U.S. patent number 6,528,313 [Application Number 08/301,037] was granted by the patent office on 2003-03-04 for procedure for specific replacement of a copy of a gene present in the recipient genome by the integration of a gene different from that where the integration is made.
This patent grant is currently assigned to Institut Pasteur. Invention is credited to Philippe Brulet, Herve Le Mouellic.
United States Patent |
6,528,313 |
Le Mouellic , et
al. |
March 4, 2003 |
**Please see images for:
( Certificate of Correction ) ** |
Procedure for specific replacement of a copy of a gene present in
the recipient genome by the integration of a gene different from
that where the integration is made
Abstract
The present invention relates to a process for targeted
replacement of at least a part of an endogenous gene by at least a
part of a foreign gene or targeted insertion of at least a part of
a foreign gene at a targeted site in an endogenous gene in a cell
by homologous recombination. This process includes (A) providing a
vector which contains (1) at least a part of the foreign gene which
is heterologous with respect to the endogenous gene; (2) a first
flanking DNA sequence homologous to a first genomic sequence
situated on one side of the part of the endogenous gene to be
replaced or the targeted site; and (3) a second flanking DNA
sequence homologous to a second genomic sequence situated on the
other side of the part of the endogenous gene to be replaced or the
targeted site, the foreign gene being located between the first and
second flanking DNA sequences and is complementary to the part of
the endogenous gene to be replaced; (B) transfecting a cell with
the vector; (C) and selecting a transfected cell that contains the
foreign gene at the targeted site or where the part of the
endogenous gene is to be replaced.
Inventors: |
Le Mouellic; Herve (Paris,
FR), Brulet; Philippe (Maurepas, FR) |
Assignee: |
Institut Pasteur (Paris,
FR)
|
Family
ID: |
9379875 |
Appl.
No.: |
08/301,037 |
Filed: |
September 6, 1994 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
048056 |
Apr 19, 1993 |
|
|
|
|
598679 |
|
|
|
|
|
Foreign Application Priority Data
|
|
|
|
|
Mar 20, 1989 [FR] |
|
|
89 03630 |
|
Current U.S.
Class: |
435/461; 435/463;
536/23.5; 536/23.7; 536/23.72 |
Current CPC
Class: |
A01K
67/0275 (20130101); C07K 14/47 (20130101); C12N
15/85 (20130101); C12N 15/8509 (20130101); C12N
15/907 (20130101); A01K 2217/05 (20130101); A01K
2227/105 (20130101); A61K 38/00 (20130101); A61K
48/00 (20130101); C12N 2800/108 (20130101); C12N
2800/30 (20130101); C12N 2830/00 (20130101); C12N
2830/85 (20130101) |
Current International
Class: |
A01K
67/027 (20060101); C07K 14/47 (20060101); C07K
14/435 (20060101); C12N 15/90 (20060101); C12N
15/87 (20060101); C12N 15/85 (20060101); A61K
38/00 (20060101); A61K 48/00 (20060101); C12N
015/64 (); C12N 005/16 (); C12N 015/12 (); C12N
015/31 () |
Field of
Search: |
;435/172.3,69.1,320.1,461,463
;536/23.1,23.2,23.4,24.1,23.5,23.7,23.72 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
A 0074808 |
|
Mar 1983 |
|
EP |
|
A 0169672 |
|
Jan 1986 |
|
EP |
|
0 247 494 |
|
Dec 1987 |
|
EP |
|
A 0279582 |
|
Aug 1988 |
|
EP |
|
A 0289121 |
|
Nov 1988 |
|
EP |
|
0 452 484 |
|
Jun 1995 |
|
EP |
|
0 747 485 |
|
Dec 1996 |
|
EP |
|
WO 91/06666 |
|
May 1991 |
|
WO |
|
WO 91/06667 |
|
May 1991 |
|
WO |
|
Other References
Smithies et al. Insertion of DNA sequences into the human
chromosomal beta-globin locus by homologus recombination. Nature
vol. 317 230-234, 1985.* .
Capecchi The new mouse genetics: Altering the genome by gene
targeting. Trends in Genetics vol. 5 70-76, 1989.* .
Joyner et al. Production of a mutation in mouse En-2 gene by
homologous recombination in embryonic stem cells. Nature vol. 338
153-156, 1989.* .
Riabowol et al. The catalytic subunit of cAMP-dependent protein
kinase induces expression of genes containing cANP-responsive
enhancer elements. nature vol. 336 pp. 83-86, 1988* .
Kim et al. Recombinant fragment assay for gene targetting based on
the polymerase chain reaction. Nucleic Acids Research vol. 16 pp.
8887-8903, 1988.* .
Jasin et al. Homologous integration in mammalian cells without
target gene selection. Genes and Development vol. 2 pp. 1353-1363,
1988.* .
Thomas et al. Site-directed mutagenesis by gene targeting in mouse
embryo-derived stem cells. Cell vol. 51 pp. 503-512, 1987.* .
Nagpal et al, Expression of the RAD1 and RAD3 genes of
Saccharomyces cerevisiae is not affected by DNA damage or during
the cell division cycle, 1985, Mol Gen Genet, vol. 199, pp. 59-63.*
.
Letsou et al. Effect of the Molecular Nature of Mutation on the
Efficiency of Intrachromosomal Gene Conversation in Mouse Cells,
Dec. 1987, Genetics, pp. 759-769.* .
Thompson et al., Cell vol. 56, Jan. 1989, pp. 313-321.* .
Breier et al., EMBO J. vol. 7, 1988, pp. 1329-1336.* .
Frohman et al., Cell vol. 56, Jan. 1989, pp. 145-147.* .
Wrischnik et al., NAR vol. 15, 1987, pp. 529-542.* .
An et al. (1982) Molecular & Cellular Biology, vol. 2, pp.
1628-1632.* .
Joyner et al. Nature 338 153-156 (1989) Production of a mutation in
mouse En-2 gene by homologous recombination.* .
Mansour et al., "Introduction of a lacZ reporter gene into the
mouse int-2 locus by homologous recombination," Proc Natl. Acad.
Sci. USA, vol. 87, pp. 7688-7692 (Oct. 1990). .
Connors et al. "DHFR Coamplification of t-PA in DHFR.sup.+ Bovine
Endothelial Cells: In Vitro Characterization of the Purified Serine
Protease", DNA, vol. 7, No. 9, pp. 651-661, (1988). .
Kaufman et al. "Coamplification and Coexpression of Human
Tissue-Type Plasminogen Activator and Murine Dihydrofolate
Reductase Sequences in Chinese Hamster Ovary Cells", Molecular and
Cellular Biology, vol. 5, No. 7, pp. 1750-1759, (1985). .
Michel et al. "Expression of Amplified Hepatitis B Virus Surface
Antigen Genes in Chinese Hamster Ovary Cells", Bio/Technology, vol.
3, pp. 561-566 (Jun. 1985). .
Bosselman et al. "Germline Transmission of Exogenous Genes in the
Chicken", Science, vol. 24-3, pp. 533-535, (Jan. 27, 1989). .
Bradley et al. "Modifying The Mouse: Design and Desire",
Biotechnology, vol. 10, pp. 534-539 (1990). .
Breitman et al. "Genetic Ablation: Targeted Expression of a Toxin
Gene Causes Microphthalmia in Transgenic Mice", Science, vol. 238,
pp. 1563-1565, (Dec. 11, 1987). .
Capecchi, Mario R. "The New Mouse Genetics: Altering the Genome by
Gene Targeting" TIG, vol. 5, No. 3, pp. 70-76, (Mar. 1989). .
Guevara-Olvera et al. "Cloning and Disruption of the Ornithine
Decarboxylase Gene of Ustilago maydis: Evidence for a Role of
Polyamines in its Dimorphic Transition", Microbiology, vol. 143,
pp. 2237-2245, (1997). .
Hallmann et al. "Gene Replacement by Homologous Recombination in
the Multicellular Green Alga Volvox carteri", Proc. Natl. Acad.
Sci. USA, vol. 94, pp. 7469-7474, (Jul. 1997). .
Hippenmeyer et al. "Transfer and Expression of the Bacterial NP,-II
Gene in Chick Embryos Using a Schmidt-Ruppin Retrovirus Vector",
Nucleic Acids Research, vol. 16, No. 15, pp. 7619-7632, (1099).
.
Knight et al. "Transgenic Rabbits with Lymphocytic Leukemia Induced
by the C-myc Oncogene Fused with the Immunoglobulin Heavy Chain
Enhancer", Proc. Natl. Acad. Sci. USA, vol. 85, pp. 3130-3134, (May
1988). .
Kothary et al. "A Transgene Containing lacZ Inserted Into the
dystonia Locus is Expressed in Neural Tube", Nature, vol. 335, pp.
435-437, (Sep. 29, 1988). .
Montrose-Rafizadeh et al. "Gene Targeting of a CFTR Allele in HT29
Human Epithelial Cells", Journal of Cellular Physiology, vol. 170,
pp. 299-308 (1997). .
Rolig et al. "Survival, Mutagenesis, and Host Cell Reactivation in
a Chinese Hamster Ovary Cell ERCC1 Knock-out Mutant", Mutagenesis,
vol. 12, No. 4, pp. 277-283, (1997). .
Shalev et al. "The Maize Transposable Element Ac Induces
Recombination Between the Donor Site and an Homologous Ectopic
Sequence", Genetics, vol. 146, pp. 1143-1151, (Jul. 1997). .
Stuart et al. "Replication, Integration and Stable Germ-line
Transmission of Foreign Sequences Injected into Early Zebrafish
Embryos", Development, vol. 130, pp. 403-411, (1988). .
Ware et al. "Development of Embryonic Stem Cell Lines From Farm
Animals", Society for the Study of Reproduction, vol.38, p. 129
(Aug. 1-4, 1988). .
Johnson et al.; Targeting of Nonexpressed Genes in Embryonic Stem
Cells Via Homologous Recombination; Science, vol. 245, pp.
1234-1236, Sep. 1989. .
"Cell Lineage Ablation in Transgenic Mice by Cell-Specific
Expression of a Toxin Gene" by Richard D. Palmiter, et al., Cell,
vol. 50, pp. 435-443 (Jul. 31, 1987). .
"Homologous recombination at c-fvn locus of mouse embryonic stem
cells with use of diphtheria toxin A-fragment gene in negative
selection" by Takeshi Yagi et al., Proc. Natl. Acad. Sci. USA, vol.
87, pp. 9918-9922 (Dec., 1990). .
"Targeted replacement of the homeobox gene Hox-3.1 by the
Escherichia coli 1acZ in mouse chimeric embryos" by Herve Le
Mouellic et al., Proc. Natl. Acad. Sci. USA, vol. 87, pp. 4712-4716
(Jun. 1990). .
"Disruption of the proto-oncogene int-2 in mouse embryo-derived
stem cells: a general strategy for targeting mutations to
non-selectable genes" by Suzanne L. Mansour, et al., Nature, vol.
336, pp. 348-352 (Nov., 1988). .
"Targeted mutation of the Hprt gene in mouse embryonic stem cells"
by T. Doetschman et al., Proc. Natl. Acad. Sci. USA, vol. 85, pp.
8583-8587 (Nov., 1988). .
"Targeting of non-expressed genes in embryonic stem cells via
homologous recombination" by R. S. Johnson et al., Chemical
Abstracts, vol. 111, No. 21, 188649f. .
"Production of chimaeric mice containing embryonic stem (ES) cells
carrying a homoeobox Hox 1.1 allele mutated by homologous
recombination" by Zimmer et al., Nature, vol. 338, pp. 150-153
(Mar. 9, 1989)..
|
Primary Examiner: Brusca; John S.
Attorney, Agent or Firm: Finnegan, Henderson, Farabow,
Garrett & Dunner, L.L.P.
Parent Case Text
This application is a continuation of application Ser. No.
08/048,056, filed Apr. 19, 1993, now abandoned, which is a
continuation of application Ser. No. 07/598,679, filed Dec. 19,
1990, now abandoned, which is the National Stage of International
Application No. PCT/FR90/00185, filed Mar. 19, 1990, which is based
on French priority application No. FR 89/03630, filed on Mar. 20,
1989.
Claims
What is claimed is:
1. An in vitro process for providing a recombinant, heterologous
gene in a genome of a mammalian cell, wherein the process
comprises: (A) providing a mammalian cell having a recipient gone
in its genome, wherein said recipient gene comprises complementing
DNA comprising a first nucleotide sequence and a second nucleotide
sequence downstream of said first nucleotide sequence; (B)
transfecting said mammalian cell in vitro with a DNA comprising:
(1) a third nucleotide sequence homologous to said first nucleotide
sequence; (2) a fourth nucleotide sequence homologous to said
second nucleotide sequence; and (3) a DNA sequence heterologous
with respect to DNA in said recipient gene, wherein said
heterologous DNA sequence is between said third and said fourth
nucleotide sequences and said heterologous DNA sequence comprises a
first insertion DNA sequence and a second insertion DNA sequence,
wherein said first insertion DNA sequence comprises a first coding
sequence that encodes a first product that does not confer
resistance to a selection agent involved in the selection of
transformants, and said second insertion DNA sequence comprises a
second coding sequence that encodes a second product that confers
resistance to a selection agent involved in the selection of
transformants, and a promoter allowing the expression of said
second product in said mammalian cell; and (C) selecting a
transfected cell in which said heterologous DNA sequence has been
inserted between said first and said second nucleotide sequences in
said recipient gene by homologous recombination with said third and
said fourth nucleotide sequences to thereby provide a mammalian
cell containing in its genome the recombinant, heterologous gene,
and in addition, the second insertion DNA sequence encoding the
selective agent.
2. The in vitro process as claimed in claim 1, wherein insertion of
said heterologous DNA in said recipient gene is accompanied by
replacement of recipient gene DNA.
3. The in vitro process as claimed in claim 1, wherein said
recipient gene contains a promoter, which is inactivated following
insertion of said heterologous DNA sequence into said recipient
gene.
4. The in vitro process as claimed in claim 1, wherein said
recipient gene has a regulatory sequence and said coding sequence
of said first insertion DNA sequence is under the control of said
regulatory sequence following insertion of said heterologous DNA
sequence into said recipient gene.
5. The in vitro process as claimed in claim 1, wherein each of said
third and said fourth nucleotide sequences has a length greater
than 150 base pairs and shorter than the length of said recipient
gene.
6. The in vitro process as claimed in claim 1, wherein said
recipient gene is present in said mammalian cell in at least two
copies and said heterologous DNA sequence is inserted into only one
copy of said recipient gene.
7. The in vitro process as claimed in claim 1, wherein said first
coding sequence encodes an interferon, an interleukin, a
.beta.-3-adrenergic receptor, a retinoic acid receptor, an HIV
receptor, or lac Z.
8. The in vitro process as claimed in claim 1, wherein said first
coding sequence encodes lac Z.
9. The in vitro process as claimed in claim 1, wherein said
mammalian cell is a mouse embryonic stem (E. S.) cell.
10. The in vitro process as claimed in claim 1, wherein said
transfection is by electroporation.
11. The in vitro process as claimed in claim 1, which further
comprises amplifing by polymerase chain reaction the heterologous
DNA sequence at the locus at which the insertion is made.
12. The in vitro process as claimed in claim 1, wherein the
selective agent is neoR.
13. The in vitro process as claimed in claim 1, wherein said
recipient gene codes for a receptor for an infectious agent, said
recipient gene is present in said mammalian cell in at least two
copies, and said heterologous DNA sequence is inserted into only
one copy of said recipient gene.
14. Mammalian cells transformed according to the in vitro process
of claim 1.
15. Mammalian cells according to claim 14, wherein said mammalian
cells comprise mouse embryonic stem (E. S.) cells.
16. The in vitro process as claimed in claim 1, wherein said
recipient gene is not expressed in said mammalian cell and
expression of said recipient gene is made possible following
insertion of said heterologous DNA sequence in said recipient
gene.
17. Mammalian cells transformed according to the in vitro process
of claim 16.
18. Mammalian cells according to claim 17, wherein said mammalian
cells comprise mouse embryonic stem (E. S.) cells.
19. The in vitro process as claimed in claim 1, wherein expression
of said recipient gene is modified following insertion of said
heterologous DNA sequence.
20. The in vitro process as claimed in claim 1, wherein said second
insertion DNA sequence lacks a polyadenylation sequence and is
operably linked at the 3' end to a 5' region on an intron
containing a sequence that causes the selective degradation of
transcripts of said heterologous DNA sequence.
21. The in vitro process as claimed in claim 20, wherein the
process further comprises achieving a homologous recombination
frequency ratio of at least 1 homologous recombination event per
900 random insertion events.
22. The in vitro process as claimed in claim 20, wherein the
process further comprises achieving a homologous recombination
frequency ratio of at least 1 homologous recombination event per 40
random insertion events.
23. The in vitro process as claimed in claim 1, wherein the process
further comprises achieving a homologous recombination frequency
ratio of at least 1 homologous recombination event per 900 random
insertion events.
24. The in vitro process as claimed in claim 1, wherein the process
further comprises achieving a homologous recombination frequency
ratio of at least 1 homologous recombination event per 40 random
insertion events.
25. A recombinant heterologous gene made according to the in
Description
BACKGROUND OF THE INVENTION
The invention relates to a procedure for specific replacement of a
copy of a gene present in the genome of a recipient eucaryotic
organism by the integration of a gene different from the
inactivated gene. Preferably, the recipient gene will be present in
at least 2 copies in the transfected host cell. The recipient gene
is defined as being the gene where the insertion of the different
gene is made.
More particularly, the invention relates to the production of
transgenic animals in which the foreign gene has been introduced in
a targetted manner in order to make possible both the maintainance
of the normal genetic functions of the animal and the expression of
the foreign gene under the control of endogenous promoters.
By "different or foreign gene" is meant any nucleotide sequence
corresponding to the totality or a part of a "foreign or different"
gene from the recipient gene such as is normally found in the
genome (RNA or DNA), or it also corresponds to an artificially
modified sequence of the normal gene or also to a fragment of this
sequence.
The invention also relates to the process for the production of
these transgenic animals.
In the production of transgenic animals, the conventional methods
used for the introduction of heterologous DNA sequences into the
germinal cell line do not make it possible to control the site of
integration of the foreign gene into the genome nor the number of
copies thus introduced. The integration of the foreign gene occurs
at random and, usually, several copies of the gene are integrated
at the same time, sometimes in the form of a head-to-tail tandem,
the site of integration and the number of copies integrated varying
from one transgenic animal to another.
Thus, it may happen that endogenous cellular genes, situated at the
point of insertion, are thus inactivated without this being easily
detectable on account of the many random insertions. If the product
of these genes is important for the development of the animal, the
latter will be seriously perturbed. Moreover, the random insertion
of the foreign gene may occur at a site which is not suitable for
the expression of the gene. In addition, the fact that there may be
variation in the site and in the number of insertions from animal
to animal makes the interpretation of the studies of expression
extremely difficult.
A major problem encountered in the production of transgenic animals
is the obtaining of the expression of the foreign gene. Generally
speaking, two types of experiment have been made in mice.
The genes introduced into the germ line are: either "complete"
genes, comprising coding sequences flanked by their own regulatory
sequences; or composite genes, composed of the coding sequence of a
gene fused to a promoter sequence of another gene, the two
fragments even sometimes belonging to two different animal
species.
Thus, it has been possible to confirm that the specificity of the
expression of the genes in this or that tissue is determined by
their regulatory sequence(s).
The choice of the suitable promoter for the expression of the
foreign gene in the transgenic animal is thus of primordial
importance.
Furthermore, the directed mutagenesis of mouse genes in embryonic
stem cells has recently been carried out by resorting to a
technique of "gene targetting" (Thomas et al., 1987; Thompson et
al., 1989).
In the first case, the mouse HPRT gene was mutated by insertion and
replacement and, in the second case, a mutated HPRT gene was
corrected. Thompson et al. have extended their experiments to the
production of chimeric mice and have observed the passage of the
genetic modification in the germ cell line.
In each of the documents cited, the precise site of integration was
targetted by homologous recombination between, on the one hand,
exogenous sequences bearing the mutation or correction included in
a vector under the control of an exogenous promoter and, on the
other hand, their genomic homologue. This being so, it should be
noted that the earlier authors carried out their experiments on a
specific gene (HPRT), the activation of which by mutation is
accompanied by a detectable phenotype. The targetted mutation
described by Thomas et al. had the effect of inactivating the HPRT
gene and, consequently, of causing the normally detectable
phenotype associated with the HPRT to disappear. The selection gene
Neo.sup.R, under the control of a promoter TK, was thus
incorporated into the DNA to be inserted in order to make possible
the selection of the transformants. It is to be noted that the
experiments described in the prior art implied a selection by means
of the recipient gene (e.g. HPRT) or by means of the inserted gene
(e.g. Neo.sup.R). The site of the insertion and/or the type of gene
inserted is thus limited to genes conferring a selectable
character.
Furthermore, in the prior art, the exogenous sequences on the
vector thus serve both to target the integration site and to
introduce the modification. Subsequent to homologous recombination,
the modified gene is always found in its normal genetic
environment.
Let it be recalled that a problem which arises in the course of the
production of transgenic animals is the danger of inactivating an
endogenous cell gene which is located at the point of insertion of
the foreign gene.
Depending on the function of the product of the inactivated gene,
such an inactivation may lead to extensive morphological or
physiological disorders in the transgenic animal, or may even
prevent its survival.
On the other hand, the inactivation of a gene might be considered
to be advantageous if the gene in question codes for a receptor of
a virus or other infectious agent.
SUMMARY OF THE INVENTION
The inventors have studied the possibility of avoiding the
disadvantages described above and associated, in some cases, with
the possible inactivation of one or several endogenous cell genes
with an important function in the course of the production of
transgenic animals.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the plasmid pGN.
FIGS. 2a and b show the molecules PGMA and PGMD, respectively,
constructed from the plasmid pGN with respect to the Hox-3.1 gene.
These plasmids are mutant plasmids. The two parts of the coding
sequence of the Hox-3.1 gene are represented on chromosome 15 by
the black box "homeo." The corresponding sequences of the Hox-3.1
were cloned in the plasmid pGN. (A: polyadenylation signal;
Enh/Pro: enhancer/promoter). 07 and 08 illustrate the two
oligonucleotides used in the PCR.
FIGS. 3-6 show the plasmids used in the Construction of the
pGN.
FIG. 7 illustrates the detection of homologous recombination with
the Polymerase Chain Reaction (P.C.R.) technique on transfected
E.S. cells.
FIGS. 8a and b show Southern analyses of individual positive clones
(L5 and F2) and E.S. cells (C.C.E.). FIG. 8c depicts a restriction
map of E.S. cells containing the mutated Hox-3.1 gene ("rec") in
comparison with that containing the wild-type locus ("wt").
FIGS. 9a, 9b, and 9c depict chimeric embryos at 9.5 and 10.5 days
p.c.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The object of the invention is a process. for specific replacement,
in particular by targetting of a DNA, called insertion DNA,
constituted by a part of a gene capable of being made functional,
or the function of which may be made more effective, when it is
recombined with a complementing DNA in order thus to supply a
complete recombinant gene in the genome of a eucaryotic cell,
characterized in that: the site of insertion is located in a
selected gene, called the recipient gene, containing the
complementing DNA and in that eucaryotic cells are transfected with
a vector containing an insert itself comprising the insertion DNA
and two so-called "flanking" sequences on either side of the DNA of
insertion, respectively homologous to two genomic sequences which
are adjacent to the desired insertion site in the recipient gene,
the insertion DNA being heterologous with respect to the recipient
gene, and the flanking sequences being selected from those which
constitute the above-mentioned complementing DNA and which allow,
as a result of homologous recombination with corresponding
sequences in the recipient gene, the reconstitution of a complete
recombinant gene in the genome of the eucaryotic cell.
The invention also relates to a procedure for the production of
transgenic animals, characterized in that E.S. cells are
transfected under the conditions described above and selected for
the homologous recombination event, namely the correct integration
of the foreign gene, the transfected cells are injected into
embryos at a stage at which they are capable of integrating the
transfected cells (for example at the blastocyte stage), the latter
are then reimplanted in a surrogate mother and the chimeric
individuals obtained at the term of pregnancy are then mated. If
the E.S. cells have colonized the germ line of the chimeric animal,
transgenic animals heterozygous for the replaced gene will be
obtained by mating (F1) in the progeny.
It is also possible to insert the gene, borne by the vector of the
invention, into the egg shortly after (i.e. less than 24 hours)
fertilization. In this manner, the insertion is effected while the
egg is in the unicellular state.
The invention also relates to a plasmid capable of effecting the
targetted insertion of a recombinant gene, called inserted gene, in
the genome of a eucaryotic cell, characterized in that it contains
an insert itself comprising the insertion gene and two so-called
"flanking" sequences on either side of the insertion gene
respectively homologous to the two genomic sequences which are
adjacent to the desired insertion site in the recipient gene.
The invention also relates to transgenic animals in which at least
one endogenous gene has been inactivated by the insertion of a gene
which is different from the inactivated gene, the inserted gene
being inserted in a position which makes possible the expression of
this gene under the control of the regulatory sequences of the
inactivated endogenous gene.
Hence, as a consequence of the phenomenon of homologous
recombination, the process of the invention makes it possible to
insert in a targetted manner foreign genes, in particular coding
sequences lacking the promoter which is normally associated with
them, into the genome of a eucaryotic organism at a site which
allows their expression under the control of the endogenous
promoter of the gene into which the insertion is made, and
consequently, enables the targetted endogenous gene to be
inactivated.
According to a preferred embodiment of the invention, the targetted
recipient gene is a gene which is present in the genome in at least
two copies. The utilization of the technique of electro-poration
(Ref. 11) ensures the introduction of one copy only of the foreign
gene.
According to this variant of the invention, the targetted insertion
of the gene of interest (i.e. the so-called insertion gene) has the
effect of inactivating only that copy of the cellular endogenous
gene at which the insertion is made and of leaving intact and
functional the other copy or copies of this gene.
In this manner, the genetic functioning of the transgenic animal is
not or is only slightly perturbed by the introduction of the
foreign gene, even if the insertion inactivates a single copy of a
recipient gene essential for the development of the animal. Thus
either its development would be not effected by the insertion of
the foreign gene, or the minor perturbations possible in the case
of the inactivation of a critical gene would probably not be lethal
for the animal. The effects of the insertion of the foreign gene in
the homozygous state could be of any kind and would be observed in
the 2nd generation (F2) after cross breedings of heterozygous
individuals (F1) among themselves.
If, on the contrary, the inactivation of all of the copies of a
gene is desired, for example, in the case in which the gene codes
for a receptor of an infectious agent, multiple copies of the
foreign gene are introduced. The control of the quantity introduced
may be ensured by having resort to known methods.
The targetted insertion of the foreign gene thus makes possible its
introduction at a site at which its expression is under the control
of the regulatory sequences of the endogenous gene where the
insertion is made.
The process of the invention thus makes it possible to insert the
foreign gene behind an endogenous promoter which has the desired
functions (for example, specificity of expression in this or that
tissue), and to do so, if necessary, without inactivating the other
copies of the recipient gene.
According to a particularly preferred embodiment of the invention,
the insertion DNA contains between the two flanking sequences,
firstly a DNA sequence designed to be recombined with the
complementing DNA in the recipient gene in order to provide a
recombinant gene and, secondly, a sequence coding for a selective
agent making possible the selection of the transformants and a
promoter allowing the expression of the selective agent, the
recipient gene and the recombinant gene coding for expression
products which do not confer a selectable phenotype.
In this manner, the selection of the transformants is entirely
independent of the nature of the recipient gene and of the inserted
gene, in contrast to the procedures described hitherto in which the
inserted gene or the recipient gene had, of necessity, to code for
a product of expression making possible the selection of the
transformants. The system developed by the inventors allows total
flexibility with respect to the nature of the recipient gene and
the inserted gene or the gene formed by homologous recombination.
In a surprising manner, the inventors have observed that the
insertion of sequences of considerable size (for example about 7.5
kb) does not affect the frequency of homologous recombination.
The effect that the insertion of the DNA sequence may have
according to this aspect of the invention includes, for example,
depending on the type of sequence inserted, the replacement of a
coding sequence, the replacement of a regulatory sequence, the
inactivation or reactivation of a gene by mutation or the
improvement of the level of expression of a gene. It is possible,
according to the invention, to replace a coding sequence or a part
of a coding sequence by a heterologous sequence which commences at
the initiation codon of the replaced gene in order that the
expression of the inserted gene entirely replaces the expression of
the replaced gene. This avoids the formation of fusion proteins
which might be undesirable in a transgenic animal.
According to this embodiment of the invention, the inserted DNA may
contain between the flanking sequences a heterologous coding
sequence lacking a promoter, the coding sequence being other than a
gene coding for a selection agent. The insertion DNA may contain in
addition, downstream from the coding sequence and still between the
flanking sequences, a gene coding for a selection agent, associated
with a promoter making possible its expression in the target
cell.
In this manner, the heterologous coding sequence may be inserted
behind an endogenous promoter which has the desired properties, for
example a certain specificity of expression, or range of
transcription etc., the selectibility of the transformed cells
being entirely independent of the expression of the heterologous
coding sequence. This type of construction makes it possible, for
example, to select the transformants even though the gene replaced
by the heterologous coding sequence is not normally expressed in
the target cells. This is particularly important in the production
of transgenic animals from embryonic stem cells since a
considerable proportion of the genes remain inactive until a more
advanced stage of development of the animal. The Hox-3.1 gene is an
example of this type of gene. Furthermore, if the coding sequence
codes for an easily detectable protein, for example the .beta.-Gal,
the development of the transcription pattern of the replaced
endogenous gene may be monitored. The vector pGN is an example of
this type of construction.
In accordance with another embodiment of the invention, the
inserted DNA may contain a foreign regulatory sequence. The
insertion site and, consequently, the flanking sequences are
selected as a function of the desired purpose, namely either the
insertion of the foreign regulatory sequence in order to give a
"double promoter" effect with the endogenous regulatory sequence,
or the replacement of an endogenous promoter by the foreign
promoter. The coding sequence which is situated under the control
of the regulatory sequence may be endogenous.
Another possibility would be the targetted insertion of a foreign
DNA which contains both a regulatory sequence and a coding
sequence. It is possible that the regulatory sequence is that which
is naturally associated with the coding sequence.
The procedure of the invention makes use of a vector containing two
"flanking" sequences, one on either side of the foreign gene. These
flanking sequence have at least 150 base pairs and are preferably
shorter than the length of the recipient gene. It is essential that
the two flanking sequences be homologous with the two genomic
sequences which are adjacent to the desired insertion site. The
flanking sequence of the vector which is situated upstream from the
foreign gene to be introduced is normally homologous to the genomic
sequence which is situated on the 5' side of the insertion site.
Similarly, the flanking sequence of the vector which is situated
downstream from the foreign gene is normally homologous to the
genomic sequence which is situated on the 3' side of the insertion
site.
It is possible to introduce "intercalating" sequences between one
or other of the flanking sequences and the foreign gene, for
example sequences making possible the selection of the
transformants, markers, sequences making possible the cloning of
the vector, etc . . .
The position of these intercalating sequences with respect to the
foreign gene must, however, be selected so as not to prevent the
expression of the foreign gene, in particular of the foreign coding
DNA sequence under the control of the endogenous promoter or,
inversely, the endogenous DNA coding sequence under the control of
foreign regulatory elements supplied by the inserted sequence.
In spite of the presence of the flanking sequences, which promote
homologous recombination, it is possible that a certain number of
integrations occur at random. In order to verify that the targetted
insertion has indeed occurred at the targetted site and not at
another site, the technique of the "Polymerase Chain Reaction"
(P.C.R.) (see Ref. 10) is used in order to amplify the DNA sequence
of the locus at which the insertion should be made. In this manner,
only the clones transformed following homologous recombination are
selected.
The flanking sequences of the vector are quite obviously selected
as a function of the desired insertion site so that the homologous
recombination may take place. Sphere appropriate, the flanking
sequences may contain replica sequences of the endogenous promoter
and/or modifications to the sequences which precede the initiation
codon in order to improve the level of translation (sequences
upstream) and replica sequences of the termination sequences, in
particular polyadenylation sites (sequences downstream).
The insertion gene may be any gene of interest. Mention should be
made, as non-limiting examples, of the lac.Z gene (as in the model
described below), the genes coding for interleukin or interferon,
the gene for the retinoic acid or 3-beta adrenergic or H.I.V.
receptor, for example, and genes known to be associated with
certain diseases, for example myopathy, etc . . .
In accordance with a preferred variant of the invention, the
eucaryotic cells are embryonic stem cells (see Ref. 14 and 15).
In fact, a mutated E.S. cell may be injected into an immature
embryo which, after reimplantation, will be born in a chimeric
form. If the germ line is colonized by the mutated cell, the
chimeric animal will transmit the mutation to its progeny.
Subsequently, it will be possible to observe the effects of this
mutation, in the homozygous state in some individuals, on their
development, their behaviour, their metabolism, their pathology,
etc . . .
The procedure of the invention is of very wide industrial
application and may vary according to the nature of the foreign
gene introduced.
The genetics of mammals will be able to make considerable progress
as a result of the recent possibility of mutagenizing specifically
any gene, thus making it possible to better define its role. By
means of this technology which involves homologous recombinations
and E.S. cells, valuable information will be provided concerning
oncogenes, growth factors, transcription factors, etc . . . genes
which concern very topical subjects in fundamental research or
applied research. An important prospect for medical research is the
possibility of reproducing a human disease whose genetic analysis
is known (certain human diseases with pathology, such as Duchesne
myopathy) in order to study its mechanisms better and to discover a
treatment.
By applying the process of the invention, a gene known to be
responsible for a certain disease is inserted in a targetted manner
into the genome of a E.S. cell. The transgenic animal which is
subsequently produced provides a useful model of this disease.
If necessary, and as described above, the normal genetic functions
may be approximately maintained, in spite of the insertion of the
foreign gene.
Another application of the process of the invention consists of
inserting an insertion gene which is easily detectable e.g. the
lac.Z gene and which can thus play the role of cell marker. In this
manner, studies of lineage e.g. in animals entered in competitions
are facilitated, and the pedigree may be monitered.
The insertion of the lac.Z gene as insertion gene also makes
possible studies of the promoter. Owing to the possibility of
detecting the .beta.-galactosidase activity, the activity and
specificity of various endogenous promoters may be studied by
targetting different sites in the same or different types of cells.
It will be possible to carry out the same studies on a whole
organism, during development, or in the adult state by using the
techniques of chimeric or transgenic animals.
The inventors have made the surprising observation that the
frequency of homologous recombination is not affected by the
insertion of fragments of large size, for example the Lac. Z. This
observation suggested to the inventors that the technique of
homologous recombination would be well adapted to the insertion of
other heterologous genes which are of large size.
Owing to the possibility of being able to modify the genome of an
animal, the process of the invention may also be used as "gene
therapy". The most obvious uses would consist of inactivating the
genes of receptors for infectious (viruses or bacteria) or toxic
agents. If such mutagenesis were to prove lethal, it would be
necessary to reestablish the lost function without reestablishing
the sensitivity to the noxious agents. A modified gene coding for
such a receptor could be reintroduced into the mutated cell
provided that the modification could be brought about by homologous
recombination. This modification of the genetic inheritance would
confer on the animal an immunity against the disease under
consideration.
This protocol may also be implemented in the context of
auto-transplantation. Diseased or healthy cells taken from a
patient could be treated and immunized, then reimplanted into the
same individual.
The technique of the invention also lends itself to studies of the
activity of pharmaceutical products presumed to have an activity
towards the products of expression of a pathological gene
associated with a disease. In this case, the inserted gene is
constituted by the pathological gene and the pharmaceutical product
is administered to the transgenic animal for the purpose of
evaluating its activity on the disease.
The invention will be illustrated by making reference to the
plasmid pGN and its use in the targetted insertion of a foreign
gene (lac.Z, coding for the enzyme .beta.-galactosidase of E. coli)
into the genome of a E.S. cell of mice. The lac.Z gene was selected
on account of the fact that its expression may be easily detected
and is simply used for purposes of illustration.
The coding sequence of the .beta.-galactosidase enzyme of E. coli
(lac.Z; 1-3057), fused with a genomic sequence (7292-3) of the
mouse gene Hox. 3-1 (Ref. 1), starts with the initiation codon for
this gene. In fact, the sequence which precedes the initiation
codon of Hox-3.1 is identical with the consensus sequence observed
in vertebrates (ref. 2), thus making possible an improved level of
translation of .beta.-galactosidase in the cells of vertebrates.
The lac. Z gene is followed by a polyadenylation signal of, for
example the SV 40 virus, like most of the eucaryotic genes, in
order to stabilize the messenger RNAs.
The activity of the .beta.-galactosidase of E. coli, which is
functional in the eucaryotic cells, may be detected in different
ways. Cells expressing the lac.Z gene take on a blue colour, after
fixation in the presence of X-Gal, which is a substrate for
.beta.-galactosidase (Ref. 3). A new substrate, the FDG (flurescein
di-.beta.-galactopyranoside) makes it possible to detect and
determine the .beta.-gal. activity while keeping the cells alive
(Ref 4). The cells expressing lac.Z accumulate a fluorescent
product and can be isolated with the aid of a cell sorter or FACS
(fluorescence-activated cell sorter).
The transcription unit of the gene for resistance to neomycin is
derived, in large part, from the plasmid pRSV neo (Ref. 5). The LTR
(long terminal repeat) of the Rous sarcoma virus provides very
powerful promoter and enhancer sequences in many eucaryotic cells
(Ref. 6). From the bacterial transposon Tn5 are derived an active
promoter in E. coli and the coding sequence of the enzyme
phosphotransferase (Ref. 7), which is followed by the
polyadenylation signal of the SV40 virus. The same gene under the
double control of the RSV and Tn5 promoters can confer resistance
to neomycin or kanamycin on bacteria and resistance to G418 on
eucaryotic cells.
As a result of the effect of a simple point mutation, the B unit of
the enhancer sequences of the PyEC F9.1 strain of the polyoma virus
became much more active in different types of cells, and in
particular in embryo carcinoma (EC) cells (Ref. 8). Two copies of
this enhancer Py F9.1 were inserted in tandem into the plasmid pGN,
upstream from the LTR-RSV, and in the "late promoter" orientation
of the regulatory region of polyoma.
In order to improve the level of translation of the
phosphotransferase, the sequence preceding the initiation codon was
modified during oligonucleotide mutagenesis. Thus the sequence T T
C G C A U G became G C A C C A U G, corresponding much better to
the consensus initiation sequence for translation in vertebrates
(Ref. 2).
It was possible to evaluate the improvements introduced into the
transcription unit of the gene for resistance to neomycin by
transfecting embryonic stem cells (ES) of the mouse. At equal
molarity of plasmid, a construction with the Py. F9.1 enhancers
produced 7.5.times. more resistant clones to G418 than the pRSV neo
and 2 to 3.times. more than the pMCl Neo described by Capecchi et
al (ref. 13). Again, the number of clones was increased 60.times.,
that is 450.times. compared to the pRSV neo, by modifying the
initiation sequence of translation. Homologous recombination may be
a quite rare event, depending on the experimental conditions used
(p. ex 1/1000 for HPRT, ref. 13). A vector possessing a high
efficacy of selection is thus very useful, all the more so since
the conditions of electroporation mainly give rise to the
integration of a single copy.
The pGN plasmid, contains, in addition, a bacterial origin of
replication of the type colE1, pBR322, which makes the clonings and
preparations in E. coli possible.
Finally, a multiple cloning site (M.C.S.), synthesized in vitro,
which only contains unique sites of cleavage in pGN, was inserted
upstream from lac.Z., in order to facilitate the uses of this
plasmid.
The plasmid "flanking" sequences which produce homologous
recombination are added to the extremities of the pGN plasmid after
linearization of the plasmid upstream from lac.Z through a site of
the ICS (see FIG. 2). In this case, the flanking sequences selected
are homologous with the chromosomal sequences derived from Hox-3.1
subsequently required to engage in homologous recombination.
FIG. 2 places the molecule constructed from the plasmid pGN with
respect to the Hox-3.1 gene. In this case, recombination between
the plasmid and chromosomal sequences of Hox-3.1 would result in an
insertion at the start of the coding sequence of this gene, hence
in its total inactivation.
The pGN plasmid brings together several advantages for this
methodology which is applicable to any gene. Since the event of
homologous recombination may be quite rare (of the order of 1 for
1000 non-homologous integrations), it is necessary to be able to
analyse a large number of clones whose resistance to G418 is
sufficiently high as to be expressed in any part of the genome. The
modifications introduced into the transcription unit of the
phosphotransferase completely solve these problems. The method of
mutagenesis by homologous recombination corresponds to inactivating
a gene by an insertion or a substitution, but the plasmid pGN
offers the additional advantage of being able to substitute the
expression of .beta.-galactosidase for that of the mutated gene.
Finally, the MCS facilitates the clonings of genomic fragments.
EXAMPLES
I--Construction of the Plasmid pGN
The intermediate plasmids are numbered according to their step.
1.degree. Step
Insertion of a Xho I site into the Bgl I site of pRSV neo
Insertion of a Xho I linker into the Bgl I site of pRSV neo, filled
in by means of the Klenow fragment of the DNA polymerase of E.
coli.
2.degree. Step
Insertion of a Cla I site into the Nde I site of the plasmid p1
Insertion of a Cla I linker into the Nde I site of p1, filled in by
means of the Klenow polymerase.
3.degree. Step
Insertion of the enhancer Py F9.1 into the Cla I site of the
plasmid p2
Insertion of the enhancer Py F9.1 Pvu II-Pvu II isolated through a
unique site, Acc I, into the Cla I site of p2. Selection of a clone
containing two enhancers oriented in the "late promoter" sense.
4.degree. Step
Sma I-Hpa I deletion from the plasmid p3
The two enzymes qive extremities with "blunt ends" Which may be
ligated directly. This deletion removes the intron of the t antigen
of SV 40, which is not very useful and appreciably uses the size of
the transcription unit of the phosphotransferase.
5.degree. Step
Insertion of a Xho I site into the Bam HI site of pCH110
Insertion of a Xho I linker into the Bam HI site of the plasmid pCH
110 (Pharmacia), filled in by the Klenow polymerase.
6.degree. Step
Insertion of the 3' lac.Z-polyA SV 40 into the plasmid P4
The 3' part of the coding sequence of .beta.-galactosidase,
followed by the polyadenylation signal of the SV 40 virus is
isolated from the plasmid p5 through the sites Xho I-Aat II and
cloned in the plasmid p.sup.4 through the same sites.
7.degree. Step
Insertion of the 5'lac.Z into the vector KS-
The 5' part of the coding sequence of .beta.-galactosidase is
isolated from the plasmid pMC 1871 (Pharmacia) through the sites
Pst I-Sac I and cloned in the vector KS- (Stratagene) through the
same sites.
8.degree. Step
Fusion of a Hox-3.1 genomic sequence with the 5' lac.Z
A genomic sequence of the gene Hox-3.1, cloned in the vector KS-,
is purified by successive digestions by the Sac I enzyme, then by
the Mung bean nuclease and finally by the enzyme Apa I. This insert
is fused with the 5' part of the coding sequence of
.beta.-galactosidase by cloning in the plasmid p7 digested by means
of Apa I-Sma I. The protein thus fused contains the initiation
codon for the translation of the Hox-3.1 gene followed by the
coding sequence for .beta.-galactosidase (subsequently verified by
sequencing).
The chart below contains the following nucleotide and amino acid
sequences, which are listed on the Sequence Listing at the end of
the specification: SEQ ID NO: 1. CCAGCATGAGCTCC SEQ ID NO: 2. Ile
Pro Gly Asp Pro SEQ ID NO: 3. ATCCCGGGGATCCC SEQ ID NO: 4.
CCAGCATGAGCT SEQ ID NO: 5. Met Gly Asp Pro SEQ ID NO: 6.
CCAGCATGGGGGATCCC ##STR1##
9.degree. Step
Insertion of Hox-3.1-5'lac.Z into the plasmid p6
The fusion Hox-3.1-5'lac.Z is isolated from the plasmid p8 through
the sites Apa I-Sac I and cloned in the plasmid p.sup.6 through the
same sites. This cloning has the effect of reconstituting the
coding sequence of .beta.-galactosidase in its entirety.
10.degree. Step
Insertion of the NeoR gene into the vector KS+
The gene for resistance to neomycin (bacterial promoter and coding
phase of the phosphotransferase) is isolated from the pRSV neo
through the Hind III-Eco RI sites and cloned in the vector KS+
(Stratagene).
11.degree. Step
Mutagenesis of the initiation sequence of Neo.sup.R in p10
The initiation sequence of the translation of the
phosphotransferase is modified in order to be identical with the
consensus sequence observed in the vertebrates and thus makes
possible a higher level of initiation of the translation, hence
enhanced resistance to G418 in the case of mammalian cells. The
modification also creates a Apa LI site which enables the
effectiveness of the mutagenesis to be controlled.
The chart below contains the following nucleotide sequences: SEQ ID
NO:7: GTTTCGCATG SEQ ID NO:8: GTGCACCATG ##STR2##
An oligonucleotide (SEQ ID NO:9 CTTGTTCAATCATGGTGCACGATCCTCA)
comprising a region of mismatching with the sequence of the pSRV
neo (underlined) is synthesized (Gene Assembler, Pharmacia), then
phosphorylated by the polynucleotide kinase of the bacteriophage
T4. A single-stranded matrix of the plasmid p10 is prepared as a
result of the f1 origin of the plasmid KS+ and hybridized with the
oligonucleotide of mutagenesis. The second strand is synthesized
and repaired by the Klenow polymerase and the DNA ligase of the
bacteriophage T4. After transformation of bacteria, the mutated
clones are screened with aid of the oligonucleotide labeled with
32P. The mutagenesis was verified by digesting with Apa LI as well
as by sequencing.
12.degree. Step
Replacement of the initiation sequence in the plasmid p9
A fragment containing the modified initiation sequence for the
translation of the gene for resistance to neomycin is isolated from
the plasmid p11 by means of the enzymes Hind III-Eag I and cloned
in the plasmid p9 through the same sites.
13.degree. Step
Insertion of the multiple cloning site into the plasmid p12
Two complementary oligonucleotides are synthesized (Gene Assembler,
Pharmacia), then phosphorylated. After matching, the MCS is cloned
into the Apa I-Sac II sites of the plasmid pl2 through its cohesive
ends.
The chart below contains the following nucleotide sequences: SEQ ID
NO:10 CCCCGGGGGTACCTCTAGAATGCATTCCGC SEQ ID NO:11
GGAATGCATTCTAGAGGTACCCCCGGGGGGCC ##STR3##
The multiple cloning site was also verified by sequencing.
II--Addition of the "Flanking" Sequences to the Extremities of the
Linearised Plasmid pGN Upstream from lac.Z' Through a Site of the
M.C.S.
The flanking sequences used were selected as a function of the
desired insertion site (for example, Hox-3.1, see FIG. 2a and b
pGMA and pGMD).
In the construction of the mutant plasmid pGMD, two arms of DNA
homologous to the Hox-3.1 locus were cloned at the Apa I-Nsi I and
Nsi I-Sac II sites of the vector pGN. The 5' arm starts at the Sac
II site (CCGCGG) at the nucleotide 219 of the cDNA c21 of Hox-3.1.
This fragment extends for 6.8 kb at the 5' up to the first BamHI
site. The 3' arm starts at the Apa 1 site (GGGCCC) at the
nucleotide 885 of the cDNA c21. This fragment extends for 1.5 kb at
the 3' up to the first PstI site. A NsiI linker was inserted into
the BamHI site of the 5' fragment and into the PstI site of the 3'
fragment. The 5' and 3' arms were cloned in the vector pGN in the
Nsi I-Sac II and the Apa I-Nsi I sites, respectively. The sequence
of the cDNA of Hox-3.1 c21 has been published (ref. 1).
The mutant plasmid is linearised by digestion with Nsi I before
electroporation of the E.S. cells. Its extremities are formed of
two genomic arms cloned at the Apa I-Nsi I and the Nsi I-Sac II
sites of the vector pGN.
The plasmid pGMD does not possess a polyadenylation signal. after
the resistance gene but, on the contrary, does possess a region
rich in AU responsible for the selective degradation of mRNA,
inserted into the sequence of the intron of the Hox-3.1 of the
plasmid.
Another mutant plasmid pGMA, possesses the same structure as pGMD
but contains the signals for polyadenylation and termination of
transcription of the SV40 and does not possess the AU sequence for
the degradation of mRNA downstream from the Neo.sup.r gene. The
purpose of these modifications is to reduce the level of
transcripts of the Neo.sup.r in the clones derived from random
integration. On the other hand, clones derived from homologous
recombination events between pGMD and a Hox-3.1 locus should have
in altered growth during the selection with G418, the AT sequence
for the degradation of mRNA being removed by the recombination
procedure itself or spliced with the intron Hox-3.1.
In the experimental steps which follow, the protocol described by
Thompson et al., 1989 was followed for the production of chimeric
animals.
III--Transfection of Mouse Embryonic Cells
The method described by Thompson et al. 1989, was used in order to
transfect mouse embryonic cells. The use of the technique of
electroporation ensures the introduction of a single copy of the
foreign gene (lac.Z) per cell. After transfection, several clones
expressing .beta.-galactosidase were isolated.
The mutant plasmids pGMD and pGMA were linearised and introduced by
electroporation into E.S. cells in order to promote the insertion
of one copy only into the genome (ref. 11).
The initial transfections were carried out in order to compare the
efficiency of screening of the Hox-3.1 of the plasmids pGMA and
pGMD (see table I).
TABLE I Homologous recombination in the Hox-3.1. gene No. of No. of
clones No. of positive Mutant the set forming P.C.R. Exp. Plasmid
analysed the set results I pGMA 3 600 0(2) II PGMD 5 250 3(5) III
pGMD 84 2-3 5(5)
The E.S. cell line "C.C.E." (ref.16) was maintained continuously on
fibroblast nurse cell layers (ref. 17). For the experiments I and
II, 1.5.times.10.sup.7 E.S. cells in 1.5 ml of HeBS were
electroporated (ref. 11) at 200 V with 40 mg of linearised plasmid,
then spread on four culture dishes (diameter 100 mm). For
experiment III, the shock was administered under the same
conditions but a quarter of the cells were spread on four plates
with 24 wells. The next day, 250 .mu.g ml.sup.-1 G418 were added.
Each transfection gave rise to about 2400 clones with pGMA and
about 1000 clones with pGMD.
The mean number of clones of E.S. cells resistant to G418 in each
set is indicated in table I, as well as the number of sets giving a
positive result with the P.C.R. technique. A positive result means
that it was possible to observe a band of 1.6 kb on an agarose gel
stained with ethidium bromide (see FIG. 7). The number of sets
giving a positive signal after a Southern analysis of the P.C.R.
mixture and hybridization with a specific probe which did not
contain the sequences of the primers is indicated in parentheses
(FIG. 8).
Detection of homologous recombination with the P.C.R. P.C.R. was
carried out on 10.sup.5 cells of a set of 250 clones of the
transfection II (see lane D of FIG. 7). In the other lanes, four
sets of the transfection III were analysed together by mixing about
4.times.5000 cells. The primers 07 and 08 used in the P.C.R.
surround the sequence 3' Hox-3.1 of the mutant plasmid (FIG. 2).
The 1.6 kb fragment covering this 3' sequence can only be amplified
in the case of homologous recombination. The lanes 2, 3 and D
illustrate positive results.
The DNA of the E.S. clones was prepared at the time of the replica
on a filter using the method "boiling-proteinase K digestion
boiling" (ref. 18). 40 cycles of amplification (40 seconds at
94.degree. C., 1 minute at 60.degree. C., 7 minutes at 72.degree.
C.) were performed in a reaction mixture of 100 .mu.l, containing
67 nM Tris-HCl (pH 8.6), 16.7 nM (NH.sub.4).sub.2 SO.sub.4, 6.7 mM
MgCl.sub.2, 10 mM 2-mercaptoethanol, 0.01% (wt/V) gelatin, 200
.mu.M dATP, dTTP and dCTP, 100 .mu.M dGTP, 100 .mu.M 7-deaza-dGT,
600 ng of each primer (07 (SEQ ID NO:12) AACTTCCCTCTCTGCTATTC and
08 (SEQ ID NO:13) AGCAGAAACATACAAGCTG) and 3U Taq polymerase
(Perkin Elmer Cetus), covered with 100 .mu.l of paraffin.
Southern Analyses
Three independent clones of E.S. cells containing the mutated
Hox-3.1 (identified by P.C.R.) were isolated from the positive sets
by using pipettes. Their DNA was examined by means of Southern
analysis after digestion with the restriction enzymes indicated in
FIG. 8 in order to confirm the specific screening and to
distinguish between the recombined and wild-type loci. Two
different probes were used in the analysis of the 3' end of the
Hox-3.1 loci in the mutated clones and in the non-mutated E.S.
cells serving as controls (FIG. 8c). The first probe "a" was
contained in the Hox-3.1 sequences of the mutant plasmid and
demonstrated the number of integrations of vector and their
physical linkages. One of the three recombined clones contained, in
addition, a copy of the plasmid integrated at random (FIG. 8a,
clone F2). The second probe "b" which was not contained in the
mutant vector distinguished between the recombined and wild-type
Hox-3.1 alleles (FIG. 8b). The recombined Hox-3.1. locus showed
with both probes the pattern of hybridization expected from the
restriction maps of the mutant vector and the intact locus.
Furthermore, the existence of two recombination domains in the 3'
arm of the vector was confirmed by the presence or absence of the
AT sequence in the recombined Hox-3.1 locus (for example FIG. 8,
clone L5). The 5' end of the Hox-3.1 locus was also analysed for
the homologous recombination event. Restriction enzymes not
possessing sites in the 5' Hox-3.1 sequence of 6.8 kb of the mutant
vector were used in the digestion of the DNAs of the recombined
clones. These DNAs were then subjected to electrophoresis in a
pulsed field in order to distinguish the fragments of high
molecular weight. A Southern analysis of this gel also showed the
recombined alleles correctly and the wild-type Hox-3.1 alleles by
using a probe possessing a sequence upstream from the mutant
plasmid.
The Southern analyses demonstrated that an allele of the Hox-3.1
gene had recombined as expected. The homologous recombination was
equivalent to a double "crossing-over" between the genomic arms of
the mutant plasmid and the homologous chromosomal sequences (FIG.
2).
In the recombinant clones, the lac Z gene has been placed under the
control of the promoter and regulatory sequences of the Hox-3.1
upstream from the AUG codon, but the 3' maturation signals of the
mRNA were derived from the SV40. In these recombined clones, the
expression of lac.Z was not detectable by staining with .beta.-Gal
which is consistent with the absence of transcription of Hox-3.1 in
E.S. cells determined by RNase protection analysis. The activity of
.beta.-Gal could be induced in some cells after 3 or 4 days of
culture in the presence of 5.10.sup.-7 M retinoic acid, known
conditions for inducing the transcription of Tox-3.1 (ref. 19).
By using the mutant vector pGNA, which possesses a total homology
of 8.3 kb DNA with the Hox-3.1 locus, a fragment of 120 bp was
replaced by an insertion of 7.2 kb. The frequency of this targeted
replacement (1/900) is comparable to that obtained recently
(1/1000) with HPRT (ref. 13) or with En-2 (1/260) (ref. 20), the
heterologous fragment inserted being, however, much smaller (1.1
and 1.5 kb, respectively) in these latter cases. Surprisingly, it
was observed that a very high frequency of homologous recombination
(1/40) could be obtained with the vector pGMD. The removal of the
3' maturation signals for mRNA and the addition of the sequence for
the degradation of mRNA to the gene for the resistance to neomycin
had the effect of reducing the total number of clones resistant to
G418 by 2.4 (table I). The specific screening ratio was almost 10
times higher (900/40). Even the mechanism of homologous
recombination must have been affected in the experiments with pGMD.
A possible explanation of these results would be that a AT sequence
of 51 bp could provide, in vivo, an open loop in the mutant plasmid
owing to its lower melting temperature. If the neighbouring Hox-3.1
sequences of the pGMD can be influenced by this opening, on each
side of the AT region, they could react more effectively in the
single-stranded state with the Hox-3.1 chromosomal locus. The model
of mitotic recombination in yeast suggests that it is initiated by
such an exchange of strands, whereas the mechanism of homologous
recombination remains unknown in the more complex eucaryotes.
FIG. 8 shows the results of the Southern analysis performed on
positive individual clones (L5 and F2) and on E.S. cells
(C.C.E.).
The probes used hybridize only with Hox-3.1 sequences included in
the vector (a) or excluded from the mutant vector (b). The pattern
of hybridization of the recombined Hox-3.1 locus (open triangles)
is clearly distinguished from the wild-type locus (black
triangles). The stars indicate the hybridization bands of a copy of
the plasmid which has been integrated at random. The size marker is
a Eco RI+Hind III digest of lambda DNA.
The FIG. 8(c) shows the restriction maps of the recombined (rec.)
and wild-type (wt) Hox-3.1 alleles. The parts of the mutant vector
and of the Hox-3.1 locus are indicated with the same symbols as
those used in FIG. 2. In this case, the AT sequence has been
integrated by homologous recombination. The vertical arrow
indicates the 3' end of the mutant plasmid. The location of the "a"
and "b" probes used in the Southern analysis is also indicated. The
abbreviations used in FIG. 8 are the following: B, Bam HI; D, Dra
I, E, Eco RI; H, Hind III; S, Sal I; X, Xho I.
IV--Production of Chimeric Embryos
A microinjection into blastocysts was carried out with two
recombinant E.S. clones containing an intact Hox-3.1 allele and a
recombined allele, these clones did not contain any other copy of
the mutant plasmid. The karyotypes of the cells were normal.
Ten to fifteen mutated cells were microinjected per blastocyst.
After reimplantation in surrogate mothers, the embryos were
collected at 9.5, 10.5 and 12.5 days p.c. and analysed for the
expression of lac.Z. The range of transcription of Hox-3.1 at these
stages had been determined beforehand by in situ hybridization
analysis (ref. 1). The Hox-3.1 transcripts are detectable for the
first time at the stage of late gastrulation and are distributed in
all of the tissues of the posterior part of the animal. Later, the
distribution becomes progressively limited in space and specific
with respect to tissue. At the stage of 12.5 days p.c.,
transcription is localized in the cervical region of the neural
tube, at the level of the heart. During the course of
embryogenesis, the distribution of the transcription of Hox-3.1
thus undergoes modifications. The 10.5 days p.c. stage seems to be
a period of transition, transcription taking place both in the two
posterior regions and in the cervical neural tube.
In chimeric embryos at 9.5 and 10.5 days p.c., the caudal part of
the posterior bud exhibited intense .beta.-Gal activity, whereas
the marker was never detected in the anterior thoracic region or
the head (FIG. 9a). In the posterior region, cells stained by
.beta.-Gal were observed in all of the tissues and all of the
embryonic strata. Between the two buds which give rise to the
limbs, stained cells were distributed in restricted zones, in the
superficial ectoderm (FIG. 9b) as in the posterior regions (FIG.
9c) and, in the form of narrow lines or stripes, in the neural tube
(FIG. 9b). These stripes showed an irregular and asymmetric
distribution in the wall of the neural tube. The transcription of
Hox-3.1 was not detected in the thin layer of cells towards the
closure of the neural tube. These cells did not perhaps withstand
the treatments used during the in situ hybridization. It has been
observed that the cells of the neural ectoderm very early form part
of different parts of the nervous system and migrate in a radial
direction, following restricted lateral movements (ref. 21). These
results are thus consistent with that observation.
The expression of Lac.Z has thus correctly illustrated the first
part of the transcription of the homeogene Hox-3.1, i.e. in all of
the tissues of the caudal regions of the embryos at 9.5 and 10.5
days p.c., and has provided novel information concerning the mode
of transcription of Hox-3.1.
On the other hand, the expression of Lac.Z has not been observed in
the cervical regions of the neural tube of chimeric embryos at 12.5
days, nor in the anterior region of embryos at 10.5 days; this was
not the result expected from the studies of in situ hybridization.
The subsequent phase of transcription of Hox-3.1 observed from day
10.5 in the very localized zones of the neural tube was not
characterized by the activity of .beta.-Gal. One possible
explanation for this result would be that, whereas the expression
of lac.Z is under the control of the Hox-3.1 promoter, the 3'
sequences of the Hox-3.1 are absent from the reporter gene. It is
possible that 3' sequences of the initiation codon AUG or the
Hox-3.1 have an influence on the late expression of Hox-3.1 in the
anterior domain. An effect of "gene dosage" could also explain this
result. The autoactivation of several homeooenes in Drosophila has
been demonstrated genetically or suggested by the formation of
complexes between the DNA and the proteins of the homeobox.
If the late component of the transcription of Hox-3.1 in the neural
tube is maintained by a similar mechanism, the inactivation of an
allele would have a dominant effect in the cells of the neural
ectoderm. Since one allele only would produce the Hox-3.1 protein,
the activation signal would be diluted on the two promoters. The
reduction of autoinactivation in the two loci would thus be able to
bring the initiation of transcription to a complete stop. This
would explain why no expression of Lac.Z was detected in the
cervical region of the neural tube of embryos at 10.5 and 12.5
days.
V--Passage of the Modification into the Term Cell Line: Production
of Transgenic Animals
The effects in F.sub.1 and F.sub.2 of the modification introduced
by the targetted insertion were observed after reproduction of the
chimeras. The passage of the modification into the germ cell line
was noted.
BIBLIOGRAPHY 1. Le Mouellic, H., Condamine, H. et Brulet, P.
(1988). Genes & Development. 2, 125-135. 2. Cavenir, D. R.
(1987). Nucleic Acids Res. 15, 1353-1361. 3. Sanes, J. R.
Rubenstein, J. L. R. et Nicolas, J. F. (1986) EMBO J. 5, 3133-3142.
4. Nolan, G. P., Fiering, S., Nicolas, J. F. et Herzenberg, L. A.
(1988) Proc. Natl. Acad. Sci. USA 85, 2603-2607. 5. Gorman, C.,
Padmanabhan, R. et Howard, B. H. (1983). Science. 221, 661-553. 6.
Gormann, C. M., Merlino, G. T. Willingham, M. C. Pastan, I. et
Howard, B. H. (1982) Proc. Natl. Acad. Sci. USA 79, 6777-6781. 7.
Southern, P. J. et Berg, P. (1982) J. Mol. Appl. Genet 1, 327-341.
8. Herbomel, P., Bourachot, B. et Yaniv, M. (1984). Cell. 39,
653-662. 9. Robertson, E. J. (1987). Teratocarcinomas and embruonic
stem cells: A practical approach. IRL Press, Oxford. 10. Kahn, A.
(1988). Medecine/Sciences 4, 515-518. 11. G. Chu, Hayakawa H.,
Berg. P. (1987) Nucleic Acid Research 15, Nr. 3, 1311-1326. 12.
Thompson, S., Clarke, A. R., Pow, A. M., Hooper, M. L., Melton, D.
W., (1989) Cell, 56, 313-321. 13. Thomas, K. R., Capecchi, M. R.,
(1987) Cell, 51 503-512. 14. Evans, M. J., Kaufmann, M. H. (1981)
Nature, 292, 154-155, 15. Robertson, E. J., (1986) Trends in
Genetics, 9-13 16. Robertson, E., Bradley, A., Kuehn, M. &
Evans, M. Nature 323, 445-448 (1986). 17. Robertson, E. J. in
Teratocarcinomas and Embryonic Stem Cells (ed. Robertson, E. J.)
71-112 (IRL, Oxford, 1987). 18. Kim, H. S. & Smithies, O.
Nucleic Acids Res. 16, 8887-8903 (1988). 19. Breier, G., Bucan, M.,
Francke, U., Colberg-Poley, A. M. & Gruss, P. EMBO J.5,
2209-2215 (1986). 20. Joyner, A. L., Skarnes, W. C. & Rossant,
J. Nature 338, 153-156 (1989). 21. McKay, R. D. G. Cell 58, 815-821
(1989).
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 17 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 14 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1 CCAGCATGAG
CTCC 14 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 5 amino acids (B) TYPE: amino acid (D)
TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE
DESCRIPTION: SEQ ID NO: 2 Ile Pro Gly Asp Pro 1 5 (2) INFORMATION
FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION:
SEQ ID NO: 3 ATTCCCGGGG ATCCC 15 (2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:
4 CCAGCATGAG CT 12 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 4 amino acids (B) TYPE: amino acid (D)
TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE
DESCRIPTION: SEQ ID NO: 5 Met Gly Asp Pro 1 (2) INFORMATION FOR SEQ
ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION:
SEQ ID NO: 6 CCAGCATGGG GGATCCC 17 (2) INFORMATION FOR SEQ ID NO:
7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 10 base pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID
NO: 7 GTTTCGCATG 10 (2) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 10 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8 GTGCACCATG 10
(2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi)
SEQUENCE DESCRIPTION: SEQ ID NO: 9 CTTGTTCAAT CATGGTGCAC GATCCTCA
28 (2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi)
SEQUENCE DESCRIPTION: SEQ ID NO: 10 CCCCGGGGGT ACCTCTAGAA
TGCATTCCGC 30 (2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11 GGAATGCATT
CTAGAGGTAC CCCCGGGGGG CC 32 (2) INFORMATION FOR SEQ ID NO: 12: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:
12 AACTTCCCTC TCTGCTATTC 20 (2) INFORMATION FOR SEQ ID NO: 13: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:
13 CAGCAGAAAC ATACAAGCTG 20 (2) INFORMATION FOR SEQ ID NO: 14: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:
14 CTGCAGGTCG ACGGATCCGG GGAATTCCC 29 (2) INFORMATION FOR SEQ ID
NO: 15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 base pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID
NO: 15 GGGGATCCCG TC 12 (2) INFORMATION FOR SEQ ID NO: 16: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:
16 AAATAATAAT AACCGGGC 18 (2) INFORMATION FOR SEQ ID NO: 17: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:
17 AGGGGGGATC CGTCGACCTG CAG 23
* * * * *