U.S. patent number 9,695,403 [Application Number 13/321,465] was granted by the patent office on 2017-07-04 for phytases, nucleic acids encoding them and methods for making and using them.
This patent grant is currently assigned to Syngenta Participations AG. The grantee listed for this patent is Ryan McCann, Arne I. Solbak, Jr., David P. Weiner. Invention is credited to Ryan McCann, Arne I. Solbak, Jr., David P. Weiner.
United States Patent |
9,695,403 |
Weiner , et al. |
July 4, 2017 |
Phytases, nucleic acids encoding them and methods for making and
using them
Abstract
This invention relates to phytases, polynucleotides encoding
them, uses of the polynucleotides and polypeptides of the
invention, as well as the production and isolation of such
polynucleotides and polypeptides. In particular, the invention
provides polypeptides having phytase activity under high
temperature conditions, and phytases that retain activity after
exposure to high temperatures. The invention further provides
phytases which have increased gastric lability. The phytases of the
invention can be used in foodstuffs to improve the feeding value of
phytate rich ingredients. The phytases of the invention can be
formulated as foods or feeds or supplements for either to, e.g.,
aid in the digestion of phytate.
Inventors: |
Weiner; David P. (Del Mar,
CA), Solbak, Jr.; Arne I. (San Diego, CA), McCann;
Ryan (San Diego, CA) |
Applicant: |
Name |
City |
State |
Country |
Type |
Weiner; David P.
Solbak, Jr.; Arne I.
McCann; Ryan |
Del Mar
San Diego
San Diego |
CA
CA
CA |
US
US
US |
|
|
Assignee: |
Syngenta Participations AG
(Basel, CH)
|
Family
ID: |
43126780 |
Appl.
No.: |
13/321,465 |
Filed: |
May 20, 2010 |
PCT
Filed: |
May 20, 2010 |
PCT No.: |
PCT/US2010/035667 |
371(c)(1),(2),(4) Date: |
May 04, 2012 |
PCT
Pub. No.: |
WO2010/135588 |
PCT
Pub. Date: |
November 25, 2010 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20120066781 A1 |
Mar 15, 2012 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
61180283 |
May 21, 2009 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P
19/08 (20180101); A61P 19/10 (20180101); C12N
15/8242 (20130101); C12N 9/16 (20130101); Y10T
428/2982 (20150115); Y02E 50/10 (20130101) |
Current International
Class: |
C12N
9/16 (20060101); A23L 7/00 (20160101) |
Field of
Search: |
;530/350 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
1706941 |
|
Dec 2005 |
|
CN |
|
0441252 |
|
Sep 1997 |
|
EP |
|
0897985 |
|
Feb 1999 |
|
EP |
|
2005-278544 |
|
Oct 2005 |
|
JP |
|
97/33976 |
|
Sep 1997 |
|
WO |
|
98/44125 |
|
Oct 1998 |
|
WO |
|
99/08539 |
|
Feb 1999 |
|
WO |
|
00/58481 |
|
Oct 2000 |
|
WO |
|
00/64247 |
|
Nov 2000 |
|
WO |
|
00/71728 |
|
Nov 2000 |
|
WO |
|
01/36607 |
|
May 2001 |
|
WO |
|
01/62947 |
|
Aug 2001 |
|
WO |
|
01/90333 |
|
Nov 2001 |
|
WO |
|
2004/015084 |
|
Feb 2004 |
|
WO |
|
2007/112739 |
|
Oct 2007 |
|
WO |
|
2008/017066 |
|
Feb 2008 |
|
WO |
|
2008036916 |
|
Mar 2008 |
|
WO |
|
2009/073399 |
|
Jun 2009 |
|
WO |
|
Other References
EPO--Aug. 21, 2013--Extended EP Search Report--EP13164378.5. cited
by applicant .
JPO--May 27, 2013--Decision of Grant and Allowed
Claims--JP2009-529415. cited by applicant .
Lei--Annu. Rev. Anim. Biosci. (2013) 1:283-309. cited by applicant
.
SIPO--Jun. 20, 2013--5th Office Action and
Translation--CN01812774.6. cited by applicant .
SIPO--Jun. 25, 2013--Third Office Action and
Translation--CN200810005794.5. cited by applicant .
SIPO--Aug. 23, 2013--Fourth Office Action and
Translation--CN200780043087.9. cited by applicant .
USPTO--Jun. 27, 2013--Final Rejection & Considered IDS--U.S.
Appl. No. 12/442,207. cited by applicant .
Vehmaanpera--"What Next--Potential Improvements in Phytases?" AB
Enzymes IPS2, Rome, IT (2012). cited by applicant .
AUIP--Aug. 2, 2013--Second Examination Report--AU2007299612. cited
by applicant .
Berg--Biochemistry Fifth Ed., W.H. Freeman and Company, New
York--(2002) pp. 176-177. cited by applicant .
EPO--Apr. 17, 2012--94(3) Communication--EP05013009.5. cited by
applicant .
EPO--Oct. 15, 2012--Rule 64 Extended EP Search
Report--EP10778424.1. cited by applicant .
EPO--Dec. 5, 2012--94(3) Communication--EP 11181439.8. cited by
applicant .
Hurrell--The American Journal of Clinical Nutrition (2003)
77--1213-1219. cited by applicant .
Iponz--Jun. 1, 2012--First Examination Report--NZ 596459. cited by
applicant .
JPO--Nov. 12, 2012--Office Action and Translation--2009-529415.
cited by applicant .
SIPO--Apr. 28, 2012--Third Office Action--CN 01812774.6. cited by
applicant .
SIPO--Jul. 2, 2012--Second Office Action--CN200780043087.9. cited
by applicant .
SIPO--Oct. 10, 2012--Decision of Final Rejection--200810005794.5.
cited by applicant .
SIPO--Feb. 5, 2013--4th Office Action and Translation--CN1812774.6.
cited by applicant .
USPTO--Jul. 19, 2012--Office Action & Form 892 +
References--U.S. Appl. No. 12/442,207. cited by applicant .
USPTO--Jan. 28, 2013--Office Action & Form 892--U.S. Appl. No.
12/442,207. cited by applicant .
Search Report--PCT/US2007/079187--ISR & WO--Oct. 1, 2008. cited
by applicant .
Search Report--PCT/US2010/35667--ISR & WO--Nov. 18, 2010. cited
by applicant .
SIPO--Dec. 15, 2010--CN Notification of Reexamination--CN
01812774.6. cited by applicant .
Tomschy--Protein Science (2000) 9:1304-1311. cited by applicant
.
Vetriani--PNAS USA (1998) 95:12300-12305. cited by applicant .
EPO--Office Action--Apr. 21, 2011--EP07842987.5. cited by applicant
.
EPO--Office Action--Nov. 4, 2011--EP07842987.5. cited by applicant
.
SIPO--Oct. 26, 2011--CN Notification of First Office Action &
Translation--CN200780043087.9. cited by applicant .
SIPO--Dec. 23, 2011--CN Second Office Action &
Translation--CN200810005794.5. cited by applicant .
INIP--Feb. 24, 2012--Second Office Action--India 3129/DELNP/2004.
cited by applicant .
Dvorakova et al., Folia Microbiol. (1998) 43:323-338. cited by
applicant .
Adeola O. et. al. Journal of Animal Science (1995) 73: 3384-3391.
cited by applicant .
Bork et al., Genome Research (2000) 10:348-400. cited by applicant
.
Branden et al., Introduction to Protein Structure, Garland
Publishing Inc., New York, (1991) p. 247. cited by applicant .
Brinch-Pedersen et al., Molecular Breeding (2000) pp. 195-206.
cited by applicant .
Broun et al., Science (1998) 282:1315-1317. cited by applicant
.
CIPO--Apr. 29, 2010--Office Action--CA 2565314. cited by applicant
.
Dassa et al., J. of Bacteriology (1990) 172:5497-5500. cited by
applicant .
Dassa et al., J. of Biological Chemistry (1982) 257(12):6669-6676.
cited by applicant .
Delagrave et al., Nature Biotech. (1993) 11:1548-1552. cited by
applicant .
Delagrave et al., Protein Eng. (1993) 6:327-331. cited by applicant
.
GenBank Accession No. AAX26540 Schistosoma japonicum (2005). cited
by applicant .
GenBank Accession No. AR130956 Sequence from U.S. Pat. No.
6,190,897 Kretz (2001). cited by applicant .
Golovan et al., Canadian Journal of Microbiology (2000) 46:59-71.
cited by applicant .
Greiner et al., Archives of Biochemistry and Biophysics (1993)
303:107-113. cited by applicant .
Greiner et al., Archives of Biochemistry and Biophysics (1997)
341:201-206. cited by applicant .
Guo et al., PNAS USA (2004) 101(25):9205-9210. cited by applicant
.
Jung et al., J. Athl. Train. 40(2):71-75, 2005. cited by applicant
.
Kerovuo et al., Applied and Environ. Biol. (1998) 64:2079-2085.
cited by applicant .
Lehmann et al., Protein Science (2000) 1866-1872. cited by
applicant .
Lim et al., Nature Structural Biology (2000) 7:108-113. cited by
applicant .
NCBI GenBank Accession No. M58708, 1991. cited by applicant .
Nelson et al., J. Nutrition (1971) 101:1289-1294. cited by
applicant .
Oh et al., Abstracts of the General Meeting of the American Society
for Microbiology (2000) 100:499-500. cited by applicant .
Ostanin et al., GenBank Accession No. L03371 (1992). cited by
applicant .
Pointillart A., Journal of Animal Science (1991) 69: 1109-1115.
cited by applicant .
Rodriguez et al., Biochemical and Biophysical Research Comm. (1999)
257:117-123. cited by applicant .
Search Report--European for EP 07075392, mailed Jul. 9, 2008. cited
by applicant .
Seffernick et al., Journal of Bacteriology (2001) 183:2405-2410.
cited by applicant .
Swiss-Prot Accession No. P07102 Escherichia coli K-12 Dassa (1988).
cited by applicant .
Warden and Schaible, Poultry Science (1962) 41:725-732. cited by
applicant .
Witkowski et al., Biochemistry (1999) 38:11643-11650. cited by
applicant .
Wu et al., Poultry Science (2006) 85:64-69. cited by applicant
.
Wyss et al., Applied and Environmental Microbiology (1999)
65:359-366. cited by applicant .
Yi Z. et. al., Journal of Animal Science (1996) 74: 1601-1611.
cited by applicant .
Blattner--Science (1997)--277--1453-1462. cited by applicant .
EBI (Geneseq) Accession No. GSP: AEI27121--Pichia pastoris phytase
appA-t protein Figure 4. Sun (2006). cited by applicant .
EBI (Geneseq) Accession No. GSP: AE127122--Pichia pastoris phytase
appA-t protein p. 15-18. Sun (2006). cited by applicant .
Extended EP Search Report--EP 07842987.5 (Aug. 24, 2010). cited by
applicant .
Garrett--Appl. Environ. Microbiol. (2004)--70--3041-3046. cited by
applicant .
Genbank Accession No. L03371--Escherichia coli periplasmic
phosphoanhydride phosphohydrolase (appA) gene--Ostanin (1992).
cited by applicant .
Giver--PNAS USA (1998) 95:12809-12813. cited by applicant .
Guo--Plant J. (2003) 34--383-392. cited by applicant .
Jermutus--J. of Biotechnology (2001) 85:15-24. cited by applicant
.
Ostanin--Journal of Biological Chemistry (1993)--268--20778-20784.
cited by applicant .
Pen--Biotechnology (1993) 11:811-814. cited by applicant .
Riley--Nucleic Acids Research (2006)--34--1-9. cited by applicant
.
Rodriguez--Archives of Biochemistry and Biophysics (2000)
382:105-112. cited by applicant .
SCORE Accession No. ADA 19445 Escherichia coli B. Short (2003).
cited by applicant .
Search Report--PCT/US2002/016482--ISR & WO--May 24, 2002. cited
by applicant .
Search Report--PCT/US2005/029621--ISR & WO--Feb. 28, 2008.
cited by applicant .
Arnold--Current Opinion in Chem. Biol. (1999)--3--54-59. cited by
applicant .
Berg--Biochemistry Fifth Ed., W.H. Freeman and Company, New
York--(2002) pp. 134-135. cited by applicant .
BPTO--Sep. 23, 2013--Office Action & Translation--PI0111124-8.
cited by applicant .
BPTO--Nov. 10, 2013--Office Action & Translation--No.
PI0010946-0. cited by applicant .
BPTO--Feb. 17, 2014--Rejection Decision--PI0010946-0. cited by
applicant .
BPTO--Apr. 21, 2014--Unfavorable Opinion--P10208851-7. cited by
applicant .
BPTO--Sep. 29, 2014--Unfavorable Opinion--P10208851-7. cited by
applicant .
BPTO--Jun. 7, 2015--Office Action--BR122012006762-8. cited by
applicant .
CIPO--Jan. 13, 2014--Office Action--CA 2663819. cited by applicant
.
EAPO--Oct. 9, 2013--Office Action & Translation--EA201171450.
cited by applicant .
EPO--Sep. 12, 2013--Extended EP Search Report--EP13163829.8. cited
by applicant .
EPO--Sep. 12, 2013--Extended EP Search Report--EP13164079.9. cited
by applicant .
EPO--Sep. 12, 2013--Extended EP Search Report--EP13164100.3. cited
by applicant .
EPO--Sep. 12, 2013--Extended EP Search Report--EP13164137.5. cited
by applicant .
EPO--Sep. 12, 2013--Extended EP Search Report--EP13164210.0. cited
by applicant .
EPO--Sep. 12, 2013--Extended EP Search Report--EP13164255.5. cited
by applicant .
EPO--Sep. 12, 2013--Extended EP Search Report--EP13164284.5. cited
by applicant .
EPO--Sep. 13, 2013--Extended EP Search Report--EP13164324.9. cited
by applicant .
EPO--Sep. 13, 2013--Extended EP Search Report--EP13164374.4. cited
by applicant .
EPO--Nov. 11, 2013--94(3) Communication EP05013009.5. cited by
applicant .
EPO--Jan. 16, 2014--Extended EP Search Report--EP13175992.0. cited
by applicant .
EPO--Nov. 26, 2014--94(3) Communication--EP13175992.0. cited by
applicant .
Iponz--Aug. 28, 2013--Second Examination Report--NZ 596459. cited
by applicant .
Kuchner--TIBTECH (1997)--15--523-530. cited by applicant .
Lei--Appl. Microbiol Biotechnol (2001) 57--474-481. cited by
applicant .
SIPO--Dec. 4, 2013--6th Office Action and
Translation--CN01812774.6. cited by applicant .
SIPO--Dec. 11, 2013--5th Office Action and
Translation--CN200780043087.9. cited by applicant .
SIPO--Jan. 27, 2014--First Office Action and
Translation--CN2010800331324. cited by applicant .
SIPO--Feb. 24, 2014--Fourth Office Action and
Translation--CN200810005794.5. cited by applicant .
SIPO--Dec. 16, 2014--Second Office Action--CN2010800331324. cited
by applicant .
USPTO--Nov. 13, 2013--Office Action, 892--U.S. Appl. No.
14/032,578. cited by applicant .
USPTO--Jan. 24, 2014--Office Action, 892, IDS Considered--U.S.
Appl. No. 12/442,207. cited by applicant .
JPO--Aug. 30, 2016--Office Action--JP2015-238207. cited by
applicant .
JPO--Aug. 30, 2016--Office Action--JP2015-238206. cited by
applicant .
KIPO--Sep. 2, 2016--Office Action--KR10-2011-7030622. cited by
applicant .
CIPO--Sep. 21, 2016--First Office Action--CN 2014106036789. cited
by applicant .
INPI--Oct. 21, 2016--First Examination Report--993/KOLNP/2009.
cited by applicant.
|
Primary Examiner: Monshipouri; Maryam
Attorney, Agent or Firm: Bruce; Karen Moon
Parent Case Text
RELATED APPLICATIONS
This application claims the benefit of priority under 35 U.S.C.
.sctn.119(e) to U.S. Provisional Application Ser. No. ("USSN")
61/180,283, filed May 21, 2009. The aforementioned application is
explicitly incorporated herein by reference in its entirety and for
all purposes.
Claims
What is claimed is:
1. An isolated, synthetic, or recombinant variant polypeptide of
the amino acid sequence of SEQ ID NO:2, wherein the variant
polypeptide is an amino acid sequence at least 95%, identical to
the amino acid sequence as set forth in SEQ ID NO:2, and at least
one amino acid mutation selected from the group consisting of:
T48F; T48H; T48I; T48K; T48L; T48M; T48V; T48W; T48Y; L50W; M51A;
M51G; M51L; G67A; Y79H; Y79N; Y79S; Y79W; Q86H; P100A; S102A;
S102Y; I107H; I107P; I108A; I108Q; I108R; I108S; I108Y; A109V;
E113P; L126R; Q137F; Q137L; Q137V; Q137Y; D139Y; P145L; L146R;
L146T; F147Y; N148K; N148M; N148R; P149L; P149N; L150T; L150Y;
K151H; K151P; C155Y; L157C; L157P; V162L; V162T; T163P; L167S;
G171M; G171S; S173G; S173H; S173V; I174F; I174P; V191A; L192F;
F194L; S197G; S211H; L216T; P217D; P217G; P217L; P217S; S218I;
S218Y; A232P; L235I; A236H; A236T; L244S; Q246W; Q247H; A248L;
A248T; P254S; G257A; G257R; H263P; W265L; N266P; L269I; L269T;
H272W; A274F; A274I; A274L; A274T; A274V; Q275H; T282H; T291V;
T291W; Q309P; P343E; P343I; P343L; P343N; P343R; P343V; N348K;
N348W; G353C; Q377R; L379S; L379V; Q381S; S389H; S389V; G395E;
G395I; G395L; G395Q; G395T; V422M; I427G; I427S; I427T; and A429P,
wherein the variant polypeptide has phytase activity and have
decreased gastric stability when compared to the parent polypeptide
of the amino acid sequence of SEQ ID NO:2.
2. A protein preparation comprising the polypeptide of claim 1,
wherein the protein preparation comprises a liquid, a slurry, or a
powder.
3. A method for hydrolyzing an inositol-hexaphosphate to inositol
and inorganic phosphate comprising: (a) providing the polypeptide
of claim 1; (b) providing a composition comprising an
inositol-hexaphosphate; and (c) contacting the polypeptide of (a)
with the composition of (b) under conditions wherein the
polypeptide hydrolyzes the inositol-hexaphosphate to produce to
inositol and inorganic phosphate.
4. A method for oil degumming comprising: (a) providing the
polypeptide of claim 1; (b) providing a composition comprising an
oil; and (c) contacting the polypeptide of (a) and the oil of (b)
under conditions wherein the polypeptide can cleave an
inositol-inorganic phosphate linkage, thereby degumming the
oil.
5. A food, a feed, a food supplement, or a feed supplement for an
animal comprising the polypeptide of claim 1.
6. A-pellet comprising the polypeptide of claim 1.
7. A soybean meal comprising the polypeptide of claim 1.
8. A method for processing of corn and sorghum kernels comprising
(a) providing the polypeptide of claim 1; (b) providing a
composition comprising a corn steep liquor or a sorghum steep
liquor; and (c) contacting the polypeptide of (a) and the
composition of (b) under conditions wherein the polypeptide can
cleave an inositol-inorganic phosphate linkage.
9. A composition comprising the polypeptide of claim 1, wherein the
composition comprises a second enzyme.
10. The composition of claim 9, wherein the second enzyme is
selected from a second phytase, a xylanase, a cellulase, a
glucanase, a pullanase, a mannanase, a protease, a lipase, a
beta-glucosidase, a celloiohydroase, an amylase, and any
combination thereof.
11. The food of claim 5, wherein the food is a bread dough.
12. The feed of claim 5, wherein the animal is livestock.
13. The feed of claim 12, wherein the livestock is selected from:
poultry, pigs, cattle, sheep, goats, and fish.
Description
REFERENCE TO SEQUENCE LISTING SUBMITTED VIA EFS-WEB
This application is being filed electronically via the USPTO
EFS-WEB server, as authorized and set forth in MPEP .sctn.1730
II.B.2(a)(A), and this electronic filing includes an electronically
submitted sequence (SEQ ID) listing. The entire content of this
sequence listing is herein incorporated by reference for all
purposes. The sequence listing is identified on the electronically
filed .txt file as follows:
TABLE-US-00001 File Name Date of Creation Size (bytes)
D1370_17WO_sequence_listing.txt May 20, 2010 58,575 bytes
FIELD OF THE INVENTION
This invention relates to phytases, polynucleotides encoding them,
uses of the polynucleotides and polypeptides of the invention, as
well as the production and isolation of such polynucleotides and
polypeptides. In particular, the invention provides polypeptides
having phytase activity under high temperature conditions, and
phytases that retain activity after exposure to high temperatures.
The invention further provides phytases which have increased
gastric lability. The phytases of the invention can be used in
foodstuffs to improve the feeding value of phytate rich
ingredients. The phytases of the invention can be formulated as
foods or feeds or supplements for either to, e.g., aid in the
digestion of phytate. The foods or feeds of the invention can be in
the form of pellets, liquids, powders and the like. In one aspect,
phytases of the invention are stabile against thermal denaturation
during pelleting; and this decreases the cost of the phytase
product while maintaining in vivo efficacy and detection of
activity in feed.
BACKGROUND
Minerals are essential elements for the growth of all organisms.
Dietary minerals can be derived from many source materials,
including plants. For example, plant seeds are a rich source of
minerals since they contain ions that are complexed with the
phosphate groups of phytic acid molecules. These phytate-associated
minerals may, in some cases, meet the dietary needs of some species
of farmed organisms, such as multi-stomached ruminants.
Accordingly, in some cases ruminants require less dietary
supplementation with inorganic phosphate and minerals because
microorganisms in the rumen produce enzymes that catalyze
conversion of phytate (myo-inositol-hexaphosphate) to inositol and
inorganic phosphate. In the process, minerals that have been
complexed with phytate are released. The majority of species of
farmed organisms, however, are unable to efficiently utilize
phytate-associated minerals. Thus, for example, in the livestock
production of monogastric animals (e.g., pigs, birds, and fish),
feed is commonly supplemented with minerals and/or with antibiotic
substances that alter the digestive flora environment of the
consuming organism to enhance growth rates.
As such, there are many problematic burdens--related to nutrition,
ex vivo processing steps, health and medicine, environmental
conservation, and resource management--that are associated with an
insufficient hydrolysis of phytate in many applications. The
following are non-limiting examples of these problems: 1) The
supplementation of diets with inorganic minerals is a costly
expense. 2) The presence of unhydrolyzed phytate is undesirable and
problematic in many ex vivo applications (e.g. by causing the
presence of unwanted sludge). 3) The supplementation of diets with
antibiotics poses a medical threat to humans and animals alike by
increasing the abundance of antibiotic-tolerant pathogens. 4) The
discharge of unabsorbed fecal minerals into the environment
disrupts and damages the ecosystems of surrounding soils, fish farm
waters, and surface waters at large. 5) The valuable nutritional
offerings of many potential foodstuffs remain significantly
untapped and squandered.
Consequently, phytate-containing foodstuffs require supplementation
with exogenous nutrients and/or with a source of phytase activity
in order to amend their deficient nutritional offerings upon
consumption by a very large number of species of organisms.
Consequently, there is a need for means to achieve efficient and
cost effective hydrolysis of phytate in various applications.
Particularly, there is a need for means to optimize the hydrolysis
of phytate in commercial applications. In a particular aspect,
there is a need to optimize commercial treatment methods that
improve the nutritional offerings of phytate-containing foodstuffs
for consumption by humans and farmed animals.
SUMMARY OF THE INVENTION
This invention provides polypeptides having phytase activity,
polynucleotides encoding them, uses of the polynucleotides and
polypeptides of the invention, and methods for the production and
isolation of such polynucleotides and polypeptides. In one aspect,
the invention provides polypeptides having phytase activity under
high temperature conditions, and phytases that retain activity
after exposure to high temperatures. The phytases of the invention
can be used in foodstuffs to improve the feeding value of phytate
rich ingredients. The phytases of the invention can be formulated
as foods or feeds or supplements for either to, e.g., aid in the
digestion of phytate. The foods or feeds of the invention can be in
the form of pellets, tablets, pills, liquids, powders, sprays and
the like. In one aspect, phytases of the invention are stabile
against thermal denaturation during pelleting; and this decreases
the cost of the phytase product while maintaining in vivo efficacy
and detection of activity in feed.
SUMMARY
The invention provides isolated, synthetic, or recombinant nucleic
acids comprising
(a) (i) a nucleic acid sequence encoding a polypeptide having a
phytase activity and having at least 95%, 96% 97%, 98% or 99% or
more sequence identity to SEQ ID NO:1, wherein the polypeptide
comprises at least one mutation listed in Table 4, 5, 6, 7, 9, or
any combination thereof;
(ii) a polynucleotide encoding a polypeptide having at least 95%,
96% 97%, 98% or 99% or more sequence identity to SEQ ID NO:2,
wherein the polypeptide comprises at least one mutation listed in
Table 4, 5, 6, 7, 9, or any combination thereof; or
(a) (i) a nucleic acid sequence encoding a polypeptide having a
phytase activity and having at least 95%, 96% 97%, 98% or 99% or
more sequence identity to SEQ ID NO:1, wherein the polypeptide
comprises at least one mutation listed in Table 4, 5, 6, 7, 9, or
any combination thereof;
(ii) a polynucleotide encoding a polypeptide having at least 95%,
96% 97%, 98% or 99% or more sequence identity to SEQ ID NO:2,
wherein the polypeptide comprises at least one mutation listed in
Table 4, 5, 6, 7, 9, or any combination thereof; or
(iii) the nucleic acid sequence of (i) or (ii), wherein the
sequence identities are determined by analysis with a sequence
comparison algorithm or by a visual inspection, and optionally the
sequence comparison algorithm is a BLAST version 2.2.2 algorithm
where a filtering setting is set to blastall -p blastp -d "nr
pataa" -F F, and all other options are set to default;
(b) the nucleic acid of (a), wherein the at least one mutation is:
A109V, A232P, A236H, A236T, A248L, A248T, A274F, A274I, A274L,
A274T, A274V, A429P, C155Y, D139Y, E113P, F147Y, F194L, G171M,
G171S, G257A, G257R, G353C, G395E, G395I, G395L, G395Q, G395T,
G67A, H263P, H272W, I107H, I107P, I108A, I108Q, I108R, I108S,
I108Y, I174F, I174P, I427G, I427S, I427T, K151H, K151P, L126R,
L146R, L146T, L150T, L150Y, L157C, L157P, L167S, L192F, L216T,
L235I, L244S, L269I, L269T, L296T, L379S, L379V, L50W, M51A, M51G,
M51L, N148K, N148M, N148R, N161K, N266P, N339E, N348K, N348W,
P100A, P145L, P149L, P149N, P217D, P217G, P217L, P217S, P254S,
P269L, P343E, P343I, P343L, P343N, P343R, P343V, Q137F, Q137L,
Q137V, Q137Y, Q246W, Q247H, Q275H, Q309P, Q377R, Q381S, Q86H,
S102A, S102Y, S173G, S173H, S173V, S197G, S208P, S211H, S218I,
S218Y, S389H, S389V, T163P, T282H, T291V, T291W, T341D, T48F, T48H,
T48I, T48K, T48L, T48M, T48V, T48W, T48Y, V162L, V162T, V191A,
V422M, W265L, Y79H, Y79N, Y79S, or Y79W;
(c) the nucleic acid of (b), wherein the polypeptide further
comprises at least one mutation of: C226D, D164R, G179R, N159V,
Q275V, T163R, or T349Y; or (d) sequences fully complementary
thereto. All of these nucleic acids are "nucleic acids of the
invention", encoding "polypeptides of the invention".
In one aspect, the sequence comparison algorithm is a BLAST version
2.2.2 algorithm where a filtering setting is set to blastall -p
blastp -d "nr pataa" -F F, and all other options are set to
default.
In one aspect, the nucleic acid sequences of the invention lack a
homologous nucleic acid sequence encoding a signal sequence,
proprotein sequence, or promoter sequence. In another aspect, the
nucleic acids of the invention further comprise of a heterologous
nucleic acid sequence, wherein optionally the heterologous nucleic
acid sequence comprises, or consists of a sequence encoding a
heterologous signal sequence, a tag, an epitope, or a promoter
sequence. In another aspect, the heterologous nucleic acid sequence
encodes a heterologous signal sequence comprising or consisting of
an N-terminal and/or C-terminal extension for targeting to an
endoplasmic reticulum (ER) or endomembrane, or to a plant
endoplasmic reticulum (ER) or endomembrane system, or the
heterologous sequence encodes a restriction site. In yet another
aspect, the heterologous promoter sequence comprises or consists of
a constitutive or inducible promoter, or a cell type specific
promoter, or a plant specific promoter, or a maize specific
promoter.
In one aspect, the phytase activity comprises catalysis of phytate
(myo-inositol-hexaphosphate) to inositol and inorganic phosphate;
or, the hydrolysis of phytate (myo-inositol-hexaphosphate). In
another aspect, the phytase activity comprises catalyzing
hydrolysis of a phytate in a feed, a food product or a beverage, or
a feed, food product or beverage comprising a cereal-based animal
feed, a wort or a beer, a dough, a fruit or a vegetable; or,
catalyzing hydrolysis of a phytate in a microbial cell, a fungal
cell, a mammalian cell or a plant cell.
In one aspect, the phytases of the invention are thermotolerant,
and optionally the polypeptide retains a phytase activity after
exposure to a temperature in the range from about -100.degree. C.
to about -80.degree. C., about -80.degree. C. to about -40.degree.
C., about -40.degree. C. to about -20.degree. C., about -20.degree.
C. to about 0.degree. C., about 0.degree. C. to about 37.degree.
C., about 0.degree. C. to about 5.degree. C., about 5.degree. C. to
about 15.degree. C., about 15.degree. C. to about 25.degree. C.,
about 25.degree. C. to about 37.degree. C., about 37.degree. C. to
about 45.degree. C., about 45.degree. C. to about 55.degree. C.,
about 55.degree. C. to about 70.degree. C., about 70.degree. C. to
about 75.degree. C., about 75.degree. C. to about 85.degree. C.,
about 85.degree. C. to about 90.degree. C., about 90.degree. C. to
about 95.degree. C., about 95.degree. C. to about 100.degree. C.,
about 100.degree. C. to about 105.degree. C., about 105.degree. C.
to about 110.degree. C., about 110.degree. C. to about 120.degree.
C., or 95.degree. C., 96.degree. C., 97.degree. C., 98.degree. C.,
99.degree. C., 100.degree. C., 101.degree. C., 102.degree. C.,
103.degree. C., 104.degree. C., 105.degree. C., 106.degree. C.,
107.degree. C., 108.degree. C., 109.degree. C., 110.degree. C.,
111.degree. C., 112.degree. C., 113.degree. C., 114.degree. C.,
115.degree. C. or more. In one aspect, the phytases of the
invention are thermostable, and optionally the phytase retains
activity at a temperature in the range from about -100.degree. C.
to about -80.degree. C., about -80.degree. C. to about -40.degree.
C., about -40.degree. C. to about -20.degree. C., about -20.degree.
C. to about 0.degree. C., about 0.degree. C. to about 37.degree.
C., about 0.degree. C. to about 5.degree. C., about 5.degree. C. to
about 15.degree. C., about 15.degree. C. to about 25.degree. C.,
about 25.degree. C. to about 37.degree. C., about 37.degree. C. to
about 45.degree. C., about 45.degree. C. to about 55.degree. C.,
about 55.degree. C. to about 70.degree. C., about 70.degree. C. to
about 75.degree. C., about 75.degree. C. to about 85.degree. C.,
about 85.degree. C. to about 90.degree. C., about 90.degree. C. to
about 95.degree. C., about 95.degree. C. to about 100.degree. C.,
about 100.degree. C. to about 105.degree. C., about 105.degree. C.
to about 110.degree. C., about 110.degree. C. to about 120.degree.
C., or 95.degree. C., 96.degree. C., 97.degree. C., 98.degree. C.,
99.degree. C., 100.degree. C., 101.degree. C., 102.degree. C.,
103.degree. C., 104.degree. C., 105.degree. C., 106.degree. C.,
107.degree. C., 108.degree. C., 109.degree. C., 110.degree. C.,
111.degree. C., 112.degree. C., 113.degree. C., 114.degree. C.,
115.degree. C. or more.
In another embodiment, the phytases of the inventions are
thermotolerant or thermoactive at an acidic pH of about pH 6.5, pH
6, pH 5.5, pH 5, pH 4.5, pH 4.0, pH 3.5, pH 3.0 or less, or the
phytase polypeptide is thermotolerant or thermoactive at about pH
7, pH 7.5, pH 8.0, pH 8.5, pH 9, pH 9.5, pH 10, pH 10.5, pH 11.0,
pH 11.5, pH 12.0, pH 12.5 or more.
The invention provides expression cassettes, vectors, cloning
vehicles, expression vectors, and cloning vectors comprising a
nucleic acid of the invention, or having contained therein a
nucleic acid of the invention (which include nucleic acids encoding
polypeptides of the invention), wherein optionally the expression
cassette, cloning vehicle or vector comprises or is a viral vector,
a plasmid, a phage, a phagemid, a cosmid, a fosmid, a bacteriophage
or an artificial chromosome, the viral vector comprises or is an
adenovirus vector, a retroviral vector or an adeno-associated viral
vector, or the expression cassette, cloning vehicle or vector
comprises or is a bacterial artificial chromosome (BAC), a
bacteriophage P1-derived vector (PAC), a yeast artificial
chromosome (YAC) or a mammalian artificial chromosome (MAC).
The invention provides transformed cells, transduced cells, host
cells and the like comprising a nucleic acid of the invention, or
having contained therein a nucleic acid of the invention (which
include nucleic acids encoding polypeptides of the invention), or
the expression cassette, vector, cloning vehicle, expression
vector, or cloning vector of the invention, wherein optionally the
cell is a bacterial cell, a mammalian cell, a fungal cell, a yeast
cell, an insect cell or a plant cell.
The invention provides transgenic non-human animals comprising a
nucleic acid of the invention, or having contained therein a
nucleic acid of the invention (which include nucleic acids encoding
polypeptides of the invention), or the expression cassette, vector,
cloning vehicle, expression vector, or cloning vector of the
invention, wherein optionally the animal is a mouse, a rat, a goat,
a rabbit, a sheep, a pig or a cow.
The invention provides transgenic plants (including plant parts,
e.g., processed, or harvested, e.g., leaves, stems, roots or
fruits) or seeds comprising a nucleic acid of the invention, or
having contained therein a nucleic acid of the invention (which
include nucleic acids encoding polypeptides of the invention), or
the expression cassette, vector, cloning vehicle, expression
vector, or cloning vector of the invention, wherein optionally the
plant is a corn plant, a potato plant, a tomato plant, a wheat
plant, an oilseed plant, a rapeseed plant, a soybean plant or a
tobacco plant, and optionally the seed is a corn seed, a wheat
kernel, an oilseed, a rapeseed, a soybean seed, a palm kernel, a
sunflower seed, a sesame seed, a peanut or a tobacco plant seed. In
alternative embodiments, the plant or a seed produced from a seed
or plant of the invention, or a plant or seed of the invention, can
include crop plants, for example, corn, alfalfa, sunflower,
Brassica, soybean, sugar cane, cotton, safflower, peanut, sorghum,
wheat, oat, rye, millet, barley, rice, conifers, legume crops,
e.g., pea, bean and soybean, starchy tuber/roots, e.g., potato,
sweet potato, cassava, taro, canna and sugar beet and the like, or
the plant can be a corn plant, a potato plant, a tomato plant, a
wheat plant, an oilseed plant, a rapeseed plant, a soybean plant or
a tobacco plant, or a forage and/or feed plant for an animal, or
for a ruminant animal, or the plant can be or comprises the forage
or feed plant is hay, corn, millet, soy, wheat, buckwheat, barley,
alfalfa, rye, an annual grass, sorghum, sudangrass, veldt grass or
buffet grass; or, the seed is a corn seed, a wheat kernel, an
oilseed, a rapeseed, a soybean seed, a palm kernel, a sunflower
seed, a sesame seed, a peanut or peanut seed, an alfalfa seed, a
cotton seed, a safflower seed, a sorghum seed, an oat kernel, a rye
seed, a millet seed, a barley seed, a rice kernel, a pea seed, or a
tobacco plant seed, or the plant is corn, alfalfa, sunflower,
Brassica, soybean, sugar cane, cotton, safflower, peanut, sorghum,
wheat, oat, rye, millet, barley, rice, conifers, pea, bean,
soybean, potato, sweet potato, cassava, taro, canna or sugar
beet.
The invention provides antisense oligonucleotides comprising a
nucleic acid which is antisense to a nucleic acid of the invention
and encoding at least one mutation listed in Table 4, 5, 6, 7, 9,
or any combination thereof, wherein optionally the antisense
oligonucleotide is between about 10 to 50, about 20 to 60, about 30
to 70, about 40 to 80, about 60 to 100 or about 50 to 150 bases in
length. The invention also provides ribozymes and/or iRNA (e.g.,
siRNA or miRNA) comprising antisense sequences of the
invention.
The invention provides methods of inhibiting the translation of a
phytase message in a cell comprising administering to the cell or
expressing in the cell an antisense oligonucleotide of the
invention.
The invention provides isolated, synthetic, or recombinant
polypeptides comprising
(a) (i) an amino acid sequence encoded by the nucleic acids of the
invention;
(ii) an amino acid sequence having at least 95%, 96% 97%, 98% or
99% sequence identity to SEQ ID NO:2, wherein the polypeptide
comprises at least one mutation listed in Table 4, 5, 6, 7, 9, or
any combination thereof; or
(iii) the polypeptide of (i) or (ii), wherein the sequence
identities are determined by analysis with a sequence comparison
algorithm or by a visual inspection;
(b) the polypeptide of (a), wherein the at least one mutation is:
A109V, A232P, A236H, A236T, A248L, A248T, A274F, A274I, A274L,
A274T, A274V, A429P, C155Y, D139Y, E113P, F147Y, F194L, G171M,
G171S, G257A, G257R, G353C, G395E, G395I, G395L, G395Q, G395T,
G67A, H263P, H272W, I107H, I107P, I108A, I108Q, I108R, I108S,
I108Y, I174F, I174P, I427G, I427S, I427T, K151H, K151P, L126R,
L146R, L146T, L150T, L150Y, L157C, L157P, L167S, L192F, L216T,
L235I, L244S, L269I, L269T, L296T, L379S, L379V, L50W, M51A, M51G,
M51L, N148K, N148M, N148R, N161K, N266P, N339E, N348K, N348W,
P100A, P145L, P149L, P149N, P217D, P217G, P217L, P217S, P254S,
P269L, P343E, P343I, P343L, P343N, P343R, P343V, Q137F, Q137L,
Q137V, Q137Y, Q246W, Q247H, Q275H, Q309P, Q377R, Q381S, Q86H,
S102A, S102Y, S173G, S173H, S173V, S197G, S208P, S211H, S218I,
S218Y, S389H, S389V, T163P, T282H, T291V, T291W, T341D, T48F, T48H,
T48I, T48K, T48L, T48M, T48V, T48W, T48Y, V162L, V162T, V191A,
V422M, W265L, Y79H, Y79N, Y79S, or Y79W; or
(c) the polypeptide of (b), wherein the polypeptide further
comprises at least one mutation of: C226D, D164R, G179R, N159V,
Q275V, T163R, or T349Y.
In one aspect, the phytase activity comprises catalysis of phytate
(myo-inositol-hexaphosphate) to inositol and inorganic phosphate;
or, the hydrolysis of phytate (myo-inositol-hexaphosphate). In
another aspect, the phytase activity comprises catalyzing
hydrolysis of a phytate in a feed, a food product or a beverage, or
a feed, food product or beverage comprising a cereal-based animal
feed, a wort or a beer, a dough, a fruit or a vegetable; or,
catalyzing hydrolysis of a phytate in a microbial cell, a fungal
cell, a mammalian cell or a plant cell.
The invention provides polypeptides of the invention that have
phytase activity whose activity is thermotolerant, and optionally
the polypeptide retains a phytase activity after exposure to a
temperature in the range of from about -100.degree. C. to about
-80.degree. C., about -80.degree. C. to about -40.degree. C., about
-40.degree. C. to about -20.degree. C., about -20.degree. C. to
about 0.degree. C., about 0.degree. C. to about 5.degree. C., about
5.degree. C. to about 15.degree. C., about 15.degree. C. to about
25.degree. C., about 25.degree. C. to about 37.degree. C., about
37.degree. C. to about 45.degree. C., about 45.degree. C. to about
55.degree. C., about 55.degree. C. to about 70.degree. C., about
70.degree. C. to about 75.degree. C., about 75.degree. C. to about
85.degree. C., about 85.degree. C. to about 90.degree. C., about
90.degree. C. to about 95.degree. C., about 95.degree. C. to about
100.degree. C., about 100.degree. C. to about 105.degree. C., about
105.degree. C. to about 110.degree. C., about 110.degree. C. to
about 120.degree. C., or 95.degree. C., 96.degree. C., 97.degree.
C., 98.degree. C., 99.degree. C., 100.degree. C., 101.degree. C.,
102.degree. C., 103.degree. C., 104.degree. C., 105.degree. C.,
106.degree. C., 107.degree. C., 108.degree. C., 109.degree. C.,
110.degree. C., 111.degree. C., 112.degree. C., 113.degree. C.,
114.degree. C., 115.degree. C. or more. The thermotolerant
polypeptides according to the invention can retain activity, e.g. a
phytase activity, after exposure to a temperature in the range from
about -100.degree. C. to about -80.degree. C., about -80.degree. C.
to about -40.degree. C., about -40.degree. C. to about -20.degree.
C., about -20.degree. C. to about 0.degree. C., about 0.degree. C.
to about 5.degree. C., about 5.degree. C. to about 15.degree. C.,
about 15.degree. C. to about 25.degree. C., about 25.degree. C. to
about 37.degree. C., about 37.degree. C. to about 45.degree. C.,
about 45.degree. C. to about 55.degree. C., about 55.degree. C. to
about 70.degree. C., about 70.degree. C. to about 75.degree. C.,
about 75.degree. C. to about 85.degree. C., about 85.degree. C. to
about 90.degree. C., about 90.degree. C. to about 95.degree. C.,
about 95.degree. C. to about 100.degree. C., about 100.degree. C.
to about 105.degree. C., about 105.degree. C. to about 110.degree.
C., about 110.degree. C. to about 120.degree. C., or 95.degree. C.,
96.degree. C., 97.degree. C., 98.degree. C., 99.degree. C.,
100.degree. C., 101.degree. C., 102.degree. C., 103.degree. C.,
104.degree. C., 105.degree. C., 106.degree. C., 107.degree. C.,
108.degree. C., 109.degree. C., 110.degree. C., 111.degree. C.,
112.degree. C., 113.degree. C., 114.degree. C., 115.degree. C. or
more. In some embodiments, the thermotolerant polypeptides
according to the invention retains activity, e.g. a phytase
activity, after exposure to a temperature in the ranges described
above, at about pH 3.0, about pH 3.5, about pH 4.0, about pH 4.5,
about pH 5.0, about pH 5.5, about pH 6.0, about pH 6.5, about pH
7.0, about pH 7.5, about pH 8.0, about pH 8.5, about pH 9.0, about
pH 9.5, about pH 10.0, about pH 10.5, about pH 11.0, about pH 11.5,
about pH 12.0 or more.
The invention provides polypeptides of the invention that have
phytase activity whose activity is thermostable. For example, a
polypeptide of the invention can be thermostable. The thermostable
polypeptide according to the invention can retain binding and/or
enzymatic activity, e.g., a phytase activity, under conditions
comprising a temperature range from about -100.degree. C. to about
-80.degree. C., about -80.degree. C. to about -40.degree. C., about
-40.degree. C. to about -20.degree. C., about -20.degree. C. to
about 0.degree. C., about 0.degree. C. to about 37.degree. C.,
about 0.degree. C. to about 5.degree. C., about 5.degree. C. to
about 15.degree. C., about 15.degree. C. to about 25.degree. C.,
about 25.degree. C. to about 37.degree. C., about 37.degree. C. to
about 45.degree. C., about 45.degree. C. to about 55.degree. C.,
about 55.degree. C. to about 70.degree. C., about 70.degree. C. to
about 75.degree. C., about 75.degree. C. to about 85.degree. C.,
about 85.degree. C. to about 90.degree. C., about 90.degree. C. to
about 95.degree. C., about 95.degree. C. to about 100.degree. C.,
about 100.degree. C. to about 105.degree. C., about 105.degree. C.
to about 110.degree. C., about 110.degree. C. to about 120.degree.
C., or 95.degree. C., 96.degree. C., 97.degree. C., 98.degree. C.,
99.degree. C., 100.degree. C., 101.degree. C., 102.degree. C.,
103.degree. C., 104.degree. C., 105.degree. C., 106.degree. C.,
107.degree. C., 108.degree. C., 109.degree. C., 110.degree. C.,
111.degree. C., 112.degree. C., 113.degree. C., 114.degree. C.,
115.degree. C. or more. The thermostable polypeptides according to
the invention can retain activity, e.g. a phytase activity, in
temperatures in the range from about -100.degree. C. to about
-80.degree. C., about -80.degree. C. to about -40.degree. C., about
-40.degree. C. to about -20.degree. C., about -20.degree. C. to
about 0.degree. C., about 0.degree. C. to about 5.degree. C., about
5.degree. C. to about 15.degree. C., about 15.degree. C. to about
25.degree. C., about 25.degree. C. to about 37.degree. C., about
37.degree. C. to about 45.degree. C., about 45.degree. C. to about
55.degree. C., about 55.degree. C. to about 70.degree. C., about
70.degree. C. to about 75.degree. C., about 75.degree. C. to about
85.degree. C., about 85.degree. C. to about 90.degree. C., about
90.degree. C. to about 95.degree. C., about 95.degree. C. to about
100.degree. C., about 100.degree. C. to about 105.degree. C., about
105.degree. C. to about 110.degree. C., about 110.degree. C. to
about 120.degree. C., or 95.degree. C., 96.degree. C., 97.degree.
C., 98.degree. C., 99.degree. C., 100.degree. C., 101.degree. C.,
102.degree. C., 103.degree. C., 104.degree. C., 105.degree. C.,
106.degree. C., 107.degree. C., 108.degree. C., 109.degree. C.,
110.degree. C., 111.degree. C., 112.degree. C., 113.degree. C.,
114.degree. C., 115.degree. C. or more. In some embodiments, the
thermostable polypeptides according to the invention retains
activity, e.g., a phytase activity, at a temperature in the ranges
described above, at about pH 3.0, about pH 3.5, about pH 4.0, about
pH 4.5, about pH 5.0, about pH 5.5, about pH 6.0, about pH 6.5,
about pH 7.0, about pH 7.5, about pH 8.0, about pH 8.5, about pH
9.0, about pH 9.5, about pH 10.0, about pH 10.5, about pH 11.0,
about pH 11.5, about pH 12.0 or more.
The invention provides isolated, synthetic or recombinant
polypeptides comprising an amino acid sequence of the invention and
(a) lacking a homologous signal sequence (leader peptide) or
proprotein sequence; (b) lacking a signal sequence (leader peptide)
and further comprising a heterologous signal sequence (leader
peptide); (c) the amino acid sequence of (a) or (b) and further
comprising a heterologous sequence, wherein optionally the
heterologous sequence comprises, or consists of a heterologous
signal sequence, or a tag or an epitope, or the heterologous
sequence comprises an identification peptide. In one aspect, the
heterologous signal sequence comprises or consists of an N-terminal
and/or C-terminal extension for targeting to an endoplasmic
reticulum (ER) or endomembrane, or to a plant endoplasmic reticulum
(ER) or endomembrane system, or the heterologous amino acid
sequence comprises, or consists of an enzyme target site. In
another aspect, the polypeptide of the invention further comprises
additional amino acid residues between a signal sequence (leader
sequence or leader peptide) and the enzyme.
In one aspect, the phytase activity of any polypeptide of the
invention comprises (has) a specific activity: at about 37.degree.
C. in the range from about 100 to about 1000 units per milligram of
protein; or, from about 500 to about 750 units per milligram of
protein; or, at 37.degree. C. in the range from about 500 to about
1200 units per milligram of protein; or, at 37.degree. C. in the
range from about 750 to about 1000 units per milligram of protein.
In one aspect, the thermotolerant phytase activity comprises a
specific activity after exposure to a temperature at about
37.degree. C. in the range from about 100 to about 1000 units per
milligram of protein; or, the thermostable phytase activity
comprises a specific activity from about 500 to about 750 units per
milligram of protein; or, the thermostable phytase activity
comprises a specific activity at 37.degree. C. in the range from
about 500 to about 1200 units per milligram of protein; or, the
thermostable phytase activity comprises a specific activity at
37.degree. C. in the range from about 750 to about 1000 units per
milligram of protein. In one aspect, the thermostable phytase
activity comprises a specific activity under conditions comprising
a temperature of about 37.degree. C. in the range from about 100 to
about 1000 units per milligram of protein; or, the thermostable
phytase activity comprises a specific activity from about 500 to
about 750 units per milligram of protein; or, the thermostable
phytase activity comprises a specific activity at 37.degree. C. in
the range from about 500 to about 1200 units per milligram of
protein; or, the thermostable phytase activity comprises a specific
activity at 37.degree. C. in the range from about 750 to about 1000
units per milligram of protein.
In one aspect, a polypeptide of the invention is glycosylated or
comprises at least one glycosylation site, wherein optionally the
glycosylation is an N-linked glycosylation, or an O-linked
glycosylation, and optionally the polypeptide is glycosylated after
being expressed in a yeast, which optionally is a P. pastoris or a
S. pombe.
In one aspect, the polypeptide retains a phytase activity under
conditions comprising about pH 6.5, pH 6, pH 5.5, pH 5, pH 4.5, pH
4.0, pH 3.5, pH 3.0 or less (more acidic) pH. Alternatively, a
polypeptide of the invention can retain a phytase activity under
conditions comprising about pH 7.5, pH 8, pH 8.5, pH 9, pH 9.5, pH
10.0, pH 10.5, pH 11.0, pH 11.5, pH 12, pH 12.5 or more (more
basic) pH.
The invention provides protein preparations comprising a
polypeptide of the invention, wherein the protein preparation
comprises a liquid, a slurry, a powder, a spray, a suspension, a
lyophilized composition/formulation, a solid, geltab, pill,
implant, a gel; or a pharmaceutical formulation, a food, a feed, a
food supplement, a feed supplement, a food additive, a feed
additive, a nutritional supplement or a dietary supplement
thereof.
The invention provides heterodimers comprising a polypeptide of the
invention, and in one aspect the heterodimer comprises a second
domain, wherein optionally the second domain is a polypeptide and
the heterodimer is a fusion protein, and optionally the second
domain is an epitope or a tag.
The invention provides immobilized polypeptides comprising a
polypeptide of the invention, wherein the immobilized polypeptide
can comprises a homodimer or a heterodimer of the invention,
wherein optionally the polypeptide is immobilized on or inside a
cell, a vesicle, a liposome, a film, a membrane, a metal, a resin,
a polymer, a ceramic, a glass, a microelectrode, a graphitic
particle, a bead, a gel, a plate, an array, a capillary tube, a
crystal, a tablet, a pill, a capsule, a powder, an agglomerate, a
surface, or a porous structure. In one aspect, the invention
provides arrays (e.g., microarrays) comprising an immobilized
polypeptide, wherein the polypeptide comprises the polypeptide of
the invention, or the heterodimer of the invention, or the nucleic
acid of the invention, or a combination thereof.
The invention provides isolated, synthetic or recombinant
antibodies that specifically bind to a polypeptide of the invention
or to a polypeptide encoded by the nucleic acid of the invention,
wherein optionally the antibody is a monoclonal or a polyclonal
antibody. The invention provides hybridomas comprising the antibody
of the invention.
The invention provides methods of producing a recombinant
polypeptide comprising: (a) providing a nucleic acid, wherein the
nucleic acid comprises a sequence of the invention; and (b)
expressing the nucleic acid of (a) under conditions that allow
expression of the polypeptide, thereby producing a recombinant
polypeptide, and optionally the method further comprises
transforming a host cell with the nucleic acid of (a) followed by
expressing the nucleic acid of (a), thereby producing the
recombinant polypeptide in a transformed host cell. In an
alternative embodiment, the nucleic acid is operably linked to a
promoter before being transformed into a host cell.
The invention provides methods for identifying a polypeptide having
a phytase activity comprising: (a) providing the polypeptide of the
invention; (b) providing a phytase substrate; and (c) contacting
the polypeptide or a fragment or variant thereof of (a) with the
substrate of (b) and detecting an increase in the amount of
substrate or a decrease in the amount of reaction product, wherein
a decrease in the amount of the substrate or an increase in the
amount of the reaction product detects a polypeptide having a
phytase activity.
The invention provides methods for identifying a phytase substrate
comprising: (a) providing the polypeptide of the invention; (b)
providing a test substrate; and (c) contacting the polypeptide of
(a) with the test substrate of (b) and detecting an increase in the
amount of substrate or a decrease in the amount of reaction
product, wherein a decrease in the amount of the substrate or an
increase in the amount of the reaction product identifies the test
substrate as a phytase substrate.
The invention provides methods of determining whether a compound
specifically binds to a polypeptide comprising: (a) expressing a
nucleic acid or a vector comprising the nucleic acid under
conditions permissive for translation of the nucleic acid to a
polypeptide, wherein the nucleic acid comprises a sequence of the
invention; (b) contacting the polypeptide with the test compound;
and (c) determining whether the test compound specifically binds to
the polypeptide, thereby determining that the compound specifically
binds to the polypeptide.
The invention provides methods for identifying a modulator of a
phytase activity comprising: (a) providing the phytase polypeptide
of the invention; (b) providing a test compound; (c) contacting the
polypeptide of (a) with the test compound of (b) and measuring an
activity of the phytase, wherein a change in the phytase activity
measured in the presence of the test compound compared to the
activity in the absence of the test compound provides a
determination that the test compound modulates the phytase
activity, wherein optionally the phytase activity is measured by
providing a phytase substrate and detecting an increase in the
amount of the substrate or a decrease in the amount of a reaction
product, and optionally a decrease in the amount of the substrate
or an increase in the amount of the reaction product with the test
compound as compared to the amount of substrate or reaction product
without the test compound identifies the test compound as an
activator of phytase activity, and optionally an increase in the
amount of the substrate or a decrease in the amount of the reaction
product with the test compound as compared to the amount of
substrate or reaction product without the test compound identifies
the test compound as an inhibitor of phytase activity.
The invention provides methods for hydrolyzing an
inositol-hexaphosphate to inositol and inorganic phosphate
comprising: (a) providing a polypeptide having a phytase activity,
wherein the polypeptide comprises the amino acid sequence of the
invention, or, a polypeptide encoded by the nucleic acid of the
invention; (b) providing a composition comprising an
inositol-hexaphosphate; and (c) contacting the polypeptide of (a)
with the composition of (b) under conditions wherein the
polypeptide hydrolyzes the inositol-hexaphosphate to produce to
inositol and inorganic phosphate, wherein optionally the conditions
comprise a temperature of between about 37.degree. C. and about
70.degree. C., between about 50.degree. C. and about 80.degree. C.,
or between about 60.degree. C. and about 90.degree. C., and
optionally the composition comprises a phytic acid.
The invention provides methods for oil degumming comprising: (a)
providing a polypeptide having a phytase activity, wherein the
polypeptide comprises the amino acid sequence of the invention, or,
a polypeptide encoded by the nucleic acid of the invention; (b)
providing a composition comprising a vegetable oil; and (c)
contacting the polypeptide of (a) and the vegetable oil of (b)
under conditions wherein the polypeptide can cleave an
inositol-inorganic phosphate linkage, thereby degumming the
vegetable oil.
The invention provides methods for producing a feed or a food, or a
feed or food supplement, or a food or feed additive, or a
nutritional supplement, or a dietary supplement, comprising: (a)
transforming a plant, plant part or plant cell with a
polynucleotide encoding a phytase enzyme polypeptide, wherein the
phytase comprises a polypeptide comprising the amino acid sequence
of the invention, or, a polypeptide encoded by the nucleic acid of
the invention; (b) culturing the plant, plant part or plant cell
under conditions in which the phytase enzyme is expressed; and, (c)
converting the plant, plant parts or plant cell into a composition
suitable for a food, a feed, a food supplement, a feed supplement,
a food additive, a feed additive, a nutritional supplement or a
dietary supplement, or adding the cultured plant, plant part or
plant cell to a food, a feed, a food supplement, a feed supplement,
a food additive, a feed additive, a nutritional supplement or a
dietary supplement, thereby producing a food, a feed, a food
supplement, a feed supplement, a food additive, a feed additive, a
nutritional supplement or a dietary supplement, wherein optionally
the polynucleotide is contained in an expression vector, and
optionally the vector comprises an expression control sequence
capable of expressing the nucleic acid in a plant cell, and
optionally the food, feed, food supplement, feed supplement, food
additive, feed additive, nutritional supplement or dietary
supplement is for an animal, and optionally wherein the animal is a
monogastric animal, and optionally the animal is a ruminant, and
optionally the food, feed, food supplement, feed supplement, food
additive, feed additive, nutritional supplement or dietary
supplement, is in the form of a delivery matrix, a pellet, a
tablet, a gel, a liquids, a spray, ground grain or a powder. In one
aspect, the phytase enzyme is glycosylated to provide
thermotolerance or thermostability at pelletizing conditions, and
optionally delivery matrix is formed by pelletizing a mixture
comprising a grain germ and the phytase enzyme to yield a particle,
and optionally the pellets are made under conditions comprising
application of steam, optionally the pellets are made under
conditions comprising application of a temperature in excess of
80.degree. C. for about 5 minutes, and optionally the pellet
comprises a phytase enzyme that comprises a specific activity of at
least 350 to about 900 units per milligram of enzyme.
The invention provides methods for delivering a phytase enzyme
supplement to an animal or a human, said method comprising: (a)
preparing an edible delivery matrix comprising an edible carrier
and a phytase enzyme comprising a polypeptide comprising the amino
acid sequence of the invention, wherein the matrix readily
disperses and releases the phytase enzyme when placed into aqueous
media, and, (b) administering the edible enzyme delivery matrix to
the animal or human, wherein optionally in the edible delivery
matrix comprises a granulate edible carrier, and optionally the
edible delivery matrix is in the form of pellets, tablets, gels,
liquids, sprays or powders, and optionally the edible carrier
comprises a carrier selected from the group consisting of grain
germ, hay, alfalfa, timothy, soy hull, sunflower seed meal, corn
meal, soy meal and wheat meal, and optionally the edible carrier
comprises grain germ that is spent of oil.
The invention provides a food, feed, food supplement, feed
supplement, food additive, feed additive, nutritional supplement or
dietary supplement, for an animal or a human, comprising the
polypeptide of the invention, or a homodimer or heterodimer of the
invention; wherein optionally the polypeptide is glycosylated, and
optionally the phytase activity is thermotolerant or thermostable.
In one aspect, the food, feed, food supplement, feed supplement,
food additive, feed additive, nutritional supplement or dietary
supplement is manufactured in pellet, pill, tablet, capsule, gel,
geltab, spray, powder, lyophilized formulation, pharmaceutical
formulation, liquid form, as a suspension or slurry, or produced
using polymer-coated additives, or manufactured in granulate form,
or produced by spray drying.
The invention provides edible or absorbable enzyme delivery matrix
(matrices) comprising the polypeptide of the invention, or a
homodimer or heterodimer of the invention; wherein optionally the
polypeptide is glycosylated, and optionally the phytase activity is
thermotolerant or thermostable. In one aspect, the edible delivery
matrix comprises a pellet, or the edible or absorbable enzyme
delivery matrix is manufactured in pellet, pill, tablet, capsule,
gel, geltab, spray, powder, lyophilized formulation, pharmaceutical
formulation, liquid form, as a suspension or slurry, or produced
using polymer-coated additives, or manufactured in granulate form,
or produced by spray drying.
The invention provides edible or absorbable pellets comprising a
granulate edible or absorbable carrier and the polypeptide of the
invention, or a homodimer or heterodimer of the invention; wherein
optionally the polypeptide is glycosylated, and optionally the
phytase activity is thermotolerant or thermostable, and optionally
the pellet is manufactured in pellet form, or as a pill, tablet,
capsule, gel, geltab, spray, powder, lyophilized formulation,
pharmaceutical formulation, liquid form, as a suspension or slurry,
or produced using polymer-coated additives, or manufactured in
granulate form, or produced by spray drying.
The invention provides meals, e.g., a soybean meal, comprising a
polypeptide of the invention, or a homodimer or heterodimer of the
invention, and optionally the meal, e.g., soybean meal, is
manufactured as a pellet, pill, tablet, capsule, gel, geltab,
spray, powder, lyophilized formulation, or liquid form.
The invention provides methods of increasing the resistance of a
phytase polypeptide to enzymatic inactivation in a digestive system
of an animal, the method comprising glycosylating a phytase
polypeptide comprising the polypeptide of the invention, thereby
increasing resistance of the phytase polypeptide to enzymatic
inactivation in a digestive system of an animal, and optionally the
glycosylation is N-linked glycosylation, and, and optionally the
phytase polypeptide is glycosylated as a result of in vivo
expression of a polynucleotide encoding the phytase in a cell, and
optionally the cell is a eukaryotic cell, and optionally the
eukaryotic cell is a fungal cell, a plant cell, or a mammalian
cell.
The invention provides methods for processing of corn and sorghum
kernels comprising: (a) providing a polypeptide having a phytase
activity, wherein the polypeptide comprises the polypeptide of the
invention; (b) providing a composition comprising a corn steep
liquor or a sorghum steep liquor; and (c) contacting the
polypeptide of (a) and the composition of (b) under conditions
wherein the polypeptide can cleave an inositol-inorganic phosphate
linkage.
The invention provides pharmaceuticals or a dietary formulations
comprising a polypeptide or heterodimer of the invention; wherein
optionally the polypeptide is glycosylated, and optionally the
phytase activity is thermotolerant or thermostable; and optionally
the pharmaceutical or a dietary formulation is formulated as in
pellet, pill, tablet, capsule, geltab, spray, powder, lotion or
liquid form, or produced using polymer-coated additives, or as an
implant, or manufactured in granulate form, or produced by spray
drying.
The invention provides compositions comprising a polypeptide or
heterodimer of the invention; and, (b) any product as set forth in
Table 2, or any of the compositions listed in Table 1; wherein
optionally the polypeptide is glycosylated, and optionally the
phytase activity is thermotolerant or thermostable.
The invention provides a self-contained meal Ready-to-Eat unit
(MRE), a drink or a hydrating agent comprising a polypeptide or
heterodimer of the invention; wherein optionally the polypeptide is
glycosylated, and optionally the phytase activity is thermotolerant
or thermostable.
The invention provides methods for ameliorating (slowing the
progress of, treating or preventing) osteoporosis comprising
administering to an individual in need thereof an effective amount
(dosage) of a composition comprising a polypeptide or heterodimer
of the invention; wherein optionally the polypeptide is
glycosylated, and optionally the phytase activity is thermotolerant
or thermostable.
The invention provides methods for increasing gastric lability of a
phytase comprising providing a polypeptide having a phytase
activity, and replacing one or more amino acids in the sequence
encoding the polypeptide with arginine, histidine, proline,
leucine, serine, threonine, or tyrosine. The invention further
provides exemplary phytases for use in the method, e.g. SEQ ID NO:2
or other phytases of the invention, as described in detail in
Example 2, below.
The invention provides methods for altering at least two different
properties of an enzyme, as described in detail in Example 2,
below, comprising (a) providing a polypeptide having an enzymatic
activity; (b) creating variants from the polypeptide of (a),
wherein each variant has a single amino acid change from the
polypeptide of (a); (c) screening the variants of (b) for the two
different properties; (d) selecting desired variants of (c), and
identifying the single amino acid change in each selected variant;
(e) creating new variants comprising different combinations of the
selected single amino acid changes of (d); (f) screening the
variants of (e) for the two altered properties; and (g) selecting
desired variants of (f) with the two altered properties. The
invention provides alternative methods for altering at least two
different properties of an enzyme comprising (a) providing a
polypeptide having an enzymatic activity; (b) creating variants
from the polypeptide of (a), wherein each variant has a single
amino acid change from the polypeptide of (a); (c) screening the
variants of (b) for one altered property; (d) screening the
variants (b) for another altered property; (e) selecting desired
variants of (c) and (d), and identifying the single amino acid
change in each selected variant; (f) creating new variants
comprising different combinations of the selected single amino acid
changes of (c) and (d); (g) screening the variants of (f) for the
two altered properties; and (h) selecting desired variants of (g)
with the two altered properties. The invention further provides
exemplary methods for creating the variants, e.g. by GSSM
evolution, GeneReassembly evolution, and/or TMCA evolution.
The invention provides methods for decoupling gastric stability
from thermotolerance of a phytase, as described in detail in
Example 2, below, comprising (a) providing a polypeptide having a
phytase activity; (b) creating variant phytases from the
polypeptide of (a), wherein each variant has a single amino acid
change from the polypeptide of (a); (c) screening the variant
phytases of (b) for altered gastric stability and altered
thermotolerance; (d) selecting the variants of (c) with desired
gastric stability and thermotolerance, and identifying the single
amino acid change in each selected variant; (e) creating new
variant phytases comprising different combinations of the selected
single amino acid changes of (d); (f) screening the variants of (e)
for altered gastric stability and altered thermotolerance; and (g)
selecting the variants of (f) with desired gastric stability and
thermotolerance. The invention provides alternative methods for
decoupling gastric stability from thermotolerance of a phytase
comprising (a) providing a polypeptide having a phytase activity;
(b) creating variant phytases from the polypeptide of (a), wherein
each variant has a single amino acid change from the polypeptide of
(a); (c) screening the variant phytases of (b) for altered gastric
stability; (d) screening the variant phytases (b) for altered
thermotolerance; (e) selecting the variants of (c) and (d) with
desired gastric stability or thermotolerance, and identifying the
single amino acid change in each selected variant; (f) creating new
variant phytases comprising different combinations of the selected
single amino acid changes of (c) and (d); (g) screening the
variants of (f) for altered gastric stability and altered
thermotolerance; and (h) selecting the variants of (g) with desired
gastric stability and thermotolerance. The invention further
provides exemplary methods for creating the variants, e.g. by GSSM
evolution, GeneReassembly evolution, and/or TMCA evolution. The
invention provides exemplary phytases for use in the methods, e.g.
SEQ ID NO:2 and other phytases of the invention. The invention
provides exemplary mutations which decouple gastric stability from
thermotolerance, for example, the mutations listed in Table 4, 5,
6, 7, 9, or any combination thereof.
The invention provides phytases which are gastric labile and
thermotolerant, described in detail in Example 2, below, wherein
the phytase completely degrades in stimulated gastric fluid (SGF)
in less than 10 minutes, less than 8 minutes, less than 6 minutes,
less than 4 minutes, or less than 2 minutes, and the phytase
retains activity after exposure to a temperature in the range from
about 75.degree. C. to about 85.degree. C., about 85.degree. C. to
about 90.degree. C., about 90.degree. C. to about 95.degree. C., or
about 80.degree. C. to about 86.degree. C., for example, the
phytases of the invention as described in detail in Example 2,
below. In one aspect, the gastric labile and thermotolerant
phytases of the invention completely degrade in stimulated gastric
fluid (SGF) in less than 4 minutes, and the phytase retains
activity after exposure to a temperature in the range from about
80.degree. C. to about 86.degree. C.
The details of one or more aspects of the invention are set forth
in the accompanying drawings and the description below. Other
features, objects, and advantages of the invention will be apparent
from the description and drawings, and from the claims.
All publications, patents, patent applications, GenBank sequences
and ATCC deposits, cited herein are hereby expressly incorporated
by reference for all purposes.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings are illustrative of aspects of the invention
and are not meant to limit the scope of the invention as
encompassed by the claims.
FIG. 1 illustrates a summary of residue activity of purified
polypeptides of the invention, single mutation exemplary sequences
of the invention, after heat treatment at various temperatures for
30 minutes; where the phytase activity is assayed with a
fluorescence substrate, and the rates were compared to the rates of
each corresponding non-treated sample; as described in detail in
Example 1, below.
FIG. 2 illustrates a summary of residue activity of purified
polypeptides of the invention comprising "blended" single residue
mutations (phytases containing multiple mutations), after heat
treatment on a thermocycler; where the phytase activity is assayed
with a fluorescence substrate, and the rates were compared to the
rates of each corresponding non-treated sample; as summarized in
FIG. 1; as described in detail in Example 1, below.
FIG. 3 graphically summarizes the data used to generate the graph
of FIG. 1; as described in detail in Example 1, below.
FIG. 4 illustrates the sequence of the parental phytase SEQ ID NO:2
and the gene site saturation mutagenesis (GSSM)-generated sequence
modifications selected for GeneReassembly.TM. library construction;
as described in detail, below.
FIG. 5 illustrates exemplary phytases having multiple residue
modifications to the parental SEQ ID NO:2; as described in detail
herein.
FIG. 6 illustrates exemplary phytases having single residue
modifications to the parental SEQ ID NO:2; as described in detail
herein.
FIG. 7 schematically illustrates an exemplary phytase assay of the
invention using the fluorescence substrate 4-methylumbelliferyl
phosphate (MeUMB-phosphate); as described in detail in Example 1,
below.
FIG. 8 schematically illustrates an exemplary phytase assay of the
invention that uses the fluorescence substrate MeUMB-phosphate; as
described in detail in Example 1, below.
FIG. 9 schematically illustrates the protocol for an exemplary
library screen, as described in FIG. 8, as described in detail in
Example 1, below.
FIG. 10 illustrates an exemplary alcohol process that can
incorporate use of phytases of this invention.
FIGS. 11A and 11B illustrate summaries of thermostability and SGF
lability of appA phytase (GenBank accession no. M58708), appA-SEQ
ID NO:2 intermediates, and SEQ ID NO:2, as described in detail in
Example 2, below.
FIG. 12 illustrates the effect of a his-tag on SGF stability, as
determined by SGF assays of purified his-tag and non his-tag
versions of the parental phytase (SEQ ID NO:2), as described in
detail in Example 2, below.
FIG. 13 illustrates the thermotolerance of glycosylation-minus SEQ
ID NO:2 variants (Variants GLY1-GLY4) and two SEQ ID NO:2 controls,
as described in detail in Example 2, below.
FIG. 14 illustrates the SGF stability of SEQ ID NO:2-HIS and the
SEQ ID NO:2-6X variant, as described in detail in Example 2,
below.
FIG. 15 illustrates the SGF activity loss of select mutants from
GSSM evolution of SEQ ID NO:2, as described in detail in Example 2,
below.
FIG. 16 illustrates the effect of different amino acids on SGF
lability, as described in detail in Example 2, below.
FIG. 17 illustrates SGF mutation hot spots, as described in detail
in Example 2, below.
FIG. 18 illustrates SGF lability of SEQ ID NO:2-HIS and Variant O
at different pepsin dosages, as described in detail in Example 2,
below.
FIG. 19 illustrates the 1/2 life of SEQ ID NO:2-HIS and Variant O,
as described in detail in Example 2, below.
FIG. 20 illustrates the residual activity of SGF labile phytase
variants, as described in detail in Example 2, below.
FIG. 21 illustrates the specific activity of SGF label variant
phytases as compared to SEQ ID NO:2, as described in detail in
Example 2, below.
Like reference symbols in the various drawings indicate like
elements.
DETAILED DESCRIPTION OF THE INVENTION
The invention relates to phytase polypeptides having comprising the
specific residue modifications to SEQ ID NO:2, as described above,
and polynucleotides encoding them, (e.g., comprising the specific
base pair modifications to SEQ ID NO:1, as described above), as
well as methods of use of the polynucleotides and polypeptides.
FIG. 6 illustrates exemplary phytases having single residue
modifications to the parental SEQ ID NO:2, and FIG. 5 illustrates
exemplary phytases having multiple residue modifications to the
parental SEQ ID NO:2.
The phytase activity of polypeptides of the invention can encompass
enzymes having any phytase activity, for example, enzymes capable
of catalyzing the degradation of phytate, e.g., the catalysis of
phytate (myo-inositol-hexaphosphate) to inositol and inorganic
phosphate. The phytases of the invention include thermotolerant and
thermoresistant enzymes.
The phytases and polynucleotides encoding the phytases of the
invention are useful in a number of processes, methods, and
compositions. For example, as discussed above, a phytase can be
used in animal feed, and feed supplements as well as in treatments
to degrade or remove excess phytate from the environment or a
sample. Other uses will be apparent to those of skill in the art
based upon the teachings provided herein, including those discussed
above.
In one aspect, phytase molecules of the invention--either alone or
in combination with other reagents (including but not limited to
enzymes, such as proteases, amylases and the like)--are used in the
processing of foodstuffs, e.g., for prevention of the unwanted corn
sludge, and in other applications where phytate hydrolysis is
desirable.
In one aspect, phytase molecules of the invention are used to
eliminate or decrease the presence of unhydrolyzed phytate,
especially where unhydrolyzed phytate leads to problematic
consequences in ex vivo processes including--but not limited
to--the processing of foodstuffs. In one aspect, phytase molecules
of the invention are used in procedures as described in
EP0321004-B1 (Vaara et al.), including steps in the processing of
corn and sorghum kernels whereby the hard kernels are steeped in
water to soften them. Water-soluble substances that leach out
during this process become part of a corn steep liquor, which is
concentrated by evaporation. Unhydrolyzed phytic acid in the corn
steep liquor, largely in the form of calcium and magnesium salts,
is associated with phosphorus and deposits an undesirable sludge
with proteins and metal ions. This sludge is problematic in the
evaporation, transportation and storage of the corn steep liquor.
Phytase molecules of the invention are used to hydrolyze this
sludge.
In one aspect, the phytases of the invention can provide
substantially superior commercial performance than previously
identified phytase molecules, e.g. phytase molecules of fungal
origin. In one aspect, the enzymes of the invention can be
approximately 4400 U/mg, or greater than approximately between 50
to 100, or 50 to 1000, or 100 to 4000 U/mg protein.
The invention also provides methods for changing the
characteristics of a phytase of the invention by mutagenesis and
other method, as discussed in detail, below.
Generating and Manipulating Nucleic Acids
The invention provides nucleic acids encoding the polypeptides and
phytases of the invention. The invention also provides expression
cassettes, vectors such as expression or cloning vectors, cloning
vehicles such as a viral vector, a plasmid, a phage, a phagemid, a
cosmid, a fosmid, a bacteriophage or an artificial chromosome,
which can comprise, or have contained therein, a nucleic acid of
the invention.
The invention also includes methods for discovering new phytase
sequences using the nucleic acids of the invention. Also provided
are methods for modifying the nucleic acids of the invention by,
e.g., synthetic ligation reassembly, optimized directed evolution
system and/or saturation mutagenesis.
In one aspect, the invention provides a genus of nucleic acids that
are synthetically generated variants of the parent SEQ ID NO:1,
wherein these nucleic acids of the invention having at least 95%,
96% 97%, 98% or 99% sequence identity to the "parent" SEQ ID NO:1,
and encoding at least one mutation listed in Table 4, 5, 6, 7, 9,
or any combination thereof,
For reference, the parent SEQ ID NO:1 is:
TABLE-US-00002 atgaaagcga tcttaatccc atttttatct cttctgattc
cgttaacccc gcaatctgca 60 ttcgctcaga gtgagccgga gctgaagctg
gaaagtgtgg tgattgtcag tcgtcatggt 120 gtgcgtgctc caaccaaggc
cacgcaactg atgcaggatg tcaccccaga cgcatggcca 180 acctggccgg
taaaactggg tgagctgaca ccgcgcggtg gtgagctaat cgcctatctc 240
ggacattact ggcgtcagcg tctggtagcc gacggattgc tgcctaaatg tggctgcccg
300 cagtctggtc aggtcgcgat tattgctgat gtcgacgagc gtacccgtaa
aacaggcgaa 360 gccttcgccg ccgggctggc acctgactgt gcaataaccg
tacataccca ggcagatacg 420 tccagtcccg atccgttatt taatcctcta
aaaactggcg tttgccaact ggataacgcg 480 aacgtgactg acgcgatcct
cgagagggca ggagggtcaa ttgctgactt taccgggcat 540 tatcaaacgg
cgtttcgcga actggaacgg gtgcttaatt ttccgcaatc aaacttgtgc 600
cttaaacgtg agaaacagga cgaaagctgt tcattaacgc aggcattacc atcggaactc
660 aaggtgagcg ccgactgtgt ctcattaacc ggtgcggtaa gcctcgcatc
aatgctgacg 720 gagatatttc tcctgcaaca agcacaggga atgccggagc
cggggtgggg aaggatcacc 780 gattcacacc agtggaacac cttgctaagt
ttgcataacg cgcaatttga tttgctacaa 840 cgcacgccag aggttgcccg
cagccgcgcc accccgttat tagatttgat caagacagcg 900 ttgacgcccc
atccaccgca aaaacaggcg tatggtgtga cattacccac ttcagtgctg 960
tttatcgccg gacacgatac taatctggca aatctcggcg gcgcactgga gctcaactgg
1020 acgcttcccg gtcagccgga taacacgccg ccaggtggtg aactggtgtt
tgaacgctgg 1080 cgtcggctaa gcgataacag ccagtggatt caggtttcgc
tggtcttcca gactttacag 1140 cagatgcgtg ataaaacgcc gctgtcatta
aatacgccgc ccggagaggt gaaactgacc 1200 ctggcaggat gtgaagagcg
aaatgcgcag ggcatgtgtt cgttggcagg ttttacgcaa 1260 atcgtgaatg
aagcacgcat accggcgtgc agtttgtaa 1299
The nucleic acids of the invention can be made, isolated and/or
manipulated by, e.g., cloning and expression of cDNA libraries,
amplification of message or genomic DNA by PCR, and the like. In
practicing the methods of the invention, homologous genes can be
modified by manipulating a template nucleic acid, as described
herein. The invention can be practiced in conjunction with any
method or protocol or device known in the art, which are well
described in the scientific and patent literature.
General Techniques
The nucleic acids used to practice this invention, whether RNA,
iRNA, antisense nucleic acid, cDNA, genomic DNA, vectors, viruses
or hybrids thereof, may be isolated from a variety of sources,
genetically engineered, amplified, and/or expressed/generated
recombinantly. Recombinant polypeptides generated from these
nucleic acids can be individually isolated or cloned and tested for
a desired activity. Any recombinant expression system can be used,
including bacterial, mammalian, yeast, insect or plant cell
expression systems.
Alternatively, these nucleic acids can be synthesized in vitro by
well-known chemical synthesis techniques, as described in, e.g.,
Adams (1983) J. Am. Chem. Soc. 105:661; Belousov (1997) Nucleic
Acids Res. 25:3440-3444; Frenkel (1995) Free Radic. Biol. Med.
19:373-380; Blommers (1994) Biochemistry 33:7886-7896; Narang
(1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68:109;
Beaucage (1981) Tetra. Lett. 22:1859; U.S. Pat. No. 4,458,066.
Techniques for the manipulation of nucleic acids, such as, e.g.,
subcloning, labeling probes (e.g., random-primer labeling using
Klenow polymerase, nick translation, amplification), sequencing,
hybridization and the like are well described in the scientific and
patent literature, see, e.g., Sambrook, ed., MOLECULAR CLONING: A
LABORATORY MANUAL (2ND ED.), Vols. 1-3, Cold Spring Harbor
Laboratory, (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY,
Ausubel, ed. John Wiley & Sons, Inc., New York (1997);
LABORATORY TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY:
HYBRIDIZATION WITH NUCLEIC ACID PROBES, Part I. Theory and Nucleic
Acid Preparation, Tijssen, ed. Elsevier, N.Y. (1993).
Another useful means of obtaining and manipulating nucleic acids
used to practice the methods of the invention is to clone from
genomic samples, and, if desired, screen and re-clone inserts
isolated or amplified from, e.g., genomic clones or cDNA clones.
Sources of nucleic acid used in the methods of the invention
include genomic or cDNA libraries contained in, e.g., mammalian
artificial chromosomes (MACs), see, e.g., U.S. Pat. Nos. 5,721,118;
6,025,155; human artificial chromosomes, see, e.g., Rosenfeld
(1997) Nat. Genet. 15:333-335; yeast artificial chromosomes (YAC);
bacterial artificial chromosomes (BAC); P1 artificial chromosomes,
see, e.g., Woon (1998) Genomics 50:306-316; P1-derived vectors
(PACs), see, e.g., Kern (1997) Biotechniques 23:120-124; cosmids,
recombinant viruses, phages or plasmids.
In alternative aspects, the phrases "nucleic acid" or "nucleic acid
sequence" refer to an oligonucleotide, nucleotide, polynucleotide,
or to a fragment of any of these, to DNA or RNA (e.g., mRNA, rRNA,
tRNA) of genomic or synthetic origin which may be single-stranded
or double-stranded and may represent a sense or antisense strand,
to peptide nucleic acid (PNA), or to any DNA-like or RNA-like
material, natural or synthetic in origin, including, e.g., iRNA,
ribonucleoproteins (e.g., iRNPs). The term encompasses nucleic
acids, i.e., oligonucleotides, containing known analogues of
natural nucleotides. The term also encompasses nucleic-acid-like
structures with synthetic backbones, see e.g., Mata (1997) Toxicol.
Appl. Pharmacol. 144:189-197; Strauss-Soukup (1997) Biochemistry
36:8692-8698; Samstag (1996) Antisense Nucleic Acid Drug Dev
6:153-156.
In one aspect, recombinant polynucleotides of the invention
comprise sequences adjacent to a "backbone" nucleic acid to which
it is not adjacent in its natural environment. In one aspect,
nucleic acids represent 5% or more of the number of nucleic acid
inserts in a population of nucleic acid "backbone molecules."
"Backbone molecules" according to the invention include nucleic
acids such as expression vectors, self-replicating nucleic acids,
viruses, integrating nucleic acids, and other vectors or nucleic
acids used to maintain or manipulate a nucleic acid insert of
interest. In one aspect, the enriched nucleic acids represent 15%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the number of
nucleic acid inserts in the population of recombinant backbone
molecules.
In one aspect, a nucleic acid encoding a polypeptide of the
invention is assembled in appropriate phase with a leader sequence
capable of directing secretion of the translated polypeptide or
fragment thereof.
The invention provides fusion proteins and nucleic acids encoding
them. A polypeptide of the invention can be fused to a heterologous
peptide or polypeptide, such as N-terminal identification peptides
which impart desired characteristics, such as increased stability
or simplified purification. Peptides and polypeptides of the
invention can also be synthesized and expressed as fusion proteins
with one or more additional domains linked thereto for, e.g.,
producing a more immunogenic peptide, to more readily isolate a
recombinantly synthesized peptide, to identify and isolate
antibodies and antibody-expressing B cells, and the like. Detection
and purification facilitating domains include, e.g., metal
chelating peptides such as polyhistidine tracts and
histidine-tryptophan modules that allow purification on immobilized
metals, protein A domains that allow purification on immobilized
immunoglobulin, and the domain utilized in the FLAGS
extension/affinity purification system (Immunex Corp, Seattle
Wash.). The inclusion of a cleavable linker sequences such as
Factor Xa or enterokinase (Invitrogen, San Diego Calif.) between a
purification domain and the motif-comprising peptide or polypeptide
to facilitate purification. For example, an expression vector can
include an epitope-encoding nucleic acid sequence linked to six
histidine residues followed by a thioredoxin and an enterokinase
cleavage site (see e.g., Williams (1995) Biochemistry 34:1787-1797;
Dobeli (1998) Protein Expr. Purif. 12:404-414). The histidine
residues facilitate detection and purification while the
enterokinase cleavage site provides a means for purifying the
epitope from the remainder of the fusion protein. Technology
pertaining to vectors encoding fusion proteins and application of
fusion proteins are well described in the scientific and patent
literature, see e.g., Kroll (1993) DNA Cell. Biol., 12:441-53.
In one aspect, the term "isolated" means that the material is
removed from its original environment (e.g., the natural
environment if it is naturally occurring). For example, a
naturally-occurring polynucleotide or polypeptide present in a
living animal is not isolated, but the same polynucleotide or
polypeptide, separated from some or all of the coexisting materials
in the natural system, is isolated. Such polynucleotides could be
part of a vector and/or such polynucleotides or polypeptides could
be part of a composition, and still be isolated in that such vector
or composition is not part of its natural environment. In one
aspect, the term "purified" does not require absolute purity;
rather, it is intended as a relative definition. Individual nucleic
acids obtained from a library have been conventionally purified to
electrophoretic homogeneity. The sequences obtained from these
clones could not be obtained directly either from the library or
from total human DNA. The purified nucleic acids of the invention
have been purified from the remainder of the genomic DNA in the
organism by at least 10.sup.4-10.sup.6 fold. In alternative
aspects, the term "purified" also includes nucleic acids which have
been purified from the remainder of the genomic DNA or from other
sequences in a library or other environment by at least one order
of magnitude, or alternatively, two or three orders, or four or
five orders of magnitude.
Transcriptional and Translational Control Sequences
The invention provides nucleic acid (e.g., DNA) sequences of the
invention operatively linked to expression (e.g., transcriptional
or translational) control sequence(s), e.g., promoters or
enhancers, to direct or modulate RNA synthesis/expression. The
expression control sequence can be in an expression vector.
Exemplary bacterial promoters include lad, lacZ, T3, T7, gpt,
lambda PR, PL and trp. Exemplary eukaryotic promoters include CMV
immediate early, HSV thymidine kinase, early and late SV40, LTRs
from retrovirus, and mouse metallothionein I.
Promoters suitable for expressing, or over-expressing, a
polypeptide in bacteria include the E. coli lac or trp promoters,
the lacI promoter, the lacZ promoter, the T3 promoter, the T7
promoter, the gpt promoter, the lambda PR promoter, the lambda PL
promoter, promoters from operons encoding glycolytic enzymes such
as 3-phosphoglycerate kinase (PGK), and the acid phosphatase
promoter. Eukaryotic promoters include the CMV immediate early
promoter, the HSV thymidine kinase promoter, heat shock promoters,
the early and late SV40 promoter, LTRs from retroviruses, and the
mouse metallothionein-I promoter. Other promoters known to control
expression of genes in prokaryotic or eukaryotic cells or their
viruses may also be used.
Expression Vectors and Cloning Vehicles
The invention provides expression systems, e.g., expression
cassettes, vectors, cloning vehicles and the like, comprising
nucleic acids of the invention, e.g., sequences encoding the
phytases of the invention, for expression, and over-expression, of
the polypeptides of the invention (and nucleic acids, e.g.,
antisense). Expression vectors and cloning vehicles of the
invention can comprise viral particles, baculovirus, phage,
plasmids, phagemids, cosmids, fosmids, bacterial artificial
chromosomes, viral DNA (e.g., vaccinia, adenovirus, foul pox virus,
pseudorabies and derivatives of SV40), P1-based artificial
chromosomes, yeast plasmids, yeast artificial chromosomes, and any
other vectors specific for specific hosts of interest (such as
bacillus, Aspergillus and yeast). Vectors of the invention can
include chromosomal, non-chromosomal and synthetic DNA sequences.
Large numbers of suitable vectors are known to those of skill in
the art, and are commercially available. Exemplary vectors are
include: bacterial: pQE vectors (Qiagen), pBluescript plasmids, pNH
vectors, (lambda-ZAP vectors (Stratagene); ptrc99a, pKK223-3,
pDR540, pRIT2T (Pharmacia); Eukaryotic: pXT1, pSG5 (Stratagene),
pSVK3, pBPV, pMSG, pSVLSV40 (Pharmacia). However, any other plasmid
or other vector may be used so long as they are replicable and
viable in the host. Low copy number or high copy number vectors may
be employed with the present invention.
As representative examples of expression vectors which may be used
there may be mentioned viral particles, baculovirus, phage,
plasmids, phagemids, cosmids, fosmids, bacterial artificial
chromosomes, viral DNA (e.g., vaccinia, adenovirus, foul pox virus,
pseudorabies and derivatives of SV40), P1-based artificial
chromosomes, yeast plasmids, yeast artificial chromosomes, and any
other vectors specific for specific hosts of interest (such as
bacillus, Aspergillus and yeast). Thus, for example, the DNA may be
included in any one of a variety of expression vectors for
expressing a polypeptide. Such vectors include chromosomal,
nonchromosomal and synthetic DNA sequences. Large numbers of
suitable vectors are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example; Bacterial: pQE vectors (Qiagen), pBluescript plasmids,
pNH vectors, (lambda-ZAP vectors (Stratagene); ptrc99a, pKK223-3,
pDR540, pRIT2T (Pharmacia); Eukaryotic: pXT1, pSG5 (Stratagene),
pSVK3, pBPV, pMSG, pSVLSV40 (Pharmacia). However, any other plasmid
or other vector may be used so long as they are replicable and
viable in the host. Low copy number or high copy number vectors may
be employed with the present invention.
An exemplary vector for use in the present invention contains an
f-factor origin replication. The f-factor (or fertility factor) in
E. coli is a plasmid which effects high frequency transfer of
itself during conjugation and less frequent transfer of the
bacterial chromosome itself. One aspect uses cloning vectors,
referred to as "fosmids" or bacterial artificial chromosome (BAC)
vectors. These are derived from E. coli f-factor which is able to
stably integrate large segments of genomic DNA. When integrated
with DNA from a mixed uncultured environmental sample, this makes
it possible to achieve large genomic fragments in the form of a
stable "environmental DNA library."
Another type of vector for use in the present invention is a cosmid
vector. Cosmid vectors were originally designed to clone and
propagate large segments of genomic DNA. Cloning into cosmid
vectors is described in detail in "Molecular Cloning: A laboratory
Manual" (Sambrook et al., 1989).
The DNA sequence in the expression vector is operatively linked to
an appropriate expression control sequence(s) (promoter) to direct
RNA synthesis. Particular named bacterial promoters include lad,
lacZ, T3, T7, gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic
promoters include CMV immediate early, HSV thymidine kinase, early
and late SV40, LTRs from retrovirus, and mouse metallothionein-I.
Selection of the appropriate vector and promoter is well within the
level of ordinary skill in the art. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression. Promoter regions can be
selected from any desired gene using CAT (chloramphenicol
transferase) vectors or other vectors with selectable markers. In
addition, the expression vectors can contain one or more selectable
marker genes to provide a phenotypic trait for selection of
transformed host cells such as dihydrofolate reductase or neomycin
resistance for eukaryotic cell culture, or tetracycline or
ampicillin resistance in E. coli.
In one aspect, expression cassettes of the invention comprise a
sequence of the invention and a nucleotide sequence which is
capable of affecting expression of a structural gene (i.e., a
protein coding sequence, such as a phytase of the invention) in a
host compatible with such sequences. Expression cassettes include
at least a promoter operably linked with the polypeptide coding
sequence; and, optionally, with other sequences, e.g.,
transcription termination signals. Additional factors necessary or
helpful in effecting expression may also be used, e.g., enhancers.
In one aspect, "operably linked" as used herein refers to linkage
of a promoter upstream from a DNA sequence such that the promoter
mediates transcription of the DNA sequence. Thus, expression
cassettes also include plasmids, expression vectors, recombinant
viruses, any form of recombinant "naked DNA" vector, and the like.
In one aspect, a "vector" comprises a nucleic acid that can infect,
transfect, transiently or permanently transduce a cell. A vector
can be a naked nucleic acid, or a nucleic acid complexed with
protein or lipid. The vector optionally comprises viral or
bacterial nucleic acids and/or proteins, and/or membranes (e.g., a
cell membrane, a viral lipid envelope, etc.). In one aspect,
vectors include, but are not limited to, replicons (e.g., RNA
replicons, bacteriophages) to which fragments of DNA may be
attached and become replicated. In one aspect, vectors include, but
are not limited to RNA, autonomous self-replicating circular or
linear DNA or RNA (e.g., plasmids, viruses, and the like, see,
e.g., U.S. Pat. No. 5,217,879), and includes both the expression
and non-expression plasmids. Where a recombinant microorganism or
cell culture is described as hosting an "expression vector" this
includes both extra-chromosomal circular and linear DNA and DNA
that has been incorporated into the host chromosome(s). Where a
vector is being maintained by a host cell, the vector may either be
stably replicated by the cells during mitosis as an autonomous
structure, or is incorporated within the host's genome.
The expression vector may comprise a promoter, a ribosome binding
site for translation initiation and a transcription terminator. The
vector may also include appropriate sequences for amplifying
expression. Mammalian expression vectors can comprise an origin of
replication, any necessary ribosome binding sites, a
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
non-transcribed sequences. In some aspects, DNA sequences derived
from the SV40 splice and polyadenylation sites may be used to
provide the required non-transcribed genetic elements.
In one aspect, the expression vectors contain one or more
selectable marker genes to permit selection of host cells
containing the vector. Such selectable markers include genes
encoding dihydrofolate reductase or genes conferring neomycin
resistance for eukaryotic cell culture, genes conferring
tetracycline or ampicillin resistance in E. coli, and the S.
cerevisiae TRP1 gene. Promoter regions can be selected from any
desired gene using chloramphenicol transferase (CAT) vectors or
other vectors with selectable markers.
Vectors for expressing the polypeptide or fragment thereof in
eukaryotic cells may also contain enhancers to increase expression
levels. Enhancers are cis-acting elements of DNA, usually from
about 10 to about 300 bp in length that act on a promoter to
increase its transcription. Examples include the SV40 enhancer on
the late side of the replication origin bp 100 to 270, the
cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and the adenovirus
enhancers.
A DNA sequence may be inserted into a vector by a variety of
procedures. In general, the DNA sequence is ligated to the desired
position in the vector following digestion of the insert and the
vector with appropriate restriction endonucleases. Alternatively,
blunt ends in both the insert and the vector may be ligated. A
variety of cloning techniques are known in the art, e.g., as
described in Ausubel and Sambrook. Such procedures and others are
deemed to be within the scope of those skilled in the art.
The vector may be in the form of a plasmid, a viral particle, or a
phage. Other vectors include chromosomal, non-chromosomal and
synthetic DNA sequences, derivatives of SV40; bacterial plasmids,
phage DNA, baculovirus, yeast plasmids, vectors derived from
combinations of plasmids and phage DNA, viral DNA such as vaccinia,
adenovirus, fowl pox virus, and pseudorabies. A variety of cloning
and expression vectors for use with prokaryotic and eukaryotic
hosts are described by, e.g., Sambrook.
Particular bacterial vectors which may be used include the
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017), pKK223-3 (Pharmacia
Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison,
Wis., USA) pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174 pBluescript
II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a,
pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8 and pCM7.
Particular eukaryotic vectors include pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, and pSVL (Pharmacia). However, any
other vector may be used as long as it is replicable and viable in
the host cell.
Host Cells and Transformed Cells
The invention also provides a transformed cell comprising a nucleic
acid sequence of the invention, e.g., a sequence encoding a phytase
of the invention, or comprising an expression cassette, vector,
cloning vehicle, expression vector, or cloning vector of the
invention. The host cell may be any of the host cells familiar to
those skilled in the art, including prokaryotic cells, eukaryotic
cells, such as bacterial cells, fungal cells, yeast cells,
mammalian cells, insect cells, or plant cells. Exemplary bacterial
cells include any species within the genera Escherichia, Bacillus,
Streptomyces, Salmonella, Pseudomonas, Lactococcus, and
Staphylococcus, including, e.g., Escherichia coli, Lactococcus
lactic, Bacillus subtilis, Bacillus cereus, Salmonella typhimurium,
Pseudomonas fluorescens. Exemplary fungal cells include any species
of Aspergillus, including Aspergillus niger. Exemplary yeast cells
include any species of Pichia, Saccharomyces, Schizosaccharomyces,
or Schwanniomyces, including Pichia pastoris, Saccharomyces
cerevisiae, or Schizosaccharomyces pombe. Exemplary insect cells
include any species of Spodoptera or Drosophila, including
Drosophila S2 and Spodoptera S/9. Exemplary insect cells include
Drosophila S2 and Spodoptera Sf9. Exemplary yeast cells include
Pichia pastoris, Saccharomyces cerevisiae or Schizosaccharomyces
pombe. Exemplary animal cells include CHO, COS or Bowes melanoma or
any mouse or human cell line. The selection of an appropriate host
is within the abilities of those skilled in the art.
The vector may be introduced into the host cells using any of a
variety of techniques, including transformation, transfection,
transduction, viral infection, gene guns, or Ti-mediated gene
transfer. Particular methods include calcium phosphate
transfection, DEAE-Dextran mediated transfection, lipofection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
Where appropriate, the engineered host cells can be cultured in
conventional nutrient media modified as appropriate for activating
promoters, selecting transformants or amplifying the genes of the
invention. Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter may be induced by appropriate means (e.g.,
temperature shift or chemical induction) and the cells may be
cultured for an additional period to allow them to produce the
desired polypeptide or fragment thereof.
Cells can be harvested by centrifugation, disrupted by physical or
chemical means, and the resulting crude extract is retained for
further purification. Microbial cells employed for expression of
proteins can be disrupted by any convenient method, including
freeze-thaw cycling, sonication, mechanical disruption, or use of
cell lysing agents. Such methods are well known to those skilled in
the art. The expressed polypeptide or fragment thereof can be
recovered and purified from recombinant cell cultures by methods
including ammonium sulfate or ethanol precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Protein refolding steps
can be used, as necessary, in completing configuration of the
polypeptide. If desired, high performance liquid chromatography
(HPLC) can be employed for final purification steps.
The constructs in host cells can be used in a conventional manner
to produce the gene product encoded by the recombinant sequence.
Depending upon the host employed in a recombinant production
procedure, the polypeptides produced by host cells containing the
vector may be glycosylated or may be non-glycosylated. Polypeptides
of the invention may or may not also include an initial methionine
amino acid residue.
Cell-free translation systems can also be employed to produce a
polypeptide of the invention. Cell-free translation systems can use
mRNAs transcribed from a DNA construct comprising a promoter
operably linked to a nucleic acid encoding the polypeptide or
fragment thereof. In some aspects, the DNA construct may be
linearized prior to conducting an in vitro transcription reaction.
The transcribed mRNA is then incubated with an appropriate
cell-free translation extract, such as a rabbit reticulocyte
extract, to produce the desired polypeptide or fragment
thereof.
The expression vectors can contain one or more selectable marker
genes to provide a phenotypic trait for selection of transformed
host cells such as dihydrofolate reductase or neomycin resistance
for eukaryotic cell culture, or such as tetracycline or ampicillin
resistance in E. coli.
The nucleic acids of the invention can be expressed, or
overexpressed, in any in vitro or in vivo expression system. Any
cell culture systems can be employed to express, or over-express,
recombinant protein, including bacterial, insect, yeast, fungal or
mammalian cultures. Over-expression can be effected by appropriate
choice of promoters, enhancers, vectors (e.g., use of replicon
vectors, dicistronic vectors (see, e.g., Gurtu (1996) Biochem.
Biophys. Res. Commun. 229:295-8)), media, culture systems and the
like. In one aspect, gene amplification using selection markers,
e.g., glutamine synthetase (see, e.g., Sanders (1987) Dev. Biol.
Stand. 66:55-63), in cell systems are used to overexpress the
polypeptides of the invention.
Various mammalian cell culture systems can be employed to express
recombinant protein, examples of mammalian expression systems
include the COS-7 lines of monkey kidney fibroblasts, described in
"SV40-transformed simian cells support the replication of early
SV40 mutants" (Gluzman, 1981), and other cell lines capable of
expressing a compatible vector, for example, the C127, 3T3, CHO,
HeLa and BHK cell lines. Mammalian expression vectors will comprise
an origin of replication, a suitable promoter and enhancer, and
also any necessary ribosome binding sites, polyadenylation site,
splice donor and acceptor sites, transcriptional termination
sequences, and 5' flanking non-transcribed sequences. DNA sequences
derived from the SV40 splice, and polyadenylation sites may be used
to provide the required non-transcribed genetic elements.
Host cells containing the polynucleotides of interest can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying genes.
The culture conditions, such as temperature, pH and the like, are
those previously used with the host cell selected for expression,
and will be apparent to the ordinarily skilled artisan. The clones
which are identified as having the specified enzyme activity may
then be sequenced to identify the polynucleotide sequence encoding
an enzyme having the enhanced activity.
Amplification of Nucleic Acids
In practicing the invention, nucleic acids encoding the
polypeptides of the invention, or modified nucleic acids, can be
reproduced by, e.g., amplification. The invention provides
amplification primer sequence pairs for amplifying nucleic acids
encoding polypeptides with a phytase activity, or subsequences
thereof, where the primer pairs are capable of amplifying nucleic
acid sequences including the exemplary SEQ ID NO:1, and at least
one of the specific sequence modifications set forth above. One of
skill in the art can design amplification primer sequence pairs for
any part of or the full length of these sequences; for example:
The "parent" SEQ ID NO:1 is as shown above. Thus, an amplification
primer sequence pair for amplifying this parent sequence, or one of
the exemplary sequences of the invention having at least one of the
specific sequence modifications set forth herein, can be residues 1
to 21 of SEQ ID NO:1 (i.e., ATGAAAGCGATCTTAATCCCA) and the
complementary strand of the last 21 residues of SEQ ID NO:1 (i.e.,
the complementary strand of TGCAGTTTGAGATCTCATCTA).
Amplification reactions can also be used to quantify the amount of
nucleic acid in a sample (such as the amount of message in a cell
sample), label the nucleic acid (e.g., to apply it to an array or a
blot), detect the nucleic acid, or quantify the amount of a
specific nucleic acid in a sample. In one aspect of the invention,
message isolated from a cell or a cDNA library are amplified. The
skilled artisan can select and design suitable oligonucleotide
amplification primers. Amplification methods are also well known in
the art, and include, e.g., polymerase chain reaction, PCR (see,
e.g., PCR PROTOCOLS, A GUIDE TO METHODS AND APPLICATIONS, ed.
Innis, Academic Press, N.Y. (1990) and PCR STRATEGIES (1995), ed.
Innis, Academic Press, Inc., N.Y., ligase chain reaction (LCR)
(see, e.g., Wu (1989) Genomics 4:560; Landegren (1988) Science
241:1077; Barringer (1990) Gene 89:117); transcription
amplification (see, e.g., Kwoh (1989) Proc. Natl. Acad. Sci. USA
86:1173); and, self-sustained sequence replication (see, e.g.,
Guatelli (1990) Proc. Natl. Acad. Sci. USA 87:1874); Q Beta
replicase amplification (see, e.g., Smith (1997) J. Clin.
Microbiol. 35:1477-1491), automated Q-beta replicase amplification
assay (see, e.g., Burg (1996) Mol. Cell. Probes 10:257-271) and
other RNA polymerase mediated techniques (e.g., NASBA, Cangene,
Mississauga, Ontario); see also Berger (1987) Methods Enzymol.
152:307-316; Sambrook; Ausubel; U.S. Pat. Nos. 4,683,195 and
4,683,202; Sooknanan (1995) Biotechnology 13:563-564.
Determining the Degree of Sequence Identity
The invention provides an isolated, synthetic or recombinant
nucleic acid comprising a nucleic acid sequence having at least
70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%,
83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%,
96%, 97%, 98%, 99%, or more sequence identity to SEQ ID NO:1, and
including at least one of the specifically enumerated modifications
to SEQ ID NO:1 discussed above. In one aspect, the extent of
sequence identity (homology) may be determined using any computer
program and associated parameters, including those described
herein, such as BLAST 2.2.2. or FASTA version 3.0t78, with the
default parameters.
Homologous sequences also include RNA sequences in which uridines
replace the thymines in the nucleic acid sequences. The homologous
sequences may be obtained using any of the procedures described
herein or may result from the correction of a sequencing error.
Various sequence comparison programs identified herein are used in
this aspect of the invention. Protein and/or nucleic acid sequence
identities (homologies) may be evaluated using any of the variety
of sequence comparison algorithms and programs known in the art.
Such algorithms and programs include, but are not limited to,
TBLASTN, BLASTP, FASTA, TFASTA, and CLUSTALW (Pearson and Lipman,
Proc. Natl. Acad. Sci. USA 85(8):2444-2448, 1988; Altschul et al.,
J. Mol. Biol. 215(3):403-410, 1990; Thompson et al., Nucleic Acids
Res. 22(2):4673-4680, 1994; Higgins et al., Methods Enzymol.
266:383-402, 1996; Altschul et al., J. Mol. Biol. 215(3):403-410,
1990; Altschul et al., Nature Genetics 3:266-272, 1993.
Homology or identity can be measured using sequence analysis
software (e.g., Sequence Analysis Software Package of the Genetics
Computer Group, University of Wisconsin Biotechnology Center, 1710
University Avenue, Madison, Wis. 53705). Such software matches
similar sequences by assigning degrees of homology to various
deletions, substitutions and other modifications. The terms
"homology" and "identity" in the context of two or more nucleic
acids or polypeptide sequences, refer to two or more sequences or
subsequences that are the same or have a specified percentage of
amino acid residues or nucleotides that are the same when compared
and aligned for maximum correspondence over a comparison window or
designated region as measured using any number of sequence
comparison algorithms or by manual alignment and visual inspection.
For sequence comparison, one sequence can act as a reference
sequence (an exemplary sequence of the invention) to which test
sequences are compared. When using a sequence comparison algorithm,
test and reference sequences are entered into a computer,
subsequence coordinates are designated, if necessary, and sequence
algorithm program parameters are designated. Default program
parameters can be used, or alternative parameters can be
designated. The sequence comparison algorithm then calculates the
percent sequence identities for the test sequences relative to the
reference sequence, based on the program parameters.
A "comparison window", as used herein, includes reference to a
segment of any one of the number of contiguous residues. For
example, in alternative aspects of the invention, continugous
residues ranging anywhere from 20 to the full length of exemplary
sequences of the invention are compared to a reference sequence of
the same number of contiguous positions after the two sequences are
optimally aligned. If the reference sequence has the requisite
sequence identity to exemplary sequences of the invention, e.g.,
98% sequence identity to SEQ ID NO:1, SEQ ID NO:2, and having one
of the specific sequence modifications noted above, that sequence
is within the scope of the invention. In alternative embodiments,
subsequences ranging from about 20 to 600, about 50 to 200, and
about 100 to 150 are compared to a reference sequence of the same
number of contiguous positions after the two sequences are
optimally aligned. Methods of alignment of sequence for comparison
are well-known in the art. Optimal alignment of sequences for
comparison can be conducted, e.g., by the local homology algorithm
of Smith & Waterman, Adv. Appl. Math. 2:482, 1981, by the
homology alignment algorithm of Needleman & Wunsch, J. Mol.
Biol. 48:443, 1970, by the search for similarity method of person
& Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444, 1988, by
computerized implementations of these algorithms (GAP, BESTFIT,
FASTA, and TFASTA in the Wisconsin Genetics Software Package,
Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by
manual alignment and visual inspection. Other algorithms for
determining homology or identity include, for example, in addition
to a BLAST program (Basic Local Alignment Search Tool at the
National Center for Biological Information, such as BLAST, BLAST2,
BLASTN and BLASTX), ALIGN, AMAS (Analysis of Multiply Aligned
Sequences), AMPS (Protein Multiple Sequence Alignment), ASSET
(Aligned Segment Statistical Evaluation Tool), BANDS, BESTSCOR,
BIOSCAN (Biological Sequence Comparative Analysis Node), BLIMPS
(BLocks IMProved Searcher), FASTA, Intervals & Points, BMB,
CLUSTAL V, CLUSTAL W, CONSENSUS, LCONSENSUS, WCONSENSUS,
Smith-Waterman algorithm, DARWIN, Las Vegas algorithm, FASTA
(Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 85: 2444, 1988),
FASTDB (Brutlag et al. Comp. App. Biosci. 6:237-245, 1990), FNAT
(Forced Nucleotide Alignment Tool), Framealign, Framesearch,
DYNAMIC, FILTER, FSAP (Fristensky Sequence Analysis Package), GAP
(Global Alignment Program), GENAL, GIBBS, GenQuest, ISSC (Sensitive
Sequence Comparison), LALIGN (Local Sequence Alignment), LCP (Local
Content Program), MACAW (Multiple Alignment Construction &
Analysis Workbench), MAP (Multiple Alignment Program), MBLKP,
MBLKN, PIMA (Pattern-Induced Multi-sequence Alignment), SAGA
(Sequence Alignment by Genetic Algorithm) and WHAT-IF. Other
programs and databases used to practice the invention include, but
are not limited to: MacPattern (EMBL), DiscoveryBase (Molecular
Applications Group), GeneMine (Molecular Applications Group), Look
(Molecular Applications Group), MacLook (Molecular Applications
Group), Catalyst (Molecular Simulations Inc.), Catalyst/SHAPE
(Molecular Simulations Inc.), Cerius2.DBAccess (Molecular
Simulations Inc.), HypoGen (Molecular Simulations Inc.), Insight
II, (Molecular Simulations Inc.), Discover (Molecular Simulations
Inc.), CHARMm (Molecular Simulations Inc.), Felix (Molecular
Simulations Inc.), DelPhi, (Molecular Simulations Inc.), QuanteMM,
(Molecular Simulations Inc.), Homology (Molecular Simulations
Inc.), Modeler (Molecular Simulations Inc.), ISIS (Molecular
Simulations Inc.), Quanta/Protein Design (Molecular Simulations
Inc.), WebLab (Molecular Simulations Inc.), WebLab Diversity
Explorer (Molecular Simulations Inc.), Gene Explorer (Molecular
Simulations Inc.), SeqFold (Molecular Simulations Inc.), the MDL
Available Chemicals Directory database, the MDL Drug Data Report
data base, the Comprehensive Medicinal Chemistry database,
Derwent's World Drug Index database, the BioByteMasterFile
database, the GenBank database, the GenSeq database, and the
GenomeQuest database. Many other programs and data bases would be
apparent to one of skill in the art given the present disclosure.
Such alignment programs can also be used to screen genome databases
to identify polynucleotide sequences having substantially identical
sequences. A number of genome databases are available, for example,
through the NCBI (National Center for Biotechnology Information)
website. Databases containing genomic information annotated with
some functional information are maintained by different
organization, and are accessible via the internet.
BLAST, BLAST 2.0 and BLAST 2.2.2 algorithms are also used to
practice the invention. They are described, e.g., in Altschul
(1977) Nuc. Acids Res. 25:3389-3402; Altschul (1990) J. Mol. Biol.
215:403-410. Software for performing BLAST analyses is publicly
available through the National Center for Biotechnology
Information. This algorithm involves first identifying high scoring
sequence pairs (HSPs) by identifying short words of length W in the
query sequence, which either match or satisfy some positive-valued
threshold score T when aligned with a word of the same length in a
database sequence. T is referred to as the neighborhood word score
threshold (Altschul (1990) supra). These initial neighborhood word
hits act as seeds for initiating searches to find longer HSPs
containing them. The word hits are extended in both directions
along each sequence for as far as the cumulative alignment score
can be increased. Cumulative scores are calculated using, for
nucleotide sequences, the parameters M (reward score for a pair of
matching residues; always >0). For amino acid sequences, a
scoring matrix is used to calculate the cumulative score. Extension
of the word hits in each direction are halted when: the cumulative
alignment score falls off by the quantity X from its maximum
achieved value; the cumulative score goes to zero or below, due to
the accumulation of one or more negative-scoring residue
alignments; or the end of either sequence is reached. The BLAST
algorithm parameters W, T, and X determine the sensitivity and
speed of the alignment. The BLASTN program (for nucleotide
sequences) uses as defaults a wordlength (W) of 11, an expectation
(E) of 10, M=5, N=-4 and a comparison of both strands. For amino
acid sequences, the BLASTP program uses as defaults a wordlength of
3, and expectations (E) of 10, and the BLOSUM62 scoring matrix (see
Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915)
alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a
comparison of both strands. The BLAST algorithm also performs a
statistical analysis of the similarity between two sequences (see,
e.g., Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA
90:5873). One measure of similarity provided by BLAST algorithm is
the smallest sum probability (P(N)), which provides an indication
of the probability by which a match between two nucleotide or amino
acid sequences would occur by chance. For example, a nucleic acid
is considered similar to a references sequence if the smallest sum
probability in a comparison of the test nucleic acid to the
reference nucleic acid is less than about 0.2, less than about
0.01, or less than about 0.001. In one aspect, protein and nucleic
acid sequence homologies are evaluated using the Basic Local
Alignment Search Tool ("BLAST"). For example, five specific BLAST
programs can be used to perform the following task: (1) BLASTP and
BLAST3 compare an amino acid query sequence against a protein
sequence database; (2) BLASTN compares a nucleotide query sequence
against a nucleotide sequence database; (3) BLASTX compares the
six-frame conceptual translation products of a query nucleotide
sequence (both strands) against a protein sequence database; (4)
TBLASTN compares a query protein sequence against a nucleotide
sequence database translated in all six reading frames (both
strands); and, (5) TBLASTX compares the six-frame translations of a
nucleotide query sequence against the six-frame translations of a
nucleotide sequence database. The BLAST programs identify
homologous sequences by identifying similar segments, which are
referred to herein as "high-scoring segment pairs," between a query
amino or nucleic acid sequence and a test sequence which can be
obtained from a protein or nucleic acid sequence database.
High-scoring segment pairs can be identified (i.e., aligned) by
means of a scoring matrix, many of which are known in the art. An
exemplary scoring matrix used is the BLOSUM62 matrix (Gonnet et
al., Science 256:1443-1445, 1992; Henikoff and Henikoff, Proteins
17:49-61, 1993). Alternatively, the PAM or PAM250 matrices may be
used (see, e.g., Schwartz and Dayhoff, eds., 1978, Matrices for
Detecting Distance Relationships: Atlas of Protein Sequence and
Structure, Washington: National Biomedical Research
Foundation).
In one aspect of the invention, to determine if a nucleic acid has
the requisite sequence identity to be within the scope of the
invention, the NCBI BLAST 2.2.2 programs is used. default options
to blastp. There are about 38 setting options in the BLAST 2.2.2
program. In this exemplary aspect of the invention, all default
values are used except for the default filtering setting (i.e., all
parameters set to default except filtering which is set to OFF); in
its place a "-F F" setting is used, which disables filtering. Use
of default filtering often results in Karlin-Altschul violations
due to short length of sequence.
The default values used in this exemplary aspect of the invention
include: "Filter for low complexity: ON >Word Size: 3
>Matrix: Blosum62 >Gap Costs: Existence: 11 >Extension:
1"
"Filter for low complexity: ON
Other default settings are: filter for low complexity OFF, word
size of 3 for protein, BLOSUM62 matrix, gap existence penalty of
-11 and a gap extension penalty of -1.
In some aspects, a sequence comparison algorithm can be used for
comparing a nucleic acid sequence or amino acid sequence of the
invention to a reference sequence. For example, the sequence
comparison algorithm may compare the nucleotide sequences or amino
acid sequences of the invention with the "parent" sequence SEQ ID
NO:1 and/or SEQ ID NO:2, or to reference sequences to identify
homologies or structural motifs. A comparison of the sequences can
be performed to determine if the first sequence is the same as the
second sequence. It is important to note that this type of
comparison is not limited to performing an exact comparison between
the new sequence and the first sequence in the database. Well-known
methods are known to those of skill in the art for comparing two
nucleotide or protein sequences, even if they are not identical.
For example, gaps can be introduced into one sequence in order to
raise the homology level between the two tested sequences. The
parameters that control whether gaps or other features are
introduced into a sequence during comparison are normally entered
by the user of the comparison algorithm.
Once a comparison of two sequences has been performed, a
determination is made whether the two sequences are the same. Of
course, the term "same" is not limited to sequences that are
absolutely identical. The sequence comparison may indicate a
sequence identity level between the sequences compared or identify
structural motifs, or it may identify structural motifs in
sequences which are compared to these nucleic acid codes and
polypeptide codes. The level of sequence identity is determined by
calculating the proportion of characters between the sequences that
were the same out of the total number of sequences in the first
sequence. Thus, if every character in a first 100 nucleotide
sequence aligned with every character in a second sequence, the
sequence identity level would be 100%.
Alternatively, the algorithm can compare a reference sequence to a
sequence of the invention to determine whether the sequences differ
at one or more positions. The result of the comparison may indicate
the length and identity of inserted, deleted or substituted
nucleotides or amino acid residues with respect to the sequence of
either the reference or the invention. In other aspects, the
algorithm can be used to identify features within a nucleic acid or
polypeptide of the invention. For example, identifier feature may
comprise an open reading frame (ORF), an "Initiation Codon" (e.g.,
the codon "ATG"), a "TAATAA Box", or motifs such as alpha helices,
beta sheets, or functional polypeptide motifs such as enzymatic
active sites, helix-turn-helix motifs, leucine zippers,
glycosylation sites, ubiquitination sites, alpha helices, beta
sheets, signal sequences encoding signal peptides which direct the
secretion of the encoded proteins, sequences implicated in
transcription regulation such as homeoboxes, acidic stretches,
enzymatic active sites, substrate binding sites, and enzymatic
cleavage sites, as well as other motifs known to those skilled in
the art.
Inhibiting Expression of a Phytase
The invention further provides for nucleic acids complementary to
(e.g., antisense sequences to) the nucleic acid sequences of the
invention, including nucleic acids comprising antisense, iRNA,
ribozymes. Antisense sequences are capable of inhibiting the
transport, splicing or transcription of phytase-encoding genes. The
inhibition can be effected through the targeting of genomic DNA or
messenger RNA. The transcription or function of targeted nucleic
acid can be inhibited, for example, by hybridization and/or
cleavage. One particularly useful set of inhibitors provided by the
present invention includes oligonucleotides which are able to
either bind phytase gene or message, in either case preventing or
inhibiting the production or function of phytase enzyme. The
association can be though sequence specific hybridization. Another
useful class of inhibitors includes oligonucleotides which cause
inactivation or cleavage of phytase message. The oligonucleotide
can have enzyme activity which causes such cleavage, such as
ribozymes. The oligonucleotide can be chemically modified or
conjugated to an enzyme or composition capable of cleaving the
complementary nucleic acid. One may screen a pool of many different
such oligonucleotides for those with the desired activity.
Antisense Oligonucleotides
The invention provides antisense oligonucleotides comprising the
new phytase sequence modifications of the invention, where these
antisense oligonucleotides are capable of binding phytase message
which can inhibit phytase activity by targeting mRNA. Strategies
for designing antisense oligonucleotides are well described in the
scientific and patent literature, and the skilled artisan can
design such phytase oligonucleotides using the novel reagents of
the invention. For example, gene walking/RNA mapping protocols to
screen for effective antisense oligonucleotides are well known in
the art, see, e.g., Ho (2000) Methods Enzymol. 314:168-183,
describing an RNA mapping assay, which is based on standard
molecular techniques to provide an easy and reliable method for
potent antisense sequence selection. See also Smith (2000) Euro. J.
Pharm. Sci. 11:191-198.
Naturally occurring nucleic acids are used as antisense
oligonucleotides. The antisense oligonucleotides can be of any
length; for example, in alternative aspects, the antisense
oligonucleotides are between about 5 to 100, about 10 to 80, about
15 to 60, about 18 to 40. The optimal length can be determined by
routine screening. The antisense oligonucleotides can be present at
any concentration. The optimal concentration can be determined by
routine screening. A wide variety of synthetic, non-naturally
occurring nucleotide and nucleic acid analogues are known which can
address this potential problem. For example, peptide nucleic acids
(PNAs) containing non-ionic backbones, such as
N-(2-aminoethyl)glycine units can be used. Antisense
oligonucleotides having phosphorothioate linkages can also be used,
as described in WO 97/03211; WO 96/39154; Mata (1997) Toxicol Appl
Pharmacol 144:189-197; Antisense Therapeutics, ed. Agarwal (Humana
Press, Totowa, N.J., 1996). Antisense oligonucleotides having
synthetic DNA backbone analogues provided by the invention can also
include phosphoro-dithioate, methylphosphonate, phosphoramidate,
alkyl phosphotriester, sulfamate, 3'-thioacetal,
methylene(methylimino), 3'-N-carbamate, and morpholino carbamate
nucleic acids, as described above.
Combinatorial chemistry methodology can be used to create vast
numbers of oligonucleotides that can be rapidly screened for
specific oligonucleotides that have appropriate binding affinities
and specificities toward any target, such as the sense and
antisense phytase sequences of the invention (see, e.g., Gold
(1995) J. of Biol. Chem. 270:13581-13584).
Inhibitory Ribozymes
The invention provides ribozymes comprising the new phytase
sequence modifications of the invention, where the ribozymes of the
invention are capable of binding phytase message which can inhibit
phytase enzyme activity by targeting mRNA. Strategies for designing
ribozymes and selecting the phytase-specific antisense sequence for
targeting are well described in the scientific and patent
literature, and the skilled artisan can design such ribozymes using
the novel reagents of the invention. Ribozymes act by binding to a
target RNA through the target RNA binding portion of a ribozyme
which is held in close proximity to an enzymatic portion of the RNA
that cleaves the target RNA. Thus, the ribozyme recognizes and
binds a target RNA through complementary base-pairing, and once
bound to the correct site, acts enzymatically to cleave and
inactivate the target RNA. Cleavage of a target RNA in such a
manner will destroy its ability to direct synthesis of an encoded
protein if the cleavage occurs in the coding sequence. After a
ribozyme has bound and cleaved its RNA target, it is typically
released from that RNA and so can bind and cleave new targets
repeatedly.
In some circumstances, the enzymatic nature of a ribozyme can be
advantageous over other technologies, such as antisense technology
(where a nucleic acid molecule simply binds to a nucleic acid
target to block its transcription, translation or association with
another molecule) as the effective concentration of ribozyme
necessary to effect a therapeutic treatment can be lower than that
of an antisense oligonucleotide. This potential advantage reflects
the ability of the ribozyme to act enzymatically. Thus, a single
ribozyme molecule is able to cleave many molecules of target RNA.
In addition, a ribozyme is typically a highly specific inhibitor,
with the specificity of inhibition depending not only on the base
pairing mechanism of binding, but also on the mechanism by which
the molecule inhibits the expression of the RNA to which it binds.
That is, the inhibition is caused by cleavage of the RNA target and
so specificity is defined as the ratio of the rate of cleavage of
the targeted RNA over the rate of cleavage of non-targeted RNA.
This cleavage mechanism is dependent upon factors additional to
those involved in base pairing. Thus, the specificity of action of
a ribozyme can be greater than that of antisense oligonucleotide
binding the same RNA site.
The enzymatic ribozyme RNA molecule can be formed in a hammerhead
motif, but may also be formed in the motif of a hairpin, hepatitis
delta virus, group I intron or RNaseP-like RNA (in association with
an RNA guide sequence). Examples of such hammerhead motifs are
described by Rossi (1992) Aids Research and Human Retroviruses
8:183; hairpin motifs by Hampel (1989) Biochemistry 28:4929, and
Hampel (1990) Nuc. Acids Res. 18:299; the hepatitis delta virus
motif by Perrotta (1992) Biochemistry 31:16; the RNaseP motif by
Guerrier-Takada (1983) Cell 35:849; and the group I intron by Cech
U.S. Pat. No. 4,987,071. The recitation of these specific motifs is
not intended to be limiting; those skilled in the art will
recognize that an enzymatic RNA molecule of this invention has a
specific substrate binding site complementary to one or more of the
target gene RNA regions, and has nucleotide sequence within or
surrounding that substrate binding site which imparts an RNA
cleaving activity to the molecule.
RNA Interference (RNAi)
In one aspect, the invention provides an RNA inhibitory molecule, a
so-called "RNAi" molecule, comprising an enzyme sequence of the
invention. The RNAi molecule comprises a double-stranded RNA
(dsRNA) molecule. The RNAi molecule, e.g., siRNA and/or miRNA, can
inhibit expression of phytase enzyme gene. In one aspect, the RNAi
molecule, e.g., siRNA and/or miRNA, is about 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25 or more duplex nucleotides in length.
While the invention is not limited by any particular mechanism of
action, the RNAi can enter a cell and cause the degradation of a
single-stranded RNA (ssRNA) of similar or identical sequences,
including endogenous mRNAs. When a cell is exposed to
double-stranded RNA (dsRNA), mRNA from the homologous gene is
selectively degraded by a process called RNA interference (RNAi). A
possible basic mechanism behind RNAi is the breaking of a
double-stranded RNA (dsRNA) matching a specific gene sequence into
short pieces called short interfering RNA, which trigger the
degradation of mRNA that matches its sequence. In one aspect, the
RNAi's of the invention are used in gene-silencing therapeutics,
see, e.g., Shuey (2002) Drug Discov. Today 7:1040-1046. In one
aspect, the invention provides methods to selectively degrade RNA
using the RNAi's molecules, e.g., siRNA and/or miRNA, of the
invention. In one aspect, the micro-inhibitory RNA (miRNA) inhibits
translation, and the siRNA inhibits transcription. The process may
be practiced in vitro, ex vivo or in vivo. In one aspect, the RNAi
molecules of the invention can be used to generate a
loss-of-function mutation in a cell, an organ or an animal. Methods
for making and using RNAi molecules, e.g., siRNA and/or miRNA, for
selectively degrade RNA are well known in the art, see, e.g., U.S.
Pat. Nos. 6,506,559; 6,511,824; 6,515,109; 6,489,127.
Modification of Nucleic Acids
The invention provides methods of generating variants of the
nucleic acids of the invention, e.g., those encoding a phytase
enzyme. These methods can be repeated or used in various
combinations to generate phytase enzymes having an altered or
different activity or an altered or different stability from that
of a phytase encoded by the template nucleic acid. These methods
also can be repeated or used in various combinations, e.g., to
generate variations in gene/message expression, message translation
or message stability. In another aspect, the genetic composition of
a cell is altered by, e.g., modification of a homologous gene ex
vivo, followed by its reinsertion into the cell.
The invention also provides methods for changing the
characteristics of a phytase of the invention by mutagenesis and
other method, including directed evolution, e.g., Diversa
Corporation's (San Diego, Calif.) proprietary approaches; e.g.,
DirectEvolution; (see, e.g., U.S. Pat. No. 5,830,696; Gene Site
Saturation Mutagenesis (GSSM) (see, e.g., U.S. Pat. Nos. 6,171,820
and 6,579,258), Exonuclease-Mediated Gene Assembly in Directed
Evolution (see, e.g., U.S. Pat. Nos. 6,361,974 and 6,352,842), End
Selection in Directed Evolution (see, e.g., U.S. Pat. Nos.
6,358,709 and 6,238,884), Recombination-Based Synthesis Shuffling
(see, e.g., U.S. Pat. Nos. 5,965,408 and 6,440,668, and Australian
Patent No. AU724521), and Directed Evolution of Thermophilic
Enzymes (see, e.g., U.S. Pat. Nos. 5,830,696 and 6,335,179).
In one aspect, the characteristics of a phytase are modified by a
DirectEvolution protocol comprising: a) the subjection of one or
more molecular templates, e.g., the phytase nucleic acids of the
invention, to mutagenesis to generate novel molecules, and b) the
selection among these progeny species of novel molecules with more
desirable characteristics. The power of directed evolution depends
on the starting choice of starting templates (e.g., the "parent"
SEQ ID NO:1, or any sequence of this invention), as well as on the
mutagenesis process(es) chosen and the screening process(es) used.
Thus, the invention provides novel highly active, physiologically
effective, and economical sources of phytase activity, including
novel phytases that: a) have superior activities under one or more
specific applications, such as high temperature manufacture of
foodstuffs, and are thus useful for optimizing these specific
applications; b) are useful as templates for directed evolution to
achieve even further improved novel molecules; and c) are useful as
tools for the identification of additional related molecules by
means such as hybridization-based approaches.
A nucleic acid of the invention can be altered by any means. For
example, random or stochastic methods, or, non-stochastic, or
"directed evolution," methods. Methods for random mutation of genes
are well known in the art, see, e.g., U.S. Pat. No. 5,830,696. For
example, mutagens can be used to randomly mutate a gene. Mutagens
include, e.g., ultraviolet light or gamma irradiation, or a
chemical mutagen, e.g., mitomycin, nitrous acid, photoactivated
psoralens, alone or in combination, to induce DNA breaks amenable
to repair by recombination. Other chemical mutagens include, for
example, sodium bisulfite, nitrous acid, hydroxylamine, hydrazine
or formic acid. Other mutagens are analogues of nucleotide
precursors, e.g., nitrosoguanidine, 5-bromouracil, 2-aminopurine,
or acridine. These agents can be added to a PCR reaction in place
of the nucleotide precursor thereby mutating the sequence.
Intercalating agents such as proflavine, acriflavine, quinacrine
and the like can also be used.
Any technique in molecular biology can be used, e.g., random PCR
mutagenesis, see, e.g., Rice (1992) Proc. Natl. Acad. Sci. USA
89:5467-5471; or, combinatorial multiple cassette mutagenesis, see,
e.g., Crameri (1995) Biotechniques 18:194-196. Alternatively,
nucleic acids, e.g., genes, can be reassembled after random, or
"stochastic," fragmentation, see, e.g., U.S. Pat. Nos. 6,291,242;
6,287,862; 6,287,861; 5,955,358; 5,830,721; 5,824,514; 5,811,238;
5,605,793. In alternative aspects, modifications, additions or
deletions are introduced by error-prone PCR, shuffling,
oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR
mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive
ensemble mutagenesis, exponential ensemble mutagenesis,
site-specific mutagenesis, gene reassembly, gene site saturation
mutagenesis (GSSM), synthetic ligation reassembly (SLR),
recombination, recursive sequence recombination,
phosphothioate-modified DNA mutagenesis, uracil-containing template
mutagenesis, gapped duplex mutagenesis, point mismatch repair
mutagenesis, repair-deficient host strain mutagenesis, chemical
mutagenesis, radiogenic mutagenesis, deletion mutagenesis,
restriction-selection mutagenesis, restriction-purification
mutagenesis, artificial gene synthesis, ensemble mutagenesis,
chimeric nucleic acid multimer creation, and/or a combination of
these and other methods.
The following publications describe a variety of recursive
recombination procedures and/or methods which can be incorporated
into the methods of the invention: Stemmer (1999) "Molecular
breeding of viruses for targeting and other clinical properties"
Tumor Targeting 4:1-4; Ness (1999) Nature Biotechnology 17:893-896;
Chang (1999) "Evolution of a cytokine using DNA family shuffling"
Nature Biotechnology 17:793-797; Minshull (1999) "Protein evolution
by molecular breeding" Current Opinion in Chemical Biology
3:284-290; Christians (1999) "Directed evolution of thymidine
kinase for AZT phosphorylation using DNA family shuffling" Nature
Biotechnology 17:259-264; Crameri (1998) "DNA shuffling of a family
of genes from diverse species accelerates directed evolution"
Nature 391:288-291; Crameri (1997) "Molecular evolution of an
arsenate detoxification pathway by DNA shuffling," Nature
Biotechnology 15:436-438; Zhang (1997) "Directed evolution of an
effective fucosidase from a galactosidase by DNA shuffling and
screening" Proc. Natl. Acad. Sci. USA 94:4504-4509; Patten et al.
(1997) "Applications of DNA Shuffling to Pharmaceuticals and
Vaccines" Current Opinion in Biotechnology 8:724-733; Crameri et
al. (1996) "Construction and evolution of antibody-phage libraries
by DNA shuffling" Nature Medicine 2:100-103; Crameri et al. (1996)
"Improved green fluorescent protein by molecular evolution using
DNA shuffling" Nature Biotechnology 14:315-319; Gates et al. (1996)
"Affinity selective isolation of ligands from peptide libraries
through display on a lac repressor `headpiece dimer`" Journal of
Molecular Biology 255:373-386; Stemmer (1996) "Sexual PCR and
Assembly PCR" In: The Encyclopedia of Molecular Biology. VCH
Publishers, New York. pp. 447-457; Crameri and Stemmer (1995)
"Combinatorial multiple cassette mutagenesis creates all the
permutations of mutant and wildtype cassettes" BioTechniques
18:194-195; Stemmer et al. (1995) "Single-step assembly of a gene
and entire plasmid form large numbers of oligodeoxyribonucleotides"
Gene, 164:49-53; Stemmer (1995) "The Evolution of Molecular
Computation" Science 270: 1510; Stemmer (1995) "Searching Sequence
Space" Bio/Technology 13:549-553; Stemmer (1994) "Rapid evolution
of a protein in vitro by DNA shuffling" Nature 370:389-391; and
Stemmer (1994) "DNA shuffling by random fragmentation and
reassembly: In vitro recombination for molecular evolution." Proc.
Natl. Acad. Sci. USA 91:10747-10751.
Mutational methods of generating diversity include, for example,
site-directed mutagenesis (Ling et al. (1997) "Approaches to DNA
mutagenesis: an overview" Anal Biochem. 254(2): 157-178; Dale et
al. (1996) "Oligonucleotide-directed random mutagenesis using the
phosphorothioate method" Methods Mol. Biol. 57:369-374; Smith
(1985) "In vitro mutagenesis" Ann. Rev. Genet. 19:423-462; Botstein
& Shortle (1985) "Strategies and applications of in vitro
mutagenesis" Science 229:1193-1201; Carter (1986) "Site-directed
mutagenesis" Biochem. J. 237:1-7; and Kunkel (1987) "The efficiency
of oligonucleotide directed mutagenesis" in Nucleic Acids &
Molecular Biology (Eckstein, F. and Lilley, D. M. J. eds., Springer
Verlag, Berlin)); mutagenesis using uracil containing templates
(Kunkel (1985) "Rapid and efficient site-specific mutagenesis
without phenotypic selection" Proc. Natl. Acad. Sci. USA
82:488-492; Kunkel et al. (1987) "Rapid and efficient site-specific
mutagenesis without phenotypic selection" Methods in Enzymol. 154,
367-382; and Bass et al. (1988) "Mutant Trp repressors with new
DNA-binding specificities" Science 242:240-245);
oligonucleotide-directed mutagenesis (Methods in Enzymol. 100:
468-500 (1983); Methods in Enzymol. 154: 329-350 (1987); Zoller
& Smith (1982) "Oligonucleotide-directed mutagenesis using
M13-derived vectors: an efficient and general procedure for the
production of point mutations in any DNA fragment" Nucleic Acids
Res. 10:6487-6500; Zoller & Smith (1983)
"Oligonucleotide-directed mutagenesis of DNA fragments cloned into
M13 vectors" Methods in Enzymol. 100:468-500; and Zoller &
Smith (1987) "Oligonucleotide-directed mutagenesis: a simple method
using two oligonucleotide primers and a single-stranded DNA
template" Methods in Enzymol. 154:329-350);
phosphorothioate-modified DNA mutagenesis (Taylor et al. (1985)
"The use of phosphorothioate-modified DNA in restriction enzyme
reactions to prepare nicked DNA" Nucl. Acids Res. 13: 8749-8764;
Taylor et al. (1985) "The rapid generation of
oligonucleotide-directed mutations at high frequency using
phosphorothioate-modified DNA" Nucl. Acids Res. 13: 8765-8787
(1985); Nakamaye (1986) "Inhibition of restriction endonuclease Nci
I cleavage by phosphorothioate groups and its application to
oligonucleotide-directed mutagenesis" Nucl. Acids Res. 14:
9679-9698; Sayers et al. (1988) "Y-T Exonucleases in
phosphorothioate-based oligonucleotide-directed mutagenesis" Nucl.
Acids Res. 16:791-802; and Sayers et al. (1988) "Strand specific
cleavage of phosphorothioate-containing DNA by reaction with
restriction endonucleases in the presence of ethidium bromide"
Nucl. Acids Res. 16: 803-814); mutagenesis using gapped duplex DNA
(Kramer et al. (1984) "The gapped duplex DNA approach to
oligonucleotide-directed mutation construction" Nucl. Acids Res.
12: 9441-9456; Kramer & Fritz (1987) Methods in Enzymol.
"Oligonucleotide-directed construction of mutations via gapped
duplex DNA" 154:350-367; Kramer et al. (1988) "Improved enzymatic
in vitro reactions in the gapped duplex DNA approach to
oligonucleotide-directed construction of mutations" Nucl. Acids
Res. 16: 7207; and Fritz et al. (1988) "Oligonucleotide-directed
construction of mutations: a gapped duplex DNA procedure without
enzymatic reactions in vitro" Nucl. Acids Res. 16: 6987-6999).
Additional protocols used in the methods of the invention include
point mismatch repair (Kramer (1984) "Point Mismatch Repair" Cell
38:879-887), mutagenesis using repair-deficient host strains
(Carter et al. (1985) "Improved oligonucleotide site-directed
mutagenesis using M13 vectors" Nucl. Acids Res. 13: 4431-4443; and
Carter (1987) "Improved oligonucleotide-directed mutagenesis using
M13 vectors" Methods in Enzymol. 154: 382-403), deletion
mutagenesis (Eghtedarzadeh (1986) "Use of oligonucleotides to
generate large deletions" Nucl. Acids Res. 14: 5115),
restriction-selection and restriction-selection and
restriction-purification (Wells et al. (1986) "Importance of
hydrogen-bond formation in stabilizing the transition state of
subtilisin" Phil. Trans. R. Soc. Lond. A 317: 415-423), mutagenesis
by total gene synthesis (Nambiar et al. (1984) "Total synthesis and
cloning of a gene coding for the ribonuclease S protein" Science
223: 1299-1301; Sakamar and Khorana (1988) "Total synthesis and
expression of a gene for the a-subunit of bovine rod outer segment
guanine nucleotide-binding protein (transducin)" Nucl. Acids Res.
14: 6361-6372; Wells et al. (1985) "Cassette mutagenesis: an
efficient method for generation of multiple mutations at defined
sites" Gene 34:315-323; and Grundstrom et al. (1985)
"Oligonucleotide-directed mutagenesis by microscale `shot-gun` gene
synthesis" Nucl. Acids Res. 13: 3305-3316), double-strand break
repair (Mandecki (1986); Arnold (1993) "Protein engineering for
unusual environments" Current Opinion in Biotechnology 4:450-455.
"Oligonucleotide-directed double-strand break repair in plasmids of
Escherichia coli: a method for site-specific mutagenesis" Proc.
Natl. Acad. Sci. USA 83:7177-7181).
Additional details or alternative protocols on many of the above
methods can be found in Methods in Enzymology Volume 154, which
also describes useful controls for trouble-shooting problems with
various mutagenesis methods. See also U.S. Pat. No. 5,605,793 to
Stemmer (Feb. 25, 1997), "Methods for In Vitro Recombination;" U.S.
Pat. No. 5,811,238 to Stemmer et al. (Sep. 22, 1998) "Methods for
Generating Polynucleotides having Desired Characteristics by
Iterative Selection and Recombination;" U.S. Pat. No. 5,830,721 to
Stemmer et al. (Nov. 3, 1998), "DNA Mutagenesis by Random
Fragmentation and Reassembly;" U.S. Pat. No. 5,834,252 to Stemmer,
et al. (Nov. 10, 1998) "End-Complementary Polymerase Reaction;"
U.S. Pat. No. 5,837,458 to Minshull, et al. (Nov. 17, 1998),
"Methods and Compositions for Cellular and Metabolic Engineering;"
WO 95/22625, Stemmer and Crameri, "Mutagenesis by Random
Fragmentation and Reassembly;" WO 96/33207 by Stemmer and Lipschutz
"End Complementary Polymerase Chain Reaction;" WO 97/20078 by
Stemmer and Crameri "Methods for Generating Polynucleotides having
Desired Characteristics by Iterative Selection and Recombination;"
WO 97/35966 by Minshull and Stemmer, "Methods and Compositions for
Cellular and Metabolic Engineering;" WO 99/41402 by Punnonen et al.
"Targeting of Genetic Vaccine Vectors;" WO 99/41383 by Punnonen et
al. "Antigen Library ImLmunization;" WO 99/41369 by Punnonen et al.
"Genetic Vaccine Vector Engineering;" WO 99/41368 by Punnonen et
al. "Optimization of Immunomodulatory Properties of Genetic
Vaccines;" EP 752008 by Stemmer and Crameri, "DNA Mutagenesis by
Random Fragmentation and Reassembly;" EP 0932670 by Stemmer
"Evolving Cellular DNA Uptake by Recursive Sequence Recombination;"
WO 99/23107 by Stemmer et al., "Modification of Virus Tropism and
Host Range by Viral Genome Shuffling;" WO 99/21979 by Apt et al.,
"Human Papillomavirus Vectors;" WO 98/31837 by del Cardayre et al.
"Evolution of Whole Cells and Organisms by Recursive Sequence
Recombination;" WO 98/27230 by Patten and Stemmer, "Methods and
Compositions for Polypeptide Engineering;" WO 98/27230 by Stemmer
et al., "Methods for Optimization of Gene Therapy by Recursive
Sequence Shuffling and Selection," WO 00/00632, "Methods for
Generating Highly Diverse Libraries," WO 00/09679, "Methods for
Obtaining in Vitro Recombined Polynucleotide Sequence Banks and
Resulting Sequences," WO 98/42832 by Arnold et al., "Recombination
of Polynucleotide Sequences Using Random or Defined Primers," WO
99/29902 by Arnold et al., "Method for Creating Polynucleotide and
Polypeptide Sequences," WO 98/41653 by Vind, "An in Vitro Method
for Construction of a DNA Library," WO 98/41622 by Borchert et al.,
"Method for Constructing a Library Using DNA Shuffling," and WO
98/42727 by Pati and Zarling, "Sequence Alterations using
Homologous Recombination."
U.S. applications provide additional details or alternative
protocols regarding various diversity generating methods, including
"SHUFFLING OF CODON ALTERED GENES" by Patten et al. filed Sep. 28,
1999, (U.S. Ser. No. 09/407,800); "EVOLUTION OF WHOLE CELLS AND
ORGANISMS BY RECURSIVE SEQUENCE RECOMBINATION" by del Cardayre et
al., filed Jul. 15, 1998 (U.S. Ser. No. 09/166,188), and Jul. 15,
1999 (U.S. Ser. No. 09/354,922); "OLIGONUCLEOTIDE MEDIATED NUCLEIC
ACID RECOMBINATION" by Crameri et al., filed Sep. 28, 1999 (U.S.
Ser. No. 09/408,392), and "OLIGONUCLEOTIDE MEDIATED NUCLEIC ACID
RECOMBINATION" by Crameri et al., filed Jan. 18, 2000
(PCT/US00/01203); "USE OF CODON-VARIED OLIGONUCLEOTIDE SYNTHESIS
FOR SYNTHETIC SHUFFLING" by Welch et al., filed Sep. 28, 1999 (U.S.
Ser. No. 09/408,393); "METHODS FOR MAKING CHARACTER STRINGS,
POLYNUCLEOTIDES & POLYPEPTIDES HAVING DESIRED CHARACTERISTICS"
by Selifonov et al., filed Jan. 18, 2000, (PCT/US00/01202) and,
e.g. "METHODS FOR MAKING CHARACTER STRINGS, POLYNUCLEOTIDES &
POLYPEPTIDES HAVING DESIRED CHARACTERISTICS" by Selifonov et al.,
filed Jul. 18, 2000 (U.S. Ser. No. 09/618,579); "METHODS OF
POPULATING DATA STRUCTURES FOR USE IN EVOLUTIONARY SIMULATIONS" by
Selifonov and Stemmer, filed Jan. 18, 2000 (PCT/US00/01138); and
"SINGLE-STRANDED NUCLEIC ACID TEMPLATE-MEDIATED RECOMBINATION AND
NUCLEIC ACID FRAGMENT ISOLATION" by Affholter, filed Sep. 6, 2000
(U.S. Ser. No. 09/656,549).
Non-stochastic, or "directed evolution," methods include, e.g.,
gene site saturation mutagenesis (GSSM), synthetic ligation
reassembly (SLR), or a combination thereof are used to modify the
nucleic acids of the invention to generate phytases with new or
altered properties (e.g., activity under highly acidic or alkaline
conditions, high or low temperatures, and the like). Polypeptides
encoded by the modified nucleic acids can be screened for an
activity before testing for a phytase or other activity. Any
testing modality or protocol can be used, e.g., using a capillary
array platform. See, e.g., U.S. Pat. Nos. 6,361,974; 6,280,926;
5,939,250.
Saturation Mutagenesis, or GSSM
The invention also provides methods for making enzyme using Gene
Site Saturation mutagenesis, or, GSSM, as described herein, and
also in U.S. Pat. Nos. 6,171,820 and 6,579,258.
In one aspect, codon primers containing a degenerate N,N,G/T
sequence are used to introduce point mutations into a
polynucleotide, e.g., a phytase enzyme or an antibody of the
invention, so as to generate a set of progeny polypeptides in which
a full range of single amino acid substitutions is represented at
each amino acid position, e.g., an amino acid residue in an enzyme
active site or ligand binding site targeted to be modified. These
oligonucleotides can comprise a contiguous first homologous
sequence, a degenerate N,N,G/T sequence, and, optionally, a second
homologous sequence. The downstream progeny translational products
from the use of such oligonucleotides include all possible amino
acid changes at each amino acid site along the polypeptide, because
the degeneracy of the N,N,G/T sequence includes codons for all 20
amino acids. In one aspect, one such degenerate oligonucleotide
(comprising, e.g., one degenerate N,N,G/T cassette) is used for
subjecting each original codon in a parental polynucleotide
template to a full range of codon substitutions. In another aspect,
at least two degenerate cassettes are used--either in the same
oligonucleotide or not, for subjecting at least two original codons
in a parental polynucleotide template to a full range of codon
substitutions. For example, more than one N,N,G/T sequence can be
contained in one oligonucleotide to introduce amino acid mutations
at more than one site. This plurality of N,N,G/T sequences can be
directly contiguous, or separated by one or more additional
nucleotide sequence(s). In another aspect, oligonucleotides
serviceable for introducing additions and deletions can be used
either alone or in combination with the codons containing an
N,N,G/T sequence, to introduce any combination or permutation of
amino acid additions, deletions, and/or substitutions.
In one aspect, simultaneous mutagenesis of two or more contiguous
amino acid positions is done using an oligonucleotide that contains
contiguous N,N,G/T triplets, i.e. a degenerate (N,N,G/T)n sequence.
In another aspect, degenerate cassettes having less degeneracy than
the N,N,G/T sequence are used. For example, it may be desirable in
some instances to use (e.g. in an oligonucleotide) a degenerate
triplet sequence comprising only one N, where said N can be in the
first second or third position of the triplet. Any other bases
including any combinations and permutations thereof can be used in
the remaining two positions of the triplet. Alternatively, it may
be desirable in some instances to use (e.g. in an oligo) a
degenerate N,N,N triplet sequence.
In one aspect, use of degenerate triplets (e.g., N,N,G/T triplets)
allows for systematic and easy generation of a full range of
possible natural amino acids (for a total of 20 amino acids) into
each and every amino acid position in a polypeptide (in alternative
aspects, the methods also include generation of less than all
possible substitutions per amino acid residue, or codon, position).
For example, for a 100 amino acid polypeptide, 2000 distinct
species (i.e. 20 possible amino acids per position X 100 amino acid
positions) can be generated. Through the use of an oligonucleotide
or set of oligonucleotides containing a degenerate N,N,G/T triplet,
32 individual sequences can code for all 20 possible natural amino
acids. Thus, in a reaction vessel in which a parental
polynucleotide sequence is subjected to saturation mutagenesis
using at least one such oligonucleotide, there are generated 32
distinct progeny polynucleotides encoding 20 distinct polypeptides.
In contrast, the use of a non-degenerate oligonucleotide in
site-directed mutagenesis leads to only one progeny polypeptide
product per reaction vessel. Nondegenerate oligonucleotides can
optionally be used in combination with degenerate primers
disclosed; for example, nondegenerate oligonucleotides can be used
to generate specific point mutations in a working polynucleotide.
This provides one means to generate specific silent point
mutations, point mutations leading to corresponding amino acid
changes, and point mutations that cause the generation of stop
codons and the corresponding expression of polypeptide
fragments.
In one aspect, each saturation mutagenesis reaction vessel contains
polynucleotides encoding at least 20 progeny polypeptide (e.g.,
phytase enzymes) molecules such that all 20 natural amino acids are
represented at the one specific amino acid position corresponding
to the codon position mutagenized in the parental polynucleotide
(other aspects use less than all 20 natural combinations). The
32-fold degenerate progeny polypeptides generated from each
saturation mutagenesis reaction vessel can be subjected to clonal
amplification (e.g. cloned into a suitable host, e.g., E. coli
host, using, e.g., an expression vector) and subjected to
expression screening. When an individual progeny polypeptide is
identified by screening to display a favorable change in property
(when compared to the parental polypeptide, such as increased
glucan hydrolysis activity under alkaline or acidic conditions), it
can be sequenced to identify the correspondingly favorable amino
acid substitution contained therein.
In one aspect, upon mutagenizing each and every amino acid position
in a parental polypeptide using saturation mutagenesis as disclosed
herein, favorable amino acid changes may be identified at more than
one amino acid position. One or more new progeny molecules can be
generated that contain a combination of all or part of these
favorable amino acid substitutions. For example, if 2 specific
favorable amino acid changes are identified in each of 3 amino acid
positions in a polypeptide, the permutations include 3
possibilities at each position (no change from the original amino
acid, and each of two favorable changes) and 3 positions. Thus,
there are 3.times.3.times.3 or 27 total possibilities, including 7
that were previously examined--6 single point mutations (i.e. 2 at
each of three positions) and no change at any position.
In yet another aspect, site-saturation mutagenesis can be used
together with shuffling, chimerization, recombination and other
mutagenizing processes, along with screening. This invention
provides for the use of any mutagenizing process(es), including
saturation mutagenesis, in an iterative manner. In one
exemplification, the iterative use of any mutagenizing process(es)
is used in combination with screening.
The invention also provides for the use of proprietary codon
primers (containing a degenerate N,N,N sequence) to introduce point
mutations into a polynucleotide, so as to generate a set of progeny
polypeptides in which a full range of single amino acid
substitutions is represented at each amino acid position (Gene Site
Saturation Mutagenesis (GSSM)). The oligos used are comprised
contiguously of a first homologous sequence, a degenerate N,N,N
sequence and in one aspect but not necessarily a second homologous
sequence. The downstream progeny translational products from the
use of such oligos include all possible amino acid changes at each
amino acid site along the polypeptide, because the degeneracy of
the N,N,N sequence includes codons for all 20 amino acids.
In one aspect, one such degenerate oligo (comprising one degenerate
N,N,N cassette) is used for subjecting each original codon in a
parental polynucleotide template to a full range of codon
substitutions. In another aspect, at least two degenerate N,N,N
cassettes are used--either in the same oligo or not, for subjecting
at least two original codons in a parental polynucleotide template
to a full range of codon substitutions. Thus, more than one N,N,N
sequence can be contained in one oligo to introduce amino acid
mutations at more than one site. This plurality of N,N,N sequences
can be directly contiguous, or separated by one or more additional
nucleotide sequence(s). In another aspect, oligos serviceable for
introducing additions and deletions can be used either alone or in
combination with the codons containing an N,N,N sequence, to
introduce any combination or permutation of amino acid additions,
deletions and/or substitutions.
In a particular exemplification, it is possible to simultaneously
mutagenize two or more contiguous amino acid positions using an
oligo that contains contiguous N,N,N triplets, i.e. a degenerate
(N,N,N).sub.n sequence.
In another aspect, the present invention provides for the use of
degenerate cassettes having less degeneracy than the N,N,N
sequence. For example, it may be desirable in some instances to use
(e.g. in an oligo) a degenerate triplet sequence comprising only
one N, where the N can be in the first second or third position of
the triplet. Any other bases including any combinations and
permutations thereof can be used in the remaining two positions of
the triplet. Alternatively, it may be desirable in some instances
to use (e.g., in an oligo) a degenerate N,N,N triplet sequence,
N,N,G/T, or an N,N, G/C triplet sequence.
It is appreciated, however, that the use of a degenerate triplet
(such as N,N,G/T or an N,N, G/C triplet sequence) as disclosed in
the instant invention is advantageous for several reasons. In one
aspect, this invention provides a means to systematically and
fairly easily generate the substitution of the full range of
possible amino acids (for a total of 20 amino acids) into each and
every amino acid position in a polypeptide. Thus, for a 100 amino
acid polypeptide, the invention provides a way to systematically
and fairly easily generate 2000 distinct species (i.e., 20 possible
amino acids per position times 100 amino acid positions). It is
appreciated that there is provided, through the use of an oligo
containing a degenerate N,N,G/T or an N,N, G/C triplet sequence, 32
individual sequences that code for 20 possible amino acids. Thus,
in a reaction vessel in which a parental polynucleotide sequence is
subjected to saturation mutagenesis using one such oligo, there are
generated 32 distinct progeny polynucleotides encoding 20 distinct
polypeptides. In contrast, the use of a non-degenerate oligo in
site-directed mutagenesis leads to only one progeny polypeptide
product per reaction vessel.
This invention also provides for the use of nondegenerate oligos,
which can optionally be used in combination with degenerate primers
disclosed. It is appreciated that in some situations, it is
advantageous to use nondegenerate oligos to generate specific point
mutations in a working polynucleotide. This provides a means to
generate specific silent point mutations, point mutations leading
to corresponding amino acid changes and point mutations that cause
the generation of stop codons and the corresponding expression of
polypeptide fragments.
Thus, in one aspect of this invention, each saturation mutagenesis
reaction vessel contains polynucleotides encoding at least 20
progeny polypeptide molecules such that all 20 amino acids are
represented at the one specific amino acid position corresponding
to the codon position mutagenized in the parental polynucleotide.
The 32-fold degenerate progeny polypeptides generated from each
saturation mutagenesis reaction vessel can be subjected to clonal
amplification (e.g., cloned into a suitable E. coli host using an
expression vector) and subjected to expression screening. When an
individual progeny polypeptide is identified by screening to
display a favorable change in property (when compared to the
parental polypeptide), it can be sequenced to identify the
correspondingly favorable amino acid substitution contained
therein.
It is appreciated that upon mutagenizing each and every amino acid
position in a parental polypeptide using saturation mutagenesis as
disclosed herein, favorable amino acid changes may be identified at
more than one amino acid position. One or more new progeny
molecules can be generated that contain a combination of all or
part of these favorable amino acid substitutions. For example, if 2
specific favorable amino acid changes are identified in each of 3
amino acid positions in a polypeptide, the permutations include 3
possibilities at each position (no change from the original amino
acid and each of two favorable changes) and 3 positions. Thus,
there are 3.times.3.times.3 or 27 total possibilities, including 7
that were previously examined--6 single point mutations (i.e., 2 at
each of three positions) and no change at any position.
Thus, in a non-limiting exemplification, this invention provides
for the use of saturation mutagenesis in combination with
additional mutagenization processes, such as process where two or
more related polynucleotides are introduced into a suitable host
cell such that a hybrid polynucleotide is generated by
recombination and reductive reassortment.
In addition to performing mutagenesis along the entire sequence of
a gene, the instant invention provides that mutagenesis can be use
to replace each of any number of bases in a polynucleotide
sequence, wherein the number of bases to be mutagenized is in one
aspect every integer from 15 to 100,000. Thus, instead of
mutagenizing every position along a molecule, one can subject every
or a discrete number of bases (in one aspect a subset totaling from
15 to 100,000) to mutagenesis. In one aspect, a separate nucleotide
is used for mutagenizing each position or group of positions along
a polynucleotide sequence. A group of 3 positions to be mutagenized
may be a codon. The mutations can be introduced using a mutagenic
primer, containing a heterologous cassette, also referred to as a
mutagenic cassette. Exemplary cassettes can have from 1 to 500
bases. Each nucleotide position in such heterologous cassettes be
N, A, C, G, T, A/C, A/G, A/T, C/G, CT, G/T, C/G/T, A/G/T, A/C/T,
A/C/G, or E, where E is any base that is not A, C, G, or T (E can
be referred to as a designer oligo).
In a general sense, saturation mutagenesis is comprised of
mutagenizing a complete set of mutagenic cassettes (wherein each
cassette is in one aspect about 1-500 bases in length) in defined
polynucleotide sequence to be mutagenized (wherein the sequence to
be mutagenized is in one aspect from about 15 to 100,000 bases in
length). Thus, a group of mutations (ranging from 1 to 100
mutations) is introduced into each cassette to be mutagenized. A
grouping of mutations to be introduced into one cassette can be
different or the same from a second grouping of mutations to be
introduced into a second cassette during the application of one
round of saturation mutagenesis. Such groupings are exemplified by
deletions, additions, groupings of particular codons and groupings
of particular nucleotide cassettes.
Defined sequences to be mutagenized include a whole gene, pathway,
cDNA, an entire open reading frame (ORF) and entire promoter,
enhancer, repressor/transactivator, origin of replication, intron,
operator, or any polynucleotide functional group. Generally, a
"defined sequences" for this purpose may be any polynucleotide that
a 15 base-polynucleotide sequence and polynucleotide sequences of
lengths between 15 bases and 15,000 bases (this invention
specifically names every integer in between). Considerations in
choosing groupings of codons include types of amino acids encoded
by a degenerate mutagenic cassette.
In one exemplification a grouping of mutations that can be
introduced into a mutagenic cassette, this invention specifically
provides for degenerate codon substitutions (using degenerate
oligos) that code for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19 and 20 amino acids at each position and a
library of polypeptides encoded thereby.
Synthetic Ligation Reassembly (SLR)
The invention provides a non-stochastic gene modification system
termed "synthetic ligation reassembly," or simply "SLR," a
"directed evolution process," to generate polypeptides, e.g.,
phytase enzymes or antibodies of the invention, with new or altered
properties. SLR is a method of ligating oligonucleotide fragments
together non-stochastically. This method differs from stochastic
oligonucleotide shuffling in that the nucleic acid building blocks
are not shuffled, concatenated or chimerized randomly, but rather
are assembled non-stochastically. See, e.g., U.S. Pat. Nos.
6,773,900; 6,740,506; 6,713,282; 6,635,449; 6,605,449;
6,537,776.
In one aspect, SLR comprises the following steps: (a) providing a
template polynucleotide, wherein the template polynucleotide
comprises sequence encoding a homologous gene; (b) providing a
plurality of building block polynucleotides, wherein the building
block polynucleotides are designed to cross-over reassemble with
the template polynucleotide at a predetermined sequence, and a
building block polynucleotide comprises a sequence that is a
variant of the homologous gene and a sequence homologous to the
template polynucleotide flanking the variant sequence; (c)
combining a building block polynucleotide with a template
polynucleotide such that the building block polynucleotide
cross-over reassembles with the template polynucleotide to generate
polynucleotides comprising homologous gene sequence variations.
SLR does not depend on the presence of high levels of homology
between polynucleotides to be rearranged. Thus, this method can be
used to non-stochastically generate libraries (or sets) of progeny
molecules comprising over 10.sup.100 different chimeras. SLR can be
used to generate libraries comprising over 10.sup.1000 different
progeny chimeras. Thus, aspects of the present invention include
non-stochastic methods of producing a set of finalized chimeric
nucleic acid molecule shaving an overall assembly order that is
chosen by design. This method includes the steps of generating by
design a plurality of specific nucleic acid building blocks having
serviceable mutually compatible ligatable ends, and assembling
these nucleic acid building blocks, such that a designed overall
assembly order is achieved.
The mutually compatible ligatable ends of the nucleic acid building
blocks to be assembled are considered to be "serviceable" for this
type of ordered assembly if they enable the building blocks to be
coupled in predetermined orders. Thus the overall assembly order in
which the nucleic acid building blocks can be coupled is specified
by the design of the ligatable ends. If more than one assembly step
is to be used, then the overall assembly order in which the nucleic
acid building blocks can be coupled is also specified by the
sequential order of the assembly step(s). In one aspect, the
annealed building pieces are treated with an enzyme, such as a
ligase (e.g. T4 DNA ligase), to achieve covalent bonding of the
building pieces. In one aspect, a non-stochastic method termed
synthetic ligation reassembly (SLR), that is somewhat related to
stochastic shuffling, save that the nucleic acid building blocks
are not shuffled or concatenated or chimerized randomly, but rather
are assembled non-stochastically can be used to create
variants.
The SLR method does not depend on the presence of a high level of
homology between polynucleotides to be shuffled. The invention can
be used to non-stochastically generate libraries (or sets) of
progeny molecules comprising over 10.sup.100 different chimeras.
Conceivably, SLR can even be used to generate libraries comprising
over 10.sup.1000 different progeny chimeras.
Thus, in one aspect, the invention provides a non-stochastic method
of producing a set of finalized chimeric nucleic acid molecules
having an overall assembly order that is chosen by design, which
method is comprises the steps of generating by design a plurality
of specific nucleic acid building blocks having serviceable
mutually compatible ligatable ends, and assembling these nucleic
acid building blocks, such that a designed overall assembly order
is achieved.
The mutually compatible ligatable ends of the nucleic acid building
blocks to be assembled are considered to be "serviceable" for this
type of ordered assembly if they enable the building blocks to be
coupled in predetermined orders. Thus, in one aspect, the overall
assembly order in which the nucleic acid building blocks can be
coupled is specified by the design of the ligatable ends and, if
more than one assembly step is to be used, then the overall
assembly order in which the nucleic acid building blocks can be
coupled is also specified by the sequential order of the assembly
step(s). In one aspect of the invention, the annealed building
pieces are treated with an enzyme, such as a ligase (e.g., T4 DNA
ligase) to achieve covalent bonding of the building pieces.
In a another aspect, the design of nucleic acid building blocks is
obtained upon analysis of the sequences of a set of progenitor
nucleic acid templates that serve as a basis for producing a
progeny set of finalized chimeric nucleic acid molecules. These
progenitor nucleic acid templates thus serve as a source of
sequence information that aids in the design of the nucleic acid
building blocks that are to be mutagenized, i.e. chimerized or
shuffled.
In one exemplification, the invention provides for the
chimerization of a family of related genes and their encoded family
of related products. In a particular exemplification, the encoded
products are enzymes. Enzymes and polypeptides for use in the
invention can be mutagenized in accordance with the methods
described herein.
Thus according to one aspect of the invention, the sequences of a
plurality of progenitor nucleic acid templates are aligned in order
to select one or more demarcation points, which demarcation points
can be located at an area of homology. The demarcation points can
be used to delineate the boundaries of nucleic acid building blocks
to be generated. Thus, the demarcation points identified and
selected in the progenitor molecules serve as potential
chimerization points in the assembly of the progeny molecules.
Typically a serviceable demarcation point is an area of homology
(comprised of at least one homologous nucleotide base) shared by at
least two progenitor templates, but the demarcation point can be an
area of homology that is shared by at least half of the progenitor
templates, at least two thirds of the progenitor templates, at
least three fourths of the progenitor templates, or almost all of
the progenitor templates. In one aspect, a serviceable demarcation
point is an area of homology that is shared by all of the
progenitor templates.
In one aspect, the ligation reassembly process is performed
exhaustively in order to generate an exhaustive library. In other
words, all possible ordered combinations of the nucleic acid
building blocks are represented in the set of finalized chimeric
nucleic acid molecules. At the same time, the assembly order (i.e.
the order of assembly of each building block in the 5' to 3
sequence of each finalized chimeric nucleic acid) in each
combination is by design (or non-stochastic). Because of the
non-stochastic nature of the method, the possibility of unwanted
side products is greatly reduced.
In another aspect, the method provides that, the ligation
reassembly process is performed systematically, for example in
order to generate a systematically compartmentalized library, with
compartments that can be screened systematically, e.g., one by one.
In other words the invention provides that, through the selective
and judicious use of specific nucleic acid building blocks, coupled
with the selective and judicious use of sequentially stepped
assembly reactions, an experimental design can be achieved where
specific sets of progeny products are made in each of several
reaction vessels. This allows a systematic examination and
screening procedure to be performed. Thus, it allows a potentially
very large number of progeny molecules to be examined
systematically in smaller groups.
Because of its ability to perform chimerizations in a manner that
is highly flexible yet exhaustive and systematic as well,
particularly when there is a low level of homology among the
progenitor molecules, the instant invention provides for the
generation of a library (or set) comprised of a large number of
progeny molecules. Because of the non-stochastic nature of the
instant ligation reassembly invention, the progeny molecules
generated can comprise a library of finalized chimeric nucleic acid
molecules having an overall assembly order that is chosen by
design. In a particularly aspect, such a generated library is
comprised of greater than 10.sup.3 to greater than 10.sup.1000
different progeny molecular species.
In one aspect, a set of finalized chimeric nucleic acid molecules,
produced as described is comprised of a polynucleotide encoding a
polypeptide. According to one aspect, this polynucleotide is a
gene, which may be a man-made gene. According to another aspect,
this polynucleotide is a gene pathway, which may be a man-made gene
pathway. The invention provides that one or more man-made genes
generated by the invention may be incorporated into a man-made gene
pathway, such as pathway operable in a eukaryotic organism
(including a plant).
In another exemplification, the synthetic nature of the step in
which the building blocks are generated allows the design and
introduction of nucleotides (e.g., one or more nucleotides, which
may be, for example, codons or introns or regulatory sequences)
that can later be optionally removed in an in vitro process (e.g.,
by mutagenesis) or in an in vivo process (e.g., by utilizing the
gene splicing ability of a host organism). It is appreciated that
in many instances the introduction of these nucleotides may also be
desirable for many other reasons in addition to the potential
benefit of creating a serviceable demarcation point.
Thus, according to another aspect, the invention provides that a
nucleic acid building block can be used to introduce an intron.
Thus, the invention provides that functional introns may be
introduced into a man-made gene of the invention. The invention
also provides that functional introns may be introduced into a
man-made gene pathway of the invention. Accordingly, the invention
provides for the generation of a chimeric polynucleotide that is a
man-made gene containing one (or more) artificially introduced
intron(s).
Accordingly, the invention also provides for the generation of a
chimeric polynucleotide that is a man-made gene pathway containing
one (or more) artificially introduced intron(s). In one aspect, the
artificially introduced intron(s) are functional in one or more
host cells for gene splicing much in the way that
naturally-occurring introns serve functionally in gene splicing.
The invention provides a process of producing man-made
intron-containing polynucleotides to be introduced into host
organisms for recombination and/or splicing.
A man-made gene produced using the invention can also serve as a
substrate for recombination with another nucleic acid. Likewise, a
man-made gene pathway produced using the invention can also serve
as a substrate for recombination with another nucleic acid. In one
aspect, the recombination is facilitated by, or occurs at, areas of
homology between the man-made intron-containing gene and a nucleic
acid with serves as a recombination partner. In one aspect, the
recombination partner may also be a nucleic acid generated by the
invention, including a man-made gene or a man-made gene pathway.
Recombination may be facilitated by or may occur at areas of
homology that exist at the one (or more) artificially introduced
intron(s) in the man-made gene.
The synthetic ligation reassembly method of the invention utilizes
a plurality of nucleic acid building blocks, each of which can have
two ligatable ends. The two ligatable ends on each nucleic acid
building block may be two blunt ends (i.e. each having an overhang
of zero nucleotides), or one blunt end and one overhang, or two
overhangs.
A useful overhang for this purpose may be a 3' overhang or a 5'
overhang. Thus, a nucleic acid building block may have a 3'
overhang or alternatively a 5' overhang or alternatively two 3'
overhangs or alternatively two 5' overhangs. The overall order in
which the nucleic acid building blocks are assembled to form a
finalized chimeric nucleic acid molecule is determined by
purposeful experimental design and is not random.
In one aspect, a nucleic acid building block is generated by
chemical synthesis of two single-stranded nucleic acids (also
referred to as single-stranded oligos) and contacting them so as to
allow them to anneal to form a double-stranded nucleic acid
building block.
A double-stranded nucleic acid building block can be of variable
size. The sizes of these building blocks can be small or large.
Exemplary sizes for building block range from 1 base pair (not
including any overhangs) to 100,000 base pairs (not including any
overhangs). Other size ranges are also provided, which have lower
limits of from 1 bp to 10,000 bp (including every integer value in
between), and upper limits of from 2 bp to 100,000 bp (including
every integer value in between).
Many methods exist by which a double-stranded nucleic acid building
block can be generated that is serviceable for the invention; and
these are known in the art and can be readily performed by the
skilled artisan.
According to one aspect, a double-stranded nucleic acid building
block is generated by first generating two single stranded nucleic
acids and allowing them to anneal to form a double-stranded nucleic
acid building block. The two strands of a double-stranded nucleic
acid building block may be complementary at every nucleotide apart
from any that form an overhang; thus containing no mismatches,
apart from any overhang(s). According to another aspect, the two
strands of a double-stranded nucleic acid building block are
complementary at fewer than every nucleotide apart from any that
form an overhang. Thus, according to this aspect, a double-stranded
nucleic acid building block can be used to introduce codon
degeneracy. In one aspect, the codon degeneracy is introduced using
the site-saturation mutagenesis described herein, using one or more
N,N,G/T cassettes or alternatively using one or more N,N,N
cassettes.
The in vivo recombination method of the invention can be performed
blindly on a pool of unknown hybrids or alleles of a specific
polynucleotide or sequence. However, it is not necessary to know
the actual DNA or RNA sequence of the specific polynucleotide.
The approach of using recombination within a mixed population of
genes can be useful for the generation of any useful proteins, for
example, interleukin I, antibodies, tPA and growth hormone. This
approach may be used to generate proteins having altered
specificity or activity. The approach may also be useful for the
generation of hybrid nucleic acid sequences, for example, promoter
regions, introns, exons, enhancer sequences, 31 untranslated
regions or 51 untranslated regions of genes. Thus this approach may
be used to generate genes having increased rates of expression.
This approach may also be useful in the study of repetitive DNA
sequences. Finally, this approach may be useful to mutate ribozymes
or aptamers.
In one aspect variants of the polynucleotides and polypeptides
described herein are obtained by the use of repeated cycles of
reductive reassortment, recombination and selection which allow for
the directed molecular evolution of highly complex linear
sequences, such as DNA, RNA or proteins thorough recombination.
In vivo shuffling of molecules is useful in providing variants and
can be performed utilizing the natural property of cells to
recombine multimers. While recombination in vivo has provided the
major natural route to molecular diversity, genetic recombination
remains a relatively complex process that involves 1) the
recognition of homologies; 2) strand cleavage, strand invasion, and
metabolic steps leading to the production of recombinant chiasma;
and finally 3) the resolution of chiasma into discrete recombined
molecules. The formation of the chiasma requires the recognition of
homologous sequences.
In another aspect, the invention includes a method for producing a
hybrid polynucleotide from at least a first polynucleotide and a
second polynucleotide. The invention can be used to produce a
hybrid polynucleotide by introducing at least a first
polynucleotide and a second polynucleotide which share at least one
region of partial sequence homology (e.g., SEQ ID NO:1) into a
suitable host cell. The regions of partial sequence homology
promote processes that result in sequence reorganization producing
a hybrid polynucleotide. The term "hybrid polynucleotide", as used
herein, is any nucleotide sequence which results from the method of
the present invention and contains sequence from at least two
original polynucleotide sequences. Such hybrid polynucleotides can
result from intermolecular recombination events which promote
sequence integration between DNA molecules. In addition, such
hybrid polynucleotides can result from intramolecular reductive
reassortment processes which utilize repeated sequences to alter a
nucleotide sequence within a DNA molecule.
The invention provides methods for generating hybrid
polynucleotides which may encode biologically active hybrid
polypeptides (e.g., a hybrid phytase). In one aspect, the original
polynucleotides encode biologically active polypeptides. The method
of the invention produces new hybrid polypeptides by utilizing
cellular processes which integrate the sequence of the original
polynucleotides such that the resulting hybrid polynucleotide
encodes a polypeptide demonstrating activities derived from the
original biologically active polypeptides. For example, the
original polynucleotides may encode a particular enzyme from
different microorganisms. An enzyme encoded by a first
polynucleotide from one organism or variant may, for example,
function effectively under a particular environmental condition,
e.g., high salinity. An enzyme encoded by a second polynucleotide
from a different organism or variant may function effectively under
a different environmental condition, such as extremely high
temperatures. A hybrid polynucleotide containing sequences from the
first and second original polynucleotides may encode an enzyme
which exhibits characteristics of both enzymes encoded by the
original polynucleotides. Thus, the enzyme encoded by the hybrid
polynucleotide may function effectively under environmental
conditions shared by each of the enzymes encoded by the first and
second polynucleotides, e.g., high salinity and extreme
temperatures.
In addition to the various methods described above, various methods
are known in the art that can be used to obtain hybrid
polynucleotides with enhanced enzymatic properties. The following
examples illustrate the use of such procedures for obtaining
thermostable or thermotolerant enzymes by mutagenesis of a
polynucleotide encoding a wild-type enzyme of interest.
For example, in one aspect, the invention uses methods as described
by M. Lehmann et al. (in Biochimica et Biophysica Acta
1543:408-415, 2000) describes a "consensus approach" wherein
sequence alignment of homologous fungal phytases was used to
calculate a consensus phytase amino acid sequence. Upon
construction of the corresponding consensus gen, recombinant
expression and purification, the recombinant phytase obtained
displayed an unfolding temperature (Tm) 15-22.degree. C. higher
than that of all parent phytases used in the design. Site-directed
mutagenesis of the gene encoding the recombinant protein was used
to further increase the Tm value to 90.4.degree. C. The
thermostabilizing effect was attributed to a combination of
multiple amino acid exchanges that were distributed over the entire
sequence of the protein and mainly affected surface-exposed
residues.
In one aspect, the invention uses methods to obtaining an enzyme
with enhanced thermal properties as described by L. Jermutus et al.
(J. of Biotechnology 85:15-24, 2001). In this approach ionic
interactions and hydrogen bonds on the surface of Aspergillus
terreus phytase were first restored to correspond to those present
in the homologous, but more thermostable enzyme from A. niger. Then
entire secondary structural elements were replaced in the same
region and based on the crystal structure of A. niger phytase. The
replacement of one l-helix on the surface of A. terreus phytase by
the corresponding stretch of A niger phytase resulted in a
structure-based chimeric enzyme (fusion protein) with improved
thermostability and unaltered enzymatic activity.
In one aspect, the invention uses methods as described by L. Giver
et al. (Proc. Natl. Acad. Sci. USA 95:12809-12813, 1998), who
describes a procedure wherein six generations of random mutagenesis
introduced during mutagenic PCR of a polynucleotide encoding
Bacillus subtilis p-nitrobenzyl esterase followed by in vitro
recombination based on the method of Stemmer resulted in a
recombinant esterase with increased thermostability (greater than
14.degree. C. increase in Tm) without compromising catalytic
activity at lower temperatures.
In one aspect, the invention uses methods as described by C.
Vetriani et al. (Proc. Natl. Acad. Sci USA 95:12300-12305, 1998),
who describes a procedure by which homology-based modeling and
direct structure comparison of the hexameric glutamate
dehydrogenases from the hyperthermophiles Pyrococcus furiosus and
Thermococcus litoralis, with optimal growth temperatures of
100.degree. C. and 88.degree. C., respectively, were used to
determine key thermostabilizing features. An intersubunit ion-pair
network observed to be substantially reduced in the less stable
enzyme was altered by mutagenesis of two residues therein to
restore the interactions found in the more stable enzyme. Although
either single mutation had adverse effects on the thermostability,
with both mutations in place, a four-fold improvement of stability
at 104.degree. C. over the wild-type enzyme was observed.
In one aspect, the invention uses methods as described by A.
Tomschy et al. (Protein Science 9:1304-1311, 2000), who describes a
procedure utilizing the crystal structure of Aspergillus Niger
phytase (at 2.5 angstroms resolution) to specify all active sites
of the enzyme. A multiple amino acid sequence alignment was then
used to identify non-conserved active site residues that might
correlate with a given favorable property of interest. Using this
approach, Gln27 of A. fumigatus phytase, which differed from Leu27
of A. niger, was identified as likely to be involved in substrate
binding and/or release and responsible for the lower specific
activity of the A. fumigatus phytase (26.5 vs. 196 6 U/mg protein
at pH 5.0). Site directed mutagenesis of Gln27 of A. fumigatus
phytase to Leu increased the specific activity of the mutant enzyme
to 92.1 U/mg protein.
Transgenic Plants and Seeds
The invention provides transgenic plants and seeds comprising a
nucleic acid, a polypeptide, an expression cassette, cloning
mechanism or vector of the invention, or a transfected or
transformed cell of the invention. The invention also provides
plant products, e.g., oils, seeds, leaves, extracts and the like,
comprising a nucleic acid and/or a polypeptide of the invention.
The transgenic plant can be dicotyledonous (a dicot) or
monocotyledonous (a monocot). The invention also provides methods
of making and using these transgenic plants and seeds. The
transgenic plant or plant cell expressing a polypeptide of the
present invention may be constructed in accordance with any method
known in the art. See, for example, U.S. Pat. No. 6,309,872.
The recombinant expression, or over-expression, of the phytase
molecules of the invention may be achieved in combination with one
or more additional molecules such as, for example, other enzymes.
This approach is useful for producing combination products, such as
a plant or plant part that contains the instant phytase molecules
as well as one or more additional molecules. The phytase molecules
of this invention and the additional molecules can be used in a
combination treatment. The resulting recombinantly expressed
molecules may be used in homogenized and/or purified form or
alternatively in relatively unpurified form (e.g. as consumable
plant parts that are useful when admixed with other foodstuffs for
catalyzing the degradation of phytate).
In a particular aspect, the present invention provides for the
expression of phytase in transgenic plants or plant organs and
methods for the production thereof. DNA expression constructs are
provided for the transformation of plants with a gene encoding
phytase under the control of regulatory sequences which are capable
of directing the expression of phytase. These regulatory sequences
include sequences capable of directing transcription in plants,
either constitutively, or in stage and/or tissue specific
manners.
The manner of expression depends, in part, on the use of the plant
or parts thereof. The transgenic plants and plant organs provided
by the present invention may be applied to a variety of industrial
processes either directly, e.g. in animal feeds or alternatively,
the expressed phytase may be extracted and if desired, purified
before application. Alternatively, the recombinant host plant or
plant part may be used directly. In a particular aspect, the
present invention provides methods of catalyzing
phytate-hydrolyzing reactions using seeds containing enhanced
amounts of phytase. The method involves contacting transgenic,
non-wild type seeds, e.g., in a ground or chewed form, with
phytate-containing substrate and allowing the enzymes in the seeds
to increase the rate of reaction. By directly adding the seeds to a
phytate-containing substrate, the invention provides a solution to
the expensive and problematic process of extracting and purifying
the enzyme. In one exemplification the present invention provides
methods of treatment whereby an organism lacking a sufficient
supply of an enzyme is administered the enzyme in the form of seeds
containing enhanced amounts of the enzyme. In one aspect, the
timing of the administration of the enzyme to an organism is
coordinated with the consumption of a phytate-containing
foodstuff.
The expression of phytase in plants can be achieved by a variety of
means. Specifically, for example, technologies are available for
transforming a large number of plant species, including
dicotyledonous species (e.g. tobacco, potato, tomato, Petunia,
Brassica) and monocot species. Additionally, for example,
strategies for the expression of foreign genes in plants are
available. Additionally still, regulatory sequences from plant
genes have been identified that are serviceable for the
construction of chimeric genes that can be functionally expressed
in plants and in plant cells (e.g. Klee (1987) Ann. Rev. of Plant
Phys. 38:467-486; Clark et al. (1990) Virology December;
179(2):640-7; Smith et al. (1990) Mol. Gen. Genet. December;
224(3):477-81.
The introduction of gene constructs into plants can be achieved
using several technologies including transformation with
Agrobacterium tumefaciens or Agrobacterium rhizogenes. Non-limiting
examples of plant tissues that can be transformed thusly include
protoplasts, microspores or pollen, and explants such as leaves,
stems, roots, hypocotyls, and cotyls. Furthermore, DNA can be
introduced directly into protoplasts and plant cells or tissues by
microinjection, electroporation, particle bombardment, and direct
DNA uptake.
Proteins may be produced in plants by a variety of expression
systems. For instance, the use of a constitutive promoter such as
the 35S promoter of Cauliflower Mosaic Virus (Guilley et al., 1982)
is serviceable for the accumulation of the expressed protein in
virtually all organs of the transgenic plant. Alternatively, the
use of promoters that are highly tissue-specific and/or
stage-specific are serviceable for this invention (Higgins, 1984;
Shotwell, 1989) in order to bias expression towards desired tissues
and/or towards a desired stage of development. The invention also
uses protocols for expression in plants of phytase molecules of the
instant invention as disclosed in, for example, U.S. Pat. No.
5,770,413 (Van Ooijen et al.) and U.S. Pat. No. 5,593,963 (Van
Ooijen et al.), that teaches use of fungal phytases.
Modification of Coding Sequences and Adjacent Sequences
The transgenic expression in plants of genes derived from
heterologous sources may involve the modification of those genes to
achieve and optimize their expression in plants. In particular,
bacterial ORFs which encode separate enzymes but which are encoded
by the same transcript in the native microbe are best expressed in
plants on separate transcripts. Thus, in one aspect, to achieve
this, each microbial ORF is isolated individually and cloned within
a cassette which provides a plant promoter sequence at the 5' end
of the ORF and a plant transcriptional terminator at the 3' end of
the ORF. The isolated ORF sequence can includes the initiating ATG
codon and the terminating STOP codon but may include additional
sequence beyond the initiating ATG and the STOP codon. In addition,
the ORF may be truncated, but still retain the required activity;
for particularly long ORFs, truncated versions which retain
activity may be preferable for expression in transgenic organisms.
"Plant promoters" and "plant transcriptional terminators" that can
be used to practice this invention include any promoters and/or
transcriptional terminators which operate within plant cells. This
includes promoters and transcription terminators which may be
derived from non-plant sources such as viruses (an example is the
Cauliflower Mosaic Virus).
In some cases, modification to the ORF coding sequences and
adjacent sequence is not required. It is sufficient to isolate a
fragment containing the ORF of interest and to insert it downstream
of a plant promoter. For example, Gaffney et. al. (Science 261:
754-756 (1993)) have expressed the Pseudomonas nahG gene in
transgenic plants under the control of the CaMV 35S promoter and
the CaMV tml terminator successfully without modification of the
coding sequence and with nucleotides of the Pseudomonas gene
upstream of the ATG still attached, and nucleotides downstream of
the STOP codon still attached to the nahG ORF. Preferably as little
adjacent microbial sequence should be left attached upstream of the
ATG and downstream of the STOP codon. In practice, such
construction may depend on the availability of restriction
sites.
In other cases, the expression of genes derived from microbial
sources may provide problems in expression. These problems have
been well characterized in the art and are particularly common with
genes derived from certain microbial sources. These problems may
apply to the nucleotide sequence of this invention and the
modification of these genes can be undertaken using techniques now
well known in the art. The following problems may be
encountered:
Codon Usage
The invention provides nucleic acids having codons modified for
usage in plants; in some cases preferred codon usage in plants
differs from the preferred codon usage in certain microorganisms.
Comparison of the usage of codons within a cloned microbial ORF to
usage in plant genes (and in particular genes from the target
plant) will enable an identification of the codons within the ORF
which should preferably be changed. Typically plant evolution has
tended towards a strong preference of the nucleotides C and G in
the third base position of monocotyledons, whereas dicotyledons
often use the nucleotides A or T at this position. By modifying a
gene to incorporate preferred codon usage for a particular target
transgenic species, many of the problems described below for GC/AT
content and illegitimate splicing will be overcome.
GC/AT Content
The invention provides nucleic acids having their GC content
modified, e.g., for usage in plants; plant genes typically have a
GC content of more than 35%. ORF sequences which are rich in A and
T nucleotides can cause several problems in plants. Firstly, motifs
of ATTTA are believed to cause destabilization of messages and are
found at the 3' end of many short-lived mRNAs. Secondly, the
occurrence of polyadenylation signals such as AATAAA at
inappropriate positions within the message is believed to cause
premature truncation of transcription. In addition, monocotyledons
may recognize AT-rich sequences as splice sites (see below).
Sequences Adjacent to the Initiating Methionine
The invention provides nucleic acids having nucleotides adjacent to
the ATG modified and/or added; plants differ from microorganisms in
that their messages do not possess a defined ribosome binding site.
Rather, it is believed that ribosomes attach to the 5' end of the
message and scan for the first available ATG at which to start
translation. Nevertheless, it is believed that there is a
preference for certain nucleotides adjacent to the ATG and that
expression of microbial genes can be enhanced by the inclusion of a
eukaryotic consensus translation initiator at the ATG. Clontech
(1993/1994 catalog, page 210, incorporated herein by reference)
have suggested one sequence as a consensus translation initiator
for the expression of the E. coli uidA gene in plants. Further,
Joshi (N.A.R. 15: 6643-6653 (1987), incorporated herein by
reference) has compared many plant sequences adjacent to the ATG
and suggests another consensus sequence. In situations where
difficulties are encountered in the expression of microbial ORFs in
plants, inclusion of one of these sequences at the initiating ATG
may improve translation. In such cases the last three nucleotides
of the consensus may not be appropriate for inclusion in the
modified sequence due to their modification of the second AA
residue. In some aspects, preferred sequences adjacent to the
initiating methionine may differ between different plant species. A
survey of 14 maize genes located in the GenBank database provided
the following results:
TABLE-US-00003 Position Before the Initiating ATG in 14 Maize
Genes: -10 -9 -8 -7 -6 -5 -4 -3 -2 -1 C 3 8 4 6 2 5 6 0 10 7 T 3 0
3 4 3 2 1 1 1 0 A 2 3 1 4 3 2 3 7 2 3 G 6 3 6 0 6 5 4 6 1 5
This analysis can be done for the desired plant species into which
the nucleotide sequence is being incorporated, and the sequence
adjacent to the ATG modified to incorporate the preferred
nucleotides. Removal of Illegitimate Splice Sites
The invention provides nucleic acids having illegitimate splice
sites modified or removed or functionally "knocked out"; genes
cloned from non-plant sources and not optimized for expression in
plants may also contain motifs which may be recognized in plants as
5' or 3' splice sites, and be cleaved, thus generating truncated or
deleted messages. These sites can be removed using the techniques
well known in the art.
Techniques for the modification of coding sequences and adjacent
sequences are well known in the art. In cases where the initial
expression of a microbial ORF is low and it is deemed appropriate
to make alterations to the sequence as described above, then the
construction of synthetic genes can be accomplished according to
methods well known in the art. These are, for example, described in
the published patent disclosures EP 0 385 962 (to Monsanto), EP 0
359 472 (to Lubrizol) and WO 93/07278 (to Ciba-Geigy), all of which
are incorporated herein by reference. In most cases it is
preferable to assay the expression of gene constructions using
transient assay protocols (which are well known in the art) prior
to their transfer to transgenic plants.
Plant Promoters
The compositions of the invention may contain nucleic acid
sequences, e.g., promoters, e.g., for transformation and expression
in a plant of interest. The nucleic acid sequences may be present
in DNA constructs or expression cassettes. Nucleic acids of the
invention can be, or comprise, "expression cassettes", including
any nucleic acid molecule capable of directing expression of a
particular nucleotide sequence in an appropriate host cell
comprising a promoter operatively linked to the nucleotide sequence
of interest which is operatively linked to termination signals.
The compositions (e.g., nucleic acid sequences) of the invention
also can comprise sequences required for proper translation of the
nucleotide sequence. The coding region usually codes for a protein
of interest but may also code for a functional RNA of interest, for
example antisense RNA or a nontranslated RNA, in the sense or
antisense direction. The expression cassette comprising the
nucleotide sequence of interest may be chimeric, meaning that at
least one of its components is heterologous with respect to at
least one of its other components. The expression cassette may also
be one that is naturally occurring but has been obtained in a
recombinant form useful for heterologous expression. Typically,
however, the expression cassette is heterologous with respect to
the host, i.e., the particular DNA sequence of the expression
cassette does not occur naturally in the host cell and must have
been introduced into the host cell or an ancestor of the host cell
by a transformation event. The expression of the nucleotide
sequence in the expression cassette may be under the control of a
constitutive promoter or of an inducible promoter that initiates
transcription only when the host cell is exposed to some particular
external stimulus. Additionally, the promoter can also be specific
to a particular tissue or organ or stage of development.
The present invention encompasses the transformation of plants with
expression cassettes capable of expressing polynucleotides. The
expression cassette will include in the 5'-3' direction of
transcription, a transcriptional and translational initiation
region (i.e., a promoter) and a polynucleotide of interest. The
expression cassette may optionally comprise a transcriptional and
translational termination region (i.e. termination region)
functional in plants. In some embodiments, the expression cassette
comprises a selectable marker gene to allow for selection for
stable transformants. Expression constructs of the invention may
also comprise a leader sequence and/or a sequence allowing for
inducible expression of the polynucleotide of interest. See, Guo
et. al. (2003) Plant J. 34:383-92 and Chen et. al. (2003) Plant J.
36:731-40 for examples of sequences allowing for inducible
expression.
The regulatory sequences of the expression construct are operably
linked to the polynucleotide of interest. By "operably linked" is
intended a functional linkage between a promoter and a second
sequence wherein the promoter sequence initiates and mediates
transcription of the DNA sequence corresponding to the second
sequence. Generally, operably linked means that the nucleotide
sequences being linked are contiguous.
Any promoter capable of driving expression in the plant of interest
may be used in the practice of the invention. The promoter may be
native or analogous or foreign or heterologous to the plant host.
The terms "heterologous" and "exogenous" when used herein to refer
to a nucleic acid sequence (e.g. a DNA or RNA sequence) or a gene,
refer to a sequence that originates from a source foreign to the
particular host cell or, if from the same source, is modified from
its original form. Thus, a heterologous gene in a host cell
includes a gene that is endogenous to the particular host cell but
has been modified. The terms also include non-naturally occurring
multiple copies of a naturally occurring DNA sequence. Thus, the
terms refer to a DNA segment that is foreign or heterologous to the
cell, or homologous to the cell but in a position within the host
cell nucleic acid in which the element is not ordinarily found.
Exogenous DNA segments are expressed to yield exogenous
polypeptides. In alternative embodiments, a "homologous" nucleic
acid (e.g. DNA) sequence is a nucleic acid (e.g. DNA or RNA)
sequence naturally associated with a host cell into which it is
introduced.
The choice of promoters to be included depends upon several
factors, including, but not limited to, efficiency, selectability,
inducibility, desired expression level, and cell- or
tissue-preferential expression. It is a routine matter for one of
skill in the art to modulate the expression of a sequence by
appropriately selecting and positioning promoters and other
regulatory regions relative to that sequence.
Some suitable promoters initiate transcription only, or
predominantly, in certain cell types. Thus, as used herein a cell
type- or tissue-preferential promoter is one that drives expression
preferentially in the target tissue, but may also lead to some
expression in other cell types or tissues as well. Methods for
identifying and characterizing promoter regions in plant genomic
DNA include, for example, those described in the following
references: Jordano, et. al., Plant Cell, 1:855-866 (1989); Bustos,
et. al., Plant Cell, 1:839-854 (1989); Green, et. al., EMBO J. 7,
4035-4044 (1988); Meier, et. al., Plant Cell, 3, 309-316 (1991);
and Zhang, et. al., Plant Physiology 110: 1069-1079 (1996).
Several tissue preferred regulated genes and/or promoters have been
reported in plants. Some reported tissue preferred genes include
the genes encoding the seed storage proteins (such as napin,
cruciferin, beta-conglycinin, and phaseolin, prolamines, glutelins,
globulins, and zeins) zeins or oil body proteins (such as oleosin),
or genes involved in fatty acid biosynthesis (including acyl
carrier protein, stearoyl-ACP desaturase, and fatty acid
desaturases (fad 2-1)), and other genes expressed during embryo
development (such as Bce4, see, for example, EP 255378 and Kridl
et. al., (1991) Seed Science Research, 1:209).
Examples of tissue-specific promoters, which have been described,
include the lectin (Vodkin, Prog. Clin. Biol. Res., 138; 87 (1983);
Lindstrom et. al., (1990) Der. Genet., 11:160), corn alcohol
dehydrogenase 1 (Dennis et. al., Nucleic Acids Res., 12:3983
(1984)), corn light harvesting complex (see, e.g., Simpson, (1986)
Science, 233:34; Bansal (1992) Proc. Natl. Acad. Sci. USA 89:3654),
corn heat shock protein (see, e.g., Odell et. al., (1985) Nature,
313:810; pea small subunit RuBP carboxylase (see, e.g., Poulsen et.
al., (1986) Mol. Gen. Genet., 205:193-200; Cashmore et. al., (1983)
Gen. Eng. of Plants, Plenum Press, New York, 29-38); Ti plasmid
mannopine synthase (see, e.g., Langridge et. al., (1989) Proc.
Natl. Acad. Sci. USA, 86:3219-3223), Ti plasmid nopaline synthase
(Langridge et. al., (1989) Proc. Natl. Acad. Sci. USA,
86:3219-3223), petunia chalcone isomerase (see, e.g., vanTunen
(1988) EMBO J. 7:1257); bean glycine rich protein 1 (see, e.g.,
Keller (1989) Genes Dev. 3:1639); truncated CaMV 35s (see, e.g.,
Odell (1985) Nature 313:810); potato patatin (see, e.g., Wenzler
(1989) Plant Mol. Biol. 13:347; root cell (see, e.g., Yamamoto
(1990) Nucleic Acids Res. 18:7449); maize zein (see, e.g., Reina
(1990) Nucleic Acids Res. 18:6425; Lopes et. al. (1995) Mol. Gen.
Genet. 247: 603-613; Kriz (1987) Mol. Gen. Genet. 207:90; Wandelt
(1989) Nucleic Acids Res., 17:2354; Langridge (1983) Cell, 34:1015;
Reina (1990) Nucleic Acids Res., 18:7449), ADP-gpp promoter (see,
e.g., U.S. Pat. No. 7,102,057); globulin-1 (see, e.g., Belanger
(1991) Genetics 129:863); .alpha.-globulin (Sunilkumar, et. al.
(2002), Transgenic Res. 11:347-359); .alpha.-tubulin; cab (see,
e.g., Sullivan (1989) Mol. Gen. Genet., 215:431); PEPCase (see
e.g., Hudspeth & Grula, (1989) Plant Molec. Biol., 12:579-589);
R gene complex-associated promoters (Chandler et. al., (1989) Plant
Cell, 1:1175); pea vicilin promoter (Czako et. al., (1992) Mol.
Gen. Genet., 235:33; U.S. Pat. No. 5,625,136); GTL1 promoter
(Takaiwa et. al. (1991) Plant Mol. Biol. 16 (1), 49-58); chalcone
synthase promoters (Franken et. al., (1991) EMBO J., 10:2605); GY1
promoter (Sims & Goldburg (1989) Nuc. Acid Res. 17(11) 4368)
and the like; all of which are herein incorporated by
reference.
The invention can use fruit-preferred promoters, including any
class of fruit-preferred promoters, e.g., as expressed at or during
antithesis through fruit development, at least until the beginning
of ripening, e.g., as discussed in U.S. Pat. No. 4,943,674, the
disclosure of which is hereby incorporated by reference. The
promoter for polygalacturonase gene is active in fruit ripening.
The invention can use the polygalacturonase gene as described,
e.g., in U.S. Pat. No. 4,535,060, U.S. Pat. No. 4,769,061, U.S.
Pat. No. 4,801,590, and U.S. Pat. No. 5,107,065, which disclosures
are incorporated herein by reference.
The invention can use any tissue-preferred promoters, including
those that direct expression in leaf cells following damage to the
leaf (for example, from chewing insects), in tubers (for example,
patatin gene promoter), and in fiber cells (an example of a
developmentally-regulated fiber cell protein is E6 (John & Crow
(1992) PNAS 89:5769-5773). The E6 gene is most active in fiber,
although low levels of transcripts are found in leaf, ovule and
flower.
The invention can use promoters active in photosynthetic tissue,
e.g., in order to drive transcription in green tissues such as
leaves and stems, are suitable when they drive expression only or
predominantly in such tissues. Alternatively, the invention can use
promoters to confer expression constitutively throughout the plant,
or differentially with respect to the green tissues, or
differentially with respect to the developmental stage of the green
tissue in which expression occurs, or in response to external
stimuli.
Exemplary promoters used to practice this invention include the
ribulose-1,5-bisphosphate carboxylase (RbcS) promoters such as the
RbcS promoter from eastern larch (Larix laricina), the pine cab6
promoter (Yamamoto et. al. (1994) Plant Cell Physiol. 35:773-778),
the Cab-1 gene promoter from wheat (Fejes et. al. (1990) Plant Mol.
Biol. 15:921-932), the CAB-1 promoter from spinach (Lubberstedt et.
al. (1994) Plant Physiol. 104:997-1006), the cab1R promoter from
rice (Luan et. al. (1992) Plant Cell 4:971-981), the pyruvate
orthophosphate dikinase (PPDK) promoter from corn (Matsuoka et. al.
(1993) Proc Natl Acad Sci USA 90:9586-9590), the tobacco Lhcb1*2
promoter (Cerdan et. al. (1997) Plant Mol. Biol. 33:245-255), the
Arabidopsis thaliana SUC2 sucrose-H+ symporter promoter (Truernit
et. al. (1995) Planta 196:564-570), and thylakoid membrane protein
promoters from spinach (psaD, psaF, psaE, PC, FNR, atpC, atpD, cab,
rbcS. Other promoters that drive transcription in stems, leafs and
green tissue are described in U.S. Patent Publication No.
2007/0006346, herein incorporated by reference in its entirety.
In some embodiments, the tissue specificity of some "tissue
preferred" promoters may not be absolute and may be tested reporter
genes such as Gus or green fluorescent protein, cyan fluorescent
protein, yellow fluorescent protein or red fluorescent protein. One
can also achieve tissue preferred expression with "leaky"
expression by a combination of different tissue-preferred
promoters. Other tissue preferred promoters can be isolated by one
skilled in the art (see U.S. Pat. No. 5,589,379).
In one aspect, plant promoters which are inducible upon exposure to
plant hormones, such as auxins, are used to express the nucleic
acids of the invention. For example, the invention can use the
auxin-response elements E1 promoter fragment (AuxREs) in the
soybean (Glycine max L.) (Liu (1997) Plant Physiol. 115:397-407);
the auxin-responsive Arabidopsis GST6 promoter (also responsive to
salicylic acid and hydrogen peroxide) (Chen (1996) Plant J. 10:
955-966); the auxin-inducible parC promoter from tobacco (Sakai
(1996) 37:906-913); a plant biotin response element (Streit (1997)
Mol. Plant Microbe Interact. 10:933-937); and, the promoter
responsive to the stress hormone abscisic acid (Sheen (1996)
Science 274:1900-1902).
The nucleic acids of the invention can also be operably linked to
plant promoters which are inducible upon exposure to chemicals
reagents which can be applied to the plant, such as herbicides or
antibiotic. For example, gene expression systems that are activated
in the presence of a chemical ligand, including ethanol, such as
can be found in WO 96/27673; WO 93/01294; WO 94/03619; WO
02/061102, all of which are hereby incorporated by reference. The
maize In2-2 promoter, activated by benzenesulfonamide herbicide
safeners, can be used (De Veylder (1997) Plant Cell Physiol.
38:568-577); application of different herbicide safeners induces
distinct gene expression patterns, including expression in the
root, hydathodes, and the shoot apical meristem. Coding sequence
can be under the control of, e.g., a tetracycline-inducible
promoter, e.g., as described with transgenic tobacco plants
containing the Avena sativa L. (oat) arginine decarboxylase gene
(Masgrau (1997) Plant J. 11:465-473); estrogen, such as, the
ecdysone receptor (WO 01/52620) or, a salicylic acid-responsive
element (Stange (1997) Plant J. 11:1315-1324). Using chemically-
(e.g., hormone- or pesticide-) induced promoters, i.e., promoter
responsive to a chemical which can be applied to the transgenic
plant in the field, expression of a polypeptide of the invention
can be induced at a particular stage of development of the
plant.
Exemplary constitutive promoters which can be used to practice this
invention, and which have been described, include rice actin 1
(Wang et. al. (1992) Mol. Cell. Biol., 12:3399; U.S. Pat. No.
5,641,876); other actin isoforms (McElroy et. al. (1990) Plant Cell
2: 163-171 and McElroy et. al. (1991) Mol. Gen. Genet. 231:
150-160); CaMV 35S (Odell et. al. (1985) Nature, 313:810); CaMV 19S
(Lawton et. al. (1987) Plant Mol. Biol. 9:315-324; U.S. Pat. No.
5,639,949); nos (Ebert et. al. (1987) PNAS USA 84:5745-5749); Adh
(Walker et. al. (1987) PNAS USA 84:6624-6628), sucrose synthase
(Yang & Russell (1990) PNAS USA 87:4144-4148); and the
ubiquitin promoters (e.g. sunflower--Binet et. al. (1991) Plant
Science 79: 87-94; maize--Christensen et. al. (1989) Plant Molec.
Biol. 12: 619-632; and Arabidopsis--Callis et. al., J. Biol. Chem.
(1990) 265:12486-12493; and Norris et. al., Plant Mol. Biol. (1993)
21:895-906.
Any transcriptional terminator can be used to practice this
invention, e.g., can be used in vectors, expression cassettes and
the like. These are responsible for the termination of
transcription beyond the transgene and correct mRNA
polyadenylation. The termination region may be native with the
transcriptional initiation region, may be native with the operably
linked DNA sequence of interest, may be native with the plant host,
or may be derived from another source (i.e., foreign or
heterologous to the promoter, the DNA sequence of interest, the
plant host, or any combination thereof). Appropriate
transcriptional terminators are those that are known to function in
plants and include the CAMV 35S terminator, the tml terminator, the
nopaline synthase terminator and the pea rbcs E9 terminator. These
can be used in both monocotyledons and dicotyledons. In addition, a
gene's native transcription terminator may be used.
The invention can use any sequence to enhance gene expression from
within the transcriptional unit; and these sequences can be used in
conjunction with the genes of this invention to increase their
expression in transgenic plants. For example, various intron
sequences have been shown to enhance expression, particularly in
monocotyledonous cells. For example, the introns of the maize Adhl
gene have been found to significantly enhance the expression of the
wild-type gene under its cognate promoter when introduced into
maize cells.
A number of non-translated leader sequences derived from viruses
are also known to enhance expression, and these are particularly
effective in dicotyledonous cells. Specifically, leader sequences
from Tobacco Mosaic Virus (TMV, the "W-sequence"), Maize Chlorotic
Mottle Virus (MCMV), and Alfalfa Mosaic Virus (AMV) have been shown
to be effective in enhancing expression (e.g. Gallie et. al. Nucl.
Acids Res. 15: 8693-8711 (1987); Skuzeski et. al. Plant Molec.
Biol. 15: 65-79 (1990)).
Targeting of the Gene Product Within the Cell
Any mechanism for targeting gene products, e.g., in plants, can be
used to practice this invention, and such mechanisms are known to
exist in plants and the sequences controlling the functioning of
these mechanisms have been characterized in some detail. Sequences
have been characterized which cause the targeting of gene products
to other cell compartments. Amino terminal sequences can be
responsible for targeting a protein of interest to any cell
compartment, such as, a vacuole, mitochondrion, peroxisome, protein
bodies, endoplasmic reticulum, chloroplast, starch granule,
amyloplast, apoplast or cell wall of a plant (e.g. Unger et. al.
Plant Molec. Biol. 13: 411-418 (1989); Rogers et. al. (1985) Proc.
Natl. Acad. Sci. USA 82: 6512-651; U.S. Pat. No. 7,102,057; WO
2005/096704, all of which are hereby incorporated by reference).
Optionally, the signal sequence may be an N-terminal signal
sequence from waxy, an N-terminal signal sequence from
.gamma.-zein, a starch binding domain, a C-terminal starch binding
domain, a chloroplast targeting sequence, which imports the mature
protein to the chloroplast (Comai et. al. (1988) J. Biol. Chem.
263: 15104-15109; van den Broeck, et. al. (1985) Nature 313:
358-363; U.S. Pat. No. 5,639,949) or a secretion signal sequence
from aleurone cells (Koehler & Ho, Plant Cell 2: 769-783
(1990)). Additionally, amino terminal sequences in conjunction with
carboxy terminal sequences are responsible for vacuolar targeting
of gene products (Shinshi et. al. (1990) Plant Molec. Biol. 14:
357-368).
In one aspect, the signal sequence selected should include the
known cleavage site, and the fusion constructed should take into
account any amino acids after the cleavage site(s), which are
required for cleavage. In some cases this requirement may be
fulfilled by the addition of a small number of amino acids between
the cleavage site and the transgene ATG or, alternatively,
replacement of some amino acids within the transgene sequence.
These construction techniques are well known in the art and are
equally applicable to any cellular compartment.
In one aspect, the above-described mechanisms for cellular
targeting can be utilized not only in conjunction with their
cognate promoters, but also in conjunction with heterologous
promoters so as to effect a specific cell-targeting goal under the
transcriptional regulation of a promoter that has an expression
pattern different to that of the promoter from which the targeting
signal derives.
In sum, a variety of means can be used to practice this invention,
including any means to achieve the recombinant expression of
phytase in a transgenic plant, seed, organ or any plant part. Such
a transgenic plants and plant parts are serviceable as sources of
recombinantly expressed phytase, which can be added directly to
phytate-containing sources. Alternatively, the recombinant
plant-expressed phytase can be extracted away from the plant source
and, if desired, purified prior to contacting the phytase
substrate.
Within the context of the present invention, plants that can be
selected (used to practice this invention) include, but are not
limited to crops producing edible flowers such as cauliflower
(Brassica oleracea), artichoke (Cynara scolymus), fruits such as
apple (Malus, e.g. domesticus), banana (Musa, e.g. acuminata),
berries (such as the currant, Ribes, e.g. rubrum), cherries (such
as the sweet cherry, Prunus, e.g. avium), cucumber (Cucumis, e.g.
sativus), grape (Vitis, e.g. vinifera), lemon (Citrus limon), melon
(Cucumis melo), nuts (such as the walnut, Juglans, e.g. regia;
peanut, Arachis hypogeae), orange (Citrus, e.g. maxima), peach
(Prunus, e.g. persica), pear (Pyra, e.g. communis), plum (Prunus,
e.g. domestics), strawberry (Fragaria, e.g. moschata), tomato
(Lycopersicon, e.g. esculentum), leafs, such as alfalfa (Medicago,
e.g. sativa), cabbages (e.g. Brassica oleracea), endive (Cichoreum,
e.g. endivia), leek (Allium, e.g. porrum), lettuce (Lactuca, e.g.
sativa), spinach (Spinacia, e.g. oleraceae), tobacco (Nicotiana,
e.g. tabacum), roots, such as arrowroot (Maranta, e.g.
arundinacea), beet (Beta, e.g. vulgaris), carrot (Daucus, e.g.
carota), cassava (Manihot, e.g. esculenta), turnip (Brassica, e.g.
rapa), radish (Raphanus, e.g. sativus), yam (Dioscorea, e.g.
esculenta), sweet potato (Ipomoea batatas) and seeds, such as bean
(Phaseolus, e.g. vulgaris), pea (Pisum, e.g. sativum), soybean
(Glycin, e.g. max), wheat (Triticum, e.g. aestivum), barley
(Hordeum, e.g. vulgare), corn (Zea, e.g. mays), rice (Oryza, e.g.
sativa), rapeseed (Brassica napus), millet (Panicum L.), sunflower
(Helianthus annus), oats (Avena sativa), tubers, such as kohlrabi
(Brassica, e.g. oleraceae), potato (Solanum, e.g. tuberosum) and
the like.
In one aspect, the nucleic acids and polypeptides of the invention
are expressed in or inserted in any plant or seed. Transgenic
plants of the invention can be dicotyledonous or monocotyledonous.
Examples of monocot transgenic plants of the invention are grasses,
such as meadow grass (blue grass, Poa), forage grass such as
festuca, lolium, temperate grass, such as Agrostis, and cereals,
e.g., wheat, oats, rye, barley, rice, sorghum, and maize (corn).
Examples of dicot transgenic plants of the invention are tobacco,
legumes, such as lupins, potato, sugar beet, pea, bean and soybean,
and cruciferous plants (family Brassicaceae), such as cauliflower,
rape seed, and the closely related model organism Arabidopsis
thaliana. Thus, the transgenic plants and seeds of the invention
include a broad range of plants, including, but not limited to,
species from the genera Anacardium, Arachis, Asparagus, Atropa,
Avena, Brassica, Citrus, Citrullus, Capsicum, Carthamus, Cocos,
Coffea, Cucumis, Cucurbita, Daucus, Elaeis, Fragaria, Glycine,
Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyamus, Lactuca,
Linum, Lolium, Lupinus, Lycopersicon, Malus, Manihot, Majorana,
Medicago, Nicotiana, Olea, Oryza, Panieum, Pannisetum, Persea,
Phaseolus, Pistachia, Pisum, Pyrus, Prunus, Raphanus, Ricinus,
Secale, Senecio, Sinapis, Solanum, Sorghum, Theobromus, Trigonella,
Triticum, Vicia, Vitis, Vigna, and Zea.
In alternative embodiments, the nucleic acids of the invention are
expressed in plants which contain fiber cells, including, e.g.,
cotton, silk cotton tree (Kapok, Ceiba pentandra), desert willow,
creosote bush, winterfat, balsa, ramie, kenaf, hemp, roselle, jute,
sisal abaca and flax. In alternative embodiments, the transgenic
plants of the invention can be members of the genus Gossypium,
including members of any Gossypium species, such as G. arboreum; G.
herbaceum, G. barbadense, and G. hirsutum.
Additional plants as well as non-plant expression systems can be
used to practice this invention. The choice of the plant species is
primarily determined by the intended use of the plant or parts
thereof and the amenability of the plant species to
transformation.
Several techniques are available for the introduction of the
expression construct containing the phytase-encoding DNA sequence
into the target plants. Techniques for transforming a wide variety
of higher plant species are well known and described in the
technical and scientific literature. See, e.g., Weising (1988) Ann.
Rev. Genet. 22:421-477; U.S. Pat. No. 5,750,870. Such techniques
also can include but are not limited to transformation of
protoplasts using the calcium/polyethylene glycol method,
electroporation and microinjection or (coated) particle bombardment
(Potrykus, 1990). In addition to these so-called direct DNA
transformation methods, transformation systems involving vectors
are widely available, such as viral vectors (e.g. from the
Cauliflower Mosaic Cirus (CaMV) and bacterial vectors (e.g. from
the genus Agrobacterium) (Potrykus, 1990). After selection and/or
screening, the protoplasts, cells or plant parts that have been
transformed can be regenerated into whole plants, using methods
known in the art (Horsch et al., 1985). The choice of the
transformation and/or regeneration techniques is not critical for
this invention.
Nucleic acids and expression constructs of the invention can be
introduced into a plant cell by any means. In alternative aspects
of practicing this invention, the term "introducing" in the context
of a polynucleotide, for example, a nucleotide construct of
interest, is intended to mean presenting to the plant the
polynucleotide in such a manner that the polynucleotide gains
access to the interior of a cell of the plant. Where more than one
polynucleotide is to be introduced, these polynucleotides can be
assembled as part of a single nucleotide construct, or as separate
nucleotide constructs, and can be located on the same or different
transformation vectors. Accordingly, these polynucleotides can be
introduced into the host cell of interest in a single
transformation event, in separate transformation events, or, for
example, in plants, as part of a breeding protocol. The methods of
the invention do not depend on a particular method for introducing
one or more polynucleotides into a plant, only that the
polynucleotide(s) gains access to the interior of at least one cell
of the plant. Methods for introducing polynucleotides into plants
are known in the art including, but not limited to, transient
transformation methods, stable transformation methods, and
virus-mediated methods.
"Transient transformation" can be used to practice this invention,
and in some aspects in the context of a polynucleotide is intended
to mean that a polynucleotide is introduced into the plant and does
not integrate into the genome of the plant. "Stably introducing" or
"stably introduced" in the context of a polynucleotide introduced
into a plant can be used to practice this invention, and in some
aspects it is intended that the introduced polynucleotide is stably
incorporated into the plant genome, and thus the plant is stably
transformed with the polynucleotide.
"Stable transformation" or "stably transformed" in the context of a
polynucleotide introduced into a plant can be used to practice this
invention, and in some aspects it is intended that a
polynucleotide, for example, a nucleotide construct described
herein, is introduced into a plant integrates into the genome of
the plant and is capable of being inherited by the progeny thereof,
more particularly, by the progeny of multiple successive
generations. Introduction into the genome of a desired plant can be
such that the enzyme is regulated by endogenous transcriptional or
translational control elements. Transformation techniques for both
monocotyledons and dicotyledons are well known in the art.
The nucleic acids of the invention can be used to confer desired
traits on essentially any plant. In one embodiment, the enzyme of
the invention may be expressed in such a way that the enzyme will
not come in contact with it's substrate until desired. For example,
an enzyme of the invention may be targeted and retained in the
endoplasmic reticulum of a plant cell. Retention of the enzyme, in
the endoplasmic reticulum of the cell, will prevent the enzyme from
coming in contact with its substrate. The enzyme and substrate may
then be brought into contact through any means able to disrupt the
subcellular architecture, such as, grinding, milling, heating, and
the like. See, WO 98/11235, WO 2003/18766, and WO 2005/096704, all
of which are hereby incorporated by reference.
Selectable marker genes can be added to the gene construct in order
to identify plant cells or tissues that have successfully
integrated the transgene. This may be necessary because achieving
incorporation and expression of genes in plant cells is a rare
event, occurring in just a few percent of the targeted tissues or
cells. Selectable marker genes encode proteins that provide
resistance to agents that are normally toxic to plants, such as
antibiotics or herbicides. Only plant cells that have integrated
the selectable marker gene will survive when grown on a medium
containing the appropriate antibiotic or herbicide. Selection
markers used routinely in transformation include the nptll gene,
which confers resistance to kanamycin and related antibiotics
(Messing & Vierra. Gene 19: 259-268 (1982); Bevan et. al.,
Nature 304:184-187 (1983)), the bar gene, which confers resistance
to the herbicide phosphinothricin (White et. al., Nucl. Acids Res
18: 1062 (1990), Spencer et. al. Theor. Appl. Genet. 79: 625-631
(1990)), the hph gene, which confers resistance to the antibiotic
hygromycin (Blochinger & Diggelmann, Mol Cell Biol 4:
2929-2931), the dhfr gene, which confers resistance to methotrexate
(Bourouis et. al., EMBO J. 2(7): 1099-1104 (1983)), the EPSPS gene,
which confers resistance to glyphosate (U.S. Pat. Nos. 4,940,935
and 5,188,642),
Alternatively, transgenic plant material can be identified through
a positive selection system, such as, the system utilizing the
mannose-6-phosphate isomerase gene, which provides the ability to
metabolize mannose (U.S. Pat. Nos. 5,767,378 and 5,994,629).
In one aspect, making transgenic plants or seeds comprises
incorporating sequences of the invention and, optionally, marker
genes into a target expression construct (e.g., a plasmid), along
with positioning of the promoter and the terminator sequences. This
can involve transferring the modified gene into the plant through a
suitable method. One or more of the sequences of the invention may
be combined with sequences that confer resistance to insect,
disease, drought, increase yield, improve nutritional quality of
the grain, improve ethanol yield and the like.
For example, a construct may be introduced directly into the
genomic DNA of the plant cell using techniques such as
electroporation and microinjection of plant cell protoplasts, or
the constructs can be introduced directly to plant tissue using
ballistic methods, such as DNA particle bombardment. For example,
see, e.g., Christou (1997) Plant Mol. Biol. 35:197-203; Pawlowski
(1996) Mol. Biotechnol. 6:17-30; Klein (1987) Nature 327:70-73;
Takumi (1997) Genes Genet. Syst. 72:63-69, discussing use of
particle bombardment to introduce transgenes into wheat; and Adam
(1997) supra, for use of particle bombardment to introduce YACs
into plant cells. For example, Rinehart (1997) supra, used particle
bombardment to generate transgenic cotton plants. Apparatus for
accelerating particles is described U.S. Pat. No. 5,015,580; and,
the commercially available BioRad (Biolistics) PDS-2000 particle
acceleration instrument; see also, John, U.S. Pat. No. 5,608,148;
and Ellis, U.S. Pat. No. 5,681,730, describing particle-mediated
transformation of gymnosperms.
In one aspect, protoplasts can be immobilized and injected with a
nucleic acids, e.g., an expression construct. Although plant
regeneration from protoplasts is not easy with cereals, plant
regeneration is possible in legumes using somatic embryogenesis
from protoplast derived callus. Organized tissues can be
transformed with naked DNA using gene gun technique, where DNA is
coated on tungsten microprojectiles, shot 1/100th the size of
cells, which carry the DNA deep into cells and organelles.
Transformed tissue is then induced to regenerate, usually by
somatic embryogenesis. This technique has been successful in
several cereal species including maize and rice.
Nucleic acids, e.g., expression constructs, can also be introduced
in to plant cells using recombinant viruses. Plant cells can be
transformed using viral vectors, such as, e.g., tobacco mosaic
virus derived vectors (Rouwendal (1997) Plant Mol. Biol.
33:989-999), see Porta (1996) "Use of viral replicons for the
expression of genes in plants," Mol. Biotechnol. 5:209-221.
Alternatively, nucleic acids, e.g., an expression construct, can be
combined with suitable T-DNA flanking regions and introduced into a
conventional Agrobacterium tumefaciens host vector. The virulence
functions of the Agrobacterium tumefaciens host will direct the
insertion of the construct and adjacent marker into the plant cell
DNA when the cell is infected by the bacteria. Agrobacterium
tumefaciens-mediated transformation techniques, including disarming
and use of binary vectors, are well described in the scientific
literature. See, e.g., Horsch (1984) Science 233:496-498; Fraley
(1983) Proc. Natl. Acad. Sci. USA 80:4803 (1983); Gene Transfer to
Plants, Potrykus, ed. (Springerlag, Berlin 1995). The DNA in an A.
tumefaciens cell is contained in the bacterial chromosome as well
as in another structure known as a Ti (tumor-inducing) plasmid. The
Ti plasmid contains a stretch of DNA termed T-DNA (.about.20 kb
long) that is transferred to the plant cell in the infection
process and a series of vir (virulence) genes that direct the
infection process. A. tumefaciens can only infect a plant through
wounds: when a plant root or stem is wounded it gives off certain
chemical signals, in response to which, the vir genes of A.
tumefaciens become activated and direct a series of events
necessary for the transfer of the T-DNA from the Ti plasmid to the
plant's chromosome. The T-DNA then enters the plant cell through
the wound. One speculation is that the T-DNA waits until the plant
DNA is being replicated or transcribed, then inserts itself into
the exposed plant DNA. In order to use A. tumefaciens as a
transgene vector, the tumor-inducing section of T-DNA have to be
removed, while retaining the T-DNA border regions and the vir
genes. The transgene is then inserted between the T-DNA border
regions, where it is transferred to the plant cell and becomes
integrated into the plant's chromosomes.
The invention provides for the transformation of monocotyledonous
plants using the nucleic acids of the invention, including
important cereals, see Hiei (1997) Plant Mol. Biol. 35:205-218. See
also, e.g., Horsch, Science (1984) 233:496; Fraley (1983) Proc.
Natl. Acad. Sci. USA 80:4803; Thykjaer (1997) supra; Park (1996)
Plant Mol. Biol. 32:1135-1148, discussing T-DNA integration into
genomic DNA. See also D'Halluin, U.S. Pat. No. 5,712,135,
describing a process for the stable integration of a DNA comprising
a gene that is functional in a cell of a cereal, or other
monocotyledonous plant.
In one aspect, the third step can involve selection and
regeneration of whole plants capable of transmitting the
incorporated target gene to the next generation. Such regeneration
techniques rely on manipulation of certain phytohormones in a
tissue culture growth medium, typically relying on a biocide and/or
herbicide marker that has been introduced together with the desired
nucleotide sequences. Plant regeneration from cultured protoplasts
is described in Evans et al., Protoplasts Isolation and Culture,
Handbook of Plant Cell Culture, pp. 124-176, MacMillilan Publishing
Company, New York, 1983; and Binding, Regeneration of Plants, Plant
Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985. Regeneration
can also be obtained from plant callus, explants, organs, or parts
thereof. Such regeneration techniques are described generally in
Klee (1987) Ann. Rev. of Plant Phys. 38:467-486. To obtain whole
plants from transgenic tissues such as immature embryos, they can
be grown under controlled environmental conditions in a series of
media containing nutrients and hormones, a process known as tissue
culture. Once whole plants are generated and produce seed,
evaluation of the progeny begins.
In one aspect, after the expression cassette is stably incorporated
in transgenic plants, it can be introduced into other plants by
sexual crossing. Any of a number of standard breeding techniques
can be used, depending upon the species to be crossed. See, for
example, Welsh J. R., Fundamentals of Plant Genetics and Breeding,
John Wiley & Sons, NY (1981); Crop Breeding, Wood D. R. (Ed.)
American Society of Agronomy Madison, Wis. (1983); Mayo O., The
Theory of Plant Breeding, Second Edition, Clarendon Press, Oxford
(1987); Singh, D. P., Breeding for Resistance to Diseases and
Insect Pests, Springer-Verlag, NY (1986); and Wricke and Weber,
Quantitative Genetics and Selection Plant Breeding, Walter de
Gruyter and Co., Berlin (1986).
In one aspect, since transgenic expression of the nucleic acids of
the invention leads to phenotypic changes, plants comprising the
recombinant nucleic acids of the invention can be sexually crossed
with a second plant to obtain a final product. Thus, the seed of
the invention can be derived from a cross between two transgenic
plants of the invention, or a cross between a plant of the
invention and another plant. The desired effects (e.g., expression
of the polypeptides of the invention to produce a plant in which
flowering behavior is altered) can be enhanced when both parental
plants express the polypeptides (e.g., phytase) of the invention.
The desired effects can be passed to future plant generations by
standard propagation means.
For dicots, a binary vector system can be used (Hoekema et al.,
1983; EP 0120516 Schilperoort et al.). For example, Agrobacterium
strains can be used which contain a vir plasmid with the virulence
genes and a compatible plasmid containing the gene construct to be
transferred. This vector can replicate in both E. coli and in
Agrobacterium, and is derived from the binary vector Bin19 (Bevan,
1984) that is altered in details that are not relevant for this
invention. The binary vectors as used in this example contain
between the left- and right-border sequences of the T-DNA, an
identical NPTII-gene coding for kanamycin resistance (Bevan, 1984)
and a multiple cloning site to clone in the required gene
constructs.
The transformation and regeneration of monocotyledonous crops can
be practiced using any method or standard procedure; monocots are
amenable to transformation and fertile transgenic plants can be
regenerated from transformed cells. In an alternative aspect,
monocots are transformed by Agrobacterium transformation.
In one aspect, transgenic rice plants can be obtained using the
bacterial hph gene, encoding hygromycin resistance, as a selection
marker; the gene can be introduced by electroporation. In one
aspect, transgenic maize plants can be obtained by introducing the
Streptomyces hygroscopicus bar gene, which encodes phosphinothricin
acetyltransferase (an enzyme which inactivates the herbicide
phosphinothricin), into embryogenic cells of a maize suspension
culture by microparticle bombardment. In one aspect, genetic
material can be introduced into aleurone protoplasts of monocot
crops such as wheat and barley. In one aspect, wheat plants are
regenerated from embryogenic suspension culture by selecting only
the aged compact and nodular embryogenic callus tissues for the
establishment of the embryogenic suspension cultures. In one
aspect, the combination with transformation systems for these crops
enables the application of the present invention to monocots. These
methods and other methods may also be applied for the
transformation and regeneration of dicots.
In practicing this invention, expression of the phytase construct
involves such details as transcription of the gene by plant
polymerases, translation of mRNA, etc. that are known to persons
skilled in the art of recombinant DNA techniques. Some details
relevant for the practicing some embodiments of this invention are
discussed herein. Regulatory sequences which are known or are found
to cause expression of phytase may be used in the present
invention. The choice of the regulatory sequences used can depend
on the target crop and/or target organ of interest. Such regulatory
sequences may be obtained from plants or plant viruses, or may be
chemically synthesized. Such regulatory sequences are promoters
active in directing transcription in plants, either constitutively
or stage and/or tissue specific, depending on the use of the plant
or parts thereof. These promoters include, but are not limited to
promoters showing constitutive expression, such as the 35S promoter
of Cauliflower Mosaic Virus (CaMV) (Guilley et al., 1982), those
for leaf-specific expression, such as the promoter of the ribulose
bisphosphate carboxylase small subunit gene (Coruzzi et al., 1984),
those for root-specific expression, such as the promoter from the
glutamine synthase gene (Tingey et al., 1987), those for
seed-specific expression, such as the cruciferin A promoter from
Brassica napus (Ryan et al., 1989), those for tuber-specific
expression, such as the class-I patatin promoter from potato
(Koster-Topfer et al., 1989; Wenzler et al., 1989) or those for
fruit-specific expression, such as the polygalacturonase (PG)
promoter from tomato (Bird et al., 1988).
Other regulatory sequences such as terminator sequences and
polyadenylation signals can be used to practice this invention, and
they can include any such sequence functioning as such in plants,
the choice of which is within the level of the skilled artisan. An
example of such sequences is the 3' flanking region of the nopaline
synthase (nos) gene of Agrobacterium tumefaciens (Bevan, supra).
The regulatory sequences may also include enhancer sequences, such
as found in the 35S promoter of CaMV, and mRNA stabilizing
sequences such as the leader sequence of Alfalfa Mosaic Cirus
(AlMV) RNA4 (Brederode et al., 1980) or any other sequences
functioning in a like manner.
In some embodiments, a phytase of the invention is expressed in an
environment that allows for stability of the expressed protein. The
choice of cellular compartments, such as cytosol, endoplasmic
reticulum, vacuole, protein body or periplasmic space can be used
in the present invention to create such a stable environment,
depending on the biophysical parameters of the phytase. Such
parameters include, but are not limited to pH-optimum, sensitivity
to proteases or sensitivity to the molarity of the preferred
compartment.
In some embodiments, a phytase of the invention is expressed in
cytoplasm; in some aspect, to obtain expression in the cytoplasm of
the cell, the expressed enzyme should not contain a secretory
signal peptide or any other target sequence. For expression in
chloroplasts and mitochondria the expressed enzyme should contain
specific so-called transit peptide for import into these
organelles. Targeting sequences that can be attached to the enzyme
of interest in order to achieve this are known (Smeekens et al.,
1990; van den Broeck et al., 1985; Wolter et al., 1988). If the
activity of the enzyme is desired in the vacuoles a secretory
signal peptide has to be present, as well as a specific targeting
sequence that directs the enzyme to these vacuoles (Tague et al.,
1990). The same is true for the protein bodies in seeds. The DNA
sequence encoding the enzyme of interest should be modified in such
a way that the enzyme can exert its action at the desired location
in the cell.
In some embodiments, to achieve extracellular expression of the
phytase, the expression construct of the present invention utilizes
a secretory signal sequence. Although signal sequences which are
homologous (native) to the plant host species may be preferred,
heterologous signal sequences, i.e. those originating from other
plant species or of microbial origin, may be used as well. Such
signal sequences are known to those skilled in the art. Appropriate
signal sequences which may be used within the context of the
present invention are disclosed in Blobel et al., 1979; Von Heijne,
1986; Garcia et al., 1987; Sijmons et al., 1990; Ng et al., 1994;
and Powers et al., 1996).
In some embodiments, all parts of the relevant DNA constructs
(promoters, regulatory-, secretory-, stabilizing-, targeting-, or
termination sequences) of the present invention are modified, if
desired, to affect their control characteristics using methods
known to those skilled in the art. Plants containing phytase
obtained via the present invention may be used to obtain plants or
plant organs with yet higher phytase levels. For example, it may be
possible to obtain such plants or plant organs by the use of
somoclonal variation techniques or by cross breeding techniques.
Such techniques are well known to those skilled in the art.
In one aspect, the instant invention provides a method (and
products thereof) of achieving a highly efficient overexpression
system for phytase and other molecules. In one aspect, the
invention provides a method (and products thereof) of achieving a
highly efficient overexpression system for phytase and pH 2.5 acid
phosphatase in Trichoderma. This system results in enzyme
compositions that have particular utility in the animal feed
industry. Additional details regarding this approach are in the
public literature and/or are known to the skilled artisan. In a
particular non-limiting exemplification, such publicly available
literature includes EP 0659215 (WO 9403612 A1) (Nevalainen et al.),
although these reference do not teach the inventive molecules of
the instant application.
In some embodiments, the invention uses in vivo reassortment, which
can be focused on "inter-molecular" processes collectively referred
to as "recombination", which in bacteria can be a "RecA-dependent"
phenomenon. The invention can rely on recombination processes of a
host cell to recombine and re-assort sequences, or the cells'
ability to mediate reductive processes to decrease the complexity
of quasi-repeated sequences in the cell by deletion. This process
of "reductive reassortment" occurs by an "intra-molecular",
RecA-independent process.
Therefore, in another aspect of the invention, variant
polynucleotides can be generated by the process of reductive
reassortment. The method involves the generation of constructs
containing consecutive sequences (original encoding sequences),
their insertion into an appropriate vector, and their subsequent
introduction into an appropriate host cell. The reassortment of the
individual molecular identities occurs by combinatorial processes
between the consecutive sequences in the construct possessing
regions of homology, or between quasi-repeated units. The
reassortment process recombines and/or reduces the complexity and
extent of the repeated sequences, and results in the production of
novel molecular species. Various treatments may be applied to
enhance the rate of reassortment. These could include treatment
with ultra-violet light, or DNA damaging chemicals, and/or the use
of host cell lines displaying enhanced levels of "genetic
instability". Thus the reassortment process may involve homologous
recombination or the natural property of quasi-repeated sequences
to direct their own evolution.
The invention can use repeated or "quasi-repeated" sequences; these
sequence can play a role in genetic instability. In the present
invention, "quasi-repeats" are repeats that are not restricted to
their original unit structure. Quasi-repeated units can be
presented as an array of sequences in a construct; consecutive
units of similar sequences. Once ligated, the junctions between the
consecutive sequences become essentially invisible and the
quasi-repetitive nature of the resulting construct is now
continuous at the molecular level. The deletion process the cell
performs to reduce the complexity of the resulting construct
operates between the quasi-repeated sequences. The quasi-repeated
units provide a practically limitless repertoire of templates upon
which slippage events can occur. The constructs containing the
quasi-repeats thus effectively provide sufficient molecular
elasticity that deletion (and potentially insertion) events can
occur virtually anywhere within the quasi-repetitive units.
In some aspects, when the quasi-repeated sequences are all ligated
in the same orientation, for instance head to tail or vice versa,
the cell cannot distinguish individual units. Consequently, the
reductive process can occur throughout the sequences. In contrast,
when for example, the units are presented head to head, rather than
head to tail, the inversion delineates the endpoints of the
adjacent unit so that deletion formation will favor the loss of
discrete units. Thus, in one aspect of the invention the sequences
are in the same orientation. Random orientation of quasi-repeated
sequences will result in the loss of reassortment efficiency, while
consistent orientation of the sequences will offer the highest
efficiency. However, while having fewer of the contiguous sequences
in the same orientation decreases the efficiency, it can still
provide sufficient elasticity for the effective recovery of novel
molecules. Constructs can be made with the quasi-repeated sequences
in the same orientation to allow higher efficiency.
Sequences can be assembled in a head to tail orientation using any
of a variety of methods, including the following: (a) Primers that
include a poly-A head and poly-T tail which when made
single-stranded provide orientation can be utilized. This is
accomplished by having the first few bases of the primers made from
RNA and hence easily removed RNAse H. (b) Primers that include
unique restriction cleavage sites can be utilized. Multiple sites,
a battery of unique sequences, and repeated synthesis and ligation
steps would be required. (c) The inner few bases of the primer can
be thiolated and an exonuclease used to produce properly tailed
molecules.
In some aspects, the recovery of the re-assorted sequences relies
on the identification of cloning vectors with a reduced RI. The
re-assorted encoding sequences can then be recovered by
amplification. The products are re-cloned and expressed. The
recovery of cloning vectors with reduced RI can be effected by: 1)
The use of vectors only stably maintained when the construct is
reduced in complexity; 2) The physical recovery of shortened
vectors by physical procedures. In this case, the cloning vector is
recovered using standard plasmid isolation procedures and size
fractionated on either an agarose gel, or column with a low
molecular weight cut off utilizing standard procedures; 3) The
recovery of vectors containing interrupted genes which can be
selected when insert size decreases; and 4) The use of direct
selection techniques with an expression vector and the appropriate
selection.
Encoding sequences (for example, genes) from related organisms can
be used to practice this invention, and they can demonstrate a high
degree of homology and encode quite diverse protein products. These
types of sequences are particularly useful in the present invention
as quasi-repeats. However, while the exemplary protocols discussed
below demonstrate the reassortment of nearly identical original
encoding sequences (quasi-repeats), this process is not limited to
such nearly identical repeats.
Once formed, the constructs may or may not be size fractionated on
an agarose gel according to published protocols, inserted into a
cloning vector, and transfected into an appropriate host cell. The
cells are then propagated and "reductive reassortment" is effected.
The rate of the reductive reassortment process may be stimulated by
the introduction of DNA damage if desired. Whether the reduction in
RI is mediated by deletion formation between repeated sequences by
an "intra-molecular" mechanism, or mediated by recombination-like
events through "inter-molecular" mechanisms is immaterial. The end
result is a reassortment of the molecules into all possible
combinations.
In one aspect, methods of this invention comprise the additional
step of screening the library members of the shuffled pool to
identify individual shuffled library members having the ability to
bind or otherwise interact, or catalyze a particular reaction
(e.g., such as catalyzing the hydrolysis of a phytate).
In one aspect, the polypeptides that are identified from such
libraries can be used for therapeutic, diagnostic, research and
related purposes (e.g., catalysts, solutes for increasing
osmolarity of an aqueous solution, and the like), and/or can be
subjected to one or more additional cycles of shuffling and/or
selection.
In another aspect, prior to or during recombination or
reassortment, polynucleotides of the invention or polynucleotides
generated by the method described herein can be subjected to agents
or processes which promote the introduction of mutations into the
original polynucleotides. The introduction of such mutations would
increase the diversity of resulting hybrid polynucleotides and
polypeptides encoded therefrom. The agents or processes which
promote mutagenesis can include, but are not limited to:
(+)-CC-1065, or a synthetic analog such as
(+)-CC-1065-(N-3-Adenine, see Sun and Hurley, 1992); an
N-acetylated or deacetylated 4'-fluoro-4-aminobiphenyl adduct
capable of inhibiting DNA synthesis (see, for example, van de Poll
et al., 1992); or a N-acetylated or deacetylated 4-aminobiphenyl
adduct capable of inhibiting DNA synthesis (see also, van de Poll
et al., 1992, pp. 751-758); trivalent chromium, a trivalent
chromium salt, a polycyclic aromatic hydrocarbon ("PAH") DNA adduct
capable of inhibiting DNA replication, such as
7-bromomethyl-benz[a]anthracene ("BMA"),
tris(2,3-dibromopropyl)phosphate ("Tris-BP"),
1,2-dibromo-3-chloropropane ("DBCP"), 2-bromoacrolein (2BA),
benzo[a]pyrene-7,8-dihydrodiol-9-10-epoxide ("BPDE"), a
platinum(II) halogen salt,
N-hydroxy-2-amino-3-methylimidazo[4,5-f]-quinoline
("N-hydroxy-IQ"), and
N-hydroxy-2-amino-1-methyl-6-phenylmidazo[4,5-f]-pyridine
("N-hydroxy-PhIP"). An exemplary means for slowing or halting PCR
amplification consist of UV light (+)-CC-1065 and
(+)-CC-1065-(N-3-Adenine). Particularly encompassed means are DNA
adducts or polynucleotides comprising the DNA adducts from the
polynucleotides or polynucleotides pool, which can be released or
removed by a process including heating the solution comprising the
polynucleotides prior to further processing.
In another aspect, the invention is directed to a method of
producing recombinant proteins having biological activity by
treating a sample comprising double-stranded template
polynucleotides encoding a wild type protein under conditions
according to the invention which provide for the production of
hybrid or re-assorted polynucleotides.
The invention also provides for the use of proprietary codon
primers (containing a degenerate N,N,G/T sequence) to introduce
point mutations into a polynucleotide, so as to generate a set of
progeny polypeptides in which a full range of single amino acid
substitutions is represented at each amino acid position (gene site
saturated mutagenesis (GSSM)). The oligos used are comprised
contiguously of a first homologous sequence, a degenerate N,N,G/T
sequence, and optionally a second homologous sequence. The
downstream progeny translational products from the use of such
oligos include all possible amino acid changes at each amino acid
site along the polypeptide, because the degeneracy of the N,N,G/T
sequence includes codons for all 20 amino acids.
In one aspect, one such degenerate oligo (comprised of one
degenerate N,N,G/T cassette) is used for subjecting each original
codon in a parental polynucleotide template to a full range of
codon substitutions. In another aspect, at least two degenerate
N,N,G/T cassettes are used--either in the same oligo or not, for
subjecting at least two original codons in a parental
polynucleotide template to a full range of codon substitutions.
Thus, more than one N,N,G/T sequence can be contained in one oligo
to introduce amino acid mutations at more than one site. This
plurality of N,N,G/T sequences can be directly contiguous, or
separated by one or more additional nucleotide sequence(s). In
another aspect, oligos serviceable for introducing additions and
deletions can be used either alone or in combination with the
codons containing an N,N,G/T sequence, to introduce any combination
or permutation of amino acid additions, deletions, and/or
substitutions.
In one aspect, it is possible to simultaneously mutagenize two or
more contiguous amino acid positions using an oligo that contains
contiguous N,N,G/T triplets, i.e. a degenerate (N,N,G/T).sub.n
sequence.
In another aspect, the present invention provides for the use of
degenerate cassettes having less degeneracy than the N,N,G/T
sequence. For example, it may be desirable in some instances to use
(e.g. in an oligo) a degenerate triplet sequence comprised of only
one N, where said N can be in the first second or third position of
the triplet. Any other bases including any combinations and
permutations thereof can be used in the remaining two positions of
the triplet. Alternatively, it may be desirable in some instances
to use (e.g., in an oligo) a degenerate N,N,N triplet sequence, or
an N,N, G/C triplet sequence.
It is appreciated, however, that the use of a degenerate triplet
(such as N,N,G/T or an N,N, G/C triplet sequence) as disclosed in
the instant invention is advantageous for several reasons. In one
aspect, this invention provides a means to systematically and
fairly easily generate the substitution of the full range of
possible amino acids (for a total of 20 amino acids) into each and
every amino acid position in a polypeptide. Thus, for a 100 amino
acid polypeptide, the invention provides a way to systematically
and fairly easily generate 2000 distinct species (i.e., 20 possible
amino acids per position times 100 amino acid positions). It is
appreciated that there is provided, through the use of an oligo
containing a degenerate N,N,G/T or an N,N, G/C triplet sequence, 32
individual sequences that code for 20 possible amino acids. Thus,
in a reaction vessel in which a parental polynucleotide sequence is
subjected to saturation mutagenesis using one such oligo, there are
generated 32 distinct progeny polynucleotides encoding 20 distinct
polypeptides. In contrast, the use of a non-degenerate oligo in
site-directed mutagenesis leads to only one progeny polypeptide
product per reaction vessel.
This invention also provides for the use of nondegenerate oligos,
which can optionally be used in combination with degenerate primers
disclosed. It is appreciated that in some situations, it is
advantageous to use nondegenerate oligos to generate specific point
mutations in a working polynucleotide. This provides a means to
generate specific silent point mutations, point mutations leading
to corresponding amino acid changes, and point mutations that cause
the generation of stop codons and the corresponding expression of
polypeptide fragments.
Thus, in one aspect, each saturation mutagenesis reaction vessel
contains polynucleotides encoding at least 20 progeny polypeptide
molecules such that all 20 amino acids are represented at the one
specific amino acid position corresponding to the codon position
mutagenized in the parental polynucleotide. The 32-fold degenerate
progeny polypeptides generated from each saturation mutagenesis
reaction vessel can be subjected to clonal amplification (e.g.,
cloned into a suitable E. coli host using an expression vector) and
subjected to expression screening. When an individual progeny
polypeptide is identified by screening to display a favorable
change in property (when compared to the parental polypeptide), it
can be sequenced to identify the correspondingly favorable amino
acid substitution contained therein.
It is appreciated that upon mutagenizing each and every amino acid
position in a parental polypeptide using gene site saturation
mutagenesis (GSSM) as disclosed herein, favorable amino acid
changes may be identified at more than one amino acid position. One
or more new progeny molecules can be generated that contain a
combination of all or part of these favorable amino acid
substitutions. For example, if 2 specific favorable amino acid
changes are identified in each of 3 amino acid positions in a
polypeptide, the permutations include 3 possibilities at each
position (no change from the original amino acid, and each of two
favorable changes) and 3 positions. Thus, there are
3.times.3.times.3 or 27 total possibilities, including 7 that were
previously examined--6 single point mutations (i.e., 2 at each of
three positions) and no change at any position.
In yet another aspect, site-saturation mutagenesis can be used
together with shuffling, chimerization, recombination and other
mutagenizing processes, along with screening. This invention
provides for the use of any mutagenizing process(es), including
saturation mutagenesis, in an iterative manner. In one
exemplification, the iterative use of any mutagenizing process(es)
is used in combination with screening.
Thus, in a non-limiting exemplification, polynucleotides and
polypeptides of the invention can be derived by gene site
saturation mutagenesis (GSSM) in combination with additional
mutagenization processes, such as process where two or more related
polynucleotides are introduced into a suitable host cell such that
a hybrid polynucleotide is generated by recombination and reductive
reassortment.
In addition to performing mutagenesis along the entire sequence of
a gene, mutagenesis can be used to replace each of any number of
bases in a polynucleotide sequence, wherein the number of bases to
be mutagenized can be every integer from 15 to 100,000. Thus,
instead of mutagenizing every position along a molecule, one can
subject every or a discrete number of bases (can be a subset
totaling from 15 to 100,000) to mutagenesis. A separate nucleotide
can be used for mutagenizing each position or group of positions
along a polynucleotide sequence. A group of 3 positions to be
mutagenized may be a codon. The mutations can be introduced using a
mutagenic primer, containing a heterologous cassette, also referred
to as a mutagenic cassette. Exemplary cassettes can have from 1 to
500 bases. Each nucleotide position in such heterologous cassettes
be N, A, C, G, T, A/C, A/G, A/T, C/G, C/T, G/T, C/G/T, A/G/T,
A/C/T, A/C/G, or E, where E is any base that is not A, C, G, or T
(E can be referred to as a designer oligo).
In a general sense, saturation mutagenesis comprises mutagenizing a
complete set of mutagenic cassettes (wherein each cassette can be
about 1-500 bases in length) in defined polynucleotide sequence to
be mutagenized (wherein the sequence to be mutagenized can be from
about 15 to 100,000 bases in length). Thus, a group of mutations
(ranging from 1 to 100 mutations) is introduced into each cassette
to be mutagenized. A grouping of mutations to be introduced into
one cassette can be different or the same from a second grouping of
mutations to be introduced into a second cassette during the
application of one round of saturation mutagenesis. Such groupings
are exemplified by deletions, additions, groupings of particular
codons, and groupings of particular nucleotide cassettes.
Defined sequences to be mutagenized include a whole gene, pathway,
cDNA, an entire open reading frame (ORF), and entire promoter,
enhancer, repressor/transactivator, origin of replication, intron,
operator, or any polynucleotide functional group. Generally, a
"defined sequences" for this purpose may be any polynucleotide that
a 15 base-polynucleotide sequence, and polynucleotide sequences of
lengths between 15 bases and 15,000 bases (this invention
specifically names every integer in between). Considerations in
choosing groupings of codons include types of amino acids encoded
by a degenerate mutagenic cassette.
In one aspect, a grouping of mutations that can be introduced into
a mutagenic cassette, this invention specifically provides for
degenerate codon substitutions (using degenerate oligos) that code
for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
and 20 amino acids at each position, and a library of polypeptides
encoded thereby.
In alternative aspects nucleic acids of the invention comprise DNA,
including cDNA, genomic DNA, and synthetic DNA. The DNA may be
double-stranded or single-stranded, and if single stranded may be
the coding strand or non-coding (anti-sense) strand. Alternatively,
the nucleic acids of the invention may comprise RNA.
As discussed in more detail below, the isolated nucleic acid
sequences of the invention may be used to prepare the polypeptides
of the invention.
Accordingly, another aspect of the invention is an isolated nucleic
acid sequence which encodes a polypeptide of the invention. A
nucleic acid sequence of the invention can comprise additional
coding sequences, such as leader sequences or proprotein sequences
and non-coding sequences, such as introns or non-coding sequences
5' and/or 3' of the coding sequence. Thus, as used herein, the term
"polynucleotide encoding a polypeptide" encompasses a
polynucleotide which includes only coding sequence for the
polypeptide as well as a polynucleotide which includes additional
coding and/or non-coding sequence.
Alternatively, the nucleic acid sequences of the invention may be
mutagenized using conventional techniques, such as site directed
mutagenesis, or other techniques familiar to those skilled in the
art, to introduce silent changes into the polynucleotide of the
invention. As used herein, "silent changes" include, for example,
changes that do not alter the amino acid sequence encoded by the
polynucleotide. Such changes may be desirable in order to increase
the level of the polypeptide produced by host cells containing a
vector encoding the polypeptide by introducing codons or codon
pairs that occur frequently in the host organism.
The invention also relates to polynucleotides that have nucleotide
changes which result in amino acid substitutions, additions,
deletions, fusions and truncations in the polypeptides of the
invention. Such nucleotide changes may be introduced using
techniques such as site directed mutagenesis, random chemical
mutagenesis, exonuclease III deletion, and other recombinant DNA
techniques.
Where necessary, conditions which permit the probe to specifically
hybridize to complementary sequences may be determined by placing
the probe in contact with complementary sequences from samples
known to contain the complementary sequence as well as control
sequences which do not contain the complementary sequence.
Hybridization conditions, such as the salt concentration of the
hybridization buffer, the formamide concentration of the
hybridization buffer, or the hybridization temperature, may be
varied to identify conditions which allow the probe to hybridize
specifically to complementary nucleic acids.
If the sample contains the organism from which the nucleic acid was
isolated, specific hybridization of the probe is then detected.
Hybridization may be detected by labeling the probe with a
detectable agent such as a radioactive isotope, a fluorescent dye
or an enzyme capable of catalyzing the formation of a detectable
product.
Many methods for using the labeled probes to detect the presence of
complementary nucleic acids in a sample are familiar to those
skilled in the art. These include Southern Blots, Northern Blots,
colony hybridization procedures, and dot blots. Protocols for each
of these procedures are provided in Ausubel et al. Current
Protocols in Molecular Biology, John Wiley 503 Sons, Inc. 1997 and
Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d Ed.,
Cold Spring Harbor Laboratory Press, 1989.
Alternatively, more than one probe (at least one of which is
capable of specifically hybridizing to any complementary sequences
which are present in the nucleic acid sample), may be used in an
amplification reaction to determine whether the sample contains an
organism containing a nucleic acid sequence of the invention (e.g.,
an organism from which the nucleic acid was isolated). Typically,
the probes comprise oligonucleotides. In one aspect, the
amplification reaction may comprise a PCR reaction. PCR protocols
are described in Ausubel and Sambrook, supra. Alternatively, the
amplification may comprise a ligase chain reaction, 3SR, or strand
displacement reaction. (See Barany, F., "The Ligase Chain Reaction
in a PCR World," PCR Methods and Applications 1:5-16, 1991; E. Fahy
et al., "Self-sustained Sequence Replication (3SR): An Isothermal
Transcription-based Amplification System Alternative to PCR", PCR
Methods and Applications 1:25-33, 1991; and Walker G. T. et al.,
"Strand Displacement Amplification--an Isothermal in vitro DNA
Amplification Technique", Nucleic Acid Research 20:1691-1696,
1992). In such procedures, the nucleic acids in the sample are
contacted with the probes, the amplification reaction is performed,
and any resulting amplification product is detected. The
amplification product may be detected by performing gel
electrophoresis on the reaction products and staining the gel with
an intercalator such as ethidium bromide. Alternatively, one or
more of the probes may be labeled with a radioactive isotope and
the presence of a radioactive amplification product may be detected
by autoradiography after gel electrophoresis.
Probes derived from sequences near the ends of a sequence of the
invention may also be used in chromosome walking procedures to
identify clones containing genomic sequences located adjacent to
the nucleic acid sequences as set forth above. Such methods allow
the isolation of genes which encode additional proteins from the
host organism.
A nucleic acid sequence of the invention can be used as a probe to
identify and isolate related nucleic acids. In some aspects, the
related nucleic acids may be cDNAs or genomic DNAs from organisms
other than the one from which the nucleic acid was isolated. For
example, the other organisms may be related organisms. In such
procedures, a nucleic acid sample is contacted with the probe under
conditions which permit the probe to specifically hybridize to
related sequences. Hybridization of the probe to nucleic acids from
the related organism is then detected using any of the methods
described above.
In nucleic acid hybridization reactions, the conditions used to
achieve a particular level of stringency will vary, depending on
the nature of the nucleic acids being hybridized. For example, the
length, degree of complementarity, nucleotide sequence composition
(e.g., GC v. AT content), and nucleic acid type (e.g., RNA v. DNA)
of the hybridizing regions of the nucleic acids can be considered
in selecting hybridization conditions. An additional consideration
is whether one of the nucleic acids is immobilized, for example, on
a filter.
Hybridization may be carried out under conditions of low
stringency, moderate stringency or high stringency. As an example
of nucleic acid hybridization, a polymer membrane containing
immobilized denatured nucleic acids is first prehybridized for 30
minutes at 45.degree. C. in a solution consisting of 0.9 M NaCl, 50
mM NaH.sub.2PO.sub.4, pH 7.0, 5.0 mM Na.sub.2EDTA, 0.5% SDS,
10.times.Denhardt's, and 0.5 mg/ml polyriboadenylic acid.
Approximately 2.times.10.sup.7 cpm (specific activity
4-9.times.10.sup.8 cpm/ug) of .sup.32P end-labeled oligonucleotide
probe are then added to the solution. After 12-16 hours of
incubation, the membrane is washed for 30 minutes at room
temperature in 1.times.SET (150 mM NaCl, 20 mM Tris hydrochloride,
pH 7.8, 1 mM Na.sub.2EDTA) containing 0.5% SDS, followed by a 30
minute wash in fresh 1.times.SET at Tm-10.degree. C. for the
oligonucleotide probe. The membrane is then exposed to
auto-radiographic film for detection of hybridization signals.
By varying the stringency of the hybridization conditions used to
identify nucleic acids, such as cDNAs or genomic DNAs, which
hybridize to the detectable probe, nucleic acids having different
levels of homology to the probe can be identified and isolated.
Stringency may be varied by conducting the hybridization at varying
temperatures below the melting temperatures of the probes. The
melting temperature, T.sub.m, is the temperature (under defined
ionic strength and pH) at which 50% of the target sequence
hybridizes to a perfectly complementary probe. Very stringent
conditions are selected to be equal to or about 5.degree. C. lower
than the T.sub.m for a particular probe. The melting temperature of
the probe may be calculated using the following formulas: For
probes between 14 and 70 nucleotides in length the melting
temperature (T.sub.m) is calculated using the formula:
T.sub.m=81.5+16.6(log [Na+])+0.41(fraction G+C)-(600/N), where N is
the length of the probe. If the hybridization is carried out in a
solution containing formamide, the melting temperature may be
calculated using the equation: T.sub.m=81.5+16.6(log
[Na+])+0.41(fraction G+C)-(0.63% formamide)-(600/N), where N is the
length of the probe. Prehybridization may be carried out in
6.times.SSC, 5.times.Denhardt's reagent, 0.5% SDS, 100 .mu.g/ml
denatured fragmented salmon sperm DNA or 6.times.SSC,
5.times.Denhardt's reagent, 0.5% SDS, 100 .mu.g/ml denatured
fragmented salmon sperm DNA, 50% formamide. The formulas for SSC
and Denhardt's solutions can be found, e.g., in Sambrook et al.,
supra.
Hybridization is conducted by adding the detectable probe to the
prehybridization solutions listed above. Where the probe comprises
double stranded DNA, it is denatured before addition to the
hybridization solution. The filter is contacted with the
hybridization solution for a sufficient period of time to allow the
probe to hybridize to cDNAs or genomic DNAs containing sequences
complementary thereto or homologous thereto. For probes over 200
nucleotides in length, the hybridization may be carried out at
15-25.degree. C. below the Tm. For shorter probes, such as
oligonucleotide probes, the hybridization may be conducted at
5-10.degree. C. below the T.sub.m. Typically, for hybridizations in
6.times.SSC, the hybridization is conducted at approximately
68.degree. C. Usually, for hybridizations in 50% formamide
containing solutions, the hybridization is conducted at
approximately 42.degree. C. All of the foregoing hybridizations are
considered to be under conditions of high stringency.
Following hybridization, the filter is washed to remove any
non-specifically bound detectable probe. The stringency used to
wash the filters can also be varied depending on the nature of the
nucleic acids being hybridized, the length of the nucleic acids
being hybridized, the degree of complementarity, the nucleotide
sequence composition (e.g., GC v. AT content), and the nucleic acid
type (e.g., RNA v. DNA). Examples of progressively higher
stringency condition washes are as follows: 2.times.SSC, 0.1% SDS
at room temperature for 15 minutes (low stringency); 0.1.times.SSC,
0.5% SDS at room temperature for 30 minutes to 1 hour (moderate
stringency); 0.1.times.SSC, 0.5% SDS for 15 to 30 minutes at
between the hybridization temperature and 68.degree. C. (high
stringency); and 0.15M NaCl for 15 minutes at 72.degree. C. (very
high stringency). A final low stringency wash can be conducted in
0.1.times.SSC at room temperature. The examples above are merely
illustrative of one set of conditions that can be used to wash
filters. One of skill in the art would know that there are numerous
recipes for different stringency washes. Some other examples are
given below.
Nucleic acids which have hybridized to the probe can be identified
by autoradiography or other conventional techniques.
The above procedure may be modified to identify nucleic acids
having decreasing levels of homology to the probe sequence. For
example, to obtain nucleic acids of decreasing homology to the
detectable probe, less stringent conditions may be used. For
example, the hybridization temperature may be decreased in
increments of 5.degree. C. from 68.degree. C. to 42.degree. C. in a
hybridization buffer having a Na+ concentration of approximately 1
M. Following hybridization, the filter may be washed with
2.times.SSC, 0.5% SDS at the temperature of hybridization. These
conditions are considered to be "moderate" conditions above
50.degree. C. and "low" conditions below 50.degree. C. A specific
example of "moderate" hybridization conditions is when the above
hybridization is conducted at 55.degree. C. A specific example of
"low stringency" hybridization conditions is when the above
hybridization is conducted at 45.degree. C.
Alternatively, the hybridization may be carried out in buffers,
such as 6.times.SSC, containing formamide at a temperature of
42.degree. C. In this case, the concentration of formamide in the
hybridization buffer may be reduced in 5% increments from 50% to 0%
to identify clones having decreasing levels of homology to the
probe. Following hybridization, the filter may be washed with
6.times.SSC, 0.5% SDS at 50.degree. C. These conditions are
considered to be "moderate" conditions above 25% formamide and
"low" conditions below 25% formamide. A specific example of
"moderate" hybridization conditions is when the above hybridization
is conducted at 30% formamide. A specific example of "low
stringency" hybridization conditions is when the above
hybridization is conducted at 10% formamide.
For example, the preceding methods may be used to isolate nucleic
acids having a sequence with at least about 99%, at least 98%, at
least 97%, at least 95%, at least 90%, or at least 80% homology to
a nucleic acid sequence as set forth in SEQ ID NO:1, sequences
substantially identical thereto, or fragments comprising at least
about 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400,
or 500 consecutive bases thereof, and the sequences complementary
to any of the foregoing sequences. Homology may be measured using
an alignment algorithm. For example, the homologous polynucleotides
may have a coding sequence which is a naturally occurring allelic
variant of one of the coding sequences described herein. Such
allelic variants may have a substitution, deletion or addition of
one or more nucleotides when compared to a nucleic acid sequence as
set forth in SEQ ID NO:1, or sequences complementary thereto.
Additionally, the above procedures may be used to isolate nucleic
acids which encode polypeptides having at least about 99%, at least
95%, at least 90%, at least 85%, at least 80%, or at least 70%
homology to a polypeptide having a sequence as set forth in SEQ ID
NO:2, sequences substantially identical thereto, or fragments
comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or
150 consecutive amino acids thereof as determined using a sequence
alignment algorithm (e.g., such as the FASTA version 3.0t78
algorithm with the default parameters).
Another aspect of the invention is an isolated or purified
polypeptide comprising a sequence as set forth in SEQ ID NO:1,
sequences substantially identical thereto, or fragments comprising
at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150
consecutive amino acids thereof. As discussed above, such
polypeptides may be obtained by inserting a nucleic acid encoding
the polypeptide into a vector such that the coding sequence is
operably linked to a sequence capable of driving the expression of
the encoded polypeptide in a suitable host cell. For example, the
expression vector may comprise a promoter, a ribosome binding site
for translation initiation and a transcription terminator. The
vector may also include appropriate sequences for amplifying
expression.
Promoters suitable for expressing the polypeptide or fragment
thereof in bacteria include the E. coli lac or trp promoters, the
lad promoter, the lacZ promoter, the T3 promoter, the T7 promoter,
the gpt promoter, the lambda P.sub.R promoter, the lambda P.sub.L
promoter, promoters from operons encoding glycolytic enzymes such
as 3-phosphoglycerate kinase (PGK), and the acid phosphatase
promoter. Fungal promoters include the .A-inverted. factor
promoter. Eukaryotic promoters include the CMV immediate early
promoter, the HSV thymidine kinase promoter, heat shock promoters,
the early and late SV40 promoter, LTRs from retroviruses, and the
mouse metallothionein-I promoter. Other promoters known to control
expression of genes in prokaryotic or eukaryotic cells or their
viruses may also be used.
Mammalian expression vectors may also comprise an origin of
replication, any necessary ribosome binding sites, a
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
non-transcribed sequences. In some aspects, DNA sequences derived
from the SV40 splice and polyadenylation sites may be used to
provide the required non-transcribed genetic elements.
Vectors for expressing the polypeptide or fragment thereof in
eukaryotic cells may also contain enhancers to increase expression
levels Enhancers are cis-acting elements of DNA, usually from about
10 to about 300 bp in length that act on a promoter to increase its
transcription. Examples include the SV40 enhancer on the late side
of the replication origin bp 100 to 270, the cytomegalovirus early
promoter enhancer, the polyoma enhancer on the late side of the
replication origin, and the adenovirus enhancers.
In addition, the expression vectors typically contain one or more
selectable marker genes to permit selection of host cells
containing the vector. Such selectable markers include genes
encoding dihydrofolate reductase or genes conferring neomycin
resistance for eukaryotic cell culture, genes conferring
tetracycline or ampicillin resistance in E. coli, and the S.
cerevisiae TRP1 gene.
The probe DNA used for selectively isolating the target DNA of
interest from the DNA derived from at least one microorganism can
be a full-length coding region sequence or a partial coding region
sequence of DNA for an enzyme of known activity. The original DNA
library can be probed using mixtures of probes comprising at least
a portion of the DNA sequence encoding an enzyme having the
specified enzyme activity. These probes or probe libraries can be
single-stranded and the microbial DNA which is probed can be
converted into single-stranded form. The probes that are suitable
are those derived from DNA encoding enzymes having an activity
similar or identical to the specified enzyme activity which is to
be screened.
The probe DNA can be at least about 10 bases or at least 15 bases.
In one aspect, the entire coding region may be employed as a probe.
Conditions for the hybridization in which target DNA is selectively
isolated by the use of at least one DNA probe will be designed to
provide a hybridization stringency of at least about 50% sequence
identity, more particularly a stringency providing for a sequence
identity of at least about 70%.
The probe DNA can be "labeled" with one partner of a specific
binding pair (i.e. a ligand) and the other partner of the pair is
bound to a solid matrix to provide ease of separation of target
from its source. The ligand and specific binding partner can be
selected from, in either orientation, the following: (1) an antigen
or hapten and an antibody or specific binding fragment thereof; (2)
biotin or iminobiotin and avidin or streptavidin; (3) a sugar and a
lectin specific therefor; (4) an enzyme and an inhibitor therefor;
(5) an apoenzyme and cofactor; (6) complementary homopolymeric
oligonucleotides; and (7) a hormone and a receptor therefor. The
solid phase can be selected from: (1) a glass or polymeric surface;
(2) a packed column of polymeric beads; and (3) magnetic or
paramagnetic particles.
The appropriate DNA sequence may be inserted into the vector by a
variety of procedures. In general, the DNA sequence is ligated to
the desired position in the vector following digestion of the
insert and the vector with appropriate restriction endonucleases.
Alternatively, blunt ends in both the insert and the vector may be
ligated. A variety of cloning techniques are disclosed in Ausubel
et al. Current Protocols in Molecular Biology, John Wiley 503 Sons,
Inc. 1997 and Sambrook et al., Molecular Cloning: A Laboratory
Manual, 2d Ed., Cold Spring Harbor Laboratory Press, 1989. Such
procedures and others are deemed to be within the scope of those
skilled in the art.
The vector may be, for example, in the form of a plasmid, a viral
particle, or a phage. Other vectors include chromosomal,
nonchromosomal and synthetic DNA sequences, derivatives of SV40;
bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors
derived from combinations of plasmids and phage DNA, viral DNA such
as vaccinia, adenovirus, fowl pox virus, and pseudorabies. A
variety of cloning and expression vectors for use with prokaryotic
and eukaryotic hosts are described by Sambrook, et al., Molecular
Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor,
N.Y., (1989).
Particular bacterial vectors which may be used include the
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017), pKK223-3 (Pharmacia
Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison,
Wis., USA) pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174 pBluescript
II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a,
pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8 and pCM7.
Particular eukaryotic vectors include pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, and pSVL (Pharmacia). However, any
other vector may be used as long as it is replicable and viable in
the host cell.
The host cell may be any of the host cells familiar to those
skilled in the art, including prokaryotic cells, eukaryotic cells,
mammalian cells, insect cells, or plant cells. As representative
examples of appropriate hosts, there may be mentioned: bacterial
cells, such as E. coli, Streptomyces, Bacillus subtilis, Bacillus
cereus, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces and Staphylococcus, fungal cells,
such as Aspergillus, yeast such as any species of Pichia,
Saccharomyces, Schizosaccharomyces, Schwanniomyces, including
Pichia pastoris, Saccharomyces cerevisiae, or Schizosaccharomyces
pombe, insect cells such as Drosophila S2 and Spodoptera Sf9,
animal cells such as CHO, COS or Bowes melanoma, and adenoviruses.
The selection of an appropriate host is within the abilities of
those skilled in the art.
The vector may be introduced into the host cells using any of a
variety of techniques, including transformation, transfection,
transduction, viral infection, gene guns, or Ti-mediated gene
transfer. Particular methods include calcium phosphate
transfection, DEAE-Dextran mediated transfection, lipofection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
Where appropriate, the engineered host cells can be cultured in
conventional nutrient media modified as appropriate for activating
promoters, selecting transformants or amplifying the genes of the
invention. Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter may be induced by appropriate means (e.g.,
temperature shift or chemical induction) and the cells may be
cultured for an additional period to allow them to produce the
desired polypeptide or fragment thereof.
Cells are typically harvested by centrifugation, disrupted by
physical or chemical means, and the resulting crude extract is
retained for further purification. Microbial cells employed for
expression of proteins can be disrupted by any convenient method,
including freeze-thaw cycling, sonication, mechanical disruption,
or use of cell lysing agents. Such methods are well known to those
skilled in the art. The expressed polypeptide or fragment thereof
can be recovered and purified from recombinant cell cultures by
methods including ammonium sulfate or ethanol precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Protein refolding steps
can be used, as necessary, in completing configuration of the
polypeptide. If desired, high performance liquid chromatography
(HPLC) can be employed for final purification steps.
Various mammalian cell culture systems can also be employed to
express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts
(described by Gluzman, Cell, 23:175, 1981), and other cell lines
capable of expressing proteins from a compatible vector, such as
the C127, 3T3, CHO, HeLa and BHK cell lines.
The constructs in host cells can be used in a conventional manner
to produce the gene product encoded by the recombinant sequence.
Depending upon the host employed in a recombinant production
procedure, the polypeptides produced by host cells containing the
vector may be glycosylated or may be non-glycosylated. Polypeptides
of the invention may or may not also include an initial methionine
amino acid residue. Additional details relating to the recombinant
expression of proteins are available to those skilled in the art.
For example, Protein Expression: A Practical Approach (Practical
Approach Series by S. J. Higgins (Editor), B. D. Hames (Editor)
(July 1999) Oxford University Press; ISBN: 0199636249 provides
ample guidance to the those skilled in the art for the expression
of proteins in a wide variety of organisms.
Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers. In
other aspects, fragments or portions of the polypeptides may be
employed for producing the corresponding full-length polypeptide by
peptide synthesis; therefore, the fragments may be employed as
intermediates for producing the full-length polypeptides.
As known by those skilled in the art, the nucleic acid sequences of
the invention can be optimized for expression in a variety of
organisms. In one aspect, sequences of the invention are optimized
for codon usage in an organism of interest, e.g., a fungus such as
S. cerevisiae or a bacterium such as E. coli. Optimization of
nucleic acid sequences for the purpose of codon usage is well
understood in the art to refer to the selection of a particular
codon favored by an organism to encode a particular amino acid.
Optimized codon usage tables are known for many organisms. For
example, see Transfer RNA in Protein Synthesis by Dolph L.
Hatfield, Byeong J. Lee, Robert M. Pirtle (Editor) (July 1992) CRC
Press; ISBN: 0849356989. Thus, the invention also includes nucleic
acids of the invention adapted for codon usage of an organism.
Optimized expression of nucleic acid sequences of the invention
also refers to directed or random mutagenesis of a nucleic acid to
effect increased expression of the encoded protein. The mutagenesis
of the nucleic acids of the invention can directly or indirectly
provide for an increased yield of expressed protein. By way of
non-limiting example, mutagenesis techniques described herein may
be utilized to effect mutation of the 5' untranslated region, 3'
untranslated region, or coding region of a nucleic acid, the
mutation of which can result in increased stability at the RNA or
protein level, thereby resulting in an increased yield of
protein.
Cell-free translation systems can also be employed to produce one
of the polypeptides of the invention, using mRNAs transcribed from
a DNA construct comprising a promoter operably linked to a nucleic
acid encoding the polypeptide or fragment thereof. In some aspects,
the DNA construct may be linearized prior to conducting an in vitro
transcription reaction. The transcribed mRNA is then incubated with
an appropriate cell-free translation extract, such as a rabbit
reticulocyte extract, to produce the desired polypeptide or
fragment thereof.
The invention also relates to variants of the polypeptides of the
invention. The term "variant" includes derivatives or analogs of
these polypeptides. In particular, the variants may differ in amino
acid sequence from the polypeptides of the invention, and sequences
substantially identical thereto, by one or more substitutions,
additions, deletions, fusions and truncations, which may be present
in any combination.
The variants may be naturally occurring or created in vitro. In
particular, such variants may be created using genetic engineering
techniques such as site directed mutagenesis, random chemical
mutagenesis, Exonuclease III deletion procedures, and standard
cloning techniques. Alternatively, such variants, fragments,
analogs, or derivatives may be created using chemical synthesis or
modification procedures.
Other methods of making variants are also familiar to those skilled
in the art. These include procedures in which nucleic acid
sequences obtained from natural isolates are modified to generate
nucleic acids which encode polypeptides having characteristics
which enhance their value in industrial or laboratory applications.
In such procedures, a large number of variant sequences having one
or more nucleotide differences with respect to the sequence
obtained from the natural isolate are generated and characterized.
Typically, these nucleotide differences result in amino acid
changes with respect to the polypeptides encoded by the nucleic
acids from the natural isolates.
For example, variants may be created using error prone PCR. In
error prone PCR, PCR is performed under conditions where the
copying fidelity of the DNA polymerase is low, such that a high
rate of point mutations is obtained along the entire length of the
PCR product. Error prone PCR is described in Leung, D. W., et al.,
Technique, 1:11-15, 1989) and Caldwell, R. C. and Joyce G. F., PCR
Methods Applic., 2:28-33, 1992. Briefly, in such procedures,
nucleic acids to be mutagenized are mixed with PCR primers,
reaction buffer, MgCl.sub.2, MnCl.sub.2, Taq polymerase and an
appropriate concentration of dNTPs for achieving a high rate of
point mutation along the entire length of the PCR product. For
example, the reaction may be performed using 20 fmoles of nucleic
acid to be mutagenized, 30 pmole of each PCR primer, a reaction
buffer comprising 50 mM KCl, 10 mM Tris HCl (pH 8.3) and 0.01%
gelatin, 7 mM MgCl.sub.2, 0.5 mM MnCl.sub.2, 5 units of Taq
polymerase, 0.2 mM dGTP, 0.2 mM dATP, 1 mM dCTP, and 1 mM dTTP. PCR
may be performed for 30 cycles of 94.degree. C. for 1 min,
45.degree. C. for 1 min, and 72.degree. C. for 1 min. However, it
will be appreciated that these parameters may be varied as
appropriate. The mutagenized nucleic acids are cloned into an
appropriate vector and the activities of the polypeptides encoded
by the mutagenized nucleic acids is evaluated.
Variants may also be created using oligonucleotide directed
mutagenesis to generate site-specific mutations in any cloned DNA
of interest. Oligonucleotide mutagenesis is described in
Reidhaar-Olson, J. F. and Sauer, R. T., et al., Science, 241:53-57,
1988. Briefly, in such procedures a plurality of double stranded
oligonucleotides bearing one or more mutations to be introduced
into the cloned DNA are synthesized and inserted into the cloned
DNA to be mutagenized. Clones containing the mutagenized DNA are
recovered and the activities of the polypeptides they encode are
assessed.
Another method for generating variants is assembly PCR. Assembly
PCR involves the assembly of a PCR product from a mixture of small
DNA fragments. A large number of different PCR reactions occur in
parallel in the same vial, with the products of one reaction
priming the products of another reaction. Assembly PCR is described
in pending U.S. patent application Ser. No. 08/677,112 filed Jul.
9, 1996, entitled, Method of "DNA Shuffling with Polynucleotides
Produced by Blocking or interrupting a Synthesis or Amplification
Process".
Still another method of generating variants is sexual PCR
mutagenesis. In sexual PCR mutagenesis, forced homologous
recombination occurs between DNA molecules of different but highly
related DNA sequence in vitro, as a result of random fragmentation
of the DNA molecule based on sequence homology, followed by
fixation of the crossover by primer extension in a PCR reaction.
Sexual PCR mutagenesis is described in Stemmer, W. P., PNAS, USA,
91:10747-10751, 1994. Briefly, in such procedures a plurality of
nucleic acids to be recombined are digested with DNase to generate
fragments having an average size of 50-200 nucleotides. Fragments
of the desired average size are purified and resuspended in a PCR
mixture. PCR is conducted under conditions which facilitate
recombination between the nucleic acid fragments. For example, PCR
may be performed by resuspending the purified fragments at a
concentration of 10-30 ng/:l in a solution of 0.2 mM of each dNTP,
2.2 mM MgCl2, 50 mM KCL, 10 mM Tris HCl, pH 9.0, and 0.1% Triton
X-100. 2.5 units of Taq polymerase per 100:1 of reaction mixture is
added and PCR is performed using the following regime: 94.degree.
C. for 60 seconds, 94.degree. C. for 30 seconds, 50-55.degree. C.
for 30 seconds, 72.degree. C. for 30 seconds (30-45 times) and
72.degree. C. for 5 minutes. However, it will be appreciated that
these parameters may be varied as appropriate. In some aspects,
oligonucleotides may be included in the PCR reactions. In other
aspects, the Klenow fragment of DNA polymerase I may be used in a
first set of PCR reactions and Taq polymerase may be used in a
subsequent set of PCR reactions. Recombinant sequences are isolated
and the activities of the polypeptides they encode are
assessed.
Variants may also be created by in vivo mutagenesis. In some
aspects, random mutations in a sequence of interest are generated
by propagating the sequence of interest in a bacterial strain, such
as an E. coli strain, which carries mutations in one or more of the
DNA repair pathways. Such "mutator" strains have a higher random
mutation rate than that of a wild type parent. Propagating the DNA
in one of these strains will eventually generate random mutations
within the DNA. Mutator strains suitable for use for in vivo
mutagenesis are described in PCT Publication No. WO 91/16427,
published Oct. 31, 1991, entitled "Methods for Phenotype Creation
from Multiple Gene Populations".
Variants may also be generated using cassette mutagenesis. In
cassette mutagenesis a small region of a double stranded DNA
molecule is replaced with a synthetic oligonucleotide "cassette"
that differs from the native sequence. The oligonucleotide often
contains completely and/or partially randomized native
sequence.
Recursive ensemble mutagenesis may also be used to generate
variants. Recursive ensemble mutagenesis is an algorithm for
protein engineering (protein mutagenesis) developed to produce
diverse populations of phenotypically related mutants whose members
differ in amino acid sequence. This method uses a feedback
mechanism to control successive rounds of combinatorial cassette
mutagenesis. Recursive ensemble mutagenesis is described in Arkin,
A. P. and Youvan, D. C., PNAS, USA, 89:7811-7815, 1992.
In some aspects, variants are created using exponential ensemble
mutagenesis. Exponential ensemble mutagenesis is a process for
generating combinatorial libraries with a high percentage of unique
and functional mutants, wherein small groups of residues are
randomized in parallel to identify, at each altered position, amino
acids which lead to functional proteins. Exponential ensemble
mutagenesis is described in Delegrave, S, and Youvan, D. C.,
Biotechnol. Res., 11:1548-1552, 1993. Random and site-directed
mutagenesis are described in Arnold, F. H., Current Opinion in
Biotechnology, 4:450-455, 1993.
In some aspects, the variants are created using shuffling
procedures wherein portions of a plurality of nucleic acids which
encode distinct polypeptides are fused together to create chimeric
nucleic acid sequences which encode chimeric polypeptides as
described in pending U.S. patent application Ser. No. 08/677,112
filed Jul. 9, 1996, entitled, "Method of DNA Shuffling with
Polynucleotides Produced by Blocking or interrupting a Synthesis or
Amplification Process", and pending U.S. patent application Ser.
No. 08/651,568 filed May 22, 1996, entitled, "Combinatorial Enzyme
Development."
The variants of the polypeptides of the invention may be variants
in which one or more of the amino acid residues of the polypeptides
of the invention are substituted with a conserved or non-conserved
amino acid residue (e.g., a conserved amino acid residue) and such
substituted amino acid residue may or may not be one encoded by the
genetic code.
Conservative substitutions are those that substitute a given amino
acid in a polypeptide by another amino acid of like
characteristics. Typically seen as conservative substitutions are
the following replacements: replacements of an aliphatic amino acid
such as Ala, Val, Leu and Ile with another aliphatic amino acid;
replacement of a Ser with a Thr or vice versa; replacement of an
acidic residue such as Asp and Glu with another acidic residue;
replacement of a residue bearing an amide group, such as Asn and
Gln, with another residue bearing an amide group; exchange of a
basic residue such as Lys and Arg with another basic residue; and
replacement of an aromatic residue such as Phe, Tyr with another
aromatic residue.
Other variants are those in which one or more of the amino acid
residues of the polypeptides of the invention includes a
substituent group.
Still other variants are those in which the polypeptide is
associated with another compound, such as a compound to increase
the half-life of the polypeptide (for example, polyethylene
glycol).
Additional variants are those in which additional amino acids are
fused to the polypeptide, such as a leader sequence, a secretory
sequence, a proprotein sequence or a sequence which facilitates
purification, enrichment, or stabilization of the polypeptide. In
some aspects, derivatives and analogs retain the same biological
function or activity as the polypeptides of the invention, and can
include a proprotein, such that the fragment, derivative, or analog
can be activated by cleavage of the proprotein portion to produce
an active polypeptide.
Optimizing Codons to Achieve High Levels of Protein Expression in
Host Cells
The invention provides methods for modifying phytase-encoding
nucleic acids to modify codon usage. In one aspect, the invention
provides methods for modifying codons in a nucleic acid encoding a
phytase to increase or decrease its expression in a host cell. The
invention also provides nucleic acids encoding a phytase modified
to increase its expression in a host cell, phytase enzymes so
modified, and methods of making the modified phytase enzymes. The
method comprises identifying a "non-preferred" or a "less
preferred" codon in phytase-encoding nucleic acid and replacing one
or more of these non-preferred or less preferred codons with a
"preferred codon" encoding the same amino acid as the replaced
codon and at least one non-preferred or less preferred codon in the
nucleic acid has been replaced by a preferred codon encoding the
same amino acid. A preferred codon is a codon over-represented in
coding sequences in genes in the host cell and a non-preferred or
less preferred codon is a codon under-represented in coding
sequences in genes in the host cell.
Host cells for expressing the nucleic acids, expression cassettes
and vectors of the invention include bacteria, yeast, fungi, plant
cells, insect cells and mammalian cells. Thus, the invention
provides methods for optimizing codon usage in all of these cells,
codon-altered nucleic acids and polypeptides made by the
codon-altered nucleic acids. Exemplary host cells include gram
negative bacteria, such as Escherichia coli and Pseudomonas
fluorescens; gram positive bacteria, such as Lactobacillus gasseri,
Lactococcus lactis, Lactococcus cremoris, Bacillus subtilis.
Exemplary host cells also include eukaryotic organisms, e.g.,
various yeast, such as Saccharomyces sp., including Saccharomyces
cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, and
Kluyveromyces lactis, Hansenula polymorpha, Aspergillus niger, and
mammalian cells and cell lines and insect cells and cell lines.
Thus, the invention also includes nucleic acids and polypeptides
optimized for expression in these organisms and species.
For example, the codons of a nucleic acid encoding an phytase
isolated from a bacterial cell are modified such that the nucleic
acid is optimally expressed in a bacterial cell different from the
bacteria from which the phytase was derived, a yeast, a fungi, a
plant cell, an insect cell or a mammalian cell. Methods for
optimizing codons are well known in the art, see, e.g., U.S. Pat.
No. 5,795,737; Baca (2000) Int. J. Parasitol. 30:113-118; Hale
(1998) Protein Expr. Purif. 12:185-188; Narum (2001) Infect. Immun.
69:7250-7253. See also Narum (2001) Infect. Immun. 69:7250-7253,
describing optimizing codons in mouse systems; Outchkourov (2002)
Protein Expr. Purif. 24:18-24, describing optimizing codons in
yeast; Feng (2000) Biochemistry 39:15399-15409, describing
optimizing codons in E. coli; Humphreys (2000) Protein Expr. Purif
20:252-264, describing optimizing codon usage that affects
secretion in E. coli.
Transgenic Non-Human Animals
The invention provides transgenic non-human animals comprising a
nucleic acid, a polypeptide, an expression cassette or vector or a
transfected or transformed cell of the invention. The transgenic
non-human animals can be, e.g., goats, rabbits, sheep, pigs, cows,
rats and mice, comprising the nucleic acids of the invention. These
animals can be used, e.g., as in vivo models to study phytase
activity, or, as models to screen for modulators of phytase
activity in vivo. The coding sequences for the polypeptides to be
expressed in the transgenic non-human animals can be designed to be
constitutive, or, under the control of tissue-specific,
developmental-specific or inducible transcriptional regulatory
factors. Transgenic non-human animals can be designed and generated
using any method known in the art; see, e.g., U.S. Pat. Nos.
6,211,428; 6,187,992; 6,156,952; 6,118,044; 6,111,166; 6,107,541;
5,959,171; 5,922,854; 5,892,070; 5,880,327; 5,891,698; 5,639,940;
5,573,933; 5,387,742; 5,087,571, describing making and using
transformed cells and eggs and transgenic mice, rats, rabbits,
sheep, pigs and cows. See also, e.g., Pollock (1999) J. Immunol.
Methods 231:147-157, describing the production of recombinant
proteins in the milk of transgenic dairy animals; Baguisi (1999)
Nat. Biotechnol. 17:456-461, demonstrating the production of
transgenic goats. U.S. Pat. No. 6,211,428, describes making and
using transgenic non-human mammals which express in their brains a
nucleic acid construct comprising a DNA sequence. U.S. Pat. No.
5,387,742, describes injecting cloned recombinant or synthetic DNA
sequences into fertilized mouse eggs, implanting the injected eggs
in pseudo-pregnant females, and growing to term transgenic mice
whose cells express proteins related to the pathology of
Alzheimer's disease. U.S. Pat. No. 6,187,992, describes making and
using a transgenic mouse whose genome comprises a disruption of the
gene encoding amyloid precursor protein (APP).
"Knockout animals" can also be used to practice the methods of the
invention. For example, in one aspect, the transgenic or modified
animals of the invention comprise a "knockout animal," e.g., a
"knockout mouse," engineered not to express or to be unable to
express a phytase.
In another aspect, transgenic non-human organisms are provided
which contain a heterologous sequence encoding a phytase of the
invention (e.g., the specifically enumerated sequence modifications
of SEQ ID NO:2). Various methods to make the transgenic animals of
the subject invention can be employed. Generally speaking, three
such methods may be employed. In one such method, an embryo at the
pronuclear stage (a "one cell embryo") is harvested from a female
and the transgene is microinjected into the embryo, in which case
the transgene will be chromosomally integrated into both the germ
cells and somatic cells of the resulting mature animal. In another
such method, embryonic stem cells are isolated and the transgene
incorporated therein by electroporation, plasmid transfection or
microinjection, followed by reintroduction of the stem cells into
the embryo where they colonize and contribute to the germ line.
Methods for microinjection of mammalian species is described in
U.S. Pat. No. 4,873,191.
In yet another exemplary method, embryonic cells are infected with
a retrovirus containing the transgene whereby the germ cells of the
embryo have the transgene chromosomally integrated therein. When
the animals to be made transgenic are avian, because avian
fertilized ova generally go through cell division for the first
twenty hours in the oviduct, microinjection into the pronucleus of
the fertilized egg is problematic due to the inaccessibility of the
pronucleus. Therefore, of the methods to make transgenic animals
described generally above, retrovirus infection is preferred for
avian species, for example as described in U.S. Pat. No. 5,162,215.
If micro-injection is to be used with avian species, however, a
published procedure by Love et al., (Biotechnol., 12 Jan. 1994) can
be utilized whereby the embryo is obtained from a sacrificed hen
approximately two and one-half hours after the laying of the
previous laid egg, the transgene is microinjected into the
cytoplasm of the germinal disc and the embryo is cultured in a host
shell until maturity. When the animals to be made transgenic are
bovine or porcine, microinjection can be hampered by the opacity of
the ova thereby making the nuclei difficult to identify by
traditional differential interference-contrast microscopy. To
overcome this problem, the ova can first be centrifuged to
segregate the pronuclei for better visualization.
In one aspect, the "non-human animals" of the invention include
bovine, porcine, ovine and avian animals (e.g., cow, pig, sheep,
chicken). The "transgenic non-human animals" of the invention are
produced by introducing "transgenes" into the germline of the
non-human animal. Embryonal target cells at various developmental
stages can be used to introduce transgenes. Different methods are
used depending on the stage of development of the embryonal target
cell. The zygote is the best target for micro-injection. The use of
zygotes as is target for gene transfer has a major advantage in
that in most cases the injected DNA will be incorporated into the
host gene before the first cleavage (Brinster et al., Proc. Natl.
Acad. Sci. USA 82:4438-4442, 1985). As a consequence, all cells of
the transgenic non-human animal will carry the incorporated
transgene. This will in general also be reflected in the efficient
transmission of the transgene to offspring of the founder since 50%
of the germ cells will harbor the transgene.
In one aspect, the term "transgenic" is used to describe an animal
which includes exogenous genetic material within all of its cells.
A "transgenic" animal can be produced by cross-breeding two
chimeric animals which include exogenous genetic material within
cells used in reproduction. Twenty-five percent of the resulting
offspring will be transgenic i.e., animals which include the
exogenous genetic material within all of their cells in both
alleles, 50% of the resulting animals will include the exogenous
genetic material within one allele and 25% will include no
exogenous genetic material.
In one aspect, a microinjection method is used to practice the
invention. The transgene is digested and purified free from any
vector DNA, e.g., by gel electrophoresis. In one aspect, the
transgene includes an operatively associated promoter which
interacts with cellular proteins involved in transcription,
ultimately resulting in constitutive expression. Promoters useful
in this regard include those from cytomegalovirus (CMV), Moloney
leukemia virus (MLV), and herpes virus, as well as those from the
genes encoding metallothionin, skeletal actin, P-enolpyruvate
carboxylase (PEPCK), phosphoglycerate (PGK), DHFR, and thymidine
kinase. Promoters for viral long terminal repeats (LTRs) such as
Rous Sarcoma Virus can also be employed. When the animals to be
made transgenic are avian, preferred promoters may include those
for the chicken .beta.-globin gene, chicken lysozyme gene, and
avian leukosis virus. Constructs useful in plasmid transfection of
embryonic stem cells will employ additional regulatory elements
well known in the art such as enhancer elements to stimulate
transcription, splice acceptors, termination and polyadenylation
signals, and ribosome binding sites to permit translation.
Retroviral infection can also be used to introduce transgene into a
non-human animal, as described above. The developing non-human
embryo can be cultured in vitro to the blastocyst stage. During
this time, the blastomeres can be targets for retroviral infection
(Jaenich, R., Proc. Natl. Acad. Sci. USA 73:1260-1264, 1976).
Efficient infection of the blastomeres is obtained by enzymatic
treatment to remove the zona pellucida (Hogan, et al. (1986) in
Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y.). The viral vector system used to
introduce the transgene is typically a replication-defective retro
virus carrying the transgene (Jahner, et al., Proc. Natl. Acad.
Sci. USA 82: 6927-6931, 1985; Van der Putten, et al., Proc. Natl.
Acad. Sci. USA 82: 6148-6152, 1985). Transfection is easily and
efficiently obtained by culturing the blastomeres on a monolayer of
virus-producing cells (Van der Putten, supra; Stewart, et al., EMBO
J. 6: 383-388, 1987). Alternatively, infection can be performed at
a later stage. Virus or virus-producing cells can be injected into
the blastocoele (D. Jahner et al., Nature 298: 623-628, 1982). Most
of the founders will be mosaic for the transgene since
incorporation occurs only in a subset of the cells which formed the
transgenic nonhuman animal. Further, the founder may contain
various retro viral insertions of the transgene at different
positions in the genome which generally will segregate in the
offspring. In addition, it is also possible to introduce transgenes
into the germ line, albeit with low efficiency, by intrauterine
retroviral infection of the midgestation embryo (D. Jahner et al.,
supra).
A third type of target cell for transgene introduction is the
embryonal stem cell (ES). ES cells are obtained from
pre-implantation embryos cultured in vitro and fused with embryos
(M. J. Evans et al., Nature 292:154-156, 1981; M. O. Bradley et
al., Nature 309:255-258, 1984; Gossler, et al., Proc. Natl. Acad.
Sci. USA 83:9065-9069, 1986; and Robertson et al., Nature
322:445-448, 1986). Transgenes can be efficiently introduced into
the ES cells by DNA transfection or by retro virus-mediated
transduction. Such transformed ES cells can thereafter be combined
with blastocysts from a nonhuman animal. The ES cells thereafter
colonize the embryo and contribute to the germ line of the
resulting chimeric animal. (For review see Jaenisch, R., Science
240:1468-1474, 1988).
In one aspect, the "transformed" means a cell into which (or into
an ancestor of which) has been introduced, by means of recombinant
nucleic acid techniques, a heterologous nucleic acid molecule.
"Heterologous" refers to a nucleic acid sequence that either
originates from another species or is modified from either its
original form or the form primarily expressed in the cell.
In one aspect, the "transgene" means any piece of DNA which is
inserted by artifice into a cell, and becomes part of the genome of
the organism (i.e., either stably integrated or as a stable
extrachromosomal element) which develops from that cell. Such a
transgene may include a gene which is partly or entirely
heterologous (i.e., foreign) to the transgenic organism, or may
represent a gene homologous to an endogenous gene of the organism.
Included within this definition is a transgene created by the
providing of an RNA sequence which is transcribed into DNA and then
incorporated into the genome. The transgenes of the invention
include DNA sequences which encode phytases or polypeptides having
phytase activity, and include polynucleotides, which may be
expressed in a transgenic non-human animal. The term "transgenic"
as used herein additionally includes any organism whose genome has
been altered by in vitro manipulation of the early embryo or
fertilized egg or by any transgenic technology to induce a specific
gene knockout. The term "gene knockout" as used herein, refers to
the targeted disruption of a gene in vivo with complete loss of
function that has been achieved by any transgenic technology
familiar to those in the art. In one aspect, transgenic animals
having gene knockouts are those in which the target gene has been
rendered nonfunctional by an insertion targeted to the gene to be
rendered non-functional by homologous recombination.
In one aspect, the term "transgenic" includes any transgenic
technology familiar to those in the art which can produce an
organism carrying an introduced transgene or one in which an
endogenous gene has been rendered non-functional or "knocked
out."
The transgene to be used in the practice of the subject invention
is a DNA sequence comprising a sequence coding for a phytase or a
polypeptide having phytase activity. In one aspect, a
polynucleotide having a sequence as set forth in SEQ ID NO:1 or a
sequence encoding a polypeptide having a sequence as set forth in
SEQ ID NO:2 is the transgene as the term is defined herein. Where
appropriate, DNA sequences that encode proteins having phytase
activity but differ in nucleic acid sequence due to the degeneracy
of the genetic code may also be used herein, as may truncated
forms, allelic variants and interspecies homologues.
In one aspect, after an embryo has been microinjected, colonized
with transfected embryonic stem cells or infected with a retrovirus
containing the transgene (except for practice of the subject
invention in avian species which is addressed elsewhere herein),
the embryo is implanted into the oviduct of a pseudopregnant
female. The consequent progeny are tested for incorporation of the
transgene by Southern blot analysis of blood or tissue samples
using transgene specific probes. PCR is particularly useful in this
regard. Positive progeny (G0) are crossbred to produce offspring
(G1) which are analyzed for transgene expression by Northern blot
analysis of tissue samples.
In one aspect, the methods comprise increasing the phosphorous
uptake in the transgenic animal and/or decreasing the amount of
polltant in the manure of the transgenic organism by about 15%,
about 20%, or about 20%, to about 50% or more.
In one aspect, the animals contemplated for use in the practice of
the subject invention are those animals generally regarded as
domesticated animals including pets (e.g., canines, felines, avian
species etc.) and those useful for the processing of food stuffs,
i.e., avian such as meat bred and egg laying chicken and turkey,
ovine such as lamb, bovine such as beef cattle and milk cows,
piscine and porcine. In one aspect, these animals are referred to
as "transgenic" when such animal has had a heterologous DNA
sequence, or one or more additional DNA sequences normally
endogenous to the animal (collectively referred to herein as
"transgenes") chromosomally integrated into the germ cells of the
animal. The transgenic animal (including its progeny) will also
have the transgene fortuitously integrated into the chromosomes of
somatic cells.
Screening Methodologies and "On-line" Monitoring Devices
In practicing the methods of the invention, a variety of apparatus
and methodologies can be used to in conjunction with the
polypeptides and nucleic acids of the invention, e.g., to screen
polypeptides for phytaseactivity, to screen compounds as potential
modulators of activity (e.g., potentiation or inhibition of enzyme
activity), for antibodies that bind to a polypeptide of the
invention, for nucleic acids that hybridize to a nucleic acid of
the invention, and the like.
Immobilized Enzyme Solid Supports
The phytase enzymes, fragments thereof and nucleic acids that
encode the enzymes and fragments can be affixed to a solid support.
This is often economical and efficient in the use of the phytases
in industrial processes. For example, a consortium or cocktail of
phytase enzymes (or active fragments thereof), which are used in a
specific chemical reaction, can be attached to a solid support and
dunked into a process vat. The enzymatic reaction can occur. Then,
the solid support can be taken out of the vat, along with the
enzymes affixed thereto, for repeated use. In one embodiment of the
invention, an isolated nucleic acid of the invention is affixed to
a solid support. In another embodiment of the invention, the solid
support is selected from the group of a gel, a resin, a polymer, a
ceramic, a glass, a microelectrode and any combination thereof.
For example, solid supports useful in this invention include gels.
Some examples of gels include Sepharose, gelatin, glutaraldehyde,
chitosan-treated glutaraldehyde, albumin-glutaraldehyde,
chitosan-Xanthan, toyopearl gel (polymer gel), alginate,
alginate-polylysine, carrageenan, agarose, glyoxyl agarose,
magnetic agarose, dextran-agarose, poly(Carbamoyl Sulfonate)
hydrogel, BSA-PEG hydrogel, phosphorylated polyvinyl alcohol (PVA),
monoaminoethyl-N-aminoethyl (MANA), amino, or any combination
thereof.
Another solid support useful in the present invention are resins or
polymers. Some examples of resins or polymers include cellulose,
acrylamide, nylon, rayon, polyester, anion-exchange resin,
AMBERLITE.TM. XAD-7, AMBERLITE.TM. XAD-8, AMBERLITE.TM. IRA-94,
AMBERLITE.TM. IRC-50, polyvinyl, polyacrylic, polymethacrylate, or
any combination thereof another type of solid support useful in the
present invention is ceramic. Some examples include non-porous
ceramic, porous ceramic, SiO.sub.2, Al.sub.2O.sub.3. Another type
of solid support useful in the present invention is glass. Some
examples include non-porous glass, porous glass, aminopropyl glass
or any combination thereof. Another type of solid support that can
be used is a microelectrode. An example is a
polyethyleneimine-coated magnetite. Graphitic particles can be used
as a solid support. Another example of a solid support is a cell,
such as a red blood cell.
Methods of Immobilization
There are many methods that would be known to one of skill in the
art for immobilizing enzymes or fragments thereof, or nucleic
acids, onto a solid support. Some examples of such methods include,
e.g., electrostatic droplet generation, electrochemical means, via
adsorption, via covalent binding, via cross-linking, via a chemical
reaction or process, via encapsulation, via entrapment, via calcium
alginate, or via poly (2-hydroxyethyl methacrylate). Like methods
are described in Methods in Enzymology, Immobilized Enzymes and
Cells, Part C. 1987. Academic Press. Edited by S. P. Colowick and
N. O. Kaplan. Volume 136; and Immobilization of Enzymes and Cells.
1997. Humana Press. Edited by G. F. Bickerstaff. Series: Methods in
Biotechnology, Edited by J. M. Walker.
Capillary Arrays
Capillary arrays, such as the GIGAMATRIX.TM., Diversa Corporation,
San Diego, Calif., can be used to in the methods of the invention.
Nucleic acids or polypeptides of the invention can be immobilized
to or applied to an array, including capillary arrays. Arrays can
be used to screen for or monitor libraries of compositions (e.g.,
small molecules, antibodies, nucleic acids, etc.) for their ability
to bind to or modulate the activity of a nucleic acid or a
polypeptide of the invention. Capillary arrays provide another
system for holding and screening samples. For example, a sample
screening apparatus can include a plurality of capillaries formed
into an array of adjacent capillaries, wherein each capillary
comprises at least one wall defining a lumen for retaining a
sample. The apparatus can further include interstitial material
disposed between adjacent capillaries in the array, and one or more
reference indicia formed within of the interstitial material. A
capillary for screening a sample, wherein the capillary is adapted
for being bound in an array of capillaries, can include a first
wall defining a lumen for retaining the sample, and a second wall
formed of a filtering material, for filtering excitation energy
provided to the lumen to excite the sample.
A polypeptide or nucleic acid, e.g., a ligand, can be introduced
into a first component into at least a portion of a capillary of a
capillary array. Each capillary of the capillary array can comprise
at least one wall defining a lumen for retaining the first
component. An air bubble can be introduced into the capillary
behind the first component. A second component can be introduced
into the capillary, wherein the second component is separated from
the first component by the air bubble. A sample of interest can be
introduced as a first liquid labeled with a detectable particle
into a capillary of a capillary array, wherein each capillary of
the capillary array comprises at least one wall defining a lumen
for retaining the first liquid and the detectable particle, and
wherein the at least one wall is coated with a binding material for
binding the detectable particle to the at least one wall. The
method can further include removing the first liquid from the
capillary tube, wherein the bound detectable particle is maintained
within the capillary, and introducing a second liquid into the
capillary tube.
The capillary array can include a plurality of individual
capillaries comprising at least one outer wall defining a lumen.
The outer wall of the capillary can be one or more walls fused
together. Similarly, the wall can define a lumen that is
cylindrical, square, hexagonal or any other geometric shape so long
as the walls form a lumen for retention of a liquid or sample. The
capillaries of the capillary array can be held together in close
proximity to form a planar structure. The capillaries can be bound
together, by being fused (e.g., where the capillaries are made of
glass), glued, bonded, or clamped side-by-side. The capillary array
can be formed of any number of individual capillaries, for example,
a range from 100 to 4,000,000 capillaries. A capillary array can
form a microtiter plate having about 100,000 or more individual
capillaries bound together.
Arrays, or "BioChips"
Nucleic acids or polypeptides of the invention can be immobilized
to or applied to an array. Arrays can be used to screen for or
monitor libraries of compositions (e.g., small molecules,
antibodies, nucleic acids, etc.) for their ability to bind to or
modulate the activity of a nucleic acid or a polypeptide of the
invention. For example, in one aspect of the invention, a monitored
parameter is transcript expression of a phytase gene. One or more,
or, all the transcripts of a cell can be measured by hybridization
of a sample comprising transcripts of the cell, or, nucleic acids
representative of or complementary to transcripts of a cell, by
hybridization to immobilized nucleic acids on an array, or
"biochip." By using an "array" of nucleic acids on a microchip,
some or all of the transcripts of a cell can be simultaneously
quantified. Alternatively, arrays comprising genomic nucleic acid
can also be used to determine the genotype of a newly engineered
strain made by the methods of the invention. "Polypeptide arrays"
can also be used to simultaneously quantify a plurality of
proteins.
In alternative aspects, "arrays" or "microarrays" or "biochips" or
"chips" of the invention comprise a plurality of target elements in
addition to a nucleic acid and/or a polypeptide or peptide of the
invention; each target element can comprises a defined amount of
one or more polypeptides (including antibodies) or nucleic acids
immobilized onto a defined area of a substrate surface, as
discussed in further detail, below.
The present invention can be practiced with any known "array," also
referred to as a "microarray" or "nucleic acid array" or
"polypeptide array" or "antibody array" or "biochip," or variation
thereof. Arrays are generically a plurality of "spots" or "target
elements," each target element comprising a defined amount of one
or more biological molecules, e.g., oligonucleotides, immobilized
onto a defined area of a substrate surface for specific binding to
a sample molecule, e.g., mRNA transcripts.
In practicing the methods of the invention, any known array and/or
method of making and using arrays can be incorporated in whole or
in part, or variations thereof, as described, for example, in U.S.
Pat. Nos. 6,277,628; 6,277,489; 6,261,776; 6,258,606; 6,054,270;
6,048,695; 6,045,996; 6,022,963; 6,013,440; 5,965,452; 5,959,098;
5,856,174; 5,830,645; 5,770,456; 5,632,957; 5,556,752; 5,143,854;
5,807,522; 5,800,992; 5,744,305; 5,700,637; 5,556,752; 5,434,049;
see also, e.g., WO 99/51773; WO 99/09217; WO 97/46313; WO 96/17958;
see also, e.g., Johnston (1998) Curr. Biol. 8:R171-R174; Schummer
(1997) Biotechniques 23:1087-1092; Kern (1997) Biotechniques
23:120-124; Solinas-Toldo (1997) Genes, Chromosomes & Cancer
20:399-407; Bowtell (1999) Nature Genetics Supp. 21:25-32. See also
published U.S. patent applications Nos. 20010018642; 20010019827;
20010016322; 20010014449; 20010014448; 20010012537;
20010008765.
Polypeptides and Peptides
The invention provides isolated, synthetic or recombinant
polypeptides having an amino acid sequence at least 95%, 96% 97%,
98% or 99% sequence identity to SEQ ID NO:2, and comprising at
least one of the mutations listed in Table 4, 5, 6, 7, 9, or any
combination thereof. The invention further provides isolated,
synthetic or recombinant nucleic acids encoding polypeptides having
an amino acid sequence at least 95%, 96% 97%, 98% or 99% sequence
identity to SEQ ID NO:2, and comprising at least one of the
mutations listed in Table 4, 5, 6, 7, 9, or any combination
thereof. For reference, the synthetically generated "parent" SEQ ID
NO:2 is:
TABLE-US-00004 Met Lys Ala Ile Leu Ile Pro Phe Leu Ser Leu Leu Ile
Pro Leu Thr 1 5 10 15 Pro Gln Ser Ala Phe Ala Gln Ser Glu Pro Glu
Leu Lys Leu Glu Ser 20 25 30 Val Val Ile Val Ser Arg His Gly Val
Arg Ala Pro Thr Lys Ala Thr 35 40 45 Gln Leu Met Gln Asp Val Thr
Pro Asp Ala Trp Pro Thr Trp Pro Val 50 55 60 Lys Leu Gly Glu Leu
Thr Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu 65 70 75 80 Gly His Tyr
Trp Arg Gln Arg Leu Val Ala Asp Gly Leu Leu Pro Lys 85 90 95 Cys
Gly Cys Pro Gln Ser Gly Gln Val Ala Ile Ile Ala Asp Val Asp 100 105
110 Glu Arg Thr Arg Lys Thr Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro
115 120 125 Asp Cys Ala Ile Thr Val His Thr Gln Ala Asp Thr Ser Ser
Pro Asp 130 135 140 Pro Leu Phe Asn Pro Leu Lys Thr Gly Val Cys Gln
Leu Asp Asn Ala 145 150 155 160 Asn Val Thr Asp Ala Ile Leu Glu Arg
Ala Gly Gly Ser Ile Ala Asp 165 170 175 Phe Thr Gly His Tyr Gln Thr
Ala Phe Arg Glu Leu Glu Arg Val Leu 180 185 190 Asn Phe Pro Gln Ser
Asn Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu 195 200 205 Ser Cys Ser
Leu Thr Gln Ala Leu Pro Ser Glu Leu Lys Val Ser Ala 210 215 220 Asp
Cys Val Ser Leu Thr Gly Ala Val Ser Leu Ala Ser Met Leu Thr 225 230
235 240 Glu Ile Phe Leu Leu Gln Gln Ala Gln Gly Met Pro Glu Pro Gly
Trp 245 250 255 Gly Arg Ile Thr Asp Ser His Gln Trp Asn Thr Leu Leu
Ser Leu His 260 265 270 Asn Ala Gln Phe Asp Leu Leu Gln Arg Thr Pro
Glu Val Ala Arg Ser 275 280 285 Arg Ala Thr Pro Leu Leu Asp Leu Ile
Lys Thr Ala Leu Thr Pro His 290 295 300 Pro Pro Gln Lys Gln Ala Tyr
Gly Val Thr Leu Pro Thr Ser Val Leu 305 310 315 320 Phe Ile Ala Gly
His Asp Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu 325 330 335 Glu Leu
Asn Trp Thr Leu Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly 340 345 350
Gly Glu Leu Val Phe Glu Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln 355
360 365 Trp Ile Gln Val Ser Leu Val Phe Gln Thr Leu Gln Gln Met Arg
Asp 370 375 380 Lys Thr Pro Leu Ser Leu Asn Thr Pro Pro Gly Glu Val
Lys Leu Thr 385 390 395 400 Leu Ala Gly Cys Glu Glu Arg Asn Ala Gln
Gly Met Cys Ser Leu Ala 405 410 415 Gly Phe Thr Gln Ile Val Asn Glu
Ala Arg Ile Pro Ala Cys Ser Leu 420 425 430
The sequence of the parental phytase SEQ ID NO:2, encoded by, e.g.,
SEQ ID NO:1, showing the gene site saturation mutagenesis
(GSSM)-generated sequence modifications selected for
GeneReassembly.TM. library construction, as described in Example 1,
are shown in FIG. 4. Parental phytase SEQ ID NO:2, encoded by,
e.g., SEQ ID NO:1 was subjected to further gene site saturation
mutagenesis (GSSM) sequence modifications, site directed
mutagenesis (SDM) and TMCA library construction, as described in
Example 2.
In one aspect, polypeptide and peptides of the invention have
phytase activity. In alternative aspects, they also can be useful
as, e.g., labeling probes, antigens, toleragens, motifs, phytase
active sites.
In alternative aspects, polypeptides and peptides of the invention
are synthetic or are recombinantly generated polypeptides. Peptides
and proteins can be recombinantly expressed in vitro or in vivo.
The peptides and polypeptides of the invention can be made and
isolated using any method known in the art. Polypeptide and
peptides of the invention can also be synthesized, whole or in
part, using chemical methods well known in the art. See e.g.,
Caruthers (1980) Nucleic Acids Res. Symp. Ser. 215-223; Horn (1980)
Nucleic Acids Res. Symp. Ser. 225-232; Banga, A. K., Therapeutic
Peptides and Proteins, Formulation, Processing and Delivery Systems
(1995) Technomic Publishing Co., Lancaster, Pa. For example,
peptide synthesis can be performed using various solid-phase
techniques (see e.g., Roberge (1995) Science 269:202; Merrifield
(1997) Methods Enzymol. 289:3 13) and automated synthesis may be
achieved, e.g., using the ABI 431A Peptide Synthesizer (Perkin
Elmer) in accordance with the instructions provided by the
manufacturer.
The enzymes and polynucleotides of the present invention can be
provided in an isolated form or purified to homogeneity. The
phytase polypeptide of the invention can be obtained using any of
several standard methods. For example, phytase polypeptides can be
produced in a standard recombinant expression system (as described
herein), chemically synthesized (although somewhat limited to small
phytase peptide fragments), or purified from organisms in which
they are naturally expressed. Useful recombinant expression methods
include mammalian hosts, microbial hosts, and plant hosts.
In alternative aspects, polypeptides and peptides of the invention
comprise "amino acids" or "amino acid sequences" that are
oligopeptides, peptides, polypeptides or protein sequences, or
alternatively, are fragments, portions or subunits of any of these,
and to naturally occurring or synthetic molecules.
In alternative aspects, "recombinant" polypeptides or proteins of
the invention include (refer to) polypeptides or proteins produced
by recombinant DNA techniques; e.g., produced from cells
transformed by an exogenous DNA construct encoding the desired
polypeptide or protein. "Synthetic" nucleic acids (including
oligonucleotides), polypeptides or proteins of the invention
include those prepared by chemical synthesis, as described in
detail herein. In alternative aspects, polypeptides or proteins of
the invention comprise amino acids joined to each other by peptide
bonds or modified peptide bonds, i.e., peptide isosteres, and may
contain modified amino acids other than the 20 gene-encoded amino
acids. The polypeptides may be modified by either natural
processes, such as post-translational processing, or by chemical
modification techniques that are well known in the art.
Modifications can occur anywhere in the polypeptide, including the
peptide backbone, the amino acid side-chains and the amino or
carboxyl termini. It will be appreciated that the same type of
modification may be present in the same or varying degrees at
several sites in a given polypeptide. Also a given polypeptide may
have many types of modifications, for example, acetylation,
acylation, ADP-ribosylation, amidation, covalent attachment of
flavin, covalent attachment of a heme moiety, covalent attachment
of a nucleotide or nucleotide derivative, covalent attachment of a
lipid or lipid derivative, covalent attachment of a
phosphatidylinositol, cross-linking cyclization, disulfide bond
formation, demethylation, formation of covalent cross-links,
formation of cysteine, formation of pyroglutamate, formylation,
gamma-carboxylation, glycosylation, GPI anchor formation,
hydroxylation, iodination, methylation, myristolyation, oxidation,
pegylation, proteolytic processing, phosphorylation, prenylation,
racemization, selenoylation, sulfation, and transfer-RNA mediated
addition of amino acids to protein such as arginylation.
In alternative aspects, "synthetic" polypeptides or protein are
those prepared by chemical synthesis. Solid-phase chemical peptide
synthesis methods can also be used to synthesize the polypeptide or
fragments of the invention. Such method have been known in the art
since the early 1960's (Merrifield, R. B., J. Am. Chem. Soc.,
85:2149-2154, 1963) (See also Stewart, J. M. and Young, J. D.,
Solid Phase Peptide Synthesis, 2 ed., Pierce Chemical Co.,
Rockford, Ill., pp. 11-12)) and have recently been employed in
commercially available laboratory peptide design and synthesis kits
(Cambridge Research Biochemicals). Such commercially available
laboratory kits have generally utilized the teachings of H. M.
Geysen et al, Proc. Natl. Acad. Sci., USA, 81:3998 (1984) and
provide for synthesizing peptides upon the tips of a multitude of
"rods" or "pins" all of which are connected to a single plate. When
such a system is utilized, a plate of rods or pins is inverted and
inserted into a second plate of corresponding wells or reservoirs,
which contain solutions for attaching or anchoring an appropriate
amino acid to the pin's or rod's tips. By repeating such a process
step, i.e., inverting and inserting the rod and pin's tips into
appropriate solutions, amino acids are built into desired peptides.
In addition, a number of available FMOC peptide synthesis systems
are available. For example, assembly of a polypeptide or fragment
can be carried out on a solid support using an Applied Biosystems,
Inc. Model 431A automated peptide synthesizer. Such equipment
provides ready access to the peptides of the invention, either by
direct synthesis or by synthesis of a series of fragments that can
be coupled using other known techniques.
In alternative aspects, peptides and polypeptides of the invention
are glycosylated. The glycosylation can be added
post-translationally either chemically or by cellular biosynthetic
mechanisms, wherein the later incorporates the use of known
glycosylation motifs, which can be native to the sequence or can be
added as a peptide or added in the nucleic acid coding sequence.
The glycosylation can be O-linked or N-linked, or, a combination
thereof.
In alternative aspects, peptides and polypeptides of the invention,
as defined above, comprise "mimetic" and "peptidomimetic" forms,
either in part or completely. In one aspect, the terms "mimetic"
and "peptidomimetic" refer to a synthetic chemical compound which
has substantially the same structural and/or functional
characteristics of the polypeptides of the invention. The mimetic
can be either entirely composed of synthetic, non-natural analogues
of amino acids, or, is a chimeric molecule of partly natural
peptide amino acids and partly non-natural analogs of amino acids.
The mimetic can also incorporate any amount of natural amino acid
conservative substitutions as long as such substitutions also do
not substantially alter the mimetic's structure and/or activity. As
with polypeptides of the invention which are conservative variants,
routine experimentation will determine whether a mimetic is within
the scope of the invention, i.e., that its structure and/or
function is not substantially altered. Thus, in one aspect, a
mimetic composition is within the scope of the invention if it has
a phytase activity.
In alternative aspects, peptides and polypeptides of the invention
have sequences comprising the specific modification to SEQ ID NO:2,
as defined above, and also conservative substitutions that may or
may not modify activity, e.g., enzymatic activity. In alternative
aspects, conservative substitutions are those that substitute a
given amino acid in a polypeptide by another amino acid of like
characteristics. In alternative aspects, conservative substitutions
are the following replacements: replacements of an aliphatic amino
acid such as Ala, Val, Leu and Ile with another aliphatic amino
acid; replacement of a Ser with a Thr or vice versa; replacement of
an acidic residue such as Asp and Glu with another acidic residue;
replacement of a residue bearing an amide group, such as Asn and
Gln, with another residue bearing an amide group; exchange of a
basic residue such as Lys and Arg with another basic residue; and
replacement of an aromatic residue such as Phe, Tyr with another
aromatic residue.
Polypeptide mimetic compositions of the invention can contain any
combination of non-natural structural components. In alternative
aspect, mimetic compositions of the invention include one or all of
the following three structural groups: a) residue linkage groups
other than the natural amide bond ("peptide bond") linkages; b)
non-natural residues in place of naturally occurring amino acid
residues; or c) residues which induce secondary structural mimicry,
i.e., to induce or stabilize a secondary structure, e.g., a beta
turn, gamma turn, beta sheet, alpha helix conformation, and the
like. For example, a polypeptide of the invention can be
characterized as a mimetic when all or some of its residues are
joined by chemical means other than natural peptide bonds.
Individual peptidomimetic residues can be joined by peptide bonds,
other chemical bonds or coupling means, such as, e.g.,
glutaraldehyde, N-hydroxysuccinimide esters, bifunctional
maleimides, N,N'-dicyclohexylcarbodiimide (DCC) or
N,N'-diisopropylcarbodiimide (DIC). Linking groups that can be an
alternative to the traditional amide bond ("peptide bond") linkages
include, e.g., ketomethylene (e.g., --C(.dbd.O)--CH2- for
--C(.dbd.O)--NH--), aminomethylene (CH2-NH), ethylene, olefin
(CH.dbd.CH), ether (CH2-O), thioether (CH2-S), tetrazole (CN4-),
thiazole, retroamide, thioamide, or ester (see, e.g., Spatola
(1983) in Chemistry and Biochemistry of Amino Acids, Peptides and
Proteins, Vol. 7, pp 267-357, "Peptide Backbone Modifications,"
Marcell Dekker, NY).
A polypeptide of the invention can also be characterized as a
mimetic by containing all or some non-natural residues in place of
naturally occurring amino acid residues. Non-natural residues are
well described in the scientific and patent literature; a few
exemplary non-natural compositions useful as mimetics of natural
amino acid residues and guidelines are described below. Mimetics of
aromatic amino acids can be generated by replacing by, e.g., D- or
L-naphylalanine; D- or L-phenylglycine; D- or L-2 thieneylalanine;
D- or L-1, -2, 3-, or 4-pyreneylalanine; D- or L-3 thieneylalanine;
D- or L-(2-pyridinyl)-alanine; D- or L-(3-pyridinyl)-alanine; D- or
L-(2-pyrazinyl)-alanine; D- or L-(4-isopropyl)-phenylglycine;
D-(trifluoromethyl)-phenylglycine;
D-(trifluoromethyl)-phenylalanine; D-p-fluoro-phenylalanine; D- or
L-p-biphenylphenylalanine; K- or L-p-methoxy-biphenylphenylalanine;
D- or L-2-indole(alkyl)alanines; and, D- or L-alkylainines, where
alkyl can be substituted or unsubstituted methyl, ethyl, propyl,
hexyl, butyl, pentyl, isopropyl, iso-butyl, sec-isotyl, iso-pentyl,
or a non-acidic amino acids. Aromatic rings of a non-natural amino
acid include, e.g., thiazolyl, thiophenyl, pyrazolyl,
benzimidazolyl, naphthyl, furanyl, pyrrolyl, and pyridyl aromatic
rings.
Mimetics of acidic amino acids can be generated by substitution by,
e.g., non-carboxylate amino acids while maintaining a negative
charge; (phosphono)alanine; sulfated threonine. Carboxyl side
groups (e.g., aspartyl or glutamyl) can also be selectively
modified by reaction with carbodiimides (R'--N--C--N--R') such as,
e.g., 1-cyclohexyl-3(2-morpholinyl-(4-ethyl) carbodiimide or
1-ethyl-3(4-azonia-4,4-dimetholpentyl) carbodiimide. Aspartyl or
glutamyl can also be converted to asparaginyl and glutaminyl
residues by reaction with ammonium ions. Mimetics of basic amino
acids can be generated by substitution with, e.g., (in addition to
lysine and arginine) the amino acids ornithine, citrulline, or
(guanidino)-acetic acid, or (guanidino)alkyl-acetic acid, where
alkyl is defined above. Nitrile derivative (e.g., containing the
CN-moiety in place of COOH) can be substituted for asparagine or
glutamine. Asparaginyl and glutaminyl residues can be deaminated to
the corresponding aspartyl or glutamyl residues. Arginine residue
mimetics can be generated by reacting arginyl with, e.g., one or
more conventional reagents, including, e.g., phenylglyoxal,
2,3-butanedione, 1,2-cyclo-hexanedione, or ninhydrin, which for
these reagents it may be preferable to use alkaline conditions.
Tyrosine residue mimetics can be generated by reacting tyrosyl
with, e.g., aromatic diazonium compounds or tetranitromethane.
N-acetylimidizol and tetranitromethane can be used to form O-acetyl
tyrosyl species and 3-nitro derivatives, respectively. Cysteine
residue mimetics can be generated by reacting cysteinyl residues
with, e.g., alpha-haloacetates such as 2-chloroacetic acid or
chloroacetamide and corresponding amines; to give carboxymethyl or
carboxyamidomethyl derivatives. Cysteine residue mimetics can also
be generated by reacting cysteinyl residues with, e.g.,
bromo-trifluoroacetone, alpha-bromo-beta-(5-imidozoyl) propionic
acid; chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl
disulfide; methyl 2-pyridyl disulfide; p-chloromercuribenzoate;
2-chloromercuri-4 nitrophenol; or,
chloro-7-nitrobenzo-oxa-1,3-diazole. Lysine mimetics can be
generated (and amino terminal residues can be altered) by reacting
lysinyl with, e.g., succinic or other carboxylic acid anhydrides.
Lysine and other alpha-amino-containing residue mimetics can also
be generated by reaction with imidoesters, such as methyl
picolinimidate, pyridoxal phosphate, pyridoxal, chloroborohydride,
trinitro-benzenesulfonic acid, O-methylisourea, 2,4, pentanedione,
and transamidase-catalyzed reactions with glyoxylate. Mimetics of
methionine can be generated by reaction with, e.g., methionine
sulfoxide. Mimetics of proline include, e.g., pipecolic acid,
thiazolidine carboxylic acid, 3- or 4-hydroxy proline,
dehydroproline, 3- or 4-methylproline, or 3,3,-dimethylproline.
Histidine residue mimetics can be generated by reacting histidyl
with, e.g., diethylprocarbonate or para-bromophenacyl bromide.
Other mimetics include, e.g., those generated by hydroxylation of
proline and lysine; phosphorylation of the hydroxyl groups of seryl
or threonyl residues; methylation of the alpha-amino groups of
lysine, arginine and histidine; acetylation of the N-terminal
amine; methylation of main chain amide residues or substitution
with N-methyl amino acids; or amidation of C-terminal carboxyl
groups.
A residue, e.g., an amino acid, of a polypeptide of the invention
can also be replaced by an amino acid (or peptidomimetic residue)
of the opposite chirality. Thus, any amino acid naturally occurring
in the L-configuration (which can also be referred to as the R or
S, depending upon the structure of the chemical entity) can be
replaced with the amino acid of the same chemical structural type
or a peptidomimetic, but of the opposite chirality, referred to as
the D-amino acid, but also can be referred to as the R-- or S--
form.
The invention also provides methods for modifying the polypeptides
of the invention by either natural processes, such as
post-translational processing (e.g., phosphorylation, acylation,
etc), or by chemical modification techniques, and the resulting
modified polypeptides. Modifications can occur anywhere in the
polypeptide, including the peptide backbone, the amino acid
side-chains and the amino or carboxyl termini. It will be
appreciated that the same type of modification may be present in
the same or varying degrees at several sites in a given
polypeptide. Also a given polypeptide may have many types of
modifications. Modifications include acetylation, acylation,
ADP-ribosylation, amidation, covalent attachment of flavin,
covalent attachment of a heme moiety, covalent attachment of a
nucleotide or nucleotide derivative, covalent attachment of a lipid
or lipid derivative, covalent attachment of a phosphatidylinositol,
cross-linking cyclization, disulfide bond formation, demethylation,
formation of covalent cross-links, formation of cysteine, formation
of pyroglutamate, formylation, gamma-carboxylation, glycosylation,
GPI anchor formation, hydroxylation, iodination, methylation,
myristolyation, oxidation, pegylation, proteolytic processing,
phosphorylation, prenylation, racemization, selenoylation,
sulfation, and transfer-RNA mediated addition of amino acids to
protein such as arginylation. See, e.g., Creighton, T. E.,
Proteins--Structure and Molecular Properties 2nd Ed., W.H. Freeman
and Company, New York (1993); Posttranslational Covalent
Modification of Proteins, B. C. Johnson, Ed., Academic Press, New
York, pp. 1-12 (1983).
Solid-phase chemical peptide synthesis methods can also be used to
synthesize the polypeptide or fragments of the invention. Such
method have been known in the art since the early 1960's
(Merrifield, R. B., J. Am. Chem. Soc., 85:2149-2154, 1963) (See
also Stewart, J. M. and Young, J. D., Solid Phase Peptide
Synthesis, 2nd Ed., Pierce Chemical Co., Rockford, Ill., pp.
11-12)) and have recently been employed in commercially available
laboratory peptide design and synthesis kits (Cambridge Research
Biochemicals). Such commercially available laboratory kits have
generally utilized the teachings of H. M. Geysen et al, Proc. Natl.
Acad. Sci., USA, 81:3998 (1984) and provide for synthesizing
peptides upon the tips of a multitude of "rods" or "pins" all of
which are connected to a single plate. When such a system is
utilized, a plate of rods or pins is inverted and inserted into a
second plate of corresponding wells or reservoirs, which contain
solutions for attaching or anchoring an appropriate amino acid to
the pin's or rod's tips. By repeating such a process step, i.e.,
inverting and inserting the rod's and pin's tips into appropriate
solutions, amino acids are built into desired peptides. In
addition, a number of available FMOC peptide synthesis systems are
available. For example, assembly of a polypeptide or fragment can
be carried out on a solid support using an Applied Biosystems, Inc.
Model 431A.TM. automated peptide synthesizer. Such equipment
provides ready access to the peptides of the invention, either by
direct synthesis or by synthesis of a series of fragments that can
be coupled using other known techniques.
In one aspect, peptides and polypeptides of the invention have
sequences comprising the specific modification to SEQ ID NO:2, as
defined above, and also "substantially identical" amino acid
sequences, i.e., a sequence that differs by one or more
conservative or non-conservative amino acid substitutions,
deletions, or insertions, particularly when such a substitution
occurs at a site that is not the active site of the molecule, and
provided that the polypeptide essentially retains its functional
properties. In one aspect, peptides and polypeptides of the
invention have sequences comprising the specific modification to
SEQ ID NO:2, as defined above, and conservative amino acid
substitutions that substitute one amino acid for another of the
same class, for example, substitution of one hydrophobic amino
acid, such as isoleucine, valine, leucine, or methionine, for
another, or substitution of one polar amino acid for another, such
as substitution of arginine for lysine, glutamic acid for aspartic
acid or glutamine for asparagine. In one aspect, one or more amino
acids can be deleted, for example, from a phytase polypeptide of
the invention to result in modification of the structure of the
polypeptide without significantly altering its biological activity,
or alternative, to purposely significantly alter its biological
activity. For example, amino- or carboxyl-terminal amino acids that
are required, or alternatively are not required, for phytase
biological activity can be removed and/or added. Modified
polypeptide sequences of the invention can be assayed for phytase
biological activity by any number of methods, including contacting
the modified polypeptide sequence with a phytase substrate and
determining whether the modified polypeptide decreases the amount
of specific substrate in the assay or increases the bioproducts of
the enzymatic reaction of a functional phytase polypeptide with the
substrate.
Another aspect of the invention comprises polypeptides having about
70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%,
83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%,
96%, 97%, 98%, 99%, or more sequence identity to SEQ ID NO:2 and
having one of the specific enumerated sequence modifications, as
discussed (set forth) above.
These amino acid sequence variants of the invention can be
characterized by a predetermined nature of the variation, a feature
that sets them apart from a naturally occurring form, e.g., an
allelic or interspecies variation of a phytase sequence. In one
aspect, the variants of the invention exhibit the same qualitative
biological activity as the naturally occurring analogue.
Alternatively, the variants can be selected for having modified
characteristics. In one aspect, while the site or region for
introducing an amino acid sequence variation is predetermined, the
mutation per se need not be predetermined. For example, in order to
optimize the performance of a mutation at a given site, random
mutagenesis may be conducted at the target codon or region and the
expressed phytase variants screened for the optimal combination of
desired activity. Techniques for making substitution mutations at
predetermined sites in DNA having a known sequence are well known,
as discussed herein for example, M13 primer mutagenesis and PCR
mutagenesis. Screening of the mutants can be done using, e.g.,
assays of catalysis of phytate (myo-inositol-hexaphosphate) to
inositol and inorganic phosphate; or, the hydrolysis of phytate
(myo-inositol-hexaphosphate). In alternative aspects, amino acid
substitutions can be single residues; insertions can be on the
order of from about 1 to 20 amino acids, although considerably
larger insertions can be done. Deletions can range from about 1 to
about 20, 30, 40, 50, 60, 70 residues or more. To obtain a final
derivative with the optimal properties, substitutions, deletions,
insertions or any combination thereof may be used. Generally, these
changes are done on a few amino acids to minimize the alteration of
the molecule. However, larger changes may be tolerated in certain
circumstances.
Polypeptides of the invention may be obtained through biochemical
enrichment or purification procedures. The sequence of potentially
homologous polypeptides or fragments may be determined by
proteolytic digestion, gel electrophoresis and/or
microsequencing.
Another aspect of the invention is an assay for identifying
fragments or variants of polypeptides of the invention.
Polypeptides of the invention may be used to catalyze biochemical
reactions to indicate that said fragment or variant retains the
enzymatic activity of a polypeptides of the invention.
An exemplary assay for determining if fragments of variants retain
the enzymatic activity of the polypeptides of the invention
comprises: contacting the polypeptide fragment or variant with a
substrate molecule under conditions which allow the polypeptide
fragment or variant to function, and detecting either a decrease in
the level of substrate or an increase in the level of the specific
reaction product of the reaction between the polypeptide and
substrate.
Polypeptides of the invention may be used to catalyze biochemical
reactions. In accordance with one aspect of the invention, there is
provided a process for utilizing a polypeptide of the invention as
a phytase.
The invention provides phytases having no or modified signal
sequences (also called signal peptides (SPs), or leader peptides),
or heterologous signal sequences. The polypeptides of the invention
also can have no or modified or heterologous prepro domains and/or
catalytic domains (CDs). The modified or heterologous SPs, prepro
domains and/or CDs incorporated in a polypeptide the invention can
be part of a fusion protein, e.g., as a heterologous domain in a
chimeric protein, or added by a chemical linking agent. For
example, an enzyme of the invention can comprise a heterologous SP
and/or prepro in a vector, e.g., a pPIC series vector (Invitrogen,
Carlsbad, Calif.).
Additionally, polypeptides of the invention can further comprise
heterologous sequences, either sequences from other phytases, or
from non-phytase sources, or entirely synthetic sequences. Thus, in
one aspect, a nucleic acid of the invention comprises coding
sequence for an endogenous, modified or heterologous signal
sequence (SP), prepro domain and/or catalytic domain (CD) and a
heterologous sequence (i.e., a sequence not naturally associated
with the a signal sequence (SP), prepro domain and/or catalytic
domain (CD) of the invention). The heterologous sequence can be on
the 3' terminal end, 5' terminal end, and/or on both ends of the
SP, prepro domain and/or CD coding sequence.
Methods for identifying "prepro" domain sequences and signal
sequences are well known in the art, see, e.g., Van de Ven (1993)
Crit. Rev. Oncog. 4(2):115-136. For example, to identify a prepro
sequence, the protein is purified from the extracellular space and
the N-terminal protein sequence is determined and compared to the
unprocessed form. Various methods of recognition of signal
sequences are known to those of skill in the art. For example, in
one aspect, signal peptides for use with polypeptides of the
invention are identified by a method referred to as SignalP.
SignalP uses a combined neural network which recognizes both signal
peptides and their cleavage sites; see, e.g., Nielsen (1997)
"Identification of prokaryotic and eukaryotic signal peptides and
prediction of their cleavage sites" Protein Engineering 10:1-6.
The invention provides phytase enzymes where the structure of the
polypeptide backbone, the secondary or the tertiary structure,
e.g., an alpha-helical or beta-sheet structure, has been modified.
In one aspect, the charge or hydrophobicity has been modified. In
one aspect, the bulk of a side chain has been modified. Substantial
changes in function or immunological identity are made by selecting
substitutions that are less conservative. For example,
substitutions can be made which more significantly affect: the
structure of the polypeptide backbone in the area of the
alteration, for example an alpha-helical or a beta-sheet structure;
a charge or a hydrophobic site of the molecule, which can be at an
active site; or a side chain. The invention provides substitutions
in polypeptide of the invention where (a) a hydrophilic residues,
e.g. seryl or threonyl, is substituted for (or by) a hydrophobic
residue, e.g. leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b)
a cysteine or proline is substituted for (or by) any other residue;
(c) a residue having an electropositive side chain, e.g. lysyl,
arginyl, or histidyl, is substituted for (or by) an electronegative
residue, e.g. glutamyl or aspartyl; or (d) a residue having a bulky
side chain, e.g. phenylalanine, is substituted for (or by) one not
having a side chain, e.g. glycine. The variants can exhibit the
same qualitative biological activity (i.e., phytase enzyme
activity) although variants can be selected to modify the
characteristics of the phytase as needed.
In one aspect, phytases of the invention comprise epitopes or
purification tags, signal sequences or other fusion sequences, etc.
In one aspect, phytases of the invention can be fused to a random
peptide to form a fusion polypeptide. By "fused" or "operably
linked" herein is meant that the random peptide and the phytase are
linked together, in such a manner as to minimize the disruption to
the stability of phytase activity. The fusion polypeptide (or
fusion polynucleotide encoding the fusion polypeptide) can comprise
further components as well, including multiple peptides at multiple
loops.
In one aspect, phytases of the invention are chimeric polypeptides,
e.g., comprising heterologous SPs, carbohydrate binding modules,
phytase enzyme catalytic domains, linkers and/or non-phytase
catalytic domains. The invention provides a means for generating
chimeric polypeptides which may encode biologically active hybrid
polypeptides (e.g., hybrid phytase enzymes). In one aspect, the
original polynucleotides encode biologically active polypeptides.
The method of the invention produces new hybrid polypeptides by
utilizing cellular processes which integrate the sequence of the
original polynucleotides such that the resulting hybrid
polynucleotide encodes a polypeptide demonstrating activities
derived from the original biologically active polypeptides. For
example, the original polynucleotides may encode a particular
enzyme from different microorganisms. An enzyme encoded by a first
polynucleotide from one organism or variant may, for example,
function effectively under a particular environmental condition,
e.g. high salinity. An enzyme encoded by a second polynucleotide
from a different organism or variant may function effectively under
a different environmental condition, such as extremely high
temperatures. A hybrid polynucleotide containing sequences from the
first and second original polynucleotides may encode an enzyme
which exhibits characteristics of both enzymes encoded by the
original polynucleotides. Thus, the enzyme encoded by the hybrid
polynucleotide may function effectively under environmental
conditions shared by each of the enzymes encoded by the first and
second polynucleotides, e.g., high salinity and extreme
temperatures.
Thus, a hybrid polypeptide resulting from this method of the
invention may exhibit specialized enzyme activity not displayed in
the original enzymes. For example, following recombination and/or
reductive reassortment of polynucleotides encoding phytase enzymes,
the resulting hybrid polypeptide encoded by a hybrid polynucleotide
can be screened for specialized enzyme activities, e.g., hydrolase,
peptidase, phosphorylase, etc., activities, obtained from each of
the original enzymes. Thus, for example, the hybrid polypeptide may
be screened to ascertain those chemical functionalities which
distinguish the hybrid polypeptide from the original parent
polypeptides, such as the temperature, pH or salt concentration at
which the hybrid polypeptide functions.
A hybrid polypeptide resulting from the method of the invention may
exhibit specialized enzyme activity not displayed in the original
enzymes. For example, following recombination and/or reductive
reassortment of polynucleotides encoding hydrolase activities, the
resulting hybrid polypeptide encoded by a hybrid polynucleotide can
be screened for specialized hydrolase activities obtained from each
of the original enzymes, i.e., the type of bond on which the
hydrolase acts and the temperature at which the hydrolase
functions. Thus, for example, a phytase may be screened to
ascertain those chemical functionalities which distinguish the
hybrid phytase from the original phytases, such as: (a) amide
(peptide bonds), i.e., proteases; (b) ester bonds, i.e., esterases
and lipases; (c) acetals, i.e., glycosidases and, for example, the
temperature, pH or salt concentration at which the hybrid
polypeptide functions.
In one aspect, the invention relates to a method for producing a
biologically active hybrid polypeptide and screening such a
polypeptide for enhanced activity by:
(1) introducing at least a first polynucleotide in operable linkage
and a second polynucleotide in operable linkage, said at least
first polynucleotide and second polynucleotide sharing at least one
region of partial sequence homology, into a suitable host cell;
(2) growing the host cell under conditions which promote sequence
reorganization resulting in a hybrid polynucleotide in operable
linkage;
(3) expressing a hybrid polypeptide encoded by the hybrid
polynucleotide;
(4) screening the hybrid polypeptide under conditions which promote
identification of enhanced biological activity; and
(5) isolating the a polynucleotide encoding the hybrid
polypeptide.
Methods for screening for various enzyme activities are known to
those of skill in the art and are discussed throughout the present
specification. Such methods may be employed when isolating the
polypeptides and polynucleotides of the invention.
In one aspect, the instant invention provides a method (and
products thereof) of producing stabilized aqueous liquid
formulations having phytase activity that exhibit increased
resistance to heat inactivation of the enzyme activity and which
retain their phytase activity during prolonged periods of storage.
The liquid formulations are stabilized by means of the addition of
urea and/or a polyol such as sorbitol and glycerol as stabilizing
agent. Also provided are feed preparations for monogastric animals
and methods for the production thereof that result from the use of
such stabilized aqueous liquid formulations. Additional details
regarding this approach are in the public literature and/or are
known to the skilled artisan. In a particular non-limiting
exemplification, such publicly available literature includes EP
0626010 (WO 9316175 A1) (Barendse et al.), although references in
the publicly available literature do not teach the inventive
molecules of the instant application.
Antibodies and Antibody-Based Screening Methods
The invention provides isolated, synthetic or recombinant
antibodies that specifically bind to a phytase of the invention.
These antibodies can be used to isolate, identify or quantify the
phytases of the invention or related polypeptides. These antibodies
can be used to inhibit the activity of an enzyme of the invention.
These antibodies can be used to isolated polypeptides related to
those of the invention, e.g., related phytase enzymes.
Antibodies of the invention can comprise a peptide or polypeptide
derived from, modeled after or substantially encoded by an
immunoglobulin gene or immunoglobulin genes, or fragments thereof,
capable of specifically binding an antigen or epitope, see, e.g.
Fundamental Immunology, Third Edition, W. E. Paul, ed., Raven
Press, N.Y. (1993); Wilson (1994) J. Immunol. Methods 175:267-273;
Yarmush (1992) J. Biochem. Biophys. Methods 25:85-97. The term
antibody includes antigen-binding portions, i.e., "antigen binding
sites," (e.g., fragments, subsequences, complementarity determining
regions (CDRs)) that retain capacity to bind antigen, including (i)
a Fab fragment, a monovalent fragment consisting of the VL, VH, CL
and CH1 domains; (ii) a F(ab')2 fragment, a bivalent fragment
comprising two Fab fragments linked by a disulfide bridge at the
hinge region; (iii) a Fd fragment consisting of the VH and CH1
domains; (iv) a Fv fragment consisting of the VL and VH domains of
a single arm of an antibody, (v) a dAb fragment (Ward et al.,
(1989) Nature 341:544-546), which consists of a VH domain; and (vi)
an isolated complementarity determining region (CDR). Single chain
antibodies are also included by reference in the term
"antibody."
The antibodies can be used in immunoprecipitation, staining (e.g.,
FACS), immunoaffinity columns, and the like. If desired, nucleic
acid sequences encoding for specific antigens can be generated by
immunization followed by isolation of polypeptide or nucleic acid,
amplification or cloning and immobilization of polypeptide onto an
array of the invention. Alternatively, the methods of the invention
can be used to modify the structure of an antibody produced by a
cell to be modified, e.g., an antibody's affinity can be increased
or decreased. Furthermore, the ability to make or modify antibodies
can be a phenotype engineered into a cell by the methods of the
invention.
Methods of immunization, producing and isolating antibodies
(polyclonal and monoclonal) are known to those of skill in the art
and described in the scientific and patent literature, see, e.g.,
Coligan, CURRENT PROTOCOLS IN IMMUNOLOGY, Wiley/Greene, NY (1991);
Stites (eds.) BASIC AND CLINICAL IMMUNOLOGY (7th ed.) Lange Medical
Publications, Los Altos, Calif. ("Stites"); Goding, MONOCLONAL
ANTIBODIES: PRINCIPLES AND PRACTICE (2d ed.) Academic Press, New
York, N.Y. (1986); Kohler (1975) Nature 256:495; Harlow (1988)
ANTIBODIES, A LABORATORY MANUAL, Cold Spring Harbor Publications,
New York. Antibodies also can be generated in vitro, e.g., using
recombinant antibody binding site expressing phage display
libraries, in addition to the traditional in vivo methods using
animals. See, e.g., Hoogenboom (1997) Trends Biotechnol. 15:62-70;
Katz (1997) Annu. Rev. Biophys. Biomol. Struct. 26:27-45.
The polypeptides can be used to generate antibodies which bind
specifically to the polypeptides of the invention. The resulting
antibodies may be used in immunoaffinity chromatography procedures
to isolate or purify the polypeptide or to determine whether the
polypeptide is present in a biological sample. In such procedures,
a protein preparation, such as an extract, or a biological sample
is contacted with an antibody capable of specifically binding to
one of the polypeptides of the invention.
In immunoaffinity procedures, the antibody is attached to a solid
support, such as a bead or other column matrix. The protein
preparation is placed in contact with the antibody under conditions
in which the antibody specifically binds to one of the polypeptides
of the invention. After a wash to remove non-specifically bound
proteins, the specifically bound polypeptides are eluted.
The ability of proteins in a biological sample to bind to the
antibody may be determined using any of a variety of procedures
familiar to those skilled in the art. For example, binding may be
determined by labeling the antibody with a detectable label such as
a fluorescent agent, an enzymatic label, or a radioisotope.
Alternatively, binding of the antibody to the sample may be
detected using a secondary antibody having such a detectable label
thereon. Particular assays include ELISA assays, sandwich assays,
radioimmunoassays, and Western Blots.
Polyclonal antibodies generated against the polypeptides of the
invention can be obtained by direct injection of the polypeptides
into an animal or by administering the polypeptides to an animal,
for example, a nonhuman. The antibody so obtained will then bind
the polypeptide itself. In this manner, even a sequence encoding
only a fragment of the polypeptide can be used to generate
antibodies which may bind to the whole native polypeptide. Such
antibodies can then be used to isolate the polypeptide from cells
expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which
provides antibodies produced by continuous cell line cultures can
be used. Examples include the hybridoma technique, the trioma
technique, the human B-cell hybridoma technique, and the
EBV-hybridoma technique (see, e.g., Cole (1985) in Monoclonal
Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain antibodies
(see, e.g., U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to the polypeptides of the invention.
Alternatively, transgenic mice may be used to express humanized
antibodies to these polypeptides or fragments thereof.
Antibodies generated against the polypeptides of the invention may
be used in screening for similar polypeptides from other organisms
and samples. In such techniques, polypeptides from the organism are
contacted with the antibody and those polypeptides which
specifically bind the antibody are detected. Any of the procedures
described above may be used to detect antibody binding.
Kits
The invention provides kits comprising the compositions, e.g.,
nucleic acids, expression cassettes, vectors, cells, polypeptides
(e.g., phytases) and/or antibodies of the invention. The kits also
can contain instructional material teaching the methodologies and
industrial uses of the invention, as described herein.
The polypeptides of the invention may also be used to generate
antibodies which bind specifically to the enzyme polypeptides or
fragments. The resulting antibodies may be used in immunoaffinity
chromatography procedures to isolate or purify the polypeptide or
to determine whether the polypeptide is present in a biological
sample. In such procedures, a protein preparation, such as an
extract, or a biological sample is contacted with an antibody
capable of specifically binding to one of a polypeptide of SEQ ID
NO:2, sequences substantially identical thereto, or fragments of
the foregoing sequences.
In immunoaffinity procedures, the antibody is attached to a solid
support, such as a bead or other column matrix. The protein
preparation is placed in contact with the antibody under conditions
in which the antibody specifically binds to one of the polypeptides
of SEQ ID NO:2, sequences substantially identical thereto, or
fragment thereof. After a wash to remove non-specifically bound
proteins, the specifically bound polypeptides are eluted.
The isolated polynucleotide sequences, polypeptide sequence,
variants and mutants thereof can be measured for retention of
biological activity characteristic to the enzyme of the present
invention, for example, in an assay for detecting enzymatic phytase
activity (Food Chemicals Codex, 4.sup.th Ed.). Such enzymes include
truncated forms of phytase, and variants such as deletion and
insertion variants of the polypeptide sequence as set forth in SEQ
ID NO:2. These phytases have thermotolerance. That is, the phytase
has a residual specific activity of about 90% after treatment at
70.degree. C. for 30 minutes and about 50% after treatment at
75.degree. C. for 30 minutes. The thermotolerance of the invention
phytases is advantageous in using the enzyme as a feed additive as
the feed can be molded, granulated, or pelletized at a high
temperature.
For example, in one aspect, the invention provides an edible
pelletized enzyme delivery matrix and method of use for delivery of
phytase to an animal, for example as a nutritional supplement. The
enzyme delivery matrix readily releases a phytase enzyme, such as
one having the amino acid sequence of SEQ ID NO:2 or at least 30
contiguous amino acids thereof, in aqueous media, such as, for
example, the digestive fluid of an animal. The invention enzyme
delivery matrix is prepared from a granulate edible carrier
selected from such components as grain germ that is spent of oil,
hay, alfalfa, timothy, soy hull, sunflower seed meal, wheat meal,
and the like, that readily disperse the recombinant enzyme
contained therein into aqueous media. In use, the edible pelletized
enzyme delivery matrix is administered to an animal to delivery of
phytase to the animal. Suitable grain-based substrates may comprise
or be derived from any suitable edible grain, such as wheat, corn,
soy, sorghum, alfalfa, barley, and the like. An exemplary
grain-based substrate is a corn-based substrate. The substrate may
be derived from any suitable part of the grain, e.g., a grain germ,
approved for animal feed use, such as corn germ that is obtained in
a wet or dry milling process. The grain germ can comprise spent
germ, which is grain germ from which oil has been expelled, such as
by pressing or hexane or other solvent extraction. Alternatively,
the grain germ is expeller extracted, that is, the oil has been
removed by pressing.
The enzyme delivery matrix of the invention is in the form of
discrete plural particles, pellets or granules. By "granules" is
meant particles that are compressed or compacted, such as by a
pelletizing, extrusion, or similar compacting to remove water from
the matrix. Such compression or compacting of the particles also
promotes intraparticle cohesion of the particles. For example, the
granules can be prepared by pelletizing the grain-based substrate
in a pellet mill. The pellets prepared thereby are ground or
crumbled to a granule size suitable for use as an adjuvant in
animal feed. Since the matrix is itself approved for use in animal
feed, it can be used as a diluent for delivery of enzymes in animal
feed.
The enzyme delivery matrix can be in the form of granules having a
granule size ranging from about 4 to about 400 mesh (USS); or about
8 to about 80 mesh; or about 14 to about 20 mesh. If the grain germ
is spent via solvent extraction, use of a lubricity agent such as
corn oil may be necessary in the pelletizer, but such a lubricity
agent ordinarily is not necessary if the germ is expeller
extracted. In other aspects of the invention, the matrix is
prepared by other compacting or compressing processes such as, for
example, by extrusion of the grain-based substrate through a die
and grinding of the extrudate to a suitable granule size.
The enzyme delivery matrix may further include a polysaccharide
component as a cohesiveness agent to enhance the cohesiveness of
the matrix granules. The cohesiveness agent is believed to provide
additional hydroxyl groups, which enhance the bonding between grain
proteins within the matrix granule. It is further believed that the
additional hydroxyl groups so function by enhancing the hydrogen
bonding of proteins to starch and to other proteins. The
cohesiveness agent may be present in any amount suitable to enhance
the cohesiveness of the granules of the enzyme delivery matrix.
Suitable cohesiveness agents include one or more of dextrins,
maltodextrins, starches, such as corn starch, flours, cellulosics,
hemicellulosics, and the like. For example, the percentage of grain
germ and cohesiveness agent in the matrix (not including the
enzyme) is 78% corn germ meal and 20% by weight of corn starch.
Because the enzyme-releasing matrix of the invention is made from
biodegradable materials, the matrix may be subject to spoilage,
such as by molding. To prevent or inhibit such molding, the matrix
may include a mold inhibitor, such as a propionate salt, which may
be present in any amount sufficient to inhibit the molding of the
enzyme-releasing matrix, thus providing a delivery matrix in a
stable formulation that does not require refrigeration.
The phytase enzyme contained in the invention enzyme delivery
matrix and methods is in one aspect a thermotolerant phytase, as
described herein, so as to resist inactivation of the phytase
during manufacture where elevated temperatures and/or steam may be
employed to prepare the pelletized enzyme delivery matrix. During
digestion of feed containing the invention enzyme delivery matrix,
aqueous digestive fluids will cause release of the active enzyme.
Other types of thermotolerant enzymes and nutritional supplements
that are thermotolerant can also be incorporated in the delivery
matrix for release under any type of aqueous conditions.
A coating can be applied to the invention enzyme matrix particles
for many different purposes, such as to add a flavor or nutrition
supplement to animal feed, to delay release of animal feed
supplements and enzymes in gastric conditions, and the like. Or,
the coating may be applied to achieve a functional goal, for
example, whenever it is desirable to slow release of the enzyme
from the matrix particles or to control the conditions under which
the enzyme will be released. The composition of the coating
material can be such that it is selectively broken down by an agent
to which it is susceptible (such as heat, acid or base, enzymes or
other chemicals). Alternatively, two or more coatings susceptible
to different such breakdown agents may be consecutively applied to
the matrix particles.
The invention is also directed towards a process for preparing an
enzyme-releasing matrix. In accordance with the invention, the
process comprises providing discrete plural particles of a
grain-based substrate in a particle size suitable for use as an
enzyme-releasing matrix, wherein the particles comprise a phytase
enzyme of the invention. The process can include compacting or
compressing the particles of enzyme-releasing matrix into granules,
which can be accomplished by pelletizing. The mold inhibitor and
cohesiveness agent, when used, can be added at any suitable time,
and can be mixed with the grain-based substrate in the desired
proportions prior to pelletizing of the grain-based substrate.
Moisture content in the pellet mill feed can be in the ranges set
forth above with respect to the moisture content in the finished
product, or about 14% to 15%, or about 10% to 20%. Moisture can be
added to the feedstock in the form of an aqueous preparation of the
enzyme to bring the feedstock to this moisture content. The
temperature in the pellet mill can be brought to about 82.degree.
C. with steam. The pellet mill may be operated under any conditions
that impart sufficient work to the feedstock to provide pellets.
The pelleting process itself is a cost-effective process for
removing water from the enzyme-containing composition.
In one aspect, the pellet mill is operated with a 1/8 in. by 2 in.
die at 100 lb./min. pressure at 82.degree. C. to provide pellets,
which then are crumbled in a pellet mill crumbler to provide
discrete plural particles having a particle size capable of passing
through an 8 mesh screen but being retained on a 20 mesh
screen.
The thermotolerant phytases described herein can have high optimum
temperatures and can have high heat resistance or heat tolerance.
Thus, the phytases of the invention can carry out enzymatic
reactions at temperatures normally considered above optimum. The
phytases of the invention also can carry out enzymatic reactions
after being exposed to high temperatures (thermotolerance being the
ability to retain enzymatic activity at temperatures where the wild
type phytase is active after previously being exposed to high
temperatures, even if the high temperature can inactivate or
diminish the enzyme's activity, see also definition of
thermotolerance, above). The gene encoding the phytase according to
the present invention can be used in preparation of phytases (e.g.
using GSSM and/or TMCA technology, as described herein) having
characteristics different from those of the phytase of SEQ ID NO:2
(in terms of optimum pH, optimum temperature, heat resistance,
stability to solvents, specific activity, affinity to substrate,
secretion ability, translation rate, transcription control and the
like). Furthermore, the polynucleotides of the invention may be
employed for screening of variant phytases prepared by the methods
described herein to determine those having a desired activity, such
as improved or modified thermostability or thermotolerance. For
example, U.S. Pat. No. 5,830,732, describes a screening assay for
determining thermotolerance of a phytase.
An in vitro example of such a screening assay is the following
assay for the detection of phytase activity: Phytase activity can
be measured by incubating 150 .mu.l of the enzyme preparation with
600 .mu.l of 2 mM sodium phytate in 100 mM Tris HCl buffer, pH 7.5,
supplemented with 1 mM CaCl.sub.2 for 30 minutes at 37.degree. C.
After incubation the reaction is stopped by adding 750 .mu.l of 5%
trichloroacetic acid. Phosphate released was measured against
phosphate standard spectrophotometrically at 700 nm after adding
1500 .mu.l of the color reagent (4 volumes of 1.5% ammonium
molybdate in 5.5% sulfuric acid and 1 volume of 2.7% ferrous
sulfate; Shimizu, 1992). One unit of enzyme activity is defined as
the amount of enzyme required to liberate one .mu.mol Pi per min
under assay conditions. Specific activity can be expressed in units
of enzyme activity per mg of protein. The enzyme of the present
invention has enzymatic activity with respect to the hydrolysis of
phytate to inositol and free phosphate.
In one aspect, the instant invention provides a method of
hydrolyzing phytate comprised of contacting the phytate with one or
more of the novel phytase molecules disclosed herein (e.g.,
proteins having the specific modifications of SEQ ID NO:2).
Accordingly, the invention provides a method for catalyzing the
hydrolysis of phytate to inositol and free phosphate with release
of minerals from the phytic acid complex. The method includes
contacting a phytate substrate with a degrading effective amount of
an enzyme of the invention. The term "degrading effective" amount
refers to the amount of enzyme which is required to degrade at
least 50% of the phytate, as compared to phytate not contacted with
the enzyme. 80% of the phytate can be degraded.
In another aspect, the invention provides a method for hydrolyzing
phospho-mono-ester bonds in phytate. The method includes
administering an effective amount of phytase molecules of the
invention, to yield inositol and free phosphate. In one aspect, an
"effective" amount refers to the amount of enzyme which is required
to hydrolyze at least 50% of the phospho-mono-ester bonds, as
compared to phytate not contacted with the enzyme. In one aspect,
at least 80% of the bonds are hydrolyzed.
In a particular aspect, when desired, the phytase molecules may be
used in combination with other reagents, such as other catalysts;
in order to effect chemical changes (e.g. hydrolysis) in the
phytate molecules and/or in other molecules of the substrate
source(s). According to this aspect, the phytase molecules and the
additional reagent(s) will not inhibit each other. The phytase
molecules and the additional reagent(s) can have an overall
additive effect, or, alternatively, phytase molecules and the
additional reagent(s) can have an overall synergistic effect.
Relevant sources of the substrate phytate molecules include
foodstuffs, potential foodstuffs, byproducts of foodstuffs (both in
vitro byproducts and in vivo byproducts, e.g. ex vivo reaction
products and animal excremental products), precursors of
foodstuffs, and any other material source of phytate.
In a non-limiting aspect, the recombinant phytase can be consumed
by organisms and retains activity upon consumption. In another
exemplification, transgenic approaches can be used to achieve
expression of the recombinant phytase--e.g., in a controlled
fashion (methods are available for controlling expression of
transgenic molecules in time-specific and tissue specific
manners).
In one aspect, the phytase activity in the source material (e.g. a
transgenic plant source or a recombinant prokaryotic host) may be
increased upon consumption; this increase in activity may occur,
for example, upon conversion of a precursor phytase molecule in
pro-form to a significantly more active enzyme in a more mature
form, where said conversion may result, for example, from the
ingestion and digestion of the phytase source. Hydrolysis of the
phytate substrate may occur at any time upon the contacting of the
phytase with the phytate; for example, this may occur before
ingestion or after ingestion or both before and after ingestion of
either the substrate or the enzyme or both. It is additionally
appreciated that the phytate substrate may be contacted with--in
addition to the phytase--one or more additional reagents, such as
another enzyme, which may be also be applied either directly or
after purification from its source material.
It is appreciated that the phytase source material(s) can be
contacted directly with the phytate source material(s); e.g. upon
in vitro or in vivo grinding or chewing of either or both the
phytase source(s) and the phytate source(s). Alternatively the
phytase enzyme may be purified away from source material(s), or the
phytate substrate may be purified away from source material(s), or
both the phytase enzyme and the phytate substrate may be purified
away from source material(s) prior to the contacting of the phytase
enzyme with the phytate substrate. It is appreciated that a
combination of purified and unpurified reagents--including
enzyme(s) or substrates(s) or both--may be used.
It is appreciated that more than one source material may be used as
a source of phytase activity. This is serviceable as one way to
achieve a timed release of reagent(s) from source material(s),
where release from different reagents from their source materials
occur differentially, for example as ingested source materials are
digested in vivo or as source materials are processed in in vitro
applications. The use of more than one source material of phytase
activity is also serviceable to obtain phytase activities under a
range of conditions and fluctuations thereof, that may be
encountered--such as a range of pH values, temperatures,
salinities, and time intervals--for example during different
processing steps of an application. The use of different source
materials is also serviceable in order to obtain different
reagents, as exemplified by one or more forms or isomers of phytase
and/or phytate and/or other materials.
It is appreciated that a single source material, such a transgenic
plant species (or plant parts thereof), may be a source material of
both phytase and phytate; and that enzymes and substrates may be
differentially compartmentalized within said single source--e.g.
secreted vs. non-secreted, differentially expressed and/or having
differential abundances in different plant parts or organs or
tissues or in subcellular compartments within the same plant part
or organ or tissue. Purification of the phytase molecules contained
therein may comprise isolating and/or further processing of one or
more desirable plant parts or organs or tissues or subcellular
compartments.
In one aspect, this invention provides a method of catalyzing in
vivo and/or in vitro reactions using seeds containing enhanced
amounts of enzymes. The method comprises adding transgenic,
non-wild type seeds, e.g., in a ground form, to a reaction mixture
and allowing the enzymes in the seeds to increase the rate of
reaction. By directly adding the seeds to the reaction mixture the
method provides a solution to the more expensive and cumbersome
process of extracting and purifying the enzyme. Methods of
treatment are also provided whereby an organism lacking a
sufficient supply of an enzyme is administered the enzyme in the
form of seeds from one or more plant species, e.g., transgenic
plant species, containing enhanced amounts of the enzyme.
Additional details regarding this approach are in the public
literature and/or are known to the skilled artisan. In a particular
non-limiting exemplification, such publicly available literature
includes U.S. Pat. No. 5,543,576 (Van Ooijen et al.) and U.S. Pat.
No. 5,714,474 (Van Ooijen et al.), although these reference do not
teach the inventive molecules of the instant application and
instead teach the use of fungal phytases.
In one aspect, the instant phytase molecules are serviceable for
generating recombinant digestive system life forms (or microbes or
flora) and for the administration of said recombinant digestive
system life forms to animals. Administration may be optionally
performed alone or in combination with other enzymes and/or with
other life forms that can provide enzymatic activity in a digestive
system, where said other enzymes and said life forms may be may
recombinant or otherwise. For example, administration may be
performed in combination with xylanolytic bacteria.
In one aspect, the present invention provides a method for steeping
corn or sorghum kernels in warm water containing sulfur dioxide in
the presence of an enzyme preparation comprising one or more
phytin-degrading enzymes, e.g., in such an amount that the phytin
present in the corn or sorghum is substantially degraded. The
enzyme preparation may comprise phytase and/or acid phosphatase and
optionally other plant material degrading enzymes. The steeping
time may be 12 to 18 hours. The steeping may be interrupted by an
intermediate milling step, reducing the steeping time. In one
aspect, corn or sorghum kernels are steeped in warm water
containing sulfur dioxide in the presence of an enzyme preparation
including one or more phytin-degrading enzymes, such as phytase and
acid phosphatases, to eliminate or greatly reduce phytic acid and
the salts of phytic acid. Additional details regarding this
approach are in the public literature and/or are known to the
skilled artisan, e.g., U.S. Pat. No. 4,914,029, (Caransa et al.)
and EP 0321004 (Vaara et al.).
In one aspect, the present invention provides a method to obtain a
bread dough having desirable physical properties such as
non-tackiness and elasticity and a bread product of superior
quality such as a specific volume comprising adding phytase
molecules to the bread dough. In one aspect, phytase molecules of
the instant invention are added to a working bread dough
preparation that is subsequently formed and baked. Additional
details regarding this approach are in the public literature and/or
are known to the skilled artisan, for example, JP 03076529 (Hara et
al.).
In one aspect, the present invention provides a method to produce
improved soybean foodstuffs. Soybeans are combined with phytase
molecules of the instant invention to remove phytic acid from the
soybeans, thus producing soybean foodstuffs that are improved in
their supply of trace nutrients essential for consuming organisms
and in its digestibility of proteins. In one aspect, in the
production of soybean milk, phytase molecules of the instant
invention are added to or brought into contact with soybeans in
order to reduce the phytic acid content. In a non-limiting
exemplification, the application process can be accelerated by
agitating the soybean milk together with the enzyme under heating
or by a conducting a mixing-type reaction in an agitation container
using an immobilized enzyme. Additional details regarding this
approach are in the public literature and/or are known to the
skilled artisan, for example, JP 59166049 (Kamikubo et al.).
In one aspect, the instant invention provides a method of producing
an admixture product for drinking water or animal feed in fluid
form, and which comprises using mineral mixtures and vitamin
mixtures, and also novel phytase molecules of the instant
invention. In a one aspect, there is achieved a correctly dosed and
composed mixture of necessary nutrients for the consuming organism
without any risk of precipitation and destruction of important
minerals/vitamins, while at the same time optimum utilization is
made of the phytin-bound phosphate in the feed. Additional details
regarding this approach are in the public literature and/or are
known to the skilled artisan, e.g., EP 0772978 (Bendixen et
al.).
It is appreciated that the phytase molecules of the instant
invention may also be used to produce other alcoholic and
non-alcoholic drinkable foodstuffs (or drinks) based on the use of
molds and/or on grains and/or on other plants. These drinkable
foodstuffs include liquors, wines, mixed alcoholic drinks (e.g.
wine coolers, other alcoholic coffees such as Irish coffees, etc.),
beers, near-beers, juices, extracts, homogenates, and purees. In
one aspect, the instantly disclosed phytase molecules are used to
generate transgenic versions of molds and/or grains and/or other
plants serviceable for the production of such drinkable foodstuffs.
In another aspect, the instantly disclosed phytase molecules are
used as additional ingredients in the manufacturing process and/or
in the final content of such drinkable foodstuffs. Additional
details regarding this approach are in the public literature and/or
are known to the skilled artisan.
In one aspect, the present invention provides a means to obtain
refined sake having a reduced amount of phytin and an increased
content of inositol. Such a sake may have--through direct and/or
psychogenic effects--a preventive action on hepatic disease,
arteriosclerosis, and other diseases. In one aspect, a sake is
produced from rice Koji by multiplying a rice Koji mold having high
phytase activity as a raw material. It is appreciated that the
phytase molecules of the instant invention may be used to produce a
serviceable mold with enhanced activity (e.g., a transgenic mold)
and/or added exogenously to augment the effects of a Koji mold. The
strain is added to boiled rice and Koji is produced by a
conventional procedure. In one exemplification, the prepared Koji
is used, the whole rice is prepared at two stages and Sake is
produced at constant Sake temperature of 15.degree. C. to give the
objective refined Sake having a reduced amount of phytin and an
increased amount of inositol. Additional details regarding this
approach are in the public literature and/or are known to the
skilled artisan, for example, JP 06153896 (Soga et al.) and JP
06070749 (Soga et al.).
In one aspect, the present invention provides a method to obtain an
absorbefacient capable of promoting the absorption of minerals
including ingested calcium without being digested by gastric juices
or intestinal juices at a low cost. In one aspect, the mineral
absorbefacient contains a partial hydrolysate of phytic acid as an
active ingredient. A partial hydrolysate of the phytic acid can be
produced by hydrolyzing the phytic acid or its salts using novel
phytase molecules of the instant invention. The treatment with the
phytase molecules may occur either alone and/or in a combination
treatment (to inhibit or to augment the final effect), and is
followed by inhibiting the hydrolysis within a range so as not to
liberate all the phosphate radicals. Additional details regarding
this approach are in the public literature and/or are known to the
skilled artisan, e.g., JP 04270296 (Hoshino).
In one aspect, the present invention provides a method (and
products therefrom) to produce an enzyme composition having an
additive or a synergistic phytate hydrolyzing activity; said
composition comprises novel phytase molecules of the instant
invention and one or more additional reagents to achieve a
composition that is serviceable for a combination treatment. In one
aspect, the combination treatment of the present invention is
achieved with the use of at least two phytases of different
position specificity, i.e. any combinations of 1-, 2-, 3-, 4-, 5-,
and 6-phytases. By combining phytases of different position
specificity an additive or synergistic effect is obtained.
Compositions such as food and feed or food and feed additives
comprising such phytases in combination are also included in this
invention as are processes for their preparation. Additional
details regarding this approach are in the public literature and/or
are known to the skilled artisan, e.g., WO 30681 (Ohmann et
al.).
In another aspect, the combination treatment of the present
invention is achieved with the use of an acid phosphatase having
phytate hydrolyzing activity at a pH of 2.5, in a low ratio
corresponding to a pH 2.5:5.0 activity profile of from about
0.1:1.0 to 10:1, or of from about 0.5:1.0 to 5:1, or from about
0.8:1.0 to 3:1, or from about 0.8:1.0 to 2:1. The enzyme
composition can display a higher synergetic phytate hydrolyzing
efficiency through thermal treatment. The enzyme composition is
serviceable in the treatment of foodstuffs (drinkable and solid
food, feed and fodder products) to improve phytate hydrolysis.
Additional details or alternative protocols regarding this approach
are in the public literature and/or are known to the skilled
artisan, e.g., U.S. Pat. No. 5,554,399 (Vanderbeke et al.) and U.S.
Pat. No. 5,443,979 (Vanderbeke et al.), teaching the use of fungal
(in particular Aspergillus) phytases.
In another aspect, the present invention provides a method (and
products therefrom) to produce a composition comprising the instant
novel phytate-acting enzyme in combination with one or more
additional enzymes that act on polysaccharides. Such
polysaccharides can be selected from the group consisting of
arabinans, fructans, fucans, galactans, galacturonans, glucans,
mannans, xylans, levan, fucoidan, carrageenan, galactocarolose,
pectin, pectic acid, amylose, pullulan, glycogen, amylopectin,
cellulose, carboxylmethylcellulose, hydroxypropylmethylcellulose,
dextran, pustulan, chitin, agarose, keratan, chondroitin, dermatan,
hyaluronic acid, alginic acid, and polysaccharides containing at
least one aldose, ketose, acid or amine selected from the group
consisting of erythrose, threose, ribose, arabinose, xylose,
lyxose, allose, altrose, glucose, mannose, gulose, idose,
galactose, talose, erythrulose, ribulose, xylulose, psicose,
fructose, sorbose, tagatose, glucuronic acid, gluconic acid,
glucaric acid, galacturonic acid, mannuronic acid, glucosamine,
galactosamine and neuraminic acid.
In one aspect, the present invention provides a method (and
products therefrom) to produce a composition having a synergistic
phytate hydrolyzing activity comprising one or more novel phytase
molecules of the instant invention, a cellulase (can also include a
xylanase), optionally a protease, and optionally one or more
additional reagents. In alternative aspects, such combination
treatments are serviceable in the treatment of foodstuffs, wood
products, such as paper products, and as cleansing solutions and
solids.
In one aspect, phytases of the invention are serviceable in
combination with cellulose components. It is known that cellulases
of many cellulolytic bacteria are organized into discrete
multi-enzyme complexes, called cellulosomes. The multiple subunits
of cellulosomes are composed of numerous functional domains, which
interact with each other and with the cellulosic substrate. One of
these subunits comprises a distinctive new class of non-catalytic
scaffolding polypeptide, which selectively integrates the various
cellulase and xylanase subunits into the cohesive complex.
Intelligent application of cellulosome hybrids and chimeric
constructs of cellulosomal domains should enable better use of
cellulosic biomass and may offer a wide range of novel applications
in research, medicine and industry.
In one aspect, phytases of the invention are serviceable--either
alone or in combination treatments--in areas of biopulping and
biobleaching where a reduction in the use of environmentally
harmful chemicals traditionally used in the pulp and paper industry
is desired. Waste water treatment represents another vast
application area where biological enzymes have been shown to be
effective not only in color removal but also in the bioconversion
of potentially noxious substances into useful bioproducts.
In one aspect, phytases of the invention are serviceable for
generating life forms that can provide at least one enzymatic
activity--either alone or in combination treatments--in the
treatment of digestive systems of organisms. Particularly relevant
organisms to be treated include non-ruminant organisms, although
ruminant organisms may also benefit from such treatment.
Specifically, it is appreciated that this approach may be performed
alone or in combination with other biological molecules (for
example, xylanases) to generate a recombinant host that expresses a
plurality of biological molecules. It is also appreciated that the
administration of the instant phytase molecules and/or recombinant
hosts expressing the instant phytase molecules may be performed
either alone or in combination with other biological molecules,
and/or life forms that can provide enzymatic activities in a
digestive system--where said other enzymes and said life forms may
be may recombinant or otherwise. For example, administration may be
performed in combination with xylanolytic bacteria.
For example, in addition to phytate, many organisms are also unable
to adequately digest hemicelluloses. Hemicelluloses or xylans are
major components (35%) of plant materials. For ruminant animals,
about 50% of the dietary xylans are degraded, but only small
amounts of xylans are degraded in the lower gut of non-ruminant
animals and humans. In the rumen, the major xylanolytic species are
Butyrivibrio fibrisolvens and Bacteroides ruminicola. In the human
colon, Bacteroides ovatus and Bacteroides fragilis subspecies "a"
are major xylanolytic bacteria. Xylans are chemically complex, and
their degradation requires multiple enzymes. Expression of these
enzymes by gut bacteria varies greatly among species. Butyrivibrio
fibrisolvens makes extracellular xylanases but Bacteroides species
have cell-bound xylanase activity. Biochemical characterization of
xylanolytic enzymes from gut bacteria has not been done completely.
A xylosidase gene has been cloned from B. fibrosolvens. The data
from DNA hybridizations using a xylanase gene cloned from B.
fibrisolvens indicate this gene may be present in other B.
fibrisolvens strains. A cloned xylanase from Bact. ruminicola was
transferred to and highly expressed in Bact. fragilis and Bact.
uniformis. Arabinosidase and xylosidase genes from Bact. ovatus
have been cloned and both activities appear to be catalyzed by a
single, bifunctional, novel enzyme.
In one aspect, phytases of the invention are serviceable for 1)
transferring into a suitable host (such as Bact. fragilis or Bact.
uniformis); 2) achieving adequate expression in a resultant
recombinant host; and 3) administering said recombinant host to
organisms to improve the ability of the treated organisms to
degrade phytate. Continued research in genetic and biochemical
areas will provide knowledge and insights for manipulation of
digestion at the gut level and improved understanding of colonic
fiber digestion.
Additional details or alternative protocols regarding this approach
are in the public literature and/or are known to the skilled
artisan, for example, the invention can incorporate procedures as
described in U.S. Pat. No. 5,624,678 (Bedford et al.), U.S. Pat.
No. 5,683,911 (Bodie et al.), U.S. Pat. No. 5,720,971 (Beauchemin
et al.), U.S. Pat. No. 5,759,840 (Sung et al.), U.S. Pat. No.
5,770,012 (Cooper), U.S. Pat. No. 5,786,316 (Baeck et al.), U.S.
Pat. No. 5,817,500 (Hansen et al.).
The instant invention teaches that phytase molecules of the instant
invention may be added to the reagent(s) disclosed in order to
obtain preparations having an additional phytase activity. In one
aspect, reagent(s) and the additional phytase molecules will not
inhibit each other. In one aspect, the reagent(s) and the
additional phytase molecules may have an overall additive effect.
In one aspect, the reagent(s) and the additional phytase molecules
may have an overall synergistic effect.
In one aspect, the present invention provides a method (and
products therefrom) for enhancement of phytate phosphorus
utilization and treatment and prevention of tibial dyschondroplasia
in animals, particularly poultry, by administering to animals a
feed composition containing a hydroxylated vitamin D.sub.3
derivative. The vitamin D.sub.3 derivative can be administered to
animals in feed containing reduced levels of calcium and phosphorus
for enhancement of phytate phosphorus utilization. Accordingly, the
vitamin D.sub.3 derivative can be administered in combination with
novel phytase molecules of the instant invention for further
enhancement of phytate phosphorus utilization. Additional details
or alternative protocols regarding this approach are in the public
literature and/or are known to the skilled artisan, e.g., U.S. Pat.
No. 5,516,525 (Edwards et al.) and U.S. Pat. No. 5,366,736 (Edwards
et al.), U.S. Pat. No. 5,316,770 (Edwards et al.).
In one aspect, the present invention provides a method (and
products therefrom) to obtain foodstuff that 1) comprises phytin
that is easily absorbed and utilized in a form of inositol in a
body of an organism; 2) that is capable of reducing phosphorus in
excrementary matter; and 3) that is accordingly useful for
improving environmental pollution. Said foodstuff is comprised of
an admixture of a phytin-containing grain, a lactic acid-producing
microorganism, and a novel phytase molecule of the instant
invention. In one aspect, said foodstuff is produced by compounding
a phytin-containing grain (e.g. rice bran) with an effective
microbial group having an acidophilic property, producing lactic
acid, without producing butyric acid, free from pathogenicity, and
a phytase. Examples of an effective microbial group include e.g.
Streptomyces sp. (American Type Culture Collection No. ATCC 3004)
belonging to the group of actinomyces and Lactobacillus sp. (IFO
3070) belonging to the group of lactobacilli.
An exemplary amount of addition of an effective microbial group is
0.2 wt. % in terms of bacterial body weight based on a grain
material. In one aspect, the amount of the addition of the phytase
is about 1-2 wt. % based on the phytin in the grain material.
Additional details or alternative protocols regarding this approach
are in the public literature and/or are known to the skilled
artisan, e.g., JP 08205785 (Akahori et al.).
In one aspect, the present invention provides a method for
improving the solubility of vegetable proteins. More specifically,
the invention relates to methods for the solubilization of proteins
in vegetable protein sources, which methods comprise treating the
vegetable protein source with an efficient amount of one or more
phytase enzymes of the invention and treating the vegetable protein
source with an efficient amount of one or more proteolytic enzymes.
In another aspect, the invention provides animal feed additives
comprising a phytase of the invention and one or more proteolytic
enzymes. Additional details or alternative protocols regarding this
approach are in the public literature and/or are known to the
skilled artisan, e.g., EP 0756457 (WO 9528850 A1) (Nielsen and
Knap).
In one aspect, the present invention provides a method of producing
a plant protein preparation comprising dispersing vegetable protein
source materials in water at a pH in the range of 2 to 6 and
admixing phytase molecules of the instant invention therein. The
acidic extract containing soluble protein is separated and dried to
yield a solid protein of desirable character. One or more proteases
can also be used to improve the characteristics of the protein.
Additional details or alternative protocols regarding this approach
are in the public literature and/or are known to the skilled
artisan, e.g., U.S. Pat. No. 3,966,971.
In one aspect, the present invention provides a method (and
products thereof) to activate inert phosphorus in soil and/or
compost, to improve the utilization rate of a nitrogen compound,
and to suppress propagation of pathogenic molds by adding three
reagents, phytase, saponin and chitosan, to the compost.
In one aspect, the method can comprise treating the compost by 1)
adding phytase-containing microorganisms in media, e.g.,
recombinant hosts that overexpress the novel phytase molecules of
the instant invention, for example, at 100 ml media/100 kg wet
compost; 2) alternatively also adding a phytase-containing plant
source--such as wheat bran--e.g. at 0.2 to 1 kg/100 kg wet compost;
3) adding a saponin-containing source--such as peat, mugworts and
yucca plants--e.g. at 0.5 to 3.0 g/kg; 4) adding
chitosan-containing materials--such as pulverized shells of
shrimps, crabs, etc.--e.g. at 100 to 300 g/kg wet compost.
In one aspect, recombinant sources the three reagents, phytase,
saponin, and chitosan, are used. Additional details or alternative
protocols regarding this approach are in the public literature
and/or are known to the skilled artisan, e.g., JP 07277865 (Toya
Taisuke).
In some instances it may be advantageous to deliver and express a
phytase sequence of the invention locally (e.g., within a
particular tissue or cell type). For example, local expression of a
phytase or digestive enzyme in the gut of an animal will assist in
the digestion and uptake of, for example, phytate and phosphorous,
respectively. The nucleic sequence may be directly delivered to the
salivary glands, tissue and cells and/or to the epithelial cells
lining the gut, for example. Such delivery methods are known in the
art and include electroporation, viral vectors and direct DNA
uptake. Any polypeptide having phytase activity can be utilized in
the methods of the invention (e.g., those specifically described
under this subsection 6.3.18, as well as those described in other
sections of the invention).
For example, a nucleic acid constructs of the present invention
will comprise nucleic acid molecules in a form suitable for uptake
into target cells within a host tissue. The nucleic acids may be in
the form of bare DNA or RNA molecules, where the molecules may
comprise one or more structural genes, one or more regulatory
genes, antisense strands, strands capable of triplex formation, or
the like. Commonly, the nucleic acid construct will include at
least one structural gene under the transcriptional and
translational control of a suitable regulatory region. More
usually, nucleic acid constructs of the present invention will
comprise nucleic acids incorporated in a delivery vehicle to
improve transfection efficiency, wherein the delivery vehicle will
be dispersed within larger particles comprising a dried hydrophilic
excipient material.
One such delivery vehicles comprises viral vectors, such as
retroviruses, adenoviruses, and adeno-associated viruses, which
have been inactivated to prevent self-replication but which
maintain the native viral ability to bind a target host cell,
deliver genetic material into the cytoplasm of the target host
cell, and promote expression of structural or other genes which
have been incorporated in the particle. Suitable retrovirus vectors
for mediated gene transfer are described in Kahn et al. (1992)
Circ. Res. 71:1508-1517. A suitable adenovirus gene delivery is
described in Rosenfeld et al. (1991) Science 252:431-434. Both
retroviral and adenovirus delivery systems are described in
Friedman (1989) Science 244:1275-1281.
A second type of nucleic acid delivery vehicle comprises liposomal
transfection vesicles, including both anionic and cationic
liposomal constructs. The use of anionic liposomes requires that
the nucleic acids be entrapped within the liposome. Cationic
liposomes do not require nucleic acid entrapment and instead may be
formed by simple mixing of the nucleic acids and liposomes. The
cationic liposomes avidly bind to the negatively charged nucleic
acid molecules, including both DNA and RNA, to yield complexes
which give reasonable transfection efficiency in many cell types.
See, Farhood et al. (1992) Biochem. Biophys. Acta. 1111:239-246. An
exemplary material for forming liposomal vesicles is lipofectin
which is composed of an equimolar mixture of dioleylphosphatidyl
ethanolamine (DOPE) and dioleyloxypropyl-triethylammonium (DOTMA),
as described in Feigner and Ringold (1989) Nature 337:387-388.
It is also possible to combine these two types of delivery systems.
For example, Kahn et al. (1992), supra., teaches that a retrovirus
vector may be combined in a cationic DEAE-dextran vesicle to
further enhance transformation efficiency. It is also possible to
incorporate nuclear proteins into viral and/or liposomal delivery
vesicles to even further improve transfection efficiencies. See,
Kaneda et al. (1989) Science 243:375-378.
In another aspect, a digestive aid containing an enzyme either as
the sole active ingredient or in combination with one or more other
agents and/or enzymes is provided. The use of enzymes and other
agents in digestive aids of livestock or domesticated animals not
only improves the animal's health and life expectancy but also
assists in increasing the health of livestock and in the production
of foodstuffs from livestock.
The invention also can use feeds for livestock (e.g., certain
poultry feed) that are highly supplemented with numerous minerals
(e.g., inorganic phosphorous), enzymes, growth factors, drugs, and
other agents for delivery to the livestock. These supplements
replace many of the calories and natural nutrients present in
grain, for example. By reducing or eliminating the inorganic
phosphorous supplement and other supplements (e.g., trace mineral
salts, growth factors, enzymes, antibiotics) from the feed itself,
the feed is able to carry more nutrient and energy. Accordingly,
the remaining diet would contain more usable energy. For example,
grain-oilseed meal diets generally contain about 3,200 kcal
metabolizable energy per kilogram of diet, and mineral salts supply
no metabolizable energy. Removal of the unneeded minerals and
substitution with grain therefore increase the usable energy in the
diet. Thus, the invention is differentiated over commonly used
phytase containing feed. For example, in one aspect, a
biocompatible material is used that is resistant to digestion by
the gastrointestinal tract of an organism.
In many organisms, including, for example, poultry or birds such
as, for example, chickens, turkeys, geese, ducks, parrots,
peacocks, ostriches, pheasants, quail, pigeons, emu, kiwi, loons,
cockatiel, cockatoo, canaries, penguins, flamingoes, and dove, the
digestive tract includes a gizzard which stores and uses hard
biocompatible objects (e.g., rocks and shells from shell fish) to
help in the digestion of seeds or other feed consumed by a bird. A
typical digestive tract of this general family of organisms,
includes the esophagus which contains a pouch, called a crop, where
food is stored for a brief period of time. From the crop, food
moves down into the true stomach, or proventriculus, where
hydrochloric acid and pepsin starts the process of digestion. Next,
food moves into the gizzard, which is oval shaped and thick walled
with powerful muscles. The chief function of the gizzard is to
grind or crush food particles--a process which is aided by the bird
swallowing small amounts of fine gravel or grit. From the gizzard,
food moves into the duodenum. The small intestine of birds is
similar to mammals. There are two blind pouches or ceca, about 4-6
inches in length at the junction of the small and large intestine.
The large intestine is short, consisting mostly of the rectum about
3-4 inches in length. The rectum empties into the cloaca and feces
are excreted through the vent.
Hard, biocompatible objects consumed (or otherwise introduced) and
presented in the gizzard provide a useful vector for delivery of
various enzymatic, chemical, therapeutic and antibiotic agents.
These hard substances have a life span of a few hours to a few days
and are passed after a period of time. Accordingly, the invention
provides coated, impregnated (e.g., impregnated matrix and
membranes) modified dietary aids for delivery of useful digestive
or therapeutic agents to an organism. Such dietary aids include
objects which are typically ingested by an organism to assist in
digestion within the gizzard (e.g., rocks or grit). The invention
provides biocompatible objects that have coated thereon or
impregnated therein agents useful as a digestive aid for an
organism or for the delivery of a therapeutic or medicinal agent or
chemical.
In one aspect, the invention provides a dietary aid, having a
biocompatible composition designed for release of an agent that
assists in digestion, wherein the biocompatible composition is
designed for oral consumption and release in the digestive tract
(e.g., the gizzard) of an organism. "Biocompatible" means that the
substance, upon contact with a host organism (e.g., a bird), does
not elicit a detrimental response sufficient to result in the
rejection of the substance or to render the substance inoperable.
Such inoperability may occur, for example, by formation of a
fibrotic structure around the substance limiting diffusion of
impregnated agents to the host organism therein or a substance
which results in an increase in mortality or morbidity in the
organism due to toxicity or infection. A biocompatible substance
may be non-biodegradable or biodegradable. In one aspect, the
biocompatible composition is resistant to degradation or digestion
by the gastrointestinal tract. In another aspect, the biocompatible
composition has the consistency of a rock or stone.
A non-biodegradable material useful in the invention is one that
allows attachment or impregnation of a dietary agent. Such
non-limiting non-biodegradable materials include, for example,
thermoplastics, such as acrylic, modacrylic, polyamide,
polycarbonate, polyester, polyethylene, polypropylene, polystyrene,
polysulfone, polyethersulfone, and polyvinylidene fluoride.
Elastomers are also useful materials and include, for example,
polyamide, polyester, polyethylene, polypropylene, polystyrene,
polyurethane, polyvinyl alcohol and silicone (e.g., silicone based
or containing silica). The invention provides that the
biocompatible composition can contain a plurality of such
materials, which can be, e.g., admixed or layered to form blends,
copolymers or combinations thereof.
In one aspect, a "biodegradable" material means that the
composition will erode or degrade in vivo to form smaller chemical
species. Degradation may occur, for example, by enzymatic, chemical
or physical processes. Suitable biodegradable materials
contemplated for use in the invention include, but are not limited
to, poly(lactide)s, poly(glycolide)s, poly(lactic acid)s,
poly(glycolic acid)s, polyanhydrides, polyorthoesters,
polyetheresters, polycaprolactone, polyesteramides, polycarbonate,
polycyanoacrylate, polyurethanes, polyacrylate, and the like. Such
materials can be admixed or layered to form blends, copolymers or
combinations thereof.
In one aspect, a number different biocompatible substances of the
invention may be given to the animal and ingested sequentially, or
otherwise provided to the same organism simultaneously, or in
various combinations (e.g., one material before the other). In
addition, the biocompatible substances of the invention may be
designed for slow passage through the digestive tract. For example,
large or fatty substances tend to move more slowly through the
digestive tract, accordingly, a biocompatible material having a
large size to prevent rapid passing in the digestive tract can be
used. Such large substances can be a combination of
non-biodegradable and biodegradable substances. For example, a
small non-biodegradable substance can be encompassed by a
biodegradable substance of the invention such that over a period of
time the biodegradable portion will be degraded allowing the
non-biodegradable portion to pass through the digestive trace. In
addition, it is recognized that any number of flavorings can be
provided to a biocompatible substance of the invention to assist in
consumption.
Any number of agents alone or in combination with other agents can
be coated on the biocompatible substances of the invention,
including polypeptides (e.g., enzymes, antibodies, cytokines or
therapeutic small molecules), and antibiotics, for example.
Examples of particular useful agents are listed in Table 1 and 2,
below. It is also contemplated that cells can be encapsulated into
the biocompatible material of the invention and used to deliver the
enzymes or therapeutics. For example, porous substances can be
designed that have pores large enough for cells to grow in and
through and that these porous materials can then be taken into the
digestive tract. For example, the biocompatible substance of the
invention can comprise a plurality of microfloral environments
(e.g., different porosity, pH etc.) that provide support for a
plurality of cell types. The cells can be genetically engineered to
deliver a particular drug, enzyme or chemical to the organism. The
cells can be eukaryotic or prokaryotic.
TABLE-US-00005 TABLE 1 Treatment Class Chemical Description
Antibiotics Amoxycillin and Its Combination Treatment Against
Bacterial Diseases Caused Mastox Injection By Gram + and Gram -
Bacteria (Amoxycillin and Cloxacillin) Ampicillin and Its
Combination Treatment Against Bacterial Diseases Caused Biolox
Injection By Gram + And Gram - Bacteria. (Ampicillin and
Cloxacillin) Nitrofurazone + Urea Treatment Of Genital Infections
Nefrea Bolus Trimethoprim + Treatment Of Respiratory Tract
Infections, Sulphamethoxazole Gastro Intestinal Tract Infections,
Urino-Genital Trizol Bolus Infections. Metronidazole and
Furazolidone Treatment Of Bacterial And Protozoal Diseases. Metofur
Bolus Phthalylsulphathiazole, Pectin and Treatment Of Bacterial And
Non-Specific Kaolin Diarrhoea, Bacillary Dysentery And Calf
Pectolin Scours. Bolus Suspension Antihelmintics Ectoparasiticide
Ectoparasiticide and Antiseptic Germex Ointment (Gamma Benzene
Hexachloride, Proflavin Hemisulphate and Cetrimide)
Endoparasiticides > Albendazole Prevention And Treatment Of
Roundworm, and Its Combination Tapeworm and Fluke Infestations
Alben (Albendazole) Suspension (Albendazole 2.5%) Plus Suspension
(Albendazole 5%) Forte Bolus (Albendazole 1.5 Gm.) Tablet
(Albendazole 600 Mg.) Powder (Albendazole 5%, 15%) Alpraz
(Albendazole and Prevention And Treatment Of Roundworm and
Praziquantel)Tablet Tapeworm Infestation In Canines and Felines.
Oxyclozanide and Its Combination Prevention and Treatment Of Fluke
Infestations Clozan (Oxyclozanide) Bolus, Suspension Tetzan
(Oxyclozanide and Prevention and Treatment Of Roundworm and
Tetramisole Hcl) Bolus, Fluke Infestations Suspension Fluzan
(Oxyclozanide and Prevention and Treatment Of Roundworm Levamisole
Hcl) Bolus, Infestations and Increasing Immunity Suspension
Levamisole Prevention and Treatment Of Roundworm Nemasol Injection
Infestations and Increasing Immunity. Wormnil Powder Fenbendazole
Prevention And Treatment of Roundworm and Fenzole Tapeworm
Infestations Tablet (Fenbendazole150 Mg.) Bolus (Fenbendazole 1.5
Gm.) Powder (Fenbendazole 2.5% W/W) Tonics Vitamin B Complex, Amino
Acids Treatment Of Anorexia, Hepatitis, Debility, and Liver Extract
Neuralgic Convulsions Emaciation and Stunted Heptogen Injection
Growth. Calcium Levulinate With Vit.B.sub.12 Prevention and
treatment of hypocalcaemia, and Vit D.sub.3 supportive therapy in
sick conditions (especially Hylactin Injection hypothermia) and
treatment of early stages of rickets. Animal Feed Essential
Minerals, Selenium and Treatment Of Anoestrus Causing Infertility
and Supplements Vitamin E Repeat Breeding In Dairy Animals and
Horses. Gynolactin Bolus Essential Minerals, Vitamin E, and
Infertility, Improper Lactation, Decreased Iodine Immunity, Stunted
Growth and Debility. Hylactin Powder Essential Electrolytes With
Diarrhoea, Dehydration, Prior to and after Vitamin C
Transportation, In Extreme temperatures (High Electra - C Powder Or
Low) and other Conditions of stress. Pyrenox Plus (Diclofenac
Sodium + Treatment Of Mastitis, Pyrexia Post Surgical Paracetamol)
Bolus, Injection. Pain and Inflammation, Prolapse Of Uterus,
Lameness and Arthritis.
TABLE-US-00006 TABLE 2 Therapeutic Formulations Product Description
Acutrim .RTM. Once-daily appetite suppressant tablets.
(phenylpropanolamine) The Baxter .RTM. Infusor For controlled
intravenous delivery of anticoagulants, antibiotics,
chemotherapeutic agents, and other widely used drugs. Catapres-TTS
.RTM. (clonidine Once-weekly transdermal system for the treatment
of hypertension. transdermal therapeutic system) Covera HS3
(verapamil Once-daily Controlled-Onset Extended-Release (COER-24)
tablets for hydrochloride) the treatment of hypertension and angina
pectoris. DynaCirc CR .RTM. (isradipine) Once-daily extended
release tablets for the treatment of hypertension. Efidac 24 .RTM.
(chlorpheniramine Once-daily extended release tablets for the
relief of allergy symptoms. maleate) Estraderm .RTM. Twice-weekly
transdermal system for treating certain postmenopausal (estradiol
transdermal system) symptoms and preventing osteoporosis Glucotrol
XL .RTM. (glipizide) Once-daily extended release tablets used as an
adjunct to diet for the control of hyperglycemia in patients with
non-insulin-dependent diabetes mellitus. IVOMEC SR .RTM. Bolus
Ruminal delivery system for season-long control of major internal
and (ivermectin) external parasites in cattle. Minipress XL .RTM.
(prazosin) Once-daily extended release tablets for the treatment of
hypertension. NicoDerm .RTM. CQ .TM. (nicotine Transdermal system
used as a once-daily aid to smoking cessation for transdermal
system) relief of nicotine withdrawal symptoms. Procardia XL .RTM.
(nifedipine) Once-daily extended release tablets for the treatment
of angina and hypertension. Sudafed .RTM. 24 Hour Once-daily nasal
decongestant for relief of colds, sinusitis, hay fever
(pseudoephedrine) and other respiratory allergies. Transderm-Nitro
.RTM. Once-daily transdermal system for the prevention of angina
pectoris (nitroglycerin transdermal due to coronary artery disease.
system) Transderm Scop .RTM. (scopolamin Transdermal system for the
prevention of nausea and vomiting transdermal system) associated
with motion sickness. Volmax (albuterol) Extended release tablets
for relief of bronchospasm in patients with reversible obstructive
airway disease. Actisite .RTM. (tetracycline hydrochloride)
Periodontal fiber used as an adjunct to scaling and root planing
for reduction of pocket depth and bleeding on probing in patients
with adult periodontitis. ALZET .RTM. Osmotic pumps for laboratory
research. Amphotec .RTM. (amphotericin B AMPHOTEC .RTM. is a
fungicidal treatment for invasive aspergillosis in cholesteryl
sulfate complex for patients where renal impairment or unacceptable
toxicity precludes use injection) of amphotericin B in effective
doses and in patients with invasive aspergillosis where prior
amphotericin B therapy has failed. BiCitra .RTM. (sodium citrate
and Alkalinizing agent used in those conditions where long-term
citric acid) maintenance of alkaline urine is desirable. Ditropan
.RTM. (oxybutynin For the relief of symptoms of bladder instability
associated with chloride) uninhibited neurogenic or reflex
neurogenic bladder (i.e., urgency, frequency, urinary leakage, urge
incontinence, dysuria). Ditropan .RTM. XL (oxybutynin is a
once-daily controlled-release tablet indicated for the treatment of
chloride) overactive bladder with symptoms of urge urinary
incontinence, urgency and frequency. DOXIL .RTM. (doxorubicin HCl
liposome injection) Duragesic .RTM. (fentanyl 72-hour transdermal
system for management of chronic pain in transdermal system) CII
patients who require continuous opioid analgesia for pain that
cannot be managed by lesser means such as acetaminophen-opioid
combinations, non-steroidal analgesics, or PRN dosing with short-
acting opioids. Elmiron .RTM. (pentosan polysulfate Indicated for
the relief of bladder pain or discomfort associated with sodium)
interstitial cystitis. ENACT AirWatch .TM. An asthma monitoring and
management system. Ethyol .RTM. (amifostine) Indicated to reduce
the cumulative renal toxicity associated with repeated
administration of cisplatin in patients with advanced ovarian
cancer or non-small cell lung cancer. Indicated to reduce the
incidence of moderate to severe xerostomia in patients undergoing
post-operative radiation treatment for head and neck cancer, where
the radiation port includes a substantial portion of the parotid
glands. Mycelex .RTM. Troche (clotrimazole) For the local treatment
of oropharyngeal candidiasis. Also indicated prophylactically to
reduce the incidence of oropharyngeal candidiasis in patients
immunocompromised by conditions that include chemotherapy,
radiotherapy, or steroid therapy utilized in the treatment of
leukemia, solid tumors, or renal transplantation. Neutra-Phos .RTM.
(potassium and a dietary/nutritional supplement sodium phosphate)
PolyCitra .RTM.-K Oral Solution Alkalinizing agent useful in those
conditions where long-term and PolyCitra .RTM.-K Crystals
maintenance of an alkaline urine is desirable, such as in patents
with (potassium citrate and citric uric acid and cystine calculi of
the urinary tract, especially when the acid) administration of
sodium salts is undesirable or contraindicated PolyCitra .RTM.-K
Syrup and LC Alkalinizing agent useful in those conditions where
long-term (tricitrates) maintenance of an alkaline urine is
desirable, such as in patients with uric acid and cystine calculi
of the urinary tract. Progestasert .RTM. (progesterone)
Intrauterine Progesterone Contraceptive System Testoderm .RTM.
Testoderm .RTM. with Testosterone Transdermal System Adhesive and
Testoderm .RTM. TTS The Testoderm .RTM. products are indicated for
replacement therapy in CIII males for conditions associated with a
deficiency or absence of endogenous testosterone: (1) Primary
hypogonadism (congenital or acquired) or (2) Hypogonadotropic
hypogonadism (congenital or acquired). Viadur .TM. (leuprolide
acetate Once-yearly implant for the palliative treatment of
prostate cancer implant)
Certain agents can be designed to become active or in activated
under certain conditions (e.g., at certain pH's, in the presence of
an activating agent etc.). In addition, it may be advantageous to
use pro-enzymes in the compositions of the invention. For example,
a pro-enzymes can be activated by a protease (e.g., a salivary
protease that is present in the digestive tract or is artificially
introduced into the digestive tract of an organism). It is
contemplated that the agents delivered by the biocompatible
compositions of the invention are activated or inactivated by the
addition of an activating agent which may be ingested by, or
otherwise delivered to, the organism. Another mechanism for control
of the agent in the digestive tract is an environment sensitive
agent that is activated in the proper digestive compartment. For
example, an agent may be inactive at low pH but active at neutral
pH. Accordingly, the agent would be inactive in the gut but active
in the intestinal tract. Alternatively, the agent can become active
in response to the presence of a microorganism specific factor
(e.g., microorganisms present in the intestine).
In one aspect, the potential benefits of the present invention
include, for example, (1) reduction in or possible elimination of
the need for mineral supplements (e.g., inorganic phosphorous
supplements), enzymes, or therapeutic drugs for animal (including
fish) from the daily feed or grain thereby increasing the amount of
calories and nutrients present in the feed, and (2) increased
health and growth of domestic and non-domestic animals including,
for example, poultry, porcine, bovine, equine, canine, and feline
animals.
A large number of enzymes can be used in the methods and
compositions of the present invention in addition to the phytases
of the invention. These enzymes include enzymes necessary for
proper digestion of consumed foods, or for proper metabolism,
activation or derivation of chemicals, prodrugs or other agents or
compounds delivered to the animal via the digestive tract. Examples
of enzymes that can be delivered or incorporated into the
compositions of the invention, include, for example, feed enhancing
enzymes selected from the group consisting of
.alpha.-galactosidases, .beta.-galactosidases, in particular
lactases, phytases, .beta.-glucanases, in particular
endo-.beta.-1,4-glucanases and endo-.beta.-1,3(4)-glucanases,
cellulases, xylosidases, galactanases, in particular
arabinogalactan endo-1,4-.beta.-galactosidases and arabinogalactan
endo-1,3-.beta.-galactosidases, endoglucanases, in particular
endo-1,2-.beta.-glucanase, endo-1,3-.alpha.-glucanase, and
endo-1,3-.beta.-glucanase, pectin degrading enzymes, in particular
pectinases, pectinesterases, pectin lyases, polygalacturonases,
arabinanases, rhamnogalacturonases, rhamnogalacturonan acetyl
esterases, rhamnogalacturonan-.alpha.-rhamnosidase, pectate lyases,
and .alpha.-galacturonisidases, mannanases, .beta.-mannosidases,
mannan acetyl esterases, xylan acetyl esterases, proteases,
xylanases, arabinoxylanases and lipolytic enzymes such as lipases,
phytases and cutinases. Phytases in addition to the phytases having
an amino acid sequence as set forth in SEQ ID NO:2 can be used in
the methods and compositions of the invention.
In one aspect, the enzyme used in the compositions (e.g., a dietary
aid) of the present invention is a phytase enzyme which is stable
to heat and is heat resistant and catalyzes the enzymatic
hydrolysis of phytate, i.e., the enzyme is able to renature and
regain activity after a brief (i.e., 5 to 30 seconds), or longer
period, for example, minutes or hours, exposure to temperatures of
above 50 C.
A "feed" and a "food," respectively, means any natural or
artificial diet, meal or the like or components of such meals
intended or suitable for being eaten, taken in, digested, by an
animal and a human being, respectively. "Dietary Aid," as used
herein, denotes, for example, a composition containing agents that
provide a therapeutic or digestive agent to an animal or organism.
A "dietary aid," typically is not a source of caloric intake for an
organism, in other words, a dietary aid typically is not a source
of energy for the organism, but rather is a composition which is
taken in addition to typical "feed" or "food".
In various aspects of the invention, feed composition are provided
that comprise a recombinant phytase protein having at least thirty
contiguous amino acids of a protein having an amino acid sequence
of SEQ ID NO:2; and a phytate-containing foodstuff. As will be
known to those skilled in the art, such compositions may be
prepared in a number of ways, including but not limited to, in
pellet form with or without polymer coated additives, in granulate
form, and by spray drying. By way of non-limiting example,
teachings in the art directed to the preparation of feed include
International Publication Nos. WO0070034 A1, WO0100042 A1,
WO0104279 A1, WO0125411 A1, WO0125412 A1, and EP 1073342A.
An agent or enzyme (e.g., a phytase) may exert its effect in vitro
or in vivo, i.e. before intake or in the stomach or gizzard of the
organism, respectively. Also a combined action is possible.
Although any enzyme may be incorporated into a dietary aid,
reference is made herein to phytase as an exemplification of the
methods and compositions of the invention. A dietary aid of the
invention includes an enzyme (e.g., a phytase). Generally, a
dietary aid containing a phytase composition is liquid or dry.
Liquid compositions need not contain anything more than the enzyme
(e.g. a phytase), preferably in a highly purified form. Usually,
however, a stabilizer such as glycerol, sorbitol or mono propylene
glycol is also added. The liquid composition may also comprise
other additives, such as salts, sugars, preservatives, pH-adjusting
agents, proteins, phytate (a phytase substrate). Typical liquid
compositions are aqueous or oil-based slurries. The liquid
compositions can be added to a biocompatible composition for slow
release. Preferably the enzyme is added to a dietary aid
composition that is a biocompatible material (e.g., biodegradable
or non-biodegradable) and includes the addition of recombinant
cells into, for example, porous microbeads.
Dry compositions may be spray dried compositions, in which case the
composition need not contain anything more than the enzyme in a dry
form. Usually, however, dry compositions are so-called granulates
which may readily be mixed with a food or feed components, or more
preferably, form a component of a pre-mix. The particle size of the
enzyme granulates preferably is compatible with that of the other
components of the mixture. This provides a safe and convenient
means of incorporating enzymes into animal feed. Granulates of the
invention can be biocompatible, or they can be biocompatible
granulates that are non-biodegradable.
Agglomeration granulates of the invention coated by an enzyme can
be prepared using agglomeration technique in a high shear mixer.
Absorption granulates are prepared by having cores of a carrier
material to absorb/be coated by the enzyme. In one aspect, the
carrier material is a biocompatible non-biodegradable material that
simulates the role of stones or grit in the gizzard of an animal.
Typical filler materials used in agglomeration techniques include
salts, such as disodium sulphate. Other fillers are kaolin, talc,
magnesium aluminum silicate and cellulose fibers. Optionally,
binders such as dextrins are also included in agglomeration
granulates. The carrier materials can be any biocompatible material
including biodegradable and non-biodegradable materials (e.g.,
rocks, stones, ceramics, various polymers). In one aspect, the
granulates are coated with a coating mixture. Such mixture
comprises coating agents, e.g., hydrophobic coating agents, such as
hydrogenated palm oil and beef tallow, and if desired other
additives, such as calcium carbonate or kaolin.
In one aspect, the dietary aid compositions (e.g., phytase dietary
aid compositions) may contain other substituents such as coloring
agents, aroma compounds, stabilizers, vitamins, minerals, other
feed or food enhancing enzymes etc. In one aspect, an additive used
in a composition of the invention comprises one or more compounds
such as vitamins, minerals or feed enhancing enzymes and suitable
carriers and/or excipients.
In one aspect, the dietary aid compositions of the invention
additionally comprise an effective amount of one or more feed
enhancing enzymes, in particular feed enhancing enzymes selected
from the group consisting of .alpha.-galactosidases,
.beta.-galactosidases, in particular lactases, other phytases,
.beta.-glucanases, in particular endo-.beta.-1,4-glucanases and
endo-.beta.-1,3(4)-glucanases, cellulases, xylosidases,
galactanases, in particular arabinogalactan
endo-1,4-.beta.-galactosidases and arabinogalactan
endo-1,3-.beta.-galactosidases, endoglucanases, in particular
endo-1,2-.beta.-glucanase, endo-1,3-.alpha.-glucanase, and
endo-1,3-.beta.-glucanase, pectin degrading enzymes, in particular
pectinases, pectinesterases, pectin lyases, polygalacturonases,
arabinanases, rhamnogalacturonases, rhamnogalacturonan acetyl
esterases, rhamnogalacturonan-.alpha.-rhamnosidase, pectate lyases,
and .alpha.-galacturonisidases, mannanases, .beta.-mannosidases,
mannan acetyl esterases, xylan acetyl esterases, proteases,
xylanases, arabinoxylanases and lipolytic enzymes such as lipases,
phytases and cutinases.
The animal dietary aid of the invention is supplemented to the
mono-gastric animal before or simultaneously with the diet. In one
aspect, the dietary aid of the invention is supplemented to the
mono-gastric animal simultaneously with the diet. In another
aspect, the dietary aid is added to the diet in the form of a
granulate or a stabilized liquid.
An effective amount of an enzyme in a dietary aid of the invention
is from about 10-20,000; from about 10 to 15,000, from about 10 to
10,000, from about 100 to 5,000, or from about 100 to about 2,000
FYT/kg dietary aid.
Non-limiting examples of other specific uses of the phytase of the
invention is in soy processing and in the manufacture of inositol
or derivatives thereof.
The invention also relates to a method for reducing phytate levels
in animal manure, wherein the animal is fed a dietary aid
containing an effective amount of the phytase of the invention. As
stated in the beginning of the present application one important
effect thereof is to reduce the phosphate pollution of the
environment.
In another aspect, the dietary aid is a magnetic carrier. For
example, a magnetic carrier containing an enzyme (e.g., a phytase)
distributed in, on or through a magnetic carrier (e.g., a porous
magnetic bead), can be distributed over an area high in phytate and
collected by magnets after a period of time. Such distribution and
recollection of beads reduces additional pollution and allows for
reuse of the beads. In addition, use of such magnetic beads in vivo
allows for the localization of the dietary aid to a point in the
digestive tract where, for example, phytase activity can be carried
out. For example, a dietary aid of the invention containing
digestive enzymes (e.g., a phytase) can be localized to the gizzard
of the animal by juxtapositioning a magnet next to the gizzard of
the animal after the animal consumes a dietary aid of magnetic
carriers. The magnet can be removed after a period of time allowing
the dietary aid to pass through the digestive tract. In addition,
the magnetic carriers are suitable for removal from the organism
after sacrificing or to aid in collection.
When the dietary aid is a porous particle, such particles are
typically impregnated by a substance with which it is desired to
release slowly to form a slow release particle. Such slow release
particles may be prepared not only by impregnating the porous
particles with the substance it is desired to release, but also by
first dissolving the desired substance in the first dispersion
phase. In this case, slow release particles prepared by the method
in which the substance to be released is first dissolved in the
first dispersion phase are also within the scope and spirit of the
invention. The porous hollow particles may, for example, be
impregnated by a slow release substance such as a medicine,
agricultural chemical or enzyme. In particular, when porous hollow
particles impregnated by an enzyme are made of a biodegradable
polymers, the particles themselves may be used as an agricultural
chemical or fertilizer, and they have no adverse effect on the
environment. In one aspect the porous particles are magnetic in
nature.
The porous hollow particles may be used as a bioreactor support, in
particular an enzyme support. Therefore, it is advantageous to
prepare the dietary aid utilizing a method of a slow release, for
instance by encapsulating the enzyme of agent in a microvesicle,
such as a liposome, from which the dose is released over the course
of several days, preferably between about 3 to 20 days.
Alternatively, the agent (e.g., an enzyme) can be formulated for
slow release, such as incorporation into a slow release polymer
from which the dosage of agent (e.g., enzyme) is slowly released
over the course of several days, for example from 2 to 30 days and
can range up to the life of the animal.
In one aspect, liposomes of the invention are derived from
phospholipids or other lipid substances. Liposomes are formed by
mono- or multilamellar hydrated liquid crystals that are dispersed
in an aqueous medium. Any non-toxic, physiologically acceptable and
metabolizable lipid capable of forming liposomes can be used. The
compositions of the invention in liposome form can contain
stabilizers, preservatives, excipients, and the like in addition to
the agent. Some exemplary lipids are the phospholipids and the
phosphatidyl cholines (lecithins), both natural and synthetic.
Methods to form liposomes are known in the art. See, for example,
Prescott, Ed., Methods in Cell Biology, Volume XIV, Academic Press,
New York, N.Y. (1976), p. 33 et seq.
Also within the scope of the invention is the use of a phytase of
the invention during the preparation of food or feed preparations
or additives, i.e., the phytase exerts its phytase activity during
the manufacture only and is not active in the final food or feed
product. This aspect is relevant for instance in dough making and
baking. Accordingly, phytase or recombinant yeast expressing
phytase can be impregnated in, on or through a magnetic carriers,
distributed in the dough or food medium, and retrieved by
magnets.
The dietary aid of the invention may be administered alone to
animals in a biocompatible (e.g., a biodegradable or
non-biodegradable) carrier or in combination with other digestion
additive agents. The dietary aid of the invention thereof can be
readily administered as a top dressing or by mixing them directly
into animal feed or provided separate from the feed, by separate
oral dosage, by injection or by transdermal means or in combination
with other growth related edible compounds, the proportions of each
of the compounds in the combination being dependent upon the
particular organism or problem being addressed and the degree of
response desired. It should be understood that the specific dietary
dosage administered in any given case will be adjusted in
accordance with the specific compounds being administered, the
problem to be treated, the condition of the subject and the other
relevant facts that may modify the activity of the effective
ingredient or the response of the subject, as is well known by
those skilled in the art. In general, either a single daily dose or
divided daily dosages may be employed, as is well known in the
art.
If administered separately from the animal feed, forms of the
dietary aid can be prepared by combining them with non-toxic
pharmaceutically acceptable edible carriers to make either
immediate release or slow release formulations, as is well known in
the art. Such edible carriers may be either solid or liquid such
as, for example, corn starch, lactose, sucrose, soy flakes, peanut
oil, olive oil, sesame oil and propylene glycol. If a solid carrier
is used the dosage form of the compounds may be tablets, capsules,
powders, troches or lozenges or top dressing as micro-dispersible
forms. If a liquid carrier is used, soft gelatin capsules, or syrup
or liquid suspensions, emulsions or solutions may be the dosage
form. The dosage forms may also contain adjuvants, such as
preserving, stabilizing, wetting or emulsifying agents, solution
promoters, etc. They may also contain other therapeutically
valuable substances. A process for preparing a granulate edible
carrier at high temperature for release of enzyme when ingested is
described in copending U.S. patent application Ser. No. 09/910,579,
filed Jul. 20, 2001.
In alternative embodiments, significant advantages of the invention
may include 1) ease of manufacture of the active ingredient loaded
biocompatible compositions; 2) versatility as it relates to the
class of polymers and/or active ingredients which may be utilized;
3) higher yields and loading efficiencies; and 4) the provision of
sustained release formulations that release active, intact active
agents in vivo, thus providing for controlled release of an active
agent over an extended period of time. In one embodiment, an
advantage may be due to the local delivery of the agent with in the
digestive tract (e.g., the gizzard) of the organism. In one aspect,
the phrase "contained within" denotes a method for formulating an
agent into a composition useful for controlled release, over an
extended period of time of the agent.
In alternative embodiments of the sustained-release or slow release
compositions of the invention an effective amount of an agent
(e.g., an enzyme or antibiotic) is utilized. In one aspect,
sustained release or slow release refers to the gradual release of
an agent from a biocompatible material, over an extended period of
time. The sustained release can be continuous or discontinuous,
linear or non-linear, and this can be accomplished using one or
more biodegradable or non-biodegradable compositions, drug
loadings, selection of excipients, or other modifications. However,
it is to be recognized that it may be desirable to provide for a
"fast" release composition that provides for rapid release once
consumed by the organism. It is also to be understood that
"release" does not necessarily mean that the agent is released from
the biocompatible carrier. Rather in one aspect, the slow release
encompasses slow activation or continual activation of an agent
present on the biocompatible composition. For example, a phytase
need not be released from the biocompatible composition to be
effective. In this aspect, the phytase is immobilized on the
biocompatible composition.
The animal feed may be any protein-containing organic meal normally
employed to meet the dietary requirements of animals. Many of such
protein-containing meals are typically primarily composed of corn,
soybean meal or a corn/soybean meal mix. For example, typical
commercially available products fed to fowl include Egg Maker
Complete, a poultry feed product of Land O'Lakes AG Services, as
well as Country Game and Turkey Grower a product of Agwa, Inc. (see
also The Emu Farmer's Handbook by Phillip Minnaar and Maria
Minnaar). Both of these commercially available products are typical
examples of animal feeds with which the present dietary aid and/or
the enzyme phytase may be incorporated to reduce or eliminate the
amount of supplemental phosphorus, zinc, manganese and iron intake
required in such compositions.
The invention provides novel formulations and dietary supplements
and additives, and methods for diet supplementation for certain
diets, e.g., Atkins' diet, vegetarian diet, macrobiotic diet, vegan
diet or regional diets, e.g., developing world diets. Foods
associated with certain elective diets, such as Atkins, vegetarian,
macrobiotic, vegan or regional diets (for example, developing world
diets) emphasize certain food categories, such as proteins and
fats, soy, etc., or they rely on indigenous crops, e.g., cereals,
rice, beans, and the like as substantial or sole contributors to
individual nutrition. Many of these cereal based crops have
elevated (3 to 10 fold) levels of phytic acid. Processed food
products such as soy protein hydrolysate and others appear to
retain elevated levels of phytic acid and their inclusion as a
protein source to nutrient bars, powders and other foods or food
supplements and ingredients increases the phytic acid load
experienced by individuals who practice these diets.
Preventing and Reversing Bone Loss
The invention also provides novel pharmaceutical and dietary
formulations to be used as supplements and additives, and methods
for dietary supplementation, comprising phytases, e.g., any
phytase, including a phytase of the invention, for individuals
predisposed to bone loss, individuals with bone loss, and
individuals with certain medical conditions, e.g., osteoporosis,
cachexia, and medical treatments, such as chemotherapies, which can
compromise the proper uptake or utilization of essential nutrients.
The methods and compositions of the invention can be used alone or
in combination with other supplements or treatment regimens,
including with medications and the like. For example, the
formulations, dietary supplements and methods for diet
supplementation can be administered with other dietary supplements
or medications for the treatment or prevention of osteoporosis,
e.g., with vitamin D3 and/or calcium (which are proven in
preventing bone loss). In one aspect, the invention provides a
formulation comprising a phytase, e.g., any phytase or a phytase of
the invention, and vitamin D3 and/or calcium. In one aspect, the
invention provides a formulation comprising a phytase, e.g., any
phytase or a phytase of the invention, for preventing bone loss. In
one aspect, the invention provides a formulation comprising a
phytase, e.g., any phytase or a phytase of the invention, for
reversing bone loss.
The formulation can be in the form of a pharmaceutical composition,
or, can be an additive to a pharmaceutical, either of which can be
in liquid, solid, powder, lotion, spray or aerosol forms.
Pharmaceutical compositions and formulations of the invention for
oral administration can be formulated using pharmaceutically
acceptable carriers well known in the art in appropriate and
suitable dosages. Such carriers enable the pharmaceuticals to be
formulated in unit dosage forms as tablets, pills, powder, dragees,
capsules, liquids, lozenges, gels, syrups, slurries, suspensions,
etc., suitable for ingestion by the patient. Pharmaceutical
preparations for oral use can be formulated as a solid excipient,
optionally grinding a resulting mixture, and processing the mixture
of granules, after adding suitable additional compounds, if
desired, to obtain tablets or dragee cores. Suitable solid
excipients are carbohydrate or protein fillers include, e.g.,
sugars, including lactose, sucrose, mannitol, or sorbitol; starch
from corn, wheat, rice, potato, or other plants; cellulose such as
methyl cellulose, hydroxypropylmethyl-cellulose, or sodium
carboxy-methylcellulose; and gums including arabic and tragacanth;
and proteins, e.g., gelatin and collagen. Disintegrating or
solubilizing agents may be added, such as the cross-linked
polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such
as sodium alginate.
The invention provides aqueous suspensions comprising a phytase,
e.g., a phytase of the invention, in admixture with excipients
suitable for the manufacture of aqueous suspensions. Such
excipients include a suspending agent, such as sodium
carboxymethylcellulose, methylcellulose,
hydroxypropylmethylcellulose, sodium alginate,
polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing
or wetting agents such as a naturally occurring phosphatide (e.g.,
lecithin), a condensation product of an alkylene oxide with a fatty
acid (e.g., polyoxyethylene stearate), a condensation product of
ethylene oxide with a long chain aliphatic alcohol (e.g.,
heptadecaethylene oxycetanol), a condensation product of ethylene
oxide with a partial ester derived from a fatty acid and a hexitol
(e.g., polyoxyethylene sorbitol mono-oleate), or a condensation
product of ethylene oxide with a partial ester derived from fatty
acid and a hexitol anhydride (e.g., polyoxyethylene sorbitan
mono-oleate). The aqueous suspension can also contain one or more
preservatives such as ethyl or n-propyl p-hydroxybenzoate, one or
more coloring agents, one or more flavoring agents and one or more
sweetening agents, such as sucrose, aspartame or saccharin.
Formulations can be adjusted for osmolarity.
The dosage regimen also takes into consideration pharmacokinetics
parameters well known in the art, i.e., the active agents' rate of
absorption, bioavailability, metabolism, clearance, and the like
(see, e.g., Hidalgo-Aragones (1996) J. Steroid Biochem. Mol. Biol.
58:611-617; Groning (1996) Pharmazie 51:337-341; Fotherby (1996)
Contraception 54:59-69; Johnson (1995) J. Pharm. Sci. 84:1144-1146;
Rohatagi (1995) Pharmazie 50:610-613; Brophy (1983) Eur. J. Clin.
Pharmacol. 24:103-108; the latest edition of Remington, The Science
and Practice of Pharmacy 20.sup.th Ed. Lippincott Williams &
Wilkins). The state of the art allows the clinician to determine
the dosage regimen for each individual patient, active agent and
disease or condition treated. Guidelines provided for similar
compositions used as pharmaceuticals can be used as guidance to
determine the dosage regiment, i.e., dose schedule and dosage
levels, administered practicing the methods of the invention (e.g.,
reversing bone loss, or, preventing bone loss) are appropriate and
correct.
Physical Training Supplements
The invention also provides novel dietary supplements and
additives, and methods of using them, comprising phytases, e.g.,
any phytase, or, a phytase of the invention, for individuals
undergoing athletic or other intense physical training, e.g.,
training for soldiers. Athletic training and hyperexertion can
deplete essential nutrients and require dietary supplementation.
These diets and conditions have in common a lack of essential
micronutrients such as metals (K, Ca, Fe, Zn, Mn, Se) and ions
(PO.sub.4) necessary for optimal nutrition. Diets rich in phytic
acid exacerbate this problem and may also lead to both chronic and
acute conditions that result from either voluntary or economically
enforced dependence on diets rich in high phytic acid foods.
For example, individuals following various low carbohydrate ("low
carb") diets are often plagued with muscle, e.g., leg muscle,
cramps. Typical advice for this is to add additional potassium,
calcium and other nutrients to their diet. This invention provides
compositions for dietary supplementation, dietary aids and
supplements and methods for diet supplementation to enhance
otherwise compromised nutrition via the mobilization of macro and
micronutrients using phytase supplementation to the diet (including
use of any phytase, or, a phytase of the invention).
In one aspect of the invention, the use of a phytase (e.g., use of
any phytase, or, a phytase of the invention) is optimized to
demonstrate thermo labile or pH-stability profiles that will make
it suitable for addition directly to the food and supplement
process and/or demonstrate enhanced stability and activity in the
human or animal gastro intestinal tract.
The invention also provides novel dietary supplements and
additives, and methods of using them, comprising phytases, e.g.,
any phytase, or, a phytase of the invention, for individuals
undergoing mineral supplementation. Mineral supplementation for
people on foods with high phytic acid content may actually
exacerbate problems with nutrient availability. Literature
references suggest that complexes of phytic acid, calcium and zinc
are much more insoluble that complexes of phytic acid and calcium.
People often take multi mineral supplements. The addition of
phytase to a scheme devised to combine mineral supplements in the
presence of high phytic acid foods could make these supplements
much more effective.
In alternative aspects, the compositions and methods of the
invention (comprising any phytase, or, a phytase of the invention)
are used as supplements or additives to Weight-loss programs which
limit intake of particular food groups, vegetarian, macrobiotic or
vegan diets which limit or preclude intake of meats, nightshade
vegetables, breads, etc and other diets which focus on intake of
nuts, Specific supplement for individuals on low carb diets rich in
high phytic acid foods to ease physiological symptoms based on
reduced mineral uptake, Athletic training regimens which seek to
enhance performance through dietary intake, including military
training regimens, Hospital diets tailored to specific needs of
patients compromised in uptake or restricted to food groups
Micronutrient-poor cereal and legume diets in the developing world,
School lunch programs.
The invention also provides kits comprising compositions of the
invention (comprising any phytase, or, a phytase of the invention)
and instructions on incorporating the composition or method of the
invention into these diets. The kits can comprise any packaging,
labeling, product inserts and the like.
In one aspect, the invention provides a natural phytase or an
optimized phytase of the invention, formulated for or optimized for
(e.g., sequence optimized for) production, processing or passage
thru human or animal system, e.g., digestive tract. The phytase
enzyme can be optimized using alternative formulations.
Alternatively, a phytase enzyme of the invention, or, any phytase,
can be optimized by engineering of its sequence, e.g., using for
example, directed evolution, error-prone PCR, shuffling,
oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR
mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive
ensemble mutagenesis, exponential ensemble mutagenesis,
site-specific mutagenesis, ligation reassembly, GSSM.TM. and any
combination thereof, to retain activity during processing,
ingestion and in the human gut.
The compositions (e.g., dietary formulations comprising any phytase
enzyme, or a phytase enzyme of the invention) can be delivered in a
number of ways to provide dietary efficacy. For example, the
invention provides compositions (e.g., dietary formulations or
additives comprising any phytase enzyme, or a phytase enzyme of the
invention) and methods comprising use of: In packaged food
supplements such as chewable tablets or nutritional bars, As a
lyophilized product available for hydration prior to ingestion,
Co-packaged with dietary products, eg., processed soy product or
sold as a formulation with soybean protein hydrolysate and other
processing fractions from whole foods that are sold as ingredients
to the processed food industry, In commercial baked goods, Spray-on
to breakfast cereals, Spray-administered (e.g., nasal spray)
formulations, As a transgenic product expressed in indigenous
crops, ie., cereals and legumes (e.g., as a transgenic product of a
microorganism, such as a bacterium) As a transgenic organism, e.g.,
a microorganism; for example, a human or animal is fed a bacteria
or other microorganism capable of making (and, in an alternative
embodiment, secreting) a recombinant phytase, such as a phytase of
the invention, after ingestion or implantation, e.g., into the gut
of the human or animal.
Phytase-containing products and methods of the invention can be
branded as nutrient enhanced, nutrient compatible or otherwise
noted for an ability to enhance nutrient performance and relieve
various symptoms associated with nutrient deficiency.
Phytase-containing products and methods of the invention are used
to mitigate the anti-nutritive effects of phytate, which chelates
important dietary minerals such as zinc, copper, iron, magnesium,
tin, and calcium. According, phytase-containing products and
methods of the invention are used as dietary supplements to prevent
the precipitation of metal-binding enzymes and proteins in ingested
foods. In one aspect, the phytase-containing products and methods
of the invention are used to mitigate the anti-nutritive effects of
phytate in human diets, in particular those rich in legumes and
cereals, to increase mineral bioavailability. In one aspect, a
phytase in a dietary supplement of the invention catalyzes the
partial or complete hydrolytic removal of orthophosphate from a
phytate, where complete hydrolysis of phytate results in the
production of 1 molecule of inositol and 6 molecules of inorganic
phosphate.
Phytase-containing products and methods of the invention are
applicable to the diet of humans and numerous animals, including
fowl and fish. For example, phytase-containing dietary supplement
products and dietary supplement methods of the invention can be
practiced with commercially significant species, e.g., pigs,
cattle, sheep, goats, laboratory rodents (rats, mice, hamsters and
gerbils), fur-bearing animals such as mink and fox, and zoo animals
such as monkeys and apes, as well as domestic mammals such as cats
and dogs. Typical commercially significant avian species include
chickens, turkeys, ducks, geese, pheasants, emu, ostrich, loons,
kiwi, doves, parrots, cockatiel, cockatoo, canaries, penguins,
flamingoes, and quail. Commercially farmed fish such as trout would
also benefit from the dietary aids disclosed herein. Other fish
that can benefit include, for example, fish (especially in an
aquarium or aquaculture environment, e.g., tropical fish), goldfish
and other ornamental carp, catfish, trout, salmon, shark, ray,
flounder, sole, tilapia, medaka, guppy, molly, platyfish,
swordtail, zebrafish, and loach.
Phytase-containing products and methods of the invention are also
used in various agars, gels, medias, and solutions used in tissue
and/or cell culturing. Inconsistent soy hydrolysates can be a
problem encountered when using tissue and/or cell culturing. In one
aspect, phytase-containing products and methods of the invention
are used as cell culture media additives or as treatments to, e.g.,
increase cell culture yield and performance consistency. In one
aspect, the invention provides hydrolysate for cell culturing
comprising phytases, e.g., phytases of the invention.
In one aspect, to provide a consistent product, the invention
provide methods for making hydrolysates, supplements or other
additives for cell culturing comprising phytases by using phytase
biomarkers. For example, the method would comprise "scoring" or
"marking" several molecules of phytase in batches of hydrolysate,
supplement or other additive, and then blending the batches in the
hydrolysate, supplement or other additive to achieve a consistent
biomarker pattern. In one aspect, culture performance with each
batch is measured in a mini-bioreactor(s) and performance with each
biomarker and batch is correlated. In one aspect, a blend is made
to generate a higher performance product that is consistent or
better than average. In one aspect, thioredoxin (TRX) is added to
increase the bioavailability of many proteins by eliminating
secondary structure caused by disulfide bonds. In one aspect,
proteases are also added to the hydrolysates, supplements or
additives of the invention. The proteases can be "scored" or
quality controlled with other biomarkers (as with phytase, as
discussed above) to direct the blending process.
In one aspect, the invention provides methods for adding phytases
to grains to provide a consistent product using a biomarker
"scoring" or quality control process analogous to that described
above for the hydrolysates, supplements or additives of the
invention.
Enzyme Enhanced Diets for Increased Warfighter Efficiency and
Morale
In one aspect, the invention provides novel dietary supplements and
additives and methods for diet supplementation comprising phytases,
e.g., any phytase, or, a phytase of the invention, for
enzyme-enhanced diets for increased warfighter efficiency and
morale. In one aspect, these dietary supplement compositions of the
invention work, in situ, to enhance energy, stamina and morale in a
stable, easily usable and desirable format while limiting food
waste.
In one aspect, these dietary supplement compositions and methods of
the invention address the military operational challenge comprising
efficient delivery of nutrients and the associated health, morale
and operational effectiveness of soldiers. The invention provides
enzymes optimized to function efficiently in the human gut. These
enzymes can enhance extraction of nutrients and generation of
energy as well as prolong maintenance of nutritional sufficiency
and individual satiety.
In addition to phytase, other enzymes, e.g., amylases, xylanases,
proteases, lipases, are used to practice the dietary supplement
compositions and methods of the invention. In one aspect, the
invention provides formulations, food supplements, foods,
self-contained meal Ready-to-Eat units (MREs), drinks, hydrating
agents and the like, comprising phytase, e.g., a phytase of the
invention, and another enzyme, e.g., amylases, xylanases,
proteases, lipases or a combination thereof. When ingested with
food, these enzymes have been shown to enhance the release of
critical nutrients, e.g., phosphorus, essential metals and ions,
amino acids, and sugars. Furthermore, co-ingestion of these enzymes
increases gastrointestinal mechanics and absorption by
depolymerizing plant-derived cellulose, hemicellulose and starch.
This white paper proposes the development of these enzymes as
supplements to military diets to provide enhanced nutrient
utilization for warfighter.
In one aspect, the food supplement of the invention causes the
release of essential phosphate from normally anti-nutritive,
plant-derived phytate to increase food energy yield and bone
CaPO.sub.4 deposition. In one aspect, phytases and other potential
nutritional supplement enzymes can withstand gut pH and endogenous
protease activities.
In one aspect, the invention provides enzyme supplements to
rations, drinks, foods, MREs, hydrating agents and the like to
significantly improve nutritional value, digestibility and energy
content of military meals (or any meal, including general consumer
meal and diet supplementation products) served to warfighters in
training, battle or any stressful situation. The supplement can be
formulated for ease of use and personal transport (in or with MREs,
hydrating agents, etc). In one aspect, the enzyme supplement will
not compromise food appearance, taste and/or consistency. In one
aspect, the product improve health and increases the stamina of
warfighters.
In alternative aspects, the enzyme supplement is delivered in a
number of ways to provide dietary efficacy; for example, the
invention provides phytases, including phytases of the invention,
and in some aspects, additional enzymes, in: Packaged food or drink
supplements such as MREs, rations, survival kits, hydrating agents,
chewable tablets or nutritional bars; As a lyophilized product
(e.g., a powder) available for hydration prior to ingestion;
Co-packaged with dietary products, foods, drinks, e.g., processed
soy product or a formulation with soybean protein hydrolysate and
other processing fractions from whole foods that are sold as
ingredients to the processed food industry; In baked goods;
Spray-on to cereals; Formulations such as tablets, geltabs,
capsules, sprays and the like.
In one aspect, the compositions and methods of the invention
provide nutritional supplementation that rapidly releases calories
and macro- and micronutrients from ingested meals. In one aspect,
the compositions and methods of the invention provides energy and
body strength to individuals in stressful situations, e.g.,
involving hyperexertion and discontinuous periods of depravation.
In one aspect, the compositions and methods of the invention
provide enzymes optimized and formulated to work effectively in
human gut while maintaining stability, shelf life and
transportability in a desired environment, e.g., a military
setting.
In one aspect, the compositions and methods of the invention
provide formulations for increased taste characteristics,
dissolvability, chewability and personal transport efficiency of
the product. In one aspect, the compositions and methods of the
invention further comprise other components, such as potassium,
glucose, CaCl.sub.2. CaCl.sub.2 in the formulation can combine with
released phosphate and, in turn, enhance bone deposition and weight
gain. In one aspect, the compositions and methods of the invention
further comprise formulations of other enzymes, such as proteases,
cellulases, hemicellulases, for protein, cellulose and
hemicellulose digestion, respectively. These enzymes can improve
protein and starch availability and further increase iron
absorption from many iron-rich foods.
In one aspect, the compositions and methods of the invention
further comprise enzymes for hydrolyzing foods derived from plant
material, which is rich in the glucose and xylose-based polymers,
cellulose, hemicellulose and starch, as well as in the amino acid
polymer, protein. In one aspect, the compositions and methods of
the invention facilitate hydrolysis of polymeric materials in
foods; i.e., to facilitate complete digestion polymers to monomers,
e.g., polysaccharides to monomeric sugars, or proteins to amino
acid moieties. Thus, in this aspect, the compositions and methods
of the invention allow a food, drink or ration to realize its full
caloric and nutritional value. In one aspect, enzyme
supplementation comprises use of stabile enzymes, e.g., hydrolases
of various kinds, cellulases, hemicellulases, amylases, lipases,
amidases, proteases and other enzymes. In one aspect, enzymes used
in the compositions and methods of the invention can withstand
ambient gut conditions, i.e., stability at low pH and in the
presence of gastric proteases.
Industrial Uses of Phytases
In addition to those described above, the invention provides novel
industrial uses for phytases, including use of the novel phytases
of the invention.
Reducing Phosphate Pollution in the Environment
In one aspect, the invention provides compositions comprising
phytases (including the phytases of the invention) for addition to
waste or manure piles to convert "environmental" phytic acid. In
one aspect, this serves the purposes of reducing pollution and
increasing nutrient availability. The invention also provides
compositions and methods for adding a phytase to soil, natural or
artificial bodies of water (e.g., lakes, ponds, wells, manure
ponds, and the like), municipal sewage, any sewage effluent, and
the like. As described above, the invention provides compositions
and methods for reducing phytate levels in waste or sewage, e.g.,
an animal manure, wherein the animal is fed a dietary aid
containing an effective amount of a phytase, e.g., a phytase of the
invention. An exemplary application of the compositions and methods
of the invention is to reduce the phosphate pollution in the
environment. Thus, the compositions and methods of the invention
can be used in any application that reduces pollution by degrading
phytic acids.
Farming and Plant Growth Applications
In one aspect, the invention provides compositions comprising
phytases (including the phytases of the invention) and methods for
farming applications or other plant growth applications, e.g.,
adding phytases to fertilizers or plant food additives (e.g.,
MIRACLEGROW.TM.) for plants, e.g., house plants. In using the
compositions and methods of the invention for farming applications,
users include organic farmers. The compositions and methods of the
invention can be used for adding phytases to any soil deficient in
phosphorous or needing supplementary phosphorous for a particular
crop or application. Because phosphorous release helps plants grow,
compositions and methods of the invention can be used for adding
phytases to anything that has algae or plant material in it.
Products of Manufacture
The invention provides a variety of products of manufacture
comprising one or more phytases of this invention. For example, in
one aspect, the invention provides compositions comprising phytases
(including the phytases of the invention) and methods for cosmetic
applications, e.g., shampoos, lotions or soaps containing plant
products.
In one aspect, the invention provides compositions comprising
phytases (including the phytases of the invention) and methods for
immobilizing the phytase. In one aspect, the immobilized phytase
acts as a controlled release mechanism. For example, in one aspect,
the invention provides control released (time release) formulations
of phytases for application to soil, e.g., clay, to house plants,
etc. In one aspect, the phytases are immobilized to beads, e.g.,
polysorb beads. These beads can be delivered to soil, e.g., for
agricultural or house plants. In another aspect, control released
(time release) formulations of phytases of the invention are used
in dietary supplements and additives.
Biofuels and Biomass Conversion
The invention provides methods for making fuels, e.g., biofuels,
comprising use of one or more phytases of this invention; including
providing fuels, e.g., biofuels, comprising one or more phytases of
this invention. The invention provides methods for biomass
conversion comprising use of one or more phytases of this
invention.
In one aspect, the invention provides compositions comprising
phytases (including the phytases of the invention) and methods for
using the phytase in a fermentation or alcohol production process,
e.g. ethanol production. For example, the compositions and methods
of the invention can be used to provide effective and sustainable
alternatives or adjuncts to use of petroleum-based products, e.g.,
as a mixture of bioethanol and gasoline.
The invention provides organisms expressing enzymes of the
invention for participation in chemical cycles involving natural
biomass conversion. In addition, the combination of phytase (e.g.,
an enzyme of this invention) with one or more starch degrading
enzymes, such as amylase or glucoamylase, improves the production
of ethanol from starch. The invention provides methods for
discovering and implementing the most effective of enzymes to
enable these important new "biomass conversion" and alternative
energy industrial processes.
Biomass Conversion and Production of Clean Bio Fuels
The invention provides polypeptides, including enzymes (phytases of
the invention) and antibodies, and methods for the processing of a
biomass or any lignocellulosic material (e.g., any composition
comprising a cellulose, hemicellulose and lignin), to a fuel (e.g.,
a bioethanol, biopropanol, biobutanol, biopropanol, biomethanol,
biodiesel), in addition to feeds, foods and chemicals. For example,
in one aspect, an enzyme of the invention breaks down undigestable
phytic acid (phytate) in a biomass (e.g., a lignocellulosic
material, a grain or an oil seed) to release digestible phosphorus;
thus, in one embodiment, phytases of this invention are used to
treat or pretreat a biomass.
Thus, the compositions and methods of the invention can be used in
the production and/or processing of biofuels, e.g., to provide
effective and sustainable alternatives and/or adjuncts to use of
petroleum-based products; for example, compositions and methods of
the invention can be used with a mixture of enzymes to produce a
biofuel--such as biomethanol, bioethanol, biopropanol, biobutanol,
biodiesel and the like; which can be added to a diesel fuel, a
gasoline, a kerosene and the like. The invention provides organisms
expressing enzymes of the invention for participation in chemical
cycles involving natural biomass conversion. In one aspect, enzymes
and methods for the conversion are used in enzyme ensembles for the
efficient processing of biomass in conjunction with the
depolymerization of polysaccharides, cellulosic and/or
hemicellulosic polymers to metabolizeable (e.g., fermentable)
carbon moieties. The invention provides methods for discovering and
implementing the most effective of enzymes to enable these
important new "biomass conversion" and alternative energy
industrial processes.
The compositions and methods of the invention can be used to
provide effective and sustainable alternatives or adjuncts to use
of petroleum-based products, e.g., as a mixture of bioethanol,
biopropanol, biobutanol, biopropanol, biomethanol and/or biodiesel
and gasoline. The invention provides organisms expressing enzymes
of the invention for participation in chemical cycles involving
natural biomass conversion. The invention provides methods for
discovering and implementing the most effective of enzymes to
enable these important new "biomass conversion" and alternative
energy industrial processes.
The invention provides methods, enzymes and mixtures of enzymes or
"cocktails" of the invention, for processing a material, e.g. a
biomass material, e.g., compositions comprising a
cellooligsaccharide, an arabinoxylan oligomer, a lignin, a
lignocellulose, a xylan, a glucan, a cellulose and/or a fermentable
sugar; e.g., including methods comprising contacting the
composition with a polypeptide of the invention, or a polypeptide
encoded by a nucleic acid of the invention, wherein optionally the
material is derived from an agricultural crop (e.g., wheat, barley,
potatoes, switchgrass, poplar wood), is a byproduct of a food or a
feed production, is a lignocellulosic waste product, or is a plant
residue or a waste paper or waste paper product, and optionally the
plant residue comprise stems, leaves, hulls, husks, corn or corn
cobs, corn stover, corn fiber, hay, straw (e.g. rice straw or wheat
straw), sugarcane bagasse, sugar beet pulp, citrus pulp, and citrus
peels, wood, wood thinnings, wood chips, wood pulp, pulp waste,
wood waste, wood shavings and sawdust, construction and/or
demolition wastes and debris (e.g. wood, wood shavings and
sawdust), and optionally the paper waste comprises discarded or
used photocopy paper, computer printer paper, notebook paper,
notepad paper, typewriter paper, newspapers, magazines, cardboard
and paper-based packaging materials, and recycled paper materials.
In addition, urban wastes, e.g. the paper fraction of municipal
solid waste, municipal wood waste, and municipal green waste, along
with other materials containing sugar, starch, and/or cellulose can
be used. In alternative embodiments, the processing of the
material, e.g. the biomass material, generates a bioalcohol, e.g.,
a biodiesel, bioethanol, biomethanol, biobutanol or
biopropanol.
Alternatively, the polypeptide of the invention may be expressed in
the biomass plant material or feedstock itself.
The methods of the invention also include taking the converted
lignocellulosic material (processed by enzymes of the invention)
and making it into a fuel (e.g. a bioalcohol, e.g., a bioethanol,
biomethanol, biobutanol or biopropanol, or biodiesel) by
fermentation and/or by chemical synthesis. In one aspect, the
produced sugars are fermented and/or the non-fermentable products
are gasified.
The methods of the invention also include converting algae, virgin
vegetable oils, waste vegetable oils, animal fats and greases (e.g.
tallow, lard, and yellow grease), or sewage, using enzymes of the
invention, and making it into a fuel (e.g. a bioalcohol, e.g., a
bioethanol, biomethanol, biobutanol or biopropanol, or biodiesel)
by fermentation and/or by chemical synthesis or conversion.
The enzymes of the invention (including, for example, organisms,
such as microorganisms, e.g., fungi, yeast or bacteria, making and
in some aspects secreting recombinant enzymes of the invention) can
be used in or included/integrated at any stage of any biomass
conversion process, e.g., at any one step, several steps, or
included in all of the steps, or all of the following methods of
biomass conversion processes, or all of these biofuel alternatives:
Direct combustion: the burning of material by direct heat and is
the simplest biomass technology; can be very economical if a
biomass source is nearby. Pyrolysis: is the thermal degradation of
biomass by heat in the absence of oxygen. In one aspect, biomass is
heated to a temperature between about 800 and 1400 degrees
Fahrenheit, but no oxygen is introduced to support combustion
resulting in the creation of gas, fuel oil and charcoal.
Gasification: biomass can be used to produce methane through
heating or anaerobic digestion. Syngas, a mixture of carbon
monoxide and hydrogen, can be derived from biomass. Landfill Gas:
is generated by the decay (anaerobic digestion) of buried garbage
in landfills. When the organic waste decomposes, it generates gas
consisting of approximately 50% methane, the major component of
natural gas. Anaerobic digestion: converts organic matter to a
mixture of methane, the major component of natural gas, and carbon
dioxide. In one aspect, biomass such as waterwaste (sewage),
manure, or food processing waste, is mixed with water and fed into
a digester tank without air. Fermentation Alcohol Fermentation:
fuel alcohol is produced by converting cellulosic mass and/or
starch to sugar, fermenting the sugar to alcohol, then separating
the alcohol water mixture by distillation. Feedstocks such as
dedicated crops (e.g., corn, wheat, barley, potatoes, switchgrass,
Miscanthus, poplar wood), agricultural residues and wastes (e.g.
rice straw, corn stover, wheat straw, sugarcane bagasse, rice
hulls, corn fiber, sugar beet pulp, citrus pulp, and citrus peels),
forestry wastes (e.g. hardwood and softwood thinnings, hardwood and
softwood residues from timber operations, wood shavings, and
sawdust), urban wastes (e.g. paper fraction of municipal solid
waste, municipal wood waste, municipal green waste), wood wastes
(e.g. saw mill waste, pulp mill waste, construction waste,
demolition waste, wood shavings, and sawdust), and waste paper or
other materials containing sugar, starch, and/or cellulose can be
converted to sugars and then to alcohol by fermentation with yeast.
Alternatively, materials containing sugars can be converted
directly to alcohol by fermentation. Transesterification: An
exemplary reaction for converting oil to biodiesel is called
transesterification. The transesterification process reacts an
alcohol (like methanol) with the triglyceride oils contained in
vegetable oils, animal fats, or recycled greases, forming fatty
acid alkyl esters (biodiesel) and glycerin. The reaction requires
heat and a strong base catalyst, such as sodium hydroxide or
potassium hydroxide. Biodiesel: Biodiesel is a mixture of fatty
acid alkyl esters made from vegetable oils, animal fats or recycled
greases. Biodiesel can be used as a fuel for vehicles in its pure
form, but it is usually used as a petroleum diesel additive to
reduce levels of particulates, carbon monoxide, hydrocarbons and
air toxics from diesel-powered vehicles. Hydrolysis: includes
hydrolysis of a compound, e.g., a biomass, such as a
lignocellulosic material, catalyzed using an enzyme of the instant
invention. Congeneration: is the simultaneous production of more
than one form of energy using a single fuel and facility. In one
aspect, biomass cogeneration has more potential growth than biomass
generation alone because cogeneration produces both heat and
electricity.
In one aspect, the polypeptides of the invention can be used in
conjunction with other enzymes, e.g., hydrolases or enzymes having
cellulolytic activity, e.g., a glucanase, endoglucanase, mannase
and/or other enzyme, for generating a fuel such as a bioalcohol,
e.g., a bioethanol, biomethanol, biobutanol or biopropanol, or
biodiesel, from any organic material, e.g., a biomass, such as
compositions derived from plants and animals, including any
agricultural crop or other renewable feedstock, an agricultural
residue or an animal waste, the organic components of municipal and
industrial wastes, or construction or demolition wastes or debris,
or microorganisms such as algae or yeast.
In one aspect, polypeptides of the invention are used in processes
for converting lignocellulosic biomass to a fuel (e.g. a
bioalcohol, e.g., a bioethanol, biomethanol, biobutanol or
biopropanol, or biodiesel), or otherwise are used in processes for
hydrolyzing or digesting biomaterials such that they can be used as
a fuel (e.g. a bioalcohol, e.g., a bioethanol, biomethanol,
biobutanol or biopropanol, or biodiesel), or for making it easier
for the biomass to be processed into a fuel.
In an alternative aspect, polypeptides of the invention, including
the mixture of enzymes or "cocktails" of the invention, are used in
processes for a transesterification process reacting an alcohol
(like ethanol, propanol, butanol, propanol, methanol) with a
triglyceride oil contained in a vegetable oil, animal fat or
recycled greases, forming fatty acid alkyl esters (biodiesel) and
glycerin. In one aspect, biodiesel is made from soybean oil or
recycled cooking oils. Animal's fats, other vegetable oils, and
other recycled oils can also be used to produce biodiesel,
depending on their costs and availability. In another aspect,
blends of all kinds of fats and oils are used to produce a
biodiesel fuel of the invention.
Enzymes of the invention, including the mixture of enzymes or
"cocktails" of the invention, can also be used in glycerin
refining. The glycerin by-product contains unreacted catalyst and
soaps that are neutralized with an acid. Water and alcohol are
removed to produce 50% to 80% crude glycerin. The remaining
contaminants include unreacted fats and oils, which can be
processes using the polypeptides of the invention. In a large
biodiesel plants of the invention, the glycerin can be further
purified, e.g., to 99% or higher purity, for the pharmaceutical and
cosmetic industries.
Fuels (including bioalcohols such as bioethanols, biomethanols,
biobutanols or biopropanols, or biodiesels) made using the
polypeptides of the invention, including the mixture of enzymes or
"cocktails" of the invention, can be used with fuel oxygenates to
improve combustion characteristics. Adding oxygen results in more
complete combustion, which reduces carbon monoxide emissions. This
is another environmental benefit of replacing petroleum fuels with
biofuels (e.g., a fuel of the invention). A biofuel made using the
compositions and/or methods of this invention can be blended with
gasoline to form an E10 blend (about 5% to 10% ethanol and about
90% to 95% gasoline), but it can be used in higher concentrations
such as E85 or in its pure form. A biofuel made using the
compositions and/or methods of this invention can be blended with
petroleum diesel to form a B20 blend (20% biodiesel and 80%
petroleum diesel), although other blend levels can be used up to
B100 (pure biodiesel).
The invention also provides processes using enzymes of this
invention for making biofuels (including bioalcohols such as
bioethanols, biomethanols, biobutanols or biopropanols, or
biodiesels) from compositions comprising a biomass, e.g., a
plant-derived source, such as a lignocellulosic biomass. The
biomass material can be obtained from agricultural crops, as a
byproduct of food or feed production, or as waste products,
including lignocellulosic waste products, such as plant residues,
waste paper or construction and/or demolition wastes or debris.
Examples of suitable plant sources or plant residues for treatment
with polypeptides of the invention include kelp, algae, grains,
seeds, stems, leaves, hulls, husks, corn cobs, corn stover, straw,
sugar cane, sugar cane bagasse, grasses (e.g., Indian grass, such
as Sorghastrum nutans; or, switch grass, e.g., Panicum species,
such as Panicum virgatum), and the like, as well as wood, wood
chips, wood pulp, and sawdust. Examples of paper waste suitable for
treatment with polypeptides of the invention include discard
photocopy paper, computer printer paper, notebook paper, notepad
paper, typewriter paper, and the like, as well as newspapers,
magazines, cardboard, and paper-based packaging materials. Examples
of construction and demolition wastes and debris include wood, wood
scraps, wood shavings and sawdust.
In one embodiment, the enzymes, including the mixture of enzymes or
"cocktails" of the invention, and methods of the invention can be
used in conjunction with more "traditional" means of making
ethanol, methanol, propanol, butanol, propanol and/or diesel from
biomass, e.g., as methods comprising hydrolyzing lignocellulosic
materials by subjecting dried lignocellulosic material in a reactor
to a catalyst comprised of a dilute solution of a strong acid and a
metal salt; this can lower the activation energy, or the
temperature, of cellulose hydrolysis to obtain higher sugar yields;
see, e.g., U.S. Pat. Nos. 6,660,506 and 6,423,145.
Another exemplary method that incorporates use of enzymes of the
invention, including the mixture of enzymes or "cocktails" of the
invention, comprises hydrolyzing a biomass, including any
lignocellulosic material, e.g., containing hemicellulose, cellulose
and lignin, or any other polysaccharide that can be hydrolyzed, by
subjecting the material to a first stage hydrolysis step in an
aqueous medium at a temperature and a pressure chosen to effect
primarily depolymerization of hemicellulose without major
depolymerization of cellulose to glucose. This step results in a
slurry in which the liquid aqueous phase contains dissolved
monosaccharides resulting from depolymerization of hemicellulose
and a solid phase containing cellulose and lignin. A second stage
hydrolysis step can comprise conditions such that at least a major
portion of the cellulose is depolymerized, such step resulting in a
liquid aqueous phase containing dissolved/soluble depolymerization
products of cellulose. See, e.g., U.S. Pat. No. 5,536,325. Enzymes
of the invention (including the invention's mixtures, or
"cocktails" of enzymes) can be added at any stage of this exemplary
process.
Another exemplary method that incorporated use of enzymes of the
invention, including the mixture of enzymes or "cocktails" of the
invention, comprises processing a lignocellulose-containing biomass
material by one or more stages of dilute acid hydrolysis with about
0.4% to 2% strong acid; and treating an unreacted solid
lignocellulosic component of the acid hydrolyzed biomass material
by alkaline delignification to produce precursors for biodegradable
thermoplastics and derivatives. See, e.g., U.S. Pat. No. 6,409,841.
Enzymes of the invention can be added at any stage of this
exemplary process.
Another exemplary method that incorporated use of enzymes of the
invention, including the mixture of enzymes or "cocktails" of the
invention, comprises prehydrolyzing lignocellulosic material in a
prehydrolysis reactor; adding an acidic liquid to the solid
lignocellulosic material to make a mixture; heating the mixture to
reaction temperature; maintaining reaction temperature for time
sufficient to fractionate the lignocellulosic material into a
solubilized portion containing at least about 20% of the lignin
from the lignocellulosic material and a solid fraction containing
cellulose; removing a solubilized portion from the solid fraction
while at or near reaction temperature wherein the cellulose in the
solid fraction is rendered more amenable to enzymatic digestion;
and recovering a solubilized portion. See, e.g., U.S. Pat. No.
5,705,369. Enzymes of the invention can be added at any stage of
this exemplary process.
The invention provides methods for making motor fuel compositions
(e.g., for spark ignition motors) based on liquid hydrocarbons
blended with a fuel grade alcohol made by using an enzyme or a
method of the invention. In one aspect, the fuels made by use of an
enzyme of the invention comprise, e.g., coal gas liquid- or natural
gas liquid-ethanol blends. In one aspect, a co-solvent is
biomass-derived 2-methyltetrahydrofuran (MTHF). See, e.g., U.S.
Pat. No. 6,712,866.
In one aspect, methods of the invention for the enzymatic
degradation of lignocellulose, e.g., for production of biofuels
(including bioalcohols such as bioethanols, biomethanols,
biobutanols or biopropanols, or biodiesels) from lignocellulosic
material, can also comprise use of ultrasonic treatment of the
biomass material; see, e.g., U.S. Pat. No. 6,333,181.
In another aspect, methods of the invention for producing biofuels
(including bioalcohols such as bioethanols, biomethanols,
biobutanols or biopropanols, or biodiesels) from a cellulosic
substrate comprise providing a reaction mixture in the form of a
slurry comprising cellulosic substrate, an enzyme of this invention
and a fermentation agent (e.g., within a reaction vessel, such as a
semi-continuously solids-fed bioreactor), and the reaction mixture
is reacted under conditions sufficient to initiate and maintain a
fermentation reaction (as described, e.g., in U.S. Pat. App. No.
20060014260). In one aspect, experiment or theoretical calculations
can determine an optimum feeding frequency. In one aspect,
additional quantities of the cellulosic substrate and the enzyme
are provided into the reaction vessel at an interval(s) according
to the optimized feeding frequency.
One exemplary process for making biofuels (including bioalcohols
such as bioethanols, biomethanols, biobutanols or biopropanols, or
biodiesels) of the invention is described in U.S. Pat. App. Pub.
Nos. 20050069998; 20020164730; and in one aspect comprises stages
of grinding the lignocellulosic biomass (e.g., to a size of 15-30
mm), subjecting the product obtained to steam explosion
pre-treatment (e.g., at a temperature of 190-230.degree. C.) for
between 1 and 10 minutes in a reactor; collecting the pre-treated
material in a cyclone or related product of manufacture; and
separating the liquid and solid fractions by filtration in a filter
press, introducing the solid fraction in a fermentation deposit and
adding one or more enzymes of the invention, e.g., a cellulase
and/or beta-glucosidase enzyme (e.g., dissolved in citrate buffer
pH 4.8).
Another exemplary process for making biofuels (including
bioalcohols such as bioethanols, biomethanols, biobutanols or
biopropanols, or biodiesels) of the invention comprising
bioethanols, biomethanols, biobutanols or biopropanols using
enzymes of the invention comprises pretreating a starting material
comprising a lignocellulosic feedstock comprising at least
hemicellulose and cellulose. In one aspect, the starting material
comprises potatoes, soybean (rapeseed), barley, rye, corn, oats,
wheat, beets or sugar cane or a component or waste or food or feed
production byproduct. The starting material ("feedstock") is
reacted at conditions which disrupt the plant's fiber structure to
effect at least a partial hydrolysis of the hemicellulose and
cellulose. Disruptive conditions can comprise, e.g., subjecting the
starting material to an average temperature of 180.degree. C. to
270.degree. C. at pH 0.5 to 2.5 for a period of about 5 seconds to
60 minutes; or, temperature of 220.degree. C. to 270.degree. C., at
pH 0.5 to 2.5 for a period of 5 seconds to 120 seconds, or
equivalent. This generates a feedstock with increased accessibility
to being digested by an enzyme, e.g., a cellulase enzyme of the
invention. U.S. Pat. No. 6,090,595.
Exemplary conditions for using enzymes of the invention in the
hydrolysis of lignocellulosic material include reactions at
temperatures between about 30.degree. C. and 48.degree. C., and/or
a pH between about 4.0 and 6.0. Other exemplary conditions include
a temperature between about 30.degree. C. and 60.degree. C. and a
pH between about 4.0 and 8.0.
Glucanases, (or cellulases), mannanases, xylanases, amylases,
xanthanases and/or glycosidases, e.g., cellobiohydrolases,
mannanases and/or beta-glucosidases can be used in the conversion
of biomass to fuels, and in the production of ethanol, e.g., as
described in PCT Application Nos. WO0043496 and WO8100857.
Glucanases (or cellulases), mannanases, xylanases, amylases,
xanthanases and/or glycosidases, e.g., cellobiohydrolases,
mannanases and/or beta-glucosidases, can be used in combination
with phytase (e.g., enzymes of the invention) to produce
fermentable sugars and glucan-containing biomass that can be
converted into fuel ethanol. Amylases, glucoamylases, pullanases,
glucoisomerase, alpha-glucosidase, and the like can be used in
combination with phytase (e.g., enzymes of the invention) to
convert starch to fermentable sugars or ethanol. Please see PCT
Application No. WO2005/096804.
Distillers Dried Grain Processing
In another aspect, the enzymes of the invention can be used to
treat/process "distillers dried solubles (DDS)", "distillers dried
grains (DDS)", "condensed distillers solubles (CDS)", "distillers
wet grains (DWG)", and "distillers dried grains with solubles
(DDGS)"; distillers dried grains can be a cereal byproduct of a
distillation process, and can include solubles. These processes can
comprise dry-grinding plant by-products, e.g. for feed
applications, e.g., for poultry, bovine, swine and other domestic
animals. Thus, the enzymes of the invention can be used to
treat/process grains, e.g., cereals, that are byproducts of any
distillation process, including processes using any source of
grain, for example, the traditional sources from brewers, or
alternatively, from an ethanol-producing plant (factory, mill or
the like). Enzymes of the invention can be used to treat/process
drying mash from distilleries; this mash can be subsequently used
for a variety of purposes, e.g., as fodder for livestock,
especially ruminants; thus the invention provides methods for
processing fodder for livestock such as ruminants, and
enzyme-processed fodder comprising phytases of this invention.
Phytases of this invention can be used alone or with other enzymes
to process "distillers dried solubles (DDS)", "distillers dried
grains (DDS)", "condensed distillers solubles (CDS)", "distillers
wet grains (DWG)", and "distillers dried grains with solubles
(DDGS)". For example, phytases of this invention can be used in any
step of an alcohol product process as illustrated in FIG. 10.
Phytases of this invention can be used to increase the
bioavailability of phosphorus in any biofuel, or potential biofuel,
including phosphorus found in "distillers dried solubles (DDS)",
"distillers dried grains (DDS)", "condensed distillers solubles
(CDS)", "distillers wet grains (DWG)", and "distillers dried grains
with solubles (DDGS)" (see, e.g., C. Martinez Amezcua, 2004 Poultry
Science 83:971-976).
Spirit, or Drinkable Alcohol Production
Phytases of this invention of this invention also can be used in
processing distillers dried grains for alcohol production--alcohol
as in "spirits", e.g., beer or whiskey production (in addition to
use in processing biomass for making biofuels). Phytases of this
invention of this invention can be used in ethanol plants, e.g. for
processing grains such as corn. Distillers dried grains can be made
by first grinding a grain (e.g., corn) to a coarse consistency and
adding to hot water. After cooling, yeast is added and the mixture
ferments for several days to a week. The solids remaining after
fermentation are the distillers grains. Phytases of this invention
of this invention can be used at any step of this process.
Formulations
The invention provides novel formulations comprising phytases,
e.g., as those described herein, and formulations for phytases,
including formulations which include the novel phytases of the
invention. The phytases of the invention can be used or formulated
alone or as mixture of phytases or phytases and other enzymes such
as xylanases, cellulases, proteases, lipases, amylases, or redox
enzymes such as laccases, peroxidases, catalases, oxidases, or
reductases. They can be used formulated in a solid form such as a
powder, a lyophilized preparation, a granule, a tablet, a bar, a
crystal, a capsule, a pill, a pellet, or in a liquid form such as
in an aqueous solution, an aerosol, a gel, a paste, a slurry, an
aqueous/oil emulsion, a cream, a capsule, or in a vesicular or
micellar suspension. The formulations of the invention can comprise
any or a combination of the following ingredients: polyols such as
a polyethylene glycol, a polyvinylalcohol, a glycerol, a sugar such
as a sucrose, a sorbitol, a trehalose, a glucose, a fructose, a
maltose, a mannose, a gelling agent such as a guar gum, a
carageenan, an alginate, a dextrans, a cellulosic derivative, a
pectin, a salt such as a sodium chloride, a sodium sulfate, an
ammonium sulfate, a calcium chloride, a magnesium chloride, a zinc
chloride, a zinc sulfate, a salt of a fatty acid and a fatty acid
derivative, a metal chelator such as an EDTA, an EGTA, a sodium
citrate, an antimicrobial agent such as a fatty acid or a fatty
acid derivative, a paraben, a sorbate, a benzoate, an additional
modulating compound to block the impact of an enzyme such as a
protease, a bulk proteins such as a BSA, a wheat hydrolysate, a
borate compound, an amino acid or a peptide, an appropriate pH or
temperature modulating compound, an emulsifier such as a non-ionic
and/or an ionic detergent, a redox agent such as a
cystine/cysteine, a glutathione, an oxidized glutathione, a reduced
or an antioxidant compound such as an ascorbic acid, a wax or oil,
or a dispersant. Cross-linking and protein modification such as
pegylation, fatty acid modification, glycosylation can also be used
to improve enzyme stability.
Measuring Metabolic Parameters
The methods of the invention involve whole cell evolution, or whole
cell engineering, of a cell to develop a new cell strain having a
new phenotype by modifying the genetic composition of the cell,
where the genetic composition is modified by addition to the cell
of a nucleic acid of the invention. To detect the new phenotype, at
least one metabolic parameter of a modified cell is monitored in
the cell in a "real time" or "on-line" time frame. In one aspect, a
plurality of cells, such as a cell culture, is monitored in "real
time" or "on-line." In one aspect, a plurality of metabolic
parameters is monitored in "real time" or "on-line."
Metabolic flux analysis (MFA) is based on a known biochemistry
framework. A linearly independent metabolic matrix is constructed
based on the law of mass conservation and on the pseudo-steady
state hypothesis (PSSH) on the intracellular metabolites. In
practicing the methods of the invention, metabolic networks are
established, including the: identity of all pathway substrates,
products and intermediary metabolites identity of all the chemical
reactions interconverting the pathway metabolites, the
stoichiometry of the pathway reactions, identity of all the enzymes
catalyzing the reactions, the enzyme reaction kinetics, the
regulatory interactions between pathway components, e.g. allosteric
interactions, enzyme-enzyme interactions etc, intracellular
compartmentalization of enzymes or any other supramolecular
organization of the enzymes, and, the presence of any concentration
gradients of metabolites, enzymes or effector molecules or
diffusion barriers to their movement.
Once the metabolic network for a given strain is built, mathematic
presentation by matrix notion can be introduced to estimate the
intracellular metabolic fluxes if the on-line metabolome data is
available.
Metabolic phenotype relies on the changes of the whole metabolic
network within a cell. Metabolic phenotype relies on the change of
pathway utilization with respect to environmental conditions,
genetic regulation, developmental state and the genotype, etc. In
one aspect of the methods of the invention, after the on-line MFA
calculation, the dynamic behavior of the cells, their phenotype and
other properties are analyzed by investigating the pathway
utilization. For example, if the glucose supply is increased and
the oxygen decreased during the yeast fermentation, the utilization
of respiratory pathways will be reduced and/or stopped, and the
utilization of the fermentative pathways will dominate. Control of
physiological state of cell cultures will become possible after the
pathway analysis. The methods of the invention can help determine
how to manipulate the fermentation by determining how to change the
substrate supply, temperature, use of inducers, etc. to control the
physiological state of cells to move along desirable direction. In
practicing the methods of the invention, the MFA results can also
be compared with transcriptome and proteome data to design
experiments and protocols for metabolic engineering or gene
shuffling, etc.
In practicing the methods of the invention, any modified or new
phenotype can be conferred and detected, including new or improved
characteristics in the cell. Any aspect of metabolism or growth can
be monitored.
Monitoring Expression of an mRNA Transcript
In one aspect of the invention, the engineered phenotype comprises
increasing or decreasing the expression of an mRNA transcript or
generating new transcripts in a cell. mRNA transcript, or message
can be detected and quantified by any method known in the art,
including, e.g., Northern blots, quantitative amplification
reactions, hybridization to arrays, and the like. Quantitative
amplification reactions include, e.g., quantitative PCR, including,
e.g., quantitative reverse transcription polymerase chain reaction,
or RT-PCR; quantitative real time RT-PCR, or "real-time kinetic
RT-PCR" (see, e.g., Kreuzer (2001) Br. J. Haematol. 114:313-318;
Xia (2001) Transplantation 72:907-914).
In one aspect of the invention, the engineered phenotype is
generated by knocking out expression of a homologous gene. The
gene's coding sequence or one or more transcriptional control
elements can be knocked out, e.g., promoters or enhancers. Thus,
the expression of a transcript can be completely ablated or only
decreased.
In one aspect of the invention, the engineered phenotype comprises
increasing the expression of a homologous gene. This can be
effected by knocking out of a negative control element, including a
transcriptional regulatory element acting in cis- or trans-, or,
mutagenizing a positive control element.
As discussed below in detail, one or more, or, all the transcripts
of a cell can be measured by hybridization of a sample comprising
transcripts of the cell, or, nucleic acids representative of or
complementary to transcripts of a cell, by hybridization to
immobilized nucleic acids on an array.
Monitoring Expression of a Polypeptides, Peptides and Amino
Acids
In one aspect of the invention, the engineered phenotype comprises
increasing or decreasing the expression of a polypeptide or
generating new polypeptides in a cell. Polypeptides, peptides and
amino acids can be detected and quantified by any method known in
the art, including, e.g., nuclear magnetic resonance (NMR),
spectrophotometry, radiography (protein radiolabeling),
electrophoresis, capillary electrophoresis, high performance liquid
chromatography (HPLC), thin layer chromatography (TLC),
hyperdiffusion chromatography, various immunological methods, e.g.
immunoprecipitation, immunodiffusion, immuno-electrophoresis,
radioimmunoassays (RIAs), enzyme-linked immunosorbent assays
(ELISAs), immuno-fluorescent assays, gel electrophoresis (e.g.,
SDS-PAGE), staining with antibodies, fluorescent activated cell
sorter (FACS), pyrolysis mass spectrometry, Fourier-Transform
Infrared Spectrometry, Raman spectrometry, GC-MS, and
LC-Electrospray and cap-LC-tandem-electrospray mass spectrometries,
and the like. Novel bioactivities can also be screened using
methods, or variations thereof, described in U.S. Pat. No.
6,057,103. Furthermore, as discussed below in detail, one or more,
or, all the polypeptides of a cell can be measured using a protein
array.
Biosynthetically directed fractional .sup.13C labeling of
proteinogenic amino acids can be monitored by feeding a mixture of
uniformly .sup.13C-labeled and unlabeled carbon source compounds
into a bioreaction network. Analysis of the resulting labeling
pattern enables both a comprehensive characterization of the
network topology and the determination of metabolic flux ratios of
the amino acids; see, e.g., Szyperski (1999) Metab. Eng.
1:189-197.
The following examples are intended to illustrate, but not to
limit, the invention. While the procedures described in the
examples are typical of those that can be used to carry out certain
aspects of the invention, other procedures known to those skilled
in the art can also be used.
EXAMPLES
Example 1: Activity Characterization of Exemplary Phytases of the
Invention
This example describes characterizing the phytase activity of
polypeptides of the invention, which are sequence modifications
(the so-called "evolved" phytases) of the parental phytase SEQ ID
NO:2, and an exemplary phytase activity assay. This phytase
activity assay can be used to determine if a polypeptide has
sufficient activity to be within the scope of the claimed
invention.
After generating the polypeptides of the invention by expressing
the GSSM-modified nucleic acid sequences of the invention, the
"evolved" phytase polypeptides--only single residue mutation
exemplary species in this study--were purified and then heat
treated (pH 7.0, 0.01% Tween) at various temperatures for 30
minutes. After the heat treatment step, the samples (20 uL) were
assayed with the fluorescence substrate (180 uL) 4 mM DiFMUP at pH
5.5. The rates were compared to the rates of each corresponding
non-treated sample. Results are illustrated in FIG. 1.
In another study, the "evolved" phytases of the invention
comprising "blended" single mutations, i.e. phytases containing
multiple mutations, were grown overnight in LBCARB100.TM.
(LBcarb100) at 30.degree. C. 100 uL of the each culture (blended
mutant) was heat treated on a thermocycler from 72.degree. C. to
100.degree. C. 20 uL of the heat treated culture was mixed with 180
uL of 4 mM DiFMUP at pH 5.5. The rates were compared to the rates
of each corresponding non-treated sample; as summarized in FIG. 2.
The table illustrated in FIG. 3 graphically summarizes the data
(rounded to the nearest tenth) used to generate the graph of FIG.
2.
Sample 1 to 21 correspond to the "blended" single mutations of the
parental SEQ ID NO:2, as illustrated in the chart of FIG. 5; note
that "evolved" phytase number 10 has a sequence residue
modification (from SEQ ID NO:2) that was not introduced by GSSM;
this mutation was introduced by random chance and may or may not
have any relevance to thermal stability of this exemplary phytase
of the invention. Also, note the ** marked exemplary phytases 19,
20 and 21 have C-terminal histidine (6.times.His) tags
(--RSHHHHHH). FIG. 5 illustrates exemplary phytases having multiple
residue modifications to the parental SEQ ID NO:2; as described in
detail herein. FIG. 6 illustrates exemplary phytases having single
residue modifications to the parental SEQ ID NO:2; as described in
detail herein.
FIG. 7 schematically illustrates an exemplary phytase assay of the
invention using the fluorescence substrate 4-methylumbelliferyl
phosphate (MeUMB-phosphate, whose structure is also illustrated):
(i) the phytase is heat challenged for 20 minutes, 72.degree. C.,
pH 4.5; and, at 80.degree. C. at physiological pH (pH 7.4); and
(ii) residual activity is tested at 37.degree. C., pH 4.5: Measure
residual activity both high and low pH, Calculate residual activity
relative to wild-type following heat treatment.
FIG. 8 schematically illustrates another exemplary phytase assay of
the invention that also uses the fluorescence substrate
MeUMB-phosphate: (i) the phytase is heat challenged for 30 minutes,
86.degree. C., pH 5.5; and (ii) residual activity is tested at
37.degree. C., pH 4.5: Measure residual activity relative to
6.times. variant control, Select hits and re-assay at higher
stringency to select top variants. This assay was used to screen
libraries of GSSM variants (of SEQ ID NO:1), by assaying for the
phytase activity of the polypeptides they encoded. FIG. 9
schematically illustrates the protocol for this library screen (as
described in FIG. 8), where the library size screened is 24,576
variants.
Example 2: Development of a Phytase with Increased Thermotolerance
and Increased Gastric Lability
This example describes development and characterization of the
phytase activity of polypeptides of the invention, which are
further sequence modifications (the "evolved" phytases) of the
parental phytase SEQ ID NO:2. The evolved phytases described herein
have been optimized for plant expression and for broad-acreage
commercialization. The phytases have better or equal thermal
tolerance relative to the parental phytase (SEQ ID NO:2, encoded by
SEQ ID NO:1) and decreased in vitro gastric stability (increased
gastric lability).
Template Selection:
The selected GSSM backbone has both thermotolerance and evidence of
SGF degradation. The evaluation began with testing the SGF
properties of thirteen thermotolerant phytase molecules (as
described in Example 1, above and Table 3, below). The SGF data on
the purified phytases shows that all thermotolerant variants,
including the single-site thermotolerant parental phytase mutation
N159V (SEQ ID NO:2-N159V), were very stable, showing minimal
degradation over two hours.
Previous work/literature suggest that the E. coli phytase appA gene
(from strain K12, (GenBank accession no. M58708) was more
susceptible to SGF degradation than the parental phytase (SEQ ID
NO:2). In an effort to understand the SGF stability phenomenon,
five of the intermediate variants between appA and the parental
phytase (SEQ ID NO:2) were investigated for SGF lability. The data
suggest a strong correlation between thermotolerance and SGF
lability (FIGS. 11A and 11B). More importantly, appA-7X which is
one amino acid different than the parental phytase (SEQ ID NO:2),
showed .about.10% more loss in activity in SGF after 10 minute
incubation compared to the parental phytase (SEQ ID NO:2). This new
data implies that one single mutation change in SEQ ID NO:2 could
impact changes in SGF tolerance and more importantly, be
differentiated from the parental phytase (SEQ ID NO:2) in the SGF
assay. Based on this new evidence, appA-7X was selected as a
benchmark control for the SGF evolution and SEQ ID NO:2 was
selected as the GSSM backbone for the evolution.
Since protein purification would be an integral part of the
characterization process, SEQ ID NO:2 was evaluated as both a
his-tag (SEQ ID NO:2-HIS) and non-his tag (SEQ ID NO:2) molecule.
SGF assays were performed for both the purified his-tagged and non
his-tag versions of the parental phytase (SEQ ID NO:2). The SGF
assays were performed with two different pepsin doses (0.15 mg/mL
and 0.75 mg/mL). The residual activity was determined at various
time points (7.5, 15, 30, 60, 90, and 120 minutes). There was no
significant difference in SGF profiles between the two versions
(FIG. 12).
TABLE-US-00007 TABLE 3 Phytase variants characterized for potential
GSSM SGF backbone. Parent Variant A47F W68E Q84W A95P C97E K97C
T136H S168E N159V T163R D164R- appA appA 2X Q84W A95P appA appA 3X
Q84W A95P appA appA 4X Q84W A95P appA appA 7X W68E Q84W A95P K97C
SEQ ID SEQ ID NO: 2 W68E Q84W A95P K97C S168E NO: 2 (no mutations)
SEQ ID SEQ ID NO: 2- W68E Q84W A95P K97C S168E N159V NO: 2 N159V
SEQ ID SEQ ID NO: 2- A47F W68E Q84W A95P K97C T136H S168E NO: 2 3X
SEQ ID SEQ ID NO: 2- W68E Q84W A95P K97C T136H S168E N159V NO: 2
5Xa SEQ ID SEQ ID NO: 2- A47F W68E Q84W A95P K97C S168E N159V NO: 2
5Xb SEQ ID SEQ ID NO: 2- A47F W68E Q84W A95P K97C T136H S168E NO: 2
5Xc SEQ ID SEQ ID NO: 2- A47F W68E Q84W A95P K97C T136H S168E N159V
NO: 2 5Xd SEQ ID SEQ ID NO: 2- A47F W68E Q84W A95P K97C T136H S168E
N159V NO: 2 5Xe SEQ ID SEQ ID NO: 2- A47F W68E Q84W A95P K97C T136H
S168E N159V NO: 2 5Xf SEQ ID SEQ ID NO: 2- A47F W68E Q84W A95P K97C
T136H S168E N159V NO: 2 6X SEQ ID SEQ ID NO: 2- A47F W68E Q84W A95P
K97C T136H S168E N159V D164R NO: 2 9X SEQ ID SEQ ID NO: 2- A47F
W68E Q84W A95P C97E T136H S168E N159V T163R NO: 2 10Xa SEQ ID SEQ
ID NO: 2- A47F W68E Q84W A95P K97C T136H S168E N159V T163R D164R
NO: 2 10Xb SEQ ID SEQ ID NO: 2- A47F W68E Q84W A95P C97E K97C T136H
S168E N159V T163R D164R NO: 2 13X Parent Variant E168R G179R R181Y
N226C C226D V233W Q275V Y277D R289A T349Y- appA appA 2X appA appA
3X Y277D appA appA 4X Y277D appA appA 7X R181Y N226C Y277D SEQ ID
SEQ ID NO: 2 R181Y N226C Y277D NO: 2 (no mutations) SEQ ID SEQ ID
NO: 2- R181Y N226C Y277D NO: 2 N159V SEQ ID SEQ ID NO: 2- R181Y
N226C V233W Y277D NO: 2 3X SEQ ID SEQ ID NO: 2- R181Y C226D V233W
Y277D T349Y NO: 2 5Xa SEQ ID SEQ ID NO: 2- R181Y C226D V233W Y277D
T349Y NO: 2 5Xb SEQ ID SEQ ID NO: 2- R181Y C226D V233W Y277D T349Y
NO: 2 5Xc SEQ ID SEQ ID NO: 2- R181Y N226C V233W Y277D T349Y NO: 2
5Xd SEQ ID SEQ ID NO: 2- R181Y C226D Y277D T349Y NO: 2 5Xe SEQ ID
SEQ ID NO: 2- R181Y C226D V233W Y277D NO: 2 5Xf SEQ ID SEQ ID NO:
2- R181Y C226D V233W Y277D T349Y NO: 2 6X SEQ ID SEQ ID NO: 2-
G179R R181Y C226D V233W Q275V Y277D T349Y NO: 2 9X SEQ ID SEQ ID
NO: 2- G179R R181Y C226D V233W Q275V Y277D T349Y NO: 2 10Xa SEQ ID
SEQ ID NO: 2- G179R R181Y C226D V233W Q275V Y277D T349Y NO: 2 10Xb
SEQ ID SEQ ID NO: 2- E168R G179R R181Y C226D V233W Q275V Y277D
R289A T349Y NO: 2 13X
Purified phytase fractions of SEQ ID NO:2 and variants SEQ ID
NO:2-N159V through SEQ ID NO:2-6X were tested for SGF stability at
pepsin doses of 0.75 mg/mL and 0.15 mg/mL; data not shown. Residual
activity at various time points (7.5, 15, 30, 60, 90, and 120
minutes) was determined. At both dosages, no significant difference
in SGF stability between the variant phytases was observed. SEQ ID
NO:2 was the least stable in SGF at both dosages. SGF assays by
SDS-PAGE analysis: All variants listed in Table 3 were tested for
SGF stability by SDS-PAGE (data not shown). SDS-PAGE gels were dyed
with Simply Blue.TM. SafeStain. In the SGF assay, SEQ ID NO:2
denatured over a 60 minute timecourse while SEQ ID NO:2-N159V and
the other variants did not show significant degradation over a two
hour period. N-Glycosylation Removal:
Previous studies suggested that N-glycosylation might improve SGF
stability. Therefore, in order to reduce SFG stability, saturated
directed mutagenesis (SDM) was performed to remove the two
N-glycosylation sites on the parental SEQ ID NO:2 molecule. The
first N-glycosylation recognition site can be removed by either
changing the Asparagine (N) at 161 or Threonine (T) at 163 to any
other amino acid. The second N-glycosylation recognition site can
be eliminated by changing the N at 339 or the T at 341 by the same
process.
SDM was conducted by constructing a primer with the desired codon
change and then utilizing PCR with the primer and the template
(parent sequence) to create a new template with the desired codon
change. During SDM all other 19 possible amino acids were
substituted at each of the four residues responsible for
N-glycosylation recognition: sites 161, 163, 339, and 341. The
mutations showing the most similar characteristics (specific
activity, thermotolerance, and pH profile) to SEQ ID NO:2 at the
four positions were then combined to create a variant that would
not have any N-glycosylation recognition sites. The four top
mutations that preserved the parental phytase's (SEQ ID NO:2)
properties were N161K, T163R, N339E, and T341D. These mutations
were combined in a manner which would remove both N-glycosylation
recognition sites on the same molecule (Table 4).
TABLE-US-00008 TABLE 4 N-glycosylation minus variants Name
Mutations Variant GLY1 N161K and N339E Variant GLY2 N161K and T341D
Variant GLY3 T163R and N339E Variant GLY4 T163R and T341D
The four glycosylation minus variants were constructed, expressed
in Pichia pastoris, and characterized. The thermotolerance (1/2
Life) of glycosylation-minus the variants of SEQ ID NO:2 (Variants
GLY1-GLY4) and two SEQ ID NO:2 controls were determined by heat
treatment at 80.degree. C. over a ten minute time course.
Pichia-expressed SEQ ID NO:2 and N-glycosylation-minus variants
(Variants GLY1-GLY4) have approximately the same thermotolerance.
However, SEQ ID NO:2 (expressed in Pichia pastoris) had greater
thermotolerance than the same gene expressed in E. coli (SEQ ID
NO:2-HIS). The lead glycosylation-minus variant, Variant GLY3, has
the same thermotolerance, pH profile, and specific activity as SEQ
ID NO:2 (FIG. 13). The thermotolerance data was a surprise, a
hypothesis from previous work suggested that glycosylation improved
thermotolerance, therefore it was expected that the
glycosylation-minus variants would have reduced the
thermotolerance. As expected, there was a significant difference in
thermotolerance between the E. coli and Pichia pastoris expressed
SEQ ID NO:2. However, if glycosylation is not the factor, perhaps
of the thermotolerance difference can be attributed to the
different protein folding environments of the two expression host;
Pichia--intracellular protein folding, E. coli--periplasm protein
folding.
The T163R and N339E mutations were incorporated into the top SGF
labile variants later in the project (see TMCA.sup.SM Evolution,
below).
Phytase activity and pH profiles of glycosylation-minus variants
(Variants GLY1-GLY4), as well as for purified Pichia expressed SEQ
ID NO:2 were determined on phytate at pH 2, 2.5, 3, 4, 5, and 6 at
37.degree. C. The data (not shown) indicates that the
glycosylation-minus variants have similar activity and pH profile
to SEQ ID NO:2.
SEQ ID NO:2 SGF GSSM.sup.SM Screen
SEQ ID NO:2-HIS was chosen as the GSSM template. GSSM.sup.SM (Gene
Site Saturation Mutagenesis.sup.SM) evolution was performed (see,
for example, U.S. Pat. No. 6,171,820).
High Throughput Assay Development:
Cultures of SEQ ID NO:2 and SEQ ID NO:2-6X were grown in 384 well
microtiter plates were tested in an automated robotic assay format
for SGF stability. The plates were heat treated at 65 C. for 30
minutes to lyse the cells. The cultures were then split into an
untreated control plate and a SGF-treated plate. The activities of
the SGF-treated samples were compared to the untreated control
samples. Time points were taken at 10, 20, 30, and 40 minutes (FIG.
14). The parental phytase's (whole cell lysate) SGF profile from
the automated assay mirrored the purified bench scale SGF
assay.
High Throughput Assay Results
The entire parental sequence (SEQ ID NO:2, except the start codon),
432 codons, were mutated, expressed (in E. coli, as described
below), and screened for SGF degradation improvements utilizing the
developed Phytase SGF high throughput assay. One hundred and thirty
two novel mutations were confirmed for SGF lability at 69 different
residue locations (Table 5). At least eight single-site mutations
met the SGF requirement of complete protein degradation in 10
minutes. However, most of these mutants fall short of the parental
phytase's thermal tolerance properties by 4.degree. C. or more.
Only one mutant, Q247H, had thermotolerance equal to or slightly
greater than the parental phytase and full degradation in SGF
within 10 minutes.
SGF activity loss of select mutants from the GSSM screen was
determined over a twenty minute time course study (FIG. 15), on
difluoro-4-methylumbelliferyl phosphate (DiFMUP), 50 mM Na-Acetate,
pH 5.5, 0.75 mg/mL pepsin. The characterization of these SGF
mutations showed that the rate for complete degradation fell into
three categories, fast (less than 2 minutes), medium (.about.10-15
minutes), and slow (.gtoreq.20 minutes); slow SGF mutants showed
just a slight improvement over the parental phytase (SEQ ID NO:2).
The data suggest that the activity analysis is a more sensitive
method to determine phytase decay; at 20% residual activity the
phytase band is not detectable on the SDS-Page gel (data not
shown).
The SGF mutants were tested for thermotolerance by two methods; a)
65.degree. C. thirty minute heat treatment and b) thirty minute
50-70.degree. C. gradient. The thermotolerance data suggest that
most of the SGF mutations lost .gtoreq.4.degree. C. with the
exception of variant I427T and variant Q247H. To quickly overcome
the thermotolerance deficiencies, a fast track strategy was
developed; several very promising SGF mutations were incorporated
into more thermotolerant phytase backbones (from Example 1, above)
to test if thermotolerance can be regained (discussed in depth
under title Fast Track Strategy).
All mutations were compared and the top 48 were ranked (Table 6) by
a Fitness Value FT (Thermotolerance %-SGF %=FT). The top
single-site mutations were considered for combination in the
Tailored Multi-Site Combinatorial Assembly (TMCA.sup.SM) phase (see
below).
Based on the data, there were certain amino acid substitutions and
residue positions, when changed in the parental phytase (SEQ ID
NO:2) molecule, which were more favorable for SGF lability
improvements than others (FIG. 16). In FIG. 16, the number below
the amino acid symbol indicates how many times the molecule is
represented in the original protein. For example, residue position
48, a Threonine, could be changed to nine other amino acids
(FYWMHKVIL). The three amino acid additions that most frequently
increased SGF lability were Leucine (14 times), Proline (12 times),
and Histidine (12 times). As a further example, Arginines which
were in the original protein (22 times in SEQ ID NO:2) were never
replaced with another amino acid where an accompanying increase in
SFG lability was observed. However, when Arginine was substituted
for another amino acid in the original protein (7 times), in each
instance, SGF lability was increased. The SGF GSSM data suggested
that hot spots for SGF mutations occurred in the phytase molecule
(FIG. 17). The largest series of mutations, seven in row, occurred
between residues 145-151. There were also three sets where three
residues in a row could be mutated. Several amino acid residues
were promiscuous to amino acid substitutions favoring SGF lability,
the most extreme being T48, which was replaced by nine different
amino acids (F, Y, W, M, H, K, V, I, and L). For position 48 and
79, H was the best mutation and selected as a candidate for the
TMCA library.
TABLE-US-00009 TABLE 5 Variant names and mutations of the hits
discovered from the GSSM screen which have SGF degradation
improvements. Variant Mutation 1 P 100 A 2 P 149 L 3 I 427 T 4 T
291 W 5 T 291 V 6 L 126 R 7 P 254 S 8 L 192 F 9 Q 377 R 10 V 422 M
11 L 157 P 12 I 107 H 13 I 108 R 14 Q 309 P 15 I 108 A 16 I 108 S
17 I 107 P 18 C 155 Y 19 I 108 Q 20 A 236 T 21 S 208 P 22 A 109 V
23 G 171 M 24 S 173 G 25 V 162 L 26 D 139 Y 27 L 146 R 28 Q 137 Y
29 Q 137 L 30 L 146 T 31 K 151 P 32 N 148 K 33 K 151 H 34 Q 137 F
35 L 157 C 36 L 150 Y 37 V 162 T 38 I 174 P 39 G 353 C 40 L 150 T
41 S 102 A 42 I 174 F 43 G 171 S 44 N 148 M 45 Q 137 V 46 P 145 L
47 I 108 Y 48 E 113 P 49 F 147 Y 50 S 173 H 51 T 163 P 52 N 148 R
53 S 173 V 54 A 248 L 55 A 248 T 56 Q 247 H 57 A 236 H 58 L 269 I
59 S 197 G 60 L 235 I 61 S 211 H 62 T 282 H 63 Q 246 W 64 G 257 R
65 L 269 T 66 G 257 A 67 F 194 L 68 H 272 W 69 V 191 A 70 S 218 Y
71 P 217 S 72 P 217 D 73 P 217 G 74 S 102 Y 75 S 218 I 76 A 232 P
77 W 265 L 78 N 266 P 79 L 167 S 80 L 216 T 81 P 217 L 82 L 244 S
83 P 269 L 84 T 48 F 85 T 48 W 86 T 48 M 87 T 48 H 88 T 48 K 89 T
48 Y 90 T 48 V 91 M 51 A 92 M 51 L 93 T 48 I 94 M 51 G 95 T 48 L 96
L 50 W 97 G 67 A 98 Y 79 W 99 Y 79 N 100 P 149 N 101 Y 79 H 102 Q
86 H 103 Q 275 H 104 A 274 I 105 A 274 T 106 Y 79 S 107 H 263 P 108
A 274 V 109 A 274 L 110 A 274 F 111 S 389 V 112 G 395 T 113 G 395 Q
114 G 395 L 115 G 395 I 116 G 395 E 117 S 389 H 118 I 427 G 119 I
427 S 120 A 429 P 121 P 343 E 122 P 343 V 123 P 343 R 124 P 343 L
125 P 343 V 126 N 348 K 127 P 343 I 128 N 348 W 129 P 343 N 130 L
379 V 131 Q 381 S 132 L 379 S
A significant number of the GSSM variants met the SGF requirements
(Fast Degradation<10% after 10 Min SGF survival), but are short
on the thermotolerance properties (<75% survival after
65.degree. C. 30 min heat treatment). The Medium and Slow degrading
mutants met the thermotolerance requirements, but not SGF
requirements. From the GSSM screen, only Variant 56 (Q247H) met
both SGF and Thermotolerance properties.
TABLE-US-00010 TABLE 6 Ranking Top SGF mutants. Fitness Rank
Mutation 65 C HT % SGF % Value 1 Q247H 76 3 0.73 2 I427T 99 37 0.62
3 Q246W 76 23 0.53 4 L157P 46 2 0.44 5 Q377R 47 3 0.44 6 T48M 66 24
0.42 7 A274V 60 17 0.42 8 A236T 47 5 0.42 9 Q275H 77 35 0.41 10
T48W 56 15 0.41 11 I174P 44 4 0.41 12 T48H 50 10 0.40 13 Y79H 67 27
0.40 14 A232P 41 1 0.40 15 T48K 53 13 0.40 16 T48Y 63 24 0.39 17 ?
45 7 0.38 18 P217D 40 3 0.37 19 P217G 43 7 0.37 20 P217S 42 5 0.37
21 T48I 70 34 0.36 22 P343V 41 5 0.36 23 S211H 67 31 0.35 24 T291V
36 2 0.34 25 A274I 51 16 0.34 26 L50W 58 26 0.33 27 P343E 40 7 0.33
28 M51L 60 28 0.33 29 G257A 36 3 0.32 30 H263P 60 29 0.32 31 Y79S
67 36 0.31 32 Y79N 68 38 0.30 33 T48F 50 21 0.29 34 L296T 62 34
0.29 35 S218Y 30 2 0.28 36 P343R 32 6 0.26 37 T48L 48 24 0.24 38
P149L 36 12 0.24 39 L167S 42 18 0.23 40 G67A 59 36 0.23 41 P343N 47
25 0.22 42 P343L 26 6 0.20 43 A236H 19 0 0.19 44 ? 36 20 0.15 45
T291W 18 3 0.14 46 SEQ ID NO: 2 74 64 0.10 47 SEQ ID NO: 2 70 61
0.09 48 S208P 11 2 0.08 49 L192F 22 13 0.08 50 SEQ ID NO: 2 64 57
0.07 51 SEQ ID NO: 2 66 59 0.07 52 SEQ ID NO: 2 63 56 0.07 53 SEQ
ID NO: 2 67 62 0.50 54 Q377R 7 3 0.04 55 Q309P 1 2 -0.01 SEQ ID NO:
2 67 60 0.07 AVERAGE All 132 mutants were compared side by side to
determine the best mutants from the SGF screen. The top 49 SGF
mutants ranked and compared with six separate controls (parental
phytase - SEQ ID NO: 2). Variants were ranked on their
thermotolerance properties (% survival at 65.degree. C. HT %) and
SGF lability (SGF survival - SGF %). An arbitrary Fitness Value
(FV) = (65.degree. C. HT %) - (SGF %) was established and the
variants with the higher FV, highlighted in orange, were considered
for further evolution using the TMCA technology.
Two of the top three mutations (Q246W and Q247H) showed
thermotolerance properties similar to the parental phytase (SEQ ID
NO:2) and significant improvements in SGF lability. Using 3-D
modeling, it was observed that W246 is predicted to be buried
beneath the surface of the protein, necessitating the protein to
adapt to a larger tryptophan side chain in what was a tightly
packed environment around a glutamine side chain. Also, the protein
must adapt to the loss of the hydrogen bond between the epsilon
oxygen of the Q246 side chain with the main chain nitrogen of G255
as there is no side chain oxygen in tryptophan residues. Structural
analysis also indicated that while the main chain of H247 would be
buried, the imidizole side chain would snorkel to the surface.
Although glutamine to histidine is a relatively conservative
change, this creates a new surface accessible group in this region
that is available for protonation at lower pH which would clearly
alter the local hydrogen bonding network, potentially acting as a
acidic switch for disrupting the local protein structure in this
region leaving the protein more susceptible to acid and pepsin
degradation. Fast Track Strategy
To overcome the thermotolerance properties which were lost in the
lead SGF labile variants (except Q247H), a Fast Track Strategy was
initiated to design phytase molecules which have both the desired
properties; SGF and thermotolerance. Thermotolerant phytases (SEQ
ID NO:2-N159V, SEQ ID NO:2-6X and SEQ ID NO:2-9.times.) from the
earlier evolution work (see Example 1, above) were selected as the
backbones for two rounds of Site Directed Mutagenesis (SDM).
The first SDM incorporated each of the single SGF mutations (T291V,
A236T, or L157P) into each of the three thermotolerant backbones as
shown in the table below (Table 7).
TABLE-US-00011 TABLE 7 SDM Round I variants SDM round I Host- His
TOP Additional Variant Parent (backbone) Tag 10 Mutations A SEQ ID
NO: 2-6X x x T291V B SEQ ID NO: 2-6X x x A236T C SEQ ID NO: 2-6X x
x L157P D SEQ ID NO: 2-N159V x x L157P E SEQ ID NO: 2-N159V x x
A236T F SEQ ID NO: 2-N159V x x T291V G SEQ ID NO: 2-9X x x L157P H
SEQ ID NO: 2-9X x x A236T I SEQ ID NO: 2-9X x x T291V
The data from this first round of SDM suggested that improvements
in SGF lability was made to the variants made from backbone SEQ ID
NO:2-N159V. However, those SGF mutations also decreased the
thermotolerance properties below the objective. The variants of the
other two thermotolerant backbones (SEQ ID NO:2-6X and SEQ ID
NO:2-9X) showed only minimal improvements in SGF degradation. It
was also observed that adding more SGF mutations to the SEQ ID
NO:2-N159V backbone reduced the thermotolerance below the
thermotolerance objective.
A second round of SDM adding more SGF mutations to the other two
thermotolerant variants was performed by incorporating up to two
SGF mutations (T291V and/or L192F) into SEQ ID NO:2-6X and SEQ ID
NO:2-9X, both with or without the A236T mutation (see Table 8
below).
TABLE-US-00012 TABLE 8 SDM Round II variants SDM round II Host- His
TOP Additional Variant Parent (backbone) Tag 10 Mutations J SEQ ID
NO: 2-6X x x L192F K SEQ ID NO: 2-6X x x T291V L SEQ ID NO: 2-6X x
x T291V + L192F M SEQ ID NO: 2-9X x x L192F N SEQ ID NO: 2-9X x x
T291V O SEQ ID NO: 2-9X x x T291V + L192F P SEQ ID NO: 2-6X +
(A236T) x x L192F Q SEQ ID NO: 2-6X + (A236T) x x T291V R SEQ ID
NO: 2-6X + (A236T) x x T291V + L192F S SEQ ID NO: 2-9X + (A236T) x
x L192F T SEQ ID NO: 2-9X + (A236T) x x T291V U SEQ ID NO: 2-9X +
(A236T) x x T291V + L192F
The result from this SDM produced a variant, Variant O, with
slightly better thermal tolerance than the parental phytase (SEQ ID
NO:2) and full degradation in less than 10 min in SGF. For example,
at T-0 and T-10 (min) time points using different SGF pepsin
dosages (0.3, 0.2, 0.1, 0.05, 0.025 and 0 mg/mL pepsin), SDS-PAGE
gels dyed with Simply Blue.TM. SafeStain, showed that Variant O was
fully degraded within 10 minutes at 0.3 mg/mL and 0.2 mg/mL pepsin.
A twenty minute SGF time course (at 0.3 mg/mL pepsin), again run on
SDS-PAGE gels, showed that SEQ ID NO:2-HIS is not degraded after 20
minutes, while Variant O is fully degraded around 7.5 minutes.
SGF stability of Variant O and SEQ ID NO:2-HIS was determined at
different pepsin dosages: 0.3, 0.2, 0.1, 0.05, 0.025, and 0.0 mg/mL
Pepsin (FIG. 18). In FIG. 18, the 0.3 mg/mL pepsin dose for SEQ ID
NO:2-HIS is graphed as a benchmark. The dosage response experiments
indicated that pepsin is required for complete degradation and that
it is not just a function of the acidic treatment (FIG. 18).
The 1/2 Life of Variant O and SEQ ID NO:2-HIS was determined at
75.degree. C. (FIG. 19). Purified parental phytase (SEQ ID
NO:2-HIS) and phytase variant Variant O, in two different buffers
(100 mM Citrate pH 5.5 and 100 mM Tris pH 7.2), were heat treated
at 75 C..degree. up to 45 minutes (T-0, 5, 10, 15, 20, 30, 45 min).
Ten microliters of the heat treated samples were assayed for
activity in 100 .mu.l, 100 .mu.M DiFMUP, 50 mM Citrate pH 5.5.
Activity was compared to T-0 activity. Variant O met the SGF and
thermotolerance requirements, however, specific activity was lower
than desired (FIG. 19). Loss of specific activity was expected
because of previous knowledge from the earlier evolution work
(Example 1) indicating that the SEQ ID NO:2-6X backbone only had
2/3 of the specific activity of the parental phytase (SEQ ID
NO:2).
To maximize the TMCA strategy, and overcome Variant O deficiencies,
the approach was to blend thermotolerant mutations that maintained
specific activity with SGF mutations using the parental phytase
(SEQ ID NO:2-HIS) as the template.
TMCA.sup.SM Evolution
The high throughput assay was modified to include a heat treatment
step in order to select for variants that desired thermotolerant as
well as the SGF properties. Two libraries were created utilizing
the Tailored Multi-Site Combinatorial Assembly (TMCA) technology
(see PCT Publication No. WO 09/018,449). TMCA evolution comprises a
method for producing a plurality of progeny polynucleotides having
different combinations of various mutations at multiple sites. The
method can be performed, in part, by a combination of at least one
or more of the following steps:
Obtaining Sequence Information of a ("First" or "Template")
Polynucleotide.
For example, the first or template sequence can be a wild type
(e.g. SEQ ID NO:2-N159V) or mutated (e.g. the "D164R template",
described below) sequence. The sequence information can be of the
complete polynucleotide (e.g., a gene or an open reading frame) or
of partial regions of interest, such as a sequence encoding a site
for binding, binding-specificity, catalysis, or
substrate-specificity.
Identifying Three or More Mutations of Interest Along the First or
Template Polynucleotide Sequence.
For example, mutations can be at 3, 4, 5, 6, 8, 10, 12, 20 or more
positions within the first or template sequence. The positions can
be predetermined by absolute position or by the context of
surrounding residues or homology. For TMCA of phytase polypeptides,
the top SGF and thermotolerant amino acid changes that resulted in
improved enzyme performance were included as mutations of interest.
The sequences flanking the mutation positions on either side can be
known. Each mutation position may contain two or more mutations,
such as for different amino acids. Such mutations can be identified
by using Gene Site Saturation Mutagenesis.sup.SM (GSSM.sup.SM)
technology, as described herein and in U.S. Pat. Nos. 6,171,820;
6,562,594; and 6,764,835.
Providing Primers (e.g., Synthetic Oligonucleotides) Comprising the
Mutations of Interest.
In one embodiment, a primer is provided for each mutation of
interest. Thus, a first or template polynucleotide having 3
mutations of interest can use 3 primers at that position. The
primer also can be provided as a pool of primers containing a
degenerate position so that the mutation of interest is the range
of any nucleotide or naturally occurring amino acid, or a subset of
that range. For example, a pool of primers can be provided that
favor mutations for aliphatic amino acid residues.
The primers can be prepared as forward or reverse primers, or the
primers can be prepared as at least one forward primer and at least
one reverse primer. When mutations are positioned closely together,
it can be convenient to use primers that contain mutations for more
than one position or different combinations of mutations at
multiple positions.
Providing a Polynucleotide Containing the Template Sequence.
The first or template polynucleotide can be circular, or can be
supercoiled, such as a plasmid or vector for cloning, sequencing or
expression. The polynucleotide may be single-stranded ("ssDNA"), or
can be double-stranded ("dsDNA"). For example, the TCMA method
subjects the supercoiled ("sc") dsDNA template to a heating step at
95.degree. C. for 1 min (see Levy, Nucleic Acid Res.,
28(12):e57(1-vii) (2000)).
Adding the Primers to the Template Polynucleotide in a Reaction
Mixture.
The primers and the template polynucleotide are combined under
conditions that allow the primers to anneal to the template
polynucleotide. In one embodiment of the TMCA protocol, the primers
are added to the polynucleotide in a single reaction mixture, but
can be added in multiple reactions.
Performing a Polymerase Extension Reactions.
The extension products (e.g., as a "progeny" or "modified extended
polynucleotide") may be amplified by conventional means. The
products may be analyzed for length, sequence, desired nucleic acid
properties, or expressed as polypeptides. Other analysis methods
include in-situ hybridization, sequence screening or expression
screening. The analysis can include one or more rounds of screening
and selecting for a desired property.
The products can also be transformed into a cell or other
expression system, such as a cell-free system. The cell-free system
may contain enzymes related to DNA replication, repair,
recombination, transcription, or for translation. Exemplary hosts
include bacterial, yeast, plant and animal cells and cell lines,
and include E. coli, Pseudomonas fluorescens, Pichia pastoris and
Aspergillus niger. For example, XL1-Blue or Stb12 strains of E.
coli can be used as hosts.
The method of the invention may be used with the same or different
primers under different reaction conditions to promote products
having different combinations or numbers of mutations.
By performing the exemplary method described above, this protocol
also provides one or more polynucleotides produced by this TMCA
evolution method, which then can be screened or selected for a
desired property. One or more of the progeny polynucleotides can be
expressed as polypeptides, and optionally screened or selected for
a desired property. Thus, this embodiment of the TMCA evolution
protocol provides polynucleotides and the encoded polypeptides, as
well as libraries of such polynucleotides encoding such
polypeptides. This embodiment of the TMCA evolution protocol
further provides for screening the libraries by screening or
selecting the library to obtain one or more polynucleotides
encoding one or more polypeptides having the desired activity.
Another embodiment of the TMCA evolution protocol described in PCT
Publication No. WO 2009/018449 comprises a method of producing a
plurality of modified polynucleotides. Such methods generally
include (a) adding at least three primers to a double stranded
template polynucleotide in a single reaction mixture, wherein the
at least three primers are not overlapping, and wherein each of the
at least three primers comprise at least one mutation different
from the other primers, wherein at least one primer is a forward
primer that can anneal to a minus strand of the template and at
least one primer is a reverse primer that can anneal to a plus
strand of the template, and (b) subjecting the reaction mixture to
a polymerase extension reaction to yield a plurality of extended
modified polynucleotides from the at least three primers.
Another embodiment of the TMCA evolution protocol described in PCT
Publication No. WO 2009/018449 comprises a method wherein a cell is
transformed with the plurality of extended products that have not
been treated with a ligase. In another embodiment of the invention,
the plurality of extended modified polynucleotides is recovered
from the cell. In another embodiment, the recovered plurality of
extended modified polynucleotides is analyzed, for example, by
expressing at least one of the plurality of extended modified
polynucleotides and analyzing the polypeptide expressed therefrom.
In another embodiment, the plurality of extended modified
polynucleotides comprising the mutations of interest is
selected.
In another embodiment of the TMCA evolution protocol, sequence
information regarding the template polynucleotide is obtained, and
three or more mutations of interest along the template
polynucleotide can be identified. In another embodiment, products
obtained by the polymerase extension can be analyzed before
transforming the plurality of extended modified products into a
cell.
In one embodiment of the TMCA evolution protocol, products obtained
by the polymerase extension are treated with an enzyme, e.g., a
restriction enzyme, such as a DpnI restriction enzyme, thereby
destroying the template polynucleotide sequence. The treated
products can be transformed into a cell, e.g., an E. coli cell.
In one embodiment of the TMCA evolution protocol, at least two, or
at least three, or at least four, or at least five, or at least
six, or at least seven, or at least eight, or at least nine, or at
least ten, or at least eleven, or at least twelve, or more primers
can be used. In one embodiment, each primer comprises a single
point mutation. In another embodiment, two forward or two reverse
primers comprise a different change in the same position on the
template polynucleotide. In another embodiment, at least one primer
comprises at least two changes in different positions on the
template polynucleotide. In yet another embodiment, at least one
primer comprises at least two changes in different positions and at
least two forward or two reverse primers comprise a different
change in the same position on the template polynucleotide.
In one embodiment of the TMCA evolution protocol, the forward
primers are grouped into a forward group and the reverse primers
are grouped into a reverse group, and the primers in the forward
group and the primers in the reverse group, independent of one
another, are normalized to be equal concentration in the
corresponding group regardless of positions on the template
polynucleotide, and wherein after the normalization an equal amount
of the forward and reverse primers is added to the reaction. In
this normalization method, a combination of some positions may be
biased. The bias can be due to, for example, a relatively low
primer concentration at one position containing a single primer
compared to a position containing multiple primers. "Positional
bias" refers to resulting polynucleotides which show a strong
preference for the incorporation of primers at a single position
relative to the other positions within its forward or reverse
primer group. This results in a combination of modified
polynucleotides which may have a high percentage of mutations
within a single primer position but a low percentage of mutations
at another position within its forward or reverse primer group.
This bias is unfavorable when the goal of the TMCA is to generate
progeny polynucleotides comprising all possible combinations of
changes to the template. The bias can be corrected, for example, by
normalizing the primers as a pool at each position to be equal.
In one embodiment of the TMCA evolution protocol, the primer
normalization is performed by organizing the primers into multiple
groups depending on their location on the template polynucleotide,
wherein the primers covering the same selected region on the
template are in one group; normalizing the grouped primers within
each group to be equal concentration; pooling the forward primers
within one group into a forward group and normalizing concentration
between each group of the forward primers to be equal; pooling the
reverse primers within one group into a reverse group and
normalizing concentration between each group of the reverse primers
to be equal; and adding an equal amount of the pooled forward and
reversed primers into the reaction. No bias has been observed for
position combinations.
In one embodiment of the TMCA evolution protocol, a set of
degenerate primers each comprising a degenerate position is
provided, wherein the mutation of interest is a range of different
nucleotides at the degenerate position. In another embodiment, a
set of degenerate primers is provided comprising at least one
degenerate codon corresponding to at least one codon of the
template polynucleotide and at least one adjacent sequence that is
homologous to a sequence adjacent to the codon of the template
polynucleotide sequence. In another embodiment, the degenerated
codon is N,N,N and encodes any of 20 naturally occurring amino
acids. In another embodiment, the degenerated codon encodes less
than 20 naturally occurring amino acids.
Another embodiment of the TMCA evolution protocol described in PCT
Publication No. WO 2009/018449 comprises a method of producing a
plurality of modified polynucleotides comprising the mutations of
interest. Such methods generally include (a) adding at least two
primers to a double stranded template polynucleotide in a single
reaction mixture, wherein the at least two primers are not
overlapping, and wherein each of the at least two primers comprise
at least one mutation different from the other primer(s), wherein
at least one primer is a forward primer that can anneal to a minus
strand of the template and at least one primer is a reverse primer
that can anneal to a plus strand of the template, (b) subjecting
the reaction mixture to a polymerase extension reaction to yield a
plurality of extended modified polynucleotides from the at least
two primers, (c) treating the plurality of extended modified
polynucleotides with an enzyme, thereby destroying the template
polynucleotide, (d) transforming the treated extended modified
polynucleotides that have not been treated with a ligase into a
cell, (e) recovering the plurality of extended modified
polynucleotides from the cell, and (f) selecting the plurality of
extended modified polynucleotides comprising the mutations of
interest.
Using the TMCA technology, a small library, Library A, was created
for quick turn around and to simplify the process (96 different
variants containing up to five SGF mutations and two
thermotolerance mutations, see Table 9). Library A used a single
template, SEQ ID NO:2-N159V and the oligoes listed in Table 10,
below. A second more extensive library, Library B, was also created
using TMCA technology in order to increase the potential of
creating a very thermotolerant variant with the required SGF
properties (4096 different variants containing up to seven SGF
mutations and five thermotolerance mutations, see Table 9). Library
B used two templates, SEQ ID NO:2-N159V and "D164R template", in
two separate TMCA reactions each using the oligoes listed in Table
11, creating two sub-libraries. The "D164R template" was generated
in Library A and consisted of the SEQ ID NO:2-N159V backbone with
the D164R mutation incorporated. Both libraries were amplified into
the pQE60 vector (Qiagen, Valencia, Calif.) and then transformed
into host PHY635 (described below) to confirm primary and secondary
phytase activity.
A total of eight promising thermotolerant SGF labile hits were
discovered by screening the libraries. Five thermotolerant
(Tm.about.5.degree. C. greater than the parental phytase, SEQ ID
NO:2, Table 13) SGF labile variants were discovered in the small
library (Variants AA-EE, Table 12). The larger TMCA library
produced ten candidates, however, only three had greater
thermotolerance than Variants AA-EE (Variants FF-HH, Table 13, had
Tm 7.5.degree. C. greater than the parental phytase, SEQ ID NO:2).
For characterization screening, these variants, along with the best
single-site SGF mutation (Variant 56), all as glycosylated and
glycosylation minus versions, were expressed in Pichia pastoris,
(glycosylation minus versions included the two mutations, T163R and
N339E, from the N-glycosylation removal research, see above).
Residual activity of SGF labile phytase variants during SGF
treatment was determined (FIG. 20). Purified parental phytase (SEQ
ID NO:2), Variant 56 and Variant AA-HH were treated with SGF (pH
1.2) with pepsin (10 U/.mu.g phytase) over a 10.0 minute time
course. Phytase stability was determined by activity on DiFMUP. The
specific activity of SGF labile phytase variants compared to SEQ ID
NO:2 phytase (FIG. 21). Purified parental phytase (SEQ ID NO:2) and
lead phytase variants were tested for activity on phytate. Purified
protein was assayed in 4 mM phytate, 100 mM Na-Acetate pH 4.5 at
37.degree. C. There was not any significant change in SGF and
thermotolerance properties between the glycosylated and
non-glycosylated Pichia expressed lead variants (FIGS. 20 and 21).
Previous work predicted that the glycosylated variants would have a
higher thermotolerance and be more tolerant to SGF; our data
suggested otherwise.
Also, a pH profile of glycosylated, glycosylation-minus variants,
and the parental phytase (SEQ ID NO:2) was generated for phytase
activity on phytate at pH 2, 2.5, 3, 4, 5, and 6 at 37.degree. C.
All phytases assayed had very similar pH profiles (data not
shown).
TABLE-US-00013 TABLE 9 Mutations selected for TMCA evolution.
Library A Library B Thermotolerant Thermotolerant SGF Mutations
Mutations SGF Mutations Mutations Q247H Q275V Q247H G179R I427T
D164R I427T Q275V L157P L157P T349Y Q275H Q275H C226D T48M T48M
D164R Q246W Q377R Y79H Thermotolerance mutations and SGF mutations
were blended utilizing TMCA technology, using SEQ ID NO: 2-N159V as
the backbone.
TABLE-US-00014 TABE 10 Oligoes used in Library A Oligo name Oligo
sequence - 5'-3' T48M_F TGCGTGCTCCAACCAAGGCCATGCAACTGATGCAGGATGTCA
SEQ ID NO: 3 C L157P_F TAAAAACTGGCGTTTGCCAACCGGATGTGGCGAACGTGACTG
SEQ ID NO: 4 ACGCGATCCTCGAGAGGGCAGGA D164R_F
TAAAAACTGGCGTTTGCCAACTGGATGTGGCGAACGTGACTC SEQ ID NO: 5
GTGCGATCCTCGAGAGGGCAGGA L157P-
TAAAAACTGGCGTTTGCCAACCGGATGTGGCGAACGTGACTC SEQ ID NO: 6 D164_R
GTGCGATCCTCGAGAGGGCAGGA Q247H_R
GAGATATTTCTCCTGCAACATGCACAGGGAATGCCGGAGCC SEQ ID NO: 7 Q275H_R
TGCTAAGTTTGCATAACGCGCATTTTGATTTGCTACAACGCAC SEQ ID NO: 8 Q275V_R
TGCTAAGTTTGCATAACGCGGTGTTTGATTTGCTACAACGCAC SEQ ID NO: 9 I427T_R
AATCGTGAATGAAGCACGCACACCGGCGTGCAGTTTGAGAT SEQ ID NO: 10
TABLE-US-00015 TABLE 11 Oligoes used in Library B Oligo name Oligo
sequence - 5'-3' T48M_F TGCGTGCTCCAACCAAGGCCATGCAACTGATGCAGGA SEQ
ID NO: 11 TGTCAC Y79H_F GCGGTGGTGAGCTAATCGCCCATCTCGGACATTACTG SEQ
ID NO: 12 GCGTCA L157P_F TAAAAACTGGCGTTTGCCAACCGGATGTGGCGAACGT SEQ
ID NO: 13 GACTGA G179R_F GGTCAATTGCTGACTTTACCCGCCATTATCAAACGGCG SEQ
ID NO: 14 TTTCG C226D_F AACTCAAGGTGAGCGCCGACGATGTCTCATTAACCGG SEQ
ID NO: 15 TGCGGT Q246W_R TGACGGAGATATTTCTCCTGTGGCAAGCACAGGGAAT SEQ
ID NO: 16 GCCGGA Q246W + Q247H_R
TGACGGAGATATTTCTCCTGTGGCATGCACAGGGAAT SEQ ID NO: 17 GCCGGAGCC
Q247H_R CGGAGATATTTCTCCTGCAACATGCACAGGGAATGCC SEQ ID NO: 18 GGAGCC
Q275V_R TGCTAAGTTTGCATAACGCGGTGTTTGATTTGCTACAA SEQ ID NO: 19 CGCAC
T349Y_R TTCCCGGTCAGCCGGATAACTATCCGCCAGGTGGTGA SEQ ID NO: 20 ACTGGT
Q377R_R TTCAGGTTTCGCTGGTCTTCCGCACTTTACAGCAGATG SEQ ID NO: 21 CGTGA
I427T_R AATCGTGAATGAAGCACGCACACCGGCGTGCAGTTTG SEQ ID NO: 22
AGAT
TABLE-US-00016 TABLE 12 Sequence of Lead SGF Labile Thermotolerant
Phytase variants Type of mutation SGF SGF SGF Thermo Glycos Thermo
Thermo Thermo SGF Variant T48M Y79H L157P N159V T163R D164R G179R
C226D Q246W AA X X X BB X X X CC X X X X DD X X X X EE X X X FF X X
X X X GG X X X X X X X HH X X X X X X X 56 X Type of mutation SGF
Thermo SGF Glycos Thermo SGF SGF Variant Q247H Q275V Q275H N339E
T349Y Q377R I427T AA X X X BB X X X CC X X X X DD X X EE X X X FF X
X X X GG X X X HH X X X 56 X X
Variant AA is SEQ ID NO:28 (encoded by SEQ ID NO:27), Variant BB is
SEQ ID NO:32 (encoded by SEQ ID NO:31), Variant CC is SEQ ID NO:34
(encoded by SEQ ID NO:33), Variant DD is SEQ ID NO:36 (encoded by
SEQ ID NO:35), Variant EE is SEQ ID NO:38 (encoded by SEQ ID
NO:37), Variant FF is SEQ ID NO:24 (encoded by SEQ ID NO:23),
Variant GG is SEQ ID NO:26 (encoded by SEQ ID NO:25), Variant HH is
SEQ ID NO:40 (encoded by SEQ ID NO:39), and Variant 56 is SEQ ID
NO:30 (encoded by SEQ ID NO:29). Note, however, that SEQ ID NOs:23,
25, 27, 29, 31, 33, 35, 37, and 39, do not include the nucleic
acids encoding the native signal sequence and that SEQ ID NOs:24,
26, 28, 30, 32, 34, 36, 38, and 40, do include the native signal
sequence amino acids (amino acids 1-22 of SEQ ID NO:2). A start
Methionine (ATG) is added in each of the referenced sequences. The
positions of the point mutations for these variants (listed e.g. in
Table 12) are counted as if the native signal sequence is
present.
TABLE-US-00017 TABLE 13 Melting Temperature (Tm) of SEQ ID NO: 2
and Lead SGF Candidates. Glycosylation Glycosylated Minus DSC Tm
Library (Tm in Celsius) (Tm in Celsius) SEQ ID NO: 2 79.8 N/A
Variant AA (SEQ ID NO: 28) A 85.2 85.8 Variant BB (SEQ ID NO: 32) A
84.2 85.8 Variant CC (SEQ ID NO: 34) A 85.6 85.2 Variant DD (SEQ ID
NO: 36) A 83.8 84.2 Variant EE (SEQ ID NO: 38) A 85.4 84.6 Variant
FF (SEQ ID NO: 24) B 87.5 87.6 Variant GG (SEQ ID NO: 26) B 87.3
87.0 Variant HH (SEQ ID NO: 40) B 87.4 86.2 Variant 56 (SEQ ID NO:
30) 81.0 81.3 Purified parental phytase (SEQ ID NO: 2) and the nine
lead SGF phytase candidates were expressed in Pichia pastoris,
purified, dialyzed in 100 mM Citrate pH 5.5, and tested for Tm
utilizing the Applied Thermodynamics N-DSCII.
Selection of Top Four Variants for Animal Studies SGF SDS-PAGE
analysis at nine time points (0, 0.5, 1.0, 1.5, 2.0, 3.0, 4.0, 5.0,
and 10 minutes), with pepsin dosage of 10 U per .mu.g phytase, four
variants were selected based on this characterization data (not
shown) for large scale fermentation to be used in animal trials.
The four selected leads showed complete protein degradation within
five minutes.
Selected Leads: Variant 56 (SEQ ID NO:30, encoded by SEQ ID NO:29)
is the closest variant to the original parental phytase (SEQ ID
NO:2) molecule, having one SGF mutation and two glycosylation-minus
mutations. Variant AA (SEQ ID NO:28, encoded by SEQ ID NO:27) has
two SGF mutations, two thermotolerant mutations and two
glycosylation-minus mutations. Variant FF (SEQ ID NO:24, encoded by
SEQ ID NO:23) has three SGF mutations, four thermotolerant
mutations and two glycosylation-minus mutations. Variant GG (SEQ ID
NO:26, encoded by SEQ ID NO:25) has three SGF mutations, five
thermotolerant mutations, two glycosylation-minus mutations.
Fermentation of Lead Candidates:
The leads (Variant 56, Variant AA, Variant FF, and Variant GG) were
selected for animal trials and scaled up for 30 L fermentations to
produce at least 5 g of each protein. Based on activity and
Bradford Protein analysis.gtoreq.than 16 g of protein for each
variant was produced. Recovered samples were lyophilized, then
resuspended and heat treated to kill potential microbial growth and
then re-lyophilized. These samples (Table 14) were used for animal
trials. Along with the four selected variants, a small sample
(15-50 mg) of the other SGF labile variants (Table 12) were used
for bench scale evaluation.
TABLE-US-00018 TABLE 14 Specifications of samples used for animal
trials and for bench scale evaluation. Variant Solid (g) Protein
(g) Units Activity 56 (SEQ ID NO: 30) 106.2 8.34 1.37 .times.
10.sup.7 AA (SEQ ID NO: 28) 98.9 10.9 1.72 .times. 10.sup.7 FF (SEQ
ID NO: 24) 132.0 14.2 2.16 .times. 10.sup.7 GG (SEQ ID NO: 26)
109.6 17.4 3.09 .times. 10.sup.7 Variant Protein (mg) BB (SEQ ID
NO: 32) 30 DD (SEQ ID NO: 36) 50 CC (SEQ ID NO: 34) 20 EE (SEQ ID
NO: 38) 40 HH (SEQ ID NO: 40) 15 SEQ ID NO: 2 30 The lyophilized
product was quantified by both activity and Bradford Protein
Assay.
Methods Growth, Induction, and Purification E. coli Phytase
Expression (2 L Scale)
All phytase variants, except of those in the glycosylation studies,
were expressed in E. coli; strain PHY635 (phy-strain; created by
making E. coli strain CU1867 (ATCC 47092; appA deficient) Rec A-
through P1 phage transduction). Starting cultures of the phytase
variants were grown in 5 mL LBcarb100 at 37 C for .about.18 hrs. 2
L of LBcarb100 were inoculated with the overnight starting
cultures, culture was induced with 1 mM IPTG when the culture
reached .about.OD.sub.600 0.5. After 24 hrs of induction, the
cultures were harvested by pelleting the culture by centrifugation
(Sorvall RC 5C Plus Centrifuge; SLC-4000 rotor, 7000 RPM; 9220 RCF)
for 20 minutes. The cells were resuspended in 50 mM Tris pH 8.0 and
lysed utilizing the microfluidizer (Microfluidics Model 11OL). To
remove cellular debris the whole cell lysate was centrifuged
(Sorvall RC 5C Plus; F13S-14X50 Rotor, 12500 RPM; 25642 RCF) for 30
minutes. The clear lysate was sterile filtered and the phytase
protein was purified across a HiisTrap FF 5 mL column on an AKTA
FPLC. Phytase was eluted off with a 2 M Immidizole, 50 mM Tris pH
8.0 gradient. Fractions were tested for activity on 100 uM DiFMUP,
100 mM Na-Acetate (pH 5.5) and SDS-gel analysis for protein
purity.
Pichia Pastoris Phytase Expression (1 L Scale)
The characterization of the final lead phytase variants
(glycosylation-plus and glycosylation-minus versions of Variants
AA-HH and Variant 56), along with the glycosylation-minus versions
of SEQ ID NO:2 (Variants GLY1-GLY4) were expressed in Pichia
pastoris (X-33). Starting cultures of the phytase variants were
grown in 10 mL BMGYzeo100 at 30.degree. C. for .about.18 hrs
(.about.OD.sub.60015-20), cells were pelleted and resuspended in 10
mL MES* medium with 0.5% MeOH. 1 L of MES* medium with 0.5% MeOH
was inoculated with the starting culture and incubated for
three-four days at 30.degree. C. (5 mL MeOH added every 24 hrs for
protein induction). The secreted protein separated from the cell
mass by centrifugation (Sorvall RC 5C Plus Centrifuge; SLC-4000
rotor, 7000 RPM; 9220 RCF), concentrated and buffer exchanged (100
mM Na Acetate pH 5.5) using the MiniKros Tangential Flow Separation
Module (SpectrumLabs M215-600-01P). To improve purity the sample
was passed across a HiTrap.TM. Q FF 5 mL column on an AKTA FPLC.
Phytase was eluted off with a 1 M NaCl, 100 mM Na-Acetate pH 5.5
gradient. Fractions were tested for activity on 100 uM DiFMUP, 100
mM Na-Acetate (pH 5.5) and SDS-gel analysis for protein purity.
Phytase Characterization
Protein Thermotolerance
Differential Scanning Calorimetry (DSC)--
Protein melting temperature (Tm) of the Pichia expressed phytase
variants were determined by utilizing the Applied Thermodynamics
N-DSC II. Protein samples (.about.1.0 mg/mL) were dialyzed in 100
mM Citrate pH 5.5, loaded into the test chamber (600 uL) and
compared to the control sample (600 ul of 100 mM Citrate pH 5.5)
and scanned from 60 to 100.degree. C. and back to 60.degree. C. (to
assess protein refolding).
Modified Tm Determination--
Quick thermotolerance tool developed to evaluate whole cell lysate
and non purified protein samples during the preliminary
characterization to compare thermotolerance of SGF labile phytases
to the parental phytase (SEQ ID NO:2). The protein sample was
arrayed across a row on a 96 well PCR plate (20 uL per well) and
heat treated across a gradient (60-80.degree. C.) on the PCR
machine for 30 minutes. Heat treated protein samples (10 uL) were
mixed with fluorescence substrate (190 uL of 100 uM DiFMUP, 50 mM
Na-Acetate pH 5.5) measuring florescence change (EX360 nm/EM465 nm)
over a five minute time course. The temperature at which 50%
activity remained was compared to the parental phytase (SEQ ID
NO:2) performance (50% activity temperature).
SGF Assay (Modified-Scaled Down)
Multiple mini reactions, quenched at different time points were
established to determine SGF lability of phytase molecule. As a
control T-0 reference, a pre-quenched SGF reaction was also run
similar to the actual experiment. Ten uL of the protein sample was
incubated in 50 uL of pH 1.2 SGF (2 mg/mL NaCl, 7 uL/mL
concentrated HCl) with pepsin (dosed at 0.15, 0.30, and 0.75 mg/mL)
over a time course at 37.degree. C. The reaction was quenched by
adding 10 uL of pH 10.0, 200 mM Na-Carbonate buffer (this step was
performed prior to adding protein sample for the T-0
reference).
SGF SDS Gel Analysis--
Removed 20 uL of the quenched SGF reaction and mixed with 210 uL
SDS sample buffer, boiled for 10 minutes, and loaded 15 uL onto a
Tris-Gly SDS Page gel. Applied 180V, 250 mA, through SDS sample
running buffer for .about.1 hour, or until complete.
SGF Activity Analysis--
Removed 10 uL of the quenched SGF reaction and mixed with substrate
(190 uL of 100 uM DiFMUP, 50 mM Na-Acetate pH 5.5) measuring
florescence change (EX360 nm/EM465 nm) over a five minute time
course.
SGF Assay (Adapted from the United States Pharmacopeia 24, 2000.
Simulated Gastric Fluid, TS, In The National Formulary 19; Board of
Trustees, Eds.; United States Pharmacopeial Convention, Inc.,
Rockville, Md., p. 2235)
Incubate 50 uL of 5 mg/mL phytase in pre-heated 37.degree. C. 950
uL SGF (2 mg/mL NaCl, titrated to pH 1.2 with HCl) with 10 U
pepsin/ug test protein (760 ug/mL SGF) over a 10 minute time course
at 37.degree. C. Time points were taken by removing 50 uL of
reaction and mixing with 50 uL termination solution (200 mM
Na-Carbonate, pH 10.0). Time points (terminated samples) were kept
on ice until assay was complete and ready for analysis (in
compliance with SGF SDS Gel Analysis and SGF Activity Analysis
outlined under SGF Assay (Modified-Scaled Down)).
Phytase Specific Activity Analysis
Phytase samples (50 uL) were assayed for relative activity in pre
heated 37.degree. C., 950 uL, 4.0 mM Phytate, 100 mM acetic acid,
titrated to pH 4.5 with NaOH. Reaction was quenched by removing 50
uL reaction and mixing with the 50 uL color/stop solution (20 mM
Ammonium molybdate/5 mM Ammonium vanadate/10% Nitric acid
solution). After 10 minute color development time points were
measure at 415 nm and results were plotted against time. The
reaction rate was compared to the phosphate standard to determine
relative rate.
The specific activity was determined by calculating relative rated
based on protein concentration. Protein concentration was
determined by 260 nm/280 nm analysis (1A OD.sub.280 correlates to
0.93 mg/mL). A secondary comparison was performed by loading equal
phytase activities on SDS gel and quantifying protein band
intensities using GelPro gel densiotometry analysis to compare
activity relationship of phytase leads and the parental phytase
(SEQ ID NO:2).
Phytase pH Profile Analysis
Same as the above specific activity protocol, except substrate was
modified with a broader buffer capacity (pH 2-6). Substrate: 4 mM
Phytate, 80 mM Malic acid, 80 mM Formic acid, and 80 mM Na-Acetate
titrated to different pH (2, 2.5, 3, 4, 5, and 6 pH Units).
Relative rated for each variant were compared to the activity
optimum which was pH 4.
Materials:
SGF Assay
Pepsin from porcine stomach mucosa (Sigma P-6887)
HCl (Fisher UN1789)
Sodium Chloride (Fisher S-271-1)
6,8-difluoro-4-methylumbelliferyl phosphate (DiFMUP)
(Invitrogen-D22068)
4-20% Tris-Glycine SDS PAGE Gels (Invitrogen EC60255BOX)
Novex Tris-Glycine SDS Sample Buffer (InvitrogenNovex LC2676)
Novex SDS Running Buffer (Invitrogen LC2675)
Simply Blue.TM. SafeStain (Invitrogen LC6065)
Phytase Specific Activity Analysis
Dodecasodium phytate from rice (Sigma P-3168)
Ammonium metavanadate (Acros Organics 194910500)
Ammonium molybdate (Sigma A-7302)
Potassium Phosphate, dibasic (Fisher P288-500)
70% Nitric Acid (Sigma 380091)
25% Ammonium Solution (Atlas Chemical AA-3060)
Protein Purification
HisTrap.TM. FF 5 mL Ni-Sepharose Column (GE Healthcare
17-5255-01)
HiTrap.TM. Q FF 5 mL Anion Exchange Column (GE Healthcare
17-5156-01)
Immidizole (Sigma I-0125)
A number of embodiments as provided herein have been described.
Nevertheless, it will be understood that various modifications may
be made without departing from the spirit and scope as provided
herein. Accordingly, other embodiments are within the scope of the
following claims.
SEQUENCE LISTINGS
1
4011299DNAArtificial sequenceSynthetically generated 1atgaaagcga
tcttaatccc atttttatct cttctgattc cgttaacccc gcaatctgca 60ttcgctcaga
gtgagccgga gctgaagctg gaaagtgtgg tgattgtcag tcgtcatggt
120gtgcgtgctc caaccaaggc cacgcaactg atgcaggatg tcaccccaga
cgcatggcca 180acctggccgg taaaactggg tgagctgaca ccgcgcggtg
gtgagctaat cgcctatctc 240ggacattact ggcgtcagcg tctggtagcc
gacggattgc tgcctaaatg tggctgcccg 300cagtctggtc aggtcgcgat
tattgctgat gtcgacgagc gtacccgtaa aacaggcgaa 360gccttcgccg
ccgggctggc acctgactgt gcaataaccg tacataccca ggcagatacg
420tccagtcccg atccgttatt taatcctcta aaaactggcg tttgccaact
ggataacgcg 480aacgtgactg acgcgatcct cgagagggca ggagggtcaa
ttgctgactt taccgggcat 540tatcaaacgg cgtttcgcga actggaacgg
gtgcttaatt ttccgcaatc aaacttgtgc 600cttaaacgtg agaaacagga
cgaaagctgt tcattaacgc aggcattacc atcggaactc 660aaggtgagcg
ccgactgtgt ctcattaacc ggtgcggtaa gcctcgcatc aatgctgacg
720gagatatttc tcctgcaaca agcacaggga atgccggagc cggggtgggg
aaggatcacc 780gattcacacc agtggaacac cttgctaagt ttgcataacg
cgcaatttga tttgctacaa 840cgcacgccag aggttgcccg cagccgcgcc
accccgttat tagatttgat caagacagcg 900ttgacgcccc atccaccgca
aaaacaggcg tatggtgtga cattacccac ttcagtgctg 960tttatcgccg
gacacgatac taatctggca aatctcggcg gcgcactgga gctcaactgg
1020acgcttcccg gtcagccgga taacacgccg ccaggtggtg aactggtgtt
tgaacgctgg 1080cgtcggctaa gcgataacag ccagtggatt caggtttcgc
tggtcttcca gactttacag 1140cagatgcgtg ataaaacgcc gctgtcatta
aatacgccgc ccggagaggt gaaactgacc 1200ctggcaggat gtgaagagcg
aaatgcgcag ggcatgtgtt cgttggcagg ttttacgcaa 1260atcgtgaatg
aagcacgcat accggcgtgc agtttgtaa 12992432PRTArtificial
sequenceSynthetically generated 2Met Lys Ala Ile Leu Ile Pro Phe
Leu Ser Leu Leu Ile Pro Leu Thr1 5 10 15Pro Gln Ser Ala Phe Ala Gln
Ser Glu Pro Glu Leu Lys Leu Glu Ser 20 25 30Val Val Ile Val Ser Arg
His Gly Val Arg Ala Pro Thr Lys Ala Thr 35 40 45Gln Leu Met Gln Asp
Val Thr Pro Asp Ala Trp Pro Thr Trp Pro Val 50 55 60Lys Leu Gly Glu
Leu Thr Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu65 70 75 80Gly His
Tyr Trp Arg Gln Arg Leu Val Ala Asp Gly Leu Leu Pro Lys 85 90 95Cys
Gly Cys Pro Gln Ser Gly Gln Val Ala Ile Ile Ala Asp Val Asp 100 105
110Glu Arg Thr Arg Lys Thr Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro
115 120 125Asp Cys Ala Ile Thr Val His Thr Gln Ala Asp Thr Ser Ser
Pro Asp 130 135 140Pro Leu Phe Asn Pro Leu Lys Thr Gly Val Cys Gln
Leu Asp Asn Ala145 150 155 160Asn Val Thr Asp Ala Ile Leu Glu Arg
Ala Gly Gly Ser Ile Ala Asp 165 170 175Phe Thr Gly His Tyr Gln Thr
Ala Phe Arg Glu Leu Glu Arg Val Leu 180 185 190Asn Phe Pro Gln Ser
Asn Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu 195 200 205Ser Cys Ser
Leu Thr Gln Ala Leu Pro Ser Glu Leu Lys Val Ser Ala 210 215 220Asp
Cys Val Ser Leu Thr Gly Ala Val Ser Leu Ala Ser Met Leu Thr225 230
235 240Glu Ile Phe Leu Leu Gln Gln Ala Gln Gly Met Pro Glu Pro Gly
Trp 245 250 255Gly Arg Ile Thr Asp Ser His Gln Trp Asn Thr Leu Leu
Ser Leu His 260 265 270Asn Ala Gln Phe Asp Leu Leu Gln Arg Thr Pro
Glu Val Ala Arg Ser 275 280 285Arg Ala Thr Pro Leu Leu Asp Leu Ile
Lys Thr Ala Leu Thr Pro His 290 295 300Pro Pro Gln Lys Gln Ala Tyr
Gly Val Thr Leu Pro Thr Ser Val Leu305 310 315 320Phe Ile Ala Gly
His Asp Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu 325 330 335Glu Leu
Asn Trp Thr Leu Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly 340 345
350Gly Glu Leu Val Phe Glu Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln
355 360 365Trp Ile Gln Val Ser Leu Val Phe Gln Thr Leu Gln Gln Met
Arg Asp 370 375 380Lys Thr Pro Leu Ser Leu Asn Thr Pro Pro Gly Glu
Val Lys Leu Thr385 390 395 400Leu Ala Gly Cys Glu Glu Arg Asn Ala
Gln Gly Met Cys Ser Leu Ala 405 410 415Gly Phe Thr Gln Ile Val Asn
Glu Ala Arg Ile Pro Ala Cys Ser Leu 420 425 430343DNAArtificial
sequenceOligonucleotide sequence 3tgcgtgctcc aaccaaggcc atgcaactga
tgcaggatgt cac 43465DNAArtificial sequenceOligonucleotide sequence
4taaaaactgg cgtttgccaa ccggatgtgg cgaacgtgac tgacgcgatc ctcgagaggg
60cagga 65565DNAArtificial sequenceOligonucleotide sequence
5taaaaactgg cgtttgccaa ctggatgtgg cgaacgtgac tcgtgcgatc ctcgagaggg
60cagga 65665DNAArtificial sequenceOligonucleotide sequence
6taaaaactgg cgtttgccaa ccggatgtgg cgaacgtgac tcgtgcgatc ctcgagaggg
60cagga 65741DNAArtificial sequenceOligonucleotide sequence
7gagatatttc tcctgcaaca tgcacaggga atgccggagc c 41843DNAArtificial
sequenceOligonucleotide sequence 8tgctaagttt gcataacgcg cattttgatt
tgctacaacg cac 43943DNAArtificial sequenceOligonucleotide sequence
9tgctaagttt gcataacgcg gtgtttgatt tgctacaacg cac
431041DNAArtificial sequenceOligonucleotide sequence 10aatcgtgaat
gaagcacgca caccggcgtg cagtttgaga t 411143DNAArtificial
sequenceOligonucleotide sequence 11tgcgtgctcc aaccaaggcc atgcaactga
tgcaggatgt cac 431243DNAArtificial sequenceOligonucleotide sequence
12gcggtggtga gctaatcgcc catctcggac attactggcg tca
431343DNAArtificial sequenceOligonucleotide sequence 13taaaaactgg
cgtttgccaa ccggatgtgg cgaacgtgac tga 431443DNAArtificial
sequenceOligonucleotide sequence 14ggtcaattgc tgactttacc cgccattatc
aaacggcgtt tcg 431543DNAArtificial sequenceOligonucleotide sequence
15aactcaaggt gagcgccgac gatgtctcat taaccggtgc ggt
431643DNAArtificial sequenceOligonucleotide sequence 16tgacggagat
atttctcctg tggcaagcac agggaatgcc gga 431746DNAArtificial
sequenceOligonucleotide sequence 17tgacggagat atttctcctg tggcatgcac
agggaatgcc ggagcc 461843DNAArtificial sequenceOligonucleotide
sequence 18cggagatatt tctcctgcaa catgcacagg gaatgccgga gcc
431943DNAArtificial sequenceOligonucleotide sequence 19tgctaagttt
gcataacgcg gtgtttgatt tgctacaacg cac 432043DNAArtificial
sequenceOligonucleotide sequence 20ttcccggtca gccggataac tatccgccag
gtggtgaact ggt 432143DNAArtificial sequenceOligonucleotide sequence
21ttcaggtttc gctggtcttc cgcactttac agcagatgcg tga
432241DNAArtificial sequenceOligonucleotide sequence 22aatcgtgaat
gaagcacgca caccggcgtg cagtttgaga t 41231236DNAArtificial
sequenceSynthetically generated 23atgcagagtg agccggagct gaagctggaa
agtgtggtga ttgtcagtcg tcatggtgtg 60cgtgctccaa ccaaggccat gcaactgatg
caggatgtca ccccagacgc atggccaacc 120tggccggtaa aactgggtga
gctgacaccg cgcggtggtg agctaatcgc ccatctcgga 180cattactggc
gtcagcgtct ggtagccgac ggattgctgc ctaaatgtgg ctgcccgcag
240tctggtcagg tcgcgattat tgctgatgtc gacgagcgta cccgtaaaac
aggcgaagcc 300ttcgccgccg ggctggcacc tgactgtgca ataaccgtac
atacccaggc agatacgtcc 360agtcccgatc cgttatttaa tcctctaaaa
actggcgttt gccaactgga tgtggcgaac 420gtgagacgtg cgatcctcga
gagggcagga gggtcaattg ctgactttac cgggcattat 480caaacggcgt
ttcgcgaact ggaacgggtg cttaattttc cgcaatcaaa cttgtgcctt
540aaacgtgaga aacaggacga aagctgttca ttaacgcagg cattaccatc
ggaactcaag 600gtgagcgccg actgtgtctc attaaccggt gcggtaagcc
tcgcatcaat gctgacggag 660atatttctcc tgcaacatgc acagggaatg
ccggagccgg ggtggggaag gatcaccgat 720tcacaccagt ggaacacctt
gctaagtttg cataacgcgg tgtttgattt gctacaacgc 780acgccagagg
ttgcccgcag ccgcgccacc ccgttattag atttgatcaa gacagcgttg
840acgccccatc caccgcaaaa acaggcgtat ggtgtgacat tacccacttc
agtgctgttt 900atcgccggac acgatactaa tctggcaaat ctcggcggcg
cactggagct cgaatggacg 960cttcccggtc agccggataa ctatccgcca
ggtggtgaac tggtgtttga acgctggcgt 1020cggctaagcg ataacagcca
gtggattcag gtttcgctgg tcttccagac tttacagcag 1080atgcgtgata
aaacgccgct gtcattaaat acgccgcccg gagaggtgaa actgaccctg
1140gcaggatgtg aagagcgaaa tgcgcagggc atgtgttcgt tggcaggttt
tacgcaaatc 1200gtgaatgaag cacgcatacc ggcgtgcagt ttgtaa
123624411PRTArtificial sequenceSynthetically generated 24Met Gln
Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser1 5 10 15Arg
His Gly Val Arg Ala Pro Thr Lys Ala Met Gln Leu Met Gln Asp 20 25
30Val Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu
35 40 45Thr Pro Arg Gly Gly Glu Leu Ile Ala His Leu Gly His Tyr Trp
Arg 50 55 60Gln Arg Leu Val Ala Asp Gly Leu Leu Pro Lys Cys Gly Cys
Pro Gln65 70 75 80Ser Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu
Arg Thr Arg Lys 85 90 95Thr Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro
Asp Cys Ala Ile Thr 100 105 110Val His Thr Gln Ala Asp Thr Ser Ser
Pro Asp Pro Leu Phe Asn Pro 115 120 125Leu Lys Thr Gly Val Cys Gln
Leu Asp Val Ala Asn Val Arg Arg Ala 130 135 140Ile Leu Glu Arg Ala
Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr145 150 155 160Gln Thr
Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser 165 170
175Asn Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr
180 185 190Gln Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Cys Val
Ser Leu 195 200 205Thr Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu
Ile Phe Leu Leu 210 215 220Gln His Ala Gln Gly Met Pro Glu Pro Gly
Trp Gly Arg Ile Thr Asp225 230 235 240Ser His Gln Trp Asn Thr Leu
Leu Ser Leu His Asn Ala Val Phe Asp 245 250 255Leu Leu Gln Arg Thr
Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu 260 265 270Leu Asp Leu
Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln 275 280 285Ala
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His 290 295
300Asp Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Glu Trp
Thr305 310 315 320Leu Pro Gly Gln Pro Asp Asn Tyr Pro Pro Gly Gly
Glu Leu Val Phe 325 330 335Glu Arg Trp Arg Arg Leu Ser Asp Asn Ser
Gln Trp Ile Gln Val Ser 340 345 350Leu Val Phe Gln Thr Leu Gln Gln
Met Arg Asp Lys Thr Pro Leu Ser 355 360 365Leu Asn Thr Pro Pro Gly
Glu Val Lys Leu Thr Leu Ala Gly Cys Glu 370 375 380Glu Arg Asn Ala
Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile385 390 395 400Val
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410251236DNAArtificial
sequenceSynthetically generated 25atgcagagtg agccggagct gaagctggaa
agtgtggtga ttgtcagtcg tcatggtgtg 60cgtgctccaa ccaaggccat gcaactgatg
caggatgtca ccccagacgc atggccaacc 120tggccggtaa aactgggtga
gctgacaccg cgcggtggtg agctaatcgc ccatctcgga 180cattactggc
gtcagcgtct ggtagccgac ggattgctgc ctaaatgtgg ctgcccgcag
240tctggtcagg tcgcgattat tgctgatgtc gacgagcgta cccgtaaaac
aggcgaagcc 300ttcgccgccg ggctggcacc tgactgtgca ataaccgtac
atacccaggc agatacgtcc 360agtcccgatc cgttatttaa tcctctaaaa
actggcgttt gccaactgga tgtggcgaac 420gtgagacgtg cgatcctcga
gagggcagga gggtcaattg ctgactttac ccgccattat 480caaacggcgt
ttcgcgaact ggaacgggtg cttaattttc cgcaatcaaa cttgtgcctt
540aaacgtgaga aacaggacga aagctgttca ttaacgcagg cattaccatc
ggaactcaag 600gtgagcgccg acgatgtctc attaaccggt gcggtaagcc
tcgcatcaat gctgacggag 660atatttctcc tgcaacatgc acagggaatg
ccggagccgg ggtggggaag gatcaccgat 720tcacaccagt ggaacacctt
gctaagtttg cataacgcgg tgtttgattt gctacaacgc 780acgccagagg
ttgcccgcag ccgcgccacc ccgttattag atttgatcaa gacagcgttg
840acgccccatc caccgcaaaa acaggcgtat ggtgtgacat tacccacttc
agtgctgttt 900atcgccggac acgatactaa tctggcaaat ctcggcggcg
cactggagct cgaatggacg 960cttcccggtc agccggataa cacgccgcca
ggtggtgaac tggtgtttga acgctggcgt 1020cggctaagcg ataacagcca
gtggattcag gtttcgctgg tcttccagac tttacagcag 1080atgcgtgata
aaacgccgct gtcattaaat acgccgcccg gagaggtgaa actgaccctg
1140gcaggatgtg aagagcgaaa tgcgcagggc atgtgttcgt tggcaggttt
tacgcaaatc 1200gtgaatgaag cacgcatacc ggcgtgcagt ttgtaa
123626411PRTArtificial sequenceSynthetically generated 26Met Gln
Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser1 5 10 15Arg
His Gly Val Arg Ala Pro Thr Lys Ala Met Gln Leu Met Gln Asp 20 25
30Val Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu
35 40 45Thr Pro Arg Gly Gly Glu Leu Ile Ala His Leu Gly His Tyr Trp
Arg 50 55 60Gln Arg Leu Val Ala Asp Gly Leu Leu Pro Lys Cys Gly Cys
Pro Gln65 70 75 80Ser Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu
Arg Thr Arg Lys 85 90 95Thr Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro
Asp Cys Ala Ile Thr 100 105 110Val His Thr Gln Ala Asp Thr Ser Ser
Pro Asp Pro Leu Phe Asn Pro 115 120 125Leu Lys Thr Gly Val Cys Gln
Leu Asp Val Ala Asn Val Arg Arg Ala 130 135 140Ile Leu Glu Arg Ala
Gly Gly Ser Ile Ala Asp Phe Thr Arg His Tyr145 150 155 160Gln Thr
Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser 165 170
175Asn Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr
180 185 190Gln Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asp Val
Ser Leu 195 200 205Thr Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu
Ile Phe Leu Leu 210 215 220Gln His Ala Gln Gly Met Pro Glu Pro Gly
Trp Gly Arg Ile Thr Asp225 230 235 240Ser His Gln Trp Asn Thr Leu
Leu Ser Leu His Asn Ala Val Phe Asp 245 250 255Leu Leu Gln Arg Thr
Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu 260 265 270Leu Asp Leu
Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln 275 280 285Ala
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His 290 295
300Asp Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Glu Trp
Thr305 310 315 320Leu Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly
Glu Leu Val Phe 325 330 335Glu Arg Trp Arg Arg Leu Ser Asp Asn Ser
Gln Trp Ile Gln Val Ser 340 345 350Leu Val Phe Gln Thr Leu Gln Gln
Met Arg Asp Lys Thr Pro Leu Ser 355 360 365Leu Asn Thr Pro Pro Gly
Glu Val Lys Leu Thr Leu Ala Gly Cys Glu 370 375 380Glu Arg Asn Ala
Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile385 390 395 400Val
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410271236DNAArtificial
sequenceSynthetically generated 27atgcagagtg agccggagct gaagctggaa
agtgtggtga ttgtcagtcg tcatggtgtg 60cgtgctccaa ccaaggccac gcaactgatg
caggatgtca ccccagacgc atggccaacc 120tggccggtaa aactgggtga
gctgacaccg cgcggtggtg agctaatcgc ctatctcgga 180cattactggc
gtcagcgtct ggtagccgac ggattgctgc ctaaatgtgg ctgcccgcag
240tctggtcagg tcgcgattat tgctgatgtc gacgagcgta cccgtaaaac
aggcgaagcc 300ttcgccgccg ggctggcacc tgactgtgca ataaccgtac
atacccaggc agatacgtcc 360agtcccgatc cgttatttaa tcctctaaaa
actggcgttt gccaactgga tgtggcgaac 420gtgagacgtg cgatcctcga
gagggcagga gggtcaattg ctgactttac cgggcattat 480caaacggcgt
ttcgcgaact ggaacgggtg cttaattttc cgcaatcaaa cttgtgcctt
540aaacgtgaga aacaggacga aagctgttca ttaacgcagg cattaccatc
ggaactcaag 600gtgagcgccg actgtgtctc attaaccggt gcggtaagcc
tcgcatcaat gctgacggag 660atatttctcc tgcaacatgc acagggaatg
ccggagccgg ggtggggaag gatcaccgat 720tcacaccagt ggaacacctt
gctaagtttg cataacgcgc attttgattt gctacaacgc 780acgccagagg
ttgcccgcag ccgcgccacc ccgttattag atttgatcaa gacagcgttg
840acgccccatc caccgcaaaa acaggcgtat ggtgtgacat tacccacttc
agtgctgttt 900atcgccggac acgatactaa tctggcaaat ctcggcggcg
cactggagct cgaatggacg 960cttcccggtc agccggataa cacgccgcca
ggtggtgaac tggtgtttga acgctggcgt 1020cggctaagcg ataacagcca
gtggattcag gtttcgctgg tcttccagac tttacagcag 1080atgcgtgata
aaacgccgct gtcattaaat acgccgcccg gagaggtgaa actgaccctg
1140gcaggatgtg aagagcgaaa tgcgcagggc atgtgttcgt tggcaggttt
tacgcaaatc 1200gtgaatgaag cacgcatacc ggcgtgcagt ttgtaa
123628411PRTArtificial sequenceSynthetically generated 28Met Gln
Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser1 5 10 15Arg
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp 20 25
30Val Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu
35 40 45Thr Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp
Arg 50 55 60Gln Arg Leu Val Ala Asp Gly Leu Leu Pro Lys Cys Gly Cys
Pro Gln65 70 75 80Ser Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu
Arg Thr Arg Lys 85 90 95Thr Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro
Asp Cys Ala Ile Thr 100 105 110Val His Thr Gln Ala Asp Thr Ser Ser
Pro Asp Pro Leu Phe Asn Pro 115 120 125Leu Lys Thr Gly Val Cys Gln
Leu Asp Val Ala Asn Val Arg Arg Ala 130 135 140Ile Leu Glu Arg Ala
Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr145 150 155 160Gln Thr
Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser 165 170
175Asn Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr
180 185 190Gln Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Cys Val
Ser Leu 195 200 205Thr Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu
Ile Phe Leu Leu 210 215 220Gln His Ala Gln Gly Met Pro Glu Pro Gly
Trp Gly Arg Ile Thr Asp225 230 235 240Ser His Gln Trp Asn Thr Leu
Leu Ser Leu His Asn Ala His Phe Asp 245 250 255Leu Leu Gln Arg Thr
Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu 260 265 270Leu Asp Leu
Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln 275 280 285Ala
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His 290 295
300Asp Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Glu Trp
Thr305 310 315 320Leu Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly
Glu Leu Val Phe 325 330 335Glu Arg Trp Arg Arg Leu Ser Asp Asn Ser
Gln Trp Ile Gln Val Ser 340 345 350Leu Val Phe Gln Thr Leu Gln Gln
Met Arg Asp Lys Thr Pro Leu Ser 355 360 365Leu Asn Thr Pro Pro Gly
Glu Val Lys Leu Thr Leu Ala Gly Cys Glu 370 375 380Glu Arg Asn Ala
Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile385 390 395 400Val
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410291236DNAArtificial
sequenceSynthetically generated 29atgcagagtg agccggagct gaagctggaa
agtgtggtga ttgtcagtcg tcatggtgtg 60cgtgctccaa ccaaggccac gcaactgatg
caggatgtca ccccagacgc atggccaacc 120tggccggtaa aactgggtga
gctgacaccg cgcggtggtg agctaatcgc ctatctcgga 180cattactggc
gtcagcgtct ggtagccgac ggattgctgc ctaaatgtgg ctgcccgcag
240tctggtcagg tcgcgattat tgctgatgtc gacgagcgta cccgtaaaac
aggcgaagcc 300ttcgccgccg ggctggcacc tgactgtgca ataaccgtac
atacccaggc agatacgtcc 360agtcccgatc cgttatttaa tcctctaaaa
actggcgttt gccaactgga taacgcgaac 420gtgagagacg cgatcctcga
gagggcagga gggtcaattg ctgactttac cgggcattat 480caaacggcgt
ttcgcgaact ggaacgggtg cttaattttc cgcaatcaaa cttgtgcctt
540aaacgtgaga aacaggacga aagctgttca ttaacgcagg cattaccatc
ggaactcaag 600gtgagcgccg actgtgtctc attaaccggt gcggtaagcc
tcgcatcaat gctgacggag 660atatttctcc tgcaacatgc acagggaatg
ccggagccgg ggtggggaag gatcaccgat 720tcacaccagt ggaacacctt
gctaagtttg cataacgcgc aatttgattt gctacaacgc 780acgccagagg
ttgcccgcag ccgcgccacc ccgttattag atttgatcaa gacagcgttg
840acgccccatc caccgcaaaa acaggcgtat ggtgtgacat tacccacttc
agtgctgttt 900atcgccggac acgatactaa tctggcaaat ctcggcggcg
cactggagct cgaatggacg 960cttcccggtc agccggataa cacgccgcca
ggtggtgaac tggtgtttga acgctggcgt 1020cggctaagcg ataacagcca
gtggattcag gtttcgctgg tcttccagac tttacagcag 1080atgcgtgata
aaacgccgct gtcattaaat acgccgcccg gagaggtgaa actgaccctg
1140gcaggatgtg aagagcgaaa tgcgcagggc atgtgttcgt tggcaggttt
tacgcaaatc 1200gtgaatgaag cacgcatacc ggcgtgcagt ttgtaa
123630411PRTArtificial sequenceSynthetically generated 30Met Gln
Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser1 5 10 15Arg
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp 20 25
30Val Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu
35 40 45Thr Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp
Arg 50 55 60Gln Arg Leu Val Ala Asp Gly Leu Leu Pro Lys Cys Gly Cys
Pro Gln65 70 75 80Ser Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu
Arg Thr Arg Lys 85 90 95Thr Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro
Asp Cys Ala Ile Thr 100 105 110Val His Thr Gln Ala Asp Thr Ser Ser
Pro Asp Pro Leu Phe Asn Pro 115 120 125Leu Lys Thr Gly Val Cys Gln
Leu Asp Asn Ala Asn Val Arg Asp Ala 130 135 140Ile Leu Glu Arg Ala
Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr145 150 155 160Gln Thr
Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser 165 170
175Asn Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr
180 185 190Gln Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Cys Val
Ser Leu 195 200 205Thr Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu
Ile Phe Leu Leu 210 215 220Gln His Ala Gln Gly Met Pro Glu Pro Gly
Trp Gly Arg Ile Thr Asp225 230 235 240Ser His Gln Trp Asn Thr Leu
Leu Ser Leu His Asn Ala Gln Phe Asp 245 250 255Leu Leu Gln Arg Thr
Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu 260 265 270Leu Asp Leu
Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln 275 280 285Ala
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His 290 295
300Asp Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Glu Trp
Thr305 310 315 320Leu Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly
Glu Leu Val Phe 325 330 335Glu Arg Trp Arg Arg Leu Ser Asp Asn Ser
Gln Trp Ile Gln Val Ser 340 345 350Leu Val Phe Gln Thr Leu Gln Gln
Met Arg Asp Lys Thr Pro Leu Ser 355 360 365Leu Asn Thr Pro Pro Gly
Glu Val Lys Leu Thr Leu Ala Gly Cys Glu 370 375 380Glu Arg Asn Ala
Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile385 390 395 400Val
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410311236DNAArtificial
sequenceSynthetically generated 31atgcagagtg agccggagct gaagctggaa
agtgtggtga ttgtcagtcg tcatggtgtg 60cgtgctccaa ccaaggccat gcaactgatg
caggatgtca ccccagacgc atggccaacc 120tggccggtaa aactgggtga
gctgacaccg cgcggtggtg agctaatcgc ctatctcgga 180cattactggc
gtcagcgtct ggtagccgac ggattgctgc ctaaatgtgg ctgcccgcag
240tctggtcagg tcgcgattat tgctgatgtc gacgagcgta cccgtaaaac
aggcgaagcc 300ttcgccgccg ggctggcacc tgactgtgca ataaccgtac
atacccaggc agatacgtcc 360agtcccgatc cgttatttaa tcctctaaaa
actggcgttt gccaactgga tgtggcgaac 420gtgagagacg cgatcctcga
gagggcagga gggtcaattg ctgactttac cgggcattat 480caaacggcgt
ttcgcgaact ggaacgggtg cttaattttc cgcaatcaaa cttgtgcctt
540aaacgtgaga aacaggacga aagctgttca ttaacgcagg cattaccatc
ggaactcaag 600gtgagcgccg actgtgtctc attaaccggt gcggtaagcc
tcgcatcaat gctgacggag 660atatttctcc tgcaacatgc acagggaatg
ccggagccgg ggtggggaag gatcaccgat 720tcacaccagt ggaacacctt
gctaagtttg cataacgcgg tgtttgattt gctacaacgc 780acgccagagg
ttgcccgcag ccgcgccacc ccgttattag atttgatcaa gacagcgttg
840acgccccatc caccgcaaaa acaggcgtat ggtgtgacat tacccacttc
agtgctgttt 900atcgccggac acgatactaa tctggcaaat ctcggcggcg
cactggagct cgaatggacg 960cttcccggtc agccggataa cacgccgcca
ggtggtgaac tggtgtttga acgctggcgt 1020cggctaagcg ataacagcca
gtggattcag gtttcgctgg tcttccagac tttacagcag 1080atgcgtgata
aaacgccgct gtcattaaat acgccgcccg gagaggtgaa actgaccctg
1140gcaggatgtg aagagcgaaa tgcgcagggc atgtgttcgt tggcaggttt
tacgcaaatc 1200gtgaatgaag cacgcatacc ggcgtgcagt ttgtaa
123632411PRTArtificial sequenceSynthetically generated 32Met Gln
Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser1 5 10 15Arg
His Gly Val Arg Ala Pro Thr Lys Ala Met Gln Leu Met Gln Asp 20 25
30Val Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu
35 40 45Thr Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp
Arg 50 55 60Gln Arg Leu Val Ala Asp Gly Leu Leu Pro Lys Cys Gly Cys
Pro Gln65 70 75 80Ser Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu
Arg Thr Arg Lys 85 90 95Thr Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro
Asp Cys Ala Ile Thr 100 105 110Val His Thr Gln Ala Asp Thr Ser Ser
Pro Asp Pro Leu Phe Asn Pro 115 120 125Leu Lys Thr Gly Val Cys Gln
Leu Asp Val Ala Asn Val Arg Asp Ala 130 135 140Ile Leu Glu Arg Ala
Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr145 150 155 160Gln Thr
Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser 165 170
175Asn Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr
180 185 190Gln Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Cys Val
Ser Leu 195 200 205Thr Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu
Ile Phe Leu Leu 210 215 220Gln His Ala Gln Gly Met Pro Glu Pro Gly
Trp Gly Arg Ile Thr Asp225 230 235 240Ser His Gln Trp Asn Thr Leu
Leu Ser Leu His Asn Ala Val Phe Asp 245 250 255Leu Leu Gln Arg Thr
Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu 260 265 270Leu Asp Leu
Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln 275 280 285Ala
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His 290 295
300Asp Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Glu Trp
Thr305 310 315 320Leu Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly
Glu Leu Val Phe 325 330 335Glu Arg Trp Arg Arg Leu Ser Asp Asn Ser
Gln Trp Ile Gln Val Ser 340 345 350Leu Val Phe Gln Thr Leu Gln Gln
Met Arg Asp Lys Thr Pro Leu Ser 355 360 365Leu Asn Thr Pro Pro Gly
Glu Val Lys Leu Thr Leu Ala Gly Cys Glu 370 375 380Glu Arg Asn Ala
Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile385 390 395 400Val
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410331236DNAArtificial
sequenceSynthetically generated 33atgcagagtg agccggagct gaagctggaa
agtgtggtga ttgtcagtcg tcatggtgtg 60cgtgctccaa ccaaggccat gcaactgatg
caggatgtca ccccagacgc atggccaacc 120tggccggtaa aactgggtga
gctgacaccg cgcggtggtg agctaatcgc ctatctcgga 180cattactggc
gtcagcgtct ggtagccgac ggattgctgc ctaaatgtgg ctgcccgcag
240tctggtcagg tcgcgattat tgctgatgtc gacgagcgta cccgtaaaac
aggcgaagcc 300ttcgccgccg ggctggcacc tgactgtgca ataaccgtac
atacccaggc agatacgtcc 360agtcccgatc cgttatttaa tcctctaaaa
actggcgttt gccaactgga tgtggcgaac 420gtgagacgtg cgatcctcga
gagggcagga gggtcaattg ctgactttac cgggcattat 480caaacggcgt
ttcgcgaact ggaacgggtg cttaattttc cgcaatcaaa cttgtgcctt
540aaacgtgaga aacaggacga aagctgttca ttaacgcagg cattaccatc
ggaactcaag 600gtgagcgccg actgtgtctc attaaccggt gcggtaagcc
tcgcatcaat gctgacggag 660atatttctcc tgcaacatgc acagggaatg
ccggagccgg ggtggggaag gatcaccgat 720tcacaccagt ggaacacctt
gctaagtttg cataacgcgg tgtttgattt gctacaacgc 780acgccagagg
ttgcccgcag ccgcgccacc ccgttattag atttgatcaa gacagcgttg
840acgccccatc caccgcaaaa acaggcgtat ggtgtgacat tacccacttc
agtgctgttt 900atcgccggac acgatactaa tctggcaaat ctcggcggcg
cactggagct cgaatggacg 960cttcccggtc agccggataa cacgccgcca
ggtggtgaac tggtgtttga acgctggcgt 1020cggctaagcg ataacagcca
gtggattcag gtttcgctgg tcttccagac tttacagcag 1080atgcgtgata
aaacgccgct gtcattaaat acgccgcccg gagaggtgaa actgaccctg
1140gcaggatgtg aagagcgaaa tgcgcagggc atgtgttcgt tggcaggttt
tacgcaaatc 1200gtgaatgaag cacgcacacc ggcgtgcagt ttgtaa
123634411PRTArtificial sequenceSynthetically generated 34Met Gln
Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser1 5 10 15Arg
His Gly Val Arg Ala Pro Thr Lys Ala Met Gln Leu Met Gln Asp 20 25
30Val Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu
35 40 45Thr Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp
Arg 50 55 60Gln Arg Leu Val Ala Asp Gly Leu Leu Pro Lys Cys Gly Cys
Pro Gln65 70 75 80Ser Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu
Arg Thr Arg Lys 85 90 95Thr Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro
Asp Cys Ala Ile Thr 100 105 110Val His Thr Gln Ala Asp Thr Ser Ser
Pro Asp Pro Leu Phe Asn Pro 115 120 125Leu Lys Thr Gly Val Cys Gln
Leu Asp Val Ala Asn Val Arg Arg Ala 130 135 140Ile Leu Glu Arg Ala
Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr145 150 155 160Gln Thr
Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser 165 170
175Asn Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr
180 185 190Gln Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Cys Val
Ser Leu 195 200 205Thr Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu
Ile Phe Leu Leu 210 215 220Gln His Ala Gln Gly Met Pro Glu Pro Gly
Trp Gly Arg Ile Thr Asp225 230 235 240Ser His Gln Trp Asn Thr Leu
Leu Ser Leu His Asn Ala Val Phe Asp 245 250 255Leu Leu Gln Arg Thr
Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu 260 265 270Leu Asp Leu
Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln 275 280 285Ala
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His 290 295
300Asp Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Glu Trp
Thr305 310 315 320Leu Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly
Glu Leu Val Phe 325 330 335Glu Arg Trp Arg Arg Leu Ser Asp Asn Ser
Gln Trp Ile Gln Val Ser 340 345 350Leu Val Phe Gln Thr Leu Gln Gln
Met Arg Asp Lys Thr Pro Leu Ser 355 360 365Leu Asn Thr Pro Pro Gly
Glu Val Lys Leu Thr Leu Ala Gly Cys Glu 370 375 380Glu Arg Asn Ala
Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile385 390 395 400Val
Asn Glu Ala Arg Thr Pro Ala Cys Ser Leu 405 410351236DNAArtificial
sequenceSynthetically generated 35atgcagagtg agccggagct gaagctggaa
agtgtggtga ttgtcagtcg tcatggtgtg 60cgtgctccaa ccaaggccat gcaactgatg
caggatgtca ccccagacgc atggccaacc 120tggccggtaa aactgggtga
gctgacaccg cgcggtggtg agctaatcgc ctatctcgga 180cattactggc
gtcagcgtct ggtagccgac ggattgctgc ctaaatgtgg ctgcccgcag
240tctggtcagg tcgcgattat tgctgatgtc gacgagcgta cccgtaaaac
aggcgaagcc
300ttcgccgccg ggctggcacc tgactgtgca ataaccgtac atacccaggc
agatacgtcc 360agtcccgatc cgttatttaa tcctctaaaa actggcgttt
gccaactgga tgtggcgaac 420gtgagacgtg cgatcctcga gagggcagga
gggtcaattg ctgactttac cgggcattat 480caaacggcgt ttcgcgaact
ggaacgggtg cttaattttc cgcaatcaaa cttgtgcctt 540aaacgtgaga
aacaggacga aagctgttca ttaacgcagg cattaccatc ggaactcaag
600gtgagcgccg actgtgtctc attaaccggt gcggtaagcc tcgcatcaat
gctgacggag 660atatttctcc tgcaacatgc acagggaatg ccggagccgg
ggtggggaag gatcaccgat 720tcacaccagt ggaacacctt gctaagtttg
cataacgcgc aatttgattt gctacaacgc 780acgccagagg ttgcccgcag
ccgcgccacc ccgttattag atttgatcaa gacagcgttg 840acgccccatc
caccgcaaaa acaggcgtat ggtgtgacat tacccacttc agtgctgttt
900atcgccggac acgatactaa tctggcaaat ctcggcggcg cactggagct
cgaatggacg 960cttcccggtc agccggataa cacgccgcca ggtggtgaac
tggtgtttga acgctggcgt 1020cggctaagcg ataacagcca gtggattcag
gtttcgctgg tcttccagac tttacagcag 1080atgcgtgata aaacgccgct
gtcattaaat acgccgcccg gagaggtgaa actgaccctg 1140gcaggatgtg
aagagcgaaa tgcgcagggc atgtgttcgt tggcaggttt tacgcaaatc
1200gtgaatgaag cacgcatacc ggcgtgcagt ttgtaa 123636411PRTArtificial
sequenceSynthetically generated 36Met Gln Ser Glu Pro Glu Leu Lys
Leu Glu Ser Val Val Ile Val Ser1 5 10 15Arg His Gly Val Arg Ala Pro
Thr Lys Ala Met Gln Leu Met Gln Asp 20 25 30Val Thr Pro Asp Ala Trp
Pro Thr Trp Pro Val Lys Leu Gly Glu Leu 35 40 45Thr Pro Arg Gly Gly
Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg 50 55 60Gln Arg Leu Val
Ala Asp Gly Leu Leu Pro Lys Cys Gly Cys Pro Gln65 70 75 80Ser Gly
Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys 85 90 95Thr
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr 100 105
110Val His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro
115 120 125Leu Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Arg
Arg Ala 130 135 140Ile Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe
Thr Gly His Tyr145 150 155 160Gln Thr Ala Phe Arg Glu Leu Glu Arg
Val Leu Asn Phe Pro Gln Ser 165 170 175Asn Leu Cys Leu Lys Arg Glu
Lys Gln Asp Glu Ser Cys Ser Leu Thr 180 185 190Gln Ala Leu Pro Ser
Glu Leu Lys Val Ser Ala Asp Cys Val Ser Leu 195 200 205Thr Gly Ala
Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu 210 215 220Gln
His Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp225 230
235 240Ser His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe
Asp 245 250 255Leu Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala
Thr Pro Leu 260 265 270Leu Asp Leu Ile Lys Thr Ala Leu Thr Pro His
Pro Pro Gln Lys Gln 275 280 285Ala Tyr Gly Val Thr Leu Pro Thr Ser
Val Leu Phe Ile Ala Gly His 290 295 300Asp Thr Asn Leu Ala Asn Leu
Gly Gly Ala Leu Glu Leu Glu Trp Thr305 310 315 320Leu Pro Gly Gln
Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe 325 330 335Glu Arg
Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser 340 345
350Leu Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser
355 360 365Leu Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly
Cys Glu 370 375 380Glu Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly
Phe Thr Gln Ile385 390 395 400Val Asn Glu Ala Arg Ile Pro Ala Cys
Ser Leu 405 410371236DNAArtificial sequenceSynthetically generated
37atgcagagtg agccggagct gaagctggaa agtgtggtga ttgtcagtcg tcatggtgtg
60cgtgctccaa ccaaggccat gcaactgatg caggatgtca ccccagacgc atggccaacc
120tggccggtaa aactgggtga gctgacaccg cgcggtggtg agctaatcgc
ctatctcgga 180cattactggc gtcagcgtct ggtagccgac ggattgctgc
ctaaatgtgg ctgcccgcag 240tctggtcagg tcgcgattat tgctgatgtc
gacgagcgta cccgtaaaac aggcgaagcc 300ttcgccgccg ggctggcacc
tgactgtgca ataaccgtac atacccaggc agatacgtcc 360agtcccgatc
cgttatttaa tcctctaaaa actggcgttt gccaactgga tgtggcgaac
420gtgagagacg cgatcctcga gagggcagga gggtcaattg ctgactttac
cgggcattat 480caaacggcgt ttcgcgaact ggaacgggtg cttaattttc
cgcaatcaaa cttgtgcctt 540aaacgtgaga aacaggacga aagctgttca
ttaacgcagg cattaccatc ggaactcaag 600gtgagcgccg actgtgtctc
attaaccggt gcggtaagcc tcgcatcaat gctgacggag 660atatttctcc
tgcaacatgc acagggaatg ccggagccgg ggtggggaag gatcaccgat
720tcacaccagt ggaacacctt gctaagtttg cataacgcgg tgtttgattt
gctacaacgc 780acgccagagg ttgcccgcag ccgcgccacc ccgttattag
atttgatcaa gacagcgttg 840acgccccatc caccgcaaaa acaggcgtat
ggtgtgacat tacccacttc agtgctgttt 900atcgccggac acgatactaa
tctggcaaat ctcggcggcg cactggagct cgaatggacg 960cttcccggtc
agccggataa cacgccgcca ggtggtgaac tggtgtttga acgctggcgt
1020cggctaagcg ataacagcca gtggattcag gtttcgctgg tcttccagac
tttacagcag 1080atgcgtgata aaacgccgct gtcattaaat acgccgcccg
gagaggtgaa actgaccctg 1140gcaggatgtg aagagcgaaa tgcgcagggc
atgtgttcgt tggcaggttt tacgcaaatc 1200gtgaatgaag cacgcacacc
ggcgtgcagt ttgtaa 123638411PRTArtificial sequenceSynthetically
generated 38Met Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile
Val Ser1 5 10 15Arg His Gly Val Arg Ala Pro Thr Lys Ala Met Gln Leu
Met Gln Asp 20 25 30Val Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys
Leu Gly Glu Leu 35 40 45Thr Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu
Gly His Tyr Trp Arg 50 55 60Gln Arg Leu Val Ala Asp Gly Leu Leu Pro
Lys Cys Gly Cys Pro Gln65 70 75 80Ser Gly Gln Val Ala Ile Ile Ala
Asp Val Asp Glu Arg Thr Arg Lys 85 90 95Thr Gly Glu Ala Phe Ala Ala
Gly Leu Ala Pro Asp Cys Ala Ile Thr 100 105 110Val His Thr Gln Ala
Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro 115 120 125Leu Lys Thr
Gly Val Cys Gln Leu Asp Val Ala Asn Val Arg Asp Ala 130 135 140Ile
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr145 150
155 160Gln Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln
Ser 165 170 175Asn Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys
Ser Leu Thr 180 185 190Gln Ala Leu Pro Ser Glu Leu Lys Val Ser Ala
Asp Cys Val Ser Leu 195 200 205Thr Gly Ala Val Ser Leu Ala Ser Met
Leu Thr Glu Ile Phe Leu Leu 210 215 220Gln His Ala Gln Gly Met Pro
Glu Pro Gly Trp Gly Arg Ile Thr Asp225 230 235 240Ser His Gln Trp
Asn Thr Leu Leu Ser Leu His Asn Ala Val Phe Asp 245 250 255Leu Leu
Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu 260 265
270Leu Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln
275 280 285Ala Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala
Gly His 290 295 300Asp Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu
Leu Glu Trp Thr305 310 315 320Leu Pro Gly Gln Pro Asp Asn Thr Pro
Pro Gly Gly Glu Leu Val Phe 325 330 335Glu Arg Trp Arg Arg Leu Ser
Asp Asn Ser Gln Trp Ile Gln Val Ser 340 345 350Leu Val Phe Gln Thr
Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser 355 360 365Leu Asn Thr
Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu 370 375 380Glu
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile385 390
395 400Val Asn Glu Ala Arg Thr Pro Ala Cys Ser Leu 405
410391236DNAArtificial sequenceSynthetically generated 39atgcagagtg
agccggagct gaagctggaa agtgtggtga ttgtcagtcg tcatggtgtg 60cgtgctccaa
ccaaggccat gcaactgatg caggatgtca ccccagacgc atggccaacc
120tggccggtaa aactgggtga gctgacaccg cgcggtggtg agctaatcgc
ctatctcgga 180cattactggc gtcagcgtct ggtagccgac ggattgctgc
ctaaatgtgg ctgcccgcag 240tctggtcagg tcgcgattat tgctgatgtc
gacgagcgta cccgtaaaac aggcgaagcc 300ttcgccgccg ggctggcacc
tgactgtgca ataaccgtac atacccaggc agatacgtcc 360agtcccgatc
cgttatttaa tcctctaaaa actggcgttt gccaactgga tgtggcgaac
420gtgagacgtg cgatcctcga gagggcagga gggtcaattg ctgactttac
ccgccattat 480caaacggcgt ttcgcgaact ggaacgggtg cttaattttc
cgcaatcaaa cttgtgcctt 540aaacgtgaga aacaggacga aagctgttca
ttaacgcagg cattaccatc ggaactcaag 600gtgagcgccg acgatgtctc
attaaccggt gcggtaagcc tcgcatcaat gctgacggag 660atatttctcc
tgtggcatgc acagggaatg ccggagccgg ggtggggaag gatcaccgat
720tcacaccagt ggaacacctt gctaagtttg cataacgcgg tgtttgattt
gctacaacgc 780acgccagagg ttgcccgcag ccgcgccacc ccgttattag
atttgatcaa gacagcgttg 840acgccccatc caccgcaaaa acaggcgtat
ggtgtgacat tacccacttc agtgctgttt 900atcgccggac acgatactaa
tctggcaaat ctcggcggcg cactggagct cgaatggacg 960cttcccggtc
agccggataa cacgccgcca ggtggtgaac tggtgtttga acgctggcgt
1020cggctaagcg ataacagcca gtggattcag gtttcgctgg tcttccagac
tttacagcag 1080atgcgtgata aaacgccgct gtcattaaat acgccgcccg
gagaggtgaa actgaccctg 1140gcaggatgtg aagagcgaaa tgcgcagggc
atgtgttcgt tggcaggttt tacgcaaatc 1200gtgaatgaag cacgcatacc
ggcgtgcagt ttgtaa 123640411PRTArtificial sequenceSynthetically
generated 40Met Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile
Val Ser1 5 10 15Arg His Gly Val Arg Ala Pro Thr Lys Ala Met Gln Leu
Met Gln Asp 20 25 30Val Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys
Leu Gly Glu Leu 35 40 45Thr Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu
Gly His Tyr Trp Arg 50 55 60Gln Arg Leu Val Ala Asp Gly Leu Leu Pro
Lys Cys Gly Cys Pro Gln65 70 75 80Ser Gly Gln Val Ala Ile Ile Ala
Asp Val Asp Glu Arg Thr Arg Lys 85 90 95Thr Gly Glu Ala Phe Ala Ala
Gly Leu Ala Pro Asp Cys Ala Ile Thr 100 105 110Val His Thr Gln Ala
Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro 115 120 125Leu Lys Thr
Gly Val Cys Gln Leu Asp Val Ala Asn Val Arg Arg Ala 130 135 140Ile
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Arg His Tyr145 150
155 160Gln Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln
Ser 165 170 175Asn Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys
Ser Leu Thr 180 185 190Gln Ala Leu Pro Ser Glu Leu Lys Val Ser Ala
Asp Asp Val Ser Leu 195 200 205Thr Gly Ala Val Ser Leu Ala Ser Met
Leu Thr Glu Ile Phe Leu Leu 210 215 220Trp His Ala Gln Gly Met Pro
Glu Pro Gly Trp Gly Arg Ile Thr Asp225 230 235 240Ser His Gln Trp
Asn Thr Leu Leu Ser Leu His Asn Ala Val Phe Asp 245 250 255Leu Leu
Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu 260 265
270Leu Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln
275 280 285Ala Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala
Gly His 290 295 300Asp Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu
Leu Glu Trp Thr305 310 315 320Leu Pro Gly Gln Pro Asp Asn Thr Pro
Pro Gly Gly Glu Leu Val Phe 325 330 335Glu Arg Trp Arg Arg Leu Ser
Asp Asn Ser Gln Trp Ile Gln Val Ser 340 345 350Leu Val Phe Gln Thr
Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser 355 360 365Leu Asn Thr
Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu 370 375 380Glu
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile385 390
395 400Val Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410
* * * * *