U.S. patent application number 10/126088 was filed with the patent office on 2003-09-11 for dna encoding b7, a new member of the ig superfamily with unique expression on activated and neoplastic b cells.
This patent application is currently assigned to The Dana-Farber Cancer Institute. Invention is credited to Freedman, Arnold S., Freeman, Gordon J., Nadler, Lee M..
Application Number | 20030170821 10/126088 |
Document ID | / |
Family ID | 27081108 |
Filed Date | 2003-09-11 |
United States Patent
Application |
20030170821 |
Kind Code |
A1 |
Freeman, Gordon J. ; et
al. |
September 11, 2003 |
DNA encoding B7, a new member of the Ig superfamily with unique
expression on activated and neoplastic B cells
Abstract
Isolated nucleic acid molecules encoding a B cell activation
antigen, B7, are provided. In one embodiment, the nucleic acid
molecules are DNA sequences. The DNA sequences of the invention can
be integrated into various expression vectors, which in turn can
direct the synthesis of the corresponding proteins or peptides in a
variety of hosts, particularly eukaryotic cells, such as mammalian
and insect cell culture. Also provided are host cells transformed
to produce proteins or peptides encoded by the DNA molecules of the
present invention and purified proteins and peptides which comprise
at least a portion of the B cell activation antigen. The proteins
and peptides comprise at least a portion of the mature form of the
B7 activation antigen and preferably comprise a soluble form of the
B7 protein.
Inventors: |
Freeman, Gordon J.;
(Brookline, MA) ; Freedman, Arnold S.; (Newton,
MA) ; Nadler, Lee M.; (Newton, MA) |
Correspondence
Address: |
LAHIVE & COCKFIELD
28 STATE STREET
BOSTON
MA
02109
US
|
Assignee: |
The Dana-Farber Cancer
Institute
|
Family ID: |
27081108 |
Appl. No.: |
10/126088 |
Filed: |
April 19, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10126088 |
Apr 19, 2002 |
|
|
|
09522206 |
Mar 9, 2000 |
|
|
|
09522206 |
Mar 9, 2000 |
|
|
|
08153262 |
Nov 15, 1993 |
|
|
|
6071716 |
|
|
|
|
08153262 |
Nov 15, 1993 |
|
|
|
07751306 |
Aug 28, 1991 |
|
|
|
07751306 |
Aug 28, 1991 |
|
|
|
07591300 |
Oct 1, 1990 |
|
|
|
Current U.S.
Class: |
435/69.3 ;
435/320.1; 435/325; 530/350; 536/23.2 |
Current CPC
Class: |
C07K 14/70532 20130101;
A01K 2217/075 20130101 |
Class at
Publication: |
435/69.3 ;
435/320.1; 435/325; 530/350; 536/23.2 |
International
Class: |
C12P 021/02; C12N
005/06; C07K 014/705; C07H 021/04 |
Goverment Interests
[0002] This invention was made with Government support under
National Institutes of Health Grants CA-34183 and CA-40216 and
Public Health Services Grant 5KO8 CA-01105 awarded by the National
Cancer Institute, Department of Health and Human Services. The
Government therefore has certain rights in this invention.
Claims
Having described the invention, what is claimed is:
1. An isolated nucleic acid sequence coding for B lymphocyte
activation antigen, B7.
2. An isolated nucleic acid sequence according to claim 1, wherein
the nucleic acid sequence is a cDNA sequence.
3. An isolated nucleic acid sequence according to claim 2, wherein
the DNA is of human origin.
4. An isolated nucleic acid sequence according to claim 2, wherein
the DNA is of murine origin.
5. An isolated nucleic acid sequence according to claim 4, wherein
the DNA of murine origin encodes a protein exhibiting about 40%
identity with the human amino acid sequence set forth in SEQ ID
NO:2.
6. An isolated nucleic acid sequence according to claim 5, wherein
the DNA of murine origin has substantially the nucleic acid
sequence set forth in SEQ ID NO:3.
7. A recombinant expression vector comprising a nucleic acid
sequence according to claim 1.
8. A recombinant expression vector according to claim 7, wherein
the nucleic acid sequence is a cDNA sequence.
9. A recombinant expression vector according to claim 8, wherein
the cDNA is of human origin.
10. A recombinant expression vector according to claim 8, wherein
the cDNA is of murine origin.
11. A recombinant expression vector according to claim 9, wherein
the vector is a plasmid.
12. A recombinant expression vector according to claim 10, wherein
the vector is a plasmid.
13. A host cell capable of expressing B7 activation antigen
transformed by a recombinant expression vector according to claim
11.
14. A host cell capable of expressing B7 activation antigen
transformed by a recombinant expression vector according to claim
12.
15. A substantially pure nucleic acid sequence coding for at least
a portion of the coding region of the B7 B lymphocyte activation
antigen set forth in SEQ ID NO:2 comprising amino acids -34 to
254.
16. A substantially pure nucleic acid sequence according to claim
15 wherein the nucleic acid is a DNA molecule of human origin.
17. A substantially pure nucleic acid sequence according to claim
16, coding for a soluble form of the B7 activation antigen.
18. A recombinant expression vector comprising a nucleic acid
sequence according to claim 17.
19. A host cell capable of expressing B7 activation antigen
transformed by a recombinant expression vector according to claim
18.
20. A substantially pure, recombinant protein expressed by a host
cell according to claim 19.
21. A substantially pure nucleic acid sequence coding for a B7
activation antigen which is identical with at least about 40% of
the amino acids sequence set forth in SEQ ID NO:2 comprising amino
acids -1 to 254.
22. A substantially pure nucleic acid sequence according to claim
21 of human origin and coding for the amino acid sequence set forth
in SEQ ID NO:2.
24. A substantially pure nucleic acid sequence according to claim
21 of murine origin and coding for the amino acid sequence set
forth in SEQ ID NO:3.
25. A recombinant expression vector comprising a nucleic acid
sequence according to claim 24.
26. A host cell capable of expressing B7 activation antigen
transformed by a recombinant expression vector according to claim
25.
27. A recombinant protein expressed by a host cell according to
claim 26.
28. A substantially pure nucleic acid sequence comprising the
nucleic acid sequence substantially as shown in SEQ ID NO:1
encoding a human B7 activation antigen.
29. A substantially pure nucleic acid sequence comprising the
nucleic acid sequence substantially as shown in SEQ ID NO:3
encoding a murine B7 activation antigen.
30. A substantially pure B7 protein.
31. A protein according to claim 30 which is of human origin.
32. A protein according to claim 31 having the amino acid sequence
set forth in SEQ ID NO: 2 or a fragment, mutant or variant thereof
capable of either enhancing or suppressing an activated T cell
mediated immune response.
33. A protein according to claim 30 which is of murine origin.
34. A protein according to claim 33 having the amino acid sequence
set forth in SEQ ID NO: 4 or a fragment, mutant or variant thereof
capable of either enhancing or suppressing an activated T cell
mediated immune response.
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation-in-part of copending U.S.
application U.S. Ser. No. 07/591,300, filed on Oct. 1, 1990.
FIELD OF THE INVENTION
[0003] The present invention relates generally to nucleic acid
sequences. More particularly, it relates to DNA sequences coding
for at least a portion of the unique B cell activation antigen, B7.
Expression vectors containing the nucleic acid sequences are
introduced into host cells and direct the production of B7 proteins
and peptides, which can be purified and included in pharmaceutical
preparations that can be used to either enhance or suppress T cell
mediated immune responses.
BACKGROUND OF THE INVENTION
[0004] All animals have a number of molecular and cellular
components capable of interacting with and neutralizing various
harmful foreign substances (antigens) in their environment. An
animal's immune response to antigen involves both non-specific
molecules and cells, as well as systems and mechanisms for the
development of protective responses which possess memory and are
extremely specific.
[0005] The primary cells of the immune system are the white blood
cells, called lymphocytes, which are derived from cells in the bone
marrow. One class of lymphocytes, the T lymphocytes, mature under
the influence of the thymus and, upon stimulation by antigen, give
rise to cellular immunity. T lymphocytes are also involved in the
regulation of B lymphocytes, which, upon appropriate stimulation,
mature into plasma cells that secrete antibody.
[0006] Mature T lymphocytes that emerge from the adult mammalian
thymus migrate to peripheral lymphoid organs such as the spleen and
lymph nodes. There, the naive T cells encounter antigens, usually
in the form of processed peptides, bound to self molecules encoded
by the major histocompatibility complex.
[0007] MHC class II molecules display peptides derived from
proteins internalized through the endocytic pathway and are
recognized predominantly by inducer T lymphocytes expressing the
CD4 surface molecule. MHC class I molecules display peptides
derived from proteins synthesized inside the antigen-presenting
cell (for example, viral proteins) and are largely recognized by
cytotoxic T lymphocytes expressing the CD8 surface molecule.
Germain, Nature, 322:687 (1986).
[0008] The frequency of T cells specific for any given foreign
antigen is initially small. If these cells are to play a central
role in host defense, they must selectively increase in number.
Thus, activation of the T lymphocyte upon recognition of foreign
antigen leads to autocrine growth in which the stimulated naive
cells proliferate in response to their own production of the
polypeptide growth hormone interleukin-2 (IL-2) and the receptor
for IL-2. Smith, Annu. Rev. Immunol., 2:319 (1984); Greene et al,
Annu. Rev. Immunol., 4:69 (1986); Waldman, Annu. Rev. Biochem.,
58:875 (1989). In addition, the cells differentiate, acquiring the
ability to produce other lymphokines, such as interleukin-4 (IL-4)
and gamma interferon (IFN-.gamma.) for CD4.sup.+ cells. Swain et
al, J. Immunol., 141:3445 (1988); Salmon et al, J. Immunol.,
143:907 (1989); Gajewski et al, Immunol. Rev., 111:79 (1989). These
proteins serve as effector molecules for activating other cells in
the immune system. IL-2 also plays a critical role in this
recruitment function, as it can act in a paracrine fashion to help
activated B lymphocytes and CD8.sup.+ cytotoxic T lymphocytes
expand in number.
[0009] The minimal requirement for an antigen-specific immune
response is the effective binding of the processed peptide and the
MHC molecule on an antigen-presenting cell by a clonally
distributed T cell receptor for antigen. For most T cells, the T
cell antigen receptor is a heterodimeric glycoprotein composed of
two glycosylated protein chains, one of which is designated the
alpha and the other, the beta, chain. Each of the two proteins
chains is divided into variable (V) and constant (C) regions. The
variable portions of the protein chains differ between T cell
clones and are primarily responsible for the unique recognition
specificity of a given T cell. These chains are non-covalently
associated with another cell surface molecule, designated CD3,
which is believed to be involved in signal transduction.
[0010] Although occupancy of the T cell receptor complex (TCR) by
antigen in association with the major histocompatibility complex
(MHC) is necessary for the initiation of T cell activation, several
lines of evidence suggest that a second costimulatory signal is
essential for the induction of proliferation and lymphokine
secretion, particularly of interleukin-2. Schwartz, Science,
248:1349 (1990); Kawakami et al, J. Immunol., 142:1818 (1989);
Mueller et al, J. Immunol., 142:2617 (1989); Williams et al, J.
Immunol., 145:85 (1990). In murine and human systems, one type of
costimulatory signal is delivered by antigen presenting cells (APC)
and requires cell to cell contact. Kawakami et al, J. Immunol.,
142:1818 (1989); Williams et al, J. Immunol., 145:85 (1990). Cells
which can deliver this costimulatory signal include activated, but
not resting B lymphocytes (Ashwell et al, J. Exp. Med., 159:881
(1984)); gamma-interferon (.gamma.-INF) activated monocytes, and
dendritic cells (Kawakami et al, J. Immunol., 142:1818 (1989);
Matis et al, Proc. Natl. Acad. Sci. USA, 80:6019 (1983)).
[0011] Several recent studies in human systems have provided
compelling evidence that the B cell activation antigen B7 can
provide one such costimulatory signal. Gimmi et al, "B7 provides a
costimulatory signal which induces T cells to proliferate and
secrete interleukin-2", Proc. Natl. Acad. Sci. USA, (in press);
Linsley et al, J. Exp. Med., 173:721 (March 1991); Koulova et al,
J. Exp. Med., 173:759 (March 1991).
[0012] The B7 activation antigen is a cell surface molecule that
appears on the surface of a subpopulation of B lymphocytes within
24 hours after activation with EBV or anti-immunoglobulin. Freedman
et al, J. Immunol., 139:3260-3267 (1987). This antigen is present
on a subpopulation of human splenic B lymphocytes that respond more
rapidly to signals of B cell activation and proliferation.
Specifically, B7+ B cells are not capable of independently
responding to low molecular weight B cell growth factor or IL-2.
However, after activation, the B7+ subpopulation of B cells more
rapidly enters the S phase of the cell cycle in response to growth
factors. The B7 antigen thus identifies a subpopulation of B cells
that appear to be previously activated or primed in vivo and
demonstrate accelerated growth to subsequent triggers.
[0013] Within the hematopoietic system, B7 is expressed on
activated B cells and on monocytes that have been activated with
gamma-interferon. In addition, B7 is present on some B
lymphoblastoid and neoplastic cell lines, and on some tumor cells
isolated from patients with certain types of B cell malignancies,
particularly lymphomas.
[0014] B7 has recently been shown to be an adhesion ligand for
another member of the immunoglobulin superfamily, the T cell
surface protein CD28. Freeman et al, J. Immunol., 143:2714 (1989);
Aruffo et al, Proc. Natl. Acad. Sci. USA, 84:8573 (1987); Linsley
et al, Proc. Natl. Acad. Sci. USA, 87:5031 (1990); Williams et al,
Ann. Rev. Immunol., 6:381 (1988). CD28 is constitutively expressed
on 95% of human CD4.sup.+ T cells, 50% of CD8.sup.+ T cells, and on
thymocytes which co-express CD4 and CD8. Turka et al, J. Immunol.,
144:1646 (1990); Yamada et al, Eur. J. Immunol., 15:1164 (1985);
Martin et al, J. Immunol., 136:3282 (1986). Following suboptimal
activation of T cells with anti-CD3 mAb; (Martin et al, J.
Immunol., 136:3282 (1986)); anti-CD2 mAb, or phorbol ester; (June
et al, J. Immunol., 143:153 (1989)) crosslinking of CD28 by
anti-CD28 mAb results in enhanced T cell proliferation and greatly
augments synthesis of multiple lymphokines. Thompson et al, Proc.
Natl. Acad. Sci. USA, 86:1333 (1989). A method of immunotherapy
involving stimulation of the T cell CD28 surface molecule to
enhance T cell proliferation and increase lymphokine levels
involving anti-CD28 monoclonal antibodies has been described. PCT
International Publication Number WO 90/05541.
[0015] That B7 is likely to be an important regulator of T cell
proliferation and lymphokine production is evidenced by its pattern
of expression and functional activity described above. Further,
human B7 transfected cells or recombinant B7-Ig fusion protein
augment proliferation and induce interleukin-2 (IL-2), but not
interleukin-4 (IL-4), synthesis in T cells which have been treated
with phorbol ester or anti-CD3 mAb. Gimmi et al, "B7 provides a
costimulatory signal which induces T cells to proliferate and
secrete interleukin-2", Proc. Natl. Acad. Sci. USA, (in press);
Linsley et al, J. Exp. Med., 173:721 (1991); Koulova et al, J. Exp.
Med., 173:759 (1991).
[0016] Approaches to either upregulate or block the expression of
B7 or the ligation of B7 to its natural ligand on T cells would
provide a specific means of therapeutic intervention, to
respectively enhance or suppress T cell-mediated immune responses
in vivo. One approach involves the molecular cloning of B7, which
would enable the recombinant preparation of B7 proteins. However,
although the molecular structure of a number of other human B cell
activation antigens has previously been determined, prior to the
present invention, attempts to clone B7 were unsuccessful.
Previously cloned B cell associated or restricted activation
antigens include the nonlineage-restricted activation antigen 4F2
and transferrin receptor as well as the lymphoid-associated
activation antigens, intracellular adhesion molecule-1, CD25,
Blast-1 and CD23. The cDNA clones encoding various human B-cell
associated antigens have been characterized through the use of
expression techniques described by Aruffo and Seed (Proc. Natl.
Acad. Sci. 84:8573-8577 (1987); Proc. Natl. Acad. Sci.,
84:3365-3369 (1987)), including those encoding the B cell
associated antigens CD19, CD20, CD22, CD27, CD39 and CDw40.
[0017] It is an object of the present invention to molecularly
clone genes encoding the B7 activation antigen.
[0018] Another object of the invention is to provide nucleic acid
molecules which code for the human and murine B7 B lymphocyte
activation antigen.
[0019] Yet another object of the present invention is to provider a
diagnostic method for quantitatively measuring activated B-cells in
a biological sample.
[0020] A still further object of the present invention is to
provide recombinantly produced B7 proteins.
[0021] These as well as other objects and advantages will be
apparent from the following specification, drawing and claims.
SUMMARY OF THE INVENTION
[0022] These objects are achieved by the present invention, which
provides isolated nucleic acid molecules encoding a B cell
activation antigen, B7. In one embodiment, the molecule is a DNA
molecule. In another embodiment of the invention, the DNA molecule
comprises a nucleic acid sequence that codes for at least a portion
of the protein whose amino acid sequence shown in SEQ ID NO: 2.
Further provided are!nucleic acid molecules which encode proteins
that are at least about 40% identical with the amino acid sequence
set forth in SEQ ID NO: 2.
[0023] The DNA sequences obtained in accordance with the present
invention can be integrated into various expression vectors, which
in turn can direct the synthesis of the corresponding proteins or
peptides in a variety of hosts, particularly eukaryotic cells, such
as mammalian and insect cell culture. The expression vectors
comprise a DNA sequence obtained in accordance with the present
invention and a promoter operatively linked upstream of the DNA
sequence. In general, depending upon the host cell used, the
expression vectors will further contain regulatory elements, such
as polyadenylation signals, RNA splice sites and enhancers.
[0024] An additional aspect of the present invention discloses host
cells transformed to produce proteins or peptides encoded by the
DNA molecules of the present invention.
[0025] Purified proteins and peptides which comprises at least a
portion of the B cell activation antigen are also provided. These
proteins and peptides comprise at least a portion of the mature
form of the B7 activation antigen and preferably comprise a soluble
form of the B7 protein. In one embodiment, the proteins and
peptides are of human origin. In another embodiment, murine
proteins and peptides are described.
[0026] The present invention also provides nucleic acid probes
useful for assaying a biological sample for the presence of B cells
expressing the B7 activation antigen.
BRIEF DESCRIPTION OF THE DRAWING
[0027] For a more complete understanding of the invention reference
should now be made to the embodiments illustrated in greater detail
in the accompanying drawing and described below by way of examples
of the invention.
[0028] FIG. 1 illustrates the pCDM8 plasmid used in the cloning of
human B7. The vector contains Sv40, polyoma and .pi.VX replication
origins, a cytomegalovirus/T7 promoter and an M13 origin of
replication. The pCDM8 vector was prepared for cloning of B7 by
digestion with the restriction enzyme BstXI.
[0029] FIG. 2 is an RNA blot analysis illustrating that murine B7
mRNA expression is B cell restricted. RNA blot analysis of (A)
lymphoid cell lines and (B) Balb/c mouse organs is shown. Two
micrograms of poly(A).sup.+ RNA were glyoxylated, electrophoresed
on agarose gels and transferred to nitrocellulose. The blot was
hybridized with (a) .sup.32P-labeled mB7 coding region cDNA and
reprobed with (b) .sup.32P-labeled rat actin cDNA. The lanes
contain RNA from the murine pre-B cell lines, 38B9 and 300.19, the
B cell lines, AJ9, CH1, and A20, the plasmacytoma lines, Ag8.653
and NS-1, and the T cell lines, EL-4, BW5147, RADA, and YAC. The
mobility of rRNAs are indicated on the left.
[0030] FIG. 3 is a genomic DNA blot analysis of B7. Five micrograms
of C57BL/6 splenic DNA were digested with (a)BamHI, (b)EcoRI,
(c)BclI, (d)KpnI, (e)BglII, (f)XbaI, (g)EcoRV, (h)ApaI, (i)BglI,
(j)BstXI, and (k)SacI. DNAs were electrophoresed in 0.7% agarose,
blotted, and hybridized with .sup.32P-labeled mB7 coding region
cDNA. The sizes, in kb, of molecular weight markers are
indicated.
[0031] FIG. 4 provides a comparison of murine and human B7 amino
acid sequences, which exhibit about 44% amino acid identity. The
murine sequence (M) appears on the upper lines with the human
sequence (H) directly below. Amino acid identities are indicated
with a vertical bar (.vertline.). Potential N-linked glycosylation
cites are marked with an *. The signal peptide, transmembrane and
cytoplasmic domains are indicated. Ig-like domains are defined by
the cysteines at positions 17 and 82 (Ig-V) and 128 and 182
(Ig-C).
DETAILED DESCRIPTION OF THE INVENTION
[0032] The human B7 activation antigen has previously been
described by Freedman et al, J. Immunol., 139:3260-3267 (1987).
This activation antigen appears within 24 hours of in vitro
stimulation of splenic B cells. The expression of the B7 antigen,
which is detected on a minor subpopulation of B cells isolated from
peripheral blood and lymphoid tissues, is strongly induced
following stimulation with either anti-immunoglobulin or EBV. In
contrast, B7 is not detected on resting or activated T cells or on
resting monocytes. As illustrated in the examples herein, the human
B7 antigen is expressed on a subset of B cell lines and B cell
neoplasms, but is not generally detected on leukemias or lymphomas
of T cell origin.
[0033] In accordance with the present invention, nucleic acid
molecules encoding a B cell activation antigen, B7, are isolated.
In one embodiment, the molecule is a DNA molecule and preferably
comprises cDNA encoding at least a portion of the B7 activation
antigen.
[0034] An exemplary, putative amino acid sequence based upon the
experimentally determined nucleotide sequence for a human B7
activation antigen is provided in SEQ ID NO:2.
[0035] A total of 15 cDNA clones which code for the human B7
activation antigen have been isolated from a Burkitt's lymphoma
cell line. These cDNA clones were identified by direct expression
in COS monkey cells using the previously described B7 mAb in the
screening process. Freedman et al, J. Immunol., 139:3260
(1987).
[0036] The gene coding for the B7 activation antigen can be cloned
from either a cDNA or a genomic library in accordance with
protocols herein described. As an example, a cDNA nucleotide
sequence for the B7 activation antigen can be obtained by isolating
total mRNA from an appropriate cell line. Double stranded cDNAs are
then prepared from the total mRNA. Subsequently, the cDNA's can be
cloned by joining them to a suitable plasmid or bacteriophage
vector using any one of a number of known techniques. B7 can also
be cloned using established polymerase chain reaction techniques in
accordance with the nucleic acid sequence information provided by
the invention.
[0037] Cell Lines
[0038] Suitable cells for use in isolating human cDNA clones are
those that can be shown to make mRNA coding for the B7 activation
antigen and appropriately translating the B7 mRNA into the B7
protein. One source of mRNA is that obtained from normal human
splenic B cells activated with anti-immunoglobulin or EBV or from
subsets of neoplastic B cells. Expression of B7 transcripts in
normal, stimulated cells is first detected about four hours after
stimulation, with mRNA levels peaking at from 4-12 hours and
declining slowly thereafter. Total cellular RNA can be obtained
during these intervals and utilized in the construction of the cDNA
library.
[0039] In addition, various subsets of neoplastic B cells are known
to express B7 and can alternatively serve as a source of the mRNA
for construction of the cDNA library. For example, tumor cells
isolated from the majority of patients with non-Hodgkins lymphoma
express B7 mRNA. B cells from nodular, poorly differentiated
lymphoma (NPDL), diffuse large cell lymphoma (LCL) and Burkitt's
lymphoma cell lines are suitable sources of human B7 mRNA. The
Burkitt's lymphoma cell line Raji is a particularly preferred
source of the B7 mRNA.
[0040] Isolation of mRNA and Construction of cDNA Library
[0041] Total cellular mRNA can be isolated by a variety of
techniques, e.g. by using the guanidinium-thiocyanate extraction
procedure of Chirgwin et al, Biochemistry, 18:5294-5299 (1979). If
this method is utilized, Poly (A+) mRNA is prepared and purified
for use in cDNA library construction using oligo (dT) cellulose
selection. cDNA is then synthesized from the poly(A+) RNA using
oligo(dT) priming and reverse transcriptase. Moloney MLV reverse
transcriptase available from Gibco/BRL, Bethesda, Md., or AMV
reverse transcriptase available from Seikagaku America, Inc., St.
Petersburg, Fla., are preferably employed.
[0042] Following reverse transcription, the cDNA clone is converted
to double stranded DNA using conventional techniques and
incorporated into a suitable vector. The experiments herein
employed E. coli DNA polymerase I and ribonuclease H in the
conversion to double stranded DNA.
[0043] Cloning of the cDNA's can be accomplished using any of the
conventional techniques for joining double stranded DNA with the
vector. The use of synthetic adaptors is particularly preferred,
since it alleviates the possibility of cleavage of the cDNA with
restriction enzyme prior to cloning. Using this method, non-self
complementary, kinased adaptors are added to the DNA prior to
ligation with the vector. Virtually any adaptor can be employed. As
set forth in more detail in the examples below, non-self
complementary BstXI adaptors are preferably added to the cDNA for
cloning, for ligation into a pCDM8 vector prepared for cloning by
digestion with BstXI.
[0044] Eukaryotic cDNA's can only be expressed if they are
correctly placed in a vector that supplies a strong eukaryotic
promoter and appropriate origin of replication and other elements
including enhancers, splice acceptors and/or donor sequences and
polyadenylation signals. The cDNA's of the present invention are
placed in suitable vectors containing a strong eukaryotic promoter,
an origin of replication, an SV 40 origin of replication which
allows growth in COS cells, and a cDNA insertion site. Suitable
vectors include .pi.H3, (Seed and Aruffo, Proc. Natl. Acad. Sci.,
84:3365-3369 (1987) .pi.H3m (Aruffo and Seed, Proc. Natl. Acad.
Sci., 84:8573-8577 (1987)), pCDM7 and pCDM8 (Seed, Nature,
329:840-841 (1987), with the pCDM8 vector being particularly
preferred. As illustrated in FIG. 1, pCDM8 contains both SV40 and
polyoma replication origins, a cytomegalovirus/T7 RNA polymerase
promoter, an M13 origin of replication. The vector also contains a
.pi.VX origin of replication, which permits replication in E. coli.
pCDM8 is available commercially from In Vitro Gen, San Diego,
Calif.
[0045] Transfection and Screening
[0046] The thus prepared cDNA library is then cloned by expression
cloning techniques. The basic expression cloning technique has been
described by Seed and Aruffo, Proc. Natl. Acad. Sci. USA,
84:3365-3369 (May 1987) and Aruffo and Seed, Proc. Natl. Acad. Sci.
USA, 84:8573-8577 (December 1987), although important modifications
to the technique are essential for the successful molecular cloning
of B7.
[0047] Initially, plasmid DNA is introduced into a simian COS cell
line (Gluzman, Cell, 23:175 (1981)) by known methods of
transfection, and allowed to replicate and express the cDNA
inserts. The cells are then treated with the monoclonal antibody to
B7 and distributed on dishes coated with an anti-Ig M antibody.
Under these conditions, cells expressing the B7 antigen and bound
with B7 mAb adhere to the plates and the remaining cells are washed
away. This general method of cell selection is known as "panning".
Use of the anti-Ig M antibody in the panning procedure is critical
to the success of the cloning. Employment of total
anti-immunoglobulin antibodies as taught by the prior art, has been
found by the inventors herein to be inadequate. This is presumably
because the anti-Ig antibody contains insufficient anti-Ig M
antibody to "pan" for cells having bound Ig M antibody.
[0048] After panning, episomal DNA is recovered from the panned
cells and transformed into a competent bacterial host, preferably
Escherichia coli. Plasmid DNA is subsequently reintroduced into COS
cells and the cycle of expression and panning repeated at least two
times. After the final cycle, plasmid DNA is prepared from
individual colonies, transfected into COS cells and analyzed for
expression of B7 by indirect immunofluorescence.
[0049] The B7 monoclonal antibody employed in the expression
cloning was described by Freedman et al, J. Immunol., 139:3260-3267
(1987), the pertinent portions of which are hereby incorporated by
reference. Such a monoclonal antibody can be prepared by immunizing
BALB/c mice for three consecutive weeks with about 5.times.10.sup.6
normal splenic B cells activated for 3 days with total
anti-immunoglobulin coupled to polyacrylamide beads. A booster can
be administered 28 days after the final immunization. After somatic
cell hybridization with a suitable myeloma cell line according to
the technique of Kohler and Milstein, as modified (Nature, 56:495
(1977)), supernatants are removed and tested for the presence of
hybridoma antibodies reactive with immunizing cells by indirect
immunofluorescence. Producer clones are then screened on
unstimulated splenic B cells and tumor cells, as described by
Freedman et al, for clones strongly reactive with immunizing cells
and tumor cells, but weakly reactive with unstimulated splenic B
cells. The B7 monoclonal antibody is of the murine Ig M isotype,
demonstrates reactivity with the Burkitt's lymphoma Raji cell line
to a dilution of 1/25,000 and exhibits the pattern of reactivity as
described by Freedman et al.
[0050] Sequencing
[0051] After cloning, plasmids are prepared from the clones
strongly reactive with B7 mAb and sequenced. Any of the
conventional sequencing techniques suitable for sequencing tracts
of DNA about 1.4 kb or larger can be employed.
[0052] The sequence of a human B7 cDNA insert obtained from the
Burkitt's lymphoma cell line Raji is comprised of 1491 nucleotides.
The entire nucleotide sequence of the clone is provided in SEQ ID
NO:1. A single long open reading frame begins at the first
methionine codon at nucleotides 318-320 and extends to nucleotide
1181. The first methionine codon is embedded in a sequence,
GCCATGG, consistent with the consensus translation initiation
sequence, RCCATGG.
[0053] The protein predicted by the thus-obtained nucleotide
sequence is set forth in SEQ ID NO:2. This polypeptide has the
typical features of a type I membrane protein and has long
hydrophobic regions near the amino terminus and close to the
carboxyl terminus. The hydrophobic sequence at the amino-terminal
end has the characteristics of a secretory signal peptide. Amino
terminal sequencing of a soluble form of the human B7 protein
purified from the culture media of B7 transfected CHO cells
revealed that the signal peptide is cleaved after the thirty fourth
amino acid, glycine. Mature human B7 thus begins with the amino
acid sequence--valine--isoleucine--histidine--valine.
[0054] The predicted mature form of B7 contains 254 amino acids,
M.sub.r 29,311 daltons, and consists of a 208 amino acid
extracellular domain (amino acids 1-208) a twenty seven amino acid
hydrophobic transmembrane region (amino acids 209-235) and a short
cytoplasmic domain (amino acids 236-254). There are 8 potential
N-linked glycosylation sites (Asn-X-Ser/Thr), all in the
extracellular region. Glycosylation of the human B7 protein leads
to an apparent molecular weight of 44-54 kd. The transmembrane
region contains three cysteine residues that could be involved in
either lipid derivitization or binding to other proteins. The
cytoplasmic domain is composed of 19 amino acids and contains nine
arginine residues. The cDNA clone did not contain a poly(A) tract
or the most common polyadenylation signal, AATAAA; however, the
alternate polyadenylation signal, ATTAAA, is present near the 3'
end of the cDNA clone.
[0055] Cells transfected with the complete human B7 DNA sequence
provide a costimulatory signal to human CD28.sup.+ T lymphocytes
that have received a primary activation signal, as evidenced by T
cell secretion of IL 2 and enhanced T cell proliferation.
[0056] Cloning B7 From other Mammalian Species
[0057] The present invention is not limited to human nucleic acid
molecules and contemplates that B7 homologues from other mammalian
species that express the B7 antigen can be cloned and sequenced
using the techniques described herein. Isolation of cDNA clones
from other species can also be accomplished using human cDNA
inserts as hybridization probes as described in the examples.
[0058] The cloning and sequencing of the murine homologue of human
B7 is illustrated in Example 8 herein and the nucleic acid sequence
set forth is SEQ ID NO:3 The predicted amino acid sequence for
murine B7, illustrated in SEQ ID NO:4, has about 44% amino acid
identity with human B7, with the greatest similarity being in the
Ig-V and Ig-C like domains. See also FIG. 4. Cells transfected with
murine B7 provide a costimulatory signal to both mouse and human T
lymphocytes, which demonstrates the costimulatory activity of
murine B7 and provides evidence that the T cell ligand attachment
site(s) is conserved between the two species.
[0059] B7 nucleic acid sequences from other species, such as the
mouse, can be used to generate transgenic animals or "knock out"
animals which, in turn, are useful in the development and screening
of therapeutically useful reagents.
[0060] For example, murine cDNA or an appropriate sequence thereof
can be used to clone for genomic B7 in accordance with established
techniques and the genomic sequences used to generate transgenic
animals that over-express B7. Methods for generating transgenic
animals, particularly animals such as mice, have become
conventional in the art and are described, for example, in U.S.
Pat. Nos. 4,736,866 and 4,870,009. Typically, particular cells
would be targeted for B7 transgene incorporation with tissue
specific enhancers, which could lead to enhanced T cell
proliferation and autoimmunity. Transgenic animals that include a
copy of a B7 transgene introduced into the germ line of the animal
at an embryonic stage can be used to examine the effect of
increased B7 expression. Such animals can be used as tester animals
for reagents thought to confer protection from, for example,
autoimmune disease. In accordance with this facet of the invention,
an animal is treated with the reagent and a reduced incidence of
the disease, compared to untreated animals bearing the transgene
would indicate a potential therapeutic intervention for the
disease.
[0061] Alternatively, the non-human homologues of B7 can be used to
construct a B7 "knock out" animal which has a defective B7 gene. An
example of the construction of a B7 "knock out" mouse is provided
in Example 10. Such animals can be characterized for their ability
to accept grafts, reject tumors and defend against infectious
diseases.
[0062] Expression of the B7 Activation Antigen
[0063] Host cells containing a suitable expression vector which
includes a nucleic acid molecule coding for a B7 activation antigen
can be prepared and used to produce the proteins and polypeptides
in accordance with methods known to those of ordinary skill in the
art. The expression vectors of the present invention comprise a
nucleic acid sequence coding for the B7 activation antigen, or any
portion or fragment thereof. The vectors further comprise a
promoter operatively linked upstream of the nucleic acid sequence
coding for B7. In general, depending upon the host cell used, the
expression vectors will further contain regulatory elements, such
as polyadenylation signals, RNA splice sites and enhancers.
[0064] Prokaryotes are very suitable hosts for expression of B7
proteins, assuming glycosylation is not desired. Preferred
prokaryotes for carrying out the present invention are strains of
the bacteria Escherichia coli, although Bacillus and other genera
are also useful. Techniques for transforming these hosts and
expressing foreign genes cloned in them are well known in the art.
Vectors for expressing foreign genes in a bacterial host will
usually contain a selectable marker, for example, a gene for
antibiotic resistance, and will also contain a functional
promoter.
[0065] Eukaryotic microorganisms, such as the yeast, Saccharomyces
cerevisiae, may also be used as host cells.
[0066] Cell cultures derived from higher eukaryotic organisms are
preferably used as the host cells. Particularly preferred are
mammalian and insect cell cultures. Examples of useful mammalian
host cell lines include HeLa cells, Chinese hamster ovary (CHO)
cell lines, baby hamster kidney cell lines and COS cell lines.
Insect cell lines, such as baculovirus infectable SF9 (S.
frugiperda) are also useful host cells. Expression vectors for such
cells ordinarily include, as necessary, an origin of replication, a
promoter located upstream of the gene to be expressed, along with
any required ribosome binding sites, RNA splice sites,
polyadenylation sites and transcriptional terminator sequences.
When used in mammalian cells, the expression vector's control
functions are often provided by viral material. For example,
commonly used promoters are derived from polyoma, Adenovirus 2,
cytomegalovirus and most frequently, Simian Virus 40.
[0067] When utilizing eukaryotic systems for expressing B7, the
host's glycosylation capability should be considered, since
glycosylation may be important to the function and/or stability of
B7.
[0068] Cloned gene sequences may be introduced into cultured cells
using any of the known methods of transfection, including
calcium-phosphate mediated transfection, electroporation and the
like. A small fraction of the cells (about 1-10.sup.5) take up the
DNA and integrate the DNA into their genomes. In order to identify
these integrants, a gene that contains a selectable marker (i.e.
resistance to antibiotics) is generally introduced into the host
cells along with the gene of interest. Preferred selectable markers
include those which confer resistance to drugs, such as neomycin,
hygromycin and methotrexate. Selectable markers may be introduced
on the same plasmid as the gene of interest or may be introduced on
a separate plasmid.
[0069] Cells containing the gene of interest are identified by drug
selection; cells that have incorporated the selectable marker gene
will survive, while the other cells die. The surviving cells can
then be screened for production of the B7 activation antigen by
radiolabeling the proteins with a labeled amino acid and
immunoprecipitating the B7 from the cell supernatant with anti-B7
monoclonal antibody.
[0070] Purification
[0071] The B7 proteins expressed in mammalian cells or otherwise
can be purified according to standard procedures of the art,
including ammonium sulfate precipitation, fractionation column
chromatography (e.g. ion exchange, gel filtration, electrophoresis,
affinity chromatography, etc.) and ultimately, crystallization (see
generally, "Enzyme Purification and Related Techniques", Methods in
Enzymology, 22:233-577 (1971)). A preferred purification method
involves a combination of immunoaffinity chromatography using
anti-B7 monoclonal antibodies bound to Sepharose-CL4B and standard
protein purification techniques. Once purified, partially or to
homogeneity, the recombinantly produced B7 proteins of the
invention can be utilized in pharmaceutical compositions as
described in more detail below.
[0072] Modifications of the B7 DNA Sequence
[0073] It will be appreciated by those skilled in the art that
other nucleic acid molecules coding for the B7 activation antigen
can be isolated by the above process. Different cell lines can be
expected to yield DNA molecules having different sequences of
bases. Additionally, variations may exist due to genetic
polymorphisms or cell-mediated modifications of the genetic
material. Furthermore, the DNA sequence of the B7 activation
antigen can be modified by genetic techniques to produce proteins
or peptides with altered amino acid sequences. Such sequences are
considered within the scope of the present invention, where the
expressed protein is capable of either enhancing or blocking
activated T cell mediated immune responses and immune function.
[0074] A number of processes can be used to generate fragments,
mutants and variants of the isolated DNA sequence. Small subregions
or fragments of the B7 protein, for example 1-30 amino acids in
length, can be prepared by standard, synthetic organic chemical
means. The technique is also useful for preparation of anti-sense
oligo nucleotides and primers for use in the generation of larger
synthetic fragments of B7 DNA.
[0075] Larger subregions or fragments of the B7 gene can be
expressed as protein by synthesizing the relevant piece of DNA
using the polymerase chain reaction (PCR) (Sambrook, Fritsch and
Maniatis, 2 Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor, N.Y., (1989)), and ligating the thus obtained DNA into an
appropriate expression vector. Using PCR, specific sequences of the
cloned double stranded DNA are generated, cloned into an expression
vector, and then assayed for B7 activity. For example, to express a
secreted (soluble) form of the human B7 polypeptide comprising
amino acids 1-204, a PCR product is synthesized using the following
two oligonucleotide primers and the B7 cDNA clone: (1) a sense
primer consisting of a restriction enzyme site and 20 nucleotides
corresponding to the translational initiation site and the first
few amino acid codons of B7, and (2) an anti-sense primer
consisting of 20 nucleotides corresponding to the last few amino
acid codons of B7 ending at codon 204, (i.e., before the
transmembrane region) followed by a stop codon and a restriction
enzyme site. The PCR DNA product is then digested with the
restriction endonuclease whose recognition sequence is in the PCR
primers, gel purified, eluted, and ligated into an appropriate
expression vector. The expression construct is introduced into a
eukaryotic cell such as CHO, where the B7 polypeptide fragment is
synthesized and secreted. The B7 polypeptide fragment can then
readily be obtained from the culture media.
[0076] As used herein, the term "soluble B7" means an amino acid
sequence corresponding to the extracellular domain of the B7
protein or any fragment thereof which does not include the
cytoplasmic and/or transmembrane regions. Such polypeptides, when
produced recombinantly in a host cell, will be secreted freely into
the medium, rather than anchored in the host cell membrane.
[0077] Fragments of the B7 protein that would not include the
normal B7 signal sequence, such as the region from amino acids
103-204 of the human protein, can be made as secreted, soluble
proteins by performing a PCR using the following two
oligonucleotide primers and the B7 cDNA clone: (1) a sense primer
consisting of a restriction enzyme site and 20 nucleotides
corresponding to amino acid codons 103-109 of B7, and (2) an
anti-sense primer consisting of 20 nucleotides corresponding to the
amino acid codons 198-204 of B7, followed by a stop codon and a
restriction enzyme site. The PCR DNA product is digested with the
restriction endonuclease whose recognition sequence is in the PCR
primers, gel purified, eluted, and ligated in frame into an
expression vector adjacent to a translational start site and signal
sequence. The expression construct is then introduced into a
eukaryotic cell such as CHO, where the B7 protein fragment is
synthesized and secreted. The B7 protein fragment is again readily
obtained from the culture media.
[0078] The foregoing fragments are provided for illustrative
purposes only. It will be readily appreciated by those skilled in
the art that a variety of fragments can be generated from the cDNA
clone using the polymerase chain reaction. Particularly useful
fragments can be made based upon knowledge of conserved amino acid
sequences, for example, those regions of amino acid identity
between mouse and human amino acid sequences illustrated in FIG.
4.
[0079] Alternatively, any one of the methods which have been
developed for introducing mutations into cloned genes, including
those for producing simple deletions or insertions, systematic
deletions, insertions or substitutions of clusters of bases or
substitutions of single bases, can be employed to generate variants
of the B7 cDNA clone. Changes in the B7 sequence such as amino acid
substitutions or deletions are preferably obtained by site-directed
mutagenesis. Site directed mutagenesis systems are well known in
the art. Protocols and reagents can be obtained commercially from
Amersham International PLC, Amersham, U.K. As an example of the
technique, amino acid 82 can be changed from a cysteine to a
histidine, by making a mutagenesis oligonucleotide primer
consisting of the codons for amino acids 79-81, a histidine codon
(CAT) instead of the cysteine codon, and the codons for amino acids
83-85. This primer is then annealed to single-stranded antisense B7
phagemid DNA (made from the B7 cDNA clone in the pCDM8 vector) and
the mutagenesis protocol followed. See, Oligonucleotide-directed in
vitro mutagenesis system, Version 2, Amersham International
PLC.
[0080] Fragments, mutants and variants of the B7 antigen that
retain the ability to bind to their natural ligand(s) on T cells
and either amplify or block activated T cell mediated immune
responses, as evidenced for example by lymphokine production and/or
T cell proliferation by T cells that have received a primary
activation signal are considered within the scope of the invention.
More specifically, B7 proteins and peptides that bind to T
lymphocytes, for example CD28.sup.+ cells, may be capable of
delivering a costimulatory signal to the T lymphocytes, which, when
transmitted in the presence of antigen and class II MHC, or other
material capable of transmitting a primary signal to the T cell,
results in activation of the T cell's lymphokine genes. Such B7
proteins can be considered to retain the essential characteristics
of the B7 cell surface activation antigen. Alternatively, in
accordance with the present invention it has been determined that
some B7 proteins, and particularly soluble, monomeric forms of the
B7 protein, retain the ability to bind to their natural ligand(s)
on CD28.sup.+ T cells but, perhaps because of insufficient
cross-linking with the ligand, fail to deliver the secondary signal
essential for enhanced lymphokine production and cell division.
Such proteins, which provide a means to induce a state of anergy or
tolerance in the cells, are also considered within the scope of the
invention.
[0081] Screening the fragments, mutants or variants for those which
retain characteristic B7 activity can be accomplished using one or
more of several different assays. First, the fragments, mutants and
variants can be screened for specific reactivity with an anti-B7
monoclonal antibody reactive with cell surface B7. Specifically,
appropriate cells, such as CHO cells, can be transfected with the
cloned variants and then analyzed for cell surface phenotype by
indirect immunofluorescence and flow cytometric analysis. Cell
surface expression of the transfected cells is evaluated using a
monoclonal antibody ("mAb") specifically reactive with cell surface
B7. Production of secreted forms of B7 is evaluated using anti-B7
mAb for immunoprecipitation.
[0082] Other, more preferred, assays take advantage of the
functional characteristics of the B7 activation antigen. As
previously set forth, the ability of T cells to synthesize
lymphokines depends not only on occupancy or cross-linking of the T
cell receptor for antigen ("the primary activation signal"), but
also on the additional binding of a costimulatory signal, in this
case, the B7 activation antigen. The binding of B7 to its natural
ligand(s) on, for example, CD28 positive T cells, has the effect of
transmitting a signal to the T cell that causes that cell to make
much higher levels of lymphokines, particularly of interleukin-2
and gamma interferon, but also of lymphokines such as TNF .alpha.,
LT and GM-CSF, which in turn stimulates the proliferation of the T
lymphocytes. Other assays for B7 function thus involve assaying for
the synthesis of lymphokines, such as interleukin-2 (or gamma
interferon) and/or assaying for T cell proliferation by CD28.sup.+
T cells which have received a primary activation signal.
[0083] In vitro, T cells can be provided with the first signal by
anti-T3 monoclonal antibody (e.g. anti-CD3) or phorbol ester or,
more preferably, by antigen in association with class II MHC. B7
function is assayed by adding a source of B7 (e.g., cells
expressing B7 or a fragment, mutant or variant thereof or a
secreted form of B7) in association with Class II MHC and assaying
the culture supernatant for interleukin-2 or gamma interferon. Any
one of several conventional assays for interleukin-2 can be
employed, such as the assay described in Proc. Natl. Acad. Sci.
USA, 86:1333 (1989) the pertinent portions of which are hereby
incorporated by reference. A kit for an assay for the production of
interferon is available from Genzyme (Boston, Mass.). T cell
proliferation can also be measured, as described in the Examples
below. B7 proteins and peptides that retain the characteristics of
cell surface B7 will cause increased production of lymphokines,
such as IL-2 and may also result in enhanced T cell proliferation
when compared to a negative control in which the secondary signal
is lacking.
[0084] The same basic functional assays can also be used to screen
for B7 proteins that are incapable of delivering the costimulatory
signal, but in the case of such proteins, addition of the B7
protein will not result in a marked increase in proliferation or
lymphokine secretion by the T cells. The ability of such proteins
to block the normal B7 costimulatory signal and induce a state of
anergy can be determined using subsequent attempts at stimulation
of the T cells with antigen presenting cells that express cell
surface B cell activation antigen B7 and present antigen. If the T
cells are unresponsive to the subsequent activation attempts, as
determined by IL-2 synthesis and T cell proliferation, a state of
anergy has been induced. See, e.g., Schwartz, Science, 1348,
1352-1354, for a model assay system that can used as the basis for
an assay in accordance with the present invention.
[0085] Utility
[0086] The nucleic acid molecules of the present invention are
useful diagnostically, for tracking the progress of disease, by
measuring the activation status of B cells in biological samples.
In accordance with this diagnostic assay, the nucleic acid
sequences are labeled with a detectable marker, e.g. a radioactive,
fluorescent, or biotinylated marker or a .sup.32P-labeled
nucleotide and used in a conventional Northern hybridization
procedure to probe mRNA molecules of total or poly(A+) RNAs from a
biological sample.
[0087] In addition, the nucleic acid sequences and proteins can be
used in the development of therapeutic reagents having the ability
to either upregulate (amplify) or down regulate (suppress) T cell
mediated immune responses. B7 proteins and peptides, including
soluble, monomeric forms of the B7 activation, that fail to deliver
a costimulatory signal to T cells that have received a primary
activation signal, can be used to block the B7 ligand(s) on T cells
and thereby provide a specific means by which to induce tolerance
in an animal. In contrast to the monomeric form, multivalent forms
of B7, such as cell surface B7, retain the ability to transmit the
costimulatory signal to the T cells, resulting in an increased
secretion of lymphokines when compared to activated T cells that
have not received the secondary signal.
[0088] More specifically, now that the structure and function of B7
is known, it is possible to either upregulate or downregulate the
function of B7 in one of a number of ways. Downregulating or
preventing B7 function, i.e., preventing high level lymphokine
synthesis by activated T cells, should be useful in autoimmune
diseases such as rheumatoid arthritis and multiple sclerosis and
also in tissue and organ transplantation. Blockage of T cell
function leads to less tissue destruction. In tissue transplants,
rejection of the transplant is initiated by its recognition as
foreign, followed by an immune reaction that destroys the
transplant. The administration of a soluble, monomeric form of B7
prior to transplantation can lead to the binding of monomeric B7 to
its natural ligand(s) on T cells without transmitting the
corresponding costimulatory signal and thus blocks the ligand on T
cells. Blocking B7 function in this manner prevents T cell
lymphokine synthesis and thus acts as an immunosuppressant.
[0089] In addition, in the acquired immune deficiency syndrome
(AIDS), viral replication is stimulated by T cell activation.
Blocking B7 function could lead to a lower level of viral
replication and thereby ameliorate the course of AIDS.
Surprisingly, HTLV-I infected T cells express B7. This expression
may be important in the growth of HTLV-I infected T cells and the
blockage of B7 function may slow the growth of HTLV-I induced
leukemias.
[0090] One method of preventing B7 function is through the use of
anti-sense oligonucleotides. For example, an oligonucleotide
complementary to the area around the B7 translation initiation
site, e.g., GTGGCCCATGGCTTCAGA, nucleotides 326-309, is
synthesized. This anti-sense oligonucleotide can be added to cell
media, typically at 200 .mu.g/ml, or administered to a patient. The
anti-sense oligonucleotide is taken up by cells and hybridizes to
the B7 mRNA to prevent its translation. Thus, no B7 protein is made
and the function B7 delivers is not performed.
[0091] The proteins or polypeptides produced from the nucleic acid
molecules of the present invention may also be useful in the
construction of therapeutic agents which block the B7 surface
antigen. For example, as described, secreted forms of the B7
polypeptide can be constructed by standard genetic engineering
techniques. By linking soluble B7 to a toxin such as ricin, an
agent capable of preventing T cell activation would be made.
Infusion of the immunotoxin, B7-ricin, into a patient would result
in the death of T cells, particularly of activated T cells that
express higher amounts of CD28. Soluble B7 in a monovalent form
alone may be useful in blocking B7 function, as described above, in
which case a carrier molecule may also be employed.
[0092] Upregulation of B7 function is also useful in therapy. For
example, viral infections are cleared primarily by cytolytic T
cells. In accordance with the present invention, it is believed
that the interaction of B7 with its natural ligand(s) on T cells
leads to an increase in the cytolytic activity of at least some T
cells. The addition of soluble B7 in a multi-valent form to
stimulate T cell activity through the costimulation pathway would
thus be therapeutically useful in cases where more rapid or
thorough clearance of virus would be beneficial. These would
include viral skin diseases such as Herpes simplex or shingles, in
which cases the multi-valent soluble B7 is delivered topically to
the skin. In addition, systemic viral diseases such as influenza,
the common cold, and encephalitis might be alleviated by the
administration of B7 proteins systemically.
[0093] The proteins and peptides of the present invention are
administered in a biologically compatible form suitable for
administration in vivo to either enhance or suppress T cell
mediated immune response. By "biologically compatible form suitable
for administration in vivo" is meant a form of the protein to be
administered in which any toxic effects are outweighed by the
therapeutic effects of the protein. Administration of the B7
proteins can be in any pharmacological form, which includes but is
not limited to intravenous injection of a protein solution.
[0094] Alternatively, therapeutic intervention with the B7 proteins
and peptides of the invention can involve removal of certain of a
patients' activated T cells and costimulating the cells with B7 in
vitro.
[0095] The present invention will be more clearly understood from
the following specific examples. These examples are provided for
illustrative purposes only and are not intended to limit the spirit
or scope of the invention in any way.
EXAMPLE 1
[0096] This Example describes the molecular cloning and
characterization of a human B7 B cell activation antigen.
[0097] Construction of cDNA Library
[0098] A cDNA library was constructed in the pCDM8 vector (Seed,
Nature, 329:840 (1987)) using poly (A).sup.+ RNA from the Burkitt
lymphoma cell line Raji (Pulvertaft, Lancet, 1:238 (1964)) as
described (Aruffo et al, Proc. Natl. Acad. Sci. USA, 84:3365
(1987)).
[0099] RNA was prepared by homogenizing Raji cells in a solution of
4M guanidine thiocyanate, 0.5% sarkosyl, 25 mM EDTA, pH 7.5, 0.13%
Sigma anti-foam A, and 0.7% mercaptoethanol (15). RNA was purified
from the homogenate by centrifugation for 24 hr at 32,000 rpm
through a solution of 5.7M CsCl, 10 mM EDTA, 25 mM Na acetate, pH
7. The pellet of RNA was dissolved in 5% sarkosyl, 1 mM EDTA, 10 mM
Tris, pH 7.5 and extracted with two volumes of 50% phenol, 49%
chloroform, 1% isoamyl alcohol (16). RNA was ethanol precipitated
twice. Poly (A).sup.+ RNA used in cDNA library construction was
purified by two cycles of oligo (dT)-cellulose selection.
[0100] Complementary cDNA was synthesized from 5.5 .mu.g of Raji
cell poly(A).sup.+ RNA in a reaction containing 50 mM Tris, pH 8.3,
75 mM KCl, 3 mM MgCl.sub.2, 10 mM dithiothreitol, 500 .mu.M DATP,
dCTP, dGTP, dTTP, 50 .mu.g/ml oligo(dT).sub.12-18, units/ml RNasin,
and 10,000 units/ml Moloney-MLV reverse transcriptase in a total
volume of 55 .mu.l at 37.degree. for 1 hr. Following reverse
transcription, the cDNA was converted to double-stranded DNA by
adjusting the solution to 25 mM Tris, pH 8.3, 100 mM KCl, 5 mM
MgCl.sub.2, 250 .mu.M each DATP, dCTP, dGTP, dTTP, 5 mM
dithiothreitol, 250 units/ml DNA polymerase I, 8.5 units/ml
ribonuclease H and incubating at 16.degree. for 2 hr. EDTA was
added to 18 mM and the solution was extracted with an equal volume
of 50% phenol, 49% chloroform, 1% isoamyl alcohol. DNA was
precipitated with two volumes of ethanol in the presence of 2.5M
ammonium acetate and with 4 micrograms of linear polyacrylamide as
carrier. In addition, cDNA was synthesized from 4 .mu.g of Raji
cell poly(A).sup.+ RNA in a reaction containing 50 mM Tris, pH 8.8,
50 .mu.g/ml oligo(dT).sub.12-18, 327 units/ml RNasin, and 952
units/ml AMV reverse transcriptase in a total volume of 100 .mu.l
at 42.degree. for 0.67 hr. Following reverse transcription, the
reverse transcriptase was inactivated by heating at 700 for 10 min.
The cDNA was converted to double-stranded DNA by adding 320 .mu.l
H.sub.2O and 80 .mu.l of a solution of 0.1M Tris, pH 7.5, 25 mM
MgCl.sub.2, 0.5M KCl, 250 g/ml bovine serum albumin, and 50 mM
dithiothreitol, and adjusting the solution to 200 .mu.M each DATP,
dCTP, dGTP, dTTP, 50 units/ml DNA polymerase I, 8 units/ml
ribonuclease H and incubating at 16.degree. for 1 hr and 22.degree.
for 1 hr. EDTA was added to 18 mM and the solution was extracted
with an equal volume of 50% phenol, 49% chloroform, 1% isoamyl
alcohol. DNA was precipitated with two volumes of ethanol in the
presence of 2.5M ammonium acetate and with 4 micrograms of linear
polyacrylamide as carrier.
[0101] The DNA from 4 .mu.g of AMV reverse transcription and 2
.mu.g of Moloney MLV reverse transcription was combined.
Non-selfcomplementary BstXI adaptors were added to the DNA as
follows: The double-stranded cDNA from 6 .mu.g of poly(A).sup.+ RNA
was incubated with 3.6 .mu.g of a kinased oligonucleotide of the
sequence CTTTAGAGCACA and 2.4 .mu.g of a kinased oligonucleotide of
the sequence CTCTAAAG in a solution containing 6 mM Tris, pH 7.5, 6
mM MgCl.sub.2, 5 mM NaCl, 350 .mu.g/ml bovine serum albumin, 7 mM
mercaptoethanol, 0.1 mM ATP, 2 mM dithiothreitol, 1 mM spermidine,
and 600 units T4 DNA ligase in a total volume of 0.45 ml at
15.degree. for 16 hr. EDTA was added to 34 mM and the solution was
extracted with an equal volume of 50% phenol, 49% chloroform, 1%
isoamyl alcohol. DNA was precipitated with two volumes of ethanol
in the presence of 2.5M ammonium acetate.
[0102] DNA larger than 600 bp was selected as follows: The
adaptored DNA was redissolved in 10 mM Tris, pH 8, 1 mM EDTA, 600
mM NaCl, 0.1% sarkosyl and chromatographed on a Sepharose CL-4B
column in the same buffer. DNA in the void volume of the column
(containing DNA greater than 600 bp) was pooled and ethanol
precipitated.
[0103] The pCDM8 vector was prepared for cDNA cloning by digestion
with BstXI and purification on an agarose gel. Adaptored DNA from 6
.mu.g of poly(A).sup.+RNA was ligated to 2.25 .mu.g of BstXI cut
pCDM8 in a solution containing 6 mM Tris, pH 7.5, 6 mM MgCl.sub.2,
5 mM NaCl, 350 .mu.g/ml bovine serum albumin, 7 mM mercaptoethanol,
0.1 mM ATP, 2 mM dithiothreitol, 1 mM spermidine, and 600 units T4
DNA ligase in a total volume of 1.5 ml at 15.degree. for 24 hr. The
ligation reaction mixture was transformed into competent E. coli
MC1061/P3 and a total of 4,290,000 independent cDNA clones were
obtained.
[0104] Plasmid DNA was prepared from a 500 ml culture of the
original transformation of the cDNA library. Plasmid DNA was
purified by the alkaline lysis procedure followed by twice banding
in CsCl equilibrium gradients (Maniatis et al, Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor, N.Y. (1987)).
[0105] Cloning Procedure
[0106] In the first round of screening, ten 100 mm dishes of 50%
confluent COS cells were transfected with 1 .mu.g/ml Raji library
DNA using the DEAE-Dextran method (Seed et al, Proc. Natl. Acad.
Sci. USA, 84:3365 (1987)). The cells were trypsinized and re-plated
after 24 hr. After 47 hr, the cells were detached by incubation in
PBS/0.5 MM EDTA, pH 7.4/0.02% Na azide at 37.degree. C. for 30 min.
The detached cells were treated with B7 mAb at a 1 to 500 dilution
as described (18). Cells were washed and distributed into panning
dishes coated with affinity-purified Goat anti-mouse IgM antibody
(Southern Biotechnology Associates, Birmingham, Ala.) and allowed
to attach at room temperature. After 3 hr, the plates were gently
washed twice with PBS/0.5 mM EDTA, pH 7.4/0.02% Na azide, 5% FCS
and once with 0.15M NaCl, 0.01 M Hepes, pH 7.4, 5% FCS. Episomal
DNA was recovered from the panned cells and transformed into E.
coli MC1061/P3. The plasmid DNA was re-introduced into COS cells
via spheroplast fusion as described (Seed et al, Proc. Natl. Acad.
Sci. USA, 84:3365 (1987)) and the cycle of expression and panning
was repeated twice. After the third round, plasmid DNA was prepared
from individual colonies and transfected into COS cells by the
DEAE-Dextran method. Expression of B7 on transfected COS cells was
analyzed by indirect immunofluorescence.
[0107] After the final round of selection, plasmid DNA was prepared
from individual colonies. A total of 15 of 16 candidate clones
contained a cDNA insert of 1.4-1.6 kb. Plasmid DNA from nine clones
was transfected into COS cells. Five clones were strongly positive
for B7 expression by indirect immunofluorescence using the anti-B7
mAb and flow cytometric analysis.
[0108] Sequencing
[0109] The B7 cDNA inserts were first subcloned into the SK plasmid
(Stratagene, La Jolla, Calif.). DNA fragments were subcloned by
first digesting with the XhoI restriction endonuclease and
separating the DNA fragments by electrophoresis on an agarose gel.
The appropriate fragment was cut out of the gel and eluted by the
glass powder method ("Geneclean", Bio 101 Inc., La Jolla, Calif.).
The SK plasmid vector was prepared by digestion with the
appropriate restriction endonuclease followed by digestion with
calf intestinal phosphatase to remove 5' phosphate residues from
the DNA to prevent self-ligation. The phosphatase was then removed
by phenol extraction. The dephosphorylated vector was purified by
electrophoresis on an agarose gel. The vector was then cut out of
the gel and eluted by the glass powder method.
[0110] Dephosphorylated vector was combined with the desired DNA
fragment (with compatible ends) at a molar ratio of 1:1 or 1:2. The
DNAs at approximately 40 .mu.g/ml were ligated in 25 mM Tris, pH
7.8, 10 mM MgCl.sub.2, 4 mM mercaptoethanol, and 0.4 mM ATP with T4
DNA ligase at a concentration of 1 unit/ml for sticky end ligations
or 100 units/ml for blunt-end ligations. Ligations were carried out
at 15.degree. C. overnight. Ligated DNAs were transformed into
competent E. coli and transformants selected by the appropriate
antibiotic, 75 .mu.g/ml Ampicillin.
[0111] Nested deletions were constructed using the Erase-a-base kit
according to the manufacturer's instructions (Promega, Madison,
Wis.). The cDNA inserts were then sequenced in their entirety on
both strands using the dideoxy method of Sanger et al. (Sanger, et
al, Proc. Natl. Acad. Sci., 74:5463 (1977)). More specifically,
sequencing was performed with Sequenase Version 2.0 (United States
Biochemical Corp., Cleveland, Ohio), in accordance with the
manufacturer's instruction. Sequenases are the enzymes of choice
for determining large tracts of DNA, such as those obtained for the
B7 clones, because of their high processivity, their high rate of
polymerization and their wide tolerance for nucleotide analogs.
[0112] The sequence obtained is set forth in its entirety in SEQ ID
NO:1.
[0113] Proof of Identification of B7 Clone
[0114] A. Immunofluorescence
[0115] COS cells were transfected with either vector DNA, CD2 DNA,
or DNA from the largest B7 clone. Transfected COS cells were
detached by incubation in PBS/0.5 mm EDTA/0.02% Na azide at
37.degree. C. for 30 min. Viable cells were isolated by
Ficoll-Hypaque density gradient centrifugation. Cells were analyzed
for cell surface phenotype by indirect immunofluorescence and flow
cytometric analysis. Cell surface expression of B7 and CD2 was
evaluated using anti-B7 and anti-CD2 mAb (both murine IgM mAb),
goat antimouse Ig FITC, and analyzed by indirect
immunofluorescence. Only B7 transfected COS cells reacted with
anti-B7 mAb whereas only CD2 transfected cells stained with
anti-CD2 mAb. In contrast, vector-transfected, CD2-transfected, and
B7-transfected COS cells demonstrated no significant staining with
G/M-FITC alone. COS cells transfected with vector alone did not
express either B7 or CD2.
[0116] The lack of binding of anti-CD2 to B7 transfected COS cells
provided preliminary evidence that the B7 clone did not encode a
nonspecific, IgM binding protein (Sanders et al, J. Immunol.,
139:188 (1987)). Five other IgM isotype mAb directed against
lymphoid cell surface antigens were also examined for binding
(anti-CD20 (pan-B), anti-CD14 (pan myeloid), anti-B5 (B
activation), anti-Bac-1 (B activation), and anti-BB-1 (B
activation)). Anti-CD20, anti-CD14, anti-B5, and anti-Bac-1 were
not reactive with B7-transfected COS cells; however, anti-BB-1
demonstrated strong staining. It has now been determined that the
BB-1 and B7 activation antigens are one in the same.
[0117] B. Cell Surface Labeling and Immunoprecipitation
[0118] The identity of the B7 antigen was further examined by
immunoprecipitation.
[0119] COS cells were transfected with the B7 cDNA and cells were
harvested after 65 hours. Viable Raji and B7 transfected COS cells
were isolated by Ficoll-Hypaque density gradient centrifugation.
Cell surface proteins were .sup.125I-labeled by the lactoperoxidase
conjugation technique (Boyd et al, J. Immunol., 126:2461 (1981))
and cell lysates prepared as described (Tedeer et al, J. Biol.
Chem., 263:10009 (1988)). Cell lysates were precleared three times
for 2 h each: once with 40 .mu.l of a 50% (v/v) suspension of
protein A-Sepharose CL-4B (Pharmacia Fine Chemicals, Piscataway,
N.J.) per ml of lysate, once with 40 .mu.l of a 50% (v/v)
suspension of W6/32 (IgG2a mAb reactive with HLA-A, B, C Ag
(Brodsky et al, J. Immunol., 128:129 (1982)) coupled to cyanogen
bromide activated Sepharose 4B (Pharmacia) and once with anti-CD20
(IgM isotype) rabbit anti-mouse IgM (25 .mu.l of 1 mg/ml purified
Ig) complex for 30 min. followed by the addition of protein
A-Sepharose CL-4B. The precleared lysates were incubated for 30
min. at 4.degree. C. with constant rotation with either: 1)
anti-CD14 mAb (irrelevant mouse IgM mAb) rabbit anti-mouse IgM
complex; 2) anti-BB-1 mAb rabbit anti-mouse IgM complex; or 3)
anti-B7 rabbit anti-mouse IgM complex, followed by the addition of
20 .mu.l of protein A-Sepharose for 3 h at 4.degree. C. with
constant rotation. Sepharose beads were washed with 1 ml of 100 mM
Tris-HCl, pH 8.0, 1% (v/v) Triton X-100, 0.2% (w/v) sodium
deoxycholate, 10 mM EDTA, 10 mM EGTA, 10 mM NaF, 1 mg/ml BSA
containing 0.5 M NaCl followed by 1 ml of the same buffer
containing 0.125 M NaCl, 0.2% (w/v) sodium deoxycholate, and 0.05%
SDS. This wash cycle was repeated once. Precipitated proteins were
eluted from the Sepharose beads by incubation in 50 .mu.l of 125 mM
Tris-HCl, pH 6.8, containing 2% (w/v) SDS, 5% 2-ME, 5% (v/v)
glycerol, and 0.002% (w/v) bromphenol blue, in a boiling water bath
for 4 min. Proteins were analyzed by 10% SDS-PAGE (Laemmli, Nature,
227:680 (1970)).
[0120] A SDS PAGE analysis showed a broad protein band of 44 to 54
kDa was specifically immunoprecipitated from B7 transfected COS
cells by the anti-B7 mAb but not by anti-CD14. The anti-BB-1 mAb
immunoprecipitated a polypeptide of identical molecular weight from
B7 transfected COS cells. The B7 Ag on the Burkitt lymphoma cell
line Raji was immunoprecipitated by anti-B7 as a 46-kDa band,
whereas an isotype identical mAb demonstrated no
immunoprecipitate.
EXAMPLE 2
[0121] DNA Blot Analysis of B7 Gene
[0122] This experiment demonstrates that B7 is encoded by a single
gene family.
[0123] DNA blot hybridizations using Nitroplus membranes (MSI,
Inc., Westborough, Mass.) were performed as previously described
(Maniatis et al, Molecular Cloning: A laboratory Manual, Cold
Spring Harbor, N.Y. (1987): Feinberg et al, Anal. Biochem., 132:6
(1983)). Briefly, aliquots (5 .mu.g) of human splenic DNA were
digested with the restriction enzymes BamHI, EcoRI, PstI, HindIII,
BglI, and KpnI, electrophoresed in 0.7% agarose, blotted and
hybridized with the .sup.32P-labeled B7 cDNA.
[0124] DNA blot analysis of the genomic organization of B7 revealed
two or more DNA restriction fragments using the restriction
endonucleases including BamHI, EcoRI, PstI, HindIII, BglI, and
KpnI. These results were consistent with a one or two gene family.
To distinguish between these possibilities, genomic DNA was
digested with either EcoRI or HindIII, each of which produces two
B7 specific restriction fragments, and the blot was probed with
fragments isolated from the 5' or 3' ends of the B7 cDNA clone. The
B7 5' probe hybridized with one of the EcoRI and HindIII fragments
and the B7 3' probe hybridized with the other of the EcoRI and
HindIII fragments. These results are consistent with B7 being
encoded for by a single gene family encompassing a large genomic
region.
EXAMPLE 3
[0125] Expression of Human B7 mRNA
[0126] In this example, the B7 cDNA clone was used to characterize
the induction and lineage restriction of human B7.
[0127] A. Expression of B7 mRNA in in vitro-activated B cells.
[0128] Inasmuch as the B7 Ag appears on the surface of B cells
after in vitro activation, it was of interest to determine whether
its expression was transcriptionally regulated. Splenic cells were
activated with anti-Ig. Total cellular RNA was harvested from the
activated B cells at various times after activation, 0, 1/6, 1/2,
4, 8, 12, 24, 48, 72, and 96 hours, or from the Burkitt's lymphoma
cell line, Raji. (Normal human spleen cells were obtained after
securing appropriate Human Protection Committee validation and
prepared as previously described. Boyd et al, J. Immunol., 134:1516
(1985)). RNA was electrophoresed, blotted and probed with
.sup.32P-labeled B7 cDNA.
[0129] RNA blot analysis revealed no detectable B7 expression in
unstimulated B cells. Expression was first detected at 4 h after
activation. Four major RNA transcripts of 1.7, 2.9, 4.2, and 10 kb
were observed with the 2.9-kb band being most intense. B7 mRNA
levels peaked from 4 to 12 h and declined slowly thereafter with
little mRNA detected after 48 h. In Raji, the cell line from which
the B7 cDNA clone was derived, the 1.7-kb mRNA was the predominant
form.
[0130] B. Expression of B7 mRNA in Normal Hematopoietic Cells and
Cell Lines.
[0131] To further characterize the induction and lineage
restriction of B7, normal resting and activated hematopoietic cells
were examined, as well as cell lines of T, B, and myeloid
origins.
[0132] Whole resting spleen and splenic B cells did not express B7
mRNA. In contrast, splenic B cells activated with anti-Ig expressed
the four major transcripts. Splenic B cells activated with TPA for
24 h did not express B7 mRNA. Granulocytes were negative whereas
PHA-activated T cells and monocytes were very faintly positive.
Cell lines of B cell origin including Raji, Daudi, and CESS were
positive. The 1.7-kB mRNA predominated in the Burkitt's lymphoma
lines, whereas the 1.7, 2.9, 4.2, and 10 kb species were all seen
in CESS and activated B cells. The myeloma line U266 was negative
whereas RPMI 8226 was very faintly positive. The T cell leukemia
line Rex, the myeloid leukemic line KG-1 and the histiocytic cell
line U937 were negative. However, the erythroleukemia line K562 was
positive.
[0133] C. Expression of B7 mRNA on Neoplastic B Cells.
[0134] RNA blot analysis of B cell neoplasias revealed that B7 mRNA
expression appeared to cluster in several histologically defined
subgroups. Leukemias of B cell origin including non-T cell acute
lymphocytic leukemia (ALL), prolymphocytic leukemia, hairy cell
leukemia (HCL), and chronic lymphocytic leukemia (CLL) were
generally negative although patients 5 (prolymphocytic leukemia), 6
(HCL), and 7 (HCL) weakly expressed the 10-kb transcript. In
contrast, the majority of patients with non-Hodgkin's lymphoma
expressed B7 mRNA. Eight of eight nodular poorly differentiated
lymphomas (NPDL) expressed all four transcripts. Five of eight B
cell diffuse large cell leukemia (LCL) were positive with most
expressing all four transcripts. Two of three DPDL weakly expressed
the 10-kb B7 transcript. Although most Burkitt's lymphoma cell
lines were positive, two of two American Burkitt's lymphomas were
negative. Only one of five myelomas were positive and the one
Waldenstrom's was negative. The pattern of B7 expression found by
Northern blot analysis is somewhat different than that reported for
indirect immunofluorescence with the B7 mAb (Freedman et al, J.
Immunol., 139:3260 (1987)). In particular, by indirect
immunofluorescence, most CLL but few NPDL were found to express B7
(Freedman et al, J. Immunol., 139:3260 (1987)). The B7 mAb is an
IgM and the low level of cell surface expression observed in CLL
may be due to binding by the 60-kD IgM-binding protein expressed by
many CLL (Sanders et al, J. Immunol., 139:188 (1987)). In NPDL, the
level of expression of B7 mRNA differed widely and the lower levels
of B7 mRNA expression may correspond to levels of protein below the
detection limit of indirect immunofluorescence.
[0135] It was of interest to note that the majority of circulating
B cell leukemias did not express B7 mRNA whereas most solid
lymphoid tumors were B7.sup.+. Of the non-Hodgkin's lymphomas that
did not express B7 mRNA, the two diffuse LCL were circulating and
one of the two Burkitt's lymphomas was in an ascites form in vivo.
To further explore this specificity of B7 expression, B7 mRNA
expression was examined in a previously untreated patient where
tumor replaced lymph node and simultaneous circulating tumor cells
were present. NPDL cells isolated from the peripheral blood (more
than 90% tumor cells) of this patient demonstrated only a very
faint amount of 10-kb B7 transcript, whereas his lymph node NPDL
cells (more than 90% tumor cells) were strongly positive,
expressing all four transcripts. Southern blot analysis of IgH
rearrangements showed the presence of equal amounts of clonally
rearranged tumor in peripheral blood and lymph node samples from
this patient.
EXAMPLE 4
[0136] Protein Homologies of B7
[0137] A search (Pearson et al, Proc. Natl. Acad. Sci. USA, 85:244
(1988)) of the GENBANK (release 59) and NBRF (release 19) databases
revealed homology of B7 to members of the Ig superfamily. The
homologies to members of the Ig superfamily are due to the presence
of two contiguous Ig-like domains in the extracellular region
between residues 1-104 and 105-202. Ig-like domains share a common
three-dimensional structure composed of two .beta.-sheets linked by
an intradomain disulfide bond. Ig domains have been divided into V,
C1, and C2 sets based on conserved amino acid patterns and the
number of antiparallel .beta.-strands composing the domain
(Williams et al, Annu. Rev. Immunol., 6:381 (1988)).
[0138] In B7, the cysteine residues at 16 and 82 define a potential
disulfide-linked Ig domain with an intercysteine distance of 66
amino acids, typical of V set sequences. The predicted secondary
structure (Chou et al, Annu. Rev. Biochem., 47:251 (1978)) of the
B7 Ig domain 1 is consistent with the 9 antiparallel .beta.-strands
of a V domain including the additional C' and C" strands. The
conserved Asp-X-Gly adjacent to .beta.-strand F and the Arg at the
base of .beta.-strand D are characteristic of V set sequences with
the Asp and Arg residues forming a salt bridge within the Ig
domain. The second Ig domain in B7 is defined by the cysteine
residues at 128 and 182. The intercysteine distance of 54 residues
is typical of C set sequences and the predicted secondary structure
(Chou et al, Annu. Rev. Biochem., 47:251 (1978)) is consistent with
the seven antiparallel .beta. strands of C set sequences. This
domain is more closely related to the C1 than the C2 set and amino
acids conserved in the C1 set and present in domain 2 are boxed in
FIG. 4b.
[0139] The B7 Ig domains were compared with other members of the Ig
superfamily using the ALIGN program (Dayhoff et al, Methods
Enzymol., 91:524 (1983)). ALIGN scores greater than 3.0 are
considered statistically significant. The closest relationship
between B7 Ig domain 1 and members of the Ig superfamily is with
murine TCR gamma-chain variable region (ALIGN score of 7.65, 36.2%
identity over 94 amino acids. The closest relationship between B7
Ig domain 2 and members of the Ig superfamily is with the human
IgA-CH1 domain (ALIGN score of 6.85, 36.5% identity over 63 amino
acids. The murine B29 protein is a member of the Ig superfamily
whose expression is B cell restricted (Hermanson et al, Proc. Natl.
Acad. Sci. USA, 85:6890 (1988)). The single Ig domain of B29 is
distantly related to the B7 Ig domains (ALIGN scores of 2.68 and
4.70 for B7 Ig domains 1 and 2, respectively). In addition,
residues 54-183 of B7 were moderately similar to the second and
third Ig domains (residues 161-289) of the murine neural cell
adhesion molecule (Cunningham et al, Science, 236:799 (1987))
(ALIGN score of 10.96, 23.8% identity over 126 amino acids).
EXAMPLE 5
[0140] This Example describes the preparation and purification of a
soluble (secreted) form of human B7.
[0141] Production of Soluble B7
[0142] In order to produce large amounts of soluble B7, a plasmid
encoding a secreted form of B7 was introduced into a eukaryotic
cell and a stable cell line expressing B7 was selected.
[0143] In more detail, a DNA fragment encoding a secreted form of
B7 was constructed by polymerase chain reaction (PCR) as follows:
The original B7 cDNA clone in pCDM8 was excised by digestion with
the restriction endonuclease XhoI. The digested DNA was phenol
extracted and ethanol precipitated. A PCR reaction was performed
using 50 nanograms of this DNA in 10 mM Tris, pH 8.3, 50 mM KCl,
1.5 mM MgCl.sub.2, 0.001% gelatin, 200 micromolar DATP, dCTP, dGTP,
dTTP, 25 unit/ml Taq DNA polymerase, and 25 picomoles each of a
sense and an antisense oligonucleotide primer in a final volume of
100 microliters. The sense oligonucleotide primer had the sequence
GCGAGAATTCGGATCCGCCACCATGGGCCACACACGG and contains recognition
sites for the restriction enzymes EcoRI (GAATTC) and BamHI
(GGATCC), a strong translation initiation site (CCACCATGG) and is
identical to the B7 cDNA from nucleotides 316-332. The antisense
primer has the sequence CGCTGAATTCGGATCCTAATGCTCTTGCTTGGTT and
contains recognition sites for the restriction enzymes EcoRI
(GAATTC) and BamHI (GGATCC), a stop codon (sense TAG, antisense of
CTA), and is identical, in an antisense orientation, to nucleotides
1016-1031.
[0144] The reaction mixture was covered with mineral oil. The PCR
reaction was performed on a Techne programmable thermal cycler with
10 cycles of 94.degree., 1 m, 42.degree., 1 m, 72.degree., 1 m and
a final cycle of 72.degree., 10 m. The resulting DNA product
extended from B7 nucleotides 316-1031, followed by a stop codon,
and was flanked by restriction enzyme sites. In the cell, this DNA
encodes a secreted form of the B7 protein from amino acids
methionine -34 to histidine 204.
[0145] Following completion, the reaction was phenol-chloroform
extracted, made 2.5M in ammonium acetate, and ethanol precipitated.
The DNA was redissolved and digested with 40 units of BamHI. The
DNA fragment was electrophoresed in an agarose gel, eluted, and
ligated into BamHI digested, calf intestinal phosphatase treated,
pLEN. pLEN is an expression vector that contains a BamHI cloning
site between the strong metallathione II promoter and the 3'
untranslated region and polyadenylation site of human growth
hormone, signals necessary for expression in mammalian cells. In
addition, the vector contains the SV40 enhancer, pUC8 origin of DNA
replication, and ampicillin resistance gene. A second plasmid,
pSV2-Neo, expressing a selectable marker, neomycin resistance, was
introduced into the cell at the same time as the secB7-pLEN plasmid
in order to provide a selectable marker for DNA integration (Neo).
The plasmids were first linearized by cutting with a restriction
enzyme, PvuI, that cuts in a non-essential region of the plasmids.
The linearized plasmids were introduced into CHO-K1 cells by
electroporation. Cells were resuspended in media without fetal calf
serum and 50 micrograms of linearized secB7-pLEN and 5 micrograms
of linearized pSV2-Neo were added to the solution. The membranes of
the cells were momentarily opened by an electric current of 250
volts, 1600 mF (Bio-Rad Corp., Richmond, Calif.) allowing the
plasmids to enter the cell. The plasmid DNAs were stably
incorporated into the chromosome of the CHO-K1 cells at some low
rate, about 1 in 100,000. It has been shown that while this
incorporation is rare, when it does take place, a large amount of
DNA is incorporated. Thus, if the pSV2-Neo plasmid is incorporated,
the secB7-pLEN is also likely to be incorporated. The cells
incorporating the DNA were selected for by adding 400 micrograms/ml
of G418, a form of neomycin, to the media. Cells that incorporated
the pSV2-Neo survive while other cells died.
[0146] Surviving cells were analyzed for the secretion of B7 by
radiolabeling the proteins with .sup.35S-methionine and
immunoprecipitating B7 from the cell supernatant with anti-B7 mAb.
Cells expressing secreted B7 were cloned and grown up in large
numbers. Secreted B7 was purified from the cell supernatant as
follows. The supernatant was first applied to a Lentil Lectin
column, and the B7 protein was eluted with 5%
methyl-.alpha.-D-mannopyranoside in PBS. The eluted material was
dialyzed against 50 mM Tris pH 8.3, 10 mM NaCl, and applied to a
Q-sepharose (Pharmacia) column equilibrated in 50 mM Tris pH 8.3,
50 mM NaCl.
[0147] The protein was next eluted with a linear salt gradient from
0.05-0.5M NaCl. The B7 protein eluted at approximately 0.25M NaCl
as assayed by polyacrylamide gel electrophoresis. B7 containing
samples were pooled and concentrated via an Amicon ultrafiltration
stirred cell using a 10 Kd MW cut-off membrane, then passed over an
S-200 gel filtration column equilibrated with 50 mM Tris pH 8.3,
250 mM NaCl. Relevant B7 fractions were pooled.
[0148] The thus-prepared soluble B7 was then screened for B7
activity in accordance with the following assay.
[0149] 1.times.10.sup.5 normal T cells isolated from peripheral
blood were cultured in 96 well flat bottom plates with either media
alone or phorbol myristic acetate (2.5 ng/ml, final conc.), with
either anti-CD28 monoclonal antibody 1 .mu.g/ml (final conc.)
(positive control), ionomycin (100 ng/ml, final conc.) positive
control, or the soluble B7 protein (used at a 1:4 dilution, final
concentration), or media alone. This assay has been published in
Proc. Natl. Acad. Sci. USA, 86:1333, (1989) the pertinent portions
of which are incorporated by reference. The T cells were cultured
at 37.degree. for 24 h, then the supernatants were harvested and
assayed for IL-2 activity in a bioassay. The IL-2 assay involved
using an ELISA IL-2 assay (described in Example 7), standard curves
were calculated and the concentration of IL-2 produced by the test
samples determined. The results of the experimentation demonstrated
that, while the anti-CD28 monoclonal antibody caused a marked
enhancement in the secretion of IL-2 by normal, suboptimally
stimulated T cells, the soluble form of B7 failed to show any
significant increase in interleukin-2 production.
[0150] Without wishing to be held to any theory or mechanism of the
invention, the inventors herein have preliminarily determined that
the inability of this soluble B7 to enhance IL-2 secretion is the
result of its inability, in monomeric form, to cross-link its
natural ligand on T cells, an event that is required for signal
transduction (Linsley et al, J. Exp. Med., 173:759 (1991)).
EXAMPLE 6
[0151] This Example describes the amino terminal sequencing of a
soluble form of human B7.
[0152] N-Terminal Amino Acid Sequence of Human B7
[0153] A secreted, soluble form of hB7 was synthesized in CHO cells
and purified from CHO cell supernatants as described in Example 5.
Purified B7 was run on a 9% polyacrylamide gel and electroblotted
onto an Immobilon-P polyvinylidene diflouride (PVDF) transfer
membrane (Millipore, Bedford, Mass.) in 10 mM CAPS
(3-(cyclohexylamino)-1-propanes- ulforic acid), pH 11.0 and 10%
methanol. The membrane was stained with Coomasie Blue to identify
the B7 protein band.
[0154] The B7 protein band was excised and the N-terminal amino
acid sequence was determined using an Applied Biosystems 477A
protein sequencing system. The N-terminal amino acid sequence was
determined to be Val, Ile, His, Val, Thr, Lys, Glu, Val, Lys,
Glu.
EXAMPLE 7
[0155] This example demonstrates that multivalent B7, in the form
of B7 transfected CHO cells, can induce suboptimally activated CD
28+ T lymphocytes to proliferate and cause the secretion of high
levels of interleukin 2.
[0156] Materials and Methods
[0157] A. Cells.
[0158] Human peripheral blood mononuclear cells were isolated from
buffy coats obtained by leukopheresis of healthy donors. After
density gradient centrifugation, the cells were further purified by
depletion of adherent cells on plastic. Residual B cells and
monocytes were depleted by passage through nylon wool. The
CD28.sup.+ subset of T cells was enriched by separation from the
reciprocal subset of CD11b.sup.+ T cells (June et al, Mol. Cell.
Biol., 7:4472-4481 (1987); Damle et al, J. Immunol., 131:2296-2299
(1983); Yamada et al, Eur. J. Immunol., 15:1164-1172 (1985),
residual B cells, and monocytes by two treatments with complement
lysis utilizing anti-3B8 (CD56), anti-Mo1 (CD11B), anti-Mo2 (CD14)
and anti-B1 (CD20) mabs. The efficiency of the purification process
was analyzed in each case by indirect cell immunofluorescence and
flow cytometry (Coulter EPICS flow cytometer) using T3 (CD3) and
4B10 (CD28) mAbs and fluorescein isothiocyanate-labeled goat
anti-mouse immunoglobulin (Tago, Burlingame, Calif.). The final T
cell preparation was >90% CD3.sup.+ and >88% CD28.sup.+ in
each case when compared with staining with an isotype identical
unreactive control antibody. Examination of smears stained for
nonspecific esterase (a naphthyl acetate esterase; SIGMA, St.
Louis, Mo.) confirmed that the cell population contained about 1%
monocytes.
[0159] B. mAbs.
[0160] 4B10 (IgG1) is an anti-CD28 mAb that immunoprecipitates a
44-kDa disulfide-bonded dimer and enhances proliferation and
lymphokine synthesis of suboptimally activated T cells. Indirect
immunofluorescence of CD28-transfected COS cells revealed about 5%
positive cells with similar intensities of staining using 4B10 or
the anti-CD28 nAbs YTH 913.12 and 9.3 (Hara et al, J. Exp. Med.,
161:1513-1524 (1985)). YTH 913.12 was kindly provided by H.
Waldmann. Optimal stimulation with anti-CD28 mAb was obtained at a
concentration of 1 .mu.g/ml and this dose was used throughout the
experiments. Anti-CD3 mAb OKT3 (IgG2a) was obtained from the
American Type Culture Collection and was adhered to plastic plates
at a concentration of 1 .mu.g/ml. This concentration was found to
produce optimal stimulation in association with a second signal of
T-cell activation. 4B10 and OXT3 were purified using a protein
A-agarose column (Bio-Rad) as described (Van Wauwe et al, J.
Immunol., 124:2708 (1980)). The anti-B7 mAb 133 (IgM) was
characterized in our laboratory (Freeman et al, J. Immunol.,
143:2714-2722 (1989); Freedman et al, J. Immunol., 139:3260-3267
(1987)), and was used as ascites at a final dilution of 1:100.
[0161] C. B7 Transfection.
[0162] The B7 cDNA clone in the pCDM8 vector obtained as in Example
1 was digested with restriction endonucleases DraI and BglII, and
the fragment comprising nucleotides 86-1213, containing the coding
region of B7, was isolated. The DraI-BglII fragment was ligated
into BamHI-digested, phosphatase-treated pLEN by a combination of
sticky-end ligation, Klenow polymerase fill-in, and blunt-end
ligation. pLEN is a eukaryotic expression vector containing the
human metallothionein IIA promoter, the simian virus 40 enhancer,
and the human growth hormone 3' untranslated region and
polyadenylation site (Friedman et al, Bio/Technology, 7:359-362
(1989). pLEN was kindly provided by Metabolic Biosystem (Mountain
View, Calif.). Fifty micrograms of PvuI-linearized B7-pLEN
construct was cotransfected with 5 .mu.g of PvuI-linearized
SV2-Neo-Sp65 into CHO-KI Chinese hamster ovary cells by
electroporation using the BRL electroporator at settings of 250 V
and 1600 mF. Transfectants were selected by growth in medium
containing the neomycin analogue G418 sulfate (400 .mu.g/ml) and
were cloned. Clones expressing cell surface B7, as assayed by
indirect immunofluorescence with anti-B7 mAb, were recloned. These
cells are referred to as CHO-B7 cells. Mock-transfected CHO-K1
(CHO-mock) cells were made by transfection of PvuI-linearized
SV2-Neo-Sp65 alone.
[0163] D. Cell Fixation.
[0164] CHO cells were detached from tissue culture plates by
incubation in Dulbecco's phosphate-buffered saline (PBS) with 0.5
mM EDTA for 30 min. Cells were washed once in PBS and resuspended
in PBS at 10.sup.7 per ml. An equal volume of freshly prepared 0.8%
paraformaldehyde in PBS was added and the cells were gently mixed
for 5 min. at room temperature. An equal volume of 0.2 M lysine in
PBS was added to block unreacted paraformaldehyde and the cells
were pelleted by centrifugation. The cells were washed once in PBS,
once in RPMI 1640 (Whittaker Bioproducts) containing lot
heat-inactivated fetal bovine serum (Sigma), resuspended in the
same medium, and incubated for 1 hr. in a humidified 37.degree. C.
incubator. Cells were pelleted, washed in RPMI 1640 containing 10%
heat-inactivated human AB serum (North American Biologicals,
Miami), 2 mM glutamine, 1 mM sodium pyruvate, penicillin (100
units/ml), streptomycin sulfate (100 .mu.g/ml), and gentamicin
sulfate (5 .mu.g/ml) (Gibco). Cells were resuspended in this medium
containing heat-inactivated human AB serum and 2.times.10.sup.4
fixed cells were added to the appropriate wells in a 96-well
flat-bottomed microtiter plate (Nunclon; Nunc).
[0165] E. Proliferation Assay.
[0166] CD28.sup.+ T lymphocytes were incubated in RPMI 1640
containing 10% heat-inactivated human AB serum, 2 mM glutamine, 1
mM sodium pyruvate, penicillin (100 units/ml), streptomycin sulfate
(100 .mu.g/ml) and gentamicin sulfate (5 .mu.g/ml). Cells were
cultured at a concentration of 5.times.10.sup.4 cells per 200 .mu.l
of medium in triplicate samples in a 96-well flat-bottomed
microtiter plate at 37.degree. C. for 3 days in 5% CO.sub.2. Cells
were cultured in medium and with the appropriate stimuli added.
Cells were stimulated with PMA (Calbiochem) at 1 ng/ml and
ionomycin (Sigma) at 100 ng/ml (Manger et al, J. Immunol.,
139:2755-2760 (1987); Wiskocil et al, J. Immunol., 134:1599-1603
(1985); June et al, J. Immunol., 143:153-161 (1989)). The anti-CD3
mAb was added at 1 .mu.g/ml to the 96-well flat-bottomed microtiter
plates and incubated at room temperature for 1 hr; the plates were
then washed twice with PBS before addition of the cells (Weiss et
al, J. Immunol., 137:819-825 (1986); Manger et al, J. Immunol.,
139:2755-2760 (1987); Matsuyama et al, J. Exp. Med., 170:1133-1148
(1989); Geppert et al, J. Immunol., 138:1660-1666 (1987)). The
anti-CD28 mAb 4B10 was added at 1 .mu.g/ml. The fixed CHO-B7 and
CHO-mock transfectants were added at 2.times.10.sup.4 cells per
well. Preliminary experiments showed that maximal stimulation
plateaued with the addition of 2.times.10.sup.4 CHO-B7 cells. The
specificity of the stimulation with CHO-B7 cells was assayed by the
addition of anti-B7 mAb to the cultures at a final ascites dilution
of 1:100. Over the wide range of concentrations (1:50 to 1:2000)
assayed, this dose was found to produce complete blocking of CHO-B7
stimulation.
[0167] F. Thymidine Incorporation Assay.
[0168] Thymidine incorporation was used as an index of mitogenic
activity. During the last 8 hrs. of the 72-hour culture, the cells
were incubated with 1 .mu.Ci of (37 kBq) of
[methyl-.sup.3H]thymidine (ICN Flow, Costa Mesa, Calif.). The cells
were harvested onto filters and the radioactivity on the dried
filters was measured in a Packard Tri-Carb scintillation
counter.
[0169] G. Lymphokine Assay.
[0170] Culture supernatants were collected 24 hrs. after the
initiation of the culture and IL-2 and IL-4 concentrations were
assayed in duplicate using an ELISA kit according to the
manufacturer's instructions (Quantikine; R 7 D Systems,
Minneapolis, Minn.).
[0171] Results
[0172] A. B7-Transfected CHO Cells Stimulate Proliferation of
Suboptimally Activated CD28.sup.+T Cells.
[0173] Crosslinking of CD28 on T cells by anti-CD28 mAb has been
shown to stimulate T-cell proliferation and lymphokine synthesis
(June et al, J. Immunol., 143:153-161 (1989)). Since B7 is a
natural adhesion ligand for CD28, we attempted to determine whether
binding of cell surface B7 to CD28 positive T cells would deliver a
costimulatory signal to T cells. To this end, a CHO cell line
expressing high levels of B7 (CHO-B7) was constructed by stable
transfection of the B7 gene under the control of the strong
metallothionein promoter. The CHO-B7 cells were fixed with
paraformaldehyde and used to stimulate CD28.sup.+ cells that had
been suboptimally stimulated with phorbol myristic acetate (PMA) or
anti-CD3.
[0174] As seen in Table 1 below, PMA, 1 ng/ml, induced a 3- to
8-fold increase in T-cell proliferation over the medium-only
controls. Addition of paraformaldehyde-fixed CHO-B7 cells to
PMA-activated CD28.sup.+ T cells stimulated proliferation 17- to
40-fold. Addition of anti-CD28 mAb also enhanced CD28.sup.+ T-cell
proliferation 26- to 58-fold compared with cells cultured with PMA
alone. The stimulation by CHO-B7 was .apprxeq.28% less than that
observed with anti-CD28 mAb in all experiments performed. CHO-mock
cells did not induce proliferation over background, providing
evidence that B7 was specifically inducing the proliferation
signal. Neither anti-CD28 mAb nor CHO-B7 cells were able to induce
proliferation of untreated CD28.sup.+ cells. Cultures of the
paraformaldehyde-fixed transfected CHO cells alone showed no
proliferation over medium controls. Table 1 depicts T cells from 3
representative, normal donors and similar results have been
consistently observed in seven independent experiments.
1TABLE 1 Effect of phorbol ester, anti-CD28, and CHO-B7 cells on
proliferation of CD28.sup.+ T Cells [.sup.3H]Thymidine
incorporation, cpm CD28.sup.+ cell (mean .+-. SEM) treatment Donor
1 Donor 2 Donor 3 Medium control 156 .+-. 65 130 .+-. 11 151 .+-.
29 PMA 1,404 .+-. 386 1,032 .+-. 176 537 .+-. 73 Anti-CD28 88 .+-.
18 109 .+-. 6 188 .+-. 6 CHO-B7 .sup. 104 .+-. 6.sup. 102 .+-. 9
143 .+-. 37 PMA + CHO-B7 57,030 .+-. 1,017 34,560 .+-. 4,961 9,440
.+-. 1,103 PMA + anti- 82,263 .+-. 1,137 45,023 .+-. 2,684 14,215
.+-. 1,682 CD28 PMA + CHO- 1,010 .+-. 228 728 .+-. 163 369 .+-. 36
mock PMA + CHO- 1,041 .+-. 434 737 .+-. 78 559 .+-. 52 B7 + anti-B7
PMA + anti- 76,697 .+-. 1,241 48,776 .+-. 712 15,290 .+-. 2,011
CD28 + anti- B7
[0175] To confirm that the increased proliferation observed in the
PMA-treated CD28.sup.+ T cells was specifically mediated through
ligation to B7, anti-B7 mAb was added to the culture system to
block this binding. The addition of anti-B7 mAb totally abrogated
the proliferative response induced by the CHO-B87 cells (Table 1).
In contrast, anti-B7 mAb had no effect on the stimulation of
proliferation induced by anti-CD28 mAb. These results further
confirm that B7 provided the costimulatory signal.
[0176] To determine whether binding of B7 to CD28 could augment
proliferation of T cells that had received a first signal of T-cell
activation through the TCR, CD28.sup.+ T cells were first
submitogenically stimulated with anti-CD3 mAb fixed to plastic
(Weiss et al, J. Immunol., 137:819-825 (1986); Manger et al, J.
Immunol., 139:2755-2760 (1987)). Activation via the TCR provides a
more physiologic model, since the cellular events following
crosslinking of TCR by anti-CD3 mimic the transmembrane signaling
that occurs following stimulation with antigen in association with
MHC proteins. The results obtained using anti-CD3 stimulation are
shown in Table 2 below for the same normal donors depicted in Table
1. Activation with anti-CD3 mAb fixed to plastic resulted in a
small, 2- to 3-fold proliferative response above medium controls
for the majority of donors examined. In contrast, donor 1
demonstrated a 10-fold stimulation. This increased proliferation
was presumably due to the greater number of contaminating monocytes
found in the preparation from this donor, as the presence of
monocytes greatly increases the stimulatory potential of fixed
anti-CD3 mAb (Jenkins et al, J. Immunol., 140:3324-3330 (1988)).
When CHO-B7 cells were added to anti-CD3-activated T cells, a
marked increase in stimulation index, ranging from 23- to 180-fold,
was observed. The addition of anti-CD28 mAb also led to a marked
increase in proliferation, with a stimulation index ranging from
30- to 75-fold over that observed with anti-CD3 mAb alone. This
stimulation appeared to be B7-specific, since CHO-mock cells did
not augment proliferation. Addition of anti-B7 mAb completely
blocked the proliferative response obtained with the CHO-B7 cells
but again had no effect on the responses seen with anti-CD28 mAb.
This further confirms that the stimulation occurred via binding of
B7.
2TABLE 2 Effect of anti-CD3, anti-CD28, and CHO-B7 cells on
proliferation of CD28.sup.+ T Cells [.sup.3H]Thymidine
incorporation, cpm CD28.sup.+ cell (mean .+-. SEM) treatment Donor
1 Donor 2 Donor 3 Medium 156 .+-. 65 130 .+-. 11 151 .+-. 29
control Anti-CD3 1,953 .+-. 631 245 .+-. 14 347 .+-. 169 Anti-CD28
88 .+-. 18 109 .+-. 6 188 .+-. 6 CHO-B7 104 .+-. 6 102 .+-. 9 143
.+-. 37 Anti-CD3 + 46,543 .+-. 11,010 45,146 .+-. 4,391 35,106 .+-.
2,847 CHO-B7 Anti-CD3 + 56,836 .+-. 10,440 18,383 .+-. 5,334 26,873
.+-. 7,833 anti-CD28 Anti-CD3 + 1,618 .+-. 158 519 .+-. 135 282
.+-. 7 CHO-mock Anti-CD3 + 174 .+-. 5 2,377 .+-. 1,072 321 .+-. 57
CHO-B7 + anti-B7 Anti-CD3 + 54,646 .+-. 3,932 24,290 .+-. 14,630
30,326 .+-. 13,853 anti-CD28 + anti-B7
[0177] G. B7-Transfected CHO Cells Induce IL-2 but Not IL-4
Secretion.
[0178] Stimulation of submitogenically activated T cells with
anti-CD28 mAb has been shown to result in increased IL-2 production
(Thompson et al, Proc. Natl. Acad. Sci. USA, 85:1194-1198 (1988)).
To determine whether IL-2 secretion could be induced by ligation of
cell surface B7, the culture supernatants from cells co-cultured
with either PMA or anti-CD3 in the presence of CHO-B7 cells or
anti-CD28 were collected from the above experiments and assayed for
lymphokine production. Results of two representative donors from
seven tested are depicted in Table 3. No IL-2 or IL-4 was detected
when the CD28.sup.+ T cells were stimulated with PMA alone. When
anti-CD28 mAb was added to PMA-stimulated CD28.sup.+ T cells, IL-2
secretion was markedly increased. In contrast, there was no
significant increase in IL-4 secretion over background, although
positive controls demonstrated sensitivity and specificity of the
assay. The addition of CHO-B7 cells similarly resulted in a marked
increase in IL-2 secretion but to a lesser extent, .apprxeq.45% of
that observed with anti-CD28 mAb. As was observed with anti-CD28
mAb, there was no increase in IL-4 production. There was no IL-2
production when resting T cells were co-cultured with either
anti-CD28 mAb or CHO-B7 cells. CHO-mock cells did not induce IL-2
secretion by PMA-stimulated CD28.sup.+ cells. The addition of
anti-B7 mAb specifically and nearly completely blocked the
stimulation of IL-2 production by CHO-B7 cells. The anti-B7 mAb had
no effect on IL-2 production in the activated cells stimulated with
anti-CD28 mAb.
[0179] Previous studies have demonstrated that the addition of PMA
and the calcium ionophore ionomycin strongly stimulates
proliferation of CD28.sup.+ cells (June et al, J. Immunol.,
143:153-161 (1989)). Costimulation of CD28 cells with both PMA and
ionomycin enhanced proliferation by up to 75-fold compared with PMA
alone in seven independent experiments. When anti-CD28 mAb or
CHO-B7 cells were added to PMA- and ionomycin-stimulated CD28
cells, proliferation was minimally augmented, between 1- and
2-fold. However, to determine whether B7 ligation could further
enhance IL-2 production, PMA- and ionomycin-stimulated CD28 cells
were co-cultured with CHO-B7 cells or anti-CD28 mAb. As seen in
Table 3 below, CD28.sup.+ cells cultured with PMA and ionomycin
secreted low levels of IL-2 and very low levels of IL-4. Addition
of anti-CD28 mAb to the PMA-and ionomycin-stimulated cells led to
maximal IL-2 production, which was only slightly greater than those
levels observed when anti-CD28 mAb was added to cultures containing
PMA alone. Addition of CHO-B7 cells to the PMA- and
ionomycin-stimulated CD28.sup.+ cells induced higher levels of IL-2
secretion than was observed when the CHO-B7 cells were added to
CD28.sup.+ cells stimulated with PMA alone. Finally, specificity
for B7 was again confirmed, since anti-B7 mAb inhibited IL-2
production by 95%.
3TABLE 3 Effect of B7 on IL-2 and IL-4 production in phorbol
ester-stimulated CD28.sup.+ cells Donor 1 Donor 2 IL-2 IL-4 IL-2
IL-4 CD28.sup.+ cell treatment pg/ml pg/ml pg/ml pg/ml Medium
control <30 <30 <30 <30 PMA <30 <30 <30 <30
Anti-CD28 <30 ND <30 ND PMA + anti-CD28 10,500 65 11,300 60
PMA + CHO-B7 3,800 <30 5,900 40 PMA + CHO-mock <30 <30
<30 <30 PMA + CHO-B7 + anti-B7 80 <30 <30 ND PMA +
anti-CD28 + anti-B7 9,000 ND 11,200 ND PMA + IM 80 50 <30 <30
PMA + IM + anti-CD28 11,500 <30 14,500 <30 PMA + IM + CHO-B7
6,000 <30 10,000 ND PMA + IM + CHO-B7 + anti-B7 340 <30
<30 ND PMA + IM + anti-CD28 + 10,000 ND 7,500 ND anti-B7 IM =
ionomycin; ND = not done.
[0180] Similar results were obtained when anti-CD3 fixed to plastic
was used to stimulate CD28 cells. As seen in Table 4, stimulation
with anti-CD3 led to very low levels of IL-2 secretion and
virtually no detectable IL-4. Addition of either anti-CD28 mAb or
CHO-B7 cells led to maximal IL-2 secretion without production of
IL-4. Again, anti-B7 mAb could inhibit IL-2 secretion by CHO-B7
cells but had no effect on anti-CD28 stimulation.
4TABLE 4 Effect of B7 on IL-2 and IL-4 production in
anti-CD3-stimulated CD28.sup.+ T cells Donor 1 Donor 2 IL-2 IL-4
IL-2 IL-4 CD28.sup.+ cell treatment pg/ml pg/ml pg/ml pg/ml Medium
control <30 <30 <30 <30 Anti-CD3 80 <30 <30 45
Anti-CD3 + anti-CD28 1500 <30 1350 <30 Anti-CD3 + CHO-B7 1050
<30 1350 40 Anti-CD3 + CHO-mock <30 <30 <30 <30
Anti-CD3 + CHO-B7 + anti-B7 130 <30 <30 ND Anti-CD3 +
anti-CD28 + anti-B7 2200 <30 1500 ND ND = not done.
EXAMPLE 8
[0181] This example describes the molecular cloning and
characterization of a murine homologue of the human B7 activation
antigen.
[0182] Isolation of murine cDNA clones. In preliminary experiments,
low stringency hybridization of the human B7 cDNA insert (Freeman
et al, J. Immunol., 143:2714 (1989)) to blots of poly(A).sup.+ RNA
from the murine B cell lines 70Z, A20, TA3, and NS-1 suggested the
presence of cross-hybridizing mRNAs in 70Z and A20. The
.sup.32P-labeled, 1.5 kb human B7 cDNA insert was used to screen a
lambda gt11 cDNA library generated from the mouse pre-B cell line,
70Z/3 (Ben-Neriah et al, Cell, 44:577 (1986)). Hybridization at
reduced stringency was performed in 5.times.SSPE, 5.times.
Denhardt's solution, 0.2% SDS, 50 .mu.g/ml salmon sperm DNA at
50.degree. C. Final washes were in 2.times.SSC, 0.1% SDS at
52.5.degree. C. for 20 min. A single cDNA clone was isolated and
the cDNA insert isolated by digestion with EcoRI followed by
agarose gel purification. DNA sequence analysis of the cDNA from
70Z revealed that it was composed of 1180 bases of intron followed
by a splice aceptor and that it contained a region homologous to
the human B7 Ig-C, transmembrane, cytoplasmic, and 3' untranslated
domains but was an incomplete cDNA because it lacked the 5'
untranslated, signal peptide and IgV domains. A DNA fragment
containing the Ig-C, transmembrane, and cytoplasmic domains was
generated by polymerase chain reaction using the cDNA as a template
with a sense primer of GCTGACTTCTCTACCC and an anti-sense primer of
CTAAAGGAAGACGGTCT. The PCR amplification was performed using Taq
polymerase. Twenty cycles of 94.degree., 1 min., 44.degree., 1
min., 72.degree., 1 min., and a final extension cycle of
72.degree., 10 min., were performed. The PCR product was gel
purified and used to screen a cDNA library prepared from the mouse
B cell line, A20, in the pCDM8 vector under stringent conditions.
Hybridation at high stringency was conducted using the same buffer
but at 65.degree. C. Final washes were in 0.2.times.SSCSOS at
65.degree. C. Four additional cDNA clones were isolated. The cDNA
insert of one of these was isolated by digestion with XbaI followed
by agarose gel purification. The cDNA insert was ligated into XbaI
digested pSKII-. DNA sequence analysis revealed that the cDNA
insert contained a region homologous to human B7 5' untranslated,
signal peptide, Ig-V, and Ig-C domains but was incomplete because
it lacked the transmembrane, cytoplasmic, and 3' untranslated
domains. The Ig-C region was identical between the two murine cDNA
clones and contained a convenient BamHI restriction enzyme site
facilitating their ligation together. A complete murine B7 cDNA
clone was constructed as follows: The first (from 70Z) cDNA clone
was ligated into the EcoRI site of the eukaryotic expression
vector, pcDNAI (Invitrogen, San Diego, Calif.), followed by
digestion with BamHI, and purification of the large fragment
containing the pcDNAI vector and the Ig-C, transmembrane,
cytoplasmic, and 3' untranslated domains. The second cDNA clone
(from A20) in the pSKII- vector, was digested with BamHI and the
fragment containing the mB7 5' untranslated, signal peptide, Ig-V,
and Ig-C domains was isolated by agarose gel electrophoresis and
ligated to the BamHI fragment containing the pcDNAI vector and the
Ig-C, transmembrane, cytoplasmic, and 3' untranslated domains from
the 70Z cDNA clone. This generated a complete murine B7 cDNA clone.
Subsequently, a second murine B7 cDNA clone from the A20 library
was sequenced and found to have a sequence identical to the one
generated by ligating the two incomplete cDNAs together.
[0183] DNA sequence analysis. B7 cDNA inserts were subcloned into
the pKSII.sup.- plasmid (stratagene, La Jolla, Calif.). Nested
deletions were constructed using the Erase-A-Base kit according to
the manufacturer's directions (Promega, Madison, Wis.). Single
stranded phagemid DNA was prepared by M13k07 helper virus infection
as described (Methods In Enzymology, 153:3-34 (1987)) and used as
the sequencing template. The cDNA insert was sequenced using dye
labelled primers and Taq polymerase (Applied Biosystems, Foster
City, Calif.) and the sequencing reactions were analyzed on an
Applied Biosystems model 373 automated fluorescent sequencer.
Sequence data obtained from overlapping deletion clones on both
strands were assembled to yield the final murine B7 sequence
illustrated in SEQ ID NO:3. Sequencing analysis and database
comparisons employed both GCG (Genetics Computer Group, Madison,
Wis.) and IG-Suite (Intelligenetics, Mountain View, Calif.)
programs and databases.
[0184] A search of the Genbank and EMBL databases with the murine
B7 nucleotide sequence revealed that only the human B7 sequence
exhibited significant homology with the murine sequence (sigma=24
standard deviations above the mean). Comparison of the murine B7
cDNA sequence with that of human B7 showed that the two were 60%
identical. Homologous domains include the 5' (50%) and 3' (40%)
untranslated regions in addition to the protein coding sequence
(63%). A poly(A) tract following a consensus polyadenylation signal
(bases 1678-1683) was identified.
[0185] Analysis of the murine B7 cDNA reveals a single, long open
reading frame of 942 bases initiated by one of three closely spaced
ATG codons beginning at nucleotides 225, 249, and 270 and ending at
nucleotide 1166. The second of these ATG codons was chosen (nt 249)
as the initiating methionine because the DNA sequence GCTATGG
around this ATG is consistent with the consensus translation
initiation sequence RCCATGG defined by Kozak (Kozak, Nucleic Acids
Res., 15:8125 (1987)). In addition, the region 5' of this ATG is
highly similar (15 of 17 nucleotides identical) to the human start
site. Initiation at this methionine predicts an open reading frame
of 918 bases encoding a protein of 306 amino acids.
[0186] FIG. 4 shows the alignment of the murine and human B7
protein sequences and the structural features associated with these
molecules. The structural domains shown for murine B7 are based on
a comparison with human B7 and with other members of the Ig
supergene family. The initiatory methionine codon is followed by a
37 amino acid signal peptide. The length of the signal peptide was
chosen to correspond to the signal cleavage site experimentally
determined for human B7 expressed in CHO cells. Amino terminal
sequencing of a soluble human B7 purified from the culture media of
transfected CHO cells revealed that the mature human B7 began with
the amino acid sequence valine--isoleucine--histidine--vali- ne
(see Example 6 herein).
[0187] Hydrophobicity analysis reveals that the putative signal
sequence agrees with the profile for a consensus signal peptide and
that a highly hydrophobic membrane spanning domain is located at
amino acids 211-235. Ig-V (amino acids 1-105) and Ig-C (amino acids
106-199) domains retain many of the conserved amino acids important
for the structure of the Ig supergene family (Williams et al, Ann.
Rev. Immunol., 6:381 (1988)). The complete human and murine B7
protein sequences were 44% identical with 47% identity in the Ig-V
domain and 57% in the Ig-C domain. The murine B7 transmembrane
domain contains two cysteine residues, as opposed to three in human
B7, and these could be involved in lipid derivatization or covalent
interaction with other membrane proteins. The murine B7 cytoplasmic
domain is not closely related to its human counterpart but retains
its highly charged nature. Both murine and human B7 contain eight
potential N-linked glycosylation sites of which four are conserved
between the two sequences. Three of the common glycosylation sites
were found in the Ig-C domain and one in the Ig-V domain. The
murine and human B7 proteins differ in that the murine B7 exhibits
an Ig hinge-like region between the Ig-C and transmembrane domains.
This should confer greater flexibility to the murine B7. The
predicted mature murine B7 protein would contain 269 amino acids
with a molecular weight of 30386 daltons as opposed to 254 amino
acids and 29311 for human B7. Glycosylation of the human B7 protein
leads to an apparent molecular weight of 44-54 Kd and a similar
increase would be expected for murine B7.
[0188] A search of the PIR (Protein Identification Resource) and
the Swiss-Prot (Intelligenetics) protein databases with the murine
B7 protein sequence revealed similarities with several
immunoglobulin variable and constant domains of human and murine
origins. Human B7 was not found in the protein homology searches
because this sequence was not present in the databases searched.
However, searching all three reading frame translations of the
Genbank and EMBL databases with the murine B7 protein sequence
showed that homology with human B7 is much greater than all other
sequences.
[0189] Expression of Murine B7 RNA
[0190] In this example, the murine B7 clone was used to
characterize the lineage restriction of murine B7.
[0191] B7 Hybridization probe. A DNA fragment corresponding to the
protein coding region of the murine B7 cDNA was used as a probe for
RNA and DNA blot hybridizations because of the presence of a
repetitive element in the 3' untranslated region of the B7 mRNA.
The complete murine B7 cDNA was used as a template for PCR
amplification of the coding region using a sense primer
(ATGGCTTGCAATTGTCAG) and anti-sense primer (CTAAAGGAAGACGGTCT)
corresponding to nucleotides 249-266 and 1169-1153 of the cDNA
sequence. The 921 bp coding region PCR product was gel purified and
used in DNA and RNA blot hybridization in accordance with standard
techniques.
[0192] Briefly, RNA was prepared from various organs isolated from
a 4 week old Balb/c mouse. RNA was also prepared from the murine
pre-B cell lines 38B9 and 300.19, the B cell lymphomas AJ9, CH1 and
A20, the plasmacytoma lines, Ag8.653 (P3.times.63-Ag8.653) and NS-1
(P3/NS1/1-Ag4-1), the T cell lymphoma lines, EL4, BW5147, and YAC,
and the thymoma line RADA. RNA preparation, detailed
characterizations, and sources of these cells are as described
(Zhou et al, "Structure and domain organization of the CD19 antigen
of human, mouse and guinea pig B lymphocytes: Conservation of the
extensive cytoplasmic domain", J. Immunol., (in press)). Two
micrograms of poly(A).sup.+ RNA were denatured with glyoxyl,
electrophoresed on an agarose gel, and blotted onto nitrocellulose
membranes (Schleicher and Schuell, Keene, N.H.).
[0193] The DNA fragment corresponding to the protein coding region
of the murine B7 cDNA (base pairs 249-1169) was synthesized using
PCR because of the presence of a repetitive element in the 3'
untranslated region of the B7 mRNA. Using this B7 coding region
probe, RNA blot hybridization analysis of B7 mRNA expression in
murine lymphoid cells revealed that B7 was expressed in the mature
B cell lines AJ9 and CH1, in the plasmacytoma line Ag8.653 and at
low levels in the mature B cell line A20 (FIG. 2A). Two mRNA
transcripts of 2.2 and 3.9 Kb were detected in poly(A).sup.+ RNA.
This is a more simple transcript pattern than seen in human B cell
lines where transcripts of 1.7, 2.9, 4.2, and 10 Kb were detected.
A large transcript (approx. 10 Kb) was observed in the pre-B cell
line 38B9. B7 mRNA expression was not detected in the pre-B cell
line 300.19, the plasmacytoma line NS-1, or the T cell lines EL-4,
BW5147, RADA, and YAC.
[0194] RNA blot hybridization analysis of poly(A).sup.+ RNA
isolated from murine organs demonstrated that B7 expression was
restricted to murine splenocytes (FIG. 2B). No expression was
observed in liver, brain, heart, lung, kidney, muscle, or thymus.
In both murine splenocytes and B cell lines, 2.2 and 3.9 Kb mRNA
transcripts were identified, with the 2.2 Kb transcript
predominating. Thus, B7 expression is restricted in both murine and
human lymphoid cells to mature B cells, some pre-B and plasmacytoma
cell lines, but is not found in T cell lines.
[0195] DNA Blot Hybridization Analysis
[0196] DNA blot analysis to determine the genomic organization of
B7 was performed using the B7 coding region described in FIG. 3.
Isolation of genomic DNA and DNA blot hybridizations were performed
as described (Maniatis et al, "Molecular Cloning: A laboratory
manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
(1989)). The 921 bp murine B7 coding region PCR product and the
actin cDNA insert were labelled by random oligonucleotide priming
using .alpha.-.sup.32P-labeled dCTP and the Klenow fragment of DNA
polymerase. Hybridization, washing, and autoradiography were
performed as previously described (Freeman et al, J. Immunol.,
143:2714 (1989); Maniatis et al, "Molecular Cloning: A laboratory
manual", Cold Spring Harbor Laboratory, Cold Spring Harbor,
N.Y.).
[0197] Five micrograms of C57BL/6 splenic DNA were digested with
eleven different restriction endonucleases: (a) BamHI, (b) EcoRI,
(c) BclI, (d) KpnI, (e) BglII, (f) XbaI, (g) EcoRV, (h) ApaI, (i)
BglI, (j) BstXI and (k) SacI. DNA's were electrophoresed in 0.7%
agarose, blotted and hybridized with .sup.32P-labeled mB7 coding
region cDNA. The sizes, in kb, of molecular weight markers, are
indicated in FIG. 3. When genomic DNA was digested with the eleven
different restriction endonucleases, the B7 coding region probe
hybridized to between one and five restriction enzyme fragments.
Digestion with ApaI or EcoRV produced a single DNA fragment,
consistent with a single copy of the B7 gene per haploid genome.
Digestion with SacI or BclI, which are not present in the B7 coding
region, each produced 5 DNA fragments. These results suggest that
the murine B7 protein coding region encompasses approximately 20 Kb
and is divided into at least 5 exons. If these correspond to the
human B7 genomic organization, these will encode the signal
peptide, Ig-V, Ig-C, transmembrane, and cytoplasmic domains.
EXAMPLE 9
[0198] This Example demonstrates that murine B7 is costimulatory
for human CD28+ T cells, suggesting the existence of a highly
conserved binding domain.
[0199] Cells. Human CD28.sup.+ T cells were isolated from
peripheral blood mononuclear cells as described (Gimmi et al, "B7
provides a costimulatory signal which induces T cells to
proliferate and secrete interleukin-2", Proc. Natl. Acad. Sci. USA,
(in press)).
[0200] Monoclonal antibodies. 4B10 (IgG1) is an anti-CD28 mAb
(Gimmi et al). Optimal stimulation of T cells with anti-CD28 mAb
was obtained at a concentration of 1 .mu.g/ml and this dose was
used throughout the experiments. 4B10 was purified using a protein
A Sepharose column (Bio-Rad) as described (Gimmi et al). The
anti-B7 mAb, 133, (IgM) was characterized in our laboratory
(Freeman et al, J. Immunol., 143:2714 (1989); Freedman et al, J.
Immunol., 137:3260 (1987)) and was used at a final concentration of
10 .mu.g/ml.
[0201] B7-Transfection. Transient expression of B7 cDNA clones in
COS cells was performed as previously described (Aruffo et al,
Proc. Natl. Acad. Sci. USA, 84:8573 (1987)). COS cells transfected
with the PcDNAI vector alone were also prepared. Transfected COS
cells were used 72 hrs. after the addition of DNA. A stably
transfected CHO cell line expressing human 87 was constructed as
previously described and is referred to as CHO-hB7 (Gimmi et
al).
[0202] Cell-fixation. COS and CHO cells were detached from tissue
culture plates and fixed with paraformaldehyde as described in
Example 7.
[0203] Proliferation assay. The capacity of B7 to costimulate T
cell proliferation was measured as described in Example 7. Briefly,
human CD28.sup.+ T lymphocytes were stimulated with phorbol
myristate 13-acetate (PMA) (Calbiochem, La Jolla, Calif.) at 1
ng/ml final concentration (June et al, J. Immunol., 143:153
(1989)). The fixed CHO-hB7 and COS cell transfectants were added at
a concentration of 2.times.10.sup.4 cells/well. The specificity of
the stimulation with COS-hB7 cell was assayed by the addition of
anti-B7 mAb to the cultures at a final concentration of 10
.mu.g/ml. The cells were pulsed with 1 .mu.Ci of .sup.3H-thymidine
(ICN Flow, Costa Mesa, Calif.) during the last eight hours of a 72
hour culture, harvested onto filters, and counted.
[0204] Table 1 below summarizes one of three representative
experiments. Coincubation of paraformaldehyde fixed COS-mB7 or
COS-hB7 cells with PMA treated CD28.sup.+ human T cells resulted in
29 fold and 30 fold enhancement of proliferation, respectively,
compared to T cells treated with PMA alone. Addition of anti-HB7
mAb could completely inhibit the costimulatory activity of COS-hB7
cells but not of COS-mB7 cells. Addition of paraformaldehyde fixed
CHO-hB7 transfected cells resulted in a 51 fold increase in
proliferation. In contrast, coincubation of PMA treated T cells
with paraformaldehyde fixed COS-Vector resulted in no increase in
proliferation. Paraformaldehyde fixed CHO-hB7, COS-hB7, COS-mB7 and
COS vector transfected cells did not induce untreated human
CD28.sup.+ cells to proliferate above media control.
5TABLE 1 Effect of murine and human B7 expressing cells on the
proliferation of phorbol ester treated human CD28.sup.+ T cells
Human CD28.sup.+ T cells co-cultured with: cpm .+-. SEM media 148
.+-. 18 PMA 689 .+-. 48 anti-CD28 109 .+-. 17 CHO-hB7 70 .+-. 2
COS-hB7 47 .+-. 7 COS-mB7 40 .+-. 4 COS-Vector 89 .+-. 28 PMA +
anti-CD28 58646 .+-. 3093 PMA + CHO-hB7 34910 .+-. 982 PMA +
COS-hB7 20676 .+-. 897 PMA + COS-mB7 20081 .+-. 1516 PMA +
COS-Vector 392 .+-. 34 PMA + COS-hB7 + anti-hB7 356 .+-. 52 PMA +
COS-mB7 + anti-hB7 17395 .+-. 1367
EXAMPLE 10
[0205] Construction of a B7 "Knock Out" Mouse
[0206] A DNA fragment corresponding to the protein coding region of
the murine B7 cDNA is used as a probe for hybridizations because of
the presence of a repetitive element in the 3' untranslated region
of the B7 mRNA. The complete murine B7 cDNA is used as a template
for PCR amplification of the coding region using a sense primer
(ATGGCTTGCAATTGTCAG) and anti-sense primer (CTAAAGGAAGACGGTCT)
corresponding to nucleotides 249-266 and 1169-1153 of SEQ ID NO:3.
The PCR amplification is performed using Taq polymerase. Twenty
cycles of 94.degree., 1 min., 44.degree., 1 min., 72.degree., 1.5
min., and a final extension cycle of 72.degree., 10 min., are
performed. The 921 bp coding region PCR product is gel purified and
used for all blot hybridizations.
[0207] The genomic region encoding the mB7 gene is isolated by
using the 921 bp coding region PCR product to screen a lambda
murine genomic DNA library. A 12 kb BamHI DNA fragment containing
the mB7 IgV and IgC exons is ligated into BamHI digested pSKII-. A
B7 "knock out" plasmid is constructed as follows: The protein
coding sequence of the mB7 IgV exon is disrupted by the insertion
of a DNA fragment containing the phosphoglycerate kinase promoter
and neomycin resistance gene into the PvuII site in the mB7 IgV
exon. The 15 kb plasmid containing the mB7 IgV and IgC exons is
partially digested with PvuII and a 15 kb linear molecule is
isolated by gel electrophoresis. The phosphoglycerate kinase
promoter and neomycin resistance gene are isolated from the pKJ-Neo
plasmid by digestion with XhoI and SalI, followed by gel
electrophoresis. The fragment is rendered blunt ended by treatment
with Klenow fragment of DNA polymerase and ligated into the PvuII
site in the mB7 IgV exon. A DNA fragment containing the Thymidine
kinase gene is isolated from the pMC1-TK plasmid by digestion with
PstI and HindIII, followed by gel electrophoresis. The 17 kb
plasmid containing the phosphoglycerate kinase promoter and
neomycin resistance gene in the PvuII site of the mB7 IgV exon is
digested with Hind III and partially digested with PstI. A 14 kb
fragment is isolated and ligated with the PstI and HindIII digested
thymidine kinase gene. This plasmid is linearized by digestion with
PvuI and introduced into murine embryonal stem (ES) cells by
electroporation. ES cells containing the plasmid are isolated by
selection in 400 .mu.g/ml G418. Cells are characterized for correct
insertion of mB7 into the mB7 gene by hybridization. ES cells with
a targeted mouse B7 insertion are introduced into murine embryos in
accordance with established techniques. After birth, these mice are
characterized for the presence of the B7 "knock out" plasmid by
hybridization. Mice containing the B7 "knock out" are bred and will
be characterized for their ability to accept grafts, reject tumors,
and defend against infectious diseases.
Sequence CWU 0
0
* * * * *