Corylus plant named `Wepster`

Abstract

A new and distinct cultivar of Corylus plant named `Wepster` characterized by high vigor and an upright-spreading plant habit, yellowish-green developing and fully expanded leaves during the spring and summer, resistance to eastern filbert blight caused by the fungus Anisogramma anomala (Peck) E. Muller, presence of random amplified polymorphic DNA markers 152-800 and 268-580 amplified by the polymerase chain reaction and which are linked to a dominant allele for resistance to eastern filbert blight from the cultivar Gasaway, expression of incompatibility alleles S.sub.1 and S.sub.2 in the styles, and DNA fingerprints at 8 of 20 microsatellite marker loci differ from both parents OSU 440.005 and `Tonda Pacifica`, and from one parent at an additional 12 marker loci.

Government Interests

ACKNOWLEDGMENT OF GOVERNMENT SUPPORT

This invention was made with government support under Specific Cooperative Agreement No. 58-5358-9-447 awarded by the United States Department of Agriculture. The government has certain rights in the invention.

Description

Botanical denomination: Corylus avellana.

Variety designation: `Wepster`.

BACKGROUND

The present Invention relates to a new and distinct cultivar of Corylus plant, botanically known as Corylus avellana, and hereinafter referred to by the name `Wepster`. Corylus avellana is in the family Betulaceae.

The new Corylus resulted from a controlled cross of female parent `Tonda Pacifica` and male parent OSU 440.005 (unpatented) made in 1997 by Shawn A. Mehlenbacher and David C. Smith. `Tonda Pacifica` is protected by U.S. Plant Pat. No. 22,715 (issued May 8, 2012). Hybrid seeds from the cross were harvested in August 1997, stratified, and seedlings grown in the greenhouse during the summer of 1998. From this cross, a total of 182 seedling trees were planted in the field in Corvallis, Oreg., USA in October, 1998. `Wepster` was discovered and selected by the Inventors as a single plant within the progeny of the stated cross-pollination in a controlled environment in Corvallis, Oreg. It was originally assigned the designation OSU 894.030 (unpatented), which indicates the row and tree location of the original seedling. OSU 440.005 (unpatented) is from a cross of OSU 49.073.times.VR 8-32 (both unpatented). OSU 49.073 is from a cross of OSU 14.084.times.`Tombul Ghiaghli` (both unpatented). OSU 14.084 is from a cross of `Barcelona`.times.`Daviana` (both unpatented). VR 8-32 is from a cross of `Montebello`.times.`Gasaway` (both unpatented). `Tonda Gentile delle Langhe` (unpatented), the female parent of `Tonda Pacifica`, is an important cultivar in Piemonte, northern Italy. `Barcelona`, Oregon's most widely planted hazelnut cultivar, is known as `Castanyera` (unpatented) where it originated in Catalunya, Spain. `Daviana`, originally from England, is the most widely planted pollinizer in `Barcelona` orchards. `Tombul Ghiaghli`, obtained from Greece, is similar to the Turkish cultivar `Mincane` (unpatented). `Montebello` is widely grown under several names in Sicily. `Gasaway` is the source of a single dominant gene for resistance to eastern filbert blight.

The new cultivar was asexually reproduced by rooted suckers annually for eight years (2004-05 and 2007-12) in Corvallis, Oreg. The new cultivar was also asexually propagated by whip grafting in 2005 in Corvallis, Oreg. The unique features of this new Corylus are stable and reproduced true-to-type in successive generations of asexual reproduction.

SUMMARY

The following traits have been repeatedly observed and are determined to be the unique characteristics of `Wepster`. These characteristics in combination distinguish `Wepster` as a new and distinct cultivar: 1. High vigor and upright-spreading plant habit. 2. Yellowish-green developing and fully expanded leaves during the spring and summer. 3. Resistance to eastern filbert blight caused by the fungus Anisogramma anomala (Peck) E. Muller. 4. Presence of random amplified polymorphic DNA markers 152-800 and 268-580 in DNA of `Wepster` amplified by the polymerase chain reaction. These two markers are linked to a dominant allele for resistance to eastern filbert blight from the cultivar Gasaway (unpatented). 5. Expression of incompatibility alleles S.sub.1 and S.sub.2 in the styles. 6. DNA fingerprints at 8 of 20 microsatellite marker loci differ from both parents, `Tonda Pacifica` and OSU 440.005, and from one parent at an additional 12 marker loci. Additional DNA fingerprints of grandparent `Tonda Gentile delle Langhe`, standard cultivar `Barcelona`, eastern filbert blight resistance source `Gasaway` and five cultivars released by Oregon State University hazelnut breeding program are shown in attached Table 2.

In comparisons in two replicated trials conducted in Corvallis, Oreg., plants of the new Corylus differed from plants of the Corylus avellana cultivar `Barcelona` (unpatented), and other cultivars and selections of Corylus avellana known to the Inventors primarily in nut size, nut shape, kernel percentage (ratio of kernel weight to nut weight), frequency of blank nuts (nuts lacking kernels), time of pollen shed, time of nut maturity, length of the husk or involucre, and plant size. For example: Blank nut frequency: `Wepster` in two trials 7.25%, `Barcelona` in one trial 7.7%; Pollen shed: `Wepster` sheds pollen about 6 days later than `Barcelona` (average of 3 years, 2011-13); Nut maturity: `Wepster` nuts mature 8 days earlier than Barcelona; and Husk Length: `Wepster` 2 times nut length, `Barcelona` 1.5 times nut length.

BRIEF DESCRIPTION OF THE DRAWINGS

The accompanying colored photographs illustrate the overall appearance of the new cultivar, showing the colors as true as it is reasonably possible to obtain in colored reproductions of this type. Colors in the photographs may differ slightly from the color values cited in the detailed botanical description which accurately describe the colors of the new Corylus.

FIG. 1 shows typical nuts, raw kernels, and blanched kernels of `Wepster` hazelnut (OSU 894.030) compared to those of `Yamhill` hazelnut.

FIG. 2 shows the typical nuts, raw kernels, and blanched kernels of `Wepster` hazelnut (OSU 894.030) compared to those of `Barcelona`, `Felix,` and `York` hazelnut cultivars.

FIG. 3 shows the blanched kernels of `Wepster` hazelnut (OSU 894.030).

FIG. 4 shows the tree of the new cultivar `Wepster` growing in a field in January, in Corvallis, Oreg.

FIG. 5 shows a pruned tree of the new cultivar `Wepster` in January, in Corvallis, Oreg.

FIG. 6 shows the husks and nuts of `Wepster` hazelnut.

FIG. 7 shows a tree of the new cultivar `Wepster,` 8.sup.th leaf, growing in a field in the summer, in Corvallis, Oreg.

DETAILED DESCRIPTION

The cultivar `Wepster` has not been observed under all possible environmental conditions. The phenotype may vary somewhat with variations in environment such as temperature and light intensity, without, however, any variance in genotype. The aforementioned images and following observations and measurements describe plants grown in Corvallis, Oreg. under commercial practice outdoors in the field during the fall, winter and spring. Plants used for the photographs and description were propagated by tie-off layerage and growing on their own roots, and about seven years old. In the following description, color references are made to The Royal Horticultural Society Colour Chart, 1966 Edition, except where general terms of ordinary dictionary significance are used. The list of UPOV descriptors are from the Mar. 28, 1979 Hazelnut guidelines from UPOV. Botanical classification: Corylus avellana cultivar Wepster. Parentage: Female, or seed, parent.--Corylus avellana cultivar Tonda Pacifica (U.S. Plant Pat. No. 22,715). Male, or pollen, parent.--Corylus avellana selection OSU 440.005 (unpatented). Propagation (type rooted suckers): Time to initiate roots.--About 30 days at 20.degree. C. Time to produce a rooted young plant.--About six months at 22.degree. C. Root description.--Fine to thick; freely branching; creamy white in color. Propagation (type whip grafting): Time to budbreak on the scions.--About 14 days at 25.degree. C. Time to produce a grafted plant.--About six months at 25.degree. C. Plant description: Type.--Natural habit is a perennial shrub, but in commercial orchards is a single-trunk tree. Upright-spreading plant habit. Growth and branching habit.--Freely branching; about 15 lateral branches develop per plant. Pinching, i.e., removal of the terminal apices, enhances branching with lateral branches potentially forming at every node. Size.--Plant height. -- About 6 meters; plant diameter or spread is about 6 meters. Vigor.--High vigor growth habit. Lateral branch description: Length.--About 32 cm. Diameter.--About 6 mm. Internode length.--About 3.0 cm. Texture.--Smooth, glabrous. Strength.--Strong. Color.--Immature -- 152B; mature -- 152B. Foliage description: Arrangement.--Alternate, simple. Length.--About 10.2 cm. Width.--About 9.1 cm. Shape.--Oblong to ovate. Apex.--Obtuse to acute. Base.--Cordate. Margin.--Serrate. Texture, upper and lower surfaces.--Slightly pubescent. Venation pattern.--Pinnate. Leaf bud shape.--Globular. Time of leaf budbreak.--Descriptor=6 (medium to late). Coloration of leaf bud.--178C. Time of leaf fall.--Descriptor=4 (between `Tonda Gentile delle Langhe` and `Barcelona`). Color.--Developing foliage, upper surface 144A, lower surfaces: 187A. Fully expanded foliage, upper surface: Spring and summer, 143A; late summer and fall, 143A. Fully expanded foliage, lower surface: Spring and summer, 139C; late summer and fall, 139C. Venation, upper surface: Spring and summer, 139C; late summer and fall, 139C. Venation, lower surface: Spring and summer, 139D; late summer and fall, 139D. Petiole description: Length.--About 2.7 cm. Diameter.--About 1.8 mm. Texture, upper and lower surfaces.--Pubescent. Color.--Upper surface: Spring and summer, 139D; late summer and fall, 139D. Lower surface: Spring and summer, 139D; late summer and fall, 139D. Flower description: Male inflorescences.--Catkins, color prior to elongation 176C. Female inflorescence.--Style color 048B to 047B. Time of pollen shed.--Descriptor=6 (same as `Daviana`, `Cosford`, and `Tonda Romana`). Catkin length.--29.5 mm, descriptor=5 (medium). Time of female flowering.--Descriptor=5 (medium). Time of female flowering compared to male flowering.--Protogyny, descriptor=1 (earlier). Involucre constriction.--Absent. Involucre length.--Twice length of nut, descriptor=7. Size of indentation.--Descriptor=7 (strong). Strength of serration of indentation.--Descriptor=7 (strong). Pubescence on husk.--Descriptor=9 (present). Thickness of callus at base.--Descriptor=5 (medium). Jointing of bracts.--Descriptor=2 (on one side). Nut description: Length.--About 18.3 mm. Width.--About 19.0 mm. Depth.--About 16.6 mm. Nut shape.--Round. Nut shape index [(width+depth)/2*length]--0.97. Nut compression index (width/depth).--1.15. Nut shell color.--164A. Nut weight.--About 2.39 grams. Kernel weight.--About 1.11 grams. Kernel percentage (kernel weight/nut weight).--About 43.9%. Number of fruits per cluster.--Two to three. Number of stripes on shell.--Descriptor=5 (medium). Prominence of fruit apex.--Slight, descriptor=3. Size of fruit pistil.--Very small, descriptor=3. Hairiness of top of fruit.--Weak, descriptor=3. Curvature of nut basal scar.--Flat. Double kernels.--Absent. Kernel shape.--Globular. Shape of kernel in cross-section.--Circular. Lateral groove in kernel.--Absent. Corkiness of pellicle of kernel.--Descriptor=5 (medium corky). Nut yield (pounds per tree or per acre).--Total 25.91 kg per tree, years 3 to 7 (1.sup.st trial) (very high) total 19.67 kg per tree, years 3 to 7 (2.sup.nd trial). Storability of fruits.--Excellent, similar to OSU releases and check cultivars. Disease/pest resistance: Plants of the new Corylus are highly resistant to eastern filbert blight caused by the fungus Anisogramma anomala (Peck) E. Muller. Plants of the new Corylus are highly resistant to bud mites (Phytoptus avellanae Nal.), while plants of `Tonda Gentile delle Langhe` are highly susceptible, and plants of `Barcelona` are highly resistant. Temperature tolerance: Plants of the new Corylus have been observed to tolerate temperatures from -10 to 38 degrees C. in the field in Corvallis, Oreg.

TABLE-US-00001 TABLE 1 Primers and annealing temperatures for the 20 microsatellite marker loci used to fingerprint `Wepster` and other hazelnut cultivars. Locus Repeat motif Size T.sub.a n He Ho A614 (TC).sub.17(CA).sub.10 125-156 60 14 0.85 0.85 NNN(CA).sub.6 A616 (AC).sub.11 136-162 60 13 0.85 0.85 A640 (CT).sub.15(CA).sub.13 354-378 67 11 0.80 0.73 B617 (GA).sub.15 280-298 60 9 0.80 0.78 B619 (TC).sub.21 146-180 60 14 0.88 0.88 B634 (AG).sub.15 218-238 60 9 0.76 0.76 B671 (AG).sub.6NN(GA).sub.17 221-249 60 13 0.86 0.88 B709 (GA).sub.21 219-233 60 16 0.87 0.80 B733 (TC).sub.15 161-183 60 8 0.68 0.68 B749 (TC).sub.12 200-210 60 6 0.60 0.64 B767 (TC).sub.15(AT).sub.7 198-238 60 16 0.87 0.80 B774 (AG).sub.15 195-213 60 8 0.80 0.80 B795 (TC).sub.8Ns(CT).sub.7Ns 296-332 60 12 0.76 0.74 (CT).sub.10Ns(TC).sub.5 C115 (TAA).sub.5(GAA).sub.12 167-226 60 14 0.80 0.80 KG807 (TAAA)AA(TAAA).sub.2 226-248 54 4 0.67 0.78 A(TAAA).sub.2 KG809 (AGG).sub.6 333-345 55 5 0.66 0.64 KG811 (GA).sub.17 240-278 58 12 0.83 0.82 KG827 (CT).sub.13AA(CA).sub.7 264-282 67 9 0.78 0.84 KG830 (CT).sub.14GTATT(CA).sub.8 279-311 67 9 0.79 0.78 Soman-G (AAT).sub.5 193-200 54 3 0.60 0.98 (=856- MS1-13) Primers 5'-3' Locus PIC r LG (forward) A614 0.84 0.00 6 Hex-TGGCAGAGCTTTGT CAGCTT (SEQ ID NO: 1) A616 0.83 0.00 8 Fam-CACTCATACCGCAA ACTCCA (SEQ ID NO: 3) A640 0.77 0.04 10 F-TGCCTCTGCAGTTAGTC ATCAAATGTAGG (SEQ ID NO: 5) B617 0.78 0.01 8 Fam-TCCGTGTTGAGTATG GACGA (SEQ ID NO: 7) B619 0.87 0.00 3 Fam-AGTCGGCTCCCCT TTTCTC (SEQ ID NO: 9) B634 0.73 0.00 4 Hex-CCTGCATCCAGGACT CATTA (SEQ ID NO: 11) B671 0.84 -0.01 9 Hex-TTGCCAGTGCATACT CTGATG (SEQ ID NO: 13) B709 0.86 0.04 8 Fam-CCACCAACTGTTTC ACACCA (SEQ ID NO: 15) B733 0.63 0.00 7,2 Ned-CACCCTCTTCACCAC CTCAT (SEQ ID NO: 17) B749 0.51 -0.03 1 Hex-GGCTGACAACACAG CAGAAA (SEQ ID NO: 19) B767 0.86 0.04 8 Fam-CCACCAACTGTTTC ACACCA (SEQ ID NO: 21) B774 0.77 0.01 5 Ned-GTTTTGCGAGCTCATT GTCA (SEQ ID NO: 23) B795 0.74 0.01 NA Fam-GACCCACAAACAAT AACCTATCTC (SEQ ID NO: 25) C115 0.77 0.00 4 Fam-ATTTTCCGCAGAT AATACAGG (SEQ ID NO: 27) KG807 0.60 -0.07 11 AAGCAAGAAAGGGATGGT (SEQ ID NO: 29) KG809 0.60 0.01 4 Hex-AGGCATCAGTTCA TCCAA (SEQ ID NO: 31) KG811 0.81 0.01 2 Ned-AAGGCGGCACTC GCTCAC (SEQ ID NO: 33) KG827 0.75 -0.04 9 Fam-AGAACTCCGACTA ATAATCCTAACCCTTGC (SEQ ID NO: 35) KG830 0.76 0.00 9 Ned-TGGAGGAAGTTTT GAATGGTAGTAGAGGA (SEQ ID NO: 37) Soman-G 0.51 -0.27 NA Hex-TGGCGTTGCAACAT (=856- ATTCTC (SEQ ID NO: 39) MS1-13) Primers 5'-3' Locus (reverse) Reference A614 R-GCAGTGGAGGATTGCTGACT Gurcan et al. 2010 (SEQ ID NO: 2) A616 R-ATGGCTTTTGCTTCGTTTTG Gurcan et al. 2010 (SEQ ID NO: 4) A640 Fam-CGCCATATAATTGGATGC Gurcan et al. 2010 TTGTTG (SEQ ID NO: 6) B617 R-TGTTTTTGGTGGAGCGATG Gurcan et al. 2010 (SEQ ID NO: 8) B619 R-GCGATCTGACCTCATTTTTG Gurcan et al. 2010 (SEQ ID NO: 10) B634 R-GTGCAGAGGTTGCACTCAAA Gurcan et al. 2010 (SEQ ID NO: 12) B671 R-ACCAGCTCTGGGCTTAACAC Gurcan et al. 2010 (SEQ ID NO: 14) B709 R-GCGAAATGGAGCTCTTGAAC Gurcan et al. 2010 (SEQ ID NO: 16) B733 R-CATCCCCTGTTGGAGTTTTC Gurcan et al. 2010 (SEQ ID NO: 18) B749 R-TCGGCTAGGGTTAGGGTTTT Gurcan et al. 2010 (SEQ ID NO: 20) B767 R-GCGAAATGGAGCTCTTGAAC Gurcan et al. 2010 (SEQ ID NO: 22) B774 R-TGTGTGTGGTCTGTAGGCAC Gurcan et al. 2010 T (SEQ ID NO: 24) B795 R-TGGGCATCATCCAGGTCTA Gurcan et al. 2010 (SEQ ID NO: 26) C115 GTTTCCAGATCTGCCTCCATAT Bassil et al. AAT (SEQ ID NO: 28) 2005b, Gokirmak et al. 2009 KG807 FAM-CTTACAGATAAATGGCTC Gurcan and AAA (SEQ ID NO: 30) Mehlenbacher 2010 KG809 F-GGAAGGTGAGAGAAATCAAG Gurcan and T (SEQ ID NO: 32) Mehlenbacher 2010 KG811 F-GAACAACTGAAGACAGCAAA Gurcan and G (SEQ ID NO: 34) Mehlenbacher 2010 KG827 GAGGGAGCAAGTCAAAGTTGAG Gurcan and AAGAAA (SEQ ID NO: 36) Mehlenbacher 2010 KG830 AAAGCAACTCATAGC Gurcan and TGAAGTCCAATCA (SEQ ID Mehlenbacher 2010 NO: 38) Soman-G R-GCCATCTTTAG unpublished (=856- AAAGTTCGATACAG MS1-13) (SEQ ID NO: 40) Primer fluorescent tags are FAM, HEX, and NED. Ta: annealing temperature (.degree. C.) N: number of alleles He: expected heterozygosity Ho: observed heterozygosity PIC: polymorphism information content r: estimated null allele frequency LG: linkage group Reference: for development and characterization

TABLE-US-00002 TABLE 2 Allele sizes in Wepstee and other hazelnut cultivars at 20 microsatellite loci. Tonda OSU Tonda Gentile Bar- Locus Wepster Pacifica 440.005 delle Langhe celona A614 135/158 135/150 125/158 125/135 125/132 A616 152/160 150/160 152/160 150/152 144/152 A640 368/374 368/374 355/368 355/368 355/374 B617 293/295 293/293 293/295 285/295 285/289 B619 166/172 166/172 166/166 150/166 158/172 B634 228/228 228/228 228/234 228/228 228/228 B671 239/249 229/239 249/249 239/243 225/229 B709 229/235 229/235 223/229 229/229 227/235 B733 173/175 173/175 173/175 173/175 173/175 B749 207/209 207/209 209/209 207/209 209/209 B767 200/242 200/218 212/242 214/218 214/240 B774 203/207 203/207 203/211 203/211 203/207 B795 333/333 315/333 333/333 315/333 333/333 C115 183/194 174/183 194/216 174/174 174/194 KG807 252/252 228/252 252/252 238/252 238/252 KG809 342/342 339/342 342/348 339/342 339/339 KG811 257/257 245/257 257/267 257/267 261/267 KG827 270/282 270/284 272/282 268/278 282/284 KG830 295/305 291/295 295/305 291/295 291/295 Soman-G 196/200 196/200 196/196 196/200 196/200 Locus Vanillin Dorris York Felix Santiam Gasaway A614 132/158 132/158 124/158 138/143 132/158 143/158 A616 150/150 150/152 144/152 150/152 150/152 150/150 A640 355/368 372/374 363/374 368/372 355/362 362/368 B617 289/295 287/295 287/289 287/287 285/295 291/295 B619 158/172 158/166 158/166 158/166 158/166 172/176 B634 236/236 228/228 228/236 228/236 222/236 222/234 B671 225/243 229/249 243/249 229/237 225/237 237/249 B709 229/229 229/229 229/233 229/233 229/229 229/229 B733 181/185 173/181 173/181 175/181 175/181 175/175 B749 209/209 207/207 209/209 207/207 209/209 207/209 B767 214/238 214/218 236/238 214/214 212/214 214/214 B774 203/211 203/207 203/209 203/213 209/213 203/209 B795 333/333 333/333 333/333 321/333 317/333 317/319 C115 197/216 194/216 197/197 197/216 194/197 216/219 KG807 230/252 242/252 242/252 238/242 242/252 242/252 KG809 348/348 339/348 339/348 339/348 339/342 339/348 KG811 251/261 257/267 257/257 251/267 257/267 257/261 KG827 268/282 272/284 268/272 272/284 272/272 272/282 KG830 291/295 295/297 295/295 293/303 291/295 291/305 Soman- 196/200 196/200 196/200 196/200 196/200 196/196 G

References: Bassil N. V., Botta R., Mehlenbacher S. A. 2005a. Microsatellite markers in hazelnut: Isolation, characterization and cross-species amplification. J. Amer. Soc. Hort. Sci. 130:543-549. Bassil N. V., Botta R., Mehlenbacher S. A. 2005b. Additional microsatellite markers of the European hazelnut. Acta Hort. 686:105-110. Boccacci P., Akkak A., Bassil N. V., Mehlenbacher S. A., Botta R. 2005. Characterization and evaluation of microsatellite loci in European hazelnut (C. avellana) and their transferability to other Corylus species. Molec. Ecol. Notes 5:934-937. Boccacci P., Akkak, A. and Botta, R. 2006. DNA typing and genetic relations among European hazelnut (Corylus avellana L.) cultivars using microsatellite markers. Genome 49:598-611. Gokirmak T., Mehlenbacher S. A., Bassil N. V. 2009. Characterization of European hazelnut (Corylus avellana) cultivars using SSR markers. Genetic Resources and Crop Evolution 56:147-172. Gurcan, K., S. A. Mehlenbacher and V. Erdogan. 2010a. Genetic diversity in hazelnut cultivars from Black Sea countries assessed using SSR markers. Plant Breeding (available on-line doi :10. 1111/j. 1439-0523. 2009. 01753. x). Gurcan, K., S. A. Mehlenbacher, N. V. Bassil, P. Boccacci, A. Akkak and R. Botta. 2010b. New microsatellite markers for Corylus avellana from enriched libraries. Tree Genetics and Genomes (available on-line as DOI 10.1007/s11295-010-0269-y). Gurcan, K. and S. A. Mehlenbacher. 2010. Development of microsatellite marker loci for European hazelnut (Corylus avellana L.) from ISSR fragments. Molecular Breeding (available on-line).

SEQUENCE LISTINGS

1

40120DNAArtificial SequenceSynthetic polynucleotide 1tggcagagct ttgtcagctt 20220DNAArtificial SequenceSynthetic polynucleotide 2gcagtggagg attgctgact 20320DNAArtificial SequenceSynthetic polynucleotide 3cactcatacc gcaaactcca 20420DNAArtificial SequenceSynthetic polynucleotide 4atggcttttg cttcgttttg 20529DNAArtificial SequenceSynthetic polynucleotide 5tgcctctgca gttagtcatc aaatgtagg 29624DNAArtificial SequenceSynthetic polynucleotide 6cgccatataa ttggatgctt gttg 24720DNAArtificial SequenceSynthetic polynucleotide 7tccgtgttga gtatggacga 20819DNAArtificial SequenceSynthetic polynucleotide 8tgtttttggt ggagcgatg 19919DNAArtificial SequenceSynthetic polynucleotide 9agtcggctcc ccttttctc 191020DNAArtificial SequenceSynthetic polynucleotide 10gcgatctgac ctcatttttg 201120DNAArtificial SequenceSynthetic polynucleotide 11cctgcatcca ggactcatta 201220DNAArtificial SequenceSynthetic polynucleotide 12gtgcagaggt tgcactcaaa 201321DNAArtificial SequenceSynthetic polynucleotide 13ttgccagtgc atactctgat g 211420DNAArtificial SequenceSynthetic polynucleotide 14accagctctg ggcttaacac 201520DNAArtificial SequenceSynthetic polynucleotide 15ccaccaactg tttcacacca 201620DNAArtificial SequenceSynthetic polynucleotide 16gcgaaatgga gctcttgaac 201720DNAArtificial SequenceSynthetic polynucleotide 17caccctcttc accacctcat 201820DNAArtificial SequenceSynthetic polynucleotide 18catcccctgt tggagttttc 201920DNAArtificial SequenceSynthetic polynucleotide 19ggctgacaac acagcagaaa 202020DNAArtificial SequenceSynthetic polynucleotide 20tcggctaggg ttagggtttt 202120DNAArtificial SequenceSynthetic polynucleotide 21ccaccaactg tttcacacca 202220DNAArtificial SequenceSynthetic polynucleotide 22gcgaaatgga gctcttgaac 202320DNAArtificial SequenceSynthetic polynucleotide 23gttttgcgag ctcattgtca 202421DNAArtificial SequenceSynthetic polynucleotide 24tgtgtgtggt ctgtaggcac t 212524DNAArtificial SequenceSynthetic polynucleotide 25gacccacaaa caataaccta tctc 242619DNAArtificial SequenceSynthetic polynucleotide 26tgggcatcat ccaggtcta 192721DNAArtificial SequenceSynthetic polynucleotide 27attttccgca gataatacag g 212825DNAArtificial SequenceSynthetic polynucleotide 28gtttccagat ctgcctccat ataat 252918DNAArtificial SequenceSynthetic polynucleotide 29aagcaagaaa gggatggt 183021DNAArtificial SequenceSynthetic polynucleotide 30cttacagata aatggctcaa a 213118DNAArtificial SequenceSynthetic polynucleotide 31aggcatcagt tcatccaa 183221DNAArtificial SequenceSynthetic polynucleotide 32ggaaggtgag agaaatcaag t 213318DNAArtificial SequenceSynthetic polynucleotide 33aaggcggcac tcgctcac 183421DNAArtificial SequenceSynthetic polynucleotide 34gaacaactga agacagcaaa g 213530DNAArtificial SequenceSynthetic polynucleotide 35agaactccga ctaataatcc taacccttgc 303628DNAArtificial SequenceSynthetic polynucleotide 36gagggagcaa gtcaaagttg agaagaaa 283729DNAArtificial SequenceSynthetic polynucleotide 37tggaggaagt tttgaatggt agtagagga 293828DNAArtificial SequenceSynthetic polynucleotide 38aaagcaactc atagctgaag tccaatca 283920DNAArtificial SequenceSynthetic polynucleotide 39tggcgttgca acatattctc 204025DNAArtificial SequenceSynthetic polynucleotide 40gccatcttta gaaagttcga tacag 25

Claims

We claim:

1. A new and distinct cultivar of Corylus plant named `Wepster`, as illustrated and described.