U.S. patent number RE39,793 [Application Number 09/366,081] was granted by the patent office on 2007-08-21 for compositions for sorting polynucleotides.
This patent grant is currently assigned to Solexa, Inc.. Invention is credited to Sydney Brenner.
United States Patent |
RE39,793 |
Brenner |
August 21, 2007 |
Compositions for sorting polynucleotides
Abstract
The invention provides a method of tracking, identifying, and/or
sorting classes or subpopulations of molecules by the use of
oligonucleotide tags. Oligonucleotide tags of the invention each
consist of a plurality of subunits 3 to 6 nucleotides in length
selected from a minimally cross-hybridizing set. A subunit of a
minimally cross-hybridizing set forms a duplex or triplex having
two or more mismatches with the complement of any other subunit of
the same set. The number of oligonucleotide tags available in a
particular embodiment depends on the number of subunits per tag and
on the length of the subunit. An important aspect of the invention
is the use of the oligonucleotide tags for sorting polynucleotides
by specifically hybridizing tags attached to the polynucleotides to
their complements on solid phase supports. This embodiment provides
a readily automated system for manipulating and sorting
polynucleotides, particularly useful in large-scale parallel
operations, such as large-scale DNA sequencing, mRNA
fingerprinting, and the like, wherein many target polynucleotides
or many segments of a single target polynucleotide are sequenced
simultaneously.
Inventors: |
Brenner; Sydney (La Jolla,
CA) |
Assignee: |
Solexa, Inc. (Hayward,
CA)
|
Family
ID: |
26983370 |
Appl.
No.: |
09/366,081 |
Filed: |
August 2, 1999 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
08358810 |
Dec 19, 1994 |
5604097 |
|
|
|
08322348 |
Oct 13, 1994 |
|
|
|
Reissue of: |
08484712 |
Jun 7, 1995 |
05654413 |
Aug 5, 1997 |
|
|
Current U.S.
Class: |
536/22.1;
435/6.14; 435/91.1; 536/24.1; 536/24.3; 536/23.1; 435/320.1 |
Current CPC
Class: |
C12Q
1/6837 (20130101); C12Q 1/6874 (20130101); C40B
80/00 (20130101); C12Q 1/6834 (20130101); C12N
15/1034 (20130101); C12N 15/10 (20130101); C12N
15/1065 (20130101); B01J 19/0046 (20130101); C12Q
1/6816 (20130101); C12Q 1/6827 (20130101); C12Q
1/6855 (20130101); C12Q 1/6809 (20130101); C07H
21/00 (20130101); C12Q 1/6809 (20130101); C12Q
2565/519 (20130101); C12Q 2525/191 (20130101); C12Q
2521/501 (20130101); C12Q 1/6816 (20130101); C12Q
2523/101 (20130101); C12Q 1/6874 (20130101); C12Q
2565/519 (20130101); C12Q 2525/185 (20130101); C12Q
2521/313 (20130101); C12Q 1/6874 (20130101); C12Q
2565/519 (20130101); C12Q 2525/161 (20130101); C12Q
2521/313 (20130101); C12Q 1/6809 (20130101); C12Q
2565/514 (20130101); C12Q 1/6827 (20130101); C12Q
2565/514 (20130101); C12Q 2563/131 (20130101); C12Q
2561/125 (20130101); C12Q 1/6837 (20130101); C12Q
2565/514 (20130101); C12Q 1/6809 (20130101); C12Q
2565/518 (20130101); C12Q 2563/107 (20130101); C12Q
2563/185 (20130101); C12Q 1/6809 (20130101); C12Q
2525/191 (20130101); C12Q 2565/519 (20130101); C12Q
2521/501 (20130101); C12Q 1/6827 (20130101); C12Q
2565/518 (20130101); C12Q 2563/107 (20130101); C12Q
2563/185 (20130101); C12Q 1/6827 (20130101); C12Q
2521/501 (20130101); C12Q 2525/191 (20130101); C12Q
2565/501 (20130101); C12Q 1/6855 (20130101); C12Q
2565/518 (20130101); C12Q 2565/501 (20130101); C12Q
1/6874 (20130101); C12Q 2521/313 (20130101); C12Q
2565/518 (20130101); C12Q 2525/191 (20130101); C12Q
2565/518 (20130101); C12Q 1/6874 (20130101); C12Q
2565/518 (20130101); C12Q 2525/161 (20130101); C12Q
2521/313 (20130101); C12Q 2521/313 (20130101); C12Q
2525/191 (20130101); C12Q 1/6874 (20130101); C12Q
2521/313 (20130101); C12Q 2525/191 (20130101); C12Q
2565/518 (20130101); C12Q 1/6874 (20130101); C12Q
2565/518 (20130101); C12Q 2525/161 (20130101); C12Q
2521/313 (20130101); B01J 2219/00605 (20130101); B01J
2219/00612 (20130101); B01J 2219/00637 (20130101); C40B
70/00 (20130101); B01J 2219/00722 (20130101); B01J
2219/00626 (20130101); B01J 2219/00572 (20130101); B01J
2219/00659 (20130101); B01J 2219/00648 (20130101); B01J
2219/0061 (20130101); B01J 2219/0063 (20130101); C40B
40/06 (20130101); B01J 2219/00641 (20130101); B01J
2219/005 (20130101) |
Current International
Class: |
C07H
19/00 (20060101); C07H 21/02 (20060101); C07H
21/04 (20060101); C12N 15/09 (20060101); C12Q
1/68 (20060101) |
Field of
Search: |
;435/6,91.1,91.31,320.1,455,468,421
;536/22.1,23.1,24.1,24.3,24.5 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
2036946 |
|
Oct 1991 |
|
CA |
|
0304845 |
|
Jan 1989 |
|
EP |
|
0 303 459 |
|
Feb 1989 |
|
EP |
|
0304845 |
|
Mar 1989 |
|
EP |
|
0 392 546 |
|
Oct 1990 |
|
EP |
|
WO 9003382 |
|
Apr 1990 |
|
WO |
|
WO 9200091 |
|
Jan 1992 |
|
WO |
|
WO 9210587 |
|
Jun 1992 |
|
WO |
|
WO 9210588 |
|
Jun 1992 |
|
WO |
|
WO 9306121 |
|
Apr 1993 |
|
WO |
|
WO 93/06121 |
|
Apr 1993 |
|
WO |
|
WO 9317126 |
|
Sep 1993 |
|
WO |
|
WO 93/17126 |
|
Sep 1993 |
|
WO |
|
WO 9321203 |
|
Oct 1993 |
|
WO |
|
WO 9322680 |
|
Nov 1993 |
|
WO |
|
WO 9322684 |
|
Nov 1993 |
|
WO |
|
WO 9408051 |
|
Apr 1994 |
|
WO |
|
WO 9520053 |
|
Jul 1995 |
|
WO |
|
Other References
Crick et al., Codes Without Commas, Proc. Natl. Acad. Sci., vol.
43, pp. 416-421 (1957). cited by examiner .
Matteucci et al, "Targeted random mutagenesis: the use of
ambiguously synthesized oligonucleotides to mutagenize sequences
immediately 5' of an ATG initiation codon," Nucleic Acids Research,
11: 3113-3121 (1983). cited by other .
Gronostajski, "Site-specific DNA binding of nuclear factor I:
effect of the spacer region," Nucleic Acids Research, 15: 5545-5560
(1987). cited by other .
Gingeras et al, "Hybridization properties of immobilized nucleic
acids," Nucleic Acids Research, 15: 5373-5390 (1987). cited by
other .
Raineri et al, "Improved efficiency for single-sided PCR by
creating a reusable pool of first-strand cDNA coupled to a solid
phase," Nucleic Acids Research, 19: 4010 (1991). cited by other
.
Lee et al, "Reusable cDNA libraries coupled to magnetic beads,"
Anal. Biochem., 206: 206-207 (1992). cited by other .
Bunemann et al, "Immobilization of denatured DNA to macroporous
supports: I. Efficiency of different coupling procedures," Nucleic
Acids Research, 10: 7163-7181 (1982). cited by other .
Lund et al, "Assessment of methods for covalent binding of nucleic
acids to magnetic beads, DynabeadsTM, and the characteristics of
the bound nucleic acids in hybridization reactions," Nucleic Acids
Research, 16: 10861-10880 (1988). cited by other .
Ghosh et al, "Covalent attachment of oligonucleotides to solid
supports," Nucleic Acids Research, 15: 5353-5373 (1987). cited by
other .
Wolf et al, "Rapid hybridization kinetics of DNA attached to
submicron latex particles," Nucleic Acids Research, 15: 2911-2927
(1987). cited by other .
Kremsky et al, "Immobilization of DNA via oligonucleotides
containing an aldehyde or carboxylic acid group at the 5'
terminus," Nucleic Acids Research, 15: 2891-2909 (1987). cited by
other .
Vlieger et al, "Quantitation of polymerase chain reaction products
by hybridization-based assays with fluorescent, colorimetric, or
chemiluminescent detection," Anal. Biochem., 205: 1-7 (1992). cited
by other .
Huang et al, "Binding of biotinylated DNA to streptavidin-coated
polystyrene latex," Anal. Biochem., 222: 441-449 (1994). cited by
other .
Ohlemeyer et al, "Complex synthetic chemical libraries indexed with
molecular tags," Proc. Natl. Acad. Sci., 90: 10922-10926 (1993).
cited by other .
Maskos and Southern, "Oligonucleotide hybridizations on glass
supports: a novel linker for oligonucleotide synthesis and
hybridization properties of oligonucleotides synthesized in situ,"
Nucleic Acids Research, 20: 1679-1684 (1992). cited by other .
Matthews and Kricka, "Analytical strategies for the use of DNA
probes," Anal. Biochem. 169: 1-25 (1988). cited by other .
Broude et al., "Enhanced DNA sequencing by hybridization," Proc.
Natl. Acad. Sci. 91: 3072-3076 (1994). cited by other .
Nielsen et al., "Synthesis methods for the implementation of
encoded combinatorial chemistry," J. Am. Chem. Soc. 115: 9812-9813
(1993). cited by other .
Needels et al, "Generation and screening of an
oligonucleotide-encoded synthetic peptide library," Proc. Natl.
Acad. Sci., 90: 10700-10704 (1993). cited by other .
Chetverin et al, "Oligonucleotide arrays: New concepts and
possibilities," Biotechnology, 12: 1093-1099 (1994). cited by other
.
Yang and Youvan, "A prospectus for multipspectral-multiplex DNA
sequencing," Biotechnology, 7: 576-580 (1989). cited by other .
Church et al, "Multiplex DNA Sequencing" Science, 240: 185-188
(1988). cited by other .
Beck et al, "A strategy for the amplification, purification, and
selection of M13 templates for large-scale DNA sequencing,"
Analytical Biochemsitry, 212: 498-505 (1993). cited by other .
Ji and Smith, "Rapid purification of double-stranded DNA by
triple-helix-mediated affinity capture," Anal. Chem., 65: 1323-1328
(1993). cited by other .
Brown et al, "A new base-stable linker for solid-phase
oligonucletide synthesis," J. Chem. Soc. Commun. 1989: 891-893.
cited by other .
Oliphant et al, "Cloning of random-sequence oligodeoxynucleotides,"
Gene, 44: 177-183 (1986). cited by other .
Hunkapiller et al, "Large-scale and automated DNA sequence
determination," Science, 254: 59-67 (1991). cited by other .
Coche et al, "Reducing bias in cDNA sequence representation by
molecular selection, " Nucleic Acids Research, 22: 4545-4546
(1994). cited by other .
Kuijper et al, "Functional cloning vectors for use in directional
cDNA cloning using cohesive ends produced with T4 DNA polymerase,"
Gene, 112: 147-155 (1992). cited by other .
Aslanidis et al, "Ligation-independent cloning of PCR products
(LIC-PCR)," Nucleic Acids Research, 18: 6069-6074 (1990). cited by
other .
Wetmur, "DNA probes: applications of the principles of nucleic acid
hybridization," Critical Reviews in Biochemistry and Molecular
Biology, 26: 227-259 (1991). cited by other .
Egholm et al, "PNA hybridizes to complementary oligonucleotides
obeying the Watson-Crick hydrogen-bonding rules," Nature, 365:
566-568 (1993). cited by other .
Gryaznov et al, "Modulation of oligonucleotide duplex and triplex
stability via hydrophobic interactions," Nucleic Acids Research,
21: 5909-5915 (1993). cited by other .
Brenner et al., "Encoded combinatorial chemistry", Proc. Natl.
Acad. Sci. USA, 89: 5381-5383. Jan. 1992. cited by other.
|
Primary Examiner: Zara; Jane
Attorney, Agent or Firm: Gorthey; LeeAnn Perkins Coie
LLP
Parent Case Text
This is a continuation of U.S. patent application Ser. No.
08/358,810 filed 19 Dec. 1994, which is a continuation-in-part of
U.S. patent application Ser. No. 08/322,348 filed 13 Oct. 1994, now
abandoned, which application is incorporated by reference.
Claims
I claim:
1. A composition of matter comprising: a solid phase support having
one or more spacially discrete regions; and a .[.uniform.].
population of .[.substantially.]. identical oligonucleotide tag
complements covalently attached to the solid phase support in at
least one of the one or more spacially discrete regions, the
oligonucleotide tag complements comprising a plurality of subunits,
each subunit consisting of an oligonucleotide having a length from
three to six nucleotides and each subunit being selected from a
minimally cross-hybridizing set, wherein a subunit of the set and a
component of any other subunit of the set would have at least two
mismatches.
2. The composition of matter of claim 1 wherein said plurality of
said subunits is in the range of from 4 to 10.
3. The composition of matter of claim 2 wherein said solid phase
support is a microparticle having a single spacially discrete
region.
4. The composition of matter of claim 3 wherein said
microparticle.[.s.]. is selected from the group consisting of glass
microparticles, magnetic beads, and polystyrene microparticles.
.Iadd.5. A composition of matter comprising a plurality of from ten
thousand to a hundred thousand different polynucleotides, selected
from cDNA molecules or fragments of a target polynucleotide to be
analyzed or sequenced, said composition including a mixture of
microparticles, wherein each microparticle has identical
polynucleotides of the plurality attached thereto, and wherein
substantially all different polynucleotides in the plurality are
attached to different microparticles. .Iaddend.
.Iadd.6. The composition of claim 5 wherein each microparticle has
about 10.sup.5 identical polynucleotides attached thereto.
.Iaddend.
.Iadd.7. A composition of matter comprising a plurality of
different polynucleotides, selected from cDNA molecules or
fragments of a target polynucleotide to be analyzed or sequenced,
said composition including a mixture of microparticles, wherein tag
complements are attached to each said microparticle, and wherein
each said cDNA molecule or fragment has an oligonucleotide tag
attached, such that substantially all the same molecules have the
same oligonucleotide tag attached and substantially all different
molecules have different oligonucleotide tags attached, such that
perfectly matched duplexes are formed between the tag complements
of said microparticles and the oligonucleotide tags of said cDNA
molecules or fragments, whereby, each microparticle has identical
polynucleotides of the plurality attached thereto, and
substantially all different polynucleotides in the plurality are
attached to different microparticles. .Iaddend.
Description
FIELD OF THE INVENTION
The invention relates generally to methods for identifying,
sorting, and/or tracking molecules, especially polynucleotides,
with oligonucleotide labels, and more particularly, to a method of
sorting polynucleotides by specific hybridization to
oligonucleotide tags.
BACKGROUND
Specific hybridization of oligonucleotides and their analogs is a
fundamental process that is employed in a wide variety of research,
medical, and industrial applications, including the identification
of disease-related polynucleotides in diagnostic assays, screening
for clones of novel target polynucleotides, identification of
specific polynucleotides in blots of mixtures of polynucleotides,
amplification of specific target polynucleotides, therapeutic
blocking of inappropriately expressed genes. DNA sequencing, and
the like, e.g. Sambrook et at, Molecular Cloning: A Laboratory
Manual 2nd Edition (Cold Spring Harbor Laboratory, New York, 1989);
Keller and Manak, DNA Probes, 2nd Edition (Stockton Press, New
York, 1993); Milligan et al. J. Med. Chem., 36: 1923-1937 (1993);
Drmanac et al, Science, 260: 1649-1652 (1993); Bains, J. DNA
Sequencing and Mapping, 4: 143-150 (1993).
Specific hybridization has also been proposed as a method of
tracking, retrieving, and identifying compounds labeled with
oligonucleotide tags. For example, in multiplex DNA sequencing
oligonucleotide tags are used to identify electrophoretically
separated bands on a gel that consist of DNA fragments generated in
the same sequencing reaction. In this way, DNA fragments from many
sequencing reactions are separated on the same length of a gel
which is then blotted with separate solid phase materials on which
the fragment bands from the separate sequencing reactions are
visualized with oligonucleotide probes that specifically hybridize
to complementary tags, Church et al. Science, 240: 185-188 (1988).
Similar uses of oligonucleotide tags have also been proposed for
identifying explosive, potentially pollutants, such as crude oil,
and currency for prevention and detection of counterfeiting, e.g.
reviewed by Dollinger, pages 265-274 in Mullis et al, editors. The
Polymerase Chain Reaction (Birkhauser, Boston, 1994). More
recently, systems employing oligonucleotide tags have also been
proposed as a means of manipulating and identifying individual
molecules in complex combinatorial chemical libraries, for example,
as an aid to screening such libraries for drug candidates, Brenner
and Lerner, Proc. Natl. Acad. Sci. 89: 5381-5383 (1992); Alper,
Science, 264: 1399-1401 (1994); and Needels et al, Proc. Natl.
Acad. Sci., 90: 10700-10704 (1993)
The successful implementation of such tagging schemes depends in
large part on the success in achieving specific hybridization
between a tag and its complementary probe. That is, for an
oligonucleotide tag to successfully identify a substance, the
number of false positive and false negative signals must be
minimized. Unfortunately, such spurious signals are not uncommon
because base pairing and base stacking free energies vary widely
among nucleotides in a duplex or triplex structure. For example, a
duplex consisting of a repeated sequence of deoxyadenine (A) and
thymidine (T) bound to its complement may have less stability than
an equal-length duplex consisting of a repeated sequence of
deoxyguanidine (G) and deoxycytidine (C) bound to a partially
complementary target containing a mismatch. Thus, if a desired
compound from a large combinatorial chemical library were tagged
with the former oligonucleotide, a significant possibility would
exist that, under hybridization conditions designed to detect
perfectly matched AT-rich duplexed, undesired compounds labeled
with the GC-rich oligonucleotide--even in a mismatched
duplex--would be detected along with the perfectly matched duplexes
consisting of the AT-rich tag. In the molecular tagging system
proposed by Brenner et al (cited above), the related problem of
mis-hybridizations of closely related tags was addressed by
employing a so-called "commaless" code, which ensures that a probe
out of register (or frame shifted) with respect to its
complementary tag would result in a duplex with one or more
mismatches for each of its five or more three-base words, or
"codons."
Even though reagents, such as tetramethylammonium chloride, are
available to negate base-specific stability differences of
oligonucleotide duplexes, the effect of such reagents is often
limited and their presence can be incompatible with, or render more
difficult, further manipulations of the selected compounds, e.g.
amplification by polymerase chain reaction (PCR) or the like.
Such problems have made the simultaneous use of multiple
hybridization probes in the analysis of multiple or complex genetic
loci e.g. via multiplex PCR, reverse dot blotting, or the like,
very difficult. As a result, direct sequencing of certain loci,
e.g. HLA genes, has been promoted as a reliable alternative to
indirected methods employing specific hybridization for the
identification of genotypes, e.g. Gyllensten et al, Proc. Nat.
Acad. Sci., 85: 7652-7656 (1988).
The ability to sort cloned and identically tagged DNA fragments
onto distinct solid phase supports would facilitate such
sequencing, particularly when coupled with a non gel-based
sequencing methodology simultaneously applicable to many samples in
parallel.
In view of the above, it would be useful if there were available an
oligonucleotide-based tagging system which provided a large
repertoire of tags, but which also minimized the occurrence of
false positive and false negative signals without the need to
employ special reagents for altering natural base pairing and base
stacking free energy differences. Such a tagging system would find
applications in many areas, including construction and use of
combinatorial chemical libraries, large-scale mapping and
sequencing of DNA, genetic identification, medical diagnosis, and
the like.
SUMMARY OF THE INVENTION
An object of my invention is to provide a molecular tagging system
for tracking, retrieving, and identifying compounds.
Another object of my invention is to provide a method for sorting
identical molecules, or subclasses of molecules, especially
polynucleotides, onto surfaces of solid phase materials by the
specific hybridization of oligonucleotide tags and their
complements.
A further object of my invention is to provide a combinatorial
chemical library whose member compounds are identified by the
specific hybridization of oligonucleotide tags and their
complements.
A still further object of my invention is to provide a system for
tagging and sorting many thousands of fragments, especially
randomly overlapping fragments, of a target polynucleotide for
simultaneous analysis and/or sequencing.
Another object of my invention is to provide a rapid and reliable
method for sequencing target polynucleotides having a length in the
range of a few hundred basepairs to several tens of thousands of
basepairs.
My invention achieve these and other objects by providing a method
and materials for tracking, identifying, and/or sorting classes or
subpopulations of molecules by the use of oligonucleotide tags. An
oligonucleotide tag of the invention consists of a plurality of
subunits, each subunit consisting of an oligonucleotide of 3 to 6
nucleotides in length. Subunits of an oligonucleotide tag are
selected from a minimally cross-hybridizing set. In such a set, a
duplex or triplex consisting of a subunit of the set and the
complement of any other subunit of the set contains at least two
mismatches. In other words, a subunit of a minimally
cross-hybridizing set at best forms a duplex or triplex having two
mismatches with the complement of any other subunit of the same
set. The numbers of oligonucleotide tags available in a particular
embodiment depends on the number of subunits per tag and on the
length of the subunit. The number is generally much less than the
number of all possible sequences the length of the tag which for a
tag nucleotides long would be 4.sup.n. More preferably, subunits
are oligonucleotides from 4 to 5 nucleotides in length.
In one aspect of my invention, complements of oligonucleotide tags
attached to a solid phase support are used to sort polynucleotides
from a mixture of polynucleotides each containing a tag. In this
embodiment, complements of the oligonucleotide tags are synthesized
on the surface of a solid phase support, such as a microscopic bead
or a specific location on an array of synthesis locations on a
single support such that populations of identical sequences are
produced in specific regions. That is, the surface of each support
in the case of a bead, or of each region, in the case of an array,
is derivatized by only one type of complement which has a
particular sequence. The population of such beads or regions
contains a repertoire of complements with distinct sequences, the
size of the repertoire depending on the number of subunits per
oligonucleotide tag and the length of the subunits employed.
Similarly, the polynucleotides to be sorted each comprises an
oligonucleotide tag in the repertoire, such that identical
polynucleotides have the same tag and different polynucleotides
have different tags. Thus, when the populations of supports and
polynucleotides are mixed under conditions which permit specific
hybridization of the oligonucleotide tags with their respective
complements, subpopulations of identical polynucleotides are sorted
onto particular beads or regions. The subpopulations of
polynucleotides can then be manipulated on the solid phase support
by micro-biochemical techniques.
Generally, the method of my invention comprises the following
steps: (a) attaching an oligonucleotide tag from a repertoire of
tags to each molecule in a population of molecules (i) such that
substantially all the same molecules or same subpopulation of
molecules in the population have the same oligonucleotide tag
attached and substantially all different molecules or different
subpopulations of molecules in the population have different
oligonucleotide tags attached and (ii) such that each
oligonucleotide tag from the repertoire comprises a plurality of
subunits and each subunit of the plurality consists of an
oligonucleotide having a length from three to six nucleotides or
from three to six basepairs, the subunits being selected from a
minimally cross-hybridizing set; and (b) sorting the molecules or
subpopulations of molecules of the population by specifically
hybridizing the oligonucleotide tags with their respective
complements.
An important aspect of my invention is the use of the
oligonucleotide tags to sort polynucleotides for parallel sequence
determination. Preferably, such sequencing is carried out by the
following steps: (a) generating from the target polynucleotide a
plurality of fragments that cover the target polynucleotide; (b)
attaching an oligonucleotide tag from a repertoire of tags to each
fragment of the plurality (i) such that substantially all the same
fragments have the same oligonucleotide tag attached and
substantially all different fragments have different
oligonucleotide tags attached and (ii) such that each
oligonucleotide tag from the repertoire comprises a plurality of
subunits and each subunit of the plurality consists of an
oligonucleotide having a length from three to six nucleotides or
from three to six basepairs, the subunits being selected from a
minimally cross-hybridizing set; sorting the fragments by
specifically hybridizing the oligonucleotide tags with their
respective complements; (c) determining the nucleotide sequence of
a portion of each of the fragments of the plurality, preferably by
a single-base sequencing methodology as described below; and (d)
determining the nucleotide sequence of he target polynucleotide by
collating the sequences of the fragments.
My invention overcomes a key deficiency of current methods of
tagging or labeling molecules with oligonucleotides: By coding the
sequences of the tags in accordance with the invention, the
stability of any mismatched duplex or triplex between a tag and
complement to another tag is far lower than that of any preferably
matched duplex between the tag and its own complement. Thus, the
problem of incorrect sorting because of mismatch duplexes of
GC-rich tags being more stable than perfectly matched AT-rich tags
is eliminated.
When used in combination with solid phase supports, such as
microscopic beads, my invention provides a readily automated system
for manipulating and sorting polynucleotides, particularly useful
in large-scale parallel operations, such as large-scale DNA
sequencing, wherein many target polynucleotides or many segments of
a single target polynucleotide are sequenced and/or analyzed
simultaneously.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1a-1c illustrates structures of labeled probes employed in a
preferred method of "single base" sequencing which may be used with
the invention.
FIG. 2 illustrates the relative positions of the nuclease
recognition site, ligation site, and cleavage site in a ligated
complex (SEQ. ID NO:16) formed between a target polynucleotide and
a probe used in a preferred "single base" sequencing method.
FIG. 3 is a flow chart illustrating a general algorithm for
generating minimally cross-hybridizing sets.
FIG. 4 illustrates a scheme for synthesizing and using a
combinatorial chemical library in which member compounds are
labeled with oligonucleotide tags in accordance with the
invention.
FIG. 5 diagrammatically illustrates an apparatus for carrying out
parallel operations, such as polynucleotide sequencing, in
accordance with the invention.
DEFINITIONS
"Complement" or "tag complement" as used herein in reference to
oligonucleotide tags refers to an oligonucleotide to which a
oligonucleotide tag specifically hybridizes to form a perfectly
matched duplex or triplex. In embodiments where specific
hybridization results in a triplex, the oligonucleotide tag may be
selected to be either double stranded or single stranded. Thus,
where triplexes are formed, the term "couplement" is meant to
encompass either a double stranded complement of a single stranded
oligonucleotide tag or a single stranded complement of a double
stranded oligonucleotide tag.
The term "oligonucleotide" as used herein includes linear oligomers
of natural or modified monomers or linkages, including
deoxyribonucleosides, ribunucleosides, .alpha.-anomeric forms
thereof, peptide nucleic acids (PNAs), and the like, capable of
specifically binding to a target polynucleotide by way of a regular
pattern of monomer-to-monomer interactions, such as Watson-Crick
type of base pairing, base stacking. Hoogsteen or reverse Hoogsteen
types of base pairing, or the like. Usually monomers are linked by
phosphodiester bonds or analogs thereof to form oligonucleotides
ranging in size from a few monomeric units, e.g., 3-4, to several
tens of monomeric units. Whenever an oligonucleotide is represented
by a sequence of letters, such as "ATGCCTG," it will be understood
that the nucleotides are in 5'.fwdarw.3' order from left to right
and that "A" denotes deoxyadenosine, "C" denotes deoxycytidine, "G"
denotes deoxyguanosine, and "T" denotes thymidine, unless otherwise
noted. Analogs of phosphodiester linkages include phosphorothioate,
phosphorodithioate, phosphoramilidate, phosphoramidiate, and the
like. Usually oligonucleotides of the invention comprise the four
natural nucleotides; however, they may also comprise non-natural
nucleotide analogs. It is clear to those skilled in the art when
oligonucleotides having natural or non-natural nucleotides may be
employed, e.g. where processing by enzymes is called for, usually
oligonucleotides consisting of natural nucleotides are
required.
"Perfectly matched" in reference to a duplex means that the poly-
or oligonucleotide strands making up the duplex form a double
stranded structure with one other such that every nucleotide in
each strand undergoes Watson-Crick basepairing with a nucleotide in
the other strand. The term also comprehends the pairing of
nucleoside analogs, such as deoxyinosine, nucleosides with
2-aminopurine bases, and the like, that may be employed. In
reference to a triplex, the term means that the triplex consists of
a perfectly matched duplex and a third strand in which every
nucleotide undergoes Hoogsteen or reverse Hoogsteen association
with a basepair of the perfectly matched duplex. Conversely, a
"mismatch" in a duplex between a tag and an oligonucleotide means
that a pair or triplet of nucleotides in the duplex or triplex
fails to undergo Watson-Crick and/or Hoogsteen and/or reverse
Hoogsteen bonding.
As used herein, "nucleoside" includes the natural nucleosides,
including 2'-deoxy and 2'-hydroxyl forms, e.g. as described in
Kornberg and Baker, DNA, Replication, 2nd Ed. (Freeman, San
Francisco, 1992), "Analogs" in reference to nucleosides includes
synthetic nucleosides having modified base moieties and/or modified
sugar modified, e.g. described by Scheti, Nucleotide Analogs (John
Wiley, New York, 1980) Uhlman and Peyman Chemical Review, 90:
543-584 (1990), or the like, with the only proviso that they are
capable of specific hybridization. Such analogs include synthetic
nucleosides designed to enhance binding properties, reduce
degeneracy, increase specificity, and the like.
DETAILED DESCRIPTION OF THE INVENTION
The invention provides a method of labeling and sorting molecules,
particularly polynucleotides, by the use of oligonucleotide tags.
The oligonucleotide tags of the invention comprise a plurality of
"words" or subunits, selected from minimally cross-hybridizing sets
of subunits. Subunits of such sets cannot form a duplex or triplex
with the complement of another subunit of the same set with less
than two mismatched nucleotides. Thus, the sequences of any two
oligonucleotide tags of a repertoire that form duplexes will never
be "closer" than differing by two nucleotides. In particular
embodiments sequences of any two oligonucleotide tags of a
repertoire can be even "further" apart, e.g. by designing a
minimally cross-hybridizing set such that subunits cannot form a
duplex with the complement of another subunit of the same set with
less than three mismatched nucleotides, and so on. The invention is
particularly useful in labeling and sorting polynucleotides for
parallel operations, such as sequencing, fingerprinting or other
types of analysis.
Constructing Oligonucleotide Tags From Minimally Cross-Hybridizing
Sets of Subunits
The nucleotide sequences of the subunits for any minimally
cross-hybridizing set are conveniently enumerated by simple
computer programs following the general algorithm illustrated in
FIG. 3, and as exemplified by program minhx whose source code is
listed in Appendix L minhx computes all minimally cross-hybridizing
sets having subunits composed of three kinds of nucleotides and
having length of four.
The algorithm of FIG. 3 is implemented by first defining the
characteristic of the subunits of the minimally cross-hybridizing
set, i.e. length, number of base differences between members, and
composition, e.g. do the consist of two, three, or four kinds of
bases. A table M.sub.n, n=1, is generated (100) that consists of
all possible sequences of a given length and composition. An
initial subunit S.sub.1 is selected and compared (120) with
successive subunits S.sub.2 for i=n+1 to the end of the cable.
Whenever a successive subunit has the required number of mismatches
to be a member of the minimally cross-hybridizing set, it is saved
in a new table M.sub.n+1 (125), that also contains subunits
previously selected in prior passes through step 120. For example,
in the first set of comparisons, M.sub.2 will contain S.sub.1; in
the second set of comparisons, M.sub.3 will contain S.sub.1 and
S.sub.2; in the third set of comparisons, M.sub.4 will contain
S.sub.1, S.sub.2, and S.sub.3; and so on. Similarly, comparisons in
table M.sub.j will be between S.sub.j and all successive subunits
in M.sub.j. Note that each successive table M.sub.n+1 is smaller
than its predecessors as subunits are eliminated in successive
passes through step 130. After every subunit of table M.sub.n has
been compared (140) the old table is replaced by the new table
M.sub.n+1, and the next round of comparisons are begun. The process
stops (160) when a table M.sub.n is reached that contains no
successive subunits to compare to the selected subunit S.sub.i,
i.e. M.sub.n=M.sub.n+1.
Preferably, minimally cross-hybridizing sets comprise subunits that
make approximately equivalent contributions to duplex stability as
every other subunit in the set. In this way, the stability of
perfectly matched duplexes between every subunit and its complement
is approximately equal. Guidance for selecting such sets is
provided by published techniques for selecting optimal PCR primers
and calculating duplex stabilities, e.g. Rychlik et al. Nucleic
Acids Research, 17: 8543-8551 (1989) and 18: 6409-6412 (1990);
Breslauer et al, Proc. Natl. Acad. Sci., 83: 3746-3750 (1986);
Wetmur, Crit. Rev. Biochem. Mol. Biol., 26: 227-259 (1991); and the
like. For shorter tags, e.g. about 30 nucleotides or less, the
algorithm described by Rychlik and Wetmur is preferred, and for
longer tags, e.g. about 30-35 nucleotides or greater, and algoithm
disclosed by Suggs et al, pages 683-693 in Brown, editor, ICN-UCLA
Syrup. Dev. Biol., Vol. 23 (Academic Press, New York, 1981) may be
conveniently employed.
A preferred embodiment of minimally cross-hybridizing sets are
those whose subunits are made up of three of the four natural
nucleotides. As will be discussed more fully below, the absence of
one type of nucleotide in the oligonucleotide tags permits target
polynucleotides to be loaded onto solid phase supports by use of
the 5'.fwdarw.3' exonuclease activity era DNA polymerase. The
following is an exemplary minimally cross-hybridizing set of
subunits each comprising four nucleotides selected from the group
consisting of A, G, and T:
TABLE-US-00001 TABLE I Word: W.sub.1 W.sub.2 W.sub.3 W.sub.4
Sequence: GATT TGAT TAGA TTTG Word: W.sub.5 W.sub.6 W.sub.7 W.sub.8
Sequence: GTAA AGTA ATGT AAAG
In this set, each member would form a duplex having three
mismatched bases with the component of every other member.
Further exemplary minimally cross-hybridizing sets are listed below
in Table I. Clearly, additional sets can be generated by
substituting different groups of nucleotides, or by using subsets
of known minimally cross-hybridizing sets.
TABLE-US-00002 TABLE II Exemplary Minimally Cross-Hybridizing Sets
of 4-mer Subunits CATT ACCC AAAC AAAG AACA AACG CTAA AGGG ACCA ACCA
ACAC ACAA TCAT CACG AGGG AGGC AGGG AGGC ACTA CCGA CACG CACC CAAG
CAAC TACA CGAC CCGC CCGG CCGC CCGG TTTC GAGC CGAA CGAA CGCA CGCA
ATCT GCAG GAGA GAGA GAGA GAGA AAAC GGCA GCAG GCAC GCCG GCCC AAAA
GGCC GGCG GGAC GGAG AAGA AAGC AAGG ACAG ACCG ACGA ACAC ACAA ACAA
AACA AAAA AAAC AGCG AGCG AGCC AGGC AGGC AGCG CAAG CAAG CAAC CAAC
CACC CACA CCCA CCCC CCCG CCGA CCGA CACA CGGC CGGA CGGA CGCG CGAG
CGGC GACC GACA GACA GAGG GAGG GAGG GCGG GCGG GCGC GCCC GCAC GCCC
GGAA GGAC GGAG GGAA GGCA GGAA
The oligonucleotide tags of the invention and their complements are
conveniently synthesized on an automated DNA synthesizer, e.g. an
Applied Biosystems, Inc. (Foster City, Calif.) model 392 or 394
DNA/RNA Synthesizer, using 6 standard chemistries, such as
phosphoramidiate chemistry, e.g. disclosed in the following
references: Beaucage and Iyer. Tetrahedron, 48: 2223.varies.2311
(1992); Moltco et al, U.S. Pat. No. 4,980,460; Koster et al, U.S.
Pat. No. 4,725,677; Caruthers et al, U.S. Pat. Nos. 4,415,732;
4,458,066; and 4,973,679; and the like. Alternative chemistries,
e.g. resulting in non-natural backbone groups, such as
phosphorothioate, phosphoramidate, and the like, may also be
employed provided that the resulting oligonucleotides are capable
of specific hybridization. In some embodiments, tags may comprise
naturally occurring nucleotides that permit processing or
manipulation by enzymes, while the corresponding tag complements
may comprise non-natural nucleotide analogs, such as peptide
nucleic acids, or like compounds, that promote the formation of
more stable duplexes during sorting.
When microparticles are used as supports, repertoires of
oligonucleotide tags and tag complements are preferably generated
by subunit-wise synthesis via "split and mix" techniques e.g. as
disclosed in Shortle et al, International patent application
PCT/US93/03418. Briefly, the basic unit of the synthesis is a
subunit of the oligonucleotide tag. Preferably, phosphoramidiate
chemistry is used and 3' phosphoramidiate oligonucleotides are
prepared for each subunit in a minimally cross-hybridizing set,
e.g. for the set first listed above, there would be eight 4-mer
3'-phosphoramidites. Synthesis proceeds as disclosed by Shortle et
al of in direct analogy with the techniques employed to generate
diverse oligonucleotide libraries using nucleosidic monomers, e.g.
as disclosed in Telenius et al, Genomics, 13: 718-725 (1992); Welsh
et al, Nucleic Acids Research, 19: 5275-5279 (1991); Grothues et
al, Nucleic Acids Research, 21: 1321-1322 (1993); Hartley, European
patent application 90304496.4; Lam et al. Nature; 354: 82-84
(1991); Zuckerman et al, Int. J. Pept. Protein Research, 40:
498-507 (1992) and the like. Generally, these techniques simply
call for fine application of mixtures of the activated monomers to
the growing oligonucleotide during the coupling steps.
Double standard forms of tags are made by separately synthesized
the complementary strands followed by mixing under conditions that
permit duplex formation. Such duplex tags may then be inserted into
cloning vectors along with target polynucleotides for sorting and
manipulation of the target polynucleotide in accordance with the
invention.
In embodiments where specific hybridization occurs via triplex
formation, coding of tag sequences follows the same principles as
for duplex-forming tags; however, there are further constraints on
the selection of subunit sequences. Generally, third strand
association via Hoogsteen type of binding is most stable along
homopyrimidine-homopurine tracks in a double stranded target.
Usually, base triplets form in T-A*T or C-G*C motifs (where "-"
indicates Watson-Crick pairing and "*" indicates Hoogsteen type of
binding); however, other motifs are also possible. For example,
Hoogsteen base pairing permits parallel and antiparallel
orientations between the third strand (the Hoogsteen strand) and
the purine-rich strand of the duplex to which the third strand
binds, depending on conditions and the composition of the strands.
There is extensive guidance in the literature for selecting
appropriate sequences, orientation, conditions, nucleoside type
(e.g. whether ribose or deoxyribose nucleosides are employed). base
modifications (e.g. methylated cytosine, and the like) in order to
maximize, or otherwise regulate, triplex stability as desired in
particular embodiments, e.g. Roberts et al, Proc. Natl. Acad. Sci.
88: 9397-9401 (1991); Roberts et al, Science, 258: 1463-1466
(1992); Distefano et al, Proc. Natl. Acad. Sci. 90: 1179-1183
(1993); Mergny et al, Biochemistry, 30: 9791-9798 (1991); Cheng et
al, J. Am. Chem. Soc., 114: 4465-4474 (1992); Beal and Dervan,
Nucleic Acids Research, 20: 2773-2776 (1992); Beal and Dervan, J.
Am. Chem. Soc, 114: 4976-4982 (1992); Giovannangeli et al, Proc.
Natl. Acad. Sci. 89: 8631-8635 (1992); Moser and Dervan, Science,
238: 645-650 (1987); McShan et al, J. Biol. Chem., 267: 5712-5721
(1992); Yoon et al, Proc. Natl. Acad. Sci., 89: 3840-3844 (1992);
Blume et al, Nucleic Acids Research, 20: 1777-1784 (1992); Thuong
and Helene, Angew. Chem. Int. Ed. Engl. 32: 666-690 (1993); and the
like. Conditions for annealing single-stranded or duplex tags to
their single-stranded or duplex complements are well known, e.g. Ji
et al, Anal. Chem. 65: 1323-1328 (1993).
Oligonudeotide tags of the invention may range in length from 12 to
60 nucleotides or basepairs. Preferably, oligonucleotide tags range
in length from 18 to 40 nucleotides or basepairs. More preferably,
oligonucleotide tags range in length from 25 to 40 nucleotides or
basepairs. Most preferably, oligonucleotide tags are single
stranded and specific hybridizing occurs via Watson-Crick pairing
with a tag complement.
Attaching Tags to Molecules
Oligonucleotide tags may be attached to many different classes of
molecules by a variety of reactive functionalities well known in
the art; e.g. Haugland, Handbook of Fluorescent Probes and Research
Chemicals (Molecular Probes, Inc. Eugene, 1992); Khanna et al, U.S.
Pat. No. 4,318,846; or the like. Table III provides exemplary
functionalities and counterpart reactive groups that may reside on
oligonucleotide tags or the molecules of interest. When the
functionalities and counterpart reactants are reacted together,
after activation in some cases, a linking group is formed.
Moreover, as described more fully below, tags may be synthesized
simultaneously with the molecules undergoing selection to form
combinatorial chemical libraries.
TABLE-US-00003 TABLE III Reactive Functionalities and Their
Counterpart Reactants and Resulting Linking Groups Reactive
Counterpart Linking Functionality Functionality Group --NH.sub.2
--COOH --CO--NH-- --NH.sub.2 --NCO --NHCONH-- --NH.sub.2 --NCS
--NHCSNH-- --NH.sub.2 ##STR00001## ##STR00002## --SH
--C.dbd.C--CO-- --S--C--C--CO-- --NH.sub.2 --CHO --CH.sub.2NH--
--NH.sub.2 --SO.sub.2Cl --SO.sub.2NH-- --OH
--OP(NCH(CH.sub.3).sub.2).sub.2 --OP(.dbd.O)(O)O-- --OP(.dbd.O)(O)S
--NHC(.dbd.O)CH.sub.2Br --NHC(.dbd.O)CH.sub.2SP(.dbd.O)(O- )O--
A class of molecules particularly convenient for the generation of
combinatorial chemical libraries includes linear polymeric
molecules of the form: --(M--L).sub.n-- wherein L is a linker
moiety and M is a monomer that may selected from a wide range of
chemical structures to provide a range of functions from serving as
an inert non-sterically hindering spacer moiety to providing a
reactive functionality which can serve as a branching point to
attach other components, a site for attaching labels; a site for
attaching oligonucleotides or other binding polymers for
hybridizing or binding to a therapeutic target; or as a site for
attaching other groups for affecting solubility, promotion of
duplex and/or triplex formation, such as intercalators, alkylating
agents, and the like. The sequence, and therefore composition, of
such linear polymeric molecules may be encoded within a
polynucleotide attached to the tag, as taught by Brenner and Lener
(cited above). However, after a selection event, instead of
amplifying then sequencing the tag of the selected molecule, the
tag itself or an additional coding segment can be sequenced
directly--using a so-called "single base" approach described
below--after releasing the molecule of interest, e.g. by
restriction digestion of a site engineered into the tag. Clearly,
any molecule produced by a sequence of chemical reaction steps
compatible with the simultaneous synthesis of the tag moieties can
be used in the generation of combinatorial libraries.
Conveniently there is a wide diversity of phosphate-linked monomers
available for generating combinatorial libraries. The following
references disclose several phosphoramidite and/or hydrogen
phosphonate monomers suitable for use in the present invention and
provide guidance for their synthesis and inclusion into
oligonucleotides: Newton et al, Nucleic Acids Research, 21:
1155-1162 (1993); Griffin et al, J. Am. Chem. Soc, 114: 7976-7982
(1992); Jaschke et al, Tetrahedron Letters, 34: 301-304 (1992); Ma
et al, International application PCT/CA92/00423; Zon et al,
International application PCT/US90/06630; Durand et al, Nucleic
Acids Research, 18: 6353-6359 (1990); Salunkhe et al, J. Am. Chem.
Soc., 114: 8768-8772 (1992); Urdea et al, U.S. Pat. No. 5,093,232;
Ruth, U.S. Pat. No. 4,948,882; Cruickshank, U.S. Pat. No.
5,091,519; Haralambidis et al, Nucleic Acids Research, 15:
4857-4876 (1987); and the like. More particularly, M may be a
straight chain, cyclic, or branched organic molecular structure
containing from 1 to 20 carbon atoms and from 0 to 10 heteroatoms
selected from the group consisting of oxygen, nitrogen and sulfur.
Preferably, M is alkyl, alkoxy, alkenyl, or aryl containing from 1
to 16 carbon atoms; a heterocycle having from 3 to 8 carbon atoms
and from 1 to 3 heteroatoms selected from the group consisting of
oxygen, nitrogen, and sulfur; glycosyl; or nucleosidyl. More
preferably, M is alkyl, alkoxy, alkenyl, or aryl containing from 1
to 8 carbon atoms; glycosyl; or nucleosidyl.
Preferably, L is a phosphorus (V) linking group which may be
phosphodiester, phosphotriester, methyl or ethyl phosphonate,
phosphorothioate, phophorodithioate, phosphoramidate, of the like.
Generally, linkages derived from phosphoramidite or hydrogen
phosphonate precursors are preferred so that the linear polymeric
units of the invention can be conveniently synthesized with
commercial automated DNA synthesizers, e.g. Applied Biosystems,
Inc. (Foster City, Calif.) model 394, or the like.
n may vary significantly depending on the nature of M and L.
Usually, n varies from about 3 to about 100. When M is a nucleoside
or analog thereof or a nucleoside-sized monomer and L is a
phosphorus(V) linkage, then n varies from about 12 to about 100.
Preferably, when M is a nucleoside or analog thereof or a
nucleoside-sized monomer and L is a phosphorus(V) linkage, then n
varies from about 12 to about 40.
Peptides are another preferred class of molecules to which tags of
the invention are attached. Synthesis of peptide, oligonucleotide
conjugates which may be used in the invention is taught in Nielsen
et al, J. Am. Chem. Soc., 115: 9812-9813 (1993); Haralambidis et al
(cited above) and International patent application PCT/AU88/004417;
Truffert et al, Tetrahedron Letters, 35:2353-2356 (1994); de la
Torre et al, Tetrahedron Letters, 35: 2733-2736 (1994); and like
references. Preferably, peptide-oligonucleotide conjugates are
synthesized as described below. Peptides synthesized in accordance
with the invention may consist of the natural amino acid monomers
or non-natural monomers, including the D isomers of the natural
amino acids and the like.
Combinatorial Chemical Libraries
Combinatorial chemical libraries employing tags of the invention
are preferably prepared by the method disclosed in Nielson et al
(cited above) and illustrated in FIG. 4 for a particular
embodiment. Briefly, a solid phase support, such as CPG, is
derivatized with a cleavable linker that is compatible with both
the chemistry employed to synthesize the tags and the chemistry
employed to synthesize the molecule that will undergo some
selection process. Preferably, tags are synthesized using
phosphoramidite chemistry as described above and with the
modifications recommended by Nielson et al (cited above); that is,
DMT-5'-O-protected 3'-phosphoramidite-derivatized subunits having
methyl-protected phosphite and phosphate, moieties are added in
each synthesis cycle. Library compounds are preferably monomers
having Fmos--or equivalent--protecting groups masking the
functionality to which successive monomer will be coupled. A
suitable linker for chemistries employing both DMT and Fmoc
protecting groups (referred to herein as a sarcosine linker) is
disclosed by Brown et al, J. Chem. Soc. Chem. Commun. 1989:
891-893, which reference is incorporated by reference.
FIG. 4 illustrates a scheme for generating a combinatorial chemical
library of peptides conjugated to oligonucleotide tags. Solid phase
support 200 is derivatized by sarcosine linker 205 (exemplified in
the formula below) as taught by Nielson et al (cited above), which
has an extended linking moiety to facilitate reagent access.
TABLE-US-00004
(CPG)-NHC(O)CN(CH.sub.3)C(O)CH.sub.2CH.sub.2C(O)O(CH.sub.2).sub.6NHC(O)CH.-
sub.2(O-DMT)NC(O)-
CH.sub.2O(CH.sub.2CH.sub.2O).sub.2CH.sub.2CH.sub.2NHC(O)CH.sub.2O(CH.sub.2-
CH.sub.2O).sub.2CH.sub.2CH.sub.2NH-Fmoc
Here "CPG" represents a controlled-pore glass support, "DMT"
represents dimethoxytrityl, and "Fmos" represents,
9-fluorenylmethoxycarbonyl.
In a preferred embodiment, an oligonucleotide segment 214 is
synthesized initially so that in double stranded form a restriction
candonuclease site is provided for cleaving the library compound
after sorting onto a microparticle, or like substrate. Synthesis
proceeds by successive alternative additions of subunits S.sub.1,
S.sub.2, S.sub.3, and the like, to form tag 212, and their
corresponding library compound monomers A.sub.1, A.sub.2, A.sub.3,
and the like, to form library compound 216. A "split and mix"
technique is employed to generate diversity.
The subunits in a minimally cross-hybridizing set code for the
monomer added in the library compound. Thus, a nine word set can
unambiguously encode library compounds constructed from nine
monomers. If some ambiguity is acceptable, then a single subunit
may encode more than one monomer.
After synthesis is completed, the product is cleaved and
deprotected (220) to form tagged library compound 225, which then
undergoes selection 230, e.g. binding to a predetermined target
235, such as a protein. The subset of library compounds recovered
from selection process 230 is then sorted (24) onto a solid phase
support 245 via their tag moieties (there complementary subunits
and nucleotides are shown in italics). After ligating
oligonucleotide splint 242 to tag complement 250 to form
restriction site 225, the conjugate is digested with the
corresponding restriction endonuclease to cleave the library
compound, a peptide in the example of FIG. 4, from the
oligonucleotide moiety. The sequence of the tag, and hence the
identity of the library compound, is then determined by the
preferred single base sequencing technique of the invention,
described below.
Solid Phase Supports
Solid phase supports for use with the invention may have a wide
variety of forms, including microparticles; beads, and membrance,
slides, plates micromachined chops, and the like. Likewise, solid
phase supports of the invention may comprise a wide variety of
compositions, including glass, plastic, silicon,
alkanethiolate-dervatized gold, cellulose, low cross-linked and
high cross-linked polystyrene, silica gel, polyamide, and the like.
Preferably, either a population of discrete particles are employed
such that each has a uniform coating, or population, of
complementary sequences of the same tag(and no other), of a single
or a few supports are employed with spacially discrete regions each
containing a uniform coating, or population, or complementary
sequences to the same tag (and no other). In the latter embodiment,
the area of the regions may vary according to particular
applications; usually, the regions range in area from several
.mu.m.sup.2, e.g. 3-5, to several hundred .mu.m.sup.2, e.g.
100-500. Preferably, such regions are specifically discrete so that
signals generated by events, e.g. fluorescent emissions, at
adjacent regions can be resolved by the detection system being
employed. In some applications, it may be desirable to have regions
with uniform coatings of more than one tag complement, e.g. for
simultaneous sequence analysis, or for bringing separately tagged
molecules into close proximity.
Tag complements may be used with the solid phase support that they
are synthesized on, or they may be separately synthesized and
attached to a solid phase support for use, e.g. as disclosed by
Lund et al. Nucleic Adds Research, 16: 10861-10880 (1988);
Albretsen et al, Anal. Biochem., 189: 40-50 (1990); Wolf et al,
Nucleic Acids Research, 15: 2911-2926 (1987); or Ghosh et al,
Nucleic Acids Research, 15: 5353-5372 (1987); Preferably, tag
complements are synthesized on and used with the same solid phase
support; which my comprise a variety of forms and include a variety
of linking moieties. Such supports may comprise microparticles or
arrays, or matrices, of regions where uniform populations of tag
complements are synthesized. A wide variety of microparticle
supports may be used with the invention, including microparticles
made of controlled pore glass (CPG), highly cross-linked
polstyrene., acrylic copolymers, cellulose, nylon, dextran, latex,
polyacrolein, and the like, disclosed in the following exemplary
references: Meth. Enzymol, Section A pages 11-147, vol. 44
(Academic Press, New York, 1976); U.S. Pat. No. 4,678,814;
4,413,070; and 4,046;720; and Pon. Chapter 19, in Agrawal, editor,
Methods in Molecular Biology, Vol. 20, (Humana Press, Totowa, N.J.,
1993). Microparticle supports further include commercially
available nucleoside-derivatized CPG and polystyrene beads (e.g.
available from Applied Biosystems, Foster City, Calif.);
derivatized magnetic beads; polystyrene grafted with polythylene
glycol (e.g. TentaGel.TM., Rapp Polymere, Tubingen Germany); and
the like. Selection of the support characteristics, such as
material, porosity, size, shape, and the like, and the type of
linking moiety employed depends on the conditions under which the
tags are used. For example, in applications involving successive
processing with enzymes, supports and linkers that minimize steric
hinderance of the enzymes and that facilitate access to substrate
are preferred. Exemplary linking moieties are disclosed in Pon et
al, Biotechniques, 6; 768-775 (1988); Webb, U.S. Pat. No.
4,659,774; Barany et al, International patent application
PCT/US91/06103; Brown et al, J. Chem. Soc. Commun., 1989: 891-893;
Damha et al. Nucleic Acids Research, 18: 3813-3821 (1990); Beattie
et al, Clinical Chemistry, 39: 719-722 (1993); Maskos and Southern,
Nucleic Acids Research, 20: 1679-1684 (1992); and the like.
As mentioned above, tag complements may also be synthesized on a
single (or a few) solid phase support to form an array of regions
uniformly coated with tag complements. That is, within each region
in such an array the same tag complement is synthesized. Techniques
for synthesizing such arrays are disclosed in McGall et al,
International application PCT/US93/03767; Pease et al, Proc. Natl.
Acad. Sci., 91: 5022-5026 (1994); Southern and Maskos,
International application PCT/GB89/01114; Maskos and Southern
(cited above); Southern et al, Genomics, 13: 1008-1017 (1992); and
Maskos and Southern, Nucleic Acids Research, 21: 4663-4669
(1993).
Preferably, the invention is implemented with microparticles or
beads uniformly coated with complements of the same tag sequence.
Microparticle supports and methods of covalently or noncovalently
linking oligonucleotides to their surfaces are well known, as
exemplified by the following references: Beaucage and Iyer (cited
above); Gait, editor, Oligonucleotide Synthesis: A Practical
Approach (IRL Press, Oxford, 1984); and the references cited above.
Generally, the size and shape of a microparticle is not critical;
however, microparticles in the size range of a few, e.g. 1-2, to
several hundred, e.g. 200-1000 .mu.m diameter are preferable, as
they facilitate the construction and manipulation of large
repertoires of oligonucleotide tags with minimal reagent and sample
usage.
Preferably, commercially available controlled-pore glass (CPG) or
polystyrene supports are employed as solid phase supports in the
invention. Such supports come available with base-labile linkers
and initial nucleosides attached, e.g. Applied Biosystems (Foster
City, Calif.). Preferably, microparticles having pore sizes between
500 and 1000 angstroms are employed.
Attaching Target Polynucleotides Microparticles
An important aspect of the invention is the sorting of populations
of identical polynucleotides, e.g. from a cDNA library, and their
attachment to microparticles or separate regions of a solid phase
support such that each microparticle or region has only a single
kind of polynucleotide. This latter condition can be essentially
met by ligating a repertoire of tags to a population of
polynucleotides followed by cloning and sampling of the ligated
sequences. A repertoire of oligonucleotide tags can be ligated to a
population of polynucleotides in a number of ways, such as through
direct enzymatic ligation, amplification, e.g. via PCR, using
primers containing the tag sequences, and the like. The initial
ligating step produces a very large populations of
tag-polynucleotide conjugates such that a single tag is generally
attached to many different polynucleotides. However, by taking a
sufficiently small sample of the conjugates, the probability of
obtaining "doubles," i.e. the same tag on two different
polynucleotide, can be made negligible. (Note that it is also
possible to obtain different tags with the same polynucleotide in a
sample. This case is simply leads to a polynucleotide being
processed, e.g. sequenced, twice). As explain more fully below, the
probability of obtaining a double in a sample can be estimated by a
Poisson distribution since the number of conjugates in a sample
will be large, e.g. on the order of thousands or more, and the
probability of selecting a particular tag will be small because the
tag repertoire is large, e.g. on the order of tens of thousands or
more. Generally, the larger the sample the greater the probability
of obtaining a double. Thus, a design trade-off exists between
selecting a large sample of tag-polynucleotide conjugates--which,
for example, ensures adequate coverage of a target polynucleotide
in a shotgun sequencing operation, and selecting a small sample
which ensures that a minimal number of doubles will be present. In
most embodiments, the presence of double merely adds an additional
source of noise or, in the case of sequencing, a minor complication
in scanning and signal processing, as microparticles giving
multiple fluorescent signals can simply ignored. As used herein,
the term "substantially all" in reference to attaching tags to
molecules, especially polynucleotides, is meant to reflect the
statistical nature of the sampling procedure employed to obtain a
population of tag-molecule conjugates essentially free of doubles.
The meaning of substantially all in terms of actual percentages of
tag-molecule conjugates depends on how the tags are being employed.
Preferably, for nucleic acid sequencing, substantially all means
that at least eighty percent of the tags have unique
polynucleotides attached. More preferably, it means that at least
ninety percent of the tags have unique polynucleotides attached.
Still more preferably, i. means that at least ninety-five percent
of the tags have unique polynucleotides attached. And, more
preferably, it means that at least ninety-nine percent of the tags
have unique polynucleotides attached.
Preferably, when the population of polynucleotides is messenger RNA
(mRNA), oligonucleotides tags are attached by reverse transcribing
the mRNA with a set of primers containing complements of tag
sequences. An exemplary set of such primers could have the
following sequence: 5'-mRNA-[A].sub.n-3'
[T].sub.19GG[W,W,W,C].sub.9ACCAGCTGATC-5'-biotin where
"[W,W,W,C].sub.9" represents the sequence of an oligonucleotide tag
of nine subunits of four nucleotides each and "[W,W,W,C]"
represents the subunit sequences listed above, i.e. "W" represents
T or A. The underlined sequences identify an optional restriction
endonuclease site that can be used to release the polynucleotide
from attachment to a solid phase support via the biotin, if one is
employed. For the above primer, the complement attached to a
microparticle could have the form .Iadd.(SEQ ID NO:4).Iaddend.:
5'-[G,W,W,W].sub.9TGG-linker-microparticle
After reverse transcription, the mRNA is removed, e.g. by RNase H
digestion, and the second strand of the cDNA is synthesized using,
for example, a primer of the following form (SEQ ID NO:6):
.[.5'-NRRGATGYNN-3'.]. .Iadd.5'-NRRGATCYNNN-3'.Iaddend. where N is
any one of A, T, G, or C; R is a purine-containing nucleotide, and
Y is a pyrimidine-containing nucleotide. This particular primer
creates a Bst Y1 restriction site in the resulting double stranded
DNA which, together with the Sal I site, facilitates cloning into a
vector with, for example, Bam HI and Xho I sites. After Bst Y1 and
Sal I digestion, the exemplary conjugate would have the form
.Iadd.(SEQ ID NO:19).Iaddend.:
5'-RCGACCA[C,W,W,W,].sub.9GG[T].sub.19-cDNA-NNR
GGT[G,W,W,W].sub.9CC[A].sub.19-rDNA0NNNYCTAG-5' Preferably, when
the ligated-based method of sequencing is employed, the Bst YI and
Sal I digested fragments are cloned into a Bam HI-/Xho I-digested
vector having the following single-copy restriction sites (SEQ ID
NO:1): 5'-GAGGATGCCTTTATGGATCCACTCGAGATCCCAATCCA-3' FokI BAmHI XhoI
This adds the Fok I site which will allow initiation of the
sequencing process discussed more fully below.
A general method for exposing the single stranded tag after
amplification involves digesting a target polynucleotide-containing
conjugate with the .[.5'.fwdarw.3'.]. .Iadd.3'.fwdarw.5'.Iaddend.
exonuclease activity of T4 DAN polymerase, or a like enzyme. When
used in the presence of a single nucleoside triphosphate, such a
polymerase will cleave nucleotides from 3' recessed ends present on
the non-template strand of a double stranded fragment until a
complement of the single nucleoside triphosphate is reached on the
template strand. When such a nucleotide is reached the
.[.5'.fwdarw.3'.]. .Iadd.3'.fwdarw.5' .Iaddend.digestion
effectively ceases, as the polymerase's extension activity adds
nucleotides at a higher rate than the excision activity removes
nucleotides. Consequently, tags constructed with three nucleotides
are readily prepared for loading onto solid phase supports.
The technique may also be used to preferentially methylate interior
Fok I sites of a target polynucleotide while leaving a single Folk
I site at the terminus of the polynucleotide unmethylated. First,
the terminal Folk I site is rendered single stranded using a
polymerase with deoxycytidine triphosphate. The double stranded
portion of the fragment is then methylated, after which the single
stranded terminus is filled in with a DNA polymerase in the
presence of all four nucleoside triphosphates, thereby regenerating
the Folk I site.
After the oligonucleotide tags are prepared for specific
hybridization, e.g. by rendering them single stranded as described
above, the polynucleotides are mixed with microparticles containing
the complementary sequences of the tags under conditions that favor
the formation of perfectly matched duplexes between the tags and
their complements. There is extensive guidance in the literature
for creating these conditions. Exemplary references providing such
guidance include Wetmur, Critical Reviews in Biochemistry and
Molecular Biology, 26: 277-259 (1991); Sambrook et al, Molecular
Cloning: A Laboratory Manual, 2nd Edition (Cold Spring Harbor
Laboratory, New York, 1989); and the like. Preferably, the
hybridization conditions are sufficiently stringent so that only
perfectly matched sequences form stable duplexes. Under such
conditions the polynucleotides specifically hybridized through
their tags are ligated to the complementary sequences attached to
the microparticles. Finally, the microparticles are washed to
remove unligated polynucleotides.
When CPG microparticles conventionally employed as synthesis
supports are used, the density of tag complements on the
microparticle surface is typically greater than that necessary for
some sequencing operations. That is, in sequencing approaches that
require successive treatment of the attached polynucleotides with a
variety of enzymes, densely spaced polynucleotides may tend to
inhibit access of the relatively bulky enzymes to the
polynucleotides. In such cases, the polynucleotides are preferably
mixed with the microparticles so that tag complements are present
in significant excess, e.g. from 10:1 to 100:1, or greater, over
the polynucleotides. This ensumes that the density of
polynucleotides on the microparticle surface will not be so high as
to inhibit enzyme access. Preferably, the average
interpolynucleotide spacing on the microparticle surface is on the
order of 30-100 nm. Guidance in selecting ratios for standard CGP
supports and Ballotini beads (a type of solid glass support) is
found in Maskos and Southern., Nucleic Acids Research, 20:
1679-1684 (1992). Preferably, for sequencing applications, standard
CPG beads of diameter in the range of 20-50 .mu.m are loaded with
about 10.sup.5 polynucleotides.
The above method may be used to fingerprint mRNA populations when
coupled with the parallel sequencing methodology described below.
Partial sequence information is obtained simultaneously from a
large sample, e.g. ten to a hundred thousand, of cDNAs attched to
separate microparticles as described in the above method. The
frequency distribution of partial sequences can identify mRNA
populations from different cell or tissue types, as well as from
diseased tissues, such as cancers. Such mRNA fingerprints are
useful in monitoring and diagnosing disease states.
Single Base DNA Sequencing
The present invention can be employed with conventional methods of
DNA sequencing, e.g. as disclosed by Hultman et al, Nucleic Acids
Research, 17: 4937-4946 (1989). However, for parallel, or
simultaneous, sequencing of multiple polynucleotides, a DNA
sequencing methodology is preferred that requires neither
electrophoretic separation of closely sized DNA fragments nor
analysis of cleaved nucleotides by a separate analytical procedure,
as in peptide sequencing. Preferably, the methodology permits the
stepwise identification of nucleotides, usually one at a time, in a
sequence through successive cycles of treatment and detection. Such
methodologies are referred to herein as "single base" sequencing
methods. Single base approaches are disclosed in the following
references: Cheeseman, U.S. Pat. No. 5,302,509; Tsien et al,
International application WO 91/06678; Rosenthal et al,
International application WO 93/21340; Canard et al, Gene, 148: 1-6
(1994); and Metzker et al, Nucleic Acids Research, 22: 4259-4267
(1994).
A "single base" method of DNA sequencing which is suitable for use
with the present invention and which requires no electrophoretic
separation of DNA fragments is described in co-pending U.S. patent
application Ser. No. 08/280,441 filed 25 Jul. 1994, which
application is incorporated by reference. The method comprises the
following steps: (a) ligating a probe to an end of the
polynucleotide having a protruding strand to form a ligated
complex, the probe having a complementary protruding strand to that
of the polynucleotide and the probe having a nuclease recognition
site; (b) removing unligated probe from the ligated complex; (c)
identifying one or more nucleotides in the protruding strand of the
polynucleotide by the identity of the ligated probe; (d) cleaving
the ligated complex with a nuclease; and (e) repeating steps (a)
through (d) until the nucleotide sequence of the polynucleotide is
determined. As is described more fully below, identifying the one
or more nucleotides can be carried out either before or after
cleavage of the ligated complex from the target polynucleotide.
Preferably, whenever natural protein endonuclease are employed, the
method further includes a step of methylating the target
polynucleotide at the start of a sequencing operation.
An important feature of the method is the probe ligated to the
target polynucleotide. A preferred form of the probes is
illustrated in FIG. 1a. Generally, the probes are double stranded
DNA with a protruding strand at one end 10. The probes contain at
least one nucleus recognition site 12 and a spacer region 14
between the recognition site and the protruding end 10. Preferably,
probes also include a label 16, which in this particular embodiment
is illustrated at the end opposite of the protruding strand. The
probes may be labeled by a variety of means and at a variety of
locations, the only restriction being that the labeling means
selected does not interfere with the ligation step or with the
recognition of the probe by the nucleus.
It is not critical whether protruding strand 10 of the probe is a
5' or 3' end. However, it is important that the protruding strands
of the target polynucleotide and probes be capable of forming
perfectly matched duplexes to allow for specific ligation. If the
protruding strands of the target polynucleotide and probe are
different lengths the resulting gap can be filled in by a
polymerase prior to ligation, e.g. as in "gap LCR" disclosed in
Backman et al, European patent application 91100959.5. Preferably,
the number of nucleotides in the respective protruding strands are
the same so that both strands of the probe and target
polynucleotide are capable of being ligated without a filling step.
Preferably, the protruding strand of the probe is from 2 to 6
nucleotides long. As indicated below, the greater the length of the
protruding strand, the greater the complexity of the probe mixture
that is applied to the target polynucleotide during each ligation
and cleavage cycle.
The complementary strands of the probes are conveniently
synthesized on an automated DNA synthesizer, e.g. an Applied
Biosystems, Inc. (Foster City, Calif.) model 392 or 394 DNA/RNA
Synthesizer, using standard chemistries. After synthesis, the
complementary strands are combined to form a double stranded probe.
Generally, the protruding strand of a probe is synthesized as a
mixture, so that every possible sequence is represented in the
protruding portion. For example, if the protruding portion
consisted of four nucleotides, in one embodiment four mixtures are
prepared as follows: X.sub.1X.sub.2 . . . X.sub.lNNNA,
X.sub.1X.sub.2 . . . X.sub.iNNNC, X.sub.1X.sub.2 . . . X.sub.rNNNG,
and X.sub.1X.sub.2 . . . X.sub.tNNNT where the "NNNs" represent
every possible 3-mer and the "Xs" represent the duplex forming
portion of the strand. Thus, each of the four probes listed above
contains 4.sup.3 or 64 distinct sequences; or, in other words, each
of the four probes has a degeneracy of 64. For example,
X.sub.1X.sub.2 . . . X.sub.iNNNA contains the following
sequences:
TABLE-US-00005 X.sub.1X.sub.2 . . . X.sub.iAAAA X.sub.1X.sub.2 . .
. X.sub.iAACA X.sub.1X.sub.2 . . . X.sub.iAAGA X.sub.1X.sub.2 . . .
X.sub.iAATA X.sub.1X.sub.2 . . . X.sub.iACAA . . . X.sub.1X.sub.2 .
. . X.sub.iTGTA X.sub.1X.sub.2 . . . X.sub.iTTAA X.sub.1X.sub.2 . .
. X.sub.iTTCA X.sub.1X.sub.2 . . . X.sub.iTTGA X.sub.1X.sub.2 . . .
X.sub.iTTTA
Such mixtures are readily synthesized using well known techniques,
e.g. as disclosed in Telenius et al (cited above). Generally, these
techniques simply call for the application of mixtures of the
activated monomers to the growing oligonucleotide during the
coupling steps where one desires to introduce the degeneracy. In
some embodiments it may be desirable to reduce the degeneracy of
the probes. This can be accomplished using degeneracy reducing
analogs, such as deoxyinosine, 2-aminopurine, or the like, e.g. as
taught in Kong Thoo Lin et al, Nucleic Acids Research, 20:
5149-5152, or by U.S. Pat. No. 5,002,867.
Preferably, for oligonucleotides with phosphodiester linkages, the
duplex forming region of a probe is between about 12 to about 30
basepairs in length; more preferably, its length is between about
15 to about 25 basepairs.
When conventional ligases are employed in the invention, as
described more fully below, the 5' end of the probe may be
phosphorylated in some embodiments. A 5' monophosphate can be
attached to a second oligonucleotide either chemically or
enzymatically with a kinase, e.g. Sambrook et al (cited above).
Chemical phosphorylation is described by Horn and Urdea,
Tetrahedron Lett, 27: 4705 (1986), and reagents for carrying out
the disclosed protocols are commercially available, e.g. 5'
Phosphate-ON(TM) from Clontech Laboratories (Palo Alto, Calif.).
Thus, in some embodiments, probes may have the form:
TABLE-US-00006 5'-X.sub.1X.sub.2 . . . X.sub.iTTGA Y.sub.1Y.sub.2 .
. . Y.sub.iP
where the Y's are the complementary nucleotides of the X's and "p"
is a monophosphate group.
The above probes can be labeled in a variety of ways, including the
direct or indirect attachment of radioactive moieties, fluorescent
moieties, colorimetric moieties, chemiluminescene markers, and the
like. Many comprehensive reviews of methodologies for labeling DNA
and constructing DNA probes provide guidance applicable to
constructing probes of the present invention. Such reviews include
Kricka, editor, Nonisotopic DNA Probe Techniques (Academic Press,
San Diego, 1992); Haugland, Handbook of Fluorescent Probes and
Research Chemicals (Molecular Probes, Inc., Eugene, 1992); Keller
and Manak, DNA Probes, 2nd Edition (Stockton Press, New York,
1993); and Eckstein, editor, Oligonucleotides and Analogues; A
Practical Approach IRL Press, Oxford, 1991,(Kessler, editor,
Nonradioactive Labeling and Detection of Biomolecules
(Springer-Verlag, Berlin, 1992); Wetmur (cited above); and the
like.
Preferably, the probes are labeled with one or more fluorescent
dyes, e.g. as disclosed by Menchen et al, U.S. Pat. No. 5,188,934;
Begot et al International application PCT/US90/05565.
In accordance with the method, a probe is ligated to an end of a
target polynucleotide to form a ligated complex in each cycle of
ligation and cleavage. The ligated complex is the double stranded
structure formed after the protruding strands of the target
polynucleotide and probe anneal and at least one pair of the
identically oriented strands of the probe and target are ligated,
i.e. are caused to be covalently linked to one another. Ligation
can be accomplished either enzymatically or chemically. Chemical
ligation methods are well known in the art, e.g. Ferris et al,
Nucleosides & Nucleotides, 8: 407-414 (1989). Shabarova et al,
Nucleis Acids Research, 19: 4247-4251 (1991); and the like.
Preferably, however, ligation is carried out enzymatically using a
ligase in a standard protocol. Many ligases are known and are
suitable for use in the invention, e.g. Lehman, Science, 186:
790-797 (1974); Engler et al, DNA Ligases, pages 3-30 in Boyer,
editor, The Enzymes, Vol. 15B (Academic Press, New York, 1982); and
the like. Preferred ligases include T4 DNA ligase, T7 DNA ligase,
E. coli DNA ligase, Taq ligase, Pfu ligase, and Tth ligase.
Protocols for their use are well know, e.g. Sambrook et al (cited
above); Barneym PCR Methods and Applications, 1: 5-16 (1991); Marsh
et al, Strategies, 5: 73-76 (1992); and the like. Generally,
ligases require that a 5' phosphate group be present for ligation
to the 3' hydroxyl of an abutting strand. This is conveniently
provided for at least one strand of the target polynucleotide by
selecting a nuclease which leaves a 5' phosphate, e.g. as Fok
I.
In an embodiment of the sequencing method employing
unphosphorylated probes, the step of ligating includes (i) ligating
the probe to the target polynucleotide with ligase so that a
ligated complex is formed having a nick on one strand, (ii)
phosphorylating the 5' hydroxyl at the nick with a kinase using
conventional protocols, e.g. Sambrook et al (cited above), and
(iii) ligating again to covalently join the strands at the nick,
i.e. to remove the nick.
Apparatus for Observing Enzymatic Processes and/or Binding Events
at Microparticle Surfaces
An objective of the invention is to sort identical molecules,
particularly polynucleotides, onto the surfaces of microparticles
by the specific hybridization of tags and their complements. Once
such sorting has taken place, the presence of the molecules or
operations performed on the can e detected in a number of ways
depending on the nature of the tagged molecule, whether
microparticles are detected separately or in "batches," whether
repeated measurements are desired, and the like. Typically, the
sorted molecules are exposed to ligands for binding, e.g. in drug
development, or are subjected chemical of enzymatic processes, e.g.
in polynucleotide sequencing. In both of these uses it is often
desirable to simultaneously observe signals corresponding to such
events or processes on large numbers of microparticles.
Microparticles carrying sorted molecules (referred to herein as
"loaded" microparticles) lend themselves to such large scale
parallel operations, e.g. as demonstrated by Lam et al (cited
above).
Preferably, whenever light-generating signals, e.g.
chemiluminescent, fluorescent, or the like, are employed to detect
events or processes, loaded microparticles are spread on a planar
substrate, e.g. a glass slide, for examination with a scanning
system, such as described in International patent applications
PCT/US91/09217 and PCT/NL90/00081. The scanning system should be
able to reproducibly scan the substrate and to define the positions
of each microparticle in a predetermined region by way of a
coordinate system. In polynucleotide sequencing applications, it is
important that the positional identification of microparticles be
repeatable in successive scan step.
Such scanning systems may be constructed from commercially
available components, e.g. x-y translation table controlled by a
digital computer used with a detection system comprising one or
more photomultiplier tubes, or alternatively, a CCD array, and
appropriate optics, e.g. for exciting, collecting, and sorting
fluorescent signals. In some embodiments a confocil optical system
may be desirable. An exemplary scanning system suitable for use in
four-color sequencing is illustrated diagrammatically in FIG. 5.
Substrate 300, e.g. a microscope slide with fixed microparticles,
is placed on x-y translation table 302, which is connected to and
controlled by an appropriately programmed digital computer 304
which may be any of a variety of commercially available personal
computers, e.g. 486-based machines or PowerPC model 7100 or 8100
available from Apple Computer (Cupertino, Calif.). Computer
software for table translation and data collection functions can be
provided by commercially available laboratory software, such as Lab
Windows, available from National Instruments.
Substrate 300 and table 302 are operationally associate with
microscope 306 having one or more objective lenses 308 which are
capable of collecting and delivering light to microparticles fixed
to substrate 300. Excitation beam 310 from light source 312, which
is preferably a laser, is directed to beam splitter 314, e.g. a
dichoric mirror, which re-directs the beam through microscope 306
and objective lens 308 which, in turn, focuses the beam onto
substrate 300. Lens 308 collects fluorescence 316 emitted from the
microparticles and directs it through beam splitter 314 to signal
distribution optics 318 which, in turn, directs fluorescence to one
or more suitable opto-electronic devices for converting some
fluorescence characteristic, e.g. intensity, lifetime, or the like,
to an electrical signal. Signal distribution optics 318 may
comprise a variety of components standard in the art, such as
bandpass filters, fiber optics, rotating mirrors, fixed position
mirrors and lenses, diffraction gratings, and the like, As
illustrated in FIG. 5, signal distribution optics 318 directs
fluorescence 316, to four separate photomultipiler tubes, 330, 332,
334, and 336, whose output is then directed to pre-amps and photon
counters 350, 352, 354, 356. The output of the photon counters is
collected by computer 304, where it can be stored, analyzed, and
viewed on video 360. Alternatively, signal distribution optics 318
could be a diffraction grating which directs fluorescent signal 318
onto a CCD array.
The stability and reproducibility of the positional location in
scanning will determine, to a large extent, the resolution for
separating closely spaced microparticles. Preferably, the scanning
systems should be capable of resolving closely spaced
microparticles, e.g. seperated by a particle diameter. Thus, for
most applications, e.g. using CPG microparticles, the scanning
system should at least have the capability of resolving objects on
the order of 10-100 .mu.m. Even higher resolution may be desirable
in some embodiments, but with increase resolution, the time
required to fully scan a substrate will increase; thus, in some
embodiments a compromise may have to be made between speed and
resolution. Increases in scanning time can be achieved by a system
which only scans positions where microparticles are known to be
located, e.g. from an initial full scan. Preferably, microparticle
size and scanning system resolution are selected to permit
resolution of fluorescently labeled microparticles randomly
disposed on a plane at a density between about ten thousand to one
hundred thousand microparticles per cm.sup.2.
In sequencing applications, loaded microparticles can be fixed to
the surface of a substrate in variety of ways. The fixation should
be strong enough to allow the microparticles to undergo successive
cycles of reagent exposure and washing without significant loss.
When the substrate is glass, its surface may be derivatized with an
alkylamino linker using commercially available reagents, e.g.
Pierce Chemical, which in turn may be cross-linked to avidin, again
using conventional chemistries, to form an avidinated surface,
Biotin moieties can be introduced to the loaded microparticles in a
number of ways. For example, a fraction, e.g. 10-15 percent, of the
cloning vectors used to attach tags to polynucleotides are
engineered to contain a unique restriction site (providing sticky
ends on digestion) immediately adjacent to the polynucleotide
insert at an end of the polynucleotide opposite of the tag. The
site is excised with the polynucleotide and tag for loading onto
microparticles. After loading, about 10-15 percent of the loaded
polynucleotides will possess the unique restriction site distal
from the microparticle surface. After digestion with the associated
restriction endonuclease, an appropriate double stranded adapter
containing a biotin moiety is ligated to the sticky end. The
resulting microparticles are then spread on the avidinated glass
surface where they become fixed via the biotin-avidin linkages.
Alternatively and preferably when sequencing by ligation is
employed, in the initial ligation step a mixture of probes is
applied to the loaded microparticle: a fraction of the probes
contain a type IIs restriction recognition site, as required by the
sequencing method, and a fraction of the probes have no such
recognition site, but instead contain a biotin moiety at its
non-ligating end. Preferably, the mixture comprises about 10-15
percent of the biotylated probe.
Parallel Sequencing
The tagging system of the invention can be used with single base
sequencing methods to sequence polynucleotides up to several
kilobases in length. The tagging system permits many thousands of
fragments of a target polynucleotide to be sorted onto one or more
solid phase supports and sequenced simultaneously. In accordance
with a preferred implementation of tha method, a portion of each
sorted fragment is sequenced in a stepwise fashion on each of the
many thousands of loaded microparticles which are fixed to a common
substrate-such as a microscope slide-associated with a scanning
system, such as that described above. The size of the portion of
the fragments sequenced depends of several factors, such as the
number of fragments generated and sorted, the length of the target
polynucleotide, the speed and accuracy of the single base method
employed, the number of microparticles and/or discrete regions that
may be monitored simultaneously; and the like. Preferably, from
12-50 bases are identified at each microparticle or region; and
more preferably, 18-30 bases are identified at each microparticle
of region. With this information, the sequence of the target
polynucleotide is determined by collating the 12-50 base fragments
via their overlapping regions, e.g. as described in U.S. Pat. No.
5,002,867. The following references provide additional guidance in
determining the portion of the fragments that must be sequenced for
successful reconstruction of a target polynucleotide of a given
length: Drmanac et al, Genomics, 4: 114-128 (1989); Bains, DNA
Sequencing and Mapping, 4: 143-150 (1993); Bains, Genomics, 11:
294-301 (1991); Drmanac et al, J. Biomolecular Structure and
Dynamics, 8: 1085-1102 (1991); and Pevzner, J. Biomolecular
Structure and Dynamics, 7: 63-73 (1989). Preferably, the length of
the target polynucleotide is between 1 kilobase and 50 kilobases.
More preferably, the length is between 10 kilobases and 40
kilobases.
Fragments may be generated from a target polynucleotide in a
variety of ways, including so-called "directed" approaches where
one attempts to generate sets of fragments covering the target
polynucleotide with minimal overlap, and so-called "shotgun"
approaches where randomly overlapping fragments are generated.
Preferably, "shotgun" approaches to fragment generation are
employed because of their simplicity and inherent redundancy. For
example, randomly overlapping fragments that cover a target
polynucleotide are generated in the following conventional
"shotgun" sequencing protocol, e.g. as disclosed in Sambrook et al
(cited above). As used herein, "cover" in this context means that
every portion of the target polynucleotide sequence is represented
in each size range, e.g. all fragments between 100 and 200
basepairs in length, of the generated fragments. Briefly, starting
with a target polynucleotide as an insert in a n appropriate
cloning vector, e.g. A phage, the vector is expanded, purified and
digested with the appropriate restriction enzymes to yield about
10-15 .mu.g of purified insert. Typically, the protocol results in
about 500-1000 subclones per microgram of starting DNA. The insert
is seperated from the vector fragments by preparative gel
electrophoresis, removed from the gel by conventional methods, and
resuspended in a standard buffer, such as TE (Tris-EDTA). The
restriction enzymes selected to excise the insert from the vector
preferably leave compatible sticky ends on the insert, so that the
insert can be self-ligated in preparation for generating randomly
overlapping fragments, As explained in Sanbrook et al (cited
above), the circularized DNA yields a better random distribution of
fragments than linear DNA in the fragmentation methods employed
below. After self-ligating the inset, e.g. with T4 ligase using
conventional protocols, the purified ligated insert is fragmented
by a standard protocol, e.g. sonication or DNAase I digestion in
the presence of Mn.sup.++. After fragmentation the ends of the
fragments are repair, e.g. as described in sambrook et al (cited
above), and the repaired fragments are seperated by size using gel
electrophoresis. Fragments in the 300-500 basepair range are
selected and eluted from the gel by conventional means, and ligated
into a tag-carrying vector as described above to form a library of
tag-fragment conjugates.
As described below, a sample containing several thousand
tag-fragment conjugates are taken from the library and expanded
after which the tag-fragment inserts are excised from the vector
and prepared for specific hybridization to the tag complements on
microparticles, as described above. Depending of the size of the
target polynucleotide, multiple samples may be taken from the
tag-fragment library and separately expanded, loaded onto
microparticles and sequenced. The number of doubles selected will
depend on the fraction of the tag repertoire represented in a
sample. (The probability of obtaining triples-three different
polynucleotides with the same tag-or above can safely be ignored).
As mentioned above, the probability of doubles in a sample can be
estimated from the Poisson distribution
p(double)=m.sup.2e.sup.-m/2, where m is the fraction of the tag
repertoire in the sample. Table IV below lists probabilities of
obtaining doubles in a sample for giving tag size, sample size, and
repertoire diversity
TABLE-US-00007 TABLE IV Number of words in Fraction of tag from 8
Size of tag repertoire Probability of word set repertoire Size of
sample sampled double 7 2.1 .times. 10.sup.6 3000 1.43 .times.
10.sup.-3 10.sup.-6 8 1.68 .times. 10.sup.7 3 .times. 10.sup.4 1.78
.times. 10.sup.-3 1.6 .times. 10.sup.-6 3000 1.78 .times. 10.sup.-4
1.6 .times. 10.sup.-8 9 1.34 .times. 108 3 .times. 10.sup.5 2.24
.times. 10.sup.-3 2.5 .times. 10.sup.-6 3 .times. 10.sup.4 2.24
.times. 10.sup.-4 2.5 .times. 10.sup.-8 10 1.07 .times. 10.sup.9 3
.times. 10.sup.6 2.8 .times. 10.sup.-3 3.9 .times. 10.sup.-6 3
.times. 10.sup.5 2.8 .times. 10.sup.-4 3.9 .times. 10.sup.-8
In any case, the loaded microparticles are then dispersed and fixed
onto a glass microscope slide, preferably via an avidin-biotin
coupling. Preferably, at least 15-20 nucleotides of each of the
random fragments are simultaneously sequenced with a single base
method. The sequence of the target polynucleotide is then
reconstructed by collating the partial sequences of the random
fragments by way of their overlapping portions, using algorithms
similar to those used for assembling contigs, or as developed for
sequencing by hybridization, disclosed in the above references.
Kits for Implementing the Method of the Invention
The invention includes kits for carrying out the various
embodiments of the invention. Preferably, kits of the invention
include a repertoire of tag complements attached to a solid phase
support. Additionally, kits of the invention may include the
corresponding repertoire of tags, e.g. as primers for amplifying
polynucleotides to be sorted or as elements of cloning vectors
which can also be used to amplify the polynucleotides to be sorted.
Preferably, the repertoire of tag complements are attached to
microparticles. Kits may also contain appropriate buffers for
enzymatic processing, detector chemistries, e.g. fluorescent or
chemiluscent tags, and the like, instructions for use, processing
enzymes, such al ligases, polymerases, transferases, and so on. In
an important embodiment for sequencing kits may also include
substrates, such as a avidinated microscope slides, for fixing
loaded nicroparticles for processing.
Example I
Sorting Multiple Target Polynucleotides Derived from pUC 19
A mixture of three target polynucleotide-tag conjugates are
obtained as follows: First, the following six oligonucleotides are
synthesized and combined pairwise to form tag 1, tag 2, and tag 3
.Iadd.(SEQ ID NO:9, SEQ ID NO:10 and SEQ ID NO:17).Iaddend.:
TABLE-US-00008
5'-pTCGACC(w.sub.1)(w.sub.2)(w.sub.3)(w.sub.4)(w.sub.5)(w.sub.6)(w.sub.7)(-
w.sub.8)(w.sub.1)A GG(**)(**)(**)(**)(**)(**)(**)(**)(**)TTCGAp-5'
Tag 1
5'-pTCGACC(w.sub.6)(w.sub.7)(w.sub.8)(w.sub.1)(w.sub.2)(w.sub.6)(w.sub.4)(-
w.sub.2)(w.sub.1)A GG(**)(**)(**)(**)(**)(**)(**)(**)(**)TTCGAp-5'
Tag 2
5'-pTCGACC(w.sub.3)(w.sub.2)(w.sub.1)(w.sub.1)(w.sub.5)(w.sub.8)(w.sub.8)(-
w.sub.4)(w.sub.4)A GG(**)(**)(**)(**)(**)(**)(**)(**)(**)TTCGAp-5'
Tag 3
where "p" indicates a monophosphate, the w.sub.i's represent the
subunits define in Table I, and the terms "(**)" represent their
respective complements. ApUC19 is digested with Sal I and Hind III,
the large fragment is purified, and separately ligated with tags 1,
2, and 3, to form pUC19-1, pUC19-2, and pUC19-3, respectively. The
three recombinants are separately amplified and isolated, after
which pUC19-1 is digested with Hind HI and Aat I, pUC19-2 is
digested with Hind III and Ssp I, and pUC19-3 is digested with Hind
III and Xmn I. The small fragments are isolated using conventional
protocols to give three double stranded fragments about 250, 375,
and 575 basepairs in length, respectively, and each having a
recessed 3' strand adjacent to the tag and a blunt or 3' protruding
strand at the opposite end. Approximately 12 nmoles of each
fragment are mixed with 5 units T4 DNA polymerase in the
manufacturer's recommended reaction buffer containing 33 .mu.M
deoxycytosine triphosphate. The reaction mixture is allowed to
incubate at 37.degree. C. for 30 minutes, after which the reaction
is stopped by placing on ice. The fragments are then purified by
conventional means.
CPG microparticles (37-74 mm, particle size, 500 angstrom pore
size, Pierce Chemical) are derivatized with the linker disclosed by
Maskos and Southern, Nucleic Acids Research, 20: 1679-1684 (1992).
After separating into three aliquots, the complements of tags 1, 2,
and 3 are synthesized on the microparticles using a conventional
automated DNA synthesizer, e.g. a model 392 DNA synthesizer
(Applied Biosystems, Foster City, Calif.). Approximately 1 mg of
each of the differently derivatized microparticles are placed in
separate vessels.
The T4 DNA polymerase-treated fragments excised from pUC19-1, -2,
and -3 are resuspended in 50 .mu.L of the manufacturer's
recommended buffer for Taq DNA ligase (New England Biolabs) The
mixture is then equally divided among the three vessels containing
the 1 mg each of derivatized CPG microparticles. 5 units of Taq DNA
ligase is added to each vessel, after which they are incubated at
55.degree. C. for 15 minutes. The reaction is stopped by placing on
ice and the microparticles are washed several times by repeated
centrifugation and resuspension in TE. Finally, the microparticles
are resuspended in Nde I reaction buffer (New England Biolabs)
where the attached polynucleotides are digested. After separation
from the microparticles the polynucleotide fragments released by
Nde I digestion are fluorescently labeled by incubating with
Sequenase DNA polymerase and fluorescent labeled thymidine
triphosphate (Applied Biosystems, Foster City, Calif.). The
fragments are thin separately analyzed on a nondenaturing
polyacrylamide gel using an Applied Biosystems model 373 DNA
sequencer.
Example II
Parallel Sequencing of SV40 Fragments
A repertoire of 36-mer tags consisting of nine 4-nucleotide
subunits selected from Table I is prepared by separately
synthesizing tags and tag complements by a split and mix approach,
as described above. The repertoire is synthesized so as to permit
ligation into a Sma I/Hind III digested M13mp19. Thus, as in
Example I, one set of oligonucleotides begins with the addition of
A followed by nine rounds of split and mix synthesis wherein the
oligonucleotide is extended subunit-wise by 3'-phosphoramidite
derivatized 4-mers corresponding to the subunits of Table I. The
synthesis of then completed with the nucleotide-by-nucleotide
addition of one half of the Sma I recognition site (GGG), two C's,
and a 5'-monophosphate, e.g. via the Phosphate-ON reagent available
from Clontech Laboratories (Palo Alto, Calif.). The other set of
oligonucleotides begins with the addition of three C's (portion of
the Sma I recognition site) and two G's, followed by nine rounds of
split and mix synthesis wherein the oligonucleotide is extended by
3'-phosphoramidite derivatized 4-mers corresponding to the
complements of the subunits of Table I. Synthesis is completed by
the nucleotide-by-nucleotide addition of the Hind III recognition
site and a 5'-monophosphate. After separation from the synthesis
supports the oligonucleotides are mixed under conditions that
permit formation of the following duplexes .Iadd.(SEQ ID
NO:18).Iaddend.:
5'-pGGGCC(w.sub.i)(w.sub.i)(w.sub.i)(w.sub.i)(w.sub.i)(w.sub.i)(w.sub.i)(-
w.sub.i)(w.sub.i)(w.sub.i)A
CCCGG(**)(**)(**)(**)(**)(**)(**)(**)(**)TTCGAp-5' The mixture of
duplexes is then ligated into a Sma I/Hind III-digested M13mp19. A
repertoire of tag complements are synthesized on CPG microparticles
as described above.
Next the following adapter (SEQ ID NO:2 and SEQ ID NO:7) is
prepared which contains a Fok I site and portion of Eco RI and Sma
I sites:
TABLE-US-00009 5'-pAATTCGGATGATGCATGCATCGACCC
GCCTACTACGTACGTAGCTGGGp-5' Eco RI Fok I Sma I
The adapter is ligated into the Eco RI/Sma I digested M13 described
above.
Separately, SV40 DNA is fragmented by sonication following the
protocol set forth in Sambrook et al (cited above). The resulting
fragments are repaired using standard protocols and separated by
size. Fragments in the range of 300-500 basepairs are selected and
ligated into the Sma I digested M13 described above to form a
library of fragment-tag conjugates, which is then amplified. A
sample containing several thousand different fragment-tag
conjugates is taken from the library, further amplified, and the
fragment-tag inserts are excised by digesting with Eco RI and Hind
III. The excised fragment-tag conjugates are treated with T4 DNA
polymerase in the presence of deoxycytidine triphosphate, as
described in Example I, to expose the oligonucleotide tags for
specific hybridization to the CPG microparticles.
After hybridization and ligation, as described in Example I, the
loaded microparticles are treated with Fok I to produce a
4-nucleotide protruding strand of a predetermined sequence. A 10:1
mixture (probe 1:probe 2) of the following probes (SEQ ID NO:3, SEQ
ID NO:8.[., SEQ ID NO:9, and SEQ ID NO:10.]. ) are ligated to the
polynucleotides on microparticles.
TABLE-US-00010 Probe 1 FAM- ATCGGATGAC TAGCCTACTGAGCT Probe 2
biotin- ATCGGATGAC TAGCCTACTGAGCT
FAM represents a fluorescein dye attached to the 5'-hydroxyl of the
top strand of Probe I through an aminophosphate linker available
from Applied Biosystems (Aminolinker). The biotin may also be
attached through an Aminolinker moiety and optionally may be
further extended via polyethylene oxide linkers, e.g. Jaschke et al
(cited above).
The loaded microparticles are then deposited on the surface of an
avidinated glass slide to which and from which reagents and wash
solutions can be delivered and removed. The avidinated slide with
the attached microparticles is examined with a scanning fluorescent
microscope (e.g. Zeiss Axiskop equipped with a Newport Model
PM500-C motion controller, a Spectra-Physics Model 2020 argon ion
laster producing a 488 nm excitation beam, and a 520 nm long-pass
emission filter, or like apparatus). The excitation beam and
fluorescent emissions are delivered and collected, respectively,
through the same objective lens. The excitation beam and collected
fluorescence are separated by a dichroic mirror which directs the
collected fluorescence through a series of bandpass filters and to
photon-counting devices corresponding to the fluorophors being
monitored, e.g. comprising Hamamatsu model 9403-02
photomutlipliers, a Stanford Research Systems model SR445 amplifier
and model SR430 multichannel scaler, and digital computer, e.g. a
486-based computer. The computer generates a two dimensional map of
the slide which registers the positions of the microparticles.
After cleavage with Fok I to remove the initial probe, the
polynucleotides on the attached microparticles undergo 20 cycles of
probe ligation, washing detection, cleavage, and washing, in
accordance with the preferred single base sequencing methodology
described below. Within each detection step, the scanning system
records the fluorescent emission corresponding to the base
identified at each microparticle. Reactions and washes below are
generally carded out with manufacturer's (New England Biolabs')
recommended buffers for the enzymes employed, unless otherwise
indicated. Standard buffers are also described in Sambrook et al
(cited above).
The following four sets of mixed probes (SEQ ID NO:11, SEQ ID
NO:12, SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15) are provided
for addition to the target polynucleotides:
TABLE-US-00011 TAMRA- ATCGGATGACATCAAC TAGCCTACTGTAGTTGANNN FAM-
ATCGGATGACATCAAC TAGCCTACTGTAGTTGCNNN ROX- ATCGGATGACATCAAC
TACCCTACTGTAGTTGGNNN JOE- ATCGGATGACATCAAC TACCCTACTGTAGTTGTNNN
where TAMRA, FAM, ROX and JOE are spectrally resolvable fluorescent
lables attached by way of Aminolinker II (all being available from
Applied Biosystems, Inc., Foster City, Calif.); the bold faced
nucleotides are the recognition site for Fok I enidonuclease, and
"N" represents any one of the four nucleotides, A, C, G, T. TAMRA
(tetramethylrhodamine), FAM (fluorescein), ROX (rhodamine X), and
JOE (2',7'-dimethoxy-4',5'-dichlorofluorescein) and their
attachment to oligonucleotides is also described in Fung et al,
U.S. Pat. No. 4;855,225.
The above probes are incubated in approximately 5 molar excess of
the target polynucleotide ends as follows: the probes are incubated
for 60 minutes at 16.degree. C. with 200 traits of T4 DNA ligase
and the anchored target polynculeotide in T4 DNA ligase buffer,
after washing, the target polynucleotide is then incubated with 100
units T4 polynucleotide kinase in the manufacturer's, recommended
buffer for 30 minutes at 37.degree. C., washed, and again incubated
for 30 minutes at 16.degree. C. with 200 units of T4 DNA ligase and
the anchored target polynucleotide in T4 DNA ligase buffer. Washing
is accomplished by successively flowing volumes of wash buffer over
the slide, e.g. TE, disclosed in Sambrook et al (cited above).
After the cycle of ligation-phosphorylation-ligation and a final
washing, the attached microparticles are scanned for the presence
of fluorescent label, the positions and characteristics of which
are recorded by the scanning system. The labeled target
polynucleotide, i.e. The ligated complex, is then incubated with 10
units of Fok I in the manufacturer's recommended buffer for 30
minutes at 37.degree. C., followed by washing in TE. As a result
the target polynucleotide is shortened by one nucleotide on each
strand and is ready for the next cycle of ligation and cleavage.
The process is continued until twenty nucleotides are
identified.
TABLE-US-00012 APPENDIX I Exemplary computer program for generating
minimally cross hybridizing sets Program minxh c c c integer*2 sub1
(6) ,mset1(1000,6) ,mset2(1000,6) dimension nbase(6) c c
write(*,*)`ENTER SUBUNIT LENGTH` read(*,100)nsub 100 format(i1)
open(1,file=`sub4.dat`,form=`formatted`,status=`new`) c c nset=0 do
7000 m1=1,3 do 7000 m2=1,3 do 7000 m3=1,3 do 7000 m4=1,3 sub1(1)=m1
sub1(2)=m2 sub1(3)=m3 sub1(4)=m4 c c ndiff=3 c c c Generate set of
subunits differing from c sub1 by at least ndiff nucleotides. c
Save in mset1. c c jj=1 do 900 J=1,nsub 900 mset1(1,j)=sub1(j) c c
do 1000 k1=1,3 do 1000 k2=1,3 do 1000 k3=1,3 do 1000 k4=1,3 c c
nbase(1)=k1 nbase(2)=k2 nbase(3)=k3 nbase(4)=k4 c n=0 do 1200
j=1,nsub if(sub1(j) .eq.1 .and. nbase(j) .ne.1 .or. 1 sub1(j) .eq.2
.and. nbase(j) .ne.2 .or. 3 sub1(j) .eq.3 .and. nbase(j) .ne.3)
then n=n+1 endif 1200 continue c c if(n.ge.ndiff) then c c c If
number of mismatches c is greater than or equal c to ndiff then
record c subunit in matrix mset c jj=jj+1 do 1100 i=1,nsub 1100
mset1(jj,i)=nbase(i) endif c c 1000 continue c c do 1325 j2=1,nsub
mset2(1,j2)=mset1(1,j2) 1325 mset2(2,j2)=mset1(2,j2) c c c Compare
subunit 2 from c mset1 with each successive c subunit in mset1,
i.e. 3, c 4,5, . . . etc. Save those c with mismatches .ge. ndiff c
in matrix mset2 starting at c position 2. c Next transfer contents
c of mset2 into mset1 and c start c comparisons again this time c
starting with subunit 3. c Continue until all subunits c undergo
the comparisons. c c npass=0 c c 1700 continue kk=npass+2
npass=npass+1 c c do 1500 m=npass+2,jj n=0 do 1600 j=1,nsub
if(mset1(npass+1,j) .eq.1.and.mset1(m,j) .ne.1.or. 2
mset1(npass+1,j) .eq.2.and.mset1(m,j) .ne.2.or. 2 mset1(npass+1,j)
.eq.3.and.mset1(m,j) .ne.3) then n=n+1 endif 1600 continue
if(n.ge.ndiff) then kk=kk+1 do 1625 i=1,nsub 1625
nset2(kk,i)=mset1(m,i) endif 1500 continue c c c kk is the number
of subunits c stored in mset2 c c c Transfer contents of mset2 c
into mset1 for next pass. c c do 2000 k=1,kk do 2000 m=1,nsub 2000
mset1(k, m)=mset2 (k, m) if(kk.1t.jj) then jj=kk goto 1700 endif c
c nset=nset+1 write (1,7009) 7009 format(/) do 7008 k=1,kk 7008
write(1,7010)(mset1(k,m),m=1,nsub) 7010 format(4i1) write(*,*)
write(*,120) kk,nset 120 format(1x,`Subunits in set=`,i5,2x,`Set
No=`,i5) 7000 continue close(1) c c end
SEQUENCE LISTINGS
1
19138DNAArtificial SequenceSegment of vector 1gaggatgcct ttatggatcc
actcgagatc ccaatcca 38226DNAArtificial SequenceAdaptor 2aattcggatg
atgcatgcat cgaccc 26314DNAArtificial SequenceAdaptor 3tcgagtcatc
cgat 14439DNAArtificial SequenceTag complement linked to solid
phase support 4dddddddddd dddddddddd dddddddddd ddddddtgg
39566DNAArtificial SequencePrimer 5ctagtcgacc ahhhhhhhhh hhhhhhhhhh
hhhhhhhhhh hhhhhhhttt tttttttttt 60tttttt 66611DNAArtificial
SequencePrimer 6nrrgatcynn n 11722DNAArtificial SequenceAdaptor
7gggtcgatgc atgcatcatc cg 22810DNAArtificial SequenceAdaptor
8atcggatgac 10943DNAArtificial SequenceAdaptor containing
oligonucleotide tag 9tcgaccgatt tgattagatt tggtaaagta atgtaaagga
tta 431043DNAArtificial SequenceAdaptor containing oligonucleotide
tag 10tcgaccagta atgtaaagga tttgatagta tttgtgatga tta
431116DNAArtificial SequenceAdaptor 11atcggatgac atcaac
161220DNAArtificial SequenceMixed Probe 12nnnagttgat gtcatccgat
201320DNAArtificial SequenceMixed Probe 13nnncgttgat gtcatccgat
201420DNAArtificial SequenceMixed Probe 14nnnggttgat gtcatccgat
201520DNAArtificial SequenceMixed Probe 15nnntgttgat gtcatccgat
201637DNAArtificial Sequencesynthetic target polynucleotide probe
complex 16nnnnnggatg nnnnnnnnnn nnntnnnnnn nnnnnnn
371743DNAArtificial SequenceAdaptor containing oligonucleotide tag
17tcgacctaga tgatgattga ttgtaaaaag aaagtttgtt tga
431842DNAArtificial SequenceAdaptor containing oligonucleotide tag
18gggccddddd dddddddddd dddddddddd dddddddddd da
421964DNAArtificial SequenceDNA fragment containing oligonucleotide
tag 19rcgaccahhh hhhhhhhhhh hhhhhhhhhh hhhhhhhhhh hhhggttttt
tttttttttt 60tttt 64
* * * * *