U.S. patent application number 10/543556 was filed with the patent office on 2006-09-14 for custom-made meganuclease and use thereof.
Invention is credited to Sylvain Arnould, Slyvia Bruneau, Jean-Pierre Cabaniols, Patrick Chames, Andre Choulika, Philippe Duchateau, Jean-Charles Epinat, Agnes Gouble, Emmanuel Lacroix, Frederic Pagues, Christophe Perez-Michaut, Julianne Smith.
Application Number | 20060206949 10/543556 |
Document ID | / |
Family ID | 32829807 |
Filed Date | 2006-09-14 |
United States Patent
Application |
20060206949 |
Kind Code |
A1 |
Arnould; Sylvain ; et
al. |
September 14, 2006 |
Custom-made meganuclease and use thereof
Abstract
New rare-cutting endonucleases, also called custom-made
meganucleases, which recognize and cleave a specific nucleotide
sequence, derived polynucleotide sequences, recombinant vector
cell, animal, or plant comprising said polynucleotide sequences,
process for producing said rare-cutting endonucleases and any use
thereof, more particularly, for genetic engineering, antiviral
therapy and gene therapy.
Inventors: |
Arnould; Sylvain; (PARIS,
FR) ; Bruneau; Slyvia; (Paris, FR) ;
Cabaniols; Jean-Pierre; (Saint Leu La Foret, FR) ;
Chames; Patrick; (Paris, FR) ; Choulika; Andre;
(Paris, FR) ; Duchateau; Philippe; (Cemy, FR)
; Epinat; Jean-Charles; (Paris, FR) ; Gouble;
Agnes; (Paris, FR) ; Lacroix; Emmanuel;
(Paris, FR) ; Pagues; Frederic; (Bourg La Reine,
FR) ; Smith; Julianne; (Paris, FR) ;
Perez-Michaut; Christophe; (Paris, FR) |
Correspondence
Address: |
NIXON & VANDERHYE, PC
901 NORTH GLEBE ROAD, 11TH FLOOR
ARLINGTON
VA
22203
US
|
Family ID: |
32829807 |
Appl. No.: |
10/543556 |
Filed: |
January 28, 2004 |
PCT Filed: |
January 28, 2004 |
PCT NO: |
PCT/IB04/00827 |
371 Date: |
March 14, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60442911 |
Jan 28, 2003 |
|
|
|
60491535 |
Aug 1, 2003 |
|
|
|
Current U.S.
Class: |
800/14 ; 435/199;
435/325; 435/419; 435/6.13; 800/284 |
Current CPC
Class: |
C12N 2830/55 20130101;
C12N 9/22 20130101; A61K 38/465 20130101; C12N 2840/44 20130101;
A61P 31/00 20180101; C12N 15/86 20130101; C12Y 301/00 20130101;
A61P 35/00 20180101; A61P 43/00 20180101; C12N 2730/10143 20130101;
C12N 15/1058 20130101; C12N 15/90 20130101; C12N 2840/20 20130101;
A01K 67/0275 20130101; A61K 38/1709 20130101; C12N 7/00 20130101;
C12Y 301/21004 20130101; A61K 48/0058 20130101; C07K 2319/81
20130101; A01K 2217/00 20130101; A61K 38/00 20130101; A01K 2267/03
20130101; A61P 31/12 20180101; A61P 35/02 20180101; A01K 2217/05
20130101; A01K 2227/105 20130101; C12N 2799/022 20130101; C12N
2800/80 20130101; A61P 31/20 20180101; C12N 2830/002 20130101; A61P
31/18 20180101; A61K 48/00 20130101; A01K 2207/15 20130101; C07K
14/435 20130101; C12N 15/8509 20130101; C12N 15/907 20130101; A01K
67/0278 20130101; A01K 2267/0337 20130101 |
Class at
Publication: |
800/014 ;
800/284; 435/006; 435/199; 435/325; 435/419 |
International
Class: |
A01K 67/027 20060101
A01K067/027; C12N 9/22 20060101 C12N009/22; A01H 1/00 20060101
A01H001/00; C12N 15/82 20060101 C12N015/82; C40B 40/02 20060101
C40B040/02; C40B 40/08 20060101 C40B040/08 |
Claims
1-40. (canceled)
41. A method for producing a meganuclease variant derived from an
initial meganuclease, said meganuclease variant being able to
cleave a DNA target sequence which is different from the
recognition and cleavage site of the initial meganuclease,
characterized in that it comprises the following steps: a)
preparing a library of meganuclease variants from an initial
meganuclease and, b) selecting and/or screening the variants able
to cleave said DNA target sequence, in vivo, under conditions where
the double-strand break in the DNA target sequence which is
generated by said variant leads to the activation of a positive
selection marker or a reporter gene, or the inactivation of a
negative selection marker or a reporter gene, by
recombination-mediated repair of said DNA double-strand break.
42. The method according to claim 41, characterized in that step b)
comprises the use of a cell modified by at least an expression
vector comprising said DNA target sequence and the coding sequence
for a negative selection marker in an active form, a positive
selection marker in an inactive form, or a reporter gene in an
active or inactive form.
43. The method according to claim 42, characterized in that said
cell is modified by an expression vector comprising a modified
positive selection marker or reporter gene, said selection marker
or reporter gene comprising an internal duplication separated by an
intervening sequence including the target DNA sequence, and
eventually an additional selection marker.
44. The method according to claim 42, characterized in that said
cell is modified by an expression vector comprising a first
modified positive selection marker or reporter gene, said selection
marker or reporter gene comprising a mutation or a deletion and an
insertion of the target DNA at the place of the deletion or in the
vicinity of the mutation, said cell being further modified by the
segment of the positive selection marker or reporter gene which has
been deleted or mutated, flanked at each side by the positive
selection marker or reporter gene sequences bordering the
deletion/insertion.
45. The method according to claim 41, characterized in that the
double-strand break in the DNA target sequence is repaired by
homologous recombination between two direct repeats.
46. The method according to claim 41, characterized in that the
double-strand break in the DNA target sequence is repaired by gene
conversion.
47. The method according to claim 42, characterized in that the
coding sequence and the DNA target sequence are on a plasmid.
48. The method according to claim 42, characterized in that the
coding sequence and the DNA target sequence are integrated in the
chromosome of said cell.
49. The method according to claim 41, characterized in that said
positive selection marker is an antibiotic resistance or an
auxotrophy marker.
50. The method according to claim 42, characterized in that said
cell is a yeast cell.
51. The method according to claim 42, characterized in that said
cell is a mammalian cell.
52. The method according to claim 41, characterized in that it
consists in step a) and a step b) which is a selection step for the
cleavage activity.
53. The method according to claim 41, characterized in that it
consists in step a) and a step b) which is a screening step for the
cleavage activity.
54. The method according to claim 41, characterized in that it
consists in step a) and step b) which is a combination of a
selection step for the cleavage activity and a screening step for
the cleavage activity.
55. The method according to claim 41, characterized in that it
consists in step a) and a step b) which is included in a
combination of selection and screening steps selected from the
group consisting of: a selection step for the binding ability, a
screening step for the binding ability, a selection step for the
cleavage activity, and a screening step for the cleavage activity;
a selection step for the binding ability, a screening step for the
binding ability, and a screening step for the cleavage activity; a
selection step for the binding ability, a selection step for the
cleavage activity, and a screening step for the cleavage activity;
or, a screening step for the binding ability and a screening step
for the cleavage activity.
56. The method according to claim 55, characterized in that said
selection and screening steps for the binding ability use the phage
display.
57. The method according to claim 52, characterized in that said
selection for the cleavage activity uses a test in which the
cleavage leads to the activation of a positive selection
marker.
58. The method according to claim 53, characterized in that and
said screening for the cleavage activity uses a test in which the
cleavage leads to the activation of a reporter gene.
59. The method according to claim 41, characterized in that said
meganuclease variants have amino acid variations at positions
contacting the DNA target or interacting directly or indirectly
with said DNA target.
60. The method according to claim 59, characterized in that said
amino acid variations are replacement of the initial amino acid
with an amino acid selected from the group consisting of: D, E, H,
K, N, Q, R, S, T, Y.
61. The method according to claim 41 characterized in that said
initial meganuclease is a natural or a modified meganuclease.
62. The method according to claim 61 characterized in that said
initial meganuclease is a homing endonuclease.
63. The method according to claim 62 characterized in that said
homing endonuclease is a LAGLIDADG homing endonuclease.
64. The method according to claim 63, characterized in that said
LAGLIDADG homing endonuclease is selected from the group consisting
of: I-Cre I, I-Dmo I, PI-Sce I, and PI-Pfu I.
65. The method according to claim 64, characterized in that said
LAGLIDADG homing endonuclease is I-Cre I.
66. The method according to claim 61, characterized in that said
initial meganuclease is a hybrid meganuclease.
67. The method according to claim 66, characterized in that said
hybrid meganuclease is the hybrid homing endonuclease I-Dmo I/I Cre
I.
68. The method according to claim 65, characterized in that I-Cre I
variants are prepared by introducing amino acid diversity in
positions selected from the group consisting of: Q26, K28, N30,
S32, Y33, Q38, Q44, R68, R70 and T140.
69. The method according to claim 68, characterized in that said
I-Cre I variants are prepared by introducing amino acid diversity
in positions: a) Q26, K28, N30, Y33, Q38, Q44, R68, R70, T140; b)
Q26, K28, N30, Y33, Q38, Q44, R68, R70; c) Q26, K28, N30, Y33, Q44,
R68, R70; or d) Q26, K28, Y33, Q38, Q44, R68, R70.
70. The method according to claim 69, characterized in that said
I-Cre I variants are prepared by introducing amino acid diversity
in positions: Q26, K28, N30, Y33, Q38, Q44, R68 and R70.
71. The method according to claim 65, characterized in that the
I-Cre I or I-Dmo I/I Cre I variants further comprise the mutation
of the aspartic acid in position 75 of I-Cre I, in an uncharged
amino acid.
72. The method according to claim 71, characterized in that said
uncharged amino acid is an asparagine residue.
Description
[0001] The present invention relates to new rare-cutting
endonucleases, also called custom-made meganucleases, which
recognize and cleave a specific nucleotide sequence, to
polynucleotide sequences encoding for said new rare-cutting
endonucleases, to a vector comprising one of said polynucleotide
sequences, to a cell, an animal, or a plant comprising one of said
polynucleotide sequences or said rare-cutting endonucleases, to a
process for producing one of said rare-cutting endonucleases and
any use of the disclosed products and methods. More particularly,
this invention contemplates any use such rare-cutting endonuclease
for genetic engineering, antiviral therapy, genome therapy and gene
therapy.
[0002] Homing endonucleases constitute a family of very
rare-cutting endonucleases. It was first characterised at beginning
of the Nineties by the use (in vivo) of the protein I-Sce I (Omega
nuclease encoded by a mitochondrial group I intron of the yeast
Saccharomyces cerevisiae). Homing endonucleases encoded by introns
ORF, independent genes or intervening sequences (inteins) present
striking structural and functional properties that distinguish them
from "classical" restriction enzymes (generally from bacterial
system R/MII). They have recognition sequences that span 12-40 bp
of DNA, whereas "classical" restriction enzymes recognise much
shorter stretches of DNA, in the 3-8 bp range (up to 12 bp for
rare-cutter). Therefore, the homing endonucleases present a very
low frequency of cleavage, even in the human genome.
[0003] Furthermore, general asymmetry of homing endonuclease target
sequences contrasts with the characteristic dyad symmetry of most
restriction enzyme recognition sites. Several homing endonucleases
encoded by introns ORF or inteins have been shown to promote the
homing of their respective genetic elements into allelic intronless
or inteinless sites. By making a site-specific double-strand break
in the intronless or inteinless alleles, these nucleases create
recombinogenic ends, which engage in a gene conversion process that
duplicates the coding sequence and leads to the insertion of an
intron or an intervening sequence at the DNA level.
[0004] Homing endonucleases fall into 4 separated families on the
basis of pretty well conserved amino acids motifs. For review, see
Chevalier and Stoddard (2001, Nucleic Acids Research, 29,
3757-3774). One of them is the dodecapeptide family (dodecamer,
DOD, D1-D2, LAGLI-DADG, P1-P2). This is the largest family of
proteins clustered by their most general conserved sequence motif:
one or two copies (vast majority) of a twelve-residue sequence: the
di-dodecapeptide. Homing endonucleases with one dodecapetide (D)
are around 20 kDa in molecular mass and act as homodimer. Those
with two copies (DD) range from 25 kDa (230 AA) to 50 kDa (HO, 545
AA) with 70 to 150 residues between each motif and act as monomer.
Cleavage is inside the recognition site, leaving 4 nt staggered cut
with 3'OH overhangs. I-Ceu I and I-Cre I illustrate the homing
endonucleases with one Dodecapeptide (mono dodecapeptide). I-Dmo I,
I-Sce I, PI-Pfu I and PI-Sce I illustrate homing endonucleases with
two Dodecapeptide motifs. Structural models using X-ray
crystallography have been generated for I-Cre I, I-Dmo I, PI-Sce I,
PI-Pfu I. structures of I-Cre I bound to its DNA site have also
been elucidated leading to a number of predictions about specific
protein-DNA contacts. Seligman et al (Nucleic Acids Research, 2002,
30, 3870-3879) tests these predictions by analysing a set of
endonuclease mutants and a complementary set of homing site
mutants. In parallel, Gruen et al (Nucleic Acids Research, 2002,
30, e29) developed an in vivo selection system to identify DNA
target site variants that are stik4 by wild-type homing
endonucleases.
[0005] Endonucleases are requisite enzymes for today's advanced
genetic engineering techniques, notably for cloning and analyzing
genes. Homing endonucleases are very interesting as rare-cutter
endonucleases because they have a very low recognition and cleavage
frequency in large genome due to the size of their recognition
site. Therefore, the homing endonucleases are used for molecular
biology and for genetic engineering.
[0006] More particularly, homologous recombination provides a
method for genetically modifying chromosomal DNA sequences in a
precise way. In addition to the possibility of introducing small
precise mutations in order to alter the activity of the chromosomal
DNA sequences, such a methodology makes it possible to correct the
genetic defects in genes which cause disease. Unfortunately,
current methods for achieving homologous recombination are
inherently inefficient, in that homologous recombination-mediated
gene repair can usually be achieved in only a small proportion of
cells that have taken up the relevant "targeting or correcting`
DNA. For example, in cultured mammalian cells, such recombinational
events usually occur in only one in ten thousand transfected
cells.
[0007] It has been shown that induction of double stranded DNA
cleavage at a specific site in chromosomal DMA induces a cellular
repair mechanism which leads to highly efficient recombinational
events at that locus. Therefore, the introduction of the double
strand break is accompanied by the introduction of a targeting
segment of DNA homologous to the region surrounding the cleavage
site, which results in the efficient introduction of the targeting
sequences into the locus (either to repair a genetic lesion or to
alter the chromosomal DNA in some specific way). Alternatively the
induction of a double stranded break at a site of interest is
employed to obtain correction of a genetic lesion via a gene
conversion event in which the homologous chromosomal DNA sequences
from an other copy of the gene donates sequences to the sequences
where the double stranded break was induced. This latter strategy
leads to the correction of genetic diseases either in which one
copy of a defective gene causes the disease phenotype (such as
occurs in the case of dominant mutations) or in which mutations
occur in both alleles of the gene, but at different locations (as
is the case of compound heterozygous mutations). (See WO 96/14408;
WO 00/46386; U.S. Pat. No. 5,830,729; Choulika et al., Mol Cell
Biol, 1995, 15, 1965-73; Cohen-Tannoudji et al., Mol Cell Biol, 15
1998, 18, 1444-8; Donoho et al, Mol Cell Biol; Rouet et al, Mol
Cell Biol, 1994, 14, 5096-106; the disclosure of which is
incorporated herein by reference).
[0008] Unfortunately, this method of genome engineering by
induction of homologous recombination by a double stranded break is
limited by the introduction of a recognition and cleavage site of a
natural meganuclease at the position where the recombinational
event is desired.
[0009] Up today, in a first approach for generating new
endonuclease, some chimeric restriction enzymes have been prepared
through hybrids between a zinc finger DNA binding domain and the
non-specific DNA-cleavage domain from the natural restriction
enzyme Fok I (Smith et al., 2000, Nucleic Acids Res, 28, 3361-9;
Smith et al., 1999, Nucleic Acids Res., 27, 274-281v; Kim et al,
1996, Proc Natl Acad Sci USA, 93, 1156-60; Kim &
Chandrasegaran, 1994, Proc Natl Acad Sci USA, 91, 883-7; WO
95/109233; W0/9418313).
[0010] Another approach consisted of embedding DNA binding and
catalytic activities within a single structural unit, such as type
II restriction endonuclease. However, efforts to increase the
length of recognition sequence or alter the specificity of these
enzymes have resulted in the loss of catalytic activity or overall
diminution of specificity due to the tight interdependence of
enzyme structure, substrate recognition and catalysis (Lanio et al,
2000, Protein Eng., 13, 275-281).
[0011] Based on homing endonuclease, Chevalier et al. (2002,
Molecular Cell, 10, 895-905) have generated an artificial highly
specific endonuclease by fusing domains of homing endonucleases
I-Dmo I and I-Cre I. The resulting enzyme binds a long chimeric DNA
target site and cleaves it precisely at a rate equivalent to its
natural parents.
[0012] However, this experiment leads to one endonuclease with a
new specificity but it is not applicable to find an endonuclease
that recognizes and cleaves any desired polynucleotide
sequence.
[0013] Although these efforts, there is still a strong need of new
rare-cutting endonucleases with new sequence specificity for the
recognition and cleavage.
[0014] The present invention concerns a method for producing a
custom-made meganuclease able to cleave a targeted DNA sequence
derived from an initial meganuclease. This method comprises the
steps of preparing a library of meganuclease variants and selecting
the variants able to cleave the targeted DNA sequence.
[0015] In a first embodiment of the method for producing a
custom-made meganuclease, the initial meganuclease is a natural
meganuclease. Alternatively, said initial meganuclease is not a
natural one. Preferably, said initial meganuclease is a homing
endonuclease, more preferably a LAGLIDADG homing endonuclease. In a
more preferred embodiment, said LAGLIDADG homing endonuclease is
I-Cre I.
[0016] In a second embodiment of the method for producing a
custom-made meganuclease, the library of meganuclease variants is
generated by targeted mutagenesis, by random mutagenesis, by DNA
shuffling, by directed mutation or by a combination thereof
Preferably, said library is generated by targeted mutagenesis. Said
targeted mutagenesis is performed in meganuclease segments
interacting with the DNA target, and more preferably introduced at
the positions of the interacting amino acids. Optionally, the amino
acids present at the variable positions comprise or are selected
from the group consisting of D, E, H, K, N, Q, R, S, T, Y.
[0017] In a particular embodiment of the present invention, a
library of I-Cre I variants is prepared by introducing amino acid
diversity in positions selected from the group consisting of: Q26,
K28, N30, S32, Y33, Q38, Q44, R68, R70 and T140. Preferably, a
library of I-Cre I variants is prepared by introducing diversity in
positions: a) Q26, K28, N30, Y33, Q38, Q44, R68, R70, T140; b) Q26,
K28, N30, Y33, Q38, Q44, R68, R70; c) Q26, K28, N30, Y33, Q44, R68,
R70; or d) Q26, K28, Y33, Q38, Q44, R68, R70. More preferably, a
library of I-Cre I variants is prepared by introducing diversity in
positions Q26, K28, N30, Y33, Q38, Q44, R68, and R70.
[0018] In a third embodiment of the method for producing a
custom-made meganuclease, said selection of the variants able to
cleave the targeted DNA sequence or a part thereof comprises the
following steps:
[0019] a) a selection step for the binding ability, a screening
step for the binding ability, a selection for the cleavage
activity, and a screening step for the cleavage activity;
[0020] b) a selection step for the binding ability, a screening
step for the binding ability, and a screening step for the cleavage
activity;
[0021] c) a selection step for the binding ability, a selection for
the cleavage activity, and a screening step for the cleavage
activity; or,
[0022] d) a screening step for the binding apathy and a screening
step for the cleavage.
[0023] Preferably, said selection of the variants able to cleave
the targeted DNA sequence or a part thereof comprises a selection
step for the binding ability, a selection for the cleavage
activity, and a screening step for the cleavage activity
Optionally, a screening assay for the binding ability after a
selection step based on the binding capacity can be done in order
to estimate the enrichment of the library for meganuclease variants
presenting a binding capacity.
[0024] Preferably, the selection and the screening based on the
binding ability use the phage display technology. Preferably, the
selection based on the cleavage activity uses a test in which the
cleavage leads to either the activation of a positive selection
marker or the inactivation of a negative selection marker.
Preferably, the screening based on the cleavage activity uses a
test in which the cleavage leads to a) the activation of a positive
selection marker or a reporter gene; or b) the inactivation of a
negative selection marker or a reporter gene.
[0025] Therefore, one object of the present invention is
custom-made meganuclease produced by the above-mentioned method, a
polynucleotide encoding said custom made meganuclease and any use
thereof. Furthermore, the invention concerns a cell, an animal or a
plant comprising said custom-made meganuclease or a polynucleotide
encoding said custom-made meganuclease.
[0026] The invention concerns the use of a custom-made meganuclease
for molecular biology, for in vivo or in vitro genetic engineering
for in vivo or in vitro genome engineering for antiviral therapy,
for genome therapy or for gene therapy.
[0027] More particularly, the invention concerns the use of a
custom-made meganuclease for introducing a double-stranded break in
a site of interest comprising the recognition and cleavage site of
said meganuclease, thereby inducing a DNA recombination event,
preferably a homologous recombination event, a DNA loss or cell
death.
[0028] In a first embodiment of a method of genetic engineering, a
custom-made meganuclease introduces a double-stranded break in a
site of interest located on a vector and comprising the recognition
and cleavage site of said meganuclease, thereby inducing a
homologous recombination with another vector presenting homology
with the sequence surrounding the cleavage site.
[0029] In a second embodiment of a method of genome engineering,
the method comprises the following steps: 1) introducing a
double-stranded break at the genomic locus comprising at least one
recognition and cleavage site of a custom-made meganuclease
according to the present invention; 2) providing a targeting DNA
construct comprising the sequence to be introduced flanked by
sequences sharing homologies to the targeted locus.
[0030] In a third embodiment of a method of genome engineering, the
method comprises the following steps: 1) introducing a
double-stranded break at the genomic locus comprising at least one
recognition and cleavage site of a custom-made meganuclease
according to the present invention; 2) maintaining under conditions
appropriate for homologous recombination with chromosomal DNA
sharing homologies to regions surrounding the cleavage site.
[0031] These methods of genetic and genome engineering could be
used for repairing a specific sequence, modifying a specific
sequence, for attenuating or activating an endogenous gene of
interest, for introducing a mutation into a site of interest, for
introducing an exogenous gene, for inactivating or deleting an
endogenous gene or a part thereof, for translocating a chromosomal
arm, or for killing the cell. The invention relates to the
resulting cells and their uses.
[0032] Therefore, the invention concerns the use of at least one
custom-made meganuclease according to the present invention to
repair a specific sequence, to restore a functional gene in place
of a mutated one, to modify a specific sequence, to attenuate or
activate an endogenous gene of interest, to introduce a mutation
into a site of interest, to introduce an exogenous gene or a part
thereof, and to inactivate or delete an endogenous gene or part
thereof, to translocate a chromosomal arm, or to leave the DNA
unrepaired and degraded, by exposing cells, animals, or plants to
said meganuclease. Optionally, said cells, animals, or plants are
further exposed to a targeting DNA construct comprising the
sequence to be introduced flanked by sequences sharing homologies
to the targeted locus.
[0033] The invention also concerns a composition comprising at
least one custom made meganuclease according to the present
invention. Said composition is used for repairing a specific
sequence, modifying a specific sequence for attenuating or
activating an endogenous gene of interest, for introducing a
mutation into a site of interest, for introducing an exogenous gene
or a part thereof, for inactivating or deleting an endogenous gene
or a part thereof, to translocate a chromosomal arm, or to leave
the DNA unrepaired and by exposing cells, animals, or plants to
said meganuclease. Optionally, said composition can further
comprise a targeting DNA construct comprising the sequence to be
introduced flanked by sequences sharing homologies to the targeted
locus.
[0034] The invention also relates to a method for treating or
prophylaxis of a genetic disease in an individual in need thereof
comprising (a) inducing in cells of the individual a double
stranded cleavage at a site of interest comprising at least one
recognition and cleavage site of a custom-made meganuclease
according to the present invention, and introducing into the
individual a targeting DNA, wherein said targeting DNA comprises
(1) DNA sharing homologies to the region surrounding the cleavage
site and (2) DNA which will be used to repair the site of interest
in the chromosomal DNA.
[0035] In a second embodiment, the method for treating or
prophylaxis of a genetic disease in an individual in need thereof
comprises inducing in cells of the individual a double stranded
break at a site of interest comprising at least one recognition and
cleavage site of a custom-made meganuclease according to the
present invention under conditions appropriate for the DNA
homologous to the region surrounding the site of cleavage to be
used in order to repair the site of interest.
[0036] The present invention further relates to the resulting cells
and their uses, such as for treatment or prophylaxis of a disease
or disorder in an individual.
[0037] The present invention concerns the use of at least one
custom-made meganuclease according to the present invention to
prevent, ameliorate or cure a genetic disease by exposing cells,
animals or patients to said meganuclease. Optionally, said cells,
animals or patients are also exposed to a targeting DNA construct
comprising the sequence which repairs the site of interest flanked
by sequences sharing homologies to the targeted locus.
[0038] The invention concerns a composition comprising at least one
custom-made meganuclease according to the present invention.
Preferably said composition is used for preventing, ameliorating or
curing a genetic disease by exposing cells, plants, animals or
patients to said composition. Optionally, said composition can
further comprise the targeting DNA construct comprising the
sequence which repairs the site of interest flanked by sequences
sharing homologies to the targeted locus.
[0039] The custom meganucleases according to the present invention
can also be used as therapeutics in the treatment of diseases
caused by infectious agents that present a DNA intermediate. It is
therefore an object of the present invention to use at least one
custom-made meganuclease according to the present invention to
prevent, ameliorate or cure infection by an infectious agent by
exposing said infectious agent and/or infected cells, animals,
plants or patients to said meganuclease, the DNA target sequence of
which being present in genome of said infectious agent. Preferably,
said infectious agent is a virus.
[0040] Another object of the present invention is to use at least
one meganuclease according to the present invention for
inactivating or deleting an infectious agent in biologically
derived products and products intended for biological uses by
treating the products with said meganucleases. Preferably, said
infectious agent is a virus.
[0041] A further object of the invention is a composition
comprising at least one custom-made meganuclease according to the
present invention for preventing, ameliorating or curing an
infection by an infectious agent by exposing the infectious agent
or the infected cells, animals or patients to said composition.
Preferably, said infectious agent is a virus.
[0042] An additional object of the invention is to provide
compositions comprising at least one meganuclease according to the
present invention for inhibiting propagation of an infectious
agent, inactivating or deleting an infectious agent in biologically
derived products or products intended for biological use, or for
disinfecting an object. Preferably, said infectious agent is a
virus.
[0043] The invention also relates to a method for treating or
prophylaxis of an infection by an infectious agent in an individual
in need thereof comprising (a) introducing into individual's cells
of the individual at least one custom-made meganuclease presenting
a recognition and cleavage site in the infectious agent sequence,
and (b) inducing a double-strand break at said recognition and
cleavage site, thereby leading to a recombination event resulting
in inactivation or deletion of the infectious agent.
DEFINITIONS
[0044] In the present application, by "meganuclease" is intended a
double-stranded endonuclease having a polynucleotide recognition
site of 14-40 bp. Said meganuclease is either monomeric or dimeric.
Therefore, the meganuclease are also called rare-cutting or very
rare cutting endonuclease. The homing endonucleases are one type of
meganucleases.
[0045] By "custom-made meganuclease" is intended a meganuclease
derived from an initial meganuclease presenting a recognition and
cleavage site different from the site of the initial one. By
"different" is intended that the custom-made meganuclease cleaves
the site with an efficacity at least 10 fold more than the natural
meganuclease, preferably at least 50 fold, more preferably at least
100 fold. The initial meganuclease can be a natural meganuclease or
a modified one. By "natural" refers to the fact that an object can
be found in nature. For example, a meganuclease that is present in
an organism, that can be isolated from a source in nature and which
has not been intentionally modified by man in the laboratory is
natural.
[0046] "Identity" refers to sequence identity between two nucleic
acid molecules or polypeptides. Identity can be determined by
comparing a position in each sequence which may be aligned for
purposes of comparison. When a position in the compared sequence is
occupied by the same base, then the molecules are identical at that
position. A degree of similarity or identity between nucleic acid
or amino acid sequences is a function of the number of identical or
matching nucleotides at positions shared by the nucleic acid
sequences. Various alignment algorithms and/or programs may be used
to calculate the identity between two sequences, including FASTA,
or BLAST which are available as a part of the GCG sequence analysis
package (University of Wisconsin, Madison, Wis.), and can be used
with, e.g., default settings.
[0047] By "homologous" is intended a sequence with enough identity
to another one to lead to a homologous recombination between
sequences, more particularly having at least 95% identity,
preferably 97%, and more preferably 99%.
[0048] The term "vector" refers to a nucleic acid molecule capable
of transporting another nucleic acid to which it has been linked.
One type of preferred vector is an episome, i.e., a nucleic acid
capable of extra-chromosomal replication. Preferred vectors are
those capable of autonomous replication and/or expression of
nucleic acids to which they are linked. Vectors capable of
directing the expression of genes to which they are operatively
linked are referred to herein as "expression vectors A vector
according to the present invention comprises, but is not limited
to, a YAC (yeast artificial chromosome), a BAC (bacterial
artificial), a baculovirus vector, a phage, a phagemid, a cosmid, a
viral vector, a plasmid, a RNA vector or a linear or circular DNA
or RNA molecule which may consist of chromosomal, non chromosomal,
semi-synthetic or synthetic DNA. In general, expression vectors of
utility in recombinant DNA techniques are often in the form of
"plasmids" which refer generally to circular double stranded DNA
loops which, in their vector form are not bound to the chromosome.
Large numbers of suitable vectors are known to those of skill in
the art and commercially available, such as the following bacterial
vectors: pQE7O, pQE6O, pQE-9 (Qiagen), pbs, pDIO, phagescript,
psiXl74. pbluescript SK, pbsks, pNH8A, pNH16A, pNH18A, pNH46A
(Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRlT5
(Pharmacia); pWLNEO, pSV2CAT, pOG44, pXTI, pSG (Stratagene); pSVK3,
pBPV, pMSG, pSVL (Pharmacia); pQE-30 (QlAexpress), pET
(Novagen).
[0049] Viral vectors include retrovirus, adenovirus, parvovirus
(e.g., adenoassociated viruses), coronavirus, negative strand RNA
viruses such as ortho-myxovirus (e.g., influenza virus),
rhabdovirus (e.g., rabies and vesicular stomatitis virus),
paramyxovirus (e.g. measles and Sendai), positive strand RNA
viruses such as picornavirus and alphavirus, and double stranded
DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex
virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and
poxvirus (e.g., vaccinia, fowlpox and canarypox). Other viruses
include Norwalk virus, togavirus, flavivirus, reoviruses,
papovavirus, hepadnavirus, and hepatitis virus, for example.
Examples of retroviruses include: avian leukosis-sarcoma, mammalian
C-type, B-type viruses, Dtype viruses, HTLV-BLV group, lenti-virus,
spumavirus (Coffin, J. M., Retroviridae: The viruses and their
replication, In Fundamental Virology, Third Edition, B. N. Fields,
et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996).
Other examples include murine leukemia viruses, murine sarcoma
viruses, mouse mammary tumor virus, bovine leukemia virus, feline
leukemia virus, feline sarcoma virus, avian leukemia virus, human
T-cell leukemia virus, baboon endogenous virus, Gibbon ape leukemia
virus, Mason Pfizer monkey virus, simian immunodeficiency virus,
simian sarcoma virus, Rous sarcoma virus and lentiviruses. Other
examples of vectors are described, for example, in McVey et al.,
U.S. Pat. No. 5,801,030, the teachings of which are incorporated
herein by reference.
[0050] Vectors can comprise selectable markers (for example,
neomycin phosphotransferase, histidinol dehydrogenase,
dihydrofolate reductase, hygromycin phosphotransferase, herpes
simplex virus thymidine kinase, adenosine deaminase, glutamine
synthetase, and hypoxanthine-guanine phosphoribosyl transferase for
eukaryotic cell culture; TRP1 for S. cerevisiae; tetracycline,
rifampicin or ampicillin resistance in E. coli; etc. . . . ).
However, the invention is intended to include such other forms of
expression vectors which serve equivalent functions and which
become and which become known in the art subsequently hereto.
[0051] The phrases "site of interest", "target site" and "specific
site", as used herein, refer to a distinct DNA location, preferably
a chromosomal location, at which a double stranded break (cleavage)
is to be induced by the meganuclease.
[0052] As used herein, the term "individual" includes mammals, as
well as other vertebrates (e.g., birds, fish and reptiles). The
terms "mammal" and "mammalian", as used herein, refer to any
vertebrate animal, including monotremes, marsupials and placental,
that suckle their young and either give birth to living young
(eutharian or placental mammals) or are egg-laying (metatharian or
nonplacental mammals). Examples of mammalian species include humans
and other primates (e.g., monkeys, chimpanzees), rodents (e.g.,
rats, mice, guinea pigs) and ruminants (e.g., cows, pigs,
horses).
[0053] By "zenetic disease" is intended any disease, partially or
completely, directly or indirectly, due to an abnormality in one or
several genes. Said abnormality can be a mutation, an insertion or
a deletion. Said mutation can be a punctual mutation. Said
abnormality can affect the coding sequence of the gene or its
regulatory sequence. Said abnormality can affect the structure of
the genomic sequence or the structure or stability of the encoded
mRNA. Said genetic disease can be recessive or dominant. Such
genetic disease could be, but are not limited to, cystic fibrosis,
Huntington's chorea, familial hyperchoiesterolemia (LDL receptor
defect), hepatoblastoma, Wilson's disease, congenital hepatic
porphyrias, inherited disorders of hepatic metabolism, Lesch Nyhan
syndrome, sickle cell anemia, thalassaemias, xeroderma pigmentosum,
Fanconi's anemia, retinitis pigmentosa, ataxia telangiectasia,
Bloom's syndrome, retinoblastoma, Duchenne's muscular dystrophy,
and Tay-Sachs disease.
[0054] --Generation of Meganuclease Variants
[0055] The present invention concerns a method to produce a
custom-made meganuclease specific to a targeted DNA sequence
derived from an initial meganuclease by the introduction of
diversity. Optionally, said initial meganuclease is a natural
meganuclease. This method comprises the steps of preparing a
library of meganuclease variants and isolating, by selection and/or
screening, the variants able to bind andl/or cleave the targeted
DNA sequence or a part thereof.
[0056] The diversity could be introduced in the meganuclease by any
method available for the man skilled in the art. Preferably, the
diversity is introduced by targeted mutagenesis (i.e. cassette
mutagenesis, oligonucleotide directed codon mutagenesis, targeted
random mutagenesis), by random mutagenesis (i.e. mutator strains,
Neurospora crassa system (U.S. Pat. No. 6,232,112; WO01/70946,
error-prone PCR), by DNA shuffling, by directed mutation or a
combination of these technologies (See Current Protocols in
Molecular Biology, Chapter 8 "Mutagenesis in cloned DNA", Eds
Ausubel et al., John Wiley and Sons). The meganuclease variants are
preferably prepared by the targeted mutagenesis of the initial
meganuclease. The diversity is introduced at positions of the
residues contacting or interacting directly or indirectly with the
DNA target. The diversity is preferably introduced in regions
interacting with the DNA target, and more preferably introduced at
the positions of the interacting amino acids. In libraries
generated by targeted mutagenesis, the 20 amino acids can be
introduced at the chosen variable positions. Preferably, the amino
acids present at the variable positions are the amino acids
well-known to be generally involved in protein-DNA interaction.
More particularly, these amino acids are generally the hydrophilic
amino acids. More preferably, the amino acids present at the
variable positions comprise D, E, H, K, N, Q, R, S, T, Y.
Optionally, the amino acids present at the variable positions are
selected from the group consisting of D, E, H, K, N, Q, R, S, T, Y.
Synthetic or modified amino acids are also contemplated in the
present invention.
[0057] One preferred way to generate a directed library is the use
of degenerated codons at the positions where diversity has to be
introduced. Several types of degenerated codons could be used. A
degenerated codon N N K ([ATCG] [ATCG] [TG]) leads to 32 different
codons encoding the 20 amino acids and one stop. A degenerated
codon N V K ([ATCG] [ACG] [TG]) leads to 24 different codons
encoding the 15 amino acids and one stop. A degenerated codon V V K
([ACG] [ACG] [TG]) leads to 18 different codons encoding the 12
amino acids (A, D, E, G, H, K, N, P, Q, R, S, T) and no stop. A
degenerated codon R V K ([AG] [ACG] [TG]) leads to 12 different
codons encoding the 9 amino acids (A, D, E, G, K, N, R, S, T).
Preferably, a degenerated codon V V K ([ACG] [ACG] [TG]) leading to
18 different codons encoding the 12 amino acids (A, D, E, G, H, K,
N, P, Q, R, S, T) is used for generating the library. Indeed, the V
V K degenerated codon does not contain any stop codon and comprises
all the hydrophilic amino acids.
[0058] If a directed library is generated, knowledge on amino acids
inter-acting with the DNA target is useful. This knowledge could be
provided, for example, by X-ray cristallography, Alanine scanning,
or cross-linking experiments. The amino acids interacting with the
DNA target can also be deduced by sequence alignment with a
homologous protein.
[0059] The custom-made meganuclease is derived from any initial
meganuclease. By initial meganuclease is intended a natural one or
a modified one. Said modified one can be derived from natural ones
by the hybrid generation or by a modification of physico-chemical
properties of a natural one. Optionally, the initial meganuclease
is selected so as its natural recognition and cleavage site is the
closest to the targeted DNA site. Preferably, the initial
meganuclease is a homing endonuclease, as specified, in the here
above definitions. Homing endonucleases fall into 4 separated
families on the basis of well conserved amino acids motifs, namely
the LAGLIDADG family, the GIY-YIG family, the His-Cys box family,
and the HNH family (Chevalier et al., 2001, N.A.R, 29,
3757-3774).
[0060] The detailed three-dimensional structures of several homing
endonucleases are known, namely I-Dmo I, PI-Sce I, PI-Pfu I, I-Cre
I, I-Ppo I, and a hybrid homing endonuclease I-Dmo I/I-Cre I called
E-Dre I (Chevalier et al., 2001, Nat Struct Biol, 8, 312-316; Duan
et al., 1997, Cell, 89, 555-564; Heath et al., 1997, Nat Struct
Biol, 4, 468-476; Hu et al., 2000, J Biol Chem, 275, 2705-2712;
Ichiyanagi et al., 2000, J Mol Biol, 300, 889-901; Jurica et al.,
1998, Mol Cell, 2, 469-476; Poland et al., 2000, J Biol Chem, 275,
16408-16413; Silva et al., 1999, J Mol Biol, 286, 1123-1136;
Chevalier et al., 2002, Molecular Cell, 10, 895-905).
[0061] The LAGLIDADG family is the largest family of proteins
clustered by their most general conserved sequence motif: one or
two copies of a twelve-residue sequence: the di-dodecapeptide, also
called LAGLIDADG motif. Homing endo-nucleases with one
dodecapeptide (D) are around 20 kDa in molecular mass and act as
homodimer. Those with two copies (DD) range from 25 kDa (230 AA) to
50 kDa (HO, 545 AA) with 70 to 150 residues between each motif and
act as monomer. Cleavage is inside the recognition site, leaving 4
nt staggered cut with 3'OH overhangs. I-Ceu I, and I-Cre I
illustrate the homodimeric homing endonucleases with one
Dodecapeptide motif (mono-dodecapeptide). I-Dmo I, I-Sce I, PI-Pfu
I and PI-Sce I illustrate monomeric homing endonucleases with two
Dodecapeptide motifs.
[0062] The initial LAGLIDADG homing endonuclease can be selected
from the group consisting of: I-Sce I, I-Chu I, I-Dmo I, I-Cre I,
I-Csm I, PI-Sce I, PI-Tli I, PI-Mtu I, I-Ceu I, I-Sce II, I-Sce
III, HO, PI-Civ I, PI-Ctr I, PI-Aae I, PI-Bsu I, PI-Dha I, PI-Dra
I, PI-Mav I, PI-Mch I, PI-Mfu I, PI-Mfl I, PI-Mga I, PI-Mgo I,
PI-Min I, PI-Mka I, PI-Mle I, PI-Mma I, PI-Msh I, PI-Msm I, PI-Mth
I, PI-Mtu I, PI-Mxe I, PI-Npu I, PI-Pfu I, PI-Rma I, PI-Spb I,
PI-Ssp I, PI-Fac I, PI-Mja I, PI-Pho I, PI-Tag I, PI-Thy I, PI-Tko
I, and PI-Tsp I; preferably, I-Sce I, I-Chu I, I-Dmo I, I-Cre I,
I-Csm I, PI-Sce I, PI-Pfu I, PI-Tli I, PI-Mtu I, and I-Ceu I; more
preferably, I-Dmo I, I-Cre I, PI-Sce I, and PI-Pfu I; still more
preferably I-Cre I.
[0063] The four structures of LAGLIDADG homing endonucleases,
namely those of I-Dmo I, PI-Sce I, PI-Pfu I, and I-Cre I, reveal
the functional significance of the LAGIDADG motif, and the nature
of the DNA-binding interface. The core .alpha. .beta. .beta.
.alpha. .beta. .beta. .alpha. fold of the homodimer homing
endonuclease is repeated twice in the monomer homing endonuclease
and confers upon the monomer a pseudo-dimeric structure. The first
.alpha.-helix of each domain or subunit contains the defining
LAGLIDADG motif. The two LAGLIDADG helices of each protein form a
tightly packed dimer or domain interface. The DNA binding interface
is formed by the four .beta.-strands of each domain or subunit that
fold into an antiparallel .beta.-sheet. A minimal DNA binding
moiety could be defined in the LAGLIDADG homing endonucleases as a
.beta.-hairpin (2 .beta.-strands connected by a loop or turn), two
such .beta.-hairpins being connected into the 4-stranded
.beta.-sheet.
[0064] Each domain or subunit interacts with a half recognition
site. The <<external>> quarter recognition site can be
defined by its interaction with only one of the 2 .beta.-hairpins
of each domain or subunit.
[0065] Therefore, meganuclease variants derived from LAGLIDADG
homing endonuclease can be fragmented in several directed
libraries. This fragmented approach for the evolution of an initial
meganuclease allows the introduction of a greater diversity (more
amino acids at a position and/or more diversificated positions). In
each library, the diversity is introduced only in the region
involved in the interaction with a half or a quarter recognition
site, the targeted DNA being modified only for the part interacting
with the region comprising the introduced diversity. More
particularly, if a new half site is searched for, then the
diversity is preferably introduced in the 4-stranded .beta.-sheet
of one domain or subunit, more preferably at the positions of the
DNA interacting amino acids in this structure. If a new quarter
site is searched for, then the diversity is introduced in the
corresponding .beta.-hairpin, more preferably at the positions of
the DNA interacting amino acids of this structure.
[0066] Preferably, a set of libraries covers the entire targeted
DNA site. Hence, if the libraries comprise diversity only in the
region interacting with a half-site, at least two libraries,
preferably two, are necessary. However, if the initial meganuclease
is a dimer, one library is enough with a half-site approach. If the
libraries comprise diversity only in the region interacting with a
quarter site, at least four libraries, preferably four, are
necessary. If the initial meganuclease is a dimer, two libraries
can be enough with a quarter site approach.
[0067] After the selection or screening of the primary libraries,
the selected elements from the primary libraries are fused or
combined in a subsequent library for a new cycle of selection. For
example, two libraries can be fused by shuffling. A new cycle of
selection could be then done on the whole targeted DNA site.
Optionally, the new cycle of selection can be done on a half
targeted DNA site if the first libraries are based on a quarter
site. Subsequently, the results of the selection and/or screening
of the half site are combined to give a final library which can be
screened for the whole targeted DNA site.
[0068] Alternatively, the best elements from each libraries are
joined together in order to obtain a meganuclease able to bind and
cleave the targeted DNA site.
[0069] In an other approach, a library with diversity located only
in the region involved in the interaction with a half or a quarter
recognition site is prepared. Then, after selection or screening of
this library, the selected elements from the library are modified
such as to introduce diversity in another region involved in the
inter-action with recognition site, leading to a subsequent
library. Libraries are generated until the complete targeted DNA
site is bound and cleaved by the selected meganuclease.
[0070] More specifically, for the dimeric homing endonuclease (such
as I-Cre I and I-Ceu I), a library can be generated by introducing
diversity only in the region interacting with a half-site, a half
site corresponding to one monomer of the initial homing
endonuclease. This library can be used for selection and/or
screening on each half sites of the target DNA sequence. When
positive elements from the library have been selected for each half
site, a variant for the first half site and a variant for the other
half site are brought together for binding and cleaving the whole
target DNA sequence. Alternatively, the positive variants can be
introduced in a single chain meganuclease structure. As described
in Example 1, a single chain meganuclease is an enzyme in which the
two monomers of the initial dimeric homing endonuclease are
covalently bound by a linker.
[0071] If an approach by a quarter site is chosen from an initial
dimer homing endonuclease, at least two libraries are generated by
introducing diversity only in the region involved in the
interaction with each quarter recognition sites. After the
selection or screening of the primary libraries, the selected
variants from the primary libraries are fused in a subsequent
library for a new cycle of selection on the half site.
Alternatively, the best elements from each libraries are joined
together to obtain a monomer able to bind the half site. Otherwise,
a library with diversity only in the region involved in the
interaction with a quarter recognition site is prepared. Then,
after selection or screening of this library, the selected elements
from the library are modified such as to introduce diversity in the
region involved in the interaction with the other quarter site,
leading to a subsequent library. The selection and/or screening of
this second library lead to the variants monomer able to bind the
half site. When positive elements from the library have been
selected for each half sites, a variant for the first half site and
a variant for the other half site are brought together for binding
and cleaving the target DNA sequence. Alternatively, the positive
variants can be introduced in a single chain meganuclease
structure.
[0072] In a preferred embodiment, the present invention concerns a
method to prepare a custom-made meganuclease which recognizes and
cleaves a desired polynucleotide target is derived from the
directed evolution of the homing endonuclease I-Cre I. As the
homing endonuclease is a homodimer, the approach in this case is
based either on the half recognition site or on the quarter
site.
[0073] The directed evolution is based on a library of I-Cre I
variants. These I-Cre I variants present a diversity of amino acids
at several positions predicted to interact with the polynucleotide
target.
[0074] The X-ray structure of I-Cre endonuclease with its DNA
target predicted that the following positions are involved: Q26,
K28, N30, S32, Y33, Q38, Q44, R68, R70 and T140. Seligman et al
(supra) showed that the positions S32 and T140 appear to be
relatively unimportant for DNA recognition.
[0075] In one embodiment of the present invention, a set of I-Cre I
variants is prepared by introducing amino acid diversity in
positions selected from the group consisting of: Q26, K28, N30,
S32, Y33, Q38, Q44, R68, R70 and T140. In a preferred embodiment, a
set of I-Cre I variants is prepared by introducing diversity in
positions: a) Q26, K28, N30, Y33, Q38, Q44, R68, R70, T140; b) Q26,
K28, N30, Y33, Q38, Q44, R68, R70; c) Q26, K28, N30, Y33, Q44, R68,
R70; or d) Q26, K28, Y33, Q38, Q44, R68, R70. Preferably, a set of
I-Cre I variants is prepared by introducing diversity in positions
Q26, K28, N30, Y33, Q38, Q44, R68, and R70.
[0076] Optionally, the residue D75 of I-Cre I could be mutated in
an uncharged amino acid such as N. Indeed, this amino acid has an
interaction with 2 residues which are preferably modified in the
library. As this charge is present in the core of the structure, it
could be preferable to abolish this charge.
[0077] If the evolution approach of the homing endonuclease I-Cre I
is based on the quarter recognition site, replacing the DNA binding
residues presented by a .beta.-hairpin (within the 4-stranded
b-sheet) is a practical solution. As those residues are part of an
element with limited length (i.e. less than 25 residue), they can
be mutated together at once, for example by cassette replacement.
Visual inspection of structure 1g9y (I-CreI with its target
double-stranded DNA) indicates that the first .beta.-hairpin is a
unique or major contributor to the recognition of the last six
bases of the target (i.e. either bases -12 to -7 or bases +7 to
+12). Thus replacing the sequence from residue S22 to residue Q44,
more preferably from residue I24 to residue T42, should be
sufficient to specify new interaction specificity for the last six
bases of the target site. More preferably, the residues interacting
directly with DNA should be modified: I24, Q26, K28, N30, S32, Y33,
Q38, S40 and T42. Alternatively (or in addition), the turn at the
middle of the .beta.-hairpin, which interacts with the very end of
the 24 bp-long DNA target, may be replaced by a short and flexible
loop that would be tolerant to DNA bases substitution. For example,
residues 30 to 36 could be replaced by 2, 3, 4, 5 or 6 glycine
residues. This strategy is worth testing with all meganucleases
presenting a comparable 3D structure. The second hairpin could be
replaced similarly as a single unit (from residue Y66 to I77).
However, while this hairpin interacts predominantly with the
internal quarter site (bases -6 to -1 or +1 to +6), other residues
(i.e. S22, Q44 and T46) separated from the hairpin may play a role
in directing the specificity of interaction. Thus, a library could
be created by replacing residues Y66, R68, R70, V73, D75 and I77.
In parallel, S22, Q44 and T46 may either be left untouched,
replaced by small polar amino acids (G, S or T; more preferably S
or T), or randomized to contribute to the library. Mutants selected
from separate library (the first wherein randomized residues are
I24, Q26, K28, N30, S32, Y33, Q38, S40 and T42 and the second
wherein randomized residues are Y66, R68, R70, V73, D75 and I77)
can be combined together by standard DNA shuffling methods based on
recombination at homologous DNA regions (i.e. the DNA coding for
the region between residue 43 and residue 65 is strictly
conserved). However, if the second library includes mutations of
residues S22, Q44 and T46, recombination becomes impractical, and
more classical DNA/protein engineering is required.
[0078] If the evolution approach of the homing endonuclease I-Cre I
is based on the quarter recognition site, a library of I-Cre I
variants is prepared by introducing diversity in positions selected
from the group consisting of: a) I24, Q26, K28, N30, S32, Y33, Q38,
S40 and T42; or b) Y66, R68, R70, V73, D75, and I77. In the
alternative b), the diversity could be also introduced in positions
selected from the group consisting of: S22, Q44, and T46.
[0079] Alternatively, a custom-made meganuclease which recognizes
and cleaves a desired polynucleotide target could be prepared by
the directed evolution of single chain I-Cre I endonuclease. A set
of single-chain I-Cre I variants is prepared by introducing amino
acid diversity in positions selected from the group consisting of:
Q26, K28, N30, S32, Y33, Q38, Q44, R68, R70, Q123, K125, N127,
S129, Y130, Q135, Q141, R165, R167.
[0080] --Selection and Screening
[0081] Two properties of the meganuclease can be used for the steps
of selection and/or screening, namely the capacity to bind the
targeted DNA sequence and the ability to cleave it.
[0082] The meganuclease variants can be selected and screened, or
only screened. The selection and/or screening can be done directly
for the ability of the meganuclease to cleave the targeted DNA
sequence. Alternatively, the selection and/or screening can be done
for the binding capacity on the targeted DNA sequence, and then for
ability of the meganuclease to cleave it. Preferably, the method to
prepare a custom-made meganuclease comprises or consists of the
following steps:
[0083] a) a selection step for the binding ability, a screening
step for the binding ability, a selection for the cleavage
activity, and a screening step for the cleavage activity;
[0084] b) a selection step for the binding ability, a screening
step for the binding ability, and a screening step for the cleavage
activity;
[0085] c) a selection step for the binding ability, a selection for
the cleavage activity, and a screening step for the cleavage
activity;
[0086] d) a screening step for the binding ability and a screening
step for the cleavage activity;
[0087] e) a selection step for and a screening step for the
cleavage activity; or,
[0088] f) a screening step for the cleavage activity.
[0089] More preferably, the method to prepare a custom-made
meganuclease comprises or consists of the following steps: a
selection step for the binding ability, a selection for the
cleavage activity, and a screening step for the cleavage activity.
A screening assay for the binding ability after a selection step
based on the binding capacity can be done in order to estimate the
enrichment of the library for meganuclease variants presenting a
binding capacity.
[0090] The selection and screening assays are performed on the DNA
region in which a double stranded cleavage has to be introduced or
a fragment thereof. Preferably, the targeted sequences comprise at
least 15 nucleotides, preferably 18 to 40, more preferably 18 to 30
nucleotides. In case of dimeric meganuclease, the targeted DNA
polynucleotide can be reduced to at least 8 nucleotides for binding
only. Preferably, the targeted DNA polynucleotide length is less
than 10 kb, preferably less than 3 kb, more preferably less than 1
kb. For the DNA binding assay, the targeted DNA polynucleotide
length is preferably less than 500 bp, more preferably less than
200 bp.
[0091] Any targeted sequence can be used to generate a custom-made
meganuclease able to cleave it according. Optionally, the targeted
sequence is chosen such as to present the most identity with the
original recognition and cleavage site of the initial
meganuclease.
[0092] Therefore, the DNA region in which a double stranded break
has to be introduced is analyzed to choose at least 1, 2, 3 or 5
sequences of at least 15 nucleotides length, preferably 18 to 40
nucleotides, more preferably 18 to 30 nucleotides, having at least
25% identity, preferably 50% identity and more preferably 75%
identity with the original recognition and cleavage site of the
initial meganuclease.
[0093] The targeted DNA sequence is adapted to the type of
meganuclease variants library. If the library is based on a half
site approach, the targeted DNA sequence used for the
selection/screening comprises one half original site and one half
site of the desired DNA sequence. If the library is based on a
quarter site approach, the targeted DNA sequence used for the
selection/screening comprises three quarters of the original site
and one quarter site of the desired DNA sequence.
[0094] The meganuclease variants resulting from the selection
and/or screening steps could optionally be an input for another
cycle of diversity introduction.
[0095] The positive meganuclease variants selected by the selection
and/or screening steps are validated by in vitro and/or ex vivo
cleavage assay.
[0096] --Selection and/or Screening Based on Binding Property of
Meganuclease
[0097] The selection and screening of meganuclease variants based
on the binding capacity has to be made in conditions that are not
compatible with the cleavage activity. For example, most of homing
endonucleases need manganese or magnesium for their cleavage
activity. Therefore, the binding assays on this type of homing
endonuclease variants are done without manganese or magnesium,
preferably replaced by calcium.
--Selection Based on Binding Property of Meganuclease
[0098] The binding selection assay is based on the enrichment of
the meganuclease variants able to bind the targeted DNA
polynucleotide. Therefore, the meganuclease variants encoded by the
library are incubated with an immobilized targeted DNA
polynucleotide so that meganuclease variants that bind to the
immobilized targeted DNA polynucleotide can be differentially
partitioned from those that do not present any binding capacity.
The meganuclease variants which are bound to the immobilized
targeted DNA polynucleotide are then recovered and amplified for a
subsequent round of affinity enrichment and amplification. After
several rounds of affinity enrichment and amplification, the
library members that are thus selected can be isolated. Optionally,
the nucleotide sequences encoding the selected meganuclease
variants are determined, thereby identifying of the meganuclease
variants able to bind the targeted DNA sequence.
[0099] The selection of meganuclease variants requires a system
linking genotype and phenotype such as phage display (WO91/17271,
WO91/18980, and WO91/19818 and WO93/08278; the disclosures of which
are incorporated herein by reference), ribosome display (Hanes
& Pluckthun, PNAS, 1997, vol. 94, 4937-4942; He & Taussig,
Nucl. Acids Res. (1997) vol. 25, p 5132-5143) and mRNA-protein
fusion (WO00/47775; U.S. Pat. No. 5,843,701; Tabuchi et al FEBS
Letters 508 (2001) 309-312; the disclosures of which are
incorporated herein by reference).
[0100] Phage display involves the presentation of a meganuclease
variant on the surface of a filamentous bacteriophage, typically as
a fusion with a bacteriophage coat protein. The library of
meganuclease variants is introduced into a phage chromosome or
phagemid so as to obtain a protein fusion with a bacteriophage coat
protein, preferably with the pIII protein. If the initial
meganuclease is a homodimer, the monomer variants of the
meganuclease are introduced so as to be displayed and the constant
monomer can be introduced so as to be produced in the periplasm.
The bacteriophage library can be incubated with an immobilized
targeted DNA sequence so that elements able to bind the DNA are
selected.
[0101] mRNA-protein fusion system opens the possibility to select
among 10.sup.13 different meganuclease variants. This system
consists in the creation of a link between the mRNA and the encoded
protein via a puromycin at the 3' end of the mRNA which leads to a
covalent mRNA-protein fusion at the end of the translation. Hence,
a double-stranded DNA library comprising the coding sequence for
the meganuclease variants is used regenerate mRNA templates for
translation that contain 3' puromycin. The mRNA-puromycin
conjugates are translated in vitro to generate the
mRNA-meganuclease fusions. After cDNA synthesis, the fusions are
tested for the ability to bind the immobilized targeted DNA
polynucleotide. A PCR is then used to generate double-stranded DNA
enriched in meganuclease variants presenting the binding capacity.
If the initial meganuclease is a homodimer, the constant monomer
can be introduced either as DNA or mRNA encoding this monomer or as
a monomer protein. In this case, an approach with the single chain
meganuclease will be preferably used.
[0102] Ribosome display involves a double-stranded DNA library
comprising the coding sequence for the meganuclease variants that
is used to generate mRNA templates for translation. After a brief
incubation, translation is halted by addition of Mg.sup.2+ and
incubation al low temperature or addition of translation inhibitor.
The ribosome complexes are then tested for the ability to bind
immobilized targeted DNA polynucleotide. The selected mRNA is used
to construct cDNA and a PCR generates double-stranded DNA enriched
in meganuclease variants presenting the binding capacity. If the
initial meganuclease is a homodimer, the constant monomer is
introduced either as DNA or mRNA encoding this monomer or as a
monomer protein. In this case, an approach with the single chain
meganuclease will be preferably used.
[0103] The targeted DNA sequence can be immobilized on a solid
support. Said solid support could be a column, paramagnetic beads
or a well of a microplate. For example, the polynucleotides
comprising the targeted DNA sequence present a ligand (such as a
biotin) at one end, said ligand allowing the immobilization on a
solid support bearing the target of the ligand (for example,
streptavidin if biotin is used).
[0104] The selection of the meganuclease variants may usually be
monitored by a screening assay based on the binding or cleavage
capacity of these meganucleases. However, the selected meganuclease
variants can be also directly introduced in a selection step based
on the cleavage capacity.
--Screening Based on Binding Property of Meganuclease
[0105] In order to perform the screening assay, the selected
meganuclease variants need to be cloned. If the selection was done
with the phage display system, the clone encoding each meganuclease
variants can be easily isolated. If the selection was done by
mRNA-protein fusion or ribosome display, the selected meganuclease
variants have to be subcloned in expression vector.
[0106] The screening assays are preferably performed in microplates
(96, 384 or 1536 wells) in which the targeted DNA polynucleotides
are immobilized. After expression of the meganuclease variants,
these variants are incubated with the immobilized targeted DNA
polynucleotides. The meganuclease variants expression can be
performed either in vivo or in vitro, preferably by in vitro
expression system. Preferably, the meganuclease variants are
purified prior to the incubation with the targeted polynucleotide.
The retained meganuclease variants are then detected. The detection
could be done by several means well known by the man skilled in the
art. For example, if phages are used, the detection can be done
with antibodies against phages (ELISA). Otherwise, the expression
could be done in presence of S35 amino acids in order to obtain
radioactive meganucleases. Thus, the binding is estimated by a
radioactivity measurement. The invention also considers the others
means of detection of DNA binding by meganuclease available to the
man skilled in the art.
[0107] Optionally, the nucleotide sequences encoding the positively
screened meganuclease variants are determined, thereby identifying
of the meganuclease variants able to bind the targeted DNA
sequence.
[0108] The positively screened meganuclease variants have to be
tested for their cleavage capacity. Therefore, said meganuclease
variants are incorporated in a cleavage selection and/or screening
experiment, preferably an in vivo cleavage screening assay.
Optionally, said meganuclease variants can be tested by an in vitro
cleavage assay.
[0109] The screening assay can also be used only for estimate the
enrichment in meganuclease variants presenting the binding
capacity. This estimation helps to decide if a new round of
selection based on the binding capacity is necessary or if the
selected library can be submitted to a cleavage selection and/or
screening, preferably an in vivo cleavage selection and/or
screening.
[0110] --Selection and/or Screening Based on Cleavage Property of
Meganuclease
[0111] The selection and screening of meganuclease variants based
on the cleavage capacity has to be made in conditions compatible
with the cleavage activity. The meganuclease variants used in the
selection and/or screening based on cleavage capacity may be either
the initial library of meganuclease variants or the meganuclease
variants selected and/or screened for the binding activity.
[0112] If necessary, the selected and/or screened meganuclease
variants are subcloned in an appropriate expression vector for the
in vitro and in vivo cleavage assay. Such subcloning step can be
performed in batch or individually. More particularly, if the
initial meganuclease is a dimer, the subcloning step allows the
introduction of the selected library(ies) in a single chain
meganuclease structure. If two libraries have been selected and/or
screened for two half recognition and cleavage sites, the
subcloning step allows to bring together the two selected libraries
in a single chain meganuclease structure.
--Selection Based on Cleavage Property of Meganuclease
[0113] The general principle of an in vivo selection of the
meganuclease variants based on their cleavage capacity is that the
double-strand break leads to the activation of a positive selection
marker or the inactivation of a negative selection marker.
[0114] If the selection is based on the inactivation of a negative
selection marker, the method involves the use of cell containing an
expression vector comprising the coding sequence for a negative
selection marker and the targeted DNA sequence for the desired
meganuclease and an expression vector comprising the library of
meganuclease variants. Preferably said expression vector is a
plasmid. Preferably said targeted DNA sequence is located either
near the negative selection gene or in the negative selection gene,
preferably between the promoter driving the expression of the
negative selection and the ORF. The expression of the negative
selection marker has to be conditional in order to keep the cell
alive until the meganuclease variants have the opportunity to
cleave. Such a conditional expression can be easily done with a
conditional promoter. However, there are other conditional systems
that could be used. The meganuclease variants are introduced in an
expression cassette. The meganuclease encoding sequence can be
operably linked to an inducible promoter or to a constitutive
promoter. Of course, the promoter is compatible with the cell used
in the assay. If the meganuclease variant has the capacity to
cleave the targeted DNA, then the negative selection marker is
inactivated, either by deleting the whole negative marker gene or a
part thereof (coding sequence or promoter) or by degrading the
vector. A culture in a negative selection condition allows the
selection of the cell containing the meganuclease variants able to
cleave the targeted DNA sequence.
[0115] The vector comprising the negative selection marker is
preferably transfected before the introduction of the vector
encoding the meganuclease variants. Optionally, the vector
comprising the negative selection marker can be conserved in the
cell in an episomal form. Alternatively, the vector comprising the
negative selection marker and the vector encoding the meganuclease
variants can be cotransfected into the cell. The cell can be
prokaryotic or eukaryotic. Preferably, the prokaryotic cell is E.
coli. Preferably, the eukaryotic cell is a yeast cell. The negative
selection marker is a protein directly or indirectly toxic for the
cell. For example, the negative selection marker can be selected
from the group consisting of toxins, translation inhibitors,
barnase, and antibiotic for bacteria, URA3 with 5FOA
(5-fluoro-orotic acid) medium and LYS2 with a .alpha.-AA medium
(alpha-adipic acid) for yeast, and thymidine kinase for superior
eukaryotic cells. For an example of negative marker selection, see
Gruen et al., 2002, Nucleic Acids Research, 30, e29; the disclosure
of which is incorporated herein by reference.
[0116] If the selection is based on the activation of a positive
selection marker, the method involves the use of cell containing an
expression vector comprising an inactive positive selection marker
and the targeted DNA sequence for the desired meganuclease and an
expression vector comprising the library of mega-nuclease variants.
Optionally, the inactive positive selection marker, the targeted
DNA sequence and the library of meganuclease variants can be on the
same vector (See WO 02/44409). Preferably said expression vector is
a plasmid. The meganuclease variants are introduced in an
expression cassette. The meganuclease encoding sequence can be
operably linked to an inducible promoter or to a constitutive
promoter. Of course, the promoter is compatible with the cell used
in the assay. For example, the positive selection marker can be an
antibiotic resistance (e.g. tetracycline, rifampicin and ampicillin
resistance) or an auxotrophy marker for bacteria, TRP1, URA3, or an
auxotrophy marker for yeast, and neomycine et puromycine for
superior eukaryotic cell. Optionally, the positive selection marker
can be an auxotrophy marker compatible with both bacteria and yeast
(e.g. URA3, LYS2, TRP1, and LEU2). The inactive positive selection
marker gene and the targeted DNA sequence have to be arranged so
that the double-strand break leads to a rearrangement of the marker
in an active positive marker. Two kinds of repair processes can
lead to an active positive selection marker, namely single-strand
annealing (SSA) or gene conversion (GC).
[0117] The in vivo Single-strand annealing recombination test (SSA)
is known by the man skilled in the art and disclosed for example in
Rudin et al. (Genetics 1989, 122, 519-534; Fishman-Lobell &
Haber (Science 1992, 258, 480-4); Lin et al (Mol. Cell. Biol.,
1984, 4, 1020-1034) and Rouet et al (Proc. Natl. Acad. Sci. USA,
1994, 91, 6064-6068); the disclosure of which are incorporated
herein by reference.
[0118] To test the meganuclease variants, an in vivo assay based on
SSA in a cell, preferably a bacterial or yeast cell has been
developed. For instance, the method uses a yeast cell. This
organism has the advantage that it recombines naturally its DNA via
homologous recombination with a high frequency.
[0119] This in vivo test is based on the reparation by SSA of a
positive selection marker induced by double-strand break generated
by an active meganuclease variant. The target consists of a
modified positive selection gene with an internal duplication
separated by a intervening sequence comprising the targeted DNA
sequence. The internal duplication should contain at least 50 bp,
preferably at least 200 bp. The efficiency of the SSA test will be
increased by the size of the internal duplication. The intervening
sequences are at least the targeted DNA sequence. The intervening
sequence can optionally comprise a selection marker, this marker
allowing checking that the cell has not repaired the positive
selection marker by a spontaneous recombination event. The positive
selection marker gene is preferably operably linked to a
constitutive promoter relating to the cell used in the assay.
According to said assay method, the cell will be selected only if a
SSA event occurs following the double-strand break introduced by an
active meganuclease variant.
[0120] Optionally, each vector can comprise a selectable marker to
ensure the presence of the plasmid in the cell. The presence of
this selectable marker is preferable for the assay performed in
yeast cell. For example, for yeast, a first construct comprising
the target gene can comprise a Leu2 selectable marker allowing
transformed yeast to grow on a synthetic medium that does not
contain any Leucine and a second construct can comprise the Trp1
selectable marker allowing transformed yeast to grow on a synthetic
medium that does not contain any tryptophane.
[0121] The vector comprising the positive selection marker is
preferably transfected before the introduction of the vector
encoding the meganuclease variants. Optionally, the vector
comprising the positive selection marker can be conserved in the
cell in an episomal form. Alternatively, the vector comprising the
positive selection marker and the vector encoding the meganuclease
variants can be cotransfected into the cell.
[0122] The in vivo selection of the meganuclease variants can also
be performed with a gene conversion assay. For example, the
selection vector comprises a first modified positive selection gene
with a deletion or a mutation and an insertion of the targeted DNA
sequence for the meganuclease at the place of the deletion. The
positive selection gene can also be inactivated by the interruption
of the gene by an insert comprising the targeted DNA sequence. The
selection construct further comprises the segment of the positive
selection marker gene which has been deleted flanked at each side
by the positive selection marker gene sequences bordering the
deletion. The bordering sequences comprise at least 100 bp of
homology with the positive selection marker gene at each side,
preferably at least 300 pb. The double-stand break generated by an
active meganuclease variant in the targeted DNA sequence triggers
on a gene conversion event resulting in a functional positive
selection marker gene. This kind of assay is documented in the
following articles: Rudin et al (Genetics 1989, 122, 519-534),
Fishman-Lobell & Haber (Science 1992, 258, 480-4), Paques &
Haber (Mol. Cell. Biol., 1997, 17, 6765-6771), the disclosures of
which are incorporated herein by reference.
[0123] Otherwise, the in vivo selection of the meganuclease
variants can be performed through a recombination assay on
chromosomic target. The recombination can be based on SSA or gene
conversion mechanisms. The in vivo selection can be based on
several SSA targets, preferably at least two SSA targets.
[0124] A first example based on SSA is the following. A modified
positive selection gene with an internal duplication separated by
an intervening sequence comprising the targeted DNA sequence for
the desired meganuclease variant is introduced into the chromosome
of the cell. The internal duplication should contain at least 50
bp, preferably at least 200 bp. The efficiency of the SSA test will
be increased by the size of the internal duplication. The
intervening sequence is at least the targeted DNA sequence. By
transfecting the cell with an expression construct allowing the
production of a meganuclease variant in the cell, the repair by
homologous recombination of the double-strand break generated by an
active meganuclease variant will lead to a functional positive
selection marker gene.
[0125] Another example based on gene conversion is the following. A
mutated non-functional positive selection marker gene comprising
the targeted DNA sequence for the desired meganuclease variant is
introduced into the chromosome of the cell. Said targeted DNA
sequence has to be in the vicinity of the mutation, preferably at
less than 1 kb from the mutation, more preferably at less than 500
bp, 200 bp, or 100 pb surrounding the mutation. By transfecting the
cell with a fragment of the functional positive selection marker
gene corresponding to the mutation area and an expression construct
allowing the production of a meganuclease variant in the cell, the
repair by homologous recombination of the double-strand break
generated by an active meganuclease variant will lead to a
functional positive selection marker gene. Alternatively, the
fragment of the functional positive selection marker allowing the
repair can be integrated on the chromosome. This kind of assay is
documented in the following articles: Rouet et al (Mol. Cell.
Biol., 1994, 14, 8096-8106); Choulika et al (Mol. Cell. Biol.,
1995, 15, 1968-1973); Donoho et al (Mol. Cell. Biol., 1998, 18,
4070-4078); the disclosures of which are incorporated herein by
reference.
[0126] The selected clones comprise a meganuclease variant
presenting the capacity to cleave the targeted DNA sequence. It is
preferable to validate the selection by a screening assay. This
screening assay can be performed in vivo or in vitro, preferably in
vivo.
[0127] Optionally, the nucleotide sequences encoding the positively
screened meganuclease variants are determined, thereby identifying
the meganuclease variants able to cleave the targeted DNA
sequence.
--Screening Based on Cleavage Property of Meganuclease
[0128] In order to perform the screening assay, the selected
meganuclease variants need to be cloned and the cleavage assay need
to be performed individually for each clone.
[0129] The in vivo cleavage assay for the screening is similar to
those used for the selection step. It can be based on the
inactivation of either a negative selection marker or a reporter
gene, or on the activation of either a positive selection marker or
a reporter gene.
[0130] By reporter gene is intended any nucleic acid encoding a
product easily assayed, for example .beta.-galactosidase,
luciferase, alkaline phosphatase, green fluorescent protein,
tyrosinase, DsRed proteins. The reporter gene is preferably
operably linked to a constitutive promoter relating to the cell
used in the assay (for example CMV promoter).
[0131] Cells used for this screening assay can be prokaryotic,
preferably E. coli, or eukaryotic, preferably a yeast cell or a
mammalian cell. More particularly, it could be interesting to use
mammalian cells for a validation of a positive meganuclease variant
by an ex vivo cleavage assay
[0132] --In Vitro Cleavage Assay
[0133] The recognition and cleavage of the targeted DNA sequence or
a part thereof by the meganuclease variants can be assayed by any
method known by the man skilled in the art.
[0134] One way to test the activity of the meganuclease variants is
to use an in vitro cleavage assay on a polynucleotide substrate
comprising the targeted DNA sequence or a part thereof. Said
polynucleotide substrate could be a synthetic target site
corresponding to:
[0135] the whole targeted DNA site;
[0136] a half targeted DNA site and a half original site; or,
[0137] a quarter targeted DNA site and three quarters original
site.
[0138] Said polynucleotide substrate can be linear or circular and
comprises preferably only one cleavage site. The assayed
meganuclease variant is incubated with the polynucleotide substrate
in appropriate conditions. The resulting polynucleotides are
analyzed by any known method, for example by electrophoresis on
agarose or by chromatography. If the polynucleotide substrate is a
linearized plasmid, the meganuclease activity is detected by the
apparition of two bands (products) and the disappearance of the
initial full-length substrate band. Preferably, said assayed
meganuclease variants are digested by proteinase K, for example,
before the analysis of the resulting polynucleotides. For instance,
the polynucleotide substrate is prepared by the introduction of a
polynucleotide comprising the sequence of the target site in a
plasmid by TA or restriction enzyme cloning, optionally followed by
the linearization of the plasmid. Preferably, such linearization is
not done in the surrounding of the targeted DNA sequence. See Wang
et al, 1997, Nucleic Acid Research, 25, 3767-3776; See Examples,
Materials & Methods "in vitro activity assays" section) and the
characterization papers of the initial homing endonucleases.
[0139] Alternatively, such in vitro cleavage assay can be performed
with polynucleotide substrates linked to fluorophores, such
substrates comprising the targeted DNA sequence. These
polynucleotide substrates are immobilized on a solid support. Said
solid support is preferably a microplate (96, 384 or 1536 wells).
For example, the polynucleotides comprising the targeted DNA
sequence present a ligand (such as a biotin) at one end, said
ligand allowing the immobilization on a solid support bearing the
target of the ligand (for example, streptavidin if biotin is used).
The end opposite to the immobilized end is linked to a fluorophore.
Cleavage leads to loss of fluorescence by release of the
fluorochrome from the solid support.
[0140] Otherwise, some in vitro cleavage assays can be based on the
fluorescence quenching. A fluorophore (for example, FAM or TAMRA)
and a quencher (for example, DABCYL) are located on the
polynucleotide substrate such as the quencher inhibits the
fluorescence emission. The quenching is abolished when the cleavage
by the meganuclease variants occurs on the polynucleotide
substrates. Several examples of this quenching assays are detailed
in Eisenschmidt et al (2002, Journal of Biotechnology, 96, 185-191)
and WO 02/42497, the disclosure of these documents are incorporated
herein by reference.
[0141] --Custom-Made Meganucleases, Polynucleotides Encoding a
Custom-Made Meganuclease, Vectors, Cells and Animals/Plants
[0142] The present invention concerns any custom-made meganuclease
prepared by the method according to the present invention and any
use of it. Optionally, said meganuclease comprises a purification
tag.
[0143] The present invention concerns a recombinant polynucleotide
encoding a custom-made meganuclease prepared by a method according
to the present invention. The present invention concerns:
[0144] a) any vector comprising a polynucteotide sequence encoding
a custom-made meganuclease according to the present invention;
[0145] b) any prokaryotic or eukaryotic cell comprising either a
polynucleotide sequence encoding a custom-made meganuclease
according to the present invention or a vector according a);
and,
[0146] c) any non-human animal or plant comprising a polynucleotide
sequence encoding a custom-made meganuclease according to the
present invention, or a vector according a), or a cell according
b).
[0147] As used herein, a cell refers to a prokaryotic cell, such as
a bacterial cell, or eukaryotic cell, such as an animal, plant or
yeast cell. A cell which is of animal or plant origin can be a stem
cell or somatic cell. Suitable animal cells can be of, for example,
mammalian, avian or invertebrate origin. Examples of mammalian
cells include human (such as HeLa cells), bovine, ovine, caprine,
porcine, murine (such as embryonic stem cells), rabbit and monkey
(such as COS1 cells) cells. The cell may be an embryonic cell, bone
marrow stem cell or other progenitor cell. Where the cell is a
somatic cell, the cell can be, for example, an epithelial cell,
fibroblast, smooth muscle cell, blood cell (including a
hematopoietic cell, red blood cell, T-cell, B-cell, etc.), tumor
cell, cardiac muscle cell, macrophage, hepatic cell, dendritic
cell, neuronal cell (e.g. a glial cell or astrocyte), or
pathogen-infected cell (e.g., those infected by bacteria, viruses,
virusoids, parasites, or prions).
[0148] The cells can be obtained commercially or from a depository
or obtained directly from an individual, such as by biopsy. The
cell can be obtained from an individual to whom they will be
returned or from individual of the same or different species. For
example, nonhuman cells, such as pig cells, can be modified to
include a DNA construct and then put into a human. Alternatively,
the cell need to be isolated from the individual for example, it is
desirable to deliver the vector to the individual in gene
therapy.
[0149] The vector comprising a polynucleotide encoding a
custom-made meganuclease contains all or part of the coding
sequence for said meganuclease operably linked to one or more
expression control sequences whereby the coding sequence is under
the control of transcriptional signals to permit production or
synthesis of said meganuclease. Therefore, said polynucleotide
encoding a custom made meganuclease is comprised in an expression
cassette. More particularly, the vector comprises a replication
origin, a promoter operatively linked to said encoding
polynucleotide, a ribosome site, an RNA-splicing site (when genomic
DNA is used), a polyadenylation site and a transcription
termination site. It also can comprise an enhancer. Selection of
the promoter will depend upon the desired route for expressing the
meganuclease.
[0150] The invention concerns a method for producing a custom-made
meganuclease comprising introducing an expression vector into a
cell compatible with the element of said expression vector.
[0151] The polynucleotide sequence encoding the custom meganuclease
can be prepared by any method known by the man skilled in the
art.
USE OF THE MEGANUCLEASE ACCORDING TO THE INVENTION
[0152] The custom-made meganucleases according to the present
invention are of great utility. Of course, these custom-made
meganucteases are precious for molecular biology and for genetic
engineering, antiviral therapy, genome therapy and gene therapy,
more particularly according to the methods described in WO
96/14408, U.S. Pat. No. 5,830,729, WO 00/46385, WO 00/46386, the
disclosure of these documents being incorporated by reference.
[0153] The custom-made meganucleases with new specificity according
to the present abolish the limiting step of introducing the
recognition and cleavage site for a natural meganuclease in the
method of genetic engineering involving meganucleases.
[0154] --Genetic Engineering and Gene Therapy
[0155] The custom-made meganuclease according to the present
invention can be used in genetic engineering for the preparation of
vector. In vitro, said meganuclease are useful when a rare-cutting
endonuclease is necessary in the vector construction. Said
custom-made meganuclease can also be used for in vivo vector
construction. For example, if the recognition and cleavage site for
a custom-made meganuclease is located on a vector, said
meganuclease can be used to induce a homologous recombination with
an other vector presenting homology with the sequence surrounding
the cleavage site. Said vector can be a plasmid or a viral vector.
Similarly, said custom made meganuclease can be used to delete a
helper vector (generally a plasmid) in a transcomplementing cell
line for the production of retroviruses, AAV or adenoviruses.
[0156] Genome engineering is the set of methods used to induce a
change in the genetic program of a living cell and/or organism. The
meganucleases obtained by the method of the present invention
allows rational site directed modifications of cell genomes. The
purpose of these techniques is to rewrite chromosomes precisely
where they should be modified leaving the rest of the genome
intact. Fields of applications of the genome engineering are
multiple: animal models generation (knock-in or knock-out), protein
production (engineering of production strains, protein production
in plant and animals for protein production in milks), agricultural
biotechnology (addition or removal of a trait, marker excision),
modification and study of metabolic pathway, or therapy of genetic
diseases or viral diseases.
[0157] A custom-made meganuclease according to the present
invention can be used in a method of genome engineering comprising:
1) introducing a double-strand break at the genomic locus
comprising at least one recognition and cleavage site of said
meganuclease; and, 2) providing a targeting DNA construct
comprising the sequence to be introduced flanked by sequences
sharing homologies to the targeted locus. Indeed, shared DNA
homologies are located in regions flanking upstream and downstream
the site of the break in the targeting DNA construct and the DNA
that might be introduced should be located between the two arms.
Said meganuclease can be provided directly to the cell or through
an expression vector comprising the polynucleotide sequence
encoding said meganuclease and suitable for its expression in the
used cell. Alternatively, the method of genome engineering
comprises: 1) introducing a double-strand break at the genomic
locus comprising at least one recognition and cleavage site of said
meganuclease; 2) maintaining under conditions appropriate for
homologous recombination with the chromosomal DNA homologous to the
region surrounding the cleavage site. Any of these methods of
genetic engineering could be used for repairing a specific
sequence, modifying a specific sequence, for attenuating or
activating an endogen gene of in for introducing a mutation into a
site of interest, for introducing an exogenous gene or a part
thereof, for inactivating or deleting an endogenous gene or a part
thereof, for methylated or demethylating the CpG dinucleotides of a
gene. The invention relates to the resulting cells and their
uses.
[0158] The custom-made meganuclease according to the present
invention could also be used for addition or substitution of
telomer, for killing cells, for chromosomic translocation, for
changing the chromatinization, or for chromosomic loss.
[0159] It is an object of the invention to use at least one
custom-made meganuclease according to the present invention to
repair a specific sequence, to modify a specific sequence, to
attenuate or activate an endogenous gene of interest, to introduce
a mutation into a site co interest, to introduce an exogenous gene
or a part thereof, and to inactivate or delete an endogenous gene
or a part thereof by exposing cells animals, plants to said
meganuclease.
[0160] Another object of the invention is a composition comprising
at least one custom-made meganuclease according to the present
invention. Preferably said composition is used for repairing a
specific sequence, modifying a specific sequence, for attenuating
or activating an endogenous gene of interest, for introducing a
mutation into a site of interest, for introducing an exogenous gene
or a part thereof, for inactivating or deleting an endogenous gene
or a part thereof by exposing cells, animals, or plants to said
meganuclease. Preferably said composition comprises one custom-made
meganuclease or two different custom-made meganucleases.
Optionally, said composition can further comprise a targeting DNA
construct comprising the sequence to be introduced flanked by
homologous sequence to the targeted locus.
[0161] More particularly, the invention also relates to the use of
a custom-made meganuclease obtained by the method according to the
present invention in a method for treating or prophylaxis of a
genetic disease in an individual in need thereof comprising (a)
inducing in cells of the individual a double stranded cleavage at a
site of interest comprising at least one recognitron and cleavage
site of said meganuclease, and (b) introducing into the individual
a targeting DNA, wherein said targeting DNA comprises (1) DNA
sharing homologies to the region surrounding the cleavage site and
(2) DNA which repairs the site of interest upon recombination
between the targeting DNA and the chromosomal DNA. The targeting
DNA is introduced into the individual under conditions appropriate
for introduction of the targeting DNA into the site of interest. In
a second embodiment the method for treating or prophylaxis of a
genetic disease in an individual in need thereof comprises inducing
in cells of the individual a double stranded break at a site of
interest comprising at least one recognition and cleavage site of
said meganuclease under conditions appropriate for chromosomal DNA
homologous to the region surrounding to be introduced or deleted
into the site of interest and repair of the site of interest.
Alternatively, cells can be removed from an individual to be
treated, modified by the present method and reintroduced by
autographt into the individual.
[0162] The invention relates to custom-made meganuclease obtained
by the method according to the present invention in a method for
correcting a genetic lesion or abnormality in chromosomal DNA of a
cell comprising inducing in the cell double stranded break at a
site of interest in the genetic lesion or abnormality comprising at
least one recognition and cleavage site of said meganuclease under
conditions appropriate for chromosomal DNA homologous to the region
surrounding the site of cleavage to be introduced into the site of
interest and correct the genetic lesion or abnormality. Here, too,
the method can be carried out in cells present in an individual or
in cells removed from the individual, modified and then returned to
the individual (ex vivo).
[0163] The present invention further relates to the resulting cells
and their uses, such as for treatment or prophylaxis of a condition
or disorder in an individual (e.g., a human or other mammal or
vertebrate). For example, cells can be produced (e.g., ex vivo) by
the method described herein and then introduced into an individual
using known methods. Alternatively, cells can be modified in the
individual (without being removed from the individual).
[0164] It is therefore an object of the present invention to use at
least one custom-made meganuclease according to the present
invention to prevent, ameliorate or cure a genetic disease by
exposing cells, animals or patients to said meganuclease.
Preferably, the invention relates to the use of one custom-made
meganuclease or two different custom-made meganucleases.
[0165] Another object of the invention is a composition comprising
at least one custom-made meganuclease according to the present
invention. Preferably said composition is used for preventing,
ameliorating or cure a genetic disease by exposing cells, animals
or patients to said composition. Preferably said composition
comprises at least one custom-made meganuclease. Optionally, said
composition can further comprise a targeting DNA construct
comprising the sequence to be introduced flanked by sequences
homologous to the targeted locus.
[0166] Targeting DNA and/or custom-made meganucleases introduced
into a cell, an animal, a plant or an individual as described above
can be inserted in a vector. Vectors comprising targeting DNA
and/or nucleic acid encoding a meganuclease can be introduced into
a cell by a variety of methods (e.g., injection, transformation,
transfection, direct uptake, projectile bombardment, liposomes).
Meganucieases can be stably or transiently expressed into cells
using expression vectors. Techniques of expression in eukaryotic
cells are well known to those in the art. (See Current Protocols in
Human Genetics: Chapter 12 "Vecto Therapy" & Chapter 13
"Delivery Systems for Gene Therapy"). Optionally, it may be
preferable to incorporate a nuclear localization signal into the
recombinant protein to be sure that it is expressed within the
nucleus. Custom-made meganuclease can also be introduced into a
cell according to methods generally known in the art which are
appropriate for the particular meganuclease and cell type.
Custom-made meganucleases according to the present invention can be
introduced into cells using liposomes or by fusion to the membrane
translocating peptide (Bonetta, 2002, The Sientist, 16, 38; Ford et
al, Gene Ther., 2001,8, 1-4; Wadia & Dowdy, 2002, CurrOpin
Biotechnol, 13, 52-56).
[0167] Once in the cell, the custom-made meganuclease and the
vector comprising targeting DNA and/or nucleic acid encoding a
custom-made meganuclease are imported or translocated by the cell
from the cytoplasm to the site of action in the nucleus.
[0168] Custom-made meganucleases and vectors which comprise
targeting DMA homologous to the region surrounding the cleavage
site and/or nucleic acid encoding a custom-made meganuclease can be
introduced into an individual using routes of administration
generally known in the art. Administration may be topical or
internal, or by any other suitable avenue for introducing a
therapeutic agent to a patient. Topical administration may be by
application to the skin, or to the eyes, ears, or nose. Internal
administration may proceed intradermally, subcutaneously,
intramuscularly, intraperitoneally, intraarterially or
intravenously, or by any other suitable route. It also may in some
cases be advantageous to administer a composition of the invention
by oral ingestion, by respiration, rectally, or vaginally.
[0169] The custom-made meganucleases and vectors can be
administered in a pharmaceutically acceptable carrier, such as
saline, sterile water, Ringers solution, and isotonic sodium
chloride solution. Typically, for therapeutic applications, the
custom-made meganucleases will be combined with a pharmaceutically
acceptable excipient appropriate to a planned route of
administration. A variety of pharmaceuticatly acceptable excipients
are well known, from which those that are effective for delivering
meganucleases to a site of infection may be selected. The HANDBOOK
OF PHARMACEUTICAL EXCIPIENTS published by the American
Pharmaceutical Association is one useful guide to appropriate
excipients for use in the invention. A composition is said to be a
"pharmaceutically acceptable excipient" if its administration can
be tolerated by the recipient. Sterile phosphate-buffer saline is
one example of pharmaceutically acceptable excipient that is
appropriatae for intravenous administration. The mode of
administration is preferably at the location of the targeted
cells.
[0170] The dosage of custom-made meganuclease or vector of the
present invention administered to an individual, including
frequency of administration, will vary depending upon a variety of
factors, including mode and route of administration: size, age,
sex, health, body weight and diet of the recipient; nature and
extent of symptoms of the disease or disorder being treated; kind
of concurrent treatment, frequency of treatment, and the effect
desired. For a brief review of pharmaceutical dosage forms and
their use, see PHARMACEUTICAL DOSAGE FORMS AND THEIR USE (1985)
(Hanshuber Publishers, Beme, Switzerland).
[0171] For purposes of therapy, the custom-made meganucleases and a
pharmaceutically acceptable excipient are administered in a
therapeutically effective amount. Such a combination is said to be
administered in a "therapeutically effective amount" if the amount
administered is physiologically significant. An agent is
physiologically significant if its presence results in a detectable
change in the physiology of the recipient. In the present context,
an agent is physiologically significant if its presence results in
a decrease in the severity of one or more symptoms of the targeted
disease or in a genome correction of the lesion or abnormality.
[0172] In one embodiment of the invention, the custom-made
meganucleases are substantially non-immunogenic, i.e., engender
little or no adverse immunological response. A variety of methods
for ameliorating or eliminating deleterious immunological reactions
oft his sort can be used in accordance with the invention. In a
preferred embodiment, the meganucleases are substantially free of
N-formylmethionine. Another way to avoid unwanted immunological
reactions is to conjugate meganucleases to polyethylene glycol
("PEG") or polypropylene glycol ("PPG") (preferably of 500 to
20,000 daltons average molecular weight (MW). Conjugation with PEG
or PPG, as described by Davis et al., (U.S. Pat. No. 4,179,337) for
example, can provide non-immunogenic, physiologically active, water
soluble endonuclease conjugates with anti-viral activity. Similar
methods also using a polyethylene-polypropylene glycol copolymer
are described in Saifer et al. (U.S. Pat. No. 5,006,333).
[0173] In another use, the custom-made meganucleases can be for in
vivo excision of a polynucleotide fragment flanked by at least one,
preferably two, recognition and cleavage site for one or two
distinct custom-made meganucleases. Custom-made meganucteases
according to the present invention can be used in methods involving
the excision of targeted DNA or polynucleotide fragment from a
vector within cells which have taken up the vector. Such methods
involve the use of a vector comprising said polynucleotide fragment
flanked by at least one, preferably two, recognition and cleavage
site for a custom-made meganuclease and either an expression vector
comprising a polynucleotide encoding said custom-made meganuclease
corresponding to the target site suitable for the expression in the
used cel 1, or said custom-made meganuclease. Said excised
polynucleotide fragment can be used for transgenesis as described
in detail in U.S. patent application under Ser. No. 10/242,664
filed on 13 Sep. 2002. Optionally, said excised targeting DNA
comprises shared DNA homologies located in regions flanking
upstream and downstream the site of the break in the targeting DNA
construct and the DNA that might be introduced being located
between the two arms. For more detail see WO 00/46385. Said method
of excision of targeting DNA from a vector within the cell can be
used for repairing a specific sequence of interest in chromosomal
DNA, for modifying a specific sequence or a gene in chromosomal
DNA, for attenuating an endogeneous gene of interest, for
introducing a mutation in a target site, or for treating or
prophylaxis of a genetic disease in an individual.
[0174] --Antiviral Application
[0175] There are currently very few effective anti-viral agents,
although the many virally transmitted diseases account for much
human suffering and mortality. Thus, there is a great need for safe
and effective antiviral agents that can serve in therapies for
these diseases, including life-threatening and fatal diseases such
as hepatitis B and AIDS. 15% of the human cancer have viral causes.
This rate increases to 80% for uterine and liver cancer. Today,
viruses are the third carcinogenic factors in human.
[0176] No existing viral treatment is dedicated to kill the virus
infecting the cells and cure the cells out of such infection. The
main goal in treating viral infection is reducing viral load in
infected cells and within a patient. Anti-viral drugs available
today are generally toxic and have little specificity. Certain
drugs are designed to inhibit a component of the virus's
replicative machinery such as the enzymes thymidine kinase or
reverse transcriptase. These agents do not destroy viral DNA. Other
anti-viral agents act to promote the host's immune response so that
infected cells are killed more efficiently. This results in
non-specific destruction of both the virus and the host cell.
[0177] Today, there is a need for new therapeutic agents that
specifically destroy viral DNA without destroying or altering the
host cell. Most viral DNA synthesis occurs within the cell's
nucleus; thus it is important to generate therapeutic agents that
can distinguish between the viral and the host cell DNA.
[0178] Sechler (U.S. Pat. No. 5,523,232) disclosed the use et
restriction endonucleases against viruses. This method comprises a
step of administering to a patient a composition with a restriction
endonuclease able te cleave the targeted virus. The problem of this
method is the very low specificity of the restriction endonuclease
(recognition sites of 4 to 6 nucleotides length) and the high
probability to cleave the patient's genome.
[0179] Chandrasegaran (U.S. Pat. No. 6,265,196) disclosed a
prospective example concerning the use of a hybrid endonuclease
(FoK I domain and zinc finger DNA binding domain) in treatment of
viral diseases. However, such hybrid endonucleases generally lack
the ability to specifically act as a single unique phosphodiester
bond or base pair within the DNA target site (Smith et al., 1999,
supra) and they do not show a high sequence specificity or any
antiviral evidence.
[0180] One application of the custom-made meganucleases according
to the present invention is as therapeutics in the treatment of
viral diseases caused by viruses or retroviruses that present a DNA
intermediate. Indeed, many viruses which infect eukaryotic cells
possess, during at least one part of their life cycle, genomes that
consist of double stranded DNA which can be cleaved readily by a
meganuclease. Custom-made meganucleases according to the present
invention can be designed so that they specifically target
viral-specific DNA sequences.
[0181] At the opposite of restriction endonucleases and zinc
fingers hybrid endonucleases, custom-made meganucleases according
to the present invention present a good specificity for its viral
DNA target and they generate a unique double strand break only in
its viral target. This strategy involves identification of DNA
sequences within the viral genome that are viral-specific, i.e.,
they are not present within the human genome. Once identified,
meganucleases that specifically bind and cleave such sequences with
high affinity and specificity can be designed using the method for
preparing custom-made meganucleases as described in the present
invention. Then the designed meganucleases are used for the
treatment of viral infection.
[0182] It is therefore an object of the present invention to use at
least one custom-made meganuclease according to the present
invention to prevent, ameliorate or cure viral infection by
exposing the virus and/or infected cells, plants, animals or
patients to these meganucleases. Preferably the invention relates
to the use of one meganuclease or two different maganucleases.
[0183] Another object of the present invention is to use at least
one meganuclease according to the present invention for
inactivating or deleting virus in biologically derived products and
products intended for biological uses by treating the products with
said meganucleases in a particular embodiment, said biological
products are blood or blood-derived products. Preferably the
invention relates to the use of at least one meganuclease;
optionally two different custom-made meganucleases.
[0184] Another object of the invention is a composition comprising
at least one custom-made meganuclease according to the present
invention for preventing, ameliorating or curing viral infection by
exposing the virus or the infected cells, plants, animals or
patients to said composition. Preferably, said composition
comprises at least one custom-made meganuclease, optionally two
meganucleases.
[0185] Another object of the invention, is compositions comprising
at least one meganuclease according to the invention for inhibiting
propagation of a virus, inactivating or deleting virus in
biologically derived products or products intended for biological
use, or for disinfecting an object. In a particular embodiment,
said biological products are blood or blood-derived products.
Preferably, said composition comprises one custom-made meganuclease
or two different custom-made meganucleases
[0186] Any virus that contains a double stranded DNA stage in its
life cycle can be targeted for deletion or inactivation by creating
a meganuclease that recognizes DNA sequences specific of the viral
genome. These viruses could be in replicative or latent form. They
could stay either episomal or integrated in the host's genome.
[0187] The double stranded DNA genome viruses are well appropriate
to be treated by using meganuclases as defined in the present
invention. Among them are found the adenoviruses, the
herpesviruses, the hepadnaviruses, the papovaviruses, and the
poxviruses. Among the herpesviruses are found herpes simplex virus
(HSV), varicella virus (VZV), Epstein-Barr virus (EBV), cytomegalo
virus (CMV), herpes virus 6, 7 and 8. Among the hepadnaviruses are
found the human hepatitis B virus (HBV). Among the papovariruses
are found papillomavirus (HPV) (i.e. HPV16 or HPV18) and polyoma
virus. Among the adenoviruses are found adenovirus 11 and 21 which
are involved in acute hemorrhagic cystitis. Plants viruses are also
contemplated by the present invention.
[0188] The retroviruses are also well appropriate to be treated by
using meganucleases according to the present invention. Although
they are RNA viruses, they are integrated in the host genome as
double-stranded DNA form. Among the retroviruses are found the
human immunodeficiency virus (HIV) and the human T lymphoma virus
(HTLV) (i.e. HTLV1).
[0189] Several above-mentioned viruses are well-known to be
involved in carcinogenesis: EBV in Burkitt's lymphoma, other
lymphoproliferative disease and nasopharyngeal carcinoma; herpes
virus 8 in Kaposi sarcoma; HBV in hepatocellular carcinoma; HPV in
genital cancer; HTLV-1 in T-cell leukemia.
[0190] For episomal viruses, a double-strand break introduced in
its genome leads to the linearisation of the genome and its
degradation. Examples of episomal viruses are HSV-1, EBV, and HPV.
See example 3.
[0191] For integrated viruses, a double strand break introduced in
or near the integrated viral sequence leads to partial or complete
deletion of the integrated viral sequence. Examples of integrated
viruses are HPV, HTLV, HBV, and HIV. Several mechanisms could be
involved in the deletion. A double-strand break in a chromosome
induces a gene conversion with the homologous chromosome, therefore
leading to viral sequence deletion. If directed repeat sequences
are present near the double strand break, the break could also be
repaired by SSA (single strand annealing) leading to partial or
complete viral deletion. If two double-strand breaks are
introduced, then the chromosome could also be repaired by end
joining leading to partial or complete deletion of the virus,
depending on the positions of the double-strand breaks. See Example
5 in U.S. Pat. No. 5,948,678, the disclosure of which is
incorporated herein by reference.
[0192] To ensure that the targeted viral DNA sequences are not
present in the host's genome, such DNA target sequences should be
at least 15 nucleotides in length and preferably at least 18
nucleotides in length. As the homing endonuclease present a
recognition sequence spanning to 12-40 bp, this condition is
fulfilled with the custom-made meganucleases as defined in the
present invention. More particularly, I-Cre I homing endonuclease
has a 22 bp recognition sequence.
[0193] Any DNA sequence of viral genomes can be targeted for
cleavage by meganucleases as defined in the present invention.
Preferred target sites include those sequences that are conserved
between strains of virus and/or which genes are essential for virus
propagation or infectivity. These positions are preferable for at
least two reasons. First, essential parts of viruses are less
mutated than others. Secondly, it is preferably to target an
essential region of the virus to maximize the inactivation of the
virus.
[0194] A good target for the custom-made meganuclease could be the
viral origin of replication (ori) and/or the viral gene encoding an
ori binding protein. Examples of ori binding proteins include the
HSV-1 UL9 gene product, the VZV gene 51 product, the human
herpesvirus 6B CH6R gene product, the EBV EBNA-1 gene product and
the HPV E1 and E2 gene products. Other interesting targets for HPV
are the genes E6 and E7 as products of which are involved in the
initiation and maintenance of the proliferative and malignant
phenotype. A preferred target is the highly conserved 62
nucleotides sequence in the pre-core/core region of HPV (E6, E7).
Examples of interesting targets for EBV are the genes EBNA and LMP.
It could be interesting to target the gene Tax of HTLV-1 which
appears to mediate the oncogenic effects of the virus. For HBV, an
interesting target could be the X gene as the X protein interacts
with elements of the DNA repair system and may increase the
mutation rate of p53. For HIV, a preferred target is within TAT,
REV, or TAR genes. The viral targets are not limited to the
above-mentioned examples. Optionally, the target DNA could be
located in the viral repeated sequences such as ITR (Inverted
Terminal Repeat) and LTR (Long Terminal Repeat).
[0195] Preferably, at least two different targeted sites are used.
Indeed, as the main protection of the viruses is their ability to
mutate. Therefore, two targeted sites avoid the virus to escape the
treatment by using the custom-made meganucleases, according to the
present invention. Moreover, the successive use of different
custom-made meganucleases may avoid the adverse immunologic
response. Said different custom-made meganuclease can present
different initial meganucleases, therefore different
immunogenicities.
[0196] The treatment by custom-made meganucleases according to the
present invention can be applied either on cells, preferably cells
taken from the patient, or on the whole body of the patient, with
or without organ targeting.
[0197] In the case of cell therapy, cells are preferably taken from
a patient. These cells are treated by custom-made meganucleases
according te the present invention in order to inactivate oo delete
the virus. After the treatment, cells are reintroduced into the
patient. These cells will proliferate and repopulate infected
tissues. Preferably, said cells are stem cells, totipotent cells or
pluripotent cells. For example, stem cells could be hematopoietic,
neuronal, mesenchymal, embryonic, muscle-derived. Another examples
of cells are those which are able te regenerate such as the
hepatocytes. The treatment by custom-made meganucleases can be done
either by the introduction of meganucleases into cells or by the
transfection with an expression vector encoding said meganucleases.
The transfection can be transient or stable. A transient expression
of the custom-made meganuclease allows the cell to be cleaned up
from the virus. A stable transfection allows the cell to be cleaned
up from the virus and avoids a further infection of the treated
cells by the targeted virus.
[0198] In the case of a whole therapy, custom-made meganucleases
according ta the present invention or expression vector encoding
said meganucleases are introduced into the individual by any
convenient mean. When the custom-made meganucleases are introduced
or expressed into the infected cells, the virus is inactivated
and/or deleted. The custom-made meganuclease treatment has no
functional impact on healthy cells.
[0199] Similarly, such cell or whole antiviral therapy based on the
use of at least one custom-made meganuclease could be used to treat
cells or organs of an animal dedicated to xenotransplantation. The
effectiveness of a meganuclease to inhibit viral propagation and
infection is preferably assessed by in vitro and in vivo assays of
infection. Such assays can be carried out first in cell culture to
establish the potential of different meganucleases to cleave a
viral DNA in a way that deleteriously affects viral propagation.
Preliminary studies of this type are followed by studies in
appropriate animal models. Finally, clinical studies will be
carried out.
[0200] Different viruses require different assay systems, since
hosts and culture conditions suitable to different viruses vary
greatly. However, such appropriate conditions have been described
for culturing many viruses and these conditions can be used to test
the effect of exposing virus and/or host to meganucleases to
determine the ability of the endonuclease to inhibit viral
infection. For one discussion of culture conditions for specific
viruses see Chapter 17 in Fields and Knipe, Eds., FIELDS VIROLOGY,
2nd Ed., Raven Press, N.Y. (1990).
[0201] A host and/or virus can be exposed at various times during a
course of infection, under varying conditions, in several amounts,
and in a variety of vehicles, to mention just a few relevant
parameters that can be varied, to assess the potential of
meganuclease to achieve a potentially therapeutic effect.
[0202] In addition, in order to tests ex vivo in cultured cells,
potential therapeutical meganuclease can be tested in animal models
to assess prophylactic, ameliorative, therapeutic and/or curative
potential, either alone or in conjunction with other therapeutic
agents. In some cases, it will not be possible to culture a virus
and it will be necessary to perform all biological assays in animal
models. It will be readily appreciated that different animal models
will be appropriate to different viruses. Any animal model,
however, can be used to assess the therapeutic potential of a
meganuclease.
[0203] A potentially effective dose of the assayed meganucleases
may be administered to a suitable population of animals, and the
effect of the meganucleases on the course of a viral infection may
be assessed by comparison with an appropriate control. Such methods
for assessing pharmacological effect are well known in the art and
can readily be adapted to determining the therapeutic profile of
the meganucleases.
[0204] In one embodiment of the uses according to the present
invention, the meganuclease is substantially non-immunogenic, i.e.,
engender little or no adverse immunological response. A variety of
methods for ameliorating or eliminating deleterious immunological
reactions of this sort can be used in accordance with the
invention. In a preferred embodiment, the meganuclease is
substantially free of N-formyl methionine. Another way to avoid
unwanted immunological reactions is to conjugate meganucleases to
polyethylene glycol ("PEG") or polypropylene glycol ("PPG")
(preferably of 500 to 20,000 daltons average molecular weight
(MW)). Conjugation with PEG or PPG, as described by Davis et al.,
(U.S. Pat. No. 4,179,337) for example, can provide non-immunogenic,
physiologically active, water soluble endonuclease conjugates with
anti-viral activity. Similar methods also using a
polyethylene-polypropylene glycol copolymer are described in Saifer
et al. (U.S. Pat. No. 5,006,333).
[0205] Custom-made meganuclease according to the present invention
can be introduced into cells using liposomes or by fusion to the
membrane translocating peptides (Bonetta 2002, The Scientist, 16,
38; Ford et al, Gene Ther, 2001, 8, 1-4; Wadia & Dowdy Curr
Opin Biotechnol, 13, 52-56). Otherwise, meganucleases can be stably
or transiently expressed into cells using expression vectors.
Techniques of expression in eukaryotic cells are well known to
those in the art. (See Current Protocols in Human Genetics: Chapter
12 "Vectors For Gene Therapy" & Chapter 13 "Delivery Systems
for Gene Therapy"). Optionally, it may be preferable to incorporate
a nuclear localization signal into the recombinant protein to be
sure that it is expressed within the nucleus.
[0206] Typically, for therapeutic applications, the custom-made
meganucleases will be combined with a pharmaceutically acceptable
excipient appropriate to a planned route of administration. A
variety of pharmaceutically acceptable excipients are well known,
from which those that are effective for delivering meganucleases to
a site af infection may be selected. The HANDBOOK OF PHARMACEUTICAL
EXCIPIENTS published by the American Pharmaceutical Association is
one useful guide to appropriate excipients for use in the
invention. A composition is said ta be a "pharmaceutically
acceptable excipient" if its administration can be tolerated by the
recipient. Sterile phosphate-buffered saline is one example of a
pharmaceutically acceptable excipient that is appropriate for
intravenous administration.
[0207] For purposes of therapy, the custom-made meganucleases and a
pharmaceutically acceptable excipient are administered in a
therapeutically effective amount. Said composition can comprise
either one kind of custom-made meganuclease or several custom-made
meganucleases with different specificity. Such a combination is
said to be administered in a "therapeutically effective amount" if
the amount administered is physioiogically significant. An agent is
physiologically significant if its presence results in a detectable
change in the physiology of the recipient. In the present context,
an agent is physiologically significant if its presence results in
a decrease in the severity of one or more symptoms of a viral
illness.
[0208] Administration may be topical or internal or other suitable
avenue for introducing a therapeutic agent to a patient. Topical
administration may be by application to the skin, or to the eyes,
ears or nose. Internal administration may proceed intradermally,
subcutaneously, intraperitoneally, intraarterially or
intravenously, or by any other suitable route. It also may in some
cases be advantageous to administer a composition of the invention
by oral ingestion, by respiration, rectally, or vaginally. For a
brief review of pharmaceutical dosage forms and their use, see
PHARMACEUTICAL DOSAGE FORMS AND THEIR USE (1985) (Hans Huber
Publishers, Berne, Switzerland).
[0209] For topical and internal therapeutic applications,
custom-made meganucleases according to the present invention can be
formulated using any suitable pharmacological technique. For
instance, the meganucleases can be formulated for prolonged
release. As described hereinabove, persistence of anti-viral
activity of the meganucteases may be increased or modulated by
incorporating the meganucleases into liposomes.
[0210] Additionally, the method described in the present invention
could be used to modify the physico-chemical properties of
meganucleases. For example, said method could be used to change the
sensitivity of a meganuclease to temperature, pH or salt
concentration (e.g. in order to decrease or increase the level at
which activity is highest or to enhance the activity at a chosen
level), as well as its solubility or stability, or its reaction
turnover. Eventually, the method described in the present invention
could also be used to relax or strengthen the specificity of given
meganucleases for preferred DNA sequence targets.
[0211] The present invention will be further illustrated by the
additional description and drawings which follows, which refers to
examples illustrating the method to produce a custom-made according
to the invention and the use thereof for antiviral therapy and gene
therapy. It should be understood however that these examples are
given only by way of illustration of the invention and do not
constitute in anyway a limitation thereof.
[0212] FIG. 1 discloses the amino acid sequence of a single chain
I-Cre I meganuclease and one polynucleotide encoding said single
chain meganuclease. In the protein sequence, the two first
N-terminal residues are methionine and alanine (MA), and the three
C-terminal residues alanine, alanine and aspartic acid (AAD). These
sequences allow having DNA coding sequences comprising the NcoI
(CCATGG) and EagI (CGGCCG) restriction sites, which are used for
cloning into various vectors.
[0213] FIG. 2 discloses polynucleotide sequences. FIG. 2A discloses
a polynucleotide called "Natural" encoding the I-Cre I homing
endonuclease. FIG. 2B discloses a polynucleotide sequence called
"Non homologous" encoding the I-Cre I homing endonuclease. FIG. 2C
discloses a polynucleotide sequence called "Template" encoding the
I-Cre I homing endonuclease comprising the mutation D75NJ. Each
I-Cre I homing endonuclease has two additional amino acids (MA) at
the N terminal end and three additional amino acids (AAD) at the
C-terminal ends. FIG. 2D discloses the polynucleotide sequences of
the primers, called UlibIfor, UlibIrev, UlibIIfor, and UlibIIrev,
used for the generation of the libraries UlibI and UlibII.
[0214] FIG. 3 is a schematic representation of the polynucleotide
sequence called "Template" encoding the I-Cre I homing endonuclease
comprising the mutation D75N. The dark arrows indicate the position
of the primers UlibIfor, UlibIrev, UlibIIfor, and UlibIIrev used to
generate the two libraries UlibI and UliblII. D-Helix refers to the
LAGLIDADG helix. N75 refers to the mutation D75N.
[0215] FIG. 4 is a schematic representation of the strategy for the
library construction. Step 1: pET24C-T is a plasmid comprising a
polynucleotide <<Template>>. Two PCR amplifications,
PCR ulib1 and ulib2, are done with either UlibIfor and UlibIIrev,
or UliblIfor and UliblIIrev. The PCR ulib1 products are cloned in a
phagemid pCes4 NHT. The PCR ulib2 products are cloned in a plasmid
pET24C-T. Step 2: Subcloning a fragment of Ulib2 vector
(pET45C-Ulib2) into the Ulib1 phagemid (pCes4-Ulib1).
[0216] FIG. 5: COS cells monolayers were transfected with vector
expressing I Sce-I (B) or with control plasmid (A). Fourty eight
(48) hours after transfection cells were infected with rHSV-1 (30
PFU). Two days later monolayer was fixed and stained (X-Gal).
Infected cells appeared in blue.
[0217] FIG. 6: FIG. 6A: cells monolayer was infected with 30 PFU.
HSV-1 growth was quantified by B-galactosidase activity in cell
lysate. FIG. 6B, cell monolayer was infected with 300 PFU. Cell
survival was measured by protein determination in cell lysate.
I-Sce I refers to vector expressing I-Sce I; I-Sce I(-) refers to a
vector in which ORF of I Sce-I was inserted in reverse orientation;
negative control refers to control plasmid.
[0218] FIG. 7: FIG. 7A is a schematic representation of recombinant
HSV-1 genomic DNA. Cassette containing CMV promoter driving Lac
gene was inserted in the major LAT transcript. I-Sce I restriction
site was cloned between promoter and reporter gene a and b
represent primers used for the semi-quantitative PCR. COS-7
monolayers were transfected with vector expressing I-Sce I or with
control plasmids. Fourty eight hours after transfection cells were
infected with rHSV-1 (30 PFU). DNA was extracted 1, 2 or 3 days
after infection. PCR was carried out as described in
<<experimental procedures>>. Std refers to Internal
standard; Lac refers to an amplicon of the rHSV-1 Lac gene. I-Sce I
refers to vector expressing I-Sce I; I-Sce I(-) refers to a vector
in which ORF of I-Sce I was inserted in reverse orientation;
negative control refers to control plasmid. FIG. 7B, PCR
quantification of the viral thymidine kinase (TK) gene. PCR was
carried out at 2 DNA concentrations. ISce-I refers to vector
expressing I-Sce I; I-Sce I(-) refers to a vector in which ORF of
I-Sce I was inserted in reverse orientation; negative control
refers to control plasmid.
[0219] FIG. 8 illustrates the titration of the virus released in
the medium after infection of the transfected cells. Every day,
medium was collected and fresh medium was added. Viruses were
measured by standard plaque assay. I-Sce I refers to vector
expressing I-SceI; I-Sce I(-) refers to a vector in which ORF of
I-Sce I was inserted in reverse orientation; negative control
refers to control plasmid.
[0220] FIG. 9 represents the I-CreI DNA target and five related
targets. Conserved positions are in grey boxes.
[0221] FIG. 10 illustrates four binding patterns obtained after
screening of the Lib2 library with six targets. Positives were
identified in a first screen and confirmed in a second one during
which they were assayed eight times (corresponding to the eight
solid bars) on each of the targets (C1234, C1221, C4334, H1234,
H1221 and H4334). Histograms are shown for one clone from each
class. Targets are described in FIG. 9.
[0222] FIG. 11 illustrates the schematic representation of the
target vectors. The CpG depleted LacZ gene (LagoZ) is driven by the
human elongation factor I alpha promoter. The LagoZ gene is
inactivated by the insertion of I-SceI cleavage site. Flanking
repeats are represented by open arrows. The length of the
homologous sequences are indicated in bold.
[0223] FIG. 12 illustrates the effect of the length of homology on
single strand annealing (SSA) efficiency. Cells monolayers were
transfected with equimolar amounts of target plasmid bearing
different lengths of homologous repeat sequences and vector
expressing ISce-I or with control plasmid. Seventy-two hours after
transfection cells were collected and .beta.-galactosidase activity
was quantified in cell lysates. (+)I-SceI, cotransfection with
vector expressing I-SceI; (-)I-SceI, cotransfection with expression
vector where the ORF of I-SceI was inserted in the reverse
orientation.
[0224] FIG. 13: Cell monolayers were cotransfected with a vector
expressing (+)I-SceI or with a control plasmid (-)I-SceI.
Seventy-two hours after transfection cells were fixed and stained
(X-Gal). FIG. 13A: cells where gene repair took place appeared in
dark. FIG. 13B: frequency of I-SceI induced recombination on 70 and
220 bp duplication target vectors. The frequency is calculated by
the ratio of blue cells/transfected cells.
[0225] FIG. 14A: X-Gal staining of liver from mice injected with a
mixture of the target LagoZ gene (30 .mu.g) and an I-SceI
expression vector (10 .mu.g). FIG. 14B: X-Gal staining of liver
from mice injected with a mixture of the target LagoZ gene (30
.mu.g) and an expression vector where the ORF of I-SceI was
inserted in the reverse orientation (10 .mu.g).
[0226] FIG. 15: X-Gal staining of the liver of hemizygote
transgenic mice of two independent strains infected with the
<<Ad.I-SceI>> adenovirus by IV. A. Five days
post-infection, .beta.-galactosidase activity is detected in
multiple cells of the entire liver of 10.sup.10 infectious units
infected <<58A>> hemizygote. In contrast, no
.beta.-galactosidase activity could be detected by X-Gal staining
of the livers of <<Ad.control>>-infected hemizygote or
un-infected <<58A>> littermates (data not shown). B.
and C. Fourteen days post-infection, .beta.-galactosidase activity
is detected in multiple cells of the entire liver of 10.sup.9
infectious units infected mouse (B) and 10.sup.10 infectious units
infected mouse (C). Stronger signal is detected in C compared to B,
probably because of the bigger number of cells that were infected
with the <<(Ad.I-SceI>>. In contrast, no
.beta.-galactosidase activity could be detected by X-Gal staining
of the livers of un-infected <<361>> littermates (data
not shown).
[0227] FIG. 16: Fluorescent .beta.-galactosidase assay on liver
extract. Two independent strains of transgenic mice (58 A and 361)
were injected with 10.sup.9 or 10.sup.10 PFU of adenovirus
expressing I-SceI (Ad.I-SceI) or control virus (Ad.control). Mice
were sacrified 5 or 14 days post injection, liver was dissected and
proteins were extracted. 30 .mu.l of liver protein extract were
incubated at 37.degree. C. in presence of Fluorescein digalactoside
(FDG). Bars represent the standard deviation of the assay (two
measure experiments with samples of the same extracts). NI, non
injected mice; Ad.I-SceI, mice injected with adenovirus expressing
I-SceI; Ad.control, mice injected with control adenovirus.
EXAMPLE 1
Single Chain Meganuclease Derived from Dimeric Homing
Endonucleases
[0228] Some LAGLIDADG homing endonucleases are active as homodimer.
Each monomer mainly dimerizes through their dodecapeptide motifs. A
single-chain meganuclease can be engineered by covalently binding
two monomers modified such as to introduce a covalent link between
the two sub-units of this enzyme. Preferably, the covalent link is
introduced by creating a peptide bond between the two monomers.
However, other convenient covalent links are also contemplated. The
single-chain meganuclease preferably comprises two subunits from
the same homing endonuclease such as single-chain I-Cre I and
single-chain I-Ceu I. A single-chain meganuclease has multiple
advantages. For example, a single-chain meganuclease is easier to
manipulate. The single-chain meganuclease is thermo-dynamically
favored, for example for the recognition of the target sequence,
compared to a dimer formation. The single-chain meganuclease allows
the control of the oligomerisation.
[0229] A single chain version of I-CreI (scI-CreI) was modeled and
engineered. scI-CreI cleaves its cognate DNA substrate in vitro and
induces homologous recombination both in yeast and mammalian
cells.
--Design of the Single Chain I-CreI Meganuclease
[0230] I-CreI from Chlamydomonas reinhardtii is a small LAGLIDADG
homing endonuclease that dimerizes into a structure similar to that
of larger monomer LAGLIDADG homing endonuclease. To engineer a
single chain version of I-CreI (scI-CreI), two I-CreI copies were
fused. This required placing a linker region between the two
domains, and a significant part of the I-CreI protein had to be
removed at the end of the domain preceding the linker.
[0231] The three-dimensional structure of I-DmoI is comparable to
that of I-CreI, with the exception that I-DmoI comprises a linker
region that leads from one apparent domain to the other. The
boundary of that linker finely matches related main chain atoms of
the I-CreI dimer. In the first domain, residues 93 to 95 from the
third .alpha.-helices of I-CreI and I-DmoI (prior to the linker)
are structurally equivalent. At the beginning of the second
LAGLIDADG .alpha.-helix (second domain), I-DmoI residues 104 to 106
correspond to I-CreI residues 7 to 9. In addition, Leu95 and Glu105
from I-DmoI have conserved identities in I-CreI, and I-DmoI residue
Arg104 aligns with another basic residue in I-CreI (Lys7). Thus,
the single chain I-CreI (scI-CreI), was designed by inserting the
I-DmoI linker region from residue 94 to 104 (sequence MLERIRLFNMR)
between a first I-CreI domain (terminated at Pro93) and a second
I-CreI domain (starting at Glu8).
[0232] Detailed structural analysis of how the new linker connects
the scI-CreI protein domains (in a modeled structure) revealed no
potential incompatibility. For example, the side chains of nonpolar
amino acids taken from I-DmoI, Met94, Ile98 and Phe109 point inside
fitting cavities of I-CreI. A single mutation was made (P93A),
however, to promote regularity of the backbone in the .alpha.-helix
prior to the linker region. (See FIG. 1 for amino acids and
polynucleotide sequences).
--Materials and Methods
Protein Expression and Purification
[0233] His-tagged proteins were over-expressed in E. coli BL21
(DE3) cells using pET-24d (+) vectors (Novagen). Induction with
IPTG (1 mM), was performed at 25.degree. C. Cells were sonicated in
a solution of 25 mM HEPES (pH 8) containing protease inhibitors
(Complete EDTA-free tablets, Roche) and 5% (v/v) glycerol. Cell
lysates were centrifuged twice (15 000 g for 30 min). His-tagged
proteins were then affinity-purified, using 5 ml Hi-Trap chelating
columns (Amersham) loaded with cobalt. Several fractions were
collected during elution with a linear gradient of immidazole (up
to 0.25M immidazole, followed by plateau at 0.5M immidazole and
0.5M NaCl). Protein-rich fractions (determined by SDS-PAGE) were
concentrated with a 10 kDa cut-off centriprep Amicon system. The
resulting sample was eventually purified by exclusion
chromatography on a Superdex75 PG Hi-Load 26-60 column (Amersham).
Fractions collected were submitted to SDS-PAGE. Selected protein
fractions concentrated and dialyzed against a solution of 25 mM
HEPES (pH 7.5) and 20% (v/v) glycerol.
In Vitro Cleavage Assays
[0234] pGEM plasmids with single meganuclease DNA target cut sites
were first linearized with XmnI. Cleavage assays were performed at
37.degree. C. or 65.degree. C. in 12.5 mM HEPES (pH 8), 2.5% (v/v)
glycerol and 10 mM MgCl2. Reactions were stopped by addition of 0.1
volume of 0.1 M Tris-HCl (pH 7.5), 0.25 M EDTA, 5% (w/v) SDS, and
0.5 mg/ml proteinase K and incubation at 37.degree. C. for 20
minutes. Reaction products were examined following separation by
electrophoresis in 1% agarose gels.
Yeast Calorimetric Assay
[0235] The yeast transformation method has been adapted from
previous protocols. For staining, a classic qualitative X-Gal
Agarose Overlay Assay was used. Each plate was covered with 2.5 ml
of 1% agarose in 0.1 M Sodium Phosphate buffer, pH 7.0, 0.2% SDS,
12% Dimethyl Formamide (DMF), 14 mM .beta.-mercaptoethanol, 0.4%
X-Gal, at 60.degree.. Plates were incubated at 37.degree. C.
Mammalian Cells Assays
[0236] COS cells were transfected with Superfect transfection
reagent accordingly to the supplier (Qiagen) protocol. 72 hours
after transfection, cells were rinsed twice with PBS1X and
incubated in lysis buffer (Tris-HCl 10 mM pH7.5, NaCl 150 mM,
Triton X100 0.1%, BSA 0.1 mg/ml, protease inhibitors). Lysate was
centrifuged and the supernatant used for protein concentration
determination and .beta.-galactosidase liquid assay. Typically, 30
.mu.l of extract were combined with 3 .mu.l Mg 100.times. buffer
(MgCl.sub.2 100 mM, .beta.-mercaptoethanol 35%), 33 .mu.l ONPG 8
mg/ml and 234 .mu.l sodium phosphate 0.1M pH7.5. After incubation
at 37.degree. C., the reaction was stopped with 500 .mu.l of 1M
Na.sub.2CO.sub.3 and OD was measured at 415 nm. The relative
.beta.-galactosidase activity is determined as a function of this
OD, normalized by the reaction time, and the total protein
quantity.
--Results: Single Chain I-CreI Cleaves its DNA Substrate in Vitro
and in Living Cells
[0237] A synthetic gene corresponding to the new enzyme was
engineered and the scI-CreI protein over-expressed in E. coli. The
ability of purified scI-CreI to cleave DNA substrates in vitro was
tested, using linearized plasmids bearing a copy of the I-CreI
homing site. Similarly to parent I-CreI, the novel enzyme cleaves
an I-CreI target site at 37.degree. C.
[0238] In order to test the functionality of scI-CreI in vivo, an
assay to monitor meganuclease-induced homologous recombination in
yeast and mammalian cells was designed. In yeast, Xenopus oocytes
and mammalian cells, DNA cleavage between two direct repeats is
known to induce a very high level of homologous recombination
between the repeats. The recombination pathway, often referred to
as Single-Strand Annealing (SSA), removes one repeat unit and all
intervening sequences. Thus, a SSA reporter vector, with two
truncated, non-functional copies of the bacterial LacZ gene and an
I-CreI cut site within the intervening sequence was constructed in
a yeast replicative plasmid. Cleavage of the cut site should result
in a unique, functional LacZ copy that can be easily detected by
X-gal staining.
[0239] The reporter vector was used to transform yeast cells. A
small fraction of cells appeared to express functional LacZ,
probably due to recombination events during transformation.
Co-transformation with plasmids expressing either I-CreI or
scI-CreI, in contrast, resulted in blue staining for all plated
cells. Even in non-induced conditions (glucose), the residual level
of protein was enough to induce SSA, suggesting that scI-CreI, as
much as I-CreI, is highly efficient in yeast cells. Furthermore,
SSA induction was truly dependent on cleavage of the target cut
site by I-CreI proteins, as vectors devoid of that site display no
increase in .beta.-galactosidase activity compared to background
levels.
[0240] The SSA assay was modified for tests in mammalian cells. The
promoter and termination sequences of the reporter and meganuclease
expression plasmid were changed, and plasmid recombination was
evaluated in a transient transfection assay. Similar levels of
induced recombination (2 to 3-fold increase) were observed with
either scI-CreI or I-CreI. As in the yeast experiment,
recombination depends on an I-CreI cut site between the repeats,
for no increase of the .beta.-galactosidase was observed in the
absence of this site.
[0241] Another recombination assay, based on recombination between
inverted repeats, was also used to monitor meganuclease-induced
recombination in COS cells. As direct repeats can recombine by SSA,
homologous recombination between indirect repeats requires a gene
conversion event. Similar stimulation of gene conversion (3 to
4-fold) was observed with either scI-CreI or I-CreI. As expected
for a true homologous recombination event, no enhancement was
observed in the absence of an homologous donor template.
EXAMPLE 2
Custom-Made Meganuclease Derived from I-Cre I Homing Endonuclease
for HIV-2 Target
--Construction of a Phage-Displayed Library of I-Cre I Variants
[0242] In order to engineer new meganuclease with altered
specificities, a combinatorial library was constructed by
mutagenesis of the I-Cre I homing endonuclease replacing DNA
binding residues. Selection and screening applications then enabled
to find those variants that were able to bind a particular, chosen
DNA target. For phage display, as I-Cre I is a homodimer, a
phagemid vector was required that encoded two separate I-Cre I
proteins. Only one of the two I-Cre I copies, which was fused to
the phage coat protein p3, was mutated. The resulting protein
library, in phage display format, comprised thus I-Cre I
wild-type/mutant heterodimers. Eight residues (Q26, K28, N30, Y33,
Q38, Q44, R68 and R70) capable together of specific interactions
with most of the bases in a single hal-site within the DNA target
were selected. Our combinatorial library was obtained by replacing
the eight corresponding codons with a unique degenerated VVK codon.
Eventually, mutants in the protein library corresponded to
independant combinations of any of the 12 amino acids encoded by
the VVK codon (ADEGHKNPQRST) at eight residue positions. In
consequence, the maximal (theoretical) diversity of the protein
library was 12.sup.8 or 4.29.times.10.sup.8.
--Construction of the Library
[0243] First, residue D75, which is shielded from solvent by R68
and R70, was mutated to N (Asn) in order to remove the likely
energetic strain caused by replacements of those two basic residues
in the library. Homodimers of mutant D75N (purified from E. coli
cells wherein it was over-expressed using a pET expression vector)
were shown to cleave the I-CreI homing site. A phagemid vector was
then engineered that encodes wild-type I-CreI (FIG. 2A and 2B:
<<Natural>> or <<Non homologous>>) and the
D75N mutant (FIG. 2C: <<Template>>) fused to the phage
coat protein p3 and phage-displayed wild-type/D75N heterodimers
were shown to bind that target DNA.
[0244] Second, two intermediate libraries of moderate size have
been built: Lib1 (residues 26, 28, 30, 33 and 38 mutated;
theoretical diversity 12.sup.5 or 2.48.times.10.sup.5) and Lib2
(residues 44, 68 and 70 mutated; theoretical diversity 12.sup.3 or
1.7.times.10.sup.3). DNA fragments carrying combinations of the
desired mutations were obtained by PCR (several reactions in 50
.mu.l), using degenerated primers (FIG. 2D: Uliblfor, Uliblrev,
Ulibllfor, Ulibllrev) and as DNA template, the D75N gene. Lib1 and
Lib2 were constructed by ligation of the corresponding PCR
products, digested with specific restriction enzymes, into the D75N
mutant gene, within the phagemid vector and within the pET
expression vector, respectively. Digestions of vectors and inserts
DNA were conducted in two steps (single enzyme digestions) between
which the DNA sample was extracted
(phenol:chloroform:isoamylalcohol) and EtOH-precipitated. 10 .mu.g
of digested vector DNA were used for ligations, with a 5:1 excess
of insert DNA. E. coli TG1 cells were transformed with the
resulting vectors by electroporation. To produce a number of cell
clones above the theoretical diversity of either library, up to 35
electroporations of the Lib1 ligation samples and 4
electroporations of the Lib2 ligation samples were necessary.
4.times.10.sup.6 (16 times the maximal diversity) and
6.times.10.sup.4 (35 times the diversity) clones were thus obtained
for Lib1 and Lib2, respectively (these numbers were corrected by
the number of clones obtained using ligations done without
inserts).
[0245] Finally, Lib1 and Lib2 bacterial clones were scraped from
plates and the corresponding plasmid vectors were extracted and
purified. The complete library was then obtained by sub-cloning a
fragment of the Lib2 vector into the Lib1 phagemid vector (see FIG.
4 for a schematic diagram of the library construction). Several
rounds of DNA 2-step digestions, dephosphorylation, purification,
quantification, ligation and electroporation were performed. After
4 rounds of 150 electroporation shots (which corresponds to 12
ligations of 1.4 .mu.g vector with 0.4 .mu.g insert),
5.5.times.10.sup.7 bacterial clones were obtained (after correction
for background). Bacteria were scraped and stored as a glycerol
stock. In addition, an aliquot of this glycerol stock was used to
inoculate a 200 ml culture and the library vector was extracted and
purified from this culture for storage or potential subcloning.
--Material and Methods
Protein Expression and Purification
[0246] His-tagged proteins were over-expressed in E. coli BL21
(DE3) cells using pET 24d (+) vectors (Novagen). Induction with
IPTG (1 mM), was performed at 15.degree. C. over 5 night. Cells
were cracked for 1 h at 4.degree. C. in a B-Per solution (Bacterial
Protein Extraction Reagent, Pierce, 5 ml for 200 ml culture cell),
containing protease inhibitors (Complete EDTA-free tablets, Roche)
and DNase I (80 units)/nuclease (respectively 80 and 60 units,
Roche). Alternatively, cells were sonicated in a solution of 25 mM
HEPES (pH 8) containing protease inhibitors (Complete EDTA-free
tablets, Roche) and 5% (v/v) glycerol.
[0247] Cell lysates were centrifuged twice (15 000 g for 30 min).
His-tagged proteins were then affinity-purified, using 1 ml Hi-Trap
chelating columns (Amersham) loaded with cobalt. Several fractions
were collected during elution with a linear gradient of immidazole
(up to 0.25 M immidazole, followed by plateau at 0.5 M immidazole
and 0.5 M NaCl). Protein-rich fractions (determined by SDS-PAGE)
were concentrated with a 10 kDa cut-off centriprep Amicon system.
The resulting sample was eventually purified by exclusion
chromatography on a Superdex75 PG Hi-Load 26-60 column
(Amersham).
[0248] Fractions collected were submitted to SDS-PAGE. Selected
protein fractions concentrated and dialyzed against a solution of
25 MM HEPES (pH 7.5) and 20% (v/v) glycerol.
In Vitro Cleavage Assay
[0249] pGEM plasmids with single meganuclease DNA target cut sites
were first linearized with XmnI. Cleavage assays were performed at
37.degree. C. in 12.5 mM HEPES (pH 8), 2.5% (v/v) glycerol and 10
mM MgCl.sub.2. Reactions were stopped by addition of 0.1 volume of
0.1 M Tris-HCl (pH 7.5), 0.25 M EDTA, 5% (w/v) SDS, and 0.5 mg/ml
proteinase K and incubation at 37.degree. C. for 20 minutes.
Reaction products were examined following separation by
electrophoresis in 1% agarose gels.
Phagemid Construction
[0250] Phage Display of I-Cre I/D75N heterodimer was obtained by
using a phagemid harboring two different ORFs as a bicistron, under
the control of promoter pLac. The first one yields a soluble
protein fused to a N-terminal signal sequence directing the product
into the periplasmic space of E. coli Gene 1-Cre I WT was cloned
into this ORF using restriction enzymes ApaLI and AscI. The D75N
domain was cloned into the second ORF using Nco I and Eag I
restriction enzyme, leading to a fusion with the phage coat protein
p3 via a hexahis tag, a C-Myc tag and an amber stop codon. This
final phagemid was called pCes1CreT. In a suppressive strain like
TG1 or XL1blue, and after infection by a helper phage (e.g.
M13K07), D75N-p3 fusions are incorporated in the phage coat and the
soluble I-CreI mononers produced in the same compartment will
either dimerize or interact with the displayed D75N domain, thereby
producing particles displaying I-CreI WT/D75N heterodimer.
Phase Production
[0251] A 5 mL culture of 2.times.TY containing 100 .mu.g/ml of
ampicillin and 2% glucose was inoculated with a 1/100 dilution of
an overnight culture of bacteria containing phagemid pCes1CreT and
agitated at 37.degree. C. At an OD.sub.600 of 0.5, phage helper
M13K07 (Pharmacia) was added at a ratio phage:bacteria of 20:1.
After 30 min at 37.degree. C. without agitation, the culture was
centrifuged for 10 min at 4000 rpm and the pellet was resuspended
in 25 ml of 2.times.TY containing 100 .mu.g/mL Ampicillin and 25
.mu.g/mL Kanamycin, and agitated overnight at 30.degree. C.
Cultures were centrifuged and supernatant were used as such in
phage ELISA.
PhageELISA
[0252] Microtiter plates were coated for 1 h at 37.degree. C. with
100 .mu.l/well of biotinylated BSA at 2 .mu.g/mL in PBS. After
several washes in PBS containing 0.1% Tween20 (PBST), wells were
incubated with 100 .mu.l/well of streptavidin at 10 .mu.g/mL in PBS
and incubated for 1 h at RT. Plates were further washed and
incubated with biotinylated PCR fragments harboring the target
site, at 250 pM in PBS. After 1 h incubation at RT and washing,
plates were saturated with 200 .mu.l/well of PBS containing 3%
powder milk and 25 mM CaCl.sub.2 (PMC). PMC was discarded and
plates were filled with 80 .mu.l of PMC and 20 .mu.l/well of
culture supernatant containing the phage particles. After 1 h of
incubation at RT, plates were extensively washed with PBST and
incubated with 100 .mu.l/well of anti 25 M13-HRP conjugated
antibody (Pharmacia) diluted 1/5000 in PMC. Plates were incubated
for 1 h at RT, washed and incubated with TMB solution (Sigma). The
reaction was blocked with 50 .mu.l/well of 1M H.sub.2SO.sub.4.
Plates were read at 450 nm. A signal higher than 3.times. the
background (irrelevant target) can be considered as positive.
PCR-Based Mutagenesis
[0253] Plasmid pET24-T45 containing the gene I-CreI D75N was
diluted at 1 ng/.mu.l to be used as template for PCR. Degenerated
oligonucleotides encoding the desired randomizations were used to
amplify PCR fragments Lib1 and Lib2 in 4.times.50 .mu.l PCR
reactions per inserts. PCR products were pooled, EtOH precipitated
and resuspended in 50 .mu.l 10 mM Tris.
DNA Digestions
[0254] All enzymes and the corresponding buffers were from
NEBiolabs. Digestions of up to 10 .mu.g DNA were realised using up
to 100 U of a first restriction enzyme, at 37.degree. C., in 150 or
500 .mu.l final reaction volume. After 2 h to 6 h, digested DNA was
phenol extracted and EtOH precipitated. Digestion substrates and
products were separated using agarose gel electrophoresis, the
desired product being extracted from the gel and purified
(Nucleospin Extract, Macherey-Nagel). For PCR inserts, digestions
were directly purified on Nucleospin columns. The second digestion
was then performed in identical conditions. At the end of this
second digestion reaction, 0.1 volume of 1 O.times. CAP buffer and
0.5 .mu.l of CAP were added to the digested vectors, and the
samples were further incubated for 30 min at 37.degree. C. (The
alkaline phosphatase was inactivated by incubating the sample 10
min at 70.degree. C., after addition of EDTA). Eventually, the
digested and de-phosphorylated DNA was phenol extracted, EtOH
precipitated and resuspended in 30 .mu.l of 10 mM Tris pH8. Final
DNA concentrations were estimated by comparison of band intensities
in agarose gels after electrophoresis.
Ligations
[0255] Large-scale ligations were done at 16.degree. C. (for 16 h)
using 1400 ng of digested vector and a 5:1 molar excess of digested
in 200 .mu.l reaction volumes and with 4000 U of T4 DNA ligase
(NEBiolabs). After ligation, reaction samples were incubated for 20
min at 65.degree. C. to inactivate the ligase. The vector DNA was
eventually EtOH precipitated and resuspended at 25 ng/.mu.l in 10
mM Tris pH8.
Electroporations
[0256] 40 .mu.l of homemade electrocompetent cells TG1 were mixed
with 25 ng of ligated DNA (1 .mu.l) in a 2 mm cuvette. After 1 min
on ice, cells were pulsed (2.5 Kv, 25 .mu.F, 200 Ohm) and
immediately resuspended in 1 ml of 2.times.TY+2% glucose. Cells
were placed at 37.degree. C. for 1 h with agitation, and then
plated on large 2.times.TY plates containing ampicillin (phagemid
vector) or kanamycin (pET vector) and 2% glucose and incubated
overnight at 30.degree. C. Aliquots were also diluted in 2.times.TY
and plates on small 2.times.TY Ampicillin glucose plates to obtain
isolated colonies allowing the calculation of library diversities
and characterization of several clones by restriction analysis.
--Selection and Screening of Meganuclease Binding to a HIV2-Derived
DNA Target from a Library of I-Cre I Variant Using Phage
Display
[0257] The goal of this project was to obtain a meganuclease
capable of cutting a sequence found in the genome of HIV2
(GGAAGAAGCCTTAAGACATTTTGA). The homing endonuclease I-Cre I was
used as a scaffold to build a library of 10.sup.8 variants by
randomizing 8 residues located at the DNA-binding interface of one
I-Cre I monomer (see previous section). This library was enriched
for binders by several rounds of selection/amplification using
biotinylated DNA fragments harboring the HIV2 derived target
(H1V6335). The selected targets were subsequently screened for
binding using a phage ELISA.
--Materials and Methods
Phagemid Format
[0258] A phagemid based on pCes1 (pCLS346) was chosen. This plasmid
harbored two different ORFs as a bicistron, under the control of
promoter pLac. The first one yielded a soluble protein fused to a
N-terminal signal sequence directing the product into the
periplasmic space of E. coli. In our case, this first product was a
wild-type monomer of I-CreI. The second ORF encoded an I-CreI
monomer that was fused to the phage coat protein p3 via a hexahis
tag, a C-Myc tag and an amber stop codon. In a suppressive strain
like TG1 or XL1blue, and after infection by a helper phage (e.g.
M13K07), bacteria harboring this phagemid produces phage particles
and around 1-10% of them displays the recombinant protein on their
surface.
[0259] The monomer fused to p3 and randomized on the DNA-binding
interface was incorporated in the phage coat and the soluble I-CreI
monomers produced in the same compartment either dimerize or
interact with the displayed monomer, thereby producing particles
displaying I-CreI homodimers (or heterodimers if the monomer fused
to p3 was mutated).
Target Production
[0260] Two complementary primers encoding the desired sequences but
harboring an extra adenosine in 3' were annealed and ligated into
pGEM-t Easy (Promega). After sequencing, a correct clone was chosen
as template to PCR amplify a biotinylated 200 pb fragment using the
kit KOD (Novagen) and primers SP6 (TTTAGGTGACACTATAGAATAC) and
biotT7 (biot-TAATACGACTCACTATAGG). The PCR product concentration
was estimated on gel and the fragment was used as such in ELISA or
selection procedures.
Rescue of the Phagemid Library
[0261] A representative aliquot of the library (at least 10.times.
more bacteria than the library size) was used to inoculate 50 ml of
2.times.TY containing 100 .mu.g/ml ampicillin and 2% glucose
(2TYAG) and the culture was agitated at 37.degree. C. At an
OD.sub.600 of 0.5, 5 ml of this culture was infected with helper
phage K07 at a ratio phage:bacteria of 20:1 and incubated without
agitation for 30 min at 37.degree. C. After centrifugation at 4000
rpm for 10 min at room temperature (RT), the pellet was resuspended
in 25 ml of 2.times.TY containing 100 .mu.g/ml ampicillin and 25
.mu.g/ml kanamycin (2TYAK) and agitated overnight at 30.degree. C.
The culture was centrifuged at 4000 rpm for 20 min at 4.degree. C.
and phage particles were precipitated by the addition of 0.2 volume
of 20% PEG6000/2.5M NaCl for 1 h on ice.
[0262] After centrifugation at 4000 rpm for 20 min at 4.degree. C.,
the phage pellet was resuspended in 1 ml of PBS and centrifuged at
10 00 rpm for 5 min. 0.2 volume of 20% PEG6000/2.5M NaCl was added
to the supernatant and the mix was centrifuged at 10 000 rpm to
pellet the phage particles. Particles were finally resuspended in
250 .mu.l PBS.
Selection Procedure
[0263] Phage particles were diluted in 1 ml of PBS containing 3%
dry milk and 25 mM CaCl (PMC) and incubated for 1 h at RT. 100
.mu.I Streptavidin beads (Dynal, 200 .mu.l for the first round)
were washed 3.times. in PMC and blocked for 1 h in the same buffer.
The biotinylated targets were added to the phage at the indicated
concentration and the mix was agitated at RT for 1 h. Beads were
added to the mix and incubated at RT for 15 min. Beads were
collected on the vial wall using a magnet and washed 10.times. in
PMC containing 0.1% tween. After a final wash in PBS, beads were
resuspended in 0.5 ml of 100 mM Triethanolamine pH 12 and incubated
for exactly 10 min. The supernatant were collected and immediately
neutralized by 0.5 ml of 1 M Tris pH8. An aliquot of this eluate
was serially diluted for titration and with 4 ml 2.times.TY. 5 ml
of exponentially growing TG1 cells were added and the mix was
incubated for 30 min at 37.degree. C. without agitation. Cells were
plated on large 2TYAG plates and incubated overnight at 30.degree.
C. Colonies were resuspended in 2TYAG, adjusted to an OD.sub.600 of
100 and kept at -80.degree. C. after addition of 15% glycerol.
Screening by Phage ELISA
[0264] Isolated colonies from selection outputs were toothpicked
into 100 .mu.l of 2TYAG in 96 well plates, and agitated overnight
at 37.degree. C. Next day, a fresh plate containing 100 .mu.l 2TYAG
was isolated using a transfer device. 50 .mu.l of sterile 60%
glycerol was added to the overnight plate and this masterplate was
stored at -80.degree. C. The fresh plate was agitated at 37.degree.
C. for 2.5 h, rescued by the addition of 2TYAG containing
2.times.10.sup.9 pfu of helper phage M13K07, incubated for 30 min
at 30.degree. C., spun at 1700 rpm for 15 min. Cells pellets were
resuspended in 150 .mu.l 2TYAK and agitated overnight at 30.degree.
C. After centrifugation, 20 .mu.l of supernatant was used as
described in the previous section.
--Results
Selections
[0265] Phage particles displaying I-Cre I variants were produced by
infecting bacteria harboring the phagemid library with helper phage
M13KO7. Phage particles were purified by PEG precipitation and
incubated with a biotinylated PCR fragment harboring HIV6335
target. After 1 h of incubation at room temperature,
streptavidin-coated magnetic beads were added to the solution to
retrieve the biotinylated DMA and bound phages. The beads were
extensively washed and the bound phages were eluted by pH shock.
Bacteria were infected with the eluted phages and plated on large
2.times.TYplates containing ampicillin and 2% glucose. Serial
dilutions of an aliquot of the eluted phages were used to infect
bacteria to calculate the number of phage particle and obtain
isolated colonies.
[0266] The day after, bacteria were scrapped from the large plates
and stored as glycerol stocks. An aliquot (representative of the
diversity) was used to produce a new batch of phage particles for a
second round of selection.
[0267] The stringency of the selections was increased after each
round. The first selection was done using 10 nM of biotinylated
target. The second was done with 400 pM and the washing steps were
extended. The third round was done using 250 pM and washed more
extensively.
[0268] As shown on Table 1, the first and second rounds of
selection against the HIV2 target lead to an output titer
characteristic of background values (10.sup.5 to 10.sup.6 pfu/ml).
However, a significant enrichment was measured on round 3.
TABLE-US-00001 TABLE 1 Selection titers. Selection Input Output
Round (pfu/ml) (pfu/ml) Enrichment 1 6.4 .times. 10.sup.11 1.4
.times. 10.sup.5 NA 2 4.0 .times. 10.sup.12 3.0 .times. 10.sup.6 3
3 2.8 .times. 10.sup.12 6.9 .times. 10.sup.7 33 C2H6335: selection
done on HIV2 target using the library described in the other
example. NA: non applicable. Enrichment is defined as (output n +
1/input n + 1)/(output n/input n).
Screening by Phage ELISA
[0269] 80 clones randomly picked from each output (as well as
unselected clones) were used to produce phage particles displaying
I-CreI variants in a mono-clonal fashion. Supernatants containing
the phage particles were incubated on biotinylated PCR fragment
immobilized on plastic via streptavidin. Bound phages were stained
with an HRP-labeled anti p8 (major coat protein) monoclonal
antibody (Pharmacia). As shown on Table 2, no binders were detected
among the unselected clones or from the outputs of the first round
of selection. However 60% of clones picked after round 2 against
are positive against H6335 but negative on an irrelevant target
(P1234, target of homing endonuclease PI-SceI). This result is in
good agreement with the output titer. Indeed this selection only
resulted in a mild enrichment, suggesting that a large number of
clones still originate from background. As expected, a third round
of selection lead to 99% of strong binders, which explains the
large number of output phages after this third selection.
TABLE-US-00002 TABLE 2 Percentage of positive clones in a ELISA
assay directed against the I-CreI target (C1234) or the HIV2
derived target (H6335). 77 clones were assayed for each output.
Selection % positive % positive round against C1234 against P1234 0
0 0 1 0 0 2 60 0 3 99 0 Round 0: unselected library
[0270] Using phage display, new meganucleases were selected from a
large library of I-Cre I variants. Selections on biotynilated DNA
targets lead to an increase of output titers characteristic of an
enrichment for molecules capable of binding the DNA targets. This
enrichment was confirmed by phage ELISA. These results demonstrate
the efficiency of the selection and screening methods.
A Selection/Screen Experiment in Yeast to Identify Novel
Meganucleases.
Material and Methods
Bacterial and Yeast Strains
[0271] Every subcloning and plasmid preparations are performed in
XLI-blue: E. coli provided by Stratagene following standard
procedures. Experiments in S. cerevisiae are done in the following
strains:
[0272] FYC2-6A: alpha, trp1.DELTA.63, leu2.DELTA.1,
his3.DELTA.200
[0273] FYBL2-7B: a, ura3 .DELTA. 851, trp1.DELTA.63, leu2.DELTA.1,
lys2.DELTA.202
[0274] YASP3 (derived from FYC2-6A): alpha,
ura3::SSA-ura3-HIV2-KanR, ade2::SSA-ade2-HIV2-TRP1, trp1.DELTA.63,
leu2.DELTA., his3.DELTA. 200
Plasmids
[0275] pCLS0279: ADH1 promoter, TRP1 selectable marker and ARS-CEN
origin of replication, .beta.-galactosidase SSA target, HIV2 6335
cleavage site.
[0276] pCLS0569: kanamycin resistance cassette, HIV2 6335, internal
fragment of the URA3gene.
[0277] pCLS0570: kanamycin resistance cassette, HIV2 6335, internal
fragment of the LYS2 gene.
[0278] pCLS0576: TRP1 selectable marker, HIV2 6335, internal
fragment of the ADE2 gene.
[0279] pCLS0047: Galactose inducible promoter, LEU2 selectable
marker and 2 micron origin of replication.
Results
[0280] An in vivo assay in yeast that allows to screen mutagenized
I-CreI protein variants with detectable activity towards a
specified target was performed.
[0281] A library of mutated I-CreI meganucleases has been first
selected by a phage display procedure, resulting in a sub-library
enriched for variants of interest, able to bind the HIV2 6335
target. The inserts from this enriched sub-library are subcloned
into pCLS0047 under the control of a galactose-inducible promoter,
for further selection in yeast. However, we can produce the library
directly in the suitable yeast expression vector, and void the
phage display step.
[0282] A specific yeast strain (YASP3) containing two reporter
systems integrated in chromosomes was prepared. These two reporter
systems are based on recombination by Single Strand Annealing
(SSA). SSA is induced by specific cleavage of the HIV2 6335
site.
[0283] Namely, a URA3 SSA target and an ADE2 SSA target were
introduced. The URA3 SSA target was a modified ura3 gene with 2
direct repeats of 600 base pairs separated by 4.3 kb (containing a
kanamycin resistance cassette and the HIV2 6335 cleavage site). The
strain was unable to grow on a minimal medium lacking uracile but
was resistant to G418. When this target was cleaved and recombined
properly, the yeast was able to grow on media without uracil and
was sensitive to G418.
[0284] The ADE2 SSA target was a modified ade2 gene with 2 direct
repeats of 1.1 kb separated by 3.6 kb (containing a tryptophan
selectable marker and the HIV2 6335 cleavage site). Because of this
mutated ade2 gene, the yeast strain was unable to grow on a minimal
medium lacking adenine, but harbored a red color on a medium with a
low adenine content. Because of the tryptophan selectable marker,
it was able to grow on minimal media without tryptophan. When this
target was cleaved and recombined properly, the yeast was white,
able to grow on media without adenine and unable to grow on a
minimal medium lacking tryptophan.
[0285] Basically, the recipient yeast strain was red (on low
adenine medium), G418 resistant, tryptophan prototroph and
auxotroph for uracile and adenine. If a specific meganuclease is
expressed in this strain and cleaves its target sites, the
resulting yeast clone is white, G418 sensitive, prototroph for
tryptophan and auxotroph for uracile and adenine.
[0286] The YASP3 strain was validated by determining the level of
spontaneous recombination of each target alone and of both targets
taken together. The URA3 SSA 10 target recombined spontaneously as
an uracile prototrophe, G418 sensitive at an approximate 6
10.sup.-4 rate. The ADE2 SSA target recombined spontaneously as an
adenine prototrophe at an approximate 2.7 10.sup.-3 rate.
Recombination of both markers occurred spontaneously (resulting in
uracile/adenin rototrophes) at an approximate 10.sup.-6 rate.
[0287] A pilot experiment with 1.5.times.10 in transformants showed
no background level of uracileladenine prototrophes means that the
number of false positive clones should be less than 10 after a
transformation experiment with a library that would yield about a
million of independent clones.
[0288] The library is used to transform YASP3. A classical
chemical/heat chock protocol that routinely gives 10.sup.6
independent transformants per pg of DNA was used (Gietz, R. D. and
Woods, R. A., 2002) Transformation of yeast by lithium
acetate/single-stranded carrier DNA/polyethylene glycol method
(Methods Enzymol, 350, 87-96).
[0289] Transformation of the strain with the library gives more an
10.sup.6 independent yeast transformants from which a number of
clones are able to grow on a selective medium whithout uracile,
leucine and containing galactose as a carbone source and a low
amount of adenine. Among those clones, the interesting ones are
white indicating that they contain a LEU2 vector allowing the
expression of a meganuclease specific for HIV2 6335 site and that
the enzyme is able to cut both URA3 and ADE2 reporters.
[0290] The positive clones are isolated and screened for their
ability to induce the specific recombination of a plasmidic SSA
.beta.-galactosidase target (pCLSO279). This plasmidic reporter was
a modified LacZ gene with 2 direct repeats of 825 base pairs
separated by 1.3 kb (containing a URA3 selectable marker and the
HIV2 6335 cleavage site). The vector (which can be selected on a
medium without tryptophan) is used to transform a yeast strain
(FYBL2-7B) and clones are maintained on minimal media 35 lacking
uracile to maintain the unrecombined LacZ target.
[0291] Yeast clones resulting from the selection experiment are
mated with the yeast strain containing the SSA .beta.-galactosidase
target. Diploids are selected and assayed for induced
.beta.-galactosidase activity. A number of clones are expected to
behave as false positives at this step. They correspond to the
background level of spontaneous recombination of the URA3 and ADE2
SSA targets. All remaining clones (uracile and adenine auxotrophes
able to induce recombination of the SSA-LacZ target) are true
positives expressing a meganuclease cleaving the HIV2 6335 target
in vivo. Also, other experiments, based on the ones described
above, can be used to determine more precisely the activity of such
novel enzymes.
EXAMPLE 3
Use of Meganuclease for Antiviral Therapy
--Experimental Procedures
Cells
[0292] COS-7 cell lines from the american Type culture collection
(ATCC) were cultured in DMEM plus 10% fetal bovine serum. PC-12
cells from ATCC were grown in RPMI1640 supplemented with 10%
heat-inactivated horse serum and 5% heat-inactivated fetal bovine
serum. PC-12 cells were differentiated as previously described (Su
et al., 1999, Journal of Virology, 4171-4180). Briefly, cells were
seeded on 6 well-plate at 5 10.sup.4 cells per well. The following
day, cells were incubated in PC-12 medium containing 100 ng/ml of
2.5 S NGF (Invitrogen). Medium was changed every three days. After
7 days of incubation, undifferentiated cells were eliminated by
adding 2 .mu.M of fluorodeoxyuridine (FdUrd).
Construction of Recombinant HSV-1
[0293] HSV-1 was purchased from ATCC. Viruses were propagated on
COS-7 cells at low MOI (0.01 PFU/cell). Recombinant virus (rHSV-1)
were generated as previously described (Lachmann, R. H.,
Efstathiou, S., 1997, Journal of Virology, 3197-3207). A 4.6 Kb
pstI-bamHI viral genomic DNA fragment was cloned in pUC 19. Based
on HSV-1 sequence from data base (ID: NC 001806 ), this region
represents nucleotides 118867 to 123460. A cassette consisting of a
CMV promoter driving Lac gene expression was introduced into a168
bp HpaI deletion. This region is located within the major LAT locus
of HSV-1. I-Sce I cleavage site was finally cloned directly after
the CMV promoter. This construct was used to generate recombinant
viruses. Plasmid was linearized by XmnI digestion, and 2 .mu.g of
this plasmid DNA was contransfected with 15 .mu.g of HSV-1 genomic
DNA prepared from COS-7 infected cells by CaCl.sub.2 method. After
3 or 4 days, infected cells were harvested and sonicated. Aliquot
of the lysed cells were used to infect COS monolayer. Virus
recombinant were selected by overlaying COS monolayer with 1%
agarose in medium containing 300 .mu.g/ml of X-Gal
(5-bromo-4-chloro-3-indolyl-.beta.-D-galactopyranoside). Blue
clones were picked and further subjected to three round of plaque
purification. Presence of the I-Sce I site was confirmed by PCR and
in vitro I Sce-I enzymatic digestion.
Viral Inhibition
[0294] 6 well-plate were seeded with 2.10.sup.4 cells per well. The
next day COS-7 cells were transfected with 0.5 .mu.g of plasmid
expressing ISce-I or containing the ISce-I ORF in the opposite
orientation by the EFFECTENE method according to the manufacturer
protocol. We achieved routinely in our laboratory 60 to 70%
efficiency using this methodology. Fourthy eight hours later,
subconfluent transfected cells were infected with rHSV-1. For
infection, rHSV-1 was diluted in PBS containing 1% fetal bovine
serum and adsorbed onto cells for 20-40 min at 37.degree., in
humidified incubator with 5% CO2. 6 wells-plates were infected at
30 or 300 PFU per well for respectively viral inhibition or cells
survival experiments. Cells were harvested at day 1, 2, and 3 and
.beta.-galactosidase activity was assayed and DNA extracted.
.beta.-galactosidase Activity
[0295] Cell monolayer was fixed in 0.5% glutaraldehyde in 100 mM
PBS containing 1 mM MgCl.sub.2 at 4.degree. for 10 minutes. After
one wash with detergent solution (100 mM PBS, 1 mM MgCl.sub.2,
0.02% Nonidet p-40) cells were incubated at 37.degree. in X-Gal
stain solution (10 mM PBS, 1 mM MgCl.sub.2, 150 mM NaCl, 33 mM
K.sub.4Fe(CN).sub.6.3H.sub.2O, 33 mM K.sub.3Fe(CN).sub.6, 0.1%
X-Gal) until color development. Beta-galactosidase activity was
also measured on cell extract with
o-nitrophenyl-.beta.-D-galactopyrannoside (ONPG) as substrate. Cell
monolayer was washed once with PBS. Cells were then lysed with 10
mM Tris ph 7.5, 150 mM NaCl, 1% Triton X-100, protease inhibitors.
After 30 minutes incubation on ice cell lysate was centrifuged and
.beta.-galactosidase was assayed. Typically 30 .mu.l of supernatant
was combined with 270 .mu.l of reaction buffer (10 mM PBS; ph 7.5,
1 mM MgCl.sub.2, 0.3% .beta.-mercaptoethanol) containing 800
.mu.g/ml ONPG. The reaction was carried out at 37.degree. and
stopped with 0.5 ml of 1M NaCO.sub.3. Optical density was measured
at 415 nm. Beta-galactosidase activity is calculated as relative
unit normalized for protein concentration and incubation time.
Semi-Quantitative PCR
[0296] To measure viral replication of rHSV-1, oligonucleotides
were designed to amplify a 217 bp fragment from Lac gene. The
standard DNA used in this assay was generated by cloning this
fragment in a Bluescript plasmid, and by inserting a 50 bp fragment
downstream to the 5' oligonucleotide. PCR of the standard produced
267 bp amplicon. Series of PCR (not shown) were carried out to fix
the amount of standard and DNA sample, and the number of cycles to
achieve linear response of the amplification. The basic
semi-quantitative PCR were carried out in a total volume of 30
.mu.l, using the READYMIX.TM. TAQ (Sigma) with 20 pmols of each
primers and 180 pg of DNA. The tubes were heated for 4 min at
94.degree. and subjected to 22 cycles: 94.degree. for 1 min,
62.degree. for 50 sec, 72.degree. for 2 min, and 72.degree. for 7
min.
Virus Titration
[0297] In one series of experiments, the culture medium was
collected every day at days 1, 2, 3, and 4, and fresh medium was
added. In the other, the medium was not changed during experiment
and aliquots were collected every day. To monitor for the release
of HSV-1 progeny, aliquot of medium were titred on COS-7 cells by
standard plaque assay.
--Results
[0298] The effect of I-Sce I on viral replication was examined
using a recombinant Herpes simplex virus carrying a I-Sce I
restriction site (rHSV-1). For convenience, rHSV-1 was build with a
cassette containing CMV promoter driving the Lac gene. I-Sce I site
was inserted at the junction of the CMV promoter and Lac gene. The
expression cassette was cloned by homologous recombination in the
major LAT locus which allowed Beta-galactosidase (.beta.-gal)
expression during lytic infection in COS-7 cell monolayer.
Strinkingly transfection of I-Sce I expression vector before viral
infection virtually completely inhibited HSV-1 plaque formation in
COS cells (FIG. 5) as shown by X-Gal coloration. In contrast,
control transfection with expression vector containing I-Sce I open
reading frame in the reverse orientation which did not allow any
functional transcript, did not affect viral replication.
Furthermore, 48 hours after infection, the cells were checked for
I-Sce I expression. All the lysis plaques formed in cells monolayer
transfected with I-Sce I expression vector represented cells which
did not expressed I-Sce I (the transient transfection is about 70%
efficient). However, cells expressing I-Sce I surrounding the lysis
plaque inhibited the viral propagation. The I-Sce I effect was
confirmed by measuring the .beta.-galactosidase activity in a cell
lysate. After infection of COS-7 cells monolayer transiently
expressing I-Sce I with 30 Pfu per well cell monolayer was
collected at day 1, 2, and 3 post infection and .beta.-gal was
assayed. FIG. 6A shows a drastic decrease of the
.beta.-galactosidase activity reflecting the inhibition of rHSV-1
replication. The protective effect of I-Sce I over a time course of
rHSV-1 infection was evaluated next. At 3 days after infection,
cells transfected with I-Sce I expressing vector shown no sign of
cytopathic effect whereas control cultures were completely lysed as
shown in FIG. 6B. In an effort to quantify the degree of inhibition
of viral DNA replication by I-Sce I, we have set-up a
semi-quantitative PCR Genomic DNA was extracted from cells at day
1, 2, and 3 after infection. PCR was carried out with primers a and
b (FIG. 7A) generating a 217 bp amplicon in Lac gene. An internal
standard was added in sample before PCR to quantify DNA. Lac gene
was virtually not detectable in I-Sce I expressing cells at 3 days
post-infection (FIG. 7A). In contrast cells that did not received
I-Sce I expression vector shown high levels of virus DNA. This
result was confirmed by PCR using primers in viral endogenous gene
(FIG. 7B). Amplification of Thymidine Kinase (TK) gene shown that
I-Sce I inhibited the viral replication. Finally COS-7 cells
expressing active I-Sce I or I-Sce I ORF in the reverse orientation
were infected with rHSV-1 and the concentration of virus released
in the medium at different time points was measured by plaque assay
(FIG. 8). Viruses were quantified in a rough array at day one when
I-Sce I was produced. Viruses production was still markly decreased
two days after the infection when compared with cells which did not
expressed I-Sce I showing that I-Sce I effectively inhibited viral
replication. This effect was still observed at day three although
in a lesser extent. Probably the high mutation rate occuring during
viral replication allowed emergence of mutant HSV-1 which were able
to escape the I-Sce I activity.
[0299] Taking together, these results demonstrates that I-Sce I and
more generally meganucleases can be used to inhibit viral
infection. The use of custom-made meganuclease or combination of
custom-made meganucleases designed to cut specific viral sequences
could represent a powerfull new strategy in the antiviral
therapy.
EXAMPLE 4
Meganuclease with Altered Binding Properties Derived from I-CreI
Homing Endonuclease
[0300] The purpose of this experiment was to obtain novel
meganucleases binding target sites close to the I-CreI natural
target site. A series of 6 targets were used (FIG. 9), including
the wild-type natural I-CreI target (named C1234), the HIV2 target
described in example 2 (named here H1234), and four additional
targets. These four additional targets are 24 bp palindromes
corresponding to inverted repeats of a 12 bp half I-CreI or HIV2
target site: C1221 and C4334 are inverted repeats of the first half
and second half, respectively, of the C1234 target; H1221 and H4334
are inverted repeats of the first half and second half,
respectively, of the H1234 target. In contrast with example 2, the
method used here did not involve any selection step, but was based
on the extensive screening of the Lib2 library (see example 2).
Three residues (Q44, R68 and R70) capable of base specific
interactions with the DNA target were selected. The combinatorial
library was obtained by replacing the three corresponding codons
with a unique degenerated VVK codon. Eventually, mutants in the
protein library corresponded to independant combinations of any of
the 12 amino acids encoded by the VVK codon (ADEGHKNPQRST) at three
residue positions. In consequence, the maximal (theoretical)
diversity of the protein library was 12.sup.3 or 1728.
Materials and Methods
Construction of a Phage-Displayed Library of I-CreI Variants.
[0301] First, residue D75, which is shielded from solvent by R68
and R70, was mutated to N (Asn) in order to remove the likely
energetic strain caused by replacements of those two basic residues
in the library. Homodimers of mutant D75N (purified from E. coli
cells wherein it was over-expressed using a pET expression vector)
were shown to cleave the I-CreI homing site. A phagemid vector was
then engineered that encodes the D75N mutant (FIG. 2C:
<<Template>>) fused to the phage coat protein p3 and
phage-displayed D75N monomers were shown to bind the I-CreI natural
DNA target (C1234 on FIG. 9).
[0302] Then, DNA fragments carrying combinations of the desired
mutations were obtained by PCR (several reactions in 50 .mu.l),
using degenerated primers (FIG. 2D: UlibIIfor, UlibIIrev) and as
DNA template, the D75N gene. Lib2 was constructed by ligation of
the corresponding PCR products, digested with specific restriction
enzymes, into the D75N mutant gene, within the phagemid vector, as
described in example 2.
Screening of Meganucleases Binding to the 6 Different Targets
Screening was Performed by Phage ELISA, as Described in Example
2.
--Results
[0303] 4560 clones (more than 2.5 times the theoretical mutant
library diversity) were individually picked and screened by phage
ELISA with the 6 different targets. 28 positives (clones binding
one of the six targets) were identified. For validation, these 28
clones were re-assayed by phage ELISA, 8 times in parallel with the
6 different targets; 20 clones were thus confirmed as true
positives. Finally, all 28 clones were sequenced. TABLE-US-00003
TABLE 3 Sequence of the proteins found in the four different
classes. Class I Class II Class III Class IV Q R K (NTQH)N Q R T
(2) Unknown Q R R Q R N (RG) (ED) sequence H (KEQ) E Q R A Q Q K
(2) Q S R Q N K Q T R (2) Q Q R Q H K D S H Unknown sequence Only
amino acids from position 44, 68 and 70 are indicated. Clones found
twice are labeled with (2).
[0304] Four different patterns (ELISA results) could be observed.
FIG. 10 features one representative example for each one. The first
class (Class I) corresponds to a strong binding of C1234, C1221,
C4334 and H4334. The wild-type protein (QRR) was recovered in this
class, showing that Class I profile is the regular binding profile
of the original scaffold. Two variants were also shown to display
such binding (QRK and another yet not completely identified
mutant).
[0305] Variants from the second class have lowered their affinity
for all targets, but H4334, since no binding was observed with
C1234, C1221 and C4334. Eight different proteins were found to
belong to this class, plus a protein which sequence could not be
determined. Among the sequence variants of Class II, five retain
the Q44 amino acid from the wild-type sequence, and one of the two
arginines in position 68 or 70. However, in one mutant (DSH), none
of the amino acids from position 44, 68 and 70 has been retained.
Class III (4 different proteins) has a more complex pattern, as it
retains apparent binding for the C1221 and H4334 target. Finally,
one protein (Class IV) retains only a slight binding for target
C1221 as none of the other targets are bound anymore.
[0306] It is difficult to draw conclusions from Class IV, since the
residual binding with C1221 is very low, and sequencing of the
unique Class IV mutant has failed. However, comparison of Class II
and III with the wild-type profile of Class I clearly shows that
the binding specificity has been altered.
[0307] The conclusion is that even from small libraries such as
Lib2 (complexity 1.7 10.sup.3), variants with altered binding
profiles can be isolated, as shown in FIG. 10. Therefore,
strategies based on screening, starting with larger mutant
libraries, should allow the identification of more dramatic
alterations, for instance binding for targets that were not bound
by the initial protein scaffold. In addition, this approach leads
to the identification of many different proteins for each profile.
An extensive study of this kind should also bring the basis of a
better understanding of DNA/meganuclease interactions.
EXAMPLE 5
Comparison of Selection and Screening Methods in Yeast Library
[0308] The purpose is here to compare the screening and selection
methods in yeast. Whereas screening is the extensive examination of
each individual clone of a population for its desired properties
(for us, the cleavage properties), selection is an enrichment step:
an initial library is submitted to the selection process, resulting
in a sublibrary enriched for clones with the desired
properties.
[0309] Since the throughput of the screening process can be
insufficient to process very large number of clones, one or several
selection steps can be useful when one has to deal with a very high
diversity. However, selection can bring several unexpected bias,
resulting in the selection of other properties than the ones wished
by the operator. Thus, it is extremely important to validate any
selection process carefully.
[0310] Therefore, a selection method and a screening method were
developped to look for meganuclease cleaving specific DNA target in
yeast. Both are based on the production, by homologous
recombination, and more precisely, by Single-Strand annealing, of
specific markers, upon cleavage of the DNA target by the
meganuclease within the yeast cell. The principle of these assays
is described in Example 2. Selection is based on the restoration of
an auxotrophy marker, (URA3 in Example 2, ADE2 and LYS2 in this
example), whereas screening is based on the restoration of a color
marker, (LacZ and ADE2 in example 2, LacZ in this example (Since an
ade2 mutation results in no growth, or in a yeast red color,
depending on the amount of adenine in the culture medium, it can be
used for both selection and screening).
[0311] Thus, the clones screened as positive with and without
selection on a small library were compared, in order to check
whether the selection method is suitable.
--Material and Methods
Bacterial and Yeast Strains
[0312] Every subcloning and plasmid preparations are performed in
XL1-blue: E. coli provided by Stratagene following standard
procedures.
[0313] Experiments in S. cerevisiae are done in the following
strains, wherein cutI-CreI represents the cleavage site for
I-CreI:
[0314] FYC2-6A: alpha, trp1.DELTA.63, leu2.DELTA.1,
his3.DELTA.200
[0315] FYBL2-7B: a, ura3.DELTA.851, trp1.DELTA.63, leu2.DELTA.1,
lys2.DELTA.202
[0316] YAP4 and YDD6 (derived from FYC2-6A): alpha,
lys2::SSA-ura3-cutI-CreI-KanR, ade2::SSA-ade2-cutI-CreI-TRP1,
trp1.DELTA.63, leu2.DELTA.1, his3.DELTA.200
Plasmids
[0317] pCLS050: ADH1 promoteur, TRP1 selectable marker and ARS-CEN
origin of replication, .beta.-galactosidase SSA target, I-CreI
cleavage site.
[0318] pCLS0047: Galactose inducible promoter, LEU2 selectable
marker and 2 micron origin of replication.
--Results
[0319] A library of mutated I-CreI meganucleases, namely Lib2 (see
example 4) was introduced into a yeast vector (pCLS0047).
[0320] Two specific yeast strain (YAP4 and YDD6) containing two
reporter systems integrated in chromosomes were prepared. These two
reporter systems are based on recombination by Single Strand
Annealing (SSA). SSA is induced by specific cleavage of the I-CreI
site.
[0321] Namely, a LYS2 SSA target and an ADE2 SSA target were
introduced. The LYS2 SSA target was a modified lys2 gene with 2
direct repeats of 3240 bp base pairs separated by 4.3 kb
(containing a kanamycin resistance cassette and the I-CreI cleavage
site). The strain was unable to grow on a minimal medium lacking
lysine but was resistant to G418. When this target was cleaved upon
overexpression of I-CreI and recombined properly, the yeast was
able to grow on media without lysine and was sensitive to G418.
[0322] The ADE2 SSA target was a modified ade2 gene with 2 direct
repeats of 1.1 kb separated by 3.6 kb (containing a tryptophan
selectable marker and the I-CreI cleavage site). Because of this
mutated ade2 gene, the yeast strain was unable to grow on a minimal
medium lacking adenine. Because of the tryptophan selectable
marker, it was able to grow on minimal media without tryptophan.
When this target was cleaved and recombined properly, the yeast was
able to grow on media without adenine and unable to grow on a
minimal medium lacking tryptophan.
[0323] Basically, the recipient yeast was G418 resistant,
tryptophan prototroph and auxotroph for both lysine and adenine. If
a specific meganuclease is expressed in this strain and cleaves the
I-CreI target sites, the resulting yeast clones are G418 sensitive,
auxotroph for tryptophan and prototroph for lysine and adenine.
[0324] The Lib2 library was used to transform YAP4 and YDD6.
Aclassical chemical/heat chock protocol that routinely gives us
10.sup.6 independent transformants per .mu.g of DNA was used(Gietz
and Woods, 2002, Methods Enzymol, 350, 87-96).
[0325] Transformation of the strain with the library gives more
than 10.sup.6 independent yeast transformants on a selective medium
whithout leucine (selection for the meganuclease expression
vectors), and containing glucose as a carbone source and a low
amount of adenine. Such clones can be screened after mating with
the yeast strain containing the SSA .beta.-galactosidase target
(FYBL2-7B transformed with pCLS050). Diploids are selected and
assayed for induced .beta.-galactosidase activity. Screening of
2400 independant clones resulted in the identification of 15
positives. DNA from these clones was recovered, electroporated into
E. coli, for recovery of the meganuclease expression plasmid. For
each of these 15 positives, two E. coli clones were amplified and
sequenced. No difference of sequence was observed between two E.
coli clones obtained from the same positive yeast clone. Plasmids
were then retransformed into the yeast YAP4 or YDD6 strain, and
screening was done again. It confirmed the results of the primary
screen for the 15 different yeast clones.
[0326] The same screening experiment was then performed, with the
exception that a selection step was added. The Lib2 libary was
transformed into YDD6, and the cells were plated onto a a selective
medium without leucine (selection for the meganuclease expression
vectors), and containing glucose as a carbone source. After three
days of growth, colonies were resuspended in water, and plated onto
a a selective medium whithout leucine (selection for the
meganuclease expression vectors), adenine and lysine (selection for
the clones wherein the two ADE2 and LYS2 SSA reporter had
recombined) and containing galactose as a carbone source. 960
clones were obtained, and 845 (88%) were screened as positive after
mating with the yeast strain containing the SSA
.beta.-galactosidase target (FYBL2-7B transformed with pCLS050).
Eighteen out of them were confirmed by a second round of
screening.
[0327] These results gave a measure of the enrichment in a single
round of selection. Since screening gave us 15 positives out of
2400 clones without selection and 845 out of 960 with selection,
the enrichement is (845/960)/(15/2400)=140.
[0328] Then the 33 confirmed clones (18 obtained with and 15
obtained without selection) were sequenced. The table below
describes the clones obtained by selection and screening. Since
Lib2 results from mutation of residues Q44, R68 and R70 of I-CreI,
clones are described by three letters, corresponding to the amino
acids (one letter code) presents at positions 44, 68, and 70. For
example, wild type would appear as QRR, as a TRR mutant corresponds
to a single mutation at position 44, replacing the glutamine with a
threonin. TABLE-US-00004 TABLE 4 Comparison of the clones obtained
either by simple screening or selection and screening. Number of
clones Number of clones containing the containing the Mutant
mutation after simple mutation after I-CreI screening of 2500
selection AND protein clones screening TRR 6 clones (Out of 15) 12
clones (out of 18) QRA 3 clones (out of 15) 5 clones (out of 18)
QAR 2 clones (out of 15) TRK 1 clone (out of 15) TRA 1 clone (out
of 15) TRN 1 clone (out of 15) 1 clone (out of 18) ARN 1 clone (out
of 15)
[0329] Clearly, the selection process is very efficient, since an
enrichement factor of 140 is observed after selection. Among the
positives, clones TRR and QRA are the most frequent with and
without selection. Four sequences were found after simple
screening, and not after selection. However, these differences are
not statistically significant: only 18 of the 845 positives found
after selection were sequenced and haracterization of a larger
sample should identify more different positive variants.
[0330] These results show that with a small library such as Lib2,
positives can be selected efficiently, whereas the biases that
could be introduced by this selection system are small if any.
Thus, this selection procedure can be used to enrich larger
libraries for variants of interest, for example when these
libraries cannot be entirely processed by the screening method. In
this example, the mutants that have still the ability to cleave the
I-CreI target site were recovered. However, mutants cleaving novel
targets could be obtained just in the same way.
EXAMPLE 6
Screening of Active Meganuclease Based on their Clevage Properties
in vitro, and in Mammalian Cells
[0331] The purpose of this experiment is to demonstrate that active
and inactive meganucleases can be distinguished on simple screening
assays in vitro and in mammalian cells. The in vitro assay is
similar to a restriction assay, and the assay in mammalian cells is
based on cleavage-induced recombination. Cleavage in mammalian
cells is similar to the assay in yeast (example 2): cleavage
induced recombination (and more precisely single-strand annealing)
results in a functional LacZ reporter gene which can be monitored
by standard methods. However, in contrats with the yeast assay,
which relies on stable replicative plasmids, the cell-based assay
is working with transient matrix.
[0332] As for examples 4 and 5, the Lib2 library was used. Three
residues (Q44, R68 and R70) capable of base specific interactions
with the DNA target were selected. The combinatorial library was
obtained by replacing the three corresponding codons with a unique
degenerated VVK codon. Eventually, mutants in the protein library
corresponded to independant combinations of any of the 12 amino
acids encoded by the VVK codon (ADEGHKNPQRST) at three residue
positions. In consequence, the maximal (theoretical) diversity of
the protein library was 123 or 1728. The target used was the
natural I-CreI target (named C1234).
[0333] 2000 clones were individually picked, and tested with the
two screening methods, to establish a comparizon of these methods.
Positives were then sequenced and analyzed.
--Materials and Methods
Construction of a Library of I-CreI Variants for Expression in
vitro.
[0334] First, residue D75, which is shielded from solvent by R68
and R70, was mutated to N (Asn) in order to remove the likely
energetic strain caused by replacements of those two basic residues
in the library. Homodimers of mutant D75N were shown to cleave the
I-CreI homing site. The library was constructed in the pTriex
vector (Novagen).
[0335] Then, DNA fragments carrying combinations of the desired
mutations were obtained by PCR (several reactions in 50 .mu.l),
using degenerated primers (FIG. 2D: UlibIIfor, UlibIIrev) and as
DNA template, the D75N gene. Lib2 was constructed by ligation of
the corresponding PCR products, digested with specific restriction
enzymes, into the D75N mutant gene, within the pTriex vector, as
described in example 2.
Production of Meganucleases in vitro
[0336] 50 ng of DNA plasmid solution in 2 .mu.l were mixed to 4
.mu.l of RTS solution (Rapid Translation System RTS 100, E. coli HY
kit from Roche). Protein productions were done in vitro at
30.degree. C. for at least 4 h. After production of the proteins,
the fresh preparation was diluted in distillated water prior to try
the meganuclease activity.
In vitro Cleavage Assay
[0337] pGEMT plasmids with single meganuclease DNA target cut sites
were first linearized with XmnI. Cleavage assays were performed at
37.degree. C. in 12.5 mM HEPES (pH 8), 2.5% (v/v) glycerol and 10
mM MgCl2. Reactions were stopped after 1 hour by addition of 0.1
volume of 0.1 M Tris-HCl (pH 7.5), 0.25 M EDTA, 5% (w/v) SDS, and
0.5 mg/ml proteinase K and incubation at 37.degree. C. for 20
minutes. Reaction products were examined following separation by
electrophoresis in 1% agarose gels.
Cleavage in Mammalian Cells
[0338] CHO cells were cotransfected with the meganuclease
expressing pTriEx plamid and the reporter plasmid. The reporter
plasmid contains an inactive LacZ gene under the contol of an
appropriate promoter. LacZ is inactive because it contains an
internal duplication of 220 bp, and an insertion of the target site
(24 to 80 pb), located between the two 220 bp repeats. For
transfection, Polyfect transfection reagent was used accordingly to
the supplier (Qiagen) protocol. 72 hours after transfection, tissue
culture medium was removed and cells were incubated in lysis buffer
(Tris-HCl 10 mM pH7.5, NaCl 150 mM, Triton X100 0.1%, BSA 0.1
mg/ml, protease inhibitors). The whole lysate was combined with 0.1
volume of Mg 100.times. buffer (MgCl.sub.2 100 mM,
.beta.-mercaptoethanol 35%), 1.1 volume of ONPG 8 mg/ml and 7.8
volume of sodium phosphate 0.1 M pH7.5. After incubation at
37.degree. C., the reaction was stopped with 0.5 volume of 1 M
Na.sub.2CO.sub.3 and OD was measured at 415 nm. The relative
.quadrature.-galactosidase activity is determined as a function of
this OD. Positives are clones choosen by comparizon with a negative
control where an empty expression vector is tranfected to the
cells. Their .beta.-galactosidase activities is higher than (M+2 E)
(where M is the average .beta.-galactosidase activity of the
negative controls and E the standard deviation between those same
mesurements).
--Results
[0339] 2000 clones clones (more than the theoretical mutant library
diversity) were individually picked and cultured in 96 deep-well
plates. Plasmid DNA was extracted using a BioRobot8000 platform
(Qiagen) with the Qiaprep 96 Turbo BioRobot kit (Qiagen). Since the
pTriEx plamid has been designed to drive the expression of protein
in bacteria and mammalian cells, plasmid DNA was then used for both
the in vitro assay and the assay in cells. All the positives
obtained with either methods were rechecked for cleavage in vitro
and in cells.
[0340] For screening with the in vitro assay, Meganuclease were
produced in vitro from each individual plasmid with the RTS (Roche)
system, and then tested for cleavage of a linearized pGEMT
(InvitroGene) plasmid containing the targets. The digests were then
run on an electrophoresis gel to detect the expected cleavage
products.
[0341] For screening with the assay in mammalian cells, the plasmid
were cotransfected with reporter plasmid containing the target
sites in CHO cells, and cleavage-induced recombination was
monitored 72 hours later, as a function of
.quadrature.-galactosidase activity.
[0342] Out of the 2000 clones, 206 clones (10.3%) were found to be
positive with the in vitro assay. In mammalian cells, 85 clones
(4.3%) were found to be positives. Out of these 291 clones, 82 were
positive in both methods.
[0343] 121 different variant proteins were identified after
sequencing of positive clones. The identity and cleavage properties
of these 121 variants are shown in the table below. 54 variants
display a detectable cleavage activity in both assays, as 66 are
positives only for cleavage in vitro. A single variant is positive
in the cell-based assay but not in vitro. TABLE-US-00005 TABLE 5
Sequence end cleavage properties of the different variants Residue
44 Residue 68 Residue 70 in vitro cleavage SSA in cells Ala Arg Ala
+ + Ala Arg Arg + + Ala Arg Gly + + Ala Arg His + + Ala Arg Ser + +
Ala Lys Lys + + Ala Thr Lys + + Asn Arg Arg + + Asn Arg His + + Asn
Arg Pro + + Asp Pro Thr + + Gln Ala Arg + + Gln Ala His + + Gln Arg
Ala + + Gln Arg Arg + + Gln Arg Asn + + Gln Arg His + + Gln Arg Pro
+ + Gln Arg Ser + + Gln Arg Thr + + Gln Asn Arg + + Gln Gln Arg + +
Gln Gln Thr + + Gln His Arg + + Gln His Asn + + Gln His Gln + + Gln
Lys Ala + + Gln Lys Gln + + Gln Lys Lys + + Gln Lys Thr + + Gln Ser
Gly + + Gln Ser His + + Gln Thr Arg + + Glu Arg Arg + + Pro Arg Gly
+ + Pro Arg Thr + + Ser Arg Asn + + Ser Arg Lys + + Ser Lys Arg + +
Ser Thr Arg + + Thr Ala Arg + + Thr Ala Thr + + Thr Arg Ala + + Thr
Arg Arg + + Thr Arg Asn + + Thr Arg Gly + + Thr Arg Lys + + Thr Arg
Ser + + Thr Arg Thr + + Thr Gln Arg + + Thr Gly Arg + + Thr Lys Arg
+ + Thr Thr Arg + + Thr Thr Lys + + Ala Ala Arg + - Ala Arg Asn + -
Ala Arg Thr + - Ala Gln Arg + - Ala Gln Lys + - Ala Glu Asn + - Ala
Gly Arg + - Ala His Arg + - Ala Ser Lys + - Ala Thr Arg + - Arg Ala
Ser + - Arg Arg Asn + - Arg Thr Asn + - Asn Ala Arg + - Asn Arg Asn
+ - Asn Arg Gly + - Asn Arg Ser + - Asn Arg Thr + - Asn Asn Arg + -
Asn Gln Arg + - Asn Thr Arg + - Asp Arg Lys + - Asp Ser Asp + - Gln
Ala Ala + - Gln Ala Ser + - Gln Ala Thr + - Gln Asn Asn + - Gln Asn
Gly + - Gln Asn Pro + - Gln Asn Thr + - Gln Gln Asn + - Gln Lys Asp
+ - Gln Pro Asn + - Gln Ser Ala + - Gln Ser Asn + - Gln Thr Ser + -
Gly Ala Arg + - Gly Arg Ala + - Gly Arg Arg + - Gly Arg Gly + - Gly
Arg Ser + - Gly Arg Thr + - Gly Gln Arg + - Gly Gln Lys + - Gly His
Arg + - His Ala Arg + - His Arg Ala + - His Arg Thr + - Lys Ala Ser
+ - Lys Ala Thr + - Lys Arg Gln + - Lys Arg Thr + - Pro Asn Thr + -
Ser Arg Ala + - Ser Arg Gly + - Ser Arg His + - Ser Arg Thr + - Ser
Asn Arg + - Ser His Arg + - Ser Ser Arg + - Ser Ser Lys + - Thr Arg
Asp + - Thr Arg His + - Thr Gln Lys + - Thr His Arg + - Thr Ser Arg
+ - Gln His His - +
[0344] These results clearly show the discrimination of positive
and negative clones can be achieved in two different assays, based
on cleavage in vitro and cleavage in mammalian cells. Cleavage in
vitro seems to be more sensitive, since much more positives were
identified. These differences can be due to many factors resulting
either from meganuclease expression, or activity, either from the
detection based on recombination. However, all but one clone (Gln44
His68 His70) identified in cells appeared to be confirmed in vitro,
which shows that the cell-based assay is reliable to identify
functional endonucleases.
EXAMPLE 7
Meganuclease-Induced Recombination of an Extrachromosomal Reporter
in toto Using I-Sce I Expressing Plasmid
A-Optimization of the Reporter System
--Experimental Procedures
Vectors Construction
[0345] The target vectors are based on a LagoZ expression vector
driven by promoter of the human EF1-alpha gene. This promoter has
been shown previously to have wide expression spectrum in vivo
(Kim, D. W., Uetsuki, T., Kaziro, Y., Yamaguchi, N., Sugano, S,
1990, Gene, 91, 217-223). The promoter region includes splice donor
and acceptor sites in the 5' untranslated region of the h-EF1-alpha
gene-LagoZ is a CpG island depleted LacZ gene designed to abolish
gene silencing in transgenic mice (Henry I, Forlani S, Vaillant S,
Muschler J, Choulika A, Nicolas J F, 1999, C R Acad Sci III. 322,
1061-70). To construct target vectors with different lengths of
homology, the 3' fragment of the LagoZ gene was first deleted
(about 2000 bp) and replaced by the I-Sce I cleavage site. The 3'
fragments of different lengths were generated by digestion of the
parental plasmid. These fragments contained different amounts of
homology with the 5' fragment of the LagoZ gene. Finally these DNA
fragments were individually cloned adjacent to the I-SceI cleavage
site, creating different target vectors with 0, 70, 220, 570, and
1200 bp of homology, respectively.
Cell Culture
[0346] COS-7 and CHO-K1 cell lines from the American Type Culture
Collection (ATCC) were cultured in DMEM or Ham's F12K medium
respectively plus 10% fetal bovine serum. For I-Sce I induced
Single Strand annealing (SSA) assays, cells were seeded in 12
well-plates at a 15.10.sup.3 cells per well one day prior
transfection. Transient transfection was carried out the following
day with 500 ng of DNA using the EFFECTENE transfection kit
(Qiagen). Equimolar amounts of target plasmid and I-SceI expression
vector were used. The next day, medium was replaced and cells were
incubated for an other 72 hours.
.beta.-galactosidase Activity
[0347] Cell monolayers were fixed in 0.5% glutaraldehyde in 100 mM
PBS containing 1 mM MgCl.sub.2 at 4.degree. for 10 minutes. After
one wash with detergent solution (100 mM PBS, 1 mM MgCl.sub.2,
0.02% Nonidet p-40) cells were incubated at 37.degree. in X-Gal
stain solution (10 mM PBS, 1 mM MgCl.sub.2, 150 mM NaCl, 33 mM
K.sub.4Fe(CN).sub.6.3H.sub.2O, 33 mM K.sub.3Fe(CN).sub.6, 0.1%
X-Gal) until color development. Beta-galactosidase activity was
also measured in cell extracts with
o-nitrophenyl-.beta.-D-galactopyrannoside (ONPG) as a substrate.
Cell monolayers were washed once with PBS. Cells were then lysed
with 10 mM Tris pH 7.5, 150 mM NaCl, 1% Triton X-100, protease
inhibitors. After 30 minutes incubation on ice, cells lysates were
centrifuged and .beta.-galactosidase was assayed. Typically 30
.mu.l of supernatant was combined with 270 .mu.l of reaction buffer
(10 mM PBS; pH 7.5, 1 mM MgCl.sub.2, 0.3% .beta.-mercaptoethanol)
containing 800 .mu.g/ml ONPG. The reaction was carried out at
37.degree. and stopped with 0.5 ml of 1M NaCO.sub.3. Optical
density was measured at 415 nm. Beta-galactosidase activity is
calculated as relative unit normalized for protein concentration
and incubation time.
--Results
[0348] When a DNA double-strand break (DSB) is introduced between
two repeated sequences, it induces homologous recombination
resulting in a deletion of the repeats, together with all the
intervening sequences. The recombination pathway is often referred
to as the single-strand annealing (SSA) pathway. A reporter system
was designed to monitor meganuclease-induced SSA in animal models
in toto. In order to optimize the reporter system, the correlation
between meganuclease-induced SSA efficiency and repeat length was
first examined. Different target vectors carrying a LagoZ gene
containing duplications of various sizes were constructed (FIG.
11). The presence of the duplication and of the I-SceI cleavage
site inactivates the gene. The repair of the LagoZ gene by SSA
results in the loss of one repeat and of the cleavage site, and in
the restoration of a functional LagoZ gene. LagoZ codes for the
.beta.-galactosidase enzyme which can be detected by colorimetry.
Transient transfection with equimolar amounts of target vector and
I-SceI expression vector or expression vector that doesn't express
the meganuclease were carried out in CHO or COS-7 cells. The
results obtained with the different constructs are presented in
FIG. 12. I-SceI induced DSBs clearly stimulate the SSA repair
mechanism. Furthermore, homology of 70 bp was sufficient to achieve
nearly maximum efficiencies of induced SSA, while the level of
spontaneous recombination (without I-SceI induced DSB) was minimal.
With duplication of 220 bp maximum efficiency was achieved while no
additional gains in SSA efficiency were observed with longer
duplications. Similar results were obtained with COS-7 cells (data
not shown). 70 and 220 bp of homology gave the best ratio of
activity vs background. Because .beta.-galactosidase is assayed in
cell lysates and one single cell can contain several copies of the
target plasmid, it is impossible to evaluate the absolute SSA
efficiency by this method. Therefore direct coloration of the
cellular monolayer was performed 72 hours post-transfection (FIG.
13). Virtually no blue cells were detected in the absence of the
meganuclease (FIG. 13A). In contrast, many
.beta.-galactosidase-positive cells are present when I-SceI is
cotransfected with the target vector, demonstrating the stimulation
of homologous recombination by meganuclease induced DSB. The
efficiency of I-SceI induced SSA was calculated by counting the
blue cells (cells where recombination has taken place) and
comparing it with the number of transfected cells (cells that
effectively received DNA). FIG. 13B shows that 50 to 60% of the
cells undergo homologous recombination when I-SceI is present along
with the target vector carrying 70 or 220 bp duplications while
spontaneous recombination represents less than 0.1% of the events.
Thus, the construct with the 70 bp and 220 bp of homology as well
as the transgene were selected for the animal study.
B. Meganuclease-Induced Recombination of an Extrachromosomal
Reporter in toto
--Experimental Procedures
Hydrodynamic-Based Transfection in vivo
[0349] Transduction of the mouse liver cells was performed by
hydrodynamic tail vein injections as previously described (Zhang,
G., Budker, V., Wolff, A., 1999, Human Gene Therapy, 10, 1735-1737;
Liu, F., Song, Y. K., Liu, D., 1999, Gene Therapy, 6, 1258-1266).
This method allows efficient transduction and expression of
exogenous genes in animals by administration of plasmid DNA by tail
vein injection. Briefly, DNA is mixed in 1.5 to 2 ml of PBS, which
represents 10% of the animal's weight. Tail vein injections are
subsequently performed with a 26-gauge needle over a 5-10 sec
period using sterile materials and working conditions. Using such a
protocol, almost exclusively liver cells are transduced, thus the
I-SceI-mediated SSA event leading to the correction of the LagoZ
gene was studied in the liver. The I-SceI expressing vector used is
the pCLS 197 corresponding to the I-SceI-coding sequences (U.S.
Pat. No. 5,474,896) under the control of the CMV promoter in a pUC
backbone and is 5737 bp long.
[0350] OF1 mice weighing fifteen to twenty grams were obtained from
Charles River Laboratories, France. A total of twenty micrograms of
DNA, containing equal amounts of target vector and either an I-SceI
expression or control vector, was injected into mouse tail veins.
The target vector contains the LagoZ gene interrupted by an I-SceI
cleavage site flanked by direct repeat sequences containing 70 bp
of homology. Control mice were injected with a mixture of the
target vector and a plasmid that does not express I-SceI.
.beta.-galactosidase Activity
[0351] Three days after injection, mice were euthanized by cervical
dislocation and X-Gal stainings of their livers were performed.
Livers were dissected out of the animals in cold 1.times. PBS and
the lobes were cut in pieces of about one fourth a centimeter in
order to allow a better access of the X-Gal in the tissue. Then
liver pieces were placed in fresh cold PBS 1.times. in a 12-well
cell culture plate kept on ice, and fixed in 4% paraformaldehyde
for 1 hour under agitation at 4.degree. C. Samples were then washed
3 times at room temperature for 30 minutes with wash buffer (100 mM
sodium phosphate pH=7.3, 2mM MgCl.sub.2, 0.01% sodium deoxycholate,
0.02% NP-40 by volume). In toto X-Gal staining was performed
overnight at 37.degree. C. in staining solution (5 mM potassium
ferricyanide, 5 mM potassium ferrocyanide, 1 mg/ml X-gal, 20 mM
Tris pH=7.3 in wash buffer). Finally samples were washed
extensively with PBS and examined under microscope. Pictures were
taken with a Nikon Coolpix camera under a Nikon SMZ 1500
binocular.
--Results
[0352] Cellular study has shown that homology of 70 bp is
sufficient to achieve nearly maximal efficiencies of DSB induced
SSA, while the level of spontaneous recombination (without I-SceI
induced DSB) is minimal. Thus, in a first attempt to stimulate
recombination in vivo, transient experiments were performed. A
mixture of the target vector (30 .mu.g) and either the I-SceI
expression or control plasmid (10 .mu.g) were introduced into the
liver via a hydrodynamic tail vein injection method. FIG. 12 shows
a magnified picture of liver collected and stained 3 days after
injection. Blue dots represent cells where a defective LagoZ gene,
bearing an I-SceI site flanked by a 70 bp duplication, was
repaired. After meganuclease induced DSB, the SSA pathway results
in the deletion of one repeat and reconstitution of a functional
gene. Active .beta.-galactosidase encoded by the LagoZ gene can
then be detected by X-Gal stainings. Furthermore, no gene
correction was detected in the absence of the meganuclease
expression vector. These data represent the first evidence that
meganuclease induced recombination can be stimulated in liver and
that in toto repair of an extrachromosomal target can be
achieved.
EXEMPLE 8
Meganuclease-Induced Recombination of a Chromosomal Reporter in
toto Using I-Sce I Expressing Adenovirus
[0353] In order to demonstrate meganuclease-induced genomic surgery
of a chromosomal reporter in toto in different mice tissues, the
repair of the lagoZ gene in toto was tested by transducing cells of
several organs with an I-SceI-expressing adenovirus,
<<Ad.I-SceI>>. Control transgenic littermates were
infected with a non-I-SceI-expressing adenovirus,
<<Ad.control>>. Adenovirus infections in transgenic
mice were performed by intraveinous (IV) injections. Repair of the
lagoZ gene in toto in several tissues was then tested by two
methods that detect .beta.-galactosidase activity in toto, X-gal
staining and FDG assays.
--Experimental Procedures
Transgenic Mice
[0354] The transgene used for the generation of transgenic founders
was a BglII/NotI fragment of 5919 bp carrying the defective LagoZ
gene, inactivated by a LagoZ duplication of 70 bp or 220 bp and the
I-SceI cleavage site, under the control of the human elongation
factor 1 alpha promoter (See FIG. 11).
[0355] Transgenic founder were generated by classical transgenesis,
i.e. by microinjecting the linear and purified BglII/I/NotI
fragment described above at 500 copies/picolitres into the male
pronuclei of fertilized ova at the one-cell stage derived from the
mating of B6D2F1 males and females purchased from Elevage Janvier.
Microinjections were performed under a Nikon TE2000 microscope with
Normarski DIC with eppendorf transferMan NK2 micromanipulators and
eppendorf Femtojet 5247 micro-injector. After injections, ova were
transferred to surrogate pseudopregnant B6CBAF1/J females (Elevage
Janvier) for development and delivery. Transgenic mice generated by
this procedure were identified by PCR and Southern Blot analysis on
genomic DNA extracted from tail biopsies of F0 mice. The molecular
characterization of the transgene integration was done by PCR and
Southern Blot analysis.
[0356] Then the founder were mated to B6D2F1 mice in order to
obtain hemizygote transgenic F1 animal. Expression of the transgene
was tested by performing an RT-PCR experiment on RNAs extracted
from a tail biopsie from a transgenic F1 animal using Qiagen RNeasy
kit (cat N.degree.74124). Hemizygote F1 mice were then mated to
B6D2F1 mice in order to establish an F2 hemizygote transgenic
strain.
[0357] Two independent strains were used bearing either 220 bp or
70 bp long lagoZ gene repeated sequences. These transgenic strains
are referred as strain <<361>> and <<58A>>,
respectively.
[0358] The molecular characterization of the transgene integration
showed that the integration is about 5 direct repeats of the
BglII/NotI transgene in <<361>> and 2 inverted repeats
plus 5 direct repeats in <<58A >>. Hemizygote mice were
identified by tail biopsies, genomic DNA extraction and PCR
analysis. <<361>> and <<58A>> hemizygote
mice were then used for in toto I-SceI mediated-lagoZ gene repair
and transgenic littermates were used as negative controls.
Adenovirus-Based Transduction in toto
[0359] Recombinant type V adenovirus bearing the I-SceI
meganuclease coding region under the control of a CMV promoter,
<<Ad.I-SceI>> was provided by Q BIO gene company at
1.58 10.sup.11 infectious units concentration scored by the
TCID.sub.50 method. The negative adenovirus control
<<Ad.control>> was as well provided by Q BIO gene
company at 3.76 10.sup.11 infectious units concentration.
Recombinant type V adenovirus infections were performed by
intraveinous (IV) injections in transgenic mice tail veins.
Transgenic mice were weighed and anesthetized before infections by
intraperitoneal injection of a mixture of Xylasin (100 mg/kg) and
Ketamine (10 mg/kg). IV infections were performed with 10.sup.10
infectious units/animal in a volume of 400 .mu.l. Infections were
performed in 4 to 7 weeks-old transgenic mice. Adenovirus-infected
mice and uninfected control littermates were bred in isolator
untill sacrificed for .beta.-galactosidase assays.
.beta.-galactosidase Activity
[0360] Adenovirus-infected mice were sacrificed by C0.sub.2
inhalation from 5 to 14 days-post-infections (dpi) and their organs
were processed for .beta.-galactosidase assays. About 10% of the
liver (8 mm.sup.3) was emplyed for protein extraction and the
remaining 90% was used for .beta.-galactosidase in toto X-gal
assays (protocol described previously).
[0361] Fluorescent .beta.-galactosidase assays were incubated at
37.degree. C. in 96 well plate. The assays were performed in a
total volume of 100 .mu.l containing 30 .mu.l of protein extract, 1
.mu.M Fluorescein digalactoside (FDG, Sigma), 0.1%
.mu.-mercaptoethanol, 1 mM MgCl.sub.2, and 100 mM Phosphate buffer,
pH 7.0. The plates were scanned on the Fuoroskan Ascent (Labsystem)
at 5-minutes intervals. The .beta.-galactosidase activity is
calculated as relative unit normalized for protein concentration
and incubation time.
--Results
[0362] Two <<58A>> transgenic mice were IV-injected
with 10.sup.10 infectious units of <<Ad.I-SceI>>
adenovirus in order to target a DSB in-between the 70 bp duplicated
lagoZ sequences and induce the repair of the reporter gene. At
various times post-injection the mice were sacrificed and several
organs were dissected and analyzed by in toto X-gal assays. Blue
staining was detected as dispersed cells over the entire liver of
infected mouse euthanized at 5 dpi (FIG. 15A). No staining could be
detected in the other organs tested, i.e. kidneys, spleen, heart
and lungs. Two <<58A>> transgenic mouse littermates
were used as controls, one IV-injected with 10.sup.10 infectious
units of the control adenovirus <<Ad.control>> and the
other uninfected. No .beta.-galactosidase activity could be
detected in the liver of either control (data not shown). Similar
results were obtained with two <<361>> transgenic mice
injected with 10.sup.9 and 10.sup.10 infectious units of the
Ad.I-SceI adenovirus (FIG. 15B and 15C respectively). These results
were confirmed by measuring the .beta.-galactosidase activity in
liver extract (FIG. 16). A high activity was detected in liver of
mice injected with Adenovirus expressing I-SceI (Ad.1Sce-I). In
contrast, Non-injected mice (NI) shows only a residual background
activity similar to the activity detected in mice injected with the
control adenovirus (Ad.control).
[0363] The IV-injected mouse with 10.sup.10 infectious units of
<(Ad.1-SceI>> adenovirus exhibited more stained liver
cells and more .beta.-galactosidase activity than the IV-injected
mouse with 10.sup.9 infectious units of <<Ad.1-SceI>>
adenovirus. These results suggest that I-SceI-induced recombination
could be dose dependent and that a better yield of I-SceI induced
recombination could be obtained by increasing the
injected-adenovirus titer. Thus, I-SceI-induced genome surgery
should be detectable in other organs reported to be less sensitive
to type V adenovirus infection.
[0364] Taken together, these data strongly suggest that the
reporter gene repair was induced by the activity of the I-SceI
meganuclease. This result is the first evidence that I-SceI and
more generally the meganucleases can be used in toto to induce
efficient site-specific homologous recombination leading to the
repair of a chromosomal gene. Thus, this result opens applications
in the field of gene therapy in mammals.
Sequence CWU 1
1
9 1 264 PRT artificial sequence single chain I-Cre I 1 Met Ala Asn
Thr Lys Tyr Asn Lys Glu Phe Leu Leu Tyr Leu Ala Gly 1 5 10 15 Phe
Val Asp Gly Asp Gly Ser Ile Ile Ala Gln Ile Lys Pro Asn Gln 20 25
30 Ser Tyr Lys Phe Lys His Gln Leu Ser Leu Thr Phe Gln Val Thr Gln
35 40 45 Lys Thr Gln Arg Arg Trp Phe Leu Asp Lys Leu Val Asp Glu
Ile Gly 50 55 60 Val Gly Tyr Val Arg Asp Arg Gly Ser Val Ser Asp
Tyr Ile Leu Ser 65 70 75 80 Glu Ile Lys Pro Leu His Asn Phe Leu Thr
Gln Leu Gln Ala Met Leu 85 90 95 Glu Arg Ile Arg Leu Phe Asn Met
Arg Glu Phe Leu Leu Tyr Leu Ala 100 105 110 Gly Phe Val Asp Gly Asp
Gly Ser Ile Ile Ala Gln Ile Lys Pro Asn 115 120 125 Gln Ser Tyr Lys
Phe Lys His Gln Leu Ser Leu Thr Phe Gln Val Thr 130 135 140 Gln Lys
Thr Gln Arg Arg Trp Phe Leu Asp Lys Leu Val Asp Glu Ile 145 150 155
160 Gly Val Gly Tyr Val Arg Asp Arg Gly Ser Val Ser Asp Tyr Ile Leu
165 170 175 Ser Glu Ile Lys Pro Leu His Asn Phe Leu Thr Gln Leu Gln
Pro Phe 180 185 190 Leu Lys Leu Lys Gln Lys Gln Ala Asn Leu Val Leu
Lys Ile Ile Glu 195 200 205 Gln Leu Pro Ser Ala Lys Glu Ser Pro Asp
Lys Phe Leu Glu Val Cys 210 215 220 Thr Trp Val Asp Gln Ile Ala Ala
Leu Asn Asp Ser Lys Thr Arg Lys 225 230 235 240 Thr Thr Ser Glu Thr
Val Arg Ala Val Leu Asp Ser Leu Ser Glu Lys 245 250 255 Lys Lys Ser
Ser Pro Ala Ala Asp 260 2 795 DNA artificial sequence single chain
I-Cre I 2 atggccaaca ctaagtacaa taaagaattt ctcctgtatc tggcaggttt
cgtcgacggc 60 gatggctcca ttatcgcaca gatcaagccg aatcagagct
acaagtttaa acaccaactg 120 tctctcactt tccaggttac ccagaaaact
caacgtcgct ggttcctgga taagctggta 180 gatgagatcg gtgtgggcta
tgtacgcgac cgtggctctg tgagcgacta tatcctgtct 240 gagattaaac
cactgcataa ttttctgacc cagctgcagg ctatgctgga gcgtatccgt 300
ctgttcaaca tgcgtgagtt cctgctgtac ctggccggct ttgtggacgg tgacggtagc
360 atcatcgctc agattaaacc aaaccagtct tataaattca agcatcagct
gtccctgacc 420 tttcaggtga ctcaaaagac ccagcgccgt tggtttctgg
acaaactggt ggatgaaatt 480 ggcgttggtt acgtacgtga tcgcggtagc
gtttccgatt acattctgag cgaaatcaag 540 ccgctgcaca acttcctgac
tcaactgcaa ccgtttctga aactgaaaca gaaacaggca 600 aacctggttc
tgaaaattat cgaacagctg ccgtctgcaa aagaatcccc ggacaaattc 660
ctggaagttt gtacctgggt ggatcagatt gcagctctga acgattctaa gacgcgtaaa
720 accacttctg aaaccgttcg tgctgtgctg gacagcctga gcgagaagaa
gaaatcctcc 780 ccggcggccg actag 795 3 492 DNA artificial sequence
natural I-Cre I 3 atggccaata ccaaatataa caaagagttc ctgctgtacc
tggccggctt tgtggacggt 60 gacggtagca tcatcgctca gattaaacca
aaccagtctt ataaattcaa gcatcagctg 120 tccctgacct ttcaggtgac
tcaaaagacc cagcgccgtt ggtttctgga caaactggtg 180 gatgaaattg
gcgttggtta cgtacgtgat cgcggtagcg tttccgatta cattctgagc 240
gaaatcaagc cgctgcacaa cttcctgact caactgcaac cgtttctgaa actgaaacag
300 aaacaggcaa acctggttct gaaaattatc gaacagctgc cgtctgcaaa
agaatccccg 360 gacaaattcc tggaagtttg tacctgggtg gatcagattg
cagctctgaa cgattctaag 420 acgcgtaaaa ccacttctga aaccgttcgt
gctgtgctgg acagcctgag cgagaagaag 480 aaatcctccc cg 492 4 492 DNA
artificial sequence non homologous I-Cre I 4 atggccaaca ctaagtacaa
taaagaattt ctcctgtatc tggcaggttt cgtcgacggc 60 gatggctcca
ttatcgcaca gatcaagccg aatcagagct acaagtttaa acaccaactg 120
tctctcactt tccaggttac ccagaaaact caacgtcgct ggttcctgga taagctggta
180 gatgagatcg gtgtgggcta tgtacgcgac cgtggctctg tgagcgacta
tatcctgtct 240 gagattaaac cactgcataa ttttctgacc cagctgcagc
cgttcctcaa gctgaagcaa 300 aaacaggcca atctcgtgct gaagatcatt
gagcaactgc catccgccaa agagtctccg 360 gataaatttc tggaggtctg
cacttgggtt gaccaaatcg ctgcactcaa cgactccaaa 420 acccgcaaga
cgaccagcga gactgtacgc gcagttctgg attctctctc cgaaaaaaag 480
aagtctagcc cg 492 5 492 DNA artificial sequence template I-Cre I 5
atggccaata ccaaatataa caaagagttc ctgctgtacc tggccggctt tgtggacggt
60 gacggtagca tcatcgctca gattaaacca aaccagtctt ataagtttaa
acatcagcta 120 agcttgacct ttcaggtgac tcaaaagacc cagcgccgtt
ggtttctgga caaactagtg 180 gatgaaattg gcgttggtta cgtacgtgat
cgcggatccg tttccaacta catcttaagc 240 gaaatcaagc cgctgcacaa
cttcctgact caactgcagc cgtttctgaa actgaaacag 300 aaacaggcaa
acctggttct gaaaattatc gaacagctgc cgtctgcaaa agaatccccg 360
gacaaattcc tggaagtttg tacctgggtg gatcagattg cagctctgaa cgattctaag
420 acgcgtaaaa ccacttctga aaccgttcgt gctgtgctgg acagcctgag
cgagaagaag 480 aaatcctccc cg 492 6 42 DNA artificial sequence
UlibfIor primer 6 acgacggcca gtgaattcac catggccaat accaaatata ac 42
7 75 DNA artificial sequence UlibIrev primer 7 cacctgaaag
gtcaagctta gmbbatgttt aaacttmbba gactgmbbtg gmbbaatmbb 60
agcgatgatg ctacc 75 8 49 DNA artificial sequence UlibIIfor primer 8
gtttaaacat cagctaagct tgacctttvv kgtgactcaa aagacccag 49 9 45 DNA
artificial sequence UlibIIrev primer 9 gatgtagttg gaaacggatc
cmbbatcmbb tacgtaacca acgcc 45
* * * * *