U.S. patent application number 09/837806 was filed with the patent office on 2002-11-14 for novel hiv-specific synthetic oligonucleotides and methods of their use.
Invention is credited to Agrawal, Sudhir.
Application Number | 20020168340 09/837806 |
Document ID | / |
Family ID | 25434822 |
Filed Date | 2002-11-14 |
United States Patent
Application |
20020168340 |
Kind Code |
A1 |
Agrawal, Sudhir |
November 14, 2002 |
Novel HIV-specific synthetic oligonucleotides and methods of their
use
Abstract
Disclosed are synthetic oligonucleotides having a nucleotide
sequences specifically complementary to nucleotides 324 to 345 of a
conserved gag region of the HIV-1 genome, the oligonucleotide
consisting of 21 nucleotides which are linked via phosphorothioate
internucleotide linkages. Also disclosed are methods for inhibiting
and treating HIV-1 and HIV-2 infection.
Inventors: |
Agrawal, Sudhir;
(Shrewsbury, MA) |
Correspondence
Address: |
Ann-Louise Kerner, Ph.D.
Hale And Dorr LLP
60 State Street
Boston
MA
02109-1816
US
|
Family ID: |
25434822 |
Appl. No.: |
09/837806 |
Filed: |
April 18, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09837806 |
Apr 18, 2001 |
|
|
|
08914827 |
Aug 19, 1997 |
|
|
|
Current U.S.
Class: |
424/93.2 ;
536/23.72 |
Current CPC
Class: |
A61P 31/18 20180101;
C12N 2310/315 20130101; C12N 15/1132 20130101; A61K 38/00 20130101;
C12N 2310/346 20130101; C12N 2310/321 20130101; C12N 2310/3521
20130101; C12N 2310/321 20130101 |
Class at
Publication: |
424/93.2 ;
536/23.72 |
International
Class: |
A61K 048/00; C07H
021/02 |
Claims
What is claimed is:
1. A synthetic oligonucleotide having a nucleotide sequences
specifically complementary to nucleotides 324 to 345 of a conserved
gag region of the HIV-1 genome set forth as SEQ ID NO:5, the
oligonucleotide consisting of 21 nucleotides which are linked via
phosphorothioate internucleotide linkages.
2. The oligonucleotide of claim 1, wherein the nucleotides comprise
at least two 3'-terminal ribonucleotides, at least two 5'-terminal
ribonucleotides, or at least two 3'-terminal and at least two
5'terminal ribonucleotides.
3. The oligonucleotide of claim 2, wherein the ribonucleotides are
2'-substituted ribonucleotides.
4. The oligonucleotide of claim 3, wherein the 3'-substituted
ribonucleotides are 2'-O-alkyl ribonucleotides.
5. The oligonucleotide of claim 4, wherein the ribonucleotides are
2'-O-methyl ribonucleotides.
6. The method of claim 2, wherein the nucleotides consist
essentially of four 3'-terminal ribonucleotides and four
3'-terminal ribonucleotides, flanking 13 deoxynucleotides.
7. The oligonucleotide of claim 6, wherein the ribonucleotides are
2'-O-methyl ribonucleotides.
8. The oligonucleotide of claim 1 having SEQ ID NO:1.
9. The oligonucleotide of claim 1 having SEQ ID NO:3.
10. The oligonucleotide of claim 7 having SEQ ID NO:1.
11. The oligonucleotide of claim 7 having SEQ ID NO:3.
12. The oligonucleotide of claim 1 having SEQ ID NO:2.
13. The oligonucleotide of claim 1 having SEQ ID NO:4.
14. The oligonucleotide of claim 1 which inhibits HIV-1 or HIV-2
infection in a cell.
15. The oligonucleotide of claim 1 which exhibits antiviral
activity against HIV-1 and HIV-2.
16. A method of treating HIV-1 or HIV-2 infection in a mammal,
comprising the step of administering to the mammal a synthetic
oligonucleotide in an amount effective to inhibit the proliferation
of HIV-1 or HIV-2, the oligonucleotide being specifically
complementary to nucleotides 324 to 345 of a conserved gag region
of the HIV-1 genome set forth as SEQ ID NO:5, and consisting of 21
nucleotides which are linked via phosphorothioate internucleotide
linkages.
17. The method of claim 16 wherein the nucleotides of the
oligonucleotide comprise at least two 3'-terminal ribonucleotides,
at least two 5'-terminal ribonucleotides, or at least two
3'-terminal and at least two 5'terminal ribonucleotides.
18. The method of claim 17, wherein the ribonucleotides of the
oligonucleotide are 2'-substituted ribonucleotides.
19. The method of claim 18, wherein the 3'-substituted
ribonucleotides of the oligonucleotides are 2'-O-alkyl
ribonucleotides.
20. The method of claim 19, wherein the ribonucleotides of the
oligonucleotide are 2'-O-methyl ribonucleotides.
21. The method of claim 19, wherein the nucleotides of the
oligonucleotide consist essentially of four 3'-terminal
ribonucleotides and four 3'-terminal ribonucleotides, flanking 13
deoxynucleotides.
22. The method of claim 21, wherein the ribonucleotides of the
oligonucleotide are 2'-O-methyl ribonucleotides.
23. The method of claim 16, wherein the oligonucleotide has SEQ ID
NO:1.
24. The method of claim 16, wherein the oligonucleotide has SEQ ID
NO:3.
25. The method of claim 21, wherein the oligonucleotide has SEQ ID
NO:1.
26. The method of claim 21, wherein the oligonucleotide has SEQ ID
NO:3.
27. The method of claim 16, wherein the oligonucleotide has SEQ ID
NO:2.
28. The method of claim 16, wherein the oligonucleotide has SEQ ID
NO:6.
29. The method of claim 16, wherein the oligonucleotide is
administered orally.
30. The method of claim 16, wherein the oligonucleotide is
administered intravenously.
31. A pharmaceutical formulation comprising the oligonucleotide of
claim 1 in a pharmaceutically acceptable carrier.
32. A pharmaceutical formulation comprising the oligonucleotide of
claim 6 in a pharmaceutically acceptable carrier.
33. A pharmaceutical formulation comprising the oligonucleotide of
claim 7 in a pharmaceutically acceptable carrier.
34. A method of inhibiting HIV-1 or HIV-2 infection in a cell
comprising the step of contacting the cell with the synthetic
oligonucleotide of claim 1.
35. A method of inhibiting HIV-1 or HIV-2 infection in a cell
comprising the step of contacting the cell with the synthetic
oligonucleotide of claim 6.
36. A method of inhibiting HIV-1 or HIV-2 infection in a cell
comprising the step of contacting the cell with the synthetic
oligonucleotide of claim 7.
37. A method for introducing an intact oligonucleotide into a
mammal, the method comprising the step of orally administering to
the mammal the oligonucleotide of claim 1, whereby the
oligonucleotide is present in intact form in the systemic plasma
following oral administration.
38. A method for introducing an intact oligonucleotide into a
mammal, the method comprising the step of orally administering to
the mammal the oligonucleotide of claim 6, whereby the
oligonucleotide is present in intact form in the systemic plasma
following oral administration.
39. A method for introducing an intact oligonucleotide into a
mammal, the method comprising the step of orally administering to
the mammal the oligonucleotide of claim 7, whereby the
oligonucleotide is present in intact form in the systemic plasma
following oral administration.
Description
BACKGROUND OF THE INVENTION
[0001] This invention relates to the treatment of HIV infection.
More particularly, this invention relates to synthetic modified
antisense oligonucleotides and pharmaceutical compositions
containing such oligonucleotides and to methods of inhibiting HIV
replication and treating HIV infection using such
oligonucleotides.
[0002] Human immunodeficiency virus types 1 and 2 (HIV-1, HIV-2),
formerly called human T-cell leukemia lymphotropic virus-type III
(HTLV-III), are believed to be the etiological agents of acquired
immune deficiency syndrome (AIDS). HIV is part of the Retroviridaie
family, the members of which contain an RNA genome and reverse
transcriptase activity. During their growth cycle, retroviruses
copy their RNA into proviral DNA. The proviral DNA is able to
integrate into the chromosomal DNA of the host cell where it uses
the transcriptional and translational machinery of the host to
express viral RNA and proteins. Viruses are released from the cell
by budding from the cytoplasmic membrane. In the case of HIV-1 and
HIV-2, viral replication results in the death of helper T-cell host
cells, which leads to a state of severe immunodeficiency, to the
development of various malignancies and opportunistic infections,
and ultimately to the death of the infected organism.
[0003] The incidence of AIDS has risen to epidemic proportions in
many countries without the development of preventative treatments
or therapies which are successful in the long term. Those few
therapeutic agents which have been prescribed, such as the
nucleoside analogs 3'-azido-3'-deoxythymidine (AZT), dideoxyinosine
(ddI), and dideoxycytosine (ddC), and various protease inhibitors
have met with limited success. This has been in part because of the
cytotoxicity of these agents. In addition, some viruses escape due
to mutations that render them insensitive to these agents and the
difficulty of antiviral action due to the ability of the virus to
integrate into the host's genome. Thus, there is a long felt need
for more effective therapeutic agents and preventative therapies
for AIDS.
[0004] More recently new chemotherapeutic agents have been
developed which are capable of modulating cellular and foreign gene
expression. These agents, called antisense oligonucleotides, bind
to a target singe-stranded nucleic acid molecules according to the
Watson-Crick or the Hoogstein rule of base pairing, and in doing
so, disrupt the function of the target by one of several
mechanisms: by preventing the binding of factors required for
normal translation or transcription; in the case of an mRNA target,
by triggering the enzymatic destruction of the message by RNase H;
or by destroying the target via reactive groups attached directly
to the antisense oligonucleotide.
[0005] Antisense oligodeoxynucleotides have been designed to
specifically inhibit the expression of HIV-1 and other viruses
(see, e.g., Agrawal (1992) Trends in Biotechnology 10:152-158;
Agrawal et al. in Gene Regulation: Biology of Antisense RNA and DNA
(Erickson and Izant, eds.) Raven Press Ltd., New York (1992) pp.
273-283); Matsukura et al. in Prospects for Antisense Nucleic Acid
Therapy of Cancer and AIDS, Wiley-Liss, Inc. (1992) pp. 159-1798);
and Agrawal (1991) in Prospects for Antisense Nucleic Acid Therapy
for Cancer and AIDS, (Wickstron, ed.) Liss, New York, pp. 145-148).
For example, it has been shown that antisense oligonucleotides
having phosphodiester internucleoside bonds and sequences
complementary to portions of genomic HIV-1 RNA inhibit viral
replication in early infected cells (Zamecnik et al. (1986) Proc.
Acid. Sci. USA 83:4143-4147; Goodchild et al. (1988) Proc. Natl.
Acad. Sci USA 85:5507-5511).
[0006] However, these phosphodiester-linked molecules are less able
to inhibit viral replication in chronically infected cells (Agrawal
et al. (1989) Proc. Natl. Acad. Sci USA 86:7790-7794), mainly
because of their nuclease susceptibility (Wickstrom (1986) J.
Biochem Biophys. Meth. 13:97-102). Therefore, chemically modified,
nuclease-resistant analogs have been developed which are effective
in inhibiting HIV-1 replication in tissue cultures (see, Sarin et
al. (1988) Proc. Natl Acad. Sci. USA 85:7448-7451; Agrawal et al.
(1988) Proc. Natl Acad. Sci USA 85:7079-7083; Matsukura et al.
(1988) Gene 72:343-347). These analogs include oligonucleotides
with nuclease-resistant phosphorothioate internucleotide linkages
shown to inhibit HIV-1 replication in both acute infection (U.S.
Ser. No. 08/309,823; Agrawal et al. (1989) Proc. Natl. Acad. Sci
USA 86:7790-7794) and in chronically infected cell lines (Agrawal
et al. (1991) in Gene Regulation: Biology of Antisense RNA, eds.
Erickson et al. (Raven Press, New York), pp. 273-284; Vickers et
al. (1991) Nucleic Acids Res. 19:3359-3368; Matsukura et al. (1989)
Proc. Natl Acad. Sci. 86:4244-4248; Agrawal et al. (1988) Proc.
Natl Acad. Sci USA 85:7079-7083).
[0007] However, some phosphorothioate-linked oligonucleotides that
have "GC-rich" nucleotide sequences have been found to evoke
immunostimmulatory responses in the organisms to whom they have
been administered. For example, Kniep et al. (Nature (1995)
374:546-549) discloses that oligonucleotides containing the CG
dinucleotide flanked by certain other sequences have a mitogenic
and other side effects.
[0008] Thus, there still remains a need for a more effective
anti-HIV oligonucleotide having therapeutic effects that are
accompanied fewer side effects, e.g., little cellular toxicity and
reduced immunostimmulatory response.
SUMMARY OF THE INVENTION
[0009] It has been discovered that synthetic oligonucleotides
directed to a region of the HIV gag inhibit HIV-1 and HIV-2
infection of mammalian cells. These discoveries have been exploited
to develop the present invention, which in its broadest aspect,
provides synthetic oligonucleotides having a nucleotide sequence
specifically complementary to nucleotides 325 to 346 of a conserved
gag region of the HIV genome set forth as SEQ ID NO:3. These
oligonucleotides have 21 nucleotides ("21mers") which are linked
via phosphorothioate internucleotide linkages. Such
phosphorothioate linkages contain a substitution of sulfur for
oxygen, thereby rendering the oligonucleotide resistant to
nucleolytic degradation. The phosphorothioate linkages may be mixed
R.sub.p and S.sub.p enantiomers, or they may be stereoregular or
substantially stereoregular in either R.sub.p or S.sub.p form (see
Iyer et al. (1995) Tetrahedron Asymmetry 6:1051-1054).
[0010] As used herein, the term "synthetic oligonucleotide"
includes chemically synthesized polymers of 12 to 50, preferably
from about 15 to about 30, and most preferably, 21 ribonucleotide
and/or deoxyribonucleotide monomers connected together or linked by
at least one, and preferably more than one, 5' to 3'
internucleotide linkage. The term "nucleotide sequence specifically
complementary to" nucleotides 324 to 345 of a conserved gag region
of the HIV genome is intended to mean a sequence of nucleotides
that binds to the gag genomic RNA, proviral DNA, or mRNA sequence
under physiological conditions, e.g., by Watson-Crick base pairing
(interaction between oligonucleotide and single-stranded nucleic
acid) or by Hoogsteen base pairing (interaction between
oligonucleotide and double-stranded nucleic acid) or by any other
means including in the case of a oligonucleotide binding to RNA,
causing pseudoknot formation. Binding by Watson-Crick or Hoogsteen
base pairing under physiological conditions is measured as a
practical matter by observing interference with the function of the
nucleic acid sequence. The term "a conserved gag region" refers to
a sequence of nucleotides within the gag gene which is found in
related HIV strains.
[0011] In one embodiment, the oligonucleotides of the invention
comprise at least two 3'-terminal ribonucleotides, at least two
5'-terminal ribonucleotides, or at least two 3'-terminal and at
least two 5' terminal ribonucleotides. In preferred embodiments
according to this aspect of the invention, the oligonucleotide is a
core region hybrid oligonucleotide comprising a region of at least
two deoxyribonucleotides, flanked by 5' and 3' ribonucleotide
regions, each having at least two ribonucleotides. In one
particular embodiment, the oligonucleotides of the invention have
four contiguous 3'-terminal ribonucleotides and four contiguous
3'-terminal ribonucleotides, flanking 13 deoxynucleotides.
[0012] In preferred embodiments, the ribonucleotides in the hybrid
oligonucleotide are 2'-substituted ribonucleotides. For purposes of
the invention, the term "2'-substituted" means substitution of the
2' position of the pentose moiety with an -O-lower alkyl group
containing one to six saturated or unsaturated carbon atoms, or
with an -O-aryl or allyl group having two to six carbon atoms,
wherein such alkyl, aryl or allyl group may be unsubstituted or may
be substituted, e.g., with halo, hydroxy, trifluoromethyl, cyano,
nitro, acyl, acyloxy, alkoxy, carboxyl, carbalkoxyl, or amino
groups; or with a hydroxy, an amino or a halo group, but not with a
2'-H group. In specific embodiments, the ribonucleotides are
2'-O-alkyl ribonucleotides such as 2'-O-methyl ribonucleotides.
[0013] In particular embodiments, the oligonucleotides of the
invention have SEQ ID NO:1, NO:2, NO:3, or NO:4. In some
embodiments, these oligonucleotides inhibit HIV-1 or HIV-2
infection in a cell and/or exhibit antiviral activity against HIV-1
and HIV-2.
[0014] In yet another aspect, the invention provides pharmaceutical
formulations suitable for inhibiting and treating HIV-1 or HIV-2
infection and having reduced side effects such as immunogenicity.
These formulations and for inhibiting comprising at least one
oligonucleotide in accordance with the invention in a
pharmaceutically acceptable carrier.
[0015] As used herein, a "pharmaceutically or physiologically
acceptable carrier" includes any and all solvents (including but
limited to lactose), dispersion media, coatings, antibacterial and
antifungal agents, isotonic and absorption delaying agents and the
like. The use of such media and agents for pharmaceutically active
substances is well known in the art. Except insofar as any
conventional media or agent is incompatible with the active
ingredient, its use in the therapeutic compositions of the
invention is contemplated. Supplementary active ingredients can
also be incorporated into the compositions.
[0016] In another aspect, the invention provides a method of
treating HIV-1 or HIV-2 infection in a mammal. In this method an
oligonucleotide according to the invention is administered to the
mammal in an amount effective to inhibit the proliferation of the
virus. For purposes of the invention, the term "mammal" is meant to
encompass primates and_humans. In some embodiments, the
oligonucleotide is orally administered to the mammal. The term
"orally administered" refers to the provision of the formulation
via the mouth through ingestion, or via some other part of the
gastrointestinal system including the esophagus. In other
embodiments, the oligonucleotide is administered via intravenous
injection. In yet other embodiments, the oligonucleotide is
administered colorectally. The term "colorectal administration" or
"rectal administration" or "colorectally administered" refers to
the provision of the pharmaceutical formulation of the invention to
any part of the large intestine via surgical implantation, anal
administration, or any other mode of placement therein.
[0017] The invention also provides in another aspect a method of
inhibiting HIV-1 or HIV-2 infection in a cell. In this method the
cell is contacted with a synthetic oligonucleotide according to the
invention.
[0018] In yet another aspect, the invention provides a method for
introducing an intact oligonucleotide into a mammal. This method
comprises administering to the mammal an oligonucleotide according
to the invention which is present in intact form in the systemic
plasma of the mammal following oral administration. In one
embodiment, the oligonucleotide is orally or enterally
administered. In another embodiment, the oligonucleotide is
intravenously administered.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] The foregoing and other objects of the present invention,
the various features thereof, as well as the invention itself may
be more fully understood from the following description, when read
together with the accompanying drawings in which:
[0020] FIG. 1 is a graphic representation of the inhibition of
HIV-1 infection in cells treated during initial infection with a
4.times.4 hybrid oligonucleotide of the invention having SEQ ID
NO:1;
[0021] FIG. 2 is a graphic representation of the inhibition of
HIV-1 infection in cells treated following initial infection with a
4.times.4 hybrid oligonucleotide of the invention having SEQ ID
NO:1; and
[0022] FIG. 3 is a graphic representation of the results of an XTT
assay demonstrating the ability of a 4.times.4 oligonucleotide of
the invention having SEQ ID NO:1 to inhibit HIV-2-induced cell
killing.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0023] The patent and scientific literature referred to herein
establishes the knowledge that is available to those with skill in
the art. The issued U.S. patent, allowed patent applications, and
articles cited herein are hereby incorporated by reference.
[0024] It is known that antisense oligonucleotides, can bind to a
target single-stranded nucleic acid molecule according to the
Watson-Crick or the Hoogsteen rule of base pairing, and in doing
so, disrupt the function of the target by one of several
mechanisms: by preventing the binding of factors required for
normal transcription, splicing, or translation; by triggering the
enzymatic destruction of MRNA by RNase H if a contiguous region of
deoxyribonucleotides exists in the oligonucleotide, and/or by
destroying the target via reactive groups attached directly to the
antisense oligonucleotide.
[0025] Novel antisense oligonucleotides have been designed which
inhibit HIV-1 and HIV-2 replication. These oligonucleotides are
synthetic oligonucleotides having phosphorothioate internucleotide
linkages and a nucleotide sequence that is complementary to a
portion of the gag region of the genome of HIV-1 and HIV-2.
Sequences situated in this region have been demonstrated to be
essential for viral packaging. These sequences form a stable
secondary structure (Harrison et al. (1991) in RNA Tumor Viruses
(Coffin et al., eds.) Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y., pp. 235). The oligonucleotides of the invention have
been designed to bind to this region of RNA and DNA, thereby
disrupting its natural stability and resulting ultimately in the
inhibition of viral packaging and translation of gag mRNA. The
specific sequence to which the oligonucleotides of the invention
are complementary is nucleotides 324-345 of the gag region of
HIV-1. This sequence is very conserved among strains of HIV-1, as
shown below in TABLE 1.
1TABLE 1 Sequence of: 324-345.fwdarw. TCTTCCTCTCTCTACCCACGCT
CONSENSUS CGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAG- CGTCAGTA . . Strains .
. of HIV-1 . . HTLV/LLAV G A HIVLAI G A HIVNL43 G G HIVMN G G
HIVJH3 G A HIVOYI G A HIVCDC4 G A HIVRF G A HIVMAL G A (African)
HIVU455 A A CCTCAG (Ugandan) HIVSF2 (GA) 4G G HIVNDK G A
[0026] Targeting an antisense oligonucleotide to such a conserved
region including an active gene allows for efficient inhibition of
HIV proliferation without the generation of "escape mutants."
Escape mutants arise when a mutation occurs in a region of the
genome targeted by the antisense oligonucleotide. They occur at a
higher frequency in non-coding regions (like the SA region of
HIV-1) than in regions encoding a protein.
[0027] Oligonucleotides of the invention are more specific, less
toxic, and have greater nuclease resistance than many other
chemotherapeutic agents designed to inhibit HIV replication. In
particular, these oligonucleotide are less immunostimulatory than
other oligonucleotides directed to the HIV-1 gag sequence because
their nucleotide sequences are not GC-rich. Furthermore, these
hybrid oligonucleotides having phosphorthioate linkages are more
resistant to nucleolytic degradation than are DNA compounds having
solely phosphodiester linkages.
[0028] The oligonucleotides useful in the method of the invention
are at least 12 nucleotides in length, but are preferably 15 to 21
nucleotides long, with 21mers being most common. They are composed
of deoxyribonucleotides, ribonucleotides, or a combination of both
(i.e., are "hybrids"), with the 5' end of one nucleotide and the 3'
end of another nucleotide being covalently linked by
phosphorodithioates or phosphorothioates, non-phosphodiester
internucleotide linkages. Oligonucleotides with these linkages can
be prepared according to known methods such as phosphoramidate or
H-phosphonate chemistry which can be carried out manually or by an
automated synthesizer as described by Brown (A Brief History of
Oligonucleotide Synthesis. Protocols for Oligonucleotides and
Analogs, Methods in Molecular Biology (1994) 20:1-8). (See also,
e.g., Sonveaux "Protecting Groups in Oligonucleotides Synthesis" in
Agrawal (1994) Methods in Molecular Biology 26:1-72; Uhlmann et al.
(1990) Chem. Rev. 90:543-583).
[0029] The oligonucleotides of the composition may also be
additionally modified in a number of ways without compromising
their ability to hybridize to the target nucleic acid. Such
modifications include, for example, those which are internal or at
the end(s) of the oligonucleotide molecule and include additions to
the molecule of the internucleoside phosphate linkages, such as
cholesteryl or diamine compounds with varying numbers of carbon
residues between the amino groups and terminal ribose, deoxyribose
and phosphate modifications which cleave, or crosslink to the
opposite chains or to associated enzymes or other proteins which
bind to the viral genome. Examples of such modified
oligonucleotides include oligonucleotides with a modified base
and/or sugar such as arabinose instead of ribose, or a 3',
5'-substituted oligonucleotide having a sugar which, at both its 3'
and 5' positions is attached to a chemical group other than a
hydroxyl group (at its 3' position) and other than a phosphate
group (at its 5' position). Other modified oligonucleotides are
capped with a nuclease resistance-conferring bulky substituent at
their 3' and/or 5' end(s), or have a substitution in one
nonbridging oxygen per nucleotide. Such modifications can be at
some or all of the internucleoside linkages, as well as at either
or both ends of the oligonucleotide and/or in the interior of the
molecule. For the preparation of such modified oligonucleotides,
see, e.g., Agrawal (1994) Methods in Molecular Biology 26; Uhlmann
et al. (1990) Chem Rev. 90:543-583). Oligonucleotides which are
self-stabilized are also considered to be modified oligonucleotides
useful in the methods of the invention (Tang et al. (1993) Nucleic
Acids Res. 20:2729-2735). These oligonucleotides comprise two
regions: a target hybridizing region; and a self-complementary
region having an oligonucleotide sequence complementary to a
nucleic acid sequence that is within the self-stabilized
oligonucleotide.
[0030] The preparation of these unmodified and modified
oligonucleotides is well known in the art (reviewed in Agrawal et
al. (1992) Trends Biotechnol. 10:152-158; see, e.g., Uhlmann et al.
(1990) Chem. Rev. 90:543-584; and (1987) Tetrahedron. Lett.
28:(31):3539-3542); Agrawal (1994) Methods in Molecular Biology
20:63-80); and zhang et al. (1996) J. Pharmacol. Expt. Thera.
278:1-5).
[0031] Preferred oligonucleotides according to the invention are
hybrid oligonucleotides in that they contain both
deoxyribonucleotides and at least two 2' substituted
ribonucleotides at their termin(i/us). For purposes of the
invention, the term "2'-substituted" means substitution at the 2'
position of the ribose with, e.g., a -O-lower alkyl containing 1-6
carbon atoms, aryl or substituted aryl or allyl having 2-6 carbon
atoms e.g., 2'-O-allyl, 2'-O-aryl, 2'-O-alkyl, 2'-halo, or
2'-amino, but not with 2'-H, wherein allyl, aryl, or alkyl groups
may be unsubstituted or substituted, e.g., with halo, hydroxy,
trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy, carboxyl,
carbalkoxyl or amino groups. Useful substituted ribonucleotides are
2'-O-alkyls such as 2'-O-methyl, 2'-O-ethyl, and 2'-O-propyl, with
2-'O-methyl being the most preferred.
[0032] The hybrid oligonucleotides useful in the method of the
invention resist nucleolytic degradation, form stable duplexes with
RNA or DNA, and preferably activate RNase H when hybridized with
RNA. They may additionally include at least one unsubstituted
ribonucleotide. For example, an oligonucleotide useful in the
method of the invention may contain all deoxyribonucleotides with
the exception of two 2' substituted ribonucleotides at the 3'
terminus of the oligonucleotide, or the 5' terminus of the
oligonucleotide. Alternatively, the oligonucleotide may have at
least two, and preferably 4, substituted ribonucleotides at both
its 3' and 5' termini.
[0033] Preferred oligonucleotides have at least two and preferably
four 2'-O-methyl ribonucleotides at both the 3' and 5' termini,
with the remaining nucleotides being deoxyribonucleotides. One
preferred oligonucleotide is a 21mer phosphorothiote linked
oligonucleotide containing therein deoxyribonucleotides flanked on
each side by four 2'-O-methyl ribonucleotides. This preferred
oligonucleotide is referred to as a "4.times.4". One preferred
class of oligonucleotides useful in the method of the invention
contains four or more deoxyribonucleotides in a contiguous block,
so as to provide an activating segment for RNase H. In certain
cases, more than one such activating segment will be present at any
location within the interior of the oligonucleotide. There may be a
majority of deoxyribonucleotides in oligonucleotides according to
the invention. In fact, such oligonucleotides may have as many as
all but two nucleotide being deoxyribonucleotides.
[0034] TABLE 2 lists some representative species of
oligonucleotides which are useful in the method of the invention.
2'-substituted nucleotides are underscored.
2TABLE 2 OLIGO SEQ ID NO. OLIGONUCLEOTIDE (5'.fwdarw.3') NO: 1
UCGCACCCATCTCTCTCCUUC 1 2 UCGCACCCATCTCTCTCCUUC 1 3
UCGCACCCATCTCTCTCCUUC 1 4 UCGCACCCATCTCTCTCCUUC 1 5
UCGCACCCATCTCTCTCCUUC 1 6 UCGCACCCATCTCTCTCCUUC 1 7
UCGCACCCATCTCTCTCCUUC 1 8 UCGCACCCATCTCTCTCCUUC 1 9
UCGCACCCATCTCTCTCCUUC 1 10 UCGCACCCATCTCTCTCCUUC 1 11
UCGCACCCATCTCTCTCCUUC 1 12 UCGCACCCATCTCTCTCCUUC 1 13
UCGCACCCATCTCTCTCCUUC 1 14 UCGCACCCATCTCTCTCCUUC 1 15
UCGCACCCATCTCTCTCCUUC 1 16 UCGCACCCATCTCTCTCCUUC 1 17
UCGCACCCATCTCTCTCCUUC 1 18 UCGCACCCATCTCTCTCCUUC 1 19
UCGCACCCATCTCTCTCCUUC 1 20 TCGCACCCATCTCTCTCCTTC 2 21
CGCACCCATCTCTCTCCUUCU 3 22 CGCACCCATCTCTCTCCUUCU 3 23
CGCACCCATCTCTCTCCUUCU 3 24 CGCACCCATCTCTCTCCUUCU 3 25
CGCACCCATCTCTCTCCUUCU 3 26 CGCACCCATCTCTCTCCUUCU 3 27
CGCACCCATCTCTCTCCUUCU 3 28 CGCACCCATCTCTCTCCUUCU 3 29
CGCACCCATCTCTCTCCUUCU 3 30 CGCACCCATCTCTCTCCUUCU 3 31
CGCACCCATCTCTCTCCUUCU 3 32 CGCACCCATCTCTCTCCUUCU 3 33
CGCACCCATCTCTCTCCUUCU 3 34 CGCACCCATCTCTCTCCUUCU 3 35
CGCACCCATCTCTCTCCUUCU 3 36 CGCACCCATCTCTCTCCUUCU 3 37
CGCACCCATCTCTCTCCUUCU 3 38 CGCACCCATCTCTCTCCUUCU 3 39
CGCACCCATCTCTCTCCUUCU 3 40 CGCACCCATCTCTCTCCTTCT 4
[0035] Oligonucleotides as described above are useful in a method
of inhibiting HIV-1 or HIV-2 infection in a cell. In this method a
cell is contacted with an oligonucleotide of the invention such
that virus present in the cell at the time of contact, or after
such contact is unable to replicate.
[0036] To determine whether oligonucleotides of the invention could
inhibit or prevent HIV infection, cytopathic effect- (CPE-)based
infection experiments were performed in MT-4 cells. The results of
these studies indicate that oligonucleotides of the invention can
both inhibit an existing infection (FIG. 1) and protect against
such infection (FIG. 2).
[0037] In addition, it was determined that synthetic
oligonucleotides systemically administered to pregnant murine
females crossed the placenta and became available in the blood of
embryos in utero. Thus, it is contemplated that oligonucleotides of
the invention will be used in a method of treating the fetuses and
human mothers harboring HIV.
[0038] The oligonucleotides described herein are administered to
the mammal in the form of therapeutic pharmaceutical formulations
that are effective for treating virus infection. These
pharmaceutical formulation may be administered in conjunction with
other therapeutic agents, e.g., AZT and/or various protease
inhibitors, to treat AIDS.
[0039] The therapeutic pharmaceutical formulation containing at
least one oligonucleotide according to the invention includes a
physiologically acceptable carrier which is congruent with the mode
of administration. Examples include an inert diluent or an
assimilable edible carrier. Suitable formulations that include
pharmaceutically acceptable excipients for introducing compounds to
the bloodstream by intravenous injection and other than injection
routes can be found in Remington's Pharmaceutical Sciences (18th
ed.) (Genarro, ed. (1990) Mack Publishing Co., Easton, Pa.).
[0040] The pharmaceutical forms suitable for injectable use include
sterile aqueous solutions or dispersions and sterile powders for
the extemporaneous preparation of sterile injectable solutions or
dispersions. In all cases the form must be sterile. It must be
stable under the conditions of manufacture and storage and may be
preserved against the contaminating action of microorganisms, such
as bacterial and fungi. The carrier can be a solvent or dispersion
medium. The prevention of the action of microorganisms can be
brought about by various antibacterial and antifungal agents.
Prolonged absorption of the injectable therapeutic agents can be
brought about by the use of the compositions of agents delaying
absorption. Sterile injectable solutions are prepared by
incorporating the oligonucleotide in the required amount in the
appropriate solvent, followed by filtered sterilization.
[0041] Alternatively, the oligonucleotide of the invention and
other ingredients may be enclosed in a hard or soft shell gelatin
capsule, compressed into tablets, or incorporated directly into the
individual's diet. The oligonucleotide may be incorporated with
excipients and used in the form of ingestible tablets, buccal
tablets, troches, capsules, elixirs, suspensions, syrups, wafers,
and the like. When the oligonucleotide is administered orally, it
may be mixed with other food forms and pharmaceutically acceptable
flavor enhancers. When the oligonucleotide is administered
enterally, they may be introduced in a solid, semi-solid,
suspension, or emulsion form and may be compounded with any number
of well-known, pharmaceutically acceptable additives. Sustained
release oral delivery systems and/or enteric coatings for orally
administered dosage forms are also contemplated such as those
described in U.S. Pat. Nos. 4,704,295, 4,556,552, 4,309,404, and
4,309,406.
[0042] As used herein, the term "therapeutically effective amount"
means the total amount of each active component of the
pharmaceutical formulation or method that is sufficient to show a
meaningful subject or patient benefit, i.e., a reduction in tumor
growth or in the expression of proteins which cause or characterize
the cancer. When applied to an individual active ingredient,
administered alone, the term refers to that ingredient alone. When
applied to a combination, the term refers to combined amounts of
the active ingredients that result in the therapeutic effect,
whether administered in combination, serially or
simultaneously.
[0043] A "therapeutically effective manner" refers to a route,
duration, and frequency of administration of the pharmaceutical
formulation which ultimately results in meaningful patient benefit,
as described above. In some embodiments of the invention, the
pharmaceutical formulation is administered via injection,
sublingually, colorectally, intradermally, orally, enterally or in
bolus, continuous, intermittent, or continuous, followed by
intermittent regimens.
[0044] The therapeutically effective amount of synthetic
oligonucleotide administered in the method of the invention will
depend upon the nature and severity of the condition being treated,
and on the nature of prior treatments which the patent has
undergone. Ultimately, the attending physician will decide the
amount of synthetic oligonucleotide with which to treat each
individual patient. Initially, the attending physician may
administer low doses of the synthetic oligonucleotide and observe
the patient's response. Larger doses of synthetic oligonucleotide
may be administered until the optimal therapeutic effect is
obtained for the patient, and at that point the dosage is not
increased further. It is contemplated that the dosages of the
pharmaceutical compositions administered in the method of the
present invention should contain about 0.1 to 100.0 mg/kg body
weight per day, preferably 0.1 to 75.0 mg/kg body weight per day,
more preferably, 1.0 to 50.0 mg/kg body weight per day, even more
preferably, 1 to 25 mg/kg body weight per day, and even more
preferably, 1 to 10 or 1 to 5.0 mg/kg body weight per day. The
oligonucleotide is preferably administered at a sufficient dosage
to attain a blood level of oligonucleotide from about 0.01 .mu.M to
about 100 .mu.M. Preferably, the concentration of oligonucleotide
at the site of aberrant gene expression should be from about 0.01
.mu.M to about 50 .mu.M, more preferably, from about 0.01 .mu.M to
about 10 .mu.M, and most preferably from about 0.05 .mu.M to about
5 .mu.M. However, for localized administration, much lower
concentrations than this may be effective, and much higher
concentrations may be tolerated. It may be desirable to administer
simultaneously or sequentially a therapeutically effective amount
of one or more of the therapeutic compositions of the invention
when individual as a single treatment episode.
[0045] It will be appreciated that the unit content of active
ingredient or ingredients contained in an individual dose of each
dosage form need not in itself constitute an effective amount since
the necessary effective amount can be reached by administration of
a plurality of dosage units (such as suppositories, gels, or
creams, or combinations thereof). In fact, multi-dosing (once a
day) has been shown to significantly increase the plasma and tissue
concentrations of MBO's (data not shown).
[0046] Administration of pharmaceutical compositions in accordance
with invention or to practice the method of the present invention
can be carried out in a variety of conventional ways, such as by
oral ingestion, enteral, colorectal, or transdermal administration,
inhalation, sublingual administration, or cutaneous, subcutaneous,
intramuscular, intraocular, intraperitoneal, or intravenous
injection, or any other route of administration known in the art
for administrating therapeutic agents.
[0047] When the composition is to be administered orally,
sublingually, or by any non-injectable route, the therapeutic
formulation will preferably include a physiologically acceptable
carrier, such as an inert diluent or an assimilable edible carrier
with which the composition is administered. Suitable formulations
that include pharmaceutically acceptable excipients for introducing
compounds to the bloodstream by other than injection routes can be
found in Remington's Pharmaceutical Sciences (18th ed.) (Genarro,
ed. (1990) Mack Publishing Co., Easton, Pa.). The oligonucleotide
and other ingredients may be enclosed in a hard or soft shell
gelatin capsule, compressed into tablets, or incorporated directly
into the individual's diet. The therapeutic compositions may be
incorporated with excipients and used in the form of ingestible
tablets, buccal tablets, troches, capsules, elixirs, suspensions,
syrups, wafers, and the like. When the therapeutic composition is
administered orally, it may be mixed with other food forms and
pharmaceutically acceptable flavor enhancers. When the therapeutic
composition is administered enterally, they may be introduced in a
solid, semi-solid, suspension, or emulsion form and may be
compounded with any number of well-known, pharmaceutically
acceptable additives. Sustained release oral delivery systems
and/or enteric coatings for orally administered dosage forms are
also contemplated such as those described in U.S. Pat. Nos.
4,704,295, 4,556,552, 4,309,404, and 4,309,406.
[0048] When a therapeutically effective amount of composition of
the invention is administered by injection, the synthetic
oligonucleotide will preferably be in the form of a pyrogen-free,
parenterally-acceptable- , aqueous solution. The preparation of
such parenterally-acceptable solutions, having due regard to ph,
isotonicity, stability, and the like, is within the skill in the
art. A preferred pharmaceutical composition for injection should
contain, in addition to the synthetic oligonucleotide, an isotonic
vehicle such as Sodium Chloride Injection, Ringer's Injection,
Dextrose Injection, Dextrose and Sodium Chloride Injection,
Lactated Ringer's Injection, or other vehicle as known in the art.
The pharmaceutical composition of the present invention may also
contain stabilizers, preservatives, buffers, antioxidants, or other
additives known to those of skill in the art. The pharmaceutical
formulation can be administered in bolus, continuous, or
intermittent dosages, or in a combination of continuous and
intermittent dosages, as determined by the physician and the degree
and/or stage of illness of the patient. The duration of therapy
using the pharmaceutical composition of the present invention will
vary, depending on the unique characteristics of the
oligonucleotide and the particular therapeutic effect to be
achieved, the limitations inherent in the art of preparing such a
therapeutic formulation for the treatment of humans, the severity
of the disease being treated and the condition and potential
idiosyncratic response of each individual patient. Ultimately the
attending physician will decide on the appropriate duration of
intravenous therapy using the pharmaceutical composition of the
present invention.
[0049] To determine the preclinical range of anti-HIV activity of
various oligonucleotides of the invention (see TABLE 2),
evaluations were performed with Oligo 12 (having SEQ ID NO:1),
Oligo 32 (SEQ ID NO:3) and Oligo 41 (SEQ ID NO:6). These
evaluations were performed to determine the activity of these
compounds against a variety of wild type and drug-resistant strains
of HIV-1, including both laboratory derived and low passage,
clinical strains of virus and T-lymphocyte-tropic and
monocyte-macrophage-tropic viruses same as these are listed below
in TABLE 3.
3TABLE 3 BIOLOGICAL PROPERTIES OF CLINICAL STRAINS OF HIV-1 AZT
IC.sub.50 ddi IC.sub.50 ISOLATE TROPISM (.mu.M) (.mu.M) SYNCYTIA
GROWTH BAKI L 0.049 2.61 SI R/H SLKA M 0.025 0.32 NSI S/L WEJO L
0.056 2.18 SI R/H ROJO L 0.016 0.87 SI R/H ROMA M 0.016 0.16 SI R/H
STDA L 0.017 0.23 SI R/H WOME L 0.016 0.41 SI R/H VIHU L 0.016 1.21
NSI S/L TEKI L 0.029 0.37 NSI S/L TEKI M 0.016 1.70 NSI S/L DEJO L
0.015 ND NSI S/L BLCH L 0.010 ND NSI S/L RIARL L 0.010 ND NSI S/L
L--lymphocyte M--macrophage SI--syncytium inducing
NSI--non-syncytium inducing R/H--rapid/high S/L--slow/low
[0050] In addition, the activity of the compounds was evaluated
against HIV-2, and the toxicity of Oligo 41 was evaluated by a
variety of methods in infected and uninfected, established and
fresh human cells.
[0051] The initial experiment performed involved evaluation of
Oligos 12, 32, and 41 against three laboratory strains of HIV-1
(IIIB, RF and SK1) and one strain of HIV-2 (ROD) in parallel with
the positive control compound ddC in the XTT-based anti-HIV assay.
All these oligonucleotides are active against both HIV-1 and HIV-2.
An enhanced level of activity was detected with these compounds
when evaluated against the HIV-2 strain ROD. Representative results
are shown in FIG. 3.
[0052] In another experiment, the anti-HIV activity of Oligos 12,
32, and 41 was evaluated against a variety of low passage, clinical
strains of HIV-1 in fresh human peripheral blood mononuclear cells.
These strains include viruses obtained from pediatric patients
attending the Children's Hospital University of Alabama at
Birmingham as well as viruses representative of the various HIV-1
clades found throughout the world, shown below in TABLE 4.
4TABLE 4 BIOLOGICAL PROPERTIES OF CLADE VIRUS ISOLATES VIRUS CLADE
PHENOTYPE COUNTRY 92RWOO9A A NSI Rwanda 92UG029A A SI Uganda
92BR021B B SI Brazil 92TH026B B NSI Thailand 92BR025C C NSI Brazil
92UG021D D SI Uganda 92UG035D D NSI Uganda 92TH022E E NSI Thailand
93BR029F F NSI Brazil 93BR020F F SI Brazil
[0053] In addition to these T-tropic strains, the activity of the
compounds was also evaluated against the monocyte-macrophage
strains BaL and ADA. Oligos 12 and 32 according to the invention,
as well as Oligo 41 are active against low passage clinical
T-tropic strains of HIV-1. The activity of the compounds varies
from strain to strain. The compounds were not active against the
monocyte-macrophage-tropic strains BaL and ADA.
[0054] In other studies, the anti-HIV activity of Oligos 12, 32,
and 41 was evaluated against a variety of drug-resistant virus
strains, including viruses resistant to nevirapine (N119), 3TC
(M198I), protease inhibitors (JE105/R and KN1272/R) and AZT
(4xAZT-R).
[0055] The results of these evaluations indicate that these
oligonucleotides remained active against viruses resistant to
nevirapine, 3TC and the protease inhibitors, but were less active
against viruses with mutations conferring resistance to AZT. An
enhanced level of activity was detected against the
nevirapine-resistant strain N119.
[0056] In yet another experiment, the toxicity of Oligo 41 was
evaluated in uninfected and HIV-1 infected fresh human peripheral
blood mononuclear cells, using a variety of quantitative endpoints.
Toxicity was evaluated using the tetrazolium dyes XTT or MTT,
trypan blue cell and cell viability counting and the incorporation
of tritiated thymidine. Two replicate assays were performed. In the
first assay, Oligo 41 was used at a high test concentration of 50
.mu.g/ml and toxicity was evaluated on day 7. No toxicity was
detected by any of the quantitative endpoints employed. A second
assay was performed to further evaluate toxicity at higher compound
concentration and with longer exposure to the compound. In this
assay, employing a high test concentration of 150 .mu.g/ml and
extending the time of drug exposure from 7 days until 14 days, once
again no toxicity was detected.
[0057] In another set of experiments, the bioavailability of Oligo
12 was examined in vivo was found to be intravenously and orally
bioavailable to rats and monkeys after a single dose.
[0058] In addition, synthetic oligonucleotides systemically
administered to pregnant murine females were found to cross the
placenta and be available in the blood of embryos in utero. Thus,
it is contemplated that oligonucleotides of the invention be used
in methods of treating human fetuses and mothers harboring HIV.
[0059] In order to determine if the oligonucleotide of the
invention administered according to the method of the invention is
absorbed into body tissues, and if so, in which tissues absorption
occurs, the following study was performed. Samples of various body
tissues from treated monkeys and rats were analyzed for
radioactivity at increasing hours after intravenous or oral
administration of a radioactively labelled oligonucleotide specific
for HIV. This oligonucleotide was found to be absorbed through the
gastrointestinal tract and accumulated in various organs and
tissues.
[0060] To evaluate the chemical form of radioactivity in plasma
HPLC is used to demonstrate the presence of both intact
oligonucleotide as well as metabolites various hours after oral
administration. Intact oligonucleotide may also be detected in
liver various hours after administration. Further evidence to
support the absorption of the oligonucleotide may come from urine
sample analysis after radioactively labelled gag-specific
oligonucleotide was orally administered. That the oligonucleotide
continues to be excreted in the urine over time following the
administration of radiolabelled oligonucleotide implies that other
tissues had absorbed it, and that the body was capable of
absorption for an extended period of time.
[0061] The following examples illustrate the preferred modes of
making and practicing the present invention, but are not meant to
limit the scope of the invention since alternative methods may be
utilized to obtain similar results.
EXAMPLE 1
Synthesis and Purification of Oligonucleotides
[0062] Oligonucleotide phosphorothioates were synthesized using an
automated DNA synthesizer (model 8700, Biosearch, Bedford, Mass.)
using a beta-cyanoethyl phosphoramidate approach on a 10 micromole
scale. To generate the phosphorothioate linkages, the intermediate
phosphite linkage obtained after each coupling was oxidized using
3H, 1,2-benzodithiole-3H-one-1,1-dioxide (see Beaucage, in
Protocols for Oligonucleotides and Analogs: Synthesis and
Properties, Agrawal (ed.), (1993) Humana Press, Totowa, N.J., pp.
33-62).
[0063] Hybrid oligonucleotides were synthesized similarly, except
that segments containing 2'-O-methylribonucleotides were assembled
using 2'-O-methylribonucleoside phosphoramidite, followed by
oxidation to a phosphorothioate or phosphodiester linkage as
described above. Deprotection and purification of oligonucleotides
was carried out according to standard procedures, (see Padmapriya
et al. (1994) Antisense Res. & Dev. 4:185-199).
EXAMPLE 2
Propagation and Ouantitation of Cell Lines and Virus Stocks
[0064] A. Cells
[0065] The CEM-SS cell line (Southern Research Institute-Frederick
Research Center, Frederick, MD) is highly susceptible to infection
with HIV, rapidly form multinucleated syncytia, and are eventually
killed by HIV. The cells were maintained (2-7.times.10.sup.5 cells
per ml) in RPMI 1640 tissue culture medium supplemented with 10%
fetal bovine serum, glutamine, and antibiotics, and were passaged
twice weekly at 1:20 dilution. Passage number was logged each week.
Cells were discarded after twenty weeks of passage and fresh CEM-SS
cells thawed and utilized in the assay. Stocks of CEM-SS cells were
frozen in liquid nitrogen in 1 ml NUNC vials in 90% fetal calf
serum and 10% dimethyl sulfoxide (DMSO). Following thawing, CEM-SS
cells were routinely ready to be utilized in the primary screen
assay after two weeks in culture. Prior to replacing a late passage
cell line, the new CEM-SS cells were tested in the screening assay
protocol utilizing the current stock of infectious virus and AZT.
If the infectivity of the virus was significantly different on the
new cells or if AZT appeared less active than expected the new
cells were not entered into the screening program. Mycoplasma
testing was routinely performed on all cell lines.
[0066] Other viral isolates tested included the following drug
resistant strains.
[0067] The N119 isolate was derived in vitro by culture of the
clinical strain A018 in the presence of the nonnucleoside reverse
transcriptase inhibitor nevirapine. This isolate was obtained from
the NIAID AIDS research and Reference Reagent Program (catalog
#1392). The isolate possesses one mutation in the reverse
transcriptase (Y181C) and we have found the isolate to be extremely
cytopathic to T cells such as CEM-SS and MT2 (Richman et al. (1991)
Proc. Natl. Acad Sci. USA 88:11241). The 3TC/M1841 isolate was
selected in vitro using the wild type IIIB strain of virus and
sequential passage of the virus in the presence of increasing drug
concentration in CEM-SS cells (Buckheit Jr. et al. (1996)
Antimicrob. Chem Chemother. 7:243-252). The JE 105/R isolate was
derived from sequential passage of IIIB in the presence of a
protease inhibitor. This isolate possesses the 184V and S37N amino
acid changes in the protease. The KNI272/R isolate was derived from
sequential passage bf IIIB in the presence of the protease
inhibitor KNI272. The isolate possesses three amino acid changes in
the protease, F53L, A71V and T80I. The 4xAZT-Ri isolate was
obtained by site-directed mutagenesis through introduction of four
amino acid changes in the reverse transcriptase of the NL4-3 wild
type virus. The four amino acid changes are D67N, K70R, T215Y, and
K219Q.
[0068] B. Virus
[0069] Virus pools (Southern Research Institute-Frederick Research
Center, Frederick M) were prepared and titrated in CEM-SS cells,
placed in 5 ml aliquots, and frozen at -135.degree. C. After
thawing, unused virus is discarded to avoid changes in infectious
titer. Virus pools were prepared by the acute infection of
5.times.10.sup.5 CEM-SS cells with HIV in a volume of 200 .mu.l at
a multiplicity of infection determined to give complete cell
killing at day 7 post-infection (approximately 0.05 for the
III.sub.B isolate of HIV-1 and 0.01 for the RF isolate of
HIV-1).
[0070] C. Assay
[0071] Infection was allowed to proceed for one hour at 37.degree.
C., after which the cells were transferred to a T25 flask and the
volume increased to 2 ml. On day 1 post-infection the volume was
brought to 5 ml and on day 2 the volume was increased to 10 ml.
Beginning on day 4, the cells were pelleted, the supernatant saved,
and the cells resuspended in a fresh 10 ml aliquot of -tissue
culture medium. Complete medium changes on a daily basis, rather
than allowing growth of the cells in the medium for longer periods
of time, allowed the virus inoculum utilized in the primary screen
to remain relatively undepleted of nutrients when it is used to
infect cells. The staining reaction utilized (XTT, see method
below) required that the glucose concentration remain high (161).
Wells depleted of glucose by cell growth will not permit metabolic
conversion of the tetrazolium dye to the formazan product.
[0072] Cell-free supernatants from the acutely infected cells were
saved on day 4, day 5, day 6, and day 7. An aliquot of supernatant
was saved separately on each day for use in titer determination.
Titer determinations included reverse transcriptase activity assay
(see below), endpoint titration or plaque assay (CEM-SS)
quantification of infectious particles (see below), and
quantification of cell killing kinetics.
[0073] It has been determined that peak levels of infectious virus
are produced in the acutely infected cultures as the viability of
the cells falls through the 50% level. Since the primary screening
assay quantifies the protective effects of a compound by its
ability to inhibit HIV-induced cytopathic effects, the quantity of
virus required to kill CEM-SS cells in 6 days was routinely
utilized to determine the amount of virus required per well in the
primary screening assay. Each of the daily pools was titrated in
the primary screening tetrazolium dye XTT assay protocol (see
below) by performing two-fold dilutions of the virus beginning at a
high test concentration of 50 .mu.l of virus per well. The XTT
staining method was utilized to determine the exact amount of virus
required to kill all of the CEM-SS cells in each well and this
minimum amount of virus was utilized for performance of all primary
testing. Identical methods were utilized to prepare all virus
isolates utilized, including laboratory-derived strains of HIV-1,
HIV-2 and SIV. Clinical isolates utilized were passaged in fresh
human cells. The methods for the growth of these cells and the
production of virus pools is described below.
EXAMPLE 3
Microtiter Antiviral XTT Assay
[0074] A. Cell Preparation:
[0075] CEM-SS cells (AIDS Research and Reference Reagent Program,
NIH) or other established human T cell lines used in these
experiments were passaged in T-150 flasks for use in the assay. On
the day preceding the assay, the cells were split 1:2 to assure
they would be in an exponential growth phase at time of infection.
On the day of assay the cells were washed twice with tissue culture
medium and resuspended in fresh tissue culture medium. Total cell
and viability counting was performed using a hemacytometer and
trypan blue dye exclusion. Cell viability was greater than 95% for
the cells to be utilized in the assay. The cells were pelleted and
resuspended at 2.5.times.10.sup.4 cells per ml in tissue culture
medium. Cells were added to the drug-containing plates in a volume
of 50 .mu.l.
[0076] B. Virus Preparation
[0077] A pretitered aliquot of virus was removed from the freezer
-80.degree. C.) and allowed to thaw slowly to room temperature in a
biological safety cabinet. The virus was resuspended and diluted
into tissue culture medium such that the amount of virus added to
each well in a volume of 50 .mu.l will be the amount determined to
give complete cell killing at 6 days post-infection. In general the
virus pools produced with the IIIB isolate of HIV required the
addition of 5 .mu.l of virus per well. Pools of RF virus were five
to ten-fold more potent, requiring 0.5 to 1 .mu.l per well.
TCID.sub.50 calculation by endpoint titration in CEM-SS cells
indicated that the multiplicity of infection of these assays ranged
from 0.005 to 2.5.
[0078] C. Plate Format
[0079] Each plate contained cell control wells (cells only), virus
control wells (cells plus virus), drug toxicity control wells
(cells plus drug only), drug colorimetric control wells (drug only)
as well as experimental wells (drug plus cells plus virus).
[0080] D. XTT Staining of Screening Plates
[0081] After 6 days of incubation at 37.degree. C. in a 5% CO.sub.2
incubator, the test plates were analyzed by staining with the
tetrazolium dye XTT. XTT-tetrazolium is metabolized by the
mitochondrial enzymes of metabolically active cells to a soluble
formazan product, allowing the rapid quantitative analysis of the
inhibition of HIV-induced cell killing by anti-HIV test substances.
On day 6 post-infection plates were removed from the incubator and
observed. The use of round bottom microtiter plates allows rapid
macroscopic analysis of the activity of a given test compound by
the evaluation of pellet size. The results of the macroscopic
observations were confirmed and enhanced by further microscopic
analysis.
[0082] XTT solution was prepared daily as a stock of 1 mg/ml in
PBS. Phenazine methosulfate (PMS) solution was prepared at 15 mg/ml
in PBS and stored in the dark at -20.degree. C. XTT/PMS stock was
prepared immediately before use by diluting the PMS 1:100 into PBS
and adding 40 .mu.l per ml of XTT solution. Fifty microliters of
XTT/PMS was added to each well of the plate and the plate was
incubated for an additional 4 hours at 37.degree. C. Adhesive plate
sealers were used in place of the lids, the sealed plate was
inverted several times to mix the soluble formazan product and the
plate was read spectrophotometrically at A450 nm with a Molecular
Devices Vmax plate reader. Using an in-house computer program % CPE
(cytopathic effect) reduction, % cell viability, IC.sub.25, 50
& 95, TC.sub.25,50 & 95 and other indices were calculated
and the graphic results summary was displayed.
EXAMPLE 4
Reverse Transcriptase Activity Assay
[0083] A microtiter based reverse transcriptase (RT) reaction was
utilized (Buckheit et al (1991) AIDS Research and Human
Retroviruses 7:295-302). Tritiated thymidine triphosphate (NEN)
(TTP) was resuspended in distilled H.sub.2O at 5 Ci/ml. Poly rA and
oligo dT were prepared as a stock solution which was kept at
-20.degree. C. The RT reaction buffer was prepared fresh on a daily
basis and consists of 125 .mu.l 1 M EGTA, 125 .mu.l dH.sub.2O, 125
.mu.l Triton X-100, 50 .mu.l 1 M Tris (pH 7.4), 50 .mu.l 1 M DTT,
and 40 .mu.l 1 M MgCl.sub.2. These three solutions were mixed
together in a ratio of one part distilled water. Ten microliters of
this reaction mixture was placed in a round bottom microtiter plate
and 15 .mu.l of virus containing supernatant was added and mixed.
The plate was incubated at 37.degree. C. and incubated for 60
minutes. Following reaction, the reaction volume was spotted onto
filter mats, washed 6 times for 5 minutes each in a 5% sodium
phosphate buffer, two times for 1 minute each in distilled water,
two times for 1 minute each in 70% ethanol, and then dried. The
dried filter mat was placed in a plastic sample bag, Betaplate
scintillation fluid was added and the bag was heat-sealed.
Incorporated radioactivity was quantified utilizing a Wallac
Microbeta, scintillation counter (Gaithersburg, Md.).
EXAMPLE 5
P24 ELISA
[0084] ELISA kits were purchased from Coulter (Miami, Fla.). The
assay is performed according to the manufacturer's recommendations.
Prior to ELISA analysis the reverse transcriptase activity assays
(described above) were routinely performed and used the values for
incorporated radioactivity in the RT activity assay to determine
the dilution of our samples requires for the ELISA. Standard curves
were constructed so that the dilutions of virus to be used in the
p24 ELISA could be accurately determined from the RT activity
assay. Control curves were generated in each assay to accurately
quantify the amount of capsid protein in each sample. Data was
obtained by spectrophotometric analysis at 450 nm using a plate
reader. Molecular Devices Vmax P24 (Sunnydale, Calif.)
concentrations were calculated from the optical density values by
use of the Molecular Devices (San Hose, Calif.) software package
Soft Max.
EXAMPLE 6
Infectious Particles
[0085] Infectious virus particles were qualified utilizing the
CEM-SS plaque assay as described by Nara et al. (Nature (1988)
332:469-470). Flat bottom 96-well microtiter plates were coated
with 50 .mu.l of poly-L-lysine (Sigma. St. Louis, Mo.) at 50
.mu.g/ml for 2 hours at 37.degree. C. The wells were then washed
with PBS and 2.5.times.10.sup.5 CEM-SS cells were placed in the
microtiter well where they became fixed to the bottom of the plate.
Enough cells were added to form a monolayer of CEM-SS cells in each
well. Virus containing supernatant was added from each well of the
XTT plate, including virus and cell controls and each serial
dilution of the test substance. The number of syncytia were
qualified in the flat-bottom 96-well microtiter plate with an
Olympus CK2 inverted microscope at 4 days following infection. Each
syncytium resulted from a single infectious HIV virion.
EXAMPLE 7
Anti-HIV Activity in Fresh Human Cells
[0086] A. Assay in Fresh Human T-Lymphocytes
[0087] Fresh human peripheral blood lymphocytes (PBL) were isolated
from voluntary Red Cross donors, seronegative for HIV and HBV.
Leukophoresed blood was diluted 1:1 with Dulbecco's phosphate
buffered saline (PBS), layered over 14 ml of Ficoll-Hypaque density
gradient in a 50 ml centrifuge tube. Tubes were then centrifuged
for 30 minutes at 600 X g. Banded PBLs were gently aspirated from
the resulting interface and subsequently washed 2X with PBS by low
speed centrifugation. After final wash, cells were enumerated by
trypan blue exclusion and re-suspended at 1.times.10.sup.7/ml in
RPMI 1640 with 15% Fetal Bovine Serum (FBS), 2 mM L-glutamine, 4
mg/ml PHA-P and allowed to incubate for 48-72 hours at 37.degree.
C. After incubation, PBLs were centrifuged and reset in RPMI 1640
with 15% FBS, 2 mM L-glutamine, 100 U/ml penicillin, 100 .mu.g/ml
streptomycin, 10 .mu.g/ml gentamycin, and 20 U/ml recombinant human
IL-2. PBLs were maintained in this medium at a concentration of
1-2.times.10.sup.6/ml with bi-weekly medium changes, until use in
assay protocol.
[0088] For the PBL assay, PHA-P stimulated cells from at least two
normal donors were pooled, set in fresh medium at
2.times.10.sup.6/ml, and plated in the interior wells of a 96 well
round bottom microplate at 50 .mu.L/well. Test drug dilutions were
prepared at a 2X concentration in microtiter tubes, and 100 .mu.l
of each concentration was placed in appropriate wells in a standard
format. Fifty microliters of a predetermined dilution of virus
stock was placed in each test well. Wells with cells and virus
alone were used for virus control. Separate plates were identically
set without virus for drug cytotoxicity studies using an XTT assay
system.
[0089] In the standard PBL assay (MOI: 0.2), the assay was ended on
day 7 following collection of cell free supernatant samples for
reverse transcriptase activity assay. In the low MOI PBL assay
(MOI: 0.02), supernatant samples were collected on day 6, day 11,
and day 14 post-infection and analyzed for RT activity. Tritiated
thymidine triphosphate (NEN) (TTP) was resuspended in distilled
H.sub.2O at 5 Ci/ml. Poly rA and oligo dT were prepared as a stock
solution which was kept at -20.degree. C. The RT reaction buffer
was prepared fresh on a daily basis and consists of 125 .mu.l 1 M
DTT, and 40 .mu.l 1 M MgCl.sub.2. These three solutions were mixed
together in a ratio of 2 parts TTP, 1 part poly rA:oligo dT, and 1
part reaction buffer. Ten microliters of this reaction mixture was
placed in a round bottom microtiter plate and 15 .mu.l of virus
containing supernatant was added and mixed. The plate was incubated
at 37.degree. C. in a water bath with a solid support to prevent
submersion of the plate and incubated for 60 minutes. Following
reaction, the reaction volume was spotted onto pieces of DE81
paper, washed 5 times for 5 minutes each in a 5% sodium phosphate
buffer, 2 times for 1 minute each in distilled water, 2 times for 1
minute each in 70% ethanol, and then dried. Opti-Fluor 0 was added
to each sample and incorporated radioactivity was quantified
utilizing a liquid scintillation counter, (Wallac 1450
Microbetaplus, Gaithersburg, Md.).
[0090] Tritiated thymidine incorporation was measured in parallel
cultures at day 7. Each well was pulsed with 1 .mu.Ci of tritiated
thymidine and the cells were harvested 18 hours later with a
Skatron cell harvester onto glass fiber filter papers. The filters
were dried, placed in a scintillation vial with 1 ml of
scintillation cocktail and incorporated radioactivity was
quantified on a liquid scintillation counter (e.g., Packard
Tri-Carb 1900 TR450).
[0091] B. Assay in Fresh Human Monocyte-Macrophages
[0092] For isolation of adherent cells, 3.times.10.sup.6 non-PHA
stimulated peripheral blood cells were resuspended in Hanks
buffered saline (with calcium and magnesium) supplemented with 10%
human AB serum. The cells were placed in a 24-well microtiter plate
at 37.degree. C. for 2 hours. Non-adherent cells were removed by
vigorously washing six times. The adherent cells were cultured for
7 days in RPMI 1640 tissue culture medium with 15% fetal bovine
serum. The cultures were carefully monitored for confluency during
this incubation period. Infection of the cells was performed with
the monocytotropic HIV-1 strains BaL or ADA and the matched pair of
AZT-sensitive and AZT-resistant virus isolates. Each of these virus
isolates was obtained from the NIAID AIDS Research and Reference
Reagent Program. High titer pools of each of these viruses have
been harvested from infected cultures of peripheral blood adherent
cells and frozen in 1.0 ml aliquots at -80.degree. C.
Monocyte-macrophage monolayers were infected at an MOI of 0.1.
Compounds to be evaluated in the monocyte-macrophage assay are
added to the monolayers shortly before infection in order to
maximize the potential for identifying active compounds.
[0093] At 2 days post-infection, the medium was decanted and the
cultures washed twice with complete medium in order to remove
excess virus. Fresh medium alone or medium containing the
appropriate concentrations of drugs was added and incubation
continued for an additional 5 days. XTT-tetrazolium or trypan blue
exclusion assays (for cell viability) and HIV p24 ELISA assays (for
production of p24 core antigen) were performed on Day 7
post-infection. ELISA kits were purchased from Coulter. The assay
is performed according to the manufacturer's recommendations.
Control curves are generated in each assay to accurately quantify
the amount of capsid protein in each sample. Data was obtained by
spectrophotometric analysis at 450 nm using a plate reader
(Molecular Devices Vmax). P24 concentrations were calculated from
the optical density values by use of the Molecular Device software
package Soft Max.
EXAMPLE 8
Inhibition of Acute Infection of MT-4 Cells
[0094] CPE based infection experiments were performed using MT-4
cells (Pauwels et al. (1988) J. Virol. Meth. 20:309; Papp et al.
(1997) AIDS Research and Human Retroviruses In Press). MT-4 cells
were obtained from the AIDS Research and Reference Reagent Bank,
Division of AIDS, NIAID, NIH contributed Dr. Richman (Pauwels et
al. (1988) J. Virol. Meth. 20:309). T-lymphoid H9 (HUT-78) cells
were obtained from Dr. Robert Gallo, National Cancer Institute,
Bethesda, Md. (Popovic et al. (1984) Science 224:497; Gazdar et al.
(1980) Blood 55:409). Cell cultures were maintained in RPMI 1640
medium (GIBCO Laboratories, Grand Island, N.Y.) supplemented with
20% (H9 cells), or 10% (MT-4 cells) heat-inactivated fetal bovine
serum (Sigma Chemical Co., St. Louis, Mo.) 250 units/ml penicillin,
250 .mu.g/ml streptomycin, 2 mM l-glutamine, and 10 mM
HEPES(N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid) buffer
(complete medium) at 37.degree. C. in 5% CO.sub.2. HIV-1 IIB was
originally obtained from Dr. Robert Gallo, National Cancer
Institute (Popovic (1984) Science 224:497). Virus stocks of HIV-1
were prepared from cell-free filtered supernatant of chronically
infected H9 cultures by the shaking method as previously described
by Vujoie et al. (J. Infectious Diseases (1988) 157:1047).
[0095] Experiments were performed under two sets of conditions.
Dilutions of hybrid oligonucleotides according to the invention
having SEQ ID NO:1 were prepared in 96-well plates and infections
were performed either in the presence of inhibitors, by adding MT-4
cells and a TCID.sub.CPE-90% concentration of HIV-HHB directly to
the wells, or by infecting MT-4 cells for 4 hours at 37.degree. C.
in the absence of inhibitors, washing to remove non-adsorbed virus,
then adding the infected cells to wells containing inhibitors. The
cultures were incubated for 6 days and CPE measured using the MTT
dye method. (Rapid, (1983) J. Immunolog. Meth. 65:55).
[0096] The results demonstrate that an oligonucleotide of the
invention inhibits HIV-1 infection when added to cells during viral
infection (FIG. 1) or post-viral adsorption (FIG. 2).
EXAMPLE 9
Measurement of Orally Administered Oligonucleotide
[0097] A. Animals and Treatment
[0098] Male Sprague-Dawley rats (100-120 g, Harlan Laboratories,
Indianapolis, Ind.) and male CD-/F2 mice (25.+-.3 g, Charles River
Laboratory, Wilmington, Mass.) are used in the study. The animals
are fed with commercial diet and water ad libitum for 1 week prior
to the study.
[0099] Unlabelled and .sup.35S-labelled oligonucleotides are
dissolved in physiological saline (0.9% NaCl) in a concentration of
25 mg/ml, and are administered to the fasted animals via gavage at
the designated dose (30-50 mg/kg for rats and 10 mg/kg for mice).
Doses are based on the pretreatment body weight and rounded to the
nearest 0.01 ml. After dosing, each animal is placed in a
metabolism cage and fed with commercial diet and water ad libitum.
Total voided urine is collected and each metabolism cage is then
washed following the collection intervals. Total excreted feces is
collected from each animal at various timepoints, and feces samples
are homogenized prior to quantitation of radioactivity. Blood
samples are collected in heparinized tubes from animals at the
various timepoints. Plasma is separated by centrifugation. Animals
are euthanized by exsanguination under sodium pentobarbital
anesthesia at various times (i.e., 1, 3, 6, 12, 24, and 48 hr; 3
animals/time point). Following euthanasia, the tissues are
collected from each animal. All tissues/organs are trimmed of
extraneous fat or connective tissue, emptied and cleaned of all
contents, individually weighed, and the weights recorded.
[0100] To quantitate the total absorption of the hybrid
oligonucleotide, two additional groups of animals (3/group) for
each test oligonucleotide are treated using the same procedure as
above. Animals are killed at 6 or 12 hr post dosing, and the
gastrointestinal tract is then removed. Radioactivities in the
gastrointestinal tract, feces, urine, plasma, and the remainder of
the body is determined separately. Total recovery of radioactivity
is also determined to be 95.+-.6%. The percentage of the absorbed
hybrid oligonucleotide-derived radioactivity is determined by the
following calculation:
[0101] (total radioactivity in the remainder of the body+total
radioactivity in urine).div.(total radioactivity in the
gastrointestinal tract, feces, urine, plasma, and the remainder of
the body).
[0102] B. Radioactive Labelling of Oligonucleotide
[0103] To obtain .sup.35S-labelled oligonucleotide, synthesis is
carried out in two steps. The first nucleotides of the
oligonucleotide sequence from its 3'-end are assembled using the
.beta.-cyanoethyl-phosphoramidite approach (see, Beaucage in
Protocols for Oligonucleotides and Analogs (Agrawal, ed.), Humana
Press, (1993), pp. 33-61). The last nucleotides are assembled using
the H-phosphonate approach (see, Froehler in Protocols for
Oligonucleotides and Analogs (Agrawal, ed.) Humana Press, 1993, pp.
63-80). Controlled pore glass (CPG) support-bound oligonucleotide
(30 mg of CPG; approximately 1 .mu.M) containing five H-phosphonate
linkage is oxidized with 35S.sub.8 (4 mCi, 1 Ci/mg, Amersham; 1
Ci=37 GBq) in 60 ml carbon disulfide/pyridine/triethylamine
(10:10:1). The oxidation reaction is performed at room temperature
for 1 hr with occasional shaking. Then 2 .mu.l, 5 .mu.l , and 200
.mu.l of 5% cold sulfur (.sup.32S.sub.8) in same solvent mixture is
added every 30 min to complete the oxidation. The solution is
removed and the CPG support is washed with carbon
disulfide/pyridine/triethylamine (10:10:1) (3.times.500 .mu.l) and
with acetonitrile (3.times.700 .mu.l). The product is deprotected
in concentrated ammonium hydroxide (55.degree. C., 14 hr) and
evaporated. The resultant product is purified by polyacrylamide gel
electrophoresis (20% polyacrylamide containing 7 M urea). The
desired band is excised under UV shadowing and the
PS-oligonucleotide was extracted from the gel and desalted with a
Sep-Pak C18 cartridge (Waters) and Sephadex G-15 column.
[0104] C. Total Radioactivity Measurements
[0105] The total radioactivities in tissues and body fluids is
determined by liquid scintillation spectrometry (LS 6000TA,
Beckman, Irvine, Calif.). In brief, biological fluids (plasma,
50-100 .mu.l; urine, 50-100 .mu.l) are mixed with 6 ml
scintillation solvent (Budget-Solve, RPI, Mt. Prospect, Ill.) to
determine total radioactivity. Feces are ground and weighed prior
to being homogenized in a 9-fold volume of 0.9% NaCl saline. An
aliquot of the homogenate (100 .mu.l) is mixed with solubilizer
(TS-2, RPI, Mt. Prospect, Ill.) and then with scintillation solvent
(6 ml) to permit quantitation of total radioactivity.
[0106] Following their removal, tissues are immediately blotted on
Whatman No. 1 filter paper and weighed prior to being homogenized
in 0.9% NaCl saline (3-5 ml per gram of wet weight). The resulting
homogenate (100 .mu.l) is mixed with solubilizer (TS-2, RPI, Mt.
Prospect, Ill.) and then with scintillation solvent (6 ml) to
determine total radioactivity. The volume of 0.9% NaCl saline added
to each tissue sample is recorded. The homogenized tissues/organs
are kept frozen at .ltoreq.-70.degree. C. until the use for further
analysis.
[0107] D. HPLC Analysis
[0108] The radioactivity in urine is analyzed by paired-ion HPLC
using a modification of the method described essentially by Sands
et al. (Mol. Pharm (1994) 45:932-943). Urine samples are
centrifuged and passed through a 0.2-.mu.m Acro filter (Gelman, Ann
Arbor, Mich.) prior to analysis. Hybrid oligonucleotide and
metabolites in plasma samples are extracted using the above methods
in sample preparation for PAGE. A Microsorb MV-C4 column (Rainin
Instruments, Woburn, Mass.) is employed in HPLC using a Hewlett
Packard 1050 HPLC with a quaternary pump for gradient making.
Mobile phase includes two buffers; Buffer A was 5 mM-A reagent
(Waters Co., Bedford, Mass.) in water and Buffer B is 4:1 (v/v)
Acetonitrile (Fisher)/water. The column is eluted at a flow rate of
1.5 ml/min, using the following gradient: (1) 0-4 min, 0% buffer B;
(2) 4-15 min 0-35% Buffer B; and (3) 15-70 min 35%-80% Buffer B.
The column is equilibrated with Buffer A for at least 30 min prior
to the next run. By using a RediFrac fraction collector (Pharmacia
LKB Biotechnology, Piscataway, N.J.), 1-min fractions (1.5 ml) are
collected into 7-ml scintillation vials and mixed with 5 ml
scintillation solvent to determine radioactivity in each
fraction.
[0109] E. Analysis of Test Oligonucleotides
[0110] Polyacrylamide gel electrophoresis (PAGE) of
oligonucleotides and its metabolites is carried out by known and
established methods. Plasma and tissue homogenates are incubated
with proteinase K (2 mg/ml) in extraction buffer (0.5% SDS/10 mM
NaCl/20 mM Tris-HCl, pH 7.6/10 mM EDTA) for 1 hr at 60.degree. C.
The samples are then extracted twice with phenol/chloroform (1:1,
v/v) and once with chloroform. After ethanol precipitation, the
extracts are analyzed by electrophoresis in 20% polyacrylamide gels
containing 7 M urea. Urine samples are filtered, desalted and then
analyzed by PAGE. The gels are fixed in 10% acetic acid/10%
methanol solution and then dried before autoradiography.
[0111] Equivalents
[0112] Those skilled in the art will recognize, or be able to
ascertain, using no more than routine experimentation, numerous
equivalents to the specific substances and procedures described
herein. Such equivalents are considered to be within the scope of
this invention, and are covered by the following claims.
Sequence CWU 1
1
* * * * *