U.S. patent number RE35,749 [Application Number 08/710,744] was granted by the patent office on 1998-03-17 for constructs of glyceraldehyde-3-phosphate dehydrogenase promoter and methods for expressing genes using said constructs.
This patent grant is currently assigned to Chiron Corporation. Invention is credited to Steven Rosenberg, Patricia Tekamp-Olson.
United States Patent |
RE35,749 |
Rosenberg , et al. |
March 17, 1998 |
Constructs of glyceraldehyde-3-phosphate dehydrogenase promoter and
methods for expressing genes using said constructs
Abstract
Yeast promoters of glycolytic enzymes are modified by isolating
a fragment encompassing the RNA polymerase binding site and joining
to the 5' end of this fragment a DNA sequence providing for
enhanced inducible or constitutive transcription of a structural
gene. Constructs are prepared for efficient expression of foreign
genes in yeast. Yeast strains 2150-2-3(pC1/1GAPSOD) and
AB110(pC1/1GAPATi9), producing human .alpha..sub.1 -antitrypsin and
superoxide dismutase, were desposited at the A.T.C.C. on May 9,
1984 and given Accession Nos. 20708 and 20709, respectively; and
2150-2-3(GAP5), 2150-2-3(Pyk5) and 2150-2-3(PHO5GAP1), expressing
Hepatitis B surface antigen, were deposited at the A.T.C.C. on May
9, 1984 and given Accession Nos. 20705, 20706 and 20707,
respectively.
Inventors: |
Rosenberg; Steven (Oakland,
CA), Tekamp-Olson; Patricia (San Francisco, CA) |
Assignee: |
Chiron Corporation (Emeryville,
CA)
|
Family
ID: |
27413075 |
Appl.
No.: |
08/710,744 |
Filed: |
September 20, 1996 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
635048 |
Dec 28, 1990 |
|
|
|
|
380783 |
Jul 18, 1989 |
5089398 |
|
|
|
73381 |
Jul 13, 1987 |
|
|
|
|
609540 |
May 11, 1984 |
|
|
|
|
468589 |
Feb 22, 1983 |
|
|
|
Reissue of: |
042134 |
Apr 2, 1993 |
05349059 |
Sep 20, 1994 |
|
|
Current U.S.
Class: |
536/24.1;
435/254.2; 435/254.21; 435/320.1; 435/69.3 |
Current CPC
Class: |
C07K
14/005 (20130101); C07K 14/8125 (20130101); C12N
9/0089 (20130101); C12N 15/62 (20130101); C12N
15/81 (20130101); C07K 2319/00 (20130101); C07K
2319/02 (20130101); C07K 2319/40 (20130101); C07K
2319/75 (20130101); C12N 2730/10122 (20130101) |
Current International
Class: |
C07K
14/005 (20060101); C07K 14/02 (20060101); C07K
14/81 (20060101); C12N 9/02 (20060101); C12N
15/81 (20060101); C12P 019/34 (); C12N
015/11 () |
Field of
Search: |
;435/69.1,69.2,69.3,172.3,254.2,254.21,320.1,189,192 ;536/23.1,24.1
;935/41 |
Foreign Patent Documents
|
|
|
|
|
|
|
0060057 A1 |
|
Sep 1982 |
|
EP |
|
0072318 A2 |
|
Feb 1983 |
|
EP |
|
0073657 A1 |
|
Mar 1983 |
|
EP |
|
0096910 A1 |
|
Dec 1983 |
|
EP |
|
Other References
Van Vuuren et al. (1987) Am. J. Enol. Vitic. 38: 49-53, abstract
cited. .
Bennetzen, J.L. et al., "Codon Selection in Yeast", J. Of Biol.
Chem., 1982, 257(6), 3026-3031. .
Burnette, W.N., et al., Developments in Biological Standardization,
"Properties and Relative Immunogenicity of Various Preparations of
Recombinant DNA-Derived Hepatitis B Surface Antigen", (Congress
Joint IABS/Who Symposium on Standardization and Control of
Biologicals Produced by Recombinant DNA Technology), 1983, 59,
113-120. .
Burnette, W.N. et al., Modern Approaches to Vaccines, "Production
of Hepatitis-B Recombinant Vacines", Cold Spring Harbor Laboratory,
1984, 245-250. .
Dobson, M.J. et al., "Conservation of high efficiency promoter
sequences in Saccharomyces cerevisiae", Nucl. Acids Res., 1982,
10(8), 2625-2637. .
Highfield, P.E., Developments in Biological Standardization,
"Impact of Genetic Engineering on Hepatitis B Virus", (Congress
Joint IABS/Who Symposium on Standardization and Control of
Biologicals Produced by Recombinant DNA Technology), 1983, 59,
121-124. .
Hitzeman, R.A. et al., "Expression of a human gene for interferon
in yeast", Nature, 1981, 293, 717-722. .
Holland, M.J. et al., "Isolation and Characterization of a Gene
Coding for Glyceraldehyde-3-phosphate Dehydrogenase from
Saccharomyces cerevisiae", J. Biol. Chem., 1979, 254(12),
5466-5474. .
Holland, J.P. et al., "The Primary Structure of a
Glyceraldehyde-3-phosphate Dehydrogenase Gene from Saccharomyces
cerevisiae", J. Biol. Chem., 1979, 254(19), 9839-9845. .
Holland, J.P. et al., "Structural Comparison of Two Nontandemly
Repeated Yeast Glyceraldehyde-3-Phosphate Dehydrogenase Genes", J.
Biol Chem., 1980, 255(6), 2596-2605. .
Holland, J.J. et al., "Structure and Expression of Yeast Glycolytic
Genes", 291-303. .
Miyanohara, A. et al., "Expression of hepatitis B surface antigen
gene in yeast", Proc. Natl. Acad. Sci. USA, 1983, 80, 1-5. .
Musti, A.M. et al., "Transcriptional mapping of two yeast genes
coding for glyceraldehyde 3-phosphate dehydrogenase isolated by
sequence homology with wit chicken gene", Gene, 1983, 133-143.
.
Oshima, T. et al., "Yeast Saccharomyces High Expression Vector",
5th Annual Meeting of the Japan Molecular Biology Institute
(Tokyo), 1982, Lecture Synopses No. A1-34, 37. .
Tekamp-Olson, P. et al., "Regulatory Regions of Yeast Pyruvate
Kinase and Glyceraldehyde-3-Phosphate Dehydrogenase Promoters",
(Abstract), Meeting on the Molecular Biology of Yeast, 1993, 197.
.
Tuite, M.F. et al., "Regulated high efficiency expression of human
interferon-alpha in Saccharomyces cerevisiae", IRL Press Limited,
Oxford, England, 1982, 603-608. .
Urdea, M.S. et al., "Chemical synthesis of a gene for human
epidermal growth factor urogastrone and its expression in yeast",
Proc. Natl. Acad. Sci. USA, 1983, 80, 7461-7465. .
Valenzuela, P. et al., "Characterization of Hepatitis B Surface
Antigen Particles Produced in Yeast and in Mammalian Cells",
(Abstract), Presented at the meeting on Modern Approaches to
Vaccines, 1983, 70..
|
Primary Examiner: LeGuyader; John L.
Attorney, Agent or Firm: Paintin; Francis A. McClung;
Barbara G. Blackburn; Robert P.
Parent Case Text
This application is a continuation of U.S. Ser. No. 07/635,048
filed Dec. 28, 1990, now abandoned, which is a continuation of U.S.
Ser. No. 07/380,783 filed Jul. 18, 1989, now U.S. Pat. No.
5,089,398, .Iadd.which is a continuation of Ser. No. 073,381, filed
Jul. 13, 1987, (now abandoned).Iaddend., which is a continuation of
U.S. Ser. No. 06/609,540 filed May 11, 1984, now abandoned, which
is a continuation-in-part of U.S. Ser. No. 06/468,589 filed Feb.
22, 1983, now abandoned.
Claims
What is claimed is:
1. A DNA construct for expression of heterologous proteins, wherein
said construct comprises:
a structural gene encoding said heterologous protein, wherein said
structural gene is under the regulatory control of a first domain;
and
.[.a.]. .Iadd.said .Iaddend.first domain .Iadd.being
.Iaddend.proximal to said structural gene, said first domain
comprising .Iadd.at least .Iaddend.about 200.[.-500.]. bp, and
including the RNA polymerase binding site and transcription
initiation site of the yeast Saccharomyces
glyceraldehyde-3-phosphate dehydrogenase gene.
2. The DNA construct of claim 1, wherein said structural gene
encodes Hepatitis B virus surface antigen.
3. The DNA construct of claim 2, wherein said construct is plasmid
PHO5GAP1. .Iadd.
4. A method for expressing and producing a heterologous protein in
yeast, which comprises:
expressing a structural gene encoding said heterologous protein in
a yeast expression vector having an inserted DNA construct to
produce said heterologous protein, said inserted DNA construct
comprising:
said structural gene being under the regulatory control of a first
domain; and
said first domain being proximal to said structural gene, said
first domain comprising at least about 200 bp and including the RNA
polymerase binding site and transcription initiation site of the
yeast Saccharomyces glyceraldehyde-3-phosphate dehydrogenase gene.
.Iaddend..Iadd.5. The method of claim 4 wherein said structural
gene encodes Hepatitis B virus
surface antigen. .Iaddend..Iadd.6. The method of claim 5 wherein
said expression vector comprises the plasmid PHO5GAP1.
.Iaddend..Iadd.7. The method of claim 4 wherein said structural
gene encodes a protein for vaccines. .Iaddend..Iadd.8. The method
of claim 4 wherein said first domain comprises about 200-500 bp.
.Iaddend..Iadd.9. The DNA construct of claim 1 wherein said first
domain comprises about 200-500 bp. .Iaddend.
Description
BACKGROUND OF THE INVENTION
1. Field of the Invention
With the advent of hybrid DNA technology, production of mammalian
proteins in microorganisms became a reality. For the first time,
mammalian proteins could be synthesized in a unicellular
microorganism by introduction of a gene encoding for the mammalian
protein under the transcriptional and translational control of
regulatory sequences recognized by the microorganism host. The
introduction of these foreign constructions into a microorganism
host resulted in competition between the regulatory signals of the
construct and the regulatory signal endogenous to the host for the
host systems involved with expression. The structural gene of
interest is usually directed to a product which, is nonproductive
and may be injurious to the host. Therefore, host cells which can
turn off the foreign gene can effectively dominate modified host
cells.
Substantially progress has been made in isolating sequences
concerned with transcriptional and translational regulation for
protein expression. But frequently flanking sequences, as well as
distant sequences, may also affect the efficiency and regulation of
the expression of the protein. Therefore, as one manipulates these
various sequences, removing them from their native environment, and
joining them to unnatural sequences, that is sequences other than
the wild-type sequence, one can never be certain as to the
result.
In order to enhance the economies of producing proteins in
microorganisms, there have been substantial efforts directed to
improving the efficiency of transcription and translation,
maximizing the proportion of total protein directed to production
of the desired product, enhancing the viability of the modified
host, as well as improving the efficiency with which the modified
host may be obtained.
2. Description of the Prior Art
Guarente et al., Proc. Natl. Acad. Sci. USA (1982) 79:7410-7414,
describes a hybrid promoter region employing the GAL4 regulatory
region. Guarente and Ptashne, ibid. (1981) 78:2199-2203, report the
presence of two domains in a yeast promoter, with a region upstream
from the TATA sequence providing an activation site. Kramer et al.,
ibid. (1984) 81:367-370, describe the regulated expression of a
human interferon gene in yeast employing the yeast acid phosphatase
promoter, where expression is induced by phosphate or a temperature
shift. Tekamp-Olson et al., Cold Spring Harbor Meeting, Molecular
Biology of Yeast, 1983, describe the absence of deleterious effects
on yeast viability when employing "short" promoters, as distinct
from the presence of such effects, when employing an extended
promoter region or "long" promoters.
SUMMARY OF THE INVENTION
Novel hybrid promoter regions are provided for use in conjunction
with constructs having a structural gene under the transcriptional
control of the hybrid promoter region and a terminator region. The
hybrid promoter comprises a first segment providing transcriptional
enhancement, either constitutive or regulated, and a second segment
defining an RNA polymerase binding site and transcriptional
initiation site. The hybrid promoter regions lack the deleterious
effects associated with a wild-type promoter region in recombinant
constructs, which results in reduced transformation efficiencies
and lower yeast viability.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a diagrammatic view of plasmids GAP1-6;
FIG. 2 is a diagrammatic view of plasmids Pyk1-6; and
FIG. 3 indicates the DNA linker sequence and a flow diagram showing
its use in a construct for hSOD.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS
Novel DNA fragments are provided as well as constructions employing
the fragments for enhanced expression of structural genes in a
yeast host. The constructs employing a hybrid promoter region
provide for enhanced efficiencies of transformation and greatly
improved viability of the yeast host as contrasted with those
employing a wild-type yeast promoter. Concomitant with the improved
viability is increased expression of a structural gene, in
comparison with the truncated promoter region, and, therefore,
greatly enhanced overall yields of expression products.
For the purposes of the subject invention, the "promoter region" is
divided into two domains: (1) the structural gene proximal region,
which includes the transcription initiation site, the "TATA"
sequence capping sequence, as appropriate, and an RNA polymerase
binding sequence, which sequence intends a sequence which includes
nucleotides upstream from the initiation site for directing the
initiation of synthesis of the messenger RNA; and (2) a distal
region which provides for regulated or constitutive expression,
with enhanced expression as compared to the first domain linked to
non-functional yeast DNA.
The hybrid promoters of the subject invention employ the RNA
polymerase binding region of a yeast glycolytic enzyme promoter and
a region upstream from said polymerase binding region, which is
different from the wild-type upstream region of the RNA polymerase
binding region and provides for enhanced efficiencies of
transcription. This distal region will be derived from either a
sequence, usually a yeast sequence, involved in regulation of
transcription, or a prokaryotic sequence which provides for
enhanced constitutive expression of the desired gene.
Conveniently, cassettes or constructs can be prepared which provide
for one or more restriction sites intermediate the promoter region
and a related terminator region where the structural gene may be
inserted, so as to be under the transcriptional control of the
hybrid promoter region. By leaving one or more restriction sites,
one can provide for ease of insertion of the structural gene
intermediate the transcription initiation and termination regions.
The cassettes which can be prepared comprising the transcriptional
initiation and termination region, having appropriate restriction
sites for structural gene insertion can be cloned in prokaryotic
vectors, so that after insertion of the structural gene, the
resulting cassette, including the structural gene, may be cloned,
isolated and purified, before introduction into a yeast vector.
The cassette, will for the most part, have the following formula:
##STR1## wherein:
P.R.(1) is the promoter region proximal to the structural gene and
having the transcription initiation site, the RNA polymerase
binding site, and including the TATA box, the CAAT sequence, as
well as translational regulatory signals, e.g., capping sequence,
as appropriate;
P.R.(-2) is the promoter region joined to the 5'-end of P.R.(1)
associated with enhancing the efficiency of transcription of the
RNA polymerase binding region;
R.S. is a sequence having one or more restriction recognition
sites, preferably at least two restriction recognition sites, where
the sites may result upon restriction into blunt ends or
overhangs;
T.R. intends the termination region, which will include the
terminator, which may be a stem and loop structure, and which may
be associated with one or more stop codon, a polyadenylation signal
sequence, if any, as well as any other transcriptional and
translational termination sequences.
P.R.(1) will generally be at least about 150 bp, more usually at
least about 200 bp, usually not more than about 600 bp, more
usually not more than about 500 bp, generally not more than about
450 bp and preferably less than about 400 bp; the sequence will
extend in the downstream direction of transcription to about bp +3,
more usually bp -1 and may extend only to bp -20, more usually to
bp -10 (the numbering intends that +1 is the first bp of the
initiation codon with which the promoter region is associated in
the wild-type host while -1 is the immediately upstream bp and the
integers increase in the direction of transcription;
P.R.(1) will be deprived from a strong yeast promoter, normally a
glycolytic enzyme promoter, such as glyceraldehyde-3-phosphate
dehydrogenase, pyruvate kinase, alcohol dehydrogenase,
phosphoglucoisomerase, triose phosphate isomerase,
phosphofructokinase, etc.;
P.R.(2) will provide for an enhancing function of transcription,
which enhancing function may provide for constitutive or regulated
transcription; regulators will be derived from regions associated
with regulation of yeast genes, other than the natural or wild-type
gene associated with the first domain in the wild-type or natural
host, such as UDP-galactose epimerase (GAL10), galactokinase
(GAL1), acid phosphatase (PHO5), etc. For yeast regulatory
sequences, the domain will usually be at least about 100 bp, more
usually at least about 200 bp, for convenience generally not
exceeding about 3 kbp, usually not exceeding about 1 kbp, desirably
not exceeding about 600 bp. The regulatory region will generally
begin at least about 200 bp from the initiation codon, usually at
least about 300 bp and may begin at 400 bp or farther upstream from
the initiation codon.
Regulation can be as a result of a change in the chemical or
physical environment of the host, such as a change in carbon
source, e.g., glucose to galactose or vice versa; a change in
concentration of a nutrient, e.g., an inorganic nutrient such as a
phosphate; or a change in temperature, e.g., 25.degree. C. to
35.degree. C. Constitutive transcription can be achieved employing
prokaryotic sequences of at least about 500 bp, usually 1 kbp or
more, for convenience, generally not exceeding about 5 kbp;
conveniently, the prokaryotic sequence can be obtained from the
vector in which the cassette is cloned, illustrative vectors
including pBR322, lambda, Charon 4A, pACYC184, pUC5, etc.
R.S. will generally be at least 4 bp, more usually at least 6 bp,
and may be 100 bp or more, more usually being not more than about
60 bp and my include one or more, usually not more than about 10
restriction sites, where such restriction sites may be illustrated
by EcoRI, BamHI, SalI, HindIII, AluI, AvaI, TaqI, HpaI, etc.,
having at least one unique restriction site for the construct
sequences.
T.R. is the termination region which will include the necessary
transcriptional and translational signals for termination, such as
the polyadenylation site, etc.;
T.R. will generally be at least about 100 bp, more usually at 150
bp, and generally less than about 1 kbp, usually less than about
600 kbp; the termination region may be derived from any convenient
yeast sequence, so long as the terminator balances the promoter,
conveniently being derived from a glycolytic enzyme terminator,
where the terminator may be associated with the same or different
enzyme with which the promoter is associated.
Where a cassette is cloned in a bacterial vector, the construction
will have the following formula: ##STR2## wherein all the symbols
have been defined previously, except for: Rep (B), which intends a
replicon or replication system recognized by a prokaryotic host and
may be derived from a plasmid or phage, such as ColE1, and R
plasmid, e.g., pRK290, lambda, e.g., Charon 4A, .lambda.dv,
etc.;
M is a marker which provides for selection of hosts containing the
construction, where (B) intends a prokaryotic, e.g., bacterial,
host and a intends an integer of from 0 to 3, usually 1 to 2,
although additional markers may be present, where the marker allows
for selection of the host containing the construct as well as
providing for selective pressure on maintaining hosts having the
construct; the markers include biocide resistance, such as
antibiotic resistance, toxin resistance and heavy metal resistance;
providing prototrophy to an auxotrophic host; providing immunity;
and the
the markers may provide for complementation of an auxotrophic host,
e.g., his.sup.-, ura.sup.-, trp.sup.-, leu.sup.- genotype,
resulting in prototrophy; resistance to metals, such as cup.sup.+
genotype; resistance to antibiotics, such as amp.sup.r, tc.sup.r,
cam.sup.r, str.sup.r, tur.sup.r genotype, etc.;
b is 0 or 1, intending that the construction is either linear or
circular, usually circular.
The above construct can he used for insertion of a wide variety of
structural genes, both prokaryotic and eukaryotic, both manually
occurring and synthetic, where the genes may include signal leaders
for secretion, and the like. The genes may express enzymes,
hormones, proteins from pathogens for vaccines, structural
proteins, lymphokines, membrane surface proteins, immunogloblins,
blood proteins, or the like. The particular structural gene which
is inserted is not critical to this invention and any polypeptide
or protein of interest may be prepared employing the constructions
of the subject invention. The structural genes will usually be
foreign to the yeast host, where foreign intends different from
wild-type yeast structural genes and from a source that does not
normally exchange genetic information with yeast.
Usually, the structural gene will be at least about 36 bp, and not
more than about 20 kbp, usually not more than about 3000 bp,
usually not more than about 1500 bp. Included in the structural
gene may be non-coding flanking regions, the 5'-flanking region
normally being quite short, usually less than about 30 bp, while
the 3'-flanking region may be extended, usually not exceeding about
500 bp. Thus, the structural gene fragment will usually include the
translational stop codons for proper termination of amino acid
chain extension.
When the structural gene has been inserted into the cassette which
is joined to a yeast replication system, normally including one or
more markers recognized by yeast, the resulting construct will have
the following formula: ##STR3## wherein all of the symbols have
been defined previously except for: gene, which intends the
structural gene, having its initiation codon and stop codons as
appropriate; and
Y, which intends that the symbol is related to yeast.
Convenient yeast replication systems include the 2 .mu.m plasmid
replication system, combination of CEN3 and ARS1 or ARS3, or the
like. The replication systems may be high or low copy number,
depending on the effect of the construct on the viability of the
host. While the indicated replication systems are those which have
found common employment, any replication system useful in yeast may
be employed which provides for efficient replication and
maintenance. Often the structural gene will be inserted into an
appropriate shuttle vector capable of replication and selection in
either a yeast or bacterial host, where the resulting construction
will have the following formula: ##STR4## where all symbols have
been defined previously. Also, it is, of course, understood that
the cassette without an inserted structural gene but containing the
restriction enzyme recognition sequence, R.S., my be propagated in
yeast or contained within a shuttle vector, where the construction
will have the following respective formulae: ##STR5## where all
symbols have been defined previously.
The various fragments which form the cassette and final
constructions may be joined together ha accordance with
conventional ways. In many cases, genes have been isolated and
restriction mapped, as well as sequenced. To that external one can
select the sequence of interest by restriction of the gene,
employing further manipulation as necessary such as resection with
Bal31, in vitro mutagenesis, primer repair, or the like, to provide
a fragment of a desired size, including the desired sequence, and
having the appropriate termini. Linkers and adapters can be used
for joining sequences, as well as replacing lost sequences, where
the restriction site is internal to the region of interest. The
various fragments which are isolated, maybe purified by
electrophoresis, electroeluted, ligated to other sequence, cloned,
reisolated and further manipulated.
The use of regulatory sequences for controlling transcription of
the structural gene of interest allows for growing the host cells
to high density with no or low levels of expression of the
structural gene, and then inducing expression by changing the
environmental conditions, e.g., nutrient, temperature, etc.
For example, with the GAL4 regulatory region, the yeast cells could
be grown in rich media with a glycerol-lactic acid combination to
high density, e.g., mid or late log phase, followed by switching
the carbon source to galactose. For PHO5 regulation one could grow
the cells at high phosphate, about 1 to 10 mM, and then decrease
the phosphate concentration to about 0.1 to 0.5 mM. For temperature
sensitivity, one could grow the cells at 25.degree. to 37.degree.
C. and then change the temperature as appropriate by about
5.degree. to 20.degree. C. The host cells would have the regulatory
system associated with the regulatory region employed.
Various techniques will be exemplified in the Experimental section
of this application, which techniques can be used as paradigmatic
for constructions employing fragments from sources other than those
exemplified. Of particular interest, as evidenced by the
Experimental section, will be the use of the
glyceraldehyde-3-phosphate dehydrogenase promoter region for the
RNA polymerase binding site in conjunction with regulator
sequences, such as those associated with GAL4, PHO5, or the like.
In referring to the GAL4 regulatory region or associated sequence,
the region intends the sequence associated with regulation of other
galactose metabolism genes, e.g., GAL1 and GAL10, which are under
the regulatory control of such sequence in conjunction with the
expression product of the GAL4 gene. The PHO5 sequence refers to a
region associated with the PHO5 gene which provides for
transcriptional regulation of the PHO5 gene.
The following examples are offered by way of illustration and not
by way of limitation.
EXPERIMENTAL
All DNA manipulations were done according to standard procedures.
See Molecular Cloning, T. Maniatis et al., Cold Spring Harbor Lab.,
1982. Enzymes used in cloning were utilized as per the
manufacturer's specifications. Enzymes were obtained either from
New England Biolabs or Bethesda Research Laboratories. Procedures
with these enzymes employed the supplier's directions. Yeast were
transformed and grown using a variety of media including selective
medium (yeast nitrogen base without lencine); YEPD medium,
containing 1% (w/v) yeast extract, 2% (w/v) peptone and 2% (w/v)
glucose, and others as appropriate and/or detailed below. In the
case of plating media contained 2% (w/v) agar and for
transformation 3% top agar. Hepatitis B surface antigen was
determined after lysis of yeast by glass bead agitation and
clarification by centrifugation, using the AusriaII assay (Abbott
Laboratories). Protein is determined by the Coomassie dye binding
method.
Construction of GAL regulator containing plasmids
Plasmid pLGSD5 is prepared as described in Gaurente et al., (1982)
supra. The plasmid was manipulated as follows: After restriction
with XhoI, the overhangs were filled in with the Klenow fragment of
DNA polymerase I ("Klenow fragment"), ligated with EcoRI linkers
(GGAATTCC) and then completely digested with EcoRI and Sau3A to
provide a 370 bp fragment which was isolated by gel electrophoresis
and included the intergenic sequence between GAL1 and GAL10 genes
of yeast, and provides for the GAL4 regulation sequence of the GAL1
and GAL10 genes.
This fragment was inserted into pBR322 which had been completely
digested with EcoRI and BamHI, followed by treatment with alkaline
phosphatase to prevent oligomerization. The resulting plasmid
pBRGAL4 was treated in two different ways.
In the first procedure pBRGAL4 was completely digested with Sau3A,
the overhangs filled in with the Klenow fragment, and the resulting
blunt-ended fragment ligated with SalI linkers (CGTCGACG), followed
by digestion with SalI and XhoI. The resulting 370 bp fragment was
isolated by gel electrophoresis. This fragment has the original 370
bp yeast GAL4 regulator sequence with XhoI and SalI termini.
The second fragment was obtained by complete digestion of pBRGAL4
with XhoI and SalI to provide a XhoI-SalI fragment which included
the 370 bp yeast GAL4 regulator sequence as well as about 280 bp of
pBR322, the GAL4 sequence extending from Sau3A to SalI.
The two fragments were then cloned in the plasmid plot5. plot5 was
prepared by inserting the 40 bp polylinker of the following
sequence ##STR6## into pBR322 as an EcoRI-PvulI substitution
followed by insertion of the trp-lac promoter (Russell and Bennett,
Gene (1982) 20:231-245) into the PvuII site with transcription
oriented toward the polylinker sequence. plot5 was completely
digested with SalI, followed treatment with alkaline phosphatase
and the 370 bp and 650 bp fragments independently inserted into
plot5 to provide plasmids plot5GAL4/370 and plot5GAL4/650,
respectively. Each of the plasmids was then completely digested
with BamHI and SalI to reproduce the individual fragments extended
by 6 bp of the polylinker fragment. These fragments were then
ligated into pC1/1, which had been completely digested with BamHI
and SalI followed by treatment with alkaline phosphatase to prevent
recircularization. Plasmid pC1/1 is a derivative of pJDB219 (Beggs,
Nature (1978) 275:104) in which the region corresponding to
bacterial plasmid pMB9 in pJDB219 has been replaced by pBR322 in
pC1/1. The resulting plasmids were designated pC1/1GAL4/370 and
pC1/1GAL4/650, respectively. The BamHI-SalI fragment is located in
the pBR322 portion of the vector pC1/1.
The next construction develops a hybrid promoter for expression of
the Hepatitis B surface antigen (HBsAg or sAg), employing the RNA
polymerase binding region of GAPDH. The previously prepared plasmid
pHBS56/16-3, a yeast shuttle vector containing the alcohol
dehydrogenase 1 (ADH1) promoter, the HBsAg gene and ADH terminator
as a SphI fragment, was digested with SphI and the ends modified
with Bam linkers. The Bam linkers have the sequence CGGATCCG.
pHBS56/16-3 was prepared as follows: A TaqI-HpaI fragment obtained
from the HBsAg coding region which included 26 bp of the pre-sAg
region, 681 bp of the sAg region and 128 bp of the 3'-untranslated
region, was linked with EcoRI linkers and cloned at the EcoRI site
in pBR322. The EcoRI linkers have the sequence GGAATTCC. The
plasmid pHBS5 was thus obtained.
After digesting pHBS5 with EcoRI, the digest was resected with
Bal31 and religated with EcoRI linkers (GGAATTCC). After digestion
with EcoRI the material of about 800 bp was isolated from a
polyacrylamide gel. This isolate was then recloned into pBR322
which had been digested with EcoRI and treated with alkaline
phosphatase. Where the resection was to the sequence CATGG, which
included the methionine codon, the EcoRI linker created an NcoI
site. The plasmids were screened for the presence of an NcoI site
and one of the plasmids chosen for further manipulation. This
plasmid, designated pHBS5-3, was restricted with EcoRI, the EcoRI
fragment made blunt-ended with Klenow fragment and dNTPs, and the
blunt-ended fragment was then restricted with XbaI to provide an
about 100 bp fragment having an XbaI overhang and blunt end at the
former EcoRI site.
pHBS5 was then digested with ClaI, made blunt-ended with the Klenow
fragment and dNTPs, digested with XbaI, followed by alkaline
phosphatase treatment. The 100 bp fragment was then inserted into
the vector to provide the plasmid pHBS6. Upon sequencing of the
blunt-ended ligation site, it was found that an adenosine had been
lost, so as to lose the EcoRI site, where the sequence was now
ATCGATTCCCATGG. The ClaI and NcoI sites were retained. The loss of
the A resulted in pKBS6 having a single EcoRI site.
pHBS5-3 was digested with EcoRI and the resulting EcoRI fragment
having the sAg fragment isolated by gel electrophoresis and
inserted into the vector pHBS16 (Valenzuela et al., Nature (1982)
298:347-350). This plasmid has the ADH1 promoter and the sAg gene
in an EcoRI fragment in a plasmid containing the 2 .mu.m origin, a
TrpI gene and pBR322. The plasmid was digested with EcoRI, treated
with alkaline phosphatase to prevent recircularization, and the
EcoRI fragment from pHBS5-3 inserted to provide pHBS16-3, where the
sAg gene isolated as a TaqI-HpaI fragment had been modified by
Bal31 resection. The plasmid pHBS16-3 was digested with SphI and
XbaI to provide a fragment which had the ADH promoter at the Sph
terminus and the 5'-end of the sAg gene.
pHBS56 was then digested with SphI. pHBS56 was prepared from pC1/1
by digestion with SphI, which deletes a portion of the plasmid
spanning the 2 .mu.m-pBR322 joint. The active portion of the ADH1
promoter region is contained within the SphI-HindIII fragment of
approximately 300 bp (Bennetzen et al., J. Biol. Chem. (1982)
257:301). The SphI site in the ADH promoter begins at position -413
and the yeast terminator sequence is contained within a
HindIII-SphI fragment of about 330 bp. In each case the SphI site
is distal to the coding region. A 1500 bp ADH1 promoter fragment
terminating at position -9 (Hitzeman et al., Nature (1981) 293:717)
and an approximately 450 bp terminator unit from nucleotides 913 to
1368 in the ADH gene nucleotide sequence were joined at a
HindIII-site between the fragments and cloned into the BamHI site
of the vector YEp13 (Broach and Hicks, Gene (1979) 8:121) to
provide pADH5.
The HBsAg-DNA segment of pHBS5 was excised by EcoRI digestion,
blunt-ended with the Klenow fragment and joined at both ends with
HindIII linkers, CAAGCTTG. After digestion with HindIII, the HBsAg
fragment was inserted into the HindIII site of the plasmid pADH5
which had been digested at the HindIII site intermediate the ADH1
promoter and terminator sequence. A plasmid with the HBsAg gene in
the correct orientation as determined by restriction analysis was
designated pRBS22. The cassette was included between two SphI
restriction sites. pHBS22 was digested with SphI to obtain a
fragment of about 1500 bp and inserted into SphI digested pC1/1 to
provide pHBS56 which was cloned in E. coli HB101.
pHBS56 was digested with SphI and XbaI to provide a 1.1 kb fragment
having the ADH terminator region and the 3'-portion of the sAg gene
with the SphI site proximal to the terminator region. The 1.1 kb
SphI-XbaI fragment was joined to the SphI-XhaI fragment from
pHBS16-3, which resulted in providing the complete sAg gene in the
correct orientation between the ADH promoter and terminator. This
SphI-SphI fragment was then ligated to SphI digested pHBS56,
replacing the cassette of pHBS56 to provide the plasmid pHBS56/16-3
with the resected sAg coding region fragment. The cassette was then
excised from pHBS56/16-3 by digestion with SphI, followed by
chewing back the overhangs with the Klenow fragment in the presence
of dNTPs, then ligated with BamHI linkers, followed by digestion
with BamHI to provide a 1.6 kb fragment which was isolated by gel
electrophoresis. The fragment included the ADH promoter region, the
sAg gene and ADH terminator region, as described above. This
fragment was inserted into the BamHI site of pBR322 to provide
pPGT16-3 which was digested with BamHI and XbaI and the resulting
1.1 kb fragment gel isolated, where the XbaI-BamHI fragment had the
3' portion of the sAg gene and the ADH terminator region.
pHBS6 was digested with XbaI and NcoI and the 94 bp fragment gel
isolated to provide the 5'-portion of the sAg gene. A synthetic
adapter was prepared of the formula ##STR7## having TaqI and NcoI
termini and providing the -25 to -1 nucleotides of the GAPDH
(GAP49) promoter and the initiation codon of the sAg gene. This
synthetic fragment, the NcoI-XbaI fragment, and the XbaI-BamHI
fragment were ligated simultaneously, followed by digestion with
TaqI and BamHI. The resulting fragment was then substituted into
pBR322 linearized with ClaI and BamHI, followed by treatment with
alkaline phosphatase. The resulting plasmid, which contains the -1
to -25 bp of the GAPDH promoter region, the sAg gene, and the ADH
terminator, when the NcoI restriction site is lost was called
pHBS6LGAPsAgtADH.
pGAP1, a plasmid prepared by insertion of a HindIII fragment
containing the GAPDH gene GAP49 (Holland and Holland, J. Biol.
Chem. (1979) 254:5466-5474) inserted in the HindIII site of pBR322,
was digested with HinfI and a 500 bp promoter containing fragment
isolated. The fragment was resected with Bal31 to remove about 50
or 90 bp, followed by ligation with HindIII linkers and digestion
with HindIII. pBR322 was digested with HindIII, followed by
treatment with alkaline phosphatase and the about 450 or 410 bp
fragment inserted to provide pGAP128 and pGAP396, respectively.
pGAP128 was digested with HindIII, the fragment made blunt-ended
with the Klenow fragment and dNTPs and the resulting 450 bp
fragment isolated by gel electrophoresis. This fragment was
inserted into SmaI digested plot5, which had been treated with
alkaline phosphatase, to provide plasmid plot5pGAP128, which
contained about -400 to +27 bp of the GAPDH promoter and coding
region, Plasmid plot5pGAP396 was prepared from pGAP396 in an
identical manner and thus differs from plasmid plot5pGAP128 in
having about 15-30 fewer bp at each terminus of the GAPDH promoter
region (about -385 to -3).
Plasmids GAP1-GAP4 were then prepared in the following manner.
Plasmid plot5pGAP128 was digested with TaqI and BamHI to provide an
about 390 bp TaqI-BamHI fragment which included the -26 to about
-400 bp of the GAPDH promoter region and a portion of the HindIII
and plot5 polylinker. pHBS6LGAPsAgtADH plasmid was also digested
with TaqI and BamHI and a 1.1 -kb TaqI-BamHI fragment containing
the 3'-terminus of the GAPDH promoter region, the sAg gene and the
ADH terminator region was gel isolated and ligated to the other
TaqI-BamHI fragment to provide a BamHI-BamHI fragment which
included approximately 400 bp of the GAPDH promoter region, the sAg
gene in proper orientation for transcriptional regulation by the
GAPDH promoter, followed by the ADH terminator region. This
fragment was ligated into pBR322 which had been digested with BamHI
and treated with alkaline phosphatase to provide plasmid pPGT80.
This BamHI cassette could now be isolated and inserted into plasmid
pC1/1, at the BamHI site in the pBR322 portion of pC1/1, where in
plasmid GAP1 the ADH terminator region is proximal to the amp.sup.r
gene with the pBR322 portion divided into an approximately 4 kb
sequence including the amp.sup.r gene and a 375 bp region
separating the cassette from the 2 .mu.m sequences. In GAP2, the
pomoter is adjacent to the long pBR322 sequence with transcription
in the same direction as the amp.sup.r gene. The same cassette was
inserted into BamHI-digested pC 1/1 GAL4/650 to obtain plasmids
GAP3 and GAP4, where GAP3 has the GAPDH promoter distal from the
GAL4 regulator region and the long pBR322 sequence and GAP4 has the
GAPDH promoter adjacent to the GAL4 regulator region, which is
adjacent to the long pBR322 sequence.
Plasmids GAP5 and GAP6 were isolated as follows. Plasmid
plot5pGAP396 was digested with SalI and TaqI and a fragment
containing 9 bp of the plot5 polylinker sequence and the GAPDH
promoter sequence extending from about -385 to -26 bp was isolated.
An approximately 130 bp TaqI-XbaI fragment including -25 to -1 bp
of the GAPDH promoter and +1 to +93 bp of the sAg gene was obtained
from pHBS6LGAPsAgtADH. A 1.1 kb XbaI-SalI fragment containing the
3'-portion of the sAg gene and the ADH terminator as well as 6 bp
of plot5 polylinker sequence was obtained from plasmid plot5sAgtADH
(described below--Pyravate Kinase Promoter). These three fragments
were ligated, digested with SalI and then cloned into SalI-digested
pC1/1GAL4/370. GAP5 has the GAPDH promoter region adjacent to the
GAL4 regulator region, which is proximal to the short pBR322
sequence, and GAP6 has the GAPDH promoter region distal from the
GAL4 regulator region-and proximal to the long pBR322 sequence (see
FIG. 1).
Pyruvate kinase promoter
Plasmid pHBS6Pyk containing the sAg gene under the transcriptional
regulatory control of the Pyk promoter was obtained by cloning a
4.4 kb insert of yeast genomic DNA in pBR322 containing the Pyk
gene and 911 nucleotides of 5'-untranslated region, and digestion
of this plasmid pPyk9.1.1 with XbaI. After making the ends
blunted-ended, the linear fragment was digested with BamHI
providing a 912 bp BamHI-blunt fragment containing the Pyk promoter
and 8 bases from the Pyk coding region. This fragment was inserted
into the plasmid pHBS6, which had been digested with NcoI,
blunt-ended and digested with BamHI. The plasmid pHBS6Pyk was
totally digested with EcoRI, to obtain a fragment including the sAg
gene and a portion of the Pyk promoter region. The fragment was
made blunt-ended with the Klenow fragment and dNTPs, followed by
ligation to BamHI linked digested with XbaI, which is internal to
the sAg gene, the XbaI terminus made blunt-ended with the Klenow
fragment and dNTPs, followed by digestion with BamHI, to provide a
580 bp BamHI-blunt-ended (XbaI) fragment. The plasmid plot5 was
digested with EcoRI, made blunt-ended, digested with BamHI and
treated with alkaline phosphatase and the two fragments joined to
provide plasmids plot5PyksAg51 and plot5PyksAg.57. The two differ
in that the BamHI site of the latter was not regenerated during
cloning, possibly as a consequence of minimal nuclease
contamination (digestion).
plot5 was treated as previously described (EcoRI digestion,
blunt-ended, BamHI digestion and treatment with alkaline
phosphatase) and joined to a 1.1 kb fragment obtained by digestion
of pPGT16-3 with XbaI, followed by blunt ending, followed by
digestion with BamHI and gel isolation. This fragment was
introduced into plot5 to provide the plasmid plot5sAgtADH. Again
the BamHI site in this plasmid was not regenerated, presumably due
to digestion by contaminating nuclease.
Plasmids Pyk1 and Pyk2 were prepared as follows. Plasmid
plot5PyksAg51 was digested with BamHI, then with XbaI, and an
approximately 580 bp fragment containing about 480 bp of Pyk
promoter and 93 bp of the 5'-end of the sAg gene was gel isolated.
A 1.1 kb XbaI-SalI fragment containing the 3'-portion of the sAg
gene, the ADH terminator and about 6 bp of the plot5 polylinker was
isolated from plot5AgtADH. These two fragments were ligated,
digested with BamHI and SalI and then cloned into plasmid pC1/1,
which had been cleaved with BamHI and SalI and treated with
alkaline phosphatase to yield plasmid Pyk1. Plasmid Pyk2 was
prepared similarly but the 580 bp SalI-XbaI, Pyk promoter/HBsAg
gene 5'-end fusion fragment was isolated from plot5PyksAg.57 and
included about 6 bp of plot5 polylinker sequence upstream from the
promoter region. Also the 1.1 kb XbaI-BamHI fragment containing the
3'-part of the HBsAg gene and the ADH terminator was derived from
plasmid pPGT16-3.
Plasmids Pyk3-Pyk6 were prepared as follows. Plasmid plot5PyksAg51
was digested with BamHI, then with XbaI and the about 580 bp
fragment containing the Pyk promoter and the 5'-part of the HBsAg
gene isolated as above. The 1.1 kb BamHI-XbaI fragment, containing
the 3'-portion of the HBsAg gene and ADH terminator, was recovered
from pPGT16-3, also as above, and the two fragments ligated,
digested with BamHI and inserted with different orientations into
the BamHI site of pC1/1GAL4/650 (Pyk3, Pyk4). Plasmids Pyk5 and
Pyk6 were prepared similarly except that the SalI-XbaI fragment
containing the Pyk promoter and 5'-end of the sAg gene was isolated
from plot5PyksAg.57 and the XbaI-SalI sAg gene 3'-portion/ADH
terminator fusion fragment was derived from plot5sAgtADH and thus
both fragments included approximately 6 bp of plot5 polylinker
sequence. The cassette so formed was then cloned into the SalI site
of pC1/1GAL4/370 in opposite orientations.
The six plasmids designated Pyk1-6 (see FIG. 2) are distinguished
by Pyk1 having the promoter region proximal to the short pBR322
sequence; Pyk2 having the promoter region proximal to the long
pBR322 sequence; Pyk3 having the promoter region proximal to the
short pBR322 sequence and distal from the GAL4 sequence; while Pyk4
has the promoter region proximal to the GAL4 region, which in turn
is proximal to the long pBR322 sequence; Pyk5 has the promoter
region proximal to the GAL4 region which is proximal to the short
pBR322 sequence; while Pyk6 has a promoter region distal from the
GAL4 region and proximal to the long pBR322 sequence.
These plasmids described above were transformed into S.
carlsbergensis strain 2150-2-3 (available from Lee Hartwell,
University of Washington) under conventional conditions (Hinnen et
al., Proc. Natl. Acad. Sci. USA (1978) 75:1929-1933). Cultures of
50-150 ml were grown to mid or late log phase in rich media (YEP)
under neutral conditions (3% glycerol, 2% lactic acid), and then
inducing conditions (+2% galactose), or repressing conditions (+2%
glucose) for the final 1-2 generations. After lysis with glass
beads and clarification of the supernatants by centrifugation,
HBsAg expression was determined as described above. The results for
the 12 plasmids are set forth in the following Table 1.
TABLE 1 ______________________________________ Expression of HBsAg
from Gal Regulated Hybrid Promoters YEP + Glycerol/ Lactic acid YEP
+ YEP + Induction .mu.g sAg/ Galactose Glucose (Gal/glycerol
Construction mg protein .mu.g sAg/mg protein lactic acid)
______________________________________ GAP1 0.04 0.09 0.02 2.0 GAP2
1.65 0.8 1.5 0.5 GAP3 0.25 0.30 -- 1.2 GAP4 0.10 0.75 -- 7.5 GAP5
0.25 2.1 -- 8.4 GAP6 1.55 1.4 1.0 0.9 PYK1 0.10 0.30 0.14 3.0 PYK2
1.65 1.4 1.1 0.85 PYK3 0.10 0.15 -- 1.5 PYK4 0.10 1.0 0.05 10.0
PYK5 0.03 1.4 0.02 47.0 PYK6 1.7 1.8 0.9 0.9
______________________________________
Construction of pPGAP
A yeast expression vector was prepared called pPGAP having a
polyrestriction site linker between the GAPDH terminator and short
promoter region. Plasmid mid plot5pGAP128 was digested with BamHI
and TaqI to yield an approximately 390 bp BamHI-TaqI fragment
having the -400 to -26 bp of the GAPDH promixer. The BamHI-TaqI
fragment was ligated to a synthetic fragment having the following
sequence: ##STR8## to provide a BamHI-SalI fragment, which was
digested with BamHI and SalI and used to replace the BamHI-SalI
fragment of BamHI-SalI digested pBR322 treated with alkaline
phosphatase. After ligation, the plasmid pGAPNRS was obtained which
was digested with BamHI and SalI to provide a 400 bp BamHI-SalI
fragment which was gel isolated. This fragment was ligated to an
about 900 bp SalI-BamHI fragment containing the GAPDH terminator
region and a short segment of 3' coding region and the resulting
1.4 kb BamHI-BamHI fragment digested with BamHI. The SalI-BamHI
GAPDH terminator fragment was obtained by SalI and BamHI digestion
of pGAP2, a plasmid prepared by insertion of an about 3.3 kb BamHI
fragment containing the GAPDH gene GAP49 (Holland and Holland,
supra) into the BamHI site of pBR322. Plasmids pGAP2 and pGAP1 were
obtained as follows: A yeast gene library was prepared by inserting
fragments obtained after partial digestion of total yeast DNA with
restriction endonuclease Sau3A in lambda-phage Charon 28 (Blattner
et al., Science (1977) 196:161-169). The phage library was screened
with DNA complementary to the yeast GAPDH mRNA and the yeast GAPDH
gene from one of these clones was subcloned as either an about 3.3
kb BamHI fragment in the BamHI site of pBR322 (pGAP-2) or as an
about 2.1 kb HindIII fragment in the HindIII site of pBR322
(pGAP-1).
pBR322 was digested with EcoRI and SalI, the termini blunt-ended
and ligated to BamHI linkers, followed by BamHI digestion and the
BamHI-BamHI 3.8 kb fragment gel isolated, recircularized by
self-ligation, cloned and designated pBR.DELTA.R1-Sal. The 1.4 kb
BamHI-BamHI fragment was inserted into the BamHI-digested, alkaline
phosphatase treated pBR.DELTA.R1-Sal vector to provide the plasmid
pPGAP of about 5.3 kb with the orientation in the opposite
direction of the amp.sup.r.
The plasmid phSOD was prepared as follows:
Molecular cloning of hSOD cDNA
Total RNA was prepared from an adult human liver by the guanidinium
thiocyanate/lithium chloride method (Cathala et al., DNA (1983)
2:329-435). polyA RNA was used to synthesize double-stranded cDNA
(Maniatis et al., Molecular Cloning, 213-242, Cold Spring Harbor,
1982) and this was passed over a Sepharose CL4B column to enrich
for cDNAs of greater than 350 bp (Fiddes and Goodman, Nature (1979)
281:351-356). The cDNA was inserted at the PstI site of plot4, a
pBR322 derivative having the following sequence replacing the
PstI-EcoRI site. The cDNA insertion employed the oligo-dG:dC
tailing method (Maniatis et al., supra). E. coli strain D1210 was
transformed with this mixture and transformants selected on L-agar
containing 10 .mu.g/ml tetracycline (Kushner, S. R. (1978) In:
Genetic Engineering eds. Boyer, H. B. and Nicosia, S.,
(Elsevier/North Holland, Amsterdam) p. 17). Plasmid DNA
constituting at liver cDNA library was prepared (Maniatis et al.,
Molecular Cloning, pp. 86-94, Cold Spring Harbor 1982) directly
from approximately 62,060 recombinant colonies plated at a density
of approximately 3,000 colonies per 9 cm diameter Petri dish.
Isolation of r-hSOD clones
Strain D1210 was retransformed with the liver cDNA library and
about 40,000 clones were grown on nine 14 cm diameter Petri dishes.
After transfer of the colonies to nitrocellulose paper and
chloramphenicol amplification of plasmid DNA, the cells were lysed
and the filters prepared for hybridization (Ish-Horowicz and Burke,
Nucleic Acids Research (1981) 9:2989-2998). Oligonucleotide probes
were employed for screening by hybridization, with the probes
consisting of enzymatically-radiolabeled, chemically-synthesized
DNA molecules complementary to the mRNA encoding amino acid
residues 19 to 24 of the protein (Jabusch et al., supra.; Barra et
al., supra.); the mixture had the following sequences: ##STR9##
where all of the indicated possibilities for encoding the peptide
sequence were prepared (32-fold degenerate).
The probes were labeled with .sup.32 P to a specific activity of
1-3.times.10.sup.8 cpm/.mu.g and Millipore (0.45 .mu.m) filtered
before use. Filters were prehybridized for 6 hrs at 30.degree. C.
in 4.times.SSC, 2.times.Denhardts's solution, 40 mM sodium
phosphate, pH 7.5, 300 .mu.g/ml sonicated salmon testes DNA.
Hybridization was for 20 hrs at 30.degree. C. in the same solution
containing 2.times.10.sup.6 cpm/ml hSOD DNA probe (residues 19-24).
Filters were washed in 4.times.SSC, once for 15 min at r.t. and
twice for 15 min at 30.degree. C., blotted dry and autoradiographed
with an intensifying screen for 24 hrs at -70.degree. C.
Areas on the master plates that corresponded to duplicate positive
signals were picked into L-broth and plasmid DNA prepared by the
miniscreen procedure (Maniatis et al., Molecular Cloning, 178,
368-369, Cold Spring Harbor 1982). This DNA was cut with PstI and
subjected to Southern blot analysis (Southern, J. Mol. Biol. (1975)
98:503-517) hybridizing initially with the previous labeled probes
(amino acid residues 19-24) and then with additional radiolabeled
probes derived from amino acid residues 109-114 and having the
following sequences (all possible variations, 72-fold degenerate)
present as a mixture: ##STR10## One plasmid pool (pSOD1) contained
a cDNA inserts of 520 bp that hybridized with both probes and after
colony purification, plasmid DNA was prepared from this clone and
sequenced by the method of Maxam and Gilbert (Proc. Natl. Acad.
Sci. USA (1977) 74:560-564). The hSOD cDNA clone pSOD1 constitutes
the coding region for amino acids 10-153 of hSOD, a single
translational stop codon and a 3' untranslated region. Therefore,
in the expression vector construct, the base sequence of the region
encoding amino acids 1-9 is derived from the published amino acid
sequence of hSOD (Jabusch et al., supra; Barra et.al., supra) and
synthesized chemically as a part of the variable linker segment
(see discussion relating to FIG. 3).
Construction of plot5 derivatives containing r-hSOD
The synthetic DNA molecules F(26), C(16), B(31), D(11), E(13) and
4(24) shown in FIG. 3, were synthesized by the phosphoramidite
method.
The single strand 4(24) was prepared by using all four bases, at
each site where X is indicated. Furthermore, silica was withdrawn
from the synthesis of the 24 mer, such that single-stranded 21
mers, 22 mers, and 23 mers are obtained in addition to the 24 mers.
After removal from the silica support, the four mixtures are
combined in appropriate proportions to provide for equimolar
amounts of each of the possible single strands. This mixture was
treated as a single product in the subsequent steps.
Molecules F(26), C(16), B(31) and D(11) were mixed together in
equimolar amounts and 10 .mu.g phosphorylated using T4
polynucleotide kinase. After phenol-ether extraction, the
additional non-phosphorylated synthetic DNA molecules 4(24) and
E(13) were added, such that all fragments were equimolar. The
equimolar mixture contained 13 .mu.g of DNA in 133 .mu.l of
0.3.times.kinase buffer.
After annealing by cooling at a uniform rate from 70.degree. C. to
20.degree. C. over 60 min, the single strands were ligated together
with T4 ligase in 200 .mu.l ligation mix at 14.degree. C. for 4
hrs, phenol-chloroform extracted, ethanol precipitated and the
5'-ends of 4(24) and E(13) phosphorylated using T4 polynucleotide
kinase (Maniatis et al., supra). Preparative polyacrytamide gel
electrophoresis was used to isolate the completely ligated 53 bp
material having 5'- and 3'-overhangs.
The above purified fragment mixture was then ligated to the 460 bp
TaqI-PstI segment of the hSOD cDNA as shown in FIG. 3. This segment
was itself constructed by isolating the 454 bp TaqI-AluI hSOD
fragment, making it flush-ended using Klenow and inserting it into
plot5 between its EcoRI and SalI sites which had been similarly
made flush-ended. After preparation of plasmid DNA from this
recombinant, the 460 bp TaqI-PstI hSOD fragment was isolated by
preparative polyacrylamide gel electrophoresis. After extraction
and precipitation, the 515 bp fragment resulting from the joining
of the synthetic fragment to the 460 bp TaqI-PstI hSOD fragment was
blunt-ended (525-528 bp) and then digested with SalI and the
resulting 519-522 bp hSOD fragment isolated by polyarcylamide gel
electrophoresis. This fragment was then inserted into plot5 which
had been digested with PvuII and SalI and then treated with
alkaline phosphatase. The resulting plasmids were used to transform
strain D1210. Recombinants obtained after transformation of strain
D1210 were selected on L-agar containing 100 .mu.g/ml ampicillin to
give a set of clones, which were screened for an NcoI site. One was
selected and designated phSOD.
Construction of a yeast vector for SOD expression
The plasmid phSOD was ligated with NcoI and SalI and a 550 bp
fragment obtained, which included 1 nucleotide untranstated at the
5'-terminus and the entire coding region for hSOD. pPGAP was
digested with NcoI and SalI followed by treatment with alkaline
phosphatase and the SalI-NcoI fragment substituted for the
NcoI-SalI fragment in pPGAP to provide pPGAPSOD. BamHI digestion of
pPGAPSOD resulted in a 2 kb fragment which was gel isolated and
inserted into the BamHI site of pC1/1 and pC1/1 GAL4/370. These
plasmids were transformed into yeast strain 2150-2-3 as described
previously, with the results of expression set forth in the
following Table 2.
TABLE 2 ______________________________________ Expression of Human
SOD in Yeast Strain 2150 SOD.sup.2 Plasmid Carbon Source .mu.g/mg
protein ______________________________________ pC1/1 g, L.sup. 0
pC1/1GAPSOD g, L 148 pC1/1GALGAPSOD g, L 0.4 gal 68
______________________________________ .sup.1 All cultures grown in
Minus Leucine media with 2% lactic acid, 3% glycerol with or
without 2% galactose to late log or early stationary phase. .sup.2
Determined by RIA.
hSOD levels were measured using a standard radioimmunoassay with
iodinated authentic hSOD as standard. Constitutive synthesis from
the GAP promoter leads to very high levels of hSOD production, of
the order of 10-30% of the total cell protein. The induction with
galactose works almost as well, yielding about 7% of the cell
protein as hSOD.
Cloning of alpha-1-antitrypsin
A cDNA library was made from 10 .mu.g of polyA.sup.+ RNA isolated
from a part of a human liver. This library was prepared by oligo-dT
priming of the first cDNA strand and self-priming of the second
cDNA strand. The ds cDNA was size fractionated on a Sepharose CL4B
column and those molecules greater than 300 bp isolated. This
fraction was treated with nuclease S1 and tailed with dCTP, using
terminal transferase. The tailed cDNA was annealed to pBR322 which
had been digested with PstI and tailed with dGTP. Transformation of
E. coli HB101 yielded 60,000 colonies, where greater than 90% of
the clones were recombinant.
Two synthetic oligonucleotide probes were used to isolate the
alpha-1-antitrypsin (.alpha..sub.1 -AT) cDNA, the first probe
corresponding to amino acid residues 344-350 near the C-terminus of
the protein was used to probe 5,000 colonies and the second probe,
corresponding to amino acid residues -23 to -17 (+1 being the first
nucleotide of the first codon of the mature .alpha..sub.1 -AT) of
the signal peptide, was used to probe 25,000 colonies. The probe
sequences were taken from the partial nucleotide sequence described
by Kurachi et al., Proc. Natl. Acad. Sci. USA (1981) 78:6826;
Leicht et al., Nature (1982) 297:655). Approximately 3% of the
colonies hybridized to the C-terminal probe and four hybridized to
the N-terminal probe. The four N-terminal clones and 12 C-terminal
clones were isolated and subjected to restriction analysis. From
these, three overlapping clones which cover the entire cDNA were
subjected to further study and were used to construct the
full-length cDNA clone.
The entire sequence of a composite full length cDNA derived from
the three plasmids is as follows:
__________________________________________________________________________
-24 Met Pro Ser Ser GGGGGGGGGGAGGGTAATCGACA ATG CCG TCT TCT -20 -10
-1 Val Ser Trp Gly Ile Leu Leu Leu Ala Gly Leu Cys Cys Leu Val Pro
Vaql Ser Leu Ala GTC TCG TGG GGC ATC CTC CTG CTG GCA GGC CTG TGC
TGC CTG GTC CCT GTC TCC CTG GCT Glu Asp Pro Gln Gly Asp Ala Ala Gln
Lys Thr Asp Thr Ser His His Asp Gln Asp His 1 GAG GAT CCC CAG GGA
GAT GCT GCC CAG AAG ACA GAT ACA TCC CAC CAT GAT CAG GAT CAC BamHI
21 Pro Thr Phe Asn Lys Ile Thr Pro Asn Leu Ala Glu Phe Ala Phe Ser
Leu Tyr Arg Gln 61 CCA ACC TTC AAC AAG ATC ACC CCC AAC CTG GCT GAG
TTC GCC TTC AGC CTA TAC CGC CAG 41 Leu Ala His Gln Ser Asn Ser Thr
Asn Ile Phe Phe Ser Pro Val Ser Ile Ala Thr Ala 121 CTG GCA CAC CAG
TCC AAC AGC ACC AAT ATC TTC TTC TCC CCA GTG AGC ATC GCT ACA GCC 61
Phe Ala Met Leu Ser Leu Gly Thr Lys Ala Asp Thr His Asp Glu Ile Leu
Glu Gly Leu 181 TTT GCA ATG CTC TCC CTG GGG ACC AAG GCT GAC ACT CAC
GAT GAA ATC CTG GAG GGC CTG 81 Asn Phe Asn Leu Thr Glu Ile Pro Glu
Ala Gln Ile His Glu Gly Phe Gln Glu Leu Leu 241 AAT TTC AAC CTC ACG
GAG ATT CCG GAG GCT CAG ATC CAT GAA GGC TTC CAG GAA CTC CTC
Arg(a,c) Asp Gly(c) 101 His Thr Leu Asn
Gln Pro Asp Ser Gln Leu Gln Leu Thr Thr Gly Asn Gly Leu Phe Leu 301
CAT ACC CTC AAC CAG CCA GAC AGC CAG CTC CAG CTG ACC ACC GGC AAT GGC
CTG TTC CTC 121 Ser Glu Gly Leu Lys Leu Val Asp Lys Phe Leu Glu Asp
Val Lys Lys Leu Tyr His Ser 361 AGC GAG GGC CTG AAG CTA GTG GAT AAG
TTT TTG GAG GAT GTT AAA AAG TTG TAC CAG TCA 141 Glu Ala Phe Thr Val
Asn Phe Gly Asp Thr Glu Glu Ala Lys Lys Gln Ile Asn Asp Tyr 421 GAA
GCC TTC ACT GTC AAC TTC GGG GAC ACC GAA GAG GCC AAG AAA CAG ATC AAC
GAT TAC 161 Val Glu Lys Gly Thr Gln Gly Lys Ile Val Asp Leu Val Lys
Glu Leu Asp Arg Asp Thr 481 GTG GAG AAG GGT ACT CAA GGG AAA ATT GTG
GAT TTG GTC AAG GAG CTT GAC AGA GAC ACA 181 Val Phe Ala Leu Val Asn
Tyr Ile Phe Phe Lys Gly Lys Trp Glu Arg Pro Phe Glu Val 541 GTT TTT
GCT CTG GTG AAT TAC ATC TTC TTT AAA GGC AAA TGG GAG AGA CCC TTT GAA
GTC Ala(b) 201 Lys Asp Thr Glu Glu Glu Asp Phe His Val Asp Gln Val
Thr Thr Val Lys Val Pro Met 601 AAG GAC ACC GAG GAA GAG GAC TTC CAC
GTG GAC CAG GTG ACC ACC GTG AAG GTG CCT ATG BstEII 221 Met Lys Arg
Leu Gly Met Phe Asn Ile Gln His
Cys Lys Lys Leu Ser Ser Trp Val Leu 661 ATG AAG CGT TTA GGC ATG TTT
AAC ATC CAG CAC TGT AAG AAG CTG TCC AGC TGG GTG CTG Asn(c) 241 Leu
Met Lys Tyr Leu Gly Asn Ala Thr Ala Ile Phe Phe Leu Pro Asp Glu Gly
Lys Leu 721 CTG ATG AAA TAC CTG GGC AAT GCC ACC GCC ATC TTC TTC CTG
CCT GAT GAG GGG AAA CTA 261 Gln His Leu Glu Asn Glu Leu Thr His Asp
Ile Ile Thr Lys Phe Leu Glu Asn Glu Asp 781 CAG CAC CTG GAA AAT GAA
CTC ACC CAC GAT ATC ATC ACC AAG TTC CTG GAA AAT GAA GAC EcoRV 281
Arg Arg Ser Ala Ser Leu His Leu Pro Lys Leu Ser Ile Thr Gly Thr Tyr
Asp Leu Lys 841 AGA AGG TCT GCC AGC TTA CAT TTA CCC AAA CTG TCC ATT
ACT GGA ACC TAT GAT CTG AAG Val(a,c) 301 Ser Ile Leu Gly Gln Leu
Gly Ile Thr Lys Val Phe Ser Asn Gly Ala Asp Leu Ser Gly 901 AGC ATC
CTG GGT CAA CTG GGC ATC ACT AAG GTC TTC AGC AAT GGG GCT GAC CTC TCC
GGG 321 Val Thr Glu Glu Ala Pro Leu Lys Leu Ser Lys Ala Val His Lys
Ala Val Leu Thr Ile 961 GTC ACA GAG GAG GCA CCC CTG AAG CTC TCC AAG
GCC GTG CAT AAG GCT GTG CTG ACC ATC 341 1021 Asp GAC Glu GAG Lys
AAA Gly GGG Thr ACT Glu GAA Ala GCT Ala GCT Gly GGG Ala GCC Met ATG
Phe TTT Leu TTA Glu GAG Ala GCC
Ile ATA Pro CCC ##STR11## Ile ATC 361 Pro Pro Glu Val Lys Phe Asn
Lys Pro Phe Val Phe Leu Met Ile Glu Gln Asn Thr Lys 1081 CCC CCC
GAG GTC AAG TTC AAC AAA CCC TTT GTC TTC TTA ATG ATT GAA CAA AAT ACC
AAG AvaI 381 Ser Pro Leu Phe Met Gly Lys Val Val Asn Pro Thr Gln
Lys OC 1141 TCT CCC CTC TTC ATG GGA AAA GTG GTG AAT CCC ACC CAA AAA
TAA CTGCCTCTCGCTCCTCAAC HinfI AAT CCC ACC CAA AAA TAG GGG TGG GTT
TTT ATC AGCT SalI
__________________________________________________________________________
LEGEND Nucleotide and predicted amino acid sequences of
.alpha..sub.1 -AT cDNA. The reactive center metser at positions
358-359 is boxed. Subscripts to amino acids in parentheses identify
differences between the subject protein sequence and those derived
from (a) protein sequencing (Carrell et al., 1982), (b) the cDNA of
Woo et al., [see Carrell et al.,
1982]), and (c) the cDNA of Bollen et al., 1983. The synthetic DNA
molecules used in the construction of the BamHI to SalI fragment
encoding the mature protein are shown as are the cDNA restriction
sites used in this construction.
The above sequence was determined using the dideoxy sequencing
method of Sanger et al., Proc. Natl. Acad. Sci. USA (1977) 74:5463,
in the M13 vectors of Messing et al., Nucleic Acids Res. (1981)
9:309. The differences at the nucleotide and amino acid level from
the published cDNA sequences are shown.
Construction of the full length clone for expression of yeast began
with three fragments isolated from cDNA clones: 1) a 630 bp
BamHI-BstEII fragment; 2) a 450 bp BstEII-AvaI fragment; and 3) an
85 bp AvaI-HinfI fragment. A synthetic adapter was employed having
the following sequence: ##STR12## Approximately two pmoles of
fragments 1 and 2 were ligated together and after removal of the
ligase, digested with BamHI and AvaI. Fragment 3 and the synthetic
adapter were ligated and digested with AvaI and SalI and the two
resulting fragment mixtures were ligated followed by digestion with
BamHI and SalI. Fragments migrating upon electrophoresis in the
region of about 1000-1400 bp were isolated and cloned by
substitution into BamHI and SalI digested and alkaline phosphatase
treated pBR322. The resulting plasmid is referred to as pATi.
Plasmid pPGAP was digested with NcoI, followed by blunt-ending,
followed by SalI digestion and treatment with alkaline phosphatase.
The NcoI-SalI fragment was substituted with an approximately 1250
bp blunt-ended (BamHI)-SalI fragment obtained from plasmid pATi, by
BamHI digestion, blunt ending, and SalI digestion. This was
inserted into the pPGAP vector to produce the plasmid pGAPATi, a
6.6 kb plasmid, which was digested with NcoI and BamHI and a 2.3 kb
NcoI-BamHI fragment obtained having the .alpha..sub.1 -AT gene and
the GAPDH terminator and approximately 400 bp BamHI-NcoI fragment
obtained having the GAPDH promoter. These fragments were treated
together and inserted into the BamHI site of pC1/1. The plasmids
pC1/1GAPATi8 and pC1/1GAPATi9 were obtained with the orientation of
expression clockwise in the former and counterclockwise in the
latter, with amp.sup.r being in the counterclockwise direction.
These plasmids were transformed in S. cerevisiae AB103 (A.T.C.C.
No. 20658, deposited Jan. 5, 1983) by standard methods, selecting
for leucine prototrophy and grown as described above. Yeast
extracts were prepared by lysis with glass beads and the
.alpha..sub.1 -AT activity determined by inhibition of human
leukocyte elastase.
Assays contained in 1 ml: 1:0-0.2 human leukocyte elastase (HLE);
0.1 mM MeO-Suc-Ala-Ala-Pro-Val-p-nitroanilide (Batty et al., J.
Biol. Chem. (1980) 255:3931); 50 mM Tris, pH 8, 0.5M NaCl, and the
indicated amounts of yeast extract or human .alpha..sub.1 -AT.
Assays were initiated by the addition of elastase, incubated at
28.degree. C. for 15 min, terminated by the addition of 100 .mu.l
of 8N acetic acid and the absorbance at 410 nm determined. Typical
results are shown in the following Table 3.
TABLE 3 ______________________________________ Amt. Amt. Amt. %
Extract HLE Protein Elastase % Plasmid Strain (.mu.l) (.mu.g)
(.mu.g) Activity .alpha..sub.1 -AT*
______________________________________ pC1/ AB103 5.0 0.1 50.0 40
0.17 IGAPATi8 10.0 0.1 100.0 26 0.11 pC1/ AB103 0.25 0.1 2.3 89 0.7
IGAPATi9 1.0 0.1 9.1 26 1.2 pC1/ AB110 0.2 0.2 2.9 39 6.1 IGAPATi9
0.4 0.2 4.8 14 4.3 ______________________________________
*Calculation based upon the Mol. wt. of HLE (29 kD), the amount of
protei added and the degree of inhibition.
The above data demonstrate that plasmids having the orientation of
the expression cassette in the counterclockwise orientation, the
promoter proximal to the long sequence of pBR322, make 10-20 times
more .alpha..sub.1 -AT than the same cassette in the other
orientation.
Yeast strain AB110
Yeast strain 2150-2-3 was crossed with a yeast strain AB103
transformant containing pC1/1GAPATi9. The diploids were sporulated
and the tetrads disected. Strains were maintained on leucine
selective plates in order to ensure maintenance of the plasmid,
since the parents are auxotrophs. A series of colonies were
screened for their genotype with respect to a number of markers.
The most vigorous strains were selected and cultures grown on
leucine selective media. The best strain was designated AB110
(pC1/1GAPATi9), gave 6-7.5% of the total cell protein as
.alpha..sub.1 -AT as shown in the above Table 3. The strain AB110
has the following genotype: Mat.alpha., ura3-52, leu2-04 or both
leu2-3 and leu2-112, pep4-3, his4-580 (cir.degree.).
Phosphate induction
Plasmid pPGT80 was digested with BamHI, the ends blunt-ended,
followed by digestion with XbaI and the 500 bp fragment containing
the GAPDH promoter and 5'-end of the sAg gene isolated.
The PHO5 gene was isolated from a yeast genomic library employing
an oligonucleotide probe 5'-GGCACTCACACGTGGGACTAG-3' derived from
the published partial sequence (Meyhack et. al., The EMBO Journal
(1932) 1:675-680). A subfragment of this clone containing 550 bp of
the 5'-untranslated region and approximately 80 bp of coding
sequence was subcloned as a BamHI-SalI substitution in pBR322 to
provide pPHO5. This fragment has the sequence 5'-ATGTTTAAA-3',
encoding the first three amino acids, the second and third codons
specifying an AhaIII site. The plasmid pHBS6 was digested with
NcoI, blunt-ended, followed by digestion with BamHI and treatment
with alkaline phosphatase. The PHO5 promoter region was obtained by
digesting the pPHO5 plasmid with AhaIII, resecting the resulting
fragment with Bal31 for a short time, followed by digestion with
BamHI and isolation of a 500-550 bp BamHI blunt-ended fragment.
This fragment was employed for substitution of the NcoI-BamHI
fragment from pHBS6 and was screened for regeneration of the NcoI
restriction site to provide plasmid pHBS6PHO5/1.
Plasmid pHBS6PHO5/1 was digested with BstEII which cleaves at
position -175 in the PHO5 promoter. This molecule was blunt-ended,
digested with SalI and the 650 bp fragment having the 5'-portion of
the promoter domain, containing 275 bp of pBR322 and 375 bp of the
PHO5 promoter region isolated. This fragment was ligated with the
blunt-ended (BamHI)-XbaI fragment obtained from digestion of pPGT80
with BamHI, blunt ending, followed by XbaI digestion. After
digesting the ligated fragment with SalI and XbaI, the resulting
fragment was then substituted into pPGT16-3 which had been digested
with SalI and XbaI and treated with alkaline phosphatase. The
resulting plasmid pPHO5PGT80 had a cassette comprising the PHO5
regulatory region, the GAPDH promoter, the sAg gene and the ADH
terminator. This cassette was excised from the plasmid by BamHI
digestion, whereby a 1.8 kb BamHI-BamHI fragment was gel isolated
and ligated into the BamHI site of BamHI digested and alkaline
phosphatase treated pC1/1 to provide plasmids PHO5GAP1 and PHO5GAP2
where the PHO5 was distal and proximal to the long pBR322sequence,
respectively.
The two plasmids were transformed into yeast strain 2150-2-3 as
described above and grown in rich media as described above for 8 to
10 generations in either high (7 mM) or low (0.2 mM) phosphate.
Samples were harvested in late log phase and HBsAg determined as
described previously. The results are shown below in Table 4.
TABLE 4 ______________________________________ Regulation of HBsAg
Production in Yeast using a Hybrid PHO5/GAPDH Promoter High
Phosphate Low Phosphate (7 mM) (0.2 mM) Induction Construction (sAg
.mu.g/mg protein) low/high ______________________________________
PHO5GAP-1 0.08 0.95 12.0 PHO5GAP-2 0.27 0.40 1.5
______________________________________
From the above results, it is evident that effective regulation
with phosphate is obtained, with one orientation being superior to
the other.
It is evident from the above results, that highly efficient
expression can be obtained, either constitutive or regulated, by
providing for truncated promoter regions of yeast glycolytic enzyme
gene promoters employing the 3' domain proximal to the coding
region of the gene in conjunction with a 5'-portion or second
domain of the promoter region of a yeast gene subject to inducible
regulation by a nutrient, e.g., carbon source or phosphate.
temperature, or other externally controllable source or condition.
Alternatively, the second domain may be replaced by prokaryotic
sequences of at least about 1 kb or greater, which provide for
constitutive enhancement in the absence of the second domain of the
promoter region. Thus, a wide variety of genes exogenous to yeast
may be expressed in high yield in high percentages of the total
protein of the yeast host.
Although the foregoing invention has been described in some detail
by way of illustration and example for purposes of clarity of
understanding it will be obvious that certain changes and
modifications my be practiced within the scope of the appended
claims.
* * * * *