U.S. patent application number 10/927262 was filed with the patent office on 2005-06-23 for inhibitors of the interaction between p53 and mdm2.
Invention is credited to Bottger, Angelika, Bottger, Volker, Chene, Patrick, Furet, Pascal, Garcia-Echeverria, Carlos, Hochkeppel, Heinz-Kurt, Lane, David Philip, Picksley, Steven Michael.
Application Number | 20050137137 10/927262 |
Document ID | / |
Family ID | 36791012 |
Filed Date | 2005-06-23 |
United States Patent
Application |
20050137137 |
Kind Code |
A1 |
Lane, David Philip ; et
al. |
June 23, 2005 |
Inhibitors of the Interaction between p53 and MDM2
Abstract
The present invention relates to compounds capable of binding to
the oncogene protein MDM2, processes for the preparation of such
compounds, pharmaceutical preparations comprising such compounds,
and uses of said compounds, e.g. in the therapeutic (including
prophylactic) treatment of an animal or especially of the human
body. The present further relates to methods of and compounds for
inhibiting the growth of tumor cells which comprise the wild type
p53 suppressor by interfering with the interaction between human
p53 and human MDM2.
Inventors: |
Lane, David Philip; (Fife,
GB) ; Bottger, Volker; (Germering-Unterpfaffenhofen,
DE) ; Bottger, Angelika;
(Germering-Unterpfaffenhofen, DE) ; Picksley, Steven
Michael; (Bradford, GB) ; Hochkeppel, Heinz-Kurt;
(Aesch, CH) ; Garcia-Echeverria, Carlos; (Basel,
CH) ; Chene, Patrick; (Mulhouse, FR) ; Furet,
Pascal; (Thann, FR) |
Correspondence
Address: |
HELLER EHRMAN WHITE & MCAULIFFE LLP
275 MIDDLEFIELD ROAD
MENLO PARK
CA
94025-3506
US
|
Family ID: |
36791012 |
Appl. No.: |
10/927262 |
Filed: |
August 25, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10927262 |
Aug 25, 2004 |
|
|
|
09214371 |
Mar 26, 1999 |
|
|
|
09214371 |
Mar 26, 1999 |
|
|
|
PCT/EP97/03549 |
Jul 4, 1997 |
|
|
|
Current U.S.
Class: |
514/19.3 ;
514/19.1; 530/329 |
Current CPC
Class: |
C07K 7/04 20130101; A61P
35/00 20180101; C07K 2319/00 20130101; A61K 38/00 20130101 |
Class at
Publication: |
514/016 ;
530/329 |
International
Class: |
A61K 038/08; C07K
007/06 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 7, 1997 |
GB |
9707041.1 |
Jul 5, 1996 |
GB |
9614197.3 |
Claims
1-23. (canceled)
24. A peptide which binds to a DM2 protein and inhibits binding of
said DM2 protein to a p53 protein, the peptide being a derivative
of an amino acid sequence that comprises an amino acid motif
comprising at least 8 consecutive amino acids of the formula
17
R.sub.1-X.sub.1-F-X.sub.2-R.sub.2-R.sub.3-W-X.sub.3-X.sub.4-R.su-
b.4 (I), (SEQ ID NO:4)
wherein R.sub.1 is proline (P), leucine (L), glutamic acid (E),
cysteine (C) or glutamine (Q), X stands for any natural amino acid,
R.sub.2 is arginine (R), histidine (H), glutamic acid, cysteine,
serine, or aspartic acid (D), R.sub.3 is histidine (H),
phenylalanine (F) or tyrosine (Y), R.sub.4 is phenylalanine (F),
glutamine (Q) or leucine (L), and F is phenylalanine and W is
tryptophan, said derivative being modified from said amino acid
sequence by substitution, whereby one or more amino acids in said
amino acid motif are each replaced by a non-natural amino acid.
25. A peptide according to claim 24 wherein said amino acid motif
comprises at least the eight consecutive amino acids
18 F-X.sub.2-R.sub.2-R.sub.3-W-X.sub.3-X.sub.4-R.sub.4 (Ib) (SEQ ID
NO:10)
from the sequence of formula (I) (SEQ ID NO:4),
26. A peptide according to claim 24, wherein the MDM2 is human
DM2.
27. A peptide according to claim 24, wherein the p53 is human
p53.
28. A peptide according to claim 24, wherein the modification is
such that an .alpha.-helix conformation in the peptide is induced,
increased or maintained.
29. A peptide according to claim 24, wherein R.sub.2, X.sub.3
and/or X.sub.4 are, independently from one another, replaced by
.alpha.,.alpha.-disubstituted amino acid residue,
.alpha.-aminoisobutyric acid, 1-aminocyclopropane-1-carboxylic
acid, 1-amino-cyclopentane-1-carbo- xylic acid,
1-aminocyclohexane-1-carboxylic acid, 4-amino
piperidine-4-carboxylic acid, or 1-aminocycloheptane-1-carboxylic
acid.
30. A peptide according to claim 29, wherein R.sub.2 is replaced by
.alpha.-aminoisobutyric acid (Aib), X.sub.3 is replaced by
.alpha.-aminoisobutyric acid and/or X.sub.4 is replaced by
1-aminocyclopropane-1-carboxylic acid (Ac.sub.3c).
31. A peptide according to claim 24, wherein the modification
includes replacement of an amino acid with a non-natural amino acid
mimetic thereof.
32. A peptide according to claim 30, wherein the modification
further includes replacement of an amino acid with a non-natural
amino acid mimetic thereof.
33. A peptide according to claim 24, consisting of no more than
fifteen amino acids.
34. A peptide according to claim 25, which is a said derivative of
an amino acid sequence that consists of an amino acid motif of the
formula
19 F-X.sub.2-R.sub.2-R.sub.3-W-X.sub.3-X.sub.4-R.sub.4 (Ib) (SEQ ID
NO:10)
wherein X.sub.2 is methionine, isoleucine, threonine, arginine,
alanine or serine; X.sub.3 is glutamic acid, threonine, alanine,
phenylalanine or serine; and X.sub.4 is glycine, glutamine,
threonine, alanine or aspartic acid.
35. A peptide according to claim 34, wherein X.sub.2 is methionine;
X.sub.3 is glutamic acid; and/or X.sub.4 is glycine.
36. A peptide according to claim 25, which is a said derivative of
an amino acid sequence that consists of an amino acid motif of the
formula
20 X.sub.1-F-X.sub.2-R.sub.2-R.sub.3-W-X.sub.3-X.sub.4-R.sub.4 (Ic)
(SEQ ID NO:11)
wherein X.sub.1 is arginine, asparagine, alanine, threonine or
valine; X.sub.2 is methionine, isoleucine, threonine, arginine,
alanine or serine; X.sub.3 is glutamic acid, threonine, alanine,
phenylalanine or serine; and X.sub.4 is glycine, glutamine,
threonine, alanine or aspartic acid.
37. A peptide according to claim 36, wherein X.sub.1 is arginine;
X.sub.2 is methionine; X.sub.3 is glutamic acid; and/or X.sub.4 is
glycine.
38. A peptide according to claim 24 carrying one or more protecting
groups.
39. A peptide according to claim 24 which is in the form of a
salt.
40. A peptide according to claim 24 which is in cyclic form.
41. A peptide according to claim 40, which contains a disulphide
bridge, a thioether bridge or a lactam.
42. A conjugate comprising the peptide of claim 24 covalently
attached to another peptide or protein.
43. A conjugate comprising a peptide of claim 24, labeled directly
or by way of a spacer or linker group with an enzyme, a fluorescent
marker, a chemiluminescent marker, a metal chelate, paramagnetic
particles or biotin.
44. A method for inhibiting the binding of a DM2 protein to a p53
protein comprising contacting said DM2 protein with a peptide
according to claim 24.
45. A composition comprising a peptide according to claim 24, in
admixture with at least one pharmaceutically acceptable
carrier.
46. A peptide which binds to a DM2 protein and inhibits binding of
said DM2 protein to a p53 protein, the peptide consisting of no
more than 15 amino acids and being a derivative of an amino acid
sequence that comprises an amino acid motif comprising at least the
eight consecutive amino acids
21 F-X.sub.2-R.sub.2-R.sub.3-W-X.sub.3-X.sub.4-R.sub.4 (Ib) (SEQ ID
NO:10)
from the sequence
22 R.sub.1-X.sub.1-F-X.sub.2-R.sub.2-R.sub.3-W-X.sub.3-X.sub.4-R.-
sub.4 (I), (SEQ ID NO:4)
wherein R.sub.1 is proline (P), leucine (L), glutamic acid (E),
cysteine (C) or glutamine (Q), X.sub.1 is any natural amino acid,
X.sub.2 is methionine (M), R.sub.2 is arginine (R), histidine (H),
glutamic acid (E), cysteine (C), serine (S), or aspartic acid (D),
R.sub.3 is phenylalanine (F) or tyrosine (Y), X.sub.3 is glutamic
acid (E), X.sub.4 is any natural amino acid R.sub.4 is
phenylalanine (F), glutamine (Q) or leucine (L), and F is
phenylalanine and W is tryptophan, said derivative being modified
from said amino acid sequence by substitution, whereby a plurality
of amino acids in said amino acid motif are each replaced by a
nonnatural amino acid, wherein said modification includes: (1)
R.sub.2 being replaced by .alpha.-aminoisobutyric acid (Aib),
X.sub.3 being replaced by .alpha.-aminoisobutyric acid and/or
X.sub.4 being replaced by 1-amino-cyclopropane-1-carboxylic acid
(Ac.sub.3c); and (2) replacement of a plurality of amino acids with
a non-natural amino acid mimetic thereof, said replacement
including R.sub.3 being replaced by a structurally related
analogue.
47. A conjugate comprising the peptide of claim 46 covalently
attached to another peptide or protein.
48. A conjugate comprising a peptide of claim 46, labeled directly
or by way of a spacer or linker group with an enzyme, a fluorescent
marker, a chemiluminescent marker, a metal chelate, paramagnetic
particles or biotin.
49. A method for inhibiting the binding of a DM2 protein to a p53
protein comprising contacting said DM2 protein with a peptide
according to claim 46.
50. A composition comprising a peptide according to claim 46, in
admixture with at least one pharmaceutically acceptable carrier.
Description
[0001] The present invention relates to compounds capable of
binding to the oncogene protein MDM2, processes for the preparation
of such compounds, pharmaceutical preparations comprising such
compounds, and uses of said compounds, e.g. in the therapeutic
(including prophylactic) treatment of an animal or especially of
the human body. The present further relates to methods of and
compounds for inhibiting the growth of tumor cells which comprise
the wild type p53 suppressor by interfering with the interaction
between human p53 and human MDM2.
[0002] Inactivation of the p53 tumor suppressor is a frequent event
in human neoplasia. Such inactivation of p53 may, for example,
result from the binding of a cellular oncogene protein, such as
MDM2. The protein encoded by the mdm2 gene, which is also referred
to as hdm2 (human double minute 2) gene in the art, is capable of
forming a complex with p63 both in vitro and in vivo and inhibit
p53-mediated transactivation (J. Momand et al., Cell 69, 1237-1245
(1992)). Formation of this complex favors nucleoplasmic
transformation because the complexed p53 essentially looses its
tumor suppressor activity. MDM2 is overproduced in about 30% of the
human sarcomas and has been associated with an oncogenic phenotype.
Compounds preventing or decreasing the binding of MDM2 to p53
alleviate the sequestration of p53, thus promoting p53 tumor
suppressor activity. Surprisingly it has been found that the
compounds of the invention interfere with the interaction of MDM2
with p53 and activate p53 function and p53 accumulation in normal
cells having non-elevated MDM2 levels.
[0003] The MDM2 binding site is localized within the region of p53
represented approximately by amino acids 13 to 31
(PLSQETFSDLWKLLPENNV; single letter code) of mature human p53
protein. Recently, it has been found that peptide fragments of p53
which include the amino acid motif FxxLW wherein F, L, and W
represent the single letter codes for amino acids phenylalanine,
leucine and tryptophan, respectively, and X may be any amino acid,
would be particularly suitable for interfering with the binding
between p53 and MDM2 (Picksley et al., Oncogene 9, 2523-2529
(1994)). However, there is still a need for compounds which are
potent inhibitors of P53-MDM2 binding, and therefore beneficial in
the treatment of p53-related diseases, such as (hyper)proliferative
diseases. It is the object of the present invention to fulfill this
and other needs.
[0004] In one aspect, the present invention is based on the
surprising finding that a peptide with the phage consensus amino
acid sequence P-X-F-X-D-Y-W-X-X-L, wherein X is any naturally
occurring L-amino acid, and P, F, D, W and L represent the L-amino
acids of proline (P), phenylalanine (F), aspartic acid (D),
tyrosine (Y), tryptophan (W) and leucine (L), respectively, given
in the single letter code, is capable of blocking the interaction
of MDM2 with p53, as determinable e.g. in an ELISA assay, and shows
a significant increase in specific blocking activity over the
wildtype p53 peptide sequence.
[0005] As used herein, "mdm" refers to the oncogene and "MDM"
refers to the protein obtainable as a result of expression of said
gene. Even though in the strict sense "mdm" means "murine double
minute gene2", as used herein it also refers to dm2 mutants,
particularly interspecies mutants, such as hdm2 (human double
minute gene2) in particular.
[0006] More specifically, it is an object of the present invention
to provide compounds capable of interfering with the interaction
between p53 and MDM2 and/or mdm2 in tumor cells having wild type
p53, particularly human p53, and non-elevated MDM2 levels, as
defined below, in vivos and in vitro. A preferred embodiment
includes peptides and derivatives thereof, capable of binding to
MDM2, particularly human DM2, and specifically inhibiting or
blocking the binding of MDM2 to the p53 protein, particularly human
p53, in vitro or in vivo. The preferred peptides of the invention
are better than the p53 wildtype peptide in inhibiting the hdm2
binding to p53 or a suitable p53 peptide, as can be determined e.g.
in suitable ELISA-type assays, particularly the assays described in
detail hereinafter, on the basis of the IC.sub.50, i.e. the
concentration of peptide necessary to inhibit the hdm2 or p53
binding by 50%. The peptides of the invention mimic the MDM2
binding site on p53. The peptides provided herein consist of or
comprise an amino acid motif (in N- to C-terminal order) of the
formula
1 R.sub.1-X-F-X-R.sub.2-R.sub.3-W-X-X-R.sub.4, (I)
[0007] wherein
[0008] R.sub.1 is a proline (P), leucine (L), glutamic acid (E),
cysteine (C) or glutamine (Q),
[0009] X stands for one (any) natural amino acid,
[0010] R.sub.2 is arginine (R), histidine (H), glutamic acid (E),
cysteine (C), serine (S), or preferably aspartic acid (D),
[0011] R.sub.3 is histidine (H), phenylalanine (F) or preferably
tyrosine,
[0012] R.sub.4 is phenylalanine (F), glutamine (Q) or preferably
leucine (L); and
[0013] F and W (as well as the other capital letters given in
brackets above) are used in accordance with the commonly used
single letter code for amino acids and represent phenylalanine and
tryptophan, respectively.
[0014] As used herein, the term "amino acid(s)" includes the tree
(charged or uncharged) form, or the monovalent or bivalent radical,
the latter also being referred to as "amino acid residue". For
example, in a 10 mer peptide of formula (I), R.sub.1 and R.sub.4
are monovalent radicals, R.sub.1 having a free amino group and
R.sub.4 having a free carboxy group, and X, for example, is a
bivalent amino acid radical.
[0015] Preferred peptides of the invention consisting of or
comprising the amino acid motif of formula (I) are peptides
consisting of no more than fifteen amino acids (15 mers),
particularly 10 mer, 11 mer, 12 mer, 13 mer, 14 mer or 15 mer
peptides. In such peptides comprising the amino acid motif of
formula (I) natural amino acid residues may be attached to the 10
mer motif of formula (I) at the N-terminus, i.e. such additional
amino acids precede R.sub.1, at the N-terminus; at the C-terminus,
i.e. such amino acids follow R.sub.4; or at both ends of a peptide
of formula (I). Sequences of exemplary 12 mer and 15 mer peptides
are given e.g. in Example 8 hereinbelow.
[0016] As used herein, a natural amino acid is a natural
.alpha.-amino acid having the L-configuration, such as those
normally occurring in natural proteins. Unnatural amino acid refers
to an amino acid, which normally does not occur in proteins, e.g.
an epimer of a natural .alpha.-amino acid having the
L-configuration, that is to say an amino acid having the unnatural
D-configuration; or a (D,L)-isomeric mixture thereof; or a
homologue of such an amino acid, for example a .beta.-amino acid,
an .alpha.,.alpha.-disubstituted amino acid, or an .alpha.-amino
acid wherein the amino acid side chain has been shortened by one or
two methylene groups or lengthened to up to 10 carbon atoms, such
as an .alpha.-amino alkanoic acid with 5 up to and including 10
carbon atoms in a linear chain, an unsubstituted or substituted
aromatic (.alpha.-aryl or .alpha.-aryl lower alkyl), for example a
substituted phenylalanine or phenylglycine.
[0017] By selectively disrupting or preventing p53 from binding to
MDM2 through its MDM2 binding site, the peptides of the invention,
or derivatives thereof, can significantly decrease or avoid the
negative regulatory effects of MDM2 on p53 activity. Therefore, the
peptides, or derivatives thereof, of the invention can be used to
restore p53 tumor suppressor function, e.g. in the treatment of
tumor diseases or viral infections when enhanced activity of p53 is
desired or required.
[0018] The peptide sequences of the invention show some homology to
the sequence on p53 required for MDM2 binding, however, additional
homologies are present which are absent from p53.
[0019] Preferred is a peptide of formula
2 R.sub.1-X.sub.1-F-X.sub.2-R.sub.2-R.sub.3-W-X.sub.3-X.sub.4-R.s-
ub.4, (Ia)
[0020] wherein
[0021] R.sub.1, R.sub.2, R.sub.3 and R.sub.4 each have the meanings
given for formula (I) above,
[0022] X.sub.1 is arginine, asparagine, alanine, threonine or
valine;
[0023] X.sub.2 is methionine, isoleucine, threonine, arginine,
alanine or serine;
[0024] X.sub.3 is glutamic acid, threonine, alanine, phenylalanine
or serine;
[0025] X.sub.4 is glycine, glutamine, threonine, alanine or
aspartic acid.
[0026] In particular, preferred peptides of the invention include
the following (amino acid sequences are given in single letter
code):
3 M-P-R-F-M-D-Y-W-E-G-L-N; (II) Q-P-T-F-S-D-Y-W-K-L-L-P (III)
P-R-P-A-L-V-F-A-D-Y-W-E-T- -L-Y. (IV)
[0027] As used herein, "peptide of the invention" refers to a
linear compound comprising the amino acid motif of formula (I) and
containing only natural amino acids which are linked by peptide
bonds and which are in an unprotected form.
[0028] The present invention also provides derivatives of the
peptides of the invention. Such derivatives may be linear or
circular. Derivatives of the invention include molecules wherein a
peptide of the invention is non-covalently or preferably covalently
modified by substitution, chemical, enzymatic or other appropriate
means with another atom or moiety including another peptide or
protein. An example of a derivative comprising a peptide linked to
another protein is exemplified by binding element TIP12/1 as
described in example 10 below. The moiety may be "foreign" to a
peptide of the invention as defined above in that it is an
unnatural amino acid, or in that one or more, preferably one or two
natural amino acid in the motif of formula (I) are replaced with
another natural or unnatural amino acid. Conjugates comprising a
peptide or derivative of the invention covalently attached to
another peptide or protein are also encompassed herein. Attachment
of another moiety may involve a linker or spacer, e.g. an amino
acid or peptidic linker. Derivatives of the invention also includes
peptides wherein one, some or all potentially reactive groups, e.g.
amino, carboxy, sulfhydryl or hydroxyl groups are in a protected
form.
[0029] The atom or moiety derivatizing a peptide of the invention
may serve analytical purposes, e.g. facilitate detection of the
peptide of the invention, favor preparation or purification of the
peptide, or improve a property of the peptide which is relevant for
the purposes of the present invention. Such properties include e.g.
cellular uptake, binding to MDM2, or suitability for in vivo
administration, particularly solubility or stability against
enzymatic degradation. Derivatives of the invention include a
covalent or aggregative conjugate of a peptide of the invention
with another chemical moiety, said derivative displaying
essentially the same activity as the underivatized peptide of the
invention, and a "peptide analogue" or "mimetic" which is modeled
to resemble the three-dimensional structure of the amino acid motif
of formula (I). Examples of such mimetics are retro-inverso
peptides (M. Chorev, M. Goodman, Acc. Chem. Res. 26, 266-273
(1993)). The designing of mimetics to a known pharmaceutically
active compound is a known approach to the design of drugs based on
a "lead" compound. This may be desirable e.g. where the "originar
active compound is difficult or expensive to synthesize, or where
it is unsuitable for a particular mode of administration, e.g.
peptides are considered unsuitable active agents for oral
compositions as they tend to be quickly degraded by proteases in
the alimentary channel.
[0030] Examples of derivatives within the above general definitions
are:
[0031] Cyclic peptides or derivatives including compounds with a
disulfide bridge, a thioether bridge or a lactam. Typically, cyclic
derivatives containing a disulphide bond will contain two
cysteines, which may be L-cysteine or D-cysteine. Advantageously,
the N-terminal amino acid (e.g. R.sub.1 in formula I) and the
C-terminal amino acids are both cysteines. In such derivatives, as
an alternative to cysteine, penicill amine
(.beta.,.beta.-dimethyl-cysteine) can be used. Peptides containing
thioether bridges are obtainable e.g. from starting compounds
having a free cysteine residue at one end and a bromo-containing
building block at the other end (e.g., bromo-acetic acid).
Cyclisation can be carried out on solid phase by a selective
deprotection of the side chain of cysteine. A cyclic lactam may be
formed e.g. between the .gamma.-carboxy group of glutamic acid and
the .epsilon.-amino group of lysine. For example, cyclic lactams
according to the invention have a Glu at the N-terminus (e.g. R in
formula I) and a Lys at the C-terminus. As an alternative to
glutamic acid, it is possible to use aspartic acid. As an
alternative to lysine, ornithine or diaminobutyric acid may be
employed. Also, it is possible to make a lactam between the side
chain of aspartic acid or glutamic acid at the C-terminus and the
.alpha.-amino group of the N-terminal amino acid. This approach is
extendable to .beta.-amino acids (e.g., .beta.-alanine).
Alternatively, glutamine residues at the N-terminus or C-terminus
can be tethered with an alkenedyl chain between the side chain
nitrogen atoms (J. C. Phelan et al., J. of the American Chemical
Society 119, 455-460 (1997)).
[0032] Peptides of the invention, which are modified by
substitution. In the sequence of formula (I) one or more,
preferably one or two, amino acids are replaced with another
natural or unnatural amino acid, e.g. with the respective D-analog,
or a mimetic. For example, in a peptide, wherein R.sub.3 is Phe or
particularly Tyr, Phe or Tyr may be replaced with another building
block, e.g. another proteinogenic amino acid, or a structurally
related analogue. Preferred modifications are such that an
.alpha.-helix conformation in the peptide is induced, increased or
maintained. For example, in a peptide of formula (I), R.sub.2,
X.sub.3 and/or X.sub.4 may, independently from one another, be
replaced by a .alpha.,.alpha.-disubstituted amino acid residue,
.alpha.-aminoisobutyric acid, 1-amino-cyclopropane-1-carboxylic
acid, 1-amino-cyclopentane-1-carb- oxylic acid,
1-aminocyclohexane-1-carboxylic acid, 4-amino
piperidine-4-carboxylic acid and 1-amino-cycloheptane-1-carboxylic
acid.
[0033] Peptides of the invention labeled with an enzyme, a
fluorescent marker, a chemiluminescent marker, a metal chelate,
paramagnetic particles, biotin, or the like. In such derivatives,
the peptide of the invention is bound to the conjugation partner
directly or by way of a spacer or linker group, e.g. a (peptidic)
hydrophilic spacer. Advantageously, the peptide is attached at the
N- or C-terminal amino acid. For example, biotin may be attached to
the N-terminus of a peptide of the invention via a serine residue
or the tetramer SerGlySerGly.
[0034] Peptides of the invention carrying one or more protecting
groups at a (potentially) reactive (side group), such as
amino-protecting group, e.g. acetyl, or a carboxy-protecting group.
For example, the C-terminal carboxy group of a compound of the
invention may be present in form of a carboxamide function.
Suitable protecting groups are commonly known in the art and
further exemplified hereinbelow. Such groups may be introduced e.g.
to enhance the stability of the compound against proteolytic
degradation. If desired, such protecting groups are removed.
[0035] Peptides of the invention fused or attached to another
protein or peptide, e.g. a protein or peptide serving as
internalization vector, such as another peptide facilitating
cellular uptake, e.g. a "penetratin". An exemplary penetratin
comprising derivative according to the invention is e.g. a peptide
comprising the sixteen amino acid sequence from the homeodomain of
the Antennapedia protein (D. Derossi et al., J. Biol. Chem. 269,
10444-10450 (1994)), particularly a peptide having the amino acid
sequence: M-P-R-F-M-D-Y-W-E-G-L-N-R-Q-I-K-I-W-F-Q-N-
-R-R-M-K-W-K-K, or comprising a peptide sequence disclosed by Y.-Z.
Lin et al., J. Biol. Chem. 270, 14255-14258 (1995)),
[0036] Salts, especially acid addition salts, salts with bases or,
where several salt-forming groups are present, mixed salts or
internal salts. Exemplary salts are e.g. the salts described in the
Examples. Preferred are pharmaceutically acceptable salts. However,
it is also possible to use pharmaceutically unacceptable salts,
e.g. for isolation or purification purposes.
[0037] Derivatives of a peptide of the invention also comprise
fragments of such peptide which, as compared to a peptide of
formula (I), consist of or comprise at least eight i.e. eight or
nine, consecutive amino acids of said motif. Such fragments may be
further derivatized as described in detail above.
[0038] More specifically, a preferred fragment according to the
invention is an 8 mer peptide, i.e. a peptide containing eight
amino acid residues, of formula
4 F-X.sub.2-R.sub.2-R.sub.3-W-X.sub.3-X.sub.4-R.sub.4, (Ib)
[0039] wherein
[0040] R.sub.2, R.sub.3 and R.sub.4, independently from one
another, each have the meanings and preferences given for formula
(I) above,
[0041] X.sub.2 is methionine, isoleucine, threonine, arginine,
alanine or serine, preferably methionine;
[0042] X.sub.3 is glutamic acid, threonine, alanine, phenylalanine
or serine, preferably glutamic acid;
[0043] X.sub.4 is glycine, glutamine, threonine, alanine or
aspartic acid, preferably glycine,
[0044] or a derivative as defined above of such fragment.
[0045] Also preferred is a fragment, which is a 9 mer peptide
having the formula
5 X.sub.1-F-X.sub.2-R.sub.2-R.sub.3-W-X.sub.3-X.sub.4-R.sub.4,
(Ic)
[0046] wherein
[0047] R.sub.1, R.sub.2, R.sub.3 and R.sub.4, independently from
one another, each have the meanings and preferences given for
formula (I) above,
[0048] X.sub.1 is arginine, asparagine, alanine, threonine or
valine; particularly arginine
[0049] X.sub.2 is methionine, isoleucine, threonine, arginine,
alanine or serine; preferably methionine;
[0050] X.sub.3 is glutamic acid, threonine, alanine, phenylalanine
or serine; preferably glutamic acid;
[0051] X.sub.4 is glycine, glutamine, threonine, alanine or
aspartic acid, preferably glycine,
[0052] or a derivative as defined above of such fragment.
[0053] Particularly preferred derivatives of peptide fragments of
the invention contain the 8 mer motif of formula (Ib) or the 9 mer
motif of formula (Ic) and also
[0054] a suitable label means, e.g. an enzyme, a fluorescent
marker, a chemiluminescent marker, a metal chelate, paramagnetic
particles, biotin, or the like, and/or
[0055] one or more protecting groups, e.g. as defined above, such
as acetyl, and/or
[0056] be fused or attached to another protein or peptide, e.g. a
peptide as mentioned above.
[0057] Also included within the scope of the provided fragment
derivatives are peptides of formula (Ib) or (Ic), wherein one or
more, preferably one, two or three amino acid residues are replaced
with another natural or unnatural amino acid. For example, in a
peptide, wherein R.sub.3 is Phe or particularly Tyr, Phe or Tyr may
be replaced with another building block, e.g. another proteinogenic
amino acid, or a structurally related analogue, e.g.
ortho-tyrosine, homophenylalanine or 2-naphtyl-alanine. Preferred
modifications are such that an .alpha.-helix conformation in the
fragment is induced, increased or maintained. For example, in a
peptide of formula (I), each of R.sub.2, X.sub.3 and/or X.sub.4
may, independently from one another, be replaced by a
.alpha.,.alpha.-disubsti- tuted amino acid residue, such as
.alpha.-aminoisobutyric acid (Aib),
1-amino-cyclopropane-1-carboxylic acid,
1-amino-cyclopentane-1-carboxylic acid,
1-amino-cyclohexane-1-carboxylic acid,
4-aminopiperidine-4-carboxyl- ic acid, or
1-amino-cycloheptane-1-carboxylic acid. Such replacement may be
combined with the above mentioned substitution by orthotyrosine.
Also, in a 9 mer fragment of formula (Ic), wherein R.sub.2 is
aspartic acid and the remaining variables have the meanings and
preferences given above, X.sub.1 may be replaced with
NH.sub.2--(CH.sub.2).sub.n--CO--, wherein n is from 4 to 6,
preferably a 6-amino-hexanoic acid residue. The N-terminal amino
group of such fragment derivative will form a lactam with the side
chain of aspartic acid.
[0058] Exemplary fragments include the following: P-A-F-T-H-Y-W-P,
and, particularly, P-T-F-S-D-Y-W-P and P-R-F-M-D-Y-W-P, or
derivatives thereof. Particularly preferred are fragments having
the following amino acid sequences: R-F-M-D-Y-W-E-G-L and
F-M-D-Y-W-E-G-L, or derivatives thereof.
[0059] Specially preferred derivatives of the invention are the
derivatives used to exemplify the present invention, derivatives of
the peptides above designated as being preferred, and derivatives
of fragments as defined above.
[0060] A derivative according to the invention may involve one or
multiple modifications as compared to a peptide of the invention,
e.g. carry one or more of the above defined moieties. In other
words, a derivative of the invention is intended to include
compounds derivable from or based on a peptide of the invention or
another derivative of the invention. The preferred derivatives of
the invention are capable of binding to MDM2 and of selectively
inhibiting or blocking the binding of MDM2 to the p53 protein.
[0061] The compounds of the invention have useful, in particular
pharmacologically useful properties. For example, they are useful
in the treatment of diseases that respond to the inhibition of the
p53-MDM2 interaction. As used hereinbefore or hereinbelow, the term
"compound of the invention" includes peptides and derivatives of
the peptides of the invention as well as DNA encoding for the
described peptides and derivatives, triple-strand forming or
antisense nucleotides, small molecules or peptides capable of
inhibiting expression of MDM2, and antibodies and any further
molecules capable of inhibiting p53-MDM2 interaction.
[0062] The ability of a test compound to inhibit interaction
between MDM2 and p53 can be shown by assays commonly known in the
art, or modifications of known assays readily apparent to a person
of ordinary skill in the art. Suitable assays include e.g. a
binding assay determining binding of a test compound, e.g. a
compound of the invention, to MDM2, an in vitro transcription assay
or an assay as described in European Patent Application 95810576.9,
corresponding to International Application No. PCT/EP 96/03957.
Assays may be performed qualitatively or quantitatively and require
comparison to one or more suitable controls.
[0063] A preferred binding assay is a competitive binding assay.
The principle underlying a competitive binding assay is generally
known in the art. Briefly, such binding assay is performed by
allowing a compound to be tested for its capability to compete with
a known, suitably labeled ligand, e.g. MDM2 or p53 for the binding
site at a target molecule, e.g. p53 or MDM2 (depending on which
molecule is used as known ligand). A suitably labeled ligand is
e.g. a radioactively labeled ligand or a ligand which can be
detected by its optical properties, such as absorbance or
fluorescence. After removing unbound ligand and test compound the
amount of labeled ligand bound to the target protein is measured.
If the amount of bound ligand is reduced in the presence of the
test compound, said compound is found to bind to the target
molecule.
[0064] Further details of suitable assays are given in the
Examples. For example, ELISA-type assays may be used wherein p53 or
an appropriately labeled p53 peptide comprising the MDM2 binding
site on p53 is immobilized and binding of MDM2 is competed for by a
candidate inhibitor. Alternatively, MDM2 may be immobilized and
binding of p53 is competed for by such candidate. Furthermore, an
assay involving phage display of a candidate peptide, e.g. a phage
ELISA assay, may be used.
[0065] Particularly preferred compounds of the invention are
superior to the peptide having the amino acid sequence QETFSDLWKLLP
corresponding to the correct p53 wild-type sequence in their
ability to selectively inhibit the binding of p53 and MDM2.
[0066] The peptides and derivatives of the present invention can be
readily prepared according to well-established, standard liquid or,
preferably, solid-phase peptide synthesis methods, general
descriptions of which are broadly available (see, for example, in
J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, 2nd
edition, Pierce Chemical Company, Rockford, Ill. (1984), in M.
Bodanzsky and A. Bodanzsky, The Practice of Peptide Synthesis,
Springer Verlag, New York (1984); and Applied Biosystems 430A Users
Manual, ABI Inc., Foster City, Calif.), or they may be prepared in
solution, by the liquid phase method or by any combination of
solid-phase, liquid phase and solution chemistry, e.g. by first
completing the respective peptide portion and then, if desired and
appropriate, after removal of any protecting groups being present,
by introduction of the residue X by reaction of the respective
carbonic or sulfonic acid or a reactive derivative thereof.
[0067] Reactive derivatives of carbonic or sulfonic acids are
preferably reactive esters, reactive anhydrides or reactive cyclic
amides. Reactive carbonic acid or reactive sulfonic acid
derivatives can also be formed in situ.
[0068] The reaction steps required e.g. for the synthesis of amide
or sulfonamide bonds usually depend on the type of activation of
the carboxylic or sulfo group participating in the reaction. The
reactions normally run in the presence of a condensing agent or,
when activating the carboxylic or sulfonic acids in the form of
anhydrides, of an agent that binds the carboxylic or sultonic acid
formed. The reactions are especially carried out in a temperature
range from -30 to +150.degree. C., preferably from +10 to
+70.degree. C., and, most preferably, from +20 to +50.degree. C.,
if appropriate, in an inert gas atmosphere, e.g. under nitrogen or
argon.
[0069] Synthesis proceeds in a stepwise, cyclical fashion by
successively removing the NH.sub.2 protecting group of the amino
group to be reacted next and then coupling an activated fragment
(e.g. an amino acid, di-, tri- or oligopeptide or a carboxylic acid
or sulfonic acid, or a reactive derivative thereof, to the
deprotected NH.sub.2 (e.g. .alpha.- or .beta.-NH.sub.2).
Preferably, activation of the COOH group of the amino acid to be
reacted or the carboxyl or sulfo group of the acid to be attached
by the condensation reaction is effected
[0070] (i) directly with a carbodiimide, with a carbonyl compound
such as carbonyldiimidazole; with 1,2-oxazolium compounds; with
acylamino compounds such as
2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline; with
N-[(dimethylamino)-1H-1,2,3-triazolo[4,5-b]pyridin-1-ylmethylene]-N-methy-
lmethanaminium hexafluorophosphate N-oxide (HATU); with an uronium
compound such as
2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyl-uronium
tetrafluoroborate (HBTU); or phosphonium corn pounds such as
benzotriazol-1-yl-oxy-tris(dimethylamino)-phosphonium hexafluoro
phosphate (BOP) or benzotriazol-1-yl-oxy-pyrrolidino-phosphonium
hexafluorophosphate (PyBOP);
[0071] (ii) via formation of the symmetric anhydride (obtainable,
for example, by condensation of the corresponding acid in the
presence of a carbodiimide or 1-diethyl-aminopropyne; symmetric
anhydrides method), or an asymmetric anhydride, such as the
respective carbonic or sulfonic acid bromide, chloride or fluoride,
or
[0072] (iii) by formation of an "active ester", e.g. an amino- or
amido ester, such as a 1-hydroxy-benzotriazole (HOBT) or
N-hydroxysuccinimide ester, or an aryl ester, such as a
penta-fluorophenyl, 4-nitrophenyl or 2,4,5-tetrachlorophenyl
ester;
[0073] or by an appropriate combination of any of the reagents and
reactions mentioned under (i) to (iii).
[0074] Useful acid binding agents that can be employed in the
condensation reactions are, for example, alkaline metals,
carbonates or bicarbonates, such as sodium or potassium carbonate
or bicarbonate (if appropriate, together with a sulfate), or
organic bases such as sterically hindered organic nitrogen bases,
for example tri-lower alkylamines, such as
N,N-diisopropyl-N-ethylamine, which can be used alone or in any
appropriate combination.
[0075] Reactive groups in the monomers of ligands or in the
resin-bound or free intermediates resulting from one or more
coupling steps can be protected by third groups as protecting
groups that are customarily used in peptide synthesis. Examples of
protecting groups, their introduction and their removal are, for
example, described in standard works such as "Protective groups in
Organic Chemistry", Plenum Press, London, New York 1973; "Methoden
der organischen Chemie", Houben-Weyl, 4. edition, Vol. 15/1,
Georg-Thieme Verlag, Stuttgart 1974; Th. W. Greene, "Protective
Groups in Organic Synthesis", John Wiley & Sons, New York 1981;
Atherton et al., "Solid Phase Peptide Synthesis--A Practical
Approach", IRL Press Oxford University, 1984; Jones, "The Chemical
Synthesis of Peptides", Oxford Science Publications, Clavendon
Press Oxford, 1991; and Bodanszky, "Peptide Chemistry", Springer
Verlag Berlin, 1988. The term "protecting groups" comprises also
resins used for solid phase synthesis, preferably those
specifically mentioned above and below.
[0076] Examples for hydroxy protecting groups are acyl radicals,
such as tert-lower alkoxycarbonyl radicals, for example
tert-butoxycarbonyl, etherifying groups, such as tert-lower alkyl
groups, for example t-butyl, or silyl- or tin radicals, such as
tert-butyl-dimethylsilyl or the tri-n-butyltin radical.
[0077] Carboxy groups can be protected by groups as defined above
for the C-terminal protecting groups Y, preferably by esterifying
groups selected from those of the tert-butyl type, from benzyl,
from trimethylsilylethyl and from 2-triphenylsilyl groups, or they
can be protected as lower alkenyl esters, such as allylic
esters.
[0078] Amino or guanidino (e.g. in H-Arg-OH) groups can be
protected by removable acyl groups or by arylmethyl, etherified
mercapto, 2-acyl-lower alk-1-enyl, a silyl group or an organic
sulfonyl group or tin amino protecting groups; tert-butoxycarbonyl,
allyloxycarbonyl, benzyl-oxycarbonyl, 4-nitrobenzyloxycarbonyl,
2-chlorobenzyloxycarbonyl, 2-bromobenzyloxy-carbonyl,
diphenylmethoxycarbonyl, nitrophenylsulfenyl,
2,2,2-trichloro-ethoxycarbonyl,
2,2,5,7,8-pentamethylchroman-6-sulfonyl (PMC--very preferred),
2,2,4,6,7-pentamethyldihydrobenzofuran-5-sulfonyl (Pbf) or
4-methoxy-2,3,6-tri methyl-benzenesulfonyl (Mtr) being especially
preferred.
[0079] Carbamide groups (for example, in the side chains of
asparagine and glutamine) can be protected at the nitrogen atom by
arylmethyl groups, preferably triphenylmethyl (trityl) or analogues
thereof with one or more lower alkoxy, such as methoxy, and/or
lower alkyl, such as methyl, substituents in one or more phenyl
rings.
[0080] Imino groups (e.g. in imidazole) can be protected by
2,4-dinitrophenyl, trityl, tert-butoxy-carbonyl or
p-toluenesulfonyl, or (e.g. in indole) by formyl or
tert-butoxycarbonyl.
[0081] Mercapto groups can be protected, e.g., by acetamidomethyl,
by trityl or by p-methylbenzyl.
[0082] A large number of methods of removing protective groups in
the final products or any inter-mediates are known in the art and
comprise, inter alia, .beta.-elimination, solvolysis, hydrolysis,
alcoholysis, acidolysis, photolysis, enzymatical removal, treatment
with a base or reduction.
[0083] The protective groups are usually removed after the complete
synthesis of the resin-bound molecule by conventional methods of
peptide chemistry, conveniently by treatment with 95%
trifluoroacetic acid (Fmoc-chemistry). In some cases, strong
nucleophiles, such as dimethyl sulfide and/or 2-ethanedithiol, may
be additionally added to capture the generated compounds resulting
from the protecting groups, e.g. in a combination such as
trimethyl-silyltrifluoro-methansulonate/dimethylsulfi-
de/trifluoroacetic acid/ethanedithiol/m-cresol.
[0084] The two preferred methods of solid phase peptide synthesis
are the Boc and the Fmoc methods, which are named with reference to
their use of the tert-butoxycarbonyl (Boc) or
9-fluorenylmethyloxycarbonyl (Fmoc) group, respectively, to protect
the .alpha.-NH.sub.2 or .alpha.-NHR.sub.3 of the amino acid residue
to be coupled (see J. M. Stewart, J. D. Young, Solid-Phase Peptide
Synthesis, 2n edn., Pierce, Rockford, Ill. (1984) or G. Barany, R.
B. Merrifield, Solid-phase Peptide Synthesis, in: The Peptides,
Vol. 2 (E. Gross, J. Meienhofer, eds.), Academic Press, New York
(1979)); and E. Atherton and R. C. Sheppard, in Solid-Phase Peptide
Synthesis-A Practical Approach, ed. D. Rickwood and B. D. Hames,
IRL Press at Oxford University Press, Oxford, 1989),
respectively).
[0085] Derivatives of the invention are prepared according to
conventional methods involving de novo synthesis or starting from a
peptide or another derivative of the invention.
[0086] In another aspect, the present invention provides a method
for treating or preventing hyperproliferative disease by
interfering with the interaction or binding between p53 and MDM2 in
tumor cells. The method may comprise administering an effective
amount of a compound of the invention to a warm blood animal,
including a human, or tumor cells containing wild type p53. The
administration of the compounds of the present invention may induce
cell growth arrest or apoptosis. The present invention may be used
to treat disease and or tumor cells comprising non-elevated MDM2
levels. Non elevated levels of MDM2 as used herein refers to MDM2
levels lower than those found in cells containing more than the
normal copy number (2) of mdm2 or below about 10,000 molecules of
MDM2 per cell as measured by ELISA and similar assays known in the
art (Picksley et al., Oncogene 9, 2523-2529 (1994)).
[0087] The method of the present invention encompasses
administering DNA to tumor cells and/or a warm blooded animal,
including a human. DNA of the present invention encodes a product
that interferes with the interaction of p53 and MDM2. DNA typically
is in an expression vector, such as a retrovirus, DNA virus or
plasmid into which DNA sequences necessary for expression in
eukaryotic cells are properly position to result in expression of
the DNA. The DNA sequences are designed to express high levels of
the desired product in tumor cells in a form that is stable and
active as exemplified by the binding element TIP 12/1 described
below. The DNA may be administered to cells in vivos, ex vivos or
in vitro as appropriate. The DNA may be administered encapsulated
in liposomes, via microinjection or any other form known in the art
to achieve efficient cellular uptake.
[0088] Administering compounds that interfere with the interaction
of p53 and MDM2 by affecting the expression of MDM2 are also
encompassed by the method of the present invention. Triple
strand-forming or antisense oligonucleotides which bind the mdm2
gene or its mRNA and prevent transcription or translation may also
administered to tumor cells and/or a warm blooded animal, including
a human, in vivos, ex vivos or in vitro. The oligonucleotides may
interact with unprocessed mRNA or processed mRNA. Small molecules
and peptides which specifically inhibit MDM2 expression may also be
administered to cells.
[0089] In another aspect of the method of the present invention,
antibodies that interfere with the interaction between p53 and MDM2
may be administered to tumor cells and/or to a warm blooded animal,
including a human, facilitating cell growth arrest or apoptosis.
Antibodies of the present invention interrupt p53 and MDM2
interaction, and may comprise polyclonal, monoclonal, and
recombinant antibodies. Antibodies of the invention may be
associated with liposomes or other means known in the art to
facilitate cellular uptake. DNA encoding for the antibodies of the
invention may also be administered to the cell, as described above,
the antibody being delivered to the upon expression of the
administered DNA.
[0090] Furthermore, the present invention relates to uses of a
compound of the invention including its use in the purification of
a binding partner, particularly MDM2; its use as a "lead compound"
for drug development or design; its use in a method of identifying
compounds which interfere with the binding of MDM2 to p53; its use
in diagnosis, e.g. to measure the levels of MDM2 in blood samples
in the case of leukemia or solid carcinomas, such as sarcomas or
glioblastomas.
[0091] The invention relates also to pharmaceutical compositions
comprising compounds of the invention, to their use in the
therapeutic (including prophylactic) treatment of the
hyperproliferative diseases and viral infections, to the compounds
for said use and to the preparation of pharmaceutical
preparations.
[0092] The pharmacologically acceptable compounds of the present
invention may be used, for example, for the preparation of
pharmaceutical compositions that comprise an effective amount of
the active ingredient together or in admixture with a significant
amount of inorganic or organic, solid or liquid, pharmaceutically
acceptable carriers.
[0093] The invention provides a pharmaceutical composition that is
suitable for administration to a warm-blooded animal, especially a
human (or to cells or cell lines derived from a warm-blooded
animal, especially a human, e.g. lymphocytes), for the treatment or
prevention of (=prophylaxis against) a disease that responds to
inhibition of the interaction of p53 with MDM2, comprising an
amount of a peptide of the invention or a pharmaceutically
acceptable derivative thereof, which is effective for said
inhibition, together with at least one pharmaceutically acceptable
carrier.
[0094] The pharmaceutical compositions according to the invention
are those for enteral, such as nasal, rectal or oral, or
parenteral, such as intramuscular or intravenous, administration to
warm-blooded animals (humans and animals), that comprise an
effective dose of the pharmacologically active ingredient, alone or
together with a significant amount of a pharmaceutically acceptable
carrier. The dose of the active ingredient depends on the species
of warm-blooded animal, the body weight, the age and the individual
condition, individual pharmacokinetic data, the disease to be
treated and the mode of administration. The invention relates also
to a method of treating diseases that respond to inhibition of the
interaction of MDM2 and p53, which comprises administering a
prophylactically or especially therapeutically effective amount of
a compound according to the invention, especially to a warm-blooded
animal, for example a human, that, on account of one of the
mentioned diseases, requires such treatment. In a preferred
embodiment the administered compound is a peptide or derivative of
the invention.
[0095] The pharmaceutical compositions comprise from approximately
1% to approximately 95%, preferably from approximately 20% to
approximately 90%, active ingredient. Pharmaceutical compositions
according to the invention may be, for example, in unit dose form,
such as in the form of ampoules, vials, suppositories, drages,
tablets or capsules.
[0096] The pharmaceutical compositions of the present invention are
prepared in a manner known per se, for example by means of
conventional dissolving, lyophilising, mixing, granulating or
confectioning processes.
[0097] Solutions of the active ingredient, and also suspensions,
and especially isotonic aqueous solutions or suspensions, are
preferably used, it being possible, for example in the case of
lyophilized compositions that comprise the active ingredient alone
or together with a carrier, for example mannitol, for such
solutions or suspensions to be produced prior to use. The
pharmaceutical compositions may be sterilized and/or may comprise
excipients, for example preservatives, stabilisers, wetting and/or
emulsifying agents, solubilisers, salts for regulating the osmotic
pressure and/or buffers, and are prepared in a manner known per se,
for example by means of conventional dissolving or lyophilising
processes. The said solutions or suspensions may comprise
viscosity-increasing substances, such as sodium
carboxymethylcellulose, carboxymethylcellulose, dextran, poly
vinylpyrrolidone or gelatin.
[0098] Suspensions in oil comprise as the oil component the
vegetable, synthetic or semi-synthetic oils customary for injection
purposes. There may be mentioned as such especially liquid fatty
acid esters that contain as the acid component a long-chained fatty
acid having from 8 to 22, especially from 12 to 22, carbon atoms,
for example lauric acid, tridecylic acid, myristic acid,
pentadecylic acid, palmitic acid, margaric acid, stearic acid,
arachidic acid, behenic acid or corresponding unsaturated acids,
for example oleic acid, elaidic acid, erucic acid, brasidic acid or
linoleic acid, if desired with the addition of anti oxidants, for
example vitamin E, .beta.-carotene or
3,5-di-tert-butyl-4-hydroxytoluene. The alcohol component of those
fatty acid esters has a maximum of 6 carbon atoms and is a mono- or
poly-hydroxy, for example a mono-, di- or tri-hydroxy, alcohol, for
example methanol, ethanol, propanol, butanol or pentanol or the
isomers thereof, but especially glycol and glycerol. The following
examples of fatty acid esters are there fore to be mentioned: ethyl
oleate, isopropyl myristate, isopropyl palmitate, "Labrafil M 2375"
(polyoxyethylene glycerol trioleate, Gattefoss, Paris), "Miglyol
812" (triglyceride of saturated fatty acids with a chain length of
C.sub.8 to C.sub.12, Huls AG, Germany), but especially vegetable
oils, such as cottonseed oil, almond oil, olive oil, castor oil,
sesame oil, soybean oil and more especially groundnut oil.
[0099] The injection compositions are prepared in customary manner
under sterile conditions; the same applies also to introducing the
compositions into ampoules or vials and sealing the containers.
[0100] Pharmaceutical compositions for oral administration can be
obtained by combining the active ingredient with solid carriers, if
desired granulating a resulting mixture, and processing the
mixture, if desired or necessary, after the addition of appropriate
excipients, into tablets, drage cores or capsules. It is also
possible for them to be incorporated into plastics carriers that
allow the active ingredients to diffuse or be released in measured
amounts.
[0101] Suitable carriers are especially fillers, such as sugars,
for example lactose, saccharose, mannitol or sorbitol, cellulose
preparations and/or calcium phosphates, for example tricalcium
phosphate or calcium hydrogen phosphate, and binders, such as
starch pastes using for example corn, wheat, rice or potato starch,
gelatin, tragacanth, methylcellulose, hydroxypropylmethylcellulose,
sodium carboxymethylcellulose and/or polyvinylpyrrolidone, and/or,
if desired, disintegrates, such as the above-mentioned starches,
also carboxymethyl starch, crosslinked polyvinylpyrrolidone, agar,
alginic acid or a salt thereof, such as sodium alginate. Excipients
are especially flow conditioners and lubricants, for example
silicic acid, talc, stearic acid or salts thereof, such as
magnesium or calcium stearate, and/or polyethylene glycol. Drage
cores are provided with suitable, optionally enteric, coatings,
there being used, inter alia, concentrated sugar solutions which
may comprise gum arabic, talc, polyvinylpyrrolidone, polyethylene
glycol and/or titanium dioxide, or coating solutions in suitable
organic solvents, or, for the preparation of enteric coatings,
solutions of suitable cellulose preparations, such as
ethylcellulose phthalate or hydroxypropylmethylcellulose phthalate.
Capsules are dry-filled capsules made of gelatin and soft sealed
capsules made of gelatin and a plasticiser, such as glycerol or
sorbitol. The dry-filled capsules may comprise the active
ingredient in the form of granules, for example with fillers, such
as lactose, binders, such as starches, and/or glidants, such as
talc or magnesium stearate, and if desired with stabilisers. In
soft capsules the active ingredient is preferably dissolved or
suspended in suitable oily excipients, such as fatty oils, paraffin
oil or liquid polyethylene glycols, it being possible also for
stabilisers and/or antibacterial agents to be added. Dyes or
pigments may be added to the tablets or drage coatings or the
capsule casings, for example for identification purposes or to
indicate different doses of active ingredient.
[0102] The following Examples serve to illustrate the present
invention, but should not be construed as a limitation thereof. The
invention particularly relates to the specific embodiments (e.g.
peptides, methods for their preparation, and assays as described in
these Examples.
[0103] Abbreviations: Acrid=thioether resulting from the reaction
of a Cys-sulfhydryl group in the peptide with
6-acryloyl-2-(dimethylamino)naph- talene; o/n=overnight; Aib:
.alpha.-aminoisobutyric acid; Ac.sub.3c:
1-amino-cyclopropane-1-carboxylic acid.
EXAMPLES
Example 1
Synthesis of N-Acylated Peptide Derivatives
[0104] The below-identified peptides are synthesised on a Milligen
9050 automated peptide synthesizer (continuous flow; Millipore,
Bedford, Mass., USA), starting with an Fmoc-PAL-PEG-PS resin (see
Albericio, F. et al, J. Org. Chem., 55 (1990) 3730-3743) for
establishing the C-terminal carboxamide, and using chemical
protocols based on the fluorenylmethoxycarbonyl chemistry (see E.
Atherton and R. C. Sheppard, in Solid-Phase Peptide Synthesis-A
Practical Approach, eds: R. Rickwood and B. D. Hames, IRL Press at
Oxford University Press, Oxford, 1989). The required Fmoc-amino
acids (3 equivalents) are incorporated using their
2,4,5-trichlorophenyl esters (single coupling) with minimum
reaction times of 30 min (see 9050 Plus PepSynthesizer User's
Guide, Millipore Corporation, Bedford, Mass., 1992). Side chains
are protected with the following groups:
[0105] tert-butyl for aspartic acid, glutamic acid, tyrosine,
serine and threonine;
[0106] tert-butyloxycarbonyl for lysine and tryptophan;
[0107] 2,2,5,7,8-pentamethyl-chroman-6-sulfonyl for arginine;
[0108] trityl for histidine, cysteine, asparagine, and
glutamine.
[0109] The complete peptide resins obtained after the final
coupling reaction are simultaneously deprotected and cleaved by
treatment with trifluoroacetic acid/water/ethanedithiol (76:4:20,
v/v/v) for 3 h at room temperature. The complete peptide resins
obtained after the final coupling reaction are simultaneously
deprotected and cleaved by treatment with trifluoroacetic
acid/water/ethanedithiol (76:4:20, v/v/v) for 3 h at room
temperature. The filtrate from each cleavage reaction is
precipitated in diisopropyl ether-petroleum ether (1:1, v/v) at
0.degree. C., and the precipitates are collected by filtration. The
crude compounds are dissolved in 2N AcOH/acetonitrile (1:1, v/v) to
remove the N.sup.in-carboxy group from the side chain of
tryptophan. The course of the reactions is monitored by analytical
reversed-phase HPLC. After 2 h at 40.degree. C., the solutions are
concentrated to dryness and the crude peptides are purified by
reversed-phase medium-pressure liquid chromatography using a
C.sub.18 column eluted with an acetonitrile-water gradient
containing 0.1% trifluoroacetic acid (Merck LICHROPREP RP-18, 15-25
.mu.m bead diameter, reversed phase column material based on
C.sub.18-derivatised silicagel, Merck, Darmstadt, FRG; column
length 46 cm, diameter 3.6 cm; flow rate 53.3 ml/min; detection at
215 nm). Mass spectrometric analyses (matrix-assisted
laser-desorption ionization time-of-flight mass spectrometry,
MALDI-TOF) reveal molecular masses within 0.1% of the expected
values (positive or negative ion mode). Quantitative amino acid
analyses of the final products reveal amino acid compositions
within 5% of the expected values. The purity of the peptides is
verified by reversed-phase analytical HPLC on a Nucleosil column
(250.times.4.0 mm; 5 mm, 100): linear gradient over 10 min of
MeCN/0.09% TFA and H.sub.2O/0.1% TFA from 1:49 to 3:2; flow rate
2.0 ml/min, detection at 215 nm (HPLC System A); HPLC System B:
linear gradient over 10 min of MeCN/0.09% TFA and H.sub.2O/0.1% TFA
from 1:49 to 1:0; flow rate 2.0 ml/min, detection at 215 nm.
[0110] The peptides are as follows:
[0111] Ac-Thr-Gly-Pro-Ala-Phe-Thr-His-Tyr-Trp-Ala-Thr-Phe-NH.sub.2
(TFA salt);
[0112] Mass spectral analysis (negative-ion mode): 1441.7 (calc.
1441.6, C.sub.71H.sub.92N.sub.16O.sub.17), t.sub.R.sup.(retention
time)=8.08 min (HPLC System A).
[0113] Ac-Met-Pro-Arg-Phe-Met-Asp-Tyr-Trp-Glu-Gly-Leu-Asn-NH.sub.2
(TFA salt);
[0114] Mass spectral analysis (negative-ion mode): 1598.9 (calc.
1598.9, C.sub.73H.sub.101N.sub.18O.sub.19S.sub.2), t.sub.R=8.82 min
(HPLC System A).
[0115] Ac-Gln-Pro-Thr-Phe-Ser-Asp-Tyr-Trp-Lys-Leu-Leu-Pro-NH.sub.2
(TFA salt);
[0116] Mass spectral analysis (negative-ion mode): 1534.8 (calc.
1534.8, C.sub.75H.sub.105N.sub.16O.sub.19), t.sub.R=8.73 min (HPLC
System A).
[0117] Ac-Pro-Ala-Phe-Thr-His-Tyr-Trp-Pro-NH.sub.2 (TFA salt);
[0118] Mass spectral analysis (negative-ion mode): 1060.3 (calc.
1060.2, C.sub.54H.sub.67N.sub.12O.sub.11), t.sub.R=8.21 min (HPLC
System A).
[0119] Ac-Pro-Thr-Phe-Ser-Asp-Tyr-Trp-Pro-NH.sub.2
[0120] Mass spectral analysis (negative-ion mode): 1052.0 (calc.
1052.1, C.sub.52H.sub.63N.sub.10O.sub.14), t.sub.R=7.97 (HPLC
System A).
[0121] Ac-Pro-Arg-Phe-Met-Asp-Tyr-Trp-Pro-NH.sub.2 (TFA salt);
[0122] Mass spectral analysis (negative-ion mode): 1151.6 (calc.
1151.3, C.sub.56H.sub.72N.sub.13O.sub.12S.sub.1), t.sub.R=8.42
(HPLC System A).
[0123] Ac-Gln-Glu-Thr-Phe-Ser-Asp-Lu-Trp-Lys-Leu-Leu-Pro-NH.sub.2
(TFA salt) (wild-type sequence)
[0124] Mass spectral analysis (negative-ion mode): 1517.1 (calc.
1516.8, C.sub.72H.sub.107N.sub.16O.sub.20), t.sub.R=9.30 (HPLC
System A), t.sub.R=6.65 (HPLC System B)
[0125] Ac-Gln-Pro-Thr-Phe-Ser-Asp-Leu-Trp-Lys-Leu-Leu-Pro-NH.sub.2
(TFA salt)
[0126] Mass spectral analysis (negative-ion mode): 1485.0 (calc.
1484.8, C.sub.72H.sub.107N.sub.16O.sub.18), t.sub.R=9.32 (HPLC
System A), t.sub.R=6.66 (HPLC System B)
[0127] Ac-Gln-Glu-Thr-Phe-Ser-Asp-Tyr-Trp-Lys-Leu-Leu-Pro-NH.sub.2
(TFA salt)
[0128] Mass spectral analysis (negative-ion mode): 1567.3 (calc.
1566.8, C.sub.75H.sub.105N.sub.16O.sub.21), t.sub.R=8.55 (HPLC
System A), t.sub.R=6.19 (HPLC System B).
[0129]
Ac-Val-Gln-Asn-Phe-Ile-Asp-Tyr-Trp-Thr-Gln-Gln-Phe-NH.sub.2
[0130] Mass spectral analysis (negative-ion mode): 1628.8 (calc.
1628.8, C.sub.78H.sub.103N.sub.18O.sub.21), t.sub.R=7.03 (HPLC
System A);
[0131]
Ac-Ile-Asp-Arg-Ala-Pro-Thr-Phe-Arg-Asp-His-Trp-Phe-Ala-Leu-Val-NH.s-
ub.2 (TFA salt)
[0132] Mass spectral analysis (negative-ion mode): 1883.9 (calc.
1884.2, C.sub.89H.sub.128N.sub.25O.sub.21), t.sub.R=8.57 min (HPLC
System A)
[0133]
Ac-Pro-Arg-Pro-Ala-Leu-Val-Phe-Ala-Asp-Tyr-Trp-Glu-Thr-Leu-Tyr-NH.s-
ub.2 (TFA salt)
[0134] Mass spectral analysis (negative-ion mode): 1881.6 (calc.
1881.2, C 92H.sub.127N.sub.20O.sub.23), t.sub.R=9.58 min (HPLC
System A); t.sub.R=6.88 min (HPLC System B).
[0135]
Ac-Pro-Ala-Phe-Ser-Arg-Phe-Trp-Ser-Asp-Leu-Ser-Ala-Gly-Ala-His-NH.s-
ub.2 (TFA salt)
[0136] Title compound: Mass spectral analysis (negative-ion mode):
1688.6 (calc. 1688.9, C.sub.78H.sub.107N.sub.22O.sub.21),
t.sub.R=9.09 min (HPLC System A); t.sub.R=6.48 min (HPLC System
B)
[0137] If desired, the peptide derivatives contain a free
N-terminal amino group. Peptides with a free N-terminal amino group
include:
[0138] H-Thr-Gly-Pro-Ala-Phe-Thr-His-Tyr-Trp-Ala-Thr-Phe-NH.sub.2
(TFA salt)
[0139] Mass spectral analysis (negative-ion mode): 1396.6 (calc.
1396.6, C.sub.69H.sub.87N.sub.16O.sub.16), t.sub.R=7.86 min (HPLC
System A).
[0140] H-Met-Pro-Arg-Phe-Met-Asp-Tyr-Trp-Glu-Gly-Leu-Asn-NH.sub.2
(TFA salt)
[0141] Mass spectral analysis (negative-ion mode): 1556.6 (calc.
1556.8, C.sub.71H.sub.99N.sub.18O.sub.18S.sub.2), t.sub.R=7.92 min
(HPLC System A).
Example 2
Synthesis of Cys(Acrld) Peptide Derivatives
[0142] I.
Ac-Cys(Acrld)-Gly-Gln-Pro-Thr-Phe-Ser-Asp-Tyr-Trp-Lys-Leu-Leu-Pr-
o-NH.sub.2 (TFA salt)
Ac-Cys-Gly-Gln-Pro-Thr-Phe-Ser-Asp-Tyr-Trp-Lys-Leu-L-
eu-Pro-NH.sub.2 (TFA salt) is obtained analogously to Example 1
(Mass spectral analysis (negative-ion mode): 1694.7 (calc. 1695.0,
C.sub.80H.sub.113N.sub.18O.sub.21S.sub.1), t.sub.R=8.39 (HPLC
System A)).
[0143] To a solution of
Ac-Cys-Gly-Gln-Pro-Thr-Phe-Ser-Asp-Tyr-Trp-Lys-Leu-
-Leu-Pro-NH.sub.2 (18 .mu.mol) in 20 ml of degassed phosphate
buffer (pH=7.5) is added 6-acryloyl-2-(dimethylamino)naphtalene
(2-fold excess: Molecular Probes, Inc., Leiden, The Netherlands)
dissolved in 2 ml of acetonitrile. The solution is stirred
overnight at room temperature under an argon atmosphere. After
completion of the reaction, 1 ml of trifluoroacetic acid is added
and the solution is concentrated to dryness. The compound is
purified by reversed-phase medium-pressure liquid
chromatography.
[0144] Title compound: Mass spectral analysis (negative-ion mode):
1920.4 (calc. 1920.3, C.sub.95H.sub.128N.sub.19O.sub.22S.sub.1),
t.sub.R=9.20 (HPLC System A); t.sub.R=6.60 (HPLC System B).
[0145] II.
Ac-Cys(Acrd)-Gly-Pro-Thr-Phe-Ser-Asp-Leu-Trp-Pro-NH.sub.2 (TFA
salt) Ac-Cys-Gly-Pro-Thr-Phe-Ser-Asp-Leu-Trp-Pro-NH.sub.2 is
obtained analogously to Example 1 (Mass spectral analysis
(negative-ion mode): 1162.0 (calc. 1162.3,
C.sub.54H.sub.73N.sub.12O.sub.15S.sub.1), t.sub.R=8.00).
[0146] The title compound (II) is obtained analogously to the
previous example (I).
[0147] Title compound: Mass spectral analysis (negative-ion mode):
1387.6 (calc. 1387.6, C.sub.69H.sub.88N.sub.13O.sub.16S.sub.1),
t.sub.R=9.63 (HPLC System A), t.sub.R=6.87 (HPLC System B).
[0148] III. Ac-Cys(Acrd)-Pro-Thr-Phe-Ser-Asp-Leu-Trp-Pro-NH.sub.2
(TFA salt) Ac-Cys-Pro-Thr-Phe-Ser-Asp-Leu-Trp-Pro-NH.sub.2 is
obtained analogously to Example 1. (Mass spectral analysis
(negative-ion mode): 1105.5 (calc. 1105.3,
C.sub.52H.sub.70N.sub.11O.sub.14S.sub.1), t.sub.R=8.25 (HPLC System
A).
[0149] The title compound is obtained analogously to the above
example.
[0150] Title compound: Mass spectral analysis (negative-ion mode):
1330.6 (calc. 1330.6, C.sub.67H.sub.85N.sub.12O.sub.15S.sub.1),
t.sub.R=9.82 (HPLC System A); t.sub.R=7.02 (HPLC System B).
Example 3
Synthesis of Biotinylated Peptide Derivatives
[0151]
Biotin-Ser-Gly-Ser-Gly-Gln-Glu-Thr-Phe-Ser-Asp-Leu-Trp-Lys-Leu-Leu--
Pro-NH.sub.2 (TFA salt) (wild-type sequence)
[0152] (+)-Biotin (3 equivalents; Fluka, Buchs, Switzerland) is
coupled with
N-[(dimethylamino)1H-1,2,3-triazolo[4,5-b]pyridin-1-ylmethylene]-N-m-
ethylmethan-aminium hexafluorophosphate N-oxide (3 equiv.; double
coupling; PerSeptive Biosystems, Hamburg, Germany) in the presence
of diisopropylethylamine (6 equiv.)
[0153] Mass spectral analysis (negative-ion mode): 1989.5 (calc.
1989.3, C.sub.90H.sub.135N.sub.22O.sub.27S.sub.1), t.sub.R=9.02
(HPLC System A), t.sub.R=6.55 (HPLC System B)
[0154]
Biotin-Ser-Gly-Ser-Gly-Gln-Pro-Thr-Phe-Ser-Asp-Leu-TrpLys-Leu-Leu-P-
ro-NH.sub.2 (TFA salt).
[0155] Mass spectral analysis (negative-ion mode): 1957.9 (calc.
1957.3, C.sub.90H.sub.135N.sub.22O.sub.25S.sub.1), t.sub.R=9.04
(HPLC System A), t.sub.R=6.57 (HPLC System B).
[0156]
Biotin-Ser-Gly-Ser-Gly-Gln-Glu-Thr-Phe-Ser-Asp-Tyr-Trp-Lys-Leu-Leu--
Pro-NH.sub.2 (TFA salt).
[0157] Mass spectral analysis (negative-ion mode): 2039.3 (calc.
2039.3, C.sub.93H.sub.133N.sub.22O.sub.28S.sub.1), t.sub.R=8.46
(HPLC System A).
[0158]
Biotin-Ser-Met-Pro-Arg-Phe-Met-Asp-Tyr-Trp-Glu-Gly-Leu-Asn-Arg-Gln--
Ile-Lys-Ile-Trp-Phe-Gln-Asn-Arg-Arg-Met-Lys-Trp-Lys-Lys-NH.sub.2
(TFA salt)
[0159] Mass spectral analysis (negative-ion mode): 4098.4 (calc.
4099.0, C.sub.188H.sub.284N.sub.55O.sub.41 S.sub.4), t.sub.R=9.08
min (HPLC System A); t.sub.R=6.41 min (System B). This derivative
comprises a biotin label, serine as spacer, a peptide of the
invention and the penetratin sequence
Arg-Gln-Ile-Lys-Ile-Trp-Phe-Gln-Asn-Arg-Arg-Met-Lys-T- rp-Lys-Lys
from the homeodomain of the Antennapedia protein (D. Derossi, J.
Biol. Chem. 269, 10444-10450 (1994)).
[0160]
Ac-Ala-Ala-Val-Ala-Leu-Leu-Pro-Ala-Val-Leu-Leu-Ala-Leu-Leu-Ala-Pro--
.beta.Ala-Met-Pro-Arg-Phe-Met-Asp-Tyr-Trp-Glu-Gly-Leu-Asn-.beta.Ala-Lys(Bi-
otin)-NH.sub.2 (TFA salt)
[0161] The peptide contains the internalization vector:
Ala-Ala-Val-Ala-Leu-Leu-Pro-Ala-Val-Leu-Leu-Ala-Leu-Leu-Ala-Pro
(Lin et al., J. Biol. Chem. 270, 14255-14258 (1995)).
[0162] The peptide is synthesised as described in Example 1 using
N.sup.a-Fmoc-Lys(Aloc)-OH. After the incorporation of the last
residue, the side chain of lysine is selectively deprotected with
tetrakis(triphenylphosphine) palladium (0) in the presence of
trimethylsilylacetate and 4-(trimethylsilyl)morpholine dissolved in
dichloromethane. The deprotection is carried out in an argon
atmosphere for 2 h at room temperature, followed by washing with
dichloromethane (4.times.1 min), N-methylpyrrolidin-2-one
(4.times.1 min), 0.05 M sodium diethyldithiocarbamate in DMF
containing 0.5% of diisopropylethylamine (4.times.1 min), and
N-methylpyrrolidin-2-one (4.times.1 min). The incorporation of
(+)-biotin to the side chain of lysine is mediated by
N-[dimethylamino)
1H-1,2,3-triazolo[4,5-b)pyridin-1-ylmethylene]-N-methyl-
methan-aminium hexafluorophosphate N-oxide in the presence of
diisopropyl ethylamine. Title compound: Mass spectral analysis
(negative-ion mode): 3593.7 (calc. 3593.4,
C.sub.169H.sub.265N.sub.40O.sub.40S.sub.3), t.sub.R=9.15 (HPLC
System B).
Example 4
Cyclic Peptide Derivatives Containing Disulphide Bond
[0163] Cyclic peptides containing a disulphide bond are synthesized
from the respective cysteinyl peptides as follows: the cysteinyl
peptide (20 mg; in the following referred to as starting compound)
is dissolved in a 0.1 M solution of ammonium bicarbonate (20 ml).
The mixture is left to stand open to atmosphere. Aliquots of the
solution are removed at different times and analysed by analytical
HPLC. After 24 h, the reaction mixture is concentrated to dryness.
The crude compound is dissolved in water and injected directly in a
medium-pressure liquid chromatography system as described above,
and the title compound is obtained.
[0164] Ac-Cys-Thr-Phe-Ser-Asp-Tyr-Trp-Cys-NH.sub.2 is obtained
analogously to Example 1. Starting compound: Mass spectral analysis
(negative-ion mode): 1064.6 (calc. 1064.2,
C.sub.48H.sub.59N.sub.10O.sub.14S.sub.2), t.sub.R=8.15 (HPLC System
A).
6 Ac-Cys-Thr-Phe-Ser-Asp-Tyr-Trp-Cys-NH.sub.2
S---------------------------------------S
[0165] Title compound: Mass spectral analysis (negative-ion mode):
1062.2 (calc. 1062.2, C.sub.48H.sub.57N.sub.10O.sub.14S.sub.2),
t.sub.R=7.96 (HPLC System A).
[0166] Ac-Cys-Ala-Phe-Thr-His-Tyr-Trp-Cys-NH.sub.2 (TFA salt);
[0167] Starting compound: Mass spectral analysis (negative-ion
mode): 1070.0 (calc. 1070.2,
C.sub.50H.sub.61N.sub.12O.sub.11S.sub.2), t.sub.R=8.35 (HPLC System
A).
7 Ac-Cys-Ala-Phe-Thr-His-Tyr-Trp-Cys-NH.sub.2 (TFA salt)
S---------------------------------------S
[0168] Mass spectral analysis (positive-ion mode): 1070.4 (calc.
1070.2, C.sub.50H.sub.61N.sub.12O.sub.11S.sub.2). t.sub.R=8.13 min
(HPLC System A).
[0169] Ac-Cys-Arg-Phe-Met-Asp-Tyr-Trp-Cys-NH.sub.2 (TFA salt)
[0170] Starting compound: Mass spectral analysis (negative-ion
mode): 1163.7 (calc. 1163.4,
C.sub.52H.sub.68N.sub.13O.sub.12S.sub.3), t.sub.R=8.67 (HPLC System
A).
8 Ac-Cys-Arg-Phe-Met-Asp-Tyr-Trp-Cys-NH.sub.2 (TFA salt)
S---------------------------------------S
[0171] Mass spectral analysis (negative-ion mode): 1161.1 (calc.
1161.4, C.sub.52H.sub.66N.sub.13O.sub.12S.sub.3), t.sub.R=8.33 min
(HPLC System A).
[0172] As an alternative to cysteine, penicillamine
(.beta.,.beta.-dimethyl-cysteine) can be used. Also, L-cysteine may
be changed for D-cysteine either at the N- or C-terminus, or in
both sides. Peptides containing thioether bridges are formed from
starting compounds having a free cysteine residue at the C-terminus
and a bromo-containing building block at the N-terminus (e.g.,
bromo-acetic acid). Cyclisation can be carried out on solid phase
by a selective deprotection of the side chain of cysteine (Mayer,
J. P. et al., Tetrahedron Lett. 361411, 7387-7390 (1995)).
Example 5
Synthesis of Lactam Peptide Derivatives
[0173] The peptide is synthesised manually on a
4-(2',4'-dimethoxyphenyl-a- minomethyl)-phenoxy-resin (Novabiochem,
Lufelfingen, Switzerland), employing the fluorenylmethoxycarbonyl
strategy. Fmoc-removal is with piperidine/dimethylacetamide (1:4,
v/v; 6.times.2 min), followed by washing with methanol (3.times.1
min), N-methylpyrrolidin-2-one (2.times.1 min), methanol (3.times.1
min), and N-methylpyrrolidin-2-one (3.times.2 min). Amino acid side
chains are protected with the following groups: tert-butyl for
threonine, serine, aspartic acid and tyrosine;
2,2,5,7,8-pentamethyl-chroman-6-sulfonyl for arginine;
tert-butyloxycarbonyl for tryptophan; allyl for glutamic acid; and
allyloxycarbonyl for lysine. The required Fmoc-derivatives of
tryptophan, tyrosine, threonine, serine, aspartic acid, arginine,
methionine, phenylalanine and alanine are incorporated using their
2,4,5-trichlorophenyl esters (2 equiv.) in the presence of
1-hydroxybenzotriazole (2 equiv.) and diisopropylethylamine (0.75
equiv.). The incorporation of N.sup..alpha.-Fmoc-Lys(Aloc)-OH (2
equiv.; PerSeptive Biosystems, Hamburg, Germany) and
N.sup..alpha.-Fmoc-Glu(OAII)- -OH (2 equiv.; Millipore, Bedford,
Mass., U.S.A.) is accomplished with
benzotriazole-1-yl-oxy-tris-(dimethylamino)-phosphonium
hexafluorophosphate/1-hydroxybenzotriazole (1:1; 2 equiv.) in the
presence of diisopropylethylamine (4 equiv.) Coupling is achieved
by first dissolving the Fmoc-amino acid, diisopropylethylamine, and
the coupling reagent in N-methylpyrrolidin-2-one, then waiting 3
min for preactivation, adding the mixture to the resin, and finally
shaking for at least 45 min. After the incorporation of the last
residue, the side chains of glutamic acid and lysine are
selectively deprotected with tetrakis(triphenylphosphine) palladium
(0) (Fluka, Buchs, Switzerland) in the presence of
trimethylsilylacetate and 4-(trimethylsilyl)morpholine dissolved in
dichloromethane. The deprotection is carried out in an argon
atmosphere for 2 h at room temperature, followed by washing with
dichloromethane (4.times.1 min), N-methylpyrrolidin-2-one
(4.times.1 min), 0.05 M sodium diethyldithiocarbamate in DMF
containing 0.5% of diisopropylethylamine (4.times.1 min), and
N-methylpyrrolidin-2-one (4.times.1 min). Intramolecular
cyclisation on the solid support is accomplished with
benzotriazole-1-yl-oxy-tris-(dimethylamino)-phosphonium-
hexafluorophosphate/1-hydroxybenzotriazole (1:1; 6 equiv.; double
coupling) in the presence of diisopropylethylamine (12 equiv.). The
complete peptide resin obtained after the cyclisation step is
simultaneously deprotected and cleaved by treatment with
trifluoroacetic acid/water/ethanedithiol (76:4:20, v/v/v) for 3 h
at room temperature. The filtrate is precipitated in diisopropyl
ether-petroleum ether (1:1, v/v) at 0.degree. C., and the
precipitate is collected by filtration. The crude compound is
dissolved in 2N AcOH/acetonitrile (1:1, v/v) to remove the
N.sup.in-carboxy group from the side chain of tryptophan. The
courses of the reactions are monitored by analytical reversed-phase
HPLC. After 2 h at 40.degree. C., the solution is concentrated to
dryness and the crude peptide is purified by medium-pressure liquid
chromatography as described above.
9 Ac-Glu-Thr-Phe-Ser-Asp-Tyr-Trp-Lys-NH.sub.2 (TFA salt)
---------------CO-NH--------------
[0174] Mass spectral analysis (negative-ion mode): 1097.5 (calc.
1097.2, C.sub.53H.sub.66N.sub.11O.sub.15), t.sub.R=7.49 min (HPLC
System A).
10 Ac-Glu-Arg-Phe-Met-Asp-Tyr-Trp-Lys-NH.sub.2 (TFA salt)
---------------CO-NH----------------
[0175] Mass spectral analysis (negative-ion mode): 1196.7 (calc.
1196.4, C.sub.57H.sub.75N.sub.14O.sub.13S.sub.1), t.sub.R=8.09 min
(HPLC System A).
[0176] As an alternative to glutamic acid, it is possible to use
aspartic acid. As an alternative to lysine, ornithine or
diaminobutyric acid may be used. As an alternative to side-side
cyclisation, it is possible to make a lactam between the side chain
of aspartic acid or glutamic acid at the C-terminus and the
.alpha.-amino group of the N-terminal amino acid. This approach can
also be expanded to .beta.-amino acids (e.g., .beta.-alanine).
[0177] The following peptides are synthesised as described in
Example 1:
[0178] Ac-Phe-Met-Aib-Tyr-Trp-Aib-Gly-Leu-NH.sub.2
[0179] Title compound: Mass spectral analysis (negative-ion mode):
1026.5 (calc. 1026.3, C.sub.52H.sub.69N.sub.10O.sub.10S.sub.1),
t.sub.R=7.81 (HPLC System B).
[0180] Ac-Arg-Phe-Met-Aib-Tyr-Trp-Aib-Gly-Leu-NH.sub.2
[0181] Title compound: Mass spectral analysis (negative-ion mode):
1182.6 (calc. 11182.4, C.sub.58H.sub.81N.sub.14O.sub.11S.sub.1),
t.sub.R=7.09 (HPLC System B).
[0182] Ac-Arg-Phe-Met-Aib-Tyr-Trp-Glu-Ac.sub.3c-Leu-NH.sub.2 (TFA
salt)
[0183] Title compound: Mass spectral analysis (negative-ion mode):
1252.7 (calc. 1252.5, C.sub.61H.sub.83N.sub.14O.sub.13S.sub.1),
t.sub.R=6.91 (HPLC System B).
[0184] Ac-Phe-Met-Aib-Tyr-Trp-Aib-Ac.sub.3c-Leu-NH.sub.2
[0185] Title compound: Mass spectral analysis (negative-ion mode):
1052.3 (calc. 1052.3, C.sub.54H.sub.71N.sub.10O.sub.10S.sub.1),
t.sub.R=8.03 (HPLC System B).
[0186] Ac-Phe-Met-Aib-Tyr-Trp-Glu-Ac.sub.3c-Leu-NH.sub.2
[0187] The peptide is synthesised as described in Example 5. The
incorporation of
N.sup..alpha.-Fmoc-1-amino-cyclopropane-1-carboxylic acid (2
equiv.) is carried out with benzotriazole-1-yl-oxy-tris-(dimethyl-
amino)-phosphonium hexafluorophosphate/N-hydroxybenzotriazole (1:1;
2 equiv.) in the presence of diisopropylethylamine (5 equiv.).
N.sup.a-Fmoc-aminoisobutyric acid (2 equiv.) is coupled with
benzotriazole-1-yl-oxy-tris-(dimethylamino)-phosphonium
hexafluorophosphate/N-hydroxybenzotriazole (1:1; 2 equiv.; first
coupling) and
N-[(dimethylamino)-1H-1,2,3-triazolo-[4,5-b]pyridin-1-ylmet-
hylene]-N-methylmethanaminium hexa fluorophosphate N-oxide (2
equiv.; second coupling) in the presence of diisopropyl ethylamine
(5 equiv.). A second coupling for glutamic acid and methionine (2
equiv.) is performed with
N-[(dimethylamino)-1H-1,2,3-triazolo-[4,5-b]pyridin-1-ylmethylene]-N-
-methylmethanaminium hexafluorophosphate N-oxide (2 equiv.; second
coupling) in the presence of diisopropylethylamine (5 equiv.). The
complete peptide resin obtained after the final coupling reaction
is simultaneously deprotected and cleaved by treatment with
trifluoro acetic acid/H.sub.2O (95:5, v/v) for 3 h at room
temperature. The filtrate from the cleavage reaction is
precipitated in diisopropyl ether/petroleum ether (1:1, v/v,
0.degree. C.), and the precipitate collected by filtration. The
crude peptide is purified as described in Example 1.
[0188] Title compound: Mass spectral analysis (negative-ion mode):
1096.4 (calc. 1096.3, C.sub.55H.sub.71N.sub.10O.sub.12S.sub.1),
t.sub.R=7.62 (HPLC System B).
[0189] The starting material is prepared as follows:
[0190] a) N.sup.a-Fmoc-1-amino-cyclopropane-1-carboxylic acid
[0191] The title compound is synthesised starting from
1-amino-cyclopropane-1-carboxylic acid (Fluka, Buchs, Switzerland)
according to a procedure known in the art (see E. Atherton et al.,
in: Solid-Phase Peptide Synthesis--A Practical Approach; D.
Rickwood and B. D. Hames, IRL Press at Oxford University Press,
Oxford, 1989): R.sub.f=0.44 (chloroform:methanol:water:acetic
acid=850:130:15:5, v/v/v/v). m.p.=223-225.degree. C.
Example 6
Synthesis of Peptide Fragment Derivatives
[0192] The below identified peptide fragment derivatives are
sythesised analogously to the method described in Example 1
above:
[0193] Ac-Arg-Phe-Met-Asp-Tyr-Trp-Glu-Gly-Leu-NH.sub.2 (TFA
salt)
[0194] Mass spectral analysis (negative-ion mode): 1256.4 (calc.
1256.4, C.sub.59H.sub.79N.sub.14O.sub.15S.sub.1), t.sub.R=8.69
(HPLC System A), t.sub.R=7.02 (HPLC System B).
[0195] Ac-Phe-Met-Asp-Tyr-Trp-Glu-Gly-Leu-NH.sub.2
[0196] Mass spectral analysis (negative-ion mode): 1100.5 (calc.
1100.3, C.sub.53H.sub.67N.sub.10O.sub.14S.sub.1), t.sub.R=9.38
(HPLC System A), t.sub.R=6.76 (HPLC System B).
[0197] Ac-Phe-Met-Aib-Tyr-Trp-Glu-Gly-Leu-NH.sub.2
[0198] Mass spectral analysis (negative-ion mode): 1070.4 (calc.
1070.3, C.sub.53H.sub.69N.sub.10O.sub.12S.sub.1), t.sub.R=7.14
(HPLC System B).
[0199] Ac-Phe-Met-Asp-Tyr-Trp-Aib-Gly-Leu-NH.sub.2
[0200] Mass spectral analysis (negative-ion mode): 1056.2 (calc.
1056.2, C.sub.52H.sub.67N.sub.10O.sub.12S.sub.1), t.sub.R=7.07
(HPLC System B).
Example 7
Fluorescence Assay
[0201] The DNA region of the mdm2 gene encoding the first 188 amino
acids of the protein is obtained by Polymerase Chain Reaction (PCR)
amplification of the mdm2 gene. The oligonucleotides used for PCR
are designed such that a BamHI restriction site is introduced at
the 5' extremity of the gene and an EcoRI restriction site at its
3' end. The PCR fragments digested by BamHI and EcoRI are ligated
with a BamHI/EcoRI cleaved pGEX-2T vector. The resulting vector
comprises a fusion gene consisting of the full length sequence of
glutathione-S-transferase of S. japonicum, a linker sequence, and
the N-terminal 188 amino acids of HDM2, in the 5' to 3' order. The
complete gene is sequenced on both strands and the recombinant
plasmid is introduced into E. coli strain BL21 (Novagen).
[0202] Glutathione-S-transferase protein (for control experiments)
is obtained from E. coli strain BL21 (Novagen) transformed with
pGEX-2T plasmid.
[0203] The test compound (c=50 nM), e.g. a fluorogenic peptide
described in Example 4, is titrated with different amounts of the
GST-hdm2 protein (c=0, 50 nM, 200 nM, and 300 nM).
[0204] The fluorescence emission spectra (.lambda..sub.ex=370 nm)
are recorded in a spectrofluorophotometer at 20.degree. C. The
instrument setting during the titration is identical so that the
fluorescence intensifies in the presence or absence of the GST-hdm2
protein can be compared. A stock solution of the fluorogenic
peptide is prepared in a PBS buffer (pH=7.6) containing 10%
glycerol, 1% Triton 100, 50 mM NaCl and BSA (1 mg/ml). The peptide
(c=50 nM) is incubated for 30 min with different amounts of the
GST-hdm2 protein. After this time, the fluorescence emission
spectrum is recorded. The addition of the GST-hdm2 protein to the
solution containing the fluorogenic peptide results in an increase
in the emission fluorescence of the fluorogenic peptide at 530 nm.
The fluorescence emission spectra of the GST-hdm2 protein (c=50-300
nM) is identical to the fluorescence emission spectra of the
buffer, so the protein does not contribute to the observed increase
in emission fluorescence.
[0205] This assay is applicable to the detection of specific
interactions of peptides or low molecular weight compounds with the
MDM2 protein. In addition, it allows accurate kinetic measurements
in solution.
Example 8
Identification of MDM2 Binding Peptides by Phage Display
[0206] In deviation from the previous definition, in the following
Examples "hdm2" refers to the human double minute gene2 and the
corresponding protein.
[0207] Phage Selection
[0208] The phage libraries used in this study display random
peptide sequences of six, twelve or fifteen amino acid residues at
the N-terminus of the minor coat protein III. These libraries are
provided by George Smith (University of Missouri, 6 and 15 mer) and
William Dower (Affymax Research Institute, 12 mer). In a biopanning
procedure library samples are screened on solid phase GST-hdm2
(hdm2 comprising amino acids 1-188). Polystyrene petri dishes
(Falcon 3001) are coated with 5 .mu.g/ml GST-hdm2 or DO-1
(monoclonal anti-p53 antibody) overnight at 4.degree. C. in a
humidity chamber. Unbound material is washed off with 2.5 ml PBS
and the dishes are blocked with 2 ml TBST-M (150 mM NaCl, 50 mM
Tris-HCl, pH 7.5, 0.1% (v/v) Tween20, 5% (w/v) low fat milk powder)
for 1 h at 4.degree. C. The petri dishes are washed three times
with 2.5 ml PBS and 500 .mu.l phage suspension containing
1.times.10.sup.11 (6 and 12 mer libraries) or 7.5.times.10.sup.12
TU (transforming units) is added and allowed to bind for 3 h at
4.degree. C. After washing ten times with 2.5 ml TBST, bound phages
are eluted with 400 .mu.l elution buffer (0.1 N HCl-glycine pH2.2,
1 mg/ml BSA) for 20 min. The eluates are neutralized with 24 .mu.l
2M Tris base and used to infect 2.5 ml log-phase E. coli K91 cells
(50 min; 37.degree. C.). The whole suspension is transfered into 50
ml Falcon tubes with 10 ml 2.times.YT medium containing 20 .mu.g/ml
tetracycline (2.times.YT, Tet) and incubated for 24 hours at
37.degree. C. with shaking. The cultures are spun to remove the
bacteria and the phage particles are purified from the supernatant
by PEG precipitation. The phage pellets are resuspended in 1 ml TBS
and aliquots are used for a second round of biopanning which is
carried out as for the first with the following modifications:
[0209] 100 .mu.l amplified phage (2.times.10.sup.11 TU) are reacted
with GST-hdm2, MBP-hdm2 or DO-1 which has been absorbed in wells of
a 96-well PVC assay plate at a concentration of 5 .mu.g/ml.
Amplified and purified phages from this round of biopanning are
tested in an ELISA on the proteins used for their selection. For
single clone screening E. coli K91 cells are infected with
appropriate phage dilutions and spread on LB agar with 20 .mu.g/ml
tetracycline. Single colonies are transfered to wells of a 96-well
tissue culture plate containing 200 .mu.l 2.times.YT medium with 20
.mu.g/ml tetracycline per well. Phage supernatant is collected for
ELISA screening after a 24 hour incubation at 37.degree. C. with
shaking. ELISA positive clones are grown up as 2 ml bacterial
cultures in 2.times.YT medium with 20 .mu.g/ml tetracycline for 24
hours. Phage are PEG precipitated and redissolved in 200 .mu.l TBS
buffer. Phage DNA is extracted with phenol/chloroform and ethanol
precipitated. The DNA pellet is redissolved in 10 .mu.l water and
used as template for sequencing (Sequenase).
[0210] Phage Elisa
[0211] Solid phase hdm2
[0212] PVC assay plates are coated with 100 .mu.l antigen
(GST-hdm2, MBP-hdm2, GST, MBP, or DO-1) at 5 .mu.g/ml in PBS
overnight at 4.degree. C. and blocked with 200 .mu.l PBST-M (PBS,
containing 5% (w/v) fat-tree dried milk and 0.1%.(v/v) Tween 20)
for one hour at room temperature. 100 .mu.l phage suspension
(supernatant or PEG concentrated phage) is diluted in PBST-M and
added for three hours at 4.degree. C. Bound phages are reacted with
100 .mu.l HRP-labelled sheep anti-M13 antibody (Pharmacia) for one
hour at room temperature followed by substrate development with 100
.mu.l TMB/H.sub.2O.sub.2 (0.1 mg/ml TMB, 0.3% H.sub.2O.sub.2 in 0.1
M Na-acetate, pH 6.0) for 15 min. The reaction is stopped by adding
100 .mu.l 1M sulphuric acid to the substrate and the absorbance is
measured at 450 nm. All washings between the incubation steps are
done with tap water.
[0213] Solution Phase hdm2
[0214] GST-, MBP-, TRX-hdm2 or baculovirus produced mdm2 (Sf9 cell
extract) diluted in PBST-M are reacted in solution with hdm2- or
GST-binding phage overnight at 4.degree. C. Simultaneously, ELISA
plates are coated with 100 .mu.l Rabbit anti-mouse antibodies
(DAKO, Z0259) 1:1000 in 0.1 M NaHCO.sub.3, pH 9.6. The plates are
blocked as usual and incubated with monoclonal anti-mdm2 antibodies
(hybridoma supernatant 1:5 diluted in PBST-M) for one hour. For the
titration ELISA, purified SMP14 (8 .mu.g/ml in PBS) is used to coat
the plate directly. In either case, the pre-incubated phage-hdm2
samples are transfered to the coated and blocked plate and
incubated for two hours at room temperature. Bound phages are
detected as described.
[0215] Results
[0216] Phage pools which have been recovered from two rounds of
biopanning on solid phase GST- and MBP-hdm2 or DO-1 using samples
of 6, 12, or 15 mer phage display libraries are screened in ELISAs
for antigen binding. Phage from 12 and 15 mer libraries selected
twice with GST-hdm2 or once with GST-hdm2 followed by MBP-hdm2
clearly bind to GST-hdm2, whereas the 6 mer pool is completely
negative. On the other hand, monoclonal anti-p53 antibody DO-1 is
able to select phages from all three libraries proving the
integrity of the 6 mer library.
[0217] To determine whether phages specific for hdm2 are selected,
the phage pools are tested against MBP-hdm2, GST and MBP. Both, 12
and 15 mer pools contain hdm2 binding phages (positive for
MBP-hdm2, but negative for MBP alone). In addition, 15 mer phages
twice biopanned with GST-hdm2 (GST/GST-hdm2) are strongly selected
for GST-binders. In the 15 mer pool which is panned on MBP-hdm2 in
the second round (GST/MBP-hdm2) the anti-GST signal is reduced,
probably because GST is no longer present as a selecting antigen.
GST does not pull out any phage from the 12 mer library. Single
phage clones are grown from 12 and 15 mer pools and tested for GST,
GST-hdm2 and MBP-hdm2 binding. Many clones are clearly positive
with GST-hdm2 and MBP-hdm2. Phage clones from the 12 and 15 mer
pools which are shown to be positive with GST- and MBP-hdm2 are
selected for further analysis. Phage DNA is extracted from each
clone and the nucleotide inserts are sequenced. From 28 clones 6
unique insert sequences are obtained (amino acid sequences given in
single letter code):
11 md2 binding site P L S Q E T F S D L W K L L P E N N V on human
p53 phage clone 12/1 M P R F M D Y W E G L N phage clone 12/2 V Q N
F I D Y W T Q Q F phage clone 12/5 T G P A F T H Y W A T F phage
clone 15/1 I D R A P T F R D H W F A L V phage clone 15/5 P R P A L
V F A D Y W E T L Y phage clone BB3 P A F S R F W S D L S A G A H
phage consensus P X F X D Y W X X L
[0218] Aligning the corresponding amino acid sequences to each
other reveals the phage consensus sequence P X F X D Y W X X L. It
shows similarity to the known mdm2 binding motif on p53, T F S D L
W (amino acid residues 18-23 of human p53; Picksley et al.,
Oncogene 9, 2523-2529 (1994) which reference is incorporated herein
by reference in its entirety. All phage sequences contain the
phenylalanine (F) and Tryptophan (W), and 4 out of 6 the aspartic
acid (D) and leucine (L) found in the same position in the mdm2
motif. A strong selection for tyrosine (Y) and proline (P) in the
phage sequences is not met by corresponding residues in the p53
sequence, although 2 successive prolines are found further upstream
of the mdm2 binding site.
[0219] Further experiments are designed to evaluate the specificity
of the hdm2-phage interaction and to prove that p53 and hdm2 phage
bind to the same region on hdm2. For these experiment clones
BB2/BB11 (GST binding control phage) and BB3/BB10 (hdm2 phage) are
chosen. Phages are preincubated in solution with GST-hdm2, MBP-hdm2
or TRX-hdm2 and the phage-hdm2 complexes are transfered to wells
which contain different monoclonal anti-mdm2 antibodies bound to
the solid phase via anti-mouse antibodies. Bound phages are
detected. As expected, GST-phages are able to bind only to
GST-hdm2. All three anti-mdm2 antibodies used (SMP14, 4B2, 3G5) are
able to bind to hdm2 complexed with GST-phage. Antibody SMP14 is
commercially available and described in Picksley et al., Oncogene
9, 2523-2529 (1994) incorporated by reference above. Antibodies 3G5
and 4B2 are described in Chen, J. et al., Mol. Cell Bio., vol. 13,
4107-4114 (1993) also incorporated herein by reference in its
entirety. On the other hand, the hdm2-phage recognizes all three
hdm2 fusion proteins including TRX-hdm2 never used for the phage
selection (biopanning). The hdm2-phage complexes are efficiently
pulled down by SMP14 and 4B2, but 3G5 is hardly able to bind to
these complexes. It has been shown that mdm2-p53 complexes cannot
be bound by 3G5, probably because the epitope of this antibody lies
within the p53 binding domain of mdm2. Another experiment shows
that hdm2-phages but not GST-phages are able to inhibit the
interaction between hdm2 and TIP. TIP is thioredoxin with the mdm2
binding sequence of p53 inserted into its active site. In order to
estimate the relative affinities of the different phage clones
towards hdm2, a dilution series of GST-hdm2 is offered in solution
to a fixed amount of phages. Phage-hdm2 complexes are pulled down
by solid phase SMP14 and bound phages are detected. All phage
clones tested show a very similar strong binding to GST-hdm2 with a
half-maximal binding concentration of 0.5 to 10 nM GST-hdm2,
dependent on the hdm2 preparation used. Experiments with
baculovirus produced mdm2 (Sf9 cell extract) prove that the phage
clones selected with hdm2 are able to bind to its mouse homologue
as well.
[0220] The phage sequences and a consensus sequence are produced as
free peptides and tested for their relative capacity to block the
interaction of MDM2 with p53 in three different ELISA formats. The
new consensus sequence and some of the phage derived peptides show
a remarkable increase in specific activity over the wild type p53
peptide sequence.
[0221] Materials and Methods for Protein Expression
[0222] 1. Thioredoxin(Thio)-fusions
[0223] The clones are produced using the Invitrogen-Expression
system. Using Bluescript containing the hdm2 gene as a template,
PCR is carried out with the following primers (5'-3'):
12 START2 primer: gcg gat ccg atg gtg agg agc agg caa atg STOP1 (to
N221): gcc tgc agc cta att cga tgg cgt ccc tgt aga STOP2 (full
length): gc ctg cag cta ggg gaa ata agt tag cac aat STOP3 (to
D294): gc ctg cag cta atc ttc ttc aaa tga atc tgt START3 primer
(from D294): ggg gat cct gaa att tcc tta gct gac.
[0224] The resulting PCR products are cloned into pCR II (TA
cloning kit, Invitrogen). The resulting plasmids are cleaved with
BamH1 and PstI. The products are ligated into the BamH1/PstI
cleaved pTrxFus. The plasmid is introduced into E. coli G1724. The
following clones are obtained:
[0225] 1. clone 1/8 Thio-MVRSRQ-MI . . . N221
[0226] 2. clone 3/8 Thio-MVRSRQ-MI . . . D294
[0227] 3. clone {fraction (2/7)} Thio-MVRSRQ-MI . . . C478
[0228] 2. Maltose Binding Protein (MBP)-Fusion
[0229] The PCR product is obtained using the STOP1 primer described
above with START1: gc gga tcc atg gtg agg agc agg caa atg.
[0230] It is again cloned into pCR II. The plasmid is cut with
BamH1 and PstI. The products are ligated into BamH1/PstI cleaved
pMALc2 (New England Biolabs). The plasmids are then introduced into
E. coli INV(F' cells (One ShotTMcompetent cell kit,
Invitrogen).
[0231] Clone 4 (MBP-MVRSRQ-M1 . . . N221) is obtained.
[0232] 3. GST-Fusion Protein
[0233] A plasmid containing wild type hdm2 is used as a template in
PCR. The primers are designed such that a BamH1 site is introduced
into the 5' end and a EcoR1 site into the 3' end of the gene. The
PCR products are digested and ligated into pGEX-2T (Pharmacia). The
plasmid is then introduced into E. coli BL21 cells.
[0234] Protein Expression:
[0235] 1. Thioredoxin-Fusionproteins
[0236] Cells are grown in RM medium (1.times.M9 salts, 2% Casamino
acids, 1% glycerol, 1 mM MgCl.sub.2, 100 g/ml ampicillin) overnight
at 30.degree. C. They are then inoculated into fresh Induction
medium (1.times.M9 salts, 0.2% Casamino acids, 0.5% glucose, 1 mM
MgCl.sub.2, 100 g/ml ampicillin to a dilution of {fraction (1/20)}.
Cells are then grown to an OD of 0.25 to 0.5 at 30.degree. C. The
culture is transfered to 37.degree. C. and induced with
L-Tryptophan at a final concentration of 100 g/ml. After 3 h cells
are harvested by centrifugation. The pellets are resuspended in ice
cold 20 mM Tris/HCl, pH 8, 2.5 mM EDTA with protease inhibitors (1
mM PMSF, 1 mM benzamidine, leupeptin, approtinin and pepstatin at
10 g/ml each. The cells are lysed by sonication, shock freezing,
quick thawing. The cycle is repeated two more times. The lysate is
then centrifuged at 4000 rpm for 15 min at 4.degree. C. The
supernatant is used.
[0237] 2. Maltose Binding Protein-Fusions
[0238] Cells are grown in rich Medium with glucose and ampicillin
(10 g tryptone, 5 g yeast extract, 5 g NaCl, 2 g glucose and 100
g/ml ampicillin to an OD of 0.5. They are then induced with IPTG at
a final concentration of 0.3 mM. Incubation is continued at
37.degree. C. for another 2 h. Cells are harvested by
centrifugation and resuspended in column buffer ({fraction
(1/20)}th of original volume, 20 mM Tris-HCl, pH 7.4; 200 mM NaCl;
1 mM EDTA; 1 mM DTT plus protease inhibitors as mentioned above.
Cells are frozen over night at -20.degree. C. They are thawed in
cold water, sonicated on ice in short pulses of 6.times.10 seconds
and spun at 9000 rpm for 30 min at 4.degree. C. The supernatant is
diluted 1/5 with column buffer and loaded on an amylose resin (New
England Biolabs, 15 ml, prepared in column buffer). Elution is
carried out with column buffer+10 mM Maltose. Active fractions are
pooled, concentrated and desalted on a 10 DG column (BioRad). They
are stored in 50 mM Tris/Hcl pH 7.4, 50 mM NaCl, 20% glycerol, 1 mM
DTT.
[0239] 3. GST-hdm2 (1-188)
[0240] Bacteria cultures are grown to OD 0.8. They are cooled to RT
and induced with 1 mM IPTG, then grown for 4 h at 27.degree. C.
Cells are harvested and pellets flash frozen in liquid nitrogen.
Pellets are resuspended in ice cold buffer A (0.5 M NaCl, 2.7 mM
KCl, 10 mM Na.sub.2HPO.sub.4, 1.8 mM KH.sub.2PO.sub.4, 1 mM PMSF, 1
mM EDTA, 10 mM 2-mercaptoethanol, pH 7.3). They are lysed by a
French press or alternatively by sonication. After centrifugation
the soluble traction is loaded onto a glutathione sepharose 4B
column (Pharmacia) equilibrated with buffer A. The protein is then
eluted with buffer B (50 mM Tris/HCl, 10 mM reduced glutathione,
0.5 M NaCl, 1 mM EDTA. 1 mM PMSF or benzamidine, 10 mM
2-mercaptoethanol or 1 mM DTT, pH 8.0.) Active fractions are
desalted on Sephadex G25 or 10 DG (BioRad) preequilibrated with
buffer C (50 mM Tris/HCl, 50 mM NaCl, 20% glycerol, 10 mM
2-mercaptoethanol or 1 mM DTT, 0.1% Triton x-100, pH 7.6). The
protein is used for Elisas or further purified on a Mono 0 column
(Pharmacia) preequilibrated with buffer C. The protein is eluted
with a linear gradient of buffer C containing 1 M NaCl. The
fractions containing fusionprotein are pooled, concentrated
(Centricon 30), flash frozen in liquid nitrogen and stored at
-70.degree. C.
[0241] Elisas
[0242] Three different Elisas are employed to analyze the
interaction between hdm2 and p53. They are named according to the
reagent which is used to coat the Elisa plates. All Elisas are
carried out at 4.degree. C.
[0243] 1. Elisa P2
[0244] P2 is a biotinylated peptide consisting of 18 amino acids of
the Terminal part of p53,
[0245] namely:
Biotin-S-G-S-G-E-P-P-L-S-Q-E-T-F-S-D-L-W-K-L-L-P-E
[0246] Plates are incubated overnight with 10 .mu.g/ml streptavidin
at 37.degree. C. They are blocked with 2% BSA in PBS for 1 h.
Peptide is applied at 5 .mu.g/ml in blocking solution for 1 h. A
second blocking step is carried out with 5% milk, 0.1% Tween20 in
PBS (blocking solution2) for a minimum of 10 min.
Hdm2fusionproteins are diluted in blocking solution2 and applied
for 1 h. Bound hdm2 is detected with SMP 14 hybridoma cell
supernatant diluted 1/2 in block solution2. HRP-anti-mouse IgG
(DAKO) is used as second antibody. Washing between incubations is
carried out 6 times with tap water.
[0247] 2. Elisa TIP
[0248] TIP is thioredoxin which has additional amino acids inserted
into its active site. These are derived from the N-terminus of p53
and are the following:
[0249] P-P-L-S-Q-E-T-F-S-D-L-W-K-L-L-P-E-N.
[0250] The following are used
13 P1: 5' gt ccg cct ctg agt cag gaa aca ttt tca gac cta tgg aaa
cta ctt cct gaa aac g 3' P2: 5' g acc gtt ttc agg aag tag ttt cca
tag gtc tga aaa atg ttt cct gac tca gag gcg 3'
[0251] 10 ng of each P1 and P2 are phosphorylated using PNK and
annealed for 1 h at 37.degree. C. The vector pTRX (InVitrogen) is
cleaved with Rsril and dephosphorylated. After ligation the
plasmids are introduced into E. coli 1724 cells.
[0252] Plasmid containing bacteria are grown in RM medium at
30.degree. C. and induced with L-Trp as described earlier. A
soluble lysate is made by freeze-thaw-sonication cycles. This
lysate is then heat shocked at 80.degree. C. for 10 min. The
soluble fraction is used to coat Elisa-plates at a concentration of
40 .mu.g/ml in PBS o/n. Plates are blocked in blocking solution2
for 1 h. Incubation with hdm2 fusionproteins and detection is
carried out as described for Elisa P2.
[0253] 3. Elisa hdm2
[0254] Plates are coated with 2.6 .mu.g/ml GST-hdm2(1-188) in PBS
at 4.degree. C. o/n. They are blocked in blocking solution 2 for 1
h. Full length p53, lysozyme lysate from E. coli, purified on
heparin-sepharose is applied in blocking solution2 with 10%
glycerol and 10 mM DTT for 1 h. Binding is established with mAb 421
and HRP coupled anti mouse IgG.
[0255] HRP activity is measured using TMB. For inhibition Elisas
inhibitors are preincubated with either hdm2-fusionproteins or p53
for 15 min before the mixture is transfered to the plate. Peptide
inhibitors are dissolved in DMSO.
Example 9
Purification of p53 D30
[0256] The human wild type p53 gene is used as a template for PCR
to obtain the gene fragment encoding for residues 1 to 362 of the
393 amino acids of natural (human) p53 (p53D30). The
oligonucleotides used for PCR are designed such that a NdeI
restriction site is introduced at the 5' end and a BamHI site at
the 3' end. The PCR fragments digested by NdeI and BamHI are
ligated with a NdeI/BamHI cleaved pET-3a plasmid. The complete gene
is sequenced and the expression plasmid is introduced into E. coli
strain BL21 (DE3)pLysS (Novagen).
[0257] For protein expression bacteria cultures are inoculated by a
100-fold diluted overnight culture and grown in Luria Broth medium
in the presence of 100 .mu.g ampicillin/ml at 37.degree. C. to
OD.sub.600=0.8. The cultures are then cooled on ice to room
temperature, induced with 1 mM isopropyl-D-thiogalactopyranoside
and grown for four additional hours at 27.degree. C. The cells are
then harvested by centrifugation and the pellets flash frozen in
liquid nitrogen and stored at -70.degree. C.
[0258] The cell pellets containing the p53D30 protein are
resuspended in ice cold buffer D (50 mM
4-(2-hydroxyethyl)-piperazine-ethane-sulfonic acid (Hepes.NaOH),
10% (v/v) glycerol, 0.1 mM EDTA, 0.1% (v/v) Triton X-100, 5 mM
1,4-dithio-DL-threitol (DTT), 1 mM PMSF-pH=7.6) and lysed with a
French press at 1000 psi. After centrifugation, the soluble
fraction is loaded onto a HiTrap Heparin column (Pharmacia Biotech)
preequilibrated at 4.degree. C. with buffer D. The column is first
washed with buffer D containing 22% buffer E (50 mM Hepes.NaOH, 1 M
KCl, 10% (v/v) glycerol-pH=7.6) and p53D30 is eluted with a linear
gradient to 100% buffer E. The fractions containing p53D30 are
pooled and loaded onto a HiTrap metal chelation column (Pharmacia
Biotech) charged with nickel and preequilibrated at 4.degree. C.
with buffer F (50 mM Hepes.NaOH, 0.5 M KCl, 10% (v/v)
glycerol-pH=7.6). After washing the column with buffer F containing
20% buffer G (50 mM Hepes.NaOH, 0.5 M KCl, 10% (v/v) glycerol, 0.1
M immidazole-pH=7.6), p53D30 is eluted with 45% buffer G. 50 mM
2-mercaptoethanol and 1 mM ZnCl.sub.2 are added to the solution and
the protein is dialysed at 4.degree. C. against 50 mM Hepes.NaOH,
0.5 M KCl, 20% (v/v) glycerol, 50 mM 2-mercaptoethanol, 1 mM
ZnCl.sub.2-pH=7.6. p53D30 is concentrated to 1 mg/ml (Amicon 30 kDa
cut off membrane), flash frozen in liquid nitrogen and stored at
-70.degree. C.
[0259] Protein Analysis
[0260] The purity of the protein preparation is evaluated by gel
scanning (Schimadzu CS-930) on a SDS-PAGE (Laemmli, U. K. (1970)
Nature, 227, 680-385) stained with Coomassie blue. Protein
concentration is determined according to Bradford, M. B. (1976)
Anal. Biochem., 72, 248-254).
Example 10
[0261] To improve the intracellular stability and facilitate
cellular uptake of the peptides described in examples 1 to 9,
peptide binding elements may be constructed in which the peptides
of the present invention are presented on the active site of
Escherichia coli thoredoxin. The pTrx vector (Invitrogen) is
cleaved with restriction enzyme RsrII. Ogligomers, corresponding to
the peptide identified on clone 12/1, described in example 8 above,
and wild type p53 sequences are phosphorylated, annealed and then
ligated into the cleaved pTrx vector.
[0262] The following oligomers may be use to produce a binding
element (TIP wt) comprising a p53 wild type peptide insert:
[0263] 5'-3'
14 GTCCGCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTACTTCCTGA AAACG, and
5'-3' GACCGTTTTCAGGAAGTAGTTTCCATAGGTCTGAAAAT- GTTTCCTGACTCAG
AGGCG
[0264] The following oligomers may be used to produce a binding
element (TIP 12/1) comprising the peptide insert of clone 12/1
described in example 8.
[0265] 5'-3':
15 GTCCGCCTCTGAGTATGCCTCGTTTTATGGATTATTGGGAGGGTCTTAATGA AAACG and
5'-3- GACCGTTTTCATTAAGACCCTCCCAATAATCCATAAAAC- GAGGCATACTCTC
AGAGGCG.
[0266] E. Coli 1724 cells are transformed with the resulting
plasmids as well as pTrx which may act as a negative control
binding element (Trx) comprising thioredoxin without a peptide
insert. The cultures may be grown in RM medium (1.times.M9 salts,
2% Casamino acids, 1% glycerol, 1 mM MgCl.sub.2, 100 g/ml
ampicillin) overnight at 30.degree. C. The cultures are inoculated
into fresh induction medium (1.times.M9 salts, 0.2% Casamino acids,
0.5% glucose, 1 mM MgCl.sub.2, 100 g/ml ampicillin to a dilution of
{fraction (1/20)}) and grown to an Optical Density (OD) of 0.25 to
0.5 at 30.degree. C. The culture is transferred to 37.degree. C.
and induced with L-Tryptophan at a final concentration of 100 g/ml.
After 3 hours to 4 hours cells are harvested by centrifugation. The
pellets are resuspended in ice cold 20 mM Tris/HCl, pH 8, 2.5 mM
EDTA with protease inhibitors 1 mM PMSF, 1 mM benzamidine,
leupeptin, approtnin and pepstatin at 10 g/ml each. The cells are
lysed by shock freezing, thawing and sonicating. The cycle is
repeated two more times. The soluble lysate is then centrifuged at
10000 g for 20 min at 4.degree. C. Heat shock lysates are obtained
by resuspending petilets to an OD of 100 and then treating at
80.degree. C. for 10 minutes followed by centrifugation at 10,000 g
for 20 min.
[0267] Purification of soluble extracts is carried out by loading
clear soluble lysates onto an Ion exchange Q50 column (BioRad) and
eluting with a linear gradient of 0.05M-1 MKCL in 50 mMTris/HCL
pH7.8, 0.1% Triton X-100, 10% glycerol and 50 mMKCL.
[0268] Active fractions may be identified on dot blots with an
anti-thioredoxin antibody available from Invitrogen. The active
fractions may then be concentrated using Centriprep 3 filters
(Amicon) and loaded unto a G100 column (Pharmacia) which has been
preequilibrated with 30 mM HEPES, pH 8.0, 500 mM KCL, 0.1% Triton
X100, and 10% glycerol. Following elution, active fractions may be
pooled, concentrated and dialyzed against PBS.
[0269] For expression in mammalian cells, the complete thioredoxin
coding region with peptide insertions (TIP wt, and TIP 12/1) or
without peptide inserts (Trx) may be PCR amplified using standard
PCR reagents and conditions known in the art and the following
primers:
16 5'-3': CGGGATCCACCATGGGCGATAAAATTATTCACCTG and 5'-3':
CTCGACGCTAACCTGGCCTAGGGAATTCC.
[0270] The resulting PCR products may be cleaved with BamHI and Eco
RI and ligated into BamHI and EcoRI cleaved pcDNA3. pcDNA3
(Promega) is a vector having a CMV promoter for driving expression
of TIP wt, TIP 12/1 and Trx in mammalian cells. The plasmids may be
amplified in E. coli as known in the art. Plasmid DNA encoding for
TIP 12/1, TIP wt and Trx may be purified using a Quiagent
purification system or phenol/chloroform precipitation.
[0271] Antibodies or DNA encoding the described binding elements
may be microinjected into Vrn.6 cells, a transformed rat thyroid
epithelial cell line and T22 cells, a mouse prostrate derived cell
line both cell lines being stably transfected with pRGC AFos-Lacz,
a p53 responsive .beta.-galactosidase reporter. Production of the
Vrn.6 cell line and the pRGC.DELTA.Fos-Lacz reporter are known in
the art. Blaydes, J. P. et al., (1997), Oncogene, vol 14, in press;
and Hupp, T. R et al. (1995) Cell, vol. 83, 237-245 hereby
incorporated by reference in its entirety. Vrn.6 tolerate hight
levels of wild type p53 and overexpress MDM2 at a protein level.
T22 cells typically contain low levels of p53 and mdm2.
[0272] For microinjection, cells may be seeded into tissue culture
dishes and grown to 60-70% confluence. Microinjection may be
performed using an Eppendorfer micorinjection system (Microinjector
5242, Micromanipulator 5170) mounted to an Axiovert light
microscope (Zeiss) having a heated stage.
[0273] Purified mouse monoclonal antibodies 3G5 and 4B2 may be
injected intranuclearly and cytoplasmicly in PBS at a concentration
of 1.3 mg/ml. Plasmid DNA encoding for TIP 12/1, TIP wt and Trx may
be injected intronuclearly in water at a concentration of 0.25 mg7
ml. Following microinjection, fresh medium may be added to the cell
cultures and the cultures further incubated for 24 hours.
[0274] To detect .beta.-galactosidase activity, cells may be washed
with PBS and fixed with 2% formaldehyde,/0.2% glutaraldehyde in PBS
for 5 minutes on ice. The cells may be washed again and overlaid
with X-gal (0.25 mg/ml) in a reaction mix (5 mM potassium
ferricyanide, 2 mM magnesium chloride in PBS). Cells may then be
incubated at 37.degree. C. for 16 hours after which they may be
observed for blue stained cells indicating a positive response.
[0275] Results:
[0276] In Vrn.6 cells, having overexpressed MDM2, a positive
response was observed when 3G5 antibody or TIP 12/1 were injected
intranuclearly. There was not a positive response weht Trx was
injected intranuclearly. 3G5 binds mdm2 withing the p53 binding
pocket thereby blocking p53-MDM2 association (Bottinger et al.,
1997) I.
[0277] In T22 cells, a low level p53 and mdm2 containing cell line,
a strong positive response was observed when 3G5 and TIP 12/1 were
injected. A positive but lower level response was observed whent
TIPwt was injected. No response was observed when 4B2 antibody or
Trx were injected. 4B2 is an anti MDM2 antibody that targets an
epitope outside the p53 binding pocket on MDM2.
[0278] DNA encoding the described binding elements TIP 12/1, TIP wt
and Trx and the pRGC.DELTA.FosLacZ reporter may be transiently
transfected into the following three different cell types, OSA
cells, a human osteosarcome cell line, U2-Os cells, another
osteosarcoma cell line, and MCF-7 cells, a breast conacer cell line
containing wild type p53. The OSA cell line contains a highly
elevated mdm2 level due to gene amplification (Florence et al.
1994). The U2-OS cell line has no gene amplification for mdm2 but
has elevated levels of mdm2-mRNA (Florence et al. 1994). The MCF-7
cell line contains heterogenously expressed low levels of wild type
p53 and no reported mdm2 elevation.
[0279] For transient transfection and reporter induction, cells are
seeded into 6 well plates at 1.5.times.10.sup.6 cell per well. They
are grown to a density of 80% confluence and transfected using
different Lipophilic reagents such Lipofectin and Lipofectamin from
Promega or Dosper and Dotap from Boehringer. 2.5 .mu.g of TIP
encoding plasmid DNA, 1 .mu.g RGC.DELTA.FosLacZ DNA and 5-10 .mu.g
of lipophili reagent according to manufacturer instructions are
mixed in serum free medium and applied to the cells. Two to four
hours after transfection, complete medium is added. Forty-eight
hours after transfection .beta.-galactosidase activity is measured
using DPRG (Boehringer) as a substrate. Cells are scraped into PBS
and centrifuged. Pellets from each well are dissolved in 50 .mu.l
of Reporter Lysis buffer (Promega) and incubated on ice for 15
minutes. Soluble Lysates are incubated with CPRG in 100 mM
phosphate buffer, pH 7.0. Optical Density at 595 nm is measured 1
to 24 hours later.
[0280] Results: Surprisingly, most induction of the p53 reporter is
achieved by TIP 12/1 in MCF-7 cells and in U2-OS cells. Lower
induction is observed in TIP 12/1 transfected OSA cells.
Transfection of the control plasmid alone induces a lowe level
respons of p53 dependent transcriptional activation in MCF-7 and
U2-OS cells but is almost completely absent in OSA cells.
[0281] T22 cells, U2-Os cells, OSA cells and SAOS 2 cells may be
grown in in Dulbeccor's modified Eagle medium (DMEM) supplemented
with 10% Fetal Calf Serum. Additionally, for T22 cells 1 mg/ml of
the antibiotic G418 may be added. Vrn.6 cells are grown as is known
in the art, previously described by Blaydes et al., 1997.
Sequence CWU 1
1
85 1 19 PRT Homo sapiens 1 Pro Leu Ser Gln Glu Thr Phe Ser Asp Leu
Trp Lys Leu Leu Pro Glu 1 5 10 15 Asn Asn Val 2 5 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 2 Phe
Xaa Xaa Leu Trp 1 5 3 10 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 3 Pro Xaa Phe Xaa Asp Tyr Trp
Xaa Xaa Leu 1 5 10 4 10 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 4 Xaa Xaa Phe Xaa Xaa Xaa Trp
Xaa Xaa Xaa 1 5 10 5 10 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 5 Xaa Xaa Phe Xaa Xaa Xaa Trp
Xaa Xaa Xaa 1 5 10 6 12 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 6 Met Pro Arg Phe Met Asp Tyr
Trp Glu Gly Leu Asn 1 5 10 7 12 PRT Artificial Sequence Description
of Artificial Sequence Synthetic Peptide 7 Gln Pro Thr Phe Ser Asp
Tyr Trp Lys Leu Leu Pro 1 5 10 8 15 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 8 Pro Arg Pro
Ala Leu Val Phe Ala Asp Tyr Trp Glu Thr Leu Tyr 1 5 10 15 9 28 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 9 Met Pro Arg Phe Met Asp Tyr Trp Glu Gly Leu Asn Arg Gln
Ile Lys 1 5 10 15 Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys
20 25 10 8 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 10 Phe Xaa Xaa Xaa Trp Xaa Xaa Xaa 1 5
11 9 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 11 Xaa Phe Xaa Xaa Xaa Trp Xaa Xaa Xaa 1 5 12 8
PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 12 Pro Ala Phe Thr His Tyr Trp Pro 1 5 13 8 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 13 Pro Thr Phe Ser Asp Tyr Trp Pro 1 5 14 8 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 14
Pro Arg Phe Met Asp Tyr Trp Pro 1 5 15 9 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 15 Arg Phe Met
Asp Tyr Trp Glu Gly Leu 1 5 16 8 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 16 Phe Met Asp
Tyr Trp Glu Gly Leu 1 5 17 12 PRT Homo sapiens 17 Gln Glu Thr Phe
Ser Asp Leu Trp Lys Leu Leu Pro 1 5 10 18 12 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 18
Thr Gly Pro Ala Phe Thr His Tyr Trp Ala Thr Phe 1 5 10 19 12 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 19 Met Pro Arg Phe Met Asp Tyr Trp Glu Gly Leu Asn 1 5 10
20 12 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 20 Gln Pro Thr Phe Ser Asp Tyr Trp Lys Leu Leu
Pro 1 5 10 21 8 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 21 Pro Ala Phe Thr His Tyr Trp Pro 1 5
22 8 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 22 Pro Thr Phe Ser Asp Tyr Trp Pro 1 5 23 8 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 23 Pro Arg Phe Met Asp Tyr Trp Pro 1 5 24 12 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 24
Gln Glu Thr Phe Ser Asp Leu Trp Lys Leu Leu Pro 1 5 10 25 12 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 25 Gln Pro Thr Phe Ser Asp Leu Trp Lys Leu Leu Pro 1 5 10
26 12 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 26 Gln Glu Thr Phe Ser Asp Tyr Trp Lys Leu Leu
Pro 1 5 10 27 12 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 27 Val Gln Asn Phe Ile Asp Tyr Trp Thr
Gln Gln Phe 1 5 10 28 15 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 28 Ile Asp Arg Ala Pro Thr
Phe Arg Asp His Trp Phe Ala Leu Val 1 5 10 15 29 15 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 29
Pro Arg Pro Ala Leu Val Phe Ala Asp Tyr Trp Glu Thr Leu Tyr 1 5 10
15 30 15 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 30 Pro Ala Phe Ser Arg Phe Trp Ser Asp Leu Ser
Ala Gly Ala His 1 5 10 15 31 12 PRT Artificial Sequence Description
of Artificial Sequence Synthetic Peptide 31 Thr Gly Pro Ala Phe Thr
His Tyr Trp Ala Thr Phe 1 5 10 32 12 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 32 Met Pro Arg
Phe Met Asp Tyr Trp Glu Gly Leu Asn 1 5 10 33 14 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 33
Cys Gly Gln Pro Thr Phe Ser Asp Tyr Trp Lys Leu Leu Pro 1 5 10 34
14 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 34 Cys Gly Gln Pro Thr Phe Ser Asp Tyr Trp Lys
Leu Leu Pro 1 5 10 35 10 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 35 Cys Gly Pro Thr Phe Ser
Asp Leu Trp Pro 1 5 10 36 10 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 36 Cys Gly Pro Thr Phe Ser
Asp Leu Trp Pro 1 5 10 37 9 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 37 Cys Pro Thr Phe Ser Asp
Leu Trp Pro 1 5 38 9 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 38 Cys Pro Thr Phe Ser Asp
Leu Trp Pro 1 5 39 16 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 39 Ser Gly Ser Gly Gln Glu
Thr Phe Ser Asp Leu Trp Lys Leu Leu Pro 1 5 10 15 40 16 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 40 Ser Gly Ser Gly Gln Pro Thr Phe Ser Asp Leu Trp Lys Leu
Leu Pro 1 5 10 15 41 16 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 41 Ser Gly Ser Gly Gln Glu
Thr Phe Ser Asp Tyr Trp Lys Leu Leu Pro 1 5 10 15 42 29 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 42 Ser Met Pro Arg Phe Met Asp Tyr Trp Glu Gly Leu Asn Arg
Gln Ile 1 5 10 15 Lys Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys
Lys 20 25 43 16 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 43 Arg Gln Ile Lys Ile Trp Phe Gln Asn
Arg Arg Met Lys Trp Lys Lys 1 5 10 15 44 31 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 44 Ala Ala Val
Ala Leu Leu Pro Ala Val Leu Leu Ala Leu Leu Ala Pro 1 5 10 15 Ala
Met Pro Arg Phe Met Asp Tyr Trp Glu Gly Leu Asn Ala Lys 20 25 30 45
16 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 45 Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu
Ala Leu Leu Ala Pro 1 5 10 15 46 8 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 46 Cys Thr Phe
Ser Asp Tyr Trp Cys 1 5 47 8 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 47 Cys Thr Phe Ser Asp Tyr
Trp Cys 1 5 48 8 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 48 Cys Ala Phe Thr His Tyr Trp Cys 1 5
49 8 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 49 Cys Ala Phe Thr His Tyr Trp Cys 1 5 50 8 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 50 Cys Arg Phe Met Asp Tyr Trp Cys 1 5 51 8 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 51
Cys Arg Phe Met Asp Tyr Trp Cys 1 5 52 8 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 52 Glu Thr Phe
Ser Asp Tyr Trp Lys 1 5 53 8 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 53 Glu Arg Phe Met Asp Tyr
Trp Lys 1 5 54 8 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 54 Phe Met Xaa Tyr Trp Xaa Gly Leu 1 5
55 9 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 55 Arg Phe Met Xaa Tyr Trp Xaa Gly Leu 1 5 56 9
PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 56 Arg Phe Met Xaa Tyr Trp Glu Xaa Leu 1 5 57 8
PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 57 Phe Met Xaa Tyr Trp Xaa Xaa Leu 1 5 58 8 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 58 Phe Met Xaa Tyr Trp Glu Xaa Leu 1 5 59 9 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 59
Arg Phe Met Asp Tyr Trp Glu Gly Leu 1 5 60 8 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 60
Phe Met Asp Tyr Trp Glu Gly Leu 1 5 61 8 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 61 Phe Met Xaa
Tyr Trp Glu Gly Leu 1 5 62 8 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 62 Phe Met Asp Tyr Trp Xaa
Gly Leu 1 5 63 12 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 63 Val Gln Asn Phe Ile Asp Tyr Trp Thr
Gln Gln Phe 1 5 10 64 12 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 64 Thr Gly Pro Ala Phe Thr
His Tyr Trp Ala Thr Phe 1 5 10 65 15 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 65 Ile Asp Arg
Ala Pro Thr Phe Arg Asp His Trp Phe Ala Leu Val 1 5 10 15 66 15 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 66 Pro Ala Phe Ser Arg Phe Trp Ser Asp Leu Ser Ala Gly Ala
His 1 5 10 15 67 30 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 67 gcggatccga tggtgaggag
caggcaaatg 30 68 33 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 68 gcctgcagcc taattcgatg
gcgtccctgt aga 33 69 32 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 69 gcctgcagct aggggaaata
agttagcaca at 32 70 32 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 70 gcctgcagct aatcttcttc
aaatgaatct gt 32 71 27 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 71 ggggatcctg aaatttcctt
agctgac 27 72 29 DNA Artificial Sequence Description of Artificial
Sequence Synthetic Primer 72 gcggatccat ggtgaggagc aggcaaatg 29 73
22 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 73 Ser Gly Ser Gly Glu Pro Pro Leu Ser Gln Glu
Thr Phe Ser Asp Leu 1 5 10 15 Trp Lys Leu Leu Pro Glu 20 74 18 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 74 Pro Pro Leu Ser Gln Glu Thr Phe Ser Asp Leu Trp Lys Leu
Leu Pro 1 5 10 15 Glu Asn 75 57 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 75 gtccgcctct
gagtcaggaa acattttcag acctatggaa actacttcct gaaaacg 57 76 58 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Oligonucleotide 76 gaccgttttc aggaagtagt ttccataggt ctgaaaaatg
tttcctgact cagaggcg 58 77 57 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Oligonucleotide 77 gtccgcctct
gagtcaggaa acattttcag acctatggaa actacttcct gaaaacg 57 78 57 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Oligonucleotide 78 gaccgttttc aggaagtagt ttccataggt ctgaaaatgt
ttcctgactc agaggcg 57 79 57 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Oligonucleotide 79 gtccgcctct
gagtatgcct cgttttatgg attattggga gggtcttaat gaaaacg 57 80 59 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Oligonucleotide 80 gaccgttttc attaagaccc tcccaataat ccataaaacg
aggcatactc tcagaggcg 59 81 35 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 81 cgggatccac
catgggcgat aaaattattc acctg 35 82 29 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Oligonucleotide 82
ctcgacgcta acctggccta gggaattcc 29 83 6 PRT Homo sapiens 83 Thr Phe
Ser Asp Leu Trp 1 5 84 4 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 84 Ser Gly Ser Gly 1 85 6 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 85 Met Val Arg Ser Arg Gln 1 5
* * * * *