U.S. patent application number 10/640898 was filed with the patent office on 2004-02-19 for method of down-regulating gene expression.
This patent application is currently assigned to Hybridon, Inc.. Invention is credited to Agrawal, Sudhir, Diasio, Robert B., Zhang, Ruiwen.
Application Number | 20040033980 10/640898 |
Document ID | / |
Family ID | 24351775 |
Filed Date | 2004-02-19 |
United States Patent
Application |
20040033980 |
Kind Code |
A1 |
Agrawal, Sudhir ; et
al. |
February 19, 2004 |
Method of down-regulating gene expression
Abstract
Disclosed is a method of down-regulating the expression of a
gene in an animal, wherein a pharmacological formulation comprising
a chimeric oligonucleotide complementary to the gene is orally
administered to an animal. The oligonucleotide administered has at
least one phosphorothioate internucleotide linkage and at least one
alkylphosphonate, phosphorodithioate, alkylphosphonothioate,
phosphoramidate, phosphoramidite, phosphate ester, carbamate,
carbonate, phosphate triester, acetamidate, or carboxymethyl ester
internucleotide linkage.
Inventors: |
Agrawal, Sudhir;
(Shrewsbury, MA) ; Diasio, Robert B.; (Birmingham,
AL) ; Zhang, Ruiwen; (Marietta, GA) |
Correspondence
Address: |
HALE AND DORR, LLP
60 STATE STREET
BOSTON
MA
02109
|
Assignee: |
Hybridon, Inc.
Cambridge
MA
|
Family ID: |
24351775 |
Appl. No.: |
10/640898 |
Filed: |
August 14, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10640898 |
Aug 14, 2003 |
|
|
|
09587934 |
Jun 6, 2000 |
|
|
|
6608035 |
|
|
|
|
09587934 |
Jun 6, 2000 |
|
|
|
08758005 |
Nov 27, 1996 |
|
|
|
08758005 |
Nov 27, 1996 |
|
|
|
08709910 |
Sep 9, 1996 |
|
|
|
08709910 |
Sep 9, 1996 |
|
|
|
08328520 |
Oct 25, 1994 |
|
|
|
5591721 |
|
|
|
|
Current U.S.
Class: |
514/44A |
Current CPC
Class: |
C12N 15/113 20130101;
A61P 25/28 20180101; A61P 33/00 20180101; C12N 2310/345 20130101;
C12N 2310/312 20130101; C12N 2310/3125 20130101; A61K 31/7125
20130101; A61K 38/1709 20130101; Y02A 50/30 20180101; Y02A 50/411
20180101; C12N 2310/315 20130101; A61P 31/00 20180101 |
Class at
Publication: |
514/44 |
International
Class: |
A61K 048/00 |
Claims
What is claimed is:
1. A method for introducing an intact oligonucleotide into a
mammal, comprising the step of orally administering an
oligonucleotide of about 15 to about 25 nucleotides, the
oligonucleotide comprising at least one phosphorothioate
internucleotide linkage, and further comprising at least one
2'-O-alkoxyalkyl ribonucleotide, wherein the oligonucleotide is
present in intact form in the systemic plasma and liver tissue of
the mammal at least six hours following oral administration.
2. The method of claim 1, wherein the 2'-O-alkoxyalkyl
ribonucleotide is at the 3' terminus of the oligonucleotide.
3. The method of claim 2, wherein the oligonucleotide comprises at
least two 2'-O-alkoxyalkyl ribonucleotides at the 3' terminus of
the oligonucleotide.
4. The method of claim 2, wherein the oligonucleotide further
comprises at least one 2'-substituted ribonucleotide at the 5'
terminus.
5. The method of claim 1, wherein the oligonucleotide further
comprises a phosphorothioate internucleotide linkage between every
nucleotide.
6. The method of claim 1, wherein the 2'-O-alkoxyalkyl
ribonucleotide is a 2'-O-methoxyethyl ribonucleotide.
7. A method for introducing an intact oligonucleotide into a
mammal, comprising the step of orally administering an
oligonucleotide of about 15 to about 25 nucleotides, the
oligonucleotide comprising at least one non-phosphodiester
internucleotide linkage, and further comprising at least one
2'-O-alkoxyalkyl ribonucleotide at the 5' terminus and at least one
2'-O-alkoxyalkyl ribonucleotide at the 3' terminus, wherein the
oligonucleotide is present in intact form in the systemic plasma
and liver tissue of the mammal at least six hours following oral
administration.
8. The method of claim 7, wherein the 2'-O-alkoxyalkyl
ribonucleotide is a 2'-O-- methoxyethyl-ribonucleotide.
9. The method of claim 7, wherein oligonucleotide is a hybrid
antisense oligonucleotide.
10. The method of claim 9, wherein the oligonucleotide comprises at
least one deoxyribonucleotide.
11. The method of claim 9, wherein the oligonucleotide further
comprises at least three contiguous deoxyribonucleotides.
12. The method of claim 9, wherein the oligonucleotide comprises a
region of at least four contiguous deoxyribonucleotides that
activate RNase H activity.
13. The method of claim 7, wherein the oligonucleotide is
complementary to a single-stranded target nucleic acid.
14. The method of claim 7, wherein oligonucleotide is complementary
to a gene.
15. The method of claim 7, wherein the oligonucleotide is
complementary to a partial sequence of a gene or of a gene
transcript.
16. The method of claim 7, wherein all of the ribonucleotides in
the oligonucleotide are 2'-substituted ribonucleotides.
17. The method of claim 7, wherein the oligonucleotide comprises an
internucleotide linkage selected from the group consisting of
alkylphosphonates, phosphorothioates, phosphorodithioates,
alkylphosphonothioates, phosphoramidates, phosphoramidites,
phosphate esters, carbamates, carbonates, phosphate triesters,
acetamidate, and carboxymethyl esters.
18. The method of claim 17, wherein essentially all of the
nucleotides are linked via phosphorothioate or phosphorodithioate
internucleotide linkages.
19. The method of claim 7, wherein the oligonucleotide is
modified.
20. The method of claim 7, wherein the oligonucleotide is
complementary to a partial sequence of a gene or a gene transcript
of a virus, a pathogenic organism, or a cellular gene.
21. The method of claim 7, wherein the oligonucleotide is
complementary to a partial sequence of a gene or a gene transcript
of a virus involved in a disease selected from the group consisting
of AIDS, oral and genital herpes, papilloma warts, influenza, foot
and mouth disease, yellow fever, chicken pox, shingles, adult
T-cell leukemia, Burkitt's lymphoma, nasopharyngeal carcinoma, and
hepatitis.
22. The method of claim 7, wherein the oligonucleotide is
complementary to a partial sequence of a gene or a gene transcript
encoding a protein associated with Alzheimer's disease.
23. The method of claim 7, wherein the oligonucleotide is
complementary to a partial sequence of a gene or a gene transcript
encoding a protein in a parasite causing a parasitic disease
selected from the group consisting of amebiasis, Chagas' disease,
toxoplasmosis, pneumocytosis, giardiasis, cryptoporidiosis,
trichomoniasis, malaria, ascariasis, filariasis, trichinosis and
schistosomiasis infections.
24. The method of claim 7, wherein the oligonucleotide is
complementary to a partial sequence of an HIV gene or a gene
transcript and comprises about 15 to 26 nucleotides linked by
phosphorothioate internucleoside linkages.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of patent application Ser.
No. 09/587,934, filed Jun. 6, 2000, which is a continuation of
patent application Ser. No. 08/758,005, filed Nov. 27, 1996, which
is a continuation-in-part of patent application Ser. No.
08/709,910, filed Sep. 9, 1996, now abandoned, which is a
continuation-in-part of patent application Ser. No. 08/328,520,
filed Oct. 25, 1994, now U.S. Pat. No. 5,591,721.
BACKGROUND OF THE INVENTION
[0002] The present invention relates to the control of gene
expression. More particularly, this invention relates to the use of
synthetic, modified oligonucleotides to down-regulate the
expression of a gene in an animal.
[0003] The potential for the development of an antisense
oligonucleotide therapeutic approach was first suggested in three
articles published in 1977 and 1978. Paterson et al. (Proc. Natl.
Acad. Sci. (USA) (1977) 74:4370-4374) discloses that cell-free
translation of mRNA can be inhibited by the binding of an
oligonucleotide complementary to the mRNA. Zamecnik et al. (Proc.
Natl. Acad. Sci. (USA) (1978) 75:280-284 and 285-288) discloses
that a 13mer synthetic oligonucleotide that is complementary to a
part of the Rous sarcoma virus (RSV) genome inhibits RSV
replication in infected chicken fibroblasts and inhibits
RSV-mediated transformation of primary chick fibroblasts into
malignant sarcoma cells.
[0004] These early indications that synthetic oligonucleotides can
be used to inhibit virus propagation and neoplasia have been
followed by the use of synthetic oligonucleotides to inhibit a wide
variety of viruses, such as HIV (see, e.g., U.S. Pat. No.
4,806,463); influenza (see, e.g., Leiter et al. (1990) (Proc. Natl.
Acad. Sci. (USA) 87:3430-3434); vesicular stomatitis virus (see,
e.g., Agris et al. (1986) Biochem. 25:6268-6275); herpes simplex
(see, e.g., Gao et al. (1990) Antimicrob. Agents Chem. 34:808-812);
SV40 (see, e.g., Birg et al. (1990) (Nucleic Acids Res.
18:2901-2908); and human papilloma virus (see, e.g., Storey et al.
(1991) (Nucleic Acids Res. 19:4109-4114). The use of synthetic
oligonucleotides and their analogs as antiviral agents has recently
been extensively reviewed by Agrawal (Trends in Biotech. (1992)
10:152-158).
[0005] In addition, synthetic oligonucleotides have been used to
inhibit a variety of non-viral pathogens, as well as to selectively
inhibit the expression of certain cellular genes. Thus, the utility
of synthetic oligonucleotides as agents to inhibit virus
propagation, propagation of non-viral, pathogens and selective
expression of cellular genes has been well established.
[0006] Improved oligonucleotides have more recently been developed
that have greater efficacy in inhibiting such viruses, pathogens
and selective gene expression. Some of these oligonucleotides
having modifications in their internucleotide linkages have been
shown to be more effective than their unmodified counterparts. For
example, Agrawal et al. (Proc. Natl. Acad. Sci. (USA) (1988)
85:7079-7083) teaches that oligonucleotide phosphorothioates and
certain oligonucleotide phosphoramidates are more effective at
inhibiting HIV-1 than conventional phosphodiester-linked
oligodeoxynucleotides. Agrawal et al. (Proc. Natl. Acad. Sci. (USA)
(1989) 86:7790-7794) discloses the advantage of oligonucleotide
phosphorothioates in inhibiting HIV-1 in early and chronically
infected cells.
[0007] In addition, chimeric oligonucleotides having more than one
type of internucleotide linkage within the oligonucleotide have
been developed. Pederson et al. (U.S. Pat. Nos. 5,149,797 and
5,220,007 discloses chimeric oligonucleotides having an
oligonucleotide phosphodiester or oligonucleotide phosphorothioate
core sequence flanked by nucleotide methylphosphonates or
phosphoramidates. Furdon et al. (Nucleic Acids Res. (1989)
17:9193-9204) discloses chimeric oligonucleotides having regions of
oligonucleotide phosphodiesters in addition to either
oligonucleotide phosphorothioate or methylphosphonate regions.
Quartin et al. (Nucleic Acids Res. (1989) 17:7523-7562) discloses
chimeric oligonucleotides having regions of oligonucleotide
phosphodiesters and oligonucleotide methylphosphonates. Inoue et
al. (FEBS Lett. (1987) 215:237-250) discloses chimeric
oligonucleotides having regions of deoxyribonucleotides and
2'-O-methyl-ribonucleotides.
[0008] Many of these modified oligonucleotides have contributed to
improving the potential efficacy of the antisense oligonucleotide
therapeutic approach. However, certain deficiencies remain in the
known oligonucleotides, and these deficiencies can limit the
effectiveness of such oligonucleotides as therapeutic agents. For
example, Wickstrom (J. Biochem. Biophys. Meth. (1986) 13:97-102)
teaches that oligonucleotide phosphodiesters are susceptible to
nuclease-mediated degradation, thereby limiting their
bioavailability in vivo. Agrawal et al. (Proc. Natl. Acad. Sci.
(USA) (1990) 87:1401-1405) teaches that oligonucleotide
phosphoramidates or methylphosphonates when hybridized to RNA do
not activate RNase H, the activation of which can be important to
the function of antisense oligonucleotides. Thus, a need for
methods of controlling gene expression exists which uses
oligonucleotides with improved therapeutic characteristics.
[0009] Several reports have been published on the development of
phosphorothioate-linked oligonucleotides as potential anti-AIDS
therapeutic agents. Although extensive studies on chemical and
molecular mechanisms of oligonucleotides have demonstrated the
potential value of this novel therapeutic strategy, little is known
about the pharmacokinetics and metabolism of these compounds in
vivo.
[0010] Several preliminary studies on this topic have been
published. Agrawal et al. (Proc. Natl. Acad. Sci. (USA) (1991)
88:7595-7599) describes the intravenous and intraperitoneal
administration to mice of a 20mer phosphorothioate
linked-oligonucleotide. In this study, approximately 30% of the
administered dose was excreted in the urine over the first 24 hours
with accumulation preferentially in the liver and kidney. Plasma
half-lives ranged from about 1 hour (t.sub.1/2.alpha.) and 40 hours
(t.sub.1/2.alpha.) respectively. Similar results have been reported
in subsequent studies (Iversen (1991) Anti-Cancer Drug Design
6:531-538; Iversen (1994) Antisense Res. Devel. 4:43-52; and Sands
(1994) Mol. Pharm. 45:932-943). However, stability problems may
exist when oligonucleotides are administered intravenously and
intraperitoneally. More recently, Agrawal et al. reported that
oligonucleotide hybrids containing 2'-O-methyl ribonucleotides at
both the 3'- and 5' ends and deoxyribonucleotide phosphorothioates
in the interior portion were absorbed through the gastrointestinal
(GI) tract of rats (Biochem. Pharm. (1995) 50:571-576).
[0011] Thus, there remains a need to develop more effective
therapeutic methods of down-regulating the expression of genes
which can be easily manipulated to fit the animal and condition to
be treated, and the gene to be targeted. Preferably, these methods
should be simple, painless, and precise in effecting the target
gene.
SUMMARY OF THE INVENTION
[0012] The present invention provides a method of down-regulating
the expression of a gene in an animal which involves the
administration of an oligonucleotide complementary to the gene via
an oral route, thereby bypassing the complications which may be
experienced during intravenous and other modes of in vivo
administration.
[0013] It has been discovered that hybrid oligonucleotides with
other than phosphodiester bonds and having at least one
2'-substituted ribonucleotide and chimeric oligonucleotides with at
least two different types of internucleotide linkages are
relatively stable in vivo following oral administration to an
animal, and that these molecules are successfully absorbed from the
gastrointestinal tract and distributed to various body tissues.
This discovery has been exploited to develop the present invention,
which is a method of down-regulating the expression of a gene in an
animal.
[0014] This method is also a means of examining the function of
various genes in an animal, including those essential to animal
development. Presently, gene function can only be examined by the
arduous task of making a "knock out" animal such as a mouse. This
task is difficult, time-consuming and cannot be accomplished for
genes essential to animal development since the "knock out" would
produce a lethal phenotype. The present invention overcomes the
shortcomings of this model.
[0015] In the method of the invention, a pharmaceutical formulation
containing an oligonucleotide complementary to the targeted gene is
orally administered in a pharmaceutically acceptable carrier to the
animal harboring the gene. The oligonucleotide inhibits the
expression of the gene, thereby down-regulating its expression.
[0016] For purposes of the invention, the term "animal" is meant to
encompass humans as well as other mammals, as well as reptiles
amphibians, and insects. The term "oral administration" refers to
the provision of the formulation via the mouth through ingestion,
or via some other part of the gastrointestinal system including the
esophagus.
[0017] As used herein, the term "oligonucleotide" is meant to
include polymers of two or more nucleotides or nucleotide analogs
connected together via 5' to 3' internucleotide linkages which may
include any linkages that are known in the antisense art, including
non-phosphodiester linkages. Such molecules have a 3' terminus and
a 5' terminus.
[0018] The term "non-phosphodiester-linkages" as used herein refers
to a synthetic covalent attachment between the 5' end of one
nucleotide and the 3' end of another nucleotide in which the 5'
nucleotide phosphate has been replaced with any number of chemical
groups. Preferable synthetic linkages include alkylphosphonates,
phosphorothioates, phosphorodithioates, alkylphosphonothioates,
phosphoramidates, phosphoramidites, phosphate esters, carbamates,
carbonates, phosphate triesters, acetamidate, and carboxymethyl
esters. In one preferred embodiment of the invention, all of the
nucleotides of the oligonucleotide are linked via phosphorothioate
and/or phosphorodithioate linkages.
[0019] In some embodiments of the invention, the oligonucleotides
administered are modified with other than, or in addition to,
non-phosphodiester-internucleotide linkages. As used herein, the
term "modified oligonucleotide" encompasses oligonucleotides with
modified nucleic acid(s), base(s), and/or sugar(s) other than those
found in nature. For example, a 3',5'-substituted oligonucleotide
is an oligonucleotide having a sugar which, at both its 3' and 5'
positions is attached to a chemical group other than a hydroxyl
group (at its 3' position) and other than a phosphate group (at its
5' position).
[0020] A modified oligonucleotide may also be one with added
substituents such as diamines, cholestryl, or other lipophilic
groups, or a capped species. In addition, unoxidized or partially
oxidized oligonucleotides having a substitution in one nonbridging
oxygen per nucleotide in the molecule are also considered to be
modified oligonucleotides. Also considered as modified
oligonucleotides are oligonucleotides having nuclease
resistance-conferring bulky substituents at their 3' and/or 5'
end(s) and/or various other structural modifications not found in
vivo without human intervention are also considered herein as
modified.
[0021] In one embodiment, the oligonucleotide being administered in
the method of the invention has non-phosphodiester internucleotide
linkages and includes at least one 2'-substituted
ribonucleotide.
[0022] For purposes of the invention, the term "2'-substituted
oligonucleotide" refers to an oligonucleotide having a sugar
attached to a chemical group other than a hydroxyl group at its 2'
position. The 2'-OH of the ribose molecule can be substituted with
-O-lower alkyl containing 1-6 carbon atoms, aryl or substituted
aryl or allyl having 2-6 carbon atoms, e.g., 2'-O-allyl, 2'-O-aryl,
2'-O-alkyl (such as a 2'-O-methyl), 2'-halo, or 2'-amino, but not
with 2'-H, wherein allyl, aryl, or alkyl groups may be
unsubstituted or substituted, e.g., with halo, hydroxy,
trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy, carboxyl,
carbalkoxyl or amino groups.
[0023] In one preferred embodiment of the invention, the
oligonucleotide administered includes at least one 2'-substituted
ribonucleotide at its 3' terminus. In some embodiments, all but
four or five nucleotides at its 5' terminus are 2'-substituted
ribonucleotides, and in some embodiments, these four or five
unsubstituted 5' nucleotides are deoxyribonucleotides. In other
embodiments, the oligonucleotide has at least one 2'-substituted
ribonucleotide at both its 3' and 5' termini, and in yet other
embodiments, the oligonucleotide is composed of 2'-substituted
ribonucleotides in all positions with the exception of at least
four or five contiguous deoxyribonucleotide nucleotides in any
interior position. Another aspect of the invention includes the
administration of an oligonucleotide composed of nucleotides that
are all 2'-substituted ribonucleotides. Particular embodiments
include oligonucleotides having a 2'-O-alkyl-ribonucleotide such as
a 2'-O-methyl. Other embodiments include the administration of
chimeric oligonucleotides. In one preferred embodiment, the
chimeric oligonucleotide has at least one alkylphosphonate
internucleotide linkage at both its 3' and 5' ends and having
phosphorothioate internucleotide linkages.
[0024] In another embodiment of the invention, the oligonucleotide
administered has at least one deoxyribonucleotide, and in a
preferred embodiment, the oligonucleotide has at least four or five
contiguous deoxyribonucleotides capable of activating RNase H.
[0025] The oligonucleotide administered is complementary to a gene
of a virus, pathogenic organism, or a cellular gene in some
embodiments of the invention. In some embodiments, the
oligonucleotide is complementary to a gene of a virus involved in
AIDS, oral or genital herpes, papilloma warts, influenza, foot and
mouth disease, yellow fever, chicken pox, shingles, adult T-cell
leukemia, Burkitt's lymphoma, nasopharyngeal carcinoma, or
hepatitis. In one particular embodiment, the oligonucleotide is
complementary to an HIV gene and includes about 15 to 26
nucleotides linked by phosphorothioate internucleotide linkages, at
least one of the nucleotides at the 3' terminus being a
2'-substituted ribonucleotide, and at least four contiguous
deoxyribonucleotides.
[0026] In another embodiment, the oligonucleotide is complementary
to a gene encoding a protein associated with Alzheimer's
disease.
[0027] In yet other embodiments, the oligonucleotide is
complementary to a gene encoding a protein expressed in a parasite
that causes a parasitic disease such as amebiasis, Chagas' disease,
toxoplasmosis, pneumocytosis, giardiasis, cryptoporidiosis,
trichomoniasis, malaria, ascariasis, filariasis, trichinosis, or
schistosomiasis infections.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] The foregoing and other objects of the present invention,
the various features thereof, as well as the invention itself may
be more fully understood from the following description, when read
together with the accompanying drawings in which:
[0029] FIG. 1 is a graphic representation showing the time course
of radiolabelled oligonucleotide in liver, kidney and plasma
following the oral administration of radiolabelled phosphorothioate
(PS) oligonucleotide 11 (SEQ ID NO:10);
[0030] FIG. 2A is a representation of an autoradiogram of
radiolabelled oligonucleotide in the stomach, small intestine, and
large intestine of rats at different times following oral
administration of PS oligonucleotide;
[0031] FIG. 2B is a representation of an autoradiogram of
radiolabelled oligonucleotide in the stomach, small intestine, and
large intestine of rats at different times following oral
administration of hybrid oligonucleotide;
[0032] FIG. 3A is a representation of an autoradiogram of
radiolabelled oligonucleotide in the stomach, small intestine, and
large intestine of mice at different times following oral
administration of hybrid oligonucleotide;
[0033] FIG. 3B is a representation of an autoradiogram of
radiolabelled oligonucleotide in the stomach, small intestine, and
large intestine of mice at different times following oral
administration of chimeric oligonucleotide;
[0034] FIG. 4A is an HPLC chromatograph of radiolabelled PS
oligonucleotide standard;
[0035] FIG. 4B is an HPLC chromatogram of oligonucleotides
extracted from plasma samples taken 12 hours after the
administration of radiolabelled PS oligonucleotide;
[0036] FIG. 5A is an HPLC chromatogram of radiolabelled PS
oligonucleotide standard;
[0037] FIG. 5B is an HPLC chromatogram of oligonucleotides
extracted from rat liver 6 hours after the administration of
radiolabelled PS oligonucleotide;
[0038] FIG. 5C is an HPLC chromatogram of oligonucleotides
extracted from rat liver 24 hours after the administration of
radiolabelled PS oligonucleotide;
[0039] FIG. 6 is a graphic representation demonstrating the time
course of urinary excretion of radioactivity in rats following the
oral administration of radiolabelled PS oligonucleotide;
[0040] FIG. 7A is an HPLC chromatogram of radiolabelled PS
oligonucleotide standard;
[0041] FIG. 7B is an HPLC chromatogram of oligonucleotides
extracted from rat urine 6 hours after the administration of
radiolabelled PS oligonucleotide;
[0042] FIG. 7C is an HPLC chromatogram of oligonucleotides
extracted from rat urine 12 hours after the administration of
radiolabelled PS oligonucleotide;
[0043] FIG. 8 is a graphic representation showing the course of
radioactivity in the gastrointestinal tract and feces in rats
following the oral administration of radiolabelled PS
oligonucleotide;
[0044] FIG. 9 is an HPLC chromatogram of oligonucleotides extracted
from rat stomach 1 hour, 3 hours, and 6 hours after the
administration of radiolabelled PS oligonucleotide;
[0045] FIG. 10 is an HPLC chromatogram of oligonucleotides
extracted from rat large intestine 3 hours, 6 hours, and 12 hours
after the administration of radiolabelled PS oligonucleotide;
[0046] FIG. 11A is a representation of an autoradiogram of
radiolabelled oligonucleotide in the plasma, liver, kidney, spleen,
heart, and lung of mice 6 hours following oral administration of
hybrid oligonucleotide;
[0047] FIG. 11B is a representation of an autoradiogram of
radiolabelled oligonucleotide in the plasma, liver, kidney, spleen,
heart, and lung of mice 6 hours following oral administration of
chimeric oligonucleotide; and
[0048] FIG. 12 is a graphic representation of the distribution of
radioactivity in GI+feces, plasma, tissue, and urine at various
times following oral administration of PS oligonucleotide (30 mg/kg
rat), hybrid oligonucleotide (10 mg/kg mouse), and chimeric
oligonucleotide (10 mg/kg mouse).
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0049] The patent and scientific literature referred to herein
establishes the knowledge that is available to those with skill in
the art. The issued U.S. patent, allowed patent applications, and
articles cited herein are hereby incorporated by reference.
[0050] This invention provides a method of down-regulating the
expression of a gene in an animal by the oral administration of an
oligonucleotide whose nucleotide sequence is complementary to the
targeted gene.
[0051] It is known that an oligonucleotide, called an "antisense
oligonucleotide," can bind to a target single-stranded nucleic acid
molecule according to the Watson-Crick or the Hoogsteen rule of
base pairing, and in doing so, disrupt the function of the target
by one of several mechanisms: by preventing the binding of factors
required for normal transcription, splicing, or translation; by
triggering the enzymatic destruction of mRNA by RNase H if a
contiguous region of deoxyribonucleotides exists in the
oligonucleotide, and/or by destroying the target via reactive
groups attached directly to the antisense oligonucleotide.
[0052] Thus, because of the properties described above, such
oligonucleotides are useful therapeutically by their ability to
control or down-regulate the expression of a particular gene in an
animal, according to the method of the present invention.
[0053] The oligonucleotides useful in the method of the invention
are at least 6 nucleotides in length, but are preferably 6 to 50,
more preferably 11 to 35, most preferably 15 to 30, and commonly 15
to 25 nucleotides in length. They are composed of
deoxyribonucleotides, ribonucleotides, or a combination of both,
with the 5' end of one nucleotide and the 3' end of another
nucleotide being covalently linked by non-phosphodiester
internucleotide linkages. Such linkages include alkylphosphonates,
phosphorothioates, phosphorodithioates, alkylphosphonothioates,
alkylphosphonates, phosphoramidates, phosphate esters, carbamates,
acetamidate, carboxymethyl esters, carbonates, and phosphate
triesters. Oligonucleotides with these linkages can be prepared
according to known methods such as phosphoramidate or H-phosphonate
chemistry which can be carried out manually or by an automated
synthesizer as described by Brown (A Brief History of
Oligonucleotide Synthesis. Protocols for Oligonucleotides and
Analogs, Methods in Molecular Biology (1994) 20:1-8). (See also,
e.g., Sonveaux "Protecting Groups in Oligonucleotides Synthesis" in
Agrawal (1994) Methods in Molecular Biology 26:1-72; Uhlmann et al.
(1990) Chem. Rev. 90:543-583).
[0054] The oligonucleotides of the composition may also be modified
in a number of ways without compromising their ability to hybridize
to the target nucleic acid. Such modifications include, for
example, those which are internal or at the end(s) of the
oligonucleotide molecule and include additions to the molecule of
the internucleoside phosphate linkages, such as cholesteryl or
diamine compounds with varying numbers of carbon residues between
the amino groups and terminal ribose, deoxyribose and phosphate
modifications which cleave, or crosslink to the opposite chains or
to associated enzymes or other proteins which bind to the viral
genome. Examples of such modified oligonucleotides include
oligonucleotides with a modified base and/or sugar such as
arabinose instead of ribose, or a 3',5'-substituted oligonucleotide
having a sugar which, at both its 3' and 5' positions is attached
to a chemical group other than a hydroxyl group (at its 3'
position) and other than a phosphate group (at its 5' position).
Other modified oligonucleotides are capped with a nuclease
resistance-conferring bulky substituent at their 3' and/or 5'
end(s), or have a substitution in one nonbridging oxygen per
nucleotide. Such modifications can be at some or all of the
internucleoside linkages, as well as at either or both ends of the
oligonucleotide and/or in the interior of the molecule. For the
preparation of such modified oligonucleotides, see, e.g., Agrawal
(1994) Methods in Molecular Biology 26; Uhlmann et al. (1990) Chem.
Rev. 90:543-583).
[0055] Oligonucleotides which are self-stabilized are also
considered to be modified oligonucleotides useful in the methods of
the invention (Tang et al. (1993) Nucleic Acids Res. 20:2729-2735).
These oligonucleotides comprise two regions: a target hybridizing
region; and a self-complementary region having an oligonucleotide
sequence complementary to a nucleic acid sequence that is within
the self-stabilized oligonucleotide.
[0056] The preparation of these unmodified and modified
oligonucleotides is well known in the art (reviewed in Agrawal et
al. (1992) Trends Biotechnol. 10:152-158) (see, e.g., Uhlmann et
al. (1990) Chem. Rev. 90:543-584; and (1987) Tetrahedron. Lett.
28:(31):3539-3542); Agrawal (1994) Methods in Molecular Biology
20:63-80); and Zhang et al. (1996) J. Pharmacol. Expt. Thera.
278:1-5).
[0057] The oligonucleotides administered to the animal may be
hybrid oligonucleotides in that they contain both
deoxyribonucleotides and at least one 2' substituted
ribonucleotide. For purposes of the invention, the term
"2'-substituted" means substitution at the 2' position of the
ribose with, e.g., a -O-lower alkyl containing 1-6 carbon atoms,
aryl or substituted aryl or allyl having 2-6 carbon atoms e.g.,
2'-O-allyl, 2'-O-aryl, 2'-O-alkyl, 2'-halo, or 2'-amino, but not
with 2'-H, wherein allyl, aryl, or alkyl groups may be
unsubstituted or substituted, e.g., with halo, hydroxy,
trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy, carboxyl,
carbalkoxyl or amino groups. Useful substituted ribonucleotides are
2'-O-alkyls such as 2'-O-methyl.
[0058] The hybrid DNA/RNA oligonucleotides useful in the method of
the invention resist nucleolytic degradation, form stable duplexes
with RNA or DNA, and preferably activate RNase H when hybridized
with RNA. They may additionally include at least one unsubstituted
ribonucleotide. For example, an oligonucleotide useful in the
method of the invention may contain all deoxyribonucleotides with
the exception of one 2' substituted ribonucleotide at the 3'
terminus of the oligonucleotide. Alternatively, the oligonucleotide
may have at least one substituted ribonucleotide at both its 3' and
5' termini.
[0059] One preferred class of oligonucleotides useful in the method
of the invention contains four or more deoxyribonucleotides in a
contiguous block, so as to provide an activating segment for RNase
H. In certain cases, more than one such activating segment will be
present at any location within the oligonucleotide. There may be a
majority of deoxyribonucleotides in oligonucleotides according to
the invention. In fact, such oligonucleotides may have as many as
all but one nucleotide being deoxyribonucleotides. Thus, a
preferred oligonucleotide having from about 2 to about 50
nucleotides or most preferably from about 12 to about 25
nucleotides, the number of deoxyribonucleotides present ranges from
1 to about 24. Other useful oligonucleotides may consist only of
2'-substituted ribonucleotides.
[0060] TABLE 1 lists some representative species of
oligonucleotides which are useful in the method of the invention.
2'-substituted nucleotides are underscored.
1TABLE 1 OLIGO ID SEQ ID NO. OLIGONUCLEOTIDE NO.: 1.
CTCTCGCACCCATCTCTCTCCTTCU 1 2. CTCTCGCACCCATCTCTCTCCTUCU 2 3.
CTCTCGCACCCATCTCTCTCCUUCU 3 4. CTCTCGCACCCATCTCUCUCCUUCU 4 5.
CTCTCGCACCCAUCUCUCUCCUUCU 5 6. CTCTCGCACCCAUCUCUCUCCUUCU 6 7.
CTCTCGCACCCAUCUCUCUCCUUCU 7 8. CUCUCGCACCCAUCUCUCUCCUUCU 8 9.
CTCTCGCACCCATCTCTCTCCTTCU 1 10. CUCTCGCACCCATCTCTCTCCTTCU 9 11.
CUCUCGCACCCATCTCTCTCCUUCU 10 12. CUCUCGCACCCATCTCUCUCCUUCU 11 13.
CUCUCGCACCCAUCUCUCUCCUUC- U 12 14. CUCUCGCACCCATCTCTCUCCUUCU 13 15.
CTCTCGCACCCAUCUCUCUCCUUCU 5 16. CUCUCGCACCCAUCTCTCTCCUUCU 14 17.
CUCUCGCACCCATCTCTCTCCUUCU 15 18. CUCTCGCACCCAUCUCUCUCCUUCU 16 19.
CUCTCGCACCCATCTCTCUCCUUC- U 17
[0061] The oligonucleotides administered to the animal may be
chimeric in that they contain more than one type of internucleotide
linkage. Such chimeric oligonucleotides are described in U.S. Pat.
Nos. 5,149,797 and 5,366,878. For example, chimeric
oligonucleotides useful in the method of the invention may include
phosphorothioate and alkylphosphonate internucleotide linkages. One
preferred alkylphosphonate linkage is a methylphosphonate
linkage.
[0062] Table 2 lists some representative specifics of chimeric
oligonucleotides which are useful in the method of the invention.
The alkylphosphonate internucleotide linkages are indicated by ":";
the phosphorothioate linkages are indicated by "-".
2TABLE 2 NO: OLIGONUCLEOTIDE (5'.o slashed.3') SEQ ID NO: 20
C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-- C:T:T:C:T 18 21
C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C- -T:T:C:T 18 22
C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C:T- :T:C:T 18 23
C:T:C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C:T:T- :C:T 18 24
C:T:C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T:T:C- :T 18 25
C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T:C:T 18 26
C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T:C:T 18 27
C:T:C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T:C:T 18 28
C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T:T:C:T 18 29
C:T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C:T:T:C:T 18 30
C:T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T:T:C:T 18 31
C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C:T 18 32
C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C:T 18 33
C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C:T 19 34
C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19 35
C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C:T 19 36
C:T:C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C:T 19 37
C:T:C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19 38
C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19 39
C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19 40
C:T:C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19 41
C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19 42
C:T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C:T 19 43
C:T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19 44
C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19 45
C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19
[0063] The oligonucleotides according to the invention are
effective in inhibiting the expression of various genes in viruses,
pathogenic organisms, or in inhibiting the expression of cellular
genes. The ability to inhibit such agents is clearly important to
the treatment of a variety of disease states. Thus,
oligonucleotides according to the method of the invention have a
nucleotide sequence which is complementary to a nucleic acid
sequence that is from a virus, a pathogenic organism or a cellular
gene. Preferably such oligonucleotides are from about 6 to about 50
nucleotides in length.
[0064] For purposes of the invention, the term "oligonucleotide
sequence that is complementary to a nucleic acid sequence" is
intended to mean an oligonucleotide sequence that binds to the
target nucleic acid sequence under physiological conditions, e.g.,
by Watson-Crick base pairing (interaction between oligonucleotide
and single-stranded nucleic acid) or by Hoogsteen base pairing
(interaction between oligonucleotide and double-stranded nucleic
acid) or by any other means including in the case of a
oligonucleotide binding to RNA, pseudoknot formation. Such binding
(by Watson Crick base pairing) under physiological conditions is
measured as a practical matter by observing interference with the
function of the nucleic acid sequence.
[0065] The nucleic acid sequence to which an oligonucleotide
according to the invention is complementary will vary, depending
upon the gene to be down-regulated. In some cases, the target gene
or nucleic acid sequence will be a virus nucleic acid sequence. The
use of antisense oligonucleotides to inhibit various viruses is
well known (reviewed in Agrawal (1992) Trends in Biotech.
10:152-158). Viral nucleic acid sequences that are complementary to
effective antisense oligonucleotides have been described for many
viruses, including human immunodeficiency virus type 1 (HIV-1)
(U.S. Pat. No. 4,806,463), herpes simplex virus (U.S. Pat. No.
4,689,320), influenza virus (U.S. Pat. No. 5,194,428), and human
papilloma virus (Storey et al. (1991) Nucleic Acids Res.
19:4109-4114). Sequences complementary to any of these nucleic acid
sequences can be used for oligonucleotides according to the
invention, as can be oligonucleotide sequences complementary to
nucleic acid sequences from any other virus. Additional viruses
that have known nucleic acid sequences against which antisense
oligonucleotides can be prepared include, but are not limited to,
foot and mouth disease virus (see, Robertson et al. (1985) J.
Virol. 54:651; Harris et al. (1980) Virol. 36:659), yellow fever
virus (see Rice et al. (1985) Science 229:726), varicella-zoster
virus (see, Davison and Scott (1986) J. Gen. Virol. 67:2279),
Epstein-Barr virus, cytomegalovirus, respiratory syncytial virus
(RSV), and cucumber mosaic virus (see Richards et al. (1978) Virol.
89:395).
[0066] For example, an oligonucleotide has been designed which is
complementary to a portion of the HIV-1 gene, and as such, has
significant anti-HIV effects (Agrawal (1992) Antisense Res.
Development 2:261-266). The target of this oligonucleotide has been
found to be conserved among various HIV-1 isolates. It is 56% G+C
rich, water soluble, and relatively stable under physiological
conditions. This oligonucleotide binds to a complementary RNA
target under physiological conditions, with the T of the duplex
approximately being 56.degree. C. The antiviral activity of this
oligonucleotide has been tested in several models, including
acutely and chronically infected CEM cells, long-term cultures
mimicking in vivo conditions, human peripheral blood lymphocytes
and macrophages, and isolates from HIV-1 infected patients
(Lisziewicz et al. (Proc. Natl. Acad. Sci. (USA) (1992)
89:11209-11213); Lisziewicz et al. (Proc. Natl. Acad. Sci. (USA)
(1993) 90:3860-3864); Lisziewicz et al. (Proc. Natl. Acad. Sci.
(USA) (1994) 91:7942-7946); Agrawal et al. (J. Ther. Biotech) in
press).
[0067] The oligonucleotides according to the invention
alternatively can have an oligonucleotide sequence complementary to
a nucleic acid sequence of a pathogenic organism. The nucleic acid
sequences of many pathogenic organisms have been described,
including the malaria organism, Plasmodium falciparum, and many
pathogenic bacteria. Oligonucleotide sequences complementary to
nucleic acid sequences from any such pathogenic organism can be
used in oligonucleotides according to the invention. Nonlimiting
examples of pathogenic eucaryotes having known nucleic acid
sequences against which antisense oligonucleotides can be prepared
include Trypanosom abrucei gambiense and Leishmania (See Campbell
et al., Nature 311:350 (1984)), and Fasciola hepatica (See Zurita
et al., Proc. Natl. Acad. Sci. (USA) 84:2340 (1987).
[0068] Antifungal oligonucleotides can be prepared using a target
hybridizing region having an oligonucleotide sequence that is
complementary to a nucleic acid sequence from, e.g., the chitin
synthetase gene, and antibacterial oligonucleotides can be prepared
using, e.g., the alanine racemase gene. Among fungal diseases that
may be treatable by the method of treatment according to the
invention are candidiasis, histoplasmosis, cryptococcocis,
blastomycosis, aspergillosis, sporotrichosis, chromomycosis,
dermatophytosis, and coccidioidomycosis. The method might also be
used to treat rickettsial diseases (e.g., typhus, Rocky Mountain
spotted fever), as well as sexually transmitted diseases caused by
Chlamydia trachomatis or Lymphogranuloma venereum. A variety of
parasitic diseases may be treated by the method according to the
invention, including amebiasis, Chagas' disease, toxoplasmosis,
pneumocystosis, giardiasis, cryptosporidiosis, trichomoniasis, and
Pneumocystis carini pneumonia; also worm (helminthic) diseases such
as ascariasis, filariasis, trichinosis, schistosomiasis and
nematode or cestode infections. Malaria may be treated by the
method of treatment of the invention regardless of whether it is
caused by P. falciparum, P. vivas, P. orale, or P. malariae.
[0069] The infectious diseases identified above may all be treated
by the method of treatment according to the invention because the
infectious agents for these diseases are known and thus
oligonucleotides according to the invention can be prepared, having
oligonucleotide sequence that is complementary to a nucleic acid
sequence that is an essential nucleic acid sequence for the
propagation of the infectious agent, such as an essential gene.
[0070] Other disease states or conditions that may be treatable by
the method according to the invention are those which result from
an abnormal expression or product of a cellular gene. These
conditions may be treated by administration of oligonucleotides
according to the invention, and have been discussed earlier in this
disclosure.
[0071] Other oligonucleotides according to the invention can have a
nucleotide sequence complementary to a cellular gene or gene
transcript, the abnormal expression or product of which results in
a disease state. The nucleic acid sequences of several such
cellular genes have been described, including prion protein (Stahl
et al. (1991) FASEB J. 5:2799-2807), the amyloid-like protein
associated with Alzheimer's disease (U.S. Pat. No. 5,015,570), and
various well-known oncogenes and proto-oncogenes, such as c-myb,
c-myc, c-abl, and n-ras. In addition, oligonucleotides that inhibit
the synthesis of structural proteins or enzymes involved largely or
exclusively in spermatogenesis, sperm motility, the binding of the
sperm to the egg or any other step affecting sperm viability may be
used as contraceptives. Similarly, contraceptives for women may be
oligonucleotides that inhibit proteins or enzymes involved in
ovulation, fertilization, implantation or in the biosynthesis of
hormones involved in those processes.
[0072] Hypertension may be controlled by oligonucleotides that
down-regulate the synthesis of angiotensin converting enzyme or
related enzymes in the renin/angiotensin system. Platelet
aggregation may be controlled by suppression of the synthesis of
enzymes necessary for the synthesis of thromboxane A2 for use in
myocardial and cerebral circulatory disorders, infarcts,
arteriosclerosis, embolism and thrombosis. Deposition of
cholesterol in arterial wall may be inhibited by suppression of the
synthesis of fatty acid co-enzyme A: cholesterol acyl transferase
in arteriosclerosis. Inhibition of the synthesis of
cholinephosphotransferase may be useful in hypolipidemia.
[0073] There are numerous neural disorders in which hybridization
arrest may be used to reduce or eliminate adverse effects of the
disorder. For example, suppression of the synthesis of monoamine
oxidase may be used in Parkinson's disease. Suppression of catechol
o-methyl transferase may be used to treat depression; and
suppression of indole N-methyl transferase may be used in treating
schizophrenia.
[0074] Suppression of selected enzymes in the arachidonic acid
cascade which leads to prostaglandins and leukotrienes may be
useful in the control of platelet aggregation, allergy,
inflammation, pain and asthma.
[0075] Suppression of the protein expressed by the multidrug
resistance (mdr-1) gene, which can be responsible for development
of resistance of tumors to a variety of anti-cancer drugs and is a
major impediment in chemotherapy may prove to be beneficial in the
treatment of cancer. Oligonucleotide sequences complementary to
nucleic acid sequences from any of these genes can be used for
oligonucleotides according to the invention, as can be
oligonucleotide sequences complementary to any other cellular gene
transcript, the abnormal expression or product of which results in
a disease state.
[0076] The oligonucleotides described herein are administered
orally or enterally to the animal subject in the form of
therapeutic pharmaceutical formulations that are effective for
treating virus infection, infections by pathogenic organisms, or
disease resulting from abnormal gene expression or from the
expression of an abnormal gene product. In some aspects or the
method according to the invention, the oligonucleotides are
administered in conjunction with other therapeutic agents, e.g.,
AZT in the case of AIDS.
[0077] The therapeutic pharmaceutical formulation containing the
oligonucleotide includes a physiologically acceptable carrier, such
as an inert diluent or an assimilable edible carrier with which the
peptide is administered. Suitable formulations that include
pharmaceutically acceptable excipients for introducing compounds to
the bloodstream by other than injection routes can be found in
Remington's Pharmaceutical Sciences (18th ed.) (Genarro, ed. (1990)
Mack Publishing Co., Easton, Pa.). The oligonucleotide and other
ingredients may be enclosed in a hard or soft shell gelatin
capsule, compressed into tablets, or incorporated directly into the
individual's diet. The oligonucleotide may be incorporated with
excipients and used in the form of ingestible tablets, buccal
tablets, troches, capsules, elixirs, suspensions, syrups, wafers,
and the like. When the oligonucleotide is administered orally, it
may be mixed with other food forms and pharmaceutically acceptable
flavor enhancers. When the oligonucleotide is administered
enterally, they may be introduced in a solid, semi-solid,
suspension, or emulsion form and may be compounded with any number
of well-known, pharmaceutically acceptable additives. Sustained
release oral delivery systems and/or enteric coatings for orally
administered dosage forms are also contemplated such as those
described in U.S. Pat. Nos. 4,704,295, 4,556,552, 4,309,404, and
4,309,406.
[0078] The amount of oligonucleotide in such therapeutically useful
compositions is such that a suitable dosage will be obtained.
Preferred compositions or preparations according to the present
invention are prepared so that an oral dosage unit contains between
from about 50 micrograms to about 200 mg per kg body weight of the
animal, with 10 mg to 100 mg per kg being most preferable.
[0079] It will be appreciated that the unit content of active
ingredient or ingredients contained in an individual dose of each
dosage form need not in itself constitute an effective amount since
the necessary effective amount can be reached by administration of
a plurality of dosage units (such as capsules or tablets or
combinations thereof).
[0080] In order to determine if the oligonucleotide administered
according to the method of the invention is absorbed into body
tissues, and if so, in which tissues absorption occurs, the
following study was performed. Samples of various body tissues from
treated rats were analyzed for radioactivity at increasing hours
after oral administration of a radioactively labelled
phosphorothioate oligonucleotide. FIG. 1 illustrates the plasma,
liver, and kidney concentration-time course of an oligonucleotide
equivalents after oral administration of the radiolabelled
oligonucleotide. These results demonstrate that the drug is
absorbed through gastrointestinal tract and accumulated in the
kidney and the liver.
[0081] As illustrated in FIGS. 2A and 2B, both unmodified and
hybrid oligonucleotides were shown to be stable in the stomach up
to 6 hr following oral administration. The unmodified
oligonucleotide underwent extensive degradation in small and large
intestine, the majority of the radioactivity being associated with
the different length of truncated oligonucleotide (FIG. 2A). In
contrast, the hybrid oligonucleotide was more stable compared to
the unmodified oligonucleotide, the majority of the radioactivity
in small intestine being associated with the intact oligonucleotide
(FIG. 2B). Increased degradation of the hybrid oligonucleotide was
observed in the large intestine (FIG. 2B).
[0082] .sup.35S-labelled modified oligonucleotides were also orally
administered to mice at a single dose. For the hybrid
oligonucleotide, similar profiles of gel electrophoresis of
radioactivity in the gastrointestinal tract were observed with mice
compared to rats (FIG. 3A). For the chimeric oligonucleotide, gel
electrophoresis of radioactivity in the gastrointestinal tract
revealed that this compound was stable in stomach and small
intestine, with significant degradation in large intestine (FIG.
3B).
[0083] The chemical form of radioactivity in rat plasma was further
evaluated by HPLC as shown in FIGS. 4A and 4B, demonstrating the
presence of both intact PS oligonucleotide (A) as well as
metabolites (B) 12 hours after oral administration (see FIG. 4B).
Intact oligonucleotide was also detected in rat liver 6 hours (FIG.
5B) and 12 hours (FIG. 5C) after oral administration. Radioactivity
in rat brain, thymus, heart, lung, liver, kidney, adrenals,
stomach, small intestine, large intestine, skeletal muscle, testes,
thyroid, epidermis, whole eye, and bone marrow was detectable 48
hours after oral administration of the radiolabelled
oligonucleotide. For unmodified oligonucleotide, minimal intact
form was detectable in rat tissue samples. However, as shown in
FIG. 11A for the hybrid oligonucleotide and in FIG. 11B for the
chimeric oligonucleotide, intact oligonucleotides were detected in
plasma and tissue samples of the liver, kidney, spleen, heart, and
lung.
[0084] Further evidence to support the absorption of the
oligonucleotide comes from urine sample analysis after
radioactively labelled oligonucleotide was orally administered.
FIG. 6 shows the cumulative excretion of the radioactively labelled
oligonucleotide into the urine over 48 hr following the
administration of radiolabelled phosphorothioate oligonucleotide.
That the oligonucleotide continues to be excreted in the urine over
time implies that other tissues had absorbed it, and that the body
was capable of absorption for an extended period of time. FIGS. 7B
and 7C demonstrate that although the majority of radioactivity in
urine was present as degradative products, intact oligonucleotide
was also detected, demonstrating that this oligonucleotide is
absorbed intact.
[0085] To determine the level of bioavailability of
oligonucleotides following oral administration, the level of the
oligonucleotide in the gastrointestinal tract (stomach and
intestine) and feces was measured. FIG. 8 shows that approximately
80% of administered oligonucleotide remained or was excreted in
feces, indicating that 20% of administered oligonucleotide was
absorbed. This oligonucleotide was stable in stomach; no
significant degradative products in stomach contents were detected
six hours after oral administration (FIG. 9). The majority of
administered oligonucleotide in the contents of the large intestine
were also present as the intact compound (FIG. 10).
[0086] In another study, the oral bioavailability of unmodified,
hybrid, and chimeric oligonucleotide administered to rat and mouse
were compared, based on the quantitation of radioactivity in the
gastrointestinal tract, feces, plasma, urine and remaining tissues
at various times. Total recovery of radioactivity in the study was
92.+-.6%. The total absorption of unmodified oligonucleotide was
shown to be 17.3.+-.5.5% over 6 hr and 35.5.+-.6.0% over 12 hr
following oral administration of the radiolabelled unmodified
oligonucleotide to rats at a dose of 30 mg/kg. Minimal intact
unmodified oligonucleotide was also detected in tissues outside
enterohepatic system.
[0087] The total absorption of hybrid oligonucleotide was
determined to be 10.2.+-.2.5% over 6 hr and 25.9.+-.4.7% over 12 hr
following oral administration of the radiolabelled hybrid
oligonucleotide in rats. Although the total absorption rates were
slightly lower than that of the PS oligonucleotide, the hybrid
oligonucleotide-derived radioactivity was stable in various
tissues. The total absorption of the chimeric oligonucleotide was
determined to be 23.6.+-.2.8% over 6 hr and 39.3.+-.2.4% over 12 hr
following oral administration of the radiolabelled oligonucleotide.
The comparison of oral availability of the three types of
oligonucleotides is shown in FIG. 12, expressed as the percentages
of administered doses in the gastrointestinal tract plus feces, in
plasma, in tissues, and in urine.
[0088] Oral absorption of oligonucleotides in fasting animals was
also determined with PS-oligonucleotide and hybrid oligonucleotide.
Decreased absorption rates were found, indicating that the
retention time of the oligonucleotides in the gastrointestinal
tract in the fasting animals may be lower than in non-fasting
animals.
[0089] These studies indicate that hybrid and chimeric
oligonucleotides have enhanced bioavailability, which is associated
with their stability in the gastrointestinal tract and other
tissues.
[0090] Thus, using the method of the invention, successful
absorption of oligonucleotides was accomplished through the
gastrointestinal tract and distributed throughout the body. Intact
oligonucleotides were detected in plasma and various tissues and
excreted into the urine. These results demonstrate that oral
administration is a potential means for delivery of
oligonucleotides as therapeutic agents.
[0091] The following examples illustrate the preferred modes of
making and practicing the present invention, but are not meant to
limit the scope of the invention since alternative methods may be
utilized to obtain similar results.
EXAMPLES
[0092] 1. Synthesis and Analysis of Oligonucleotides
[0093] An unmodified HIV-specific 25mer oligonucleotide and hybrid
25mer phosphorothioate-linked oligonucleotide having SEQ ID NO:10
and containing 2'-O-methyl ribonucleotide 3' and 5' sequences and a
deoxyribonucleotide interior, as well as two hybrid 18mer
phosphorothioate-linked oligonucleotides having SEQ ID NOS:20 and
21, and containing 2'-O-methyl ribonucleotide 3' and 5' sequences
and a deoxyribonucleotide interior, were synthesized, purified, and
analyzed as follows.
[0094] Unmodified phosphorothioate deoxynucleosides were
synthesized on CPG on a 5-6 .mu.mole scale on an automated
synthesizer (model 8700, Millipore, Bedford, Mass.) using the
H-phosphonate approach described in U.S. Pat. No. 5,149,798.
Deoxynucleoside H-phosphonates were obtained from Millipore
(Bedford, Mass.). 2'-O-methyl ribonucleotide H-phosphonates or
phosphorothioates were synthesized by standard procedures (see,
e.g., "Protocols for Oligonucleotides and Analogs" in Meth. Mol.
Biol. (1993) volume 20) or commercially obtained (e.g., from Glenn
Research, Sterling, Va. and Clontech, Palo Alto, Calif.). Segments
of oligonucleotides containing 2'-O-methyl nucleoside(s) were
assembled by using 2'-O-methyl ribonucleoside H-phosphonates or
phosphorothioates for the desired cycles. Similarly, segments of
oligonucleotides containing deoxyribonucleosides were assembled by
using deoxynucleoside H-phosphonates for the desired cycles. After
assembly, CPG bound oligonucleotide H-phosphonate was oxidized with
sulfur to generate the phosphorothioate linkage. Oligonucleotides
were then deprotected in concentrated NH.sub.4OH at 40.degree. C.
for 48 hours.
[0095] Crude oligonucleotide (about 500 A.sub.260 units) was
analyzed on reverse low pressure chromatography on a C.sub.18
reversed phase medium. The DMT group was removed by treatment with
80% aqueous acetic acid, then the oligonucleotides were dialyzed
against distilled water and lyophilized.
[0096] Chimeric oligonucleotide was prepared as described in Zhang
et al. (J. Pharmacol. Exptal. Thera. (1996) 278:(in press)). This
chimeric oligonucleotide had 3 methylphosphate internucleotide
linkages at the 5' end, 4 methylphosphonate internucleotide
linkages at the 3' end, and phosphorothioate internucleotide
linkages elsewhere in the molecule were prepared and purified as
follows. The first four couplings were carried out by using
nucleoside methyl-phosphoramidite, followed by oxidation with a
standard iodine reagent. The next seven couplings were carried out
by using nucleoside .beta.-cyanoethylphosphoramidite, followed by
oxidation with 3H-1,2-benzodithiole-3-one-1,1,-dioxide. The eighth
coupling was carried out by using nucleoside
.beta.-cyanoethylphosphorami- dite. After several washes with
acetonitrile, the column was removed from the machine, and
CPG-bound oligonucleotide was removed from the column and placed in
an Eppendorf tube (1.5 ml).
[0097] 2. Radioactive Labelling of Oligonucleotide
[0098] To obtain .sup.35S-labelled oligonucleotide, synthesis was
carried out in two steps. The first 19 nucleotides of the sequence
SEQ ID NO:1) from its 3'-end were assembled using the
.beta.-cyanoethyl-phosphoramidit- e approach (see, Beaucage in
Protocols for Oligonucleotides and Analogs (Agrawal, ed.), Humana
Press, (1993), pp. 33-61). The last six nucleotides were assembled
using the H-phosphonate approach (see, Froehler in Protocols for
Oligonucleotides and Analogs (Agrawal, ed.) Humana Press, 1993, pp.
63-80). Controlled pore glass (CPG) support-bound oligonucleotide
(30 mg of CPG; approximately 1 .mu.M) containing five H-phosphonate
linkage was oxidized with .sup.35S.sub.8 (4 mCi, 1 Ci/mg, Amersham;
1 Ci=37 GBq) in 60 ml carbon disulfide/pyridine/triethylamine
(10:10:1). The oxidation reaction was performed at room temperature
for 1 hr with occasional shaking. Then 2 .mu.l, 5 .mu.l, and 200
.mu.l of 5% cold sulfur (.sup.32 S.sub.8) in same solvent mixture
was added every 30 min to complete the oxidation. The solution was
removed and the CPG support was washed with carbon
disulfide/pyridine/triethylamine (10:10:1) (3.times.500 .mu.l) and
with acetonitrile (3.times.700 .mu.l). The product was deprotected
in concentrated ammonium hydroxide (55.degree. C., 14 hr) and
evaporated. The resultant product was purified by polyacrylamide
gel electrophoresis (20% polyacrylamide containing 7 M urea). The
desired band was excised under UV shadowing and the
PS-oligonucleotide was extracted from the gel and desalted with a
Sep-Pak C18 cartridge (Waters) and Sephadex G-15 column. The yield
was 20 A.sub.260 units (600 .mu.g; specific activity, 1
.mu.Ci/.mu.g).
[0099] To prepare .sup.35S-labelled chimeric oligonucleotide,
CPG-bound oligonucleotide was treated with a mixture of elemental
.sup.35S (4.5 mCi/mg atom, in 50 .mu.l of toluene; Amersham) in a
solution of carbon disulfide, pyridine and triethylamine (200
.mu.l, 200 .mu.l and 4 .mu.l, respectively) at 25.degree. C. for 1
hr. 3H-1,2-benzodithiole-3-one-1,1-d- ioxide (1 ml, 2% in
acetonitrile) was added, and the reaction mixture was allowed to
remain at 25.degree. C. for 10 min. The supernatant was removed and
the CPG-bound oligonucleotide was washed with CH.sub.3CN
(10.times.1 ml). After capping with acetic anhydride (300 .mu.l,
tetrahydrofuran-lutidine-acetic anhydride, 8:1:1) and
dimethylaminopyridine (300 .mu.l, 0.625% in pyridine), the
.sup.35S-CPG-bound oligonucleotide was washed with acetonitrile
(10.times.1 ml) and packed in the column. For the next eight
couplings, we used nucleoside .beta.-cyanoethylphosphoramidite
followed by oxidation with 3H-1,2-benzodithiole-3-one-1,1-dioxide.
The last four couplings were carried out by using nucleoside
methylphosphonamidite followed by oxidation with iodine reagent.
The crude CPG-bound 25mer chimeric oligonucleotide was treated with
concentrated ammonium hydroxide (28%, 3 ml) at 25.degree. C. for 2
hr. Evaporation on a Speed-Vac concentrator yielded a dried yellow
pellet as crude .sup.35S-labelled chimeric PS-oligonucleotide,
which was immediately treated with a solution of
ethylenediamine-ethanol-water (50:45:5, v/v/v/, 4 ml) for 4.5 hr at
25.degree. C. Purification by PAGE (20% polyacrylamide, 7 M urea)
gave pure .sup.35S-labeled chimeric oligonucleotide as a white
pellet (194 A.sub.260 units, 155 .mu.Ci, 180 .mu.Ci/mol). Other
chemicals and reagents used in the present study were of the
highest grade available.
[0100] 3. Animals and Treatment
[0101] Male Sprague-Dawley rats (110+/-10 g, Harlan Laboratories,
Indianapolis, Ind.) and male CD-/F2 mice (25.+-.3 g, Charles River
Laboratory, Wilmington, Mass.) were used in the study. The animals
were fed with commercial diet and water ad libitum for 1 week prior
to the study.
[0102] Unlabelled and .sup.35S-labelled oligonucleotides were
dissolved in physiological saline (0.9% NaCl) in a concentration of
25 mg/ml, and were administered to the fasted animals via gavage at
the designated dose (30-50 mg/kg for rats and 10 mg/kg for mice).
Doses were based on the pretreatment body weight and rounded to the
nearest 0.01 ml. After dosing, each animal was placed in a
metabolism cage and fed with commercial diet and water ad libitum.
Total voided urine was collected and each metabolism cage was then
washed following the collection intervals. Total excreted feces was
collected from each animal at various timepoints, and feces samples
were homogenized prior to quantitation of radioactivity. Blood
samples were collected in heparinized tubes from animals at the
various timepoints. Plasma was separated by centrifugation. Animals
were euthanized by exsanguination under sodium pentobarbital
anesthesia at various times (i.e., 1, 3, 6, 12, 24, and 48 hr; 3
animals/time point). Following euthanasia, the tissues were
collected from each animal. All tissues/organs were trimmed of
extraneous fat or connective tissue, emptied and cleaned of all
contents, individually weighed, and the weights recorded prior to
homogenization.
[0103] To quantitate the total absorption of the hybrid
oligonucleotide, two additional groups of animals (3 per group) for
each test oligonucleotide were treated using the same procedure as
above. Animals were killed at 6 or 12 hr post dosing, and the
gastrointestinal tract was then removed. Radioactivities in the
gastrointestinal tract, feces, urine, plasma, and the remainder of
the body were determined separately. Total recovery of
radioactivity was also determined to be 95.+-.6%. The percentage of
the absorbed hybrid oligonucleotide-derived radioactivity was
determined by the following calculation: 1 ( total radioactivity in
the remainder of the body + total radioactivity in urine ) ( total
radioactivity in the gastrointestinal tract , feces , urine ,
plasma , and the remainder of the body ) .times. 100 % .
[0104] 4. Total Radioactivity Measurements
[0105] The total radioactivities in tissues and body fluids were
determined by liquid scintillation spectrometry (LS 6000TA,
Beckman, Irvine, Calif.). In brief, biological fluids (plasma,
50-100 .mu.l; urine, 50-100 .mu.l) were mixed with 6 ml
scintillation solvent (Budget-Solve, RPI, Mt. Prospect, Ill.) to
determine total radioactivity. Feces were ground and weighed prior
to being homogenized in a 9-fold volume of 0.9% NaCl saline. An
aliquot of the homogenate (100 .mu.l) was mixed with solubilizer
(TS-2, RPI, Mt. Prospect, Ill.) and then with scintillation solvent
(6 ml) to permit quantitation of total radioactivity.
[0106] Following their removal, tissues were immediately blotted on
Whatman No. 1 filter paper and weighed prior to being homogenized
in 0.9% NaCl saline (3-5 ml per gram of wet weight). The resulting
homogenate (100 .mu.l) was mixed with solubilizer (TS-2, RPI, Mt.
Prospect, Ill.) and then with scintillation solvent (6 ml) to
determine total radioactivity. The volume of 0.9% NaCl saline added
to each tissue sample was recorded. The homogenized tissues/organs
were kept frozen at .ltoreq.-70.degree. C. until the use for
further analysis.
[0107] 5. HPLC Analysis
[0108] The radioactivity in urine was analyzed by paired-ion HPLC
using a modification of the method described essentially by Sands
et al. (Mol. Pharm. (1994) 45:932-943). Urine samples were
centrifuged and passed through a 0.2-.mu.m Acro filter (Gelman, Ann
Arbor, Mich.) prior to analysis. Hybrid oligonucleotide and
metabolites in plasma samples were extracted using the above
methods in sample preparation for PAGE. A Microsorb MV-C4 column
(Rainin Instruments, Woburn, Mass.) was employed in HPLC using a
Hewlett Packard 1050 HPLC with a quaternary pump for gradient
making. Mobile phase included two buffers; Buffer A was 5 mM-A
reagent (Waters Co., Bedford, Mass.) in water and Buffer B was 4:1
(v/v) Acetonitrile (Fisher)/water. The column was eluted at a flow
rate of 1.5 ml/min, using the following gradient: (1) 0-4 min, 0%
buffer B; (2) 4-15 min 0-35% Buffer B; and (3) 15-70 min 35%-80%
Buffer B. The column was equilibrated with Buffer A for at least 30
min prior to the next run. By using a RediFrac fraction collector
(Pharmacia LKB Biotechnology, Piscataway, N.J.), 1-min fractions
(1.5 ml) were collected into 7-ml scintillation vials and mixed
with 5 ml scintillation solvent to determine radioactivity in each
fraction.
[0109] 6. PAGE and Autoradiography
[0110] Plasma and tissue homogenates were incubated with proteinase
K (2 mg/ml) in extraction buffer (0.5% SDS/10 mM NaCl/20 mM
Tris-HCl, pH 7.6/10 mM EDTA) for 1 hr at 60.degree. C. The samples
were then extracted twice with phenol/chloroform (1:1, v/v) and
once with chloroform. After ethanol precipitation, the extracts
were analyzed by electrophoresis in 20% polyacrylamide gels
containing 7 M urea. Urine samples were filtered, desalted and then
analyzed by polyacrylamide gel electrophoresis (PAGE). The gels
were fixed in 10% acetic acid/10% methanol solution and then dried
before autoradiography.
[0111] Eouivalents
[0112] Those skilled in the art will recognize, or be able to
ascertain, using no more than routine experimentation, numerous
equivalents to the specific substances and procedures described
herein. Such equivalents are considered to be within the scope of
this invention, and are covered by the following claims.
Sequence CWU 1
1
21 1 25 DNA Artificial Sequence Antisense DNA/RNA 1 ctctcgcacc
catctctctc cttcu 25 2 25 DNA Artificial Sequence Antisense DNA/RNA
2 ctctcgcacc catctctctc ctucu 25 3 25 DNA Artificial Sequence
Antisense DNA/RNA 3 ctctcgcacc catctctctc cuucu 25 4 25 DNA
Artificial Sequence Antisense DNA/RNA 4 ctctcgcacc catctcucuc cuucu
25 5 25 DNA Artificial Sequence Antisense DNA/RNA 5 ctctcgcacc
caucucucuc cuucu 25 6 25 DNA Artificial Sequence Antisense DNA/RNA
6 ctctcgcacc caucucucuc cuucu 25 7 25 DNA Artificial Sequence
Antisense DNA/RNA 7 ctctcgcacc caucucucuc cuucu 25 8 25 RNA
Artificial Sequence Antisense 8 cucucgcacc caucucucuc cuucu 25 9 25
DNA Artificial Sequence Antisense DNA/RNA 9 cuctcgcacc catctctctc
cttcu 25 10 25 DNA Artificial Sequence Antisense DNA/RNA 10
cucucgcacc catctctctc cuucu 25 11 25 DNA Artificial Sequence
Antisense DNA/RNA 11 cucucgcacc catctcucuc cuucu 25 12 25 DNA
Artificial Sequence Antisense DNA/RNA 12 cucucgcacc caucucucuc
cuucu 25 13 25 DNA Artificial Sequence Antisense DNA/RNA 13
cucucgcacc catctctcuc cuucu 25 14 25 DNA Artificial Sequence
Antisense DNA/RNA 14 cucucgcacc cauctctctc cuucu 25 15 25 DNA
Artificial Sequence Antisense DNA/RNA 15 cucucgcacc catctctctc
cuucu 25 16 25 DNA Artificial Sequence Antisense DNA/RNA 16
cuctcgcacc caucucucuc cuucu 25 17 25 DNA Artificial Sequence
Antisense DNA/RNA 17 cuctcgcacc catctctcuc cuucu 25 18 25 DNA
Artificial Sequence Antisense 18 ctctcgcacc catctctctc cttct 25 19
22 DNA Artificial Sequence Antisense 19 ctctcgcacc catctctctc ct 22
20 18 DNA Artificial Sequence Antisense DNA/RNA 20 gcgugcctcc
tcacuggc 18 21 18 DNA Artificial Sequence Mismatched Control
DNA/RNA 21 gcaugcatcc gcacaggc 18
* * * * *