U.S. patent number RE37,343 [Application Number 09/140,858] was granted by the patent office on 2001-08-28 for expression and secretion of heterologous proteins in yeast employing truncated alpha-factor leader sequences.
This patent grant is currently assigned to Chiron Corporation. Invention is credited to Patricia Tekamp-Olson.
United States Patent |
RE37,343 |
Tekamp-Olson |
August 28, 2001 |
Expression and secretion of heterologous proteins in yeast
employing truncated alpha-factor leader sequences
Abstract
A yeast .alpha.-factor expression system is provided comprised
of a truncated leader sequence, containing the .alpha.-factor
signal peptide and one glycosylation site, linked by a processing
site to a non-yeast protein-encoding sequence.
Inventors: |
Tekamp-Olson; Patricia (San
Anselmo, CA) |
Assignee: |
Chiron Corporation (Emeryville,
CA)
|
Family
ID: |
22487825 |
Appl.
No.: |
09/140,858 |
Filed: |
August 27, 1998 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
864206 |
Apr 3, 1992 |
|
|
|
|
670352 |
Mar 13, 1991 |
|
|
|
|
530477 |
May 29, 1990 |
|
|
|
|
139682 |
Dec 30, 1987 |
|
|
|
Reissue of: |
313540 |
Sep 27, 1994 |
05602034 |
Feb 11, 1997 |
|
|
Current U.S.
Class: |
435/69.9;
435/254.11; 435/254.2; 435/320.1; 435/471; 435/483; 435/69.7;
435/69.8; 536/23.4; 536/24.1; 536/24.2 |
Current CPC
Class: |
C07K
14/39 (20130101); C07K 14/62 (20130101); C12N
15/81 (20130101); C07K 14/65 (20130101); C07K
2319/02 (20130101) |
Current International
Class: |
C07K
14/435 (20060101); C07K 14/39 (20060101); C07K
14/37 (20060101); C07K 14/62 (20060101); C12N
15/81 (20060101); C07K 14/65 (20060101); C12N
015/62 (); C12N 015/09 (); C12N 001/15 (); C12N
015/63 (); C12N 015/81 () |
Field of
Search: |
;435/69.9,254.2,254.11,320.1,69.7,69.8,471,483
;536/23.4,24.1,24.2 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
088632 |
|
Sep 1983 |
|
EP |
|
0 123 228 |
|
Oct 1984 |
|
EP |
|
0 123 294 |
|
Oct 1984 |
|
EP |
|
0 171 000 |
|
Dec 1986 |
|
EP |
|
0 206 783 |
|
Dec 1986 |
|
EP |
|
0 214 826 |
|
Mar 1987 |
|
EP |
|
Other References
Barr, P.J. et al. (eds.), Yeast Genetic Engineering, 1989, 239 and
272. .
Brake et al., Mol. Cell. Biol., 1983, 3(8), 1440-1450. .
Fuller et al., Microbiology, 1986, 273-278. .
Hitzeman et al., Science, 1983, 219, 620-625. .
Julius et al., Cell, 1983, 32, 839-852. .
Rothblatt et al., EMBO J., 1987, 6(11), 3455-3463. .
Singh et al., "Saccharomyces cerevisiae contains two discrete genes
coding for the .alpha.-factor pheromone," Nucl. Acids Res., 1983,
11(12), 4049-4063. .
Sidhu et al., Gene, 1987, 54, 175-184. .
Zsebo, K.M. et al., J. Biol. Chem., 1986, 261(13),
5858-5865..
|
Primary Examiner: Prouty; Rebecca E.
Attorney, Agent or Firm: Paintin; Francis A. Guth; Joseph H.
Blackburn; Robert P.
Parent Case Text
This application is a continuation of application Ser. No.
07/864,206, filed 3 Apr. 1992, now abandoned, which is a
continuation of application Ser. No. 07/670,352, filed 13 Mar.
1991, now abandoned, which is a continuation of application Ser.
No. 07/530,477, filed 29 May 1990, now abandoned, which is a
continuation of application Ser. No. 07/139,682, filed 30 Dec.
1987, now abandoned.
Claims
I claim:
1. A yeast cell comprising a DNA construct that provides for the
expression and secretion of a non-yeast protein, said DNA construct
comprising
a yeast recognized transcription initiation sequence, linked 5'
to
a coding sequence under the control of both said yeast recognized
transcription initiation sequence and
a yeast-recognized termination sequence, said yeast-recognized
termination sequence being 3' to said coding sequence,
wherein said coding sequence encodes a precursor polypeptide
comprised of a leader sequence and said non-yeast protein linked by
a processing site that provides for the cleavage of said non-yeast
protein from said precursor polypeptide,
wherein said leader sequence is about the first 25 to about the
first 50 N-terminal residues of a yeast alpha-factor leader
polypeptide,
comprises a single yeast alpha-factor precursor glycosylation site
and comprises a single peptide of a yeast alpha-factor precursor
comprising the first about 19 to about 23 N-terminal residues of
said alpha-factor precursor.
2. The cell of claim 1 wherein said non-yeast protein is a
mammalian protein.
3. The cell of claim 2 wherein said mammalian protein is a
precursor of human insulin.
4. The cell of claim 3 wherein said precursor of human insulin is
human proinsulin.
5. The cell of claim .[.3.]. .Iadd.1 .Iaddend.wherein said
.[.precursor of human insulin.]. .Iadd.non-yeast protein
.Iaddend.comprises insulin a chain and insulin b chain linked by a
yeast-recognized processing site cleaved in vivo.
6. The cell of claim 5 wherein said processing site is cleaved by
the KEX2 gene product of Saccharomyces.
7. The cell of claim 2 wherein said mammalian protein is
insulin-like growth factor I.
8. The cell of claim 1 wherein said yeast cell is from the genus
Saccharomyces.
9. The cell of claim 8 wherein said yeast cell is S.
cerevisiae.
10. The cell of claim 8 wherein yeast .alpha.-factor precursor is
S. cerevisiae MF.alpha.1.
11. The cell of claim 1 wherein said leader sequence is about 28 to
about 40 N-terminal residues of said precursor polypeptide.
12. The cell of claim 1 wherein said leader sequence is about 35
contiguous N-terminal residues of a yeast alpha-factor precursor
polypeptide.
13. A double-stranded DNA molecule comprising a region encoding a
precursor polypeptide secretable by a yeast host, said region, with
reference to one of the strands, .[.having.]. .Iadd.comprising
.Iaddend.the structure:
wherein
AF encodes a yeast alpha-factor signal peptide;
CHO encodes a .[.yeast alpha-factor precursor.]. glycosylation site
.Iadd.comprising the amino acid sequence Asn-Y-Y' wherein Y is any
amino acid and Y' is Thr or Ser;.Iaddend.
X.sub.n encodes a spacer polypeptide of n amino acids in length
that does not contain a glycosylation site or a processing site
that provides for cleavage of said precursor polypeptide in vivo by
yeast;
n is an integer from 0 to 30;
Gene* encodes a non-yeast protein; and
S encodes a processing site that provides for cleavage of said
precursor polypeptide.
14. The DNA molecule of claim 13 wherein AF encodes a polypeptide
of about 19 to 23 amino acids in length.
15. The DNA molecule of claim 13 wherein n is an integer from about
0 to about 20.
16. The DNA molecule of claim 13 wherein n is an integer from about
0 to about 10.
17. The DNA molecule of claim 13 wherein n is an integer from about
3 to about 10.
18. The DNA molecule of claim 13 wherein said yeast host is a
Saccharomyces.
19. The DNA molecule of claim 13 wherein said yeast .alpha.-factor
signal peptide is a Saccharomyces signal peptide.
20. The DNA molecule of claim 13 wherein S encodes a processing
site recognized in vivo by said yeast host.
21. The DNA molecule of claim 20 wherein S encodes a dipeptide
recognized by the KEX2 endopeptidase.
22. The DNA molecule of claim 21 wherein said dipeptide is
5'-Lys-Arg-3' or 5'-Arg-Arg-3'.
23. The DNA molecule of claim 13 comprising a replicon.
24. The DNA molecule of claim 23 wherein said region encoding said
precursor polypeptide is under the control of yeast-recognized
transcription initiation and termination sequences, and said
replicon is a yeast replicon.
25. The DNA molecule of claim 24 wherein said replicon is a
plasmid.
26. The DNA molecule of claim 24 wherein said replicon is a
chromosome.
27. A DNA molecule comprising a nucleotide sequence that encodes
about the first 25 to about the first 50 contiguous N-terminal
amino acids of a yeast alpha-factor precursor leader sequence that
includes a single yeast alpha-factor precursor leader sequence
glycosylation site and no other yeast alpha-factor precursor leader
sequence glycosylation site.
28. The DNA molecule of claim 27 wherein the nucleotide sequence
encodes about the first 25 to about the first 40 contiguous
N-terminal amino acids of a yeast alpha-factor precursor leader
sequence that includes a single yeast alpha-factor precursor leader
sequence glycosylation site and no other yeast alpha-factor
precursor leader sequence glycosylation site.
29. The DNA molecule of claim 27 wherein the nucleotide sequence
encodes about the first 35 contiguous N-terminal amino acids of a
yeast alpha-factor precursor leader sequence that includes a single
yeast alpha-factor precursor leader sequence glycosylation site and
not other yeast alpha-factor precursor leader sequence
glycosylation site.
30. The DNA molecule of claim 27 wherein the nucleotide sequence
encodes about the first 28 contiguous N-terminal amino acids of a
yeast alpha-factor precursor leader sequence that includes a single
yeast alpha-factor precursor leader sequence glycosylation site and
no other yeast alpha-factor precursor leader sequence glycosylation
site.
31. The DNA molecule of claim 27 wherein the nucleotide sequence
encodes amino acids 1-25 and 81-83 of a yeast alpha-factor
precursor leader sequence..Iadd.
32. A method for producing a recombinant protein, said method
comprising:
providing a yeast cell as defined in claim 1, and
culturing said yeast cell under conditions that provide for
expression and secretion of said non-yeast
protein..Iaddend..Iadd.
33. The method of claim 32 wherein said non-yeast protein is a
mammalian protein..Iaddend..Iadd.
34. The method of claim 32 wherein said non-yeast protein is a
precursor of human insulin..Iaddend..Iadd.
35. The method of claim 34 wherein said precursor of human insulin
is human proinsulin..Iaddend..Iadd.
36. The method of claim 34 wherein said precursor of human insulin
comprises insulin a chain and insulin b chain linked by a
yeast-recognized processing site cleaved in
vivo..Iaddend..Iadd.
37. The method of claim 36 wherein said processing site is cleaved
by the KEX2 gene product of Saccharomyces..Iaddend..Iadd.
38. The method of claim 33 wherein said mammalian protein is
insulin-like growth factor I..Iaddend..Iadd.
39. The method of claim 32 wherein said yeast cell is from the
genus Saccharomyces..Iaddend..Iadd.
40. The method of claim 39 wherein said yeast cell is S.
cerevisiae..Iaddend..Iadd.
41. The method of claim 39 wherein said yeast alpha-factor leader
polypeptide is from S. cerevisiae MF.alpha.1..Iaddend..Iadd.
42. The method of claim 32 wherein said leader sequence is about
the first 28 to about the first 40 N-terminal amino acid residues
of a yeast alpha-factor leader polypeptide..Iaddend..Iadd.
43. The method of claim 32 wherein said leader sequence is about
the first 35 contiguous N-terminal residues of a yeast alpha-factor
leader polypeptide..Iaddend..Iadd.
44. A method of producing a recombinant protein, said method
comprising:
transforming a yeast cell with a DNA construct that provides for
the expression and secretion of a non-yeast protein, wherein said
DNA construct comprises the double-stranded DNA molecule as defined
in claim 13, and
culturing said transformed yeast cell under conditions that provide
for expression and secretion of said non-yeast
protein..Iaddend..Iadd.
45. The method of claim 44 wherein AF encodes a polypeptide of
about 19 to 23 amino acids in length..Iaddend..Iadd.
46. The method of claim 44 wherein n is an integer from about 0 to
about 20..Iaddend..Iadd.
47. The method of claim 44 wherein n is an integer from about 0 to
about 10..Iaddend..Iadd.
48. The method of claim 44 wherein n is an integer from about 3 to
about 10..Iaddend..Iadd.
49. The method of claim 44 wherein said yeast host is a
Saccharomyces..Iaddend..Iadd.
50. The method of claim 44 wherein said yeast alpha-factor signal
peptide is a Saccharomyces signal peptide..Iaddend..Iadd.
51. The method of claim 44 wherein S encodes a processing site
recognized in vivo by said yeast host..Iaddend..Iadd.
52. The method of claim 51 wherein S encodes a dipeptide recognized
by the KEX2 endopeptidase..Iaddend..Iadd.
53. The method of claim 52 wherein said dipeptide is 5'-Lys-Arg-3'
or 5'-Arg-Arg-3'..Iaddend..Iadd.
54. The method of claim 44 wherein said DNA molecule comprises a
replicon..Iaddend..Iadd.
55. The method of claim 54 wherein said region encoding said
precursor polypeptide is under the control of yeast-recognized
transcription initiation and termination sequences, and said
replicon is a yeast replicon..Iaddend..Iadd.
56. The method of claim 55 wherein said replicon is a
plasmid..Iaddend..Iadd.
57. The method of claim 55 wherein said replicon is a
chromosome..Iaddend..Iadd.
58. A method of producing a recombinant protein, said method
comprising:
transforming a yeast cell with a DNA construct that provides for
the expression and secretion of a non-yeast protein, wherein said
DNA construct comprises the double-stranded DNA molecule as defined
in claim 27, and
culturing said transformed yeast cell under conditions that provide
for expression and secretion of said non-yeast
protein..Iaddend..Iadd.
59. The method of claim 58 wherein the nucleotide sequence encodes
about the first 25 to about the first 40 contiguous N-terminal
amino acids of a yeast alpha-factor precursor leader sequence that
includes a single yeast alpha-factor precursor leader sequence
glycosylation site and no other yeast alpha-factor precursor leader
sequence glycosylation site..Iaddend..Iadd.
60. The method of claim 58 wherein the nucleotide sequence encodes
about the first 35 contiguous N-terminal amino acids of a yeast
alpha-factor precursor leader sequence that includes a single yeast
alpha-factor precursor leader sequence glycosylation site and no
other yeast alpha-factor precursor leader sequence glycosylation
site..Iaddend..Iadd.
61. The method of claim 58 wherein the nucleotide sequence encodes
about the first 28 contiguous N-terminal amino acids of a yeast
alpha-factor precursor leader sequence that includes a single yeast
alpha-factor precursor leader sequence glycosylation site and no
other yeast alpha-factor precursor leader sequence glycosylation
site..Iaddend..Iadd.
62. The method of claim 59 wherein the nucleotide sequence encodes
amino acids 1-25 linked to amino acids 81-83 of a yeast
alpha-factor precursor leader sequence..Iaddend..Iadd.
63. The method of claim 44 wherein CHO encodes a yeast alpha-factor
precursor glycosylation site..Iaddend..Iadd.
64. The DNA molecule of claim 13 wherein CHO encodes a yeast
alpha-factor precursor glycosylation site..Iaddend..Iadd.
65. The method of claim 49 wherein said yeast host is S.
cerevisiae..Iaddend..Iadd.
66. The method of claim 49 wherein the leader construct
AF-CHO-X.sub.n -S is about the first 25 to about the first 40
contiguous N-terminal residues of a yeast alpha-factor signal
peptide..Iaddend..Iadd.
67. The method of claim 49 wherein the leader construct
AF-CHO-X.sub.n -S is about the first 28 to about the first 40
contiguous N-terminal residues of a yeast alpha-factor signal
peptide..Iaddend..Iadd.
68. The method of claim 49 wherein the leader construct
AF-CHO-X.sub.n -S is about the first 35 to about the first 40
contiguous N-terminal residues of yeast alpha-factor signal
peptide..Iaddend..Iadd.
69. The method of claim 68 wherein said non-yeast protein is a
human proinsulin..Iaddend..Iadd.
70. The method of claim 69 wherein said DNA construct is plasmid
pYGAI7 (ATCC Accession Number 67597)..Iaddend..Iadd.
71. The method of claim 69 wherein said human proinsulin comprises
insulin a chain and insulin b chain linked by a yeast-recognized
processing site cleaved in vivo by the KEX2 gene product of
Saccharomyces..Iaddend..Iadd.
72. The method of claim 71 wherein said DNA construct is plasmid
pY.alpha.f.sub.L 7C3(ATCC Accession Number
67596)..Iaddend..Iadd.
73. The method of claim 49 wherein the leader construct
AF-CHO-X.sub.n -S is amino acids 1-25 linked to amino acids 81-83
of a yeast alpha-factor signal peptide..Iaddend..Iadd.
74. The method of claim 73 wherein said non-yeast protein is
insulin-like growth factor I..Iaddend..Iadd.
75. The method of claim 74 wherein said DNA construct is plasmid
pYLUIGFI-55(ATCC Accession Number 67595)..Iaddend.
Description
Related U.S. Application Data
This is a reissue of U.S. Pat. No. 5,602,034, Issued, Feb. 11,
1997, incorporated herein by reference in its entirety.
TECHNICAL FIELD
The present invention relates to the production of recombinant
proteins in yeast. More particularly, the present invention is
directed to an improved .alpha.-factor expression system which
provides for the secretion of heterologous proteins from yeast host
cells.
BACKGROUND
Kurjan et al. (1982) Cell 30:933-943 discloses the first cloning
and sequencing of a gene encoding a yeast .alpha.-factor precursor
gene. Kurjan et al., U.S. Pat. No. 4,546,082, also reports the
cloning of this gene, and suggests that the .alpha.-factor leader
sequence can be employed to direct the secretion of heterologous
proteins in yeast. The patent, however, does not contain data which
would indicate that the patentees ever successfully employed the
.alpha.-factor leader to express and secrete a heterologous protein
in yeast.
EPO Publication No. 116,201 discloses the first successful
application of the .alpha.-factor leader to direct the expression
and secretion of an heterologous protein, epidermal growth factor,
from a transformed yeast. Subsequent to this work, there have been
additional reports of the expression of heterologous proteins in
yeast employing the .alpha.-factor leader. See, e.g., Elliott et
al. (1983) Proc. Nat'l Acad. Sci. USA 80:7080-7084; Bitter et al.
(1984) Proc. Nat'l Acad. Sci. USA 81:5330-5334; Smith et al. (1985)
Science 229:1219-1229; EPO Publication Nos. 114,695; 123,228;
123,294; 123,544; 128,773; and 206,783. See also Brake et al. in
Protein Transport and Secretion, p. 103 (J. M. Gething ed.
1984).
The expression systems in the above reports produce a full-length
.alpha.-factor leader fused to a heterologous protein. While the
above work demonstrates that the .alpha.-factor expression system
is widely useful, it is not generally predictable prior to
performing the experiment whether a particular heterologous protein
will be successfully secreted, processed and biologically active.
See, e.g., EPO 206,783, supra, pp. 2-5; Rothblatt et al. (1987)
EMBO J. 6:3455-3463; V. L. MacKay, "Secretion of Heterologous
Proteins in Yeast" (in press).
There have been several reports, based on unpublished data, that
deletions from the "pro" region of the .alpha.-factor leader
(between the signal peptide and the first spacer) causes
substantial declines in the amount of non-yeast protein secreted by
yeast transformed the heterologous constructs. Sidhu et al. (1987)
Gene 54:175-184, reports that yeast acid phosphatase (PHO5) is
secreted into the medium from a heterologous construct employing
both a full-length .alpha.-factor leader, and a truncated
.alpha.-factor leader, but that expression levels are 3-4.times.
less than for the PHO5 gene under the control of its homologous
leader. It has also been reported that deletions in the
prepro-.alpha.-factor precursor gene results in substantial
declines in secretion of the native .alpha.-factor peptide. See,
e.g., V. L. MacKay, supra; Rothblatt et al., supra.
A need exists, therefore, to improve the .alpha.-factor expression
system, particularly for applications to non-yeast proteins that
are not efficiently produced by current .alpha.-factor expression
constructs.
SUMMARY OF THE INVENTION
It has been surprisingly discovered that a truncated form of the
.alpha.-factor leader sequence can efficiently direct the
expression and secretion of heterologous polypeptides in yeast.
Particularly surprising is the discovery that truncated
.alpha.-factor leader sequences can substantially improve the
efficiency of expression of such heterologous proteins in relation
to expression systems using the full-length .alpha.-factor leader;
i.e., higher levels of correct N-terminal processing, secretion of
heterologous proteins wherein a greater percentage of the molecules
are biologically active, etc. These results are particularly
surprising in view of reports that deletions from the leader
sequence of the .alpha.-factor precursor result in decreased levels
of secretion of active .alpha.-factor.
The present invention provides, therefore, for alternative
.alpha.-factor-based expression constructs, which are particularly
useful for the expression of heterologous polypeptides which are
either inefficiently expressed by full-length .alpha.-factor leader
constructs, or are not expressed at all by such full-length
constructs.
In one embodiment, the present invention is directed to a yeast
cell comprising a DNA construct that provides for the expression
and secretion of a non-yeast protein, said DNA construct comprising
a coding sequence under the control of yeast-recognized
transcription initiation and termination sequences, said coding
sequence encoding a precursor polypeptide comprised of a leader
sequence and said non-yeast protein linked by a processing site
that provides for the cleavage of said non-yeast protein from said
precursor polypeptide, wherein said leader sequence is about 25 to
about 50 N-terminal residues of said precursor polypeptide and
comprises the signal peptide of a yeast .alpha.-factor precursor
and a single glycosylation site.
In another embodiment, the present invention is directed to a
double-stranded DNA molecule comprising a region encoding a
precursor polypeptide secretable by a yeast host, said region, with
reference to one of the DNA strands, having the structure:
wherein
AF encodes a yeast .alpha.-factor signal peptide; CHO encodes a
glycosylation site;
X.sub.n encodes a polypeptide of n amino acids in length that does
not contain a glycosylation site or a processing site that provides
for cleavage of said precursor polypeptide in vivo by yeast;
n is an integer from 0 to about 30;
Gene* encodes a non-yeast protein; and
S encodes a processing site that provides for cleavage of said
precursor polypeptide.
The present invention is also directed to methods of employing the
above cells and DNA constructs to produce recombinant proteins, as
well as the compositions of recombinant proteins produced by the
above methods. Other embodiments will also be readily apparent to
those of ordinary skill in the art.
DESCRIPTION OF THE FIGURES
FIG. 1 is a flow diagram showing the construction of pYBCA5, and
both the nucleotide and amino acid sequences of the synthetic
proinsulin gene employed in Example I. The various synthetic
oligonucleotides used in construct are delineated by black dots.
Arrows above the sequence show the beginning and end of the B, C
and A proinsulin chains. The boxes mark the dibasic processing
sites.
FIG. 2 is the nucleotide and amino acid sequence of a synthetic
oligonucleotide encoding a modified .alpha.-factor leader and the
first 13 amino acids of the proinsulin gene used to construct
pYGAI3 in Example I. The modified .alpha.-factor leader has had the
glycosylation sites removed by changing the codons for
Asn.sub.23,57,67 to encode Gln (boxed). The arrow denotes the
junction between the sequence encoding the KEX2 endopeptidase site
and the N-terminus of human proinsulin.
FIG. 3 shows the synthetic gene of fragment of pYGAIC3 encoding the
proinsulin analog, where a KEX2 endopeptidase site has replaced the
C peptide (boxed). The synthetic 133 bp fragment referred to in
Example II is defined by the vertical and horizontal lines thru the
nucleotide sequence.
FIG. 4 is a restriction map of yeast shuttle vector pAB24.
FIG. 5 shows the DNA sequence of the synthetic gene encoding IGF1
described in Example III.
FIG. 6 is a restriction map of pYLUIGF1-55, an expression vector
described in Example III encoding IGF1 under the control of a
truncated .alpha.-factor leader.
FIG. 7 is a restriction map of pYLUIGF1-24, an expression vector
described in Example III encoding IGF1 under the control of a
full-length .alpha.-factor leader with three glycosylation
sites.
DETAILED DESCRIPTION
The practice of the present invention will employ, unless otherwise
indicated, conventional molecular biology, microbiology, and
recombinant DNA techniques within the skill of the art. Such
techniques are fully explained in the literature. See, e.g.,
Maniatis, Fritsch & Sambrook, Molecular Cloning: A Laboratory
Manual (1982); DNA Cloning, Vols. I & II (D. N. Glover, ed.
1985); Oligonucleotide Synthesis (M. J. Gait, ed. 1984);
Transcription and Translation (B. D. Hames & S. J. Higgins,
eds. 1984); Immobilized Cells and Enzymes (IRL Press, 1986); B.
Perbal, A Practical Guide to Molecular Cloning (1984).
In describing the present invention, the following terminology will
be used in accordance with the definitions set out below.
A "replicon" is any genetic element (e.g., plasmid, cosmid,
chromosome, virus) that functions as an autonomous unit of DNA
replication in vivo--i.e., capable of replication under its own
control.
A "vector" is a replicon such as a plasmid, phage, or cosmid to
which another DNA segment may be attached so as to bring about the
replication of the attached segment.
A "double-stranded DNA molecule" refers to the polymeric form of
deoxyribonucleotides (adenine, guanine, thymidine, or cytosine) in
its normal, double-stranded helix. This term refers only to the
primary and secondary structure of the molecule, and does not limit
it to any particular tertiary forms. Thus, this term includes
double-stranded DNA found, inter alia, in linear DNA molecules
(e.g., restriction fragments), viruses, plasmids, and chromosomes.
In discussing the structure of a particular double-stranded DNA
molecule, sequences will be described herein according to the
normal convention of giving only the sequence in the 5' to 3'
direction along the nontranscribed strand of DNA, i.e., the strand
having a sequence homologous to the mRNA produced from a particular
coding sequence.
A DNA "coding sequence" is DNA sequence which can be transcribed
and translated into a polypeptide in vivo when placed under the
control of appropriate regulatory sequences. The boundaries of the
coding sequence are determined by and include the translation start
codon at the 5' (amino) terminus, and a translation stop codon at
the 3' (carboxy) terminus. A coding sequence can include, but is
not limited to, procaryotic DNA sequences, vital DNA sequences,
cDNA or genomic DNA sequences from eucaryotic sources (e.g.,
mammalian), and even synthetic DNA sequences.
"Yeast-recognized transcription initiation and termination
sequences" refer to DNA regulatory regions which flank a coding
sequence and are responsible for the transcription in yeast of an
mRNA homologous to the coding sequence which can then be translated
into the polypeptide encoded by the coding sequence. Transcription
initiation sequences include yeast promoter sequences, which are
DNA regulatory sequences capable of binding yeast RNA polymerase in
a cell and initiating transcription of a downstream (3' direction)
coding sequence. For the purposes of defining the present
invention, the promoter sequence is bounded (and excludes) at its
3' terminus by the translation start codon of a coding sequence and
extends upstream (5' direction) to include the minimum number of
nucleotides or elements necessary to initiate transcription at
levels detectable above background. Within the promoter sequence
will be found a transcription initiation site (conveniently defined
by mapping with nuclease S1), as well as protein-binding domains
(consensus sequences) responsible for the binding of the yeast RNA
polymerase. Promoters useful in the present invention include the
wild-type .alpha.-factor promoter, as well as other yeast
promoters. Particularly preferred are promoters involved with the
enzymes in the glycolytic pathway, e.g., phosphoglucoisomerase,
phosphofructokinase, phosphotrioseisomerase, phosphoglucomutase,
enolase, pyruvic kinase, glyceraldehyde-3-phosphate dehydrogenase,
alcohol dehydrogenase, as well as hybrids of these promoters. See,
e.g., EPO Publication Nos. 120,551; 164,556. Transcription
initiation sequences can also include other regulatory regions
responsible for promoter regulation or enhancement. In like manner,
a transcription terminator sequence located 3' to the translation
stop codon can be either the wild-type .alpha.-factor transcription
termination sequence, or another yeast-recognized termination
sequence, such as those from the genes for the above glycolytic
enzymes.
A coding sequence is "under the control" of transcription
initiation and termination sequences when RNA polymerase binds the
transcription initiation sequence and transcribes the coding
sequence into mRNA terminating at the transcription termination
sequence, and the mRNA is then translated into the polypeptide
encoded by the coding sequence (i.e., "expression"). The precursor
polypeptide encoded by the coding sequences of the present
invention is "secreted" when at least a portion (usually the
non-yeast protein in the absence of the leader sequence) is
transported extracellularly where it is found in the cell growth
medium. Usually, only the portion of precursor protein downstream
from the lead sequence is secreted, and this downstream portion may
also be subjected to additional processing during secretion, such
as proteolytic cleavage, glycosylation, folding, disulfide bond
formation, etc.
A cell has been "transformed" by exogenous DNA when such exogenous
DNA has been introduced inside the cell wall. Exogenous DNA may or
may not be integrated (covalently linked) to chromosomal DNA making
up the genome of the cell. The exogenous DNA may be maintained
extrachromosomally on a replicon such as a plasmid. When the
exogenous DNA has become integrated to the chromosome, it is
inherited by daughter cells through chromosome replication. A cell
which has been transformed by exogenous DNA which is integrated
into the chromosome is referred to as a "stably" transformed cell.
A "clone" or "clonal population" is a population of cells derived
from a single cell or common ancestor by mitosis.
Two DNA sequences are "substantially homologous" when at least
about 60% (preferably at least about 75%, and most preferably at
least about 90%) of the nucleotides match over a defined length of
the molecules. Sequences that are substantially homologous can be
identified in a Southern hybridization experiment under conditions
of a selected stringency as defined for that particular system.
Defining appropriate hybridization conditions is within the skill
of the art. See, e.g., Maniatis et al., supra; DNA Cloning, supra;
Nucleic Acid Hybridization, supra.
A "heterologous region" of a DNA molecule is an identifiable
segment of DNA within a larger DNA molecule that is not found in
association with the larger molecule in nature. Thus, when the
heterologous region encodes a mammalian protein, the heterologous
region will usually be flanked by DNA that does not flank the
mammalian DNA sequence in the genome of the source organism.
Another example of a heterologous coding sequence is a construct
where the coding sequence itself is not found in nature (e.g., a
cDNA where the genomic coding sequence contains introns, or
synthetic sequences having codons different from organisms which
encode the same or similar protein). Allelic variations or
naturally occurring mutational events do not give rise to a
"heterologous" region of DNA as used herein.
As used herein, "yeast" includes ascosporogenous yeasts
(Endomycetales), basidiosporogenous yeasts and yeast belonging to
the Fungi imperfecti (Blastomycetes). The scosporogenous yeasts are
divided into two families, Spermophthoraceae and
Saccharomycetaceae. The latter is comprised of four subfamilies,
Schizosaccharomycoideae (e.g., genus Schizosaccharomyces),
Nadsonioideae, Lipomycoideae and Saccharomycoideae (e.g., genera
Pichia, Klyveromyces and Saccharomyces). The basidiosporogenous
yeasts include the genera Leucosporidium, Rhodosporidium,
Sporidiobolus, Filobasidium and Filobasidiella. Yeast belonging to
the Fungi Imperfecti are divided into two families,
Sporobolomycetaceae (e.g., genera Sporobolomyces, Bullera) and
Cryptococcaceae (e.g., genus Candida). Of particular interest to
the present invention are species within the genera Pichia,
Kluyveromyces, Saccharomyces, Schizosaccharomyces and Candida. Of
particular interest are the Saccharomyces species S. cerevisiae, S.
carlsbergensis, S. diastaticus, S. douglasii, S. kluyveri, S.
norbensis and S. oviformis. Species of particular interest in the
genus Kluyveromyces include K. lactis. Since the classification of
yeast may change in the future, for the purposes of this invention,
yeast shall be defined as described in Biology and Activities of
Yeast (F. A. Skinner, S. M. Passmore & R. R. Davenport eds.
1980) (Soc. App. Bacteriol. Symp. Series No. 9). In addition to the
foregoing, those of ordinary skill in the art are presumably
familiar with the biology of yeast and the manipulation of yeast
genetics. See, e.g., Biochemistry and Genetics of Yeast (M. Bacila,
B. L. Horecker & A. O. M. Stoppani eds. 1978); The Yeasts (A.
H. Rose & J. S. Harrison eds., 2nd ed., 1987); The Molecular
Biology of the Yeast Saccharomyces (Strathern et al. eds. 1981).
The disclosures of the foregoing references are incorporated herein
by reference.
The present invention employs truncated leader sequences from a
yeast .alpha.-factor gene. .alpha.-factor is an oligopeptide mating
pheromone about 13 residues in length produced from a large
precursor polypeptide between about 100 and 200 residues (typically
about 120-160) in length (prepro-.alpha.-factor). The precursor is
comprised of a hydrophobic "signal sequence" of about 20 residues
(e.g., about 19-23, typically about 20-22) followed by an
additional leader region of about 60 hydrophilic residues (the
"pro" region), which is then linked to several tandem repeats of
the mature pheromone sequence (typically about 2-6) separated by
short oligopeptide spacer regions (typically about 6-8 residues)
which provide for proteolytic processing to the mature
pheromone.
The cloning of various prepro-.alpha.-factor genes has been
reported. See, e.g., Kurjan et al., U.S. Pat. No. 4,546,082; Singh
et al. (1983) Nucleic Acids Res. 11:4049-4063; commonly owned U.S.
patent application Ser. No. 078,551, filed 28 Jul. 1987, now U.S.
Pat. No. 5,010,182, the disclosure of which is incorporated herein
by reference. In addition, DNA sequences encoding the
prepro-.alpha.-factor gene can be identified by hybridization with
probes from known prepro-.alpha.-factor sequences. See, e.g., Brake
et al. (1983) Molec. & Cell Biol. 3:1440-1450. .alpha.-factor
may also be purified from a yeast species, sequenced and probes
designed to clone the prepro-.alpha.-factor gene. See, e.g.,
McCullough et al. (1979) J. Bacteriol. 138:146-154; Sato et al.
(1981) Agric. Biol. Chem. 44:1451-1453; Singh et al. (1983), supra.
It has also been determined that the .alpha.-factor leader sequence
from one yeast species can be functional in another yeast species.
See, e.g., U.S. Ser. No. 078,551, supra. Thus, the present
invention contemplates not only the use of .alpha.-factor leader
sequences from yeast in general, but the use of such leader
sequences in heterologous yeast species. For ease of presentation,
however, the invention will be discussed in terms of the
prepro-.alpha.-factor gene MF.alpha.1 from S. cerevisiae. See,
e.g., Kurjan et al., U.S. Pat. No. 4,546,083; Singh et al. (1983),
supra.
The present invention employs chimetic DNA constructs encoding
hybrid precursor polypeptides comprised of a leader sequence and a
non-yeast polypeptide. For purposes Of this invention, the leader
sequence DNA is defined as beginning at the N-terminal start codon
(methionine) of the precursor polypeptide through the codon
encoding the last amino acid residue before the processing site
that intervenes between the leader sequence and the sequence
encoding the non-yeast protein. The leader sequence of the present
invention is comprised of a truncated form of a yeast
.alpha.-factor leader sequence, typically about 25 to about 50
amino acid residues in length. Thus, the leader sequence of the
present invention is approximately 30 amino acid residues shorter
than the typical full-length .alpha.-factor leader. MF.alpha.1, for
example, contains a leader sequence of 83 amino acid residues
followed by a hexapeptide spacer sequence which is cleaved by yeast
processing enzymes. In making deletions from the leader sequence,
it is important that at least one glycosylation site
(-Asn-Y-Thr/Ser-) is retained to provide for efficient
secretion.
It is also necessary that the leader retain a functional
.alpha.-factor signal sequence. As indicated above, the signal
peptide is usually about 20 amino acids in length, and
characteristic features including a hydrophobic core. See, e.g.,
von Heijne, (1984) J. Mol. Biol. 173:243-251. All of the
prepro-.alpha.-factor sequences examined today encode for a
hydrophobic peptide of about 20 residues in length. While the exact
length of a signal peptide necessary to direct the precursor
polypeptide to the secretory pathway is not defined, it will
usually require between about 19 and about 23 residues, the minimum
sequence required being readily definable by the testing of
deletion mutants.
Thus, with reference to MF.alpha.1, deletions within the range of
about 30 to about 60 residues, typically between about 33 and about
58 residues, and more typically between about 48 and about 58
residues, is contemplated by the present invention. These deletions
will generally occur in the region between and including residues
26 through 83. It is preferred that the deletions include the
glycosylation sites at residues 57-59 and 67-69. The deleted
.alpha.-factor leader sequences may be replaced, in part, by
non-.alpha.-factor leader sequences, if desired. The sequences
should generally encode hydrophilic amino acid residues, should not
encode glycosylation or processing sites, and preferably should be
selected to maintain the overall length of the leader to be about
50 residues or less, preferably about 23 to 40 residues, and most
preferably about 25 to 35 residues.
As indicated above, the leader sequence of the present invention
has immediately 3' thereto a processing site which allows for the
cleavage of the leader from the non-yeast protein sequence to which
it is fused in the precursor polypeptide. The processing site
employed in the present invention is defined as the codons defining
the minimum number of amino acid residues which are specifically
recognized for cleavage by the selected process (e.g., chemical,
enzymatic, etc.). Various processing sites are known in the art,
including both those active in vivo and in vitro. For example, the
processing site may provide for in vitro processing by encoding a
cleavage site for a proteolytic enzyme which does not occur in the
yeast host. The recovered precursor polypeptide would then be
treated with the enzyme to cleave the non-yeast protein from the
precursor. Another in vitro processing site is a methionine codon
which can be cleaved by post-expression treatment with cyanogen
bromide. See, e.g., U.S. Pat. No. 4,366,246.
In vivo processing sites can be selected from any peptide signals
recognized by a yeast proteolytic enzyme which will provide for
expression of the desired non-yeast protein sequence. Particularly
preferred processing sites are those for the enzymes involved in
processing of native prepro-.alpha.-factor. For example, dipeptidyl
aminopeptidase A (DPAPase A) removes terminal -X-Ala- sequences,
where X is Glu or Asp. See, e.g., Julius et al. (1983) Cell
32:839-852. The endopeptidase encoded by the KEX2 gene cleaves
basic dipeptides comprised of Lys and Arg residues; i.e., Lys-Arg,
Arg-Arg, Arg-Lys and Lys-Lys. Fuller et al., Microbiology 1986, pp.
273-278 (1986). In yeast, the .alpha.-factor precursor is first
cleaved by the KEX2 endopeptidase, and then the N-termini are
trimmed by DPAPase A to provide mature .alpha.-factor pheromone.
Since it appears that the latter proteolytic process is a rate
limiting step, it is preferred to eliminate the signals for DPAPase
A, such that the processing site is comprised only of the signal
for the KEX2 endopeptidase. In such an embodiment, therefore, the
leader sequence will be joined to the non-yeast protein sequence by
the dibasic peptide recognition site for KEX2 endopeptidase, such
as Lys-Arg or Arg-Arg.
The carboxy-terminal portion of the precursor polypeptide of the
present invention is a non-yeast protein. The DNA sequence encoding
this portion is defined herein as beginning with the first codon
downstream (3' direction) from the last codon of the processing
site through to the translation stop codon which defines the
carboxy-terminal of the precursor polypeptide. This DNA sequence
will be considered to encode a "non-yeast protein" when, over its
entire sequence, it defines a polypeptide that is not substantially
homologous to a polypeptide expressed by yeast. In general, the
preferred non-yeast proteins will be mammalian protein sequence
(including their analogs; i.e., "muteins", fragments, etc) As
defined herein, non-yeast proteins can include, therefore, a fusion
protein comprised of mammalian and yeast sequences, as well as
"pro" forms of the mature mammalian protein.
DNA sequences encoding the non-yeast proteins can be sequences
cloned from non-yeast organisms, or they can be synthetic
sequences, usually prepared using yeast-preferred codons. Usually,
the non-yeast proteins will be at least about 8 amino acids in
length and can include polypeptides up to about 100,000 daltons or
higher. Usually, the non-yeast polypeptide sequence will be less
than about 300,000 daltons, and more usually less than about
150,000 daltons. Of particular interest are polypeptides of from
about 5,000 to about 150,000 daltons, more particularly of about
5,000 to about 100,000 daltons. Illustrative non-yeast proteins of
interest include hormones and factors, such as growth hormone,
somatomedins, epidermal growth factor, luteinizing hormone,
thyroid-stimulating hormone, oxytocin, insulin, vasopressin, renin,
calcitonin, follicle-stimulating hormone, prolactin,
erythropoietin, colony-stimulating factors, lymphokines such as
interleukin-2, globins, immunoglobulins, interferons (e.g.,
.alpha., .beta. or .gamma.), enzymes, .beta.-endorphin enkephalin,
dynorphin, insulin-like growth factors, etc.
In a preferred embodiment of the present invention, DNA constructs
encoding the above-described precursor polypeptides have the
structure:
wherein AF encodes a yeast alpha-factor signal peptide; CHO encodes
a glycosylation site; X.sub.n encodes a polypeptide of n amino
acids in length that does not contain a glycosylation site or
processing site that will cause the precursor polypeptide to be
cleaved in vivo by the yeast host; n is an integer from 0 to about
30; Gene* encodes a non-yeast protein; and S encodes a processing
site that provides for cleavage of said precursor polypeptide.
The signal peptide encoded by AF is the same .alpha.-factor signal
peptide described above. It is approximately 20 residues in length
(e.g., about 19-23) and is of sufficient length to direct the
precursor polypeptide into the yeast secretory pathway. The precise
minimum or maximum length can be determined for a particular
.alpha.-factor by screening a series of deletion constructs.
The DNA sequence defined by CHO encodes a glycosylation site. It
will generally be nine nucleotides in length, including three
codons for the amino acids Asn-Y-Y'-, wherein Y is any amino acid
residue, and Y' is Thr or .[.Set.]. .Iadd.Ser.Iaddend..
X.sub.n, if present, encodes, for example, portions of the
.alpha.-factor leader which are not deleted or unrelated amino acid
sequences. In general, X.sub.n will be a maximum of about 30 amino
acid residues, more preferably a maximum of about 20 residues, and
most preferably a maximum of about 10 residues. While it may not be
necessary for X.sub.n to encode any polypeptides (i.e., n=0), it
may be desired to provide some spacing between the glycosylation
site CHO, and the processing site S in the event that carbohydrate
additions at the glycosylation site sterically hinder access of the
agent which cleaves the processing sites. In such case, n will
usually be a minimum of about 1, more preferably a minimum of about
2, while most preferably a minimum of about 3.
It is preferred that X.sub.n, if present, not contain any
functional glycosylation sites or processing sites recognized and
cleaved by the yeast host. Further, when departing from sequences
found in an .alpha.-factor leader, it is preferred to select
hydrophilic amino acid residues. It is possible that the length of
X.sub.n will affect the efficiency of expression and secretion of
the non-yeast protein. Selection of the appropriate length of
X.sub.n to optimize expression can be done through screening
constructs of various sizes.
The non-yeast protein encoded by Gene* and the processing site
encoded by S are as described above.
The DNA constructs of the present invention will normally be
maintained in a replicon capable of stable maintenance in a host,
particularly a yeast host. The replicons, usually plasmids, will
include one or more replication systems, desirably two replication
systems, allowing for maintenance of the replicon in both a yeast
host for expression, and in a procaryotic host for cloning.
Examples of such yeast-bacteria shuttle vectors include YEp24
[Botstein et al. (1979) Gene 8:17-24], pC1/1 [Brake et al. (1984)
Proc. Natl. Acad. Sci. USA 81:4642-4646], and YRp17 [Stnichomb et
al. (1982) J. Mol. Biol. 158:157]. Furthermore, a plasmid
expression vector may be a high or low copy number plasmid, the
copy number generally ranging from about 1 to about 200. With high
copy number yeast vectors, there will generally be at least 10,
preferably at least 20, and usually not exceeding about 150 copies
in a single host. Depending upon the non-yeast protein selected,
either a high or low copy number vector may be desirable, depending
upon the effect of the vector and the foreign protein on the host.
See, e.g., Brake et al., supra. DNA constructs of present invention
can also be integrated into the yeast genome by an integrating
vector. Examples of such vectors are known in the art. See, e.g.,
Botstein et al., supra.
The selection of suitable yeast and other microorganism hosts for
the practice of the present invention is within the skill of the
art. When selecting yeasts hosts for expression, suitable hosts may
include those shown to have, inter alia, good secretion capacity,
low proteolytic activity, and overall robustness. Yeast and other
microorganisms are generally available from a variety of sources,
including the Yeast Genetic Stock Center, Department of Biophysics
and Medical Physics, University of California, Berkeley, Calif.;
and the American Type Culture Collection, Rockville, Md.
Methods of introducing exogenous DNA into yeast hosts are well
known in the art. There is a wide variety of ways to transform
yeast. For example, spheroplast transformation is taught, for
example, by Hinnen et al. (1978) Proc. Natl. Acad. Sci. USA
75:1919-1933, and Stinchcomb et al., EPO Publication No. 45,573.
Transformants are grown in an appropriate nutrient medium, and,
where appropriate, maintained under selective pressure to insure
retention of endogenous DNA. Where expression is inducible, growth
can be permitted of the yeast host to yield a high density of
cells, and then expression is induced. The secreted, processed
non-yeast protein can be harvested by any conventional means, and
purified by chromatography, electrophoresis, dialysis,
solvent-solvent extraction, and the like.
EXAMPLES
The following examples are provided for illustrative purposes only,
and are not intended to limit the scope of the present invention.
It is believed that the deposit of the starting biological
materials is not necessary for the practice of the present
invention since either the same or equivalent materials are
publicly available.
Example I
The following example provides a comparison of the levels of
expression and secretion obtained with modified .alpha.-factor
constructs used to express human proinsulin. Three constructs
employ full-length .alpha.-factor leaders; one having
.alpha.-factor leader with the three native glycosylation sites,
one having all three of the glycosylation sites eliminated, and one
having all of the sites, except the one at Asn.sub.23, removed. The
fourth construct is a truncated .alpha.-factor leader which retains
a single glycosylation site at Asn.sub.23.
A. pYGAI1
This plasmid encodes an .alpha.-factor leader [Brake et al. (1984)
Proc. Natl. Acad. Sci. USA 81:4642-4646; EPO Publication No.
116,201] linked to human proinsulin. The proinsulin is encoded by a
synthetic gene made with yeast preferred codons (FIG. 1). The
.alpha.-factor leader sequence, the synthetic proinsulin gene and
the .alpha.-factor terminator sequence are from pYBCA5, the
construction of which is shown in FIG. 1. Transcription is mediated
by the 404 bp BamHI-NcoI GAPDH promoter fragment. Travis et al.
(1985) J. Biol. Chem. 260:4384-4389. The 1206 bp BamHI expression
cassette consisting of the GAPDH promoter, the sequence encoding
the .alpha.-factor leader linked to proinsulin and the
.alpha.-factor terminator was cloned into the unique BamHI site of
the yeast shuttle vector pAB24 (below) or pC1/1 such that the GAPDH
promoter sequence was proximal to the SalI site of the vector to
give the plasmids pYGAI1-AB24 or pYGAI1-C1/1, respectively. The
1206 bp BamHI expression cassette was also subcloned into the
unique BamHI site of a derivative of pBR322
[pBR322(.DELTA.EcoRI-SalI)BamHI; Travis et al. supra.] This plasmid
was called pGAI1.
Plasmid pAB24 (FIG. 4) is a yeast shuttle vector which contains the
complete 2.mu. sequence [Broach, in: Molecular Biology of the Yeast
Saccharomyces, Vol., 1, p. 445 (1981)] and pBR322 sequences. It
also contains the yeast URA3 gene derived from plasmid YEp24
[Botstein et al. (1979) Gene 8:17] and the yeast LEU2d gene derived
from plasmid pC1/1. EPO Publication No. 116,201. Plasmid pAB24 was
constructed by digesting YEp24 with EcoRI and religating the vector
to remove the partial 2.mu. sequences. The resulting plasmid,
YEp24.DELTA.RI, was linearized by digestion with ClaI and ligated
with the complete 2.mu. plasmid which had been linearized with
ClaI. The resulting plasmid, pCBou, was then digested with XbaI and
the 8605 bp vector fragment was gel isolated. This isolated XbaI
fragment was ligated with a 4460 bp XbaI fragment containing the
LEU2d gene isolated from pC1/1; the orientation of the LEU2d gene
is in the same direction as the URA3 gene.
B. pYGAI3
Plasmid pYGAI3 differs from pYGAI1 in that it encodes a modified
.alpha.-factor leader wherein the codons for Asn at residues 23, 57
and 67 have been changed to encode Gln, thereby eliminating all
three signals for N-linked glycosylation.
The .alpha.-factor leader and the N-terminal 13 amino acids of
proinsulin encoded by this plasmid were constructed by ligation of
synthetic oligonucleotides to give a 294 bp fragment with a 5' NcoI
overhang and a 3' HindIII overhang, the sequence which is shown in
FIG. 2. The sequence of appropriate oligonucleotides was altered
during the synthesis so that codons which specified Asn at
positions 23, 57 and 67 of the natural .alpha.-factor leader now
specified Gln at the same positions. The DNA sequence specifying
the N-terminal 13 amino acids of proinsulin was identical to that
in pYGAI1. The 294 bp synthetic DNA (NcoI-HindIII) fragment was
substituted for the comparable fragment of pGAI1 and pYGAI1-C1/1
which gave the plasmids pGAI3 and pYGAI3, respectively.
C. pYGAI8
Plasmid pYGAI8 contains DNA encoding an .alpha.-factor leader which
eliminates two of the three glycosylation sites. Asn.sub.57,67 have
been modified to Gln.sub.57,67. The resulting plasmid has only a
single glycosylation site at position Asn.sub.23. pYGAI8 was
prepared as follows.
First, a 5' fragment was isolated from the expression cassette of
pGAI1 by cutting with HpaII, followed by cutting with BamHI, and
then gel isolating a 504 bp fragment containing the GAPDH promoter
and the sequence encoding residues 1-33 of the .alpha.-factor
leader. Next, plasmid pYGAI3 encoding an .alpha.-factor leader
lacking glycosylation sites was also sequentially cut with HpaII
and BamHI, and a 702 bp fragment isolated containing sequences
encoding modified .alpha.-factor leader residues 34-83, the LysArg
processing site, the proinsulin sequence and the .alpha.-factor
termination sequence. This fragment was then ligated to the 504 bp
fragment from pGAI1, cut with BamHI and a 1206 bp fragment
isolated.
The above 1.2 kb BamHI fragment which contained a complete GAPDH
promoter/.alpha.-factor leader/proinsulin/.alpha.-factor terminator
expression cassette was then ligated into BamHI-cut and
phosphatase-treated pBR322(AEcoRI-SalI-)BamHI to give plasmid
pGAI8, which was cloned in E. coli.
The 1.2 kb expression cassette from pGAI8 was removed by cutting
with BamHI and then gel isolating the fragment. It was ligated into
BamHI-cut and phosphatase-treated yeast shuttle vector pAB24.
Insertion of the expression cassette was in the unique BamHI site
of the pBR322 sequences such that the GAPDH promoter was proximal
to the unique SalI site of the vector. This plasmid was pYGAI8.
D. pYGAI7
Plasmid pYGAI7 contains the DNA encoding a truncated .alpha.-factor
leader and the synthetic gene for human proinsulin. The
.alpha.-factor leader has been truncated so that it encodes only
amino acids 1-35 of the .alpha.-factor leader and therefore
contains a single site for glycosylation at Asn.sub.23. This yeast
expression vector was constructed as follows.
First, pGAI1 was cut with HindIII. An HPalI-HindIII linker was
added of the following structure:
5'-CGGCTAAAAGATTCGTTAACCAACACTTGTGTGGTTCTCACTTGGTTGA
CGATTTTCTAAGCAATTGGTTGTGAACACACCAAGAGTGAACCAACTTCGA-5'
After adding the linker, the linearized plasmid was cut with BamHI,
and a 558 bp HpaII-BamHI fragment was gel isolated. This fragment
contains the codons for residues 34-35 of the .alpha.-factor leader
linked directly to a Lys-Arg processing site and the proinsulin
sequence. There are no intervening sequences between the codon for
residue 35 of the .alpha.-factor leader and the processing site
directly adjacent to the proinsulin sequence.
Second, pGAI1 was cut with HpaII and BamHI, and a 504 bp fragment
gel isolated. This fragment contains the GAPDH promoter and
nucleotides encoding amino acids 1-33 of the .alpha.-factor leader,
the 3' end terminating in an HpaII overhang complementary to the 5'
end of the above-described 558 bp HpaII-BamHI fragment. These two
fragments were ligated together and cut with BamHI to provide an
expression cassette containing the GAPDH promoter, sequences
encoding a modified .alpha.-factor leader containing residues 1-35
directly linked to a Lys-Arg processing site, the proinsulin gene,
and the .alpha.-factor terminator. The cassette was then ligated
into a BamHI site of pBR322(.DELTA.EcoRI-SalI)BamHI, as described
above, to give plasmid pGAI7 and cloned in E. coli.
pGAI7 was then cut with BamHI, and the 1062 bp expression cassette
gel isolated. The expression cassette was then ligated into the
BamHI site of pAB24 to give plasmid pYGAI7.
E. Comparative Expression
Plasmids pYGAI1-G1/1, pYGAI3, pYGAI1-AB24, pYGAI7 and pYGAI8 were
transformed into Saccharomyces cerevisiae strain AB103.1
(Mat.alpha., leu2-3,112,ura3-52, his4-580, pep4-3[cir.degree.])
essentially as described by Hinnen et al. (1978) Proc. Natl. Acad.
Sci. USA 75:1929-1933. Transformants of pYGAI1-C1/1 and pYGAI3 were
selected for leucine prototrophy, transformants of the other
plasmids were selected for ura prototrophy.
Data shown in Table 1 compares secretion of proinsulin mediated by
the natural .alpha.-factor leader (pYGAI1-C1/1) or the
.alpha.-factor leader with Gln substituted for Asn at positions 23,
57 and 67 (pYGAI3). Inoculum cultures (-2 ml of individual
transformants) were grown for 48 hr in synthetic complete medium
lacking leucine [SD-leu; Sherman et al., Methods in Yeast Genesis,
p. 62 (Cold Spring Harbor Laboratory, 1982)] and diluted 20-fold
into the same medium. Cultures were grown 48-72 hrs, culture
supernatants were prepared by centrifugation and were assayed for
immunoreactive cross-reacting insulin-like material (ILM) in a
competition radioimmune assay with .sup.125 I-labeled insulin. As
can be seen in Table 1, elimination of the three glycosylation
sites from the .alpha.-factor leader resulted in essentially no
secretion of insulin-like-material compared to that mediated by the
native .alpha.-factor leader.
Data presented in Table 2 compares transformants of pYGAI1-pAB24
(full-length native .alpha.-factor leader), pYGAI8 (full-length
.alpha.-factor leader with only one glycosylation site at
Asn.sub.23) and pYGAI7 (truncated .alpha.-factor leader containing
a single glycosylation site at Asn.sub.23) for their ability to
secrete insulin-like-material. Inoculum cultures of the indicated
transformants (.about.2 ml) in SD-Leu grown for .about.48 hr at
30.degree. C. were pelleted by centrifugation washed and diluted
20-50 fold into ura.sup.- medium. This medium contains 0.67% yeast
nitrogen base, 1% succinic acid, 0.35% NaOH, 0.5% casamino acids,
2% glucose, 0.005% adenine, 0.01% tryptophan and 0.02%
threonine.
Cultures were grown at 30.degree. C. for 48-72 hr, and culture
supernatants prepared and assayed as described above. Data
presented in Table 2 show that the transformants carrying the
construct employing the truncated .alpha.-factor leader retaining a
single glycosylation site at Asn.sub.23 secreted generally more
immunoreactive insulin-like-material than did transformants bearing
the construct with the full-length native .alpha.-factor leader.
Transformants bearing the construct with the full-length
.alpha.-factor leader with the same single glycosylation site
(Asn.sub.23) secreted much less insulin cross-reactive material
than did transformants bearing the full-length native
.alpha.-factor leader or the truncated .alpha.-factor leader.
TABLE 1 Effect of Elimination of .alpha.-Factcr Leader
Glycosylation Sites on Secretion of Insulin-Like-Material ILM.sup.1
Transformant OD.sub.650 .mu.g/ml .mu.g/ml, OD.sub.650
AB103.1[pYGAI1-C1/1] -1 5.9 .24 .04 -2 5.9 .24 .04 -3 2.1 .08 .04
AB103.1[pYGAI3] -1 ND .003 -- -2 ND .007 -- .sup.1 Cross-reactive
insulin-like-material (ILM) as determined by a competition
radioimmune assay with .sup.125 I-labeled insulin and insulin
standards. Data is reported as ILM secreted per ml of culture and
in some cases as ILM secreted per ml normalized to a culture cell
density with an absorbance at wavelength 650 m.mu. of 1.
TABLE 1 Effect of Elimination of .alpha.-Factcr Leader
Glycosylation Sites on Secretion of Insulin-Like-Material ILM.sup.1
Transformant OD.sub.650 .mu.g/ml .mu.g/ml, OD.sub.650
AB103.1[pYGAI1-C1/1] -1 5.9 .24 .04 -2 5.9 .24 .04 -3 2.1 .08 .04
AB103.1[pYGAI3] -1 ND .003 -- -2 ND .007 -- .sup.1 Cross-reactive
insulin-like-material (ILM) as determined by a competition
radioimmune assay with .sup.125 I-labeled insulin and insulin
standards. Data is reported as ILM secreted per ml of culture and
in some cases as ILM secreted per ml normalized to a culture cell
density with an absorbance at wavelength 650 m.mu. of 1.
Example II
This example compares the expression of a full-length
.alpha.-factor leader construct, retaining all glycosylation sites,
to an expression construct employing a truncated .alpha.-factor
sequence retaining only a single glycosylation site at Asn.sub.23.
The non-yeast protein employed in this example is a human
proinsulin analog wherein the connecting "C" peptide has been
replaced by a yeast KEX2 endopeptidase cleavage site.
A. pYGAIC3
The plasmid pGAIC3 was made by replacing the 231 bp HindIII-SalI
fragment of pGAI1 which encodes amino acids 14 through 30 of the B
chain, the C-peptide, the A chain and 2 translation stop codons
with a 132 bp synthetic HindIII-SalI gene fragment (shown in FIG.
3) which encodes amino acids 14 through 30 of the B chain, a
Lys-Arg KEX2 endopeptidase cleavage site, the A chain, and
translation stop codons. The plasmid pYGAIC3 was prepared from
pGAIC3 as follows.
Plasmid pGAIC3 was digested with BamHI, and the 1107 bp BamHI
expression cassette containing the GAPDH promoter, the sequence
encoding .alpha.-factor leader linked to proinsulin analog, and the
.alpha.-factor transcription terminator was isolated and ligated
into BamHI digested and phosphatase-treated pAB24, and then cloned
in E. coli. Plasmid pYGAIC3 was obtained, in which the expression
cassette was oriented such that the GAPDH promoter was proximal to
the unique SalI site of the vector.
B. pY.alpha.f.sub.L 7C3
Plasmid pY.alpha.F.sub.L 7C3 contains DNA encoding the truncated
.alpha.-factor leader described above for pYGAI7 linked to the
sequence for the proinsulin analog, also described above (pYGAIC3).
This plasmid was constructed as follows.
First, pGAIC3 was cut with HindIII and SalI, and a 132 bp fragment
was gel isolated. This fragment contains sequences encoding all but
the first 12 codons of the proinsulin analog. It was ligated into a
gel isolated 4640 bp fragment from HindIII- and Sail-digested pGAI7
to provide plasmid p.alpha.f.sub.L 7C3. After cloning in E. coli,
this plasmid was cut with BamHI and a 1062 bp BamHI fragment was
gel isolated. This expression cassette contains the truncated
.alpha.-factor leader construct of pGAI7 with the proinsulin analog
in place of the normal proinsulin sequence. The expression cassette
was then ligated into the BamHI site of pAB24, as described above,
to give pY.alpha.f.sub.L 7C3.
Comparative Expression
Expression levels were determined for pYGAIC3 and pY.alpha.f.sub.L
7C3 in two strains of S. cerevisiae. Strain AB103.1 has been
described in Example I. Strain AB110-4 is a derivative of
Saccharomyces cerevisiae strain AB110 (Mat.alpha., leu2, ura3-52,
pep4-3, his4-580[cir.degree.]) in which a deletion has been
engineered into the pep4 gene. These strains were transformed as
described above with plasmids pYGAIC3, and pY.alpha.f.sub.L 7C3,
and ura prototrophs were selected. Inoculum cultures were grown in
SD-leu [Sherman et al., supra.] at 30.degree. C. for 24-48 hours
then pelleted by centrifugation, washed and diluted 20 fold into
ura.sup.- medium (described above) and grown for 48-72 hours at
30.degree. C. Cell-free conditioned culture medium was prepared by
centrifugation for assay in a competition insulin radioimmune
assay.
The results are shown in Table 3. As can be seen the truncated
.alpha.-factor construct mediates increased secretion of
immunoreactive proinsulin analog, compared to the natural
.alpha.-factor leader sequence.
TABLE 3 Secretion of ILM from a Proinsulin Analog Construct
Mediated by a Truncated .alpha.-Factor Leader or Natural
.alpha.-Factor Leader ILM.sup.2 No. of .mu.g/ml .mu.g/ml OD.sub.650
Transformant Tests.sup.1 Range Mean Std. dev. Range Mean Std. dev.
AB103.1 6 1-2.75 1.66 .65 .11-.20 .14 .04 [pYGA1C3] AB103.1 6
1.5-6.63 4.46 2.15 .14-.60 .40 .19 [py.alpha.f.sub.L 7C3] AB110.4 3
1.15-1.4 1.28 .13 .10-.12 .11 .01 [pYGAIC3] AB110.4 3 2.15-4.12
3.46 1.14 .19-.38 .31 10 [py.alpha.f.sub.L 7C3] .sup.1 A minimum of
three independent transformants were tested. .sup.2 Secreted
cross-reactive insulin-like-material (ILM) was determined by a
competition radioimmune assay with .sup.125 I-labeled insulin and
insulin standards. Results are reported as amounts of ILM per ml of
culture and as amount secreted per ml normalized to a cell density
with an absorbance at 650 m.mu. wavelength = 1.
Example III
This example describes the construction of a truncated
.alpha.-factor expression vector which mediates increased levels of
active insulin-like growth factor-1.
First, a DNA sequence encoding a truncated .alpha.-factor leader
and a coding sequence for IFG1 was prepared. A synthetic sequence
was prepared by standard procedures employing an Applied Biosystems
380A DNA synthesis machine according to manufacturer's direction.
Fourteen DNA sequences were synthesized ranging from 22 to 57 bases
in length, purified by PAGE, and phosphorylated individually by T4
kinase in the presence of ATP. The sequences were then annealed and
ligated by standard procedures.
The sequence of the synthetic gene is shown in FIG. 5. The purified
synthetic gene fragment was cloned into NcoI/SalI digested pBS100
(described below). The resulting plasmid was called pBS100
T.alpha.f.sub.L IGF1.
Plasmid pBS100 contains a yeast expression cassette cloned into a
pBR322 derivative, pAB12. The expression cassette contains the
hybrid ADH-2/GAPDH promoter and the GAPDH terminator flanking a
non-essential gene segment. The ADH-2/GADPH promoter is a 1200 bp
BamHI-NcoI fragment isolated from pJS103 (see below) and the GAPDH
terminator is a 900 bp SalI-BamHI fragment isolated from plasmid
pPAG1. EPO Publication No. 164,556. Plasmid pBS100 also contains a
non-essential fragment between NcoI and SalI sites which is
replaced by gene fragments of interest. The expression cassette can
be removed from pBS100 by digestion with BamHI and cloned into
yeast shuttle vectors for introduction into yeast cells.
Plasmid pJS103, which contains the hybrid ADH-2/GAPDH promoter
employed above, was constructed as follows. The ADH-2 portion of
the promoter was constructed by cutting a plasmid containing the
wild-type ADH2 gene from plasmid pADR2 [Beier et al. (1982) Nature
300:724-728] with restriction enzyme EcoR5, which cuts at position
+66 relative to the ATG start codon, as well as in two other sites
in pADR2, outside of the ADH2 region. The resulting mixture of a
vector fragment and two smaller fragments was reacted with Ba131
exonuclease to remove about 300 bp. Synthetic XhoI linkers were
ligated onto the Ba131-treated DNA. The resulting DNA linker vector
fragment (about 5 kb) was separated from the linkers by column
chromatography, cut with restriction enzyme XhoI, religated, and
used to transform E. coli to ampicillin resistance. The positions
of the XhoI linker were determined by DNA sequencing. One plasmid
which contained an XhoI linker within the 5' nontranscribed region
of the ADH2 gene (position -232 from ATG) was cut with the
restriction enzyme XhoI, treated with nuclease S1, and subsequently
treated with the restriction enzyme EcoRI to create a linear vector
molecule having 1 blunt end at the site of the XhoI linker and an
EcoRI end. The GAPDH portion of the promoter was constructed by
cutting plasmid pPGAP [EPO Publication No. 164,556] with the
enzymes BamHI and EcoRI, followed by the isolation of the 0.4 Kbp
DNA fragment. This purified fragment was then completely digested
with the enzyme AluI and an approximately 200 bp fragment was
isolated. This GAPDH promoter fragment was ligated to the ADH-2
fragment present on the linear vector described above to give
plasmid JS103.
A BamHI fragment was then isolated from pBS100 T.alpha..sub.fL
IGF1. This fragment contains the ADH2/GAPDH promoter, a truncated
.alpha.-factor leader (AA 1-25, 81-83) a LysArg processing site, a
coding sequence for IGF1, and the GAPDH terminator sequence. This
BamHI fragment was then cloned into pAB24, previously digested with
BamHI. A positive clone was selected, and while initially called
plasmid 18.5, it was subsequently named pYLUIGF1-55. (See FIG.
6.)
A second expression vector, pYLUIGF1-24 was also prepared by
analogous methods. A restriction map is shown in FIG. 7. This
vector is similar to pYLUIGF1-55, except that it has a full-length
.alpha.-factor leader directing secretion with three glycosylation
sites (compare Example I.A.) and the .alpha.-factor terminator.
Yeast strain AB110 (EPO Publication No. 164,556) was transformed
with pYLUIGF1-55 and pYLUIGF1-24 by conventional spheroplasting
techniques [Hinnen et al. (1978) Proc. Natl. Acad. Sci. USA
75:1919-1933], and expression compared.
The expression of IGF1 from AB110 (pYLUIGF1-55) and AB110
(pYLUIGF1-24) is non-constitutive. Induction of IGF1 expression was
achieved by bringing about a low concentration of glucose in the
growth medium. Under standard conditions, shake flask cultures (25
ml) fully utilize the glucose in the medium by 18-24 hours post
inoculation. Thus, 25 ml cultures of AB110 (pYLUIGF1-55) and AB110
(pXLUIGF1-24) were grown under standard conditions for 72 hours.
Supernatant samples were taken at 49 and 72 hours post inoculation
and assayed for IGF1 biological activity (RigA) and for
immunoreactivity (RIA) with anti-IGF1 antibodies. As can be seen,
pYLUIGF1-55, with a truncated .alpha.-factor leader, secreted
protein of which a substantially greater fraction was biologically
active. Although pYLUIGF1-24 secreted more protein that showed
reactivity with IGF1 antibodies, relatively little of this protein
was biologically active.
The results are shown in Table 4. The radioreceptor assay (RRA)
measures the ability of IGF-1 to bind to its receptor. This is a
measure of the biological activity of recombinant polypeptide since
it is believed that IGF-1 exerts all of its activity through its
receptor. The receptor assay is described in Marshall et al. (1974)
J. Clin. Endorinol. Metab. 19:283-292. The radioimmunoassay (RIA)
is a competitive assay that measures the amount of protein
antigenically cross-reactive with native IGF-1, whether or not it
is biologically active. The assay is described in Zapf et al.
(1981) J. Clin. Invest. 68:1321-1330.
TABLE 4 Secretion of IGF1 Mediated by a Truncated .alpha.-Factor
Leader or a Natural .alpha.-Factor Leader Transformant 49 hrs 72
hrs RRA.sup.1 RIA.sup.2 RRA RIA AB110 1.0 14 1.3 14 (pYLUIGF1-55)
AB110 1.3 54 2.7 66 (pYLUIGF1-24) .sup.1.mu.g/ml .sup.2.mu.g/ml
Deposit of Biological Materials
The following expression vectors were deposited with the American
Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville,
Md., U.S.A., and will be maintained under the provisions of the
Budapest Treaty. The accession numbers and dates of deposit are
listed below.
Deposited Material ATCC Number Deposit Date E. coli (pYGAI7) 67597
12/29/87 E. coli (pY.alpha.f.sub.L 7C3) 67596 12/29/87 E. coli
(pYLUIGFI-55) 67595 12/29/87
These deposits are provided for the convenience of those skilled in
the art. These deposits are neither an admission that such deposits
are required to practice the present invention nor that equivalent
embodiments are not within the skill of the art in view of the
present disclosure. The public availability of these deposits is
not a grant of a license to make, use or sell the deposited
materials under this or any other patent. The nucleic acid
sequences of the deposited materials are incorporated in the
present disclosure by reference, and are controlling if in conflict
with any sequences described herein.
Although the foregoing invention has been described in some detail
for the purpose of illustration, it will be obvious that changes
and modifications may be practiced within the scope of the appended
claims by those of ordinary skill in the art.
* * * * *