U.S. patent application number 11/441858 was filed with the patent office on 2007-02-08 for small molecular weight tnf receptor multimeric molecule.
Invention is credited to Yuti Chernajovsky, Marc Feldmann, Richard Neve.
Application Number | 20070031925 11/441858 |
Document ID | / |
Family ID | 36613670 |
Filed Date | 2007-02-08 |
United States Patent
Application |
20070031925 |
Kind Code |
A1 |
Chernajovsky; Yuti ; et
al. |
February 8, 2007 |
Small molecular weight TNF receptor multimeric molecule
Abstract
The present invention relates to a receptor molecule which binds
to TNF comprising all or a functional portion of the extracellular
domain (ECD) of two or more TNF-Rs linked via one or more
polypeptide linkers. The receptor can further comprise a signal
peptide of a secreted protein, such as the signal peptide of the
extracellular domain of the TNF-R or the signal peptide of a
cytokine. The invention also relates to isolated DNA encoding a
receptor molecule which binds to TNF, comprising two or more
sequences encoding all or a functional portion of the ECD of TNF-Rs
linked via one or more sequences encoding a polypeptide linker. The
invention further relates to a method of making a construct which
expresses all or a functional portion of the ECD of two or more
TNF-Rs linked via one or more polypeptide linkers and cells which
express the construct. The invention also relates to a method of
inhibiting the biological activity of TNF in a host comprising
administering to the host an effective amount of a receptor
molecule of the present invention. The invention further relates to
receptor molecules which bind cytokines that bind to receptor
molecules comprising more than one subunit.
Inventors: |
Chernajovsky; Yuti; (London,
GB) ; Neve; Richard; (Sandwich, GB) ;
Feldmann; Marc; (London, GB) |
Correspondence
Address: |
Cooper & Dunham LLP
1185 Avenue of the Americas
New York
NY
10036
US
|
Family ID: |
36613670 |
Appl. No.: |
11/441858 |
Filed: |
May 26, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09285531 |
Apr 2, 1999 |
7070783 |
|
|
11441858 |
May 26, 2006 |
|
|
|
08437533 |
May 9, 1995 |
|
|
|
09285531 |
Apr 2, 1999 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/325; 514/12.2; 514/18.2; 514/19.3; 514/2.1; 514/4.6;
530/350; 536/23.5 |
Current CPC
Class: |
A61K 38/00 20130101;
C07K 14/7151 20130101; A61P 25/00 20180101; Y02A 50/411 20180101;
A61P 25/28 20180101; A61P 35/00 20180101; A61P 1/00 20180101; Y02A
50/30 20180101; A61P 37/06 20180101 |
Class at
Publication: |
435/069.1 ;
435/320.1; 435/325; 530/350; 536/023.5; 514/012 |
International
Class: |
A61K 38/17 20070101
A61K038/17; C07K 14/715 20070101 C07K014/715; C07H 21/04 20060101
C07H021/04; C12P 21/06 20060101 C12P021/06 |
Claims
1-23. (canceled)
24. A receptor molecule which binds to tumor necrosis factor
comprising all or a functional portion of a first extracellular
domain of tumor necrosis factor receptor bound via a peptide bond
to a first polypeptide linker, wherein said first polypeptide
linker is bound via a peptide bond to all or a functional portion
of a second extracellular domain of tumor necrosis factor receptor
bound via a peptide bond to a second polypeptide linker, wherein
said second polypeptide linker is bound via a peptide bond to all
or a functional portion of a third extracellular domain of tumor
necrosis factor receptor, wherein the first and second polypeptide
linkers are each from about 10 to about 30 amino acid residues in
length, and wherein the receptor molecule is capable of binding to
a tumor necrosis factor trimer in a stoichiometric ratio of almost
1:1.
25. The receptor molecule of claim 24, wherein the first
extracellular domain, the second extracellular domain, and the
third extracellular domain are independently selected from the
group consisting of (i) the extracellular domain of a p75 tumor
necrosis factor receptor, (ii) the extracellular domain of a p55
tumor necrosis factor receptor or (iii) functional portions of (i)
or (ii).
26. The receptor molecule of claim 24 further comprising a signal
peptide of a secreted protein.
27. The receptor molecule of claim 25, wherein the first, second
and third extracellular domains are the same.
28. Isolated DNA encoding a receptor molecule according to claim
24.
29. A method of making a construct which expresses the receptor
molecule of claim 24 comprising the steps of: a) obtaining a first
vector which expresses an extracellular domain of a first tumor
necrosis factor receptor and a signal peptide of a secreted
protein; b) obtaining a second vector which expresses an
extracellular domain of a second tumor necrosis factor receptor; c)
obtaining a third vector which expresses an extracellular domain of
a third tumor necrosis factor receptor; and d) ligating the first
vector of (a) to the second vector of (b) and litigating the second
vector of (b) to the third vector of (c) using a coding sequence
for a first polypeptide linker so that the first vector of (a) is
linked to the second vector of (b) using the coding sequence for
the first polypeptide linker and using a second coding sequence for
a second polypeptide linker so that the second vector of (b) is
linked to the third vector of (c) using the second coding sequence
for the second polypeptide linker, resulting in a construct which
expresses the receptor molecule of claim 24.
30. A cell which expresses a receptor molecule according to claim
24 comprising a nucleic acid encoding such receptor molecule.
31. A method of inhibiting the biological activity of tumor
necrosis factor in a subject comprising administering to a subject
a tumor necrosis factor-inhibiting amount of a receptor molecule
according to claim 24.
32. A method of treating a tumor necrosis factor-related disease in
a subject in need thereof comprising administering to the subject a
tumor necrosis factor-inhibiting amount of a receptor molecule
according to claim 24.
33. The method of claim 32, wherein the tumor necrosis
factor-related disease is selected from the group consisting of an
autoimmune disease, an inflammatory bowel disease, a bacterial
infection, a viral infection, a parasitic infection, a malignancy,
and a neurodegenerative disease.
34. The method of claim 32, wherein the tumor necrosis
factor-related disease is selected from the group consisting of
rheumatoid arthritis, septic shock, cerebral malaria, inflammatory
bowel disease, multiple sclerosis, allograft rejection, host versus
graft disease, neoplastic pathology and endotoxemic response.
35. The method of claim 32, wherein the tumor necrosis
factor-related disease is rheumatoid arthritis.
36. The receptor molecule of claim 24, wherein the first
extracellular domain, the second extracellular domain, and the
third extracellular domain are of human origin and wherein the
first and second polypeptide linkers are polyglycine linker
sequences.
Description
RELATED APPLICATION(S)
[0001] This application is a Continuation of 08/437,533 filed May
9, 1995, the entire teachings of which are incorporated herein by
reference.
BACKGROUND OF THE INVENTION
[0002] Tumor Necrosis Factor, a pleiotropic cytokine released by
activated T cells and macrophages, is expressed as a mature 17 kDa
protein that is active as a trimer (Smith, R. A. and Baglioni, C.,
J. Biol. Chem., 262:6951 (1986). Trimeric cytokines such as Tumor
Necrosis Factor (TNF.alpha.) and the closely related protein
lymphotoxin (TNF.beta.), exert their biological activity by
aggregating their cell surface receptors. The TNF trimer binds the
receptors on the cell surface causing localized crosslinking of TNF
receptors into clusters necessary for signal transduction.
[0003] The action of TNF.alpha. and TNF.beta. are mediated through
two cell surface receptors, the 55 kDa (p55 TNF-R) and the 75 kDa
(p75 TNF-R) receptors. Truncated forms of these receptors,
comprising the extracellular domains (ECD) of the receptors, have
been detected in the urine and serum as 30 kDa and 40 kDa TNF
inhibitory binding proteins (Engelmann, H., et al., J. Biol. Chem.,
265:1531 (1990)).
[0004] TNF is a key mediator in a number of autoimmune and
inflammatory diseases such as rheumatoid arthritis, septic shock,
cerebral malaria and multiple sclerosis (reviewed in Tracy, K. J.
and Cerami, A., Ann. Rev. Cell. Biol., 9:317 (1993)). Antagonistic
TNF treatment with anti-TNF antibodies and dimeric TNF-receptor-IgG
fusion chimeras have shown promising therapeutic results for a
variety of diseases in animal models (Lesslauer, W., et al., Eur.
J. Immunol., 21:2883 (1991); Kolls, J., et al., Proc. Natl. Acad.
Sci. USA, 91:215 (1994); Baker, D., et al., Eur. J. Immunol.,
24:2040 (1994);Williams, R. O., et al., Proc. Natl. Acad. Sci. USA,
89:9784 (1993)) and human clinical trials (Elliot, M., et al.,
Arthritis and Rheum., 36:1681 (1993)).
[0005] For example, it has been shown that the IgG-Hu p75 TNF-R ECD
dimers have a 100-4000 fold higher affinity for TNF over the
monomeric counterparts (Lesslauer, W., et al., Eur. J Immunol.,
21:2883 (1991); Kolls, J., et al., Proc. Natl. Acad. Sci. USA,
91:215 (1994); Butler, D., et al., Cytokine, 6:616 (1994)).
However, these molecules are large in size, immunogenic and include
the Fc portion of the IgG which may interfere with clearance by
binding to Fc receptors.
[0006] Thus, a need exists for improved TNF inhibitors which are
less immunogenic and allow for faster clearance and greater tissue
penetration when administered to a host.
SUMMARY OF THE INVENTION
[0007] The present invention is based on the discovery that a small
molecular weight protein or tumor necrosis factor receptor (TNF-R),
built from two or more TNF-R monomers linked via one or more
polypeptide bridges or linkers, is active in inhibiting the
biological activity of tumor necrosis factor (TNF). In one
embodiment the invention relates to a receptor molecule which binds
to TNF comprising all or a functional portion of the extracellular
domain (ECD) of two TNF-Rs linked via a polypeptide linker. In
another embodiment, the invention relates to a receptor molecule
which binds to TNF comprising three TNF-Rs linked via two
polypeptide linkers. The receptor molecule can include the ECDs of
two or more p75 TNF-Rs or the ECDs of two or more p55 TNF-R. The
receptor can further comprise a signal peptide of a secreted
protein, such as the signal peptide of the extracellular domain of
the TNF-R or the signal peptide of a cytokine.
[0008] In another embodiment the invention relates to isolated DNA
encoding a protein or receptor molecule which binds to TNF,
comprising two or more sequences encoding all or a functional
portion of the ECD of TNF-Rs linked via one or more sequences
encoding a polypeptide linker.
[0009] The invention further relates to a method of making a
construct which expresses all or a functional portion of the ECD of
two or more TNF-Rs linked via one or more polypeptide linkers
comprising the steps of: a) obtaining a first vector which
expresses all or a functional portion of the ECD of a first TNF-R
and a signal peptide of a secreted protein; b) obtaining a second
vector which expresses all or a functional portion of an ECD of a
second TNF-R; and c) ligating the first vector of (a) with the
second vector of (b) via a polypeptide linker. Thus, the first
vector of (a) is linked to the second vector of (b) via the
polypeptide linker resulting in a construct which expresses all or
a functional portion of the ECD of the first TNF-R and all or a
portion of the ECD of the second TNF-R linked via a polypeptide
linker. The method of making a construct can further comprise one
or more vectors which express a second polypeptide linker and all
or a functional portion of an ECD of a third TNF-R wherein the ECD
of the third TNF-R is linked to the ECD of the second TNF-R via the
second polypeptide linker.
[0010] The present invention also relates to cells which express a
construct which expresses all or a functional portion of the ECD of
two or more TNF-Rs linked via one or more polypeptide linkers.
[0011] In another embodiment the invention relates to a method of
inhibiting the biological activity of TNF in a host comprising
administering to the host an effective amount of a receptor
molecule which binds to TNF, the receptor comprising all or a
functional portion of the ECD of two or more TNF-Rs linked via one
or more polypeptide linkers. The invention can further be used in a
method of treating a host for a TNF related disease comprising
administering an effective amount of the receptor molecule of the
present invention to a host.
[0012] The present invention also relates to protein or receptor
molecules which bind cytokines that bind to receptor molecules
comprising more than one subunit (e.g., IL-2 and IL-6 bind to an
.alpha. or .beta. receptor protein). The ECD of such receptors
linked by a polypeptide linker have higher affinity for the
cytokine, and, are effective inhibitors of the biological activity
of the cytokine. Thus, the receptor comprises all or a functional
portion of the ECD of two or more cytokine receptors linked via one
or more polypeptide linkers. Furthermore, the receptor is less
immunogenic, allows faster clearance and greater tissue penetration
in the host upon administration than recombinant immunoglobulin
molecules.
BRIEF DESCRIPTION OF THE FIGURES
[0013] FIG. 1 is a drawing which illustrates the different stages
of cloning used to obtain the Hu p75 TNF-R ECD dimer.
[0014] FIG. 2 is a drawing which illustrates the cloning of the Hu
p75 TNF-R ECD dimer into the retroviral vector pBabe Neo used to
obtain the plasmid Oscar.
[0015] FIG. 3 is the expected DNA sequence (SEQ ID NO: 1) and
protein sequence (SEQ ID NO: 2) of the Hu p75 TNF-R ECD dimer in
which the signal peptide is underlined, the polyglycine linker is
boxed, and the putative N-linked glycosylation sites are indicated
by a single bar.
[0016] FIG. 4 is a photograph of a Western blot of the soluble Hu
p75 TNF-R ECD dimer.
[0017] FIG. 5A is a graph of pg/ml TNF versus % cell death
illustrating the standard TNF cytotoxic curve from 0.2 pg/ml to 500
pg/ml.
[0018] FIG. 5B is a graph of dilution versus % protection of the
monomeric Hu p75 TNF-R ECD CRIP supernatant (at 3.35 ng/ml) diluted
1:4 to 1:32 incubated with 62.5 pg/ml TNF.
[0019] FIG. 5C is a graph of dilution versus % protection of the
dimeric p75 sf2 protein (at 2.3 ng/ml) diluted 1:4 to 1:128 with
167 pg/ml human TNF.
[0020] FIG. 5D is a graph of dilution versus % protection of two
fold dilutions of concentrated supernatant from Oscar transfected
cells (at 0.31 ng/ml) diluted from 1:4 to 1:256 incubated with 62.5
pg/ml TNF (samples were incubated for 1 hour at 37.degree. C. and
then applied in triplicate to WEHI cells as described by Butler et
al., Cytokine, 6:616 (1994).
DETAILED DESCRIPTION OF THE INVENTION
[0021] The present invention is based on the discovery of an
efficient small molecular weight tumor necrosis factor/lymphotoxin
antagonist which is active in inhibiting the biological activity of
tumor necrosis factor (TNF). The present invention relates to a
receptor molecule which binds to TNF comprising all or a functional
portion of the extracellular domain (ECD) of two or more tumor
necrosis factor receptors (TNF-Rs) linked via one or more
polypeptide linkers. For example, the receptor molecule can
comprise the ECDs of two TNF-Rs linked via a polypeptide linker to
produce a dimeric TNF-R, as described in Example 1, or the ECDs of
three TNF-Rs linked via two polypeptide linkers resulting in a
trimeric TNF-R.
[0022] The invention also includes isolated DNA encoding a receptor
which binds to TNF, comprising two or more sequences encoding all
or a functional portion of the ECD of TNF-Rs linked via one or more
sequences encoding a polypeptide linker. In a particular
embodiment, the isolated DNA of the present invention is the
sequence of FIG. 3 (SEQ ID No: 1).
[0023] As described in Example 1, in the embodiment in which the
ECDs of two TNF-Rs are linked via a polypeptide linker, a small
molecular weight TNF-R dimer was produced using two TNF-R monomers
linked via a 15 amino acid polyglycine-serine bridge and is active
in inhibiting the biological activity of TNF. As described in
Example 2, this 59 kDa protein has four potential N glycosylation
sites, is recognized in western blots and in the enzyme-linked
immunosorbent assay with monoclonal antibodies against the p75
TNF-R.
[0024] Although the present invention is exemplified using the ECD
from human p75 TNF-R, other ECDs from TNF-Rs can be used, such as
the ECD from the p55 TNF-R. Also, functional fragments or portions
of the ECD or derivatives thereof (including site mutations such as
one or more amino acid deletions, additions and substitutions) are
encompassed. The two or more ECDs can also be the same or different
Thus, the receptor molecule of the present invention is capable of
binding tumor necrosis factor (TNF.alpha.) and lymphotoxin
(TNF.beta.) and the biological activities of TNF.alpha. and
TNF.beta. can be inhibited using the receptor molecule of the
present invention.
[0025] The ECD of the TNF receptors can be derived from a suitable
source for use in the present invention. For example, the ECD of
the TNF-Rs can be purified from natural sources (e.g., mammalian,
more particularly, human), produced by chemical synthesis or
produced by recombinant DNA techniques as described in Example 1.
In addition, the present invention includes nucleic acid sequences
which encode the ECD of a TNF-R, as well as RNAs encoded by such
nucleic acid sequences. As used herein, the ECD of the TNF-R refers
to fragments and functional equivalents of the ECD of the
TNF-R.
[0026] The terms "functional portion, fragment or derivative" refer
to the portion of the ECD of the TNF-R protein, or the portion of
the TNF-R sequence which encodes the ECD of TNF-R protein, that is
of sufficient size and sequences to have the desired function
(i.e., the ability to bind TNF) (PCT/GB91/01826; WO 9207076).
Functional equivalents or derivatives of the ECD of TNF-R include a
modified ECD of the TNF-R protein such that the resulting ECD of
the TNF-R has the same or similar binding activity for TNF as the
natural or endogenous TNF-R ECD, and/or nucleic acid sequences
which, for example, through the degeneracy of the genetic code
encode the same peptide gene product as the ECD of TNF-R and/or
have the same TNF binding activity as described herein. For
example, a functional equivalent of the ECD of the TNF-R can
contain a "SILENT" codon or one or more amino acid substitutions,
deletions or additions (e.g., substitution of one acidic amino acid
for another acidic amino acid; or substitution of one codon
encoding the same or different hydrophobic amino acid for another
codon encoding a hydrophobic amino acid). See Ausubel, F. M. et
al., Current Protocols in Molecular Biology, Greene Publishing
Assoc. and Wiley-Interscience 1989.
[0027] The polypeptide linker preferably includes suitable
polypeptide linkers which link or ligate the TNF-Rs of the present
invention so as to facilitate the highest binding affinity of the
TNF trimer to the ECDs of the receptor molecule described herein.
That is, the polypeptide linker of the present invention is of a
length and composition which allows binding of the TNF trimer to
the receptor of the present invention to occur to its greatest
extent. Thus, preferred polypeptide linkers provide minimal steric
hindrance to binding of TNF to the receptor molecule (e.g., glycine
preferred), minimal immunological reaction and maximal solubility
of the receptor molecule. The polypeptide linker can be from about
10 to about 30 amino acids in length, preferably between about 10
to about 20 amino acids. In one embodiment, the polypeptide linker
is about 15 amino acids in length, as described in Example 1. In
addition, the composition of the polypeptide linker can be for
example, a polyglycine-serine linker, a polyglycine-leucine linker,
polyglycine-alanine linker and a polyglycine-threonine linker.
[0028] The receptor molecule of the present invention can further
comprise a signal peptide of a secreted protein to direct
expression of the receptor of the present invention. A suitable
signal peptide of the present invention includes the signal peptide
of the ECD of the TNF-R or the signal peptide of a cytokine.
Functional equivalents of the signal peptides of the present
invention are also encompassed by the present invention. Functional
equivalents of the signal peptide include a modified signal peptide
of a secreted protein such that the resulting signal peptide has
the same secretion activity as the non-modified signal peptide.
Functional equivalents also include nucleic acid sequences which
through the degeneracy of the genetic code encode the same signal
peptide as known signal peptides of secreted proteins and have a
similar secretion activity.
[0029] Thus, the order of the components of the receptor described
herein can be: all or a functional portion of a first ECD of a
TNF-R, a first polypeptide linker, and all or a functional portion
of a second ECD of a TNF-R in one embodiment. In another embodiment
the order of components can be: all or a functional portion of a
first ECD of a TNF-R, a first polypeptide linker, all or a
functional portion of a second ECD of a TNF-R, a second polypeptide
linker, and all or a portion of a third ECD of a TNF-R. In
addition, in either embodiment, the order of components can begin
with a signal peptide. The receptor molecule links the components
through peptide bonds and is preferably the result of a single
recombinant expression unit.
[0030] The invention further relates to a method of making a
construct which expresses all or a function portion of the
extracellular domain of two or more TNF-Rs linked via one or more
polypeptide linkers comprising the steps of: a) obtaining a first
vector which expresses all or a functional portion of an ECD of a
first TNF-R and a signal peptide of a secreted protein; b)
obtaining a second vector which expresses all or a functional
portion of an ECD of a second TNF-R; and c) ligating the vector of
(a) to the vector of (b) via a polypeptide linker resulting in a
construct which expresses all or a functional portion of two TNF-Rs
linked via a polypeptide sequence. The method can further comprise
one or more vectors which express a second polypeptide linker and
all or a functional portion of a third ECD of a TNF-R wherein the
third ECD of the TNF-R is linked to the second TNF-R via the second
polypeptide linker.
[0031] The invention further relates to cells which express a
receptor molecule which binds to tumor necrosis factor comprising
all or a functional portion of the extracellular domain of two or
more TNF-Rs linked via one or more polypeptide linker. Suitable
cells which can be used to express the receptor molecule include
yeast, bacterial and mammalian cells.
[0032] The present invention relates to receptor molecules which
bind cytokines that bind to receptor molecules comprising more than
one subunit. The ECD of such receptors linked by a polypeptide
linker have high affinity for the cytokine, and, are effective
inhibitors of the biological activity of the cytokine. Thus, the
receptor comprises all or a functional portion of the ECD of two or
more cytokine receptors linked via one or more polypeptide linkers
employing the methods described herein. Thus, the ECD of the
receptors of the present invention can be used to inhibit the
biological activity of cytokines such as IL-1, IL-2, IL-6, GMCSF,
IL-3 and IL-5 (Nicola, N. M. and Metcalf, D., Cell, 67:1-4
(1991)).
[0033] The invention further includes a method of inhibiting the
biological activity of TNF comprising administering to a host an
effective amount of a receptor molecule which binds TNF, the
receptor comprising all or a functional portion of the ECD of two
or more TNF-Rs linked via one or more polypeptide linkers. Such
receptor molecules have utilities for use in research, diagnostic
and/or therapeutic methods for diagnosing and/or treating animals
or humans having pathologies or conditions associated with TNF.
Such pathologies can include generalized or local presence of TNF
or related compounds, in amounts and/or concentrations exceeding,
or less than, those present in normal, healthy subject, or as
related to a pathological condition.
[0034] For example, the invention includes a method of treating or
preventing in a host a TNF related diseases (e.g., autoimmune
diseases, inflammatory diseases bacterial, viral or parasitic
infections, malignancies and/or neurodegenerative diseases)
comprising administering to a host (such as a human) an effective
amount of a receptor molecule which binds TNF, the receptor
comprising all or a functional portion of the ECD of two or more
TNF-Rs linked via one or more polypeptide linkers. For example, the
method can be used to treat a host for rheumatoid arthritis, septic
shock, cerebral malaria, inflammatory bowel disease, (e.g. Crohn's
disease, ulcerative colitis) multiple sclerosis, allograft
rejection, graft vs. host disease, neoplastic pathology (e.g., in
chachexis accompanying some malignancies) and endotoxemic
responses.
[0035] The receptor of the present invention can be administered to
a host in a variety of ways. The routes of administration include
intradermal, transdermal (e.g., slow release polymers),
intramuscular, intraperitoneal, intravenous, subcutaneous, oral,
epidural and intranasal routes. Any other convenient route of
administration can be used, for example, infusion or bolus
injection, or absorption through epithelial or mucocutaneous
linings. In addition the receptor of the invention can be
administered together with other components or biologically active
agents, such as pharmaceutically acceptable surfactants (e.g.,
glycerides), excipients (e.g., lactose), carriers, diluents and
vehicles. If desired, certain sweetening, flavoring and/or coloring
agents can also be added. The receptor can be administered
prophylactically or therapeutically to a host and can result in
protection from amelioration of, or elimination of the TNF-related
disease state.
[0036] Further the receptor molecule can be administered by in vivo
expression of a polynucleotide encoding the receptor module. The
"administration of protein" by definition includes the delivery of
a recombinant host cell which expresses the protein in vivo. For
example, the receptor molecule can be administered to a host using
live vectors, wherein the live vector containing the receptor
sequences are administered under conditions in which the receptor
molecule is expressed in vivo. In addition, a host can be injected
with a cDNA or DNA sequence, or a recombinant host cell containing
the cDNA or DNA sequence, which encodes and expresses the receptor
of the present invention (e.g., ex vivo infection of autologous
white blood cells for delivery of protein into localized areas of
the body, see e.g., U.S. Pat. No. 5,399,346, which is herein
incorporated by reference).
[0037] Several expression vectors for use in making the constructs
described herein and administering the receptor molecule of the
present invention to a host are available commercially or can be
reproduced according to recombinant DNA and cell culture
techniques. For example, vector systems such as retroviral, yeast
or vaccinia virus expression systems, or virus vectors can be used
in the methods and compositions of the present invention (Kaufman,
R. J., J. of Method. in Cell. and Molec. Biol., 2:221-236 (1990)).
Other techniques using naked plasmids or DNA, and cloned genes
encapsidated in targets liposomes or in erythrocyte ghosts, can be
used to introduce the receptor into the host (Freidman, T.,
Science, 244:1275-1281 (1990); Rabinovich, N. R., et al., Science,
265:1401-1404 (1994)). The construction of expression vectors and
the transfer of vectors and nucleic acids into various host cells
can be accomplished using genetic engineering techniques, as
described in manuals like Molecular Cloning and Current Protocols
in Molecular Biology, which are hereby incorporated by reference,
or by using commercially available kits (Sambrook, J., et al.,
Molec. Cloning, Cold Spring Harbor Press (1989); Ausubel, F. M., et
al., Current Protocols in Molecular Biology, Greene Publishing
Assoc. and Wiley-Interscience 1989)).
[0038] An "effective amount" is such that when administered, the
receptor molecule of the present invention results in inhibition of
the biological activity of TNF, relative to the biological activity
of TNF when an effective amount of the receptor is not
administered. For example, the inhibition of activity can be at
least about 50%, or preferably at least about 75% at the disease
site. In addition, the amount of receptor administered to a host
will vary depending on a variety of factors, including the size,
age, body weight, general health, sex, and diet of the host and the
time of administration or particular symptoms of the TNF-related
disease being treated. Adjustment and manipulation of established
dosage ranges are well within the ability of those skilled in the
art. In vitro and in vivo methods of determining the inhibition of
TNF in a host are well known to those of skill in the art. Such in
vitro assays can include a TNF cytotoxicity assay (e.g. the WEHI
assay described in Example 1 or a radioimmunoassay, ELISA). In vivo
methods can include rodent lethality assays and/or primate
pathology model systems (Mathison et al., J. Clin. Invest.,
81:1925-1937 (1988); Beutler et al., Science, 229:869-871(1985);
Tracey et al., Nature, 330:662-664 (1987); Shimamoto et al.,
Immunol. Lett., 17:311-318 (1988); Silva et al., J. Infect. Dis.,
162:421-427 (1990); Opal et al., J. Infect. Dis., 161:1148-1152
(1990); Hinshaw et al., Circ. Shock, 30:279-292 (1990)).
[0039] The receptor molecule of the present invention preferably is
capable of binding TNF with high affinity. That is, the binding
affinity of the receptor molecules described herein for TNF
approaches or is greater than the binding affinity of endogenous
TNF receptors. Preferably the binding affinity of the receptor is
such that the receptor binds the TNF homotrimer in a stoichiometric
ratio of about 1:1.
[0040] As described in Example 3, the specific activity of the
TNF/lymphotoxin inhibitor of the present invention is similar to
that of a dimeric p75 TNF-R built on an Ig backbone (Butler, D., et
al., Cytokine, 6:616 (1994)) and it is therefore capable of
inhibiting TNF cytoxicity at a 1:1 molar ratio.
[0041] The receptor molecule of the present invention is expected
to behave pharmacodynamically as the monomeric TNF-R and be quickly
removed from the blood stream via the kidneys (Bemelmans, M. H. A.,
et al., Cytokine, 6:608 (1994); Jacobs, C. A., et al., Intl. Rev.
Exp. Pathol. 34B:123 (1993)). However, the receptor is expected to
have higher penetration to tissues than Ig fusion proteins due to
its smaller molecular weight. Preferably, the molecular weight of
the receptor molecule of the present invention is about 45 kd to
about 130 kd. In addition, the Ig fusion proteins are expected to
bind complement to the Fc receptor of a cell surface thereby
facilitating development of an immune response. In contrast, the
receptors of the present invention, being devoid of an Ig
structure, are not expected to be immunogenic.
[0042] The invention is further illustrated in the following
examples.
Exemplification
EXAMPLE 1
Cloning of the Hu p75 TNF-R ECD Dimer
[0043] In order to express a small molecular weight Hu p75 TNF-R
ECD dimer, we constructed the retroviral expression vector, Oscar,
that was built in a multiple-step cloning procedure described
below. Plasmids were grown using DH5.alpha. competent cells [supE44
DlacU169f80 lacZDM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1].
PCR of Human p75 TNF-R Extracellular Domain
[0044] The Hu p75 TNF-R ECD was amplified by PCR from the
pVL1393-Hu p75 TNF-R ECD plasmid using primers (1) and (2) shown
below. pVL1393-Hu p75 TNF-R ECD (derived from pVL1393, In-Vitrogen)
contained the Hu p75 TNF-R ECD from amino acid 1to 205 with a 3'
stop codon. The 5' primer (1) contained a BamHI restriction site.
Bases 7 to 30 of primer (1) annealed to bases 70 to 93 of the
mature Hu p75 TNF-R ECD. The 3' primer which anneals to the
multiple cloning site of the pVL1393, downstream of the ECD insert,
contained an Asp718 restriction site. TABLE-US-00001 (SEQ ID NO:3)
(1) 5' TCGGATCCCGCCCAGGTGGCATTTACACCC 3' 30 mer (SEQ ID NO:4) (2)
5' CGGAATTCTAGAAGGTACCC 3' 20 mer
[0045] The reaction mix consisted of 0.02 mg pDNA, 1 mg of each
primer, 0.25 mM dNTPs, 2.5 mM MgCl.sub.2, 1.times.PCR buffer
(10.times.buffer: 500 mM KC1, 100 mM Tris-HCl pH 8.3, 0.01% w/v
gelatin) and 0.4 units of Taq DNA polymerase to a final volume of
50 .mu.l. The amplification procedure included a denaturation step,
94.degree. C., for 2 minutes, followed by 35 cycles of 1 minute
strand separation at 94.degree. C., 1 minute annealing at
56.degree. C., 1 minute extension at 72.degree. C., followed by an
elongation step 10 minutes at 72.degree. C.
[0046] The extracellular domain (ECD) of the Hu p75 TNF-R ECD with
its signal peptide sequence was cloned into the Ncol-Xbal sites of
the vector pCITE. pCITE ECD, was derived from pCITE (Novagen) into
which the Hu p75 TNF-R ECD, digested from pVL1393-Hu p75 TNF-R ECD
with Ncol and Xbal, was cloned. This unit corresponds to the 5' ECD
of the final dimer Hu p75 TNF-R ECD. FIG. 1 illustrates the
different stages of cloning used to obtain the Hu p75 TNF-R ECD
dimer. Also shown in FIG. 1 are the principal restriction enzymes
sites of Hu p75 TNF-R ECD.
Cloning of the 3' Hu p75 TNF-R ECD Into pIg16
[0047] The 3' ECD was first amplified by PCR to introduce a 3' stop
codon and two unique restriction sites at either end for cloning
into the plasmid pIg16 which contains a single chain Fv anti-DNA
antibody cloned in it. The plasmid pIg16 (Brigido, M. M., et al.,
J. Immunol., 150:469 (1993)), derived from the pGEM-3Zf(-) vector
(Promega) and containing a scFv construct was obtained from
Professor David Stollar, Tufts University.
[0048] The PCR reaction product was phenol extracted, ethanol
precipitated, resuspended and its ends blunted with Kienow fragment
of DNA polymerase. The DNA was phenol extracted, ethanol
precipitated, resuspended and digested with BamHI and Asp718. The
770 bp product was purified by agarose gel electrophoresis,
reprecipitated and ligated into the BgIII/Asp718 sites of
pIg16.
[0049] The 3' ECD cloned into pIg16, replacing the VL domain from
this construct, was named p75s. The product, p75s, was confirmed by
restriction analysis and contained the Hu p75 TNF-R ECD, with a 3'
stop codon, immediately downstream of the pIg16 polyglycine linker
sequence (Brigido, M. M., et al., J. Immunol., 150:469 (1993)).
Construction of Dimeric Hu p75 TNF-R ECD Retroviral Vector
[0050] The polyglycine-serine linker and 3' ECD were removed
together from p75s and cloned into pUC18 in tandem with the 5' ECD
from the pCITE-ECD construct. pUC18 was obtained from
Pharmacia.
[0051] p75s was digested with XbaI, the 5' overhangs filled in with
Klenow and digested with Asp718. The 800 bp fragment was purified
by agarose gel electrophoresis, precipitated and resuspended in
water.
[0052] pCITE ECD was digested with EcoRI and PvuII removing the Hu
p75 TNF-R ECD with its signal peptide and CITE sequence. The 1500
bp fragment was purified by agarose gel electrophoresis,
precipitated and resuspended in water. These two fragments were
ligated into the EcoRI/Asp718 sites of pUC18 to produce the Hu p75
TNF-R ECD-dimer construct, TRIP-4, confirmed by restriction
analysis.
[0053] The Hu p75 TNF-R ECD dimer construct was removed from the
pUC18 vector and placed into the retroviral vector pBabeNeo, the
clone obtained was named Oscar. TRIP-4 was digested with NcoI, the
5' overhang filled with Klenow and digested with SalII. The 1600 bp
fragment was purified by agarose gel electrophoresis. The fragment
was ligated into the retroviral vector pBabeNeo (Morgenstern, J. P.
and Land, H., Nucleic Acids Res., 18:3587 (1990)) which had been
digested with BamHI, blunted with Klenow, and digested with Sall.
pBabeNeo contains a MuLV LTR promoter, a neomycin resistance gene
under the control of an SV40 promoter and an ampicillin gene. The
Hu p75 TNF-R ECD dimer was inserted into the multiple cloning site
3' to the gag gene and 5' to the SV40 promoter (FIG. 2). The
resulting clone, named Oscar, was confirmed by restriction
analysis.
[0054] The open reading frame of the soluble Hu p75 TNF-R ECD dimer
with its polyglycine-serine linker is shown in FIG. 3.
EXAMPLE 2
Transfection of GPenvAM12 Cells with the Dimeric Hu p75 TNR-R ECD
Retroviral Vector
[0055] Permanent transfections were done in GPenvAM12 cells
(Markowitz, D., et al., Virology, 167:400 (1988)). Stable
transfectants expressing the Hu p75 TNF-R ECD dimer were made in
the cell line GPenvAm12 and G418 was used to select for permanent
transfectants. These cells constitutively express the protein which
is secreted into the media.
[0056] The GPenv AM12 cells were grown and maintained in DMEM
medium supplemented with 10% new-born calf serum, 2.5 units/ml
penicillin, 2.5 .mu.g/ml streptomycin and 2 mM glutamine.
[0057] For stable expression of Oscar from GPenvAM12 cells
(Markowitz, D., et al., Virology, 167:400 (1988)), 20 .mu.g of
vector DNA were transfected into the cell line using the
calcium-phosphate precipitation method. Transfected cells were
selected and maintained in medium with 1 mg/ml G418. G418 resistant
cell clones were pooled and tested for expression of Hu p75 TNF-R
ECD dimer by ELISA, Western and inhibition of the TNF cytoxicity
assay on WEHI cells.
[0058] To collect the secreted dimer from the supernatant of the
stable transfected cell line, cells were grown to 80-100%
confluence in the presence of 0.5 mg/ml G418. The media was removed
and the cells washed twice in serum-free media. Fresh serum-free
media was added to the cells, without G418, and the supernatants
and cells harvested after 48 hours. Supernatants were stored at
-70.degree. C. until used.
ELISA Assay
[0059] Concentrations of Hu p75 TNF-R ECD, produced by transfected
GPenvAm12 cells, were determined by ELISA. The monoclonal antibody
4C8 (Dr. Buurman, Maastricht, The Netherlands) was used as trapping
antibody and the ELISA assay performed as described (Bemelmans, M.
H. A., et al., Cytokine, 6:608 (1994)). A titration curve was
prepared with a standard Hu p75 TNF-R ECD diluted 1:1 in PBS, 0.1%
BSA at concentrations ranging from 62 pg/ml to 5 ng/ml. The amounts
secreted averaged 560 pg/ml (3400 pg/plate) and were too low for
irnmediate detection by Western blot analysis.
Western Blot
[0060] The serum-free medium from the GPenvAM 12 cells was
concentrated by centrifugation using Amicon Centricon 30
concentrators. The concentration of the soluble TNF inhibitors were
determined by ELISA.
[0061] 9% SDS-PAGE were run to standard western protocol and probed
using the monoclonal antibody 4C8 to the Hu TNF-R75 ECD and a
polyclonal anti mouse secondary antibody crosslinked with
horseradish peroxidase. Westerns were developed using the ECL
detection system (Amersham).
[0062] Each slot contained from left to right: 0.5 ng of dimeric Hu
p75 TNF-R ECD, GPenvAM12 control supernatants I and 2, 1 .mu.g
soluble p75 sf2 Ig dimer (Butler, D., et al., Cytokine, 6:616
(1994)) and 8.7 .mu.g soluble hs p75 TNF-R CRIP monomer. These were
separated on a 9% acrylarnide gel, electroblotted onto
nitrocellulose, probed with 4C8 monoclonal antibodies and
HRP-linked secondary antibodies and developed using the ECL
system.
[0063] After concentration of the supernatants to 20 ng/ml, the Hu
p75 TNF-R ECD dimer was clearly detected in the supernatant of
Oscar stable tranfectants as a band of apparent molecular weight of
59 kDa (FIG. 4, left lane). The arrow indicates the sTNF-R dimer
with apparent molecular weight of 59 kDa. The positions of
molecular weight markers are indicated on the right. The band,
detected by the monoclonal antibody 4C8 was not present in the
GPenvAml2 untransfected cell supernatants. The expected molecular
weight of the dimer was 53 kDa although there are four potential
N-linked glycosylation sites within the Hu p75 TNF-R ECD protein
(FIG. 3). This glycosylation sites may explain the increase in
apparent molecular weight.
[0064] The Hu p75 TNF-R ECD dimer protein seems to be stable to
proteolytic degradation since no smaller products were detected
especially when compared to the Ig- fusion protein p75 sf2 (FIG.
4). The smaller difference seen between the monomeric 40 kDa (FIG.
4, right lane) and the dimeric 59 kDa dimeric Hu p75 TNF-R ECD
(FIG. 4, left lane) is probably due to secondary structure obtained
by the presence of the polyglycine-serine linker.
EXAMPLE 3
Protection from TNF Cytotoxicity on WEHI cells by Hu p75 TNF-R ECD
Construct
[0065] WEHI Assay. The concentrated supernatants were tested for
protection against TNF cytotoxicity in the WEHI cell assay. To
measure the inhibitory effect of the expressed Hu p75 TNF-R ECD
dimer on TNF cytotoxic activity, WHEI 164 clone 13 mouse
fibrosarcoma cells were used (Espevic, T., and Nissen-Meyer, J., J.
Immunol. Methods, 95:99 (1986)).
[0066] FIG. 5 shows the protective effect obtained in this assay
when TNF was preincubated with dilutions of various Hu p75 TNF-R
ECD proteins. However, the two dimeric Hu p75 TNF-R ECD constructs
namely p75 sf2 and Oscar efficiently protected WEHI cells from TNF
cytotoxicity. Table 1 shows that 20 pg dimeric Hu TNF-R75 ECD were
sufficient to inhibit by 50% the killing activity of 63.5 pg of
human TNF. In comparison, 57 pg of the dimeric Hu p75 TNF-R ECD in
an Ig backbone (p75 sf2) (Butler, D., et al., Cytokine, 6:616
(1994)) were needed to obtain the same level of protection. This
lower than expected activity of the p75 sf2 construct may be due to
the partial degradation in this protein (FIG. 4) that affected its
efficiency. The monomeric Hu TNF-R75 ECD at 300 fold higher
concentration was not effective at blocking TNF cytoxicity in the
WEHI assay (FIG. 5). The cell line CRIP producing monomeric Hu p75
TNF-R ECD, was provided by Dr. Paul Robbins, University of
Pittsburgh.
[0067] The concentration of 20 pg/ml Hu p75 TNF-R ECD dimer needed
to inhibit by 50% the cytotoxic effect of 62.5 pg/ml TNF indicates
that this antagonist is capable of binding to the TNF homotrimer in
a stoichiometric ratio of almost 1:1. TABLE-US-00002 TABLE 1
Specific activity of Hu p75 TNF-R ECD dimer 50% Mr (kD) protection
OSCAR 59,000 20 pg/ml (Hu p75 TNF-R ECD dimer) hs p75 TNF-R CRIP
40,000 N/A (Hu p75 TNF-R ECD monomer) IgG-ECD 150,000 57 pg/ml (Hu
p75 TNF-R ECD dimer on Ig)
Equivalents
[0068] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
specifically herein. Such equivalents are intended to be
encompassed in the scope of the following claims.
Sequence CWU 1
1
4 1 1506 DNA Artificial Sequence CDS (1)...(1506) Open Reading
Frame of Human P75 TNF-R ECD 1 atg gcg ccc gtc gcc gtc tgg gcc gcg
ctg gcc gtc gga ctg gag ctc 48 Met Ala Pro Val Ala Val Trp Ala Ala
Leu Ala Val Gly Leu Glu Leu 1 5 10 15 tgg gct gcg gcg cac gcc ttg
ccc gcc cag gtg gca ttt aca ccc tac 96 Trp Ala Ala Ala His Ala Leu
Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30 gcc ccg gag ccc ggg
agc aca tgc cgg ctc aga gaa tac tat gac cag 144 Ala Pro Glu Pro Gly
Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45 aca gct cag
atg tgc tgc agc aaa tgc tcg ccg ggc caa cat gca aaa 192 Thr Ala Gln
Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60 gtc
ttc tgt acc aag acc tcg gac acc gtg tgt gac tcc tgt gag gac 240 Val
Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp 65 70
75 80 agc aca tac acc cag ctc tgg aac tgg gtt ccc gag tgc ttg agc
tgt 288 Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro Glu Cys Leu Ser
Cys 85 90 95 ggc tcc cgc tgt agc tct gac cag gtg gaa act caa gcc
tgc act cgg 336 Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala
Cys Thr Arg 100 105 110 gaa cag aac cgc atc tgc acc tgc agg ccc ggc
tgg tac tgc gcg ctg 384 Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly
Trp Tyr Cys Ala Leu 115 120 125 agc aag cag gag ggg tgc cgg ctg tgc
gcg ccg ctg cgc aag tgc cgc 432 Ser Lys Gln Glu Gly Cys Arg Leu Cys
Ala Pro Leu Arg Lys Cys Arg 130 135 140 ccg ggc ttc ggc gtg gcc aga
cca gga act gaa aca tca gac gtg gtg 480 Pro Gly Phe Gly Val Ala Arg
Pro Gly Thr Glu Thr Ser Asp Val Val 145 150 155 160 tgc aag ccc tgt
gcc ccg ggg acg ttc tcc aac acg act tca tcc acg 528 Cys Lys Pro Cys
Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175 gat att
tgc agg ccc cac cag atc tgt aac gtg gtg gcc atc cct ggg 576 Asp Ile
Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190
aat gca agc atg gat gca gtc tgc acg tcc acg tcc ccc acc cgg agt 624
Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195
200 205 atg gcc cca ggg gca gta cac tta ccc cag cca gtg tcc aca cga
tcc 672 Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg
Ser 210 215 220 caa cac acg cag cca act cca gaa ccc agc act gct cca
agc acc tcc 720 Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro
Ser Thr Ser 225 230 235 240 ttc ctg ctc cca atg ggc ccc agc ccc cca
gct aga ggt ggg ggc ggt 768 Phe Leu Leu Pro Met Gly Pro Ser Pro Pro
Ala Arg Gly Gly Gly Gly 245 250 255 tcg ggt ggc ggc ggc tcg ggc ggg
ggt ggc tcg gat ccc gcc cag gtg 816 Ser Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Asp Pro Ala Gln Val 260 265 270 gca ttt aca ccc tac gcc
ccg gag ccc ggg agc aca tgc cgg ctc aga 864 Ala Phe Thr Pro Tyr Ala
Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg 275 280 285 gaa tac tat gac
cag aca gct cag atg tgc tgc agc aaa tgc tcg ccg 912 Glu Tyr Tyr Asp
Gln Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro 290 295 300 ggc caa
cat gca aaa gtc ttc tgt acc aag acc tcg gac acc gtg tgt 960 Gly Gln
His Ala Lys Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys 305 310 315
320 gac tcc tgt gag gac agc aca tac acc cag ctc tgg aac tgg gtt ccc
1008 Asp Ser Cys Glu Asp Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val
Pro 325 330 335 gag tgc ttg agc tgt ggc tcc cgc tgt agc tct gac cag
gtg gaa act 1056 Glu Cys Leu Ser Cys Gly Ser Arg Cys Ser Ser Asp
Gln Val Glu Thr 340 345 350 caa gcc tgc act cgg gaa cag aac cgc atc
tgc acc tgc agg ccc ggc 1104 Gln Ala Cys Thr Arg Glu Gln Asn Arg
Ile Cys Thr Cys Arg Pro Gly 355 360 365 tgg tac tgc gcg ctg agc aag
cag gag ggg tgc cgg ctg tgc gcg ccg 1152 Trp Tyr Cys Ala Leu Ser
Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro 370 375 380 ctg cgc aag tgc
cgc ccg ggc ttc ggc gtg gcc aga cca gga act gaa 1200 Leu Arg Lys
Cys Arg Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu 385 390 395 400
aca tca gac gtg gtg tgc aag ccc tgt gcc ccg ggg acg ttc tcc aac
1248 Thr Ser Asp Val Val Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser
Asn 405 410 415 acg act tca tcc acg gat att tgc agg ccc cac cag atc
tgt aac gtg 1296 Thr Thr Ser Ser Thr Asp Ile Cys Arg Pro His Gln
Ile Cys Asn Val 420 425 430 gtg gcc atc cct ggg aat gca agc atg gat
gca gtc tgc acg tcc acg 1344 Val Ala Ile Pro Gly Asn Ala Ser Met
Asp Ala Val Cys Thr Ser Thr 435 440 445 tcc ccc acc cgg agt atg gcc
cca ggg gca gta cac tta ccc cag cca 1392 Ser Pro Thr Arg Ser Met
Ala Pro Gly Ala Val His Leu Pro Gln Pro 450 455 460 gtg tcc aca cga
tcc caa cac acg cag cca act cca gaa ccc agc act 1440 Val Ser Thr
Arg Ser Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr 465 470 475 480
gct cca agc acc tcc ttc ctg ctc cca atg ggc ccc agc ccc cca gct
1488 Ala Pro Ser Thr Ser Phe Leu Leu Pro Met Gly Pro Ser Pro Pro
Ala 485 490 495 gaa ggg agc act ggc tag 1506 Glu Gly Ser Thr Gly *
500 2 501 PRT Artificial Sequence Open Reading Frame of Human P75
TNF-R ECD 2 Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu
Glu Leu 1 5 10 15 Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala
Phe Thr Pro Tyr 20 25 30 Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu
Arg Glu Tyr Tyr Asp Gln 35 40 45 Thr Ala Gln Met Cys Cys Ser Lys
Cys Ser Pro Gly Gln His Ala Lys 50 55 60 Val Phe Cys Thr Lys Thr
Ser Asp Thr Val Cys Asp Ser Cys Glu Asp 65 70 75 80 Ser Thr Tyr Thr
Gln Leu Trp Asn Trp Val Pro Glu Cys Leu Ser Cys 85 90 95 Gly Ser
Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110
Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115
120 125 Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys
Arg 130 135 140 Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser
Asp Val Val 145 150 155 160 Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser
Asn Thr Thr Ser Ser Thr 165 170 175 Asp Ile Cys Arg Pro His Gln Ile
Cys Asn Val Val Ala Ile Pro Gly 180 185 190 Asn Ala Ser Met Asp Ala
Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205 Met Ala Pro Gly
Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220 Gln His
Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser 225 230 235
240 Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Arg Gly Gly Gly Gly
245 250 255 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Pro Ala
Gln Val 260 265 270 Ala Phe Thr Pro Tyr Ala Pro Glu Pro Gly Ser Thr
Cys Arg Leu Arg 275 280 285 Glu Tyr Tyr Asp Gln Thr Ala Gln Met Cys
Cys Ser Lys Cys Ser Pro 290 295 300 Gly Gln His Ala Lys Val Phe Cys
Thr Lys Thr Ser Asp Thr Val Cys 305 310 315 320 Asp Ser Cys Glu Asp
Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro 325 330 335 Glu Cys Leu
Ser Cys Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr 340 345 350 Gln
Ala Cys Thr Arg Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly 355 360
365 Trp Tyr Cys Ala Leu Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro
370 375 380 Leu Arg Lys Cys Arg Pro Gly Phe Gly Val Ala Arg Pro Gly
Thr Glu 385 390 395 400 Thr Ser Asp Val Val Cys Lys Pro Cys Ala Pro
Gly Thr Phe Ser Asn 405 410 415 Thr Thr Ser Ser Thr Asp Ile Cys Arg
Pro His Gln Ile Cys Asn Val 420 425 430 Val Ala Ile Pro Gly Asn Ala
Ser Met Asp Ala Val Cys Thr Ser Thr 435 440 445 Ser Pro Thr Arg Ser
Met Ala Pro Gly Ala Val His Leu Pro Gln Pro 450 455 460 Val Ser Thr
Arg Ser Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr 465 470 475 480
Ala Pro Ser Thr Ser Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala 485
490 495 Glu Gly Ser Thr Gly 500 3 30 DNA Artificial Sequence
deoxyoligonucleotide primer 3 tcggatcccg cccaggtggc atttacaccc 30 4
20 DNA Artificial Sequence deoxyoligonucleotide primer 4 cggaattcta
gaaggtaccc 20
* * * * *