U.S. patent application number 10/936273 was filed with the patent office on 2005-04-07 for chimeric oligomeric compounds comprising alternating regions of northern and southern conformational geometry.
Invention is credited to Baker, Brenda F., Butler, Madeline M., McKay, Robert, Monia, Brett P..
Application Number | 20050074801 10/936273 |
Document ID | / |
Family ID | 34278750 |
Filed Date | 2005-04-07 |
United States Patent
Application |
20050074801 |
Kind Code |
A1 |
Monia, Brett P. ; et
al. |
April 7, 2005 |
Chimeric oligomeric compounds comprising alternating regions of
northern and southern conformational geometry
Abstract
The present invention relates to novel chimeric oligomeric
compounds having a plurality of alternating regions having either
RNA like having northern or 3'-endo conformational geometry
(3'-endo regions) or DNA like having southern or C2'-endo/O4'-endo
conformational geometry. The oligomeric compounds of the present
invention have shown reduction in mRNA levels in multiple in vitro
and in vivo assay systems and are useful, for example, for
investigative and therapeutic purposes.
Inventors: |
Monia, Brett P.; (Encinitas,
CA) ; Butler, Madeline M.; (Rancho Santa Fe, CA)
; McKay, Robert; (Poway, CA) ; Baker, Brenda
F.; (Carlsbad, CA) |
Correspondence
Address: |
COZEN O'CONNOR, P.C.
1900 MARKET STREET
PHILADELPHIA
PA
19103-3508
US
|
Family ID: |
34278750 |
Appl. No.: |
10/936273 |
Filed: |
September 8, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60501719 |
Sep 9, 2003 |
|
|
|
60568489 |
May 6, 2004 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/6.1; 536/23.1 |
Current CPC
Class: |
C12N 2320/51 20130101;
A61P 3/06 20180101; C12N 15/113 20130101; C12N 2310/323 20130101;
C12N 2310/3231 20130101; C12N 2310/32 20130101; C07H 21/00
20130101; A61P 3/04 20180101; C12N 15/111 20130101; C12N 2310/321
20130101 |
Class at
Publication: |
435/006 ;
536/023.1 |
International
Class: |
C12Q 001/68; C07H
021/04 |
Claims
What is claimed is:
1. A chimeric oligomeric compound comprising from about 5 to about
80 linked nucleosides, wherein the chimeric oligomeric compound is
divided into at least 5 separate regions, wherein each of the
regions is a continuous sequence from 1 to about 5 nucleosides each
comprising a 3'-endo sugar conformational geometry or a continuous
sequence of from 1 to about 5 2'-deoxyribonucleosides, and wherein
each of the regions comprising from 1 to about 5
2'-deoxyribonucleosides is internally located between two of the
regions comprising 1 to about 5 nucleosides each comprising a
3'-endo sugar conformational geometry or at one of the 3' or
5'-termini.
2. The compound of claim 1 comprising 5 separate regions.
3. The compound of claim 1 comprising 7 separate regions.
4. The compound of claim 1 comprising 9 separate regions.
5. The compound of claim 1 comprising 11 separate regions.
6. The compound of claim 1 comprising 13 separate regions.
7. The compound of claim 1 comprising 15 separate regions.
8. The compound of claim 1 comprising 17 separate regions.
9. The compound of claim 1 wherein each of the regions is from 1 to
4 nucleosides in length.
10. The compound of claim 1 wherein each of the regions is,
independently, from 2 to 4 nucleosides in length.
11. The compound of claim 1 wherein each of the regions is,
independently, from 1 to 3 nucleosides in length.
12. The compound of claim 1 wherein each of the regions is,
independently, from 2 to 3 nucleosides in length.
13. The compound of claim 1 wherein each of the regions comprising
a continuous sequence of nucleosides each comprising a 3'-endo
sugar conformational geometry is, independently, from 1 to 4
nucleosides in length.
14. The compound of claim 1 wherein each of the regions comprising
a continuous sequence of nucleosides each comprising a 3'-endo
sugar conformational geometry is, independently, from 2 to 4
nucleosides in length.
15. The compound of claim 1 wherein each of the regions comprising
a continuous sequence of nucleosides each comprising a 3'-endo
sugar conformational geometry is, independently, from 3 to 4
nucleosides in length.
16. The compound of claim 1 wherein each of the regions comprising
a continuous sequence of nucleosides each comprising a 3'-endo
sugar conformational geometry is, independently, from 2 to 3
nucleosides in length.
17. The compound of claim 1 wherein each of the regions comprising
a continuous sequence of 2'-deoxyribonucleosides is, independently,
from 1 to 4 nucleosides in length.
18. The compound of claim 1 wherein each of the regions comprising
a continuous sequence of 2'-deoxyribonucleosides is, independently,
from 2 to 4 nucleosides in length.
19. The compound of claim 1 wherein each of the regions comprising
a continuous sequence of 2'-deoxyribonucleosides is, independently,
from 3 to 4 nucleosides in length.
20. The compound of claim 1 wherein each of the regions comprising
a continuous sequence of 2'-deoxyribonucleosides is, independently,
from 2 to 3 nucleosides in length.
21. The compound of claim 1 wherein each of the regions positioned
at the terminal 3' and 5' ends comprise from 2 to 5 nucleosides in
length.
22. The compound of claim 1 wherein each of the regions positioned
at the terminal 3' and 5' ends comprise from 2 to 4 nucleosides in
length.
23. The compound of claim 1 wherein each of the regions positioned
at the terminal 3' and 5' ends comprise from 3 to 4 nucleosides in
length.
24. The compound of claim 1 wherein each of the regions positioned
at the terminal 3' and 5' ends comprise from 2 to 3 nucleosides in
length.
25. The compound of claim 1 wherein each of the nucleosides
comprising a 3'-endo sugar conformational geometry is,
independently, a sugar modified nucleoside, a base modified
nucleoside, or a nucleoside having one or more modifications that
include both the base and the sugar.
26. The compound of claim 25 wherein each of the nucleosides
comprising a 3'-endo sugar conformational geometry is a sugar
modified nucleoside.
27. The compound of claim 26 wherein each of the sugar modified
nucleosides, independently, comprises a 2'-substituent group.
28. The compound of claim 27 wherein each of the 2'-substituent
groups is, independently, C.sub.1-C.sub.20 alkyl, C.sub.2-C.sub.20
alkenyl, C.sub.2-C.sub.20 alkynyl, C.sub.5-C.sub.20 aryl,
--O-alkyl, --O-alkenyl, --O-alkynyl, --O-alkylamino,
--O-alkylalkoxy, --O-alkylaminoalkyl, --O-alkyl imidazole, --OH,
--SH, --S-alkyl, --S-alkenyl, --S-alkynyl, --N(H)-alkyl,
--N(H)-alkenyl, --N(H)-alkynyl, --N(alkyl).sub.2, --O-aryl,
--S-aryl, --NH-aryl, --O-aralkyl, --S-aralkyl, --N(H)-aralkyl,
phthalimido (attached at N), halogen, amino, keto
(--C(.dbd.O)--R.sub.a), carboxyl (--C(.dbd.O)OH), nitro
(--NO.sub.2), nitroso (--N.dbd.O), cyano (--CN), trifluoromethyl
(--CF.sub.3), trifluoromethoxy (--O--CF.sub.3), imidazole, azido
(--N.sub.3), hydrazino (--N(H)--NH.sub.2), aminooxy
(--O--NH.sub.2), isocyanato (--N.dbd.C.dbd.O), sulfoxide
(--S(.dbd.O)--R.sub.a), sulfone (--S(.dbd.O).sub.2--R.sub.a),
disulfide (--S--S--R.sub.a), silyl, heterocyclyl, carbocyclyl, an
intercalator, a reporter group, a conjugate group, polyamine,
polyamide, polyalkylene glycol, or a polyether of the formula
(--O-alkyl)m.sub.a; wherein each R.sub.a is, independently,
hydrogen, a protecting group or substituted or unsubstituted alkyl,
alkenyl, or alkynyl, wherein the substituent group is haloalkyl,
alkenyl, alkoxy, thioalkoxy, haloalkoxy or aryl as well as halogen,
hydroxyl, amino, azido, carboxy, cyano, nitro, mercapto, a sulfide
group, a sulfonyl group, or a sulfoxide group; or each sugar
substituent group has one of formula I.sub.a or II.sub.a:
26wherein: R.sub.b is O, S or NH; R.sub.d is a single bond, O, S or
C(.dbd.O); R.sub.e is C.sub.1-C.sub.10 alkyl, N(R.sub.k)(R.sub.m),
N(R.sub.k)(R.sub.n), N.dbd.C(R.sub.p)(R.sub.q),
N.dbd.C(R.sub.p)(R.sub.r)- , or has formula III.sub.a; 27R.sub.p
and R.sub.q are each independently hydrogen or C.sub.1-C.sub.10
alkyl; R.sub.r is --R.sub.x--R.sub.y; each R.sub.s, R.sub.t,
R.sub.u and R.sub.v is, independently, hydrogen, C(O)R.sub.w,
substituted or unsubstituted C.sub.1-C.sub.10 alkyl, substituted or
unsubstituted C.sub.2-C.sub.10 alkenyl, substituted or
unsubstituted C.sub.2-C.sub.10 alkynyl, alkylsulfonyl,
arylsulfonyl, a chemical functional group or a conjugate group,
wherein the substituent group is hydroxyl, amino, alkoxy, carboxy,
benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl,
alkenyl, or alkynyl; or optionally, R.sub.u and R.sub.v, together
form a phthalimido moiety with the nitrogen atom to which they are
attached; each R.sub.w is, independently, substituted or
unsubstituted C.sub.1-C.sub.10 alkyl, trifluoromethyl,
cyanoethyloxy, methoxy, ethoxy, t-butoxy, allyloxy,
9-fluorenylmethoxy, 2-(trimethylsilyl)-ethoxy,
2,2,2-trichloroethoxy, benzyloxy, butyryl, iso-butyryl, phenyl or
aryl; R.sub.k is hydrogen, a nitrogen protecting group or
--R.sub.x--R.sub.y; R.sub.p is hydrogen, a nitrogen protecting
group or --R.sub.x--R.sub.y; R.sub.x is a bond or a linking moiety;
R.sub.y is a chemical functional group, a conjugate group or a
solid support medium; each R.sub.m and R.sub.n is, independently,
H, a nitrogen protecting group, substituted or unsubstituted
C.sub.1-C.sub.10 alkyl, substituted or unsubstituted
C.sub.2-C.sub.10 alkenyl, substituted or unsubstituted
C.sub.2-C.sub.10 alkynyl, wherein the substituent group is
hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol,
thioalkoxy, halogen, alkyl, aryl, alkenyl, alkynyl, NH.sub.3.sup.+,
N(R.sub.u)(R.sub.v), guanidine, or acyl where the acyl is an acid
amide or an ester; or R.sub.m and R.sub.n, together, are a nitrogen
protecting group, are joined in a ring structure that optionally
includes an additional heteroatom selected from N and O or are a
chemical functional group; R.sub.i is OR.sub.z, SR.sub.z, or
N(R.sub.z).sub.2; each R.sub.z is, independently, H,
C.sub.1-C.sub.8 alkyl, C.sub.1-C.sub.8 haloalkyl,
C(.dbd.NH)N(H)R.sub.u, C(.dbd.O)N(H)R.sub.u, or
OC(.dbd.O)N(H)R.sub.u; R.sub.f, R.sub.g and R.sub.h comprise a ring
system comprising from about 4 to about 7 carbon atoms or
comprising from about 3 to about 6 carbon atoms and 1 or 2
heteroatoms wherein the heteroatoms are oxygen, nitrogen, or sulfur
and wherein the ring system is aliphatic, unsaturated aliphatic,
aromatic, or saturated or unsaturated heterocyclic; R.sub.j is
alkyl or haloalkyl having 1 to about 10 carbon atoms, alkenyl
having 2 to about 10 carbon atoms, alkynyl having 2 to about 10
carbon atoms, aryl having 6 to about 14 carbon atoms,
N(R.sub.k)(R.sub.m) OR.sub.k, halo, SR.sub.k or CN; m.sub.a is 1 to
about 10; each mb is, independently, 0 or 1; mc is 0 or an integer
from 1 to 10; md is an integer from 1 to 10; me is from 0, 1 or 2;
and provided that when mc is 0, md is greater than 1.
29. The compound of claim 26 wherein each of the 2'-substituent
groups is, independently, O(CH.sub.2).sub.2OCH.sub.3,
O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(CH.sub.3).sub.2,
O(CH.sub.2).sub.2N(CH.sub.3).sub.2, OCH.sub.2C(.dbd.O)N(H)CH.sub.3,
OCH.sub.3, O(CH.sub.2).sub.2NH.sub.2,
O(CH.sub.2).sub.2N(CH.sub.3).sub.2, O(CH.sub.2).sub.3NH.sub.2,
O(CH.sub.2).sub.3N(H)CH.sub.3, CH.sub.2CH.dbd.CH.sub.2, or
O(CH.sub.2).sub.2S(O)CH.sub.3.
30. The compound of claim 25 wherein each of the 2'-substituent
groups is, independently, OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3,
N.sub.3, CH.sub.2CHCH.sub.2, C.sub.1-C.sub.20 alkyl, COOH,
CONR.sup.1R.sup.2, CONR.sup.1R.sup.2, NR.sup.1R.sup.2, --SR.sup.1,
NR.sup.1OR.sup.2, or F wherein each R.sup.1 and R.sup.2 is,
independently, hydrogen, a nitrogen protecting group, substituted
or unsubstituted C.sub.1-C.sub.10 alkyl, substituted or
unsubstituted C.sub.2-C.sub.10 alkenyl, substituted or
unsubstituted C.sub.2-C.sub.10 alkynyl, wherein the substituent
group is hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro,
thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, alkynyl,
guanidine, or acyl where the acyl is an acid amide or an ester.
31. The compound of claim 1 wherein at least one of the nucleosides
of one of the regions comprising 3'-endo sugar conformational
geometry is a xlyo nucleoside.
32. The compound of claim 1 wherein at least one of the nucleosides
of one of the regions comprising 3'-endo sugar conformational
geometry is an arbino nucleoside.
33. The compound of claim 1 wherein at least one of the nucleosides
of one of the regions comprising 3'-endo sugar conformational
geometry has a bicyclic sugar moiety.
34. The compound of claim 33 wherein at least one of the bicyclic
sugar moieties is a locked nucleic acid (LNA).
35. The compound of claim 23 wherein at least one of the
nucleosides comprising a 3'-endo sugar conformational geometry is a
base modified nucleoside.
36. The compound of claim 35 wherein the modified base nucleoside
is 5-methyl cytosine.
37. The compound of claim 35 wherein each cytosine containing
nucleoside is substituted with a 5-methyl cytosine containing
nucleoside.
38. The compound of claim 35 wherein at least one of the
nucleosides of one of the regions comprising 3'-endo sugar
conformational geometry comprises a modified heterocyclic base
moiety selected from the group consisting of 2-thiothymine,
2'-O-methylpseudouricyl, 7-halo-7-deaza purine, 7-propyne-7-deaza
purine, and 2,6-diaminopurine.
39. The compound of claim 1 wherein each of the nucleosides is
linked by an internucleoside linking group independently selected
from the group consisting of phosphodiester, phosphorothioate,
chiral phosphorothioate, phosphorodithioate, phosphotriester,
aminoalkylphosphotriester, methyl phosphonate, alkyl phosphonate,
5'-alkylene phosphonate, chiral phosphonate, phosphinate,
phosphoramidate, 3'-amino phosphoramidate,
aminoalkylphosphoramidate, thionophosphoramidate,
thionoalkylphosphonate, thionoalkylphosphotriester,
selenophosphate, and boranophosphate.
40. The compound of claim 39 wherein each of the nucleosides is,
independently, linked by phosphodiester or phosphorothioate.
41. The compound of claim 40 wherein each of the nucleosides is
linked by a phosphorothioate internucleoside linking group.
42. The compound of claim 1 wherein each nucleoside of the regions
comprising 3'-endo conformational geometry comprises a
2'-O--CH.sub.2CH.sub.2--O--CH.sub.3 group.
43. The compound of claim 1 comprising from about 5 to 50
nucleosides in length.
44. The compound of claim 1 comprising from about 12 to 30
nucleosides in length.
45. The compound of claim 1 comprising from about 15 to 25
nucleosides in length.
46. The compound of claim 1 comprising from about 21 to 25
nucleosides in length.
47. The compound of claim 1 wherein each nucleoside of the regions
comprising 3'-endo conformational geometry comprises a
2'-O--CH.sub.3 group.
48. The compound of claim 1 wherein each nucleoside of the regions
comprising 3'-endo conformational geometry comprises a 2'-fluoro
group.
49. The compound of claim 1 wherein each nucleoside of the regions
comprising 3'-endo conformational geometry is a LNA nucleoside.
50. The compound of claim 1 comprising from about 13 to 30
nucleosides in length.
51. A method of reducing target mRNA levels in a cell in vitro
comprising contacting the cell with a gap-disabled compound listed
in Table 13 or Table 26.
52. A method of reducing cell surface expression of CD86 in an MH-S
cell comprising contacting the cell with a gap-disabled
compound.
53. A method of reducing viability of a cell comprising contacting
the cell with a gap-disabled compound listed in Table 28.
54. An oligomeric compound comprising the gap-disabled motif
2-1-1-2-1-1-1-1-1-1-1-1-1-3-2.
55. A method of reducing the hepatotoxicity of an oligonucleotide
comprising incorporating a gap-disabled motif into the
oligonucleotide.
56. The method of claim 55 wherein the gap-disabled motif is
2-1-1-2-1-1-1-1-1-1-1-1-1-3-2 or 3-2-1-2-1-2-1-2-1-2-3.
57. The method of claim 55 wherein the gap-disabled motif comprises
at least 9 alternating 3'-endo and 2'-endo regions.
58. A double-stranded heteroduplex compound comprising a
gap-disabled oligonucleotide having the gap-disabled motif of
3-2-1-3-1-3-1-3-3.
59. A method of eliciting cleavage of a target RNA comprising
contacting the target RNA with a gap-disabled compound comprising
the gap-disabled motif of 3-2-1-3-1-3-1-3-3.
60. The method of claim 59 wherein the cleavage of the target RNA
occurs in the nucleus.
61. The method of claim 59 wherein the cleavage position on the
target RNA occurs within the 2'-deoxynucleotide gaps.
62. The method of claim 59 wherein the cleavage occurs at a guanine
residue.
63. A method of reducing target RNA levels in an animal comprising
contacting the animal with a gap-disabled compound comprising a
gap-disabled motif listed in Table 13 or Table 26 and wherein the
gap-disabled compound comprises a nucleobase sequence substantially
complementary to a portion of the target RNA.
64. A method of lowering cholesterol or triglycerides in an animal
comprising contacting the animal with a gap-disabled compound
comprising the gap-disabled motif 3-2-1-2-1-2-1-2-1-2-3.
65. A method of lowering plasma leptin, glucose, or plasma insulin
in an animal comprising contacting the animal with a gap-disabled
compound having the gap-disabled motif 3-2-1-2-1-2-1-2-1-2-3.
66. A method of lowering body weight, fat depot weight or food
intake in an animal comprising contacting the animal with a
gap-disabled compound comprising the gap-disabled motif
3-2-1-2-1-2-1-2-1-2-3.
67. A method of reducing serum cholesterol, triglycerides or body
weight in an obese animal comprising contacting the animal with a
gap-disabled compound comprising the gap-disabled motif of
3-2-1-2-1-2-1-2-1-2-3.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. provisional
application Ser. No. 60/501,719 filed Sep. 9, 2003 and to U.S.
provisional application Ser. No. 60/568,489 filed May 6, 2004, each
which is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to novel chimeric oligomeric
compounds having regions of nucleosides that are RNA like having
northern or 3'-endo conformational geometry (3'-endo regions) and
regions of nucleosides that are DNA like having southern or
C2'-endo/O4'-endo conformational geometry. In certain embodiments
the nucleosides that comprise the DNA like regions are
2'-deoxyribonucleosides. Chimeric oligomeric compounds include
those having 3'-endo regions positioned at the 3' and 5'-termini
with at least two internal C2'-endo/O4'-endo regions that are
separated by at least one 3'-endo region. In other embodiments
there are at least 5 separate regions that alternate between
C2'-endo/O4'-endo and 3'-endo regions. The oligomeric compounds of
the present invention are useful in the regulation of gene
expression. The oligomeric compounds of the present invention have
shown reduction in mRNA levels in multiple in vitro and in vivo
assay systems. The chimeric oligomeric compounds of the present
invention are useful, for example, for investigative and
therapeutic purposes.
BACKGROUND OF THE INVENTION
[0003] Nearly all disease states in multicellular organisms involve
the action of proteins. Classic therapeutic approaches have focused
on the interaction of proteins with other molecules in efforts to
moderate the proteins' disease-causing or disease-potentiating
activities. In newer therapeutic approaches, modulation of the
production of proteins has been sought. A general object of some
current therapeutic approaches is to interfere with or otherwise
modulate gene expression.
[0004] One method for inhibiting the expression of specific genes
involves the use of oligonucleotides, particularly oligonucleotides
that are complementary to a specific target messenger RNA (mRNA)
sequence. Due to promising research results in recent years,
oligonucleotides and oligonucleotide analogs are now accepted as
therapeutic agents holding great promise for therapeutic and
diagnostic methods.
[0005] Oligonucleotides and their analogs can be designed to have
particular properties. A number of chemical modifications have been
introduced into oligomeric compounds to increase their usefulness
as therapeutic agents. Such modifications include those designed to
increase binding affinity to a target strand, to increase cell
penetration, to stabilize against nucleases and other enzymes that
degrade or interfere with the structure or activity of the
oligonucleotide, to provide a mode of disruption (terminating
event) once the oligonucleotide is bound to a target, and to
improve the pharmacokinetic properties of the oligonucleotide.
[0006] Despite these advances, a need exists in the art for the
development of means to improve the binding affinity and nuclease
resistance properties of oligomeric compounds. The present
invention meets these needs as well as other needs.
SUMMARY OF THE INVENTION
[0007] The present invention provides chimeric oligomeric compounds
comprising from about 5 to about 80 linked nucleosides wherein the
chimeric oligomeric compounds are divided into at least 5 separate
regions and each of these regions is a continuous sequence of from
1 to about 5 nucleosides each having a 3'-endo sugar conformational
geometry or a continuous sequence of from 1 to about 5
2'-deoxyribonucleosides and wherein each of these regions
comprising from 1 to about 5 2'-deoxyribonucleosides is internally
located between two of said regions comprising 1 to about 5
nucleosides each having a 3'-endo sugar conformational geometry or
at one of the 3' or 5' termini.
DETAILED DESCRIPTION OF THE INVENTION
[0008] The present invention provides novel chimeric oligomeric
compounds comprising regions that alternate between 3'-endo sugar
conformational geometry (3'-endo regions) and 2'-endo/O4'-endo
sugar conformational geometry (2'-endo regions). Each of the
alternating regions comprise from 1 to about 5 nucleosides. The
chimeric oligomeric compounds can start (5'-end) or end (3'-end)
with either of the 2 regions and can have from about 5 to about 20
separate regions. One or more of the nucleosides of the chimeric
oligomeric compound can further comprise a conjugate group. In one
aspect of the present invention chimeric oligomeric compounds have
the formula: T.sub.1-(3'-endo region)-[(2'-endo region)-(3'-endo
region)].sub.n-T.sub.2 wherein n is at least two and each T.sub.1
and T.sub.2 is independently an optional conjugate group.
[0009] Each of the regions can range from 1 to about 5 nucleosides
in length allowing for a plurality of motifs for oligonucleotides
having the same length. Such as for example a chimeric oligomeric
compound of the present invention having a length of 20 base pairs
(bp) would include such motifs as 3-3-2-4-2-3-3, 3-4-1-4-1-4-3 and
4-3-1-4-1-3-4 where each motif has the same number and orientation
of regions (bold and italicized numbers are 3'-endo regions, unbold
and not underlined numbers are 2'-endo regions and the number
corresponding to each region representing the number of base pairs
for that particular region).
[0010] A plurality of motifs for the chimeric oligomeric compounds
of the present invention has been prepared and has shown activity
in a plurality of assays against various targets. In addition to in
vitro assays some positive data have also been obtained through in
vivo assays. A list of motifs is shown below. This list is meant to
be representative and not limiting.
1 Motifs # bp's Regions Motif 20 mer 5 1-8-2-8-1 20 mer 5 2-6-4-6-2
20 mer 5 2-7-2-7-2 20 mer 5 3-5-4-5-3 20 mer 5 3-6-1-7-3 20 mer 5
3-7-1-6-3 20 mer 7 3-3-2-4-2-3-3 20 mer 7 3-4-1-4-1-4-3 20 mer 7
4-3-1-4-1-3-4 18 mer 9 2-2-1-3-1-2-1-3-3 20 mer 9 3-2-1-3-1-3-1-3-3
20 mer 9 3-2-1-3-1-2-1-3-4 18 mer 9 3-3-1-2-1-3-1-2-2 20 mer 9
3-3-1-2-1-3-1-3-3 20 mer 9 3-3-1-2-1-2-1-3-4 20 mer 9
3-3-1-3-1-2-1-2-4 20 mer 9 3-3-1-3-1-2-1-3-3 20 mer 9
5-2-1-2-1-2-1-1-5 20 mer 11 3-2-2-1-2-1-2-1-1-2-3 20 mer 11
3-1-3-1-2-1-2-1-2-1-3 20 mer 11 3-1-2-1-2-1-2-1-2-1-4 20 mer 11
3-2-1-2-1-2-1-2-1-2-3 20 mer 11 3-2-1-2-1-3-1-2-1-1-3 20 mer 15
2-1-1-2-1-1-1-1-1-1-1-1-1-3-2 20 mer 15 3-1-1-1-1-1-1-1-1-1-1-1-1-
-1-4 20 mer 19 1-1-1-1-1-1-1-1-1-1-1-1-1-1-1-1-1-1-2 # = number of
3'-endo nucleosides in the region (bolded) # = number of 2'-deoxy
ribonucleotides in the region
[0011] Compounds of the Invention
[0012] The present invention provides chimeric oligomeric compounds
that have at least 5 regions that alternate between 3'-endo and
2'-endo in conformational geometry. The nucleoside or nucleosides
of a particular region can be modified in a variety of ways to give
the region either a 3'-endo or a 2'-endo conformational geometry.
The conformational geometry of a selected nucleoside can be
modulated in one aspect by modifying the sugar the base or both the
sugar and the base. Modifications include attachment of substituent
groups or conjugate groups or by directly modifying the base or the
sugar.
[0013] The sugar conformational geometry (puckering) plays a
central role in determining the duplex conformational geometry
between an oligonucleotide and its nucleic acid target. By
controlling the sugar puckering independently at each position of
an oligonucleotide the duplex geometry can be modulated to help
maximize desired properties of the resulting chimeric oligomeric
compound. Modulation of sugar geometry has been shown to enhance
properties such as for example increased lipohpilicity, binding
affinity to target nucleic acid (e.g. mRNA), chemical stability and
nuclease resistance.
[0014] The present invention discloses novel chimeric oligomeric
compounds comprised of a plurality of alternating 3'-endo and
2'-endo (including 2'-deoxy) regions wherein each of the regions
are independently from about 1 to about 5 nucleosides in length.
The chimeric oligomeric compounds can start and end with either
3'-endo or 2'-endo regions and have from about 5 to about 19
regions in total. The nucleosides of each region can be selected to
be uniform such as for example uniform 2'-O-MOE nucleosides for one
or more of the 3'-endo regions and 2'-deoxynucleosides for the
2'-endo regions. Alternatively the nucleosides can be mixed such
that any nucleoside having 3'-endo conformational geometry can be
used in any position of any 3'-endo region and any nucleoside
having 2'-endo conformational geometry can be used in any position
of any 2'-endo region. In some embodiments a 5'-conjugate group is
used as a 5'-cap as a method of increasing the 5'-exonuclease
resistance but conjugate groups can be used at any position within
the chimeric oligomeric compounds of the invention.
[0015] 3'-Endo Regions
[0016] The present invention provides chimeric oligomeric compounds
having alternating regions wherein one of the alternating regions
has 3'-endo conformational geometry. These 3'-endo regions include
nucleosides synthetically modified to induce a 3'-endo sugar
conformation. A nucleoside can incorporate synthetic modifications
of the heterocyclic base, the sugar moiety or both to induce a
desired 3'-endo sugar conformation. These modified nucleosides are
used to mimic RNA like nucleosides so that particular properties of
an oligomeric compound can be enhanced while maintaining the
desirable 3'-endo conformational geometry. Properties that are
enhanced by using more stable 3'-endo nucleosides include but
aren't limited to modulation of pharmacokinetic properties through
modification of protein binding, protein off-rate, absorption and
clearance; modulation of nuclease stability as well as chemical
stability; modulation of the binding affinity and specificity of
the oligomer (affinity and specificity for enzymes as well as for
complementary sequences); and increasing efficacy of RNA cleavage.
The present invention provides regions of nucleosides modified in
such a way as to favor a C3'-endo type conformation. 1
[0017] Nucleoside conformation is influenced by various factors
including substitution at the 2', 3' or 4'-positions of the
pentofuranosyl sugar. Electronegative substituents generally prefer
the axial positions, while sterically demanding substituents
generally prefer the equatorial positions (Principles of Nucleic
Acid Structure, Wolfgang Sanger, 1984, Springer-Verlag.)
Modification of the 2' position to favor the 3'-endo conformation
can be achieved while maintaining the 2'-OH as a recognition
element (Gallo et al., Tetrahedron (2001), 57, 5707-5713.
Harry-O'kuru et al., J. Org. Chem., (1997), 62(6), 1754-1759 and
Tang et al., J. Org. Chem. (1999), 64, 747-754.)
[0018] Alternatively, preference for the 3'-endo conformation can
be achieved by deletion of the 2'-OH as exemplified by
2'deoxy-2'F-nucleosides (Kawasaki et al., J. Med. Chem. (1993), 36,
831-841), which adopts the 3'-endo conformation positioning the
electronegative fluorine atom in the axial position. Other
modifications of the ribose ring, for example substitution at the
4'-position to give 4'-F modified nucleosides (Guillerm et al.,
Bioorganic and Medicinal Chemistry Letters (1995), 5, 1455-1460 and
Owen et al., J. Org. Chem. (1976), 41, 3010-3017), or for example
modification to yield methanocarba nucleoside analogs (Jacobson et
al., J. Med. Chem. Lett. (2000), 43, 2196-2203 and Lee et al.,
Bioorganic and Medicinal Chemistry Letters (2001), 11, 1333-1337)
also induce preference for the 3'-endo conformation. Along similar
lines, 3'-endo regions can include one or more nucleosides modified
in such a way that conformation is locked into a C3'-endo type
conformation, i.e. Locked Nucleic Acid (LNA, Singh et al, Chem.
Commun. (1998), 4, 455-456), and ethylene bridged Nucleic Acids
(ENA, Morita et al, Bioorganic & Medicinal Chemistry Letters
(2002), 12, 73-76.)
[0019] Examples of modified nucleosides amenable to the present
invention are shown below in Table 1. These examples are meant to
be representative and not exhaustive.
2TABLE 1 2 3 4 5 6 7 8
[0020] The preferred conformation of modified nucleosides and their
oligomers can be estimated by various methods such as molecular
dynamics calculations, nuclear magnetic resonance spectroscopy and
CD measurements. Hence, modifications predicted to induce RNA like
conformations, A-form duplex geometry in an oligomeric context, are
selected for use in the modified oligoncleotides of the present
invention. The synthesis of numerous of the modified nucleosides
amenable to the present invention are known in the art (see for
example, Chemistry of Nucleosides and Nucleotides Vol 1-3, ed.
Leroy B. Townsend, 1988, Plenum press., and the examples section
below). Nucleosides known to be inhibitors/substrates for RNA
dependent RNA polymerases (for example HCV NS5B).
[0021] The terms used to describe the conformational geometry of
homoduplex nucleic acids are "A Form" for RNA and "B Form" for DNA.
The respective conformational geometry for RNA and DNA duplexes was
determined from X-ray diffraction analysis of nucleic acid fibers
(Arnott and Hukins, Biochem. Biophys. Res. Comm., 1970, 47, 1504.)
In general, RNA:RNA duplexes are more stable and have higher
melting temperatures (T.sub.ms) than DNA:DNA duplexes (Sanger et
al., Principles of Nucleic Acid Structure, 1984, Springer-Verlag;
New York, N.Y.; Lesnik et al., Biochemistry, 1995, 34, 10807-10815;
Conte et al., Nucleic Acids Res., 1997, 25, 2627-2634). The
increased stability of RNA has been attributed to several
structural features, most notably the improved base stacking
interactions that result from an A-form geometry (Searle et al.,
Nucleic Acids Res., 1993, 21, 2051-2056). The presence of the 2'
hydroxyl in RNA biases the sugar toward a C3' endo pucker, i.e.,
also designated as Northern pucker, which causes the duplex to
favor the A-form geometry. In addition, the 2' hydroxyl groups of
RNA can form a network of water mediated hydrogen bonds that help
stabilize the RNA duplex (Egli et al., Biochemistry, 1996, 35,
8489-8494). On the other hand, deoxy nucleic acids prefer a C2'
endo sugar pucker, i.e., also known as Southern pucker, which is
thought to impart a less stable B-form geometry (Sanger, W. (1984)
Principles of Nucleic Acid Structure, Springer-Verlag, New York,
N.Y.). As used herein, B-form geometry is inclusive of both
C2'-endo pucker and O4'-endo pucker. This is consistent with
Berger, et. al., Nucleic Acids Research, 1998, 26, 2473-2480, who
pointed out that in considering the furanose conformations which
give rise to B-form duplexes consideration should also be given to
a O4'-endo pucker contribution.
[0022] DNA:RNA hybrid duplexes, however, are usually less stable
than pure RNA:RNA duplexes, and depending on their sequence may be
either more or less stable than DNA:DNA duplexes (Searle et al.,
Nucleic Acids Res., 1993, 21, 2051-2056). The structure of a hybrid
duplex is intermediate between A- and B-form geometries, which may
result in poor stacking interactions (Lane et al., Eur. J.
Biochem., 1993, 215, 297-306; Fedoroff et al., J. Mol. Biol., 1993,
233, 509-523; Gonzalez et al., Biochemistry, 1995, 34, 4969-4982;
Horton et al., J. Mol. Biol., 1996, 264, 521-533). The stability of
the duplex formed between a target RNA and a synthetic sequence is
central to therapies such as, but not limited to, antisense and RNA
interference as these mechanisms require the binding of an
oligonucleotide strand to an RNA target strand. In the case of
antisense, effective inhibition of the mRNA requires that the
antisense DNA have a minimum binding affinity with the mRNA.
Otherwise, the desired interaction between the oligonucleotide
strand and target mRNA strand will occur infrequently, resulting in
decreased efficacy.
[0023] One routinely used method of modifying the sugar puckering
is the substitution on the sugar at the 2'-position with a
substituent group that influences the sugar geometry. The influence
on ring conformation is dependant on the nature of the substituent
at the 2'-position. A number of different substituents have been
studied to determine their sugar puckering effect. For example,
2'-halogens have been studied showing that the 2'-fluoro derivative
exhibits the largest population (65%) of the C3'-endo form, and the
2'-iodo exhibits the lowest population (7%). The populations of
adenosine (2'-OH) versus deoxyadenosine (2'-H) are 36% and 19%,
respectively. Furthermore, the effect of the 2'-fluoro group of
adenosine dimers
(2'-deoxy-2'-fluoroadenosine-2'-deoxy-2'-fluoro-adenosin- e) is
further correlated to the stabilization of the stacked
conformation.
[0024] As expected, the relative duplex stability can be enhanced
by replacement of 2'-OH groups with 2'-F groups thereby increasing
the C3'-endo population. It is assumed that the highly polar nature
of the 2'-F bond and the extreme preference for C3'-endo puckering
may stabilize the stacked conformation in an A-form duplex. Data
from UV hypochromicity, circular dichroism, and .sup.1H NMR also
indicate that the degree of stacking decreases as the
electronegativity of the halo substituent decreases. Furthermore,
steric bulk at the 2'-position of the sugar moiety is better
accommodated in an A-form duplex than a B-form duplex. Thus, a
2'-substituent on the 3'-terminus of a dinucleoside monophosphate
is thought to exert a number of effects on the stacking
conformation: steric repulsion, furanose puckering preference,
electrostatic repulsion, hydrophobic attraction, and hydrogen
bonding capabilities. These substituent effects are thought to be
determined by the molecular size, electronegativity, and
hydrophobicity of the substituent. Melting temperatures of
complementary strands is also increased with the 2'-substituted
adenosine diphosphates. It is not clear whether the 3'-endo
preference of the conformation or the presence of the substituent
is responsible for the increased binding. However, greater overlap
of adjacent bases (stacking) can be achieved with the 3'-endo
conformation.
[0025] One synthetic 2'-modification that imparts increased
nuclease resistance and a very high binding affinity to nucleotides
is the 2-methoxyethoxy (2'-MOE, 2'-OCH.sub.2CH.sub.2OCH.sub.3) side
chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). One
of the immediate advantages of the 2'-MOE substitution is the
improvement in binding affinity, which is greater than many similar
2' modifications such as O-methyl, O-propyl, and O-aminopropyl.
Oligonucleotides having the 2'-O-methoxyethyl substituent also have
been shown to be antisense inhibitors of gene expression with
promising features for in vivo use (Martin, P., Helv. Chim. Acta,
1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176;
Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and
Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).
Relative to DNA, the oligonucleotides having the 2'-MOE
modification displayed improved RNA affinity and higher nuclease
resistance. Chimeric oligomeric compounds having 2'-MOE
substituents in the wing nucleosides and an internal region of
deoxy-phosphorothioate nucleotides (also termed a gapped
oligonucleotide or gapmer) have shown effective reduction in the
growth of tumors in animal models at low doses. 2'-MOE substituted
oligonucleotides have also shown outstanding promise as antisense
agents in several disease states. One such MOE substituted
oligonucleotide is presently being investigated in clinical trials
for the treatment of CMV retinitis.
[0026] To better understand the higher RNA affinity of
2'-O-methoxyethyl substituted RNA and to examine the conformational
properties of the 2'-O-methoxyethyl substituent, two dodecamer
oligonucleotides were synthesized having SEQ ID NO: 1 (CGC GAA UUC
GCG) and SEQ ID NO: 2 (GCG CUU AAG CGC). These self-complementary
strands have every 2'-position modified with a 2'-O-methoxyethyl.
The duplex was crystallized at a resolution of 1.7 .ANG.ngstrom and
the crystal structure was determined. The conditions used for the
crystallization were 2 mM oligonucleotide, 50 mM Na Hepes pH
6.2-7.5, 10.50 mM MgCl.sub.2, 15% PEG 400. The crystal data showed:
space group C2, cell constants a=41.2 .ANG., b=34.4 .ANG., c=46.6
.ANG., =92.4.degree.. The resolution was 1.7 .ANG. at -170.degree.
C. The current R=factor was 20% (R.sub.free 26%).
[0027] This crystal structure is believed to be the first crystal
structure of a fully modified RNA oligonucleotide analogue. The
duplex adopts an overall A-form conformation and all modified
sugars display C3'-endo pucker. In most of the 2'-O-substituents,
the torsion angle around the A'-B' bond, as depicted in Structure
II below, of the ethylene glycol linker has a gauche conformation.
For 2'-O-MOE, A' and B' of Structure II below are methylene
moieties of the ethyl portion of the MOE and R' is the methoxy
portion. 9
[0028] In the crystal, the 2'-O-MOE RNA duplex adopts a general
orientation such that the crystallographic 2-fold rotation axis
does not coincide with the molecular 2-fold rotation axis. The
duplex adopts the expected A-type geometry and all of the 24
2'-O-MOE substituents were visible in the electron density maps at
full resolution. The electron density maps as well as the
temperature factors of substituent atoms indicate flexibility of
the 2'-O-MOE substituent in some cases.
[0029] Most of the 2'-O-MOE substituents display a gauche
conformation around the C--C bond of the ethyl linker. However, in
two cases, a trans conformation around the C--C bond is observed.
The lattice interactions in the crystal include packing of duplexes
against each other via their minor grooves. Therefore, for some
residues, the conformation of the 2'-O-substituent is affected by
contacts to an adjacent duplex. In general, variations in the
conformation of the substituents (e.g. g.sup.+ or g.sup.- around
the C--C bonds) create a range of interactions between
substituents, both inter-strand, across the minor groove, and
intra-strand. At one location, atoms of substituents from two
residues are in van der Waals contact across the minor groove.
Similarly, a close contact occurs between atoms of substituents
from two adjacent intra-strand residues.
[0030] Previously determined crystal structures of A-DNA duplexes
were for those that incorporated isolated 2'-O-methyl T residues.
In the crystal structure noted above for the 2'-O-MOE substituents,
a conserved hydration pattern has been observed for the 2'-O-MOE
residues. A single water molecule is seen located between O2', O3'
and the methoxy oxygen atom of the substituent, forming contacts to
all three of between 2.9 and 3.4 .ANG.. In addition, oxygen atoms
of substituents are involved in several other hydrogen bonding
contacts. For example, the methoxy oxygen atom of a particular
2'-O-substituent forms a hydrogen bond to N3 of an adenosine from
the opposite strand via a bridging water molecule.
[0031] In several cases a water molecule is trapped between the
oxygen atoms O2', O3' and OC' of modified nucleosides. 2'-O-MOE
substituents with trans conformation around the C--C bond of the
ethylene glycol linker are associated with close contacts between
OC' and N2 of a guanosine from the opposite strand, and,
water-mediated, between OC' and N3(G). When combined with the
available thermodynamic data for duplexes containing 2'-O-MOE
modified strands, this crystal structure allows for further
detailed structure-stability analysis of other modifications.
[0032] In extending the crystallographic structure studies,
molecular modeling experiments were performed to study further
enhanced binding affinity of oligonucleotides having
2'-O-modifications of the invention. The computer simulations were
conducted on compounds of SEQ ID NO: 1, above, having
2'-O-modifications of the invention located at each of the
nucleoside of the oligonucleotide. The simulations were performed
with the oligonucleotide in aqueous solution using the AMBER force
field method (Cornell et al., J. Am. Chem. Soc., 1995, 117,
5179-5197)(modeling software package from UCSF, San Francisco,
Calif.). The calculations were performed on an Indigo2 SGI machine
(Silicon Graphics, Mountain View, Calif.).
[0033] Further 2'-O-modifications that will have a 3'-endo sugar
influence include those having a ring structure that incorporates a
two atom portion corresponding to the A' and B' atoms of Structure
II. The ring structure is attached at the 2' position of a sugar
moiety of one or more nucleosides that are incorporated into an
oligonucleotide. The 2'-oxygen of the nucleoside links to a carbon
atom corresponding to the A' atom of Structure II. These ring
structures can be aliphatic, unsaturated aliphatic, aromatic or
heterocyclic. A further atom of the ring (corresponding to the B'
atom of Structure II), bears a further oxygen atom, or a sulfur or
nitrogen atom. This oxygen, sulfur or nitrogen atom is bonded to
one or more hydrogen atoms, alkyl moieties, or haloalkyl moieties,
or is part of a further chemical moiety such as a ureido,
carbamate, amide or amidine moiety. The remainder of the ring
structure restricts rotation about the bond joining these two ring
atoms. This assists in positioning the "further oxygen, sulfur or
nitrogen atom" (part of the R position as described above) such
that the further atom can be located in close proximity to the
3'-oxygen atom (O3') of the nucleoside.
[0034] Another 2'-sugar substituent group that gives a 3'-endo
sugar conformational geometry is the 2'-OMe group. 2'-Substitution
of guanosine, cytidine, and uridine dinucleoside phosphates with
the 2'-OMe group showed enhanced stacking effects with respect to
the corresponding native (2'-OH) species leading to the conclusion
that the sugar is adopting a C3'-endo conformation. In this case,
it is believed that the hydrophobic attractive forces of the methyl
group tend to overcome the destabilizing effects of its steric
bulk.
[0035] The ability of oligonucleotides to bind to their
complementary target strands is compared by determining the melting
temperature (T.sub.m) of the hybridization complex of the
oligonucleotide and its complementary strand. The melting
temperature (T.sub.m), a characteristic physical property of double
helices, denotes the temperature (in degrees centigrade) at which
50% helical (hybridized) versus coil (unhybridized) forms are
present. T.sub.m is measured by using the UV spectrum to determine
the formation and breakdown (melting) of the hybridization complex.
Base stacking, which occurs during hybridization, is accompanied by
a reduction in UV absorption (hypochromicity). Consequently, a
reduction in UV absorption indicates a higher T.sub.m. The higher
the T.sub.m, the greater the strength of the bonds between the
strands.
[0036] Freier and Altmann, Nucleic Acids Research, (1997)
25:4429-4443, have previously published a study on the influence of
structural modifications of oligonucleotides on the stability of
their duplexes with target RNA. In this study, the authors reviewed
a series of oligonucleotides containing more than 200 different
modifications that had been synthesized and assessed for their
hybridization affinity and T.sub.m. Sugar modifications studied
included substitutions on the 2'-position of the sugar,
3'-substitution, replacement of the 4'-oxygen, the use of bicyclic
sugars, and four member ring replacements. Several nucleobase
modifications were also studied including substitutions at the 5,
or 6 position of thymine, modifications of pyrimidine heterocycle
and modifications of the purine heterocycle. Modified
internucleoside linkages were also studied including neutral,
phosphorus and non-phosphorus containing internucleoside
linkages.
[0037] Increasing the percentage of C3'-endo sugars in a modified
oligonucleotide targeted to an RNA target strand should preorganize
this strand for binding to RNA. Of the several sugar modifications
that have been reported and studied in the literature, the
incorporation of electronegative substituents such as 2'-fluoro or
2'-alkoxy shift the sugar conformation towards the 3' endo
(northern) pucker conformation. This preorganizes an
oligonucleotide that incorporates such modifications to have an
A-form conformational geometry. This A-form conformation results in
increased binding affinity of the oligonucleotide to a target RNA
strand.
[0038] Molecular modeling experiments were performed to study
further enhanced binding affinity of oligonucleotides having
2'-O-modifications. Computer simulations were conducted on
compounds having SEQ ID NO: 1, r(CGC GAA UUC GCG), having
2'-O-modifications of the invention located at each of the
nucleoside of the oligonucleotide. The simulations were performed
with the oligonucleotide in aqueous solution using the AMBER force
field method (Cornell et al., J. Am. Chem. Soc., 1995, 117,
5179-5197)(modeling software package from UCSF, San Francisco,
Calif.). The calculations were performed on an Indigo2 SGI machine
(Silicon Graphics, Mountain View, Calif.).
[0039] In addition, for 2'-substituents containing an ethylene
glycol motif, a gauche interaction between the oxygen atoms around
the O--C--C--O torsion of the side chain may have a stabilizing
effect on the duplex (Freier and Altmann, Nucleic Acids Research,
1997, 25, 4429-4443). Such gauche interactions have been observed
experimentally for a number of years (Wolfe et al., Acc. Chem.
Res., 1972, 5, 102; Abe et al., J. Am. Chem. Soc., 1976, 98, 468).
This gauche effect may result in a configuration of the side chain
that is favorable for duplex formation. The exact nature of this
stabilizing configuration has not yet been explained. While not
wishing to be bound by theory, it may be that holding the
O--C--C--O torsion in a single gauche configuration, rather than a
more random distribution seen in an alkyl side chain, provides an
entropic advantage for duplex formation.
[0040] Representative 2'-substituent groups amenable to the present
invention that give A-form conformational properties (3'-endo) to
the resultant duplexes include 2'-O-alkyl, 2'-O-substituted alkyl
and 2'-fluoro substituent groups. Substituent groups can be various
alkyl and aryl ethers and thioethers, amines and monoalkyl and
dialkyl substituted amines. It is further intended that multiple
modifications can be made to one or more nucleosides and or
internucleoside linkages within an oligonucleotide of the invention
to enhance activity of the oligonucleotide. Tables 2 through 8 list
nucleoside and internucleotide linkage modifications/replacements
that have been shown to give a positive .epsilon.T.sub.m per
modification when the modification/replacement was made to a DNA
strand that was hybridized to an RNA complement.
3TABLE 2 Modified DNA strand having 2'-substituent groups that gave
an overall increase in T.sub.m against an RNA complement: Positive
.epsilon.T.sub.m/mod 2'-substituents 2'-OH 2'-O--C.sub.1--C.sub.4
alkyl 2'-O--(CH.sub.2).sub.2CH.sub.3 2'-O--CH.sub.2CH.dbd.CH.sub.2
2'-F 2'-O--(CH.sub.2).sub.2--O--CH.sub.3
2'-[O--(CH.sub.2).sub.2].sub.2--O--CH.sub.3
2'-[O--(CH.sub.2).sub.2].sub.3--O--CH.sub.3
2'-[O--(CH.sub.2).sub.2].sub.4--O--CH.sub.3
2'-[O--(CH.sub.2).sub.2].sub.3--O--(CH.sub.2).sub.8CH.sub.3
2'-O--(CH.sub.2).sub.2CF.sub.3 2'-O--(CH.sub.2).sub.2OH
2'-O--(CH.sub.2).sub.2F 2'-O--CH.sub.2CH(CH.sub.3)F
2'-O--CH.sub.2CH(CH.sub.2OH)OH 2'-O--CH.sub.2CH(CH.sub.2OCH.sub.-
3)OCH.sub.3 2'-O--CH.sub.2CH(CH.sub.3)OCH.sub.3
2'-O--CH.sub.2--C.sub.14H.sub.7O.sub.2 (--C.sub.14H.sub.7O.sub.2 =
Anthraquinone) 2'-O--(CH.sub.2).sub.3--NH.sub.2*
2'-O--(CH.sub.2).sub.4--NH.sub.2* *These modifications can increase
the T.sub.m of oligonucleotides but can also decrease the T.sub.m
depending on positioning and number (motif dependant).
[0041]
4TABLE 3 Modified DNA strand having modified sugar ring (see
structure) that give an overall increase in T.sub.m against an RNA
complement: 10 Positive .di-elect cons.T.sub.m/mod Q --S--
--CH.sub.2-- Note: In general ring oxygen substitution with sulfur
or methylene had only a minor effect on T.sub.m for the specific
motiffs studied. Substitution at the 2'-position with groups shown
to stabilize the duplex were destabilizing when CH.sub.2 replaced
the ring O. This is thought to be due to the necessary gauche
interaction between the ring O with particular 2'-substituents #
(for example --O--CH.sub.3 and
--(O--CH.sub.2CH.sub.2).sub.3--O--CH.sub.3.
[0042] Note: In general ring oxygen substitution with sulfur or
methylene had only a minor effect on T.sub.m for the specific
motiffs studied. Substitution at the 2'-position with groups shown
to stabilize the duplex were destabilizing when CH.sub.2 replaced
the ring O. This is thought to be due to the necessary gauche
interaction between the ring O with particular 2'-substituents (for
example --O--CH.sub.3 and
--(O--CH.sub.2CH.sub.2).sub.3--O--CH.sub.3.
5TABLE 4 Modified DNA strand having modified sugar ring that give
an overall increase in T.sub.m against an RNA complement: 11
Positive .di-elect cons.T.sub.m/mod --C(H)R.sub.1 effects OH
(R.sub.2, R.sub.3 both = H) CH.sub.3* CH.sub.2OH* OCH.sub.3* *These
modifications can increase the T.sub.m of oligonucleotides but can
also decrease the T.sub.m depending on positioning and number
(motif dependant).
[0043] * These modifications can increase the T.sub.m of
oligonucleotides but can also decrease the T.sub.m depending on
positioning and number (motif dependant).
6TABLE 5 Modified DNA strand having bicyclic substitute sugar
modifications that give an overall increase in T.sub.m against an
RNA complement: Formula Positive .di-elect cons.T.sub.m/mod I + II
+ 12
[0044]
7TABLE 6 Modified DNA strand having modified heterocyclic base
moieties that give an overall increase in T.sub.m against an RNA
complement: Modification/Formula Positive .di-elect
cons.T.sub.m/mod Heterocyclic base 2-thioT modifications
2'-O-methylpseudoU 7-halo-7-deaza purines 7-propyne-7-deaza purines
2-aminoA(2,6-diaminopurine) 13 (R.sub.2, R.sub.3 = H), R.sub.1 = Br
C/C--CH.sub.3 (CH.sub.2).sub.3NH.sub.2 CH.sub.3
Motiffs-disubstitution R.sub.1 = C/C--CH.sub.3, R.sub.2 = H,
R.sub.3 = F R.sub.1 = C/C--CH.sub.3, R.sub.2 = H R.sub.3 =
O--(CH.sub.2).sub.2--O--CH.sub.3 R.sub.1 = O--CH.sub.3, R.sub.2 =
H, R.sub.3 = O--(CH.sub.2).sub.2--O--CH.sub.3* *This modification
can increase the T.sub.m of oligonucleotides but can also decrease
the T.sub.m depending on positioning and number (motif
dependant).
[0045] Substitution at R.sub.1 can be stabilizing, substitution at
R.sub.2 is generally greatly destabilizing (unable to form anti
conformation), motiffs with stabilizing 5 and 2'-substituent groups
are generally additive e.g. increase stability.
[0046] Substitution of the O4 and O2 positions of 2'-O-methyl
uridine was greatly duplex destabilizing as these modifications
remove hydrogen binding sites that would be an expected result.
6-Aza T also showed extreme destabilization as this substitution
reduces the pK.sub.a and shifts the nucleoside toward the enol
tautomer resulting in reduced hydrogen bonding.
8TABLE 7 DNA strand having at least one modified phosphorus
containing internucleoside linkage and the effect on the T.sub.m
against an RNA complement: .epsilon.T.sub.m/mod +
.epsilon.T.sub.m/mod - phosphorothioate.sup.1 phosphoramidate.sup.1
methyl phosphonates.sup.1 (.sup.1one of the non-bridging oxygen
atoms replaced with S, N(H)R or --CH.sub.3) phosphoramidate (the
3'-bridging atom replaced with an N(H)R group, stabilization effect
enhanced when also have 2'-F)
[0047]
9TABLE 8 DNA strand having at least one non-phosphorus containing
internucleoside linkage and the effect on the T.sub.m against an
RNA complement: Positive .epsilon.T.sub.m/mod
--CH.sub.2C(.dbd.O)NHCH.sub.2--*
--CH.sub.2C(.dbd.O)N(CH.sub.3)CH.sub.2--*
--CH.sub.2C(.dbd.O)N(CH.sub.2CH.sub.2CH.sub.3)CH.sub.2--*
--CH.sub.2C(.dbd.O)N(H)CH.sub.2-- (motif with 5'-propyne on T's)
--CH.sub.2N(H)C(.dbd.O)CH.sub.2--* --CH.sub.2N(CH.sub.3)OCH.sub.2-
--* --CH.sub.2N(CH.sub.3)N(CH.sub.3)CH.sub.2--* *This modification
can increase the T.sub.m of oligonucleotides but can also decrease
the T.sub.m depending on positioning and number (motif
dependant).
[0048] Notes: In general carbon chain internucleotide linkages were
destabilizing to duplex formation. This destabilization was not as
severe when double and tripple bonds were utilized. The use of
glycol and flexible ether linkages were also destabilizing.
[0049] Suitable ring structures of the invention for inclusion as a
2'-O modification include cyclohexyl, cyclopentyl and phenyl rings
as well as heterocyclic rings having spacial footprints similar to
cyclohexyl, cyclopentyl and phenyl rings. Particularly suitable
2'-O-substituent groups of the invention are listed below including
an abbreviation for each:
[0050] 2'-O-(trans2-methoxy cyclohexyl)--2'-O-(TMCHL)
[0051] 2'-O-(trans2-methoxy cyclopentyl)--2'-O-(TMCPL)
[0052] 2'-O-(trans2-ureido cyclohexyl)--2'-O-(TUCHL)
[0053] 2'-O-(trans2-methoxyphenyl)--2'-O-(2MP)
[0054] Structural details for duplexes incorporating such
2-O-substituents were analyzed using the described AMBER force
field program on the Indigo2 SGI machine. The simulated structure
maintained a stable A-form geometry throughout the duration of the
simulation. The presence of the 2' substitutions locked the sugars
in the C3'-endo conformation.
[0055] The simulation for the TMCHL modification revealed that the
2'-O-(TMCHL) side chains have a direct interaction with water
molecules solvating the duplex. The oxygen atoms in the
2'-O-(TMCHL) side chain are capable of forming a water-mediated
interaction with the 3' oxygen of the phosphate backbone. The
presence of the two oxygen atoms in the 2'-O-(TMCHL) side chain
gives rise to favorable gauche interactions. The barrier for
rotation around the O--C--C--O torsion is made even larger by this
novel modification. The preferential preorganization in an A-type
geometry increases the binding affinity of the 2'-O-(TMCHL) to the
target RNA. The locked side chain conformation in the 2'-O-(TMCHL)
group created a more favorable pocket for binding water molecules.
The presence of these water molecules played a key role in holding
the side chains in the preferable gauche conformation. While not
wishing to be bound by theory, the bulk of the substituent, the
diequatorial orientation of the substituents in the cyclohexane
ring, the water of hydration and the potential for trapping of
metal ions in the conformation generated will additionally
contribute to improved binding affinity and nuclease resistance of
oligonucleotides incorporating nucleosides having this
2'-O-modification.
[0056] As described for the TMCHL modification above, identical
computer simulations of the 2'-O-(TMCPL), the 2'-O-(2MP) and
2'-O-(TUCHL) modified oligonucleotides in aqueous solution also
illustrate that stable A-form geometry will be maintained
throughout the duration of the simulation. The presence of the 2'
substitution will lock the sugars in the C3'-endo conformation and
the side chains will have direct interaction with water molecules
solvating the duplex. The oxygen atoms in the respective side
chains are capable of forming a water-mediated interaction with the
3' oxygen of the phosphate backbone. The presence of the two oxygen
atoms in the respective side chains give rise to the favorable
gauche interactions. The barrier for rotation around the respective
O--C--C--O torsions will be made even larger by respective
modification. The preferential preorganization in A-type geometry
will increase the binding affinity of the respective 2'-O-modified
oligonucleotides to the target RNA. The locked side chain
conformation in the respective modifications will create a more
favorable pocket for binding water molecules. The presence of these
water molecules plays a key role in holding the side chains in the
preferable gauche conformation. The bulk of the substituent, the
diequatorial orientation of the substituents in their respective
rings, the water of hydration and the potential trapping of metal
ions in the conformation generated will all contribute to improved
binding affinity and nuclease resistance of oligonucleotides
incorporating nucleosides having these respective
2'-O-modification.
[0057] Ribose conformations in C2'-modified nucleosides containing
S-methyl groups were examined. To understand the influence of
2'-O-methyl and 2'-S-methyl groups on the conformation of
nucleosides, we evaluated the relative energies of the 2'-O-- and
2'-S-methylguanosine, along with normal deoxyguanosine and
riboguanosine, starting from both C2'-endo and C3'-endo
conformations using ab initio quantum mechanical calculations. All
the structures were fully optimized at HF/6-31G* level and single
point energies with electron-correlation were obtained at the
MP2/6-31G*//HF/6-31G* level. As shown in Table 9, the C2'-endo
conformation of deoxyguanosine is estimated to be 0.6 kcal/mol more
stable than the C3'-endo conformation in the gas-phase. The
conformational preference of the C2'-endo over the C3'-endo
conformation appears to be less dependent upon electron correlation
as revealed by the MP2/6-31G*//HF/6-31G* values which also predict
the same difference in energy. The opposite trend is noted for
riboguanosine. At the HF/6-31G* and MP2/6-31G*//HF/6-31G* levels,
the C3'-endo form of riboguanosine is shown to be about 0.65 and
1.41 kcal/mol more stable than the C2'endo form, respectively.
10TABLE 9 Relative energies* of the C3'-endo and C2'-endo
conformations of representative nucleosides HF/6-31G MP2/6-31-G
Continuum Model Amber dG 0.60 0.56 0.88 0.65 rG -0.65 -1.41 -0.28
-2.09 2'-O--MeG -0.89 -1.79 -0.36 -0.86 2'-S--MeG 2.55 1.41 3.16
2.43 *energies are in kcal/mol relative to the C2'-endo
conformation
[0058] Table 9 also includes the relative energies of
2'-O-methylguanosine and 2'-S-methylguanosine in C2'-endo and
C3'-endo conformation. This data indicates the electronic nature of
C2'-substitution has a significant impact on the relative stability
of these conformations. Substitution of the 2'-O-methyl group
increases the preference for the C3'-endo conformation (when
compared to riboguanosine) by about 0.4 kcal/mol at both the
HF/6-31G* and MP2/6-31G*//HF/6-31G* levels. In contrast, the
2'-S-methyl group reverses the trend. The C2'-endo conformation is
favored by about 2.6 kcal/mol at the HF/6-31G* level, while the
same difference is reduced to 1.41 kcal/mol at the
MP2/6-31G*//HF/6-31G* level. For comparison, and also to evaluate
the accuracy of the molecular mechanical force-field parameters
used for the 2'-O-methyl and 2'-S-methyl substituted nucleosides,
we have calculated the gas phase energies of the nucleosides. The
results reported in Table 9 indicate that the calculated relative
energies of these nucleosides compare qualitatively well with the
ab initio calculations.
[0059] Additional calculations were also performed to gauge the
effect of solvation on the relative stability of nucleoside
conformations. The estimated solvation effect using HF/6-31G*
geometries confirms that the relative energetic preference of the
four nucleosides in the gas-phase is maintained in the aqueous
phase as well (Table 9). Solvation effects were also examined using
molecular dynamics simulations of the nucleosides in explicit
water. From these trajectories, one can observe the predominance of
C2'-endo conformation for deoxyriboguanosine and
2'-S-methylriboguanosine while riboguanosine and
2'-O-methylriboguanosine prefer the C3'-endo conformation. These
results are in much accord with the available NMR results on
2'-S-methylribonucleosides. NMR studies of sugar puckering
equilibrium using vicinal spin-coupling constants have indicated
that the conformation of the sugar ring in 2'-S-methylpyrimidine
nucleosides show an average of >75% S-character, whereas the
corresponding purine analogs exhibit an average of >90% S-pucker
(Fraser, A., Wheeler, P., Cook, P. D. and Sanghvi, Y. S., J.
Heterocycl. Chem., 1993, 30, 1277-1287). It was observed that the
2'-S-methyl substitution in deoxynucleoside confers more
conformational rigidity to the sugar conformation when compared
with deoxyribonucleosides.
[0060] Structural features of DNA:RNA, OMe-DNA:RNA and SMe-DNA:RNA
hybrids were also observed. The average RMS deviation of the
DNA:RNA structure from the starting hybrid coordinates indicate the
structure is stabilized over the length of the simulation with an
approximate average RMS deviation of 1.0 .ANG.. This deviation is
due, in part, to inherent differences in averaged structures (i.e.
the starting conformation) and structures at thermal equilibrium.
The changes in sugar pucker conformation for three of the central
base pairs of this hybrid are in good agreement with the
observations made in previous NMR studies. The sugars in the RNA
strand maintain very stable geometries in the C3'-endo conformation
with ring pucker values near 0.degree.. In contrast, the sugars of
the DNA strand show significant variability.
[0061] The average RMS deviation of the OMe-DNA:RNA is
approximately 1.2 .ANG. from the starting A-form conformation;
while the SMe-DNA:RNA shows a slightly higher deviation
(approximately 1.8 .ANG.) from the starting hybrid conformation.
The SMe-DNA strand also shows a greater variance in RMS deviation,
suggesting the S-methyl group may induce some structural
fluctuations. The sugar puckers of the RNA complements maintain
C3'-endo puckering throughout the simulation. As expected from the
nucleoside calculations, however, significant differences are noted
in the puckering of the OMe-DNA and SMe-DNA strands, with the
former adopting C3'-endo, and the latter, C1'-exo/C2'-endo
conformations.
[0062] An analysis of the helicoidal parameters for all three
hybrid structures has also been performed to further characterize
the duplex conformation. Three of the more important axis-basepair
parameters that distinguish the different forms of the duplexes,
X-displacement, propeller twist, and inclination, are reported in
Table 10. Usually, an X-displacement near zero represents a B-form
duplex; while a negative displacement, which is a direct measure of
deviation of the helix from the helical axis, makes the structure
appear more A-like in conformation. In A-form duplexes, these
values typically vary from -4 .ANG. to -5 .ANG.. In comparing these
values for all three hybrids, the SMe_DNA:RNA hybrid shows the most
deviation from the A-form value, the OMe_DNA:RNA shows the least,
and the DNA:RNA is intermediate. A similar trend is also evident
when comparing the inclination and propeller twist values with
ideal A-form parameters. These results are further supported by an
analysis of the backbone and glycosidic torsion angles of the
hybrid structures. Glycosidic angles (X) of A-form geometries, for
example, are typically near -159.degree. while B form values are
near -102.degree.. These angles are found to be -162.degree.,
-133.degree., and -108.degree. for the OMe-DNA, DNA, and SMe-DNA
strands, respectively. All RNA complements adopt an X angle close
to -160.degree.. In addition, "crankshaft" transitions were also
noted in the backbone torsions of the central UpU steps of the RNA
strand in the SMe-DNA:RNA and DNA;RNA hybrids. Such transitions
suggest some local conformational changes may occur to relieve a
less favorable global conformation. Taken overall, the results
indicate the amount of A-character decreases as
OMe-DNA:RNA>DNA:RNA>SMe-DNA:RNA, with the latter two adopting
more intermediate conformations when compared to A- and B-form
geometries.
11TABLE 10 Average helical parameters derived from the last 500 ps
of simulation time (canonical A-and B-form values are given for
comparison) Helicoidal B-DNA OMe_DNA: SMe_DNA: Parameter
B-DNA(x-ray) (fibre) A-DNA(fibre) DNA:RNA RNA RNA X-disp 1.2 0.0
-5.3 -4.5 -5.4 -3.5 Inclination -2.3 1.5 20.7 11.6 15.1 0.7
Propeller -16.4 -13.3 -7.5 -12.7 -15.8 -10.3
[0063] Stability of C2'-modified DNA:RNA hybrids was determined.
Although the overall stability of the DNA:RNA hybrids depends on
several factors including sequence-dependencies and the purine
content in the DNA or RNA strands DNA:RNA hybrids are usually less
stable than RNA:RNA duplexes and, in some cases, even less stable
than DNA:DNA duplexes. Available experimental data attributes the
relatively lowered stability of DNA:RNA hybrids largely to its
intermediate conformational nature between DNA:DNA (B-family) and
RNA:RNA (A-family) duplexes. The overall thermodynamic stability of
nucleic acid duplexes may originate from several factors including
the conformation of backbone, base-pairing and stacking
interactions. While it is difficult to ascertain the individual
thermodynamic contributions to the overall stabilization of the
duplex, it is reasonable to argue that the major factors that
promote increased stability of hybrid duplexes are better stacking
interactions (electrostatic .pi.-.pi. interactions) and more
favorable groove dimensions for hydration. The C2'-S-methyl
substitution has been shown to destabilize the hybrid duplex. The
notable differences in the rise values among the three hybrids may
offer some explanation. While the 2'-S-methyl group has a strong
influence on decreasing the base-stacking through high rise values
(.about.3.2 .ANG.), the 2'-O-methyl group makes the overall
structure more compact with a rise value that is equal to that of
A-form duplexes (.about.2.6 .ANG.). Despite its overall A-like
structural features, the SMe_DNA:RNA hybrid structure possesses an
average rise value of 3.2 .ANG. which is quite close to that of
B-family duplexes. In fact, some local base-steps (CG steps) may be
observed to have unusually high rise values (as high as 4.5 .ANG.).
Thus, the greater destabilization of 2'-S-methyl substituted
DNA:RNA hybrids may be partly attributed to poor stacking
interactions.
[0064] It has been postulated that RNase H binds to the minor
groove of RNA:DNA hybrid complexes, requiring an intermediate minor
groove width between ideal A- and B-form geometries to optimize
interactions between the sugar phosphate backbone atoms and RNase
H. A close inspection of the averaged structures for the hybrid
duplexes using computer simulations reveals significant variation
in the minor groove width dimensions as shown in Table 11. Whereas
the O-methyl substitution leads to a slight expansion of the minor
groove width when compared to the standard DNA:RNA complex, the
S-methyl substitution leads to a general contraction (approximately
0.9 .ANG.). These changes are most likely due to the preferred
sugar puckering noted for the antisense strands which induce either
A- or B-like single strand conformations. In addition to minor
groove variations, the results also point to potential differences
in the steric makeup of the minor groove. The O-methyl group points
into the minor groove while the S-methyl is directed away towards
the major groove. Essentially, the S-methyl group has flipped
through the bases into the major groove as a consequence of
C2'-endo puckering.
12TABLE 11 Minor groove widths averaged over the last 500 ps of
simulation time Phosphate OMe_DNA: SMe_DNA: DNA:RNA RNA:RNA
Distance DNA:RNA RNA RNA (B-form) (A-form) P5-P20 15.27 16.82 13.73
14.19 17.32 P6-P19 15.52 16.79 15.73 12.66 17.12 P7-P18 15.19 16.40
14.08 11.10 16.60 P8-P17 15.07 16.12 14.00 10.98 16.14 P9-P16 15.29
16.25 14.98 11.65 16.93 P10-P15 15.37 16.57 13.92 14.05 17.69
[0065] In addition to the modifications described above, the
nucleotides of the chimeric oligomeric compounds of the invention
can have a variety of other modification so long as these other
modifications do not significantly detract from the properties
described above. Thus, for nucleotides that are incorporated into
oligonucleotides of the invention, these nucleotides can have sugar
portions that correspond to naturally-occurring sugars or modified
sugars. Representative modified sugars include carbocyclic or
acyclic sugars, sugars having substituent groups at their 2'
position, sugars having substituent groups at their 3' position,
and sugars having substituents in place of one or more hydrogen
atoms of the sugar. Other altered base moieties and altered sugar
moieties are disclosed in U.S. Pat. No. 3,687,808 and PCT
application PCT/US89/02323.
[0066] 2'-Endo Regions
[0067] A number of different nucleosides can be used independently
or exclusively to create one or more of the C2'-endo regions to
prepare chimeric oligomeric compounds of the present invention. For
the purpose of the present invention the terms 2'-endo and C2'-endo
are meant to include O4'-endo and 2'-deoxy nucleosides. 2'-Deoxy
nucleic acids prefer both C2'-endo sugar pucker and O4'-endo sugar,
i.e., also known as Southern pucker, which is thought to impart a
less stable B-form geometry (Sanger, W. (1984) Principles of
Nucleic Acid Structure, Springer-Verlag, New York, N.Y. and Berger,
et. al., Nucleic Acids Research, 1998, 26, 2473-2480). The
2'-deoxyribonucleoside is one suitable nucleoside for the 2'-endo
regions but all manner of nucleosides known in the art that have a
preference for 2'-endo sugar conformational geometry are amenable
to the present invention. Such nucleosides include without
limitation 2'-modified ribonucleosides such as for example:
2'-SCH.sub.3, 2'-NH.sub.2, 2'-NH(C.sub.1-C.sub.2 alkyl),
2'-N(C.sub.1-C.sub.2 alkyl).sub.2, 2'-CF.sub.3, 2'.dbd.CH.sub.2,
2'.dbd.CHF, 2'.dbd.CF.sub.2, 2'-CH.sub.3, 2'-C.sub.2H.sub.5,
2'-CH.dbd.CH.sub.2 or 2'-C.ident.CH. Also amenable to the present
invention are modified 2'-arabinonucleosides including without
limitation: 2'-CN, 2'-F, 2'-Cl, 2'-Br, 2'-N.sub.3 (azido), 2'-OH,
2'-O--CH.sub.3 or 2'-dehydro-2'-CH.sub.3.
[0068] Suitable sugar modifications for the 2'-endo regions of the
present invention include without limitation 2'-deoxy-2'-S-methyl,
2'-deoxy-2'-methyl, 2'-deoxy-2'-amino, 2'-deoxy-2'-mono or dialkyl
substituted amino, 2'-deoxy-2'-fluoromethyl,
2'-deoxy-2'-difluoromethyl, 2'-deoxy-2'-trifluoromethyl,
2'-deoxy-2'-methylene, 2'-deoxy-2'-fluoromethylene,
2'-deoxy-2'-difluoromethylene, 2'-deoxy-2'-ethyl,
2'-deoxy-2'-ethylene and 2'-deoxy-2'-acetylene. These nucleotides
can alternately be described as 2'-SCH.sub.3 ribonucleotide,
2'-CH.sub.3 ribonucleotide, 2'-NH.sub.2 ribonucleotide
2'-NH(C.sub.1-C.sub.2 alkyl) ribonucleotide, 2'-N(C.sub.1-C.sub.2
alkyl).sub.2 ribonucleotide, 2'-CH.sub.2F ribonucleotide,
2'-CHF.sub.2 ribonucleotide, 2'-CF.sub.3 ribonucleotide,
2'.dbd.CH.sub.2 ribonucleotide, 2'=CHF ribonucleotide,
2'.dbd.CF.sub.2 ribonucleotide, 2'-C.sub.2H.sub.5 ribonucleotide,
2'-CH.dbd.CH.sub.2 ribonucleotide, 2'-CCH ribonucleotide. A further
useful sugar modification is one having a ring located on the
ribose ring in a cage-like structure including
3',O,4'-C-methyleneribonucleotides. Such cage-like structures will
physically fix the ribose ring in the desired conformation.
[0069] Additionally, suitable sugar modifications for the 2'-endo
regions of the present invention include without limitation are
arabino nucleotides having 2'-deoxy-2'-cyano, 2'-deoxy-2'-fluoro,
2'-deoxy-2'-chloro, 2'-deoxy-2'-bromo, 2'-deoxy-2'-azido,
2'-methoxy and the unmodified arabino nucleotide (that includes a
2'-OH projecting upwards towards the base of the nucleotide). These
arabino nucleotides can alternately be described as 2'-CN arabino
nucleotide, 2'-F arabino nucleotide, 2'-Cl arabino nucleotide,
2'-Br arabino nucleotide, 2'-N.sub.3 arabino nucleotide,
2'-O--CH.sub.3 arabino nucleotide and arabino nucleotide.
[0070] Such nucleotides are linked together via phosphorothioate,
phosphorodithioate, boranophosphate or phosphodiester linkages.
Particularly suitable is the phosphorothioate linkage.
[0071] Internucleoside Linkages
[0072] Specific examples of chimeric oligomeric compounds useful in
this invention include oligonucleotides containing modified e.g.
non-naturally occurring internucleoside linkages. As defined in
this specification, oligonucleotides having modified
internucleoside linkages include internucleoside linkages that
retain a phosphorus atom and internucleoside linkages that do not
have a phosphorus atom. For the purposes of this specification, and
as sometimes referenced in the art, modified oligonucleotides that
do not have a phosphorus atom in their internucleoside backbone can
also be considered to be oligonucleosides.
[0073] Modified internucleoside linkages containing a phosphorus
atom therein include, for example, phosphorothioates, chiral
phosphorothioates, phosphorodithioates, phosphotriesters,
aminoalkylphosphotriesters, methyl and other alkyl phosphonates
including 3'-alkylene phosphonates, 5'-alkylene phosphonates and
chiral phosphonates, phosphinates, phosphoramidates including
3'-amino phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, selenophosphates and boranophosphates
having normal 3'-5' linkages, 2'-5' linked analogs of these, and
those having inverted polarity wherein one or more internucleotide
linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage.
Oligonucleotides having inverted polarity comprise a single 3' to
3' linkage at the 3'-most internucleotide linkage i.e. a single
inverted nucleoside residue which may be abasic (the nucleobase is
missing or has a hydroxyl group in place thereof). Various salts,
mixed salts and free acid forms are also included.
[0074] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555;
5,527,899; 5,721,218; 5,672,697 and 5,625,050, each of which is
herein incorporated by reference.
[0075] In other embodiments of the invention, chimeric oligomeric
compounds include one or more phosphorothioate and/or heteroatom
internucleoside linkages, in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester internucleotide linkage is represented as
--O--P(.dbd.O)(OH)--O--CH.sub.2- --]. The MMI type internucleoside
linkages are disclosed in the above referenced U.S. Pat. No.
5,489,677. Amide internucleoside linkages are disclosed in the
above referenced U.S. Pat. No. 5,602,240.
[0076] Modified internucleoside linkages that do not include a
phosphorus atom therein include those formed by short chain alkyl
or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl
or cycloalkyl internucleoside linkages, or one or more short chain
heteroatomic or heterocyclic internucleoside linkages. These
include those having morpholino linkages (formed in part from the
sugar portion of a nucleoside); siloxane backbones; sulfide,
sulfoxide and sulfone backbones; formacetyl and thioformacetyl
backbones; methylene formacetyl and thioformacetyl backbones;
riboacetyl backbones; alkene containing backbones; sulfamate
backbones; methyleneimino and methylenehydrazino backbones;
sulfonate and sulfonamide backbones; amide backbones; and others
having mixed N, O, S and CH.sub.2 component parts.
[0077] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608;
5,646,269 and 5,677,439, each of which is herein incorporated by
reference.
[0078] Conjugate Groups
[0079] An additional substitution that can be appended to the
oligomeric compounds of the invention involves the linkage of one
or more moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the resulting oligomeric
compounds. In one embodiment such modified oligomeric compounds are
prepared by covalently attaching conjugate groups to functional
groups such as hydroxyl or amino groups. Conjugate groups of the
invention include intercalators, reporter molecules, polyamines,
polyamides, polyethylene glycols, polyethers, groups that enhance
the pharmacodynamic properties of oligomers, and groups that
enhance the pharmacokinetic properties of oligomers. Typical
conjugates groups include cholesterols, lipids, phospholipids,
biotin, phenazine, folate, phenanthridine, anthraquinone, acridine,
fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance
the pharmacodynamic properties, in the context of this invention,
include groups that improve oligomer uptake, enhance oligomer
resistance to degradation, and/or strengthen sequence-specific
hybridization with RNA. Groups that enhance the pharmacokinetic
properties, in the context of this invention, include groups that
improve oligomer uptake, distribution, metabolism or excretion.
Representative conjugate groups are disclosed in International
Patent Application PCT/US92/09196, filed Oct. 23, 1992 the entire
disclosure of which is incorporated herein by reference. Conjugate
moieties include but are not limited to lipid moieties such as a
cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA,
1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med.
Chem. Let., 1994, 4, 1053-1060), a thioether, e.g.,
hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992,
660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3,
2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res.,
1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or
undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10,
1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330;
Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid,
e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-gly- cero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937.
[0080] The chimeric oligomeric compounds of the invention may also
be conjugated to active drug substances, for example, aspirin,
warfarin, phenylbutazone, ibuprofen, naproxen, suprofen, fenbufen,
ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine,
2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a
benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a
barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an
antibacterial or an antibiotic. Oligonucleotide-drug conjugates and
their preparation are described in U.S. patent application Ser. No.
09/334,130 which is incorporated herein by reference in its
entirety.
[0081] Representative United States patents that teach the
preparation of such oligonucleotide conjugates include, but are not
limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, each of which is herein incorporated by
reference.
[0082] Oligomeric compounds used in the compositions of the present
invention can also be modified to have one or more stabilizing
groups that are generally attached to one or both termini of
oligomeric compounds to enhance properties such as for example
nuclease stability. Included in stabilizing groups are cap
structures. By "cap structure or terminal cap moiety" is meant
chemical modifications, which have been incorporated at either
terminus of oligonucleotides (see for example Wincott et al., WO
97/26270, incorporated by reference herein). These terminal
modifications protect the oligomeric compounds having terminal
nucleic acid molecules from exonuclease degradation, and can help
in delivery and/or localization within a cell. The cap can be
present at the 5'-terminus (5'-cap) or at the 3'-terminus (3'-cap)
or can be present on both termini. In non-limiting examples, the
5'-cap includes inverted abasic residue (moiety), 4',5'-methylene
nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide, 4'-thio
nucleotide, carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide;
L-nucleotides; alpha-nucleotides; modified base nucleotide;
phosphorodithioate linkage; threo-pentofuranosyl nucleotide;
acyclic 3',4'-seco nucleotide; acyclic 3,4-dihydroxybutyl
nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3'-3'-inverted
nucleotide moiety; 3'-3'-inverted abasic moiety; 3'-2'-inverted
nucleotide moiety; 3'-2'-inverted abasic moiety; 1,4-butanediol
phosphate; 3'-phosphoramidate; hexylphosphate; aminohexyl
phosphate; 3'-phosphate; 3'-phosphorothioate; phosphorodithioate;
or bridging or non-bridging methylphosphonate moiety (for more
details see Wincott et al., International PCT publication No. WO
97/26270, which is incorporated by reference herein.
[0083] Particularly suitable 3'-cap structures of the present
invention include, for example 4',5'-methylene nucleotide;
1-(beta-D-erythrofuranos- yl) nucleotide; 4'-thio nucleotide,
carbocyclic nucleotide; 5'-amino-alkyl phosphate;
1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate;
6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl
phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide;
alpha-nucleotide; modified base nucleotide; phosphorodithioate;
threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide;
3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide,
5'-5'-inverted nucleotide moiety; 5'-5'-inverted abasic moiety;
5'-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate;
5'-amino; bridging and/or non-bridging 5'-phosphoramidate,
phosphorothioate and/or phosphorodithioate, bridging or non
bridging methylphosphonate and 5'-mercapto moieties (for more
details see Beaucage and Tyer, 1993, Tetrahedron 49, 1925;
incorporated by reference herein).
[0084] Further 3' and 5'-stabilizing groups that can be used to cap
one or both ends of an oligomeric compound to impart nuclease
stability include those disclosed in WO 03/004602.
[0085] Oligomeric Compounds
[0086] In the context of the present invention, the term
"oligomeric compound" refers to a polymeric structure capable of
hybridizing a region of a nucleic acid molecule. This term includes
oligonucleotides, oligonucleosides, oligonucleotide analogs,
oligonucleotide mimetics and combinations of these. Oligomeric
compounds routinely prepared linearly but can be joined or
otherwise prepared to be circular and may also include branching.
Oligomeric compounds can hybridized to form double stranded
compounds which can be blunt ended or may include overhangs. In
general an oligomeric compound comprises a backbone of linked
momeric subunits where each linked momeric subunit is directly or
indirectly attached to a heterocyclic base moiety. The linkages
joining the monomeric subunits, the sugar moieties or surrogates
and the heterocyclic base moieties can be independently modified
giving rise to a plurality of motifs for the resulting oligomeric
compounds including hemimers, gapmers and chimeras.
[0087] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base moiety. The two most common classes of such
heterocyclic bases are purines and pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to the 2', 3' or 5' hydroxyl moiety of the
sugar. In forming oligonucleotides, the phosphate groups covalently
link adjacent nucleosides to one another to form a linear polymeric
compound. The respective ends of this linear polymeric structure
can be joined to form a circular structure by hybridization or by
formation of a covalent bond, however, open linear structures are
generally suitable. Within the oligonucleotide structure, the
phosphate groups are commonly referred to as forming the
internucleoside linkages of the oligonucleotide. The normal
internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester
linkage.
[0088] In the context of this invention, the term "oligonucleotide"
refers to an oligomer or polymer of ribonucleic acid (RNA) or
deoxyribonucleic acid (DNA). This term includes oligonucleotides
composed of naturally-occurring nucleobases, sugars and covalent
internucleoside linkages. The term "oligonucleotide analog" refers
to oligonucleotides that have one or more non-naturally occurring
portions which function in a similar manner to oligonulceotides.
Such non-naturally occurring oligonucleotides are often desired,
the naturally occurring forms because of desirable properties such
as, for example, enhanced cellular uptake, enhanced affinity for
nucleic acid target and increased stability in the presence of
nucleases.
[0089] In the context of this invention, the term "oligonucleoside"
refers to nucleosides that are joined by internucleoside linkages
that do not have phosphorus atoms. Internucleoside linkages of this
type include short chain alkyl, cycloalkyl, mixed heteroatom alkyl,
mixed heteroatom cycloalkyl, one or more short chain heteroatomic
and one or more short chain heterocyclic. These internucleoside
linkages include but are not limited to siloxane, sulfide,
sulfoxide, sulfone, acetyl, formacetyl, thioformacetyl, methylene
formacetyl, thioformacetyl, alkeneyl, sulfamate; methyleneimino,
methylenehydrazino, sulfonate, sulfonamide, amide and others having
mixed N, O, S and CH.sub.2 component parts.
[0090] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608;
5,646,269 and 5,677,439, each of which is herein incorporated by
reference.
[0091] Further included in the present invention are oligomeric
compounds such as antisense oligomeric compounds, antisense
oligonucleotides, alternate splicers and other oligomeric compounds
which hybridize to at least a portion of the target nucleic acid.
As such, these oligomeric compounds may be introduced in the form
of single-stranded, double-stranded, circular or hairpin oligomeric
compounds and may contain structural elements such as internal or
terminal bulges or loops or mismatches. Once introduced to a
system, the oligomeric compounds of the invention may elicit the
action of one or more enzymes or structural proteins to effect
modification of the target nucleic acid.
[0092] One non-limiting example of such an enzyme is RNAse H, a
cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. It is known in the art that single-stranded antisense
oligomeric compounds which are "DNA-like" or have "DNA-like"
regions elicit RNAse H. Activation of RNase H, therefore, results
in cleavage of the RNA target, thereby greatly enhancing the
efficiency of oligonucleotide-mediated inhibition of gene
expression. Similar roles have been postulated for other
ribonucleases such as those in the RNase III and ribonuclease L
family of enzymes.
[0093] While one form of antisense acting chimeric oligomeric
compound is a single-stranded chimeric oligonucleotide, in many
species the introduction of double-stranded structures, such as
double-stranded RNA (dsRNA) molecules, has been shown to induce
potent and specific antisense-mediated reduction of the function of
a gene or its associated gene products. This phenomenon, which has
been designated RNA interference (RNAi), occurs in both plants and
animals and is believed to have an evolutionary connection to viral
defense and transposon silencing. The term RNAi has been
generalized to mean antisense-mediated gene silencing involving the
introduction of dsRNA leading to the sequence-specific reduction of
endogenous targeted mRNA levels (Fire et al., Nature, 1998, 391,
806-811). It has been shown that it is, in fact, the
single-stranded RNA oligomers of antisense polarity of the dsRNAs
which are the potent inducers of RNAi (Tijsterman et al., Science,
2002, 295, 694-697). The primary interference effects of dsRNAs are
posttranscriptional (Montgomery et al., Proc. Natl. Acad. Sci. USA,
1998, 95, 15502-15507).
[0094] In addition to the modifications described above, the
nucleosides of the oligomeric compounds of the invention can have a
variety of other modifications. These modifications either alone or
in combination with other nucleosides may enhance one or more of
the desired properties described above. Thus, for nucleotides that
are incorporated into oligonucleotides of the invention, these
nucleotides can have sugar portions that correspond to
naturally-occurring sugars or modified sugars. Representative
modified sugars include carbocyclic or acyclic sugars, sugars
having substituent groups at one or more of their 2', 3' or 4'
positions and sugars having substituents in place of one or more
hydrogen atoms of the sugar. Additional nucleosides amenable to the
present invention having altered base moieties and or altered sugar
moieties are disclosed in U.S. Pat. No. 3,687,808 and PCT
application PCT/US89/02323.
[0095] The oligomeric compounds in accordance with this invention
comprise from about 5 to about 80 nucleobases (i.e. from about 5 to
about 80 linked nucleosides). One of ordinary skill in the art will
appreciate that the invention embodies oligomeric compounds of 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57,
58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74,
75, 76, 77, 78, 79, or 80 nucleobases in length, or any sub-range
therewithin.
[0096] In a further embodiment, the oligomeric compounds of the
invention are 5 to 50 nucleobases in length. One of ordinary skill
in the art will appreciate that the invention embodies oligomeric
compounds of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50
nucleobases in length, or any sub-range therewithin.
[0097] In another embodiment, the oligomeric compounds of the
invention are 12 to 50 nucleobases in length. One having ordinary
skill in the art will appreciate that this embodies oligomeric
compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29 or 30 nucleobases in length, or any sub-range
therewithin.
[0098] In another embodiment, the oligomeric compounds of the
invention are 12 to 30 nucleobases in length. One having ordinary
skill in the art will appreciate that this embodies oligomeric
compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,
42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleobases in length, or any
sub-range therewithin.
[0099] In a further embodiment, the oligomeric compounds of the
invention are 13 to 40 nucleobases in length. One having ordinary
skill in the art will appreciate that this embodies oligomeric
compounds of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40
nucleobases in length, or any sub-range therewithin.
[0100] In another embodiment, the oligomeric compounds of the
invention are 15 to 30 nucleobases in length. One having ordinary
skill in the art will appreciate that this embodies oligomeric
compounds of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, or 30 nucleobases in length, or any sub-range
therewithin.
[0101] In another embodiment, the oligomeric compounds of the
invention are 15 to 25 nucleobases in length. One having ordinary
skill in the art will appreciate that this embodies oligomeric
compounds of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25
nucleobases in length, or any sub-range therewithin.
[0102] In a further embodiment, the oligomeric compounds of the
invention are 21 to 25 nucleobases in length. One having ordinary
skill in the art will appreciate that this embodies oligomeric
compounds of 21, 22, 23, 24 or 25 nucleobases in length, or any
sub-range therewithin.
[0103] Particularly suitable oligomeric compounds are
oligonucleotides comprising from about 12 to about 50 nucleobases,
from about 13 to 40 nucleobases, or from about 15 to about 30
nucleobases.
[0104] Oligomer Synthesis
[0105] Oligomerization of modified and unmodified nucleosides is
performed according to literature procedures for DNA (Protocols for
Oligonucleotides and Analogs, Ed. Agrawal (1993), Humana Press)
and/or RNA (Scaringe, Methods (2001), 23, 206-217. Gait et al.,
Applications of Chemically synthesized RNA in RNA:Protein
Interactions, Ed. Smith (1998), 1-36. Gallo et al., Tetrahedron
(2001), 57, 5707-5713) synthesis as appropriate. In addition
specific protocols for the synthesis of oligomeric compounds of the
invention are illustrated in the examples below.
[0106] The oligomeric compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0107] The present invention is also useful for the preparation of
oligomeric compounds incorporating at least one 2'-O-protected
nucleoside. After incorporation and appropriate deprotection the
2'-O-protected nucleoside will be converted to a ribonucleoside at
the position of incorporation. The number and position of the
2-ribonucleoside units in the final oligomeric compound can vary
from one at any site or the strategy can be used to prepare up to a
full 2'-OH modified oligomeric compound. All 2'-O-protecting groups
amenable to the synthesis of oligomeric compounds are included in
the present invention. In general a protected nucleoside is
attached to a solid support by for example a succinate linker. Then
the oligonucleotide is elongated by repeated cycles of deprotecting
the 5'-terminal hydroxyl group, coupling of a further nucleoside
unit, capping and oxidation (alternatively sulfurization). In a
more frequently used method of synthesis the completed
oligonucleotide is cleaved from the solid support with the removal
of phosphate protecting groups and exocyclic amino protecting
groups by treatment with an ammonia solution. Then a further
deprotection step is normally required for the more specialized
protecting groups used for the protection of 2'-hydroxyl groups
which will give the fully deprotected oligonucleotide.
[0108] A large number of 2'-O-protecting groups have been used for
the synthesis of oligoribonucleotides but over the years more
effective groups have been discovered. The key to an effective
2'-O-protecting group is that it is capable of selectively being
introduced at the 2'-O-position and that it can be removed easily
after synthesis without the formation of unwanted side products.
The protecting group also needs to be inert to the normal
deprotecting, coupling, and capping steps required for
oligoribonucleotide synthesis. Some of the protecting groups used
initially for oligoribonucleotide synthesis included
tetrahydropyran-1-yl and 4-methoxytetrahydropyran-4-yl. These two
groups are not compatible with all 5'-O-protecting groups so
modified versions were used with 5'-DMT groups such as
1-(2-fluorophenyl)-4-methoxypiperidi- n-4-yl (Fpmp). Reese has
identified a number of piperidine derivatives (like Fpmp) that are
useful in the synthesis of oligoribonucleotides including
1-[(chloro-4-methyl)phenyl]-4'-methoxypiperidin-4-yl (Reese et al.,
Tetrahedron Lett., 1986, (27), 2291). Another approach was to
replace the standard 5'-DMT (dimethoxytrityl) group with protecting
groups that were removed under non-acidic conditions such as
levulinyl and 9-fluorenylmethoxycarbonyl. Such groups enable the
use of acid labile 2'-protecting groups for oligoribonucleotide
synthesis. Another more widely used protecting group initially used
for the synthesis of oligoribonucleotides was the
t-butyldimethylsilyl group (Ogilvie et al., Tetrahedron Lett.,
1974, 2861; Hakimelahi et al., Tetrahedron Lett., 1981, (22), 2543;
and Jones et al., J. Chem. Soc. Perkin I., 2762). The
2'-O-protecting groups can require special reagents for their
removal such as for example the t-butyldimethylsilyl group is
normally removed after all other cleaving/deprotecting steps by
treatment of the oligomeric compound with tetrabutylammonium
fluoride (TBAF).
[0109] One group of researchers examined a number of
2'-O-protecting groups (Pitsch, S., Chimia, 2001, (55), 320-324.)
The group examined fluoride labile and photolabile protecting
groups that are removed using moderate conditions. One photolabile
group that was examined was the [2-(nitrobenzyl)oxy]methyl (nbm)
protecting group (Schwartz et al., Bioorg. Med. Chem. Lett., 1992,
(2), 1019.) Other groups examined included a number structurally
related formaldehyde acetal-derived, 2'-O-protecting groups. Also
prepared were a number of related protecting groups for preparing
2'-O-alkylated nucleoside phosphoramidites including
2'-O-[(triisopropylsilyl)oxy]methyl
(2'-O--CH.sub.2--O--Si(iPr).sub.3, TOM). One 2'-O-protecting group
that was prepared to be used orthogonally to the TOM group was
2'-O-[(R)-1-(2-nitrophenyl)ethyloxy)methyl]((R)-mnbm- ).
[0110] Another strategy using a fluoride labile 5'-O-protecting
group (non-acid labile) and an acid labile 2'-O-protecting group
has been reported (Scaringe, Stephen A., Methods, 2001, (23)
206-217). A number of possible silyl ethers were examined for
5'-O-protection and a number of acetals and orthoesters were
examined for 2'-O-protection. The protection scheme that gave the
best results was 5'-O-silyl ether-2'-ACE
(5'-O-bis(trimethylsiloxy)cyclododecyloxysilyl ether
(DOD)-2'-O-bis(2-acetoxyethoxy)methyl (ACE). This approach uses a
modified phosphoramidite synthesis approach in that some different
reagents are required that are not routinely used for RNA/DNA
synthesis.
[0111] Although a lot of research has focused on the synthesis of
oligoribonucleotides the main RNA synthesis strategies that are
presently being used commercially include
5'-O-DMT-2'-O-t-butyldimethylsilyl (TBDMS),
5'-O-DMT-2'-O-[1(2-fluorophenyl)-4-methoxypiperidin-4-yl](FPMP),
2'-O-[(triisopropylsilyl)oxy]methyl
(2'-O--CH.sub.2--O--Si(iPr).sub.3 (TOM), and the 5'-O-silyl
ether-2'-ACE (5'-O-bis(trimethylsiloxy)cyclodod- ecyloxysilyl ether
(DOD)-2'-O-bis(2-acetoxyethoxy)methyl (ACE). A current list of some
of the major companies currently offering RNA products include
Pierce Nucleic Acid Technologies, Dharmacon Research Inc., Ameri
Biotechnologies Inc., and Integrated DNA Technologies, Inc. One
company, Princeton Separations, is marketing an RNA synthesis
activator advertised to reduce coupling times especially with TOM
and TBDMS chemistries. Such an activator would also be amenable to
the present invention.
[0112] The primary groups being used for commercial RNA synthesis
are:
[0113] TBDMS=5'-O-DMT-2'-O-t-butyldimethylsilyl;
[0114] TOM=2'-O-[(triisopropylsilyl)oxy]methyl;
[0115] DOD/ACE=(5'-O-bis(trimethylsiloxy)cyclododecyloxysilyl
ether-2'-O-bis(2-acetoxyethoxy)methyl
[0116]
FPMP=5'-O-DMT-2'-O-[1(2-fluorophenyl)-4-methoxypiperidin-4-yl].
[0117] All of the aforementioned RNA synthesis strategies are
amenable to the present invention. Strategies that would be a
hybrid of the above e.g. using a 5'-protecting group from one
strategy with a 2'-O-protecting from another strategy is also
amenable to the present invention.
[0118] The preparation of ribonucleotides and oligomeric compounds
having at least one ribonucleoside incorporated and all the
possible configurations falling in between these two extremes are
encompassed by the present invention. The corresponding oligomeric
compounds can be hybridized to further oligomeric compounds
including oligoribonucleotides having regions of complementarity to
form double-stranded (duplexed) oligomeric compounds, which are
commonly referred to as dsRNAs in the art. Such double stranded
oligonucleotide moieties have been shown in the art to modulate
target expression and regulate translation as well as RNA
processsing via an antisense mechanism. Moreover, the
double-stranded moieties may be subject to chemical modifications
(Fire et al., Nature, 1998, 391, 806-811; Timmons and Fire, Nature
1998, 395, 854; Timmons et al., Gene, 2001, 263, 103-112; Tabara et
al., Science, 1998, 282, 430-431; Montgomery et al., Proc. Natl.
Acad. Sci. USA, 1998, 95, 15502-15507; Tuschl et al., Genes Dev.,
1999, 13, 3191-3197; Elbashir et al., Nature, 2001, 411, 494-498;
Elbashir et al., Genes Dev. 2001, 15, 188-200). For example, such
double-stranded moieties have been shown to inhibit the target by
the classical hybridization of antisense strand of the duplex to
the target, thereby triggering enzymatic degradation of the target
(Tijsterman et al., Science, 2002, 295, 694-697). The effects of
nucleoside modifications on RNAi activity are evaluated according
to existing literature (Elbashir et al., Nature (2001), 411,
494-498; Nishikura et al., Cell (2001), 107, 415-416; and Bass et
al., Cell (2000), 101, 235-238.)
[0119] The methods of preparing oligomeric compounds of the present
invention can also be applied in the areas of drug discovery and
target validation.
[0120] Oligomer Mimetics (Oligonucleotide Mimics)
[0121] Another group of oligomeric compounds amenable to the
present invention includes oligonucleotide mimetics. The term
mimetic as it is applied to oligonucleotides is intended to include
oligomeric compounds wherein only the furanose ring or both the
furanose ring and the internucleotide linkage are replaced with
novel groups, replacement of only the furanose ring is also
referred to in the art as being a sugar surrogate. The heterocyclic
base moiety or a modified heterocyclic base moiety is maintained
for hybridization with an appropriate target nucleic acid. One such
oligomeric compound, an oligonucleotide mimetic that has been shown
to have excellent hybridization properties, is referred to as a
peptide nucleic acid (PNA). In PNA oligomeric compounds, the
sugar-backbone of an oligonucleotide is replaced with an amide
containing backbone, in particular an aminoethylglycine backbone.
The nucleobases are retained and are bound directly or indirectly
to aza nitrogen atoms of the amide portion of the backbone.
Representative United States patents that teach the preparation of
PNA oligomeric compounds include, but are not limited to, U.S. Pat.
Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein
incorporated by reference. Further teaching of PNA oligomeric
compounds can be found in Nielsen et al., Science, 1991, 254,
1497-1500.
[0122] PNA has been modified in the art to incorporate numerous
modifications since the basic PNA structure was first prepared. The
basic structure is shown below: 14
[0123] wherein
[0124] Bx is a heterocyclic base moiety;
[0125] T.sub.4 is hydrogen, an amino protecting group,
--C(O)R.sub.5, substituted or unsubstituted C.sub.1-C.sub.12 alkyl,
substituted or unsubstituted C.sub.2-C.sub.12 alkenyl, substituted
or unsubstituted C.sub.2-C.sub.12 alkynyl, alkylsulfonyl,
arylsulfonyl, a chemical functional group, a reporter group, a
conjugate group, a D or L .alpha.-amino acid linked via the
.alpha.-carboxyl group or optionally through the .omega.-carboxyl
group when the amino acid is aspartic acid or glutamic acid or a
peptide derived from D, L or mixed D and L amino acids linked
through a carboxyl group, wherein the substituent groups are
selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl,
nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and
alkynyl;
[0126] T.sub.5 is --OH, --N(Z.sub.1)Z.sub.2, R.sub.5, D or L
.alpha.-amino acid linked via the .alpha.-amino group or optionally
through the co-amino group when the amino acid is lysine or
ornithine or a peptide derived from D, L or mixed D and L amino
acids linked through an amino group, a chemical functional group, a
reporter group or a conjugate group;
[0127] Z.sub.1 is hydrogen, C.sub.1-C.sub.6 alkyl, or an amino
protecting group;
[0128] Z.sub.2 is hydrogen, C.sub.1-C.sub.6 alkyl, an amino
protecting group, --C(.dbd.O)--(CH.sub.2).sub.n-J-Z.sub.3, a D or L
.alpha.-amino acid linked via the .alpha.-carboxyl group or
optionally through the .omega.-carboxyl group when the amino acid
is aspartic acid or glutamic acid or a peptide derived from D, L or
mixed D and L amino acids linked through a carboxyl group;
[0129] Z.sub.3 is hydrogen, an amino protecting group,
--C.sub.1-C.sub.6 alkyl, --C(.dbd.O)--CH.sub.3, benzyl, benzoyl, or
--(CH.sub.2).sub.n--N(H- )Z.sub.1;
[0130] each J is O, S or NH;
[0131] R.sub.5 is a carbonyl protecting group; and
[0132] n is from 2 to about 50.
[0133] Another class of oligonucleotide mimetic that has been
studied is based on linked morpholino units (morpholino nucleic
acid) having heterocyclic bases attached to the morpholino ring. A
number of linking groups have been reported that link the
morpholino monomeric units in a morpholino nucleic acid. One class
of linking groups has been selected to give a non-ionic oligomeric
compound. The non-ionic morpholino-based oligomeric compounds are
less likely to have undesired interactions with cellular proteins.
Morpholino-based oligomeric compounds are non-ionic mimics of
oligonucleotides which are less likely to form undesired
interactions with cellular proteins (Dwaine A. Braasch and David R.
Corey, Biochemistry, 2002, 41(14), 4503-4510). Morpholino-based
oligomeric compounds are disclosed in U.S. Pat. No. 5,034,506,
issued Jul. 23, 1991. The morpholino class of oligomeric compounds
has been prepared having a variety of different linking groups
joining the monomeric subunits.
[0134] Morpholino nucleic acids have been prepared having a variety
of different linking groups (L.sub.2) joining the monomeric
subunits. The basic formula is shown below: 15
[0135] wherein
[0136] T.sub.1 is hydroxyl or a protected hydroxyl;
[0137] T.sub.5 is hydrogen or a phosphate or phosphate
derivative;
[0138] L.sub.2 is a linking group; and
[0139] n is from 2 to about 50.
[0140] A further class of oligonucleotide mimetic is referred to as
cyclohexenyl nucleic acids (CeNA). The furanose ring normally
present in an DNA/RNA molecule is replaced with a cyclohenyl ring.
CeNA DMT protected phosphoramidite monomers have been prepared and
used for oligomeric compound synthesis following classical
phosphoramidite chemistry. Fully modified CeNA oligomeric compounds
and oligonucleotides having specific positions modified with CeNA
have been prepared and studied (see Wang et al., J. Am. Chem. Soc.,
2000, 122, 8595-8602). In general the incorporation of CeNA
monomers into a DNA chain increases its stability of a DNA/RNA
hybrid. CeNA oligoadenylates formed complexes with RNA and DNA
complements with similar stability to the native complexes. The
study of incorporating CeNA structures into natural nucleic acid
structures was shown by NMR and circular dichroism to proceed with
easy conformational adaptation. Furthermore the incorporation of
CeNA into a sequence targeting RNA was stable to serum and able to
activate E. Coli RNase resulting in cleavage of the target RNA
strand.
[0141] The general formula of CeNA is shown below: 16
[0142] wherein
[0143] each Bx is a heterocyclic base moiety;
[0144] T.sub.1 is hydroxyl or a protected hydroxyl; and
[0145] T2 is hydroxyl or a protected hydroxyl.
[0146] Another class of oligonucleotide mimetic (anhydrohexitol
nucleic acid) can be prepared from one or more anhydrohexitol
nucleosides (see, Wouters and Herdewijn, Bioorg. Med. Chem. Lett.,
1999, 9, 1563-1566) and would have the general formula: 17
[0147] Another group of modifications includes nucleosides having
sugar moieties that are bicyclic thereby locking the sugar
conformational geometry. The most studied of these nucleosides
having a bicyclic sugar moiety is locked nucleic acid or LNA. As
can be seen in the structure below the 2'-O-- has been linked via a
methylene group to the 4' carbon. This bridge attaches under the 3'
bonds forcing the sugar ring into a locked 3'-endo conformation
geometry. The linkage can be a methylene (--CH.sub.2--).sub.n group
bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1
for LNA. LNA and LNA analogs display very high duplex thermal
stabilities with complementary DNA and RNA (T.sub.m=+3 to +10 C),
stability towards 3'-exonucleolytic degradation and good solubility
properties.
[0148] An LNA analog that also has been looked at is ENA wherein an
additional methylene group has been added to the bridge between the
2' and the 2' carbons (4'-CH.sub.2--CH.sub.2--O-2', Kaneko et al.,
United States Patent Application Publication No. US 2002/0147332,
Singh et al., Chem. Commun., 1998, 4, 455-456, also see Japanese
Patent Application HEI-11-33863, Feb. 12, 1999).
[0149] In another publication a large genus of nucleosides having
bicyclic sugar moieties is disclosed. The bridging group is
variable as are the points of attachment (Unites States Patent
Application Publication No. U.S. 2002/0068708).
[0150] The basic structure of LNA showing the bicyclic ring system
is shown below: 18
[0151] The conformations of LNAs determined by 2D NMR spectroscopy
have shown that the locked orientation of the LNA nucleotides, both
in single-stranded LNA and in duplexes, constrains the phosphate
backbone in such a way as to introduce a higher population of the
N-type conformation (Petersen et al., J. Mol. Recognit., 2000, 13,
44-53). These conformations are associated with improved stacking
of the nucleobases (Wengel et al., Nucleosides Nucleotides, 1999,
18, 1365-1370).
[0152] LNA has been shown to form exceedingly stable LNA:LNA
duplexes (Koshkin et al., J. Am. Chem. Soc., 1998, 120,
13252-13253). LNA:LNA hybridization was shown to be the most
thermally stable nucleic acid type duplex system, and the
RNA-mimicking character of LNA was established at the duplex level.
Introduction of 3 LNA monomers (T or A) significantly increased
melting points (T.sub.m=+15/+11) toward DNA complements. The
universality of LNA-mediated hybridization has been stressed by the
formation of exceedingly stable LNA:LNA duplexes. The RNA-mimicking
of LNA was reflected with regard to the N-type conformational
restriction of the monomers and to the secondary structure of the
LNA:RNA duplex.
[0153] LNAs also form duplexes with complementary DNA, RNA or LNA
with high thermal affinities. Circular dichroism (CD) spectra show
that duplexes involving fully modified LNA (esp. LNA:RNA)
structurally resemble an A-form RNA:RNA duplex. Nuclear magnetic
resonance (NMR) examination of an LNA:DNA duplex confirmed the
3'-endo conformation of an LNA monomer. Recognition of
double-stranded DNA has also been demonstrated suggesting strand
invasion by LNA. Studies of mismatched sequences show that LNAs
obey the Watson-Crick base pairing rules with generally improved
selectivity compared to the corresponding unmodified reference
strands.
[0154] Novel types of LNA-oligomeric compounds, as well as the
LNAs, are useful in a wide range of diagnostic and therapeutic
applications. Among these are antisense applications, PCR
applications, strand-displacement oligomers, substrates for nucleic
acid polymerases and generally as nucleotide based drugs.
[0155] Potent and nontoxic antisense oligonucleotides containing
LNAs have been described (Wahlestedt et al., Proc. Natl. Acad. Sci.
U.S.A., 2000, 97, 5633-5638.) The authors have demonstrated that
LNAs confer several desired properties to antisense agents. LNA/DNA
copolymers were not degraded readily in blood serum and cell
extracts. LNA/DNA copolymers exhibited potent antisense activity in
assay systems as disparate as G-protein-coupled receptor signaling
in living rat brain and detection of reporter genes in Escherichia
coli. Lipofectin-mediated efficient delivery of LNA into living
human breast cancer cells has also been accomplished.
[0156] The synthesis and preparation of the LNA monomers adenine,
cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along
with their oligomerization, and nucleic acid recognition properties
have been described (Koshkin et al., Tetrahedron, 1998, 54,
3607-3630). LNAs and preparation thereof are also described in WO
98/39352 and WO 99/14226.
[0157] The first analogs of LNA, phosphorothioate-LNA and
2'-thio-LNAs, have also been prepared (Kumar et al., Bioorg. Med.
Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside
analogs containing oligodeoxyribonucleotide duplexes as substrates
for nucleic acid polymerases has also been described (Wengel et
al., PCT International Application WO 98-DK393 19980914).
Furthermore, synthesis of 2'-amino-LNA, a novel conformationally
restricted high-affinity oligonucleotide analog with a handle has
been described in the art (Singh et al., J. Org. Chem., 1998, 63,
10035-10039). In addition, 2'-Amino- and 2'-methylamino-LNA's have
been prepared and the thermal stability of their duplexes with
complementary RNA and DNA strands has been previously reported.
[0158] One group has added an additional methlene group to the LNA
2',4'-bridging group (e.g. 4'-CH.sub.2--CH.sub.2--O-2' (ENA),
Kaneko et al., United States Patent Application Publication No. US
2002/0147332, also see Japanese Patent Application HEI-11-33863,
Feb. 12, 1999).
[0159] Further oligonucleotide mimetics have been prepared to
incude bicyclic and tricyclic nucleoside analogs having the
formulas (amidite monomers shown): 19
[0160] (see Steffens et al., Helv. Chim. Acta, 1997, 80, 2426-2439;
Steffens et al., J. Am. Chem. Soc., 1999, 121, 3249-3255; and
Renneberg et al., J. Am. Chem. Soc., 2002, 124, 5993-6002). These
modified nucleoside analogs have been oligomerized using the
phosphoramidite approach and the resulting oligomeric compounds
containing tricyclic nucleoside analogs have shown increased
thermal stabilities (T.sub.m's) when hybridized to DNA, RNA and
itself. Oligomeric compounds containing bicyclic nucleoside analogs
have shown thermal stabilities approaching that of DNA
duplexes.
[0161] Another class of oligonucleotide mimetic is referred to as
phosphonomonoester nucleic acids incorporate a phosphorus group in
a backbone the backbone. This class of olignucleotide mimetic is
reported to have useful physical and biological and pharmacological
properties in the areas of inhibiting gene expression (antisense
oligonucleotides, ribozymes, sense oligonucleotides and
triplex-forming oligonucleotides), as probes for the detection of
nucleic acids and as auxiliaries for use in molecular biology.
[0162] The general formula (for definitions of Markush variables
see: U.S. Pat. Nos. 5,874,553 and 6,127,346 herein incorporated by
reference in their entirety) is shown below. 20
[0163] Another oligonucleotide mimetic has been reported wherein
the furanosyl ring has been replaced by a cyclobutyl moiety.
[0164] Modified Sugars
[0165] Oligomeric compounds of the invention may also contain one
or more substituted sugar moieties. Oligomeric compounds comprise a
sugar substituent group selected from: OH; F; O--, S--, or N-alkyl;
O--, S--, or N-alkenyl; O--, S-- or N-alkynyl; or O-alkyl-O-alkyl,
wherein the alkyl, alkenyl and alkynyl may be substituted or
unsubstituted C.sub.1 to C.sub.12 alkyl or C.sub.2 to C.sub.12
alkenyl and alkynyl. Particularly suitable are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub- .3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.su- b.3].sub.2, where n and
m are from 1 to about 10. Other oligonucleotides comprise a sugar
substituent group selected from: C.sub.1 to C.sub.12 lower alkyl,
substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl,
O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3,
OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2,
N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl,
aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving
group, a reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. One modification
includes 2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2OCH.sub.3, also
known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv.
Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group. Another
modification includes 2'-dimethylaminooxyetho- xy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples hereinbelow, and
2'-dimethylaminoethoxyethoxy (also known in the art as
2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.3).sub.2.
[0166] Other sugar substituent groups include methoxy
(--O--CH.sub.3), aminopropoxy
(--OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), allyl
(--CH.sub.2--CH.dbd.CH.sub.2), --O-allyl
(--O--CH.sub.2--CH.dbd.CH.sub.2) and fluoro (F). 2'-Sugar
substituent groups may be in the arabino (up) position or ribo
(down) position. One 2'-arabino modification is 2'-F. Similar
modifications may also be made at other positions on the oligomeric
compoiund, particularly the 3' position of the sugar on the 3'
terminal nucleoside or in 2'-5' linked oligonucleotides and the 5'
position of 5' terminal nucleotide. Oligomeric compounds may also
have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugar structures include,
but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747;
and 5,700,920, each of which is herein incorporated by reference in
its entirety.
[0167] Further representative sugar substituent groups include
groups of formula I.sub.a or II.sub.a: 21
[0168] wherein:
[0169] R.sub.b is O, S or NH;
[0170] R.sub.d is a single bond, O, S or C(.dbd.O);
[0171] R.sub.e is C.sub.1-C.sub.12 alkyl, N(R.sub.k)(R.sub.m),
N(R.sub.k)(R.sub.n), N.dbd.C(R.sub.p)(R.sub.q),
N.dbd.C(R.sub.p)(R.sub.r) or has formula III.sub.a; 22
[0172] R.sub.p and R.sub.q are each independently hydrogen or
C.sub.1-C.sub.12 alkyl;
[0173] R.sub.r is --R.sub.x--R.sub.y;
[0174] each R.sub.s, R.sub.t, R.sub.u and R.sub.v is,
independently, hydrogen, C(O)R.sub.w, substituted or unsubstituted
C.sub.1-C.sub.12 alkyl, substituted or unsubstituted
C.sub.2-C.sub.12 alkenyl, substituted or unsubstituted
C.sub.2-C.sub.12 alkynyl, alkylsulfonyl, arylsulfonyl, a chemical
functional group or a conjugate group, wherein the substituent
groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl,
phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and
alkynyl;
[0175] or optionally, R.sub.u and R.sub.v, together form a
phthalimido moiety with the nitrogen atom to which they are
attached;
[0176] each R.sub.w is, independently, substituted or unsubstituted
C.sub.1-C.sub.12alkyl, trifluoromethyl, cyanoethyloxy, methoxy,
ethoxy, t-butoxy, allyloxy, 9-fluorenylmethoxy,
2-(trimethylsilyl)-ethoxy, 2,2,2-trichloroethoxy, benzyloxy,
butyryl, iso-butyryl, phenyl or aryl;
[0177] R.sub.k is hydrogen, a nitrogen protecting group or
--R.sub.x--R.sub.y;
[0178] R.sub.p is hydrogen, a nitrogen protecting group or
--R.sub.x--R.sub.y;
[0179] R.sub.x is a bond or a linking moiety;
[0180] R.sub.y is a chemical functional group, a conjugate group or
a solid support medium;
[0181] each R.sub.m and R.sub.n is, independently, H, a nitrogen
protecting group, substituted or unsubstituted C.sub.1-C.sub.12
alkyl, substituted or unsubstituted C.sub.2-C.sub.12 alkenyl,
substituted or unsubstituted C.sub.2-C.sub.12 alkynyl, wherein the
substituent groups are selected from hydroxyl, amino, alkoxy,
carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl,
aryl, alkenyl, alkynyl; NH.sub.3.sup.+, N(R.sub.u)(R.sub.v),
guanidino and acyl where said acyl is an acid amide or an
ester;
[0182] or R.sub.m and R.sub.n, together, are a nitrogen protecting
group, are joined in a ring structure that optionally includes an
additional heteroatom selected from N and O or are a chemical
functional group;
[0183] R.sub.i is OR.sub.z, SR.sub.z, or N(R.sub.z).sub.2;
[0184] each R.sub.z is, independently, H, C.sub.1-C.sub.8 alkyl,
C.sub.1-C.sub.8 haloalkyl, C(.dbd.NH)N(H)R.sub.u,
C(.dbd.O)N(H)R.sub.u or OC(.dbd.O)N(H)R.sub.u;
[0185] R.sub.f, R.sub.g and R.sub.h comprise a ring system having
from about 4 to about 7 carbon atoms or having from about 3 to
about 6 carbon atoms and 1 or 2 heteroatoms wherein said
heteroatoms are selected from oxygen, nitrogen and sulfur and
wherein said ring system is aliphatic, unsaturated aliphatic,
aromatic, or saturated or unsaturated heterocyclic;
[0186] R.sub.j is alkyl or haloalkyl having 1 to about 10 carbon
atoms, alkenyl having 2 to about 10 carbon atoms, alkynyl having 2
to about 10 carbon atoms, aryl having 6 to about 14 carbon atoms,
N(R.sub.k)(R.sub.m) OR.sub.k, halo, SR.sub.k or CN;
[0187] m.sub.a is 1 to about 10;
[0188] each mb is, independently, 0 or 1;
[0189] mc is 0 or an integer from 1 to 10;
[0190] md is an integer from 1 to 10;
[0191] me is from 0, 1 or 2; and
[0192] provided that when mc is 0, md is greater than 1.
[0193] Representative substituents groups of Formula Ia are
disclosed in U.S. patent application Ser. No. 09/130,973, filed
Aug. 7, 1998, entitled "Capped 2'-Oxyethoxy Oligonucleotides,"
hereby incorporated by reference in its entirety.
[0194] Representative cyclic substituent groups of Formula IIa are
disclosed in U.S. patent application Ser. No. 09/123,108, filed
Jul. 27, 1998, entitled "RNA Targeted 2'-Oligomeric compounds that
are Conformationally Preorganized," hereby incorporated by
reference in its entirety.
[0195] Sugar substituent groups include
O[(CH.sub.2).sub.nO].sub.mCH.sub.3- , O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10.
[0196] Representative guanidino substituent groups that are shown
in formula IIIa disclosed in co-owned U.S. patent application Ser.
No. 09/349,040, entitled "Functionalized Oligomers", filed Jul. 7,
1999, hereby incorporated by reference in its entirety.
[0197] Representative acetamido substituent groups are disclosed in
U.S. Pat. No. 6,147,200 which is hereby incorporated by reference
in its entirety.
[0198] Representative dimethylaminoethyloxyethyl substituent groups
are disclosed in International Patent Application PCT/US99/17895,
entitled "2'-O-Dimethylaminoethyloxy-ethyl-Oligomeric compounds",
filed Aug. 6, 1999, hereby incorporated by reference in its
entirety.
[0199] Modified Nucleobases/Naturally Occurring Nucleobases
[0200] Chimeric oligomeric compounds of the invention may also
include nucleobase (often referred to in the art simply as "base"
or "heterocyclic base moiety") modifications or substitutions. As
used herein, "unmodified" or "natural" nucleobases include the
purine bases adenine (A) and guanine (G), and the pyrimidine bases
thymine (T), cytosine (C) and uracil (U). Modified nucleobases also
referred herein as heterocyclic base moieties include other
synthetic and natural nucleobases such as 5-methylcytosine
(5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine,
2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and
guanine, 2-propyl and other alkyl derivatives of adenine and
guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine,
5-halouracil and cytosine, 5-propynyl (--C.dbd.C--CH.sub.3) uracil
and cytosine and other alkynyl derivatives of pyrimidine bases,
6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil),
4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and
other 8-substituted adenines and guanines, 5-halo particularly
5-bromo, 5-trifluoromethyl and other 5-substituted uracils and
cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine,
2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and
7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
[0201] Heterocyclic base moieties may also include those in which
the purine or pyrimidine base is replaced with other heterocycles,
for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and
2-pyridone. Further nucleobases include those disclosed in U.S. Pat
No. 3,687,808, those disclosed in The Concise Encyclopedia Of
Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I.,
ed. John Wiley & Sons, 1990, those disclosed by Englisch et
al., Angewandte Chemie, International Edition, 1991, 30, 613, and
those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research
and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed.,
CRC Press, 1993. Certain of these nucleobases are particularly
useful for increasing the binding affinity of the oligomeric
compounds of the invention. These include 5-substituted
pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted
purines, including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C.
(Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense
Research and Applications, CRC Press, Boca Raton, 1993, pp.
276-278) and are presently suitable base substitutions, even more
particularly when combined with 2'-O-methoxyethyl sugar
modifications.
[0202] In one aspect of the present invention chimeric oligomeric
compounds are prepared having polycyclic heterocyclic compounds in
place of one or more heterocyclic base moieties. A number of
tricyclic heterocyclic comounds have been previously reported.
These compounds are routinely used in antisense applications to
increase the binding properties of the modified strand to a target
strand. The most studied modifications are targeted to guanosines
hence they have been termed G-clamps or cytidine analogs. Many of
these polycyclic heterocyclic compounds have the general formula:
23
[0203] Representative cytosine analogs that make 3 hydrogen bonds
with a guanosine in a second strand include
1,3-diazaphenoxazine-2-one (R.sub.10=O, R.sub.11--R.sub.14.dbd.H)
(Kurchavov, et al., Nucleosides and Nucleotides, 1997, 16,
1837-1846), 1,3-diazaphenothiazine-2-one (R.sub.10.dbd.S,
R.sub.11--R.sub.14.dbd.H), (Lin, K.-Y.; Jones, R. J.; Matteucci, M.
J. Am. Chem. Soc. 1995, 117, 3873-3874) and
6,7,8,9-tetrafluoro-1,3-diazaphenoxazine-2-one (R.sub.10.dbd.O,
R.sub.11--R.sub.14.dbd.F)(Wang, J.; Lin, K.-Y., Matteucci, M.
Tetrahedron Lett. 1998, 39, 8385-8388). Incorporated into
oligonucleotides these base modifications were shown to hybridize
with complementary guanine and the latter was also shown to
hybridize with adenine and to enhance helical thermal stability by
extended stacking interactions (also see U.S. patent application
entitled "Modified Peptide Nucleic Acids" filed May 24, 2002, Ser.
No. 10/155,920; and U.S. patent application entitled "Nuclease
Resistant Chimeric oligomeric compounds" filed May 24, 2002, Ser.
No. 10/013,295, both of which are herein incorporated by reference
in their entirety).
[0204] Further helix-stabilizing properties have been observed when
a cytosine analog/substitute has an aminoethoxy moiety attached to
the rigid 1,3-diazaphenoxazine-2-one scaffold (R.sub.10.dbd.O,
R.sub.11.dbd.--O--(CH.sub.2).sub.2--NH.sub.2, R.sub.12-14.dbd.H
)(Lin, K.-Y.; Matteucci, M. J. Am. Chem. Soc. 1998, 120,
8531-8532). Binding studies demonstrated that a single
incorporation could enhance the binding affinity of a model
oligonucleotide to its complementary target DNA or RNA with a
.DELTA.T.sub.m of up to 18.degree. relative to 5-methyl cytosine
(dC5.sup.me), which is the highest known affinity enhancement for a
single modification. On the other hand, the gain in helical
stability does not compromise the specificity of the
oligonucleotides. The T.sub.m data indicate an even greater
discrimination between the perfect match and mismatched sequences
compared to dC5.sup.me. It was suggested that the tethered amino
group serves as an additional hydrogen bond donor to interact with
the Hoogsteen face, namely the O6, of a complementary guanine
thereby forming 4 hydrogen bonds. This means that the increased
affinity of G-clamp is mediated by the combination of extended base
stacking and additional specific hydrogen bonding.
[0205] Further tricyclic heterocyclic compounds and methods of
using them that are amenable to the present invention are disclosed
in U.S. Pat. No. 6,028,183 and U.S. Pat. No. 6,007,992, each of
which is incorporated herein in its entirety.
[0206] The enhanced binding affinity of the phenoxazine derivatives
together with their uncompromised sequence specificity makes them
valuable nucleobase analogs for the development of more potent
antisense-based drugs. In fact, promising data have been derived
from in vitro experiments demonstrating that heptanucleotides
containing phenoxazine substitutions are capable to activate
RNaseH, enhance cellular uptake and exhibit an increased antisense
activity (Lin, K-Y; Matteucci, M. J. Am. Chem. Soc. 1998, 120,
8531-8532). The activity enhancement was even more pronounced in
case of G-clamp, as a single substitution was shown to
significantly improve the in vitro potency of a 20 mer
2'-deoxyphosphorothioate oligonucleotides (Flanagan, W. M.; Wolf,
J. J.; Olson, P.; Grant, D.; Lin, K.-Y.; Wagner, R. W.; Matteucci,
M. Proc. Natl. Acad. Sci. USA, 1999, 96, 3513-3518). Nevertheless,
to optimize oligonucleotide design and to better understand the
impact of these heterocyclic modifications on the biological
activity, it is important to evaluate their effect on the nuclease
stability of the oligomers.
[0207] Further modified polycyclic heterocyclic compounds useful as
heterocyclcic bases are disclosed in but not limited to, the above
noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205;
5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,646,269;
5,750,692; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, and U.S.
patent application Ser. No. 09/996,292 filed Nov. 28, 2001, each of
which is herein incorporated by reference.
[0208] Activated Phosphorus Groups
[0209] The compositions of the present invention illustrate the use
of activated phosphorus compositions (e.g. compounds having
activated phosphorus-containing substituent groups) in coupling
reactions. As used herein, the term activated phosphorus
composition includes monomers and oligomers that have an activated
phosphorus-containing substituent group that is reactive with a
hydroxyl group of another monomeric or oligomeric compound to form
a phosphorus-containing internucleotide linkage. Such activated
phosphorus groups contain activated phosphorus atoms in P.sup.III
valence state and are known in the art and include, but are not
limited to, phosphoramidite, H-phosphonate, phosphate triesters and
chiral auxiliaries. One synthetic solid phase synthesis utilizes
phosphoramidites as activated phosphates. The phosphoramidites
utilize P.sup.III chemistry. The intermediate phosphite compounds
are subsequently oxidized to the P.sup.V state using known methods
to yield, in one embodiment, phosphodiester or phosphorothioate
internucleotide linkages. Additional activated phosphates and
phosphites are disclosed in Tetrahedron Report Number 309 (Beaucage
and Iyer, Tetrahedron, 1992, 48, 2223-2311).
[0210] Activated phosphorus groups are useful in the preparation of
a wide range of oligomeric compounds including but not limited to
oligonucleosides and oligonucleotides as well as oligonucleotides
that have been modified or conjugated with other groups at the base
or sugar or both. Also included are oligonucleotide mimetics
including but not limited to peptide nucleic acids (PNA),
morpholino nucleic acids, cyclohexenyl nucleic acids (CeNA),
anhydrohexitol nucleic acids, locked nucleic acids (LNA and ENA),
bicyclic and tricyclic nucleic acids, phosphonomonoester nucleic
acids and cyclobutyl nucleic acids. A representative example of one
type of oligomer synthesis that utilizes the coupling of an
activated phosphorus group with a reactive hydroxyl group is the
widely used phosphoramidite approach. A phosphoramidite synthon is
reacted under appropriate conditions with a reactive hydroxyl group
to form a phosphite linkage that is further oxidized to a
phosphodiester or phosphorothioate linkage. This approach commonly
utilizes nucleoside phosphoramidites of the formula: 24
[0211] wherein
[0212] each Bx' is an optionally protected heterocyclic base
moiety;
[0213] each R.sub.1' is, independently, H or an optionally
protected sugar substituent group;
[0214] T.sub.3' is H, a hydroxyl protecting group, a nucleoside, a
nucleotide, an oligonucleoside or an oligonucleotide;
[0215] L.sub.1 is N(R.sub.1)R.sub.2;
[0216] each R.sub.2 and R.sub.3 is, independently, C.sub.1-C.sub.12
straight or branched chain alkyl;
[0217] or R.sub.2 and R.sub.3 are joined together to form a 4- to
7-membered heterocyclic ring system including the nitrogen atom to
which R.sub.2 and R.sub.3 are attached, wherein said ring system
optionally includes at least one additional heteroatom selected
from O, N and S;
[0218] L.sub.2 is Pg-O--, Pg-S--, C.sub.1-C.sub.12 straight or
branched chain alkyl, CH.sub.3(CH.sub.2).sub.0-10--O-- or
--NR.sub.5R.sub.6;
[0219] Pg is a protecting/blocking group; and
[0220] each R.sub.5 and R.sub.6 is, independently, hydrogen,
C.sub.1-C.sub.12 straight or branched chain alkyl, cycloalkyl or
aryl;
[0221] or optionally, R.sub.5 and R.sub.6, together with the
nitrogen atom to which they are attached form a cyclic moiety that
may include an additional heteroatom selected from O, S and N;
or
[0222] L.sub.1 and L.sub.2 together with the phosphorus atom to
which L.sub.1 and L.sub.2 are attached form a chiral auxiliary.
[0223] Groups that are attached to the phosphorus atom of
internucleotide linkages before and after oxidation (L.sub.1 and
L.sub.2) can include nitrogen containing cyclic moieties such as
morpholine. Such oxidized internucleoside linkages include a
phosphoromorpholidothioate linkage (Wilk et al., Nucleosides and
nucleotides, 1991, 10, 319-322). Further cyclic moieties amenable
to the present invention include mono-, bi- or tricyclic ring
moieties which may be substituted with groups such as oxo, acyl,
alkoxy, alkoxycarbonyl, alkyl, alkenyl, alkynyl, amino, amido,
azido, aryl, heteroaryl, carboxylic acid, cyano, guanidino, halo,
haloalkyl, haloalkoxy, hydrazino, ODMT, alkylsulfonyl, nitro,
sulfide, sulfone, sulfonamide, thiol and thioalkoxy. A bicyclic
ring structure that includes nitrogen is phthalimido.
[0224] Unless otherwise defined herein, alkyl means
C.sub.1-C.sub.12, C.sub.1-C.sub.8, or C.sub.1-C.sub.6, straight or
(where possible) branched chain aliphatic hydrocarbyl.
[0225] Unless otherwise defined herein, heteroalkyl means
C.sub.1-C.sub.12, C.sub.1-C.sub.8, or C.sub.1-C.sub.6, straight or
(where possible) branched chain aliphatic hydrocarbyl containing at
least one or about 1 to about 3, hetero atoms in the chain,
including the terminal portion of the chain. Suitable heteroatoms
include N, O and S.
[0226] Unless otherwise defined herein, cycloalkyl means
C.sub.3-C.sub.12, C.sub.3-C.sub.8, or C.sub.3-C.sub.6, aliphatic
hydrocarbyl ring.
[0227] Unless otherwise defined herein, alkenyl means
C.sub.2-C.sub.12, C.sub.2-C.sub.8, or C.sub.2-C.sub.6 alkenyl,
which may be straight or (where possible) branched hydrocarbyl
moiety, which contains at least one carbon-carbon double bond.
[0228] Unless otherwise defined herein, alkynyl means
C.sub.2-C.sub.12, C.sub.2-C.sub.8, or C.sub.2-C.sub.6 alkynyl,
which may be straight or (where possible) branched hydrocarbyl
moiety, which contains at least one carbon-carbon triple bond.
[0229] Unless otherwise defined herein, heterocycloalkyl means a
ring moiety containing at least three ring members, at least one of
which is carbon, and of which 1, 2 or three ring members are other
than carbon. The number of carbon atoms can vary from 1 to about
12, or from 1 to about 6, and the total number of ring members can
vary from three to about 15, or from about 3 to about 8. Ring
heteroatoms can be N, O and S. Heterocycloalkyl groups include
morpholino, thiomorpholino, piperidinyl, piperazinyl,
homopiperidinyl, homopiperazinyl, homomorpholino,
homothiomorpholino, pyrrolodinyl, tetrahydrooxazolyl,
tetrahydroimidazolyl, tetrahydrothiazolyl, tetrahydroisoxazolyl,
tetrahydropyrrazolyl, furanyl, pyranyl, and
tetrahydroisothiazolyl.
[0230] Unless otherwise defined herein, aryl means any hydrocarbon
ring structure containing at least one aryl ring. Ayl rings can
have about 6 to about 20 ring carbons. Aryl rings can include
phenyl, napthyl, anthracenyl, and phenanthrenyl.
[0231] Unless otherwise defined herein, hetaryl means a ring moiety
containing at least one fully unsaturated ring, the ring consisting
of carbon and non-carbon atoms. The ring system can contain about 1
to about 4 rings. The number of carbon atoms can vary from 1 to
about 12, or from 1 to about 6, and the total number of ring
members can vary from three to about 15, or from about 3 to about
8. Ring heteroatoms are N, O and S. Hetaryl moieties include
pyrazolyl, thiophenyl, pyridyl, imidazolyl, tetrazolyl, pyridyl,
pyrimidinyl, purinyl, quinazolinyl, quinoxalinyl, benzimidazolyl,
benzothiophenyl, etc.
[0232] Unless otherwise defined herein, where a moiety is defined
as a compound moiety, such as hetarylalkyl (hetaryl and alkyl),
aralkyl (aryl and alkyl), etc., each of the sub-moieties is as
defined herein.
[0233] Unless otherwise defined herein, an electron withdrawing
group is a group, such as the cyano or isocyanato group that draws
electronic charge away from the carbon to which it is attached.
Other electron withdrawing groups of note include those whose
electronegativities exceed that of carbon, for example halogen,
nitro, or phenyl substituted in the ortho- or para-position with
one or more cyano, isothiocyanato, nitro or halo groups.
[0234] Unless otherwise defined herein, the terms halogen and halo
have their ordinary meanings. Halo (halogen) substituents can be
Cl, Br, and I.
[0235] The aforementioned optional substituents are, unless
otherwise herein defined, suitable substituents depending upon
desired properties. Included are halogens (Cl, Br, I), alkyl,
alkenyl, and alkynyl moieties, NO.sub.2, NH.sub.3 (substituted and
unsubstituted), acid moieties (e.g. --CO.sub.2H,
--OSO.sub.3H.sub.2, etc.), heterocycloalkyl moieties, hetaryl
moieties, aryl moieties, etc.
[0236] In all the preceding formulae, the squiggle (.about.)
indicates a bond to an oxygen or sulfur of the 5'-phosphate.
[0237] Phosphate protecting groups include those described in U.S.
Pat. No. 5,760,209, U.S. Pat. No. 5,614,621, U.S. Pat. No.
6,051,699, U.S. Pat. No. 6,020,475, U.S. Pat. No. 6,326,478, U.S.
Pat. No. 6,169,177, U.S. Pat. No. 6,121,437, U.S. Pat. No.
6,465,628 each of which is expressly incorporated herein by
reference in its entirety.
[0238] Hybridization
[0239] In the context of this invention, "hybridization" means the
pairing of complementary strands of oligomeric compounds. In the
present invention, one mechanism of pairing involves hydrogen
bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen
hydrogen bonding, between complementary nucleoside or nucleotide
bases (nucleobases) of the strands of oligomeric compounds. For
example, adenine and thymine are complementary nucleobases which
pair through the formation of hydrogen bonds. Hybridization can
occur under varying circumstances.
[0240] An oligomeric compound is specifically hybridizable when
binding of the compound to the target nucleic acid interferes with
the normal function of the target nucleic acid to cause a reduction
in activity, and there is a sufficient degree of complementarity to
avoid off-target effects (non-specific binding of the antisense
oligomeric compound to non-target nucleic acid sequences under
conditions in which specific binding is desired, i.e., under
physiological conditions in the case of in vivo assays or
therapeutic treatment, or under conditions in which assays are
performed in the case of in vitro assays).
[0241] In the present invention the phrase "stringent hybridization
conditions" or "stringent conditions" refers to conditions under
which an oligomeric compound of the invention will hybridize to its
target sequence, but to a minimal number of other sequences.
Stringent conditions are sequence-dependent and will vary with
different circumstances and in the context of this invention,
"stringent conditions" under which oligomeric compounds hybridize
to a target sequence are determined by the nature and composition
of the oligomeric compounds and the assays in which they are being
investigated.
[0242] "Complementary," as used herein, refers to the capacity for
precise pairing of two nucleobases regardless of where the two are
located. For example, if a nucleobase at a certain position of an
oligomeric compound is capable of hydrogen bonding (pairing) with a
nucleobase at a certain position of a target nucleic acid, the
target nucleic acid being a DNA, RNA, or oligonucleotide molecule,
then the position of hydrogen bonding between the oligonucleotide
and the target nucleic acid is considered to be a complementary
position. The oligomeric compound and the further DNA, RNA, or
oligonucleotide molecule are complementary to each other when a
sufficient number of complementary positions in each molecule are
occupied by nucleobases which can hydrogen bond with each other.
Thus, "specifically hybridizable" and "complementary" are terms
which are used to indicate a sufficient degree of precise pairing
or complementarity over a sufficient number of nucleobases such
that stable and specific binding occurs between the oligonucleotide
and a target nucleic acid.
[0243] It is understood in the art that the sequence of a chimeric
oligomeric compound compound need not be 100% complementary to that
of its target nucleic acid to be specifically hybridizable.
Moreover, an oligonucleotide may hybridize over one or more
segments such that intervening or adjacent segments are not
involved in the hybridization event (e.g., a loop structure or
hairpin structure). It may be desirable that the chimeric
oligomeric compounds of the present invention comprise at least
70%, at least 80%, at least 90%, at least 95%, or at least 99%
sequence complementarity to a target region within the target
nucleic acid to which they are targeted. For example, a chimeric
oligomeric compound in which 18 of 20 nucleobases are complementary
(the remaining 2 being mismatches) to a target region, which
specifically hybridizes, would represent 90 percent
complementarity. In this example, the remaining noncomplementary
nucleobases may be clustered or interspersed with complementary
nucleobases and need not be contiguous to each other or to
complementary nucleobases. As such, a chimeric oligomeric compound
which is 18 nucleobases in length having 4 (four) noncomplementary
nucleobases which are flanked by two regions of complete
complementarity with the target nucleic acid would have 77.8%
overall complementarity with the target nucleic acid and would thus
fall within the scope of the present invention. Percent
complementarity of a chimeric oligomeric compound with a region of
a target nucleic acid can be determined routinely using BLAST
programs (basic local alignment search tools) and PowerBLAST
programs known in the art (Altschul et al., J. Mol. Biol., 1990,
215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).
[0244] Targets of the Invention
[0245] The chimeric oligomeric compounds of the present invention
are targeted to nucleic acid targets in a sequence dependent
manner. One nucleic acid target is messenger RNA. More
specifically, chimeric oligomeric compounds of the invention will
modulate gene expression by hybridizing to a nucleic acid target
resulting in alteration of or reduction in normal function of the
target nucleic acid. As used herein, the term "target nucleic acid"
or "nucleic acid target" is used for convenience to encompass any
nucleic acid capable of being targeted including without limitation
DNA, RNA (including pre-mRNA and mRNA or portions thereof)
transcribed from such DNA, and also cDNA derived from such RNA. In
one embodiment of the invention the target nucleic acid is a
messenger RNA. The inhibition of the target is typically based upon
hydrogen bonding-based hybridization of the chimeric oligomeric
compound strands or segments such that at least one strand or
segment is cleaved, degraded, or otherwise rendered inoperable. In
this regard, it is presently suitable to target specific nucleic
acid molecules and their functions for such inhibition.
[0246] The functions of DNA to be interfered with can include
replication and transcription. Replication and transcription, for
example, can be from an endogenous cellular template, a vector, a
plasmid construct or otherwise. The functions of RNA to be
interfered with can include functions such as translocation of the
RNA to a site of protein translation, translocation of the RNA to
sites within the cell which are distant from the site of RNA
synthesis, translation of protein from the RNA, splicing of the RNA
to yield one or more RNA species, and catalytic activity or complex
formation involving the RNA which may be engaged in or facilitated
by the RNA. In the context of the present invention, "modulation"
and "modulation of expression" mean either an increase
(stimulation) or a decrease (inhibition) in the amount or levels of
a nucleic acid molecule encoding the gene, e.g., DNA or RNA.
Inhibition is often the desired form of modulation of expression
and mRNA is often a suitable target nucleic acid.
[0247] In one aspect, the present invention is directed to chimeric
oligomeric compounds that are prepared having enhanced activity
against nucleic acid targets. As used herein the phrase "enhanced
activity" can indicate upregulation or downregulation of a system.
A target and a mechanism for its modulation is determined. An
oligonucleotide is selected having an effective length and sequence
that is complementary to a portion of the target sequence. The
selected sequence is divided into regions and the nucleosides of
each region are modified to enhance the desired properties of the
respective region. Consideration is also given to the 5' and
3'-termini as there are often advantageous modifications that can
be made to one or more of the terminal nucleosides. Further
modifications are also considered such as internucleoside linkages,
conjugate groups, substitute sugars or bases, substitution of one
or more nucleosides with nucleoside mimetics and any other
modification that can enhance the selected sequence for its
intended target.
[0248] "Targeting" a chimeric oligomeric compound of the invention
to a particular nucleic acid molecule, in the context of this
invention, can be a multistep process. The process usually begins
with the identification of a target nucleic acid whose function is
to be modulated. This target nucleic acid may be, for example, a
cellular gene (or mRNA transcribed from the gene) whose expression
is associated with a particular disorder or disease state, or a
nucleic acid molecule from an infectious agent.
[0249] The targeting process usually also includes determination of
at least one target region, target segment, or target site within
the target nucleic acid for the antisense interaction to occur
(hybridization of the chimeric oligomeric compound to its
complementary sense target) such that the desired effect, e.g.,
modulation of expression, will result. Within the context of the
present invention, the term "target region" is defined as a portion
of the target nucleic acid having at least one identifiable
structure, function, or characteristic. Within regions of target
nucleic acids are segments. "Target segments" are defined as
smaller or sub-portions of regions within a target nucleic acid.
"Target sites," as used in the present invention, are defined as
positions within a target nucleic acid. Since, as is known in the
art, the translation initiation codon is typically 5'-AUG (in
transcribed mRNA molecules; 5'-ATG in the corresponding DNA
molecule), the translation initiation codon is also referred to as
the "AUG codon," the "start codon" or the "AUG start codon". A
minority of genes has a translation initiation codon having the RNA
sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG
have been shown to function in vivo. Thus, the terms "translation
initiation codon" and "start codon" can encompass many codon
sequences, even though the initiator amino acid in each instance is
typically methionine (in eukaryotes) or formylmethionine (in
prokaryotes). It is also known in the art that eukaryotic and
prokaryotic genes may have two or more alternative start codons,
any one of which may be preferentially utilized for translation
initiation in a particular cell type or tissue, or under a
particular set of conditions. In the context of the invention,
"start codon" and "translation initiation codon" refer to the codon
or codons that are used in vivo to initiate translation of an mRNA
transcribed from a gene encoding a nucleic acid target, regardless
of the sequence(s) of such codons. It is also known in the art that
a translation termination codon (or "stop codon") of a gene may
have one of three sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the
corresponding DNA sequences are 5'-TAA, 5'-TAG and 5'-TGA,
respectively).
[0250] The terms "start codon region" and "translation initiation
codon region" refer to a portion of such an mRNA or gene that
encompasses from about 25 to about 50 contiguous nucleotides in
either direction (i.e., 5' or 3') from a translation initiation
codon. Similarly, the terms "stop codon region" and "translation
termination codon region" refer to a portion of such an mRNA or
gene that encompasses from about 25 to about 50 contiguous
nucleotides in either direction (i.e., 5' or 3') from a translation
termination codon. Consequently, the "start codon region" (or
"translation initiation codon region") and the "stop codon region"
(or "translation termination codon region") are all regions which
may be targeted effectively with the chimeric oligomeric compounds
of the present invention.
[0251] The open reading frame (ORF) or "coding region," which is
known in the art to refer to the region between the translation
initiation codon and the translation termination codon, is also a
region which may be targeted effectively. Within the context of the
present invention, one region is the intragenic region encompassing
the translation initiation or termination codon of the open reading
frame (ORF) of a gene.
[0252] Other target regions include the 5' untranslated region
(5'UTR), known in the art to refer to the portion of an mRNA in the
5' direction from the translation initiation codon, and thus
including nucleotides between the 5' cap site and the translation
initiation codon of an mRNA (or corresponding nucleotides on the
gene), and the 3' untranslated region (3'UTR), known in the art to
refer to the portion of an mRNA in the 3' direction from the
translation termination codon, and thus including nucleotides
between the translation termination codon and 3' end of an mRNA (or
corresponding nucleotides on the gene). The 5' cap site of an mRNA
comprises an N7-methylated guanosine residue joined to the 5'-most
residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap
region of an mRNA is considered to include the 5' cap structure
itself as well as the first 50 nucleotides adjacent to the cap
site. It is also suitable to target the 5' cap region.
[0253] Although some eukaryotic mRNA transcripts are directly
translated, many contain one or more regions, known as "introns,"
which are excised from a transcript before it is translated. The
remaining (and therefore translated) regions are known as "exons"
and are spliced together to form a continuous mRNA sequence,
resulting in exon-exon junctions at the sites where exons are
joined. Targeting exon-exon junctions can be useful in situations
where the overproduction of a normal splice product is implicated
in disease, or where the overproduction of an aberrant splice
product is implicated in disease. Targeting splice sites, i.e.,
intron-exon junctions or exon-intron junctions, may also be
particularly useful in situations where aberrant splicing is
implicated in disease, or where an overproduction of a particular
splice product is implicated in disease. Aberrant fusion junctions
due to rearrangements or deletions are also suitable target sites.
mRNA transcripts produced via the process of splicing of two (or
more) mRNAs from different gene sources known as "fusion
transcripts" are also suitable target sites. It is also known that
introns can be effectively targeted using chimeric oligomeric
compounds targeted to, for example, DNA or pre-mRNA.
[0254] It is also known in the art that alternative RNA transcripts
can be produced from the same genomic region of DNA. These
alternative transcripts are generally known as "variants". More
specifically, "pre-mRNA variants" are transcripts produced from the
same genomic DNA that differ from other transcripts produced from
the same genomic DNA in either their start or stop position and
contain both intronic and exonic sequences.
[0255] Upon excision of one or more exon or intron regions, or
portions thereof during splicing, pre-mRNA variants produce smaller
"mRNA variants". Consequently, mRNA variants are processed pre-mRNA
variants and each unique pre-mRNA variant must always produce a
unique mRNA variant as a result of splicing. These mRNA variants
are also known as "alternative splice variants". If no splicing of
the pre-mRNA variant occurs then the pre-mRNA variant is identical
to the mRNA variant.
[0256] It is also known in the art that variants can be produced
through the use of alternative signals to start or stop
transcription and that pre-mRNAs and mRNAs can possess more that
one start codon or stop codon. Variants that originate from a
pre-mRNA or mRNA that use alternative start codons are known as
"alternative start variants" of that pre-mRNA or mRNA. Those
transcripts that use an alternative stop codon are known as
"alternative stop variants" of that pre-mRNA or mRNA. One specific
type of alternative stop variant is the "polyA variant" in which
the multiple transcripts produced result from the alternative
selection of one of the "polyA stop signals" by the transcription
machinery, thereby producing transcripts that terminate at unique
polyA sites. Within the context of the invention, the types of
variants described herein are also suitable target nucleic
acids.
[0257] The locations on the target nucleic acid to which the
chimeric oligomeric compounds hybridize are hereinbelow referred to
as "suitable target segments." As used herein the term "suitable
target segment" is defined as at least a 5-nucleobase portion of a
target region to which an active chimeric oligomeric compound of
the present invention is targeted. While not wishing to be bound by
theory, it is presently believed that these target segments
represent portions of the target nucleic acid which are accessible
for hybridization.
[0258] Exemplary chimeric oligomeric compounds include at least the
5 consecutive nucleobases from the 5'-terminus of a targeted
nucleic acid e.g. a cellular gene or mRNA transcribed from the gene
(the remaining nucleobases being a consecutive stretch of the same
oligonucleotide beginning immediately upstream of the 5'-terminus
of the chimeric oligomeric compound which is specifically
hybridizable to the target nucleic acid and continuing until the
oligonucleotide contains from about 5 to about 80 nucleobases).
Similarly, chimeric oligomeric compounds comprise at least the 5
consecutive nucleobases from the 3'-terminus of one of the
illustrative chimeric oligomeric compounds (the remaining
nucleobases being a consecutive stretch of the same oligonucleotide
beginning immediately downstream of the 3'-terminus of the chimeric
oligomeric compound which is specifically hybridizable to the
target nucleic acid and continuing until the chimeric oligomeric
compound contains from about 5 to about 80 nucleobases). One having
skill in the art armed with the chimeric oligomeric compounds
illustrated herein will be able, without undue experimentation, to
identify further chimeric oligomeric compounds.
[0259] Once one or more target regions, target segments or target
sites have been identified, chimeric oligomeric compounds of the
invention are chosen which are sufficiently complementary to the
target, i.e., hybridize sufficiently well and with sufficient
specificity, to give the desired effect.
[0260] The oligomeric antisense compounds can also be targeted to
regions of a target nucleobase sequence, such as those disclosed
herein. All regions of a nucleobase sequence to which an oligomeric
antisense compound can be targeted, wherein the regions are greater
than or equal to 5 and less than or equal to 80 nucleobases, are
described as follows:
[0261] Let R(n, n+m-1) be a region from a target nucleobase
sequence, where "n" is the 5'-most nucleobase position of the
region, where "n+m-1" is the 3'-most nucleobase position of the
region and where "m" is the length of the region. A set "S(m)", of
regions of length "m" is defined as the regions where n ranges from
1 to L-m+1, where L is the length of the target nucleobase sequence
and L>m. A set, "A", of all regions can be constructed as a
union of the sets of regions for each length from where m is
greater than or equal to 5 and is less than or equal to 80.
[0262] This set of regions can be represented using the following
mathematical notation: 1 A = m S ( m ) where m N 5 m 80
[0263] and
S(m)={R.sub.n,n+m-1.vertline.n.epsilon.{1,2,3, . . . , L-m+1}}
[0264] where the mathematical operator .vertline. indicates "such
that",
[0265] where the mathematical operator .epsilon. indicates "a
member of a set" (e.g. y.epsilon.Z indicates that element y is a
member of set Z),
[0266] where x is a variable,
[0267] where N indicates all natural numbers, defined as positive
integers,
[0268] and where the mathematical operator .orgate. indicates "the
union of sets".
[0269] For example, the set of regions for m equal to 5, 20 and 80
can be constructed in the following manner. The set of regions,
each 5 nucleobases in length, S(m=5), in a target nucleobase
sequence 100 nucleobases in length (L=100), beginning at position 1
(n=1) of the target nucleobase sequence, can be created using the
following expression:
S(5)={R.sub.1,5.vertline.n.epsilon.{1,2,3, . . . , 96}}
[0270] and describes the set of regions comprising nucleobases 1-5,
2-6, 3-7, 4-8, 5-9, 6-10, 7-11, 8-12, 9-13, 10-14, 11-15, 12-16,
13-17, 14-18, 15-19, 16-20, 17-21, 18-22, 19-23, 20-24, 21-25,
22-26, 23-27, 24-28, 25-29, 26-30, 27-31, 28-32, 29-33, 30-34,
31-35, 32-36, 33-37, 34-38, 35-39, 36-40, 37-41, 38-42, 39-43,
40-44, 41-45, 42-46, 43-47, 44-48, 45-49, 46-50, 47-51, 48-52,
49-53, 50-54, 51-55, 52-56, 53-57, 54-58, 55-59, 56-60, 57-61,
58-62, 59-63, 60-64, 61-65, 62-66, 63-67, 64-68, 65-69, 66-70,
67-71, 68-72, 69-73, 70-74, 71-75, 72-76, 73-77, 74-78, 75-79,
76-80, 77-81, 78-82, 79-83, 80-84, 81-85, 82-86, 83-87, 84-88,
85-89, 86-90, 87-91, 88-92, 89-93, 90-94, 91-95, 92-96, 93-97,
94-98, 95-99, 96-100.
[0271] An additional set for regions 20 nucleobases in length, in a
target sequence 100 nucleobases in length, beginning at position 1
of the target nucleobase sequence, can be described using the
following expression:
S(20)={R.sub.1,20.vertline.n.epsilon.{1,2,3, . . . ,81}}
[0272] and describes the set of regions comprising nucleobases
1-20, 2-21, 3-22, 4-23, 5-24, 6-25, 7-26, 8-27, 9-28, 10-29, 11-30,
12-31, 13-32, 14-33, 15-34, 16-35, 17-36, 18-37, 19-38, 20-39,
21-40, 22-41, 23-42, 24-43, 25-44, 26-45, 27-46, 28-47, 29-48,
30-49, 31-50, 32-51, 33-52, 34-53, 35-54, 36-55, 37-56, 38-57,
39-58, 40-59, 41-60, 42-61, 43-62, 44-63, 45-64, 46-65, 47-66,
48-67, 49-68, 50-69, 51-70, 52-71, 53-72, 54-73, 55-74, 56-75,
57-76, 58-77, 59-78, 60-79, 61-80, 62-81, 63-82, 64-83, 65-84,
66-85, 67-86, 68-87, 69-88, 70-89, 71-90, 72-91, 73-92, 74-93,
75-94, 76-95, 77-96, 78-97, 79-98, 80-99, 81-100.
[0273] An additional set for regions 80 nucleobases in length, in a
target sequence 100 nucleobases in length, beginning at position 1
of the target nucleobase sequence, can be described using the
following expression:
S(80)={R.sub.1,80.vertline.n.epsilon.{1,2,3, . . . , 21}}
[0274] and describes the set of regions comprising nucleobases
1-80, 2-81, 3-82, 4-83, 5-84, 6-85, 7-86, 8-87, 9-88, 10-89, 11-90,
12-91, 13-92, 14-93, 15-94, 16-95, 17-96, 18-97, 19-98, 20-99,
21-100.
[0275] Thus, in this example, A would include regions 1-5, 2-6, 3-7
. . . 93-100, 1-20, 2-21, 3-22 . . . 81-100, 1-80, 2-81, 3-82 . . .
21-100.
[0276] The union of these aforementioned example sets and other
sets for lengths from 10 to 19 and 21 to 79 can be described using
the mathematical expression 2 A = m S ( m )
[0277] where .orgate. represents the union of the sets obtained by
combining all members of all sets.
[0278] The mathematical expressions described herein defines all
possible target regions in a target nucleobase sequence of any
length L, where the region is of length m, and where m is greater
than or equal to 5 and less than or equal to 80 nucleobases and,
and where m is less than L, and where n is less than L-m+1.
[0279] In accordance with one embodiment of the present invention,
a series of nucleic acid duplexes comprising the chimeric
oligomeric compounds of the present invention and their complements
can be designed for a specific target or targets. These nucleic
acid duplexes are commonly referred to in the art as double-strand
RNAs (dsRNAs) or small interfering RNAs (siRNAs). As described
herein, such duplexes have been shown in the art to modulate target
expression and regulate translation as well as RNA processing via
an antisense mechanism. Within a duplex, the ends of the strands
may be modified by the addition of one or more natural or modified
nucleobases to form an overhang. The sense strand of the duplex is
then designed and synthesized as the complement of the antisense
strand and may also contain modifications or additions to either
terminus. For example, in one embodiment, both strands of the
duplex would be complementary over the central nucleobases, each
having overhangs at one or both termini. The antisense and sense
strands of the duplex comprise from about 17 to 25 nucleotides, or
from about 19 to 23 nucleotides. Alternatively, the antisense and
sense strands comprise 20, 21 or 22 nucleotides.
[0280] For example, a duplex comprising a chimeric oligomeric
compound having the sequence CGAGAGGCGGACGGGACCG (SEQ ID NO: 3) and
having a two-nucleobase overhang of deoxythymidine(dT) would have
the following structure:
13 cgagaggcggacgggaccgTT Antisense (SEQ ID NO: 4)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline..vertline..vertline..vertli-
ne..vertline..vertline..vertline..vertline. Strand
TTgctctccgcctgccctggc Complement (SEQ ID NO: 5) Strand
[0281] Overhangs can range from 1 to 6 nucleobases and these
nucleobases may or may not be complementary to the target nucleic
acid. One of skill in the art will understand that the overhang may
be 1, 2, 3, 4, 5 or 6 nucleobases in length. In another embodiment,
the duplexes may have an overhang on only on terminus.
[0282] In another embodiment, a duplex comprising an antisense
strand having the same sequence CGAGAGGCGGACGGGACCG (SEQ ID NO: 3)
may be prepared with blunt ends (no single stranded overhang) as
shown:
14 cgagaggcggacgggaccg Antisense (SEQ ID NO: 3)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline..vertline..vertline..vertli-
ne..vertline..vertline..vertline..vertline. Strand
gctctccgcctgccctggc Complement (SEQ ID NO: 6) Strand
[0283] The RNA duplex can be unimolecular or bimolecular; i.e., the
two strands can be part of a single molecule or may be separate
molecules. These sequences are shown to contain thymine (T), but
one of skill in the art will appreciate that thymine (T) can
generally be replaced with uracil (U) in RNA sequences.
[0284] Screening and Target Validation
[0285] In a further embodiment, "suitable target segments" may be
employed in a screen for additional oligomeric compounds that
modulate the expression of a selected protein. "Modulators" are
those oligomeric compounds that decrease or increase the expression
of a nucleic acid molecule encoding a protein and which comprise at
least an 8-nucleobase portion which is complementary to a suitable
target segment. The screening method comprises the steps of
contacting a suitable target segment of a nucleic acid molecule
encoding a protein with one or more candidate modulators, and
selecting for one or more candidate modulators which decrease or
increase the expression of a nucleic acid molecule encoding a
protein. Once it is shown that the candidate modulator or
modulators are capable of modulating (e.g. either decreasing or
increasing) the expression of a nucleic acid molecule encoding a
peptide, the modulator may then be employed in further
investigative studies of the function of the peptide, or for use as
a research, diagnostic, or therapeutic agent in accordance with the
present invention.
[0286] The suitable target segments of the present invention may
also be combined with their respective complementary chimeric
oligomeric compounds of the present invention to form stabilized
double-stranded (duplexed) oligonucleotides. Such double-stranded
oligonucleotide moieties have been shown in the art to modulate
target expression and regulate translation as well as RNA
processing via an antisense mechanism.
[0287] The oligomeric compounds of the present invention can also
be applied in the areas of drug discovery and target validation.
The present invention comprehends the use of the oligomeric
compounds and suitable targets identified herein in drug discovery
efforts to elucidate relationships that exist between proteins and
a disease state, phenotype, or condition. These methods include
detecting or modulating a target peptide comprising contacting a
sample, tissue, cell, or organism with the oligomeric compounds of
the present invention, measuring the nucleic acid or protein level
of the target and/or a related phenotypic or chemical endpoint at
some time after treatment, and optionally comparing the measured
value to a non-treated sample or sample treated with a further
oligomeric compound of the invention. These methods can also be
performed in parallel or in combination with other experiments to
determine the function of unknown genes for the process of target
validation or to determine the validity of a particular gene
product as a target for treatment or prevention of a particular
disease, condition, or phenotype.
[0288] Kits, Research Reagents, Diagnostics, and Therapeutics
[0289] The oligomeric compounds of the present invention can be
utilized for diagnostics, therapeutics, prophylaxis and as research
reagents and kits. Furthermore, antisense oligonucleotides, which
are able to inhibit gene expression with exquisite specificity, are
often used by those of ordinary skill to elucidate the function of
particular genes or to distinguish between functions of various
members of a biological pathway.
[0290] For use in kits and diagnostics, the oligomeric compounds of
the present invention, either alone or in combination with other
oligomeric compounds or therapeutics, can be used as tools in
differential and/or combinatorial analyses to elucidate expression
patterns of a portion or the entire complement of genes expressed
within cells and tissues. As one nonlimiting example, expression
patterns within cells or tissues treated with one or more chimeric
oligomeric compounds are compared to control cells or tissues not
treated with chimeric oligomeric compounds and the patterns
produced are analyzed for differential levels of gene expression as
they pertain, for example, to disease association, signaling
pathway, cellular localization, expression level, size, structure
or function of the genes examined. These analyses can be performed
on stimulated or unstimulated cells and in the presence or absence
of other compounds and or oligomeric compounds which affect
expression patterns.
[0291] Examples of methods of gene expression analysis known in the
art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett.,
2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE
(serial analysis of gene expression)(Madden, et al., Drug Discov.
Today, 2000, 5, 415-425), READS (restriction enzyme amplification
of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999,
303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et
al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 1976-81), protein
arrays and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16;
Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), expressed
sequence tag (EST) sequencing (Celis, et al., FEBS Lett., 2000,
480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57),
subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal.
Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41,
203-208), subtractive cloning, differential display (DD) (Jurecic
and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative
genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl.,
1998, 31, 286-96), FISH (fluorescent in situ hybridization)
techniques (Going and Gusterson, Eur. J. Cancer, 1999, 35,
1895-904) and mass spectrometry methods (To, Comb. Chem. High
Throughput Screen, 2000, 3, 235-41).
[0292] The oligomeric compounds of the invention are useful for
research and diagnostics, because these oligomeric compounds
hybridize to nucleic acids encoding proteins. The primers and
probes disclosed herein are useful in methods requiring the
specific detection of nucleic acid molecules encoding proteins and
in the amplification of the nucleic acid molecules for detection or
for use in further studies. Hybridization of the primers and probes
with a nucleic acid can be detected by means known in the art. Such
means may include conjugation of an enzyme to the primer or probe,
radiolabelling of the primer or probe or any other suitable
detection means. Kits using such detection means for detecting the
level of selected proteins in a sample may also be prepared.
[0293] The specificity and sensitivity of antisense is also
harnessed by those of skill in the art for therapeutic uses.
Antisense oligomeric compounds have been employed as therapeutic
moieties in the treatment of disease states in animals, including
humans. Antisense oligonucleotide drugs, including ribozymes, have
been safely and effectively administered to humans and numerous
clinical trials are presently underway. It is thus established that
antisense oligomeric compounds can be useful therapeutic modalities
that can be configured to be useful in treatment regimes for the
treatment of cells, tissues and animals, especially humans.
[0294] For therapeutics, an animal, such as a human, suspected of
having a disease or disorder which can be treated by modulating the
expression of a selected protein is treated by administering
chimeric oligomeric compounds in accordance with this invention.
For example, in one non-limiting embodiment, the methods comprise
the step of administering to the animal in need of treatment, a
therapeutically effective amount of a protein inhibitor. The
protein inhibitors of the present invention effectively inhibit the
activity of the protein or inhibit the expression of the protein.
In one embodiment, the activity or expression of a protein in an
animal is inhibited by about 10% or more, by about 20% or more, by
about 30% or more, by about 40% or more, by about 50% or more, by
about 60% or more, by about 70% or more, by about 80% or more, by
about 90% or more, by about 95% or more, or by about 99% or more.
For example, the reduction of the expression of a protein may be
measured in serum, adipose tissue, liver or any other body fluid,
tissue or organ of the animal. The cells contained within the
fluids, tissues or organs being analyzed can contain a nucleic acid
molecule encoding a protein and/or the protein itself.
[0295] The oligomeric compounds of the invention can be utilized in
pharmaceutical compositions by adding an effective amount of an
oligomeric compound to a suitable pharmaceutically acceptable
diluent or carrier. Use of the oligomeric compounds and methods of
the invention may also be useful prophylactically.
[0296] Formulations
[0297] The oligomeric compounds of the invention may also be
admixed, encapsulated, conjugated or otherwise associated with
other molecules, molecule structures or mixtures of compounds, as
for example, liposomes, receptor-targeted molecules, oral, rectal,
topical or other formulations, for assisting in uptake,
distribution and/or absorption. Representative United States
patents that teach the preparation of such uptake, distribution
and/or absorption-assisting formulations include, but are not
limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016;
5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721;
4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170;
5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854;
5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948;
5,580,575; and 5,595,756, each of which is herein incorporated by
reference.
[0298] The chimeric oligomeric compounds of the invention encompass
any pharmaceutically acceptable salts, esters, or salts of such
esters, or any other compound which, upon administration to an
animal, including a human, is capable of providing (directly or
indirectly) the biologically active metabolite or residue thereof.
Accordingly, for example, the disclosure is also drawn to prodrugs
and pharmaceutically acceptable salts of the oligomeric compounds
of the invention, pharmaceutically acceptable salts of such
prodrugs, and other bioequivalents. The term "prodrug" indicates a
therapeutic agent that is prepared in an inactive form that is
converted to an active form (i.e., drug) within the body or cells
thereof by the action of endogenous enzymes or other chemicals
and/or conditions. In particular, prodrug versions of the
oligomeric compounds of the invention are prepared as SATE
[(S-acetyl-2-thioethyl) phosphate] derivatives according to the
methods disclosed in WO 93/24510 to Gosselin et al., published Dec.
9, 1993 or in WO 94/26764 and U.S. Pat. No. 5,770,713 to Imbach et
al.
[0299] The term "pharmaceutically acceptable salts" refers to
physiologically and pharmaceutically acceptable salts of the
compounds of the invention: i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto.
[0300] Pharmaceutically acceptable base addition salts are formed
with metals or amines, such as alkali and alkaline earth metals or
organic amines. Examples of metals used as cations are sodium,
potassium, magnesium, calcium, and the like. Examples of suitable
amines are N,N'-dibenzylethylenediamine, chloroprocaine, choline,
diethanolamine, dicyclohexylamine, ethylenediamine,
N-methylglucamine, and procaine (see, for example, Berge et al.,
"Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 1-19). The
base addition salts of said acidic compounds are prepared by
contacting the free acid form with a sufficient amount of the
desired base to produce the salt in the conventional manner. The
free acid form may be regenerated by contacting the salt form with
an acid and isolating the free acid in the conventional manner. The
free acid forms differ from their respective salt forms somewhat in
certain physical properties such as solubility in polar solvents,
but otherwise the salts are equivalent to their respective free
acid for purposes of the present invention. As used herein, a
"pharmaceutical addition salt" includes a pharmaceutically
acceptable salt of an acid form of one of the components of the
compositions of the invention. These include organic or inorganic
acid salts of the amines. Acid salts are the hydrochlorides,
acetates, salicylates, nitrates and phosphates. Other suitable
pharmaceutically acceptable salts are well known to those skilled
in the art and include basic salts of a variety of inorganic and
organic acids, such as, for example, with inorganic acids, such as
for example hydrochloric acid, hydrobromic acid, sulfuric acid or
phosphoric acid; with organic carboxylic, sulfonic, sulfo or
phospho acids or N-substituted sulfamic acids, for example acetic
acid, propionic acid, glycolic acid, succinic acid, maleic acid,
hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid,
tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric
acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid,
mandelic acid, salicylic acid, 4-aminosalicylic acid,
2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid,
nicotinic acid or isonicotinic acid; and with amino acids, such as
the 20 alpha-amino acids involved in the synthesis of proteins in
nature, for example glutamic acid or aspartic acid, and also with
phenylacetic acid, methanesulfonic acid, ethanesulfonic acid,
2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid,
benzenesulfonic acid, 4-methylbenzenesulfonic acid,
naphthalene-2-sulfonic acid, naphthalene-1,5-disulfonic acid, 2- or
3-phosphoglycerate, glucose-6-phosphate, N-cyclohexylsulfamic acid
(with the formation of cyclamates), or with other acid organic
compounds, such as ascorbic acid. Pharmaceutically acceptable salts
of compounds may also be prepared with a pharmaceutically
acceptable cation. Suitable pharmaceutically acceptable cations are
well known to those skilled in the art and include alkaline,
alkaline earth, ammonium and quaternary ammonium cations.
Carbonates or hydrogen carbonates are also possible.
[0301] For oligonucleotides, examples of pharmaceutically
acceptable salts include but are not limited to (a) salts formed
with cations such as sodium, potassium, ammonium, magnesium,
calcium, polyamines such as spermine and spermidine, etc.; (b) acid
addition salts formed with inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric
acid, nitric acid and the like; (c) salts formed with organic acids
such as, for example, acetic acid, oxalic acid, tartaric acid,
succinic acid, maleic acid, fumaric acid, gluconic acid, citric
acid, malic acid, ascorbic acid, benzoic acid, tannic acid,
palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic
acid, methanesulfonic acid, p-toluenesulfonic acid,
naphthalenedisulfonic acid, polygalacturonic acid, and the like;
and (d) salts formed from elemental anions such as chlorine,
bromine, and iodine.
[0302] Pharmaceutical Compositions and Routes of Administration The
present invention also includes pharmaceutical compositions and
formulations which include the oligomeric compounds of the
invention. The pharmaceutical compositions of the present invention
may be administered in a number of ways depending upon whether
local or systemic treatment is desired and upon the area to be
treated. Administration may be topical (including ophthalmic and to
mucous membranes including vaginal and rectal delivery), pulmonary,
e.g., by inhalation or insufflation of powders or aerosols,
including by nebulizer; intratracheal, intranasal, epidermal and
transdermal), oral or parenteral. Parenteral administration
includes intravenous, intraarterial, subcutaneous, intraperitoneal
or intramuscular injection or infusion; or intracranial, e.g.,
intrathecal or intraventricular, administration. Oligonucleotides
with at least one 2'-O-methoxyethyl modification are believed to be
particularly useful for oral administration.
[0303] Pharmaceutical compositions and formulations for topical
administration may include transdermal patches, ointments, lotions,
creams, gels, drops, suppositories, sprays, liquids and powders.
Conventional pharmaceutical carriers, aqueous, powder or oily
bases, thickeners and the like may be necessary or desirable.
Coated condoms, gloves and the like may also be useful. Topical
formulations include those in which the oligonucleotides of the
invention are in admixture with a topical delivery agent such as
lipids, liposomes, fatty acids, fatty acid esters, steroids,
chelating agents and surfactants. Lipids and liposomes include
neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine,
dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl
choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and
cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and
dioleoylphosphatidyl ethanolamine DOTMA). Oligonucleotides of the
invention may be encapsulated within liposomes or may form
complexes thereto, in particular to cationic liposomes.
Alternatively, oligonucleotides may be complexed to lipids, in
particular to cationic lipids. Fatty acids and esters include but
are not limited arachidonic acid, oleic acid, eicosanoic acid,
lauric acid, caprylic acid, capric acid, myristic acid, palmitic
acid, stearic acid, linoleic acid, linolenic acid, dicaprate,
tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a C.sub.1-10 alkyl ester (e.g. isopropylmyristate IPM),
monoglyceride, diglyceride or pharmaceutically acceptable salt
thereof. Topical formulations are described in detail in U.S.
patent application Ser. No. 09/315,298 filed on May 20, 1999 which
is incorporated herein by reference in its entirety.
[0304] In some embodiments, an oligonucleotide may be administered
to a subject via an oral route of administration. The subjects of
the present invention comprise animals. An animal subject may be a
mammal, such as a mouse, a rat, a dog, a guinea pig, a monkey, a
human, a non-human primate, a cat or a pig. Non-human primates
include monkeys and chimpanzees. A suitable animal subject may be
an experimental animal, such as a mouse, a rat, a dog, a non-human
primate, a cat or a pig.
[0305] In some embodiments, the subject may be a human. In certain
embodiments, the subject may be a human patient as discussed in
more detail herein. In certain embodiments, it may be necessary to
modulate the expression of one or more genes of the human patient.
In some particular embodiments, it may be necessary to inhibit
expression of one or more genes of the human patient. In particular
embodiments, it may be necessary to modulate, i.e. inhibit or
enhance, the expression of one or more genes in order to obtain
therapeutic outcomes discussed herein.
[0306] In some embodiments, non-parenteral (e.g. oral)
oligonucleotide formulations according to the present invention
result in enhanced bioavailability of the oligonucleotide. In this
context, the term "bioavailability" refers to a measurement of that
portion of an administered drug which reaches the circulatory
system (e.g. blood, especially blood plasma) when a particular mode
of administration is used to deliver the drug. Enhanced
bioavailability refers to a particular mode of administration's
ability to deliver oligonucleotide to the peripheral blood plasma
of a subject relative to another mode of administration. For
example, when a non-parenteral mode of administration (e.g. an oral
mode) is used to introduce the drug into a subject, the
bioavailability for that mode of administration may be compared to
a different mode of administration, e.g. an IV mode of
administration. In some embodiments, the area under a compound's
blood plasma concentration curve (AUC.sub.0) after non-parenteral
administration may be divided by the area under the drug's plasma
concentration curve after intravenous (i.v.) administration
(AUC.sub.iv) to provide a dimensionless quotient (relative
bioavailability, RB) that represents fraction of compound absorbed
via the non-parenteral route as compared to the IV route. A
composition's bioavailability is said to be enhanced in comparison
to another composition's bioavailability when the first
composition's relative bioavailability (RB.sub.1) is greater than
the second composition's relative bioavailability (RB.sub.2).
[0307] In general, bioavailability correlates with therapeutic
efficacy when a compound's therapeutic efficacy is related to the
blood concentration achieved, even if the drug's ultimate site of
action is intracellular (van Berge-Henegouwen et al.,
Gastroenterol., 1977, 73, 300). Bioavailability studies have been
used to determine the degree of intestinal absorption of a drug by
measuring the change in peripheral blood levels of the drug after
an oral dose (DiSanto, Chapter 76 In: Remington's Pharmaceutical
Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa.,
1990, pages 1451-1458).
[0308] In general, an oral composition (comprising an
oligonucleotide) bioavailability is said to be "enhanced" when its
relative bioavailability is greater than the bioavailability of a
composition substantially consisting of pure oligonucleotide, i.e.
oligonucleotide in the absence of a penetration enhancer.
[0309] Organ bioavailability refers to the concentration of
compound in an organ. Organ bioavailability may be measured in test
subjects by a number of means, such as by whole-body radiography.
Organ bioavailability may be modified, e.g. enhanced, by one or
more modifications to the oligonucleotide, by use of one or more
carrier compounds or excipients, etc. as discussed in more detail
herein. In general, an increase in bioavailability will result in
an increase in organ bioavailability.
[0310] Oral oligonucleotide compositions according to the present
invention may comprise one or more "mucosal penetration enhancers,"
also known as "absorption enhancers" or simply as "penetration
enhancers." Accordingly, some embodiments of the invention comprise
at least one oligonucleotide in combination with at least one
penetration enhancer. In general, a penetration enhancer is a
substance that facilitates the transport of a drug across mucous
membrane(s) associated with the desired mode of administration,
e.g. intestinal epithelial membranes. Accordingly it is desirable
to select one or more penetration enhancers that facilitate the
uptake of an oligonucleotide, without interfering with the activity
of the oligonucleotide, and in such a manner the oligonucleotide
can be introduced into the body of an animal without unacceptable
degrees of side-effects such as toxicity, irritation or allergic
response.
[0311] Embodiments of the present invention provide compositions
comprising one or more pharmaceutically acceptable penetration
enhancers, and methods of using such compositions, which result in
the improved bioavailability of oligonucleotides administered via
non-parenteral modes of administration. Heretofore, certain
penetration enhancers have been used to improve the bioavailability
of certain drugs. See Muranishi, Crit. Rev. Ther. Drug Carrier
Systems, 1990, 7, 1 and Lee et al., Crit. Rev. Ther. Drug Carrier
Systems, 1991, 8, 91. It has been found that the uptake and
delivery of oligonucleotides can be greatly improved even when
administered by non-parenteral means through the use of a number of
different classes of penetration enhancers.
[0312] In some embodiments, compositions for non-parenteral
administration include one or more modifications to
naturally-occurring oligonucleotides (i.e. full-phosphodiester
deoxyribosyl or full-phosphodiester ribosyl oligonucleotides). Such
modifications may increase binding affinity, nuclease stability,
cell or tissue permeability, tissue distribution, or other
biological or pharmacokinetic property. Modifications may be made
to the base, the linker, or the sugar, in general, as discussed in
more detail herein with regards to oligonucleotide chemistry. In
some embodiments of the invention, compositions for administration
to a subject, and in particular oral compositions for
administration to an animal (human or non-human) subject, will
comprise modified oligonucleotides having one or more modifications
for enhancing affinity, stability, tissue distribution, or other
biological property.
[0313] Suitable modified linkers include phosphorothioate linkers.
In some embodiments according to the invention, the oligonucleotide
has at least one phosphorothioate linker. Phosphorothioate linkers
provide nuclease stability as well as plasma protein binding
characteristics to the oligonucleotide. Nuclease stability is
useful for increasing the in vivo lifetime of oligonucleotides,
while plasma protein binding decreases the rate of first pass
clearance of oligonucleotide via renal excretion. In some
embodiments according to the present invention, the oligonucleotide
has at least two phosphorothioate linkers. In some embodiments,
wherein the oligonucleotide has exactly n nucleosides, the
oligonucleotide has from one to n-1 phosphorothioate linkages. In
some embodiments, wherein the oligonucleotide has exactly n
nucleosides, the oligonucleotide has n-1 phosphorothioate linkages.
In other embodiments wherein the oligonucleotide has exactly n
nucleoside, and n is even, the oligonucleotide has from 1 to n/2
phosphorothioate linkages, or, when n is odd, from 1 to (n-1)/2
phosphorothioate linkages. In some embodiments, the oligonucleotide
has alternating phosphodiester (PO) and phosphorothioate (PS)
linkages. In other embodiments, the oligonucleotide has at least
one stretch of two or more consecutive PO linkages and at least one
stretch of two or more PS linkages. In other embodiments, the
oligonucleotide has at least two stretches of PO linkages
interrupted by at least on PS linkage.
[0314] In some embodiments, at least one of the nucleosides is
modified on the ribosyl sugar unit by a modification that imparts
nuclease stability, binding affinity or some other beneficial
biological property to the sugar. In some cases, the sugar
modification includes a 2'-modification, e.g. the 2'-OH of the
ribosyl sugar is replaced or substituted. Suitable replacements for
2'-OH include 2'-F and 2'-arabino-F. Suitable substitutions for OH
include 2'-O-alkyl, e.g. 2-O-methyl, and 2'-O-substituted alkyl,
e.g. 2'-O-methoxyethyl, 2'-NH.sub.2, 2'-O-aminopropyl, etc. In some
embodiments, the oligonucleotide contains at least one
2'-modification. In some embodiments, the oligonucleotide contains
at least two 2'-modifications. In some embodiments, the
oligonucleotide has at least one 2'-modification at each of the
termini (i.e. the 3'- and 5'-terminal nucleosides each have the
same or different 2'-modifications). In some embodiments, the
oligonucleotide has at least two sequential 2'-modifications at
each end of the oligonucleotide. In some embodiments,
oligonucleotides further comprise at least one deoxynucleoside. In
particular embodiments, oligonucleotides comprise a stretch of
deoxynucleosides such that the stretch is capable of activating
RNase (e.g. RNase H) cleavage of an RNA to which the
oligonucleotide is capable of hybridizing. In some embodiments, a
stretch of deoxynucleosides capable of activating RNase-mediated
cleavage of RNA comprises about 6 to about 16, e.g. about 8 to
about 16 consecutive deoxynucleosides. In further embodiments,
oligonucleotides are capable of eliciting cleaveage by dsRNAse
enzymes which act on RNA:RNA hybrids.
[0315] Oligonucleotide compositions of the present invention may be
formulated in various dosage forms such as, but not limited to,
tablets, capsules, liquid syrups, soft gels, suppositories, and
enemas. The term "alimentary delivery" encompasses e.g. oral,
rectal, endoscopic and sublingual/buccal administration. A common
requirement for these modes of administration is absorption over
some portion or all of the alimentary tract and a need for
efficient mucosal penetration of the oligonucleotides or mimetics
thereof so administered.
[0316] Delivery of a drug via the oral mucosa, as in the case of
buccal and sublingual administration, has several desirable
features, including, in many instances, a more rapid rise in plasma
concentration of the drug (Harvey, Chapter 35 In: Remington's
Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing
Co., Easton, Pa., 1990, page 711).
[0317] Endoscopy may be used for drug delivery directly to an
interior portion of the alimentary tract. For example, endoscopic
retrograde cystopancreatography (ERCP) takes advantage of extended
gastroscopy and permits selective access to the biliary tract and
the pancreatic duct (Hirahata et al., Gan To Kagaku Ryoho, 1992,
19(10 Suppl.), 1591). Pharmaceutical compositions, including
liposomal formulations, can be delivered directly into portions of
the alimentary canal, such as, e.g., the duodenum (Somogyi et al.,
Pharm. Res., 1995, 12, 149) or the gastric submucosa (Akamo et al.,
Japanese J. Cancer Res., 1994, 85, 652) via endoscopic means.
Gastric lavage devices (Inoue et al., Artif. Organs, 1997, 21, 28)
and percutaneous endoscopic feeding devices (Pennington et al.,
Ailment Pharmacol. Ther., 1995, 9, 471) can also be used for direct
alimentary delivery of pharmaceutical compositions.
[0318] In some embodiments, oligonucleotide formulations may be
administered through the anus into the rectum or lower intestine.
Rectal suppositories, retention enemas or rectal catheters can be
used for this purpose and may be desired when patient compliance
might otherwise be difficult to achieve (e.g., in pediatric and
geriatric applications, or when the patient is vomiting or
unconscious). Rectal administration can result in more prompt and
higher blood levels than the oral route. (Harvey, Chapter 35 In:
Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack
Publishing Co., Easton, Pa., 1990, page 711). Because about 50% of
the drug that is absorbed from the rectum will likely bypass the
liver, administration by this route significantly reduces the
potential for first-pass metabolism (Benet et al., Chapter 1 In:
Goodman & Gilman's The Pharmacological Basis of Therapeutics,
9th Ed., Hardman et al., eds., McGraw-Hill, New York, N.Y.,
1996).
[0319] Some embodiments employ various penetration enhancers in
order to effect transport of oligonucleotides and other nucleic
acids across mucosal and epithelial membranes. Penetration
enhancers may be classified as belonging to one of five broad
categories--surfactants, fatty acids, bile salts, chelating agents,
and non-chelating non-surfactants (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, p. 92). Accordingly, some
embodiments comprise oral oligonucleotide compositions comprising
at least one member of the group consisting of surfactants, fatty
acids, bile salts, chelating agents, and non-chelating surfactants.
Further embodiments comprise oral oligonucleotide compositions
comprising at least one fatty acid, e.g. capric or lauric acid, or
combinations or salts thereof. Other embodiments comprise methods
of enhancing the oral bioavailability of an oligonucleotide, the
method comprising co-administering the oligonucleotide and at least
one penetration enhancer.
[0320] Other excipients that may be added to oral oligonucleotide
compositions include surfactants (or "surface-active agents").
These are chemical entities which, when dissolved in an aqueous
solution, reduce the surface tension of the solution or the
interfacial tension between the aqueous solution and another
liquid, with the result that absorption of oligonucleotides through
the alimentary mucosa and other epithelial membranes is enhanced.
In addition to bile salts and fatty acids, surfactants include, for
example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and
polyoxyethylene-20-cetyl ether (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, page 92); and
perfluorohemical emulsions, such as FC-43 (Takahashi et al., J.
Pharm. Phamacol., 1988, 40, 252).
[0321] Fatty acids and their derivatives which act as penetration
enhancers and may be used in compositions of the present invention
include, for example, oleic acid, lauric acid, capric acid
(n-decanoic acid), myristic acid, palmitic acid, stearic acid,
linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein
(1-monooleoyl-rac-glycer- ol), dilaurin, caprylic acid, arachidonic
acid, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one,
acylcarnitines, acylcholines and mono- and di-glycerides thereof
and/or physiologically acceptable salts thereof (i.e., oleate,
laurate, caprate, myristate, palmitate, stearate, linoleate, etc.)
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug
Carrier Systems, 1990, 7, 1; El-Hariri et al., J. Pharm.
Pharmacol., 1992, 44, 651).
[0322] In some embodiments, oligonucleotide compositions for oral
delivery comprise at least two discrete phases, which phases may
comprise particles, capsules, gel-capsules, microspheres, etc. Each
phase may contain one or more oligonucleotides, penetration
enhancers, surfactants, bioadhesives, effervescent agents, or other
adjuvant, excipient or diluent. In some embodiments, one phase
comprises at least one oligonucleotide and at lease one penetration
enhancer. In some embodiments, a first phase comprises at least one
oligonucleotide and at least one penetration enhancer, while a
second phase comprises at least one penetration enhancer. In some
embodiments, a first phase comprises at least one oligonucleotide
and at least one penetration enhancer, while a second phase
comprises at least one penetration enhancer and substantially no
oligonucleotide. In some embodiments, at least one phase is
compounded with at least one degradation retardant, such as a
coating or a matrix, which delays release of the contents of that
phase. In some embodiments, at least one phase In some embodiments,
a first phase comprises at least one oligonucleotide, at least one
penetration enhancer, while a second phase comprises at least one
penetration enhancer and a release-retardant. In particular
embodiments, an oral oligonucleotide composition comprises a first
phase comprising particles containing an oligonucleotide and a
penetration enhancer, and a second phase comprising particles
coated with a release-retarding agent and containing penetration
enhancer.
[0323] A variety of bile salts also function as penetration
enhancers to facilitate the uptake and bioavailability of drugs.
The physiological roles of bile include the facilitation of
dispersion and absorption of lipids and fat-soluble vitamins
(Brunton, Chapter 38 In: Goodman & Gilman's The Pharmacological
Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill,
New York, N.Y., 1996, pages 934-935). Various natural bile salts,
and their synthetic derivatives, act as penetration enhancers.
Thus, the term "bile salt" includes any of the naturally occurring
components of bile as well as any of their synthetic derivatives.
The bile salts of the invention include, for example, cholic acid
(or its pharmaceutically acceptable sodium salt, sodium cholate),
dehydrocholic acid (sodium dehydrocholate), deoxycholic acid
(sodium deoxycholate), glucholic acid (sodium glucholate),
glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium
glycodeoxycholate), taurocholic acid (sodium taurocholate),
taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic
acid (CDCA, sodium chenodeoxycholate), ursodeoxycholic acid (UDCA),
sodium tauro-24,25-dihydro-fusidate (STDHF), sodium
glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee
et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991,
page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical
Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa.,
1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic
Drug Carrier Systems, 1990, 7, 1; Yamamoto et al., J. Pharm. Exp.
Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79,
579).
[0324] In some embodiments, penetration enhancers of the present
invention are mixtures of penetration enhancing compounds. One such
penetration mixture is UDCA (and/or CDCA) with capric and/or lauric
acids or salts thereof e.g. sodium. Such mixtures are useful for
enhancing the delivery of biologically active substances across
mucosal membranes, in particular intestinal mucosa. Other
penetration enhancer mixtures comprise about 5-95% of bile acid or
salt(s) UDCA and/or CDCA with 5-95% capric and/or lauric acid.
Particular penetration enhancers are mixtures of the sodium salts
of UDCA, capric acid and lauric acid in a ratio of about 1:2:2
respectively. Anther such penetration enhancer is a mixture of
capric and lauric acid (or salts thereof) in a 0.01:1 to 1:0.01
ratio (mole basis). In particular embodiments capric acid and
lauric acid are present in molar ratios of e.g. about 0.1:1 to
about 1:0.1, in particular about 0.5:1 to about 1:0.5.
[0325] Other excipients include chelating agents, i.e. compounds
that remove metallic ions from solution by forming complexes
therewith, with the result that absorption of oligonucleotides
through the alimentary and other mucosa is enhanced. With regards
to their use as penetration enhancers in compositions containing
DNA-like oligonucleotides in the present invention, chelating
agents have the added advantage of also serving as DNase
inhibitors, as most characterized DNA nucleases require a divalent
metal ion for catalysis and are thus inhibited by chelating agents
(Jarrett, J. Chromatogr., 1993, 618, 315). Chelating agents of the
invention include, but are not limited to, disodium
ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g.,
sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl
derivatives of collagen, laureth-9 and N-amino acyl derivatives of
beta-diketones (enamines)(Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi,
Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1;
Buur et al., J. Control Rel., 1990, 14, 43).
[0326] As used herein, non-chelating non-surfactant penetration
enhancers may be defined as compounds that demonstrate
insignificant activity as chelating agents or as surfactants but
that nonetheless enhance absorption of oligonucleotides through the
alimentary and other mucosal membranes (Muranishi, Critical Reviews
in Therapeutic Drug Carrier Systems, 1990, 7, 1). This class of
penetration enhancers includes, but is not limited to, unsaturated
cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, page 92); and non-steroidal anti-inflammatory agents such as
diclofenac sodium, indomethacin and phenylbutazone (Yamashita et
al., J. Pharm. Pharmacol., 1987, 39, 621).
[0327] Agents that enhance uptake of oligonucleotides at the
cellular level may also be added to the pharmaceutical, therapeutic
and other compositions of the present invention. For example,
cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No.
5,705,188), cationic glycerol derivatives, and polycationic
molecules, such as polylysine (Lollo et al., PCT Application WO
97/30731), can be used.
[0328] A "pharmaceutical carrier" or "excipient" may be a
pharmaceutically acceptable solvent, suspending agent or any other
pharmacologically inert vehicle for delivering one or more nucleic
acids to an animal. The excipient may be liquid or solid and is
selected, with the planned manner of administration in mind, so as
to provide for the desired bulk, consistency, etc., when combined
with a an oligonucleotide and the other components of a given
pharmaceutical composition. Typical pharmaceutical carriers
include, but are not limited to, binding agents (e.g.,
pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl
methylcellulose, etc.); fillers (e.g., lactose and other sugars,
microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl
cellulose, polyacrylates or calcium hydrogen phosphate, etc.);
lubricants (e.g., magnesium stearate, talc, silica, colloidal
silicon dioxide, stearic acid, metallic stearates, hydrogenated
vegetable oils, corn starch, polyethylene glycols, sodium benzoate,
sodium acetate, etc.); disintegrants (e.g., starch, sodium starch
glycolate, EXPLOTAB); and wetting agents (e.g., sodium lauryl
sulphate, etc.).
[0329] Oral oligonucleotide compositions may additionally contain
other adjunct components conventionally found in pharmaceutical
compositions, at their art-established usage levels. Thus, for
example, the compositions may contain additional, compatible,
pharmaceutically-active materials such as, for example,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may contain additional materials useful in physically
formulating various dosage forms of the composition of present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the present invention. Compositions and
formulations for parenteral, intrathecal or intraventricular
administration may include sterile aqueous solutions which may also
contain buffers, diluents and other suitable additives such as, but
not limited to, penetration enhancers, carrier compounds and other
pharmaceutically acceptable carriers or excipients.
[0330] Pharmaceutical compositions of the present invention
include, but are not limited to, solutions, emulsions, and
liposome-containing formulations. These compositions may be
generated from a variety of components that include, but are not
limited to, preformed liquids, self-emulsifying solids and
self-emulsifying semisolids.
[0331] The pharmaceutical formulations of the present invention,
which may conveniently be presented in unit dosage form, may be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0332] The compositions of the present invention may be formulated
into any of many possible dosage forms such as, but not limited to,
tablets, capsules, gel capsules, liquid syrups, soft gels,
suppositories, and enemas. The compositions of the present
invention may also be formulated as suspensions in aqueous,
non-aqueous or mixed media. Aqueous suspensions may further contain
substances which increase the viscosity of the suspension
including, for example, sodium carboxymethylcellulose, sorbitol
and/or dextran. The suspension may also contain stabilizers.
[0333] In one embodiment of the present invention the
pharmaceutical compositions may be formulated and used as foams.
Pharmaceutical foams include formulations such as, but not limited
to, emulsions, microemulsions, creams, jellies and liposomes. While
basically similar in nature these formulations vary in the
components and the consistency of the final product. The
preparation of such compositions and formulations is generally
known to those skilled in the pharmaceutical and formulation arts
and may be applied to the formulation of the compositions of the
present invention.
[0334] Emulsions
[0335] The compositions of the present invention may be prepared
and formulated as emulsions. Emulsions are typically heterogenous
systems of one liquid dispersed in another in the form of droplets
usually exceeding 0.1 .mu.m in diameter (Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p.
335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often
biphasic systems comprising of two immiscible liquid phases
intimately mixed and dispersed with each other. In general,
emulsions may be either water-in-oil (w/o) or of the oil-in-water
(o/w) variety. When an aqueous phase is finely divided into and
dispersed as minute droplets into a bulk oily phase the resulting
composition is called a water-in-oil (w/o) emulsion. Alternatively,
when an oily phase is finely divided into and dispersed as minute
droplets into a bulk aqueous phase the resulting composition is
called an oil-in-water (o/w) emulsion. Emulsions may contain
additional components in addition to the dispersed phases and the
active drug which may be present as a solution in either the
aqueous phase, oily phase or itself as a separate phase.
Pharmaceutical excipients such as emulsifiers, stabilizers, dyes,
and anti-oxidants may also be present in emulsions as needed.
Pharmaceutical emulsions may also be multiple emulsions that are
comprised of more than two phases such as, for example, in the case
of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w)
emulsions. Such complex formulations often provide certain
advantages that simple binary emulsions do not. Multiple emulsions
in which individual oil droplets of an o/w emulsion enclose small
water droplets constitute a w/o/w emulsion. Likewise a system of
oil droplets enclosed in globules of water stabilized in an oily
continuous provides an o/w/o emulsion.
[0336] Often, the dispersed or discontinuous phase of the emulsion
is well dispersed into the external or continuous phase and
maintained in this form through the means of emulsifiers or the
viscosity of the formulation. Either of the phases of the emulsion
may be a semisolid or a solid, as is the case of emulsion-style
ointment bases and creams. Other means of stabilizing emulsions
entail the use of emulsifiers that may be incorporated into either
phase of the emulsion. Emulsifiers may broadly be classified into
four categories: synthetic surfactants, naturally occurring
emulsifiers, absorption bases, and finely dispersed solids (Idson,
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
199).
[0337] Synthetic surfactants, also known as surface active agents,
have found wide applicability in the formulation of emulsions and
have been reviewed in the literature (Rieger, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199).
Surfactants are typically amphiphilic and comprise a hydrophilic
and a hydrophobic portion. The ratio of the hydrophilic to the
hydrophobic nature of the surfactant has been termed the
hydrophile/lipophile balance (HLB) and is a valuable tool in
categorizing and selecting surfactants in the preparation of
formulations. Surfactants may be classified into different classes
based on the nature of the hydrophilic group: nonionic, anionic,
cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New
York, N.Y., volume 1, p. 285).
[0338] Naturally occurring emulsifiers used in emulsion
formulations include lanolin, beeswax, phosphatides, lecithin and
acacia. Absorption bases possess hydrophilic properties such that
they can soak up water to form w/o emulsions yet retain their
semisolid consistencies, such as anhydrous lanolin and hydrophilic
petrolatum. Finely divided solids have also been used as good
emulsifiers especially in combination with surfactants and in
viscous preparations. These include polar inorganic solids, such as
heavy metal hydroxides, nonswelling clays such as bentonite,
attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum
silicate and colloidal magnesium aluminum silicate, pigments and
nonpolar solids such as carbon or glyceryl tristearate.
[0339] A large variety of non-emulsifying materials are also
included in emulsion formulations and contribute to the properties
of emulsions. These include fats, oils, waxes, fatty acids, fatty
alcohols, fatty esters, humectants, hydrophilic colloids,
preservatives and antioxidants (Block, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0340] Hydrophilic colloids or hydrocolloids include naturally
occurring gums and synthetic polymers such as polysaccharides (for
example, acacia, agar, alginic acid, carrageenan, guar gum, karaya
gum, and tragacanth), cellulose derivatives (for example,
carboxymethylcellulose and carboxypropylcellulose), and synthetic
polymers (for example, carbomers, cellulose ethers, and
carboxyvinyl polymers). These disperse or swell in water to form
colloidal solutions that stabilize emulsions by forming strong
interfacial films around the dispersed-phase droplets and by
increasing the viscosity of the external phase.
[0341] Since emulsions often contain a number of ingredients such
as carbohydrates, proteins, sterols and phosphatides that may
readily support the growth of microbes, these formulations often
incorporate preservatives. Commonly used preservatives included in
emulsion formulations include methyl paraben, propyl paraben,
quaternary ammonium salts, benzalkonium chloride, esters of
p-hydroxybenzoic acid, and boric acid. Antioxidants are also
commonly added to emulsion formulations to prevent deterioration of
the formulation. Antioxidants used may be free radical scavengers
such as tocopherols, alkyl gallates, butylated hydroxyanisole,
butylated hydroxytoluene, or reducing agents such as ascorbic acid
and sodium metabisulfite, and antioxidant synergists such as citric
acid, tartaric acid, and lecithin.
[0342] The application of emulsion formulations via dermatological,
oral and parenteral routes and methods for their manufacture have
been reviewed in the literature (Idson, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for
oral delivery have been very widely used because of reasons of ease
of formulation, efficacy from an absorption and bioavailability
standpoint. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman,
Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York,
N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New
York, N.Y., volume 1, p. 199). Mineral-oil base laxatives,
oil-soluble vitamins and high fat nutritive preparations are among
the materials that have commonly been administered orally as o/w
emulsions.
[0343] In one embodiment of the present invention, the compositions
of oligonucleotides are formulated as microemulsions. A
microemulsion may be defined as a system of water, oil and
amphiphile which is a single optically isotropic and
thermodynamically stable liquid solution (Rosoff, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically
microemulsions are systems that are prepared by first dispersing an
oil in an aqueous surfactant solution and then adding a sufficient
amount of a fourth component, generally an intermediate
chain-length alcohol to form a transparent system. Therefore,
microemulsions have also been described as thermodynamically
stable, isotropically clear dispersions of two immiscible liquids
that are stabilized by interfacial films of surface-active
molecules (Leung and Shah, in: Controlled Release of Drugs:
Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH
Publishers, New York, pages 185-215). Microemulsions commonly are
prepared via a combination of three to five components that include
oil, water, surfactant, cosurfactant and electrolyte. Whether the
microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w)
type is dependent on the properties of the oil and surfactant used
and on the structure and geometric packing of the polar heads and
hydrocarbon tails of the surfactant molecules (Schott, in
Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton,
Pa., 1985, p. 271).
[0344] The phenomenological approach utilizing phase diagrams has
been extensively studied and has yielded a comprehensive knowledge,
to one skilled in the art, of how to formulate microemulsions
(Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1,
p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger
and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y.,
volume 1, p. 335). Compared to conventional emulsions,
microemulsions offer the advantage of solubilizing water-insoluble
drugs in a formulation of thermodynamically stable droplets that
are formed spontaneously.
[0345] Surfactants used in the preparation of microemulsions
include, but are not limited to, ionic surfactants, non-ionic
surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol
fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol
monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol
pentaoleate (PO500), decaglycerol monocaprate (MCA750),
decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750),
decaglycerol decaoleate (DAO750), alone or in combination with
cosurfactants. The cosurfactant, usually a short-chain alcohol such
as ethanol, 1-propanol, and 1-butanol, serves to increase the
interfacial fluidity by penetrating into the surfactant film and
consequently creating a disordered film because of the void space
generated among surfactant molecules. Microemulsions may, however,
be prepared without the use of cosurfactants and alcohol-free
self-emulsifying microemulsion systems are known in the art. The
aqueous phase may typically be, but is not limited to, water, an
aqueous solution of the drug, glycerol, PEG300, PEG400,
polyglycerols, propylene glycols, and derivatives of ethylene
glycol. The oil phase may include, but is not limited to, materials
such as Captex 300, Captex 355, Capmul MCM, fatty acid esters,
medium chain (C8-C12) mono, di, and tri-glycerides,
polyoxyethylated glyceryl fatty acid esters, fatty alcohols,
polyglycolized glycerides, saturated polyglycolized C8-C10
glycerides, vegetable oils and silicone oil.
[0346] Microemulsions are particularly of interest from the
standpoint of drug solubilization and the enhanced absorption of
drugs. Lipid based microemulsions (both o/w and w/o) have been
proposed to enhance the oral bioavailability of drugs, including
peptides (Constantinides et al., Pharmaceutical Research, 1994, 11,
1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13,
205). Microemulsions afford advantages of improved drug
solubilization, protection of drug from enzymatic hydrolysis,
possible enhancement of drug absorption due to surfactant-induced
alterations in membrane fluidity and permeability, ease of
preparation, ease of oral administration over solid dosage forms,
improved clinical potency, and decreased toxicity (Constantinides
et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J.
Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form
spontaneously when their components are brought together at ambient
temperature. This may be particularly advantageous when formulating
thermolabile drugs, peptides or oligonucleotides. Microemulsions
have also been effective in the transdermal delivery of active
components in both cosmetic and pharmaceutical applications. It is
expected that the microemulsion compositions and formulations of
the present invention will facilitate the increased systemic
absorption of oligonucleotides from the gastrointestinal tract, as
well as improve the local cellular uptake of oligonucleotides
within the gastrointestinal tract, vagina, buccal cavity and other
areas of administration.
[0347] Microemulsions of the present invention may also contain
additional components and additives such as sorbitan monostearate
(Grill 3), Labrasol, and penetration enhancers to improve the
properties of the formulation and to enhance the absorption of the
oligonucleotides and nucleic acids of the present invention.
Penetration enhancers used in the microemulsions of the present
invention may be classified as belonging to one of five broad
categories--surfactants, fatty acids, bile salts, chelating agents,
and non-chelating non-surfactants (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these
classes has been discussed above.
[0348] Liposomes
[0349] There are many organized surfactant structures besides
microemulsions that have been studied and used in the formulation
of drugs. These include monolayers, micelles, bilayers and
vesicles. Vesicles, such as liposomes, have attracted great
interest because of their specificity and the duration of action
they offer from the standpoint of drug delivery. As used in the
present invention, the term "liposome" means a vesicle composed of
amphiphilic lipids arranged in a spherical bilayer or bilayers.
[0350] Liposomes are unilamellar or multilamellar vesicles which
have a membrane formed from a lipophilic material and an aqueous
interior. The aqueous portion contains the composition to be
delivered. Cationic liposomes possess the advantage of being able
to fuse to the cell wall. Non-cationic liposomes, although not able
to fuse as efficiently with the cell wall, are taken up by
macrophages in vivo.
[0351] In order to cross intact mammalian skin, lipid vesicles must
pass through a series of fine pores, each with a diameter less than
50 nm, under the influence of a suitable transdermal gradient.
Therefore, it is desirable to use a liposome which is highly
deformable and able to pass through such fine pores.
[0352] Further advantages of liposomes include; liposomes obtained
from natural phospholipids are biocompatible and biodegradable;
liposomes can incorporate a wide range of water and lipid soluble
drugs; liposomes can protect encapsulated drugs in their internal
compartments from metabolism and degradation (Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
Important considerations in the preparation of liposome
formulations are the lipid surface charge, vesicle size and the
aqueous volume of the liposomes.
[0353] Liposomes are useful for the transfer and delivery of active
ingredients to the site of action. Because the liposomal membrane
is structurally similar to biological membranes, when liposomes are
applied to a tissue, the liposomes start to merge with the cellular
membranes. As the merging of the liposome and cell progresses, the
liposomal contents are emptied into the cell where the active agent
may act.
[0354] Liposomal formulations have been the focus of extensive
investigation as the mode of delivery for many drugs. There is
growing evidence that for topical administration, liposomes present
several advantages over other formulations. Such advantages include
reduced side-effects related to high systemic absorption of the
administered drug, increased accumulation of the administered drug
at the desired target, and the ability to administer a wide variety
of drugs, both hydrophilic and hydrophobic, into the skin.
[0355] Several reports have detailed the ability of liposomes to
deliver agents including high-molecular weight DNA into the skin.
Compounds including analgesics, antibodies, hormones and
high-molecular weight DNAs have been administered to the skin. The
majority of applications resulted in the targeting of the upper
epidermis.
[0356] Liposomes fall into two broad classes and are useful for the
delivery of DNA, RNA or any nucleic acid-based construct. Cationic
liposomes are positively charged liposomes which interact with
negatively charged DNA molecules to form a stable complex. The
positively charged DNA/liposome complex binds to the negatively
charged cell surface and is internalized in an endosome. Due to the
acidic pH within the endosome, the liposomes are ruptured,
releasing their contents into the cell cytoplasm (Wang et al.,
Biochem. Biophys. Res. Commun., 1987, 147, 980-985).
[0357] Liposomes which are pH-sensitive or negatively-charged,
entrap DNA rather than complex with it. Since both the DNA and the
lipid are similarly charged, repulsion rather than complex
formation occurs. Nevertheless, some DNA is entrapped within the
aqueous interior of these liposomes. pH-sensitive liposomes have
been used to deliver DNA encoding the thymidine kinase gene to cell
monolayers in culture. Expression of the exogenous gene was
detected in the target cells (Zhou et al., Journal of Controlled
Release, 1992, 19, 269-274).
[0358] One major type of liposomal composition includes
phospholipids other than naturally-derived phosphatidylcholine.
Neutral liposome compositions, for example, can be formed from
dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl
phosphatidylcholine (DPPC). Anionic liposome compositions generally
are formed from dimyristoyl phosphatidylglycerol, while anionic
fusogenic liposomes are formed primarily from dioleoyl
phosphatidylethanolamine (DOPE). Another type of liposomal
composition is formed from phosphatidylcholine (PC) such as, for
example, soybean PC, and egg PC. Another type is formed from
mixtures of phospholipid and/or phosphatidylcholine and/or
cholesterol.
[0359] Several studies have assessed the topical delivery of
liposomal drug formulations to the skin. Application of liposomes
containing interferon to guinea pig skin resulted in a reduction of
skin herpes sores while delivery of interferon via other means
(e.g. as a solution or as an emulsion) were ineffective (Weiner et
al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an
additional study tested the efficacy of interferon administered as
part of a liposomal formulation to the administration of interferon
using an aqueous system, and concluded that the liposomal
formulation was superior to aqueous administration (du Plessis et
al., Antiviral Research, 1992, 18, 259-265).
[0360] Non-ionic liposomal systems have also been examined to
determine their utility in the delivery of drugs to the skin, in
particular systems comprising non-ionic surfactant and cholesterol.
Non-ionic liposomal formulations comprising Novasome.TM. I
(glyceryl dilaurate/cholesterol/po- lyoxyethylene-10-stearyl ether)
and Novasome.TM. II (glyceryl
distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used
to deliver cyclosporin-A into the dermis of mouse skin. Results
indicated that such non-ionic liposomal systems were effective in
facilitating the deposition of cyclosporin-A into different layers
of the skin (Hu et al. S.T.P.Pharma. Sci., 1994, 4, 6, 466).
[0361] Liposomes also include "sterically stabilized" liposomes, a
term which, as used herein, refers to liposomes comprising one or
more specialized lipids that, when incorporated into liposomes,
result in enhanced circulation lifetimes relative to liposomes
lacking such specialized lipids. Examples of sterically stabilized
liposomes are those in which part of the vesicle-forming lipid
portion of the liposome (A) comprises one or more glycolipids, such
as monosialoganglioside G.sub.M1, or (B) is derivatized with one or
more hydrophilic polymers, such as a polyethylene glycol (PEG)
moiety. While not wishing to be bound by any particular theory, it
is thought in the art that, at least for sterically stabilized
liposomes containing gangliosides, sphingomyelin, or
PEG-derivatized lipids, the enhanced circulation half-life of these
sterically stabilized liposomes derives from a reduced uptake into
cells of the reticuloendothelial system (RES) (Allen et al., FEBS
Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53,
3765).
[0362] Various liposomes comprising one or more glycolipids are
known in the art. Papahadjopoulos et al. (Ann. N.Y Acad. Sci.,
1987, 507, 64) reported the ability of monosialoganglioside
G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to
improve blood half-lives of liposomes. These findings were
expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A.,
1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to
Allen et al., disclose liposomes comprising (1) sphingomyelin and
(2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester.
U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes
comprising sphingomyelin. Liposomes comprising
1,2-sn-dimyristoylphosphat- idylcholine are disclosed in WO
97/13499 (Lim et al.).
[0363] Many liposomes comprising lipids derivatized with one or
more hydrophilic polymers, and methods of preparation thereof, are
known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53,
2778) described liposomes comprising a nonionic detergent,
2C.sub.1215G, that contains a PEG moiety. Illum et al. (FEBS Lett.,
1984, 167, 79) noted that hydrophilic coating of polystyrene
particles with polymeric glycols results in significantly enhanced
blood half-lives. Synthetic phospholipids modified by the
attachment of carboxylic groups of polyalkylene glycols (e.g., PEG)
are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899).
Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments
demonstrating that liposomes comprising phosphatidylethanolamine
(PE) derivatized with PEG or PEG stearate have significant
increases in blood circulation half-lives. Blume et al. (Biochimica
et Biophysica Acta, 1990, 1029, 91) extended such observations to
other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from
the combination of distearoylphosphatidylethanolamine (DSPE) and
PEG. Liposomes having covalently bound PEG moieties on their
external surface are described in European Patent No. EP 0 445 131
B1 and WO 90/04384 to Fisher. Liposome compositions containing 1-20
mole percent of PE derivatized with PEG, and methods of use
thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556
and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and
European Patent No. EP 0 496 813 B1). Liposomes comprising a number
of other lipid-polymer conjugates are disclosed in WO 91/05545 and
U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073
(Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids
are described in WO 96/10391 (Choi et al.). U.S. Pat. Nos.
5,540,935 (Miyazaki et al.) and 5,556,948 (Tagawa et al.) describe
PEG-containing liposomes that can be further derivatized with
functional moieties on their surfaces.
[0364] WO 96/40062 to Thierry et al. discloses methods for
encapsulating high molecular weight nucleic acids in liposomes.
U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded
liposomes and asserts that the contents of such liposomes may
include an antisense RNA. U.S. Pat. No. 5,665,710 to Rahman et al.
describes certain methods of encapsulating oligodeoxynucleotides in
liposomes. WO 97/04787 to Love et al. discloses liposomes
comprising antisense oligonucleotides targeted to the raf gene.
[0365] Transfersomes are yet another type of liposomes, and are
highly deformable lipid aggregates which are attractive candidates
for drug delivery vehicles. Transfersomes may be described as lipid
droplets which are so highly deformable that they are easily able
to penetrate through pores which are smaller than the droplet.
Transfersomes are adaptable to the environment in which they are
used, e.g. they are self-optimizing (adaptive to the shape of pores
in the skin), self-repairing, frequently reach their targets
without fragmenting, and often self-loading. To make transfersomes
it is possible to add surface edge-activators, usually surfactants,
to a standard liposomal composition. Transfersomes have been used
to deliver serum albumin to the skin. The transfersome-mediated
delivery of serum albumin has been shown to be as effective as
subcutaneous injection of a solution containing serum albumin.
[0366] Surfactants find wide application in formulations such as
emulsions (including microemulsions) and liposomes. The most common
way of classifying and ranking the properties of the many different
types of surfactants, both natural and synthetic, is by the use of
the hydrophile/lipophile balance (HLB). The nature of the
hydrophilic group (also known as the "head") provides the most
useful means for categorizing the different surfactants used in
formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel
Dekker, Inc., New York, N.Y., 1988, p. 285).
[0367] If the surfactant molecule is not ionized, it is classified
as a nonionic surfactant. Nonionic surfactants find wide
application in pharmaceutical and cosmetic products and are usable
over a wide range of pH values. In general their HLB values range
from 2 to about 18 depending on their structure. Nonionic
surfactants include nonionic esters such as ethylene glycol esters,
propylene glycol esters, glyceryl esters, polyglyceryl esters,
sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic
alkanolamides and ethers such as fatty alcohol ethoxylates,
propoxylated alcohols, and ethoxylated/propoxylated block polymers
are also included in this class. The polyoxyethylene surfactants
are the most popular members of the nonionic surfactant class.
[0368] If the surfactant molecule carries a negative charge when it
is dissolved or dispersed in water, the surfactant is classified as
anionic. Anionic surfactants include carboxylates such as soaps,
acyl lactylates, acyl amides of amino acids, esters of sulfuric
acid such as alkyl sulfates and ethoxylated alkyl sulfates,
sulfonates such as alkyl benzene sulfonates, acyl isethionates,
acyl taurates and sulfosuccinates, and phosphates. The most
important members of the anionic surfactant class are the alkyl
sulfates and the soaps.
[0369] If the surfactant molecule carries a positive charge when it
is dissolved or dispersed in water, the surfactant is classified as
cationic. Cationic surfactants include quaternary ammonium salts
and ethoxylated amines. The quaternary ammonium salts are the most
used members of this class.
[0370] If the surfactant molecule has the ability to carry either a
positive or negative charge, the surfactant is classified as
amphoteric. Amphoteric surfactants include acrylic acid
derivatives, substituted alkylamides, N-alkylbetaines and
phosphatides.
[0371] The use of surfactants in drug products, formulations and in
emulsions has been reviewed (Rieger, in Pharmaceutical Dosage
Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
[0372] Pharmaceutically acceptable organic or inorganic excipient
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can also be used to
formulate the compositions of the present invention. Suitable
pharmaceutically acceptable carriers include, but are not limited
to, water, salt solutions, alcohols, polyethylene glycols, gelatin,
lactose, amylose, magnesium stearate, talc, silicic acid, viscous
paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the
like.
[0373] Formulations for topical administration of nucleic acids may
include sterile and non-sterile aqueous solutions, non-aqueous
solutions in common solvents such as alcohols, or solutions of the
nucleic acids in liquid or solid oil biases. The solutions may also
contain buffers, diluents and other suitable additives.
Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can be used.
[0374] Suitable pharmaceutically acceptable excipients include, but
are not limited to, water, salt solutions, alcohol, polyethylene
glycols, gelatin, lactose, amylose, magnesium stearate, talc,
silicic acid, viscous paraffin, hydroxymethylcellulose,
polyvinylpyrrolidone and the like.
[0375] Pulsatile Delivery
[0376] The compounds of the present invention may also be
administered by pulsatile delivery. "Pulsatile delivery" refers to
a pharmaceutical formulation that delivers a first pulse of drug
(e.g. an antisense compound) combined with a penetration enhancer
and a second pulse of penetration enhancer to promote absorption of
drug which is not absorbed upon release with the first pulse of
penetration enhancer.
[0377] One embodiment of the present invention is a delayed release
oral formulation for enhanced intestinal drug absorption,
comprising:
[0378] (a) a first population of carrier particles comprising said
drug and a penetration enhancer, wherein said drug and said
penetration enhancer are released at a first location in the
intestine; and
[0379] (b) a second population of carrier particles comprising a
penetration enhancer and a delayed release coating or matrix,
wherein the penetration enhancer is released at a second location
in the intestine downstream from the first location, whereby
absorption of the drug is enhanced when the drug reaches the second
location.
[0380] Alternatively, the penetration enhancer in (a) and (b) is
different. This enhancement is obtained by encapsulating at least
two populations of carrier particles. The first population of
carrier particles comprises a biologically active substance and a
penetration enhancer, and the second (and optionally additional)
population of carrier particles comprises a penetration enhancer
and a delayed release coating or matrix.
[0381] A "first pass effect" that applies to orally administered
drugs is degradation due to the action of gastric acid and various
digestive enzymes. One means of ameliorating first pass clearance
effects is to increase the dose of administered drug, thereby
compensating for proportion of drug lost to first pass clearance.
Although this may be readily achieved with i.v. administration by,
for example, simply providing more of the drug to an animal, other
factors influence the bioavailability of drugs administered via
non-parenteral means. For example, a drug may be enzymatically or
chemically degraded in the alimentary canal or blood stream and/or
may be impermeable or semipermeable to various mucosal
membranes.
[0382] It is also contemplated that these pharmacutical compositons
are capable of enhancing absorption of biologically active
substances when administered via the rectal, vaginal, nasal or
pulmonary routes. It is also contemplated that release of the
biologically active substance can be achieved in any part of the
gastrointestinal tract.
[0383] Liquid pharmaceutical compositions of oligonucleotide can be
prepared by combining the oligonucleotide with a suitable vehicle,
for example sterile pyrogen free water, or saline solution. Other
therapeutic compounds may optionally be included.
[0384] The present invention also contemplates the use of solid
particulate compositions. Such compositions comprise particles of
oligonucleotide that are of respirable size. Such particles can be
prepared by, for example, grinding dry oligonucleotide by
conventional means, fore example with a mortar and pestle, and then
passing the resulting powder composition through a 400 mesh screen
to segregate large particles and agglomerates. A solid particulate
composition comprised of an active oligonucleotide can optionally
contain a dispersant which serves to facilitate the formation of an
aerosol, for example lactose.
[0385] In accordance with the present invention, oligonucleotide
compositions can be aerosolized. Aerosolization of liquid particles
can be produced by any suitable means, such as with a nebulizer.
See, for example, U.S. Pat. No. 4,501,729. Nebulizers are
commercially available devices which transform solutions or
suspensions into a therapeutic aerosol mist either by means of
acceleration of a compressed gas, typically air or oxygen, through
a narrow venturi orifice or by means of ultrasonic agitation.
Suitable nebulizers include those sold by Blairex.RTM. under the
name PARI LC PLUS, PARI DURA-NEB 2000, PARI-BABY Size, PARI PRONEB
Compressor with LC PLUS, PARI WALKHALER Compressor/Nebulizer
System, PARI LC PLUS Reusable Nebulizer, and PARI LC Jet+
.RTM.Nebulizer.
[0386] Formulations for use in nebulizers may consist of an
oligonucleotide in a liquid, such as sterile, pyragen free water,
or saline solution, wherein the oligonucleotide comprises up to
about 40% w/w of the formulation. The oligonucleotide can comprise
less than 20% w/w. If desired, further additives such as
preservatives (for example, methyl hydroxybenzoate) antioxidants,
and flavoring agents can be added to the composition.
[0387] Solid particles comprising an oligonucleotide can also be
aerosolized using any solid particulate medicament aerosol
generator known in the art. Such aerosol generators produce
respirable particles, as described above, and further produce
reproducible metered dose per unit volume of aerosol. Suitable
solid particulate aerosol generators include insufflators and
metered dose inhalers. Metered dose inhalers are used in the art
and are useful in the present invention.
[0388] Liquid or solid aerosols are produced at a rate of from
about 10 to 150 liters per minute, from about 30 to 150 liters per
minute, or from about 60 to 150 liters per minute.
[0389] Enhanced bioavailability of biologically active substances
is also achieved via the oral administration of the compositions
and methods of the present invention.
[0390] Other Components
[0391] The compositions of the present invention may additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions may contain additional,
compatible, pharmaceutically-active materials such as, for example,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may contain additional materials useful in physically
formulating various dosage forms of the compositions of the present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the present invention. The formulations can be
sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the nucleic acid(s) of the
formulation.
[0392] Aqueous suspensions may contain substances which increase
the viscosity of the suspension including, for example, sodium
carboxymethylcellulose, sorbitol and/or dextran. The suspension may
also contain stabilizers.
[0393] Certain embodiments of the invention provide pharmaceutical
compositions containing (a) one or more antisense compounds and (b)
one or more other chemotherapeutic agents which function by a
non-antisense mechanism. Examples of such chemotherapeutic agents
include but are not limited to daunorubicin, daunomycin,
dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin,
bleomycin, mafosfamide, ifosfamide, cytosine arabinoside,
bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D,
mithramycin, prednisone, hydroxyprogesterone, testosterone,
tamoxifen, dacarbazine, procarbazine, hexamethylmelamine,
pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil,
methylcyclohexylnitrosurea, nitrogen mustards, melphalan,
cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine,
5-azacytidine, hydroxyurea, deoxycoformycin,
4-hydroxyperoxycyclophosphor- amide, 5-fluorouracil (5-FU),
5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine,
taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate,
irinotecan, topotecan, gemcitabine, teniposide, cisplatin and
diethylstilbestrol (DES). See, generally, The Merck Manual of
Diagnosis and Therapy, 15th Ed. 1987, pp. 1206-1228, Berkow et al.,
eds., Rahway, N.J. When used with the compounds of the invention,
such chemotherapeutic agents may be used individually (e.g., 5-FU
and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide
for a period of time followed by MTX and oligonucleotide), or in
combination with one or more other such chemotherapeutic agents
(e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and
oligonucleotide). Anti-inflammatory drugs, including but not
limited to nonsteroidal anti-inflammatory drugs and
corticosteroids, and antiviral drugs, including but not limited to
ribivirin, vidarabine, acyclovir and ganciclovir, may also be
combined in compositions of the invention. See, generally, The
Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al.,
eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively).
Other non-antisense chemotherapeutic agents are also within the
scope of this invention. Two or more combined compounds may be used
together or sequentially.
[0394] In another related embodiment, compositions of the invention
may contain one or more antisense compounds, particularly
oligonucleotides, targeted to a first nucleic acid and one or more
additional antisense compounds targeted to a second nucleic acid
target. Two or more antisense compounds may be used together or
sequentially.
[0395] Dosing
[0396] The formulation of therapeutic compositions and their
subsequent administration (dosing) is believed to be within the
skill of those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50s found to be
effective in in vitro and in vivo animal models. In general, dosage
is from 0.01 .mu.g to 100 g per kg of body weight, from 0.1 .mu.g
to 10 g per kg of body weight, from 1.0 .mu.g to 1 g per kg of body
weight, from 10.0 .mu.g to 100 mg per kg of body weight, from 100
.mu.g to 10 mg per kg of body weight, or from 1 mg to 5 mg per kg
of body weight, and may be given once or more daily, weekly,
monthly or yearly, or even once every 2 to 20 years. Persons of
ordinary skill in the art can easily estimate repetition rates for
dosing based on measured residence times and concentrations of the
drug in bodily fluids or tissues. Following successful treatment,
it may be desirable to have the patient undergo maintenance therapy
to prevent the recurrence of the disease state, wherein the
oligonucleotide is administered in maintenance doses, ranging from
0.01 .mu.g to 100 g per kg of body weight, once or more daily, to
once every 20 years.
[0397] The effects of treatments with therapeutic compositions can
be assessed following collection of tissues or fluids from a
patient or subject receiving said treatments. It is known in the
art that a biopsy sample can be procured from certain tissues
without resulting in detrimental effects to a patient or subject.
In certain embodiments, a tissue and its constituent cells
comprise, but are not limited to, blood (e.g., hematopoietic cells,
such as human hematopoietic progenitor cells, human hematopoietic
stem cells, CD34+ cells CD4+ cells), lymphocytes and other blood
lineage cells, bone marrow, breast, cervix, colon, esophagus, lymph
node, muscle, peripheral blood, oral mucosa and skin. In other
embodiments, a fluid and its constituent cells comprise, but are
not limited to, blood, urine, semen, synovial fluid, lymphatic
fluid and cerebro-spinal fluid. Tissues or fluids procured from
patients can be evaluated for expression levels of the target mRNA
or protein. Additionally, the mRNA or protein expression levels of
other genes known or suspected to be associated with the specific
disease state, condition or phenotype can be assessed. mRNA levels
can be measured or evaluated by real-time PCR, Northern blot, in
situ hybridization or DNA array analysis. Protein levels can be
measured or evaluated by ELISA, immunoblotting, quantitative
protein assays, protein activity assays (for example, caspase
activity assays) immunohistochemistry or immunocytochemistry.
Furthermore, the effects of treatment can be assessed by measuring
biomarkers associated with the disease or condition in the
aforementioned tissues and fluids, collected from a patient or
subject receiving treatment, by routine clinical methods known in
the art. These biomarkers include but are not limited to: glucose,
cholesterol, lipoproteins, triglycerides, free fatty acids and
other markers of glucose and lipid metabolism; lipoprotein(a)
particle and apolipoprotein B-100; liver transaminases, bilirubin,
albumin, blood urea nitrogen, creatine and other markers of kidney
and liver function; interleukins, tumor necrosis factors,
intracellular adhesion molecules, C-reactive protein and other
markers of inflammation; testosterone, estrogen and other hormones;
tumor markers; vitamins, minerals and electrolytes.
[0398] The present invention also provides methods of reducing
target RNA levels in an animal comprising contacting the animal
with a gap-disabled compound comprising a gap-disabled motif listed
in Table 13 or Table 26 and wherein the gap-disabled compound
comprises a nucleobase sequence substantially complementary to a
portion of the target RNA. These methods may also comprise
identifying an animal in need of reducing target RNA levels.
[0399] The present invention also provides methods of lowering
cholesterol or triglycerides in an animal comprising contacting the
animal with a gap-disabled compound comprising the gap-disabled
motif 3-2-1-2-1-2-1-2-1-2-3. These methods may also comprise
identifying an animal in need of lowering cholesterol or
triglycerides.
[0400] The present invention also provides methods of lowering
plasma leptin, glucose, or plasma insulin in an animal comprising
contacting the animal with a gap-disabled compound having the
gap-disabled motif 3-2-1-2-1-2-1-2-1-2-3. These methods may also
comprise identifying an animal in need of lowering plasma leptin,
glucose, or plasma insulin.
[0401] The present invention also provides methods of lowering body
weight, fat depot weight or food intake in an animal comprising
contacting the animal with a gap-disabled compound comprising the
gap-disabled motif 3-2-1-2-1-2-1-2-1-2-3. These methods may also
comprise identifying an animal in need of lowering body weight, fat
depot weight or food intake.
[0402] The present invention also provides methods of reducing
serum cholesterol, triglycerides or body weight in an obese animal
comprising contacting the animal with a gap-disabled compound
comprising the gap-disabled motif of 3-2-1-2-1-2-1-2-1-2-3. These
methods may also comprise identifying an obese animal in need of
reducing serum cholesterol, triglycerides or body weight.
[0403] In order that the invention disclosed herein may be more
efficiently understood, examples are provided below. It should be
understood that these examples are for illustrative purposes only
and are not to be construed as limiting the invention in any
manner. Throughout these examples, molecular cloning reactions, and
other standard recombinant DNA techniques, were carried out
according to methods described in Maniatis et al., Molecular
Cloning--A Laboratory Manual, 2nd ed., Cold Spring Harbor Press
(1989), using commercially available reagents, except where
otherwise noted.
EXAMPLES
Examples 1-17
(Scheme I, FIGS. 1-3)
Preparation of
1-(8-hydroxy-5-hydroxymethyl-2-methyl-3,6-dioxa-2-aza-bicyc-
lo[3.2.1]oct-7-yl)-1H-pyrimidine-2,4-dione (1)
[0404] 25
Example 1
1-(3-hydroxy-5,5,7,7-tetraisopropyl-tetrahydro-1,4,6,8-tetraoxa-5,7-disila-
-cyclopentacycloocten-2-yl)-1H-pyrimidine-2,4-dione (4)
[0405] The 3',5'-protected nucleoside is prepared as illustrated in
Karpeisky, A., et. al., Tetrahedron Lett. 1998, 39, 1131-1134. To a
solution of arabinouridine (3, 1.0 eq., 0.degree. C.) in anhydrous
pyridine is added 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane
(1.1 eq.). The resulting solution is warmed to room temperature and
stirred for two hours. The reaction mixture is subsequently
quenched with methanol, concentrated to an oil, dissolved in
dichloromethane, washed with aqueous NaHCO.sub.3 and saturated
brine, dried over anhydrous Na.sub.2SO.sub.4, filtered, and
evaporated. Purification by silica gel chromatography will yield
Compound 4.
[0406] For the preparation of the corresponding cytidine and
adenosine analogs, N.sup.4-benzoyl arabinocytidine and
N.sup.6-benzoyl arabinoadenosine are used, respectively, both of
which are prepared from the unprotected arabinonucleoside using the
transient protection strategy as illustrated in Ti, et al., J. Am.
Chem. Soc. 1982, 104, 1316-1319. Alternatively, the cytidine analog
can also be prepared by conversion of the uridine analog as
illustrated in Lin, et al., J. Med. Chem. 1983, 26, 1691.
Example 2
acetic acid
2-(2,4-dioxo-3,4-dihydro-2H-pyrimidin-1-yl)-5,5,7,7-tetraisopr-
opyl-tetrahydro-1,4,6,8-tetraoxa-5,7-disila-cyclopentacycloocten-3-yl
ester (5)
[0407] Compound 4 is O-Acetylated using well known literature
procedures (Protective Groups in Organic Synthesis, 3.sup.rd
edition, 1999, pp. 150-160 and references cited therein and in
Greene, T. W. and Wuts, P. G. M., eds, Wiley-Interscience, New
York.) Acetic anhydride (2 to 2.5 eq.) and triethylamine (4 eq.) is
added to a solution of 4 (1 eq.) and N,N-dimethylaminopyridine (0.1
eq.) in anhydrous pyridine. After stirring at room temperature for
1 hour the mixture is treated with methanol to quench excess acetic
anhydride and evaporated. The residue is redissolved in ethyl
acetate, washed extensively with aqueous NaHCO.sub.3, dried over
anhydrous Na.sub.2SO.sub.4, filtered, and evaporated. The compound
is used without further purification.
Example 3
acetic acid
2-(2,4-dioxo-3,4-dihydro-2H-pyrimidin-1-yl)-4-hydroxy-5-hydrox-
ymethyl-tetrahydro-furan-3-yl ester (6)
[0408] The Tips protecting group is removed from Compound 5 as
illustrated in the literature (Protective Groups in Organic
Synthesis, 3.sup.rd edition, 1999, pp. 239 and references therein,
Greene, T. W. and Wuts, P. G. M., eds, Wiley-Interscience, New
York). To a solution of 5 (1 eq.) in anhydrous dichloromethane is
added triethylamine (2 eq.) and triethylamine trihydrofluoride (2
eq.). The reaction mixture is monitored by thin layer
chromatography until complete at which point the reaction mixture
is diluted with additional dichloromethane, washed with aqueous
NaHCO.sub.3, dried over anhydrous Na.sub.2SO.sub.4, and evaporated.
The resulting Compound 6 is optionally purified by silica gel
chromatography.
Example 4
acetic acid
5-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-2-(2,4-dioxo-3-
,4-dihydro-2H-pyrimidin-1-yl)-4-hydroxy-tetrahydro-furan-3-yl ester
(7)
[0409] Dimethoxytritylation of Compound 6 is performed using known
literature procedures. Formation of the primary
4,4'-dimethoxytrityl ether should be achieved using standard
conditions (Nucleic Acids in Chemistry and Biology, 1992, pp.
108-110, Blackburn, Michael G., and Gait, Michael J., eds, IRL
Press, New York.) Generally, a solution of 6 (1 eq.) and
N,N-dimethylaminopyridine (0.1 eq.) in anhydrous pyridine is
treated with 4,4'-dimethoxytrityl chloride (DMTCl, 1.2 eq.) and
triethylamine (4 eq.). After several hours at room temperature,
excess 4,4'-dimethoxytrityl chloride is quenched with the addition
of methanol and the mixture is evaporated. The mixture is dissolved
in dichloromethane and washed extensively with aqueous NaHCO.sub.3
and dried over anhydrous Na.sub.2SO.sub.4. Purification by silica
gel chromatography will yield Compound 7.
Example 5
acetic acid
5-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-(tert-butyl--
diphenyl-silanyloxy)-2-(2,4-dioxo-3,4-dihydro-2H-pyrimidin-1-yl)-tetrahydr-
o-furan-3-yl ester (8)
[0410] The preparation of tert-butyldiphenylsilyl ethers is a
common, routine procedure (Protective Groups in Organic Synthesis,
3.sup.rd edition, 1999, pp. 141-144 and references therein, Greene,
T. W. and Wuts, P. G. M., eds, Wiley-Interscience, New York). In
general, a solution of one eq. of 7 and imidazole (3.5 eq.) in
anhydrous N,N-dimethylformamide (DMF) is treated with
tert-butyldiphenylsilyl chloride (1.2 eq.). After stirring at room
temperature for several hours, the reaction mixture is poured into
ethyl acetate and washed extensively with water and saturated brine
solution. The resulting organic solution is dried over anhydrous
sodium sulfate, filtered, evaporated, and purified by silica gel
chromatography to give Compound 8.
Example 6
acetic acid
4-(tert-butyl-diphenyl-silanyloxy)-2-(2,4-dioxo-3,4-dihydro-.s-
up.2H-pyrimidin-1-yl)-5-hydroxymethyl-tetrahydro-furan-3-yl ester
(9)
[0411] The 5'-O-DMT group is removed as per known literature
procedures 4,4'-dimethoxytrityl ethers are commonly removed under
acidic conditions (Oligonucleotides and analogues, A Practical
Approach, Eckstein, F., ed, IRL Press, New York.) Generally,
Compound 8 (1 eq.) is dissolved in 80% aqueous acetic acid. After
several hours, the mixture is evaporated, dissolved in ethyl
acetate and washed with a sodium bicarbonate solution. Purification
by silica gel chromatography will give compound 9.
Example 7
acetic acid
4-(tert-butyl-diphenyl-silanyloxy)-2-(2,4-dioxo-3,4-dihydro-2H-
-pyrimidin-1-yl)-5-formyl-tetrahydro-furan-3-yl ester (10)
[0412] To a mixture of trichloroacetic anhydride (1.5 eq.) and
dimethylsulfoxide (2.0 eq.) in dichloromethane at -78.degree. C. is
added a solution of Compound 9 in dichloromethane. After 30
minutes, triethylamine (4.5 eq.) is added. Subsequently, the
mixture is poured into ethyl acetate, washed with water and brine,
dried over anhydrous sodium sulfate, and evaporated to dryness. The
resulting material is carried into the next step without further
purification. This procedure has been used to prepare the related
4'-C-.A-inverted.-formyl nucleosides (Nomura, M., et. al., J. Med.
Chem. 1999, 42, 2901-2908).
Example 8
1-[4-(tert-butyl-diphenyl-silanyloxy)-3-hydroxy-5,5-bis-hydroxymethyl-tetr-
ahydro-furan-2-yl]-1H-pyrimidine-2,4-dione (11)
[0413] Hydroxymethylation of the 5'-aldehyde is performed as per
the method of Cannizzaro which is well documented in the literature
(Jones, G. H., et. al., J. Org. Chem. 1979, 44, 1309-1317). These
condisions are expected to additionally remove the 2'-O-acetyl
group. Generally, Briefly, formaldehyde (2.0 eq., 37% aq.) and NaOH
(1.2 eq., 2 M) is added to a solution of Compound 10 in
1,4-dioxane. After stirring at room temperature for several hours,
this mixture is neutralized with acetic acid, evaporated to
dryness, suspended in methanol, and evaporated onto silica gel. The
resulting mixture is added to the top of a silica gel column and
eluted using an appropriate solvent system to give Compound 11.
Example 9
1-[5-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-(tert-butyl-diphenyl--
silanyloxy)-3-hydroxy-5-hydroxymethyl-tetrahydro-furan-2-yl]-1H-pyrimidine-
-2,4-dione (12)
[0414] Preferential protection with DMT at the
.A-inverted.-hydroxymethyl position is performed following a
published literature procedure (Nomura, M., et. al., J. Med. Chem.
1999, 42, 2901-2908). Generally, a solution of Compound 11 (1 eq.)
in anhydrous pyridine is treated with DMTCl (1.3 eq.), then stirred
at room temperature for several hours. Subsequently, the mixture is
poured into ethyl acetate, washed with water, dried over anhydrous
Na.sub.2SO.sub.4, filtered, and evaporated. Purification by silica
gel chromatography will yield Compound 12.
Example 10
1-[5-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-(tert-butyl-diphenyl--
silanyloxy)-5-(tert-butyl-diphenyl-silanyloxymethyl)-3-hydroxy-tetrahydro--
furan-2-yl]-1H-pyrimidine-2,4-dione (13)
[0415] The 5'-hydroxyl positon is selectively protected with
tert-butyldiphenylsilyl following published literature procedures
(Protective Groups in Organic Synthesis, 3.sup.rd edition, 1999,
pp. 141-144 and references therein, Greene, T. W. and Wuts, P. G.
M., eds, Wiley-Interscience, New York). Generally, a solution of
Compound 12 (1 eq.) and N,N-dimethylaminopyridine (0.2 eq.) in
anhydrous dichloromethane is treated with tert-butyldiphenylsilyl
chloride (1.2 eq.) and triethylamine (4 eq.). After several hours
at room temperature, the reaction is quenched with methanol, poured
into ethyl acetate, washed with saturated NaHCO.sub.3, saturated
brine, dried over anhydrous Na.sub.2SO.sub.4, filtered, and
evaporated. Purification by silica gel chromatography will yield
Compound 13.
Example 11
acetic acid
5-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-(tert-butyl--
diphenyl-silanyloxy)-5-(tert-butyl-diphenyl-silanyloxymethyl)-2-(2,4-dioxo-
-3,4-dihydro-2H-pyrimidin-1-yl)-tetrahydro-furan-3-yl ester
(14)
[0416] Compound 14 is prepared as per the procedure illustrated in
Example 2 above.
Example 12
acetic acid
4-(tert-butyl-diphenyl-silanyloxy)-5-(tert-butyl-diphenyl-sila-
nyloxymethyl)-2-(2,4-dioxo-3,4-dihydro-2H-pyrimidin-1-yl)-5-hydroxymethyl--
tetrahydro-furan-3-yl ester (15)
[0417] Compound 15 is prepared as per the procedure illustrated in
Example 9 above.
Example 13
acetic acid
4-(tert-butyl-diphenyl-silanyloxy)-5-(tert-butyl-diphenyl-sila-
nyloxymethyl)-5-(1,3-dioxo-1,3-dihydro-isoindol-2-yloxymethyl)-2-(2,4-diox-
o-3,4-dihydro-2H-pyrimidin-1-yl)-tetrahydro-furan-3-yl ester
(16)
[0418] The use of the Mitsunobu procedure to generate the
5'-O-phthalimido nucleosides starting with the 5'-unprotected
nucleosides has been reported previously (Perbost, M., et. al., J.
Org. Chem. 1995, 60, 5150-5156). Generally, a mixture of Compound
15 (1 eq.), triphenylphosphine (1.15 eq.), and N-hydroxyphthalimide
(PhthNOH, 1.15 eq.) in anhydrous 1,4-dioxane is treated with
diethyl azodicarboxylate (DEAD, 1.15 eq.). The reaction is stirred
at room temperature for several hours until complete by thin layer
chromatography. The resulting mixture is evaporated, suspended in
ethyl acetate, washed with both saturated NaHCO.sub.3 and saturated
brine, dried over anhydrous Na.sub.2SO.sub.4, filtered and
evaporated. Purification by silica gel chromatography will yield
Compound 16.
Example 14
1-[4-(tert-butyl-diphenyl-silanyloxy)-5-(tert-butyl-diphenyl-silanyloxymet-
hyl)-3-hydroxy-5-methyleneaminooxymethyl-tetrahydro-furan-2-yl]-1H-pyrimid-
ine-2,4-dione (17)
[0419] This transformation is performed smoothly in high yield
using published procedures (Bhat, B., et. al., J. Org. Chem. 1996,
61, 8186-8199). Generally, a portion of Compound 16 is dissolved in
dichloromethane and cooled to -10.degree. C. To this solution is
added methylhydrazine (2.5 eq.). After 1-2 hours of stirring at
0.degree. C., the mixture is diluted with dichloromethane, washed
with water and brine, dried with anhydrous Na.sub.2SO.sub.4,
filtered, and evaporated. The resulting residue is immediately
redissolved in a 1:1 mixture of ethyl acetate:methanol, and treated
with 20% (w/w) aqueous formaldehyde (1.1 eq.). After an hour at
room temperature, the mixture is concentrated then purified by
silica gel chromatography to give Compound 17.
Example 15
methanesulfonic acid
4-(tert-butyl-diphenyl-silanyloxy)-5-(tert-butyl-diph-
enyl-silanyloxymethyl)-2-(2,4-dioxo-3,4-dihydro-2H-pyrimidin-1-yl)-5-methy-
lene-aminooxymethyl-tetrahydro-furan-3-yl ester (18)
[0420] The mesylation of hydroxyl groups proceeds readily under
these conditions (Protective Groups in Organic Synthesis, 3.sup.rd
edition, 1999, pp. 150-160 and references cited therein). Briefly,
to a solution of Compound 17 in a 1:1 mixture of anhydrous
dichloromethane and anhydrous pyridine is added methanesulfonyl
chloride (1.2 eq.). After stirring at room temperature for several
hours, this mixture is quenched with methanol, concentrated,
diluted with dichloromethane, washed with aqueous NaHCO.sub.3 and
brine, dried over anhydrous Na.sub.2SO.sub.4, filtered and
evaporated. Purification by silica gel chromatography will yield
Compound 18.
Example 16
1-[8-(tert-butyl-diphenyl-silanyloxy)-5-(tert-butyl-diphenyl-silanyloxymet-
hyl)-2-methyl-3,6-dioxa-2-aza-bicyclo[3.2.1]oct-7-yl]-1H-pyrimidine-2,4-di-
one (19)
[0421] The reduction of the formaldoxime moiety is performed as per
known literature procedures. Generally, a solution of Compound 18
in methanol is treated with sodium cyanoborohydride (1.5 eq.). This
treatment will result in quantitative reduction of the formaldoxime
moiety to yield the 4'-C-(aminooxymethyl) arabinonucleoside. The
proximity of the methylated electron-rich amine to the activated
2'-O-mesylate will result in the spontaneous ring closing of this
intermediate to yield bicyclic Compound 19. The reaction is
monitored by thin layer chromatography until completion. The
mixture is then poured into ethyl acetate, washed extensively with
aqueous NaHCO.sub.3 and brine, dried over anhydrous
Na.sub.2SO.sub.4, filtered and evaporated. Purification by silica
gel chromatography will yield Compound 19.
Example 17
1-(8-hydroxy-5-hydroxymethyl-2-methyl-3,6-dioxa-2-aza-bicyclo[3.2.1]oct-7--
yl)-1H-pyrimidine-2,4-dione (1)
[0422] The tert-butyldiphenylsilyl ether protecting groups are
readily cleaved by treatment with tetrabutylammonium fluoride
(Protective Groups in Organic Synthesis, 3.sup.rd edition, 1999,
pp. 141-144 and references therein, Greene, T. W. and Wuts, P. G.
M., eds, Wiley-Interscience, New York). Briefly, a solution of
Compound 19 in a minimal amount of tetrahydrofuran (THF) is treated
with a 1 M solution of tetrabutylammonium fluoride (TBAF, 5-10 eq.)
in THF. After several hours at room temperature, this mixture is
evaporated onto silica gel and subjected to silica gel
chromatography to give Compound 1.
Alternate Sythetic Route to Compound 1, Synthesis of Guanosine
Analog
Examples 18-25 (Scheme II, FIGS. 4-7)
Example 18
4-benzyloxy-5-benzyloxymethyl-5-hydroxymethyl-2-methoxy-tetrahydro-furan-3-
-ol (21)
[0423] The preparation of the protected
4'-C-hydroxymethylribofuranose, Compound 20, follows published
literature procedures (Koshkin, A. A., et. al., Tetrahedron 1998,
54, 3607-3630). Compound 20 (1 eq.) is dissolved in anhydrous
methanol and hydrogen chloride in an anhydrous solvent (either
methanol or 1,4-dioxane) is added to give a final concentration of
5% (w/v). After stirring at room temperature for several hours, the
mixture is concentrated to an oil, dried under vacuum, and used in
the next step without further purification.
Example 19
2-(3-benzyloxy-2-benzyloxymethyl-4-hydroxy-5-methoxy-tetrahydro-furan-2-yl-
methoxy)-isoindole-1,3-dione (22)
[0424] The O-phthalimido compound is prepared following the
reference cited and the procedures illustrated in Example 13 above.
The reaction can be adjusted to preferentially react at the primary
hydroxyl e.g. the 4'-C-hydroxymethyl group (Bhat, B., et. al., J.
Org. Chem. 1996, 61, 8186-8199). Generally, a solution of 21 (1
eq.), N-hydroxyphthalimide (1.1 eq.), and triphenylphosphine (1.1
eq.) in anhydrous tetrahydrofuran is treated with diethyl
azodicarboxylate (1.1 eq.). After several hours at room
temperature, the mixture is concentrated and subjected to silica
gel chromatography to give Compound 22.
Example 20
Formaldehyde
O-(3-benzyloxy-2-benzyloxymethyl-4-hydroxy-5-methoxy-tetrahyd-
ro-furan-2-ylmethyl)-oxime (23)
[0425] Compound 23 is prepared as per the procedure illustrated in
Example 14 above.
Example 21
methanesulfonic acid
4-benzyloxy-5-benzyloxymethyl-2-methoxy-5-methyleneam-
inooxymethyl-tetrahydro-furan-3-yl ester (24)
[0426] Mesylation is achieved with inversion of configuration using
Mitsunobu conditions (Anderson, N. G., et. al., J. Org Chem. 1996,
60, 7955). Generyally, a mixture of Compound 23 (1 eq.),
triphenylphosphine (1.2 eq.) and methanesulfonic acid (1.2 eq.) in
anhydrous 1,4-dioxane is treated with diethyl azodicarboxylate (1.2
eq.). After stirring at room temperature for several hours, the
resulting mixture is concentrated and subjected to silica gel
chromatography to give Compound 24.
Example 22
8-benzyloxy-5-benzyloxymethyl-7-methoxy-2-methyl-3,6-dioxa-2-aza-bicyclo[3-
.2.1]octane (25)
[0427] Compound 25 is prepared as per the procedure illustrated in
Example 16 above.
Example 23
acetic acid
8-benzyloxy-5-benzyloxymethyl-2-methyl-3,6-dioxa-2-aza-bicyclo-
[3.2.1]oct-7-yl ester (26)
[0428] Compound 25 is dissolved in 80% (v/v) aqueous acetic acid.
After 1-2 hours at room temperature, the solution is concentrated,
then dissolved in dichloromethane and washed with saturated aqueous
NaHCO.sub.3 and brine. The organic portion is subsequently dried
over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated. The
resulting mixture is coevaporated from anhydrous pyridine, then
dissolved in anhydrous pyridine and treated with acetic anhydride
(2 eq.). The solution is stirred overnight, quenched with methanol,
dissolved in ethyl acetate and washed extensively with saturated
NaHCO.sub.3. The organic portion is then dried (Na.sub.2SO.sub.4),
filtered and evaporated without further purification.
Example 24
1-(8-benzyloxy-5-benzyloxymethyl-2-methyl-3,6-dioxa-2-aza-bicyclo[3.2.1]oc-
t-7-yl)-1H-pyrimidine-2,4-dione (27)
[0429] Compound 26 is converted to one of several N-glycosides
(nucleosides) using published chemistry procedures including either
Vorbruggen chemistry or one of several other methods (Chemistry of
Nucleosides and Nucleotides, Volume 1, 1988, edited by Leroy B.
Townsend, Plenum Press, New York). To prepare the uradinyl analog,
a mixture of Compound 26 (1 eq.) and uracil (1.3 eq.) is suspended
in anhydrous acetonitrile. To the suspension is added
N,O-bis-(trimethylsilyl)-acetami- de (BSA, 4 eq.). The suspension
is heated to 70.degree. C. for 1 hour, then cooled to 0.degree. C.
and treated with trimethylsilyl-trifluorometh- anesulfonate
(TMSOTf, 1.6 eq.). The resulting solution is heated at 55.degree.
C. until the reaction appears complete by TLC. The reaction mixture
is poured into ethyl acetate and washed extensively with saturated
NaHCO.sub.3, dried over anhydrous Na.sub.2SO.sub.4, filtered,
evaporated, and purified by silica gel chromatography to give
Compound 24.
[0430] In order to use the above preparation with nucleobases with
reactive functional groups the reactive functional groups are
protected prior to use. For example such protected nucleobases
include naturally occurring nucleobases such as N.sup.4-benzoyl
cytosine, N.sup.6-benzoyl adenine and N.sup.2-isobutyryl
guanine.
Example 25
1-(8-hydroxy-5-hydroxymethyl-2-methyl-3,6-dioxa-2-aza-bicyclo[3.2.1]oct-7--
yl)-1H-pyrimidine-2,4-dione (1)
[0431] To give the desired product, Compound 1 the benzyl ethers
protecting groups are removed following published literature
procedures (Koshkin, A. A., et. al., Tetrahedron 1998, 54,
3607-3630). Generally, the bis-O-benzylated bicyclic Compound 27 is
dissolved in methanol. To this solution is added 20%
Pd(OH).sub.2/C, and the resulting suspension is maintained under an
atmosphere of H.sub.2 at 1-2 atm pressure. This mixture is stirred
at room temperature for several hours until complete by TLC, at
which point the Pd(OH).sub.2/C is removed by filtration, and the
filtrate is concentrated and purified by silica gel chromatography,
if necessary, to give Compound 1.
Example 26
2'-O-tert-butyldimethylsilyl-3'-C-styryluridine (33)
[0432] Compound 28 is treated with DMTCl, in pyridine in presence
of DMAP to get 5'-DMT derivative, Compound 29. Compound 29 is
treated with TBDMSCl in pyridine to which yields both the 2' and
the 3'-silyl derivative. The 3'-TBDMS derivative is isolated by
silica gel flash column chromatography and further heated with
phenyl chlorothionoformate and N-chlorosuccinimide in a solution of
pyridine in benzene 60.degree. C. to give Compound 31. Compound 31
is treated with .beta.-tributylstannylstyrene and AIBN in benzene
give Compound 32. Compound 32 is detritylated with dichloroacetic
acid in dichloromethane give compound 33.
Example 27
1-[(1R,3R,8S)-8-[(2-cyanoethyl)bis(1-methylethyl)phosphoramidite)-3-[(4,4'-
-dimethoxytrityloxy)methyl]-5-methyl-2-oxo-5-azabicyclo[2.3.1]octane-5-met-
hyl-2,4-(1H,3H)-pyrimidinedione (40)
[0433] Compound 33 is treated with oxalyl chloride in DMSO in the
presence of ethyl diisopropylamine to give the 5'-aldehyde which is
then subjected to a tandem aldol condensation and Cannizzaro
reaction using aqueous formaldehyde and 1 M NaOH in 1,4-dioxane to
yield the diol, Compound 34. Selective silylation with TBDMSCl in
pyridine and isolation of the required isomer will give Compound
35. Compound 35 is treated with methanesulfonyl chloride in
pyridine to give the methane sufonyl derivative which is treated
with methanolic ammonia to give compound 36. The double bond of
Compound 36 is oxidatively cleaved by oxymylation go give the diol
and then by cleavage of the diol with sodium periodate to give the
aldehyde, Compound 37. The amino and aldehyde groups in Compound 37
are cross coupled under reductive condition followed by methylation
of the amino group with formaldehyde in the presence of sodium
borohydride will give the Compound 38. Treatment of Compound 38
with triethylamine trihydrofluoride and triethylamine in THF will
give Compound 39. The primary alcohol of Compound 39 is selectively
titylated with DMTCl in pyridine followed by phosphytilation at
8-position to give Compound 40.
Example 28
1-[(1R,3R,8S)-8-[(2-cyanoethyl)bis(1-methylethyl)phosphoramidite)-3-[(4,4'-
-dimethoxytrityloxy)methyl]-5-methyl-2-oxo-5-azabicyclo[3.2.1]octan-4-one--
5-methyl-2,4-(1H,3H)-pyrimidinedione (47)
[0434] Compound 35 is benzylated with benzyl bromide in DMF and
sodium hydride to give Compound 41. Oxidative cleavage of Compound
41 will give an aldehyde at the 2'-position which is reduced to the
corresponding alcohol using sodium borohydride in methanol to give
Compound 42. Compound 42 is converted into the 3'-C-aminomethyl
derivative, Compound 43 by in situ generation of the methane
sulfonyl derivative and treatment with ammonia. The amino group in
Compound 43 is protected with an Fmoc protecting group using
Fmoc-Cl and sodium bicarbonate in aqueous dioxane to give Compound
44. Deprotection of the benzyl group is achieved with BCl.sub.3 in
dichloromethane at -78.degree. C. followed by oxidation of the
alcohol with pyridinium dichromate in DMF give the corresponding
carboxylic acid. The deprotection of the Fmoc group releases the
amino group at the 2'-position to give Compound 45. Compound 45 is
treated with TBTU
(2-(1H-benzotriazole-1-yl)-1,1,3,3-tetramethyluroniumtetrafluorobora-
te) and triethylamine in DMF to yield Compound 46. Compound 46 is
desilylated with triethylamine trihydrofluoride in triethylamine in
THF followed by tritylation at 3 position to give the
3-trityloxymethyl derivative followed by phosphytilation at
8-position to give Compound 47. The DMT phosphoramidite bicyclic
nucleoside, Compound 47 is purified by silica gel flash column
chromatography.
Example 29
Synthesis of Nucleoside Phosphoramidites
[0435] The following compounds, including amidites and their
intermediates were prepared as described in U.S. Pat. No. 6,426,220
and published PCT WO 02/36743; 5'-O-Dimethoxytrityl-thymidine
intermediate for 5-methyl dC amidite,
5'-O-Dimethoxytrityl-2'-deoxy-5-methylcytidine intermediate for
5-methyl-dC amidite,
5'-O-Dimethoxytrityl-2'-deoxy-N4-benzoyl-5-methylcyt- idine
penultimate intermediate for 5-methyl dC amidite,
[5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-deoxy-N.sup.4-benzoyl-5-methylcy-
tidin-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite
(5-methyl dC amidite), 2'-Fluorodeoxy-adenosine,
2'-Fluorodeoxyguanosine, 2'-Fluorouridine, 2'-Fluorodeoxycytidine,
2'-O-(2-Methoxyethyl) modified amidites,
2'-O-(2-methoxyethyl)-5-methyluridine intermediate,
5'-O-DMT-2'-O-(2-methoxyethyl)-5-methyluridine penultimate
intermediate,
[5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-5-methyluridi-
n-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE T
amidite),
5'-O-Dimethoxytrityl-2'-O-(2-methoxy-ethyl)-5-methylcytidine
intermediate,
5'-O-dimethoxytrityl-2'-O-(2-methoxyethyl)-N.sup.4-benzoyl--
5-methyl-cytidine penultimate intermediate,
[5'-O-(4,4'-Dimethoxytriphenyl-
methyl)-2'-O-(2-methoxyethyl)-N.sup.4-benzoyl-5-methylcytidin-3'-O-yl]-2-c-
yanoethyl-N,N-diisopropylphosphoramidite (MOE 5-Me-C amidite),
[5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-N.sup.6-benzo-
yladenosin-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite
(MOE A amdite),
[5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-N.su-
p.4-isobutyrylguanosin-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidit-
e (MOE G amidite), 2'-O-(Aminooxyethyl) nucleoside amidites and
2'-O-(dimethylaminooxyethyl) nucleoside amidites,
2'-(Dimethylaminooxyeth- oxy) nucleoside amidites,
5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-- 5-methyluridine ,
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-met-
hyluridine,
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyl-
uridine,
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-m-
ethyluridine, 5'-O-tert-Butyldiphenylsilyl-2'-O-[N,N
dimethylaminooxyethyl]-5-methyluridine,
2'-O-(dimethyl-aminooxyethyl)-5-m- ethyluridine,
5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine,
5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoe-
thyl)-N,N-diisopropylphosphoramidite], 2'-(Aminooxyethoxy)
nucleoside amidites,
N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(-
4,4'-dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphora-
midite], 2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside
amidites, 2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl
uridine,
5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl
uridine and
5'-O-Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl-
)]-5-methyl
uridine-3'-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite.
Example 30
Oligonucleotide and Oligonucleoside Synthesis
[0436] The chimeric oligomeric compounds used in accordance with
this invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0437] Oligonucleotides: Unsubstituted and substituted
phosphodiester (P.dbd.O) oligonucleotides are synthesized on an
automated DNA synthesizer (Applied Biosystems model 394) using
standard phosphoramidite chemistry with oxidation by iodine.
[0438] Phosphorothioates (P.dbd.S) are synthesized similar to
phosphodiester oligonucleotides with the following exceptions:
thiation was effected by utilizing a 10% w/v solution of
3,H-1,2-benzodithiole-3-o- ne 1,1-dioxide in acetonitrile for the
oxidation of the phosphite linkages. The thiation reaction step
time was increased to 180 sec and preceded by the normal capping
step. After cleavage from the CPG column and deblocking in
concentrated ammonium hydroxide at 55.degree. C. (12-16 hr), the
oligonucleotides were recovered by precipitating with >3 volumes
of ethanol from a 1 M NH.sub.4OAc solution. Phosphinate
oligonucleotides are prepared as described in U.S. Pat. No.
5,508,270, herein incorporated by reference.
[0439] Alkyl phosphonate oligonucleotides are prepared as described
in U.S. Pat. No. 4,469,863, herein incorporated by reference.
[0440] 3'-Deoxy-3'-methylene phosphonate oligonucleotides are
prepared as described in U.S. Pat. Nos. 5,610,289 or 5,625,050,
herein incorporated by reference.
[0441] Phosphoramidite oligonucleotides are prepared as described
in U.S. Pat. No. 5,256,775 or U.S. Pat. No. 5,366,878, herein
incorporated by reference.
[0442] Alkylphosphonothioate oligonucleotides are prepared as
described in published PCT applications PCT/US94/00902 and
PCT/US93/06976 (published as WO 94/17093 and WO 94/02499,
respectively), herein incorporated by reference.
[0443] 3'-Deoxy-3'-amino phosphoramidate oligonucleotides are
prepared as described in U.S. Pat. No. 5,476,925, herein
incorporated by reference.
[0444] Phosphotriester oligonucleotides are prepared as described
in U.S. Pat. No. 5,023,243, herein incorporated by reference.
[0445] Borano phosphate oligonucleotides are prepared as described
in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated
by reference.
[0446] Oligonucleosides: Methylenemethylimino linked
oligonucleosides, also identified as MMI linked oligonucleosides,
methylenedimethylhydrazo linked oligonucleosides, also identified
as MDH linked oligonucleosides, and methylenecarbonylamino linked
oligonucleosides, also identified as amide-3 linked
oligonucleosides, and methyleneaminocarbonyl linked
oligonucleosides, also identified as amide-4 linked
oligo-nucleosides, as well as mixed backbone oligomeric compounds
having, for instance, alternating MMI and P.dbd.O or P.dbd.S
linkages are prepared as described in U.S. Pat. Nos. 5,378,825,
5,386,023, 5,489,677, 5,602,240 and 5,610,289, all of which are
herein incorporated by reference.
[0447] Formacetal and thioformacetal linked oligonucleosides are
prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564,
herein incorporated by reference.
[0448] Ethylene oxide linked oligonucleosides are prepared as
described in U.S. Pat. No. 5,223,618, herein incorporated by
reference.
Example 31
RNA Synthesis
[0449] In general, RNA synthesis chemistry is based on the
selective incorporation of various protecting groups at strategic
intermediary reactions. Although one of ordinary skill in the art
will understand the use of protecting groups in organic synthesis,
a useful class of protecting groups includes silyl ethers. In
particular bulky silyl ethers are used to protect the 5'-hydroxyl
in combination with an acid-labile orthoester protecting group on
the 2'-hydroxyl. This set of protecting groups is then used with
standard solid-phase synthesis technology. It is important to
lastly remove the acid labile orthoester protecting group after all
other synthetic steps. Moreover, the early use of the silyl
protecting groups during synthesis ensures facile removal when
desired, without undesired deprotection of 2' hydroxyl.
[0450] Following this procedure for the sequential protection of
the 5'-hydroxyl in combination with protection of the 2'-hydroxyl
by protecting groups that are differentially removed and are
differentially chemically labile, RNA oligonucleotides were
synthesized.
[0451] RNA oligonucleotides are synthesized in a stepwise fashion.
Each nucleotide is added sequentially (3'- to 5'-direction) to a
solid support-bound oligonucleotide. The first nucleoside at the
3'-end of the chain is covalently attached to a solid support. The
nucleotide precursor, a ribonucleoside phosphoramidite, and
activator are added, coupling the second base onto the 5'-end of
the first nucleoside. The support is washed and any unreacted
5'-hydroxyl groups are capped with acetic anhydride to yield
5'-acetyl moieties. The linkage is then oxidized to the more stable
and ultimately desired P(V) linkage. At the end of the nucleotide
addition cycle, the 5'-silyl group is cleaved with fluoride. The
cycle is repeated for each subsequent nucleotide.
[0452] Following synthesis, the methyl protecting groups on the
phosphates are cleaved in 30 minutes utilizing 1 M
disodium-2-carbamoyl-2-cyanoethyl- ene-1,1-dithiolate trihydrate
(S.sub.2Na.sub.2) in DMF. The deprotection solution is washed from
the solid support-bound oligonucleotide using water. The support is
then treated with 40% methylamine in water for 10 minutes at
55.degree. C. This releases the RNA oligonucleotides into solution,
deprotects the exocyclic amines, and modifies the 2'-groups. The
oligonucleotides can be analyzed by anion exchange HPLC at this
stage.
[0453] The 2'-orthoester groups are the last protecting groups to
be removed. The ethylene glycol monoacetate orthoester protecting
group developed by Dharmacon Research, Inc. (Lafayette, Colo.), is
one example of a useful orthoester protecting group which, has the
following important properties. It is stable to the conditions of
nucleoside phosphoramidite synthesis and oligonucleotide synthesis.
However, after oligonucleotide synthesis the oligonucleotide is
treated with methylamine which not only cleaves the oligonucleotide
from the solid support but also removes the acetyl groups from the
orthoesters. The resulting 2-ethyl-hydroxyl substituents on the
orthoester are less electron withdrawing than the acetylated
precursor. As a result, the modified orthoester becomes more labile
to acid-catalyzed hydrolysis. Specifically, the rate of cleavage is
approximately 10 times faster after the acetyl groups are removed.
Therefore, this orthoester possesses sufficient stability in order
to be compatible with oligonucleotide synthesis and yet, when
subsequently modified, permits deprotection to be carried out under
relatively mild aqueous conditions compatible with the final RNA
oligonucleotide product.
[0454] Additionally, methods of RNA synthesis are well known in the
art (Scaringe, S. A. Ph.D. Thesis, University of Colorado, 1996;
Scaringe, S. A., et al., J. Am. Chem. Soc., 1998, 120, 11820-11821;
Matteucci, M. D. and Caruthers, M. H. J. Am. Chem. Soc., 1981, 103,
3185-3191; Beaucage, S. L. and Caruthers, M. H. Tetrahedron Lett.,
1981, 22, 1859-1862; Dahl, B. J., et al., Acta Chem. Scand,. 1990,
44, 639-641; Reddy, M. P., et al., Tetrahedron Lett., 1994, 25,
4311-4314; Wincott, F. et al., Nucleic Acids Res., 1995, 23,
2677-2684; Griffin, B. E., et al., Tetrahedron, 1967, 23,
2301-2313; Griffin, B. E., et al., Tetrahedron, 1967, 23,
2315-2331).
[0455] RNA oligomeric compounds (RNA oligonucleotides) for use in
the present invention can be synthesized by the methods herein or
purchased from Dharmacon Research, Inc (Lafayette, Colo.). Once
synthesized, complementary RNA oligomeric compounds can then be
annealed by methods known in the art to form double stranded
(duplexed) oligomeric compounds. For example, duplexes can be
formed by combining 30 .mu.l of each of the complementary strands
of RNA oligonucleotides (50 uM RNA oligonucleotide solution) and 15
.mu.l of 5.times. annealing buffer (100 mM potassium acetate, 30 mM
HEPES-KOH pH 7.4, 2 mM magnesium acetate) followed by heating for 1
minute at 90.degree. C., then 1 hour at 37.degree. C. The resulting
duplexed oligomeric compounds can be used in kits, assays, screens,
or other methods to investigate the role of a target nucleic
acid.
Example 32
Synthesis of Chimeric Oligomeric Compounds
[0456] Chimeric oligomeric compounds, oligonucleosides or mixed
oligonucleotides/oligonucleosides of the invention can be of
several different types. These include a first type wherein the
"gap" segment of linked nucleosides is positioned between 5' and 3'
"wing" segments of linked nucleosides and a second "open end" type
wherein the "gap" segment is located at either the 3' or the 5'
terminus of the oligomeric compound. Oligonucleotides of the first
type are also known in the art as "gapmers" or gapped
oligonucleotides. Oligonucleotides of the second type are also
known in the art as "hemimers" or "wingmers".
[2'-O-Me]-[2'-deoxy]-[2'-O-Me] Chimeric Phosphorothioate
Oligonucleotides
[0457] Chimeric oligomeric compounds having 2'-O-alkyl
phosphorothioate and 2'-deoxy phosphorothioate oligonucleotide
segments are synthesized using an Applied Biosystems automated DNA
synthesizer Model 394, as above. Oligonucleotides are synthesized
using the automated synthesizer and
2'-deoxy-5'-dimethoxytrityl-3'-O-phosphoramidite for the DNA
portion and 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for
5' and 3' wings. The standard synthesis cycle is modified by
incorporating coupling steps with increased reaction times for the
5'-dimethoxytrityl-2'-O-methy- l-3'-O-phosphoramidite. The fully
protected oligonucleotide is cleaved from the support and
deprotected in concentrated ammonia (NH.sub.4OH) for 12-16 hr at
55.degree. C. The deprotected oligonucleotide is then recovered by
an appropriate method (precipitation, column chromatography, volume
reduced in vacuo and analyzed spetrophotometrically for yield and
for purity by capillary electrophoresis and by mass
spectrometry.
[2'-O-(2-Methoxyethyl)]-[2'-deoxy]-[2'-O-(Methoxyethyl)] Chimeric
Phosphorothioate Oligonucleotides
[0458] [2'-O-(2-methoxyethyl)]-[2'-deoxy]-[-2'-O-(methoxyethyl)]
chimeric phosphorothioate oligonucleotides were prepared as per the
procedure above for the 2'-O-methyl chimeric oligomeric compound,
with the substitution of 2'-O-(methoxyethyl) amidites for the
2'-O-methyl amidites.
[2'-O-(2-Methoxyethyl)Phosphodiester]-[2'-deoxy
Phosphorothioate]-[2'-O-(2- -Methoxyethyl) Phosphodiester] Chimeric
Oligomeric Compounds
[0459] [2'-O-(2-methoxyethyl phosphodiester]-[2'-deoxy
phosphorothioate]-[2'-O-(methoxyethyl) phosphodiester] chimeric
oligomeric compounds are prepared as per the above procedure for
the 2'-O-methyl chimeric oligomeric compound with the substitution
of 2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites,
oxidation with iodine to generate the phosphodiester
internucleotide linkages within the wing portions of the chimeric
structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one
1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate
internucleotide linkages for the center gap.
[0460] The above methods are also applicable to the synthesis of
chimeric oligomeric compounds having multiple alternating regions
such as olignucleotides having the formula: T.sub.1-(3'-endo
region)-[(2'-deoxy region)-(3'-endo region)].sub.n-T.sub.2. The use
of 2'-MOE or other nucleoside amidites will enable the preparation
of a myriad of different oligonucleotides.
[0461] Other chimeric oligomeric compounds, chimeric
oligonucleosides and mixed chimeric oligomeric
compounds/oligonucleosides are synthesized according to U.S. Pat.
No. 5,623,065, herein incorporated by reference.
Example 33
Screening of Duplexed Oligomeric Compounds of the Invention
[0462] In accordance with the present invention, nucleic acid
duplexes comprising the oligonucleotides of the invention and their
complements are tested for their ability to modulate the expression
of the nucleic acid molecule to which they are targeted. The
desired RNA strand(s) of the duplex can be synthesized by methods
disclosed herein or purchased from various RNA synthesis companies
such as for example Dharmacon Research Inc., (Lafayette, Colo.).
Once synthesized, the complementary strands are annealed. The
single strands are aliquoted and diluted to a concentration of 50
uM. Once diluted, 30 uL of each strand is combined with 15 uL of a
5.times. solution of annealing buffer. The final concentration of
the buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and
2 mM magnesium acetate. The final volume is 75 uL. This solution is
incubated for 1 minute at 90.degree. C. and then centrifuged for 15
seconds. The tube is allowed to sit for 1 hour at 37.degree. C. at
which time the dsRNA duplexes are used in experimentation. The
final concentration of the dsRNA compound is 20 uM. This solution
can be stored frozen (-20.degree. C.) and freeze-thawed up to 5
times.
[0463] Once prepared, the desired synthetic duplexes are evaluated
for their ability to modulate target expression. When cells reach
approximately 60-80% confluency, they are treated with synthetic
duplexes comprising at least one oligomeric compound of the
invention. The duplexes are mixed with LIPOFECTIN.TM. (Invitrogen
Life Technologies, Carlsbad, Calif.) in 1 mL of Opti-MEM.TM.-1
reduced serum medium (Invitrogen Life Technologies, Carlsbad,
Calif.) to achieve the desired final concentration of duplex. This
transfection mixture was incubated at room temperature for
approximately 0.5 hours. The final concentration of duplex ranges
from 10 to 200 nM. LIPOFECTIN.TM. is used at a concentration of 5
or 6 .mu.g/mL LIPOFECTIN.TM. per 200 nM of duplex. For cells grown
in 96-well plates, wells were washed once with 100 .mu.L
OPTI-MEM.TM.-1 and then treated with 130 .mu.L of the transfection
mixutre. Cells grown in 24-well plates or other standard tissue
culture plates are treated similarly, using appropriate volumes of
medium and oligonucleotide. Cells are treated and data are obtained
in duplicate or triplicate. After approximately 4-7 hours of
treatment at 37.degree. C., the medium containing the transfection
mixture was replaced with fresh medium. Cells were harvested 16-24
hours after oligonucleotide treatment, at which time RNA is
isolated and target reduction is measured by real-time PCR or
Northern blot.
Example 34
Oligonucleotide Isolation
[0464] After cleavage from the controlled pore glass solid support
and deblocking in concentrated ammonium hydroxide at 55.degree. C.
for 12-16 hours, the oligonucleotides or oligonucleosides are
recovered by precipitation out of 1 M NH.sub.4OAc with >3
volumes of ethanol. Synthesized oligonucleotides were analyzed by
electrospray mass spectroscopy (molecular weight determination) and
by capillary gel electrophoresis and judged to be at least 70% full
length material. The relative amounts of phosphorothioate and
phosphodiester linkages obtained in the synthesis was determined by
the ratio of correct molecular weight relative to the -16 amu
product (.+-.32 .+-.48). For some studies oligonucleotides were
purified by HPLC, as described by Chiang et al., J. Biol. Chem.
1991, 266, 18162-18171. Results obtained with HPLC-purified
material were similar to those obtained with non-HPLC purified
material.
Example 35
Oligonucleotide Synthesis--96 Well Plate Format
[0465] Oligonucleotides were synthesized via solid phase P(III)
phosphoramidite chemistry on an automated synthesizer capable of
assembling 96 sequences simultaneously in a 96-well format.
Phosphodiester internucleotide linkages were afforded by oxidation
with aqueous iodine. Phosphorothioate internucleotide linkages were
generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one
1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard
base-protected beta-cyanoethyl-diiso-propyl phosphoramidites were
purchased from commercial vendors (e.g. PE-Applied Biosystems,
Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard
nucleosides are synthesized as per standard or patented methods.
They are utilized as base protected beta-cyanoethyldiisopropyl
phosphoramidites.
[0466] Oligonucleotides were cleaved from support and deprotected
with concentrated NH.sub.4OH at elevated temperature (55-60.degree.
C.) for 12-16 hours and the released product then dried in vacuo.
The dried product was then re-suspended in sterile water to afford
a master plate from which all analytical and test plate samples are
then diluted utilizing robotic pipettors.
Example 36
Oligonucleotide Analysis--96-Well Plate Format
[0467] The concentration of oligonucleotide in each well was
assessed by dilution of samples and UV absorption spectroscopy. The
full-length integrity of the individual products was evaluated by
capillary electrophoresis (CE) in either the 96-well format
(Beckman P/ACE.TM. MDQ) or, for individually prepared samples, on a
commercial CE apparatus (e.g., Beckman P/ACE.TM. 5000, ABI 270).
Base and backbone-composition was confirmed by mass analysis of the
oligomeric compounds utilizing electrospray-mass spectroscopy. All
assay test plates were diluted from the master plate using single
and multi-channel robotic pipettors. Plates were judged to be
acceptable if at least 85% of the oligomeric compounds on the plate
were at least 85% full length.
Example 37
Cell Culture and Oligonucleotide Treatment
[0468] The effect of chimeric oligomeric compounds on target
nucleic acid expression can be tested in any of a variety of cell
types provided that the target nucleic acid is present at
measurable levels. This can be routinely determined using, for
example, PCR or Northern blot analysis. The following cell types
are provided for illustrative purposes, but other cell types can be
routinely used, provided that the target is expressed in the cell
type chosen. This can be readily determined by methods routine in
the art, for example Northern blot analysis, ribonuclease
protection assays, or real-time PCR.
[0469] T-24 Cells:
[0470] The human transitional cell bladder carcinoma cell line T-24
was obtained from the American Type Culture Collection (ATCC)
(Manassas, Va.). T-24 cells were routinely cultured in complete
McCoy's 5A basal media (Invitrogen Corporation, Carlsbad, Calif.)
supplemented with 10% fetal bovine serum (Invitrogen Corporation,
Carlsbad, Calif.), 100 units per mL penicillin and 100 micrograms
per mL streptomycin (Invitrogen Corporation, Carlsbad, Calif.).
Cells were routinely passaged by trypsinization and dilution when
they reached approximately 90% confluence. Cells were seeded into
96-well plates (Falcon-Primaria #353872, BD Biosciences, Bedford,
Mass.) at a density of approximately 4000-6000 cells/well for use
in oligomeric compound transfection experiments.
[0471] A549 Cells:
[0472] The human lung carcinoma cell line A549 was obtained from
the American Type Culture Collection (Manassas, Va.). A549 cells
were routinely cultured in DMEM, high glucose (Invitrogen Life
Technologies, Carlsbad, Calif.) supplemented with 10% fetal bovine
serum, 100 units per ml penicillin, and 100 micrograms per ml
streptomycin (Invitrogen Life Technologies, Carlsbad, Calif.).
Cells were routinely passaged by trypsinization and dilution when
they reached approximately 90% confluence. Cells were seeded into
96-well plates (Falcon-Primaria #353872, BD Biosciences, Bedford,
Mass.) at a density of approximately 5000 cells/well for use in
oligomeric compound transfection experiments.
[0473] NHDF Cells:
[0474] Human neonatal dermal fibroblast (NHDF) were obtained from
the Clonetics Corporation (Walkersville, Md.). NHDFs were routinely
maintained in Fibroblast Growth Medium (Clonetics Corporation,
Walkersville, Md.) supplemented as recommended by the supplier.
Cells were maintained for up to 10 passages as recommended by the
supplier.
[0475] HEK Cells:
[0476] Human embryonic keratinocytes (HEK) were obtained from the
Clonetics Corporation (Walkersville, Md.). HEKs were routinely
maintained in Keratinocyte Growth Medium (Clonetics Corporation,
Walkersville, Md.) formulated as recommended by the supplier. Cells
were routinely maintained for up to 10 passages as recommended by
the supplier.
[0477] HeLa Cells:
[0478] The human epitheloid carcinoma cell line HeLa was obtained
from the American Tissue Type Culture Collection (Manassas, Va.).
HeLa cells were routinely cultured in DMEM, high glucose
(Invitrogen Corporation, Carlsbad, Calif.) supplemented with 10%
fetal bovine serum (Invitrogen Corporation, Carlsbad, Calif.).
Cells were routinely passaged by trypsinization and dilution when
they reached approximately 90% confluence. Cells were seeded into
24-well plates (Falcon-Primaria #353846, BD Biosciences, Bedford,
Mass.) at a density of 50,000 cells/well or in 96-well plates
(Falcon-Primaria #353872, BD Biosciences, Bedford, Mass.) at a
density of 5,000 cells/well for use in oligomeric compound
transfection experiments. For Northern blotting or other analyses,
cells were harvested when they reached approximately 90%
confluence.
[0479] NIH3T3 Cells:
[0480] The mouse embryo-derived NIH3T3 cell line was obtained from
American Type Culture Collection (Manassas, Va.). NIH3T3 cells were
routinely cultured in DMEM, high glucose (Invitrogen Life
Technologies, Carlsbad, Calif.) supplemented with 10% fetal bovine
serum, (Invitrogen Life Technologies, Carlsbad, Calif.), 100
.mu.g/ml penicillin and 100 .mu.g/ml streptomycin (Invitrogen Life
Technologies, Carlsbad, Calif.). Cells were routinely passaged by
trypsinization and dilution when they reached 80% confluencey.
Cells were seeded into 96-well plates (Falcon-Primaria #353872, BD
Biosciences, Bedford, Mass.) at a density of 3000 cells/well for
use in oligomeric compound transfection experiments.
[0481] b.END Cells:
[0482] The mouse brain endothelial cell line b.END was obtained
from Dr. Werner Risau at the Max Plank Institute (Bad Nauheim,
Germany). b.END cells were routinely cultured in DMEM, high glucose
(Invitrogen Life Technologies, Carlsbad, Calif.) supplemented with
10% fetal bovine serum (Invitrogen Life Technologies, Carlsbad,
Calif.). Cells were routinely passaged by trypsinization and
dilution when they reached approximately 90% confluence. Cells were
seeded into 96-well plates (Falcon-Primaria #3872) at a density of
approximately 3000 cells/well for use in oligomeric compound
transfection experiments.
[0483] Primary Mouse Hepatocytes:
[0484] Primary mouse hepatocytes were prepared from CD-1 mice
purchased from Charles River Labs. Primary mouse hepatocytes were
routinely cultured in Hepatocyte Attachment Media supplemented with
10% fetal bovine serum , 1% penicillin/streptomycin, 1%
antibiotic-antimycotic (Invitrogen Life Technologies, Carlsbad,
Calif.) and 10 nM bovine insulin (Sigma-Aldrich, St. Louis, Mo.).
Cells were seeded into 96-well plates (Falcon-Primaria #3872)
coated with 0.1 mg/ml collagen at a density of approximately 10,000
cells/well for use in oligomeric compound transfection
experiments.
[0485] Primary Rat Hepatocytes:
[0486] Primary rat hepatocytes are prepared from Sprague-Dawley
rats purchased from Charles River Labs (Wilmington, Mass.) and are
routinely cultured in DMEM, high glucose (Invitrogen Life
Technologies, Carlsbad, Calif.) supplemented with 10% fetal bovine
serum (Invitrogen Life Technologies, Carlsbad, Calif.), 100 units
per mL penicillin, and 100 .mu.g/mL streptomycin (Invitrogen Life
Technologies, Carlsbad, Calif.). Cells are seeded into 96-well
plates (Falcon-Primaria #353872, BD Biosciences, Bedford, Mass.) at
a density of 4000-6000 cells/well for use in oligomeric compound
transfection experiments.
[0487] MH-S Cells:
[0488] The mouse alveolar macrophage cell line was obtained from
American Type Culture Collection (Manassas, Va.). MH-S cells were
cultured in RPMI Medium 1640 with L-glutamine (Invitrogen Life
Technologies, Carlsbad, Calif.), supplemented with 10% fetal bovine
serum, 1 mM sodium pyruvate and 10 mM HEPES ( all supplements from
Invitrogen Life Technologies, Carlsbad, Calif.). Cells were
routinely passaged by trypsinization and dilution when they reached
70-80% confluence. Cells were seeded into 96-well plates
(Falcon-Primaria #353047, BD Biosciences, Bedford, Mass.) at a
density of 6500 cells/well for for use in oligomeric compound
transfection experiments.
[0489] Treatment with Oligomeric Compounds:
[0490] When cells reached approximately 65-90% confluency, they
were treated with oligomeric compound. Oligomeric compounds were
mixed with LIPOFECTIN.TM. (Invitrogen Life Technologies, Carlsbad,
Calif.) in 1 mL of Opti-MEM.TM.-1 reduced serum medium (Invitrogen
Life Technologies, Carlsbad, Calif.) to achieve the desired
concentration of oligomeric compound. The concentration of
oligomeric compound used herein ranges from 5 to 300 nM. This
transfection mixture was incubated at room temperature for
approximately 0.5 hours. LIPOFECTIN.TM. is used at a concentration
of 2.5 or 3 .mu.g/mL LIPOFECTIN.TM. per 100 nM oligomeric compound.
For cells grown in 96-well plates, wells were washed once with 100
.mu.L OPTI-MEM.TM.-1 and then treated with 130 .mu.L of the
transfection mixutre. Cells grown in 24-well plates or other
standard tissue culture plates are treated similarly, using
appropriate volumes of medium and oligonucleotide. Cells are
treated and data are obtained in duplicate or triplicate. After
approximately 4-7 hours of treatment at 37.degree. C., the medium
containing the transfection mixture was replaced with fresh medium.
Cells were harvested 16-24 hours after oligonucleotide treatment,
at which time RNA was isolated and target expression was measured
by real-time PCR.
[0491] The concentration of oligonucleotide used varies from cell
line to cell line. To determine the optimal oligonucleotide
concentration for a particular cell line, the cells are treated
with a positive control oligonucleotide at a range of
concentrations. For human cells the positive control
oligonucleotide is selected from either ISIS 13920
(TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 7) which is targeted to human
H-ras, or ISIS 18078 (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 8) which is
targeted to human Jun-N-terminal kinase-2 (JNK2). Both controls are
chimeric oligomeric compounds composed of a central "gap" segment
comprising 2'-deoxynucleotides, which is flanked on both sides (5'
and 3') by "wing" segments comprising 2'-O-methoxyethyl nucleotides
(2'-O-methoxyethyls shown in emboldened, underlined type).
Internucleoside linkages are phosphorothioate throughout both
compounds. All cytosine residues in the wing segments are
5-methylcytosines. For mouse or rat cells the positive control
oligonucleotide is ISIS 15770 (ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 9)
is targeted to both mouse and rat C-raf. ISIS 15770 is a chimeric
oligomeric compound composed of a central "gap" segment comprising
2'-deoxynucleotides, which is flanked on both sides (5' and 3') by
"wing" segments comprising 2'-O-methoxyethyl nucleotides
(2'-O-methoxyethyls shown in emboldened, underlined type).
Internucleoside linkages are phosphorothioate throughout the
compound. The cytosine residue in the 5' wing segment is a
5-methylcytosine. The concentration of positive control
oligonucleotide that results in 80% inhibition of c-H-ras (for ISIS
13920), JNK2 (for ISIS 18078) or C-raf (for ISIS 15770) mRNA is
then utilized as the screening concentration for new
oligonucleotides in subsequent experiments for that cell line. If
80% inhibition is not achieved, the lowest concentration of
positive control oligonucleotide that results in 60% inhibition of
c-H-ras, JNK2 or C-raf mRNA is then utilized as the oligonucleotide
screening concentration in subsequent experiments for that cell
line. If 60% inhibition is not achieved, that particular cell line
is deemed as unsuitable for oligonucleotide transfection
experiments. The concentrations of antisense oligonucleotides used
herein are from 50 nM to300 nM.
Example 38
Analysis of Oligonucleotide Inhibition of a Target Expression
[0492] Antisense modulation of a target expression can be assayed
in a variety of ways known in the art. For example, a target mRNA
levels can be quantitated by, e.g., Northern blot analysis,
competitive polymerase chain reaction (PCR), or real-time PCR.
Real-time quantitative PCR is presently preferred. RNA analysis can
be performed on total cellular RNA or poly(A)+ mRNA. One method of
RNA analysis of the present invention is the use of total cellular
RNA as described in other examples herein. Methods of RNA isolation
are well known in the art. Northern blot analysis is also routine
in the art. Quantitative real-time PCR can be conveniently
accomplished using the commercially available ABI PRISM.TM. 7600,
7700, or 7900 Sequence Detection System, available from PE-Applied
Biosystems, Foster City, Calif. and used according to
manufacturer's instructions.
[0493] Protein levels of a target can be quantitated in a variety
of ways well known in the art, such as immunoprecipitation, Western
blot analysis (immunoblotting), enzyme-linked immunosorbent assay
(ELISA) or fluorescence-activated cell sorting (FACS). Antibodies
directed to a target can be identified and obtained from a variety
of sources, such as the MSRS catalog of antibodies (Aerie
Corporation, Birmingham, Mich.), or can be prepared via
conventional monoclonal or polyclonal antibody generation methods
well known in the art.
Example 39
Design of Phenotypic Assays for the Use of Target Inhibitors
[0494] Once a target inhibitors have been identified by the methods
disclosed herein, the oligomeric compounds are further investigated
in one or more phenotypic assays, each having measurable endpoints
predictive of efficacy in the treatment of a particular disease
state or condition.
[0495] Phenotypic assays, kits and reagents for their use are well
known to those skilled in the art and are herein used to
investigate the role and/or association of a target in health and
disease. Representative phenotypic assays, which can be purchased
from any one of several commercial vendors, include those for
determining cell viability, cytotoxicity, proliferation or cell
survival (Molecular Probes, Eugene, Oreg.; PerkinElmer, Boston,
Mass.), protein-based assays including enzymatic assays (Panvera,
LLC, Madison, Wisc.; BD Biosciences, Franklin Lakes, N.J.; Oncogene
Research Products, San Diego, Calif.), cell regulation, signal
transduction, inflammation, oxidative processes and apoptosis
(Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation
(Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube
formation assays, cytokine and hormone assays and metabolic assays
(Chemicon International Inc., Temecula, Calif.; Amersham
Biosciences, Piscataway, N.J.).
[0496] In one non-limiting example, cells determined to be
appropriate for a particular phenotypic assay (i.e., MCF-7 cells
selected for breast cancer studies; adipocytes for obesity studies)
are treated with a target inhibitors identified from the in vitro
studies as well as control compounds at optimal concentrations
which are determined by the methods described above. At the end of
the treatment period, treated and untreated cells are analyzed by
one or more methods specific for the assay to determine phenotypic
outcomes and endpoints.
[0497] Phenotypic endpoints include changes in cell morphology over
time or treatment dose as well as changes in levels of cellular
components such as proteins, lipids, nucleic acids, hormones,
saccharides or metals. Measurements of cellular status which
include pH, stage of the cell cycle, intake or excretion of
biological indicators by the cell, are also endpoints of
interest.
[0498] Measurement of the expression of one or more of the genes of
the cell after treatment is also used as an indicator of the
efficacy or potency of the target inhibitors. Hallmark genes, or
those genes suspected to be associated with a specific disease
state, condition, or phenotype, are measured in both treated and
untreated cells.
Example 40
RNA Isolation
Poly(A)+ mRNA Isolation
[0499] Poly(A)+ mRNA was isolated according to Miura et al., (Clin.
Chem., 1996, 42, 1758-1764). Other methods for poly(A)+ mRNA
isolation are routine in the art. Briefly, for cells grown on
96-well plates, growth medium was removed from the cells and each
well was washed with 200 .mu.L cold PBS. 60 .mu.L lysis buffer (10
mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM
vanadyl-ribonucleoside complex) was added to each well, the plate
was gently agitated and then incubated at room temperature for five
minutes. 55 .mu.L of lysate was transferred to Oligo d(T) coated
96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated
for 60 minutes at room temperature, washed 3 times with 200 .mu.L
of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl).
After the final wash, the plate was blotted on paper towels to
remove excess wash buffer and then air-dried for 5 minutes. 60
.mu.L of elution buffer (5 mM Tris-HCl pH 7.6), preheated to
70.degree. C., was added to each well, the plate was incubated on a
90.degree. C. hot plate for 5 minutes, and the eluate was then
transferred to a fresh 96-well plate.
[0500] Cells grown on 100 mm or other standard plates may be
treated similarly, using appropriate volumes of all solutions.
[0501] Total RNA Isolation
[0502] Total RNA was isolated using an RNEASY 96.TM. kit and
buffers purchased from Qiagen Inc. (Valencia, Calif.) following the
manufacturer's recommended procedures. Briefly, for cells grown on
96-well plates, growth medium was removed from the cells and each
well was washed with 200 .mu.L cold PBS. 150 .mu.L Buffer RLT was
added to each well and the plate vigorously agitated for 20
seconds. 150 .mu.L of 70% ethanol was then added to each well and
the contents mixed by pipetting three times up and down. The
samples were then transferred to the RNEASY 96.TM. well plate
attached to a QIAVAC.TM. manifold fitted with a waste collection
tray and attached to a vacuum source. Vacuum was applied for 1
minute. 500 .mu.L of Buffer RW1 was added to each well of the
RNEASY 96.TM. plate and incubated for 15 minutes and the vacuum was
again applied for 1 minute. An additional 500 .mu.L of Buffer RW1
was added to each well of the RNEASY 96.TM. plate and the vacuum
was applied for 2 minutes. 1 mL of Buffer RPE was then added to
each well of the RNEASY 96.TM. plate and the vacuum applied for a
period of 90 seconds. The Buffer RPE wash was then repeated and the
vacuum was applied for an additional 3 minutes. The plate was then
removed from the QIAVAC.TM. manifold and blotted dry on paper
towels. The plate was then re-attached to the QIAVAC.TM. manifold
fitted with a collection tube rack containing 1.2 mL collection
tubes. RNA was then eluted by pipetting 140 .mu.L of RNAse free
water into each well, incubating 1 minute, and then applying the
vacuum for 3 minutes.
[0503] The repetitive pipetting and elution steps may be automated
using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.).
Essentially, after lysing of the cells on the culture plate, the
plate is transferred to the robot deck where the pipetting, DNase
treatment and elution steps are carried out.
Example 41
Real-Time Quantitative PCR Analysis of a Target mRNA Levels
[0504] Quantitation of a target mRNA levels was accomplished by
real-time quantitative PCR using the ABI PRISM.TM. 7600, 7700, or
7900 Sequence Detection System (PE-Applied Biosystems, Foster City,
Calif.) according to manufacturer's instructions. This is a
closed-tube, non-gel-based, fluorescence detection system which
allows high-throughput quantitation of polymerase chain reaction
(PCR) products in real-time. As opposed to standard PCR in which
amplification products are quantitated after the PCR is completed,
products in real-time PCR are quantitated as they accumulate. This
is accomplished by including in the PCR reaction an oligonucleotide
probe that anneals specifically between the forward and reverse PCR
primers, and contains two fluorescent dyes. A reporter dye (e.g.,
FAM or JOE, obtained from either PE-Applied Biosystems, Foster
City, Calif., Operon Technologies Inc., Alameda, Calif. or
Integrated DNA Technologies Inc., Coralville, Iowa) is attached to
the 5' end of the probe and a quencher dye (e.g., TAMRA, obtained
from either PE-Applied Biosystems, Foster City, Calif., Operon
Technologies Inc., Alameda, Calif. or Integrated DNA Technologies
Inc., Coralville, Iowa) is attached to the 3' end of the probe.
When the probe and dyes are intact, reporter dye emission is
quenched by the proximity of the 3' quencher dye. During
amplification, annealing of the probe to the target sequence
creates a substrate that can be cleaved by the 5'-exonuclease
activity of Taq polymerase. During the extension phase of the PCR
amplification cycle, cleavage of the probe by Taq polymerase
releases the reporter dye from the remainder of the probe (and
hence from the quencher moiety) and a sequence-specific fluorescent
signal is generated. With each cycle, additional reporter dye
molecules are cleaved from their respective probes, and the
fluorescence intensity is monitored at regular intervals by laser
optics built into the ABI PRISM.TM. Sequence Detection System. In
each assay, a series of parallel reactions containing serial
dilutions of mRNA from untreated control samples generates a
standard curve that is used to quantitate the percent inhibition
after antisense oligonucleotide treatment of test samples.
[0505] Prior to quantitative PCR analysis, primer-probe sets
specific to the target gene being measured are evaluated for their
ability to be "multiplexed" with a GAPDH amplification reaction. In
multiplexing, both the target gene and the internal standard gene
GAPDH are amplified concurrently in a single sample. In this
analysis, mRNA isolated from untreated cells is serially diluted.
Each dilution is amplified in the presence of primer-probe sets
specific for GAPDH only, target gene only ("single-plexing"), or
both (multiplexing). Following PCR amplification, standard curves
of GAPDH and target mRNA signal as a function of dilution are
generated from both the single-plexed and multiplexed samples. If
both the slope and correlation coefficient of the GAPDH and target
signals generated from the multiplexed samples fall within 10% of
their corresponding values generated from the single-plexed
samples, the primer-probe set specific for that target is deemed
multiplexable. Other methods of PCR are also known in the art.
[0506] Gene target quantities are obtained by real-time PCR. Prior
to the real-time PCR, isolated RNA is subjected to a reverse
transcriptase (RT) reaction, for the purpose of generating
complementary DNA (cDNA). Reverse transcriptase and PCR reagents
were obtained from Invitrogen Corporation (Carlsbad, Calif.). RT,
real-time PCR reactions were carried out by adding 20 .mu.L PCR
cocktail (2.5.times.PCR buffer minus MgCl.sub.2, 6.6 mM MgCl.sub.2,
375 .mu.M each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward
primer and reverse primer, 125 nM of probe, 4 Units RNAse
inhibitor, 1.25 Units PLATINUM.RTM. Taq, 5 Units MuLV reverse
transcriptase, and 2.5.times.ROX dye) to 96-well plates containing
30 .mu.L total RNA solution (20-200 ng). The RT reaction was
carried out by incubation for 30 minutes at 48.degree. C. Following
a 10 minute incubation at 95.degree. C. to activate the
PLATINUM.RTM. Taq, 40 cycles of a two-step PCR protocol were
carried out: 95.degree. C. for 15 seconds (denaturation) followed
by 60.degree. C. for 1.5 minutes (annealing/extension).
[0507] Gene target quantities obtained by real-time PCR are
normalized using either the expression level of GAPDH or
cyclophilin A, genes whose expression levels are constant, or by
quantifying total RNA. GAPDH expression is quantified by real-time
PCR, by being run simultaneously with the target, multiplexing, or
separately. Total RNA is quantified using RiboGreen.TM. RNA
quantification reagent (Molecular Probes, Inc. Eugene, Oreg.).
Methods of RNA quantification by RiboGreen.TM. are taught in Jones,
L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374).
[0508] In this assay, 170 .mu.L of RiboGreen.TM. working reagent
(RiboGreen.TM. reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA,
pH 7.5) is pipetted into a 96-well plate containing 30 .mu.L
purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE
Applied Biosystems) with excitation at 485 nm and emission at 530
nm.
[0509] Primers and probes used in real-time PCR are designed with
the aid of computer software, for example, Primer Express.RTM.
Software (PE-Applied Biosystems, Foster City, Calif., Operon
Technologies Inc., Alameda, Calif.), using publicly available
sequence information. It is understood that one of skill in the art
will readily be able to design such primers and probes.
Example 42
Northern Blot Analysis of a Target mRNA Levels
[0510] Eighteen hours after antisense treatment, cell monolayers
were washed twice with cold PBS and lysed in 1 mL RNAZOL.TM.
(TEL-TEST "B" Inc., Friendswood, Tex.). Total RNA was prepared
following manufacturer's recommended protocols. Twenty micrograms
of total RNA was fractionated by electrophoresis through 1.2%
agarose gels containing 1.1% formaldehyde using a MOPS buffer
system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the
gel to HYBOND.TM.-N+ nylon membranes (Amersham Pharmacia Biotech,
Piscataway, N.J.) by overnight capillary transfer using a
Northern/Southern Transfer buffer system (TEL-TEST "B" Inc.,
Friendswood, Tex.). RNA transfer was confirmed by UV visualization.
Membranes were fixed by UV cross-linking using a STRATALINKER.TM.
UV Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.) and then
probed using QUICKHYB.TM. hybridization solution (Stratagene, La
Jolla, Calif.) using manufacturer's recommendations for stringent
conditions.
[0511] To detect human a target, a human target-specific probe is
prepared by PCR. To normalize for variations in loading and
transfer efficiency membranes are stripped and probed for human
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech,
Palo Alto, Calif.).
[0512] Hybridized membranes were visualized and quantitated using a
PhosphorImager.TM. and IMAGEQUANT.TM. Software V3.3 (Molecular
Dynamics, Sunnyvale, Calif.). Data was normalized to GAPDH levels
in untreated controls.
Example 43
Western Blot Analysis of a Target Protein Levels
[0513] Western blot analysis (immunoblot analysis) is carried out
using standard methods. Cells are harvested 16-20 h after
oligonucleotide treatment, washed once with PBS, suspended in
Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a
16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and
transferred to membrane for western blotting. Appropriate primary
antibody directed to a target is used, with a radiolabeled or
fluorescently labeled secondary antibody directed against the
primary antibody species. Bands are visualized using a
PhosphorImager.TM. (Molecular Dynamics, Sunnyvale Calif.).
Example 44
Gene Target Sequences
[0514] In accordance with the present invention, a series of
oligomeric compounds was designed to hybridize to different regions
of target genes or targets. Presented in Table 12 are the target
genes, as well as the corresponding sequences, identified by
GenBank.RTM. accession number, used to design the oligomeric
compounds of the invention and other compounds described herein.
"Gene symbol" indicates the name used to herein to describe the
target nucleic acid molecule, and "Gene Name" indicates an
additional name by which the gene target is known.
15TABLE 12 Gene target sequences SEQ Gene GenBank .RTM. ID Symbol
Gene Name Accession # NO CD86 CD86 S70108.1 10 DGAT2 Diacylglycerol
AK002443.1 11 Acyltransferase 2 FAS Fatty Acid Synthase AF127033.1
12 FAS Fatty Acid Synthase X62889.1 13 FACL2 Fatty-Acid-Coenzyme
NM_007981.1 14 A Ligase, Long-Chain 2 GCGR Glucagon Receptor
NM_000160.1 15 GCGR Glucagon Receptor NM_008101.1 16 HSL
Hormone-Sensitive U08188.1 17 Lipase HSD11 Hydroxysteroid 11-Beta
X83202.1 18 Dehydrogenase 1 JNK1 Jun N-Terminal L26318.1 19 Kinase
- 1 PP2A- Protein Phosphatase 2 NM_002715.1 20 alpha Catalytic
Subunit Alpha PTEN Phosphatase And Tensin U92436.1 21 Homologue
PTP1B Protein Tyrosine M33962.1 22 Phosphatase 1b NaDC1 Solute
Carrier Family AF201903.1 23 13 (Sodium-Dependent Dicarboxylate
Transporter), Member 2 SCD1 Stearoyl-Coenzyme A 1850_038A 24
Desaturase 1 Survivin Survivin U75285.1 25 Survivin Survivin
AA717921.1 26 Survivin Survivin AB013819.1 27 TRADD Tumor Necrosis
Factor L41690.1 28 Receptor Associated Death Domain C-raf Raf
kinase C X03484.1 29 C-raf Raf kinase C assembled from 30
AC026153.10 and AC018500.2 SRC-2 steroid receptor U39060.1 31
coactivator 2 SRC-2 steroid receptor complement of 32 coactivator 2
nucleotides 10220000 to 10460000 of NW_000149.1 SRC-2 steroid
receptor AK028964.1 33 coactivator 2
Example 45
Chimeric Oligomeric Compounds Having Alternating 3'-Endo and
2'-Endo Regions
[0515] In one embodiment of the invention, the target sequences
presented in Table 12 were used as targets to which oligomeric
compounds were designed. These compounds have regions of
nucleosides that are "RNA-like", having northern or 3'-endo
conformational geometry (3'-endo regions), and regions of
nucleosides that are "DNA-like", having southern or
C2'-endo/O4'-endo conformational geometry. Each of the regions
ranges from 1 to 8 nucleosides in length. The motif of each
oligomeric compound is illustrated in Table 13, where 3'-endo
regions are indicated by bold, underlined type, or by italicized,
underlined type in the case of ISIS 199043, and 2'-endo regions are
indicated by plain type. The number corresponding to each region
represents the number of base pairs for that particular region. The
motif further indicates the total number of regions in the
compound, for example, a compound having the motif
"3-3-1-2-1-2-1-3-4" has a total of 9 regions, with each region
ranging from 1 to 4 nucleotides. In the compounds shown in Table
13, the 3'-endo regions shown in bold, underlined type comprise
2'-O-methoxyethyl (2'-MOE) nucleotides; the 3'-endo regions in
italicized, underlined type comprise 2'-O-methyl nucleotides; and
the 2'-endo regions comprise 2'-deoxynucleotides. Internucleoside
linkages are phosphorothioate throughout all compound in Table 13,
except where an asterisk "*" is present to indicate a
phosphodiester internucleoside linkage. All cytosines are
5-methylcytosines, unless otherwise indicated by a superscript "U"
preceding the nucleobase, for example, .sup.uC, which a natural or
unmodified cytosine.
[0516] The nucleic acid molecule to which each compound is targeted
is indicated by SEQ ID NO. "Target site" indicates the first
(5'-most) nucleotide number on the particular target nucleic acid
to which the compound binds. Where present, "NA" indicates that
"Target SEQ ID No." and "Target site" do not apply to a particular
oligomeric compound due to its lack of perfect complementarity to
any known gene (i.e., it is a mismatched oligomeric compound).
[0517] The chimeric oligomeric compounds of the invention,
comprising at least 5 regions that alternate between 3'-endo
regions and 2'-endo regions, are herein referred to as
"gap-disabled" oligomeric compounds. Also described herein are
"gapmers", chimeric oligomeric compounds having 3 regions, where
one 2'-endo region comprised of 2'-deoxynucleotides is flanked on
both sides (5' and 3' directions) by a 3'-endo region.
16TABLE 13 Oligomeric compounds TARGET SEQ ID TARGET SEQ ID ISIS #
NO SITE SEQUENCE MOTIF NO 113715 22 980 GCTCCTTCCACTGATCCTGC 5-10-5
45 114905 26 296 GTTGGTCTCCTTTGCCTGGA 5-10-5 49 116847 21 2097
CTGCTAGCCTCTGGATTTGA 5-10-5 42 118929 20 1492 TCTACAGTCATGCTGAGTAA
5-10-5 53 121874 10 289 TCAAGTTTCTCTGTGCCCAA 5-10-5 51 121875 10
335 GTTCCTGTCAAAGCTCGTGC 5-10-5 48 126965 17 2263
CCAGGGCTGCCTCAGACACA 5-10-5 39 129605 NA NA CCTGCTCCCTCTAATGCTGC
5-10-5 63 129686 NA NA CGTTATTAACCTCCGTTGAA 5-10-5 65 131906 NA NA
TCAAGTCCTTCCACACCCAA 5-10-5 70 141923 NA NA CCTTCCCTGAAGGTTCCTCC
5-10-5 64 146038 18 1107 TTCTCATGATGAGGTGTACC 5-10-5 58 146039 18
1119 TGTTGCAAGAATTTCTCATG 5-10-5 56 148529 12 630
TTCATGAACTGCACAGAGGT 5-10-5 57 148548 12 2238 TTGTTGACATTGTACTCGGC
5-10-5 59 166659 22 980 GCTCCTTCCACTGATCCTGC 3-3-1-2-1-2-1-3-4 45
180475 16 1348 GAGCTTTGCCTTCTTGCCAT 5-10-5 43 189525 NA NA
.sup.uC.sup.uCTG.sup.uCT.sup.uC.sup.uC.sup.uCT.sup.uCTAATG.sup.uCTG.sup.u-
C 5-10-5 63 194563 NA NA CCTGCTCCCTCTAATGCTGC
2-1-1-2-1-1-1-1-1-1-1-1-1-3-2 63 199041 NA NA CCTGCTCCCTCTAATGCTGC
Uniform 2'-MOE 63 199042 NA NA CCTGCTCCCTCTAATGCTGC
5-2-1-2-1-2-1-1-5 63 199043 NA NA CCTGCTCCCTCTAATGCTGC Uniform
2'-deoxy 63 199044 NA NA CCTGCTCCCTCTAATGCTGC 5-10-5 63 199046 NA
NA C*C*T*G*CTCCCTCTAATG*C*T*G*C 5-10-5 63 199047 NA NA
CCTGATCCCTCTAATGATGC 5-10-5 61 199048 NA NA CCTGCTCACTCTAATGCTGC
5-10-5 62 217352 11 1424 ATGCACTCAAGAACTCGGTA 5-10-5 35 217376 11
2230 TCCATTTATTAGTCTAGGAA 5-10-5 52 244504 24 1329
GTGTTTCTGAGAACTTGTGG 5-10-5 47 244541 24 1435 ATGTCCAGTTTTCCGCCCTT
5-10-5 36 249375 23 846 GGACCTGTAGCCATAGCCAA 5-10-5 46 249386 23
1021 CTCGTGAACCAGAGCACCAC 5-10-5 41 256899 13 12343
TTGTTGACGTTGTACTCAGC 5-10-5 60 283586 22 980 GCTCCTTCCACTGATCCTGC
Uniform 2'-MOE 45 284346 NA NA CTTCTAGCCTCTGGATTGGA 5-10-5 66
291452 14 214 TCAAGGACTGCTGATCTTCG 5-10-5 50 298682 NA NA
GCGATTTCCCGTTTTCACCT 5-10-5 67 298683 16 1348 GAGCTTTGCCTTCTTGCCAT
Uniform 2'-MOE 43 298683 16 1348 GAGCTTTGCCTTCTTGCCAT Uniform
2'-MOE 43 299228 25 12665 TGTGCTATTCTGTGAATT 2-2-1-3-1-2-1-3-3 55
299229 25 12665 TGTGCTATTCTGTGAATT 3-3-1-2-1-3-1-2-2 55 299230 27
856 AACCACACTTACCCATGGGC 3-2-1-3-1-2-1-3-4 34 299231 26 296
GTTGGTCTCCTTTGCCTGGA 3-2-1-3-1-2-1-3-4 49 299232 27 303
TGTCATCGGGTTCCCAGCCT 3-2-1-3-1-2-1-3-4 54 300861 16 1348
GAGCTTTGCCTTCTTGCCAT 3-2-1-3-1-3-1-3-3 43 303767 NA NA
GTTCGTGTTCTCTGGCTCGA 5-10-5 68 304170 13 12343 TTGTTGACGTTGTACTCAGC
3-2-1-2-1-2-1-2-1-2-3 60 304171 12 2238 TTGTTGACATTGTACTCGGC
3-2-1-2-1-2-1-2-1-2-3 59 306058 10 289 TCAAGTTTCTCTGTGCCCAA
3-2-1-2-1-3-1-2-1-1-3 51 307754 19 341 ATTTGCATCCATGAGCTCCA 5-10-5
37 310456 15 500 CAGGAGATGTTGGCCGTGGT 5-10-5 38 310457 15 532
GCACTTTGTGGTGCCAAGGC 5-10-5 44 310514 11 1424 ATGCACTCAAGAACTCGGTA
3-2-1-2-1-2-1-2-1-2-3 35 310515 11 2230 TCCATTTATTAGTCTAGGAA
3-2-1-2-1-2-1-2-1-2-3 52 310516 18 1107 TTCTCATGATGAGGTGTACC
3-2-1-2-1-2-1-2-1-2-3 58 310517 18 1119 TGTTGCAAGAATTTCTCATG
3-2-1-2-1-2-1-2-1-2-3 56 312837 23 846 GGACCTGTAGCCATAGCCAA
3-2-1-2-1-2-1-2-1-2-3 46 312844 24 1329 GTGTTTCTGAGAACTTGTGG
3-2-1-2-1-2-1-2-1-2-3 47 319162 14 214 TCAAGGACTGCTGATCTTCG
3-2-1-2-1-2-1-2-1-2-3 50 319237 NA NA TTGTTAACGGTGTTCTCAGC 5-10-5
71 319238 NA NA TTTGTAACGGTGTTCACTGA 5-10-5 72 319239 12 630
TTCATGAACTGCACAGAGGT 3-2-1-2-1-2-1-2-1-2-3 57 319240 NA NA
TACTTGACCTACAGAGTGGA 5-10-5 69 330693 17 2263 CCAGGGCTGCCTCAGACACA
2-1-1-2-1-1-1-1-1-1-1-1-1-3-2 39 332520 15 532 GCACTTTGTGGTGCCAAGGC
Uniform 2'-MOE 44 332521 15 532 GCACTTTGTGGTGCCAAGGC Uniform
2'-deoxy 44 332522 15 532 GCACTTTGTGGTGCCAAGGC
3-2-1-2-1-2-1-2-1-2-3 44 332864 16 1348 GAGCTTTGCCTTCTTGCCAT
4-3-1-4-1-3-4 43 332865 16 1348 GAGCTTTGCCTTCTTGCCAT
3-2-1-2-1-2-1-2-1-2-3 43 332866 16 1348 GAGCTTTGCCTTCTTGCCAT
3-5-4-5-3 43 332867 16 1348 GAGCTTTGCCTTCTTGCCAT 3-14-3 43 332868
16 1348 GAGCTTTGCCTTCTTGCCAT 3-3-2-4-2-3-3 43 332869 16 1348
GAGCTTTGCCTTCTTGCCAT 3-1-1-1-1-1-1-1-1-1-1-1-1-1-4 43 333022 15 500
CAGGAGATGTTGGCCGTGGT Uniform 2'-MOE 38 333023 15 500
CAGGAGATGTTGGCCGTGGT Uniform 2'-deoxy 38 333024 15 500
CAGGAGATGTTGGCCGTGGT 3-2-1-2-1-2-1-2-1-2-3 38 334269 21 2097
CTGCTAGCCTCTGGATTTGA 3-14-3 42 334270 21 2097 CTGCTAGCCTCTGGATTTGA
3-6-1-7-3 42 334271 21 2097 CTGCTAGCCTCTGGATTTGA 3-7-1-6-3 42
334272 21 2097 CTGCTAGCCTCTGGATTTGA 3-4-1-4-1-4-3 42 334273 21 2097
CTGCTAGCCTCTGGATTTGA 3-3-1-2-1-3-1-3-3 42 334274 21 2097
CTGCTAGCCTCTGGATTTGA 3-3-1-3-1-2-1-3-3 42 334275 21 2097
CTGCTAGCCTCTGGATTTGA 3-2-1-2-1-2-1-2-1-2-3 42 334276 21 2097
C*T*G*C*T*A*G*C*C*T*C*T* Uniform 2'-deoxy 42 G*G*A*T*T*T*G*A 335032
16 1348 GAGCTTTGCCTTCTTGCCAT Uniform 2'-deoxy 43 335033 16 1348
G*A*G*C*T*T*T*G*C*C*T*T*C* Uniform 2'-deoxy 43 T*T*G*C*C*A*T 335112
16 1348 G*A*G*C*T*T*T*G*C*C*T*T* 5-10-5 43 C*T*T*G*C*C*A*T 335114
16 1348 G*A*G*C*T*T*T*G*C*C*T*T* 3-2-1-3-1-3-1-3-3 43
C*T*T*G*C*C*A*T 337205 11 1424 ATGCACTCAAGAACTCGGTA 3-14-3 35
337206 11 1424 ATGCACTCAAGAACTCGGTA 3-6-1-7-3 35 337207 11 1424
ATGCACTCAAGAACTCGGTA 3-7-1-6-3 35 337208 11 1424
ATGCACTCAAGAACTCGGTA 3-4-1-4-1-4-3 35 337209 11 1424
ATGCACTCAAGAACTCGGTA 3-3-1-2-1-3-1-3-3 35 337210 11 1424
ATGCACTCAAGAACTCGGTA 3-3-1-3-1-2-1-3-3 35 337211 11 1424
A*T*G*C*A*C*T*C*A*A*G*A* Uniform 2'-deoxy 35 A*C*T*C**G*G*T*A
337212 11 1424 ATGCACTCAAGAACTCGGTA 3-2-2-1-2-1-2-1-1-2-3 35 337213
11 1424 ATGCACTCAAGAACTCGGTA 3-1-3-1-2-1-2-1-2-1-3 35 337214 11
1424 ATGCACTCAAGAACTCGGTA 3-1-2-1-2-1-2-1-2-1-4 35 337215 11 1424
ATGCACTCAAGAACTCGGTA 3-1-1-1-1-1-1-1-1-1-1-1-1-1-4 35 337216 11
1424 ATGCACTCAAGAACTCGGTA 1-1-1-1-1-1-1-1-1-1-1-1- 35 1-1-1-1-1-1-2
337217 21 2097 CTGCTAGCCTCTGGATTTGA 3-2-2-1-2-1-2-1-1-2-3 42 337218
21 2097 CTGCTAGCCTCTGGATTTGA 3-1-3-1-2-1-2-1-2-1-3 42 337219 21
2097 CTGCTAGCCTCTGGATTTGA 3-1-2-1-2-1-2-1-2-1-4 42 337220 21 2097
CTGCTAGCCTCTGGATTTGA 3-1-1-1-1-1-1-1-1-1-1-1-1-1-4 42 337221 21
2097 CTGCTAGCCTCTGGATTTGA 1-1-1-1-1-1-1-1-1-1-1-1- 42 1-1-1-1-1-1-2
337222 11 1424 ATGCACTCAAGAACTCGGTA Uniform 2'-MOE 35 338173 28 802
CGCTCGTACTCGTAGGCCAG 5-10-5 40 338174 28 802 CGCTCGTACTCGTAGGCCAG
Uniform 2'-MOE 40 338175 28 802 CGCTCGTACTCGTAGGCCAG 4-3-1-4-1-3-4
40 338176 28 802 CGCTCGTACTCGTAGGCCAG 3-2-1-2-1-2-1-2-1ee -2-3 40
338177 28 802 CGCTCGTACTCGTAGGCCAG 3-5-4-5-3 40 338178 28 802
CGCTCGTACTCGTAGGCCAG 3-14-3 40 338179 28 802 CGCTCGTACTCGTAGGCCAG
3-3-2-4-2-3-3 40 338180 28 802 CGCTCGTACTCGTAGGCCAG
3-1-1-1-1-1-1-1-1-1-1-1-1-1-4 40 345888 19 341 ATTTGCATCCATGAGCTCCA
3-2-1-2-1-2-1-2-1-2-3 37 352426 16 1348 GAGCTTTGCCTTCTTGCCAT
2-6-4-6-2 43 352427 16 1348 GAGCTTTGCCTTCTTGCCAT 2-7-2-7-2 43
352428 16 1348 GAGCTTTGCCTTCTTGCCAT 1-8-2-8-1 43
[0518] The target regions to which these sequences are
complementary are herein referred to as "target segments" and are
therefore suitable for targeting by oligomeric compounds of the
present invention. The target segment sequences represent the
reverse complement of the chimeric oligomeric compounds.
[0519] As these "target segments" have been found by
experimentation to be open to, and accessible for, hybridization
with the chimeric oligomeric compounds of the present invention,
one of skill in the art will recognize or be able to ascertain,
using no more than routine experimentation, further embodiments of
the invention that encompass other oligomeric compounds that
specifically hybridize to these target segments and consequently
inhibit the expression of a target.
[0520] According to the present invention, chimeric oligomeric
compounds include antisense olgiomeric compounds, antisense
oligonucleotides, siRNAs, alternate splicers and other short
olgiomeric compounds which hybridize to at least a portion of the
target nucleic acid.
Example 46
In Vitro Analysis of Chimeric Oligomeric Compounds Having
Alternating 3'-Endo and 2'-Endo Regions
[0521] In one embodiment, gap-disabled oligomeric compounds were
selected from Table 13 and tested for their effects on target
expression in cultured cells. Gapmer compounds were also tested in
each in vitro assay and served as the positive control for target
reduction.
[0522] To test the effects of gap-disabled compounds of the
invention on mouse survivin expression, NIH 3T3 cells were treated
6.25, 25, 100 and 200 nM of the oligomeric compounds shown in Table
13. ISIS 303767, which contains 6 mismatches to mouse survivin, was
used as a negative control in this assay. Cells were transfected
using LIPOFECTIN.TM. and mRNA levels were measured using real-time
PCR as described in other examples herein. Results of these studies
are shown in Table 14. Data are averages from two or more
experiments and are expressed as percent inhibition relative to
untreated control. As demonstrated in Table 14, the gap-disabled
compounds ISIS 299230 and ISIS 229231 and the gapmer ISIS 114905
inhibited mouse survivin expression in a dose-dependent manner. The
gap-disabled compounds ISIS 299229 and ISIS 299232 inhibited mouse
survivin expression at the 100 and 200 nM doses.
17TABLE 14 Inhibition of mouse survivin expression in NIH 3T3
cells: dose response % Inhibition SEQ ID Dose of oligonucleotide
(nM) ISIS # NO 6.25 25 100 200 299228 55 0 0 0 9 299229 55 0 0 10
17 299230 34 23 28 64 72 299231 49 22 44 78 83 299232 54 0 0 38 59
114905 49 0 51 82 91 303767 68 0 0 10 60
[0523] Oligomeric compounds targeting mouse SCD1 were also tested.
Primary mouse hepatocytes were treated with 15, 44, 133 and 400 nM
of the oligomeric compounds shown in Table 15, or the control
oligomeric compound ISIS 141923, which does not target mouse SCD1.
Cells were transfected using LIPOFECTIN.TM. and mRNA levels were
measured using real-time PCR as described in other examples herein.
Results of these studies are shown in Table 15. Data are averages
from three experiments and are expressed as percent inhibition
relative to untreated control. As demonstrated in Table 15, the
gap-disabled compound ISIS 312844 inhibited SCD1 expression in a
dose-dependent manner. The gapmer compounds also inhibited SCD1
expression in a dose-dependent manner.
18TABLE 15 Inhibition of mouse SCD1 expression in mouse primary
hepatocytes: dose response % Inhibition SEQ ID Dose of
oligonucleotide (nM) ISIS # NO 15 44 133 400 312844 47 0 15 40 69
244504 47 15 32 65 83 244541 36 0 1 46 78 141923 64 0 0 0 0
[0524] To evaluate the effects of oligomeric compounds of the
invention on mouse PTEN expression, b.END cells were treated with
12.5, 25, 50 or 100 nM of the oligomeric compounds shown in Table
16. ISIS 141923, which does not target PTEN, was used as a negative
control in this assay. Cells were transfected using LIPOFECTIN.TM.
and mRNA levels were measured using real-time PCR as described in
other examples herein. Results of these studies are shown in Table
16. Data are averages from two or more experiments and are
expressed as percent inhibition relative to untreated control. As
demonstrated in Table 16, the gap-disabled compounds ISIS 334269,
ISIS 334270, ISIS 334271, ISIS 334272, ISIS 334273, ISIS 334274,
ISIS 334275 inhibited mouse PTEN mRNA expression in a
dose-dependent manner, as did the gapmer compound ISIS 116847. ISIS
334269, a gapmer compound with a gap segment 14 nucleotides in
length and wing segments 3 nucleotides in length, also inhibited
PTEN expression in a dose-dependent manner. The uniform 2'-deoxy
compound ISIS 334276 did not exhibit target inhibition greater than
9%.
19TABLE 16 Inhibition of mouse PTEN mRNA expression in b.END cells:
dose response % Inhibition SEQ ID Dose of oligonucleotide (nM) ISIS
# NO 12.5 25 50 100 334269 42 9 29 56 71 334270 42 31 29 63 75
334271 42 18 46 59 66 334272 42 0 31 57 64 334273 42 19 31 47 60
334274 42 9 26 47 50 334275 42 10 30 43 63 334276 42 3 9 8 0 116847
42 12 45 62 75 141923 64 0 0 0 0
[0525] Additional compounds targeted to mouse PTEN were tested in a
similar assay in b.END cells. Cells were transfected using
LIPOFECTIN.TM. and mRNA levels were measured using real-time PCR as
described in other examples herein. ISIS 337217 inhibited target
expression 10% and 15% at doses of 25 and 50 nM, respectively. ISIS
331218 inhibited PTEN expression by 17% at a dose of 100 nM. ISIS
337219, ISIS 337220 and ISIS 337221 did not significantly inhibit
PTEN expression in b.END cells in this assay.
[0526] Oligomeric compounds targeted to NaDCl were also tested in
an in vitro assay. Primary mouse hepatocytes were treated with 15,
44, 133 or 400 nM of the oligomeric compounds shown in Table 17.
ISIS 141923, which does not target mouse NaDCl, was used as a
negative control compound in this assay. Cells were transfected
using LIPOFECTIN.TM. and mRNA levels were measured using real-time
PCR as described in other examples herein. Results of these studies
are shown in Table 17. Data are averages from three experiments and
are expressed as percent inhibition relative to untreated control.
As demonstrated in Table 17 the gap-disabled compound ISIS 312387
inhibited mouse NaDCl in a dose-dependent manner, as did the gapmer
compounds targeted to NaDCl.
20TABLE 17 Inhibition of mouse NaDC1 mRNA expression in mouse
primary hepatocytes: dose response % Inhibition SEQ ID Dose of
oligonucleotide (nM) ISIS NO 15 44 133 400 312837 46 16 55 61 79
249375 46 29 59 71 90 249386 41 0 9 38 76 141923 64 0 0 0 0
[0527] Primary mouse hepatocytes were treated for 4 hours with 15,
44, 133, and 400 nM of the oligomeric compounds shown in Table 18.
ISIS 141923, which does not target mouse HSD11, was used as a
negative control in this assay. Cells were transfected using
LIPOFECTIN.TM. and mRNA levels were measured using real-time PCR as
described in other examples herein. Results of these studies are
shown in Table 18. Data are averages from three experiments and are
expressed as percent inhibition relative to untreated control. As
demonstrated in Table 18, the gap-disabled compound ISIS 310516
inhibited HSD11 expression in a dose-dependent manner, as did the
gapmer compound.
21TABLE 18 Inhibition of mouse HSD11 mRNA expression in mouse
primary hepatocytes: dose response % Inhibition SEQ ID Dose of
oligonucleotide (nM) ISIS NO 15 44 133 400 310516 58 0 40 69 95
146038 58 37 70 94 97 141923 64 0 0 0 0
[0528] Gap-disabled compound targeting the mouse glucagon receptor
RNA were also tested in an in vitro assay. Primary mouse
hepatocytes were treated with 0.5, 1, 5, 10, 25 or 50 nM of the
oligomeric compounds shown in Table 19. ISIS 116847, which does not
target the mouse glucagon receptor, was used as a negative control
in this assay. Cells were transfected using LIPOFECTIN.TM. and mRNA
levels were measured using real-time PCR as described in other
examples herein.
[0529] Results of these studies are shown in Table 19. Data are
averages from three experiments and are expressed as percent
inhibition relative to untreated control. "IC.sub.50" indicates the
concentration of oligomeric compond required to inhibit glucagon
receptor mRNA expression by 50%. Where present, "ND" indicates "not
determined." As demonstrated in Table 19, the gap-disabled
compounds ISIS 300861, ISIS 332864, ISIS 332865, ISIS 332866, ISIS
332897 and ISIS 332868 inhibited mouse glucagon receptor expression
in a dose-dependent manner, as did the gapmer compound. ISIS
332867, a gap-disabled compound, inhibited mouse glucagon receptor
expression. ISIS 332869, a gapmer compound with a gap segment of 14
nucleotides in length and wing segments of 3 nucleotides in length,
exhibited dose-dependent inhibition of mouse glucagon receptor mRNA
at doses of 5, 10 and 25 nM.
22TABLE 19 Inhibition of mouse glucagon receptor mRNA expression in
mouse primary hepatocytes: dose response % Inhibition SEQ ID Dose
of oligonucleotide (nM) ISIS # NO 0.5 1 5 10 25 50 IC.sub.50(nM)
300861 43 1 15 32 20 51 67 24 332864 43 10 30 52 45 63 70 14 332865
43 6 10 29 36 49 53 33 332866 43 27 42 ND 58 70 75 6 332867 43 37
48 66 74 74 77 1 332868 43 7 34 52 58 68 ND 5 332869 43 15 2 5 12
24 25 >50 180475 43 3 43 58 68 78 80 3 116847 42 11 13 0 0 0 0
>50
[0530] To evaluate the effects of gap-disabled compounds targeted
to mouse DGAT2, primary mouse hepatocytes were treated with 15, 44,
133, and 400 nM of the oligomeric compounds shown in Table 20. ISIS
116847, which does not target the mouse glucagon receptor, was used
as a negative control in this assay. Cells were transfected using
LIPOFECTIN.TM. and mRNA levels were measured using real-time PCR as
described in other examples herein. Results of these studies are
shown in Table 20. Data are averages from three experiments and are
expressed as percent inhibition relative to untreated control. As
demonstrated in Table 2 the gap-disabled compounds ISIS 310514 and
ISIS 310515, like the gapmer compounds, inhibited mouse DGAT2
expression in a dose-dependent manner.
23TABLE 20 Inhibition of mouse DGAT2 expression in mouse primary
hepatocytes: dose response % Inhibition Dose of oligonucleotide
(nM) ISIS NO SEQ ID NO 15 44 133 400 310514 35 32 64 78 88 310515
52 0 39 45 66 217352 35 71 87 94 95 217376 52 65 75 91 98 141923 64
43 44 0 0
[0531] An additional assay tested a gap-disabled compound targeted
to mouse CD86. MH-S cells were treated with 0.12, 0.37, 1,1, 3.3,
10 and 30 nM of the oligomeric compounds shown in Table 21. ISIS
131906, which contains seven mismatched bases to mouse CD86, served
as the negative control compound in this assay. Cells were
transfected using LIPOFECTIN.TM. and mRNA levels were measured
using real-time PCR as described in other examples herein. Data are
averages from two or more experiments and are expressed as percent
inhibition relative to untreated control. Results of these studies
are shown in Table 21 and demonstrate that the gap-disabled
compound ISIS 306058, inhibited CD86 mRNA expression in a
dose-dependent manner at doses of 3.3, 10 and 30 nM.
24TABLE 21 Inhibition of mouse CD86 mRNA expression in MH-S cells:
dose response % Inhibition SEQ ID Dose of oligonucleotide (nM) ISIS
# NO 0.12 0.37 1.1 3.3 10 30 306058 51 0 6 0 17 32 45 121874 51 0
27 42 61 74 70 121875 48 0 25 43 62 78 81 131906 70 0 1 0 0 0
21
[0532] In a further embodiment, ISIS 306058 was tested for its
ability to modulate cell surface expression of CD86 protein. MH-S
cells were treated with 0.1, 0.4, 1.2, 3.7, 11.1, 33.3 and 100 nM
of the oligomeric compounds shown in Table 22. ISIS 131906, which
contains seven mismatched bases to mouse CD86, served as the
negative control compound in this assay. Cells were transfected
using LIPOFECTIN.TM. as described in other examples herein. Cell
surface expression of CD86 protein was measured by flow cytometry.
Cell surface expression of CD80, which shares sequence identify
with CD86 at the nucleic acid level, was also measured. Cells were
harvested by brief trypsinization, washed with PBS, then
resuspended in 100 .mu.L of staining buffer (PBS, 0.2% BSA)
containing both 10 .mu.L of FITC-conjugated anti-CD86 antibody
(FITC-anti-hCD86; FITC: fluorescien isothiocyanate; BD Biosciences,
San Jose, Calif.) and 10 ul of PE-conjugated anti-CD80 antibody
(PE: phycoerythrin; PE-anti-hCD80, BD Biosciences, San Jose,
Calif.). The cells were stained for 30 minutes at 4.degree. C.,
washed with PBS, resuspended in 300 .mu.L PBS containing 0.5%
paraformaldehyde. Measurements of mean fluorescence activity were
made by flow cytometry using the FL-1 and FL-2 channels of a BD
Biosciences FACScan (BD Biosciences, San Jose, Calif.). With this
method, both CD86 and CD80 protein expression on the surface of the
same cell was measured. Data were averaged from two or more
experiments and are expressed as percent inhibition relative to
untreated control. As shown in Table 22, the gap-disabled compound
ISIS 306058 exhibited inhibition of CD86 protein expression in a
pattern similar to that observed in cells treated with the gapmer
compounds, with dose-dependent inhibition limited to the 5 lower
doses. CD80 protein levels were not lowered by the gap-disabled or
gapmer compounds targeted to CD86.
25TABLE 22 Inhibition of mouse CD86 protein expression in MH-S
cells: dose response % Inhibition SEQ ID Dose of oligonucleotide
(nM) ISIS # NO 0.1 0.4 1.2 3.7 11.1 33.3 100 306058 51 4 6 12 19 30
31 31 121874 51 10 22 43 56 57 57 57 121875 48 9 21 34 46 57 55 54
131906 70 0 6 9 3 3 15 30
[0533] A gap-disabled compound targeted to mouse ACS1 was tested
for its effects on target mRNA expression. Primary mouse
hepatocytes were treated with 15, 44, 133 and 400 nM of the
oligomeric compounds shown in Table 23. ISIS 141923, which does not
target mouse ACS1, was used as a negative control in this assay.
Cells were transfected using LIPOFECTIN.TM. and mRNA levels were
measured using real-time PCR as described in other examples herein.
Data were averaged from three experiments and are expressed as
percent inhibition relative to untreated control. Results of these
studies are shown in Table 23 and demonstrate that the gap-disabled
compound ISIS 319962 inhibited mouse ACS1 in a dose-dependent
manner, as the the gapmer compound.
26TABLE 23 Inhibition of mouse ACS1 expression in mouse primary
hepatocytes: dose response % Inhibition Dose of oligonucleotide
(nM) ISIS # SEQ ID NO 15 44 133 400 319162 50 9 12 45 77 291452 50
20 38 63 90 141923 64 32 5 17 29
[0534] An additional in vitro assay was performed to test a
gap-disabled compound targeted to rat HSD11. Primary rat
hepatocytes were treated for 4 hours with 15, 44, 133 and 400 nM of
the oligomeric compounds shown in Table 24. ISIS 141923, which does
not target rat HSD11, was used as a negative control in this assay.
Cells were transfected using LIPOFECTIN.TM. and mRNA levels were
measured using real-time PCR as described in other examples herein.
Data were averaged from three experiments and are expressed as
percent inhibition relative to untreated control. Results of these
studies are shown in Table 24 and demonstrate that the gap-disabled
compound ISIS 310517 inhibited target mRNA expression in a
dose-dependent manner at the 3 higher doses of oligomeric
compound.
27TABLE 24 Inhibition of rat HSD11 mRNA expression in rat primary
hepatocytes: dose response % Inhibition Dose of oligonucleotide
(nM) ISIS NO SEQ ID NO 15 44 133 400 146039 56 31 53 76 92 310517
56 0 20 54 79 141923 64 7 9 0 0
[0535] Gap-disabled compounds targeted to rat FAS were tested for
their effects on target mRNA expression. Primary rat hepatocytes
were treated with 5, 10, 25, 50, 100, and 200 nM of the oligomeric
compounds shown in Table 25. ISIS 319237, ISIS 319238, or ISIS
319240, which contain 3, 8 and 7 mismatches to rat FAS,
respectively, were used as negative control compounds in this
assay. Cells were transfected using LIPOFECTIN.TM. and mRNA levels
were measured using real-time PCR as described in other examples
herein. Results of these studies are shown in Table 25. Data are
averages from three experiments and are expressed as percent
inhibition relative to untreated control. "IC.sub.50" indicates the
concentration of oligomeric compound required to inhibit FAS mRNA
expression by 50%. Where present, "ND" indicates "not determined."
The data illustrate that the gap-disabled compound ISIS 304170
inhibited rat FAS mRNA in a dose-dependent manner. With the
exception of the 25 nM dose, the treatments with ISIS 319239
inhibited rat FAS expression in a dose-dependent manner. The gapmer
compounds also inhibited target expression, whereas the mismatched
compounds did not.
28TABLE 25 Inhibition of rat FAS mRNA expression in rat primary
hepatocytes: dose response % Inhibition SEQ ID Dose of
oligonucleotide (nm) IC.sub.50 ISIS # NO 5 10 25 50 100 200 (nM)
304170 60 1 12 9 13 42 71 104 319239 57 4 14 0 38 62 76 67 148529
57 0 0 8 28 61 70 75 256899 60 17 16 3 25 52 73 97 319237 71 0 0 0
0 0 5 N.D. 319238 72 0 0 0 0 0 0 N.D. 319240 69 0 0 0 0 0 13
N.D.
[0536] From the data from the in vitro assays presented in Tables
14-25, it is evident that gap-disabled compounds effectively
inhibited the expression of the nucleic acid molecules to which
they are targeted.
Example 47
Chimeric Oligomeric Gap-Disabled Compounds Having Varying 2' Sugar
Modifications
[0537] The data described herein demonstrate that gap-disabled
oligomeric compounds having 2'-MOE nucleotides in the 3'-endo
regions are able to inhibit expression of a target gene. In a
further embodiment, a series of oligomeric compounds was designed,
using various 2' sugar modifications in the 3'-endo region. The
oligomeric compounds were designed using SEQ ID NO: 43, which
targets the mouse glucagon receptor RNA. The compounds are shown in
Table 26. All compounds in Table 26 are chimeric oligomeric
compounds comprising regions that alternate between 3'-endo regions
and 2'-endo regions. The motif of each oligomeric compound is
illustrated in Table 26, where 3'-endo regions are indicated by
bold, underlined type and 2'-endo regions are indicated by plain
type. The number corresponding to each region represents the number
of base pairs for that particular region. The 3'-endo modification
of each oligomeric compound is also indicated in Table 26. All
internucleoside linkages are phosphorothioate throughout each
compound in Table 26. Unmodified cytosines are indicated by a
superscript "U" preceding the nucleobase, for example, ".sup.UC";
all other cytosines are 5-methylcytosines. The 2'-endo regions of
ISIS 340662 are comprised of 2'-ribonucleotides. The 2'-endo
regions of all other compounds in Table 26 are comprised of
2'-deoxynucleotides. Where indicated by "U" at the 3'-terminal
nucleobase position of ISIS 340658, ISIS 340661, ISIS 340663 and
ISIS 358699, uracil was used in place of thymidine, making the
compounds hybrids of DNA and RNA.
29TABLE 26 Gap-disabled oligomeric compounds targeted to mouse
glucagon receptor: varying motifs and 3'-endo nucleosides SEQ ID
3'-endo ISIS NO NO Sequence (5' to 3') Motif modification 180475 43
GAGCTTTGCCTTCTTGCCAT 5-10-5 2'-MOE 298683 43 GAGCTTTGCCTTCTTGCCAT
Uniform 2'-MOE 2'-MOE 300861 43 GAGCTTTGCCTTCTTGCCAT
3-2-1-3-1-3-1-3-3 2'-MOE 340658 43 GAGCTTTGCCTTCTTGCCAU
3-2-1-3-1-3-1-3-3 2'-O-methyl 340659 43 GAGCTTTGCCTTCTTGCCAT
3-2-1-3-1-3-1-3-3 2'-fluoro 340660 43 GAGCTTTGCCTTCTTGCCAT
3-2-1-3-1-3-1-3-3 LNA 340661 43 GAGCTUTGC.sup.UCTTCUTGC.sup.UCAU
3-2-1-3-1-3-1-3-3 2'-OH 340662 43
GAG.sup.UCUTUG.sup.UCCUU.sup.UCTUG.sup.UCCAT 3-2-1-3-1-3-1-3-3
2'-MOE 332866 43 GAGCTTTGCCTTCTTGCCAT 3-5-4-5-3 2'-MOE 340663 43
GAGCTTTGCCTTCTTGCCAU 3-5-4-5-3 2'-O-methyl 340673 43
GAGCTTTGCCTTCTTGCCAT 3-5-4-5-3 LNA 358699 43 GAGCTTTGCCTTCTTGCCAU
3-5-4-5-3 2'-fluoro
[0538] The compounds were tested for their ability to modulate the
expression of glucagon receptor mRNA in mouse primary hepatocytes.
Cells, cultured as described herein, were treated with 0.1, 0.316,
1, 3.16, 10, 31.6 or 100 nM of oligomeric compounds. Untreated
cells served as a control group to which all other data were
normalized. Cells were transfected and mRNA was measured as
described herein. The data, shown in Table 27, are the average of 3
experiments and are presented as percent of control cell mRNA
expression. A number less than or greater than 100% indicates a
decrease or increase in mRNA expression, respectively.
30TABLE 27 Oligomeric compounds of varying motifs and 3'-endo
regions: effects on mouse glucagon receptor mRNA Dose of oligomeric
compound (nM) 100 31.6 10 3.16 1 0.316 0.1 3'-endo ISIS # % Control
expression Motif modification 180475 16 58 84 130 140 141 103
5-10-5 2'-MOE 298683 105 133 149 167 150 133 144 Uniform 2'-MOE
2'-MOE 300861 58 109 116 145 151 162 132 3-2-1-3-1-3-1-3-3 2'-MOE
340658 78 100 131 141 171 160 119 3-2-1-3-1-3-1-3-3 2'-O-methyl
340659 62 85 118 131 138 154 134 3-2-1-3-1-3-1-3-3 2'-fluoro 340660
38 61 97 121 134 146 154 3-2-1-3-1-3-1-3-3 LNA 340661 93 129 129
124 165 146 116 3-2-1-3-1-3-1-3-3 2'-OH 340662 99 151 145 149 163
168 128 3-2-1-3-1-3-1-3-3 2'-MOE 332866 20 64 83 146 133 128 144
3-5-4-5-3 2'-MOE 340663 25 76 112 123 137 138 137 3-5-4-5-3
2'-O-methyl 340673 45 59 87 112 128 125 99 3-5-4-5-3 LNA 358699 42
75 113 118 158 115 147 3-5-4-5-3 2'-fluoro
[0539] These data demonstrate that gap-disabled compounds, having a
plurality of motifs and 3'-endo modifications, exhibit target
reduction activity in this assay. For example, ISIS 300861
(2'-MOE), ISIS 340658 (2'-O-methyl), ISIS 340659 (2'-fluoro), ISIS
340660 (LNA), ISIS 332866 (2'-MOE), ISIS 340663 (2'-O-methyl), ISIS
340673 (LNA) and ISIS 359699 (2'-fluoro) inhibited target
expression at the 100 nM dose.
Example 48
Comparison of Gapmers and Gap-Disabled Oligomeric Compounds:
Influence on Apoptosis Induction and Cell Viability
[0540] Programmed cell death, or apoptosis, is an important aspect
of various biological processes, including normal cell turnover, as
well as immune system and embryonic development. Apoptosis involves
the activation of caspases, a family of intracellular proteases
through which a cascade of events leads to the cleavage of a select
set of proteins. The caspase family can be divided into two groups:
the initiator caspases, such as caspase-8 and -9, and the
executioner caspases, such as caspase-3, -6 and -7, which are
activated by the initiator caspases. The caspase family contains at
least 14 members, with differing substrate preferences (Thornberry
and Lazebnik, Science, 1998, 281, 1312-1316). Measuring caspase-3
activity is one manner in which caspase activity is evaluated.
Changes in nucleic acid content also serve as an indicator of cell
viability, as well as cytotoxic events or pathological
abnormalities that affect cell proliferation.
[0541] The ability of gap-disabled and gapmer oligomeric compounds
to affect apoptosis and viability in cultured cells was assayed
using gap-disabled compounds and their corresponding gapmer
compounds. The nucleic acid molecules to which these compounds are
targeted, as well as the sequence and motif of each compound, are
shown in Table 13. The gap-disabled compounds were: ISIS 330693,
ISIS 194563, ISIS 300861 and ISIS 304170. The gapmer compounds
were: ISIS 126965, ISIS 129605, ISIS 180475 and ISIS 256899.
[0542] These were tested for their effects on caspase-3 activity
and cell viability in the human lung carcinoma cell line A549
(American Type Culture Collection; Manassas, Va.). A549 cells were
routinely cultured in DMEM basal media (Invitrogen Corporation,
Carlsbad, Calif.) supplemented with 10% fetal bovine serum
(Invitrogen Corporation, Carlsbad, Calif.) and 1.times.
antibiotic-antimycotic mix (Invitrogen Corporation, Carlsbad,
Calif.). Cells were routinely passaged by trypsinization and
dilution when they reached approximately 100% confluence. For
LIPOFECTIN.TM.-mediated transfection A549 cells were plated on
96-well microtiter plates (Falcon-Primaria #353872, BD Biosciences,
Bedford, Mass.) precoated with rat tail collagen (BD Biosciences,
Bedford Mass.) at a density of approximately 2*10.sup.5 cells/ml in
Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal
bovine serum and antibiotic-antimycotic mix. Cells were cultured
overnight at 37.degree. C. in the presence of 5% CO.sub.2. The
following day the media was aspirated and replaced with prewarmed
OPTI-MEM.TM. (Invitrogen Corporation, Carlsbad, Calif.) containing
300 nM oligonucleotide and 9 .mu.g/mL LIPOFECTIN.TM. (Invitrogen
Corporation, Carlsbad, Calif. ). Cells incubated with OPTI-MEM.TM.
alone served as untreated control cells. After four hours the
transfection mix was exchanged for fresh culture medium and cells
were incubated for an additional 44 hours at 37.degree. C. in the
presence of 5% CO.sub.2.
[0543] Caspase-3 activity was evaluated with a fluorometric HTS
Caspase-3 assay (Oncogene Research Products, San Diego, Calif. )
that detects cleavage after aspartate residues in the peptide
sequence DEVD. The DEVD substrate is labeled with a fluorescent
molecule, which exhibits a blue to green shift in fluorescence upon
cleavage. Active caspase-3 in the oligonucleotide treated cells is
measured by this assay according to the manufacturer's
instructions. 48 hours after oligonucleotide treatment, 50 uL of
assay buffer was added to each well, followed by addition 20 uL of
the caspase-3 fluorescent substrate conjugate. Data were obtained
in triplicate. Fluorescence in wells was immediately detected
(excitation/emission 400/505 nm) using a fluorescent plate reader
(SpectraMAX GeminiXS, Molecular Devices, Sunnyvale, Calif.). The
plate was covered and incubated at 37.degree. C. for and additional
three hours, after which the fluorescence was again measured
(excitation/emission 400/505 nm). The value at time zero was
subtracted from the measurement obtained at 3 hours. The
measurement obtained from the untreated control cells was
designated as 100% activity. The data are presented in Table 28.
Values above or below 100% indicate an increase or decrease in
caspase-3 activity, respectively.
[0544] Cell proliferation and viability were measured using the
CyQuant Cell Proliferation Assay Kit (Molecular Probes, Eugene,
Oreg.) utilizing the CyQuant GR green fluorescent dye which
exhibits strong fluorescence enhancement when bound to cellular
nucleic acids. After the 48 hour oligonucleotide treatment, the
microplate was gently inverted to remove the medium from the wells,
which were each washed once with 200 uL of phosphate-buffered
saline. Plates were frozen at -70.degree. C. and then thawed. A
volume of 200 uL of the CyQUANT GR dye/cell-lysis buffer was added
to each well. The microplate was incubated for 5 minutes at room
temperature, protected from light. Data were obtained in
triplicate. Fluorescence in wells was immediately detected
(excitation/emission 480/520 nm) using a fluorescent plate reader
(SpectraMAX GeminiXS, Molecular Devices, Sunnyvale, Calif.). The
measurement obtained from the untreated control cells was
designated as 100% activity. The data are presented in Table 28.
Values above or below 100% indicate an increase or decrease in
caspase-3 activity, respectively.
31TABLE 28 Apoptosis and cell viability: comparison of gapmer and
gap-disabled oligomeric compounds % % caspase-3 SEQ ID ISIS # Motif
cell viability activity NO 126965 5-10-5 27 2408 39 330693
2-1-1-2-1-1-1-1-1-1-1-1-1-3-2 76 119 39 129605 5-10-5 60 156 63
194563 2-1-1-2-1-1-1-1-1-1-1-1-1-3-2 51 67 63 180475 5-10-5 30 436
43 300861 3-2-1-3-1-3-1-3-3 43 94 43 256899 5-10-5 68 110 60 304170
3-2-1-2-1-2-1-2-1-2-3 58 72 60
[0545] These data demonstrate that when cells were treated with
compounds have the nucleobase sequence of SEQ ID NOs: 39 and 43,
cell viability was higher and caspase-3 activity was lowered in
cells treated with the gap-disabled compounds, as compared to cells
treated with the gapmer compounds. Comparison of gap-disabled and
gapmer compounds having the nucleobase sequence of SEQ ID NOs: 63
and 60 reveals that both cell viability and caspase-3 activity were
lowered in the cells treated with the gap-disabled compounds, as
compared to cells treated with the gapmer compounds. These data
further illustrate that gap-disabled compounds, like gapmer
compounds, are able to modulate cellular pathways.
Example 49
Gap-Disabled vs. Gapmer Oligomeric Compounds: Hepatotoxic
Effects
[0546] A number of chemical modifications have been introduced into
oligomeric compounds to increase their usefulness as therapeutic
agents and improve their pharmacokinetic properties. Of particular
interest is the elimination of toxicity caused by oligomeric
compounds, which can be significant in the liver and kidney due to
the relatively high accumulation of oligomeric compounds in these
organs. In a further embodiment, the hepatotoxic effects of the
gapmer compound ISIS 129605 (SEQ ID NO: 63; no known target) and
the gap-disabled compound ISIS 194563 (SEQ ID NO: 63; no known
target) were tested in normal mice. Other oligomeric compounds
tested included ISIS 118929 (SEQ ID NO: 53), a randomized control
ISIS 29848 (NNNNNNNNNNNNNNNNNNNN, where N is A, T, C or G, SEQ ID
NO: 75); and ISIS 148548 (SEQ ID NO: 59), all three of which are
gapmer oligomeric compounds with 5-methylcytidines and
phosphorothioate internucleoside linkages throughout.
[0547] Normal mice, maintained on a lean diet, were injected with
50 mg/kg of each oligomeric compound, twice weekly for 2 weeks.
Saline-injected animals served as a control group. Each treatment
group contained 4 animals. Animals were sacrificed at the end of
the treatment period. Liver weights were determined at necropsy,
and serum was collected for analysis of liver transaminase levels
determined by routine clinical assays.
[0548] The serum transaminases ALT and AST are frequently used as
indicators of hepatotoxicity. ISIS 129605 caused marked increases
in both AST and ALT levels, which were 20 and 17 times,
respectively, that observed in saline-treated mice. Conversely,
ISIS 194563, which has the same nucleotide sequence as ISIS 129605
but is a gap-disabled compound, caused no increase in ALT and AST
levels relative to saline-treated animals. Similarly, treatment
ISIS 118929, ISIS 148548 or ISIS 29848 did not result in elevated
ALT and AST levels. Increases in liver and spleen weights can also
indicate the presence of toxicity. Treatment with ISIS 129605
resulted in an increase in liver weight approximately 1.6 times
that of livers from saline-treated animals. Conversely, treatment
with ISIS 194563 did not elevate or reduce liver weight. Serum
transaminase levels and liver weight data demonstrate that
introduction of 2'-MOE nucleotides into the gap segment of ISIS
129605 reduced the toxicity of that compound. Liver weights
following treatment with the other gamper compounds were not
significantly increased. None of the compounds resulted in
significantly elevated spleen weights.
[0549] An additional in vivo experiment was performed, using
oligomeric compounds described herein: ISIS 129605 (SEQ ID NO: 63),
a gapmer having the motif 5-10-5 wherein the wing segments are
composed of 2'-MOE nucleotides; ISIS 189525 (SEQ ID NO: 63), a
gapmer having the motif 5-10-5, wherein the wings are composed of
2'-MOE nucleotides, and also having unmodified cytosines (rather
than 5-methylcytosines); ISIS 199041 (SEQ ID NO: 63), uniformly
composed of 2'-MOE nucleotides; ISIS 199042 (SEQ ID NO: 63), a
gap-disabled compound having the motif 5-2-1-2-1-2-1-1-5; ISIS
199043 (SEQ ID NO: 63), uniformly composed of 2'-deoxynucleotides;
ISIS 199044 (SEQ ID NO: 63), a 5-10-5gapmer wherein the wing
segments are composed of 2'-O-methyl nucleotides and the gap is
composed of 2'-deoxynucleotides; and ISIS 199046 (SEQ ID NO: 63), a
5-10-5 gapmer wherein the wing segments are composed of 2'-MOE
nucleotides, and wherein the internucleoside linkages in the wings
are phosphodiester and the internucleoside linkages in the gap are
phosphorothioate. Also tested were ISIS 199047 (SEQ ID NO: 61) and
ISIS 199048 (SEQ ID NO: 62), both gapmer compounds with the motif
5-10-5, having wing segments composed of 2'-MOE nucleotides. Unless
otherwise noted, internucleoside linkages are phosphorothioate and
cytosines are 5-methylcytosines. For each motif presented,
emboldened, underlined type indicates 2'-MOE nucleotides and plain
type indicated 2'-deoxynucleotides. SEQ ID NOs: 63, 61 and 62 are
not perfectly complementary to any known target.
[0550] Lean mice were treated with 50 mg/kg oligomeric compound,
twice weekly for 3 weeks. The serum transaminases ALT and AST,
indicators of toxicity, were measured by routine clinical analysis
at the end of the study. ISIS 129605 treatment resulted in AST and
ALT levels approximately 6 and 5 times those of saline-treated
mice, respectively. ISIS 199044 resulted in dramatically elevated
AST and ALT, approximately 15 and 9 times those of saline-treated
mice, respectively. Treatment with ISIS 199048 also resulted in
elevated AST and ALT, approximately 10 and 15 times those of
saline-treated mice, respectively. The gap-disabled compound ISIS
199042 did not significantly elevate ALT and AST levels,
demonstrating that an additional gap-disabled compound exhibits
significantly fewer toxic properties than the gapmer version having
the same nucleotide sequence. ISIS 189525, ISIS 199041, ISIS
199043, ISIS 199046 and ISIS 199047 similarly did not cause
significantly elevated ALT and AST levels, illustrating that
various chemical modifications of SEQ ID NO: 63 exhibit fewer toxic
properties relative to ISIS 129605.
[0551] Liver weights, increases in which can also indicate
toxicity, were also measured at the end of the study. In accordance
with the observation that ISIS 199042 did not elevate ALT and AST
levels, this compound did not significantly change liver weight.
ISIS 199041 and ISIS 199046 did not cause increases in liver
weight. However, ISIS 129605 and ISIS 199044, which did exhibit
toxic properties as judged by ALT and AST levels, increased liver
weight by approximately 1.6 and 1.8 times that of liver weights
from saline-treated mice. These data further demonstrate the toxic
properties of these compounds. Although ISIS 189525 and ISIS 199043
did not elevate ALT and AST levels, treatment with these compounds
resulted in approximately 1.4-fold increases in liver weights
relative to livers from saline-treated mice.
[0552] These in vivo studies illustrate that chimeric oligomeric
compounds having at least 9 alternating 3'-endo and 2'-endo regions
ameliorate hepatotoxicity, thereby improving the pharmacokinetic
properties of the compounds. Thus, these compounds have
applications in the development of therapeutic agents.
Example 50
In Vivo Comparison of Gapmer and Gap-Disabled Oligomeric Compounds
Targeted to JNK1: Target Reduction and Toxicity
[0553] In a further embodiment, gap-disabled and gapmer oligomeric
compounds targeted to both human and mouse jun N-terminal kinase-1
(JNK1) were tested for their effects on both toxicity and target
reduction in vivo. The gap-disabled compound ISIS 345888 (SEQ ID
NO: 37) and the gapmer compound ISIS 307754 (SEQ ID NO: 37) are
both shown in Table 13 and were selected for this study.
[0554] Male Balb/c mice, 6 to 7 weeks of age, received twice weekly
intraperitoneal injections of 12.5, 25 or 50 mg/kg of either ISIS
307754 or ISIS 345888, for a period of three weeks. ISIS 141923
(SEQ ID NO: 64) was used as a negative control oligomeric compound
and was injected at 50 mg/kg. Saline-injected animals served as a
control group and were injected in the same manner as the
oligomeric compounds. Each treatment group contained 4 animals.
Body weights were monitored throughout the study (Days 1, 5, 8, 12,
15 and 19). Two days following the final injection, animals were
sacrificed (Day 20). Liver and spleen weights, increases in which
can indicate toxicity, were determined at time of necropsy. Serum
was collected for analysis of the liver transaminase ALT, an
indicator of toxicity. ALT levels were determined by routine
clinical analysis. Liver tissue was collected for measurement of
target mRNA expression by real-time PCR. Liver and kidney tissue
were evaluated for concentration of total and full-length
oligomeric compound by capillary gel electrophoresis.
[0555] ALT levels are shown in Table 29, in international units per
liter (IU/L), with the saline control levels included for
comparison. Body, liver and spleen weights are also presented in
Table 29. Body weights are shown as percentage relative to the
weight of each animal at the start of the study. Liver and spleen
weights are normalized to saline-treated control weights.
32TABLE 29 Indicators of toxicity: gap-disabled vs. gapmer
oligomeric compounds targeted to JNK1 Liver Spleen Body Weights
Weight Weight ALT % relative to Day 1 Dose, IU/L Day Day Day Day
Day % relative to saline Treatment mg/kg Day 20 5 8 12 15 19 Day 20
Day 20 Saline none 46 100 106 104 108 108 100 100 141923 50 64 100
104 105 107 109 99 106 307754 50 292 101 102 103 102 105 131 147
307754 25 218 98 101 101 105 107 118 122 307754 12.5 40 101 105 106
106 109 109 120 345888 50 58 100 104 103 106 106 101 125 345888 25
103 102 105 105 107 110 110 124 345888 12.5 48 98 103 103 107 110
107 119
[0556] From these data, it is evident that at doses of 25 or 50
mg/kg, treatment with the gap-disabled compound ISIS 345888
resulted in markedly lower ALT levels, relative to treatment with
the gapmer compound ISIS 307754. These data further reveal that at
the 25 and 50 mg/kg doses, ISIS 307754 caused increases in liver
weight, relative to saline-treatment. The 12.5 mg/kg dose of ISIS
307754 did not increase liver weight, relative to saline-treatment.
None of the doses of the gap-disabled compound ISIS 345888 resulted
in an increase in liver weight, relative to saline-treatment. Thus,
ISIS 345888 exhibits fewer toxic properties than ISIS 307754.
[0557] Oligomeric compounds isolated from kidney and liver tissue
were subjected to capillary gel electrophoresis, to determine the
concentrations of total and full-length oligomeric compound. The
total concentration of oligomeric compound following treatment with
ISIS 307754 (gapmer) was 163 .mu.g/g in kidney and 176 .mu.g/g in
liver. Full-length ISIS 307754 represented 94% of the total
compound present in kidney and 98% of the total compound present in
liver. The total concentration following treatment with ISIS 345888
was 126 .mu.g/g in kidney and 174 .mu.g/g in liver. Full-length
ISIS 345888 represented 82% of the total compound present in kidney
and 78% of the total compound present in liver. These data
demonstrate that full-length ISIS 345888 accumulates in liver and
kidney tissue.
[0558] Liver RNA was analyzed for JNK1 expression levels by
quantitative real-time PCR as described by other examples herein,
using the housekeeping gene cyclophilin A to normalize RNA levels
among samples. In Table 30, JNK1 mRNA expression levels are shown
as normalized to saline-treated control JNK1 levels.
33TABLE 30 Target reduction and serum transaminases: gap-disabled
vs. gapmer oligomeric compounds targeted to JNK1 JNK1 Dose, mRNA %
Treatment mg/kg control 141923 50 93 307754 50 15 307754 25 16
307754 12.5 31 345888 50 23 345888 25 26 345888 12.5 49
[0559] These results demonstrate a substantial reduction in target
expression following treatment with both the gap-disabled and
gapmer compounds. Furthermore, the hepatoxicity caused by the
gapmer, as judged by liver weights and ALT levels, is ameliorated
by the introduction of 2'-MOE nucleotides into the gap segment. The
significant reduction of JNK1 mRNA in livers of mice treated with
ISIS 345888 also illustrates that the concentration of ISIS 345888
accumulated in the liver is an amount sufficient to elicit
substantial target reduction.
Example 51
Antisense Inhibition by Gap-Disabled Oligomeric Compounds Target to
Human C-raf
[0560] In a further embodiment, a series of oligomeric compounds
was designed to target human C-raf RNA, using publicly available
sequences (GenBank accession number X03484.1, incorporated herein
as SEQ ID NO: 29; and a sequence assembled from GenBank accession
numbers AC026153.10 and AC018500.2, incorporated herein as SEQ ID
NO: 30). The compounds are shown in Table 31. "Target site"
indicates the first (5'-most) nucleotide number on the particular
target sequence to which the compound binds. All compounds in Table
31 are chimeric oligomeric compounds, comprising regions that
alternate between 3'-endo regions and 2'-endo regions, also known
as gap-disabled compounds. The motif of each compound in Table 31
is 3-2-1-2-1-2-1-2-1-2-3, where the number indicates the number of
nucleosides in that region. Regions consisting of 2'-MOE
nucleotides are indicated by bold, underlined type and the
remaining regions in plain type consist of 2'-deoxynucleotides. All
internucleoside linkages are phosphorothioate linkages, and all
cytosines are 5-methylcytosines.
[0561] The compounds were tested for their effect on human C-raf
mRNA levels by quantitative real-time PCR as described in other
examples herein. Data are averages from two experiments in which
A549 cells were treated with 75 nM of the compounds in Table 31.
ISIS 18078 (SEQ ID NO: 8), which does not target Raf kinase C, was
used as a negative control oligonucleotide in this assay.
34TABLE 31 Antisense inhibition by gap-disabled oligomeric
compounds targeted to human C-raf Target SEQ ID Target % Seq ID
Isis # Region NO Site Sequence (5' to 3') Inhib NO 336818 Coding 29
94 attcttaaacctgagggagc 26 76 336819 Coding 29 144
tgatcgtcttccaagctccc 46 77 336820 Coding 29 198
gagagatgcagctggagcca 61 78 336821 Coding 29 249
tgccatcatctgatgcccgg 77 79 336822 Coding 29 268
ttagaaggatctgtgagttt 67 80 336823 Coding 29 327
gcacattgaccactgttctt 43 81 336824 Coding 29 367
agtgctttcataaggcagtc 38 82 336825 Coding 29 392
ctctggttgcaggcccctca 59 83 336826 Coding 29 413
aagtctgaacactgcacagc 57 84 336827 Coding 29 433
ttacctttgtgttcgtggag 75 85 336828 Coding 29 466
gcagcatcagtattccaatc 58 86 336829 Coding 29 543
tcttccgagcaaagttgtgt 35 87 336830 Coding 29 591
tgagcaggaatttctgacag 53 88 336831 Coding 29 701
tggaaacaataagagttgtc 40 89 336832 Coding 29 776
ggaaacagactctcgcatac 38 90 336833 Coding 29 800
gtgctgagaactaacaggca 78 91 336834 Coding 29 909
tgaccatgtggacattaggt 70 92 336835 Coding 29 931
ctgtccacaggcagcgtggt 40 93 336837 Coding 29 954
gaaggtgaggctgattcgct 43 94 336838 Coding 29 982
cacgaggcctaattttgttt 91 95 336839 Coding 29 1110
atttcccaataatagcttga 68 96 336840 Coding 29 1141
gcaacatctccgtgccattt 48 97 336841 Coding 29 1228
tcctgaaggcctggaattgc 53 98 336842 Coding 29 1284
ccgtgttttgcgcagaacag 50 99 336843 Coding 29 1313
caggttgtcctttgtcatgt 17 100 336844 Coding 29 1361
ggacatgcaggtgtttgtag 27 101 336845 Coding 29 1416
attagctggaacatctgaaa 19 102 336846 Coding 29 1447
atgcaaatagtccattccct 21 103 336847 Coding 29 1490
gaaatatattgttggatttc 61 104 336848 Coding 29 1536
cgtgactttactgttgccaa 34 105 336849 Coding 29 1594
gggccatccagaggacagag 58 106 336850 Coding 29 1650
tgaagatgatctgatctcgg 31 107 336851 Coding 29 1788
atatagcttactaagatctg 33 108 336852 Coding 29 1832
aatggaagacaggatctggg 34 109 336853 Coding 29 1928
cttcggtagagagtgttgga 52 110 336854 Coding 29 1955
tatcctcagtgtgggctgcc 39 111 336855 Coding 29 2010
tgcaaagtcaactagaagac 49 112 336856 Coding 29 2068
ttctgcctctggagaaaggg 20 113 336857 Intron 29 2144
aggtccttagcagagcttct 33 114 336858 Intron 29 2177
aaatggcttccttctcccag 13 115 336859 Intron 29 2255
tacagaaggctgggccttga 67 116 336860 Intron 29 2317
tttttgtactaccatcaaca 50 117 336861 Intron 29 2351
acttcctctaaatactcatg 24 118 336862 Intron 29 2399
tccacatcagggctggactg 32 119 336863 Intron 29 2430
gaagctgatttccaaaatcc 14 120 336864 Intron 29 2458
tcccgcctgtgacatgcatt 39 121 336865 Intron 29 2484
accactctctgaagaaagtc 25 122 336866 Intron 29 2502
gtgccttatgtgcaaaatgt 36 123 336867 Intron 29 2532
ggcggccagagtctcggcag 13 124 336868 Intron 29 2566
ctaagaaaagttccatagta 14 125 336869 Intron 29 2604
gaagctgtgaaaggaggacg 9 126 336870 Intron 29 2630
gggcagctcctggaagacaa 31 127 336871 Intron 29 2746
tgtatacacatgatgtgact 25 128 336872 Intron 30 2834
aacatagctatttgaagcta 47 129 336873 Intron 30 27366
aagcaataatttcaatttct 35 130 336874 Intron 30 27473
gcccagcttaacgtgtattt 12 131 336875 Intron 30 27513
tcatcaggcccagcttaacg 52 132 336876 Intron 30 27520
ccatccatggaaacattatc 35 133 336877 Intron 30 28081
acagcatctaacatcactgt 24 134 336878 Intron 30 28103
agtcaatctcccgaggatag 38 135 336879 Intron 30 28215
agtgacgctttccaagaaga 27 136 336880 Intron 30 28503
atgtaagctaacgatgaata 10 137 336881 Exon-Exon Junction 30 28528
ttccctgggctattctccca 51 138 336882 Exon-Exon Junction 30 28577
aattgagaattacactcacc 55 139 336883 Exon-Exon Junction 30 28613
aacgcctcctaaattgagaa 27 140 336884 Exon-Exon Junction 30 28624
tggattggcttagggaccca 25 141 336885 Exon-Exon Junction 30 28700
actattttgcccttatgaag 81 142 336886 Exon-Exon Junction 30 28886
tcttaaaatctactctgaaa 29 143 336887 Exon-Exon Junction 30 29191
cttaactgtcttaaaatcta 47 144 336888 Exon-Exon Junction 30 29199
tgaaaaatgtacttttctat 51 145 336889 Exon-Exon Junction 30 29273
aaagttttctttaaacaatg 44 146 336890 Exon-Exon Junction 30 29462
gcccatgttctcagaataaa 63 147 336891 Exon-Exon Junction 30 29641
aatctaggtctgttgaactc 6 148 336892 Exon-Exon Junction 30 29665
aaggtaatttgctcaaggcc 46 149 336893 Exon-Exon Junction 30 29713
agaaaactgggactctaaga 60 150 336894 Exon-Exon Junction 30 29732
tatttctatctgaaaaataa 48 151 336895 Exon-Exon Junction 30 29751
aacaaacctatgaagtaggt 59 152 337561 Exon 1: Intron 1 30 29773
tgccacctacctgagggagc 43 153 337562 Exon 10: Intron 10 30 20510
attcttaaacctggtaagaa 64 154 337563 Exon 11: Intron 11 30 20743
gttcacataccactgttctt 48 155 337564 Exon 12: Intron 12 30 27195
gcacattgacctacaaacaa 57 156 337565 Exon 13: Intron 13 30 27308
gagctcttaccctttgtgtt 45 157 337566 Exon 14: Intron 14 30 30025
tgcaacttacaaagttgtgt 67 158 337567 Exon 15: Intron 15 30 30334
tcttccgagcctacaacaag 43 159 337568 Exon 2: Intron 2 30 30492
aatgccttacaagagttgtc 48 160 337569 Exon 3: Intron 3 30 34981
gtgctgagaactaggaggag 63 161 337570 Exon 4: Intron 4 30 35135
gccctattacctcaatcatc 48 162 337571 Exon 5: Intron 5 30 38855
gaattgcatcctgaaacaga 69 163 337572 Exon 7: Intron 7 30 38883
ggaaaagtacctgattcgct 43 164 337573 Exon 8: Intron 8 30 38991
gaaggtgaggcttaatagac 84 165 337574 Intron 1: Exon 2 30 39462
cacgaggcctctgaaacaag 60 166 337575 Intron 10: Exon 11 30 39580
ccaagcttaccgtgccattt 65 167 337576 Intron 12: Exon 13 30 47482
gcaacatctcctgcaaaatt 40 168 337577 Intron 13: Exon 14 30 47567
ttctactcaccgcagaacag 28 169 337578 Intron 15: Exon 16 30 48476
tctactcactccattccctg 38 170 337579 Intron 16: Exon 17 30 51633
atgcaaatagctgtgaaggg 58 171 337580 Intron 2: Exon 3 30 51680
caaaggatactgttggattt 76 172 337581 Intron 4: Exon 5 30 53471
agaaatatatctcaatgctt 58 173 337582 Intron 6: Exon 7 30 53590
agattctcaccatccagagg 79 174 337583 Intron 7: Exon 8 30 54149
acagacttacctgatctcgg 44 175 337584 Intron 8: Exon 9 30 54289
tgaagatgatctaagggaaa 65 176 337585 Intron 9: Exon 10 30 54615
ggaagacaggatctgaaaca 56 177
[0562] These data reveal that SEQ ID NOs 77, 78, 79, 80, 81, 83,
84, 85, 86, 88, 91, 92, 94, 95, 96, 97, 98, 99, 104, 106, 110, 112,
116, 117, 129, 132, 138, 139, 142, 144, 145, 146, 147, 149, 150,
151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163,
164, 165, 166, 167, 171, 172, 173, 174, 175, 176 and 177 exhibited
at least 43% inhibition of human C-raf mRNA expression in this
assay.
Example 52
Antisense Inhibition by Gap-Disabled Oligomeric Compounds Target to
Mouse SRC-2
[0563] In a further embodiment, a series of oligomeric compounds
was designed to target mouse SRC-2 RNA, using publicly available
sequences (GenBank accession number U39060.1, corporated herein as
SEQ ID NO: 31; the complement of nucleotides 10220000 to 10460000
of the sequence with GenBank accession number NW.sub.13 000149.1,
incorporated herein as SEQ ID NO: 32; and GenBank accession number
AK028964. 1, incorporated herein as SEQ ID NO: 33). The compounds
are shown in Table 32. "Target site" indicates the first (5'-most)
nucleotide number on the particular target sequence to which the
compound binds. All compounds in Table 32 are chimeric oligomeric
compounds, comprising alternating 3'-endo regions and 2'-endo
regions, also known as gap disabled compounds. The motif of
compound in Table 19 is 3-2-1-2-1-2-1-2-1-2-3, where the number
indicates of nucleosides in that region. Regions consisting of
2'-MOE nucleotides are indicated by bold, underlined type and the
remaining regions in plain type consist of 2'-deoxynucleotides. All
internucleoside linkages are phosphorothioate linkages, and all
cytosines are 5-methylcytosines.
[0564] The compounds were tested for their effect on mouse SRC-2
mRNA levels by quantitative real-time PCR as described in other
examples herein. Data are averages from two experiments in which
b.END cells were treated with 50 nM of the compounds in Table 32.
ISIS 337599 (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 178), which does not
target Raf kinase C, is a gap-disabled compound having the same
motif as the compounds in Table 32 and was used as a negative
control compound in this assay.
35TABLE 32 Antisense inhibition by gap-disabled oligomeric
compounds targeted to human Raf kinase C TARGET SEQ ID TARGET % SEQ
ID ISIS # Region NO SITE SEQUENCE (5' to 3') INHIB NO 337600 5'UTR
31 174 tatcagcaactgtgcctgta 6 179 337601 5'UTR 31 193
cccactcatcttgaacacat 21 180 337602 Coding 31 479
tctgcacttcatctatgttg 45 181 337603 Coding 31 646
cagctcttcttggttatacc 37 182 337604 Coding 31 1170
tgtctcagaacttcatggtg 34 183 337605 Coding 31 1257
gaacggatgagtttgctctt 9 184 337606 Coding 31 1272
tcattagtagtctgagaacg 0 185 337607 Coding 31 1426
acctgggttcccactgcaca 49 186 337608 Coding 31 1462
gggaaaatttatattgctac 9 187 337609 Coding 31 1491
atgcccatttgttcctttgg 22 188 337610 Coding 31 2244
tgcttctccttgagcgaggt 31 189 337611 Coding 31 2509
aggatctgtcttactgtcca 53 190 337612 Coding 31 2519
tgttactggcaggatctgtc 20 191 337613 Coding 31 2625
tgcaaatcatccaaaatctc 26 192 337614 Coding 31 2700
atggcttgcttgtcaactga 53 193 337615 Coding 31 2705
tgatgatggcttgcttgtca 35 194 337616 Coding 31 2720
gttgcatgaggtcattgatg 31 195 337617 Coding 31 2804
gtgggttattaaaagtgctc 7 196 337618 Coding 31 2809
tggtcgtgggttattaaaag 16 197 337619 Coding 31 2819
ccagttgccctggtcgtggg 39 198 337620 Coding 31 2824
cctgcccagttgccctggtc 10 199 337621 Coding 31 2839
ctggtttggcaataacctgc 1 200 337622 Coding 31 2885
gtccagcaccagttgggctt 27 201 337623 Coding 31 2890
gaaaggtccagcaccagttg 33 202 337624 Coding 31 2900
tgattggtgggaaaggtcca 11 203 337625 Coding 31 2910
ctactgtttctgattggtgg 33 204 337626 Coding 31 2934
ggctgaggtatcactgagta 62 205 337627 Coding 31 2939
ttcctggctgaggtatcact 34 206 337628 Coding 31 2949
ttacccatcattcctggctg 36 207 337629 Coding 31 3182
gtctttggccaggctggctg 27 208 337630 Coding 31 3513
tggctctggctgaccagttc 20 209 337631 Coding 31 3650
agtttggatcttgcatggga 28 210 337632 Coding 31 3789
ttctgctgtgcttggaggcg 24 211 337633 Coding 31 4137
gtcgtagccccagtaaagcc 2 212 337634 3'UTR 31 4833
agttgcactacggtgaatgc 43 213 337635 Exon 1a: Intron 1c 32 77182
gcatctttaccacttcagga 39 214 337636 Exon 11: Intron 11 32 200699
gaaaactcacctggtcactg 0 215 337637 3'UTR 33 2520
aacaggtcgagctcagtagt 34 216
[0565] These data demonstrate that SEQ ID NOs 180, 181, 182, 183,
186, 188, 189, 190, 191, 192, 193, 194, 195, 198, 201, 202, 204,
205, 206, 207, 208, 209, 210, 211, 213, 214 and 216 demonstrated at
least 20% inhibition of mouse SRC-2 in this assay. These results
provide another example of target inhibition by gap-disabled
oligomeric compounds.
Example 53
Recombinant Human RNase H Analysis
[0566] RNase H is a cellular endonuclease which cleaves the RNA
strand of an RNA:DNA duplex. It is known in the art that
single-stranded antisense oligomeric compounds which are "DNA-like"
or have DNA-like regions elicit RNase H activity. Activation of
RNase H, therefore, results in cleavage of the RNA target, thereby
allowing oligonucleotide-mediated inhibition of gene
expression.
[0567] In a further embodiment, the ability of oligomeric compounds
to elicit RNase H activity was tested using RNase H activity
assays. Where the motif of each compound is indicated, 2'-MOE
nucleotides are in bold, underlined type and 2'-deoxynucleotide
regions are in plain type. The number in each region represents the
number of nucleotides in that region. Oligomeric compounds tested
included ISIS 300861 (SEQ ID NO: 43), a gap-disabled compound
having the motif 3-2-1-3-1-3-1-3-3 and phosphorothioate (P.dbd.S)
internucleoside linkages throughout the compound, and ISIS 335114
(SEQ ID NO: 43), also a gap-disabled compound having the motif
3-2-1-3-1-3-1-3-3and phosphodiester (P.dbd.O) internucleoside
linkages throughout the compound. Also tested was ISIS 335112 (SEQ
ID NO: 43), a chimeric oligonucleotide 20 nucleotides in length,
having a 10-nucleotide gap segment flanked on both sides (5' and
3') by 5-nucleotide wing segments, wherein the gap segment consists
of 2'-deoxynucleotides and the wing segments consist of 2'-MOE
nucleotides. Internucleoside linkages are phosphodiester (P.dbd.O)
throughout the compound. An additional oligomeric compound tested
was ISIS 335033 (SEQ ID NO: 43), uniformly composed of
2'-deoxynucleotides with phospodiester (P.dbd.O) internucleoside
linkages throughout the compound. In these compounds, all cytosines
are 5-methylcytosines.
[0568] RNase H1 activity was evaluated using 40
oligoribonucleotides of mouse glucagon receptor RNA
(GTTGGAGGCAATGGCAAGAAGGCAAAGCTCTTCAGGAGGA, incorporated herein as
SEQ ID NO: 217) as the target RNA. This target RNA was
radiolabelled with .sup.32P at the 5'-end as described by Wu et al.
(J. Biol. Chem, 2001, 276, 23547-23553). In a volume of 100 .mu.L,
100 nM of radiolabelled RNA and 200 nM of oligomeric compound were
incubated in a reaction containing 20 mM Tris HCl, pH 7.5, 20 mM
KCl, 1 mM MgCL.sub.2, 0.1 mM Tris(2-carboxyethyl)phosphine
hydrochloride (TCEP) and 4% RNaseOUT.TM. (Invitrogen Corporation,
Carlsbad, Calif.). Reactions were melted by heating to 95.degree.
C. for 5 minutes then allowed to cool slowly to room temperature.
Formation of the heteroduplex between the target RNA and an
oligomeric compound was confirmed by the shift in mobility between
the single-stranded end labeled sense RNA and the annealed duplex
on non-denaturing polyacrylamide gels. The resulting heteroduplexes
were tested as substrates for digestion by recominant human RNase
H1, which was expressed and purified as described by Wu et al. (J.
Biol. Chem, 2004, 279, 17181-17189). An aliquot of annealed
heteroduplex reaction was removed for use as the t=0 timepoint. 70
ng of purified recombinant RNase H1 in a solution of 50 mM Tris
HCl, pH 7.5, 50 mM NaCl, 50% glycerol, 1 mM TCEP and 4%
RNaseOUT.TM. was added to 100 .mu.L of the duplex reaction and was
incubated at 37.degree. C. The reaction was terminated at 15, 60
and 240 minute timepoints by the addition of 4M Urea and 20 mM
EDTA. The reactions were heated at 90.degree. C. for 2 minutes and
the reaction products were resolved on a 12% polyacrylamide gel
containing 7 M Urea and visualized and quantitated using a
PhosphorImager.TM. and IMAGEQUANT.TM. Software (Molecular Dynamics,
Sunnyvale, Calif.).
[0569] Recombinant human RNase H1 was tested for its ability to
cleave four different heteroduplexes formed between the target RNA
and each of the oligomeric compounds ISIS 335112, ISIS 335033, ISIS
335114 and ISIS 300861. The percentage of target RNA cleaved was
calculated using the following formula: [(fraction of RNA
cleaved/total RNA input).times.100]-% background. The data from the
15, 60 and 240 minute time points were normalized to the data from
the t=0 timepoint. The results are shown in Table 33.
36TABLE 33 Recombinant human Rnase-H1 mediated cleavage of
heteroduplexes % target mRNA cleavage Reaction ISIS 335112 ISIS
335033 ISIS 335114 ISIS 300861 time Gapmer 2'-deoxy Gap-disabled
Gap-disabled (minutes) P.dbd.O P.dbd.O P.dbd.O P.dbd.S 15 3 5 1 0
60 15 30 1 1 240 38 74 1 1
[0570] These data demonstrate that whereas ISIS 335112 (gapmer) and
ISIS 335033 (uniform 2'-deoxy) oligomeric compounds elicited RNase
H1-mediated cleavage, the gap-disabled compounds (ISIS 335114 or
ISIS 300861) were unable to utilize recombinant RNase H1 to effect
the detectable cleavage of target mRNA in this assay.
Example 54
Immunoprecipitated RNase H Activity
[0571] In a further embodiment, the ability of gap-disabled
oligomeric compounds to utilize immunoprecipitated RNase H1 and
RNase H2 to direct the cleavage of target RNA was tested.
Polyclonal antibodies were generated by Biosolutions (Ramona,
Calif.) using RNase H1 and RNase H2 proteins purified as described
by Wu, et al. (J. Biol. Chem, 2004, 279, 17181-17189).
Immunoprecipitations were also performed as described by Wu, et al.
(J. Biol. Chem, 2004, 279, 17181-17189). Duplex formation was
performed as described herein, using ISIS 300861 (SEQ ID NO: 43,
gap-disabled), ISIS 335112 (SEQ ID NO: 43, gapmer) and ISIS 335033
(SEQ ID NO: 43, uniform 2'-deoxy) as the oligomeric compounds and
the mouse glucagon receptor (SEQ ID NO: 217) as the target RNA. The
cleavage assay was performed as described herein for recombinant
RNase H1, using RNase H1 or RNase H2 immunoprecipitated with 10
.mu.g of the respective antibody per 1 mg total cellular protein.
Samples of the cleavage assay were collected at t=0 (start of the
reaction), 15, 60 and 180 minutes and products were resolved by
denaturing polyacrylamide electrophoresis and visualized by using a
PhosphorImager.TM. and IMAGEQUANT.TM. Software (Molecular Dynamics,
Sunnyvale, Calif.). Whereas both ISIS 335033 (uniform 2'deoxy) and
ISIS 335112 (gapmer) were able to direct cleavage of the target RNA
by both immunoprecipitated RNase H1 and RNase H2, ISIS 300861
(gap-disabled) did not elicit detectable cleavage of the target RNA
by immunoprecipitated RNase H1 or RNase H2 in this assay.
Example 55
In Vitro Nuclease Assay
[0572] In a further embodiment, the ability of gap-disabled
compounds to elicit target cleavage in subcellular fractions was
evaluated. HeLa cell nuclear, nuclear membrane and cytosolic
fractions were isolated as described previously (Dignam, et al.,
Nucleic Acids Research., 1983, 11, 1475-1489) and used to test the
ability of gap-disabled oligomeric compounds to elicit target
reduction. Following isolation of the subcellular fractions, the
cleavage assay was performed as described for recombinant RNase
H1.
[0573] Duplexes between the mouse glucagon receptor RNA and
oligomeric compound were prepared as described herein, using as the
oligomeric compounds ISIS 335033 (SEQ ID NO: 43, uniform 2'-deoxy),
ISIS 335112 (SEQ ID NO: 43, gapmer), ISIS 300861 (SEQ ID NO: 43,
gap-disabled) and ISIS 298683 (SEQ ID NO: 43, uniform 2'-MOE).
Annealed duplexes (10 .mu.l) were incubated with 3 .mu.g of the
HeLa cytosolic extract at 37.degree. C. The assay was also
performed with a 4-fold higher concentration of cytosolic extract.
Samples were collected at t=0 (reaction start time), 15, 60 and 180
minutes. The reaction was terminated by phenol/chloroform
extraction and ethanol precipitated with the addition of 10 .mu.g
of tRNA as a carrier. Pellets were resuspended in 10 .mu.l of
denaturing loading dye and products were resolved on 12% denaturing
acrylamide gels as described herein. Visualization of cleavage
patterns by PhosphorImager.TM. detection revealed that while HeLa
cytosolic extracts were capable of supporting target cleavage
mediated by ISIS 335112 (gapmer) and ISIS 335033 (uniform 2'-deoxy)
in a time-dependent manner, this fraction was unable to support
target reduction by ISIS 300861 (gap-disabled). Additionally, ISIS
298683 (uniform 2'-MOE) was unable to direct cleavage in the
cytosolic extracts.
[0574] The ability of ISIS 300861 (gap-disabled) and ISIS 335112
(gapmer) to mediate target cleavage was also tested in the nuclear
fraction isolated from HeLa cells. In this assay, the mouse
glucagon receptor target RNA contained a 3' phosphorothioate cap,
to improve its resistance to exonuclease activity, which, as is
known in the art, is present in nuclear extracts and results in
non-specific degradation of the target RNA. Annealed duplexes (10
.mu.l) were incubated with 3 .mu.g of the HeLa nuclear extract at
37.degree. C. The assay was performed both in the presence and
absence of beta-mercapoethanol. Samples were collected at t=0
(start of the reaction), 10 and 60 minutes. Resolution of the
products on a denaturing polyacrylamide gel, followed by
PhosphorImager.TM. detection, revealed that ISIS 300861
(gap-disabled) and ISIS 355112 (gapmer) elicited target cleavage in
HeLa nuclear extracts in a time-dependent manner, both in the
presence and absence of beta-mercaptoethanol. A four-fold higher
concentration of nuclear extract was also able to support cleavage
by both compounds.
[0575] The assay was also performed using HeLa nuclear membrane
extract as source of RNase activity. Annealed duplexes (10 .mu.l)
were incubated with 3 .mu.g of the HeLa nuclear membrane extract at
37.degree. C. Neither ISIS 331112 (gapmer) nor ISIS 335114
(gap-disabled) was able to elicit cleavage of the target RNA in
HeLa nuclear membrane extracts.
[0576] Together, these data reveal that the enzyme activity
responsible for the cleavage of duplexes formed between
gap-disabled oligomeric compounds and target RNAs resides in the
nuclear fraction of the cell, not in the cytosolic or nuclear
membrane fractions.
[0577] In the nuclear extracts, comparison of the target RNA
cleavage pattern to a molecular weight ladder revealed that
cleavage of the target RNA occurred only at nucleobase positions
complementary to a 2'deoxynucleotide of the gap-disabled oligomeric
compound, i.e. the cleavage sites were positioned within the
2'-deoxynucleotide gaps. Furthermore, within the target site for
ISIS 300861, cleavage occurred preferentially at guanines.
Example 56
Influence of Divalent Cations on RNase Activity in Subcellular
Extracts
[0578] Multiple RNase H-like activities exist in human cells, and
these activities are differentially activated by magnesium and
manganese (Wu et al., J. Biol. Chem., 2004, 279, 17181-17189).
Thus, it was of interest to determine the influence of these
divalent cations on the ability of RNase enzymes to cleave
heteroduplexes comprising gap-disabled oligomeric compounds.
[0579] ISIS 300861 (SEQ ID NO: 43, gap-disabled) and ISIS 335112
(SEQ ID NO: 43, gapmer) were tested for their ability to direct
RNase mediated cleavage in the presence of manganese or mangesium.
Duplex formation and subcellular fractionation of HeLa cells were
performed as described herein. The cleavage assay was also
conducted as described herein, with the addition of 0.05 mM
magnesium, 5 mM magnesium, 0.05 mM manganese or 5 mM manganese. The
cleavage reaction was terminated at t=0 (start of the reaction),
15, 60 and 120 minutes, and samples from each of these timepoints
were resolved on a denaturing polyacrylamide gel. Cleavage products
were detected using a PhosphorImager.TM..
[0580] In nuclear extracts, prepared as described herein, both
magnesium- and manganese-dependent degradation of ISIS 300861
(gap-disabled) and ISIS 335112 (gapmer) heteroduplexes was
observed. The cleavage activity in the presence of 0.05 mM
manganese was approximately equal to that observed in the presence
of 5 mM mangesium, demonstrating that manganese is more effective
than magnesium at enhancing RNase activity in HeLa cell nuclear
extracts.
[0581] The influence of divalent cations on cleavage activity was
similarly tested in cytosolic extracts. The assay was performed as
described herein. In the presence of either 5 mM magnesium or 5 mM
manganese, ISIS 300861 (gap-disabled) did not elicit cleavage of
the target RNA. ISIS 335112 (gapmer) was, however, able to direct
cleavage of the target RNA in cytosolic extracts.
[0582] The effects of divalent cations on cleavage by
immunoprecipitated RNase H1 were also evaluated. Duplex formation
between the target RNA and ISIS 300861 (gap-disabled) or ISIS
335112 (gapmer) was conducted as described herein.
Immunoprecipitation and the cleavage assay were performed as
described herein, with the addition of 0.05 mM mangesium, 5 mM
magnesium, 0.05 mM manganese or 5 mM manganese to the cleavage
assay. ISIS 335112 (gapmer) resulted in target RNA cleavage in the
presence of either divalent cation at all concentrations. In
contrast to the results observed in the absence of divalent cation,
the addition of 5 mM manganese allowed the gap-disabled compound
ISIS 300861 to direct the cleavage of the target RNA by
immunoprecipitated RNase H1 in a pattern consistent with that
observed for gap-disabled cleavage activity in nuclear extracts.
Coupled with the observation that without additional manganese, a
gap-disabled compound was unable to utilize immunoprecipitated
RNase H1 to effect target RNA cleavage, these data demonstrate that
additional manganese is required for immunoprecipitated RNase H1 to
cleave heteroduplexes formed between a gap-disabled oligomeric
compound and a target RNA.
[0583] A similar assay was performed using immunoprecipitated RNase
H2, however, neither the gap-disabled nor gapmer oligomeric
compound elicited target RNA cleavage by immunoprecipitated RNase
H2, regardless of the presence of a divalent cation in the cleavage
assay.
[0584] Further tested was the effect of divalent cations on the
activity of recombinant human RNase H1. The assay was performed as
described herein, using ISIS 300861 as the gap-disabled compound
and ISIS 335112 as the gapmer compound. Manganese at a
concentration of 5 mM was added to the cleavage assay. In contrast
to the results described for the activity of recombinant RNase H1
in the absence of additional manganese, in the presence of 5 mM
manganese ISIS 300861 was able to direct cleavage of its target RNA
by recombinant RNase H1. The cleavage pattern mimicked those
observed for nuclear extracts and for immunoprecipitated RNase H1
in the presence of manganese. These data demonstrate that manganese
is required for recombinant RNase H1 to cleave heteroduplexes
formed between a gap-disabled oligomeric compound and a target
RNA.
[0585] To extend the observation that the presence of manganese
influences the potency of gap-disabled oligomeric compounds, the
extent of cleavage and the rate at which it occurs were evaluated
as a function of manganese concentration. Duplex formation between
ISIS 300861 and the mouse glucagon target RNA was performed as
described herein. A cleavage assay was performed as described
herein using recombinant human RNase H1, with the addition of
manganese at 0.5, 1, 5, 20 or 50 mM. To measure the rate at which
cleavage occurs, reactions were terminated at t=0 (start of the
reaction), 10, 60 and 180 minutes and the percentage of RNA cleaved
was calculated as described herein, using the t=0 timepoint to
normalize the data from the 10, 60 and 180 minute timepoints. The
data are shown in Table 34.
37TABLE 34 Dependence of RNA cleavage by recombinant RNase H1 on
manganese concentration Time Concentration of manganese (mM)
(minutes) 0.5 1 5 20 50 10 3 56 68 63 0 60 6 69 74 69 0 180 12 75
75 70 12
[0586] These data demonstrate concentration-dependent cleavage at
0.5 and 1 mM manganese, however, the addition of 5 or 20 nM
manganese did not further increase target cleavage. The addition of
50 mM manganese inhibited cleavage of the target RNA.
[0587] A comparison of cleavage rates achieved by ISIS 335112
(gapmer) and ISIS 300861 (gap-disabled) was conducted. Duplexes
formed with the target RNA and ISIS 335112 were cleaved at rates of
0.7 and 1.3 nM per minute in the presence of 50 and 500 uM
manganese, respectively. Duplexes formed with the target RNA and
ISIS 300861 were cleaved at 0.1 and 0.3 uM per minute at manganese
concentrations of 50 and 500 uM, respectively. These data
demonstrate that cleavage elicited by the gapmer oligomeric
compound occurs at a higher rate than that elicited by the
gap-disabled oligomeric compound.
Example 57
siRNA-Mediated Disruption of RNase H1 Activity: Influence on
Gap-Disabled Oligomeric Compound Potency
[0588] In a further embodiment, the participation of RNase H1 in
the cleavage of target RNA mediated by gap-disabled oligomeric
compounds was tested following disruption of cellular RNase H1 mRNA
by siRNAs. Because siRNAs elicit target reduction through
mechanisms not dependent on RNase H1, the use of siRNAs to disrupt
the expression of RNase H1 is a method by which the activity of
RNase H1 can be reduced, while not interfering with the pathway
through which it acts. In this assay, cells receive a first
treatment with an siRNA to reduce RNase H1 mRNA, followed by a
second treatment with a known or putative RNase H1-dependent
compound. The target RNA cleavage following the second treatment is
used to assess whether the siRNA affected the enzyme activity
stimulated by the addition of the oligomeric compound.
[0589] A549 cells were treated with 100 nM of an siRNA directed to
RNase H1, comprised of the antisense strand with the sequence
CUCAUCCUCUGUGGCAAACUU (SEQ ID NO: 218) annealed to the
complementary sense strand (AAGUUUGCCACAGAGGAUGAG, SEQ ID NO: 219).
Both strands are oligoribonucleotides with phosphodiester linkages
throughout the compounds. As controls, cells were treated with 100
nM of the single-strand sense RNA (SEQ ID NO: 219) or were left
untreated. Following 10 hours of treatment, RNase H1 mRNA
expression was measured by quantitative real-time PCR and was
reduced by 49% in cells treated with the RNase H1 siRNA. Untreated
cells and cells treated with the control siRNA showed no reduction
in RNase H1 mRNA expresssion. Cells were split into 96-well format
cell culture plates at a density of 6000 cells per well and were
cultured for an additional 10 hours. Next, cells were treated with
ISIS 336848 (SEQ ID NO: 105) at 5, 10 or 30 nM. ISIS 336848 is a
gap-disabled compound targeted to C-raf and having the motif
3-2-1-2-1-2-1-2-1-2-3; internucleoside linkages are
phosphorothioate throughout the compound and all cytosines are
5-methylcytosines. C-raf mRNA was measured by quantitative
real-time PCR as described herein. Untreated cells served as the
control to which data were normalized. The data are presented in
Table 35 as percentage reduction in C-raf mRNA.
38TABLE 35 Gap-disabled mediated reduction of C-raf mRNA in A549
cells with lowered RNase H1 activity Reduction in C-raf mRNA
Concentration of gap-disabled compound (nM) 5 10 30 Single-strand
sense RNA 40 61 89 No siRNA 39 55 89 RNase H1 siRNA 32 48 83
[0590] These data demonstrate that, in comparison to cells treated
with a control sense RNA or cells left untreated, the reduction in
expression of RNase H1 mRNA results in a decrease in the ability of
the gap-disabled oligomeric compound to result in cleavage of its
target mRNA. For example, whereas a dose of 5 nM of ISIS 336848
results in 39% and 40% reductions in target mRNA in cells receiving
no siRNA or single-strand sense RNA, respectively, C-raf mRNA is
reduced by only 32% in cells in which RNase H1 has been reduced by
siRNA treatment.
[0591] This assay was also performed in HeLa cells, in which either
RNase H1 or RNase H2 was disrupted using siRNAs directed to the
mRNA sequence encoding each respective enzyme. The siRNA directed
to RNase H1 was comprised of SEQ ID NOs: 218 and 219. The siRNA
directed to RNase H2 was comprised of the antisense strand with the
sequence GGAGCCUUGCGUCCUGGGCTT (SEQ ID NO: 220), annealed to the
complementary sense strand GCCCAGGACGCAAGGCTCCTT (SEQ ID NO: 221).
SEQ ID NOs 220 and 221 are oligoribonucleotides 19 nucleobases in
length each having a two-nucleobase overhang of deoxythymidine. In
cells receiving no first treatment with siRNA, the second treatment
with 5, 10 or 30 nM of ISIS 336848 (gap-disabled) resulted in 18,
32 and 75% reductions in C-raf mRNA. In cells in which RNase H2 was
disrupted, a second treatment with 5, 10 or 30 nM of ISIS 336848
(gap-disabled) resulted in 23, 38 and 73% reductions in C-raf mRNA.
Thus, disruption of RNase H2 did not significantly affect
gap-disabled oligomeric compound activity. However, in cells in
which RNase H1 was disrupted, a second treatment with 5, 10 or 30
nM of the gap-disabled oligomeric compound resulted in 14, 28 and
58% reductions in C-raf mRNA. These data illustrate that
siRNA-mediated reduction of RNase H1 mRNA reduced the potency of
the gap-disabled compound. Thus, gap-disabled compounds elicit
target RNA cleavage through the activity of RNase H1.
Example 58
Overexpression of RNase H
[0592] In a further embodiment, RNase H overexpression in cultured
cells was tested for its effects on the potency of gap-disabled
oligomeric compounds. RNase H overexpression was accomplished using
the RNase H full-length coding regions packaged in adenoviral
vectors, which were prepared as previously described (Wu et al., J.
Biol. Chem., 2004, 279, 17181-17189). An RNase H1 adenoviral vector
was prepared using the full-length RNase H1 coding region. An RNase
H2 adenoviral vector was prepared in the same manner, using the
RNase H2 full-length coding region. An additional vector was
prepared using a truncated human RNase H1 cDNA that encodes a
protein lacking the 26 N-terminal amino acids; this construct is
named RNase H1(-26). Two native isoforms of human RNase H1 exist in
the cell: a full length RNase H1 and the truncated RNase H1. The
N-terminal 26 amino acids of human RNase H1 comprise a mitochondial
localization signal, thus the full-length isoform is found
predominantly in the cytosol and mitochondria and the truncated
protein (lacking the localization signal) is found predominantly in
the nucleus. When compared in the in vitro assays described herein,
both isoforms behave similarly with respects to enzyme kinetics. A
control vector, pLox, contained the shuttle vector used in
preparation of the RNase H-containing viruses and lacked the
inserted genes.
[0593] In this assay, HeLa cells were cultured in DMEM supplemented
with 10% fetal bovine serum, 0.005 mg/mL insulin, 0.005 mg/mL
transferring, 5 ng/mL selenium, 40 ng/mL dexamethasone (medium and
all supplements from Invitrogen Corporation, Carlsbad, Calif.).
Cells were plated at a density of approximately 6000 cells per well
in 96-well plates and infected with RNase H1, RNase H2, RNase
H1(-26) or pLox adenovirus at 200 plaque forming units per cell
(pfu/cell). After 12 hours, cells transfected with each virus were
collected for RNA isolation and real-time PCR quantitation of RNase
H mRNA. The remaining cells were transfected with the gap-disabled
compound ISIS 336848 (SEQ ID NO: 105) at concentrations of 15, 30
and 45 nM, using LIPOFECTIN.TM. as described herein. Cells were
harvested 24 hours later, RNA was isolated and C-raf mRNA levels
were measured using real-time PCR, as described herein. Real-time
PCR measurements of RNase H1, RNase H2, RNase H1(-26) and C-raf
were normalized using the housekeeping gene cyclophilin. The
results of this assay are shown in Table 36. RNases H mRNA levels
are shown as percent relative to RNase H expression in
pLox-infected cells. C-raf mRNA levels are presented as percent
reduction relative to cells that did not receive oligomeric
compound treatment.
39TABLE 36 Gap-disabled compound potency in cells overexpressing
RNases H Virus pLox RNase H1 RNase H1(-26) RNase H2 RNase H 100%
2938% 801% 1216% level Dose of ISIS 336848 % Reduction in C-raf
mRNA 15 nM 30 45 37 26 30 nM 54 55 56 46 45 nM 63 67 74 60
[0594] These data demonstrate that when RNase H1 is present at a
level approximately 30 times higher than that in pLox-infected
cells, treatment with a 15 nM dose of the gap-disabled compound
resulted in a 45% reduction in C-raf mRNA, whereas target mRNA was
reduced by only 30% in pLox-infected cells. Overexpression of RNase
H1(-26) to levels approximately 8 times higher than that in
p-Lox-infected cells also improved the potency of the gap-disabled
compound. An excess of RNase H2 did not improve the activity of the
gap-disabled compound. When the % reduction in C-raf mRNA is
plotted against the base-10 logarithm of the gap-disabled compound
concentration, an increase in gap-disabled compound activity is
apparent at all oligomeric compound concentrations tested in this
assay. Similar observations were made in cells expressing any of
the RNases H at levels 5 to 7 times that of the p-Lox-infected
cells. These data suggest that overexpression of either isoform
improves gap-disabled oligomeric compound activity and that
gap-disabled oligomeric compounds are active in both the nucleus
and cytosol. These data further illustrate that gap-disabled
compounds elicit target RNA cleavage through RNase H1.
Example 59
In Vivo Analysis of Gap-Disabled Compounds Targeted to Mouse
Glucagon Receptor
[0595] In a further embodiment, gap-disabled chimeric oligomeric
compounds targeted to mouse glucagon receptor were tested for their
effects on target reduction in vivo. The gap-disabled compounds
were: ISIS 332866, ISIS 332868, ISIS 352426 and ISIS 352427 (all
with the nucleotide sequence of SEQ ID NO: 43). Also tested were
ISIS 180475 (SEQ ID NO: 43), a gapmer compound; ISIS 332867, also a
gapmer compound; ISIS 335032 (SEQ ID NO: 43), an olgiomeric
compound uniformly comprised of 2'-deoxynucleotides and ISIS 298683
(SEQ ID NO: 43), an oligomeric compound uniformly comprised of
2'-MOE nucleotides. The motif of each compound is shown in Table 37
as described for other compounds herein. Male Balb/c mice, 6 to 7
weeks of age, received twice weekly intraperitoneal injections of
approximately 1, 3 or 10 mg/kg of the compounds shown in Table 37.
Saline-injected animals served as a control group and were injected
in the same manner as the olgiomeric compounds. Each treatment
group contained 4 animals.
[0596] Liver RNA was analyzed for glucagon receptor expression
levels by quantitative real-time PCR as described by other examples
herein, using the housekeeping gene cyclophilin A to normalize RNA
levels among samples. In Table 37, glucagon receptor mRNA
expression levels are shown as percentage of saline-treated control
glucagon receptor levels. A value less than or greater than 100
indicates a decrease or increase in mRNA expression, respectively.
If present, "ND" indicates "not determined".
40TABLE 37 Target reduction following treatment with chimeric
oligomeric compounds targeted to mouse glucagon receptor % Control
SEQ Dose of oligonucleotide ISIS # ID NO Motif 10 mg/kg 3 mg/kg 1
mg/kg 335032 43 Uniform 10 85 117 2'-deoxy 332866 43 3-5-4-5-3 27
53 115 332867 43 3-14-3 12 111 112 332868 43 3-3-2-4-2-3-3 40 77
107 352426 43 2-6-4-6-2 21 66 115 352427 43 2-7-2-7-2 9 48 122
298683 43 Uniform 84 ND ND 2'-MOE 180475 43 5-10-5 15 53 93
[0597] These results demonstrate that treatment with 3 mg/kg and 10
mg/kg doses of the gap-disabled compounds ISIS 332866, ISIS 332868,
ISIS 352426 and ISIS 352427, in addition to the gapmer compound
ISIS 180475 and the uniform 2'-deoxy compound ISIS 335032,
inhibited mouse glucagon receptor mRNA expression in a
dose-dependent manner in vivo. ISIS 332867 inhibited mouse glucagon
receptor mRNA expression at the 10 mg/kg dose.
Example 60
In Vivo Analysis of Chimeric Oligomeric Compounds Targeted to FAS:
Levin Rat Model
[0598] The Levin model is a polygenic model of rats selectively
bred to develop diet-induced obesity (DIO) associated with impaired
glucose tolerance, dyslipidemia and insulin resistance when fed a
high-fat diet. The advantage of this model is that it displays
traits more similar to human obesity and glucose intolerance than
in animals that are obese/hyperinsulinemic due to genetic defects,
for example, a defect in leptin signaling. In a further embodiment,
the gap-disabled compound ISIS 304170 (SEQ ID NO: 60), targeted to
rat fatty acid synthase (FAS), was tested for its effects on target
reduction in the Levin rat model. Male Levin rats were purchases
from Charles River Laboratories at approximately 8 weeks of age.
Rats were fed a high-fat diet (60% fat) for 8 weeks, after which
the animals were divided into three groups and treated with saline,
ISIS 304170 or the gapmer ISIS 256899 (SEQ ID NO: 60). ISIS 256899,
also targeted to rat FAS, was used as a positive control for target
reduction. Treatments were administered subcutaneously at a dose of
25 mg/kg, twice weekly, for 8 weeks. Control groups consisted of
animals on the high-fat diet receiving saline treatment and animals
on a standard rodent diet receiving saline treatment. Each
treatment group included 5 to 6 animals.
[0599] At the end of the 8 week treatment period, animals were
sacrificed and liver was collected for FAS protein analysis and
white adipose tissue (WAT) and brown adipose tissue (BAT) were
collected for measurement of FAS mRNA expression. mRNA was measured
by real-time PCR as described herein and were normalized to levels
in saline treated animals that received a high-fat diet. Protein
levels were measured by western blot as described herein, using an
antibody recognizing rodent FAS (BD Transduction Laboratories of
the BD Pharmingen Unit, San Diego, Calif.) and were normalized to
levels in saline treated animals that received a high-fat diet.
Data are shown in Table 38 and are expressed as percentage of
high-fat diet saline control. If present, "ND" indicates "not
determined". Also shown in Table 38 are serum cholesterol (mg/dL),
triglyceride (mg/dL) and liver transaminase (ALT and AST, IU/L)
levels, which were measured at the end of the study using routine
clinical analyzer instruments (e.g. Olympus Clinical Analyzer,
Melville, N.Y.).
41TABLE 38 FAS, cholesterol and triglycerides in Levin rats treated
with chimeric oligomeric compounds High High High Standard Fat Fat
Fat Treatment Saline Saline ISIS ISIS 304170 256899 % FAS protein,
110 100 55 39 Liver % FAS mRNA, WAT ND 100 21 17 % FAS mRNA, BAT ND
100 5 6 Serum Cholesterol 81 81 69 160 (mg/dL) Serum Triglyceride
269 377 104 607 (mg/dL) ALT (IU/L) 79 73 158 61 AST (IU/L) 45 30 51
32
[0600] These data demonstrate that the gap-disabled compound ISIS
304170 resulted in a marked reduction in rat FAS mRNA expression in
both white and brown adipose tissue. Furthermore, rat FAS protein
levels were reduced in liver following treatment with ISIS 304170.
FAS mRNA and protein levels were similar to those observed
following treatment with the gapmer compound. Furthermore,
cholesterol and triglycerides in Levin rats receiving a high-fat
diet were markedly lowered by treatment with ISIS 304170, whereas
ISIS 256899 did not lower cholesterol and triglycerides in Levin
rats receiving a high-fat diet. AST and ALT levels were not at
levels considered indicative of toxicity.
[0601] Plasma glucose concentrations were measured at 0 (beginning
of study) and 8 (end of study) weeks of treatment by routine
clinical analysis using a YSI2700 Select.TM. Biochemistry Analyzer
(YSI Inc., Yellow Spring, Ohio). Plasma insulin levels were
measured at 0 and 8 weeks of treatment using an insulin ELISA kit
(ALPCO Diagnostics, Windham, N.H.) according to the manufacturer's
instructions. Plasma leptin levels were measured at 0 and 8 weeks
using a rat leptin ELISA kit (Crystal Chem Inc., Downer's Grove,
Ill.). Leptin is a hormone that regulates appetite. Plasma insulin,
glucose and leptin levels are shown in Table 39.
42TABLE 39 Plasma leptin, glucose and insulin in Levin rats treated
with chimeric oligomeric compounds Diet and Treatment Study High
High High week Standard Fat Fat Fat Saline Saline 304170 256899
Plasma Leptin (ng/mL) 0 11 42 46 46 Plasma Leptin (ng/mL) 8 10 57 8
24 Plasma Glucose (mg/dL) 0 106 103 100 105 Plasma Glucose (mg/dL)
8 95 115 106 98 Plasma Insulin (ng/mL) 0 1.3 3.3 3.6 2.9 Plasma
Insulin (ng/mL) 8 1.0 1.8 0.9 0.8
[0602] These data demonstrate that after 8 weeks, relative to
animals receiving a high-fat diet and saline treatment, treatment
with ISIS 304170 and ISIS 256899 lowered plasma leptin, glucose and
insulin levels. ISIS 304170 lowered plasma leptin and insulin
levels to those observed in rats on a standard diet. ISIS 256899
lowered plasma glucose levels to those observed in rats on a
standard diet.
[0603] After 4 weeks of treatment, an insulin tolerance test was
performed. After 7 weeks of treatment, a glucose tolerance test was
performed. For the tolerance tests, a baseline tail blood glucose
measurement was obtained, after which 1.0 g/kg glucose or 0.5
units/kg insulin was administered orally or intraperitoneally,
respectively. Tail blood glucose levels were measured using a
Glucometer.RTM. instrument (Abbott Laboratories, Bedford, Mass.) at
15, 30, 60, 90, 120, 150 and 180 minutes following the challenge
with insulin and 30, 60, 90 and 120 minutes following the glucose
challenge. Insulin sensitivity in the animals receiving ISIS 304170
and ISIS 256899 was similar to animals on a standard diet receiving
saline treatment and was improved relative to saline-treated
animals on a high-fat diet. Glucose tolerance was not improved by
treatment with ISIS 304170 or ISIS 256899.
[0604] Body weight and food intake were measured weekly throughout
the study. At the beginning of the study, animals on the high-fat
diet weighed approximately 670 grams. Whereas the saline-treated
rats maintained this weight throughout the treatment period, the
body weights of rats treated with ISIS 304170 and ISIS 256899
dropped to approximately 500 g, the same body weight as the rats on
a standard rodent diet, by the end of the study. Throughout the
study, food intake among rats treated with ISIS 304170 and ISIS
256899 was approximately half that among saline treated rats. Thus,
concomitant with a reduction in FAS mRNA and protein, body weight
and food intake were lowered.
[0605] At the end of the study, liver and spleen weights, increases
in which can indicate toxicity, were measured. Relative to
saline-treated rats on a high-fat diet, liver weights were lower in
rats receiving ISIS 304170 and slightly higher in rats receiving
ISIS 256899. The converse was true for spleen weights, which were
slightly raised in rats receiving ISIS 304170. Fat depot weights
were also determined. Treatment with ISIS 304170 and ISIS 256899
prevented increases in brown adipose tissue and intra-abdominal
white adipose tissue (both epididymal and perinephric fat) weights,
which were all significantly raised in saline-treated rats on a
high-fat diet.
[0606] Metabolic rate was measured after 4 weeks and 8 weeks of
oligomeric compound treatment using indirect calorimetry in a
metabolic chamber (Oxymax System, Columbus Instruments, Columbus,
Ohio). No significant differenced in metabolic rates were observed
when oligomeric compound-treated mice were compared to
saline-treated mice.
[0607] This study in a rat model of diabetes and obesity
illustrates that treatment with the gap-disabled compound ISIS
304170 reduces rat FAS protein expression. Concomitant reductions
are observed in body weight, fat depot weight, food intake, plasma
leptin, plasma insulin, serum cholesterol, serum triglycerides and
insulin sensitivity. Thus, this compound has applications in the
treatment of diabetes, obesity and related conditions.
Example 61
In Vivo Analysis of Chimeric Oligomeric Compounds Targeted to FAS:
Mouse Model of Diabetes and Obesity
[0608] Leptin is a hormone produced by fat that regulates appetite.
Deficiencies in this hormone lead to obesity in animals. ob/ob mice
have a mutation in the leptin gene which results in obesity and
hyperglycemia. As such, these mice are a useful model for the
investigation of obesity and diabetes and treatments designed to
treat these conditions. ob/ob mice have higher circulating levels
of insulin and are less hyperglycemic than db/db mice, which harbor
a mutation in the leptin receptor. In accordance with the present
invention, the oligomeric compounds of the invention are tested in
the ob/ob model of obesity and diabetes.
[0609] Seven-week old male C57B1/6J-Lep ob/ob mice (Jackson
Laboratory, Bar Harbor, Me.) were fed a diet with a fat content of
approximately 11% and were subcutaneously injected with ISIS 304171
(SEQ ID NO: 59) or ISIS 148548 (SEQ ID NO: 59) at a dose of 25
mg/kg two times per week for 8 weeks. Saline-injected animals
served as a control group. Each treatment group contained 8
mice.
[0610] After the treatment period, mice were sacrificed and FAS
protein levels were measured by western blot in liver and white
adipose tissue (WAT), using an antibody that recognizes mouse FAS
(BD Transduction Laboratories of the BD Pharmingen Unit, San Diego,
Calif.). Relative to FAS protein levels in saline-treated mice,
treatment with ISIS 304171 reduced protein expression by 66% in
liver and by 62% in white adipose tissue. Treatment with ISIS
148548 resulted in 93% and 81% reductions in fatty acid protein in
liver and white adipose tissue, respectively.
[0611] To assess the physiological effects resulting from reduction
of FAS expression, the mice were further evaluated at the end of
the treatment period for serum triglycerides, serum cholesterol,
and serum transaminase levels. Triglycerides, cholesterol and
transaminases were measured by routine clinical analyzer
instruments (e.g. Olympus Clinical Analyzer, Melville, N.Y.).
Triglyceride levels were 173, 101 and 118 mg/dL in mice receiving
treatment with saline, ISIS 304171 or ISIS 148548, respectively.
Cholesterol levels were 312, 221 and 218 mg/dL in mice receiving
treatment with saline, ISIS 304171 or ISIS 148548, respectively.
These data demonstrate that treatment with either the gap-disabled
compound or gapmer compound targeted to FAS reduced both
cholesterol and triglyceride levels in ob/ob mice on a high fat
diet. Also reduced were the liver transaminases ALT and AST
(measured in international units/liter, or IU/L), indicating an
improvement in liver function following treatment of ob/ob animals
with a gap-disabled or gapmer compound. AST levels were 511, 277
and 334 IU/L in mice receiving treatment with saline, ISIS 304171
or ISIS 148548, respectively. ALT levels were 751, 481 and 344 IU/L
in mice receiving treatment with saline, ISIS 304171 or ISIS
148548, respectively.
[0612] Body weight was monitored throughout the study. Body weights
in all 3 treatment groups increased steadily throughout the first 5
weeks. After 6, 7 and 8 weeks of treatment, the average body weight
in ISIS 304171-treated mice was 59 grams. The average body weight
in ISIS 148548-treated mice after 6, 7 and 8 weeks of treatment was
58 grams. However, in the saline-treated mice, the average body
weight at 6, 7 and 8 weeks was 64 grams. Thus, treatment with the
gap-disabled or gapmer compound targeted to FAS resulted in reduced
weight gain in ob/ob mice on a high fat diet.
[0613] Metabolic rate was measured after 5 weeks of oligomeric
compound treatment using indirect calorimetry in a metabolic
chamber (Oxymax System, Columbus Instruments, Columbus, Ohio). No
significant differenced in metabolic rates were observed when
oligomeric compound-treated mice were compared to saline-treated
mice.
[0614] Adipose tissue weight was also measured at the end of the
study. No significant differences were observed when the oligomeric
compound-treated mice were compared to saline-treated mice.
[0615] The effects of target inhibition on glucose metabolism were
also evaluated. After 7 weeks of treatment with oligomeric
compounds, an oral glucose tolerance test was performed. Mice
received an oral dose of approximately 1 g/kg of glucose, and blood
glucose levels were measured at 30 minute intervals for up to 2
hours. Glucose levels are measured using a YSI glucose analyzer
(YSI Scientific, Yellow Springs, Ohio). No differences in glucose
tolerance were observed when oligomeric compound-treated mice were
compared to saline-treated mice.
[0616] These data demonstrate that the gap-disabled compound ISIS
304171, like the gapmer compound ISIS 148548, reduced FAS
expression in the livers of ob/ob mice. Furthermore, reductions
were observed in serum cholesterol and triglycerides, body weight
and liver transaminases.
[0617] Various modifications of the invention, in addition to those
described herein, will be apparent to those skilled in the art from
the foregoing description. Such modifications are also intended to
fall within the scope of the appended claims. Each reference
(including, but not limited to, journal articles, U.S. and non-U.S.
patents, patent application publications, international patent
application publications, gene bank accession numbers, and the
like) cited in the present application is incorporated herein by
reference in its entirety.
Sequence CWU 0
0
* * * * *