U.S. patent number 7,081,226 [Application Number 08/869,275] was granted by the patent office on 2006-07-25 for system and method for fluorescence monitoring.
This patent grant is currently assigned to University of Utah Research Foundation. Invention is credited to David R. Hillyard, Randy P. Rasmussen, Kirk M. Ririe, Carl T. Wittwer.
United States Patent |
7,081,226 |
Wittwer , et al. |
July 25, 2006 |
**Please see images for:
( Certificate of Correction ) ** |
System and method for fluorescence monitoring
Abstract
A thermal cycling method and device is disclosed. The device
comprises a sample chamber whose temperature can be rapidly and
accurately modulated over a range of temperatures needed to carry
out a number of biological procedures, such as the DNA polymerase
chain reaction. Biological samples are placed in glass micro
capillary tubes and then located inside the sample chamber. A
programmable controller regulates the temperature of the sample
inside the sample chamber. Monitoring of the DNA amplification is
monitored by fluorescence once per cycle or many times per cycle.
The present invention provides that fluorescence monitoring of PCR
is a powerful tool for DNA quantification.
Inventors: |
Wittwer; Carl T. (Salt Lake
City, UT), Ririe; Kirk M. (Idaho Falls, ID), Rasmussen;
Randy P. (Salt Lake City, UT), Hillyard; David R. (Salt
Lake City, UT) |
Assignee: |
University of Utah Research
Foundation (Salt Lake City, UT)
|
Family
ID: |
36687056 |
Appl.
No.: |
08/869,275 |
Filed: |
June 4, 1997 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
08658993 |
Jun 4, 1996 |
|
|
|
|
Current U.S.
Class: |
422/68.1; 422/50;
435/91.2 |
Current CPC
Class: |
B01L
3/5025 (20130101); B01L 7/52 (20130101); B01L
2300/0803 (20130101); B01L 2300/0838 (20130101); B01L
2300/1844 (20130101); B01L 2400/0406 (20130101); B01L
2400/0409 (20130101) |
Current International
Class: |
G01N
33/50 (20060101); C12P 19/34 (20060101) |
Field of
Search: |
;422/50,68.1 ;435/6
;436/501 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
528259 |
|
Apr 1983 |
|
AU |
|
3 808 942 |
|
Sep 1989 |
|
DE |
|
0 171 140 |
|
Feb 1986 |
|
EP |
|
0 211 334 |
|
Feb 1987 |
|
EP |
|
0 229 943 |
|
Jul 1987 |
|
EP |
|
0 236 069 |
|
Sep 1987 |
|
EP |
|
0 318 255 |
|
May 1989 |
|
EP |
|
0 404 258 |
|
Dec 1990 |
|
EP |
|
0 459 241 |
|
Dec 1991 |
|
EP |
|
0 475 760 |
|
Mar 1992 |
|
EP |
|
0 488 769 |
|
Jun 1992 |
|
EP |
|
0 519 623 |
|
Dec 1992 |
|
EP |
|
0 566 751 |
|
Oct 1993 |
|
EP |
|
0 580 362 |
|
Jan 1994 |
|
EP |
|
0 636 413 |
|
Feb 1995 |
|
EP |
|
0 640 828 |
|
Mar 1995 |
|
EP |
|
0 643 140 |
|
Mar 1995 |
|
EP |
|
0 674 009 |
|
Sep 1995 |
|
EP |
|
0 686 699 |
|
Dec 1995 |
|
EP |
|
2 122 187 |
|
Aug 1972 |
|
FR |
|
6 212 986 |
|
Mar 1987 |
|
JP |
|
WO 89 09437 |
|
Oct 1989 |
|
WO |
|
WO 92 20778 |
|
Nov 1992 |
|
WO |
|
WO 93/20240 |
|
Oct 1993 |
|
WO |
|
WO 94/27137 |
|
Nov 1994 |
|
WO |
|
WO 95 13399 |
|
May 1995 |
|
WO |
|
WO 95/21266 |
|
Aug 1995 |
|
WO |
|
WO 95 21382 |
|
Aug 1995 |
|
WO |
|
WO 95 30139 |
|
Nov 1995 |
|
WO |
|
WO 95 32306 |
|
Nov 1995 |
|
WO |
|
WO 96 00901 |
|
Jan 1996 |
|
WO |
|
WO 96 06354 |
|
Feb 1996 |
|
WO |
|
Other References
Haff et al., Biotechniques, vol. 10, No. 1, pp. 102-112, 1991.
cited by examiner .
Barnes, W.M., "PCR Amplification of up to 35-kb DNA with High
Fidelity and High Yield from .lamda. Bacteriophage Templates,"
Proc. Natl. Acad. Sci. USA, vol. 91, pp. 2216-2220 (1994). cited by
other .
Brown, A.B., et al., "Rapid Cycle Amplification For Construction of
Competitive Templates," Genetic Engineering with PCR, Edited by:
Horton, R.M., Horizon Scientific Press, Wymondham, U.K., Chap. 4
(1997). cited by other .
Cao, T.M., "A Simple and Inexpensive System to Amplify DNA by PCR,"
BioTechniques, vol. 7, No. 6, pp. 566-567 (1989). cited by other
.
Cardullo, R.A., et al., "Detection of Nucleic Acid Hybridization by
Nonradiative Fluorescence Resonance Energy Transfer," Proc. Natl.
Acad. Sci. USA, vol. 85, pp. 8790-8794 (1988). cited by other .
Cotton, R. G. H, "Detection of Single Base Changes in Nucleic
Acids", The Biochemical Journal, vol. 263, pp. 1-10, Oct. 1, 1989.
cited by other .
Denton, P., et al., "A Low-Cost Air-Driven Cycling Oven," PCR
Protocols: A Guide to Methods and Applications, Edited by M.A.
Innis, et al., Academic Press, Inc., San Diego, Chap. 52, pp.
435-441 (1990). cited by other .
Findlay, J.B., et al., "Automated Closed-Vessel System for in Vitro
Diagnostics Based on Polymerase Chain Reaction," Clinical
Chemistry, vol. 39, No. 9, pp. 1927-1933 (1993). cited by other
.
Ghosh, S.S., et al., "Real Time Kinetics of Reduction Endonuclease
Cleavage Monitored by Fluorescence Resonance Energy Transfer,"
Nucleic Acids Research, vol. 22, No. 15, pp. 3155-3159 (1994).
cited by other .
Goldner, H., "PCR update: New Techniques Multiply Uses," R & D
Magazine, vol. 36, No. 4, pp. 55 (Mar. 1994). cited by other .
Graham, A., "A Haystack of Needles: Applying the Polymerase Chain
Reaction," Chemistry and Industry, No. 18, pp. 718 (Sep. 19, 1994).
cited by other .
Gustafson, C.E., et al., "Effect of Heat Denaturation of Target DNA
on the PCR Amplification," Gene, vol. 123, pp. 241-244 (1993).
cited by other .
Higuchi, R., et al., "Simultaneous Amplification and Detection of
Specific DNA Sequences," Bio/Technology, vol. 10, pp. 413-417
(1992). cited by other .
Higuchi, R., et al., "Kinetic PCR Analysis: Real-time Monitoring of
DNA Amplification Reactions," Bio/Technology, vol. 11, pp.
1026-1030 (1993). cited by other .
Hillen, W., et al., "High Resolution Experimental and Theoretical
Thermal Denaturation Studies on Small Overlapping Restriction
Fragments Containing the Escherichia coli Lactose Genetic Control
Region," The Journal of Biological Chemistry, vol. 256, No. 6, pp.
2761-2766 (1981). cited by other .
Hiyoshi, M., et al., "Assay of DNA Denaturation by Polymerase Chain
Reaction-Driven Fluorescence Resonance Energy Transfer," Analytical
Biochemistry, vol. 221, pp. 306-311 (1994). cited by other .
Hoffman, L.M., et al., "Use of a Gas Chromatograph Oven for DNA
Amplification by the Polymerase Chain Reaction," BioTechniques,
vol. 6, No. 10, pp. 932-936 (1988). cited by other .
Holland, P.M., et al., "Detection of Specific Polymerase Chain
Reaction Product by Utilizing the 5'.fwdarw. 3' Exonuclease
Activity of Thermus aquaticus DNA Polymerase," Proc. Natl. Acad.
Sci. USA, vol. 88, pp. 7276-7280 (1991). cited by other .
Hopfenbeck, J.A., et al., "Digoxigenin-Labeled Probes Amplified
from Genomic DNA Detect T-Cell Gene Rearrangements," American
Journal of Clinical Pathology, vol. 97, No. 5, pp. 638-644 (1992).
cited by other .
Ishiguro, T., et al., "Homogeneous Quantitative Assay of Hepatitis
C Virus RNA by Polymerase Chain Reaction in the Presence of a
Fluorescent Intercalater," Analytical Biochemistry, vol. 229, pp.
207-213 (1995). cited by other .
Kang, J., et al., "Exact Quantification of DNA-RNA Copy Numbers by
PCR-TGGE, " PCR Strategies, Academic Press, Inc., Chap 15, pp.
189-198 (1995). cited by other .
Ke, S., et al., "Influence of Nearest Neighbor Sequence on the
Stability of Base Pair Mismatches in Long DNA: Determined by
Temperature-Gradient Gel Electrophoresis," Nucleic Acids Research,
vol. 21, No. 22, pp. 5137-5143 (1993). cited by other .
Lee, L.G., et al., "Allelic Discrimination by Nick-Translation PCR
with Fluorogenic Probes," Nucleic Acids Research, vol. 21, No. 16,
pp. 3761-3766 (1993). cited by other .
Linz, U., "Thermocycler Temperature Variation Invalidates PCR
Results," Biotechniques, vol. 9, No. 3, pp. 286-290 (1990). cited
by other .
Livak, K.J., et al., "Oligonucleotides with Fluorescent Dyes at
Opposite Ends Provide a Quenched Probe System Useful for Detecting
PCR Product and Nucleic Acid Hybridization," PCR Methods and
Applications, vol. 4, pp. 357-362 (1995). cited by other .
Livak, K.J., "Quantitation of DNA/RNA Using Real-Time PCR
Detection," Perkin-Elmer Applied Biosystems Report (1996). cited by
other .
Morrison, L.E., "Detection of Energy Transfer and Fluorescence
Quenching," Nonisotopic DNA Probe Techniques, Edited by: Larry J.
Kricka, Academic Press, Inc., San Diego, Chap. 13, pp. 311-352
(1992). cited by other .
Morrison, L.E., et al., "Sensitive Fluorescence-Based Thermodynamic
and Kinetic Measurements of DNA Hybridization in Solution,"
Biochemistry, vol. 32, pp. 3095-3104 (1993). cited by other .
Nilsson, P., et al., "Real-Time Monitoring of DNA Manipulations
Using Biosensor Technology," Analytic Biochemistry, vol. 224, pp.
400-408 (1995). cited by other .
Oste, C.C., "PCR Instrumentation: Where Do We Stand?," The
Polymerase Chain Reaction, Edited by Mullis, et al., Birkhauser,
Boston, Chap. 14 (1994). cited by other .
Ririe, K.M., et al., "Product Differentiation by Analysis of DNA
Melting Curves during the Polymerase Chain Reaction," Analytical
Biochemistry, vol. 254, pp. 154-160 (1997). cited by other .
Segal, G.H., et al., "Identification of Monoclonal B-cell
Populations by Rapid Cycle Polymerase Chain Reaction," The American
Journal of Pathology, vol. 141, No. 6, pp. 1291-1297 (1992). cited
by other .
Service, R.E., "The Incredible Shrinking Laboratory: Microchips
Allow Miniaturization of Analytical Laboratories," Science, vol.
268, No. 5207, pp. 26 (Apr. 7, 1995). cited by other .
Stimpson, D.I., "Real-time Detection of DNA Hybridization and
Melting on Oligonucleotide Arrays by Using Optical Wave Guides,"
Proc. Natl. Acad. Sci. USA, vol. 92, pp. 6379-6383 (1995). cited by
other .
Swerdlow, H., et al., "Fully Automated DNA Reaction and Analysis in
a Fluidic Capillary Instrument," Anal. Chem., vol. 69, pp. 848-855
(1997). cited by other .
Tombler, E.R., et al., "Spectrofluorometric Assay for Hybridization
of Oligodeoxynucleotides Using Ethidium Dimer," BioTechniques, vol.
15, No. 6, pp. 1060-1064 (1993). cited by other .
Tyagi, S., et al., "Molecular Beacons: Probes that Fluoresce upon
Hybridization," Nature Biotechnology, vol. 14, pp. 303-308 (1996).
cited by other .
Weis, J.H., et al., "Detection of Rare mRNAs via Quantitative
RT-PCR," Trends in Genetics, vol. 8, No. 8, pp. 263-264 (1992).
cited by other .
Wilding, et al., "PCR in Silicon Microstructure," Clinical
Chemistry, vol. 40, No. 9, pp. 1815-1818, (1994). cited by other
.
Wittwer, C.T., et al., "Minimizing the Time Required for DNA
Amplification by Efficient Heat Transfer to Small Samples,"
Analytical Biochemistry, vol. 186 pp. 328-331 (1990). cited by
other .
Wittwer, C.T., et al., "Automated Polymerase Chain Reaction in
Capillary Tubes with Hot Air," Nucleic Acids Research, vol. 17, No.
11, pp. 4353-4357 (1989). cited by other .
Wittwer, C.T., et al., "Rapid Cycle DNA Amplification: Time and
Temperature Optimization," BioTechniques, vol. 10, No. 1, pp. 76-83
(1991). cited by other .
Wittwer, C.T., et al., "Rapid Cycle Allele-Specific Amplification:
Studies with the Cystic Fibrosis .DELTA.F.sub.508 Locus," Clinical
Chemistry, vol. 39, No. 5, pp. 804-809 (1993). cited by other .
Wittwer, C.T., et al., "Rapid Cycle DNA Amplification," The
Polymerase Chain Reaction, Edited by: Mullis, et al., Birkhauser,
Boston, Chap. 15, (1994). cited by other .
Wittwer, C.T., et al., "Continuous Fluorescence Monitoring of Rapid
Cycle DNA Amplification," BioTechniques, vol. 22, pp. 130-138
(1997). cited by other .
Wittwer, C.T., et al., "The LightCycler: A Microvolume Multisample
Fluorimeter with Rapid Temperature Control," BioTechniques, vol.
22, pp. 176-181 (1997). cited by other .
Yguerabide, J., et al., "Quantitative Fluorescence Method for
Continuous Measurement of DNA Hybridization Kinetics Using a
Fluorescent Intercalator," Analytical Biochemistry, vol. 228, pp.
208-220 (1995). cited by other .
Biotherm Corporation Advertisement, BioOven (1991). cited by other
.
Ericomp Advertisement, Twinblock System (1991). cited by other
.
Techne Advertisement, PHC-1 Dri-Block (1988). cited by other .
Hybaid Advertisement, Hybaid Heating and Cooling Block (1988).
cited by other .
Eppendorf Advertisement, Eppendorf MicroCycler (1988). cited by
other .
COY Advertisement, Tempcycler Model 50 Microtube Incubator (1991).
cited by other .
Idaho Technology Advertisement and Specification Sheets for 1605
Product (1991). cited by other .
Perkin-Elmer Advertisement, ABI Prism 7700 Sequence Detection
System (1991). cited by other .
Clark, et al., "Cassettes Simplify Small-sample Dialysis," R&D
Magazine, p. 31, Sep. 1995. cited by other .
"Let the Microchip Fall Where Diagnostics Lies: Implications: A
Diagnostic Revolution?," Genesis Report-Dx, vol. 4, No. 3 (1994).
cited by other .
"Let the Microchip Fall Where Diagnostics Lies: Implications:
Affymetrix: DNA on a Chip," Genesis Report-Dx, vol. 4, No. 3
(1994). cited by other .
"PCR Detection Blows Cover on Lyme Disease, Q Fever," Biotechnology
Newswatch, vol. 10, No. 1 (Jan. 1, 1990). cited by other .
Schoffner et al., "Chip PCR. I. Surface passivation of
microfabricated silicon-glass chips or PCR", Nucleic Acids
Research,, vol. 24, No. 2, pp. 375-379, 1996. cited by other .
Cheng et al., "Chip PCR. II. Investigation of different PCR
amplification systems in microfabricated silicon-glass chips",
Nucleic Acids Research, vol. 24, No. 2, pp. 380-385, 1996. cited by
other .
Operation manual for the MIC 6000, Jan. 1987. cited by
other.
|
Primary Examiner: Fredman; Jeffrey
Attorney, Agent or Firm: Barnes & Thornburg LLP
Parent Case Text
RELATED APPLICATIONS
This application is a continuation-in-part of U.S. patent
application Ser. No. 08/658,993, filed Jun. 4, 1996, now abandoned,
entitled System and Method for Monitoring PCR Processes.
The copending U.S. application filed in the U.S. Patent and
Trademark on Jun. 4, 1997 entitled Monitoring Hybridization During
PCR as Ser. No. 08/869,276 and naming Carl T. Wittwer, Kirk M.
Ririe, and Randy P. Rasmussen as inventors is hereby incorporated
by reference in its entirety.
Claims
What is claimed and desired to be secured by United States Letters
Patent is:
1. A system for performing PCR and monitoring the reaction during
temperature cycling comprising; a chamber; a plurality of sample
containers each for holding a PCR sample, each sample container
comprising walls composed of an optically transparent material and
defining a volume having a first and second dimension, wherein the
first dimension is less than the second dimension and the ratio of
volume to external surface area of the container is less than 1 mm,
each sample container formed for holding a maximum volume of 1
milliliter of a sample; a rotatable carousel rotatably mounted
within said chamber and formed for holding said plurality of
samples, wherein said carousel moves the sample containers one by
one to a monitoring position located within said chamber; a forced
air heater for simultaneously heating all the PCR samples in the
carousel; means for simultaneously cooling all the PCR samples in
the carousel; control means for repeatedly operating the forced air
heater and the means for cooling to subject the PCR sample to
thermal cycling within said chamber; means for optically exciting
the sample in the monitoring position to cause the sample to
fluoresce; and means for detecting the fluorescence of the excited
sample during amplification when the sample is in the monitoring
position.
2. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 1 further comprising: means
for determining at least one reaction parameter in accordance with
the detected fluorescence.
3. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 2 further comprising means
for adjusting the control means in accordance with the reaction
parameter.
4. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 3 in which the control
means adjusts the operation of the forced air heater and the means
for cooling to alter the times the means for heating and the means
for cooling operate in accordance with the reaction parameter.
5. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 3 in which the control
means adjusts the operation of the forced air heater and the means
for cooling to alter the rate at which the biological sample is
heated and cooled in accordance with the reaction parameter.
6. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 1 wherein the sample
containers are fabricated at least partially from glass, wherein
the sample container comprises a capillary tube, that is closed at
one end, with an inner capillary tube wall diameter of about 0.25
mm to about 1.0 mm and having a volume not greater than about 100
.mu.l.
7. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 1 further comprising means
for positioning the means for optically exciting the sample and the
means for detecting the fluorescence of excited sample to optimize
the fluorescence which is detected.
8. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 1 wherein the means for
cooling comprises an air movement mechanism which transports
ambient air to the sample containers.
9. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 1 wherein the control means
comprises a microprocessor.
10. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 1 wherein the means for
optically exciting the sample comprises a photo emitter structure
positioned so that the radiation emitted therefrom impinges the
first side of the sample container in the monitoring position.
11. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 10 wherein means for
detecting the fluorescence of the excited sample comprises a photo
detector structure positioned so that the radiation emitted from
the second side of the sample container in the monitoring position
is detected.
12. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 1 wherein the means for
optically exciting the sample comprises a photo emitter structure
positioned so that the radiation emitted therefrom impinges the end
of the sample container in the monitoring position.
13. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 12 wherein the means for
detecting the fluorescence of the excited sample comprises a photo
detector structure positioned so that the radiation emitted from
the end of the sample container in the monitoring position is
detected.
14. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 2 wherein the means for
determining at least one reaction parameter in accordance with the
detected fluorescence comprises means for determining at least one
reaction parameter selected from the group consisting of: product
melting temperature, product melting time, product reannealing
temperature, product reannealing time, probe melting time, primer
annealing/extension temperature, and primer annealing/extension
time.
15. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 1 wherein the control means
comprises means for cooling the sample when the means for detecting
the fluorescence of the excited sample detects that the product is
completely melted.
16. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 1 wherein the control means
comprises means for heating the sample when the means for detecting
the fluorescence of the excited sample detects no more product
generation.
17. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 1 wherein the means for
optically exciting is positioned to interact with the first side of
the sample container in the monitoring position and the means for
detecting the fluorescence is positioned to interact with the
second side of the sample container in the monitoring position.
18. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 1 wherein the means for
optically exciting is positioned to interact with the end of the
sample container and the means for detecting the fluorescence is
positioned to interact with the end of the sample container.
19. A system for performing PCR and monitoring the reaction in real
time during temperature cycling comprising: a chamber; a plurality
of sample containers for holding a plurality of PCR samples, each
sample container comprising an optically clear capillary tube, each
sample container formed for holding a maximum volume of 1
milliliter of a sample and having a sealed end and an open end with
a sealable closure on the open end; a rotatable carousel, rotatably
mounted within said chamber and formed for holding the sample
containers, to move the sample containers one by one to a
monitoring position, said monitoring position located with in said
chamber; means for forcing hot gas into contact with the plurality
of sample containers in the carousel; means for forcing cool gas
into contact with the plurality of sample containers in the
carousel; means for repeatedly operating the means for forcing hot
gas and the means for forcing cool gas to subject the PCR samples
to thermal cycling within said chamber; means for optically
exciting at least one selected PCR sample to cause the selected PCR
sample to fluoresce; means for detecting the fluorescence of the
excited selected PCR sample at both a first wavelength and a second
wavelength; and means for determining at least one reaction
parameter for the selected PCR sample in accordance with the
fluorescence at the first and second wavelengths and displaying the
reaction parameter in a visually perceptible manner in real
time.
20. A system for performing PCR and monitoring the reaction in real
time during temperature cycling as defined in claim 19 further
comprising means for adjusting the means fbr repeatedly operating
in accordance with the reaction parameter such that the reaction is
adjusted in real time.
21. A system for performing PCR and monitoring the reaction in real
time during temperature cycling as defined in claim 19 wherein the
means for determining at least one reaction parameter in accordance
with the detected fluorescence at the first and second wavelengths
and displaying the reaction parameter in a visually perceptible
manner in real time comprises means for determining a reaction
parameter selected from the group consisting of denaturation
temperature and time, primer annealing temperature and time, probe
annealing temperature and time, enzyme extension temperature and
time, and number of cycles.
22. A system for carrying out and monitoring the progress of first
and second biological reactions comprising: a chamber; first
holding means for holding a first biological sample; second holding
means for holding a second biological sample; transporting means
for moving the first and second holding means between a non
monitoring position and a monitoring position, wherein said
transporting means and said monitoring and non monitoring positions
are located with in said chamber; thermal cycling means for
repeatedly heating and cooling the first holding means and the
second holding means in both the non monitoring position and in the
monitoring position to carry out thermal cycling simultaneously on
both the first biological sample and the second biological sample
to generate a first and second biological reaction, the thermal
cycling means comprising a forced air heater and a fan; monitoring
means for ascertaining the progress of the first biological
reaction in the first means for holding and the second biological
reaction in the second means for holding, the means for monitoring
comprising means for detecting radiation emitted from the first and
second biological reactions, when the first and second biological
reaction are sequentially positioned in the monitoring position;
and controlling means for controlling the operation of the
transporting means, thermal cycling means, and the monitoring means
such that the progress of the first and second biological reactions
is detected as thermal cycling occurs.
23. A system for carrying out and monitoring the progress of first
and second biological reactions as defined in claim 22 wherein the
monitoring means comprises: an excitation source emitting
excitation radiation; means for directing the excitation radiation
to the monitoring position such that when the first or second
biological samples are located at the monitoring position the
samples emit radiation; means for converting the emitted radiation
to an electrical signal; means for processing the electrical signal
to arrive at a reaction parameter; means for displaying the
reaction parameter; and means for recording the reaction
parameter.
24. A system for carrying out and monitoring the progress of first
and second biological reactions as defined in claim 23 wherein the
reaction parameter is selected from the group consisting of
denaturation temperature and time, primer annealing temperature and
time, probe annealing temperature and time, enzyme extension
temperature and time, and number of cycles.
25. A system for carrying out and monitoring the progress of first
and second biological reactions as defined in claim 23 wherein: the
excitation source comprises a photo-emitting source, the
photo-emitting source selected from the group consisting of a xenon
lamp and a light emitting diode; the means for converting the
emitted radiation to an electrical signal comprises a
photo-detection device, the photo-detection device selected from
the group consisting of a photo-multiplier tube and a photo-diode;
and the means for processing the electrical signal to arrive at a
reaction parameter comprises a microprocessor.
26. A system for carrying out and monitoring the progress of first
and second biological reactions as defined in claim 25 wherein the
means for converting the emitted radiation to an electrical signal
comprises a first photo-detection device, the first photo-detection
device is selected from the group consisting of a photo-multiplier
tube and a photo-diode and a second photo-detection device selected
from the group consisting of a photo-multiplier tube and a
photo-diode.
27. A device for monitoring the fluorescence of a plurality of
samples each held within its respective sample vessel, said device
comprising a chamber; a carousel for holding a plurality of sample
vessels and moving each sample vessel sequentially to a monitoring
position, said carousel being rotatably mounted in said chamber,
and each sample vessel comprising an optically transparent material
and walls defining a volume having at least first and second
dimensions wherein the first dimension is less than the second
dimension and wherein the ratio of volume to external surface area
of the vessel is less than 1 mm; a stepper motor for rotating said
carousel; means for coupling said carousel to said motor; a forced
air heater and a fan in air flow communication with the chamber and
a controller therefor for rapidly cycling the temperature of the
chamber; a light emitting source mounted in said chamber and
positioned to illuminate the sample vessel in the monitoring
position along an axis substantially parallel to a wall along the
second dimension of the vessel; and a light detector mounted in
said chamber and positioned to measure fluorescence from the sample
vessel in the monitoring position along an axis substantially
parallel to a wall along the second dimension of the vessel.
28. The device of claim 27 wherein said sample vessels are
capillary tubes.
29. A device for conducting PCR reactions, said device comprising a
chamber; a forced air heater and a fan mounted in said device and
in air flow communication with the chamber; a carousel for holding
a plurality of sample vessels, said carousel being rotatably
mounted in said chamber to move the sample vessels one by one to a
monitoring position, said heater and fan positioned to supply hot
or cool air simultaneously to each of the plurality of sample
vessels held in the carousel; each of said sample vessels
comprising an optically transparent material and walls defining a
volume having at least first and second dimensions wherein the
first dimension is less than the second dimension and wherein the
ratio of volume to external surface area of each of said sample
vessels is less than 1 mm, each sample container formed for holding
a maximum volume of 1 milliliter of a sample; a light emitting
source mounted in said chamber and positioned to illuminate at
least one selected sample vessel in the monitoring position along
an axis substantially parallel to a wall along the second dimension
of the selected sample vessel; and a light detector mounted in said
chamber and positioned to measure fluorescence from the selected
sample vessel in the monitoring position along an axis
substantially parallel to a wall along the second dimension of the
selected sample vessel.
30. A device for conducting PCR reactions, said device comprising a
chamber; a forced air heater and a fan mounted in said device and
in air flow communication with the chamber; a carousel for holding
a plurality of sample vessels, said carousel being rotatably
mounted in said chamber to move the sample vessels sequentially to
a monitoring position, the carousel positioned such that each of
the samples in the carousel are simultaneously heated or cooled by
air flow directed by said mounted fan; said sample vessels
comprising an optically transparent material and walls, wherein
said walls define a volume having at least first and second
dimensions wherein the first dimension is less than the second
dimension and wherein the ratio of volume to external surface area
of each of said sample vessels is less than 1 mm, each sample
container formed for holding a maximum volume of 1 milliliter of a
sample; a light emitting source positioned to illuminate the
selected sample vessel in the monitoring position along an axis
substantially parallel to a wall along the second dimension of the
selected sample vessel; a light detector positioned to measure
fluorescence from the selected sample vessel in the monitoring
position along an axis substantially parallel to a wall along the
second dimension of the selected sample vessel.
31. A system for performing PCR and monitoring the reaction
comprising: a chamber; a heater and a fan in air flow communication
with the chamber and a controller for cycling the temperature in
the chamber according to initial predefined temperature and time
parameters; a carousel for holding a plurality of sample vessels
said carousel being rotatably mounted in said chamber to move the
sample vessels sequentially to a monitoring position, the carousel
positioned such that the heater and the fan simultaneously heat and
cool each of the samples in the carousel, said sample vessels
comprising an optically transparent material and walls defining a
volume having at least first and second dimensions wherein the
first dimension is less than the second dimension and wherein the
ratio of volume to external surface area of the vessel is less than
1 mm; a light emitting source positioned to illuminate the sample
vessel in the monitoring position along an axis substantially
parallel to a wall along the second dimension of the vessel; a
light detector positioned to measure fluorescence from the sample
vessel in the monitoring position along an axis substantially
parallel to a wall along the second dimension of the vessel; and
means for displaying the status of the reaction based detected
fluorescence.
32. The system of claim 31 further comprising means for adjusting
the controller such that one or more reaction parameters the
reaction is adjusted during temperature cycling.
33. The system of claim 31 wherein the carousel comprises: a disc
having a top surface, a bottom surface, an outer edge extending
therebetween, a sample receiving port in the top surface, a sample
vessel port in the outer edge, and a sample passageway
communicating with said sample receiving port and the sample vessel
port, said sample vessel port and passageway formed for receiving
and fixing a sample vessel to the disc.
34. The system of claim 31 wherein the sample vessels are capillary
tubes each having an inner diameter ranging from about 0.02 mm to
about 1.0 mm.
35. The system of claim 33 wherein the passageway of the carousel
includes a barrier that prevents a liquid sample delivered through
the sample receiving port from flowing to the sample vessel port
absent a biasing force on said liquid sample.
36. The system of claim 33 further comprising a motor for rotating
the carousel to provide a biasing force on a liquid sample
delivered through the sample receiving port.
37. A system for performing PCR and monitoring the reaction during
temperature cycling comprising; a chamber; a plurality of sample
containers, each sample container comprising walls composed of an
optically transparent material and defining a volume having a first
and second dimension, wherein the first dimension is less than the
second dimension and the ratio of volume to external surface area
of the container is less than 1 mm, wherein each sample container
is formed for holding a maximum volume of 1 milliliter of a sample;
means for moving the sample containers sequentially into and out of
a monitoring position located with in the chamber; a forced air
heater for heating each PCR sample simultaneously within said
chamber, regardless of whether the sample is in or out of the
monitoring position, at a rate of at least 0.5.degree. C./second;
means for cooling each PCR sample simultaneously within said
chamber, regardless of whether it is in or out of the monitoring
position, at a rate of at least 0.5.degree. C./second; control
means for repeatedly operating the forced air heater, when the
means for detecting the fluorescence of the excited sample detects
no more product generation, and the means for cooling, when the
means for detecting the fluorescence of the excited sample detects
that the product is completely melted, to subject the PCR sample to
thermal cycling; means for optically exciting the sample in the
monitoring position within said chamber to cause the sample to
fluoresce; means for detecting the fluorescence of the excited
sample during amplification when the sample container is in the
monitoring position; means for determining at least one reaction
parameter in accordance with the detected fluorescence; and means
for adjusting the control means in accordance with the reaction
parameter.
38. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 37 in which the control
means adjusts the operation of the means for heating and the means
for cooling to alter the times the forced air heater and the means
for cooling operate in accordance with the reaction parameter.
39. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 37 in which the control
means adjusts the operation of the forced air heater and the means
for cooling to alter the rate at which the biological sample is
heated and cooled in accordance with the reaction parameter.
40. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 37 wherein the means for
moving the PCR sample containers comprises a rotatable
carousel.
41. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 37 further comprising means
for positioning the means for optically exciting the sample and the
means for detecting the fluorescence of excited sample to optimize
the fluorescence which is detected.
42. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 37 wherein the means for
cooling comprises an air movement mechanism which transports
ambient air to the sample container.
43. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 37 wherein the control
means comprises a microprocessor.
44. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 37 wherein the means for
optically exciting the sample comprises a photo emitter structure
positioned so that the radiation emitted therefrom impinges the
first side of the sample container in the monitoring position.
45. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 44 wherein means for
detecting the fluorescence of the excited sample comprises a photo
detector structure positioned so that the radiation emitted from
the second side of the sample container in the monitoring position
is detected.
46. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 37 wherein the means for
optically exciting the sample comprises a photo emitter structure
positioned so that the radiation emitted therefrom impinges the end
of the sample container in the monitoring position.
47. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 46 wherein the means for
detecting the fluorescence of the excited sample comprises a photo
detector structure positioned so that the radiation emitted from
the end of the sample container in the monitoring position is
detected.
48. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 37 wherein the means for
determining at least one reaction parameter in accordance with the
detected fluorescence comprises means for determining at least one
reaction parameter selected from the group consisting of: product
melting temperature, product melting time, product reannealing
temperature, product reannealing time, probe melting time, primer
annealing/extension temperature, and primer annealing/extension
time.
49. A system for performing PCR and monitoring the reaction in real
time during temperature cycling comprising: a chamber a plurality
of sample containers for holding a plurality of PCR samples, each
sample container comprising an optically clear capillary tube, each
sample container formed for holding a maximum volume of 1
milliliter of a sample and having a sealed end and an open end with
a sealable closure on the open end; a rotatable carousel rotatable
mounted within said chamber and formed for holding the sample
containers to move the sample containers one by one to a monitoring
position, said monitoring position located within said chamber;
means for forcing hot gas into contact with the plurality of sample
containers in the carousel; means for forcing cool gas into contact
with the plurality of sample containers in the carousel; means for
repeatedly operating the means for forcing hot gas and the means
for forcing gas fluid to subject the PCR samples to thermal cycling
within said chamber; means for optically exciting at least one
selected PCR sample in the monitoring position to cause the
selected PCR sample to fluoresce; means for detecting the
fluorescence of the excited selected PCR sample in the monitoring
position at both a first wavelength and a second wavelength; means
for determining at least one reaction parameter for the selected
PCR sample in accordance with the detected fluorescence at the
first and second wavelengths and displaying the reaction parameter
in a visually perceptible manner in real time; and means for
adjusting the means for repeatedly operating in accordance with the
reaction parameter such that the reaction is adjusted in real
time.
50. A system for performing PCR and monitoring the reaction in real
time during temperature cycling as defined in claim 49 wherein the
means for determining at least one reaction parameter in accordance
with the detected fluorescence at the first and second wavelengths
and displaying the reaction parameter in a visually perceptible
mariner in real time comprises means for determining a reaction
parameter selected from the group consisting of denaturation
temperature and time, primer annealing temperature and time, probe
annealing temperature and time, enzyme extension temperature and
time, and number of cycles.
51. A system for performing PCR and monitoring the reaction in real
time comprising; a chamber; a heater and a fan mounted in air flow
communication with the chamber and a controller for cycling the
temperature in the chamber according to initial predefined
temperature and time parameters; a carousel for holding a plurality
of sample vessels said carousel being rotatably mounted in said
chamber to move the sample vessels sequentially to a monitoring
position, said sample vessels comprising an optically transparent
material and walls defining a volume having at least first and
second dimensions wherein the first dimension is less than the
second dimension and wherein the ratio of volume to external
surface area of the vessel is less than 1 mm; a light emitting
source mounted in said chamber and positioned to illuminate at
least one of the sample vessels in the monitoring position along an
axis substantially parallel to a wall along the second dimension of
the vessel; a light detector mounted in said chamber and positioned
to measure fluorescence from at least one of the sample vessels in
the monitoring position along an axis substantially parallel to a
wall along the second dimension of the vessel; means for displaying
the status of the reaction based detected fluorescence; and means
for adjusting the controller such that one or more reaction
parameters the reaction is adjusted in real time.
52. The system of claim 51 wherein the carousel comprises: a disc
having a top surface, a bottom surface, an outer edge extending
therebetween, a sample receiving port in the top surface, a sample
vessel port in the outer edge, and a sample passageway
communicating with said sample receiving port and the sample vessel
port, said sample vessel port and passageway formed for receiving
and fixing a sample vessel to the disc.
53. The system of claim 52 wherein the passageway of the carousel
includes a barrier that prevents a liquid sample delivered through
the sample receiving port from flowing to the sample vessel port
absent a biasing force on said liquid sample.
54. The system of claim 53 further comprising a motor for rotating
the carousel to provide the biasing force on the liquid sample to
deliver the liquid sample through the sample receiving port.
55. The system of claim 51 wherein the sample vessels are capillary
tubes having an inner diameter ranging from about 0.02 mm to about
1.0 mm.
56. A system for performing PCR and monitoring the reaction
comprising: a chamber; a heater and a fan in air flow communication
with the chamber and a controller for cycling the temperature in
the chamber according to initial predefined temperature and time
parameters; a carousel for holding a plurality of sample vessels
said carousel being rotatably mounted in said chamber to move the
sample vessels one by one to a monitoring position located within
said chamber; the carousel comprising a disc having a top surface,
a bottom surface, and an outer edge extending therebetween, a
sample receiving port in the top surface, a sample vessel port in
the outer edge, and a sample passageway communicating with said
sample receiving port and the sample vessel port, said sample
vessel port and passageway formed for receiving and fixing a sample
vessel to the disc; the passageway including a barrier that
prevents a liquid sample delivered through the sample receiving
port from flowing to the sample vessel port absent a biasing force
on said liquid sample; a motor for rotating the carousel to provide
a biasing force on a liquid sample delivered through the sample
receiving port; said sample vessels comprising an optically
transparent material and walls defining a volume having at least
first and second dimensions wherein the first dimension is less
than the second dimension and wherein the ratio of volume to
external surface area of the vessel is less than 1 mm; a light
emitting source positioned to illuminate at least one of the sample
vessels in the monitoring position along an axis substantially
parallel to a wall along the second dimension of the vessel; a
light detector positioned to measure fluorescence from at least one
of the sample vessels in the monitoring position along an axis
substantially parallel to a wall along the second dimension of the
vessel; and a display for displaying the status of the reaction
based detected fluorescence.
57. The system of claim 56 further comprising an adjuster for
adjusting the controller such that one or more reaction parameters
the reaction is adjusted in real time.
58. The system of claim 56 wherein the sample vessels are capillary
tubes each having an inner diameter ranging from about 0.02 mm to
about 1.0 mm.
59. The system of claim 1 further comprising a movable platform on
which the means for optically exciting and means for detecting are
mounted.
60. The system of claim 1 wherein the means for detecting the
fluorescence of the excited sample during amplification detects
fluorescence throughout temperature cycling.
61. The system of claim 1 wherein the means for detecting the
fluorescence of the excited sample during amplification detects
fluorescence during an extension or combined annealing/extension
phase of temperature cycling.
62. The system of claim 1 wherein the rate of heating the PCR
sample and the rate of cooling the PCR sample is at least
4.0.degree. C./second.
63. The system for carrying out and monitoring the progress of
first and second biological reactions as defined in claim 22
wherein the thermal cycling means heats and cools the first
biological sample and the second biological sample at a rate of at
least 1.0.degree. C./second.
64. The system for carrying out and monitoring the progress of
first and second biological reactions as defined in claim 22
wherein the thermal cycling means heats and cools the first
biological sample and the second biological sample at a rate of at
least 4.0.degree. C./second.
65. The system for carrying out and monitoring the progress of
first and second biological reactions as defined in claim 22
wherein the thermal cycling means heats and cools the first
biological sample and the second biological sample at a rate of at
least 10.degree. C./second.
66. The system for carrying out and monitoring the progress of
first and second biological reactions as defined in claim 22
wherein the thermal cycling means heats and cools the first holding
means and the second holding means at a rate of at least
200.degree. C./second.
67. A system for performing PCR and monitoring the reaction during
temperature cycling comprising; a chamber; a sample container for
holding a PCR sample, the sample container comprising walls
composed of an optically transparent material and defining a volume
having a first and second dimension, wherein the first dimension is
less than the second dimension and the ratio of volume to external
surface area of the container is less than 1 mm, each sample
container formed for holding a maximum volume of 1 milliliter of a
sample; means for positioning the PCR sample container in a
monitoring position, said monitoring position located within said
chamber; means for heating the PCR sample at a rate of at least
10.degree. C./second; means for cooling the PCR sample at a rate of
at least 10.degree. C./second; control means for repeatedly
operating the means for heating and the means for cooling to
subject the PCR sample to thermal cycling within said chamber;
means for optically exciting the sample in the monitoring position
to cause the sample to fluoresce; and means for detecting the
fluorescence of the excited sample during amplification when the
sample is in the monitoring position.
68. Previously presented) A system for performing PCR and
monitoring the reaction during temperature cycling as defined in
claim 67 further comprising: means for determining at least one
reaction parameter in accordance with the detected
fluorescence.
69. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 68 further comprising means
for adjusting the control means in accordance with the reaction
parameter.
70. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 69 in which the control
means adjusts the operation of the means for heating and the means
for cooling to alter the times the means for heating and the means
for cooling operate in accordance with the reaction parameter.
71. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 69 in which the control
means adjusts the operation of the means for heating and the means
for cooling to alter the rate at which the biological sample is
heated and cooled in accordance with the reaction parameter.
72. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 67 wherein the sample
container is fabricated at least partially from glass, the sample
container having a volume of about 100 .mu.l.
73. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 67 wherein the means for
positioning the PCR sample container in a monitoring position
comprises a rotatable carousel.
74. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 67 further comprising means
for positioning the means for optically exciting the sample and the
means for detecting the fluorescence of excited sample to optimize
the fluorescence which is detected.
75. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 67 wherein the means for
heating the PCR sample comprises a forced air heater.
76. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 67 wherein the means for
cooling comprises an air movement mechanism which transports
ambient air to the sample container.
77. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 67 wherein the control
means comprises a microprocessor.
78. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 67 wherein the means for
optically exciting the sample comprises a photo emitter structure
positioned so that the radiation emitted therefrom impinges the
first side of the sample container.
79. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 78 wherein means for
detecting the fluorescence of the excited sample comprises a photo
detector structure positioned so that the radiation emitted from
the second side of the sample container is detected.
80. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 67 wherein the means for
optically exciting the sample comprises a photo emitter structure
positioned so that the radiation emitted therefrom impinges the end
of the sample container.
81. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 80 wherein the means for
detecting the fluorescence of the excited sample comprises a photo
detector structure positioned so that the radiation emitted from
the end of the sample container is detected.
82. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 68 wherein the means for
determining at least one reaction parameter in accordance with the
detected fluorescence comprises means for determining at least one
reaction parameter selected from the group consisting of: product
melting temperature, product melting time, product reannealing
temperature, product reannealing time, probe melting time, primer
annealing/extension temperature, and primer annealing/extension
time.
83. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 67 wherein the control
means comprises means cooling the sample when the means for
detecting the fluorescence of the excited sample detects that the
product is completely melted.
84. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 67 wherein the control
means comprises means for heating the sample when the means for
detecting the fluorescence of the excited sample detects no more
product generation.
85. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 67 wherein the means for
optically exciting is positioned to interact with the first side of
the sample container and the means for detecting the fluorescence
is positioned to interact with the second side of the sample
container.
86. A system for performing PCR and monitoring the reaction during
temperature cycling as defined in claim 67 wherein the means for
optically exciting is positioned to interact with the end of the
sample container and the means for detecting the fluorescence is
positioned to interact with the end of the sample container.
87. The system of claim 67 wherein the rate of heating the PCR
sample and the rate of cooling the PCR sample is at least
20.degree. C./second.
88. A system for carrying out and monitoring the progress of first
and second biological reactions comprising: a chamber; first
holding means for holding a first biological sample; second holding
means for holding a second biological sample; transporting means
for moving the first and second holding means between a non
monitoring position and a monitoring position, wherein said
transporting means and said monitoring and non monitoring positions
are all located with in said chamber; thermal cycling means for
repeatedly heating and cooling the first biological sample and the
second biological sample, in both the non monitoring position and
in the monitoring position, at a rate of at least 10.degree.
C./second; monitoring means for ascertaining the progress of the
first biological reaction in the first means for holding and the
second biological reaction in the second means for holding when the
first and second biological samples are in the monitoring position,
the means for monitoring comprising means for detecting radiation
emitted from the first and second biological samples; and
controlling means for controlling the operation of the transporting
means, thermal cycling means, and the monitoring means such that
the progress of the first and second biological reactions is
detected as thermal cycling occurs.
89. The system of claim 88 wherein the thermal cycling means heats
and cools the first biological sample and the second biological
sample at a rate of at least 20.degree. C./second.
90. The system of claim 1 wherein the rate of heating the PCR
sample and the rate of cooling the PCR sample is at least
1.0.degree. C./second.
Description
BACKGROUND
1. The Field of the Invention
This invention relates generally to apparatus which are used to
carry out biological processes, such as the polymerase chain
reaction. More specifically, the present invention relates to
apparatus and methods which carry out thermal cycling and
monitoring of various biological reactions, such as the polymerase
chain reaction.
2. The Background Art
In numerous areas of industry, technology, and research there is a
need to reliably and reproducibly subject samples to thermal
cycling. The need to subject a sample to repeated thermal cycles is
particularly acute in biotechnology applications. In the
biotechnology field, it is often desirable to repeatedly heat and
cool small samples of materials over a short period of time. One
such biological process that is regularly carried out is cyclic DNA
amplification.
Cyclic DNA amplification, using a thermostable DNA polymerase,
allows automated amplification of primer specific DNA, widely known
as the "polymerase chain reaction" or "PCR." Automation of this
process requires controlled and precise thermal cycling of reaction
mixtures usually contained in a plurality of containers. In the
past, the container of preference has been a standard, plastic
microfuge tube.
Commercial programmable metal heat blocks have been used in the
past to effect the temperature cycling of samples in microfuge
tubes through the desired temperature versus time profile. However,
the inability to quickly and accurately adjust the temperature of
the heat blocks through a large temperature range over a short time
period, has rendered the use of heat block type devices undesirable
as a heat control system when carrying out processes such as the
polymerase chain reaction.
Moreover, the microfuge tubes which are generally used have
disadvantages. The material of the microfuge tubes, their wall
thickness, and the geometry of microfuge tubes is a hindrance to
rapid heating and cooling of the sample contained therein. The
plastic material and the thickness of the wall of microfuge tubes
act as an insulator between the sample contained therein and the
surrounding medium thus hindering transfer of thermal energy. Also,
the geometry of the microfuge tube presents a small surface area to
whatever medium is being used to transfer thermal energy. The
continued use of microfuge tubes in the art, with their suboptimal
geometry, indicates that the benefits of improved thermal transfer
(which come by increasing the surface area of a sample container
for a sample of constant volume) has heretofore not been
recognized.
Furthermore, devices using water baths with fluidic switching, (or
mechanical transfer) have also been used as a thermal cycler for
the polymerase chain reaction. Although water baths have been used
in cycling a polymerase chain reaction mixture through a desired
temperature versus time profile necessary for the reaction to take
place, the high thermal mass of the water (and the low thermal
conductivity of plastic microfuge tubes), has been significantly
limiting as far as performance of the apparatus and the specificity
of the reaction are concerned.
Devices using water baths are limited in their performance. This is
because the water's thermal mass significantly restricts the
maximum temperature versus time gradient which can be achieved
thereby. Also, the water bath apparatus has been found to be very
cumbersome due to the size and number of water carrying hoses and
external temperature controlling devices for the water. Further the
need for excessive periodic maintenance and inspection of the water
fittings for the purpose of detecting leaks in a water bath
apparatus is tedious and time consuming. Finally, it is difficult
with the water bath apparatus to control the temperature in the
sample tubes with the desired accuracy.
U.S. Pat. No. 3,616,264 to Ray shows a thermal forced air apparatus
for cycling air to heat or cool biological samples to a constant
temperature. Although the Ray device is somewhat effective in
maintaining a constant temperature within an air chamber, it does
not address the need for rapidly adjusting the temperature in a
cyclical manner according to a temperature versus time profile such
as is required for biological procedures such as the polymerase
chain reaction.
U.S. Pat. No. 4,420,679 to Howe and U.S. Pat. No. 4,286,456 to
Sisti et al. both disclose gas chromatographic ovens. The devices
disclosed in the Howe and Sisti et al. patents are suited for
carrying out gas chromatography procedures but do not provide
thermal cycling which is substantially any more rapid than that
provided by any of the earlier described devices. Rapid thermal
cycling is useful for carrying out many procedures. Devices such as
those described in the Howe and Sisti et al. patents are not
suitable for efficiently and rapidly carrying out such
reactions.
In particular, the polymerase chain reaction (PCR) is a fundamental
DNA amplification technique essential to modern molecular biology.
Despite its usefulness and popularity, the current understanding of
PCR is not highly advanced. Amplifications must be optimized by
trial and error and protocols are often followed blindly. The
limited understanding of PCR found in the art is a good example of
how those skilled in the art are content to utilize a powerful
technique without reflection or comprehension.
Biological processes such as PCR require temperature cycling of the
sample. Not only does the prior art, as explained above, carry out
temperature cycling slowly, the prior art also ignores the
underlying principles which allow PCR to work and could be used to
make PCR even more useful. Thus, it would be a great advance in the
art to provide methods and apparatus which are particularly
adaptable for rapidly carrying out PCR and analyzing the reaction
which is taking place, particularly if such reaction is analyzed as
it is taking place, that is, in real time.
BRIEF SUMMARY AND OBJECTS OF THE INVENTION
In view of the above described state of the art, the present
invention seeks to realize the following objects and
advantages.
It is an object of the present invention to provide an apparatus
for accurately controlling the temperature of biological
samples.
It is a further object of the present invention to provide a
thermal cycling apparatus for quickly and accurately varying the
temperature of biological samples according to a predetermined
temperature versus time profile.
It is another object of the present invention to provide an
apparatus suitable for subjecting a number of different biological
samples to rapid thermal cycling.
It is also an object of the present invention to provide a thermal
cycling apparatus having a thermal transfer medium of low thermal
mass which can effectively subject samples to a large temperature
gradient over a very short period of time.
It is a further object of the present invention to provide an
apparatus which can subject a biological sample to rapid thermal
cycling using air as a thermal transfer medium.
It is another object of the present invention to provide a thermal
cycling apparatus which will heat samples located in a fluid
chamber therein, by means of an internal heater, and will
subsequently cool the samples by moving ambient fluid into the
chamber, at the proper time in the thermal cycle, to cool the
samples.
It is an object of the present invention to provide a system and
method for performing PCR rapidly and for simultaneously monitoring
the reaction.
It is another object of the present invention to provide a system
and method for performing PCR rapidly and also continuously
monitoring the reaction while it is ongoing.
It is a further object of the present invention to provide a system
and method for performing PCR rapidly while also adjusting the
reaction parameters while the reaction is ongoing.
It is another object of the present invention to replace the
nucleic acid probes by synthetic nucleic acid analogs or
derivatives, e.g., by peptide nucleic acids (PNA) provided that
they can also be labeled with fluorescent compounds.
These and other objects and advantages of the invention will become
more fully apparent from the description and claims which follow,
or may be learned by the practice of the invention.
In accordance with one aspect of the present invention, an
apparatus is provided which is particularly suited for subjecting
biological samples to rapid thermal cycling in order to carry out
one or more of a number of procedures or processes. In one of its
preferred forms, the apparatus includes a means for holding a
biological sample. In some preferred embodiments, the structure
which holds a biological sample, also referred to as a sample
chamber, is provided with an insulation means for retaining thermal
energy and also a means for heating the interior of the sample
chamber. In some preferred embodiments, an incandescent lamp
functions as a means for heating the interior of the sample
chamber. In further embodiments, hot or cool air is conveyed into
and out of a chamber holding the biological sample. In some
preferred embodiments, a thermal insulator is disposed along the
interior of the sample chamber and functions to retain the heat
generated by the lamp within the sample chamber and serves as an
insulation means.
In order to rapidly cool the sample chamber, the preferred
apparatus includes a means for forcing air into the sample chamber
and a means for dispersing the air forced into the sample chamber.
The preferred structures included in some embodiments are a high
velocity fan which functions to force air into the sample chamber
and a rotating paddle which functions to disperse the air into the
chamber. In some embodiments, a means for venting allows the air to
escape from the sample chamber taking the unwanted heat with it.
The present invention allows heating and cooling of a sample to
take place both quickly and uniformly.
In accordance with the method and the apparatus of the present
invention, a control structure provides means for operating the
system through a desired time versus temperature profile. The
present invention is particularly well suited for carrying out
automated polymerase chain reaction procedures.
The controller of the present invention allows the biological
samples to pass through a predetermined temperature cycle
corresponding to the denaturation, annealing and elongation steps
in the polymerase chain reaction. In use, the apparatus of the
present invention allows rapid optimization of denaturation,
annealing, and elongation steps in terms of time and temperature,
and shortened time periods (ramp times) between the temperatures at
each step.
The present invention particularly decreases the total time
required for completion of polymerase chain reaction cycling over
prior art thermal cycling devices while at the same time
significantly increasing specificity and yield.
In accordance with another aspect of the present invention, the
present invention provides methods and apparatus for monitoring of
DNA amplification so as to track the progress of such procedures.
In particular, the present invention provides methods and apparatus
for continuous fluorescence monitoring of the polymerase chain
reaction procedure. In preferred embodiments of the present
invention, optical components are combined with structures to
provide rapid temperature cycling in order to continuously monitor
DNA amplification by a variety of different fluorescence
techniques. Glass capillary sample containers and composite
plastic/glass sample containers allow rapid heat transfer from the
preferred thermal transfer medium (allowing 30 amplification cycles
in less than 15 minutes when a gas such as air is used as the
thermal transfer medium) and simultaneous monitoring of the
reaction.
In accordance with another aspect of the present invention, optical
techniques are used to monitor the progress of the reaction as the
reaction is ongoing. In some preferred embodiments of the
invention, flourescent probes are added to the reaction mixture.
The present invention then monitors the fluorescence at least once
during a temperature transition, and preferably the fluorescence is
acquired two or more times during a temperature transition, either
from a single sample or from multiple samples. In some preferred
embodiments a rotating carousel is included to sequentially move
the samples, one-by-one, to a monitoring location with all of the
samples being simultaneously subjected to rapid thermal cycling.
Desirably, embodiments of the present invention provide for
monitoring of fluorescence once per amplification cycle or
monitoring temperature, time, and fluorescence continuously
throughout each amplification cycle.
Using the present invention, a 3-dimensional plot of temperature,
time, and fluorescence, can be obtained. Fluorescence vs.
temperature plots of hybridization probes discriminate between the
cumulative, irreversible signal of exonuclease cleavage and the
temperature-dependent, reversible hybridization of adjacent probes.
Hybridization probes are more useful than hydrolysis probes because
the temperature dependence of fluorescence can be followed and used
to detect alterations in product sequence, i.e., polymorphisms and
mutations. Using dyes that fluoresce in the presence of double
stranded DNA, product denaturation, reannealing and extension can
be followed within each cycle. The present invention provides
apparatus and methods for rapidly carrying out DNA amplification
reactions which combines amplification and analysis of the reaction
in under fifteen minutes and more preferably in under fifteen
minutes and most preferably in under ten minutes.
BRIEF DESCRIPTION OF THE DRAWINGS
In order to better appreciate how the above-recited and other
advantages and objects of the invention are obtained, a more
particular description of the invention briefly described above
will be rendered by reference to specific embodiments thereof which
are illustrated in the appended drawings. Understanding that these
drawings depict only typical embodiments of the invention and are
not therefore to be considered limiting of its scope, the invention
will be described and explained with additional specificity and
detail through the use of the accompanying drawings in which:
FIG. 1 shows a perspective view of a thermal cycling apparatus
adapted for thermal cycling of biological samples and adapted
especially for use in cyclic DNA amplification, according to the
concepts of the present invention.
FIG. 2 is a side elevation view of the fluid chamber portion of the
apparatus of FIG. 1.
FIG. 3 is an interior plan view of the fluid chamber portion of the
apparatus illustrated in FIG. 1.
FIG. 4 shows an interior plan view of the fluid chamber of another
embodiment of the present invention.
FIG. 5 shows an optimized temperature versus time profile for a
polymerase chain reaction using the thermal cycling device of the
present invention.
FIG. 6 shows graphically the effect of denaturation time on
polymerase chain reaction yields using one thermal cycling device
of the present invention.
FIG. 7 shows graphically the effect of annealing time on polymerase
chain reaction specificity and yields using the thermal cycling
device of the present invention.
FIGS. 8A B, which are perspective and elevational cross sectioned
views, respectively, of another preferred embodiment of the present
invention.
FIG. 8C is a diagrammatic representation of the relationship of the
heat producing element and the capillary tubes holding the
biological samples in the embodiment illustrated in FIGS. 8A B.
FIG. 9A shows the results of four different temperature/time
profiles (A D) and their resultant amplification products after
thirty cycles (A D).
FIG. 9B shows a cycle of another preferred temperature/time profile
used by the present invention.
FIGS. 9C G show exemplary cycles of other preferred
temperature/time profiles used by the present invention.
FIG. 10 provides a block diagram of a temperature slope control
circuit in accordance with the present invention.
FIG. 10A is a graphical representation of the effect of the
temperature transition rate from the product denaturation
temperature to the primer annealing temperature on reaction product
specificity.
FIG. 11 is a schematic view of a preferred rapid temperature cycler
with fluorescence detection in accordance with the present
invention.
FIG. 11A is a temperature v. time chart of showing one preferred
operation of the apparatus of FIG. 11.
FIG. 12 is a representation of three dimensional plots of
temperature, time, and fluorescence during amplification of a
hepatitis B DNA fragment in the presence of SYBR Green I.
FIGS. 12A C are representations of two dimensional plots of
temperature vs. time, fluorescence vs. time, and fluorescence vs.
temperature which are together shown as a three dimensional plot in
FIG. 12.
FIG. 13 is a plot of fluorescence vs. temperature during the
amplification of a 536 base pair fragment of the human
.beta.-globin gene in the presence of SYBR Green I.
FIG. 14 is a plot of fluorescence vs. cycle number obtained in
accordance with an aspect of the present invention.
FIG. 14A provides a legend for FIG. 14, and subsequent figures,
indicating different initial template copy numbers.
FIG. 15 is a plot of fluorescence vs. cycle number obtained in
accordance with an aspect of the present invention.
FIG. 16 is a fluorescence ratio vs. temperature plot obtained in
accordance with one aspect of the present invention.
FIG. 17 is a fluorescence ratio vs. temperature plot obtained in
accordance with one aspect of the present invention.
FIG. 18A is a graph representing an equilibrium PCR paradigm.
FIG. 18B is a graph representing a kinetic PCR paradigm.
FIG. 18C is a graph representing different time/temperature
profiles near an annealing temperature.
FIG. 19 represents another preferred embodiment of the present
invention configured for continuous monitoring of a sample.
FIGS. 19A 19D are representations of different sample container
configurations.
FIG. 19E is a chart which shows the effect of the different sample
container configurations of FIGS. 19A D on the temperature response
of the sample itself.
FIGS. 19F and 19G are side and end views, respectively, of one
preferred sample container in accordance with the present
invention.
FIGS. 19H and 19I, respectively, show two possible orientations of
a rectangular capillary tube when detecting fluorescence of the
sample.
FIG. 20 shows the optical layout of another preferred embodiment in
accordance with the present invention to provide continuous
monitoring of a sample undergoing DNA amplification.
FIG. 21 is a schematic representation of another embodiment of the
present invention which is a rapid temperature cycler with
fluorescence detection at the tip of the sample containers.
FIGS. 21A D show composite plastic/glass containers into which
biological samples are loaded.
FIG. 22 illustrates useful temperature vs. time segments for
fluorescence hybridization monitoring.
FIG. 22A charts the effectiveness of light piping by viewing the
tip rather than the side of capillary sample container.
FIG. 22B charts the efficiency of light piping by two different
sizes of capillary sample tubes.
FIG. 22C is a high level block diagram showing the tasks which are
performed by one preferred embodiment of the present invention
which includes a rapid temperature cycler with epifluorescence
detection.
FIG. 22D is a plot of temperature vs. time for a PCR reaction in
which fluorescence feedback was used to control reaction
parameters.
FIG. 22E is a plot of fluorescence vs. time for a PCR reaction in
which fluorescence feedback was used to control reaction
parameters.
FIG. 23 is a plot of fluorescence vs. time showing showing the
inverse relationship between temperature and fluorescence.
FIG. 24 is a plot of temperature vs. time showing the inverse
relationship between temperature and fluorescence.
FIG. 25 is a plot of fluorescence vs. temperature for three
different PCR products in the presence of SYBR Green 1 acquired
during a 0.2 degree per second temperature transition through the
product melting temperatures.
FIG. 26 is a plot of fluorescence vs. time showing product
annealing for different concentrations of PCR product in the
presence of SYBR Green 1.
FIGS. 27A and 27B are cross sectional schematic views of the
embodiment represented in FIG. 28 in a run mode and a load mode,
respectively.
FIG. 28 is a schematic representation of another embodiment of the
present invention which is a rapid temperature cycler with
fluorescence detection at the tip of the sample containers and
which includes positioning for fluorescence detection in two
dimensions to optimize detection.
FIG. 29 is a perspective view of the exterior of the embodiment of
the present invention including the components illustrated in the
schematic representation of FIG. 28.
FIGS. 30A 30V are detailed schematic diagrams of the electrical
components of one preferred embodiment of the present
invention.
FIGS. 31A and 31B are perspective and cross sectional views,
respectively, of a sample handling system in accordance with the
present invention.
FIG. 32 is a schematic representation of another embodiment of the
present invention which accommodates multiple sample handling
trays.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Reference will now be made to the drawings wherein like structures
will be provided with like reference designations.
As shown in FIG. 1, the one preferred thermal cycling device 10
includes a closed loop fluid (most preferably air) chamber,
generally designated at 11, which is adapted to accept samples to
be cycled through vent door 14. The closed loop fluid chamber 11
includes a plurality of compartments each of which will be
described shortly. The device 10 also includes a controller 12
which can be programmed by means of input keys 25 and display 26 to
cause the chamber 11 to be cycled through a series of temperatures
over a predetermined period of time. The thermal cycling of chamber
11 can be used to carry out numerous procedures and is particularly
suited for amplification of primer specific DNA from samples
containing reaction mixtures as will be explained below.
The closed loop fluid chamber 11 is enclosed in a generally box
shaped configuration by housing 13. Blower mounting boards 16, if
desired, can be located so as to section off a smaller rectangular
section of the chamber 11 and function to support and secure a
generally cylindrically shaped lower housing 15 thereto.
Alternatively, the fan of the blower 28 may be housed integrally
within chamber housing 13.
The interior of blower housing 15 contains the blades and shaft of
the blower. The blower motor (not shown) is located externally of
blower housing 15, and therefore exteriorly of the enclosed chamber
11. In this configuration, the blades and shaft are the only parts
of the blower which become exposed to the circulating hot fluid
within chamber 11. It would be disadvantageous to mount the motor
within the chamber which would subject the motor to temperature
variations and also would add the thermal mass of the motor to that
which is subject to heating and cooling. The reduction of thermal
mass exposed to the fluid in chamber 11 is desirable to the overall
performance of the device 10 in its function of subjecting samples
placed therein to a desired temperature versus time profiles, using
either predetermined profiles or by altering one or more reaction
parameters as the reaction continues, as will be more fully
explained below.
The blower 28 is a well known type of blower usually identified as
an "in line" type blower which preferably employs a propeller type
fan, due to its generally low thermal mass, or if desired, a
squirrel cage type fan, the fan preferably having a 75 cubic feet
per minute minimum capacity.
The solenoid platform 17 has secured thereto a solenoid 18. The
solenoid armature 19 is attached to upper end 21 of rod 20 which is
rigidly attached to vent door 14 and rotatably attached to housing
13 at points above and below the vent door 14. The rod 20 therefore
allows vent door 14 to freely rotate relative to the housing 13
about the rod's longitudinal axis.
A spring 22 is attached at one of its ends to the housing 13 by
support post 23. The opposite end of spring 22 is attached to the
top end 21 of rod 20 directly adjacent the attachment of solenoid
armature 19. The spring 22 is drawn between these two attachment
points so as to be in tension. The spring 22 therefore tends to
draw top end 21 toward the support post 23, which in turn tends to
rotate vent door 14 to its closed position. When solenoid 18 is
actuated, armature 19 tends to pull top end 21 of the rod 20 in the
direction of the solenoid 18, which is opposite the direction of
pull of spring 22, and which tends to open the vent door 14.
Controller, generally designated at 12, is electrically attached to
the chamber 11 by means of a transmission cable 24. The cable 24
also supplies power to the blower motor (not shown), and to the
heat coil 31. Further, the controller 12 also is connected to
thermocouple sensor 35 for receiving signals corresponding to
temperature data, and to solenoid 18 for triggering the solenoid
armature.
Controller 12 can be any well known type of temperature controller
unit which is programmable to control the heat coil 31, vent door
14, and blower so as to achieve predetermined temperatures as a
function of time within the chamber 11, and which is also capable
of being programmed to actuate a relay output for driving a
solenoid at predetermined time periods and chamber temperature
levels. A preferred temperature controller 12 for use in the
embodiment of FIGS. 1 3 is a Partlow MIC-6000 proportional
temperature controller, available through Omega Engineering Inc, of
Stanford, Conn., as the Model No. CN8600 process controller.
As shown in FIGS. 2 and 3, the interior of chamber 11 is sectioned
off into four main compartments. The blower compartment 28 is
formed of the blower housing 15 and the blower mounting plates 16.
The entirety of blower compartment 28 is filled with the fan and
shaft portions of a blower as has been described above. The blower
can be any of a number of well-known designs, as has been described
above, and has therefore been omitted from FIG. 3 for purposes of
clarity. It is sufficient for the present invention to understand
that the fan located in blower compartment 28 draws fluid into the
blower compartment 28 through inlet opening 36 and pushes the fluid
out of exit opening 37.
It is preferred that the fluid be driven by the blower at a rate of
at least 75 cubic feet per minute. It is important however, in
regard to the present invention, to realize that the fluid located
in chamber 11 only contacts the fan and a portion of the drive
shaft of the blower, the blower motor itself being located outside
of the blower housing 15 so as to avoid any contact thereof with
fluid in the chamber 11. This consideration contributes to the
speed of operation of the invention to minimize the material which
contacts the fluid inside the chamber 11 so as to minimize the
thermal mass of material which must be heated and/or cooled thereby
during the cycling process. By minimizing the thermal mass which
must be heated or cooled by the fluid, the response time necessary
to bring the contents of chamber 11 to a uniform temperature is
greatly diminished.
Fluid exiting blower compartment 28 through outlet opening 37
enters heating compartment 29. Fluid passing into heating
compartment 29 must pass by heating coils 31. If the heating coils
31 get hotter than the fluid passing into heating compartment 29,
the fluid will become heated thereby as it is forced through the
compartment. The heating coil is preferably a 1,000 watt (125 VAC)
nichrome wire coil wound around a microsupport. However, any
heating unit suitable for heating the type of fluid present in the
chamber may be used. The particular heating coil of embodiment of
FIGS. 1 3 is manufactured by Johnstone Supply, of Portland,
Oreg.
The heating coil is activated by an output relay included in the
controller 12. The preferred relay is a 25 A, 125 VAC solid state
relay manufactured by Omega Engineering Inc. of Stanford, Conn. as
Model No. Omega SSR 240 D25.
Fluid passing through heating compartment 29 becomes incident on
baffles 32 and 33 before passing into the reaction compartment 30.
Baffles 32 and 33 tend to break up any laminar fluid flow and
generate turbulence therein to effectively mix the fluid so that it
arrives in reaction compartment 30 at an homogenous
temperature.
Thermocouple sensor 35 provides an electrical input signal to
controller 12 which corresponds to the fluid temperature in the
reaction compartment 30. Temperature monitoring during operation of
the thermal cycling device 10 is preferably achieved by a 30-gauge
iron-constantan "J-type" thermocouple. The controller uses this
information to regulate the heat coil 31 according to the
predetermined temperature versus time profiles programmed therein
and to actuate solenoid 18, as will be explained momentarily.
The fluid passing from the reaction compartment 30 to the return
air compartment 34 must pass through sample compartment 27 (as
shown in dashed lines). Sample compartment 27 will also be
explained momentarily.
The fluid in return compartment 34 has been slightly cooled due to
the heat transfer therefrom into samples located in sample
compartment 27. The fluid in return compartment 34 is drawn through
inlet opening 36 into blower compartment 28 where it is again
forced, by action of the fan, out through outlet opening 37 into
the heating compartment 39. Thus, the fluid chamber 11, when
operating with vent door 14 closed, is a closed loop fluid chamber
which continuously recirculates the fluid along a closed loop path
through each compartment thereof in order to bring the contents
therein to a uniform temperature. Continuous circulation of the air
in the air chamber 11 allows the samples in sample compartment 27
to be brought to a predetermined temperature as quickly as
possible, and then to be held at that temperature, if desired.
When the device 10 must be used to not only heat material located
in the reaction compartment 27, but also to subsequently cool these
materials as quickly as possible to a temperature at or above the
ambient fluid (air) temperature, the controller 12 can be
programmed to actuate solenoid 18 to cause vent door 14 to open and
allow large quantities of ambient fluid to immediately flood the
compartment 11 while heated fluid therein simultaneously
escapes.
Deactivation of the heating coil 31 while continuing activation of
the blower with vent door 14 open, will draw ambient fluid into
return compartment 34 and from there into the blower compartment
28. The blower will then push this ambient fluid through heating
compartment 29 where it will pass directly into reaction
compartment 30 without being heated by coil 31. The ambient fluid
then passes through the sample compartment 27 and escapes out of
chamber 11 through the vent door 14. Due to the minimum thermal
mass of material located in chamber 11, and the action of the
blower fan, vast quantities of ambient fluid will be forced past
the sample compartment 27, and from there out of the chamber 11.
Thus, rapid cooling of samples or material located in the reaction
compartment 27 is obtained. The sample compartment 27 is sized so
as to allow a plurality of samples, such as hollow elongate glass
tubes containing a sample therein, to be easily located in a spaced
apart orientation so that fluid may be evenly distributed around
each sample. If desired, the sample compartment 27 may be sized and
configured so as to allow insertion of a rack, basket, or the like
which has been configured so as to accept a plurality of samples in
uniform spaced apart configuration so as to simplify loading the
samples into the sample chamber 27.
Access to sample compartment 27 is accomplished by rotation of the
vent door 14 to its open position. Once the vent door 14 is rotated
to approximately 90 degrees from it's closed position, the sample
compartment 27 is easily accessible there through. Also, as can be
seen in FIGS. 1 3, rotation of vent door 14 approximately 90
degrees from its closed position causes return fluid compartment 34
to be substantially closed off from the reaction compartment 30.
Thus, when the device 10 of the present invention is in a "cooling"
mode, ambient fluid enters directly into the return fluid
compartment 34 and is forced through the blower compartment 28,
heating compartment 29, reaction compartment 30, and sample
compartment 27 substantially along the same path as the closed loop
fluid flow path described above. The fluid is then forced out of
the air chamber 11 and prevented from passing back into air return
compartment 34 by the positioning of the vent door 14 between the
sample compartment 27 and the return fluid compartment 34.
Thus, the vent door 14 not only allows ambient fluid to enter the
chamber 11, it can also prevent the fluid from recirculating in a
loop fashion through the chamber 11. Instead, fluid is forced to
pass through the sample compartment 27 and then out of the chamber
11 to aid in the rapid cooling of the sample contents and chamber
11.
When the device 10 of the present invention is used for cyclic DNA
amplification, repetitive cycling through different temperatures is
required. Samples containing a reaction mixture for the polymerase
chain reaction generally must be cycled approximately 30 times
through temperature changes which correspond to the denaturation,
annealing and elongation phases of the amplification process.
The device 10 of the present invention, due to its novel
characteristics described above, is capable of cycling samples in
significantly shortened periods compared to the prior art. For
example, the DNA amplification application of the embodiment
represented in the figures can pass through a temperature versus
time profile cycle in 30 60 seconds (see FIG. 5). This same cycle
using prior art devices would take approximately 5 10 times longer.
These low cycle times have proven also to increase yield and
specificity of the polymerase chain reaction over prior art
cycling.
EXAMPLE 1
The polymerase chain reaction was run in a 10 .mu.l volume with 50
ng of human genomic template DNAes, 0.5 mM of each deoxynucleotide,
500 nM of each of two oligonucleotide primers
GGTTGGCCAATCTACTCCCAGG (SEQ ID NO:5) and GCTCACTCAGTGTGGCAAAG (SEQ
ID NO:6) in a reaction buffer consisting of 50 mM Tris-HCl (pH 8.5
at 25.degree. C.), 3.0 mM magnesium chloride, 20 mM KCl, and 500
.mu.g/ml bovine serum albumin. Thermus aquaticus DNA polymerase
(0.4.mu.) was added, the samples placed in 8 cm long, thin-walled
capillary tubes (manufactured by Kimble, Kimax 46485 1), and the
ends fused with a laboratory gas burner so that an air bubble was
present on both ends of each tube.
The capillary tubes were then placed vertically in a holder
constructed of 1 mm thick "prepunched perfboard" (manufactured by
Radio Shack). The mixture was cycled 30 times through denaturation
(90 92.degree. C.), annealing (50 55.degree. C.), and elongation
(72 75.degree. C.) to give the temperature versus time profile of
FIG. 5. Temperature monitoring of the capillary tubes was done with
a miniature thermocouple (IT-23, Sensortek, Clifton, N.J.) placed
in 10 .mu.l of deionized water and connected to a thermocouple
monitor (BAT-12, Sensortek) Amplification products were
fractionated by electrophoresis on a 1.5% agarose gel. Specific
amplification products were obtained in good yield.
Due to the fact that the device 10 of the present invention uses
air as the thermal transfer medium instead of water, it has the
advantage that heat transfer occurs through a low heat capacity
medium (air) which can be warmed very rapidly.
The response time for sample cooling is very fast due to the use of
thin walled glass capillary tubes for holding samples, instead of
plastic microfuge tubes as has been done in the past with prior art
processes, and by minimizing the thermal mass of material inside
the chamber 11 (see FIG. 5). Such response times can allow for
optimization of the time and temperature requirements for the
denaturation, annealing, and elongation steps in the polymerase
chain reaction.
Further, shortened "ramp" times are obtained, i.e., the time
required to bring the temperature of the sample from one
temperature level to the next temperature level corresponding to
phases in the amplification process is shortened. This decreases
the time required for a complete amplification, as well as allowing
specific study of annealing, denaturation and enzyme kinetics
within a polymerase chain reaction protocol.
The baffles 32 and 33 (as shown in FIG. 3) may be used if desired
to achieve better temperature homogeneity within the sample
compartment 27. As shown in this embodiment, baffles 32 and 33
decrease the temperature variation in the reaction compartment 30
from about 10.degree. C., to about 2.degree. C. If desired, further
(or more complicated) baffles may be used to further decrease the
temperature variation in reaction compartment 30. Alternately, as
shown in FIG. 4 the fan may be positioned downstream from the
heating coil 31, but before the sample compartment 27 to achieve
more uniform mixing.
Amplification products obtained through the use of apparatus 10 are
at least qualitatively and quantitatively as desirable as those
obtained through the manual water bath cycling method. However,
advantages in specificity and yield are possible with rapid thermal
control of the reaction mixture.
FIG. 6 shows the effect of the temperature versus time profile of
FIG. 5 as used with the thermal cycling apparatus 10 on specificity
(i.e., one specific product yield as opposed to a plurality of
similar or "shadow" products). As can be seen, the shorter the ramp
and annealing time, the greater the product specificity. The rapid
temperature response of the apparatus 10 allows improved
specificity and yield which is not possible with prior art
systems.
FIG. 7 shows the effect of varying the denaturation time of the
temperature versus time profile of FIG. 5 as used with the thermal
cycling apparatus 10 of the present invention on DNA amplification
yields. The brighter vertical lines each correspond to a particular
time at a denaturation temperature. As can be seen, the yield is
greatest at the shortest possible denaturation time. Such a result
is not possible with prior art systems.
As has been shown, by decreasing the thermal capacity (thermal
mass) of the apparatus 10, the present invention can markedly
decrease the total time required for carrying out the polymerase
chain reaction. In addition, the use of small sample volumes
further shortens the total time required for the reaction and also
reduces the amounts of expensive reagents which must be used by up
to about 90%, thus further reducing the cost of carrying out
procedures using the present invention. For example, in the
embodiment represented in FIGS. 1 3, capillary tubes 108 having
inner diameters in the range from about 0.25 mm to about 11.0 mm
can desirably be used. In some applications, capillary tubes 108
having inner diameters in the range from about 0.02 mm to about 0.1
mm can also be desirably used.
The apparatus 10 of the present invention is useful for amplifying
DNA from any source. Although particular configurations and
arrangements of the present invention have been discussed in
connection with the specific embodiments of the thermal cycling
device 10 as constructed in accordance with the teachings of the
present invention, other arrangements and configurations may be
utilized. For example, various fluids other than air, of generally
low thermal mass, may alternatively be used in the device 10.
Another embodiment of the present invention is represented in FIGS.
8A C. FIG. 8A is a perspective view and FIG. 8B is an elevational
cross sectioned view of the additional embodiment. It will be
understood that many of the earlier explained components and
teachings also have application in the embodiment illustrated in
FIGS. 8A C. Thus, only the pertinent additional information
concerning this embodiment will be provided below. Importantly, in
the embodiment of FIGS. 8A C, the heat producing element is
adjacent to the biological sample containers allowing faster
heating and cooling of biological samples as explained below.
As will be appreciated shortly, the apparatus of FIGS. 8A C
provides even greater improvement over the prior art in the speed
at which thermal cycling can be carried out, e.g., 15 or 30 cycles
of DNA amplification in 30, 15, 10, or even fewer, minutes.
Furthermore, the apparatus 100 provides better thermal
homogenization throughout the samples than previously possible.
Shown in FIG. 8A is the general configuration of the housing 102 of
the embodiment. The housing 102 rests on feet 104 (best seen in
FIG. 8B) and functions to hold the other described structures in
place and to isolate those structures which become hot from the
surrounding environment. Included in the embodiment 100 of FIG. 8A
are input keys 25 and a display 26 as in the previously described
apparatus 10. The previously described control structures can
readily be modified or used as a pattern for a control means for
use in the embodiment of FIGS. 8A C.
As shown best in the cross sectional view of FIG. 8B, a sample
chamber is designated by bracket 106. A lid 138 connected to the
housing 102 by a hinge 131 can be opened to allow access to the
sample chamber 106. The sample chamber 106 is preferably
cylindrical in shape but can be of any shape or size required by
the particular application.
The sample chamber 106 is preferably lined with a black colored
foam material 110 whose surface has light absorbing characteristics
with the bulk of the thickness of the foam having insulating
characteristics. The black foam material can be one which is
readily available in the art and one fabricated from a plastic
material. The foam 110 is preferably a material which is readily
cooled by the air passing there over, i.e., the material has low
thermal conductivity and a porous surface.
The dark or black porous surface of the material converts shorter
wavelength radiation striking the surface into longer wavelength
radiation, i.e., heat, which is radiated into the sample
chamber.
The foam 110 functions to thermally isolate the sample chamber from
the surrounding air space in the housing and also to convert the
light emitted by lamp 112 into thermal energy. The foam 110 can be
replaced with other structures. For example, a material having a
black, dark, or other nonreflective surface, such as a thin sheet
of polycarbonate having one surface painted black, can be backed by
an insulative material, such as a fiberglass or foam material. The
black or dark surface, which can be painted on a number of
different substrates, converts shorter wavelength radiation
striking it into thermal radiation while the insulative material
thermally isolates the sample chamber from the surrounding
environment. Thus, using the teachings provided herein, those
skilled in the art can utilize many different materials and
structures as a lining for the sample chamber.
The lamp 112 is preferably a 500 watt halogen lamp. If appropriate
control devices are used, higher power lamps or a plurality of
lamps, such as four 500 watt halogen lamps, can be used. A lamp
socket 112A is attached to the housing 102 by a support 112B. The
lamp 112 is able to very rapidly and uniformly heat the sample
chamber 106 to the desired temperature. Other sources of heat, i.e.
infrared radiation, such as the earlier described nichrome wire
element, can also be used within the scope of the present
invention.
Represented in FIG. 8B are two thin-walled capillary tubes 108 such
as those described earlier. While two thin-walled capillary tubes
108 are shown, the sample chamber 106 can hold many such tubes. The
thin-walled capillary tubes 108 have several important advantages
over previously used devices as described earlier and, together
with the sample chamber 106, function as the one presently
preferred example of a means for holding a biological sample.
It will be appreciated that many other structures performing
equivalent or similar functions can also be used. The thin-walled
capillary tubes 108 are preferably left partially extending out of
the sample chamber through apertures 140 for ease of access but may
be completely contained within the sample chamber 106 as may
numerous other fluid holding structures which are suited to
particular applications. The preferred thin-walled capillary tubes
108 have a capacity of about 10 .mu.l. As will be understood, the
volume of the sample should be keep small, and the surface area of
the sample holding structure relatively large, and together they
present a relatively small thermal mass. It is also preferred that
the sample holding structure contain a volume anywhere from about 1
pl to about 10,000 .mu.l but those skilled in the art will
appreciate that other volumes of samples can also be used within
the scope of the present invention if the different thermal mass of
the structure is considered.
The lamp 112 and the insulative foam 110 together provide rapid and
uniform heating of the sample contained in the thin-walled
capillary tubes 108 and the air contained within the sample chamber
106. A thermocouple 134 is included within the sample chamber 106
to sense the temperature within the chamber and is used to maintain
the desired temperature within the sample chamber as earlier
described.
The thermocouple 134 is preferably one available in the art whose
thermal response substantially matches the thermal response of the
biological sample and the container holding the same. Such
thermocouples can be commercially obtained from sources such as
Idaho Labs which manufactures a line of thermocouples referred to
as metal sheathed, J-type thermocouples. The matching of the
thermal response of the thermocouple to that of the biological
sample and container can be preferably carried out by inserting a
micro thermocouple, such as the model IT-23 thermocouple available
from PhysiTemp as known in the art, into a typical biological
sample being held by the chosen container and subjecting the sample
and the thermocouple under test to the same temperature changes.
The thermocouple under test, or some external criteria, can be
changed until the thermal response of the thermocouple suitably
matches the thermal response of the sample and its container.
The arrangement represented in FIG. 8B provides more uniform
heating and cooling of the sample than previously available
devices. In previously available devices, transfer of heat
throughout the sample is carried out by convection through the
sample. Convection induced movement of the sample within whatever
structure is used to hold the sample is caused by temperature
gradients or differences in the generally small biological samples
(e.g., 10 100 .mu.l).
The effect of temperature gradients within the sample become more
pronounced and more difficult to control as the cycle time for a
sample decreases. The existence of uneven temperatures within a
sample, and particularly the reliance on "mixing by convection"
within the sample relied upon by the prior art devices, generally
increases the cycle time for a sample and likely has deleterious
effects on the biological sample. The apparatus 100 is capable of
providing heating and cooling such that thermal differences within
a 10 .mu.l sample are maintained at not greater than .+-.1.degree.
C. at all times during a 30 second cycle.
In order to promote uniform heating and cooling, it is preferred
that the thin-walled capillary tubes 108 be at least somewhat
uniformly spaced from the heat source, for example, lamp 112 in
apparatus 100. FIG. 8C provides a diagrammatic top view of the lamp
112 and the plurality of thin-walled capillary tubes 108 as
arranged in the apparatus 100 represented in FIGS. 8A B.
In the arrangement represented in FIG. 8C, the thin-walled
capillary tubes 108 which are farthest from the lamp 112 (as
indicated by line F) are preferably no more than substantially 40%,
and more preferably no more than substantially 25%, farther from
the lamp 112 than the distance between the lamp 112 and those
thin-walled capillary tubes 108 which are closest to the lamp 112
(as indicated by line N). For example, the distance indicated by
line N can be about 7.3 cm while the distance indicated by line F
can be about 8.5 cm.
It will be appreciated that the arrangement of the thin-walled
capillary tubes 108 can be other than that represented in the
figures, for example, circular or semi-circular. Moreover, it will
appreciated that the point from which to measure the distance
between the heat producing element and the sample containers will
vary as the type and size of the heat producing element varies. For
example, the heat producing element may comprise a plurality of
lamps or electric resistive elements which vary in shape and size.
In some embodiments, it may also become important to consider the
distance from the sample chamber wall the sample containers are
positioned. In the illustrated embodiment, the apertures 140 (see
FIG. 8A) function as a means for holding the sample containers but
other structures performing equivalent functions can also be used
in accordance with the present invention.
The apparatus 100 also cools the samples contained in the capillary
tubes 108 very rapidly and uniformly. In order to cool the sample
chamber 106, air from outside the housing 102 is drawn into the
interior of the housing through a lower housing portal 114 by a fan
116 which is connected to a motor shaft 122 driven by a motor 118.
Since rapid cooling of the sample chamber is desired, it is
preferred that the combination of the motor 118 and the fan 116 be
able to move sufficient volumes of air into the sample chamber 106
and then disperse that air inside the sample chamber 106, as will
be explained shortly. Arrangements other than the motor 118 and fan
116 illustrated in FIG. 8B can also be used within the scope of the
present invention.
The use of air as the thermal transfer medium, in contrast to other
gases and liquids, has the advantages of being inexpensive, readily
available, easily mixed, and never making a mess. In the case of
the described embodiments, the high surface area-to-volume ratio of
the sample containing capillary tubes provides for rapid thermal
transfer using air as the thermal transfer medium.
During cooling portions of the thermal cycle, the action of the fan
116 draws ambient temperature air into the housing 102. A vent door
128, articulating on hinge 129, is provided. The vent door 128 is
automatically opened by way of a solenoid 132 so that the interior
of the housing 102 is sealed off from the upper housing portal 130.
In some embodiments, the solenoid 132 is preferably replaced by a
stepper motor as is known in the art. The use of a stepper motor
allows the vent door 128 to be accurately and incrementally opened
and closed in accordance with the needs for heating and cooling the
samples. Those skilled in the art will be able to derive an
appropriate control mechanism for use with a stepper motor, for
example an SC-149 stepper motor controller (available from Alpha
Products) as known in the art, using the information set forth
herein.
Due to the arrangement of the lower sample chamber portal 120 and
the larger cross sectional area and position of the upper sample
chamber portal 126, room temperature air is moved into the sample
chamber 106 and is dispersed and mixed within the sample chamber
106 by a paddle 124 which is connected to the motor shaft 122. The
paddle 124 should rotate at a relatively high rate, for example,
fast enough to create air velocities of around preferably about
250, more preferably 500, and most preferably 1000 meters per
minute within the sample chamber 106. With the paddle 124, which
can be a single or a multivane paddle, rotating at a high speed,
air is moved, or drawn, into the sample chamber 106 and vented out
of the sample chamber 106 following the path indicated by the
dashed line 136. The rotation of the paddle 124 also promotes
mixing of the air entering the sample chamber 106 and ensures the
most efficient transfer of thermal energy from the surfaces of the
thin-walled capillary tubes 108 to the air appreciated that
structures other than those illustrated herein can perform
equivalent functions.
As the solenoid 132 is actuated to open the vent door 128, all of
the room temperature air moved into the sample chamber 106 is
exhausted through a sample chamber upper portal 126 and then
through the upper housing portal 130 carrying the heat from the
sample chamber 106 to the surrounding atmosphere. The rapid mixing
of the air that passes through, and is disbursed in, the sample
chamber 106 results in rapid and uniform cooling of the
samples.
EXAMPLE 2
FIG. 9A shows the results of four different temperature/time
profiles (A D) and their resultant amplification products after
thirty cycles (A D). The profiles A and B in FIG. 9A were obtained
using a prior art heating block device using the prior art
microfuge tube. As can be seen in FIG. 9A, the transitions between
temperatures are slow and many nonspecific bands are present in
profiles A and B. Profile B shows improvement in eliminating some
of the nonspecific bands (in contrast to profile A) by limiting the
time each sample remains at each temperature thus indicating that
shorter times produce more desirable results.
Profiles C and D were obtained using the apparatus of FIGS. 8A B.
As can be seen in FIG. 9A, amplification is specific and,
desirably, even though yield is maximal in C (60 second elongation)
it is still entirely adequate in D (10 seconds elongation).
The optimal times and temperatures for the amplification of a 536
bp fragment of .beta.-globin from human genomic DNA were also
determined. Amplification yield and product specificity were
optimal when denaturation (93.degree. C.) and annealing (55.degree.
C.) were less than 1 second. No advantage was found to longer
denaturation or annealing times. The yield increased with longer
elongation times at (77.degree. C.) but there was little change
with elongation times longer than 10 20 seconds. These unexpected
results indicate that the previously available devices used for DNA
amplification are not maximizing the conditions needed to optimize
the physical and enzymatic requirements of the reaction.
Further information can be obtained from: Wittwer, Carl T.,
Marshall, Bruce C., Reed, Gudrun B., and Cherry, Joshua L., "Rapid
Cycle Allele-Specific Amplification with Cystic Fibrosis
.DELTA.F.sub.50B Locus," 39 Clinical Chemistry 804 (1993) and
Wittwer, Carl T., Reed, Gudrun H., and Rire, Kirk M., "Rapid DNA
Amplification," THE POLYMERASE CHAIN REACTION 174 (1994) which are
both now incorporated herein by this reference.
From the information provided in FIG. 9A, it can be seen that the
embodiments of the present invention subject the samples placed
therein to rapid thermal cycling wherein the temperature of the
sample is increased and decreased at a rate preferably at least as
great as 0.5.degree. C./second. In the case of the present
invention carrying out the polymerase chain reaction, the
temperature change is preferably carried out over an approximate
range of between 30.degree. C. to 50.degree. C. It is preferred
that the thermal cycles be carried out quickly enough to complete
at least thirty thermal cycles in forty minutes and more preferably
complete thirty thermal cycles in twenty minutes and most
preferably complete thirty thermal cycles in ten minutes.
The apparatus 100 more preferably increases and decreases the
temperature of the sample at a rate at least as great as
1.0.degree. C./second and even more preferably at a rate at least
as great as 4.0.degree. C./second and most preferably at a rate at
least as great as 10.0.degree. C./second. Critically, the
biological sample, not just the surrounding medium and/or the
sample container, must undergo the specified thermal change. The
previously available devices, while having the drawback of not
being able to perform thermal changes as rapidly as the present
invention, also did not recognize the problem of changing the
temperature of the sample, not just the temperature of the
surrounding medium and container, rapidly and uniformly.
Referring now to the chart of FIG. 9B, the method of the present
invention can desirably achieve thermal cycling preferably at a
rate at least as great as 10.degree. C./sec., and more preferably
at a rate at least as great as 20.degree. C./sec., over a
temperature range of greater than about 20.degree. C., more
preferably over a temperature range of greater than about
30.degree. C., and most preferably over a temperature range of
about 40.degree. C. FIG. 9B shows the temperature in .degree. C. of
the biological sample, not just the surrounding air or container,
as the biological sample undergoes thermal cycling. FIG. 9B shows a
PCR sample beginning at about 74.degree. C. and being heated to a
denaturation temperature, indicated at D, of about 92.degree. C.
for 2 seconds. The sample is then cooled to an annealing
temperature, indicated at A, of about 55.degree. C. for two
seconds. The transition between the denaturation temperature and
the annealing temperature covers a range of 37.degree. C. in just
under 4 seconds providing a rate at least as great as 10.degree.
C./sec. The sample is then warmed to an extension temperature of
74.degree. C. for five seconds as indicated at E in FIG. 9B. The
cycling of the sample through the denaturation temperature, the
annealing temperature, and the extension temperature is repeated
thirty times or as many times as desired.
FIGS. 9C G show exemplary cycles of other preferred
temperature/time profiles which are achieved by the present
invention. It will be understood that those skilled in the art can
alter the represented temperature/time profiles to carry out
specific processes in accordance with the present invention. Those
skilled in the art will also appreciate that the previously
available devices and methods, such as devices which conduct heat
to and from the sample via a solid or liquid, cannot provide the
resulting temperature/time profiles described herein. Moreover, the
previously available devices and methods do not suggest or teach
the temperature/time profiles described herein. Furthermore, it
will be appreciated that the previously available devices and
methods utilizing air as the transfer medium, for example
previously available chromatographic ovens, cannot provide, and do
not suggest or teach, the temperature/time profiles which are
described herein and obtained by the practice of the present
invention.
In order to provide the fastest thermal cycling time, it is
preferred that the lamp (112 in FIGS. 8A and 8B) be rated at 2000
watts or a plurality of lamps be included which provide similar
output. It is also preferred to include a temperature slope control
circuit which is represented in FIG. 10 in conjunction with an
A-bus controller/acquisition system using an 8052 micro controller
board with a clock and high level program interpreter available
from Alpha Products (model no. SP-127) of Darian, Conn. Exemplary
programming code used in connection with the described micro
controller is included in the Programming Code Appendix A attached
hereto and incorporated herein. The programming code provided in
Appendix A is a BASIC52 file for serial downloading into the micro
controller and provides exemplary temperature slope control during
thermal cycling. Use of the 2000 watt heat producing device and the
described control structures allows thermal cycling rates of
20.degree. C./sec. to be desirably obtained.
The preferred arrangement for the temperature slope control circuit
represented in FIG. 10 will be explained with the understanding the
additional necessary components not explicitly illustrated in FIG.
10 can readily be supplied by those skilled in the art.
The temperature slope control circuit of FIG. 10 includes a
thermocouple 200 matched to the sample temperature response as
explained earlier. The thermocouple 200 is connected to an
integrated circuit 206, which preferably is one known in the art as
an AD595, whose output is conveyed to a 4th order low pass filter
208 with a cutoff frequency of 100 Hz and to a 12 bit
analog-to-digital convertor 210 whose output is used to provide a
digital display of the temperature.
The output of the circuit 206 is also conveyed to a measured slope
circuit 212. The measured slope circuit 212 preferably includes a
353 operational amplifier 218, a 100 K.OMEGA. potentiometer 214, a
1 M.OMEGA. potentiometer 230, and a 22 .mu.F capacitor. The
measured slope circuit 212 outputs a signal to the inverting input
of a 353 operational amplifier 246.
A slope set circuit 222 includes a positive slope set
digital-to-analog converter 226 and a negative slope set
digital-to-analog converter 224. The digital-to-analog converters
224 and 226 are preferably 8-bit digital-to-analog converters
referred to in the art as DA147. The slope set circuit can
preferably receive instructions from another digital device (not
illustrated in FIG. 10) such as a personal computer. The output of
the slope set circuit 228 is communicated to a summing circuit
240.
The summing circuit 240 preferably includes 100 K.OMEGA. resistors
236, 238, and 244 and a 353 operational amplifier 242. The output
of the summing circuit 240 is conveyed to the non-inverting input
of the operational amplifier 246 and represents the desired slope
of the temperature change. The output of the operational amplifier
246 is provided to a transistor 248 contained within a power
switching circuit 262.
The power switching circuit 262 includes a 5 VDC supply 250
providing current to the transistor 248. The transistor 248 has its
emitter connected to a 3010 circuit 254 by way of resistor 252
which is preferably a 330.OMEGA. resistor. The 3010 circuit 254
includes an output connected in series with a resistor 256 which
preferably is a 180.OMEGA. resistor. A triac 258 is preferably used
to control the current delivered to a lamp 262, or other heat
producing device, from a source of AC current 260.
The temperature slope control circuit represented in FIG. 10, in
cooperation with the other described system components, provides
thermal cycling of biological samples as great as 20.degree. C./sec
over a temperature range of 30.degree. C., and most preferably over
a temperature range of 40.degree. C., with homogeneity being
maintained throughout the biological sample.
It will be appreciated that the systems described herein can
readily be used for many different applications including:
polymerase chain reaction processes; cycle sequencing; and, other
amplification protocols such as the ligase chain reaction. The
present invention also advantageously provides an apparatus for
accurately controlling the temperature of samples located in the
sample chamber and quickly and accurately varying the temperature
of samples located in a chamber according to a predetermined
temperature versus time profile.
As indicated earlier, and in contrast to the teachings of the prior
art, the polymerase chain reaction can be performed rapidly. Using
the methods and apparatus described herein, the necessary number of
temperature cycles can routinely be completed in much less time
than possible with the prior art devices, for example in less than
15 minutes. By minimizing denaturation and annealing times, the
specificity and yield of rapidly cycled amplifications are also
improved to an extent not otherwise previously possible. Moreover,
in addition to facilitating rapid heat transfer, the use of
optically clear sample containers, such as clear capillary tubes,
allows for continuous fluorescence monitoring of DNA amplification
in accordance with the present invention.
FIG. 10A shows graphically the effect of temperature transition
rates on PCR reaction specificity and yield using an apparatus of
the present invention. The results of FIG. 10A were obtained using
a 536 base pair fragment of the beta globin gene which was
amplified from 50 ng of human genomic DNA with 50 mM Tris, pH 8.3,
2 mM MgCl.sub.2, 50 .mu.g/ml bovine serum albumin, 0.5 .mu.M each
primer, 0.2 mM each dNTP, and 0.4 U native Taq DNA polymerase in a
10 .mu.l reaction. The human beta-globin primers RS42 and KM29 (536
base pairs) are described in C. T. Wittwer, G. C. Fillmore and D.
R. Hillyard, "Automated Polymerase Chain Reaction in Capillary
Tubes with Hot Air," Nucl. Acids. Res. 17:4353 4357. Temperature
cycling parameters were 94.degree. C. for 0 sec., 55.degree. C. for
0 sec., and 72.degree. C. for 10 sec. Thirty five cycles of
amplification were performed with the indicated rates between all
temperatures. The samples were electrophoresed on 1.5% agarose gels
and stained with 0.5 .mu.g/mQ ethidium bromide. Specificity and
yield both decrease as the temperature transition rate
decreases.
Fluorescent probes can be used to detect and monitor DNA
amplification. As known to those skilled in the art, useful probes
include double-stranded-DNA-specific dyes and sequence-specific
probes. With the intercalater ethidium bromide, UV-excited red
fluorescence increases after amplification. While microfuge tubes
have been used as a sample container for DNA amplification, the
embodiments of the present invention described herein
advantageously utilize sample containers with many of the
characteristics of structures referred to herein as capillary
tubes.
The use of the sample containers described herein allows detection
of fluorescence while the sample is held within the container, as
will be explained more fully hereinafter. Those skilled in the art
will appreciate the number of different schemes of fluorescence
detection of DNA amplification which are now available. For
example, sequence-specific fluorescence detection is readily
possible using the present invention and oligonucleotide
hybridization probes. As another example, dual-labeled
fluorescein/rhodamine probes can be cleaved during polymerase
extension by 5'-exonuclease activity, separating the fluorophores
and increasing the fluorescein/rhodamine fluorescence ratio.
Using the embodiments of the present invention described
hereinafter, fluorescence can be measured after temperature cycling
is complete, once per cycle as a monitor of product accumulation,
two or more times during a temperature transition, or continuously
within each cycle. In contrast to the present invention, previously
available methods only cycle relatively slowly and do not teach
acquisition and analysis of fluorescence during temperature
changes.
The present invention allows cycle-by-cycle monitoring for
quantification of initial template copy number. To carry out such
cycle-by-cycle monitoring, fluorescence is acquired during the
extension or combined annealing/extension phase of each cycle and
related to product concentration. For example, a quantitative assay
for hepatitis C RNA using the intercalater YO-PRO-1.TM. is known in
the art and can be used in accordance with the present invention.
For more information see Ishiguro, T., J. Saitch, H. Yawata, H.
Yamagishi, S. Iwasaki, and Y. Mitoma, 1995, "Homogeneous
quantitative assay of hepatitis C virus RNA by polymerase chain
reaction in the presence of a fluorescent intercalater," Anal.
Biochem. 229:207 213. Prior to the present invention, continuous
fluorescence monitoring within each cycle during temperature
transitions has not been attempted.
In accordance with one aspect of the present invention, one
embodiment of the present invention disclosed herein is a rapid
temperature cycler integrated with 2-color fluorescence optics to
provide continuous fluorescence monitoring. As will be more fully
discussed below, different preferred fluorescence techniques for
monitoring DNA amplification are provided herein as specific
examples of carrying out one aspect of the present invention. Those
skilled in the art will be familiar with the use of ethidium
bromide in fluorescence techniques which can be used in accordance
with the present invention. In one presently preferred embodiment
described below, it is preferred that SYBR.RTM. Green I, which is
well known in the art and available from Molecular Probes of
Eugene, Oreg., be used as a double-strand-specific dye.
In one presently preferred embodiment of the present invention,
time, temperature, and fluorescence is acquired every 200 msec.
during the amplification reaction. By acquiring data regularly
during the reaction, the acquisition of such data reveals fine
details of product denaturation, reannealing, and extension which
is not available in the previously available apparatus and
methods.
As will be appreciated by those skilled in the art, once-per-cycle
monitoring of multiple samples undergoing DNA amplification is a
powerful quantitative tool. Importantly, as will be appreciated by
an understanding of this disclosure, continuous monitoring within a
cycle can identify the nature of probe fluorescence, provide
insight into DNA amplification mechanics not previously available
in the art, and assess PCR product and probe melting curves to
identify amplification products and mutations.
Referring now to FIG. 11, a schematic view of a preferred rapid
temperature cycler with fluorescence detection is provided,
generally designated at 300. A forced air hot air source 302 is
preferably provided. The forced air hot air source 302 is
preferably a commercially available device including a 1600 watt
heating coil and fan. A cool forced air cool air source 304 is also
preferably provided. The cool forced air source 304 is preferably a
2200 rpm shaded pole blower available in the art from Dayton of
Niles, Ill., model no. 4C006B. It is preferred that the cool air
source 304 provide ambient temperature air, but it is within the
scope of the present invention to utilize a means for providing
fluid that is at a temperature lower than ambient air
temperature.
In the embodiment of FIG. 11, ducts 306 and 308 connect the forced
hot air source 302 and the forced cool air source 304,
respectively, to a sample chamber 310. The ducts 306 and 308 are
preferably corrugated black nylon tubing having a 2.5 cm diameter.
The duct 306 is connected to the sample chamber 310 via a port 306A
and the duct 308 is connected to the sample chamber 310 via a port
308A. A vent 312 and an exhaust fan 314 function to move air out of
the sample chamber 310. Moreover, a means for shielding the
interior of the sample chamber 310 from ambient light is integral
with the sample chamber 310.
The temperature of the samples within the sample chamber 310 is
preferably monitored by a tubular, metal-sheathed thermocouple 316,
available from Idaho Technology of Idaho Falls, Id., model no.
1844, which is matched in thermal response to the samples held in
the preferred sample containers, for example capillary tubes.
Importantly, temperature homogeneity within the sample chamber 310
is achieved by mixing the air within the sample chamber 310. It is
preferred that such mixing of the air within the sample camber 310
be carried out by a central sample chamber fan 318. The sample
chamber fan preferably includes a 1.7.times.11 cm fan blade
available from Idaho Technology, model no. 1862, and a motor
available from Idaho Technology, model no. 1861, which creates air
velocities of at least 800 to 1000 meters per minute within the
sample chamber 310. Such rapid air velocities may not be needed in
all applications of the present invention but rapid air velocities
promote extensive mixing and temperature homogeneity within the
sample chamber 310.
Within the sample chamber 310, a plurality of samples are held in
capillary tubes, some of which are indicted at 320, and are placed
in a vertical orientation on a rotatable carousel 322. The carousel
322 is preferably fourteen centimeters in diameter and rotated by a
400 step per revolution stepper motor 324 controlled by a micro
stepping drive module 326. The stepper motor 324 is preferably one
available from New England Affiliated Technologies of Lawrence,
Mass., model no. 2198364, and the micro stepping drive module 326
is preferably one also available from New England Affiliated
Technologies, model no. MDM7 micro stepping drive module, which
provides 12,800 steps per rotation of the carousel 322.
Still referring to FIG. 11, a fluorescence excitation source 328 is
provided. One preferred arrangement for the excitation path in
accordance with the present invention will now be described with
one preferred arrangement for the collection path in accordance
with the present invention will subsequently be described. The
fluorescence excitation source 328 preferably includes a 75 watt
xenon arc source 328A focused with an elliptical reflector 328B.
The xenon arc source 328A is preferably available from Photon
Technology International of South Brunswick, N.J., model no. A1010,
with f/2.5 elliptical reflector 328B. The power supply and other
components needed to operate the fluorescence excitation source 328
are well known to those skilled in the art. Alternatively, a light
emitting diode can be used as a fluorescence excitation source.
Those skilled in the art will appreciate that many different
excitation sources can be used within the scope of the present
invention.
The radiation emitted by the fluorescence excitation source 328 is
focused to about 2 mm using an adjustable iris 334 such as one
available in the industry from Rolyn (Covina, Calif.), model no.
75.0125. The light emitted from the fluorescence excitation source
328 impinges upon a cold mirror 330, which is preferably available
from Rolyn, model no. 60.4400, and passes through heat absorbing
glass 332, which is preferably one available from Rolyn, model no.
65.3130. After collimation through a planoconvex lens 336,
preferably one available from Rolyn, model no. 10.0260, a 450 490
nm bandpass interference filter 338, preferably one available from
Omega Optical of Brattleboro, Vt., model no. 470RDF40, a focusing
planoconvex lens 340, preferably available from Rolyn, model no.
10.0260, and a 1 mm silica window 342, preferably available from
Omega, to prevent condensation on the just described optical
components during temperature cycling. Using the described
excitation path, a 5 7 mm section of one capillary sample tube 320A
is illuminated.
Still referring to FIG. 11, the collection path for collecting the
fluorescence emitted from the sample 320A will be described next.
The optics of the collection path include a 1 mm silica window 344
which is placed in the optical path to prevent condensation on the
other optical components. Two opposed aspheric lenses 346A&B,
preferably available from Rolyn, model no. 17.1175, function to
focus emitted fluorescence onto a 2.times.10 mm slit 348. The slit
348 can preferably be fabricated from cutting exposed X-ray film
and the slit 348 functions as a spatial filter. After the slit 348
(acting as a spatial filter), the emitted fluorescence is imposed
upon a 35 mm electronic shutter 350 operated via an electronic
shutter control 352. The 35 mm electronic shutter 350 is preferably
a Uniblitz shutter model no. VS35 and the electronic shutter
control 352 is preferably driver model no. D122, both available
from Vincent Associates of Rochester, N.Y. A collimating aspheric
lens 354, preferably one available from Rolyn model no. 17.1175, is
also provided.
A filter 356 is also included when detection of SYBR.RTM. Green I
emissions is desired. The filter 356 is preferably a 520 580 nm
band pass filter, available from Omega as model no. 550RDF60, which
is preferably used for single wavelength acquisition. For detection
of other emissions, for example, a combination of a dichroic filter
358 and wavelength filters 358A and 358B can be used. For example,
for separation of fluorescein and rhodamine emissions, the dichroic
filter 358 preferably consists of a 560 nm dichroic filter,
preferably available from Omega, model no. 560 DRLP, and a 520 550
nm band pass filter (358A), preferably available from Omega, model
no. 535DF30, for detection of fluorescein, and a 580 620 nm band
pass filter (358B), preferably available from Omega, model no.
600DF40, for detection of rhodamine. For separation of fluorescein
and Cy5 emissions, the dichroic filter 358 preferably is a 590 nm
dichroic filter, available from Omega, model no. 590 DRLP, and
filters 358A&B preferably consist of a 520 550 nm band pass
filter (358A), available from Omega, model no. 535DF30, for
detection of fluorescein, and a 660 680 nm band pass filter (358B),
available from Omega, model no. 670DF20, for Cy5 detection. Those
skilled in the art will readily appreciate that the use of other
components can be readily implemented using the information set
forth herein in order to accommodate other flourescent
wavelengths.
Still referring to FIG. 11, after being subjected to the respective
filter 358A or 358B, the emitted fluorescence is focused through
two planoconvex lenses 360A & 360B, each preferably available
from Edmund of Barrington, N.J., model no. 32970, and onto
photomultiplier tubes 362A and 362B, respectively. The
photomultiplier tubes ("PMT") 362A and 362B are preferably
available from Hamamatsu of Middlesex, New Jersey, model no. R928,
and are each enclosed in a suitable housing including appropriate
circuitry, preferably one available from Photon Technology
International, model no. 714, with analog acquisition capabilities.
A PMT and data acquisition control module 364 is also preferably
provided. Manual PMT shutters 366A and 366B, as known in the art,
are also provided.
The forgoing described optical components are preferably five
centimeters in diameter and mounted in five centimeter universal
lens mounts, such as those available from Rolyn, model no. 90.0190.
As can be carried out by those skilled in the art, many of the
necessary structural components were machined from black Delrin.TM.
using techniques known in the industry.
Those skilled in the art will appreciate that the rapid temperature
cycler with fluorescence detection 300 can advantageously be
constructed using light emitting diodes (LEDs) and photodiodes in
place of similarly functioning components represented in FIG. 11.
Thus, the function of the fluorescence excitation source 328 can be
carried out by light emitting diodes. The photomultiplier tubes
362A&B can also be replaced with photodiodes. Additional
information regarding suitable light emitting diodes and
photodiodes will be provided later herein. It will be appreciated
that technique sensitivity is limited by background fluorescence,
most of which comes from the probes, not the detection system.
Significantly, stability is generally more important than absolute
sensitivity.
Those versed in the art will appreciate that the rapid temperature
cycler with fluorescence detection 300 represented in FIG. 11
includes the beneficial characteristics of a fluorimetry device
with rapid temperature control, a combination nowhere suggested or
taught in the art. PCR can be performed and analyzed during ten to
twenty minutes of temperature cycling. The present invention's
combination of 1) fluorescence monitoring within each temperature
cycle and 2) analysis of the temperature and time dependence of
hybridization provides advantages not otherwise obtainable.
The present invention also makes possible single-color fluorescence
methods to monitor product purity and quantify template during PCR.
Dyes that monitor DNA strand status are added to PCR reactions for
observation during temperature cycling using embodiments of the
present invention.
In order to explain some of the benefits which accrue with the
present invention, specific examples using the apparatus
represented in FIG. 11 will now be provided. DNA amplification was
performed in 50 mM Tris, pH 8.3 (25.degree. C.), 3 mM MgCl.sub.2,
500 .mu.g/ml bovine serum albumin, 0.5 .mu.M of each primer, 0.2 mM
of each deoxynucleoside triphosphate and 0.2 U of Taq polymerase
per 5 .mu.l sample unless otherwise stated in the following
examples. Also in the following examples, human genomic DNA
(denatured for 1 min by boiling) or purified amplification product
was used as DNA template. Purified amplification product was
obtained by phenol/chloroform extraction and ethanol precipitation
(see D. M. Wallace 1987, Large- and small-scale phenol extractions
and precipitation of nucleic acids (as described at p. 33 48, in S.
L. Berger and A. R. Kimmel (Eds.), Guide to Molecular Cloning
Techniques (Methods in Enzymology, Vol. 152) Academic Press,
Orlando), followed by removal of primers by repeated washing
through a Centricon 30 micro concentrator (available from Amicon of
Danvers, Mass.). Template concentrations were determined by
absorbence at 260 nm. A.sub.260/A.sub.280 ratios of templates were
greater than 1.7.
In these examples, primers were synthesized by standard
phosphoramidite chemistry, as known in the art, namely, using
Pharmacia Biotech Gene Assembler Plus (Piscataway, N.J.). The 180
base pair fragment of the hepatitis B surface antigen gene was
amplified using primers 5'-CGTGGTGGACTTCTCTCAAT-3' (SEQ ID NO:1),
and 5'-AGAAGATGAGGCATAGCAGC-3' (SEQ ID NO:2) (Genbank sequence
HVHEPB). SYBR.RTM. Green I dye was obtained from Molecular Probes
(Eugene, Oreg.). The .beta.-actin primers and fluorescein/rhodamine
dual probe were obtained from Perkin Elmer (Foster City, Calif.)
(no. N808 0230). The human .beta.-globin primers RS42/KM29 (536
base pairs) and PC03/PC04 (110 base pairs) are described in C. T.
Wittwer, G. C. Fillmore and D. R. Hillyard, "Automated Polymerase
Chain Reaction in Capillary Tubes with Hot Air," Nucl. Acids. Res.
17:4353 4357 which is now incorporated herein by reference. The
single labeled probes:
5'-CAAACAGACACCATGGTGCACCTGACTCCTGAGGA-fluorescein-3' (SEQ ID NO:3)
and 5'-Cy5-AAGTCTGCCGTTACTGCCCTGTGGGGCAAG-phosphate-3' (SEQ ID
NO:4) were synthesized using a fluorescein phosphoramidite
(available from Glen Research of Sterling, Va., no. 10 1963) a
Cy5.TM. phosphoramidite (available from Pharmacia no. 27 1801-2),
and a chemical phosphorylation reagent (available from Glen
Research no. 10 1900). These adjacent probes hybridize internal to
the PC03/PC04 .beta.-globin primer pair on the same DNA strand and
are separated by one base pair. Probes were purified by reverse
phase C-18 high pressure liquid chromatography and homogeneity
checked by polyacrylamide electrophoresis and absorbance (A.sub.260
and the absorbance maximum of the fluorophore). Hybridization
probes .beta.-actin and .beta.-globin) were used at 0.2 .mu.M
each.
In the pertinent examples described herein, amplification samples
of 5 .mu.l were loaded into capillary sample tubes, some of which
are represented in FIG. 11 at 320. The preferred capillary sample
tubes are those available from Idaho Technology, model no. 1705,
having dimensions of 1.02 mm O.D. and 0.56 mm I.D. Once loaded, the
capillary sample tubes were sealed with a butane flame. The surface
of the capillary sample tube was cleaned with optical grade
methanol before it was loaded into the carousel 322 of the rapid
temperature cycler with fluorescence detection 300.
Control of the components represented in FIG. 11 was achieved by
use of a graphical programming language known as LabView (available
from National Instruments, Austin, Tex.) and a 12-bit multifunction
input/output card 368A (available from National Instruments under
the designation AT-MIO-E2) in a PC compatible computer 368
utilizing an Intel.RTM. 80486 microprocessor running at a clock
speed of 120 MHZ. Analog output channels on the input/output card
368A were used to control the sensitivity, i.e. the PMT voltage, of
each of the photomultiplier tubes 362A&B. Analog input channels
on the input/output card 368A receive the signals from each of the
photomultiplier tubes 362A&B. The PC compatible computer 368,
through the input/output card 368A, controls the position, rate and
direction of movement of the carousel 322. For example, when
multiple capillary sample tubes are loaded, the carousel 322
rapidly positions each capillary sample tube 320 sequentially at a
monitoring location (the location represented by capillary sample
tube 320A) for a 10 100 msec acquisition period. For continuous
monitoring of a single capillary sample tube, the capillary sample
tube is held in the monitoring position while data is preferably
acquired every 200 msec. and is averaged in accordance with
well-known techniques. Time, temperature, and preferably two
channels of fluorescence are continuously displayed via a monitor
368B associated with the computer 368 as fluorescence vs. cycle
number and fluorescence vs. temperature plots.
The carousel 322 should be positioned where maximal fluorescence
and signals are acquired. When a single capillary sample tube, such
as the capillary sample tube 320A, is monitored the signals are
acquired every 200 msec with an integrating time constant set on
the photomultiplier tube 362A or 362B, or both, at 50 msec. For
multiple sample tubes, the time constant is set at 0.5 msec and the
carousel is rotated once to locate the precise position where each
capillary sample tube 320 provides the maximum fluorescence in each
of the two channels. After positioning the capillary sample tube
320A at a location where maximum fluorescence is obtained, the
sensitivity of each PMT 362A&B is adjusted and the carousel
rotated again to count and locate the position of all the capillary
sample tubes 320 in the carousel 322. When only a signal
fluorescence acquisition is desired once each amplification cycle
during extension, each capillary sample tube 320 is sequentially
positioned on the carousel 322 at the monitoring position for 100
msec. Continous acquisition for multiple tubes can also be obtained
by continuously rotating the carousel 322. Temperature control
programming was based upon, and modified from, a commercial rapid
temperature cycler available from Idaho Technology under the
trademark Rapidcycler.TM. using an 8051 cross compiler available
from Systronics, Salt Lake City, Utah, designated BCI51 and Dallas
development system (also available from Systronics under the
designation DPB2).
In practice, the temperature response of the rapid temperature
cycler with fluorescence detection 300 is similar to the response
obtained with the embodiment of the present invention disclosed in
FIGS. 8A&B allowing 20 30 second cycles (30 cycles in 10 15
min) as represented in the temperature vs. time chart of FIG. 11A
(which shows a few cycles of one preferred temperature profile).
When a double strand-specific fluorescent dye is present during
amplification, fluorescence generally increases as more double
stranded product is made. See R. Higuchi, G. Dollinger, P. S.
Walsh, and R. Griffith, 1992, "Simultaneous Amplification and
Detection of Specific DNA Sequences," Bio/Technology 10:413
417.
Moreover, it will also be appreciated that double strand specific
dyes such as ethidium bromide or SYBR.RTM. Green I can be used as
generic indicators of amplification. SYBR.RTM. Green I dye is
preferred over ethidium bromide in many applications because it has
an excitation maximum near fluorescein and often provides a
stronger signal with DNA than visible excitation of ethidium
bromide.
Fluorescence also depends on temperature, a confounding effect
during temperature cycling that is usually eliminated by
considering fluorescence once per cycle at a constant extension
temperature. However, if temperature, time, and fluorescence are
acquired every 200 msec during rapid cycle amplification, a three
dimensional spiral is shown on the monitor 368B as represented in
FIG. 12. The three dimensional plot represented in FIG. 12 is also
projected in FIG. 12A as a two dimensional plot of temperature vs.
time, projected in FIG. 12B as a two dimensional plot of
fluorescence vs. time, and projected in FIG. 12C as fluorescence
vs. temperature. The temperature vs. time projection of FIG. 12A
repeats each cycle and provides essentially the same information as
set forth in FIG. 11A. Because fluorescence varies inversely with
temperature, the fluorescence vs. time projection shown in FIG. 12B
at early cycles is a scaled mirror image of the temperature vs.
time plot. As product accumulates, the fluorescence increases at
all temperatures where double stranded product is present. However
at denaturation temperatures, fluorescence returns to baseline
since only single stranded DNA is present.
The fluorescence vs. temperature projection of double stranded dyes
shown in FIG. 12C eliminates the time axis and shows the
temperature dependence of strand status during DNA amplification.
The fluorescence vs. temperature projection shown in FIG. 12C is
for a 180 base pair fragment of hepatitis B virus DNA.
Another fluorescence vs. temperature projection is shown in FIG.
13. The projection represented in FIG. 13 is for a 536 base pair
fragment of human .beta.-globin DNA. Early cycles represented in
FIG. 13 appear identical, with a nonlinear increase in fluorescence
at lower temperatures. As amplification proceeds, later cycles
appear as rising loops between annealing and denaturation
temperatures that show significant hysteresis. That is, the
observed fluorescence during heating is greater than that during
cooling. As the sample is heated, fluorescence is high until
denaturation occurs (apparent as a sharp drop in fluorescence). As
can be seen in FIG. 13, as the sample cools from denaturation to
annealing temperatures, double strand signal increases rapidly.
Also as can be seen in FIG. 13, the fluorescence continues to
increase during extension while the temperature is held
constant.
Double strand specific dyes can also be used in accordance with
various aspects of the present invention. The strand status of PCR
products can be followed with dyes that fluoresce in the presence
of dsDNA. When SYBR.RTM. Green I is present during amplification,
fluorescence increases as more dsDNA is made. However, temperature
cycling introduces a confounding effect because fluorescence is
inversely proportional to temperature as shown in FIGS. 26A and
26B. As product accumulates, the fluorescence increases except at
denaturation temperatures, where the fluorescence returns to
baseline as shown in FIG. 12C.
When multiple samples are monitored, using the rapid temperature
cycler with fluorescence detection 300, once each cycle with
SYBR.RTM. Green I, a 10.sup.7 10.sup.8 range of initial template
concentration can be discerned as represented in FIG. 14. FIG. 14A
provides a legend for the indicia provided on the different plots
in FIG. 14, and subsequent figures, for different initial template
copy number. When the data are normalized as the percent maximal
fluorescence of each capillary sample tube 320, one hundred initial
copies are clearly separated from ten copies. However, the
difference between one and ten copies is marginal, and no
difference is observed between zero and one average copies per
capillary sample tube 320.
Double strand dyes depend on the specificity inherent in the
amplification primers. As will be appreciated by those skilled in
the art, nonspecific amplification at high cycle numbers can limit
detection sensitivity to about one hundred initial template copies
(see FIG. 14). With rapid cycling taught by the present invention,
further improvements in amplification specificity are obtained
further improving the overall DNA amplification performance.
Quantitifcation with sequence-specific probes has a similar dynamic
range as double stranded DNA dyes but, as shown in the plots of
FIGS. 15A and 15B, appear to discriminate even a single initial
template copy from negative controls.
When low copy number detection and quantification are needed,
additional specificity is provided by fluorescent probes that
require hybridization for signal generation. Cleavage of a
dual-labeled exonuclease probe is one technique which is capable of
distinguishing a single template copy from a negative control as
shown by FIG. 15. FIG. 15 show plots of fluorescence ratio vs.
cycle number for different initial template copy number, according
to the legend provided in FIG. 14A.
Signal generation with 5'-exonuclease probes is dependent not only
on DNA synthesis, but requires hybridization and hydrolysis between
the fluorophores of the dual-labeled probe. This hydrolysis reduces
quenching and the fluorescence ratio of fluorescein to rhodamine
emission increases. For more information on this technique, see L.
G. Lee, C. R. Connell and W. Bloch, 1993, "Allelic Discrimination
by Nick-translation PCR with Fluorogenic Probes," Nucl. Acids Res.
21:3761 3766 & Livak, K. J., S. J. A. Flood, J. Marmaro, W.
Giusti and K. Deetz, 1995, "Oligonucleotides with Fluorescent Dyes
at Opposite Ends Provide a Quenched Probe System Useful for
Detecting PCR Product and Nucleic Acid Hybridization," PCR Meth.
Appl. 4:357 362).
FIG. 25 shows fluorescence PCR results from a probe with five
intervening bases between fluorescein and rhodamine labels. The
forty-five cycle amplification was completed in 20 minutes using
the rapid temperature cycler with fluorescence detection 300 of
FIG. 11. By monitoring the fluorescence ratio once per cycle, a
10.sup.9 fold range of initial template concentration could be
distinguished. The amplification curves are shifted approximately 3
4 cycles for each 10-fold change in initial template
concentration.
Although the final fluorescence signal is decreased when low copy
numbers are amplified (presumably because of decreased
amplification efficiency), quantification between zero and one
hundred copies is readily possible. The signal generated by
exonuclease probes is cumulative and only indirectly related to
product concentration. Hence, the fluorescence signal continues to
increase even after the amount of product has reached a plateau.
Using the information contained herein, those skilled in the art
can formulate appropriate standards to control for efficiency of
amplification and cleavage in order to carry out absolute
quantification.
Fluorescence vs. temperature plots of 5'-exonuclease probes confirm
that probe hydrolysis is the mechanism of signal generation. In
FIG. 16, a fluorescence vs. temperature plot of two-temperature
cycling is shown with the .beta.-actin exonuclease probe. In each
cycle the fluorescence ratio varies linearly with temperature and
there is little, if any, hysteresis. The signal increases each
cycle during the annealing/extension phase when probe hydrolysis
occurs. Although the fluorescence of both fluorescein and rhodamine
decreases with increasing temperature (data not shown in the
figures), the rate of change is greater for rhodamine, resulting in
an increasing ratio with increasing temperature. No
temperature-dependent hybridization effects are apparent with the
5'-exonuclease probe.
In contrast, when the fluorescence signal is dependent only on
hybridization, fluorescence ratio vs. temperature plots show a
different pattern with hysteresis during two-temperature cycling,
as plotted in FIG. 17. The plots in FIG. 17 represent the results
obtained using two adjacent hybridization probes which are present,
an upstream probe labeled 3' with fluorescein and a downstream
probe labeled 5' with Cy5.TM.. The probes are separated by a 1 base
pair gap. During the annealing/extension phase of the reaction, the
probes hybridize resulting in accumulating product and the Cy5.TM.
to fluorescein fluorescence ratio increasing. During heating to
product denaturation temperatures, the probes dissociate between
65.degree. C. and 75.degree. C., returning the fluorescence ratio
to background levels. The change in fluorescence ratio during
hybridization is largely due to an increase in Cy5.TM. fluorescence
from resonance energy transfer. The temperature dependence of
hybridization can be used to detect mutations by a shift in the
melting curve. Adjacent hybridization probes are also very useful
for quantification, as shown in FIG. 15B.
From the foregoing discussion, it will be appreciated that
fluorescence monitoring during DNA amplification is an
extraordinarily powerful analytical technique. Using the rapid
temperature cycler with fluorescence detection 300, productive and
cost efficient real time monitoring, sequence-specific detection,
and quantification can be achieved in five to twenty minutes,
depending on the number of initial template copies present.
Furthermore, the system and results represented in FIGS. 11 17 is
particularly suited for continuous monitoring of a biological
reaction using fluorescent dyes. For example, with precise
temperature control and double-strand-specific dyes, product purity
can be estimated by melting curves. With rapid temperature control
provided by the present invention, absolute product concentration
can be determined by reannealing kinetics. The present invention
advantageously provides rapid temperature changes and strict
intra-sample temperature homogeneity which is not available in the
prior art. In contrast to the prior art, the present invention
utilizes sample containers with a high surface area to volume
ratio, (for example by using the preferred capillary sample tubes
320 in FIG. 11) and uses air as the thermal transfer medium
providing rapid control of sample temperature not otherwise
obtainable. For example, sample temperature vs. time plots obtained
when processing samples in the sample containers of the present
invention show sharp spikes at denaturation and annealing
temperatures (showing rapid temperature response) in contrast to
the prior art conical plastic tubes which require several seconds
for all of the sample to reach thermal equilibrium. Moreover, the
sample containers of the present invention provide improved results
over using etched silicon or glass chips as sample containers since
the thermal cycle times and thermal homogeneity of the present
invention are superior than the thermal cycle times and thermal
homogeneity possible using such other structures.
Using the present invention, many aspects of DNA amplification
which have heretofore been little understood are discernable. For
example, product denaturation occurs in less than one second, yet
the prior art calls for ten seconds to one minute of denaturation.
Observing product melting by real time fluorescence monitoring with
double strand dyes in accordance with the present invention (see
FIGS. 12 and 13) shows that use of shorter denaturation times is
very effective. As another example, many causes of the known
"plateau effect" have been proposed, but few data are available to
distinguish between alternatives. As shown in FIG. 13, product
reannealing is very rapid. In fact, during later cycles of
amplification, a majority of product is reannealed each cycle
during cooling before the primer annealing temperature is reached.
This occurs with cooling rates of 5 10.degree. C./second carried
out by the present invention. Product reannealing with slower,
prior art temperature cyclers will even be greater because more
time is required to transition between denaturation and annealing
temperature. This undesirable effect limits product yield, and is a
major cause of the "plateau effect" known in the art.
Furthermore, the present invention provides an inexpensive
instrument that can be used in commercial applications and that
continuously monitors fluorescence during rapid cycle
amplification. The thermal cycler of the present invention is
capable of carrying out DNA amplification in no more than 10 20
minutes and the optical and detection components of the present
invention discern one, two, three, or more fluorophores. The
preferred embodiments of the present invention monitor a number of
individual samples, for example, 24 samples (capillary sample tubes
320 in FIG. 11) from once every few seconds, preferably once a
second, and more preferably ten times each second.
It is within the scope of the present invention to prepare samples
for processing using the known ninety-six well apparatus and the
capillary sample tubes 320 which are then placed in one of the
preferred embodiments of the present invention, for example, the
rapid temperature cycler with fluorescence detection (300 in FIG.
11), for thermal cycling and analysis.
Advantageously, preferred embodiments of the present invention
utilize fluorescence feedback for real time control and
optimization of the biological process, for example DNA
amplification, as the process is ongoing. Thus, with the preferred
embodiments disclosed herein, the fluorescence which is detected is
used to control temperature cycling. Using embodiments of the
present invention disclosed herein, and using the preferred
continuous monitoring techniques with dsDNA-specific dyes,
extension will be terminated each thermal cycle after the detected
fluorescence stops increasing. Further, in accordance with the
present invention, denaturation conditions are also controlled by
increasing the temperature only until the product is completely
melted. Still further, in accordance with the present invention,
primer annealing is monitored with resonance energy transfer
between fluorescein and Cy5-labeled oligonucleotides. Moreover,
using the present invention, temperature cycling of the sample is
automatically terminated after a predetermined amount of product
has been made.
In accordance with the present invention and as is possible using
the apparatus of the present invention, rapid temperature cycling
with minimal annealing and denaturation times improves quantitative
PCR and increases the discrimination of allele specific
amplification. Rapid cycling for cycle sequencing reduces
sequencing ambiguities and minimizes "shadow banding" in
dinucleotide repeat amplifications. In accordance with the present
invention, for long PCR up to 35 kb, yield is improved when the
sample is exposed as little as possible to high denaturation
temperatures.
In contrast to the previous approach to PCR which treat PCR as
three reactions, denaturation, annealing, extension, each of which
occur at three different temperatures (as represented in FIG. 18A),
one aspect of the present invention provides that a kinetic
paradigm for PCR renders important improvements. Using a kinetic
paradigm for PCR (as represented in FIG. 18B), the temperature vs.
time curve consists of continuous transitions between overlapping
reactions. The method and apparatus of the present invention is
particularly efficient at carrying out PCR under the kinetic
paradigm. FIG. 18C is a graph representing different
time/temperature profiles near an annealing temperature of
55.degree. C. In FIG. 18C, the solid trace shows a centrally
positioned "spike" representing the temperature of response of a 10
.mu.l sample. In contrast, the traces shown as short and long line
segments in FIG. 18C represent the temperature responses of samples
obtained using heat block instruments. As can be seen from FIG.
18C, the embodiments of the present invention produce annealing
segment "spikes," with the advantages discussed herein, in contrast
to the temperatures "plateaus" according to the conventional wisdom
in the art.
The previously available instrumentation used for detection
presented many drawbacks. Rapid, precise temperature cycling is
provided by the system of the present invention described herein,
in contrast to previously available instrumentation that is five to
ten times slower. With the continuous fluorescence monitoring also
provided by the system of the present invention, the temperature
dependence of hybridization can be followed. By following
hybridization during temperature cycling, the number of probes
and/or spectral colors required can be minimized. That is,
different products and mutations can be detected by their dynamic
melting characteristics, rather than going to the trouble of
synthesizing different fluorophore-labeled probes for each DNA
species that is to be detected.
In order to provide an embodiment of the present invention that is
most cost effective, a high intensity light emitting diode is used
instead of a xenon arc source or a laser for sample illumination,
and photodiodes are used for detection. Samples are loaded into
glass capillary sample tubes, or alternatively into composite
glass/plastic sample containers (see FIGS. 21A D) in a 96-well
format that does not require heat sealing. The present invention
thus provides real time fluorescence analysis in a cost effective
manner. Real time fluorescence control of temperature cycling
improves amplification quality. For example, if the temperature of
samples is increased only until denaturation occurs, product
exposure to high temperatures is minimized. This increases yield by
limiting product and enzyme degradation and increases specificity
by limiting amplification of products with a high melting
temperature.
Reference will next be made to FIG. 19, which provides a
diagrammatic representation of another preferred embodiment of the
present invention configured for continuous monitoring of a single
sample. It will be understood, however, that the structures
represented in FIGS. 19 and 20 can also be incorporated into a
system which automatically processes multiple samples, such as the
apparatus represented in FIG. 11 and as will be explained shortly
herein. In the embodiment of FIG. 19, a single sample holder 402 is
placed in a holding bracket 404 positioned at the intersection of a
temperature-controlled air stream and a linear optical path. The
sample holder 402 includes a tube 402A which has many of the
desirable characteristics of a capillary tube. In accordance with
the present invention, different configurations of capillary tubes
can be used and the tube 402A preferably has a rectangular cross
section. The biological sample preferably is held at a bottom end
of the tube 402A as indicated at 402B. A cap 402C is also
preferably provided on the sample holder 402.
Reference will next be made to FIGS. 19A 19E which compare the
effect of different configurations of sample containers on the
temperature response of the sample itself. The temperature-time
tracings shown in FIG. 19E correspond to the response obtained
using the sample container configurations represented in FIGS. 19A
C, respectively. FIG. 19D represents a sample container which is
less preferred for use in the present invention and is included for
comparison. Using the information set forth herein, those skilled
in the art can arrive at optimum sample container configurations
for particular applications of the present invention. Further
information regarding each of the sample container configurations
represented in FIGS. 19A D are set forth below.
TABLE-US-00001 Fluid Surface Column Area Length Sample FIG.
(mm.sup.2/10 .mu.l) (mm) Volume Source 19A 77 47 10 .mu.l Kimble
KIMAX #46485-1 19B 42 13.8 34 .mu.l Kimble KIMAX #46485-15 19C 32 8
59 .mu.l Kimble KIMAX #34500-99 19D 18 N/A 10 .mu.l MICROAMP .TM.
tube of Perkin- Elmer Cetus GeneAmp PCR System 9600
In the apparatus of FIG. 19, an excitation radiation source 418,
preferably an LED and most preferably a blue LED, is provided to
illuminate the sample holder 402. The radiation emitted by the
excitation radiation source 418 passes through aspheric focusing
lenses 420 and an excitation bandpass filter 422 and the radiation
is focused onto the sample holder 402.
The optical components illustrated in FIG. 19 are preferably held
in an optical housing 412. A housing 406 is also provided. A fan
408 is provided to move air through an air duct 414 and over the
sample holder 402 held in the sample bracket 404. A temperature
unit 410 is placed in the air flow path to provide heating or
heating and cooling for the air passing over the sample holder 404.
A nozzle 416 effectively directs the air over the sample holder
404.
The emissions which are given off by the sample pass through two
more aspheric lenses 420 and an emission bandpass filter 424 and
are received by a photo detector 426, which preferably is a photo
diode. Those skilled in the art can readily provide the control
components needed to advantageously operate the apparatus
represented in FIG. 19 using the information set forth herein.
FIGS. 19F and 19G are side and end views, respectively, of one
preferred sample container 403 which utilizes a rectangular
capillary tube 403A. The capillary tube 403A is preferably one
available from Vitro Dynamics Inc. having dimensions of 1
mm.times.3 mm.times.50 mm. A first cap member 403B and a second cap
member 403C are held together by a screw 403D, the screw 403D also
functioning as a holder for the capillary tube 403A.
FIGS. 19H and 19I, respectively, show two possible orientations of
a rectangular capillary tube 403A when detecting fluorescence of
the sample contained therein. FIG. 19H shows the rectangular
capillary tube 403A oriented so that its edges are in line with the
optical axis of the excitation and detection optics ("edge
excitation and detection"). FIG. 19I shows the rectangular
capillary tube 403A oriented so that its faces are in line with the
optical axis of the excitation and detection optics ("face
excitation and detection"). Surprisingly, the fluorescence signal
obtained from the edge detection orientation shown in FIG. 19H is
about three-fold to about five-fold higher than obtained with the
face detection orientation shown in FIG. 19I. The desirable
characteristics of using the edge detection orientation shown in
FIG. 19H is at least partially due to total internal reflection
which takes place in the capillary tube 403A which concentrates the
fluorescence signal to the extremities of the capillary tube
403A.
FIG. 20 shows the optical components of another referred embodiment
in accordance with another aspect of the present invention. The
optical components represented in FIG. 20 are preferably
incorporated into the thermal cycling and sample handling
structures represented in FIG. 21, which will be more fully
described shortly, but which can also be used with many different
arrangements to provide monitoring (most preferably continuous
monitoring) of a sample undergoing the polymerase chain
reaction.
In contrast to the arrangements previously disclosed herein, the
optical excitation and detection paths are combined in the
embodiment of FIGS. 20 and 21, referred to herein as an
epifluorescent path, rather than a linear path. In the embodiment
of FIGS. 20 and 21, the excitation and emission radiation follow
the same optical path between the capillary tube and the dichroic
element used in the excitation path. A capillary tube is
particularly adapted for use in the embodiment of FIGS. 20 and 21
due to the total internal reflection (also referred to as "light
piping") along the length of the capillary sample tube which is
exploited to increase both excitation and emission intensities.
In the embodiment of FIGS. 20 and 21, to accommodate maximal light
piping, the optical axis is parallel to the length of the capillary
tube (paraxial) with the tip of the capillary tube positioned at
the focal point. Assuming a refractive index of about 1.33 for the
sample being detected, about 12.3% of emitted light is guided to
the tip. It is understood that centrifuge action can be used to
move the sample to the tip of the capillary tube.
FIG. 22A charts the effectiveness of light piping when detecting
fluorescence at the tip of the capillary tube and shows a 10-fold
increase in signal intensity by viewing the tip (closed diamonds)
rather than the side (open circles) of the capillary sample
container. Also, as indicated in FIG. 22B, the results obtained
using capillary sample tubes of two different sizes and which were
filled to different lengths with dsDNA stained with SYBR.RTM. Green
I are plotted. As can be surmised from FIGS. 22A and 22B, the
observed epifluorescence increases as more sample is added to the
tube, although the fluorescence efficiency decreases.
The optical properties of the emission from a capillary were
investigated by stimulating fluorescence in a capillary filled with
a fluorescein solution at 470 nm. The emission from a blunt end of
the capillary was seen to be homogenous across the face of the
capillary as opposed to concentrated in the glass as would be
exepcted if the emission were the result of evanescent wave
fluorescence.
The optical components represented in FIG. 20 carry out paraxial
epifluorescent illumination of the capillary tip, which provides
advantageous results not otherwise obtainable. In FIG. 20, an
excitation radiation source 468 is preferably a blue LED, such as
one known in the industry as a super bright LED and available from
LEDtronics. The emitted fluorescence signals are acquired by photo
detectors 466A and 466B. The excitation radiation source 468 and
the photo detectors 466A and 466B are supported on a mounting board
468 which also includes necessary circuitry and which integrates
filters with the photo detectors 466A and 466B. A preferred
mounting board is available from Ealing Electrooptics which
includes 0.5 inch interference filters with high performance
silicon photodiodes in TO5 packages. The excitation and detection
components are supported directly on the mounting board 468 with
associated electronics. It is preferred that the optical components
are preferably .ltoreq.1.0 inches in diameter. A collimating lens
454, two dichroic filters 456A and 456B, a mirror 458, interference
filters 460A C, and aspheric focusing lenses 462A C direct the
radiation to and from the sample.
While the embodiment of the present invention represented in FIG.
20 utilizes only two colors/wavelengths when performing an
analysis, those skilled in the art can readily adapt the embodiment
to provide three, or more, color analysis. To provide three or more
color analysis, the apparatus represented in FIG. 20 can
accommodate additional dichroic filters and photo detectors.
Moreover, it is within the scope of the present invention to allow
simultaneous separation of wavelengths onto a linear photo detector
array, as is available in the industry, for multicolor acquisition.
When a linear photo detector array is used in accordance with the
present invention, it is preferred that a prism or diffraction
grating be utilized in cooperation with a lens and a photo detector
array or CCD for detection of multiple wavelengths. One preferred
linear photo detector array available in the industry collects 15
30 wavelength bins of 10 20 nm each between 500 and 800 nm. Various
configurations of optical components, for example the Littrow
autocollimating configuration for gratings used in most
monochrometers, can be arrived at using the information set forth
herein to arrive at the best accommodation between collection
efficiency, spectral resolution and spatial requirements. The
apparatus of FIG. 20 will now be further described incorporated
into an automated thermal cycling apparatus represented in FIG.
21.
FIG. 21 provides a schematic representation of another presently
preferred embodiment 400 of the present invention which includes
rapid temperature cycling components, sample handling components,
and the optical components represented in FIG. 20, all working
together to provide fluorescence detection at the tip of the sample
containers (epifluorescence). The rapid temperature cycler with
epifluorescence detection 400 represented in FIG. 21 provides
particular advantages. It is to be understood that this described
embodiment is merely exemplary of the present invention and that
those skilled in the art can arrive at many different arrangements
for carrying out the invention claimed herein.
In the embodiment represented in FIG. 21, air is taken in through
an aperture 470 and generally follows the flow path indicated by
the lines 472. The temperature of the air, and thus the temperature
of the plastic/glass sample container 450, is preferably adjusted
using a 400 watt heating cartridge 474 which is preferably one
available from Reheat, Inc. The heating cartridge 474 is positioned
within a central duct 476. A fan 498 is provided to move the air in
the indicated path 472. The fan is driven via a shaft 496 and a
motor 494. The motor 494 is preferably a DC rare earth brush motor
which is preferably available from Escap AG. and having a maximum
rpm of 15,000. When heating the plastic/glass sample tubes 450, the
heating cartridge is proportionally controlled and the fan is run
at a relatively low speed (12 volts, 0.5 amp) to provide
temperature homogeneity for all of the plastic/glass sample
containers 450. When cooling the plastic/glass sample containers
450, the heating cartridge 474 is disabled and the motor 494 is run
at a fast speed (for example with the above-mentioned preferred
motor maximum speed is obtained by applying 27 volts, 1.4 amps).
The fan 498 forces air into the aperture 470 and out via exhaust
ports 471.
In the preferred rapid temperature cycler with epifluorescence
detection 400, it is preferred that twenty-four plastic/glass
sample containers 450 (two of which are represented in FIG. 21) be
symmetrically arranged around the heating cartridge 474 and the
central duct 476. The plastic/glass sample containers 450 are
received by sleeves 451 which (due to their offset structure) allow
for precise adjusting of the position of the individual
plastic/glass sample containers 450 in a circular carousel 480. The
sleeves 451 are preferably fabricated from brass. The off-axis
structure of the sleeve 451 allows each sleeve 451 to be aligned so
that the tip of the glass/plastic sample container 450 can be
precisely adjusted to be at the optical focal point represented in
FIG. 21, both laterally and longitudinally, at the time that the
rapid temperature cycler with epifluorescence detection 400 is
fabricated.
The carousel 480 is supported on a bearing 482 above a housing 490.
The carousel 480 is positioned by a stepper motor 488 provided with
a drive gear 484 connected to the motor 488 via a shaft 486. The
stepper motor 488 is microstepped (using a controller (not
explicitly represented in FIG. 21) from New England Affiliated
Technologies) to provide over 10,000 steps per revolution of the
carousel 480, providing precise positioning of each the
plastic/glass sample containers 450. The interior of the housing
490 is provided with an insulative material 492, preferably in
accordance with the previously described insulative material.
Baffles 476 function to form the exhaust port 471 and to block
ambient light.
FIGS. 21A D provide additional detailed views of the plastic/glass
sample containers 450 and will be referred to for an explanation of
the preferred method of using the same. The plastic/glass sample
container 450 includes a capillary tube portion 450B which is
closed at one end. The capillary tube portion 450B can take many
different configurations and is not limited to only a capillary
tube type structure. It is, however, preferred that the volume of
fluid held by the plastic/glass sample containers 450 be not more
than 1 milliliter in order to promote sample temperature
homogeneity and rapid thermal cycling. For example, it is preferred
that the material from which the capillary tube portion 450B is
fabricated have a thermal conductively in the range from about 20
to about 35 in accordance with the formula
.times..times..times..times..times..times..times..times.
##EQU00001## Further information regarding the thermal conductivity
of different glasses can be obtained from R. C. Weast & M. J.
Astle, HANDBOOK OF CHEMISTRY AND PHYSICS, page E-6 (1982)(CRC
Press) which is now incorporated herein by reference. The
plastic/glass sample containers 450 are also provided with a
reservoir portion 450C which is preferably fabricated from an
appropriate plastic and joined to the open end of the capillary
tube portion 450B. While many different materials can be used for
the reservoir portion 450C, it is preferred that a plastic material
be formed in a funnel-like shape and attached to the capillary tube
portion 450B.
A sample S is loaded into the composite plastic/glass sample
container 450 using a pipette P, or some other appropriate
instrument, either manually or using an automated process. It is
preferred that the volume of the sample be in the range from about
0.01 .mu.l to about 10,000 .mu.l, more preferably in the range from
about 0.01 .mu.l to about 100 .mu.l, and most preferably in the
range from about 0.01 .mu.l to about 10 .mu.l, with about 5 .mu.l
being the most preferred volume. Once a sample has been added to
each plastic/glass sample container 450, the plastic/glass sample
containers 450 are centrifuged at low speed to place the samples at
the tips of the closed end of the capillary portion 450B, so that
the sample forms a 0.2 2.0 cm column of fluid 450A as represented
best in FIG. 21B. A stopper 450D (which is preferably configured as
a plastic plug) is then placed in the reservoir portion 450C to
seal the plastic/glass sample container 450 as shown best in FIG.
21C and the plastic/glass sample container 450 is placed in the
sleeve 451 in the rapid temperature cycler with epifluorescence
detection 400. It is also within the scope of the present invention
to provide different structures to seal the capillary tube portion
450B.
The capillary tube portion 450B of the glass/plastic sample
container 450 is preferably a glass capillary tube available in the
industry having 0.8 mm inner diameter and a 1.0 mm outer diameter,
and which is closed/sealed on one end and flared at the other end
for receiving the plastic reservoir 450C. The glass/plastic sample
containers 450 can be readily and economically fabricated. The
shape of the tip 450E of the capillary tube portion 450B is
optimized for optical efficiency. Flat tips as well as tips with
various outside curvatures and inside curvature are all
contemplated within the scope of the present invention. Those
skilled in the art can select the most efficient configuration for
the tip.
As can be discerned from FIGS. 21A D, the addition of plastic
loading and sealing structures to a capillary tube provides great
advantages and allows efficient use of glass capillary tubes while
retaining their desirable thermal characteristics. It will be
appreciated that it is within the scope of the present invention to
add the samples to the plastic/glass sample containers 450, and to
subject the samples to centrifuging, in a 96-well format. Moreover,
it is within the scope of the present invention to load the
plastic/glass sample containers individually into the rapid
temperature cycler with epifluorescence detection 400 and it is
also within the scope of the present invention to provide an
embodiment of the present invention to load the plastic/glass
sample containers 450 in a 96-well format or some other format.
Advantageously, the composite plastic/glass sample containers 450
provide a convenient, inexpensive sample holder. With the
embodiment of FIG. 21, it is preferred that fluorescence is
acquired from single samples one to ten times each second. When
acquiring fluorescence from multiple samples at the preferred rate,
the samples need to be moved into position by rotation of the
carousel 480 relatively rapidly. With the preferred stepper motor
488 and appropriate control devices (which can be selected using
the information contained herein) each of the twenty-four samples
can be rapidly and accurately moved to the monitoring position
represented in FIG. 21.
When the flourescent signal from each sample is acquired for 100
msec., the signal variation (with repositioning) is <1%. It will
be appreciated that it is within the scope of the present invention
to decrease the signal acquisition time, increase the transit
speeds, and also observe the coefficient of variation from repeated
sampling. When twenty-four samples are processed, and the carousel
is rotated without stopping at a rate between one and ten
revolutions per second, each sample has 0.37 3.7 msec of excitation
and detection.
Using the information set forth herein, one skilled the art can
select whether the flourescent signal is integrated via software or
hardware. In one preferred embodiment, a graphical programming
language is used in connection with the rapid temperature cycler
with epifluorescence detection 400, such as one known in the
industry as LabView (available from National Instruments), which
has subprograms for peak detection and integration. In another
preferred embodiment, integration is done in hardware with variable
integration time (user adjustable sensitivity control) so that the
signals reach a level optimal for analog-to-digital conversion.
Using the rapid temperature cycler with epifluorescence detection
400 represented in FIG. 21, continuous monitoring of the sample as
the reaction is ongoing allows determination of temperature cycling
requirements during amplification, based on continuous observation
of annealing, extension, and denaturation. This is in contrast to
the prior art where all cycling parameters are determined and
programmed before amplification begins. In accordance with the
prior art, using complementary oligonucleotides equivalent to the
lowest melting primer, the annealing efficiency is controlled even
during early cycles. In many cases, extension and denaturation can
only be monitored with dsDNA dyes during later cycles when enough
product has been made. Significantly, such a requirement is not
usually a problem because denaturation and extension conditions are
made permissive enough to amplify most products, and data from the
first amplification can be used to optimize subsequent runs.
Still referring to FIG. 21, a user interface and instrument control
500 can be fabricated using the information set forth herein in
connection with the embodiment of FIG. 11. As one preferred example
of a user interface and instrument control 500, a PENTIUM.TM.
microcomputer running the LabView programming language with a
12-bit multifunction input/output card (available from National
Instruments) provides data acquisition and control. It is preferred
that the analog output signals be used to adjust the amplifiers
associated with the photo detectors 466A and 466B. Analog input
channels also measure the temperature of the samples via a
thermocouple 499 as well as the flourescent detected from the
sample by the photodiodes. The user interface and instrument
control 500 represented in FIG. 21 also provides digital I/O
control of the excitation radiation source 468, the direction of
the stepper motor 488, the heating cartridge 474, and the fan
498.
When continuous fluorescence monitoring of PCR samples containing
the dsDNA dye SYBR Green I or fluorescently labeled oligonucleotide
probes can be used to monitor hybridization and melting during
individual amplification cycles. This information can be used by
preferred arrangements for the user interface and instrument
control 500 to provide improved and customized thermal cycling
conditions. The benefits of using hybridization information for
temperature cycling include: (A) Ensuring that complete
denaturation of the PCR product occurs with each cycle while:
Minimizing exposure to excessively high denaturation temperatures,
thus, avoiding heat induced damage to the amplification products
and polymerase. Increasing reaction specificity by minimizing the
denaturation temperature which selects against products with a
T.sub.m higher than the intended amplification product. (B)
Maximizing the amplification efficiency by ensuring adequate time
for product extension with each cycle while: Minimizing the amount
of time required for amplification by allowing no longer than
needed to complete product extension. Enhancing reaction
specificity by selecting against products longer than the intended
amplification product. (C) Maximizing the amplification efficiency
by ensuring adequate time for product extension each cycle while:
Minimizing the amount of time required for amplification by
allowing no longer than needed to complete product extension.
Enhancing reaction specificity by selecting against products longer
than the intended amplification product. These would require longer
than the allotted time to complete product extension. (D)
Initiating thermal cycling changes dependent on the level of
fluorescence obtained or the current efficiency of amplification.
For example, over-amplification and nonspecific reaction products
can be minimized by terminating thermal cycling when the efficiency
drops to a certain level. As another example, temperature cycling
can be modified to initiate slower temperature ramps for melting
curve acquisition when the fluorescence becomes detectable. This
saves time because the slower ramps need not be used on earlier
cycles. Other desirable changes may become evident on continued
practice of the invention. (E) Minimizing over-amplification damage
to PCR product and/or initiation of melting curve acquisition
before over-amplification has increased the background of
nonspecific reaction products.
In accordance with the present invention, the user interface and
instrument control 500 can follow preprogrammed time/temperature
set points and/or, advantageously, can acquire detected
fluorescence values and then use the acquired detected fluorescence
values to alter or adjust one or more reaction parameters in real
time to optimize the results obtained. As used herein, the term
"reaction parameter" includes, but is not limited to, any parameter
which is used as a basis for controlling a reaction. Such reaction
parameters include, but are not limited to, denaturation
temperature and time, primer annealing temperature and time, probe
annealing temperature and time, enzyme extension temperature and
time, and number of cycles. In general, control of the reaction is
initally based on an estimate of reaction parameters from the
fluorescence data. The original fluorescence data is either
acquired as a change in fluorescence over time (temperature
specific rates of denaturation, annealing, and extension), a change
in fluorescence over temperature (product or probe T.sub.m) or a
change in extent of amplification (amplification yield and
efficiency). These rates, T.sub.ms, and their first and second
derivatives, are used to determine optimal reaction parameters such
as denaturation temperature and time, primer annealing temperature
and time, probe annealing temperature and time, enzyme extension
temperature and time, and number of cycles.
As depicted in the high level block of FIG. 22C, tasks are divided
between those carried out by a portion of the user interface and
instrument control 500 (which preferably can be an IBM compatible
computer using programing based upon the teachings set forth
herein) (Blocks 500A 500E in FIG. 22C) and those carried out by the
remaining components (Blocks 500A, and 500G 500S in FIG. 22C) of
the rapid temperature cycler with epifluorescence detection 400. It
is to be understood that the block diagram of FIG. 22C is merely
exemplary and many different arrangements can be used to carry out
the present invention.
As an example of the advantages of the arrangement shown in FIG.
22C, product melting control will be discussed. A melting peak
fluorescence value is acquired for the intended PCR product and a
baseline fluorescence is acquired for the sample containing the
reaction mixture at the temperature at which the product is seen to
have completely melted. Each cycle of the reaction uses this
fluorescence value as a target. The approach being described in
this example uses two stages in to provide a time lag to
accommodate the requirement of sending the fluorescence values to a
separate PC computer. With each product melting step, the
temperature is increased until the fluorescence reaches an
intermediate value, then the power applied to the heating device is
reduced so that a temperature ramp of approximately 3.degree. C.
per second is imposed so that the PC computer has adequate time to
analyze the fluorescence and convey to other components that
product denaturation has occurred. The resulting time/temperature
plot is shown in FIG. 22D. FIG. 22D shows a characteristic increase
in the melting temperature after twenty cycles as the concentration
of amplification product grows. This is due to the fact that
product T.sub.m is a function of product concentration.
As an example of the further advantages of the arrangement shown in
FIG. 22C, product annealing/extension will be discussed. During an
extended hold at a combined annealing/extension temperature, the
fluorescence of the sample is monitored and this information is
used to ensure that adequate, but not excessive, time had been
allowed for product extension. Fluorescence is monitored at ten
second intervals, and if the fluoresce increased more than a preset
ratio (typically 1.00 to 1.05), then the annealing/extension step
is continued. Otherwise, the next product melting step is
initiated. The interval of ten seconds is chosen to give a minimum
of twenty seconds at the combined annealing/extension
temperature.
FIG. 22E shows a fluorescence/time plot which exhibits a
characteristic increase in the dwell time at the combined
annealing/extension temperature as the concentration of
amplification product grows. This is due to the fact that as the
primer concentration and polymerase become limiting more time is
needed to complete product extension with each cycle.
As a yet another example of the advantages of the arrangement shown
in FIG. 22C, amplification plateau will be discussed. At the end of
each annealing/extension step, the fluorescence value is acquired
and stored. When this value increases to 1.2 times the lowest
end-cycle fluorescence value and had subsequently stopped
increasing below a user settable ratio (typically 1.00 1.02) the
thermal cycle is terminated. Alternatively, a melting curve
accusation step is initiated by entering a slow 0.1.degree. C. to
0.2.degree. C./second temperature ramp through the product T.sub.m
and monitoring the fluorescence of the sample continuously. The
resulting fluorescence/time plot shown in FIG. 22D shows that after
twenty-five cycles of amplification the ratio of cycle-by-cycle
fluorescence growth fell below 1.00 and the reaction terminated. It
will be appreciated that this approach can be used to acquire a
high resolution melting curve for each sample. As a sample reaches
its amplification plateau, a melting curve can be acquired for that
sample, then regular temperature cycling can resume until another
reaction reaches its amplification plateau.
FIG. 22E illustrates useful temperature vs. time segments for
fluorescence hybridization monitoring. Product melting curves are
obtained during a slow temperature increase to denaturation. By
quickly lowering the temperature after denaturation to a constant
temperature, product, probe, or primer annealing can be detected.
Probe melting curves are obtained by slowly heating through
temperatures around the probe T.sub.m. Those skilled in the art can
readily utilize the system represented in FIG. 21 to provide the
necessary analysis, in real time if desired, during temperature
cycling to provide heretofore unavailable information on the
characteristics of the product, probe, and primer using the
hardware and software described herein.
Absolute quantification of product is also advantageously carried
out in accordance with the present invention. Continuous monitoring
of double stranded DNA formation allows direct, absolute DNA
quantification by reannealing kinetics. The sample temperature is
quickly dropped from the denaturation temperature and held constant
at a lower temperature that is still high enough to prevent primer
annealing. The rate of product reannealing then follows second
order kinetics. When different concentrations of DNA are tested,
the shape of the reannealing curve is characteristic of the DNA
concentration (see FIG. 26). For any given PCR product and
temperature, a second order rate constant can be measured. Once the
rate constant is known, any unknown DNA concentration can be
determined from experimental reannealing data. The curves can be
fit by non-linear least squares regression during temperature
cycling in real time using the LabView programming environment
(explained previously). Cooling is not instantaneous, and some
reannealing occurs before a constant temperature is reached, but
regression analysis allow for this in accordance with the present
invention. The technique requires pure PCR product, but this can be
verified by melting curves also obtained during temperature
cycling. Quantification by reannealing kinetics is independent of
signal level and not affected by sample volume differences.
FIG. 28 is a schematic representation of another embodiment of the
present invention which includes many of the structures included in
the embodiment of FIG. 21. In order to provide a succinct
description of the embodiment of FIG. 28, only those significant
differences between those components represented in FIG. 21 and
those components represented in FIG. 28 will be explained with the
understanding that one skilled in the art can readily use the
information contained herein to fabricate embodiments of the
present invention. FIGS. 27A and 27B are cross sectional schematic
views of the embodiment represented in FIG. 28 in a run mode and a
load mode, respectively.
The embodiment of FIG. 28 is a rapid temperature cycler, generally
designed at 502, with fluorescence detection at the tip of the
sample containers with automatic positioning of the sample
containers in two dimensions which improves the fluoresce signal
which is obtained from the sample. FIG. 29 is a perspective view of
the exterior of the embodiment of the present invention including
the components illustrated in the schematic representation of FIG.
28.
As seen in both FIGS. 28 and 29, a removable circular sample tray
483 holds thirty-two samples. The removable circular sample tray
483 is placed into the rapid temperature cycler 502 so that it
engages a carousel 481 which is driven by a motor 488. As the
carousel 481 rotates, a hall effect position locator is used to
precisely position the carousel 481 so that the each sample is
precisely positioned over a flourimeter assembly 459. The
flourimeter assembly 459 preferably includes a LED source 459A,
three photodiodes 459B, focusing lenses 459C, and a filter assembly
459D. The flourimeter assembly 459 is similar in structure and
function to that represented in FIG. 20.
Most advantageously, the fluorimeter is mounted on a slider bearing
493 which is moved by a lateral stepper motor 491. As the carousel
481 rotates, the composite plastic/glass sample containers 450 are
precisely positioned over the fluorimeter assembly 459 in the
direction of the carousel and the position is noted by the
apparatus via the hall effect position locator 495 while the
lateral stepper motor 491 adjusts the position of the fluorimeter
assembly 459 is adjusted in a second dimension, and the position
noted. Thus, the rapid temperature cycler 502 provides for improved
placement of a plurality of samples into the apparatus using a
removable sample tray 483 and provides for improved detection of a
fluorescence signal from a sample.
Provided in FIGS. 30A 30V are detailed schematic diagrams showing
the preferred configuration of the electrical components of the
rapid temperature cycler 502 represented in FIGS. 28 and 29. It is
to be understood that the diagrams of FIGS. 30A 30V are merely one
preferred arrangement for carrying out particular aspects of the
present invention and these diagrams are not intended to be
limiting of the scope of the present invention. In order to improve
the clarity of the diagrams, the notations which are commonly used
in the industry are maintained on these diagrams and are referenced
in the corresponding parts list provided below.
TABLE-US-00002 Parts List-MAIN Quan- Item tity Reference Part 1 1
BT1 3 V LITHIUM 2 9 C1,C2,C3,C8,C9,C13,C18, .1 UF C24,C26 3 7
C4,C5,C10,C12,C14,C15, 1 UF C17 4 2 C7,C6 100 UF 5 6
C11,C16,C19,C20,C21,C22 18 pF 6 1 C23 47 UF 7 2 C25,C27 22 UF 8 2
C28,C29 10 UF 9 1 F1 1 A 10 1 IC1 AD594 11 2 IC2,IC3 DS5000FP 12 1
IC4 LM324 13 8 IC5,IC7,IC10,R13,R17, 10K R18,R21,R22 14 2 IC6,IC8
MS62256 15 2 IC9,IC10 DS2003 16 1 IC11 TLC1451 17 1 IC12 7432 18 1
IC13 PT5101 19 1 IC14 PT5102 20 1 IC15 7404 21 1 IC16 PIC16C54 22 1
IC17 MAX232 23 1 IC18 LM4040 24 1 IC19 LTC1293 25 1 IC20 LTC1286 26
1 IC21 LM385 1.2 27 1 IC22 LTC1144 28 2 IC23,IC24 PVG612S 29 1 JP1
HALL SENSOR 30 1 JP2 FLO1 31 1 JP3 FLO3 32 1 JP4 FLO2 33 1 JP5 MAIN
HEADER 34 1 J1 CON2 35 1 LED1 STEP 36 1 LED2 TEMP 37 2 LED3,LED4
RED/GREEN LED 38 1 P1 SERIAL CONNECTOR 39 1 Q1 2N5484 40 10
Q2,Q3,Q4,Q5,Q6,Q7,Q8, NDS351 Q9,Q10,Q11 41 1 R1 4.87K 1% 42 4
R2,R4,R5,R6 10K 1% 43 1 R3 2.74K 1% 44 1 R7 200 45 8
R8,R9,R10,R11,R19,R20, 470 R28,R29 46 2 R15,R12 100 47 3
R14,R16,R23 1K 48 4 R24,R25,R26,R27 4.7K 49 1 S1 TYPE J 50 1 Y1
20.0000 51 2 Y3,Y2 14.745600
TABLE-US-00003 Parts List-POWER BOARD Quan- Item tity Reference
Part 1 3 C1,C5,C6 330 UF 2 1 C2 47 UF 3 1 C3 1000 UF 4 1 C4 22 UF 5
1 C7 100 UF 6 1 C8 220 UF 7 5 C9,C10,C11,C12,C13 .1 UF 8 2 C15,C14
10 UF 9 2 DR1,DR2 IM481H 10 1 D1 1N5232 11 2 D2,D4 1N4756 12 2
D5,D3 11DQ06 13 1 F1 2A 14 4 IC1,IC2,IC3,IC4 HCPL2630 15 1 IC5
LM2574hv8 16 2 IC7,IC6 PVG612S 17 1 IC8 MOC 3020 18 1 IC9 TLC1451
19 1 IC10 LM324 20 1 IC11 BRIDGE 21 1 IC12 LTC1144 22 1 JP1 HEADER
14 23 2 JP2,JP3 4 HEADER 24 1 JP4 HEADER 12 25 2 L2,L1 330 UH 26 1
Q1 4008 27 9 R1,R2,R4,R5,R6,R7,R8, 470 R9,R10 28 1 R3 360 29 7
R11,R13,R14,R16,R17, 10K R18,R19 30 1 R12 4.7K 31 1 R15 1K 32 1 R20
261 33 1 R21 866 34 1 R22 650 35 1 R23 180 36 2 S1,S2 110/220 37 1
T1 TRANSFORMER FLAT COMPACT 38 1 VR1 LM2575
TABLE-US-00004 Parts List-INTEGRATOR Quan- Item tity Reference Part
1 2 C1,C2 1 UF 2 1 C3 .01 3 1 IC1 ACF2101 4 1 IC2 OPT301 5 1 IC3
OPA627 6 1 IC4 REF200 7 1 J1 CON6 8 1 P1 500 9 1 R1 30M 10 1 R2
100K 11 2 R3,R4 10K 12 2 R5,R6 100
TABLE-US-00005 Parts List-HALL EFFECT Quan- Item tity Reference
Part 1 1 IC1 HAL115 2 1 J1 CON3 3 1 R1 10K
Exemplary programming code used in connection with the components
of FIGS. 28, 29, and 30A 30V is included in the Programming Code
Appendix B attached hereto and incorporated herein by
reference.
In accordance with another embodiment of the present invention a
handling system is provided for loading small volume sample vessels
with liquid samples, particularly samples to analyzed by detection
of emitted fluorescence. The sample vessel typically has a volume
of less than 1 ml, and it can be in the form of a tube (i.e. a
capillary tube) or a "flat capillary" wherein the capillary space
is defined by two spaced-apart plates or sheets sealed along their
edges. The sample vessel typically has a volume to external surface
area ratio of about 1 mm, more typically less than about 0.5.
Capillary tubes having an inner diameter of less than 1 mm have a
volume to surface area ratio of less than 0.25 mm. The vessel used
in accordance with the present invention is preferably formed from
an optically transparent material. Preferred materials are
optically transmissible for light having a wavelength ranging from
about 400 to about 800 nm. The use of such material will allow the
detection of a fluorescent signal generated in a liquid sample held
by the vessel. Moreover the use of vessels with a low volume to
surface area ratio for analyzing fluorescence from a fluorescent
sample enables more efficient detection of the fluorescence due to
enhanced total internal reflection.
Vessels having a high surface area to volume ratio (or conversely,
a low volume to surface area ratio) can be difficult to load with
liquid samples. Advantageously, the sample handling system of the
present invention helps to overcome such difficulties. In
accordance with one embodiment a vessel having a high surface area
to volume ratio and an open end is provided with a funnel cap that
fits onto the open end of the vessel to facilitate loading of
liquid samples into the vessel. The funnel cap includes a first
sample receiving port and a second sample transfer port and means
for releasably fixing the funnel cap on the vessel so that the
sample transfer port of the funnel cap and the open end of the
vessel are in alignment. In one embodiment the funnel cap is of
plastic or rubber construction and is formed so that the inner
diameter of the sample transfer port frictionally engages the outer
diameter of the vessel proximal to its open end. However, other
means of coupling the funnel cap to the vessel are know to those
skilled in the art and are within the scope of the invention,
including the use of adhesives, clamps, clasps and the like. In one
embodiment the sample handling system further comprises a plug for
frictional fit sealing engagement with the sample receiving port of
the funnel cap. However any device or material that effectively
seals the opening of the funnel to prevent contamination or
evaporation of the loaded sample is suitable for use with the
present invention.
Advantageously the vessels of the present invention can be used in
a method for enhancing detection and efficiency of acquisition of
fluorescence in a sample comprising a fluorophore. The method
comprises the steps of placing a sample in a vessel having walls
composed of an optically transparent material and defining a volume
having at least first and second dimensions. The first dimension is
less than the second dimension and the ratio of volume to external
surface area of the vessel is less than 1 mm. Enhanced detection
and efficiency of acquisition of fluorescence generated from the
sample is achieved by detecting fluorescence along an axis
substantially parallel to a wall along the second dimension of the
vessel. In one embodiment, sample fluorescence is induced by
fluorophore-excitatory illumination of the sample wherein the
sample is illuminated along an axis substantially parallel to a
wall along the second dimension of the vessel. In a preferred
embodiment, optimum efficiency of fluorescence acquisition is
achieved by fluorophore-excitatory illumination of the sample along
the fluorescence detection axis (epifluorescent detection), and
fluorescence is detected along an axis through a wall of the vessel
having the smallest surface area, preferably along an axis through
the bottom of the vessel.
In one embodiment, the fluorescence of the biological sample is
temperature dependent. For example the vessel may contain a sample
comprising nucleic acid sequences and the fluorescent entity may
comprise a double strand specific dye. As the temperature of the
sample is raised to the denaturation temperature, fluorescence
intensity decreases. Alternatively the fluorescent entity may
comprise a pair of oligonucleotide probes that hybridize to
adjacent regions of a target nucleic acid sequence, wherein one of
said probes is labeled with an acceptor fluorophore and the other
probe is labeled with a donor fluorophore of a fluorescence energy
transfer pair. In this embodiment the vessel and the sample can be
heated while monitoring the fluorescence of at least one
fluorophore of the fluorescence energy transfer pair.
In accordance with one embodiment the vessel is in the form of a
capillary tube or flat capillary that can be used with advantage in
procedures that require thermal cycling of a sample, for example,
amplification of a target nucleic acid sequence by the polymerase
chain reaction. In one embodiment the capillary vessel is formed to
be inserted into a sample holder of a device used for thermal
cycling or a device used to detect fluorescence. The sample holder
of the device may hold only a single vessel, or the sample holder
may be in the form of a carousel for holding a plurality of sample
vessels.
A carousel suitable for use in accordance with the present
invention is shown in FIGS. 31A&B. The carousel 1 is generally
in the form of a disc 2 having a top surface 3, a bottom surface 4
and an outer edge 5 extending therebetween. The disc 2 has a
plurality of sets of radially aligned sample receiving ports 6A,
6B, and 6C in the top surface 3, a sample vessel port 7 in outer
edge 5 and a sample passageway 8 communicating with the sample
receiving ports 6A, 6B, and 6C and the respective sample vessel
port 7. The carousel 1 is shown with fixed sample vessels, some of
which are indicated at 9. The sample vessel port 7 and sample
passageway 8 are formed for receiving and fixing sample vessel 9 to
the disc 2. In one embodiment the sample vessel 9 is releasably
fixed to the carousel 1 to allow the removal of the sample vessel
and its replacement with another sample vessel to allow for
multiple use of the carousel 1. In an alternative embodiment the
sample vessels 9 are permanently fixed to, or formed as an integral
component of, the disc 2. In one embodiment the sample vessel 9 is
fixed to the disc 2 by frictional contact between the sample vessel
9 and at least a portion of the sample passageway 8 proximal to
said sample vessel port 7. Other conventional means for fixing the
sample vessel in communication with the sample vessel can be used.
For example, complementary screw threads can be formed on the
surface of the sample passageway 8 and on the exterior surface of
the sample vessel 9. In addition adhesives or any other fixation
means known to those skilled in the art can be used in accordance
with the present invention to fix the sample vessel 9 to the disc
2. The top and bottom surfaces of the carousel of the present
invention are preferably formed to allow multiple carousels to be
stacked one on top of another so that a stack of multiple carousels
can be releasably engaged with a motor drive shaft and rotated
simultaneously as a unit as shown in FIG. 32.
The embodiment shown in FIG. 32 includes a stepper motor 504 and a
drive shaft 506 which functions to hold and rotate the carousels
generally indicated at 1. A chamber fan 508 is used to generate the
air flow indicated by the arrows 512. A heating device 510
functions to heat the air which passes by the sample vessels 9. A
fluorimeter assembly 514 includes an LED source 514A, photodiodes
514B, focusing lenses 514C, and a filter assembly 514D. A
fluorimeter stepper motor 516 functions to move the fluorimeter
assembly 514 in the direction of arrow 518. Those skilled in the
art can readily fabricate embodiments of the present invention
fashioned after the arrangement represented in FIG. 32 using the
information set forth herein.
In another embodiment (not shown) the carousel comprises a disc
having a top surface, a bottom surface, an outer edge extending
therebetween, a sample receiving port in the top surface, a sample
vessel port in the bottom surface and a sample passageway
communicating with said sample receiving port and the sample vessel
port. The sample vessel port and sample passageway are formed for
receiving and fixing a sample vessel to the disc. Preferably the
sample vessels are held at a radially extending acute angle to the
bottom surface of the disc.
In one embodiment the sample passageway of the disc comprises a
first portion having a central axis substantively parallel to the
top and bottom surfaces of the disc and a second portion having a
central axis forming an acute angle with the top and bottom
surfaces of the disc. In this embodiment the sample vessel port and
sample passageway are formed for receiving and fixing a sample
vessel to the disc such that the sample vessel extends from the
disc at an acute angle relative to the bottom surface of the
disc.
Carousel 1 is further provided with means for closing the sample
receiving ports 6A, 6B, and 6C. The closure means can be a plug
(not shown) that fits into the sample receiving port 6 and
frictionally engages the adjacent walls of the sample passageway,
or for example, adhesive backed tape, for application to the top
surface to effectively seal the opening of the sample receiving
port to prevent contamination or evaporation of a loaded sample.
Carousel 1 is releasably engaged with a drive shaft for rotation.
Any suitable engagement means well known to those of ordinary skill
in the art can be used including frictional engagement, or the use
of screws, bolts, locking pins or clamps. In one embodiment, the
disc 2 is formed as ring having a center hole formed for receiving
a drive shaft (see 506 in FIG. 32). The end of the drive shaft is
preferably provided with structures for holding the discs 2 in
place.
The carousel 1 of the present invention can be used to deliver a
liquid sample to a sample vessel 9. In one embodiment the sample
vessel 9 is a capillary vessel containing a predetermined mixture
(for example a reagent mixture) that interacts with one or more
components of the introduced sample. In accordance with one
embodiment the predetermined mixture is added to the sample vessel
before positioning a capillary sample vessel into the sample vessel
port. Alternatively the sample vessel is prepackaged with a
predetermined mixture. The predetermined mixture may comprise
reagents that react or interact with the sample to produce a
detectable signal or to produce a derivative product.
The sample passageway 8 of the carousel 1 are optionally provided
with one or more barriers 10 that prevent a liquid sample delivered
through sample receiving ports 6A, 6B, and 6C from flowing to the
sample vessel port 7 absent a biasing force on said liquid sample.
The term "barrier" is used herein to include any structure that
impedes the free flow of a liquid sample delivered into a sample
receiving port to the sample vessel port. Examples of suitable
barriers for use in the sample passageway of the carousel of the
present invention include depressions or wells formed in the sample
passageway, sample passageway narrowing projections or annular rims
that extend from the surface of the sample passageway, porous
membranes, directional valves, or flaps that are biased in a closed
position.
The barriers are formed so that the liquid sample can overcome the
barrier by application of a biasing force on a liquid sample
present in the sample passageway and blocked by the barrier. The
application of biasing force on the sample is preferably provided
by the centripetal force generated by rotation of the carousel.
Therefore, in a carousel having a plurality of sets of sample
receiving ports 6A, 6B, and 6C in the top surface, each set with a
corresponding sample passageway and sample vessel port, samples can
be added individually to the various sample receiving ports and the
barrier will localize the liquid sample and prevent the samples
from flowing to the respective sample vessel ports. After all of
the samples are delivered into the respective receiving ports, the
carousel is rotated to deliver the samples to the respective sample
vessel port and into an attached sample vessel.
In accordance with one embodiment, each sample passageway of the
carousel communicates with a single sample vessel port and a
plurality of sample receiving ports. In accordance with that
embodiment, the sample passageway can optionally include a central
passageway that branches to communicate with multiple sample
receiving ports, or alternatively, as illustrated in FIGS.
31A&B multiple sample receiving ports 6A, 6B, and 6C are
aligned along a common axis that extends radially from the center
of the disc, each of said ports communicating through one
passageway with a sample vessel received in the sample vessel port.
The sample passageway can be provided with one or more barriers 9A
that prevent a sample added to any one of the plurality of sample
receiving ports from flowing to the sample vessel port absent a
biasing force on said liquid sample. Furthermore, each sample
passageway can be provided with multiple barriers, each of which
require a different amount of biasing force to transfer a sample
over the barrier. In accordance with this embodiment, after
delivery of the samples to the respective sample receiving ports,
individual samples can be selectively transferred to the sample
vessel port and into the sample vessel by controlling the rate of
rotation of the carousel.
For example, a first sample can be delivered into a first sample
receiving port and a second sample can be delivered to a second
sample receiving port wherein the first and second sample receiving
ports communicate with a common passageway and the first and second
sample receiving ports are each provided with a barrier that
prevents flow of the respective first and second sample. The
barriers allow the disc to be provided as part of a kit with
predetermined amounts of selected reagents, catalysts, enzymes,
oils, etc. being preloaded into the sample passageway via one or
more of the sample receiving ports.
In one embodiment the barrier for the second sample receiving port
is formed so that a greater biasing force must be applied to the
sample delivered to the second sample receiving port to pass its
associated barrier than is required for a sample delivered to the
first sample receiving port to pass its associated barrier. In
accordance with this embodiment, rotation of the carousel at a
first rate will deliver the first sample to the sample vessel port
and into the sample vessel, while the second sample is prevented
from flowing to the sample vessel port and into the sample vessel.
Rotation at a increased second rate will then enhance the
centripetal force on the second sample and result in the delivery
of the second sample to the sample vessel port and into the sample
vessel. Based on this principle, different samples can be delivered
to multiple sample vessel ports that communicate with a common
passageway and after all the samples have been loaded, the
individual samples can be delivered to the sample vessel port and
into the sample vessel one at a time or simultaneously by
controlling the rate of rotation of the carousel. In one embodiment
a first sample, comprising a fluorophore is added to a first sample
vessel port and a second sample comprising oil is delivered to the
second vessel port. The carousel is rotated to deliver the first
sample into the sample vessel followed by the oil. The oil (or
another liquid that effectively seals the first sample within the
sample vessel) functions both to decrease evaporation of the first
sample and to reduce the risk of contamination of the first
sample.
In one example a multiple sample carousel is used to handle
multiple samples simultaneously. The carousel is a disc-like
structure having a multiplicity of sample receiving ports in the
top surface of the disc structure and in fluid communication with
corresponding sample vessels attached to the disc. Samples added to
the sample receiving ports are transferred to their corresponding
sample vessels by rotation of the carousel. The carousel can also
have multiple sample receiving ports communicating with each
individual sample vessel. Reagents can be placed by the user into a
second sample receiving port that communicates with the sample
vessel for delivery to the vessel with another sample that was
added to the first sample receiving port, or alternatively,
predetermined reagents may be located in a second sample receiving
port by the manufacturer; i.e. where the carousel, the sample
vessels and the predetermined reagent are in a prepackaged form.
The reagents, with the sample, are delivered to the sample vessel
by rotation of the carousel. An oil for overlay of an aqueous
sample may be placed in a third sample receiving port that is in
liquid communication with the sample vessel (and the first and
second sample receiving ports), or the oil may be added to the
carousel by the manufacturer.
Alternatively, a sample, reagents and oil for sample overlays can
be delivered to a single sample receiving port. The carousel can be
rotated to deliver each composition or sample to the respective
vessel before a second or subsequent sample or other composition is
delivered to the sample receiving port.
One preferred sample vessel carousel of this invention includes
three sample receiving ports preferably, but optionally, arranged
in radial alignment and in fluid communication with a common sample
vessel. In accordance with this embodiment, about 1 to about 5
.mu.l of an oil overlay, preferably dyed black, is present in
prepackaged form, or delivered to the radially innermost sample
receiving port. The oil overlay comprises mineral oil and about
0.01% to about 1% organic black dye such as Waxoline.RTM. Black OBP
available from Zenica, Inc. of Wilmington, Del. About 1 to abut 9
.mu.l of a reagent master mix is present in prepackaged form or is
delivered to the radially outer most sample receiving port. The
reagent master mix comprises a portion of, or all the necessary
reaction components. A liquid sample containing the template
nucleic acid to be tested is delivered manually or robotically into
the radially intermediate sample receiving port. The disc is then
rotated at a rate that transfers the sample to the reagent
compartment, but at a rotated rate insufficient to deliver the
mixture into the sample vessel. The sample and reagent can
optionally be mixed by rapid changes in the rate of the rotation of
the disc. The disc is then rotated at a higher rate that causes the
sample and reagent mixture, but not the oil, to move into the
sample vessel. The disc is then rotated at still a higher rotation
rate to deliver the oil overlay to the sample vessel. The oil will
overlay the aqueous sample because of its lower density and will
block light passage because of its dye content. The selective
transfer of oil, reagents and sample by altering the rate of
carousel rotation is achieved by a combination of: 1) varying the
diameter of the fluid communication passageways; 2) varying the
size or shape of the physical barriers present in the fluid
communication passageways; and 3) by using the dependence of
centrifugal force on the varying distance (radius) of each sample
receiving port from the center of the disc.
The carousel of the present invention can be releasably engaged
with the drive shaft and a motor (506 and 504, respectively in FIG.
32) for rotating the carousel. Furthermore, individual carousels of
this invention can be stacked upon one another and engaged with a
drive shaft for simultaneous rotation (as shown in FIG. 32). In
accordance with another aspect of the present invention a device is
provided for monitoring the fluorescence of a sample held within a
sample vessel (see 514 in FIG. 32). The sample vessel comprises an
optically transparent material and has walls defining a volume
having at least first and second dimensions wherein the first
dimension is less than the second dimension and wherein the ratio
of volume to external surface area of the vessel is less than 1 mm.
In one embodiment the device comprises a chamber, a sample vessel
holder, a light emitting source mounted in said chamber and
positioned to illuminate the sample vessel along an axis
substantially parallel to a wall along the second dimension of the
vessel and a light detector mounted in said chamber and positioned
to measure fluorescence from the sample vessel along an axis
substantially parallel to a wall along the second dimension of the
vessel. The light emitting source and the light detector in
accordance with one embodiment are mounted on a platform that can
be raised and lowered (as indicated by arrow 518 in FIG. 32). In
this embodiment, the light emitting source and the light detector
can be positioned to measure fluorescence from the sample vessels
(along an axis substantially parallel to a wall along the second
dimension of the vessel) of multiple carousels when individual
carousels are stacked upon one another and engaged with a drive
shaft for simultaneous rotation (see FIG. 32).
In one embodiment the sample vessel holder comprises a carousel for
holding a plurality of capillary tubes, and the carousel is
rotatably mounted in said chamber. The light emitting source is
positioned to illuminate the capillary tube through the bottom of
the tube and the light detector is mounted to detect fluorescence
through the bottom of the capillary tube. In addition the device is
provided with a stepper motor for rotating said carousel and means
for coupling the carousel to the motor.
In accordance with one preferred embodiment, the chamber of the
fluorescence detecting device is further provided with a heater
(see 510 in FIG. 32) and a fan (see 508 in FIG. 32) mounted in said
device and in air flow communication with the chamber, and a
controller therefor, for rapidly cycling the temperature of the
chamber using, at least initially, predetermined time and
temperature parameters. The device is capable of conducting
polymerase chain reactions in the sample vessels held by the
carousel. In particular the device allows for an improved method of
conducting PCR reactions because the progress of the reaction can
be monitored in real time, and thus allow the adjustment of
temperature and time parameters during the course of the reaction
to optimize the yield and purity of the amplified target nucleic
acid sequence.
Further, in accordance with the present invention, there is
provided an improved method of amplifying a targeted nucleic acid
sequence of a biological sample comprising the steps of adding to
the biological sample an effective amount of two nucleic acid
probes that hybridize to adjacent regions of the target sequence,
one of said probes being labeled with an acceptor fluorophore and
the other probe labeled with a donor fluorophore of a fluorescence
energy transfer pair such that upon hybridization of the two probes
with the target sequence, the donor and acceptor fluorophores are
within 0 to 15 nucleotides, and more preferably within 1 5
nucleotides of one another, amplifying the targeted nucleic acid
sequence using polymerase chain reaction, illuminating the
biological sample with a selected wavelength of light that is
absorbed by said donor fluorophore during the polymerase chain
reaction monitoring fluorescent emissions from said sample, and
adjusting the temperature and time parameters in accordance with
the data generated from the monitoring step.
Thus in accordance with the present invention an improved device is
provided for conducting PCR reactions. The device comprises a
chamber, a heater and a fan mounted in said device and in air flow
communication with the chamber, carousel for holding a plurality of
sample vessels. The sample vessels used in conjunction with this
device comprise an optically transparent material and walls
defining a volume having at least first and second dimensions
wherein the first dimension is less than the second dimension and
wherein the ratio of volume to external surface area of the vessel
is less than 1 mm. The carousel is rotatably mounted in the
chamber. The device further comprises a light emitting source
mounted in said chamber and positioned to illuminate at least one
of the sample vessels along an axis substantially parallel to a
wall along the second dimension of the vessel and a light detector
ounted in said chamber and positioned to measure fluorescence from
at least one of the sample vessels along an axis substantially
parallel to a wall along the second dimension of the vessel.
Furthermore, the device can be equipped with a stepper motor for
rotating the carousel to position the respective capillary tubes
held by said carousel for illumination and fluorescence detection.
Monitoring the PCR reaction in real time and determining at least
one reaction parameter in accordance with the detected fluorescence
allows for the adjustment of the reaction conditions to optimize
the reaction. In a preferred embodiment one or more values
representative of the status of the reaction are displayed in a
visually perceptible manner in real time.
The carousel of the present invention can also be used for
delivering a liquid sample to a capillary sample vessel. The
carousel comprises a disc having a top surface, a bottom surface
and an outer edge extending therebetween, a sample receiving port
in the top surface, a sample vessel port in the outer edge and a
sample passageway communicating with the sample receiving port and
the sample vessel port. The sample vessel port and the sample
passageway are formed for receiving and fixing a sample vessel to
the disc. The method of using the carousel to deliver a liquid
sample to a capillary sample vessel comprises the steps of
selecting a carousel for receiving a liquid sample and holding a
sample vessel, delivering the liquid sample into the sample
receiving port of the carousel, positioning a capillary sample
vessel into the sample vessel port, and rotating the carousel to
deliver the sample into the capillary sample vessel.
The present invention is also directed to a system for detecting
the presence of a target nucleic acid sequence in a sample. The
system comprises a pair of oligonucleotide probes that hybridize to
adjacent regions of the target nucleic acid sequence, wherein one
of said probes is labeled with an acceptor fluorophore and the
other probe labeled with a donor fluorophore of a fluorescence
energy transfer pair. Preferably, the donor fluorophore emission
and the acceptor fluorophore absorption overlap less than 25%, the
acceptor fluorophore has a peak extinction coefficient greater than
100,000 M.sup.-1cm.sup.-1 and upon hybridization of the two probes
with the target sequence, the donor and acceptor fluorophores are
within 15 nucleotides of one another. In another embodiment the
donor fluorophore emission and the acceptor fluorophore absorption
overlap less than 20% and upon hybridization of the two probes with
the target sequence, the donor and acceptor fluorophores are within
5 nucleotides of one another, and more preferably within 3
nucleotides of one another.
In view of the foregoing, it will be appreciated that the present
invention provides an apparatus for accurately submitting
biological samples to thermal cycling and for quickly and
accurately varying the temperature of biological samples, most
advantageously adjusting one or more reaction parameters in real
time or according to a predetermined temperature versus time
profile. The present invention also provides an apparatus suitable
for subjecting a number of different biological samples to rapid
thermal cycling and also provides a thermal cycling apparatus
having a thermal transfer medium of low thermal mass which can
effectively subject samples to a large temperature gradient over a
very short period of time.
Moreover, the present invention provides an apparatus which can
subject a biological sample to rapid thermal cycling using air as a
thermal transfer medium and which provides a system and method for
performing PCR rapidly and for simultaneously monitoring the
reaction. Still further, the present invention also provides a
system and method for performing PCR rapidly and also continuously
monitoring the reaction while it is ongoing and for adjusting the
reaction parameters while the reaction is ongoing.
Information regarding an On-line DNA Analysis System with Rapid
Thermal Cycling is found in U.S. patent application Ser. No.
08/381,703 filed Jan. 31, 1995 which is now incorporated herein in
its entirety.
The present invention may be embodied in other specific forms
without departing from its spirit or essential characteristics. The
described embodiments are to be considered in all respects only as
illustrative and not restrictive. The scope of the invention is,
therefore, indicated by the appended claims rather than by the
foregoing description. All changes which come within the meaning
and range of equivalency of the claims are to be embraced within
their scope.
SEQUENCE LISTINGS
1
6 20nucleic acidsingle-strandedlinear1CGTGGTGGAC TTCTCTCAAT
2020nucleic acidsingle-strandedlinear2AGAAGATGAG GCATAGCAGC
2035nucleic acidsingle-strandedlinear3CAAACAGACA CCATGGTGCA
CCTGACTCCT GAGGA 3530nucleic acidsingle-strandedlinear4AAGTCTGCCG
TTACTGCCCT GTGGGGCAAG 3022nucleic
acidsingle-strandedlinear5GGTTGGCCAA TCTACTCCCA GG 2220nucleic
acidsingle-strandedlinear6GCTCACTCAG TGTGGCAAAG 20
* * * * *