U.S. patent number RE44,265 [Application Number 13/329,998] was granted by the patent office on 2013-06-04 for nucleic acid amplification method.
This patent grant is currently assigned to Olink AB. The grantee listed for this patent is Mats Gullberg, Ulf Landegren. Invention is credited to Mats Gullberg, Ulf Landegren.
United States Patent |
RE44,265 |
Landegren , et al. |
June 4, 2013 |
Nucleic acid amplification method
Abstract
A nucleic acid amplification method, and probes for use within
the method are described.
Inventors: |
Landegren; Ulf (Uppsala,
SE), Gullberg; Mats (Sollentuna, SE) |
Applicant: |
Name |
City |
State |
Country |
Type |
Landegren; Ulf
Gullberg; Mats |
Uppsala
Sollentuna |
N/A
N/A |
SE
SE |
|
|
Assignee: |
Olink AB (Uppsala,
SE)
|
Family
ID: |
9919749 |
Appl.
No.: |
13/329,998 |
Filed: |
December 19, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
10483900 |
|
7320860 |
|
|
|
PCT/SE02/01378 |
Jul 12, 2002 |
|
|
|
Reissue of: |
11946706 |
Nov 28, 2007 |
7790388 |
Sep 7, 2010 |
|
|
Foreign Application Priority Data
|
|
|
|
|
Aug 3, 2001 [GB] |
|
|
0118959.6 |
|
Current U.S.
Class: |
435/6.12;
435/91.2 |
Current CPC
Class: |
C12Q
1/6848 (20130101); C12Q 1/6848 (20130101); C12Q
2561/125 (20130101); C12Q 2531/125 (20130101); C12Q
2525/131 (20130101); C12Q 1/6848 (20130101); C12Q
2565/501 (20130101); C12Q 2531/125 (20130101); C12Q
2525/131 (20130101); C12Q 1/6848 (20130101); C12Q
2561/113 (20130101); C12Q 2531/125 (20130101); C12Q
2525/131 (20130101) |
Current International
Class: |
C12Q
1/68 (20060101); C12P 19/34 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
9201813 |
|
Feb 1992 |
|
WO |
|
9700446 |
|
Jan 1997 |
|
WO |
|
97/20948 |
|
Jun 1997 |
|
WO |
|
99/09216 |
|
Feb 1999 |
|
WO |
|
9949079 |
|
Sep 1999 |
|
WO |
|
00/06778 |
|
Feb 2000 |
|
WO |
|
01/20039 |
|
Mar 2001 |
|
WO |
|
0138580 |
|
May 2001 |
|
WO |
|
0140516 |
|
Jun 2001 |
|
WO |
|
01/88190 |
|
Nov 2001 |
|
WO |
|
2005111236 |
|
Nov 2005 |
|
WO |
|
Other References
Morris et al., Rapid reverse transcription-PCR detection of
hepatitis C virus RNA in serum by using the taqman fluorogenic
detection system, Journal of Clinical Microbiology, 34(12)2933-2936
(1996). cited by applicant .
Nitsche et al., Different real-time PCR formats compared for the
quantitative detection of human cytomegalovirus DNA, Clinical
chemistry, American Association for Clinical Chemistry,
45(11)1932-1937 (1999). cited by applicant .
Chen et al., A homogeneous ligase-mediated DNA diagnostic test
genome research, Cold Spring Harbor Laboratory Press, 8(5)549-556
(1998). cited by applicant .
Lizardi et al., Mutation detection and single-molecule counting
using isothermal rolling-circle amplification, Nature Genetics,
19(3)225-232 (1998). cited by applicant .
Thomas et al., Amplification of padlock probes for DNA diagnostics
by cascade rolling circle amplification or the polymerase chain
reaction., Arch. Pathol. Lab. Med., 123:1170-1176 (1999). cited by
applicant .
Chen et al., A homogenous, ligase-mediated DNA diagnostic test,
Geneome Res., 8:549-556 (1998). cited by applicant .
Ohmichi et al., The virtues of self-binding:high sequence
specificity for RNA cleavage by self-processed hammerhead
ribozymes., Nucleic Acids Res., 28:776-783 (2000). cited by
applicant .
Baner, et al, "Signal amplification of padlock probes by rolling
circle replication", Nucleic Acids Research (1998), 26
(22):5073-5078. cited by applicant .
Copley, et al, "Exonuclease Cycling Assay: An amplified assay for
the detection of specific DNA sequences" BioTechniques, (1992),
13(6):888-892. cited by applicant .
Daubendiek, et al, "Generation of catalytic RNAs by rolling
transcription of synthetic DNA nanocircles", Nature Biotechnology,
(Mar. 1997), 15: 273-277. cited by applicant .
Dauerse, et al, "Multiple colors by fluorescence in situ
hybridization using ratio-labelled DNA probes create a molecular
karyotype", Human Molecular Genetics, (1992), 1(8):593-598. cited
by applicant .
Heid, et al, "Real Time Quantitative PCR", Genome Research, (1996),
6:986-994. cited by applicant .
Herschlag, et al, "DNA cleavage catalysed by the ribozyme from
Tetrahymena", Nature (Mar. 29, 1990), 344: 405-409. cited by
applicant .
Lizardi, et al, "Mutation detection and single-molecule counting
using isothermal rolling-circle amplification", Nature Genetics,
(Jul. 19, 1998), 19: 225-232. cited by applicant .
Layamichev, et al, "Polymorphism identification and quantitative
detection of genomic DNA by invasive cleavage of oligonucleotide
probes", Nature Biotechnology, (Mar. 1999), 17: 292-296. cited by
applicant .
Nilsson, et al, "Padlock probes: Circularization oligonucleotides
for localized DNA detection", Science, (Sep. 30, 19994),
265:2085-2088, (1999). cited by applicant .
Tyagi, et al, "Molecular Beacons: Probes that fluoresce upon
Hybridization", Nature Biotechnology, (Mar. 1996), 14:303-308.
cited by applicant .
Dahl et.al., Circle-to-circle amplification for precise and
sensitive DNA analysis,PNAS 2004, vol. 101, No. 13, pp. 4548-4553.
cited by applicant .
Diegelman et.al., Generation of circular RNAs and trans-cleaving
catalytic RNAs by rolling transcription of circular DNA
oligonucleotides encoding hairpin ribozymes, Nucleic Acids
Research, 1998, vol. 26, No. 13, pp. 3235-3241. cited by applicant
.
Hatch et.al., Rolling circle amplification of DNA immobilized on
solid surfaces ad its application to multiplex mutation detection,
Genetic analysis:Biomolecular Engineering, 1999, vol. 15, No. 2,
pp. 35-40. cited by applicant .
Liu et.al., Rolling circle DNA synthesis: small circular
oligonucleotides as efficient templates for DA polymerases, Journal
of American Chemical Society, 1996, vol. 118, No. 7, pp. 1587-1594.
cited by applicant .
Podhajska et al., Conversion of the Fokl endonuclease to a
universal restriction enzyme: cleavage of phage M13mp7 DNA at
predetermined sites, Gene, 1985, vol. 40, No. 2-3, pp. 175-182.
cited by applicant .
Szybalski et.al., Univerisal restriction endonucleases: designing
novel cleavage specificities by combining adapter
oligodeoxynuceotide and enzyme moieties, Gene, 1985, vol. 40, No.
2-3, pp. 169-173. cited by applicant .
Tanke et. al., New strategy for multi-colour fluorescence in situ
hybridisation: COBRA: combined binary ratio labelling, European
Journal of Human Genetics, 1999, vol. 7, No. 1, pp. 2-11. cited by
applicant .
Carmi, et al., "Cleaving DNA with DNA", Proc. Natl. Acad. Sci.
(Mar. 1998), 95: 2233-2237. cited by applicant .
Cuenoud et al., "A DNA metalloenzyme with DNA ligase activity",
Nature (Jun. 15, 1995), 375: 611-614. cited by applicant .
Nederlof, et al, "Fluorescence ratio measurements of double-labeled
probes for multiple in situ hybridization bydigital-imaging
microscopy", Cytometry, (1992), 13:839-845. cited by
applicant.
|
Primary Examiner: Horlick; Kenneth R.
Assistant Examiner: Thomas; David
Attorney, Agent or Firm: Browdy and Neimark, PLLC
Parent Case Text
The present application is a continuation of application Ser. No.
10/483,900, filed Jul. 20, 2004, which is a national stage under 35
U.S.C. 371 of PCT/SE02/01378, filed Jul. 12, 2002, which claims
priority from UK0118959.6, filed Aug. 3, 2001. The entire contents
of the prior applications are incorporated by reference.
Claims
What is claimed is:
1. A method of generating circularized nucleic acid, said method
comprising: providing a single-stranded target nucleic acid;
hybridizing the single-stranded target nucleic acid with a
circularization adaptor having (i) single-stranded sequences at
each end and on the same strand, which single-stranded sequences
are complementary to the ends of the single-stranded target nucleic
acid and (ii) a double-stranded non-target complementary segment
between said single-stranded end sequences.[.;.]. and .Iadd.(iii) a
restriction oligonucleotide sequence in said double-stranded
segment; and.Iaddend. circularizing the target nucleic acid using a
DNA ligase.
.[.2. The method of claim 1, wherein said circularization adaptor
contains a restriction oligonucleotide sequence in said
double-stranded segment..].
3. The method of claim 1, further comprising amplifying said
circularized nucleic acid.
4. The method of claim 3, wherein said amplification is rolling
circle amplification.
5. The method of claim 1, wherein said single-stranded target
nucleic acid is obtained by fragmenting a double-stranded nucleic
acid using one or more restriction enzymes or FLAP endonucleases
and then denaturing the resulting fragments.
6. The method of claim 1, wherein a multiplicity of different
nucleic acid fragments are circularized in parallel using different
circularization adaptors.
7. The method of claim 6, wherein the different circularization
adaptors contain the same restriction oligonucleotide sequence and
wherein a multiplicity of different nucleic acid fragments are
amplified in parallel.
8. The method of claim 1, wherein the circularized nucleic acid
comprises cDNA or genomic DNA.
9. A method of amplifying a target nucleic acid fragment, said
method comprising: (i) fragmenting a target nucleic acid, (ii)
circularizing a target nucleic acid fragment thus obtained, using a
circularization adaptor having single-stranded sequences at each
end complementary to the ends of the target fragment and, between
said single-stranded end sequences, a double-stranded
non-target-complementary segment .Iadd.which contains a restriction
oligonucleotide sequence.Iaddend., and (iii) amplifying said
circularized target nucleic acid fragment.
10. A method of analyzing at least one circularized nucleic acid,
the method comprising amplifying the said circularized nucleic acid
to provide an amplification product free in solution which
comprises a concatemer of a sequence to be analysed coiled into a
ball, the method further comprising the step of: directly detecting
by microscopic analysis said concatemer amplification product ball
which is free in solution in a homogeneous detection reaction by
hybridizing hybridization probes being fluorescence-labelled
oligonucleotides to said amplification product ball, wherein the
hybridization of the oligonucleotides results in an enrichment of
the oligonucleotides in said amplification product ball and said
enrichment causes a condensed signal which can be directly detected
by microscopic analysis due to the contrast between said condensed
signal and the diffuse signal from non-bound oligonucleotides.
11. The method of claim 10, wherein the signalling probes are
singly or ratio-labelled.
12. The method claim 10, wherein the circularized nucleic acid to
be analysed is a probe sequence.
13. The method of claim 10, wherein the circularized nucleic acid
to be analysed comprises cDNA, genomic DNA or RNA sequences.
14. The method of claim 10, wherein the circularized nucleic acid
to be analysed is circularized using cDNA, genomic DNA, or RNA
sequence.
15. The method of claim 10, wherein said circularized nucleic acid
is formed by hybridizing to a linear nucleic acid an
oligonucleotide complementary to both end sequences of said linear
nucleic acid and ligating said end sequences.
16. A method for generating a circularized nucleic acid molecule
from two oligonucleotides, being parts of a pair of proximity
probes, that have been joined in a proximity-dependent nucleic acid
ligation reaction to form a joined product, said method comprising:
hybridizing a restriction oligonucleotide to two identical
sequences present in both of the joined oligonucleotides in said
joined product, digesting said joined product at the restriction
sites thus created to release a linear nucleic acid molecule, and
circularizing said released linear nucleic acid molecule by
ligation by using an intact restriction oligonucleotide as a
ligation template, said intact restriction oligonucleotide being
complementary to both ends of said released linear molecule.
17. The method of claim 16, further comprising amplifying said
circularized nucleic acid molecule.
18. The method of claim 17, wherein said amplification is rolling
circle amplification.
19. The method of claim 16, wherein said restriction
oligonucleotide is present in excess.
20. The method of claim 16, further comprising, after the digesting
step, a heating step that inactivates the restriction enzyme and
denatures the joined product.
21. The method claim 16, wherein the ligatable ends of the
oligonucleotides that have been joined to form a joined product
constitute unique half-tag sequences.
22. The method of claim 16, wherein the oligonucleotides that have
been joined to form a joined product are joined by blunt-end
ligation.
Description
INTRODUCTION
This invention relates to the generation, amplification, detection
and quantification of nucleic acids. More particularly, the present
invention relates to the generation, amplification, detection and
quantification of circular nucleic acids.
Over the last 20 years nucleic acid amplification has become a
common technique in the identification of genetic disorders,
genetic variants or for the identification of infectious
agents.
Many methods exist for the amplification of nucleic acids. These
include the polymerase chain reaction (PCR), and the ligase chain
reaction (LCR), both of which require thermal cycling, the
transcription based amplification system (TAS), the nucleic acid
sequence based amplification (NASBA), the strand displacement
amplification (SDA), the invader assay, rolling circle
amplification (RCA), and hyper-branched RCA (HRCA).
In the description that follows, the present invention will be
described with reference to its preferred use in rolling circle
amplification method (Lizardi et al., 1998), U.S. Pat. Nos.
5,854,033, 6,124,120, 6,143,495, 6,183,960, 6,210,884. However, it
is not intended to be limited thereto since the invention may find
equal utility in other nucleic acid amplification methods,
especially other circular amplification methods. The circular
nucleic acids referred to in the invention can be circularised
probes, circularised target nucleic acids, circular reporter
nucleic acids, plasmids, or circular target nucleic acids. The
present invention can be used for nucleic acid sequence analyses
for e.g. genotyping, finding mutations, sequencing, identification
of infectious agents, molecular diagnostics, genetic analyses and
forensics, but also for detection of proteins, analysis of
protein-protein interactions, and interactions of biomolecules.
The present invention relates to novel means of generating
circularized nucleic acids, and to amplify, detect, or analyze the
said circularized nucleic acids. Some means of generating
circularized nucleic acids for analytical purpose are known in the
literature. Padlock probes are oligonucleotide probes that become
circularized upon recognition of a target nucleic acid sequence
(Nilsson et al., 1994). Proximity probe ligation can template
generation of circularized probes as a consequence of target
molecule recognition, as described in (Landegren, PCT
WO99/49079).
RCA results in a linear amplification of circularized probes and is
therefore of limited sensitivity. Typically an RCA produces about
1000 copies of each circularized probe molecule per hour.
It is an object of the present invention to improve the sensitivity
of nucleic acid amplification processes, especially RCA
processes.
STATEMENTS OF INVENTION
One means of improving the sensitivity of an amplification process,
such as for example a RCA process, is to increase the signal
obtained during the process. This may be done by performing
additional amplification procedures templated by the first
generation RCA product. One such additional amplification procedure
is obtained by turning the first generation RCA product into a new
generation of monomers which themselves are amplified in a further
amplification reaction. Accordingly, in a first aspect, the
invention relates to a method of amplifying a nucleic acid product,
comprising the steps of: providing a first generation amplification
product, typically by RCA, which product comprises a concatemer of
a sequence to be amplified; monomerising the amplification product;
and carrying out a further amplification of the thus-formed
monomers to form a second generation amplification product.
Preferably, the monomers are ligated to form circles followed by
further amplification of the circles, in which case the further
amplification is ideally RCA (FIG. 1). The sequence to be amplified
may be a probe sequence, or part of probe sequence, or it may
comprise cDNA, genomic DNA or RNA sequences.
In one embodiment of the invention, monomerization of the first
generation amplification product is achieved using a restriction
enzyme and an oligonucleotide complementary to the first generation
amplification product, wherein the restriction enzyme cleaves any
first generation amplification product/oligonucleotide hybrids.
Typically, oligonucleotide is added in excess of the numbers of
monomers contained in the first generation reaction product.
Alternatively, the sequence to be amplified may include a
catalytically active sequence which enables monomerization of the
first generation amplification product (Daubendiek & Kool,
1997).
Typically, the first generation amplification product is produced
in a first generation amplification step, which step utilizes a
polymerase enzyme, wherein the method includes a step of
inactivating the polymerase enzyme. Ideally the polymerization is
carried out under isothermal conditions.
When monomerization of the first generation amplification product
is achieved using oligonucleotides and restriction enzymes,
oligonucleotide is added in excess of the number of monomers
present in the RCA reaction product. Most of the oligonucleotides
that will hybridise to the monomers after a denaturation (and
enzyme inactivation) step will be non-cleaved. Hence, because
circularization is favored (at any practical concentrations) over
di- or multi-merization due to the intra-molecular nature of this
hybridization reaction, the monomers will preferentially become
circularized upon hybridization to non-cleaved oligonucleotides and
ligase treatment.
This new set of circles is now able to serve as templates for
subsequent rounds of RCA, primed e.g. by the same oligonucleotide
serving as template for ligation. Therefore, instead of a linear
amplification, this procedure will generate a
(X.sub.1.times.X.sub.2 . . . .times.X.sub.n)-fold amplification,
where "X" is the number of monomers synthesized in each RCA, and
"n" is the number of rounds of RCAs, digestions and
circularizations. The procedure should be of particular value for
applications where a large set of different circular nucleic acids
is amplified by RCA, since the procedure should preserve the
complexity of the initial set of circular nucleic acids. This is
due to the intra-molecular nature of the circularization reactions,
and because in each round of replication of the circularised
nucleic acids is contiguous and processive (one circle->one
product carrying thousands of copies of the circle), without
interference from any other simultaneously replicating molecule.
Furthermore, each round of the reaction should not be product
inhibited or primer limited, and does not recruit more polymerases
during the polymerization reaction. Hence, the procedure should
essentially be independent of the number of different amplified
circles. The product of the reaction is single stranded, readily
available for detection via hybridisation probes. The linear nature
of RCA reactions should ensure faithful quantification quantitative
determination of target molecules.
The monomerization can be effected using a general sequence that is
present in each of the different probes present in a reaction. In
the second generation of the RCA, the risk that the product will
become double-stranded (see below) is minimal because all monomers
will become circularised, due to the addition of excess
cleavage/circularization oligonucleotides. Therefore, there should
be no sequences present in the second-generation RCA, and able to
prime synthesis on the second-generation RCA product. Also, this
polynomial amplification method is completely specific to
circularized molecules, reducing the risk for spurious
amplification products seen in other amplification methods.
When analyzing gene expression patterns in a highly multiplexed
fashion one needs to make an endpoint measurement on for example a
microarray. Using the present invention, gene expression can be
monitored with high resolution and precision in a multiplexed
procedure. Several so called padlock probes, each specific for a
gene product or fragment, are circularized by ligation templated by
cDNA or RNA. These padlock probes can be encoded by a tag sequence
in order to analyze the RCA products on a DNA microarray. An
alternative way of amplification is by using PCR. However, PCR is a
product inhibited reaction which will reach a plateau-phase after a
number of PCR cycles, where after no more products are formed due
to reannealing of the DNA strands. This will skew the
quantification of abundant transcripts compared to rare ones, since
the abundant ones will stop amplifying towards the end of the
multiplexed amplification reaction, while rare ones continue to be
amplified. The problem of obtaining quantitative endpoint
measurements using PCR is well known, and hence the technique of
real-time analysis of PCR has been developed where a low number of
transcripts (.about.1-4 transcripts) can be simultaneously analyzed
(Heid et al., 1996).
By instead amplifying the circularized padlock probes using the
present invention, no such skewing will occur since the reaction is
not product inhibited but rather only limited by the substrates,
i.e. the deoxynucleotide-triphosphates. This will enable the
quantification of very high numbers of transcripts in one single
reaction.
The method of replicating a first, second, and maybe more
generations of circularized sequences is applicable both for probe
and target nucleic acid sequences. The product can be analyzed by
sequencing or by detection via e.g. any of the methods described
below. In a preferred format for amplification of genomic or cDNA
sequences, the target DNA is first fragmented using e.g.
restriction enzymes or FLAP endonucleases, and then circularized
using a circularization adapter consisting of single-stranded
sequences at each end, complementary to the ends of the target DNA
fragment to be amplified. It may be advantageous to amplify
similar-sized fragments when many different fragments are amplified
in the same reaction. It may not be possible to find one
restriction enzyme or a combination of restriction enzymes that
will generate restriction fragments of a similar size of all
sequences in e.g. a genomic DNA sample. But it is very likely that
all sequences will be represented on restriction fragments of the
desired size in at least one of perhaps ten different restriction
digestions using different restriction enzymes or combinations of
restriction enzymes. Most advantageously, a double-stranded
non-target complementary segment is located in between the
single-stranded segments, and that contains a general restriction
oligonucleotide sequence (FIG. 2). By using the general restriction
oligonucleotide sequence, many different target DNA fragments can
be circularized using different circularization adaptors, but can
then be amplified using the same general restriction
oligonucleotides and enzymes. Similarly to probe circularization
reactions, this target circularization reaction is unlikely to give
rise to cross-reactive products since the intra-molecular
circularization reaction is favored over inter-molecular ligation
reactions. Therefore, a multiplicity of different target DNA
fragments can be amplified in parallel, unlike amplification
methods like PCR. It may be advantageous to amplify similar-sized
fragments when many different fragments are amplified in the same
reaction. It may not be possible to find one restriction enzyme or
a combination of restriction enzymes that will generate restriction
fragments of a similar size of all sequences in e.g. a genomic DNA
sample. But it is very likely that all sequences will be
represented on restriction fragments of the desired size in at
least one of perhaps ten different restriction digest using
different restriction enzymes or combinations of restriction
enzymes. If 1000 different DNA sequences are to be amplified, then
they can be amplified in perhaps ten different reactions using DNA
samples digested with ten different combinations of restriction
enzymes. The appropriate restriction digests and the corresponding
circularization adaptors can be deduced from the available sequence
databases. Amplified DNA sequences can be analyzed by suitable
methods, including but not limited to, microarray hybridization,
mini-sequencing, or mass-spectrometry, that today are limited in
their through-put due to the limited multiplexing capacity of
PCR.
The same mechanism of circularizing monomerized amplification
products can be used to generate circularized representations of
oligonucleotide probes that have been joined in a
proximity-dependent nucleic acid interaction event (Landegren, 1995
and Landegren & Fredriksson, 2000). In this assay binding of
two or more probes to a target molecule, e.g. a protein, allows
attached DNA strands to be joined by ligation, serving as an
amplifiable and detectable indicator of the bound protein. In a
preferred embodiment, an excess of restriction oligonucleotide is
hybridized to two identical sequences, in two of the joined
oligonucleotide probes, containing a restriction enzyme recognition
sequence. After restriction digestion and heat-inactivation of the
restriction enzyme, cleaved oligonucleotides are detached, allowing
an intact restriction oligonucleotide to hybridize to both ends of
the joined and digested probe oligonucleotides, due to the
preferred intra-molecular hybridization reaction. Upon addition of
a DNA ligase, the restriction oligonucleotide acts as a ligation
template, guiding the circularization of the oligonucleotide (FIG.
3). The circle that forms can now be amplified according to the
present invention. The mechanism of forming circularized DNA as an
effect of a proximity-dependent nucleic acid ligation reaction is
distinct from the one described in PCT WO99/49079. In the present
invention, parts of the proximity probes become circularized, in
contrast to the method described in PCT WO99/49079 where proximity
probes template circularization of added oligonucleotides.
In one preferred format, circularised amplification products are
hybridised to different primers attached to a solid support,
specific for each of the different products present in the
reaction. The different primers are preferably designed to be as
dissimilar as possible, i.e. they represent so-called zip-code- or
tag-sequences, and they may be arranged in an array. The primers
are used to initiate a localised RCA. By hybridizing the
circularized amplification products rather than the initial
circular set of nucleic acids, the hybridisation kinetics and
sensitivity are improved by several orders of magnitude. Moreover,
if a localised RCA is monitored in real-time, a signal accumulation
over time could be detected over a very broad dynamic range,
particularly suitable for expression analyses. If the complexity of
the sample is very high with respect to differences in copy number
and/or the number of different sequences, then cross hybridisation
between different tag-sequences will be difficult to avoid
completely. Therefore, it would be valuable to increase the
specificity of zip code recognition, over that attained by
oligonucleotide hybridization, by requiring that the solid support
attached tag-sequence primers template circularization of the
amplified monomers. If the number of different targets is very
high, a monomerization procedure must be devised that allows for
specific cleavage in each of many different tag-sequences. For this
purpose, every sequence in the complex mix of circularizable
nucleic acids may be equipped with a type IIs restriction enzyme
recognition sequence adjacent to the unique tag-sequence. Specific
cleavage within the tag-sequence motif is obtained by rendering the
recognition sequence double-stranded with an oligonucleotide having
a sequence general for all RCA products and/or a pool of random
short oligonucleotides, e.g. hexamers, which will form
double-stranded substrates for restriction cleavage (FIG. 4). After
restriction digest, the monomers have now in effect been converted
to padlock probes containing half-tag end-sequences. Moreover, this
strategy allows half-tags connected to pairs of detection reagents
to be combined to identify the pairs of binding reagents that have
been bound in proximity. This is possible by using proximity
ligation probes where ligatable ends constitute unique base-paired
half-tag sequences. In this manner ends may be joined by blunt- or
sticky end ligation (FIG. 3).
Repeated RCAs has been proposed previously in WO 92/01813 and U.S.
Pat. No. 5,714,320. However, in WO 92/01813 the RCA products are
cleaved to monomers in order to create new primers for subsequent
RCA reactions using preformed circles. In U.S. Pat. No. 5,714,320 a
preparative method is described for producing selected
oligonucleotides having well-defined ends by providing an isolated
circular oligonucleotide template. The method is however not suited
for analytical purposes or for amplification of rare circular DNA
strands generally, since it typically requires 0.1 .mu.M to 1 mM
isolated circular templates. In the method described in U.S. Pat.
No. 5,714,320 the primers are provided in a molar excess over
circular template of less than 100, and the
deoxynucleotidetriphosphates in a molar excess over circular
templates of less than 10.sup.7. For analytical applications these
molar ratios are to low to allow efficient priming and
polymerization, respectively, due to the low amount of target
molecules. For analysis of, e.g. genomic DNA sequences by either
amplification of circularized genomic DNA or circularized
oligonucleotide probes, the corresponding molar ratios required in
the first amplification step are at least 100 and 10.sup.7,
respectively, or more preferably greater than 100 000 and
10.sup.10, respectively, or ideally about, 10.sup.7 and 10.sup.12,
respectively, because of the low concentration of initial
circularized nucleic acids. Japanese patent application JP 4-304900
describes the use of RCA for detecting circularised probes. In this
application repeated RCAs are described using the RCA product as a
target for subsequent probe ligations and RCAs. By contrast, in the
present invention the monomerised RCA product is used as probe in
subsequent ligations and RCAs. The advantages of this procedure
have already been discussed.
In a further aspect of the invention, the present inventors have
devised several approaches for increasing the signal obtained from
an RCA by adding a linear signal-generating amplification of the
RCA product. This results in an amplification of the signal from
circularized probes that grows as a square function of time.
The first approach is based on selective, hybridisation-dependent,
degradation of a probe complementary to the RCA product. It is
desirable that the probe is designed in a manner such that its
cleavage is detectable. Accordingly, in a further aspect, the
invention comprises a method of nucleic acid amplification that
employs probes to indicate the extent of the amplification, which
method comprises the steps of: providing a signaling probe, which
probe includes a sequence which is complementary to an
amplification product; reacting the signaling probe with the
amplification product; selectively degrading signaling probes that
have hybridized to the first generation amplification product,
wherein degraded probes dissociate from the first generation
amplification product allowing further signaling probes to
hybridize with the product, wherein hybridization and degradation
of the probes effects a change in detection signal emitted by the
probe.
Preferably, the probe consists of a hairpin-loop probe, a so-called
molecular beacon (Tyagi & Kramer, 1996) comprising a detectable
marker ligand therein, which selectively emits a detectable signal.
The marker may be part of the nucleic acid sequence or may be a
ligand held within the hairpin formation. Preferably, the ligand is
released from the nucleic acid on cleavage of the nucleic acid.
If the part of the probe hybridising to the RCA product at least
partially consists of RNA it will, upon hybridisation, be degrade
by the enzyme RNase H. (Duck et al, e.g. U.S. Pat. Nos. 5,011,769,
5,660,988, 5,403,711 and 6,121,001)
A similar effect can be obtained by substituting one or more of the
deoxynucleotides, used in the RCA, for
thiophosphorodeoxynucleotides, thereby protecting the RCA product
from endonuclease hydrolysis. The molecular beacon would in this
case be made of ordinary deoxynucleotides and would therefore be
susceptible to degradation by a double strand specific
endonuclease. Specifically, a restriction enzyme recognition site
can be designed into the loop sequence of the beacon. There are
several known restriction enzymes that specifically cleave the
non-thiophosphorylated strand when this is hybridised to a
thiophosphorylated strand. By analogy to the RNaseH degradable
probe, this would only result in cleavage and thereby signal
emission from of the probe in the presence of the target molecules.
Instead of a specific endonuclease, any unspecific double strand
specific endonuclease can be used, thereby avoiding the need for a
specific sequence in the probe.
A related way of producing detectable cleavage products is to add a
probe complementary to an RCA product and a restriction enzyme that
recognise a sequence in the RCA-oligonucleotide duplex. After
cleavage of the RCA-oligonucleotide duplex, the cleaved probe will
dissociate from the monomerized RCA products. Then an intact
oligonucleotide can hybridise to one end of the cleaved monomer,
whereafter the other end of the monomer will most likely hybridise
to the same oligonucleotide, due to the intra-molecular nature of
the interaction. In this manner, a new substrate for the
restriction enzyme is formed, and a second signal-generating
cleavage occurs. By labelling the probe with a fluorescent moiety
at one end and a quencher molecule at the other end a signal will
be generated upon cleavage and subsequent dissociation.
Hybridisation-dependent degradation of probes can also be performed
with any double strand-specific exonuclease ((Copley & Boot,
1992), U.S. Pat. No. 6,121,001). In this case a probe that
hybridise to the RCA product will be a substrate for the
exonuclease and thereby degraded while the RCA product are
unaffected due to the lack of any double stranded ends. Upon
degradation the melting temperature of the duplex will decrease and
the probe is more likely to dissociate even if not fully degraded.
Thereby the sequence is made accessibly for another probe to
hybridise and subsequently be degraded.
This approach for increasing the signal can also be performed with
ribo- or so called DNA-zymes (R/D-zyme) (e.g. (Herschlag &
Cech, 1990) & (Carmi et al., 1998). By incorporating the
complementary sequence of an R/D-zyme in the circularised nucleic
acid the RCA product will contain the active R/D-zyme. This can
then be used to cleave a probe that is added to the reaction
mixture. Upon cleavage the cleaved probe will dissociated from the
RCA product and leave place for another uncleaved probe to
hybridise and be cleaved. The R/D-zyme does not need to cleave the
probe but it can instead template ligation of two oligonucleotides
together and generate a signal as described below (Cuenoud &
Szostak, 1995).
Probes may also be designed so that upon hybridisation to the RCA
product they assemble in such a way that they resemble the
substrate for a structure specific enzyme. The enzyme is preferably
selected from the group comprising resolvases, recombinases or
nucleases, examples Ruv ABC, Holliday junction resolvases, Flip
recombinases, FEN nuclease or certain polymerases. One aspect of
the invention is to use two oligonucleotides hybridising in tandem
in such a way that the downstream oligonucleotide has a protruding
5 prime end. This structure can be cleaved by several different
enzymes e.g. FEN nucleases, Taq polymerase, Tth polymerase or Mja
nuclease (Lyamichev et al, 1999). The downstream oligonucleotide is
designed so that it has a melting temperature near the temperature
of the isothermal RCA reaction.
Accordingly, the probes may comprise a fluorescent moiety and a
quenching moiety which are separated by a hairpin-loop structure,
wherein the quenching moiety quenches the signal from the
fluorescent moiety when the probe is in an un-bound and intact
conformation the quenching moiety quenches the signal from the
fluorescent moiety, and wherein bound or degraged probe emits a
signal (FIG. 5). Alternatively, the probe may include a pair of
signalling moieties, which moieties produce a signal by FRET when
the probe is intact, but where degradation of the probe inhibits
signal production.
Advantageously, with the above combination of a probe with any of
the hybridization-dependent accumulation of detectable moieties the
reaction can continue isothermally, even at low temperature.
In this manner the temperature may be less than 60.degree. C. and
preferably is less than 50.degree. C. Advantageously, this may
remove the need to maintain the reactions at an elevated
temperature.
Instead of degrading probes it is possible to assemble probes to
mark the presence of an RCA product. If two oligonucleotide probes
are constructed in such a way that they hybridise adjacent to each
other on the RCA product, then they can subsequently be joined by a
ligase. If the two oligonucleotides are designed in such a way that
upon ligation and dissociation from the target they form a stable
stem-loop structure, a donator molecule at the 5 prime position can
be placed in close proximity to a acceptor molecule at the 3 prime
position in the other oligonucleotide. A signal can then be
generated based upon fluorescence resonance energy transfer (FRET).
By designing the probes so that the ligated probe will have a
melting temperature near the temperature of the isothermally
proceeding RCA reaction a fast turnover will be possible. The
unligated probes will be present in large molar excess over the
produced ligated probes, thereby increasing the rate at which they
will hybridise to the target RCA product and subsequently be
ligated, dissociate and so on. The reaction is thus possible to
perform isothermally.
Accordingly, in a further aspect, there is provided a method of
nucleic acid amplification which employs probes to indicate the
extent of the amplification, which method employs a pair of
signaling probes, which probes are designed such that they
hybridize to a target sequence on an amplification product adjacent
to each other, wherein upon hybridization the probes are ligated to
form a ligated product which dissociates from the target sequence,
wherein dissociation of the ligated product from the target
sequence allows a further pair of probes to hybridize to the target
sequence, and wherein upon dissociation from the target sequence
the ligated product emits a signal.
Preferably, one of the pair of signaling probes comprises a donor
moiety and another comprises an acceptor moiety, and wherein the
probes are designed such that the ligated product forms a hairpin
loop structure, which upon formation allows energy transfer between
the donor and acceptor moieties to produce a signal.
In yet another aspect, the invention comprises homogenous detection
of concatemer amplification products using a modified molecular
beacon design. The present inventors have found that conventional
molecular beacons generate signal in the absence of an RCA product
but in the presence of DNA polymerase, unless at least parts of the
DNA residues in the beacon are replaced by nucleic acid residues
that are not accepted as substrates for the polymerase, since the
3' end (usually carrying the fluorescence quencher) is degraded by
the 3' exonucleolytic (proof reading) activity of the polymerase.
Generation of non-specific signal can be completely avoided by
using molecular beacons comprising 2'-O-methyl-RNA residues instead
of DNA residues (FIG. 6). The inventors further found that
conventional molecular beacons that hybridise to an RCA product are
quenched, because neighbouring beacons readily form stems with each
other (inter-molecular stems), bringing the quencher and reporter
fluorophores close together, much like the closed (quenched)
conformation of non-hybridising beacons (FIG. 7). This can be
avoided by including one of the stem sequences of the beacon in the
padlock probe sequence so that, upon hybridisation to the RCA
product, one part of the stem hybridises to the product so that it
cannot form stem-like structures with neighbouring beacons (FIG.
7). With these modifications the RCA can be monitored in real-time
(FIG. 8). Alternatively, a second probe could be added to the
detection reaction that hybridises to the RCA product in between
the molecular beacons to avoid that this sequence loops out, thus
hindering the inter-molecular stems to form. The magnitude of the
inter-molecular quenching may vary between different molecular
beacon sequences as exemplified by the complete quenching of the
DNA molecular beacon version (FIG. 9) compared to the partial
quenching of the 2'-O-Me-RNA beacon used in FIG. 8.
The inter-molecular hairpin structure that forms between adjacent
molecular beacons, hybridising to a concatenate sequence, can also
be used to generate FRET between two molecular beacons that
hybridise within one monomer of the concatenate sequence. The two
molecular beacons should be equipped with the same stem sequence,
but the position of the donor and acceptor fluorophores should be
switched in one of the two molecular beacons. Such molecular
beacons will hybridise in an alternating fashion, forming
inter-molecular hairpin structures between adjacent, but
alternating molecular beacons, such that the fluorophore of one
beacon is positioned in close proximity to the fluorophore of the
neighbouring molecular beacon, enabling efficient FRET between the
two fluorophores. In this way background fluorescence from closed
molecular beacons can be diminished, increasing detection
sensitivity.
In a yet further aspect, the invention comprises homogenous
detection of concatemer amplification products by virtue of the
increased concentration of signaling probes hybridized to the
amplification product, compared to the concentration of non-bound
signaling probes free in the surrounding solution. The homogenous
detection is possible because the long concatemer amplification
products are coiled when free in solution and form micrometer-sized
balls. The enrichment of signaling probes in the balls of DNA
allows convenient detection of single amplification products from
individual circularized probes in microscopic analysis, due to the
contrast between the condensed signal from the signaling probes
hybridizing to the product and the relatively diffuse, fainter
signal from non-bound probes (FIG. 12). When for example analyzing
gene expression, the number of RCA product balls will directly
correspond to the gene expression level. Such a homogenous
detection system is very convenient and accurate, since each
counted RCA-product corresponds to one detected transcript
molecule.
Multiplexed homogenous analyses are generally limited by the number
of fluorophores which can be spectrally resolved. If several
fluorescently labeled probes are added to for example a PCR
reaction, overlapping spectra become a major problem, since the sum
of the different fluorophores in the reaction is analyzed. However,
in the present invention the analysis of individual RCA products by
fluorescence labeled probes can be performed in high multiplex,
because fluorophores with closely resembling spectra can be
resolved since individual RCA product balls are analyzed, hence no
spectral cross-talk.
The homogenous detection can be multiplexed for gene expression
analysis or for multiplexed genotyping, by including different
zip-code sequences in the different amplified probes, to allow
identification of the amplification products by hybridizing
ratio-labeled zip-code oligonucleotides to different amplification
products. Ratio-labeling is well known in the art and has been used
to create multiple color-blends from a limited number of primary
colors (Dauwerse et al., 1992, and Nederlof et al., 1992). For
example, if two primary dyes A and B are mixed as follows: 0% A and
100% B, 20% A and 80% B, 40% A and 60%, 60% A and 40% B, 80% A and
20% B, and 100% A and 0% B, six different color-blends are created.
If three primary dyes are mixed with a similar increment, 36
color-blends can be distinguished. The zip-code oligonucleotides
are easily ratio-labeled by either mixing different proportions of
fluorescent dye and conjugating these mixes with different zip-code
oligonucleotides, or mixing zip-code oligonucleotides labeled with
different dyes in the desired proportions. The degree of
multiplicity in this labeling approach depends on the number of
primary dyes added to the labeling scheme (n), and the precision of
the labeling determining the number of ratio increments (x), which
limits the number of color blends that can be distinguished
x.sup.(n-1). Since the amplification products can consist of
thousands of repeated units, the precision in the ratio-labeling
should be very high, and the contribution of any minor
cross-hybridizing zip-code oligonucleotides would be negligible.
The major advantages of using the ratio-labeling approach compared
to the combinatorial labeling approach, which uses binary
(all-or-none) combinations of primary dyes to create multiple
pseudo-colors, is that many more color-blends can be obtained using
color-ratios compared to color-combinations.
In some embodiments of the present invention it may be advantageous
to eliminate any linear probes before the initial RCA, e.g., it has
been noticed that remaining non-circularised probes produce a
non-specific signal in RCAs. An attempt to overcome this problem is
described in WO 00/36141 where enzymes or so-called capture ligands
are used to remove any remaining linear nucleic acid probes.
Accordingly, in a further aspect, the present invention relates to
a method of removing or rendering inert non-circularized probes
during (or after) a nucleic acid amplification process which
utilizes circular probes, in which the non-circularized probes
comprise first and second segments separated by a linking segment,
wherein the first and second segments are complementary to
sequences on a target sequence, wherein the probe is designed to
form a hairpin loop structure between the 3' end of the probe and a
sequence in a linking segment of the probe, wherein a stem of the
hairpin loop structure ideally has a thermal stability that neither
inhibits formation of a hybrid between the loop and the target
sequence nor inhibit replication of the probe by RCA.
The stem should be sufficiently stable to prime synthesis and thus
convert non-ligated probes to full hairpins, unable to prime
"second strand" synthesis on the RCA-product.
Additionally, the hairpin-forming probe has a further advantage in
that such a probe design may be more specific than conventionally
designed probes. In conventional probe design the diagnostic base
should be positioned at the ultimate 3' position of the probe
sequence to fully take advantage of the mismatch discriminatory
capacity of DNA ligases. In the hairpin probes of the present
invention, this diagnostic base will thus be a part of the hairpin
forming sequence. This sequence may be designed to flip back and
forth between the hairpin and the target hybridising conformation
at the ligation temperature. The matched sequence version of a
probe will then spend more time in the target sequence hybridising
conformation than the corresponding mismatched probe version. This
will favour ligation of matched probes over misligation of
mismatched probes.
In a further aspect, the invention provides a further method of
removing or rendering inert non-circularized probes during (or
after) a nucleic acid amplification process which utilizes circular
probes, in which an excess of oligonucleotides that are
complementary to a 3' end of the probes are added before the
amplification reaction, which oligonucleotides preferably include a
5' sequence extension, whereby the 3' end of non-circularized
probes will lose complementarity to a product of the amplification
process
Preferably, the excess of oligonucleotides which are complementary
to the 3' end of the probes are added to the system before the RCA
is begun although they may be added simultaneously with the other
reagents or immediately after the reaction is begun.
According to the invention, the 3' ends of non-ligated probes will
lose their complementarity to the RCA product, and will not be able
to prime a second strand synthesis. These 3' eliminators may be
used to prime the RCA.
Alternatively, to avoid the situation where the linking segment of
non-ligated probes becomes replicated, the 3' eliminators may be
equipped with an unextendable 3' end that is also unremovable by 3'
exonucleolytic activities of DNA polymerases. This may be
particularly important if the RCA product is intended to be
detected by oligonucleotides recognizing sequences in the RCA
product that correspond to the linking segment of the padlock
probes. In this case a general primer could be added to the
circularised probes to initiate the RCA. Because of the limited
length of the 3' eliminators, they will become displaced by the
polymerase extending the primer and will thus not inhibit the RCA
(Baner et al., 1998).
DETAILED DESCRIPTION OF THE INVENTION
Embodiments of the invention will now be described in more detail,
by way of example only, with reference to the accompanying drawings
of which:
FIG. 1 illustrates the general procedure of several generation
rolling circle replication (RCA) according to the invention, 1) a
padlock probe is hybridized to a specific target nucleic acid
strand, 2) the padlock probe is circularized using a DNA ligase, 3)
the circularized probe is replicated in an RCA, 4) an excess of
oligonucleotides are hybridized to a restriction enzyme recognition
sequence present once per monomer of the RCA product, 5) the RCA
product is monomerized using a restriction enzyme that digests the
oligonucleotide/product duplexes, 6) after a heating step that
inactivates the restriction enzyme and denature the oligonucleotide
fragments, an absolute majority of the monomers will hybridize with
both ends to intact oligo-nucleotides, 7) the monomers are
circularized using a DNA ligase and the thus formed circles can now
be treated according to steps 3-7 for additional cycles;
FIG. 2 illustrates the amplification of genomic- or cDNA fragments
using a circularization adaptor to circularize and amplify the
sequences according to the invention, 1) a DNA sample is fragmented
using e.g. a restriction enzyme, 2) the fragmented DNA is
denatured, 3) a circularization adaptor is hybridized to a specific
target fragment, 4) the target fragment is circularized using a DNA
ligase, 5) the circularized target fragment is replicated in an
RCA, 6) an excess of a general adaptor oligonucleotide is
hybridized to a restriction enzyme recognition sequence present in
the adaptor sequence once per monomer of the RCA product, 7) the
RCA product is monomerized using a restriction enzyme that digests
the oligonucleotide/product duplexes, 8) after a heating step that
inactivates the restriction enzyme and denature the oligonucleotide
fragments, an absolute majority of the monomers will hybridize with
both ends to intact oligonucleotides, 9) the monomers are
circularized using a DNA ligase and the thus formed circles can now
be treated according to steps 5-9 for additional cycles;
FIG. 3 illustrates the conversion of a proximity-dependent ligation
event to circularized DNA that can be amplified according to the
present invention, 1) a pair of proximity probes, e.g. antibodies
equipped with oligonucleotides, binds to a target protein, 2) the
two oligonucleotide are joined in a proximity-dependent ligation
reaction, e.g. via blunt end ligation to allow half-tag ligation
for the identification of pairs of binding reagents that have been
bound in proximity, 3) an excess of oligonucleotides are hybridized
to two identical sequences containing a restriction enzyme
recognition sequence and present in both of the joined
oligonucleotide sequences, 5) the joined product is cleaved using a
restriction enzyme that digests the oligonucleotide/product
duplexes, 6) after a heating step that inactivates the restriction
enzyme and denature the oligonucleotide fragments, an absolute
majority of the cleaved ligation products will hybridize with both
ends to intact oligonucleotides, 7) the monomers are circularized
using a DNA ligase and the thus formed circles can now be treated
according to steps 3-7 in FIG. 1;
FIG. 4 illustrates how a complex set of RCA products can be
monomerized in the middle of a zip-code motif using a type IIs
restriction enzyme and random hexamers, and how the monomerized RCA
products then are hybridized and circularized on a zip-code
oligonucleotide microarray for increased specificity and dynamic
range, 1) a set of RCA products containing identifying zip-code
oligonucleotide sequences has been generated from e.g. multiplexed
padlock probe genotyping or expression analysis experiments, or a
multiplexed proximity-dependent ligation event, 2) a type IIs
restriction enzyme is added along with a set of random hexamers and
a general oligonucleotide containing a type IIs is restriction
enzyme recognition sequence, 3) the hexamers and the restriction
oligonucleotides are optionally removed and the monomers have now
in effect been converted to padlock probes with half zip-code
end-sequences, 4) the monomers are hybridized to zip-code
oligonucleotide microarray, 5) the monomers are circularized on the
zip-code oligonucleotides using a DNA ligase, 6) the monomers are
amplified in a RCA using the zip-code oligonucleotides as primers,
and the polymerization may optionally be monitored in a homogenous
format for increased dynamic range;
FIG. 5 is a schematic representation of the amplification method of
the invention whereby molecular beacons are degraded;
FIG. 6 is a graph showing removal of non-specific accumulation of
fluorescence in presence of DNA polymerase by replacing all DNA
residues of the molecular beacon with 2'O-Me-RNA residues where one
DNA molecular beacon is labeled with FAM fluorescence (upper panel)
and one 2'O-Me-RNA molecular beacon is labelled with HEX
fluorophore (lower panel) which was added to the same test tube in
presence (squares) or in absence (circles) of .PHI.29 DNA
polymerase;
FIG. 7 is a schematic representation of inter-molecular quenching
of molecular beacons hybridizing to an RCA product when using a
traditional molecular beacon design;
FIG. 8 is a graph showing the inter-molecular beacon quenching is
demonstrated by restriction cleavage of the RCA product, and the
modified design of the molecular beacon allows for real-time
monitoring of RCA;
FIG. 9 is a graph showing the temperature profile of RCA reactions
performed as in FIG. 8. Fluorescence is obtained from the DNA
molecular beacon added after RCA, and heat inactivation of the
polymerase;
FIG. 10 shows real time monitoring of third generation RCA
according to example 1;
FIG. 11 shows the fluorescence recorded at a microarray feature
containing an oligonucleotide complementary to the
second-generation RCA product obtained according to example 2;
and
FIG. 12 shows individual RCA products in solution detected by
homogenous hybridization of fluorescence labeled oligonucleotides,
demonstrating the contrast between the condensed signal from the
fluorescence labeled oligonucleotides hybridizing to the product
and the relatively diffuse, fainter signal from non-bound
oligonucleotides.
EXAMPLES
Example 1
Real-Time Monitoring of a Third-Generation RCA Using Modified
Molecular Beacons
2 nM padlock probe (P-CCTCCCATCATATTAAAGGCTTTCTCTAT GTTAA
GTGACCTACGACCTCAATGCTGCTGCTGTACTACTCTTCCTA AGGCATTCTGCAAACAT; SEQ
ID NO:1) (P=5' phosphate) was circularized in 10 mM TrisAc (pH
7.5), 10 mM MgAc.sub.2, 50 mM KAc, 0.1% BSA, 1 mM ATP, 200 mM NaCl,
and 20 mU/.mu.l T4 DNA ligase in presence of 0, 10, 40, or 160 zmol
of a target oligonucleotide (GCCTTTAATATGGGAGGATGTTTGCAG
AATGCCTTAG; SEQ ID NO:2). The reactions were incubated for 15
minutes at 37.degree. C., and then the ligase was inactivated for 5
minutes at 65.degree. C. The first-generation RCA was performed for
45 minutes at 37.degree. C. in 0.1 .mu.g/.mu.l BSA, 250 .mu.M dNTP,
10 mM DTT, 1 pmol primer (CGTCGTAGGTCACTTAACAT; SEQ ID NO:3), and 1
ng/.mu.l .phi.29 DNA polymerase. The polymerization components were
added to 10 .mu.l ligation reactions in 15 .mu.l of .phi.29 DNA
polymerase buffer (10 mM Tris-HCl (pH 7.5), 10 mM MgCl.sub.2, and
20 mM (NH.sub.4).sub.2SO.sub.4 The DNA polymerase was inactivated
for 10 min a 65.degree. C. The first-generation RCA product was
monomerized by adding 5 .mu.l 0.1 .mu.g/.mu.l BSA, 3 pmol RSAI
(GCTGCTGTACTACTCTCTT; SEQ ID NO:4), and 10 U RsaI in .phi.29 DNA
polymerase buffer. The reaction was incubated for 60 minutes at
37.degree. C. and then the enzyme was inactivated for 10 minutes at
65.degree. C. The monomerized RCA product was circularized by
adding 5 .mu.l 0.1 .mu.g/.mu.l BSA, 1 mM ATP, and 1 U T4 DNA ligase
in .phi.29 polymerase buffer. The ligation was incubated for 15 min
at 37.degree. C. and then the enzyme was inactivated for 5 minutes
at 65.degree. C. The second-generation RCA was performed using the
same conditions as the first-generation RCA by adding 15 .mu.l
polymerization reagents to 35 .mu.l of the circularized RCA
product. The polymerization reaction continued for 45 minutes at
37.degree. C. Half of the second-generation RCA product was
monomerized by adding 6 pmol RSAI comp (AAGAGAGTAGTACAGCAGC; SEQ ID
NO:5) and 10 U RsaI in 5 .mu.l .phi.29 DNA polymerase buffer
including 0.1 .mu.g/.mu.l BSA. The reaction was incubated for 60
minutes at 37.degree. C., and then the enzyme was inactivated for
10 minutes at 65.degree. C. Circularization of the monomerized
second-generation RCA product was performed using the same
procedure as the circularization of the monomerized
first-generation RCA product. The third-generation RCA was
performed as the second-generation RCA but in presence of 0.1 .mu.M
molecular beacon (HEX-ccucAAUGCUGCUGCUGUACUACgagg-DABCYL; SEQ ID
NO:6) and for 60 min. The reaction was followed in real-time using
an ABI 7700.
Example 2
Detection of a Second-generation RCA Product on a DNA
Microarray
2 nM padlock probe (WD 1216G) was circularized as above in presence
of various amounts of target oligonucleotides (T 1216G; 0, 25, 250,
or 2500 zmol). The first-generation RCA was performed for 100
minutes at 37.degree. C. as above 1 pmol of the primer WDP-F. The
polymerization components were added to 10 .mu.l ligation reactions
in 15 .mu.l of .phi.29 DNA polymerase buffer The DNA polymerase was
inactivated for 10 min at 65.degree. C. The first-generation RCA
product was monomerized by adding 5 .mu.l 0.1 .mu.g/.mu.l BSA, 3
pmol Comp WDP-F, and 5 U Fnu4H 1 in .phi.29 DNA polymerase buffer.
The reaction was incubated for 60 minutes at 37.degree. C. and then
the enzyme was inactivated for 10 minutes at 65.degree. C. The
monomerized RCA product was circularized by adding 5 .mu.l 0.1
.mu.g/.mu.l BSA, 1 mM ATP, and 1 U T4 DNA ligase in .phi.29
polymerase buffer. The ligation was incubated for 15 min at
37.degree. C. and then the enzyme was inactivated for 5 minutes at
65.degree. C. The second-generation RCA was performed using the
same conditions as the first-generation RCA by adding 15 .mu.l
polymerization reagents to 35 .mu.l of the circularized RCA
product. The polymerization reaction continued for 100 minutes at
37.degree. C. Half of the second-generation RCA product was
monomerized by adding 4.5 .mu.mol D-RCRcut and 5 U Fnu4HI in 5
.mu.l .phi.29 DNA polymerase buffer including 0.1 .mu.g/.mu.l BSA.
The reaction was incubated for 60 minutes at 37.degree. C., and
then the enzyme was inactivated for 10 minutes at 65.degree. C. 30
.mu.l 1 monomerized second-generation RCA product was hybridized to
a DNA microarray in 4*SSC, 0.525 .mu.M Comp WD Cy5, 10 .mu.M EDTA
at 45.degree. C. for 2 h, washed in 0.1.times.SSC at 45.degree. C.,
rinsed in water, and finally dried. The Cy5 fluorescence signal was
recorded in a fluorescence laser scanner.
A schematic drawing of the general procedure of a several
generation RCA, as described in examples 1 and 2 is illustrated in
FIG. 1. The results of examples 1 and 2 are shown in FIGS. 10 and
11, respectively. First a circular nucleic acid is replicated in an
RCA. Then the first-generation RCA product is monomerized, e.g. by
using a restriction enzyme that will cleave the product at a
recognition site, rendered double-stranded by an oligonucleotide
complementary to the RCA product. Intact restriction
oligonucleotides will displace the digested ones, e.g. during or
after heat inactivation of the restriction enzyme. When an intact
restriction hybridizes to one end of a monomerized RCA product, the
other end of the monomer will hybridize to the same restriction
oligonucleotide, because of the intra-molecular nature of the
second hybridization reaction. The monomers can then be
circularized by joining the ends, e.g. using a DNA ligase. The
procedure can now be repeated for one or more rounds of the same
procedure.
FIG. 10 shows real-time monitoring of the third-generation RCA
described in example 1. A) Real-time measurement of HEX
fluorescence emitted from molecular beacons hybridizing to the RCA
product as it is generated. B) A graph showing the relationship
between the amounts of target oligonucleotide added in the first
probe circularization reaction, performed in quadruplicate, and the
maximum slope of the third-generation real-time RCA of these
ligation reactions. The error-bars denote the standard
deviation.
FIG. 11 shows the fluorescence recorded at a microarray feature
containing an oligonucleotide complementary to the
second-generation RCA product obtained according to example 2.
Example 3
Oligonucleotides: The padlock probes used were p90:
P-CCTCCCATCATATTAAAGGCTTTCTCTATGTTAAGTGACCTACGACGATG
CTGCTGCTGTACTACTCTTCCTAAGGCATTCTGCAAACAT; SEQ ID NO:7 and p93:
P-CCTCCCATCATATTAAAGGCTTTCTCTATGTTAAGTGACCTAC
GACCTCAATGCTGCTGCTGTACTACTCTTCCTAAGGCATTCTGCA AACAT; SEQ ID NO:8
(P=5' phosphate). The ligation template for the padlock probes was
t40: GCCTTTAATATGGGAGGATGTTTGCAGA ATGCCTTAG; SEQ ID NO:9. The DNA
molecular beacon was FAM-cgcctcAATGCTGCTGCTGTACTACgaggcg-DABCYL;
SEQ ID NO:10 (the stem part in lower case) and the 2' O-Me-RNA
molecular beacon was HEX-ccucAAUGCUGCUGCUGUACUACgagg-DABCYL; SEQ ID
NO:11. The stem is two base pairs shorter in the 2'-O-Me-RNA beacon
because of the higher hybrid stability of 2'-O-Me-RNA base pairs.
The oligonucleotide used for restriction digestion was Tsp45I:
GGCTTTCTCTATGTTAAGTGACCTACGA; SEQ ID NO:12.
Example 4
Padlock probe circularization: 200 nM padlock probes were ligated
in 10 mM Tris-acetate pH 7.5, 10 mM MgAcetate, 50 mM NaCl, 1 mM
ATP, 1 .mu.g/.mu.l BSA, and 0.2 units/.mu.l T4 DNA ligase (Amersham
Pharmacia Biotech) at 37.degree. C. for 30 minutes in presence of
600 nM ligation template.
Example 5
Rolling-circle amplification: Polymerization reactions were
performed in 50 mM Tris-HCl (pH 7.5), 10 mM MgCl.sub.2, 20 mM
(NH.sub.4).sub.2SO.sub.4, 10 mM dithiothreitol and 0.2 .mu.g/.mu.l
BSA, 0.25 mM dNTP, and 2 ng/.mu.l .PHI.29 DNA polymerase (kindly
provided by Dr. M. Salas) at 37.degree. C. For real-time monitoring
the RCA was performed in presence of 100 nM molecular beacon and
300 nM ROX dye. Fluorescence values are given as a ratio between
the fluorescence emitted by the molecular beacon (FAM or HEX) and
the ROX reference dye. The temperature profiles were obtained by
sampling fluorescence after temperature increments of 1.degree. C.
held for 30 seconds.
Example 6
Restriction digestion: 20 .mu.l of a 10 mM Bis Tris Propane-HCl (pH
7.0), 10 mM MgCl.sub.2, 1 mM dithiothreitol, 0.1 .mu.g/.mu.l BSA,
1.5 .mu.M Tsp45I, and 0.1 U/.mu.l Tsp 45I (New England Biolabs) was
added to 40 .mu.l RCA products and incubated at 65.degree. C. for
four hours.
Turning to the drawings as can be seen in FIG. 6, removal of
non-specific accumulation of fluorescence in presence of DNA
polymerase by replacing all DNA residues of the molecular beacon
with 2'O-Me-RNA residues. One DNA molecular beacon labeled with FAM
fluorescence (upper panel) and one 2'O-Me-RNA molecular beacon
labeled with HEX fluorophore (lower panel) was added to the same
test tube in presence (squares) or in absence (circles) of .PHI.29
DNA polymerase. The left portion of the graphs shows a real time
monitoring of fluorescence in the test tube, and the right portion
shows the temperature profile of the components present at the end
of the 60 min incubation.
From FIG. 7 it can be seen that inter-molecular quenching of
molecular beacons hybridizing to an RCA product when using a
traditional molecular beacon design (upper panel). The structure
can be avoided by using a modified design (lower panel).
FIG. 8: The inter-molecular beacon quenching shown in FIG. 7 is
demonstrated by restriction cleavage of the RCA product, and the
modified design of the molecular beacon allows for real-time
monitoring of RCA. RCA was performed on ligation reactions
subjected to ligase (black) or no ligase (grey) containing either
the p90 (squares) or the p93 (circles) padlock probes. The left
portion of the graph shows a real time monitoring of fluorescence
from the 2' O-Me-RNA molecular beacon in the different reactions.
The right portion shows the temperature profile of the components
present at the end of the 90 min RCA (filled symbols). Superimposed
are the temperature profiles of the different reaction components
after a restriction digest (open symbols).
Temperature profile of RCA reactions performed as in FIG. 8 are
shown in FIG. 9 where fluorescence is obtained from the DNA
molecular beacon added after RCA, and heat inactivation of the
polymerase.
Example 7
One hundred nanogram of PstI-cut genomic DNA was denatured at
95.degree. C. for 12 minutes and cooled rapidly in a thermal cycler
to 12.degree. C. Pre-annealed oligonucleotides "CircEx15ATP7B"; TTG
CTG GCT TTT GTC TCG TAT CGG AGC GTA CCT AGA TAG CGT GCA GTC CTC TTT
MT TTG; SEQ ID NO:13 and "gDNAadapter1.degree."; 5'P-CGC TAT CTA
GGT ACG CTC CGA TAC AT; SEQ ID NO:14 were added to a final
concentration of 2 nM to the denatured cut genomic DNA. To one
reaction ligase was added, and to another ligase was omitted.
Ligation was allowed to proceed for 1 h at room temperature
followed by 30 minutes at 37.degree. C. before the ligase was heat
inactivated at 65.degree. C. for 20 minutes. Five microliter of the
ligase reaction were subjected to a rolling circle amplification
reaction in 50 mM Tris-HCl, pH 7.5, mM MgCl.sub.2, 20 mM
(NH.sub.4).sub.2SO.sub.4, 0.2 .mu.g/.mu.l BSA, 0.25 mM dNTP, and 10
ng .phi.29 polymerase at 37.degree. C. for 3 hours. To quantify the
amount of RCA product, a real-time PCR reaction was run on 2.5
.mu.l of the RCA reactions in 1.times.PCR GOLD buffer (ABI), 1.6 mM
MgCl.sub.2, 0.25 mM dNTP, 200 nM Ex15ATP7B-Frw (AGA CCT TGG GAT ACT
GCA CGG; SEQ ID NO:15) and 200 nM Ex15ATP7B-Rew (CAA TTC CAC AGC
CTG GCA CT; SEQ ID NO:16) primers, 0.625 U Taq GOLD polymerase
(ABI), 300 nM ROX dye and 0.15.times. SYBR Green (Molecular Probes)
in a volume of 25 .mu.l. The primers were designed to PCR amplify
both the genomic fragment and the RCA product. The PCR program was
95.degree. C. for 10 minutes followed by 45 cycles of 95.degree. C.
for 15 sec and 60.degree. C. for 60 sec. The PCR amplicons were
subjected to a dissociation-curve analysis after the completion of
the PCR. The results presented as Ct-values are shown in table 1
with standard deviations in brackets. The melting temperature of
all amplicons was 82.6.degree. C. which correlates well with the
estimated Tm of 83.degree. C. for the amplicon. .phi.29 DNA
polymerase exhibits a strong exonucleolytic activity on single
stranded DNA (denatured); therefore the non-ligated DNA shows
4-fold fewer products compared to the non-.phi.29 DNA polymerase
treated sample when taking the four-fold dilution into account. The
DNA to be amplified is 545 nt long and with a processivity of 1500
nt/min, a 500-fold amplification should be expected. This would be
expected to result in a 120-fold amplification compared to the
unamplified sample, when taking the four-fold dilution into
account. The delta Ct-value of 6.75 corresponds to a 110-fold
amplification.
TABLE-US-00001 TABLE 1 SAMPLE BEFORE RCA AFTER RCA NO LIGASE 25.27
(.+-.0.191) 29.06 (.+-.0.255) LIGASE 25.98 (.+-.0.057) 19.23
(.+-.0.212)
Example 8
A 1.times.PBS solution of 2 pM RCA product from circularized
padlock probes p93, and 5 nM of the product complementary rhodamine
labeled probe RC1R (5'-Rhodamine-CTCTATGTTAAGTG ACCTACG; SEQ ID
NO:17) was injected into two microfluidic channels with a width of
50 micrometer and a inter-channel spacing of 40 micrometer.
Circularization of the padlock probe and the RCA was performed
according to examples 4 and 5. The RCA products consist of on
average 1500 copies of the circularized probes, since the RCA was
performed for 1 hour. The fluorescence from bound and non-bound
fluorescence labeled probes in the channels was imaged using an
epifluorescence microscope equipped with a 40.times. dry lens. In
FIG. 12, several bright balls of DNA are seen in the channels, as
well as many less bright out-of-focus objects, on a background of
the diffuse fluorescence from non-bound probes.
The invention is not limited to the embodiments hereinbefore
described which may be varied in both construction and detail
without departing from the spirit of the invention.
REFERENCES
Baner J., Nilsson M., Mendel-Hartvig M., and Landegren U. (1998).
Signal amplification of padlock probes by rolling circle
replication. Nucleic Acids Res. 22: 5073-5078. Carmi N., Balkhi S.
R., and Breaker R. R. (1998). Cleaving DNA with DNA. Proc Natl Acad
Sci USA 95: 2233-7. Copley C. G., and Boot C. (1992). Exonuclease
cycling assay: an amplified assay for the detection of specific DNA
sequences. Biotechniques 13: 888-92. Cuenoud B., and Szostak J. W.
(1995). A DNA metalloenzyme with DNA ligase activity. Nature 375:
611-4. Daubendiek, S. L. and Kool, E. T. (1997) Generation of
catalytic RNAs by rolling transcription of synthetic DNA
nanocircles. Nat Biotechnol, 15: 273-277. Dauwerse, J. G., Wiegant,
J., Raap, A. K., Breuning, M. H. and van Ommen, G.-J. B. (1992)
Multiple colors by fluorescence in situ hybridization using
ratio-labelled DNA probes create a molecular karyotype. Hum Mol
Genet, 1: 593-598. Herschlag D., and Cech T. R. (1990). DNA
cleavage catalysed by the ribozyme from Tetrahymena. Nature 344:
405-9. Heid C. A., Stevens J., Livak K. J., and Williams P. M.
(1996) Real time quantitative PCR. Genome Research 6: 986-994.
Lizardi P. M., Huang X., Zhu Z., Bray-Ward P., Thomas D. C., and
Ward D. C. (1998). Mutation detection and single-molecule counting
using isothermal rolling-circle amplification. Nature Genet. 19:
225-232. Lyamichev V., Mast A. L., Hall J. G., Prudent J. R.,
Kaiser M. W., Takova T., Kwiatkowski R. W., Sander T. J., de Arruda
M., Arco D. A., Neri B. P., and Brow M. A. D. (1999). Polymorphism
identification and quantitative detection of genomic DNA by
invasive cleavage of oligonucleotide probes. Nat. Biotechnol. 17:
292-296. Nederlof, P. M., van, d. F. S., Vrolijk, J., Tanke, H. J.
and Raap, A. K. (1992) Fluorescence ratio measurements of
double-labeled probes for multiple in situ hybridization by digital
imaging microscopy. Cytometry, 13: 839-845. Nilsson, M., Malmgren,
H., Samiotaki, M., Kwiatkowski, M., Chowdhary, B. P. and Landegren,
U. (1994) Padlock probes: Circularizing oligonucleotides for
localized DNA detection. Science, 265: 2085-2088. Tyagi S., and
Kramer F. R. (1996). Molecular beacons: probes that fluoresce upon
hybridization. Nat. Biotechnol. 14: 303-308.
SEQUENCE LISTINGS
1
17193DNAArtificialSynthetic 1cctcccatca tattaaaggc tttctctatg
ttaagtgacc tacgacctca atgctgctgc 60tgtactactc ttcctaaggc attctgcaaa
cat 93237DNAArtificialSynthetic 2gcctttaata tgggaggatg tttgcagaat
gccttag 37320DNAArtificialSynthetic 3cgtcgtaggt cacttaacat
20419DNAArtificialSynthetic 4gctgctgtac tactctctt
19519DNAArtificialSynthetic 5aagagagtag tacagcagc
19627RNAArtificialSynthetic 6ccucaaugcu gcugcuguac uacgagg
27790DNAArtificialSynthetic 7cctcccatca tattaaaggc tttctctatg
ttaagtgacc tacgacgatg ctgctgctgt 60actactcttc ctaaggcatt ctgcaaacat
90893DNAArtificialSynthetic 8cctcccatca tattaaaggc tttctctatg
ttaagtgacc tacgacctca atgctgctgc 60tgtactactc ttcctaaggc attctgcaaa
cat 93937DNAArtificialSynthetic 9gcctttaata tgggaggatg tttgcagaat
gccttag 371031DNAArtificialSynthetic 10cgcctcaatg ctgctgctgt
actacgaggc g 311127RNAArtificialSynthetic 11ccucaaugcu gcugcuguac
uacgagg 271228DNAArtificialSynthetic 12ggctttctct atgttaagtg
acctacga 281360DNAArtificialSynthetic 13ttgctggctt ttgtctcgta
tcggagcgta cctagatagc gtgcagtcct ctttaatttg
601426DNAArtificialSynthetic 14cgctatctag gtacgctccg atacat
261521DNAArtificialSynthetic 15agaccttggg atactgcacg g
211620DNAArtificialSynthetic 16caattccaca gcctggcact
201721DNAArtificialSynthetic 17ctctatgtta agtgacctac g 21
* * * * *