U.S. patent number RE44,596 [Application Number 13/447,104] was granted by the patent office on 2013-11-12 for method for the detection of cancer.
This patent grant is currently assigned to Guardant Health, Inc.. The grantee listed for this patent is Philippe Anker, Maurice Stroun. Invention is credited to Philippe Anker, Maurice Stroun.
United States Patent |
RE44,596 |
Stroun , et al. |
November 12, 2013 |
Method for the detection of cancer
Abstract
The present invention relates to a method for the diagnosis
and/or the follow up of the evolution of cancer, which includes the
analysis and quantification of over expressed and amplified genes
in the plasma/serum of cancer patients or persons suspected to
harbor cancer. This is achieved by analyzing together the amount of
DNA and RNA of certain genes in the plasma/serum of cancer patients
that are the reflection of a gene amplification and/or a gene over
expression in comparison to healthy controls.
Inventors: |
Stroun; Maurice (Geneva,
CH), Anker; Philippe (Geneva, CH) |
Applicant: |
Name |
City |
State |
Country |
Type |
Stroun; Maurice
Anker; Philippe |
Geneva
Geneva |
N/A
N/A |
CH
CH |
|
|
Assignee: |
Guardant Health, Inc. (Redwood
City, CA)
|
Family
ID: |
34934801 |
Appl.
No.: |
13/447,104 |
Filed: |
April 13, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
Reissue of: |
11336780 |
Jan 23, 2006 |
7700286 |
Apr 20, 2010 |
|
|
Foreign Application Priority Data
|
|
|
|
|
Apr 6, 2005 [EP] |
|
|
05007508 |
|
Current U.S.
Class: |
435/6.1;
435/6.11; 435/91.21; 435/6.12; 435/91.5; 435/6.14; 435/91.1;
435/91.2; 435/91.51 |
Current CPC
Class: |
C12Q
1/6886 (20130101); C12Q 2600/16 (20130101) |
Current International
Class: |
C12Q
1/68 (20060101); C12P 19/34 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
1 158 055 |
|
Nov 2001 |
|
EP |
|
1158055 |
|
Nov 2001 |
|
EP |
|
WO 97/35589 |
|
Oct 1997 |
|
WO |
|
WO 97/35589 |
|
Oct 1997 |
|
WO |
|
WO 01/90409 |
|
Nov 2001 |
|
WO |
|
WO 01/90409 |
|
Nov 2001 |
|
WO |
|
Other References
Anker, et al. Detection of circulating tumour DNA in the blood
(plasma/serum) of cancer patients. Cancer Metastasis Rev.
1999;18(1):65-73. cited by applicant .
Anker, et al. Progress in the knowledge of circulating nucleic
acids: plasma RNA is particle-associated. Can it become a general
detection marker for a cancer blood test? Clin Chem. Aug.
2002;48(8):1210-1. cited by applicant .
Chan, et al. Plasma Epstein-Barr virus DNA and residual disease
after radiotherapy for undifferentiated nasopharyngeal carcinoma. J
Natl Cancer Inst. Nov. 6, 2002;94(21):1614-9. cited by applicant
.
Chen, et al. Telomerase RNA as a detection marker in the serum of
breast cancer patients. Clin Cancer Res. Oct. 2000;6(10):3823-6.
cited by applicant .
Dasi, et al. Real-time quantification in plasma of human telomerase
reverse transcriptase (hTERT) mRNA: a simple blood test to monitor
disease in cancer patients. Lab Invest. May 2001;81(5):767-9. cited
by applicant .
Fleischhacker, et al. Detection of amplifiable messenger RNA in the
serum of patients with lung cancer. Ann N Y Acad Sci. Sep.
2001;945:179-88. cited by applicant .
Hasselmann, et al. Detection of tumor-associated circulating mRNA
in serum, plasma and blood cells from patients with disseminated
malignant melanoma. Oncol Rep. Jan.-Feb. 2001;8(1):115-8. cited by
applicant .
Kopreski, et al. Detection of tumor messenger RNA in the serum of
patients with malignant melanoma. Clin Cancer Res. Aug.
1999;5(8):1961-5. cited by applicant .
Nawroz, et al. Microsatellite alterations in serum DNA of head and
neck cancer patients. Nat Med. Sep. 1996;2(9):1035-7. cited by
applicant .
Rykova, et al. Breast cancer diagnostics based on extracellular DNA
and RNA circulating in blood. Biochemistry (Moscow) Supplement
Series B: Biomedical Chemistry. 2008; 2(2):208-213. cited by
applicant .
Silva, et al. Detection of epithelial messenger RNA in the plasma
of breast cancer patients is associated with poor prognosis tumor
characteristics. Clin Cancer Res. Sep. 2001;7(9):2821-5. cited by
applicant .
Silva, et al. Detection of epithelial tumour RNA in the plasma of
colon cancer patients is associated with advanced stages and
circu-lating tumour cells. Gut. Apr. 2002:50(4):530-4. cited by
applicant .
Wong, et al. New markers for cancer detection. Curr Oncol Rep. Nov.
2002;4(6):471-7. cited by applicant .
Wong, et al. Quantitative correlation of cytokeratin 19 mRNA level
in peripheral blood with disease stage and metastasis in breast
cancer patients: potential prognostic implications. Int J Oncol.
Mar. 2001;18(3):633-8. cited by applicant .
Wong, et al. Quantitative relationship of the circulating tumor
burden assessed by reverse transcription-polymerase chain reaction
for cytokeratin 19 mRNA in peripheral blood of colorectal cancer
patients with Dukes' stage, serum carcinoembryonic antigen level
and tumor progression. Cancer Left. Jan. 10, 2001;162(1):65-73.
cited by applicant .
Philippe Anker et al., "Circulating Nucleic Acids in Plasma and
Serum as a Noninvasive Investigation for Cancer: Time for
Large-Scale Clinical Studies?", International Journal of Cancer,
2003, pp. 149-152, XP 002275956. cited by applicant .
Carsten Goessl, "Diagnostic Potential of Circulating Nucleic Acids
for Oncology", Expert Review of Molecular Diagnostics, 2003, vol.
3, No. 4, p. 431-442, XP009052512. cited by applicant .
Javier Silva et al., "RNA is More Sensitive than DNA in
Identification of Breast Cancer Patients Bearing Tumor Nucleic
Acids in Plasma", Genes, Chromosomes & Cancer, vol. 35, No. 4,
2002, pp. 375-376, XP009052544. cited by applicant.
|
Primary Examiner: O Hara; Eileen B
Attorney, Agent or Firm: Wilson Sonsini Goodrich &
Rosati
Claims
The invention claimed is:
1. A method for the diagnosis or the follow up of the evolution of
cancers which comprises measuring both gene over-expression (RNA)
and gene amplification (DNA) of a gene .[.present.]. in .[.the.].
.Iadd.a sample derived from .Iaddend.bodily .[.fluids of.].
.Iadd.fluid from .Iaddend.a patient.Iadd., .Iaddend.that is both
amplified and over-expressed in cancer cells and comparing to
healthy controls.Iadd., wherein the sample is cell free or
substantially cell free.Iaddend..
2. The method according to claim 1, wherein .Iadd.the .Iaddend.RNA
and .Iadd.the .Iaddend.DNA are extracted from .[.a.]. .Iadd.the
.Iaddend.bodily fluid, purified and amplified, and the
over-expressed RNA and .Iadd.the .Iaddend.amplified DNA are
analyzed and compared to a house keeping gene.
3. The method according to claim 2, wherein the .[.genes.].
.Iadd.gene .Iaddend.analyzed .[.are.]. .Iadd.is .Iaddend.selected
from hTERT, hTR, TEP1, MYCN, MYCC, ErbB2, Her2, Her2/Neu, Her 1,
Cyclin A and D1, ABL, SKP2, ETV6 (TELgene), MGC2177, PLAG1, PSMC6P
and LYN.
4. The method according to claim 2, wherein the .[.nucleic acids.].
.Iadd.RNA and the DNA .Iaddend.are amplified by reverse
transcriptase chain reaction (RT-PCR).
5. The method according to claim 3, wherein the .[.nucleic acids.].
.Iadd.RNA and the DNA .Iaddend.are amplified by reverse
transcriptase chain reaction (RT-PCR).
6. The method according to claim 1, wherein the .[.genes analyzed
are.]. .Iadd.gene measured is .Iaddend.selected from the group
consisting of hTERT, hTR, TEP1, MYCN, MYCC, ErbB2, Her2, Her2/Neu,
Her 1, Cyclin A and D1, ABL, SKP2, ETV6 (TELgene), MGC2177, PLAG1,
PSMC6P and LYN.
7. The method according to claim 6, wherein the .[.nucleic acids.].
.Iadd.RNA and the DNA .Iaddend.are amplified by reverse
transcriptase chain reaction (RT-PCR).
8. The method according to claim 1, wherein the .[.nucleic acids.].
.Iadd.RNA and the DNA .Iaddend.are amplified by reverse
transcriptase chain reaction (RT-PCR).
9. The method according to claim 1, wherein the .[.genes analyzed
are.]. .Iadd.gene measured is .Iaddend.compared to a reference
nucleic acid extract (DNA and RNA) corresponding to .[.the.].
expression (RNA) and quantity (DNA) of a house keeping gene.
10. The method according to claim 1, wherein the .[.genes analyzed
are.]. .Iadd.gene is .Iaddend.compared to a reference RNA
corresponding to .[.the.]. expression of a house keeping gene.
11. The method according to claim 1, wherein the .[.genes analyzed
are.]. .Iadd.gene is .Iaddend.compared to a reference DNA
corresponding to a housekeeping gene.
12. The method according to claim 1, wherein the gene
quantification may be estimated in reference to a standard curve
obtained with nucleic acids of a cell line.
13. The method according to claim 1, wherein the .[.nucleic
acids.]. RNA and .Iadd.the .Iaddend.DNA are analyzed by gel
coloration, by radioactive immunological technique (RIA), by enzyme
linked immunosorbant test (ELISA) or by a microchip test (gene
array), and quantified by any method for nucleic acid
quantification.
14. The method according to claim 1, wherein the .[.nucleic
acids.]. RNA .[.and DNA are.]. .Iadd.is .Iaddend.quantified by real
time .[.RT PCR.]. .Iadd.RT-PCR.Iaddend..
15. The method according to claim 1, wherein the RNA and .Iadd.the
.Iaddend.DNA are extracted from the patient and measured
simultaneously.
16. A method for measuring both gene over-expression (RNA) and gene
amplification (DNA) in a patient suspected of having cancer,
wherein the gene .Iadd.measured .Iaddend.is selected from the group
consisting of hTERT, hTR, TEP1, MYCN, MYCC, ErbB2, Her2, Her2/Neu,
Her 1, Cyclin A, Cyclin D1, ABL, SKP2, ETV6 (TELgene), MGC2177,
PLAG1, PSMC6P and LYN, comprising: obtaining a sample .[.of.].
.Iadd.derived from .Iaddend.a bodily fluid from a patient,
.[.and.]. .Iadd.wherein the sample is cell free or substantially
cell free, .Iaddend.extracting both RNA and DNA simultaneously from
said sample, measuring both gene over-expression (RNA) and gene
amplification (DNA) at the same time .[.in said sample.].
.Iadd.from the extracted RNA and DNA.Iaddend., and comparing said
measurement to a healthy control.
17. The method according to claim 16, wherein .Iadd.the
.Iaddend.RNA and .Iadd.the .Iaddend.DNA are extracted from .[.a.].
.Iadd.the .Iaddend.bodily fluid, purified and amplified, and the
over-expressed RNA and .Iadd.the .Iaddend.amplified DNA are
analyzed and compared to a house keeping gene.
18. The method according to claim 17, wherein the over-expressed
and amplified gene is hTERT.
19. The method according to claim 18, wherein the .[.nucleic acids
are.]. .Iadd.RNA is .Iaddend.amplified by reverse transcriptase
.Iadd.polymerase .Iaddend.chain reaction (RT-PCR).
20. The method according to claim 16, wherein the .[.genes analyzed
are.]. .Iadd.gene measured is .Iaddend.compared to a reference
nucleic acid extract (DNA and RNA) corresponding to the expression
(RNA) and quantity (DNA) of a house keeping gene.
21. The method according to claim 16, wherein the .[.genes.].
.Iadd.gene .Iaddend.analyzed .[.are.]. .Iadd.is .Iaddend.compared
to a reference RNA corresponding to the expression of a house
keeping gene.
.Iadd.22. The method according to claim 1, wherein said sample is
selected from plasma, serum, saliva, and sputum..Iaddend.
.Iadd.23. The method according to claim 16, wherein said sample is
selected from plasma, serum, saliva, and sputum..Iaddend.
.Iadd.24. The method according to either claim 1 or 16, wherein
said RNA and said DNA from said bodily fluid comprise extracellular
RNA and DNA..Iaddend.
.Iadd.25. The method according to either claim 1 or 16, wherein
said measuring comprises amplifying both of said RNA and said DNA
by polymerase chain reaction..Iaddend.
.Iadd.26. The method according to claim 25, wherein said amplifying
further comprises using a single primer/probe set to amplify both
of said DNA and said RNA..Iaddend.
.Iadd.27. A method for the diagnosis or the follow up of the
evolution of cancers which comprises measuring both the quantity of
gene expression (RNA) and quantity of gene amplification (DNA) of
one or more genes in a sample derived from a bodily fluid of a
patient, wherein said sample is cell free or substantially cell
free, and comparing to healthy controls..Iaddend.
.Iadd.28. The method according to claim 27, wherein said measuring
comprises extracting both of said RNA and said DNA from said bodily
fluid, purifying said extracted RNA and said extracted DNA,
amplifying said purified RNA and said purified DNA, analyzing said
amplified RNA and said amplified DNA, and comparing to a house
keeping gene..Iaddend.
.Iadd.29. The method according to claim 28, wherein said amplifying
comprises using polymerase chain reaction..Iaddend.
.Iadd.30. The method according to claim 28, wherein said amplifying
comprises using a single primer/probe set to amplify both of said
RNA and said DNA..Iaddend.
.Iadd.31. The method according to claim 27, wherein said comparing
comprises comparing to a reference nucleic acid extract
corresponding to expression (RNA) and/or quantity (DNA) of a house
keeping gene..Iaddend.
.Iadd.32. The method according to claim 27, wherein said measuring
comprises estimating said one or more genes in reference to a
standard curve obtained with nucleic acids of a cell
line..Iaddend.
.Iadd.33. The method according to claim 27, further comprising
analyzing said RNA and said DNA by gel coloration, by radioactive
immunological technique (RIA), by enzyme linked immunosorbant test
(ELISA) or by a microchip test (gene array), and quantifying by any
method for nucleic acid quantification..Iaddend.
.Iadd.34. The method according to claim 27, further comprising
extracting both of said RNA and said DNA from the patient and
measuring simultaneously..Iaddend.
.Iadd.35. The method according to claim 27, wherein said sample is
selected from plasma, serum, saliva, and sputum..Iaddend.
.Iadd.36. The method according to claim 27, wherein both of said
RNA and said DNA comprise extracellular RNA and extracellular
DNA..Iaddend.
.Iadd.37. The method according to claim 1 or 16 further comprising
providing a diagnosis and/or follow up as to the evolution of said
cancer..Iaddend.
.Iadd.38. The method of claim 1, wherein the measuring is performed
using a microchip..Iaddend.
.Iadd.39. The method of claim 16, wherein the measuring is
performed using a microchip..Iaddend.
.Iadd.40. The method of claim 27, wherein the measuring is
performed using a microchip..Iaddend.
.Iadd.41. The method of claim 1, further comprising identifying if
the patient is in need of treatment if there is an increased level
in the sample as compared to the healthy controls..Iaddend.
.Iadd.42. The method of claim 16, further comprising identifying if
the patient is in need of treatment if there is an increased level
in the sample as compared to the healthy controls..Iaddend.
.Iadd.43. The method of claim 27, further comprising identifying if
the patient is in need of treatment if there is an increased level
in the sample as compared to the healthy controls..Iaddend.
.Iadd.44. The method of claim 41, further comprising providing
treatment to the identified patient..Iaddend.
.Iadd.45. The method of claim 42, further comprising providing
treatment to the identified patient..Iaddend.
.Iadd.46. The method of claim 43, further comprising providing
treatment to the identified patient..Iaddend.
Description
The present invention describes a method of diagnosis and/or follow
up of the evolution of most types of cancer, for instance after a
chemotherapy or after an operation.
It is known that diagnosis and follow up of the evolution of cancer
are done, besides direct observation of the tumors, by biopsy
analysis or in the case of blood malignancies by analysis of the
bone marrow. This implies either a surgical intervention or an
invasive test such as a biopsy or a bone marrow aspiration. Now,
without taking into account the disagreeable or even dangerous
aspect of such methods it has been observed that they could
moreover not be very precise.
Conventional methods of diagnosis are not very satisfactory. As an
example, colorectal cancer screening presently relies on fecal
occult blood testing (FOBT) which is both insensitive and
non-specific. In contrast, flexible sigmoidoscopy is sensitive and
specific for early distal disease but is both invasive and
insensitive for proximal disease. Furthermore, barium enema is
relatively sensitive and specific but requires colonic preparation,
radiation and a day off work, while total colonoscopy is highly
sensitive and specific but is also invasive and expensive.
The situation appears little better for other cancers. No reliable
test is available for early detection of lung cancer, with
computerized tomography being the most reliable tool.
An important strategy to reduce mortality from breast cancer is the
introduction of mammographic screening in an attempt to detect
cancers at an asymptomatic and pathologically early stage. Although
several studies indicate that mass screening is a useful strategy
for reducing breast cancer mortality, there are a number of
disadvantages associated with this form of cancer screening. These
include a high rate of false positive tests, frequent false
negative tests and the enormous public health costs involved. Thus,
when the benefits of mammographic screening are weighed against its
costs and other disadvantages, it is perhaps not surprising that
this form of screening has engendered an enthusiastic and
contentious debate over the past 20 years.
Finally, development of conventional protein tumor markers, such as
carcinoembryonic antigen (CEA) and alpha-fetoprotein (AFP), along
with the widely used prostate specific antigen (PSA) was driven
largely by the introduction of new methods for quantifying small
amounts of circulating proteins. However, sensitivity and
specificity shortcomings with these assays remain to be
overcome.
The aim of this invention consists therefore in providing a method
of diagnosis and/or follow up of the evolution of most types of
cancer which would be, on one hand, more precise and trustworthy
and, on the other hand easier to perform without implying an
invasive test for the patient.
Small amounts of free DNA circulate in both healthy and diseased
human plasma or serum, and increased concentrations of plasma or
serum DNA are present in cancer patients. The present inventors
were the first to demonstrate that this DNA extracted from the
plasma of cancer patients has tumor related characteristics. They
include decreased strand stability, oncogene and tumor suppressor
gene mutations, micro-satellite alterations, and gene
hypermethylation. This has led to suggest that a non-invasive
diagnostic test for cancer might be feasible using these molecular
techniques.
Using essentially similar molecular techniques, tumor related mRNA
have been detected in the plasma of cancer patients. These RNA
markers are the result of an over expression of some genes in the
cancer cells and may be found in increased quantities in the
plasma/serum of cancer patients compared to healthy controls.
Now this over expression of genes is often accompanied by an
amplification of the same gene in the cancer cells, and the present
inventors have found that this amplification can be seen
subsequently in the plasma/serum of the patient. It should be
stressed that this amplification is independent of the fact that
there is, as mentioned above, usually more plasma/serum DNA in
cancer patients than in healthy controls.
The present inventors have therefore developed a cancer detection
assay in plasma/serum measuring by adding and comparing the amount
of DNA and RNA of certain genes in the plasma/serum of cancer
patients that are the reflection of a gene amplification and a gene
over expression. Thus gene amplification (seen by more DNA) and
gene over expression (more RNA) are linked.
Consequently, the object of the present invention, reaching the
above-mentioned aim, is consisting of a method for the diagnosis or
the follow up of the evolution of cancers which comprises measuring
together gene over expression (RNA) and gene amplification (DNA) in
the bodily fluids of patients suspected to harbor cancer on any
gene that is both amplified and over expressed in cancer cells and
comparing to healthy controls.
More particularly, RNA and DNA are extracted from a bodily fluid,
such as plasma, serum, sputum, saliva, etc, purified and amplified,
and the over expressed RNA and amplified DNA are analyzed and
compared to a unique house keeping gene.
As examples, the genes analyzed can be selected from hTERT, hTR,
TEP1, MYCN, MYCC, ErbB2, Her2, Her2/Neu, Her1, Cyclin A and D1,
ABL, SKP2, ETV6 (TELgene), MGC2177, PLAG1, PSMC6P and LYN.
Preferably, the nucleic acids are amplified by reversed
transcriptase chain reaction (RT-PCR) and are analyzed by gel
coloration, by radioactive immunological technique (RIA), by enzyme
linked immunosorbant test (ELISA) or by a microchip test (gene
array), and possibly quantified by any method for nucleic acid
quantification.
The quantification of RNA and DNA can advantageously be carried out
by real time PCR, such as "TAQMAN.TM.", or on capillaries
"LIGHTCYCLER.TM.", or real time PCR and RT PCR of any company.
Furthermore, the genes analyzed may be compared to a reference
nucleic acid extract (DNA and RNA) corresponding to the expression
(RNA) and quantity (DNA) of a unique house keeping gene, or to a
reference RNA corresponding to the expression of a house keeping
coding gene, or to a reference DNA corresponding to a unique gene,
or may be estimated in reference to a standard curve obtained with
nucleic acids of a cell line.
In the following description of the present invention, telomerase
RNA and DNA have been chosen as example, since telomerase activity
is enhanced in 85 to 100% of cancers. But it must be stressed that
the present invention is valid for all genes, and specially
oncogenes that have been reported to be both amplified and over
expressed in many cancers and cancer cell lines, for instance MYCN
in neuroblastoma, ErbB2 in esophagal, breast and ovarian cancer,
Her2, Her2/Neu and Her1 in breast and Her2/Neu in lung, Cyclin A an
D1 in colorectal or laryngeal cancer, ABL in leukemias and
lymphomas, SKP2 in non small cell lung cancer, ETV& (TELgene)
in myelodysplastic syndrome. These are some of the most studied,
but many others have been reported, such as MGC2177, PLAG1, PSMC6P,
and LYN.
To illustrate the present invention, the hTERT gene was used, which
codes for the reverse transcriptase of the telomerase
ribonucleoprotein.
Telomerase is a ribonucleoprotein enzyme that synthesizes repeated
telomeric sequences at chromosomal ends. The telomeres protect the
chromosomal ends and at each cell division these telomeres are
shortened. Telomerase composed of an RNA template (hTR) and a
reverse transcriptase enzyme (hTERT) plus associated proteins such
as TEP 1 that synthesizes these telomeres.
The activity of this enzyme has become an accepted indicator for
the diagnosis and the prognosis of most malignant tumors. The
expression of human telomerase RNA (hTR) or of the reverse
transcriptase enzyme of the RNA telomerase (hTERT) or of the
associated protein (TEP1) has been measured during the progression
of several types of tumors. This has enabled the establishment of a
correlation between this expression (the amount of RNA) and
telomerase activity. Most cancers and immortalized cell lines have
a high telomerase activity that reflects a mechanism that escapes
normal aging regulations. We have a patent in Europe and a pending
patent in the US for the measurement of the amount of mRNA in the
plasma/serum coding for hTERT and TEP1.
Now, an amplification of the genes (DNA) coding for telomerase
subunits (especially hTERT) has been observed in cancer cell lines
and in different kinds of cancers. The present inventors have
further observed an amplification of the hTERT gene in the plasma
of cancer patients.
Although RNA components and mRNA coding for telomerase are cellular
components, it was observed that, surprisingly, these components
could be also found in an extracellular form in plasma or
serum.
Indeed when both nucleic acids are extracted and amplified, the
difference between the healthy controls and the cancer patients is
surprisingly higher.
To sum up the method, the present inventors have shown an increased
amount of hTR, hTERT and TEP1 RNA in the plasma or serum of persons
suffering from breast, ovarian, head and neck, pancreatic, liver,
stomach or colon cancer while these products have been shown to be
absent in the blood of healthy persons. Moreover DNA coding for
telomerase components in particular for hTERT can also be found in
greater amounts (amplified) in the plasma of cancer patients than
in healthy controls. It is known since a long time that there is
often more DNA in the plasma of cancer patients than in the plasma
of healthy controls (this has been demonstrated by measuring the
amount of beta-globin for instance), but hTERT DNA yields even more
than what could be expected, giving evidence of an amplification of
this gene.
More precisely, the method of diagnosis according to the invention
consists in extracting the nucleic acids (RNA and DNA) from the
plasma or the serum of the blood, purifying it and amplifying it in
order to establish the presence and the quantity of the product
made in this case by the reverse polymerase chain reaction (RT-PCR)
representing both RNA and DNA of components hTERT. This shall be
done in a comparative manner between the plasma or serum of a
person suspected of malignancy and the plasma or serum of a healthy
person or of a control suffering from a non-malignant disease.
The amplification product of the DNA and of the RNA components
transcribed into DNA by RT-PCR are detected and quantified. This
can be done by any nucleic acid quantification method.
Similarly, any technique of extraction of purification and of
amplification of the nucleic acids (DNA and RNA) in the plasma or
the serum may be used.
The present invention will now be illustrated in a non-limitative
manner by the following example related to the diagnosis of some
cancers using hTERT DNA and RNA quantification.
EXAMPLE
Diagnosis of different cancers by the detection of amplified hTERT
DNA and over exypressed hTERT RNA in the plasma or serum of the
blood.
Blood samples (2 ml) were collected in EDTA tubes prior to surgery
or treatment on patients bearing small malignant breast tumors or
on patients suffering of head and neck, colorectal, pancreatic and
liver cancer. Blood was taken in the same way as healthy volunteers
for controls.
To guarantee good quality plasma nucleic acids, the whole blood
samples should be centrifuged as soon as possible. If the
centrifugation cannot take place immediately, the blood samples
should be stored at 4.degree. immediately after blood collection
and centrifuged within 6 hours. The blood samples at 1,600 g for 10
min at 4.degree. C. The plasma was transferred into new tubes
taking care not to disturb the buffy coat layer. A second round
centrifugation of the plasma was performed at 16,000 g for 10 min
at 4.degree. C. The plasma was finally transferred into new tubes
taking care not to disturb the underlying cell pellet and stored if
necessary at -70.degree..
RNA and DNA were extracted using a commercially available kit
(Ultrasens viral kit from Qiagen), which extracts DNA as well as
RNA, according to manufacturers instructions.
The primers and TAQMAN.TM. probe for hTERT were located on one exon
and which would yield both RNA and DNA:
TABLE-US-00001 F: (SEQ ID NO: 1) 5'-ACC GTC TGC GTG AGG AGA TC-3';
R: (SEQ ID NO: 2) 5'-CCG GTA GAA AAA AGA GCC TGT TC-3' and the
PROBE (SEQ ID NO: 3) 5'Fam -TGT ACG TCG TCG AGC TGC TCA GGT CTT
T-3' TAMRA.
As reference for RNA and DNA we used the beta-Globin gene on exon
2: forward primer: 5' CTGCTGGTGGTCTACCCTTG 3' (SEQ ID NO: 4);
Reverse primer: 5' CCTGAAGTTCTCAGGATCCA 3' (SEQ ID NO: 5); and
Hybridization probe:5'Fam. CTCCTGATGCTGTTATGGGCAACCCT 3 TAMRA' (SEQ
ID NO: 6) which would yield both RNA and DNA or the GAPDH gene on
exon 8: Forward primer 5'GTGGACCTGACCTGCCG3' (SEQ ID NO: 7);
Reverse primer 5' GGAGGAGTGGGTGTCGC 3' (SEQ ID NO: 8) and the probe
for TAQMAN.TM. 5' FAM-AAGGGCATCCTGGGCTACACTGAGCA3' TAMRA (SEQ ID
NO: 9).
These reference primers for RNA and DNA can be replaced by any
housekeeping unique gene. The results given below were calculated
using arbitrary quantities expressed either as CT (cycle threshold
numbers) or 2.sup..DELTA.CT values (for instance 2.sup.CT of
hTERT.sup.-CT of b-Globin). They always compared extractions of
plasma nucleic acids of cancer patients and healthy donors
extracted the same day and with the same amount (0.5 ml) of
plasma/serum. It is possible to estimate in another way by
comparing the results to a curve obtained by known quantities of
one gene.
The QuantiTect Probe RT-PCR (Qiagen) was used in 25 .mu.l RT-PCR
reaction mixture containing the manufacturer's Master Mix, the RT
mix (Onmiscript.TM. reverse transcriptase, Sensiscript.TM. reverse
transcriptase, hot-start Taq.TM. DNA polymerase) to which we added
the set of primers (0.4 .mu.M) and TAQMAN.TM. probe (0.1 .mu.M) and
3 to 6 .mu.l of the 30 .mu.l of eluted nucleic acids. The RT-PCT
conditions of the mixture were an initial incubation at 50.degree.
C. for 30 min followed by a 95.degree. C. incubation for 15 min to
activate the HotstarTaq.TM. DNA Polymerase, then 50 cycles at
94.degree. C. (15 sec), 60.degree. C. (1 min).
All base sequences mentioned here above as primer examples are
known and may as such be consulted on the web site of the Genome
Database. They may be replaced by other primers and probes located
on the above-mentioned genes. Reference genes may be changed by
other genes.
Results Obtained:
Data have been obtained on 74 cancer patients and 51 controls with
98% specificity. The sensitivity changes from cancer to cancer
ranging from 81% to over 90%. The cancer patients suffered from
head and neck, breast, colorectal, pancreatic and liver
cancers.
The results obtained by Real Time Quantitative RT PCR measuring
both DNA and RNA of hTERT compared to beta-Globin gene in the
plasma of cancer patients and healthy controls are presented on the
following Table.
TABLE-US-00002 Samples studied Number of samples hTERT positive %
CONTROLS 51 2% PANCREATIC CANCER 27 81% HEAD AND NECK 16 94%
COLORECTAL 18 83% BREAST 7 100% LIVER 6 83%
Furthermore, the results obtained are illustrated on the annexed
figures, where;
FIG. 1 shows as reference the amplification plots obtained using
real time quantitative PCR for the hTERT gene (DNA), and with the
x-axis being the cycle number of the PCR reaction and the y-axis
the fluorescence intensity over background.
FIG. 2 shows as reference the amplification plots obtained using
real time quantitative RT-PCR for the hTERT gene (RNA), and with
the x-axis being the cycle number of the PCR reaction and the
y-axis the fluorescence intensity over background.
FIG. 3 shows the amplification plots obtained using real time
quantitative RT-PCR for the hTERT gene (total nucleic acids DNA and
RNA), according to the present invention, and with the x-axis being
the cycle number of the PCR reaction and the y-axis the
fluorescence intensity over background.
As it can easily be seen on FIG. 1, the first group of lines (A)
with a CT value around 37 is composed of the amplification product
of samples of DNA from healthy donors with hTERT primers, and the
second group (B) with a CT value around 35 is composed of the
amplification product of samples of plasma DNA from patients
suffering from head and neck cancer.
On FIG. 2, the first group of lines (C) with a CT value around 34
is composed of the amplification product of samples of RNA from
healthy donors with hTERT primers, and the second group (D) with a
CT value around 32 is composed of the amplification product of
samples of plasma RNA from patients suffering from head and neck
cancer. A difference of 2 CT values represents a difference of 4
times RNA values obtained from the same amount of plasma.
On FIG. 3, which represents the results of the method according to
the present invention, the first group of lines (E) with a CT value
around 35 is composed of the amplification product of samples of
plasma nucleic acid from healthy donors with hTERT primers, and the
second group (F) with a CT value around 29 is composed of the
amplification product of samples of plasma nucleic acid from
patients suffering from head and neck cancer. The difference
between the CT values (comprising RNA and DNA) of the control group
and the cancer group is higher than in FIGS. 1 and 2, DNA or RNA
are measured. This demonstrates the clear advantage of the method
according to the present invention.
SEQUENCE LISTINGS
1
9120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1accgtctgcg tgaggagatc 20223DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2ccggtagaaa aaagagcctg ttc 23328DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe 3tgtacgtcgt cgagctgctc
aggtcttt 28420DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 4ctgctggtgg tctacccttg 20520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5cctgaagttc tcaggatcca 20626DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 6ctcctgatgc tgttatgggc aaccct
26717DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7gtggacctga cctgccg 17817DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
8ggaggagtgg gtgtcgc 17926DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 9aagggcatcc tgggctacac tgagca
26
* * * * *