Antisense modulation of interleukin 12 P35 subunit expression

Abstract

Compounds, compositions and methods are provided for modulating the expression of Interleukin 12 p35 subunit. The compositions comprise chemically modified antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Interleukin 12 p35 subunit. Methods of using these compounds for modulation of Interleukin 12 p35 subunit expression and for treatment of diseases associated with expression of Interleukin 12 p35 subunit are provided.

Description

RELATED APPLICATIONS

[0001] This application is a continuation-in-part of U.S. patent application Ser. No. 10/476,960, filed Nov. 7, 2003, which is a United States National Phase of PCT/US02/13871, filed May 1, 2002, which claims priority to and is a continuation (PCT) of U.S. patent application Ser. No. 09/851,520, filed May 7, 2001 now issued as U.S. Pat. No. 6,399,379. This application is also a continuation-in-part of U.S. patent application Ser. No. 10/667,236, filed Sep. 17, 2003. This application is also a continuation-in-part of U.S. patent application Ser. No. 10/038,335, filed Jan. 2, 2002, which is a continuation-in-part of U.S. patent application Ser. No. 09/299,058, filed Apr. 23, 1999, which is a continuation of U.S. patent application Ser. No. 08/403,888, filed Jun. 12, 1995 now issued as U.S. Pat. No. 5,952,490, which is a United States National Phase of PCT/US93/09297, filed Sep. 29, 1993, which claims priority to and is a continuation (PCT) of U.S. patent application Ser. No. 07/954,185, filed Sep. 29, 1992. This application is also a continuation-in-part of U.S. patent application Ser. No. 10/515,546, filed Nov. 23, 2004, which is a United States National Phase of PCT/US03/18312, filed Jun. 10, 2003, which claims priority to and is a continuation (PCT) of U.S. patent application Ser. No. 60/388,100, filed Jun. 11, 2002. This application is also a continuation-in-part of U.S. patent application Ser. No. 10/512,739, filed Oct. 27, 2004, which is a United States National Phase of PCT/US03/18320, filed Jun. 10, 2003, which claims priority to and is a continuation (PCT) of U.S. patent application Ser. No. 60/388,074, filed Jun. 11, 2002. This application is also a continuation-in-part of U.S. patent application Ser. No. 10/515,545, filed Nov. 23, 2004, which is a United States National Phase of PCT/US03/18258, filed Jun. 10, 2003, which claims priority to and is a continuation (PCT) of U.S. patent application Ser. No. 60/388,118, filed Jun. 11, 2002. This application is also a continuation-in-part of U.S. patent application Ser. No. 10/188,883, filed Jul. 2, 2002. This application is also a continuation-in-part of U.S. patent application Ser. No. 10/464,158, filed Jun. 18, 2003, which is a continuation-in-part of U.S. patent application Ser. No. 09/857,278, filed Sep. 24, 2001, which is a United States National Phase of PCT/US99/13624, filed Jun. 16, 1999, which claims priority to and is a continuation (PCT) of U.S. patent application Ser. No. 09/205,204, filed Dec. 3, 1998 now issued as U.S. Pat. No. 5,958,772. This application also claims priority to U.S. patent application Ser. No. 10/070,789, filed Aug. 6, 2002, which is a United States National Phase of PCT/US00/00583, filed Jan. 11, 2000, which claims priority to and is a continuation (PCT) of U.S. patent application Ser. No. 09/392,580, filed Sep. 9, 1999 now issued as U.S. Pat. No. 6,087,173. This application is also a continuation-in-part of U.S. patent application Ser. No. 11/048,271, filed Feb. 1, 2005, which is a continuation of U.S. patent application Ser. No. 10/197,290, filed Jul. 16, 2002, which is a continuation-in-part of U.S. patent application Ser. No. 09/857,299, filed Oct. 4, 2001, which is a United States National Phase of PCT/US99/22083, filed Sep. 23, 1999, which claims priority to and is a continuation (PCT) of U.S. patent application Ser. No. 09/205,144, filed Dec. 3, 1998 now issued as U.S. Pat. No. 5,958,771. The entire contents of each the above applications and patents are herein incorporated by reference.

FIELD OF THE INVENTION

[0002] The present invention provides compositions and methods for modulating the expression of Interleukin 12 p35 subunit. In particular, this invention relates to compounds, particularly oligonucleotides, specifically hybridizable with nucleic acids encoding Interleukin 12 p35 subunit. Such compounds have been shown to modulate the expression of Interleukin 12 p35 subunit.

BACKGROUND OF THE INVENTION

[0003] Cytokines are soluble factors produced by lymphocytes that regulate the survival, proliferation, differentiation, and homeostasis of cells involved in mediating the immune response. These factors do not only activate other lymphocytes, they also relay signals to non-lymphoid cells including macrophages, epithelial and stromal cells, creating a broad spectrum of cytokine activity that is critical to the maintenance of health. Consequently, much effort has been devoted to the study of these proteins.

[0004] Interleukin 12 (IL-12; formerly NKSF, for natural killer cell stimulatory factor, or CLMF, for cytotoxic lymphocyte maturation factor) is a cytokine produced by monocytes, macrophages, neutrophils, dendritic cells and antibody-producing B cells (Hall, Science, 1995, 268, 1432-1434) as well as keratinocytes and epidermoid carcinoma cell lines (Aragane et al., J. Immunol., 1994, 153, 5366-5372).

[0005] Interleukin 12 is responsible for activation of natural killer (NK) cells, T cells and induction of increased levels of interferon-gamma, a cytokine that helps to shape the immune response (Hall, Science, 1995, 268, 1432-1434). The combination of interferon-gamma and interleukin 12 sends a powerful signal to native precursor cells of the T helper lineage, shifting the immune system to a T.sub.H1-type immune response (Hall, Science, 1995, 268, 1432-1434). Generally, resistance to pathogens increases when interleukin 12 is present to drive a T.sub.H1 response (Hall, Science, 1995, 268, 1432-1434).

[0006] Interleukin 12 is unique among the cytokines because it is a disulfide-linked heterodimer composed of unrelated 40-kD (p40) and 35-kD (p35) subunits that are encoded by genes on separate chromosomes. The p35 and p40 subunits are localized to chromosomes 3p12-3q13.2 and 5q31-q33 respectively (Sieburth et al., Genomics, 1992, 14, 59-62). The p35 subunit shares structural similarities with the cytokines interleukin 6 and granulocyte colony-stimulating factor (Merberg et al., Immunol. Today, 1992, 13, 77-78). Alternatively, the p40 subunit is structurally related to the interleukin 6 receptor (Gearing and Cosman, Cell, 1991, 66, 9-10).

[0007] Disclosed and claimed in U.S. Pat. No. 5,457,038 and PCT publication WO 92/05206 is a DNA sequence coding for interleukin 12 or a subunit thereof (Trinchieri et al., 1995; Trinchieri et al., 1992).

[0008] cDNAs for both subunits of interleukin 12 were cloned in 1991 from a lymphoblastoid B-cell line (Gubler et al., Proc. Natl. Acad. Sci. USA, 1991, 88, 4143-4147). Both subunits are required to obtain the biologically active heterodimer (Gubler et al., Proc. Natl. Acad. Sci. USA, 1991, 88, 4143-4147) and p35 is only secreted as part of the heterodimer (D'Andrea et al., J Exp. Med., 1992, 176, 1387-1398) whereas p40 can be induced and secreted independently (Snijders et al., J. Immunol., 1996, 156, 1207-1212) and has no biological activity (Ling et al., J. Immunol., 1995, 154, 116-127). Bioactive murine and human single chain interleukin 12 fusion proteins expressed from retroviral constructs have been demonstrated to retain antitumor activity in vivo (Lieschke et al., Nat. Biotechnol., 1997, 15, 35-40).

[0009] Interleukin 12 has been found to be upregulated in vivo during murine lipopolysaccharide-induced endotoxemia and to stimulate the synthesis of interferon-gamma (Heinzel et al., Infect. Immun., 1994, 62, 4244-4249). However, pretreatment of the mice with anti-interleukin 12 antibodies caused a reduction in interferon-gamma levels after lipopolysaccharide injection (Heinzel et al., Infect. Immun., 1994, 62, 4244-4249).

[0010] Astrocyte-targeted expression of both interleukin 12 p35 and p40 genes in mice promoted the spontaneous development of a severe neuroimmunological disorder with many features resembling those of experimental allergic encephalomyelitis (EAE) (Pagenstecher et al., J. Immunol., 2000, 164, 4481-4492).

[0011] Analysis of the cytokine pattern expressed in situ in inhalant allergen patch test reactions of atopic dermatitis patients indicate increased expression of interleukin 12 p35 subunit. This upregulation of the p35 subunit may contribute to the observed switch of the cytokine secretion pattern (Grewe et al., J. Invest. Dermatol., 1995, 105, 407-410).

[0012] Structure-function analysis of the mouse interleukin 12 p35 subunit has indicated that p35 participates in both receptor binding and signaling (Zou et al., J. Biol. Chem., 1995, 270, 5864-5871).

[0013] Tone et al. have determined that the murine interleukin 12 p35 subunit has multiple transcription start sites and can initiate from either of two 5' exons, resulting in mRNA isoforms with different 5' untranslated regions (Tone et al., Eur. J. Immunol., 1996, 26, 1222-1227). In a separate study, the same research group found that p35 subunit mRNA was up-regulated by lipopolysaccharide stimulation of murine B cell lymphoma line A20 and in bone marrow-derived dendritic cells (Babik et al., J. Immunol., 1999, 162, 4069-4078). Four p35 subunit mRNA isoforms were found in both cell types and transcription was found to initiate from alternate positions after lipopolysaccharide stimulation. Further regulation of p35 subunit was observed at the translational level in addition to the transcriptional level (Babik et al., J. Immunol., 1999, 162, 4069-4078).

[0014] Interleukin 12 p35 and p40 antisense probes were used in in situ hybridization studies that identified enhanced interleukin 12 transcription in the gastric mucosa of pediatric patients with Crohn's disease (Berrebi et al., Am. J. Pathol., 1998, 152, 667-672).

[0015] The homodimer of the interleukin 12 p40 subunit (also known as (p40).sub.2) has been found to be a very potent inhibitor of interleukin 12 activity (Gillessen et al., Eur. J. Immunol., 1995, 25, 200-206; Ling et al., J. Immunol., 1995, 154, 116-127) and functions by binding to the interleukin 12 receptor (Ling et al., J. Immunol., 1995, 154, 116-127). The p40 homodimer was used as an antagonist of interleukin 12 in investigative treatments of mice with cyclophosphamide-induced diabetes and found to dampen islet formation (Rothe et al., Diabetologia, 1997, 40, 641-646). The p40 homodimer was found to inhibit the antitumor activity of the interleukin 12 heterodimer and the induction of interferon-gamma in murine bladder carcinoma in vivo. (Chen et al., J. Immunol., 1997, 159, 351-359).

[0016] Carter et al. have produced antibodies to recombinant human interleukin 12 which have been demonstrated to neutralize the biological activity of interleukin 12. However, essentially all antibodies were generated to the p40 subunit, possibly due to conformational limitations of the intact interleukin 12 heterodimer (Carter et al., Hybridoma, 1997, 16, 363-369). Larsson et al. have reported an immunoassay that only recognized the bioactive human interleukin 12 heterodimer and not the individual p35 and p40 subunits (Larsson and Linden, Cytokine, 1998, 10, 786-789). Disclosed and claimed in PCT publication WO 99/37682 are anti-human interleukin 12 antibodies that are characterized by specificity to the interleukin 12 heterodimer but do not bind to the interleukin 12 p40 subunit (Gately and Presky, 1999).

[0017] Disclosed and claimed in PCT Publication WO 00/28000 is a genetically modified immature dendritic cell which is capable of maturation, in which one or more endogenous gene(s) have been inactivated, and wherein the inactivated endogenous gene(s) comprise any of: B7-1, IL-12, the p35 or p40 subunit of IL-12. Further claimed is a composition comprising said cell, use of the cell of any one of the preceding claims for the manufacture of a medicament for use in therapy or prophylaxis, a process for the manufacture of a medicament for use in therapy of said cell, a method for producing dendritic cells which method comprises providing a population of embryonic stem (ES) cells, culturing the ES cells in the presence of a cytokine or combination of cytokines which bring about differentiation of the ES cells into dendritic cells, and recovering the dendritic cells from the culture, wherein the ES cells are genetically modified so as to inactivate at least one copy of at least one gene, for example by homologous recombination or antisense technology (Waldmann, et al., 2000).

[0018] In investigations of the mechanisms of anti-inflammatory effects of corticosteriods budesonide was found to inhibit production of bioactive interleukin 12 in human monocytes (Larsson and Linden, Cytokine, 1998, 10, 786-789).

[0019] Pentoxifylline, a non-specific phosphodiesterase inhibitor exhibited complex effects on the expression of interleukin 12. The production of interleukin 12 p35 subunit was inhibited but, the production of the p40 subunit was enhanced (Marcinkiewicz et al., Immunopharmacology, 2000, 49, 335-343).

[0020] The involvement of interleukin 12 p35 subunit in immune system regulation and as well as viral and bacterial infections make it a potentially useful therapeutic target for intervention in autoimmune diseases. Currently, inhibitors of the interleukin 12 p35 subunit and/or the interleukin 12 heterodimer include the p40 homodimer, antibodies and small molecules such as corticosteroids and the phosphodiesterase inhibitor pentoxyfylline. Consequently, there remains a long felt need for additional agents capable of effectively and selectively inhibiting the function of the interleukin 12 p35 subunit.

[0021] Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of expression of the interleukin 12 p35 subunit.

[0022] The present invention provides compositions and methods for modulating expression of the interleukin 12 p35 subunit, including modulation of alternative splice variants of the p35 subunit.

SUMMARY OF THE INVENTION

[0023] The present invention is directed to compounds, particularly chemically modified antisense oligonucleotides, which are targeted to a nucleic acid encoding Interleukin 12 p35 subunit, and which modulate the expression of Interleukin 12 p35 subunit. Pharmaceutical and other compositions comprising the compounds of the invention are also provided. Further provided are methods of modulating the expression of Interleukin 12 p35 subunit in cells or tissues comprising contacting said cells or tissues with one or more of the antisense compounds or compositions of the invention. Further provided are methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of Interleukin 12 p35 subunit by administering a therapeutically or prophylactically effective amount of one or more of the antisense compounds or compositions of the invention.

DETAILED DESCRIPTION OF THE INVENTION

[0024] The present invention employs oligomeric compounds, particularly antisense oligonucleotides, for use in modulating the function of nucleic acid molecules encoding Interleukin 12 p35 subunit, ultimately modulating the amount of Interleukin 12 p35 subunit produced. This is accomplished by providing antisense compounds which specifically hybridize with one or more nucleic acids encoding Interleukin 12 p35 subunit. As used herein, the terms "target nucleic acid" and "nucleic acid encoding Interleukin 12 p35 subunit" encompass DNA encoding Interleukin 12 p35 subunit, RNA (including pre-mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA. The specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid. This modulation of function of a target nucleic acid by compounds which specifically hybridize to it is generally referred to as "antisense". The functions of DNA to be interfered with include replication and transcription. The functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA. The overall effect of such interference with target nucleic acid function is modulation of the expression of Interleukin 12 p35 subunit. In the context of the present invention, "modulation" means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene. In the context of the present invention, inhibition is the preferred form of modulation of gene expression and mRNA is a preferred target.

[0025] It is preferred to target specific nucleic acids for antisense. "Targeting" an antisense compound to a particular nucleic acid, in the context of this invention, is a multistep process. The process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target is a nucleic acid molecule encoding Interleukin 12 p35 subunit. The targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result. Within the context of the present invention, a preferred intragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Since, as is known in the art, the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon," the "start codon" or the "AUG start codon". A minority of genes have a translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo. Thus, the terms "translation initiation codon" and "start codon" can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, "start codon" and "translation initiation codon" refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding Interleukin 12 p35 subunit, regardless of the sequence(s) of such codons.

[0026] It is also known in the art that a translation termination codon (or "stop codon") of a gene may have one of three sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences are 5'-TAA, 5'-TAG and 5'-TGA, respectively). The terms "start codon region" and "translation initiation codon region" refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon. Similarly, the terms "stop codon region" and "translation termination codon region" refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon.

[0027] The open reading frame (ORF) or "coding region," which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Other target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA or corresponding nucleotides on the gene. The 5' cap of an mRNA comprises an N7-methylated guanosine residue joined to the 5'-most residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap. The 5' cap region may also be a preferred target region.

[0028] Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns," which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as "exons" and are spliced together to form a continuous mRNA sequence. mRNA splice sites, i.e., intron-exon junctions, may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred targets. It has also been found that introns can also be effective, and therefore preferred, target regions for antisense compounds targeted, for example, to DNA or pre-mRNA.

[0029] Once one or more target sites have been identified, oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.

[0030] In the context of this invention, "hybridization" means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. "Complementary," as used herein, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position. The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.

[0031] Antisense and other compounds of the invention which hybridize to the target and inhibit expression of the target are identified through experimentation, and the sequences of these compounds are hereinbelow identified as preferred embodiments of the invention. The target sites to which these preferred sequences are complementary are hereinbelow referred to as "active sites" and are therefore preferred sites for targeting. Therefore another embodiment of the invention encompasses compounds which hybridize to these active sites.

[0032] Antisense compounds are commonly used as research reagents and diagnostics. For example, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes. Antisense compounds are also used, for example, to distinguish between functions of various members of a biological pathway. Antisense modulation has, therefore, been harnessed for research use.

[0033] For use in kits and diagnostics, the antisense compounds of the present invention, either alone or in combination with other antisense compounds or therapeutics, can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues.

[0034] Expression patterns within cells or tissues treated with one or more antisense compounds are compared to control cells or tissues not treated with antisense compounds and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds which affect expression patterns.

[0035] Examples of methods of gene expression analysis known in the art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett., 2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE (serial analysis of gene expression)(Madden, et al., Drug Discov. Today, 2000, 5, 415-425), READS (restriction enzyme amplification of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999, 303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 1976-81), protein arrays and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16; Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), expressed sequence tag (EST) sequencing (Celis, et al., FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57), subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal. Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41, 203-208), subtractive cloning, differential display (DD) (Jurecic and Belmont, Curr. Opin. Microbiol, 2000, 3, 316-21), comparative genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl., 1998, 31, 286-96), FISH (fluorescent in situ hybridization) techniques (Going and Gusterson, Eur. J. Cancer, 1999, 35, 1895-904) and mass spectrometry methods (reviewed in (To, Comb. Chem. High Throughput Screen, 2000, 3, 23541).

[0036] The specificity and sensitivity of antisense is also harnessed by those of skill in the art for therapeutic uses. Antisense oligonucleotides have been employed as therapeutic moieties in the treatment of disease states in animals and man. Antisense oligonucleotide drugs, including ribozymes, have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that oligonucleotides can be useful therapeutic modalities that can be configured to be useful in treatment regimes for treatment of cells, tissues and animals, especially humans.

[0037] In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes single-stranded and double-stranded oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent intemucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.

[0038] While the one form of antisense compound is a single-stranded antisense oligonucleotide, in many species the introduction of double-stranded structures, such as double-stranded RNA (dsRNA) molecules, has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. This phenomenon occurs in both plants and animals and is believed to have an evolutionary connection to viral defense and transposon silencing.

[0039] The first evidence that dsRNA could lead to gene silencing in animals came in 1995 from work in the nematode, Caenorhabditis elegans (Guo and Kempheus, Cell, 1995, 81, 611-620). Montgomery et al. have shown that the primary interference effects of dsRNA are posttranscriptional (Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507). The posttranscriptional antisense mechanism defined in Caenorhabditis elegans resulting from exposure to double-stranded RNA (dsRNA), also refered to as small interfering RNA (siRNA), has since been designated as RNA interference (RNAi). This term has been generalized to mean antisense-mediated gene silencing involving the introduction of dsRNA leading to the sequence-specific reduction of endogenous targeted mRNA levels (Fire et al., Nature, 1998, 391, 806-811). It has further been confirmed that it is, in fact, the single-stranded RNA oligomers of antisense polarity of the dsRNAs which are the potent inducers of RNAi (Tijsterman et al., Science, 2002, 295, 694-697).

[0040] While antisense oligonucleotides are a preferred form of antisense compound, the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics such as are described below. The antisense compounds in accordance with this invention preferably comprise from about 8 to about 50 nucleobases (i.e. from about 8 to about 50 linked nucleosides). Particularly preferred antisense compounds are antisense oligonucleotides, even more preferably are antisense compounds comprising from about 15 to about 30 nucleobases. Antisense compounds include single-stranded and double-stranded oligonucleotides (including siRNA), ribozymes, external guide sequence (EGS) oligonucleotides (oligozymes), and other short catalytic RNAs or catalytic oligonucleotides which hybridize to the target nucleic acid and modulate its expression, such antisense compounds can have chemical modifications such as those described below. A preferred form of the invention is an antisense compound which further comprises a sense strand such that the antisense compound is double-stranded, even more preferably such double-stranded antisense compound is chemically modified siRNA.

[0041] As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentoftiranosyl sugar, the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.

[0042] Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.

[0043] Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriest- ers, selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Preferred oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.

[0044] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.

[0045] Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH.sub.2 component parts.

[0046] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.

[0047] In other preferred oligonucleotide mimetics, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.

[0048] Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular --CH.sub.2--NH--O--CH.sub.2--, --CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene (methylimino) or MMI backbone], --CH.sub.2--O--N(CH.sub.3)--CH.sub.2--, --CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and --O--N(CH.sub.3)--CH.sub.2--CH.sub.2--[wherein the native phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of the above referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above referenced U.S. Pat. No. 5,602,240. Also preferred are oligonucleotides having morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.

[0049] Modified oligonucleotides may also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; O--, S--, or N-alkyl; O--, S--, or N-alkenyl; O--, S--or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Particularly preferred are O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.su- b.3)].sub.2, where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2' position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE, as described in examples hereinbelow, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2, also described in examples hereinbelow.

[0050] A further prefered modification includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. The linkage is preferably a methelyne (--CH.sub.2--).sub.n group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226.

[0051] Other preferred modifications include 2'-methoxy (2'-O-CH.sub.3), 2'-aminopropoxy (2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), 2'-allyl (2'-CH.sub.2--CH.dbd.CH.sub.2), 2'-O-allyl (2'-O--CH.sub.2--CH.dbd.CH.sub- .2) and 2'-fluoro (2'-F). The 2'-modification may be in the arabino (up) position or ribo (down) position. A preferred 2'-arabino modification is 2'-F. Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.

[0052] Oligonucleotides may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (--C.ident.C--CH.sub.3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido[5,4-b][1,4]benzoxazi- n-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-- 2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2.degree. C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0053] Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference, and U.S. Pat. No. 5,750,692, which is commonly owned with the instant application and also herein incorporated by reference.

[0054] Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. The compounds of the invention can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugates groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhoda-mines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve oligomer uptake, enhance oligomer resistance to degradation, and/or strengthen sequence-specific hybridization with RNA. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve oligomer uptake, distribution, metabolism or excretion. Representative conjugate groups are disclosed in International Patent Application PCT/US92/09196, filed Oct. 23, 1992 the entire disclosure of which is incorporated herein by reference. Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glyc- ero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937. Oligonucleotides of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15, 1999) which is incorporated herein by reference in its entirety.

[0055] Representative U.S. patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717,5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference.

[0056] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide. The present invention also includes antisense compounds which are chimeric compounds. "Chimeric" antisense compounds or "chimeras," in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

[0057] Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative U.S. patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.

[0058] The antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.

[0059] The antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules. The compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative U.S. patents that teach the preparation of such uptake, distribution and/or absorption assisting formulations include, but are not limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is herein incorporated by reference.

[0060] The antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.

[0061] The term "prodrug" indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2-thioethyl)phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published Dec. 9, 1993 or in WO 94/26764 and U.S. Pat. No. 5,770,713 to Imbach et al.

[0062] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0063] Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium, and the like. Examples of suitable amines are N,N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, for example, Berge et al., "Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 1-19). The base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner. The free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner. The free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid for purposes of the present invention. As used herein, a "pharmaceutical addition salt" includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines. Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates. Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as for example hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids or N-substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid, nicotinic acid or isonicotinic acid; and with amino acids, such as the 20 alpha-amino acids involved in the synthesis of proteins in nature, for example glutamic acid or aspartic acid, and also with phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid, benzenesulfonic acid, 4-methylbenzenesulfonic acid, naphthalene-2-sulfonic acid, naphthalene-1,5-disulfonic acid, 2- or 3-phosphoglycerate, glucose-6-phosphate, N-cyclohexylsulfamic acid (with the formation of cyclamates), or with other acid organic compounds, such as ascorbic acid. Pharmaceutically acceptable salts of compounds may also be prepared with a pharmaceutically acceptable cation. Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkaline, alkaline earth, ammonium and quaternary ammonium cations. Carbonates or hydrogen carbonates are also possible.

[0064] For oligonucleotides, preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine.

[0065] The antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits. For therapeutics, an animal, preferably a human, suspected of having a disease or disorder which can be treated by modulating the expression of Interleukin 12 p35 subunit is treated by administering antisense compounds in accordance with this invention. The compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the antisense compounds and methods of the invention may also be useful prophylactically, e.g., to prevent or delay infection, inflammation or tumor formation, for example.

[0066] The antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding Interleukin 12 p35 subunit, enabling sandwich and other assays to easily be constructed to exploit this fact. Hybridization of the antisense oligonucleotides of the invention with a nucleic acid encoding Interleukin 12 p35 subunit can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of Interleukin 12 p35 subunit in a sample may also be prepared.

[0067] The present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration.

[0068] Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful. Preferred topical formulations include those in which the oligonucleotides of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). Oligonucleotides of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, oligonucleotides may be complexed to lipids, in particular to cationic lipids. Preferred fatty acids and esters include but are not limited arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C.sub.1-10 alkyl ester (e.g. isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof. Topical formulations are described in detail in U.S. patent application Ser. No. 09/315,298 filed on May 20, 1999 which is incorporated herein by reference in its entirety.

[0069] Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Preferred oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators. Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Prefered bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusid- ate, sodium glycodihydrofusidate,. Prefered fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g. sodium). Also prefered are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts. A particularly prefered combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Oligonucleotides of the invention may be delivered orally in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oligonucleotide complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches. Particularly preferred complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylamino-methylethylene P(TDAE), polyaminostyrene (e.g. p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for oligonucleotides and their preparation are described in detail in U.S. application Ser. No. 08/886,829 (filed Jul. 1, 1997), Ser. No. 09/108,673 (filed Jul. 1, 1998), Ser. No. 09/256,515 (filed Feb. 23, 1999), Ser. No. 09/082,624 (filed May 21, 1998) and Ser. No. 09/315,298 (filed May 20, 1999) each of which is incorporated herein by reference in their entirety.

[0070] Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

[0071] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.

[0072] The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

[0073] The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

[0074] In one embodiment of the present invention the pharmaceutical compositions may be formulated and used as foams. Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product. The preparation of such compositions and formulations is generally known to those skilled in the pharmaceutical and formulation arts and may be applied to the formulation of the compositions of the present invention.

[0075] Emulsions

[0076] The compositions of the present invention may be prepared and formulated as emulsions. Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 .mu.m in diameter. (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising of two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions may be either water-in-oil (w/o) or of the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersed phases and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed. Pharmaceutical emulsions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous provides an o/w/o emulsion.

[0077] Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion. Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0078] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).

[0079] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.

[0080] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0081] Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.

[0082] Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

[0083] The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of reasons of ease of formulation, efficacy from an absorption and bioavailability standpoint. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.

[0084] In one embodiment of the present invention, the compositions of oligonucleotides and nucleic acids are formulated as microemulsions. A microemulsion may be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, N.Y., pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

[0085] The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.

[0086] Surfactants used in the preparation of nicroemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C 10 glycerides, vegetable oils and silicone oil.

[0087] Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides or oligonucleotides. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of oligonucleotides and nucleic acids within the gastrointestinal tract, vagina, buccal cavity and other areas of administration.

[0088] Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the oligonucleotides and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories--surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.

[0089] Liposomes

[0090] There are many organized surfactant structures besides microemulsions that have been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers and vesicles. Vesicles, such as liposomes, have attracted great interest because of their specificity and the duration of action they offer from the standpoint of drug delivery. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.

[0091] Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Non-cationic liposomes, although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.

[0092] In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome which is highly deformable and able to pass through such fine pores.

[0093] Further advantages of liposomes include; liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.

[0094] Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes. As the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.

[0095] Liposomal formulations have been the focus of extensive investigation as the mode of delivery for many drugs. There is growing evidence that for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side-effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin.

[0096] Several reports have detailed the ability of liposomes to deliver agents including high-molecular weight DNA into the skin. Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis.

[0097] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

[0098] Liposomes which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

[0099] One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.

[0100] Several studies have assessed the topical delivery of liposomal drug formulations to the skin. Application of liposomes containing interferon to guinea pig skin resulted in a reduction of skin herpes sores while delivery of interferon via other means (e.g. as a solution or as an emulsion) were ineffective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an additional study tested the efficacy of interferon administered as part of a liposomal formulation to the administration of interferon using an aqueous system, and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265).

[0101] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome.TM. I (glyceryl dilaurate/cholesterol/po- lyoxyethylene-10-stearyl ether) and Novasome.TM. II (glyceryl distearate/ cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al. S.T.P. Pharma. Sci., 1994, 4, 6, 466).

[0102] Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G.sub.M1, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

[0103] Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphat- idylcholine are disclosed in WO 97/13499 (Lim et al.).

[0104] Many liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C.sub.1215G, that contains a PEG moiety. Illum et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives. Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols (e.g., PEG) are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments demonstrating that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate have significant increases in blood circulation half-lives. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extended such observations to other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes having covalently bound PEG moieties on their external surface are described in European Patent No. EP 0 445 131 B1 and WO 90/04384 to Fisher. Liposome compositions containing 1-20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and European Patent No. EP 0 496 813 B1). Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al.). U.S. Pat. No. 5,540,935 (Miyazaki et al.) and U.S. Pat. No. 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that can be further derivatized with functional moieties on their surfaces.

[0105] A limited number of liposomes comprising nucleic acids are known in the art. WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes. U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include an antisense RNA. U.S. Pat. No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes. WO 97/04787 to Love et al. discloses liposomes comprising antisense oligonucleotides targeted to the raf gene.

[0106] Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g. they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[0107] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0108] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

[0109] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

[0110] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.

[0111] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.

[0112] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0113] Penetration Enhancers

[0114] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligonucleotides, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.

[0115] Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.

[0116] Surfactants: In connection with the present invention, surfactants (or "surface-active agents") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of oligonucleotides through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and perfluorochemical emulsions, such as FC43. Takahashi et al., J. Pharm. Pharmacol, 1988, 40, 252).

[0117] Fatty acids: Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C.sub.1-10 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

[0118] Bile salts: The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

[0119] Chelating Agents: Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of oligonucleotides through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Chelating agents of the invention include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

[0120] Non-chelating non-surfactants: As used herein, non-chelating non-surfactant penetration enhancing compounds can be defmed as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of oligonucleotides through the alimentary mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers include, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

[0121] Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of oligonucleotides.

[0122] Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.

[0123] Carriers

[0124] Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate oligonucleotide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., Antisense Res. Dev., 1995, 5, 115-121; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183).

[0125] Excipients

[0126] In contrast to a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).

[0127] Pharmaceutically acceptable organic or inorganic excipient suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0128] Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.

[0129] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0130] Other Components

[0131] The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.

[0132] Aqueous suspensions may contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

[0133] Certain embodiments of the invention provide pharmaceutical compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism. Examples of such chemotherapeutic agents include but are not limited to daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphor- amide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed. 1987, pp. 1206-1228, Berkow et al., eds., Rahway, N.J. When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively). Other non-antisense chemotherapeutic agents are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.

[0134] In another related embodiment, compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.

[0135] The formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC.sub.50s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 ug to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight, once or more daily, to once every 20 years.

[0136] While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same. Each of the references, GenBank accession numbers, U.S. patents and the like recited in the present application is incorporated herein by reference in its entirety.

EXAMPLES

Example 1

[0137] Synthesis of Nucleoside Phosphoramidites

[0138] The following compounds, including amidites and their intermediates were prepared as described in U.S. Pat. No. 6,426,220 and published PCT WO 02/36743; 5'-O-Dimethoxytrityl-thymidine intermediate for 5-methyl dC amidite, 5'-O-Dimethoxytrityl-2'-deoxy-5-methylcytidine intermediate for 5-methyl-dC amidite, 5'-O-Dimethoxytrityl-2'-deoxy-N4-benzoyl-5-methylcyt- idine penultimate intermediate for 5-methyl dC amidite, [5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-deoxy-N4-benzoyl-5-methylcytidin- -3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (5-methyl dC amidite), 2'-Fluorodeoxyadenosine, 2'-Fluorodeoxyguanosine, 2'-Fluorouridine, 2'-Fluorodeoxycytidine, 2'-O-(2-Methoxyethyl) modified amidites, 2'-O-(2-methoxyethyl)-5-methyluridine intermediate, 5'-O-DMT-2'-O-(2-methoxyethyl)-5-methyluridine penultimate intermediate, [5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-5-methyluridi- n-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE T amidite), 5'-O-Dimethoxytrityl-2'-O-(2-methoxyethyl)-5-methylcytidine intermediate, 5'-O-dimethoxytrityl-2'-O-(2-methoxyethyl)-N4-benzoyl-5-methyl-cytidine penultimate intermediate, [5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-m- ethoxyethyl)-N4-benzoyl-5-methylcytidin-3'-O-yl]-2-cyanoethyl-N,N-diisopro- pylphosphoramidite (MOE 5-Me-C amidite), [5'-O-(4,4'-Dimethoxytriphenylmet- hyl)-2'-O-(2-methoxyethyl)-N6-benzoyladenosin-3'-O-yl]-2-cyanoethyl-N,N-di- isopropylphosphoramidite (MOE A amdite), [5'-O-(4,4'-Dimethoxytriphenylmet- hyl)-2'-O-(2-methoxyethyl)-N4-isobutyrylguanosin-3'-O-yl]-2-cyanoethyl-N,N- -diisopropylphosphoramidite (MOE G amidite), 2'-O-(Aminooxyethyl) nucleoside amidites and 2'-O-(dimethylaminooxyethyl) nucleoside amidites, 2'-(Dimethylaminooxyethoxy) nucleoside amidites, 5'-O-tert-Butyldiphenyls- ilyl-O2-2'-anhydro-5-methyluridine, 5'-O-tert-Butyldiphenylsilyl-2'-O-(2-h- ydroxyethyl)-5-methyluridine, 2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiph- enylsilyl-5-methyluridine, 5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoxi- minooxy)ethyl]-5-methyluridine, 5'-O-tert-Butyldiphenylsilyl-2'-O-[N,N dimethylaminooxyethyl]-5-methyluridine, 2'-O-(dimethylaminooxyethyl)-5-me- thyluridine, 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine, 5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoe- thyl)-N,N-diisopropylphosphoramidite], 2'-(Aminooxyethoxy) nucleoside amidites, N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(- 4,4'-dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphora- midite], 2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites, 2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl uridine, 5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine and 5'-O-Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl- )]-5-methyl uridine-3'-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite.

Example 2

[0139] Oligonucleotide and Oligonucleoside Synthesis

[0140] The antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.

[0141] Oligonucleotides: Unsubstituted and substituted phosphodiester (P.dbd.O) oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 394) using standard phosphoramidite chemistry with oxidation by iodine.

[0142] Phosphorothioates (P.dbd.S) are synthesized similar to phosphodiester oligonucleotides with the following exceptions: thiation was effected by utilizing a 10% w/v solution of 3,H-1,2-benzodithiole-3-o- ne 1,1-dioxide in acetonitrile for the oxidation of the phosphite linkages. The thiation reaction step time was increased to 180 sec and preceded by the normal capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55.quadrature.C (12-16 hr), the oligonucleotides were recovered by precipitating with >3 volumes of ethanol from a 1 M NH4OAc solution. Phosphinate oligonucleotides are prepared as described in U.S. Pat. No. 5,508,270, herein incorporated by reference.

[0143] Alkyl phosphonate oligonucleotides are prepared as described in U.S. Pat. No. 4,469,863, herein incorporated by reference.

[0144] 3'-Deoxy-3'-methylene phosphonate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,610,289 or 5,625,050, herein incorporated by reference.

[0145] Phosphoramidite oligonucleotides are prepared as described in U.S. Pat. No. 5,256,775 or U.S. Pat. No. 5,366,878, herein incorporated by reference.

[0146] Alkylphosphonothioate oligonucleotides are prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively), herein incorporated by reference.

[0147] 3'-Deoxy-3'-amino phosphoramidate oligonucleotides are prepared as described in U.S. Pat. No. 5,476,925, herein incorporated by reference.

[0148] Phosphotriester oligonucleotides are prepared as described in U.S. Pat. No. 5,023,243, herein incorporated by reference.

[0149] Borano phosphate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated by reference.

[0150] Oligonucleosides: Methylenemethylimino linked oligonucleosides, also identified as MMI linked oligonucleosides, methylenedimethylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, and methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligonucleosides, also identified as amide-4 linked oligonucleosides, as well as mixed backbone compounds having, for instance, alternating MMI and P.dbd.O or P.dbd.S linkages are prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289, all of which are herein incorporated by reference.

[0151] Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564, herein incorporated by reference.

[0152] Ethylene oxide linked oligonucleosides are prepared as described in U.S. Pat. No. 5,223,618, herein incorporated by reference.

Example 3

[0153] RNA Synthesis

[0154] In general, RNA synthesis chemistry is based on the selective incorporation of various protecting groups at strategic intermediary reactions. Although one of ordinary skill in the art will understand the use of protecting groups in organic synthesis, a useful class of protecting groups includes silyl ethers. In particular bulky silyl ethers are used to protect the 5'-hydroxyl in combination with an acid-labile orthoester protecting group on the 2'-hydroxyl. This set of protecting groups is then used with standard solid-phase synthesis technology. It is important to lastly remove the acid labile orthoester protecting group after all other synthetic steps. Moreover, the early use of the silyl protecting groups during synthesis ensures facile removal when desired, without undesired deprotection of 2' hydroxyl. Following this procedure for the sequential protection of the 5 '-hydroxyl in combination with protection of the 2'-hydroxyl by protecting groups that are differentially removed and are differentially chemically labile, RNA oligonucleotides were synthesized. RNA oligonucleotides are synthesized in a stepwise fashion. Each nucleotide is added sequentially (3'- to 5'-direction) to a solid support-bound oligonucleotide. The first nucleoside at the 3'-end of the chain is covalently attached to a solid support. The nucleotide precursor, a ribonucleoside phosphoramidite, and activator are added, coupling the second base onto the 5'-end of the first nucleoside. The support is washed and any unreacted 5'-hydroxyl groups are capped with acetic anhydride to yield 5'-acetyl moieties. The linkage is then oxidized to the more stable and ultimately desired P(V) linkage. At the end of the nucleotide addition cycle, the 5'-silyl group is cleaved with fluoride. The cycle is repeated for each subsequent nucleotide.

[0155] Following synthesis, the methyl protecting groups on the phosphates are cleaved in 30 minutes utilizing 1 M disodium-2-carbamoyl-2-cyanoethyl- ene-1,1-dithiolate trihydrate (S2Na2) in DMF. The deprotection solution is washed from the solid support-bound oligonucleotide using water. The support is then treated with 40% methylamine in water for 10 minutes at 55.degree. C. This releases the RNA oligonucleotides into solution, deprotects the exocyclic amines, and modifies the 2'-groups. The oligonucleotides can be analyzed by anion exchange HPLC at this stage. The 2'-orthoester groups are the last protecting groups to be removed. The ethylene glycol monoacetate orthoester protecting group developed by Dharmacon Research, Inc. (Lafayette, Colo.), is one example of a useful orthoester protecting group which, has the following important properties. It is stable to the conditions of nucleoside phosphoramidite synthesis and oligonucleotide synthesis. However, after oligonucleotide synthesis the oligonucleotide is treated with methylamine which not only cleaves the oligonucleotide from the solid support but also removes the acetyl groups from the orthoesters. The resulting 2-ethyl-hydroxyl substituents on the orthoester are less electron withdrawing than the acetylated precursor. As a result, the modified orthoester becomes more labile to acid-catalyzed hydrolysis. Specifically, the rate of cleavage is approximately 10 times faster after the acetyl groups are removed. Therefore, this orthoester possesses sufficient stability in order to be compatible with oligonucleotide synthesis and yet, when subsequently modified, permits deprotection to be carried out under relatively mild aqueous conditions compatible with the final RNA oligonucleotide product. Additionally, methods of RNA synthesis are well known in the art (Scaringe, S. A. Ph. D. Thesis, University of Colorado, 1996; Scaringe, S. A., et al., J. Am. Chem. Soc., 1998, 120, 11820-11821; Matteucci, M. D. and Caruthers, M. H. J. Am. Chem. Soc., 1981, 103, 3185-3191; Beaucage, S. L. and Caruthers, M. H. Tetrahedron Lett., 1981, 22, 1859-1862; Dahl, B. J., et al., Acta Chem. Scand,. 1990, 44, 639-641; Reddy, M. P., et al., Tetrahedrom Lett., 1994, 25, 4311-4314; Wincott, F. et al., Nucleic Acids Res., 1995, 23, 2677-2684; Griffin, B. E., et al., Tetrahedron, 1967, 23, 2301-2313; Griffin, B. E., et al., Tetrahedron, 1967, 23, 2315-2331). RNA antisense compounds (RNA oligonucleotides) of the present invention can be synthesized by the methods herein or purchased from Dharmacon Research, Inc (Lafayette, Colo.). Once synthesized, complementary RNA antisense compounds can then be annealed by methods known in the art to form double stranded (duplexed) antisense compounds. For example, duplexes can be formed by combining 30 .mu.l of each of the complementary strands of RNA oligonucleotides (50 uM RNA oligonucleotide solution) and 15 .mu.l of 5.times. annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, 2 mM magnesium acetate) followed by heating for 1 minute at 90.degree. C., then 1 hour at 37.degree. C. The resulting duplexed antisense compounds can be used in kits, assays, screens, or other methods to investigate the role of a target nucleic acid, or for diagnostic or therapeutic purposes.

Example 4

[0156] Synthesis of Chimeric Compounds

[0157] Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end" type wherein the "gap" segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as "gapmers" or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as "hemimers" or "wingmers".

[2'-O-Me]-[2'-deoxy]-[2'-O-Me] Chimeric Phosphorothioate Oligonucleotides

[0158] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate and 2'-deoxy phosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems automated DNA synthesizer Model 394, as above. Oligonucleotides are synthesized using the automated synthesizer and 2'-deoxy-5'-dimethoxytrityl-3'-O-phosphoramidite for the DNA portion and 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for 5' and 3' wings. The standard synthesis cycle is modified by incorporating coupling steps with increased reaction times for the 5'-dimethoxytrityl-2'-O-methyl-3'-O- -phosphoramidite. The fully protected oligonucleotide is cleaved from the support and deprotected in concentrated ammonia (NH4OH) for 12-16 hr at 55.degree. C. The deprotected oligo is then recovered by an appropriate method (precipitation, column chromatography, volume reduced in vacuo and analyzed spetrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry.

[2'-O-(2-Methoxyethyl)]-[2'-deoxy]-[2'-O-(Methoxyethyl)] Chimeric Phosphorothioate Oligonucleotides

[0159] [2'-O-(2-methoxyethyl)]-[2'-deoxy]-[-2'-O-(methoxyethyl)] chimeric phosphorothioate oligonucleotides were prepared as per the procedure above for the 2'-O-methyl chimeric oligonucleotide, with the substitution of 2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites.

[2'-O-(2-Methoxyethyl)Phosphodiester]-[2'-deoxy Phosphorothioate]-[2'-O-(2- -Methoxyethyl)Phosphodiester] Chimeric Oligonucleotides

[0160] [2'-O-(2-methoxyethyl phosphodiester]-[2'-deoxy phosphorothioate]-[2'-O-(methoxyethyl)phosphodiester] chimeric oligonucleotides are prepared as per the above procedure for the 2'-O-methyl chimeric oligonucleotide with the substitution of 2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites, oxidation with iodine to generate the phosphodiester internucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate intemucleotide linkages for the center gap.

[0161] Other chimeric oligonucleotides, chimeric oligonucleosides and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to U.S. Pat. No. 5,623,065, herein incorporated by reference.

Example 5

[0162] PNA Synthesis

[0163] Peptide nucleic acids (PNAs) are prepared in accordance with any of the various procedures referred to in Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 1996, 4, 5-23. They may also be prepared in accordance with U.S. Pat. Nos. 5,539,082, 5,700,922, and 5,719,262, herein incorporated by reference.

Example 6

[0164] Oligonucleotide Isolation

[0165] After cleavage from the controlled pore glass column (Applied Biosystems) and deblocking in concentrated ammonium hydroxide at 55.degree. C. for 18 hours, the oligonucleotides or oligonucleosides are purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides were analyzed by polyacrylamide gel electrophoresis on denaturing gels and judged to be at least 85% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in synthesis were periodically checked by .sup.31P nuclear magnetic resonance spectroscopy, and for some studies oligonucleotides were purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171. Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material.

Example 7

[0166] Oligonucleotide Synthesis--96 Well Plate Format

[0167] Oligonucleotides were synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a standard 96 well format. Phosphodiester intemucleotide linkages were afforded by oxidation with aqueous iodine. Phosphorothioate intemucleotide linkages were generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta-cyanoethyldiisopropyl phosphoramidites were purchased from commercial vendors (e.g. PE-Applied Biosystems, Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard nucleosides are synthesized as per known literature or patented methods. They are utilized as base protected beta-cyanoethyldiisopropyl phosphoramidites.

[0168] Oligonucleotides were cleaved from support and deprotected with concentrated NH.sub.4OH at elevated temperature (55-60.degree. C.) for 12-16 hours and the released product then dried in vacuo. The dried product was then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.

Example 8

[0169] Oligonucleotide Analysis--96 Well Plate Format

[0170] The concentration of oligonucleotide in each well was assessed by dilution of samples and UV absorption spectroscopy. The full-length integrity of the individual products was evaluated by capillary electrophoresis (CE) in either the 96 well format (Beckman P/ACE.TM. MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACE.TM. 5000, ABI 270). Base and backbone composition was confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates were diluted from the master plate using single and multi-channel robotic pipettors. Plates were judged to be acceptable if at least 85% of the compounds on the plate were at least 85% full length.

Example 9

[0171] Cell culture and Oligonucleotide Treatment

[0172] The effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following 5 cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, Ribonuclease protection assays, or RT-PCR.

[0173] T-24 Cells:

[0174] The human transitional cell bladder carcinoma cell line T-24 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). T-24 cells were routinely cultured in complete McCoy's 5A basal media (Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis.

[0175] For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.

[0176] A549 Cells:

[0177] The human lung carcinoma cell line A549 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). A549 cells were routinely cultured in DMEM basal media (Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence.

[0178] NHDF Cells:

[0179] Human neonatal dermal fibroblast (NHDF) were obtained from the Clonetics Corporation (Walkersville Md.). NHDFs were routinely maintained in Fibroblast Growth Medium (Clonetics Corporation, Walkersville Md.) supplemented as recommended by the supplier. Cells were maintained for up to 10 passages as recommended by the supplier.

[0180] HEK Cells:

[0181] Human embryonic keratinocytes (HEK) were obtained from the Clonetics Corporation (Walkersville Md.). HEKs were routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville Md.) formulated as recommended by the supplier. Cells were routinely maintained for up to 10 passages as recommended by the supplier.

[0182] HepG2 Cells:

[0183] The human hepatoblastoma cell line HepG2 was obtained from the American Type Culure Collection (Manassas, Va.). HepG2 cells were routinely cultured in Eagle's MEM supplemented with 10% fetal calf serum, non-essential amino acids, and 1 mM sodium pyruvate (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis.

[0184] For Northern blotting or other analyses, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.

[0185] Treatment With Antisense Compounds:

[0186] When cells reached 80% confluency, they were treated with oligonucleotide. For cells grown in 96-well plates, wells were washed once with 200 .mu.L OPTI-MEM.TM.-1 reduced-serum medium (Gibco BRL) and then treated with 130 .mu.L of OPTI-MEM.TM.-1 containing 3.75 .mu.g/mL LIPOFECTIN.TM. (Gibco BRL) and the desired concentration of oligonucleotide. After 4-7 hours of treatment, the medium was replaced with fresh medium. Cells were harvested 16-24 hours after oligonucleotide treatment.

[0187] The concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations. For human cells the positive control oligonucleotide is ISIS 13920, TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1, a 2'-O-methoxyethyl gapmer (2'-O-methoxyethyls shown in bold) with a phosphorothioate backbone which is targeted to human H-ras. For mouse or rat cells the positive control oligonucleotide is ISIS 15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 2, a 2'-O-methoxyethyl gapmer (2'-O-methoxyethyls shown in bold) with a phosphorothioate backbone which is targeted to both mouse and rat c-raf. The concentration of positive control oligonucleotide that results in 80% inhibition of c-Ha-ras (for ISIS 13920) or c-raf (for ISIS 15770) mRNA is then utilized as the screening concentration for new oligonucleotides in subsequent experiments for that cell line. If 80% inhibition is not achieved, the lowest concentration of positive control oligonucleotide that results in 60% inhibition of H-ras or c-raf mRNA is then utilized as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not achieved, that particular cell line is deemed as unsuitable for oligonucleotide transfection experiments.

Example 10

[0188] Analysis of Oligonucleotide Inhibition of Interleukin 12 p35 Subunit Expression

[0189] Antisense modulation of Interleukin 12 p35 subunit expression can be assayed in a variety of ways known in the art. For example, Interleukin 12 p35 subunit mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is presently preferred. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Northern blot analysis is routine in the art and is taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc., 1996. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM.TM. 7700 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.

[0190] Protein levels of Interleukin 12 p35 subunit can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELISA or fluorescence-activated cell sorting (FACS). Antibodies directed to Interleukin 12 p35 subunit can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional antibody generation methods. Methods for preparation of polyclonal antisera are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of monoclonal antibodies is taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc., 1997.

[0191] Immunoprecipitation methods are standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley & Sons, Inc., 1998. Western blot (immunoblot) analysis is standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked immunosorbent assays (ELISA) are standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., 1991.

Example 11

[0192] Poly(A)+ mRNA Isolation

[0193] Poly(A)+ mRNA was isolated according to Miura et al., Clin. Chem., 1996, 42, 1758-1764. Other methods for poly(A)+ mRNA isolation are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 .mu.L cold PBS. 60 .mu.L lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) was added to each well, the plate was gently agitated and then incubated at room temperature for five minutes. 55 .mu.L of lysate was transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated for 60 minutes at room temperature, washed 3 times with 200 .mu.L of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate was blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 .mu.L of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70.degree. C. was added to each well, the plate was incubated on a 90.degree. C. hot plate for 5 minutes, and the eluate was then transferred to a fresh 96-well plate.

[0194] Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.

Example 12

[0195] Total RNA Isolation

[0196] Total RNA was isolated using an RNEASY 96.TM. kit and buffers purchased from Qiagen Inc. (Valencia Calif.) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 .mu.L cold PBS. 100 .mu.L Buffer RLT was added to each well and the plate vigorously agitated for 20 seconds. 100 .mu.L of 70% ethanol was then added to each well and the contents mixed by pipetting three times up and down. The samples were then transferred to the RNEASY 96.TM. well plate attached to a QIAVAC.TM. manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum was applied for 15 seconds. 1 mL of Buffer RW1 was added to each well of the RNEASY 96.TM. plate and the vacuum again applied for 15 seconds. 1 mL of Buffer RPE was then added to each well of the RNEASY 96.TM. plate and the vacuum applied for a period of 15 seconds. The Buffer RPE wash was then repeated and the vacuum was applied for an additional 10 minutes. The plate was then removed from the QIAVAC.TM. manifold and blotted dry on paper towels. The plate was then re-attached to the QIAVAC.TM. manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA was then eluted by pipetting 60 .mu.L water into each well, incubating 1 minute, and then applying the vacuum for 30 seconds. The elution step was repeated with an additional 60 .mu.L water.

[0197] The repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.

Example 13

[0198] Real-time Quantitative PCR Analysis of Interleukin 12 p35 Subunit mRNA Levels

[0199] Quantitation of Interleukin 12 p35 subunit mRNA levels was determined by real-time quantitative PCR using the ABI PRISM.TM. 7700 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR, in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., JOE, FAM, or VIC, obtained from either Operon Technologies Inc., Alameda, Calif. or PE-Applied Biosystems, Foster City, Calif.) is attached to the 5' end of the probe and a quencher dye (e.g., TAMRA, obtained from either Operon Technologies Inc., Alameda, Calif. or PE-Applied Biosystems, Foster City, Calif.) is attached to the 3' end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3' quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5'-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM.TM. 7700 Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.

[0200] Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be "multiplexed" with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only ("single-plexing"), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed multiplexable. Other methods of PCR are also known in the art.

[0201] PCR reagents were obtained from PE-Applied Biosystems, Foster City, Calif. RT-PCR reactions were carried out by adding 25 .mu.L PCR cocktail (1.times. TAQMAN.TM. buffer A, 5.5 mM MgCl.sub.2, 300 .mu.M each of dATP, dCTP and dGTP, 600 .mu.M of dUTP, 100 nM each of forward primer, reverse primer, and probe, 20 Units RNAse inhibitor, 1.25 Units AMPLITAQ GOLD.TM., and 12.5 Units MuLV reverse transcriptase) to 96 well plates containing 25 .mu.L total RNA solution. The RT reaction was carried out by incubation for 30 minutes at 48.degree. C. Following a 10 minute incubation at 95.degree. C. to activate the AMPLITAQ GOLD.TM., 40 cycles of a two-step PCR protocol were carried out: 95.degree. C. for 15 seconds (denaturation) followed by 60.degree. C. for 1.5 minutes (annealing/extension).

[0202] Gene target quantities obtained by real time RT-PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreen.TM. (Molecular Probes, Inc. Eugene, Oreg.). GAPDH expression is quantified by real time RT-PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RiboGreen.TM. RNA quantification reagent from Molecular Probes. Methods of RNA quantification by RiboGreen.TM. are taught in Jones, L. J., et al, Analytical Biochemistry, 1998, 265, 368-374.

[0203] In this assay, 175 .mu.L of RiboGreen.TM. working reagent (RiboGreen.TM. reagent diluted 1:2865 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 25 uL purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 480 nm and emission at 520 nm.

[0204] Probes and primers to human Interleukin 12 p35 subunit were designed to hybridize to a human Interleukin 12 p35 subunit sequence, using published sequence information (GenBank accession number M65291, incorporated herein as SEQ ID NO:3). For human Interleukin 12 p35 subunit the PCR primers were:

[0205] forward primer: GCCACTCCAGACCCAGGAAT (SEQ ID NO: 4)

[0206] reverse primer: TGTCTGGCCTTCTGGAGCAT (SEQ ID NO: 5) and the PCR probe was: FAM-TCCCATGCCTTCACCACTCCCAA-TAMRA (SEQ ID NO: 6) where FAM (PE-Applied Biosystems, Foster City, Calif.) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, Calif.) is the quencher dye. For human GAPDH the PCR primers were:

[0207] forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 7)

[0208] reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 8) and the PCR probe was: 5' JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID NO: 9) where JOE (PE-Applied Biosystems, Foster City, Calif.) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, Calif.) is the quencher dye.

Example 14

[0209] Northern Blot Analysis of Interleukin 12 p35 Subunit mRNA Levels

[0210] Eighteen hours after antisense treatment, cell monolayers were washed twice with cold PBS and lysed in 1 mL RNAZOL.TM. (TEL-TEST "B" Inc., Friendswood, Tex.). Total RNA was prepared following manufacturer's recommended protocols. Twenty micrograms of total RNA was fractionated by electrophoresis through 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the gel to HYBOND.TM.-N+ nylon membranes (Amersham Pharmacia Biotech, Piscataway, N.J.) by overnight capillary transfer using a Northern/Southern Transfer buffer system (TEL-TEST "B" Inc., Friendswood, Tex.). RNA transfer was confirmed by UV visualization. Membranes were fixed by UV cross-linking using a STRATALINKER.TM. UV Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.) and then robed using QUICKHYB.TM. hybridization solution (Stratagene, La Jolla, Calif.) using manufacturer's recommendations for stringent conditions.

[0211] To detect human Interleukin 12 p35 subunit, a human Interleukin 12 p35 subunit specific probe was prepared by PCR using the forward primer GCCACTCCAGACCCAGGAAT (SEQ ID NO: 4) and the reverse primer TGTCTGGCCTTCTGGAGCAT (SEQ ID NO: 5). To normalize for variations in loading and transfer efficiency membranes were stripped and probed for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).

[0212] Hybridized membranes were visualized and quantitated using a PHOSPHORIMAGER.TM. and IMAGEQUANT.TM. Software V3.3 (Molecular Dynamics, Sunnyvale, Calif.). Data was normalized to GAPDH levels in untreated controls.

Example 15

[0213] Antisense Inhibition of Human Interleukin 12 p35 Subunit Expression By Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Deoxy Gap

[0214] In accordance with the present invention, a series of oligonucleotides were designed to target different regions of the human Interleukin 12 p35 subunit RNA, using published sequences (GenBank accession number M65291, incorporated herein as SEQ ID NO: 3, and GenBank accession number AF050083, incorporated herein as SEQ ID NO: 10). The oligonucleotides are shown in Table 1. "Target site" indicates the first (5'-most) nucleotide number on the particular target sequence to which the oligonucleotide binds. All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of ten 2'-deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five-nucleotide "wings". The wings are composed of 2'-methoxyethyl (2'-MOE)nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P.dbd.S) throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The compounds were analyzed for their effect on human Interleukin 12 p35 subunit mRNA levels by quantitative real-time PCR as described in other examples herein. Data are averages from two experiments. If present, "N.D." indicates "no data".

1TABLE 1 Inhibition of human Interleukin 12 p35 subunit mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap TARGET SEQ ID TARGET % SEQ ID ISIS # REGION NO. SITE SEQUENCE INHIB NO 138957 5'UTR 3 1 acatcagcttctcggtgacc 79 11 138958 5'UTR 3 10 tctctctctacatcagcttc 49 12 138959 5'UTR 3 61 cggcaggactttcccgggac 45 13 138960 5'UTR 3 66 aggcgcggcaggactttccc 65 14 138961 Coding 3 148 tggatgcagacctgtggccg 32 15 138962 Coding 3 183 ctgagccggcactgcaggga 78 16 138963 Coding 3 191 gacacatgctgagccggcac 71 17 138964 Coding 3 201 ctgcgcgctggacacatgct 43 18 138965 Coding 3 217 agcgacaaggaggaggctgc 52 19 138966 Coding 3 230 ggaggaccagggtagcgaca 58 20 138967 Coding 3 255 tttctggccaaactgaggtg 59 21 138968 Coding 3 282 cctgggtctggagtggccac 73 22 138969 Coding 3 290 ggaacattcctgggtctgga 100 23 138970 Coding 3 305 agtggtgaaggcatgggaac 94 24 138971 Coding 3 311 tttgggagtggtgaaggcat 94 25 138972 Coding 3 332 tgctgacggccctcagcagg 88 26 138973 Coding 3 356 tttgtctggccttctggagc 61 27 138974 Coding 3 362 ctagagtttgtctggccttc 53 28 138975 Coding 3 375 caagggtaaaattctagagt 38 29 138976 Coding 3 390 atctcttcagaagtgcaagg 85 30 138977 Coding 3 435 gcctccactgtgctggtttt 79 31 138978 Coding 3 441 aaacaggcctccactgtgct 66 32 138979 Coding 3 448 caatggtaaacaggcctcca 82 33 138980 Coding 3 453 aattccaatggtaaacaggc 52 34 138981 Coding 3 462 ttcttggttaattccaatgg 62 35 138982 Coding 3 482 tggaatttaggcaactctca 74 36 138983 Coding 3 490 ggtctctctggaatttaggc 70 37 138984 Coding 3 503 tagttatgaaagaggtctct 49 38 138985 Coding 3 522 gaggccaggcaactcccatt 54 39 138986 Coding 3 529 ctttctggaggccaggcaac 58 40 138987 Coding 3 535 agaggtctttctggaggcca 67 41 138988 Coding 3 540 ataaaagaggtctttctgga 68 42 138989 Coding 3 553 gcacagggccatcataaaag 24 43 138990 Coding 3 587 ggtacatcttcaagtcttca 96 44 138991 Coding 3 598 gaactccacctggtacatct 44 45 138992 Coding 3 614 ttgcattcatggtcttgaac 64 46 138993 Coding 3 624 atcagaagctttgcattcat 49 47 138994 Coding 3 636 ctcttaggatccatcagaag 83 48 138995 Coding 3 645 aagatctgcctcttaggatc 56 49 138996 Coding 3 651 tctagaaagatctgcctctt 60 50 138997 Coding 3 657 ttttgatctagaaagatctg 20 51 138998 Coding 3 661 catgttttgatctagaaaga 80 52 138999 Coding 3 675 tcaataactgccagcatgtt 67 53 139000 Coding 3 686 gcatcagctcatcaataact 46 54 139001 Coding 3 727 ggatttttgtggcacagtct 42 55 139002 Coding 3 740 gttcttcaagggaggatttt 48 56 139003 Coding 3 757 agttttataaaaatccggtt 57 57 139004 Coding 3 790 gaaagcatgaagaagtatgc 55 58 139005 Coding 3 799 ccgaattctgaaagcatgaa 62 59 139006 Coding 3 804 actgcccgaattctgaaagc 77 60 139007 Coding 3 828 tagctcatcactctatcaat 52 61 139008 Stop 3 853 cctcgctttttaggaagcat 60 62 Codon 139009 3'UTR 3 877 aaaaatgacaacggtttgga 91 63 139010 3'UTR 3 908 ctatcaaagtttcctcattt 26 64 139011 3'UTR 3 913 acatcctatcaaagtttcct 37 65 139012 3'UTR 3 926 tagttcttaatccacatcct 47 66 139013 3'UTR 3 934 cccctccctagttcttaatc 20 67 139014 3'UTR 3 953 atagtcccatccttctttcc 35 68 139015 3'UTR 3 959 gatgtaatagtcccatcctt 58 69 139016 3'UTR 3 964 atgtggatgtaatagtccca 84 70 139017 3'UTR 3 987 aaaaatacttgatcagaggt 56 71 139018 3'UTR 3 1035 gcaattcattcatgaaaact 60 72 139019 3'UTR 3 1041 ttcttagcaattcattcatg 74 73 139020 3'UTR 3 1066 acaccttcaggatggatatt 76 74 139021 3'UTR 3 1073 atgaaaaacaccttcaggat 47 75 139022 3'UTR 3 1099 aaatatttgcccttctatta 61 76 139023 3'UTR 3 1117 ggtacagaaatagcttataa 74 77 139024 3'UTR 3 1123 cactttggtacagaaatagc 62 78 139025 3'UTR 3 1131 tccacaaacactttggtaca 76 79 139026 3'UTR 3 1141 catgtttgtttccacaaaca 73 80 139027 3'UTR 3 1158 aaaataagttatgcttacat 25 81 139028 3'UTR 3 1194 ctttcatgattaccaagtta 71 82 139029 3'UTR 3 1212 tataagttagctcagatgct 60 83 139030 3'UTR 3 1284 tatttttagaacacttaaaa 28 84 139031 Intron 10 1434 gcgctttcggattaactccc 47 85 139032 Coding 10 1575 gggccacatttttataattg 24 86 139033 Coding 10 1597 gtggctgggaggctgaccca 41 87 139034 Coding 10 1678 ctggacacatgctgagccgg 51 88

[0215] As shown in Table 1, SEQ ID NOs 11, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 66, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 82, 83, 85, 87 and 88 demonstrated at least 40% inhibition of human Interleukin 12 p35 subunit expression in this assay and are therefore preferred. The target sites to which these preferred sequences are complementary are herein referred to as "active sites" and are therefore preferred sites for targeting by compounds of the present invention.

Example 16

[0216] Western Blot Analysis of Interleukin 12 p35 Subunit Protein Levels

[0217] Western blot analysis (immunoblot analysis) is carried out using standard methods. Cells are harvested 16-20 h after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Appropriate primary antibody directed to Interleukin 12 p35 subunit is used, with a radiolabelled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a PHOSPHORIMAGER.TM. (Molecular Dynamics, Sunnyvale Calif.).

Example 17

[0218] Triglyceride Accumulation Assay:

[0219] This assay measures the accumulation of triglyceride by newly differentiated adipocytes. The in vitro triglyceride assay model used here is a good representation of an in vivo model because a time-dependent increase in triglyceride accumulation by the adipocytes has been shown to increase concomitantly with increasing leptin secretion. Furthermore, an increased in triglyceride content is a well established marker for adipocyte differentiation.

[0220] Triglyceride accumulation is measured using the Infinity.TM. Triglyceride reagent kit (Sigma-Aldrich, St. Louis, Mo.). Human white preadipocytes (Zen-Bio Inc., Research Triangle Park, N.C.) are grown in preadipocyte media (ZenBio Inc.) One day before transfection, 96-well plates are seeded with 3000 cells/well. Cells are treated according to standard published procedures with Interleukin 12 p35 inhibitor (in this experiment, 250 nM oligonucleotide) in lipofectin (Gibco). Monia et al., J. Biol. Chem., 1993, 268, 14514-22. Inhibitors are tested in triplicate on each 96-well plate, and the effects of TNF-.alpha., a positive drug control that inhibits adipocyte differentiation, are also measured in triplicate. Negative controls and transfectant-only controls may be measured up to six times per plate. After the cells have reached confluence (approximately three days), they are exposed to differentiation media (Zen-Bio, Inc.; differentiation media contains a PPAR-.gamma. agonist, IBMX, dexamethasone and insulin) for three days. Cells are then fed adipocyte media (Zen-Bio, Inc.), which is replaced at 2 to 3 day intervals. On day nine post-transfection, cells are washed and lysed at RT, and the triglyceride assay reagent is added. Triglyceride accumulation is measured based on the amount of glycerol liberated from triglycerides by the enzyme lipoprotein lipase. Liberated glycerol is phosphorylated by glycerol kinase. Next, glycerol-1-phosphate is oxidized to dihydroxyacetone phosphate by glycerol phosphate oxidase. Hydrogen peroxide is generated during this reaction. Horseradish peroxidase (HRP) uses H.sub.2O.sub.2 to oxidize 4-aminoantipyrine and 3,5 dichloro-2-hydroxybenzene sulfonate to produce a red-colored dye. Dye absorbance, which is proportional to the concentration of glycerol, is measured at 515 nm using an UV spectrophotometer. Glycerol concentration is calculated from a standard curve for each assay, and data are normalized to total cellular protein as determined by a Bradford assay (Bio-Rad Laboratories, Hercules, Calif.). Results are expressed as a percent +standard deviation relative to transfectant-only control.

[0221] The Interleukin 12 p35 inhibitor employed in this assay is an antisense oligomer, ISIS 138969; SEQ ID NO: 23, and the control (or negative control) employed in this assay is a nonsense oligomer, ISIS 29848, NNNNNNNNNNNNNNNNNNNN, SEQ ID NO. 89, where N is a mixture of A, C, G and T. Other antisense inhibitors of Interleukin 12 p35, their synthesis and uses are disclosed in U.S. Pat. No. 6,399,379.

[0222] At 250 nM of Interleukin 12 p35 inhibitor, the triglyceride accumulation was reduced by 94% as compared to control. This indicates that differentiation of preadipocytes to adipocytes was inhibited by treatment with Interleukin 12 p35 inhibitor.

Example 18

[0223] Leptin Secretion Assay for Differentiated Adipocytes:

[0224] Leptin is a marker for differentiated adipocytes. In this assay, leptin secretion into the media above the newly differentiated adipocytes is measured by protein ELISA. Cell growth, treatment with Interleukin 12 p35 inhibitor and differentiation procedures are carried out as described for the triglyceride accumulation assay (see above). On day nine post-transfection, 96-well plates are coated with a monoclonal antibody to human leptin (R&D Systems, Minneapolis, Minn.) and are left at 4 oC overnight. The plates are blocked with bovine serum albumin (BSA), and a dilution of the media is incubated in the plate at room temperature for 2 hours. After washing to remove unbound components, a second monoclonal antibody to human leptin (conjugated with biotin) is added. The plate is then incubated with strepavidin-conjugated horseradish peroxidase (HRP) and enzyme levels are determined by incubation with 3,3',5,5'-Tetramethylbenzidine, which turns blue when cleaved by HRP. The OD450 is read for each well, where the dye absorbance is proportional to the leptin concentration in the cell lysate. Results are expressed as a percent .+-.standard deviation relative to transfectant-only controls.

Example 19

[0225] Hallmark Gene Expression:

[0226] During adipocyte differentiation, the gene expression patterns in adipocytes change considerably. This gene expression pattern is controlled by several different transcription factors, including glucose transporter-4 (GLUT4), hormone-sensitive lipase (HSL) and adipocyte lipid binding protein (aP2). These genes play important roles in the uptake of glucose and the metabolism and utilization of fats. Cell growth, treatment with Interleukin 12 p35 inhibitor and differentiation procedures are carried out as described for the triglyceride accumulation assay. On day nine post-transfection, cells are lysed in a guanidinium-containing buffer and total RNA is harvested. The amount of total RNA in each sample is determined using a RIBOGREEN assay (Molecular Probes, Eugene, Oreg.). Real-time PCR is performed on the total RNA using primer/probe sets for three adipocyte differentiation hallmark genes: glucose transporter-4 (GLUT4), hormone-sensitive lipase (HSL) and adipocyte lipid binding protein (aP2). Expression levels for each gene are normalized to total RNA, and values .+-. standard deviation relative to transfectant-only controls are entered into the database.

[0227] The Interleukin 12 p35 inhibitor employed in this assay is an antisense oligomer, ISIS 138969; SEQ ID NO. 23; and the control (or negative control) employed in this assay is an nonsense oligomer, ISIS 29848, NNNNNNNNNNNNNNNNNNNN, SEQ ID NO: 89; where N is a mixture of A, C, G and T. Other antisense inhibitors of Interleukin 12 p35, their synthesis and uses are disclosed in U.S. Pat. No. 6,399,379.

[0228] At 250 nM of Interleukin 12 p35 inhibitor, aP2 was reduced by 67% and GLUT4 was reduced by 89% as compared to control. This indicates that differentiation of preadipocytes to adipocytes was inhibited by treatment with Interleukin 12 p35 inhibitor.

Sequence CWU 1

1

88 1 20 DNA Artificial Sequence Antisense Oligonucleotide 1 tccgtcatcg ctcctcaggg 20 2 20 DNA Artificial Sequence Antisense Oligonucleotide 2 atgcattctg cccccaagga 20 3 1316 DNA Homo sapiens CDS (102)...(863) 3 ggtcaccgag aagctgatgt agagagagac acagaaggag acagaaagca agagaccaga 60 gtcccgggaa agtcctgccg cgcctcggga caattataaa a atg tgg ccc cct ggg 116 Met Trp Pro Pro Gly 1 5 tca gcc tcc cag cca ccg ccc tca cct gcc gcg gcc aca ggt ctg cat 164 Ser Ala Ser Gln Pro Pro Pro Ser Pro Ala Ala Ala Thr Gly Leu His 10 15 20 cca gcg gct cgc cct gtg tcc ctg cag tgc cgg ctc agc atg tgt cca 212 Pro Ala Ala Arg Pro Val Ser Leu Gln Cys Arg Leu Ser Met Cys Pro 25 30 35 gcg cgc agc ctc ctc ctt gtc gct acc ctg gtc ctc ctg gac cac ctc 260 Ala Arg Ser Leu Leu Leu Val Ala Thr Leu Val Leu Leu Asp His Leu 40 45 50 agt ttg gcc aga aac ctc ccc gtg gcc act cca gac cca gga atg ttc 308 Ser Leu Ala Arg Asn Leu Pro Val Ala Thr Pro Asp Pro Gly Met Phe 55 60 65 cca tgc ctt cac cac tcc caa aac ctg ctg agg gcc gtc agc aac atg 356 Pro Cys Leu His His Ser Gln Asn Leu Leu Arg Ala Val Ser Asn Met 70 75 80 85 ctc cag aag gcc aga caa act cta gaa ttt tac cct tgc act tct gaa 404 Leu Gln Lys Ala Arg Gln Thr Leu Glu Phe Tyr Pro Cys Thr Ser Glu 90 95 100 gag att gat cat gaa gat atc aca aaa gat aaa acc agc aca gtg gag 452 Glu Ile Asp His Glu Asp Ile Thr Lys Asp Lys Thr Ser Thr Val Glu 105 110 115 gcc tgt tta cca ttg gaa tta acc aag aat gag agt tgc cta aat tcc 500 Ala Cys Leu Pro Leu Glu Leu Thr Lys Asn Glu Ser Cys Leu Asn Ser 120 125 130 aga gag acc tct ttc ata act aat ggg agt tgc ctg gcc tcc aga aag 548 Arg Glu Thr Ser Phe Ile Thr Asn Gly Ser Cys Leu Ala Ser Arg Lys 135 140 145 acc tct ttt atg atg gcc ctg tgc ctt agt agt att tat gaa gac ttg 596 Thr Ser Phe Met Met Ala Leu Cys Leu Ser Ser Ile Tyr Glu Asp Leu 150 155 160 165 aag atg tac cag gtg gag ttc aag acc atg aat gca aag ctt ctg atg 644 Lys Met Tyr Gln Val Glu Phe Lys Thr Met Asn Ala Lys Leu Leu Met 170 175 180 gat cct aag agg cag atc ttt cta gat caa aac atg ctg gca gtt att 692 Asp Pro Lys Arg Gln Ile Phe Leu Asp Gln Asn Met Leu Ala Val Ile 185 190 195 gat gag ctg atg cag gcc ctg aat ttc aac agt gag act gtg cca caa 740 Asp Glu Leu Met Gln Ala Leu Asn Phe Asn Ser Glu Thr Val Pro Gln 200 205 210 aaa tcc tcc ctt gaa gaa ccg gat ttt tat aaa act aaa atc aag ctc 788 Lys Ser Ser Leu Glu Glu Pro Asp Phe Tyr Lys Thr Lys Ile Lys Leu 215 220 225 tgc ata ctt ctt cat gct ttc aga att cgg gca gtg act att gat aga 836 Cys Ile Leu Leu His Ala Phe Arg Ile Arg Ala Val Thr Ile Asp Arg 230 235 240 245 gtg atg agc tat ctg aat gct tcc taa aaagcgaggt ccctccaaac 883 Val Met Ser Tyr Leu Asn Ala Ser 250 cgttgtcatt tttataaaac tttgaaatga ggaaactttg ataggatgtg gattaagaac 943 tagggagggg gaaagaagga tgggactatt acatccacat gatacctctg atcaagtatt 1003 tttgacattt actgtggata aattgttttt aagttttcat gaatgaattg ctaagaaggg 1063 aaaatatcca tcctgaaggt gtttttcatt cactttaata gaagggcaaa tatttataag 1123 ctatttctgt accaaagtgt ttgtggaaac aaacatgtaa gcataactta ttttaaaata 1183 tttatttata taacttggta atcatgaaag catctgagct aacttatatt tatttatgtt 1243 atatttatta aattatttat caagtgtatt tgaaaaatat ttttaagtgt tctaaaaata 1303 aaagtattga att 1316 4 20 DNA Artificial Sequence PCR Primer 4 gccactccag acccaggaat 20 5 20 DNA Artificial Sequence PCR Primer 5 tgtctggcct tctggagcat 20 6 23 DNA Artificial Sequence PCR Probe 6 tcccatgcct tcaccactcc caa 23 7 19 DNA Artificial Sequence PCR Primer 7 gaaggtgaag gtcggagtc 19 8 20 DNA Artificial Sequence PCR Primer 8 gaagatggtg atgggatttc 20 9 20 DNA Artificial Sequence PCR Probe 9 caagcttccc gttctcagcc 20 10 1703 DNA Homo sapiens CDS (1586)...(1703) CDS (1688)...(1703) 10 gaattctcag acagcagcat tagaaggggc cttagagatc aaccatttct cttattttac 60 acacacctaa aactccctac agccgtgctt catcagcttc gagcagatga gccacccaga 120 aggcagctcc agttattagg tcctagggcc tgggtgtagt caggcccttt ggaagctcca 180 agtcagagat caaacacatc ctccccacta cccacgccta gggtgactaa tgcctgtggg 240 aaaaacaact gaactaaaaa gtcccacagg aacctcaaac ccagcacatc caaaatggaa 300 cttctcacca tctcctccaa actcagtcct cttatacagt aatccctgta aagctagaac 360 aatctccatt ccccattctc agggccttcc tctcccgctc acctgaggag ctaccaagcc 420 ttggcccaca agccctctga gagtccctcc tgcccaccct gtgttctcca tactgaataa 480 ggacttggcc acaccttgtc aactcttccc tctgctctac tcctgacccc tggatccccc 540 catcatgcaa attctgccac atctcccgcc taaaacccag gaagactccc cactactctc 600 agcacagaaa gtacactcct tagtatggca tcccctgccc tcatggcatg gcccatccag 660 ccctccagcc tcacaccctg caaggacacc tagaccccca cctccctcaa cccttcatga 720 ctgcgcttct gatccctgtt tcccctggct agaccctgcg tgccctcccg ctggaagcgg 780 tctaatgcct gcttgttttt aacactcagg ttggggcccc tgcctgctcc cgggagcctt 840 tgctgactcc tggaccccgt tgctccggct gagcgtgggc tctttctcta ggtctttcct 900 cccaggactc tgtgtattca tcctatcgtt aaactggatt ctctacaaga gtaataattg 960 cagagtcagc cagctctcat cccttttcag gtttcagaaa agacctgtga acaaaacgcc 1020 ttgagtctga tttagtgtgg caatgcccca agggtcctgt tctccctggg tgtcctgcac 1080 ctggtgcaac gtcggcctgg catctagtga gccatctaaa ggaacgatga tgagtgaatg 1140 atttgcctac cccttccagt actaggctgg aggtcgtggt tagggcccat ccctacgcag 1200 gacatgcaaa gtgggaggca ctcctctctc tacgtcggca gggggcgctg cacagctgcg 1260 gggcggggta gcttagacac ggggcgtccg gctaaggccg gggacccagg gtggtgggcg 1320 gggtgtcccg cccgcctgtg gaccccgcgc agtaactgcg aacatttcgc tttcattttg 1380 ggccgagctg gaggcggcgg ggccgtcccg gaacggctgc ggccgggcac cccgggagtt 1440 aatccgaaag cgccgcaagc ccccggggcc ggccgcaccg cacgtgtcac cgagaagctg 1500 atgtagagag agacacagaa ggagacagaa agcaagagac cagagtcccg ggaaagtcct 1560 gccgcgcctc gggacaatta taaaa atg tgg ccc cct ggg tca gcc tcc cag 1612 Met Trp Pro Pro Gly Ser Ala Ser Gln 1 5 cca ccg ccc tca cct gcc gcg gcc aca ggt ctg cat cca gcg gct cgc 1660 Pro Pro Pro Ser Pro Ala Ala Ala Thr Gly Leu His Pro Ala Ala Arg 10 15 20 25 cct gtg tcc ctg cag tgc cgg ctc agc atg tgt cca gcg cgc a 1703 Pro Val Ser Leu Gln Cys Arg Leu Ser Met Cys Pro Ala Arg 30 35 1703 11 20 DNA Artificial Sequence Antisense Oligonucleotide 11 acatcagctt ctcggtgacc 20 12 20 DNA Artificial Sequence Antisense Oligonucleotide 12 tctctctcta catcagcttc 20 13 20 DNA Artificial Sequence Antisense Oligonucleotide 13 cggcaggact ttcccgggac 20 14 20 DNA Artificial Sequence Antisense Oligonucleotide 14 aggcgcggca ggactttccc 20 15 20 DNA Artificial Sequence Antisense Oligonucleotide 15 tggatgcaga cctgtggccg 20 16 20 DNA Artificial Sequence Antisense Oligonucleotide 16 ctgagccggc actgcaggga 20 17 20 DNA Artificial Sequence Antisense Oligonucleotide 17 gacacatgct gagccggcac 20 18 20 DNA Artificial Sequence Antisense Oligonucleotide 18 ctgcgcgctg gacacatgct 20 19 20 DNA Artificial Sequence Antisense Oligonucleotide 19 agcgacaagg aggaggctgc 20 20 20 DNA Artificial Sequence Antisense Oligonucleotide 20 ggaggaccag ggtagcgaca 20 21 20 DNA Artificial Sequence Antisense Oligonucleotide 21 tttctggcca aactgaggtg 20 22 20 DNA Artificial Sequence Antisense Oligonucleotide 22 cctgggtctg gagtggccac 20 23 20 DNA Artificial Sequence Antisense Oligonucleotide 23 ggaacattcc tgggtctgga 20 24 20 DNA Artificial Sequence Antisense Oligonucleotide 24 agtggtgaag gcatgggaac 20 25 20 DNA Artificial Sequence Antisense Oligonucleotide 25 tttgggagtg gtgaaggcat 20 26 20 DNA Artificial Sequence Antisense Oligonucleotide 26 tgctgacggc cctcagcagg 20 27 20 DNA Artificial Sequence Antisense Oligonucleotide 27 tttgtctggc cttctggagc 20 28 20 DNA Artificial Sequence Antisense Oligonucleotide 28 ctagagtttg tctggccttc 20 29 20 DNA Artificial Sequence Antisense Oligonucleotide 29 caagggtaaa attctagagt 20 30 20 DNA Artificial Sequence Antisense Oligonucleotide 30 atctcttcag aagtgcaagg 20 31 20 DNA Artificial Sequence Antisense Oligonucleotide 31 gcctccactg tgctggtttt 20 32 20 DNA Artificial Sequence Antisense Oligonucleotide 32 aaacaggcct ccactgtgct 20 33 20 DNA Artificial Sequence Antisense Oligonucleotide 33 caatggtaaa caggcctcca 20 34 20 DNA Artificial Sequence Antisense Oligonucleotide 34 aattccaatg gtaaacaggc 20 35 20 DNA Artificial Sequence Antisense Oligonucleotide 35 ttcttggtta attccaatgg 20 36 20 DNA Artificial Sequence Antisense Oligonucleotide 36 tggaatttag gcaactctca 20 37 20 DNA Artificial Sequence Antisense Oligonucleotide 37 ggtctctctg gaatttaggc 20 38 20 DNA Artificial Sequence Antisense Oligonucleotide 38 tagttatgaa agaggtctct 20 39 20 DNA Artificial Sequence Antisense Oligonucleotide 39 gaggccaggc aactcccatt 20 40 20 DNA Artificial Sequence Antisense Oligonucleotide 40 ctttctggag gccaggcaac 20 41 20 DNA Artificial Sequence Antisense Oligonucleotide 41 agaggtcttt ctggaggcca 20 42 20 DNA Artificial Sequence Antisense Oligonucleotide 42 ataaaagagg tctttctgga 20 43 20 DNA Artificial Sequence Antisense Oligonucleotide 43 gcacagggcc atcataaaag 20 44 20 DNA Artificial Sequence Antisense Oligonucleotide 44 ggtacatctt caagtcttca 20 45 20 DNA Artificial Sequence Antisense Oligonucleotide 45 gaactccacc tggtacatct 20 46 20 DNA Artificial Sequence Antisense Oligonucleotide 46 ttgcattcat ggtcttgaac 20 47 20 DNA Artificial Sequence Antisense Oligonucleotide 47 atcagaagct ttgcattcat 20 48 20 DNA Artificial Sequence Antisense Oligonucleotide 48 ctcttaggat ccatcagaag 20 49 20 DNA Artificial Sequence Antisense Oligonucleotide 49 aagatctgcc tcttaggatc 20 50 20 DNA Artificial Sequence Antisense Oligonucleotide 50 tctagaaaga tctgcctctt 20 51 20 DNA Artificial Sequence Antisense Oligonucleotide 51 ttttgatcta gaaagatctg 20 52 20 DNA Artificial Sequence Antisense Oligonucleotide 52 catgttttga tctagaaaga 20 53 20 DNA Artificial Sequence Antisense Oligonucleotide 53 tcaataactg ccagcatgtt 20 54 20 DNA Artificial Sequence Antisense Oligonucleotide 54 gcatcagctc atcaataact 20 55 20 DNA Artificial Sequence Antisense Oligonucleotide 55 ggatttttgt ggcacagtct 20 56 20 DNA Artificial Sequence Antisense Oligonucleotide 56 gttcttcaag ggaggatttt 20 57 20 DNA Artificial Sequence Antisense Oligonucleotide 57 agttttataa aaatccggtt 20 58 20 DNA Artificial Sequence Antisense Oligonucleotide 58 gaaagcatga agaagtatgc 20 59 20 DNA Artificial Sequence Antisense Oligonucleotide 59 ccgaattctg aaagcatgaa 20 60 20 DNA Artificial Sequence Antisense Oligonucleotide 60 actgcccgaa ttctgaaagc 20 61 20 DNA Artificial Sequence Antisense Oligonucleotide 61 tagctcatca ctctatcaat 20 62 20 DNA Artificial Sequence Antisense Oligonucleotide 62 cctcgctttt taggaagcat 20 63 20 DNA Artificial Sequence Antisense Oligonucleotide 63 aaaaatgaca acggtttgga 20 64 20 DNA Artificial Sequence Antisense Oligonucleotide 64 ctatcaaagt ttcctcattt 20 65 20 DNA Artificial Sequence Antisense Oligonucleotide 65 acatcctatc aaagtttcct 20 66 20 DNA Artificial Sequence Antisense Oligonucleotide 66 tagttcttaa tccacatcct 20 67 20 DNA Artificial Sequence Antisense Oligonucleotide 67 cccctcccta gttcttaatc 20 68 20 DNA Artificial Sequence Antisense Oligonucleotide 68 atagtcccat ccttctttcc 20 69 20 DNA Artificial Sequence Antisense Oligonucleotide 69 gatgtaatag tcccatcctt 20 70 20 DNA Artificial Sequence Antisense Oligonucleotide 70 atgtggatgt aatagtccca 20 71 20 DNA Artificial Sequence Antisense Oligonucleotide 71 aaaaatactt gatcagaggt 20 72 20 DNA Artificial Sequence Antisense Oligonucleotide 72 gcaattcatt catgaaaact 20 73 20 DNA Artificial Sequence Antisense Oligonucleotide 73 ttcttagcaa ttcattcatg 20 74 20 DNA Artificial Sequence Antisense Oligonucleotide 74 acaccttcag gatggatatt 20 75 20 DNA Artificial Sequence Antisense Oligonucleotide 75 atgaaaaaca ccttcaggat 20 76 20 DNA Artificial Sequence Antisense Oligonucleotide 76 aaatatttgc ccttctatta 20 77 20 DNA Artificial Sequence Antisense Oligonucleotide 77 ggtacagaaa tagcttataa 20 78 20 DNA Artificial Sequence Antisense Oligonucleotide 78 cactttggta cagaaatagc 20 79 20 DNA Artificial Sequence Antisense Oligonucleotide 79 tccacaaaca ctttggtaca 20 80 20 DNA Artificial Sequence Antisense Oligonucleotide 80 catgtttgtt tccacaaaca 20 81 20 DNA Artificial Sequence Antisense Oligonucleotide 81 aaaataagtt atgcttacat 20 82 20 DNA Artificial Sequence Antisense Oligonucleotide 82 ctttcatgat taccaagtta 20 83 20 DNA Artificial Sequence Antisense Oligonucleotide 83 tataagttag ctcagatgct 20 84 20 DNA Artificial Sequence Antisense Oligonucleotide 84 tatttttaga acacttaaaa 20 85 20 DNA Artificial Sequence Antisense

Oligonucleotide 85 gcgctttcgg attaactccc 20 86 20 DNA Artificial Sequence Antisense Oligonucleotide 86 gggccacatt tttataattg 20 87 20 DNA Artificial Sequence Antisense Oligonucleotide 87 gtggctggga ggctgaccca 20 88 20 DNA Artificial Sequence Antisense Oligonucleotide 88 ctggacacat gctgagccgg 20

Claims

What is claimed is:

1. A compound comprising a chemically modified antisense oligonucleotide compound 15 to 30 nucleobases in length targeted to an active site of a nucleic acid molecule encoding Interleukin 12 p35 subunit.

2. The compound of claim 1 comprising SEQ ID NO: 23, 24 or 44.

3. The compound of claim 1 further comprising at least one chemical modification selected from the group consisting of: a modified nucleobase, a substituted sugar moiety, a modified oligonucleotide backbone or a conjugate.

4. The compound of claim 3 further comprising a sense strand such that the antisense oligonucleotide is double stranded siRNA.

5. The compound of claim 3 comprising a chimeric oligonucleotide of 15 to 30 nucleobases in length targeted to a nucleic acid molecule encoding Interleukin 12 p35 subunit comprising: a 5' region of nucleobases, each containing a 2'-MOE modification; a central region containing deoxynucleotides; and a 3' region of nucleobases, each containing a 2'-MOE modification.

6. The chimeric oligonucleotide of claim 4 comprising SEQ ID NO: 23, 24 or 44.

7. A method of inhibiting the expression of Interleukin 12 p35 subunit in cells or tissues comprising contacting said cells or tissues with the compound of claim 1 so that expression of Interleukin 12 p35 subunit is inhibited.

8. A method of treating an animal having a disease or condition associated with Interleukin 12 p35 subunit comprising administering to said animal a therapeutically or prophylactically effective amount of the compound of claim 1 so that expression of Interleukin 12 p35 subunit is inhibited.

9. The method of claim 8 wherein the disease or condition is selected from the group consisting of an autoimmune disorder, cancer, a metabolic disorder, or a viral or bacterial infection.

10. The method of claim 9 wherein the autoimmune disorder is multiple sclerosis, diabetes or Crohn's disease.

11. The method of claim 9 wherein the infection is endotoxemia.

12. The method of claim 9 wherein the metabolic disorder is selected from the group consisting of obesity, cardiovascular disease, metabolic syndrome, diabetes, or insulin resistance.

13. A method for inhibiting the differentiation of an adipocyte cell comprising contacting a preadipocyte cell with an effective amount of a compound of claim 1, whereby adipocyte differentiation is inhibited.

14. A method for inhibiting lipid accumulation in a cell comprising contacting a cell with a compound of claim 1, whereby lipid accumulation in the cell is inhibited.