U.S. patent application number 11/358863 was filed with the patent office on 2006-09-28 for rna interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (sina).
This patent application is currently assigned to Sirna Therapeutics, Inc.. Invention is credited to Leonid Beigelman, Tongqian Chen, Bharat Chowrira, Kathy Fosnaugh, Peter Haeberli, Sharon Jamison, Dennis Macejak, James McSwiggen, David Morrissey, Pamela Pavco, James Thompson, Nassim Usman, Narendra Vaish, Chandra Vargeese, Weimin Wang, Shawn Zinnen.
Application Number | 20060217336 11/358863 |
Document ID | / |
Family ID | 46299317 |
Filed Date | 2006-09-28 |
United States Patent
Application |
20060217336 |
Kind Code |
A1 |
McSwiggen; James ; et
al. |
September 28, 2006 |
RNA interference mediated inhibition of gene expression using
chemically modified short interfering nucleic acid (siNA)
Abstract
The present invention concerns methods and reagents useful in
modulating gene expression in a variety of applications, including
use in therapeutic, diagnostic, target validation, and genomic
discovery applications. Specifically, the invention relates to
synthetic chemically modified small nucleic acid molecules, such as
short interfering nucleic acid (siNA), short interfering RNA
(siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short
hairpin RNA (shRNA) molecules capable of mediating RNA interference
(RNAi) against target nucleic acid sequences. The small nucleic
acid molecules are useful in the treatment of any disease or
condition that responds to modulation of gene expression or
activity in a cell, tissue, or organism.
Inventors: |
McSwiggen; James; (Boulder,
CO) ; Chowrira; Bharat; (Louisville, CO) ;
Beigelman; Leonid; (Longmont, CO) ; Macejak;
Dennis; (Arvada, CO) ; Zinnen; Shawn; (Denver,
CO) ; Pavco; Pamela; (Lafayette, CO) ;
Haeberli; Peter; (Berthoud, CO) ; Morrissey;
David; (Boulder, CO) ; Fosnaugh; Kathy;
(Boulder, CO) ; Jamison; Sharon; (Boulder, CO)
; Usman; Nassim; (Lafayette, CO) ; Thompson;
James; (Lafayette, CO) ; Vargeese; Chandra;
(Thorton, CO) ; Wang; Weimin; (Superior, CO)
; Chen; Tongqian; (Longmont, CO) ; Vaish;
Narendra; (Boulder, CO) |
Correspondence
Address: |
MCDONNELL BOEHNEN HULBERT & BERGHOFF LLP
300 S. WACKER DRIVE
32ND FLOOR
CHICAGO
IL
60606
US
|
Assignee: |
Sirna Therapeutics, Inc.
Boulder
CO
|
Family ID: |
46299317 |
Appl. No.: |
11/358863 |
Filed: |
February 21, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10444853 |
May 23, 2003 |
|
|
|
11358863 |
Feb 21, 2006 |
|
|
|
10417012 |
Apr 16, 2003 |
|
|
|
10444853 |
May 23, 2003 |
|
|
|
PCT/US03/05346 |
Feb 20, 2003 |
|
|
|
10444853 |
May 23, 2003 |
|
|
|
PCT/US03/05028 |
Feb 20, 2003 |
|
|
|
10444853 |
May 23, 2003 |
|
|
|
10427160 |
Apr 30, 2003 |
|
|
|
10444853 |
|
|
|
|
PCT/US02/15876 |
May 17, 2002 |
|
|
|
10444853 |
|
|
|
|
60358580 |
Feb 20, 2002 |
|
|
|
60358580 |
Feb 20, 2002 |
|
|
|
60363124 |
Mar 11, 2002 |
|
|
|
60363124 |
Mar 11, 2002 |
|
|
|
60386782 |
Jun 6, 2002 |
|
|
|
60406784 |
Aug 29, 2002 |
|
|
|
60406784 |
Aug 29, 2002 |
|
|
|
60408378 |
Sep 5, 2002 |
|
|
|
60408378 |
Sep 5, 2002 |
|
|
|
60409293 |
Sep 9, 2002 |
|
|
|
60409293 |
Sep 9, 2002 |
|
|
|
60440129 |
Jan 15, 2003 |
|
|
|
60440129 |
Jan 15, 2003 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/25.3; 544/243 |
Current CPC
Class: |
Y02A 50/465 20180101;
C12N 2310/321 20130101; C12N 2310/317 20130101; A61K 47/544
20170801; C12N 2310/315 20130101; C12N 2310/346 20130101; C12N
15/111 20130101; C12N 2320/51 20130101; C07F 9/65616 20130101; C12N
2310/322 20130101; A61K 47/554 20170801; C12N 2330/30 20130101;
A61K 47/549 20170801; C12N 2310/351 20130101; Y02A 50/30 20180101;
C12N 2310/14 20130101; A61K 9/0019 20130101; C12N 2310/321
20130101; C12N 2310/3521 20130101 |
Class at
Publication: |
514/044 ;
536/025.3; 544/243 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C07H 21/00 20060101 C07H021/00; C07F 9/6512 20060101
C07F009/6512 |
Claims
1. A method of synthesizing a double stranded nucleic acid molecule
consisting of a sense strand and an antisense strand, wherein: (a)
each strand of said double stranded nucleic acid molecule is 19 to
29 nucleotides in length; (b) at least 19 nucleotides of the sense
strand are complementary to the antisense strand (c) the antisense
strand of said double stranded nucleic acid molecule has
complementarity to a target RNA encoded by a human gene; (d) at
least 35% of the nucleotides of each strand of said double stranded
nucleic acid molecule are modified nucleosides having a sugar
modification; and (e) at least two of said sugar modifications are
different from each other; the method comprising (i) synthesizing
two strands of nucleic acid molecules that have the structural
features described in parts (a)-(e), and (ii) annealing the two
complementary strands under conditions suitable to obtain a
double-stranded nucleic acid molecule.
2. The method of claim 1, wherein said double stranded nucleic acid
molecule comprises no ribonucleotides.
3. The method of claim 1, wherein said double stranded nucleic acid
molecule comprises ribonucleotides.
4. The method of claim 1, wherein pyrimidine nucleotides in the
sense strand are 2'-O-methylpyrimidine nucleotides.
5. The method of claim 1, wherein purine nucleotides in the sense
strand are 2'-deoxy purine nucleotides.
6. The method of claim 1, wherein the pyrimidine nucleotides
present in the sense strand are 2'-deoxy-2'-fluoro pyrimidine
nucleotides.
7. The method of claim 1, wherein the sense strand has a terminal
cap moiety at the 5'-end, the 3'-end, or both of the 5' and 3'
ends.
8. The method of claim 7, wherein said terminal cap moiety is an
inverted deoxy abasic moiety.
9. The method of claim 1, wherein the pyrimidine nucleotides of
said antisense strand are 2'-deoxy-2'-fluoro pyrimidine
nucleotides.
10. The method of claim 1, wherein the purine nucleotides of said
antisense strand are 2'-O-methyl purine nucleotides.
11. The method of claim 1, wherein the purine nucleotides present
in said antisense strand comprise 2'-deoxy-purine nucleotides.
12. The method of claim 10, wherein said antisense strand comprises
a phosphorothioate internucleotide linkage at the 3' end.
13. The method of claim 1, wherein each of the two strands of said
double stranded nucleic acid molecule is 21 nucleotides in
length.
14. The method of claim 13, wherein at least two 3' terminal
nucleotides of each strand of the double stranded nucleic acid
molecule are not base-paired to the nucleotides of the other strand
of the double stranded nucleic acid molecule.
15. The method of claim 14, wherein each of the two 3' terminal
nucleotides of each strand of the double stranded nucleic acid
molecule are 2'-deoxy-pyrimidines.
16. The method of claim 15, wherein said 2'-deoxy-pyrimidine is
2'-deoxythymidine.
17. The method of claim 13, wherein all 21 nucleotides of each
strand of the double stranded nucleic acid molecule are base-paired
to the complementary nucleotides of the other strand of the double
stranded nucleic acid molecule.
18. The method of claim 13, wherein 19 nucleotides of the antisense
strand are base-paired to the target RNA.
19. The method of claim 13, wherein 21 nucleotides of the antisense
strand are base-paired to the target RNA.
20. The method of claim 1, wherein the 5'-end of the antisense
strand includes a phosphate group.
21. The method of claim 1, wherein said sugar modifications are
selected from the group consisting of 2'-H, 2'-O-alkyl,
2'-O--CF.sub.3 and 2'-deoxy-2'-fluoro.
22. The method of claim 1, wherein each strand of said double
stranded nucleic acid molecule is about 19 to 23 nucleotides in
length and at least about 19 nucleotides of the sense strand are
complementary to the antisense strand
23. A method of synthesizing a double stranded nucleic acid
molecule consisting of a sense strand and an antisense strand,
wherein: (a) each strand of said double stranded nucleic acid
molecule is 18 to 27 nucleotides in length; (b) 18-23 nucleotides
of the sense strand are complementary to the antisense strand (c)
the antisense strand of said double stranded nucleic acid molecule
has complementarity to a target RNA encoded by a human gene; (d) at
least 35% of the nucleotides of each strand of said double stranded
nucleic acid molecule are modified nucleosides having a sugar
modification; and (e) at least two of said sugar modifications are
different from each other, and the method comprising (i)
synthesizing two strands of nucleic acid molecules that have the
structural features described in parts (a)-(e), and (ii) annealing
the two complementary strands under conditions suitable to obtain a
double-stranded nucleic acid molecule.
Description
[0001] This application is a division of U.S. patent application
Ser. No. 10/444,853, filed May 23, 2003, which is a
continuation-in-part of U.S. patent application Ser. No.
10/417,012, filed Apr. 16, 2003, and a continuation-in-part of
International Patent Application No. PCT/US03/05346, filed Feb. 20,
2003, and a continuation-in-part of International Patent
Application No. PCT/US03/05028, filed Feb. 20, 2003, which the
International Patent Applications claim the benefit of U.S.
Provisional Application No. 60/358,580, filed Feb. 20, 2002, U.S.
Provisional Application No. 60/363,124, filed Mar. 11, 2002, U.S.
Provisional Application No. 60/386,782, filed Jun. 6, 2002, U.S.
Provisional Application No. 60/406,784, filed Aug. 29, 2002, U.S.
Provisional Application No. 60/408,378, filed Sep. 5, 2002, U.S.
Provisional Application No. 60/409,293, filed Sep. 9, 2002, and
U.S. Provisional Application No. 60/440,129, filed Jan. 15, 2003.
U.S. patent application Ser. No. 10/444,853 is also a
continuation-in-part of U.S. patent application Ser. No. 10/427,160
filed Apr. 30, 2003 and International Patent Application No.
PCT/US02/15876 filed May 17, 2002. The instant application claims
the benefit of all the listed applications, which are hereby
incorporated by reference in their entireties, including the
drawings.
FIELD OF THE INVENTION
[0002] The present invention concerns methods and reagents useful
in modulating gene expression in a variety of applications,
including use in therapeutic, diagnostic, target validation, and
genomic discovery applications. Specifically, the invention relates
to synthetic small nucleic acid molecules, such as short
interfering nucleic acid (siNA), short interfering RNA (siRNA),
double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin
RNA (shRNA) molecules capable of mediating RNA interference
(RNAi).
BACKGROUND OF THE INVENTION
[0003] The following is a discussion of relevant art pertaining to
RNAi. The discussion is provided only for understanding of the
invention that follows. The summary is not an admission that any of
the work described below is prior art to the claimed invention.
Applicant demonstrates herein that chemically modified short
interfering nucleic acids possess the same capacity to mediate RNAi
as do siRNA molecules and are expected to possess improved
stability and activity in vivo; therefore, this discussion is not
meant to be limiting only to siRNA and can be applied to siNA as a
whole.
[0004] RNA interference refers to the process of sequence-specific
post-transcriptional gene silencing in animals mediated by short
interfering RNAs (siRNAs) (Fire et al., 1998, Nature, 391, 806;
Hamilton et al., 1999, Science, 286, 950-951). The corresponding
process in plants is commonly referred to as post-transcriptional
gene silencing or RNA silencing and is also referred to as quelling
in fungi. The process of post-transcriptional gene silencing is
thought to be an evolutionarily-conserved cellular defense
mechanism used to prevent the expression of foreign genes and is
commonly shared by diverse flora and phyla (Fire et al., 1999,
Trends Genet., 15, 358). Such protection from foreign gene
expression may have evolved in response to the production of
double-stranded RNAs (dsRNAs) derived from viral infection or from
the random integration of transposon elements into a host genome
via a cellular response that specifically destroys homologous
single-stranded RNA or viral genomic RNA. The presence of dsRNA in
cells triggers the RNAi response though a mechanism that has yet to
be fully characterized. This mechanism appears to be different from
the interferon response that results from dsRNA-mediated activation
of protein kinase PKR and 2',5'-oligoadenylate synthetase resulting
in non-specific cleavage of mRNA by ribonuclease L.
[0005] The presence of long dsRNAs in cells stimulates the activity
of a ribonuclease III enzyme referred to as dicer. Dicer is
involved in the processing of the dsRNA into short pieces of dsRNA
known as short interfering RNAs (siRNAs) (Hamilton et al., supra;
Berstein et al., 2001, Nature, 409, 363). Short interfering RNAs
derived from dicer activity are typically about 21 to about 23
nucleotides in length and comprise about 19 base pair duplexes
(Hamilton et al., supra; Elbashir et al., 2001, Genes Dev., 15,
188). Dicer has also been implicated in the excision of 21- and
22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of
conserved structure that are implicated in translational control
(Hutvagner et al., 2001, Science, 293, 834). The RNAi response also
features an endonuclease complex, commonly referred to as an
RNA-induced silencing complex (RISC), which mediates cleavage of
single-stranded RNA having sequence complementary to the antisense
strand of the siRNA duplex. Cleavage of the target RNA takes place
in the middle of the region complementary to the antisense strand
of the siRNA duplex (Elbashir et al., 2001, Genes Dev., 15,
188).
[0006] RNAi has been studied in a variety of systems. Fire et al.,
1998, Nature, 391, 806, were the first to observe RNAi in C.
elegans. Bahramian and Zarbl, 1999, Molecular and Cellular Biology,
19, 274-283 and Wianny and Goetz, 1999, Nature Cell Biol., 2, 70,
describe RNAi mediated by dsRNA in mammalian systems. Hammond et
al., 2000, Nature, 404, 293, describe RNAi in Drosophila cells
transfected with dsRNA. Elbashir et al., 2001, Nature, 411, 494,
describe RNAi induced by introduction of duplexes of synthetic
21-nucleotide RNAs in cultured mammalian cells including human
embryonic kidney and HeLa cells. Recent work in Drosophila
embryonic lysates (Elbashir et al., 2001, EMBO J., 20, 6877) has
revealed certain requirements for siRNA length, structure, chemical
composition, and sequence that are essential to mediate efficient
RNAi activity. These studies have shown that 21-nucleotide siRNA
duplexes are most active when containing 3'-terminal dinucleotide
overhangs. Furthermore, complete substitution of one or both siRNA
strands with 2'-deoxy (2'-H) or 2'-O-methyl nucleotides abolishes
RNAi activity, whereas substitution of the 3'-terminal siRNA
overhang nucleotides with 2'-deoxy nucleotides (2'-H) was shown to
be tolerated. Single mismatch sequences in the center of the siRNA
duplex were also shown to abolish RNAi activity. In addition, these
studies also indicate that the position of the cleavage site in the
target RNA is defined by the 5'-end of the siRNA guide sequence
rather than the 3'-end of the guide sequence (Elbashir et al.,
2001, EMBO J., 20, 6877). Other studies have indicated that a
5'-phosphate on the target-complementary strand of a siRNA duplex
is required for siRNA activity and that ATP is utilized to maintain
the 5'-phosphate moiety on the siRNA (Nykanen et al., 2001, Cell,
107, 309).
[0007] Studies have shown that replacing the 3'-terminal nucleotide
overhanging segments of a 21-mer siRNA duplex having two-nucleotide
3'-overhangs with deoxyribonucleotides does not have an adverse
effect on RNAi activity. Replacing up to four nucleotides on each
end of the siRNA with deoxyribonucleotides has been reported to be
well tolerated, whereas complete substitution with
deoxyribonucleotides results in no RNAi activity (Elbashir et al.,
2001, EMBO J., 20, 6877). In addition, Elbashir et al., supra, also
report that substitution of siRNA with 2'-O-methyl nucleotides
completely abolishes RNAi activity. Li et al., International PCT
Publication No. WO 00/44914, and Beach et al., International PCT
Publication No. WO 01/68836 preliminarily suggest that siRNA may
include modifications to either the phosphate-sugar backbone or the
nucleoside to include at least one of a nitrogen or sulfur
heteroatom, however, neither application postulates to what extent
such modifications would be tolerated in siRNA molecules, nor
provides any further guidance or examples of such modified siRNA.
Kreutzer et al., Canadian Patent Application No. 2,359,180, also
describe certain chemical modifications for use in dsRNA constructs
in order to counteract activation of double-stranded RNA-dependent
protein kinase PKR, specifically 2'-amino or 2'-O-methyl
nucleotides, and nucleotides containing a 2'-O or 4'-C methylene
bridge. However, Kreutzer et al. similarly fails to provide
examples or guidance as to what extent these modifications would be
tolerated in siRNA molecules.
[0008] Parrish et al., 2000, Molecular Cell, 6, 1077-1087, tested
certain chemical modifications targeting the unc-22 gene in C.
elegans using long (>25 nt) siRNA transcripts. The authors
describe the introduction of thiophosphate residues into these
siRNA transcripts by incorporating thiophosphate nucleotide analogs
with T7 and T3 RNA polymerase and observed that RNAs with two
phosphorothioate modified bases also had substantial decreases in
effectiveness as RNAi. Further, Parrish et al. reported that
phosphorothioate modification of more than two residues greatly
destabilized the RNAs in vitro such that interference activities
could not be assayed. Id. at 1081. The authors also tested certain
modifications at the 2'-position of the nucleotide sugar in the
long siRNA transcripts and found that substituting deoxynucleotides
for ribonucleotides produced a substantial decrease in interference
activity, especially in the case of Uridine to Thymidine and/or
Cytidine to deoxy-Cytidine substitutions. Id. In addition, the
authors tested certain base modifications, including substituting,
in sense and antisense strands of the siRNA, 4-thiouracil,
5-bromouracil, 5-iodouracil, and 3-(aminoallyl)uracil for uracil,
and inosine for guanosine. Whereas 4-thiouracil and 5-bromouracil
substitution appeared to be tolerated, Parrish reported that
inosine produced a substantial decrease in interference activity
when incorporated in either strand. Parrish also reported that
incorporation of 5-iodouracil and 3-(aminoallyl)uracil in the
antisense strand resulted in a substantial decrease in RNAi
activity as well.
[0009] The use of longer dsRNA has been described. For example,
Beach et al., International PCT Publication No. WO 01/68836,
describes specific methods for attenuating gene expression using
endogenously-derived dsRNA. Tuschl et al., International PCT
Publication No. WO 01/75164, describe a Drosophila in vitro RNAi
system and the use of specific siRNA molecules for certain
functional genomic and certain therapeutic applications; although
Tuschl, 2001, Chem. Biochem., 2, 239-245, doubts that RNAi can be
used to cure genetic diseases or viral infection due to the danger
of activating interferon response. Li et al., International PCT
Publication No. WO 00/44914, describe the use of specific dsRNAs
for attenuating the expression of certain target genes.
Zernicka-Goetz et al., International PCT Publication No. WO
01/36646, describe certain methods for inhibiting the expression of
particular genes in mammalian cells using certain dsRNA molecules.
Fire et al., International PCT Publication No. WO 99/32619,
describe particular methods for introducing certain dsRNA molecules
into cells for use in inhibiting gene expression. Plaetinck et al.,
International PCT Publication No. WO 00/01846, describe certain
methods for identifying specific genes responsible for conferring a
particular phenotype in a cell using specific dsRNA molecules.
Mello et al., International PCT Publication No. WO 01/29058,
describe the identification of specific genes involved in
dsRNA-mediated RNAi. Deschamps Depaillette et al., International
PCT Publication No. WO 99/07409, describe specific compositions
consisting of particular dsRNA molecules combined with certain
anti-viral agents. Waterhouse et al., International PCT Publication
No. 99/53050, describe certain methods for decreasing the
phenotypic expression of a nucleic acid in plant cells using
certain dsRNAs. Driscoll et al., International PCT Publication No.
WO 01/49844, describe specific DNA constructs for use in
facilitating gene silencing in targeted organisms.
[0010] Others have reported on various RNAi and gene-silencing
systems. For example, Parrish et al., 2000, Molecular Cell, 6,
1077-1087, describe specific chemically-modified siRNA constructs
targeting the unc-22 gene of C. elegans. Grossniklaus,
International PCT Publication No. WO 01/38551, describes certain
methods for regulating polycomb gene expression in plants using
certain dsRNAs. Churikov et al., International PCT Publication No.
WO 01/42443, describe certain methods for modifying genetic
characteristics of an organism using certain dsRNAs. Cogoni et al.,
International PCT Publication No. WO 01/53475, describe certain
methods for isolating a Neurospora silencing gene and uses thereof.
Reed et al., International PCT Publication No. WO 01/68836,
describe certain methods for gene silencing in plants. Honer et
al., International PCT Publication No. WO 01/70944, describe
certain methods of drug screening using transgenic nematodes as
Parkinson's Disease models using certain dsRNAs. Deak et al.,
International PCT Publication No. WO 01/72774, describe certain
Drosophila-derived gene products that may be related to RNAi in
Drosophila. Arndt et al., International PCT Publication No. WO
01/92513 describe certain methods for mediating gene suppression by
using factors that enhance RNAi. Tuschl et al., International PCT
Publication No. WO 02/44321, describe certain synthetic siRNA
constructs. Pachuk et al., International PCT Publication No. WO
00/63364, and Satishchandran et al., International PCT Publication
No. WO 01/04313, describe certain methods and compositions for
inhibiting the function of certain polynucleotide sequences using
certain dsRNAs. Echeverri et al., International PCT Publication No.
WO 02/38805, describe certain C. elegans genes identified via RNAi.
Kreutzer et al., International PCT Publications Nos. WO 02/055692,
WO 02/055693, and EP 1144623 B1 describes certain methods for
inhibiting gene expression using RNAi. Graham et al., International
PCT Publications Nos. WO 99/49029 and WO 01/70949, and AU 4037501
describe certain vector expressed siRNA molecules. Fire et al.,
U.S. Pat. No. 6,506,559, describe certain methods for inhibiting
gene expression in vitro using certain long dsRNA (greater than 25
nucleotide) constructs that mediate RNAi.
SUMMARY OF THE INVENTION
[0011] This invention relates to compounds, compositions, and
methods useful for modulating RNA function and/or gene expression
in a cell. Specifically, the instant invention features synthetic
small nucleic acid molecules, such as short interfering nucleic
acid (siNA), short interfering RNA (siRNA), double-stranded RNA
(dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules
capable of modulating gene expression in cells by RNA inference
(RNAi). The siNA molecules of the invention can be chemically
modified. The use of chemically modified siNA can improve various
properties of native siRNA molecules through increased resistance
to nuclease degradation in vivo and/or improved cellular uptake.
The chemically modified siNA molecules of the instant invention
provide useful reagents and methods for a variety of therapeutic,
diagnostic, agricultural, target validation, genomic discovery,
genetic engineering and pharmacogenomic applications.
[0012] In a non-limiting example, the introduction of chemically
modified nucleotides into nucleic acid molecules provides a
powerful tool in overcoming potential limitations of in vivo
stability and bioavailability inherent to native RNA molecules that
are delivered exogenously. For example, the use of chemically
modified nucleic acid molecules can enable a lower dose of a
particular nucleic acid molecule for a given therapeutic effect
since chemically modified nucleic acid molecules tend to have a
longer half-life in serum. Furthermore, certain chemical
modifications can improve the bioavailability of nucleic acid
molecules by targeting particular cells or tissues and/or improving
cellular uptake of the nucleic acid molecule. Therefore, even if
the activity of a chemically modified nucleic acid molecule is
reduced as compared to a native nucleic acid molecule, for example
when compared to an all RNA nucleic acid molecule, the overall
activity of the modified nucleic acid molecule can be greater than
the native molecule due to improved stability and/or delivery of
the molecule. Unlike native unmodified siRNA, chemically modified
siNA can also minimize the possibility of activating interferon
activity in humans.
[0013] In one embodiment, the nucleic acid molecules of the
invention that act as mediators of the RNA interference gene
silencing response are chemically modified double stranded nucleic
acid molecules. As in their native double stranded RNA
counterparts, these siNA molecules typically consist of duplexes
containing about 19 base pairs between oligonucleotides comprising
about 19 to about 25 nucleotides. The most active siRNA molecules
are thought to have such duplexes with overhanging ends of 1-3
nucleotides, for example 21 nucleotide duplexes with 19 base pairs
and 2 nucleotide 3'-overhangs. These overhanging segments are
readily hydrolyzed by endonucleases in vivo. Studies have shown
that replacing the 3'-overhanging segments of a 21-mer siRNA duplex
having 2 nucleotide 3' overhangs with deoxyribonucleotides does not
have an adverse effect on RNAi activity. Replacing up to 4
nucleotides on each end of the siRNA with deoxyribonucleotides has
been reported to be well tolerated whereas complete substitution
with deoxyribonucleotides results in no RNAi activity (Elbashir et
al., 2001, EMBO J., 20, 6877). In addition, Elbashir et al, supra,
also report that substitution of siRNA with 2'-O-methyl nucleotides
completely abolishes RNAi activity. Li et al., International PCT
Publication No. WO 00/44914, and Beach et al., International PCT
Publication No. WO 01/68836 both suggest that siRNA may include
modifications to either the phosphate-sugar back bone or the
nucleoside to include at least one of a nitrogen or sulfur
heteroatom, however neither application teaches to what extent
these modifications are tolerated in siRNA molecules nor provide
any examples of such modified siRNA. Kreutzer and Limmer, Canadian
Patent Application No. 2,359,180, also describe certain chemical
modifications for use in dsRNA constructs in order to counteract
activation of double stranded-RNA-dependent protein kinase PKR,
specifically 2'-amino or 2'-O-methyl nucleotides, and nucleotides
containing a 2'-O or 4'-C methylene bridge. However, Kreutzer and
Limmer similarly fail to show to what extent these modifications
are tolerated in siRNA molecules nor provide any examples of such
modified siRNA.
[0014] In one embodiment, the invention features chemically
modified siNA constructs having specificity for target nucleic acid
molecules in a cell. Non-limiting examples of such chemical
modifications include without limitation phosphorothioate
internucleotide linkages, 2'-O-methyl ribonucleotides,
2'-deoxy-2'-fluoro ribonucleotides, 2'-deoxy ribonucleotides,
"universal base" nucleotides, 5-C-methyl nucleotides, and inverted
deoxyabasic residue incorporation. These chemical modifications,
when used in various siNA constructs, are shown to preserve RNAi
activity in cells while at the same time, dramatically increasing
the serum stability of these compounds. Furthermore, contrary to
the data published by Parrish et al., supra, applicant demonstrates
that multiple (greater than one) phosphorothioate substitutions are
well-tolerated and confer substantial increases in serum stability
for modified siNA constructs.
[0015] In one embodiment, the chemically-modified siNA molecules of
the invention comprise a duplex having two strands, one or both of
which can be chemically-modified, wherein each strand is about 19
to about 29 (e.g., about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or
29) nucleotides. In one embodiment, the chemically-modified siNA
molecules of the invention comprise a duplex having two strands,
one or both of which can be chemically-modified, wherein each
strand is about 19 to about 23 (e.g., about 19, 20, 21, 22, or 23)
nucleotides. In one embodiment, a siNA molecule of the invention
comprises modified nucleotides while maintaining the ability to
mediate RNAi. The modified nucleotides can be used to improve in
vitro or in vivo characteristics such as stability, activity,
and/or bioavailability. For example, a siNA molecule of the
invention can comprise modified nucleotides as a percentage of the
total number of nucleotides present in the siNA molecule. As such,
a siNA molecule of the invention can generally comprise modified
nucleotides from about 5 to about 100% of the nucleotide positions
(e.g., 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the nucleotide
positions). The actual percentage of modified nucleotides present
in a given siNA molecule depends on the total number of nucleotides
present in the siNA. If the siNA molecule is single stranded, the
percent modification can be based upon the total number of
nucleotides present in the single stranded siNA molecules.
Likewise, if the siNA molecule is double stranded, the percent
modification can be based upon the total number of nucleotides
present in the sense strand, antisense strand, or both the sense
and antisense strands. In addition, the actual percentage of
modified nucleotides present in a given siNA molecule can also
depend on the total number of purine and pyrimidine nucleotides
present in the siNA, for example, wherein all pyrimidine
nucleotides and/or all purine nucleotides present in the siNA
molecule are modified.
[0016] The antisense region of a siNA molecule of the invention can
comprise a phosphorothioate internucleotide linkage at the 3'-end
of said antisense region. The antisense region can comprise about
one to about five phosphorothioate internucleotide linkages at the
5'-end of said antisense region. The 3'-terminal nucleotide
overhangs of a siNA molecule of the invention can comprise
ribonucleotides or deoxyribonucleotides that are
chemically-modified at a nucleic acid sugar, base, or backbone. The
3'-terminal nucleotide overhangs can comprise one or more universal
base ribonucleotides. The 3'-terminal nucleotide overhangs can
comprise one or more acyclic nucleotides.
[0017] In one embodiment, a siNA molecule of the invention
comprises blunt ends, i.e., the ends do not include any overhanging
nucleotides. For example, a siNA molecule of the invention
comprising modifications described herein (e.g., comprising
nucleotides having Formulae I-VII or siNA constructs comprising
Stab1-Stab18 or any combination thereof) and/or any length
described herein can comprise blunt ends or ends with no
overhanging nucleotides.
[0018] By "blunt ends" is meant symmetric termini or termini of a
double stranded siNA molecule having no overhainging nucleotides.
The two strands of a double stranded siNA molecule align with each
other without over-hanging nucleotides at the termini. For example,
a blunt ended siNA construct comprises terminal nucleotides that
are complimentary between the sense and antisense regions of the
siNA molecule.
[0019] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a target gene, wherein the siNA molecule comprises no
ribonucleotides and each strand of the double-stranded siNA
comprises about 19 to about 23 nucleotides.
[0020] In one embodiment, one of the strands of a double-stranded
siNA molecule of the invention comprises a nucleotide sequence that
is complementary to a nucleotide sequence or a portion thereof of a
target gene, and wherein the second strand of a double-stranded
siNA molecule comprises a nucleotide sequence substantially similar
to the nucleotide sequence or a portion thereof of the target
gene.
[0021] In one embodiment, a siNA molecule of the invention
comprises about 19 to about 23 nucleotides, and each strand
comprises at least about 19 nucleotides that are complementary to
the nucleotides of the other strand.
[0022] In one embodiment, a siNA molecule of the invention
comprises an antisense region comprising a nucleotide sequence that
is complementary to a nucleotide sequence or a portion thereof of a
target gene, and the siNA further comprises a sense region, wherein
the sense region comprises a nucleotide sequence substantially
similar to the nucleotide sequence or a portion thereof of the
target gene. The antisense region and the sense region each
comprise about 19 to about 23 nucleotides, and the antisense region
comprises at least about 19 nucleotides that are complementary to
nucleotides of the sense region.
[0023] In one embodiment, a siNA molecule of the invention
comprises a sense region and an antisense region, wherein the
antisense region comprises a nucleotide sequence that is
complementary to a nucleotide sequence or a portion thereof of RNA
encoded by a target gene and the sense region comprises a
nucleotide sequence that is complementary to the antisense
region.
[0024] In one embodiment, a siNA molecule of the invention is
assembled from two separate oligonucleotide fragments wherein one
fragment comprises the sense region and the second fragment
comprises the antisense region of the siNA molecule. In another
embodiment, the sense region is connected to the antisense region
via a linker molecule, which can be a polynucleotide linker or a
non-nucleotide linker.
[0025] In one embodiment, a siNA molecule of the invention
comprises a sense region and antisense region, wherein pyrimidine
nucleotides in the sense region compries 2'-O-methylpyrimidine
nucleotides and purine nucleotides in the sense region comprise
2'-deoxy purine nucleotides. In one embodiment, a siNA molecule of
the invention comprises a sense region and antisense region,
wherein pyrimidine nucleotides present in the sense region comprise
2'-deoxy-2'-fluoro pyrimidine nucleotides and wherein purine
nucleotides present in the sense region comprise 2'-deoxy purine
nucleotides.
[0026] In one embodiment, a siNA molecule of the invention
comprises a sense region and antisense region, wherein the
pyrimidine nucleotides when present in said antisense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides and the purine
nucleotides when present in said antisense region are 2'-O-methyl
purine nucleotides.
[0027] In one embodiment, a siNA molecule of the invention
comprises a sense region and antisense region, wherein the
pyrimidine nucleotides when present in said antisense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides and wherein the purine
nucleotides when present in said antisense region comprise
2'-deoxy-purine nucleotides.
[0028] In one embodiment, a siNA molecule of the invention
comprises a sense region and antisense region, wherein the sense
region includes a terminal cap moiety at the 5'-end, the 3'-end, or
both of the 5' and 3' ends of the sense region. In another
embodiment, the terminal cap moiety is an inverted deoxy abasic
moiety.
[0029] In one embodiment, a siNA molecule of the invention has RNAi
activity that modulates expression of RNA encoded by a gene.
Because many genes can share some degree of sequence homology with
each other, siNA molecules can be designed to target a class of
genes (and associated receptor or ligand genes) or alternately
specific genes by selecting sequences that are either shared
amongst different gene targets or alternatively that are unique for
a specific gene target. Therefore, in one embodiment, the siNA
molecule can be designed to target conserved regions of a RNA
sequence having homology between several genes so as to target
several genes or gene families (e.g., different gene isoforms,
splice variants, mutant genes etc.) with one siNA molecule. In
another embodiment, the siNA molecule can be designed to target a
sequence that is unique to a specific RNA sequence of a specific
gene due to the high degree of specificity that the siNA molecule
requires to mediate RNAi activity.
[0030] In one embodiment, nucleic acid molecules of the invention
that act as mediators of the RNA interference gene silencing
response are double-stranded nucleic acid molecules. In another
embodiment, the siNA molecules of the invention consist of duplexes
containing about 19 base pairs between oligonucleotides comprising
about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24 or 25)
nucleotides. In yet another embodiment, siNA molecules of the
invention comprise duplexes with overhanging ends of about 1 to
about 3 (e.g., about 1, 2, or 3) nucleotides, for example, about
21-nucleotide duplexes with about 19 base pairs and 3'-terminal
mononucleotide, dinucleotide, or trinucleotide overhangs.
[0031] In one embodiment, the invention features one or more
chemically-modified siNA constructs having specificity for nucleic
acid molecules that express or encode a protein sequence, such as
RNA or DNA encoding a protein sequence. Non-limiting examples of
such chemical modifications include without limitation
phosphorothioate internucleotide linkages, 2'-deoxyribonucleotides,
2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides,
"universal base" nucleotides, "acyclic" nucleotides, 5-C-methyl
nucleotides, and terminal glyceryl and/or inverted deoxy abasic
residue incorporation. These chemical modifications, when used in
various siNA constructs, are shown to preserve RNAi activity in
cells while at the same time, dramatically increasing the serum
stability of these compounds.
[0032] In one embodiment, a siNA molecule of the invention does not
contain any ribonucleotides. In another embodiment, a siNA molecule
of the invention comprises one or more ribonucleotides.
[0033] In one embodiment, the invention features the use of
compounds or compositions that inhibit the activity of double
stranded RNA binding proteins (dsRBPs, see for example Silhavy et
al., 2003, Journal of General Virology, 84, 975-980). Non-limiting
examples of compounds and compositions that can be used to inhibit
the activity of dsRBPs include but are not limited to small
molecules and nucleic acid aptamers that bind to or interact with
the dsRBPs and consequently reduce dsRBP activity and/or siNA
molecules that target nucleic acid sequences encoding dsRBPs. The
use of such compounds and compositions is expected to improve the
activity of siNA molecules in biological systems in which dsRBPs
can abrogate or suppress the efficacy of siNA mediated RNA
interference, such as where dsRBPs are expressed during viral
infection of a cell to escape RNAi surveillance. Therefore, the use
of agents that inhibit dsRBP activity is preferred in those
instances where RNA interference activity can be improved via the
abrogation or suppression of dsRBP activity. Such anti-dsRBP agents
can be administered alone or can be co-administered with siNA
molecules of the invention, or can be used to pretreat cells or a
subject before siNA administration. In another embodiment,
anti-dsRBP agents are used to treat viral infection, such as HCV,
HBV, or HIV infection with or without siNA molecules of the
invention.
[0034] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a gene, wherein one of the strands of the
double-stranded siNA molecule comprises a nucleotide sequence that
is complementary to a nucleotide sequence of the gene or RNA
encoded by the gene or a portion thereof, and wherein the second
strand of the double-stranded siNA molecule comprises a nucleotide
sequence substantially similar to the nucleotide sequence of the
gene or RNA encoded by the gene or a portion thereof.
[0035] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a gene, wherein each strand of the siNA molecule
comprises about 19 to about 23 nucleotides, and wherein each strand
comprises at least about 19 nucleotides that are complementary to
the nucleotides of the other strand.
[0036] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a gene, wherein the siNA molecule comprises an
antisense region comprising a nucleotide sequence that is
complementary to a nucleotide sequence of the gene or RNA encoded
by the gene or a portion thereof, and wherein the siNA further
comprises a sense region, wherein the sense region comprises a
nucleotide sequence substantially similar to the nucleotide
sequence of the gene or RNA encoded by the gene or a portion
thereof.
[0037] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits the
expression of a target gene by mediating RNA interference (RNAi)
process, wherein the siNA molecule comprises no ribonucleotides and
wherein each strand of the double-stranded siNA molecule comprises
about 21 nucleotides.
[0038] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits the
replication of a virus (e.g, as mammalian virus, plant virus,
hepatitis C virus, human immunodeficiency virus, hepatitis B virus,
herpes simplex virus, cytomegalovirus, human papilloma virus,
respiratory syncytial virus, or influenza virus), wherein the siNA
molecule does not require the presence of a ribonucleotide within
the siNA molecule for the inhibition of replication of the virus
and each strand of the double-stranded siNA molecule comprises
about 21 nucleotides.
[0039] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a gene, wherein the siNA molecule comprises a sense
region and an antisense region and wherein the antisense region
comprises a nucleotide sequence that is complementary to a
nucleotide sequence or a portion thereof of RNA encoded by the gene
and the sense region comprises a nucleotide sequence that is
complementary to the antisense region, and wherein the purine
nucleotides present in the antisense region comprise
2'-deoxy-purine nucleotides. In another embodiment, the purine
nucleotides present in the antisense region comprise 2'-O-methyl
purine nucleotides. In either of the above embodiments, the
antisense region comprises a phosphorothioate internucleotide
linkage at the 3' end of the antisense region. In an alternative
embodiment, the antisense region comprises a glyceryl modification
at the 3' end of the antisense region. In another embodiment of any
of the above described siNA molecules, any nucleotides present in a
non-complementary region of the antisense strand (e.g. overhang
region) are 2'-deoxy nucleotides.
[0040] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that down-regulates
expression of a gene, wherein the siNA molecule is assembled from
two separate oligonucleotide fragments each comprising 21
nucleotides, wherein one fragment comprises the sense region and
the second fragment comprises the antisense region of the siNA
molecule, and wherein about 19 nucleotides of each fragment of the
siNA molecule are base-paired to the complementary nucleotides of
the other fragment of the siNA molecule and wherein at least two 3'
terminal nucleotides of each fragment of the siNA molecule are not
base-paired to the nucleotides of the other fragment of the siNA
molecule. In one embodiment, each of the two 3' terminal
nucleotides of each fragment of the siNA molecule is a
2'-deoxy-pyrimidine, such as 2'-deoxy-thymidine. In another
embodiment, all 21 nucleotides of each fragment of the siNA
molecule are base-paired to the complementary nucleotides of the
other fragment of the siNA molecule. In another embodiment, about
19 nucleotides of the antisense region are base-paired to the
nucleotide sequence or a portion thereof of the RNA encoded by the
gene. In another embodiment, 21 nucleotides of the antisense region
are base-paired to the nucleotide sequence or a portion thereof of
the RNA encoded by the gene. In any of the above embodiments, the
5'-end of the fragment comprising said antisense region can
optionally include a phosphate group.
[0041] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits the
expression of a RNA sequence (e.g., wherein said target RNA
sequence is encoded by a gene or a gene involved in a pathway of
gene expression), wherein the siNA molecule does not contain any
ribonucleotides and wherein each strand of the double-stranded siNA
molecule is about 21 nucleotides long.
[0042] In one embodiment, the invention features a medicament
comprising a siNA molecule of the invention.
[0043] In one embodiment, the invention features an active
ingredient comprising a siNA molecule of the invention.
[0044] In one embodiment, the invention features the use of a
double-stranded short interfering nucleic acid (siNA) molecule to
down-regulate expression of a target gene, wherein the siNA
molecule comprises one or more chemical modifications and each
strand of the double-stranded siNA is about 21 nucleotides
long.
[0045] The invention features a double-stranded short interfering
nucleic acid (siNA) molecule that inhibits expression of a gene,
wherein one of the strands of the double-stranded siNA molecule is
an antisense strand which comprises nucleotide sequence that is
complementary to nucleotide sequence of a RNA encoded by the gene
or a portion thereof, the other strand is a sense strand which
comprises nucleotide sequence that is complementary to a nucleotide
sequence of the antisense strand and wherein a majority of the
pyrimidine nucleotides present in the double-stranded siNA molecule
comprises a sugar modification. In one embodiment, the nucleotide
sequence of the antisense strand of the double-stranded siNA
molecule is complementary to the nucleotide sequence of a RNA which
encodes a protein or a portion thereof. In one embodiment, each
strand of the siNA molecule comprises about 19 to about 29
nucleotides, and each strand comprises at least about 19
nucleotides that are complementary to the nucleotides of the other
strand. In one embodiment, the siNA molecule is assembled from two
oligonucleotide fragments, wherein one fragment comprises the
nucleotide sequence of the antisense strand of the siNA molecule
and a second fragment comprises nucleotide sequence of the sense
region of the siNA molecule. In another embodiment, the sense
strand is connected to the antisense strand via a linker molecule,
such as a polynucleotide linker or a non-nucleotide linker. In one
embodiment, the pyrimidine nucleotides present in the sense strand
are 2'-deoxy-2'-fluoro pyrimidine nucleotides and the purine
nucleotides present in the sense region are 2'-deoxy purine
nucleotides. In another embodiment, the pyrimidine nucleotides
present in the sense strand are 2'-deoxy-2'-fluoro pyrimidine
nucleotides and the purine nucleotides present in the sense region
are 2'-O-methyl purine nucleotides. In one embodiment, wherein the
sense strand comprises a 3'-end and a 5'-end, a terminal cap moiety
(e.g., an inverted deoxy abasic moiety) is present at the 5'-end,
the 3'-end, or both of the 5' and 3' ends of the sense strand. In
one embodiment, the antisense strand comprises one or more
2'-deoxy-2'-fluoro pyrimidine nucleotides and one or more
2'-O-methyl purine nucleotides. In one embodiment, the pyrimidine
nucleotides present in the antisense strand are 2'-deoxy-2'-fluoro
pyrimidine nucleotides and any purine nucleotides present in the
antisense strand are 2'-O-methyl purine nucleotides. In one
embodiment, the antisense strand comprises a phosphorothioate
internucleotide linkage at the 3' end of the antisense strand. In
another embodiment, the antisense strand comprises a glyceryl
modification at the 3' end. In another embodiment, the 5'-end of
the antisense strand optionally includes a phosphate group. In one
embodiment, the invention features a double-stranded short
interfering nucleic acid (siNA) molecule that down-regulates
expression of a gene, wherein one of the strands of the
double-stranded siNA molecule is an antisense strand which
comprises nucleotide sequence that is complementary to nucleotide
sequence of RNA encoded by a gene or a portion thereof, the other
strand is a sense strand which comprises nucleotide sequence that
is complementary to a nucleotide sequence of the antisense strand
and wherein a majority of the pyrimidine nucleotides present in the
double-stranded siNA molecule comprises a sugar modification, and
wherein the nucleotide sequence of the antisense strand is
complementary to a nucleotide sequence of the 5'-untranslated
region or a portion thereof of the RNA. In another embodiment, the
nucleotide sequence of the antisense strand is complementary to a
nucleotide sequence of the RNA or a portion thereof.
[0046] In one embodiment, the invention features a double-stranded
short interfering nucleic acid (siNA) molecule that inhibits
expression of a gene, wherein one of the strands of the
double-stranded siNA molecule is an antisense strand which
comprises nucleotide sequence that is complementary to nucleotide
sequence of a RNA or a portion thereof, the other strand is a sense
strand which comprises nucleotide sequence that is complementary to
a nucleotide sequence of the antisense strand and wherein a
majority of the pyrimidine nucleotides present in the
double-stranded siNA molecule comprises a sugar modification, and
wherein each of the two strands of the siNA molecule comprises 21
nucleotides. In one embodiment, about 19 nucleotides of each strand
of the siNA molecule are base-paired to the complementary
nucleotides of the other strand of the siNA molecule and at least
two 3' terminal nucleotides of each strand of the siNA molecule are
not base-paired to the nucleotides of the other strand of the siNA
molecule. In one embodiment, each of the two 3' terminal
nucleotides of each fragment of the siNA molecule are
2'-deoxy-pyrimidines, such as 2'-deoxy-thymidine. In another
embodiment, each strand of the siNA molecule is base-paired to the
complementary nucleotides of the other strand of the siNA molecule.
In one embodiment, about 19 nucleotides of the antisense strand are
base-paired to the nucleotide sequence of the RNA or a portion
thereof. In another embodiment, 21 nucleotides of the antisense
strand are base-paired to the nucleotide sequence of the RNA or a
portion thereof.
[0047] In one embodiment, the invention features a composition
comprising a siNA molecule of the invention and a pharmaceutically
acceptable carrier or diluent.
[0048] In one embodiment, the invention features the use of a
double-stranded short interfering nucleic acid (siNA) molecule that
inhibits expression of a gene, wherein one of the strands of the
double-stranded siNA molecule is an antisense strand which
comprises nucleotide sequence that is complementary to nucleotide
sequence of a RNA or a portion thereof, the other strand is a sense
strand which comprises nucleotide sequence that is complementary to
a nucleotide sequence of the antisense strand and wherein a
majority of the pyrimidine nucleotides present in the
double-stranded siNA molecule comprises a sugar modification.
[0049] In one embodiment, the invention features a short
interfering nucleic acid (siNA) molecule comprising a
double-stranded structure that down-regulates expression of a
target nucleic acid, wherein the siNA molecule does not require a
2'-hydroxyl group containing ribonucleotide, each strand of the
double-stranded structure of the siNA molecule comprises about 21
nucleotides and the siNA molecule comprises nucleotide sequence
having complementarity to nucleotide sequence of the target nucleic
acid or a portion thereof. The target nucleic acid can be an
endogenous gene, an exogenous gene, a viral nucleic acid, or a RNA,
such as a mammalian gene, plant gene, viral gene, fungal gene,
bacterial gene, plant viral gene, or mammalian viral gene. Examples
of mammalian viral gene include hepatitis C virus, human
immunodeficiency virus, hepatitis B virus, herpes simplex virus,
cytomegalovirus, human papilloma virus, respiratory syncytial
virus, influenza virus, and severe acute respiratory syndrome virus
(SARS).
[0050] In one embodiment, a siNA molecule of the invention
comprises a sense region and an antisense region wherein the
antisense region comprises the nucleotide sequence that is
complementary to a nucleotide sequence or a portion thereof of the
target nucleic acid and the sense region comprises a nucleotide
sequence that is complementary to nucleotide sequence of the
antisense region or a portion thereof.
[0051] In one embodiment, a siNA molecule of the invention is
assembled from two separate oligonucleotide fragments wherein one
fragment comprises the sense region and the second fragment
comprises the antisense region of the siNA molecule. The sense
region can be connected to the antisense region via a linker
molecule, such as a polynucleotide linker or non-nucleotide linker.
In another embodiment, each sense region and antisense region
comprise about 21 nucleotides in length. In another embodiment,
about 19 nucleotides of each fragment of the siNA molecule are
base-paired to the complementary nucleotides of the other fragment
of the siNA molecule and at least two 3' terminal nucleotides of
each fragment of the siNA molecule are not base-paired to the
nucleotides of the other fragment of the siNA molecule. In another
embodiment, each of the two 3' terminal nucleotides of each
fragment of the siNA molecule are 2'-deoxy-pyrimidines, such as the
thymidine. In another embodiment, all 21 nucleotides of each
fragment of the siNA molecule are base-paired to the complementary
nucleotides of the other fragment of the siNA molecule. In another
embodiment, about 19 nucleotides of the antisense region of the
siNA molecule are base-paired to the nucleotide sequence or a
portion thereof of the the target nucleic acid. In another
embodiment, 21 nucleotides of the antisense region of the siNA
molecule are base-paired to the nucleotide sequence or a portion
thereof of the target nucleic acid. In another embodiment, the
5'-end of the fragment comprising the antisense region optionally
includes a phosphate group.
[0052] In one embodiment, a siNA molecule of the invention
comprises nucleotide sequence having complementarity to nucleotide
sequence of RNA or a portion thereof encoded by the target nucleic
acid or a portion thereof.
[0053] In one embodiment, a siNA molecule of the invention
comprises a sense region and an antisense region, wherein the
pyrimidine nucleotides when present in the sense region are
2'-O-methylpyrimidine nucleotides and wherein the purine
nucleotides when present in the sense region are 2'-deoxy purine
nucleotides.
[0054] In one embodiment, a siNA molecule of the invention
comprises a sense region and an antisense region, wherein the
pyrimidine nucleotides when present in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides and wherein the purine
nucleotides when present in the sense region are 2'-deoxy purine
nucleotides.
[0055] In one embodiment, a siNA molecule of the invention
comprises a sense region and an antisense region, wherein the sense
region includes a terminal cap moiety at the 5'-end, the 3'-end, or
both of the 5' and 3' ends. The cap moiety can be an inverted deoxy
abasic moiety, an inverted deoxy thymidine moiety, or a thymidine
moiety.
[0056] In one embodiment, a siNA molecule of the invention
comprises a sense region and an antisense region, wherein the
pyrimidine nucleotides when present in the antisense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides and the purine
nucleotides when present in the antisense region are 2'-O-methyl
purine nucleotides.
[0057] In one embodiment, a siNA molecule of the invention
comprises a sense region and an antisense region, wherein the
pyrimidine nucleotides when present in the antisense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides and wherein the purine
nucleotides when present in the antisense region comprise
2'-deoxy-purine nucleotides.
[0058] In one embodiment, a siNA molecule of the invention
comprises a sense region and an antisense region, wherein the
antisense region comprises a phosphate backbone modification at the
3' end of the antisense region. The phosphate backbone modification
can be a phosphorothioate.
[0059] In one embodiment, a siNA molecule of the invention
comprises a sense region and an antisense region, wherein the
antisense region comprises a glyceryl modification at the 3' end of
the antisense region.
[0060] In one embodiment, a siNA molecule of the invention
comprises a sense region and an antisense region, wherein each of
sense and the antisense regions of the siNA molecule comprise about
21 nucleotides.
[0061] In a non-limiting example, the introduction of
chemically-modified nucleotides into nucleic acid molecules
provides a powerful tool in overcoming potential limitations of in
vivo stability and bioavailability inherent to native RNA molecules
that are delivered exogenously. For example, the use of
chemically-modified nucleic acid molecules can enable a lower dose
of a particular nucleic acid molecule for a given therapeutic
effect since chemically-modified nucleic acid molecules tend to
have a longer half-life in serum. Furthermore, certain chemical
modifications can improve the bioavailability of nucleic acid
molecules by targeting particular cells or tissues and/or improving
cellular uptake of the nucleic acid molecule. Therefore, even if
the activity of a chemically-modified nucleic acid molecule is
reduced as compared to a native nucleic acid molecule, for example,
when compared to an all-RNA nucleic acid molecule, the overall
activity of the modified nucleic acid molecule can be greater than
that of the native molecule due to improved stability and/or
delivery of the molecule. Unlike native unmodified siNA,
chemically-modified siNA can also minimize the possibility of
activating interferon activity in humans.
[0062] In any of the embodiments of siNA molecules described
herein, the antisense region of a siNA molecule of the invention
can comprise a phosphorothioate internucleotide linkage at the
3'-end of said antisense region. In any of the embodiments of siNA
molecules described herein, the antisense region can comprise about
one to about five phosphorothioate internucleotide linkages at the
5'-end of said antisense region. In any of the embodiments of siNA
molecules described herein, the 3'-terminal nucleotide overhangs of
a siNA molecule of the invention can comprise ribonucleotides or
deoxyribonucleotides that are chemically-modified at a nucleic acid
sugar, base, or backbone. In any of the embodiments of siNA
molecules described herein, the 3'-terminal nucleotide overhangs
can comprise one or more universal base ribonucleotides. In any of
the embodiments of siNA molecules described herein, the 3'-terminal
nucleotide overhangs can comprise one or more acyclic
nucleotides.
[0063] One embodiment of the invention provides an expression
vector comprising a nucleic acid sequence encoding at least one
siNA molecule of the invention in a manner that allows expression
of the nucleic acid molecule. Another embodiment of the invention
provides a mammalian cell comprising such an expression vector. The
mammalian cell can be a human cell. The siNA molecule of the
expression vector can comprise a sense region and an antisense
region. The antisense region can comprise sequence complementary to
an RNA or DNA sequence encoding a protein or polypeptide and the
sense region can comprise sequence complementary to the antisense
region. The siNA molecule can comprise two distinct strands having
complementary sense and antisense regions. The siNA molecule can
comprise a single strand having complementary sense and antisense
regions.
[0064] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
capable of mediating RNA interference (RNAi) inside a cell or
reconstituted in vitro system, wherein the chemical modification
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) nucleotides comprising a backbone modified internucleotide
linkage having Formula I: ##STR1##
[0065] wherein each R1 and R2 is independently any nucleotide,
non-nucleotide, or polynucleotide which can be naturally-occurring
or chemically-modified, each X and Y is independently O, S, N,
alkyl, or substituted alkyl, each Z and W is independently O, S, N,
alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, or aralkyl,
and wherein W, X, Y, and Z are optionally not all O.
[0066] The chemically-modified internucleotide linkages having
Formula I, for example, wherein any Z, W, X, and/or Y independently
comprises a sulphur atom, can be present in one or both
oligonucleotide strands of the siNA duplex, for example, in the
sense strand, the antisense strand, or both strands. The siNA
molecules of the invention can comprise one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, or more) chemically-modified
internucleotide linkages having Formula I at the 3'-end, the
5'-end, or both of the 3' and 5'-ends of the sense strand, the
antisense strand, or both strands. For example, an exemplary siNA
molecule of the invention can comprise about 1 to about 5 or more
(e.g., about 1, 2, 3, 4, 5, or more) chemically-modified
internucleotide linkages having Formula I at the 5'-end of the
sense strand, the antisense strand, or both strands. In another
non-limiting example, an exemplary siNA molecule of the invention
can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, or more) pyrimidine nucleotides with chemically-modified
internucleotide linkages having Formula I in the sense strand, the
antisense strand, or both strands. In yet another non-limiting
example, an exemplary siNA molecule of the invention can comprise
one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more)
purine nucleotides with chemically-modified internucleotide
linkages having Formula I in the sense strand, the antisense
strand, or both strands. In another embodiment, a siNA molecule of
the invention having internucleotide linkage(s) of Formula I also
comprises a chemically-modified nucleotide or non-nucleotide having
any of Formulae I-VII.
[0067] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
capable of mediating RNA interference (RNAi) inside a cell or
reconstituted in vitro system, wherein the chemical modification
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) nucleotides or non-nucleotides having Formula II: ##STR2##
wherein each R3, R4, R5, R6, R7, R8, R10, R11 and R12 is
independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl,
F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, or group having Formula I; R9 is
O, S, CH2, S.dbd.O, CHF, or CF2, and B is a nucleosidic base such
as adenine, guanine, uracil, cytosine, thymine, 2-aminoadenosine,
5-methylcytosine, 2,6-diaminopurine, or any other non-naturally
occurring base that can be complementary or non-complementary to
target RNA or a non-nucleosidic base such as phenyl, naphthyl,
3-nitropyrrole, 5-nitroindole, nebularine, pyridone, pyridinone, or
any other non-naturally occurring universal base that can be
complementary or non-complementary to target RNA.
[0068] The chemically-modified nucleotide or non-nucleotide of
Formula II can be present in one or both oligonucleotide strands of
the siNA duplex, for example in the sense strand, the antisense
strand, or both strands. The siNA molecules of the invention can
comprise one or more chemically-modified nucleotide or
non-nucleotide of Formula II at the 3'-end, the 5'-end, or both of
the 3' and 5'-ends of the sense strand, the antisense strand, or
both strands. For example, an exemplary siNA molecule of the
invention can comprise about 1 to about 5 or more (e.g., about 1,
2, 3, 4, 5, or more) chemically-modified nucleotides or
non-nucleotides of Formula II at the 5'-end of the sense strand,
the antisense strand, or both strands. In anther non-limiting
example, an exemplary siNA molecule of the invention can comprise
about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more)
chemically-modified nucleotides or non-nucleotides of Formula II at
the 3'-end of the sense strand, the antisense strand, or both
strands.
[0069] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
capable of mediating RNA interference (RNAi) inside a cell or
reconstituted in vitro system, wherein the chemical modification
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) nucleotides or non-nucleotides having Formula III:
##STR3## wherein each R3, R4, R5, R6, R7, R8, R10, R11 and R12 is
independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl,
F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, or group having Formula I; R9 is
O, S, CH2, S.dbd.O, CHF, or CF2, and B is a nucleosidic base such
as adenine, guanine, uracil, cytosine, thymine, 2-aminoadenosine,
5-methylcytosine, 2,6-diaminopurine, or any other non-naturally
occurring base that can be employed to be complementary or
non-complementary to target RNA or a non-nucleosidic base such as
phenyl, naphthyl, 3-nitropyrrole, 5-nitroindole, nebularine,
pyridone, pyridinone, or any other non-naturally occurring
universal base that can be complementary or non-complementary to
target RNA.
[0070] The chemically-modified nucleotide or non-nucleotide of
Formula III can be present in one or both oligonucleotide strands
of the siNA duplex, for example, in the sense strand, the antisense
strand, or both strands. The siNA molecules of the invention can
comprise one or more chemically-modified nucleotide or
non-nucleotide of Formula III at the 3'-end, the 5'-end, or both of
the 3' and 5'-ends of the sense strand, the antisense strand, or
both strands. For example, an exemplary siNA molecule of the
invention can comprise about 1 to about 5 or more (e.g., about 1,
2, 3, 4, 5, or more) chemically-modified nucleotide(s) or
non-nucleotide(s) of Formula III at the 5'-end of the sense strand,
the antisense strand, or both strands. In anther non-limiting
example, an exemplary siNA molecule of the invention can comprise
about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more)
chemically-modified nucleotide or non-nucleotide of Formula III at
the 3'-end of the sense strand, the antisense strand, or both
strands.
[0071] In another embodiment, a siNA molecule of the invention
comprises a nucleotide having Formula II or III, wherein the
nucleotide having Formula II or III is in an inverted
configuration. For example, the nucleotide having Formula II or III
is connected to the siNA construct in a 3'-3', 3'-2', 2'-3', or
5'-5' configuration, such as at the 3'-end, the 5'-end, or both of
the 3' and 5'-ends of one or both siNA strands.
[0072] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
capable of mediating RNA interference (RNAi) inside a cell or
reconstituted in vitro system, wherein the chemical modification
comprises a 5'-terminal phosphate group having Formula IV: ##STR4##
wherein each X and Y is independently O, S, N, alkyl, substituted
alkyl, or alkylhalo; wherein each Z and W is independently O, S, N,
alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, aralkyl, or
alkylhalo; and wherein W, X, Y and Z are not all O.
[0073] In one embodiment, the invention features a siNA molecule
having a 5'-terminal phosphate group having Formula IV on the
target-complementary strand, for example, a strand complementary to
a target RNA, wherein the siNA molecule comprises an all RNA siNA
molecule. In another embodiment, the invention features a siNA
molecule having a 5'-terminal phosphate group having Formula IV on
the target-complementary strand wherein the siNA molecule also
comprises about 1 to about 3 (e.g., about 1, 2, or 3) nucleotide
3'-terminal nucleotide overhangs having about 1 to about 4 (e.g.,
about 1, 2, 3, or 4) deoxyribonucleotides on the 3'-end of one or
both strands. In another embodiment, a 5'-terminal phosphate group
having Formula IV is present on the target-complementary strand of
a siNA molecule of the invention, for example a siNA molecule
having chemical modifications having any of Formulae I-VII.
[0074] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
capable of mediating RNA interference (RNAi) inside a cell or
reconstituted in vitro system, wherein the chemical modification
comprises one or more phosphorothioate internucleotide linkages.
For example, in a non-limiting example, the invention features a
chemically-modified short interfering nucleic acid (siNA) having
about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate
internucleotide linkages in one siNA strand. In yet another
embodiment, the invention features a chemically-modified short
interfering nucleic acid (siNA) individually having about 1, 2, 3,
4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages in
both siNA strands. The phosphorothioate internucleotide linkages
can be present in one or both oligonucleotide strands of the siNA
duplex, for example in the sense strand, the antisense strand, or
both strands. The siNA molecules of the invention can comprise one
or more phosphorothioate internucleotide linkages at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the sense strand, the
antisense strand, or both strands. For example, an exemplary siNA
molecule of the invention can comprise about 1 to about 5 or more
(e.g., about 1, 2, 3, 4, 5, or more) consecutive phosphorothioate
internucleotide linkages at the 5'-end of the sense strand, the
antisense strand, or both strands. In another non-limiting example,
an exemplary siNA molecule of the invention can comprise one or
more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more)
pyrimidine phosphorothioate internucleotide linkages in the sense
strand, the antisense strand, or both strands. In yet another
non-limiting example, an exemplary siNA molecule of the invention
can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, or more) purine phosphorothioate internucleotide linkages in
the sense strand, the antisense strand, or both strands.
[0075] In one embodiment, the invention features a siNA molecule,
wherein the sense strand comprises one or more, for example, about
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate
internucleotide linkages, and/or one or more (e.g., about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl,
2'-deoxy-2'-fluoro, and/or about one or more (e.g., about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides,
and optionally a terminal cap molecule at the 3'-end, the 5'-end,
or both of the 3'- and 5'-ends of the sense strand; and wherein the
antisense strand comprises about 1 to about 10 or more,
specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more
phosphorothioate internucleotide linkages, and/or one or more
(e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy,
2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified
nucleotides, and optionally a terminal cap molecule at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the antisense strand.
In another embodiment, one or more, for example about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense
and/or antisense siNA strand are chemically-modified with 2'-deoxy,
2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without
one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more, phosphorothioate internucleotide linkages and/or a terminal
cap molecule at the 3'-end, the 5'-end, or both of the 3'- and
5'-ends, being present in the same or different strand.
[0076] In another embodiment, the invention features a siNA
molecule, wherein the sense strand comprises about 1 to about 5,
specifically about 1, 2, 3, 4, or 5 phosphorothioate
internucleotide linkages, and/or one or more (e.g., about 1, 2, 3,
4, 5, or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and/or
one or more (e.g., about 1, 2, 3, 4, 5, or more) universal base
modified nucleotides, and optionally a terminal cap molecule at the
3-end, the 5'-end, or both of the 3'- and 5'-ends of the sense
strand; and wherein the antisense strand comprises about 1 to about
5 or more, specifically about 1, 2, 3, 4, 5, or more
phosphorothioate internucleotide linkages, and/or one or more
(e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy,
2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified
nucleotides, and optionally a terminal cap molecule at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the antisense strand.
In another embodiment, one or more, for example about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense
and/or antisense siNA strand are chemically-modified with 2'-deoxy,
2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without
about 1 to about 5 or more, for example about 1, 2, 3, 4, 5, or
more phosphorothioate internucleotide linkages and/or a terminal
cap molecule at the 3'-end, the 5'-end, or both of the 3'- and
5'-ends, being present in the same or different strand.
[0077] In one embodiment, the invention features a siNA molecule,
wherein the antisense strand comprises one or more, for example,
about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate
internucleotide linkages, and/or about one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl,
2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5,
6, 7, 8, 9, 10 or more) universal base modified nucleotides, and
optionally a terminal cap molecule at the 3'-end, the 5'-end, or
both of the 3'- and 5'-ends of the sense strand; and wherein the
antisense strand comprises about 1 to about 10 or more,
specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more
phosphorothioate internucleotide linkages, and/or one or more
(e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy,
2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified
nucleotides, and optionally a terminal cap molecule at the 3'-end,
the 5'-end, or both of the 3'- and 5'-ends of the antisense strand.
In another embodiment, one or more, for example about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense
and/or antisense siNA strand are chemically-modified with 2'-deoxy,
2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without
one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or
more phosphorothioate internucleotide linkages and/or a terminal
cap molecule at the 3'-end, the 5'-end, or both of the 3' and
5'-ends, being present in the same or different strand.
[0078] In another embodiment, the invention features a siNA
molecule, wherein the antisense strand comprises about 1 to about 5
or more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate
internucleotide linkages, and/or one or more (e.g., about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl,
2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5,
6, 7, 8, 9, 10 or more) universal base modified nucleotides, and
optionally a terminal cap molecule at the 3'-end, the 5'-end, or
both of the 3'- and 5'-ends of the sense strand; and wherein the
antisense strand comprises about 1 to about 5 or more, specifically
about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide
linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8,
9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and/or
one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more)
universal base modified nucleotides, and optionally a terminal cap
molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends
of the antisense strand. In another embodiment, one or more, for
example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine
nucleotides of the sense and/or antisense siNA strand are
chemically-modified with 2'-deoxy, 2'-O-methyl and/or
2'-deoxy-2'-fluoro nucleotides, with or without about 1 to about 5,
for example about 1, 2, 3, 4, 5 or more phosphorothioate
internucleotide linkages and/or a terminal cap molecule at the
3'-end, the 5'-end, or both of the 3'- and 5'-ends, being present
in the same or different strand.
[0079] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
having about 1 to about 5, specifically about 1, 2, 3, 4, 5 or more
phosphorothioate internucleotide linkages in each strand of the
siNA molecule.
[0080] In another embodiment, the invention features a siNA
molecule comprising 2'-5' internucleotide linkages. The 2'-5'
internucleotide linkage(s) can be at the 3'-end, the 5'-end, or
both of the 3'- and 5'-ends of one or both siNA sequence strands.
In addition, the 2'-5' internucleotide linkage(s) can be present at
various other positions within one or both siNA sequence strands,
for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including
every internucleotide linkage of a pyrimidine nucleotide in one or
both strands of the siNA molecule can comprise a 2'-5'
internucleotide linkage, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more including every internucleotide linkage of a purine nucleotide
in one or both strands of the siNA molecule can comprise a 2'-5'
internucleotide linkage.
[0081] In another embodiment, a chemically-modified siNA molecule
of the invention comprises a duplex having two strands, one or both
of which can be chemically-modified, wherein each strand is about
18 to about 27 (e.g., about 18, 19, 20, 21, 22, 23, 24, 25, 26, or
27) nucleotides in length, wherein the duplex has about 18 to about
23 (e.g., about 18, 19, 20, 21, 22, or 23) base pairs, and wherein
the chemical modification comprises a structure having any of
Formulae I-VII. For example, an exemplary chemically-modified siNA
molecule of the invention comprises a duplex having two strands,
one or both of which can be chemically-modified with a chemical
modification having any of Formulae I-VII or any combination
thereof, wherein each strand consists of about 21 nucleotides, each
having a 2-nucleotide 3'-terminal nucleotide overhang, and wherein
the duplex has about 19 base pairs. In another embodiment, a siNA
molecule of the invention comprises a single stranded hairpin
structure, wherein the siNA is about 36 to about 70 (e.g., about
36, 40, 45, 50, 55, 60, 65, or 70) nucleotides in length having
about 18 to about 23 (e.g., about 18, 19, 20, 21, 22, or 23) base
pairs, and wherein the siNA can include a chemical modification
comprising a structure having any of Formulae I-VII or any
combination thereof. For example, an exemplary chemically-modified
siNA molecule of the invention comprises a linear oligonucleotide
having about 42 to about 50 (e.g., about 42, 43, 44, 45, 46, 47,
48, 49, or 50) nucleotides that is chemically-modified with a
chemical modification having any of Formulae I-VII or any
combination thereof, wherein the linear oligonucleotide forms a
hairpin structure having about 19 base pairs and a 2-nucleotide
3'-terminal nucleotide overhang. In another embodiment, a linear
hairpin siNA molecule of the invention contains a stem loop motif,
wherein the loop portion of the siNA molecule is biodegradable. For
example, a linear hairpin siNA molecule of the invention is
designed such that degradation of the loop portion of the siNA
molecule in vivo can generate a double-stranded siNA molecule with
3'-terminal overhangs, such as 3'-terminal nucleotide overhangs
comprising about 2 nucleotides.
[0082] In another embodiment, a siNA molecule of the invention
comprises a hairpin structure, wherein the siNA is about 25 to
about 50 (e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,
36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50)
nucleotides in length having about 3 to about 25 (e.g., about 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, or 25) base pairs, and wherein the siNA can include one or
more chemical modifications comprising a structure having any of
Formulae I-VII or any combination thereof. For example, an
exemplary chemically-modified siNA molecule of the invention
comprises a linear oligonucleotide having about 25 to about 35
(e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35)
nucleotides that is chemically-modified with one or more chemical
modifications having any of Formulae I-VII or any combination
thereof, wherein the linear oligonucleotide forms a hairpin
structure having about 3 to about 23 (e.g., about 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23) base
pairs and a 5'-terminal phosphate group that can be chemically
modified as described herein (for example a 5'-terminal phosphate
group having Formula IV). In another embodiment, a linear hairpin
siNA molecule of the invention contains a stem loop motif, wherein
the loop portion of the siNA molecule is biodegradable. In another
embodiment, a linear hairpin siNA molecule of the invention
comprises a loop portion comprising a non-nucleotide linker.
[0083] In another embodiment, a siNA molecule of the invention
comprises an asymmetric hairpin structure, wherein the siNA is
about 25 to about 50 (e.g., about 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
or 50) nucleotides in length having about 3 to about 20 (e.g.,
about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
or 20) base pairs, and wherein the siNA can include one or more
chemical modifications comprising a structure having any of
Formulae I-VII or any combination thereof. For example, an
exemplary chemically-modified siNA molecule of the invention
comprises a linear oligonucleotide having about 25 to about 35
(e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35)
nucleotides that is chemically-modified with one or more chemical
modifications having any of Formulae I-VII or any combination
thereof, wherein the linear oligonucleotide forms an asymmetric
hairpin structure having about 3 to about 18 (e.g., about 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18) base pairs and a
5'-terminal phosphate group that can be chemically modified as
described herein (for example a 5'-terminal phosphate group having
Formula IV). In another embodiment, an asymmetric hairpin siNA
molecule of the invention contains a stem loop motif, wherein the
loop portion of the siNA molecule is biodegradable. In another
embodiment, an asymmetric hairpin siNA molecule of the invention
comprises a loop portion comprising a non-nucleotide linker.
[0084] In another embodiment, a siNA molecule of the invention
comprises an asymmetric double stranded structure having separate
polynucleotide strands comprising sense and antisense regions,
wherein the antisense region is about 16 to about 25 (e.g., about
16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides in length,
wherein the sense region is about 3 to about 18 (e.g., about 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18) nucleotides
in length, wherein the sense region the antisense region have at
least 3 complementary nucleotides, and wherein the siNA can include
one or more chemical modifications comprising a structure having
any of Formulae I-VII or any combination thereof. For example, an
exemplary chemically-modified siNA molecule of the invention
comprises an asymmetric double stranded structure having separate
polynucleotide strands comprising sense and antisense regions,
wherein the antisense region is about 18 to about 22 (e.g., about
18, 19, 20, 21, or 22) nucleotides in length and wherein the sense
region is about 3 to about 15 (e.g., about 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, or 15) nucleotides in length, wherein the sense
region the antisense region have at least 3 complementary
nucleotides, and wherein the siNA can include one or more chemical
modifications comprising a structure having any of Formulae I-VII
or any combination thereof. In another embodiment, the asymmetic
double stranded siNA molecule can also have a 5'-terminal phosphate
group that can be chemically modified as described herein (for
example a 5'-terminal phosphate group having Formula IV).
[0085] In another embodiment, a siNA molecule of the invention
comprises a circular nucleic acid molecule, wherein the siNA is
about 38 to about 70 (e.g., about 38, 40, 45, 50, 55, 60, 65, or
70) nucleotides in length having about 18 to about 23 (e.g., about
18, 19, 20, 21, 22, or 23) base pairs, and wherein the siNA can
include a chemical modification, which comprises a structure having
any of Formulae I-VII or any combination thereof. For example, an
exemplary chemically-modified siNA molecule of the invention
comprises a circular oligonucleotide having about 42 to about 50
(e.g., about 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides
that is chemically-modified with a chemical modification having any
of Formulae I-VII or any combination thereof, wherein the circular
oligonucleotide forms a dumbbell shaped structure having about 19
base pairs and 2 loops.
[0086] In another embodiment, a circular siNA molecule of the
invention contains two loop motifs, wherein one or both loop
portions of the siNA molecule is biodegradable. For example, a
circular siNA molecule of the invention is designed such that
degradation of the loop portions of the siNA molecule in vivo can
generate a double-stranded siNA molecule with 3'-terminal
overhangs, such as 3'-terminal nucleotide overhangs comprising
about 2 nucleotides.
[0087] In one embodiment, a siNA molecule of the invention
comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) abasic moiety, for example a compound having Formula V:
##STR5## wherein each R3, R4, R5, R6, R7, R8, R10, R11, R12, and
R13 is independently H, OH, alkyl, substituted alkyl, alkaryl or
aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl,
O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH,
O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl,
alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalklylamino, substituted silyl, or group having Formula I; R9
is O, S, CH2, S.dbd.O, CHF, or CF2.
[0088] In one embodiment, a siNA molecule of the invention
comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) inverted abasic moiety, for example a compound having
Formula VI: ##STR6## wherein each R3, R4, R5, R6, R7, R8, R10, R11,
R12, and R13 is independently H, OH, alkyl, substituted alkyl,
alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl,
S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl,
alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH,
S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2,
aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid,
O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalklylamino, substituted silyl, or group having Formula I; R9
is O, S, CH2, S.dbd.O, CHF, or CF2, and either R3, R5, R8 or R13
serve as points of attachment to the siNA molecule of the
invention.
[0089] In another embodiment, a siNA molecule of the invention
comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) substituted polyalkyl moieties, for example a compound
having Formula VII: ##STR7## wherein each n is independently an
integer from 1 to 12, each R1, R2 and R3 is independently H, OH,
alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3,
OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl,
N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH,
S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2,
N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl,
O-aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl,
aminoalkylamino, polyalklylamino, substituted silyl, or a group
having Formula I, and R1, R2 or R3 serves as points of attachment
to the siNA molecule of the invention.
[0090] In another embodiment, the invention features a compound
having Formula VII, wherein R1 and R2 are hydroxyl (OH) groups,
n=1, and R3 comprises O and is the point of attachment to the
3'-end, the 5'-end, or both of the 3' and 5'-ends of one or both
strands of a double-stranded siNA molecule of the invention or to a
single-stranded siNA molecule of the invention. This modification
is referred to herein as "glyceryl" (for example modification 6 in
FIG. 22).
[0091] In another embodiment, a moiety having any of Formula V, VI
or VII of the invention is at the 3'-end, the 5'-end, or both of
the 3' and 5'-ends of a siNA molecule of the invention. For
example, a moiety having Formula V, VI or VII can be present at the
3'-end, the 5'-end, or both of the 3' and 5'-ends of the antisense
strand, the sense strand, or both antisense and sense strands of
the siNA molecule. In addition, a moiety having Formula VII can be
present at the 3'-end or the 5'-end of a hairpin siNA molecule as
described herein.
[0092] In another embodiment, a siNA molecule of the invention
comprises an abasic residue having Formula V or VI, wherein the
abasic residue having Formula V or VI is connected to the siNA
construct in a 3-3', 3-2', 2-3', or 5-5' configuration, such as at
the 3'-end, the 5'-end, or both of the 3' and 5'-ends of one or
both siNA strands.
[0093] In one embodiment, a siNA molecule of the invention
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) locked nucleic acid (LNA) nucleotides, for example at the
5'-end, the 3'-end, both of the 5' and 3'-ends, or any combination
thereof, of the siNA molecule.
[0094] In another embodiment, a siNA molecule of the invention
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) acyclic nucleotides, for example at the 5'-end, the
3'-end, both of the 5' and 3'-ends, or any combination thereof, of
the siNA molecule.
[0095] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention, wherein the chemically-modified siNA comprises a
sense region, where any (e.g., one or more or all) pyrimidine
nucleotides present in the sense region are 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and where any (e.g., one or more or all)
purine nucleotides present in the sense region are 2'-deoxy purine
nucleotides (e.g., wherein all purine nucleotides are 2'-deoxy
purine nucleotides or alternately a plurality of purine nucleotides
are 2'-deoxy purine nucleotides).
[0096] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention, wherein the chemically-modified siNA comprises a
sense region, where any (e.g., one or more or all) pyrimidine
nucleotides present in the sense region are 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and where any (e.g., one or more or all)
purine nucleotides present in the sense region are 2'-deoxy purine
nucleotides (e.g., wherein all purine nucleotides are 2'-deoxy
purine nucleotides or alternately a plurality of purine nucleotides
are 2'-deoxy purine nucleotides), wherein any nucleotides
comprising a 3'-terminal nucleotide overhang that are present in
said sense region are 2'-deoxy nucleotides.
[0097] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention, wherein the chemically-modified siNA comprises a
sense region, where any (e.g., one or more or all) pyrimidine
nucleotides present in the sense region are 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and where any (e.g., one or more or all)
purine nucleotides present in the sense region are 2'-O-methyl
purine nucleotides (e.g., wherein all purine nucleotides are
2'-O-methyl purine nucleotides or alternately a plurality of purine
nucleotides are 2'-O-methyl purine nucleotides).
[0098] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention, wherein the chemically-modified siNA comprises a
sense region, where any (e.g., one or more or all) pyrimidine
nucleotides present in the sense region are 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and where any (e.g., one or more or all)
purine nucleotides present in the sense region are 2'-O-methyl
purine nucleotides (e.g., wherein all purine nucleotides are
2'-O-methyl purine nucleotides or alternately a plurality of purine
nucleotides are 2'-O-methyl purine nucleotides), wherein any
nucleotides comprising a 3'-terminal nucleotide overhang that are
present in said sense region are 2'-deoxy nucleotides.
[0099] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention, wherein the chemically-modified siNA comprises an
antisense region, where any (e.g., one or more or all) pyrimidine
nucleotides present in the antisense region are 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and wherein any (e.g., one or more or all)
purine nucleotides present in the antisense region are 2'-O-methyl
purine nucleotides (e.g., wherein all purine nucleotides are
2'-O-methyl purine nucleotides or alternately a plurality of purine
nucleotides are 2'-O-methyl purine nucleotides).
[0100] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention, wherein the chemically-modified siNA comprises an
antisense region, where any (e.g., one or more or all) pyrimidine
nucleotides present in the antisense region are 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and wherein any (e.g., one or more or all)
purine nucleotides present in the antisense region are 2'-O-methyl
purine nucleotides (e.g., wherein all purine nucleotides are
2'-O-methyl purine nucleotides or alternately a plurality of purine
nucleotides are 2'-O-methyl purine nucleotides), wherein any
nucleotides comprising a 3'-terminal nucleotide overhang that are
present in said antisense region are 2'-deoxy nucleotides.
[0101] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention, wherein the chemically-modified siNA comprises an
antisense region, where any (e.g., one or more or all) pyrimidine
nucleotides present in the antisense region are 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and where any (e.g., one or more or all)
purine nucleotides present in the antisense region are 2'-deoxy
purine nucleotides (e.g., wherein all purine nucleotides are
2'-deoxy purine nucleotides or alternately a plurality of purine
nucleotides are 2'-deoxy purine nucleotides).
[0102] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention capable of mediating RNA interference (RNAi)
inside a cell or reconstituted in vitro system comprising a sense
region and an antisense region. In one embodiment, the sense region
comprises one or more 2'-deoxy-2'-fluoro pyrimidine nucleotides
(e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides or alternately a plurality of pyrimidine
nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and one
or more 2'-deoxy purine nucleotides (e.g., wherein all purine
nucleotides are 2'-deoxy purine nucleotides or alternately a
plurality of purine nucleotides are 2'-deoxy purine nucleotides).
The sense region can comprise inverted deoxy abasic modifications
that are optionally present at the 3'-end, the 5'-end, or both of
the 3' and 5'-ends of the sense region. The sense region can
optionally further comprise a 3'-terminal overhang having about 1
to about 4 (e.g., about 1, 2, 3, or 4) 2'-deoxyribonucleotides. The
antisense region comprises one or more 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and one or more 2'-O-methyl purine
nucleotides (e.g., wherein all purine nucleotides are 2'-O-methyl
purine nucleotides or alternately a plurality of purine nucleotides
are 2'-O-methyl purine nucleotides). The antisense region can
comprise a terminal cap modification, such as any modification
described herein or shown in FIG. 22, that is optionally present at
the 3'-end, the 5'-end, or both of the 3' and 5'-ends of the
antisense sequence. The antisense region optionally further
comprises a 3'-terminal nucleotide overhang having about 1 to about
4 (e.g., about 1, 2, 3, or 4) 2'-deoxynucleotides, wherein the
overhang nucleotides can further comprise one or more (e.g., 1, 2,
3, or 4) phosphorothioate internucleotide linkages. Non-limiting
examples of these chemically-modified siNAs are shown in FIGS. 18
and 19 and Table IV herein.
[0103] In another embodiment of the chemically-modified short
interfering nucleic acid comprising a sense region and an antisense
region, the sense region comprises one or more 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and one or more purine ribonucleotides
(e.g., wherein all purine nucleotides are purine ribonucleotides or
alternately a plurality of purine nucleotides are purine
ribonucleotides). The sense region can also comprise inverted deoxy
abasic modifications that are optionally present at the 3'-end, the
5'-end, or both of the 3' and 5'-ends of the sense region. The
sense region optionally further comprises a 3'-terminal overhang
having about 1 to about 4 (e.g., about 1, 2, 3, or 4)
2'-deoxyribonucleotides. The antisense region comprises one or more
2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and one or more
2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides). The antisense region can also comprise a terminal cap
modification, such as any modification described herein or shown in
FIG. 22, that is optionally present at the 3'-end, the 5'-end, or
both of the 3' and 5'-ends of the antisense sequence. The antisense
region optionally further comprises a 3'-terminal nucleotide
overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4)
2'-deoxynucleotides, wherein the overhang nucleotides can further
comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate
internucleotide linkages. Non-limiting examples of these
chemically-modified siNAs are shown in FIGS. 18 and 19 and Table IV
herein.
[0104] In another embodiment of the chemically-modified short
interfering nucleic acid comprising a sense region and an antisense
region, the sense region comprises one or more 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and one or more purine nucleotides
selected from the group consisting of 2'-deoxy nucleotides, locked
nucleic acid (LNA) nucleotides, 2'-methoxyethyl nucleotides,
4'-thionucleotides, and 2'-O-methyl nucleotides (e.g., wherein all
purine nucleotides are selected from the group consisting of
2'-deoxy nucleotides, locked nucleic acid (LNA) nucleotides,
2'-methoxyethyl nucleotides, 4'-thionucleotides, and 2'-O-methyl
nucleotides or alternately a plurality of purine nucleotides are
selected from the group consisting of 2'-deoxy nucleotides, locked
nucleic acid (LNA) nucleotides, 2'-methoxyethyl nucleotides,
4'-thionucleotides, and 2'-O-methyl nucleotides). The sense region
can comprise inverted deoxy abasic modifications that are
optionally present at the 3'-end, the 5'-end, or both of the 3' and
5'-ends of the sense region. The sense region can optionally
further comprise a 3'-terminal overhang having about 1 to about 4
(e.g., about 1, 2, 3, or 4) 2'-deoxyribonucleotides. The antisense
region comprises one or more 2'-deoxy-2'-fluoro pyrimidine
nucleotides (e.g., wherein all pyrimidine nucleotides are
2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and one or more purine nucleotides
selected from the group consisting of 2'-deoxy nucleotides, locked
nucleic acid (LNA) nucleotides, 2'-methoxyethyl nucleotides,
4'-thionucleotides, and 2'-O-methyl nucleotides (e.g., wherein all
purine nucleotides are selected from the group consisting of
2'-deoxy nucleotides, locked nucleic acid (LNA) nucleotides,
2'-methoxyethyl nucleotides, 4'-thionucleotides, and 2'-O-methyl
nucleotides or alternately a plurality of purine nucleotides are
selected from the group consisting of 2'-deoxy nucleotides, locked
nucleic acid (LNA) nucleotides, 2'-methoxyethyl nucleotides,
4'-thionucleotides, and 2'-O-methyl nucleotides). The antisense can
also comprise a terminal cap modification, such as any modification
described herein or shown in FIG. 22, that is optionally present at
the 3'-end, the 5'-end, or both of the 3' and 5'-ends of the
antisense sequence. The antisense region optionally further
comprises a 3'-terminal nucleotide overhang having about 1 to about
4 (e.g., about 1, 2, 3, or 4) 2'-deoxynucleotides, wherein the
overhang nucleotides can further comprise one or more (e.g., 1, 2,
3, or 4) phosphorothioate internucleotide linkages.
[0105] In another embodiment, any modified nucleotides present in
the siNA molecules of the invention, preferably in the antisense
strand of the siNA molecules of the invention, but also optionally
in the sense and/or both antisense and sense strands, comprise
modified nucleotides having properties or characteristics similar
to naturally occurring ribonucleotides. For example, the invention
features siNA molecules including modified nucleotides having a
Northern conformation (e.g., Northern pseudorotation cycle, see for
example Saenger, Principles of Nucleic Acid Structure,
Springer-Verlag ed., 1984). As such, chemically modified
nucleotides present in the siNA molecules of the invention,
preferably in the antisense strand of the siNA molecules of the
invention, but also optionally in the sense and/or both antisense
and sense strands, are resistant to nuclease degradation while at
the same time maintaining the capacity to mediate RNAi.
Non-limiting examples of nucleotides having a northern
configuration include locked nucleic acid (LNA) nucleotides (e.g.,
2'-O,4'-C-methylene-(D-ribofuranosyl) nucleotides);
2'-methoxyethoxy (MOE) nucleotides; 2'-methyl-thio-ethyl,
2'-deoxy-2'-fluoro nucleotides, 2'-deoxy-2'-chloro nucleotides,
2'-azido nucleotides, and 2'-O-methyl nucleotides.
[0106] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid molecule (siNA)
capable of mediating RNA interference (RNAi) inside a cell or
reconstituted in vitro system, wherein the chemical modification
comprises a conjugate attached to the chemically-modified siNA
molecule. The conjugate can be attached to the chemically-modified
siNA molecule via a covalent attachment. In one embodiment, the
conjugate is attached to the chemically-modified siNA molecule via
a biodegradable linker. In one embodiment, the conjugate molecule
is attached at the 3'-end of either the sense strand, the antisense
strand, or both strands of the chemically-modified siNA molecule.
In another embodiment, the conjugate molecule is attached at the
5'-end of either the sense strand, the antisense strand, or both
strands of the chemically-modified siNA molecule. In yet another
embodiment, the conjugate molecule is attached both the 3'-end and
5'-end of either the sense strand, the antisense strand, or both
strands of the chemically-modified siNA molecule, or any
combination thereof. In one embodiment, the conjugate molecule of
the invention comprises a molecule that facilitates delivery of a
chemically-modified siNA molecule into a biological system, such as
a cell. In another embodiment, the conjugate molecule attached to
the chemically-modified siNA molecule is a poly ethylene glycol,
human serum albumin, or a ligand for a cellular receptor that can
mediate cellular uptake. Examples of specific conjugate molecules
contemplated by the instant invention that can be attached to
chemically-modified siNA molecules are described in Vargeese et
al., U.S. Ser. No. 10/201,394, incorporated by reference herein.
The type of conjugates used and the extent of conjugation of siNA
molecules of the invention can be evaluated for improved
pharmacokinetic profiles, bioavailability, and/or stability of siNA
constructs while at the same time maintaining the ability of the
siNA to mediate RNAi activity. As such, one skilled in the art can
screen siNA constructs that are modified with various conjugates to
determine whether the siNA conjugate complex possesses improved
properties while maintaining the ability to mediate RNAi, for
example in animal models as are generally known in the art.
[0107] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention capable of mediating RNA interference (RNAi)
inside a cell or reconstituted in vitro system, wherein the
chemically-modified siNA comprises a sense region, where one or
more pyrimidine nucleotides present in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and where one or
more purine nucleotides present in the sense region are 2'-deoxy
purine nucleotides (e.g., wherein all purine nucleotides are
2'-deoxy purine nucleotides or alternately a plurality of purine
nucleotides are 2'-deoxy purine nucleotides), and inverted deoxy
abasic modifications that are optionally present at the 3'-end, the
5'-end, or both of the 3' and 5'-ends of the sense region, the
sense region optionally further comprising a 3'-terminal overhang
having about 1 to about 4 (e.g., about 1, 2, 3, or 4)
2'-deoxyribonucleotides; and wherein the chemically-modified short
interfering nucleic acid molecule comprises an antisense region,
where one or more pyrimidine nucleotides present in the antisense
region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein
all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein one or
more purine nucleotides present in the antisense region are
2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides), and a terminal cap modification, such as any
modification described herein or shown in FIG. 22, that is
optionally present at the 3'-end, the 5'-end, or both of the 3' and
5'-ends of the antisense sequence, the antisense region optionally
further comprising a 3'-terminal nucleotide overhang having about 1
to about 4 (e.g., about 1, 2, 3, or 4) 2'-deoxynucleotides, wherein
the overhang nucleotides can further comprise one or more (e.g., 1,
2, 3, or 4) phosphorothioate internucleotide linkages. Non-limiting
examples of these chemically-modified siNAs are shown in FIGS. 18
and 19 and Table IV herein.
[0108] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention capable of mediating RNA interference (RNAi)
inside a cell or reconstituted in vitro system, wherein the
chemically-modified siNA comprises a sense region, where one or
more pyrimidine nucleotides present in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and where one or
more purine nucleotides present in the sense region are 2'-O-methyl
purine nucleotides (e.g., wherein all purine nucleotides are
2'-O-methyl purine nucleotides or alternately a plurality of purine
nucleotides are 2'-O-methyl purine nucleotides), and inverted deoxy
abasic modifications that are optionally present at the 3'-end, the
5'-end, or both of the 3' and 5'-ends of the sense region, the
sense region optionally further comprising a 3'-terminal overhang
having about 1 to about 4 (e.g., about 1, 2, 3, or 4)
2'-deoxyribonucleotides; and wherein the chemically-modified short
interfering nucleic acid molecule comprises an antisense region,
where one or more pyrimidine nucleotides present in the antisense
region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein
all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein one or
more purine nucleotides present in the antisense region are
2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides), and a terminal cap modification, such as any
modification described herein or shown in FIG. 22, that is
optionally present at the 3'-end, the 5'-end, or both of the 3' and
5'-ends of the antisense sequence, the antisense region optionally
further comprising a 3'-terminal nucleotide overhang having about 1
to about 4 (e.g., about 1, 2, 3, or 4) 2'-deoxynucleotides, wherein
the overhang nucleotides can further comprise one or more (e.g., 1,
2, 3, or 4) phosphorothioate internucleotide linkages. Non-limiting
examples of these chemically-modified siNAs are shown in FIGS. 18
and 19 and Table IV herein.
[0109] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention capable of mediating RNA interference (RNAi)
inside a cell or reconstituted in vitro system, wherein the siNA
comprises a sense region, where one or more pyrimidine nucleotides
present in the sense region are 2'-deoxy-2'-fluoro pyrimidine
nucleotides (e.g., wherein all pyrimidine nucleotides are
2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and where one or more purine nucleotides
present in the sense region are purine ribonucleotides (e.g.,
wherein all purine nucleotides are purine ribonucleotides or
alternately a plurality of purine nucleotides are purine
ribonucleotides), and inverted deoxy abasic modifications that are
optionally present at the 3'-end, the 5'-end, or both of the 3' and
5'-ends of the sense region, the sense region optionally further
comprising a 3'-terminal overhang having about 1 to about 4 (e.g.,
about 1, 2, 3, or 4) 2'-deoxyribonucleotides; and wherein the siNA
comprises an antisense region, where one or more pyrimidine
nucleotides present in the antisense region are 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and wherein any purine nucleotides present
in the antisense region are 2'-O-methyl purine nucleotides (e.g.,
wherein all purine nucleotides are 2'-O-methyl purine nucleotides
or alternately a plurality of purine nucleotides are 2'-O-methyl
purine nucleotides), and a terminal cap modification, such as any
modification described herein or shown in FIG. 22, that is
optionally present at the 3'-end, the 5'-end, or both of the 3' and
5'-ends of the antisense sequence, the antisense region optionally
further comprising a 3'-terminal nucleotide overhang having about 1
to about 4 (e.g., about 1, 2, 3, or 4) 2'-deoxynucleotides, wherein
the overhang nucleotides can further comprise one or more (e.g., 1,
2, 3, or 4) phosphorothioate internucleotide linkages. Non-limiting
examples of these chemically-modified siNAs are shown in FIGS. 18
and 19 and Table IV herein.
[0110] In one embodiment, the invention features a
chemically-modified short interfering nucleic acid (siNA) molecule
of the invention capable of mediating RNA interference (RNAi)
inside a cell or reconstituted in vitro system, wherein the
chemically-modified siNA comprises a sense region, where one or
more pyrimidine nucleotides present in the sense region are
2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and for example
where one or more purine nucleotides present in the sense region
are selected from the group consisting of 2'-deoxy nucleotides,
locked nucleic acid (LNA) nucleotides, 2'-methoxyethyl nucleotides,
4'-thionucleotides, and 2'-O-methyl nucleotides (e.g., wherein all
purine nucleotides are selected from the group consisting of
2'-deoxy nucleotides, locked nucleic acid (LNA) nucleotides,
2'-methoxyethyl nucleotides, 4'-thionucleotides, and 2'-O-methyl
nucleotides or alternately a plurality of purine nucleotides are
selected from the group consisting of 2'-deoxy nucleotides, locked
nucleic acid (LNA) nucleotides, 2'-methoxyethyl nucleotides,
4'-thionucleotides, and 2'-O-methyl nucleotides), and wherein
inverted deoxy abasic modifications are optionally present at the
3'-end, the 5'-end, or both of the 3' and 5'-ends of the sense
region, the sense region optionally further comprising a
3'-terminal overhang having about 1 to about 4 (e.g., about 1, 2,
3, or 4) 2'-deoxyribonucleotides; and wherein the
chemically-modified short interfering nucleic acid molecule
comprises an antisense region, where one or more pyrimidine
nucleotides present in the antisense region are 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and wherein one or more purine nucleotides
present in the antisense region are selected from the group
consisting of 2'-deoxy nucleotides, locked nucleic acid (LNA)
nucleotides, 2'-methoxyethyl nucleotides, 4'-thionucleotides, and
2'-O-methyl nucleotides (e.g., wherein all purine nucleotides are
selected from the group consisting of 2'-deoxy nucleotides, locked
nucleic acid (LNA) nucleotides, 2'-methoxyethyl nucleotides,
4'-thionucleotides, and 2'-O-methyl nucleotides or alternately a
plurality of purine nucleotides are selected from the group
consisting of 2'-deoxy nucleotides, locked nucleic acid (LNA)
nucleotides, 2'-methoxyethyl nucleotides, 4'-thionucleotides, and
2'-O-methyl nucleotides), and a terminal cap modification, such as
any modification described herein or shown in FIG. 22, that is
optionally present at the 3'-end, the 5'-end, or both of the 3' and
5'-ends of the antisense sequence, the antisense region optionally
further comprising a 3'-terminal nucleotide overhang having about 1
to about 4 (e.g., about 1, 2, 3, or 4) 2'-deoxynucleotides, wherein
the overhang nucleotides can further comprise one or more (e.g., 1,
2, 3, or 4) phosphorothioate internucleotide linkages.
[0111] In one embodiment, the invention features a short
interfering nucleic acid (siNA) molecule of the invention, wherein
the siNA further comprises a nucleotide, non-nucleotide, or mixed
nucleotide/non-nucleotide linker that joins the sense region of the
siNA to the antisense region of the siNA. In one embodiment, a
nucleotide linker of the invention can be a linker of .gtoreq.2
nucleotides in length, for example 3, 4, 5, 6, 7, 8, 9, or 10
nucleotides in length. In another embodiment, the nucleotide linker
can be a nucleic acid aptamer. By "aptamer" or "nucleic acid
aptamer" as used herein is meant a nucleic acid molecule that binds
specifically to a target molecule wherein the nucleic acid molecule
has sequence that comprises a sequence recognized by the target
molecule in its natural setting. Alternately, an aptamer can be a
nucleic acid molecule that binds to a target molecule where the
target molecule does not naturally bind to a nucleic acid. The
target molecule can be any molecule of interest. For example, the
aptamer can be used to bind to a ligand-binding domain of a
protein, thereby preventing interaction of the naturally occurring
ligand with the protein. This is a non-limiting example and those
in the art will recognize that other embodiments can be readily
generated using techniques generally known in the art. (See, for
example, Gold et al., 1995, Annu. Rev. Biochem., 64, 763; Brody and
Gold, 2000, J. Biotechnol., 74, 5; Sun, 2000, Curr. Opin. Mol.
Ther., 2, 100; Kusser, 2000, J. Biotechnol., 74, 27; Hermann and
Patel, 2000, Science, 287, 820; and Jayasena, 1999, Clinical
Chemistry, 45, 1628.)
[0112] In yet another embodiment, a non-nucleotide linker of the
invention comprises abasic nucleotide, polyether, polyamine,
polyamide, peptide, carbohydrate, lipid, polyhydrocarbon, or other
polymeric compounds (e.g. polyethylene glycols such as those having
between 2 and 100 ethylene glycol units). Specific examples include
those described by Seela and Kaiser, Nucleic Acids Res. 1990,
18:6353 and Nucleic Acids Res. 1987, 15:3113; Cload and Schepartz,
J. Am. Chem. Soc. 1991, 113:6324; Richardson and Schepartz, J. Am.
Chem. Soc. 1991, 113:5109; Ma et al., Nucleic Acids Res. 1993,
21:2585 and Biochemistry 1993, 32:1751; Durand et al., Nucleic
Acids Res. 1990, 18:6353; McCurdy et al., Nucleosides &
Nucleotides 1991, 10:287; Jschke et al., Tetrahedron Lett. 1993,
34:301; Ono et al., Biochemistry 1991, 30:9914; Arnold et al.,
International Publication No. WO 89/02439; Usman et al.,
International Publication No. WO 95/06731; Dudycz et al.,
International Publication No. WO 95/11910 and Ferentz and Verdine,
J. Am. Chem. Soc. 1991, 113:4000, all hereby incorporated by
reference herein. A "non-nucleotide" further means any group or
compound that can be incorporated into a nucleic acid chain in the
place of one or more nucleotide units, including either sugar
and/or phosphate substitutions, and allows the remaining bases to
exhibit their enzymatic activity. The group or compound can be
abasic in that it does not contain a commonly recognized nucleotide
base, such as adenosine, guanine, cytosine, uracil or thymine, for
example at the C1 position of the sugar.
[0113] In one embodiment, the invention features a short
interfering nucleic acid (siNA) molecule capable of mediating RNA
interference (RNAi) inside a cell or reconstituted in vitro system,
wherein one or both strands of the siNA molecule that are assembled
from two separate oligonucleotides do not comprise any
ribonucleotides. For example, a siNA molecule can be assembled from
a single oligonculeotide where the sense and antisense regions of
the siNA comprise separate oligonucleotides that do not have any
ribonucleotides (e.g., nucleotides having a 2'-OH group) present in
the oligonucleotides. In another example, a siNA molecule can be
assembled from a single oligonculeotide where the sense and
antisense regions of the siNA are linked or circularized by a
nucleotide or non-nucleotide linker as described herein, wherein
the oligonucleotide does not have any ribonucleotides (e.g.,
nucleotides having a 2'-OH group) present in the oligonucleotide.
Applicant has surprisingly found that the presense of
ribonucleotides (e.g., nucleotides having a 2'-hydroxyl group)
within the siNA molecule is not required or essential to support
RNAi activity. As such, in one embodiment, all positions within the
siNA can include chemically modified nucleotides and/or
non-nucleotides such as nucleotides and or non-nucleotides having
Formula I, II, III, IV, V, VI, or VII or any combination thereof to
the extent that the ability of the siNA molecule to support RNAi
activity in a cell is maintained.
[0114] In one embodiment; a siNA molecule of the invention is a
single stranded siNA molecule that mediates RNAi activity in a cell
or reconstituted in vitro system, wherein the siNA molecule
comprises a single stranded polynucleotide having complementarity
to a target nucleic acid sequence. In another embodiment, the
single stranded siNA molecule of the invention comprises a
5'-terminal phosphate group. In another embodiment, the single
stranded siNA molecule of the invention comprises a 5'-terminal
phosphate group and a 3'-terminal phosphate group (e.g., a
2',3'-cyclic phosphate). In another embodiment, the single stranded
siNA molecule of the invention comprises about 19 to about 29
nucleotides. In yet another embodiment, the single stranded siNA
molecule of the invention comprises one or more chemically modified
nucleotides or non-nucleotides described herein. For example, all
the positions within the siNA molecule can include
chemically-modified nucleotides such as nucleotides having any of
Formulae I-VII, or any combination thereof to the extent that the
ability of the siNA molecule to support RNAi activity in a cell is
maintained.
[0115] In one embodiment, the single stranded siNA molecule having
complementarity to a target nucleic acid sequence comprises one or
more 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all
pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine
nucleotides or alternately a plurality of pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and one or more
2'-O-methyl purine nucleotides (e.g., wherein all purine
nucleotides are 2'-O-methyl purine nucleotides or alternately a
plurality of purine nucleotides are 2'-O-methyl purine
nucleotides). In another embodiment, the single stranded siNA
molecule comprises one or more 2'-deoxy-2'-fluoro pyrimidine
nucleotides (e.g., wherein all pyrimidine nucleotides are
2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and one or more 2'-deoxy purine
nucleotides (e.g., wherein all purine nucleotides are 2'-deoxy
purine nucleotides or alternately a plurality of purine nucleotides
are 2'-deoxy purine nucleotides). In another embodiment, the single
stranded siNA molecule comprises one or more 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), wherein any purine nucleotides present in
the antisense region are locked nucleic acid (LNA) nucleotides
(e.g., wherein all purine nucleotides are LNA nucleotides or
alternately a plurality of purine nucleotides are LNA nucleotides).
In another embodiment, the single stranded siNA molecule comprises
one or more 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g.,
wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides or alternately a plurality of pyrimidine
nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and one
or more 2'-methoxyethyl purine nucleotides (e.g., wherein all
purine nucleotides are 2'-methoxyethyl purine nucleotides or
alternately a plurality of purine nucleotides are 2'-methoxyethyl
purine nucleotides), the single stranded siNA can comprise a
terminal cap modification, such as any modification described
herein or shown in FIG. 22, that is optionally present at the
3'-end, the 5'-end, or both of the 3' and 5'-ends of the antisense
sequence. The single stranded siNA optionally further comprises
about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal
2'-deoxynucleotides at the 3'-end of the siNA molecule, wherein the
terminal nucleotides can further comprise one or more (e.g., 1, 2,
3, or 4) phosphorothioate internucleotide linkages. The single
stranded siNA optionally further comprises a terminal phosphate
group, such as a 5'-terminal phosphate group.
[0116] In one embodiment, a siNA molecule of the invention is a
single stranded siNA molecule that mediates RNAi activity in a cell
or reconstituted in vitro system, wherein the siNA molecule
comprises a single stranded polynucleotide having complementarity
to a target nucleic acid sequence, and wherein one or more
pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and wherein any purine nucleotides present
in the antisense region are 2'-O-methyl purine nucleotides (e.g.,
wherein all purine nucleotides are 2'-O-methyl purine nucleotides
or alternately a plurality of purine nucleotides are 2'-O-methyl
purine nucleotides), and a terminal cap modification, such as any
modification described herein or shown in FIG. 22, that is
optionally present at the 3'-end, the 5'-end, or both of the 3' and
5'-ends of the antisense sequence, the siNA optionally further
comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal
2'-deoxynucleotides at the 3'-end of the siNA molecule, wherein the
terminal nucleotides can further comprise one or more (e.g., 1, 2,
3, or 4) phosphorothioate internucleotide linkages, and wherein the
siNA optionally further comprises a terminal phosphate group, such
as a 5'-terminal phosphate group.
[0117] In one embodiment, a siNA molecule of the invention is a
single stranded siNA molecule that mediates RNAi activity in a cell
or reconstituted in vitro system, wherein the siNA molecule
comprises a single stranded polynucleotide having complementarity
to a target nucleic acid sequence, and wherein one or more
pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and wherein any purine nucleotides present
in the siNA are 2'-O-methyl purine nucleotides (e.g., wherein all
purine nucleotides are 2'-O-methyl purine nucleotides or
alternately a plurality of purine nucleotides are 2'-O-methyl
purine nucleotides), and a terminal cap modification, such as any
modification described herein or shown in FIG. 22, that is
optionally present at the 3'-end, the 5'-end, or both of the 3' and
5'-ends of the antisense sequence, the siNA optionally further
comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal
2'-deoxynucleotides at the 3'-end of the siNA molecule, wherein the
terminal nucleotides can further comprise one or more (e.g., 1, 2,
3, or 4) phosphorothioate internucleotide linkages, and wherein the
siNA optionally further comprises a terminal phosphate group, such
as a 5'-terminal phosphate group.
[0118] In one embodiment, a siNA molecule of the invention is a
single stranded siNA molecule that mediates RNAi activity in a cell
or reconstituted in vitro system, wherein the siNA molecule
comprises a single stranded polynucleotide having complementarity
to a target nucleic acid sequence, and wherein one or more
pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and wherein any purine nucleotides present
in the siNA are 2'-deoxy purine nucleotides (e.g., wherein all
purine nucleotides are 2'-deoxy purine nucleotides or alternately a
plurality of purine nucleotides are 2'-deoxy purine nucleotides),
and a terminal cap modification, such as any modification described
herein or shown in FIG. 22, that is optionally present at the
3'-end, the 5'-end, or both of the 3' and 5'-ends of the antisense
sequence, the siNA optionally further comprising about 1 to about 4
(e.g., about 1, 2, 3, or 4) terminal 2'-deoxynucleotides at the
3'-end of the siNA molecule, wherein the terminal nucleotides can
further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate
internucleotide linkages, and wherein the siNA optionally further
comprises a terminal phosphate group, such as a 5'-terminal
phosphate group.
[0119] In one embodiment, a siNA molecule of the invention is a
single stranded siNA molecule that mediates RNAi activity in a cell
or reconstituted in vitro system, wherein the siNA molecule
comprises a single stranded polynucleotide having complementarity
to a target nucleic acid sequence, and wherein one or more
pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and wherein any purine nucleotides present
in the siNA are locked nucleic acid (LNA) nucleotides (e.g.,
wherein all purine nucleotides are LNA nucleotides or alternately a
plurality of purine nucleotides are LNA nucleotides), and a
terminal cap modification, such as any modification described
herein or shown in FIG. 22, that is optionally present at the
3'-end, the 5'-end, or both of the 3' and 5'-ends of the antisense
sequence, the siNA optionally further comprising about 1 to about 4
(e.g., about 1, 2, 3, or 4) terminal 2'-deoxynucleotides at the
3'-end of the siNA molecule, wherein the terminal nucleotides can
further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate
internucleotide linkages, and wherein the siNA optionally further
comprises a terminal phosphate group, such as a 5'-terminal
phosphate group.
[0120] In one embodiment, a siNA molecule of the invention is a
single stranded siNA molecule that mediates RNAi activity in a cell
or reconstituted in vitro system, wherein the siNA molecule
comprises a single stranded polynucleotide having complementarity
to a target nucleic acid sequence, and wherein one or more
pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro
pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides
are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a
plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro
pyrimidine nucleotides), and wherein any purine nucleotides present
in the siNA are 2'-methoxyethyl purine nucleotides (e.g., wherein
all purine nucleotides are 2'-methoxyethyl purine nucleotides or
alternately a plurality of purine nucleotides are 2'-methoxyethyl
purine nucleotides), and a terminal cap modification, such as any
modification described herein or shown in FIG. 22, that is
optionally present at the 3'-end, the 5'-end, or both of the 3' and
5'-ends of the antisense sequence, the siNA optionally further
comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal
2'-deoxynucleotides at the 3'-end of the siNA molecule, wherein the
terminal nucleotides can further comprise one or more (e.g., 1, 2,
3, or 4) phosphorothioate internucleotide linkages, and wherein the
siNA optionally further comprises a terminal phosphate group, such
as a 5'-terminal phosphate group.
[0121] In another embodiment, any modified nucleotides present in
the single stranded siNA molecules of the invention comprise
modified nucleotides having properties or characteristics similar
to naturally occurring ribonucleotides. For example, the invention
features siNA molecules including modified nucleotides having a
Northern conformation (e.g., Northern pseudorotation cycle, see for
example Saenger, Principles of nucleic Acid Structure,
Springer-Verlag ed., 1984). As such, chemically modified
nucleotides present in the single stranded siNA molecules of the
invention are preferably resistant to nuclease degradation while at
the same time maintaining the capacity to mediate RNAi.
[0122] In one embodiment, the invention features a method for
modulating the expression of a gene within a cell comprising: (a)
synthesizing a siNA molecule of the invention, which can be
chemically-modified, wherein one of the siNA strands comprises a
sequence complementary to RNA of the gene; and (b) introducing the
siNA molecule into a cell under conditions suitable to modulate the
expression of the gene in the cell.
[0123] In one embodiment, the invention features a method for
modulating the expression of a gene within a cell comprising: (a)
synthesizing a siNA molecule of the invention, which can be
chemically-modified, wherein one of the siNA strands comprises a
sequence complementary to RNA of the gene and wherein the sense
strand sequence of the siNA comprises a sequence substantially
similar to the sequence of the target RNA; and (b) introducing the
siNA molecule into a cell under conditions suitable to modulate the
expression of the gene in the cell.
[0124] In another embodiment, the invention features a method for
modulating the expression of more than one gene within a cell
comprising: (a) synthesizing siNA molecules of the invention, which
can be chemically-modified, wherein one of the siNA strands
comprises a sequence complementary to RNA of the genes; and (b)
introducing the siNA molecules into a cell under conditions
suitable to modulate the expression of the genes in the cell.
[0125] In another embodiment, the invention features a method for
modulating the expression of more than one gene within a cell
comprising: (a) synthesizing a siNA molecule of the invention,
which can be chemically-modified, wherein one of the siNA strands
comprises a sequence complementary to RNA of the gene and wherein
the sense strand sequence of the siNA comprises a sequence
substantially similar to the sequence of the target RNA; and (b)
introducing the siNA molecules into a cell under conditions
suitable to modulate the expression of the genes in the cell.
[0126] In one embodiment, siNA molecules of the invention are used
as reagents in ex vivo applications. For example, siNA reagents are
intoduced into tissue or cells that are transplanted into a subject
for therapeutic effect. The cells and/or tissue can be derived from
an organism or subject that later receives the explant, or can be
derived from another organism or subject prior to transplantation.
The siNA molecules can be used to modulate the expression of one or
more genes in the cells or tissue, such that the cells or tissue
obtain a desired phenotype or are able to perform a function when
transplanted in vivo. In one embodiment, certain target cells from
a patient are extracted. These extracted cells are contacted with
siNAs targeteing a specific nucleotide sequence within the cells
under conditions suitable for uptake of the siNAs by these cells
(e.g. using delivery reagents such as cationic lipids, liposomes
and the like or using techniques such as electroporation to
facilitate the delivery of siNAs into cells). The cells are then
reintroduced back into the same patient or other patients.
Non-limiting examples of ex vivo applications include use in
organ/tissue transplant, tissue grafting, or treatment of pulmonary
disease (e.g., restenosis) or prevent neointimal hyperplasia and
atherosclerosis in vein grafts. Such ex vivo applications may also
used to treat conditions associated with coronary and peripheral
bypass graft failure, for example, such methods can be used in
conjunction with peripheral vascular bypass graft surgery and
coronary artery bypass graft surgery. Additional applications
include transplants to treat CNS lesions or injury, including use
in treatment of neurodegenerative conditions such as Alzheimer's
disease, Parkinson's Disease, Epilepsy, Dementia, Huntington's
disease, or amyotrophic lateral sclerosis (ALS).
[0127] In one embodiment, the invention features a method of
modulating the expression of a gene in a tissue explant comprising:
(a) synthesizing a siNA molecule of the invention, which can be
chemically-modified, wherein one of the siNA strands comprises a
sequence complementary to RNA of the gene; and (b) introducing the
siNA molecule into a cell of the tissue explant derived from a
particular organism under conditions suitable to modulate the
expression of the gene in the tissue explant. In another
embodiment, the method further comprises introducing the tissue
explant back into the organism the tissue was derived from or into
another organism under conditions suitable to modulate the
expression of the gene in that organism.
[0128] In one embodiment, the invention features a method of
modulating the expression of a gene in a tissue explant comprising:
(a) synthesizing a siNA molecule of the invention, which can be
chemically-modified, wherein one of the siNA strands comprises a
sequence complementary to RNA of the gene and wherein the sense
strand sequence of the siNA comprises a sequence substantially
similar to the sequence of the target RNA; and (b) introducing the
siNA molecule into a cell of the tissue explant derived from a
particular organism under conditions suitable to modulate the
expression of the gene in the tissue explant. In another
embodiment, the method further comprises introducing the tissue
explant back into the organism the tissue was derived from or into
another organism under conditions suitable to modulate the
expression of the gene in that organism.
[0129] In another embodiment, the invention features a method of
modulating the expression of more than one gene in a tissue explant
comprising: (a) synthesizing siNA molecules of the invention, which
can be chemically-modified, wherein one of the siNA strands
comprises a sequence complementary to RNA of the genes; and (b)
introducing the siNA molecules into a cell of the tissue explant
derived from a particular organism under conditions suitable to
modulate the expression of the genes in the tissue explant. In
another embodiment, the method further comprises introducing the
tissue explant back into the organism the tissue was derived from
or into another organism under conditions suitable to modulate the
expression of the genes in that organism.
[0130] In one embodiment, the invention features a method of
modulating the expression of a gene in an organism comprising: (a)
synthesizing a siNA molecule of the invention, which can be
chemically-modified, wherein one of the siNA strands comprises a
sequence complementary to RNA of the gene; and (b) introducing the
siNA molecule into the organism under conditions suitable to
modulate the expression of the gene in the organism.
[0131] In another embodiment, the invention features a method of
modulating the expression of more than one gene in an organism
comprising: (a) synthesizing siNA molecules of the invention, which
can be chemically-modified, wherein one of the siNA strands
comprises a sequence complementary to RNA of the genes; and (b)
introducing the siNA molecules into the organism under conditions
suitable to modulate the expression of the genes in the
organism.
[0132] In one embodiment, the invention features a method for
modulating the expression of a gene within a cell comprising: (a)
synthesizing a siNA molecule of the invention, which can be
chemically-modified, wherein the siNA comprises a single stranded
sequence having complementarity to RNA of the gene; and (b)
introducing the siNA molecule into a cell under conditions suitable
to modulate the expression of the gene in the cell.
[0133] In another embodiment, the invention features a method for
modulating the expression of more than one gene within a cell
comprising: (a) synthesizing siNA molecules of the invention, which
can be chemically-modified, wherein the siNA comprises a single
stranded sequence having complementarity to RNA of the gene; and
(b) contacting the siNA molecule with a cell in vitro or in vivo
under conditions suitable to modulate the expression of the genes
in the cell.
[0134] In one embodiment, the invention features a method of
modulating the expression of a gene in a tissue explant comprising:
(a) synthesizing a siNA molecule of the invention, which can be
chemically-modified, wherein the siNA comprises a single stranded
sequence having complementarity to RNA of the gene; and (b)
contacting the siNA molecule with a cell of the tissue explant
derived from a particular organism under conditions suitable to
modulate the expression of the gene in the tissue explant. In
another embodiment, the method further comprises introducing the
tissue explant back into the organism the tissue was derived from
or into another organism under conditions suitable to modulate the
expression of the gene in that organism.
[0135] In another embodiment, the invention features a method of
modulating the expression of more than one gene in a tissue explant
comprising: (a) synthesizing siNA molecules of the invention, which
can be chemically-modified, wherein the siNA comprises a single
stranded sequence having complementarity to RNA of the gene; and
(b) introducing the siNA molecules into a cell of the tissue
explant derived from a particular organism under conditions
suitable to modulate the expression of the genes in the tissue
explant. In another embodiment, the method further comprises
introducing the tissue explant back into the organism the tissue
was derived from or into another organism under conditions suitable
to modulate the expression of the genes in that organism.
[0136] In one embodiment, the invention features a method of
modulating the expression of a gene in an organism comprising: (a)
synthesizing a siNA molecule of the invention, which can be
chemically-modified, wherein the siNA comprises a single stranded
sequence having complementarity to RNA of the gene; and (b)
introducing the siNA molecule into the organism under conditions
suitable to modulate the expression of the gene in the
organism.
[0137] In another embodiment, the invention features a method of
modulating the expression of more than one gene in an organism
comprising: (a) synthesizing siNA molecules of the invention, which
can be chemically-modified, wherein the siNA comprises a single
stranded sequence having complementarity to RNA of the gene; and
(b) introducing the siNA molecules into the organism under
conditions suitable to modulate the expression of the genes in the
organism.
[0138] In one embodiment, the invention features a method of
modulating the expression of a gene in an organism comprising
contacting the organism with a siNA molecule of the invention under
conditions suitable to modulate the expression of the gene in the
organism.
[0139] In another embodiment, the invention features a method of
modulating the expression of more than one gene in an organism
comprising contacting the organism with one or more siNA molecules
of the invention under conditions suitable to modulate the
expression of the genes in the organism.
[0140] The siNA molecules of the invention can be designed to
inhibit target gene expression through RNAi targeting of a variety
of RNA molecules. In one embodiment, the siNA molecules of the
invention are used to target various RNAs corresponding to a target
gene. Non-limiting examples of such RNAs include messenger RNA
(mRNA), alternate RNA splice variants of target gene(s),
post-transcriptionally modified RNA of target gene(s), pre-mRNA of
target gene(s), and/or RNA templates. If alternate splicing
produces a family of transcripts that are distinguished by usage of
appropriate exons, the instant invention can be used to inhibit
gene expression through the appropriate exons to specifically
inhibit or to distinguish among the functions of gene family
members. For example, a protein that contains an alternatively
spliced transmembrane domain can be expressed in both membrane
bound and secreted forms. Use of the invention to target the exon
containing the transmembrane domain can be used to determine the
functional consequences of pharmaceutical targeting of membrane
bound as opposed to the secreted form of the protein. Non-limiting
examples of applications of the invention relating to targeting
these RNA molecules include therapeutic pharmaceutical
applications, pharmaceutical discovery applications, molecular
diagnostic and gene function applications, and gene mapping, for
example using single nucleotide polymorphism mapping with siNA
molecules of the invention. Such applications can be implemented
using known gene sequences or from partial sequences available from
an expressed sequence tag (EST).
[0141] In another embodiment, the siNA molecules of the invention
are used to target conserved sequences corresponding to a gene
family or gene families. As such, siNA molecules targeting multiple
gene targets can provide increased therapeutic effect. In addition,
siNA can be used to characterize pathways of gene function in a
variety of applications. For example, the present invention can be
used to inhibit the activity of target gene(s) in a pathway to
determine the function of uncharacterized gene(s) in gene function
analysis, mRNA function analysis, or translational analysis. The
invention can be used to determine potential target gene pathways
involved in various diseases and conditions toward pharmaceutical
development. The invention can be used to understand pathways of
gene expression involved in, for example, in development, such as
prenatal development and postnatal development, and/or the
progression and/or maintenance of cancer, infectious disease,
autoimmunity, inflammation, endocrine disorders, renal disease,
pulmonary disease, cardiovascular disease, birth defects, ageing,
any other disease or condition related to gene expression.
[0142] In one embodiment, siNA molecule(s) and/or methods of the
invention are used to down-regulate the expression of gene(s) that
encode RNA referred to by Genbank Accession, for example genes
encoding RNA sequence(s) referred to herein by Genbank Accession
number.
[0143] In one embodiment, the invention features a method
comprising: (a) generating a library of siNA constructs having a
predetermined complexity; and (b) assaying the siNA constructs of
(a) above, under conditions suitable to determine RNAi target sites
within the target RNA sequence. In one embodiment, the siNA
molecules of (a) have strands of a fixed length, for example, about
23 nucleotides in length. In another embodiment, the siNA molecules
of (a) are of differing length, for example having strands of about
19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25)
nucleotides in length. In one embodiment, the assay can comprise a
reconstituted in vitro siNA assay as described herein. In another
embodiment, the assay can comprise a cell culture system in which
target RNA is expressed. In another embodiment, fragments of target
RNA are analyzed for detectable levels of cleavage, for example by
gel electrophoresis, northern blot analysis, or RNAse protection
assays, to determine the most suitable target site(s) within the
target RNA sequence. The target RNA sequence can be obtained as is
known in the art, for example, by cloning and/or transcription for
in vitro systems, and by cellular expression in in vivo
systems.
[0144] In one embodiment, the invention features a method
comprising: (a) generating a randomized library of siNA constructs
having a predetermined complexity, such as of 4.sup.N, where N
represents the number of base paired nucleotides in each of the
siNA construct strands (eg. for a siNA construct having 21
nucleotide sense and antisense strands with 19 base pairs, the
complexity would be 4.sup.19); and (b) assaying the siNA constructs
of (a) above, under conditions suitable to determine RNAi target
sites within the target RNA sequence. In another embodiment, the
siNA molecules of (a) have strands of a fixed length, for example
about 23 nucleotides in length. In yet another embodiment, the siNA
molecules of (a) are of differing length, for example having
strands of about 19 to about 25 (e.g., about 19, 20, 21, 22, 23,
24, or 25) nucleotides in length. In one embodiment, the assay can
comprise a reconstituted in vitro siNA assay as described in
Example 7 herein. In another embodiment, the assay can comprise a
cell culture system in which target RNA is expressed. In another
embodiment, fragments of target RNA are analyzed for detectable
levels of cleavage, for example by gel electrophoresis, northern
blot analysis, or RNAse protection assays, to determine the most
suitable target site(s) within the target RNA sequence. In another
embodiment, the target RNA sequence can be obtained as is known in
the art, for example, by cloning and/or transcription for in vitro
systems, and by cellular expression in in vivo systems.
[0145] In another embodiment, the invention features a method
comprising: (a) analyzing the sequence of a RNA target encoded by a
target gene; (b) synthesizing one or more sets of siNA molecules
having sequence complementary to one or more regions of the RNA of
(a); and (c) assaying the siNA molecules of (b) under conditions
suitable to determine RNAi targets within the target RNA sequence.
In one embodiment, the siNA molecules of (b) have strands of a
fixed length, for example about 23 nucleotides in length. In
another embodiment, the siNA molecules of (b) are of differing
length, for example having strands of about 19 to about 25 (e.g.,
about 19, 20, 21, 22, 23, 24, or 25) nucleotides in length. In one
embodiment, the assay can comprise a reconstituted in vitro siNA
assay as described herein. In another embodiment, the assay can
comprise a cell culture system in which target RNA is expressed.
Fragments of target RNA are analyzed for detectable levels of
cleavage, for example by gel electrophoresis, northern blot
analysis, or RNAse protection assays, to determine the most
suitable target site(s) within the target RNA sequence. The target
RNA sequence can be obtained as is known in the art, for example,
by cloning and/or transcription for in vitro systems, and by
expression in in vivo systems.
[0146] By "target site" is meant a sequence within a target RNA
that is "targeted" for cleavage mediated by a siNA construct which
contains sequences within its antisense region that are
complementary to the target sequence.
[0147] By "detectable level of cleavage" is meant cleavage of
target. RNA (and formation of cleaved product RNAs) to an extent
sufficient to discern cleavage products above the background of
RNAs produced by random degradation of the target RNA. Production
of cleavage products from 1-5% of the target RNA is sufficient to
detect above the background for most methods of detection.
[0148] In one embodiment, the invention features a composition
comprising a siNA molecule of the invention, which can be
chemically-modified, in a pharmaceutically acceptable carrier or
diluent. In another embodiment, the invention features a
pharmaceutical composition comprising siNA molecules of the
invention, which can be chemically-modified, targeting one or more
genes in a pharmaceutically acceptable carrier or diluent. In
another embodiment, the invention features a method for diagnosing
a disease or condition in a subject comprising administering to the
subject a composition of the invention under conditions suitable
for the diagnosis of the disease or condition in the subject. In
another embodiment, the invention features a method for treating or
preventing a disease or condition in a subject, comprising
administering to the subject a composition of the invention under
conditions suitable for the treatment or prevention of the disease
or condition in the subject, alone or in conjunction with one or
more other therapeutic compounds. In yet another embodiment, the
invention features a method for reducing or preventing tissue
rejection in a subject comprising administering to the subject a
composition of the invention under conditions suitable for the
reduction or prevention of tissue rejection in the subject.
[0149] In another embodiment, the invention features a method for
validating a gene target, comprising: (a) synthesizing a siNA
molecule of the invention, which can be chemically-modified,
wherein one of the siNA strands includes a sequence complementary
to RNA of a target gene; (b) introducing the siNA molecule into a
cell, tissue, or organism under conditions suitable for modulating
expression of the target gene in the cell, tissue, or organism; and
(c) determining the function of the gene by assaying for any
phenotypic change in the cell, tissue, or organism.
[0150] In another embodiment, the invention features a method for
validating a target gene comprising: (a) synthesizing a siNA
molecule of the invention, which can be chemically-modified,
wherein one of the siNA strands includes a sequence complementary
to RNA of a target gene; (b) introducing the siNA molecule into a
biological system under conditions suitable for modulating
expression of the target gene in the biological system; and (c)
determining the function of the gene by assaying for any phenotypic
change in the biological system.
[0151] By "biological system" is meant, material, in a purified or
unpurified form, from biological sources, including but not limited
to human, animal, plant, insect, bacterial, viral or other sources,
wherein the system comprises the components required for RNAi
acitivity. The term "biological system" includes, for example, a
cell, tissue, or organism, or extract thereof. The term biological
system also includes reconstituted RNAi systems that can be used in
an in vitro setting.
[0152] By "phenotypic change" is meant any detectable change to a
cell that occurs in response to contact or treatment with a nucleic
acid molecule of the invention (e.g., siNA). Such detectable
changes include, but are not limited to, changes in shape, size,
proliferation, motility, protein expression or RNA expression or
other physical or chemical changes as can be assayed by methods
known in the art. The detectable change can also include expression
of reporter genes/molecules such as Green Florescent Protein (GFP)
or various tags that are used to identify an expressed protein or
any other cellular component that can be assayed.
[0153] In one embodiment, the invention features a kit containing a
siNA molecule of the invention, which can be chemically-modified,
that can be used to modulate the expression of a target gene in a
cell, tissue, or organism. In another embodiment, the invention
features a kit containing more than one siNA molecule of the
invention, which can be chemically-modified, that can be used to
modulate the expression of more than one target gene in a cell,
tissue, or organism.
[0154] In one embodiment, the invention features a kit containing a
siNA molecule of the invention, which can be chemically-modified,
that can be used to modulate the expression of a target gene in a
biological system. In another embodiment, the invention features a
kit containing more than one siNA molecule of the invention, which
can be chemically-modified, that can be used to modulate the
expression of more than one target gene in a biological system.
[0155] In one embodiment, the invention features a cell containing
one or more siNA molecules of the invention, which can be
chemically-modified. In another embodiment, the cell containing a
siNA molecule of the invention is a mammalian cell. In yet another
embodiment, the cell containing a siNA molecule of the invention is
a human cell.
[0156] In one embodiment, the synthesis of a siNA molecule of the
invention, which can be chemically-modified, comprises: (a)
synthesis of two complementary strands of the siNA molecule; (b)
annealing the two complementary strands together under conditions
suitable to obtain a double-stranded siNA molecule. In another
embodiment, synthesis of the two complementary strands of the siNA
molecule is by solid phase oligonucleotide synthesis. In yet
another embodiment, synthesis of the two complementary strands of
the siNA molecule is by solid phase tandem oligonucleotide
synthesis.
[0157] In one embodiment, the invention features a method for
synthesizing a siNA duplex molecule comprising: (a) synthesizing a
first oligonucleotide sequence strand of the siNA molecule, wherein
the first oligonucleotide sequence strand comprises a cleavable
linker molecule that can be used as a scaffold for the synthesis of
the second oligonucleotide sequence strand of the siNA; (b)
synthesizing the second oligonucleotide sequence strand of siNA on
the scaffold of the first oligonucleotide sequence strand, wherein
the second oligonucleotide sequence strand further comprises a
chemical moiety than can be used to purify the siNA duplex; (c)
cleaving the linker molecule of (a) under conditions suitable for
the two siNA oligonucleotide strands to hybridize and form a stable
duplex; and (d) purifying the siNA duplex utilizing the chemical
moiety of the second oligonucleotide sequence strand. In one
embodiment, cleavage of the linker molecule in (c) above takes
place during deprotection of the oligonucleotide, for example,
under hydrolysis conditions using an alkylamine base such as
methylamine. In one embodiment, the method of synthesis comprises
solid phase synthesis on a solid support such as controlled pore
glass (CPG) or polystyrene, wherein the first sequence of (a) is
synthesized on a cleavable linker, such as a succinyl linker, using
the solid support as a scaffold. The cleavable linker in (a) used
as a scaffold for synthesizing the second strand can comprise
similar reactivity as the solid support derivatized linker, such
that cleavage of the solid support derivatized linker and the
cleavable linker of (a) takes place concomitantly. In another
embodiment, the chemical moiety of (b) that can be used to isolate
the attached oligonucleotide sequence comprises a trityl group, for
example a dimethoxytrityl group, which can be employed in a
trityl-on synthesis strategy as described herein. In yet another
embodiment, the chemical moiety, such as a dimethoxytrityl group,
is removed during purification, for example, using acidic
conditions.
[0158] In a further embodiment, the method for siNA synthesis is a
solution phase synthesis or hybrid phase synthesis wherein both
strands of the siNA duplex are synthesized in tandem using a
cleavable linker attached to the first sequence which acts a
scaffold for synthesis of the second sequence. Cleavage of the
linker under conditions suitable for hybridization of the separate
siNA sequence strands results in formation of the double-stranded
siNA molecule.
[0159] In another embodiment, the invention features a method for
synthesizing a siNA duplex molecule comprising: (a) synthesizing
one oligonucleotide sequence strand of the siNA molecule, wherein
the sequence comprises a cleavable linker molecule that can be used
as a scaffold for the synthesis of another oligonucleotide
sequence; (b) synthesizing a second oligonucleotide sequence having
complementarity to the first sequence strand on the scaffold of
(a), wherein the second sequence comprises the other strand of the
double-stranded siNA molecule and wherein the second sequence
further comprises a chemical moiety than can be used to isolate the
attached oligonucleotide sequence; (c) purifying the product of (b)
utilizing the chemical moiety of the second oligonucleotide
sequence strand under conditions suitable for isolating the
full-length sequence comprising both siNA oligonucleotide strands
connected by the cleavable linker and under conditions suitable for
the two siNA oligonucleotide strands to hybridize and form a stable
duplex. In one embodiment, cleavage of the linker molecule in (c)
above takes place during deprotection of the oligonucleotide, for
example under hydrolysis conditions. In another embodiment,
cleavage of the linker molecule in (c) above takes place after
deprotection of the oligonucleotide. In another embodiment, the
method of synthesis comprises solid phase synthesis on a solid
support such as controlled pore glass (CPG) or polystyrene, wherein
the first sequence of (a) is synthesized on a cleavable linker,
such as a succinyl linker, using the solid support as a scaffold.
The cleavable linker in (a) used as a scaffold for synthesizing the
second strand can comprise similar reactivity or differing
reactivity as the solid support derivatized linker, such that
cleavage of the solid support derivatized linker and the cleavable
linker of (a) takes place either concomitantly or sequentially. In
one embodiment, the chemical moiety of (b) that can be used to
isolate the attached oligonucleotide sequence comprises a trityl
group, for example a dimethoxytrityl group.
[0160] In another embodiment, the invention features a method for
making a double-stranded siNA molecule in a single synthetic
process comprising: (a) synthesizing an oligonucleotide having a
first and a second sequence, wherein the first sequence is
complementary to the second sequence, and the first oligonucleotide
sequence is linked to the second sequence via a cleavable linker,
and wherein a terminal 5'-protecting group, for example, a
5'-O-dimethoxytrityl group (5'-O-DMT) remains on the
oligonucleotide having the second sequence; (b) deprotecting the
oligonucleotide whereby the deprotection results in the cleavage of
the linker joining the two oligonucleotide sequences; and (c)
purifying the product of (b) under conditions suitable for
isolating the double-stranded siNA molecule, for example using a
trityl-on synthesis strategy as described herein.
[0161] In another embodiment, the method of synthesis of siNA
molecules of the invention comprises the teachings of Scaringe et
al., U.S. Pat. Nos. 5,889,136; 6,008,400; and 6,111,086,
incorporated by reference herein in their entirety.
[0162] In one embodiment, the invention features siNA constructs
that mediate RNAi in a cell or reconstituted system, wherein the
siNA construct comprises one or more chemical modifications, for
example, one or more chemical modifications having any of Formulae
I-VII or any combination thereof that increases the nuclease
resistance of the siNA construct.
[0163] In another embodiment, the invention features a method for
generating siNA molecules with increased nuclease resistance
comprising (a) introducing nucleotides having any of Formula I-VII
or any combination thereof into a siNA molecule, and (b) assaying
the siNA molecule of step (a) under conditions suitable for
isolating siNA molecules having increased nuclease resistance.
[0164] In one embodiment, the invention features siNA constructs
that mediate RNAi against a target gene, wherein the siNA construct
comprises one or more chemical modifications described herein that
modulates the binding affinity between the sense and antisense
strands of the siNA construct.
[0165] In another embodiment, the invention features a method for
generating siNA molecules with increased binding affinity between
the sense and antisense strands of the siNA molecule comprising (a)
introducing nucleotides having any of Formula I-VII or any
combination thereof into a siNA molecule, and (b) assaying the siNA
molecule of step (a) under conditions suitable for isolating siNA
molecules having increased binding affinity between the sense and
antisense strands of the siNA molecule.
[0166] In one embodiment, the invention features siNA constructs
that mediate RNAi in a cell or reconstituted system, wherein the
siNA construct comprises one or more chemical modifications
described herein that modulates the binding affinity between the
antisense strand of the siNA construct and a complementary target
RNA sequence within a cell.
[0167] In one embodiment, the invention features siNA constructs
that mediate RNAi in a cell or reconstituted system, wherein the
siNA construct comprises one or more chemical modifications
described herein that modulates the binding affinity between the
antisense strand of the siNA construct and a complementary target
DNA sequence within a cell.
[0168] In another embodiment, the invention features a method for
generating siNA molecules with increased binding affinity between
the antisense strand of the siNA molecule and a complementary
target RNA sequence comprising (a) introducing nucleotides having
any of Formula I-VII or any combination thereof into a siNA
molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules having increased
binding affinity between the antisense strand of the siNA molecule
and a complementary target RNA sequence.
[0169] In another embodiment, the invention features a method for
generating siNA molecules with increased binding affinity between
the antisense strand of the siNA molecule and a complementary
target DNA sequence comprising (a) introducing nucleotides having
any of Formula I-VII or any combination thereof into a siNA
molecule, and (b) assaying the siNA molecule of step (a) under
conditions suitable for isolating siNA molecules having increased
binding affinity between the antisense strand of the siNA molecule
and a complementary target DNA sequence.
[0170] In one embodiment, the invention features siNA constructs
that mediate RNAi in a cell or reconstituted system, wherein the
siNA construct comprises one or more chemical modifications
described herein that modulate the polymerase activity of a
cellular polymerase capable of generating additional endogenous
siNA molecules having sequence homology to the chemically-modified
siNA construct.
[0171] In another embodiment, the invention features a method for
generating siNA molecules capable of mediating increased polymerase
activity of a cellular polymerase capable of generating additional
endogenous siNA molecules having sequence homology to a
chemically-modified siNA molecule comprising (a) introducing
nucleotides having any of Formula I-VII or any combination thereof
into a siNA molecule, and (b) assaying the siNA molecule of step
(a) under conditions suitable for isolating siNA molecules capable
of mediating increased polymerase activity of a cellular polymerase
capable of generating additional endogenous siNA molecules having
sequence homology to the chemically-modified siNA molecule. In one
embodiment, the invention features chemically-modified siNA
constructs that mediate RNAi in a cell or reconstituted system,
wherein the chemical modifications do not significantly effect the
interaction of siNA with a target RNA molecule, DNA molecule and/or
proteins or other factors that are essential for RNAi in a manner
that would decrease the efficacy of RNAi mediated by such siNA
constructs.
[0172] In another embodiment, the invention features a method for
generating siNA molecules with improved RNAi activity comprising
(a) introducing nucleotides having any of Formula I-VII or any
combination thereof into a siNA molecule, and (b) assaying the siNA
molecule of step (a) under conditions suitable for isolating siNA
molecules having improved RNAi activity.
[0173] In yet another embodiment, the invention features a method
for generating siNA molecules with improved RNAi activity against a
target RNA comprising (a) introducing nucleotides having any of
Formula I-VII or any combination thereof into a siNA molecule, and
(b) assaying the siNA molecule of step (a) under conditions
suitable for isolating siNA molecules having improved RNAi activity
against the target RNA.
[0174] In yet another embodiment, the invention features a method
for generating siNA molecules with improved RNAi activity against a
DNA target comprising (a) introducing nucleotides having any of
Formula I-VII or any combination thereof into a siNA molecule, and
(b) assaying the siNA molecule of step (a) under conditions
suitable for isolating siNA molecules having improved RNAi activity
against the DNA target, such as a gene, chromosome, or portion
thereof.
[0175] In one embodiment, the invention features siNA constructs
that mediate RNAi in a cell or reconstituted system, wherein the
siNA construct comprises one or more chemical modifications
described herein that modulates the cellular uptake of the siNA
construct.
[0176] In another embodiment, the invention features a method for
generating siNA molecules against a target gene with improved
cellular uptake comprising (a) introducing nucleotides having any
of Formula I-VII or any combination thereof into a siNA molecule,
and (b) assaying the siNA molecule of step (a) under conditions
suitable for isolating siNA molecules having improved cellular
uptake.
[0177] In one embodiment, the invention features siNA constructs
that mediate RNAi against a target gene, wherein the siNA construct
comprises one or more chemical modifications described herein that
increases the bioavailability of the siNA construct, for example,
by attaching polymeric conjugates such as polyethyleneglycol or
equivalent conjugates that improve the pharmacokinetics of the siNA
construct, or by attaching conjugates that target specific tissue
types or cell types in vivo. Non-limiting examples of such
conjugates are described in Vargeese et al., U.S. Ser. No.
10/201,394 incorporated by reference herein.
[0178] In one embodiment, the invention features a method for
generating siNA molecules of the invention with improved
bioavailability, comprising (a) introducing a conjugate into the
structure of a siNA molecule, and (b) assaying the siNA molecule of
step (a) under conditions suitable for isolating siNA molecules
having improved bioavailability. Such conjugates can include
ligands for cellular receptors, such as peptides derived from
naturally occurring protein ligands; protein localization
sequences, including cellular ZIP code sequences; antibodies;
nucleic acid aptamers; vitamins and other co-factors, such as
folate and N-acetylgalactosamine; polymers, such as
polyethyleneglycol (PEG); phospholipids; cholesterol; polyamines,
such as spermine or spermidine; and others.
[0179] In another embodiment, the invention features a method for
generating siNA molecules of the invention with improved
bioavailability comprising (a) introducing an excipient formulation
to a siNA molecule, and (b) assaying the siNA molecule of step (a)
under conditions suitable for isolating siNA molecules having
improved bioavailability. Such excipients include polymers such as
cyclodextrins, lipids, cationic lipids, polyamines, phospholipids,
and others.
[0180] In another embodiment, the invention features a method for
generating siNA molecules of the invention with improved
bioavailability comprising (a) introducing nucleotides having any
of Formulae I-VII or any combination thereof into a siNA molecule,
and (b) assaying the siNA molecule of step (a) under conditions
suitable for isolating siNA molecules having improved
bioavailability.
[0181] In another embodiment, polyethylene glycol (PEG) can be
covalently attached to siNA compounds of the present invention. The
attached PEG can be any molecular weight, preferably from about
2,000 to about 50,000 daltons (Da).
[0182] The present invention can be used alone or as a component of
a kit having at least one of the reagents necessary to carry out
the in vitro or in vivo introduction of RNA to test samples and/or
subjects. For example, preferred components of the kit include a
siNA molecule of the invention and a vehicle that promotes
introduction of the siNA into cells of interest as described herein
(e.g., using lipids and other methods of transfection known in the
art, see for example Beigelman et al, U.S. Pat. No. 6,395,713). The
kit can be used for target validation, such as in determining gene
function and/or activity, or in drug optimization, and in drug
discovery (see for example Usman et al., U.S. Ser. No. 60/402,996).
Such a kit can also include instructions to allow a user of the kit
to practice the invention.
[0183] The term "short interfering nucleic acid", "siNA", "short
interfering RNA", "siRNA", "short interfering nucleic acid
molecule", "short interfering oligonucleotide molecule", or
"chemically-modified short interfering nucleic acid molecule" as
used herein refers to any nucleic acid molecule capable of
inhibiting or down regulating gene expression or viral replication,
for example by mediating RNA interference "RNAi" or gene silencing
in a sequence-specific manner; see for example Bass, 2001, Nature,
411, 428-429; Elbashir et al., 2001, Nature, 411, 494-498; and
Kreutzer et al., International PCT Publication No. WO 00/44895;
Zernicka-Goetz et al., International PCT Publication No. WO
01/36646; Fire, International PCT Publication No. WO 99/32619;
Plaetinck et al., International PCT Publication No. WO 00/01846;
Mello and Fire, International PCT Publication No. WO 01/29058;
Deschamps-Depaillette, International PCT Publication No. WO
99/07409; and Li et al., International PCT Publication No. WO
00/44914; Allshire, 2002, Science, 297, 1818-1819; Volpe et al.,
2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297,
2215-2218; and Hall et al., 2002, Science, 297, 2232-2237;
Hutvagner and Zamore, 2002, Science, 297, 2056-60; McManus et al.,
2002, RNA, 8, 842-850; Reinhart et al., 2002, Gene & Dev., 16,
1616-1626; and Reinhart & Bartel, 2002, Science, 297, 1831).
Non limiting examples of siNA molecules of the invention are shown
in FIGS. 18-20, and Table I herein. For example the siNA can be a
double-stranded polynucleotide molecule comprising
self-complementary sense and antisense regions, wherein the
antisense region comprises nucleotide sequence that is
complementary to nucleotide sequence in a target nucleic acid
molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. The siNA can be assembled from two
separate oligonucleotides, where one strand is the sense strand and
the other is the antisense strand, wherein the antisense and sense
strands are self-complementary (i.e. each strand comprises
nucleotide sequence that is complementary to nucleotide sequence in
the other strand; such as where the antisense strand and sense
strand form a duplex or double stranded structure, for example
wherein the double stranded region is about 19 base pairs); the
antisense strand comprises nucleotide sequence that is
complementary to nucleotide sequence in a target nucleic acid
molecule or a portion thereof and the sense strand comprises
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. Alternatively, the siNA is assembled
from a single oligonucleotide, where the self-complementary sense
and antisense regions of the siNA are linked by means of a nucleic
acid based or non-nucleic acid-based linker(s). The siNA can be a
polynucleotide with a duplex, asymmetric duplex, hairpin or
asymmetric hairpin secondary structure, having self-complementary
sense and antisense regions, wherein the antisense region comprises
nucleotide sequence that is complementary to nucleotide sequence in
a separate target nucleic acid molecule or a portion thereof and
the sense region having nucleotide sequence corresponding to the
target nucleic acid sequence or a portion thereof. The siNA can be
a circular single-stranded polynucleotide having two or more loop
structures and a stem comprising self-complementary sense and
antisense regions, wherein the antisense region comprises
nucleotide sequence that is complementary to nucleotide sequence in
a target nucleic acid molecule or a portion thereof and the sense
region having nucleotide sequence corresponding to the target
nucleic acid sequence or a portion thereof, and wherein the
circular polynucleotide can be processed either in vivo or in vitro
to generate an active siNA molecule capable of mediating RNAi. The
siNA can also comprise a single stranded polynucleotide having
nucleotide sequence complementary to nucleotide sequence in a
target nucleic acid molecule or a portion thereof (for example,
where such siNA molecule does not require the presence within the
siNA molecule of nucleotide sequence corresponding to the target
nucleic acid sequence or a portion thereof), wherein the single
stranded polynucleotide can further comprise a terminal phosphate
group, such as a 5'-phosphate (see for example Martinez et al.,
2002, Cell., 110, 563-574 and Schwarz et al., 2002, Molecular Cell,
10, 537-568), or 5',3'-diphosphate. In certain embodiments, the
siNA molecule of the invention comprises separate sense and
antisense sequences or regions, wherein the sense and antisense
regions are covalently linked by nucleotide or non-nucleotide
linkers molecules as is known in the art, or are alternately
non-covalently linked by ionic interactions, hydrogen bonding, van
der waals interactions, hydrophobic intercations, and/or stacking
interactions. In certain embodiments, the siNA molecules of the
invention comprise nucleotide sequence that is complementary to
nucleotide sequence of a target gene. In another embodiment, the
siNA molecule of the invention interacts with nucleotide sequence
of a target gene in a manner that causes inhibition of expression
of the target gene. As used herein, siNA molecules need not be
limited to those molecules containing only RNA, but further
encompasses chemically-modified nucleotides and non-nucleotides. In
certain embodiments, the short interfering nucleic acid molecules
of the invention lack 2'-hydroxy (2'-OH) containing nucleotides.
Applicant describes in certain embodiments short interfering
nucleic acids that do not require the presence of nucleotides
having a 2'-hydroxy group for mediating RNAi and as such, short
interfering nucleic acid molecules of the invention optionally do
not include any ribonucleotides (e.g., nucleotides having a 2'-OH
group). Such siNA molecules that do not require the presence of
ribonucleotides within the siNA molecule to support RNAi can
however have an attached linker or linkers or other attached or
associated groups, moieties, or chains containing one or more
nucleotides with 2'-OH groups. Optionally, siNA molecules can
comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the
nucleotide positions. The modified short interfering nucleic acid
molecules of the invention can also be referred to as short
interfering modified oligonucleotides "siMON." As used herein, the
term siNA is meant to be equivalent to other terms used to describe
nucleic acid molecules that are capable of mediating sequence
specific RNAi, for example short interfering RNA (siRNA),
double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA
(shRNA), short interfering oligonucleotide, short interfering
nucleic acid, short interfering modified oligonucleotide,
chemically-modified siRNA, post-transcriptional gene silencing RNA
(ptgsRNA), and others. In addition, as used herein, the term RNAi
is meant to be equivalent to other terms used to describe sequence
specific RNA interference, such as post transcriptional gene
silencing, translational inhibition, or epigenetics. For example,
siNA molecules of the invention can be used to epigenetically
silence genes at both the post-transcriptional level or the
pre-transcriptional level. In a non-limiting example, epigenetic
regulation of gene expression by siNA molecules of the invention
can result from siNA mediated modification of chromatin structure
to alter gene expression (see, for example, Allshire, 2002,
Science, 297, 1818-1819; Volpe et al., 2002, Science, 297,
1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et
al., 2002, Science, 297, 2232-2237).
[0184] By "asymmetric hairpin" as used herein is meant a linear
siNA molecule comprising an antisense region, a loop portion that
can comprise nucleotides or non-nucleotides, and a sense region
that comprises fewer nucleotides than the antisense region to the
extent that the sense region has enough complimentary nucleotides
to base pair with the antisense region and form a duplex with loop.
For example, an asymmetric hairpin siNA molecule of the invention
can comprise an antisense region having length sufficient to
mediate RNAi in a cell or in vitro system (e.g. about 19 to about
22 nucleotides) and a loop region comprising about 4 to about 8
nucleotides, and a sense region having about 3 to about 18
nucleotides that are complementary to the antisense region (see for
example FIG. 74). The asymmetric hairpin siNA molecule can also
comprise a 5'-terminal phosphate group that can be chemically
modified (for example as shown in FIG. 75). The loop portion of the
asymmetric hairpin siNA molecule can comprise nucleotides,
non-nucleotides, linker molecules, or conjugate molecules as
described herein.
[0185] By "asymmetric duplex" as used herein is meant a siNA
molecule having two separate strands comprising a sense region and
an antisense region, wherein the sense region comprises fewer
nucleotides than the antisense region to the extent that the sense
region has enough complimentary nucleotides to base pair with the
antisense region and form a duplex. For example, an asymmetric
duplex siNA molecule of the invention can comprise an antisense
region having length sufficient to mediate RNAi in a cell or in
vitro system (e.g. about 19 to about 22 nucleotides) and a sense
region having about 3 to about 18 nucleotides that are
complementary to the antisense region (see for example FIG.
74).
[0186] By "modulate" is meant that the expression of the gene, or
level of RNA molecule or equivalent RNA molecules encoding one or
more proteins or protein subunits, or activity of one or more
proteins or protein subunits is up regulated or down regulated,
such that expression, level, or activity is greater than or less
than that observed in the absence of the modulator. For example,
the term "modulate" can mean "inhibit," but the use of the word
"modulate" is not limited to this definition.
[0187] By "inhibit", "down-regulate", or "reduce", it is meant that
the expression of the gene, or level of RNA molecules or equivalent
RNA molecules encoding one or more proteins or protein subunits, or
activity of one or more proteins or protein subunits, is reduced
below that observed in the absence of the nucleic acid molecules
(e.g., siNA) of the invention. In one embodiment, inhibition,
down-regulation or reduction with an siNA molecule is below that
level observed in the presence of an inactive or attenuated
molecule. In another embodiment, inhibition, down-regulation, or
reduction with siNA molecules is below that level observed in the
presence of, for example, an siNA molecule with scrambled sequence
or with mismatches. In another embodiment, inhibition,
down-regulation, or reduction of gene expression with a nucleic
acid molecule of the instant invention is greater in the presence
of the nucleic acid molecule than in its absence.
[0188] By "gene" or "target gene" is meant, a nucleic acid that
encodes an RNA, for example, nucleic acid sequences including, but
not limited to, structural genes encoding a polypeptide. The target
gene can be a gene derived from a cell, an endogenous gene, a
transgene, or exogenous genes such as genes of a pathogen, for
example a virus, which is present in the cell after infection
thereof. The cell containing the target gene can be derived from or
contained in any organism, for example a plant, animal, protozoan,
virus, bacterium, or fungus. Non-limiting examples of plants
include monocots, dicots, or gymnosperms. Non-limiting examples of
animals include vertebrates or invertebrates. Non-limiting examples
of fungi include molds or yeasts.
[0189] By "highly conserved sequence region" is meant, a nucleotide
sequence of one or more regions in a target gene does not vary
significantly from one generation to the other or from one
biological system to the other.
[0190] By "cancer" is meant a group of diseases characterized by
uncontrolled growth and spread of abnormal cells.
[0191] By "sense region" is meant a nucleotide sequence of a siNA
molecule having complementarity to an antisense region of the siNA
molecule. In addition, the sense region of a siNA molecule can
comprise a nucleic acid sequence having homology with a target
nucleic acid sequence.
[0192] By "antisense region" is meant a nucleotide sequence of a
siNA molecule having complementarity to a target nucleic acid
sequence. In addition, the antisense region of a siNA molecule can
optionally comprise a nucleic acid sequence having complementarity
to a sense region of the siNA molecule.
[0193] By "target nucleic acid" is meant any nucleic acid sequence
whose expression or activity is to be modulated. The target nucleic
acid can be DNA or RNA, such as endogenous DNA or RNA, viral DNA or
viral RNA, or other RNA encoded by a gene, virus, bacteria, fungus,
mammal, or plant.
[0194] By "complementarity" is meant that a nucleic acid can form
hydrogen bond(s) with another nucleic acid sequence by either
traditional Watson-Crick or other non-traditional types. In
reference to the nucleic molecules of the present invention, the
binding free energy for a nucleic acid molecule with its
complementary sequence is sufficient to allow the relevant function
of the nucleic acid to proceed, e.g., RNAi activity. Determination
of binding free energies for nucleic acid molecules is well known
in the art (see, e.g., Turner et al., 1987, CSH Symp. Quant. Biol.
LII pp. 123-133; Frier et al., 1986, Proc. Nat. Acad. Sci. USA
83:9373-9377; Turner et al., 1987, J. Am. Chem. Soc.
109:3783-3785). A percent complementarity indicates the percentage
of contiguous residues in a nucleic acid molecule that can form
hydrogen bonds (e.g., Watson-Crick base pairing) with a second
nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%,
60%, 70%, 80%, 90%, and 100% complementary). "Perfectly
complementary" means that all the contiguous residues of a nucleic
acid sequence will hydrogen bond with the same number of contiguous
residues in a second nucleic acid sequence.
[0195] The siNA molecules of the invention represent a novel
therapeutic approach to a broad spectrum of diseases and
conditions, including cancer or cancerous disease, infectious
disease, cardiovascular disease, neurological disease, prion
disease, inflammatory disease, autoimmune disease, pulmonary
disease, renal disease, liver disease, mitochondrial disease,
endocrine disease, reproduction related diseases and conditions,
and any other indications that can respond to the level of an
expressed gene product in a cell or organsim.
[0196] In one embodiment of the present invention, each sequence of
a siNA molecule of the invention is independently about 18 to about
24 nucleotides in length, in specific embodiments about 18, 19, 20,
21, 22, 23, or 24 nucleotides in length. In another embodiment, the
siNA duplexes of the invention independently comprise about 17 to
about 23 base pairs (e.g., about 17, 18, 19, 20, 21, 22 or 23). In
yet another embodiment, siNA molecules of the invention comprising
hairpin or circular structures are about 35 to about 55 (e.g.,
about 35, 40, 45, 50 or 55) nucleotides in length, or about 38 to
about 44 (e.g., 38, 39, 40, 41, 42, 43 or 44) nucleotides in length
and comprising about 16 to about 22 (e.g., about 16, 17, 18, 19,
20, 21 or 22) base pairs. Exemplary siNA molecules of the invention
are shown in Table I. and/or FIGS. 18-19.
[0197] As used herein "cell" is used in its usual biological sense,
and does not refer to an entire multicellular organism, e.g.,
specifically does not refer to a human. The cell can be present in
an organism, e.g., birds, plants and mammals such as humans, cows,
sheep, apes, monkeys, swine, dogs, and cats. The cell can be
prokaryotic (e.g., bacterial cell) or eukaryotic (e.g., mammalian
or plant cell). The cell can be of somatic or germ line origin,
totipotent or pluripotent, dividing or non-dividing. The cell can
also be derived from or can comprise a gamete or embryo, a stem
cell, or a fully differentiated cell.
[0198] The siNA molecules of the invention are added directly, or
can be complexed with cationic lipids, packaged within liposomes,
or otherwise delivered to target cells or tissues. The nucleic acid
or nucleic acid complexes can be locally administered to relevant
tissues ex vivo, or in vivo through injection, infusion pump or
stent, with or without their incorporation in biopolymers. In
particular embodiments, the nucleic acid molecules of the invention
comprise sequences shown in Table I and/or FIGS. 18-19. Examples of
such nucleic acid molecules consist essentially of sequences
defined in these tables and figures. Furthermore, the chemically
modified constructs described in Table IV can be applied to any
siNA sequence of the invention.
[0199] In another aspect, the invention provides mammalian cells
containing one or more siNA molecules of this invention. The one or
more siNA molecules can independently be targeted to the same or
different sites.
[0200] By "RNA" is meant a molecule comprising at least one
ribonucleotide residue. By "ribonucleotide" is meant a nucleotide
with a hydroxyl group at the 2' position of a
.beta.-D-ribo-furanose moiety. The terms include double-stranded
RNA, single-stranded RNA, isolated RNA such as partially purified
RNA, essentially pure RNA, synthetic RNA, recombinantly produced
RNA, as well as altered RNA that differs from naturally occurring
RNA by the addition, deletion, substitution and/or alteration of
one or more nucleotides. Such alterations can include addition of
non-nucleotide material, such as to the end(s) of the siNA or
internally, for example at one or more nucleotides of the RNA.
Nucleotides in the RNA molecules of the instant invention can also
comprise non-standard nucleotides, such as non-naturally occurring
nucleotides or chemically synthesized nucleotides or
deoxynucleotides. These altered RNAs can be referred to as analogs
or analogs of naturally-occurring RNA.
[0201] By "subject" is meant an organism, which is a donor or
recipient of explanted cells or the cells themselves. "Subject"
also refers to an organism to which the nucleic acid molecules of
the invention can be administered. A subject can be a mammal or
mammalian cells, including a human or human cells.
[0202] The term "phosphorothioate" as used herein refers to an
internucleotide linkage having Formula I, wherein Z and/or W
comprise a sulfur atom. Hence, the term phosphorothioate refers to
both phosphorothioate and phosphorodithioate internucleotide
linkages.
[0203] The term "universal base" as used herein refers to
nucleotide base analogs that form base pairs with each of the
natural DNA/RNA bases with little discrimination between them.
Non-limiting examples of universal bases include C-phenyl,
C-naphthyl and other aromatic derivatives, inosine, azole
carboxamides, and nitroazole derivatives such as 3-nitropyrrole,
4-nitroindole, 5-nitroindole, and 6-nitroindole as known in the art
(see for example Loakes, 2001, Nucleic Acids Research, 29,
2437-2447).
[0204] The term "acyclic nucleotide" as used herein refers to any
nucleotide having an acyclic ribose sugar, for example where any of
the ribose carbons (C1, C2, C3, C4, or C5), are independently or in
combination absent from the nucleotide.
[0205] The nucleic acid molecules of the instant invention,
individually, or in combination or in conjunction with other drugs,
can be used to treat diseases or conditions discussed herein (e.g.,
cancers and othe proliferative conditions, viral infection,
inflammatory disease, autoimmunity, pulmonary disease, renal
disease, ocular disease, etc.). For example, to treat a particular
disease or condition, the siNA molecules can be administered to a
subject or can be administered to other appropriate cells evident
to those skilled in the art, individually or in combination with
one or more drugs under conditions suitable for the treatment.
[0206] In a further embodiment, the siNA molecules can be used in
combination with other known treatments to treat conditions or
diseases discussed above. For example, the described molecules
could be used in combination with one or more known therapeutic
agents to treat a disease or condition. Non-limiting examples of
other therapeutic agents that can be readily combined with a siNA
molecule of the invention are enzymatic nucleic acid molecules,
allosteric nucleic acid molecules, antisense, decoy, or aptamer
nucleic acid molecules, antibodies such as monoclonal antibodies,
small molecules, and other organic and/or inorganic compounds
including metals, salts and ions.
[0207] Other features and advantages of the invention will be
apparent from the following description of the preferred
embodiments thereof, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0208] FIG. 1 shows a non-limiting example of a scheme for the
synthesis of siNA molecules. The complementary siNA sequence
strands, strand 1 and strand 2, are synthesized in tandem and are
connected by a cleavable linkage, such as a nucleotide succinate or
abasic succinate, which can be the same or different from the
cleavable linker used for solid phase synthesis on a solid support.
The synthesis can be either solid phase or solution phase, in the
example shown, the synthesis is a solid phase synthesis. The
synthesis is performed such that a protecting group, such as a
dimethoxytrityl group, remains intact on the terminal nucleotide of
the tandem oligonucleotide. Upon cleavage and deprotection of the
oligonucleotide, the two siNA strands spontaneously hybridize to
form a siNA duplex, which allows the purification of the duplex by
utilizing the properties of the terminal protecting group, for
example by applying a trityl on purification method wherein only
duplexes/oligonucleotides with the terminal protecting group are
isolated.
[0209] FIG. 2 shows a MALDI-TOF mass spectrum of a purified siNA
duplex synthesized by a method of the invention. The two peaks
shown correspond to the predicted mass of the separate siNA
sequence strands. This result demonstrates that the siNA duplex
generated from tandem synthesis can be purified as a single entity
using a simple trityl-on purification methodology.
[0210] FIG. 3 shows the results of a stability assay used to
determine the serum stability of chemically modified siNA
constructs compared to a siNA control consisting of all RNA with
3'-TT termini. T 1/2 values are shown for duplex stability.
[0211] FIG. 4 shows the results of an RNAi activity screen of
several phosphorothioate modified siNA constructs using a
luciferase reporter system.
[0212] FIG. 5 shows the results of an RNAi activity screen of
several phosphorothioate and universal base modified siNA
constructs using a luciferase reporter system.
[0213] FIG. 6 shows the results of an RNAi activity screen of
several 2'-O-methyl modified siNA constructs using a luciferase
reporter system.
[0214] FIG. 7 shows the results of an RNAi activity screen of
several 2'-O-methyl and 2'-deoxy-2'-fluoro modified siNA constructs
using a luciferase reporter system.
[0215] FIG. 8 shows the results of an RNAi activity screen of a
phosphorothioate modified siNA construct using a luciferase
reporter system.
[0216] FIG. 9 shows the results of an RNAi activity screen of an
inverted deoxyabasic modified siNA construct generated via tandem
synthesis using a luciferase reporter system.
[0217] FIG. 10 shows the results of an RNAi activity screen of
chemically modifed siNA constructs including 3'-glyceryl modified
siNA constructs compared to an all RNA control siNA construct using
a luciferase reporter system. These chemically modified siNAs were
compared in the luciferase assay described herein at 1 nM and 10 nM
concentration using an all RNA siNA control (siGL2) having
3'-terminal dithymidine (TT) and its corresponding inverted control
(Inv siGL2). The background level of luciferase expression in the
HeLa cells is designated by the "cells" column. Sense and antisense
strands of chemically modified siNA constructs are shown by
Sirna/RPI number (sense strand/antisense strand). Sequences
corresponding to these Sirna/RPI numbers are shown in Table I.
[0218] FIG. 11 shows the results of an RNAi activity screen of
chemically modifed siNA constructs. The screen compared various
combinations of sense strand chemical modifications and antisense
strand chemical modifications. These chemically modified siNAs were
compared in the luciferase assay described herein at 1 nM and 10 nM
concentration using an all RNA siNA control (siGL2) having
3'-terminal dithymidine (TT) and its corresponding inverted control
(Inv siGL2). The background level of luciferase expression in the
HeLa cells is designated by the "cells" column. Sense and antisense
strands of chemically modified siNA constructs are shown by
Sirna/RPI number (sense strand/antisense strand). Sequences
corresponding to these Sirna/RPI numbers are shown in Table I.
[0219] FIG. 12 shows the results of an RNAi activity screen of
chemically modifed siNA constructs. The screen compared various
combinations of sense strand chemical modifications and antisense
strand chemical modifications. These chemically modified siNAs were
compared in the luciferase assay described herein at 1 nM and 10 nM
concentration using an all RNA siNA control (siGL2) having
3'-terminal dithymidine (TT) and its corresponding inverted control
(Inv siGL2). The background level of luciferase expression in the
HeLa cells is designated by the "cells" column. Sense and antisense
strands of chemically modified siNA constructs are shown by
Sirna/RPI number (sense strand/antisense strand). Sequences
corresponding to these Sirna/RPI numbers are shown in Table I. In
addition, the antisense strand alone (Sirna/RPI 30430) and an
inverted control (Sirna/RPI 30227/30229, having matched chemistry
to Sirna/RPI (30063/30224) was compared to the siNA duplexes
described above.
[0220] FIG. 13 shows the results of an RNAi activity screen of
chemically modifed siNA constructs. The screen compared various
combinations of sense strand chemical modifications and antisense
strand chemical modifications. These chemically modified siNAs were
compared in the luciferase assay described herein at 1 nM and 10 nM
concentration using an all RNA siNA control (siGL2) having
3'-terminal dithymidine (TT) and its corresponding inverted control
(Inv siGL2). The background level of luciferase expression in the
HeLa cells is designated by the "cells" column. Sense and antisense
strands of chemically modified siNA constructs are shown by
Sirna/RPI number (sense strand/antisense strand). Sequences
corresponding to these Sirna/RPI numbers are shown in Table I. In
addition, an inverted control (Sirna/RPI 30226/30229), having
matched chemistry to Sirna/RPI (30222/30224) was compared to the
siNA duplexes described above.
[0221] FIG. 14 shows the results of an RNAi activity screen of
chemically modifed siNA constructs including various 3'-terminal
modified siNA constructs compared to an all RNA control siNA
construct using a luciferase reporter system. These chemically
modified siNAs were compared in the luciferase assay described
herein at 1 nM and 10 nM concentration using an all RNA siNA
control (siGL2) having 3'-terminal dithymidine (TT) and its
corresponding inverted control (Inv siGL2). The background level of
luciferase expression in the HeLa cells is designated by the
"cells" column. Sense and antisense strands of chemically modified
siNA constructs are shown by Sirna/RPI number (sense
strand/antisense strand). Sequences corresponding to these
Sirna/RPI numbers are shown in Table I.
[0222] FIG. 15 shows the results of an RNAi activity screen of
chemically modifed siNA constructs. The screen compared various
combinations of sense strand chemistries compared to a fixed
antisense strand chemistry. These chemically modified siNAs were
compared in the luciferase assay described herein at 1 nM and 10 nM
concentration using an all RNA siNA control (siGL2) having
3'-terminal dithymidine (TT) and its corresponding inverted control
(Inv siGL2). The background level of luciferase expression in the
HeLa cells is designated by the "cells" column. Sense and antisense
strands of chemically modified siNA constructs are shown by
Sirna/RPI number (sense strand/antisense strand). Sequences
corresponding to these Sirna/RPI numbers are shown in Table I.
[0223] FIG. 16 shows the results of a siNA titration study using a
luciferase reporter system, wherein the RNAi activity of a
phosphorothioate modified siNA construct is compared to that of a
siNA construct consisting of all ribonucleotides except for two
terminal thymidine residues.
[0224] FIG. 17 shows a non-limiting proposed mechanistic
representation of target RNA degradation involved in RNAi.
Double-stranded RNA (dsRNA), which is generated by RNA-dependent
RNA polymerase (RdRP) from foreign single-stranded RNA, for example
viral, transposon, or other exogenous RNA, activates the DICER
enzyme that in turn generates siNA duplexes. Alternately, synthetic
or expressed siNA can be introduced directely into a cell by
appropriate means. An active siNA complex forms which recognizes a
target RNA, resulting in degradation of the target RNA by the RISC
endonuclease complex or in the synthesis of additional RNA by
RNA-dependent RNA polymerase (RdRP), which can activate DICER and
result in additional siNA molecules, thereby amplifying the RNAi
response.
[0225] FIG. 18A-F shows non-limiting examples of
chemically-modified siNA constructs of the present invention. In
the figure, N stands for any nucleotide (adenosine, guanosine,
cytosine, uridine, or optionally thymidine, for example thymidine
can be substituted in the overhanging regions designated by
parenthesis (N N). Various modifications are shown for the sense
and antisense strands of the siNA constructs.
[0226] FIG. 18A: The sense strand comprises 21 nucleotides wherein
the two terminal 3'-nucleotides are optionally base paired and
wherein all nucleotides present are ribonucleotides except for (N
N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. The antisense strand comprises 21 nucleotides,
optionally having a 3'-terminal glyceryl moiety and wherein the two
terminal 3'-nucleotides are optionally complementary to the target
RNA sequence, and wherein all nucleotides present are
ribonucleotides except for (N N) nucleotides, which can comprise
ribonucleotides, deoxynucleotides, universal bases, or other
chemical modifications described herein. A modified internucleotide
linkage, such as a phosphorothioate, phosphorodithioate or other
modified internucleotide linkage as described herein, shown as "s"
connects the (N N) nucleotides in the antisense strand.
[0227] FIG. 18B: The sense strand comprises 21 nucleotides wherein
the two terminal 3'-nucleotides are optionally base paired and
wherein all pyrimidine nucleotides that may be present are
2'-deoxy-2'-fluoro modified nucleotides and all purine nucleotides
that may be present are 2'-O-methyl modified nucleotides except for
(N N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. The antisense strand comprises 21 nucleotides,
optionally having a 3'-terminal glyceryl moiety and wherein the two
terminal 3'-nucleotides are optionally complementary to the target
RNA sequence, and wherein all pyrimidine nucleotides that may be
present are 2'-deoxy-2'-fluoro modified nucleotides and all purine
nucleotides that may be present are 2'-O-methyl modified
nucleotides except for (N N) nucleotides, which can comprise
ribonucleotides, deoxynucleotides, universal bases, or other
chemical modifications described herein. A modified internucleotide
linkage, such as a phosphorothioate, phosphorodithioate or other
modified internucleotide linkage as described herein, shown as "s"
connects the (N N) nucleotides in the sense and antisense
strand.
[0228] FIG. 18C: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-O-methyl or
2'-deoxy-2'-fluoro modified nucleotides except for (N N)
nucleotides, which can comprise ribonucleotides, deoxynucleotides,
universal bases, or other chemical modifications described herein.
The antisense strand comprises 21 nucleotides, optionally having a
3'-terminal glyceryl moiety and wherein the two terminal
3'-nucleotides are optionally complementary to the target RNA
sequence, and wherein all pyrimidine nucleotides that may be
present are 2'-deoxy-2'-fluoro modified nucleotides except for (N
N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. A modified internucleotide linkage, such as a
phosphorothioate, phosphorodithioate or other modified
internucleotide linkage as described herein, shown as "s" connects
the (N N) nucleotides in the antisense strand.
[0229] FIG. 18D: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides except for (N N) nucleotides, which can
comprise ribonucleotides, deoxynucleotides, universal bases, or
other chemical modifications described herein and wherein and all
purine nucleotides that may be present are 2'-deoxy nucleotides.
The antisense strand comprises 21 nucleotides, optionally having a
3'-terminal glyceryl moiety and wherein the two terminal
3'-nucleotides are optionally complementary to the target RNA
sequence, and wherein all pyrimidine nucleotides that may be
present are 2'-deoxy-2'-fluoro modified nucleotides and all purine
nucleotides that may be present are 2'-O-methyl modified
nucleotides except for (N N) nucleotides, which can comprise
ribonucleotides, deoxynucleotides, universal bases, or other
chemical modifications described herein. A modified internucleotide
linkage, such as a phosphorothioate, phosphorodithioate or other
modified internucleotide linkage as described herein, shown as "s"
connects the (N N) nucleotides in the antisense strand.
[0230] FIG. 18E: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides except for (N N) nucleotides, which can
comprise ribonucleotides, deoxynucleotides, universal bases, or
other chemical modifications described herein. The antisense strand
comprises 21 nucleotides, optionally having a 3'-terminal glyceryl
moiety and wherein the two terminal 3'-nucleotides are optionally
complementary to the target RNA sequence, and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides and all purine nucleotides that may be present
are 2'-O-methyl modified nucleotides except for (N N) nucleotides,
which can comprise ribonucleotides, deoxynucleotides, universal
bases, or other chemical modifications described herein. A modified
internucleotide linkage, such as a phosphorothioate,
phosphorodithioate or other modified internucleotide linkage as
described herein, shown as "s" connects the (N N) nucleotides in
the antisense strand.
[0231] FIG. 18F: The sense strand comprises 21 nucleotides having
5'- and 3'-terminal cap moieties wherein the two terminal
3'-nucleotides are optionally base paired and wherein all
pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro
modified nucleotides except for (N N) nucleotides, which can
comprise ribonucleotides, deoxynucleotides, universal bases, or
other chemical modifications described herein and wherein and all
purine nucleotides that may be present are 2'-deoxy nucleotides.
The antisense strand comprises 21 nucleotides, optionally having a
3'-terminal glyceryl moiety and wherein the two terminal
3'-nucleotides are optionally complementary to the target RNA
sequence, and wherein all pyrimidine nucleotides that may be
present are 2'-deoxy-2'-fluoro modified nucleotides and all purine
nucleotides that may be present are 2'-deoxy nucleotides except for
(N N) nucleotides, which can comprise ribonucleotides,
deoxynucleotides, universal bases, or other chemical modifications
described herein. A modified internucleotide linkage, such as a
phosphorothioate, phosphorodithioate or other modified
internucleotide linkage as described herein, shown as "s" connects
the (N N) nucleotides in the antisense strand. The antisense strand
of constructs A-F comprise sequence complementary to any target
nucleic acid sequence of the invention. Furthermore, when a
glyceryl moiety (L) is present at the 3'-end of the antisense
strand for any construct shown in FIG. 4 A-F, the modified
internucleotide linkage is optional.
[0232] FIG. 19 shows non-limiting examples of specific chemically
modified siNA sequences of the invention. A-F applies the chemical
modifications described in FIG. 18A-F to a representative siNA
sequence targeting the hepatitis C virus (HCV).
[0233] FIG. 20 shows non-limiting examples of different siNA
constructs of the invention. The examples shown (constructs 1, 2,
and 3) have 19 representative base pairs, however, different
embodiments of the invention include any number of base pairs
described herein. Bracketed regions represent nucleotide overhangs,
for example comprising about 1, 2, 3, or 4 nucleotides in length,
preferably about 2 nucleotides. Constructs 1 and 2 can be used
independently for RNAi activity. Construct 2 can comprise a
polynucleotide or non-nucleotide linker, which can optionally be
designed as a biodegradable linker. In one embodiment, the loop
structure shown in construct 2 can comprise a biodegradable linker
that results in the formation of construct 1 in vivo and/or in
vitro. In another example, construct 3 can be used to generate
construct 2 under the same principle wherein a linker is used to
generate the active siNA construct 2 in vivo and/or in vitro, which
can optionally utilize another biodegradable linker to generate the
active siNA construct 1 in vivo and/or in vitro. As such, the
stability and/or activity of the siNA constructs can be modulated
based on the design of the siNA construct for use in vivo or in
vitro and/or in vitro.
[0234] FIG. 21 is a diagrammatic representation of a method used to
determine target sites for siNA mediated RNAi within a particular
target nucleic acid sequence, such as messenger RNA. (A) A pool of
siNA oligonucleotides are synthesized wherein the antisense region
of the siNA constructs has complementarity to target sites across
the target nucleic acid sequence, and wherein the sense region
comprises sequence complementary to the antisense region of the
siNA. (B) The sequences are transfected into cells. (C) Cells are
selected based on phenotypic change that is associated with
modulation of the target nucleic acid sequence. (D) The siNA is
isolated from the selected cells and is sequenced to identify
efficacious target sites within the target nucleic acid
sequence.
[0235] FIG. 22 shows non-limiting examples of different
stabilization chemistries (1-10) that can be used, for example, to
stabilize the 3'-end of siNA sequences of the invention, including
(1) [3-3']-inverted deoxyribose; (2) deoxyribonucleotide; (3)
[5'-3']-3'-deoxyribonucleotide; (4) [5'-3']-ribonucleotide; (5)
[5'-3']-3'-O-methyl ribonucleotide; (6) 3'-glyceryl; (7)
[3'-5']-3'-deoxyribonucleotide; (8) [3'-3']-deoxyribonucleotide;
(9) [5'-2']-deoxyribonucleotide; and (10)
[5-3']-dideoxyribonucleotide. In addition to modified and
unmodified backbone chemistries indicated in the figure, these
chemistries can be combined with different backbone modifications
as described herein, for example, backbone modifications having
Formula I. In addition, the 2'-deoxy nucleotide shown 5' to the
terminal modifications shown can be another modified or unmodified
nucleotide or non-nucleotide described herein, for example
modifications having any of Formulae I-VII or any combination
thereof.
[0236] FIG. 23 shows a non-limiting example of siNA mediated
inhibition of VEGF-induced angiogenesis using the rat corneal model
of angiogenesis. siNA targeting site 2340 of VEGFR1 RNA (shown as
Sirna/RPI No. 29695/29699) were compared to inverted controls
(shown as Sirna/RPI No. 29983/29984) at three different
concentrations and compared to a VEGF control in which no siNA was
administered.
[0237] FIG. 24 is a non-limiting example of a HBsAg screen of
stabilized siNA constructs ("stab 4/5", see Table IV) targeting HBV
pregenomic RNA in HepG2 cells at 25 nM compared to untreated and
matched chemistry inverted sequence controls. The siNA sense and
antisense strands are shown by Sirna/RPI number
(sense/antisense).
[0238] FIG. 25 is a non-limiting example of a dose response HBsAg
screen of stabilized siNA constructs ("stab 4/5", see Table IV)
targeting sites 262 and 1580 of the HBV pregenomic RNA in HepG2
cells at 0.5, 5, 10 and 25 nM compared to untreated and matched
chemistry inverted sequence controls. The siNA sense and antisense
strands are shown by Sirna/RPI number (sense/antisense).
[0239] FIG. 26 shows a dose response comparison of two different
stabilization chemistries ("stab 7/8" and "stab 7/11", see Table
IV) targeting site 1580 of the HBV pregenomic RNA in HepG2 cells at
5, 10, 25, 50 and 100 nM compared to untreated and matched
chemistry inverted sequence controls. The siNA sense and antisense
strands are shown by Sirna/RPI number (sense/antisense).
[0240] FIG. 27 shows a non-limiting example of a strategy used to
identify chemically modified siNA constructs of the invention that
are nuclease resistance while preserving the ability to mediate
RNAi activity. Chemical modifications are introduced into the siNA
construct based on educated design parameters (e.g. introducing
2'-modifications, base modifications, backbone modifications,
terminal cap modifications etc). The modified construct in tested
in an appropriate system (e.g human serum for nuclease resistance,
shown, or an animal model for PK/delivery parameters). In parallel,
the siNA construct is tested for RNAi activity, for example in a
cell culture system such as a luciferase reporter assay). Lead siNA
constructs are then identified which possess a particular
characteristic while maintaining RNAi activity, and can be further
modified and assayed once again. This same approach can be used to
identify siNA-conjugate molecules with improved pharmacokinetic
profiles, delivery, and RNAi activity.
[0241] FIG. 28 shows representative data of a chemically modified
siNA construct (Stab 4/5, Table IV) targeting HBV site 1580 RNA
compared to an unstabilized siRNA construct in a dose response time
course HBsAg assay. The constructs were compared at different
concentrations (5 nM, 10 nM, 25 nM, 50 nM, and 100 nM) over the
course of nine days. Activity based on HBsAg levels was determined
at day 3, day 6, and day 9.
[0242] FIG. 29 shows representative data of a chemically modified
siNA construct (Stab 7/8, Table IV) targeting HBV site 1580 RNA
compared to an unstabilized siRNA construct in a dose response time
course HBsAg assay. The constructs were compared at different
concentrations (5 nM, 10 nM, 25 nM, 50 nM, and 100 nM) over the
course of nine days. SiNA activity based on HBsAg levels was
determined at day 3, day 6, and day 9.
[0243] FIG. 30 shows representative data of a chemically modified
siNA construct (Stab 7/11, Table IV) targeting HBV site 1580 RNA
compared to an unstabilized siRNA construct in a dose response time
course HBsAg assay. The constructs were compared at different
concentrations (5 nM, 10 nM, 25 nM, 50 nM, and 100 nM) over the
course of nine days. SiNA activity based on HBsAg levels was
determined at day 3, day 6, and day 9.
[0244] FIG. 31 shows representative data of a chemically modified
siNA construct (Stab 9/10, Table IV) targeting HBV site 1580 RNA
compared to an unstabilized siRNA construct in a dose response time
course HBsAg assay. The constructs were compared at different
concentrations (5 nM, 10 nM, 25 nM, 50 nM, and 100 nM) over the
course of nine days. SiNA activity based on HBsAg levels was
determined at day 3, day 6, and day 9.
[0245] FIG. 32 shows non-limiting examples of inhibition of viral
replication of a HCV/poliovirus chimera by siNA constructs targeted
to HCV chimera (29579/29586; 29578/29585) compared to control
(29593/29600).
[0246] FIG. 33 shows a non-limiting example of a dose response
study demonstrating the inhibition of viral replication of a
HCV/poliovirus chimera by siNA construct (29579/29586) at various
concentrations (1 nM, 5 nM, 10 nM, and 25 nM) compared to control
(29593/29600).
[0247] FIG. 34 shows a non-limiting example demonstrating the
inhibition of viral replication of a HCV/poliovirus chimera by a
chemically modified siRNA construct (30051/30053) compared to
control construct (30052/30054).
[0248] FIG. 35 shows a non-limiting example demonstrating the
inhibition of viral replication of a HCV/poliovirus chimera by a
chemically modified siRNA construct (30055/30057) compared to
control construct (30056/30058).
[0249] FIG. 36 shows a non-limiting example of several chemically
modified siRNA constructs targeting viral replication of an
HCV/poliovirus chimera at 10 nM treatment in comparison to a lipid
control and an inverse siNA control construct 29593/29600.
[0250] FIG. 37 shows a non-limiting example of several chemically
modified siRNA constructs targeting viral replication of a
HCV/poliovirus chimera at 25 nM treatment in comparison to a lipid
control and an inverse siNA control construct 29593/29600.
[0251] FIG. 38 shows a non-limiting example of several chemically
modified siRNA constructs targeting viral replication of a Huh7 HCV
replicon system at 25 nM treatment in comparison to untreated cells
("cells"), cells transfected with lipofectamine ("LFA2K") and
inverse siNA control constructs.
[0252] FIG. 39 shows a non-limiting example of a dose response
study using chemically modified siNA molecules (Stab 4/5, see Table
IV) targeting HCV RNA sites 291, 300, and 303 in a Huh7 HCV
replicon system at 5, 10, 25, and 100 nM treatment comparison to
untreated cells ("cells"), cells transfected with lipofectamine
("LFA") and inverse siNA control constructs.
[0253] FIG. 40 shows a non-limiting example of several chemically
modified siNA constructs (Stab 7/8, see Table IV) targeting viral
replication in a Huh7 HCV replicon system at 25 nM treatment in
comparison to untreated cells ("cells"), cells transfected with
lipofectamine ("Lipid") and inverse siNA control constructs.
[0254] FIG. 41 shows a non-limiting example of a dose response
study using chemically modified siNA molecules (Stab 7/8, see Table
IV) targeting HCV site 327 in a Huh7 HCV replicon system at 5, 10,
25, 50, and 100 nM treatment in comparison to inverse siNA control
constructs.
[0255] FIG. 42 shows a synthetic scheme for post-synthetic
modification of a nucleic acid molecule to produce a folate
conjugate.
[0256] FIG. 43 shows a synthetic scheme for generating an
oligonucleotide or nucleic acid-folate conjugate.
[0257] FIG. 44 shows an alternative synthetic scheme for generating
an oligonucleotide or nucleic acid-folate conjugate.
[0258] FIG. 45 shows an alternative synthetic scheme for
post-synthetic modification of a nucleic acid molecule to produce a
folate conjugate.
[0259] FIG. 46 shows a non-limiting example of a synthetic scheme
for the synthesis of a N-acetyl-D-galactosamine-2'-aminouridine
phosphoramidite conjugate of the invention.
[0260] FIG. 47 shows a non-limiting example of a synthetic scheme
for the synthesis of a N-acetyl-D-galactosamine-D-threoninol
phosphoramidite conjugate of the invention.
[0261] FIG. 48 shows a non-limiting example of a
N-acetyl-D-galactosamine siNA nucleic acid conjugate of the
invention. W shown in the example refers to a biodegradable linker,
for example a nucleic acid dimer, trimer, or tetramer comprising
ribonucleotides and/or deoxyribonucleotides. The siNA can be
conjugated at the 3', 5' or both 3' and 5' ends of the sense strand
of a double stranded siNA and/or the 3'-end of the antisense strand
of the siNA. A single stranded siNA molecule can be conjugated at
the 3'-end of the siNA.
[0262] FIG. 49 shows a non-limiting example of a synthetic scheme
for the synthesis of a dodecanoic acid derived conjugate linker of
the invention.
[0263] FIG. 50 shows a non-limiting example of a synthetic scheme
for the synthesis of an oxime linked nucleic acid/peptide conjugate
of the invention.
[0264] FIG. 51 shows non-limiting examples of phospholipid derived
siNA conjugates of the invention. CL shown in the examples refers
to a biodegradable linker, for example a nucleic acid dimer,
trimer, or tetramer comprising ribonucleotides and/or
deoxyribonucleotides. The siNA can be conjugated at the 3', 5' or
both 3' and 5' ends of the sense strand of a double stranded siNA
and/or the 3'-end of the antisense strand of the siNA. A single
stranded siNA molecule can be conjugated at the 3'-end of the
siNA.
[0265] FIG. 52 shows a non-limiting example of a synthetic scheme
for preparing a phospholipid derived siNA conjugates of the
invention.
[0266] FIG. 53 shows a non-limiting example of a synthetic scheme
for preparing a poly-N-acetyl-D-galactosamine nucleic acid
conjugate of the invention.
[0267] FIG. 54 shows a non-limiting example of the synthesis of
siNA cholesterol conjugates of the invention using a
phosphoramidite approach.
[0268] FIG. 55 shows a non-limiting example of the synthesis of
siNA PEG conjugates of the invention using NHS ester coupling.
[0269] FIG. 56 shows a non-limiting example of the synthesis of
siNA cholesterol conjugates of the invention using NHS ester
coupling.
[0270] FIG. 57 shows a non-limiting example of various siNA
cholesterol conjugates of the invention.
[0271] FIG. 58 shows a non-limiting example of various siNA
cholesterol conjugates of the invention in which various linker
chemistries and/or cleavable linkers can be utilized at different
positions of a double stranded siNA molecule.
[0272] FIG. 59 shows a non-limiting example of various siNA
cholesterol conjugates of the invention in which various linker
chemistries and/or cleavable linkers can be utilized at different
positions of a double stranded siNA molecule.
[0273] FIG. 60 shows a non-limiting example of various siNA
cholesterol conjugates of the invention in which various linker
chemistries and/or cleavable linkers can be utilized at different
positions of a single stranded siNA molecule.
[0274] FIG. 61 shows a non-limiting example of various siNA
phospholipid conjugates of the invention in which various linker
chemistries and/or cleavable linkers can be utilized at different
positions of a double stranded siNA molecule.
[0275] FIG. 62 shows a non-limiting example of various siNA
phospholipid conjugates of the invention in which various linker
chemistries and/or cleavable linkers can be utilized at different
positions of a single stranded siNA molecule.
[0276] FIG. 63 shows a non-limiting example of various siNA
galactosamine conjugates of the invention in which various linker
chemistries and/or cleavable linkers can be utilized at different
positions of a double stranded siNA molecule.
[0277] FIG. 64 shows a non-limiting example of various siNA
galactosamine conjugates of the invention in which various linker
chemistries and/or cleavable linkers can be utilized at different
positions of a single stranded siNA molecule.
[0278] FIG. 65 shows a non-limiting example of various generalized
siNA conjugates of the invention in which various linker
chemistries and/or cleavable linkers can be utilized at different
positions of a double stranded siNA molecule. CONJ in the figure
refers to any biologically active compound or any other conjugate
compound as described herein and in the Formulae herein.
[0279] FIG. 66 shows a non-limiting example of various generalized
siNA conjugates of the invention in which various linker
chemistries and/or cleavable linkers can be utilized at different
positions of a single stranded siNA molecule. CONJ in the figure
refers to any biologically active compound or any other conjugate
compound as described herein and in the Formulae herein.
[0280] FIG. 67 shows a non-limiting example of the pharmacokinetic
distribution of intact siNA in liver after administration of
conjugated or unconjugated siNA molecules in mice.
[0281] FIG. 68 shows a non-limiting example of the activity of
conjugated siNA constructs compared to matched chemistry
unconjugated siNA constructs in an HBV cell culture system without
the use of transfection lipid. As shown in the Figure, siNA
conjugates provide efficacy in cell culture without the need for
transfection reagent.
[0282] FIG. 69 shows a non-limiting example of a scheme for the
synthesis of a mono-galactosamine phosphoramidite of the invention
that can be used to generate galactosamine conjugated nucleic acid
molecules.
[0283] FIG. 70 shows a non-limiting example of a scheme for the
synthesis of a tri-galactosamine phosphoramidite of the invention
that can be used to generate tri-galactosamine conjugated nucleic
acid molecules.
[0284] FIG. 71 shows a non-limiting example of a scheme for the
synthesis of another tri-galactosamine phosphoramidite of the
invention that can be used to generate tri-galactosamine conjugated
nucleic acid molecules.
[0285] FIG. 72 shows a non-limiting example of an alternate scheme
for the synthesis of a tri-galactosamine phosphoramidite of the
invention that can be used to generate tri-galactosamine conjugated
nucleic acid molecules.
[0286] FIG. 73 shows a non-limiting example of a scheme for the
synthesis of a cholesterol NHS ester of the invention that can be
used to generate cholesterol conjugated nucleic acid molecules.
[0287] FIG. 74 shows non-limiting exampled of phosphorylated siNA
molecules of the invention, including linear and duplex constructs
and asymmetric derivatives thereof.
[0288] FIG. 75 shows non-limiting examples of a chemically modified
terminal phosphate groups of the invention.
[0289] FIG. 76 shows a non-limiting example of inhibition of VEGF
induced neovascularization in the rat corneal model. VEGFr1 site
349 active siNA having "Stab 9/10" chemistry (Sirna # 31270/31273)
was tested for inhibition of VEGF-induced angiogenesis at three
different concentrations (2.0 ug, 1.0 ug, and 0.1 ug dose response)
as compared to a matched chemistry inverted control siNA construct
(Sirna # 31276/31279) at each concentration and a VEGF control in
which no siNA was administered. As shown in the figure, the active
siNA construct having "Stab 9/10" chemistry (Sirna # 31270/31273)
is highly effective in inhibiting VEGF-induced angiogenesis in the
rat corneal model compared to the matched chemistry inverted
control siNA at concentrations from 0.1 ug to 2.0 ug.
[0290] FIG. 77 shows activity of modified siNA constructs having
stab 4/5 (Sirna 30355/30366), stab 7/8 (Sirna 30612/30620), and
stab 7/11 (Sirna 30612/31175) chemistries and an all ribo siNA
construct (Sirna 30287/30298) in the reduction of HBsAg levels
compared to matched inverted controls at A. 3 days, B. 9 days, and
C. 21 days post transfection. Also shown is the corresponding
percent inhibition as function of time at siNA concentrations of D.
100 nM, E. 50 nM, and F. 25 nM
DETAILED DESCRIPTION OF THE INVENTION
Mechanism of Action of Nucleic Acid Molecules of the Invention
[0291] The discussion that follows discusses the proposed mechanism
of RNA interference mediated by short interfering RNA as is
presently known, and is not meant to be limiting and is not an
admission of prior art. Applicant demonstrates herein that
chemically-modified short interfering nucleic acids possess similar
or improved capacity to mediate RNAi as do siRNA molecules and are
expected to possess improved stability and activity in vivo;
therefore, this discussion is not meant to be limited to siRNA only
and can be applied to siNA as a whole. By "improved capacity to
mediate RNAi" or "improved RNAi activity" is meant to include RNAi
activity measured in vitro and/or in vivo where the RNAi activity
is a reflection of both the ability of the siNA to mediate RNAi and
the stability of the siNAs of the invention. In this invention, the
product of these activities can be increased in vitro and/or in
vivo compared to an all RNA siRNA or a siNA containing a plurality
of ribonucleotides. In some cases, the activity or stability of the
siNA molecule can be decreased (i.e., less than ten-fold), but the
overall activity of the siNA molecule is enhanced in vitro and/or
in vivo.
[0292] RNA interference refers to the process of sequence specific
post-transcriptional gene silencing in animals mediated by short
interfering RNAs (siRNAs) (Fire et al., 1998, Nature, 391, 806).
The corresponding process in plants is commonly referred to as
post-transcriptional gene silencing or RNA silencing and is also
referred to as quelling in fungi. The process of
post-transcriptional gene silencing is thought to be an
evolutionarily-conserved cellular defense mechanism used to prevent
the expression of foreign genes which is commonly shared by diverse
flora and phyla (Fire et al., 1999, Trends Genet., 15, 358). Such
protection from foreign gene expression may have evolved in
response to the production of double-stranded RNAs (dsRNAs) derived
from viral infection or the random integration of transposon
elements into a host genome via a cellular response that
specifically destroys homologous single-stranded RNA or viral
genomic RNA. The presence of dsRNA in cells triggers the RNAi
response though a mechanism that has yet to be fully characterized.
This mechanism appears to be different from the interferon response
that results from dsRNA-mediated activation of protein kinase PKR
and 2',5'-oligoadenylate synthetase resulting in non-specific
cleavage of mRNA by ribonuclease L.
[0293] The presence of long dsRNAs in cells stimulates the activity
of a ribonuclease III enzyme referred to as Dicer. Dicer is
involved in the processing of the dsRNA into short pieces of dsRNA
known as short interfering RNAs (siRNAs) (Berstein et al., 2001,
Nature, 409, 363). Short interfering RNAs derived from Dicer
activity are typically about 21 to about 23 nucleotides in length
and comprise about 19 base pair duplexes. Dicer has also been
implicated in the excision of 21- and 22-nucleotide small temporal
RNAs (stRNAs) from precursor RNA of conserved structure that are
implicated in translational control (Hutvagner et al., 2001,
Science, 293, 834). The RNAi response also features an endonuclease
complex containing a siRNA, commonly referred to as an RNA-induced
silencing complex (RISC), which mediates cleavage of
single-stranded RNA having sequence homologous to the siRNA.
Cleavage of the target RNA takes place in the middle of the region
complementary to the guide sequence of the siRNA duplex (Elbashir
et al., 2001, Genes Dev., 15, 188). In addition, RNA interference
can also involve small RNA (e.g., micro-RNA or miRNA) mediated gene
silencing, presumably though cellular mechanisms that regulate
chromatin structure and thereby prevent transcription of target
gene sequences (see for example Allshire, 2002, Science, 297,
1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein,
2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297,
2232-2237). As such, siNA molecules of the invention can be used to
mediate gene silencing via interaction with RNA transcripts or
alternately by interaction with particular gene sequences, wherein
such interaction results in gene silencing either at the
transcriptional level or post-transcriptional level.
[0294] RNAi has been studied in a variety of systems. Fire et al.,
1998, Nature, 391, 806, were the first to observe RNAi in C.
elegans. Wianny and Goetz, 1999, Nature Cell Biol., 2, 70, describe
RNAi mediated by dsRNA in mouse embryos. Hammond et al., 2000,
Nature, 404, 293, describe RNAi in Drosophila cells transfected
with dsRNA. Elbashir et al., 2001, Nature, 411, 494, describe RNAi
induced by introduction of duplexes of synthetic 21-nucleotide RNAs
in cultured mammalian cells including human embryonic kidney and
HeLa cells. Recent work in Drosophila embryonic lysates has
revealed certain requirements for siRNA length, structure, chemical
composition, and sequence that are essential to mediate efficient
RNAi activity. These studies have shown that 21 nucleotide siRNA
duplexes are most active when containing two 2-nucleotide
3'-terminal nucleotide overhangs. Furthermore, substitution of one
or both siRNA strands with 2'-deoxy or 2'-O-methyl nucleotides
abolishes RNAi activity, whereas substitution of 3'-terminal siRNA
nucleotides with deoxy nucleotides was shown to be tolerated.
Mismatch sequences in the center of the siRNA duplex were also
shown to abolish RNAi activity. In addition, these studies also
indicate that the position of the cleavage site in the target RNA
is defined by the 5'-end of the siRNA guide sequence rather than
the 3'-end (Elbashir et al., 2001, EMBO J., 20, 6877). Other
studies have indicated that a 5'-phosphate on the
target-complementary strand of a siRNA duplex is required for siRNA
activity and that ATP is utilized to maintain the 5'-phosphate
moiety on the siRNA (Nykanen et al., 2001, Cell, 107, 309);
however, siRNA molecules lacking a 5'-phosphate are active when
introduced exogenously, suggesting that 5'-phosphorylation of siRNA
constructs may occur in vivo.
Synthesis of Nucleic Acid Molecules
[0295] Synthesis of nucleic acids greater than 100 nucleotides in
length is difficult using automated methods, and the therapeutic
cost of such molecules is prohibitive. In this invention, small
nucleic acid motifs "small" refers to nucleic acid motifs no more
than 100 nucleotides in length, preferably no more than 80
nucleotides in length, and most preferably no more than 50
nucleotides in length; (e.g., individual siNA oligonucleotide
sequences or siNA sequences synthesized in tandem) are preferably
used for exogenous delivery. The simple structure of these
molecules increases the ability of the nucleic acid to invade
targeted regions of protein and/or RNA structure. Exemplary
molecules of the instant invention are chemically synthesized, and
others can similarly be synthesized.
[0296] Oligonucleotides (e.g., certain modified oligonucleotides or
portions of oligonucleotides lacking ribonucleotides) are
synthesized using protocols known in the art, for example as
described in Caruthers et al., 1992, Methods in Enzymology 211,
3-19, Thompson et al., International PCT Publication No. WO
99/54459, Wincott et al., 1995, Nucleic Acids Res. 23, 2677-2684,
Wincott et al., 1997, Methods Mol. Bio., 74, 59, Brennan et al.,
1998, Biotechnol Bioeng., 61, 33-45, and Brennan, U.S. Pat. No.
6,001,311. All of these references are incorporated herein by
reference. The synthesis of oligonucleotides makes use of common
nucleic acid protecting and coupling groups, such as
dimethoxytrityl at the 5'-end, and phosphoramidites at the 3'-end.
In a non-limiting example, small scale syntheses are conducted on a
394 Applied Biosystems, Inc. synthesizer using a 0.2 .mu.mol scale
protocol with a 2.5 minute coupling step for 2'-O-methylated
nucleotides and a 45 second coupling step for 2'-deoxy nucleotides
or 2'-deoxy-2'-fluoro nucleotides. Table II outlines the amounts
and the contact times of the reagents used in the synthesis cycle.
Alternatively, syntheses at the 0.2 .mu.mol scale can be performed
on a 96-well plate synthesizer, such as the instrument produced by
Protogene (Palo Alto, Calif.) with minimal modification to the
cycle. A 33-fold excess (60 .mu.L of 0.11 M=6.6 .mu.mol) of
2'-O-methyl phosphoramidite and a 105-fold excess of S-ethyl
tetrazole (60 .mu.L of 0.25 M=15 .mu.mol) can be used in each
coupling cycle of 2'-O-methyl residues relative to polymer-bound
5'-hydroxyl. A 22-fold excess (40 .mu.L of 0.11 M=4.4 .mu.mol) of
deoxy phosphoramidite and a 70-fold excess of S-ethyl tetrazole (40
.mu.L of 0.25 M=10 .mu.mol) can be used in each coupling cycle of
deoxy residues relative to polymer-bound 5'-hydroxyl. Average
coupling yields on the 394 Applied Biosystems, Inc. synthesizer,
determined by calorimetric quantitation of the trityl fractions,
are typically 97.5-99%. Other oligonucleotide synthesis reagents
for the 394 Applied Biosystems, Inc. synthesizer include the
following: detritylation solution is 3% TCA in methylene chloride
(ABI); capping is performed with 16% N-methyl imidazole in THF
(ABI) and 10% acetic anhydride/10% 2,6-lutidine in THF (ABI); and
oxidation solution is 16.9 mM I.sub.2, 49 mM pyridine, 9% water in
THF (PERSEPTIVE.TM.). Burdick & Jackson Synthesis Grade
acetonitrile is used directly from the reagent bottle.
S-Ethyltetrazole solution (0.25 M in acetonitrile) is made up from
the solid obtained from American International Chemical, Inc.
Alternately, for the introduction of phosphorothioate linkages,
Beaucage reagent (3H-1,2-Benzodithiol-3-one 1,1-dioxide, 0.05 M in
acetonitrile) is used.
[0297] Deprotection of the DNA-based oligonucleotides is performed
as follows: the polymer-bound trityl-on oligoribonucleotide is
transferred to a 4 mL glass screw top vial and suspended in a
solution of 40% aqueous methylamine (1 mL) at 65.degree. C. for 10
minutes. After cooling to -20.degree. C., the supernatant is
removed from the polymer support. The support is washed three times
with 1.0 mL of EtOH:MeCN:H2O/3:1:1, vortexed and the supernatant is
then added to the first supernatant. The combined supernatants,
containing the oligoribonucleotide, are dried to a white
powder.
[0298] The method of synthesis used for RNA including certain siNA
molecules of the invention follows the procedure as described in
Usman et al., 1987, J. Am. Chem. Soc., 109, 7845; Scaringe et al.,
1990, Nucleic Acids Res., 18, 5433; and Wincott et al., 1995,
Nucleic Acids Res. 23, 2677-2684 Wincott et al., 1997, Methods Mol.
Bio., 74, 59, and makes use of common nucleic acid protecting and
coupling groups, such as dimethoxytrityl at the 5'-end, and
phosphoramidites at the 3'-end. In a non-limiting example, small
scale syntheses are conducted on a 394 Applied Biosystems, Inc.
synthesizer using a 0.2 .mu.mol scale protocol with a 7.5 minute
coupling step for alkylsilyl protected nucleotides and a 2.5 minute
coupling step for 2'-O-methylated nucleotides. Table H outlines the
amounts and the contact times of the reagents used in the synthesis
cycle. Alternatively, syntheses at the 0.2 .mu.mol scale can be
done on a 96-well plate synthesizer, such as the instrument
produced by Protogene (Palo Alto, Calif.) with minimal modification
to the cycle. A 33-fold excess (60 .mu.L of 0.11 M=6.6 .mu.mol) of
2'-O-methyl phosphoramidite and a 75-fold excess of S-ethyl
tetrazole (60 .mu.L of 0.25 M=15 .mu.mol) can be used in each
coupling cycle of 2'-O-methyl residues relative to polymer-bound
5'-hydroxyl. A 66-fold excess (120 .mu.L of 0.11 M=13.2 .mu.mol) of
alkylsilyl (ribo) protected phosphoramidite and a 150-fold excess
of S-ethyl tetrazole (120 .mu.L of 0.25 M=30 .mu.mol) can be used
in each coupling cycle of ribo residues relative to polymer-bound
5'-hydroxyl. Average coupling yields on the 394 Applied Biosystems,
Inc. synthesizer, determined by calorimetric quantitation of the
trityl fractions, are typically 97.5-99%. Other oligonucleotide
synthesis reagents for the 394 Applied Biosystems, Inc. synthesizer
include the following: detritylation solution is 3% TCA in
methylene chloride (ABI); capping is performed with 16% N-methyl
imidazole in THF (ABI) and 10% acetic anhydride/10% 2,6-lutidine in
THF (ABI); oxidation solution is 16.9 mM I.sub.2, 49 mM pyridine,
9% water in THF (PERSEPTIVE.TM.). Burdick & Jackson Synthesis
Grade acetonitrile is used directly from the reagent bottle.
S-Ethyltetrazole solution (0.25 M in acetonitrile) is made up from
the solid obtained from American International Chemical, Inc.
Alternately, for the introduction of phosphorothioate linkages,
Beaucage reagent (3H-1,2-Benzodithiol-3-one 1,1-dioxide 0.05 M in
acetonitrile) is used.
[0299] Deprotection of the RNA is performed using either a two-pot
or one-pot protocol. For the two-pot protocol, the polymer-bound
trityl-on oligoribonucleotide is transferred to a 4 mL glass screw
top vial and suspended in a solution of 40% aq. methylamine (1 mL)
at 65.degree. C. for 10 minutes. After cooling to -20.degree. C.,
the supernatant is removed from the polymer support. The support is
washed three times with 1.0 mL of EtOH:MeCN:H2O/3:1:1, vortexed and
the supernatant is then added to the first supernatant. The
combined supernatants, containing the oligoribonucleotide, are
dried to a white powder. The base deprotected oligoribonucleotide
is resuspended in anhydrous TEA/HF/NMP solution (300 .mu.L of a
solution of 1.5 mL N-methylpyrrolidinone, 750 .mu.L TEA and 1 mL
TEA.3HF to provide a 1.4 M HF concentration) and heated to
65.degree. C. After 1.5 hours, the oligomer is quenched with 1.5 M
NH.sub.4HCO.sub.3.
[0300] Alternatively, for the one-pot protocol, the polymer-bound
trityl-on oligoribonucleotide is transferred to a 4 mL glass screw
top vial and suspended in a solution of 33% ethanolic
methylamine/DMSO: 1/1 (0.8 mL) at 65.degree. C. for 15 minutes. The
vial is brought to room temperature. TEA.3HF (0.1 mL) is added and
the vial is heated at 65.degree. C. for 15 minutes. The sample is
cooled at -20.degree. C. and then quenched with 1.5 M
NH.sub.4HCO.sub.3.
[0301] For purification of the trityl-on oligomers, the quenched
NH.sub.4HCO.sub.3 solution is loaded onto a C-18 containing
cartridge that had been prewashed with acetonitrile followed by 50
mM TEAA. After washing the loaded cartridge with water, the RNA is
detritylated with 0.5% TFA for 13 minutes. The cartridge is then
washed again with water, salt exchanged with 1 M NaCl and washed
with water again. The oligonucleotide is then eluted with 30%
acetonitrile.
[0302] The average stepwise coupling yields are typically >98%
(Wincott et al., 1995 Nucleic Acids Res. 23, 2677-2684). Those of
ordinary skill in the art will recognize that the scale of
synthesis can be adapted to be larger or smaller than the example
described above including but not limited to 96-well format.
[0303] Alternatively, the nucleic acid molecules of the present
invention can be synthesized separately and joined together
post-synthetically, for example, by ligation (Moore et al., 1992,
Science 256, 9923; Draper et al., International PCT publication No.
WO 93/23569; Shabarova et al., 1991, Nucleic Acids Research 19,
4247; Bellon et al., 1997, Nucleosides & Nucleotides, 16, 951;
Bellon et al., 1997, Bioconjugate Chem. 8, 204), or by
hybridization following synthesis and/or deprotection.
[0304] The siNA molecules of the invention can also be synthesized
via a tandem synthesis methodology as described in Example 1
herein, wherein both siNA strands are synthesized as a single
contiguous oligonucleotide fragment or strand separated by a
cleavable linker which is subsequently cleaved to provide separate
siNA fragments or strands that hybridize and permit purification of
the siNA duplex. The linker can be a polynucleotide linker or a
non-nucleotide linker. The tandem synthesis of siNA as described
herein can be readily adapted to both multiwell/multiplate
synthesis platforms such as 96 well or similarly larger multi-well
platforms. The tandem synthesis of siNA as described herein can
also be readily adapted to large scale synthesis platforms
employing batch reactors, synthesis columns and the like.
[0305] A siNA molecule can also be assembled from two distinct
nucleic acid strands or fragments wherein one fragment includes the
sense region and the second fragment includes the antisense region
of the RNA molecule.
[0306] The nucleic acid molecules of the present invention can be
modified extensively to enhance stability by modification with
nuclease resistant groups, for example, 2'-amino, 2'-C-allyl,
2'-fluoro, 2'-O-methyl, 2'-H (for a review see Usman and Cedergren,
1992, TIBS 17, 34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31,
163). siNA constructs can be purified by gel electrophoresis using
general methods or can be purified by high pressure liquid
chromatography (HPLC; see Wincott et al., supra, the totality of
which is hereby incorporated herein by reference) and re-suspended
in water.
[0307] In another aspect of the invention, siNA molecules of the
invention are expressed from transcription units inserted into DNA
or RNA vectors. The recombinant vectors can be DNA plasmids or
viral vectors. siNA expressing viral vectors can be constructed
based on, but not limited to, adeno-associated virus, retrovirus,
adenovirus, or alphavirus. The recombinant vectors capable of
expressing the siNA molecules can be delivered as described herein,
and persist in target cells. Alternatively, viral vectors can be
used that provide for transient expression of siNA molecules.
Optimizing Activity of the Nucleic Acid Molecule of the
Invention.
[0308] Chemically synthesizing nucleic acid molecules with
modifications (base, sugar and/or phosphate) can prevent their
degradation by serum ribonucleases, which can increase their
potency (see e.g., Eckstein et al., International Publication No.
WO 92/07065; Perrault et al., 1990 Nature 344, 565; Pieken et al.,
1991, Science 253, 314; Usman and Cedergren, 1992, Trends in
Biochem. Sci. 17, 334; Usman et al., International Publication No.
WO 93/15187; and Rossi et al., International Publication No. WO
91/03162; Sproat, U.S. Pat. No. 5,334,711; Gold et al., U.S. Pat.
No. 6,300,074; and Burgin et al., supra; all of which are
incorporated by reference herein). All of the above references
describe various chemical modifications that can be made to the
base, phosphate and/or sugar moieties of the nucleic acid molecules
described herein. Modifications that enhance their efficacy in
cells, and removal of bases from nucleic acid molecules to shorten
oligonucleotide synthesis times and reduce chemical requirements
are desired.
[0309] There are several examples in the art describing sugar, base
and phosphate modifications that can be introduced into nucleic
acid molecules with significant enhancement in their nuclease
stability and efficacy. For example, oligonucleotides are modified
to enhance stability and/or enhance biological activity by
modification with nuclease resistant groups, for example, 2'-amino,
2'-C-allyl, 2'-fluoro, 2'-O-methyl, 2'-O-allyl, 2'-H, nucleotide
base modifications (for a review see Usman and Cedergren, 1992,
TIBS. 17, 34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31, 163;
Burgin et al., 1996, Biochemistry, 35, 14090). Sugar modification
of nucleic acid molecules have been extensively described in the
art (see Eckstein et al., International Publication PCT No. WO
92/07065; Perrault et al. Nature, 1990, 344, 565-568; Pieken et al.
Science, 1991, 253, 314-317; Usman and Cedergren, Trends in
Biochem. Sci., 1992, 17, 334-339; Usman et al. International
Publication PCT No. WO 93/15187; Sproat, U.S. Pat. No. 5,334,711
and Beigelman et al., 1995, J. Biol. Chem., 270, 25702; Beigelman
et al., International PCT publication No. WO 97/26270; Beigelman et
al., U.S. Pat. No. 5,716,824; Usman et al., U.S. Pat. No.
5,627,053; Woolf et al., International PCT Publication No. WO
98/13526; Thompson et al., U.S. Ser. No. 60/082,404 which was filed
on Apr. 20, 1998; Karpeisky et al., 1998, Tetrahedron Lett., 39,
1131; Earnshaw and Gait, 1998, Biopolymers (Nucleic Acid Sciences),
48, 39-55; Verma and Eckstein, 1998, Annu. Rev. Biochem., 67,
99-134; and Burlina et al., 1997, Bioorg. Med. Chem., 5, 1999-2010;
all of the references are hereby incorporated in their totality by
reference herein). Such publications describe general methods and
strategies to determine the location of incorporation of sugar,
base and/or phosphate modifications and the like into nucleic acid
molecules without modulating catalysis, and are incorporated by
reference herein. In view of such teachings, similar modifications
can be used as described herein to modify the siNA nucleic acid
molecules of the instant invention so long as the ability of siNA
to promote RNAi is cells is not significantly inhibited.
[0310] While chemical modification of oligonucleotide
internucleotide linkages with phosphorothioate, phosphorodithioate,
and/or 5'-methylphosphonate linkages improves stability, excessive
modifications can cause some toxicity or decreased activity.
Therefore, when designing nucleic acid molecules, the amount of
these internucleotide linkages should be minimized. The reduction
in the concentration of these linkages should lower toxicity,
resulting in increased efficacy and higher specificity of these
molecules.
[0311] Short interfering nucleic acid (siNA) molecules having
chemical modifications that maintain or enhance activity are
provided. Such a nucleic acid is also generally more resistant to
nucleases than an unmodified nucleic acid. Accordingly, the in
vitro and/or in vivo activity should not be significantly lowered.
In cases in which modulation is the goal, therapeutic nucleic acid
molecules delivered exogenously should optimally be stable within
cells until translation of the target RNA has been modulated long
enough to reduce the levels of the undesirable protein. This period
of time varies between hours to days depending upon the disease
state. Improvements in the chemical synthesis of RNA and DNA
(Wincott et al., 1995, Nucleic Acids Res. 23, 2677; Caruthers et
al., 1992, Methods in Enzymology 211, 3-19 (incorporated by
reference herein)) have expanded the ability to modify nucleic acid
molecules by introducing nucleotide modifications to enhance their
nuclease stability, as described above.
[0312] In one embodiment, nucleic acid molecules of the invention
include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more) G-clamp nucleotides. A G-clamp nucleotide is a modified
cytosine analog wherein the modifications confer the ability to
hydrogen bond both Watson-Crick and Hoogsteen faces of a
complementary guanine within a duplex, see for example Lin and
Matteucci, 1998, J. Am. Chem. Soc., 120, 8531-8532. A single
G-clamp analog substitution within an oligonucleotide can result in
substantially enhanced helical thermal stability and mismatch
discrimination when hybridized to complementary oligonucleotides.
The inclusion of such nucleotides in nucleic acid molecules of the
invention results in both enhanced affinity and specificity to
nucleic acid targets, complementary sequences, or template strands.
In another embodiment, nucleic acid molecules of the invention
include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or
more) LNA "locked nucleic acid" nucleotides such as a 2',4'-C
methylene bicyclo nucleotide (see for example Wengel et al.,
International PCT Publication No. WO 00/66604 and WO 99/14226).
[0313] In another embodiment, the invention features conjugates
and/or complexes of siNA molecules of the invention. Such
conjugates and/or complexes can be used to facilitate delivery of
siNA molecules into a biological system, such as a cell. The
conjugates and complexes provided by the instant invention can
impart therapeutic activity by transferring therapeutic compounds
across cellular membranes, altering the pharmacokinetics, and/or
modulating the localization of nucleic acid molecules of the
invention. The present invention encompasses the design and
synthesis of novel conjugates and complexes for the delivery of
molecules, including, but not limited to, small molecules, lipids,
cholesterol, phospholipids, nucleosides, nucleotides, nucleic
acids, antibodies, toxins, negatively charged polymers and other
polymers, for example, proteins, peptides, hormones, carbohydrates,
polyethylene glycols, or polyamines, across cellular membranes. In
general, the transporters described are designed to be used either
individually or as part of a multi-component system, with or
without degradable linkers. These compounds are expected to improve
delivery and/or localization of nucleic acid molecules of the
invention into a number of cell types originating from different
tissues, in the presence or absence of serum (see Sullenger and
Cech, U.S. Pat. No. 5,854,038). Conjugates of the molecules
described herein can be attached to biologically active molecules
via linkers that are biodegradable, such as biodegradable nucleic
acid linker molecules.
[0314] In one embodiment, the invention features a compound having
Formula 1: ##STR8##
[0315] wherein each R.sub.1, R.sub.3, R.sub.4, R.sub.5, R.sub.6,
R.sub.7 and R.sub.8 is independently hydrogen, alkyl, substituted
alkyl, aryl, substituted aryl, or a protecting group, each "n" is
independently an integer from 0 to about 200, R.sub.12 is a
straight or branched chain alkyl, substituted alkyl, aryl, or
substituted aryl, and R.sub.2 is a siNA molecule or a portion
thereof.
[0316] In one embodiment, the invention features a compound having
Formula 2: ##STR9##
[0317] wherein each R.sub.3, R.sub.4, R.sub.5, R.sub.6 and R.sub.7
is independently hydrogen, alkyl, substituted alkyl, aryl,
substituted aryl, or a protecting group, each "n" is independently
an integer from 0 to about 200, R.sub.12 is a straight or branched
chain alkyl, substituted alkyl, aryl, or substituted aryl, and
R.sub.2 is a siNA molecule or a portion thereof.
[0318] In one embodiment, the invention features a compound having
Formula 3: ##STR10##
[0319] wherein each R.sub.1, R.sub.3, R.sub.4, R.sub.5 R.sub.6 and
R.sub.7 is independently hydrogen, alkyl substituted alkyl, aryl,
substituted aryl, or a protecting group, each "n" is independently
an integer from 0 to about 200, R.sub.12 is a straight or branched
chain alkyl, substituted alkyl, aryl, or substituted aryl, and
R.sub.2 is a siNA molecule or a portion thereof.
[0320] In one embodiment, the invention features a compound having
Formula 4: ##STR11##
[0321] wherein each R.sub.3, R.sub.4, R.sub.5, R.sub.6 and R.sub.7
is independently hydrogen, alkyl, substituted alkyl, aryl,
substituted aryl, or a protecting group, each "n" is independently
an integer from 0 to about 200, R.sub.2 is a siNA molecule or a
portion thereof, and R.sub.13 is an amino acid side chain.
[0322] In one embodiment, the invention features a compound having
Formula 5: ##STR12##
[0323] wherein each R.sub.1 and R.sub.4 is independently a
protecting group or hydrogen, each R.sub.3, R.sub.5, R.sub.6,
R.sub.7 and R.sub.8 is independently hydrogen, alkyl or nitrogen
protecting group, each "n" is independently an integer from 0 to
about 200, R.sub.12 is a straight or branched chain alkyl,
substituted alkyl, aryl, or substituted aryl, and each R.sub.9 and
R.sub.10 is independently a nitrogen containing group, cyanoalkoxy,
alkoxy, aryloxy, or alkyl group.
[0324] In one embodiment, the invention features a compound having
Formula 6: ##STR13##
[0325] wherein each R.sub.4, R.sub.5, R.sub.6 and R.sub.7 is
independently hydrogen, alkyl, substituted alkyl, aryl, substituted
aryl, or a protecting group, R.sub.2 is a siNA molecule or a
portion thereof, each "n" is independently an integer from 0 to
about 200, and L is a degradable linker.
[0326] In one embodiment, the invention features a compound having
Formula 7: ##STR14##
[0327] wherein each R.sub.1, R.sub.3, R.sub.4, R.sub.5, R.sub.6 and
R.sub.7 is independently hydrogen, alkyl substituted alkyl, aryl,
substituted aryl, or a protecting group, each "n" is independently
an integer from 0 to about 200, R.sub.12 is a straight or branched
chain alkyl, substituted alkyl, aryl, or substituted aryl, and
R.sub.2 is a siNA molecule or a portion thereof.
[0328] In one embodiment, the invention features a compound having
Formula 8: ##STR15##
[0329] wherein each R.sub.1 and R.sub.4 is independently a
protecting group or hydrogen, each R.sub.3, R.sub.5, R.sub.6 and
R.sub.7 is independently hydrogen, alkyl or nitrogen protecting
group, each "n" is independently an integer from 0 to about 200,
R.sub.12 is a straight or branched chain alkyl, substituted alkyl,
aryl, or substituted aryl, and each R.sub.9 and R.sub.10 is
independently a nitrogen containing group, cyanoalkoxy, alkoxy,
aryloxy, or alkyl group.
[0330] In one embodiment, R.sub.13 of a compound of the invention
comprises an alkylamino or an alkoxy group, for example,
--CH.sub.2O-- or --CH(CH.sub.2)CH.sub.2O--.
[0331] In another embodiment, R.sub.12 of a compound of the
invention is an alkylhyrdroxyl, for example, --(CH.sub.2).sub.nOH,
where n comprises an integer from about 1 to about 10.
[0332] In another embodiment, L of Formula 6 of the invention
comprises serine, threonine, or a photolabile linkage.
[0333] In one embodiment, R.sub.9 of a compound of the invention
comprises a phosphorus protecting group, for example
--OCH.sub.2CH.sub.2CN (oxyethylcyano).
[0334] In one embodiment, R.sub.10 of a compound of the invention
comprises a nitrogen containing group, for example, --N(R.sub.14)
wherein R.sub.14 is a straight or branched chain alkyl having from
about 1 to about 10 carbons.
[0335] In another embodiment, R.sub.10 of a compound of the
invention comprises a heterocycloalkyl or heterocycloalkenyl ring
containing from about 4 to about 7 atoms, and having from about 1
to about 3 heteroatoms comprising oxygen, nitrogen, or sulfur.
[0336] In another embodiment, R.sub.1 of a compound of the
invention comprises an acid labile protecting group, such as a
trityl or substituted trityl group, for example, a dimethoxytrityl
or mono-methoxytrityl group.
[0337] In another embodiment, R.sub.4 of a compound of the
invention comprises a tert-butyl, Fm (fluorenyl-methoxy), or allyl
group.
[0338] In one embodiment, R.sub.6 of a compound of the invention
comprises a TFA (trifluoracetyl) group.
[0339] In another embodiment, R.sub.3, R.sub.5, R.sub.7 and R.sub.8
of a compound of the invention are independently hydrogen.
[0340] In one embodiment, R.sub.7 of a compound of the invention is
independently isobutyryl, dimethylformamide, or hydrogen.
[0341] In another embodiment, R.sub.12 of a compound of the
invention comprises a methyl group or ethyl group.
[0342] In one embodiment, the invention features a compound having
Formula 27: ##STR16##
[0343] wherein "n" is an integer from about 0 to about 20, R.sub.4
is H or a cationic salt, X is a siNA molecule or a portion thereof,
and R.sub.24 is a sulfur containing leaving group, for example a
group comprising: ##STR17##
[0344] In one embodiment, the invention features a compound having
Formula 39: ##STR18##
[0345] wherein "n" is an integer from about 0 to about 20, X is a
siNA molecule or a portion thereof, and P is a phosphorus
containing group.
[0346] In another embodiment, a thiol containing linker of the
invention is a compound having Formula 41: ##STR19##
[0347] wherein "n" is an integer from about 0 to about 20, P is a
phosphorus containing group, for example a phosphine, phosphite, or
phosphate, and R24 is any alkyl, substituted alkyl, alkoxy, aryl,
substituted aryl, alkenyl, substituted alkenyl, alkynyl, or
substituted alkynyl group with or without additional protecting
groups.
[0348] In one embodiment, the invention features a compound having
Formula 43: ##STR20##
[0349] wherein X comprises a siNA molecule or portion thereof; W
comprises a degradable nucleic acid linker; Y comprises a linker
molecule or amino acid that can be present or absent; Z comprises
H, OH, O-alkyl, SH, S-alkyl, alkyl, substituted alkyl, aryl,
substituted aryl, amino, substituted amino, nucleotide, nucleoside,
nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid,
phospholipid, or label; n is an integer from about 1 to about 100;
and N' is an integer from about 1 to about 20. In another
embodiment, W is selected from the group consisting of amide,
phosphate, phosphate ester, phosphoramidate, or thiophosphate ester
linkage.
[0350] In another embodiment, the invention features a compound
having Formula 44: ##STR21##
[0351] wherein X comprises a siNA molecule or portion thereof; W
comprises a linker molecule or chemical linkage that can be present
or absent; n is an integer from about 1 to about 50, and PEG
represents a compound having Formula 45: ##STR22##
[0352] wherein Z comprises H, OH, O-alkyl, SH, S-alkyl, alkyl,
substituted alkyl, aryl, substituted aryl, amino, substituted
amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino
acid, peptide, protein, lipid, phospholipid, or label; and n is an
integer from about 1 to about 100. In another embodiment, W is
selected from the group consisting of amide, phosphate, phosphate
ester, phosphoramidate, or thiophosphate ester linkage.
[0353] In another embodiment, the invention features a compound
having Formula 46: ##STR23##
[0354] wherein X comprises a siNA molecule or portion thereof; each
W independently comprises linker molecule or chemical linkage that
can be present or absent, Y comprises a linker molecule or chemical
linkage that can be present or absent; and PEG represents a
compound having Formula 45: ##STR24##
[0355] wherein Z comprises H, OH, O-alkyl, SH, S-alkyl, alkyl,
substituted alkyl, aryl, substituted aryl, amino, substituted
amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino
acid, peptide, protein, lipid, phospholipid, or label; and n is an
integer from about 1 to about 100. In another embodiment, W is
selected from the group consisting of amide, phosphate, phosphate
ester, phosphoramidate, or thiophosphate ester linkage.
[0356] In one embodiment, the invention features a compound having
Formula 47: ##STR25##
[0357] wherein X comprises a siNA molecule or portion thereof; each
W independently comprises a linker molecule or chemical linkage
that can be the same or different and can be present or absent, Y
comprises a linker molecule that can be present or absent; each Q
independently comprises a hydrophobic group or phospholipid; each
R1, R2, R3, and R4 independently comprises O, OH, H, alkyl,
alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or
substituted N, and n is an integer from about 1 to about 10. In
another embodiment, W is selected from the group consisting of
amide, phosphate, phosphate ester, phosphoramidate, or
thiophosphate ester linkage.
[0358] In another embodiment, the invention features a compound
having Formula 48: ##STR26##
[0359] wherein X comprises a siNA molecule or portion thereof; each
W independently comprises a linker molecule or chemical linkage
that can be present or absent, Y comprises a linker molecule that
can be present or absent; each R1, R2, R3, and R4 independently
comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S,
S-alkyl, S-alkylcyano, N or substituted N, and B represents a
lipophilic group, for example a saturated or unsaturated linear,
branched, or cyclic alkyl group, cholesterol, or a derivative
thereof. In another embodiment, W is selected from the group
consisting of amide, phosphate, phosphate ester, phosphoramidate,
or thiophosphate ester linkage.
[0360] In another embodiment, the invention features a compound
having Formula 49: ##STR27##
[0361] wherein X comprises a siNA molecule or portion thereof; W
comprises a linker molecule or chemical linkage that can be present
or absent, Y comprises a linker molecule that can be present or
absent; each R1, R2, R3, and R4 independently comprises O, OH, H,
alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano,
N or substituted N, and B represents a lipophilic group, for
example a saturated or unsaturated linear, branched, or cyclic
alkyl group, cholesterol, or a derivative thereof. In another
embodiment, W is selected from the group consisting of amide,
phosphate, phosphate ester, phosphoramidate, or thiophosphate ester
linkage.
[0362] In another embodiment, the invention features a compound
having Formula 50: ##STR28##
[0363] wherein X comprises a siNA molecule or portion thereof; W
comprises a linker molecule or chemical linkage that can be present
or absent, Y comprises a linker molecule or chemical linkage that
can be present or absent; and each Q independently comprises a
hydrophobic group or phospholipid. In another embodiment, W is
selected from the group consisting of amide, phosphate, phosphate
ester, phosphoramidate, or thiophosphate ester linkage.
[0364] In one embodiment, the invention features a compound having
Formula 51: ##STR29##
[0365] wherein X comprises a siNA molecule or portion thereof; W
comprises a linker molecule or chemical linkage that can be present
or absent; Y comprises a linker molecule or amino acid that can be
present or absent; Z comprises H, OH, O-alkyl, SH, S-alkyl, alkyl,
substituted alkyl, aryl, substituted aryl, amino, substituted
amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino
acid, peptide, protein, lipid, phospholipid, or label; SG comprises
a sugar, for example galactose, galactosamine,
N-acetyl-galactosamine, glucose, mannose, fructose, or fucose and
the respective D or L, alpha or beta isomers, and n is an integer
from about 1 to about 20. In another embodiment, W is selected from
the group consisting of amide, phosphate, phosphate ester,
phosphoramidate, or thiophosphate ester linkage.
[0366] In another embodiment, the invention features a compound
having Formula 52: ##STR30##
[0367] wherein X comprises a siNA molecule or portion thereof; Y
comprises a linker molecule or chemical linkage that can be present
or absent; each R1, R2, R3, R4, and R5 independently comprises O,
OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl,
S-alkylcyano, N or substituted N; Z comprises H, OH, O-alkyl, SH,
S-alkyl, alkyl, substituted alkyl, aryl, substituted aryl, amino,
substituted amino, nucleotide, nucleoside, nucleic acid,
oligonucleotide, amino acid, peptide, protein, lipid, phospholipid,
or label; SG comprises a sugar, for example galactose,
galactosamine, N-acetyl-galactosamine, glucose, mannose, fructose,
or fucose and the respective D or L, alpha or beta isomers, n is an
integer from about 1 to about 20; and N' is an integer from about 1
to about 20. In another embodiment, X comprises a siNA molecule or
a portion thereof. In another embodiment, Y is selected from the
group consisting of amide, phosphate, phosphate ester,
phosphoramidate, or thiophosphate ester linkage.
[0368] In another embodiment, the invention features a compound
having Formula 53: ##STR31##
[0369] wherein B comprises H, a nucleoside base, or a
non-nucleosidic base with or without protecting groups; each R1
independently comprises O, N, S, alkyl, or substituted N; each R2
independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl,
O-alkylhalo, S, N, substituted N, or a phosphorus containing group;
each R3 independently comprises N or O--N, each R4 independently
comprises O, CH2, S, sulfone, or sulfoxy; X comprises H, a
removable protecting group, a siNA molecule or a portion thereof; W
comprises a linker molecule or chemical linkage that can be present
or absent; SG comprises a sugar, for example galactose,
galactosamine, N-acetyl-galactosamine, glucose, mannose, fructose,
or fucose and the respective D or L, alpha or beta isomers, each n
is independently an integer from about 1 to about 50; and N' is an
integer from about 1 to about 10. In another embodiment, W is
selected from the group consisting of amide, phosphate, phosphate
ester, phosphoramidate, or thiophosphate ester linkage.
[0370] In another embodiment, the invention features a compound
having Formula 54: ##STR32##
[0371] wherein B comprises H, a nucleoside base, or a
non-nucleosidic base with or without protecting groups; each R1
independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl,
O-alkylhalo, S, N, substituted N, or a phosphorus containing group;
X comprises H, a removable protecting group, a siNA molecule or a
portion thereof; W comprises a linker molecule or chemical linkage
that can be present or absent; and SG comprises a sugar, for
example galactose, galactosamine, N-acetyl-galactosamine, glucose,
mannose, fructose, or fucose and the respective D or L, alpha or
beta isomers. In another embodiment, W is selected from the group
consisting of amide, phosphate, phosphate ester, phosphoramidate,
or thiophosphate ester linkage.
[0372] In one embodiment, the invention features a compound having
Formula 55: ##STR33##
[0373] wherein each R1 independently comprises O, N, S, alkyl, or
substituted N; each R2 independently comprises O, OH, H, alkyl,
alkylhalo, O-alkyl, O-alkylhalo, S, N, substituted N, or a
phosphorus containing group; each R3 independently comprises H, OH,
alkyl, substituted alkyl, or halo; X comprises H, a removable
protecting group, a siNA molecule or a portion thereof; W comprises
a linker molecule or chemical linkage that can be present or
absent; SG comprises a sugar, for example galactose, galactosamine,
N-acetyl-galactosamine, glucose, mannose, fructose, or fucose and
the respective D or L, alpha or beta isomers, each n is
independently an integer from about 1 to about 50; and N' is an
integer from about 1 to about 100. In another embodiment, W is
selected from the group consisting of amide, phosphate, phosphate
ester, phosphoramidate, or thiophosphate ester linkage.
[0374] In another embodiment, the invention features a compound
having Formula 56: ##STR34##
[0375] wherein R1 comprises H, alkyl, alkylhalo, N, substituted N,
or a phosphorus containing group; R2 comprises H, O, OH, alkyl,
alkylhalo, halo, S, N, substituted N, or a phosphorus containing
group; X comprises H, a removable protecting group, a siNA molecule
or a portion thereof; W comprises a linker molecule or chemical
linkage that can be present or absent; SG comprises a sugar, for
example galactose, galactosamine, N-acetyl-galactosamine, glucose,
mannose, fructose, or fucose and the respective D or L, alpha or
beta isomers, and each n is independently an integer from about 0
to about 20. In another embodiment, W is selected from the group
consisting of amide, phosphate, phosphate ester, phosphoramidate,
or thiophosphate ester linkage.
[0376] In another embodiment, the invention features a compound
having Formula 57: ##STR35## [0377] wherein R1 can include the
groups: ##STR36## [0378] and wherein R2 can include the groups:
##STR37##
[0379] and wherein Tr is a removable protecting group, for example
a trityl, monomethoxytrityl, or dimethoxytrityl; SG comprises a
sugar, for example galactose, galactosamine,
N-acetyl-galactosamine, glucose, mannose, fructose, or fucose and
the respective D or L, alpha or beta isomers, and n is an integer
from about 1 to about 20.
[0380] In one embodiment, compounds having Formula 52, 53, 54, 55,
56, and 57 are featured wherein each nitrogen adjacent to a
carbonyl can independently be substituted for a carbonyl adjacent
to a nitrogen or each carbonyl adjacent to a nitrogen can be
substituted for a nitrogen adjacent to a carbonyl.
[0381] In another embodiment, the invention features a compound
having Formula 58: ##STR38##
[0382] wherein X comprises a siNA molecule or portion thereof; W
comprises a linker molecule or chemical linkage that can be present
or absent; Y comprises a linker molecule or amino acid that can be
present or absent; V comprises a signal protein or peptide, for
example Human serum albumin protein, Antennapedia peptide, Kaposi
fibroblast growth factor peptide, Caiman crocodylus Ig(5) light
chain peptide, HIV envelope glycoprotein gp41 peptide, HIV-1 Tat
peptide, Influenza hemagglutinin envelope glycoprotein peptide, or
transportan A peptide; each n is independently an integer from
about 1 to about 50; and N' is an integer from about 1 to about
100. In another embodiment, W is selected from the group consisting
of amide, phosphate, phosphate ester, phosphoramidate, or
thiophosphate ester linkage.
[0383] In another embodiment, the invention features a compound
having Formula 59: ##STR39##
[0384] wherein each R1 independently comprises O, S, N, substituted
N, or a phosphorus containing group; each R2 independently
comprises O, S, or N; X comprises H, amino, substituted amino,
nucleotide, nucleoside, nucleic acid, oligonucleotide, or other
biologically active molecule; n is an integer from about 1 to about
50, Q comprises H or a removable protecting group which can be
optionally absent, each W independently comprises a linker molecule
or chemical linkage that can be present or absent, and V comprises
a signal protein or peptide, for example Human serum albumin
protein, Antennapedia peptide, Kaposi fibroblast growth factor
peptide, Caiman crocodylus Ig(5) light chain peptide, HIV envelope
glycoprotein gp41 peptide, HIV-1 Tat peptide, Influenza
hemagglutinin envelope glycoprotein peptide, or transportan A
peptide, or a compound having Formula 45 ##STR40##
[0385] wherein Z comprises H, OH, O-alkyl, SH, S-alkyl, alkyl,
substituted alkyl, aryl, substituted aryl, amino, substituted
amino, a removable protecting group, a siNA molecule or a portion
thereof; and n is an integer from about 1 to about 100. In another
embodiment, W is selected from the group consisting of amide,
phosphate, phosphate ester, phosphoramidate, or thiophosphate ester
linkage.
[0386] In another embodiment, the invention features a compound
having Formula 60: ##STR41## [0387] wherein R1 can include the
groups: ##STR42## [0388] and wherein R2 can include the groups:
##STR43##
[0389] and wherein Tr is a removable protecting group, for example
a trityl, monomethoxytrityl, or dimethoxytrityl; n is an integer
from about 1 to about 50; and R8 is a nitrogen protecting group,
for example a phthaloyl, trifluoroacetyl, FMOC, or
monomethoxytrityl group.
[0390] In another embodiment, the invention features a compound
having Formula 61: ##STR44##
[0391] wherein X comprises a siNA molecule or portion thereof; each
W independently comprises a linker molecule or chemical linkage
that can be the same or different and can be present or absent, Y
comprises a linker molecule that can be present or absent; each 5
independently comprises a signal protein or peptide, for example
Human serum albumin protein, Antennapedia peptide, Kaposi
fibroblast growth factor peptide, Caiman crocodylus Ig(5) light
chain peptide, HIV envelope glycoprotein gp41 peptide, HIV-1 Tat
peptide, Influenza hemagglutinin envelope glycoprotein peptide, or
transportan A peptide; each R1, R2, R3, and R4 independently
comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S,
S-alkyl, S-alkylcyano, N or substituted N, and n is an integer from
about 1 to about 10. In another embodiment, W is selected from the
group consisting of amide, phosphate, phosphate ester,
phosphoramidate, or thiophosphate ester linkage.
[0392] In another embodiment, the invention features a compound
having Formula 62: ##STR45##
[0393] wherein X comprises a siNA molecule or portion thereof; each
5 independently comprises a signal protein or peptide, for example
Human serum albumin protein, Antennapedia peptide, Kaposi
fibroblast growth factor peptide, Caiman crocodylus Ig(5) light
chain peptide, HIV envelope glycoprotein gp41 peptide, HIV-1 Tat
peptide, Influenza hemagglutinin envelope glycoprotein peptide, or
transportan A peptide; W comprises a linker molecule or chemical
linkage that can be present or absent; each R1, R2, and R3
independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl,
O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, and
each n is independently an integer from about 1 to about 10. In
another embodiment, W is selected from the group consisting of
amide, phosphate, phosphate ester, phosphoramidate, or
thiophosphate ester linkage.
[0394] In another embodiment, the invention features a compound
having Formula 63: ##STR46##
[0395] wherein X comprises a siNA molecule or portion thereof; V
comprises a signal protein or peptide, for example Human serum
albumin protein, Antennapedia peptide, Kaposi fibroblast growth
factor peptide, Caiman crocodylus Ig(5) light chain peptide, HIV
envelope glycoprotein gp41 peptide, HIV-1 Tat peptide, Influenza
hemagglutinin envelope glycoprotein peptide, or transportan A
peptide; W comprises a linker molecule or chemical linkage that can
be present or absent; each R1, R2, R3 independently comprises O,
OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl,
S-alkylcyano, N or substituted N, R4 represents an ester, amide, or
protecting group, and each n is independently an integer from about
1 to about 10. In another embodiment, W is selected from the group
consisting of amide, phosphate, phosphate ester, phosphoramidate,
or thiophosphate ester linkage.
[0396] In another embodiment, the invention features a compound
having Formula 64: ##STR47##
[0397] wherein X comprises a siNA molecule or portion thereof; each
W independently comprises a linker molecule or chemical linkage
that can be present or absent, Y comprises a linker molecule that
can be present or absent; each R1, R2, R3, and R4 independently
comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S,
S-alkyl, S-alkylcyano, N or substituted N, A comprises a nitrogen
containing group, and B comprises a lipophilic group. In another
embodiment, W is selected from the group consisting of amide,
phosphate, phosphate ester, phosphoramidate, or thiophosphate ester
linkage.
[0398] In another embodiment, the invention features a compound
having Formula 65: ##STR48##
[0399] wherein X comprises a siNA molecule or portion thereof; each
W independently comprises a linker molecule or chemical linkage
that can be present or absent, Y comprises a linker molecule that
can be present or absent; each R1, R2, R3, and R4 independently
comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S,
S-alkyl, S-alkylcyano, N or substituted N, RV comprises the lipid
or phospholipid component of any of Formulae 47-50, and R6
comprises a nitrogen containing group. In another embodiment, W is
selected from the group consisting of amide, phosphate, phosphate
ester, phosphoramidate, or thiophosphate ester linkage.
[0400] In another embodiment, the invention features a compound
having Formula 92: ##STR49##
[0401] wherein B comprises H, a nucleoside base, or a
non-nucleosidic base with or without protecting groups; each R1
independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl,
O-alkylhalo, S, N, substituted N, or a phosphorus containing group;
X comprises H, a removable protecting group, amino, substituted
amino, nucleotide, nucleoside, nucleic acid, oligonucleotide,
enzymatic nucleic acid, amino acid, peptide, protein, lipid,
phospholipid, biologically active molecule or label; W comprises a
linker molecule or chemical linkage that can be present or absent;
R2 comprises O, NH, S, CO, COO, ON.dbd.C, or alkyl; R3 comprises
alkyl, akloxy, or an aminoacyl side chain; and SG comprises a
sugar, for example galactose, galactosamine,
N-acetyl-galactosamine, glucose, mannose, fructose, or fucose and
the respective D or L, alpha or beta isomers. In another
embodiment, W is selected from the group consisting of amide,
phosphate, phosphate ester, phosphoramidate, or thiophosphate ester
linkage.
[0402] In another embodiment, the invention features a compound
having Formula 86: ##STR50##
[0403] wherein R1 comprises H, alkyl, alkylhalo, N, substituted N,
or a phosphorus containing group; R2 comprises H, O, OH, alkyl,
alkylhalo, halo, S, N, substituted N, or a phosphorus containing
group; X comprises H, a removable protecting group, a siNA molecule
or a portion thereof; W comprises a linker molecule or chemical
linkage that can be present or absent; R3 comprises O, NH, S, CO,
COO, ON.dbd.C, or alkyl; R4 comprises alkyl, akloxy, or an
aminoacyl side chain; and SG comprises a sugar, for example
galactose, galactosamine, N-acetyl-galactosamine, glucose, mannose,
fructose, or fucose and the respective D or L, alpha or beta
isomers, and each n is independently an integer from about 0 to
about 20. In another embodiment, W is selected from the group
consisting of amide, phosphate, phosphate ester, phosphoramidate,
or thiophosphate ester linkage.
[0404] In another embodiment, the invention features a compound
having Formula 87: ##STR51##
[0405] wherein X comprises a protein, peptide, antibody, lipid,
phospholipid, oligosaccharide, label, biologically active molecule,
for example a vitamin such as folate, vitamin A, E, B6, B12,
coenzyme, antibiotic, antiviral, nucleic acid, nucleotide,
nucleoside, or oligonucleotide such as an enzymatic nucleic acid,
allozyme, antisense nucleic acid, siNA, 2,5-A chimera, decoy,
aptamer or triplex forming oligonucleotide, or polymers such as
polyethylene glycol; W comprises a linker molecule or chemical
linkage that can be present or absent; and Y comprises siNA or a
portion thereof; R1 comprises H, alkyl, or substituted alkyl. In
another embodiment, W is selected from the group consisting of
amide, phosphate, phosphate ester, phosphoramidate, or
thiophosphate ester linkage.
[0406] In another embodiment, the invention features a compound
having Formula 88: ##STR52##
[0407] wherein X comprises a protein, peptide, antibody, lipid,
phospholipid, oligosaccharide, label, biologically active molecule,
for example a vitamin such as folate, vitamin A, E, B6, B 12,
coenzyme, antibiotic, antiviral, nucleic acid, nucleotide,
nucleoside, or oligonucleotide such as an enzymatic nucleic acid,
allozyme, antisense nucleic acid, siNA, 2,5-A chimera, decoy,
aptamer or triplex forming oligonucleotide, or polymers such as
polyethylene glycol; W comprises a linker molecule or chemical
linkage that can be present or absent, and Y comprises a siNA or a
portion thereof. In another embodiment, W is selected from the
group consisting of amide, phosphate, phosphate ester,
phosphoramidate, or thiophosphate ester linkage.
[0408] In another embodiment, the invention features a compound
having Formula 99: ##STR53##
[0409] wherein X comprises a siNA molecule or portion thereof; each
W independently comprises a linker molecule or chemical linkage
that can be present or absent, Y comprises a linker molecule that
can be present or absent; each R1, R2, R3, and R4 independently
comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S,
S-alkyl, S-alkylcyano, N or substituted N, and SG comprises a
sugar, for example galactose, galactosamine, N-acetyl-galactosamine
or branched derivative thereof, glucose, mannose, fructose, or
fucose and the respective D or L, alpha or beta isomers. In another
embodiment, W is selected from the group consisting of amide,
phosphate, phosphate ester, phosphoramidate, or thiophosphate ester
linkage.
[0410] In another embodiment, the invention features a compound
having Formula 100: ##STR54##
[0411] wherein X comprises a siNA molecule or portion thereof; W
comprises a linker molecule or chemical linkage that can be present
or absent, Y comprises a linker molecule that can be present or
absent; each R1, R2, R3, and R4 independently comprises O, OH, H,
alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano,
N or substituted N, and SG comprises a sugar, for example
galactose, galactosamine, N-acetyl-galactosamine or branched
derivative thereof, glucose, mannose, fructose, or fucose and the
respective D or L, alpha or beta isomers. In another embodiment, W
is selected from the group consisting of amide, phosphate,
phosphate ester, phosphoramidate, or thiophosphate ester
linkage.
[0412] In one embodiment, the SG component of any compound having
Formulae 99 or 100 comprises a compound having Formula 101:
##STR55##
[0413] wherein Y comprises a linker molecule or chemical linkage
that can be present or absent and each R7 independently comprises
an acyl group that can be present or absent, for example a acetyl
group.
[0414] In one embodiment, the W-SG component of a compound having
Formulae 99 comprises a compound having Formula 102: ##STR56##
[0415] wherein R2 comprises O, OH, H, alkyl, alkylhalo, O-alkyl,
O-alkylhalo, S, N, substituted N, a protecting group, or another
compound having Formula 102; R1 independently H, OH, alkyl,
substituted alkyl, or halo and each R7 independently comprises an
acyl group that can be present or absent, for example a acetyl
group, and R3 comprises O or R3 in Formula 99, and n is an integer
from about 1 to about 20.
[0416] In one embodiment, the W-SG component of a compound having
Formulae 99 comprises a compound having Formula 103: ##STR57##
[0417] wherein R1 comprises H, alkyl, alkylhalo, O-alkyl,
O-alkylhalo, S, N, substituted N, a protecting group, or another
compound having Formula 103; each R7 independently comprises an
acyl group that can be present or absent, for example a acetyl
group, and R3 comprises H or R3 in Formula 99, and each n is
independently an integer from about 1 to about 20.
[0418] In one embodiment, the invention features a compound having
Formula 104: ##STR58##
[0419] wherein R3 comprises H, OH, amino, substituted amino,
nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid,
peptide, protein, lipid, phospholipid, label, or a portion thereof,
or OR5 where R5 a removable protecting group, R4 comprises O,
alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano,
N or substituted N, each R7 independently comprises an acyl group
that can be present or absent, for example a acetyl group, and each
n is independently an integer from about 1 to about 20, and
[0420] wherein R1 can include the groups: ##STR59##
[0421] and wherein R2 can include the groups: ##STR60##
[0422] In one embodiment, the invention features a compound having
Formula 105: ##STR61##
[0423] wherein X comprises a siNA molecule or a portion thereof, R2
comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylhalo, S, N,
substituted N, a protecting group, or a nucleotide, polynucleotide,
or oligonucleotide or a portion thereof, R1 independently H. OH,
alkyl, substituted alkyl, or halo and each R7 independently
comprises an acyl group that can be present or absent, for example
a acetyl group, and n is an integer from about 1 to about 20.
[0424] In one embodiment, the invention features a compound having
Formula 106: ##STR62##
[0425] wherein X comprises a siNA molecule or a portion thereof, R1
comprises H, OH, amino, substituted amino, nucleotide, nucleoside,
nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid,
phospholipid, label, or a portion thereof, or OR5 where R5 a
removable protecting group, each R7 independently comprises an acyl
group that can be present or absent, for example a acetyl group,
and each n is independently an integer from about 1 to about 20
[0426] In another embodiment, the invention features a compound
having Formula 107: ##STR63##
[0427] wherein X comprises a siNA molecule or portion thereof; each
W independently comprises a linker molecule or chemical linkage
that can be present or absent, Y comprises a linker molecule that
can be present or absent; each R1, R2, R3, and R4 independently
comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S,
S-alkyl, S-alkylcyano, N or substituted N, and Cholesterol
comprises cholesterol or an analog, derivative, or metabolite
thereof. In another embodiment, W is selected from the group
consisting of amide, phosphate, phosphate ester, phosphoramidate,
or thiophosphate ester linkage.
[0428] In another embodiment, the invention features a compound
having Formula 108: ##STR64##
[0429] wherein X comprises a siNA molecule or portion thereof; W
comprises a linker molecule or chemical linkage that can be present
or absent, Y comprises a linker molecule that can be present or
absent; each R1, R2, R3, and R4 independently comprises O, OH, H,
alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano,
N or substituted N, and Cholesterol comprises cholesterol or an
analog, derivative, or metabolite thereof. In another embodiment, W
is selected from the group consisting of amide, phosphate,
phosphate ester, phosphoramidate, or thiophosphate ester
linkage.
[0430] In one embodiment, the W-Cholesterol component of a compound
having Formula 107 comprises a compound having Formula 109:
##STR65##
[0431] wherein R3 comprises R3 as described in Formula 107, and n
is independently an integer from about 1 to about 20.
[0432] In one embodiment, the invention features a compound having
Formula 110: ##STR66##
[0433] wherein R4 comprises O, alkyl, alkylhalo, O-alkyl,
O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, each n
is independently an integer from about 1 to about 20, and
[0434] wherein R1 can include the groups: ##STR67##
[0435] and wherein R2 can include the groups: ##STR68##
[0436] In one embodiment, the invention features a compound having
Formula 111: ##STR69##
[0437] wherein X comprises a siNA molecule or portion thereof; W
comprises a linker molecule or chemical linkage that can be present
or absent, and n is an integer from about 1 to about 20. In another
embodiment, W is selected from the group consisting of amide,
phosphate, phosphate ester, phosphoramidate, or thiophosphate ester
linkage.
[0438] In one embodiment, the invention features a compound having
Formula 112: ##STR70##
[0439] wherein n is an integer from about 1 to about 20. In another
embodiment, a compound having Formula 112 is used to generate a
compound having Formula 111 via NHS ester mediated coupling with a
biologically active molecule, such as a siNA molecule or a portion
thereof. In a non-limiting example, the NHS ester coupling can be
effectuated via attachment to a free amine present in the siNA
molecule, such as an amino linker molecule present on a nucleic
acid sugar (e.g. 2'-amino linker) or base (e.g., C5 alkyl amine
linker) component of the siNA molecule.
[0440] In one embodiment, the invention features a compound having
Formula 113: ##STR71##
[0441] wherein R3 comprises H, OH, amino, substituted amino,
nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid,
peptide, protein, lipid, phospholipid, label, or a portion thereof,
or OR5 where R5 a removable protecting group, R4 comprises O,
alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano,
N or substituted N, each n is independently an integer from about 1
to about 20, and
[0442] wherein R1 can include the groups: ##STR72##
[0443] and wherein R2 can include the groups: ##STR73##
[0444] In another embodiment, a compound having Formula 113 is used
to generate a compound having Formula 111 via phosphoramidite
mediated coupling with a biologically active molecule, such as a
siNA molecule or a portion thereof.
[0445] In one embodiment, the invention features a compound having
Formula 114: ##STR74##
[0446] wherein X comprises a siNA molecule or portion thereof; W
comprises a linker molecule or chemical linkage that can be present
or absent, and n is an integer from about 1 to about 20. In another
embodiment, W is selected from the group consisting of amide,
phosphate, phosphate ester, phosphoramidate, or thiophosphate ester
linkage.
[0447] In one embodiment, the invention features a compound having
Formula 115: ##STR75##
[0448] wherein X comprises a siNA molecule or portion thereof; W
comprises a linker molecule or chemical linkage that can be present
or absent, R3 comprises H, OH, amino, substituted amino,
nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid,
peptide, protein, lipid, phospholipid, label, or a portion thereof,
or OR5 where R5 a removable protecting group, and each n is
independently an integer from about 1 to about 20. In another
embodiment, W is selected from the group consisting of amide,
phosphate, phosphate ester, phosphoramidate, or thiophosphate ester
linkage.
[0449] In one embodiment, the invention features a compound having
Formula 116: ##STR76##
[0450] wherein R3 comprises H, OH, amino, substituted amino,
nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid,
peptide, protein, lipid, phospholipid, label, or a portion thereof,
or OR5 where R5 a removable protecting group, R4 comprises O,
alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano,
N or substituted N, each n is independently an integer from about 1
to about 20, and
[0451] wherein R1 can include the groups: ##STR77##
[0452] and wherein R2 can include the groups: ##STR78##
[0453] In another embodiment, a compound having Formula 116 is used
to generate a compound having Formula 114 or 115 via
phosphoramidite mediated coupling with a biologically active
molecule, such as a siNA molecule or a portion thereof.
[0454] In one embodiment, the invention features a compound having
Formula 117: ##STR79##
[0455] wherein R3 comprises H, OH, amino, substituted amino,
nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid,
peptide, protein, lipid, phospholipid, label, or a portion thereof,
or OR5 where R5 a removable protecting group, R4 comprises O,
alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano,
N or substituted N, each R7 independently comprises an acyl group
that can be present or absent, for example a acetyl group, each n
is independently an integer from about 1 to about 20, and
[0456] wherein R1 can include the groups: ##STR80##
[0457] and wherein R2 can include the groups: ##STR81##
[0458] In another embodiment, a compound having Formula 117 is used
to generate a compound having Formula 105 via phosphoramidite
mediated coupling with a biologically active molecule, such as a
siNA molecule or a portion thereof.
[0459] In one embodiment, the invention features a compound having
Formula 118: ##STR82##
[0460] wherein X comprises a siNA molecule or portion thereof, W
comprises a linker molecule or chemical linkage that can be present
or absent, R3 comprises H, OH, ammo, substituted amino, nucleotide,
nucleoside, nucleic acid, oligonucleotide, amino acid, peptide,
protein, lipid, phospholipid, label, or a portion thereof, or OR5
where R5 a removable protecting group, each R7 independently
comprises an acyl group that can be present or absent, for example
a acetyl group, and each n is independently an integer from about 1
to about 20. In another embodiment, W is selected from the group
consisting of amide, phosphate, phosphate ester, phosphoramidate,
or thiophosphate ester linkage.
[0461] In one embodiment, the invention features a compound having
Formula 119: ##STR83##
[0462] wherein X comprises a siNA molecule or portion thereof, W
comprises a linker molecule or chemical linkage that can be present
or absent, each R7 independently comprises an acyl group that can
be present or absent, for example a acetyl group, and each n is
independently an integer from about 1 to about 20. In another
embodiment, W is selected from the group consisting of amide,
phosphate, phosphate ester, phosphoramidate, or thiophosphate ester
linkage.
[0463] In one embodiment, the invention features a compound having
Formula 120: ##STR84##
[0464] wherein R3 comprises H, OH, amino, substituted amino,
nucleotide, nucleo side, nucleic acid, oligonucleotide, amino acid,
peptide, protein, lipid, phospholipid, label, or a portion thereof,
or OR5 where R5 a removable protecting group, R4 comprises O,
alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano,
N or substituted N, each R7 independently comprises an acyl group
that can be present or absent, for example a acetyl group, each n
is independently an integer from about 1 to about 20, and
[0465] wherein R1 can include the groups: ##STR85##
[0466] and wherein R2 can include the groups: ##STR86##
[0467] In another embodiment, a compound having Formula 120 is used
to generate a compound having Formula 118 or 119 via
phosphoramidite mediated coupling with a biologically active
molecule, such as a siNA molecule or a portion thereof.
[0468] In one embodiment, the invention features a compound having
Formula 121: ##STR87##
[0469] wherein X comprises a siNA molecule or portion thereof; W
comprises a linker molecule or chemical linkage that can be present
or absent, each R7 independently comprises an acyl group that can
be present or absent, for example a acetyl group, and each n is
independently an integer from about 1 to about 20. In another
embodiment, W is selected from the group consisting of amide,
phosphate, phosphate ester, phosphoramidate, or thiophosphate ester
linkage.
[0470] In one embodiment, the invention features a compound having
Formula 122: ##STR88##
[0471] wherein R3 comprises H, OH, amino, substituted amino,
nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid,
peptide, protein, lipid, phospholipid, label, or a portion thereof,
or OR5 where R5 a removable protecting group, R4 comprises O,
alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano,
N or substituted N, each R7 independently comprises an acyl group
that can be present or absent, for example a acetyl group, each n
is independently an integer from about 1 to about 20, and
[0472] wherein R1 can include the groups: ##STR89##
[0473] and wherein R2 can include the groups: ##STR90##
[0474] In another embodiment, a compound having Formula 122 is used
to generate a compound having Formula 121 via phosphoramidite
mediated coupling with a biologically active molecule, such as a
siNA molecule or a portion thereof.
[0475] In one embodiment, the invention features a compound having
Formula 94, X--Y--W--Y-Z 94
[0476] wherein X comprises a siNA molecule or a portion thereof;
each Y independently comprises a linker or chemical linkage that
can be present or absent, W comprises a biodegradable nucleic acid
linker molecule, and Z comprises a biologically active molecule,
for example an enzymatic nucleic acid, allozyme, antisense nucleic
acid, siNA, 2,5-A chimera, decoy, aptamer or triplex forming
oligonucleotide, peptide, protein, or antibody.
[0477] In another embodiment, W of a compound having Formula 94 of
the invention comprises 5'-cytidine-deoxythymidine-3',
5'-deoxythymidine-cytidine-3', 5'-cytidine-deoxyuridine-3',
5'-deoxyuridine-cytidine-3', 5'-uridine-deoxythymidine-3', or
5'-deoxythymidine-uridine-3'.
[0478] In yet another embodiment, W of a compound having Formula 94
of the invention comprises 5'-adenosine-deoxythymidine-3',
5'-deoxythymidine-adenosine-3', 5'-adenosine-deoxyuridine-3', or
5'-deoxyuridine-adenosine-3'.
[0479] In another embodiment, Y of a compound having Formula 94 of
the invention comprises a phosphorus containing linkage,
phoshoramidate linkage, phosphodiester linkage, phosphorothioate
linkage, amide linkage, ester linkage, carbamate linkage, disulfide
linkage, oxime linkage, or morpholino linkage.
[0480] In another embodiment, compounds having Formula 89 and 91 of
the invention are synthesized by periodate oxidation of an
N-terminal Serine or Threonine residue of a peptide or protein.
[0481] In one embodiment, X of compounds having Formulae 43, 44,
46-52, 58, 61-65, 85-88, 92, 94, 95, 99, 100, 105-108, 111, 114,
115, 118, 119, or 121 of the invention comprises a siNA molecule or
a portion thereof. In one embodiment, the siNA molecule can be
conjugated at the 5' end, 3'-end, or both 5' and 3' ends of the
sense strand or region of the siNA. In one embodiment, the siNA
molecule can be conjugated at the 3'-end of the antisense strand or
region of the siNA with a compound of the invention. In one
embodiment, both the sense strand and antisense strands or regions
of the siNA molecule are conjugated with a compound of the
invention. In one embodiment, only the sense strand or region of
the siNA is conjugated with a compound of the invention. In one
embodiment, only the antisense strand or region of the siNA is
conjugated with a compound of the invention.
[0482] In one embodiment, W and/or Y of compounds having Formulae
43, 44, 46-52, 58, 61-65, 85-88, 92, 94, 95, 99, 100, 101, 107,
108, 111, 114, 115, 118, 119, or 121 of the invention comprises a
degradable or cleavable linker, for example a nucleic acid sequence
comprising ribonucleotides and/or deoxynucleotides, such as a
dimer, trimer, or tetramer. A non limiting example of a nucleic
acid cleavable linker is an adenosine-deoxythymidine (A-dT) dimer
or a cytidine-deoxythymidine (C-dT) dimer. In yet another
embodiment, W and/or V of compounds having Formulae 43, 44, 48-51,
58, 63-65, 96, 99, 100, 107, 108, 111, 114, 115, 118, 119, or 121
of the invention comprises a N-hydroxy succinimide (NHS) ester
linkage, oxime linkage, disulfide linkage, phosphoramidate,
phosphorothioate, phosphorodithioate, phosphodiester linkage, or
NHC(O), CH.sub.3NC(O), CONH, C(O)NCH.sub.3, S, SO, SO.sub.2, O, NH,
NCH.sub.3 group. In another embodiment, the degradable linker, W
and/or Y, of compounds having Formulae Formulae 43, 44, 46-52, 58,
61-65, 85-88, 92, 94, 95, 99, 100, 101, 107, 108, 111, 114, 115,
118, 119, or 121 of the invention comprises a linker that is
susceptible to cleavage by carboxypeptidase activity.
[0483] In another embodiment, W and/or Y of Formulae Formulae 43,
44, 46-52, 58, 61-65, 85-88, 92, 94, 95, 99, 100, 101, 107, 108,
111, 114, 115, 118, 119, or 121 comprises a polyethylene glycol
linker having Formula 45: ##STR91##
[0484] wherein Z comprises H, OH, O-alkyl, SH, S-alkyl, alkyl,
substituted alkyl, aryl, substituted aryl, amino, substituted
amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino
acid, peptide, protein, lipid, phospholipid, or label; and n is an
integer from about 1 to about 100.
[0485] In one embodiment, the nucleic acid conjugates of the
instant invention are assembled by solid phase synthesis, for
example on an automated peptide synthesizer, for example a Miligen
9050 synthesizer and/or an automated oligonucleotide synthesizer
such as an ABI 394, 390Z, or Pharmacia OligoProcess, OligoPilot,
OligoMax, or AKTA synthesizer. In another embodiment, the nucleic
acid conjugates of the invention are assembled post synthetically,
for example, following solid phase oligonucleotide synthesis (see
for example FIGS. 45, 50, 53, and 73).
[0486] In another embodiment, V of compounds having Formula 58-63
and 96 comprise peptides having SEQ ID NOS: 507-516 (Table V).
[0487] In one embodiment, the nucleic acid conjugates of the
instant invention are assembled post synthetically, for example,
following solid phase oligonucleotide synthesis.
[0488] The present invention provides compositions and conjugates
comprising nucleosidic and non-nucleosidic derivatives. The present
invention also provides nucleic acid, polynucleotide and
oligonucleotide derivatives including RNA, DNA, and PNA based
conjugates. The attachment of compounds of the invention to
nucleosides, nucleotides, non-nucleosides, and nucleic acid
molecules is provided at any position within the molecule, for
example, at internucleotide linkages, nucleosidic sugar hydroxyl
groups such as 5', 3', and 2'-hydroxyls, and/or at nucleobase
positions such as amino and carbonyl groups.
[0489] The exemplary conjugates of the invention are described as
compounds of the formulae herein, however, other peptide, protein,
phospholipid, and poly-alkyl glycol derivatives are provided by the
invention, including various analogs of the compounds of formulae
1-122, including but not limited to different isomers of the
compounds described herein.
[0490] The exemplary folate conjugates of the invention are
described as compounds shown by formulae herein, however, other
folate and antifolate derivatives are provided by the invention,
including various folate analogs of the formulae of the invention,
including dihydrofloates, tetrahydrofolates, tetrahydorpterins,
folinic acid, pteropolyglutamic acid, 1-deza, 3-deaza, 5-deaza,
8-deaza, 10-deaza, 1,5-deaza, 5,10 dideaza, 8,10-dideaza, and
5,8-dideaza folates, antifolates, and pteroic acids. As used
herein, the term "folate" is meant to refer to folate and folate
derivatives, including pteroic acid derivatives and analogs.
[0491] The present invention features compositions and conjugates
to facilitate delivery of molecules into a biological system such
as cells. The conjugates provided by the instant invention can
impart therapeutic activity by transferring therapeutic compounds
across cellular membranes. The present invention encompasses the
design and synthesis of novel agents for the delivery of molecules,
including but not limited to siNA molecules. In general, the
transporters described are designed to be used either individually
or as part of a multi-component system. The compounds of the
invention generally shown in Formulae herein are expected to
improve delivery of molecules into a number of cell types
originating from different tissues, in the presence or absence of
serum.
[0492] In another embodiment, the compounds of the invention are
provided as a surface component of a lipid aggregate, such as a
liposome encapsulated with the predetermined molecule to be
delivered. Liposomes, which can be unilamellar or multilamellar,
can introduce encapsulated material into a cell by different
mechanisms. For example, the liposome can directly introduce its
encapsulated material into the cell cytoplasm by fusing with the
cell membrane. Alternatively, the liposome can be compartmentalized
into an acidic vacuole (i.e., an endosome) and its contents
released from the liposome and out of the acidic vacuole into the
cellular cytoplasm.
[0493] In one embodiment the invention features a lipid aggregate
formulation of the compounds described herein, including
phosphatidylcholine (of varying chain length; e.g., egg yolk
phosphatidylcholine), cholesterol, a cationic lipid, and
1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polythyleneglycol-2000
(DSPE-PEG2000). The cationic lipid component of this lipid
aggregate can be any cationic lipid known in the art such as
dioleoyl 1,2,-diacyl-3-trimethylammonium-propane (DOTAP). In
another embodiment this cationic lipid aggregate comprises a
covalently bound compound described in any of the Formulae
herein.
[0494] In another embodiment, polyethylene glycol (PEG) is
covalently attached to the compounds of the present invention. The
attached PEG can be any molecular weight but is preferably between
2000-50,000 daltons.
[0495] The compounds and methods of the present invention are
useful for introducing nucleotides, nucleosides, nucleic acid
molecules, lipids, peptides, proteins, and/or non-nucleosidic small
molecules into a cell. For example, the invention can be used for
nucleotide, nucleoside, nucleic acid, lipids, peptides, proteins,
and/or non-nucleosidic small molecule delivery where the
corresponding target site of action exists intracellularly.
[0496] In one embodiment, the compounds of the instant invention
provide conjugates of molecules that can interact with cellular
receptors, such as high affinity folate receptors and ASGPr
receptors, and provide a number of features that allow the
efficient delivery and subsequent release of conjugated compounds
across biological membranes. The compounds utilize chemical
linkages between the receptor ligand and the compound to be
delivered of length that can interact preferentially with cellular
receptors. Furthermore, the chemical linkages between the ligand
and the compound to be delivered can be designed as degradable
linkages, for example by utilizing a phosphate linkage that is
proximal to a nucleophile, such as a hydroxyl group. Deprotonation
of the hydroxyl group or an equivalent group, as a result of pH or
interaction with a nuclease, can result in nucleophilic attack of
the phosphate resulting in a cyclic phosphate intermediate that can
be hydrolyzed. This cleavage mechanism is analogous RNA cleavage in
the presence of a base or RNA nuclease. Alternately, other
degradable linkages can be selected that respond to various factors
such as UV irradiation, cellular nucleases, pH, temperature etc.
The use of degradable linkages allows the delivered compound to be
released in a predetermined system, for example in the cytoplasm of
a cell, or in a particular cellular organelle.
[0497] The present invention also provides ligand derived
phosphoramidites that are readily conjugated to compounds and
molecules of interest. Phosphoramidite compounds of the invention
permit the direct attachment of conjugates to molecules of interest
without the need for using nucleic acid phosphoramidite species as
scaffolds. As such, the used of phosphoramidite chemistry can be
used directly in coupling the compounds of the invention to a
compound of interest, without the need for other condensation
reactions, such as condensation of the ligand to an amino group on
the nucleic acid, for example at the N6 position of adenosine or a
2'-deoxy-2'-amino function. Additionally, compounds of the
invention can be used to introduce non-nucleic acid based
conjugated linkages into oligonucleotides that can provide more
efficient coupling during oligonucleotide synthesis than the use of
nucleic acid-based phosphoramidites. This improved coupling can
take into account improved steric considerations of abasic or
non-nucleosidic scaffolds bearing pendant alkyl linkages.
[0498] Compounds of the invention utilizing triphosphate groups can
be utilized in the enzymatic incorporation of conjugate molecules
into oligonucleotides. Such enzymatic incorporation is useful when
conjugates are used in post-synthetic enzymatic conjugation or
selection reactions, (see for example Matulic-Adamic et al., 2000,
Bioorg. Med. Chem. Lett., 10, 1299-1302; Lee et al., 2001, NAR.,
29, 1565-1573; Joyce, 1989, Gene, 82, 83-87; Beaudry et al., 1992,
Science 257, 635-641; Joyce, 1992, Scientific American 267, 90-97;
Breaker et al., 1994, TIBTECH 12, 268; Bartel et al., 1993, Science
261:1411-1418; Szostak, 1993, TIBS 17, 89-93; Kumar et al., 1995,
FASEB J., 9, 1183; Breaker, 1996, Curr. Op. Biotech., 7, 442;
Santoro et al., 1997, Proc. Natl. Acad. Sci., 94, 4262; Tang et
al., 1997, RNA 3, 914; Nakamaye & Eckstein, 1994, supra; Long
& Uhlenbeck, 1994, supra; Ishizaka et al., 1995, supra; Vaish
et al., 1997, Biochemistry 36, 6495; Kuwabara et al., 2000, Curr.
Opin. Chem. Biol., 4, 669).
[0499] The term "biodegradable linker" as used herein, refers to a
nucleic acid or non-nucleic acid linker molecule that is designed
as a biodegradable linker to connect one molecule to another
molecule, for example, a biologically active molecule to a siNA
molecule of the invention or the sense and antisense strands of a
siNA molecule of the invention. The biodegradable linker is
designed such that its stability can be modulated for a particular
purpose, such as delivery to a particular tissue or cell type. The
stability of a nucleic acid-based biodegradable linker molecule can
be modulated by using various chemistries, for example combinations
of ribonucleotides, deoxyribonucleotides, and chemically-modified
nucleotides, such as 2'-O-methyl, 2'-fluoro, 2'-amino, 2'-O-amino,
2'-C-allyl, 2'-O-allyl, and other 2'-modified or base modified
nucleotides. The biodegradable nucleic acid linker molecule can be
a dimer, trimer, tetramer or longer nucleic acid molecule, for
example, an oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, or
can comprise a single nucleotide with a phosphorus-based linkage,
for example, a phosphoramidate or phosphodiester linkage. The
biodegradable nucleic acid linker molecule can also comprise
nucleic acid backbone, nucleic acid sugar, or nucleic acid base
modifications.
[0500] The term "biodegradable" as used herein, refers to
degradation in a biological system, for example enzymatic
degradation or chemical degradation.
[0501] The term "biologically active molecule" as used herein,
refers to compounds or molecules that are capable of eliciting or
modifying a biological response in a system. Non-limiting examples
of biologically active siNA molecules either alone or in
combination with other molecules contemplated by the instant
invention include therapeutically active molecules such as
antibodies, cholesterol, hormones, antivirals, peptides, proteins,
chemotherapeutics, small molecules, vitamins, co-factors,
nucleosides, nucleotides, oligonucleotides, enzymatic nucleic
acids, antisense nucleic acids, triplex forming oligonucleotides,
2,5-A chimeras, siNA, dsRNA, allozymes, aptamers, decoys and
analogs thereof. Biologically active molecules of the invention
also include molecules capable of modulating the pharmacokinetics
and/or pharmacodynamics of other biologically active molecules, for
example, lipids and polymers such as polyamines, polyamides,
polyethylene glycol and other polyethers.
[0502] The term "phospholipid" as used herein, refers to a
hydrophobic molecule comprising at least one phosphorus group. For
example, a phospholipid can comprise a phosphorus-containing group
and saturated or unsaturated alkyl group, optionally substituted
with OH, COOH, oxo, amine, or substituted or unsubstituted aryl
groups.
[0503] The term "alkyl" as used herein refers to a saturated
aliphatic hydrocarbon, including straight-chain, branched-chain
"isoalkyl", and cyclic alkyl groups. The term "alkyl" also
comprises alkoxy, alkyl-thio, alkyl-thio-alkyl, alkoxyalkyl,
alkylamino, alkenyl, alkynyl, alkoxy, cycloalkenyl, cycloalkyl,
cycloalkylalkyl, heterocycloalkyl, heteroaryl, C1-C6 hydrocarbyl,
aryl or substituted aryl groups. Preferably, the alkyl group has 1
to 12 carbons. More preferably it is a lower alkyl of from about 1
to about 7 carbons, more preferably about 1 to about 4 carbons. The
alkyl group can be substituted or unsubstituted. When substituted
the substituted group(s) preferably comprise hydroxy, oxy, thio,
amino, nitro, cyano, alkoxy, alkyl-thio, alkyl-thio-alkyl,
alkoxyalkyl, alkylamino, silyl, alkenyl, alkynyl, alkoxy,
cycloalkenyl, cycloalkyl, cycloalkylalkyl, heterocycloalkyl,
heteroaryl, C1-C6 hydrocarbyl, aryl or substituted aryl groups. The
term "alkyl" also includes alkenyl groups containing at least one
carbon-carbon double bond, including straight-chain,
branched-chain, and cyclic groups. Preferably, the alkenyl group
has about 2 to about 12 carbons. More preferably it is a lower
alkenyl of from about 2 to about 7 carbons, more preferably about 2
to about 4 carbons. The alkenyl group can be substituted or
unsubstituted. When substituted the substituted group(s) preferably
comprise hydroxy, oxy, thio, amino, nitro, cyano, alkoxy,
alkyl-thio, alkyl-thio-alkyl, alkoxyalkyl, alkylamino, silyl,
alkenyl, alkynyl, alkoxy, cycloalkenyl, cycloalkyl,
cycloalkylalkyl, heterocycloalkyl, heteroaryl, C1-C6 hydrocarbyl,
aryl or substituted aryl groups. The term "alkyl" also includes
alkynyl groups containing at least one carbon-carbon triple bond,
including straight-chain, branched-chain, and cyclic groups.
Preferably, the alkynyl group has about 2 to about 12 carbons. More
preferably it is a lower alkynyl of from about 2 to about 7
carbons, more preferably about 2 to about 4 carbons. The alkynyl
group can be substituted or unsubstituted. When substituted the
substituted group(s) preferably comprise hydroxy, oxy, thio, amino,
nitro, cyano, alkoxy, alkyl-thio, alkyl-thio-alkyl, alkoxyalkyl,
alkylamino, silyl, alkenyl, alkynyl, alkoxy, cycloalkenyl,
cycloalkyl, cycloalkylalkyl, heterocycloalkyl, heteroaryl, C1-C6
hydrocarbyl, aryl or substituted aryl groups. Alkyl groups or
moieties of the invention can also include aryl, alkylaryl,
carbocyclic aryl, heterocyclic aryl, amide and ester groups. The
preferred substituent(s) of aryl groups are halogen, trihalomethyl,
hydroxyl, SH, OH, cyano, alkoxy, alkyl, alkenyl, alkynyl, and amino
groups. An "alkylaryl" group refers to an alkyl group (as described
above) covalently joined to an aryl group (as described above).
Carbocyclic aryl groups are groups wherein the ring atoms on the
aromatic ring are all carbon atoms. The carbon atoms are optionally
substituted. Heterocyclic aryl groups are groups having from about
1 to about 3 heteroatoms as ring atoms in the aromatic ring and the
remainder of the ring atoms are carbon atoms. Suitable heteroatoms
include oxygen, sulfur, and nitrogen, and include furanyl, thienyl,
pyridyl, pyrrolyl, N-lower alkyl pyrrolo, pyrimidyl, pyrazinyl,
imidazolyl and the like, all optionally substituted. An "amide"
refers to an --C(O)--NH--R, where R is either alkyl, aryl,
alkylaryl or hydrogen. An "ester" refers to an --C(O)--OR', where R
is either alkyl, aryl, alkylaryl or hydrogen.
[0504] The term "alkoxyalkyl" as used herein refers to an
alkyl-O-alkyl ether, for example, methoxyethyl or ethoxymethyl.
[0505] The term "alkyl-thio-alkyl" as used herein refers to an
alkyl-S-alkyl thioether, for example, methylthiomethyl or
methylthioethyl.
[0506] The term "amino" as used herein refers to a nitrogen
containing group as is known in the art derived from ammonia by the
replacement of one or more hydrogen radicals by organic radicals.
For example, the terms "aminoacyl" and "aminoalkyl" refer to
specific N-substituted organic radicals with acyl and alkyl
substituent groups respectively.
[0507] The term "amination" as used herein refers to a process in
which an amino group or substituted amine is introduced into an
organic molecule.
[0508] The term "exocyclic amine protecting moiety" as used herein
refers to a nucleobase amino protecting group compatible with
oligonucleotide synthesis, for example, an acyl or amide group.
[0509] The term "alkenyl" as used herein refers to a straight or
branched hydrocarbon of a designed number of carbon atoms
containing at least one carbon-carbon double bond. Examples of
"alkenyl" include vinyl, allyl, and 2-methyl-3-heptene.
[0510] The term "alkoxy" as used herein refers to an alkyl group of
indicated number of carbon atoms attached to the parent molecular
moiety through an oxygen bridge. Examples of alkoxy groups include,
for example, methoxy, ethoxy, propoxy and isopropoxy.
[0511] The term "alkynyl" as used herein refers to a straight or
branched hydrocarbon of a designed number of carbon atoms
containing at least one carbon-carbon triple bond. Examples of
"alkynyl" include propargyl, propyne, and 3-hexyne.
[0512] The term "aryl" as used herein refers to an aromatic
hydrocarbon ring system containing at least one aromatic ring. The
aromatic ring can optionally be fused or otherwise attached to
other aromatic hydrocarbon rings or non-aromatic hydrocarbon rings.
Examples of aryl groups include, for example, phenyl, naphthyl,
1,2,3,4-tetrahydronaphthalene and biphenyl. Preferred examples of
aryl groups include phenyl and naphthyl.
[0513] The term "cycloalkenyl" as used herein refers to a C3-C8
cyclic hydrocarbon containing at least one carbon-carbon double
bond. Examples of cycloalkenyl include cyclopropenyl, cyclobutenyl,
cyclopentenyl, cyclopentadiene, cyclohexenyl, 1,3-cyclohexadiene,
cycloheptenyl, cycloheptatrienyl, and cyclooctenyl.
[0514] The term "cycloalkyl" as used herein refers to a C3-C8
cyclic hydrocarbon. Examples of cycloalkyl include cyclopropyl,
cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and
cyclooctyl.
[0515] The term "cycloalkylalkyl," as used herein, refers to a
C3-C7 cycloalkyl group attached to the parent molecular moiety
through an alkyl group, as defined above. Examples of
cycloalkylalkyl groups include cyclopropylmethyl and
cyclopentylethyl.
[0516] The terms "halogen" or "halo" as used herein refers to
indicate fluorine, chlorine, bromine, and iodine.
[0517] The term "heterocycloalkyl," as used herein refers to a
non-aromatic ring system containing at least one heteroatom
selected from nitrogen, oxygen, and sulfur. The heterocycloalkyl
ring can be optionally fused to or otherwise attached to other
heterocycloalkyl rings and/or non-aromatic hydrocarbon rings.
Preferred heterocycloalkyl groups have from 3 to 7 members.
Examples of heterocycloalkyl groups include, for example,
piperazine, morpholine, piperidine, tetrahydrofuran, pyrrolidine,
and pyrazole. Preferred heterocycloalkyl groups include
piperidinyl, piperazinyl, morpholinyl, and pyrolidinyl.
[0518] The term "heteroaryl" as used herein refers to an aromatic
ring system containing at least one heteroatom selected from
nitrogen, oxygen, and sulfur. The heteroaryl ring can be fused or
otherwise attached to one or more heteroaryl rings, aromatic or
non-aromatic hydrocarbon rings or heterocycloalkyl rings. Examples
of heteroaryl groups include, for example, pyridine, furan,
thiophene, 5,6,7,8-tetrahydroisoquinoline and pyrimidine. Preferred
examples of heteroaryl groups include thienyl, benzothienyl,
pyridyl, quinolyl, pyrazinyl, pyrimidyl, imidazolyl,
benzimidazolyl, furanyl, benzofuranyl, thiazolyl, benzothiazolyl,
isoxazolyl, oxadiazolyl, isothiazolyl, benzisothiazolyl, triazolyl,
tetrazolyl, pyrrolyl, indolyl, pyrazolyl, and benzopyrazolyl.
[0519] The term "C1-C6 hydrocarbyl" as used herein refers to
straight, branched, or cyclic alkyl groups having 1-6 carbon atoms,
optionally containing one or more carbon-carbon double or triple
bonds. Examples of hydrocarbyl groups include, for example, methyl,
ethyl, propyl, isopropyl, n-butyl, sec-butyl, tert-butyl, pentyl,
2-pentyl, isopentyl, neopentyl, hexyl, 2-hexyl, 3-hexyl,
3-methylpentyl, vinyl, 2-pentene, cyclopropylmethyl, cyclopropyl,
cyclohexylmethyl, cyclohexyl and propargyl. When reference is made
herein to C1-C6 hydrocarbyl containing one or two double or triple
bonds it is understood that at least two carbons are present in the
alkyl for one double or triple bond, and at least four carbons for
two double or triple bonds.
[0520] The term "protecting group" as used herein, refers to groups
known in the art that are readily introduced and removed from an
atom, for example O, N, P, or S. Protecting groups are used to
prevent undesirable reactions from taking place that can compete
with the formation of a specific compound or intermediate of
interest. See also "Protective Groups in Organic Synthesis", 3rd
Ed., 1999, Greene, T. W. and related publications.
[0521] The term "nitrogen protecting group," as used herein, refers
to groups known in the art that are readily introduced on to and
removed from a nitrogen. Examples of nitrogen protecting groups
include Boc, Cbz, benzoyl, and benzyl. See also "Protective Groups
in Organic Synthesis", 3rd Ed., 1999, Greene, T. W. and related
publications.
[0522] The term "hydroxy protecting group," or "hydroxy protection"
as used herein, refers to groups known in the art that are readily
introduced on to and removed from an oxygen, specifically an --OH
group. Examples of hyroxy protecting groups include trityl or
substituted trityl goups, such as monomethoxytrityl and
dimethoxytrityl, or substituted silyl groups, such as
tert-butyldimethyl, trimethylsilyl, or tert-butyldiphenyl silyl
groups. See also "Protective Groups in Organic Synthesis", 3rd Ed.,
1999, Greene, T. W. and related publications.
[0523] The term "acyl" as used herein refers to --C(O)R groups,
wherein R is an alkyl or aryl.
[0524] The term "phosphorus containing group" as used herein,
refers to a chemical group containing a phosphorus atom. The
phosphorus atom can be trivalent or pentavalent, and can be
substituted with O, H, N, S, C or halogen atoms. Examples of
phosphorus containing groups of the instant invention include but
are not limited to phosphorus atoms substituted with O, H, N, S, C
or halogen atoms, comprising phosphonate, alkylphosphonate,
phosphate, diphosphate, triphosphate, pyrophosphate,
phosphorothioate, phosphorodithioate, phosphoramidate,
phosphoramidite groups, nucleotides and nucleic acid molecules.
[0525] The term "phosphine" or "phosphite" as used herein refers to
a trivalent phosphorus species, for example compounds having
Formula 97: ##STR92## [0526] wherein R can include the groups:
##STR93## [0527] and wherein S and T independently include the
groups: ##STR94##
[0528] The term "phosphate" as used herein refers to a pentavalent
phosphorus species, for example a compound having Formula 98:
##STR95## [0529] wherein R includes the groups: ##STR96##
[0530] and wherein S and T each independently can be a sulfur or
oxygen atom or a group which can include: ##STR97## and wherein M
comprises a sulfur or oxygen atom. The phosphate of the invention
can comprise a nucleotide phosphate, wherein any R, S, or T in
Formula 98 comprises a linkage to a nucleic acid or nucleoside.
[0531] The term "cationic salt" as used herein refers to any
organic or inorganic salt having a net positive charge, for example
a triethylammonium (TEA) salt.
[0532] The term "degradable linker" as used herein, refers to
linker moieties that are capable of cleavage under various
conditions. Conditions suitable for cleavage can include but are
not limited to pH, UV irradiation, enzymatic activity, temperature,
hydrolysis, elimination, and substitution reactions, and
thermodynamic properties of the linkage.
[0533] The term "photolabile linker" as used herein, refers to
linker moieties as are known in the art, that are selectively
cleaved under particular UV wavelengths. Compounds of the invention
containing photolabile linkers can be used to deliver compounds to
a target cell or tissue of interest, and can be subsequently
released in the presence of a UV source.
[0534] The term "nucleic acid conjugates" as used herein, refers to
nucleoside, nucleotide and oligonucleotide conjugates.
[0535] The term "lipid" as used herein, refers to any lipophilic
compound. Non-limiting examples of lipid compounds include fatty
acids and their derivatives, including straight chain, branched
chain, saturated and unsaturated fatty acids, carotenoids,
terpenes, bile acids, and steroids, including cholesterol and
derivatives or analogs thereof.
[0536] The term "folate" as used herein, refers to analogs and
derivatives of folic acid, for example antifolates, dihydrofloates,
tetrahydrofolates, tetrahydorpterins, folinic acid,
pteropolyglutamic acid, 1-deza, 3-deaza, 5-deaza, 8-deaza,
10-deaza, 1,5-deaza, 5,10 dideaza, 8,10-dideaza, and 5,8-dideaza
folates, antifolates, and pteroic acid derivatives.
[0537] The term "compounds with neutral charge" as used herein,
refers to compositions which are neutral or uncharged at neutral or
physiological pH. Examples of such compounds are cholesterol and
other steroids, cholesteryl hemisuccinate (CHEMS), dioleoyl
phosphatidyl choline, distearoylphosphotidyl choline (DSPC), fatty
acids such as oleic acid, phosphatidic acid and its derivatives,
phosphatidyl serine, polyethylene glycol-conjugated
phosphatidylamine, phosphatidylcholine, phosphatidylethanolamine
and related variants, prenylated compounds including farnesol,
polyprenols, tocopherol, and their modified forms, diacylsuccinyl
glycerols, fusogenic or pore forming peptides,
dioleoylphosphotidylethanolamine (DOPE), ceramide and the like.
[0538] The term "lipid aggregate" as used herein refers to a
lipid-containing composition wherein the lipid is in the form of a
liposome, micelle (non-lamellar phase) or other aggregates with one
or more lipids.
[0539] The term "nitrogen containing group" as used herein refers
to any chemical group or moiety comprising a nitrogen or
substituted nitrogen. Non-limiting examples of nitrogen containing
groups include amines, substituted amines, amides, alkylamines,
amino acids such as arginine or lysine, polyamines such as spermine
or spermidine, cyclic amines such as pyridines, pyrimidines
including uracil, thymine, and cytosine, morpholines, phthalimides,
and heterocyclic amines such as purines, including guanine and
adenine.
[0540] Therapeutic nucleic acid molecules (e.g., siNA molecules)
delivered exogenously optimally are stable within cells until
reverse transcription of the RNA has been modulated long enough to
reduce the levels of the RNA transcript. The nucleic acid molecules
are resistant to nucleases in order to function as effective
intracellular therapeutic agents. Improvements in the chemical
synthesis of nucleic acid molecules described in the instant
invention and in the art have expanded the ability to modify
nucleic acid molecules by introducing nucleotide modifications to
enhance their nuclease stability as described above.
[0541] In yet another embodiment, siNA molecules having chemical
modifications that maintain or enhance enzymatic activity of
proteins involved in RNAi are provided. Such nucleic acids are also
generally more resistant to nucleases than unmodified nucleic
acids. Thus, in vitro and/or in vivo the activity should not be
significantly lowered.
[0542] Use of the nucleic acid-based molecules of the invention
will lead to better treatment of the disease progression by
affording the possibility of combination therapies (e.g., multiple
siNA molecules targeted to different genes; nucleic acid molecules
coupled with known small molecule modulators; or intermittent
treatment with combinations of molecules, including different
motifs and/or other chemical or biological molecules). The
treatment of subjects with siNA molecules can also include
combinations of different types of nucleic acid molecules, such as
enzymatic nucleic acid molecules (ribozymes), allozymes, antisense,
2,5-A oligoadenylate, decoys, and aptamers.
[0543] In another aspect a siNA molecule of the invention comprises
one or more 5' and/or a 3'-cap structure, for example on only the
sense siNA strand, the antisense siNA strand, or both siNA
strands.
[0544] By "cap structure" is meant chemical modifications, which
have been incorporated at either terminus of the oligonucleotide
(see, for example, Adamic et al., U.S. Pat. No. 5,998,203,
incorporated by reference herein). These terminal modifications
protect the nucleic acid molecule from exonuclease degradation, and
can help in delivery and/or localization within a cell. The cap can
be present at the 5'-terminus (5'-cap) or at the 3'-terminal
(3'-cap) or can be present on both termini. Non-limiting examples
of the 5'-cap include, but are not limited to, glyceryl, inverted
deoxy abasic residue (moiety); 4',5'-methylene nucleotide;
1-(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide;
carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide;
L-nucleotides; alpha-nucleotides; modified base nucleotide;
phosphorodithioate linkage; threo-pentofuranosyl nucleotide;
acyclic 3',4'-seco nucleotide; acyclic 3,4-dihydroxybutyl
nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3'-3'-inverted
nucleotide moiety; 3'-3'-inverted abasic moiety; 3'-2'-inverted
nucleotide moiety; 3'-2'-inverted abasic moiety; 1,4-butanediol
phosphate; 3'-phosphoramidate; hexylphosphate; aminohexyl
phosphate; 3'-phosphate; 3'-phosphorothioate; phosphorodithioate;
or bridging or non-bridging methylphosphonate moiety.
[0545] Non-limiting examples of the 3'-cap include, but are not
limited to, glyceryl, inverted deoxy abasic residue (moiety),
4',5'-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide;
4'-thio nucleotide, carbocyclic nucleotide; 5'-amino-alkyl
phosphate; 1,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate;
6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl
phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide;
alpha-nucleotide; modified base nucleotide; phosphorodithioate;
threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide;
3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide,
5'-5'-inverted nucleotide moiety; 5'-5'-inverted abasic moiety;
5'-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate;
5'-amino; bridging and/or non-bridging 5'-phosphoramidate,
phosphorothioate and/or phosphorodithioate, bridging or non
bridging methylphosphonate and 5'-mercapto moieties (for more
details see Beaucage and Iyer, 1993, Tetrahedron 49, 1925;
incorporated by reference herein).
[0546] By the term "non-nucleotide" is meant any group or compound
which can be incorporated into a nucleic acid chain in the place of
one or more nucleotide units, including either sugar and/or
phosphate substitutions, and allows the remaining bases to exhibit
their enzymatic activity. The group or compound is abasic in that
it does not contain a commonly recognized nucleotide base, such as
adenosine, guanine, cytosine, uracil or thymine and therefore lacks
a base at the 1'-position.
[0547] By "nucleotide" as used herein is as recognized in the art
to include natural bases (standard), and modified bases well known
in the art. Such bases are generally located at the 1' position of
a nucleotide sugar moiety. Nucleotides generally comprise a base,
sugar and a phosphate group. The nucleotides can be unmodified or
modified at the sugar, phosphate and/or base moiety, (also referred
to interchangeably as nucleotide analogs, modified nucleotides,
non-natural nucleotides, non-standard nucleotides and other; see,
for example, Usman and McSwiggen, supra; Eckstein et al.,
International PCT Publication No. WO 92/07065; Usman et al.,
International PCT Publication No. WO 93/15187; Uhlman & Peyman,
supra, all are hereby incorporated by reference herein). There are
several examples of modified nucleic acid bases known in the art as
summarized by Limbach et al., 1994, Nucleic Acids Res. 22, 2183.
Some of the non-limiting examples of base modifications that can be
introduced into nucleic acid molecules include, inosine, purine,
pyridin-4-one, pyridin-2-one, phenyl, pseudouracil,
2,4,6-trimethoxy benzene, 3-methyl uracil, dihydrouridine,
naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine),
5-alkyluridines (e.g., ribothymidine), 5-halouridine (e.g.,
5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g.
6-methyluridine), propyne, and others (Burgin et al., 1996,
Biochemistry, 35, 14090; Uhlman & Peyman, supra). By "modified
bases" in this aspect is meant nucleotide bases other than adenine,
guanine, cytosine and uracil at 1' position or their
equivalents.
[0548] In one embodiment, the invention features modified siNA
molecules, with phosphate backbone modifications comprising one or
more phosphorothioate, phosphorodithioate, methylphosphonate,
phosphotriester, morpholino, amidate carbamate, carboxymethyl,
acetamidate, polyamide, sulfonate, sulfonamide, sulfamate,
formacetal, thioformacetal, and/or alkylsilyl, substitutions. For a
review of oligonucleotide backbone modifications, see Hunziker and
Leumann, 1995, Nucleic Acid Analogues: Synthesis and Properties, in
Modern Synthetic Methods, VCH, 331-417, and Mesmaeker et al., 1994,
Novel Backbone Replacements for Oligonucleotides, in Carbohydrate
Modifications in Antisense Research, ACS, 24-39.
[0549] By "abasic" is meant sugar moieties lacking a base or having
other chemical groups in place of a base at the 1' position, see
for example Adamic et al., U.S. Pat. No. 5,998,203.
[0550] By "unmodified nucleoside" is meant one of the bases
adenine, cytosine, guanine, thymine, or uracil joined to the 1'
carbon of .beta.-D-ribo-furanose.
[0551] By "modified nucleoside" is meant any nucleotide base which
contains a modification in the chemical structure of an unmodified
nucleotide base, sugar and/or phosphate. Non-limiting examples of
modified nucleotides are shown by Formulae I-VII and/or other
modifications described herein.
[0552] In connection with 2'-modified nucleotides as described for
the present invention, by "amino" is meant 2'-NH2 or
2'-O--NH.sub.2, which can be modified or unmodified. Such modified
groups are described, for example, in Eckstein et al., U.S. Pat.
No. 5,672,695 and Matulic-Adamic et al., U.S. Pat. No. 6,248,878,
which are both incorporated by reference in their entireties.
[0553] Various modifications to nucleic acid siNA structure can be
made to enhance the utility of these molecules. Such modifications
will enhance shelf-life, half-life in vitro, stability, and ease of
introduction of such oligonucleotides to the target site, e.g., to
enhance penetration of cellular membranes, and confer the ability
to recognize and bind to targeted cells.
Administration of Nucleic Acid Molecules
[0554] A siNA molecule of the invention can be adapted for use to
treat any disease, infection or condition associated with gene
expression, and other indications that can respond to the level of
gene product in a cell or tissue, alone or in combination with
other therapies. For example, a siNA molecule can comprise a
delivery vehicle, including liposomes, for administration to a
subject, carriers and diluents and their salts, and/or can be
present in pharmaceutically acceptable formulations. Methods for
the delivery of nucleic acid molecules are described in Akhtar et
al., 1992, Trends Cell Bio., 2, 139; Delivery Strategies for
Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995, Maurer et
al., 1999, Mol. Membr. Biol., 16, 129-140; Hofland and Huang, 1999,
Handb. Exp. Pharmacol., 137, 165-192; and Lee et al., 2000, ACS
Symp. Ser., 752, 184-192, all of which are incorporated herein by
reference. Beigelman et al., U.S. Pat. No. 6,395,713 and Sullivan
et al., PCT WO 94/02595 further describe the general methods for
delivery of nucleic acid molecules. These protocols can be utilized
for the delivery of virtually any nucleic acid molecule. Nucleic
acid molecules can be administered to cells by a variety of methods
known to those of skill in the art, including, but not restricted
to, encapsulation in liposomes, by iontophoresis, or by
incorporation into other vehicles, such as biodegradable polymers,
hydrogels, cyclodextrins (see for example Gonzalez et al., 1999,
Bioconjugate Chem., 10, 1068-1074), poly(lactic-co-glycolic)acid
(PLGA) and PLCA microspheres (see for example U.S. Pat. No.
6,447,796 and US Patent Application Publication No. US 2002130430),
biodegradable nanocapsules, and bioadhesive microspheres, or by
proteinaceous vectors (O'Hare and Normand, International PCT
Publication No. WO 00/53722). Alternatively, the nucleic
acid/vehicle combination is locally delivered by direct injection
or by use of an infusion pump. Direct injection of the nucleic acid
molecules of the invention, whether subcutaneous, intramuscular, or
intradermal, can take place using standard needle and syringe
methodologies, or by needle-free technologies such as those
described in Conry et al., 1999, Clin. Cancer Res., 5, 2330-2337
and Barry et al., International PCT Publication No. WO 99/31262.
Many examples in the art describe CNS delivery methods of
oligonucleotides by osmotic pump, (see Chun et al., 1998,
Neuroscience Letters, 257, 135-138, D'Aldin et al., 1998, Mol.
Brain Research, 55, 151-164, Dryden et al., 1998, J. Endocrinol.,
157, 169-175, Ghirnikar et al., 1998, Neuroscience Letters, 247,
21-24) or direct infusion (Broaddus et al., 1997, Neurosurg. Focus,
3, article 4). Other routes of delivery include, but are not
limited to oral (tablet or pill form) and/or intrathecal delivery
(Gold, 1997, Neuroscience, 76, 1153-1158). More detailed
descriptions of nucleic acid delivery and administration are
provided in Sullivan et al., supra, Draper et al., PCT WO93/23569,
Beigelman et al., PCT WO99/05094, and Klimuk et al., PCT WO99/04819
all of which have been incorporated by reference herein. The
molecules of the instant invention can be used as pharmaceutical
agents. Pharmaceutical agents prevent, modulate the occurrence, or
treat (alleviate a symptom to some extent, preferably all of the
symptoms) of a disease state in a subject.
[0555] In addition, the invention features the use of methods to
deliver the nucleic acid molecules of the instant invention to
hematopoietic cells, including monocytes and lymphocytes. These
methods are described in detail by Hartmann et al., 1998, J.
Phamacol. Exp. Ther., 285(2), 920-928; Kronenwett et al., 1998,
Blood, 91(3), 852-862; Filion and Phillips, 1997, Biochim. Biophys.
Acta., 1329(2), 345-356; Ma and Wei, 1996, Leuk. Res., 20(11/12),
925-930; and Bongartz et al., 1994, Nucleic Acids Research, 22(22),
4681-8. Such methods, as described above, include the use of free
oligonucleitide, cationic lipid formulations, liposome formulations
including pH sensitive liposomes and immunoliposomes, and
bioconjugates including oligonucleotides conjugated to fusogenic
peptides, for the transfection of hematopoietic cells with
oligonucleotides.
[0556] Thus, the invention features a pharmaceutical composition
comprising one or more nucleic acid(s) of the invention in an
acceptable carrier, such as a stabilizer, buffer, and the like. The
polynucleotides of the invention can be administered (e.g., RNA,
DNA or protein) and introduced into a subject by any standard
means, with or without stabilizers, buffers, and the like, to form
a pharmaceutical composition. When it is desired to use a liposome
delivery mechanism, standard protocols for formation of liposomes
can be followed. The compositions of the present invention can also
be formulated and used as tablets, capsules or elixirs for oral
administration, suppositories for rectal administration, sterile
solutions, suspensions for injectable administration, and the other
compositions known in the art.
[0557] The present invention also includes pharmaceutically
acceptable formulations of the compounds described. These
formulations include salts of the above compounds, e.g., acid
addition salts, for example, salts of hydrochloric, hydrobromic,
acetic acid, and benzene sulfonic acid.
[0558] A pharmacological composition or formulation refers to a
composition or formulation in a form suitable for administration,
e.g., systemic administration, into a cell or subject, including
for example a human. Suitable forms, in part, depend upon the use
or the route of entry, for example oral, transdermal, or by
injection. Such forms should not prevent the composition or
formulation from reaching a target cell (i.e., a cell to which the
negatively charged nucleic acid is desirable for delivery). For
example, pharmacological compositions injected into the blood
stream should be soluble. Other factors are known in the art, and
include considerations such as toxicity and forms that prevent the
composition or formulation from exerting its effect.
[0559] By "systemic administration" is meant in vivo systemic
absorption or accumulation of drugs in the blood stream followed by
distribution throughout the entire body. Administration routes that
lead to systemic absorption include, without limitation:
intravenous, subcutaneous, intraperitoneal, inhalation, oral,
intrapulmonary and intramuscular. Each of these administration
routes exposes the siNA molecules of the invention to an accessible
diseased tissue. The rate of entry of a drug into the circulation
has been shown to be a function of molecular weight or size. The
use of a liposome or other drug carrier comprising the compounds of
the instant invention can potentially localize the drug, for
example, in certain tissue types, such as the tissues of the
reticular endothelial system (RES). A liposome formulation that can
facilitate the association of drug with the surface of cells, such
as, lymphocytes and macrophages is also useful. This approach can
provide enhanced delivery of the drug to target cells by taking
advantage of the specificity of macrophage and lymphocyte immune
recognition of abnormal cells, such as cancer cells.
[0560] By "pharmaceutically acceptable formulation" is meant a
composition or formulation that allows for the effective
distribution of the nucleic acid molecules of the instant invention
in the physical location most suitable for their desired activity.
Non-limiting examples of agents suitable for formulation with the
nucleic acid molecules of the instant invention include:
P-glycoprotein inhibitors (such as Pluronic P85), which can enhance
entry of drugs into the CNS (Jolliet-Riant and Tillement, 1999,
Fundam. Clin. Pharmacol., 13, 16-26); biodegradable polymers, such
as poly(DL-lactide-coglycolide) microspheres for sustained release
delivery after intracerebral implantation (Emerich, D F et al,
1999, Cell Transplant, 8, 47-58) (Alkermes, Inc. Cambridge, Mass.);
and loaded nanoparticles, such as those made of
polybutylcyanoacrylate, which can deliver drugs across the blood
brain barrier and can alter neuronal uptake mechanisms (Prog
Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999). Other
non-limiting examples of delivery strategies for the nucleic acid
molecules of the instant invention include material described in
Boado et al., 1998, J. Pharm. Sci., 87, 1308-1315; Tyler et al.,
1999, FEBS Lett., 421, 280-284; Pardridge et al., 1995, PNAS USA.,
92, 5592-5596; Boado, 1995, Adv. Drug Delivery Rev., 15, 73-107;
Aldrian-Herrada et al., 1998, Nucleic Acids Res., 26, 4910-4916;
and Tyler et al., 1999, PNAS USA., 96, 7053-7058.
[0561] The invention also features the use of the composition
comprising surface-modified liposomes containing poly(ethylene
glycol) lipids (PEG-modified, or long-circulating liposomes or
stealth liposomes). These formulations offer a method for
increasing the accumulation of drugs in target tissues. This class
of drug carriers resists opsonization and elimination by the
mononuclear phagocytic system (MPS or RES), thereby enabling longer
blood circulation times and enhanced tissue exposure for the
encapsulated drug (Lasic et al. Chem. Rev. 1995, 95, 2601-2627;
Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011). Such
liposomes have been shown to accumulate selectively in tumors,
presumably by extravasation and capture in the neovascularized
target tissues (Lasic et al., Science 1995, 267, 1275-1276; Oku et
al., 1995, Biochim. Biophys. Acta, 1238, 86-90). The
long-circulating liposomes enhance the pharmacokinetics and
pharmacodynamics of DNA and RNA, particularly compared to
conventional cationic liposomes which are known to accumulate in
tissues of the MPS (Liu et al., J. Biol. Chem. 1995, 42,
24864-24870; Choi et al., International PCT Publication No. WO
96/10391; Ansell et al., International PCT Publication No. WO
96/10390; Holland et al., International PCT Publication No. WO
96/10392). Long-circulating liposomes are also likely to protect
drugs from nuclease degradation to a greater extent compared to
cationic liposomes, based on their ability to avoid accumulation in
metabolically aggressive MPS tissues such as the liver and
spleen.
[0562] The present invention also includes compositions prepared
for storage or administration that include a pharmaceutically
effective amount of the desired compounds in a pharmaceutically
acceptable carrier or diluent. Acceptable carriers or diluents for
therapeutic use are well known in the pharmaceutical art, and are
described, for example, in Remington's Pharmaceutical Sciences,
Mack Publishing Co. (A. R. Gennaro edit. 1985), hereby incorporated
by reference herein. For example, preservatives, stabilizers, dyes
and flavoring agents can be provided. These include sodium
benzoate, sorbic acid and esters of p-hydroxybenzoic acid. In
addition, antioxidants and suspending agents can be used.
[0563] A pharmaceutically effective dose is that dose required to
prevent, inhibit the occurrence, or treat (alleviate a symptom to
some extent, preferably all of the symptoms) of a disease state.
The pharmaceutically effective dose depends on the type of disease,
the composition used, the route of administration, the type of
mammal being treated, the physical characteristics of the specific
mammal under consideration, concurrent medication, and other
factors that those skilled in the medical arts will recognize.
Generally, an amount between 0.1 mg/kg and 100 mg/kg body
weight/day of active ingredients is administered dependent upon
potency of the negatively charged polymer.
[0564] The nucleic acid molecules of the invention and formulations
thereof can be administered orally, topically, parenterally, by
inhalation or spray, or rectally in dosage unit formulations
containing conventional non-toxic pharmaceutically acceptable
carriers, adjuvants and/or vehicles. The term parenteral as used
herein includes percutaneous, subcutaneous, intravascular (e.g.,
intravenous), intramuscular, or intrathecal injection or infusion
techniques and the like. In addition, there is provided a
pharmaceutical formulation comprising a nucleic acid molecule of
the invention and a pharmaceutically acceptable carrier. One or
more nucleic acid molecules of the invention can be present in
association with one or more non-toxic pharmaceutically acceptable
carriers and/or diluents and/or adjuvants, and if desired other
active ingredients. The pharmaceutical compositions containing
nucleic acid molecules of the invention can be in a form suitable
for oral use, for example, as tablets, troches, lozenges, aqueous
or oily suspensions, dispersible powders or granules, emulsion,
hard or soft capsules, or syrups or elixirs.
[0565] Compositions intended for oral use can be prepared according
to any method known to the art for the manufacture of
pharmaceutical compositions and such compositions can contain one
or more such sweetening agents, flavoring agents, coloring agents
or preservative agents in order to provide pharmaceutically elegant
and palatable preparations. Tablets contain the active ingredient
in admixture with non-toxic pharmaceutically acceptable excipients
that are suitable for the manufacture of tablets. These excipients
can be, for example, inert diluents; such as calcium carbonate,
sodium carbonate, lactose, calcium phosphate or sodium phosphate;
granulating and disintegrating agents, for example, corn starch, or
alginic acid; binding agents, for example starch, gelatin or
acacia; and lubricating agents, for example magnesium stearate,
stearic acid or talc. The tablets can be uncoated or they can be
coated by known techniques. In some cases such coatings can be
prepared by known techniques to delay disintegration and absorption
in the gastrointestinal tract and thereby provide a sustained
action over a longer period. For example, a time delay material
such as glyceryl monosterate or glyceryl distearate can be
employed.
[0566] Formulations for oral use can also be presented as hard
gelatin capsules wherein the active ingredient is mixed with an
inert solid diluent, for example, calcium carbonate, calcium
phosphate or kaolin, or as soft gelatin capsules wherein the active
ingredient is mixed with water or an oil medium, for example peanut
oil, liquid paraffin or olive oil.
[0567] Aqueous suspensions contain the active materials in a
mixture with excipients suitable for the manufacture of aqueous
suspensions. Such excipients are suspending agents, for example
sodium carboxymethylcellulose, methylcellulose,
hydropropylmethylcellulose, sodium alginate, polyvinylpyrrolidone,
gum tragacanth and gum acacia; dispersing or wetting agents can be
a naturally-occurring phosphatide, for example, lecithin, or
condensation products of an alkylene oxide with fatty acids, for
example polyoxyethylene stearate, or condensation products of
ethylene oxide with long chain aliphatic alcohols, for example
heptadecaethyleneoxycetanol, or condensation products of ethylene
oxide with partial esters derived from fatty acids and a hexitol
such as polyoxyethylene sorbitol monooleate, or condensation
products of ethylene oxide with partial esters derived from fatty
acids and hexitol anhydrides, for example polyethylene sorbitan
monooleate. The aqueous suspensions can also contain one or more
preservatives, for example ethyl, or n-propyl p-hydroxybenzoate,
one or more coloring agents, one or more flavoring agents, and one
or more sweetening agents, such as sucrose or saccharin.
[0568] Oily suspensions can be formulated by suspending the active
ingredients in a vegetable oil, for example arachis oil, olive oil,
sesame oil or coconut oil, or in a mineral oil such as liquid
paraffin. The oily suspensions can contain a thickening agent, for
example beeswax, hard paraffin or cetyl alcohol. Sweetening agents
and flavoring agents can be added to provide palatable oral
preparations. These compositions can be preserved by the addition
of an anti-oxidant such as ascorbic acid
[0569] Dispersible powders and granules suitable for preparation of
an aqueous suspension by the addition of water provide the active
ingredient in admixture with a dispersing or wetting agent,
suspending agent and one or more preservatives. Suitable dispersing
or wetting agents or suspending agents are exemplified by those
already mentioned above. Additional excipients, for example
sweetening, flavoring and coloring agents, can also be present.
[0570] Pharmaceutical compositions of the invention can also be in
the form of oil-in-water emulsions. The oily phase can be a
vegetable oil or a mineral oil or mixtures of these. Suitable
emulsifying agents can be naturally-occurring gums, for example gum
acacia or gum tragacanth, naturally-occurring phosphatides, for
example soy bean, lecithin, and esters or partial esters derived
from fatty acids and hexitol, anhydrides, for example sorbitan
monooleate, and condensation products of the said partial esters
with ethylene oxide, for example polyoxyethylene sorbitan
monooleate. The emulsions can also contain sweetening and flavoring
agents.
[0571] Syrups and elixirs can be formulated with sweetening agents,
for example glycerol, propylene glycol, sorbitol, glucose or
sucrose. Such formulations can also contain a demulcent, a
preservative and flavoring and coloring agents. The pharmaceutical
compositions can be in the form of a sterile injectable aqueous or
oleaginous suspension. This suspension can be formulated according
to the known art using those suitable dispersing or wetting agents
and suspending agents that have been mentioned above. The sterile
injectable preparation can also be a sterile injectable solution or
suspension in a non-toxic parentally acceptable diluent or solvent,
for example as a solution in 1,3-butanediol. Among the acceptable
vehicles and solvents that can be employed are water, Ringer's
solution and isotonic sodium chloride solution. In addition,
sterile, fixed oils are conventionally employed as a solvent or
suspending medium. For this purpose, any bland fixed oil can be
employed including synthetic mono- or diglycerides. In addition,
fatty acids such as oleic acid find use in the preparation of
injectables.
[0572] The nucleic acid molecules of the invention can also be
administered in the form of suppositories, e.g., for rectal
administration of the drug. These compositions can be prepared by
mixing the drug with a suitable non-irritating excipient that is
solid at ordinary temperatures but liquid at the rectal temperature
and will therefore melt in the rectum to release the drug. Such
materials include cocoa butter and polyethylene glycols.
[0573] Nucleic acid molecules of the invention can be administered
parenterally in a sterile medium. The drug, depending on the
vehicle and concentration used, can either be suspended or
dissolved in the vehicle. Advantageously, adjuvants such as local
anesthetics, preservatives and buffering agents can be dissolved in
the vehicle.
[0574] Dosage levels of the order of from about 0.1 mg to about 140
mg per kilogram of body weight per day are useful in the treatment
of the above-indicated conditions (about 0.5 mg to about 7 g per
subject per day). The amount of active ingredient that can be
combined with the carrier materials to produce a single dosage form
varies depending upon the host treated and the particular mode of
administration. Dosage unit forms generally contain between from
about 1 mg to about 500 mg of an active ingredient.
[0575] It is understood that the specific dose level for any
particular subject depends upon a variety of factors including the
activity of the specific compound employed, the age, body weight,
general health, sex, diet, time of administration, route of
administration, and rate of excretion, drug combination and the
severity of the particular disease undergoing therapy.
[0576] For administration to non-human animals, the composition can
also be added to the animal feed or drinking water. It can be
convenient to formulate the animal feed and drinking water
compositions so that the animal takes in a therapeutically
appropriate quantity of the composition along with its diet. It can
also be convenient to present the composition as a premix for
addition to the feed or drinking water.
[0577] The nucleic acid molecules of the present invention can also
be administered to a subject in combination with other therapeutic
compounds to increase the overall therapeutic effect. The use of
multiple compounds to treat an indication can increase the
beneficial effects while reducing the presence of side effects.
[0578] In one embodiment, the invention comprises compositions
suitable for administering nucleic acid molecules of the invention
to specific cell types. For example, the asialoglycoprotein
receptor (ASGPr) (Wu and Wu, 1987, J. Biol. Chem. 262, 4429-4432)
is unique to hepatocytes and binds branched galactose-terminal
glycoproteins, such as asialoorosomucoid (ASOR). In another
example, the folate receptor is overexpressed in many cancer cells.
Binding of such glycoproteins, synthetic glycoconjugates, or
folates to the receptor takes place with an affinity that strongly
depends on the degree of branching of the oligosaccharide chain,
for example, triatennary structures are bound with greater affinity
than biatenarry or monoatennary chains (Baenziger and Fiete, 1980,
Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257,
939-945). Lee and Lee, 1987, Glycoconjugate J., 4, 317-328,
obtained this high specificity through the use of
N-acetyl-D-galactosamine as the carbohydrate moiety, which has
higher affinity for the receptor, compared to galactose. This
"clustering effect" has also been described for the binding and
uptake of mannosyl-terminating glycoproteins or glycoconjugates
(Ponpipom et al., 1981, J. Med. Chem., 24, 1388-1395). The use of
galactose, galactosamine, or folate based conjugates to transport
exogenous compounds across cell membranes can provide a targeted
delivery approach to, for example, the treatment of liver disease,
cancers of the liver, or other cancers. The use of bioconjugates
can also provide a reduction in the required dose of therapeutic
compounds required for treatment. Furthermore, therapeutic
bioavialability, pharmacodynamics, and pharmacokinetic parameters
can be modulated through the use of nucleic acid bioconjugates of
the invention. Non-limiting examples of such bioconjugates are
described in Vargeese et al., U.S. Ser. No. 10/201,394, filed Aug.
13, 2001; and Matulic-Adamic et al., U.S. Ser. No. 60/362,016,
filed Mar. 6, 2002.
EXAMPLES
[0579] The following are non-limiting examples showing the
selection, isolation, synthesis and activity of nucleic acids of
the instant invention.
Example 1
Tandem Synthesis of siNA Constructs
[0580] Exemplary siNA molecules of the invention are synthesized in
tandem using a cleavable linker, for example, a succinyl-based
linker. Tandem synthesis as described herein is followed by a
one-step purification process that provides RNAi molecules in high
yield. This approach is highly amenable to siNA synthesis in
support of high throughput RNAi screening, and can be readily
adapted to multi-column or multi-well synthesis platforms.
[0581] After completing a tandem synthesis of a siNA oligo and its
complement in which the 5'-terminal dimethoxytrityl (5'-O-DMT)
group remains intact (trityl on synthesis), the oligonucleotides
are deprotected as described above. Following deprotection, the
siNA sequence strands are allowed to spontaneously hybridize. This
hybridization yields a duplex in which one strand has retained the
5'-O-DMT group while the complementary strand comprises a terminal
5'-hydroxyl. The newly formed duplex behaves as a single molecule
during routine solid-phase extraction purification (Trityl-On
purification) even though only one molecule has a dimethoxytrityl
group. Because the strands form a stable duplex, this
dimethoxytrityl group (or an equivalent group, such as other trityl
groups or other hydrophobic moieties) is all that is required to
purify the pair of oligos, for example, by using a C18
cartridge.
[0582] Standard phosphoramidite synthesis chemistry is used up to
the point of introducing a tandem linker, such as an inverted deoxy
abasic succinate or glyceryl succinate linker (see FIG. 1) or an
equivalent cleavable linker. A non-limiting example of linker
coupling conditions that can be used includes a hindered base such
as diisopropylethylamine (DIPA) and/or DMAP in the presence of an
activator reagent such as
Bromotripyrrolidinophosphoniumhexaflurorophosphate (PyBrOP). After
the linker is coupled, standard synthesis chemistry is utilized to
complete synthesis of the second sequence leaving the terminal the
5'-O-DMT intact. Following synthesis, the resulting oligonucleotide
is deprotected according to the procedures described herein and
quenched with a suitable buffer, for example with 50 mM NaOAc or
1.5M NH.sub.4H.sub.2CO.sub.3.
[0583] Purification of the siNA duplex can be readily accomplished
using solid phase extraction, for example using a Waters C18 SepPak
1 g cartridge conditioned with 1 column volume (CV) of
acetonitrile, 2 CV H.sub.2O, and 2 CV 50 mM NaOAc. The sample is
loaded and then washed with 1 CV H.sub.2O or 50 mM NaOAc. Failure
sequences are eluted with 1 CV 14% ACN (Aqueous with 50 mM NaOAc
and 50 mM NaCl). The column is then washed, for example with 1 CV
H.sub.2O followed by on-column detritylation, for example by
passing 1 CV of 1% aqueous trifluoroacetic acid (TFA) over the
column, then adding a second CV of 1% aqueous TFA to the column and
allowing to stand for approximately 10 minutes. The remaining TFA
solution is removed and the column washed with H.sub.2O followed by
1 CV 1M NaCl and additional H.sub.2O. The siNA duplex product is
then eluted, for example, using 1 CV 20% aqueous CAN.
[0584] FIG. 2 provides an example of MALDI-TOF mass spectrometry
analysis of a purified siNA construct in which each peak
corresponds to the calculated mass of an individual siNA strand of
the siNA duplex. The same purified siNA provides three peaks when
analyzed by capillary gel electrophoresis (CGE), one peak
presumably corresponding to the duplex siNA, and two peaks
presumably corresponding to the separate siNA sequence strands. Ion
exchange HPLC analysis of the same siNA contract only shows a
single peak. Testing of the purified siNA construct using a
luciferase reporter assay described below demonstrated the same
RNAi activity compared to siNA constructs generated from separately
synthesized oligonucleotide sequence strands.
Example 2
Serum Stability of Chemically Modified siNA Constructs
[0585] Chemical modifications were introduced into siNA constructs
to determine the stability of these constructs compared to native
siNA oligonucleotides (containing two thymidine nucleotide
overhangs) in human serum. An investigation of the serum stability
of RNA duplexes revealed that siNA constructs consisting of all RNA
nucleotides containing two thymidine nucleotide overhangs have a
half-life in serum of 15 seconds, whereas chemically modified siNA
constructs remained stable in serum for 1 to 3 days depending on
the extent of modification (see FIG. 3). RNAi stability tests were
performed by internally labeling one strand (strand 1) of siNA and
duplexing with 1.5.times. the concentration of the complementary
siNA strand (strand 2) (to insure all labeled material was in
duplex form). Duplexed siNA constructs were then tested for
stability by incubating at a final concentration of 2 .mu.M siNA
(strand 2 concentration) in 90% mouse or human serum for
time-points of 30 sec, 1 min, 5 min, 30 min, 90 min, 4 hrs 10 min,
16 hrs 24 min, and 49 hrs. Time points were run on a 15% denaturing
polyacrylamide gels and analyzed on a phosphoimager.
[0586] Internal labeling was performed via kinase reactions with
polynucleotide kinase (PNK) and .sup.32P-.gamma.-ATP, with addition
of radiolabeled phosphate at nucleotide 13 of strand 2, counting in
from the 3' side. Ligation of the remaining 8-mer fragments with T4
RNA ligase resulted in the full length, 21-mer, strand 2. Duplexing
of RNAi was done by adding appropriate concentrations of the siNA
oligonucleotides and heating to 95.degree. C. for 5 minutes
followed by slow cooling to room temperature. Reactions were
performed by adding 100% serum to the siNA duplexes and incubating
at 37.degree. C., then removing aliquots at desired time-points.
Results of this study are summarized in FIG. 3. As shown in the
FIG. 3, chemically modified siNA molecules (e.g., SEQ ID NOs:
41.2/413, 412/414, 412/415, 412/416, and 412/418) have
significantly increased serum stability compared to an siNA
construct having all ribonucleotides except a 3'-terminal
dithymidine (TT) modification (e.g., SEQ ID NOs: 419/420).
Example 3
Identification of Potential siNA Target Sites in any RNA
Sequence
[0587] The sequence of an RNA target of interest, such as a viral
or human mRNA transcript, is screened for target sites, for example
by using a computer folding algorithm. In a non-limiting example,
the sequence of a gene or RNA gene transcript derived from a
database, such as Genbank, is used to generate siNA targets having
complementarity to the target. Such sequences can be obtained from
a database, or can be determined experimentally as known in the
art. Target sites that are known, for example, those target sites
determined to be effective target sites based on studies with other
nucleic acid molecules, for example ribozymes or antisense, or
those targets known to be associated with a disease or condition
such as those sites containing mutations or deletions, can be used
to design siNA molecules targeting those sites. Various parameters
can be used to determine which sites are the most suitable target
sites within the target RNA sequence. These parameters include but
are not limited to secondary or tertiary RNA structure, the
nucleotide base composition of the target sequence, the degree of
homology between various regions of the target sequence, or the
relative position of the target sequence within the RNA transcript.
Based on these determinations, any number of target sites within
the RNA transcript can be chosen to screen siNA molecules for
efficacy, for example by using in vitro RNA cleavage assays, cell
culture, or animal models. In a non-limiting example, anywhere from
1 to 1000 target sites are chosen within the transcript based on
the size of the siNA construct to be used. High throughput
screening assays can be developed for screening siNA molecules
using methods known in the art, such as with multi-well or
multi-plate assays or combinatorial/siNA library screening assays
to determine efficient reduction in target gene expression.
Example 4
Selection of siNA Molecule Target Sites in a RNA
[0588] The following non-limiting steps can be used to carry out
the selection of siNAs targeting a given gene sequence or
transcript.
[0589] The target sequence is parsed in silico into a list of all
fragments or subsequences of a particular length, for example 23
nucleotide fragments, contained within the target sequence. This
step is typically carried out using a custom Perl script, but
commercial sequence analysis programs such as Oligo, MacVector, or
the GCG Wisconsin Package can be employed as well.
[0590] In some instances the siNAs correspond to more than one
target sequence; such would be the case for example in targeting
different transcripts of the same gene, targeting different
transcripts of more than one gene, or for targeting both the human
gene and an animal homolog. In this case, a subsequence list of a
particular length is generated for each of the targets, and then
the lists are compared to find matching sequences in each list. The
subsequences are then ranked according to the number of target
sequences that contain the given subsequence; the goal is to find
subsequences that are present in most or all of the target
sequences. Alternately, the ranking can identify subsequences that
are unique to a target sequence, such as a mutant target sequence.
Such an approach would enable the use of siNA to target
specifically the mutant sequence and not effect the expression of
the normal sequence.
[0591] In some instances the siNA subsequences are absent in one or
more sequences while present in the desired target sequence; such
would be the case if the siNA targets a gene with a paralogous
family member that is to remain untargeted. As in case 2 above, a
subsequence list of a particular length is generated for each of
the targets, and then the lists are compared to find sequences that
are present in the target gene but are absent in the untargeted
paralog.
[0592] The ranked siNA subsequences can be further analyzed and
ranked according to GC content. A preference can be given to sites
containing 30-70% GC, with a further preference to sites containing
40-60% GC.
[0593] The ranked siNA subsequences can be further analyzed and
ranked according to self-folding and internal hairpins. Weaker
internal folds are preferred; strong hairpin structures are to be
avoided.
[0594] The ranked siNA subsequences can be further analyzed and
ranked according to whether they have runs of GGG or CCC in the
sequence. GGG (or even more Gs) in either strand can make
oligonucleotide synthesis problematic and can potentially interfere
with RNAi activity, so it is avoided other appropriately suitable
sequences are available. CCC is searched in the target strand
because that will place GGG in the antisense strand.
[0595] The ranked siNA subsequences can be further analyzed and
ranked according to whether they have the dinucleotide UU (uridine
dinucleotide) on the 3'-end of the sequence, and/or AA on the
5'-end of the sequence (to yield 3' UU on the antisense sequence).
These sequences allow one to design siNA molecules with terminal TT
thymidine dinucleotides.
[0596] Four or five target sites are chosen from the ranked list of
subsequences as described above. For example, in subsequences
having 23 nucleotides, the right 21 nucleotides of each chosen
23-mer subsequence are then designed and synthesized for the upper
(sense) strand of the siNA duplex, while the reverse complement of
the left 21 nucleotides of each chosen 23-mer subsequence are then
designed and synthesized for the lower (antisense) strand of the
siNA duplex (see Tables I). If terminal TT residues are desired for
the sequence (as described in paragraph 7), then the two 3'
terminal nucleotides of both the sense and antisense strands are
replaced by TT prior to synthesizing the oligos.
[0597] The siNA molecules are screened in an in vitro, cell culture
or animal model system to identify the most active siNA molecule or
the most preferred target site within the target RNA sequence.
[0598] In an alternate approach, a pool of siNA constructs specific
to a target sequence is used to screen for target sites in cells
expressing target RNA, such as human HeLa cells. The general
strategy used in this approach is shown in FIG. 21. A non-limiting
example of such a pool is a pool comprising sequences having
antisense sequences complementary to the target RNA sequence and
sense sequences complementary to the antisense sequences. Cells
(e.g., HeLa cells) expressing the target gene are transfected with
the pool of siNA constructs and cells that demonstrate a phenotype
associated with gene silencing are sorted. The pool of siNA
constructs can be chemically modified as described herein and
synthesized, for example, in a high throughput manner. The siNA
from cells demonstrating a positive phenotypic change (e.g.,
decreased target mRNA levels or target protein expression), are
identified, for example by positional analysis within the assay,
and are used to determine the most suitable target site(s) within
the target RNA sequence based upon the complementary sequence to
the corresponding siNA antisense strand identified in the
assay.
Example 5
RNAi Activity of Chemically Modified siNA Constructs
[0599] Short interfering nucleic acid (siNA) is emerging as a
powerful tool for gene regulation. All-ribose siNA duplexes
activate the RNAi pathway but have limited utility as therapeutic
compounds due to their nuclease sensitivity and short half-life in
serum, as shown in Example 2 above. To develop nuclease-resistant
siNA constructs for in vivo applications, siNAs that target
luciferase mRNA and contain stabilizing chemical modifications were
tested for activity in HeLa cells. The sequences for the siNA
oligonucleotide sequences used in this study are shown in Table I.
Modifications included phosphorothioate linkages (P.dbd.S),
2'-O-methyl nucleotides, or 2'-fluoro (F) nucleotides in one or
both siNA strands and various 3'-end stabilization chemistries,
including 3'-glyceryl, 3'-inverted abasic, 3'-inverted Thymidine,
and/or Thymidine. The RNAi activity of chemically stabilized siNA
constructs was compared with the RNAi activity of control siNA
constructs consisting of all ribonucleotides at every position
except the 3'-terminus which comprised two thymidine nucleotide
overhangs. Active siNA molecules containing stabilizing
modifications such as described herein should prove useful for in
vivo applications, given their enhanced nuclease-resistance.
[0600] A luciferase reporter system was utilized to test RNAi
activity of chemically modified siNA constructs compared to siNA
constructs consisting of all RNA nucleotides containing two
thymidine nucleotide overhangs. Sense and antisense siNA strands
(20 uM each) were annealed by incubation in buffer (100 mM
potassium acetate, 30 mM HEPES-KOH, pH 7.4, 2 mM magnesium acetate)
for 1 min. at 90.degree. C. followed by 1 hour at 37.degree. C.
Plasmids encoding firefly luciferase (pGL2) and renilla luciferase
(pRLSV40) were purchased from Promega Biotech.
[0601] HeLa S3 cells were grown at 37.degree. C. in DMEM with 5%
FBS and seeded at 15,300 cells in 100 ul media per well of a
96-well plate 24 hours prior to transfection. For transfection, 4
ul Lipofectamine 2000 (Life Technologies) was added to 96 ul
OPTI-MEM, vortexed and incubated at room temperature for 5 minutes.
The 100 ul diluted lipid was then added to a microtiter tube
containing 5 ul pGL2 (200 ng/ul), 5 ul pRLSV40 (8 ng/ul) 6 ul siNA
(25 nM or 10 nM final), and 84 ul OPTI-MEM, vortexed briefly and
incubated at room temperature for 20 minutes. The transfection mix
was then mixed briefly and 50 ul was added to each of three wells
that contained HeLa S3 cells in 100 ul media Cells were incubated
for 20 hours after transfection and analyzed for luciferase
expression using the Dual luciferase assay according to the
manufacturer's instructions (Promega Biotech). The results of this
study are summarized in FIGS. 4-16. The sequences of the siNA
strands used in this study are shown in Table I and are referred to
by Sirna/RPI # in the figures. Normalized luciferase activity is
reported as the ratio of firefly luciferase activity to renilla
luciferase activity in the same sample. Error bars represent
standard deviation of triplicate transfections. As shown in FIGS.
4-16, the RNAi activity of chemically modified constructs is often
comparable to that of unmodified control siNA constructs, which
consist of all ribonucleotides at every position except the
3'-terminus which comprises two thymidine nucleotide overhangs. In
some instances, the RNAi activity of the chemically modified
constructs is greater than the unmodified control siNA construct
consisting of all ribonucleotides.
[0602] For example, FIG. 4 shows results obtained from a screen
using phosphorothioate modified siNA constructs. The Sirna/RPI
27654/27659 construct contains phosphorothioate substitutions for
every pyrimidine nucleotide in both sequences, the Sirna/RPI
27657/27662 construct contains 5 terminal 3'-phosphorothioate
substitutions in each strand, the Sirna/RPI 27649/27658 construct
contains all phosphorothioate substitutions only in the antisense
strand, whereas the Sirna/RPI 27649/27660 and Sirna/RPI 27649/27661
constructs have unmodified sense strands and varying degrees of
phosphorothioate substitutions in the antisense strand. All of
these constructs show significant RNAi activity when compared to a
scrambled siNA conrol construct (27651/27652).
[0603] FIG. 5 shows results obtained from a screen using
phosphorothioate (Sirna/RPI 28253/28255 and Sirna/RPI 28254/28256)
and universal base substitutions (Sirna/RPI 28257/28259 and
Sirna/RPI 28258/28260) compared to the same controls described
above, these modifications show equivalent or better RNAi activity
when compared to the unmodified control siNA construct.
[0604] FIG. 6 shows results obtained from a screen using
2'-O-methyl modified siNA constructs in which the sense strand
contains either 10 (Sirna/RPI 28244/27650) or 5 (Sirna/RPI
28245/27650) 2'-O-methyl substitutions, both with comparable
activity to the unmodified control siNA construct.
[0605] FIG. 7 shows results obtained from a screen using
2'-O-methyl or 2'-deoxy-2'-fluoro modified siNA constructs compared
to a control construct consisting of all ribonucleotides at every
position except the 3'-terminus which comprises two thymidine
nucleotide overhangs.
[0606] FIG. 8 compares a siNA construct containing six
phosphorothioate substitutions in each strand (Sirna/RPI
28460/28461), where 5 phosphorothioates are present at the 3' end
and a single phosphorothioate is present at the 5' end of each
strand. This motif shows very similar activity to the control siNA
construct consisting of all ribonucleotides at every position
except the 3'-terminus, which comprises two thymidine nucleotide
overhangs.
[0607] FIG. 9 compares a siNA construct synthesized by the method
of the invention described in Example 1, wherein an inverted
deoxyabasic succinate linker was used to generate a siNA having a
3'-inverted deoxyabasic cap on the antisense strand of the siNA.
This construct shows improved activity compared to the control siNA
construct consisting of all ribonucleotides at every position
except the 3'-terminus which comprises two thymidine nucleotide
overhangs.
[0608] FIG. 10 shows the results of an RNAi activity screen of
chemically modifed siNA constructs including 3'-glyceryl modified
siNA constructs compared to an all RNA control siNA construct using
a luciferase reporter system. These chemically modified siNAs were
compared in the luciferase assay described herein at 1 nM and 10 nM
concentration using an all RNA siNA control (siGL2) having
3'-terminal dithymidine (TT) and its corresponding inverted control
(Inv siGL2). The background level of luciferase expression in the
HeLa cells is designated by the "cells" column. Sense and antisense
strands of chemically modified siNA constructs are shown by
Sirna/RPI number (sense strand/antisense strand). Sequences
corresponding to these Sirna/RPI numbers are shown in Table I. As
shown in the Figure, the 3'-terminal modified siNA constructs
retain significant RNAi activity compared to the unmodified control
siNA (siGL2) construct.
[0609] FIG. 11 shows the results of an RNAi activity screen of
chemically modifed siNA constructs. The screen compared various
combinations of sense strand chemical modifications and antisense
strand chemical modifications. These chemically modified siNAs were
compared in the luciferase assay described herein at 1 nM and 10 nM
concentration using an all RNA siNA control (siGL2) having
3'-terminal dithymidine (TT) and its corresponding inverted control
(Inv siGL2). The background level of luciferase expression in the
HeLa cells is designated by the "cells" column. Sense and antisense
strands of chemically modified siNA constructs are shown by
Sirna/RPI number (sense strand/antisense strand). Sequences
corresponding to these Sirna/RPI numbers are shown in Table I. As
shown in the figure, the chemically modified Sirna/RPI 30063/30430,
Sirna/RPI 30433/30430, and Sirna/RPI 30063/30224 constructs retain
significant RNAi activity compared to the unmodified control siNA
construct. It should be noted that Sirna/RPI 30433/30430 is a siNA
construct having no ribonucleotides which retains significant RNAi
activity compared to the unmodified control siGL2 construct in
vitro, therefore, this construct is expected to have both similar
RNAi activity and improved stability in vivo compared to siNA
constructs having ribonucleotides.
[0610] FIG. 12 shows the results of an RNAi activity screen of
chemically modifed siNA constructs. The screen compared various
combinations of sense strand chemical modifications and antisense
strand chemical modifications. These chemically modified siNAs were
compared in the luciferase assay described herein at 1 nM and 10 nM
concentration using an all RNA siNA control (siGL2) having
3'-terminal dithymidine (TT) and its corresponding inverted control
(Inv siGL2). The background level of luciferase expression in the
HeLa cells is designated by the "cells" column. Sense and antisense
strands of chemically modified siNA constructs are shown by
Sirna/RPI number (sense strand/antisense strand). Sequences
corresponding to these Sirna/RPI numbers are shown in Table I. As
shown in the figure, the chemically modified Sirna/RPI 30063/30224
and Sirna/RPI 30063/30430 constructs retain significant RNAi
activity compared to the control siNA (siGL2) construct. In
addition, the antisense strand alone (Sirna/RPI 30430) and an
inverted control (Sirna/RPI 30227/30229), having matched chemistry
to Sirna/RPI (30063/30224) were compared to the siNA duplexes
described above. The antisense strand (Sirna/RPI 30430) alone
provides far less inhibition compared to the siNA duplexes using
this sequence.
[0611] FIG. 13 shows the results of an RNAi activity screen of
chemically modifed siNA constructs. The screen compared various
combinations of sense strand chemical modifications and antisense
strand chemical modifications. These chemically modified siNAs were
compared in the luciferase assay described herein at 1 nM and 10 nM
concentration using an all RNA siNA control (siGL2) having
3'-terminal dithymidine (TT) and its corresponding inverted control
(Inv siGL2). The background level of luciferase expression in the
HeLa cells is designated by the "cells" column. Sense and antisense
strands of chemically modified siNA constructs are shown by
Sirna/RPI number (sense strand/antisense strand). Sequences
corresponding to these Sirna/RPI numbers are shown in Table I. In
addition, an inverted control (Sirna/RPI 30226/30229, having
matched chemistry to Sirna/RPI 30222/30224) was compared to the
siNA duplexes described above. As shown in the figure, the
chemically modified Sirna/RPI 28251/30430, Sirna/RPI 28251/30224,
and Sirna/RPI 30222/30224 constructs retain significant RNAi
activity compared to the control siNA construct, and the chemically
modified Sirna/RPI 28251/30430 construct demonstrates improved
activity compared to the control siNA (siGL2) construct.
[0612] FIG. 14 shows the results of an RNAi activity screen of
chemically modifed siNA constructs including various 3'-terminal
modified siNA constructs compared to an all RNA control siNA
construct using a luciferase reporter system. These chemically
modified siNAs were compared in the luciferase assay described
herein at 1 nM and 10 nM concentration using an all RNA siNA
control (siGL2) having 3'-terminal dithymidine (TT) and its
corresponding inverted control (Inv siGL2). The background level of
luciferase expression in the HeLa cells is designated by the
"cells" column. Sense and antisense strands of chemically modified
siNA constructs are shown by Sirna/RPI number (sense
strand/antisense strand). Sequences corresponding to these
Sirna/RPI numbers are shown in Table I. As shown in the figure, the
chemically modified Sirna/RPI 30222/30546, 30222/30224,
30222/30551, 30222/30557 and 30222/30558 constructs retain
significant RNAi activity compared to the control siNA
construct.
[0613] FIG. 15 shows the results of an RNAi activity screen of
chemically modifed siNA constructs. The screen compared various
combinations of sense strand chemistries compared to a fixed
antisense strand chemistry. These chemically modified siNAs were
compared in the luciferase assay described herein at 1 nM and 10 nM
concentration using an all RNA siNA control (siGL2) having
3'-terminal dithymidine (TT) and its corresponding inverted control
(Inv siGL2). The background level of luciferase expression in the
HeLa cells is designated by the "cells" column. Sense and antisense
strands of chemically modified siNA constructs are shown by
Sirna/RPI number (sense strand/antisense strand). Sequences
corresponding to these Sirna/RPI numbers are shown in Table I. As
shown in the figure, the chemically modified Sirna/RPI 30063/30430,
30434/30430, and 30435/30430 constructs all demonstrate greater
activity compared to the control siNA (siGL2) construct.
Example 6
RNAi Activity Titration
[0614] A titration assay was performed to determine the lower range
of siNA concentration required for RNAi activity both in a control
siNA construct consisting of all RNA nucleotides containing two
thymidine nucleotide overhangs and a chemically modified siNA
construct comprising five phosphorothioate internucleotide linkages
in both the sense and antisense strands. The assay was performed as
described above, however, the siNA constructs were diluted to final
concentrations between 2.5 nM and 0.025 nM. Results are shown in
FIG. 16. As shown in FIG. 16, the chemically modified siNA
construct shows a very similar concentration dependent RNAi
activity profile to the control siNA construct when compared to an
inverted siNA sequence control.
Example 7
siNA Design
[0615] siNA target sites were chosen by analyzing sequences of the
target RNA and optionally prioritizing the target sites on the
basis of folding (structure of any given sequence analyzed to
determine siNA accessibility to the target), by using a library of
siNA molecules as described in Example 4, or alternately by using
an in vitro siNA system as described in Example 9 herein. siNA
molecules were designed that could bind each target and are
optionally individually analyzed by computer folding to assess
whether the siNA molecule can interact with the target sequence.
Varying the length of the siNA molecules can be chosen to optimize
activity. Generally, a sufficient number of complementary
nucleotide bases are chosen to bind to, or otherwise interact with,
the target RNA, but the degree of complementarity can be modulated
to accommodate siNA duplexes or varying length or base composition.
By using such methodologies, siNA molecules can be designed to
target sites within any known RNA sequence, for example those RNA
sequences corresponding to the any gene transcript.
[0616] Chemically modified siNA constructs are designed to provide
nuclease stability for systemic administration in vivo and/or
improved pharmacokinetic, localization, and delivery properties
while preserving the ability to mediate RNAi activity. Chemical
modifications as described herein are introduced synthetically
using synthetic methods described herein and those generally known
in the art. The synthetic siNA constructs are then assayed for
nuclease stability in serum and/or cellular/tissue extracts (e.g.
liver extracts). The synthetic siNA constructs are also tested in
parallel for RNAi activity using an appropriate assay, such as a
luciferase reporter assay as described herein or another suitable
assay that can quantity RNAi activity. Synthetic siNA constructs
that possess both nuclease stability and RNAi activity can be
further modified and re-evaluated in stability and activity assays.
The chemical modifications of the stabilized active siNA constructs
can then be applied to any siNA sequence targeting any chosen RNA
and used, for example, in target screening assays to pick lead siNA
compounds for therapeutic development (see for example FIG.
27).
Example 8
Chemical Synthesis and Purification of siNA
[0617] siNA molecules can be designed to interact with various
sites in the RNA message, for example, target sequences within the
RNA sequences described herein. The sequence of one strand of the
siNA molecule(s) is complementary to the target site sequences
described above. The siNA molecules can be chemically synthesized
using methods described herein. Inactive siNA molecules that are
used as control sequences can be synthesized by scrambling the
sequence of the siNA molecules such that it is not complementary to
the target sequence. Generally, siNA constructs can by synthesized
using solid phase oligonucleotide synthesis methods as described
herein (see for example Usman et al., U.S. Pat. Nos. 5,804,683;
5,831,071; 5,998,203; 6,117,657; 6,353,098; 6,362,323; 6,437,117;
6,469,158; Scaringe et al., U.S. Pat. Nos. 6,111,086; 6,008,400;
6,111,086 all incorporated by reference herein in their
entirety).
[0618] In a non-limiting example, RNA oligonucleotides are
synthesized in a stepwise fashion using the phosphoramidite
chemistry as is known in the art. Standard phosphoramidite
chemistry involves the use of nucleosides comprising any of
5'-O-dimethoxytrityl, 2'-O-tert-butyldimethylsilyl,
3'-O-2-Cyanoethyl N,N-diisopropylphosphoroamidite groups, and
exocyclic amine protecting groups (e.g. N6-benzoyl adenosine, N4
acetyl cytidine, and N2-isobutyryl guanosine). Alternately,
2'-O-Silyl Ethers can be used in conjunction with acid-labile
2'-O-orthoester protecting groups in the synthesis of RNA as
described by Scaringe supra. Differing 2' chemistries can require
different protecting groups, for example 2'-deoxy-2'-amino
nucleosides can utilize N-phthaloyl protection as described by
Usman et al., U.S. Pat. No. 5,631,360, incorporated by reference
herein in its entirety).
[0619] During solid phase synthesis, each nucleotide is added
sequentially (3'- to 5'-direction) to the solid support-bound
oligonucleotide. The first nucleoside at the 3'-end of the chain is
covalently attached to a solid support (e.g., controlled pore glass
or polystyrene) using various linkers. The nucleotide precursor, a
ribonucleoside phosphoramidite, and activator are combined
resulting in the coupling of the second nucleoside phosphoramidite
onto the 5'-end of the first nucleoside. The support is then washed
and any unreacted 5'-hydroxyl groups are capped with a capping
reagent such as acetic anhydride to yield inactive 5'-acetyl
moieties. The trivalent phosphorus linkage is then oxidized to a
more stable phosphate linkage. At the end of the nucleotide
addition cycle, the 5'-O-protecting group is cleaved under suitable
conditions (e.g., acidic conditions for trityl-based groups and
Fluoride for silyl-based groups). The cycle is repeated for each
subsequent nucleotide.
[0620] Modification of synthesis conditions can be used to optimize
coupling efficiency, for example by using differing coupling times,
differing reagent/phosphoramidite concentrations, differing contact
times, differing solid supports and solid support linker
chemistries depending on the particular chemical composition of the
siNA to be synthesized. Deprotection and purification of the siNA
can be performed as is generally described in Deprotection and
purification of the siNA can be performed as is generally described
in Usman et al., U.S. Pat. No. 5,831,071, U.S. Pat. No. 6,353,098,
U.S. Pat. No. 6,437,117, and Bellon et al., U.S. Pat. No.
6,054,576, U.S. Pat. No. 6,162,909, U.S. Pat. No. 6,303,773, or
Scaringe supra, incorporated by reference herein in their
entireties. Additionally, deprotection conditions can be modified
to provide the best possible yield and purity of siNA constructs.
For example, applicant has observed that oligonucleotides
comprising 2'-deoxy-2'-fluoro nucleotides can degrade under
inappropriate deprotection conditions. Such oligonucleotides are
deprotected using aqueous methylamine at about 35.degree. C. for 30
minutes. If the 2'-deoxy-2'-fluoro containing oligonucleotide also
comprises ribonucleotides, after deprotection with aqueous
methylamine at about 35.degree. C. for 30 minutes, TEA-HF is added
and the reaction maintained at about 65.degree. C. for an
additional 15 minutes.
Example 9
RNAi In Vitro Assay to Assess siNA Activity
[0621] An in vitro assay that recapitulates RNAi in a cell free
system is used to evaluate siNA constructs specific to target RNA.
The assay comprises the system described by Tuschl et al., 1999,
Genes and Development, 13, 3191-3197 and Zamore et al., 2000, Cell,
101, 25-33 adapted for use with target RNA. A Drosophila extract
derived from syncytial blastoderm is used to reconstitute RNAi
activity in vitro. Target RNA is generated via in vitro
transcription from an appropriate plasmid using T7 RNA polymerase
or via chemical synthesis as described herein. Sense and antisense
siNA strands (for example 20 uM each) are annealed by incubation in
buffer (such as 100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4,
2 mM magnesium acetate) for 1 minute at 90.degree. C. followed by 1
hour at 37.degree. C., then diluted in lysis buffer (for example
100 mM potassium acetate, 30 mM HEPES-KOH at pH 7.4, 2 mM magnesium
acetate). Annealing can be monitored by gel electrophoresis on an
agarose gel in TBE buffer and stained with ethidium bromide. The
Drosophila lysate is prepared using zero to two-hour-old embryos
from Oregon R flies collected on yeasted molasses agar that are
dechorionated and lysed. The lysate is centrifuged and the
supernatant isolated. The assay comprises a reaction mixture
containing 50% lysate [vol/vol], RNA (10-50 pM final
concentration), and 10% [vol/vol] lysis buffer containing siNA (10
nM final concentration). The reaction mixture also contains 10 mM
creatine phosphate, 10 ugml creatine phosphokinase, 100 um GTP, 100
uM UTP, 100 uM CTP, 500 uM ATP, 5 mM DTT, 0.1 U/uL RNasin
(Promega), and 100 uM of each amino acid. The final concentration
of potassium acetate is adjusted to 100 mM. The reactions are
pre-assembled on ice and preincubated at 25.degree. C. for 10
minutes before adding RNA, then incubated at 25.degree. C. for an
additional 60 minutes. Reactions are quenched with 4 volumes of
1.25.times. Passive Lysis Buffer (Promega). Target RNA cleavage is
assayed by RT-PCR analysis or other methods known in the art and
are compared to control reactions in which siNA is omitted from the
reaction.
[0622] Alternately, internally-labeled target RNA for the assay is
prepared by in vitro transcription in the presence of
[alpha-.sup.32P] CTP, passed over a G 50 Sephadex column by spin
chromatography and used as target RNA without further purification.
Optionally, target RNA is 5'-.sup.32P-end labeled using T4
polynucleotide kinase enzyme. Assays are performed as described
above and target RNA and the specific RNA cleavage products
generated by RNAi are visualized on an autoradiograph of a gel. The
percentage of cleavage is determined by Phosphor Imager.RTM.
quantitation of bands representing intact control RNA or RNA from
control reactions without siNA and the cleavage products generated
by the assay.
[0623] In one embodiment, this assay is used to determine target
sites the RNA target for siNA mediated RNAi cleavage, wherein a
plurality of siNA constructs are screened for RNAi mediated
cleavage of the RNA target, for example, by analyzing the assay
reaction by electrophoresis of labeled target RNA, or by northern
blotting, as well as by other methodology well known in the
art.
Example 10
Nucleic Acid Inhibition of Target RNA In Vivo
[0624] siNA molecules targeted to the target RNA are designed and
synthesized as described above. These nucleic acid molecules can be
tested for cleavage activity in vivo, for example, using the
following procedure.
[0625] Two formats are used to test the efficacy of siNAs targeting
a particular gene transcipt. First, the reagents are tested on
target expressing cells (e.g., HeLa), to determine the extent of
RNA and protein inhibition. siNA reagents are selected against the
RNA target. RNA inhibition is measured after delivery of these
reagents by a suitable transfection agent to cells. Relative
amounts of target RNA are measured versus actin using real-time PCR
monitoring of amplification (eg., ABI 7700 Taqman.RTM.). A
comparison is made to a mixture of oligonucleotide sequences made
to unrelated targets or to a randomized siNA control with the same
overall length and chemistry, but with randomly substituted
nucleotides at each position. Primary and secondary lead reagents
are chosen for the target and optimization performed. After an
optimal transfection agent concentration is chosen, a RNA
time-course of inhibition is performed with the lead siNA molecule.
In addition, a cell-plating format can be used to determine RNA
inhibition.
Delivery of siNA to Cells
[0626] Cells (e.g., HeLa) are seeded, for example, at
1.times.10.sup.5 cells per well of a six-well dish in EGM-2
(BioWhittaker) the day before transfection. siNA (final
concentration, for example 20 nM) and cationic lipid (e.g., final
concentration 2 .mu.g/ml) are complexed in EGM basal media
(Biowhittaker) at 37.degree. C. for 30 mins in polystyrene tubes.
Following vortexing, the complexed siNA is added to each well and
incubated for the times indicated. For initial optimization
experiments, cells are seeded, for example, at 1.times.10.sup.3 in
96 well plates and siNA complex added as described. Efficiency of
delivery of siNA to cells is determined using a fluorescent siNA
complexed with lipid. Cells in 6-well dishes are incubated with
siNA for 24 hours, rinsed with PBS and fixed in 2% paraformaldehyde
for 15 minutes at room temperature. Uptake of siNA is visualized
using a fluorescent microscope.
Taqman and Lightcycler Quantification of mRNA
[0627] Total RNA is prepared from cells following siNA delivery,
for example, using Qiagen RNA purification kits for 6-well or
Rneasy extraction kits for 96-well assays. For Taqman analysis,
dual-labeled probes are synthesized with the reporter dye, FAM or
JOE, covalently linked at the 5'-end and the quencher dye TAMRA
conjugated to the 3'-end. One-step RT-PCR amplifications are
performed on, for example, an ABI PRISM 7700 Sequence Detector
using 50 .mu.l reactions consisting of 10 .mu.l total RNA, 100 nM
forward primer, 900 nM reverse primer, 100 nM probe, 1.times.
TaqMan PCR reaction buffer (PE-Applied Biosystems), 5.5 mM
MgCl.sub.2, 300 .mu.M each dATP, dCTP, dGTP, and dTTP, 10 U RNase
Inhibitor (Promega), 1.25 U AmpliTaq Gold (PE-Applied Biosystems)
and 10 U M-MLV Reverse Transcriptase (Promega). The thermal cycling
conditions can consist of 30 min at 48.degree. C., 10 min at
95.degree. C., followed by 40 cycles of 15 sec at 95.degree. C. and
1 min at 60.degree. C. Quantitation of mRNA levels is determined
relative to standards generated from serially diluted total
cellular RNA (300, 100, 33, 11 ng/r.times.n) and normalizing to
.beta.-actin or GAPDH mRNA in parallel TaqMan reactions. For each
gene of interest an upper and lower primer and a fluorescently
labeled probe are designed. Real time incorporation of SYBR Green I
dye into a specific PCR product can be measured in glass capillary
tubes using a lightcyler. A standard curve is generated for each
primer pair using control cRNA. Values are represented as relative
expression to GAPDH in each sample.
Western Blotting
[0628] Nuclear extracts can be prepared using a standard micro
preparation technique (see for example Andrews and Faller, 1991,
Nucleic Acids Research, 19, 2499). Protein extracts from
supernatants are prepared, for example using TCA precipitation. An
equal volume of 20% TCA is added to the cell supernatant, incubated
on ice for 1 hour and pelleted by centrifugation for 5 minutes.
Pellets are washed in acetone, dried and resuspended in water.
Cellular protein extracts are run on a 10% Bis-Tris NuPage (nuclear
extracts) or 4-12% Tris-Glycine (supernatant extracts)
polyacrylamide gel and transferred onto nitro-cellulose membranes.
Non-specific binding can be blocked by incubation, for example,
with 5% non-fat milk for 1 hour followed by primary antibody for 16
hour at 4.degree. C. Following washes, the secondary antibody is
applied, for example (1:10,000 dilution) for 1 hour at room
temperature and the signal detected with SuperSignal reagent
(Pierce).
Example 11
Animal Models
[0629] Various animal models can be used to screen siNA constructs
in vivo as are known in the art, for example those animal models
that are used to evaluate other nucleic acid technologies such as
enzymatic nucleic acid molecules (ribozymes) and/or antisense. Such
animal models are used to test the efficacy of siNA molecules
described herein. In a non-limiting example, siNA molecules that
are designed as anti-angiogenic agents can be screened using animal
models. There are several animal models available in which to test
the anti-angiogenesis effect of nucleic acids of the present
invention, such as siNA, directed against genes associated with
angiogenesis and/or metastais, such as VEGFR (e.g., VEGFR1, VEGFR2,
and VEGFR3) genes. Typically a corneal model has been used to study
angiogenesis in rat and rabbit, since recruitment of vessels can
easily be followed in this normally avascular tissue (Pandey et
al., 1995 Science 268: 567-569). In these models, a small Teflon or
Hydron disk pretreated with an angiogenesis factor (e.g. bFGF or
VEGF) is inserted into a pocket surgically created in the cornea.
Angiogenesis is monitored 3 to 5 days later. siNA molecules
directed against VEGFR mRNAs would be delivered in the disk as
well, or dropwise to the eye over the time course of the
experiment. In another eye model, hypoxia has been shown to cause
both increased expression of VEGF and neovascularization in the
retina (Pierce et al., 1995 Proc. Natl. Acad. Sci. USA. 92:
905-909; Shweiki et al., 1992 J. Clin. Invest. 91: 2235-2243).
[0630] Several animal models exist for screening of anti-angiogenic
agents. These include corneal vessel formation following corneal
injury (Burger et al., 1985 Cornea 4: 35-41; Lepri, et al., 1994 J.
Ocular Pharmacol. 10: 273-280; Ormerod et al., 1990 Am. J. Pathol.
137: 1243-1252) or intracorneal growth factor implant (Grant et
al., 1993 Diabetologia 36: 282-291; Pandey et al. 1995 supra;
Zieche et al., 1992 Lab. Invest. 67: 711-715), vessel growth into
Matrigel matrix containing growth factors (Passaniti et al., 1992
supra), female reproductive organ neovascularization following
hormonal manipulation (Shweiki et al., 1993 Clin. Invest. 91:
2235-2243), several models involving inhibition of tumor growth in
highly vascularized solid tumors (O'Reilly et al., 1994 Cell 79:
315-328; Senger et al., 1993 Cancer and Metas. Rev. 12: 303-324;
Takahasi et al., 1994 Cancer Res. 54: 4233-4237; Kim et al., 1993
supra), and transient hypoxia-induced neovascularization in the
mouse retina (Pierce et al., 1995 Proc. Natl. Acad. Sci. USA. 92:
905-909).gene
[0631] The cornea model, described in Pandey et al. supra, is the
most common and well characterized anti-angiogenic agent efficacy
screening model. This model involves an avascular tissue into which
vessels are recruited by a stimulating agent (growth factor,
thermal or alkalai burn, endotoxin). The corneal model utilizes the
intrastromal corneal implantation of a Teflon pellet soaked in a
VEGF-Hydron solution to recruit blood vessels toward the pellet,
which can be quantitated using standard microscopic and image
analysis techniques. To evaluate their anti-angiogenic efficacy,
siNA molecules are applied topically to the eye or bound within
Hydron on the Teflon pellet itself. This avascular cornea as well
as the Matrigel model (described below) provide for low background
assays. While the corneal model has been performed extensively in
the rabbit, studies in the rat have also been conducted.
[0632] The mouse model (Passaniti et al., supra) is a non-tissue
model which utilizes Matrigel, an extract of basement membrane
(Kleinman et al., 1986) or Millipore.RTM. filter disk, which can be
impregnated with growth factors and anti-angiogenic agents in a
liquid form prior to injection. Upon subcutaneous administration at
body temperature, the Matrigel or Millipore.RTM. filter disk forms
a solid implant. VEGF embedded in the Matrigel or Millipore.RTM.
filter disk is used to recruit vessels within the matrix of the
Matrigel or Millipore.RTM. filter disk which can be processed
histologically for endothelial cell specific vWF (factor VIII
antigen) immunohistochemistry, Trichrome-Masson stain, or
hemoglobin content. Like the cornea, the Matrigel or Millipore.RTM.
filter disk are avascular; however, it is not tissue. In the
Matrigel or Millipore.RTM. filter disk model, siNA molecules are
administered within the matrix of the Matrigel or Millipore.RTM.
filter disk to test their anti-angiogenic efficacy. Thus, delivery
issues in this model, as with delivery of siNA molecules by
Hydron-coated Teflon pellets in the rat cornea model, may be less
problematic due to the homogeneous presence of the siNA within the
respective matrix.
[0633] The Lewis lung carcinoma and B-16 murine melanoma models are
well accepted models of primary and metastatic cancer and are used
for initial screening of anti-cancer agents. These murine models
are not dependent upon the use of immunodeficient mice, are
relatively inexpensive, and minimize housing concerns. Both the
Lewis lung and B-16 melanoma models involve subcutaneous
implantation of approximately 10.sup.6 tumor cells from
metastatically aggressive tumor cell lines (Lewis lung lines 3LL or
D122, LLc-LN7; B-16-BL6 melanoma) in C57BL/6J mice. Alternatively,
the Lewis lung model can be produced by the surgical implantation
of tumor spheres (approximately 0.8 mm in diameter). Metastasis
also may be modeled by injecting the tumor cells directly
intraveneously. In the Lewis lung model, microscopic metastases can
be observed approximately 14 days following implantation with
quantifiable macroscopic metastatic tumors developing within 21-25
days. The B-16 melanoma exhibits a similar time course with tumor
neovascularization beginning 4 days following implantation. Since
both primary and metastatic tumors exist in these models after
21-25 days in the same animal, multiple measurements can be taken
as indices of efficacy. Primary tumor volume and growth latency as
well as the number of micro- and macroscopic metastatic lung foci
or number of animals exhibiting metastases can be quantitated. The
percent increase in lifespan can also be measured. Thus, these
models would provide suitable primary efficacy assays for screening
systemically administered siNA molecules and siNA formulations.
[0634] In the Lewis lung and B-16 melanoma models, systemic
pharmacotherapy with a wide variety of agents usually begins 1-7
days following tumor implantation/inoculation with either
continuous or multiple administration regimens. Concurrent
pharmacokinetic studies can be performed to determine whether
sufficient tissue levels of siNA can be achieved for
pharmacodynamic effect to be expected. Furthermore, primary tumors
and secondary lung metastases can be removed and subjected to a
variety of in vitro studies (i.e. target RNA reduction).
[0635] Ohno-Matsui et al., 2002, Am. J. Pathology, 160, 711-719
describe a model of severe proliferative retinopathy and retinal
detachment in mice under inducible expression of vascular
endothelial growth factor. In this model, expression of a VEGF
transgene results in elevated levels of ocular VEGF that is
associated with severe proliferative retinopathy and retinal
detachment. Furthermore, Mori et al., 2001, J. Cellular Physiology,
188, 253-263, describe a model of laser induced choroidal
neovascularization that can be used in conjunction with
intravitreous or subretianl injection of siNA molecules of the
invention to evaluate the efficacy of siNA treatment of severe
proliferative retinopathy and retinal detachment.
[0636] In utilizing these models to assess siNA activity, VEGFR1,
VEGFR2, and/or VEGFR3 protein levels can be measured clinically or
experimentally by FACS analysis. VEGFR1, VEGFR2, and/or VEGFR3
encoded mRNA levels can be assessed by Northern analysis,
RNase-protection, primer extension analysis and/or quantitative
RT-PCR. siNA molecules that block VEGFR1, VEGFR2, and/or VEGFR3
protein encoding mRNAs and therefore result in decreased levels of
VEGFR1, VEGFR2, and/or VEGFR3 activity by more than 20% in vitro
can be identified using the techniques described herein.
Example 12
siNA-Mediated Inhibition of Angiogenesis In Vivo
[0637] The purpose of this study was to assess the anti-angiogenic
activity of siNA targeted against VEGFR1, using the rat cornea
model of VEGF induced angiogenesis discussed in Example 11 above).
The siNA molecules shown in FIG. 23 have matched inverted controls
which are inactive since they are not able to interact with the RNA
target. The siNA molecules and VEGF were co-delivered using the
filter disk method. Nitrocellulose filter disks (Millipore.RTM.) of
0.057 diameter were immersed in appropriate solutions and were
surgically implanted in rat cornea as described by Pandey et al.,
supra.
[0638] The stimulus for angiogenesis in this study was the
treatment of the filter disk with 30 .mu.M VEGF which is implanted
within the cornea's stroma. This dose yields reproducible
neovascularization stemming from the pericorneal vascular plexus
growing toward the disk in a dose-response study 5 days following
implant. Filter disks treated only with the vehicle for VEGF show
no angiogenic response. The siNA were co-adminstered with VEGF on a
disk in three different siNA concentrations. One concern with the
simultaneous administration is that the siNA would not be able to
inhibit angiogenesis since VEGF receptors can be stimulated.
However, Applicant has observed that in low VEGF doses, the
neovascular response reverts to normal suggesting that the VEGF
stimulus is essential for maintaining the angiogenic response.
Blocking the production of VEGF receptors using simultaneous
administration of anti-VEGF-R mRNA siNA could attenuate the normal
neovascularization induced by the filter disk treated with
VEGF.
Materials and Methods:
Test Compounds and Controls
[0639] R&D Systems VEGF, carrier free at 75 .mu.M in 82 mM
Tris-Cl, pH 6.9
[0640] siNA, 1.67 .mu.G/.mu.L, SITE 2340 (SIRNA/RPI 29695/29699)
sense/antisense
[0641] siNA, 1.67 .mu.G/.mu.L, INVERTED CONTROL FOR SITE 2340
(SIRNA/RPI 29983/29984) sense/antisense
[0642] siNA 1.67 .mu.g/.mu.L, Site 2340 (Sirna/RPI 30196/30416)
sense/antisense
Animals
[0643] Harlan Sprague-Dawley Rats, Approximately 225-250 g
[0644] 45 males, 5 animals per group.
Husbandry
[0645] Animals are housed in groups of two. Feed, water,
temperature and humidity are determined according to Pharmacology
Testing Facility performance standards (SOP's) which are in
accordance with the 1996 Guide for the Care and Use of Laboratory
Animals (NRC). Animals are acclimated to the facility for at least
7 days prior to experimentation. During this time, animals are
observed for overall health and sentinels are bled for baseline
serology.
Experimental Groups
[0646] Each solution (VEGF and siNAs) was prepared as a 1.times.
solution for final concentrations shown in the experimental groups
described in Table III.
siNA Annealing Conditions
[0647] siNA sense and antisense strands are annealed for 1 minute
in H.sub.2O at 1.67 mg/mL/strand followed by a 1 hour incubation at
37.degree. C. producing 3.34 mg/mL of duplexed siNA. For the 20
.mu.g/eye treatment, 6 .mu.Ls of the 3.34 mg/mL duplex is injected
into the eye (see below). The 3.34 mg/mL duplex siNA can then be
serially diluted for dose response assays.
Preparation of VEGF Filter Disk
[0648] For corneal implantation, 0.57 mm diameter nitrocellulose
disks, prepared from 0.45 .mu.m pore diameter nitrocellulose filter
membranes (Millipore Corporation), were soaked for 30 min in 1
.mu.L of 75 .mu.M VEGF in 82 mM Tris.HCl (pH 6.9) in covered petri
dishes on ice. Filter disks soaked only with the vehicle for VEGF
(83 mM Tris-Cl pH 6.9) elicit no angiogenic response.
Corneal Surgery
[0649] The rat corneal model used in this study was a modified from
Koch et al. Supra and Pandey et al., supra. Briefly, corneas were
irrigated with 0.5% povidone iodine solution followed by normal
saline and two drops of 2% lidocaine. Under a dissecting microscope
(Leica MZ-6), a stromal pocket was created and a presoaked filter
disk (see above) was inserted into the pocket such that its edge
was 1 mm from the corneal limbus.
Intraconjunctival Injection of Test Solutions
[0650] Immediately after disk insertion, the tip of a 40-50 .mu.m
OD injector (constructed in our laboratory) was inserted within the
conjunctival tissue 1 mm away from the edge of the corneal limbus
that was directly adjacent to the VEGF-soaked filter disk. Six
hundred nanoliters of test solution (siNA, inverted control or
sterile water vehicle) were dispensed at a rate of 1.2 .mu.L/min
using a syringe pump (Kd Scientific). The injector was then
removed, serially rinsed in 70% ethanol and sterile water and
immersed in sterile water between each injection. Once the test
solution was injected, closure of the eyelid was maintained using
microaneurism clips until the animal began to recover gross motor
activity. Following treatment, animals were warmed on a heating pad
at 37.degree. C.
Quantitation of Angiogenic Response
[0651] Five days after disk implantation, animals were euthanized
following administration of 0.4 mg/kg atropine and corneas were
digitally imaged. The neovascular surface area (NSA, expressed in
pixels) was measured postmortem from blood-filled corneal vessels
using computerized morphometry (Image Pro Plus, Media Cybernetics,
v2.0). The individual mean NSA was determined in triplicate from
three regions of identical size in the area of maximal
neovascularization between the filter disk and the limbus. The
number of pixels corresponding to the blood-filled corneal vessels
in these regions was summated to produce an index of NSA. A group
mean NSA was then calculated. Data from each treatment group were
normalized to VEGF/siNA vehicle-treated control NSA and finally
expressed as percent inhibition of VEGF-induced angiogenesis.
Statistics
[0652] After determining the normality of treatment group means,
group mean percent inhibition of VEGF-induced angiogenesis was
subjected to a one-way analysis of variance. This was followed by
two post-hoc tests for significance including Dunnett's (comparison
to VEGF control) and Tukey-Kramer (all other group mean
comparisons) at alpha=0.05. Statistical analyses were performed
using JMP v.3.1.6 (SAS Institute).
[0653] Results of the study are graphically represented in FIGS. 23
and 76. As shown in FIG. 23, VEGFr1 site 4229 active siNA
(Sirna/RPI 29695/29699) at three concentrations were effective at
inhibiting angiogenesis compared to the inverted siNA control
(Sirna/RPI 29983/29984) and the VEGF control. A chemically modified
version of the VEGFr1 site 4229 active siNA comprising a sense
strand having 2'-deoxy-2'-fluoro pyrimidines and ribo purines with
5' and 3' terminal inverted deoxyabasic residues and an antisense
strand having having 2'-deoxy-2'-fluoro pyrimidines and ribo
purines with a terminal 3'-phosphorothioate internucleotide linkage
(Sirna/RPI 30196/30416), showed similar inhibition. Furthermore,
VEGFr1 site 349 active siNA having "Stab 9/10" chemistry (Sirna #
31270/31273) was tested for inhibition of VEGF-induced angiogenesis
at three different concentrations (2.0 ug, 1.0 ug, and 0.1 ug dose
response) as compared to a matched chemistry inverted control siNA
construct (Sirna # 31276/31279) at each concentration and a VEGF
control in which no siNA was administered. As shown in FIG. 76, the
active siNA construct having "Stab 9/10" chemistry (Sirna #
31270/31273) is highly effective in inhibiting VEGF-induced
angiogenesis in the rat corneal model compared to the matched
chemistry inverted control siNA at concentrations from 0.1 ug to
2.0 ug. These results demonstrate that siNA molecules having
different chemically modified compositions, such as the
modifications described herein, are capable of significantly
inhibiting angiogenesis in vivo.
Example 13
Inhibition of HBV Using siNA Molecules of the Invention
Transfection of HepG2 Cells with psHBV-1 and siNA
[0654] The human hepatocellular carcinoma cell line Hep G2 was
grown in Dulbecco's modified Eagle media supplemented with 10%
fetal calf serum, 2 mM glutamine, 0.1 mM nonessential amino acids,
1 mM sodium pyruvate, 25 mM Hepes, 100 units penicillin, and 100
.mu.g/ml streptomycin. To generate a replication competent cDNA,
prior to transfection the HBV genomic sequences are excised from
the bacterial plasmid sequence contained in the psHBV-1 vector.
Other methods known in the art can be used to generate a
replication competent cDNA. This was done with an EcoRI and Hind
III restriction digest. Following completion of the digest, a
ligation was performed under dilute conditions (20 .mu.g/ml) to
favor intermolecular ligation. The total ligation mixture was then
concentrated using Qiagen spin columns.
siNA Activity Screen and Dose Response Assay
[0655] Transfection of the human hepatocellular carcinoma cell
line, Hep G2, with replication-competent HBV DNA results in the
expression of HBV proteins and the production of virions. To test
the efficacy of siNAs targeted against HBV RNA, several siNA
duplexes targeting different sites within HBV pregenomic RNA were
co-transfected with HBV genomic DNA once at 25 nM with lipid at
12.5 ug/ml into Hep G2 cells, and the subsequent levels of secreted
HBV surface antigen (HBsAg) were analyzed by ELISA (see FIG. 24).
Inverted sequence duplexes were used as negative controls.
Subsequently, dose response studies were performed in which the
siNA duplexes were co-transfected with HBV genomic DNA at 0.5, 5,
10 and 25 nM with lipid at 12.5 ug/ml into Hep G2 cells, and the
subsequent levels of secreted HBV surface antigen (HBsAg) were
analyzed by ELISA (see FIG. 25).
Analysis of HBsAg Levels Following siNA Treatment
[0656] To determine siNA activity, HbsAg levels were measured
following transfection with siNA. Immulon 4 (Dynax) microtiter
wells were coated overnight at 4.degree. C. with anti-HBsAg Mab
(Biostride B88-95-31ad,ay) at 1 .mu.g/ml in Carbonate Buffer
(Na2CO3 15 mM, NaHCO3 35 mM, pH 9.5). The wells were then washed
4.times. with PBST (PBS, 0.05% Tween.RTM. 20) and blocked for 1 hr
at 37.degree. C. with PBST, 1% BSA. Following washing as above, the
wells were dried at 37.degree. C. for 30 min. Biotinylated goat
ant-HBsAg (Accurate YVS1807) was diluted 1:1000 in PBST and
incubated in the wells for 1 hr. at 37.degree. C. The wells were
washed 4.times. with PBST. Streptavidin/Alkaline Phosphatase
Conjugate (Pierce 21324) was diluted to 250 ng/ml in PBST, and
incubated in the wells for 1 hr. at 37.degree. C. After washing as
above, p-nitrophenyl phosphate substrate (Pierce 37620) was added
to the wells, which were then incubated for 1 hour at 37.degree. C.
The optical density at 405 nm was then determined. Results of the
HBV screen study are summarized in FIG. 24, whereas the results of
a dose response assay using lead siNA constructs targeting sites
262 and 1580 of the HBV pregenomic RNA are shown in FIG. 25. As
shown in FIG. 25, the siNA constructs targeting sites 262 and 1580
of HBV RNA provides significant dose response inhibition of viral
replication/activity when compared to inverted siNA controls.
Comparison of Different Chemically Stabilized siNA Motifs Targeting
HBV RNA Site 1580
[0657] Two different siNA stabilization chemistries were compared
in a dose response HBsAg assay using inverted matched chemistry
controls. The "Stab7/8" (Table IV) constructs comprise a sense
strand having 2'-deoxy-2'-fluoro pyrimidine nucleotides and
2'-deoxy purine nucleotides with 5' and 3' terminal inverted
deoxyabasic residues and an antisense strand having
2'-deoxy-2'-fluoro pyrimidine nucleotides and 2'-O-methyl purine
nucleotides with a terminal 3' phosphorothioate linkage. The
"Stab7/11 (Table IV) constructs comprise a sense strand having
2'-deoxy-2'-fluoro pyrimidine nucleotides and 2'-deoxy purine
nucleotides with 5' and 3' terminal inverted deoxyabasic residues
and an antisense strand having 2'-deoxy-2'-fluoro pyrimidine
nucleotides and 2'-deoxy purine nucleotides with a terminal 3'
phosphorothioate linkage (see for example Table I). As shown in
FIG. 26, the chemically stabilized siNA constructs both show
significant inhibition of HBV antigen in a dose dependent manner
compared to matched inverted contols.
Time Course Evaluation of Different Chemically Stabilized siNA
Motifs Targeting HBV RNA Site 1580
[0658] Four different siNA constructs having different
stabilization chemistries were compared to an unstabilized siRNA
construct in a dose response time course HBsAg assay, the results
of which are shown in FIGS. 28-31. The different constructs were
compared to an unstabilized ribonucleotide control siRNA construct
(Sirna/RPI#30287/30298) at different concentrations (5 nM, 10 nM,
25 nM, 50 nM, and 100 nM) over the course of nine days. Activity
based on HBsAg levels was determined at day 3, day 6, and day 9.
The "Stab 4/5" (Table IV) constructs comprise a sense strand
(Sirna/RPI#30355) having 2'-deoxy-2'-fluoro pyrimidine nucleotides
and purine ribonucleotides with 5' and 3' terminal inverted
deoxyabasic residues and an antisense strand (Sirna/RPI#30366)
having 2'-deoxy-2'-fluoro pyrimidine nucleotides and purine
ribonucleotides with a terminal 3' phosphorothioate linkage (data
shown in FIG. 28). The "Stab7/8" (Table IV) constructs comprise a
sense strand (Sirna/RPI#30612) having 2'-deoxy-2'-fluoro pyrimidine
nucleotides and 2'-deoxy purine nucleotides with 5' and 3' terminal
inverted deoxyabasic residues and an antisense strand
(Sirna/RPI#30620) having 2'-deoxy-2'-fluoro pyrimidine nucleotides
and 2'-O-methyl purine nucleotides with a terminal 3'
phosphorothioate linkage (data shown in FIG. 29). The "Stab7/11
(Table IV) constructs comprise a sense (Sirna/RPI#30612) strand
having 2'-deoxy-2'-fluoro pyrimidine nucleotides and 2'-deoxy
purine nucleotides with 5' and 3' terminal inverted deoxyabasic
residues and an antisense strand (Sirna/RPI#31175) having
2'-deoxy-2'-fluoro pyrimidine nucleotides and 2'-deoxy purine
nucleotides with a terminal 3' phosphorothioate linkage (data shown
in FIG. 30). The "Stab9/10 (Table IV) constructs comprise a sense
(Sirna/RPI#31335) strand having ribonucleotides with 5' and 3'
terminal inverted deoxyabasic residues and an antisense strand
(Sirna/RPI#31337) having ribonucleotides with a terminal 3'
phosphorothioate linkage (data shown in FIG. 31). As shown in FIGS.
28-31, the chemically stabilized siNA constructs all show
significantly greater inhibition of HBV antigen in a dose dependent
manner over the time course experiment compared to the unstabilized
siRNA construct.
[0659] A second study was performed using the stab 4/5 (Sirna
30355/30366), stab 7/8 (Sirna 30612/30620), and stab 7/11 (Sirna
30612/31175) siNA constructs described above to examine the
duration of effect of the modified siNA constructs out to 21 days
post transfection compared to an all RNA control siNA (Sirna
30287/30298). A single transfection was performed with siRNAs
targeted to HBV site 1580 and the culture media was subsequently
replaced every three days. Secreted HBsAg levels were monitored for
at 3, 6, 9, 12, 15, 18 and 21 days post-transfection. FIG. 77 shows
activity of siNAs in reduction of HBsAg levels compared to matched
inverted controls at A. 3 days, B. 9 days, and C. 21 days post
transfection. Also shown is the corresponding percent inhibition as
function of time at siNA concentrations of D. 100 nM, E. 50 nM, and
F. 25 nM.
Example 14
Inhibition of HCV Using siNA Molecules of the Invention
siNA Inhibition of a Chimeric HCV/Poliovirus in HeLa Cells
[0660] Inhibition of a chimeric HCV/Poliovirus was investigated
using 21 nucleotide siNA duplexes in HeLa cells. Seven siNA
constructs were designed that target three regions in the highly
conserved 5' untranslated region (UTR) of HCV RNA. The siNAs were
screened in two cell culture systems dependent upon the 5'-UTR of
HCV; one requires translation of an HCV/luciferase gene, while the
other involves replication of a chimeric HCV/poliovirus (PV) (see
Blatt et al., U.S. Ser. No. 09/740,332, filed Dec. 18, 2000,
incorporated by reference herein). Two siNAs (29579/29586;
29578/29585) targeting the same region (shifted by one nucleotide)
are active in both systems (see FIG. 32) as compared with inverse
control siNA (29593/29600). For example, a >85% reduction in
HCVPV replication was observed in siNA-treated cells compared to an
inverse siNA control (FIG. 32) with an IC50=.about.2.5 nM (FIG.
33). To develop nuclease-resistant siNA for in vivo applications,
siNAs can be modified to contain stabilizing chemical
modifications. Such modifications include phosphorothioate linkages
(P.dbd.S), 2'-O-methyl nucleotides, 2'-fluoro (F) nucleotides,
2'-deoxy nucleotides, universal base nucleotides, 5' and/or 3' end
modifications and a variety of other nucleotide and non-nucleotide
modifications, in one or both siNA strands. Several of these
constructs were tested in the HCV/poliovirus chimera system,
demonstrating significant reduction in viral replication (FIGS.
34-37). siNA constructs shown in FIGS. 34-37 are referred to by
Sirna/RPI#s that are cross referenced to Table III, which shows the
sequence and chemical modifications of the constructs. siNA
activity is compared to relevant controls (untreated cells,
scrambled/inactive control sequences, or transfection controls). As
shown in the Figures, siNA constructs of the invention provide
potent inhibition of HCV RNA in the HCV/poliovirus chimera system.
As such, siNA constructs, including chemically modified, nuclease
resistant siNA molecules, represent an important class of
therapeutic agents for treating chronic HCV infection.
siNA Inhibition of a HCV RNA Expression in a HCV Replicon
System
[0661] In addition, a HCV replicon system was used to test the
efficacy of siNAs targeting HCV RNA. The reagents are tested in
cell culture using Huh7 cells (see for example Randall et al.,
2003, PNAS USA, 100, 235-240) to determine the extent of RNA and
protein inhibition. siNA were selected against the HCV target as
described herein. RNA inhibition was measured after delivery of
these reagents by a suitable transfection agent to Huh7 cells.
Relative amounts of target RNA are measured versus actin using
real-time PCR monitoring of amplification (eg., ABI 7700
Taqman.RTM.). A comparison is made to a mixture of oligonucleotide
sequences designed to target unrelated targets or to a randomized
siNA control with the same overall length and chemistry, but with
randomly substituted nucleotides at each position. Primary and
secondary lead reagents were chosen for the target and optimization
performed. After an optimal transfection agent concentration is
chosen, a RNA time-course of inhibition is performed with the lead
siNA molecule. In addition, a cell-plating format can be used to
determine RNA inhibition. A non-limiting example of a multiple
target screen to assay siNA mediated inhibition of HCV RNA is shown
in FIG. 38. siNA reagents (Table I) were transfected at 25 nM into
Huh7 cells and HCV RNA quantitated compared to untreated cells
("cells" column in the figure) and cells transfected with
lipofectamine ("LFA2K" column in the figure). As shown in the
Figure, several siNA constructs show significant inhibition of HCV
RNA expression in the Huh7 replicon system. Chemically modified
siNA constructs were then screened as described above, with a
non-limiting example of a Stab 7/8 (see Table IV) chemisty siNA
construct screen shown in FIG. 40. A follow up dose response study
using chemically modified siNA constructs (Stab 4/5, see Table IV)
at concentrations of 5 nM, 10 nM, 25 nM and 100 nM compared to
matched chemistry inverted controls is shown in FIG. 39, whereas a
dose response study for Stab 7/8 constructs at concentrations of 5
nM, 10 nM, 25 nM, 50 nM and 100 nM compared to matched chemistry
inverted controls is shown in FIG. 41.
Example 15
Target Discovery in Mammalian Cells Using siNA Molecules
[0662] In a non-limiting example, compositions and methods of the
invention are used to discover genes involved in a process of
interest within mammalian cells, such as cell growth,
proliferation, apoptosis, morphology, angiogenesis,
differentiation, migration, viral multiplication, drug resistance,
signal transduction, cell cycle regulation, or temperature
sensitivity or other process. First, a randomized siNA library is
generated. These constructs are inserted into a vector capable of
expressing a siNA from the library inside mammalian cells.
Alternately, a pool of synthetic siNA molecules is generated.
Reporter System
[0663] In order to discover genes playing a role in the expression
of certain proteins, such as proteins involved in a cellular
process described herein, a readily assayable reporter system is
constructed in which a reporter molecule is co-expressed when a
particular protein of interest is expressed. The reporter system
consists of a plasmid construct bearing a gene coding for a
reporter gene, such as Green Fluorescent Protein (GFP) or other
reporter proteins known and readily available in the art. The
promoter region of the GFP gene is replaced by a portion of a
promoter for the protein of interest sufficient to direct efficient
transcription of the GFP gene. The plasmid can also contain a drug
resistance gene, such as neomycin resistance, in order to select
cells containing the plasmid.
Host Cell Lines for Target Discovery
[0664] A cell line is selected as host for target discovery. The
cell line is preferably known to express the protein of interest,
such that upstream genes controlling the expression of the protein
can be identified when modulated by a siNA construct expressed
therein. The cells preferably retain protein expression
characteristics in culture. The reporter plasmid is transfected
into cells, for example, using a cationic lipid formulation.
Following transfection, the cells are subjected to limiting
dilution cloning, for example, under selection by 600 .mu.g/mL
Geneticin. Cells retaining the plasmid survive the Geneticin
treatment and form colonies derived from single surviving cells.
The resulting clonal cell lines are screened by flow cytometry for
the capacity to upregulate GFP production. Treating the cells with,
for example, sterilized M9 bacterial medium in which Pseudomonas
aeruginosa had been cultured (Pseudomonas conditioned medium, PCM)
is used to induce the promoter. The PCM is supplemented with
phorbol myristate acetate (PMA). A clonal cell line highly
responsive to promoter induction is selected as the reporter line
for subsequent studies.
siNA Library Construction
[0665] A siNA library was constructed with oligonucletides
containing hairpin siNA constructs having randomized antisense
regions and self complementary sense regions. The library is
generated synthesizing siNA constructs having randomized sequence.
Alternately, the siNA libraries are constructed as described in
Usman et al., U.S. Ser. No. 60/402,996 (incorporated by reference
herein) Oligo sequence 5' and 3' of the siNA contains restriction
endonuclease cleavage sites for cloning. The 3' trailing sequence
forms a stem-loop for priming DNA polymerase extension to form a
hairpin structure. The hairpin DNA construct is melted at
90.degree. C. allowing DNA polymerase to generate a dsDNA
construct. The double-stranded siNA library is cloned into, for
example, a U6+27 transcription unit located in the 5' LTR region of
a retroviral vector containing the human nerve growth factor
receptor (hNGFr) reporter gene. Positioning the U6+27/siNA
transcription unit in the 5' LTR results in a duplication of the
transcription unit when the vector integrates into the host cell
genome. As a result, the siNA is transcribed by RNA polymerase III
from U6+27 and by RNA polymerase II activity directed by the 5'
LTR. The siNA library is packaged into retroviral particles that
are used to infect and transduce clonal cells selected above.
Assays of the hNGFr reporter are used to indicate the percentage of
cells that incorporated the siNA construct. By randomized region is
meant a region of completely random sequence and/or partially
random sequence. By completely random sequence is meant a sequence
wherein theoretically there is equal representation of A, T, G and
C nucleotides or modified derivatives thereof, at each position in
the sequence. By partially random sequence is meant a sequence
wherein there is an unequal representation of A, T, G and C
nucleotides or modified derivatives thereof, at each position in
the sequence. A partially random sequence can therefore have one or
more positions of complete randomness and one or more positions
with defined nucleotides.
Enriching for Non-Responders to Induction
[0666] Sorting of siNA library-containing cells is performed to
enrich for cells that produce less reporter GFP after treatment
with the promoter inducers PCM and PMA. Lower GFP production cancan
be due to RNAi activity against genes involved in the activation of
the mucin promoter. Alternatively, siNA can directly target the
mucin/GFP transcript resulting in reduced GFP expression.
[0667] Cells are seeded at a certain density, such as
1.times.10.sup.6 per 150 cm.sup.2 style cell culture flasks and
grown in the appropriate cell culture medium with fetal bovine
serum. After 72 hours, the cell culture medium is replaced with
serum-free medium. After 24 hours of serum deprivation, the cells
are treated with serum-containing medium supplemented with PCM (to
40%) and PMA (to 50 nM) to induced GFP production. After 20 to 22
hours, cells are monitored for GFP level on, for example, a FACStar
Plus cell sorter. Sorting is performed if .gtoreq.90% of siNA
library cells from an unsorted control sample were induced to
produce GFP above background levels. Two cell fractions are
collected in each round of sorting. Following the appropriate round
of sorting, the M1 fraction is selected to generate a database of
siNA molecules present in the sorted cells.
Recovery of siNA Sequence from Sorted Cells
[0668] Genomic DNA is obtained from sorted siNA library cells by
standard methods. Nested polymerase chain reaction (PCR) primers
that hybridized to the retroviral vector 5' and 3' of the siNA are
used to recover and amplify the siNA sequences from the particular
clone of library cell DNA. The PCR product is ligated into a
bacterial cloning vector. The recovered siNA library in plasmid
form can be used to generate a database of siNA sequences. For
example, the library is cloned into E. coli. DNA is prepared by
plasmid isolation from bacterial colonies or by direct colony PCR
and siNA sequence is determined. A second method can use the siNA
library to transfect cloned cells. Clonal lines of stably
transfected cells are established and induced with, for example,
PCM and PMA. Those lines which fail to respond to GFP induction are
probed by PCR for single siNA integration events. The unique siNA
sequences obtained by both methods are added to a Target Sequence
Tag (TST) database.
Bioinformatics
[0669] The antisense region sequences of the isolated siNA
constructs are compared to public and private gene data banks. Gene
matches are compiled according to perfect and imperfect matches.
Potential gene targets are categorized by the number of different
siNA sequences matching each gene. Genes with more than one perfect
siNA match are selected for Target Validation studies.
Validation of the Target Gene
[0670] To validate a target as a regulator of protein expression,
siNA reagents are designed to the target gene cDNA sequence from
Genbank. The siNA reagents are complexed with a cationic lipid
formulation prior to administration to cloned cells at appropriate
concentrations (e.g. 5-50 nM or less). Cells are treated with siNA
reagents, for example from 72 to 96 hours. Before the termination
of siNA treatment, PCM (to 40%) and PMA (to 50 nM), for example,
are added to induce the promoter. After twenty hours of induction
the cells are harvested and assayed for phenotypic and molecular
parameters. Reduced GFP expression in siNA treated cells (measured
by flow cytometry) is taken as evidence for validation of the
target gene. Knockdown of target RNA in siNA treated cells can
correlate with reduced endogenous RNA and reduced GFP RNA to
complete validation of the target.
Example 16
Screening siNA Constructs for Improved Pharmacokinetics
[0671] In a non-limiting example, siNA constructs are screened in
vivo for improved pharmacokinetic properties compared to all RNA or
unmodified siNA constructs. Chemical modifications are introduced
into the siNA construct based on educated design parameters (e.g.
introducing 2'-mofications, base modifications, backbone
modifications, terminal cap modifications, or covalently attached
conjugates etc). The modified construct in tested in an appropriate
system (e.g human serum for nuclease resistance, shown, or an
animal model for PK/delivery parameters). In parallel, the siNA
construct is tested for RNAi activity, for example in a cell
culture system such as a luciferase reporter assay). Lead siNA
constructs are then identified which possess a particular
characteristic while maintaining RNAi activity, and can be further
modified and assayed once again. This same approach can be used to
identify siNA-conjugate molecules with improved pharmacokinetic
profiles, delivery, localized delivery, cellular uptake, and RNAi
activity.
Example 17
Indications
[0672] The siNA molecules of the invention can be used to treat a
variety of diseases and conditions through modulation of gene
expression. Using the methods described herein, chemically modified
siNA molecules can be designed to modulate the expression any
number of target genes, including but not limited to genes
associated with cancer, metabolic diseases, infectious diseases
such as viral, bacterial or fungal infections, neurologic diseases,
musculoskeletal diseases, diseases of the immune system, diseases
associated with signaling pathways and cellular messengers, and
diseases associated with transport systems including molecular
pumps and channels.
[0673] Non-limiting examples of various viral genes that can be
targeted using siNA molecules of the invention include Hepatitis C
Virus (HCV, for example Genbank Accession Nos: D11168, D50483.1,
L38318 and S82227), Hepatitis B Virus (HBV, for example GenBank
Accession No. AF100308.1), Human Immunodeficiency Virus type 1
(HIV-1, for example GenBank Accession No. U51188), Human
Immunodeficiency Virus type 2 (HIV-2, for example GenBank Accession
No. X60667), West Nile Virus (WNV for example GenBank accession No.
NC.sub.--001563), cytomegalovirus (CMV for example GenBank
Accession No. NC.sub.--001347), respiratory syncytial virus (RSV
for example GenBank Accession No. NC.sub.--001781), influenza virus
(for example example GenBank Accession No. AF037412, rhinovirus
(for example, GenBank accession numbers: D00239, X02316, X01087,
L24917, M16248, K02121, X01087), papillomavirus (for example
GenBank Accession No. NC.sub.--001353), Herpes Simplex Virus (HSV
for example GenBank Accession No. NC.sub.--001345), and other
viruses such as HTLV (for example GenBank Accession No. AJ430458).
Due to the high sequence variability of many viral genomes,
selection of siNA molecules for broad therapeutic applications
would likely involve the conserved regions of the viral genome.
Nonlimiting examples of conserved regions of the viral genomes
include but are not limited to 5'-Non Coding Regions (NCR), 3'-Non
Coding Regions (NCR) LTR regions and/or internal ribosome entry
sites (IRES). siNA molecules designed against conserved regions of
various viral genomes will enable efficient inhibition of viral
replication in diverse patient populations and may ensure the
effectiveness of the siNA molecules against viral quasi species
which evolve due to mutations in the non-conserved regions of the
viral genome.
[0674] Non-limiting examples of human genes that can be targeted
using siNA molecules of the invention using methods described
herein include any human RNA sequence, for example those commonly
referred to by Genbank Accession Number. These RNA sequences can be
used to design siNA molecules that inhibit gene expression and
therefore abrogate diseases, conditions, or infections associated
with expression of those genes. Such non-limiting examples of human
genes that can be targeted using siNA molecules of the invention
include VEGFr (VEGFR1 for example GenBank Accession No.
XM.sub.--067723, VEGFR2 for example GenBank Accession No.
AF063658), HER1, HER2, HER3, and HER4 (for example Genbank
Accession Nos: NM.sub.--005228, NM.sub.--004448, NM.sub.--001982,
and NM.sub.--005235 respectively), telomerase (TERT, for example
GenBank Accession No. NM.sub.--003219), telomerase RNA (for example
GenBank Accession No. U86046), NFkappaB, Rel-A (for example GenBank
Accession No. NM.sub.--005228), NOGO (for example GenBank Accession
No. AB020693), NOGOr (for example GenBank Accession No.
XM.sub.--015620), RAS (for example GenBank Accession No.
NM.sub.--004283), RAF (for example GenBank Accession No.
XM.sub.--033884), CD20 (for example GenBank Accession No. X07203),
METAP2 (for example GenBank Accession No. NM.sub.--003219), CLCA1
(for example GenBank Accession No. NM.sub.--001285), phospholamban
(for example GenBank Accession No. NM.sub.--002667), PTP1B (for
example GenBank Accession No. M31724), PCNA (for example GenBank
Accession No. NM.sub.--002592.1), PKC-alpha (for example GenBank
Accession No. NM.sub.--002737) and others. The genes described
herein are provided as non-limiting examples of genes that can be
targeted using siNA molecules of the invention. Additional examples
of such genes are described by accession number in Beigelman et
al., U.S. Ser. No. 60/363,124, filed Mar. 11, 2002 and incorporated
by reference herein in its entirety.
[0675] The siNA molecule of the invention can also be used in a
variety of agricultural applications involving modulation of
endogenous or exogenous gene expression in plants using siNA,
including use as insecticidal, antiviral and anti-fungal agents or
modulate plant traits such as oil and starch profiles and stress
resistance.
Example 18
Diagnostic Uses
[0676] The siNA molecules of the invention can be used in a variety
of diagnostic applications, such as in the identification of
molecular targets (e.g., RNA) in a variety of applications, for
example, in clinical, industrial, environmental, agricultural
and/or research settings. Such diagnostic use of siNA molecules
involves utilizing reconstituted RNAi systems, for example, using
cellular lysates or partially purified cellular lysates. siNA
molecules of this invention can be used as diagnostic tools to
examine genetic drift and mutations within diseased cells or to
detect the presence of endogenous or exogenous, for example viral,
RNA in a cell. The close relationship between siNA activity and the
structure of the target RNA allows the detection of mutations in
any region of the molecule, which alters the base-pairing and
three-dimensional structure of the target RNA. By using multiple
siNA molecules described in this invention, one can map nucleotide
changes, which are important to RNA structure and function in
vitro, as well as in cells and tissues. Cleavage of target RNAs
with siNA molecules can be used to inhibit gene expression and
define the role of specified gene products in the progression of
disease or infection. In this manner, other genetic targets can be
defined as important mediators of the disease. These experiments
will lead to better treatment of the disease progression by
affording the possibility of combination therapies (e.g., multiple
siNA molecules targeted to different genes, siNA molecules coupled
with known small molecule inhibitors, or intermittent treatment
with combinations siNA molecules and/or other chemical or
biological molecules). Other in vitro uses of siNA molecules of
this invention are well known in the art, and include detection of
the presence of mRNAs associated with a disease, infection, or
related condition. Such RNA is detected by determining the presence
of a cleavage product after treatment with a siNA using standard
methodologies, for example, fluorescence resonance emission
transfer (FRET).
[0677] In a specific example, siNA molecules that cleave only
wild-type or mutant forms of the target RNA are used for the assay.
The first siNA molecules (i.e., those that cleave only wild-type
forms of target RNA) are used to identify wild-type RNA present in
the sample and the second siNA molecules (i.e., those that cleave
only mutant forms of target RNA) are used to identify mutant RNA in
the sample. As reaction controls, synthetic substrates of both
wild-type and mutant RNA are cleaved by both siNA molecules to
demonstrate the relative siNA efficiencies in the reactions and the
absence of cleavage of the "non-targeted" RNA species. The cleavage
products from the synthetic substrates also serve to generate size
markers for the analysis of wild-type and mutant RNAs in the sample
population. Thus, each analysis requires two siNA molecules, two
substrates and one unknown sample, which is combined into six
reactions. The presence of cleavage products is determined using an
RNase protection assay so that full-length and cleavage fragments
of each RNA can be analyzed in one lane of a polyacrylamide gel. It
is not absolutely required to quantify the results to gain insight
into the expression of mutant RNAs and putative risk of the desired
phenotypic changes in target cells. The expression of mRNA whose
protein product is implicated in the development of the phenotype
(i.e., disease related or infection related) is adequate to
establish risk. If probes of comparable specific activity are used
for both transcripts, then a qualitative comparison of RNA levels
is adequate and decreases the cost of the initial diagnosis. Higher
mutant form to wild-type ratios are correlated with higher risk
whether RNA levels are compared qualitatively or
quantitatively.
Example 19
Synthesis of siNA Conjugates
[0678] The introduction of conjugate moieties to siNA molecules of
the invention is accomplished either during solid phase synthesis
using phosphoramidite chemistry described above, or
post-synthetically using, for example, N-hydroxysuccinimide (NHS)
ester coupling to an amino linker present in the siNA. Typically, a
conjugate introduced during solid phase synthesis will be added to
the 5'-end of a nucleic acid sequence as the final coupling
reaction in the synthesis cycle using the phosphoramidite approach.
Coupling conditions can be optimized for high yield coupling, for
example by modification of coupling times and reagent
concentrations to effectuate efficient coupling. As such, the
5'-end of the sense strand of a siNA molecule is readily conjugated
with a conjugate moiety having a reactive phosphorus group
available for coupling (e.g., a compound having Formulae 1, 5, 8,
55, 56, 57, 60, 86, 92, 104, 110, 113, 115, 116, 117, 118, 120, or
122) using the phosphoramidite approach, providing a 5'-terminal
conjugate (see for example FIG. 65).
[0679] Conjugate precursors having a reactive phosphorus group and
a protected hydroxyl group can be used to incorporate a conjugate
moiety anywhere in the siNA sequence, such as in the loop portion
of a single stranded hairpin siNA construct (see for example FIG.
66). For example, using the phosphoramidite approach, a conjugate
moiety comprising a phosphoramidite and protected hydroxyl (e.g., a
compound having Formulae 86, 92, 104, 113, 115, 116, 117, 118, 120,
or 122 herein) is first coupled at the desired position within the
siNA sequence using solid phase synthesis phosphoramidite coupling.
Second, removal of the protecting group (e.g., dimethoxytrityl)
allows coupling of additional nucleotides to the siNA sequence.
This approach allows the conjugate moiety to be positioned anywhere
within the siNA molecule.
[0680] Conjugate derivatives can also be introduced to a siNA
molecule post synthetically. Post synthetic conjugation allows a
conjugate moiety to be introduced at any position within the siNA
molecule where an appropriate functional group is present (e.g., a
C5 alkylamine linker present on a nucleotide base or a
2'-alkylamine linker present on a nucleotide sugar can provide a
point of attachment for an NHS-conjugate moiety). Generally, a
reactive chemical group present in the siNA molecule is unmasked
following synthesis, thus allowing post-synthetic coupling of the
conjugate to occur. In a non-limiting example, an protected amino
linker containing nucleotide (e.g., TFA protected C5 propylamino
thymidine) is introduced at a desired position of the siNA during
solid phase synthesis. Following cleavage and deprotection of the
siNA, the free amine is made available for NHS ester coupling of
the conjugate at the desired position within the siNA sequence,
such as at the 3'-end of the sense and/or antisense strands, the 3'
and/or 5'-end of the sense strand, or within the siNA sequence,
such as in the loop portion of a single stranded hairpin siNA
sequence.
[0681] A conjugate moiety can be introduced at different locations
within a siNA molecule using both solid phase synthesis and
post-synthetic coupling approaches. For example, solid phase
synthesis can be used to introduce a conjugate moiety at the 5'-end
of the siNA (e.g. sense strand) and post-synthetic coupling can be
used to introduce a conjugate moiety at the 3'-end of the siNA
(e.g. sense strand and/or antisense strand). As such, a siNA sense
strand having 3' and 5' end conjugates can be synthesized (see for
example FIG. 65). Conjugate moieties can also be introduced in
other combinations, such as at the 5'-end, 3'-end and/or loop
portions of a siNA molecule (see for example FIG. 66).
Example 20
Phamacokinetics of siNA Conjugates (FIG. 67)
[0682] Three nuclease resistant siNA molecule targeting site 1580
of hepatitis B virus (HBV) RNA were designed using Stab 7/8
chemistry (see Table IV) and a 5'-terminal conjugate moiety.
[0683] One siNA conjugate comprises a branched cholesterol
conjugate linked to the sense strand of the siNA. The "cholesterol"
siNA conjugate molecule has the structure shown below:
##STR98##
[0684] where T stands for thymidine, B stands for inverted
deoxyabasic, G stands for 2'-deoxy guanosine, A stands for 2'-deoxy
adenosine, G stands for 2'-O-methyl guanosine, A stands for
2'-O-methyl adenosine, u stands for 2'-fluoro uridine, c stands for
2'-fluoro cytidine, a stands for adenosine, and s stands for
phosphorothioate linkage.
[0685] Another siNA conjugate comprises a branched phospholipid
conjugate linked to the sense strand of the siNA. The
"phospholipid" siNA conjugate molecule has the structure shown
below: ##STR99##
[0686] where T stands for thymidine, B stands for inverted
deoxyabasic, G stands for 2'-deoxy guanosine, A stands for 2'-deoxy
adenosine, G stands for 2'-O-methyl guanosine, A stands for
2'-O-methyl adenosine, u stands for 2'-fluoro uridine, c stands for
2'-fluoro cytidine, a stands for adenosine, and s stands for
phosphorothioate linkage.
[0687] Another siNA conjugate comprises a polyethylene glycol (PEG)
conjugate linked to the sense strand of the siNA. The "PEG" siNA
conjugate molecule has the structure shown below: ##STR100##
[0688] where T stands for thymidine, B stands for inverted
deoxyabasic, G stands for 2'-deoxy guanosine, A stands for 2'-deoxy
adenosine, G stands for 2'-O-methyl guanosine, A stands for
2'-O-methyl adenosine, u stands for 2'-fluoro uridine, c stands for
2'-fluoro cytidine, a stands for adenosine, and s stands for
phosphorothioate linkage.
[0689] The Cholesterol, Phospholipid, and PEG conjugates were
evaluated for pharmakokinetic properties in mice compared to a
non-conjugated siNA construct having matched chemistry and
sequence. This study was conducted in female CD-1 mice
approximately 26 g (6-7 weeks of age). Animals were housed in
groups of 3. Food and water were provided ad libitum. Temperature
and humidity were according to Pharmacology Testing Facility
performance standards (SOP's) which are in accordance with the 1996
Guide for the Care and Use of Laboratory Animals (NRC). Animals
were acclimated to the facility for at least 3 days prior to
experimentation.
[0690] Absorbance at 260 nm was used to determine the actual
concentration of the stock solution of pre-annealed HBV siNA. An
appropriate amount of HBV siNA was diluted in sterile veterinary
grade normal saline (0.9%) based on the average body weight of the
mice. A small amount of the antisense (Stab 7) strand was
internally labeled with gamma 32P-ATP. The 32P-labeled stock was
combined with excess sense strand (Stab 8) and annealed. Annealing
was confirmed prior to combination with unlabled drug. Each mouse
received a subcutaneous bolus of 30 mg/kg (based on duplex) and
approximately 10 million cpm (specific activity of approximately 15
cpm/ng).
[0691] Three animals per timepoint (1, 4, 8, 24, 72, 96 h) were
euthanized by CO2 inhalation followed immediately by
exsanguination. Blood was sampled from the heart and collected in
heparinized tubes. After exsanguination, animals were perfused with
10-15 mL of sterile veterinary grade saline via the heart. Samples
of liver were then collected and frozen.
[0692] Tissue samples were homogenized in a digestion buffer prior
to compound quantitation. Quantitation of intact compound was
determined by scintillation counting followed by PAGE and
phosphorimage analysis. Results are shown in FIG. 43. As shown in
the figure, the conjugated siNA constructs shown vastly improved
liver PK compared to the unconjugated siNA construct.
Example 21
Cell Culture of siNA Conjugates (FIG. 68)
[0693] The Cholesterol conjugates and Phospholipid conjugated siNA
constructs described in Example 20 above were evaluated for cell
culture efficacy in a HBV cell culture system.
Transfection of HepG2 Cells with psHBV-1 and siNA
[0694] The human hepatocellular carcinoma cell line Hep G2 was
grown in Dulbecco's modified Eagle media supplemented with 10%
fetal calf serum, 2 mM glutamine, 0.1 mM nonessential amino acids,
1 mM sodium pyruvate, 25 mM Hepes, 100 units penicillin, and 100
.mu.g/ml streptomycin. To generate a replication competent cDNA,
prior to transfection the HBV genomic sequences are excised from
the bacterial plasmid sequence contained in the psHBV-1 vector.
Other methods known in the art can be used to generate a
replication competent cDNA. This was done with an EcoRI and Hind
III restriction digest. Following completion of the digest, a
ligation was performed under dilute conditions (20 .mu.g/ml) to
favor intermolecular ligation. The total ligation mixture was then
concentrated using Qiagen spin columns.
siNA Activity Screen and Dose Response Assay
[0695] Transfection of the human hepatocellular carcinoma cell
line, Hep G2, with replication-competent HBV DNA results in the
expression of HBV proteins and the production of virions. To test
the efficacy of siNA conjugates targeted against HBV RNA, the
Cholesterol siNA conjugate and Phospholipid siNA conjugate
described in Example 12 were compared to a non-conjugated control
siNA (see FIG. 68). An inverted sequence duplex was used as a
negative control for the unconjugated siNA. Dose response studies
were performed in which HBV genomic DNA was transfected with HBV
genomic DNA with lipid at 12.5 ug/ml into Hep G2 cells. 24 hours
after transfection with HBV DNA, cell culture media was removed and
siNA duplexes were added to cells without lipid at 10 uM, 5, uM,
2.5 uM, 1 uM, and 100 nm and the subsequent levels of secreted HBV
surface antigen (HBsAg) were analyzed by ELISA 72 hours post
treatment (see FIG. 44). To determine siNA activity, HbsAg levels
were measured following transfection with siNA. Immulon 4 (Dynax)
microtiter wells were coated overnight at 4.degree. C. with
anti-HBsAg Mab (Biostride B88-95-31ad,ay) at 1 .mu.g/ml in
Carbonate Buffer (Na2CO3 15 mM, NaHCO3 35 mM, pH 9.5). The wells
were then washed 4.times. with PBST (PBS, 0.05% Tween.RTM. 20) and
blocked for 1 hr at 37.degree. C. with PBST, 1% BSA. Following
washing as above, the wells were dried at 37.degree. C. for 30 min.
Biotinylated goat ant-HBsAg (Accurate YVS1807) was diluted 1:1000
in PBST and incubated in the wells for 1 hr. at 37.degree. C. The
wells were washed 4.times. with PBST. Streptavidin/Alkaline
Phosphatase Conjugate (Pierce 21324) was diluted to 250 ng/ml in
PBST, and incubated in the wells for 1 hr. at 37.degree. C. After
washing as above, p-nitrophenyl phosphate substrate (Pierce 37620)
was added to the wells, which were then incubated for 1 hour at
37.degree. C. The optical density at 405 nm was then determined. As
shown in FIG. 68, the phospholipid and cholesterol conjugates
demonstrate marked dose dependent inhibition of HBsAg expression
compared to the unconjugated siNA construct when delivered to cells
without any-transfection agent (lipid).
Example 22
Ex Vivo Stability of siNA Constructs
[0696] Chemically modified siNA constructs were designed and
synthesized in order to improve resistance to nucleases while
maintaining silencing in cell culture systems. Modified strands,
designated Stab 4, Stab 5, Stab 7, Stab 8, and Stab 11 (Table IV),
were tested in three sets of duplexes that demonstrated a range of
stability and activity. These duplexes contained differentially
modified sense and antisense strands. All modified sense strands
contain terminal 5' and 3' inverted abasic caps, while antisense
strands possess a 3' terminal phosphorothioate linkage. The results
characterize the impact of chemical modifications on nuclease
resistance in ex vivo models of the environments sampled by
drugs.
[0697] Active siNAs were assessed for their resistance to
degradation in serum and liver extracts. Stability in blood will be
a requirement for a systemically administered siNA, and an anti-HBV
or anti-HCV siNA would require stability and activity in the
hepatic intracellular environment. Liver extracts potentially
provide an extreme nuclease model where many catabolic enzymes are
present. Both mouse and human systems were assessed.
[0698] Individual strands of siNA duplexes were internally labeled
with 32P and incubated as single strands or as duplex siRNAs in
human or mouse serum and liver extracts. Representative data is
shown in Table VI. Throughout the course of the experiments,
constant levels of ribonuclease activity were verified. The extent
and pattern of all-RNA siNA degradation (3 minute time point) did
not change following preincubation of serum or liver extract at
37.degree. C. for up to 24 hours.
[0699] The biological activity of siRNAs containing all-ribose
residues has been well established. The extreme instability
(t1/2=0.017 hours) of these compounds in serum underscores the need
for chemical modification for use in systemic therapeutic
applications. The Stab 4/5 duplex modifications provide significant
stability in human and mouse serum (t1/2's=10-408 hours) and human
liver extract (t1/2's=28-43 hours). In human serum the Stab 4
strand chemistry in the context of the Stab 4/5 duplex, possesses
greater stability than the Stab 5 strand chemistry (t1/2=408 vs. 39
hours). This result highlights the impact terminal modifications
have on stability. A fully-modified Stab 7/11 construct (no
ribonucleotides present) was generated from the Stab 4/5 constructs
by substituting the ribonucleotides in all purine positions with
deoxyribonucleotides. Another fully modified construct, Stab 7/8,
was generated by replacing all purine positions in the antisense
strand with 2'-O-methyl nucleotides. This proved to be the most
stable antisense strand chemistry observed, with t1/2=816 hours in
human liver extract.
[0700] The dramatic stability of Stab 8 modifications was also
observed when non-duplexed single strands were incubated in human
serum and liver extract, as shown in Table VII. An approximate
five-fold increase in serum stability is seen for the double
stranded constructs, compared to that observed for the individual
strands. In liver extract, the siNA duplex provides even greater
stability compared to the single strands. For example, the Stab 5
chemistry is greater than 100-fold more stable in the Stab 4/5
duplex relative to its stability alone.
[0701] Terminal modifications have a large impact on stability in
human serum, as can be seen from a comparison of sense verses
antisense stabilities in duplex form, and the Stab 4 and Stab 5
single-strand stabilities. Therefore, a number of 3' antisense
capping moieties on Stab 4/5 chemistry duplexes were assessed for
their contribution to stability in human serum. The structures of
these modifications are shown in FIG. 22, and resultant half-lives
are shown in Table VIII. A wide range of different stabilities were
observed, from half-lives as short as one hour to greater than 770
hours. Thus, in the context of 2'-fluoro modified pyrimidines,
3'-exonuclease becomes the primary mode of attack on duplexes in
human serum; a number of chemistries minimize this site of attack.
These results suggest that susceptibility to 3' exonucleases is a
major path to degradation in the serum.
[0702] All patents and publications mentioned in the specification
are indicative of the levels of skill of those skilled in the art
to which the invention pertains. All references cited in this
disclosure are incorporated by reference to the same extent as if
each reference had been incorporated by reference in its entirety
individually.
[0703] One skilled in the art would readily appreciate that the
present invention is well adapted to carry out the objects and
obtain the ends and advantages mentioned, as well as those inherent
therein. The methods and compositions described herein as presently
representative of preferred embodiments are exemplary and are not
intended as limitations on the scope of the invention. Changes
therein and other uses will occur to those skilled in the art,
which are encompassed within the spirit of the invention, are
defined by the scope of the claims.
[0704] It will be readily apparent to one skilled in the art that
varying substitutions and modifications can be made to the
invention disclosed herein without departing from the scope and
spirit of the invention. Thus, such additional embodiments are
within the scope of the present invention and the following claims.
The present invention teaches one skilled in the art to test
various combinations and/or substitutions of chemical modifications
described herein toward generating nucleic acid constructs with
improved activity for mediating RNAi activity. Such improved
activity can comprise improved stability, improved bioavailability,
and/or improved activation of cellular responses mediating RNAi.
Therefore, the specific embodiments described herein are not
limiting and one skilled in the art can readily appreciate that
specific combinations of the modifications described herein can be
tested without undue experimentation toward identifying siNA
molecules with improved RNAi activity.
[0705] The invention illustratively described herein suitably can
be practiced in the absence of any element or elements, limitation
or limitations that are not specifically disclosed herein. Thus,
for example, in each instance herein any of the terms "comprising",
"consisting essentially of", and "consisting of" may be replaced
with either of the other two terms. The terms and expressions which
have been employed are used as terms of description and not of
limitation, and there is no intention that in the use of such terms
and expressions of excluding any equivalents of the features shown
and described or portions thereof, but it is recognized that
various modifications are possible within the scope of the
invention claimed. Thus, it should be understood that although the
present invention has been specifically disclosed by preferred
embodiments, optional features, modification and variation of the
concepts herein disclosed may be resorted to by those skilled in
the art, and that such modifications and variations are considered
to be within the scope of this invention as defined by the
description and the appended claims.
[0706] In addition, where features or aspects of the invention are
described in terms of Markush groups or other grouping of
alternatives, those skilled in the art will recognize that the
invention is also thereby described in terms of any individual
member or subgroup of members of the Markush group or other group.
TABLE-US-00001 TABLE I Sirna/ SEQ RPI# Aliases Sequence ID# 25227
Sirna/RPI 21550 EGFR 3830L23 AS as B UAACCUCGUACUGGUGCCUCC B 1 siNA
Str 1 (sense) 25228 Sirna/RPI 21550 EGFR 3830L23 AS as B
GGAGGCACCAGUACGAGGUUA B 2 siNA Str 2 (antisense) 25229 Sirna/RPI
21549 EGFR as siNA Str 2 B AAACUCCAAGAUCCCCAAUCA B 3 (antisense)
25230 Sirna/RPI 21549 EGFR 3 as siNA Str 1 B UGAUUGGGGAUCUUGGAGUUU
B 4 (sense) 25231 Sirna/RPI 21547 EGFR as siNA Str 2 B
GUUGGAGUCUGUAGGACUUGG B 5 (antisense) 25232 Sirna/RPI 21547 EGFR as
siNA Str 1 B CCAAGUCCUACAGACUCCAAC B 6 (sense) 25233 Sirna/RPI
21545 EGFR as siNA Str 2 B GCAAAAACCCUGUGAUUUCCU B 7 (antisense)
25234 Sirna/RPI 21545 EGFR as siNA Str 1 B AGGAAAUCACAGGGUUUUUGC B
8 (sense) 25235 Sirna/RPI 21543 EGFR as siNA Str 2 B
UUGGUCAGUUUCUGGCAGUUC B 9 (antisense) 25236 Sirna/RPI 21543 EGFR as
siNA Str 1 B GAACUGCCAGAAACUGACCAA B 10 (sense) 25237 HCV IRES Loop
IIIb (Heptazyme site) as B GGUCCUUUCUUGGAUCAACCC B 11 siNA str1
(sense) 25238 HCV IRES Loop IIIb (Heptazyme site) as B
GGGUUGAUCCAAGAAAGGACC B 12 siNA str2 (antisense) 25239 HBV
(HepBzyme site) as siNA str1 (sense) B UGGACUUCUCUCAAUUUUCUA B 13
25240 HBV (HepBzyme site) as siNA str2 B UAGAAAAUUGAGAGAAGUCCA B 14
(antisense) 25241 HBV18371 site as siNA str1 (sense) B
UUUUUCACCUCUGCCUAAUCA B 15 25242 HBV18371 site as siNA str2
(antisense) B UGAUUAGGCAGAGGUGAAAAA B 16 25243 HBV16372-18373 site
as siNA str1 (sense) B CAAGCCUCCAAGCUGUGCCUU B 17 25244
HBV16372-18373 site as siNA str 2 B AAGGCACAGCUUGGAGGCUUG B 18
(antisense) 25245 Sirna/RPI 17763 Her2Neu AS as siNA Str B
UCCAUGGUGCUCACUGCGGCU B 19 2 (antisense) 25246 Sirna/RPI 17763
Her2Neu AS as siNA Str B AGCCGCAGUGAGCACCAUGGA B 20 1 (sense) 25247
Sirna/RPI 17763 Her2Neu AS as siNA Str B AGGUACCACGAGUGACGCCGA B 21
1 (sense) inverted control 25248 Sirna/RPI 17763 Her2Neu AS as siNA
Str B UCGGCGUCACUCGUGGUACCU B 22 1 (sense) Inverted control
compliment 25249 Sirna/RPI 21550 EGFR 3830L23 AS as B
CCUCCGUGGUCAUGCUCCAAU B 23 siNA Str 1 (sence) Inverted Control
25250 Sirna/RPI 21550 EGFR 3830L23 AS as B AUUGGAGCAUGACCACGGAGG B
24 siNA Str 1 (sence) Inverted Control Compliment 25251 HCV IRES
Loop IIIb (Heptazyme site) as B CCCAACUAGGUUCUUUCCUGG B 25 siNA
str1 (sense) Inverted Control 25252 HCV IRES Loop IIIb (Heptazyme
site) as B CCAGGAAAGAACCUAGUUGGG B 26 siNA str1 (sense) Inverted
Control Compliment 25804 Sirna/RPI 21550 EGFR 3830L23 AS as
UAACCUCGUACUGGUGCCUCCUU 27 siNA Str 1 (sense) + 2U overhang 25805
Sirna/RPI 21550 EGFR 3830L23 AS as GGAGGCACCAGUACGAGGUUAUU 28 siNA
Str 2 (antisense) + 2U overhang 25806 Sirna/RPI 21549 EGFR as siNA
Str 2 AAACUCCAAGAUCCCCAAUCAUU 29 (antisense) + 2U overhang 25824
Sirna/RPI 21550 EGFR 3830L23 AS as BUAACCUCGUACUGGUGCCUCCUUB 30
siNA Str 1 (sense) + 2U overhang 25825 Sirna/RPI 21550 EGFR 3830L23
AS as BGGAGGCACCAGUACGAGGUUAUUB 31 siNA Str 2 (antisense) + 2U
overhang 25826 Sirna/RPI 21549 EGFR as siNA Str 2
BAAACUCCAAGAUCCCCAAUCAUUB 32 (antisense) + 2U overhang 25807
Sirna/RPI 21549 EGFR 3 as siNA Str 1 UGAUUGGGGAUCUUGGAGUUUUU 33
(sense) + 2U overhang 25808 Sirna/RPI 21547 EGFR as siNA Str 2
GUUGGAGUCUGUAGGACUUGGUU 34 (antisense) + 2U overhang 25809
Sirna/RPI 21547 EGFR as siNA Str 1 CCAAGUCCUACAGACUCCAACUU 35
(sense) + 2U overhang 25827 Sirna/RPI 21549 EGFR 3 as siNA Str 1
BUGAUUGGGGAUCUUGGAGUUUUUB 36 (sense) + 2U overhang 25828 Sirna/RPI
21547 EGFR as siNA Str 2 BGUUGGAGUCUGUAGGACUUGGUUB 37 (antisense) +
2U overhang 25829 Sirna/RPI 21547 EGFR as siNA Str 1
BCCAAGUCCUACAGACUCCAACUUB 38 (sense) + 2U overhang 25810 Sirna/RPI
21545 EGFR as siNA Str 2 GCAAAAACCCUGUGAUUUCCUUU 39 (antisense) +
2U overhang 25811 Sirna/RPI 21545 EGFR as siNA Str 1
AGGAAAUCACAGGGUUUUUGCUU 40 (sense) + 2U overhang 25812 Sirna/RPI
21543 EGFR as siNA Str 2 UUGGUCAGUUUCUGGCAGUUCUU 41 (antisense) +
2U overhang 25830 Sirna/RPI 21545 EGFR as siNA Str 2
BGCAAAAACCCUGUGAUUUCCUUUB 42 (antisense) + 2U overhang 25831
Sirna/RPI 21545 EGFR as siNA Str 1 BAGGAAAUCACAGGGUUUUUGCUUB 43
(sense) + 2U overhang 25832 Sirna/RPI 21543 EGFR as siNA Str 2
BUUGGUCAGUUUCUGGCAGUUCUUB 44 (antisense) + 2U overhang 25813
Sirna/RPI 21543 EGFR as siNA Str 1 GAACUGCCAGAAACUGACCAAUU 45
(sense) + 2U overhang 25814 HCV IRES Loop IIIb (Heptazyme site) as
GGUCCUUUCUUGGAUCAACCCUU 46 siNA str1 (sense) + 2U overhang 25815
HCV IRES Loop IIIb (Heptazyme site) as GGGUUGAUCCAAGAAAGGACCUU 47
siNA str2 (antisense) + 2U overhang 25833 Sirna/RPI 21543 EGFR as
siNA Str 1 BGAACUGCCAGAAACUGACCAAUUB 48 (sense) + 2U overhang 25834
HCV IRES Loop IIIb (Heptazyme site) as BGGUCCUUUCUUGGAUCAACCCUUB 49
siNA str1 (sense) + 2U overhang 25835 HCV IRES Loop IIIb (Heptazyme
site) as BGGGUUGAUCCAAGAAAGGACCUUB 50 siNA str2 (antisense) + 2U
overhang 25816 HBV (HepBzyme site) as siNA UGGACUUCUCUCAAUUUUCUAUU
51 str1 (sense) + 2U overhang 25817 HBV (HepBzyme site) as siNA
str2 UAGAAAAUUGAGAGAAGUCCAUU 52 (antisense) + 2U overhang 25818
HBV18371 site as siNA str1 (sense) + 2U UUUUUCACCUCUGCCUAAUCAUU 53
overhang 25836 HBV (HepBzyme site) as siNA
BUGGACUUCUCUCAAUUUUCUAUUB 54 str1 (sense) + 2U overhang 25837 HBV
(HepBzyme site) as siNA str2 BUAGAAAAUUGAGAGAAGUCCAUUB 55
(antisense) + 2U overhang 25838 HBV18371 site as siNA str1 (sense)
+ 2U BUUUUUCACCUCUGCCUAAUCAUUB 56 overhang 25819 HBV18371 site as
siNA str2 UGAUUAGGCAGAGGUGAAAAAUU 57 (antisense) + 2U overhang
25820 HBV16372-18373 site as siNA CAAGCCUCCAAGCUGUGCCUUUU 58 str 1
(sense) + 2U overhang 25821 HBV16372-18373 site as siNA str 2
AAGGCACAGCUUGGAGGCUUGUU 59 (antisense) + 2U overhang 25839 HBV18371
site as siNA str2 BUGAUUAGGCAGAGGUGAAAAAUUB 60 (antisense) + 2U
overhang 25840 HBV16372-18373 site as siNA
BCAAGCCUCCAAGCUGUGCCUUUUB 61 str1 (sense) + 2U overhang 25841
HBV16372-18373 site as siNA str 2 BAAGGCACAGCUUGGAGGCUUGUUB 62
(antisense) + 2U overhang 25822 Sirna/RPI 17763 Her2Neu AS as siNA
Str UCCAUGGUGCUCACUGCGGCUUU 63 2 (antisense) + 2U overhang 25823
Sirna/RPI 17763 Her2Neu AS as siNA Str AGCCGCAGUGAGCACCAUGGAUU 64 1
(sense) + 2U overhang 25842 Sirna/RPI 17763 Her2Neu AS as siNA Str
BUCCAUGGUGCUCACUGCGGCUUUB 65 2 (antisense) + 2U overhang 25843
Sirna/RPI 17763 Her2Neu AS as siNA Str BAGCCGCAGUGAGCACCAUGGAUUB 66
1 (sense) + 2U overhang 27649 Sirna/RPI GL2 Str1 (sense)
CGUACGCGGAAUACUUCGA TT 67 27650 Sirna/RPI GL2 Str2 (antisense)
UCGAAGUAUUCCGCGUACG TT 68 27651 Sirna/RPI Inverted GL2 Str1 (sense)
AGCUUCAUAAGGCGCAUGC TT 69 27652 Sirna/RPI Inverted GL2 Str2
(antisense) GCAUGCGCCUUAUGAAGCU TT 70 27653 Sirna/RPI GL2 Str1
(sense) all ribo P = S
C.sub.sG.sub.sU.sub.sA.sub.sC.sub.sG.sub.sC.sub.sG.sub.sG.sub.sA.sub.sA.s-
ub.sU.sub.sA.sub.sC.sub.sU.sub.sU.sub.sC.sub.sG.sub.sA TT 71 27654
Sirna/RPI GL2 Str1 (sense) all ribo
C.sub.sGU.sub.sAC.sub.sGC.sub.sGGAAU.sub.sAC.sub.sU.sub.sU.sub.sC.sub.sGA
TT 72 pyrimidines P = S 27655 Sirna/RPI GL2 Str1 (sense) 14 5' P =
S
C.sub.sG.sub.sU.sub.sA.sub.sC.sub.sG.sub.sC.sub.sG.sub.sG.sub.sA.sub.sA.s-
ub.sU.sub.sA.sub.sC.sub.sUUCGA TT 73 27656 Sirna/RPI GL2 Str1
(sense) 10 5' P = S
C.sub.sG.sub.sU.sub.sA.sub.sC.sub.sG.sub.sC.sub.sG.sub.sG.sub.sA.sub.sAUA-
CUUCGA TT 74 27657 Sirna/RPI GL2 Str1 (sense) 5 5' P = S
C.sub.sG.sub.sU.sub.sA.sub.sC.sub.sGCGGAAUACUUCGA TT 75 27658
Sirna/RPI GL2 Str2 (antisense) all ribo
U.sub.sC.sub.sG.sub.sA.sub.sA.sub.sG.sub.sU.sub.sA.sub.sU.sub.sU.sub.sC.s-
ub.sC.sub.sG.sub.sC.sub.sG.sub.sU.sub.sA.sub.sC.sub.sG TT 76 P = S
27659 Sirna/RPI GL2 Str2 (antisense) all ribo
U.sub.sC.sub.sGAAGU.sub.sAU.sub.sU.sub.sC.sub.sC.sub.sGC.sub.sGU.sub.sAC.-
sub.sG TT 77 pyrimidines P = S 27660 Sirna/RPI GL2 Str2 (antisense)
5' 14
U.sub.sC.sub.sG.sub.sA.sub.sA.sub.sGU.sub.sA.sub.sU.sub.sU.sub.sC.sub.sC.-
sub.sG.sub.sC.sub.sGUACG TT 78 P = S 27661 Sirna/RPI GL2 Str2
(antisense) 5' 10
U.sub.sC.sub.sG.sub.sA.sub.sA.sub.sG.sub.sU.sub.sA.sub.sU.sub.sU.sub.sCCG-
CGUACG TT 79 P = S 27662 Sirna/RPI GL2 Str2 (antisense) 5' 5 P = S
U.sub.sC.sub.sG.sub.sA.sub.sA.sub.sGUAUUCCGCGUACG TT 80 28010
Sirna/RPI GL2 Str1 (sense) 5' ligation CGUACG 81 fragment 28011
Sirna/RPI GL2 Str1 (sense) 3' ligation CGGAAUACUUCGATT 82 fragment
28012 Sirna/RPI GL2 Str2 (antisense) 5' UCGAAGUA 83 ligation
fragment 28013 Sirna/RPI GL2 Str2 (antisense) 3' UUCCGCGUACGTT 84
ligation fragment 28254 Sirna/RPI GL2 Str1 (sense) all
C.sub.sGU.sub.sAC.sub.sGC.sub.sGGAAU.sub.sAC.sub.sU.sub.sU.sub.sC.sub.sGA-
T.sub.sT 85 pyrimidines + TT = PS 28255 Sirna/RPI GL2 Str2
(antisense), + TT = PS UCGAAGUAUUCCGCGUACGT.sub.sT 86 28256
Sirna/RPI GL2 Str2 (antisense), all
U.sub.sC.sub.sGAAGU.sub.sAU.sub.sU.sub.sC.sub.sC.sub.sGC.sub.sGU.sub.sAC.-
sub.sGT.sub.sT 87 pyrimidines + TT = PS 28262 Her2.1.sense Str1
(sense) UGGGGUCGUCAAAGACGUUTT 88 28263 Her2.1.antisense Str2
(antisense) AACGUCUUUGACGACCCCATT 89 28264 Her2.1.sense Str1
(sense) inverted UUGCAGAAACUGCUGGGGUTT 90 28265 Her2.1.antisense
Str2 (antisense) ACCCCAGCAGUUUCUGCAATT 91 inverted 28266
Her2.2.sense Str1 (sense) GGUGCUUGGAUCUGGCGCUTT 92 28267
Her2.2.antisense Str2 (antisense) AGCGCCAGAUCCAAGCACCTT 93 28268
Her2.2.sense Str1 (sense) inverted UCGCGGUCUAGGUUCGUGGTT 94 28269
Her2.2.antisense Str2 (antisense) CCACGAACCUAGACCGCGATT 95 inverted
28270 Her2.3.sense Str1 (sense) GAUCUUUGGGAGCCUGGCATT 96 28271
Her2.3.antisense Str2 (antisense) UGCCAGGCUCCCAAAGAUCTT 97 28272
Her2.3.sense Str1 (sense) inverted ACGGUCCGAGGGUUUCUAGTT 98 28273
Her2.3.antisense Str2 (antisense) CUAGAAACCCUCGGACCGUTT 99 inverted
28274 Sirna/RPI Inverted GL2 Str1 (sense) all
AGC.sub.sU.sub.sU.sub.sC.sub.sAU.sub.sAAGGC.sub.sGC.sub.sAU.sub.sGC
TT 100 ribo pyrimidines P = S 28275 Sirna/RPI Inverted GL2 Str1
(sense) 5 5' A.sub.sG.sub.sC.sub.sU.sub.sU.sub.sCAUAAGGCGCAUGC TT
101 P = S 28276 Sirna/RPI Inverted GL2 Str2 (antisense)
GC.sub.sAU.sub.sGC.sub.sGC.sub.sC.sub.sU.sub.sU.sub.sAU.sub.sGAAGC.sub.sU
TT 102 all ribo pyrimidines P = S 28277 Sirna/RPI Inverted GL2 Str2
(antisense) 5 G.sub.sC.sub.sA.sub.sU.sub.sG.sub.sCGCCUUAUGAAGCU TT
103 5' P = S 28278 Sirna/RPI Inverted GL2 Str2 (antisense)
G.sub.sC.sub.sA.sub.sU.sub.sG.sub.sC.sub.sG.sub.sC.sub.sC.sub.sU.sub.sU.s-
ub.sA.sub.sU.sub.sG.sub.sA.sub.sA.sub.sG.sub.sC.sub.sU TT 104 all
ribo P = S 28279 Sirna/RPI Inverted GL2 Str2 (antisense)
G.sub.sC.sub.sA.sub.sU.sub.sG.sub.sC.sub.sG.sub.sC.sub.sC.sub.sU.sub.sU.s-
ub.sA.sub.sU.sub.sG.sub.sAAGCU TT 105 14 5' P = S 28280 Sirna/RPI
Inverted GL2 Str2 (antisense)
G.sub.sC.sub.sA.sub.sU.sub.sG.sub.sC.sub.sG.sub.sC.sub.sC.sub.sU.sub.sUAU-
GAAGCU TT 106 10 5' P = S 28383 hReIA.1.sense Str1 (sense)
CAGCACAGACCCAGCUGUGTT 107 28384 hReIA.1.antisense Str2 (antisense)
CACAGCUGGGUCUGUGCUGTT 108 28385 hReIA.1.sense Str1 (sense) inverted
GUGUCGACCCAGACACGACTT 109 28386 hReIA.1.antisense Str2 (antisense)
GUCGUGUCUGGGUCGACACTT 110 inverted 28387 hReIA.2.sense Str1 (sense)
GCAGGCUGGAGGUAAGGCCTT 111 28388 hReIA.2.antisense Str2 (antisense)
GGCCUUACCUCCAGCCUGCTT 112 28389 hReIA.2.sense Str1 (sense) inverted
CCGGAAUGGAGGUCGGACGTT 113 28390 hReIA.2.antisense Str2 (antisense)
CGUCCGACCUCCAUUCCGGTT 114 inverted 28391 h/mReIA.3.sense Str1
(sense) GACUUCUCCUCCAUUGCGGTT 115 28392 h/mReIA.3.antisense Str2
(antisense) CCGCAAUGGAGGAGAAGUCTT 116 28393 h/mReIA.3.sense Str1
(sense) inverted GGCGUUACCUCCUCUUCAGTT 117 28394
h/mReIA.3.antisense Str2 (antisense) CUGAAGAGGAGGUAACGCCTT 118
inverted 28395 h/mReIA.4.sense Str1 (sense) CACUGCCGAGCUCAAGAUCTT
119 28396 h/mReIA.4.antisense Str2 (antisense)
GAUCUUGAGCUCGGCAGUGTT 120 28397 h/mReIA.4.sense Str1 (sense)
inverted CUAGAACUCGAGCCGUCACTT 121 28398 h/mReIA.4.antisense Str2
(antisense) GUGACGGCUCGAGUUCUAGTT 122 inverted 28399 hlKKg.1.sense
Str1 (sense) GGAGUUCCUCAUGUGCAAGTT 123 28400 hlKKg.1.antisense Str2
(antisense) CUUGCACAUGAGGAACUCCTT 124 28401 hlKKg.1.sense Str1
(sense) inverted GAACGUGUACUCCUUGAGGTT 125 28402 hlKKg.1.antisense
Str2 (antisense) CCUCAAGGAGUACACGUUCTT 126 inverted 28403
hlKKg.2.sense Str1 (sense) UCAAGAGCUCCGAGAUGCCTT 127 28404
hlKKg.2.antisense Str2 (antisense) GGCAUCUCGGAGCUCUUGATT 128 28405
hlKKg.2.sense Str1 (sense) inverted CCGUAGAGCCUCGAGAACUTT 129 28406
hlKKg.2.antisense Str2 (antisense) AGUUCUCGAGGCUCUACGGTT 130
inverted 28407 h/mlKKG.sense Str1 (sense) GCAGAUGGCUGAGGACAAGTT 131
28408 h/mlKKG.3.antisense Str2 (antisense) CUUGUCCUCAGCCAUCUGCTT
132 28409 h/mlKKG.3.sense Str1 (sense) inverted
GAACAGGAGUCGGUAGACGTT 133 28410 h/mlKKG.3.antisense Str2
(antisense) CGUCUACCGACUCCUGUUCTT 134 inverted 28447 Sirna/RPI
construct as hairpin + GAAA +
AACGUACGCGGAAUACUUCGAUUAAAAGUAAUCGAAGUAUUCCGCGUACGUU 135 AU blunt
28448 Sirna/RPI construct as hairpin + GAAA +
CGUACGCGGAAUACUUCGAUUAAAAGUAAUCGAAGUAUUCCGCGUACGUU 136 AU 3'
overhang 28449 Sirna/RPI construct as hairpin + GAAA
AACGUACGCGGAAUACUUCGAUUAAAGAAUCGAAGUAUUCCGCGUACGUU 137 blunt 28450
Sirna/RPI construct as hairpin + GAAA 3'
CGUACGCGGAAUACUUCGAUUAAAGAAUCGAAGUAUUCCGCGUACGUU 138 overhang 28451
Sirna/RPI construct as hairpin + UUG 3'
CGUACGCGGAAUACUUCGAUUGUUAAUCGAAGUAUUCCGCGUACGUU 139 overhang 28452
Sirna/RPI construct as hairpin + UUG
AACGUACGCGGAAUACUUCGAUUGUUAAUCGAAGUAUUCCGCGUACGUU 140 blunt 28453
Sirna/RPI construct as hairpin + UUG + AU
AACGUACGCGGAAUACUUCGAUUAGUUUAAUCGAAGUAUUCCGCGUACGUU 141 blunt 28454
Sirna/RPI construct as hairpin + UUG 3'
CGUACGCGGAAUACUUCGAUUAGUUUAAUCGAAGUAUUCCGCGUACGUU 142 overhang
28415 HCV-Luc:325U21 TT siNA (sense) CCCCGGGAGGUCUCGUAGATT 143
28416 HCV-Luc:162U21 TT siNA (sense) CGGAACCGGUGAGUACACCTT 144
28417 HCV-Luc:324U21 TT siNA (sense) GCCCCGGGAGGUCUCGUAGTT 145
28418 HCV-Luc:163U21 TT siNA (sense) GGAACCGGUGAGUACACCGTT 146
28419 HCV-Luc:294U21 TT siNA (sense) GUGGUACUGCCUGAUAGGGTT 147
28420 HCV-Luc:293U21 TT siNA (sense) UGUGGUACUGCCUGAUAGGTT 148
28421 HCV-Luc:292U21 TT siNA (sense) UUGUGGUACUGCCUGAUAGTT 149
28422 HCV-Luc:343L21 TT siNA (325C) UCUACGAGACCUCCCGGGGTT 150
(antisense) 28423 HCV-Luc:180L21 TT siNA (162C)
GGUGUACUCACCGGUUCCGTT 151 (antisense) 28424 HCV-Luc:342L21 TT siNA
(324C) CUACGAGACCUCCCGGGGCTT 152 (antisense) 28425 HCV-Luc:181L21
TT siNA (163C) CGGUGUACUCACCGGUUCCTT 153 (antisense) 28426
HCV-Luc:312L21 TT siNA (294C) CCCUAUCAGGCAGUACCACTT 154 (antisense)
28427 HCV-Luc:311L21 TT siNA (293C) CCUAUCAGGCAGUACCACATT 155
(antisense) 28428 HCV-Luc:310L21 TT siNA (292C)
CUAUCAGGCAGUACCACAATT 156 (antisense) 28429 HCV-Luc:325U21 TT siNA
(sense) inv TTAGAUGCUCUGGAGGGCCCC 157 28430 HCV-Luc:162U21 TT siNA
(sense) inv TTCCACAUGAGUGGCCAAGGC 158 28431 HCV-Luc:324U21 TT siNA
(sense) inv TTGAUGCUCUGGAGGGCCCCG 159 28432 HCV-Luc:163U21 TT siNA
(sense) inv TTGCCACAUGAGUGGCCAAGG 160 28433 HCV-Luc:294U21 TT siNA
(sense) inv TTGGGAUAGUCCGUCAUGGUG 161 28434 HCV-Luc:293U21 TT siNA
(sense) inv TTGGAUAGUCCGUCAUGGUGU 162 28435 HCV-Luc:292U21 TT siNA
(sense) inv TTGAUAGUCCGUCAUGGUGUU 163 28436 HCV-Luc:343L21 TT siNA
(325C) TTGGGGCCCUCCAGAGCAUCU 164 (antisense) inv 28437
HCV-Luc:180L21 TT siNA (162C) TTGCCUUGGCCACUCAUGUGG 165 (antisense)
inv 28438 HCV-Luc:342L21 TT siNA (324C) TTCGGGGCCCUCCAGAGCAUC 166
(antisense) inv 28439 HCV-Luc:181L21 TT siNA (163C)
TTCCUUGGCCACUCAUGUGGC 167 (antisense) inv
28440 HCV-Luc:312L21 TT sINA (294C) TTCACCAUGACGGACUAUCCC 168
(antisense) inv 28441 HCV-Luc:311L21 TT siNA (293C)
TTACACCAUGACGGACUAUCC 169 (antisense) inv 28442 HCV-Luc:310L21 TT
siNA (292C) TTAACACCAUGACGGACUAUC 170 (antisense) inv 28458
Sirna/RPI Inverted GL2 Str1 (sense) 5 5'
A.sub.sG.sub.sC.sub.sU.sub.sU.sub.sCAUAAGGCGCAUGC T.sub.sT 171 P =
S + TsT 28459 Sirna/RPI Inverted GL2 Str2 (antisense) 5
G.sub.sC.sub.sA.sub.sU.sub.sG.sub.sCGCCUUAUGAAGCU T.sub.sT 172 5' P
= S + TsT 28460 Sirna/RPI GL2 Str1 (sense) 5 5' P = S +
C.sub.sG.sub.sU.sub.sA.sub.sC.sub.sGCGGAAUACUUCGA T.sub.sT 173 TsT
28461 Sirna/RPI GL2 Str2 (antisense) 5 5'
U.sub.sC.sub.sG.sub.sA.sub.sA.sub.sGUAUUCCGCGUACG T.sub.sT 174 P =
S + TsT 28511 Sirna/RPI GL2 Str2 (antisense) +
CGUACGCGGAAUACUUCGATTBUCGAAGUAUUCCGCGUACG TT 175 Sirna/RPI GL2 Str1
(sense) (tandem synth. w/idB on 3' of Str 1) 29543 HBV:248U21 siNA
pos (sense) GUCUAGACUCGUGGUGGACTT 176 29544 HBV:414U21 siNA pos
(sense) CCUGCUGCUAUGCCUCAUCTT 177 29545 HBV:1867U21 siNA pos
(sense) CAAGCCUCCAAGCUGUGCCTT 178 29546 HBV:1877U21 siNA pos
(sense) AGCUGUGCCUUGGGUGGCUTT 179 29547 HBV:228L21 siNA neg (248C)
(antisense) GUCCACCACGAGUCUAGACTT 180 29548 HBV:394L21 siNA neg
(414C) (antisense) GAUGAGGCAUAGCAGCAGGTT 181 29549 HBV:1847L21 siNA
neg (1867C) GGCACAGCUUGGAGGCUUGTT 182 (antisense) 29550 HBV:1857L21
siNA neg (1877C) AGCCACCCAAGGCACAGCUTT 183 (antisense) 29551
HBV:248U21 siNA pos (sense) inv CAGGUGGUGCUCAGAUCUGTT 184 29552
HBV:414U21 siNA pos (sense) inv CUACUCCGUAUCGUCGUCCTT 185 29553
HBV:1867U21 siNA pos (sense) inv CCGUGUCGAACCUCCGAACTT 186 29554
HBV:1877U21 siNA pos (sense) inv UCGGUGGGUUCCGUGUCGATT 187 29555
HBV:228L21 siNA neg (248C) (antisense) CAGAUCUGAGCACCACCUGTT 188
inv 29556 HBV:394L21 siNA neg (414C) (antisense)
GGACGACGAUACGGAGUAGTT 189 inv 29557 HBV:1847L21 siNA neg (1867C)
GUUCGGAGGUUCGACACGGTT 190 (antisense) inv 29558 HBV:1857L21 siNA
neg (1877C) UCGACACGGAACCCACCGATT 191 (antisense) inv 29573
HCV-Luc:162U21 siNA (sense) CGGAACCGGUGAGUACACCGG 192 29574
HCV-Luc:163U21 siNA (sense) GGAACCGGUGAGUACACCGGA 193 29575
HCV-Luc:292U21 siNA (sense) UUGUGGUACUGCCUGAUAGGG 194 29576
HCV-Luc:293U21 siNA (sense) UGUGGUACUGCCUGAUAGGGU 195 29577
HCV-Luc:294U21 siNA (sense) GUGGUACUGCCUGAUAGGGUG 196 29578
HCV-Luc:324U21 siNA (sense) GCCCCGGGAGGUCUCGUAGAC 197 29579
HCV-Luc:325U21 siNA (sense) CCCCGGGAGGUCUCGUAGACC 198 29580
HCV-Luc:182L21 siNA (162C) (antisense) GGUGUACUCACCGGUUCCGCA 199
29581 HCV-Luc:183L21 siNA (163C) (antisense) CGGUGUACUCACCGGUUCCGC
200 29582 HCV-Luc:312L21 siNA (292C) (antisense)
CUAUCAGGCAGUACCACAAGG 201 29583 HCV-Luc:313L21 siNA (293C)
(antisense) CCUAUCAGGCAGUACCACAAG 202 29584 HCV-Luc:314L21 siNA
(294C) (antisense) CCCUAUCAGGCAGUACCACAA 203 29585 HCV-Luc:344L21
siNA (324C) (antisense) CUACGAGACCUCCCGGGGCAC 204 29586
HCV-Luc:345L21 siNA (325C) (antisense) UCUACGAGACCUCCCGGGGCA 205
29587 HCV-Luc:162U21 siNA (sense) rev GGCCACAUGAGUGGCCAAGGC 206
29588 HCV-Luc:163U21 siNA (sense) rev AGGCCACAUGAGUGGCCAAGG 207
29589 HCV-Luc:292U21 siNA (sense) rev GGGAUAGUCCGUCAUGGUGUU 208
29590 HCV-Luc:293U21 siNA (sense) rev UGGGAUAGUCCGUCAUGGUGU 209
29591 HCV-Luc:294U21 siNA (sense) rev GUGGGAUAGUCCGUCAUGGUG 210
29592 HCV-Luc:324U21 siNA (sense) rev CAGAUGCUCUGGAGGGCCCCG 211
29593 HCV-Luc:325U21 siNA (sense) rev CCAGAUGCUCUGGAGGGCCCC 212
29594 HCV-Luc:182L21 siNA (162C) (antisense) ACGCCUUGGCCACUCAUGUGG
213 rev 29595 HCV-Luc:183L21 siNA (163C) (antisense)
CGCCUUGGCCACUCAUGUGGC 214 rev 29596 HCV-Luc:312L21 siNA (292C)
(antisense) GGAACACCAUGACGGACUAUC 215 rev 29597 HCV-Luc:313L21 siNA
(293C) (antisense) GAACACCAUGACGGACUAUCC 216 rev 29598
HCV-Luc:314L21 siNA (294C) (antisense) AACACCAUGACGGACUAUCCC 217
rev 29599 HCV-Luc:344L21 siNA (324C) (antisense)
CACGGGGCCCUCCAGAGCAUC 218 rev 29600 HCV-Luc:345L21 siNA (325C)
(antisense) ACGGGGCCCUCCAGAGCAUCU 219 rev 29601 Luc2:128U21 siNA
(sense) CAGAUGCACAUAUCGAGGUGA 220 29602 Luc3:128U21 siNA (sense)
CAGAUGCACAUAUCGAGGUGG 221 29603 Luc2/3:128U21 TT siNA (sense)
CAGAUGCACAUAUCGAGGUTT 222 29604 Luc2/3:148L21 siNA (128C)
(antisense) ACCUCGAUAUGUGCAUCUGUA 223 29605 Luc2/3:148L21 TT siNA
(128C) (antisense) ACCUCGAUAUGUGCAUCUGTT 224 29606 Luc2/3:166U21
siNA (sense) UACUUCGAAAUGUCCGUUCGG 225 29607 Luc2/3:166U21 TT siNA
(sense) UACUUCGAAAUGUCCGUUCTT 226 29608 Luc2:186L21 siNA (166C)
(antisense) GAACGGACAUUUCGAAGUAUU 227 29609 Luc3:186L21 siNA (166C)
(antisense) GAACGGACAUUUCGAAGUACU 228 29610 Luc2/3:186L21 TT siNA
(166C) (antisense) GAACGGACAUUUCGAAGUATT 229 29611 Luc2/3:167U21
siNA (sense) ACUUCGAAAUGUCCGUUCGGU 230 29612 Luc2/3:167U21 TT siNA
(sense) ACUUCGAAAUGUCCGUUCGTT 231 29613 Luc2:187L21 siNA (167C)
(antisense) CGAACGGACAUUUCGAAGUAU 232 29614 Luc3:187L21 siNA (167C)
(antisense) CGAACGGACAUUUCGAAGUAC 233 29615 Luc2/3:187L21 TT siNA
(167C) (antisense) CGAACGGACAUUUCGAAGUTT 234 29616 Luc2/3:652U21
siNA (sense) AGAUUCUCGCAUGCCAGAGAU 235 29617 Luc2/3:652U21 TT siNA
(sense) AGAUUCUCGCAUGCCAGAGTT 236 29618 Luc2:672L21 siNA (652C)
(antisense) CUCUGGCAUGCGAGAAUCUGA 237 29619 Luc3:672L21 siNA (652C)
(antisense) CUCUGGCAUGCGAGAAUCUCA 238 29620 Luc2/3:672L21 TT siNA
(652C) (antisense) CUCUGGCAUGCGAGAAUCUTT 239 29621 Luc2/3:653U21
siNA (sense) GAUUCUCGCAUGCCAGAGAUC 240 29622 Luc2/3:653U21 TT siNA
(sense) GAUUCUCGCAUGCCAGAGATT 241 29623 Luc2:673L21 siNA (653C)
(antisense) UCUCUGGCAUGCGAGAAUCUG 242 29624 Luc3:673L21 siNA (653C)
(antisense) UCUCUGGCAUGCGAGAAUCUC 243 29625 Luc2/3:673L21 TT siNA
(653C) (antisense) UCUCUGGCAUGCGAGAAUCTT 244 29626 Luc2/3:880U21
siNA (sense) UUCUUCGCCAAAAGCACUCUG 245 29627 Luc2/3:880U21 TT siNA
(sense) UUCUUCGCCAAAAGCACUCTT 246 29628 Luc2:900L21 siNA (880C)
(antisense) GAGUGCUUUUGGCGAAGAAUG 247 29629 Luc3:900L21 siNA (880C)
(antisense) GAGUGCUUUUGGCGAAGAAGG 248 29630 Luc2/3:900L21 TT siNA
(880C) (antisense) GAGUGCUUUUGGCGAAGAATT 249 29631 Luc2/3:1012U21
siNA (sense) CAAGGAUAUGGGCUCACUGAG 250 29632 Luc2/3:1012U21 TT siNA
(sense) CAAGGAUAUGGGCUCACUGTT 251 29633 Luc2:1032L21 siNA (1012C)
(antisense) CAGUGAGCCCAUAUCCUUGUC 252 29634 Luc3:1032L21 siNA
(1012C) (antisense) CAGUGAGCCCAUAUCCUUGCC 253 29635 Luc2/3:1032L21
TT siNA (1012C) CAGUGAGCCCAUAUCCUUGTT 254 (antisense) 29636
Luc2:1139U21 siNA (sense) AAACGCUGGGCGUUAAUCAGA 255 29637
Luc3:1139U21 siNA (sense) AAACGCUGGGCGUUAAUCAAA 256 29638
Luc2/3:1139U21 TT siNA (sense) AAACGCUGGGCGUUAAUCATT 257 29639
Luc2/3:1159L21 siNA (1139C) (antisense) UGAUUAACGCCCAGCGUUUUC 258
29640 Luc2/3:1159L21 TT siNA (1139C) UGAUUAACGCCCAGCGUUUTT 259
(antisense) 29641 Luc2:1283U21 siNA (sense) AAGACGAACACUUCUUCAUAG
260 29642 Luc3:1283U21 siNA (sense) AAGACGAACACUUCUUCAUCG 261 29643
Luc2/3:1283U21 TT siNA (sense) AAGACGAACACUUCUUCAUTT 262 29644
Luc2/3:1303L21 siNA (1283C) (antisense) AUGAAGAAGUGUUCGUCUUCG 263
29645 Luc2/3:1303L21 TT siNA (1283C) AUGAAGAAGUGUUCGUCUUTT 264
(antisense) 29646 Luc2:1487U21 siNA (sense) AAGAGAUCGUGGAUUACGUGG
265 29647 Luc3:1487U21 siNA (sense) AAGAGAUCGUGGAUUACGUCG 266 29648
Luc2/3:1487U21 TT siNA (sense) AAGAGAUCGUGGAUUACGUTT 267 29649
Luc2/3:1507L21 siNA (1487C) (antisense) ACGUAAUCCACGAUCUCUUUU 268
29650 Luc2/3:1507L21 TT siNA (1487C) (antisense)
ACGUAAUCCACGAUCUCUUTT 269 29651 Luc2:1622U21 siNA (sense)
AGGCCAAGAAGGGCGGAAAGU 270 29652 Luc3:1622U21 siNA (sense)
AGGCCAAGAAGGGCGGAAAGA 271 29653 Luc2/3:1622U21 TT siNA (sense)
AGGCCAAGAAGGGCGGAAATT 272 29654 Luc2/3:1642L21 siNA (1622C)
(antisense) UUUCCGCCCUUCUUGGCCUUU 273 29655 Luc2/3:1642L21 TT siNA
(1622C) UUUCCGCCCUUCUUGGCCUTT 274 (antisense) 29656 Luc2:1623U21
siNA (sense) GGCCAAGAAGGGCGGAAAGUC 275 29657 Luc3:1623U21 siNA
(sense) GGCCAAGAAGGGCGGAAAGAU 276
29658 Luc2/3:1623U21 TT siNA (sense) GGCCAAGAAGGGCGGAAAGTT 277
29659 Luc2/3:1643L21 siNA (1623C) (antisense) CUUUCCGCCCUUCUUGGCCUU
278 29660 Luc2/3:1643L21 TT siNA (1623C) CUUUCCGCCCUUCUUGGCCTT 279
(antisense) 29663 Sirna/RPI GL2 Str2 (antisense), all
U.sub.sC.sub.sGAAGU.sub.sAU.sub.sU.sub.sC.sub.sC.sub.sGC.sub.sGU.sub.sAC.-
sub.sGU.sub.sT 280 pyrimidines + 5BrdUT = PS 29664 Sirna/RPI GL2
Str1 (sense) all
C.sub.sGU.sub.sAC.sub.sGC.sub.sGGAAU.sub.sAC.sub.sU.sub.sU.sub.sC.sub.sGA-
U.sub.sT 281 pyrimidines + 5-BrdUT = PS 29665 Sirna/RPI GL2 Str1
(sense) 5 C.sub.sG.sub.sU.sub.sA.sub.sC.sub.sGCGGAAUACUUCGA
U.sub.sT 282 5' + 5-BrdUT = P = S 29666 Sirna/RPI GL2 Str2
(antisense) U.sub.sC.sub.sG.sub.sA.sub.sA.sub.sGUAUUCCGCGUACG
U.sub.sT 283 5' 5 + 5BrdUT = P = S 29667 Sirna/RPI GL2 Str1 (sense)
all
C.sub.sGU.sub.sAC.sub.sGC.sub.sGGAAU.sub.sAC.sub.sU.sub.sU.sub.sC.sub.sGA-
T.sub.sTB 284 pyrimidines + TT = PS + 3'invAba 29668 Sirna/RPI GL2
Str1 (sense) all
BC.sub.sGU.sub.sAC.sub.sGC.sub.sGGAAU.sub.sAC.sub.sU.sub.sU.sub.sC.sub.sG-
AT.sub.sTB 285 pyrimidines = PS + 3' and 5' nvAba 29669 Sirna/RPI
GL2 Str1 (sense) all
BC.sub.sGU.sub.sAC.sub.sGC.sub.sGGAAU.sub.sAC.sub.sU.sub.sU.sub.sC.sub.sG-
AT.sub.sT 286 pyrimidines + TT = PS + 5' invAba 29670 Sirna/RPI GL2
Str2 (antisense), all pyrimidines + TT = PS + 3' inverted
U.sub.sC.sub.sGAAGU.sub.sAU.sub.sU.sub.sC.sub.sC.sub.sGC.sub.sGU.sub.sAC.-
sub.sGT.sub.sTB 287 abasic 29671 Sirna/RPI GL2 Str2 (antisense),
all pyrimidines + TT = PS + 3' and 5'
BU.sub.sC.sub.sGAAGU.sub.sAU.sub.sU.sub.sC.sub.sC.sub.sGC.sub.sGU.sub.sAC-
.sub.sGT.sub.sTB 288 inverted abasic 29672 Sirna/RPI GL2 Str2
(antisense), all
BU.sub.sC.sub.sGAAGU.sub.sAU.sub.sU.sub.sC.sub.sC.sub.sGC.sub.sGU.sub.sAC-
.sub.sGT.sub.sT 289 pyrimidines + TT = PS + 5' inverted abasic
29678 Sirna/RPI GL2 Str1 (sense) + Sirna/RPI UCGAAGUAUUCCGCGUACG
TTBCGUACGCGGAAUACUUCGATT 290 GL2 Str 2 (antisense) (tandem synth.
w/idB on 3' of Str 2) 29681 Sirna/RPI GL2 Str1 (sense) 5' ligation
C.sub.sG.sub.sU.sub.sA.sub.sC.sub.sG 291 fragment 5-5'-P = S 29682
Sirna/RPI GL2 Str1 (sense) 3'-ligation CGGAAUACUUCGAT.sub.sT 292
fragment 5-5'-P = S 29683 Sirna/RPI GL2 Str2 (antisense) 5'
U.sub.sC.sub.sG.sub.sA.sub.sA.sub.sGUA 293 ligation fragment 5-5'-P
= S 29684 Sirna/RPI GL2 Str2 (antisense) 3' UUCCGCGUACGT.sub.sT 294
ligation fragment 5-5'-P = S 29685 Sirna/RPI GL2 Str2 (antisense)
5' U.sub.sC.sub.sG.sub.sA.sub.sA.sub.sG.sub.sU.sub.sA 295 ligation
fragment all-P = S 29686 Sirna/RPI GL2 Str2 (antisense) 3'
U.sub.sU.sub.sC.sub.sC.sub.sG.sub.sC.sub.sG.sub.sU.sub.sA.sub.sC.sub.sG.s-
ub.sT.sub.sT 296 ligation fragment all-P = S 29694 FLT1:349U21 siNA
stab1 (sense)
C.sub.sU.sub.sG.sub.sA.sub.sG.sub.sUUUAAAAGGCACCCT.sub.sT 297 29695
FLT1:2340U21 siNA stab1 (sense)
C.sub.sA.sub.sA.sub.sC.sub.sC.sub.sACAAAAUACAACAAT.sub.sT 298 29696
FLT1:3912U21 siNA stab1 (sense)
C.sub.sC.sub.sU.sub.sG.sub.sG.sub.sGAAAGAAUCAAAACCT.sub.sT 299
29697 FLT1:2949U21 siNA stab1 (sense)
G.sub.sC.sub.sA.sub.sA.sub.sG.sub.sGAGGGCCUCUGAUGT.sub.sT 300 29698
FLT1:369L21 siNA (349C) stab1
G.sub.sG.sub.sG.sub.sU.sub.sG.sub.sCCUUUUAAACUCAGT.sub.sT 301
(antisense) 29699 FLT1:2360L21 siNA (2340C) stab1
U.sub.sU.sub.sG.sub.sU.sub.sU.sub.sGUAUUUUGUGGUUGT.sub.sT 302
(antisense) 29700 FLT1:3932L21 siNA (3912C) stab1
G.sub.sG.sub.sU.sub.sU.sub.sU.sub.sUGAUUCUUUCCAGGT.sub.sT 303
(antisense) 29701 FLT1:2969L21 siNA (2949C) stab1
C.sub.sA.sub.sU.sub.sC.sub.sA.sub.sGAGGCCCUCCUUGCT.sub.sT 304
(antisense) 29706 FLT1:369L21 siNA (349C) (antisense)
G.sub.sG.sub.sG.sub.sU.sub.sG.sub.sC.sub.sC.sub.sU.sub.sU.sub.sU.sub.sU.s-
ub.sA.sub.sA.sub.sA.sub.sC.sub.sU.sub.sC.sub.sA.sub.sG.sub.sT.sub.sT
305 stab2 29707 FLT1:2360L21 siNA (2340C) (antisense)
U.sub.sU.sub.sG.sub.sU.sub.sU.sub.sG.sub.sU.sub.sA.sub.sU.sub.sU.sub.sU.s-
ub.sU.sub.sG.sub.sU.sub.sG.sub.sG.sub.sU.sub.sU.sub.sG.sub.sT.sub.sT
306 stab2 29708 FLT1:3932L21 siNA (3912C) (antisense)
G.sub.sG.sub.sU.sub.sU.sub.sU.sub.sU.sub.sG.sub.sA.sub.sU.sub.sU.sub.sC.s-
ub.sU.sub.sU.sub.sU.sub.sC.sub.sC.sub.sA.sub.sG.sub.sG.sub.sT.sub.sT
307 stab2 29709 FLT1:2969L21 siNA (2949C) (antisense)
C.sub.sA.sub.sU.sub.sC.sub.sA.sub.sG.sub.sA.sub.sG.sub.sG.sub.sC.sub.sC.s-
ub.sC.sub.sU.sub.sC.sub.sC.sub.sU.sub.sU.sub.sG.sub.sC.sub.sT.sub.sT
308 stab2 28030 Sirna/RPI GL2 Str1 (sense)
ggcauuggccaacguacgcggaauacuucgauucgguuacgaa 309 28242 Sirna/RPI GL2
Str1 (sense) 2'-OMe cguacgcggaauacuucgauu 310 28243 Sirna/RPI GL2
Str1 (sense) 14 5' 2'-O-Me cguacgcggaauacUUCGATT 311 28244
Sirna/RPI GL2 Str1 (sense) 10 5' 2'-O-Me cguacgcggaAUACUUCGATT 312
28245 Sirna/RPI GL2 Str1 (sense) 5 5' 2'-O-Me cguacGCGGAAUACUUCGATT
313 28246 Sirna/RPI GL2 Str2 (antisense) all ucgaaguauuccgcguacguu
314 2'-O-me 28247 Sirna/RPI GL2 Str2 (antisense) all ribo
ucGAAGuAuuccGcGuAcGuu 315 pyrimidines = 2'-Ome 28248 Sirna/RPI GL2
Str2 (antisense) 5' 14 ucgaaguauuccgcGUACGTT 316 2'-O-Me 28249
Sirna/RPI GL2 Str2 (antisense) 5' 10 ucgaaguauuCCGCGUACGTT 317
2'-O-Me 28250 Sirna/RPI GL2 Str2 (antisense) 5' 2'-O-Me
ucgaaGUAUUCCGCGUACGTT 318 28251 Sirna/RPI GL2 Str1 (sense) all
cGuAcGcGGAAuAcuucGATT 319 pyrimidines 2'-O-Me except 3'-TT 28252
Sirna/RPI GL2 Str1 (sense) all cGuAcGcGGAAuAcuucGAuu 320
pyrimidines = 2'-OMe 28253 Sirna/RPI GL2 Str1 (sense) + TT = P = S
CGUACGCGGAAUACUUCGAT.sub.sT 321 28261 Sirna/RPI GL2 Str2
(antisense) all ribo uCGAAGuAuuccGcGuAcGTT 322 pyrimidines =
2'-O-me, except 3'-TT 28257 Sirna/RPI GL2 Str1 (sense) + 3' univ.
CGUACGCGGAAUACUUCGAXX 323 base 2 28258 Sirna/RPI GL2 Str1 (sense) +
3' univ CGUACGCGGAAUACUUCGAZZ 324 base 1 28259 Sirna/RPI GL2 Str2
(antisense), + 3' UCGAAGUAUUCCGCGUACGXX 325 univ. base 2 28260
Sirna/RPI GL2 Str2 (antisense), + 3' UCGAAGUAUUCCGCGUACGZZ 326
univ. base 1 28014 Sirna/RPI GL2 Str1 (sense) 5' ligation
c.sub.sG.sub.su.sub.sA.sub.scG 327 fragment P = Scapped Y-2'F 28015
Sirna/RPI GL2 Str1 (sense) 3' ligation
cGGAAuAcuuc.sub.sG.sub.sA.sub.sT.sub.sT 328 fragment P = Scapped
Y-2'F 28026 Sirna/RPI GL2 Str1 (sense) P = Scapped Y-
c.sub.sG.sub.su.sub.sA.sub.scGcGGAAuAcuuc.sub.sG.sub.sA.sub.sT.sub.sT
329 2'F 28016 Sirna/RPI GL2 Str2 (antisense) 5'
u.sub.sc.sub.sG.sub.sA.sub.sAGuA 330 ligation fragment P = Scapped
Y-2'F 28017 Sirna/RPI GL2 Str2 (antisense) 3'
uuccGCGuA.sub.sc.sub.sG.sub.sT.sub.sT 331 ligation fragment P =
Scapped Y-2'F 28027 Sirna/RP1 GL2 Str2 (antisense) P =
u.sub.sc.sub.sG.sub.sA.sub.sAGuAuuccGCGuA.sub.sc.sub.sG.sub.sT.sub.sT
332 Scapped Y-2'F 28018 Sirna/RPI GL2 Str1 (sense) 5' ligation
.sub.scGuAcG 333 fragment 5'P = S Y-2'F 28019 Sirna/RPI GL2 Str1
(sense) 3' ligation cGGAAuAcuucGATT 334 fragment 5'P = S Y-2'F
28028 Sirna/RPI GL2 Str1 (sense) 5'P = S Y-2'F
.sub.scGuAcGcGGAAuAcuucGATT 335 28020 Sirna/RPI GL2 Str2
(antisense) 5' .sub.sucGAAGuA 336 ligation fragment 5'P = S Y-2'F
28021 Sirna/RPI GL2 Str2 (antisense) 3'ligation uuccGCGuAcGTT 337
fragment 5'P = S Y-2'F 28029 Sirna/RPI GL2 Str2 (antisense) 5'P = S
Y- .sub.sucGAAGuAuuccGCGuAcGTT 338 2'F 28022 Sirna/RPI Inverted GL2
Str1 (sense)
A.sub.sG.sub.sc.sub.su.sub.sucAuAAGGcGcAu.sub.sG.sub.sc.sub.sT.sub.sT
339 P = Scapped Y-2'F 28023 Sirna/RPI Inverted GL2 Str2 (antisense)
G.sub.sc.sub.sA.sub.su.sub.sGcGccuuAuGAAG.sub.sc.sub.su.sub.sT.sub.sT
340 P = Scapped Y-2'F 28024 Sirna/RPI Inverted GL2 Str1 (sense) 5'P
= .sub.sAGcuucAuAAGGcGcAuGcTT 341 S Y-2'F 28025 Sirna/RPI Inverted
GL2 Str2 (antisense) .sub.sGcAuGcGccuuAuGAAGcuTT 342 5'P = S Y-2'F
28455 Sirna/RPI GL2 Str1 (sense) 2'-F U C cGuAcGcGGAAuAcuucGATT 343
28456 Sirna/RPI GL2 Str2 (antisense) 2'-F U C ucGAAGuAuuccGcGuAcGTT
344
29702 FLT1:349U21 siNA stab3 (sense)
c.sub.su.sub.sG.sub.sA.sub.sGuuuAAAAGGcAc.sub.sc.sub.sc.sub.sT.sub.sT
345 29703 FLT1:2340U21 siNA stab3 (sense)
c.sub.sA.sub.sA.sub.sc.sub.scAcAAAAuAcAAc.sub.sA.sub.sA.sub.sT.sub.sT
346 29704 FLT1:3912U21 siNA stab3 (sense)
c.sub.sc.sub.su.sub.sG.sub.sGAAAGAAucAAAA.sub.sc.sub.sc.sub.sT.sub.sT
347 29705 FLT1:2949U21 siNA stab3 (sense)
G.sub.sc.sub.sA.sub.sA.sub.sGGAGGGccucuGA.sub.su.sub.sG.sub.sT.sub.sT
348 28443 Sirna/RPI GL2 Str1 (sense) 2'-amino U C
cGuAcGcGGAAuAcuucGATT 349 28444 Sirna/RPI GL2 Str2 (antisense)
2'-amino U ucGAAGuAuuccGcGuAcGTT 350 C 28445 Sirna/RPI GL2 Str1
(sense) 2'-amino U C cGuAcGcGGAAuAcuucGAuT 351 uT 3'end 28446
Sirna/RPI GL2 Str2 (antisense) 2'-amino U ucGAAGuAuuccGcGuAcGuT 352
C uT 3'end 30051 HCV-Luc:325U21 siNA 5 5' P = S + 3' univ.
BC.sub.sC.sub.sC.sub.sC.sub.sG.sub.sGGAGGUCUCGUAGAXXB 353 base 2 +
5'/3' invAba (antisense) 30052 HCV-Luc:325U21 siNA rev 5 5' P = S +
3' BA.sub.sG.sub.sA.sub.sU.sub.sG.sub.sCUCUGGAGGGCCCCXXB 354 univ.
base 2 + 5'/3' invAba (antisense) 30053 HCV-Luc:345L21 siNA (325C)
(antisense) U.sub.sC.sub.sU.sub.sA.sub.sC.sub.sGAGACCUCCCGGGGXXB
355 5 5' P = S + 3' univ. base 2 + 3' invAba (sense) 30054
HCV-Luc:345L21 siNA (325C) (antisense)
G.sub.sG.sub.sG.sub.sG.sub.sC.sub.sCCUCCAGAGCAUCUXXB 356 rev 5 5' P
= S + 3' univ. base 2 + 3' invAba (sense) 30055 HCV-Luc:325U21 siNA
all Y P = S + 3'
BC.sub.sC.sub.sC.sub.sC.sub.sGGGAGGU.sub.sC.sub.sU.sub.sC.sub.sGU.sub.sAG-
AXXB 357 univ. base 2 + 5'/3' invAba (antisense) 30056
HCV-Luc:325U21 siNA rev all Y P = S + 3'
BAGAU.sub.sGC.sub.sU.sub.sC.sub.sU.sub.sGGAGGGC.sub.sC.sub.sC.sub.sC.sub.-
sXXB 358 univ. base 2 + 5'/3' invAba (antisense) 30057
HCV-Luc:345L21 siNA (325C) (antisense)
U.sub.sC.sub.sU.sub.sAC.sub.sGAGAC.sub.sC.sub.sU.sub.sC.sub.sC.sub.sC.sub-
.sGGGGXXB 359 all Y P = S + 3' univ. base 2 + 3' invAba (sense)
30058 HCV-Luc:345L21 siNA (325C) (antisense)
GGGGC.sub.sC.sub.sC.sub.sU.sub.sC.sub.sC.sub.sAGAGC.sub.sAU.sub.sC.sub.sU-
.sub.sXXB 360 rev all Y P = S + 3' univ. base 2 + 3' invAba (sense)
30059 HCV-Luc:325U21 siNA 4/3 P = S ends + all
Bc.sub.sc.sub.sc.sub.sc.sub.sGGGAGGucucGuA.sub.sG.sub.sA.sub.sXXB
361 Y-2'F + 3' univ. base 2 + 5'/3' invAba (antisense) 30060
HCV-Luc:325U21 siNA rev 4/3 P = S ends +
BA.sub.sG.sub.sA.sub.su.sub.sGcucuGGAGGGcc.sub.sc.sub.sc.sub.sXXB
362 all Y-2'F + 3' univ. base 2 + 5'/3' invAba (antisense) 30170
HCV-Luc:325U21 siNA all Y-2'F + 3' univ. B ccccGGGAGGucucGuAGAXX B
363 base 2 + 5'/3' invAba (antisense) 30171 HCV-Luc:325U21 siNA rev
all Y-2'F + 3' B AGAuGcucuGGAGGGccccXX B 364 univ. base 2 + 5'/3'
invAba (antisense) 30172 HCV-Luc:345L21 siNA (325C) (antisense) B
U.sub.sC.sub.sU.sub.sAC.sub.sGAGAC.sub.sC.sub.sU.sub.sC.sub.sC.sub.sC.sub-
.sGGGGXX B 365 all Y P = S + 3' univ. base 2 + 5'/3' invAba
(antisense) 30173 HCV-Luc:345L21 siNA (325C) (antisense)
ucuAcGAGAccucccGGGG 366 all Y-2'F 30174 HCV-Luc:345L21 siNA (325C)
(antisense) GGGGcccuccAGAGcAucu 367 rev all Y-2'F 30175
HCV-Luc:345L21 siNA (325C) (antisense) ucuAcGAGAccucccGGGGXX 368
all Y-2'F + 3' univ. base 2 30176 HCV-Luc:345L21 siNA (325C)
(antisense) GGGGcccuccAGAGcAucuXX 369 rev all Y-2'F + 3' univ. base
2 30177 HCV-Luc:345L21 siNA (325C) (antisense) B
ucuAcGAGAccucccGGGGXX B 370 all Y-2'F + 3' univ. base 2 + 5'/3' iB
30178 HCV-Luc:325U21 siNA all Y P = S + 3'
C.sub.sC.sub.sC.sub.sC.sub.sGGGAGGU.sub.sC.sub.sU.sub.sC.sub.sGU.sub.sAGA-
XX B 371 univ. base 2 + 3' invAba (sense) 30063 Sirna/RPI GL2 Str1
(sense) 2'-F U,C + 3', BcGuAcGcGGAAuAcuucGATTB 372 5' abasic 30222
Sirna/RPI GL2 Str1 (sense) Y 2'-O-Me B cGuAcGcGGAAuAcuucGATT B 373
with 3'-TT & 5'/3' iB 30224 Sirna/RPI GL2 Str2 (antisense) Y
2'-F & ucGAAGuAuuccGcGuAcGT.sub.sT 374 3' TsT 30430 Sirna/RPI
GL2 Str2 (antisense) 2'-F U,C + ucgaaguauuccgcguacgT.sub.sT 375
5',3' abasic, A,G = 2'-O-Me 30431 Sirna/RPI GL2 Str1 (sense) 2'-F
U,C + 3', BcguacgcggaauacuucgaTTB 376 5' abasic,TT; 2'-O-Me-A,G
30433 Sirna/RPI GL2 Str1 (sense) 2'-F U,C + 3',
BcGuAcGcGGAAuAcuucGATTB 377 5' abasic,TT; 2'-deoxy-A,G 30550
Sirna/RPI GL2 Str2 (antisense) 2'-F U,C ucGAAGuAuuccGcGuAcGT.sub.st
378 3'- dTsT 30555 Sirna/RPI GL2 Str2 (antisense) 2'-F U,C
ucGAAGuAuuccGcGuAcGTL 379 3'- glycerol.T 30556 Sirna/RPI GL2 Str2
(antisense) 2'-F U,C ucGAAGuAuuccGcGuAcGTTL 380 3'- glycerol,2T
30226 rev Sirna/RPI GL2 Str1 (sense) Y 2'-O-Me B
AGcuucAuAAGGcGcAuGcTT B 381 with 3'-TT & 5'/3' iB 30227 rev
Sirna/RPI GL2 Str1 (sense) Y 2'-F B AGcuucAuAAGGcGcAuGcTT B 382
with 3'-TT & 5'/3' iB 30229 rev Sirna/RPI GL2 Str2 (antisense)
Y GcAuGcGccuuAuGAAGcuT.sub.sT 383 2'-F & 3' TsT 30434 Sirna/RPI
GL2 Str1 (sense) 2'-F U,C + 3', BcguacgcGGAAuAcuucgaTTB 384 5'
Abasic,TT; 2'-O-Me-A,G;ribo core 30435 Sirna/RPI GL2 Str1 (sense)
2'-F U,C + 3', BcGuAcGcGGAAuAcuucGATTB 385 5' Abasic,TT;
2'-deoxyA,G;ribo core 30546 Sirna/RPI GL2 Str2 (antisense) 2'-F U,C
ucGAAGuAuuccGcGuAcG3T 386 3'- dTT 30551 Sirna/RPI GL2 Str2
(antisense) 2'-F U,C ucGAAGuAuuccGcGuAcGTddC 387 dTddC 30557
Sirna/RPI GL2 Str2 (antisense) 2'-F U,C ucGAAGuAuuccGcGuAcGT 388
3'- invertedT,T 30558 Sirna/RPI GL2 Str2 (antisense) 2'-F U,C
ucGAAGuAuuccGcGuAcGTT 389 3'- invertedT,TT 30196 FLT1:2340U21 siRNA
sense iB caps B cAAccAcAAAAuAcAAcAATT B 419 w/2'FY's 30416
FLT1:2358L21 siRNA (2340C) (antisense) uuGuuGuAuuuuGuGGuuGT.sub.sT
420 TsT 29548 HBV:394L21 siRNA (414C) (antisense)
GAUGAGGCAUAGCAGCAGGTT 421 29544 HBV:414U21 siRNA pos (sense)
CCUGCUGCUAUGCCUCAUCTT 422 29556 HBV:394L21 siRNA neg (414C)
(antisense) GGACGACGAUACGGAGUAGTT 423 inv 29552 HBV:414U21 siRNA
pos (sense) inv CUACUCCGUAUCGUCGUCCTT 424 30350 HBV:262U21 siRNA
stab04 (sense) B uGGAcuucucucAAuuuucuA B 425 30361 HBV:280L21 siRNA
(262C) (antisense) GAAAAuuGAGAGAAGuccAT.sub.sT 426 stab05 30372
HBV:262U21 siRNA inv stab04 (sense) B AucuuuuAAcucucuucAGGu B 427
30383 HBV:280L21 siRNA (262C) (antisense) inv
AccuGAAGAGAGuuAAAAGT.sub.sT 428 stab05 30352 HBV:380U21 siRNA
stab04 (sense) B uGuGucuGcGGcGuuuuAucA B 429 30363 HBV:398L21 siRNA
(380C) (antisense) AuAAAAcGccGcAGAcAcAT.sub.sT 430 stab05 30374
HBV:380U21 siRNA inv stab04 (sense) B AcuAuuuuGcGGcGucuGuGu B 431
30385 HBV:398L21 siRNA (380C) (antisense) inv
AcAcAGAcGccGcAAAAuAT.sub.sT 432 stab05 30353 HBV:413U21 siRNA
stab04 (sense) B uccuGcuGcuAuGccucAucu B 433 30364 HBV:431L21 siRNA
(413C) (antisense) AuGAGGcAuAGcAGcAGGAT.sub.sT 434 stab05 30375
HBV:413U21 siRNA inv stab04 (sense) B ucuAcuccGuAucGucGuccu B 435
30386 HBV:431L21 siRNA (413C) (antisense) inv
AGGAcGAcGAuAcGGAGuAT.sub.sT 436 stab05 30354 HBV:462U21 siRNA
stab04 (sense) B uAuGuuGcccGuuuGuccucu B 437 30365 HBV:480L21 siRNA
(462C) (antisense) AGGAcAAAcGGGcAAcAuAT.sub.sT 438 stab05 30376
HBV:462U21 siRNA inv stab04 (sense) B ucuccuGuuuGcccGuuGuAu B 439
30387 HBV:480L21 siRNA (462C) (antisense) inv
AuAcAAcGGGcAAAcAGGAT.sub.sT 440 stab05 30355 HBV:1580U21 siRNA
stab04 (sense) B uGuGcAcuucGcuucAccucu B 441 30366 HBV:1598L21
siRNA (1580C) (antisense) AGGuGAAGcGAAGuGcAcAT.sub.sT 442 stab05
30377 HBV:1580U21 siRNA inv stab04 (sense) B ucuccAcuucGcuucAcGuGu
B 443 30388 HBV:1598L21 siRNA (1580C) (antisense)
AcAcGuGAAGcGAAGuGGAT.sub.sT 444 inv stab05 30356 HBV:1586U21 siRNA
stab04 (sense) B cuucGcuucAccucuGcAcGu B 445 30367 HBV:1604L21
siRNA (1586C) (antisense) GuGcAGAGGuGAAGcGAAGT.sub.sT
446 stab05 30378 HBV:1586U21 siRNA inv stab04 (sense) B
uGcAcGucuccAcuucGcuuc B 447 30389 HBV:1604L21 siRNA (1586C)
(antisense) GAAGcGAAGuGGAGAcGuGT.sub.sT 448 inv stab05 30357
HBV:1780U21 siRNA stab04 (sense) B AGGcuGuAGGcAuAAAuuGGu B 449
30368 HBV:1798L21 siRNA (1780C) (antisense)
cAAuuuAuGccuAcAGccuT.sub.sT 450 stab05 30379 HBV:1780U21 siRNA inv
stab04 (sense) B uGGuuAAAuAcGGAuGucGGA B 451 30390 HBV:1798L21
siRNA (1780C) (antisense) uccGAcAuccGuAuuuAAcT.sub.sT 452 inv
stab05 30612 HBV:1580U21 siRNA stab07 (sense) B
uGuGcAcuucGcuucAccuTT B 453 30620 HBV:1598L21 siRNA (1580C)
(antisense) aggugaagcgaagugcacaT.sub.sT 454 stab08 30628
HBV:1582U21 siRNA inv stab07 (sense) B ucuccAcuucGcuucAcGuTT B 455
30636 HBV:1596L21 siRNA (1578C) (antisense)
gcacacgugaagcgaagugT.sub.sT 456 inv stab08 30612 HBV:1580U21 siRNA
stab07 (sense) B uGuGcAcuucGcuucAccuTT B 457 31175 HBV:1598L21
siRNA (1580C) stab11 AGGuGAAGcGAAGuGcAcAT.sub.sT 458 (antisense)
30612 HBV:1580U21 siRNA stab07 (sense) B uGuGcAcuucGcuucAccuTT B
459 31176 HBV:1596L21 siRNA (1578C) (antisense)
GcAcAcGuGAAGcGAAGuGT.sub.sT 460 inv stab11 (antisense) 30287
HBV:1580U21 siRNA (sense) UGUGCACUUCGCUUCACCUCU 461 30298
HBV:1598L21 siRNA (1580C) (antisense) AGGUGAAGCGAAGUGCACACG 462
30355 HBV:1580U21 siRNA stab04 (sense) B uGuGcAcuucGcuucAccucu B
463 30366 HBV:1598L21 siRNA (1580C) (antisense)
AGGuGAAGcGAAGuGcAcATsT 464 stab05 30612 HBV:1580U21 siRNA stab07
(sense) B uGuGcAcuucGcuucAccuTT B 465 31175 HBV:1598L21 siRNA
(1580C) stab11 AGGuGAAGcGAAGuGcAcATsT 466 (antisense) 30612
HBV:1580U21 siRNA stab07 (sense) B uGuGcAcuucGcuucAccuTT B 467
30620 HBV:1598L21 siRNA (1580C) (antisense) AGGuGAAGcGAAGuGcAcATsT
468 stab08 31335 HBV:1580U21 siRNA stab09 (sense) B
UGUGCACUUCGCUUCACCUTT B 469 31337 HBV:1598L21 siRNA (1580C) stab10
AGGUGAAGCGAAGUGCACATsT 470 (antisense) 31456 HCVa:291U21 siRNA
stab04 B cuuGuGGuAcuGccuGAuATT B 471 31468 HCVa:309L21 siRNA (291C)
stab05 uAucAGGcAGuAccAcAAGTsT 472 31480 HCVa:291U21 siRNA inv
stab04 B AuAGuccGucAuGGuGuucTT B 473 31492 HCVa:309L21 siRNA (291C)
inv stab05 GAAcAccAuGAcGGAcuAuTsT 474 31461 HCVa:300U21 siRNA
stab04 B cuGccuGAuAGGGuGcuuGTT B 475 31473 HCVa:318L21 siRNA (300C)
stab05 cAAGcAcccuAucAGGcAGTsT 476 31485 HCVa:300U21 siRNA inv
stab04 B GuucGuGGGAuAGuccGucTT B 477 31497 HCVa:318L21 siRNA (300C)
inv stab05 GAcGGAcuAucccAcGAAcTst 478 31463 HCVa:303U21 siRNA
stab04 B ccuGAuAGGGuGcuuGcGATT B 479 31475 HCVa:321L21 siRNA (303C)
stab05 ucGcAAGcAcccuAucAGGTsT 480 31487 HCVa:303U21 siRNA inv
stab04 B AGcGuucGuGGGAuAGuccTT B 481 31499 HCVa:321L21 siRNA (303C)
inv stab05 GGAcuAucccAcGAAcGcuTsT 482 31344 HCVa:325U21 siRNA
stab07 B ccccGGGAGGucucGuAGATT B 483 30562 HCVa:345L21 siRNA (325C)
Y-2'F, R- ucuAcGAGAccucccGGGGTsT 484 2'OMe + TsT 31345 HCVa:325U21
siRNA inv stab07 B AGAuGcucuGGAGGGccccTT B 485 31346 HCVa:343L21
siRNA (325C) inv stab08 GGGGcccuccAGAGcAucuTsT 486 31702
HCVa:326U21 siRNA stab07 B cccGGGAGGucucGuAGAcTT B 487 31706
HCVa:344L21 siRNA (326C) stab08 GucuAcGAGAccucccGGGTsT 488 31710
HCVa:326U21 siRNA inv stab07 B cAGAuGcucuGGAGGGcccTT B 489 31714
HCVa:344L21 siRNA (326C) inv stab08 GGGcccuccAGAGcAucuGTsT 490
31703 HCVa:327U21 siRNA stab07 B ccGGGAGGucucGuAGAccTT B 491 31707
HCVa:345L21 siRNA (327C) stab08 GGucuAcGAGAccucccGGTsT 492 31711
HCVa:327U21 siRNA inv stab07 B ccAGAuGcucuGGAGGGccTT B 493 31715
HCVa:345L21 siRNA (327C) inv stab08 GGcccuccAGAGcAucuGGTsT 494
31704 HCVa:328U21 siRNA stab07 B cGGGAGGucucGuAGAccGTT B 495 31708
HCVa:346L21 siRNA (328C) stab08 cGGucuAcGAGAccucccGTsT 496 31712
HCVa:328U21 siRNA inv stab07 B GccAGAuGcucuGGAGGGcTT B 497 31716
HCVa:346L21 siRNA (328C) inv stab08 GcccuccAGAGcAucuGGcTsT 498
31705 HCVa:329U21 siRNA stab07 B GGGAGGucucGuAGAccGuTT B 499 31709
HCVa:347L21 siRNA (329C) stab08 AcGGucuAcGAGAccucccTsT 500 31713
HCVa:329U21 siRNA inv stab07 B uGccAGAuGcucuGGAGGGTT B 501 31717
HCVa:347L21 siRNA (329C) inv stab08 cccuccAGAGcAucuGGcATsT 502
31703 HCVa:327U21 siRNA stab07 B ccGGGAGGucucGuAGAccTT B 503 31707
HCVa:345L21 siRNA (327C) stab08 GGucuAcGAGAccucccGGTsT 504 31711
HCVa:327U21 siRNA inv stab07 B ccAGAuGcucuGGAGGGccTT B 505 31715
HCVa:345L21 siRNA (327C) inv stab08 GGcccuccAGAGcAucuGGTsT 506
CCCCGGGAGGUCUCGUAGACCGU 543 HCVa:327 siRNA 3'-classI 10 bp
UCUCGUAGACCUUGGUCUACGAGACCUCCCGGTT 544 HCVa:327 siRNA 3'-classI 8
bp UCGUAGACCUUGGUCUACGAGACCUCCCGGTT 545 HCVa:327 siRNA 3'-classI 6
bp GUAGACCUUGGUCUACGAGACCUCCCGGTT 546 HCVa:327 siRNA 3'-classI 4 bp
AGACCUUGGUCUACGAGACCUCCCGGTT 547 HCVa:327 siRNA 5'-classI 10 bp
GGUCUACGAGACCUCCCGGUUCCGGGAGGUCU 548 HCVa:327 siRNA 5'-classI 8 bp
GGUCUACGAGACCUCCCGGUUCCGGGAGGU 549 HCVa:327 siRNA 5'-classI 6 bp
GGUCUACGAGACCUCCCGGUUCCGGGAG 550 HCVa:327 siRNA 5'-classI 4 bp
GGUCUACGAGACCUCCCGGUUCCGGG 551 HCVa:327 siRNA 3'-gaaa 10 bp
CUCGUAGACCGAAAGGUCUACGAGACCUCCCGGTT 552 HCVa:327 siRNA 3'-gaaa 8 bp
CGUAGACCGAAAGGUCUACGAGACCUCCCGGTT 553 HCVa:327 siRNA 3'-gaaa 6 bp
UAGACCGAAAGGUCUACGAGACCUCCCGGTT 554 HCVa:327 siRNA 3'-gaaa 4 bp
GACCGAAAGGUCUACGAGACCUCCCGGTT 555 HCVa:327 siRNA 5'-gaaa 10 bp
GGUCUACGAGACCUCCCGGUUGAAACCGGGAGGUC 556 HCVa:327 siRNA 5'-gaaa 8 bp
GGUCUACGAGACCUCCCGGUUGAAACCGGGAGG 557 HCVa:327 siRNA 5'-gaaa 6 bp
GGUCUACGAGACCUCCCGGUUGAAACCGGGA 558 HCVa:327 siRNA 5'-gaaa 4 bp
GGUCUACGAGACCUCCCGGUUGAAACCGG 559 HCVa:327 siRNA 3'-uuuguguag 10 bp
CGUAGACCUUUUUGUGUAGGGUCUACGAGACCUCCCGGTT 560 HCVa:327 siRNA
3'-uuuguguag 8 bp UAGACCUUUUUGUGUAGGGUCUACGAGACCUCCCGGTT 561
HCVa:327 siRNA 3'-uuuguguag 6 bp
GACCUUUUUGUGUAGGGUCUACGAGACCUCCCGGTT 562 HCVa:327 siRNA
3'-uuuguguag 4 bp CCUUUUUGUGUAGGGUCUACGAGACCUCCCGGTT 563 HCVa:327
siRNA 5'-uuuguguag 10 bp GGUCUACGAGACCUCCCGGUUUUUGUGUAGCCGGGAGGUC
564 HCVa:327 siRNA 5'-uuuguguag 8 bp
GGUCUACGAGACCUCCCGGUUUUUGUGUAGCCGGGAGG 565 HCVa:327 siRNA
5'-uuuguguag 6 bp GGUCUACGAGACCUCCCGGUUUUUGUGUAGCCGGGA 566 HCVa:327
siRNA 5'-uuuguguag 4 bp GGUCUACGAGACCUCCCGGUUUUUGUGUAGCCGG 567
HCVa:327 siRNA 3'-classI 10 bp stab08
ucucGuAGAccuuGGucuAcGAGAccucccGGTsT 568 HCVa:327 siRNA 3'-classI 8
bp stab08 ucGuAGAccuuGGucuAcGAGAccucccGGTsT 569 HCVa:327 siRNA
3'-classI 6 bp stab08 GuAGAccuuGGucuAcGAGAccucccGGTsT 570 HCVa:327
siRNA 3'-classI 4 bp stab08 AGAccuuGGucuAcGAGAccucccGGTsT 571
HCVa:327 siRNA 5'-classI 10 bp stab08
GGucuAcGAGAccucccGGuuccGGGAGGucu 572 HCVa:327 siRNA 5'-classI 8 bp
stab08 GGucuAcGAGAccucccGGuuccGGGAGGu 573 HCVa:327 siRNA 5'-classI
6 bp stab08 GGucuAcGAGAccucccGGuuccGGGAG 574 HCVa:327 siRNA
5'-classI 4 bp stab08 GGucuAcGAGAccucccGGuuccGGG 575 HCVa:327 siRNA
3'-gaaa 10 bp stab08 cucGuAGAccGAAAGGucuAcGAGAccucccGGTsT 576
HCVa:327 siRNA 3'-gaaa 8 bp stab08
cGuAGAccGAAAGGucuAcGAGAccucccGGTsT 577 HCVa:327 siRNA 3'-gaaa 6 bp
stab08 uAGAccGAAAGGucuAcGAGAccucccGGTsT 578 HCVa:327 siRNA 3'-gaaa
4 bp stab08 GAccGAAAGGucuAcGAGAccucccGGTsT 579 HCVa:327 siRNA
5'-gaaa 10 bp stab08 GGucuAcGAGAccucccGGuuGAAAccGGGAGGuc 580
HCVa:327 siRNA 5'-gaaa 8 bp stab08
GGucuAcGAGAccucccGGuuGAAAccGGGAGG 581 HCVa:327 siRNA 5'-gaaa 6 bp
stab08 GGucuAcGAGAccucccGGuuGAAAccGGGA 582 HCVa:327 siRNA 5'-gaaa 4
bp stab08 GGucuAcGAGAccucccGGuuGAAAccGG 583 HCVa:327 siRNA
3'-uuuguguag 10 bp cGuAGAccuuuuuGuGuAGGGucuAcGAGAccucccGGTsT 584
stab08 HCVa:327 siRNA 3'-uuuguguag 8 bp
uAGAccuuuuuGuGuAGGGucuAcGAGAccucccGGTsT 585 stab08 HCVa:327 siRNA
3'-uuuguguag 6 bp GAccuuuuuGuGuAGGGucuAcGAGAccucccGGTsT 586 stab08
HCVa:327 siRNA 3'-uuuguguag 4 bp
ccuuuuuGuGuAGGGucuAcGAGAccucccGGTsT 587 stab08 HCVa:327 siRNA
5'-uuuguguag 10 bp
GGucuAcGAGAccucccGGuuuuuGuGuAGccGGGAGGuc 588 stab08 HCVa:327 siRNA
5'-uuuguguag 8 bp GGucuAcGAGAccucccGGuuuuuGuGuAGccGGGAGG 589 stab08
HCVa:327 siRNA 5'-uuuguguag 6 bp
GGucuAcGAGAccucccGGuuuuuGuGuAGccGGGA 590 stab08 HCVa:327 siRNA
5'-uuuguguag 4 bp GGucuAcGAGAccucccGGuuuuuGuGuAGccGG 591 stab08
HCVa:347L23 siRNA (327C) stab08 acGGucuAcGAGAccucccGGTsT 592
HCVa:346L22 siRNA (327C) stab08 cGGucuAcGAGAccucccGGTsT 593
HCVa:345L21 siRNA (327C) stab08 GGucuAcGAGAccucccGGTsT 594
HCVa:344L20 siRNA (327C) stab08 GucuAcGAGAccucccGGTsT 595
HCVa:343L19 siRNA (327C) stab08 ucuAcGAGAccucccGGTsT 596
HCVa:342L18 siRNA (327C) stab08 cuAcGAGAccucccGGTsT 597 HCVa:341L17
siRNA (327C) stab08 uAcGAGAccucccGGTsT 598 HCVa:340L16 siRNA (327C)
stab08 AcGAGAccucccGGTsT 599 HCVa:339L15 siRNA (327C) stab08
cGAGAccucccGGTsT 600 HCVa:345L21 siRNA (327C) stab08 GG
GGucuAcGAGAccucccGGGsG 601 HCVa:345L20 siRNA (327C) stab08 G
GGucuAcGAGAccucccGGsG 602 HCVa:345L20 siRNA (327C) stab08
GGucuAcGAGAccucccGGsT 603 HCVa:345L19 siRNA (327C) stab08
GGucuAcGAGAccucccGsG 604 HCVa:345L18 siRNA (327C) stab08
GGucuAcGAGAccucccsG 605 HCVa:345L17 siRNA (327C) stab08
GGucuAcGAGAccuccsc 606 HCVa:345L16 siRNA (327C) stab08
GGucuAcGAGAccucsc 607 HCVa:345L15 siRNA (327C) stab08
GGucuAcGAGAccusc 608 HCVa:327U21 siRNA stab07 B
ccGGGAGGucucGuAGAccTT B 609 HCVa:327U21 siRNA stab07 GT B
ccGGGAGGucucGuAGAccGT B 610 HCVa:327U21 siRNA stab07 B
cGGGAGGucucGuAGAccTT B 611 HCVa:328U20 siRNA stab07 B
GGGAGGucucGuAGAccTT B 612 HCVa:329U19 siRNA stab07 B
GGAGGucucGuAGAccTT B 613 HCVa:330U18 siRNA stab07 B
GAGGucucGuAGAccTT B 614 HCVa:331U17 siRNA stab07 B AGGucucGuAGAccTT
B 615 HCVa:332U16 siRNA stab07 B ccGGGAGGucucGuAGAccT B 616
HCVa:327U21 siRNA stab07 B ccGGGAGGucucGuAGAcc B 617 HCVa:327U21
siRNA stab07 B ccGGGAGGucucGuAGAc B 618 HCVa:327U21 siRNA stab07 B
ccGGGAGGucucGuAGA B 619 HCVa:327U21 siRNA stab07 B ccGGGAGGucucGuAG
B 620 31270 FLT1:349U21 siRNA stab09 sense B CUGAGUUUAAAAGGCACCCTT
B 621 31273 FLT1:367L21 siRNA (349C) stab10 GGGUGCCUUUUAAACUCAGTsT
622 antisense 31276 FLT1:349U21 siRNA stab09 inv sense B
CCCACGGAAAAUUUGAGUCTT B 623 31279 FLT1:367L21 siRNA (349C) stab10
inv GACUCAAAUUUUCCGUGGGTsT 624 antisense 31679 HBV1598 all RNA
sense AGGUGAAGCGAAGUGCACAUU 625 30287 HBV1598 all RNA antisense
UGUGCACUUCGCUUCACCUCU 626
UPPER CASE=ribonucleotide Lower case=2'-O-methyl nucleotide
Underline=2'-deoxy-2'-amino nucleotide Italic=2'-deoxy-2'-fluoro
nucleotide T=thymidine T=inverted thymidine t=3'-deoxy thymidine
B=inverted deoxyabasic succinate linker B=inverted deoxyabasic
X=universal base (5-nitroindole) Z=universal base (3-nitropyrrole)
S=phosphorothioate internucleotide linkage U=5-bromodeoxyuridine
A=deoxyadenosine G=deoxyguanosine L=glyceryl moiety
[0707] ddC=dideoxy Cytidine TABLE-US-00002 TABLE II Wait Time* Wait
Time* Wait Time* Reagent Equivalents Amount DNA 2'-O-methyl RNA A.
2.5 .mu.mol Synthesis Cycle ABI 394 Instrument Phosphoramidites 6.5
163 .mu.L 45 sec 2.5 min 7.5 min S-Ethyl Tetrazole 23.8 238 .mu.L
45 sec 2.5 min 7.5 min Acetic Anhydride 100 233 .mu.L 5 sec 5 sec 5
sec N-Methyl Imidazole 186 233 .mu.L 5 sec 5 sec 5 sec TCA 176 2.3
mL 21 sec 21 sec 21 sec Iodine 11.2 1.7 mL 45 sec 45 sec 45 sec
Beaucage 12.9 645 .mu.L 100 sec 300 sec 300 sec Acetonitrile NA
6.67 mL NA NA NA B. 0.2 .mu.mol Synthesis Cycle ABI 394 Instrument
Phosphoramidites 15 31 .mu.L 45 sec 233 sec 465 sec S-Ethyl
Tetrazole 38.7 31 .mu.L 45 sec 233 min 465 sec Acetic Anhydride 655
124 .mu.L 5 sec 5 sec 5 sec N-Methyl Imidazole 1245 124 .mu.L 5 sec
5 sec 5 sec TCA 700 732 .mu.L 10 sec 10 sec 10 sec Iodine 20.6 244
.mu.L 15 sec 15 sec 15 sec Beaucage 7.7 232 .mu.L 100 sec 300 sec
300 sec Acetonitrile NA 2.64 mL NA NA NA C. 0.2 .mu.mol Synthesis
Cycle 96 well Instrument Equivalents: Amount: DNA/2'-O- DNA/2'-O-
Wait Time* Wait Time* Wait Time* Reagent methyl/Ribo methyl/Ribo
DNA 2'-O-methyl Ribo Phosphoramidites 22/33/66 40/60/120 .mu.L 60
sec 180 sec 360 sec S-Ethyl Tetrazole 70/105/210 40/60/120 .mu.L 60
sec 180 min 360 sec Acetic Anhydride 265/265/265 50/50/50 .mu.L 10
sec 10 sec 10 sec N-Methyl Imidazole 502/502/502 50/50/50 .mu.L 10
sec 10 sec 10 sec TCA 238/475/475 250/500/500 .mu.L 15 sec 15 sec
15 sec Iodine 6.8/6.8/6.8 80/80/80 .mu.L 30 sec 30 sec 30 sec
Beaucage 34/51/51 80/120/120 100 sec 200 sec 200 sec Acetonitrile
NA 1150/1150/1150 .mu.L NA NA NA Wait time does not include contact
time during delivery. Tandem synthesis utilizes double coupling of
linker molecule
[0708] TABLE-US-00003 TABLE III Stock VEGF Number of Conc. Group
Solution on Filter (1.0 .mu.L) concentration Animals Injectate (6.0
.mu.L) Dose injectate 1 Tris-Cl pH 6.9 NA 5 water NA NA 2 R&D
Systems VEGF-carrier free 75 .mu.M 3.53 .mu.g/.mu.L 5 water NA NA 3
R&D Systems VEGF-carrier free 75 .mu.M 3.53 .mu.g/.mu.L 5 Site
2340 Stab1 siRNA 10 .mu.g/eye 1.67 .mu.g/.mu.L 4 R&D Systems
VEGF-carrier free 75 .mu.M 3.53 .mu.g/.mu.L 5 Site 2340 Stab1 siRNA
3 .mu.g/eye 0.5 .mu.g/.mu.L 5 R&D Systems VEGF-carrier free 75
.mu.M 3.53 .mu.g/.mu.L 5 Site 2340 Stab1 siRNA 1 .mu.g/eye 0.167
.mu.g/.mu.L 6 R&D Systems VEGF-carrier free 75 .mu.M 3.53
.mu.g/.mu.L 5 Inactive Site 2340 Stab1 siRNA 10 .mu.g/eye 1.67
.mu.g/.mu.L 7 R&D Systems VEGF-carrier free 75 .mu.M 3.53
.mu.g/.mu.L 5 Inactive Site 2340 Stab1 siRNA 3 .mu.g/eye 0.5
.mu.g/.mu.L 8 R&D Systems VEGF-carrier free 75 .mu.M 3.53
.mu.g/.mu.L 5 Inactive Site 2340 Stab1 siRNA 1 .mu.g/eye 0.167
.mu.g/.mu.L
[0709] TABLE-US-00004 TABLE IV Non-limiting examples of
Stabilization Chemistries for chemically modified siNA constructs
Chemistry pyrimidine Purine cap p = S Strand "Stab 1" Ribo Ribo --
5 at 5'-end S/AS 1 at 3'-end "Stab 2" Ribo Ribo -- All linkages
Usually AS "Stab 3" 2'-fluoro Ribo -- 4 at 5'-end Usually S 4 at
3'-end "Stab 4" 2'-fluoro Ribo 5' and 3'-ends -- Usually S "Stab 5"
2'-fluoro Ribo -- 1 at 3'-end Usually AS "Stab 6" 2'-O-Methyl Ribo
5' and 3'-ends -- Usually S "Stab 7" 2'-fluoro 2'-deoxy 5' and
3'-ends -- Usually S "Stab 8" 2'-fluoro 2'-O-Methyl -- 1 at 3'-end
S or AS "Stab 9" Ribo Ribo 5' and 3'-ends -- Usually S "Stab 10"
Ribo Ribo -- 1 at 3'-end Usually AS "Stab 11" 2'-fluoro 2'-deoxy --
1 at 3'-end Usually AS Stab 12 2'-fluoro LNA 5' and 3'-ends Usually
S "Stab 13" 2'-fluoro LNA 1 at 3'-end Usually AS "Stab 14"
2'-fluoro 2'-deoxy 2 at 5'-end Usually AS 1 at 3'-end "Stab 15"
2'-deoxy 2'-deoxy 2 at 5'-end Usually AS 1 at 3'-end "Stab 16 Ribo
2'-O-Methyl 5' and 3'-ends Usually S "Stab 17" 2'-O-Methyl
2'-O-Methyl 5' and 3'-ends Usually S "Stab 18" 2'-fluoro
2'-O-Methyl 1 at 3'-end Usually AS CAP = any terminal cap, see for
example FIG. 22. All Stab 1-18 chemistries can comprise 3'-terminal
thymidine (TT) residues All Stab 1-18 chemistries typically
comprise 21 nucleotides, but can vary as described herein. S =
sense strand AS = antisense strand
[0710] TABLE-US-00005 TABLE V Peptides for Conjugation SEQ ID
Peptide Sequence NO ANTENNAPEDI RQI KIW FQN RRM KWK K amide 507 A
Kaposi fibroblast AAV ALL PAV LLA LLA P + VQR 508 growth factor KRQ
KLMP caiman crocodylus MGL GLH LLV LAA ALQ GA 509 Ig(5) light chain
HIV envelope GAL FLG FLG AAG STM GA + PKS 510 glycoprotein KRK 5
(NLS of the SV40) gp41 HIV-1 Tat RKK RRQ RRR 511 Influenza
GLFEAIAGFIENGWEGMIDGGGYC 512 hemagglutinin envelop glycoprotein RGD
peptide X-RGD-X 513 where X is any amino acid or peptide
transportan A GWT LNS AGY LLG KIN LKA LAA 514 LAK KIL Somatostatin
(S)FC YWK TCT 515 (tyr-3-octreotate) Pre-S-peptide (S)DH QLN PAF
516 (S) optional Serine for coupling Italic = optional D isomer for
stability
[0711] TABLE-US-00006 TABLE VI Duplex half-lives in human and mouse
serum and liver extracts Stability All RNA 4*/5 4/5* 7/11* 7*/8
7/8* S/AS Sirna # 47715/ 30355/ 30355/ 30612/ 30612/ 30612/ 47933
30366 30366 31175 30620 30620 Human 0.017 408 39 54 130 94 Serum
(0.96).sup..dagger. (0.65) (0.76) (0.88) (0.86) t.sub.1/2 hours
Human 2.5 28.6 43.5 0.78/2.9.sup..dagger-dbl. 9 816 Liver (0.40)
(0.66) (0.45) (0.39) (0.99) t.sub.1/2 hours Mouse 1.17 16.7 10 2.3
16.6 35.7 Serum (0.9) (0.81) (0.46) (0.69) t.sub.1/2 hours Mouse 6
1.08 0.80 0.20 0.22 120 Liver (0.89) t.sub.1/2 hours *The asterisk
designates the strand carrying the radiolabel in the duplex.
.sup..dagger.For longer half-lives the fraction full-length at the
18 hours is presented as the parenthetic lower number in each cell.
.sup..dagger-dbl.A biphasic curve was observed, half-lives for both
phases are shown.
[0712] TABLE-US-00007 TABLE VII Single strand half-lives in human
serum Stability 4 5 7 11 8 Sirna # 30355 30366 30612 31175 30620
Human serum 22 16 13 19 28 t.sub.1/2 hours Human liver 0.92 0.40
0.43 0.27 192 t.sub.1/2 hours
[0713] TABLE-US-00008 TABLE VIII Human serum half-lives for Stab
4/5 duplex chemistry with terminus chemistries of FIG. 22 Cap 2 7 9
2 8 1 3 6 Chemistry (R.dbd.O) (R.dbd.O) (R.dbd.O) (R.dbd.S)
(R.dbd.O) (R.dbd.O) (R.dbd.O) (R.dbd.O) (B=T) (B=T) (B=T) (B=T)
(B=T) (B=T) (B=T) (B=T) Human Serum 1 1.2 2.3 39 96
(0.69).dagger-dbl. 460 (0.95) 770 (0.94) 770 (0.95) t.sub.1/2 hours
The capping structures were in the following position of the 4:5
chemistry formatted sequence: antisense strand -
5'-uuGuuGuAuuuuGuGGuuG-CAP-3' where CAP is 1, 2, 3, 6, 7, 8, or 9
from FIG. 22. (SEQ ID NO: 627) sense strand
5'-CAP-cAAccAcAAAAuAcAAcAATT-CAP-3' where CAP is 1 from FIG. 22.
(SEQ ID NO: 628) .dagger-dbl.For half-lives that extend beyond the
time course sampled the fraction full-length is presented in
parentheses.
* * * * *