic. An exemplary agent is a peptide such as tat or
antennopedia. If the agent is a peptide, it can be modified,
including a peptidylmimetic, invertomers, non-peptide or
pseudo-peptide linkages, and use of D-amino acids. The helical
agent is preferably an alpha-helical agent, which preferably has a
lipophilic and a lipophobic phase.
[0343] Peptides that target markers enriched in proliferating cells
can be used. E.g., RGD containing peptides and peptidomimetics can
target cancer cells, in particular cells that exhibit an
.alpha..sub.v.beta..sub.3 integrin. Thus, one could use RGD
peptides, cyclic peptides containing RGD, RGD peptides that include
D-amino acids, as well as synthetic RGD mimics. In addition to RGD,
one can use other moieties that target the
.alpha..sub.v-.beta..sub.3 integrin ligand. Generally, such ligands
can be used to control proliferating cells and angiogeneis.
Preferred conjugates of this type include an oligonucleotide agent
that targets PECAM-1, VEGF, or other cancer gene, e.g., a cancer
gene described herein.
[0344] The oligonucleotide agents of the invention are particularly
useful when targeted to the liver. For example, a single stranded
oligonucleotide agent featured in the invention can target an miRNA
enriched in the liver, and the oligonucleotide agent can include a
ligand for enhanced delivery to the liver. An oligonucleotide agent
can be targeted to the liver by incorporation of a monomer
derivatized with a ligand which targets to the liver. For example,
a liver-targeting agent can be a lipophilic moiety. Preferred
lipophilic moieties include lipid, cholesterols, oleyl, retinyl, or
cholesteryl residues. Other lipophilic moieties that can function
as liver-targeting agents include cholic acid, adamantane acetic
acid, 1-pyrene butyric acid, dihydrotestosterone,
1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group,
hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl
group, palmitic acid, myristic acid,O3-(oleoyl)lithocholic acid,
O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine.
[0345] An oligonucleotide agent can also be targeted to the liver
by association with a low-density lipoprotein (LDL), such as
lactosylated LDL. Polymeric carriers complexed with sugar residues
can also function to target oligonucleotide agents to the
liver.
[0346] A targeting agent that incorporates a sugar, e.g., galactose
and/or analogues thereof, is particularly useful. These agents
target, in particular, the parenchymal cells of the liver. For
example, a targeting moiety can include more than one or preferably
two or three galactose moieties, spaced about 15 angstroms from
each other. The targeting moiety can alternatively be lactose
(e.g., three lactose moieties), which is glucose coupled to a
galactose. The targeting moiety can also be N-Acetyl-Galactosamine,
N--Ac-Glucosamine. A mannose or mannose-6-phosphate targeting
moiety can be used for macrophage targeting.
[0347] The ligand can be a peptide or peptidomimetic. A
peptidomimetic (also referred to herein as an oligopeptidomimetic)
is a molecule capable of folding into a defined three-dimensional
structure similar to a natural peptide. The attachment of peptide
and peptidomimetics to oligonucleotide agents can affect
pharmacokinetic distribution of the iRNA, such as by enhancing
cellular recognition and absorption. The peptide or peptidomimetic
moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15,
20, 25, 30, 35, 40, 45, or 50 amino acids long (see Table 3, for
example). TABLE-US-00003 TABLE 3 Exemplary Cell Permeation Peptides
Cell Permeation Peptide Amino acid Sequence Reference Penetratin
RQIKIWFQNRRJVIKWKK (SEQ ID NO:31) Derossi et al., J. Biol. Chem.
269:10444, 1994 Tat fragment GRKKRRQRRRPPQC (SEQ ID NO:32) Vives et
al., J. Biol. (48-60) Chem., 272:16010, 1997 Signal
GALFLGWLGAAGSTMGAWSQPKKKRKV Chaloin et al., Sequence- (SEQ ID
NO:33) Biochem. Biophys. based peptide Res. Commun., 243:601, 1998
PVEC LLIILRRRIRKQAHAHSK (SEQ ID NO:34) Elmquist et al., Exp. Cell
Res., 269:237, 2001 Transportan GWTLNSAGYLLKINLKALAALAKKIL Pooga et
al., FASEB (SEQ ID NO:35) J., 12:67, 1998 Amphiphilic
KLALKLALKALKAALKLA (SEQ ID Oehlke et al., Mol. model peptide NO:36)
Ther., 2:339, 2000 Arg.sub.9 RRRRRRRRR (SEQ ID NO:37) Mitchell et
al., J. Pept. Res., 56:318, 2000 Bacterial cell KFFKFFKFFK (SEQ ID
NO:38) wall permeating LL-37 LLGDFFRKSKEKIGKEFKRIVQRIKDFLRN LVPRTES
(SEQ ID NO:39) Cecropin P1 SWLSKTAKKLENSAKKRISEGIAIAIQGGP R (SEQ ID
NO:40) .alpha.-defensin ACYCRIPACIAGERRYGTCIYQGRLWAFC C (SEQ ID
NO:41) b-defensin DHYNCVSSGGQCLYSACPIFTKIQGTCYR GKAKCCK (SEQ ID
NO:42) Bactenecin RKCRIVVIRVCR (SEQ ID NO:43) PR-39
RRRPRPPYLPRPRPPPFFPPRLPPRIPPGFPP RFPPRFPGKR-N112 (SEQ ID NO:44)
Indolicidin ILPWKWPWWPWRR-NH2 (SEQ ID NO:45)
[0348] A peptide or peptidomimetic can be, for example, a cell
permeation peptide, cationic peptide, amphipathic peptide, or
hydrophobic peptide (e.g., consisting primarily of Tyr, Trp or
Phe). The peptide moiety can be a dendrimer peptide, constrained
peptide or crosslinked peptide. The peptide moiety can be an
L-peptide or D-peptide. In another alternative, the peptide moiety
can include a hydrophobic membrane translocation sequence (MTS). An
exemplary hydrophobic MTS-containing peptide is RFGF having the
amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO:46). An RFGF
analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO:47)
containing a hydrophobic MTS can also be a targeting moiety. The
peptide moiety can be a "delivery" peptide, which can carry large
polar molecules including peptides, oligonucleotides, and protein
across cell membranes. For example, sequences from the HIV Tat
protein (GRKKRRQRRRPPQ (SEQ ID NO:48) and the Drosophila
Antennapedia protein (RQIKFWFQNRRMKWKK (SEQ ID NO:49) have been
found to be capable of functioning as delivery peptides. A peptide
or peptidomimetic can be encoded by a random sequence of DNA, such
as a peptide identified from a phage-display library, or
one-bead-one-compound (OBOC) combinatorial library (Lam et al.,
Nature 354:82-84, 1991). Preferably the peptide or peptidomimetic
tethered to an iRNA agent via an incorporated monomer unit is a
cell targeting peptide such as an arginine-glycine-aspartic acid
(RGD)-peptide, or RGD mimic. A peptide moiety can range in length
from about 5 amino acids to about 40 amino acids. The peptide
moieties can have a structural modification, such as to increase
stability or direct conformational properties. Any of the
structural modifications described below can be utilized.
[0349] A "cell permeation peptide" is capable of permeating a cell,
e.g., a-mammalian cell, such as a human cell. A cell permeation
peptide can also include a nuclear localization signal (NLS). For
example, a cell permeation peptide can be a bipartite amphipathic
peptide, such as MPG, which is derived from the fusion peptide
domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni
et al., Nucl. Acids Res. 31:2717-2724, 2003).
[0350] In one embodiment, a targeting peptide tethered to an SRMS
can be an amphipathic .alpha.-helical peptide. Exemplary
amphipathic .alpha.-helical peptides include, but are not limited
to, cecropins, lycotoxins, paradaxins, buforin, CPF, bombinin-like
peptide (BLP), cathelicidins, ceratotoxins, S. clava peptides,
hagfish intestinal antimicrobial peptides (HFIAPs), magainines,
brevinins-2, dermaseptins, melittins, pleurocidin, H.sub.2A
peptides, Xenopus peptides, esculentinis-1, and caerins. A number
of factors will preferably be considered to maintain the integrity
of helix stability. For example, a maximum number of helix
stabilization residues will be utilized (e.g., leu, ala, or lys),
and a minimum number helix destabilization residues will be
utilized (e.g., proline, or cyclic monomeric units. The capping
residue will be considered (for example Gly is an exemplary
N-capping residue and/or C-terminal amidation can be used to
provide an extra H-bond to stabilize the helix. Formation of salt
bridges between residues with opposite charges, separated by
i.+-.3, or i.+-.4 positions can provide stability. For example,
cationic residues such as lysine, arginine, homo-arginine, omithine
or histidine can form salt bridges with the anionic residues
glutamate or aspartate.
[0351] Peptide and peptidomimetic ligands include those having
naturally occurring or modified peptides, e.g., D or L peptides;
.alpha., .beta., or .gamma. peptides; N-methyl peptides;
azapeptides; peptides having one or more amide, i.e., peptide,
linkages replaced with one or more urea, thiourea, carbamate, or
sulfonyl urea linkages; or cyclic peptides.
[0352] Methods for Making iRNA Agents
[0353] iRNA agents conjugate to a lipophilic moiety for enhanced
uptake into neural cells can include modified or non-naturally
occurring bases, e.g., bases described herein. In addition, iRNA
agents can have a modified or non-naturally occurring base and
another element described herein.
[0354] The synthesis and purification of oligonucleotide peptide
conjugates can be performed by established methods. See, for
example, Trufert et al., Tetrahedron, 52:3005, 1996; and Manoharan,
"Oligonucleotide Conjugates in Antisense Technology," in Antisense
Drug Technology, ed. S. T. Crooke, Marcel Dekker, Inc., 2001.
[0355] In one embodiment of the invention, a peptidomimetic can be
modified to create a constrained peptide that adopts a distinct and
specific preferred conformation, which can increase the potency and
selectivity of the peptide. For example, the constrained peptide
can be an azapeptide (Gante, Synthesis 405-413, 1989). An
azapeptide is synthesized by replacing the .alpha.-carbon of an
amino acid with a nitrogen atom without changing the structure of
the amino acid side chain. For example, the azapeptide can be
synthesized by using hydrazine in traditional peptide synthesis
coupling methods, such as by reacting hydrazine with a "carbonyl
donor," e.g., phenylchloroformate.
[0356] In one embodiment of the invention, a peptide or
peptidomimetic (e.g., a peptide or peptidomimetic tethered to an
SRMS) can be an N-methyl peptide. N-methyl peptides are composed of
N-methyl amino acids, which provide an additional methyl group in
the peptide backbone, thereby potentially providing additional
means of resistance to proteolytic cleavage. N-methyl peptides can
by synthesized by methods known in the art (see, for example,
Lindgren et al., Trends Pharmacol. Sci. 21:99, 2000; Cell
Penetrating Peptides: Processes and Applications, Langel, ed., CRC
Press, Boca Raton, Fla., 2002; Fische et al., Bioconjugate. Chem.
12: 825, 2001; Wander et al., J. Am. Chem. Soc., 124:13382, 2002).
For example, an Ant or Tat peptide can be an N-methyl peptide.
[0357] In one embodiment of the invention, a peptide or
peptidomimetic (e.g., a peptide or peptidomimetic tethered to an
SRMS) can be a .beta.-peptide. .beta.-peptides form stable
secondary structures such as helices, pleated sheets, turns and
hairpins in solutions. Their cyclic derivatives can fold into
nanotubes in the solid state. .beta.-peptides are resistant to
degradation by proteolytic enzymes. .beta.-peptides can be
synthesized by methods known in the art. For example, an Ant or Tat
peptide can be a .beta.-peptide.
[0358] In one embodiment of the invention, a peptide or
peptidomimetic (e.g., a peptide or peptidomimetic tethered to an
SRMS) can be an oligourea conjugate (or an oligothiourea
conjugate), in which the amide bond of a peptidomimetic is replaced
with a urea moiety. Replacement of the amide bond provides
increased resistance to degradation by proteolytic enzymes, e.g.,
proteolytic enzymes in the gastrointestinal tract. In one
embodiment, an oligourea conjugate is tethered to an iRNA agent for
use in oral delivery. The backbone in each repeating unit of an
oligourea peptidomimetic can be extended by one carbon atom in
comparison with the natural amino acid. The single carbon atom
extension can increase peptide stability and lipophilicity, for
example. An oligourea peptide can therefore be advantageous when an
iRNA agent is directed for passage through a bacterial cell wall,
or when an iRNA agent must traverse the blood-brain barrier, such
as for the treatment of a neurological disorder. In one embodiment,
a hydrogen bonding unit is conjugated to the oligourea peptide,
such as to create an increased affinity with a receptor. For
example, an Ant or Tat peptide can be an oligourea conjugate (or an
oligothiourea conjugate).
[0359] The dsRNA peptide conjugates of the invention can be
affiliated with, e.g., tethered to, SRMSs occurring at various
positions on an iRNA agent. For example, a peptide can be
terminally conjugated, on either the sense or the antisense strand,
or a peptide can be bisconjugated (one peptide tethered to each
end, one conjugated to the sense strand, and one conjugated to the
antisense strand). In another option, the peptide can be internally
conjugated, such as in the loop of a short hairpin iRNA agent. In
yet another option, the peptide can be affiliated with a complex,
such as a peptide-carrier complex.
[0360] A number of exemplary routes of delivery are described that
can be used to administer an oligonucleotide agent to a subject. In
addition, the oligonucleotide agent can be formulated according to
an exemplary method described herein.
[0361] An RGD peptide moiety can be used to target a tumor cell,
such as an endothelial tumor cell or a breast cancer tumor cell
(Zitzmann et al., Cancer Res., 62:5139-43, 2002). An RGD peptide
can facilitate targeting of an oligonucleotide agent (e.g., an
oligonucleotide agent targeting an miRNA or pre-miRNA) to tumors of
a variety of other tissues, including the lung, kidney, spleen, or
liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001).
Preferably, the RGD peptide will facilitate targeting of an
oligonucleotide agent to the kidney. The RGD peptide can be linear
or cyclic, and can be modified, e.g., glycosylated or methylated to
facilitate targeting to specific tissues. For example, a
glycosylated RGD peptide can deliver an oligonucleotide agent to a
tumor cell expressing .alpha..sub.V.beta..sub.3 (Haubner et al.,
Jour. Nucl. Med., 42:326-336, 2001).
[0362] Peptides that target markers enriched in proliferating cells
can be used. E.g., RGD containing peptides and peptidomimetics can
target cancer cells, in particular cells that exhibit an
.alpha..sub.v.beta..sub.3 integrin. Thus, one could use RGD
peptides, cyclic peptides containing RGD, RGD peptides that include
D-amino acids, as well as synthetic RGD mimics. In addition to RGD,
one can use other moieties that target the
.alpha..sub.v-.beta..sub.3 integrin ligand. Generally, such ligands
can be used to control proliferating cells and angiogeneis.
Preferred conjugates of this type include an oligonucleotide agent
that targets PECAM-1, VEGF, or other cancer gene, e.g., a cancer
gene described herein.
[0363] A "cell permeation peptide" is capable of permeating a cell,
e.g., a microbial cell, such as a bacterial or fungal cell, or a
mammalian cell, such as a human cell. A microbial cell-permeating
peptide can be, for example, an .alpha.-helical linear peptide
(e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide
(e.g., .alpha.-defensin, .beta.-defensin or bactenecin), or a
peptide containing only one or two dominating amino acids (e.g.,
PR-39 or indolicidin). A cell permeation peptide can also include a
nuclear localization signal (NLS). For example, a cell permeation
peptide can be a bipartite amphipathic peptide, such as MPG, which
is derived from the fusion peptide domain of HIV-1 gp41 and the NLS
of SV40 large T antigen (Simeoni et al., Nucl. Acids Res.
31:2717-2724, 2003).
[0364] In one embodiment, a targeting peptide tethered to a
ligand-conjugated monomer can be an amphipathic .alpha.-helical
peptide. Exemplary amphipathic .alpha.-helical peptides include,
but are not limited to, cecropins, lycotoxins, paradaxins, buforin,
CPF, bombinin-like peptide (BLP), cathelicidins, ceratotoxins, S.
clava peptides, hagfish intestinal antimicrobial peptides (HFIAPs),
magainines, brevinins-2, dermaseptins, melittins, pleurocidin,
H.sub.2A peptides, Xenopus peptides, esculentinis-1, and caerins. A
number of factors will preferably be considered to maintain the
integrity of helix stability. For example, a maximum number of
helix stabilization residues will be utilized (e.g., leu, ala, or
lys), and a minimum number of helix destabilization residues will
be utilized (e.g., proline, or cyclic monomeric units). The capping
residue will be considered (for example Gly is an exemplary
N-capping residue) and/or C-terminal amidation can be used to
provide an extra H-bond to stabilize the helix. Formation of salt
bridges between residues with opposite charges, separated by
i.+-.3, or i.+-.4 positions can provide stability. For example,
cationic residues such as lysine, arginine, homo-arginine,
ornithine or histidine can form salt bridges with the anionic
residues glutamate or aspartate.
[0365] Peptide and peptidomimetic ligands include those having
naturally occurring or modified peptides, e.g., D or L peptides;
.alpha., .beta., or .gamma. peptides; N-methyl peptides;
azapeptides; peptides having one or more amide, i.e., peptide,
linkages replaced with one or more urea, thiourea, carbamate, or
sulfonyl urea linkages; or cyclic peptides.
[0366] In some embodiments, the peptide can have a cationic and/or
a hydrophobic moiety.
[0367] In some embodiments, the ligand can be any of the
nucleobases described herein.
[0368] In some embodiments, the ligand can be a substituted amine,
e.g. dimethylamino. In some embodiments, the substituted amine can
be quaternized, e.g., by protonation or alkylation, rendering it
cationic. In some embodiments, the substituted amine can be at the
terminal position of a relatively hydrophobic tether, e.g.,
alkylene.
[0369] In some embodiments, the ligand can be one of the following
triterpenes: ##STR19##
[0370] In some embodiments, the ligand can be substituted or
unsubstituted cholesterol, or a stereoisomer thereof or one of the
following steroids: ##STR20##
[0371] In some embodiments, a tethered ligand can contain one or
more atoms than the corresponding untethered or uncoupled ligand
(e.g., one or more protons of a heteroatom-based functional group
or an entire heteroatom-based functional group may be displaced
from the uncoupled ligand during coupling of a ligand to a carrier
or tether). For example, the proton of the 3-hydroxy group of
cholesterol can be replaced by a tether (e.g., Chol-3-OH
(uncoupled) and Chol-3-O-tether (coupled)) or the entire 3-hydroxy
group of cholesterol can be replaced by a sulfur atom (e.g.,
Chol-3-OH (uncoupled) and Chol-3-S-tether (coupled, e.g.,
thiocholesterol)).
[0372] Methods for Making Oligonucleotide Agents
[0373] A listing of ribonucleosides containing the unusual bases
described herein are described in "The RNA Modification Database"
maintained by Pamela F. Crain, Jef Rozenski and James A. McCloskey;
Departments of Medicinal Chemistry and Biochemistry, University of
Utah, Salt Lake City, Utah 84112, USA.
[0374] The 5' silyl protecting group can be used in conjunction
with acid labile orthoesters at the 2' position of ribonucleosides
to synthesize oligonucleotides via phosphoramidite chemistry. Final
deprotection conditions are known not to significantly degrade RNA
products. Functional groups on the unusual and universal bases are
blocked during oligonucleotide synthesis with protecting groups
that are compatible with the operations being performed that are
described herein. All syntheses can be conducted in any automated
or manual synthesizer on large, medium, or small scale. The
syntheses may also be carried out in multiple well plates or glass
slides.
[0375] The 5'-O-silyl group can be removed via exposure to fluoride
ions, which can include any source of fluoride ion, e.g., those
salts containing fluoride ion paired with inorganic counterions
e.g., cesium fluoride and potassium fluoride or those salts
containing fluoride ion paired with an organic counterion, e.g., a
tetraalkylammonium fluoride. A crown ether catalyst can be utilized
in combination with the inorganic fluoride in the deprotection
reaction. Preferred fluoride ion source are tetrabutylammonium
fluoride or aminehydrofluorides (e.g., combining aqueous HF with
triethylamine in a dipolar aprotic solvent, e.g.,
dimethylformamide).
[0376] The choice of protecting groups for use on the phosphite
triesters and phosphotriesters can alter the stability of the
triesters towards fluoride. Methyl protection of the
phosphotriester or phosphitetriester can stabilize the linkage
against fluoride ions and improve process yields.
[0377] Since ribonucleosides have a reactive 2' hydroxyl
substituent, it can be desirable to protect the reactive 2'
position in RNA with a protecting group that is compatible with a
5'-O-silyl protecting group, e.g. one stable to fluoride.
Orthoesters meet this criterion and can be readily removed in a
final acid deprotection step that can result in minimal RNA
degradation.
[0378] Tetrazole catalysts can be used in the standard
phosphoramidite coupling reaction. Preferred catalysts include e.g.
tetrazole, S-ethyl-tetrazole, p-nitrophenyltetrazole.
[0379] The general process is as follows. Nucleosides are suitably
protected and functionalized for use in solid-phase or
solution-phase synthesis of RNA oligonucleotides. The 2'-hydroxyl
group in a ribonucleotide can be modified using a tris orthoester
reagent. The 2'-hydroxyl can be modified to yield a 2'-O-orthoester
nucleoside by reacting the ribonucleoside with the tris orthoester
reagent in the presence of an acidic catalyst, e.g., pyridinium
p-toluene sulfonate. This reaction is known to those skilled in the
art. The product can then be subjected to further protecting group
reactions (e.g., 5'-O-silylation) and functionalizations (e.g.,
3'-O-phosphitylation) to produce a desired reagent (e.g.,
nucleoside phosphoramidite) for incorporation within an
oligonucleotide or polymer by reactions known to those skilled in
the art.
[0380] Preferred orthoesters include those comprising ethylene
glycol ligands which are protected with acyl or ester protecting
groups. Specifically, the preferred acyl group is acetyl. The
nucleoside reagents may then be used by those skilled in the art to
synthesize RNA oligonucleotides on commercially available
synthesizer instruments, e.g., Gene Assembler Plus (Pharmacia),
380B (Applied Biosystems). Following synthesis (either
solution-phase or solid-phase) of an oligonucleotide or polymer,
the product can be subjected to one or more reactions using
non-acidic reagents. One of these reactions may be strong basic
conditions, for example, 40% methylamine in water for 10 minutes at
55.degree. C., which will remove the acyl protecting groups from
the ethylene glycol ligands but leave the orthoester moiety
attached. The resultant orthoester may be left attached when the
polymer or oligonucleotide is used in subsequent applications, or
it may be removed in a final mildly-acidic reaction, for example,
10 minutes at 55.degree. C. in 50 mM acetic acid, pH 3.0, followed
by addition of equal volume of 150 mM TRIS buffer for 10 minutes at
55.degree. C.
[0381] Universal bases are described in "Survey and Summary: The
Applications of Universal DNA base analogues" Loakes, D., Nucleic
Acid Research 2001, 29, 2437, which is incorporated by reference in
its entirety. Specific examples are described in the following:
Liu, D.; Moran, S.; Kool, E. T. Chem. Biol., 1997, 4, 919-926;
Morales, J. C.; Kool, E. T. Biochemistry, 2000, 39, 2626-2632;
Matray, T, J.; Kool, E. T. J. Am. Chem. Soc., 1998, 120, 6191-6192;
Moran, S. Ren, R. X.-F.; Rumney IV, S.; Kool, E. T. J. Am. Chem.
Soc., 1997, 119, 2056-2057; Guckian, K. M.; Morales, J. C.; Kool,
E. T. J. Org. Chem., 1998, 63, 9652-9656; Berger, M.; Wu. Y.;
Ogawa, A. K.; McMinn, D. L.; Schultz, P. G.; Romesberg, F. E.
Nucleic Acids Res., 2000, 28, 2911-2914; Ogawa, A. K.; Wu, Y.;
McMinn, D. L.; Liu, J.; Schultz, P. G.; Romesberg, F. E. J. Am.
Chem. Soc., 2000, 122, 3274-3287; Ogawa, A. K.; Wu. Y.; Berger, M.;
Schultz, P. G.; Romesberg, F. E. J. Am. Chem. Soc., 2000, 122,
8803-8804; Tae, E. L.; Wu, Y.; Xia, G.; Schultz, P. G.; Romesberg,
F. E. J. Am. Chem. Soc., 2001, 123, 7439-7440; Wu, Y.; Ogawa, A.
K.; Berger, M.; McMinn, D. L.; Schultz, P. G.; Romesberg, F. E. J.
Am. Chem. Soc., 2000, 122, 7621-7632;. McMinn, D. L.; Ogawa. A. K.;
Wu, Y.; Liu, J.; Schultz, P. G.; Romesberg, F. E. J. Am. Chem.
Soc., 1999, 121, 11585-11586; Brotschi, C.; Haberli, A.; Leumann,
C, J. Angew. Chem. Int. Ed., 2001, 40, 3012-3014; Weizman, H.; Tor,
Y. J. Am. Chem. Soc., 2001, 123, 3375-3376; Lan, T.; McLaughlin, L.
W. J. Am. Chem. Soc., 2000, 122, 6512-13.
[0382] As discussed above, the monomers and methods described
herein can be used in the preparation of modified RNA molecules, or
polymeric molecules comprising any combination of monomer compounds
described herein and/or natural or modified ribonucleotides in
which one or more subunits contain an unusual or universal base.
Modified RNA molecules include e.g. those molecules containing a
chemically or stereochemically modified nucleoside (e.g., having
one or more backbone modifications, e.g., phosphorothioate or
P-alkyl; having one or more sugar modifications, e.g., 2'-OCH.sub.3
or 2'-F; and/or having one or more base modifications, e.g.,
5-alkylamino or 5-allylamino) or a nucleoside surrogate.
[0383] Coupling of 5'-hydroxyl groups with phosphoramidites forms
phosphite ester intermediates, which in turn are oxidized e.g.,
with iodine, to the phosphate diester. Alternatively, the
phosphites may be treated with, e.g., sulfur, selenium, amino, and
boron reagents to form modified phosphate backbones. Linkages
between the monomers described herein and a nucleoside or
oligonucleotide chain can also be treated with iodine, sulfur,
selenium, amino, and boron reagents to form unmodified and modified
phosphate backbones respectively. Similarly, the monomers described
herein may be coupled with nucleosides or oligonucleotides
containing any of the modifications or nucleoside surrogates
described herein.
[0384] The synthesis and purification of oligonucleotide peptide
conjugates can be performed by established methods. See, for
example, Trufert et al., Tetrahedron, 52:3005, 1996; and Manoharan,
"Oligonucleotide Conjugates in Antisense Technology," in Antisense
Drug Technology, ed. S. T. Crooke, Marcel Dekker, Inc., 2001.
[0385] In one embodiment of the invention, a peptidomimetic can be
modified to create a constrained peptide that adopts a distinct and
specific preferred conformation, which can increase the potency and
selectivity of the peptide. For example, the constrained peptide
can be an azapeptide (Gante, Synthesis, 1989, 405-413). An
azapeptide is synthesized by replacing the .alpha.-carbon of an
amino acid with a nitrogen atom without changing the structure of
the amino acid side chain. For example, the azapeptide can be
synthesized by using hydrazine in traditional peptide synthesis
coupling methods, such as by reacting hydrazine with a "carbonyl
donor," e.g., phenylchloroformate.
[0386] In one embodiment of the invention, a peptide or
peptidomimetic (e.g., a peptide or peptidomimetic tethered to an
ligand-conjugated monomer) can be an N-methyl peptide. N-methyl
peptides are composed of N-methyl amino acids, which provide an
additional methyl group in the peptide backbone, thereby
potentially providing additional means of resistance to proteolytic
cleavage. N-methyl peptides can by synthesized by methods known in
the art (see, for example, Lindgren et al., Trends Pharmacol. Sci.
21:99, 2000; Cell Penetrating Peptides: Processes and Applications,
Langel, ed., CRC Press, Boca Raton, Fla., 2002; Fische et al.,
Bioconjugate. Chem. 12: 825, 2001; Wander et al., J. Am. Chem.
Soc., 124:13382, 2002). For example, an Ant or Tat peptide can be
an N-methyl peptide.
[0387] In one embodiment of the invention, a peptide or
peptidomimetic (e.g., a peptide or peptidomimetic tethered to a
ligand-conjugated monomer) can be a .beta.-peptide. .beta.-peptides
form stable secondary structures such as helices, pleated sheets,
turns and hairpins in solutions. Their cyclic derivatives can fold
into nanotubes in the solid state. .beta.-peptides are resistant to
degradation by proteolytic enzymes. .beta.-peptides can be
synthesized by methods known in the art. For example, an Ant or Tat
peptide can be a .beta.-peptide.
[0388] In one embodiment of the invention, a peptide or
peptidomimetic (e.g., a peptide or peptidomimetic tethered to a
ligand-conjugated monomer) can be a oligocarbamate. Oligocarbamate
peptides are internalized into a cell by a transport pathway
facilitated by carbamate transporters. For example, an Ant or Tat
peptide can be an oligocarbamate.
[0389] In one embodiment of the invention, a peptide or
peptidomimetic (e.g., a peptide or peptidomimetic tethered to a
ligand-conjugated monomer) can be an oligourea conjugate (or an
oligothiourea conjugate), in which the amide bond of a
peptidomimetic is replaced with a urea moiety. Replacement of the
amide bond provides increased resistance to degradation by
proteolytic enzymes, e.g., proteolytic enzymes in the
gastrointestinal tract. In one embodiment, an oligourea conjugate
is tethered to an oligonucleotide agent for use in oral delivery.
The backbone in each repeating unit of an oligourea peptidomimetic
can be extended by one carbon atom in comparison with the natural
amino acid. The single carbon atom extension can increase peptide
stability and lipophilicity, for example. An oligourea peptide can
therefore be advantageous when an oligonucleotide agent is directed
for passage through a bacterial cell wall, or when an
oligonucleotide agent must traverse the blood-brain barrier, such
as for the treatment of a neurological disorder. In one embodiment,
a hydrogen bonding unit is conjugated to the oligourea peptide,
such as to create an increased affinity with a receptor. For
example, an Ant or Tat peptide can be an oligourea conjugate (or an
oligothiourea conjugate).
[0390] The siRNA peptide conjugates of the invention can be
affiliated with, e.g., tethered to, ligand-conjugated monomers
occurring at various positions on an oligonucleotide agent. For
example, a peptide can be terminally conjugated, on either the
sense or the antisense strand, or a peptide can be bisconjugated
(one peptide tethered to each end, one conjugated to the sense
strand, and one conjugated to the antisense strand). In another
option, the peptide can be internally conjugated, such as in the
loop of a short hairpin oligonucleotide agent. In yet another
option, the peptide can be affiliated with a complex, such as a
peptide-carrier complex.
[0391] A peptide-carrier complex consists of at least a carrier
molecule, which can encapsulate one or more oligonucleotide agents
(such as for delivery to a biological system and/or a cell), and a
peptide moiety tethered to the outside of the carrier molecule,
such as for targeting the carrier complex to a particular tissue or
cell type. A carrier complex can carry additional targeting
molecules on the exterior of the complex, or fusogenic agents to
aid in cell delivery. The one or more oligonucleotide agents
encapsulated within the carrier can be conjugated to lipophilic
molecules, which can aid in the delivery of the agents to the
interior of the carrier.
[0392] A carrier molecule or structure can be, for example, a
micelle, a liposome (e.g., a cationic liposome), a nanoparticle, a
microsphere, or a biodegradable polymer. A peptide moiety can be
tethered to the carrier molecule by a variety of linkages, such as
a disulfide linkage, an acid labile linkage, a peptide-based
linkage, an oxyamino linkage or a hydrazine linkage. For example, a
peptide-based linkage can be a GFLG peptide. Certain linkages will
have particular advantages, and the advantages (or disadvantages)
can be considered depending on the tissue target or intended use.
For example, peptide based linkages are stable in the blood stream
but are susceptible to enzymatic cleavage in the lysosomes.
[0393] The protected monomer compounds can be separated from a
reaction mixture and further purified by a method such as column
chromatography, high pressure liquid chromatography, or
recrystallization. As can be appreciated by the skilled artisan,
further methods of synthesizing the compounds of the formulae
herein will be evident to those of ordinary skill in the art.
Additionally, the various synthetic steps may be performed in an
alternate sequence or order to give the desired compounds. Other
synthetic chemistry transformations, protecting groups (e.g., for
hydroxyl, amino, etc. present on the bases) and protecting group
methodologies (protection and deprotection) useful in synthesizing
the compounds described herein are known in the art and include,
for example, those such as described in R. Larock, Comprehensive
Organic Transformations, VCH Publishers (1989); T. W. Greene and P.
G. M. Wuts, Protective Groups in Organic Synthesis, 2d. Ed., John
Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's
Reagents for Organic Synthesis, John Wiley and Sons (1994); and L.
Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John
Wiley and Sons (1995), and subsequent editions thereof.
[0394] The protected monomer compounds of this invention may
contain one or more asymmetric centers and thus occur as racemates
and racemic mixtures, single enantiomers, individual diastereomers
and diastereomeric mixtures. All such isomeric forms of these
compounds are expressly included in the present invention. The
compounds described herein can also contain linkages (e.g.,
carbon-carbon bonds, carbon-nitrogen bonds, e.g., amides) or
substituents that can restrict bond rotation, e.g. restriction
resulting from the presence of a ring or double bond. Accordingly,
all cis/trans, E/Z isomers, and rotational isomers (rotamers) are
expressly included herein. The compounds of this invention may also
be represented in multiple tautomeric forms, in such instances, the
invention expressly includes all tautomeric forms of the compounds
described herein (e.g., alkylation of a ring system may result in
alkylation at multiple sites, the invention expressly includes all
such reaction products). All such isomeric forms of such compounds
are expressly included in the present invention. All crystal forms
of the compounds described herein are expressly included in the
present invention.
[0395] Representative ligand-conjugated monomers and typical
syntheses for preparing ligand-conjugated monomers and related
compounds described herein are provided below. As discussed
elsewhere, protecting groups for ligand-conjugated monomer hydroxyl
groups, e.g., OFG.sup.1, include but are not limited to the
dimethoxytrityl group (DMT). For example, it can be desirable in
some embodiments to use silicon-based protecting groups as a
protecting group for OFG.sup.1. Silicon-based protecting groups can
therefore be used in conjunction with or in place of the DMT group
as necessary or desired. Thus, the ligand-conjugated monomers and
syntheses delineated below, which feature the DMT protecting group
as a protecting group for OFG.sup.1, is not to be construed as
limiting in any way to the invention.
[0396] Synthesis of Pyrroline Carrier ##STR21## ##STR22## ##STR23##
##STR24## ##STR25## ##STR26##
[0397] Synthesis of 5'-Labelled siRNA ##STR27## ##STR28##
[0398] Synthesis of Pthalimido Derivative ##STR29##
[0399] Synthesis of Thalimido Derivative ##STR30## ##STR31##
[0400] Synthesis of N-Alkyl Pyrroline Derivatives ##STR32##
##STR33##
[0401] Piperidine Series Ligands:
[0402] Similar to pyrroline series piperidine series can be
synthesised ##STR34## ##STR35##
[0403] Piperidine Series Ligands:
[0404] Similar to pyrroline series piperidine series can be
synthesised ##STR36## ##STR37##
[0405] Hydroxy Proline Series Linkers:
[0406] From commercially available cis-3-hydroxy proline and
(s)-pyrrolidone carboxylate ##STR38## ##STR39##
[0407] Phthalimide Derivative to Stabilise siRNA ##STR40##
##STR41##
[0408] 4-Hydroxy Proline Derivatives ##STR42##
[0409] Phthalimido Derivatives ##STR43##
[0410] Synthesis of 6-Membered Linker ##STR44##
[0411] Similar reaction can be carried out with 2-piperidone and
3-piperidone
[0412] Linkers from 4-Piperidone ##STR45## ##STR46##
[0413] Linkers from 3-Piperidone ##STR47## ##STR48##
[0414] Linkers from 2-Piperidone ##STR49## ##STR50##
[0415] Conjugation Through Decalin System ##STR51## ##STR52##
[0416] Conjugates from Decalin System: ##STR53##
[0417] Decalin Linker from Wieland-Miescher Ketone ##STR54##
[0418] Conjugates from Wieland-Miescher Ketone ##STR55##
[0419] Synthesis of Pyrroline Linker: ##STR56## ##STR57##
[0420] Solid Phase Synthesis and Post-Synthesis Conjugation:
##STR58## TABLE-US-00004 Exemplary Ligand Conjugated Monomers
LCM-E.g.- 1 ##STR59## 7 2 ##STR60## 9 3 ##STR61## 13 4 ##STR62## 15
5 ##STR63## 20 6 ##STR64## 22 7 ##STR65## 26 8 ##STR66## 28 9
##STR67## 33 10 ##STR68## 35 11 ##STR69## 45a 12 ##STR70## 46a 13
##STR71## 55 14 ##STR72## 56 15 ##STR73## 209a 16 ##STR74## 208a 17
##STR75## 209b 18 ##STR76## 208b 19 ##STR77## 223 20 ##STR78## 224
21 ##STR79## 229a 22 ##STR80## 230a 23 ##STR81## 229b 24 ##STR82##
230b 25 ##STR83## 212a 26 ##STR84## 211a 27 ##STR85## 100 28
##STR86## 102 29 ##STR87## 212b 30 ##STR88## 211b 31 ##STR89## 67
32 ##STR90## 69 33 ##STR91## 95 34 ##STR92## 97 35 ##STR93## 45b 36
##STR94## 46b 37 ##STR95## 78 38 ##STR96## 80 39 ##STR97## 216a 40
##STR98## 215a 41 ##STR99## 216b 42 ##STR100## 215b 43 ##STR101##
243a 44 ##STR102## 242a 45 ##STR103## 243b 46 ##STR104## 242b 47
##STR105## 236a 48 ##STR106## 237a 49 ##STR107## 239a 50 ##STR108##
240a 51 ##STR109## 85 52 ##STR110## 87 53 ##STR111## 91 54
##STR112## 93 55. ##STR113## 106 56. ##STR114## 108 57. ##STR115##
112 58. ##STR116## 114
[0421] Conjugation of Ligands to Oligonucleotide Agents
[0422] The conjugation of a ligand to an oligonucleotide agent,
e.g., an oligonucleotide agent that targets an miRNA or pre-miRNA
can have a favorable effect on the modulating effect of the agent.
For example, the agent can improve pharmacokinetics, stability,
and/or tissue specificity.
[0423] In some embodiments, an oligonucleotide agent (referred to
as "NA" in formula OT-I through OT-IV below, e.g., RNA, DNA,
chimeric RNA-DNA, DNA-RNA, RNA-DNA-RNA, or DNA-RNA-DNA) can be
chemically modified by conjugating a moiety that includes a ligand
having one or more chemical linkages for attachment of the ligand
(L) to the oligonucleotide or nucleic acid. The ligand of an
oligonucleotide agent can be coupled by one or both of a tether and
linker. In the diagram below, exemplary chemical linkages are
represented as X, Y, and Z. These can be part of the tether or
linker. ##STR117##
[0424] Ligands can be attached at one or both of the 3' end, the 5'
end, and internal positions. In certain embodiments, the
oligonucleotide agent can be chemically modified by conjugating one
or more moieties having formula OT-I. Table 4, shows a variety of
conjugates. TABLE-US-00005 TABLE 4 ##STR118## ##STR119## 3-end
Conjugation 5-end Conjugation ##STR120## ##STR121## Internal
placement Terminal Bisconjugation ##STR122## ##STR123## 3'-end and
internal Bisconjugation 5-end and internal Bisconjugation
##STR124## ##STR125## 3-end Bisconjugation 5-end Bisconjugation
##STR126## ##STR127## Hairpin
[0425] Exemplary ligands are listed in Table 5 and are discussed
elsewhere herein. The exemplary ligands (L) shown in Table 5 are
preferred. TABLE-US-00006 TABLE 5 ##STR128## L = Cholesterol
Thiocholesterol 5.beta.-Cholanic Acid Cholic acid Lithocholic acid
Biotin Vitamin E Naproxen Ibuprofen Amines (mono, di, tri,
tetraalkyl or aryl) Folate Sugar (N-Acetylgalactosamine,
galactosamine, galactose, Mannose)
--(CH.sub.2).sub.nNQ.sub.1Q.sub.2, where n = 0-40, Q.sub.1, Q.sub.2
= H, Me or Et; Q.sub.1 = H, Q.sub.2 = H, Me, Et or aryl
--(CH.sub.2).sub.pCH.dbd.CH(CH.sub.2).sub.qNQ.sub.1Q.sub.2, where p
and/or q = 0-40, Q.sub.1, Q.sub.2 = H, Me or Et; Q.sub.1 = H,
Q.sub.2 = H, Me, Et or aryl with E and/or Z configuration
--(CH.sub.2).sub.pCH.dbd.CH(CH.sub.2).sub.qNQ.sub.1Q.sub.2, where p
and/or q = 0-40, Q.sub.1, Q.sub.2 = H, Me or Et; Q.sub.1 = H,
Q.sub.2 = H, Me, Et or aryl
--(CH.sub.2).sub.pCH.dbd.CH(CH.sub.2).sub.qCH.dbd.CH(CH.sub.2).sub.rNQ.su-
b.1Q.sub.2, where p, q and/or r = 0-40, Q.sub.1, Q.sub.2 = H, Me or
Et; Q.sub.1 = H, Q.sub.2 = H, Me, Et or aryl with E and/or Z
configuration --O(CH.sub.2).sub.m(OCH.sub.2CH.sub.2).sub.n--OR,
where m, n = 0-40 and R = H, Me, NQ.sub.1Q.sub.2,
--C(O)NR'R''--C(S)NR'R''
--NH(CH.sub.2).sub.m(OCH.sub.2CH.sub.2).sub.n--OR, where m, n =
0-40 and R = H, Me, NQ.sub.1Q.sub.2, --C(O)NR'R''--C(S)NR'R''
--O(CH.sub.2).sub.m(NHCH.sub.2CH.sub.2).sub.n--R, where m, n = 0-40
and R = H, OH, Me, NQ.sub.1Q.sub.2, --C(O)NR'R''--C(S)NR'R''
--NH(CH.sub.2).sub.m(NHCH.sub.2CH.sub.2).sub.n--R, where m, n =
0-40 and R = H, OH, Me, NQ.sub.1Q.sub.2, --C(O)NR'R''--C(S)NR'R''
Dialkylglycerol (sn3, sn1, sn2 and racemic) with number of
methylene varies from 0-40 Diacylglycerol (sn3, sn1, sn2 and
racemic) with number of methylene varies from 0-40 Dialkylglycerol
(sn3, sn1, sn2 and racemic) with number of methylene varies from
0-40 and the alkyl chian contains one or more double bonds with E
and/or Z isomers Diacylglycerol (sn3, sn1, sn2 and racemic) with
number of methylene varies from 0-40 and the alkyl chian contains
one or more double bonds with E and/or Z isomers Lipids
[0426] Exemplary X, Y, and Z moieties are shown in in Table 6. The
X, Y, and Z moieties can be selected independently of one another.
TABLE-US-00007 TABLE 6 ##STR129## X = --NHC(O)-- Y = --NHC(O)-- Z =
--NHC(O)-- --C(O)NH-- --C(O)NH-- --C(O)NH-- --OC(O)NH-- --OC(O)NH--
--OC(O)NH-- --NHC(O)O-- --NHC(O)O-- --NHC(O)O-- --O-- --O-- --O--
--S-- --S-- --S-- --SS-- --SS-- --SS-- --S(O)-- --S(O)-- --S(O)--
--S(O.sub.2)-- --S(O.sub.2)-- --S(O.sub.2)-- --NHC(O)NH--
--NHC(O)NH-- --NHC(O)NH-- --NHC(S)NH-- --NHC(S)NH-- --NHC(S)NH--
--C(O)O-- --C(O)O-- --C(O)O-- --OC(O)-- --OC(O)-- --OC(O)--
--NHC(S)-- --NHC(S)-- --NHC(S)-- --NHC(S)O-- --NHC(S)O--
--NHC(S)O-- --C(S)NH-- --C(S)NH-- --C(S)NH-- --OC(S)NH--
--OC(S)NH-- --OC(S)NH-- --NHC(S)O-- --NHC(S)O-- --NHC(S)O--
--CH.sub.2-- --CH.sub.2-- --CH.sub.2-- --CH.sub.2CH.dbd.CH--
--CH.sub.2CH.dbd.CH-- --CH.sub.2CH.dbd.CH-- --C(O)CH.dbd.CH--
--C(O)CH.dbd.CH-- --C(O)CH.dbd.CH-- --NH--CH.sub.2CH.dbd.CH--
--NH--CH.sub.2CH.dbd.CH-- --NH--CH.sub.2CH.dbd.CH--
--O--P(O)(OH)--O-- --O--P(O)(OH)--O-- --O--P(O)(OH)--O--
--O--P(S)(OH)--O-- --O--P(S)(OH)--O-- --O--P(S)(OH)--O--
--O--P(S)(SH)--O-- --O--P(S)(SH)--O-- --O--P(S)(SH)--O--
--S--P(O)(OH)--O-- --S--P(O)(OH)--O-- --S--P(O)(OH)--O--
--O--P(O)(OH)--S-- --O--P(O)(OH)--S-- --O--P(O)(OH)--S--
--S--P(O)(OH)--S-- --S--P(O)(OH)--S-- --S--P(O)(OH)--S--
--O--P(S)(OH)--S-- --O--P(S)(OH)--S-- --O--P(S)(OH)--S--
--S--P(S)(OH)--O-- --S--P(S)(OH)--O-- --S--P(S)(OH)--O--
--O--P(O)(R)--O-- --O--P(O)(R)--O-- --O--P(O)(R)--O--
--O--P(S)(R)--O-- --O--P(S)(R)--O-- --O--P(S)(R)--O--
--S--P(O)(R)--O-- --S--P(O)(R)--O-- --S--P(O)(R)--O--
--S--P(S)(R)--O-- --S--P(S)(R)--O-- --S--P(S)(R)--O--
--S--P(O)(R)--S-- --S--P(O)(R)--S-- --S--P(O)(R)--S--
--O--P(S)(R)--S-- --O--P(S)(R)--S-- --O--P(S)(R)--S-- R = Alkyl,
fluroalkyl, aryl or aralkyl
[0427] TABLE-US-00008 Exemplary tethers are shown in Table 7.
##STR130## Linker = 3'-end 5'-end interior ##STR131## ##STR132##
##STR133## ##STR134## ##STR135## ##STR136## ##STR137## ##STR138##
##STR139## ##STR140## ##STR141## ##STR142## ##STR143## ##STR144##
##STR145## ##STR146## ##STR147## ##STR148## ##STR149## Tether:
--(CH.sub.2).sub.m--, where n = 1-40
--(CH.sub.2--CH.sub.2O).sub.n--, where n = 1-20
--O(CH.sub.2--CH.sub.2O).sub.n--, where n = 1-20
--(CH.sub.2--CH.sub.2NH).sub.n--, where n = 1-20
--NH(CH.sub.2--CH.sub.2NH).sub.n--, where n = 1-20
--CH.sub.2).sub.1[(CH.dbd.CH).sub.m(CH.sub.2).sub.n].sub.p(CH.dbd.CH).sub-
.q(CH.sub.2)r--, where l, m, n, p, q and/or r = 0-20
--(CH.sub.2).sub.1[(C.dbd.C).sub.m(CH.sub.2).sub.n]p(C.dbd.C).sub.q(CH.su-
b.2).sub.r--, where l, m, n, p, q and/or r = 0-20
[0428] Compounds described herein can be prepared by methods
described herein or by conventional methods from commercially
available reagents and starting materials.
[0429] Compound 1 is prepared as reported by Fraser et al.
(Tetrahedron Lett. 41:1523, 2000). Steps (ii), (iii) (a), (iii)
(c), (iv), (v) and (vii) are performed according to literature
procedure (Fraser et al., Tetrahedron Lett. 41:1523, 2000). Step
(iii) (b) and (v) (b) are performed as reported in the literature
(Bioorg. Med. Chem. Lett. 13:1713, 2003). Step (iv) is performed as
reported in the literature (Corey and Venkateswarlu, J. Am. Chem.
Soc. 94:6190, 1972). ##STR150## ##STR151##
[0430] The synthesis of certain compounds is described in scheme 2,
below. Step (i) is performed as reported in Dubowchik and Radia
(Tetrahedron Lett., 38:5257, 1997); step (ii) is performed as
reported in Corey and Venkateswarlu (J. Am. Chem. Soc. 94:6190,
1972); step (iii) is performed as reported in Fraser et al.
(Tetrahedron Lett. 41:1523, 2000) and step (iv) is performed as
described in Miller et al. (Current Protocol in Nucleic Acids
Chemistry, 2000, 2.5.1-2.5.36, John Wiley and Sons, Inc.).
##STR152## ##STR153##
[0431] The synthesis of certain compounds is performed as described
in Scheme 3, below. Step (i) is performed as described in Miller et
al. (Current Protocol in Nucleic Acids Chemistry, 2000,
2.5.1-2.5.36, John Wiley and Sons, Inc.); step (ii) is performed as
reported in the Corey and Venkateswarlu (J. Am. Chem. Soc. 94:6190,
1972) and step (iii) is performed as reported by Fraser et al.
(Tetrahedron Lett. 41:1523, 2000). ##STR154##
[0432] The synthesis of certain compounds is performed as described
in Scheme 4 below. Step (ii) is performed as reported in Corey and
Venkateswarlu (J. Am. Chem. Soc. 94:6190, 1972) and step (iii) is
performed as reported by Fraser et al. (Tetrahedron Lett. 41:1523,
2000). ##STR155##
[0433] The synthesis of certain compounds is described in Scheme 5,
below. Step (i) is performed as described in Miller et al. (Current
Protocol in Nucleic Acids Chemistry, 2000, 2.5.1-2.5.36, John Wiley
and Sons, Inc.); step (ii) is performed as described in Corey and
Venkateswarlu (J. Am. Chem. Soc. 94:6190, 1972) and step (iii) is
performed as reported by Fraser et al. (Tetrahedron Lett. 41:1523,
2000). ##STR156##
[0434] The synthesis of certain compounds is described in Scheme 6,
below. Compound 130, shown in Scheme 6, is obtained as reported in
Liu and Austin, J. Org. Chem. 66:8643, 2001). Step (i) and (iii)
(b) are performed as reported in the literature (Chem. Rev., 1954,
54, 1); step (ii) (a) is performed according to literature
procedures (J. Org. Chem., 1993, 58, 2334); step (ii) (b), (iii)
(a) and (iv) (b) are performed as reported in the literature
(Bioorg. Med. Chem. Lett., 2003, 13, 1713); step (iii) (c) is
performed as reported in Dubowchik and Radia (Tetrahedron Lett.
38:5257, 1997); step (iv) (a) is performed as reported in the
literature (Organic Lett., 2001, 3, 1809); step (v) is performed as
reported in Corey and Venkateswarlu (J. Am. Chem. Soc. 94:6190,
1972) and step (vi) is performed as reported by Fraser et al.
(Tetrahedron Lett. 41:1523, 2000). ##STR157##
[0435] The synthesis of certain compounds is described in Scheme 7,
below. Compound 146 is obtained as reported in Liu and Austin (J.
Org. Chem., 2001, 66, 8643). Step (i) (b) and (iii) (c) are
performed as reported in the literature (Chem. Rev., 1954, 54, 1);
step (ii) (a) is performed according to literature procedures (J.
Org. Chem., 1993, 58, 2334); step (ii) (b), (iii) (b) and (iv) (b)
are performed as reported in the literature (Bioorg. Med. Chem.
Lett., 2003, 13, 1713); step (iii) (d) is performed as reported in
Dubowchik and Radia (Tetrahedron Lett., 1997, 38, 5257); step (iv)
(a) is performed as reported in the literature (Organic Lett.,
2001, 3, 1809); step (v) is performed as reported in Corey and
Venkateswarlu (J. Am. Chem. Soc., 1972, 94, 6190) and step (vi) is
performed as reported by Fraser et al. (Tetrahedron Lett., 2000,
41, 1523) ##STR158##
[0436] The synthesis of certain compounds is described in Scheme 8,
below. Compound 163 is obtained as reported in Liu and Austin (J.
Org. Chem., 2001, 66, 8643). ##STR159##
[0437] The synthesis of certain compounds is described in Scheme 9,
below. Compound 180 is obtained as reported in Liu and Austin (J.
Org. Chem., 2001, 66, 8643). ##STR160## Ligand-Conjugated Monomer
Subunits and Monomers for Oligonucleotide Synthesis
[0438] Definitions
[0439] The term "halo" refers to any radical of fluorine, chlorine,
bromine or iodine.
[0440] The term "alkyl" refers to a hydrocarbon chain that may be a
straight chain or branched chain, containing the indicated number
of carbon atoms. For example, C.sub.1-C.sub.12 alkyl indicates that
the group may have from 1 to 12 (inclusive) carbon atoms in it. The
term "haloalkyl" refers to an alkyl in which one or more hydrogen
atoms are replaced by halo, and includes alkyl moieties in which
all hydrogens have been replaced by halo (e.g., perfluoroalkyl).
Alkyl and haloalkyl groups may be optionally inserted with O, N, or
S. The terms "aralkyl" refers to an alkyl moiety in which an alkyl
hydrogen atom is replaced by an aryl group. Aralkyl includes groups
in which more than one hydrogen atom has been replaced by an aryl
group. Examples of "aralkyl" include benzyl, 9-fluorenyl,
benzhydryl, and trityl groups.
[0441] The term "alkenyl" refers to a straight or branched
hydrocarbon chain containing 2-8 carbon atoms and characterized in
having one or more double bonds. Examples of a typical alkenyl
include, but not limited to, allyl, propenyl, 2-butenyl, 3-hexenyl
and 3-octenyl groups. The term "alkynyl" refers to a straight or
branched hydrocarbon chain containing 2-8 carbon atoms and
characterized in having one or more triple bonds. Some examples of
a typical alkynyl are ethynyl, 2-propynyl, and 3-methylbutynyl, and
propargyl. The sp.sup.2 and sp.sup.3 carbons may optionally serve
as the point of attachment of the alkenyl and alkynyl groups,
respectively.
[0442] The terms "alkylamino" and "dialkylamino" refer to
--NH(alkyl) and --NH(alkyl).sub.2 radicals respectively. The term
"aralkylamino" refers to a --NH(aralkyl) radical. The term "alkoxy"
refers to an --O-alkyl radical, and the terms "cycloalkoxy" and
"aralkoxy" refer to an --O-cycloalkyl and O-aralkyl radicals
respectively. The term "siloxy" refers to a R.sub.3SiO-radical. The
term "mercapto" refers to an SH radical. The term "thioalkoxy"
refers to an --S-alkyl radical.
[0443] The term "alkylene" refers to a divalent alkyl (i.e.,
--R--), e.g., --CH.sub.2--, --CH.sub.2CH.sub.2--, and
--CH.sub.2CH.sub.2CH.sub.2--. The term "alkylenedioxo" refers to a
divalent species of the structure --O--R--O--, in which R
represents an alkylene.
[0444] The term "aryl" refers to an aromatic monocyclic, bicyclic,
or tricyclic hydrocarbon ring system, wherein any ring atom can be
substituted. Examples of aryl moieties include, but are not limited
to, phenyl, naphthyl, anthracenyl, and pyrenyl.
[0445] The term "cycloalkyl" as employed herein includes saturated
cyclic, bicyclic, tricyclic,or polycyclic hydrocarbon groups having
3 to 12 carbons, wherein any ring atom can be substituted. The
cycloalkyl groups herein described may also contain fused rings.
Fused rings are rings that share a common carbon-carbon bond or a
common carbon atom (e.g., spiro-fused rings). Examples of
cycloalkyl moieties include, but are not limited to, cyclohexyl,
adamantyl, and norbornyl, and decalin.
[0446] The term "heterocyclyl" refers to a nonaromatic 3-10
membered monocyclic, 8-12 membered bicyclic, or 11-14 membered
tricyclic ring system having 1-3 heteroatoms if monocyclic, 1-6
heteroatoms if bicyclic, or 1-9 heteroatoms if tricyclic, said
heteroatoms selected from O, N, or S (e.g., carbon atoms and 1-3,
1-6, or 1-9 heteroatoms of N, O, or S if monocyclic, bicyclic, or
tricyclic, respectively), wherein any ring atom can be substituted.
The heterocyclyl groups herein described may also contain fused
rings. Fused rings are rings that share a common carbon-carbon bond
or a common carbon atom (e.g., spiro-fused rings). Examples of
heterocyclyl include, but are not limited to tetrahydrofuranyl,
tetrahydropyranyl, piperidinyl, morpholino, pyrrolinyl and
pyrrolidinyl.
[0447] The term "cycloalkenyl" as employed herein includes
partially unsaturated, nonaromatic, cyclic, bicyclic, tricyclic,or
polycyclic hydrocarbon groups having 5 to 12 carbons, preferably 5
to 8 carbons, wherein any ring atom can be substituted. The
cycloalkenyl groups herein described may also contain fused rings.
Fused rings are rings that share a common carbon-carbon bond or a
common carbon atom (e.g., spiro-fused rings). Examples of
cycloalkenyl moieties include, but are not limited to cyclohexenyl,
cyclohexadienyl, or norbornenyl.
[0448] The term "heterocycloalkenyl" refers to a partially
saturated, nonaromatic 5-10 membered monocyclic, 8-12 membered
bicyclic, or 11-14 membered tricyclic ring system having 1-3
heteroatoms if monocyclic, 1-6 heteroatoms if bicyclic, or 1-9
heteroatoms if tricyclic, said heteroatoms selected from O, N, or S
(e.g., carbon atoms and 1-3, 1-6, or 1-9 heteroatoms of N, O, or S
if monocyclic, bicyclic, or tricyclic, respectively), wherein any
ring atom can be substituted. The heterocycloalkenyl groups herein
described may also contain fused rings. Fused rings are rings that
share a common carbon-carbon bond or a common carbon atom (e.g.,
spiro-fused rings). Examples of heterocycloalkenyl include but are
not limited to tetrahydropyridyl and dihydropyran.
[0449] The term "heteroaryl" refers to an aromatic 5-8 membered
monocyclic, 8-12 membered bicyclic, or 11-14 membered tricyclic
ring system having 1-3 heteroatoms if monocyclic, 1-6 heteroatoms
if bicyclic, or 1-9 heteroatoms if tricyclic, said heteroatoms
selected from O, N, or S (e.g., carbon atoms and 1-3, 1-6, or 1-9
heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic,
respectively), wherein any ring atom can be substituted. The
heteroaryl groups herein described may also contain fused rings
that share a common carbon-carbon bond.
[0450] The term "oxo" refers to an oxygen atom, which forms a
carbonyl when attached to carbon, an N-oxide when attached to
nitrogen, and a sulfoxide or sulfone when attached to sulfur.
[0451] The term "acyl" refers to an alkylcarbonyl,
cycloalkylcarbonyl, arylcarbonyl, heterocyclylcarbonyl, or
heteroarylcarbonyl substituent, any of which may be further
substituted by substituents.
[0452] The term "substituents" refers to a group "substituted" on
an alkyl, cycloalkyl, alkenyl, alkynyl, heterocyclyl,
heterocycloalkenyl, cycloalkenyl, aryl, or heteroaryl group at any
atom of that group. Suitable substituents include, without
limitation, alkyl, alkenyl, alkynyl, alkoxy, halo, hydroxy, cyano,
nitro, amino, SO.sub.3H, sulfate, phosphate, perfluoroalkyl,
perfluoroalkoxy, methylenedioxy, ethylenedioxy, carboxyl, oxo,
thioxo, imino (alkyl, aryl, aralkyl), S(O).sub.nalkyl (where n is
0-2), S(O).sub.n aryl (where n is 0-2), S(O), heteroaryl (where n
is 0-2), S(O).sub.n heterocyclyl (where n is 0-2), amine (mono-,
di-, alkyl, cycloalkyl, aralkyl, heteroaralkyl, and combinations
thereof), ester (alkyl, aralkyl, heteroaralkyl), amide (mono-, di-,
alkyl, aralkyl, heteroaralkyl, and combinations thereof),
sulfonamide (mono-, di-, alkyl, aralkyl, heteroaralkyl, and
combinations thereof), unsubstituted aryl, unsubstituted
heteroaryl, unsubstituted heterocyclyl, and unsubstituted
cycloalkyl. In one aspect, the substituents on a group are
independently any one single, or any subset of the aforementioned
substituents.
[0453] The terms "adeninyl, cytosinyl, guaninyl, thyminyl, and
uracilyl" and the like refer to radicals of adenine, cytosine,
guanine, thymine, and uracil.
[0454] A "protected" moiety refers to a reactive functional group,
e.g., a hydroxyl group or an amino group, or a class of molecules,
e.g., sugars, having one or more functional groups, in which the
reactivity of the functional group is temporarily blocked by the
presence of an attached protecting group. Protecting groups useful
for the monomers and methods described herein can be found, e.g.,
in Greene, T. W., Protective Groups in Organic Synthesis (John
Wiley and Sons: New York), 1981, which is hereby incorporated by
reference.
[0455] As used herein, an "unusual" nucleobase can include any one
of the following:
[0456] 2-methyladeninyl,
[0457] N6-methyladeninyl,
[0458] 2-methylthio-N6-methyladeninyl,
[0459] N6-isopentenyladeninyl,
[0460] 2-methylthio-N6-isopentenyladeninyl,
[0461] N6-(cis-hydroxyisopentenyl)adeninyl,
[0462] 2-methylthio-N6-(cis-hydroxyisopentenyl)adeninyl,
[0463] N6-glycinylcarbamoyladeninyl,
[0464] N6-threonylcarbamoyladeninyl,
[0465] 2-methylthio-N6-threonyl carbamoyladeninyl,
[0466] N6-methyl-N6-threonylcarbamoyladeninyl,
[0467] N6-hydroxynorvalylcarbamoyladeninyl,
[0468] 2-methylthio-N6-hydroxynorvalyl carbamoyladeninyl,
[0469] N6,N6-dimethyladeninyl,
[0470] 3-methylcytosinyl,
[0471] 5-methylcytosinyl,
[0472] 2-thiocytosinyl,
[0473] 5-formylcytosinyl, ##STR161##
[0474] N4-methylcytosinyl,
[0475] 5-hydroxymethylcytosinyl,
[0476] 1-methylguaninyl,
[0477] N2-methylguaninyl,
[0478] 7-methylguaninyl,
[0479] N2,N2-dimethylguaninyl, ##STR162## ##STR163##
[0480] N2,7-dimethylguaninyl,
[0481] N2,N2,7-trimethylguaninyl,
[0482] 1-methylguaninyl,
[0483] 7-cyano-7-deazaguaninyl,
[0484] 7-aminomethyl-7-deazaguaninyl,
[0485] pseudouracilyl,
[0486] dihydrouracilyl,
[0487] 5-methyluracilyl,
[0488] 1-methylpseudouracilyl,
[0489] 2-thiouracilyl,
[0490] 4-thiouracilyl,
[0491] 2-thiothyminyl
[0492] 5-methyl-2-thiouracilyl,
[0493] 3-(3-amino-3-carboxypropyl)uracilyl,
[0494] 5-hydroxyuracilyl,
[0495] 5-methoxyuracilyl,
[0496] uracilyl 5-oxyacetic acid,
[0497] uracilyl 5-oxyacetic acid methyl ester,
[0498] 5-(carboxyhydroxymethyl)uracilyl,
[0499] 5-(carboxyhydroxymethyl)uracilyl methyl ester,
[0500] 5-methoxycarbonylmethyluracilyl,
[0501] 5-methoxycarbonylmethyl-2-thiouracilyl,
[0502] 5-aminomethyl-2-thiouracilyl,
[0503] 5-methylaminomethyluracilyl,
[0504] 5-methylaminomethyl-2-thiouracilyl,
[0505] 5-methylaminomethyl-2-selenouracilyl,
[0506] 5-carbamoylmethyluracilyl,
[0507] 5-carboxymethylaminomethyluracilyl,
[0508] 5-carboxymethylaminomethyl-2-thiouracilyl,
[0509] 3-methyluracilyl,
[0510] 1-methyl-3-(3-amino-3-carboxypropyl)pseudouracilyl,
[0511] 5-carboxymethyluracilyl,
[0512] 5-methyldihydrouracilyl, or
[0513] 3-methylpseudouracilyl.
[0514] A universal base can form base pairs with each of the
natural DNA/RNA bases, exhibiting relatively little discrimination
between them. In general, the universal bases are non-hydrogen
bonding, hydrophobic, aromatic moieties which can stabilize e.g.,
duplex RNA or RNA-like molecules, via stacking interactions. A
universal base can also include hydrogen bonding substituents.
[0515] General
[0516] An oligonucleotide agent, e.g., a conjugated oligonucleotide
agent, containing a preferred, but nonlimiting ligand-conjugated
monomer subunit is presented as formula (II) below. The carrier
(also referred to in some embodiments as a "linker") can be a
cyclic or acyclic moiety and includes two "backbone attachment
points" (e.g., hydroxyl groups) and a ligand. The ligand can be
directly attached (e.g., conjugated) to the carrier or indirectly
attached (e.g., conjugated) to the carrier by an intervening tether
(e.g., an acyclic chain of one or more atoms; or a nucleobase,
e.g., a naturally occurring nucleobase optionally having one or
more chemical modifications, e.g., an unusual base; or a universal
base). The carrier therefore also includes a "ligand or tethering
attachment point" for the ligand and tether/tethered ligand,
respectively.
[0517] The ligand-conjugated monomer subunit may be the 5' or 3'
terminal subunit of the RNA molecule, i.e., one of the two "W"
groups may be a hydroxyl group, and the other "W" group may be a
chain of two or more unmodified or modified ribonucleotides.
Alternatively, the ligand-conjugated monomer subunit may occupy an
internal position, and both "W" groups may be one or more
unmodified or modified ribonucleotides. More than one
ligand-conjugated monomer subunit may be present in a RNA molecule,
e.g., an oligonucleotide agent. Preferred positions for inclusion
of a tethered ligand-conjugated monomer subunit, e.g., one in which
a lipophilic moiety, e.g., cholesterol, is tethered to the carrier
are at the 3' terminus, the 5' terminus, or at an internal
position. ##STR164##
[0518] The modified RNA molecule of formula (II) can be obtained
using oligonucleotide synthetic methods known in the art. In a
preferred embodiment, the modified RNA molecule of formula (II) can
be prepared by incorporating one or more of the corresponding
monomer compounds (see, e.g., A, B, and C below) into a growing
strand, utilizing, e.g., phosphoramidite or H-phosphonate coupling
strategies.
[0519] The monomers, e.g., a ligand-conjugated monomers, generally
include two differently functionalized hydroxyl groups (OFG.sup.1
and OFG.sup.2), which are linked to the carrier molecule (see A
below), and a ligand/tethering attachment point. As used herein,
the term "functionalized hydroxyl group" means that the hydroxyl
proton has been replaced by another substituent. As shown in
representative structures B and C below, one hydroxyl group
(OFG.sup.1) on the carrier is functionalized with a protecting
group (PG). The other hydroxyl group (OFG.sup.2) can be
functionalized with either (1) a liquid or solid phase synthesis
support reagent (solid circle) directly or indirectly through a
linker, L, as in B, or (2) a phosphorus-containing moiety, e.g., a
phosphoramidite as in C. The tethering attachment point may be
connected to a hydrogen atom, a suitable protecting group, a
tether, or a tethered ligand at the time that the monomer is
incorporated into the growing strand (see variable "R" in A below).
Thus, the tethered ligand can be, but need not be attached to the
monomer at the time that the monomer is incorporated into the
growing strand. In certain embodiments, the tether, the ligand or
the tethered ligand may be linked to a "precursor"
ligand-conjugated monomer subunit after a "precursor"
ligand-conjugated monomer subunit has been incorporated into the
strand. The wavy line used below (and elsewhere herein) refers to a
connection, and can represent a direct bond between the moiety and
the attachment point or a tethering molecule which is interposed
between the moiety and the attachment point. Directly tethered
means the moiety is bound directly to the attachment point.
Indirectly tethered means that there is a tether molecule
interposed between the attachment point and the moiety.
##STR165##
[0520] The (OFG.sup.1) protecting group may be selected as desired,
e.g., from T. W. Greene and P. G. M. Wuts, Protective Groups in
Organic Synthesis, 2d. Ed., John Wiley and Sons (1991). The
protecting group is preferably stable under amidite synthesis
conditions, storage conditions, and oligonucleotide synthesis
conditions. Hydroxyl groups, --OH, are nucleophilic groups (i.e.,
Lewis bases), which react through the oxygen with electrophiles
(i.e., Lewis acids). Hydroxyl groups in which the hydrogen has been
replaced with a protecting group, e.g., a triarylmethyl group or a
trialkylsilyl group, are essentially unreactive as nucleophiles in
displacement reactions. Thus, the protected hydroxyl group is
useful in preventing e.g., homocoupling of compounds exemplified by
structure C during oligonucleotide synthesis. In some embodiments,
a preferred protecting group is the dimethoxytrityl group. In other
embodiments, a preferred protecting group is a silicon-based
protecting group having the formula below: ##STR166##
[0521] X5', X5'', and X5''' can be selected from substituted or
unsubstituted alkyl, cycloalkyl, aryl, araklyl, heteroaryl, alkoxy,
cycloalkoxy, aralkoxy, aryloxy, heteroaryloxy, or siloxy (i.e.,
R.sub.3SiO--, the three "R" groups can be any combination of the
above listed groups). X.sup.5', X.sup.5'', and X.sup.''' may all be
the same or different; also contemplated is a combination in which
two of X.sup.5', X.sup.5'', and X.sup.5''' are identical and the
third is different. In certain embodiments X.sup.5', X.sup.5'', and
X.sup.5''' include at least one alkoxy or siloxy groups. A
preferred combination includes X.sup.5', X.sup.5''=trimethylsiloxy
and X.sup.5'''=1,3-(triphenylmethoxy)-2-propoxy or
cyclododecyloxy.
[0522] Other preferred combinations of X.sup.5', X.sup.5'', and
X.sup.5''' include those that result in OFG.sup.1 groups that meet
the deprotection and stability criteria delineated below. The group
is preferably stable under amidite synthesis conditions, storage
conditions, and oligonucleotide synthesis conditions. Rapid
removal, i.e., less than one minute, of the silyl group from e.g.,
a support-bound oligonucleotide is desirable because it can reduce
synthesis times and thereby reduce exposure timeof the growing
oligonucleotide chain to the reagents. Oligonucleotide synthesis
can be improved if the silyl protecting group is visible during
deprotection, e.g., from the addition of a chromophore silyl
substituent.
[0523] Selection of silyl protecting groups can be complicated by
the competing demands of the essential characteristics of stability
and facile removal, and the need to balance these competitive
goals. Most substituents that increase stability can also increase
the reaction time required for removal of the silyl group,
potentially increasing the level of difficulty in removal of the
group.
[0524] The addition of alkoxy and siloxy substituents to OFG.sup.1
silicon-containing protecting groups increases the susceptibility
of the protecting groups to fluoride cleavage of the silylether
bonds. Increasing the steric bulk of the substituents preserves
stability while not decreasing fluoride lability to an equal
extent. An appropriate balance of substituents on the silyl group
makes a silyl ether a viable nucleoside protecting group.
[0525] Candidate OFG.sup.1 silicon-containing protecting groups may
be tested by exposing a tetrahydrofuran solution of a preferred
carrier bearing the candidate OFG.sup.1 group to five molar
equivalents of tetrahydrofuran at room temperature. The reaction
time may be determined by monitoring the disappearance of the
starting material by thin layer chromatography.
[0526] When the OFG.sup.2 in B includes a linker, e.g., a
relatively long organic linker, connected to a soluble or insoluble
support reagent, solution or solid phase synthesis techniques can
be employed to build up a chain of natural and/or modified
ribonucleotides once OFG.sup.1 is deprotected and free to react as
a nucleophile with another nucleoside or monomer containing an
electrophilic group (e.g., an amidite group). Alternatively, a
natural or modified ribonucleotide or oligoribonucleotide chain can
be coupled to monomer C via an amidite group or H-phosphonate group
at OFG.sup.2. Subsequent to this operation, OFG.sup.1 can be
deblocked, and the restored nucleophilic hydroxyl group can react
with another nucleoside or monomer containing an electrophilic
group. R' can be substituted or unsubstituted alkyl or alkenyl. In
preferred embodiments, R' is methyl, allyl or 2-cyanoethyl. R'' may
a C.sub.1-C.sub.10 alkyl group, preferably it is a branched group
containing three or more carbons, e.g., isopropyl.
[0527] OFG.sup.2 in B can be hydroxyl functionalized with a linker,
which in turn contains a liquid or solid phase synthesis support
reagent at the other linker terminus. The support reagent can be
any support medium that can support the monomers described herein.
The monomer can be attached to an insoluble support via a linker,
L, which allows the monomer (and the growing chain) to be
solubilized in the solvent in which the support is placed. The
solubilized, yet immobilized, monomer can react with reagents in
the surrounding solvent; unreacted reagents and soluble by-products
can be readily washed away from the solid support to which the
monomer or monomer-derived products is attached. Alternatively, the
monomer can be attached to a soluble support moiety, e.g.,
polyethylene glycol (PEG) and liquid phase synthesis techniques can
be used to build up the chain. Linker and support medium selection
is within skill of the art. Generally the linker may be
--C(O)(CH.sub.2).sub.qC(O)--, or --C(O)(CH.sub.2).sub.qS--, in
which q can be 0, 1, 2, 3, or 4; preferably, it is oxalyl, succinyl
or thioglycolyl. Standard control pore glass solid phase synthesis
supports can not be used in conjunction with fluoride labile 5'
silyl protecting groups because the glass is degraded by fluoride
with a significant reduction in the amount of full-length product.
Fluoride-stable polystyrene based supports or PEG are
preferred.
[0528] The ligand/tethering attachment point can be any divalent,
trivalent, tetravalent, pentavalent or hexavalent atom. In some
embodiments, ligand/tethering attachment point can be a carbon,
oxygen, nitrogen or sulfur atom. For example, a ligand/tethering
attachment point precursor functional group can have a nucleophilic
heteroatom, e.g., --SH, --NH.sub.2, secondary amino, ONH.sub.2, or
NH.sub.2NH.sub.2. As another example, the ligand/tethering
attachment point precursor functional group can be an olefin, e.g.,
--CH.dbd.CH.sub.2 or a Diels-Alder diene or dienophile and the
precursor functional group can be attached to a ligand, a tether,
or tethered ligand using, e.g., transition metal catalyzed
carbon-carbon (for example olefin metathesis) processes or
cycloadditions (e.g., Diels-Alder). As a further example, the
ligand/tethering attachment point precursor functional group can be
an electrophilic moiety, e.g., an aldehyde. When the carrier is a
cyclic carrier, the ligand/tethering attachment point can be an
endocyclic atom (i.e., a constituent atom in the cyclic moiety,
e.g., a nitrogenatom) or an exocyclic atom (i.e., an atom or group
of atoms attached to a constituent atom in the cyclic moiety).
[0529] The carrier can be any organic molecule containing
attachment points for OFG.sup.1, OFG.sup.2, and the ligand. In
certain embodiments, carrier is a cyclic molecule and may contain
heteroatoms (e.g., O, N or S). E.g., carrier molecules may include
aryl (e.g., benzene, biphenyl, etc.), cycloalkyl (e.g.,
cyclohexane, cis or trans decalin, etc.), or heterocyclyl
(piperazine, pyrrolidine, etc.). In other embodiments, the carrier
can be an acyclic moiety, e.g., based on serinol. Any of the above
cyclic systems may include substituents in addition to OFG.sup.1,
OFG.sup.2, and the ligand.
[0530] Sugar-Based Monomers
[0531] In some embodiments, the carrier molecule is an oxygen
containing heterocycle. Preferably the carrier is a ribose sugar as
shown in structure LCM-I. In this embodiment, the ligand-conjugated
monomer is a nucleoside. ##STR167##
[0532] "B" represents a nucleobase, e.g., a naturally occurring
nucleobase optionally having one or more chemical modifications,
e.g., and unusual base; or a universal base.
[0533] As used herein, an "unusual" nucleobase can include any one
of the following:
[0534] 2-methyladeninyl,
[0535] N6-methyladeninyl,
[0536] 2-methylthio-N6-methyladeninyl,
[0537] N6-isopentenyladeninyl,
[0538] 2-methylthio-N6-isopentenyladeninyl,
[0539] N6-(cis-hydroxyisopentenyl)adeninyl,
[0540] 2-methylthio-N6-(cis-hydroxyisopentenyl)adeninyl,
[0541] N6-glycinylcarbamoyladeninyl,
[0542] N6-threonylcarbamoyladeninyl,
[0543] 2-methylthio-N6-threonyl carbamoyladeninyl,
[0544] N6-methyl-N6-threonylcarbamoyladeninyl,
[0545] N6-hydroxynorvalylcarbamoyladeninyl,
[0546] 2-methylthio-N6-hydroxynorvalyl carbamoyladeninyl,
[0547] N6,N6-dimethyladeninyl,
[0548] 3-methylcytosinyl,
[0549] 5-methylcytosinyl,
[0550] 2-thiocytosinyl,
[0551] 5-formylcytosimyl, ##STR168##
[0552] N4-methylcytosinyl,
[0553] 5-hydroxymethylcytosinyl,
[0554] 1-methylguaninyl,
[0555] N2-methylguaninyl,
[0556] 7-methylguaninyl,
[0557] N2,N2-dimethylguaninyl, ##STR169## ##STR170##
[0558] N2,7-dimethylguaninyl,
[0559] N2,N2,7-trimethylguaninyl,
[0560] 1-methylguaninyl,
[0561] 7-cyano-7-deazaguaninyl,
[0562] 7-aminomethyl-7-deazaguaninyl,
[0563] pseudouracilyl,
[0564] dihydrouracilyl,
[0565] 5-methyluracilyl,
[0566] 1-methylpseudouracilyl,
[0567] 2-thiouracilyl,
[0568] 4-thiouracilyl,
[0569] 2-thiothyminyl
[0570] 5-methyl-2-thiouracilyl,
[0571] 3-(3-amino-3-carboxypropyl)uracilyl,
[0572] 5-hydroxyuracilyl,
[0573] 5-methoxyuracilyl,
[0574] uracilyl 5-oxyacetic acid,
[0575] uracilyl 5-oxyacetic acid methyl ester,
[0576] 5-(carboxyhydroxymethyl)uracilyl,
[0577] 5-(carboxyhydroxymethyl)uracilyl methyl ester,
[0578] 5-methoxycarbonylmethyluracilyl,
[0579] 5-methoxycarbonylmethyl-2-thiouracilyl,
[0580] 5-aminomethyl-2-thiouracilyl,
[0581] 5-methylaminomethyluracilyl,
[0582] 5-methylaminomethyl-2-thiouracilyl,
[0583] 5-methylaminomethyl-2-selenouracilyl,
[0584] 5-carbamoylmethyluracilyl,
[0585] 5-carboxymethylaminomethyluracilyl,
[0586] 5-carboxymethylaminomethyl-2-thiouracilyl,
[0587] 3-methyluracilyl,
[0588] 1-methyl-3-(3-amino-3-carboxypropyl)pseudouracilyl,
[0589] 5-carboxymethyluracilyl,
[0590] 5-methyldihydrouracilyl, or
[0591] 3-methylpseudouracilyl.
[0592] A universal base can form base pairs with each of the
natural DNA/RNA bases, exhibiting relatively little discrimination
between them. In general, the universal bases are non-hydrogen
bonding, hydrophobic, aromatic moieties which can stabilize e.g.,
duplex RNA or RNA-like molecules, via stacking interactions. A
universal base can also include hydrogen bonding substituents.
[0593] As used herein, a "universal base" can include anthracenes,
pyrenes or any one of the following: ##STR171## ##STR172##
[0594] In some embodiments, B can form part of a tether that
connects a ligand to the carrier. For example, the tether can be
B--CH.dbd.CH--C(O)NH--(CH.sub.2).sub.5--NHC(O)-LIGAND. In a
preferred embodiment, the double bond is trans, and the ligand is a
substituted or unsubstituted cholesterolyl radical (e.g., attached
through the D-ring side chain or the C-3 hydroxyl); an aralkyl
moiety having at least one sterogenic center and at least one
substituent on the aryl portion of the aralkyl group; or a
nucleobase. In certain embodiments, B, in the tether described
above, is uracilyl or a universal base, e.g., an aryl moiety, e.g.,
phenyl, optionally having additional substituents, e.g., one or
more fluoro groups. B can be substituted at any atom with the
remainder of the tether.
[0595] X.sup.2 can include "oxy" or "deoxy" substituents in place
of the 2'-OH or be a ligand or a tethered ligand.
[0596] Examples of "oxy"-substituents include alkoxy or aryloxy
(OR, e.g., R.dbd.H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl,
sugar, or protecting group); polyethyleneglycols (PEG),
O(CH.sub.2CH.sub.2O).sub.nCH.sub.2CH.sub.2OR; "locked" nucleic
acids (LNA) in which the 2' hydroxyl is connected, e.g., by a
methylene bridge, to the 4' carbon of the same ribose sugar;
O-PROTECTED AMINE (AMINE=NH.sub.2; alkylamino, dialkylamino,
heterocyclyl, arylamino, diaryl amino, heteroaryl amino, or
diheteroaryl amino, ethylene diamine, polyamino) and aminoalkoxy,
O(CH.sub.2).sub.nPROTECTED AMINE, (e.g., AMINE=NH.sub.2;
alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino,
heteroaryl amino, or diheteroaryl amino, ethylene diamine,
polyamino), and orthoester. Amine protecting groups can include
formyl, amido, benzyl, allyl, etc.
[0597] Preferred orthoesters have the general formula J. The groups
R.sup.31 and R.sup.32 may be the same or different. A preferred
orthoester is the "ACE" group, shown below as structure K.
##STR173##
[0598] "Deoxy" substituents include hydrogen (i.e. deoxyribose
sugars); halo (e.g., fluoro); protected amino (e.g. NH.sub.2;
alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino,
heteroaryl amino, diheteroaryl amino, or amino acid in which all
amino are protected); fully protected polyamino (e.g.,
NH(CH.sub.2CH.sub.2NH).sub.nCH.sub.2CH.sub.2-AMINE, wherein
AMINE=NH.sub.2; alkylamino, dialkylamino, heterocyclyl, arylamino,
diaryl amino, heteroaryl amino,or diheteroaryl amino and all amino
groups are protected), --NHC(O)R (R=alkyl, cycloalkyl, aryl,
aralkyl, heteroaryl or sugar), cyano; alkyl-thio-alkyl; thioalkoxy;
and alkyl, cycloalkyl, aryl, alkenyl and alkynyl, which may be
optionally substituted with e.g., a protected amino functionality.
Preferred substitutents are 2'-methoxyethyl, 2'-OCH3, 2'-O-allyl,
2'-C-allyl, and 2'-fluoro.
[0599] X.sup.3 is as described for OFG.sup.2 above.
[0600] PG can be a triarylmethyl group (e.g., a dimethoxytrityl
group) or Si(X.sup.5')(X.sup.5'')(X.sup.5''') in which
(X.sup.5'),(X.sup.5''), and (X.sup.5''') are as described
elsewhere.
[0601] Sugar Replacement-Based Monomers
[0602] Cyclic sugar replacement-based monomers, e.g., sugar
replacement-based ligand-conjugated monomers, are also referred to
herein as sugar replacement monomer subunit (SRMS) monomer
compounds. Preferred carriers have the general formula (LCM-2)
provided below. (In that structure preferred backbone attachment
points can be chosen from R.sup.1 or R.sup.2; R.sup.3 or R.sup.4;
or R.sup.9 and R.sup.10 if Y is CR.sup.9R.sup.10 (two positions are
chosen to give two backbone attachment points, e.g., R.sup.1 and
R.sup.4, or R.sup.4 and R.sup.9). Preferred tethering attachment
points include R.sup.7; R.sup.5 or R.sup.6 when X is CH.sub.2. The
carriers are described below as an entity, which can be
incorporated into a strand. Thus, it is understood that the
structures also encompass the situations wherein one (in the case
of a terminal position) or two (in the case of an internal
position) of the attachment points, e.g., R.sup.1 or R.sup.2;
R.sup.3 or R.sup.4; or R.sup.9 or R.sup.10 (when Y is
CR.sup.9R.sup.10), is connected to the phosphate, or modified
phosphate, e.g., sulfur containing, backbone. E.g., one of the
above-named R groups can be --CH.sub.2--, wherein one bond is
connected to the carrier and one to a backbone atom, e.g., a
linking oxygen or a central phosphorus atom. ##STR174##
[0603] in which,
[0604] X is N(CO)R.sup.7, NR.sup.7 or CH.sub.2;
[0605] Y is NR.sup.8, O, S, CR.sup.9R.sup.10;
[0606] Z is CR.sup.11R.sup.12 or absent;
[0607] Each of R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.9, and
R.sup.10 is, independently, H, OR.sup.a, or
(CH.sub.2).sub.nOR.sup.b, provided that at least two of R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.9, and R.sup.10 are OR.sup.a
and/or (CH.sub.2).sub.nOR.sup.b;
[0608] Each of R.sup.5, R.sup.6, R.sup.11, and R.sup.12 is,
independently, a ligand, H, C.sub.1-C.sub.6 alkyl optionally
substituted with 1-3 R.sup.13, or C(O)NHR.sup.7; or R.sup.5 and
R.sup.11 together are C.sub.3-C.sub.8 cycloalkyl optionally
substituted with R.sup.14;
[0609] R.sup.7 can be a ligand, e.g., R.sup.7 can be R.sup.d, or
R.sup.7 can be a ligand tethered indirectly to the carrier, e.g.,
through a tethering moiety, e.g., C.sub.1-C.sub.20 alkyl
substituted with NR.sup.cR.sup.d; or C.sub.1-C.sub.20 alkyl
substituted with NHC(O)R.sup.d;
[0610] R.sup.8 is H or C.sub.1-C.sub.6 alkyl;
[0611] R.sup.13 is hydroxy, C.sub.1-C.sub.4 alkoxy, or halo;
[0612] R.sup.14is NR.sup.cR.sup.7;
[0613] R.sup.15 is C.sub.1-C.sub.6 alkyl optionally substituted
with cyano, or C.sub.2-C.sub.6 alkenyl;
[0614] R.sup.16 is C.sub.1-C.sub.10 alkyl;
[0615] R.sup.17 is a liquid or solid phase support reagent;
[0616] L is --C(O)(CH.sub.2).sub.qC(O)--, or
--C(O)(CH.sub.2).sub.qS--;
[0617] R.sup.a is a protecting group, e.g., CAr.sub.3; (e.g., a
dimethoxytrityl group) or Si(X.sup.5')(X.sup.5'')(X.sup.5''') in
which (X.sup.5'),(X.sup.5''), and (X.sup.5''') are as described
elsewhere.
[0618] R.sup.b is P(O)(O.sup.-)H, P(OR.sup.15)N(R.sup.16).sub.2 or
L-R.sup.17;
[0619] R.sup.c is H or C.sub.1-C.sub.6 alkyl;
[0620] R.sup.d is H or a ligand;
[0621] Each Ar is, independently, C.sub.6-C.sub.10 aryl optionally
substituted with C.sub.1-C.sub.4 alkoxy;
[0622] n is 1-4; and q is 0-4.
[0623] Exemplary carriers include those in which, e.g., X is
N(CO)R.sup.7 or NR.sup.7, Y is CR.sup.9R.sup.10, and Z is absent;
or X is N(CO)R.sup.7 or NR.sup.7, Y is CR.sup.9R.sup.10, and Z is
CR.sup.11R.sup.12; or X is N(CO)R.sup.7 or NR.sup.7, Y is NR.sup.8,
and Z is CR.sup.11R.sup.12; or X is N(CO)R.sup.7 or NR.sup.7, Y is
O, and Z is CR.sup.11R.sup.12; or X is CH.sub.2; Y is
CR.sup.9R.sup.10; Z is CR.sup.11R.sup.12, and R.sup.5 and R.sup.11
together form C.sub.6 cycloalkyl (H, z=2), or the indane ring
system, e.g., X is CH.sub.2; Y is CR.sup.9R.sup.10; Z is
CR.sup.11R.sup.12, and R.sup.5 and R.sup.11 together form C.sub.5
cycloalkyl (H, z=1).
[0624] In certain embodiments, the carrier may be based on the
pyrroline ring system or the 4-hydroxyproline ring system, e.g., X
is N(CO)R.sup.7 or NR.sup.7, Y is CR.sup.9R.sup.10, and Z is absent
(D). OFG.sup.1 is preferably attached to a primary carbon, e.g., an
exocyclic alkylene ##STR175##
[0625] group, e.g., a methylene group, connected to one of the
carbons in the five-membered ring (--CH.sub.2OFG.sup.1 in D).
OFG.sup.2 is preferably attached directly to one of the carbons in
the five-membered ring (--OFG.sup.2 in D). For the pyrroline-based
carriers, --CH.sub.2OFG.sup.1 may be attached to C-2 and OFG.sup.2
may be attached to C-3; or --CH.sub.2OFG.sup.1 may be attached to
C-3 and OFG.sup.2 may be attached to C-4. In certain embodiments,
CH.sub.2OFG.sup.1 and OFG.sup.2 may be geminally substituted to one
of the above-referenced carbons. For the 3-hydroxyproline-based
carriers, --CH.sub.2OFG.sup.1 may be attached to C-2 and OFG.sup.2
may be attached to C-4. The pyrroline- and 4-hydroxyproline-based
monomers may therefore contain linkages (e.g., carbon-carbon bonds)
wherein bond rotation is restricted about that particular linkage,
e.g. restriction resulting from the presence of a ring. Thus,
CH.sub.2OFG.sup.1 and OFG.sup.2 may be cis or trans with respect to
one another in any of the pairings delineated above Accordingly,
all cis/trans isomers are expressly included. The monomers may also
contain one or more asymmetric centers and thus occur as racemates
and racemic mixtures, single enantiomers, individual diastereomers
and diastereomeric mixtures. All such isomeric forms of the
monomers are expressly included (e.g., the centers bearing
CH.sub.2OFG.sup.1 and OFG.sup.2 can both have the R configuration;
or both have the S configuration; or one center can have the R
configuration and the other center can have the S configuration and
vice versa). The tethering attachment point is preferably nitrogen.
Preferred examples of carrier D include the following:
##STR176##
[0626] In certain embodiments, the carrier may be based on the
piperidine ring system (E), e.g., X is N(CO)R.sup.7 or NR.sup.7, Y
is CR.sup.9R.sup.10, and Z is CR.sup.11R.sup.12. OFG.sup.1 is
preferably ##STR177## attached to a primary carbon, e.g., an
exocyclic alkylene group, e.g., a methylene group (n=1) or ethylene
group (n=2), connected to one of the carbons in the six-membered
ring [--(CH.sub.2).sub.nOFG.sup.1 in E]. OFG.sup.2 is preferably
attached directly to one of the carbons in the six-membered ring
(--OFG.sup.2 in E). --(CH.sub.2).sub.nOFG.sup.1 and OFG.sup.2 may
be disposed in a geminal manner on the ring, i.e., both groups may
be attached to the same carbon, e.g., at C-2, C-3, or C-4.
Alternatively, --(CH.sub.2).sub.nOFG.sup.1 and OFG.sup.2 may be
disposed in a vicinal manner on the ring, i.e., both groups may be
attached to adjacent ring carbon atoms, e.g.,
--(CH.sub.2).sub.nOFG.sup.1 may be attached to C-2 and OFG.sup.2
may be attached to C-3; --(CH.sub.2).sub.nOFG.sup.1 may be attached
to C-3 and OFG.sup.2 may be attached to C-2;
--(CH.sub.2).sub.nOFG.sup.1 may be attached to C-3 and OFG.sup.2
may be attached to C-4; or --(CH.sub.2).sub.nOFG.sup.1 may be
attached to C-4 and OFG.sup.2 may be attached to C-3. The
piperidine-based monomers may therefore contain linkages (e.g.,
carbon-carbon bonds) wherein bond rotation is restricted about that
particular linkage, e.g. restriction resulting from the presence of
a ring. Thus, --(CH.sub.2).sub.nOFG.sup.1 and OFG.sup.2 may be cis
or trans with respect to one another in any of the pairings
delineated above. Accordingly, all cis/trans isomers are expressly
included. The monomers may also contain one or more asymmetric
centers and thus occur as racemates and racemic mixtures, single
enantiomers, individual diastereomers and diastereomeric mixtures.
All such isomeric forms of the monomers are expressly included
(e.g., the centers bearing CH.sub.2OFG.sup.1 and OFG.sup.2 can both
have the R configuration; or both have the S configuration; or one
center can have the R configuration and the other center can have
the S configuration and vice versa). The tethering attachment point
is preferably nitrogen.
[0627] In certain embodiments, the carrier may be based on the
piperazine ring system (F), e.g., X is N(CO)R.sup.7 or NR.sup.7, Y
is NR.sup.8, and Z is CR.sup.11R.sup.12, or the morpholine ring
system (G), e.g., X is N(CO)R.sup.7 or NR.sup.7, Y is O, and Z is
CR.sup.11R.sup.12. OFG.sup.1 is preferably ##STR178## attached to a
primary carbon, e.g., an exocyclic alkylene group, e.g., a
methylene group, connected to one of the carbons in the
six-membered ring (--CH.sub.2OFG.sup.1 in F or G). OFG.sup.2 is
preferably attached directly to one of the carbons in the
six-membered rings (--OFG.sup.2 in F or G). For both F and G,
--CH.sub.2OFG.sup.1 may be attached to C-2 and OFG.sup.2 may be
attached to C-3; or vice versa. In certain embodiments,
CH.sub.2OFG.sup.1 and OFG.sup.2 may be geminally substituted to one
of the above-referenced carbons.The piperazine- and
morpholine-based monomers may therefore contain linkages (e.g.,
carbon-carbon bonds) wherein bond rotation is restricted about that
particular linkage, e.g. restriction resulting from the presence of
a ring. Thus, CH.sub.2OFG.sup.1 and OFG.sup.2 may be cis or trans
with respect to one another in any of the pairings delineated
above. Accordingly, all cis/trans isomers are expressly included.
The monomers may also contain one or more asymmetric centers and
thus occur as racemates and racemic mixtures, single enantiomers,
individual diastereomers and diastereomeric mixtures. All such
isomeric forms of the monomers are expressly included (e.g., the
centers bearing CH.sub.2OFG.sup.1 and OFG.sup.2 can both have the R
configuration; or both have the S configuration; or one center can
have the R configuration and the other center can have the S
configuration and vice versa). R''' can be, e.g., C.sub.1-C.sub.6
alkyl, preferably CH.sub.3. The tethering attachment point is
preferably nitrogen in both F and G.
[0628] In certain embodiments, the carrier may be based on the
decalin ring system, e.g., X is CH.sub.2; Y is CR.sup.9R.sup.10; Z
is CR.sup.11R.sup.12, and R.sup.5 and R.sup.11 together form
C.sub.6 cycloalkyl (H, z=2), or the indane ring system, e.g., X is
CH.sub.2; Y is CR.sup.9R.sup.10; Z is CR.sup.11R.sup.12, and
R.sup.5 and R.sup.11 together form C.sub.5 cycloalkyl (H, z=1).
OFG.sup.1 is preferably attached to a primary carbon, ##STR179##
e.g., an exocyclic methylene group (n=1) or ethylene group (n=2)
connected to one of C-2, C-3, C-4, or C-5
[--(CH.sub.2).sub.nOFG.sup.1 in H]. OFG.sup.2 is preferably
attached directly to one of C-2, C-3, C-4, or C-5 (--OFG.sup.2 in
H). --(CH.sub.2).sub.nOFG.sup.1 and OFG.sup.2 may be disposed in a
geminal manner on the ring, i.e., both groups may be attached to
the same carbon, e.g., at C-2, C-3, C-4, or C-5. Alternatively,
--(CH.sub.2).sub.nOFG.sup.1 and OFG.sup.2 may be disposed in a
vicinal manner on the ring, i.e., both groups may be attached to
adjacent ring carbon atoms, e.g., --(CH.sub.2).sub.nOFG.sup.1 may
be attached to C-2 and OFG.sup.2 may be attached to C-3;
--(CH.sub.2).sub.nOFG.sup.1 may be attached to C-3 and OFG.sup.2
may be attached to C-2; --(CH.sub.2).sub.nOFG.sup.1 may be attached
to C-3 and OFG.sup.2 may be attached to C-4; or
--(CH.sub.2).sub.nOFG.sup.1 may be attached to C-4 and OFG.sup.2
may be attached to C-3; --(CH.sub.2).sub.nOFG.sup.1 may be attached
to C-4 and OFG.sup.2 may be attached to C-5; or
--(CH.sub.2).sub.nOFG.sup.1 may be attached to C-5 and OFG.sup.2
may be attached to C-4. The decalin or indane-based monomers may
therefore contain linkages (e.g., carbon-carbon bonds) wherein bond
rotation is restricted about that particular linkage, e.g.
restriction resulting from the presence of a ring. Thus,
--(CH.sub.2).sub.nOFG.sup.1 and OFG.sup.2 may be cis or trans with
respect to one another in any of the pairings delineated above.
Accordingly, all cis/trans isomers are expressly included. The
monomers may also contain one or more asymmetric centers and thus
occur as racemates and racemic mixtures, single enantiomers,
individual diastereomers and diastereomeric mixtures. All such
isomeric forms of the monomers are expressly included (e.g., the
centers bearing CH.sub.2OFG.sup.1 and OFG.sup.2 can both have the R
configuration; or both have the S configuration; or one center can
have the R configuration and the other center can have the S
configuration and vice versa). In a preferred embodiment, the
substituents at C-1 and C-6 are trans with respect to one another.
The tethering attachment point is preferably C-6 or C-7.
[0629] Other carriers may include those based on 3-hydroxyproline
(J). Thus, --(CH.sub.2).sub.nOFG.sup.1 and OFG.sup.2 may be cis or
trans with respect to one another. Accordingly, all cis/trans
isomers are expressly included. The monomers may also contain one
or more asymmetric centers ##STR180## and thus occur as racemates
and racemic mixtures, single enantiomers, individual diastereomers
and diastereomeric mixtures. All such isomeric forms of the
monomers are expressly included (e.g., the centers bearing
CH.sub.2OFG.sup.1 and OFG.sup.2 can both have the R configuration;
or both have the S configuration; or one center can have the R
configuration and the other center can have the S configuration and
vice versa). The tethering attachment point is preferably
nitrogen.
[0630] Sugar Replacement-Based Monomers (Acyclic)
[0631] Acyclic sugar replacement-based monomers, e.g., sugar
replacement-based ligand-conjugated monomers, are also referred to
herein as sugar replacement monomer subunit (SRMS) monomer
compounds. Preferred acyclic carriers can have formula LCM-3 or
LCM-4 below. ##STR181##
[0632] In some embodiments, each of x, y, and z can be,
independently of one another, 0, 1, 2, or 3. In formula LCM-3, when
y and z are different, then the tertiary carbon can have either the
R or S configuration. In preferred embodiments, x is zero and y and
z are each 1 in formula LCM-3(e.g., based on serinol), and y and z
are each 1 in formula LCM-3. Each of formula LCM-3 or LCM-4 below
can optionally be substituted, e.g., with hydroxy, alkoxy,
perhaloalkyl.
[0633] Tethers
[0634] In certain embodiments, a moiety, e.g., a ligand may be
connected indirectly to the carrier via the intermediacy of an
intervening tether. Tethers are connected to the carrier at a
tethering attachment point (TAP) and may include any
C.sub.1-C.sub.100 carbon-containing moiety, (e.g. C.sub.1-C.sub.75,
C.sub.1-C.sub.50, C.sub.1-C.sub.20, C.sub.1-C.sub.10; C.sub.1,
C.sub.2, C.sub.3, C.sub.4, C.sub.5, C.sub.6, C.sub.7, C.sub.8,
C.sub.9, or C.sub.10), preferably having at least one nitrogen
atom. In preferred embodiments, the nitrogen atom forms part of a
terminal amino or amido (NHC(O)--) group on the tether, which may
serve as a connection point for the ligand. Preferred tethers
(underlined) include TAP--(CH.sub.2).sub.nNH--;
TAP--C(O)(CH.sub.2).sub.nNH--; TAP--NR''''(CH.sub.2).sub.nNH--,
TAP--C(O)13 (CH.sub.2).sub.n--C(O)--;
TAP--C(O)--(CH.sub.2).sub.n--C(O)O--; TAP--C(O)--O--;
TAP--C(O)--(CH.sub.2).sub.n--NH--C(O)--;
TAP--C(O)--(CH.sub.2).sub.n--; TAP--C(O)--NH--; TAP--C(O)--;
TAP--(CH.sub.2).sub.n--C(O)--; TAP--(CH.sub.2).sub.n--C(O)O--;
TAP--(CH.sub.2).sub.n--; or TAP--(CH.sub.2).sub.n--NH--C(O)--; in
which n is 1-20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, or 20) and R'''' is C.sub.1-C.sub.6 alkyl.
Preferably, n is 5, 6, or 11. In other embodiments, the nitrogen
may form part of a terminal oxyamino group, e.g., --ONH.sub.2, or
hydrazino group, --NHNH.sub.2. The tether may optionally be
substituted, e.g., with hydroxy, alkoxy, perhaloalkyl, and/or
optionally inserted with one or more additional heteroatoms, e.g.,
N, O, or S. Preferred tethered ligands may include, e.g.,
TAP--(CH.sub.2).sub.nNH(LIGAND);
TAP--C(O)(CH.sub.2).sub.nNH(LIGAND);
TAP--NR''''(CH.sub.2).sub.nNH(LIGAND);
TAP--(CH.sub.2).sub.nONH(LIGAND);
TAP--C(O)(CH.sub.2).sub.nONH(LIGAND);
TAP--NR''''(CH.sub.2).sub.nONH(LIGAND);
TAP--(CH.sub.2).sub.nNHNH.sub.2(LIGAND),
TAP--C(O)(CH.sub.2).sub.nNHNH.sub.2(LIGAND);
TAP--NR''''(CH.sub.2).sub.nNHNH.sub.2(LIGAND);
TAP--C(O)--(CH.sub.2).sub.n--C(O)(LIGAND);
TAP--C(O)--(CH.sub.2).sub.n--C(O)O(LIGAND); TAP--C(O)--O(LIGAND);
TAP--C(O)--(CH.sub.2).sub.n--NH--C(O)(LIGAND);
TAP--C(O)--(CH.sub.2).sub.n(LIGAND); TAP--C(O)--NH(LIGAND);
TAP--C(O)(LIGAND); TAP--(CH.sub.2).sub.n--C(O)(LIGAND);
TAP--(CH.sub.2).sub.n--C(O)O(LIGAND);
TAP--(CH.sub.2).sub.n(LIGAND); or
TAP--(CH.sub.2).sub.n--NH--C(O)(LIGAND). In some embodiments, amino
terminated tethers (e.g., NH.sub.2, ONH.sub.2, NH.sub.2NH.sub.2)
can form an imino bond (i.e., C.dbd.N) with the ligand. In some
embodiments, amino terminated tethers (e.g., NH.sub.2, ONH.sub.2,
NH.sub.2NH.sub.2) can acylated, e.g., with C(O)CF.sub.3.
[0635] In some embodiments, the tether can terminate with a
mercapto group (i.e., SH) or an olefin (e.g., CH.dbd.CH.sub.2). For
example, the tether can be TAP--(CH.sub.2).sub.n--SH,
TAP--C(O)(CH.sub.2).sub.nSH,
TAP--(CH.sub.2).sub.n--(CH.dbd.CH.sub.2), or
TAP--C(O)(CH.sub.2).sub.n(CH.dbd.CH.sub.2), in which n can be as
described elsewhere. In certain embodiments, the olefin can be a
Diels-Alder diene or dienophile. The tether may optionally be
substituted, e.g., with hydroxy, alkoxy, perhaloalkyl, and/or
optionally inserted with one or more additional heteroatoms, e.g.,
N, O, or S. The double bond can be cis or trans or E or Z.
[0636] In other embodiments the tether may include an electrophilic
moiety, preferably at the terminal position of the tether.
Preferred electrophilic moieties include, e.g., an aldehyde, alkyl
halide, mesylate, tosylate, nosylate, or brosylate, or an activated
carboxylic acid ester, e.g. an NHS ester, or a pentafluorophenyl
ester. Preferred tethers (underlined) include
TAP--(CH.sub.2).sub.nCHO; TAP--C(O)(CH.sub.2).sub.nCHO; or
TAP--NR''''(CH.sub.2).sub.nCHO, in which n is 1-6 and R'''' is
C.sub.1-C.sub.6 alkyl; or TAP--(CH.sub.2).sub.nC(O)ONHS;
TAP--C(O)(CH.sub.2).sub.nC(O)ONHS; or TAP--NR''''(CH.sub.2)
.sub.nC(O)ONHS, in which n is 1-6 and R'''' is C.sub.1-C.sub.6
alkyl; TAP--(CH.sub.2).sub.nC(O)OC.sub.6F.sub.5;;
TAP--C(O)(CH.sub.2).sub.nC(O)OC.sub.6F.sub.5; or
TAP--NR''''(CH.sub.2) .sub.nC(O)OC.sub.6F.sub.5, in which n is 1-11
and R'''' is C.sub.1-C.sub.6 alkyl; or
--(CH.sub.2).sub.nCH.sub.2LG; TAP--C(O)(CH.sub.2).sub.nCH.sub.2LG;
or TAP--NR''''(CH.sub.2).sub.nCH.sub.2LG, in which n can be as
described elsewhere and R'''' is C.sub.1-C.sub.6 alkyl (LG can be a
leaving group, e.g., halide, mesylate, tosylate, nosylate,
brosylate). Tethering can be carried out by coupling a nucleophilic
group of a ligand, e.g., a thiol or amino group with an
electrophilic group on the tether.
[0637] In other embodiments, it can be desirable for the
ligand-conjugated monomer or a ligand-conjugated monomer to include
a phthalimido group (K) at the terminal position of the tether.
##STR182##
[0638] In other embodiments, other protected amino groups can be at
the terminal position of the tether, e.g., alloc, monomethoxy
trityl (MMT), trifluoroacetyl, Fmoc, or aryl sulfonyl (e.g., the
aryl portion can be ortho-nitrophenyl or ortho,
para-dinitrophenyl).
[0639] Any of the tethers described herein may further include one
or more additional linking groups, e.g., --O--(CH.sub.2).sub.n--,
--(CH.sub.2).sub.n--SS--, --(CH.sub.2).sub.n--, or
--(CH.dbd.CH)--.
[0640] Asymmetrical Modifications
[0641] An RNA, e.g., an iRNA agent, can be asymmetrically modified
as described herein, and as described in International Application
Serial No. PCT/US04/07070, filed Mar. 8, 2004, which is hereby
incorporated by reference.
[0642] An asymmetrically modified iRNA agent is one in which a
strand has a modification which is not present on the other strand.
An asymmetrical modification is a modification found on one strand
but not on the other strand. Any modification, e.g., any
modification described herein, can be present as an asymmetrical
modification. An asymmetrical modification can confer any of the
desired properties associated with a modification, e.g., those
properties discussed herein. E.g., an asymmetrical modification
can: confer resistance to degradation, an alteration in half life;
target the iRNA agent to a particular target, e.g., to a particular
tissue; modulate, e.g., increase or decrease, the affinity of a
strand for its complement or target sequence; or hinder or promote
modification of a terminal moiety, e.g., modification by a kinase
or other enzymes involved in the RISC mechanism pathway. The
designation of a modification as having one property does not mean
that it has no other property, e.g., a modification referred to as
one which promotes stabilization might also enhance targeting.
[0643] While not wishing to be bound by theory or any particular
mechanistic model, it is believed that asymmetrical modification
allows an iRNA agent to be optimized in view of the different or
"asymmetrical" functions of the sense and antisense strands. For
example, both strands can be modified to increase nuclease
resistance, however, since some changes can inhibit RISC activity,
these changes can be chosen for the sense stand. In addition, since
some modifications, e.g., targeting moieties, can add large bulky
groups that, e.g., can interfere with the cleavage activity of the
RISC complex, such modifications are preferably placed on the sense
strand. Thus, targeting moieties, especially bulky ones (e.g.
cholesterol), are preferentially added to the sense strand. In one
embodiment, an asymmetrical modification in which a phosphate of
the backbone is substituted with S, e.g., a phosphorothioate
modification, is present in the antisense strand, and a 2'
modification, e.g., 2' OMe is present in the sense strand. A
targeting moiety can be present at either (or both) the 5' or 3'
end of the sense strand of the iRNA agent. In a preferred example,
a P of the backbone is replaced with S in the antisense strand,
2'OMe is present in the sense strand, and a targeting moiety is
added to either the 5' or 3' end of the sense strand of the iRNA
agent.
[0644] In a preferred embodiment an asymmetrically modified iRNA
agent has a modification on the sense strand which modification is
not found on the antisense strand and the antisense strand has a
modification which is not found on the sense strand.
[0645] Each strand can include one or more asymmetrical
modifications. By way of example: one strand can include a first
asymmetrical modification which confers a first property on the
iRNA agent and the other strand can have a second asymmetrical
modification which confers a second property on the iRNA. E.g., one
strand, e.g., the sense strand can have a modification which
targets the iRNA agent to a tissue, and the other strand, e.g., the
antisense strand, has a modification which promotes hybridization
with the target gene sequence.
[0646] In some embodiments both strands can be modified to optimize
the same property, e.g., to increase resistance to nucleolytic
degradation, but different modifications are chosen for the sense
and the antisense strands, e.g., because the modifications affect
other properties as well. E.g., since some changes can affect RISC
activity these modifications are chosen for the sense strand.
[0647] In one embodiment, one strand has an asymmetrical 2'
modification, e.g., a 2' OMe modification, and the other strand has
an asymmetrical modification of the phosphate backbone, e.g., a
phosphorothioate modification. So, in one embodiment the antisense
strand has an asymmetrical 2' OMe modification and the sense strand
has an asymmetrical phosphorothioate modification (or vice versa).
In a particularly preferred embodiment, the RNAi agent will have
asymmetrical 2'-O alkyl, preferably, 2'-OMe modifications on the
sense strand and asymmetrical backbone P modification, preferably a
phosphorothioate modification in the antisense strand. There can be
one or multiple 2'-OMe modifications, e.g., at least 2, 3, 4, 5, or
6, of the subunits of the sense strand can be so modified. There
can be one or multiple phosphorothioate modifications, e.g., at
least 2, 3, 4, 5, or 6, of the subunits of the antisense strand can
be so modified. It is preferable to have an iRNA agent wherein
there are multiple 2'-OMe modifications on the sense strand and
multiple phophorothioate modifications on the antisense strand. All
of the subunits on one or both strands can be so modified. A
particularly preferred embodiment of multiple asymmetric
modifications on both strands has a duplex region about 20-21, and
preferably 19, subunits in length and one or two 3' overhangs of
about 2 subunits in length.
[0648] Asymmetrical modifications are useful for promoting
resistance to degradation by nucleases, e.g., endonucleases. iRNA
agents can include one or more asymmetrical modifications which
promote resistance to degradation. In preferred embodiments the
modification on the antisense strand is one which will not
interfere with silencing of the target, e.g., one which will not
interfere with cleavage of the target. Most if not all sites on a
strand are vulnerable, to some degree, to degradation by
endonucleases. One can determine sites which are relatively
vulnerable and insert asymmetrical modifications which inhibit
degradation. It is often desirable to provide asymmetrical
modification of a UA site in an iRNA agent, and in some cases it is
desirable to provide the UA sequence on both strands with
asymmetrical modification. Examples of modifications which inhibit
endonucleolytic degradation can be found herein. Particularly
favored modifications include: 2' modification, e.g., provision of
a 2' OMe moiety on the U, especially on a sense strand;
modification of the backbone, e.g., with the replacement of an O
with an S, in the phosphate backbone, e.g., the provision of a
phosphorothioate modification, on the U or the A or both,
especially on an antisense strand; replacement of the U with a C5
amino linker; replacement of the A with a G (sequence changes are
preferred to be located on the sense strand and not the antisense
strand); and modification of the at the 2', 6', 7', or 8' position.
Preferred embodiments are those in which one or more of these
modifications are present on the sense but not the antisense
strand, or embodiments where the antisense strand has fewer of such
modifications.
[0649] Asymmetrical modification can be used to inhibit degradation
by exonucleases. Asymmetrical modifications can include those in
which only one strand is modified as well as those in which both
are modified. In preferred embodiments the modification on the
antisense strand is one which will not interfere with silencing of
the target, e.g., one which will not interfere with cleavage of the
target. Some embodiments will have an asymmetrical modification on
the sense strand, e.g., in a 3' overhang, e.g., at the 3' terminus,
and on the antisense strand, e.g., in a 3' overhang, e.g., at the
3' terminus. If the modifications introduce moieties of different
size it is preferable that the larger be on the sense strand. If
the modifications introduce moieties of different charge it is
preferable that the one with greater charge be on the sense
strand.
[0650] Examples of modifications which inhibit exonucleolytic
degradation can be found herein. Particularly favored modifications
include: 2' modification, e.g., provision of a 2' OMe moiety in a
3' overhang, e.g., at the 3' terminus (3' terminus means at the 3'
atom of the molecule or at the most 3' moiety, e.g., the most 3' P
or 2' position, as indicated by the context); modification of the
backbone, e.g., with the replacement of a P with an S, e.g., the
provision of a phosphorothioate modification, or the use of a
methylated P in a 3' overhang, e.g., at the 3' terminus;
combination of a 2' modification, e.g., provision of a 2' O Me
moiety and modification of the backbone, e.g., with the replacement
of a P with an S, e.g., the provision of a phosphorothioate
modification, or the use of a methylated P, in a 3' overhang, e.g.,
at the 3' terminus; modification with a 3' alkyl; modification with
an abasic pyrolidine in a 3' overhang, e.g., at the 3' terminus;
modification with naproxene, ibuprofen, or other moieties which
inhibit degradation at the 3' terminus. Preferred embodiments are
those in which one or more of these modifications are present on
the sense but not the antisense strand, or embodiments where the
antisense strand has fewer of such modifications.
[0651] Modifications, e.g., those described herein, which affect
targeting can be provided as asymmetrical modifications. Targeting
modifications which can inhibit silencing, e.g., by inhibiting
cleavage of a target, can be provided as asymmetrical modifications
of the sense strand. A biodistribution altering moiety, e.g.,
cholesterol, can be provided in one or more, e.g., two,
asymmetrical modifications of the sense strand. Targeting
modifications which introduce moieties having a relatively large
molecular weight, e.g., a molecular weight of more than 400, 500,
or 1000 daltons, or which introduce a charged moiety (e.g., having
more than one positive charge or one negative charge) can be placed
on the sense strand.
[0652] Modifications, e.g., those described herein, which modulate,
e.g., increase or decrease, the affinity of a strand for its
compliment or target, can be provided as asymmetrical
modifications. These include: 5 methyl U; 5 methyl C;
pseudouridine, Locked nucleic acids include: 2 thio U and
2-amino-A. In some embodiments one or more of these is provided on
the antisense strand.
[0653] iRNA agents have a defined structure, with a sense strand
and an antisense strand, and in many cases short single strand
overhangs, e.g., of 2 or 3 nucleotides are present at one or both
3' ends. Asymmetrical modification can be used to optimize the
activity of such a structure, e.g., by being placed selectively
within the iRNA. E.g., the end region of the iRNA agent defined by
the 5' end of the sense strand and the 3'end of the antisense
strand is important for function. This region can include the
terminal 2, 3, or 4 paired nucleotides and any 3' overhang. In
preferred embodiments asymmetrical modifications which result in
one or more of the following are used: modifications of the 5' end
of the sense strand which inhibit kinase activation of the sense
strand, including, e.g., attachments of conjugates which target the
molecule or the use modifications which protect against 5'
exonucleolytic degradation; or modifications of either strand, but
preferably the sense strand, which enhance binding between the
sense and antisense strand and thereby promote a "tight" structure
at this end of the molecule.
[0654] The end region of the iRNA agent defined by the 3' end of
the sense strand and the 5'end of the antisense strand is also
important for function. This region can include the terminal 2, 3,
or 4 paired nucleotides and any 3' overhang. Preferred embodiments
include asymmetrical modifications of either strand, but preferably
the sense strand, which decrease binding between the sense and
antisense strand and thereby promote an "open" structure at this
end of the molecule. Such modifications include placing conjugates
which target the molecule or modifications which promote nuclease
resistance on the sense strand in this region. Modification of the
antisense strand which inhibit kinase activation are avoided in
preferred embodiments.
[0655] Exemplary modifications for asymmetrical placement in the
sense strand include the following:
[0656] (a) backbone modifications, e.g., modification of a backbone
P, including replacement of P with S, or P substituted with alkyl
or allyl, e.g., Me, and dithioates (S--P.dbd.S); these
modifications can be used to promote nuclease resistance;
[0657] (b) 2'-O alkyl, e.g., 2'-OMe, 3'-O alkyl, e.g., 3'-OMe (at
terminal and/or internal positions); these modifications can be
used to promote nuclease resistance or to enhance binding of the
sense to the antisense strand, the 3' modifications can be used at
the 5' end of the sense strand to avoid sense strand activation by
RISC;
[0658] (c) 2'-5' linkages (with 2'-H, 2'-OH and 2'-OMe and with
P.dbd.O or P.dbd.S) these modifications can be used to promote
nuclease resistance or to inhibit binding of the sense to the
antisense strand, or can be used at the 5' end of the sense strand
to avoid sense strand activation by RISC;
[0659] (d) L sugars (e.g., L ribose, L-arabinose with 2'-H, 2'-OH
and 2'-OMe); these modifications can be used to promote nuclease
resistance or to inhibit binding of the sense to the antisense
strand, or can be used at the 5' end of the sense strand to avoid
sense strand activation by RISC;
[0660] (e) modified sugars (e.g., locked nucleic acids (LNA's),
hexose nucleic acids (HNA's) and cyclohexene nucleic acids
(CeNA's)); these modifications can be used to promote nuclease
resistance or to inhibit binding of the sense to the antisense
strand, or can be used at the 5' end of the sense strand to avoid
sense strand activation by RISC;
[0661] (f) nucleobase modifications (e.g., C-5 modified
pyrimidines, N-2 modified purines, N-7 modified purines, N-6
modified purines), these modifications can be used to promote
nuclease resistance or to enhance binding of the sense to the
antisense strand;
[0662] (g) cationic groups and Zwitterionic groups (preferably at a
terminus), these modifications can be used to promote nuclease
resistance;
[0663] (h) conjugate groups (preferably at terminal positions),
e.g., naproxen, biotin, cholesterol, ibuprofen, folic acid,
peptides, and carbohydrates; these modifications can be used to
promote nuclease resistance or to target the molecule, or can be
used at the 5' end of the sense strand to avoid sense strand
activation by RISC.
[0664] Exemplary modifications for asymmetrical placement in the
antisense strand include the following:
[0665] (a) backbone modifications, e.g., modification of a backbone
P, including replacement of P with S, or P substituted with alkyl
or allyl, e.g., Me, and dithioates (S--P.dbd.S);
[0666] (b) 2'-O alkyl, e.g., 2'-OMe, (at terminal positions);
[0667] (c) 2'-5' linkages (with 2'-H, 2'-OH and 2'-OMe) e.g.,
terminal at the 3' end); e.g., with P.dbd.O or P.dbd.S preferably
at the 3'-end, these modifications are preferably excluded from the
5' end region as they may interfere with RISC enzyme activity such
as kinase activity;
[0668] (d) L sugars (e.g, L ribose, L-arabinose with 2'-H, 2'-OH
and 2'-OMe); e.g., terminal at the 3' end; e.g., with P.dbd.O or
P.dbd.S preferably at the 3'-end, these modifications are
preferably excluded from the 5' end region as they may interfere
with kinase activity;
[0669] (e) modified sugars (e.g., LNA's, HNA's and CeNA's); these
modifications are preferably excluded from the 5' end region as
they may contribute to unwanted enhancements of paring between the
sense and antisense strands, it is often preferred to have a
"loose" structure in the 5' region, additionally, they may
interfere with kinase activity;
[0670] (f) nucleobase modifications (e.g., C-5 modified
pyrimidines, N-2 modified purines, N-7 modified purines, N-6
modified purines);
[0671] (g) cationic groups and Zwitterionic groups (preferably at a
terminus);
[0672] cationic groups and Zwitterionic groups at 2'-position of
sugar; 3'-position of the sugar; as nucleobase modifications (e.g.,
C-5 modified pyrimidines, N-2 modified purines, N-7 modified
purines, N-6 modified purines);
[0673] conjugate groups (preferably at terminal positions), e.g.,
naproxen, biotin, cholesterol, ibuprofen, folic acid, peptides, and
carbohydrates, but bulky groups or generally groups which inhibit
RISC activity should are less preferred.
[0674] The 5'-OH of the antisense strand should be kept free to
promote activity. In some preferred embodiments modifications that
promote nuclease resistance should be included at the 3' end,
particularly in the 3' overhang.
[0675] In another aspect, the invention features a method of
optimizing, e.g., stabilizing, an iRNA agent. The method includes
selecting a sequence having activity, introducing one or more
asymmetric modifications into the sequence, wherein the
introduction of the asymmetric modification optimizes a property of
the iRNA agent but does not result in a decrease in activity.
[0676] The decrease in activity can be less than a preselected
level of decrease. In preferred embodiments decrease in activity
means a decrease of less than 5, 10, 20, 40, or 50% activity, as
compared with an otherwise similar iRNA lacking the introduced
modification. Activity can, e.g., be measured in vivo, or in vitro,
with a result in either being sufficient to demonstrate the
required maintenance of activity.
[0677] The optimized property can be any property described herein
and in particular the properties discussed in the section on
asymmetrical modifications provided herein. The modification can be
any asymmetrical modification, e.g., an asymmetric modification
described in the section on asymmetrical modifications described
herein. Particularly preferred asymmetric modifications are 2'-O
alkyl modifications, e.g., 2'-OMe modifications, particularly in
the sense sequence, and modifications of a backbone O, particularly
phosphorothioate modifications, in the antisense sequence.
[0678] In a preferred embodiment a sense sequence is selected and
provided with an asymmetrical modification, while in other
embodiments an antisense sequence is selected and provided with an
asymmetrical modification. In some embodiments both sense and
antisense sequences are selected and each provided with one or more
asymmetrical modifications.
[0679] Multiple asymmetric modifications can be introduced into
either or both of the sense and antisense sequence. A sequence can
have at least 2, 4, 6, 8, or more modifications and all or
substantially all of the monomers of a sequence can be
modified.
Differential Modification of Terminal Duplex Stability
[0680] In one aspect, the invention features an iRNA agent which
can have differential modification of terminal duplex stability
(DMTDS).
[0681] In addition, the invention includes iRNA agents having DMTDS
and another element described herein. E.g., the invention includes
an iRNA agent described herein, e.g., a palindromic iRNA agent, an
iRNA agent having a non canonical pairing, an iRNA agent which
targets a gene described herein, e.g., an htt gene, an iRNA agent
having an architecture or structure described herein, an iRNA
associated with an amphipathic delivery agent described herein, an
iRNA associated with a drug delivery module described herein, an
iRNA agent administered as described herein, or an iRNA agent
formulated as described herein, which also incorporates DMTDS.
[0682] iRNA agents can be optimized by increasing the propensity of
the duplex to disassociate or melt (decreasing the free energy of
duplex association), in the region of the 5' end of the antisense
strand duplex. This can be accomplished, e.g., by the inclusion of
subunits, which increase the propensity of the duplex to
disassociate or melt in the region of the 5' end of the antisense
strand. This can also be accomplished by the attachment of a ligand
that increases the propensity of the duplex to disassociate of melt
in the region of the 5'end. While not wishing to be bound by
theory, the effect may be due to promoting the effect of an enzyme
such as a helicase, for example, promoting the effect of the enzyme
in the proximity of the 5' end of the antisense strand.
[0683] The inventors have also discovered that iRNA agents can be
optimized by decreasing the propensity of the duplex to
disassociate or melt (increasing the free energy of duplex
association), in the region of the 3' end of the antisense strand
duplex. This can be accomplished, e.g., by the inclusion of
subunits which decrease the propensity of the duplex to
disassociate or melt in the region of the 3' end of the antisense
strand. It can also be accomplished by the attachment of ligand
that decreases the propensity of the duplex to disassociate or melt
in the region of the 5'end.
[0684] Modifications which increase the tendency of the 5' end of
the duplex to dissociate can be used alone or in combination with
other modifications described herein, e.g., with modifications
which decrease the tendency of the 3' end of the duplex to
dissociate. Likewise, modifications which decrease the tendency of
the 3' end of the duplex to dissociate can be used alone or in
combination with other modifications described herein, e.g., with
modifications which increase the tendency of the 5' end of the
duplex to dissociate.
Decreasing the Stability of the AS 5 ' End of the Duplex
[0685] Subunit pairs can be ranked on the basis of their propensity
to promote dissociation or melting (e.g., on the free energy of
association or dissociation of a particular pairing, the simplest
approach is to examine the pairs on an individual pair basis,
though next neighbor or similar analysis can also be used). In
terms of promoting dissociation: TABLE-US-00009 A:U is preferred
over G:C; G:U is preferred over G:C; I:C is preferred over G:C (I =
inosine);
[0686] mismatches, e.g., non-canonical or other than canonical
pairings (as described elsewhere herein) are preferred over
canonical (A:T, A:U, G:C) pairings; [0687] pairings which include a
universal base are preferred over canonical pairings.
[0688] A typical ds iRNA agent can be diagrammed as follows:
TABLE-US-00010 S 5' R.sub.1 N.sub.1 N.sub.2 N.sub.3 N.sub.4 N.sub.5
[N] N.sub.-5 N.sub.-4 N.sub.-3 N.sub.-2 N.sub.-1 R.sub.2 3' AS 3'
R.sub.3 N.sub.1 N.sub.2 N.sub.3 N.sub.4 N.sub.5 [N] N.sub.-5
N.sub.-4 N.sub.-3 N.sub.-2 N.sub.-1 R.sub.4 5' S:AS P.sub.1 P.sub.2
P.sub.3 P.sub.4 P.sub.5 [N] P.sub.-5 P.sub.-4 P.sub.-3 P.sub.-2
P.sub.-1 5'
[0689] S indicates the sense strand; AS indicates antisense strand;
R.sub.1 indicates an optional (and nonpreferred) 5' sense strand
overhang; R.sub.2 indicates an optional (though preferred) 3' sense
overhang; R.sub.3 indicates an optional (though preferred) 3'
antisense sense overhang; R.sub.4 indicates an optional (and
nonpreferred) 5' antisense overhang; N indicates subunits; [N]
indicates that additional subunit pairs may be present; and
P.sub.x, indicates a paring of sense N.sub.x and antisense N.sub.x.
Overhangs are not shown in the P diagram. In some embodiments a 3'
AS overhang corresponds to region Z, the duplex region corresponds
to region X, and the 3' S strand overhang corresponds to region Y,
as described elsewhere herein. (The diagram is not meant to imply
maximum or minimum lengths, on which guidance is provided elsewhere
herein.) It is preferred that pairings which decrease the
propensity to form a duplex are used at 1 or more of the positions
in the duplex at the 5' end of the AS strand. The terminal pair
(the most 5' pair in terms of the AS strand) is designated as
P.sub.-1, and the subsequent pairing positions (going in the 3'
direction in terms of the AS strand) in the duplex are designated,
P.sub.-2, P.sub.-3, P.sub.-4, P.sub.-4, P.sub.-5, and so on. The
preferred region in which to modify or modulate duplex formation is
at P.sub.-5 through P.sub.-1, more preferably P.sub.-4 through
P.sub.-1, more preferably P.sub.-3 through P.sub.-1. Modification
at P.sub.-1, is particularly preferred, alone or with
modification(s) other position(s), e.g., any of the positions just
identified. It is preferred that at least 1, and more preferably 2,
3, 4, or 5 of the pairs of one of the recited regions be chosen
independently from the group of: [0690] A:U [0691] G:U [0692] I:C
[0693] mismatched pairs, e.g., non-canonical or other than
canonical pairings or pairings which include a universal base.
[0694] In preferred embodiments the change in subunit needed to
achieve a pairing which promotes dissociation will be made in the
sense strand, though in some embodiments the change will be made in
the antisense strand.
[0695] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.-1, through P.sub.-4, are pairs which promote
dissociation.
[0696] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.-1, through P.sub.-4, are A:U.
[0697] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.-1, through P.sub.-4, are G:U.
[0698] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.-1, through P.sub.-4, are I:C.
[0699] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.-1, through P.sub.-4, are mismatched pairs, e.g.,
non-canonical or other than canonical pairings pairings.
[0700] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.-1, through P.sub.-4, are pairings which include a
universal base.
Increasing the Stability of the AS 3' End of the Duplex
[0701] Subunit pairs can be ranked on the basis of their propensity
to promote stability and inhibit dissociation or melting (e.g., on
the free energy of association or dissociation of a particular
pairing, the simplest approach is to examine the pairs on an
individual pair basis, though next neighbor or similar analysis can
also be used). In terms of promoting duplex stability:
TABLE-US-00011 G:C is preferred over A:U
[0702] Watson-Crick matches (A:T, A:U, G:C) are preferred over
non-canonical or other than canonical pairings
[0703] analogs that increase stability are preferred over
Watson-Crick matches (A:T, A:U, G:C) TABLE-US-00012 2-amino-A:U is
preferred over A:U 2-thio U or 5 Me-thio-U:A are preferred over U:A
G-clamp (an analog of C is preferred over C:G having 4 hydrogen
bonds):G guanadinium-G-clamp:G is preferred over C:G pseudo
uridine:A is preferred over U:A
[0704] sugar modifications, e.g., 2' modifications, e.g., 2'F, ENA,
or LNA, which enhance binding are preferred over non-modified
moieties and can be present on one or both strands to enhance
stability of the duplex. It is preferred that pairings which
increase the propensity to form a duplex are used at 1 or more of
the positions in the duplex at the 3' end of the AS strand. The
terminal pair (the most 3' pair in terms of the AS strand) is
designated as P.sub.1, and the subsequent pairing positions (going
in the 5' direction in terms of the AS strand) in the duplex are
designated, P.sub.2, P.sub.3, P.sub.4, P.sub.5, and so on. The
preferred region in which to modify to modulate duplex formation is
at P.sub.5 through P.sub.1, more preferably P.sub.4 through
P.sub.1, more preferably P.sub.3 through P.sub.1. Modification at
P.sub.1, is particularly preferred, alone or with modification(s)
at other position(s), e.g., any of the positions just identified.
It is preferred that at least 1, and more preferably 2, 3, 4, or 5
of the pairs of the recited regions be chosen independently from
the group of: [0705] G:C [0706] a pair having an analog that
increases stability over Watson-Crick matches (A:T, A:U, G:C)
[0707] 2-amino-A:U [0708] 2-thio U or 5 Me-thio-U:A [0709] G-clamp
(an analog of C having 4 hydrogen bonds):G [0710]
guanadinium-G-clamp:G [0711] pseudo uridine:A [0712] a pair in
which one or both subunits has a sugar modification, e.g., a 2'
modification, e.g., 2'F, ENA, or LNA, which enhance binding.
[0713] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.-1, through P.sub.-4, are pairs which promote duplex
stability.
[0714] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are G:C.
[0715] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are a pair having an analog that
increases stability over Watson-Crick matches.
[0716] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are 2-amino-A:U.
[0717] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are 2-thio U or 5 Me-thio-U:A.
[0718] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are G-clamp:G.
[0719] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are guanidinium-G-clamp:G.
[0720] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are pseudo uridine:A.
[0721] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are a pair in which one or both
subunits has a sugar modification, e.g., a 2' modification, e.g.,
2'F, ENA, or LNA, which enhances binding.
[0722] G-clamps and guanidinium G-clamps are discussed in the
following references: Holmes and Gait, "The Synthesis of
2'-O-Methyl G-Clamp Containing Oligonucleotides and Their
Inhibition of the HIV-1 Tat-TAR Interaction," Nucleosides,
Nucleotides & Nucleic Acids, 22:1259-1262, 2003; Holmes et al.,
"Steric inhibition of human immunodeficiency virus type-1
Tat-dependent trans-activation in vitro and in cells by
oligonucleotides containing 2'-O-methyl G-clamp ribonucleoside
analogues," Nucleic Acids Research, 31:2759-2768, 2003; Wilds, et
al., "Structural basis for recognition of guanosine by a synthetic
tricyclic cytosine analogue: Guanidinium G-clamp," Helvetica
Chimica Acta, 86:966-978, 2003; Rajeev, et al., "High-Affinity
Peptide Nucleic Acid Oligomers Containing Tricyclic Cytosine
Analogues," Organic Letters, 4:4395-4398, 2002; Ausin, et al.,
"Synthesis of Amino- and Guanidino-G-Clamp PNA Monomers," Organic
Letters, 4:4073-4075, 2002; Maier et al., "Nuclease resistance of
oligonucleotides containing the tricyclic cytosine analogues
phenoxazine and 9-(2-aminoethoxy)-phenoxazine ("G-clamp") and
origins of their nuclease resistance properties," Biochemistry,
41:1323-7,2002; Flanagan, et al., "A cytosine analog that confers
enhanced potency to antisense oligonucleotides," Proceedings Of The
National Academy Of Sciences Of The United States Of America,
96:3513-8, 1999.
[0723] Simultaneously Decreasing the Stability of the AS 5'End of
the Duplex and Increasing the Stability of the AS 3' End of the
Duplex
[0724] As is discussed above, an iRNA agent can be modified to both
decrease the stability of the AS 5'end of the duplex and increase
the stability of the AS 3' end of the duplex. This can be effected
by combining one or more of the stability decreasing modifications
in the AS 5' end of the duplex with one or more of the stability
increasing modifications in the AS 3' end of the duplex.
Accordingly a preferred embodiment includes modification in
P.sub.-5 through P.sub.-1, more preferably P.sub.-4 through
P.sub.-1 and more preferably P.sub.-3 through P.sub.-1.
Modification at P.sub.-1, is particularly preferred, alone or with
other position, e.g., the positions just identified. It is
preferred that at least 1, and more preferably 2, 3, 4, or 5 of the
pairs of one of the recited regions of the AS 5' end of the duplex
region be chosen independently from the group of: [0725] A:U [0726]
G:U [0727] I:C [0728] mismatched pairs, e.g., non-canonical or
other than canonical pairings which include a universal base;
and
[0729] a modification in P.sub.5 through P.sub.1, more preferably
P.sub.4 through P.sub.1 and more preferably P.sub.3 through
P.sub.1. Modification at P.sub.1, is particularly preferred, alone
or with other position, e.g., the positions just identified. It is
preferred that at least 1, and more preferably 2, 3, 4, or 5 of the
pairs of one of the recited regions of the AS 3' end of the duplex
region be chosen independently from the group of: [0730] G:C [0731]
a pair having an analog that increases stability over Watson-Crick
matches (A:T, A:U, G:C) [0732] 2-amino-A:U [0733] 2-thio U or 5
Me-thio-U:A [0734] G-clamp (an analog of C having 4 hydrogen
bonds):G [0735] guanadinium-G-clamp: G [0736] pseudo uridine:A
[0737] a pair in which one or both subunits has a sugar
modification, e.g., a 2' modification, e.g., 2'F, ENA, or LNA,
which enhance binding.
[0738] The invention also includes methods of selecting and making
iRNA agents having DMTDS. E.g., when screening a target sequence
for candidate sequences for use as iRNA agents one can select
sequences having a DMTDS property described herein or one which can
be modified, preferably with as few changes as possible, especially
to the
[0739] AS strand, to provide a desired level of DMTDS.
[0740] The invention also includes, providing a candidate iRNA
agent sequence, and modifying at least one P in P.sub.-5 through
P.sub.-1 and/or at least one P in P.sub.5 through P.sub.1 to
provide a DMTDS iRNA agent.
[0741] DMTDS iRNA agents can be used in any method described
herein, e.g., to silence an htt RNA, to treat any disorder
described herein, e.g., a neurological disorder, in any formulation
described herein, and generally in and/or with the methods and
compositions described elsewhere herein. DMTDS iRNA agents can
incorporate other modifications described herein, e.g., the
attachment of targeting agents or the inclusion of modifications
which enhance stability, e.g., the inclusion of nuclease resistant
monomers or the inclusion of single strand overhangs (e.g., 3' AS
overhangs and/or 3' S strand overhangs) which self associate to
form intrastrand duplex structure.
[0742] Preferably these iRNA agents will have an architecture
described herein.
Other Embodiments
[0743] An RNA, e.g., an iRNA agent, can be produced in a cell in
vivo, e.g., from exogenous DNA templates that are delivered into
the cell. For example, the DNA templates can be inserted into
vectors and used as gene therapy vectors. Gene therapy vectors can
be delivered to a subject by, for example, intravenous injection,
local administration (U.S. Pat. No. 5,328,470), or by stereotactic
injection (see, e.g., Chen et al., Proc. Natl. Acad. Sci. USA
91:3054-3057, 1994). The pharmaceutical preparation of the gene
therapy vector can include the gene therapy vector in an acceptable
diluent, or can comprise a slow release matrix in which the gene
delivery vehicle is imbedded. The DNA templates, for example, can
include two transcription units, one that produces a transcript
that includes the top strand of an iRNA agent and one that produces
a transcript that includes the bottom strand of an iRNA agent. When
the templates are transcribed, the iRNA agent is produced, and
processed into sRNA agent fragments that mediate gene
silencing.
[0744] Physiological Effects
[0745] The iRNA agents described herein can be designed such that
determining therapeutic toxicity is made easier by the
complementarity of the iRNA agent with both a human and a non-human
animal sequence. By these methods, an iRNA agent can consist of a
sequence that is fully complementary to a nucleic acid sequence
from a human and a nucleic acid sequence from at least one
non-human animal, e.g., a non-human mammal, such as a rodent,
ruminant or primate. For example, the non-human mammal can be a
mouse, rat, dog, pig, goat, sheep, cow, monkey, Pan paniscus, Pan
troglodytes, Macaca mulatto, or Cynomolgus monkey. The sequence of
the iRNA agent could be complementary to sequences within
homologous genes, e.g., oncogenes or tumor suppressor genes, of the
non-human mammal and the human. By determining the toxicity of the
iRNA agent in the non-human mammal, one can extrapolate the
toxicity of the iRNA agent in a human. For a more strenuous
toxicity test, the iRNA agent can be complementary to a human and
more than one, e.g., two or three or more, non-human animals.
[0746] The methods described herein can be used to correlate any
physiological effect of an iRNA agent on a human, e.g., any
unwanted effect, such as a toxic effect, or any positive, or
desired effect.
[0747] Amphipathic Delivery Agents
[0748] An iRNA agent, described herein can be used with an
amphipathic delivery conjugate or module, such as those described
herein.
[0749] An amphipathic molecule is a molecule having a hydrophobic
and a hydrophilic region. Such molecules can interact with (e.g.,
penetrate or disrupt) lipids, e.g., a lipid bilayer of a cell. As
such, they can serve as delivery agent for an associated (e.g.,
bound) iRNA (e.g., an iRNA or sRNA described herein). A preferred
amphipathic molecule to be used in the compositions described
herein (e.g., the amphipathic iRNA constructs described herein) is
a polymer. The polymer may have a secondary structure, e.g., a
repeating secondary structure.
[0750] One example of an amphipathic polymer is an amphipathic
polypeptide, e.g., a polypeptide having a secondary structure such
that the polypeptide has a hydrophilic and a hybrophobic face. The
design of amphipathic peptide structures (e.g., alpha-helical
polypeptides) is routine to one of skill in the art. For example,
the following references provide guidance: Grell et al. (2001) J
Pept Sci 7(3):146-51; Chen et al. (2002) J Pept Res 59(1):18-33;
Iwata et al. (1994) J Biol Chem 269(7):4928-33; Cornut et al.
(1994) FEBS Lett 349(1):29-33; Negrete et al. (1998) Protein Sci
7(6):1368-79.
[0751] Another example of an amphipathic polymer is a polymer made
up of two or more amphipathic subunits, e.g., two or more subunits
containing cyclic moieties (e.g., a cyclic moiety having one or
more hydrophilic groups and one or more hydrophobic groups). For
example, the subunit may contain a steroid, e.g., cholic acid; or a
aromatic moiety. Such moieties preferably can exhibit
atropisomerism, such that they can form opposing hydrophobic and
hydrophilic faces when in a polymer structure.
[0752] The ability of a putative amphipathic molecule to interact
with a lipid membrane, e.g., a cell membrane, can be tested by
routine methods, e.g., in a cell free or cellular assay. For
example, a test compound is combined or contacted with a synthetic
lipid bilayer, a cellular membrane fraction, or a cell, and the
test compound is evaluated for its ability to interact with,
penetrate, or disrupt the lipid bilayer, cell membrane or cell. The
test compound can be labeled in order to detect the interaction
with the lipid bilayer, cell membrane, or cell. In another type of
assay, the test compound is linked to a reporter molecule or an
iRNA agent (e.g., an iRNA or sRNA described herein), and the
ability of the reporter molecule or iRNA agent to penetrate the
lipid bilayer, cell membrane or cell is evaluated. A two-step assay
can also be performed, wherein a first assay evaluates the ability
of a test compound alone to interact with a lipid bilayer, cell
membrane or cell; and a second assay evaluates the ability of a
construct (e.g., a construct described herein) that includes the
test compound and a reporter or iRNA agent to interact with a lipid
bilayer, cell membrane or cell.
[0753] An amphipathic polymer useful in the compositions described
herein has at least 2, preferably at least 5, more preferably at
least 10, 25, 50, 100, 200, 500, 1000, 2000, 50000 or more subunits
(e.g., amino acids or cyclic subunits). A single amphipathic
polymer can be linked to one or more, e.g., 2, 3, 5, 10 or more
iRNA agents (e.g., iRNA or sRNA agents described herein). In some
embodiments, an amphipathic polymer can contain both amino acid and
cyclic subunits, e.g., aromatic subunits.
[0754] The invention features a composition that includes an iRNA
agent (e.g., an iRNA or sRNA described herein) in association with
an amphipathic molecule. Such compositions may be referred to
herein as "amphipathic iRNA constructs." Such compositions and
constructs are useful in the delivery or targeting of iRNA agents,
e.g., delivery or targeting of iRNA agents to a cell. While not
wanting to be bound by theory, such compositions and constructs can
increase the porosity of, e.g., can penetrate or disrupt, a lipid
(e.g., a lipid bilayer of a cell), e.g., to allow entry of the iRNA
agent into a cell.
[0755] In one aspect, the invention relates to a composition
comprising an iRNA agent (e.g., an iRNA or sRNA agent described
herein) linked to an amphipathic molecule. The iRNA agent and the
amphipathic molecule may be held in continuous contact with one
another by either covalent or noncovalent linkages.
[0756] The amphipathic molecule of the composition or construct is
preferably other than a phospholipid, e.g., other than a micelle,
membrane or membrane fragment.
[0757] The amphipathic molecule of the composition or construct is
preferably a polymer. The polymer may include two or more
amphipathic subunits. One or more hydrophilic groups and one or
more hydrophobic groups may be present on the polymer. The polymer
may have a repeating secondary structure as well as a first face
and a second face. The distribution of the hydrophilic groups and
the hydrophobic groups along the repeating secondary structure can
be such that one face of the polymer is a hydrophilic face and the
other face of the polymer is a hydrophobic face.
[0758] The amphipathic molecule can be a polypeptide, e.g., a
polypeptide comprising an .alpha.-helical conformation as its
secondary structure.
[0759] In one embodiment, the amphipathic polymer includes one or
more subunits containing one or more cyclic moiety (e.g., a cyclic
moiety having one or more hydrophilic groups and/or one or more
hydrophobic groups). In one embodiment, the polymer is a polymer of
cyclic moieties such that the moieties have alternating hydrophobic
and hydrophilic groups. For example, the subunit may contain a
steroid, e.g., cholic acid. In another example, the subunit may
contain an aromatic moiety. The aromatic moiety may be one that can
exhibit atropisomerism, e.g., a
2,2'-bis(substituted)-1-1'-binaphthyl or a
2,2'-bis(substituted)biphenyl. A subunit may include an aromatic
moiety of Formula (M): ##STR183##
[0760] The invention features a composition that includes an iRNA
agent (e.g., an iRNA or sRNA described herein) in association with
an amphipathic molecule. Such compositions may be referred to
herein as "amphipathic iRNA constructs." Such compositions and
constructs are useful in the delivery or targeting of iRNA agents,
e.g., delivery or targeting of iRNA agents to a cell. While not
wanting to be bound by theory, such compositions and constructs can
increase the porosity of, e.g., can penetrate or disrupt, a lipid
(e.g., a lipid bilayer of a cell), e.g., to allow entry of the iRNA
agent into a cell.
[0761] Referring to Formula M, R.sub.1 is C.sub.1-C.sub.100 alkyl
optionally substituted with aryl, alkenyl, alkynyl, alkoxy or halo
and/or optionally inserted with O, S, alkenyl or alkynyl;
C.sub.1-C.sub.100 perfluoroalkyl; or OR.sub.5.
[0762] R.sub.2 is hydroxy; nitro; sulfate; phosphate; phosphate
ester; sulfonic acid; OR.sup.6; or C.sub.1-C.sub.100 alkyl
optionally substituted with hydroxy, halo, nitro, aryl or alkyl
sulfinyl, aryl or alkyl sulfonyl, sulfate, sulfonic acid,
phosphate, phosphate ester, substituted or unsubstituted aryl,
carboxyl, carboxylate, amino carbonyl, or alkoxycarbonyl, and/or
optionally inserted with O, NH, S, S(O), SO.sub.2, alkenyl, or
alkynyl.
[0763] R.sub.3 is hydrogen, or when taken together with R.sup.4
forms a fused phenyl ring.
[0764] R.sup.4 is hydrogen, or when taken together with R.sub.3
forms a fused phenyl ring.
[0765] R.sub.5 is C.sub.1-C.sub.100 alkyl optionally substituted
with aryl, alkenyl, alkynyl, alkoxy or halo and/or optionally
inserted with O, S, alkenyl or alkynyl; or C.sub.1-C.sub.100
perfluoroalkyl; and R is C.sub.1-C.sub.100 alkyl optionally
substituted with hydroxy, halo, nitro, aryl or alkyl sulfinyl, aryl
or alkyl sulfonyl, sulfate, sulfonic acid, phosphate, phosphate
ester, substituted or unsubstituted aryl, carboxyl, carboxylate,
amino carbonyl, or alkoxycarbonyl, and/or optionally inserted with
O, NH, S, S(O), SO.sub.2, alkenyl, or alkynyl.
[0766] An iRNA agent can have a ZXY structure, such as is described
in co-owned PCT Application No. PCT/US2004/07070 filed on Mar. 8,
2004.
[0767] The sense and antisense sequences of an iRNA agent can be
palindromic. Exemplary features of palindromic iRNA agents are
described in co-owned PCT Application No.PCT/US2004/07070 filed on
Mar. 8, 2004.
[0768] In another embodiment, the iRNA agent can be complexed to a
delivery agent that features a modular complex. The complex can
include a carrier agent linked to one or more of (preferably two or
more, more preferably all three of): (a) a condensing agent (e.g.,
an agent capable of attracting, e.g., binding, a nucleic acid,
e.g., through ionic or electrostatic interactions); (b) a fusogenic
agent (e.g., an agent capable of fusing and/or being transported
through a cell membrane); and (c) a targeting group, e.g., a cell
or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or
protein, e.g., an antibody, that binds to a specified cell type.
iRNA agents complexed to a delivery agent are described in co-owned
PCT Application No. PCT/US2004/07070 filed on Mar. 8, 2004.
[0769] An iRNA agent can have non-canonical pairings, such as
between the sense and antisense sequences of the iRNA duplex.
Exemplary features of non-canonical iRNA agents are described in
co-owned PCT Application No. PCT/US2004/07070 filed on Mar. 8,
2004.
[0770] Increasing Cellular Uptake of dsRNAs
[0771] A method of the invention that can include the
administration of an iRNA agent and a drug that affects the uptake
of the iRNA agent into the cell. The drug can be administered
before, after, or at the same time that the iRNA agent is
administered. The drug can be covalently linked to the iRNA agent.
The drug can have a transient effect on the cell.
[0772] The drug can increase the uptake of the iRNA agent into the
cell, for example, by disrupting the cell's cytoskeleton, e.g., by
disrupting the cell's microtubules, microfilaments, and/or
intermediate filaments. The drug can be, for example, taxon,
vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide,
latrunculin A, phalloidin, swinholide A, indanocine, or
myoservin.
[0773] iRNA Conjugates
[0774] An iRNA agent conjugated to lipophilic agent for enhanced
uptake into a neural cell can be coupled, e.g., covalently coupled,
to a second agent. For example, an iRNA agent used to treat a
particular neurological disorder can be coupled to a second
therapeutic agent, e.g., an agent other than the iRNA agent. The
second therapeutic agent can be one which is directed to the
treatment of the same neurological disorder. For example, in the
case of an iRNA used to treat a HD, the iRNA agent can be coupled
to a second agent which is known to be useful for the treatment of
HD.
[0775] iRNA Production
[0776] An iRNA can be produced, e.g., in bulk, by a variety of
methods. Exemplary methods include: organic synthesis and RNA
cleavage, e.g., in vitro cleavage.
[0777] Organic Synthesis. An iRNA can be made by separately
synthesizing each respective strand of a double-stranded RNA
molecule. The component strands can then be annealed.
[0778] A large bioreactor, e.g., the OligoPilot II from Pharmacia
Biotec AB (Uppsala Sweden), can be used to produce a large amount
of a particular RNA strand for a given iRNA. The OligoPilotII
reactor can efficiently couple a nucleotide using only a 1.5 molar
excess of a phosphoramidite nucleotide. To make an RNA strand,
ribonucleotides amidites are used. Standard cycles of monomer
addition can be used to synthesize the 21 to 23 nucleotide strand
for the iRNA. Typically, the two complementary strands are produced
separately and then annealed, e.g., after release from the solid
support and deprotection.
[0779] Organic synthesis can be used to produce a discrete iRNA
species. The complementary of the species to a particular target
gene can be precisely specified. For example, the species may be
complementary to a region that includes a polymorphism, e.g., a
single nucleotide polymorphism. Further the location of the
polymorphism can be precisely defined. In some embodiments, the
polymorphism is located in an internal region, e.g., at least 4, 5,
7, or 9 nucleotides from one or both of the termini.
[0780] dsRNA Cleavage. iRNAs can also be made by cleaving a larger
ds iRNA. The cleavage can be mediated in vitro or in vivo. For
example, to produce iRNAs by cleavage in vitro, the following
method can be used:
[0781] In vitro transcription. dsRNA is produced by transcribing a
nucleic acid (DNA) segment in both directions. For example, the
HiScribe.TM. RNAi transcription kit (New England Biolabs) provides
a vector and a method for producing a dsRNA for a nucleic acid
segment that is cloned into the vector at a position flanked on
either side by a T7 promoter. Separate templates are generated for
T7 transcription of the two complementary strands for the dsRNA.
The templates are transcribed in vitro by addition of T7 RNA
polymerase and dsRNA is produced. Similar methods using PCR and/or
other RNA polymerases (e.g., T3 or SP6 polymerase) can also be
used. In one embodiment, RNA generated by this method is carefully
purified to remove endotoxins that may contaminate preparations of
the recombinant enzymes.
[0782] In vitro cleavage. dsRNA is cleaved in vitro into iRNAs, for
example, using a Dicer or comparable RNAse III-based activity. For
example, the dsRNA can be incubated in an in vitro extract from
Drosophila or using purified components, e.g. a purified RNAse or
RISC complex (RNA-induced silencing complex ). See, e.g., Ketting
et al. Genes Dev Oct. 15, 2001;15(20):2654-9. and Hammond Science
Aug. 10, 2001;293(5532):1146-50.
[0783] dsRNA cleavage generally produces a plurality of iRNA
species, each being a particular 21 to 23 nt fragment of a source
dsRNA molecule. For example, iRNAs that include sequences
complementary to overlapping regions and adjacent regions of a
source dsRNA molecule may be present.
[0784] Regardless of the method of synthesis, the iRNA preparation
can be prepared in a solution (e.g., an aqueous and/or organic
solution) that is appropriate for formulation. For example, the
iRNA preparation can be precipitated and redissolved in pure
double-distilled water, and lyophilized. The dried iRNA can then be
resuspended in a solution appropriate for the intended formulation
process.
[0785] Synthesis of modified and nucleotide surrogate iRNA agents
is discussed below.
[0786] Formulation
[0787] The iRNA agents described herein can be formulated for
administration to a subject.
[0788] For ease of exposition, the formulations, compositions, and
methods in this section are discussed largely with regard to
unmodified iRNA agents. It should be understood, however, that
these formulations, compositions, and methods can be practiced with
other iRNA agents, e.g., modified iRNA agents, and such practice is
within the invention.
[0789] A formulated iRNA composition can assume a variety of
states. In some examples, the composition is at least partially
crystalline, uniformly crystalline, and/or anhydrous (e.g., less
than 80, 50, 30, 20, or 10% water). In another example, the iRNA is
in an aqueous phase, e.g., in a solution that includes water.
[0790] The aqueous phase or the crystalline compositions can, e.g.,
be incorporated into a delivery vehicle, e.g., a liposome
(particularly for the aqueous phase) or a particle (e.g., a
microparticle as can be appropriate for a crystalline composition).
Generally, the iRNA composition is formulated in a manner that is
compatible with the intended method of administration.
[0791] In particular embodiments, the composition is prepared by at
least one of the following methods: spray drying, lyophilization,
vacuum drying, evaporation, fluid bed drying, or a combination of
these techniques; or sonication with a lipid, freeze-drying,
condensation and other self-assembly.
[0792] A iRNA preparation can be formulated in combination with
another agent, e.g., another therapeutic agent or an agent that
stabilizes a iRNA, e.g., a protein that complexes with iRNA to form
an iRNP. Still other agents include chelators, e.g., EDTA (e.g., to
remove divalent cations such as Mg.sup.2+), salts, RNAse inhibitors
(e.g., a broad specificity RNAse inhibitor such as RNAsin) and so
forth.
[0793] In one embodiment, the iRNA preparation includes another
iRNA agent, e.g., a second iRNA that can mediated RNAi with respect
to a second gene, or with respect to the same gene. Still other
preparation can include at least three, five, ten, twenty, fifty,
or a hundred or more different iRNA species. Such iRNAs can
mediated RNAi with respect to a similar number of different
genes.
[0794] In one embodiment, the iRNA preparation includes at least a
second therapeutic agent (e.g., an agent other than an RNA or a
DNA). For example, a iRNA composition for the treatment of a
neurological disease, e.g., neurodegenerative disease, such as PD,
might include a known PD therapeutic (e.g., levadopa or
depronil)
[0795] Targeting
[0796] For ease of exposition the formulations, compositions and
methods in this section are discussed largely with regard to
unmodified iRNAs. It should be understood, however, that these
formulations, compositions and methods can be practiced with other
iRNA agents, e.g., modified iRNA agents, and such practice is
within the invention.
[0797] In some embodiments, an iRNA agent, e.g., a double-stranded
iRNA agent, or sRNA agent, (e.g., a precursor, e.g., a larger iRNA
agent which can be processed into a sRNA agent, or a DNA which
encodes an iRNA agent, e.g., a double-stranded iRNA agent, or sRNA
agent, or precursor thereof) is targeted to a particular cell. For
example, a liposome or particle or other structure that includes a
iRNA can also include a targeting moiety that recognizes a specific
molecule on a target cell. The targeting moiety can be a molecule
with a specific affinity for a target cell. Targeting moieties can
include antibodies directed against a protein found on the surface
of a target cell, or the ligand or a receptor-binding portion of a
ligand for a molecule found on the surface of a target cell.
[0798] An antigen, can be used to target an iRNA to a neural cell
in the brain.
[0799] In one embodiment, the targeting moiety is attached to a
liposome. For example, U.S. Pat. No. 6,245,427 describes a method
for targeting a liposome using a protein or peptide. In another
example, a cationic lipid component of the liposome is derivatized
with a targeting moiety. For example, WO 96/37194 describes
converting N-glutaryldioleoylphosphatidyl ethanolamine to a
N-hydroxysuccinimide activated ester. The product was then coupled
to an RGD peptide.
[0800] Treatment Methods and Routes of Delivery
[0801] A composition that includes an iRNA agent targeting a gene
expressed in neural cells, can be delivered to a subject by a
variety of routes. Exemplary routes include intrathecal,
parenchymal (e.g., in the brain), nasal, and ocular delivery. The
composition can also be delivered systemically, e.g., by
intravenous, subcutaneous or intramuscular injection, which is
particularly useful for delivery of the iRNA agents to peripheral
neurons. A preferred route of delivery is directly to the brain,
e.g., into the ventricles or the hypothalamus of the brain, or into
the lateral or dorsal areas of the brain. The iRNA agents for
neural cell delivery can be incorporated into pharmaceutical
compositions suitable for administration. For example, compositions
can include one or more species of an iRNA agent and a
pharmaceutically acceptable carrier. As used herein the language
"pharmaceutically acceptable carrier" is intended to include any
and all solvents, dispersion media, coatings, antibacterial and
antifungal agents, isotonic and absorption delaying agents, and the
like, compatible with pharmaceutical administration. A
pharmaceutically acceptable carrier does not include a transfection
reagent or a reagent to facilitate uptake in a neural cell that is
in addition to the lipophilic moiety conjugated to the iRNA agent
featured in the invention. The use of such media and agents for
pharmaceutically active substances is well known in the art. Except
insofar as any conventional media or agent is incompatible with the
active compound, use thereof in the compositions is contemplated.
Supplementary active compounds can also be incorporated into the
compositions.
[0802] The pharmaceutical compositions of the present invention may
be administered in a number of ways depending upon whether local or
systemic treatment is desired and upon the area to be treated.
Administration may be topical (including ophthalmic, intranasal,
transdermal), oral or parenteral. Parenteral administration
includes intravenous drip, subcutaneous, intraperitoneal or
intramuscular injection, intrathecal, or intraventricular (e.g.,
intracerebroventricular) administration.
[0803] The route of delivery can be dependent on the disorder of
the patient. For example, a subject diagnosed with HD can be
administered an anti-htt iRNA agent conjugated to a lipophilic
agent directly into the brain (e.g., into the globus pallidus or
the corpus striatum of the basal ganglia, and near the medium spiny
neurons of the corpos striatum). A subject diagnosed with multiple
system atrophy can be administered an iRNA agent directly into the
brain, e.g., into the striatum and substantia nigra regions of the
brain, and into the spinal cord. A subject diagnosed with Lewy body
dementia can be administered an iRNA agent directly into the brain,
e.g., directly into the cortex of the brain, and administration can
be diffuse. In addition to an iRNA agent modified for enhanced
delivery to neural cells, a patient can be administered a second
therapy, e.g., a palliative therapy and/or disease-specific
therapy. The secondary therapy can be, for example, symptomatic,
(e.g., for alleviating symptoms), neuroprotective (e.g., for
slowing or halting disease progression), or restorative (e.g., for
reversing the disease process). Preferable, the subject is not
administered an anti-SNCA iRNA.
[0804] For the treatment of HD, for example, symptomatic therapies
can include the drugs haloperidol, carbamazepine, or valproate.
Other therapies can include psychotherapy, physiotherapy, speech
therapy, communicative and memory aids, social support services,
and dietary advice.
[0805] For the treatment of Parkinson's Disease, symptomatic
therapies can include the drugs carbidopa/levodopa, entacapone,
tolcapone, pramipexole, ropinerole, pergolide, bromocriptine,
selegeline, amantadine, and several anticholingergic agents. Deep
brain stimulation surgery as well as stereotactic brain lesioning
may also provide symptomatic relief. Neuroprotective therapies
include, for example, carbidopa/levodopa, selegeline, vitamin E,
amantadine, pramipexole, ropinerole, coenzyme Q10, and GDNF.
Restorative therapies can include, for example, surgical
transplantation of stem cells.
[0806] An iRNA agent conjugated with a lipophilic moiety can be
delivered to neural cells of the brain. Delivery methods that do
not require passage of the composition across the blood-brain
barrier can be utilized. For example, a pharmaceutical composition
containing an iRNA agent can be delivered to the patient by
injection directly into the area containing the disease-affected
cells. For example, the pharmaceutical composition can be delivered
by injection directly into the brain. The injection can be by
stereotactic injection into a particular region of the brain (e.g.,
the substantia nigra, cortex, hippocampus, striatum, or globus
pallidus). The iRNA agent can be delivered into multiple regions of
the central nervous system (e.g., into multiple regions of the
brain, and/or into the spinal cord). The iRNA agent can be
delivered into diffuse regions of the brain (e.g., diffuse delivery
to the cortex of the brain).
[0807] In one embodiment, the iRNA agent can be delivered by way of
a cannula or other delivery device having one end implanted in a
tissue, e.g., the brain, e.g., the substantia nigra, cortex,
hippocampus, striatum or globus pallidus of the brain. The cannula
can be connected to a reservoir of iRNA agent. The flow or delivery
can be mediated by a pump, e.g., an osmotic pump or minipump, such
as an Alzet pump (Durect, Cupertino, Calif.). In one embodiment, a
pump and reservoir are implanted in an area distant from the
tissue, e.g., in the abdomen, and delivery is effected by a conduit
leading from the pump or reservoir to the site of release. Devices
for delivery to the brain are described, for example, in U.S. Pat.
Nos. 6,093,180, and 5,814,014.
[0808] An iRNA agent conjugated to a lipophilic moiety, e.g.,
cholesterol, can be further modified such that it is capable of
traversing the blood brain barrier. For example, the iRNA agent can
be conjugated to a molecule that enables the agent to traverse the
barrier. Such modified iRNA agents can be administered by any
desired method, such as by intraventricular or intramuscular
injection, or by pulmonary delivery, for example.
[0809] The iRNA agent conjugated to a lipophilic moiety for
enhanced uptake into neural cells can be administered ocularly,
such as to treat retinal disorder, e.g., a retinopathy. For
example, the pharmaceutical compositions can be applied to the
surface of the eye or nearby tissue, e.g., the inside of the
eyelid. They can be applied topically, e.g., by spraying, in drops,
as an eyewash, or an ointment. Ointments or droppable liquids may
be delivered by ocular delivery systems known in the art such as
applicators or eye droppers. Such compositions can include
mucomimetics such as hyaluronic acid, chondroitin sulfate,
hydroxypropyl methylcellulose or poly(vinyl alcohol), preservatives
such as sorbic acid, EDTA or benzylchronium chloride, and the usual
quantities of diluents and/or carriers. The pharmaceutical
composition can also be administered to the interior of the eye,
and can be introduced by a needle or other delivery device which
can introduce it to a selected area or structure. The composition
containing the iRNA agent can also be applied via an ocular
patch.
[0810] Administration can be provided by the subject or by another
person, e.g., a another caregiver. A caregiver can be any entity
involved with providing care to the human: for example, a hospital,
hospice, doctor's office, outpatient clinic; a healthcare worker
such as a doctor, nurse, or other practitioner; or a spouse or
guardian, such as a parent. The medication can be provided in
measured doses or in a dispenser which delivers a metered dose.
[0811] The subject can be monitored for reactions to the treatment,
such as edema or hemorrhaging. For example, the patient can be
monitored by MRI, such as daily or weekly following injection, and
at periodic time intervals following injection.
[0812] The subject can also be monitored for an improvement or
stabilization of disease symptoms. Such monitoring can be achieved,
for example, by serial clinical assessments (e.g., using the United
Parkinson's Disease Rating Scale) or functional neuroimaging.
Monitoring can also include serial quantitative measures of
striatal dopaminergic function (e.g., fluorodopa and positron
emission tomography) comparing treated subjects to normative data
collected from untreated subjects. Additional outcome measures can
include survival and survival free of palliative therapy and
nursing home placement. Statistically significant differences in
these measurements and outcomes for treated and untreated subjects
is evidence of the efficacy of the treatment.
[0813] A pharmaceutical composition containing an iRNA agent
conjugated to a lipophilic moiety for enhanced uptake into neural
cells can be administered to any patient diagnosed as having or at
risk for developing a neurological disorder, such as HD. In one
embodiment, the patient is diagnosed as having a neurological
disorder, and the patient is otherwise in general good health. For
example, the patient is not terminally ill, and the patient is
likely to live at least 2, 3, 5, or 10 years or longer following
diagnosis. The patient can be treated immediately following
diagnosis, or treatment can be delayed until the patient is
experiencing more debilitating symptoms, such as motor fluctuations
and dyskinesis in PD patients. In another embodiment, the patient
has not reached an advanced stage of the disease, e.g., the patient
has not reached Hoehn and Yahr stage 5 of PD (Hoehn and Yahr,
Neurology 17:427-442, 1967). In general, an iRNA agent conjugated
to a lipophilic moiety can be administered by any suitable method.
As used herein, topical delivery can refer to the direct
application of an iRNA agent to any surface of the body, including
the eye, a mucous membrane, surfaces of a body cavity, or to any
internal surface. Formulations for topical administration may
include transdermal patches, ointments, lotions, creams, gels,
drops, sprays, and liquids. Conventional pharmaceutical carriers,
aqueous, powder or oily bases, thickeners and the like may be
necessary or desirable. Topical administration can also be used as
a means to selectively deliver the iRNA agent to the epidermis or
dermis of a subject, or to specific strata thereof, or to an
underlying tissue.
[0814] Compositions for intrathecal or intraventricular (e.g.,
intracerebroventricular) administration may include sterile aqueous
solutions which may also contain buffers, diluents and other
suitable additives. Compositions for intrathecal or
intraventricular administration preferably do not include a
transfection reagent or an additional lipophilic moiety besides the
lipophilic moiety attached to the iRNA agent.
[0815] Formulations for parenteral administration may include
sterile aqueous solutions which may also contain buffers, diluents
and other suitable additives. Intraventricular injection may be
facilitated by an intraventricular catheter, for example, attached
to a reservoir. For intravenous use, the total concentration of
solutes should be controlled to render the preparation
isotonic.
[0816] An iRNA agent conjugated to a lipophilic agent for enhanced
uptake into neural cells can be administered to a subject by
pulmonary delivery. Pulmonary delivery compositions can be
delivered by inhalation by the patient of a dispersion so that the
composition, preferably iRNA, within the dispersion can reach the
lung where it can be readily absorbed through the alveolar region
directly into blood circulation. Pulmonary delivery can be
effective both for systemic delivery and for localized delivery to
treat diseases of the lungs. In one embodiment, an iRNA agent
administered by pulmonary delivery has been modified such that it
is capable of traversing the blood brain barrier.
[0817] Pulmonary delivery can be achieved by different approaches,
including the use of nebulized, aerosolized, micellular and dry
powder-based formulations. Delivery can be achieved with liquid
nebulizers, aerosol-based inhalers, and dry powder dispersion
devices. Metered-dose devices are preferred. One of the benefits of
using an atomizer or inhaler is that the potential for
contamination is minimized because the devices are self contained.
Dry powder dispersion devices, for example, deliver drugs that may
be readily formulated as dry powders. An iRNA composition may be
stably stored as lyophilized or spray-dried powders by itself or in
combination with suitable powder carriers. The delivery of a
composition for inhalation can be mediated by a dosing timing
element which can include a timer, a dose counter, time measuring
device, or a time indicator which when incorporated into the device
enables dose tracking, compliance monitoring, and/or dose
triggering to a patient during administration of the aerosol
medicament.
[0818] The term "therapeutically effective amount" is the amount
present in the composition that is needed to provide the desired
level of drug in the subject to be treated to give the anticipated
physiological response.
[0819] The term "physiologically effective amount" is that amount
delivered to a subject to give the desired palliative or curative
effect.
[0820] The term "pharmaceutically acceptable carrier" means that
the carrier can be taken into the lungs with no significant adverse
toxicological effects on the lungs.
[0821] The types of pharmaceutical excipients that are useful as
carrier include stabilizers such as human serum albumin (HSA),
bulking agents such as carbohydrates, amino acids and polypeptides;
pH adjusters or buffers; salts such as sodium chloride; and the
like. These carriers may be in a crystalline or amorphous form or
may be a mixture of the two.
[0822] Bulking agents that are particularly valuable include
compatible carbohydrates, polypeptides, amino acids or combinations
thereof. Suitable carbohydrates include monosaccharides such as
galactose, D-mannose, sorbose, and the like; disaccharides, such as
lactose, trehalose, and the like; cyclodextrins, such as
2-hydroxypropyl-.beta.-cyclodextrin; and polysaccharides, such as
raffinose, maltodextrins, dextrans, and the like; alditols, such as
mannitol, xylitol, and the like. A preferred group of carbohydrates
includes lactose, threhalose, raffinose maltodextrins, and
mannitol. Suitable polypeptides include aspartame. Amino acids
include alanine and glycine, with glycine being preferred.
[0823] Suitable pH adjusters or buffers include organic salts
prepared from organic acids and bases, such as sodium citrate,
sodium ascorbate, and the like; sodium citrate is preferred.
[0824] An iRNA agent conjugated to a lipophilic moiety for enhanced
uptake into neural cells can be administered by oral and nasal
delivery. For example, drugs administered through these membranes
have a rapid onset of action, provide therapeutic plasma levels,
avoid first pass effect of hepatic metabolism, and avoid exposure
of the drug to the hostile gastrointestinal (GI) environment.
Additional advantages include easy access to the membrane sites so
that the drug can be applied, localized and removed easily. In one
embodiment, an iRNA agent administered by oral or nasal delivery
has been modified to be capable of traversing the blood-brain
barrier.
[0825] In one embodiment, unit doses or measured doses of a
composition that include iRNA are dispensed by an implanted device.
The device can include a sensor that monitors a parameter within a
subject. For example, the device can include a pump, such as an
osmotic pump and, optionally, associated electronics.
[0826] An iRNA agent can be packaged in a viral natural capsid or
in a chemically or enzymatically produced artificial capsid or
structure derived therefrom.
[0827] Dosage. An iRNA agent modified for enhance uptake into
neural cells can be administered at a unit dose less than about 1.4
mg per kg of bodyweight, or less than 10, 5, 2, 1, 0.5, 0.1, 0.05,
0.01, 0.005, 0.001, 0.0005, 0.0001, 0.00005 or 0.00001 mg per kg of
bodyweight, and less than 200 nmole of RNA agent (e.g., about
4.4.times.10.sup.16 copies) per kg of bodyweight, or less than
1500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015,
0.0075, 0.0015, 0.00075, 0.00015 nmole of RNA agent per kg of
bodyweight. The unit dose, for example, can be administered by
injection (e.g., intravenous or intramuscular, intrathecally, or
directly into the brain), an inhaled dose, or a topical
application. Particularly preferred dosages are less than 2, 1, or
0.1 mg/kg of body weight.
[0828] Delivery of an iRNA agent directly to an organ (e.g.,
directly to the brain) can be at a dosage on the order of about
0.00001 mg to about 3 mg per organ, or preferably about
0.0001-0.001 mg per organ, about 0.03-3.0 mg per organ, about 0.
1-3.0 mg per eye or about 0.3-3.0 mg per organ.
[0829] The dosage can be an amount effective to treat or prevent a
neurological disease or disorder, e.g., HD.
[0830] In one embodiment, the unit dose is administered less
frequently than once a day, e.g., less than every 2, 4, 8 or 30
days. In another embodiment, the unit dose is not administered with
a frequency (e.g., not a regular frequency). For example, the unit
dose may be administered a single time.
[0831] In one embodiment, the effective dose is administered with
other traditional therapeutic modalities. In one embodiment, the
subject has PD and the modality is a therapeutic agent other than
an iRNA agent, e.g., other than a double-stranded iRNA agent, or
sRNA agent. The therapeutic modality can be, for example, levadopa
or depronil.
[0832] In one embodiment, a subject is administered an initial
dose, and one or more maintenance doses of an iRNA agent, e.g., a
double-stranded iRNA agent, or sRNA agent, (e.g., a precursor,
e.g., a larger iRNA agent which can be processed into an sRNA
agent, or a DNA which encodes an iRNA agent, e.g., a
double-stranded iRNA agent, or sRNA agent, or precursor thereof).
The maintenance dose or doses are generally lower than the initial
dose, e.g., one-half less of the initial dose. A maintenance
regimen can include treating the subject with a dose or doses
ranging from 0.01 .mu.g to 1.4 mg/kg of body weight per day, e.g.,
10, 1, 0.1, 0.01, 0.001, or 0.00001 mg per kg of bodyweight per
day. The maintenance doses are preferably administered no more than
once every 5, 10, or 30 days. Further, the treatment regimen may
last for a period of time which will vary depending upon the nature
of the particular disease, its severity and the overall condition
of the patient. In preferred embodiments the dosage may be
delivered no more than once per day, e.g., no more than once per
24, 36, 48, or more hours, e.g., no more than once every 5 or 8
days. Following treatment, the patient can be monitored for changes
in his condition and for alleviation of the symptoms of the disease
state. The dosage of the compound may either be increased in the
event the patient does not respond significantly to current dosage
levels, or the dose may be decreased if an alleviation of the
symptoms of the disease state is observed, if the disease state has
been ablated, or if undesired side-effects are observed.
[0833] The effective dose can be administered in a single dose or
in two or more doses, as desired or considered appropriate under
the specific circumstances. If desired to facilitate repeated or
frequent infusions, implantation of a delivery device, e.g., a
pump, semi-permanent stent (e.g., intravenous, intraperitoneal,
intracisternal or intracapsular), or reservoir may be
advisable.
[0834] In one embodiment, the iRNA agent pharmaceutical composition
includes a plurality of iRNA agent species. In another embodiment,
the iRNA agent species has sequences that are non-overlapping and
non-adjacent to another species with respect to a naturally
occurring target sequence. In another embodiment, the plurality of
iRNA agent species is specific for different naturally occurring
target genes. In another embodiment, the iRNA agent is allele
specific.
[0835] Following successful treatment, it may be desirable to have
the patient undergo maintenance therapy to prevent the recurrence
of the disease state, wherein the compound of the invention is
administered in maintenance doses, ranging from 0.01 .mu.g to 100
.mu.g per kg of body weight (see U.S. Pat. No. 6,107,094).
[0836] The concentration of the iRNA agent composition is an amount
sufficient to be effective in treating or preventing a disorder or
to regulate a physiological condition in humans. The concentration
or amount of iRNA agent administered will depend on the parameters
determined for the agent and the method of administration, e.g.
nasal, buccal, or pulmonary. For example, nasal formulations tend
to require much lower concentrations of some ingredients in order
to avoid irritation or burning of the nasal passages. It is
sometimes desirable to dilute an oral formulation up to 10-100
times in order to provide a suitable nasal formulation.
[0837] Certain factors may influence the dosage required to
effectively treat a subject, including but not limited to the
severity of the disease or disorder, previous treatments, the
general health and/or age of the subject, and other diseases
present. Moreover, treatment of a subject with a therapeutically
effective amount of an iRNA agent, e.g., a double-stranded iRNA
agent, or sRNA agent (e.g., a precursor, e.g., a larger iRNA agent
which can be processed into a sRNA agent, or a DNA which encodes an
iRNA agent, e.g., a double-stranded iRNA agent, or sRNA agent, or
precursor thereof) can include a single treatment or, preferably,
can include a series of treatments. It will also be appreciated
that the effective dosage of an iRNA agent such as an sRNA agent
used for treatment may increase or decrease over the course of a
particular treatment. Changes in dosage may result and become
apparent from the results of diagnostic assays as described herein.
For example, the subject can be monitored after administering an
iRNA agent composition. Based on information from the monitoring,
an additional amount of the iRNA agent composition can be
administered.
[0838] Dosing is dependent on severity and responsiveness of the
disease condition to be treated, with the course of treatment
lasting from several days to several months, or until a cure is
effected or a diminution of disease state is achieved. Optimal
dosing schedules can be calculated from measurements of drug
accumulation in the body of the patient. Persons of ordinary skill
can easily determine optimum dosages, dosing methodologies and
repetition rates. Optimum dosages may vary depending on the
relative potency of individual compounds, and can generally be
estimated based on EC50s found to be effective in in vitro and in
vivo animal models. In some embodiments, the animal models include
transgenic animals that express a human gene, e.g., a gene that
produces a target RNA, e.g., an RNA expressed in a neural cell. The
transgenic animal can be deficient for the corresponding endogenous
RNA. In another embodiment, the composition for testing includes an
iRNA agent that is complementary, at least in an internal region,
to a sequence that is conserved between the target RNA in the
animal model and the target RNA in a human.
[0839] Kits. In certain other aspects, the invention provides kits
that include a suitable container containing a pharmaceutical
formulation of an iRNA agent, e.g., a double-stranded iRNA agent,
or sRNA agent, (e.g., a precursor, e.g., a larger iRNA agent which
can be processed into a sRNA agent, or a DNA which encodes an iRNA
agent, e.g., a double-stranded iRNA agent, or sRNA agent, or
precursor thereof). In certain embodiments the individual
components of the pharmaceutical formulation may be provided in one
container. Alternatively, it may be desirable to provide the
components of the pharmaceutical formulation separately in two or
more containers, e.g., one container for an iRNA agent preparation,
and at least another for a carrier compound. The kit may be
packaged in a number of different configurations such as one or
more containers in a single box. The different components can be
combined, e.g., according to instructions provided with the kit.
The components can be combined according to a method described
herein, e.g., to prepare and administer a pharmaceutical
composition. The kit can also include a delivery device.
[0840] The invention is further illustrated by the following
examples, which should not be construed as further limiting.
EXAMPLES
Example 1
Cholesterol Conjugated siRNAs are Taken up into Primary Striatal
Neurons
[0841] Primary striatal neurons were isolated from mouse fetal
tissue at day 15.5 gestation. The isolated cells were cultured in
NeuroBasal.TM. medium (Gibco) for 7 days. An siRNA conjugated with
cholesterol and Cy3 (called Chol-siRNA-Cy3) targeting against GFP,
in a solution of PBS, was introduced to a culture of primary
striatal neurons isolated from mouse (final concentration=50 nM).
The cells were incubated with chol-siRNA-Cy3 for 6-12 hours and
then the medium was changed, washing away any chol-siRNA-Cy3 that
was not taken up into the cell. No transfection agents were used.
Nearly all primary neurons were observed to contain the
chol-siRNA-Cy3 in the cytoplasm of neurons. An siRNA-Cy3 (without a
cholesterol conjugate) was found to be taken up by primary neurons
to a much lesser extent then the cholesterol-conjugated siRNA when
the cells were cultured under the same conditions.
Example 2
Cholesterol-Conjugated siRNAs were Administered to Neurons in
vivo.
[0842] We administered chol-siRNA-Cy3 against GFP in mouse striatum
by a single direct injection and by Alzet.RTM. pump (DURECT
Corporation, Cupertino, Calif.) over 7 days. The direct injection
contained 50 .mu.M in 1 .mu.l solution with PBS, and the Alzet pump
delivered 50 .mu.M in 1 .mu.l per day. We compared the chol-siRNA
with high dose unconjugated siRNA-Cy3, at the same doses. By
fluorescence microscopy, we found that both sets of siRNAs entered
many brain cells. The chol-siRNA-Cy3 had a higher frequency of cell
entry than the unconjugated siRNA in administration with Alzet pump
by observation. Direct injection of chol-siRNA-Cy3 showed presence
of Cy3 siRNA one week later, whereas direct injection of
unconjugated siRNA showed very little Cy3 labeling after one
week.
[0843] In separate experiments, 2 .mu.l of 50 .mu.M chol-siRNA-Cy3
in PBS was injected into the striatum of mice. Three days later,
mice were perfused and striatal sections prepared for
immunofluorescence (FITC) for DARRP 32. DARRP 32 serves as a marker
for medium spiny neurons, a neuronal type affected in Huntington's
disease. The data indicated that the chol-siRNA at the volume
tested spreads throughout the extent of the striatum and enters
medium size spiny neurons. The sections were studied under 60X oil,
to ensure that the Cy3 labeling resides inside the neurons, not on
the surface. Sections at each of the three striatal regions were
counted (1113 cells in all). 98% of the cells in each striatal
region had colocalization of FITC (DARRP 32) and Cy3 (chol-siRNA).
These pilot studies provide support that modified siRNA can be
delivered to brain, to enter neurons.
[0844] To investigate whether cholesterol conjugated siRNAs were
toxic to the striatal cells in vivo, the cells were stained with
fluorojade, a marker for apoptotic cell death. Fluorojade staining
was observed along the injection site, but not in the surrounding
cells. In a positive control experiment, fluorojade staining was
observed in striatal cells in vivo following injection of the NMDA
receptor agonist quinolinic acid, which is known to induce neuronal
cell death.
[0845] These experiments indicated that chol-siRNA is not toxic to
striatal cells in vivo.
Example 3
GFP Expression was Inhibited in PC12 Cells Stably Transfected with
GFP-htt
[0846] We tested whether chol-siRNA targeting GFP could knockdown
GFP expression, and also examined the duration of this RNAi
activity We added chol-siRNA versus GFP (50 nM final concentration)
to PC12 cells stably transfected with GFP fused to human mut-htt
carrying about a 100 Q expansion (Qin et al., Hum Mol Genet.
12:3231-44, 2003, Epub Oct. 21, 2003). Treatment with pronasterone
increases expression of a because of promoter GFP-htt protein, but
significantly reduces GFP fluorescence in the stably transfected
cells. A control pronasterone-treated PC12 culture was treated with
chol-siRNA in PBS (final concentration=100 nM) targeting
luciferase; and a test pronasterone-treated PC12 cell culture was
treated with chol-siRNA (final concentration 100 nM) targeting GFP.
No transfection reagents were used. The chol-siRNA was kept in the
culture medium for 6-12 hours and then the medium was refreshed,
therefore washing out an chol-siRNA not incorporated into the
cells. Images were taken one week later to assess the effect on
cell fluorescence. GFP fluorescence was decreased to a much greater
extent in cells treated with chol-siRNA targeting GFP, than in
cells treated with chol-siRNA targeting luciferase.
Example 4
siRNA Protects Against Huntingtin-Induced Neuronal Dysfunction
[0847] With evidence that chol-siRNA can enter brain cells and
knockdown target gene expression (see above), we tested chol-siRNA
against human mut-htt carrying about a 100-Q expansion expression
in vivo. In a mouse model of Huntington's Disease, introduction of
lentivirus-mut-htt (1 .mu.l, 1.times.10.sup.10 particles) leads to
clasping 5 days later. We injected lentivirus-mut-htt into the
cortex and striatum of 4 mice. In two of the mice, we co-injected
chol-siRNA against htt mRNA. In one mouse, we co-injected
chol-siRNA targeting luciferase, and in the other mouse, we
co-injected vehicle. The two mice that received chol-siRNA against
htt showed no clasping at 7 days. The control mice clasped, as
expected. The results are shown in Table 8. TABLE-US-00013 TABLE 8
Study Testing Cholesterol siRNA in Vivo Animal Treatment 1 2 3 4
Lentivirus-mut-htt + + + + Chol-siRNA targeting mut-htt + + - -
Chol-siRNA targeting GFP - - + - No siRNA - - - + Behavior:
Clasping No No Yes Yes
Example 5
Hallmarks of Huntington's Disease are Found in Mice Treated with
Lentivirus-mut-htt
[0848] Mice continue to have clasping for seven months after
lentivirus-mut-htt administration into a unilateral striatum. In
other respects, the mice grew and moved as expected. Furthermore,
mice treated with lentivirus-WT-htt (CAG repeat of 18) show no
evidence of clasping over the course of the experimental protocol,
which was to three weeks post-injection. The images in FIGS. 1A-1D
are taken from the striatum of a mouse seven months after injection
with lentivirus-mut-htt. The tissue was treated with an antiserum
against the N-terminus of huntingtin (Ab1) for immunohistochemical
analysis. Notable phenotypes include nuclear inclusions
(arrowheads) and dystrophic neurites (arrows) similar to those
found in adult-onset human HD (see DiFiglia et al, Science
277:1990-3, 1997). Use of the lentivirus model is convenient for
use with co-injection of siRNA. Coinjection allows for reduced
discrepancies in time and space that may complicate delivery of
siRNA in transgenic mouse models.
Example 6
A Single Intrastriatal Administration of siRNA Targeting Huntingtin
Reduces Neuropathology in a Mouse Model of Huntington's Disease
[0849] The effect of an siRNA targeting huntingtin was evaluated in
an AAV mouse model of Huntington's disease. In this mouse model of
Huntington's disease, a portion of the mutant human huntingtin gene
with a polyglutamine expansion comprising 100 CAG repeats is
introduced into the brain by viral (AAV) delivery. When a single
intrastriatal injection of 0.5 nmoles (7.5 ug) siRNA was
administered, the cholesterol-conjugated siRNA, AL-DP-1799 (E1-4),
targeting huntingtin reduced inclusion size in striatum (FIGS. 2,
3) and cortex (FIG. 3A), and reduced neuropil aggregates in
striatum (FIG. 3B), compared with a non-physiological siRNA,
AL-DP-1956, targeting luciferase. In addition, the number of
huntingtin-immunoreactive cells in the striatum was significantly
increased, consistent with an increase in survival of striatal
neurons after a single intrastriatal injection of AL-DP-1799 (FIG.
3).
[0850] Adult female SJL/B6 mice, 6 months of age, received an
injection of 3 uL of 1.1.times.10.sup.13 titer units of
AAV-htt-100Q, together with 0.5 nmoles (7.5 ug) siRNA. AAV-htt-100Q
comprised AAV serotype 8, for delivery of the portion of the human
huntingtin gene encoding amino acids 1-400, with a 100 CAG repeat
(100Q). The siRNA tested was either a cholesterol-conjugated siRNA
targeting huntingtin (AL-DP-1799, below) or an irrelevant
cholesterol-conjugated siRNA targeting luciferase (AL-DP-1956). For
each mouse, 0.5 uL of 1 mM siRNA was injected unilaterally into the
striatum at a rate of 100 nL/minute. The injection coordinates were
AP+1.0 mm, Lateral+1.8 mm, Ventral 2.3 mm. For immunohistochemical
analysis, mice were sacrificed 14 days after siRNA injection, and
perfused intracardially with 4% paraformaldehyde. Brains were
removed and vibratome frozen sections of 30 or 40 .mu.m thickness
were cut. The primary antibody against huntingtin, Ab1, that
recognizes both human and mouse huntingtin, was made as described
previously (DiFiglia M, Sapp E, Chase K, Schwarz C, Meloni A, Young
C, Martin E, Vonsattel J-P, Carraway R, Reeves S A, Boyce F M,
Carraway R, and Aronin N: Huntingtin is a cytoplasmic protein
associated with vesicles in human and rat brain neurons. Neuron
14:1075-1081, 1995; Aronin N, Chase K, Young C, Sapp E, Schwarcz C,
Matta N, Kornreich R, Sheth A, Landwehrmeyer B, Bird E, Vonsattel
J-P, Smith T, Carraway R, Boyce F M, Beal M F, Young A B, Penney J
B, and DiFiglia M: CAG expansion affects the expression of mutant
huntingtin in the Huntington's disease brain. Neuron 15:1193-1201,
1995). Immunoabsorbed antiserum Ab1 was used at a concentration of
1 .mu.g/ml. The secondary antibody was a goat anti-rabbit antibody
(Vector Laboratories, California) and used at 1:10,000. For DAB
histological processing, a kit was used (Pierce Laboratory,
Illinois). TABLE-US-00014 Sequence of Cholesterol-Conjugated dsRNA
AL-DP-1799 AL-DP- Number sense: 5'-3' antisense: 5'-3' AL-DP-
CsCCUGGAAAAGCUGAUGACGsGsChol UsUCAUCAGCUUUUCCAGGGsUsC 1799 Note:
`s` represents a phosphorothioate bound between neighboring bases,
`Chol` represents cholesterol-conjugate
[0851] Mice that received AAV-htt-100Q exhibited
huntingtin-immunoreactivity in the ipsilateral striatum and cortex,
whether they received cholesterol-conjugated siRNA targeting
luciferase (AL-DP-1956; FIG. 2A) or cholesterol-conjugated siRNA
targeting huntingtin (AL-DP-1799; FIG. 2D). However, the appearance
of intracellular staining for huntingtin in mice that received
AAV-htt-100Q was clearly different, in that the size of the
inclusions appeared smaller in the ipsilateral striatum of mice
treated with AL-DP-1799 (cholesterol-conjugated siRNA targeting
huntingtin, FIG. 2F) than in the ipsilateral striatum of mice
treated with AL-DP-1956 (cholesterol-conjugated siRNA targeting
luciferase, FIG. 2C). The contralateral striatum exhibited faint
staining for huntingtin in mice that received AAV-htt-100Q, whether
they received cholesterol-conjugated siRNA targeting luciferase
(AL-DP-1956; FIG. 2B) or cholesterol-conjugated siRNA targeting
huntingtin (AL-DP-1799; FIG. 2E). When ipsilateral striatal and
cortical inclusion sizes were quantified (70-100 inclusions
measured per mouse) in mice treated with AL-DP-1956 (n=8) and mice
treated with AL-DP-1799 (n=8), inclusion size was significantly
(p<0.02) reduced in mice treated with AL-DP-1799 compared to
mice treated with AL-DP-1956. Median inclusion sizes for
ipsilateral cortex and striatum are shown as scatter plots in FIG.
3A. Therefore, a single intrastriatal injection of
cholesterol-conjugated siRNA targeting huntingtin results in
reduced striatal and cortical pathology, and represents a novel
approach to providing effective treatment of Huntington's
disease.
[0852] Moreover, when the same mice were evaluated for neuropil
aggregates in the striatum (FIG. 3B), mice that received
AAV-htt-100Q and AL-DP-1799 (cholesterol-conjugated siRNA targeting
huntingtin) exhibited an approximately two-thirds reduction
(p<0.02) in the number of neuropil aggregates compared with mice
that received AAV-htt-100Q and AL-DP-1956 (cholesterol-conjugated
siRNA targeting luciferase). Total neuropil aggregates were counted
in a 2500 um.sup.2 area, using 6 sections per mouse. These data
provide additional evidence that a single intrastriatal injection
of cholesterol-conjugated siRNA targeting huntingtin results in
reduced neuropathology, and represents a novel approach to
providing effective treatment of Huntington's disease.
[0853] The number of huntingtin-immunoreactive cells was scored in
cortex and striatum of 8 mice that received AAV-htt-100Q and
AL-DP-1799 (cholesterol-conjugated siRNA targeting huntingtin,
`Htt`) and 8 mice that received AAV-htt-100Q and AL-DP-1956
(cholesterol-conjugated siRNA targeting luciferase, `luc`). In the
striatum (FIG. 4), a statistically significant increase
(p<0.001) was found in the mean number of total
huntingtin-immunoreactive cells per 2500 um.sup.2 area in mice
treated with AL-DP-1799 (cholesterol-conjugated siRNA targeting
huntingtin) compared to mice treated with AL-DP-1956
(cholesterol-conjugated siRNA targeting luciferase). In the cortex
(FIG. 4), there was a trend towards an increased mean number of
total huntingtin-immunoreactive cells per 2500 um.sup.2 area in
mice treated with AL-DP-1799 (cholesterol-conjugated siRNA
targeting huntingtin) compared to mice treated with AL-DP-1956
(cholesterol-conjugated siRNA targeting luciferase). When cells
with nuclear inclusions and cytoplasmic aggregates (`+inc/+cyto`)
were scored separately from cells with nuclear inclusions and no
cytoplasmic aggregates (`+inc/-cyto`), there was a statistically
significant increase (p<0.001) in the number of cells with
nuclear inclusions and cytoplasmic aggregates in striatum. One
explanation for this result is that mice that received AAV-htt-100Q
and were treated with AL-DP-1799 (cholesterol-conjugated siRNA
targeting huntingtin) have more surviving striatal neurons. These
data imply that a single intrastriatal injection of
cholesterol-conjugated siRNA targeting huntingtin results in
protection of striatal neurons, and represents a novel approach to
providing effective treatment of Huntington's disease.
Example 7
A Single Intrastriatal Administration of siRNA Targeting Huntingtin
Reduces Abnormal Clasping Behavior in a Mouse Model of Huntington's
Disease
[0854] The effect of the siRNA targeting huntingtin was further
evaluated in the AAV mouse model of Huntington's disease by
assessing clasping behavior, a stereotypical and abnormal behavior
characteristic of animal models of Huntington's disease. In the
same mice where pathology was subsequently evaluated, clasping was
scored as a binary yes/no daily assessment over a period of 14
days, and then the percentage of days that clasping was observed
was determined for each mouse. The average percentage of clasping
days was reduced by approximately half (p<0.01) in mice treated
with the cholesterol-conjugated siRNA targeting huntingtin,
AL-DP-1799 (`Htt`, FIG. 5), as compared to mice that received a
non-physiological siRNA targeting luciferase, AL-DP-1956 (`Luc`,
FIG. 5). These data demonstrate that a single intrastriatal
injection of cholesterol-conjugated siRNA targeting huntingtin
results in functional improvement, and therefore, represents a
novel approach to providing effective treatment of Huntington's
disease.
Other Embodiments
[0855] A number of embodiments of the invention have been
described. Nevertheless, it will be understood that various
modifications may be made without departing from the spirit and
scope of the invention. Accordingly, other embodiments are within
the scope of the following claims.
Sequence CWU 1
1
54 1 21 RNA Artificial Sequence Synthetically generated
oligonucleotide misc_feature 1, 19 n = cytidine phosphorothioate
linkage misc_feature 20 n = guanine phosphorothioate linkage 1
nccuggaaaa gcugaugann g 21 2 21 RNA Artificial Sequence
Synthetically generated oligonucleotide misc_feature 1, 20 n =
uridine phosphorothioate linkage misc_feature 19 n = guanine
phosphorothioate linkage 2 nucaucagcu uuuccaggnn c 21 3 21 RNA
Artificial Sequence Synthetically generated oligonucleotide
misc_feature 1, 2, 19 n = cytidine phosphorothioate linkage
misc_feature 18 n = adenine phosphorothioate linkage misc_feature
20 n = guanine phosphorothioate linkage 3 nncuggaaaa gcugaugnnn g
21 4 21 RNA Artificial Sequence Synthetically generated
oligonucleotide misc_feature 1, 2, 20 n = uridine phosphorothioate
linkage misc_feature 18, 19 n = guanine phosphorothioate linkage 4
nncaucagcu uuuccagnnn c 21 5 21 RNA Artificial Sequence
Synthetically generated oligonucleotide misc_feature 1 n = uridine
phosphorothioate linkage misc_feature 19, 20 n = adenine
phosphorothioate linkage 5 ngugcugacu cugaggaann g 21 6 21 RNA
Artificial Sequence Synthetically generated oligonucleotide
misc_feature 1 n = guanine phosphorothioate linkage misc_feature 19
n = adenine phosphorothioate linkage misc_feature 20 n = uridine
phosphorothioate linkage 6 nuuccucaga gucagcacnn c 21 7 21 RNA
Artificial Sequence Synthetically generated oligonucleotide
misc_feature 1 n = uridine phosphorothioate linkage misc_feature 2
n = guanine phosphorothioate linkage misc_feature 18, 19, 20 n =
adenine phosphorothioate linkage 7 nnugcugacu cugaggannn g 21 8 21
RNA Artificial Sequence Synthetically generated oligonucleotide
misc_feature 1 n = guanine phosphorothioate linkage misc_feature 2
n = uridine phosphorothioate linkage misc_feature 18 n = cytidine
phosphorothioate linkage 8 nnuccucaga gucagcanau c 21 9 21 RNA
Artificial Sequence Synthetically generated oligonucleotide
misc_feature 1, 19 n = cytidine phosphorothioate linkage
modified_base 4, 13, 16 / uridine 2'O-Methyl sugar modification
misc_feature 20 n = guanine phosphorothioate linkage 9 nccuggaaaa
gcugaugann g 21 10 21 RNA Artificial Sequence Synthetically
generated oligonucleotide modified_base 1 / uridine 2'O-Methyl
sugar modification phosphorothioate linkage modified_base 3, 6, 12
/ uridine 2'O-Methyl sugar modification misc_feature 19, 20 n =
adenine phosphorothioate linkage 10 ugugcugacu cugaggaann g 21 11
21 RNA Artificial Sequence Synthetically generated oligonucleotide
11 cccucaucca cugugugccc u 21 12 21 RNA Artificial Sequence
Synthetically generated oligonucleotide 12 ugcacacagu ggaugaggga g
21 13 21 RNA Artificial Sequence Synthetically generated
oligonucleotide 13 ccacaugaag cagcacgacu u 21 14 23 RNA Artificial
Sequence Synthetically generated oligonucleotide modified_base 21 /
2'O-Methyl sugar guanine modified_base 22 / 2'O-Methyl sugar
uridine 14 aagucgugcu gcuucaugug guc 23 15 21 RNA Artificial
Sequence Synthetically generated oligonucleotide misc_feature 1, 19
n = cytidine phosphorothioate linkage misc_feature 20, 21 n =
guanine phosphorothioate linkage; cholesterol conjugate at position
21 15 nccuggaaaa gcugaugann n 21 16 21 RNA Artificial Sequence
Synthetically generated oligonucleotide 1 / Cy3 conjugate at
position 1 misc_feature 19 n = cytidine phosphorothioate linkage
misc_feature 20, 21 n = guanine phosphorothioate linkage;
cholesterol conjugate at position 21 16 cccuggaaaa gcugaugann n 21
17 21 RNA Artificial Sequence Synthetically generated
oligonucleotide misc_feature 1 n = cytidine phosphorothioate
linkage misc_feature 20, 21 n = guanine phosphorothioate linkage;
cholesterol conjugate at position 21 17 nccuggaaaa gcugaugacn n 21
18 21 RNA Artificial Sequence Synthetically generated
oligonucleotide misc_feature 1, 20 n = cytidine phosphorothioate
linkage misc_feature 21 n = uridine phosphorothioate linkage,
cholesterol conjugate 18 nccucaucca cugugugccn n 21 19 21 RNA
Artificial Sequence Synthetically generated oligonucleotide
misc_feature 1, 20 n = cytidine phosphorothioate linkage; Cy3
conjugate at position 1 misc_feature 21 n = uridine
phosphorothioate linkage, cholesterol conjugate 19 nccucaucca
cugugugccn n 21 20 21 RNA Artificial Sequence Synthetically
generated oligonucleotide 21 / cholesterol conjugate 20 ccacaugaag
cagcacgacu u 21 21 21 RNA Artificial Sequence Synthetically
generated oligonucleotide 1 /Cy3 conjugate at position 1
misc_feature 19 n = cytidine phosphorothioate linkage misc_feature
20 n = guanine phosphorothioate linkage; cholesterol conjugate at
position 21 21 cccuggaaaa gcugaugann g 21 22 23 RNA Artificial
Sequence Synthetically generated oligonucleotide 1 /Cy3 conjugate
at position 1 modified_base 21 / guanine 2'O-Methyl sugar
modification modified_base 22 / uridine 2'O-Methyl sugar
modification 22 aagucgugcu gcuucaugug guc 23 23 21 RNA Artificial
Sequence Synthetically generated oligonucleotide 1 Cy3 conjugate at
position 1 misc_feature 19 n = cytidine phosphorothioate linkage
misc_feature 20, 21 n = guanine phosphorothioate linkage;
cholesterol conjugate at position 21 23 cccuggaaaa gcugaugann n 21
24 21 RNA Artificial Sequence Synthetically generated
oligonucleotide 1 /Cy3 conjugate at position 1 misc_feature 20, 21
n = guanine phosphorothioate linkage; cholesterol conjugate at
position 21 24 cccuggaaaa gcugaugacn n 21 25 21 RNA Artificial
Sequence Synthetically generated oligonucleotide misc_feature 1 n =
uridine phosphorothioate linkage misc_feature 20 n = adenine
phosphorothioate linkage misc_feature 21 n = guanine
phosphorothioate linkage; Cy3 conjugate at position 21 25
ngcacacagu ggaugagggn n 21 26 21 RNA Artificial Sequence
Synthetically generated oligonucleotide misc_feature 1, 20 n =
uridine phosphorothioate linkage misc_feature 21 n = cytidine
phosphorothioate linkage; Cy3 conjugate at position 21 26
nucaucagcu uuuccagggn n 21 27 21 RNA Artificial Sequence
Synthetically generated oligonucleotide 27 cccuggaaaa gcugaugacg g
21 28 21 RNA Artificial Sequence Synthetically generated
oligonucleotide 28 uucaucagcu uuuccagggu c 21 29 21 RNA Artificial
Sequence Synthetically generated oligonucleotide 29 cccucaucca
cugugugccc u 21 30 21 RNA Artificial Sequence Synthetically
generated oligonucleotide 30 ugcacacagu ggaugaggga g 21 31 16 PRT
Artificial Sequence Exemplary Cell Permeation Peptide 31 Arg Gln
Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys 1 5 10 15
32 14 PRT Artificial Sequence Exemplary Cell Permeation Peptide 32
Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro Pro Gln Cys 1 5 10 33
27 PRT Artificial Sequence Exemplary Cell Permeation Peptide 33 Gly
Ala Leu Phe Leu Gly Trp Leu Gly Ala Ala Gly Ser Thr Met Gly 1 5 10
15 Ala Trp Ser Gln Pro Lys Lys Lys Arg Lys Val 20 25 34 18 PRT
Artificial Sequence Exemplary Cell Permeation Peptide 34 Leu Leu
Ile Ile Leu Arg Arg Arg Ile Arg Lys Gln Ala His Ala His 1 5 10 15
Ser Lys 35 26 PRT Artificial Sequence Exemplary Cell Permeation
Peptide 35 Gly Trp Thr Leu Asn Ser Ala Gly Tyr Leu Leu Lys Ile Asn
Leu Lys 1 5 10 15 Ala Leu Ala Ala Leu Ala Lys Lys Ile Leu 20 25 36
18 PRT Artificial Sequence Amphiphilic model peptide 36 Lys Leu Ala
Leu Lys Leu Ala Leu Lys Ala Leu Lys Ala Ala Leu Lys 1 5 10 15 Leu
Ala 37 9 PRT Artificial Sequence Exemplary Cell Permeation Peptide
37 Arg Arg Arg Arg Arg Arg Arg Arg Arg 1 5 38 10 PRT Artificial
Sequence Exemplary Cell Permeation Peptide 38 Lys Phe Phe Lys Phe
Phe Lys Phe Phe Lys 1 5 10 39 37 PRT Artificial Sequence Exemplary
Cell Permeation Peptides 39 Leu Leu Gly Asp Phe Phe Arg Lys Ser Lys
Glu Lys Ile Gly Lys Glu 1 5 10 15 Phe Lys Arg Ile Val Gln Arg Ile
Lys Asp Phe Leu Arg Asn Leu Val 20 25 30 Pro Arg Thr Glu Ser 35 40
31 PRT Artificial Sequence Exemplary Cell Permeation Peptides 40
Ser Trp Leu Ser Lys Thr Ala Lys Lys Leu Glu Asn Ser Ala Lys Lys 1 5
10 15 Arg Ile Ser Glu Gly Ile Ala Ile Ala Ile Gln Gly Gly Pro Arg
20 25 30 41 30 PRT Artificial Sequence Exemplary Cell Permeation
Peptides 41 Ala Cys Tyr Cys Arg Ile Pro Ala Cys Ile Ala Gly Glu Arg
Arg Tyr 1 5 10 15 Gly Thr Cys Ile Tyr Gln Gly Arg Leu Trp Ala Phe
Cys Cys 20 25 30 42 36 PRT Artificial Sequence Exemplary Cell
Permeation Peptides 42 Asp His Tyr Asn Cys Val Ser Ser Gly Gly Gln
Cys Leu Tyr Ser Ala 1 5 10 15 Cys Pro Ile Phe Thr Lys Ile Gln Gly
Thr Cys Tyr Arg Gly Lys Ala 20 25 30 Lys Cys Cys Lys 35 43 12 PRT
Artificial Sequence Exemplary Cell Permeation Peptides 43 Arg Lys
Cys Arg Ile Val Val Ile Arg Val Cys Arg 1 5 10 44 42 PRT Artificial
Sequence Exemplary Cell Permeation Peptides 44 Arg Arg Arg Pro Arg
Pro Pro Tyr Leu Pro Arg Pro Arg Pro Pro Pro 1 5 10 15 Phe Phe Pro
Pro Arg Leu Pro Pro Arg Ile Pro Pro Gly Phe Pro Pro 20 25 30 Arg
Phe Pro Pro Arg Phe Pro Gly Lys Arg 35 40 45 13 PRT Artificial
Sequence Exemplary Cell Permeation Peptides 45 Ile Leu Pro Trp Lys
Trp Pro Trp Trp Pro Trp Arg Arg 1 5 10 46 16 PRT Artificial
Sequence Synthetically generated peptide 46 Ala Ala Val Ala Leu Leu
Pro Ala Val Leu Leu Ala Leu Leu Ala Pro 1 5 10 15 47 11 PRT
Artificial Sequence Synthetically generated peptide 47 Ala Ala Leu
Leu Pro Val Leu Leu Ala Ala Pro 1 5 10 48 13 PRT Human
immunodeficiency virus 48 Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg
Pro Pro Gln 1 5 10 49 16 PRT Drosophila melanogaster, Antennapedia
mutant 49 Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys Trp
Lys Lys 1 5 10 15 50 21 RNA Artificial Sequence Synthetically
generated oligonucleotide 50 ugugcugacu cugaggaaaa g 21 51 21 RNA
Artificial Sequence Synthetically generated oligonucleotide 51
guuccucaga gucagcacau c 21 52 21 RNA Artificial Sequence
Synthetically generated oligonucleotide 52 cccuggaaaa gcugaugaag g
21 53 21 RNA Artificial Sequence Synthetically generated
oligonucleotide 53 uucaucagcu uuuccagggu c 21 54 13481 DNA Homo
sapiens huntingtin 54 gctgccggga cgggtccaag atggacggcc gctcaggttc
tgcttttacc tgcggcccag 60 agccccattc attgccccgg tgctgagcgg
cgccgcgagt cggcccgagg cctccgggga 120 ctgccgtgcc gggcgggaga
ccgccatggc gaccctggaa aagctgatga aggccttcga 180 gtccctcaag
tccttccagc agcagcagca gcagcagcag cagcagcagc agcagcagca 240
gcagcagcag cagcagcagc aacagccgcc accgccgccg ccgccgccgc cgcctcctca
300 gcttcctcag ccgccgccgc aggcacagcc gctgctgcct cagccgcagc
cgcccccgcc 360 gccgcccccg ccgccacccg gcccggctgt ggctgaggag
ccgctgcacc gaccaaagaa 420 agaactttca gctaccaaga aagaccgtgt
gaatcattgt ctgacaatat gtgaaaacat 480 agtggcacag tctgtcagaa
attctccaga atttcagaaa cttctgggca tcgctatgga 540 actttttctg
ctgtgcagtg atgacgcaga gtcagatgtc aggatggtgg ctgacgaatg 600
cctcaacaaa gttatcaaag ctttgatgga ttctaatctt ccaaggttac agctcgagct
660 ctataaggaa attaaaaaga atggtgcccc tcggagtttg cgtgctgccc
tgtggaggtt 720 tgctgagctg gctcacctgg ttcggcctca gaaatgcagg
ccttacctgg tgaaccttct 780 gccgtgcctg actcgaacaa gcaagagacc
cgaagaatca gtccaggaga ccttggctgc 840 agctgttccc aaaattatgg
cttcttttgg caattttgca aatgacaatg aaattaaggt 900 tttgttaaag
gccttcatag cgaacctgaa gtcaagctcc cccaccattc ggcggacagc 960
ggctggatca gcagtgagca tctgccagca ctcaagaagg acacaatatt tctatagttg
1020 gctactaaat gtgctcttag gcttactcgt tcctgtcgag gatgaacact
ccactctgct 1080 gattcttggc gtgctgctca ccctgaggta tttggtgccc
ttgctgcagc agcaggtcaa 1140 ggacacaagc ctgaaaggca gcttcggagt
gacaaggaaa gaaatggaag tctctccttc 1200 tgcagagcag cttgtccagg
tttatgaact gacgttacat catacacagc accaagacca 1260 caatgttgtg
accggagccc tggagctgtt gcagcagctc ttcagaacgc ctccacccga 1320
gcttctgcaa accctgaccg cagtcggggg cattgggcag ctcaccgctg ctaaggagga
1380 gtctggtggc cgaagccgta gtgggagtat tgtggaactt atagctggag
ggggttcctc 1440 atgcagccct gtcctttcaa gaaaacaaaa aggcaaagtg
ctcttaggag aagaagaagc 1500 cttggaggat gactctgaat cgagatcgga
tgtcagcagc tctgccttaa cagcctcagt 1560 gaaggatgag atcagtggag
agctggctgc ttcttcaggg gtttccactc cagggtcagc 1620 aggtcatgac
atcatcacag aacagccacg gtcacagcac acactgcagg cggactcagt 1680
ggatctggcc agctgtgact tgacaagctc tgccactgat ggggatgagg aggatatctt
1740 gagccacagc tccagccagg tcagcgccgt cccatctgac cctgccatgg
acctgaatga 1800 tgggacccag gcctcgtcgc ccatcagcga cagctcccag
accaccaccg aagggcctga 1860 ttcagctgtt accccttcag acagttctga
aattgtgtta gacggtaccg acaaccagta 1920 tttgggcctg cagattggac
agccccagga tgaagatgag gaagccacag gtattcttcc 1980 tgatgaagcc
tcggaggcct tcaggaactc ttccatggcc cttcaacagg cacatttatt 2040
gaaaaacatg agtcactgca ggcagccttc tgacagcagt gttgataaat ttgtgttgag
2100 agatgaagct actgaaccgg gtgatcaaga aaacaagcct tgccgcatca
aaggtgacat 2160 tggacagtcc actgatgatg actctgcacc tcttgtccat
tgtgtccgcc ttttatctgc 2220 ttcgtttttg ctaacagggg gaaaaaatgt
gctggttccg gacagggatg tgagggtcag 2280 cgtgaaggcc ctggccctca
gctgtgtggg agcagctgtg gccctccacc cggaatcttt 2340 cttcagcaaa
ctctataaag ttcctcttga caccacggaa taccctgagg aacagtatgt 2400
ctcagacatc ttgaactaca tcgatcatgg agacccacag gttcgaggag ccactgccat
2460 tctctgtggg accctcatct gctccatcct cagcaggtcc cgcttccacg
tgggagattg 2520 gatgggcacc attagaaccc tcacaggaaa tacattttct
ttggcggatt gcattccttt 2580 gctgcggaaa acactgaagg atgagtcttc
tgttacttgc aagttagctt gtacagctgt 2640 gaggaactgt gtcatgagtc
tctgcagcag cagctacagt gagttaggac tgcagctgat 2700 catcgatgtg
ctgactctga ggaacagttc ctattggctg gtgaggacag agcttctgga 2760
aacccttgca gagattgact tcaggctggt gagctttttg gaggcaaaag cagaaaactt
2820 acacagaggg gctcatcatt atacagggct tttaaaactg caagaacgag
tgctcaataa 2880 tgttgtcatc catttgcttg gagatgaaga ccccagggtg
cgacatgttg ccgcagcatc 2940 actaattagg cttgtcccaa agctgtttta
taaatgtgac caaggacaag ctgatccagt 3000 agtggccgtg gcaagagatc
aaagcagtgt ttacctgaaa cttctcatgc atgagacgca 3060 gcctccatct
catttctccg tcagcacaat aaccagaata tatagaggct ataacctact 3120
accaagcata acagacgtca ctatggaaaa taacctttca agagttattg cagcagtttc
3180 tcatgaacta atcacatcaa ccaccagagc actcacattt ggatgctgtg
aagctttgtg 3240 tcttctttcc actgccttcc cagtttgcat ttggagttta
ggttggcact gtggagtgcc 3300 tccactgagt gcctcagatg agtctaggaa
gagctgtacc gttgggatgg ccacaatgat 3360 tctgaccctg ctctcgtcag
cttggttccc attggatctc tcagcccatc aagatgcttt 3420 gattttggcc
ggaaacttgc ttgcagccag tgctcccaaa tctctgagaa gttcatgggc 3480
ctctgaagaa gaagccaacc cagcagccac caagcaagag gaggtctggc cagccctggg
3540 ggaccgggcc ctggtgccca tggtggagca gctcttctct cacctgctga
aggtgattaa 3600 catttgtgcc cacgtcctgg atgacgtggc tcctggaccc
gcaataaagg cagccttgcc 3660 ttctctaaca aacccccctt ctctaagtcc
catccgacga aaggggaagg agaaagaacc 3720 aggagaacaa gcatctgtac
cgttgagtcc caagaaaggc agtgaggcca gtgcagcttc 3780 tagacaatct
gatacctcag gtcctgttac aacaagtaaa tcctcatcac tggggagttt 3840
ctatcatctt ccttcatacc tcaaactgca tgatgtcctg aaagctacac acgctaacta
3900 caaggtcacg ctggatcttc agaacagcac ggaaaagttt ggagggtttc
tccgctcagc 3960 cttggatgtt ctttctcaga tactagagct ggccacactg
caggacattg ggaagtgtgt 4020 tgaagagatc ctaggatacc tgaaatcctg
ctttagtcga gaaccaatga tggcaactgt 4080 ttgtgttcaa caattgttga
agactctctt tggcacaaac ttggcctccc agtttgatgg 4140 cttatcttcc
aaccccagca agtcacaagg ccgagcacag cgccttggct cctccagtgt 4200
gaggccaggc ttgtaccact actgcttcat ggccccgtac acccacttca cccaggccct
4260 cgctgacgcc agcctgagga acatggtgca ggcggagcag gagaacgaca
cctcgggatg 4320 gtttgatgtc ctccagaaag tgtctaccca gttgaagaca
aacctcacga gtgtcacaaa 4380 gaaccgtgca gataagaatg ctattcataa
tcacattcgt ttgtttgaac ctcttgttat 4440 aaaagcttta aaacagtaca
cgactacaac atgtgtgcag ttacagaagc aggttttaga 4500
tttgctggcg cagctggttc agttacgggt taattactgt cttctggatt cagatcaggt
4560 gtttattggc tttgtattga aacagtttga atacattgaa gtgggccagt
tcagggaatc 4620 agaggcaatc attccaaaca tctttttctt cttggtatta
ctatcttatg aacgctatca 4680 ttcaaaacag atcattggaa ttcctaaaat
cattcagctc tgtgatggca tcatggccag 4740 tggaaggaag gctgtgacac
atgccatacc ggctctgcag cccatagtcc acgacctctt 4800 tgtattaaga
ggaacaaata aagctgatgc aggaaaagag cttgaaaccc aaaaagaggt 4860
ggtggtgtca atgttactga gactcatcca gtaccatcag gtgttggaga tgttcattct
4920 tgtcctgcag cagtgccaca aggagaatga agacaagtgg aagcgactgt
ctcgacagat 4980 agctgacatc atcctcccaa tgttagccaa acagcagatg
cacattgact ctcatgaagc 5040 ccttggagtg ttaaatacat tatttgagat
tttggcccct tcctccctcc gtccggtaga 5100 catgctttta cggagtatgt
tcgtcactcc aaacacaatg gcgtccgtga gcactgttca 5160 actgtggata
tcgggaattc tggccatttt gagggttctg atttcccagt caactgaaga 5220
tattgttctt tctcgtattc aggagctctc cttctctccg tatttaatct cctgtacagt
5280 aattaatagg ttaagagatg gggacagtac ttcaacgcta gaagaacaca
gtgaagggaa 5340 acaaataaag aatttgccag aagaaacatt ttcaaggttt
ctattacaac tggttggtat 5400 tcttttagaa gacattgtta caaaacagct
gaaggtggaa atgagtgagc agcaacatac 5460 tttctattgc caggaactag
gcacactgct aatgtgtctg atccacatct tcaagtctgg 5520 aatgttccgg
agaatcacag cagctgccac taggctgttc cgcagtgatg gctgtggcgg 5580
cagtttctac accctggaca gcttgaactt gcgggctcgt tccatgatca ccacccaccc
5640 ggccctggtg ctgctctggt gtcagatact gctgcttgtc aaccacaccg
actaccgctg 5700 gtgggcagaa gtgcagcaga ccccgaaaag acacagtctg
tccagcacaa agttacttag 5760 tccccagatg tctggagaag aggaggattc
tgacttggca gccaaacttg gaatgtgcaa 5820 tagagaaata gtacgaagag
gggctctcat tctcttctgt gattatgtct gtcagaacct 5880 ccatgactcc
gagcacttaa cgtggctcat tgtaaatcac attcaagatc tgatcagcct 5940
ttcccacgag cctccagtac aggacttcat cagtgccgtt catcggaact ctgctgccag
6000 cggcctgttc atccaggcaa ttcagtctcg ttgtgaaaac ctttcaactc
caaccatgct 6060 gaagaaaact cttcagtgct tggaggggat ccatctcagc
cagtcgggag ctgtgctcac 6120 gctgtatgtg gacaggcttc tgtgcacccc
tttccgtgtg ctggctcgca tggtcgacat 6180 ccttgcttgt cgccgggtag
aaatgcttct ggctgcaaat ttacagagca gcatggccca 6240 gttgccaatg
gaagaactca acagaatcca ggaatacctt cagagcagcg ggctcgctca 6300
gagacaccaa aggctctatt ccctgctgga caggtttcgt ctctccacca tgcaagactc
6360 acttagtccc tctcctccag tctcttccca cccgctggac ggggatgggc
acgtgtcact 6420 ggaaacagtg agtccggaca aagactggta cgttcatctt
gtcaaatccc agtgttggac 6480 caggtcagat tctgcactgc tggaaggtgc
agagctggtg aatcggattc ctgctgaaga 6540 tatgaatgcc ttcatgatga
actcggagtt caacctaagc ctgctagctc catgcttaag 6600 cctagggatg
agtgaaattt ctggtggcca gaagagtgcc ctttttgaag cagcccgtga 6660
ggtgactctg gcccgtgtga gcggcaccgt gcagcagctc cctgctgtcc atcatgtctt
6720 ccagcccgag ctgcctgcag agccggcggc ctactggagc aagttgaatg
atctgtttgg 6780 ggatgctgca ctgtatcagt ccctgcccac tctggcccgg
gccctggcac agtacctggt 6840 ggtggtctcc aaactgccca gtcatttgca
ccttcctcct gagaaagaga aggacattgt 6900 gaaattcgtg gtggcaaccc
ttgaggccct gtcctggcat ttgatccatg agcagatccc 6960 gctgagtctg
gatctccagg cagggctgga ctgctgctgc ctggccctgc agctgcctgg 7020
cctctggagc gtggtctcct ccacagagtt tgtgacccac gcctgctccc tcatctactg
7080 tgtgcacttc atcctggagg ccgttgcagt gcagcctgga gagcagcttc
ttagtccaga 7140 aagaaggaca aataccccaa aagccatcag cgaggaggag
gaggaagtag atccaaacac 7200 acagaatcct aagtatatca ctgcagcctg
tgagatggtg gcagaaatgg tggagtctct 7260 gcagtcggtg ttggccttgg
gtcataaaag gaatagcggc gtgccggcgt ttctcacgcc 7320 attgctaagg
aacatcatca tcagcctggc ccgcctgccc cttgtcaaca gctacacacg 7380
tgtgccccca ctggtgtgga agcttggatg gtcacccaaa ccgggagggg attttggcac
7440 agcattccct gagatccccg tggagttcct ccaggaaaag gaagtcttta
aggagttcat 7500 ctaccgcatc aacacactag gctggaccag tcgtactcag
tttgaagaaa cttgggccac 7560 cctccttggt gtcctggtga cgcagcccct
cgtgatggag caggaggaga gcccaccaga 7620 agaagacaca gagaggaccc
agatcaacgt cctggccgtg caggccatca cctcactggt 7680 gctcagtgca
atgactgtgc ctgtggccgg caacccagct gtaagctgct tggagcagca 7740
gccccggaac aagcctctga aagctctcga caccaggttt gggaggaagc tgagcattat
7800 cagagggatt gtggagcaag agattcaagc aatggtttca aagagagaga
atattgccac 7860 ccatcattta tatcaggcat gggatcctgt cccttctctg
tctccggcta ctacaggtgc 7920 cctcatcagc cacgagaagc tgctgctaca
gatcaacccc gagcgggagc tggggagcat 7980 gagctacaaa ctcggccagg
tgtccataca ctccgtgtgg ctggggaaca gcatcacacc 8040 cctgagggag
gaggaatggg acgaggaaga ggaggaggag gccgacgccc ctgcaccttc 8100
gtcaccaccc acgtctccag tcaactccag gaaacaccgg gctggagttg acatccactc
8160 ctgttcgcag tttttgcttg agttgtacag ccgctggatc ctgccgtcca
gctcagccag 8220 gaggaccccg gccatcctga tcagtgaggt ggtcagatcc
cttctagtgg tctcagactt 8280 gttcaccgag cgcaaccagt ttgagctgat
gtatgtgacg ctgacagaac tgcgaagggt 8340 gcacccttca gaagacgaga
tcctcgctca gtacctggtg cctgccacct gcaaggcagc 8400 tgccgtcctt
gggatggaca aggccgtggc ggagcctgtc agccgcctgc tggagagcac 8460
gctcaggagc agccacctgc ccagcagggt tggagccctg cacggcgtcc tctatgtgct
8520 ggagtgcgac ctgctggacg acactgccaa gcagctcatc ccggtcatca
gcgactatct 8580 cctctccaac ctgaaaggga tcgcccactg cgtgaacatt
cacagccagc agcacgtact 8640 ggtcatgtgt gccactgcgt tttacctcat
tgagaactat cctctggacg tagggccgga 8700 attttcagca tcaataatac
agatgtgtgg ggtgatgctg tctggaagtg aggagtccac 8760 cccctccatc
atttaccact gtgccctcag aggcctggag cgcctcctgc tctctgagca 8820
gctctcccgc ctggatgcag aatcgctggt caagctgagt gtggacagag tgaacgtgca
8880 cagcccgcac cgggccatgg cggctctggg cctgatgctc acctgcatgt
acacaggaaa 8940 ggagaaagtc agtccgggta gaacttcaga ccctaatcct
gcagcccccg acagcgagtc 9000 agtgattgtt gctatggagc gggtatctgt
tctttttgat aggatcagga aaggctttcc 9060 ttgtgaagcc agagtggtgg
ccaggatcct gccccagttt ctagacgact tcttcccacc 9120 ccaggacatc
atgaacaaag tcatcggaga gtttctgtcc aaccagcagc cataccccca 9180
gttcatggcc accgtggtgt ataaggtgtt tcagactctg cacagcaccg ggcagtcgtc
9240 catggtccgg gactgggtca tgctgtccct ctccaacttc acgcagaggg
ccccggtcgc 9300 catggccacg tggagcctct cctgcttctt tgtcagcgcg
tccaccagcc cgtgggtcgc 9360 ggcgatcctc ccacatgtca tcagcaggat
gggcaagctg gagcaggtgg acgtgaacct 9420 tttctgcctg gtcgccacag
acttctacag acaccagata gaggaggagc tcgaccgcag 9480 ggccttccag
tctgtgcttg aggtggttgc agccccagga agcccatatc accggctgct 9540
gacttgttta cgaaatgtcc acaaggtcac cacctgctga gcgccatggt gggagagact
9600 gtgaggcggc agctggggcc ggagcctttg gaagtctgcg cccttgtgcc
ctgcctccac 9660 cgagccagct tggtccctat gggcttccgc acatgccgcg
ggcggccagg caacgtgcgt 9720 gtctctgcca tgtggcagaa gtgctctttg
tggcagtggc caggcaggga gtgtctgcag 9780 tcctggtggg gctgagcctg
aggccttcca gaaagcagga gcagctgtgc tgcaccccat 9840 gtgggtgacc
aggtcctttc tcctgatagt cacctgctgg ttgttgccag gttgcagctg 9900
ctcttgcatc tgggccagaa gtcctccctc ctgcaggctg gctgttggcc cctctgctgt
9960 cctgcagtag aaggtgccgt gagcaggctt tgggaacact ggcctgggtc
tccctggtgg 10020 ggtgtgcatg ccacgccccg tgtctggatg cacagatgcc
atggcctgtg ctgggccagt 10080 ggctgggggt gctagacacc cggcaccatt
ctcccttctc tcttttcttc tcaggattta 10140 aaatttaatt atatcagtaa
agagattaat tttaacgtaa ctctttctat gcccgtgtaa 10200 agtatgtgaa
tcgcaaggcc tgtgctgcat gcgacagcgt ccggggtggt ggacagggcc 10260
cccggccacg ctccctctcc tgtagccact ggcatagccc tcctgagcac ccgctgacat
10320 ttccgttgta catgttcctg tttatgcatt cacaaggtga ctgggatgta
gagaggcgtt 10380 agtgggcagg tggccacagc aggactgagg acaggccccc
attatcctag gggtgcgctc 10440 acctgcagcc cctcctcctc gggcacagac
gactgtcgtt ctccacccac cagtcaggga 10500 cagcagcctc cctgtcactc
agctgagaag gccagccctc cctggctgtg agcagcctcc 10560 actgtgtcca
gagacatggg cctcccactc ctgttccttg ctagccctgg ggtggcgtct 10620
gcctaggagc tggctggcag gtgttgggac ctgctgctcc atggatgcat gccctaagag
10680 tgtcactgag ctgtgttttg tctgagcctc tctcggtcaa cagcaaagct
tggtgtcttg 10740 gcactgttag tgacagagcc cagcatccct tctgcccccg
ttccagctga catcttgcac 10800 ggtgacccct tttagtcagg agagtgcaga
tctgtgctca tcggagactg ccccacggcc 10860 ctgtcagagc cgccactcct
atccccaggc caggtccctg gaccagcctc ctgtttgcag 10920 gcccagagga
gccaagtcat taaaatggaa gtggattctg gatggccggg ctgctgctga 10980
tgtaggagct ggatttggga gctctgcttg ccgactggct gtgagacgag gcaggggctc
11040 tgcttcctca gccctagagg cgagccaggc aaggttggcg actgtcatgt
ggcttggttt 11100 ggtcatgccc gtcgatgttt tgggtattga atgtggtaag
tggaggaaat gttggaactc 11160 tgtgcaggtg ctgccttgag acccccaagc
ttccacctgt ccctctccta tgtggcagct 11220 ggggagcagc tgagatgtgg
acttgtatgc tgcccacata cgtgaggggg agctgaaagg 11280 gagcccctcc
tctgagcagc ctctgccagg cctgtatgag gcttttccca ccagctccca 11340
acagaggcct cccccagcca ggaccacctc gtcctcgtgg cggggcagca ggagcggtag
11400 aaaggggtcc gatgtttgag gaggccctta agggaagcta ctgaattata
acacgtaaga 11460 aaatcaccat tccgtattgg ttgggggctc ctgtttctca
tcctagcttt ttcctggaaa 11520 gcccgctaga aggtttggga acgaggggaa
agttctcaga actgttggct gctccccacc 11580 cgcctcccgc ctcccccgca
ggttatgtca gcagctctga gacagcagta tcacaggcca 11640 gatgttgttc
ctggctagat gtttacattt gtaagaaata acactgtgaa tgtaaaacag 11700
agccattccc ttggaatgca tatcgctggg ctcaacatag agtttgtctt cctcttgttt
11760 acgacgtgat ctaaaccagt ccttagcaag gggctcagaa caccccgctc
tggcagtagg 11820 tgtcccccac ccccaaagac ctgcctgtgt gctccggaga
tgaatatgag ctcattagta 11880 aaaatgactt cacccacgca tatacataaa
gtatccatgc atgtgcatat agacacatct 11940 ataattttac acacacacct
ctcaagacgg agatgcatgg cctctaagag tgcccgtgtc 12000 ggttcttcct
ggaagttgac tttccttaga cccgccaggt caagttagcc gcgtgacgga 12060
catccaggcg tgggacgtgg tcagggcagg gctcattcat tgcccactag gatcccactg
12120 gcgaagatgg tctccatatc agctctctgc agaagggagg aagactttat
catgttccta 12180 aaaatctgtg gcaagcaccc atcgtattat ccaaattttg
ttgcaaatgt gattaatttg 12240 gttgtcaagt tttgggggtg ggctgtgggg
agattgcttt tgttttcctg ctggtaatat 12300 cgggaaagat tttaatgaaa
ccagggtaga attgtttggc aatgcactga agcgtgtttc 12360 tttcccaaaa
tgtgcctccc ttccgctgcg ggcccagctg agtctatgta ggtgatgttt 12420
ccagctgcca agtgctcttt gttactgtcc accctcattt ctgccagcgc atgtgtcctt
12480 tcaaggggaa aatgtgaagc tgaaccccct ccagacaccc agaatgtagc
atctgagaag 12540 gccctgtgcc ctaaaggaca cccctcgccc ccatcttcat
ggagggggtc atttcagagc 12600 cctcggagcc aatgaacagc tcctcctctt
ggagctgaga tgagccccac gtggagctcg 12660 ggacggatag tagacagcaa
taactcggtg tgtggccgcc tggcaggtgg aacttcctcc 12720 cgttgcgggg
tggagtgagg ttagttctgt gtgtctggtg ggtggagtca ggcttctctt 12780
gctacctgtg agcatccttc ccagcagaca tcctcatcgg gctttgtccc tcccccgctt
12840 cctccctctg cggggaggac ccgggaccac agctgctggc cagggtagac
ttggagctgt 12900 cctccagagg ggtcacgtgt aggagtgaga agaaggaaga
tcttgagagc tgctgaggga 12960 ccttggagag ctcaggatgg ctcagacgag
gacactcgct tgccgggcct gggcctcctg 13020 ggaaggaggg agctgctcag
aatgccgcat gacaactgaa ggcaacctgg aaggttcagg 13080 ggccgctctt
cccccatgtg cctgtcacgc tctggtgcag tcaaaggaac gccttcccct 13140
cagttgtttc taagagcaga gtctcccgct gcaatctggg tggtaactgc cagccttgga
13200 ggatcgtggc caacgtggac ctgcctacgg agggtgggct ctgacccaag
tggggcctcc 13260 ttgtccaggt ctcactgctt tgcaccgtgg tcagagggac
tgtcagctga gcttgagctc 13320 ccctggagcc agcagggctg tgatgggcga
gtcccggagc cccacccaga cctgaatgct 13380 tctgagagca aagggaagga
ctgacgagag atgtatattt aattttttaa ctgctgcaaa 13440 cattgtacat
ccaaattaaa ggaaaaaaat ggaaaccatc a 13481
* * * * *