U.S. patent number 7,399,617 [Application Number 11/276,522] was granted by the patent office on 2008-07-15 for method for producing an l-amino acid in an escherichia bacterium via altering expression levels of target proteins.
This patent grant is currently assigned to Ajinomoto Co., Inc.. Invention is credited to Vladimir Veniaminovich Aleshin, Vitaliy Arkadievich Livshits, Kazuo Nakanishi, Irina Lyvovna Tokhmakova, Petr Vladimirovich Troshin, Natalia Pavlovna Zakataeva.
United States Patent |
7,399,617 |
Livshits , et al. |
July 15, 2008 |
Method for producing an L-amino acid in an Escherichia bacterium
via altering expression levels of target proteins
Abstract
A bacterium belonging to the genus Escherichia which has an
ability to produce an L-amino acid, wherein the ability to produce
the L-amino acid is increased by increasing expression of an
L-amino acid excretion protein is described. A method for producing
the L-amino acid using the bacterium is also described.
Inventors: |
Livshits; Vitaliy Arkadievich
(Moscow, RU), Zakataeva; Natalia Pavlovna (Moscow,
RU), Nakanishi; Kazuo (Yokohama, JP),
Aleshin; Vladimir Veniaminovich (Moscow, RU),
Troshin; Petr Vladimirovich (Moscow, RU), Tokhmakova;
Irina Lyvovna (Moscow, RU) |
Assignee: |
Ajinomoto Co., Inc. (Tokyo,
JP)
|
Family
ID: |
26653994 |
Appl.
No.: |
11/276,522 |
Filed: |
March 3, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
11116286 |
Apr 28, 2005 |
|
|
|
|
09459573 |
Dec 27, 2005 |
6979560 |
|
|
|
Foreign Application Priority Data
|
|
|
|
|
Dec 30, 1998 [RU] |
|
|
98124016 |
Mar 9, 1999 [RU] |
|
|
99104431 |
|
Current U.S.
Class: |
435/106; 435/115;
435/110; 435/252.33; 435/440; 530/350; 536/23.1; 435/69.1;
435/320.1; 435/252.3; 435/116; 435/107 |
Current CPC
Class: |
C12P
13/10 (20130101); C12P 13/08 (20130101); C12P
13/24 (20130101); C07K 14/245 (20130101); C12P
13/04 (20130101); C12P 13/14 (20130101) |
Current International
Class: |
C12P
13/04 (20060101); C12P 13/06 (20060101); C12P
13/08 (20060101); C12P 13/14 (20060101); C12P
13/24 (20060101); C07H 21/00 (20060101); C07K
14/00 (20060101); C12N 1/21 (20060101); C12N
15/00 (20060101); C12P 21/00 (20060101) |
Field of
Search: |
;435/69.1,320.1,440,110,115,116,107,252.33,252.3 ;530/350
;536/23.1 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0 994 190 |
|
Apr 2000 |
|
EP |
|
WO97/23597 |
|
Jul 1997 |
|
WO |
|
Other References
Zhou et al., Cell Mol Life Sci 63(19-20):2260-2290. cited by
examiner .
Kozak, M., Gene 234:187-208, 1999. cited by examiner .
Aiba, H., et al., "Non-Ribosomal Proteins Affecting the Assembly of
Ribosomes in Escherichia coli," Database EMBL/Swissprot (Online)
ID: YFIK.sub.--Ecoli, Oct. 1, 1994. cited by other .
Alefounder, P. R., et al., "Identification, Molecular Cloning and
Sequence Analysis of a Gene Cluster Encoding the Class II Fructose
1,6-Bisphosphate Aldolase, 3-Phosphoglycerate Kinase and a Putative
Second Glyceraldehyde 3-Phosphate Dehydrogenase of Escherichia
coli," Database EMBL/Swissprot (Online) ID: YGGA.sub.--Ecoli, Oct.
1, 1989. cited by other .
Aleshin, et al., Trends Biochem. Sci. 1999;24(4):133-135. cited by
other .
Blattner, F.R., et al., "The Complete Genome Sequence of
Escherichia coli K-12," Science 1997;277:1-8, Acc. AE000344,
Definition=Escherichia coli K-12 MG1655 section 234 of 400 of the
complete genome. cited by other .
Blattner, F.R., et al., "The Complete Genome Sequence of
Escherichia coli K-12," Science 1997;277:1-7, Acc. AE000375,
Definition=Escherichia coli K-12 MG1655 section 265 of 400 of the
complete genome. cited by other .
Blattner, F.R., et al., "The Complete Genome Sequence of
Escherichia coli K-12," Science 1997;277:1-9, Acc. AE000140,
Definition=Escherichia coli K-12 MG1655 section 30 of 400 of the
complete genome. cited by other .
Blattner, F.R., et al., "The Complete Genome Sequence of
Escherichia coli K-12," Science 1997;277:1-10, Acc. AE000274,
Definition=Escherichia coli K-12 MG1655 section 164 of 400 of the
complete genome. cited by other .
Blattner, F.R., et al., GenBank Accession No. P75693, Nov. 1, 1997.
cited by other .
Duncan, M., et al., "The Complete Genome Sequence of Eschrichia
coli K-12," Database EMBL/Swissprot (Online) ID: Yahn-Ecoli, Nov.
1, 1997. cited by other .
Itoh, T., et al., "A 460-.kappa.b DNA Sequence of the Escherichia
coli K-12 Genome Corresponding to the 40.1-50.0 Min Region on the
Linkage Map," Database EMBL/Swissprot (Online) ID:
YEAS.sub.--Ecoli, Jul. 15, 1998. cited by other .
"LysE," Pfam 7.0, Accession No. PF01810. cited by other .
Vrljic, M., et al., Mol. Microbiol. 1996;22(5):815-826. cited by
other .
Zakataeva, N. P., et al., "Characterization of a Pleiotropic
Mutation That Confers Upon Escherichia coli Cells Resistance to
High Concentrations of Homoserine and Threonine," FASEB Journal
1997;11(9):A935. cited by other .
Branden, C., et al., Introduction to Protein Structure, Garland
Publishing, Inc., New York, pp. 247, 1991. cited by other .
Current Protocols in Molecular Biology, Hybridization Analysis of
DNA Blots, pp. 2.10.8-2.10.11, 1993. cited by other .
Seffernick, J. L., et al., "Melamine Deaminase and Atrazine
Chlorohydrolase: 98 Percent Identical but Functionally Different,"
J. Bacteriol. 2001;183(8):2405-2410. cited by other .
Witkowski, A., et al., "Conversion of a .beta.-Ketoacyl Synthase to
a Malonyl Decarboxylase by Replacement of the Active-Site Cysteine
with Glutamine," Biochem. 1999;38:11643-11650. cited by other .
U.S. Appl. No. 09/137,695, filed Aug. 21, 1998, cited by other
.
U.S. Appl. No. 09/459,573, filed Dec. 13, 1999, Livshits et al.
cited by other .
U.S. Appl. No. 09/466,935, filed Dec. 20, 1999, Livshits et al.
cited by other .
U.S. Appl. No. 10/149,450, filed Jun. 27, 2002, Nakanishi et al.
cited by other .
Alefounder, P. R., et al., Accession: P11667 [GI: 140686],
Definition: Hypothetical 21.7 KD Protein in FBA/FDA 5'Region (ORF
5). Publication Date: Jul. 21, 1998. cited by other .
Blattner, F. R., et al., Accession: P76249 [GI: 3025145],
Definition: Hypothetical 23.2 KD Protein in GAPA-RND Intergenic
Region. Publication Date: Jul. 15, 1998. cited by other .
Cossart, P., et al., "Nucleotide sequence of the thrB gene of E.
coli, and its two adjacent regions; the thrAB and thrBC junctions,"
Nuc. Acids Res. 1981;9(2):339-347. cited by other .
Katinka, M., et al., "Nucleotide sequence of the thrA gene of
Escherichia coli," Proc. Natl. Acad. Sci. USA
1980;77(10):5730-5733. cited by other .
Nashimoto, H., Accession: P38101 [GI: 586624], Definition:
Hypothetical 21.2 KD Protein in SRMB-UNG Intergenic Region.
Publication Date: Dec. 18, 1998. cited by other .
Office Action [Notice of Reason for Rejection] from Japanese Patent
App. No. 11-373651 (Jul. 31, 2007) and English translation thereof.
cited by other .
U.S. Appl. No. 11/854,850, filed Sep. 13, 2007, Livshits et al.
cited by other .
U.S. Appl. No. 11/854,868, filed Sep. 13, 2007, Livshits et al.
cited by other.
|
Primary Examiner: Ramirez; Delia M
Attorney, Agent or Firm: Cermak; Shelly Guest Cermak Kenealy
& Vaidya LLP
Parent Case Text
This application claims the benefit as a divisional application
under 35 U.S.C. .sctn.120 to application Ser. No. 11/116,286, filed
Apr. 28, 2005, now abandoned which is a continuation of application
Ser. No. 09/459,573, filed Dec. 13, 1999 which is now U.S. Pat. No.
6,979,560, issued Dec. 27, 2005.
Claims
We claim:
1. A method for producing an L-amino acid selected from the group
consisting of L-glutamic acid, L-alanine, L-valine, L-isoleucine,
L-histidine and L-proline, comprising: I) cultivating in a culture
medium an Escherichia bacterium which has an ability to produce an
L-amino acid selected from the group consisting of L-glutamic acid,
L-alanine, L-valine, L-isoleucine, L-histidine and L-proline,
wherein said ability to produce the L-amino acid is increased by
increasing expression of a protein comprising the amino acid
sequence shown in SEQ ID NO: 12, wherein the expression is
increased relative to the expression of said protein in a wild-type
strain MG1655 or W3110 by increasing the copy number of the DNA
coding for said protein or by replacing the native promoter with a
stronger promoter for expression of the DNA coding for said
protein, and II) recovering the L-amino acid from the medium.
2. The method according to claim 1, wherein said L-amino acid is
L-glutamic acid.
3. The method according to claim 1, wherein said L-amino acid is
L-alanine.
4. The method according to claim 1, wherein said L-amino acid is
L-valine.
5. The method according to claim 1, wherein said L-amino acid is
L-histidine.
6. The method according to claim 1, wherein said L-amino acid is
L-proline.
7. The method according to claim 1, wherein said L-amino acid is
L-isoleucine.
8. The method according to claim 1, wherein the copy number of a
DNA coding for said protein in said bacterium is increased.
9. The method according to claim 8, wherein said DNA is located on
a multicopy vector.
10. The method according to claim 8, wherein said DNA is located on
a transposon.
Description
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to a method for producing an amino
acid. In particular, the present invention relates to an L-amino
acid-producing bacterium belonging to the genus Escherichia and a
method for producing L-amino acids using the bacterium, more
specifically, L-glutamic acid, L-lysine, L-threonine, L-alanine,
L-histidine, L-proline, L-arginine, L-valine, and L-isoleucine.
2. Brief Description of the Related Art
To improve production of L-amino acids by fermentation, strains
isolated from nature or artificial mutants thereof have been used.
For example, many artificial mutants which produce L-lysine are
known, and most of them are resistant to S-2-aminoethylcysteine
(AEC) and belong to the genus Brevibacterium, Corynebacterium,
Bacillus, or Escherichia. Also, various techniques have been
proposed to increase amino acid production, such as using a strain
which has been transformed with recombinant DNA (U.S. Pat. No.
4,278,765).
The reported techniques are largely based on enhancing an activity
of an enzyme involved in an amino acid biosynthetic pathway,
conversion of the enzyme to one that is desensitized in inhibition,
and the like (As to bacterium belonging the genus Escherichia, see
Japanese Patent Application Laid-Open No. 56-18596 (1981) and
International Publication No. WO 95/16042).
Alternatively, a bacterium belonging to the genus Corynebacterium
in which the L-lysine excretion gene lysE is enhanced is known, and
is an example of improving amino acid productivity by enhancing an
amino acid excretion protein. However, as to bacteria belonging to
the genus Escherichia, it is unknown whether an L-amino acid
excretion protein exists or not. Therefore, it is unknown whether
or not enhancing an L-amino acid excretion protein would be
effective for L-amino acid production when using a bacterium
belonging to the genus Escherichia.
Although the entire nucleotide sequence of E. coli strain K-12 has
been determined (Science, 277, 1453-1474 (1997)), there are a large
number of proteins for which their functions remain unknown.
SUMMARY OF THE INVENTION
An object of the present invention is to obtain a protein which
participates in excretion of an L-amino acid, and thereby provide a
strain which has improved L-amino acid productivity. Another object
of the present invention is to provide an improved method for
producing an L-amino acid by fermentation.
The inventors have conducted screening for a protein which
participates in excretion of an L-amino acid. As a result, the
present inventors have found that the yield of an L-amino acid
based on consumed sugar increases when a particular gene is
enhanced. On the basis of this finding, the present invention has
been completed.
Thus, the present invention provides a bacterium belonging to the
genus Escherichia (hereinafter "the bacterium of the present
invention") which has an ability to produce an L-amino acid,
wherein the ability to produce the L-amino acid increases by
increasing the expression of at least one protein selected from the
group consisting of:
(A) a protein comprising an amino acid sequence shown in SEQ ID NO:
10;
(B) a protein comprising an amino acid sequence of SEQ ID NO: 10,
and which includes deletion, substitution, insertion, addition, or
inversion of one or several amino acids in said amino acid
sequence, and which has an activity of increasing the ability of
the bacterium having the protein to produce the L-amino acid;
(C) a protein comprising an amino acid sequence shown in SEQ ID NO:
12;
(D) a protein comprising an amino acid sequence of SEQ ID NO: 12,
and which includes deletion, substitution, insertion, addition, or
inversion of one or several amino acids in said amino acid
sequence, and which has an activity of increasing the ability of
the bacterium having the protein to produce the L-amino acid;
(E) a protein comprising an amino acid sequence shown in SEQ ID NO:
14;
(F) a protein comprising an amino acid sequence of SEQ ID NO: 14,
and which includes deletion, substitution, insertion, addition, or
inversion of one or several amino acids in said amino acid
sequence, and which has an activity of increasing the ability of
the bacterium having the protein to produce the L-amino acid;
(G) a protein comprising an amino acid sequence shown in SEQ ID NO:
16; or
(H) a protein comprising an amino acid sequence of SEQ ID NO: 16,
and which includes deletion, substitution, insertion, addition, or
inversion of one or several amino acids in said amino acid
sequence, and which has an activity of increasing the ability of
the bacterium having the protein to produce the L-amino acid.
The bacterium of the present invention is preferably an
L-lysine-producing bacterium in which expression of at least one
protein selected from the group consisting of the proteins (A) to
(D), (G) and (H) is increased; an L-glutamic acid-producing
bacterium in which expression of at least one protein selected from
the group consisting of the proteins (A) to (H) is increased; an
L-alanine-producing bacterium in which expression of at least one
protein selected from the group consisting of the proteins (C) and
(D) is increased; an L-valine-producing bacterium in which
expression of at least one protein selected from the group
consisting of the proteins (C) and (D) is increased; an
L-histidine-producing bacterium in which expression of at least one
protein selected from the group consisting of said proteins (C) to
(F) is increased; an L-proline-producing bacterium in which
expression of at least one protein selected from the group
consisting of said proteins (A) to (F) is increased; an
L-threonine-producing bacterium in which expression of at least one
protein selected from the group consisting of said proteins (E) and
(F) is increased; an L-arginine-producing bacterium in which
expression of at least one protein selected from the group
consisting of said proteins (G) and (H) is increased; or an
L-isoleucine-producing bacterium in which expression of at least
one protein selected from the group consisting of said proteins (C)
and (D) is increased.
Preferably, in the bacterium of the present invention, the copy
number of a DNA coding for said protein is increased. The DNA is
preferably carried on a multicopy vector or on a transposon in the
cell.
The present invention also provides a method for producing an
L-amino acid comprising cultivating the bacterium of the present
invention in a culture medium, and recovering the L-amino acid from
the medium (hereinafter also referred to as "the method of the
present invention").
The method of the present invention is preferably an L-lysine
production method using an L-lysine-producing bacterium in which
expression of at least one protein selected from the group
consisting of the proteins (A) to (D), (G) and (H) is increased; an
L-glutamic acid production method using an L-glutamic
acid-producing bacterium in which expression of at least one
protein selected from the group consisting of the proteins (A) to
(H) is increased; an L-alanine production method using an
L-alanine-producing bacterium in which expression of at least one
protein selected from the group consisting of the proteins (C) and
(D) is increased; an L-valine production method using an
L-valine-producing bacterium in which expression of at least one
protein selected from the group consisting of the proteins (C) and
(D) is increased; an L-histidine production method using an
L-histidine-producing bacterium in which expression of at least one
protein selected from the group consisting of said proteins (C) to
(F) is increased; an L-proline production method using an
L-proline-producing bacterium in which expression of at least one
protein selected from the group consisting of said proteins (A) to
(F) is increased; an L-threonine production method using an
L-threonine-producing bacterium in which expression of at least one
protein selected from the group consisting of said proteins (E) and
(F) is increased; an L-arginine production method using an
L-arginine-producing bacterium in which expression of at least one
protein selected from the group consisting of said proteins (G) and
(H) is increased; or an L-isoleucine production method using an
L-isoleucine-producing bacterium in which expression of at least
one protein selected from the group consisting of said proteins (C)
and (D) is increased.
Preferably, in the method of the present invention, a copy number
of a DNA coding for said protein in the bacterium is increased. The
DNA is preferably carried on a multicopy vector or on a transposon
in the cell.
According to the present invention, an ability of a bacterium
belonging to the genus Escherichia to produce an L-amino acid is
increased. Also, a method for producing an L-amino acid is improved
by increasing the production rate of the L-amino acid.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention will be explained in detail below.
Hereinafter, an amino acid is of L-configuration unless otherwise
noted.
<1> BACTERIUM OF THE PRESENT INVENTION
The bacterium of the present invention is a bacterium belonging to
the genus Escherichia which has an ability to produce an amino
acid. The ability to produce the amino acid is increased by
increasing expression of a protein which has an activity of
increasing the ability to produce the amino acid of the bacterium,
or an activity of increasing resistance to an amino acid or amino
acid analogue. Hereinafter, the protein is referred to as "amino
acid excretion protein". However, the term does not mean that
function of the protein is limited to amino acid excretion.
Examples of the amino acid excretion protein include a protein
having an amino acid sequence shown in SEQ ID NO: 10, a protein
having an amino acid sequence shown in SEQ ID NO: 12, a protein
having an amino acid sequence shown in SEQ ID NO: 14, and a protein
having an amino acid sequence shown in SEQ ID NO: 16.
The amino acid excretion protein may be selective for a particular
amino acid. An amino acid excretion protein appropriate for each
amino acid can be determined by expressing the protein in an
Escherichia bacterium which has the ability to produce the amino
acid, and measuring the increased yield of the amino acid, or
measuring the increased minimum inhibition concentration (MIC) of
the amino acid or an amino acid analogue.
For example, for lysine, a protein having an amino acid sequence
shown in SEQ ID NO: 10, 12, or 16 is effective; for glutamic acid,
a protein having an amino acid sequence shown in SEQ ID NO: 10, 12,
14, or 16 is effective; for alanine, a protein having an amino acid
sequence shown in SEQ ID NO: 12 is effective; for valine, a protein
having an amino acid sequence shown in SEQ ID NO: 12 is effective;
for histidine, a protein having an amino acid sequence shown in SEQ
ID NO: 12 or 14; for proline, a protein having an amino acid
sequence shown in SEQ ID NO: 10, 12, or 14 is effective; for
threonine, a protein having an amino acid sequence shown in SEQ ID
NO: 14 is effective; for arginine, a protein having an amino acid
sequence shown in SEQ ID NO: 16 is effective; for isoleucine, a
protein having an amino acid sequence shown in SEQ ID NO: 12 is
effective.
The phrase "expression is increased" used herein usually means that
the expression amount is larger than that in a wild-type strain of
E. coli, such as the strains MG1655 or W3110. The phrase also means
that when a strain is modified by genetic engineering techniques or
the like, the expression amount is larger than that prior to the
modification. Expression of the amino acid excretion protein may be
determined directly by measuring the protein amount, or indirectly
by measuring the MIC of the amino acid or an amino acid analogue,
or measuring the amino acid productivity of the Escherichia
bacterium.
The method for increasing expression of the amino acid excretion
protein is exemplified by increasing a copy number of a DNA
encoding the amino acid excretion protein in the bacterium.
To increase the copy number in the cell, a DNA fragment coding for
the amino acid excretion protein may be ligated to a vector which
functions in the chosen Escherichia bacterium to produce a
recombinant DNA, which is introduced into a host to transform it.
The copy number of the gene coding for the amino acid excretion
protein (amino acid excretion protein gene) in the cell of the
transformant strain increases, thereby increasing the expression
amount of the amino acid excretion protein. The vector is
preferably a multicopy vector.
The increase of the copy number in the cell can be achieved by
allowing plural copies of the amino acid excretion protein gene to
exist on the chromosomal DNA of the host. The introduction of
plural copies of the amino acid excretion protein gene to the
chromosomal DNA of the Escherichia bacterium, may be achieved via
homologous recombination using a target sequence of which plural
copies exist on the chromosomal DNA. As said target sequence, a
repetitive DNA and an inverted repeat present in a terminal portion
of a transposable element may be used. Alternatively, as disclosed
in Japanese Patent Application Laid-Open No. 2-109985 (1990),
plural copies can be introduced to the chromosomal DNA by carrying
the amino acid excretion protein gene on a transposon and allowing
the transposon to be transposed, which is preferred. According to
any of the above-mentioned methods, the copy number of the amino
acid excretion protein gene in the transformant strain increases,
thereby increasing expression of the amino acid excretion
protein.
The multicopy vector is exemplified by plasmid vectors such as
pBR322, pMW118, pUC19, or the like, and phage vectors such as
.lamda.1059, .lamda.BF101, M13mp9, or the like. The transposon is
exemplified by Mu, Tn10, Tn5, or the like.
To introduce a DNA into an Escherichia bacterium, for example, the
method of D. M. Morrison (Methods in Enzymology 68, 326 (1979)), or
a method in which recipient bacterial cells are treated with
calcium chloride to increase permeability of DNA (Mandel, M. and
Higa, A., J. Mol. Biol., 53, 159 (1970)), and the like can be
used.
Besides the above-mentioned gene amplification, increasing
expression of the amino acid excretion protein can be also achieved
by replacing an expression regulatory sequence, such as a promoter
of the amino acid excretion protein gene, with stronger one (see
Japanese Patent Application Laid-Open No. 1-215280 (1989)). For
example, lac promoter, trp promoter, tac promoter, P.sub.R promoter
and P.sub.L promoter of lambda phage, and the like are known as a
strong promoters. Replacing the promoter enhances expression of the
amino acid excretion protein, thereby increasing expression of the
amino acid excretion protein. Enhancing the expression regulatory
sequence may be combined with increasing the copy number of the
amino acid excretion protein.
In the bacterium of the present invention, expression of plural
amino acid excretion proteins may be increased.
The amino acid excretion protein is encoded by genes which are
known as the yahN gene, yeaS gene, yfiK gene, and yggA gene. The
functions of these genes are unknown. Therefore, the DNA encoding
the amino acid excretion protein can be obtained by synthesizing
primers based on the known sequences (for example, the entire
nucleotide sequence of the chromosome of Escherichia coli strain
K-12 has been determined (Science, 277, 1453-1474 (1997))), and
amplifying by PCR using chromosomal DNA of an Escherichia bacterium
as a template. Also, the object DNA fragment can be selected by
hybridization from an Escherichia bacterium chromosomal DNA library
by preparing a probe based on the known sequences. Alternatively,
the DNA encoding the amino acid excretion protein may be
synthesized based on the known sequences. The nucleotide sequence
of the DNA encoding the amino acid excretion protein is exemplified
by those shown in SEQ ID NOs: 9, 11, 13, or 15.
Methods for preparation of a chromosomal DNA, preparation of a
chromosomal DNA library, hybridization, PCR, preparation of plasmid
DNA, digestion and ligation of DNA, transformation, selection of an
oligonucleotide as a primer, and the like may be performed by
ordinary methods well known to those skilled in the art. These
methods are described in Sambrook, J., Fritsch, E. F., and
Maniatis, T., "Molecular Cloning A Laboratory Manual, Second
Edition", Cold Spring Harbor Laboratory Press (1989) and the
like.
The amino acid excretion protein may include substitution,
deletion, insertion, addition, or inversion of one or several amino
acids at one or a plurality of positions, provided that the
activity of increasing the ability of the Escherichia bacterium
having the protein to produce the amino acid is not deteriorated.
The number intended by the term "several" may vary depending on the
position in the steric structure of the protein and the kind of
amino acid residue. This is because some amino acids such as
isoleucine and valine are highly similar, and interchanging such
amino acids does not largely affect the steric structure of the
protein.
The DNA which codes for substantially the same protein as the amino
acid excretion protein as described above, may be obtained, for
example, by modifying the nucleotide sequence, for example, by
means of site-directed mutagenesis so that one or more amino acid
residues at a specified site are substituted, deleted, inserted,
added, or inverted. The DNA modified as described above may be
obtained by a conventionally known mutation treatment. Such a
mutation treatment includes treating a DNA coding for the amino
acid excretion protein in vitro, for example, with hydroxylamine,
and treating a microorganism, for example, a bacterium belonging to
the genus Escherichia, harboring a DNA coding for the amino acid
excretion protein with ultraviolet irradiation or a mutating agent,
such as N-methyl-N'-nitro-N-nitrosoguanidine (NG) and nitrous acid,
which are usually used for mutation treatments.
The substitution, deletion, insertion, addition, or inversion of
one or more amino acid residues includes a naturally-occurring
mutation or variation which results from differences between
individual microorganisms having the amino acid excretion protein,
and differences between species, strains, or the like.
The DNA which codes for substantially the same protein as the amino
acid excretion protein can be obtained by allowing a DNA having the
mutation as described above to be expressed in an appropriate
Escherichia bacterium, and investigating the increase of amino acid
productivity of the cell.
Also, the DNA which codes for substantially the same protein as the
amino acid excretion protein can be obtained by isolating a DNA
which hybridizes with, for example, a nucleotide sequence shown in
SEQ ID NO: 9, 11, 13, or 15 under stringent conditions, and which
DNA codes for a protein having the activity of increasing the
ability of the bacterium belonging to the genus Escherichia to
produce the amino acid, from DNAs encoding the amino acid excretion
proteins having mutations or cells containing the DNAs. The term
"stringent conditions" referred to herein means conditions under
which a specific hybrid is formed, and a non-specific hybrid is not
formed. It is difficult to clearly express this condition by using
any numerical value. However, for example, the stringent conditions
include conditions under which DNAs having high homology, for
example, DNAs having homology of not less than 70% with each other
are hybridized, and DNAs having homology with each other lower than
the above are not hybridized, or conditions comprising washing in a
salt concentration corresponding to 60.degree. C., 1.times.SSC,
0.1% SDS, preferably 0.1.times.SSC, 0.1% SDS, which is ordinary
washing conditions for Southern hybridization.
Although there may be a gene in which a stop codon is located in
the middle, or a gene encoding a protein which has lost activity
due to mutation of the active center among the genes which
hybridize under such the condition, such genes can be easily
eliminated by ligating the genes to a commercially available
activity-expression vector and determining the activity of the
bacterium belonging to the genus Escherichia to increase the
ability to produce the amino acid as described above.
The term "DNA coding for a protein" used herein means a DNA of
which one of strands codes for the protein when the DNA is
double-stranded.
By increasing expression of an amino acid excretion protein in an
amino acid-producing Escherichia bacterium as described above, the
amount of the amino acid produced can be increased. As the
Escherichia bacterium which has increased expression of the amino
acid excretion protein, strains which have abilities to produce
desired amino acids (amino acid productivities) are used. Besides,
an ability to produce an amino acid may be imparted to a bacterium
in which expression of the amino acid excretion protein is
increased. Examples of amino acid-producing bacteria belonging to
the genus Escherichia include E. coli AJ13199 (FR patent No.
2747689), and those obtainable from known materials (e.g., E. coli
W3110 (tyrA)/pCABD2, E. coli VL614, E. coli VL2054, E. coli VL2160,
E. coli VL2151, E. coli W3350 argE::Tn10/pKA10 as described in the
Examples below).
For reference, the amino acid excretion protein according to the
present invention was identified for the first time as described
below.
The present inventors have identified rhtB and rhtC as threonine
excretion protein genes of a bacterium belonging to the genus
Escherichia. The present inventors searched databases based on a
hypothesis that amino acid excretion proteins may share a common
structure. Namely, BLAST and PSI-BLAST search (Altschul, S. F. et
al., Nucleic Acids Res., 25, 3389-3402 (1997)) for homology of a
protein encoded by rhtB was performed in GenBank CDS, PDB,
SWISS-PROT, Spupdate, and PIR. Tblastn search was performed in
unfinished microbial genomes. BLITZ search (Sturrock, S. S., and
Collins, J. F., Mpsch version 1.3. Biocomputing research unit
University of Edinburgh, UK (1993)) was performed in SWALL
database. SMART search (Ogiwara, I. et al., Protein Sci., 5,
1991-1999 (1996)) was performed in the databases of translations
and SWISS-PROT. From the samples of more than 60 sequences found,
YeaS (corresponding to f212 of ACCESSION No. AE000274 in GenBank),
YahN (corresponding to f223 of ACCESSION No. AE000140 in GenBank),
YfiK (corresponding to o195 of ACCESSION No. AE000344 in GenBank)
and YggA (corresponding to f211 of ACCESSION No. AE000375 in
GenBank) remained among those originating from E. coli as proteins
which may have similar function to RhtB. Since the function of any
of these genes was unknown, the genes were actually obtained, and
effects thereof on MIC of amino acids and amino acid analogues and
on amino acid production were examined by enhancing the activities
thereof. As a result, an effect of increasing MIC of some amino
acids and analogues was found with respect to YeaS, YfiK, YahN and
YggA. Further examination has revealed that proteins encoded by
these genes exhibit an effect of increasing accumulation of an
amino acid, although they may have some amino acid
selectivities.
<2> METHOD OF THE PRESENT INVENTION
The method of the present invention includes the steps of
cultivating the bacterium of the present invention in a culture
medium to produce and accumulate the amino acid in the medium, and
recovering the amino acid from the medium.
Suitable amino acids include lysine, glutamic acid, alanine,
valine, histidine, proline, threonine, arginine, and
isoleucine.
In the method of present invention, the cultivation of the
Escherichia bacterium, and the collection and purification of an
amino acid from the liquid medium may be performed in a manner
similar to conventional methods for producing an amino acid by
fermentation using a bacterium. A medium used in cultivation may be
either a synthetic medium or a natural medium, so long as the
medium includes a carbon and a nitrogen source and minerals and, if
necessary, nutrients which the chosen bacterium requires for growth
in appropriate amounts. The carbon source may include various
carbohydrates such as glucose and sucrose, and various organic
acids. Depending on the assimilatory ability of the chosen
bacterium, alcohols including ethanol and glycerol may be used. As
the nitrogen source, ammonia, various ammonium salts such as
ammonium sulfate, other nitrogen compounds such as amines, a
natural nitrogen source such as peptone, soybean hydrolyte and
digested fermentative microbe are used. As minerals, monopotassium
phosphate, magnesium sulfate, sodium chloride, ferrous sulfate,
manganese sulfate, and calcium carbonate are used.
The cultivation is preferably under aerobic conditions such as by
shaking, aeration, and/or stirring. The temperature of the culture
is usually 20 to 40.degree. C., preferably 30 to 38.degree. C. The
pH of the culture is usually between 5 and 9, preferably between
6.5 and 7.2. The pH of the culture can be adjusted with ammonia,
calcium carbonate, various acids, various bases, and buffers.
Usually, a 1 to 3-day cultivation leads to the accumulation of the
target amino acid in the medium.
Recovering the amino acid can be performed by removing solids such
as cells from the medium by centrifugation or membrane filtration
after cultivation, and then collecting and purifying the target
amino acid by ion exchange, concentration, crystalline fraction
methods, and the like.
EXAMPLES
The present invention will be more concretely explained below with
reference to the following non-limiting Examples.
Example 1
Preparation of the DNA Fragments which Code for Amino Acid
Excretion Proteins
The entire nucleotide sequence of the chromosome of E. coli strain
K-12 has been determined (Science, 277, 1453-1474, 1997). Based on
the reported nucleotide sequence, primers were synthesized and the
genes yahN, yfiK, yeaS and yggA were amplified by PCR.
(1). Chromosomal DNA of the E. coli Strain MG1655 was used as a
Template.
The chromosomal DNA was prepared by an ordinary method (Sambrook,
J., Fritsch E. F. and Maniatis T. (1989) Molecular cloning: a
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y.). In the PCR reaction, a standard
condition described in "PCR protocols. Current methods and
applications". (White, B. A., ed. Humana Press, Totowa, N.J., 1993)
was used. The obtained PCR products were purified by an ordinary
method and digested with restriction enzymes as described
below.
The yahN gene was amplified by using primers No.1 and No.2.
Primer No.1: gtgtggaaccgacgccggat (a sequence complementary to a
sequence from nucleotide numbers 1885 to 1904 in the nucleotide
sequence registered under ACCESSION No. AE000140 in GenBank; SEQ ID
NO: 17), and
Primer No.2: tgttgtatggtacggggttcgag (a sequence from nucleotide
numbers 223 to 245 in the same; SEQ ID NO: 18).
The obtained PCR product after purification was digested with
restriction enzymes PstI and StuI and ligated to vector pUC21
(Vieira, Messing, Gene, 100, 189-194, 1991), and digested with the
enzymes PstI and EcoRV by using a ligation kit. Then,
transformation of competent cells of E. coli TG1 (Sambrook, J.,
Fritsch E. F. and Maniatis T. (1989) Molecular cloning: a
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y.) with the product was conducted and the
cells were spread on L medium (10 .mu.l Bacto trypton, 5 g/l Yeast
extract, 5 g/l NaCl, 15 g/l agar, pH 7.0) containing 10 .mu.g/ml
IPTG (isopropyl-.beta.-D-thiogalactopyranoside) and 40 .mu.g/ml
X-gal (5-bromo-4-chloro-3-indolyl-.beta.-D-galactoside) and 100
.mu.g/ml ampicillin, and cultured overnight. White colonies which
appeared were picked up and subjected to single colony isolation to
obtain transformants. A plasmid was prepared from the transformants
using an alkali extraction method and designated as pYAHN.
The yeaS gene was amplified by using primers No.3 and No.4.
Primer No.3: ctttgccaatcccgtctccc (a sequence complementary to a
sequence from nucleotide numbers 7683 to 7702 in a nucleotide
sequence registered under ACCESSION No AE000274 in GenBank; SEQ ID
NO: 19);
Primer No.4: gccccatgcataacggaaag (a sequence from nucleotide
numbers 5542 to 5561 in the same; SEQ ID NO: 20).
The obtained PCR product after purification was digested with a
restriction enzyme AvaI and ligated to vector pUC19. After
transformation of E. coli TG1 as above, a plasmid was obtained and
designated pYEAS.
The yfiK gene was amplified by using primers No.5 and No.6.
Primer No.5: gaagatcttgtaggccggataaggcg (a sequence from nucleotide
numbers 4155 to 4177 in a nucleotide sequence registered under
ACCESSION No AE000344 in GenBank, with a restriction enzyme BglII
site added at the 5'-end thereof; SEQ ID NO: 21)
Primer No.6: tggttttaccaattggccgc (a sequence complementary to a
sequence from nucleotide numbers 6307 base to 6326 in the same; SEQ
ID NO: 22).
The PCR product obtained after purification was digested with
restriction enzymes BglII and MunI and ligated to vector pUC21
digested with restriction enzymes BglII and EcoRI. After
transformation of E. coli TG1 as above, the plasmid designated
pYFIK was obtained.
The yggA gene was amplified by using primers No.7 and No.8.
Primer No.7: acttctcccgcgagccagttc (a sequence complementary to a
sequence from nucleotide numbers 9606 to 9626 in a nucleotide
sequence registered under ACCESSION No AE000375 in GenBank; SEQ ID
NO: 23).
Primer No.8: ggcaagcttagcgcctctgtt (a sequence from nucleotide
numbers 8478 to 8498 in the same; SEQ ID NO: 24).
The PCR product obtained after purification was digested with
restriction enzymes HindIII and ClaI and ligated to vector pOK12
(Vieira, Messing, Gene, 100, 189-194, 1991) digested with the same
restriction enzymes. After transformation of E. coli TG1 as above,
a plasmid was obtained and designated pYGGA.
(2). Chromosomal DNA of the E. coli Strain W3110 was used as a
Template.
The yahN gene was amplified by using primers No.9 (SEQ ID NO 1) and
No. 10 (SEQ ID NO.2)
The yeaS gene was amplified by using primers No.11 (SEQ ID NO 3)
and No.12 (SEQ ID NO 4)
The yfiK gene was amplified by using primers No.13 (SEQ ID NO 5)
and No.14 (SEQ ID NO 6).
The yggA gene was amplified by using primers No.15 (SEQ ID NO 7)
and No.16 (SEQ ID NO 8)
The obtained PCR product was purified, digested with restriction
enzymes SacI and XbaI (EcoRI and PstI for yggA), and ligated to
plasmid pMW118 (Nippon Gene). The plasmid into which a DNA fragment
with an identical sequence to the reported sequence was inserted
was designated as follows:
Plasmid carrying yahN: pMW118::yahN
Plasmid carrying yeaS: pMW118::yeaS Plasmid carrying yfiK:
pMW118::yfiK
Plasmid carrying yggA: pMW118::yggA
Example 2
Effect of Amplification of the yahN, yeaS, yfiK, and yggA DNA
Fragments on the E. coli TG1 Resistance to Some Amino Acids and
Amino Acid Analogues
The homology of the yeaS, yfiK, yahN, and yggA gene products with
the lysine transporter, LysE, of Corynebacterium glutamicum (Vrljic
et al., Mol. Microbiol., 22, 815-826, 1996) and RhtB protein
involved in homoserine excretion, indicates functional analogues
for these proteins. It is well known that the increased expression
of genes involved in antibiotic and heavy metal efflux increases
the level of resistance to the drugs (Nikaido, H. J. Bacteriology,
178, 5853-5859, 1996). Therefore, the effect of the pYEAS, pYAHN,
pYFIK, and pYGGA plasmids on susceptibility of the strain TG1 to
some amino acids and amino acid analogues was tested. Overnight
cultures of the E. coli strains TG1/pYEAS, TG1/pYAHN, TG1/pYFIK,
TG1/pYGGA and of the control strains TG1/pUC21, TG1/pUC19 and
TG1/pOK12 grown in M9 minimal medium with an appropriate antibiotic
on a rotary shaker (10.sup.9 cfu/ml) were diluted 1:100 in M9
minimal medium and grown for 5 h in the same medium. Then the log
phase cultures thus obtained were diluted and about 10.sup.4 live
cells were applied to well-dried test plates with M9 agar
containing doubling increments of amino acids or analogues. Thus,
the minimum inhibition concentration (MIC) of these compounds was
examined.
The results are shown in Table 1. It follows from the Table 1 that
multiple copies of the yfiK gene conferred increased resistance to
proline, homoserine, histidine, threonine, glutamate, lysine,
.alpha.-amino-.beta.-hydroxyvaleric-acid (AHVA),
S-(2-aminoethyl)-L-cysteine (AEC), and .alpha.-aminobutyric acid;
multiple copies of yahN gene conferred increased resistance to
proline, multiple copies of the yeaS gene conferred increased
resistance to threonine, homoserine, lysine, glutamate, histidine,
proline, and .alpha.-aminobutyric acid; multiple copies of yggA
gene conferred increased resistance to S-(2-aminoethyl)-L-cysteine
(AEC), lysine, and arginine. These results indicate that except for
YahN, all of the presumed transporters have specificity to several
substrates (amino acids and amino acid analogues), or may show
non-specific effects as a result of amplification.
TABLE-US-00001 TABLE 1 MIC (.mu.g/ml) for E. coli TG1, harboring
the plasmid Substrate pUC21 pYFIK pYAHN pYEAS pYGGA L-homoserine
500 1000 500 1000 500 L-threonine 30000 40000 30000 50000 30000
L-lysine 5000 7500 5000 7500 15000 L-glutamate (Na salt) 5000 10000
5000 20000 5000 L-histidine 5000 10000 5000 30000 5000 L-valine 0.5
0.5 0.5 0.5 0.5 L-proline 1000 5000 2000 2000 1000 L-arginine 10000
10000 10000 10000 20000 AHVA 100 200 100 100 100 AEC 5 10 5 5 200
.alpha.-aminobutyric acid 2500 5000 2500 >10000 2500
4-aza-DL-leucine 100 100 100 100 100
Example 3
Effect of Amplification of the yeaS, yahN, and yfiK DNA Fragments
on Glutamic Acid Production
The E. coli strain AJ13199 (FR patent No. 2747689) was transformed
with the vector pUC21 and each of the plasmids pYAHN, pYEAS and
pYFIK. Thus the strains AJ13199/pUC21 (VKPM B-7728), AJ13199/pYAHN
(VKPM B-7729), AJ13199/pYEAS (VKPM B-7731), and AJ13199/pYFIK (VKPM
B-7730) were obtained.
These strains were each cultivated at 37.degree. C. for 18 hours in
a nutrient broth with 100 mg/l ampicillin, and 0.3 ml of the
obtained culture was inoculated into 3 ml of a fermentation medium
containing 100 mg/l ampicillin, in a 20.times.200 mm test tube, and
cultivated at 37.degree. C. for 48 hours on a rotary shaker. After
the cultivation, the amount of glutamic acid which had accumulated
in the medium was determined by a known method.
The composition of the fermentation medium (g/l):
TABLE-US-00002 Glucose 80 (NH.sub.4).sub.2SO.sub.4 22
K.sub.2HPO.sub.4 2 NaCl 0.8 MgSO.sub.4.cndot.7H.sub.2O 0.8
FeSO.sub.4.cndot.7H.sub.2O 0.02 MnSO.sub.4.cndot.5H.sub.2O 0.02
Thiamine HCl 0.0002 Yeast extract 1.0 CaCO.sub.3 30.0
(dry-heat-sterilized at 180.degree. C. for 2 h) (Glucose and
K.sub.2HPO.sub.4 separately sterilized)
The results are shown in Table 2. As shown in Table 2, the strains
AJ13199/pYAHN, AJ13199/pYEAS, and AJ13199/pYFIK yielded glutamic
acid in a larger amount than the strain AJ13199/pUC21, in which
expression of amino acid excretion proteins was not enhanced.
TABLE-US-00003 TABLE 2 Strain Glutamic acid, g/l AJ13199/pUC21 21.9
AJ13199/pYAHN 27.9 AJ13199/pYEAS 29.7 AJ13199/pYFIK 28.4
Example 4
Effect of Amplification of yeaS, yahN, and yfiK DNA Fragments on
Lysine Production
(1) As the lysine-producing bacterium belonging to the genus
Escherichia, E. coli strain W3110 (TyrA) described in European
Patent Publication No. 488424, and which contains plasmid pCABD2,
described in International Publication No. WO 95/16042, was used.
Specifically, plasmid pCABD2, and each of the plasmid pMW118::yahN,
pMW118::yeaS, pMW118::yfiK and pMW118 were introduced into E. coli
strain W3110 (TyrA) to obtain the following strains:
W3110 (tyrA)/pCABD2+pMW118::yahN
W3110 (tyrA)/pCABD2+pMW118::yeaS
W3110 (tyrA)/pCABD2+pMW118::yfik
W3110 (tyrA)/pCABD2+pMW118.
Lysine productivity of these strains was estimated by culturing.
The composition of the medium was as follows (g/l):
TABLE-US-00004 Glucose 40.0 MgSO.sub.4.cndot.7H.sub.2O 1.0
(NH.sub.4).sub.2SO.sub.4 16.0 K.sub.2HPO.sub.4 1.0
FeSO.sub.4.cndot.7H.sub.2O 0.01 MnSO.sub.4.cndot.7H.sub.2O 0.01
Yeast extract (Difco) 2.0 Tyrosine 0.1
Adjusted to pH 7.0 and autoclaved at 115.degree. C. for 10 minutes.
(Glucose and MgSO.sub.4.7H.sub.2O separately sterilized)
TABLE-US-00005 Pharmacopeial CaCO.sub.3 25 g/l (dry-heat-sterilized
at 180.degree. C. for 2 h)
As antibiotics, 20 mg/l of streptomycin and 50 mg/l of ampicillin
were added depending on the plasmid. Cultivation was conducted at
37.degree. C. for 30 hours with agitation at 115 rpm. The results
are shown in Table 3.
TABLE-US-00006 TABLE 3 Lysine, Strain g/l Yield, (%) W3110(tyrA)
0.08 0.2 W3110(tyrA)/pCABD2 + pMW118 12.2 30.5 W3110(tyrA)/pCABD2 +
pMW118::yahN 13.8 34.5 W3110(tyrA)/pCABD2 + pMW118::yeaS 12.7 31.8
W3110(tyrA)/pCABD2 + pMW118::yfiK 12.2 30.5
Table 3 shows that the amount produced and the yield based on
consumed sugar of lysine is increased by enhancing YahN and
YeaS.
(2) As the lysine-producing bacterium belonging to the genus
Escherichia, E. coli strain VL614 was used. This strain is a
derivative of the known E. coli strain VL613 (SU Patent No.
1354458). In turn, the strain VL613 was obtained from the known
strain Gif102 (Theze, J. and Saint Girons. J. Bacteriol., 118,
990-998, 1974) in the three steps:
In the first step, the mutants resistant to 2 mg/ml
S-(2-aminoethyl)-L-cysteine were selected, and among them strain
VL611 was found able to produce L-lysine.
In the second step, the genes involved in sucrose utilization and
located on the transposon Tn2555 (Doroshenko et al., Mol.
Biologiya, 22, 645-658, 1988), were introduced into VL611 using
phage P1-mediated transduction giving the strain VL612.
In the third step, the mutation rhtA23 from the strain VKPM B-3996,
conferring resistance to threonine and homoserine (U.S. Pat. No.
5,175,107) was introduced into VL612 by phage P1 transduction
giving the strain VL613.
The E. coli strain VL614 was obtained by transduction of the
wild-type allele of the rhtA gene from the E. coli strain VKPM
B-6204 (MG1655 zbi3058::Tn10) to VL613. Transductants were selected
on L-medium containing 10 mg/l tetracyclin, and among them the
strain VL614 (rhtA.sup.+) sensitive to 10 .mu.l homoserine was
found.
The strain VL614 was transformed with the pYGGA plasmid or with the
pOK12 vector to obtain strains VL614/pYGGA (VKPM B-7719) and
VL614/pOK12 (VKPM B-7722).
These strains were each cultivated at 37.degree. C. for 18 hours in
a nutrient broth with 50 mg/l kanamycin, and 0.3 ml of the obtained
culture was inoculated into 3 ml of a fermentation medium (Example
3) containing 0.3 .mu.l threonine, 0.3 .mu.l methionine and 50 mg/l
kanamycin, in a 20.times.200 mm test tube, and cultivated at
37.degree. C. for 48 hours on a rotary shaker. After the
cultivation, the amount of lysine and glutamate which accumulated
in the medium was each determined by a known method.
The results are shown in Table 4.
TABLE-US-00007 TABLE 4 Strain Lysine, g/l Glutamate, g/l
VL614/pOK12 2.6 0.8 VL614/pYGGA 3.6 2.2
As shown in Table 4, the strain VL614/pYGGA yielded lysine in a
larger amount than the strain VL614/pOK12, in which the yggA gene
was not enhanced. Besides, the strain VL614/pYGGA yielded more
glutamic acid than the strain VL614/pOK12.
Example 5
Effect of Amplification of yeaS, yahN, and yfiK DNA Fragments on
Threonine, Alanine, Valine, and Isoleucine Production
As the threonine-producing bacterium belonging to the genus
Escherichia, the E. coli strain VL2054 was used. This strain was
derived from the known E. coli strain VKPM B-3996 (U.S. Pat. No.
5,175,107) as follows.
Initially, a new recipient strain was constructed in several steps:
The plasmidless derivative of the strain VKPM B-3996 was selected
after spontaneous elimination of pVIC40 plasmid. The wild-type
allele of the rhtA gene from the E. coli strain VKPM B-6204 (MG1655
zbi3058::Tn10) was introduced into the thus obtained strain by
phage P1 mediated transduction as in the Example 4. A mutation
inactivating kan gene of the Tn5 transposon inserted into the tdh
gene was obtained after NG mutagenesis and selection of
kanamycin-sensitive cells still unable to degrade threonine. Thus
the strain VL2053 was obtained.
On the other hand, the threonine operon from pVIC40 was cloned into
integrative Mud vector under the P.sub.R promoter of the phage
lambda. In addition, the cat gene of Tn9 conferring the resistance
to chloramphenicol was cloned into the same vector. The construct
thus obtained was inserted into the chromosome of the E. coli
strain C600 by use of a known method (U.S. Pat. No. 5,595,889) and
transduced from the thus obtained strain to VL2053, giving the new
plasmidless threonine-producing strain VL2054. This strain was able
to yield alanine, valine and isoleucine in the culture broth.
The strain VL2054 was transformed with each of the plasmids pYEAS,
pYFIK, and with the vector pUC21 to obtain E. coli strains
VL2054/pYEAS (VKPM B-7707), VL2054/pYFIK (VKPM B-7712), and
VL2054/pUC21 (VKPM B-7708).
These strains were each cultivated at 37.degree. C. for 18 hours in
a nutrient broth with 100 mg/l ampicillin, and 0.3 ml of the
obtained culture was inoculated into 3 ml of a fermentation medium
(Example 3) containing 100 mg/l ampicillin, in a 20.times.200 mm
test tube, and cultivated at 37.degree. C. for 48 hours with a
rotary shaker. After the cultivation, threonine, alanine, valine
and isoleucine each accumulated in the medium, and the amount of
each was determined by a known method.
The results are shown in Table 5.
As shown in Table 5, the strain VL2054/pYFIK yielded threonine in a
larger amount than the strain VL2054/pUC21 in which the yfiK gene
was not enhanced. Besides, the strain VL2054/pYEAS yielded more
alanine, valine, and isoleucine than the strain VL2054/pUC21, in
which the yeaS gene was not enhanced.
TABLE-US-00008 TABLE 5 Amino acid accumulation, g/l Strain
Threonine Alanine Valine Isoleucine VL2054/pUC21 5.8 0.4 0.31 0.15
VL2054/pYEAS 5.2 1.4 0.52 0.45 VL2054/pYFIK 8.8 0.5 0.22 0.14
Example 6
Effect of Amplification of yeaS and yfiK DNA Fragments on Histidine
Production
As the histidine-producing bacterium belonging to the genus
Escherichia, the strain E. coli VL2160 was used. This strain was
obtained based on the known strain NK5526 hisG::Tn10 (VKPM B-3384)
by phage P1-mediated transduction of the hisG.sup.R mutation
desensitizing ATP-phosphoribosyltransferase from the strain CC46
(Astvatsaturianz et al., Genetika, 24, 1928-1934, 1988). The strain
E. coli VL2160 was transformed with each of the plasmids pYEAS,
pYFIK, and with the vectors pUC21 to obtain E. coli strains
VL2160/pYEAS (VKPM B-7753), E. coli VL2160/pYFIK (VKPM B-7754), E.
coli VL2160/pUC21 (VKPM B-7752).
These strains were each cultivated at 37.degree. C. for 18 hours in
a nutrient broth with 100 mg/l ampicillin, and 0.3 ml of the
obtained culture was inoculated into 3 ml of the fermentation
medium (Example 3) containing an increased amount of yeast extract
(3 g/l) and 100 mg/l ampicillin, in a 20.times.200 mm test tube,
and cultivated at 34.degree. C. for 68 hours on a rotary
shaker.
After the cultivation, the amount of histidine which had
accumulated in the medium was determined by a known method. The
results are shown in Table 6.
TABLE-US-00009 TABLE 6 Strain Histidine, g/l VL2160/pUC21 1.2
VL2160/pYEAS 1.8 VL2160/pYFIK 1.4
As shown in Table 6, the strains E. coli VL2160/pYEAS and E. coli
VL2160/pYFIK yielded histidine in a larger amount than the strain
E. coli VL2160/pUC21, in which the yeaS and yfiK genes were not
enhanced.
Example 7
Effect of Amplification of yahN, yfiK and yeaS DNA Fragments on
Proline Production
As the proline-producing bacterium belonging to the genus
Escherichia, the strain VL2151 (W3350 proB*.DELTA.putAP TN10) was
used. This strain was obtained by transduction into W3350 of
.DELTA.putAP mutation linked to Tn10 and selecting
tetracycline-resistant transductants unable to utilize proline as a
sole carbon source. The thus obtained strain W3350 .DELTA.putAP
Tn10 was mutagenized with NG and mutants resistant to 20 mg/l of
3,4-dehydro-DL-proline were selected. Among them the strain VL2151
(W3350 proB*.DELTA.putAP Tn10) was found able to produce
proline.
The strain E. coli VL2151 was transformed with each of the plasmids
pYEAS, pYFIK, pYAHN and with the vector pUC21 to obtain E. coli
strains VL2151/pYEAS (VKPM B-7714), VL2151/pYFIK (VKPM B-7713),
VL2151/pYAHN (VKPM B-7748) and E. coli VL2151/pUC21 (VKPM
B-7715).
These strains were each cultivated at 37.degree. C. for 18 hours in
a nutrient broth with 100 mg/l ampicillin, and 0.3 ml of the
obtained culture was inoculated into 3 ml of a fermentation medium
(Example 3) containing 100 mg/l ampicillin, in a 20.times.200 mm
test tube, and cultivated at 37.degree. C. for 48 hours on a rotary
shaker. After the cultivation, the amount of proline which had
accumulated in the medium was determined by a known method. The
results are shown in Table 7.
TABLE-US-00010 TABLE 7 Strain Proline, g/l VL2151/pUC21 1.8
VL2151/pYAHN 2.2 VL2151/pYEAS 2.1 VL2151/pYFIK 2.5
As shown in Table 7, the strains E. coli VL2151/pYFIK, E. coli
VL2151/pYAHN and E. coli VL2151/pYEAS yielded proline in a larger
amount than the strain E. coli VL2151/pUC21, in which the yfiK,
yahN and yeaS genes were not enhanced. The amplification of the
yfiK gene had the most pronounced effect.
Example 8
Effect of Amplification of yggA DNA Fragments on Arginine
Production
As arginine-producing bacterium belonging to the genus Escherichia,
the strain W3350 argE::Tn10/pKA10 was used. This strain harbors a
plasmid, pKA10, which contains a DNA region from Corynebacterium
(Brevibacterium) flavum which complements at least argA and argE
mutations in the recipient strain of E. coli K-12 (Kharitonov A.
and Tarasov A. P. Molecular Genetics, Microbiology and Virology.
No.9, 29-33, 1986).
The strain E. coli W3350 argE::Tn10/pKA10 was transformed with the
plasmid pYGGA, or with the vector pOK12 to obtain the strains E.
coli W3350 argE::Tn10/pKA10, pYGGA (VKPM B-7716) and E. coli W3350
argE::Tn10/pKA10, pOK12 (VKPM B-7718).
The thus obtained transformants were each cultivated at 37.degree.
C. for 18 hours in a nutrient broth with 100 mg/l ampicillin and 50
mg/l kanamycin, and 0.3 ml of the obtained culture was inoculated
into 3 ml of a fermentation medium (Example 3) containing 100 mg/l
ampicillin and 50 mg/l kanamycin, in a 20.times.200 mm test tube,
and cultivated at 37.degree. C. for 48 hours on a rotary shaker.
After the cultivation, the amount of arginine which had accumulated
in the medium was determined by a known method.
The results are shown in Table 8.
TABLE-US-00011 TABLE 8 Strain Arginine, g/l W3350 argE::Tn10/pKA10,
pOK12 0.11 W3350 argE::Tn10/pKA10, pYGGA 0.46
As shown in Table 8, the strains E. coli W3350 argE::Tn10/pKA10,
pYGGA yielded arginine in a larger amount than the strain E. coli
W3350 argE::Tn10/pKA10, pUC21 in which the yggA gene was not
enhanced.
The following E. coli strains have been deposited according to the
Budapest Treaty in the Russian National Collection of Industrial
Microorganisms (VKPM) on Dec. 29, 1998 under the accession numbers
shown in parenthesis.
AJ13199/pUC21 VKPM B-7728)
AJ13199/pYAHN (VKPM B-7729)
AJ13199/pYEAS (VKPM B-7731)
AJ13199/pYFIK (VKPM B-7730)
VL614/pYGGA (VKPM B-7719)
VL614/pOK12 (VKPM B-7722)
VL2054/pYEAS (VKPM B-7707)
VL2054/pYFIK (VKPM B-7712)
VL2054/pUC21 (VKPM B-7708)
VL2160/pYEAS (VKPM B-7753)
VL2160/pYFIK (VKPM B-7754)
VL2160/pUC21 (VKPM B-7752)
VL2151/pYFIK (VKPM B-7713)
VL2151/pYEAS (VKPM B-7714)
VL2151/pYAHN (VKPM B-7748)
VL2151/pUC21 (VKPM B-7715)
W3350 argE::Tn10/pKA10, pYGGA (VKPM B-7716)
W3350 argE::Tn10/pKA10, pOK12 (VKPM B-7718)
While the invention has been described in detail with reference to
preferred embodiments thereof, it will be apparent to one skilled
in the art that various changes can be made, and equivalents
employed, without departing from the scope of the invention. Each
of the aforementioned documents, including the foreign priority
document, is incorporated by reference herein in its entirety.
SEQUENCE LISTINGS
1
24127DNAArtificial Sequencemisc_featureDescription of Artificial
Sequence synthetic DNA 1ggcgagctcc cagtaaccgg aaataag
27227DNAArtificial Sequencemisc_featureDescription of Artificial
Sequence synthetic DNA 2cgctctagaa aggaccacgc attacgg
27327DNAArtificial Sequencemisc_featureDescription of Artificial
Sequence synthetic DNA 3ggcgagctca gattggttag catattc
27427DNAArtificial Sequencemisc_featureDescription of Artificial
Sequence synthetic DNA 4cggtctagaa tcagcgaaga atcaggg
27527DNAArtificial Sequencemisc_featureDescription of Artificial
Sequence synthetic DNA 5ggcgagctca tgttccgtgt cgggtac
27627DNAArtificial Sequencemisc_featureDescription of Artificial
Sequence synthetic DNA 6ggctctagat agcaagttac taagcgg
27735DNAArtificial Sequencemisc_featureDescription of Artificial
Sequence synthetic DNA 7ctctgaattc tctcttatta gtttttctga ttgcc
35838DNAArtificial Sequencemisc_featureDescription of Artificial
Sequence synthetic DNA 8cgtgacctgc agcgttctca cagcgcggta gcctttaa
389672DNAEscherichia coliCDS(1)..(672) 9atg atg cag tta gtt cac tta
ttt atg gat gaa atc act atg gat cct 48Met Met Gln Leu Val His Leu
Phe Met Asp Glu Ile Thr Met Asp Pro1 5 10 15ttg cat gcc gtt tac ctg
acc gta gga ctg ttc gtg att act ttt ttt 96Leu His Ala Val Tyr Leu
Thr Val Gly Leu Phe Val Ile Thr Phe Phe 20 25 30aat ccg gga gcc aat
ctc ttt gtg gta gta caa acc agc ctg gct tcc 144Asn Pro Gly Ala Asn
Leu Phe Val Val Val Gln Thr Ser Leu Ala Ser 35 40 45ggt cga cgc gca
ggg gtg ctg acc ggg ctg ggc gtg gcg ctg ggc gat 192Gly Arg Arg Ala
Gly Val Leu Thr Gly Leu Gly Val Ala Leu Gly Asp 50 55 60gca ttt tat
tcc ggg ttg ggt ttg ttt ggt ctt gca acg cta att acg 240Ala Phe Tyr
Ser Gly Leu Gly Leu Phe Gly Leu Ala Thr Leu Ile Thr65 70 75 80cag
tgt gag gag att ttt tcg ctt atc aga atc gtc ggc ggc gct tat 288Gln
Cys Glu Glu Ile Phe Ser Leu Ile Arg Ile Val Gly Gly Ala Tyr 85 90
95ctc tta tgg ttt gcg tgg tgc agc atg cgc cgc cag tca aca ccg caa
336Leu Leu Trp Phe Ala Trp Cys Ser Met Arg Arg Gln Ser Thr Pro Gln
100 105 110atg agc aca cta caa caa ccg att agc gcc ccc tgg tat gtc
ttt ttt 384Met Ser Thr Leu Gln Gln Pro Ile Ser Ala Pro Trp Tyr Val
Phe Phe 115 120 125cgc cgc gga tta att acc gat ctc tct aac ccg caa
acc gtt tta ttt 432Arg Arg Gly Leu Ile Thr Asp Leu Ser Asn Pro Gln
Thr Val Leu Phe 130 135 140ttt atc agt att ttc tca gta aca tta aat
gcc gaa aca cca aca tgg 480Phe Ile Ser Ile Phe Ser Val Thr Leu Asn
Ala Glu Thr Pro Thr Trp145 150 155 160gca cgt tta atg gcc tgg gcg
ggg att gtg ctc gca tca att atc tgg 528Ala Arg Leu Met Ala Trp Ala
Gly Ile Val Leu Ala Ser Ile Ile Trp 165 170 175cga gtt ttt ctt agt
cag gcg ttt tct ttg ccc gct gtg cgt cgt gct 576Arg Val Phe Leu Ser
Gln Ala Phe Ser Leu Pro Ala Val Arg Arg Ala 180 185 190tat ggg cgt
atg caa cgc gtt gcc agt cgg gtt att ggt gca att att 624Tyr Gly Arg
Met Gln Arg Val Ala Ser Arg Val Ile Gly Ala Ile Ile 195 200 205ggt
gta ttc gcg cta cgc ctg att tac gaa ggg gtg acg cag cgg tga 672Gly
Val Phe Ala Leu Arg Leu Ile Tyr Glu Gly Val Thr Gln Arg 210 215
22010223PRTEscherichia coli 10Met Met Gln Leu Val His Leu Phe Met
Asp Glu Ile Thr Met Asp Pro1 5 10 15Leu His Ala Val Tyr Leu Thr Val
Gly Leu Phe Val Ile Thr Phe Phe 20 25 30Asn Pro Gly Ala Asn Leu Phe
Val Val Val Gln Thr Ser Leu Ala Ser 35 40 45Gly Arg Arg Ala Gly Val
Leu Thr Gly Leu Gly Val Ala Leu Gly Asp 50 55 60Ala Phe Tyr Ser Gly
Leu Gly Leu Phe Gly Leu Ala Thr Leu Ile Thr65 70 75 80Gln Cys Glu
Glu Ile Phe Ser Leu Ile Arg Ile Val Gly Gly Ala Tyr 85 90 95Leu Leu
Trp Phe Ala Trp Cys Ser Met Arg Arg Gln Ser Thr Pro Gln 100 105
110Met Ser Thr Leu Gln Gln Pro Ile Ser Ala Pro Trp Tyr Val Phe Phe
115 120 125Arg Arg Gly Leu Ile Thr Asp Leu Ser Asn Pro Gln Thr Val
Leu Phe 130 135 140Phe Ile Ser Ile Phe Ser Val Thr Leu Asn Ala Glu
Thr Pro Thr Trp145 150 155 160Ala Arg Leu Met Ala Trp Ala Gly Ile
Val Leu Ala Ser Ile Ile Trp 165 170 175Arg Val Phe Leu Ser Gln Ala
Phe Ser Leu Pro Ala Val Arg Arg Ala 180 185 190Tyr Gly Arg Met Gln
Arg Val Ala Ser Arg Val Ile Gly Ala Ile Ile 195 200 205Gly Val Phe
Ala Leu Arg Leu Ile Tyr Glu Gly Val Thr Gln Arg 210 215
22011639DNAEscherichia coliCDS(1)..(639) 11gtg ttc gct gaa tac ggg
gtt ctg aat tac tgg acc tat ctg gtt ggg 48Val Phe Ala Glu Tyr Gly
Val Leu Asn Tyr Trp Thr Tyr Leu Val Gly1 5 10 15gcc att ttt att gtg
ttg gtg cca ggg cca aat acc ctg ttt gta ctc 96Ala Ile Phe Ile Val
Leu Val Pro Gly Pro Asn Thr Leu Phe Val Leu 20 25 30aaa aat agc gtc
agt agc ggt atg aaa ggc ggt tat ctt gcg gcc tgc 144Lys Asn Ser Val
Ser Ser Gly Met Lys Gly Gly Tyr Leu Ala Ala Cys 35 40 45ggt gta ttt
att ggc gat gcg gta ttg atg ttt ctg gca tgg gct gga 192Gly Val Phe
Ile Gly Asp Ala Val Leu Met Phe Leu Ala Trp Ala Gly 50 55 60gtg gcg
aca tta att aag acc acc ccg ata tta ttc aac att gta cgt 240Val Ala
Thr Leu Ile Lys Thr Thr Pro Ile Leu Phe Asn Ile Val Arg65 70 75
80tat ctt ggt gcg ttt tat ttg ctc tat ctg ggg agt aaa att ctt tac
288Tyr Leu Gly Ala Phe Tyr Leu Leu Tyr Leu Gly Ser Lys Ile Leu Tyr
85 90 95gcg acc ctg aag ggt aaa aat agc gag gcc aaa tcc gat gag ccc
caa 336Ala Thr Leu Lys Gly Lys Asn Ser Glu Ala Lys Ser Asp Glu Pro
Gln 100 105 110tac ggt gct att ttt aaa cgc gcg tta att ttg agc ctg
act aat ccg 384Tyr Gly Ala Ile Phe Lys Arg Ala Leu Ile Leu Ser Leu
Thr Asn Pro 115 120 125aaa gcc att ttg ttc tat gtg tcg ttt ttc gta
cag ttt atc gat gtt 432Lys Ala Ile Leu Phe Tyr Val Ser Phe Phe Val
Gln Phe Ile Asp Val 130 135 140aat gcc cca cat acg gga att tca ttc
ttt att ctg gcg gcg acg ctg 480Asn Ala Pro His Thr Gly Ile Ser Phe
Phe Ile Leu Ala Ala Thr Leu145 150 155 160gaa ctg gtg agt ttc tgc
tat ttg agc ttc ctg att ata tct ggt gct 528Glu Leu Val Ser Phe Cys
Tyr Leu Ser Phe Leu Ile Ile Ser Gly Ala 165 170 175ttt gtc acg cag
tac ata cgt acc aaa aag aaa ctg gct aaa gtt ggc 576Phe Val Thr Gln
Tyr Ile Arg Thr Lys Lys Lys Leu Ala Lys Val Gly 180 185 190aac tca
ctg att ggt ttg atg ttc gtg ggt ttc gct gcc cga ctg gcg 624Asn Ser
Leu Ile Gly Leu Met Phe Val Gly Phe Ala Ala Arg Leu Ala 195 200
205acg ctg caa tcc tga 639Thr Leu Gln Ser 21012212PRTEscherichia
coli 12Val Phe Ala Glu Tyr Gly Val Leu Asn Tyr Trp Thr Tyr Leu Val
Gly1 5 10 15Ala Ile Phe Ile Val Leu Val Pro Gly Pro Asn Thr Leu Phe
Val Leu 20 25 30Lys Asn Ser Val Ser Ser Gly Met Lys Gly Gly Tyr Leu
Ala Ala Cys 35 40 45Gly Val Phe Ile Gly Asp Ala Val Leu Met Phe Leu
Ala Trp Ala Gly 50 55 60Val Ala Thr Leu Ile Lys Thr Thr Pro Ile Leu
Phe Asn Ile Val Arg65 70 75 80Tyr Leu Gly Ala Phe Tyr Leu Leu Tyr
Leu Gly Ser Lys Ile Leu Tyr 85 90 95Ala Thr Leu Lys Gly Lys Asn Ser
Glu Ala Lys Ser Asp Glu Pro Gln 100 105 110Tyr Gly Ala Ile Phe Lys
Arg Ala Leu Ile Leu Ser Leu Thr Asn Pro 115 120 125Lys Ala Ile Leu
Phe Tyr Val Ser Phe Phe Val Gln Phe Ile Asp Val 130 135 140Asn Ala
Pro His Thr Gly Ile Ser Phe Phe Ile Leu Ala Ala Thr Leu145 150 155
160Glu Leu Val Ser Phe Cys Tyr Leu Ser Phe Leu Ile Ile Ser Gly Ala
165 170 175Phe Val Thr Gln Tyr Ile Arg Thr Lys Lys Lys Leu Ala Lys
Val Gly 180 185 190Asn Ser Leu Ile Gly Leu Met Phe Val Gly Phe Ala
Ala Arg Leu Ala 195 200 205Thr Leu Gln Ser 21013588DNAEscherichia
coliCDS(1)..(588) 13gtg aca ccg acc ctt tta agt gct ttt tgg act tac
acc ctg att acc 48Val Thr Pro Thr Leu Leu Ser Ala Phe Trp Thr Tyr
Thr Leu Ile Thr1 5 10 15gct atg acg cca gga ccg aac aat att ctc gcc
ctt agc tct gct acg 96Ala Met Thr Pro Gly Pro Asn Asn Ile Leu Ala
Leu Ser Ser Ala Thr 20 25 30tcg cat gga ttt cgt caa agt acc cgc gtg
ctg gca ggg atg agt ctg 144Ser His Gly Phe Arg Gln Ser Thr Arg Val
Leu Ala Gly Met Ser Leu 35 40 45gga ttt ttg att gtg atg tta ctg tgt
gcg ggc att tca ttt tca ctg 192Gly Phe Leu Ile Val Met Leu Leu Cys
Ala Gly Ile Ser Phe Ser Leu 50 55 60gca gtg att gac ccg gca gcg gta
cac ctt ttg agt tgg gcg ggg gcg 240Ala Val Ile Asp Pro Ala Ala Val
His Leu Leu Ser Trp Ala Gly Ala65 70 75 80gca tat att gtc tgg ctg
gcg tgg aaa atc gcc acc agc cca aca aag 288Ala Tyr Ile Val Trp Leu
Ala Trp Lys Ile Ala Thr Ser Pro Thr Lys 85 90 95gaa gac gga ctt cag
gca aaa cca atc agc ttt tgg gcc agc ttt gct 336Glu Asp Gly Leu Gln
Ala Lys Pro Ile Ser Phe Trp Ala Ser Phe Ala 100 105 110ttg cag ttt
gtg aac gtc aaa atc att ttg tac ggt gtt acg gca ctg 384Leu Gln Phe
Val Asn Val Lys Ile Ile Leu Tyr Gly Val Thr Ala Leu 115 120 125tcg
acg ttt gtt ctg ccg caa aca cag gcg tta agc tgg gta gtt ggc 432Ser
Thr Phe Val Leu Pro Gln Thr Gln Ala Leu Ser Trp Val Val Gly 130 135
140gtc agc gtt ttg ctg gcg atg att ggg acg ttt ggc aat gtg tgc tgg
480Val Ser Val Leu Leu Ala Met Ile Gly Thr Phe Gly Asn Val Cys
Trp145 150 155 160gcg ctg gcg ggg cat ctg ttt cag cga ttg ttt cgc
cag tat ggt cgc 528Ala Leu Ala Gly His Leu Phe Gln Arg Leu Phe Arg
Gln Tyr Gly Arg 165 170 175cag tta aat atc gtg ctt gcc ctg ttg ctg
gtc tat tgc gcg gta cgc 576Gln Leu Asn Ile Val Leu Ala Leu Leu Leu
Val Tyr Cys Ala Val Arg 180 185 190att ttc tat taa 588Ile Phe Tyr
19514195PRTEscherichia coli 14Val Thr Pro Thr Leu Leu Ser Ala Phe
Trp Thr Tyr Thr Leu Ile Thr1 5 10 15Ala Met Thr Pro Gly Pro Asn Asn
Ile Leu Ala Leu Ser Ser Ala Thr 20 25 30Ser His Gly Phe Arg Gln Ser
Thr Arg Val Leu Ala Gly Met Ser Leu 35 40 45Gly Phe Leu Ile Val Met
Leu Leu Cys Ala Gly Ile Ser Phe Ser Leu 50 55 60Ala Val Ile Asp Pro
Ala Ala Val His Leu Leu Ser Trp Ala Gly Ala65 70 75 80Ala Tyr Ile
Val Trp Leu Ala Trp Lys Ile Ala Thr Ser Pro Thr Lys 85 90 95Glu Asp
Gly Leu Gln Ala Lys Pro Ile Ser Phe Trp Ala Ser Phe Ala 100 105
110Leu Gln Phe Val Asn Val Lys Ile Ile Leu Tyr Gly Val Thr Ala Leu
115 120 125Ser Thr Phe Val Leu Pro Gln Thr Gln Ala Leu Ser Trp Val
Val Gly 130 135 140Val Ser Val Leu Leu Ala Met Ile Gly Thr Phe Gly
Asn Val Cys Trp145 150 155 160Ala Leu Ala Gly His Leu Phe Gln Arg
Leu Phe Arg Gln Tyr Gly Arg 165 170 175Gln Leu Asn Ile Val Leu Ala
Leu Leu Leu Val Tyr Cys Ala Val Arg 180 185 190Ile Phe Tyr
19515636DNAEscherichia coliCDS(1)..(636) 15gtg ttt tct tat tac ttt
caa ggt ctt gca ctt ggg gcg gct atg atc 48Val Phe Ser Tyr Tyr Phe
Gln Gly Leu Ala Leu Gly Ala Ala Met Ile1 5 10 15cta ccg ctc ggt cca
caa aat gct ttt gtg atg aat cag ggc ata cgt 96Leu Pro Leu Gly Pro
Gln Asn Ala Phe Val Met Asn Gln Gly Ile Arg 20 25 30cgt cag tac cac
att atg att gcc tta ctt tgt gct atc agc gat ttg 144Arg Gln Tyr His
Ile Met Ile Ala Leu Leu Cys Ala Ile Ser Asp Leu 35 40 45gtc ctg att
tgc gcc ggg att ttt ggt ggc agc gcg tta ttg atg cag 192Val Leu Ile
Cys Ala Gly Ile Phe Gly Gly Ser Ala Leu Leu Met Gln 50 55 60tcg ccg
tgg ttg ctg gcg ctg gtc acc tgg ggc ggc gta gcc ttc ttg 240Ser Pro
Trp Leu Leu Ala Leu Val Thr Trp Gly Gly Val Ala Phe Leu65 70 75
80ctg tgg tat ggt ttt ggc gct ttt aaa aca gca atg agc agt aat att
288Leu Trp Tyr Gly Phe Gly Ala Phe Lys Thr Ala Met Ser Ser Asn Ile
85 90 95gag tta gcc agc gcc gaa gtc atg aag caa ggc aga tgg aaa att
atc 336Glu Leu Ala Ser Ala Glu Val Met Lys Gln Gly Arg Trp Lys Ile
Ile 100 105 110gcc acc atg ttg gca gtg acc tgg ctg aat ccg cat gtt
tac ctg gat 384Ala Thr Met Leu Ala Val Thr Trp Leu Asn Pro His Val
Tyr Leu Asp 115 120 125act ttt gtt gta ctg ggc agc ctt ggc ggg caa
ctt gat gtg gaa cca 432Thr Phe Val Val Leu Gly Ser Leu Gly Gly Gln
Leu Asp Val Glu Pro 130 135 140aaa cgc tgg ttt gca ctc ggg aca att
agc gcc tct ttc ctg tgg ttc 480Lys Arg Trp Phe Ala Leu Gly Thr Ile
Ser Ala Ser Phe Leu Trp Phe145 150 155 160ttt ggt ctg gct ctt ctc
gca gcc tgg ctg gca ccg cgt ctg cgc acg 528Phe Gly Leu Ala Leu Leu
Ala Ala Trp Leu Ala Pro Arg Leu Arg Thr 165 170 175gca aaa gca cag
cgc att atc aat ctg gtt gtg gga tgt gtt atg tgg 576Ala Lys Ala Gln
Arg Ile Ile Asn Leu Val Val Gly Cys Val Met Trp 180 185 190ttt att
gcc ttg cag ctg gcg aga gac ggt att gct cat gca caa gcc 624Phe Ile
Ala Leu Gln Leu Ala Arg Asp Gly Ile Ala His Ala Gln Ala 195 200
205ttg ttc agt tag 636Leu Phe Ser 21016211PRTEscherichia coli 16Val
Phe Ser Tyr Tyr Phe Gln Gly Leu Ala Leu Gly Ala Ala Met Ile1 5 10
15Leu Pro Leu Gly Pro Gln Asn Ala Phe Val Met Asn Gln Gly Ile Arg
20 25 30Arg Gln Tyr His Ile Met Ile Ala Leu Leu Cys Ala Ile Ser Asp
Leu 35 40 45Val Leu Ile Cys Ala Gly Ile Phe Gly Gly Ser Ala Leu Leu
Met Gln 50 55 60Ser Pro Trp Leu Leu Ala Leu Val Thr Trp Gly Gly Val
Ala Phe Leu65 70 75 80Leu Trp Tyr Gly Phe Gly Ala Phe Lys Thr Ala
Met Ser Ser Asn Ile 85 90 95Glu Leu Ala Ser Ala Glu Val Met Lys Gln
Gly Arg Trp Lys Ile Ile 100 105 110Ala Thr Met Leu Ala Val Thr Trp
Leu Asn Pro His Val Tyr Leu Asp 115 120 125Thr Phe Val Val Leu Gly
Ser Leu Gly Gly Gln Leu Asp Val Glu Pro 130 135 140Lys Arg Trp Phe
Ala Leu Gly Thr Ile Ser Ala Ser Phe Leu Trp Phe145 150 155 160Phe
Gly Leu Ala Leu Leu Ala Ala Trp Leu Ala Pro Arg Leu Arg Thr 165 170
175Ala Lys Ala Gln Arg Ile Ile Asn Leu Val Val Gly Cys Val Met Trp
180 185 190Phe Ile Ala Leu Gln Leu Ala Arg Asp Gly Ile Ala His Ala
Gln Ala 195 200 205Leu Phe Ser 2101720DNAArtificial
Sequencemisc_featureDescription of Artificial Sequence synthetic
DNA 17gtgtggaacc gacgccggat 201823DNAArtificial
Sequencemisc_featureDescription of Artificial Sequence synthetic
DNA
18tgttgtatgg tacggggttc gag 231920DNAArtificial
Sequencemisc_featureDescription of Artificial Sequence synthetic
DNA 19ctttgccaat cccgtctccc 202020DNAArtificial
Sequencemisc_featureDescription of Artificial Sequence synthetic
DNA 20gccccatgca taacggaaag 202126DNAArtificial
Sequencemisc_featureDescription of Artificial Sequence synthetic
DNA 21gaagatcttg taggccggat aaggcg 262220DNAArtificial
Sequencemisc_featureDescription of Artificial Sequence synthetic
DNA 22tggttttacc aattggccgc 202321DNAArtificial
Sequencemisc_featureDescription of Artificial Sequence synthetic
DNA 23acttctcccg cgagccagtt c 212421DNAArtificial
Sequencemisc_featureDescription of Artificial Sequence synthetic
DNA 24ggcaagctta gcgcctctgt t 21
* * * * *