U.S. patent number 6,107,037 [Application Number 09/100,803] was granted by the patent office on 2000-08-22 for methods for using mutant rna polymerases with reduced discrimination between non-canonical and canonical nucleoside triphosphates.
This patent grant is currently assigned to Epicentre Technologies Corporation, The University of Texas. Invention is credited to Jerome J. Jendrisak, Rui Sousa.
United States Patent |
6,107,037 |
Sousa , et al. |
August 22, 2000 |
**Please see images for:
( Certificate of Correction ) ** |
Methods for using mutant RNA polymerases with reduced
discrimination between non-canonical and canonical nucleoside
triphosphates
Abstract
A method for synthesizing a nucleic acid molecule comprising at
least one non-canonical nucleoside triphosphate using a mutant
polymerase having a reduced discrimination between canonical and
non-canonical substrates is disclosed. The method comprises
incubating a template nucleic acid in a reaction mixture comprising
the mutant nucleic acid polymerase and the appropriate canonical
and non-canonical nucleoside triphosphates which are desired
substrates for the mutant nucleic acid polymerase. The present
invention is also a method of determining the sequence of a nucleic
acid molecule using the mutant polymerase to create a nucleic acid
molecule comprising at least one non-canonical nucleoside
triphosphate.
Inventors: |
Sousa; Rui (San Antonia,
TX), Jendrisak; Jerome J. (Madison, WI) |
Assignee: |
Epicentre Technologies
Corporation (Madison, WI)
The University of Texas (Ausin, TX)
|
Family
ID: |
24865724 |
Appl.
No.: |
09/100,803 |
Filed: |
June 19, 1998 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
713331 |
Sep 13, 1996 |
5849546 |
|
|
|
Current U.S.
Class: |
435/6.12; 435/5;
435/6.15; 435/91.2; 536/22.1; 536/24.3; 536/24.32 |
Current CPC
Class: |
C12N
9/1247 (20130101); C12P 19/34 (20130101); C12Q
1/6806 (20130101); C12Q 1/6865 (20130101); C12Q
1/6869 (20130101); C12Q 1/6869 (20130101); C12Q
1/6806 (20130101); C12Q 1/6865 (20130101); C12Q
1/6869 (20130101); C12Q 1/6869 (20130101); C12Q
1/6869 (20130101); C12Q 2531/143 (20130101); C12Q
2521/119 (20130101); C12Q 2531/143 (20130101); C12Q
2525/121 (20130101); C12Q 2521/119 (20130101); C12Q
2531/143 (20130101); C12Q 2525/121 (20130101); C12Q
2521/119 (20130101); C12Q 2531/143 (20130101); C12Q
2525/121 (20130101); C12Q 2521/119 (20130101); C12Q
2521/119 (20130101); C12Q 2531/143 (20130101) |
Current International
Class: |
C12P
19/00 (20060101); C12Q 1/68 (20060101); C12P
19/34 (20060101); C12N 9/12 (20060101); C12Q
001/68 (); C12P 019/34 (); C07H 021/04 () |
Field of
Search: |
;435/6,91.2
;536/22.1,24.3,24.32 |
References Cited
[Referenced By]
U.S. Patent Documents
Other References
Sousa et al, "A mutant T7 RNA polymerase as a DNA polymerase", The
Embo Journal, vol. 14(18), pp. 4609-4621, 1995. .
Kostyuk et al, "Mutants of T7 RNA polymerase that are able to
synthesize both RNA and DNA", FEBS Letters, vol. 369, pp. 165-168,
Jun. 13, 1995. .
Axelrod et al, "Transcription from Bacteriophage T7 and SP6 RNA
Polymerase Promoters in the Presence of 3-Deoxyribonucleoside
5-triphosphate Chain Terminators", Biochemistry, vol. 24, pp.
5716-5723, Mar. 15, 1995. .
Stratagene catalog, p. 39, 1988. .
"Probe Amplifier System Based on Chimeric Cycling
Oligonucleotides," Biotechniques 9(2):142-146, 1990. .
W.M. Barnes, "DNA Sequencing by Partial Ribosubstitution," J. Mol.
Biol. 119:83-99, 1978. .
E.T. Butler and M.J. Chamberlin, "Bacteriophage SP6-specific RNA
Polymerase," J. Biol. Chem. 257 (10):5772-5778, 1982. .
C. Cazenave, et al., "RNA template-directed RNA systhesis by T7 RNA
polymerase," PNAS 91:6972-6976, 1994. .
D.H. Jones and B.H. Howard, "A Rapid Method for Recombination and
Site-Specific Mutagenesis by Placing Homologous Ends on DNA Using
Polymerase Chain Reaction, " Biotechniques 10(1): 62-66, 1991.
.
G.A. Kassavetis, et al., "Bacteriophage SP6-specific RNA
Polymerase, " J. Biol. Chem. 257(10)5779-5788, 1982. .
D.A. Kostyuk, et al., "Mutants of T7 RNA polymerase that are able
to synthesize both RNA and DNA," FEBS Letters 369:165-168, 1995.
.
H. Kotani, et al., "Nucleotide sequence and expression of the
cloned gene of bacteriophage SP6 RNA polymerase," Nucl. Acids Res.
15(6):2653-2664, 1987. .
R. Sousa and R. Padilla, "A mutant T7 RNA polymerase as a DNA
polymerase," EMBO J. 14(18):4609-4621, 1995. .
E. Uhlmann, et al., "Antisense oligonucleotides: A new therapeutic
principle," Chem. Rev. 90:543-593, 1990. .
A. Wolfgang, et al., "Kinetic characterization of
ribonuclease-resistant 2' -modified hammerhead ribozymes," Science
253:314-317, 1991..
|
Primary Examiner: Fredman; Jeffrey
Assistant Examiner: Chakrabarti; Arun
Attorney, Agent or Firm: Quarles & Brady LLP
Parent Case Text
This is a division of application Ser. No. 08/713,331, Sep. 13,
1996, now U.S. Pat. No. 5,849,546.
Claims
We claim:
1. A method for determining sequence of a nucleic acid molecule,
comprising the steps of:
a) synthesizing a nucleic acid molecule de novo from an RNAP
promoter sequence in a reaction mixture containing a mutant RNA
polymerase in each of four separate reactions, wherein said mutant
RNA polymerase is selected from the group consisting of SP6 RNA
polymerase comprising an altered amino acid at position 631 and T7
RNA polymerase comprising an altered amino acid at position 639,
and wherein said mutant RNA polymerase has a reduced discrimination
between canonical and non-canonical nucleoside triphosphates, each
reaction comprising at least four nucleoside triphosphates, wherein
at least one nucleoside triphosphate has a nucleic acid base which
is complementary to each of adenine, cytidine, guanine and uracil
or thymine and a sugar with either a hydroxy or a hydrogen or a
fluorine at the 2'-position, and further comprising a ddNTP, such
that each of the four separate reactions forms a plurality of
reaction products of differing length, the length of said reaction
products indicating the positions or the type of base corresponding
to the incorporated ddNTP, and
b) evaluating the reaction products so that the sequence of the
template molecule may be deduced.
2. The method of claim 1, wherein each reaction comprises at least
four nucleoside triphosphates chosen from the group consisting of
ATP, CTP, GTP, and UTP or rTTP.
3. The method of claim 1, wherein each reaction comprises at least
four nucleoside triphosphates chosen from the group consisting of
dATP, dCTP, dGTP, dUTP, dTTP, 7-deaza-dGTP, dITP, 5-methyl-dCTP,
5-hydroxy-methyl-dCTP.
4. The method of claim 1, wherein each reaction comprises at least
four nucleoside triphosphates chosen from the group consisting of
2'-F-ATP, 2'-F-CTP, 2'-F-GTP, 2'-F-UTP, 2'-F-TTP,
2'-deaza-2'-F-GTP, 2'-F-ITP, and 5-methyl-2'-F-CTP,
5-hydroxymethyl-2'-F-CTP.
5. A method for determining the sequence of a nucleic acid
molecule, comprising the steps of:
a) synthesizing a nucleic acid molecule by extending a primer,
wherein at least part of the primer is complementary to a template
molecule so as to anneal therewith, in a reaction mixture
containing a mutant RNA polymerase in each of four separate
reactions, wherein said mutant RNA polymerase is selected from the
group consisting of SP6 RNA polymerase comprising an altered amino
acid at position 631 and T7 RNA polymerase comprising an altered
amino acid at position 639, and wherein said mutant RNA polymerase
has a reduced discrimination between canonical and non-canonical
nucleoside triphosphates, each comprising at least four nucleoside
triphosphates, wherein at least one nucleoside triphosphate has a
nucleic acid base which is complementary to each of adenine,
cytidine, guanine and uracil or thymine and a sugar with either a
hydroxy or a hydrogen or a fluorine at the 2'-position, and further
comprising a ddNTP, such that each of the four separate reactions
forms a plurality of reaction products of differing length, the
length of said reaction products indicating the positions of the
type of base corresponding to the incorporated ddNTP, and
b) evaluating the reaction products so that the sequence of the
template molecule may be deduced.
6. The method of claim 5, wherein each reaction comprises at least
four nucleoside triphosphates chosen from the group consisting of
ATP, CTP, GTP, and UTP or rTTP.
7. The method of claim 5, wherein each reaction comprises at least
four nucleoside triphosphates chosen from the group consisting of
dATP, dGTP, dUTP, dTTP, 7-deaza-dGTP, dITP, 5-methyl-dCTP,
5-hydroxymethyl-dCTP.
8. The method of claim 5, wherein each reaction comprises at least
four nucleoside triphosphates chosen from the group consisting of
dATP, dCTP, dGTP, dUTP, dTTP, 7-deaza-dGTP, dTTP, 5-methyl-dCTP,
5-hydroxy-methyl-dCTP.
9. The method of claim 1, wherein a dinucleotide or trinucleotide
for initiation of de novo acid synthesis is added to the reaction
mixture.
10. The method of claim 1, wherein at least one of the nucleoside
triphosphates in the reaction mixture is modified to contain a
radioactive or non-radioactive label.
11. The method of claim 1, wherein the ddNTP in the reaction
mixture is modified to contain a radioactive or non-radioactive
label.
12. The method of claim 9, wherein the dinucleotide or
trinucleotide in the reaction mixture is modified to contain a
radioactive or non-radioactive label.
13. A method for determining the sequence of a nucleic acid
molecule, comprising the steps of:
a) synthesizing a nucleic acid molecule de novo from an RNAP
promoter sequence in a reaction mixture containing a mutant RNA
polymerase in each of four separate reactions, wherein said mutant
RNA polymerase is selected from the group consisting of SP6 RNA
polymerase comprising an altered amino acid at position 631 and T7
RNA polymerase comprising an altered amino acid at position 639,
and wherein said mutant RNA polymerase has a reduced,
discrimination between canonical and non-canonical nucleoside
triphosphates, each reaction comprising at least four nucleoside
triphosphates, wherein at least one nucleoside triphosphate has a
nucleic acid base which is complementary to each of adenine,
cytidine, guanine and uracil or thymine and a sugar with either a
hydrogen or a fluorine at the 3'-position, and further comprising a
rNTP, and
b) treating the nucleic acid products of the reactions so as to
bring about hydrolysis of the rNTP has been incorporated, whereby a
plurality of reaction products of differing length are formed, the
length of said reaction products indicating the positions of the
type of base corresponding to the incorporated rNTP,
c) evaluating the reaction products so that the sequence of the
template molecule may be deduced.
14. The method of claim 13, wherein the nucleic acid synthesis is
part of or coupled to a method for nucleic acid amplification.
15. A kit for performing the method of claim 13 comprising a mutant
nucleic acid polymerase selected from the group consisting of SP6
RNA polymerase comprising an altered amino acid at position 631 and
T7 RNA polymerase comprising an altered amino acid at position 639,
wherein said mutant RNA polymerase has a reduced discrimination
triphosphates and data or instructions describing conditions under
which the method of claim 13 may be performed.
16. A kit for performing the method of claim 14 comprising a mutant
nucleic acid polymerase which has reduced discrimination between
canonical and non-canonical nucleoside triphosphates and data or
instructions describing conditions under which the method of claim
14 may be performed.
17. A method for determining the sequence of a nucleic molecule,
comprising the steps of:
a) synthesizing a nucleic acid molecule by extending a primer,
wherein at least part of the primer is complementary to a template
molecule so as to anneal therewith, in a reaction mixture
containing a mutant RNA polymerase in each of four separate
reactions, wherein said mutant RNA polymerase is selected from the
group consisting of SP6 RNA polymerase comprising an altered amino
acid at position 631 and T7 RNA polymerase comprising an altered
amino acid at position 639, and wherein said mutant RNA polymerase
has a reduced discrimination between canonical and non-canonical
nucleoside triphosphates, each reaction comprising at least four
nucleoside triphosphates, wherein at least one nucleoside
triphosphate has a nucleic acid base which is complementary to each
of adenine, cytidine, guanine and uracil or thymine and a sugar
with either a hydrogen or a fluorine at the 2'-position, and
further comprising a rNTP,
b) treating the nucleic acid products of the reactions so as to
bring about hydrolysis of the phosphodiester backbone at all sites
where a rNTP has been incorporated, whereby a plurality of reaction
products of differing length are formed, the length of said
reaction products indicating the positions of the type of base
corresponding to the incorporated rNTP,
c) evaluating the reaction products using any of the methods common
in the art for separating and detecting products of sequencing
reactions so that the sequence of the template molecule may be
deduced.
18. The method of claim 17, wherein the nucleic acid synthesis is
part of or coupled to a method for nucleic acid amplification.
19. A kit for performing the method of claim 17 comprising a mutant
nucleic acid polymerase which has reduced discrimination between
canonical and non-canonical nucleoside triphosphates and data or
instructions describing conditions under which the method of claim
17 may be performed.
20. A kit for performing the method of claim 18 comprising a mutant
nucleic acid polymerase which has reduced discrimination between
canonical and non-canonical nucleoside triphosphates and data or
instructions describing conditions under which the method of claim
18 may be performed.
21. A kit for performing a partial ribo-substitution reaction
comprising a mutant nucleic acid polymerase which has reduced
discrimination between canonical and non-canonical nucleoside
triphosphates and data or information describing conditions under
which the method may be performed.
22. A kit for determining a sequence of a nucleic acid molecule by
a dideoxy sequencing procedure, which kit comprises:
a) a mutant RNA polymerase, wherein said mutant RNA polymerase is
selected from the group consisting of SP6 RNA polymerase comprising
an altered amino acid at position 631 and T7 RNA polymerase
comprising an altered amino acid at position 639, and wherein said
mutant RNA polymerase has a reduced discrimination between
canonical and non-canonical nucleoside triphosphates;
b) four nucleoside triphosphates; and
c) four ddNTPs.
23. The kit of claim 22, wherein said nucleoside triphosphates are
chosen from the group consisting of ATP, CTP, GTP, and UTP or rTTP
and said ddNTPs are ddATP, ddCTP, ddGTP, and ddUTP or ddTTP.
24. The kit of claim 22, wherein said nucleoside triphosphates are
chosen from the group consisting of dATP, dCTP, dGTP, dUTP, dTTP,
7-deaza-dGTP, dITP, 5-methyl-dCTP, 5-hydroxy-methyl-dCTP and said
ddNTPs are ddATP, ddCTP, ddGTP, and ddUTP or ddTTP.
25. The kit of claim 22, wherein said nucleoside triphosphates are
chosen from the group consisting of 2'-F-ATP, 2' -F-CTP, 2'-F-GTP,
2'-F-UTP, 2'-F-TTP, 2'-deaza-2'-F-GTP, 2'-F-ITP, and
5-methyl-2'-F-CTP, 5-hydroxymethyl-2'-F-CTP and said ddNTPs are
ddATP, ddCTP, ddGTP, and ddUTP or ddTTP.
26. A kit for determining a sequence of a nucleic acid molecule by
a dideoxy sequencing procedure, which kit comprises:
a) a mutant RNA polymerase, wherein said mutant RNA polymerase is
selected from the group consisting of SP6 RNA polymerase comprising
an altered amino acid at position 631 and T7 RNA polymerase
comprising an altered amino acid at position 639, and wherein said
mutant RNA polymerase has a reduced discrimination between
canonical and non-canonical nucleoside triphosphates;
b) a primer for extending, in a template-dependent manner, a
nucleic acid comprising a sequence complementary to said nucleic
acid molecule;
c) four nucleoside triphosphates; and
d) four ddNTPs.
27. The kit of claim 26, wherein said nucleoside triphosphates are
chosen from the group consisting of ATP, CTP, GTP, and UTP or rTTP
and said ddNTPs are ddATP, ddCTP, ddGTP, and ddUTP or ddTTP.
28. The kit of claim 26, wherein said nucleoside triphosphates are
chosen from the group consisting of dATP, dCTP, dGTP, dUTP, dTTP,
7-deaza-dGTP, dITP, 5-methyl-dCTP, 5-hydroxy-methyl-dCTP and said
ddNTPs are ddATP, ddCTP, ddGTP, and ddUTP or ddTTP.
29. The kit of claim 26, wherein said nucleoside triphosphates are
chosen from the group consisting of 2'-F-ATP, 2'-F-CTP, 2'-F-GTP,
2'-F-UTP, 2'-F-TTP, 2'-deaza-2'-F-GTP, 2'-F-ITP, and
5-methyl-2'-F-CTP, 5-hydroxymethyl-2'-F-CTP and said ddNTPs are
ddATP, ddCTP, ddGTP, and ddUTP or ddTTP.
Description
FIELD OF INVENTION
The field of the present invention is methods for producing nucleic
acid molecules containing at least one non-canonical nucleotide and
for characterizing nucleic acid molecules by synthesizing nucleic
acid molecules containing at least one non-canonical nucleotide in
vitro using mutant nucleic acid polymerases having at least a
10-fold reduced discrimination between
2'-deoxyribonucleoside-5'-triphosphates and
ribonucleoside-5'-triphosphates as substrates compared to the
corresponding wild-type enzymes.
BACKGROUND
There are a number of procedures commonly used in the art for in
vitro synthesis of nucleic acid molecules, including both DNA and
RNA. For example, one may use an in vitro transcription reaction to
synthesize RNA from a DNA template present in the reaction. T7-type
RNA polymerases, such as T7 RNA polymerase, T3 RNA polymerase or
SP6 RNA polymerase, are commonly used in such reactions, although
many other RNA polymerases may also be used. Usually, but not
always, synthesis of RNA is de novo (i.e., unprimed), and usually,
but not always, transcription is initiated at a sequence in the
template that is specifically recognized by the RNA polymerase,
termed a "promoter" or a "promoter sequence". A method for in vitro
transcription is presented herein.
Procedures for in vitro nucleic acid synthesis are also commonly
used in the art to amplify nucleic acid molecules, including both
DNA and RNA. For example, transcriptions using RNA polymerases are
an integral part of "nucleic acid sequence-based amplification"
(NASBA), "self-sustained sequence replication" (3SR), and
"transcription-mediated amplification" (TMA) Hill, C. S., 1996,
three similar methods for amplifying nucleic acid molecules in
vitro.
By way of example, all or a specific portion of an RNA molecule may
be amplified using NASBA (Compton, et al., 1991) or 3SR (Fahy, et
al., 1991) by isothermal incubation of a sample RNA in a buffer
containing two primers (a first primer complementary to the RNA
molecule and encoding a promoter sequence for an RNA polymerase and
a second primer complementary to the 3'-end of the first cDNA
strand resulting from reverse transcription of the RNA molecule),
an RNA- and DNA-dependent DNA polymerase which also has RNase H
activity (or a separate RNase H enzyme), all four canonical
2'-deoxynucleoside-5'-triphosphates (dATP, dCTP, dGTP and dTTP), an
RNA polymerase that recognizes the promoter sequence of the first
primer, and all four canonical ribonucleoside-5'-triphosphates
(rATP, rCTP, rGTP and rUTP).
A first cDNA strand is synthesized by extension of the first primer
by reverse transcription. Then, the RNase H digests the RNA of the
resulting DNA:RNA hybrid, and the second primer primes synthesis of
the second cDNA strand. The RNA polymerase then transcribes the
resultant double-stranded DNA (ds-DNA) molecule from the RNA
polymerase promoter sequence, making many more copies of RNA, which
in turn, are reversed transcribed into cDNA and the process begins
all over again. This series of reactions, from ds-DNA through RNA
intermediates to more ds-DNA, continues in a self-sustained way
until reaction components are exhausted or the enzymes are
inactivated. DNA samples can also be amplified by other variations
of NASBA or 3SR or TMA.
Another nucleic acid amplification method involving DNA synthesis
is the polymerase chain reaction (PCR).
By way of example, a specific portion of a DNA molecule may be
amplified using PCR by temperature cycling of a sample DNA in a
buffer containing two primers (one primer complementary to each of
the DNA strands and which, together, flank the DNA sequence of
interest), a thermostable DNA polymerase, and all four canonical
2'-deoxynucleoside-5'-triphosphates (dATP, dCTP, dGTP and dTTP).
The specific nucleic acid sequence is geometrically amplified
during each of about 30 cycles of denaturation (e.g., at 95.degree.
C.), annealing of the two primers (e.g., at 55.degree. C.), and
extension of the primers by the DNA polymerase (e.g., at 70.degree.
C.), so that up to about a billion copies of the nucleic acid
sequence are obtained. RNA may be similarly amplified using one of
several protocols for (reverse transcription-PCR) RT-PCR, such as,
for example, by carrying out the reaction using a thermostable DNA
polymerase which also has reverse transcriptase activity (Myers and
Gelfand, 1991).
The polymerase chain reaction, discussed above, is the subject of
numerous publications and patents, including, for example: Mullis,
K. B., et al., U.S. Pat. No. 4,683,202 and U.S. Pat. No.
4,965,188.
A variety of procedures for using in vitro nucleic acid synthesis
for characterizing nucleic acid molecules, including both DNA and
RNA, also are known in the art.
There are many reasons for characterizing nucleic acid molecules.
For example, genes are rapidly being identified and characterized
which are causative or related to many human, animal and plant
diseases. Even within any particular gene, numerous mutations are
being identified that are responsible for particular pathological
conditions. Thus, although many methods for detection of both known
and unknown mutations have been developed (e.g., see Cotton, 1993),
our growing knowledge of human and other genomes makes it
increasingly important to develop new, better, and faster methods
for characterizing nucleic acids. Besides diagnostic uses, improved
methods for rapidly characterizing nucleic acids will also be
useful in many other areas, including human forensics, paternity
testing, animal and plant breeding, tissue typing, screening for
smuggling of
endangered species, and biological research.
One of the most informative ways to characterize a DNA molecule is
to determine its nucleotide sequence. The most commonly used method
for sequencing DNA at this time (Sanger, et al., 1977) uses a DNA
polymerase to produce differently sized fragments depending on the
positions (sequence) of the four bases (A=Adenine; C=Cytidine;
G=Guanine; and T=Thymine) within the DNA to be sequenced. In this
method, the DNA to be sequenced is used as a template for in vitro
DNA synthesis. RNA may also be used as a template if a polymerase
with RNA-directed DNA polymerase (i.e., reverse transcriptase)
activity is used. In addition to all four of the deoxynucleotides
(dATP, dCTP, dGTP and dTTP), a 2',3'-dideoxynucleotide is also
included in each in vitro DNA synthesis reaction at a concentration
that will result in random substitution of a small percentage of a
normal nucleotide by the corresponding dideoxynucleotide. Thus,
each DNA synthesis reaction yields a mixture of DNA fragments of
different lengths corresponding to chain termination wherever the
dideoxynucleotide was incorporated in place of the normal
deoxynucleotide.
The DNA fragments are labelled, either radioactively or
non-radioactively, by one of several methods known in the art and
the label(s) may be incorporated into the DNA by extension of a
labeled primer, or by incorporation of a labelled deoxy- or
dideoxy- nucleotide. By carrying out DNA synthesis reactions for
each of the four dideoxynucleotides (ddATP, ddCTP, ddGTP or ddTTP),
then separating the products of each reaction in adjacent lanes of
a denaturing polyacrylamide gel or in the same lane of a gel if
different distinguishable labels are used for each reaction, and
detecting those products by one of several methods, the sequence of
the DNA template can be read directly. Radioactively-labelled
products may be read by analyzing an exposed X-ray film.
Alternatively, other methods commonly known in the art for
detecting DNA molecules labelled with fluorescent, chemiluminescent
or other non-radioactive moieties may be used.
Because 2',3'-dideoxynucleotides (ddNTPs), including even ddNTPs
with modified nucleic acid bases, can be used as substrates for
many DNA polymerases, Sanger's dideoxy-sequencing method is widely
used. Recently, Tabor and Richardson (EP application 942034331,
1994) reported that mutations at specific sites in many DNA
polymerases improved the ability of these mutant enzymes to accept
ddNTPs as substrates, thereby leading to improved DNA polymerases
for DNA sequencing using the Sanger method.
Nucleic acid sequencing provides the highest degree of certainty as
to the identity of a particular nucleic acid. Also, nucleic acid
sequencing permits one to detect mutations in a gene even if the
site of the mutation is unknown. Sequencing data may even provide
enough information to permit an estimation of the clinical
significance of a particular mutation or of a variation in the
sequence.
Cycle sequencing is a variation of Sanger sequencing that achieves
a linear amplification of the sequencing signal by using a
thermostable DNA polymerase and repeating chain terminating DNA
synthesis during each of multiple rounds of denaturation of a
template DNA (e.g., at 95.degree. C.), annealing of a single primer
oligonucleotide (e.g., at 55.degree. C.), and extension of the
primer (e.g., at 70.degree. C.).
Other methods for sequencing nucleic acids are also known besides
the Sanger method. For example, Barnes described a method for
sequencing DNA by partial ribo-substitution (Barnes, W. M., 1977).
In this method, a pre-labelled primer was extended in vitro on a
template DNA to be sequenced in each of four reactions containing a
wild-type DNA polymerase in the presence of Mn2+, all four
canonical 2'-deoxyribonucleoside triphosphates, and one of four
ribonucleoside triphosphates under deoxy-/ribonucleotide ratios and
conditions that result in about 2% ribonucleotide substitution at
each position. After alkali treatment to cleave the synthetic DNA
at the positions of partial ribosubstitution, the sequence was
determined by analyzing the fragments resulting from each reaction
following electrophoresis on a denaturing polyacrylamide gel.
Although most methods for sequencing nucleic acids employ DNA
polymerases, some work has also been reported on the use of T7 RNAP
and SP6 RNAP for transcription sequencing of DNA templates
beginning at the respective T7 or SP6 promoter sequence using
3'-deoxyribonucleoside-5'-triphosphates (Axelrod, V. D., and
Kramer, F. R., 1985), and Q-Beta replicase for sequencing
single-stranded RNA templates (Kramer, F. R., and Mills, D. R.,
1978). Also, 3'-O-methyl-ribonucleoside-5'-triphosphates have been
used for sequencing DNA templates with E. coli RNA polymerase
((Axelrod, V. D., et al., 1978). None of these techniques is
commonly used at present, perhaps in part, due to the difficulty to
obtain the 3'-deoxy- and 3'-O-methyl-nucleoside triphosphate
substrates, while 2',3'-dideoxyribonucleoside-5'-triphosphates that
are commercially available have not been found to be substrates for
wild-type (w.t.) RNA polymerases.
In view of the numerous applications involving in vitro nucleic
acid synthesis known in the art, it is useful to consider the
properties of the key nucleic acid polymerase reagents which make
these procedures possible, and which, if modified in their
essential properties, might improve these procedures.
One classification of nucleic acid polymerases relies on their
different template specificities (RNA or DNA), substrate
specificities (rNTPs or dNTPs), and mode of initiation (de novo or
primed). These designations usually refer to the template and
substrate specificities displayed in vivo during the fulfillment of
a polymerase's biological function.
In vitro, polymerases can display novel activities, albeit with
reduced efficiency and/or under non-physiological conditions. E.
coli DNA-directed DNA polymerase I, for example, can use RNA as a
template, although there is a concomitant .sup..about. 100-fold
increase in dNTP K.sub.m (Ricchetti and Buc, 1993). T7 DNA-directed
RNA polymerase can also use RNA as a template (Konarska and Sharp,
1989). These are not exceptional observations because it is a
general property of polymerases that they display relaxed template
specificity, at least in vitro.
While template specificity may be relaxed, polymerase substrate
specificity is normally extremely stringent. T7 DNAP, for example,
displays at least 2,000-fold selectivity for dNTPs over rNTPs, even
in Mn.sup.++ buffer which relaxes the ability of the polymerase to
discriminate between dNTPs and ddNTPs (Tabor and Richardson,
1989).
It has been reported that transcripts synthesized by a T7 RNAP
Y639F mutant in vivo yielded 1/2-1/3 of the protein per transcript
compared to transcripts synthesized by the wild-type enzyme
(Makarova, et al., 1995). The latter phenotype was unique to the
Y639F mutant amongst a number of other active site mutants examined
for in vivo expression, and indicated that Y639F transcripts
contained a defect that led to their being inefficiently
translated.
A polymerase with an altered substrate specificity would be useful
in many molecular biological applications, such as creating a
nucleic acid molecule comprising at least one non-canonical
nucleotide.
SUMMARY OF THE INVENTION
We disclose herein the identification of mutant polymerases, such
as T7-type RNAPs, that display the ability to use dNTPs. The
mutations occur in tyrosine 639 within motif B (Delarue, et al.,
1990) of T7 RNAP.
We have characterized the ability of the Y639 mutants, as well as a
large number of other active site mutants, to use dNTPs in both
Mg.sup.++ and Mn.sup.++ buffers. Our results point to a specialized
role for tyrosine 639 in T7 RNAP--and the corresponding amino acid
in other polymerases--in insuring that substrates to be added to
the growing nucleic acid have the correct structure. The results
reveal that both transcript and substrate structure affect the
efficiency with which the transcript is extended and show that the
restriction of unprimed initiation to RNA polymerases is not due to
an intrinsic property of ribo- vs. deoxynucleotides, but simply to
the selectivity of the polymerase active site. The present
invention provides researchers with novel polymerase reagents and
improved methods that expand the structural range of nucleic acids
that can be enzymatically synthesized in vitro.
The present invention requires a polymerase with a reduced
discrimination between canonical and non-canonical nucleoside
triphosphates. In a preferred embodiment of the present invention,
the polymerase has a reduced discrimination between rNTPs and
dNTPs. In an especially preferred embodiment, the reduced
discrimination is at least 10-fold compared to wild-type
enzymes.
In one embodiment, the present invention is a method for
synthesizing a nucleic acid molecule that comprises at least one
non-canonical nucleotide. This method comprises the steps of
incubating a template nucleic acid in a reaction mixture suitable
for nucleic acid polymerization containing a mutant nucleic acid
polymerase and the appropriate canonical and non-canonical
nucleoside triphosphates which are substrates for a mutant nucleic
acid polymerase and which are desired to be incorporated into the
synthesized nucleic acid molecule.
In an especially preferred form of this method, the synthesized
nucleic acid molecule has an altered susceptibility to a nuclease
compared to a nucleic acid which could be synthesized using the
corresponding non-mutant nucleic acid polymerase with canonical
nucleoside triphosphates.
The present invention is also a method for determining the sequence
of a nucleic acid molecule using a mutant RNA polymerase.
The method comprises synthesizing a nucleic acid molecule, either
de novo from a promoter, or by extending a primer annealed to the
template molecule in four separate reactions. The four separate
reactions each have all 4 rNTPs and a portion of a ddNTP, or have
all 4 dNTPs and a portion of a ddNTP, or have 4
2'-fluorine-substituted NTPs and a portion of a ddNTP. Chain
termination will occur and the products may be evaluated so that
the sequence of the template molecule may be deduced. In one
embodiment of this method, the reactions which include a ddNTP
occur in the same reaction mixture and are linked to a method for
nucleic acid amplification, including, but not limited to, NASBA,
3SR, TMA, or other similar methods.
The present invention is also a partial ribo-substitution method
for determining the sequence of a nucleic acid molecule. This
method comprises synthesizing a nucleic acid molecule, either de
novo from a promoter or by extending a primer annealed to the
template molecule in four separate reactions. The reactions each
have, either four dNTPs and a portion of an rNTP or four 2'-F-NTPs
and a portion of an rNTP, or four different non-canonical
nucleoside triphosphates, wherein these nucleoside triphosphates
have substituents different than a hydroxyl group at the 2'
position of the ribose and which the mutant polymerase can use as
substrates for synthesis in nucleic acids, and a portion of an
rNTP. The reaction products are then cleaved at sites containing an
incorporated rNTP by using an alkaline solution or an RNase, and
the cleaved nucleic acid fragments are separated according to size
so that the sequence of the template molecule may be
determined.
The present invention is also embodiments of a partial
ribo-substitution method wherein the nucleic acid synthesis
reactions of said method occur in the same reaction mixture and are
also part of or linked to a method for nucleic acid amplification,
including, but not limited to, NASBA, 3SR, TMA, or other similar
methods.
In still other embodiments of the present invention, the products
of either 1, 2, 3, or 4 of the dideoxy-sequencing reactions or of
the partial ribo-substitution sequencing reactions are performed or
analyzed to determine the presence or absence of a particular
nucleic acid, or its relatedness to another nucleic acid, or
whether it contains a mutation compared to another nucleic
acid.
The present invention is also a kit for performing any of the
above-identified methods.
It is an object of the present invention to provide a mutant
polymerase capable of altered discrimination between canonical and
non-canonical nucleoside triphosphates.
It is an object of the present invention to provide an improved DNA
sequencing method.
It is an object of the present invention to provide a method to
detect the presence of a nucleic acid.
It is an object of the present invention to provide a method to
detect the identity of a nucleic acid.
It is an object of the present invention to provide a method to
detect mutations in a nucleic acid.
It is an object of the present invention to minimize the steps
involved in amplifying and sequencing, detecting, identifying and
detecting mutations in nucleic acids.
It is another object of the present invention to provide a method
for synthesizing nucleic acid molecules with altered nuclease
susceptibility.
It is another object of the present invention to provide a method
for synthesizing nucleic acid molecules comprising at least one
non-canonical nucleoside triphosphate.
Other objects, features and advantages of the present invention
will become apparent after examination of the specification, claims
and drawings.
DESCRIPTION OF THE DRAWINGS
FIG. 1 diagrams the transcription products produced by Y639F and
w.t. T7 RNAP in the presence of various combinations of rNTPs and
dNTPs.
FIG. 2 shows the effect of dGTP substitution on transcription by
the w.t. and Y639F polymerase.
FIG. 3 shows the effects of single-strandedness and sequence in the
initially transcribed region on the activity of Y639F in reactions
with 4 rNTPs or 4 dNTPs.
FIG. 4 shows transcription by Y639F and w.t. polymerase with dGTP
or rGTP on poly(dI).poly (dC).
FIG. 5 shows primed synthesis of DNA and RNA with Y639F and the
w.t. polymerase.
FIG. 6 shows relative elongation rates of Y639F in "4 rNTP" and "3
rNTP+1 dNTP" reactions.
FIG. 7 is a diagram of the mutagenesis strategy involved in
creating a mutant SP6 RNA polymerase.
DESCRIPTION OF THE INVENTION
Definitions
By "mutant polymerase" is meant a nucleic acid polymerase which has
at least one altered amino acid compared to the corresponding
wild-type polymerase, wherein said mutation or alteration results
in the mutant polymerase having a reduced discrimination between
non-canonical and canonical nucleoside triphosphates as
substrates.
By "template" we mean a macromolecular pattern or mold for the
synthesis of another macromolecule, composed of a sequence of
nucleotides, either rNTPs or dNTPs, that serves to specify the
nucleotide sequence of another structure.
"Nucleotide" refers to a base-sugar-phosphate compound. Nucleotides
are the monomeric subunits of both types of nucleic acid polymers,
RNA and DNA. "Nucleotide" refers to ribonucleoside triphosphates,
rATP, rGTP, rUTP and rCTP, and deoxyribonucleoside triphosphates,
such as dATP, dGTP, dTTP, dCTP.
As used herein, "nucleoside" refers to a base-sugar combination
without a phosphate group. "Base" refers to the nitrogen-containing
base, for example adenine (A), cytidine (C), guanine (G) and
thymine (T) and uracil (U).
"Incorporation" refers to becoming a part of a nucleic acid
polymer. There is a known flexibility in the terminology about
incorporation of nucleic acid precursors. For example, the
nucleotide dGTP is a deoxyribonucleoside triphosphate. Upon
incorporation into DNA, it becomes a dGMP, or deoxyguanosine
monophosphate moiety. Although there is no dGTP molecule in DNA,
one may say that one incorporates dGTP into DNA.
As defined herein, a "canonical" nucleoside triphosphate for an
RNA
polymerase ("RNAP") consists of any ribonucleoside-5'-triphosphate
("rNTP" or "NTP") which has an hydroxyl group at the 2'-position of
the sugar, including, but not limited to, the four common
ribose-containing substrates for an RNA polymerase -ATP, CTP, GTP
and UTP. A 2'-deoxyribonucleoside-5'-triphosphate ("dNTP") which
has hydrogen at the 2'-position of the sugar, including, but not
limited to, the four common deoxyribose-containing substrates
(dATP, dCTP, dGTP and dTTP, also known as "TTP") for a DNA
polymerase ("DNAP") is defined herein as a "non-canonical"
nucleoside-5'-triphosphate or a "non-canonical NTP" or a
"non-canonical nucleotide" or a "non-canonical deoxynucleotide" or
a "non-canonical triphosphate" or a "non-canonical substrate" for
an RNA polymerase. On the other hand, a "canonical" nucleoside
triphosphate for a DNAP consists of any dNTP which has a hydrogen
at the 2'-position of the sugar, while an rNTP is defined as a
"non-canonical NTP" or a "non-canonical nucleotide" or a
"non-canonical substrate" for a DNAP. The terms "canonical" and
"non-canonical" are meant to be used herein only with reference to
the 2' position of the sugar. Thus, as defined herein,
2',3'-dideoxynucleoside-5'-triphosphates ("2',3'-ddNTPs" or
"ddNTPs") are "non-canonical" substrates for an RNAP, but are
defined as "canonical" for a DNAP. Further, any other substituent
than an hydroxyl group at the 2'-position of ribose or a hydrogen
at the 2'-position of deoxyribose, including, but not limited to, a
fluorine ("F" or "fluoro" group) or an amino group, would be
defined as "non-canonical" for both RNAPs and DNAPs herein. The
terms "canonical" or "non-canonical" also are not meant to refer to
the nucleic acid bases attached to the sugar moieties. Thus, for
example, other natural or modified nucleic acid bases attached to
the 1'-position of ribose-5'-triphosphate would still be defined as
"canonical" herein.
By "a (mutant) nucleic acid polymerase (enzyme) with reduced
discrimination between canonical and non-canonical nucleoside
triphosphate substrates", we have a specific quantitative
definition calculated as follows:
1. One first determines the K.sub.m and the k.sub.cat for each
enzyme (mutant and wild-type) using the non-canonical nucleotide as
a substrate and using the canonical nucleotide as a substrate, as
was described previously (Patra, et al., 1992). The value "K.sub.m
" expresses how readily the enzyme will bind the substrate (a
larger K.sub.m implies weaker binding) and "k.sub.cat " expresses
the rapidity with which the substrate, once bound by the enzyme, is
reacted upon.
2. One next calculates the numerical value for k.sub.cat /K.sub.m
for each enzyme and for each substrate. By broad scientific
consensus, the specificity of an enzyme for a substrate is felt to
be most suitably expressed by this ratio.
3. For each enzyme, one then calculates the numerical value
obtained by using the value of k.sub.cat /K.sub.m for the canonical
substrate in the numerator and k.sub.cat /K.sub.m for the
non-canonical substrate in the denominator. This number indicates
how much a given enzyme discriminates between the two substrates.
For example, if this value equals 1, then the enzyme uses both the
canonical and the non-canonical substrates equally well; it does
not discriminate between the two substrates. If this value is
greater than 1, then the enzyme discriminates by that factor
between the two substrates; for example, if the value is 100, then
the enzyme discriminates by a factor of 100 in favor of the
canonical substrate compared to the non-canonical substrate.
Similarly, a value less than 1 means that the enzyme discriminates
in favor of the non-canonical substrate over the canonical
substrate.
4. Finally, one compares the numerical value calculated in step 3
above for the wild-type (w.t.) enzyme with the value calculated in
step 3 for the mutant enzyme. If the value calculated for the
mutant enzyme is less than the value calculated for the wild-type
enzyme, then the mutant enzyme "has a reduced discrimination for
the non-canonical substrate compared to the wild-type enzyme." For
example, if the values calculated in step 3 are 100 for the
wild-type enzyme and 10 for the mutant enzyme, then the
discrimination of the mutant enzyme in favor of the canonical
substrate (or against the non-canonical substrate) is reduced
10-fold compared to the discrimination of the wild-type enzyme.
We have found that for wild-type T7 RNAP, the average of the
k.sub.cat /K.sub.m values for the four common rNTPs (ATP, CTP, GTP
& UTP) is about 120-fold larger than the average k.sub.cat
/K.sub.m values for the four common dNTPs (dATP, dCTP, dGTP and
dTTP); i.e., the wild-type enzyme discriminates by a factor of 120
for rNTPs vs. dNTPs. For the Y639F mutant enzyme, the average of
the k.sub.cat /K.sub.m values for the four common rNTPs is only
about 6-fold larger than the average k.sub.cat /K.sub.m values for
the four common dNTPs. Thus, using the average k.sub.cat /K.sub.m
values for these substrates, the Y639F mutant T7 RNAP enzyme has
about a 20-fold reduced discrimination between dNTPs and rNTPs.
However, it is recognized that the difference in discrimination
between wild-type and mutant enzymes will vary depending on the
non-canonical substrates and the mutant enzymes used. Therefore,
for the purposes of this invention, we herein define "a (mutant)
nucleic acid polymerase (enzyme) with reduced discrimination
between canonical and non-canonical nucleoside triphosphate
substrates" as "a polymerase which has at least a 10-fold reduced
discrimination compared to the corresponding wild-type enzyme for
non-canonical nucleotides compared to canonical nucleotides,
wherein the respective values for discrimination between canonical
and non-canonical substrates is calculated using the average of the
k.sub.cat /K.sub.m values for all four rNTPs and all four
dNTPs."
By "T7-type RNA polymerases" we mean T7, T3, .phi.I, .phi.IIH, W31,
gh1, Y, A1122, SP6 and mitochondrial RNAPs.
In General
There are many reasons to synthesize nucleic acid molecules
containing at least one non-canonical nucleotide. For example,
incorporation of a non-canonical nucleotide may make the synthetic
nucleic acid more resistant and therefore, more stable, to a
nuclease, such as a ribonuclease. Also, one may wish to incorporate
one or more non-canonical nucleotides which, for example, change
the nuclease digestion pattern so that the product nucleic acid is
easier to detect or characterize. For example, because RNase A
cleaves RNA only after C or U, replacement of one or both of these
rNMPs by a dNMP or other non-canonical nucleotide that is resistant
to cleavage by RNase A would alter the digestion pattern of the
nucleic acid.
There are many uses for nucleic acids which have one or more of
these properties, such as nuclease resistance. For example, nucleic
acids containing at least one non-canonical nucleotide may have
advantages for use as ribozymes, or as nucleic acid molecules used
for gene therapy, in a vaccine, in an antiviral composition, in an
antimicrobial composition, in an anti-sense composition for
regulating gene expression, in a composition for hybridization to a
complementary nucleic acid, including as a primer, or as a probe
for detection of a complementary nucleic acid for a variety of
purposes.
Some nucleic acid molecules, such as those of mixed dNMP/rNMP
composition, are highly useful for certain applications, but are
presently difficult or impossible to produce on a practical scale.
Thus, improved methods for synthesizing such nucleic acid molecules
in vitro would be highly desirable. For example, probes of mixed
DNA-RNA-DNA composition for the Cycling Probe Assay (Duck, P. G.,
et al., 1990) are currently made using difficult chemical
methods.
We describe herein previously-unknown properties of T7-type RNA
polymerases having a non-wild-type amino acid at specific positions
within the polypeptides. We found that altering the amino acid at
these specific positions results in mutant polymerases having at
least a 10-fold reduced discrimination between
2'-deoxyribonucleoside-5'-triphosphates (dNTPs) and
ribonucleoside-5'-triphosphates (rNTPs) as substrates in in vitro
nucleic acid synthesis reactions compared to the corresponding
wild-type enzymes. We found that these mutant polymerases also have
reduced discrimination for other non-canonical nucleoside
triphosphate (NTP) substrates, including
2',3'-dideoxy-ribonucleoside-5'-triphosphates (ddNTPs) and
2'-fluoro-nucleoside-5'-triphosphates (2'-F-NTPs). Based on
knowledge of these novel properties, we have disclosed methods for
using these mutant polymerases for producing nucleic acid molecules
containing at least one non-canonical nucleotide and for
characterizing nucleic acid molecules by synthesizing nucleic acid
molecules containing at least one non-canonical nucleotide in
vitro.
In one preferred embodiment, the invention uses mutant RNA
polymerases that efficiently utilize deoxynucleoside triphosphates
as substrates. In vitro, this mutant will synthesize RNA, DNA, or
`transcripts` of mixed dNMP/rNMP composition from a template
molecule depending on the mix of NTPs or dNTPs present in the
synthesis reaction.
Mutant Polymerases of the Present Invention
In a preferred embodiment, the polymerase mutation is conservative,
for example, changing tyrosine 639 (of T7 polymerase) within the
active site to phenylalanine, and does not substantially affect
promoter specificity or overall activity. Non-conservative
mutations of this tyrosine also reduce discrimination between
deoxy- and ribonucleoside triphosphates, but these mutations also
typically cause large activity reductions. Among the most active of
the non-conservative mutations, enzymes with methionine or leucine
in place of the wild-type tyrosine at the 639 position of T7 RNAP
had about half the enzymatic activity of the wild-type enzyme.
Of 26 other mutations of other amino acid positions examined in and
around the active site of T7 RNAP, none showed marked effects on
rNTP/dNTP discrimination.
T7 RNA polymerase can use RNA templates as well as DNA templates
and is capable of both primer extension and de novo initiation. The
Y639F mutant, described below in the Examples, retains the ability
to use RNA or DNA templates. Thus, this mutant can display de novo
initiated or primed DNA directed DNA polymerase, reverse
transcriptase, RNA directed RNA polymerase, or DNA directed RNA
polymerase activities depending on the templates and substrates
presented to it in the synthesis reaction.
A major theme of research on nucleic acid polymerases over the past
several years has been the discovery of extensive structural
similarity between the majority of these enzymes, even those from
functionally different classes (Sousa, et al., 1993; Pelletier, et
al., 1994; Jacob-Molina, et al., 1993; Kohlstaedt, et al., 1992;
Sawaya, et al., 1994; Steitz, et al., 1994). One part of this work
has been the identification of well-conserved residues. Five amino
acids have been identified as invariant in a large number of
DNA-directed RNA polymerases (Delarue, et al., 1990). In T7 RNAP
these are D537, K631, Y639, G640A and D812. A specific, conserved
function has been revealed for the two invariant aspartates in
coordinating the catalytic Mg.sup.++ ion (Sousa, et al., 1993;
Pelletier, et al., 1994; Jacob-Molina, et al., 1993; Kohlstaedt, et
al., 1993; Sawaya, et al., 1994; Steitz, et al., 1994). Our
observations imply a similarly specific and conserved function for
Y639 as a sensor of inappropriate geometry or structure in the
template-NTP-primer/RNA complex.
The present invention encompasses methods for synthesis of nucleic
acids containing at least one non-canonical nucleotide using mutant
nucleic acid polymerases which have reduced discrimination for
non-canonical nucleoside triphosphate substrates. The examples
below demonstrate the reduced dNTP/rNTP discrimination of mutants
of T7 RNA polymerase and SP6 RNA polymerase. Genes for other
polymerases may be modified or mutated to obtain mutant enzymes
which have similar reduced discrimination for non-canonical
substrates. If one wished to mutate an RNA polymerase to have the
properties described herein, one would first locate the amino acid
corresponding to the T7 polymerase Y639 in other RNA polymerases.
Identification of the corresponding mutation site in other
polymerases can be done by the well-established procedure of
sequence alignment, which involves aligning the amino acid
sequences of two proteins, introducing gaps and insertions, and
shifting the sequences with respect to each other while maintaining
their original linearity. Such alignment procedures are often
performed with the aid of one or more computer programs into which
the amino acid sequences that one wishes to compare have been
entered. When the sequence identity of two proteins is high enough
(greater than or equal to 30%) over a sufficient length of amino
acids (greater than or equal to 50), this procedure is very
reliable in identifying amino acids that occupy corresponding
structural and functional positions in the two proteins. Such
conditions are met for the T7-type group of RNAPs, which include
T7, T3, .phi.I, .phi.IIH, W31, gh1, Y, A1122, SP6 and mitochondrial
RNAPs, and allow identification of the mutation site corresponding
to Y639 in T7 RNAP.
Using this method, we predicted that the amino acid in w.t. SP6
RNAP that corresponded to the Y639 site in T7 RNAP was Y631, and as
described herein, mutagenesis of this site resulted in a Y631F
mutant SP6 RNAP which has a similar reduced discrimination for
dNTPs compared to rNTPs like the Y639F mutant T7 RNAP.
From alignment studies, it is known that there is a conserved motif
present in T7-like RNAPs and class I DNAPs with the following
consensus sequences:
. . K . . . Y G . .
where Y is the tyrosine at amino acid number 639 in the T7 RNA
polymerase protein. The same consensus sequence is observed in the
SP6 RNA polymerase and T3 RNA polymerase proteins where a K
(K=lysine) is succeeded by 7 amino acids and a Y G (G=glycine). In
SP6 RNA polymerase the Y is at amino acid number 631 in the
polypeptide chain, and in T3 RNA polymerase it is at amino acid
number 573. By mutating the codon for Y631 in SP6 RNA polymerase
such that a phenylalanine is at this position, the expected
phenotypic change was realized.
In summary, one may locate the corresponding mutation site in other
RNAPs by aligning the amino acid sequence of a T7-like RNAP, chosen
from among T7, T3, .phi.I, .phi.IIH, W31, gh1, Y, A1122, SP6 and
mitochondrial RNAPs, against the conserved motif given above and
identifying which position corresponds to the Y639 position in T7
RNAP.
As stated above, the conserved motif is also present in class I
DNAPs. While a structure of T7 RNAP complexed with NTP is not
available, the structure of the homologous Klenow fragment of DNAP
I with dNTP has been obtained (Beese, et al., 1993). This structure
demonstrated that the amino acids encompassed within the
above-mentioned conserved motif (i.e., amino acid residues 758 to
767 of E. coli DNAP I) are in proximity to the deoxyribose sugar of
the dNTP, so that it is reasonable that mutations within this motif
might affect the ability of a DNAP to discriminate between dNTPs
and rNTPs. However, one of the present inventors found that when a
mutation was made which changed the amino acid at the position in a
class I DNAP corresponding to the Y639 mutation in T7 RNAP, the
mutant DNAP retained enzymatic activity, but did not have a reduced
discrimination for rNTPs compared to dNTPs. Thus, it is not obvious
what mutations, if any, would result in a class I DNAP having
reduced discrimination for rNTPs vs. dNTPs, even if it is
reasonable to assume that such a mutation would occur within the
above-mentioned conserved motif (residues 758 to 767 of E. coli
DNAP I) which the structure shows to be in proximity to the
dNTP.
Because the structure of the Klenow fragment of DNAP I complexed
with dNTP was determined (Beese, et al., 1993), researchers have
believed that the homologous conserved motif of T7 RNAP (i.e.,
amino acid residues 631-640) is likely to be in proximity to the
ribose moiety of an NTP, as the case for the DNAP I. Nevertheless,
prior to the work of the present invention, it was not possible to
know which mutation, if any, might result in a reduced
discrimination for dNTPs vs. rNTPs. Since the Y639 mutation of T7
RNAP was identified, as presented herein, one of the present
inventors has modeled NTP in T7 RNAP (Huang, et al., submitted for
publication) based on the structures of the homologous Klenow
fragment of DNAP I complexed with dNTP (Beese, et al., 1993) and of
RT complexed with primer-template (Jacabo-Molina, et al., 1993).
Models based on either structure agree in placing the ribose close
to Y639, and in revealing no other side chain capable of
discriminating the hydrogen bonding character of the 2'-substituent
within 5 angstroms of the 2'-group of the NTP. Thus, the
model is consistent with our results related to a reduced
discrimination of Y639 RNAP mutants for dNTPs vs. rNTPs, even
though additional studies (Huang, et al., submitted for
publication) have determined that the hydrogen bonding character is
not the only factor involved in dNTP/rNTP discrimination.
Less is known about non-T7-type RNAPs. For many, the amino acid
sequences are not known. Non-phage-encoded host bacterial RNA
polymerases are complex multi-subunit proteins. A nucleotide
polymerization site has been localized in the .beta. subunit of E.
coli RNA polymerase although participation of other subunits is not
ruled out. In order to determine the site in a non-T7-like RNAP
which would result in a reduced dNTP/rNTP discrimination, one would
first use the above-described procedure of alignment to determine
if the
. . K Y G ... motif was present. If so, it may be possible to
obtain the desired mutation in the same manner as for T7-like
RNAPs. However, if the conserved motif is not present, one may
obtain the desired mutation with greater difficulty by random
mutagenesis and enzyme assay screening in order to find a change or
changes that result in reduced dNTP/rNTP discrimination.
Once one has determined where the corresponding Y639 site is in the
polymerase one wishes to mutate, one would use standard methods in
the art of molecular biology to create an amino acid substitution.
As disclosed above, a conservative substitution is preferable. For
example, a substitution of a phenylalanine for a tyrosine is most
preferable. The Examples below disclose a method for creating a
mutant polymerase, but one of skill in the art will realize that
there are many substitute methods of equal effectiveness.
Methods of the Present Invention
In one embodiment, the present invention is a method for using a
mutant polymerase for synthesizing in vitro a nucleic acid molecule
which comprises at least one non-canonical nucleotide in place of
at least a portion of the canonical nucleotides. The method
comprises the steps of incubating a template nucleic acid in a
reaction mixture containing a mutant nucleic acid polymerase which
has reduced discrimination between canonical and non-canonical
nucleoside triphosphates, including between dNTPs and rNTPs, and
the appropriate canonical or non-canonical nucleoside triphosphates
which are substrates for the nucleic acid polymerase. One then
follows standard polymerase reaction protocols and creates the
synthesized nucleic acid molecule.
Preferably, the reactions also contain inorganic pyrophosphatase,
which is known to increase the yields in in vitro transcription
reactions (Cunningham, P. R. and Ofengand, J., 1990) and to reduce
pyrophosphorolysis in in vitro DNA synthesis reactions (Tabor, S.,
and Richardson, C. C., 1990), as well as buffers and other
components which are known to those of skill in the art to be
optimal for the particular w.t. polymerase used. Cunningham and
Ofengand (1990) provide an example of conditions which may be used
for unprimed synthesis with T7 RNA polymerase or mutant T7 RNAPs,
although one of skill in the art will recognize, with respect to
reactions with these enzymes or other enzymes, the need to optimize
the concentrations and ratios of canonical and non-canonical NTP
substrates according to the respective K.sub.m and application and
to modify reaction conditions, such as temperature, amount of
enzyme, salt concentration, or divalent cation (e.g., Mg2+ or Mn2+)
concentration, in order to produce improved results such as higher
yield or a greater percentage of full-length products.
In a preferred form of this method, the resulting synthesized
nucleic acid molecule has a different susceptibility to a nuclease
compared to a nucleic acid synthesized by the corresponding
non-mutant nucleic acid polymerase under identical reaction
conditions with canonical substrates. By "different susceptibility"
we mean to include reduced, increased, or, in the case of synthetic
nucleic acids containing both canonical and non-canonical
nucleotides, altered susceptibility to a nuclease, which may be
either a DNAse or RNAse. The nature of the reduced, increased or
altered susceptibility to a nuclease is also related to the
properties of the nuclease. For example, a nucleic acid resistant
to RNase A, which cleaves RNA only after C or U, may be synthesized
using fewer non-canonical nucleotides (e.g., dNTPs or 2'-F-NTPs)
than a nucleic acid which is resistant to RNase I, which cleaves
after every base.
In a preferred form of the present invention, the resulting
synthesized nucleic acid is a ribozyme or a nucleic acid molecule
used for gene therapy, in a vaccine as an antiviral composition, in
an antimicrobial composition, as an antisense composition for
regulating gene expression, in a composition for hybridization to a
complementary nucleic acid, such as for a primer, or as a probe for
detection of a complementary nucleic acid.
The resulting synthesized nucleic acid may be either single- or
double-stranded.
The present invention is also a kit for performing the method of
synthesizing a nucleic acid containing at least one non-canonical
nucleotide. Typically, the kit contains a mutant nucleic acid
polymerase with a reduced discrimination for non-canonical compared
to canonical substrates and data or information describing
conditions under which the method may be performed.
The present invention is also improved methods for sequencing
nucleic acids using a mutant nucleic acid polymerase of the present
invention.
Because 2',3'-dideoxynucleotides are not substrates for wild-type
RNA polymerase, it previously has not been possible to use the
Sanger method for determining the sequence of a nucleic acid with
an RNA polymerase, although 3'-deoxy- or 3'-hydroxymethyl analogs
have been used as terminators for Sanger-like sequencing with RNA
polymerases.
However, 2',3'-ddNTPs are substrates for the mutant nucleic acid
polymerases of this invention which can also utilize both rNTPs and
dNTPs as substrates, and the present invention is also a method for
sequencing nucleic acid molecules (DNA or RNA) using a mutant
nucleic acid polymerase and 2',3'-ddNTPs as terminators.
In one embodiment of this method, the nucleic acid to be sequenced,
whether DNA or RNA, is used as a template for in vitro nucleic acid
synthesis from a primer (i.e., primed synthesis) using a mutant RNA
polymerase which has a reduced discrimination for dNTPs compared to
rNTPs. Each of four different reactions also contains an amount of
at least one nucleoside triphosphate corresponding to each nucleic
acid base represented in either DNA or RNA, chosen from among the
2'-deoxynucleotides dATP, dCTP, dGTP and dTTP or dUTP, or the four
common ribonucleotides ATP, CTP, GTP and UTP, or the
2'-fluorine-substituted nucleotides 2'-F-ATP, 2'-F-CTP, 2'-F-GTP
and 2'-F-UTP or 2'-F-TTP. A 2',3'-dideoxynucleotide is also
included in each in vitro nucleic acid synthesis reaction in an
amount that will result in random substitution by the
dideoxynucleotide of a small percentage of the corresponding rNTP,
dNTP or 2'-F-NTP that is present in the reaction and that would be
incorporated into the synthetic nucleic acid in a
template-dependent fashion.
Thus, each DNA synthesis reaction yields a mixture of DNA fragments
of different lengths corresponding to chain termination wherever
the dideoxynucleotide was incorporated in place of the ribo-,
2'-deoxy- or 2'-fluoro- nucleotide. The DNA fragments are labelled,
either radioactively or non-radioactively, by one of several
methods known in the art and the label(s) may be incorporated into
the DNA by extension of a labelled primer, or by incorporation of a
labelled ribo-, deoxy-, 2'-fluoro- or 2',3'-dideoxynucleotide.
By carrying out DNA synthesis reactions for each of the
dideoxynucleotides (ddATP, ddCTP, ddGTP and ddTTP or ddUTP), then
separating the products of each reaction in adjacent lanes of a
denaturing polyacrylamide gel or in the same lane of the gel if
different distinguishable labels are used for each separate
reaction, and then detecting those products by one of several
radioactive or non-radioactive methods known in the art, the
sequence of the DNA template can be read directly. Also, other
matrices than polyacrylamide which separate the fragments based on
size may be used. Those with skill in the art will also recognize
that other nucleotide analogs generally used for reducing
sequencing compressions, such as ribo-, deoxy- or 2'-fluoro-
nucleoside triphosphates containing 7-deaza-guanine or inosine, may
also be used in place of the ribo-, deoxy- or 2'-fluoro-nucleotide
for which the respective analog is used.
The present invention also comprises another embodiment of this
method for sequencing using 2',3'-ddNTPs and a mutant RNA
polymerase which has a reduced discrimination for dNTPs compared to
rNTPs. In this embodiment of the method, the nucleic acid to be
sequenced, whether DNA or RNA, is used as a template for de novo
(i.e., unprimed) in vitro nucleic acid synthesis beginning at an
RNA polymerase promoter. In this embodiment, a primer is omitted
from the reactions and depending on the promoter sequence, in
addition to the other components used in the first embodiment, an
amount of a dinucleoside tetraphosphate or a trinucleoside
penta-phosphate may be added as an initiating nucleotide (Moroney
and Piccirilli, 1991) so that the majority of nucleic acid
synthesis is initiated from a single site. Because no primer is
used, the labelling of the sequencing products must be carried out
by one of the other methods envisioned and discussed with respect
to the first embodiment of the method or by incorporating a label
into or on an initiating dinucleotide or trinucleotide. In other
respects, the second embodiment of this sequencing method of the
invention is similar to the first embodiment of the method.
The present invention also comprises methods of sequencing nucleic
acids by part al ribo-substitution using mutant nucleic acid
polymerase which have a reduced discrimination between
non-canonical and canonical nucleotides. These methods have
advantages over the partial ribo-substitution sequencing method
described by Barnes (1977), which relied on the use of a
Mn2+-containing reaction buffer to relax the ability of a wild-type
DNA polymerase to discriminate between dNTPs and rNTPs. Further,
only DNA was used as a template for this method and de novo (i.e.,
unprimed) nucleic acid synthesis was not envisioned. In contrast,
the ribo-substitution sequencing method of the present invention
uses a mutant nucleic acid polymerase which has an inherent reduced
discrimination between dNTPs and rNTPs and, although it may be
included, Mn2+ is not required in the sequencing reactions. In
still another embodiment, 2'-fluorine-substituted NTPs are used in
place of dNTPs in the ribo-substitution reaction. Embodiments of
the method of the present invention also include sequencing using
either DNA or RNA as templates and sequencing using either nucleic
acid primers or de novo nucleic acid synthesis from an RNA
polymerase promoter sequence.
Since incorporation of the sequence-delimiting ribonucleotide does
not terminate nucleic acid synthesis during partial
ribo-substitution sequencing, all of the radioactive or
non-radioactive label must be incorporated into the sequencing
reaction products prior to incorporation of the first
ribonucleotide in order to avoid multiple labeled produced from
each nucleic acid molecule synthesized. Multiple labeled products,
starting from different positions on the template, would make it
difficult or impossible to interpret sequence results. Thus,
labeling of nucleic acid products for partial ribo-substitution
sequencing must be accomplished by means such as incorporating the
label into a primer, when used, or into an initiating di- or tri-
nucleotide, or by prelabelling in the presence of an amount of a
labeled nucleotide which will be used up or destroyed and/or
limiting 2'-deoxy- or 2'-fluoro-nucleotides prior to addition of
the sequence-delimiting rNTPs.
We envision sequencing reactions wherein all of the distinguishable
non-radioactive labels in, or attached to, or connected with, the
products from more than one of the reactions, up to and including
all four of the sequencing reactions for a template, or even
reactions from multiple templates if distinguishable
non-radioactive labels are present, are detected in or from a
single lane of a sequencing gel or a single capillary
electrophoresis tube or a single matrix or means of any kind using
an automated sequencer or other detection device.
EXAMPLE
Example 1: Creation and Characterization of a Mutant T7 RNA
Polymerase
A. Materials and Methods
Nucleic acids and NTPs: Nucleotides were from Pharmacia or
USB/Amersham. Polynucleotides were from Pharmacia and the Midland
Certified Reagent Company. Synthetic DNAs were prepared at the
UTHSCSA DNA synthesis facility on an Applied Biosystems DNA
synthesizer and purified by HPLC. A synthetic RNA 12mer was from
the Midland Certified Reagent Company. Plasmids pT75 (Tabor and
Richardson, 1985) and pBS (Stratagene Inc.) were purified from E.
coli by alkaline-lysis and cesium chloride gradient centrifugation
(Sambrook, et al., 1989). Radioactive nucleotides were from NEN
Dupont or ICN.
Preparation and purification of mutant polymerases: Construction,
expression, and purification of the T7 RNAP mutants was described
previously (Bonner, et al., 1992).
Transcription reactions: Transcription reactions were carried out
in 40 mM Tris-Cl pH 8.0, 15 MM MgCl.sub.2, and 5 mM DTT or 20 mM
Manganese Citrate pH 8.0, 5 mM DTT at 37.degree. C. Template,
polymerase, and NTP concentrations were as indicated in the legends
to the figures and tables. Relative activity determinations were
made by taking 4 .mu.l aliquots of reactions at 5, 10, and 20
minute time points and spotting on to DE81 filter paper.
Unincorporated nucleotides were separated from incorporated
nucleotides by washing the filter paper with 0.5 M KH.sub.2
PO.sub.4 pH 7.0 and retained radioactive nucleotide was quantitated
with a Molecular Dynamics phosphorimager. Radioactive NTPs used
were as indicated in figure and table legends. To evaluate
rNTP/dNTP selectivity, reactions were run with 4 rNTPs and pT75 as
template and .alpha.-P.sup.32 rNTPs or .alpha.-P.sup.32 dNTPs were
used to label the transcripts. The relative rate of incorporation
of an rNTP vs. its cognate dNTP was determined from the relative
percentages of labeled rNTP vs. dNTP incorporated into DE81
retainable RNA at 5, 10, and 20 minute time points. Apparent
miscoding frequencies were determined similarly, though in this
instance the template was a single-stranded homopolymer and the
reaction contained the complementary unlabeled rNTP, and
complementary .alpha.-P.sup.32 rNTP or one of the 3
non-complementary .alpha.-P.sup.32 rNTPs. The relative percentages
of labeled complementary vs. non-complementary rNTPs incorporated
at 5, 10 and 20 minute time points gave an apparent miscoding rate.
The rNTP/dNTP selectivity assay was used to test the following T7
RNAP mutants for effects on substrate discrimination: D537S, D537E,
S539A, R551S, D552S, R627S, K631S, L637A, Y639S, Y639F, Y639A,
G640A, F644A, G645A, Q649S, H810S, H811S, H811A, D812A, D812E,
D812S, D812N, D879E+.DELTA.F882+.DELTA.A883,
D879E+A881T+.DELTA.A883, D879E+F884+A885, D879E+F882Y,
D879E+.DELTA.A883, D879E+F882W, D879E.
Elongation rate determinations were carried out as described
(Golomb & Chamberlin, 1974) with some variations (Bonner, et
al., 1994).
Determination of NTP K.sub.m and k.sub.cat was as described
previously (Patra, et al., 1992).
B. Results
Structure of the transcripts synthesized by Y639F and the w.t.
enzyme with rNTPs and dNTPS: FIG. 1 diagrams the structure of
transcription products produced by Y639F and w.t. T7 RNAP in the
presence of various combinations of rNTPs and dNTPs. The template
was pT75 (Tabor and Richardson, 1985) cut with HindIII so that
transcription from its T7 promoter generates a 59-base run-off
transcript. Electrophoresis was on a 20% polyacrylamide 6M urea
gel. Plasmid and polymerases were at concentrations of 10.sup.-7 M,
and NTP concentrations were 0.5 mM (all rNTPs and dTTP), 1 mM
(dATP, dGTP), or 5 mM (dCTP). .gamma.-P.sup.32 -GTP was added to
radiolabel the transcription products. Wild-type (WT) or Y639F
mutant (Mu) polymerases and NTPs used are as indicated. Poly-rG
products of various sizes are labeled in lane A ("2G", "3G", etc .
. . ) and heterogeneous sequence abortive transcripts of different
lengths are indicated by "4H", "5H", etc . . . in lane c. Lanes q-t
are a 10-fold longer exposure of lanes m-p.
FIG. 1 shows transcription reactions carried out with the w.t.
enzyme or
the Y639F mutant polymerase and a T7 .phi.-10 promoter template.
Transcription by T7 RNA polymerase, like other RNA polymerases, is
characterized by an initial, poorly processive `abortive` phase of
transcription during which the short, nascent transcript frequently
dissociates from the ternary complex. When the transcript reaches a
length of .sup..about. 9 bases transcription becomes highly
processive and the transcript becomes stably associated with the
elongation complex. On this promoter, which initiates with
GGGAGACCGGAAU (SEQ ID NO:1), T7 RNAP can also synthesize long
poly-G ladders (labeled "2G", 3G", etc. in lanes a and b) when rGTP
is the sole NTP present (Martin, et al., 1988). Lanes c and d of
the electrophoretic gel display the transcription products typical
of runoff reactions counting all 4 rNTPs: there are abortive
transcripts ranging up to 8 bases in length and a 59-base runoff
product. The 4mer length the sequences of the poly-G transcripts
and the abortive transcripts made in the presence of all 4 rNTPs
(labeled "4H", "5H", etc.) diverge and no longer co-migrate with
the poly-G transcripts of equivalent size.
When rATP is omitted from the transcription reactions (lanes e and
f) normal elongation of the initially synthesized GGG trimer cannot
occur. There are no heterogenous sequence abortive transcripts or
59 base runoff products made and instead long poly-G transcript s,
as in lane a, are made. Adding dATP to reactions lacking rATP does
not change the transcripts produced by the w.t. enzyme (lane g).
However, with the mutant enzyme we observed that addition of dATP
(lane h) allows synthesis a long runoff transcript as well as
synthesis of heterogenous sequence abortive transcripts that do not
co-migrate with the poly-G transcripts. Observation of an abortive
transcript in lane h running near the position of the "4H" band in
lane d confirms extension of the GGG trimer with an A but note that
the major 4mer transcript in lane h migrates close to, but not
precisely with, the major 4mer in lane d or in adjacent lane i.
This is consistent with the expectation that these 4mers will have
identical sequence and length but different structure (i.e.,
rGrGrGrA in lanes d or i; rGrGrGdA in lane h). It should also be
noted that some poly-G transcript synthesis is observed in lane h.
For example, in lane h we observe both a heterogeneous sequence
4mer migrating near the "4H" position and a smaller amount of 4mer
band migrating at the "4G" position. When 4 rNTPs are present
(lanes c or d) the synthesis of poly-G transcripts is more
completely suppressed. This indicates that dATP is utilized by
Y639F, but not as efficiently as rATP.
When rCTP is omitted from the reaction, transcripts terminate
predominately at the 6mer length because rCMP is normally first
incorporated at position 7 (lanes i, j). Addition of dCTP does not
allow extension of the 6mer in reactions with the w.t. enzyme (lane
k). However, addition of dCTP to reactions with Y639F allows
extension beyond the 6mer length and synthesis of the runoff
transcript (lane 1). Again, the following should be noted: 1. The
transcripts larger than 6 bases do not co-migrate with their
counterparts in lanes c or d consistent with the expected
structural difference despite length and sequence identity, 2.
there is more termination at the 6- and 7mer points in lane 1 than
in lanes c or d, indicating that Y639F uses dCTP well, but not as
efficiently as it utilizes rCTP.
In lanes m and n UTP was omitted from the reactions. Lanes q-t show
a 10-fold longer exposure of lanes m-p. Within the set of 4 NTPs,
UTP is unique on this template since it first becomes incorporated
into the transcript at the 13 base position. This corresponds to a
transcript length subsequent to the transition form abortive to
processive transcription. As a consequence of this transition, the
ternary complex becomes more stable (Martin, et al., 1988).
Therefore, when transcript extension is blocked during the
processive phase of transcription, the stalled ternary complex does
not rapidly dissociate (Shi, et al., 1988). Instead it remains
stalled on the template, near the promoter, and blocks
reinitiation. For this reason we observe a large decrease in the
overall amount of transcription when UTP is omitted from the
reaction in lanes m and n.
A longer exposure of lanes m and n (lanes q, r) does, however,
reveal transcription products of the expected structure. When TTP
is added to these reactions (lanes o, p, s, t) synthesis of the 59
base runoff transcript is observed with both the w.t. and Y639F
mutant.
The ability of the w.t. enzyme to extend transcripts with TTP when
it is unable to extend transcripts with the other dNTPs is also
likely to be related to unique position at which UTP/TTP first
becomes incorporated into the transcript. The amount of transcript
termination or extension that occurs with a particular dNTP depends
simply on the relative rates of ternary complex dissociation or
dNMP incorporation (McClure and Chow, 1980). During abortive
transcription complex, dissociation must be more rapid than the
rate at which the w.t. enzyme incorporates dNMPs into its
transcripts. During processive transcription even the expected slow
rate of dNMP incorporation by the w.t. enzyme must be competitive
with the slow rate of dissociation of the stable elongation
complex, and an ability of the w.t. enzyme to incorporate dNMPs
becomes manifest. Because elongation during the processive phase of
transcription is fast (.sup..about. 230 bases/sec, Golomb and
Chamberlin, 1974), while initiation and progression through
abortive transcription is slow (Martin and Coleman, 1987; Martin,
et al., 1988), elongation of the transcript from 11 to 59 bases is
expected to contribute less than 10% to the time required for
transcript synthesis. As a consequence the phase of transcription
during which TTP is incorporated may not be the rate limiting step
in synthesis of the runoff transcript even for the w.t. enzyme.
These considerations imply that one need not expect to see marked
differences in synthesis of a relatively short runoff transcript by
Y639F or the w.t. enzyme when TTP is substituted for UTP.
Lanes u and v show reactions in which two rNTPs have been
substituted with dNTPs (dATP and dCTP), and lanes w and x show
reactions in which three rNTPs have been substituted with dNTPs
(dATP, dCTP, and TTP). Synthesis of the 59 base runoff transcript
is observed with the mutant polymerase (lanes v and x) indicating
that Y639F can carry out synthesis even when 3 rNTPs are
substituted with dNTPs.
While the abortive transcript patterns in lanes v and x may largely
be described as a combination of the patterns observed in lanes h
and 1 there are some important distinctions. The transcript
patterns in lanes v and x reveal that the structure of the
transcript, as well as the structure of the NTP, affect the rate at
which NMPs are added to the transcript. For example, in lanes v and
x there is an increase in termination at the 6mer length relative
to lane 1 (the 6mer in lanes v or x runs slightly slower than the
poly-G 5mer in the adjacent lane). In lanes 1, v and x synthesis of
the 7mer involves incorporation of dCMP but in lanes v and x the
6mer contains a dAMP at its 3' end and in lane 1 it contains an
rAMP.
The increase in termination at the 6mer point in lanes v or x
indicates that the presence of a dNMP on the 3' end of the
transcript reduces the ability of the polymerase to further
incorporate NMPs. The high level of termination after synthesis of
the rGrGrGdA 4mer in lane h relative to the observed termination
after synthesis of the rGrGrGrA 4mer in lanes c or d similarly
indicates that the presence of deoxynucleotides in the transcript,
at least at the 3'-end, influences subsequent extension of the
transcript.
FIG. 2 shows the effect of dGTP substitution on transcription by
the w.t. and Y639F polymerase. Polymerases, template
(supercoiled(Sc) or HindIII linearized (Li) pT75), and NTPs were as
indicated. Polymerase and template concentrations and
electrophoresis conditions as in FIG. 1. Left panel: Labeling was
with .alpha.-P.sup.32 rGTP (a, d, g, j) or .alpha.-P.sup.32
dGTP(all other lanes). The runoff transcript from the HindIII-cut
template is indicated in lane f. Right panel: Labeling was with
.alpha.-P.sup.32 -rGTP (a, b, f, g) or .alpha.-P.sup.32 -dGTP (all
other lanes). Poly-rG and poly-dG products of various sizes are
indicated in lanes a, c, d. Alignment of these transcript patterns
with those in lanes b, c, h, and i in the left panel reveals that
the added complexity of the transcript pattern in the latter set of
lanes is due to the presence of a mixture of heterogeneous sequence
and poly-G transcripts. Heterogenous sequence abortive transcripts
are indicated in lane c of the left panel ("4H", "5H").
FIG. 2 reveals the effects of substituting dGTP for rGTP in
transcription reactions with the w.t. or Y639F polymerase. In
reactions containing only dGTP and HindIII-cut pT75 as the
template, the mutant polymerase synthesizes poly-dG transcripts up
to 4 bases in length (lane c, right panel). Note that--consistent
with the assumed structural differences--the poly-dG transcripts
("2dG", "3dG", etc.) in lane c do no co-migrate with the poly-rG
transcripts ("2rG", "3rG", etc.) in lane a despite length and
sequence identity. When a supercoiled template is used, poly-dG
transcripts up to 5 bases in length are obtained (lane d, right
panel). In lane e rGMP is added to reactions which contain only
dGTP. Ribo-GMP can serve as the initiating, but not elongating
nucleotide during transcription(Martin and Coleman, 1989). With
rGMP we therefore ask whether either polymerase can elongate with
dGTP if an rNMP is provided for initiation. Addition of rGMP to
reactions with dGTP further extends the lengths of the transcripts
obtained with the mutant polymerase (lane e, right panel). With the
w.t. enzyme very little synthesis is observed in reactions with
dGTP (lanes h-j, right panel), though the normal pattern of poly-rG
synthesis is observed in the rGTP reactions (lanes f, g, right
panel).
When reactions contained three rNTPs and dGTP synthesis of runoff
transcript from the HindIII-cut template is reduced much more than
in reactions in which rGTP is present but other ribonucleotides are
substituted with deoxynucleotides. For example, there is very
little runoff transcript in lane h of the left panel of FIG. 2.
Addition of rGMP increases the amount of runoff transcript made by
the mutant enzyme in a reaction containing dGTP (lane i) but the
amount of runoff transcript is still much less than in reactions
with rGTP. On a supercoiled template (lanes a-c, left panel) high
levels of long transcripts are obtained with the mutant enzyme in
the reactions with dGTP. The w.t. enzyme shows no transcript
synthesis in any of the reactions with dGTP irrespective of whether
supercoiled templates or rGMP is used.
Examination of FIG. 2 shows that the marked reduction in runoff
transcript synthesis by the mutant enzyme in reactions with dGTP is
not due to a deficit in initiation. In fact, in all of the
reactions with dGTP we observe abundant synthesis of 2-.sup..about.
6 base transcripts with the mutant enzyme. The low level of runoff
transcript synthesis means that these short transcripts are being
inefficiently extended to greater lengths. It should also be noted
that the abortive transcript pattern seen in lanes b, c, h, and i
of the left h panel in FIG. 2 is too complex to be accounted for by
presuming one product of each base length. Aligning the transcripts
produced in the presence of dGTP only with those produced with
dGTP, rUTP, rCTP, and rATP allows us to identify the predominant
abortive transcripts in lanes c, d, h, and i of the left panel as
poly-dG products. In lane c of the left panel we indicate the major
non poly-dG abortives by "4H" and "5H". In lanes b, c, h, and i of
the left panel of FIG. 2 we therefore see a pattern similar to that
of lane h in FIG. 1. The presence of a mixture of normally extended
heterogenous sequence and poly-G abortive transcripts indicates
that `normal` transcript extension is inefficient.
It has been shown that mutations in T7 RNAP that reduce
phosphodiester bond formation rates cause poly-rG transcript
synthesis even when 4 rNTPs are present (Bonner, et al., 1994). It
can be seen that the ratio of poly-G to heterogenous sequence
transcripts in lanes b, c, h, i of the left panel of FIG. 2 is
greater than in lane h of FIG. 1, indicating a greater deficiency
in normal transcript extension when dGTP is substituted for rGTP
than when dATP is substituted for dGTP. Note that this occurs even
though normal extension of the dGdGdG trimer in lane i of the left
panel of FIG. 2 (for example) would involve addition of a ribo-AMP
while extension of the rGrGrG trimer in lane h of FIG. 1 would
involve addition of a deoxy-AMP, clearly highlighting the role of
transcript structure, as well as substrate structure, in
determining the efficiency of transcript extension. These results
show that Y639F can initiate and elongate transcripts with dGTP
substituted for rGTP but normal extension of the transcripts in the
2-8 base range is impaired leading to a large increase in the
proportion of poly-dG and short transcripts synthesized. Addition
of rGMP to serve as the initiating nucleotide and the use of a
supercoiled template both enhance the ability of the mutant to
extend the short transcripts during the initial stages of
transcription.
Barriers to initiation and extension of the initial transcript with
dNTPs: FIG. 2 reveals that Y639F can efficiently transcribe with
dGTP the initial G segment of a promoter that initiates "GGGA" but
is severely blocked in extending the dG trimer with the A. This
implies that the sequence of the initially transcribed region may
influence the efficiency with which Y639F can extend the transcript
when using dNTPs. FIG. 2 also shows that supercoiling, which
presumably facilitates unwinding of the template, enhances the
activity of Y639F when using dNTPs. To evaluate the effects of
sequence and single-strandedness in the initially transcribed
region on the activity of Y639F when using dNTPs, we examined
transcription from a set of synthetic promoters which differed in
the sequence of their initially transcribed regions and in being
fully double-stranded or single-stranded in their initially
transcribed regions (FIG. 3).
FIG. 3 shows the effects of single-strandedness and sequence in the
initially transcribed region on the activity of Y639F in reactions
with 4 rNTPs or 4 dNTPs. Poly-rG transcripts of various sizes are
indicated in lane a. Reactions contained the indicated NTPs and
polymerases. Polymerase and promoter concentrations were 10.sup.-6
M and 10.sup.-5 M, respectively. NTP concentrations and
electrophoresis as in FIG. 1. Indicated in some of the lanes are
the sequences of different transcripts as deduced from alignment
with poly-rG or poly-dG ladders synthesized in the presence of rGTP
or dGTP only. The synthetic promoter templates used are
double-stranded and have the sequence--CGAAATTAATACGACTCACTATA (SEQ
ID NO:2)--in their -23 to -1 regions. The promoters differ in their
initially transcribed regions as follows: b-e, t, u: GGACT; f-j, v,
w: GAGACCGG; a, j-m, x, y: GGGAGACC; n, o, z: GGAAAATT; p-s:
GGGGGGGGGGGACT (SEQ ID NO:3). The promoters also differ in being
double-stranded (b, d, f, h, j, l, p, r) or single-stranded (other
lanes) in their transcribed regions.
For most of the promoters tested, transcription with rNTPs was not
markedly affected by having the initially transcribed region be
single-stranded. However, when transcribing with 4 dNTPs, Y639F was
more active on the partially single-stranded promoters. For
example, in lane e (partially single-stranded promoter) of FIG. 3
transcription products are both more abundant and extend to greater
lengths than in lane d, where the promoter is fully
double-stranded. A similar comparison may be made between lanes m
and 1 or s and r. Regarding sequence we found that a promoter which
initiated with 3 G's was superior to a promoter which initiated
with two, which was in turn superior to a promoter which initiated
with just one G. Thus Y639F activity when using dNTPs was greatest
on a promoter which initiates "GGGAGACC" (lanes l and m). The
initially transcribed region of this promoter corresponds to the
consensus sequence for T7 promoters in the +1 to +6 segment. This
was the only promoter which, when fully double stranded, gave rise
to high levels of transcript synthesis with Y639F in reactions
containing only dNTPs (lane 1).
Promoters which initiated with 2 G's (lanes d, e, o) gave lower
levels of transcript synthesis in the 4 dNTP reactions, and a
promoter which initiated with 1 G (lanes h, i) was not utilized by
Y639F in reactions with 4 dNTPs. Within the initially transcribed
region, elements other than the number of G's appear to be
important. For example, we have found that the w.t. or Y639F
polymerases are less efficient in initial transcription extension
on the T7 promoter found in the pBS plasmid which initiates GGGC,
than on the .phi.10 promoter found in pT75 which initiates with the
consensus GGGAGA (data not shown).
Another example is evident in lanes n and o which show the
transcripts obtained on a partially single-stranded promoter that
initiates GGAAAAUU. Like the promoter used in lanes c and e, this
promoter initiates with 2 G's but normal transcript extension on
this promoter is less efficient than on the promoter that initiates
GGACU. In the 4 rNTP reactions (lanes c, n), the proportion of
short transcripts (dimers, trimers) is greater in lane n and we
observe significant amounts of poly-rG transcripts beyond the dimer
length in lane n but not in lane c. In the 4 dNTP reactions almost
all of the transcripts in lane o terminate at the trimer or
tetramer length. Because increasing the number of Gs from 1 to 3
enhanced Y639F activity when using dNTPs, we tested a promoter
which initiated with a run of 11 G's (lanes p-s). A potential
drawback to such a promoter is that such a long run of G's could
inhibit the ability of the polymerase to unwind the template. Since
T7 promoters with more than 3 consecutive G's in the initial region
do not occur naturally, it may be that for other reasons such
sequences do not favor initial transcript extension. In fact, we
find that this promoter is a poor template. When it is fully
double-stranded, initiation and extension of the transcript is
inefficient with either rNTPs (lane p) or dNTPs (lane r),
consistent with the expectation that a promoter with this sequence
would be difficult to melt. Initiation and transcript extension is
enhanced when this promoter is partially single-stranded (lanes q
and s), but while poly-G transcripts from 2 to 7 or more bases in
length are abundant, runoff transcripts of the expected length are
not predominant products. In reactions with 4 rNTPs the transcript
patterns of the w.t. and Y639F polymerases are virtually identical
so we do not repeat the 4 rNTP reactions with the w.t. enzyme in
FIG. 3. Lanes t-z show that the w.t. enzyme is virtually inactive
in reactions with 4 dNTPs and the same set of promoter used in
lanes b-s.
Relative selectivity of the mutant and w.t. polymerases for dNTPs
and rNTPs: FIGS. 1-3 present a qualitative analysis of the
structure of the transcripts produced by the w.t. and Y639F
polymerases with various combinations of NTPs. They show that Y639F
can use dNTPs with high efficiency and that both transcript and
substrate structure play a role in determining the efficiency of
transcript extension. To obtain a quantitative measure of the
relative selectivity of the w.t. and mutant polymerases for dNTPs
vs. rNTPs under conditions where transcript structure was not a
complicating factor, we carried out reactions in which all 4 rNTPs
were present but rNTPs or dNTPs were used to radiolabel the
transcripts (Table I, see Appendix 1). Under these conditions the
unlabeled rNTPs were present in vast excess relative to the
labeling NTPs so labeling dNTPs are almost always incorporated
adjacent to rNTPs and into transcripts of nearly uniform rNMP
structure. On average the mutant enzyme is .sup..about. 20-fold
less selective for rNTPs over dNTPs than the w.t. enzyme. We used
this assay to screen our collection of T7 RNAP active site mutants
for increased dNTP utilization. In this screen we looked for
increased dATP incorporation in transcription reactions with all of
these mutants using supercoiled pT75 as the template, 4 cold rNTPs,
and P.sup.32 -rATP or P.sup.32 -dATP to label. Since these results
were negative with the exception of the tyrosine 639 mutants, we do
not present them here, but the mutants tested in this way are
listed in "Materials and Methods". It has been reported that use of
Mn.sup.++ instead of Mg.sup.++ decreases substrate discrimination
and increases miscoding for a number of polymerases (Tabor and
Richardson, 1989; Nivogi and Feldman, 1981). We, therefore,
examined the rNTP/dNTP selectivity of the mutant and w.t. enzymes
in Mn.sup.++ -citrate buffer (Tabor and Richardson, 1989). With
Mn.sup.++ the preference of both the w.t. and Y639F polymerases for
rNTPs over dNTPs was markedly reduced.
Relative activity of the w.t. and Y639F polymerases with different
NTP combinations: The relative activities of the Y639F and w.t.
polymerases with supercoiled pT75 as a template and various
combinations of rNTPs/dNTPs were measured in both Mg.sup.++ and
Mn.sup.++ buffers (Table II, see Appendix 1). In Mg.sup.++ buffer,
substitution of a single rNTP with a dNTP reduces w.t. activity by
20 to >400-fold, but only modestly reduces the activity of
Y639F. The rank order of the effect of a particular dNTP
substitution on w.t. enzyme
activity--dGTP>dATP>dCTP>dTTP=dUTP--matches the order of
their addition to the transcript. With the "2 dNTP" reactions the
w.t. enzyme was most active when rCTP and rUTP were substituted
with dNTPs, corresponding to the 2 nucleotides added latest to the
transcript. The w.t. enzyme was inactive with all other "2 dNTP" or
"3 dNTP". In the "2 dNTP" reactions Y639F was least active in the
dGTP, dATP reaction, corresponding to the 2 nucleotides
incorporated first during transcription. In the "3 dNTP" reactions
Y639F was least active in the dGTP, dATP, dCTP reaction,
corresponding to the 3 nucleotides incorporated first during
transcription.
In Mn.sup.++ buffer both the w.t. enzyme and Y639F show a reduction
in their sensitivity to substitution of dNTPs for rNTPs, consistent
with an expectation of reduced substrate discrimination in
Mn.sup.++ buffer. There was, however, also a sharp reduction in
overall activity with Mn.sup.++. We varied Mn.sup.++ concentrations
over a wide range (from 20 mM to 150 .mu.M in 2-fold dilutions) to
determine if an optimal Mn.sup.++ concentration that would result
in high activity could be identified, but we found similar activity
at all Mn.sup.++ concentrations tested (data not shown). Thus,
while discrimination between rNTPs and dNTPs was less in Mn.sup.++
buffer, Y639F is more active in Mg.sup.++ buffer than in Mn.sup.++
buffer with all NTP combinations examined. Similarly, the w.t.
enzyme exhibits greatly reduced discrimination between rNTPs and
dNTPs in Mn.sup.++ buffer, but is modestly more active in Mn.sup.++
buffer than in Mg.sup.++ buffer only for certain combinations of
dNTPs and rNTPs.
DNA and RNA synthesis on homopolymeric templates: T7 RNAP will
synthesize poly(rG) RNAs on poly(dC) templates (Bonner, et al.,
1994; Ikeda and Richardson 1987). We measured the activity of the
w.t. and mutant polymerases on poly(dI).poly(dC) with rGTP, dGTP,
dGTP+rGMP (Table III, see Appendix 1). The activity of T7 RNAP on
poly(dI)-poly(dC) and poly(dC) is especially robust. Mutant
polymerases that have greatly reduced activity on normal promoter
templates still display high activity on poly(dC) templates
(Bonner, et al., 1994). We, therefore, characterized two poorly
active non-conservative tyrosine mutations on this template (Y639A
and Y639S). In Table III we also present results obtained with
mutant G640A. Presentation of data for the latter mutant was
selected because it is more comparable in activity to the Y639A/S
mutants and because it is representative of a mutation which has
marked effects on the kinetics of transcription but does not affect
substrate discrimination, even though it is directly adjacent to
Y639. We find that all of the Y639 mutants exhibit reduced
substrate discrimination as demonstrated by the fact that their
differential activity in reactions containing dGTP or dGTP+rGMP vs.
rGTP is less than for the w.t. enzyme or the G640A mutant. In fact
Y639F displays similar activity with rGTP, dGTP, or dGTP+rGMP.
Since the nucleic acid synthesized by Y639F on poly(dI).poly(dC)
using dGTP is presumably composed solely of dNMPs it is expected to
be resistant to alkaline hydrolysis (Schmidt and Tannhauser, 1945).
FIG. 4 shows transcription by Y639F and w.t. polymerase with dGTP
or rGTP on poly(dI).poly dC). Transcription reactions were carried
out with poly(dI).poly(dC) at 0.2 mg/ml and the indicated NTPs and
polymerases. Reaction products were left untreated (-) or treated
with 1 M NaOH for 5 hours at 37.degree. C. (+). Polymerase and NTP
concentrations and electrophoresis as in FIG. 1. Labeling was with
.alpha.-P.sup.32 rGTP (a, d, g, j) or .alpha.-P.sup.32 dGTP (other
lanes). FIG. 4 shows the transcription products obtained with the
w.t. or Y639F polymerases on poly(dI).poly(dC) before and after
treatment with alkali. With dGTP or dGTP+rGMP the w.t. enzyme is
poorly active in the synthesis of long transcripts, however we can
observe smears of heterogeneously sized, short transcripts in the
reactions with the w.t. enzyme and the dGTP substrates (lanes e and
f) while Y639F synthesizes higher levels of long transcripts which
are retained near the top of these gels (lanes b and c). The
presence of these short transcripts indicates that Y639F and the
w.t. enzyme differ only in the degree to which they can utilize
dNTPs. The w.t. can also initiate and extend transcripts with dGTP,
but it is much less processive when using dNTPs than Y639F so its
transcripts are much shorter. When these reactions are treated with
base, degradation of the long transcripts made in the reactions
with rGTP is observed and the amounts of short RNAs (presumably
hydrolysis products) increase (lanes g and j). In the reactions in
which dGTP or dGTP+rGMP were used as substrates no degradation of
the transcripts by base treatment is observed, confirming that
these transcripts are composed of dNMPs.
T7 RNAP as a reverse transcriptase or RNA replicase which initiates
de novo: It has been reported that T7 RNAP can use both RNA and DNA
templates (Konarska and Sharp, 1989). We, therefore, determined if
the Y639F mutant would use dNTPs when transcribing an RNA template
(poly(rC), Table IV). Overall the activity of the w.t. and Y639F
polymerases on poly(rC) with rGTP was 10-20-fold less than on
poly(dC) (not shown), but this reduction did not preclude synthesis
of high levels of RNA on poly(rC) by using higher polymerase
concentrations than were used in the poly(dI).poly(dC) reactions.
When dGTP or dGTP+rGMP was used the w.t. enzyme was not measurably
active on poly(rC), while the activity of Y639F was reduced by only
.sup..about. 4-fold (with dGTP+rGMP) or .sup..about. 8-fold (with
dGTP). Thus, both the w.t. and Y639F polymerases are capable of
unprimed RNA-directed RNA polymerization while Y639F is also
capable of unprimed reverse transcription.
DNA- and RNA-primed synthesis of DNA and RNA: In the assays
described so far we have examined de novo initiated synthesis. T7
RNAP can also extend RNA primers. We, therefore, examined the
abilities of both polymerase to carry out DNA or RNA primed
synthesis of DNA and RNA (FIG. 5).
FIG. 5 shows primed synthesis of DNA and RNA with Y639F and the
w.t. polymerase. Transcription reactions contained end-labeled 12
base DNA or RNA primers of identical sequence (GGACACGGCGAA, SEQ ID
NO: 4) hybridized to a DNA template
(CCCGGGATGGAATGGAGTATTCGCCGTGTCCATGGCTGTAAGTATCC, SEQ ID NO: 5).
Primer-template concentration was 10.sup.-5 M. Reactions contained
the indicated polymerases (10.sup.-7 M) and NTPs. NTP
concentrations and electrophoresis as in FIG. 1.
We found that both the w.t. and Y639F polymerases can extend DNA
and RNA primers with rNTPs, but extension of DNA primers was
2-3-fold less efficient than extension of RNA primers. Y639F also
extended DNA and RNA primers with dNTPs but .sup..about. 4-fold
less efficiently than with rNTPs.
The Y639F mutant does not exhibit greatly increased miscoding: We
examined the miscoding properties of the w.t. and mutant T7 RNAPs
by measuring the relative incorporation of labeled rGTP, rUTP,
rATP, and rCTP on poly(dC) or poly(dT) templates in the presence of
excess unlabeled rGTP or rATP, respectively (Table V, see Appendix
1). An increase in miscoding would be reflected in an increase in
the rate of incorporation of the non-complementary NTP into
RNA.
On poly(dC), the w.t., Y639F, and G640A polymerases incorporate
rGTP into RNA at greater than 1300-2000-fold the rate of rUTP
incorporation. Ribo-GTP is incorporated some 400-600- fold better
than rCTP, and 200-400-fold better than rATP. Because of their
lower activity we can say only that the relative rate of
incorporation of rGTP on poly(dC) is 184-fold greater than the rate
of incorporation of non-complementary rNTPs for Y639A, and 50-fold
greater for Y639S. The use of Mn.sup.++ instead of Mg.sup.++ has
been reported to increase miscoding for a number of polymerases
(Tabor and Richardson, 1989; Nivogi and Feldman, 1981) so we
examined the effects of Mn.sup.++ on miscoding by w.t. and Y639F
polymerases. In Mn.sup.++ buffer the G640A, Y639A, and Y639S
mutants were insufficiently active to allow accurate measures of
miscoding. With the w.t. and Y639F polymerases the use of Mn.sup.++
increases miscoding by 20-40-fold. However, the apparent rate of
miscoding by Y639F remains similar to the w.t enzyme.
On poly(dT), high levels of activity allowing an accurate measure
of miscoding frequencies could only be observed for Y639F and the
w.t. polymerase in both Mg.sup.++ and Mn.sup.++ buffers. In
Mg.sup.++ buffer apparent miscoding rates on poly(dT) were higher
than on poly(dC), but were similar for Y639F and the w.t. enzyme.
In Mn.sup.++ buffer miscoding rates were increased by .sup..about.
5-fold, on average, but again rates were similar for w.t. and
Y639F. However, on poly(dT) Y639F did show a reproducible
.sup..about. 2-fold increase, relative to the w.t. enzyme, in the
ratio of the rates of rGTP to rATP incorporation.
Homopolymer assays have been used previously to measure miscoding
by RNAPs (Nivogi and Feldman, 1981; Glazer, 1978; Blank, et al.,
1986) but it should be remarked that they can produce only upper
bounds for miscoding frequencies Measured miscoding rates could
reflect contamination of the homopolymeric templates. It is also
possible that the transcripts themselves could serve as templates
and support incorporation of rNMPs non-complementary to the
original template (i.e., the poly(rG) or poly(rA) transcripts made
on poly(dC) or poly(dT) could subsequently support synthesis of
poly(rC) or poly(rU) transcripts). Such caveats are less relevant
to the miscoding observed in Mn.sup.++ buffer since the change in
divalent cation increases miscoding but cannot affect template
composition. However, in Mg.sup.++ buffer we should consider the
measured miscoding frequencies to be upper bounds for the true
rates of miscoding. Nevertheless, the results presented in table V
indicate that Y639F does not exhibit a gross increase in miscoding
which would manifest itself as a clear increase in the
incorporation of non-complementary rNMPs on homopolymeric
templates.
The increased utilization of dNTPs by Y639F is due to both a
decreased K.sub.m and an increased k.sub.cat for dNTPs: The K.sub.m
and k.sub.cat of the w.t. and Y639F polymerases with rATP, rITP and
5 different dNTPs were measured (Table VI, see Appendix 1). The
K.sub.m of the w.t. enzyme for dNTPs was much higher than
previously reported values for the corresponding rNTPs and varied
considerably for different dNTPs (Ikeda and Richardson, 1987;
Patra, et al., 1992). Notably the w.t. enzyme K.sub.m values
correlate with the rNTP/dNTP selectivity values presented in Table
I. The selectivity of the w.t. enzyme with ribo- vs.
deoxy-nucleotides was greatest for CTP, followed by ATP, and was
the least for UTP, implying that an important component of the
selectivity of the w.t. enzyme for rNTPs over dNTPs is a much
higher K.sub.m for dNTPs. For Y639F, the K.sub.m values for these
dNTPs are from .sup..about. 3 to .sup..about. 11-fold less, but the
rank order of these K.sub.m values (dCTP K.sub.m >dATP K.sub.m
>dGTP K.sub.m >dTTP K.sub.m) is the same as for the w.t.
enzyme. For Y639F, k.sub.cat values for reactions with different
dNTPs were only 2-4 fold less than for rNTPs, while the w.t. enzyme
displayed k.sub.cat values with dNTPs that were from .sup..about. 6
to .sup..about. 30-fold less than for rNTPs.
Elongation rates of Y639F in reactions containing a single dNTP:
Elongation rates for Y639F in reactions with 4 rNTPs or 1 dNTP and
3 rNTPs were determined by analyzing aliquots, taken at 10 second
intervals, from transcription reactions initiated on supercoiled
PT75 by adding NTPs to otherwise complete reaction mixes (FIG.
6).
FIG. 6 shows relative elongation rates of Y639F in "4 rNTP" and "3
rNTP+0.1 dNTP" reactions. The template was supercoiled pT75 at
5.times.10.sup.-7 M. Y639F polymerase was used at a concentration
of 10.sup.-6 M. Reactions contained the indicated NTPs. Labeling
was with .alpha.-P.sup.32 -rATP (lane e) or .alpha.-P.sup.32 -rGTP
(other lanes). After initiation of the reactions aliquots were
taken at 10 second intervals and analyzed on 1% agarose
denaturing-formaldehyde gels. The figure shows the 20 second time
point. The bars indicate the positions of .lambda. DNA markers.
When analyzed on denaturing agarose gels (FIG. 6) the
heterogeneously sized transcripts from these reactions are resolved
as a smear with the trailing edge of the smear corresponding to
transcripts initiated at t=0 and from which the maximal transcript
elongation rate can be determined (Golomb and Chamberlin, 1974;
Bonner, et al., 1994). The following elongation rate
reductions (relative to a `4 rNTP` reaction) were obtained for
reactions containing a 3 rNTPS and 1 dNTP:dATP, .sup..about.
3-fold; dUTP, .sup..about. 2-fold; dGTP .sup..about. 1.5-fold;
dCTP, 1-1.5-fold. Because of its poor activity in reactions with
dNTPs we could not determine the corresponding elongation rate
reductions for the w.t. enzyme.
Other non-canonical nucleoside triphosphate substrates for mutant
polymerases: Although wild-type T7 RNAP can not efficiently utilize
dideoxy-NTPs as substrates, we have found that Y639 mutants of this
enzyme can also use dideoxy-NTPs as substrates (Table VII). We have
also found that Y639 mutants can use other non-canonical nucleoside
triphosphates as substrates (Table VIII). Nucleic acids synthesized
by incorporation of some non-canonical nucleotides, such as
2'-F-NTPs, may offer advantages in being more resistant to
digestion by nucleases such as ribonucleases. Other uses and
advantages of various non-canonical nucleotide substrates in
methods of the present invention using the mutant polymerases will
be apparent after examination of the specification, claims and
drawings.
Other mutations: It is conceivable that, in the absence of a bound
rNTP, a hydrogen bond forms between Y639 and some other active site
side chain. The possibility of an interaction between M635 and Y639
was tested since M635 and Y639 are close and M635 approaches the
ribose in our models of NTP in T7 RNAP (Huang, et al., submitted
for publication). This position is methionine in the T7 RNAP class
of RNAPs (McAllister, W. T., 1993), but is either tyrosine or
phenylalanine in the homologous DNAPs, and in the DNAP mutants at
this site (i.e., positions homologous to position 762 in E. coli
DNAP I) that affect dNTP/ddNTP discrimination (Tabor. S., and
Richardson, C. C., European patent application, 1994). While M635A,
M635F or M635Y mutants had effects on NTP K.sub.m, they did not
affect 2'-group discrimination with respect to dNTPs and rNTPs in
either wild-type or the Y639F T7 RNAP background. Additional
studies will reveal whether these M635 mutations have other
effects, such as effects on discrimination at the 3'-position of
the sugar, or effects on discrimination with respect to NTPs with
other substituents, such as fluorine at the 2' position of the
sugar. Also, studies on similar double mutations at the homologous
sites in the homologous class I DNAPs will reveal the effects of
such double mutations on discrimination at the 2'- and 3'-positions
of the sugar; specifically, these studies will reveal whether class
I DNAPs having a phenylalanine at the position homologous to amino
acid position 766 in E. coli DNAP I have reduced discrimination for
rNTPs if the amino acid is methionine or tyrosine at the position
homologous to amino acid position 762 in E. coli DNAP I.
Provided that class I DNAP mutants which have a reduced
discrimination for rNTPs compared to dNTPs can be obtained, it will
be possible to use such DNAP mutants to carry out the methods of
the present invention that comprise nucleic acid synthesis from a
nucleic acid primer, at least part of which is sufficiently
complementary to a template nucleic acid to hybridize therewith and
to be extended by the polymerase. An especially preferable use for
such mutant DNA polymerases would be to carry out Partial
Ribo-substitution sequencing reactions from primers, whether
labelled by any of the methods known in the art, or unlabelled.
Since the sequence-delimiting rNTP nucleotides for the Partial
Ribo-substitution Reaction do not terminate the growing
phosphodiester chain when they are incorporated during nucleic acid
synthesis, the DNA synthesis for Partial Ribo-substitution can
occur simultaneous with and be identical to nucleic acid synthesis
for another procedure, such as NASBA, 3SR, TMA or another similar
method, provided that the mutant DNAP with reduced discrimination
for rNTP compared to dNTPs is thermostable, or the PCR strand
displacement amplification or other methods for nucleic acid
amplification involving nucleic acid synthesis from a primer. The
nucleic acid products containing the sequence-delimiting rNMPs can
then be cleaved by treatment with a chemical base or a
ribonuclease, and analyzed by methods known in the art to obtain
the nucleotide-specific pattern of bands or, provided that a
Partial Ribo-substitution Reaction is carried out for each of the
four nucleotides, the complete sequence of the nucleic acid. Also,
provided that primers with distinguishable non-radioactive labels
are used, multiple Partial Ribo-substitution sequencing reactions
may be carried out simultaneously in the same reaction mixture and
run and read in the same lane of a polyacrylamide gel or capillary
tube or other matrix for separating the fragments based on size, as
is the case for all of the methods of the present invention
described herein.
C. Discussion
Our results reveal that mutations of tyrosine 639 in T7 RNAP reduce
the ability of the polymerase to discriminate between rNTPs and
dNTPs. A conservative mutation which removes the tyrosine hydroxyl
but retains the phenolic ring (Y639F) exhibits w.t. activity but an
average reduction of .sup..about. 20-fold in the selectivity for
dNTPs over rNTPs (Table I). Non-conservative mutations of this
tyrosine (Y639A/S) also display decreased rNTP/dNTP discrimination
(Table III), but are less active than the w.t. enzyme. Replacement
of an rNTP by a dNTP typically reduces Y639F transcript elongation
rates by only a factor of two. Tyrosine 639 is conserved in a large
number of DNA-directed RNA and DNA polymerases (Delarue, et al.,
1990). In DNAP I, mutations of the Y766 to serine and phenylalanine
have been characterized (Polesky, et al., 1989; Carrol, et al.,
1991). The Y766S mutation was alone amongst a number of active site
mutations characterized in decreasing DNAP I fidelity (increasing
miscoding). The Y766F mutation displayed w.t. fidelity and
activity. Similarly, the T7 RNAP Y639F mutant displays w.t.
kinetics (Bonner, et al., 1992, 1994; Woody, et al., 1994), and the
only effect we can identify for this mutation in T7 RNAP is the
reduced substrate discrimination reported here. Thus, while T7 RNAP
Y639F showed decreased dNTP/rNTP selectivity, it did not exhibit
increased miscoding as assessed by incorporation of
non-complementary NTPs on homopolymeric templates.
The Y639 T7 RNAP mutations present us with, in one sense, the
functional unification of polymerases to go along with their
structural unification. The active site of w.t. T7 RNAP is
forgiving with regards to template structure (RNA or DNA) or mode
of initiation (primed or de novo). A mutation which relaxes the
substrate selectivity of this polymerase further expands the range
of activities which it can display in vitro. Depending on the
substrates and templates presented to it, the Y639F T7 RNAP can act
as an RNA- or DNA-directed RNA or DNA polymerase in primed or de
novo initiated reactions. Thus it can display a variety of
activities normally associated with distinct polymerases, including
some entirely novel activities such as de novo initiated reverse
transcription or mixed dNMP/rNMP polymer synthesis.
Example 2: A mutant SP6 RNA Polymerase as a DNA Polymerase
After the observations made above with T7 RNAP, we decided to
examine bacteriophage SP6 RNA polymerase to determine whether the
DNA synthesis properties observed for the mutant T7 RNAP could, as
expected, be extended to other mutant polymerases. Bacteriophage
SP6 is a lytic phage which infects the bacterial species Salmonella
tryphimurium (Butler and Chamberlin, 1982). SP6 phage resembles E.
coli phage T7 and their genomes are comparable in size, gene
organization and pattern of gene expression (Kassavetis, et al.,
1982).
The phage encoded RNA polymerases are very similar in size (Butler
and Chamberlin, 1982) and amino acid sequence (Katani, et al.,
1987).
The homologous tyrosine at position 639 in T7 RNA polymerase is
readily identified at position 631 in SP6 RNA polymerase (FIG. 7).
Substitution of tyrosine 631 with phenylalanine in the SP6 RNA
polymerase was expected to confer the same phenotypic changes in
catalytic properties in this enzyme as were demonstrated for
Y639FT7 RNA polymerase (Example 1).
Localized Mutagenesis. Refer to FIG. 7 for a summary of the amino
acid and nucleotide sequence surrounding TYR631 in the SP6 RNA
polymerase gene. Mutagenesis of the Y631 residue may be
accomplished by the method of Kunkel, et al. (1991). Alternatively,
one of the many other methods for mutagenesis known to those of
skill in the art may be used. The amino acid and nucleotide
sequences of the resulting TYR631PHE mutant SP6 RNA polymerase are
also given in FIG. 7. As shown, the A residue at position 2 in
codon 631 of the SP6 RNA polymerase gene was changed to a T. This
results in the loss of the single NdeI restriction enzyme site
which is present in the wild-type gene, permitting identification
of mutant clones.
Preparation and Purification of Mutant RNA Polymerase
A single clone was selected in which the NdeI site was missing and
which expressed SP6 RNA polymerase activity. Several liters of
LB+Amp were grown from a pUC18 Y631F SP6 RNA polymerase clone
overnight at 37.degree. C. Cells were harvested, lysed and Y631F
mutant SP6 RNA polymerase was purified approximately according to
standard methods (Butler and Chamberlin, 1983).
Transcription Reactions
To verify that Y631F SP6 RNAP had the desired phenotype, in vitro
transcription reactions were done where one of the four rNTPs was
substituted by the corresponding dNTP (Sousa and Padilla, 1995). As
expected, the Y631F SP6 RNAP mutant displayed reduced dNTP/rNTP
discrimination compared with wild-type SP6 RNAP, similar to that
observed for the Y639 mutant of T7 RNAP.
In a standard in vitro transcription reaction using the four
ribonucleoside triphosphates (rATP, rGTP, rCTP, and rUTP), both
enzymes, the wild-type SP6 RNA polymerase as well as the Y631F
mutant, synthesized the correct 1.4 kb transcript and in the
expected amounts as visualized on gels. However, if one of the four
ribonucleoside triphosphates, rGTP for example, is completely
substituted by dGTP and in vitro transcription reactions are done
with the wild-type and mutant enzymes, no transcript is made by the
wild-type enzymes. However, the mutant enzyme makes the expected
full length transcript in good yield as observed on agarose
gels.
Appendix 1
TABLE I ______________________________________ Relative Selectivity
of Y639F and W.T. Polymerase for rNTPs vs. dNTPs rATP/dATP
rUTP/dTTP rCTP/dCTP rGTP/dGTP
______________________________________ Y639F 8.5-10 (Mg)* 1.7-1.9
2.4-2.5 .93-1.6 .9-1.0 (Mn)* .48-.76 .55-.80 .98-.99 W.T. 72-83
(Mg)* 22-25 110-150 51-67 6-14 (Mn)* 2.3-2.8 4.3-5.1 4.4-6.3
______________________________________
Reactions were carried out with all 4 rNTPs (0.5 mM) in great
excess over radioactive rNTPs or dNTPs. Relative selectivity was
determined from the relative percentages of radioactive rNTP vs.
dNTP incorporated into RNA. Maximal incorporation was less than
.sup. 30% of total input radioactivity with all data points used so
as to limit effects due to changing NTP concentrations during the
experimental time course. The numbers shown give the range for 2
experiments.
*For each rNTP/dNTP and polymerase the upper numbers are those
obtained in Mg.sup.++ buffer, the lower numbers are from Mn.sup.++
buffer. Polymerases at 10.sup.-8 M. Template was supercoiled pT75
at 10.sup.-7 M.
TABLE II ______________________________________ Relative Activity
of Y639F and W.T. Polymerase with Different rNTP/dNTP Mixes Y639F
W.T. Y639F W.T. (Mg.sup.++) (Mg.sup.++) (Mn.sup.++) (Mn.sup.++)
______________________________________ 4 rNTPs 200 200 21-23 9 3
rNTPs, dTTP 11-13 90-96 7-8 4 3 rNTPs, dUTP 9-11 82-91 10-11 7-8 3
rNTPs, dATP 1-2 73 1-2 2-3 3 rNTPs, dCTP 4-9 86 15 7-11 3 rNTPs,
dGTP, rGMP <.5 95-109 1-3 1.4-2.5 3 rNTPs, dGTP <.5 43-63
.5-2 3 2 rNTPs, dCTP, dUTP 2-6 27-29 3 4-7 2 rNTPs, dCTP, dTTP 2 30
5-7 5 2 rNTPs, dCTP, dATP <.5 20-29 .5-.9 4-7 2 rNTPs, dTTP,
dGTP, rGMP <.5 13-15 <.5 3-6 2 rNTPs, dATP, dTTP <.5 11-14
<.5 3-4 2 rNTPs, dCTP, dGTP, rGMP <.5 11-14 <.5 2-5 2
rNTPs, dATP, dGTP, rGMP <.5 5-6 <.5 1-1.5 1 rNTP, dCTP, dATP,
dTTP <.5 12-14 <.5 .7-2 1 rNTP, dCTP, dATP, dUTP <.5 10-11
<.5 2-3 1 rNTP, dTTP, dCTP, dGTP* <.5 10-13 <.5 2-4 1
rNTP, dTTP, dATP, dGTP* <.5 11 <.5 1.5-2 1 rNTP, dCTP, dATP,
dGTP* <.5 3-5 <.5 1-2 4 dNTPs, rGMP <.5 <.5 <.5 .5
______________________________________
*These reactions also contain rGMP. Numbers give ranges from 2
experiments. Template was supercoiled pT75 (10.sup.-7 M),
polymerases at 10.sup.-8 M (in Mg.sup.++ buffer) or 10.sup.-7 M (in
Mn.sup.++ buffer). rNTPs, rGMP, dTTP were at 0.5 mM; dATP, dGTP
were at 1 mM; dUTP was at 2.5 mM, dCTP was at 5 mM. From top to
bottom the labeling NTPs were: .alpha.-P.sup.32 rGTP,
.alpha.-P.sup.32 rCTP, .alpha.-P.sup.32 rCTP, .alpha.-P.sup.32
dATP, .alpha.-P.sup.32 dCTP, .alpha.-P.sup.32 dGTP,
.alpha.-P.sup.32 dGTP, .alpha.-P.sup.32 dCTP, .alpha.-P.sup.32
dTTP, .alpha.-P.sup.32 dCTP, .alpha.-P.sup.32 dTTP,
.alpha.-P.sup.32 dTTP, .alpha.-P.sup.32 dCTP, .alpha.-P.sup.32
dATP, .alpha.-P.sup.32 dTTP, .alpha.-P.sup.32 dCTP,
.alpha.-P.sup.32 dTTP, .alpha.-P.sup.32 dTTP, .alpha.-P.sup.32
rCTP, .alpha.-P.sup.32 dCTP.
TABLE III
__________________________________________________________________________
Relative activity on poly(dI).poly(dC) W.T. Y639F G640A Y639A Y639S
__________________________________________________________________________
rGTP 1000 1000 240 (200-270) 145 (142-151) 48 (47-50) dGTP 7.4
(5.4-12.5) 964 (684-1257) <5 5.3 (4.8-5.5) .6 dGTP + rGMP 25
(20-27) 1070 (816-1457) <5 25 (17-30) 4.4
__________________________________________________________________________
Numbers give mean and range from 3 experiments. Templates were at
0.2 mg/ml, polymerases at 10.sup.-8 M. Labeling NTPs were
.alpha.-P.sup.32 rGTP, .alpha.-P.sup.32 dGTP, .alpha.-P.sup.32
rATP, .alpha.-P.sup.32 dATP, as appropriate. rNTPs or rNMPs at 0.5
mM; dNTPs at 1 mM.
TABLE IV ______________________________________ W.T. and Y639F
activity on an RNA (poly(rC)) template .5 mM GTP 1 mM dGTP 1 mM
dGTP + .5 mM GMP ______________________________________ w.t. 1000
<.5 <.5 Y639F 505 (358-733) 62 (48-80) 116 (90-148)
______________________________________
Numbers give mean and range from 3 experiments. Template was at 0.2
mg/ml, polymerases at 10.sup.-6 M. Labeling NTPs were
.alpha.-P.sup.32 rGTP, .alpha.-P.sup.32 dGTP.
TABLE V ______________________________________ Relative rates of
incorporation of complementary and non-complementary rNTPs on
homopolymeric templates by w.t. and mutant polymerases W.T. Y639F
G640A Y639A Y639S ______________________________________ I.
Template: poly(dC) GTP/UTP >2000 (Mg.sup.++ *)
>1760 >1320 >184 >50 53 (Mn.sup.++)* 55 n.d. n.d. n.d.
GTP/CTP 400 550 508 >184 >50 32 40 n.d. n.d. n.d. GTP/ATP 233
338 388 >184 >50 9.3 8 n.d. n.d. n.d. II. Template: poly(dT)
ATP/GTP 170 94 n.d. n.d. n.d. 50 27 n.d. n.d. n.d. ATP/UTP 121 94
n.d. n.d. n.d. 21 20 n.d. n.d. n.d. ATP/CTP >340 >94 n.d.
n.d. n.d. 77 60 n.d. n.d. n.d.
______________________________________
Numbers are averages from 2 experiments and reflect the ratio of
the percentages of labeled rNTPs incorporated into RNA in reactions
in which unlabeled complementary rNTPs were in great excess (.5 mM)
to labeled complementary or non-complementary rNTPs. Templates were
at 0.1 mg/ml. Polymerases were at 10.sup.-8 M in Mg.sup.++ buffer
and 10.sup.-7 M in Mn.sup.++ buffer.
*The upper number refers to results obtained in Mg.sup.++ buffer,
the lower number to results in Mn.sup.++ buffer. n.d.: G640A,
Y639A, Y639S were poorly active in Mn.sup.++ buffer, or on poly(dT)
under all conditions.
TABLE VI
__________________________________________________________________________
Kinetic Constants for Y639F and the W.T. polymerase with rNTPs or
dNTPs rATP rITP dTTP dUTP dCTP dGTP dATP
__________________________________________________________________________
Y639F: K.sub.m .063-.125 .034-.094 .038-.059 .052-.092 .92-1.6
.185-.264 .20-.35 k.sub.cat 150-210 s.sup.-1 180-200 s.sup.-1
70-110 s.sup.-1 70-130 s.sup.-1 50-90 s.sup.-1 30-60 s.sup.-1 50-70
s.sup.-1 W.T.: K.sub.m .034-.068 .029-.059 .209-.262 4.4-9.0
4.3-13.5 .602-.701 2.0-5.0 k.sub.cat 190-220 s.sup.-1 170-230
s.sup.-1 26-29 s.sup.-1 25-39 s.sup.-1 9-14 s.sup.-1 5-9 s.sup.-1
6-9 s.sup.-1
__________________________________________________________________________
Numbers give ranges from 3 experiments. The template was
supercoiled pT75 at 10.sup.-7 M, and polymerases were at 10.sup.-8
M.
TABLE VII ______________________________________ 2',3'-dideoxy NTP
preferences of the Y639F mutant ATP/ddATP TTP/ddUTP CTP/ddCTP
GTP/ddGTP ______________________________________ 9.0 7.0 10.0 5.0
______________________________________
Numbers reflect the relative specificity (k.sub.cat /K.sub.m) for
an NTP vs. the corresponding ddNTP. Relative specificities could
not be evaluated for the wild-type T7 RNAP because the ddNTPs are
such poor substrates, but these relative specificities appear to be
at least 150-fold.
TABLE VIII ______________________________________ Activity of W.T.
and Y639 mutants with NTPs containing different 2'-substituents NTP
W.T. Y639F Y639M ______________________________________ UTP 100 95
.+-. 6.7 50 .+-. 1.2 2'-NH2-UTP 5.9 .+-. .27 12 .+-. .41 3.6 .+-.
.19 2'-F-UTP 3.1 .+-. .14 73 .+-. 2.6 23 .+-. .72 2'-dUTP 2.4 .+-.
.11 46 .+-. 2.4 11 .+-. .46 CTP 100 103 .+-. 2.3 54 .+-. 3.9
2'-NH2-CTP 34 .+-. .86 60 .+-. 2.5 21 .+-. .38 2'-F-CTP 3.4 .+-.
.22 63 .+-. 3.1 47 .+-. .70 2'-dCTP 1.6 .+-. .16 57 .+-. 1.7 32
.+-. 1.1 ATP 100 96 .+-. 3.0 51 .+-. 1.3 2'-NH2-ATP 18 .+-. .39 21
.+-. .75 .92 .+-. .035 2'-F-ATP 6.6 .+-. .12 50 .+-. 1.4 9.7 .+-.
.20 2'-dATP 2.7 .+-. .28 40 .+-. 1.3 3.2 .+-. .11
______________________________________
Activity was determined with pT75 as template but with one of the
rNTPs replaced with a dNTP or a 2'-modified NTP. The labeling NTP
was UTP (in reactions with 2'-modified CTPs or ATPs) or CTP (in
reactions with 2'-modified UTPs). Y639F and Y639M represent enzymes
with substitutions of the wild-type (W.T.) tyrosine at position 639
by phenyalanine (F) or methionine (M), respectively.
Appendix 2
REFERENCES
U.S. PATENTS
U.S. Pat. No. 4,683,202
U.S. Pat. No. 4,965,188
INTERNATIONAL PATENTS
Tabor, S and Richardson, C. C. (Filed 24.11.94) European Patent
Application Number 94203433.1; Publication Number 0 655 506 A1.
PUBLICATIONS
Astatke, M., Grindley, N. D. F., and Joyce, C. M. (1995) J. Biol.
Chem. 270, 1945-1954.
Axelrod, V. D, Vartikyan, R. M., Aivazashvilli, V. A., and
Bebelashvilly, R. S. (1978) Nucleic Acids Res. 5, 3549-3563.
Axelrod, V. D, and Kramer, P.R. (1985) Biochemistry 24,
5716-5723.
Barnes, W. M. (1978) J. Mol. Biol. 119, 83-99.
Beese, L. S., Friedman, J. M., and Steitz, T. A. (1993)
Biochemistry 31, 9636.
Blank, A., Gallant, J. A., Burgess, R. R., Loeb, L. A. (1986)
Biochemistry 25, 5920-5928.
Bonner, G., Patra, D., Lafer, E. M., and Sousa, R. (1992) EMBO J.
11, 3767-3775.
Bonner, G., Lafer, E. M., and Sousa, R. (1994) J. Biol. Chem. 42,
25120-25128.
Butler, E. T. and Chamberlin, M. J. (1982) J. Biol. Chem. 257,
5772-5778.
Carroll, S. S., Cowart, M., and Benkovic, S. J. (1991) Biochemistry
30, 804-13.
Cazenave, C., and Uhlenbeck, O. C. (1994) Proc. Natl. Acad. Sci.
USA 91, 6972-6976.
Chapman, K. A., and Burgess, R. R. (1987) Nucl. Acids Res. 15,
5413-5426.
Chapman, K. A., Gunderson, S. I., Arnello, M., Wells, R. D., and
Burgess, R. R. (1988) Nucl. Acids Res. 16, 4511-4530.
Compton, J. (1991) Nature 350:91-92.
Cotton (1993) Mutation Res. 285:125-144.
Cunningham, P. R., and Ofengand, J. (1990) BioTechniques 9(6),
713-714.
Duck, P. G., Alvarado-Urbina, B., Burdick, B., and Collier, B.
(1990) BioTechniques 9, 142-148.
Fahy, et al. (1991) PCR Methods & Applications 1, 25-33.
Glazer, R. I. (1978) Nucleic Acids Res. 5, 2607-2616.
Golomb and Chamberlin, (1974) J. Biol. Chem. 249, 2858-2863.
DeLarue, M., Poch, O., Tordo, N., Moras, D., and Argos, P. (1990)
J. Protein Engineering 10, 461-467.
Hill, C. S. (1996) "Gen-Probe Transcription-mediated Amplification
System Principles," Tech. Bulletin No: L137/01/96, of Gen-Probe,
Inc.
Ikeda, R. A., Richardson, C. C. (1987) J. Biol. Chem. 262,
2800-3808.
Jacobo-Molina, A, Ding., J., Nanni, R. G., Clark, A. D., Lu, X.,
Tantillo, C., Williams, R. L., Kramer, G., Ferris, A. L., Clark,
P., Hizi, A., Hughes, S. H. & Arnold, E. (1993) Proc. Natl.
Acad. Sci. (USA) 90, 6320.
Kassavetis, G. A., Butler, E. T., Roulland, D., and Chamberlin, M.
J. (1982) J. Biol. Chem. 257, 5779-5788.
Katani, H., Ishizaki, Y., Hiraoka, N., and Obayashi, A. (1987)
Nucleic Acids Res. 15, 2653-2664.
Kohlstaedt, L. A., Wang, J., Friedman, J. M., Rice, P. A., and
Steitz, T. A. (1992) Science 256, 1783-1790.
Konarska, M. M., and Sharp, P. A. (1989) Cell 57, 423-431.
Kramer, F. R., and Mills, D. R., (1978) Proc. Natl. Acad. Sci.
(USA) 75, 5334-5338.
Kuchta, R. D., Mizrahi, V., Benkovic, P. A., Johnson, K. A., and
Benkovic, S. J. (1987) Biochemistry 26, 8410-8417.
Kunkel, T. A., Bebenek, K., and McClary, J. (1991) Methods in
Enzymology 204, 125.
Makarova, O. V., Makarov, E. M., Sousa R., Dreyfus, M. (1995) Proc.
Natl. Acad. Sci. USA. (submitted).
Martin, C. T., Coleman, J. E. (1987) Biochemistry 26,
2690-2696.
Martin, C. T., Muller, D. K., Coleman, J. E. (1988) Biochemistry
27, 3966-3974.
Martin, C. T., and Coleman, J. E. (1989) Biochemistry 28,
2760-2762.
McAllister, W. T. (1993) Cellular & Molecular Biol. Res. 39,
385.
McClure, W. R., and Chow, Y. (1980) Methods of Enzymology 64,
277-297.
Milligan, J. F., Groebe, D. R., Witherwell, G. W., and Uhlenbeck,
O. C. (1987) Nucl. Acids. Res. 15, 8783-8798.
Mizrahi, V., Henrie, R. N., Marlier, J. F., Johnson, K. A., and
Benkovic, S. J. (1985) Biochemistry 24, 4010-4018.
Moroney, S. E., and Picirrilli, J. A. (1991) Biochemistry 30,
10343-10349.
Niyogi, S. K., Feldman, R. P. (1981) Nucleic Acids Res. 9,
2615-2627.
Myers and Gelfand, D. (1991) Biochemistry 30, 7661-7666.
Patra, D., Sousa, R., and Lafer, E. M. (1992) J. Mol. Biol. 224,
307-318.
Pelletier, H., Sawaya, M. R., Kumar, A., Wilson, S. H., and Kraut,
J. (1994) Science 264, 1891.
Polesky, A. H., Steitz, T. A., Grindley, N. D., and Joyce, C. M.
(1989) J. Biol. Chem. 265, 14579-14591.
Ricchetti, M. and Buc, H. (1993) EMBO J. 12, 387-396.
Sambrook, J., Fritsch, E. F., Maniatis, T., (1989) Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.
Sanger, et al. (1977) Proc. Natl. Acad. Sci. (USA) 74,
5463-5468.
Schmidt, G. and Tannhauser, S. J. (1945) J. Biol. Chem. 159,
83-89.
Shi, Y., Gamper, H., Hearst, J. E. (1988) J. Biol. Chem. 263,
527-534.
Sawaya, M. R., Pelletier, H., Kumar, A., Wilson, S. H., and Kraut,
J. (1994) Science 264, 1930.
Sousa, R., and Padilla, R. (1995) EMBO J. 14, 4609-4621.
(Incorporated by reference as if set forth herein.)
Sousa, R., Lafer, E. M., and Wang, B. -C. (1991) J. Crystal Growth
110, 237-246.
Sousa, R., Chung, Y. J., Rose, J. R., and Wang, B. C. (1993) Nature
364, 593-599.
Steitz, T. A., Smerdon, S. J., Jager, J., and Joyce, C. M. (1994)
Science 266, 2022-2025.
Tabor, S., and Richardson, C. C. (1990) J. Biol. Chem.
265:8322.
Tantillo, C., Jianoing, D., Jacobo-Molina, A., Nanni, R. G., Boyer,
P. L., Hughes, S. H., Pauwels, R., Andiries, K., Janssen, P. A. J.,
and Arnold, E. (1994) J. Mol. Biol. 243, 369-387.
Tabor, S., and Richardson, C. C. (1989) Proc. Natl. Acad. Sci. USA
82, 1074-1078.
Tabor, S., and Richardson, C. C. (1985) Proc. Natl. Acad. Sci. USA
82, 1074-1078.
Osumi-Davis, P. A., Sreerama N., Volkin, D. B., Middaugh, C. R.,
Woody, R. W., Woody, A. Y. (1994) J. Mol. Biol. 237, 5-19.
__________________________________________________________________________
# SEQUENCE LISTING - - - - (1) GENERAL INFORMATION: - - (iii)
NUMBER OF SEQUENCES: 5 - - - - (2) INFORMATION FOR SEQ ID NO:1: - -
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 base - #pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear -
- (ii) MOLECULE TYPE: Other Nucleic Acid - - (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:1: - - GGGAGACCGG AAU - # - # - # 13 - - - -
(2) INFORMATION FOR SEQ ID NO:2: - - (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base - #pairs (B) TYPE: nucleic acid (C)
STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE:
Other Nucleic Acid - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: - -
CGAAATTAAT ACGACTCACT ATA - # - # 23 - - - - (2) INFORMATION FOR
SEQ ID NO:3: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 base
- #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D)
TOPOLOGY: linear - - (ii) MOLECULE TYPE: Other Nucleic Acid - -
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: - - GGGGGGGGGG GACT - # - #
- # 14 - - - - (2) INFORMATION FOR SEQ ID NO:4: - - (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 12 base - #pairs (B) TYPE: nucleic
acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii)
MOLECULE TYPE: Other Nucleic Acid - - (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:4: - - GGACACGGCG AA - # - # - # 12 - - - - (2)
INFORMATION FOR SEQ ID NO:5: - - (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 47 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Other Nucleic
Acid - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: - - CCCGGGATGG
AATGGAGTAT TCGCCGTGTC CATGGCTGTA AGTATCC - # 47
__________________________________________________________________________
* * * * *