U.S. patent application number 10/352586 was filed with the patent office on 2003-10-02 for 2' -modified oligonucleotides.
This patent application is currently assigned to ISIS Pharmaceuticals, Inc.. Invention is credited to Cook, Phillip Dan, Kawasaki, Andrew Mamoru.
Application Number | 20030187240 10/352586 |
Document ID | / |
Family ID | 23858189 |
Filed Date | 2003-10-02 |
United States Patent
Application |
20030187240 |
Kind Code |
A1 |
Cook, Phillip Dan ; et
al. |
October 2, 2003 |
2' -modified oligonucleotides
Abstract
Compositions and methods are provided for the treatment and
diagnosis of diseases amenable to modulation of the production of
selected proteins. In accordance with preferred embodiments,
oligonucleotides and oligonucleotide analogs are provided which are
specifically hybridizable with a selected sequence of RNA or DNA
wherein at least one of the 2'-deoxyfuranosyl moieties of the
nucleoside unit is modified. Treatment of diseases caused by
various viruses and other causative agents is provided.
Inventors: |
Cook, Phillip Dan;
(Carlsbad, CA) ; Kawasaki, Andrew Mamoru;
(Oceanside, CA) |
Correspondence
Address: |
WOODCOCK WASHBURN LLP
ONE LIBERTY PLACE - 46TH FLOOR
PHILADELPHIA
PA
19103
US
|
Assignee: |
ISIS Pharmaceuticals, Inc.
|
Family ID: |
23858189 |
Appl. No.: |
10/352586 |
Filed: |
January 28, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10352586 |
Jan 28, 2003 |
|
|
|
09389283 |
Sep 2, 1999 |
|
|
|
6531584 |
|
|
|
|
09389283 |
Sep 2, 1999 |
|
|
|
08468037 |
Jun 6, 1995 |
|
|
|
5859221 |
|
|
|
|
08468037 |
Jun 6, 1995 |
|
|
|
07835932 |
Mar 5, 1992 |
|
|
|
5670633 |
|
|
|
|
07835932 |
Mar 5, 1992 |
|
|
|
07566977 |
Aug 13, 1990 |
|
|
|
07854634 |
Jul 1, 1992 |
|
|
|
07463358 |
Jan 11, 1990 |
|
|
|
07854634 |
Jul 1, 1992 |
|
|
|
07566977 |
Aug 13, 1990 |
|
|
|
Current U.S.
Class: |
536/23.1 |
Current CPC
Class: |
C12N 2310/3527 20130101;
C12N 2310/3533 20130101; C07H 21/04 20130101; C12N 2310/3533
20130101; C12N 2310/3523 20130101; C12N 2310/321 20130101; C07H
23/00 20130101; C12N 2310/3521 20130101; C12N 2310/3531 20130101;
C07J 43/003 20130101; C12N 2310/33 20130101; C12N 2310/3527
20130101; C12N 9/0069 20130101; C12N 15/113 20130101; C12N
2310/3125 20130101; C12N 2310/336 20130101; C12N 15/111 20130101;
C12Q 1/68 20130101; C12Y 113/11012 20130101; C07H 19/16 20130101;
C12N 2310/321 20130101; C07H 21/00 20130101; C12N 15/1137 20130101;
C07H 19/04 20130101; C12N 2310/321 20130101; C07H 19/10 20130101;
A61K 31/7125 20130101; C12N 2310/32 20130101; C12N 2310/333
20130101; C12N 2310/315 20130101; C07H 19/06 20130101; A61K 48/00
20130101; C12N 2310/3523 20130101; C12N 2310/11 20130101; A61K
38/00 20130101; C12N 2310/322 20130101; C12N 2310/322 20130101;
C07H 19/20 20130101 |
Class at
Publication: |
536/23.1 |
International
Class: |
C07H 021/02 |
Claims
What is claimed is:
1. A compound comprising a plurality of covalently-bound
nucleosides that individually include a ribose or deoxyribose sugar
portion and a base portion, wherein: said nucleosides are joined
together by internucleoside linkages such that the base portion of
said nucleosides form a mixed base sequence; at least one of said
nucleosides includes a modified ribofuranosyl moiety bearing a
2'-fluoro substituent; provided that at least two of said
nucleosides are 2-fluoro modified ribofuranosyl nucleosides when
said internucleoside linkages are phosphodiester linkages.
2. The compound of claim 1 having 5 to 50 nucleoside linked
nucleosides.
3. The compound of claim 1 wherein at least two of said nucleosides
are covalently bound through phosphorothioate, methyl phosphoate,
or phosphate alkylate internucleoside linkages.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 08/468,037, filed on Jun. 6, 1995, which is a
continuation-in-part of U.S. patent application Ser. No. 07/835,932
(now U.S. Pat. No. 5,670,633), filed Mar. 5, 1992 [which is the
U.S. national phase application of International application
PCT/US91/05720, filed Aug. 12, 1991 (now abandoned)], which is a
continuation-in-part of U.S. patent application Ser. No.
07/566,977, filed Aug. 13, 1990 (now abandoned). This application
is also a continuation-in-part of U.S. patent application Ser. No.
07/854,634 (now abandoned), filed Jul. 1, 1992 [which is the U.S.
national phase application of International application
PCT/US91/00243, filed Jan. 11, 1991 (now abandoned)], which is a
continuation-in-part of U.S. patent application Ser. No.
07/463,358, filed Jan. 11, 1990 (now abandoned), and U.S. patent
application Ser. No. 07/566,977, filed Aug. 13, 1990 (now
abandoned). Each of the above-mentioned applications is commonly
assigned with this application, and the entire disclosures of each
are herein incorporated by reference.
FIELD OF THE INVENTION
[0002] This invention is directed to nuclease resistant
oligonucleotides which are useful as therapeutics, diagnostics, and
research reagents. Sugar-modified oligonucleotides which are
resistant to nuclease degradation and are capable of modulating the
activity of DNA and RNA are provided.
BACKGROUND OF THE INVENTION
[0003] It has been recognized that oligonucleotides can be used to
modulate mRNA expression by a mechanism that involves the
complementary hybridization of relatively short oligonucleotides to
mRNA such that the normal, essential functions of these
intracellular nucleic acids are disrupted. Hybridization is the
sequence-specific base pair hydrogen bonding of an oligonucleotide
to a complementary RNA or DNA.
[0004] One deficiency of oligonucleotides for these purposes is
their susceptibility to enzymatic degradation by a variety of
ubiquitous nucleases which may be intracellularly and
extracellularly located. Unmodified, "wild type", oligonucleotides
are not useful as therapeutic agents because they are rapidly
degraded by nucleases. Therefore, modification of oligonucleotides
for conferring nuclease resistance on them has been a focus of
research directed towards the development of oligonucleotide
therapeutics and diagnostics.
[0005] In addition to nuclease stability, the ability of an
oligonucleotide to bind to a specific DNA or RNA with fidelity is a
further important factor.
[0006] The relative ability of an oligonucleotide to bind to
complementary nucleic acids is compared by determining the melting
temperature of a particular hybridization complex. The melting
temperature (T.sub.m), a characteristic physical property of double
helices, is the temperature (in .degree. C.) at which 50% helical
versus coil (unhybridized) forms are present. T.sub.m is measured
by using UV spectroscopy to determine the formation and breakdown
(melting) of hybridization. Base stacking, which occurs during
hybridization, is accompanied by a reduction in UV absorption
(hypochromicity). Consequently, a reduction in UV absorption
indicates a higher T.sub.m. The higher the T.sub.m the greater the
strength of the binding of the nucleic acid strands.
[0007] Therefore, oligonucleotides modified to exhibit resistance
to nucleases and to hybridize with appropriate strength and
fidelity to its targeted RNA (or DNA) are greatly desired for use
as research reagents, diagnostic agents and as oligonucleotide
therapeutics. Various 2'-substitutions have been introduced in the
sugar moiety of oligonucleotides. The nuclease resistance of these
compounds has been increased by the introduction of 2'-substituents
such as halo, alkoxy and allyloxy groups.
[0008] Ikehara et al. [European Journal of Biochemistry 139, 447
(1984)] have reported the synthesis of a mixed octamer containing
one 2'-deoxy-2'-fluoroguanosine residue or one
2'-deoxy-2'-fluoroadenine residue. Guschlbauer and Jankowski
[Nucleic Acids Res. 8, 1421 (1980)] have shown that the
contribution of the 3'-endo increases with increasing
electronegativity of the 2'-substituent. Thus,
2'-deoxy-2'-fluorouridine contains 85% of the C3'-endo
conformer.
[0009] Furthermore, evidence has been presented which indicates
that 2'-substituted-2'-deoxyadenosine polynucleotides resemble
double-stranded RNA rather than DNA. Ikehara et al. [Nucleic Acids
Res., 5, 3315 (1978)] have shown that a 2'-fluoro substituent in
poly A, poly I, or poly C duplexed to its complement is
significantly more stable than the ribonucleotide or
deoxyribonucleotide poly duplex as determined by standard melting
assays. Ikehara et al. [Nucleic Acids Res., 4, 4249 (1978)] have
shown that a 2'-chloro or bromo substituent in
poly(2'-deoxyadenylic acid) provides nuclease resistance. Eckstein
et al. [Biochemistry, 11, 4336 (1972)] have reported that
poly(2'-chloro-2'-deoxyuridylic acid) and
poly(2'-chloro-2'-deoxycytidyli- c acid) are resistant to various
nucleases. Inoue et al. [Nucleic Acids Research, 15, 6131 (1987)]
have described the synthesis of mixed oligonucleotide sequences
containing 2'-OMe substituents on every nucleotide. The mixed
2'-OMe-substituted oligonucleotide hybridized to its RNA complement
as strongly as the RNA-RNA duplex which is significantly stronger
than the same sequence RNA-DNA heteroduplex (T.sub.ms, 49.0 and
50.1 versus 33.0 degrees for nonamers). Shibahara et al. [Nucleic
Acids Research, 17, 239 (1987)] have reported the synthesis of
mixed oligonucleotides containing 2'-OMe substituents on every
nucleotide. The mixed 2'-OMe-substituted oligonucleotides were
designed to inhibit HIV replication.
[0010] It is believed that the composite of the hydroxyl group's
steric effect, its hydrogen bonding capabilities, and its
electronegativity versus the properties of the hydrogen atom is
responsible for the gross structural difference between RNA and
DNA. Thermal melting studies indicate that the order of duplex
stability (hybridization) of 2'-methoxy oligonucleotides is in the
order of RNA-RNA>RNA-DNA>DNA-DNA.
[0011] U.S. Pat. No. 5,013,830, issued May 7, 1991, discloses mixed
oligonucleotides comprising an RNA portion, bearing 2'-O-alkyl
substituents, conjugated to a DNA portion via a phosphodiester
linkage. However, being phosphodiesters, these oligonucleotides are
susceptible to nuclease cleavage.
[0012] European Patent application 339,842, filed Apr. 13, 1989,
discloses 2'-O-substituted phosphorothioate oligonucleotides,
including 2'-O-methylribooligonucleotide phosphorothioate
derivatives. This application also discloses 2'-O-methyl
phosphodiester oligonucleotides which lack nuclease resistance.
[0013] European Patent application 260,032, filed Aug. 27, 1987,
discloses oligonucleotides having 2'-O-methyl substituents on the
sugar moiety. This application also makes mention of other
2'-O-alkyl substituents, such as ethyl, propyl and butyl
groups.
[0014] International Publication Number WO 91/06556, published May
16, 1991, discloses oligomers derivatized at the 2' position with
substituents, which are stable to nuclease activity. Specific
2'-O-substituents which were incorporated into oligonucleotides
include ethoxycarbonylmethyl (ester form), and its acid, amide and
substituted amide forms.
[0015] European Patent application 399,330, filed May 15, 1990,
discloses nucleotides having 2'-O-alkyl substituents.
[0016] International Publication Number WO 91/15499, published Oct.
17, 1991, discloses oligonucleotides bearing 2'-O-alkyl, -alkenyl
and -alkynyl substituents.
[0017] It has been recognized that nuclease resistance of
oligonucleotides and fidelity of hybridization are of great
importance in the development of oligonucleotide therapeutics.
Oligonucleotides possessing nuclease resistance are also desired as
research reagents and diagnostic agents.
BRIEF DESCRIPTION OF THE INVENTION
[0018] In accordance with the present invention, compositions which
are resistant to nuclease degradation and those that modulate the
activity of DNA and RNA are provided. These compositions are
comprised of sugar-modified oligonucleotides, which are
specifically hybridizable with preselected nucleotide sequences of
single-stranded or double-stranded target DNA or RNA. The
sugar-modified oligonucleotides recognize and form double strands
with single-stranded DNA and RNA.
[0019] The nuclease resistant oligonucleotides of the present
invention consist of a single strand of nucleic acid bases linked
together through linking groups. The oligonucleotides of this
invention may range in length from about 5 to about 50 nucleic acid
bases. However, in accordance with a preferred embodiment of this
invention, a sequence of about 12 to 25 bases in length is
optimal.
[0020] The individual nucleotides of the oligonucleotides of the
present invention are connected via phosphorus linkages. Preferred
phosphorous linkages include phosphodiester, phosphorothioate and
phosphorodithioate linkages, with phosphodiester and
phosphorothioate linkages being particularly preferred.
[0021] Preferred nucleobases of the invention include adenine,
guanine, cytosine, uracil, thymine, xanthine, hypoxanthine,
2-aminoadenine, 6-methyl, 2-propyl and other alkyl adenines, 5-halo
uracil, 5-halo cytosine, 6-aza uracil, 6-aza cytosine and 6-aza
thymine, pseudo uracil, 4-thiouracil, 8-halo adenine,
8-aminoadenine, 8-thiol adenine, 8-thiolalkyl adenines, 8-hydroxyl
adenine and other 8-substituted adenines, 8-halo guanines, 8-amino
guanine, 8-thiol guanine, 8-thiolalkyl guanines, 8-hydroxyl guanine
and other 8-substituted guanines, other aza and deaza uracils,
other aza and deaza thymidines, other aza and deaza cytosines,
other aza and deaza adenines, other aza and deaza guanines,
5-trifluoromethyl uracil and 5-trifluoro cytosine.
[0022] In accordance with this invention at least one of the
2'-deoxyribofuranosyl moiety of at least one of the nucleosides of
an oligonucleotide is modified. A halo, alkoxy, aminoalkoxy, alkyl,
azido, or amino group may be added. For example, F, CN, CF.sub.3,
OCF.sub.3, OCN, O-alkyl, S-alkyl, SMe, SO.sub.2Me, ONO.sub.2,
NO.sub.2, NH.sub.3, NH.sub.2, NH-alkyl, OCH.sub.2CH.dbd.CH.sub.2
(allyloxy), OCH.sub.3.dbd.CH.sub.2, OCCH, where alkyl is a straight
or branched chain of C.sub.1 to C.sub.20, with unsaturation within
the carbon chain.
[0023] The present invention also includes oligonucleotides formed
from a plurality of linked-.beta.-nucleosides including
2'-deoxy-erythro-pentofu- ranosyl-.beta.-nucleosides. These
nucleosides are connected by charged phosphorus linkages in a
sequence that is specifically hybridizable with a complementary
target nucleic acid. The sequence of linked nucleosides is divided
into at least two subsequences. The first subsequence includes
.beta.-nucleosides, having 2'-substituents, linked by charged 3'-5'
phosphorous linkages. The second subsequence consists of
2'-deoxy-erythro-pentofuranosyl-.beta.-nucleosides linked by
charged 3'-5' phosphorous linkages bearing a negative charge at
physiological pH. In further preferred embodiments there exists a
third subsequence whose nucleosides are selected from those
selectable for the first subsequence. In preferred embodiments the
second subsequence is positioned between the first and third
subsequences. Such oligonucleotides of the present invention are
also referred to as "chimeric" or "gapped" oligonucleotides, or
"chimeras."
[0024] The resulting novel oligonucleotides of the invention are
resistant to nuclease degradation and exhibit hybridization
properties of higher quality relative to wild-type DNA-DNA and
RNA-DNA duplexes and phosphorus-modified oligonucleotide duplexes
containing methylphosphonates, phophoramidates and phosphate
triesters.
[0025] The invention is also directed to methods for modulating the
production of a protein by an organism comprising contacting the
organism with a composition formulated in accordance with the
foregoing considerations. It is preferred that the RNA or DNA
portion which is to be modulated be preselected to comprise that
portion of DNA or RNA which codes for the protein whose formation
is to be modulated. Therefore, the oligonucleotide to be employed
is designed to be specifically hybridizable to the preselected
portion of target DNA or RNA.
[0026] This invention is also directed to methods of treating an
organism having a disease characterized by the undesired production
of a protein. This method comprises contacting the organism with a
composition in accordance with the foregoing considerations. The
composition is preferably one which is designed to specifically
bind with mRNA which codes for the protein whose production is to
be inhibited.
[0027] The invention further is directed to diagnostic methods for
detecting the presence or absence of abnormal RNA molecules, or
abnormal or inappropriate expression of normal RNA molecules in
organisms or cells.
[0028] The invention is also directed to methods for the selective
binding of RNA for use as research reagents and diagnostic agents.
Such selective and strong binding is accomplished by interacting
such RNA or DNA with oligonucleotides of the invention which are
resistant to degradative nucleases and which display greater
fidelity of hybridization than any other known oligonucleotide.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] FIG. 1 is a graph showing dose response activity of
oligonucleotides of the invention and a reference compound.
[0030] FIG. 2 is a bar chart showing dose response activity of
oligonucleotides of the invention and reference compounds.
[0031] FIG. 3 is a bar graph showing the effects of several
2'-O-methyl chimeric oligonucleotides on PKC-.alpha. mRNA levels.
Hatched bars represent the 8.5 kb transcript, and plain bars
represent the 4.0 kb transcript.
[0032] FIG. 4 is a bar graph showing the effects of several
2'-O-methyl and 2'-O-propyl chimeric oligonucleotides on
PKC-.alpha. mRNA levels. Hatched bars represent the 8.5 kb
transcript, and plain bars represent the 4.0 kb transcript.
[0033] FIG. 5 is a bar graph showing the effects of additional
2'-O-methyl and 2'-O-propyl chimeric oligonucleotides on
PKC-.alpha. mRNA levels. Hatched bars represent the 8.5 kb
transcript, and plain bars represent the 4.0 kb transcript.
[0034] FIG. 6 is a graph showing mouse plasma concentrations of a
control compound and two of the compounds of the invention. The
plasma concentration is plotted verses time.
[0035] FIG. 7 is a three dimensional graph showing distribution of
a control compound among various tissue in the mouse. Specific
tissues are shown on one axis, time on a second axis and percent of
dose on the third axis. The compound was delivered by intravenous
injected.
[0036] FIG. 8 is a three dimensional graph showing distribution of
a compound of the invention among various tissue in the mouse.
Specific tissues are shown on one axis, time on a second axis and
percent of dose on the third axis. The compound was delivered by
intravenous injected.
[0037] FIG. 9 is a three dimensional graph showing distribution of
a further compound of the invention among various tissue in the
mouse. Specific tissues are shown on one axis, time on a second
axis and percent of dose on the third axis. The compound was
delivered by intravenous injected.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
[0038] The compositions useful for modulating the activity of an
RNA or DNA molecule in accordance with this invention generally
comprise a sugar-modified oligonucleotide which is specifically
hybridizable with a preselected nucleotide sequence of a
single-stranded or double-stranded target DNA or RNA molecule, and
which is nuclease resistant.
[0039] It is generally desirable to select a sequence of DNA or RNA
which is involved in the production of a protein whose synthesis is
ultimately to be modulated or inhibited in its entirety. The
oligonucleotides of the invention are conveniently synthesized
using solid phase synthesis of known methodology, and is designed
to be complementary to or specifically hybridizable with the
preselected nucleotide sequence of the target RNA or DNA. Nucleic
acid synthesizers are commercially available and their use is
understood by persons of ordinary skill in the art as being
effective in generating any desired oligonucleotide of reasonable
length.
[0040] The oligonucleotides of the invention also include those
that comprise nucleosides connected by charged linkages, and whose
sequences are divided into at least two subsequences. The first
subsequence includes 2'-substituted-nucleosides linked by a first
type of linkage. The second subsequence includes nucleosides linked
by a second type of linkage. In a preferred embodiment there exists
a third subsequence whose nucleosides are selected from those
selectable for the first subsequence, and the second subsequence is
positioned between the first and the third subsequences. Such
oligonucleotides of the invention are known as "chimeras," or
"chimeric" or "gapped" oligonucleotides.
[0041] In the context of this invention, the term "oligonucleotide"
refers to a plurality of nucleotides joined together in a specific
sequence from naturally and non-naturally occurring nucleobases.
Preferred nucleobases of the invention are joined through a sugar
moiety via phosphorus linkages, and include adenine, guanine,
adenine, cytosine, uracil, thymine, xanthine, hypoxanthine,
2-aminoadenine, 6-methyl, 2-propyl and other alkyl adenines, 5-halo
uracil, 5-halo cytosine, 6-aza uracil, 6-aza cytosine and 6-aza
thymine, pseudo uracil, 4-thiouracil, 8-halo adenine,
8-aminoadenine, 8-thiol adenine, 8-thiolalkyl adenines, 8-hydroxyl
adenine and other 8-substituted adenines, 8-halo guanines, 8-amino
guanine, 8-thiol guanine, 8-thiolalkyl guanines, 8-hydroxyl guanine
and other 8-substituted guanines, other aza and deaza uracils,
other aza and deaza thymidines, other aza and deaza cytosines,
other aza and deaza adenines, other aza and deaza guanines,
5-trifluoromethyl uracil and 5-trifluoro cytosine. The sugar moiety
may be deoxyribose or ribose. The oligonucleotides of the invention
may also comprise modified nucleobases or nucleobases having other
modifications consistent with the spirit of this invention, and in
particular modifications that increase their nuclease resistance in
order to facilitate their use as therapeutic, diagnostic or
research reagents.
[0042] The oligonucleotides of the present invention are about 5 to
about 50 bases in length. It is more preferred that the
oligonucleotides of the invention have from 8 to about 40 bases,
and even more preferred that from about 12 to about 25 bases be
employed.
[0043] It is desired that the oligonucleotides of the invention be
adapted to be specifically hybridizable with the nucleotide
sequence of the target RNA or. DNA selected for modulation.
Oligonucleotides particularly suited for the practice of one or
more embodiments of the present invention comprise 2'-sugar
modified oligonucleotides wherein one or more of the 2'-deoxy
ribofuranosyl moieties of the nucleoside is modified with a halo,
alkoxy, aminoalkoxy, alkyl, azido, or amino group. For example, the
substitutions which may occur include F, CN, CF.sub.3, OCF.sub.3,
OCN, O-alkyl, S-alkyl, SMe, SO.sub.2Me, ONO.sub.2, NO.sub.2,
NH.sub.3, NH.sub.2, NH-alkyl, OCH.sub.3.dbd.CH.sub.2 and OCCH. In
each of these, alkyl is a straight or branched chain of C.sub.1 to
C.sub.20, having unsaturation within the carbon chain. A preferred
alkyl group is C.sub.1-C.sub.9 alkyl. A further preferred alkyl
group is C.sub.5-C.sub.20 alkyl.
[0044] A first preferred group of substituents include
2'-deoxy-2'-fluoro substituents. A further preferred group of
substituents include C.sub.1-C.sub.20 alkoxyl substituents. An
additional preferred group of substituents include cyano,
fluoromethyl, thioalkoxyl, fluoroalkoxyl, alkylsulfinyl,
alkylsulfonyl, allyloxy and alkeneoxy substituents.
[0045] In further embodiments of the present invention, the
individual nucleotides of the oligonucleotides of the invention are
connected via phosphorus linkages. Preferred phosphorus linkages
include phosphodiester, phosphorothioate and phosphorodithioate
linkages. In one preferred embodiment of this invention, nuclease
resistance is conferred on the oligonucleotides by utilizing
phosphorothioate internucleoside linkages.
[0046] In further embodiments of the invention, nucleosides can be
joined via linkages that substitute for the internucleoside
phosphate linkage. Macromolecules of this type have been identified
as oligonucleosides. The term "oligonucleoside" thus refers to a
plurality of nucleoside units joined by non-phosphorus linkages. In
such oligonucleosides the linkages include an
--O--CH.sub.2--CH.sub.2--O-- linkage (i.e., an ethylene glycol
linkage) as well as other novel linkages disclosed in U.S. Pat. No.
5,223,618, issued Jun. 29, 1993, U.S. Pat. No. 5,378,825, issued
Jan. 3, 1995 and U.S. patent application Ser. No. 08/395,168, filed
Feb. 27, 1995. Other modifications can be made to the sugar, to the
base, or to the phosphate group of the nucleotide. Representative
modifications are disclosed in International Publication Numbers WO
91/10671, published Jul. 25, 1991, WO 92/02258, published Feb. 20,
1992, WO 92/03568, published Mar. 5, 1992, and U.S. Pat. No.
5,138,045, issued Aug. 11, 1992, all assigned to the assignee of
this application. The disclosures of each of the above referenced
publications are herein incorporated by reference.
[0047] In the context of this invention, "hybridization" shall mean
hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary nucleotides. For
example, adenine and thymine are complementary nucleobases which
pair through the formation of hydrogen bonds. "Complementary," as
used herein, also refers to sequence complementarity between two
nucleotides. For example, if a nucleotide at a certain position of
an oligonucleotide is capable of hydrogen bonding with a nucleotide
at the same position of a DNA or RNA molecule, then the
oligonucleotide and the DNA or RNA are considered to be
complementary to each other at that position. The oligonucleotide
and the DNA or RNA are complementary to each other when a
sufficient number of corresponding positions in each molecule are
occupied by nucleotides which can hydrogen bond with each other.
Thus, "specifically hybridizable" and "complementary" are terms
which are used to indicate a sufficient degree of complementarity
such that stable and specific binding occurs between the
oligonucleotide and the DNA or RNA target. It is understood that an
oligonucleotide need not be 100% complementary to its target DNA
sequence to be specifically hybridizable. An oligonucleotide is
specifically hybridizable when binding of the oligonucleotide to
the target DNA or RNA molecule interferes with the normal function
of the target DNA or RNA, and there is a sufficient degree of
complementarity to avoid non-specific binding of the
oligonucleotide to non-target sequences under conditions in which
specific binding is desired, i.e. under physiological conditions in
the case of in vivo assays or therapeutic treatment, or in the case
of in vitro assays, under conditions in which the assays are
performed.
[0048] Cleavage of oligonucleotides by nucleolytic enzymes require
the formation of an enzyme-substrate complex, or in particular a
nuclease-oligonucleotide complex. The nuclease enzymes will
generally require specific binding sites located on the
oligonucleotides for appropriate attachment. If the oligonucleotide
binding sites are removed or blocked, such that nucleases are
unable to attach to the oligonucleotides, the oligonucleotides will
be nuclease resistant. In the case of restriction endonucleases
that cleave sequence-specific palindromic double-stranded DNA,
certain binding sites such as the ring nitrogen in the 3- and
7-positions have been identified as required binding sites. Removal
of one or more of these sites or sterically blocking approach of
the nuclease to these particular positions within the
oligonucleotide has provided various levels of resistance to
specific nucleases.
[0049] This invention provides oligonucleotides possessing superior
hybridization properties. Structure-activity relationship studies
have revealed that an increase in binding (T.sub.m) of certain
2'-sugar modified oligonucleotides to an RNA target (complement)
correlates with an increased "A" type conformation of the
heteroduplex. Furthermore, absolute fidelity of the modified
oligonucleotides is maintained. Increased binding of 2'-sugar
modified sequence-specific oligonucleotides of the invention
provides superior potency and specificity compared to
phosphorus-modified oligonucleotides such as methyl phosphonates,
phosphate triesters and phosphoramidates as known in the
literature.
[0050] The only structural difference between DNA and RNA duplexes
is a hydrogen atom at the 2'-position of the sugar moiety of a DNA
molecule versus a hydroxyl group at the 2'-position of the sugar
moiety of an RNA molecule (assuming that the presence or absence of
a methyl group in the uracil ring system has no effect). However,
gross conformational differences exist between DNA and RNA
duplexes.
[0051] It is known from X-ray diffraction analysis of nucleic acid
fibers [Arnott and Hukins, Biochemical and Biophysical Research
Communication, 47, 1504-1510 (1970)] and analysis of crystals of
double-stranded nucleic acids that DNA takes a "B" form structure
and RNA takes the more rigid "A" form structure. The difference
between the sugar puckering (C2' endo for "B" form DNA and C3' endo
for "A" form RNA) of the nucleosides of DNA and RNA is the major
conformational difference between double-stranded nucleic
acids.
[0052] The primary contributor to the conformation of the
pentofuranosyl moiety is the nature of the substituent at the
2'-position. Thus, the population of the C3'-endo form increases
with respect to the C2'-endo form as the electronegativity of the
2'-substituent increases. For example, among
2'-deoxy-2'-haloadenosines, the 2'-fluoro derivative exhibits the
largest population (65%) of the C3'-endo form, and the 2'-iodo
exhibits the lowest population (7%). Those of adenosine (2'-OH) and
deoxyadenosine (2'-H) are 36% and 19%, respectively. Furthermore,
the effect of the 2'-fluoro group of adenosine dimers
(2'-deoxy-2'-fluoroaden- osine-2'-deoxy-2'-fluoroadenosine) is
further correlated to the stabilization of the stacked
conformation. Research indicates that dinucleoside phosphates have
a stacked conformation with a geometry similar to that of A-A but
with a greater extent of base-base overlapping than A-A. It is
assumed that the highly polar nature of the C2'-F bond and the
extreme preference for C3'-endo puckering may stabilize the stacked
conformation in an "A" structure.
[0053] Data from UV hypochromicity, circular dichromism, and
.sup.1H NMR also indicate that the degree of stacking decreases as
the electronegativity of the halo substituent decreases.
Furthermore, steric bulk at the 2'-position of the sugar moiety is
better accommodated in an "A" form duplex than a "B" form
duplex.
[0054] Thus, a 2'-substituent on the 3'-nucleotidyl unit of a
dinucleoside monophosphate is thought to exert a number of effects
on the stacking conformation: steric repulsion, furanose puckering
preference, electrostatic repulsion, hydrophobic attraction, and
hydrogen bonding capabilities. These substituent effects are
thought to be determined by the molecular size, electronegativity,
and hydrophobicity of the substituent.
[0055] The 2'-iodo substituted nucleosides possess the lowest
C3'-endo population (7%) of the halogen series. Thus, based solely
on steric effects, one would predict that a 2'-iodo (or other
similar group) would contribute stacking destabilization
properties, and thus reduced binding (T.sub.m) of the
oligonucleotides. However, the lower electronegativity and high
hydrophobicity of the iodine atom (or another similar group)
complicates the ability to predict stacking stabilities and binding
strengths.
[0056] Studies with a 2'-OMe modification of 2'-deoxy guanosine,
cytidine, and uridine dinucleoside phosphates exhibit enhanced
stacking effects with respect to the corresponding unmethylated
species (2'-OH). In this case, the hydrophobic attractive forces of
the methyl group tend to overcome the destablilizing effects of its
steric bulk.
[0057] 2'-Fluoro-2'-deoxyadenosine has been determined to have an
unusually high population of 3'-endo puckered form among
nucleosides. Adenosine, 2'-deoxyadenosine and other derivatives
have less than 40% of their population in the 3'-endo conformation.
It is known that a nucleoside residue in well-stacked
oligonucleotides favors 3'-endo ribofuranose puckering.
[0058] Melting temperatures (complementary binding) are increased
with the 2'-substituted adenosine diphosphates. It is not clear
whether the 3'-endo preference of the conformation or the presence
of the substituent is responsible for the increased binding.
However, greater overlap of adjacent bases (stacking) can be
achieved with the 3'-endo conformation.
[0059] Compounds of the invention can be utilized as diagnostics,
therapeutics and as research reagents and kits. They can be
utilized in pharmaceutical compositions by adding an effective
amount of an oligonucleotide of the invention to a suitable
pharmaceutically acceptable diluent or carrier. They further can be
used for treating organisms having a disease characterized by the
undesired production of a protein. The organism can be contacted
with an oligonucleotide of the invention having a sequence that is
capable of specifically hybridizing with a strand of target nucleic
acid that codes for the undesirable protein.
[0060] The formulation of therapeutic compositions and their
subsequent administration is believed to be within the skill of
those in the art. In general, for therapeutics, a patient in need
of such therapy is administered an oligomer in accordance with the
invention, commonly in a pharmaceutically acceptable carrier, in
doses ranging from 0.01 .mu.g to 100 g per kg of body weight
depending on the age of the patient and the severity of the disease
state being treated. Further, the treatment may be a single dose or
may be a regimen that may last for a period of time which will vary
depending upon the nature of the particular disease, its severity
and the overall condition of the patient, and may extend from once
daily to once every 20 years. Following treatment, the patient is
monitored for changes in his/her condition and for alleviation of
the symptoms of the disease state. The dosage of the oligomer may
either be increased in the event the patient does not respond
significantly to current dosage levels, or the dose may be
decreased if an alleviation of the symptoms of the disease state is
observed, or if the disease state has been ablated.
[0061] In some cases it may be more effective to treat a patient
with an oligomer of the invention in conjunction with other
traditional therapeutic modalities. For example, a patient being
treated for AIDS may be administered an oligomer in conjunction
with AZT, or a patient with atherosclerosis may be treated with an
oligomer of the invention following angioplasty to prevent
reocclusion of the treated arteries.
[0062] Dosing is dependent on severity and responsiveness of the
disease condition to be treated, with the course of treatment
lasting from several days to several months, or until a cure is
effected or a diminution of disease state is achieved. Optimal
dosing schedules can be calculated from measurements of drug
accumulation in the body of the patient. Persons of ordinary skill
can easily determine optimum dosages, dosing methodologies and
repetition rates. Optimum dosages may vary depending on the
relative potency of individual oligomers, and can generally be
estimated based on EC.sub.50s found to be effective in in vitro and
in vivo animal models. In general, dosage is from 0.01 .mu.g to 100
g per kg of body weight, and may be given once or more daily,
weekly, monthly or yearly, or even once every 2 to several
years.
[0063] Following successful treatment, it may be desirable to have
the patient undergo maintenance therapy to prevent the recurrence
of the disease state, wherein the oligomer is administered in
maintenance doses, ranging from 0.01 .mu.g to 100 g per kg of body
weight, once or more daily, to once every several years.
[0064] The pharmaceutical compositions of the present invention may
be administered in a number of ways depending upon whether local or
systemic treatment is desired and upon the area to be treated.
Administration may be topical (including ophthalmic, vaginal,
rectal, intranasal, transdermal), oral or parenteral. Parenteral
administration includes intravenous drip, subcutaneous,
intraperitoneal or intramuscular injection, or intrathecal or
intraventricular administration.
[0065] Formulations for topical administration may include
transdermal patches, ointments, lotions, creams, gels, drops,
suppositories, sprays, liquids and powders. Conventional
pharmaceutical carriers, aqueous, powder or oily bases, thickeners
and the like may be necessary or desirable. Coated condoms, gloves
and the like may also be useful.
[0066] Compositions for oral administration include powders or
granules, suspensions or solutions in water or non-aqueous media,
capsules, sachets or tablets. Thickeners, flavoring agents,
diluents, emulsifiers, dispersing aids or binders may be
desirable.
[0067] Compositions for intrathecal or intraventricular
administration may include sterile aqueous solutions which may also
contain buffers, diluents and other suitable additives.
[0068] Formulations for parenteral administration may include
sterile aqueous solutions which may also contain buffers, diluents
and other suitable additives.
[0069] The present invention can be practiced in a variety of
organisms ranging from unicellular prokaryotic and eukaryotic
organisms to multicellular eukaryotic organisms. Any organism that
utilizes DNA-RNA transcription or RNA-protein translation as a
fundamental part of its hereditary, metabolic or cellular machinery
is susceptible to such therapeutic and/or prophylactic treatment.
Seemingly diverse organisms such as bacteria, yeast, protozoa,
algae, plant and higher animal forms, including warm-blooded
animals, can be treated in this manner. Further, since each of the
cells of multicellular eukaryotes also includes both DNA-RNA
transcription and RNA-protein translation as an integral part of
their cellular activity, such therapeutics and/or diagnostics can
also be practiced on such cellular populations. Furthermore, many
of the organelles, e.g. mitochondria and chloroplasts, of
eukaryotic cells also include transcription and translation
mechanisms. As such, single cells, cellular populations or
organelles also can be included within the definition of organisms
that are capable of being treated with the therapeutic or
diagnostic oligonucleotides of the invention. As used herein,
therapeutics is meant to include both the eradication of a disease
state, killing of an organism, e.g. bacterial, protozoan or other
infection, or control of aberrant or undesirable cellular growth or
expression.
[0070] The present novel approach to obtaining stronger binding is
to prepare RNA mimics that bind to target RNA. Therefore, a random
structure-activity relationship approach was undertaken to discover
nuclease resistant oligonucleotides that maintain appropriate
hybridization properties.
[0071] A series of 2'-deoxy-2'-modified nucleosides of adenine,
guanine, cytosine, thymidine and certain analogs of these
nucleobases have been prepared and incorporated into
oligonucleotides via solid phase nucleic acid synthesis. These
novel oligonucleotides were assayed for their hybridization
properties and their ability to resist degradation by nucleases
compared to the unmodified oligonucleotides. Initially, small
electronegative atoms or groups were selected because they would
not be expected to sterically interfere with required Watson-Crick
base pair hydrogen bonding (hybridization). However, electronic
changes due to the electronegativity of the atom or group in the
2'-position may profoundly affect the sugar conformation.
Structure-activity relationship studies revealed that the
sugar-modified oligonucleotides hybridized to the target RNA more
strongly than the unmodified 2'-deoxy oligonucleotides.
[0072] 2'-Substituted oligonucleotides were synthesized by standard
solid phase nucleic acid synthesis using an automated synthesizer
such as Model 380B (Perkin-Elmer/Applied Biosystems) or
MilliGen/Biosearch 7500 or 8800. Triester, phosphoramidite, or
hydrogen phosphonate coupling chemistries [Oligonucleotides.
Antisense Inhibitors of Gene Expression. M. Caruthers, p. 7, J. S.
Cohen (Ed.), CRC Press, Boca Raton, Fla., 1989] are used with these
synthesizers to provide the desired oligonucleotides. The Beaucage
reagent [J. Amer. Chem. Soc., 112, 1253 (1990)] or elemental sulfur
[Beaucage et al., Tet. Lett., 22, 1859 (1981)] is used with
phosphoramidite or hydrogen phosphonate chemistries to provide
2'-substituted phosphorothioate oligonucleotides.
[0073] The requisite 2'-substituted nucleosides (A, G, C, T(U), and
other modified nucleobases) were prepared by modification of
several literature procedures as described below.
[0074] Procedure 1. Nucleophilic Displacement of 2'-Leaving Group
in Arabino Purine Nucleosides. Nucleophilic displacement of a
leaving group in the 2'-up position (2'-deoxy-2'-(leaving
group)arabino sugar) of adenine or guanine or their analog
nucleosides. General synthetic procedures of this type have been
described by Ikehara et al., Tetrahedron, 34, 1133 (1978); ibid.,
31, 1369 (1975); Chemistry and Pharmaceutical Bulletin, 26, 2449
(1978); ibid., 26, 240 (1978); Ikehara, Accounts of Chemical
Research, 2, 47 (1969); and Ranganathan, Tetrahedron Letters, 15,
1291 (1977).
[0075] Procedure 2. Nucleophilic Displacement of 2,2'-Anhydro
Pyrimidines. Nucleosides thymine, uracil, cytosine or their analogs
are converted to 2'-substituted nucleosides by the intermediacy of
2,2'-cycloanhydro nucleoside as described by Fox et al., Journal of
Organic Chemistry, 29, 558 (1964).
[0076] Procedure 3. 2'-Coupling Reactions. Appropriately
3',5'-sugar and base protected purine and pyrimidine nucleosides
having a unprotected 2'-hydroxyl group are coupled with
electrophilic reagents such as methyl iodide and diazomethane to
provide the mixed sequences containing a 2'-OMe group H. Inoue et
al., Nucleic Acids Research, 15, 6131.
[0077] Procedure 4. 2-Deoxy-2-substituted Ribosylations.
2-Substituted-2-deoxyribosylation of the appropriately protected
nucleic acid bases and nucleic acids base analogs has been reported
by Jarvi et al., Nucleosides & Nucleotides, 8, 1111-1114 (1989)
and Hertel et al., Journal of Organic Chemistry, 53, 2406
(1988).
[0078] Procedure 5. Enzymatic Synthesis of 2'-Deoxy-2'-Substituted
Nucleosides. The 2-Deoxy-2-substituted glycosyl transfer from one
nucleoside to another with the aid of pyrimidine and purine ribo or
deoxyribo phosphorolyses has been described by Rideout and
Krenitsky, U.S. Pat. No. 4,381,344 (1983).
[0079] Procedure 6. Conversion of 2'-Substituents Into New
Substituents. 2'-Substituted-2'-deoxynucleosides are converted into
new substituents via standard chemical manipulations. For example,
Chladek et al. [Journal of Carbohydrates, Nucleosides &
Nucleotides, 7, 63 (1980)] describes the conversion of
2'-deoxy-2'-azidoadenosine, prepared from arabinofuranosyladenine,
into 2'-deoxy-2'-aminoadenosine.
[0080] Procedure 7. Free Radical Reactions. Conversions of halogen
substituted nucleosides into 2'-deoxy-2'-substituted nucleosides
via free radical reactions has been described by Parkes and Taylor
[Tetrahedron Letters, 29, 2995 (1988)].
[0081] Procedure 8. Conversion of Ribonucleosides to
2'-Deoxy-2'-Substituted Nucleoside. Appropriately 3',5'-sugar and
base protected purine and pyrimidine nucleosides having a
unprotected 2'-hydroxyl group are converted to
2'-deoxy-2'-substituted nucleosides by the process of oxidation to
the 2'-keto group, reaction with nucleophilic reagents , and
finally 2'-deoxygenation. Procedures of this type have been
described by De las Heras, et al. [Tetrahedron Letters, 29, 941
(1988)].
[0082] Procedure 9. In one process of the invention, 2'-deoxy
substituted guanosine compounds are prepared via an
(arabinofuranosyl)guanine intermediate obtained via an
oxidation-reduction reaction. A leaving group at the 2' position of
the arabinofuranosyl sugar moiety of the intermediate arabino
compound is displaced via an SN.sub.2 reaction with an appropriate
nucleophile. This procedure thus incorporates principles of both
Procedure 1 and Procedure 8 above. 2'-Deoxy-2'-fluoroguanosine is
preferably prepared via this procedure. The intermediate arabino
compound was obtained utilizing a variation of the
oxidation-reduction procedure of Hansske et al. [Tetrahedron, 40,
125 (1984)]. According to this invention, the reduction was
effected starting at -78.degree. C. and allowing the reduction
reaction to exothermically warm to about -2.degree. C. This results
in a high yield of the intermediate arabino compound.
[0083] In conjunction with use of a low temperature reduction,
utilization of a tetraisopropyldisiloxane blocking group (a "TPDS"
group) for the 3' and 5' positions of the starting guanosine
compound contributes to an improved ratio of intermediate arabino
compound to the ribo compound following oxidation and reduction.
Following oxidation and reduction, the N.sup.2 guanine amino
nitrogen and the 2'-hydroxyl moieties of the intermediate arabino
compound are blocked with isobutyryl protecting groups ("Ibu"
groups). The tetraisopropyldisiloxane blocking group is removed and
the 3' and 5' hydroxy groups are further protected with a second
blocking group, a tetrahydropyranyl blocking group ("THP" group).
The isobutyryl group is selectively removed from 2'-hydroxyl group
followed by derivation of the 2' position with a triflate leaving
group. The triflate group was then displaced with inversion about
the 2' position to yield the desired 2'-deoxy-2'-fluoroguanosine
compound.
[0084] In addition to the triflate leaving group, other leaving
groups include, but are not limited to, alkylsulfonyl, substituted
alkylsulfonyl, arylsulfonyl, substituted arylsulfonyl,
heterocyclosulfonyl or trichloroacetimidate. Representative
examples include p-(2,4-dinitroanilino)-benzenesulfonyl,
benzenesulfonyl, methylsulfonyl, p-methyl-benzenesulfonyl,
p-bromobenzenesulfonyl, trichloroacetimidate, acyloxy,
2,2,2-trifluoroethanesulfonyl, imidazolesulfonyl and
2,4,6-trichlorophenyl.
[0085] The isobutyryl group remaining on the N.sup.2 heterocyclic
amino moiety of the guanine ring can be removed to yield a
completely deblocked nucleoside. However, preferably, for
incorporation of the 2'-deoxy-2'-substituted compound into an
oligonucleotide, deblocking of the 2 isobutyryl protecting group is
deferred until after oligonucleotide synthesis is complete.
Normally for use in automated nucleic acid synthesizers, blocking
of the N.sup.2 guanine moiety with an isobutyryl group is
preferred. Thus, advantageously, the N.sup.2-isobutyryl-blocked
2'-deoxy-2'-substituted guanosine compounds resulting from the
method of the invention can be directly used for oligonucleotide
synthesis on automated nucleic acid synthesizers.
[0086] For the purpose of illustration, the oligonucleotides of the
invention have been used in a ras-luciferase fusion system using
ras-luciferase transactivation. As described in International
Publication Number WO 92/22651, published Dec. 23, 1992 and
commonly assigned with this application, the entire contents of
which are herein incorporated by reference, the ras oncogenes are
members of a gene family that encode related proteins that are
localized to the inner face of the plasma membrane. Ras proteins
have been shown to be highly conserved at the amino acid level, to
bind GTP with high affinity and specificity, and to possess GTPase
activity. Although the cellular function of ras gene products is
unknown, their biochemical properties, along with their significant
sequence homology with a class of signal-transducing proteins known
as GTP binding proteins, or G proteins, suggest that ras gene
products play a fundamental role in basic cellular regulatory
functions relating to the transduction of extracellular signals
across plasma membranes.
[0087] Three ras genes, designated H-ras, K-ras, and N-ras, have
been identified in the mammalian genome. Mammalian ras genes
acquire transformation-inducing properties by single point
mutations within their coding sequences. Mutations in naturally
occurring ras oncogenes have been localized to codons 12, 13, and
61. The most commonly detected activating ras mutation found in
human tumors is in codon-12 of the H-ras gene in which a base
change from GGC to GTC results in a glycine-to-valine substitution
in the GTPase regulatory domain of the ras protein product. This
single amino acid change is thought to abolish normal control of
ras protein function, thereby converting a normally regulated cell
protein to one that is continuously active. It is believed that
such deregulation of normal ras protein function is responsible for
the transformation from normal to malignant growth.
[0088] The oligonucleotides of the present invention have also been
used for modulating the expression of the raf gene, a naturally
present cellular gene which occasionally converts to an activated
form that has been implicated in abnormal cell proliferation and
tumor formation.
[0089] The oligonucleotides of the present invention are also
specifically hybridizable with nucleic acids relating to protein
kinase C (PKC). These oligonucleotides have been found to modulate
the expression of PKC.
[0090] The following examples illustrate the present invention and
are not intended to limit the same.
EXAMPLE 1
Preparation of 2'-Deoxy-2'-fluoro Modified Oligonucleotides
[0091] A.
N.sup.6-Benzoyl-[2'-deoxy-2'-fluoro-5'-O-(4,4'-di-methoxytrityl)-
]adenosine-3'-O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite.
[0092] N.sup.6-Benzoyl-9-(2'-fluoro-b-D-ribofuranosyl)adenine was
prepared from 9-.beta.-D-arabinofuranosyladenine in a five-step
synthesis using a modification of a procedure reported by Ikehara
at al. [Nucleosides and Nucleotides, 2, 373-385 (1983)]. The
N.sup.6-benzoyl derivative was obtained in good yield utilizing the
method of transient protection with chlorotrimethylsilane. Jones
[J. Am. Chem. Soc., 104, 1316 (1982)]. Selective protection of the
3' and 5'-hydroxyl groups of
N.sup.6-Benzoyl-9-.beta.-D-arabinofuranosyladenine with
tetrahydropyranyl (THP) was accomplished by modification of the
literature procedure according to Butke et al. [Nucleic Acid
Chemistry, Part 3, p.149, L. B. Townsend and R. S. Tipson, Eds., J.
Wiley and Sons, New York, 1986], to yield
N.sup.6-Benzoyl-9-[3',5'-di-O-tetrahydropyran-2-yl)-.beta.-D-arabin-
o-furanosyl]adenine in good yield. Treatment of
N.sup.6-Benzoyl-9-[3',5'-d-
i-O-tetrahydropyran-2-yl)-.beta.-D-arabino-furanosyl]adenine with
trifluoromethanesulfonic anhydride in dichloromethane gave the
2'-triflate derivative
N.sup.6-Benzoyl-9-[2'-O-trifluoromethylsulfonyl-3'-
,5'-di-O-tetrahydropyran-2-yl)-.beta.-D-arabinofuranosyl]adenine
which was not isolated due to its lability. Displacement of the
2'-triflate group was effected by reaction with tetrabutylammonium
fluoride in tetrahydrofuran to obtain a moderate yield of the
2'-fluoro derivative
N.sup.6-Benzoyl-9-[2'-fluoro-3',5'-di-O-tetrahydropyran-2-yl)
-.beta.-D-arabinofuranosyl]adenine. Deprotection of the THP groups
of N.sup.6
-Benzoyl-9-[2'-fluoro-3',5'-di-O-tetrahydro-pyran-2-yl)-.beta.-D--
arabinofuranosyl]adenine was accomplished by treatment with
Dowex-50W in methanol to yield
N.sup.6-benzoyl-9-(2'-deoxy-2'-fluoro-.beta.-D-ribofura-
nosyl)adenine in moderate yield. The .sup.1H-NMR spectrum was in
agreement with the literature values. [Ikehara and Miki, Chem.
Pharm. Bull., 26, 2449 (1978)]. Standard methodologies were
employed to obtain the 5'-dimethoxytrityl-3'-phosphoramidite
intermediates
N.sup.6-Benzoyl-9-[2'-fluoro-5'-O-(4,4'-dimethoxytrityl)-.beta.-D-ribofur-
anosyl]adenine and
N.sup.6-Benzoyl-[2'-deoxy-2'-fluoro-5'-O-(4,4'-dimethox-
ytrityl)]adenosine-3'-O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite.
[Ogilvie, Can J. Chem., 67, 831-839 (1989)].
[0093] B. N.sup.6-Benzoyl-9-.beta.-D-arabinofuranosyladenine.
[0094] 9-.beta.-D-arabinofuranosyladenine (1.07 g, 4.00 mmol) was
dissolved in anhydrous pyridine (20 mL) and anhydrous
dimethylformamide (20 mL) under an argon atmosphere. The solution
was cooled to 0.degree. C. and chlorotrimethylsilane (3.88 mL, 30.6
mmol) was added slowly to the reaction mixture via a syringe. After
stirring the reaction mixture at 0.degree. C. for 30 minutes,
benzoyl chloride (2.32 mL, 20 mmol) was added slowly. The reaction
mixture was allowed to warm to 20.degree. C. and stirred for 2
hours. After cooling the reaction mixture to 0.degree. C., cold
water (8 mL) was added and the mixture was stirred for 15 minutes.
Concentrated ammonium hydroxide (8 mL) was slowly added to the
reaction mixture to give a final concentration of 2 M of ammonia.
After stirring the cold reaction mixture for 30 minutes, the
solvent was evaporated in vacuo (60 torr) at 20.degree. C. followed
by evaporation in vacuo (1 torr) at 40.degree. C. to give an oil.
This oil was triturated with diethyl ether (50 mL) to give a solid
which was filtered and washed with diethyl ether three times. This
crude solid was triturated in methanol (100 mL) at reflux
temperature three times and the solvent was evaporated to yield
N.sup.6-Benzoyl-9-.beta.-D-arabino-furanosyladenine as a solid
(1.50 g, 100%).
[0095] C.
N.sup.6-Benzoyl-9-[3',5'-di-O-tetrahydropyran-2-yl)-.beta.-D-ara-
binofuranosyl]adenine.
[0096] N.sup.6-Benzoyl-9-.beta.-D-arabinofuranosyladenine (2.62 g,
7.06 mmol) was dissolved in anhydrous dimethylformamide (150 mL)
under argon and p-toluenesulfonic acid monohydrate (1.32 g, 6.92
mmol) was added. This solution was cooled to 0.degree. C. and
dihydropyran (1.26 mL, 13.8 mmol) was added via a syringe. The
reaction mixture was allowed to warm to 20.degree. C. Over a period
of 5 hours a total of 10 equivalents of dihydropyran were added in
2 equivalent amounts in the fashion described. The reaction mixture
was cooled to 0.degree. C. and saturated aqueous sodium bicarbonate
was added slowly to a pH of 8, then water was added to a volume of
750 mL. The aqueous mixture was extracted with methylene chloride
(4.times.200 mL), and the organic phases were combined and dried
over magnesium sulfate. The solids were filtered and the solvent
was evaporated in vacuo (60 torr) at 30.degree. C. to give a small
volume of liquid which was evaporated in vacuo (1 torr) at
40.degree. C. to give an oil. This oil was coevaporated with
p-xylene in vacuo at 40.degree. C. to give an oil which was
dissolved in methylene chloride (100 mL). Hexane (200 mL) was added
to the solution and the lower-boiling solvent was evaporated in
vacuo at 30.degree. C. to leave a white solid suspended in hexane.
This solid was filtered and washed with hexane (3.times.10 mL) then
purified by column chromatography using silica gel and methylene
chloride-methanol (93:7) as the eluent. The first fraction yielded
the title compound 3 as a white foam (3.19 g, 83%) and a second
fraction gave a white foam (0.81 g) which was characterized as the
5'-monotetrahydropyranyl derivative of
N.sup.6-Benzoyl-9-.beta.-D-arabino- furanosyladenine.
[0097] D.
N.sup.6-Benzoyl-9-[2'-O-trifluoromethylsulfonyl-3',5'-di-O-tetra-
hydropyran-2-yl) -.beta.-D-arabinofuranosyl]adenine.
[0098]
N.sup.6-Benzoyl-9-[3',5'-di-O-tetrahydropyran-2-yl)-.beta.-D-arabin-
ofuranosyl]adenine (2.65 g, 4.91 mmol) was dissolved in anhydrous
pyridine (20 mL) and the solvent was evaporated in vacuo (1 mm Hg)
at 40.degree. C. The resulting oil was dissolved in anhydrous
methylene chloride (130 mL) under argon anhydrous pyridine (3.34
mL, 41.3 mmol) and N,N-dimethylaminopyridine (1.95 g, 16.0 mmol)
were added. The reaction mixture was cooled to 0.degree. C. and
trifluoromethanesulfonic anhydride (1.36 mL, 8.05 mmol) was added
slowly via a syringe. After stirring the reaction mixture at
0.degree. C. for 1 hour, it was poured into cold saturated aqueous
sodium bicarbonate (140 mL). The mixture was shaken and the organic
phase was separated and kept at 0.degree. C. The aqueous phase was
extracted with methylene chloride (2.times.140 mL). The organic
extracts which were diligently kept cold were combined and dried
over magnesium sulfate. The solvent was evaporated in vacuo (60
torr) at 20.degree. C. then evaporated in vacuo (1 torr) at
20.degree. C. to give
N.sup.6-Benzoyl-9-[2'-O-trifluoromethylsulfonyl-3',5'-di-O-tetrahydropyra-
n-2-yl)-.beta.-D-arabinofuranosyl]adenine as a crude oil which was
not purified further.
[0099] E.
N.sup.6-Benzoyl-9-[2'-fluoro-3',5'-di-O-tetrahydro-pyran-2-yl)-.-
beta.-D-arabinofuranosyl]adenine.
[0100]
N.sup.6-Benzoyl-9-[2'-O-trifluoromethylsulfonyl-3',5'-di-O-tetrahyd-
ropyran-2-yl)-.beta.-D-arabinofuranosyl]adenine (4.9 mmol) as a
crude oil was dissolved in anhydrous tetrahydrofuran (120 mL) and
this solution was cooled to 0.degree. C. under argon.
Tetrabutylammonium fluoride as the hydrate (12.8 g, 49.1 mmol) was
dissolved in anhydrous tetrahydrofuran (50 mL) and half of this
volume was slowly added via a syringe to the cold reaction mixture.
After stirring at 0.degree. C. for 1 hour, the remainder of the
reagent was added slowly. The reaction mixture was stirred at
0.degree. C. for an additional 1 hour, then the solvent was
evaporated in vacuo (60 torr) at 20.degree. C. to give an oil. This
oil was dissolved in methylene chloride (250 mL) and washed with
brine three times. The organic phase was separated and dried over
magnesium sulfate. The solids were filtered and the solvent was
evaporated to give an oil. The crude product was purified by column
chromatography using silica gel in a sintered-glass funnel and
ethyl acetate was used as the eluent.
N.sup.6-Benzoyl-9-[2'-fluoro-3',5'-di-O-tetrahydropyran-2-yl)-.beta.-D-ar-
abinofuranosyl]adenine was obtained as an oil (2.03 g, 76%).
[0101] F.
N.sup.6-Benzoyl-9-(2'-fluoro-.beta.-D-ribofuranosyl)adenine.
[0102]
N.sup.6-Benzoyl-9-[2'-fluoro-3',5'-di-O-tetrahydropyran-2-yl)-.beta-
.-D-arabinofuranosyl]adenine (1.31 g, 2.42 mmol) was dissolved in
methanol (60 mL), and Dowex 50W.times.2-100 (4 cm.sup.3, 2.4 m.eq)
was added to the reaction mixture. The reaction mixture was stirred
at 20.degree. C. for 1 hour then cooled to 0.degree. C.
Triethylamine (5 mL) was then slowly added to the cold reaction
mixture to a pH of 12. The resin was filtered and washed with 30%
triethylamine in methanol until the wash no longer contained UV
absorbing material. Toluene (50 mL) was added to the washes and the
solvent was evaporated at 24.degree. C. in vacuo (60 torr, then 1
torr) to give a residue. This residue was partially dissolved in
methylene chloride (30 mL) and the solvent was transferred to a
separatory funnel. The remainder of the residue was dissolved in
hot (60.degree. C.) water and after cooling the solvent it was also
added to the separatory funnel. The biphasic system was extracted,
and the organic phase was separated and extracted with water
(3.times.100 mL). The combined aqueous extracts were evaporated in
vacuo (60 torr, then 1 torr Hg) at 40.degree. C. to give an oil
which was evaporated with anhydrous pyridine (50 mL). This oil was
further dried in vacuo (1 torr Hg) at 20.degree. C. in the presence
of phosphorous pentoxide overnight to give
N.sup.6-benzoyl-9-(2'-fluoro-b-D-ribofuranosyl)adenine as a yellow
foam (1.08 g, 100%) which contained minor impurities.
[0103] G.
N.sup.6-Benzoyl-9-[2'-fluoro-5'-O-(4,4'-dimethoxy-trityl)-.beta.-
-D-ribofuranosyl]adenine.
[0104] N.sup.6-Benzoyl-9-(2'-fluoro-b-D-ribofuranosyl)adenine (1.08
g, 2.89 mmol) which contained minor impurities was dissolved in
anhydrous pyridine (20 mL) under argon and dry triethylamine (0.52
mL, 3.76 mmol) was added followed by addition of
4,4'-dimethoxytrityl chloride (1.13 g, 3.32 mmol). After 4 hours of
stirring at 20.degree. C. the reaction mixture was transferred to a
separatory funnel and diethyl ether (40 mL) was added to give a
white suspension. This mixture was washed with water three times
(3.times.10 ml), the organic phase was separated and dried over
magnesium sulfate. Triethylamine (1 ml) was added to the solution
and the solvent was evaporated in vacuo (60 torr Hg) at 20.degree.
C. to give an oil which was evaporated with toluene (20 mL)
containing triethylamine (1 mL). This crude product was purified by
column chromatography using silica gel and ethyl
acetate-triethylamine (99:1) followed by ethyl
acetate-methanol-triethylamine (80:19:1) to give the product in two
fractions. The fractions were evaporated in vacuo (60 torr, then 1
torr Hg) at 20.degree. C. to give a foam which was further dried in
vacuo (1 torr Hg) at 20.degree. C. in the presence of sodium
hydroxide to give
N.sup.6-Benzoyl-9-[2'-fluoro-5'-O-(4,4'-dimethoxytrityl-
)-.beta.-D-ribofuranosyl]adenine as a foam (1.02 g, 52%).
[0105] H.
N.sup.6-Benzoyl-[2'-fluoro-5'-O-(4,4'-dimethoxytrityl]adenosine--
3'-O-N,N-diisopropyl-.beta.-cyanoethylphosphoramidite.
[0106]
N.sup.6-Benzoyl-9-[2'-fluoro-5'-O-(4,4'-dimethoxytrityl)-.beta.-D-r-
ibofuranosyl]adenine (1.26 g, 1.89 mmol) was dissolved in anhydrous
dichloromethane (13 mL) under argon, diisopropylethylamine (0.82
mL, 4.66 mmol) was added, and the reaction mixture was cooled to
0.degree. C. Chloro (diisopropylamino)-.beta.-cyanoethoxyphosphine
(0.88 mL, 4.03 mmol) was added to the reaction mixture which was
allowed to warm to 20.degree. C. and stirred for 3 hours.
Ethylacetate (80 mL) and triethylamine (1 mL) were added and this
solution was washed with brine (3.times.25 mL). The organic phase
was separated and dried over magnesium sulfate. After filtration of
the solids the solvent was evaporated in vacuo at 20.degree. C. to
give an oil which was purified by column chromatography using
silica gel and hexanes-ethyl acetate-triethyl-amine (50:49:1) as
the eluent. Evaporation of the fractions in vacuo at 20.degree. C.
gave a foam which was evaporated with anhydrous pyridine (20 mL) in
vacuo (1 torr) at 26.degree. C. and further dried in vacuo (1 torr
Hg) at 20.degree. C. in the presence of sodium hydroxide for 24 h
to give N.sup.6
-Benzoyl-[2'-deoxy-2'-fluoro-5'-O-(4,4'-dimethoxytrityl]aden-
osine-3'-O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite as a
foam (1.05 g, 63%).
[0107] I.
2'-Deoxy-2'-fluoro-5'-O-(4,4'-dimethoxytrityl)uridine-3'-O-(N,N--
diisopropyl-.beta.-cyanoethylphosphoramidite).
[0108] 2,2'-Cyclouridine is treated with a solution of 70% hydrogen
fluoride/pyridine in dioxane at 120.degree. C. for ten hours to
provide after solvent removal a 75% yield of
2'-deoxy-2'-fluorouridine. The 5'-DMT and
3'-cyanoethoxydiisopropyl-phosphoramidite derivitized nucleoside is
obtained by standard literature procedures [Gait, Ed.,
Oligonucleotide Synthesis. A Practical Approach, IRL Press,
Washington, D.C. (1984)], or according to the procedure of Example
1A.
[0109] J.
2'-Deoxy-2'-fluoro-5'-O-(4,4'-dimethoxytrityl)-cytidine-3'-O-(N,-
N-diisopropyl-.beta.-cyanoethylphosphoramidite).
[0110] 2'-Deoxy-2'-fluorouridine (2.51 g, 10.3 mmol) was converted
to corresponding cytidine analog via the method of C. B. Reese, et
al., J. Chem. Soc. Perkin Trans I, pp. 1171-1176 (1982), by
acetylation with acetic anhydride (3.1 mL, 32.7 mmol) in anhydrous
pyridine (26 mL) at room temperature. The reaction was quenched
with methanol, the solvent was evaporated in vacuo (1 torr) to give
an oil which was coevaporated with ethanol and toluene.
3',5'-O-diacetyl-2'-deoxy-2'-fluorouridine was crystallized from
ethanol to afford colorless crystals (2.38 g, 81%).
[0111]
N-4-(1,2,4-triazol-1-yl)-3',5'-O-diacetyl-2'-deoxy-2'-fluorouridine
was obtained in a 70% yield (2.37 g) by reaction of
3',5'-O-diacetyl-2'-deoxy-2'-fluorouridine (2.75 g, 9.61 mmol) with
1,2,4-triazole (5.97 g, 86.5 mmol), phosphorus oxychloride (1.73
mL, 18.4 mmol), and triethylamine (11.5 mL, 82.7 mmol) in anhydrous
acetonitrile at room temperature. After 90 min the reaction mixture
was cooled to ice temperature and triethylamine (7.98 ml, 56.9
mmol) was added followed by addition of water (4.0 ml). The solvent
was evaporated in vacuo (1 torr) to give an oil which was dissolved
in methylene chloride and washed with saturated aqueous sodium
bicarbonate. The aqueous phase was extracted with methylene
chloride twice (2.times.100 mL) and the organic extracts dried with
magnesium sulfate. Evaporation of the solvent afforded an oil from
which the product
N-4-(1,2,4-triazol-1-yl)-3',5'-O-diacetyl-2'-deoxy-
-2'-fluorouridine was obtained by crystallization from ethanol.
[0112] 2'-deoxy-2'-fluorocytidine was afforded by treatment of
protected triazol-1-yl derivative with concentrated ammonium
hydroxide (4.26 mL, 81.2 mmol) in dioxane at room temperature for 6
hours. After evaporation of the solvent the oil was stirred in
half-saturated (at ice temperature) ammonia in methanol for 16
hours. The solvent was evaporated and 2'-deoxy-2'-fluoro-cytidine
crystallized from ethyl-acetate-methanol (v/v, 75:25) to give
colorless crystals (1.24 g, 75%).
[0113] N-4-benzoyl-2'-deoxy-2'-fluorocytidine was prepared by
selective benzoylation with benzoic anhydride in anhydrous
dimethylformamide, V. Bhat, et al. Nucleosides Nucleotides, Vol. 8,
pp. 179-183 (1989). The
5'-O-(4,4'-dimethoxytrityl)-3'-O-(N,N-diisopropyl-.beta.-cyanoethyl-phosp-
horamidite) was prepared in accordance with Example 1A.
[0114] K.
9-(3',5'-[1,1,3,3-Tetraisopropyldisilox-1,3-diyl]-.beta.-D-arabi-
nofuranosyl)guanine.
[0115] The 3' and 5' positions of guanosine were protected by the
addition of a TPDS (1,1,3,3-tetraisopropyldisilox-1,3-diyl)
protecting group as per the procedure of Robins et al. [Can. J.
Chem., 61, 1911 (1983)]. To a stirred solution of DMSO (160 mL) and
acetic anhydride (20 mL) was added the TPDS guanosine (21 g, 0.040
mol). The reaction was stirred at room temperature for 36 hours and
then cooled to 0.degree. C. Cold ethanol (400 mL, 95%) was added
and the reaction mixture further cooled to -78.degree. C. in a dry
ice/acetone bath. NaBH.sub.4 (2.0 g, 1.32 mol. eq.) was added. The
reaction mixture was allowed to warm up to -2.degree. C., stirred
for 30 minutes and again cooled to -78.degree. C. This was repeated
twice. After the addition of NaBH.sub.4 was complete, the reaction
was stirred at 0.degree. C. for 30 minutes and then at room
temperature for 1 hour. The reaction was taken up in ethyl acetate
(1 L) and washed twice with a saturated solution of NaCl. The
organic layer was dried over MgSO.sub.4 and evaporated under
reduced pressure. The residue was coevaporated twice with toluene
and purified by silica gel chromatography using
CH.sub.2Cl.sub.2--MeOH (9:1) as the eluent. Pure product (6.02 g)
precipitated from the appropriate column fractions during
evaporation of these fractions, and an additional 11.49 g of
product was obtained as a residue upon evaporation of the
fractions.
[0116] L.
N.sup.2-Isobutyryl-9-(2'-O-isobutyryl-3',5'-[1,1,3,3-tetraisopro-
pyldisilox-1,3-diyl]-.beta.-D-arabinofuranosyl)guanine.
[0117]
9-(3',5'-[1,1,3,3-Tetraisopropyldisilox-1,3-diyl].beta.-D-arabinofu-
ranosyl)guanine (6.5 g, 0.01248 mol) was dissolved in anhydrous
pyridine (156 mL) under argon. DMAP (9.15 g) was added. Isobutyric
anhydride (6.12 mL) was slowly added and the reaction mixture
stirred at room temperature overnight. The reaction mixture was
poured into cold saturated NaHCO.sub.3 (156 mL) and stirred for 10
minutes. The aqueous solution was extracted three times with ethyl
acetate (156 mL). The organic phase was washed three times with
saturated NaHCO.sub.3 and evaporated to dryness. The residue was
coevaporated with toluene and purified by silica gel column
chromatography using CH.sub.2Cl.sub.2-acetone (85:15) to yield 5.67
g of product.
[0118] M.
N.sup.2-Isobutyryl-9-(2'-O-isobutyryl-.beta.-D-arabinofuranosyl)-
guanine.
[0119]
N.sup.2-Isobutyryl-9-(2'-isobutyryl-3',5'-[1,1,3,3-tetraisopropyldi-
silox-1,3-diyl]-.beta.-D-arabinofuranosyl)guanine (9.83 g, 0.01476
mol) was dissolved in anhydrous THF (87.4 mL) at room temperature
under argon. 1 M (nBu).sub.4N.sup.+F.sup.- in THF (29.52 mL, 2 eq.)
was added and the reaction mixture stirred for 30 minutes. The
reaction mixture was evaporated at room temperature and the residue
purified by silica gel column chromatography using EtOAc--MeOH
(85:15) to yield 4.98 g (80%) of product.
[0120] N.
N.sup.2-Isobutyryl-9-(2'-O-isobutyryl-3',5'-di-O-[tetrahydropyra-
n-2-yl]-.beta.-D-arabinofuranosyl)guanine.
[0121] N.sup.2
-Isobutyryl-9-(2'-isobutyryl-.beta.-D-arabinofuranosyl)guan- ine
(4.9 g) was dissolved in anhydrous 1,4-dioxane (98 mL) at room
temperature under argon. p-Toluenesulphonic acid monohydrate (0.97
g) was added followed by 3,4-dihydro-2H-pyran (DHP, 9.34 mL, 8.8
eq.). The reaction mixture was stirred for 2 hours, then cooled to
0.degree. C. and saturated NaHCO.sub.3 (125 mL) was added to quench
the reaction. The reaction mixture was extracted three times with
125 mL portions of CH.sub.2Cl.sub.2 and the organic phase dried
over MgSO.sub.4. The organic phase was evaporated and the residue
dissolved in minimum volume of CH.sub.2Cl.sub.2, but in an amount
sufficient to yield a clear liquid not a syrup, and then dripped
into hexane (100 times the volume of CH.sub.2Cl.sub.2). The
precipitate was filtered to yield 5.59 (81.5%) of product.
[0122] O.
N.sup.2-Isobutyryl-9-(3',5'-di-O-[tetrahydropyran-2-yl]-.beta.-D-
-arabinofuranosyl)guanine.
[0123] N.sup.2
-Isobutyryl-9-(2'-isobutyryl-3',5'-di-O-[tetrahydropyran-2--
yl]-.beta.-D-arabinofuranosyl) guanine (5.58 g) was dissolved in
pyridine-MeOH--H.sub.2O (65:30:15, 52 mL) at room temperature. The
solution was cooled to 0.degree. C. and 52 mL of 2 N NaOH in
EtOH--MeOH (95:5) was added slowly, followed by stirring for 2
hours at 0.degree. C. Glacial acetic acid was added to pH 6, and
saturated NaHCO.sub.3 was added to pH 7. The reaction mixture was
evaporated under reduced pressure and the residue coevaporated with
toluene. The residue was then dissolved in EtOAc (150 mL) and
washed 3.times. with saturated NaHCO.sub.3. The organic phase was
evaporated and the residue purified by silica gel column
chromatography using EtOAc--MeOH (95:5) as the eluent, yielding
3.85 g (78.3%) of product.
[0124] P. N.sup.2
-Isobutyryl-9-(3',5'-di-O-[tetrahydropyran-2-yl]-2'-O-tr-
ifluoromethylsulfonyl-.beta.-D-arabinofuranosyl)guanine.
[0125]
N.sup.2-Isobutyryl-9-(3',5'-di-O-[tetrahydropyran-2-yl]-.beta.-D-ar-
abinofuranosyl)guanine (3.84 g) was dissolved in anhydrous
CH.sub.2Cl.sub.2 (79 mL), anhydrous pyridine (5 mL) and DMAP (2.93
g) at room temperature under argon. The solution was cooled to
0.degree. C. and trifluoromethanesulfonic anhydride (1.99 mL) was
slowly added with stirring. The reaction mixture was stirred at
room temperature for 1 hour then poured into 100 mL of saturated
NaHCO.sub.3. The aqueous phase was extracted three times with cold
CH.sub.2Cl.sub.2. The organic phase was dried over MgSO.sub.4,
evaporated and coevaporated with anhydrous MeCN to yield a crude
product.
[0126] Q.
N.sup.2-Isobutyryl-9-(2'-deoxy-2'-fluoro-3',5'-di-O-[tetrahydrop-
yran-2-yl]-2'-O-trifluoromethylsulfonyl-.beta.-D-ribofuranosyl)guanine.
[0127] The crude product from Example 1-P, i.e.
N.sup.2-isobutyryl-9-(3',5-
'-di-O-[tetrahydropyran-2-yl]-2'-O-trifluoromethylsulfonyl-.beta.-D-arabin-
ofuranosyl)guanine was dissolved in anhydrous THF (113 mL) under
argon at 0.degree. C. 1 M (nBu).sub.4N.sup.+F.sup.- (dried by
coevaporation with pyridine) in THF (36.95 mL) was added with
stirring. After 1 hour, a further aliquot of
(nBu).sub.4N.sup.+F.sup.- in THF (36.95 mL) was added. The reaction
mixture was stirred at 0.degree. C. for 5 hours and stored
overnight at -30.degree. C. The reaction mixture was evaporated
under reduced pressure and the residue dissolved in
CH.sub.2Cl.sub.2 (160 mL) and extracted five times with deionized
water. The organic phase was dried over MgSO.sub.4 and evaporated.
The residue was purified by silica gel column chromatography using
EtOAc--MeOH (95:5) to yield 5.25 g of product.
[0128] R.
N.sup.2-Isobutyryl-9-(2'-deoxy-2'-fluoro-.beta.-D-ribofuranosyl)-
guanine.
[0129]
N.sup.2-isobutyryl-9-(2'-deoxy-2'-fluoro-3',5'-di-O-[tetrahydropyra-
n-2-yl]-.beta.-D-ribofuranosyl)guanine (3.85 g) was dissolved in
MeOH (80 mL) at room temperature. Pre-washed Dowex 50W resin (12.32
cm.sup.3) was added and the reaction mixture stirred at room
temperature for 1 hour. The resin was filtered and the filtrate
evaporated to dryness. The resin was washed with
pyridine-triethylamine-H.sub.2O (1:3:3) until filtrate was clear.
This filtrate was evaporated to obtain an oil. The residues from
both filtrates were combined in H.sub.2O (200 mL) and washed with
CH.sub.2Cl.sub.2 (3.times.100 mL). The aqueous phase was evaporated
to dryness and the residue recrystallized from hot MeOH to yield
0.299 g of product as a white powder. The remaining MeOH solution
was purified by silica gel column chromatography to further yield
0.783 g of product by elution with EtOH--MeOH (4:1).
[0130] S.
N.sup.2-Isobutyryl-9-(2'-deoxy-2'-fluoro-5'-O-[4,4-dimethoxytrit-
yl]-.beta.-D-ribofuranosyl)guanine.
[0131] N.sup.2
-isobutyryl-9-(2'-deoxy-2'-fluoro-.beta.-D-ribofuranosyl)gu- anine
(1.09 g) was dissolved in pyridine (20 mL) and triethylamine (0.56
mL) at room temperature under argon. 4,4'-Dimethoxytrityl chloride
(1.20 g, 1.15 molar eq.) was added and the reaction mixture stirred
at room temperature for 5 hours. The mixture was transferred to a
separatory funnel and extracted with diethyl ether (100 mL). The
organic phase was washed with saturated NaHCO.sub.3 (3.times.70
mL), and the aqueous phase back-extracted three times with diethyl
ether. The combined organic phases were dried over MgSO.sub.4 and
triethylamine (4 mL) was added to maintain the solution at basic
pH. The solvent was evaporated and the residue purified by silica
gel column chromatography using EtOAc-triethylamine (100:1) and
then EtOAc--MeOH-triethylamine (95:5:1) as eluents yielding 1.03 g
of product.
[0132] T.
N.sup.2-Isobutyryl-9-(2'-deoxy-2'-fluoro-5'-O-[4,4-dimethoxytrit-
yl]-guanosine-3'-O-N,N-diisopropyl-.beta.-D-cyanoethylphosphoramidite.
[0133]
N.sup.2-isobutyryl-9-(2'-deoxy-2'-fluoro-5'-O-[4,4'-dimethoxytrityl-
])-.beta.-D-ribofuranosyl)guanine (0.587 g) was dissolved in
anhydrous CH.sub.2Cl.sub.2 (31 mL) and diisopropylethylamine (0.4
mL) at room temperature under argon. The solution was cooled to
0.degree. C. and
chloro(diisopropylamino)-.beta.-cyanoethoxyphosphine (0.42 mL) was
slowly added. The reaction mixture was allowed to warm to room
temperature and stirred for 3.5 hours.
CH.sub.2Cl.sub.2-triethylamine (100:1, 35 mL) was added and the
mixture washed with saturated NaHCO.sub.3 (6 mL). The organic phase
was dried over MgSO.sub.4 and evaporated under reduced pressure.
The residue was purified by silica gel column chromatography using
hexane-EtOAc-triethylamine (75:25:1) for 2 column volumes, then
hexane-EtOAc-triethylamine (25:75:1), and finally
EtOAc-triethylamine. The product-containing fractions were pooled
and the solvent evaporated under reduced pressure. The resulting
oil was coevaporated twice with MeCN and dried under reduced
pressure. The resulting white solid was dissolved in
CH.sub.2Cl.sub.2 (3 mL) and dripped into stirring hexane (300 mL).
The resulting precipitate was filtered and dried under reduced
pressure to yield 0.673 g (88%) of product.
EXAMPLE 2
Preparation of 2'-Deoxy-2'-cyano Modified Oligonucleotides
[0134] A.
N.sup.6-Benzoyl-[2'-deoxy-2'-cyano-5'-O-(4,4'-dimethoxytrityl]ad-
enosine-3'-O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite).
[0135] 2'-Deoxy-2'-cyanoadenosine is prepared by the free radical
replacement of the 2'-iodo group of
2'-deoxy-2'-iodo-3',5'-O-(disiloxytet-
raisopropyl)-N.sup.6-benzoyladenosine according to a similar
procedure described by Parkes and Taylor [Tetrahedron Letters, 29,
2995 (1988)]. 2'-Deoxy-2'-iodoadenosine was prepared by Ranganathan
as described in Tetrahedron Letters, 15, 1291 (1977), and
disilyated as described by Markiewicz and Wiewiorowski [Nucleic
Acid Chemistry, Part 3, pp. 222-231, L. B. Townsend and R. S.
Tipson, Eds., J. Wiley and Sons, New York, 1986. This material is
treated with hexamethylditin, AIBN, and t-butylisocyanate in
toluene to provide protected 2'-deoxy-2'-cyanoadenos- ine. This
material, after selective deprotection, is converted to its
5'-DMT-3'-phosphoramidite as described in Example 1A.
[0136] B.
2'-Deoxy-2'-cyano-5'-O-(4,4'-dimethoxytrityl)-uridine-3'-O-(N,N--
diisopropyl-.beta.-cyanoethyl phosphoramidite).
[0137] 2'-Deoxy-2'-iodouridine (or 5-methyluridine),
3',5'-disilylated as described above, is converted to the 2'-iodo
derivative by triphenylphosphonium methyl iodide treatment as
described by Parkes and Taylor [Tetrahedron Letters, 29, 2995
(1988)]. Application of free radical reaction conditions as
described by Parkes and Taylor provides the 2'-cyano group of the
protected nucleoside. Deprotection of this material and subsequent
conversion to the protected monomer as described above provides the
requisite phosphoramidite.
[0138] C.
2'-Deoxy-2'-cyano-5'-O-(4,4'-dimethoxytrityl)-cytidine-3'-O-(N,N-
-diisopropyl-.beta.-cyanoethylphosphoramidite).
[0139] 2'-Deoxy-2'-iodocytidine is obtained from the corresponding
uridine compound described above via a conventional keto to amino
conversion.
[0140]
D.2'-Deoxy-2'-cyano-5'-O-(4,4'-dimethoxytrityl)-guanosine-3'-O-(N,N-
-diisopropyl-b-cyanoethylphosphoramidite).
[0141] 2'-Deoxy-2'-cyanoguanosine is obtained by the displacement
of the triflate group in the 2'-position (arabinosugar) of
3',5'-disilylated N.sup.2-isobutrylguanosine. Standard deprotection
and subsequent reprotection provides the title monomer.
EXAMPLE 3
Preparation of 2'-Deoxy-2'-(trifluoromethyl) Modified
Oligonucleotides
[0142] The requisite 2'-deoxy-2'-trifluromethyribosides of nucleic
acid bases A, G, U(T), and C are prepared by modifications of a
literature procedure described by Chen and Wu [Journal of Chemical
Society, Perkin Transactions, 2385 (1989)]. Standard procedures, as
described in Example 1A, are employed to prepare the 5'-DMT and
3'-phosphoramidites as listed below.
[0143] A.
N.sup.6-Benzoyl-[2'-deoxy-2'-trifluoromethyl-5'-O-(4,4'-dimethox-
ytrityl)]adenosine-3'-O-(N,N-di-isopropyl-.beta.-cyanoethyl
phosphoramidite).
[0144] B.
2'-Deoxy-2'-trifluoromethyl-5'-O-(4,4'-dimethoxytrityl)uridine-3-
'-O-(N,N-diisopropyl-.beta.-c yanoethylphosphoramidite).
[0145] C.
2'-Deoxy-2'-trifluoromethyl-5'-O-(4,4'-dimethoxytrityl)-cytidine-
-3'-O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite).
[0146] D.
2'-Deoxy-2'-trifluoromethyl-5'-O-(4,4'-dimethoxytrityl)-guanosin-
e-3'-O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite).
EXAMPLE 4
Preparation of 2'-Deoxy-2'-(trifluoromethoxy) Modified
Oligonucleotides
[0147] The requisite 2'-deoxy-2'-O-trifluromethyribosides of
nucleic acid bases A, G, U(T), and C are prepared by modifications
of literature procedures described by Sproat et al. [Nucleic Acids
Research, 18, 41 (1990)] and Inoue et al. [Nucleic Acids Research,
15:, 131 (1987)]. Standard procedures, as described in Example 1A,
are employed to prepare the 5'-DMT and 3'-phosphoramidites as
listed below.
[0148] A.
N.sup.6-Benzoyl-[2'-deoxy-2'-(trifluoromethoxy)-5'-O-(4,4'-dimet-
hoxytrityl)]adenosine-3'-O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidi-
te).
[0149] B.
2'-Deoxy-2'-(trifluoromethoxy)-5'-O-(4,4'-dimethoxytrityl)-uridi-
ne-3'-O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite).
[0150] C.
2'-Deoxy-2'-(trifluoromethoxy)-5'-O-(4,4'-dimethoxytrityl)-cytid-
ine-3'-O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite).
[0151] D.
2'-Deoxy-2'-(trifluoromethoxy)-5'-O-(4,4'-dimethoxytrityl)-guano-
sine-3'-O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite).
EXAMPLE 5
Preparation of 2'-Deoxy-2'-O-alkyl Modified Oligonucleotides
[0152] Illustrative 2'-O-alkyl (2'-alkoxy) modified
oligonucleotides are prepared from appropriate precursor
nucleotides that in turn are prepared starting from a commercial
nucleoside. The nucleoside, either unblocked or appropriately
blocked as necessary to protected exocyclic functional groups on
their heterobases, are alkylated at the 2'-O position. This
2'-O-alkylated nucleosides is converted to a 5'-O-dimethoxytrityl
protected nucleosides and 3'-O-phosphitylated to give a
phosphoramidite. The phosphoramidites are incorporated in
oligonucleotides using standard machine cycle solid phase
phosphoramidite oligonucleotide chemistry. For illustrative
purposes the synthesis of 2-O-nonyladenosine, 2-O-propyluridine,
2-O-methylcytidine, 2'-O-octadecylguanosine,
2'-O-[(N-phthalimido)prop-3-yl]-N.sup.6-benzoyladenosine and
2-O-[(imidazol-1-yl)but-4-yl]adenosine are given. Other
2'-O-alkylated nucleosides are prepared in a like manner using an
appropriate starting alkyl halide in place of the illustrated alkyl
halides. For certain 2'-O-aminoalkyl compounds of the invention,
protected amines, e.g. phthalimido, were used during alkylation,
subsequent tritylation and phosphitylation. After incorporation
into the oligonucleotide of interest, the 2'-O-protected aminoalkyl
moiety are deblocked to yield the free amino compound, i.e
2'-O--(CH.sub.2).sub.n--NH.sub.2.
[0153] A.
N.sup.6-Benzoyl-(2'-deoxy-2'-O-nonyl-5'-O-(4,4'-dimethoxytrityl]-
adenosine-3'-O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite).
[0154] 2'-O-Nonyladenosine
[0155] To a solution of 10 g of adenosine in 400 ml of dimethyl
formamide was added 2.25 g of 60% sodium hydride (oil). After one
hour, 8.5 ml of 1-bromononane was added. The reaction was stirred
for 16 hours. Ice was added and the solution evaporated in vacuo.
Water and ethyl acetate were added. The organic phase was
separated, dried, and evaporated in vacuo to give a white solid,
which was recrystallized from ethanol to yield 4.8 g of the title
compound, m.p. 143-144.degree. C. analysis for:
C.sub.19H.sub.31N.sub.5O.sub.4. Calculated: C, 57.99; H, 7.94; N,
1779. Found: C, 58.13; H, 7.93; N, 17.83.
[0156] 2'-O-Nonyl-N.sup.6-benzoyladenosine
[0157] 2'-O-Nonyladenosine was treated with benzoyl chloride in a
manner similar to the procedure of B. L. Gaffney and R. A. Jones,
Tetrahedron Lett., Vol. 23, p. 2257 (1982). After chromatography on
silica gel (ethyl acetate-methanol), the title compound was
obtained. Analysis for: C.sub.26H.sub.35N.sub.5O.sub.9. Calculated:
C, 62.75; H, 7.09; N, 17.07. Found: C, 62.73; H, 14.07; N,
13.87.
[0158] 2'-O-Nonyl-5'-O-dimethoxytrityl-N.sup.6-benzoyladenosine
[0159] To a solution of 4.0 g of
2'-O-nonyl-N.sup.6-benzoyladenosine in 250 ml of pyridine was added
3.3 g of 4,4'-dimethoxytrityl chloride. The reaction was stirred
for 16 hours. The reaction was added to ice/water/ethyl acetate,
the organic layer was separated, dried, and concentrated in vacuo
to a gum. 5.8 g of the title compound was obtained after
chromatography on silica gel (ethyl acetate-methanol
triethylamine). Analysis for: C.sub.47H.sub.53N.sub.5O.sub.7.
Calculated: C, 70.56; H, 6.68; N, 8.75. Found: C, 70.26; H, 6.70;
N, 8.71.
[0160]
N.sup.6-Benzoyl-5'-O-dimethoxytrityl-2'-O-nonyladenosine-3'-O,N,N-d-
iisopropyl-.beta.-cyanoethyl Phosphoramidite
[0161] 2'-O-nonyl-5'-O-dimethoxytrityl-N-benzoyladenosine was
treated with
(.beta.-cyanoethoxy)chloro(N,N-diisopropyl)-aminephosphane in a
manner similar to the procedure of F. Seela and A. Kehne,
Biochemistry, Vol. 26, p. 2233 (1987). After chromatography on
silica gel (E=OAC/hexane), the title compound was obtained as a
white foam.
[0162] B.
2'-Deoxy-2'-O-propyl-5'-O-(4,4'-dimethoxy-trityl)-uridine-3'-O-(-
N,N-diisopropyl-.beta.-cyanoethylphosphoramidite).
[0163]
3',5'-O-(1,1,3,3)Tetraisopropyl-1,3-disiloxanediyluridine
[0164] With stirring, uridine (40 g, 0.164 mol) and
1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane (TIPS-Cl, 50 g, 0.159
mol) were added to dry pyridine (250 mL). After stirring for 16 h
at 25.degree. C., the reaction was concentrated under reduced
pressure to an oil. The oil was dissolved in methylene chloride
(800 mL) and washed with sat'd sodium bicarbonate (200 g) scrub
column. The product was recovered by elution with methylene
chloride-methanol (97:3). The appropriate fractions were combined,
evaporated under reduced pressure and dried at 25.degree. C./0.2
mmHg for 1 h to give 65 g (84%) of tan oil; TLC purity 95% (Rf
0.53, ethyl acetate-methanol 95:5); PMR (CDCl.sub.3) .delta. 7.87
(d, 1, H-6), 5.76 (d, 1, H-5), 5.81 (s, 1, H-1').
[0165]
N.sup.3-(4-Toluoyl)-3'-5'-O-(1,1,3,3)tetraisopropyl-1,3-disiloxane--
diyluridine
[0166] 4-Toluoyl chloride (19.6 g, 0.127 mol) was added over 30 min
to a stirred solution of
3',5'-O-(1,1,3,3)-tetra-isopropyl-1,3-disiloxanediylu- ridine (56
g, 0.115 mol) and triethylamine (15.1 g, 0.15 mol) in
dimethylacetamide (400 mL) at 5.degree. C. The mixture was allowed
to warm to 25.degree. C. for 3 h and then poured onto ice water
(3.5 L) with stirring. The resulting solid was collected, washed
with ice water (3.times.500 mL) and dried at 45.degree. C./0.2 mmHg
for 5 h to afford 49 g (70%) of tan solid; mp slowly softens above
45.degree. C.; TLC purity ca. 95% (Rf 0.25, hexanes-ethyl acetate
4:1); PMR (DMSO) .delta. 7.9 (H-6), 7.9-7.4 (Bz), 5.8 (H-5), 5.65
(HO-2'), 5.6 (H-1'), 2.4 (CH.sub.3--Ar).
[0167]
N.sup.3-(4-Toluoyl)-2'-O-propyl-3',5'-O-(1,1,3,3)tetraisopropyl-1,3-
-disiloxanediyluridine
[0168] A mixture of
N.sup.3-(4-toluoyl)-3'-5'-O-(1,1,3,3)tetraisopropyl-1,-
3-disiloxane-diyluridine (88 g, 0.146 mol, 95% purity), silver
oxide (88 g, 0.38 mol) and toluene (225 mL) was evaporated under
reduced pressure. More toluene (350 mL) was added and an additional
amount (100 mL) was evaporated. Under a nitrogen atmosphere, propyl
iodide was added in one portion and the reaction was stirred at
40.degree. C. for 16 h. The silver salts were collected and washed
with ethyl acetate (3.times.150 mL). The combined filtrate was
concentrated under reduced pressure. The residue was dissolved in a
minimum of hexanes, applied on a silica gel column (800 g) and
eluted with hexanes-ethyl acetate (9:1.fwdarw.4:1). The appropriate
fractions were combined, concentrated under reduced pressure and
dried at 25.degree. C./0.2 mmHg for 1 h to provide 68 g (74%) of
tan oil; TLC purity 95% (Rf 0.38, hexanes-ethyl acetate 4:1); PMR
(CDCl.sub.3) 6 8.1-7.3 (m, 6, H-6 and Bz), 5.8 (H-5), 5.76
(H-1')
[0169] 2'-O-Propyluridine
[0170] A solution of
N.sup.3-(4-toluoyl)-2'-O-propyl-3',5'-O-(1,1,3,3)tetr-
aisopropyl-1,3-disiloxanediyluridine (27 g) in methanol (400 mL)
and ammonium hydroxide (50 mL) was stirred for 16 h at 25.degree.
C. The reaction was concentrated under reduced pressure to an oil;
TLC homogenous (Rf 0.45, ethyl acetate-methanol 95:5).
[0171] The oil was dissolved in toluene (100 mL) and the solution
was evaporated under reduced pressure to dryness. The residue was
dissolved in tetrahydrofuran (300 mL). Tetrabutylammonium fluoride
solution (86 mL, 1 M in tetrahydrofuran) was added and the reaction
was stirred at 25.degree. C. for 16 h. The pH was adjusted to 7
with Amberlite IRC-50 resin. The mixture was filtered and the resin
was washed with hot methanol (2.times.200 mL). To the combined
filtrate was added silica gel (40 g). The suspension was
concentrated under reduced pressure to a dry powder. The residue
was placed on top of a silica gel column (500 g) and eluted with
ethyl acetate and then ethyl acetate-methanol (9:1). The
appropriate fractions were combined, evaporated under reduced
pressure and dried at 90.degree. C./0.2 mmHg for 5 h to yield 8.0 g
(70%) of light tan solid; TLC purity 98% (Rf 0.45, ethyl
acetate-methanol 4:1); PMR (DMSO) .delta. 11.37 (H--N.sup.3), 7.9
(H-6), 5.86 (H-1'), 5.65 (H-5), 5.2 (HO-3',5').
[0172] 5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-propyluridine
[0173] 2'-O-Methyluridine (8.0 g) was evaporated under reduced
pressure to an oil with pyridine (100 mL). To the residue was added
4,4'-dimethoxytriphenylmethyl chloride (DMT-Cl, 11.5 g, 0.34 mol)
and pyridine (100 mL). The mixture was stirred at 25.degree. C. for
1.5 h and then quenched by the addition of methanol (10 mL) for 30
min. The mixture was concentrated under reduced pressure and the
residue was chromatographed on silica gel (250 g, hexanes-ethyl
acetate-triethylamine 80:20:1 and then ethyl acetate-triethylamine
99:1). The appropriate fractions were combined, evaporated under
reduced pressure and dried at 25.degree. C./0.2 mmHg for 1 h to
provide 17.4 g (100%, 30% from uridine) of tan foam; TLC purity 98k
(Rf 0.23, hexanes-ethyl acetate 4:1); PMR (DMSO) .delta. 11.4
(H--N.sup.3), 7.78 (H-6), 7.6-6.8 (Bz), 5.8 (H-1'), 5.3 (H-5'),
5.25 (HO-3'), 3.7 (CH.sub.3O--Bz).
[0174]
[5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-propyluridin-3'-O-yl]-N,-
N-diisopropylaminocyanoethoxyphosphoramidite
[0175] The product was prepared in the same manner as the adenosine
analog above by starting with intermediate
5'-O-(4,4'-dimethoxytriphenylmethyl)-- 2'-O-propyluridine and using
ethyl acetate-hexanes-triethylamine 59:40:1 as the chromatography
eluent to give the product as a solid foam in 60% yield (18% from
uridine); TLC homogenous diastereomers (Rf 0.58; 0.44, ethyl
acetate-hexanes-triethylamine 59:40:1); .sup.31P-NMR (CDCl.sub.3,
H.sub.3PO.sub.4 std.) .delta. 148.11; 148.61 (diastereomers)
[0176] C.
2'-Deoxy-2'-O-methyl-5'-O-(4,4'-dimethoxy-trityl)-cytidine-3'-O--
(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite).
[0177] Two methods will be described for the preparation of the
intermediate N.sup.4-benzoyl-2'-O-methylcytidine. Method A involves
blocking of the 3'-5' sites with the TIPS-Cl reagent to allow
alkylation only on the 2' position. Method B uses a direct
alkylation of cytidine followed by separation of the resulting
mixture. The overall yields are comparable.
Method A
[0178]
3',5'-O-(1,1,3,3)-Tetraisopropyl-1,3-disiloxanediylcytidine
[0179] With stirring, cytidine (40 g, 0.165 mol) and
1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane (TIPS-Cl, 50 g, 0.159
mol) were added to dry pyridine (250 mL). After stirring for 16 h
at 25.degree. C., the reaction was concentrated under reduced
pressure to an oil. The oil was dissolved in methylene chloride
(800 mL) and washed with sat'd sodium bicarbonate (2.times.300 mL).
The organic layer was passed through a silica gel (200 g) scrub
column. The product was recovered by elution with methylene
chloride:methanol (97:3). The appropriate fractions were combined,
evaporated under reduced pressure and dried at 25.degree. C./0.2
mmHg for 1 h to give 59.3 g (77%) of oil (the product may be
crystallized from ethyl acetate as white crystals, mp
242-244.degree. C.); TLC purity 95% (Rf 0.59, ethyl
acetate-methanol 9:1); PMR (DMSO) .delta. 7.7 (H-6), 5.68 (H-5),
5.61 (HO-2'), 5.55 (H-1').
[0180]
N.sup.4-(Benzoyl)-3'-5'-O-(1,1,3,3)Tetraisopropyl-1,3-disiloxanediy-
lcytidine
[0181] Benzoyl chloride (18.5 g, 0.13 mol) was added over 30 min to
a stirred solution of
3',5'-O-(1,1,3,3)-tetraisopropyl-1,3-disiloxanediylcy- tidine (58
g, 0.12 mol) and triethylamine (15.6 g, 0.16 mol) in
dimethylacetamide (400 mL) at 5.degree. C. The mixture was allowed
to warm to 25.degree. C. for 16 h and then poured onto ice water
(3.5 L) with stirring. The resulting solid was collected, washed
with ice water (3.times.500 mL) and dried at 45.degree. C./0.2 mmHg
for 5 h to provide 77 g (100%) of solid; TLC purity ca. 90% (Rf
0.63, chloroform-methanol 9:1); PMR (CDCL.sub.3) .delta. 8.32
(H-6). Lit. mp 100-101.degree. C.
[0182]
N.sup.4-(Benzoyl)-2'-O-methyl-3',5'-O-(1,1,3,3)tetraisopropyl-1,3-d-
isiloxanediylcytidine
[0183] A mixture of
N.sup.4-(benzoyl)-3'-5'-O-(1,1,3,3)tetra-isopropyl-1,3-
-disiloxanediylcytidine (166 g, 0.25 mol, 90% purity), silver oxide
(150 g, 0.65 mol) and toluene (300 mL) was evaporated under reduced
pressure. More toluene (500 mL) was added and an additional amount
(100 mL) was evaporated. Under a nitrogen atmosphere, methyl iodide
was added in one portion and the reaction was stirred at 40!C for
16 h. The silver salts were collected and washed with ethyl acetate
(3.times.150 mL). The combined filtrate was concentrated under
reduced pressure. The residue was dissolved in a minimum of
methylene chloride, applied to a silica gel column (1 kg) and
eluted with hexanes-ethyl acetate (3:2.RTM.1:1). The appropriate
fractions were combined, concentrated under reduced pressure and
dried at 45.degree. C./0.2 mmHg for 1 h to yield 111 g (66%) of
oil; TLC purity ca. 90% (Rf 0.59, hexanes-ethyl acetate 3:2). PMR
(CDCl.sub.3) .delta. 8.8 (br s, 1, H--N.sup.4), 8.40 (d, 1, H-6),
8.0-7.4 (m, 6, H-5 and Bz), 5.86 (s, 1, H-1'), 3.74 (s, 3,
CH.sub.3O-2').
[0184] N.sup.4-Benzoyl-2'-O-methylcytidine
[0185] A solution of
N.sup.4-(benzoyl)-2'-O-methyl-3',5'-O-(1,1,3,3)tetrai-
sopropyl-1,3-disiloxanediylcytidine (111 g, 0.18 mol) in methanol
(160 mL) and tetrahydrofuran (640 mL) was treated with
tetrabutylammonium flouride solution (368 mL, 1 M in
tetrahydrofuran). The reaction was stirred at 25.degree. C. for 16
h. The pH was adjusted to 7 with Amberlite IRC-50 resin. The
mixture was filtered and the resin was washed with hot methanol
(2.times.200 mL). The combined filtrate was concentrated under
reduced pressure, absorbed on silica gel (175 g) and
chromatographed on silica gel (500 g, ethyl acetate-methanol
19:1.RTM.4:1). Selected fractions were combined, concentrated under
reduced pressure and dried at 40.degree. C./0.2 mmHg for 2 h to
yield 28 g (42.4%, 21.5% from cytidine) of solid; TLC homogenous
(Rf 0.37, ethyl acetate). mp 178-180.degree. C. (recryst. from
ethanol); PMR (CDCl.sub.3) .delta. 11.22 (br s, 1, H--N.sup.4),
8.55 (d, 1, H-6), 8.1-7.2 (m, 6, H-5 and Bz), 5.89 (d, 1, H-1'),
5.2 (m, 2, HO-3',5'), 3.48 (s, 3, CH.sub.3O-2').
Method B
[0186] N.sup.4-Benzoyl-2'-O-methylcytidine
[0187] Cytidine (100 g, 0.41 mol) was dissolved in warm
dimethylformamide (65.degree. C., 1125 mL). The solution was cooled
with stirring to 0.degree. C. A slow, steady stream of nitrogen gas
was delivered throughout the reaction. Sodium hydride (60% in oil,
washed thrice with hexanes, 18 g, 0.45 mol) was added and the
mixture was stirred at 0!C for 45 min. A solution of methyl iodide
(92.25 g, 40.5 mL, 0.65 mol) in dimethylformamide (400 mL) was
added in portions over 4 h at 0.degree. C. The mixture was stirred
for 7 h at 25.degree. C. and then filtered. The filtrate was
concentrated to dryness under reduced pressure followed by
coevaporation with methanol (2.times.200 mL). The residue was
dissolved in methanol (350 mL). The solution was adsorbed on silica
gel (175 g) and evaporated to dryness. The mixture was slurried in
dichloromethane (500 mL) and applied on top of a silica gel column
(1 kg). The column was eluted with a gradient of
dichloromethane-methanol (10:1.RTM.2:1). The less polar
2',3'-dimethyl side product was removed and the coeluting 2' and
3'-O-methyl product containing fractions were combined and
evaporated under reduced pressure to a syrup. The syrup was
dissolved in a minimum of hot ethanol (ca. 150 mL) and allowed to
cool to 25.degree. C. The resulting precipitate (2' less soluble)
was collected, washed with ethanol (2.times.25 ml) and dried to
give 15.2 g of pure 2'-O-methylcytidine; mp 252-254.degree. C.
(lit. mp 252-254.degree. C.); TLC homogenous (Rf 0.50,
dichloromethane-methanol 3:1, (Rf of 3' isomer is 0.50 and the
dimethyl product is 0.80). The filtrate was evaporated to give 18 g
of a mixture of isomers and sodium iodide.
[0188] The pure 2'-O-methylcytidine (15.2 g, 0.060 mol) was
dissolved in a solution of benzoic anhydride (14.7 g, 0.12 mol) in
dimethylformamide (200 mL). The solution was stirred at 25.degree.
C. for 48 h and then evaporated to dryness under reduced pressure.
The residue was triturated with methanol (2.times.200 mL),
collected and then triturated with warm ether (300 mL) for 10 min.
The solid was collected and triturated with hot 2-propanol (50 mL)
and allowed to stand at 4.degree. C. for 16 h. The solid was
collected and dried to give 17 g of product. The crude filtrate
residue (18 g) of 2'-O-methylcytidine was treated with benzoic
anhydride (17.3 g, 0.076 mol) in dimethylformamide (250 mL) as
above and triturated in a similar fashion to give an additional 6.7
g of pure product for a total yield of 23.7 g (16% from cytidine)
of solid; TLC homogenous (Rf 0.25, chloroform-methanol 5:1, cospots
with material produced from the other route.)
[0189]
N.sup.4-Benzoyl-5'-O-(4,4'-dimethoxytriphenylmethyl)-2'-O-methylcyt-
idine
[0190] N.sup.4-Benzoyl-2'-O-methylcytidine (28 g, 0.077 mol) was
evaporated under reduced pressure to an oil with pyridine (400 mL).
To the residue was added 4,4'-dimethoxytriphenylmethyl chloride
(DMT-Cl, 28.8 g, 0.085 mol) and pyridine (400 mL). The mixture was
stirred at 25.degree. C. for 2 h and then quenched by the addition
of methanol (10 mL) for 30 min. The mixture was concentrated under
reduced pressure and the residue was chromatographed on silica gel
(500 g, hexanes-ethyl acetate-triethylamine 60:40:1 and then ethyl
acetate-triethylamine 99:1). The appropriate fractions were
combined, evaporated under reduced pressure and dried at 40.degree.
C./0.2 mmHg for 2 h to give 26 g (74%, 16% from cytidine) of foam;
TLC homogenous (Rf 0.45, ethyl acetate); PMR (DMSO) .delta. 11.3
(H--N.sup.4), 8.4-6.9 (H-6, H-5, Bz), 5.95 (H-1'), 5.2 (HO-3'), 3.7
(s, 6, CH.sub.3O-trit.), 3.5 (s, 3, CH.sub.3O-2')
[0191] [N.sup.4
-Benzoyl-5'-O-(4,4'-dimethoxytriphenylmethyl)-2'-O-methylc-
ytidin-3'-O-yl]-N,N-diisopropylamino-cyanoethoxyphosphoramidite
[0192] The product was prepared in the same manner as the adenosine
analog above by starting with intermediate
N-.sup.4-benzoyl-5'-O-(4,4'-dimethoxy-
triphenylmethyl)-2'-O-methyl-cytidine and using ethyl
acetate-hexanes-triethylamine 59:40:1 as the chromatography eluent
to give the product as a solid foam in 71% yield (11% from
cytidine); TLC homogenous diastereomers (Rf 0.46; 0.33, ethyl
acetate-hexanes-triethylam- ine 59:40:1); .sup.31P-NMR (CD.sub.3CN,
H.sub.3PO.sub.4 std.) .delta. 150.34; 151.02 (diastereomers).
[0193] D.
2'-Deoxy-2'-octadecyl-5'-O-(4,4'-dimethoxy-trityl)-guanosine-3'--
O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite).
[0194]
2,6-Diamino-9-(2-O-octadecyl-.beta.-D-ribofuranosyl)purine
[0195] 2,6-Diamino-9-(.beta.-D-ribofuranosyl)purine (50 g, 180
mmol) and sodium hydride (7 g) in DMF (1 L) were heated to boiling
for 2 hr. Iodooctadecane (100 g) was added at 150.degree. C. and
the reaction mixture allowed to cool to RT. The reaction mixture
was stirred for 11 days at RT. The solvent was evaporated and the
residue purified by silica gel chromatography. The product was
eluted with 5% MeOH/CH.sub.2Cl.sub.2. The appropriate fractions
were evaporated to yield the product (11 g). .sup.1H NMR
(DMSO-d.sub.6) .delta. 0.84 (t, 3, CH.sub.2), 1.22 (m, 32,
O--CH.sub.2--CH.sub.2--(CH.sub.2).sub.16), 1.86 (m, 2,
O--CH.sub.2CH.sub.2), 3.25 (m, 2, O--CH.sub.2), 3.93 (d, 1, 4'H),
4.25 (m, 1, 3'H), 4.38 (t, 1, 2'H), 5.08 (d, 1, 3'-OH), 5.48 (t, 1,
5'-OH), 5.75 (s, 2, 6-NH.sub.2), 5.84 (d, 1, 1'-H), 6.8 (s, 2,
2-NH.sub.2), and 7.95 (s, 1, 8-H).
[0196] 2'-O-Octadecylguanosine
[0197] 2,6-Diamino-9-(2-O-octadecyl-.beta.-D-ribofuranosyl) purine
(10 g) in 0.1 M sodium phosphate buffer (50 ml, pH 7.4), 0.1 M tris
buffer (1000 ml, pH 7.4) and DMSO (1000 ml) was treated with
adenosine deaminase (1.5 g) at RT. At day 3, day 5 and day 7 an
additional aliquot (500 mg, 880 mg and 200 mg, respectively) of
adenosine deaminase was added. The reaction was stirred for a total
of 9 day and purification by silica gel chromatography yielded the
product (2 g). An analytical sample was recrystallized from MeOH.
.sup.1H NMR (DMSO-d.sub.6) .delta. 0.84 (t, 3, CH.sub.3), 1.22 (s,
32, O--CH.sub.2--CH.sub.2--(CH.sub.2).sub.16), 5.07 (m, 2, 3'-OH
and 5'-OH), 5.78 (d, 1, 1'H), 6.43 (s, 2, NH.sub.2), 7.97 (s, 1,
8H) and 10.64 (s, 1, NH.sub.2). Anal. Calcd. for
C.sub.28H.sub.49N.sub.5O.sub.5: C, 62.80; H, 9.16; N, 12.95. Found:
C, 62.54; H, 9.18; N, 12.95.
[0198] N.sup.2-Isobutyryl-2'-O-octadecylguanosine
[0199] 2'-O-Octadecylguanosine (1.9 g) in pyridine (150 ml) was
cooled in an ice bath, and treated with trimethylsilyl chloride (2
g, 5 eq) and isobutyryl chloride (2 g, 5 eq). The reaction mixture
was stirred for 4 hours, during which time it was allowed to warm
to room temperature. The solution was cooled, water added (10 mL)
and stirred for an additional 30 minutes. Concentrated ammonium
hydroxide (10 mL) was added and the solution concentrated in vacuo.
The residue was purified by silica gel chromatography (eluted with
3% MeOH/EtOAc) to yield 1.2 g of product.
[0200] .sup.1H NMR (DMSO-d6) .delta. 0.85 (t, 3, CH.sub.3), 1.15
(m, 38, O--CH.sub.2CH.sub.2(CH.sub.2).sub.16 and
CH(CH.sub.3).sub.2), 2.77 (m, 1, CH(CH.sub.3).sub.2), 4.25 (m, 2,
2'H, 3'H), 5.08 (t, 1, 5'-OH), 5.12 (d, 1, 3'-OH), 5.87 (d, 1,
1'-H), 8.27 (s, 1, 8-H), 11.68 (s, 1, NH.sub.2) and 12.08 (s, 1,
NH.sub.2). Anal. Calcd. for C.sub.32H.sub.55N.sub.5O.sub- .6: C,
63.47; H, 9.09; N, 11.57. Found: C, 63.53; H, 9.20; N, 11.52.
[0201]
N.sup.2-Isobutyryl-5'-dimethoxytrityl-2'-O-octadecylguanosine
[0202] N.sup.2-Isobutyryl-2'-O-octadecylguanosine was converted to
the N.sup.2-isobutyryl-5'-dimethoxytrityl-2'-O-octadecyl-guanosine
as per the procedure for adenosine above.
[0203]
[N.sup.2-Isobutyryl-5'-dimethoxytrityl-2'-O-octadecylguan-3'-O-yl]--
N,N-diisopropylamino-cyanoethoxy phosphoramidite
[0204] The product was prepared in the same manner as the adenosine
analog above by starting with intermediate
N.sup.2-iso-butyryl-5'-dimethoxytrity-
l-2'-O-octadecylguanosine.
[0205] E.
N.sup.6-Benzoyl-2'-[N-phthalimido)prop-3-yl]5'-O(4,4'-dimethoxyt-
rityl)]adenosine3'-O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite).
[0206] 2'-O-[(N-Phthalimido)prop-3-yl]adenosine
[0207] The title compound was prepared as per the
2'-O-nonyladenosine procedure using N-(3-bromopropyl)phthalimide.
Chromatography on silica gel give a white solid, m.p.
123-124.degree. C. Analysis for: C.sub.21H.sub.22N.sub.6O.sub.6.
Calculated: C, 55.03; H, 4.88; N, 18.49. Found: C, 55.38; H, 4.85;
N, 18.46.
[0208] 2'-O-[(N-Phthalmido)prop-3-yl]-N.sup.6-benzoyladenosine
[0209] Benzoylation of 2'-O-[(N-phthalimido)prop-3-yl]-adenosine as
per the 2'-O-nonyladenosine procedure above give the title
compound. Analysis for: C.sub.28H.sub.26N.sub.6O.sub.7. Calculated:
C, 60.21; H, 4.69; N, 15.05. Found: C, 59.94; H, 4.66; N,
14.76.
[0210]
2'-O-[(N-Phthalimido)prop-3-yl]-5'-O-dimethoxytrityl-N.sup.6-benzoy-
ladenosine
[0211] The title compound was prepared from
2'-O-[(N-phthalimido)prop-3-yl- ]-N.sup.6-benzoyladenosine as per
the 2'-O-nonyladenosine above. Analysis for:
C.sub.49H.sub.44N.sub.6O.sub.9. Calculated: C, 68.36; H, 5.15; N,
9.76. Found: C, 68.16; H, 5.03; N, 9.43.
[0212]
N.sub.6-Benzoyl-5'-O-dimethoxytrityl-2'-O-[(N-phthalimido)prop-3-yl-
]adenosine-3'-O,N,N-diisopropyl-.beta.-cyanoethylphosphoramidite
[0213] The title compound was prepared from
2'-O-[(N-phthalimido)prop-3-yl-
]-5'-O-dimethoxytrityl-N.sup.6-benzoyl-adenosine as above for the
2'-O-nonyladenosine compound. A white foam was obtained.
[0214]
[0215] F.
N.sup.6-Benzoyl-2'-[(imidazol-1-yl)butyl-4-yl]5'O-(4,4'dimethoxy-
trityl)]adenosine3'-O(N,N-diiso-propyl-.beta.-cyanoethylphosphoramidite).
[0216] 2'-O-[Imidizo-1-yl-(but-4-yl)]adenosine
[0217] The title compound can be prepared as per the
2'-O-nonyladenosine procedure using 1-(4-bromobutyl)imidazole in
place of 1-bromononane.
[0218] 2'-O-[(Imidizol-1-yl)but-4-yl]-N.sup.6-benzoyladenosine
[0219] Benoylation of 2'-O-[(imidizol-1-yl)but-4-yl)]-adenosine as
per the 2'-O-nonyladenosine procedure above will give the title
compound.
[0220]
2'-O-[(Imidizol-1-yl)but-4-yl-5'-O-dimethoxytrityl-N.sup.6-benzoyla-
denosine
[0221] The title compound can be prepared from
2'-O-[(imidizol-1-yl)but-4-- yl]adenosine as per the
2'-O-nonyladenosine procedure above.
[0222]
N.sup.6-benzoyl-5'-O-dimethoxytrityl-2'-O-[(imidizol-1-yl)but-4-yl]-
adenosine-3'-O,N,N-diisopropyl-B-cyanoethyl Phosphoramidite The
title compound can be prepared from
2'-O-[(imidizol-1-yl)but-4-yl)]-5'-O-dimeth-
oxytrityl-N.sup.6-benzoyladenosine as per the 2'-O-nonyladenosine
procedure above.
EXAMPLE 6
Preparation of 2'-Deoxy-2'-(vinyloxy) Modified Oligonucleotides
[0223] The requisite 2'-deoxy-2'-O-vinyl ribosides of nucleic acid
bases A, G, U(T), and C are prepared by modifications of literature
procedures described by Sproat et al. (Nucleic Acids Research, 18,
41 (1990)] and Inoue et al. [Nucleic Acids Research, 15, 6131
(1987)]. In this case 1,2-dibromoethane is coupled to the
2'-hydroxyl and subsequent dehydrobromination affords the desired
blocked 2'-vinyl nucleoside. Standard procedures, as described in
Example 1A, are employed to prepare the 5'-DMT and
3'-phosphoramidites as listed below.
[0224] A.
N.sup.6-Benzoyl-[2'-deoxy-2'-(vinyloxy)-5'-O-(4,4'-dimethoxytrit-
yl)]adenosine-3'-O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite).
[0225] B.
2'-Deoxy-2'-(vinyloxy)-5'-O-(4,4'-dimethoxy-trityl)-uridine-3'-O-
-(N,N-diisopropyl-.beta.-cyano-ethylphosphoramidite).
[0226] C.
2'-Deoxy-2'-(vinyloxy)-5'-O-(4,4'-dimethoxy-trityl)-cytidine-3'--
O-(N,N-diisopropyl-.beta.-cyano-ethylphosphoramidite).
[0227] D.
2'-Deoxy-2'-(vinyloxy)-5'-O-(4,4'-dimethoxy-trityl)-guanosine-3'-
-O-(N,N-diisopropyl-.beta.-cyano-ethylphosphoramidite).
EXAMPLE 7
Preparation of 2'-Deoxy-2'-(allyloxy) Modified Oligonucleotides
[0228] The requisite 2'-deoxy-2'-O-allyl ribosides of nucleic acid
bases A, G, U(T), and C are prepared by modifications of literature
procedures described by Sproat et al. [Nucleic Acids Research, 18,
41 (1990)] and Inoue et al. [Nucleic Acids Research, 15, 6131
(1987)]. Standard procedures, as described in Example 1A, are
employed to prepare the 5'-DMT and 3'-phosphoramidites as listed
below.
[0229] A.
N-Benzoyl-[2'-deoxy-2'-(allyloxy)-5'-O-(4,4'-dimethoxytrityl]ade-
nosine-3'-O-(N,N-diisopropyl-.beta.-cyanoethylphosphoramidite).
[0230] B.
2'-Deoxy-2'-(allyloxy)-5'-O-(4,4'-dimethoxy-trityl)-uridine-3'-O-
-(N,N-diisopropyl-.beta.-cyano-ethylphosphoramidite).
[0231] C.
2'-Deoxy-2'-(allyloxy)-5'-O-(4,4'-dimethoxy-trityl)-cytidine-3'--
O-(N,N-diisopropyl-.beta.-cyano-ethylphosphoramidite).
[0232] D.
2'-Deoxy-2'-(allyloxy)-5'-O-(4,4'-dimethoxy-trityl)-guanosine-3'-
-O-(N,N-diisopropyl-.beta.-cyano-ethylphosphoramidite).
EXAMPLE 8
Preparation of 2'-Deoxy-2'-(methylthio), (Methylsulfinyl) and
(Methylsulfonyl) Modified Oligonucleotides
[0233] A. 2'-Deoxy-2'-methylthiouridine.
[0234] 2,2'Anhydrouridine (15.5 g, 68.2 mmol) [Rao and Reese, J.
Chem. Soc., Chem. Commun., 997%), methanethiol (15.7 g, 327 mmol),
1,1,3,3-tetramethylguanidine (39.2 g, 341 mmol) and DMF (150 mL)
were heated at 60.degree. C. After 12 hours, the reaction mixture
was cooled and concentrated under reduced pressure. The residual
oil was purified by flash column chromatography on silica gel (300
g). Concentration of the appropriate fractions, which were eluted
with CH.sub.2Cl.sub.2--MeOH (9:1), and drying the residue under
reduced pressure gave 2'-deoxy-2'-methylthiouridine as a pale
yellow solid (14.11 g, 75.4%). Attempts to crystallize the solids
from EtOH-hexanes [as reported by Imazawa et al., Chem. Pharm.
Bull., 23, 604 (1975)] failed and the material turned into a
hygroscopic foam.
[0235] .sup.1H NMR (DMSO-d.sub.6) .delta. 2.0 (3H, s, SCH.sub.3),
3.34 (1H, dd, J.sub.3',2'=5.4 Hz, 2'H), 3.59 (2H, br m, 5'
CH.sub.2), 3.84 (1H, m, 4'H), 4.2 (1H, dd, J.sub.3',4'=2.2 Hz,
3'H), 5.15 (1H, t, 5'OH), 5.62 (1H, t, 3' OH), 5.64 (1H, d,
J.sub.C6,C5=8.2 Hz), 6.02 (1H, d, J.sub.1',2'=6 Hz, 1'H), 7.82 (1H,
d, J.sub.C5,C6=8.2 Hz, C6H), 11.38 (1H, br s, NH).
[0236] B. 2,2'-Anhydro-5-methyluridine.
[0237] A mixture of 5-methyluridine (16.77 g, 69.2 mmol), diphenyl
carbonate (17.8 g, 83.1 mmol) and NaHCO.sub.3 (100 mg) in
hexamethylphosphoramide (175 mL) was heated to 150.degree. C. with
stirring until evolution of CO.sub.2 ceased (approximately 1 hour).
The reaction mixture was cooled and then poured into diethyl ether
(1 L) while stirring to furnish a brown gum. Repeated washings with
diethyl ether (4.times.250 mL) furnished a straw-colored
hygroscopic powder. The solid was purified by short column
chromatography on silica gel (400 g). Pooling and concentrating
appropriate fraction, which were eluted with CH.sub.2Cl.sub.2--MeOH
(85:15), furnished the title compound as a straw-colored solid (12
g, 77.3%), which crystallized from EtOH as long needles, m.p.
226-227.degree. C.
[0238] C. 2'-Deoxy-2'-methylthio-5-methyluridine.
[0239] 2,2'-Anhydro-5-methyluridine (17.02 g, 70.6 mmol),
methanethiol (16.3 g, 339 mmol), 1,1,3,3-tetramethylguanidine (40.6
g, 353 mmol) and DMF (150 mL) were heated at 60.degree. C. After 12
hours, the products were cooled and concentrated under reduced
pressure. The residual oil was purified by short silica gel column
chromatography (300 g). Pooling and concentrating appropriate
fractions, which were eluted with CH.sub.2Cl.sub.2--MeOH (93:7),
furnished the title compound as a white foam (15.08 g, 74.1%),
which was crystallized from EtOH--CH.sub.2Cl.sub.2 as white
needles.
[0240] D. 2'-Deoxy-2'-methylsulfinyluridine.
[0241] To a stirred solution of 2'-deoxy-2'-methylthiouridine (1 g,
3.65 mmol) in EtOH (50 mL) was added a solution of
m-chloroperbenzoic acid (50%, 1.26 g, 3.65 mmol) in EtOH (50 mL)
over a period of 45 minutes at 0.degree. C. the solvent was removed
under reduced pressure and the residue purified by short silica gel
(30 g) column chromatography. Concentration of the appropriate
fractions, which were eluted with CH.sub.2Cl.sub.2--MeOH (75:25),
afforded the title compound as a white solid (0.65 g, 61.4%).
Crystallization from EtOH furnished white granules, m.p.
219-221.degree. C.
[0242] .sup.1H NMR (DMSO-d.sub.6) .delta. 2.5 (3H, s, SOCH.sub.3),
3.56 (2H, br s, 5'CH.sub.2), 3.8 (1H, m, 4'H), 3.91 (1H, m, 2'H),
4.57 (1H, m, 3'H), 5.2 (1H, br s, 5'OH), 5.75 (1H, d, C.sub.5H),
6.19 (1H, d, 3'OH), 6.35 (1H, d, 1'H), 7.88 (1H, d, C.sub.6H),
11.43 (1H, br s, NH).
[0243] E. 2'-Deoxy-2'-methylsulfonyluridine.
[0244] To a stirred solution of 2'-deoxy-2'-methyluridine (1 g,
3.65 mmol) in EtOH (50 mL) was added a solution of
m-chloroperbenzoic acid (50%, 3.27 g, 14.6 mmol) in one portion at
room temperature. After 2 hours, the solution was filtered to
separate the white precipitate which was formed, which upon washing
(2.times.20 mL EtOH and 2.times.20 mL diethyl ether) and drying,
furnished the title compound as a fine powder (0.76 g, 68%), m.p.
227-228.degree. C.
[0245] .sup.1H NMR (DMSO-d.sub.6) .delta. 3.1 (3H, s,
SO.sub.2CH.sub.3), 3.58 (2H, m, 5'CH.sub.2), 3.95 (1H, m, 2'H),
3.98 (1H, m, 4'H), 4.5 (1H, br s, 3'H), 5.2 (1H, br s, 5'OH), 5.75
(1H, d, C.sub.5H), 6.25 (1H, d, 3'OH), 6.5 (1H, d, 1'H), 7.8 (1H,
d, C.sub.6H), 11.45 (1H, br s, NH).
[0246] F.
2'-Deoxy-5'-O-(4,4'-dimethoxytrityl)-2'-methylthiouridine.
[0247] To a stirred solution of 2'-deoxy-2'-methylthiouridine (1.09
g, 4 mmol) in dry pyridine (10 mL) was added
4,4'-dimethoxytritylchloride (1.69 g, 5 mmol) and
4-dimethylaminopyridine (50 mg) at room temperature. The solution
was stirred for 12 hours and the reaction mixture quenched by
adding MeOH (1 mL). The reaction mixture was concentrated under
reduced pressure and the residue was dissolved in CH.sub.2Cl.sub.2
(100 mL), washed with saturated aqueous NaHCO.sub.3 (2.times.50 mL)
and saturated aqueous NaCl (2.times.50 mL), and dried with
MgSO.sub.4. The solution was concentrated under reduced pressure
and the residue purified by silica gel (30 g) column
chromatography. Elution with CH.sub.2Cl.sub.2--MeOH-triethylamine
(89:1:1) furnished the title compound as a homogenous material.
Pooling and concentrating the appropriate fractions furnished the
5'-O-DMT nucleoside as a foam (1.5 g, 66.5%).
[0248] .sup.1H NMR (DMSO-d.sub.6) .delta. 2.02 (3H, s, SCH.sub.3),
3.15-3.55 (1H, m, 2'CH), 3.75 (6H, s, 2'CH.sub.3), 3.97 (1H, m,
4'H), 4.24 (1H, m, 3'H), 5.48 (1H, d, C.sub.5H), 5.73 (1H, d,
3'OH), 6.03 (1H, d, Cl'H), 6.82-7.4 (13H, m, ArH), 6.65 (1H, d,
C.sub.6H), 11.4 (1H, br s, NH).
[0249] G.
2'-Deoxy-3'-.beta.-[(N,N-diisopropyl)-O-.beta.-cyanoethylphospho-
ramide]-5'-O-(4,4'-dimethoxytrityl)-2'-methylthiouridine.
[0250] To a stirred solution of
2'-deoxy-5'-O-(4,4'-dimethoxytrityl)-2'-me- thylthiouridine (1.5 g,
2.67 mmol) in dry THF (25 mL) was added diisopropylethylamine (1.4
mL, 8 mmol) and the solution was cooled to 0.degree. C.
N,N,-Diisopropyl-.beta.-cyanoethylphosphoramidic chloride (1.26 mL,
5.34 mmol) was added dropwise over a period of 15 minutes. The
reaction mixture was then stirred at room temperature for 2 hours.
Ethyl acetate (100 mL, containing 1% triethylamine) was added and
the solution washed with saturated NaCl (2.times.50 mL) and the
organic layer dried over MgSO.sub.4. The solvent was removed under
reduced pressure and the residue purified by short silica gel (30
g) column chromatography. Elution with
CH.sub.2Cl.sub.2--MeOH-triethylamine (98:1:1) furnished the product
as a mixture of diastereomers. Evaporation of the appropriate
fractions provided the title compound as a foam (1.32 g,
64.7%).
[0251] .sup.1H NMR (CDCl.sub.3) .delta. 2.0 and 2.02 (3H, s,
SCH.sub.3), 5.3 and 5.35 (1H, 2d, C.sub.5H), 6.23 (1H, d, 1'H), 7.8
and 7.88 (1H, 2d, C.sub.6H) and other protons. .sup.31P NMR
(CDCl.sub.3) .delta. 151.68 and 152.2 ppm.
[0252] H. 2'-Deoxy-3',5'-di-O-acetyl-2'-methylthiouridine.
[0253] 2'-Deoxy-2'-methylthiouridine (5.0 g, 18.24 mmol) and acetic
anhydride (5.6 mL, 54.74 mmol) were stirred in dry pyridine (30 mL)
at room temperature for 12 hours. The products were then
concentrated under reduced pressure and the residue obtained was
purified by short silica gel column chromatography. The appropriate
fractions, which were eluted with CH.sub.2Cl.sub.2--MeOH (9:1),
were combined, evaporated under reduced pressure and the residue
crystallized from EtOH to give the title compound (6.0 g, 91.8%) as
white needles, m.p. 132.degree. C.
[0254] .sup.1H NMR (CDCl.sub.3) .delta. 2.17 (3H, s, SCH.sub.3),
2.20 (6H, s, 2COCH.sub.3), 3.40 (1H, t, 2'H), 4.31-4.40 (3H, m,
4',5'H), 5.31 (1H, m, 3'H), 5.80 (1H, d, C.sub.5H), 6.11 (1H, d,
1'H), 7.45 (1H, d, C.sub.6H), 8.7 (1H, br s, NH).
[0255] I.
2'-Deoxy-3',5'-di-O-acetyl-4-(1,2,4-triazol-yl)-2'-methylthiouri-
dine.
[0256] Triethylamine (8.4 mL, 60.3 mmol) and phosphoryl chloride
(1.2 mL, 12.9 mmol) were added to a stirred solution of
2'-deoxy-3',5'-di-O-acetyl- -2'-methylthiouridine (4.6 g, 13 mmol)
in MeCN (50 mL). 1,2,4-Triazole (4.14 g, 59.9 mmol) was then added
and the reactants were stirred at room temperature. After 16 hours,
triethylamine-H.sub.2O (6:1, 20 mL) was added, followed by
saturated aqueous NaHCO.sub.3 (100 mL), and the resulting mixture
was extracted with CH.sub.2Cl.sub.2 (2.times.100 mL). The organic
layer was dried with MgSO.sub.4 and evaporated under reduced
pressure. The residue was purified by short silica gel column
chromatography. The appropriate fractions, which were eluted with
CH.sub.2Cl.sub.2--MeOH (9:1), were evaporated under reduced
pressure and the residue was crystallized from EtOH to give the
title compound (3.01 g, 56.4%) as needles, m.p. 127-130.degree.
C.
[0257] .sup.1H NMR (CDCl.sub.3) .delta. 2.18 (6H, s, 2 COCH.sub.3),
2.30 (3H, s, SCH.sub.3), 3.67 (1H, m, 2'H), 4.38-4.50 (3H, m,
4',5'H), 5.17 (1H, t, 3'H), 6.21 (1H, d, 1'H), 7.08 (1H, d,
C.sub.5H), 8.16 (1H, s, CH), 8.33 (1H, d, C.sub.6H), 9.25 (1H, s,
NH).
[0258] J. 2'-Deoxy-2'-methylthiocytidine.
[0259]
2'-Deoxy-3',5'-di-O-acetyl-4-(1,2,4-triazol-1-yl)-2'-methylthiourid-
ine (3.0 g, 7.5 mmol) was dissolved in a saturated solution of
ammonia in MeOH (70 mL) and the solution was stirred at room
temperature in a pressure bottle for 3 days. The products were then
concentrated under reduced pressure and the residue was
crystallized from EtOH--CH.sub.2Cl.sub.2 to give the title compound
(1.06 g, 51.7%) as crystals, m.p. 201.degree. C.
[0260] .sup.1H NMR (DMSO-d.sub.6) .delta. 1.95 (3H, s, SCH.sub.3),
3.36 (1H, m, 2'H), 3.55 (2H, m, 5'CH.sub.2), 3.82 (1H, m, 4'H),
4.18 (1H, dd, 3'H), 5.75 (1H, d, C.sub.5H), 6.1 (1H, d, 1'H), 7.77
(1H, d, C.sub.6H).
[0261] Anal calcd. for C.sub.10H.sub.15N.sub.3O.sub.4S: C, 43.94;
H, 5.53; N, 15.37: S, 11.73. Found: C, 44.07; H, 5.45; N, 15.47; S,
11.80.
[0262] K. 2'-Deoxy-N.sup.4-benzoyl-2'-methylthiocytidine.
[0263] To a stirred solution of 2'-deoxy-2'-methylthiocytidine
(0.86 g, 3.15 mmol) in dry pyridine (20 mL) was added
trimethylchlorosilane (2 mL, 15.75 mmol), and stirring continued
for 15 minutes. Benzoyl chloride (2.18 mL, 18.9 mmol) was added to
the solution followed by stirring for 2 hours. The mixture was then
cooled in an ice bath and MeOH (10 mL) was added. After 5 minutes,
ammonium hydroxide (30% aq., 20 mL) was added and the mixture
stirred for 30 minutes. The reaction mixture was then concentrated
under reduced pressure and the residue purified by short silica gel
(70 g) column chromatography. Elution with CH.sub.2Cl.sub.2--MeOH
(9:1), pooling of the appropriate fractions and evaporation
furnished the title compound (0.55 g, 46.6%), which crystallized
from EtOH as needles, m.p. 193-194.degree. C.
[0264] L.
N.sup.4-Benzoylamino-1-[2'-deoxy-5'-(4,4'-dimethoxytrityl)-2-met-
hylthio-.beta.-D-ribofuranosyl]pyrimidin-3 (2H)-one or
2'-deoxy-N.sup.4-benzoyl-5'-(4,4'-dimethoxytrityl)-2'-methylthiocytidine)-
.
[0265] To a stirred solution of
2'-deoxy-N.sup.4-benzoyl-2'-methylthiocyti- dine (0.80 g, 2.12
mmol) in dry pyridine (10 mL) was added 4,4'-dimethoxytrityl
chloride (1.16 g, 3.41 mmol) and DMAP (10 mg) at room temperature.
The solution was stirred for 2 hours and the product concentrated
under reduced pressure. The residue was dissolved in
CH.sub.2Cl.sub.2 (70 mL), washed with saturated NaHCO.sub.3 (50
mL), saturated NaCl (2.times.50 mL), dried with MgSO.sub.4 and
evaporated under reduced pressure. The residue was purified by
short silica gel (50 g) column chromatography. Elution with
CH.sub.2Cl.sub.2-triethylamine (99:1), pooling and concentrating
the appropriate fractions furnished the title compound (1.29 g,
90%) as a white foam.
[0266] .sup.1H NMR (DMSO-d.sub.6) .delta. 2.1 (3H, s, SCH.sub.3),
3.5 (1H, m, 2'H), 3.75 (6H, s, OCH.sub.3), 4.15 (1H, m, 4'H), 4.4
(1H, t, 3'H), 5.74 (1H, br d, 3'OH), 6.15 (1H, d, C1H), 6.8-8.0
(25H, m, ArH and C.sub.5H), 8.24 (1H, d, C.sub.6H), 11.3 (1H, br s,
NH).
[0267] M.
2'-Deoxy-N.sup.4-Benzoyl-3-O-[(N,N-diisopropyl)-.beta.-cyanoethy-
lphosphoramide]-5'-O-(4,4'-dimethoxytrityl)-2'-methylthiocytidine).
[0268]
2'-Deoxy-N.sup.4-benzoyl-5'-(4,4'-dimethoxytrityl)-2'-methylthiocyt-
idine (1.41 g, 2.07 mmol) was treated with diisopropylethylamine
(1.4 mL, 8 mmol) and N,N-diisopropyl-.beta.-cyanoethylphosphoramide
chloride (1.26 mL, 5.34 mmol) in dry THF (25 mL) as described in
Example 8-G above. The crude product was purified by short silica
gel (50 g) column chromatography using
CH.sub.2Cl.sub.2-hexanes-triethylamine (89:10:1) as the eluent. The
appropriate fractions were pooled and evaporated under reduced
pressure to give the title compound (1.30 g, 71%) as a white foam
(mixture of diastereoisomers).
[0269] .sup.1H NMR (CDCl.sub.3) .delta. 2.31 (3H, s, SCH.sub.3),
3.45-3.7 (3H, m, 2'H and 5'CH.sub.2), 3.83 (6H, m, OCH.sub.3),
4.27-4.35 (1H, m, 4'H), 4.6-4.8 (1H, m, 3'H), 6.35 (1H, 2d, 1'H),
6.82-7.8 (25H, m, ArH and C.sub.5H), 8.38 and 8.45 (1H, 2d,
C.sub.6H) and other protons. .sub.31P NMR .delta. 151.03 and 151.08
ppm.
[0270] N. 2'-Deoxy-2'-methylsulfinylcytidine.
[0271] 2'-Deoxy-2'-methylthiocytidine of Example 8-J was treated as
per the procedure of Example 8-D to yield the title compound as a
mixture of diastereoisomers having a complex .sup.1H NMR
spectrum.
[0272] O. 2'-Deoxy-2'-methylsulfonylcytidine.
[0273] 2'-Deoxy-2'-methylthiocytidine of Example 8-J was treated as
per the procedure of Example 8-E to yield the title compound.
[0274] P.
N.sup.6-Benzoyl-3',5'-di-O-[tetrahydropyran-2-yl]-2'-deoxy-2'-me-
thylthioadenosine.
[0275]
N.sup.6-Benzoyl-9-[2'-O-trifluoromethylsulfonyl-3',5'-di-O-(tetrahy-
dropyran-2-yl)-.beta.-D-arabinofuranosyl]adenine from Example 1-D
is prepared by treatment with methanethiol in the presence of
tetramethylguanidine to yield the title compound.
[0276] Q . N.sup.6-Benzoyl-2'-deoxy-2'-methylthioadenosine.
[0277]
N.sup.6-Benzoyl-3',5'-di-O-(tetrahydropyran-2-yl)-.beta.-D-arabinof-
uranosyl]adenosine from Example 8-P is treated as per Example 1-F
to yield the title compound.
[0278] R. N.sup.6-Benzoyl-2'-deoxy-2'-methylsulfinyladenosine.
[0279] N.sup.6-Benzoyl-2'-deoxy-2'methylthioadenosine from Example
8-Q is treated as per the procedure of Example 8-D to yield the
title compound.
[0280] S. N.sup.6-Benzoyl-2'-deoxy-2'-methylsulfonyladenosine.
[0281] N'-Benzoyl-2'-deoxy-2'methylthioadenosine from Example 8-Q
is treated as per the procedure of Example 8-E to yield the title
compound.
[0282] T.
N.sup.2-Isobutyryl-3',5'-di-O-(tetrahydropyran-2-yl)-2'-deoxy-2'-
-methylthioguanosine.
[0283]
N.sup.2-Isobutyryl-9-(3',5'-di-O-[tetrahydropyran-2-yl]-2'-O-triflu-
oromethylsulfonyl-.beta.-D-arabinofuranosyl)guanine from Example
1-P is treated with methanethiol in the presence of
1,1,3,3-tetramethylguanidine to yield the title compound.
[0284] U. N.sup.2-Isobutyryl-2'-deoxy-2'-methylthioguanosine.
[0285]
N.sup.2-Isobutyryl-3',5'-di-O-(tetrahydropyran-2-yl)-2'-deoxy-2'-me-
thylthioguanosine is treated as per the procedure of Example 1-R to
yield the title compound.
[0286] V.
N.sup.2-Isobutyryl-2'-deoxy-2'-methylsulfinyl-guanosine.
[0287] N.sup.2-Isobutyryl-2'-deoxy-2'-methylthioguanosine from
Example 8-U is treated as per the procedure of Example 8-D to yield
the title compound.
[0288] W.
N.sup.2-Isobutyryl-2'-deoxy-2'-methylsulfonyl-guanosine.
[0289] N.sup.2-Isobutyryl-2'-deoxy-2'-methylthioguanosine from
Example 8-U is treated as per the procedure of Example 8-E to yield
the title compound.
[0290] X.
2'-Deoxy-5'-O-(4,4'-dimethoxytrityl)-2'-methylsulfinyluridine.
[0291] 2'-Deoxy-2'-methylsulfinyluridine from Example 8-D above is
treated as per the procedure of Example 8-F to yield the title
compound.
[0292] Y.
2'-Deoxy-3'-O-[(N,N-diisopropyl)-O-.beta.-cyanoethylphosphoramid-
e]-5'-O-(4,4'-dimethoxytrityl)-2'-methylsulfinyluridine.
[0293]
2'-Deoxy-5'-O-(4,4'-dimethoxytrityl)-2'-methylsulfinyluridine is
treated as per the procedure of Example 8-G to yield the title
compound.
[0294] Z.
N.sup.6Benzoyl-2'-deoxy-5'-O-(4,4'-dimethoxytrityl)-2'-methylthi-
oadenosine.
[0295] N.sup.6-Benzoyl-2'-deoxy-2'-methylthioadenosine from Example
8-Q above is treated as per the procedure of Example 8-F to yield
the title compound.
[0296] AA. N.sup.6
Benzoyl-2'-deoxy-3'-O-[(N,N-diisopropyl)-O-.beta.-cyano-
ethylphosphoramide]-5'-O-(4,4'-dimethoxytrityl-2'-methylthioadenosine.
[0297]
N.sup.6-Benzoyl-2'-deoxy-5'-O-(4,4'-dimethoxytrityl)-2'-methylthioa-
denosine is treated as per the procedure of Example 8-G to yield
the title compound.
[0298] BB.
2'-Deoxy-N.sup.2-isobutyryl-5'-O-(4,4'-dimethoxytrityl)-2'-meth-
ylthioadenosine.
[0299] 2'-Deoxy-N.sup.2-isobutyryl-2'-methylthioguanosine from
Example 8-U above is treated as per the procedure of Example 8-F to
yield the title compound.
[0300] CC.
2'-Deoxy-N.sup.2-isobutyryl-3'-O-[(N,N-diisopropyl)-O-.beta.-cy-
anoethylphosphoramide-5'-O-(4,4'-dimethoxytrityl-2'-methylthioguanosine.
[0301]
2'-Deoxy-N.sup.2-isobutyryl-5'-O-(4,4'-dimethoxytrityl)-2'-methylth-
ioguanosine is treated as per the procedure of Example 8-G to yield
the title compound.
[0302] DD .
2'-Deoxy-5'-O-(4,4'-dimethoxytrityl-2'-methylsulfonyluridine.
[0303] 2'-Deoxy-2'-methylsulfonyluridine from Example 8-E above is
treated as per the procedure of Example 8-F to yield the title
compound.
[0304] EE.
2'-Deoxy-3'-O-[(N,N-diisopropyl)-O-.beta.-cyanoethylphosphorami-
de]-5'-O-(4,4'-dimethoxytrityl-2'-methylsulfinyluridine.
[0305] 2'-Deoxy-5'-O-(4,4'dimethoxytrityl)-2'-methylsulfinyluridine
is treated as per the procedure of Example 8-G to yield the title
compound.
EXAMPLE 9
Chemical Conversion of an Thymine or Cytosine (Pyrimidine Type
Base) to its .beta.-D-2'-Deoxy-2'-substituted Erythropentofuranosyl
Nucleoside; 2'-Substituted Ribosylation)
[0306] The thymine or cytosine type analogs are trimethylsilylated
under standard conditions such as hexamethyldisilazane (HMDS) and
an acid catalyst (ie. ammonium chloride) and then treated with
3,5-O-ditoluoyl-2-deoxy-2-substituted-.alpha.-D-erythropentofuranosyl
chloride in the presence of Lewis acid catalysts (i.e. stannic
chloride, iodine, boron tetrafluoroborate, etc.). A specific
procedure has recently been described by Freskos [Nucleosides &
Nucleotides, 8, 1075 (1989)] in which copper (I) iodide is the
catalyst employed.
EXAMPLE 10
Chemical Conversion of an Adenine or Guanine (Purine Type Base) to
its .beta.-D-2'-deoxy-2'-substituted Erythropentofuranosyl
Nucleoside; 2'-Substituted Ribosylation)
[0307] The protected purine type analogs are converted to their
sodium salts via sodium hydride in acetonitrile and are then
treated with
3,5-O-ditoluoyl-2-deoxy-2-substituted-.alpha.-D-erythro-pentofuranosyl
chloride at ambient temperature. A specific procedure has recently
been described by Robins et al. [Journal of American Chemical
Society, 106, 6379 (1984)].
EXAMPLE 11
Conversion of 2'-Deoxy-2-substituted Thymidines to the
Corresponding 2'-Deoxy-2'-substituted Cytidines (Chemical
Conversion of an Pyrimidine Type 4-Keto Group to an 4-Amino
Group)
[0308] The 3' and 5' sugar hydroxyls of the 2'modified nucleoside
types are protected by acyl groups such as toluoyl, benzoyl,
p-nitrobenzoyl, acetyl, isobutryl, trifluoroacetyl, etc. under
standards conditions using acid chlorides or anhydrides, pyridine
as the solvent and dimethylaminopyridine as a catalyst. The
protected nucleoside is next chlorinated with thionyl chloride or
phosphoryl chloride in pyridine or another appropriate basic
solvent. The 4-chloro group is then displaced with ammonia in
methanol. Deprotection of the sugar hydroxyls also takes place. The
amino group is benzoylated and the acyl groups are selectively
removed by aqueous sodium hydroxide solution. Alternatively, the in
situ process of first treating the nucleoside with
chlprotrimethylsilane and base to protect the sugar hydroxyls from
subsequent acylation may be employed. [Ogilvie, Can J. Chem., 67,
831 (1989)] Another conversion approach is to replace the 4-chloro
group with a 1,2,4-triazolo group which remains intact throughout
the oligonucleotide synthesis on the automated synthesizer and is
displaced by ammonia during treatment with ammonium hydroxide which
cleaves the oligonucleotide from the CPG support and effects
deprotection of the heterocycle. Furthermore, in many cases the
4-chloro group can be utilized as described and replaced at the end
of oligonucleotide synthesis.
EXAMPLE 12
Procedure for the Attachment of 2'-Deoxy-2'-substituted
5'-Dimethoxytriphenylmethyl Ribonucleosides to the 5'-Hydroxyl of
Nucleosides Bound to CPG Support
[0309] The 2'-deoxy-2'-substituted nucleoside that will reside at
the terminal 3'-position of the oligonucleotide is protected as a
5'-DMT group (the cytosine and adenine exocyclic amino groups are
benzoylated and the guanine amino is isobutrylated) and treated
with trifluoroacetic acid/bromoacetic acid mixed anhydride in
pyridine and dimethylaminopyridine at 50.degree. C. for five hours.
The solution is then evaporated under reduced pressure to a thin
syrup which is dissolved in ethyl acetate and passed through a
column of silica gel. The homogenous fractions are collected and
evaporated to dryness. A solution of 10 mL of acetonitrile, 10
.mu.M of the 3'-O-bromomethylester-modified pyrimidine nucleoside,
and 1 mL of pyridine/dimethylaminopyridine (1:1) is syringed slowly
(60 to 90 sec) through a 1 .mu.M column of CPG thymidine (Applied
Biosystems, Inc.) that had previously been treated with acid
according to standard conditions to afford the free 5'-hydroxyl
group. Other nucleoside-bound CPG columns may be employed. The
eluent is collected and syringed again through the column. This
process is repeated three times. The CPG column is washed slowly
with 10 mL of acetonitrile and then attached to an ABI 380B nucleic
acid synthesizer. Oligonucleotide synthesis is now initiated. The
standard conditions of concentrated ammonium hydroxide deprotection
that cleaves the thymidine ester linkage from the CPG support also
cleaves the 3',5' ester linkage connecting the pyrimidine modified
nucleoside to the thymidine that was initially bound to the CPG
nucleoside. In this manner, any 2'-substituted nucleoside or
generally any nucleoside with modifications in the heterocycle
and/or sugar can be attached at the 3' end of an
oligonucleotide.
EXAMPLE 13
Procedure for the Conversion of 2'-Deoxy-2'-substituted
Ribonucleoside-5'-DMT-3'-phosphoramidites into Oligonucleotides
[0310] The polyribonucleotide solid phase synthesis procedure of
Sproat et al. [Nucleic Acids Research, 17, 3373 (1989)] is utilized
to prepare 2'-modified oligonucleotides.
[0311] Oligonucleotides of the sequence CGACTATGCAAGTAC (SEQ ID NO:
21) having 2'-deoxy-2'-fluoro nucleotides were incorporated at
various positions within this sequence. In a first oligonucleotide,
each of the adenosine nucleotides at positions 3, 6, 10, 11 and 14
(5' to 3' direction) were modified to include a 2'-deoxy-2'-fluoro
moiety. In a further oligonucleotide, the adenosine and the
thymidine nucleotides at positions 3, 5, 6, 7, 10, 11, 13 and 14
were so modified. In a further oligonucleotide, the adenosine,
thymidine and cytidine nucleotides at positions 1, 3, 4, 5, 6, 7,
9, 10, 11, 13 and 14 were so modified, and in even a further
oligonucleotide, the nucleotides (adenosine, thymidine, cytidine
and guanosine) at every position were so modified. Additionally, an
oligonucleotide having the sequence CTCGTACCTTCCGGTCC (SEQ ID NO:
22) was prepared having adenosine, thymidine and cytidine
nucleotides at positions 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 15 and
16 also modified to contain 2'-deoxy-2'-fluoro substituents.
[0312] Various oligonucleotides were prepared incorporating
nucleotides having 2'-deoxy-2'-methylthio substituents. For
ascertaining the coupling efficiencies of 2'-deoxy-2'-methylthio
bearing nucleotides into oligonucleotides, the trimer TCC and the
tetramer TUU U were synthesized. In the trimer, the central
cytidine nucleotide (the second nucleotide) included a
2'-deoxy-2'-methylthio substituent. In the tetramer, each of the
uridine nucleotides included a 2'-deoxy-2'methylthio substituent.
In further oligonucleotides, 2'-deoxy-2'-methylthio substituent
bearing nucleotides were incorporated within the oligonucleotide
sequence in selected sequence positions. Each of the nucleotides at
the remaining sequence positions incorporated a 2'-O-methyl
substituent. Thus, all the nucleotides within the oligonucleotide
included a substituent group thereon, either a
2'-deoxy-2'-methylthio substituent or a 2'-O-methyl substituent.
These oligonucleotides are: GAGCUCCCAGGC (SEQ ID NO: 23) having
2'-deoxy-2'-methylthio substituents at positions 4, 5, 6, 7 and 8;
CGACUAUGCAAGUAC (SEQ ID NO: 24) having 2'-deoxy-2'-methylthio
substituents at positions 1, 4, 5, 7, 9 and 13; UCCAGGUGUCCGAUC
(SEQ ID NO: 25) having 2'-deoxy-2'-methylthio substituents at
positions 1, 2, 3, 7, 9, 10, 11 and 14; TCCAGGCCGUUUC (SEQ ID NO:
26) having 2'-deoxy-2'-methylthio substituents at positions 10, 11
and 12; and TCCAGGTGTCCCC (SEQ ID NO: 27) having
2'-deoxy-2'-methylthio substituents at positions 10, 11 and 12.
EXAMPLE 14
Preparation of 2'-Deoxy-2'-fluoro Modified Phosphorothioates
Oligonucleotides
[0313] 2'-Deoxy-2'-substituted 5'-DMT nucleoside
3'-phosphoramidites prepared as described in Examples 1-7 were
inserted into sequence-specific oligonucleotide phosphorothioates
as described by Beaucage et al. [Journal of American Chemical
Society, 112, 1253 (1990)] and Sproat et al. [Nucleic Acids
Research, 17, 3373 (1989)].
[0314] Oligonucleotides of the sequence CGA CTA TGC AAG TAC having
phosphorothioate backbone linkages and 2'-deoxy-2'-fluoro
substituent bearing nucleotides were incorporated at various
positions within this sequence. In a first oligonucleotide, each of
the backbone linkages was a phosphorothioate linkage and each of
the adenosine, thymidine and cytidine nucleotides at positions 1,
3, 4, 5, 6, 7, 9, 10, 11, 13 and 14 (5' to 3' direction) were
modified to include a 2'-deoxy-2'-fluoro moiety. In a further
oligonucleotide, each of the backbone linkages was a
phosphorothioate linkage and the nucleotides (adenosine, thymidine,
cytidine and guanosine) at every position were modified to include
a 2'-deoxy-2'-fluoro moiety.
EXAMPLE 15
Preparation of 2'-Deoxy-2'-fluoro Modified Phosphate Methylated
Oligonucleotides
[0315] The protection, tosyl chloride mediated methanolysis, and
mild deprotection described by Koole et al. [Journal of Organic
Chemistry, 54, 1657 (1989)] is applied to 2'-substituted
oligonucleotides to afford phosphate-methylated 2'-substituted
oligonucleotides.
EXAMPLE 16
Hybridization Analysis
[0316] A. Evaluation of the Thermodynamics of Hybridization of
2'-Modified Oligonucleotides.
[0317] The ability of the 2'-modified oligonucleotides to hybridize
to their complementary RNA or DNA sequences was determined by
thermal melting analysis. The RNA complement was synthesized from
T7 RNA polymerase and a template-promoter of DNA synthesized with
an Applied Biosystems, Inc. 380B RNA species was purified by ion
exchange using FPLC (LKB Pharmacia, Inc.). Natural antisense
oligonucleotides or those containing 2'-modifications at specific
locations were added to either the RNA or DNA complement at
stoichiometric concentrations and the absorbance (260 nm)
hyperchromicity upon duplex to random coil transition was monitored
using a Gilford Response II spectrophotometer. These measurements
were performed in a buffer of 10 mM Na-phosphate, pH 7.4, 0.1 mM
EDTA, and NaCl to yield an ionic strength of 10 either 0.1 M or 1.0
M. Data was analyzed by a graphic representation of 1/T.sub.m vs
ln[Ct], where [Ct] was the total oligonucleotide concentration.
From this analysis the thermodynamic parameters were determined.
Based upon the information gained concerning the stability of the
duplex of heteroduplex formed, the placement of modified pyrimidine
into oligonucleotides were assessed for their effects on helix
stability. Modifications that drastically alter the stability of
the hybrid exhibit reductions in the free energy (delta G) and
decisions concerning their usefulness as antisense oligonucleotides
were made.
[0318] As is shown in the following table (Table 1), the
incorporation of 2'-deoxy-2'-fluoro nucleotides into
oligonucleotides resulted in significant increases in the duplex
stability of the modified oligonucletide strand (the antisense
strand) and its complementary RNA strand (the sense strand). In
both, phosphodiester backbone and phosphorothioate backbone
oligonucleotides, the stability of the duplex increased as the
number of 2'-deoxy-2'-fluoro-containing nucleotides in the
antisense strand increased. As is evident from Table 1, without
exception, the addition of a 2'-deoxy-2'-fluoro bearing nucleotide,
irrespective of the individual substituent bearing nucleotide or
the position of that nucleotide in the oligonucleotide sequence,
resulted in an increase in the duplex stability.
[0319] In Table 1, the underlined nucleotides represent nucleotides
that include 1 2'-deoxy-2'-fluoro substituent. The oligonucleotides
prefaced with the designation "ps" have a phosphorothioate
backbone. Unlabeled oligonucleotides have phosphodiester
backbones.
1TABLE 1 EFFECTS OF 2'-DEOXY-2'-FLUORO MODIFICATIONS ON DNA
(ANTISENSE) RNA (SENSE) DUPLEX STABILITY G.degree.37 G.degree.37
T.sub.m (.degree. C.)/ Antisense Sequence (kcal/mol) (kcal/mol)
T.sub.m (.degree. C.) T.sub.m (.degree. C.) subst. CGA CTA TGC AAG
TAC -10.11 .+-. 0.04 45.1 (SEQ ID NO:21) CGA CTA TGC AAG TAC -13.61
.+-. 0.08 -3.50 .+-. 0.09 53.0 +7.9 +1.6 (SEQ ID NO:21) CGA CUA UGC
AAG UAC -16.18 .+-. 0.08 -6.07 .+-. 0.09 58.9 +13.8 +1.7 (SEQ ID
NO:24) CGA CUA UGC AAG UAC -19.85 .+-. 0.05 -9.74 .+-. 0.06 65.2
+20.1 +1.8 (SEQ ID NO:24) ps(CGA CTA TGC AAG TAC) -7.58 .+-. 0.06
33.9 -11.2 (SEQ ID NO:21) ps(CGA CUA UGC AAG UAC) -15.90 .+-. 0.34
-8.32 .+-. 0.34 60.9 +27.0 +2.5 (SEQ ID NO:24) CTC GTA CCT TCC GGT
CC -14.57 .+-. 0.13 61.6 (SEQ ID NO:22) CUC GUA CCU UCC GGU CC
-27.81 .+-. 0.05 -13.24 .+-. 0.14 81.6 +1.4 (SEQ ID NO:28)
[0320] As is evident from Table 1, the duplexes formed between RNA
and oligonucleotides containing 2'-deoxy-2'-fluoro substituted
nucleotides exhibited increased binding stability as measured by
the hybridization thermodynamic stability. Delta T.sub.ms of
greater than 20.degree. C. were measured. By modifying the backbone
to a phosphorothioate backbone, even greater delta T.sub.ms were
observed. In this instance, delta T.sub.ms greater than 31.degree.
C. were measured. These fluoro-substituted oligonucleotides
exhibited a consistent and additive increase in the thermodynamic
stability of the duplexes formed with RNA. While we do not wish to
be bound by theory, it is presently believed that the presence of a
2'-fluoro substituent results in the sugar moiety of the
2'-fluoro-substituted nucleotide assuming substantially a 3'-endo
conformation and this results in the oligonucleotide-RNA complex
assuming an A-type helical conformation.
[0321] B. Fidelity of Hybridization of 2'-Modified
Oligonucleotides
[0322] The ability of the 2'-modified antisense oligonucleotides to
hybridize with absolute specificity to the targeted mRNA was shown
by Northern blot analysis of purified target mRNA in the presence
of total cellular RNA. Target mRNA was synthesized from a vector
containing the cDNA for the target mRNA located downstream from a
T7 RNA polymerase promoter. Synthesized mRNA was electrophoresed in
an agarose gel and transferred to a suitable support membrane (i.e.
nitrocellulose). The support membrane was blocked and probed using
.sup.32P-labeled antisense oligonucleotides. The stringency will be
determined by replicate blots and washing in either elevated
temperatures or decreased ionic strength of the wash buffer.
Autoradiography was performed to assess the presence of
heteroduplex formation and the autoradiogram quantitated by laser
densitometry (LKB Pharmacia, Inc.). The specificity of hybrid
formation was determined by isolation of total cellular RNA by
standard techniques and its analysis by agarose electrophoresis,
membrane transfer and probing with the labeled 2'-modified
oligonucleotides. Stringency was predetermined for the unmodified
antisense oligonucleotides and the conditions used such that only
the specifically targeted mRNA was capable of forming a
heteroduplex with the 2'-modified oligonucleotide.
[0323] C. Base-pair Specificity of Oligonucleotides and RNA
[0324] Base-pair specificity of 2'-deoxy-2'-fluoro modified
oligonucleotides with the RNA complement (a "Y" strand) was
determined by effecting single base-pair mismatches and a bulge.
The results of these determinations are shown in Table 2. An 18mer
"X" strand oligonucleotide containing 14 adenosine, thymidine and
cytidine nucleotides having a 2'-deoxy-2'-fluoro substituent was
hybridized with the RNA complement "Y" strand in which the 10th
position was varied. In Table 2, the underlined nucleotides
represent nucleotides that include a 2'-deoxy-2'-fluoro
substituent.
[0325] As is evident from Table 2, the 2'-deoxy-2'-fluoro modified
oligonucleotide formed a duplex with the RNA complement with
greater specificity than a like-sequenced unmodified
oligonucleotide.
2TABLE 2 EFFECTS OF SINGLE BASE MISMATCHES ON 2'-DEOXY-2'-FLUORO
MODIFIED DNA-RNA DUPLEX STABILITY G.degree.37 G.degree.37 T.sub.m
T.sub.m Y Base pair type (kcal/mol) (kcal/mol) (.degree. C.)
(.degree. C.) X strand: deoxy(CTC GTA CCT TTC CGG TCC) (SEQ ID NO:
29) Y strand: ribo(.sup.3'GAG CAU GGY AAG GCC AGG.sup.5') (SEQ ID
NO: 30) A Watson-Crick -14.57 .+-. 0.13 61.6 C T-C mismatch -12.78
.+-. 0.11 1.79 .+-. 0.17 54.4 -7.2 G T-G mismatch -16.39 .+-. 0.25
-1.82 .+-. 0.28 61.7 0.1 U T-U mismatch -13.48 .+-. 0.17 1.09 .+-.
0.22 55.9 -5.7 None Bulged T -14.86 .+-. 0.35 -0.284 .+-. 0.37 59.4
-2.2 X strand: deoxy(CUC GUA CCU UUC CGG UCC) (SEQ ID NO: 31) Y
strand: ribo(.sup.3'GAG CAU GGY AAG GCC AGG.sup.5') (SEQ ID NO: 30)
A Watson-Crick -27.80 .+-. 0.05 81.6 C U-C mismatch -21.98 .+-.
0.28 5.82 .+-. 0.28 73.8 -7.8 G U-G mismatch -21.69 .+-. 0.16 6.12
.+-. 0.17 77.8 -3.8 U U-U mismatch -18.68 .+-. 0.15 9.13 .+-. 0.16
73.6 -8.0 None Bulged U -22.87 .+-. 0.27 4.94 .+-. 0.27 75.5
-6.2
EXAMPLE 17
Nuclease Resistance
[0326] A. Evaluation of the Resistance of 2'-Modified
Oligonucleotides to Serum and Cytoplasmic Nucleases.
[0327] Natural phosphorothioate, and 2-modified oligonucleotides
were assessed for their resistance to serum nucleases by incubation
of the oligonucleotides in media containing various concentrations
of fetal calf serum or adult human serum. Labeled oligonucleotides
were incubated for various times, treated with protease K and then
analyzed by gel electrophoresis on 20% polyacrylamide-urea
denaturing gels and subsequent autoradiography. Autoradiograms were
quantitated by laser densitometry. Based upon the location of the
modifications and the known length of the oligonucleotide it was
possible to determine the effect on nuclease degradation by the
particular 2'-modification. For the cytoplasmic nucleases, a HL60
cell line was used. A post-mitochondrial supernatant was prepared
by differential centrifugation and the labeled oligonucleotides
were incubated in this supernatant for various times. Following the
incubation, oligonucleotides were assessed for degradation as
outlined above for serum nucleolytic degradation. Autoradiography
results were quantitated for comparison of the unmodified, the
phosphorothioates, and the 2'-modified oligonucleotides.
[0328] Utilizing these test systems, the stability of a 15 mer
oligonucleotide having 2'-deoxy-2'-fluoro-substituted nucleotides
at positions 12 and 14 and a phosphorothioate backbone were
investigated. As a control, an unsubstituted phosphodiester
oligonucleotide was 50% degraded within 1 hour, and 100% degraded
within 20 hours. In comparison, for the
2'-deoxy-2'-fluoro-substituted oligonucleotide having a
phosphorothioate backbone, degradation was limited to less that 10%
after 20 hours.
[0329] B. Evaluation of the Resistance of 2'-Modified
Oligonucleotides to Specific Endo- and Exonucleases.
[0330] Evaluation of the resistance of natural and 2'-modified
oligonucleotides to specific nucleases (i.e., endonucleases,
3',5'-exo-, and 5',3'-exonucleases) was done to determine the exact
effect of the modifications on degradation. Modified
oligonucleotides were incubated in defined reaction buffers
specific for various selected nucleases. Following treatment of the
products with protease K, urea was added and analysis on 20%
poly-acrylamide gels containing urea was done. Gel products were
visualized by staining using Stains All (Sigma Chemical Co.). Laser
densitometry was used to quantitate the extend of degradation. The
effects of the 2'-modifications were determined for specific
nucleases and compared with the results obtained from the serum and
cytoplasmic systems.
EXAMPLE 18
Oligonucleotide Synthesis
[0331] Unsubstituted and substituted oligonucleotides were
synthesized on an automated DNA synthesizer (Applied Biosystems
model 380B) using standard phosphoramidite chemistry with oxidation
by iodine. For phosphorothioate oligonucleotides, the standard
oxidation bottle was replaced by 0.2 M solution of
3H-1,2-benzodithiole-3-one-1,1-dioxide in acetonitrile for the step
wise thiation of the phosphite linkages. The thiation wait step was
increased to 68 sec and was followed by the capping step. After
cleavage from the CPG column and deblocking in concentrated
ammonium hydroxide at 55.degree. C. (18 hours), the
oligonucleotides were purified by precipitating twice with 2.5
volumes of ethanol from a 0.5 M NaCl solution. Analytical gel
electrophoresis was accomplished in 20% acrylamide, 8 M urea, 454
mM Tris-borate buffer, pH=7.0. Oligonucleotides and
phosphorothioates were judged, based on polyacrylamide gel
electrophoresis, to be greater than 80% full-length material.
EXAMPLE 19
Oligonucleotide Having 2'-Substituted Oligonucleotides Regions
Flanking Central 2'-Deoxy Phosphorothioate Oligonucleotide
Region
[0332] A 15 mer RNA target of the sequence 5'GCGTTTTTTTTTTGCG 3'
(SEQ ID NO: 32) was prepared in the normal manner on the DNA
sequencer using RNA protocols. A series of complementary
phosphorothioate oligonucleotides having 2'-O-substituted
nucleotides in regions that flank a 2'-deoxy region were prepared
utilizing 2'-O-substituted nucleotide precursors prepared as per
known literature preparations, i.e. 2'-O-methyl, or as per the
procedure of International Publication Number WO 92/03568,
published Mar. 5, 1992. The 2'-O-substituted nucleotides were added
as their 5'-O-dimethoxytrityl-3'-phosphoramidites in the normal
manner on the DNA synthesizer. The complementary oligonucleotides
have the sequence of 5' CGCAAAAAAAAAAAAACGC 3' (SEQ ID NO: 33). The
2'-O-substituent was located in CGC and CG regions of these
oligonucleotides. The following 2'-O-substituents were used:
2'-fluoro; 2'-O-methyl; 2'-O-propyl; 2'-O-allyl; 2'-O-aminopropoxy;
2'-O-(methoxyethoxyethyl), 2'-O-imidazolebutoxy and
2'-O-imidazolepropoxy.
EXAMPLE 20
Ras-Luciferase Reporter Gene Assembly
[0333] The ras-luciferase reporter genes described in this study
were assembled using PCR technology. Oligonucleotide primers were
synthesized for use as primers for PCR cloning of the 5'-regions of
exon 1 of both the mutant (codon 12) and non-mutant (wild-type)
human H-ras genes. H-ras gene templates were purchased from the
American Type Culture Collection (ATCC numbers 41000 and 41001) in
Bethesda, Md. The oligonucleotide PCR primers
5'-ACA-TTA-TGC-TAG-CTT-TTT-GAG-TAA-ACT-TGT-GGG-GCA-GGA-GAC-CCT-GT-
-3' (sense) (SEQ ID NO: 34), and
5'-GAG-ATC-TGA-AGC-TTC-TGG-ATG-GTC-AGC-GC- -3' (antisense) (SEQ ID
NO: 35), were used in standard PCR reactions using mutant and
non-mutant H-ras genes as templates. These primers are expected to
produce a DNA product of 145 base pairs corresponding to sequences
-53 to +65 (relative to the translational initiation site) of
normal and mutant H-ras, flanked by NheI and HindIII restriction
endonuclease sites. The PCR product was gel purified, precipitated,
washed and resuspended in water using standard procedures.
[0334] PCR primers for the cloning of the P. pyralis (firefly)
luciferase gene were designed such that the PCR product would code
for the full-length luciferase protein with the exception of the
amino-terminal methionine residue, which would be replaced with two
amino acids, an amino-terminal lysine residue followed by a leucine
residue. The oligonucleotide PCR primers used for the cloning of
the luciferase gene were
5'-GAG-ATC-TGA-AGC-TTG-AAG-ACG-CCA-AAA-ACA-TAA-AG-3' (sense) (SEQ
ID NO: 36), and 5'-ACG-CAT-CTG-GCG-CGC-CGA-TAC-CGT-CGA-CCT-CGA-3'
(antisense) (SEQ ID NO: 37), were used in standard PCR reactions
using a commercially available plasmid (pT3/T7-Luc) (Clontech),
containing the luciferase reporter gene, as a template. These
primers were expected to yield a product of approximately 1.9 kb
corresponding to the luciferase gene, flanked by HindIII and BssHII
restriction endonuclease sites. This fragment was gel purified,
precipitated, washed and resuspended in water using standard
procedures.
[0335] To complete the assembly of the ras-luciferase fusion
reporter gene, the ras and luciferase PCR products were digested
with the appropriate restriction endonucleases and cloned by
three-part ligation into an expression vector containing the
steroid-inducible mouse mammary tumor virus promotor MMTV using the
restriction endonucleases NheI, HindIII and BssHII. The resulting
clone results in the insertion of H-ras 5' sequences (-53 to +65)
fused in frame with the firefly luciferase gene. The resulting
expression vector encodes a ras-luciferase fusion product which is
expressed under control of the steroid-inducible MMTV promoter.
EXAMPLE 21
Transfection of Cells With Plasmid DNA
[0336] Transfections were performed as described by Greenberg in
Current Protocols in Molecular Biology, Ausubel et al., Eds., John
Wiley and Sons, New York, with the following modifications: HeLa
cells were plated on 60 mm dishes at 5.times.10.sup.5 cells/dish. A
total of 10 .mu.g of DNA was added to each dish, of which 9 .mu.g
was ras-luciferase reporter plasmid and 1 .mu.g was a vector
expressing the rat glucocorticoid receptor under control of the
constitutive Rous sarcoma virus (RSV) promoter. Calcium
phosphate-DNA coprecipitates were removed after 16-20 hours by
washing with Tris-buffered saline [50 Mm Tris-Cl (pH 7.5), 150 mM
NaCl] containing 3 mM EGTA. Fresh medium supplemented with 10%
fetal bovine serum was then added to the cells. At this time, cells
were pretreated with antisense oligonucleotides prior to activation
of reporter gene expression by dexamethasone.
EXAMPLE 22
Oligonucleotide Treatment of Cells
[0337] Immediately following plasmid transfection, cells were
thrice washed with OptiMEM (GIBCO), and prewarmed to 37.degree. C.
2 ml of OptiMEM containing 10 .mu.g/ml
N-[1-(2,3-diolethyloxy)propyl]-N,N,N,-trim- ethylammonium chloride
(DOTMA) (Bethesda Research Labs, Gaithersburg, Md.) was added to
each dish and oligonucleotides were added directly and incubated
for 4 hours at 37.degree. C. OptiMEM was then removed and replaced
with the appropriate cell growth medium containing oligonucleotide.
At this time, reporter gene expression was activated by treatment
of cells with dexamethasone to a final concentration of 0.2 .mu.M.
Cells were harvested 12-16 hours following steroid treatment.
EXAMPLE 23
Luciferase Assays
[0338] Luciferase was extracted from cells by lysis with the
detergent Triton X-100, as described by Greenberg in Current
Protocols in Molecular Biology, Ausubel et al., Eds., John Wiley
and Sons, New York. A Dynatech ML1000 luminometer was used to
measure peak luminescence upon addition of luciferin (Sigma) to 625
.mu.M. For each extract, luciferase assays were performed multiple
times, using differing amounts of extract to ensure that the data
were gathered in the linear range of the assay.
EXAMPLE 24
Antisense Oligonucleotide Inhibition of ras-Luciferase Gene
Expression
[0339] A series of antisense phosphorothioate oligonucleotide
analogs targeted to the codon-12 point mutation of activated H-ras
were tested using the ras-luciferase reporter gene system described
in the foregoing examples. This series comprised a basic sequence
and analogs of that basic sequence. The basic sequence was of known
activity as reported in International Publication Number WO
92/22651 identified above. In both the basic sequence and its
analogs, each of the nucleotide subunits incorporated
phosphorothioate linkages to provide nuclease resistance. Each of
the analogs incorporated nucleotide subunits that contained
2'-O-methyl substitutions and 2'-deoxy-erythro-pentofuranosyl
sugars. In the analogs, a subsequence of the
2'-deoxy-erythro-pentofuranosyl sugar-containing subunits was
flanked on both ends by subsequences of 2'-O-methyl substituted
subunits. The analogs differed from one another with respect to the
length of the subsequence of the 2'-deoxy-erythro-pentofuranosyl
sugar containing nucleotides. The length of these subsequences
varied by 2 nucleotides between 1 and 9 total nucleotides. The
2'-deoxy-erythro-pentofuranosyl nucleotide sub-sequences were
centered at the point mutation of the codon-12 point mutation of
the activated ras.
[0340] The base sequences, sequence reference numbers and sequence
ID numbers of these oligonucleotides (all are phosphorothioate
analogs) are shown in Table 3. In this table those nucleotides
identified with a ".sup.M" contain a 2'-O-methyl substituent group
and the remainder of the nucleotides identified with a ".sub.d" are
2'-deoxy-erythro-pentofuranosy- l nucleotides.
3TABLE 3 Chimeric 2'-O-methyl P = S oligonucleotides SEQ ID OLIGO
SEQUENCE NO: 2570 C.sub.dC.sub.dA.sub.d C.sub.dA.sub.dC.sub.d
C.sub.dG.sub.dA.sub.d C.sub.dG.sub.dG.sub.d C.sub.dG.sub.dC.sub.d
C.sub.dC.sub.d 1 3975 C.sup.MC.sup.MA.sup.M C.sup.MA.sup.MC.sup.M
C.sup.MG.sup.MA.sub.d C.sup.MG.sup.MG.sup.M C.sup.MG.sup.MC.sup.M 1
C.sup.MC.sup.M 3979 C.sup.MC.sup.MA.sup.M C.sup.MA.sup.MC.sup.M
C.sup.MG.sub.dA.sub.d C.sub.dG.sup.MG.sup.M C.sup.MG.sup.MC.sup.M
C.sup.MC.sup.M 1 3980 C.sup.MC.sup.MA.sup.M C.sup.MA.sup.MC.sup.M
C.sub.dG.sub.dA.sub.d C.sub.dG.sub.dG.sup.M C.sup.MG.sup.MC.sup.M
C.sup.MC.sup.M 1 3985 C.sup.MC.sup.MA.sup.M C.sup.MA.sup.MC.sub.d
C.sub.dG.sub.dA.sub.d C.sub.dG.sub.dG.sub.d C.sup.MG.sup.MC.sup.M
C.sup.MC.sup.M 1 3984 C.sup.MC.sup.MA.sup.M C.sup.MA.sub.dC.sub.d
C.sub.dG.sub.dA.sub.d C.sub.dG.sub.dG.sub.d C.sub.dG.sup.MC.sup.M
C.sup.MC.sup.M 1
[0341] FIG. 1 shows dose-response data in which cells were treated
with the phosphorothioate oligonucleotides of Table 3.
Oligonucleotide 2570 is targeted to the codon-12 point mutation of
mutant (activated) H-ras RNA. The other nucleotides have
2'-O-methyl substituents groups thereon to increase binding
affinity with sections of various lengths of interspaced
2'-deoxy-erythro-pentofuranosyl nucleotides. The control
oligonucleotide is a random phosphorothioate oligonucleotide
analog, 20 bases long. Results are expressed as percentage of
luciferase activity in transfected cells not treated with
oligonucleotide. As the figure shows, treatment of cells with
increasing concentrations of oligonucleotide 2570 resulted in a
dose-dependent inhibition of ras-luciferase activity in cells
expressing the mutant form of ras-luciferase. Oligonucleotide 2570
displays an approximate threefold selectivity toward the mutant
form of ras-luciferase as compared to the normal form. As is
further seen in FIG. 1, each of the oligonucleotides 3980, 3985 and
3984 exhibited greater inhibition of ras-luciferase activity than
did oligonucleotide 2570. The greatest inhibition was displayed by
oligonucleotide 3985 that has a subsequence of
2'-deoxy-erythro-pentofuranosyl nucleotides seven nucleotides long.
oligonucleotide 3980, having a five nucleotide long
2'-deoxy-erythro-pentofuranosyl nucleotide subsequence exhibited
the next greatest inhibition followed by oligonucleotide 3984 that
has a nine nucleotide 2'-deoxy-erythro-pentofuranosyl nucleotide
subsequence.
[0342] FIG. 2 shows the results similar to FIG. 1 except it is in
bar graph form. Further seen on FIG. 2 is the activity of
oligonucleotide 3975 and oligonucleotide 3979. These
oligonucleotides have subsequences of
2'-deoxy-erythro-pentofuranosyl nucleotides one and three
nucleotides long, respectively. As is evident from FIG. 2, neither
of the oligonucleotides having either the one or the three
2'-deoxy-erythro-pentofuranosyl nucleotide subsequences showed
significant activity. There was measurable activity for the three
nucleotide subsequence oligonucleotide 3979 at the highest
concentration dose.
[0343] The increases in activity of oligonucleotides 3980, 3985 and
3984 compared to oligonucleotide 2570 is attributed to the increase
in binding affinity imparted to these compounds by the 2'-O-methyl
substituent groups located on the compounds and by the RNase H
activation imparted to these compounds by incorporation of a
subsequence of 2'-deoxy-erythro-pentofuranosyl nucleotides within
the main sequence of nucleotides. In contrast to the active
compounds of the invention, it is interesting to note that
sequences identical to those of the active oligonucleotides 2570,
3980, 3985 and 3984 but having phosphodiester linkages in stead of
the phosphorothioate linkages of the active oligonucleotides of the
invention showed no activity. This is attributed to these
phosphodiester compounds being substrates for nucleases that
degrade such phosphodiester compounds thus preventing them
potentially activating RNase H. Other sugar modifications: The
effects of other 2' sugar modifications besides 2'-O-methyl on
antisense activity in chimeric oligonucleotides have been examined.
These modifications are listed in Table 4, along with the T.sub.m
values obtained when 17 mer oligonucleotides having 2'-modified
nucleotides flanking a 7-base deoxy gap were hybridized with a 25
mer oligoribonucleotide complement as described in Example 25. A
relationship was observed for these oligonucleotides between alkyl
length at the 2' position and T.sub.m. As alkyl length increased,
T.sub.m decreased. The 2'-fluoro chimeric oligonucleotide displayed
the highest T.sub.m of the series.
4TABLE 4 Correlation of T.sub.m with Antisense Activity 2'-modified
17-mer with 7-deoxy gap CCACACCGACGGCGCCC (SEQ ID NO: 1) 2'
MODIFICATION T.sub.m (.degree. C.) IC.sub.50 (nM) Deoxy 6 4.2 150
O-Pentyl 6 8.5 150 O-Propyl 7 0.4 70 O-Methyl 7 4.7 20 Fluoro 7 6.9
10
[0344] These 2' modified oligonucleotides were tested for antisense
activity against H-ras using the transactivation reporter gene
assay described in Example 26. All of these 2' modified chimeric
compounds inhibited ras expression, with the 2'-fluoro 7-deoxy-gap
compound being the most active. A 2'-fluoro chimeric
oligonucleotide with a centered 5-deoxy gap was also active.
[0345] Chimeric phosphorothioate oligonucleotides having SEQ ID NO:
1 having 2'-O-propyl regions surrounding a 5-base or 7-base deoxy
gap were compared to 2'-O-methyl chimeric oligonucleotides. ras
expression in T24 cells was inhibited by both 2'-O-methyl and
2'-O-propyl chimeric oligonucleotides with a 7-deoxy gap and a
uniform phosphorothioate backbone. When the deoxy gap was decreased
to five nucleotides, only the 2'-O-methyl oligonucleotide inhibited
ras expression.
[0346] Antisense oligonucleotide inhibition of H-ras gene
expression in cancer cells: Two phosphorothioate oligonucleotides
(2502, 2503) complementary to the ras AUG region were tested as
described in Example 27, along with chimeric oligonucleotides
(4998, 5122) having the same sequence and 7-base deoxy gaps flanked
by 2'-O-methyl regions. These chimeric oligonucleotides are shown
in Table 5.
5TABLE 5 Chimeric phosphorothioate oligonucleotides having
2'-O-methyl ends (bold) and central deoxy gap (AUG target) OLIGO #
DEOXY SEQUENCE SEQ ID NO: 2502 20 C T T A T A T T C C G T C A T C G
C T C 2 4998 7 C T T A T AT T C C G T C A T C G C T C 2 2503 20 T C
C G T C AT C G C T C C T C A G G G 3 5122 7 T C C G T C AT C G C T
C C T C A G G G 3
[0347] Compound 2503 inhibited ras expression in T24 cells by 71%,
and the chimeric compound (4998) inhibited ras mRNA even further
(84% inhibition). Compound 2502, also complementary to the AUG
region, decreased ras RNA levels by 26% and the chimeric version of
this oligonucleotide (5122) demonstrated 15% inhibition. Also
included in this assay were two oligonucleotides targeted to the
mutant codon 12. Compound 2570 (SEQ ID NO: 1) decreased ras RNA by
82% and the 2'-O-methyl chimeric version of this oligonucleotide
with a seven-deoxy gap (3985) decreased ras RNA by 95%.
[0348] Oligonucleotides 2570 and 2503 were also tested to determine
their effects on ras expression in HeLa cells, which have a
wild-type (i.e., not activated) H-ras codon-12. While both of these
oligonucleotides inhibited ras expression in T24 cells (having
activated codon-12), only the oligonucleotide (2503) specifically
hybridizable with the ras AUG inhibited ras expression in HeLa
cells. Oligonucleotide 2570 (SEQ ID NO: 1), specifically
hybridizable with the activated codon-12, did not inhibit ras
expression in HeLa cells, because these cells lack the activated
codon-12 target.
[0349] Oligonucleotide 2570, a 17 mer phosphorothioate
oligonucleotide complementary to the codon-12 region of activated
H-ras, was tested for inhibition of ras expression (as described in
Example 25) in T24 cells along with chimeric phosphorothioate
2'-O-methyl oligonucleotides 3980, 3985 and 3984, which have the
same sequence as 2570 and have deoxy gaps of 5, 7 and 9 bases,
respectively (shown in Table 3). The fully 2'-deoxy oligonucleotide
2570 and the three chimeric oligonucleotides decreased ras mRNA
levels in T24 cells. Compounds 3985 (7-deoxy gap) and 3984 (9-deoxy
gap) decreased ras mRNA by 81%; compound 3980 (5-deoxy gap)
decreased ras mRNA by 61%. Chimeric oligonucleotides having this
sequence, but having 2'-fluoro-modified nucleotides flanking a
5-deoxy (4689) or 7-deoxy (4690) gap, inhibited ras mRNA expression
in T24 cells, with the 7-deoxy gap being preferred (82% inhibition,
vs 63% inhibition for the 2'-fluoro chimera with a 5-deoxy
gap).
[0350] Antisense oligonucleotide inhibition of proliferation of
cancer cells: Three 17mer oligonucleotides having the same sequence
(SEQ ID NO: 1), complementary to the codon 12 region of activated
ras, were tested for effects on T24 cancer cell proliferation as
described in Example 28. 3985 is a full phosphorothioate
oligonucleotide having a 7-deoxy gap flanked by 2'-O-methyl
nucleotides, and 4690 is a full phosphorothioate oligonucleotide
having a 7-deoxy gap flanked by 2'-F nucleotides
(C.sup.FC.sup.FA.sup.F C.sup.FA.sup.FC.sub.d C.sub.dG.sub.dA.sub.d
C.sub.dG.sub.dG.sub.d C.sup.FG.sup.FC.sup.F C.sup.FC.sup.F, SEQ ID
NO: 1, nucleotides identified with an ".sup.F" contain a
2'-O-fluoro substituent group and the remainder of the nucleotides
identified with a ".sub.d" are 2'-deoxy-erythro-pentofuranosyl
nucleotides). Effects of these oligonucleotides on cancer cell
proliferation correlated well with their effects on ras mRNA
expression shown by Northern blot analysis: oligonucleotide 2570
inhibited cell proliferation by 61%, the 2'-O-methyl chimeric
oligonucleotide 3985 inhibited cell proliferation by 82%, and the
2'-fluoro chimeric analog inhibited cell proliferation by 93%.
[0351] In dose-response studies of these oligonucleotides on cell
proliferation, the inhibition was shown to be dose-dependent in the
25 nM-100 nM range. IC.sub.50 values of 44 nM, 61 nM and 98 nM
could be assigned to oligonucleotides 4690, 3985 and 2570,
respectively. The random oligonucleotide control had no effect at
the doses tested.
[0352] The effect of ISIS 2570 on cell proliferation was cell
type-specific. The inhibition of T24 cell proliferation by this
oligonucleotide was four times as severe as the inhibition of HeLa
cells by the same oligonucleotide (100 nM oligonucleotide
concentration). ISIS 2570 is targeted to the activated (mutant) ras
codon-12, which is present in T24 but lacking in HeLa cells, which
have the wild-type codon-12.
[0353] Chimeric backbone-modified oligonucleotides:
Oligonucleotides discussed in previous examples have had uniform
phosphorothioate backbones. The 2'modified chimeric
oligonucleotides discussed above are not active in uniform
phosphodiester backbones. A chimeric oligonucleotide was
synthesized (ISIS 4226) having 2'-O-methyl regions flanking a
5-nucleotide deoxy gap, with the gap region having a P.dbd.S
backbone and the flanking regions having a P.dbd.O backbone.
Another chimeric oligonucleotide (ISIS 4223) having a P.dbd.O
backbone in the gap and P.dbd.S in flanking regions was also made.
These oligonucleotides are shown in Table 6.
[0354] Additional oligonucleotides were synthesized, completely
2'deoxy and having phosphorothioate backbones containing either a
single phosphodiester (ISIS 4248), two phosphodiesters (ISIS 4546),
three phosphodiesters (ISIS 4551), four phosphodiesters (ISIS
4593), five phosphodiesters (ISIS 4606) or ten phosphodiester
linkages (ISIS-4241) in the center of the molecule. These
oligonucleotides are also shown in Table 6.
6TABLE 6 Chimeric backbone (P = S/P = O) oligonucleotides having
2'-O-methyl wings (bold) and central deoxy gap (backbone linkages
indicated by s (P = S) or o (P = O) SEQ # ID OLIGO P = S SEQUENCE
NO: 2570 16 CsCsAsCsAsCsCsGsAsCsGsGsCsGsCsCsC 1 4226 5
CoCoAoCoAoCsCsGsAsCsGoGoCoGoCoCoC 1 4233 11
CsCsAsCsAsCoCoGoAoCoGsGsCsGsCsCsC 1 4248 15
CsCsAsCsAsCsCsGsAoCsGsGsCsGsCsCsC 1 4546 14
CsCsAsCsAsCsCsGoAoCsGsGsCsGsCsCsC 1 4551 13
CsCsAsCsAsCsCsGoAoCoGsGsCsGsCsCsC 1 4593 12
CsCsAsCsAsCsCoGoAoCoGsGsCsGsCsCsC 1 4606 11
CsCsAsCsAsCsCoGoAoCoGoGsCsGsCsCsC 1 4241 6 CsCsAsCoAoCoCoGoAoCoGoG-
oCoGsCsCsC 1
[0355] Oligonucleotides were incubated in crude HeLa cellular
extracts at 37.degree. C. to determine their sensitivity to
nuclease degradation as described in Dignam et al. [Nucleic Acids
Res., 11, 1475 (1983)]. The oligonucleotide (4233) with a 5-diester
gap between phosphorothioate/2'-O-methyl wings had a T1/2 of 7 hr.
The oligonucleotide with a five-phosphorothioate gap in a
phosphorothioate/2'-O-methyl molecule had a T1/2 of 30 hours. In
the set of oligonucleotides having one to ten diester linkages, the
oligonucleotide (4248) with a single phosphodiester linkage was as
stable to nucleases as was the full-phosphorothioate molecule, ISIS
2570, showing no degradation after 5 hours in HeLa cell extract.
Oligonucleotides with two-, three and four-diester gaps had T1/2 of
approximately 5.5 hours, 3.75 hours, and 3.2 hours, and
oligonucleotides with five or ten deoxy linkages had T1/2 of 1.75
hours and 0.9 hours, respectively.
[0356] Antisense activity of chimeric backbone-modified
oligonucleotides: A uniform phosphorothioate backbone is not
required for antisense activity. ISIS 4226 and ISIS 4233 were
tested in the ras-luciferase reporter system for effect on ras
expression along with ISIS 2570 (fully phosphorothioate/all deoxy),
ISIS 3980 (fully phosphorothioate, 2'-O-methyl wings with deoxy
gap) and ISIS 3961 (fully phosphodiester, 2'-O-methyl wings with
deoxy gap). All of the oligonucleotides having a P.dbd.S (i.e.,
nuclease-resistant) gap region inhibited ras expression. The two
completely 2'deoxy oligonucleotides having phosphorothioate
backbones containing either a single phosphodiester (ISIS 4248) or
ten phosphodiester linkages (ISIS 4241) in the center of the
molecule were also assayed for activity. The compound containing a
single P.dbd.O was just as active as a full P.dbd.S molecule, while
the same compound containing ten P.dbd.O was completely
inactive.
[0357] Chimeric phosphorothioate oligonucleotides of SEQ ID NO: 1
were made, having a phosphorothioate backbone in the 7-base deoxy
gap region only, and phosphodiester in the flanking regions, which
were either 2'-O-methyl or 2'-O-propyl. The oligonucleotide with
the 2'-O-propyl diester flanking regions was able to inhibit ras
expression.
EXAMPLE 25
Melting Curves
[0358] Absorbance vs. temperature curves were measured at 260 nm
using a Gilford 260 spectrophotometer interfaced to an IBM PC
computer and a Gilford Response II spectrophotometer. The buffer
contained 100 mM Na.sup.+, 10 mM phosphate and 0.1 mM EDTA, pH 7.
Oligonucleotide concentration was 4 .mu.M each strand determined
from the absorbance at 85.degree. C. and extinction coefficients
calculated according to Puglisi and Tinoco [Methods in Enzymol.,
180, 304 (1989). T.sub.m values, free energies of duplex formation
and association constants were obtained from fits of data to a two
state model with linear sloping baselines. [Petersheim and Turner,
Biochemistry, 22, 256 (1983). Reported parameters are averages of
at least three experiments. For some oligonucleotides, free
energies of duplex formation were also obtained from plots of
T.sub.m.sup.-1 vs log.sub.10 (concentration). Borer et al., J. Mol.
Biol., 86, 843 (1974).
EXAMPLE 26
ras Transactivation Reporter Gene System
[0359] The expression plasmid pSV2-oli, containing an activated
(codon 12, GGC.fwdarw.GTC) H-ras cDNA insert under control of the
constitutive SV40 promoter, was a gift from Dr. Bruno Tocque
(Rhone-Poulenc Sante, Vitry, France). This plasmid was used as a
template to construct, by PCR, a H-ras expression plasmid under
regulation of the steroid-inducible mouse mammary tumor virus
(MMTV) promoter. To obtain H-ras coding sequences, the 570 bp
coding region of the H-ras gene was amplified by PCR. The PCR
primers were designed with unique restriction endonuclease sites in
their 5'-regions to facilitate cloning. The PCR product containing
the coding region of the H-ras codon 12 mutant oncogene was gel
purified, digested, and gel purified once again prior to cloning.
This construction was completed by cloning the insert into the
expression plasmid pMAMneo (Clontech Laboratories, Calif.).
[0360] The ras-responsive reporter gene pRD053 was used to detect
ras expression. [Owen et al., Proc. Natl. Acad. Sci. U.S.A., 87,
3866 (1990).
EXAMPLE 27
Northern Blot Analysis of ras Expression in vivo
[0361] The human urinary bladder cancer cell line T24 was obtained
from the American Type Culture Collection (Rockville Md.). Cells
were grown in McCoy's 5A medium with L-glutamine (GIBCO-BRL,
Gaithersburg, Md.), supplemented with 10% heat-inactivated fetal
calf serum and 50 U/ml each of penicillin and streptomycin. Cells
were seeded on 100 mm plates. When they reached 70% confluency,
they were treated with oligonucleotide. Plates were washed with 10
ml prewarmed PBS and 5 ml of OptiMEM (GIBCO) reduced-serum medium
containing 2.5 .mu.l DOTMA. Oligonucleotide was then added to the
desired concentration. After 4 hours of treatment, the medium was
replaced with McCoy's medium. Cells were harvested 48 hours after
oligonucleotide treatment and RNA was isolated using a standard
CsCl purification method. [Kingston in Current Protocols in
Molecular Biology, F. M. Ausubel, R. Brent, R. E. Kingston, D. D.
Moore, J. A. Smith, J. G. Seidman and K. Strahl, Eds., John Wiley
and Sons, New York.] The human epithelioid carcinoma cell line HeLa
229 was obtained from the American Type Culture Collection
(Bethesda, Md.). HeLa cells were maintained as monolayers on 6-well
plates in Dulbecco's Modified Eagle's medium (DMEM) supplemented
with 10 fetal bovine serum and 100 U/ml penicillin. Treatment with
oligonucleotide and isolation of RNA were essentially as described
above for T24 cells.
[0362] Northern hybridization: 10 .mu.g of each RNA was
electrophoresed on a 1.2% agarose/formaldehyde gel and transferred
overnight to GeneBind 45 nylon membrane (Pharmacia LKB, Piscataway,
N.J.) using standard methods. [Kingston in Current Protocols in
Molecular Biology, F. M. Ausubel, R. Brent, R. E. Kingston, D. D.
Moore, J. A. Smith, J. G. Seidman and K. Strahl, Eds., John Wiley
and Sons, New York.] RNA was UV-crosslinked to the membrane.
Double-stranded .sup.32P-labeled probes were synthesized using the
Prime a Gene labeling kit (Promega, Madison Wis.). The ras probe
was a SalI-NheI fragment of a cDNA clone of the activated (mutant)
H-ras mRNA having a GGC-to-GTC mutation at codon-12. The control
probe was G3PDH. Blots were prehybridized for 15 minutes at
68.degree. C. with the QuickHyb hybridization solution (Stratagene,
La Jolla, Calif.). The heat-denatured radioactive probe
(2.5.times.10.sup.6 counts/2 ml hybridization solution) mixed with
100 .mu.l of 10 mg/ml salmon sperm DNA was added and the membrane
was hybridized for 1 hour at 68.degree. C. The blots were washed
twice for 15 minutes at room temperature in 2.times.SSC/0.1% SDS
and once for 30 minutes at 60.degree. C. with
0.1.times.SSC/0.1%SDS. Blots were autoradiographed and the
intensity of signal was quantitated using an ImageQuant
PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.). Northern
blots were first hybridized with the ras probe, then stripped by
boiling for 15 minutes in 0.1.times.SSC/0.1%SDS and rehybridized
with the control G3PDH probe to check for correct sample
loading.
EXAMPLE 28
Antisense Oligonucleotide Inhibition of Proliferation of Cancer
Cells
[0363] Cells were cultured and treated with oligonucleotide
essentially as described in Example 27. Cells were seeded on 60 mm
plates and were treated with oligonucleotide in the presence of
DOTMA when they reached 70% confluency. Time course experiment: On
day 1, cells were treated with a single dose of oligonucleotide at
a final concentration of 100 nM. The growth medium was changed once
on day 3 and cells were counted every day for 5 days, using a
counting chamber. Dose-response experiment: Various concentrations
of oligonucleotide (10, 25, 50, 100 or 250 nM) were added to the
cells and cells were harvested and counted 3 days later.
Oligonucleotides 2570, 3985 and 4690 were tested for effects on T24
cancer cell proliferation.
EXAMPLE 29
Inhibition of PKC-.alpha. mRNA Expression by Chimeric (Deoxy
Gapped) 2'-O-Methyl Oligonucleotides
[0364] Oligonucleotides having SEQ ID NO: 4 were synthesized as
uniformly phosphorothioate chimeric oligonucleotides having a
centered deoxy gap of varying lengths flanked by 2'-O-methylated
regions. These oligonucleotides (500 nM concentration) were tested
for effects on PKC-.alpha. mRNA levels by Northern blot analysis.
Deoxy gaps of eight nucleotides or more gave maximal reduction of
PKC-.alpha. mRNA levels (both transcripts) in all cases. These
oligonucleotides reduced PKC-.alpha. mRNA by approximately 83% with
a deoxy gap length of four nucleotides, and gave nearly complete
reduction of PKC-.alpha. mRNA with a deoxy gap length of six or
more.
[0365] The 2'-O-methyl chimeric oligonucleotides with four- or
six-nucleotide deoxy gaps have an IC.sub.50 for PKC-.alpha. mRNA
reduction (concentration of oligonucleotide needed to give a 50%
reduction in PKC-.alpha. mRNA levels) of 200-250 nM, as did the
full-deoxy oligonucleotide (all are phosphorothioates throughout).
The 2'-O-methyl chimeric oligonucleotide with an 8-nucleotide deoxy
gap had an IC.sub.50 (of approximately 85 nM.
[0366] Several variations of this chimeric oligonucleotide (SEQ ID
NO: 4) were compared for ability to lower PKC-.alpha. mRNA levels.
These oligonucleotides are shown in Table 7.
7TABLE 7 Chimeric 2'-O-methyl/deoxy P = S oligonucleotides bold =
2'-O-methyl; s = P = S linkage, o = P = O linkage OLIGO SEQUENCE
SEQ ID NO: 3522 AsAsAsAsCsGsTsCsAsGsCsCsAsTsGsGsTsCsCsC 4 5352
AsAsAsAsCsGsTsCsAsGsCsCsAsTsGsGsTsCsCsC 4 6996
AoAoAoAoCoGsTsCsAsGsCsCsAsTsGoGoToCoCoC 4 7008
AsAoAoAoCoGsTsCsAsGsCsCsAsTsGoGoToCoCsC 4 7024
AsAoAoAoCoGsToCsAoGsCoCsAsTsGoGoToCoCsC 4
[0367] Effect of these oligonucleotides on PKC-.alpha. mRNA levels
is shown in FIG. 3. Oligonucleotides 7008, 3522 and 5352 show
reduction of PKC-.alpha. mRNA, with 5352 being most active.
[0368] A series of 2'-O-propyl chimeric oligonucleotides was
synthesized having SEQ ID NO: 4. These oligonucleotides are shown
in Table 8.
8TABLE 8 Chimeric 2'-O-propyl/deoxy P = S oligonucleotides bold =
2'-O-propyl; s = P = S linkage, o = P = O linkage SEQ ID OLIGO
SEQUENCE NO. 7199 AsAsAsAsCsGsTsCsAsGsCsCsAsTsGsGsTsCsCsC 4 7273
AoAoAoAoCoGsTsCsAsGsCsCsAsTsGoGoToCoCoC 4 7294
AsAoAoAoCoGsTsCsAsGsCsCsAsTsGoGoToCoCsC 4 7295
AsAoAoAoCoGsToCsAoGsCoCsAsTsGoGoToCoCsC 4
[0369] These 2'-O-propyl chimeric oligonucleotides were compared to
the 2'-O-methyl chimeric oligonucleotides. Oligonucleotides 7273
and 7294 were more active than their 2'-O-methyl counterparts at
lowering PKC-.alpha. mRNA levels. This is shown in FIGS. 4 and
5.
EXAMPLE 30
Additional Oligonucleotides Which Decrease PKC-.alpha. mRNA
Expression
[0370] Additional phosphorothioate oligonucleotides targeted to the
human PKC-.alpha. 3' untranslated region were designed and
synthesized. These sequences are shown in Table 9.
9TABLE 9 Chimeric 2'-O-propyl/deoxy P = S oligonucleotides targeted
to PKC-.alpha. 3'-UTR bold = 2'-O-propyl; s = P = S linkage, o = P
= O linkage SEQ ID OLIGO SEQUENCE NO: 6632 TsTsCs TsCsGs CsTsGs
GsTsGs AsGsTs TsTsC 5 6653 TsTsCsTsCsGs CsTsGs GsTsGs AsGsTs TsTsC
5 6665 ToToCoTsCsGs CsTsGs GsTsGs AsGsToToToC 5 7082 TsCsTs CsGsCs
TsGsGs TsGsAs GsTsTs TsC 6 7083 TsCsTsCsGsCs TsGsGs TsGsAs GsTsTs
TsC 6 7084 ToCoToCsGsCs TsGsGs TsGsAs GsToTo ToC 6
[0371] Oligonucleotides 6632, 6653, 7082 and 7083 are most active
in reducing PKC-.alpha. mRNA levels.
EXAMPLE 31
Inhibition of c-raf Expression by Chimeric Oligonucleotides
[0372] Chimeric oligonucleotides having SEQ ID NO: 7 were designed
using the Genbank c-raf sequence HUMRAFR (Genbank listing x03484),
synthesized and tested for inhibition of c-raf mRNA expression in
T24 bladder carcinoma cells using a Northern blot assay. These
chimeric oligonucleotides have central "gap" regions of 6, 8 or 10
deoxynucleotides flanked by two regions of 2'-O-methyl modified
nucleotides, and are shown in Table 10. Backbones were uniformly
phosphorothioate. In a Northern blot analysis, as described in
Example 32, all three of these oligonucleotides (ISIS 6720, 6-deoxy
gap; ISIS 6717, 8-deoxy gap; ISIS 6729, 10-deoxy gap) showed
greater than 70% inhibition of c-raf mRNA expression in T24 cells.
These oligonucleotides are preferred. The 8-deoxy gap compound
(6717) showed greater than 90% inhibition and is more
preferred.
10TABLE 10 Chimeric 2'-O-methyl P = S deoxy "gap" oligonucleotides
bold = 2'-O-methyl OLIGO SEQUENCE Target site SEQ ID NO: 6720
TCCCGCCTGTGACATGCATT 3'UTR 7 6717 TCCCGCCTGTGACATGCATT 3'UTR 7 6729
TCCCGCCTGTGACATGCATT 3'UTR 7
[0373] Additional chimeric oligonucleotides were synthesized having
one or more regions of 2'-O-methyl modification and uniform
phosphorothioate backbones. These are shown in Table 11. All are
phosphorothioates; bold regions indicate 2'-O-methyl modified
regions.
11TABLE 11 Chimeric 2'-O-methyl P = S c-raf oligonucleotides OLIGO
SEQUENCE Target site SEQ ID NO: 7848 TCCTCCTCCCCGCGGCGGGT 5'UTR 8
7852 TCCTCCTCCCCGCGGCGGGT 5'UTR 8 7849 CTCGCCCGCTCCTCCTCCCC 5'UTR 9
7851 CTCGCCCGCTCCTCCTCCCC 5'UTR 9 7856 TTCTCGCCCGCTCCTCCTCC 5'UTR
10 7855 TTCTCGCCCGCTCCTCCTCC 5'UTR 10 7854 TTCTCCTCCTCCCCTGGCAG
3'UTR 11 7847 CTGGCTTCTCCTCCTCCCCT 3'UTR 12 7850
CTGGCTTCTCCTCCTCCCCT 3'UTR 12 7853 CCTGCTGGCTTCTCCTCCTC 3'UTR
13
[0374] When tested for their ability to inhibit c-raf mRNA by
Northern blot analysis, ISIS 7848, 7849, 7851, 7856, 7855, 7854,
7847, and 7853 gave better than 70% inhibition and are therefore
preferred. Of these, 7851, 7855, 7847 and 7853 gave greater than
90% inhibition and are more preferred.
[0375] Additional chimeric oligonucleotides with various 2'
modifications were prepared and tested. These are shown in Table
12. All are phosphorothioates; bold regions indicate 2'-modified
regions.
12TABLE 12 Chimeric 2'-modified P = S c-raf oligonucleotides OLIGO
SEQUENCE TARGET SITE MODIFIC. SEQ ID NO: 6720 TCCCGCCTGTGACATGCATT
3'UTR 2'-O-Me 7 6717 TCCCGCCTGTGACATGCATT 3'UTR 2'-O-Me 7 6729
TCCCGCCTGTGACATGCATT 3'UTR 2'-O-Me 7 8097 TCTGGCGCTGCACCACTCTC
3'UTR 2'-O-Me 14 9270 TCCCGCCTGTGACATGCATT 3'UTR 2'-O-Pr 7 9058
TCCCGCCTGTGACATGCATT 3'UTR 2'-F 7 9057 TCTGGCGCTGCACCACTCTC 3'UTR
2'-F 14
[0376] Of these, oligonucleotides 6720, 6717, 6729, 9720 and 9058
are preferred. Oligonucleotides 6717, 6729, 9720 and 9058 are more
preferred.
EXAMPLE 32
Northern Blot Analysis of Inhibition of c-raf mRNA Expression
[0377] The human urinary bladder cancer cell line T24 was obtained
from the American Type Culture Collection (Rockville, Md.). Cells
were grown in McCoy's 5A medium with L-glutamine (GIBCO-BRL,
Gaithersburg, Md.), supplemented with 10% heat-inactivated fetal
calf serum and 50 U/ml each of penicillin and streptomycin. Cells
were seeded on 100 mm plates. When they reached 70% confluency,
they were treated with oligonucleotide. Plates were washed with 10
ml prewarmed PBS and 5 ml of OptiMEM reduced-serum medium
containing 2.5 .mu.l DOTMA. Oligonucleotide with lipofectin was
then added to the desired concentration. After 4 hours of
treatment, the medium was replaced with McCoy's medium. Cells were
harvested 24 to 72 hours after oligonucleotide treatment and RNA
was isolated using a standard CsCl purification method. [Kingston
in Current Protocols in Molecular Biology, F. M. Ausubel, R. Brent,
R. E. Kingston, D. D. Moore, J. A. Smith, J. G. Seidman and K.
Strahl, Eds., John Wiley and Sons, New York.] Total RNA was
isolated by centrifugation of cell lysates over a CsCl cushion. RNA
samples were electrophoresed through 1.2% agarose-formaldehyde gels
and transferred to hybridization membranes by capillary diffusion
over a 12-14 hour period. The RNA was cross-linked to the membrane
by exposure to UV light in a Stratalinker (Stratagene, La Jolla,
Calif.) and hybridized to random-primed .sup.32P-labeled c-raf cDNA
probe (obtained from ATCC) or G3PDH probe as a control. RNA was
quantitated using a Phosphorimager (Molecular Dynamics, Sunnyvale,
Calif.).
EXAMPLE 33
Oligonucleotide Inhibition of Rev Gene Expression
[0378] The chimeric oligonucleotides used in this assay are shown
in Table 13 below.
13TABLE 13 Chimeric 2'-O-propyl/deoxy P = S oligonucleotides
targeted to HIV rev gene bold = 2'-O-propyl; s = P=S linkage; o =
P=O linkage OLIGO SEQUENCE SEQ ID NO: 8907
UoAoGoGoAoGoAsUsGsCsCsUsAsAoGoGoCoUoUoU 15 8908
GoCoUoAoUoGoUsCsGsAsCsAsCsCoCoAoAoUoUoC 16 8909
CoAoUoAoGoGoAsGsAsUsGsCsCsUoAoAoGoGoCoT 17
[0379] Transfection and Luciferase assay: 3T3 cells were maintained
in DMEM with glucose, L-glutamine, sodium pyruvate and 10% fetal
bovine serum (GIBCO). For all experiments, cells were seeded the
previous night at 75,000 cells/well in 6-well plates (Falcon).
Transfections were performed using the standard CaPO.sub.4 method.
For each set of replicates, 15 .mu.g/mL of pSG5/rev plasmid, 18
.mu.g/mL pHIVenu-luc and 2 .mu.g/mL of Rep 6 were precipitated and
200 .mu.L of this was dripped on each well. The precipitate was
allowed to incubate on cells for 7 hours at 37.degree. C. The media
was then aspirated, the cells washed once with PBS, and fresh
complete media added for overnight incubation. Following
incubation, the media was removed, cells washed with 2 mL of
OPTIMEM (GIBCO) and 1 mL of OPTIMEM containing 2.5 .mu.g/mL of
Lipofectin (GIBCO-BRL) and the oligonucleotide added. The mixture
was incubated for 4 hours at 37.degree. C., at which point it was
aspirated off the cells and complete media was added. Two hours
after this treatment, 0.2 .mu.M/mL of dexamethasone (Sigma) was
added to all wells to allow induction of the MMTV promoter of
pHIVenu-luc.
[0380] The Luciferase assay was performed 24 hours later, as
follows: The wells were washed twice with PBS and the cells were
harvested by scraping in 200 .mu.L of lysis buffer (1% Triton, 25
mM glycylglycine, pH 7.8, 15 mM MgSO.sub.4, 4 mM EGTA and 1 mM
DTT)> The lysate was clarified by microfuging for 5 minutes at
11,500 rpm in the cold. 100 .mu.L of the lysate was then combined
in a microtiter plate with 50 .mu.L of assay buffer (25 mM
glycylglycine, pH 7.8, 15 mM MgSO.sub.4, 4 mM EGTA, 15 mM potassium
phosphate, pH 7.8, 1 mM DTT and 7.5 mM ATP). Luc detection was
performed using a microtiter luminescent reader (Dynatech
Laboratories). The reactions were started by injecting 50 .mu.L of
1X luciferase solution (Sigma). The 1X solution was diluted in
luciferin buffer (25 mM glycylglycine, pH 7.8, 15 mM MgSO.sub.4, 4
mM EGTA and 4 mM DTT) prior to use from a 10X stock (10 mM
luciferin in 10 mM DTT). Samples were counted for 20 seconds. The
kinetics of firefly luc light emission are characterized by a flash
period lasting a few seconds followed by a period of lower light
intensity emission lasting several minutes.
[0381] Rev and RRE RNA synthesis: pSGk-Rev contains the Rev gene
adjacent to a T7 promoter. BglII linearized pSG5-Rev was used as a
DNA template for transcription with T7 RNA polymerase. A template
for the production of RRE RNA was produced by PCR. For RNA
synthesis, DNA templates were used at 0.2 to 1.0 mg/mL, with 5 mM
each of ATP, CTP and GTP, 0.5 mM of UTP, 10 mM of DTT, 40 mM of
Tris-HCl, pH 7.5, 6 mM of MgCl.sub.2, 4 mM of Spermidine, 500 U/mL
of RNAsin at 20 U/.mu.L, 2500 .mu.Ci/mL of a .sup.32P UTP at 10
mCi/mL and 1000 U/mL of T7 RNA polymerase. The reaction was
incubated for 1 hour at 37.degree. C. The transcription reaction
was terminated by adding formamide loading buffer and was run in a
denaturing polyacrylamide gel containing 8 M urea. The RNA was
eluted from the gel according to the procedure of Schwartz et al.
(Gene, 1990, 88, 197).
EXAMPLE 34
Immunoassay for Antiviral Screening
[0382] NHDF cells were seeded in 96-well culture plates at a
density of 15,000 cells/well in serum-free FGM. Established
monolayers were pretreated with the oligonucleotide overnight in
FGM prior to infection. After pretreatment, cells were rinsed
thrice with fresh, prewarmed FGM, and virus in 100 .mu.L of
FGM/well was added to achieve an MOI of 0.05 PFU/cell. After 2
hours of incubation at 37.degree. C., virus was removed and fresh
medium (100 .mu.L/well) containing the oligonucleotide was added.
Medium was exchanged 2 days after infection with fresh medium
containing the oligonucleotide, and 6 days after infection, the
cells were fixed in absolute ethanol and dried in preparation for
antibody staining. A modified protocol was used for some assays in
which FGM was supplemented with low levels of FBS (0.2%), and the
incubation period after infection was shortened from 6 days to 3
days. The shorter assay eliminated the need to exchange medium 2
days after infection. Both assays yielded comparable values for 50%
effective concentrations (EC50s).
[0383] Fixed cells were blocked in a solution of PBS containing 2%
bovine serum albumin (BSA), and mouse monoclonal antibody (1H10,
supplied by Eisai Co., Ltd., Japan) was added in a 1:2000 dilution
in PBS-1% BSA. The 1H10 antibody recognizes an abundant late HCMV
polypeptide approximately 65 kDa in size. Detection of bound
monoclonal antibody was facilitated with biotinylated goat
anti-mouse immunoglobulin G abd streptavidin-coupled
.beta.-galactosidase (GIBCO-BRL, Gaithersburg, Md.). Chlorophenol
red .beta.-D-galactopyranoside was used as a substrate for
.beta.-galactosidase, and activity was determined by measuring the
optical density at 575 nm of individual wells with a BioTex model
EL312e microplate reader.
[0384] The oligonucleotides used in this assay are shown in Table
14 below.
14TABLE 14 Inhibition of CMV replication by chimeric 2'-O-methyl P=
S oligonucleotides bold = 2'-O-methyl OLIGO SEQUENCE SEQ ID NO:
4325 GCG UUTGCT CTT CTT CUU GCG 18 4326 GCG UUU GCTCTT CTU CUU GCG
19
EXAMPLE 35
Diagnostic Assay for the Detection of mRNA Overexpression
[0385] Oligonucleotides are radiolabeled after synthesis by
.sup.32P labeling at the 5' end with polynucleotide kinase.
Sambrook et al. ["Molecular Cloning. A Laboratory Manual," Cold
Spring Harbor Laboratory Press, 1989, Volume 2, pg. 11.31-11.32].
Radiolabeled oligonucleotide is contacted with tissue or cell
samples suspected of mRNA overexpression, such as a sample from a
patient, under conditions in which specific hybridization can
occur, and the sample is washed to remove unbound oligonucleotide.
A similar control is maintained wherein the radiolabeled
oligonucleotide is contacted with normal cell or tissue sample
under conditions that allow specific hybridization, and the sample
is washed to remove unbound oligonucleotide. Radioactivity
reamining in the sample indicates bound oligonucleotide and is
quantitated using a scintillation counter or other routine means.
Comparison of the radioactivity remaining in the samples from
normal and diseased cells indicates overexpression of the mRNA of
interest.
[0386] Radiolabeled oligonucleotides of the invention are also
useful in autoradiography. Tissue sections are treated with
radiolabeled oligonucleotide and washed as described above, then
exposed to photographic emulsion according to standard
autoradiography procedures. A control with normal cell or tissue
sample is also maintained. The emulsion, when developed, yields an
image of silver grains over the regions overexpressing the mRNA,
which is quantitated. The extent of mRNA overexpression is
determined by comparison of the silver grains observed with normal
and diseased cells.
[0387] Analogous assays for fluorescent detection of mRNA
expression use oligonucleotides of the invention which are labeled
with fluorescein or other fluorescent tags. Labeled DNA
oligonucleotides are synthesized on an automated DNA synthesizer
(Applied Biosystems model 380B) using standard phosphoramidite
chemistry with oxidation by iodine. .beta.-cyanoethyldiisopropyl
phosphoramidites are purchased from Applied Biosystems (Foster
City, Calif.). Fluorescein-labeled amidites are purchased from Glen
Research (Sterling, Va.). Incubation of oligonucleotide and
biological sample is carried out as described for radiolabeled
oligonucleotides except that instead of a scintillation counter, a
fluorescence microscope is used to detect the fluorescence.
Comparison of the fluorescence observed in samples from normal and
diseased cells enables detection of mRNA overexpression.
EXAMPLE 36
Detection of Abnormal mRNA Expression
[0388] Tissue or cell samples suspected of expressing abnormal mRNA
are incubated with a first .sup.32P or fluorescein-labeled
oligonucleotide which is targeted to the wild-type (normal) mRNA.
An identical sample of cells or tissues is incubated with a second
labeled oligonucleotide which is targeted to the abnormal mRNA,
under conditions in which specific hybridization can occur, and the
sample is washed to remove unbound oligonucleotide. Label remaining
in the sample indicates bound oligonucleotide and can be
quantitated using a scintillation counter, fluorimeter, or other
routine means. The presence of abnormal mRNA is indicated if
binding is observed in the case of the second but not the first
sample.
[0389] Double labeling can also be used with the oligonucleotides
and methods of the invention to specifically detect expression of
abnormal mRNA. A single tissue sample is incubated with a first
.sup.32P-labeled oligonucleotide which is targeted to wild-type
mRNA, and a second fluorescein-labeled oligonucleotide which is
targeted to the abnormal mRNA, under conditions in which specific
hybridization can occur. The sample is washed to remove unbound
oligonucleotide and the labels are detected by scintillation
counting and fluorimetry. The presence of abnormal mRNA is
indicated if the sample does not bind the .sup.32P-labeled
oligonucleotide (i.e., is not radioactive) but does retain the
fluorescent label (i.e., is fluorescent).
EXAMPLE 37
Plasma Uptake and Tissue Distribution of Oligonucleotides in
Mice
[0390] The following oligonucleotides were prepared:
[0391] UsGsCsAsTsCsCsCsCsCsAsGsGsCsCsAsCsCsAsT, SEQ ID NO: 20
[0392] UsGsCsAsTsCsCsCsCsAsGsGsCsCsAsCsCsAsT, SEQ ID NO: 20
[0393] UsGsCsAsTsCsCCCCAGGCsCsAsCsCsAsT, SEQ ID NO: 20
[0394] wherein bold type indicated a 2'-O-propyl substituent, "s"
indicates a phosphorothioate linkage and the absence of "s"
indicates a phosphodiester linkage in the respective
oligonucleotides. The first oligonucleotide is identified as Isis
3082, the second as Isis 9045 and the third as Isis 9046 in the
FIGS. 6, 7, 8 and 9. The oligonucleotides were tritiated as per the
procedure of Graham et al., Nuc. Acids Res., 1993, 16,
3737-3743.
[0395] Animals and Experimental Procedure
[0396] For each oligonucleotide studied, twenty male Balb/c mice
(Charles River), weighing about 25 gm, were randomly assigned into
one of four treatment groups. Following a one-week acclimation,
mice received a single tail vein injection of .sup.3H-radiolabeled
oligonucleotide (approximately 750 nmoles/kg; ranging from 124-170
.mu.Ci/kg) administered in phosphate buffered saline, pH 7.0. The
concentration of oligonucleotide in the dosing solution was
approximately 60 .mu.M. One retro-orbital bleed (at either 0.25,
0.5, 2, or 4 hours post-dose) and a terminal bleed (either 1, 3, 8
or 24 hours post-dose) was collected from each group. The terminal
bleed was collected by cardiac puncture following ketamine/xylazine
anesthesia. An aliquot of each blood sample was reserved for
radioactivity determination and the remaining blood was transferred
to an EDTA-coated collection tube and centrifuged to obtain plasma.
Urine and feces were collected at intervals (0-4, 4-8 and 8-24
hours) from the group terminated at 24 hours.
[0397] At termination, the liver, kidneys, spleen, lungs, heart,
brain, sample of skeletal muscle, portion of the small intestine,
sample of skin, pancreas, bone (both femurs containing marrow) and
two lymph nodes were collected from each mouse and weighed. Feces
were weighed, then homogenized 1:1 with distilled water using a
Brinkmann Polytron homogenizer (Westbury, N.Y.). Plasma, tissues,
urine and feces homogenate were divided for the analysis of
radioactivity by combustion and for determination of intact
oligonucleotide content. All samples were immediately frozen on dry
ice after collection and stored at -80.degree. C. until
analysis.
[0398] Analysis of Radioactivity in Plasma, Tissue, and Excreta
[0399] Plasma and urine samples were weighed directly into
scintillation vials and analyzed directly by liquid scintillation
counting after the addition of 15 ml of BetaBlend (ICN Biomedicals,
Costa Mesa, Calif.). All other samples (tissues, blood and
homogenized feces) were weighed into combustion boats and oxidized
in a Biological Materials Oxidizer (Model OX-100; R. J. Harvey
Instrument Corp., Hillsdale, N.J.). The .sup.3H.sub.2O was
collected in 20 ml of cocktail, composed of 15 ml of BetaBlend and
5 ml of Harvey Tritium Cocktail (R. J. Harvey Instrument Corp.,
Hillsdale, N.J.). The combustion efficiency was determined daily by
combustion of samples spiked with a solution of .sup.3H-mannitol
and ranged between 73.9-88.3%. Liquid scintillation counting was
performed using a Beckman LS 9800 or LS 6500 Liquid Scintillation
System (Beckman Instruments, Fullerton, Calif.). Samples were
counted for 10 minutes with automatic quench correction.
Disintergration per minute values were corrected for the efficiency
of the combustion process.
[0400] Analysis of Data
[0401] Radioactivity in samples was expressed as disintergrations
per minute per gram of sample. These values were divided by the
specific activity of the radiolabel to express the data in
nanomole-equivalents of total oligonucleotide per gram of sample,
then converted to percent of dose administered per organ or tissue.
Assuming a tissue density of 1 gm/ml, the nmole/gram data were
converted to a total .mu.M concentration. To calculate the
concentration of intact oligonucleotide in plasma, liver or kidney
at each time point, the mean total .mu.M concentrations were
divided by the percent of intact oligonucleotide in the dosing
solution (82-97%), then multiplied by the mean percentage of intact
oligonucleotide at each time point as determined by CGE or HPLC.
This data was then used for the calculation of tissue half-lives by
linear regression and to compare the plasma pharmacokinetics of the
different modified oligonucleotides. The pharmacokinetic parameters
were determined using PCNONLIN 4.0 (Statistical Consultants, Inc.,
Apex, N.C.). After examination of the data, a one-compartment bolus
input, first order output model (library model 1) was selected for
use.
[0402] The result of the animal plasma uptake and tissue
distribution tests are illustrated graphically in FIGS. 6, 7, 8 and
9. As is seen in FIG. 6, plasma concentration of each of the test
oligonucleotides decrease from the initial injection levels to
lower levels over the twenty-four hour test period. Plasma
concentrations of the oligonucleotides of the invention were
maintained at levels equivalent to those of the non-conjugate
bearing phosphorothioate. All of the test compounds were taken up
from the plasma to tissues as is shown in FIGS. 7, 8 and 9. The
compounds of the invention had different distribution between the
various tissues. FIG. 7 shows the distribution pattern for the
control oligonucleotide, identified as ISIS 3082, a
phosphorothioate oligonucleotide. FIG. 8 shows the distribution
pattern for a first compound of the invention, an oligonucleotide,
identified as ISIS 9045, having a 2'-substituent at each
nucleotide. FIG. 9 shows the distribution pattern for a further
compound of the invention, a "gap mer" oligonucleotide, identified
as ISIS 9046, having a 2'-substituent and phosphodiester linkages
at each nucleotide at "flanking" sections of the oligonucleotide
and 2'-deoxy, phosphorothioate nucleotides in a central or gap
region.
Sequence CWU 1
1
37 1 17 DNA Artificial Sequence Synthetic construct 1 ccacaccgac
ggcgccc 17 2 20 DNA Artificial Sequence Synthetic construct 2
cttatattcc gtcatcgctc 20 3 20 DNA Artificial Sequence Synthetic
construct 3 tccgtcatcg ctcctcaggg 20 4 20 DNA Artificial Sequence
Synthetic construct 4 aaaacgtcag ccatggtccc 20 5 18 DNA Artificial
Sequence Synthetic construct 5 ttctcgctgg tgagtttc 18 6 17 DNA
Artificial Sequence Synthetic construct 6 tctcgctggt gagtttc 17 7
20 DNA Artificial Sequence Synthetic construct 7 tcccgcctgt
gacatgcatt 20 8 20 DNA Artificial Sequence Synthetic construct 8
tcctcctccc cgcggcgggt 20 9 20 DNA Artificial Sequence Synthetic
construct 9 ctcgcccgct cctcctcccc 20 10 20 DNA Artificial Sequence
Synthetic construct 10 ttctcgcccg ctcctcctcc 20 11 20 DNA
Artificial Sequence Synthetic construct 11 ttctcctcct cccctggcag 20
12 20 DNA Artificial Sequence Synthetic construct 12 ctggcttctc
ctcctcccct 20 13 20 DNA Artificial Sequence Synthetic construct 13
cctgctggct tctcctcctc 20 14 20 DNA Artificial Sequence Synthetic
construct 14 tctggcgctg caccactctc 20 15 20 RNA Artificial Sequence
Synthetic construct 15 uaggagaugc cuaaggcuuu 20 16 20 RNA
Artificial Sequence Synthetic construct 16 gcuaugucga cacccaauuc 20
17 20 DNA Artificial Sequence Synthetic construct 17 cauaggagau
gccuaaggct 20 18 21 DNA Artificial Sequence Synthetic construct 18
gcguutgctc ttcttcuugc g 21 19 22 DNA Artificial Sequence Synthetic
construct 19 gcguutgctc ttctucuuug cg 22 20 20 DNA Artificial
Sequence Synthetic construct 20 ugcatccccc aggccaccat 20 21 15 DNA
Artificial Sequence Synthetic construct 21 cgactatgca agtac 15 22
17 DNA Artificial Sequence Synthetic construct 22 ctcgtacctt
ccggtcc 17 23 12 RNA Artificial Sequence Synthetic construct 23
gagcucccag gc 12 24 15 RNA Artificial Sequence Synthetic construct
24 cgacuaugca aguac 15 25 15 RNA Artificial Sequence Synthetic
construct 25 uccagguguc cgauc 15 26 13 DNA Artificial Sequence
Synthetic construct 26 tccaggccgu uuc 13 27 13 DNA Artificial
Sequence Synthetic construct 27 tccaggtgtc ccc 13 28 17 RNA
Artificial Sequence Synthetic construct 28 cucguaccuu ccggucc 17 29
18 DNA Artificial Sequence Synthetic construct 29 ctcgtacctt
tccggtcc 18 30 18 RNA Artificial Sequence Synthetic construct 30
gagcauggya aggccagg 18 31 18 RNA Artificial Sequence Synthetic
construct 31 cucguaccuu uccggucc 18 32 16 DNA Artificial Sequence
Synthetic construct 32 gcgttttttt tttgcg 16 33 19 DNA Artificial
Sequence Synthetic construct 33 cgcaaaaaaa aaaaaacgc 19 34 47 DNA
Artificial Sequence Synthetic construct 34 acattatgct agctttttga
gtaaacttgt ggggcaggag accctgt 47 35 29 DNA Artificial Sequence
Synthetic construct 35 gagatctgaa gcttctggat ggtcagcgc 29 36 35 DNA
Artificial Sequence Synthetic construct 36 gagatctgaa gcttgaagac
gccaaaaaca taaag 35 37 33 DNA Artificial Sequence Synthetic
construct 37 acgcatctgg cgcgccgata ccgtcgacct cga 33
* * * * *