U.S. patent number 6,057,103 [Application Number 08/918,406] was granted by the patent office on 2000-05-02 for screening for novel bioactivities.
This patent grant is currently assigned to Diversa Corporation. Invention is credited to Jay M. Short.
United States Patent |
6,057,103 |
Short |
May 2, 2000 |
**Please see images for:
( Certificate of Correction ) ** |
Screening for novel bioactivities
Abstract
Disclosed is a process for identifying clones having a specified
activity of interest, which process comprises (i) generating one or
more expression libraries derived from nucleic acid directly
isolated from the environment; and (ii) screening said libraries
utilizing an assay system. More particularly, this is a process for
identifying clones having a specified activity of interest by (i)
generating one or more expression libraries derived from nucleic
acid directly or indirectly isolated from the environment; (ii)
exposing said libraries to a particular substrate or substrates of
interest; and (iii) screening said exposed libraries utilizing a
fluorescence activated cell sorter to identify clones which react
with the substrate or substrates. Also provided is a process for
identifying clones having a specified activity of interest by (i)
generating one or more expression libraries derived from nucleic
acid directly or indirectly isolated from the environment; and (ii)
screening said exposed libraries utilizing an assay requiring a
binding event or the covalent modification of a target, and a
fluorescence activated cell sorter to identify positive clones.
Inventors: |
Short; Jay M. (Encinitas,
CA) |
Assignee: |
Diversa Corporation (San Diego,
CA)
|
Family
ID: |
25440325 |
Appl.
No.: |
08/918,406 |
Filed: |
August 26, 1997 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
657409 |
Jun 3, 1996 |
5958672 |
|
|
|
568994 |
Dec 7, 1995 |
|
|
|
|
503606 |
Jul 18, 1995 |
|
|
|
|
Current U.S.
Class: |
435/6.14;
435/91.1; 435/91.2; 436/501; 536/23.1; 536/24.3; 536/24.31;
536/24.32; 536/24.33; 536/25.4 |
Current CPC
Class: |
C12N
15/1034 (20130101); C12N 15/1086 (20130101); C12N
15/1093 (20130101); C12N 15/52 (20130101); C12Q
1/00 (20130101) |
Current International
Class: |
C12N
15/10 (20060101); C12N 15/52 (20060101); C12Q
1/68 (20060101); C12Q 1/00 (20060101); C12Q
001/68 (); C12P 019/34 (); C07H 021/02 (); C07H
021/04 () |
Field of
Search: |
;435/6,91.1,91.2,172.3
;536/23.1,24.3,24.31,24.32,24.33,25.4 ;436/501 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
Other References
Dynal Technical Handbook, "Biomagnetic Techniques in Molecular
Biology", pp. 78-89, 1995. .
Nakamura et al, "The murine lymphotoxin-B receptor cDNA: isolation
by the signal sequences trap and chromosomal mapping", Genomics
30:312-319, 1995. .
Eberwine et al, "Isolation of enzyme cDNA clones by enzyme
immunodetection assay: Isolation of a peptide acetyltransferase",
Proc. Natl. Acad. Sci. 84:1449-1453, Mar. 1987..
|
Primary Examiner: Fredman; Jeffrey
Attorney, Agent or Firm: Gray Cary Ware & Freidenrich
LLP Haile; Lisa A.
Parent Case Text
This application is a continuation-in-part of U.S. application Ser.
No. 08/657,409, which was filed on Jun. 3, 1996 now U.S. Pat. No.
5,958,672, which is a continuation-in-part of U.S. application Ser.
No. 08/568,994 which was filed on Dec. 7, 1995 (now abandoned)
which is a continuation-in-part of U.S. application Ser. No.
08/503,606 which was filed on Jul. 18, 1995 (now abandoned).
Claims
What is claimed is:
1. A method for identifying a desired activity encoded by a genomic
DNA population comprising:
(a) obtaining a single-stranded genomic DNA population;
(b) contacting the single-stranded DNA population of (a) with a DNA
probe bound to a ligand under conditions and for sufficient time to
allow hybridization and to produce a double-stranded complex of
probe and members of the genomic DNA population which hybridize
thereto;
(c) contacting the double-stranded complex of (b) with a solid
phase specific binding partner for said ligand so as to produce a
solid phase complex;
(d) separating the solid phase complex from the single-stranded DNA
population of (b);
(e) releasing from the probe the members of the genomic population
which had bound to the solid phase bound probe;
(f) forming double-stranded DNA from the members of the genomic
population of (e);
(g) introducing the double-stranded DNA of (f) into a suitable host
cell to produce an expression library containing a plurality of
clones containing and expressing the selected DNA;
(h) producing a cell-free extract of the expression library,
(i) combining the expression library extract with a host cell-free
protein extract from a metabolically rich host organism to form an
extract mixture, and
(j) screening the extract mixture for a desired activity resulting
from the combining of the cell-free extracts.
2. The method of claim 1, wherein the genomic DNA population is
derived from uncultivated or microorganisms.
3. The method of claim 2, wherein the uncultivated or cultivated
microorganisms are isolated from an environmental sample.
4. The method of claim 3, wherein the microorganisms isolated from
an environmental sample are extremophiles.
5. The method of claim 4, wherein the extremophiles are selected
from the group consisting of thermophiles, hyperthermophiles,
psychrophiles, halophiles, acidophiles, barophiles and
psychrotrophs.
6. The method of claim 1, wherein the genomic DNA, or fragments
thereof, comprise one or more operons, or portions thereof.
7. The method of claim 6, wherein the operons, or portions thereof,
encodes a complete or partial metabolic pathway.
8. The method of claim 7, wherein the operons or portions thereof
encoding a complete or partial metabolic pathway encodes polyketide
syntheses.
9. The method of claim 1, wherein the expression library containing
a plurality of clones is selected from the group consisting of
phage, plasmids, phagemids, cosmids, phosmids, viral vectors and
artificial chromosomes.
10. The method of claim 1, wherein the a suitable host cell is
selected from the group consisting of a bacterium, fungus, plant
cell, insect cell and animal cell.
11. The method of claim 1, wherein the DNA probe bound to a ligand
is comprised of at least a portion of the coding region sequence of
DNA for a known bioactivity.
12. The method of claim 1, wherein the ligand is selected from the
group consisting of antigens or haptens, biotin or iminobiotin,
sugars, enzymes, apoenzymes, homopolymeric oligonucleotides and
hormones.
13. The method of claim 1, wherein the binding partner for said
ligand is selected from the group consisting of antibodies or
specific binding fragments thereof, avidin or streptavidin,
lectins, enzyme inhibitors, apoenzyme cofactors, homopolymeric
oligonucleotides and hormone receptors.
14. The method of claim 1, wherein a solid phase is selected from
the group consisting of a glass or polymeric surface, a packed
column of polymeric beads or magnetic or paramagnetic
particles.
15. The method of claim 1, wherein the host organism is
Streptomyces.
16. The method of claim 1, wherein the host organism is
Bacillus.
17. A method for preselecting a desired DNA from a genomic DNA
population comprising:
(a) obtaining a single-stranded genomic DNA population;
(b) contacting the single-stranded DNA population of (a) with a
ligand-bound oligonucleotide probe that is complementary to a
secretion signal sequence unique to a given class of proteins under
conditions permissive of hybridization to form a double-stranded
complex;
(c) contacting the double-stranded complex of (a) with a solid
phase specific binding partner for said ligand so as to produce a
solid phase complex;
(d) separating the solid phase complex from the single-stranded DNA
population of (a);
(e) releasing the members of the genomic population which had bound
to said solid phase bound probe;
(f) separating the solid phase bound probe from the members of the
genomic population which hand bound thereto;
(g) forming double-stranded DNA from the members of the genomic
population of (e);
(h) introducing the double-stranded DNA of (g) into a suitable host
cell to form an expression library containing a plurality of clones
containing the selected DNA;
(i) producing a cell-free extract of the expression library,
(j) combining the expression library extract with a host cell-free
protein extract from a metabolically rich host organism to form an
extract mixture, and
(k) screening the extract mixture for a desired activity resulting
from the combining of the cell-free extracts.
18. The method of claim 17, wherein the genomic DNA population is
derived from uncultivated or cultivated microorganisms.
19. The method of claim 17, wherein the uncultivated or cultivated
microorganisms are isolated from an environmental sample.
20. The method of claim 19, wherein the microorganisms isolated
from an environmental sample are extremophiles.
21. The method of claim 20, wherein the extremophiles are selected
from the group consisting of thermophiles, hyperthermophiles,
psychrophiles, halophiles, acidophiles, barophiles and
psychrotrophs.
22. The method of claim 17, wherein the genomic DNA, or fragments
thereof, comprise one or more operons, or portions thereof.
23. The method of claim 22, wherein the operons, or portions
thereof, encodes a complete or partial metabolic pathway.
24. The method of claim 23, wherein the operons or portions thereof
encoding a complete or partial metabolic pathway encodes polyketide
syntheses.
25. The method of claim 17, wherein the expression library
containing a plurality of clones is selected from the group
consisting of phage, plasmids, phagemids, cosmids, phosmids, viral
vectors and artificial chromosomes.
26. The method of claim 17, wherein the a suitable host cell is
selected from the group consisting of a bacterium, fungus, plant
cell, insect cell and animal cell.
27. The method of claim 17, wherein the DNA probe bound to a ligand
is comprised of at least a portion of the coding region sequence of
DNA for a known bioactivity.
28. The method of claim 17, wherein the ligand is selected from the
group consisting of antigens or haptens, biotin or iminobiotin,
sugars, enzymes, apoenzymes, homopolymeric oligonucleotides and
hormones.
29. The method of claim 17, wherein the binding partner for said
ligand is selected from the group consisting of antibodies or
specific binding fragments thereof, avidin or streptavidin,
lectins, enzyme inhibitors, apoenzyme cofactors, homopolymeric
oligonucteotides and hormone receptors.
30. The method of claim 17, wherein a solid phase is selected from
the group consisting of a glass or polymeric surface, a packed
column of polymeric beads or magnetic or paramagnetic
particles.
31. The method of claim 17, wherein the host organism is
Streptomyces.
32. The method of claim 17, wherein the host organism is
Bacillus.
33. A method for identifying a desired bioactivity or biomolecule
comprising:
(a) producing one or more expression libraries containing clones
derived from nucleic acid directly isolated from the
environment;
(b) producing a cell-free extract of proteins produced by the
expression library,
(c) combining the cell-free extract from expression library or
libraries with crude or partially purified extracts, or pure
proteins from a metabolically rich cell line to form an extract
mixture free from the library and cell line cells, and
(d) screening said mixture to identify an activity or molecule
produced by the extract mixture.
Description
FIELD OF THE INVENTION
The present invention relates to the discovery of new bio-active
molecules, such as antibiotics, anti-virals, anti-tumor agents and
regulatory proteins. More particularly, the invention relates to a
system for capturing genes potentially encoding novel biochemical
pathways of interest in prokaryotic systems, and screening for
these pathways utilizing high throughput screening assays.
BACKGROUND OF THE INVENTION
Within the last decade there has been a dramatic increase in the
need for bioactive compounds with novel activities. This demand has
arisen largely from changes in worldwide demographics coupled with
the clear and increasing trend in the number of pathogenic
organisms that are resistant to currently available antibiotics.
For example, while there has been a surge in demand for
antibacterial drugs in emerging nations with young populations,
countries with aging populations, such as the US, require a growing
repertoire of drugs against cancer, diabetes, arthritis and other
debilitating conditions. The death rate from infectious diseases
has increased 58% between 1980 and 1992 and it has been estimated
that the emergence of antibiotic resistant microbes has added in
excess of $30 billion annually to the cost of health care in the US
alone. (Adams et al., Chemical and Engineering News, 1995; Amann et
al., Microbiological Reviews, 59, 1995). As a response to this
trend pharmaceutical companies have significantly increased their
screening of microbial diversity for compounds with unique
activities or specificities.
There are several common sources of lead compounds (drug
candidates), including natural product collections, synthetic
chemical collections, and synthetic combinatorial chemical
libraries, such as nucleotides, peptides, or other polymeric
molecules. Each of these sources has advantages and disadvantages.
The success of programs to screen these candidates depends largely
on the number of compounds entering the programs, and
pharmaceutical companies have to date screened hundred of thousands
of synthetic and natural compounds in search of lead compounds.
Unfortunately, the ratio of novel to previously-discovered
compounds has diminished with time. The discovery rate of novel
lead compounds has not kept pace with demand despite the best
efforts of pharmaceutical companies. There exists a strong need for
accessing new sources of potential drug candidates.
The majority of bioactive compounds currently in use are derived
from soil microorganisms. Many microbes inhabiting soils and other
complex ecological communities produce a variety of compounds that
increase their ability to survive and proliferate. These compounds
are generally thought to be nonessential for growth of the organism
and are synthesized with the aid of genes involved in intermediary
metabolism hence their name--"secondary metabolites". Secondary
metabolites that influence the growth or survival of other
organisms are known as "bioactive" compounds and serve as key
components of the chemical defense arsenal of both micro- and
macroorganisms. Humans have exploited these compounds for use as
antibiotics, antiinfectives and other bioactive compounds with
activity against a broad range of prokaryotic and eukaryotic
pathogens. Approximately 6,000 bioactive compounds of microbial
origin have been characterized, with more than 60% produced by the
gram positive soil bacteria of the genus Streptomyces. (Barnes et
al., Proc.Nat. Acad. Sci. U.S.A., 91, 1994). Of these, at least 70
are currently used for biomedical and agricultural applications.
The largest class of bioactive compounds, the polyketides, include
a broad range of antibiotics, immunosuppressants and anticancer
agents which together account for sales of over $5 billion per
year.
Despite the seemingly large number of available bioactive
compounds, it is clear that one of the greatest challenges facing
modern biomedical science is the proliferation of antibiotic
resistant pathogens. Because of their short generation time and
ability to readily exchange genetic information, pathogenic
microbes have rapidly evolved and disseminated resistance
mechanisms against virtually all classes of antibiotic compounds.
For example, there are virulent strains of the human pathogens
Staphylococcus and Streptococcus that can now be treated with but a
single antibiotic, vancomycin, and resistance to this compound will
require only the transfer of a single gene, vanA, from resistant
Enterococcus species for this to occur. (Bateson et al., System.
Appl. Microbiol, 12, 1989). When this crucial need for novel
antibacterial compounds is superimposed on the growing demand for
enzyme inhibitors, immunosuppressants and anti-cancer agents it
becomes readily apparent why pharmaceutical companies have stepped
up their screening of microbial diversity for bioactive compounds
with novel properties.
The approach currently used to screen microbes for new bioactive
compounds has been largely unchanged since the inception of the
field. New isolates of bacteria, particularly gram positive strains
from soil environments, are collected and their metabolites tested
for pharmacological activity. A more recent approach has been to
use recombinant techniques to synthesize hybrid antibiotic pathways
by combining gene subunits from previously characterized pathways.
This approach, called "combinatorial biosynthesis" has focused
primarily on the polyketide antibiotics and has resulted in a
number of structurally unique compounds which have displayed
activity. (Betz et al., Cytometry, 5, 1984; Davey et al.,
Microbiological Reviews, 60, 1989). However, compounds with novel
antibiotic activities have not yet been reported; an observation
that may be do to the fact that the
pathway subunits are derived from those encoding previously
characterized compounds. Dramatic success in using recombinant
approaches due to small molecule synthesis has been recently
reported in the engineering of biosynthetic pathways to increase
the production of desirable antibiotics. (Diaper et al., Appl.
Bacteriol., 77, 1994; Enzyme Nomenclature, Academic Press: NY,
1992).
There is still tremendous biodiversity that remains untapped as the
source of lead compounds. However, the currently available methods
for screening and producing lead compounds cannot be applied
efficiently to these under-explored resources. For instance, it is
estimated that at least 99% of marine bacteria species do not
survive on laboratory media, and commercially available
fermentation equipment is not optimal for use in the conditions
under which these species will grow, hence these organisms are
difficult or impossible to culture for screening or re-supply.
Recollection, growth, strain improvement, media improvement and
scale-up production of the drug-producing organisms often pose
problems for synthesis and development of lead compounds.
Furthermore, the need for the interaction of specific organisms to
synthesize some compounds makes their use in discovery extremely
difficult. New methods to harness the genetic resources and
chemical diversity of these untapped sources of compounds for use
in drug discovery are very valuable. The present invention provides
a path to access this untapped biodiversity and to rapidly screen
for activities of interest utilizing recombinant DNA technology.
This invention combines the benefits associated with the ability to
rapidly screen natural compounds with the flexibility and
reproducibility afforded with working with the genetic material of
organisms.
The present invention allows one to identify genes encoding
bioactivities of interest from complex environmental gene
expression libraries, and to manipulate cloned pathways to evolve
recombinant small molecules with unique activities. Bacteria and
many eukaryotes have a coordinated mechanism for regulating genes
whose products are involved in related processes. The genes are
clustered, in structures referred to as "gene clusters," on a
single chromosome and are transcribed together under the control of
a single regulatory sequence, including a single promoter which
initiates transcription of the entire cluster. The gene cluster,
the promoter, and additional sequences that function in regulation
altogether are referred to as an "operon" and can include up to 20
or more genes, usually from 2 to 6 genes. Thus, a gene cluster is a
group of adjacent genes that are either identical or related,
usually as to their function. Gene clusters are of interest in drug
discovery processes since product(s) of gene clusters include, for
example, antibiotics, antivirals, antitumor agents and regulatory
proteins.
Some gene families consist of one or more identical members.
Clustering is a prerequisite for maintaining identity between
genes, although clustered genes are not necessarily identical. Gene
clusters range from extremes where a duplication is generated of
adjacent related genes to cases where hundreds of identical genes
lie in a tandem array. Sometimes no significance is discernable in
a repetition of a particular gene. A principal example of this is
the expressed duplicate insulin genes in some species, whereas a
single insulin gene is adequate in other mammalian species.
Gene clusters undergo continual reorganization and, thus, the
ability to create heterogeneous libraries of gene clusters from,
for example, bacterial or other prokaryote sources is valuable in
determining sources of novel bioactivities, including enzymes such
as, for example, the polyketide synthases that are responsible for
the synthesis of polyketides having a vast array of useful
activities.
Polyketides are molecules which are an extremely rich source of
bioactivities, including antibiotics (such as tetracyclines and
erythromycin), anti-cancer agents (daunomycin), immunosuppressants
(FK506 and rapamycin), and veterinary products (monensin). Many
polyketides (produced by polyketide synthases) are valuable as
therapeutic agents. Polyketide synthases (PKSs) are multifunctional
enzymes that catalyze the biosynthesis of a huge variety of carbon
chains differing in length and patterns of functionality and
cyclization. Despite their apparent structural diversity, they are
synthesized by a common pathway in which units derived from acetate
or propionate are condensed onto the growing chain in a process
resembling fatty acid biosynthesis. The intermediates remain bound
to the polyketide synthase during multiple cycles of chain
extension and (to a variable extent) reduction of the
(.beta.-ketone group formed in each condensation. The structural
variation between naturally occurring polyketides arises largely
from the way in which each PKS controls the number and type of
units added, and from the extent and stereochemistry of reduction
at each cycle. Still greater diversity is produced by the action of
regiospecific glycosylases, methyltransferases and oxidative
enzymes on the product of the PKS.
Polyketide synthase genes fall into gene clusters. At least one
type (designated type I) of polyketide synthases have large size
genes and encoded enzymes, complicating genetic manipulation and in
vitro studies of these genes/proteins. Progress in understanding
the enzymology of such type I systems have previously been
frustrated by the lack of cell-free systems to study polyketide
chain synthesis by any of these multienzymes, although several
partial reactions of certain pathways have been successfully
assayed in vitro. Cell-free enzymatic synthesis of complex
polyketides has proved unsuccessful, despite more than 30 years of
intense efforts, presumably because of the difficulties in
isolating fully active forms of these large, poorly expressed
multifunctional proteins from naturally occurring producer
organisms, and because of the relative lability of intermediates
formed during the course of polyketide biosynthesis. In an attempt
to overcome some of these limitations, modular PKS subunits have
been expressed in heterologous hosts such as Escherichia coli and
Streptomyces coelicolor. Whereas the proteins expressed in E. coli
are not fully active, heterologous expression of certain PKSs in S.
coelicolor resulted in the production of active protein. Cell-free
enzymatic synthesis of polyketides from PKSs with substantially
fewer active sites, such as the 6-methylsalicylate synthase,
chalcone synthase, tetracenomycin synthase, and the PKS responsible
for the polyketide component of cyclosporin, have been
reported.
Hence, studies have indicated that in vitro synthesis of
polyketides is possible, however, synthesis was always performed
with purified enzymes. Heterologous expression of genes encoding
PKS modular subunits have allowed synthesis of functional
polyketides in vivo, however, there are several challenges
presented by this approach, which had to be overcome. The large
sizes of modular PKS gene clusters (>30 kb) make their
manipulation on plasmids difficult. Modular PKSs also often utilize
substrates which may be absent in a heterologous host. Finally,
proper folding, assembly, and posttranslational modification of
very large foreign polypeptides are not guaranteed.
Novel systems to clone and screen for bioactivities of interest in
vitro are desirable. The method(s) of the present invention allow
the cloning and discovery of novel bioactive molecules in vitro,
and in particular novel bioactive molecules derived from
uncultivated samples. Large size gene clusters can be cloned and
screened using the method(s) of the present invention. Unlike
previous strategies, the method(s) of the present invention allow
one to clone utilizing well known genetic systems, and to screen in
vitro with crude (impure) preparations.
SUMMARY OF THE INVENTION
The present invention allows one to clone genes potentially
encoding novel biochemical pathways of interest in prokaryotic
systems, and screen for these pathways utilizing a novel process.
Sources of the genes may be isolated, individual organisms
("isolates"), collections of organisms that have been grown in
defined media ("enrichment cultures"), or, most preferably,
uncultivated organisms ("environmental samples"). The use of a
culture-independent approach to directly clone genes encoding novel
bioactivities from environmental samples is most preferable since
it allows one to access untapped resources of biodiversity.
"Environmental libraries" are generated from environmental samples
and represent the collective genomes of naturally occurring
organisms archived in cloning vectors that can be propagated in
suitable prokaryotic hosts. Because the cloned DNA is initially
extracted directly from environmental samples, the libraries are
not limited to the small fraction of prokaryotes that can be grown
in pure culture. Additionally, a normalization of the environmental
DNA present in these samples could allow more equal representation
of the DNA from all of the species present in the original sample.
This can dramatically increase the efficiency of finding
interesting genes from minor constituents of the sample which may
be under-represented by several orders of magnitude compared to the
dominant species.
In the evaluation of complex environmental expression libraries, a
rate limiting step occurs at the level of discovery of
bioactivities. The present invention allows the rapid screening of
complex environmental expression libraries, containing, for
example, thousands of different organisms.
In the present invention, for example, gene libraries generated
from one or more uncultivated microorganisms are screened for an
activity of interest. Potential pathways encoding bioactive
molecules of interest are first captured in prokaryotic cells in
the form of gene expression libraries; crude or partially purified
extracts, or pure proteins from metabolically rich cell lines are
then combined with the gene expression libraries to create
potentially active molecules; and the combination is screened for
an activity of interest.
Common approaches to drug discovery involve screening assays in
which disease targets (macromolecules implicated in causing a
disease) are exposed to potential drug candidates which are tested
for therapeutic activity. In other approaches, whole cells or
organisms that are representative of the causative agent of the
disease, such as bacteria or tumor cell lines, are exposed to the
potential candidates for screening purposes. Any of these
approaches can be employed with the present invention.
The present invention also allows for the transfer of cloned
pathways derived from uncultivated samples into metabolically rich
hosts for heterologous expression and downstream screening for
bioactive compounds of interest using a variety of screening
approaches briefly described above.
Accordingly, in one aspect, the present invention provides a
process for identifying clones encoding a specified activity of
interest, which process comprises (i) generating one or more
expression libraries derived from nucleic acid directly isolated
from the environment; and (ii) combining the expression libraries
with crude or partially purified extracts, or pure proteins from
metabolically rich cell lines; and (iii) screening said libraries
utilizing any of a variety of screening assays to identify said
clones.
In another aspect, the present invention provides a process for
identifying clones encoding a specified activity of interest, which
process comprises (i) generating one or more expression libraries
derived from nucleic acid directly isolated from the environment;
and (ii) transferring the clones into a metabolically rich cell
line; and (iii) screening said cell line utilizing any of a variety
of screening assays to identify said clones.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows a scheme to capture, clone and archive large genome
fragments from uncultivated microbes from natural environments. The
cloning vectors used in this process can archive from 40 kbp
(fosmids) to greater than 100 kbp (BACs).
FIG. 2 shows the nucleotide alignment of a region of the
ketosynthase I gene of polyketide pathways from a variety of
Streptomyces species. These regions are aligned with a homologous
region encoding a fatty acid synthase from E. coli. Observed
sequence differences were used to construct probes that hybridize
to cloned polyketide sequences but not to fatty acid sequences
carried by the E. Coli host strain.
FIG. 3 shows an example of a high density filter array of
environmental fosmid clones probed with a labeled oligonucleotide
probe. The 2400 arrayed clones contain approximately 96 million
base pairs of DNA cloned from a naturally occurring microbial
community.
FIG. 4 shows the results of mixed extract experiment measuring
conferral of bioactivity on recombinant backbones heterologously
expressed in E. coli. A. Organic extracts from 3 oxytetracylin
clones (1-3) and 3 gramicidin clones (4-6) were incubated with a
protein extract from Streptomyces lividans strain TK24. After
incubation the mixture was reextracted with methyl ethyl ketone,
spotted on to filter disks, allowed to dry, then placed on a lawn
of an E. coli test strain. Distinct zones of clearing can be seen
around disks 2, 3 and 5. Extracts from 2 and 3 were subsequently
seperated by thin layer chromatography which showed UV fluorescent
spots with similar Rf and appearance to authentic oxytetracylin. B.
Filters corresponding to those in A but without incubation with
protein extract from Streptomyces. The Streptomyces extract alone
also showed no bioactivity.
FIG. 5 shows a strategy for FACS screening for recombinant
bioactive molecules in Streptomyces venezuelae.
FIG. 6 shows a micrograph of pMF4 oxytetracyclin clone expressed in
S. lividans strain TK24. The red fluorescence near the end of the
mycelia suggests that recombinant expression of oxytetracyclin may
be induced at the onset sporulation as is the activity of the
endogenous actinorhodin pathway.
FIG. 7 shows an approach to screen for small molecules that enhance
or inhibit transcription factor initiation. Both the small molecule
pathway and the GFP reporter construct are co-expressed. Clones
altered in GFP expression can then be sorted by FACS and the
pathway clone isolated for characterization.
FIG. 8 shows the gene replacement vector pLL25 designed to
inactivate the actinorhodin pathway in Streptomyces lividans strain
TK24.
FIG. 9 shows the possible recombination events and predicted
phenotypes from replacement of the actinorhodin gene cluster in S.
lividans by the spectinomycin gene resident on pLL25.
FIG. 10 shows a tandem duplication of a pMF3 clone into the S.
lividans chromosome. Duplicated clones will contain cos sites at
the appropriate spacing for lambda packaging.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
Sample Source/Collection
The method of the present invention begins with the construction of
gene libraries which represent the collective genomes of naturally
occurring organisms archived in cloning vectors that can be
propagated in suitable prokaryotic hosts.
The microorganisms from which the libraries may be prepared include
prokaryotic microorganisms, such as Eubacteria and Archaebacteria,
and lower eukaryotic microorganisms such as fungi, some algae and
protozoa. Libraries may be produced from environmental samples in
which case DNA may be recovered without culturing of an organism or
the DNA may be recovered from one or more cultured organisms. Such
microorganisms may be extremophiles, such as hyperthermophiles,
psychrophiles, psychrotrophs, halophiles, barophiles, acidophiles,
etc.
The microorganisms from which the libraries may be prepared may be
collected using a variety of techniques known in the art. Samples
may also be collected using the methods detailed in the example
provided below. Briefly, the example below provides a method of
selective in situ enrichment of bacterial and archaeal species
while at the same time inhibiting the proliferation of eukaryotic
members of the population. In situ enrichments can to increase the
likelihood of recovering rare species and previously uncultivated
members of a microbial population. If one desires to obtain
bacterial and archaeal species, nucleic acids from
eukaryotes in an environmental sample can seriously complicate DNA
library construction and decrease the number of desired bacterial
species by grazing. The method described below employs selective
agents, such as antifungal agents, to inhibit the growth of
eukaryotic species.
In situ enrichment is achieved by using a microbial containment
device composed of growth substrates and nutritional amendments
with the intent to lure, selectively, members of the surrounding
environmental matrix. Choice of substrates (carbon sources) and
nutritional amendments (ie, nitrogen, phosphorous, etc.) is
dependent upon the members of the community for which one desires
to enrich. Selective agents against eukaryotic members are also
added to the trap. Again, the exact composition depends upon which
members of the community one desires to enrich and which members of
the community one desires to inhibit. Some of the enrichment
"media" which may be useful in pulling out particular members of
the community is described in the example provided herein.
Sources of microorganism DNA as a starting material library from
which target DNA is obtained are particularly contemplated to
include environmental samples, such as microbial samples obtained
from Arctic and Antarctic ice, water or permafrost sources,
materials of volcanic origin, materials from soil or plant sources
in tropical areas, etc. Thus, for example, genomic DNA may be
recovered from either a culturable or non-culturable organism and
employed to produce an appropriate recombinant expression library
for subsequent determination of a biological activity.
DNA Isolation
The preparation of DNA from the sample is an important step in the
generation DNA libraries from environmental samples composed of
uncultivated organisms, or for the generation of libraries from
cultivated organisms. DNA can be isolated from samples using
various techniques well known in the art (Nucleic Acids in the
Environment Methods & Applications, J. T. Trevors, D. D. van
Elsas, Springer Laboratory, 1995). Preferably, DNA obtained will be
of large size and free of enzyme inhibitors or other contaminants.
DNA can be isolated directly from an environmental sample (direct
lysis), or cells may be harvested from the sample prior to DNA
recovery (cell separation). Direct lysis procedures have several
advantages over protocols based on cell separation. The direct
lysis technique provides more DNA with a generally higher
representation of the microbial community, however, it is sometimes
smaller in size and more likely to contain enzyme inhibitors than
DNA recovered using the cell separation technique. Very useful
direct lysis techniques have been described which provide DNA of
high molecular weight and high purity (Barns, 1994; Holben, 1994).
If inhibitors are present, there are several protocols which
utilize cell isolation which can be employed (Holben, 1994).
Additionally, a fractionation technique, such as the bis-benzimide
separation (cesium chloride isolation) described herein, can be
used to enhance the purity of the DNA.
Isolation of total genomic DNA from extreme environmental samples
varies depending on the source and quantity of material.
Uncontaminated, good quality (>20 kbp) DNA is required for the
construction of a representative library for the present invention.
A successful general DNA isolation protocol is the standard
cetyl-trimethyl-ammonium-bromide (CTAB) precipitation technique. A
biomass pellet is lysed and proteins digested by the nonspecific
protease, proteinase K, in the presence of the detergent SDS. At
elevated temperatures and high salt concentrations, CTAB forms
insoluble complexes with denatured protein, polysaccharides and
cell debris. Chloroform extractions are performed until the white
interface containing the CTAB complexes is reduced substantially.
The nucleic acids in the supernatant are precipitated with
isopropanol and resuspended in TE buffer.
For cells which are recalcitrant to lysis, a combination of
chemical and mechanical methods with cocktails of various
cell-lysing enzymes may be employed. Isolated nucleic acid may then
further be purified using small cesium gradients.
A further example of an isolation strategy is detailed in an
example below. This type of isolation strategy is optimal for
obtaining good quality, large size DNA fragments for cloning.
Normalization
The present invention can further optimize methods for isolation of
activities of interest from a variety of sources, including
consortias of microorganisms, primary enrichments, and
environmental "uncultivated" samples. Libraries which have been
"normalized" in their representation of the genome populations in
the original samples are possible with the present invention. These
libraries can then be screened utilizing the methods of the present
invention, for enzyme and other bioactivities of interest.
Libraries with equivalent representation of genomes from microbes
that can differ vastly in abundance in natural populations are
generated and screened. This "normalization" approach reduces the
redundancy of clones from abundant species and increases the
representation of clones from rare species. These normalized
libraries allow for greater screening efficiency resulting in the
identification of cells encoding novel biological catalysts.
In one embodiment, viable or non-viable cells isolated from the
environment are, prior to the isolation of nucleic acid for
generation of the expression gene library, FACS sorted to separate
cells from the sample based on, for instance, DNA or AT/GC content
of the cells. Various dyes or stains well known in the art, for
example those described in "Practical Flow Cytometry", 1995
Wiley-Liss, Inc., Howard M. Shapiro, M.D., are used to intercalate
or associate with nucleic acid of cells, and cells are separated on
the FACS based on relative DNA content or AT/GC DNA content in the
cells. Other criteria can be used to separate cells from the
sample, as well. DNA is then isolated from the cells and used for
the generation of expression gene libraries, which are then
screened for activities of interest.
Alternatively, the nucleic acid is isolated directly from the
environment and is, prior to generation of the gene library, sorted
based on DNA or AT/GC content. DNA isolated directly from the
environment, is used intact, randomly sheared or digested to
general fragmented DNA. The DNA is then bound to an intercalating
agent as described above, and separated on the analyzer based on
relative base content to isolate DNA of interest. Sorted DNA is
then used for the generation of gene libraries, which are then
screened for activities of interest.
As indicated, one embodiment for forming a normalized library from
an environmental sample begins with the isolation of nucleic acid
from the sample. This nucleic acid can then be fractionated prior
to normalization to increase the chances of cloning DNA from minor
species from the pool of organisms sampled. DNA can be fractionated
using a density centrifugation technique, such as a cesium-chloride
gradient. When an intercalating agent, such as bis-benzimide is
employed to change the buoyant density of the nucleic acid,
gradients will fractionate the DNA based on relative base content.
Nucleic acid from multiple organisms can be separated in this
manner, and this technique can be used to fractionate complex
mixtures of genomes. This can be of particular value when working
with complex environmental samples. Alternatively, the DNA does not
have to be fractionated prior to normalization. Samples are
recovered from the fractionated DNA, and the strands of nucleic
acid are then melted and allowed to selectively reanneal under
fixed conditions(Cot driven hybridization). When a mixture of
nucleic acid fragments is melted and allowed to reanneal under
stringent conditions, the common sequences find their complementary
strands faster than the rare sequences. After an optional
single-stranded nucleic acid isolation step, single-stranded
nucleic acid representing an enrichment of rare sequences is
amplified using techniques well known in the art, such as a
polymerase chain reaction (Barnes, 1994), and used to generate gene
libraries. This procedure leads to the amplification of rare or low
abundance nucleic acid molecules, which are then used to generate a
gene library which can be screened for a desired bioactivity. While
DNA will be recovered, the identification of the organism(s)
originally containing the DNA may be lost. This method offers the
ability to recover DNA from "unclonable" sources. This method is
further detailed in the example below.
Hence, one embodiment for forming a normalized library from
environmental sample(s) is by (a) isolating nucleic acid from the
environmental sample(s); (b) optionally fractionating the nucleic
acid and recovering desired fractions; (c) normalizing the
representation of the DNA within the population so as to form a
normalized expression library from the DNA of the environmental
sample(s). The normalization process is described and exemplified
in detail in co-pending, commonly assigned U.S. Ser. No.
08/665,565, filed Jun. 18, 1996.
Gene Libraries
Gene libraries can be generated by inserting the normalized or
non-normalized DNA isolated or derived from a sample into a vector
or a plasmid. Such vectors or plasmids are preferably those
containing expression regulatory sequences, including promoters,
enhancers and the like. Such polynucleotides can be part of a
vector and/or a composition and still be isolated, in that such
vector or composition is not part of its natural environment.
Particularly preferred phage or plasmids and methods for
introduction and packaging into them are described herein.
The examples below detail procedures for producing libraries from
both cultured and non-cultured organisms.
Cloning of DNA fragments prepared by random cleavage of the target
DNA can also be used to generate a representative library. DNA
dissolved in TE buffer is vigorously passed through a 25 gauge
double-hubbed needle until the sheared fragments are in the desired
size range. The DNA ends are "polished" or blunted with Mung Bean
Nuclease, and EcoRI restriction sites in the target DNA are
protected with EcoRI Methylase. EcoRI linkers (GGAATTCC) are
ligated to the blunted/protected DNA using a very high molar ratio
of linkers to target DNA. This lowers the probability of two DNA
molecules ligating together to create a chimeric clone. The linkers
are cut back with EcoRI restriction endonuclease and the DNA is
size fractionated. The removal of sub-optimal DNA fragments and the
small linkers is critical because ligation to the vector will
result in recombinant molecules that are unpackageable, or the
construction of a library containing only linkers as inserts.
Sucrose gradient fractionation is used since it is extremely easy,
rapid and reliable. Although the sucrose gradients do not provide
the resolution of agarose gel isolations, they do produce DNA that
is relatively free of inhibiting contaminants. The prepared target
DNA is ligated to the lambda vector, packaged using in vitro
packaging extracts and grown on the appropriate E. coli.
As representative examples of expression vectors which may be used
there may be mentioned viral particles, baculovirus, phage,
plasmids, phagemids, cosmids, fosmids, bacterial artificial
chromosomes, viral DNA (e.g. vaccinia, adenovirus, foul pox virus,
pseudorabies and derivatives of SV40), P1-based artificial
chromosomes, yeast plasmids, yeast artificial chromosomes, and any
other vectors specific for specific hosts of interest (such as
bacillus, aspergillus, yeast, etc.) Thus, for example, the DNA may
be included in any one of a variety of expression vectors for
expressing a polypeptide. Such vectors include chromosomal,
nonchromosomal and synthetic DNA sequences. Large numbers of
suitable vectors are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example; Bacterial: pQE vectors (Qiagen), pBluescript plasmids,
pNH vectors, (lambda-ZAP vectors (Stratagene); ptrc99a, pKK223-3,
pDR540, pRIT2T (Pharmacia); Eukaryotic: pXT1, pSG5 (Stratagene),
pSVK3, pBPV, pMSG, pSVLSV40 (Pharmacia). However, any other plasmid
or other vector may be used as long as they are replicable and
viable in the host. Low copy number or high copy number vectors may
be employed with the present invention.
A preferred type of vector for use in the present invention
contains an f-factor origin replication. The f-factor (or fertility
factor) in E. coli is a plasmid which effects high frequency
transfer of itself during conjugation and less frequent transfer of
the bacterial chromosome itself A particularly preferred embodiment
is to use cloning vectors, referred to as "fosmids" or bacterial
artificial chromosome (BAC) vectors. These are derived from E. coli
f-factor which is able to stably integrate large segments of
genomic DNA. When integrated with DNA from a mixed uncultured
environmental sample, this makes it possible to achieve large
genomic fragments in the form of a stable "environmental DNA
library."
Another preferred type of vector for use in the present invention
is a cosmid vector. Cosmid vectors were originally designed to
clone and propagate large segments of genomic DNA. Cloning into
cosmid vectors is described in detail in Sambrook, et al.,
Molecular Cloning A Laboratory Manual, Second Edition, Cold Spring
Harbor Laboratory Press, 1989.
The DNA sequence in the expression vector is operatively linked to
an appropriate expression control sequence(s) (promoter) to direct
RNA synthesis. Particular named bacterial promoters include lacI,
lacZ, T3, T7, gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic
promoters include CMV immediate early, HSV thymidine kinase, early
and late SV40, LTRs from retrovirus, and mouse metallothionein-I.
Selection of the appropriate vector and promoter is well within the
level of ordinary skill in the art. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression. Promoter regions can be
selected from any desired gene using CAT (chloramphenicol
transferase) vectors or other vectors with selectable markers.
In addition, the expression vectors preferably contain one or more
selectable marker genes to provide a phenotypic trait for selection
of transformed host cells such as dihydrofolate reductase or
neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
Generally, recombinant expression vectors will include origins of
replication and selectable markers permitting transformation of the
host cell, e.g., the ampicillin resistance gene of E. coli and S.
cerevisiae TRP1 gene, and a promoter derived from a
highly-expressed gene to direct transcription of a downstream
structural sequence. Such promoters can be derived from operons
encoding glycolytic enzymes such as 3-phosphoglycerate kinase
(PGK), .alpha.-factor, acid phosphatase, or heat shock proteins,
among others. The heterologous structural sequence is assembled in
appropriate phase with translation initiation and termination
sequences, and preferably, a leader sequence capable of directing
secretion of translated protein into the periplasmic space or
extracellular medium.
The cloning strategy permits expression via both vector driven and
endogenous promoters; vector promotion may be important with
expression of genes whose endogenous promoter will not function in
E. coli.
The DNA derived from a microorganism(s) may be inserted into the
vector by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
The DNA selected and isolated as hereinabove described is
introduced into a suitable host to prepare a library which is
screened for the desired activity. The selected DNA is preferably
already in a vector which includes appropriate control sequences
whereby selected DNA which encodes for a bio-activity may be
expressed, for detection of the desired activity. The host cell is
a prokaryotic cell, such as a bacterial cell. Particularly
preferred host cells are E. coli. Introduction of the construct
into the host cell can be effected by calcium phosphate
transfection, DEAE-Dextran mediated transfection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)). The selection of an appropriate host
is deemed to be within the scope of those skilled in the art from
the teachings herein.
Host cells are genetically engineered (transduced or transformed or
transfected) with the vectors. The engineered host cells can be
cultured
in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying genes.
The culture conditions, such as temperature, pH and the like, are
those previously used with the host cell selected for expression,
and will be apparent to the ordinarily skilled artisan.
Since it appears that many bioactive compounds of bacterial origin
are encoded in contiguous multigene pathways varying from 15 to 100
kbp, cloning large genome fragments is preferred with the present
invention, in order to express novel pathways from natural
assemblages of microorganisms. Capturing and replicating DNA
fragments of 40 to 100 kbp in surrogate hosts such as E. coli,
Bacillus or Streptomyces is in effect "propagating" uncultivated
microbes, albeit in the form of large DNA fragments each
representing from 2 to 5% of a typical eubacterial genome.
Two hurdles that must be overcome to successfully capture large
genome fragments from naturally occurring microbes and to express
multigene pathways from subsequent clones are 1) the low cloning
efficiency of environmental DNA and 2) the inherent instability of
large clones. To overcome these hurdles, high quality large
molecular weight DNA is extracted directly from soil and other
environments and vectors such as the F factor based Bacterial
Artificial Chromosome (BAC) vectors are used to efficiently clone
and propagate large genome fragments. The environmental library
approach (FIG. 1) will process such samples with an aim to archive
and replicate with a high degree of fidelity the collective genomes
in the mixed microbial assemblage. The basis of this approach is
the application of modified Bacterial Artificial Chromosome (BAC)
vectors to stably propagate 100-200 kbp genome fragments. The BAC
vector and its derivative the fosmid (for F factor based cosmid)
use the f-origin of replication to maintain copy number at one or
two per cell. This feature has been shown to be a crucial factor in
maintaining stability of large cloned fragments. High fidelity
replication is especially important in propagating libraries
comprised of high GC organisms such as the Streptomyces from which
clones may be prone to rearrangement and deletion of duplicate
sequences.
Because the fosmid vector uses the highly efficient lambda
packaging system, comprehensive libraries can be assembled with a
minimal amount of starting DNA. Environmental fosmid libraries of
4.times.10.sup.7 clones of the present invention can be generated,
each containing approximately 40 kbp of cloned DNA, from 100 ng of
purified DNA collected from samples, including, for example, from
the microbial containment device described herein.
A potential problem with constructing libraries for the expression
of bioactive compounds in E. coli is that this gram-negative
bacterium may not have the appropriate genetic background to
express the compounds in their active form. One aspect of the
present invention allows the efficient cloning of fragments in E.
coli and the subsequent transfer to a different suitable host for
expression and screening. Shuttle vectors, which allow propagation
in two different types of hosts, can be utilized in the present
invention to clone and propagate in bacterial hosts, such as E.
coli, and transfer to alternative hosts for expression of active
molecules. Such alternative hosts may include but are not limited
to, for example, Streptomyces or Bacillus, or other metabolically
rich hosts such as Cyanobacteria, Myxobacteria, etc. Streptomyces
lividans, for example, may be used as the expression host for the
cloned pathways. This strain is routinely used in the recombinant
expression of heterologous antibiotic pathways because it
recognized a large number of promoters and appears to lack a
restriction system (Guseck, T. W. & Kinsella, J. E., (1992)
Crit. Rev. Microbiol. 18, 247-260).
In the present invention, the example below describes a shuttle
vector which can be utilized. The vector is an E. coli-Streptomyces
shuttle vector. This system allows one to stably clone and express
large inserts (40 kbp genome fragments). Chromosomally integrated
recombinants can be recovered as the original fosmid to facilitate
sequence characterization and further manipulation of positive
clones. Replicons which allow regulation of the clone copy number
in hosts can be utilized. For instance, the SPC2 replicon, a 32 kb
fertility plasmid that is present at one copy per cell in
Streptomyces coelicolor, can be utilized. This replicon can be
"tuned" by truncation to replicate at various copy number in
Streptomyces hosts. For instance, replicative versions of
integrative shuttle vectors may be designed containing the full
length and truncated SCP2 replicon which will regulate the clone
copy number in the Streptomyces host from 1 to 10 copies per
cell.
In order to ensure that the bioactivity of the clones containing
the putative polyketide or other clustered genes is not due to the
activation of any resident gene cluster, the resident gene
sequences can be removed from the host strain by gene replacement
or deletion. An example is presented below.
Biopanning
After the expression libraries have been generated one can include
the additional step of "biopanning" such libraries prior to
transfer to a second host for expression screening. The
"biopanning" procedure refers to a process for identifying clones
having a specified biological activity by screening for sequence
homology in a library of clones prepared by (i) selectively
isolating target DNA, from DNA derived from at least one
microorganism, by use of at least one probe DNA comprising at least
a portion of a DNA sequence encoding an biological having the
specified biological activity; and (ii) transforming a host with
isolated target DNA to produce a library of clones which are then
processed for screening for the specified biological activity.
The probe DNA used for selectively isolating the target DNA of
interest from the DNA derived from at least one microorganism can
be a full-length coding region sequence or a partial coding region
sequence of DNA for an known bioactivity. The original DNA library
can be preferably probed using mixtures of probes comprising at
least a portion of the DNA sequence encoding a known bioactivity
having a desired activity. These probes or probe libraries are
preferably single-stranded and the microbial DNA which is probed
has preferably been converted into single-stranded form. The probes
that are particularly suitable are those derived from DNA encoding
bioactivities having an activity similar or identical to the
specified bioactivity which is to be screened.
The probe DNA should be at least about 10 bases and preferably at
least 15 bases. In one embodiment, an entire coding region of one
part of a pathway may be employed as a probe. Conditions for the
hybridization in which target DNA is selectively isolated by the
use of at least one DNA probe will be designed to provide a
hybridization stringency of at least about 50% sequence identity,
more particularly a stringency providing for a sequence identity of
at least about 70%.
Hybridization techniques for probing a microbial DNA library to
isolate target DNA of potential interest are well known in the art
and any of those which are described in the literature are suitable
for use herein, particularly those which use a solid phase-bound,
directly or indirectly bound, probe DNA for ease in separation from
the remainder of the DNA derived from the microorganisms.
Preferably the probe DNA is "labeled" with one partner of a
specific binding pair (i.e. a ligand) and the other partner of the
pair is bound to a solid matrix to provide ease of separation of
target from its source. The ligand and specific binding partner can
be selected from, in either orientation, the following: (1) an
antigen or hapten and an antibody or specific binding fragment
thereof; (2) biotin or iminobiotin and avidin or streptavidin; (3)
a sugar and a lectin specific therefor; (4) an enzyme and an
inhibitor therefor; (5) an apoenzyme and cofactor; (6)
complementary homopolymeric oligonucleotides; and (7) a hormone and
a receptor therefor. The solid phase is preferably selected from:
(1) a glass or polymeric surface; (2) a packed column of polymeric
beads; and (3) magnetic or paramagnetic particles.
Further, it is optional but desirable to perform an amplification
of the target DNA that has been isolated. In this embodiment the
target DNA is separated from the probe DNA after isolation. It is
then amplified before being used to transform hosts. Long PCR
(Barnes, W M, Proc. Natl. Acad. Sci, USA, Mar. 15, 1994 ) can be
used to amplify large DNA fragments (e.g., 35 kb). The double
stranded DNA selected to include as at least a portion thereof a
predetermined DNA sequence can be rendered single stranded,
subjected to amplification and reannealed to provide amplified
numbers of selected double stranded DNA. Numerous amplification
methodologies are now well known in the art.
The selected DNA is then used for preparing a library for further
processing and screening by transforming a suitable organism.
Hosts, particularly those specifically identified herein as
preferred, are transformed by artificial introduction of the
vectors containing the target DNA by inoculation under conditions
conducive for such transformation.
The resultant libraries of transformed clones are then processed
for screening for clones which display an activity of interest.
Clones can be shuttled in alternative hosts for expression of
active compounds, or screened using methods described herein.
Having prepared a multiplicity of clones from DNA selectively
isolated from an organism, such clones are screened for a specific
activity and to identify the clones having the specified
characteristics.
The screening for activity may be effected on individual expression
clones or may be initially effected on a mixture of expression
clones to ascertain whether or not the mixture has one or more
specified activities. If the mixture has a specified activity, then
the individual clones may be rescreened for such activity or for a
more specific activity. Alternatively, encapsulation techniques
such as gel microdroplets, may be employed to localize multiple
clones in one location to be screened on a FACS machine for
positive expressing clones within the group of clones which can
then be broken out into individual clones to be screened again on a
FACS machine to identify positive individual clones. Screening in
this manner using a FACS machine is fully described in patent
application Ser. No. 08/876,276 filed Jun. 16, 1997. Thus, for
example, if a clone mixture has a desirable activity, then the
individual clones may be recovered and rescreened utilizing a FACS
machine to determine which of such clones has the specified
desirable activity.
As described with respect to one of the above aspects, the
invention provides a process for activity screening of clones
containing selected DNA derived from a microorganism which process
comprises:
screening a library for specified bioactivity, said library
including a plurality of clones, said clones having been prepared
by recovering from genomic DNA of a microorganism selected DNA,
which DNA is selected by hybridization to at least one DNA sequence
which is all or a portion of a DNA sequence encoding a bioactivity
having a desirable activity; and
transforming a host with the selected DNA to produce clones which
are further processed and/or screened for the specified
bioactivity.
In one embodiment, a DNA library derived from a microorganism is
subjected to a selection procedure to select therefrom DNA which
hybridizes to one or more probe DNA sequences which is all or a
portion of a DNA sequence encoding an activity having a desirable
activity by:
(a) rendering the double-stranded genomic DNA population into a
single-stranded DNA population;
(b) contacting the single-stranded DNA population of (a) with the
DNA probe bound to a ligand under conditions permissive of
hybridization so as to produce a double-stranded complex of probe
and members of the genomic DNA population which hybridize
thereto;
(c) contacting the double-stranded complex of (b) with a solid
phase specific binding partner for said ligand so as to produce a
solid phase complex;
(d) separating the solid phase complex from the single-stranded DNA
population of (b);
(e) releasing from the probe the members of the genomic population
which had bound to the solid phase bound probe;
(f) forming double-stranded DNA from the members of the genomic
population of (e);
(g) introducing the double-stranded DNA of (f) into a suitable host
to form a library containing a plurality of clones containing the
selected DNA; and
(h) screening the library for the desired activity.
In another aspect, the process includes a preselection to recover
DNA including signal or secretion sequences. In this manner it is
possible to select from the genomic DNA population by hybridization
as hereinabove described only DNA which includes a signal or
secretion sequence. The following paragraphs describe the protocol
for this embodiment of the invention, the nature and function of
secretion signal sequences in general and a specific exemplary
application of such sequences to an assay or selection process.
A particularly preferred embodiment of this aspect further
comprises, after (a) but before (b) above, the steps of:
(a i) contacting the single-stranded DNA population of (a) with a
ligand-bound oligonucleotide probe that is complementary to a
secretion signal sequence unique to a given class of proteins under
conditions permissive of hybridization to form a double-stranded
complex;
(a ii) contacting the double-stranded complex of (a i) with a solid
phase specific binding partner for said ligand so as to produce a
solid phase complex;
(a iii) separating the solid phase complex from the single-stranded
DNA population of (a);
(a iv) releasing the members of the genomic population which had
bound to said solid phase bound probe; and
(a v) separating the solid phase bound probe from the members of
the genomic population which had bound thereto.
The DNA which has been selected and isolated to include a signal
sequence is then subjected to the selection procedure hereinabove
described to select and isolate therefrom DNA which binds to one or
more probe DNA sequences derived from DNA encoding a bioactivity
having a desirable bioactivity.
This procedure of "biopanning" is described and exemplified in U.S.
Ser. No. 08/692,002, filed Aug. 2, 1996.
Further, it is possible to combine all the above embodiments such
that a normalization step is performed prior to generation of the
expression library, the expression library is then generated, the
expression library so generated is then biopanned, and the
biopanned expression library is then screened using a high
throughput cell sorting and screening instrument. Thus there are a
variety of options: i.e. (i) one can just generate the library and
then screen it; (ii) normalize the target DNA, generate the
expression library and screen it; (iii) normalize, generate the
library, biopan and screen; or (iv) generate, biopan and screen the
library.
The clones which are identified as having the specified activity
may then be sequenced to identify the DNA sequence encoding a
bioactivity having the specified activity. Thus, in accordance with
the present invention it is possible to isolate and identify: (i)
DNA encoding a bioactivity having a specified activity, (ii)
bioactivities having such activity (including the amino acid
sequence thereof) and (iii) produce recombinant molecules having
such activity.
Screening
The present invention offers the ability to screen for many types
of bioactivities. For instance, the ability to select and combine
desired components from a library of polyketides and postpolyketide
biosynthesis genes for generation of novel polyketides for study is
appealing. The method(s) of the present invention make it possible
to and facilitate the cloning of novel polyketide synthases, and
other relevant pathways or genes encoding commercially relevant
secondary metabolites, since one can generate gene banks with
clones containing large inserts (especially when
using vectors which can accept large inserts, such as the f-factor
based vectors), which facilitates cloning of gene clusters.
Preferably, the gene cluster or pathway DNA is ligated into a
vector, particularly wherein a vector further comprises expression
regulatory sequences which can control and regulate the production
of a detectable protein or protein-related array activity from the
ligated gene clusters. Use of vectors which have an exceptionally
large capacity for exogenous DNA introduction are particularly
appropriate for use with such gene clusters and are described by
way of example herein to include the f-factor (or fertility factor)
of E. coli. As previously indicated, this f-factor of E. coli is a
plasmid which affect high-frequency transfer of itself during
conjugation and is ideal to achieve and stably propagate large DNA
fragments, such as gene clusters from mixed microbial samples.
Other examples of vectors include cosmids, bacterial artificial
chromosome vectors (BAC vectors), and P1 vectors.
Gene expression libraries of the present invention, capturing
potential pathways encoding bioactive molecules of interest can
first be induced in prokaryotic cells to express desirable
precursers (e.g. backbone molecules which will be capable of being
modified) which can then be screened in another host system which
allows the expression of active molecules. Particulary preferred
prokaryotic cells are E. coli cells. Alternatively, crude or
partially purified extracts, or pure proteins from metabolically
rich cell lines can be combined with the original gene expression
libraries to create potentially active molecules, which can then be
screened for an activity of interest.
For example, gene libraries can be generated in E.coli as a host,
and a shuttle vector as the vector, according to the examples
provided herein. These libraries may then be screened using
"hybridization screening". "Hybridization screening" is an approach
used to detect pathways encoding compounds related to previously
characterized small molecules which relies on the hybridization of
probes to conserved genes within the pathway. This approach appears
effective for the polyketide class of molecules which have highly
conserved regions within the polyketide synthase genes in the
pathway. Because of the highly conserved nature of these genes,
hybridization of probes to high density filter arrays of clones
from low complexity libraries is an effective approach to identify
clones carrying potential full length pathways. Alternatively,
multiplex PCR using primers designed against the conserved pathway
genes can be used on DNA pools from clones arrayed in microtiter
dish format.
Libraries made from complex communities require an enrichment
procedure to increase the likelihood of identifying by
hybridization any clones carrying homologous sequences. For
example, the .about.100 million base pairs of DNA immobilized on
the filter shown in FIG. 3 represents approximately 5-fold coverage
of 3 typical Streptomyces genomes. However, a gram of soil can
contain approximately 10.sup.6 bacterial cells representing over
10.sup.4 species. Screening a library made from such a sample would
require over 3,000 filters.
The biopanning approach described above can be used to create
libraries enriched with clones carrying sequences homologous to a
given probe sequence. Using this approach libraries containing
clones with inserts of up to 40 kbp can be enriched approximately
1,000 fold after each round of panning. This enables one to reduce
the above 3,000 filter fosmid library to 3 filters after 1 round of
biopanning enrichment. This approach can be applied to create
libraries enriched for clones carrying polyketide sequences.
Hybridization screening using high density filters or biopanning
has proven an efficient approach to detect homologues of pathways
containing conserved genes. To discover novel bioactive molecules
that may have no known counterparts, however, other approaches are
necessary. Another approach of the present invention is to screen
in E. coli for the expression of small molecule ring structures or
"backbones". Because the genes encoding these polycyclic structures
can often be expressed in E. coli the small molecule backbone can
be manufactured albeit in an inactive form. Bioactivity is
conferred upon transferring the molecule or pathway to an
appropriate host that expresses the requisite glycosylation and
methylation genes that can modify or "decorate" the structure to
its active form. Thus, inactive ring compounds, recombinantly
expressed in E. coli are detected to identify clones which are then
shuttled to a metabolically rich host, such as Streptomyces, for
subsequent production of the bioactive molecule. The use of high
throughput robotic systems allows the screening of hundreds of
thousands of clones in multiplexed arrays in microtiter dishes.
One approach to detect and enrich for clones carrying these
structures is to use FACS screening, a procedure described and
exemplified in U.S. Ser. No. 08/876,276, filed Jun. 16, 1997.
Polycyclic ring compounds typically have characteristic fluorescent
spectra when excited by ultraviolet light. Thus clones expressing
these structures can be distinguished from background using a
sufficiently sensitive detection method. High throughput FACS
screening can be utilized to screen for small molecule backbones in
E. coli libraries. Commercially available FACS machines are capable
of screening up to 100,000 clones per second for UV active
molecules. These clones can be sorted for further FACS screening or
the resident plasmids can be extracted and shuttled to Streptomyces
for activity screening.
In an alternate screening approach, after shuttling to Streptomyces
hosts, organic extracts from candidate clones can be tested for
bioactivity by susceptibility screening against test organisms such
as Staphylococcus aureus, E. coli, or Saccharomyces cervisiae. FACS
screening can be used in this approach by co-encapsulating clones
with the test organism (FIG. 5).
An alternative to the abovementioned screening methods provided by
the present invention is an approach termed "mixed extract"
screening. The "mixed extract" screening approach takes advantage
of the fact that the accessory genes needed to confer activity upon
the polycyclic backbones are expressed in metabolically rich hosts,
such as Streptomyces, and that the enzymes can be extracted and
combined with the backbones extracted from E. coli clones to
produce the bioactive compound in vitro. Enzyme extract
preparations from metabolically rich hosts, such as Streptomyces
strains, at various growth stages are combined with pools of
organic extracts from E. coli libraries and then evaluated for
bioactivity. A description of this is provided in the examples
below.
Another approach to detect activity in the E. coli clones is to
screen for genes that can convert bioactive compounds to different
forms. For example, a recombinant enzyme was recently discovered
that can convert the low value daunomycin to the higher value
doxorubicin. Similar enzyme pathways are being sought to convert
penicillins to cephalosporins.
FACS screening can also be used to detect expression of UV
fluorescent molecules in metabolically rich hosts, such as
Streptomyces. Recombinant oxytetracylin retains its diagnostic red
fluorescence when produced heterologously in S. lividans TK24 (FIG.
6). Pathway clones, which can be sorted by FACS, can thus be
screened for polycyclic molecules in a high throughput fashion.
Recombinant bioactive compounds can also be screened in vivo using
"two-hybrid" systems, which can detect enhancers and inhibitors of
protein--protein or other interactions such as those between
transcription factors and their activators, or receptors and their
cognate targets. FIG. 7 depicts an approach to screen for small
molecules that enhance or inhibit transcription factor initiation.
Both the small molecule pathway and the GFP reporter construct are
co-expressed. Clones altered in GFP expression can then be sorted
by FACS and the pathway clone isolated for characterization.
As indicated, common approaches to drug discovery involve screening
assays in which disease targets (macromolecules implicated in
causing a disease) are exposed to potential drug candidates which
are tested for therapeutic activity. In other approaches, whole
cells or organisms that are representative of the causative agent
of the disease, such as bacteria or tumor cell lines, are exposed
to the potential candidates for screening purposes. Any of these
approaches can be employed with the present invention.
The present invention also allows for the transfer of cloned
pathways derived from uncultivated samples into metabolically rich
hosts for heterologous expression and downstream screening for
bioactive compounds of interest using a variety of screening
approaches briefly described above.
Recovering Desirable Bioactivities
After viable or non-viable cells, each containing a different
expression clone from the gene library are screened, and positive
clones are recovered, DNA is isolated from positive clones
utilizing techniques well known in the art. The DNA can then be
amplified either in vivo or in vitro by utilizing any of the
various amplification techniques known in the art. In vivo
amplification would include transformation of the clone(s) or
subclone(s) of the clones into a viable host, followed by growth of
the host. In vitro amplification can be performed using techniques
such as the polymerase chain reaction.
Evolution
One advantage afforded by a recombinant approach to the discovery
of novel bioactive compounds is the ability to manipulate pathway
subunits to generate and select for variants with altered
specificity. Pathway subunits can be substituted or individual
subunits can be evolved utilizing methods described below, to
select for resultant bioactive molecules with different
activities.
Clones found to have the bioactivity for which the screen was
performed can be subjected to directed mutagenesis to develop new
bioactivities with desired properties or to develop modified
bioactivities with particularly desired properties that are absent
or less pronounced in the wild-type activity, such as stability to
heat or organic solvents. Any of the known techniques for directed
mutagenesis are applicable to the invention. For example,
particularly preferred mutagenesis techniques for use in accordance
with the invention include those described below.
The term "error-prone PCR" refers to a process for performing PCR
under conditions where the copying fidelity of the DNA polymerase
is low, such that a high rate of point mutations is obtained along
the entire length of the PCR product. Leung, D. W., et al.,
Technique, 1:11-15 (1989) and Caldwell, R. C. & Joyce G. F.,
PCR Methods Applic., 2:28-33 (1992).
The term "oligonucleotide directed mutagenesis" refers to a process
which allows for the generation of site-specific mutations in any
cloned DNA segment of interest. Reidhaar-Olson, J. F. & Sauer,
R. T., et al., Science, 241:53-57 (1988).
The term "assembly PCR" refers to a process which involves the
assembly of a PCR product from a mixture of small DNA fragments. A
large number of different PCR reactions occur in parallel in the
same vial, with the products of one reaction priming the products
of another reaction.
The term "sexual PCR mutagenesis" (also known as "DNA shuffling")
refers to forced homologous recombination between DNA molecules of
different but highly related DNA sequence in vitro, caused by
random fragmentation of the DNA molecule based on sequence
homology, followed by fixation of the crossover by primer extension
in a PCR reaction. Stemmer, W. P., PNAS, USA, 91:10747-10751
(1994).
The term "in vivo mutagenesis" refers to a process of generating
random mutations in any cloned DNA of interest which involves the
propagation of the DNA in a strain of E. coli that carries
mutations in one or more of the DNA repair pathways. These
"mutator" strains have a higher random mutation rate than that of a
wild-type parent. Propagating the DNA in one of these strains will
eventually generate random mutations within the DNA.
The term "cassette mutagenesis" refers to any process for replacing
a small region of a double stranded DNA molecule with a synthetic
oligonucleotide "cassette" that differs from the native sequence.
The oligonucleotide often contains completely and/or partially
randomized native sequence.
The term "recursive ensemble mutagenesis" refers to an algorithm
for protein engineering (protein mutagenesis) developed to produce
diverse populations of phenotypically related mutants whose members
differ in amino acid sequence. This method uses a feedback
mechanism to control successive rounds of combinatorial cassette
mutagenesis. Arkin, A. P. and Youvan, D. C., PNAS, USA,
89:7811-7815 (1992).
The term "exponential ensemble mutagenesis" refers to a process for
generating combinatorial libraries with a high percentage of unique
and functional mutants, wherein small groups of residues are
randomized in parallel to identify, at each altered position, amino
acids which lead to functional proteins, Delegrave, S. and Youvan,
D. C., Biotechnology Research, 11:1548-1552 (1993); and random and
site-directed mutagenesis, Arnold, F. H., Current Opinion in
Biotechnology, 4:450-455 (1993).
All of the references mentioned above are hereby incorporated by
reference in their entirety. Each of these techniques is described
in detail in the references mentioned. DNA can be mutagenized, or
"evolved", utilizing any one or more of these techniques, and
rescreened to identify more desirable clones. The invention will
now be illustrated by the following working examples, which are in
no way a limitation thereof.
EXAMPLE 1
Sample Collection Using a Microbial Containment Device
Sample to be utilized for downstream nucleic acid isolation for
library generation may be collected according to the following
example:
The following represents a method of selective in situ enrichment
of bacterial and archaeal species while at the same time inhibiting
the proliferation of eukaryotic members of the population.
In situ enrichment is achieved by using OtrapsO composed of growth
substrates and nutritional amendments with the intent to lure,
selectively, members of the surrounding environmental matrix,
coated onto surfaces. Choice of substrates (carbon sources) and
nutritional amendments (ie, nitrogen, phosphorous, etc.) is
dependent upon the members of the community one desires to enrich.
Selective agents against eukaryotic members are also added to the
trap. Again, the exact composition will depend upon which members
of the community one desires to enrich and which members of the
community one desires to inhibit. Substrates include monomers and
polymers. Monomers of substrates, such as glucosamine, cellulose,
pentanoic or other acids, xylan, chitin, etc., can be utilized for
attraction of certain types of microbes. Polymers can also be used
to attract microbes that can degrade them. Some of the enrichment
OmediaO which may be useful in pulling out particular members of
the community is described below:
1. Addition of bioactive compounds against fungi and microscopic
eukaryotes:
Proliferation of eukaryotic members of the community may be
inhibited by the use of one or more commercially available
compounds such as nystatin, cycloheximide, and/or pimaricin. These
compounds may be sprinkled as a powder or incorporated as a liquid
in the selective enrichment medium.
2. Addition of bioactive compounds against other bacterial
species:
Compounds which inhibit the growth of some bacterial species but
not others (ie, polymyxin, penicillin, and rifampin) may be
incorporated into the enrichment medium. Use of the compounds is
dependent upon which members of the bacterial community one desires
to enrich. For example, while a majority of the Streptomyces are
sensitive to polymyxin, penicillin, and rifampin, these may be used
to enrich for OrareO members of the family which are resistant.
Selective agents may also be used in enrichments for archaeal
members of the community.
3. Use of carbon sources as selective agents:
Any particular carbon source can be utilized by some members of the
community and not others. Carbon source selection thus depends upon
the members of the community one desires to enrich. For example,
members of the Streptomycetales tend to utilize complex, polymeric
substrates such as cellulose, chitin, and lignin. These complex
subtrates, while utilized by other genera, are recalcitrant to most
bacteria. These complex substrates are utilized by fungi, which
necessitates the use of anti-fungal agents,
mentioned above.
4. Addition of nitrogen sources:
The use of additional nitrogen sources may be called for depending
upon the choice for carbon source. For example, while chitin is
balanced in its C:N ratio, cellulose is not. To enhance utilization
of cellulose (or other carbon-rich substrates), it is often useful
to add nitrogen soures such as nitrate or ammonia.
5. Addition of trace elements:
In general, the environmental matrix tends to be a good source of
trace elements, but in certain environments, the elements may be
limiting. Addition of trace elements may enhance growth of some
members of the community while inhibiting others.
Large surface area materials, such as glass beads or silica
aerogels can be utilized as surfaces in the present example. This
allows a high concentration of microbes to be collected in a
relatively small device holding multiple collections of
substrate-surface conjugates.
Glass beads can be derivitized with N-Acetyl
B-D-glucosamine-phenylisothiocyanate as follows:
Bead Preparation:
30 ml glass beads (Biospec Products, Bartlesville, Okla.) are mixed
with 50 ml APS/Toluene (10% APS) (Sigma Chemical Co.)
Reflux overnight
Decant and wash 3 times with Toluene
Wash 3 times with ethanol and dry in oven
Derivitize with N-Acetyl B-D-glucosamine-phenylisothiocyanate as
follows:
Combine in Falcon Tube:
25 ml prepared glass beads from above
15 ml 0.1M NaHCO.sub.3 +25 mg N-Acetyl-B-D-glucosamine-PITC (Sigma
Chemical Co.)+1 ml DMSO
Add 10 ml NaHCO.sub.3 +1 ml DMSO
Pour over glass beads
Let shake in Falcon Tube overnight
Wash with 20 ml 0.1M NaHCO.sub.3
Wash with 50 ml ddH.sub.2 O
Dry at 55.degree. C. for 1 hour
Beads can then be placed in mesh filter "bags" (Spectrum, Houston,
Tex.) created to allow containment of the beads, while
simultaneously allowing migration of microbes, which are then
placed in any device used as a solid support which allows
containment of the bag. Particularly preferred devices are made of
inert materials, such as plexiglass. Alternatively, beads can be
placed directly into Falcon Tubes (VWR, Fisher Scientific) which
have been punctured with holes using a needle. These "containment"
devices are then deployed in desired biotopes for a period of time
to allow attraction and growth of desirable microbes. The following
protocol details one method for generating a simple "microbial
containment device":
Puncture holes using a heated needle or other pointed device into a
15 ml Falcon Tube (VWR, Fisher Scientific).
Place approximately 1-5 mls of the derivitized beads into a
Spectra/mesh nylon filter, such as those available from Spectrum
(Houston, Tex.) with a mesh opening of 70 m, an open area of 43%,
and a thickness of 70 m. Seal the nylon filter to create a "bag"
containing the beads using, for instance, Goop, Houshold Adhesive
& Sealant.
Place the filter containing the beads into the ventilated Falcon
Tube and deploy the tube into the desired biotope for a period of
time (typically days).
EXAMPLE 2
DNA Isolation and Library Construction from Cultivated Organism
The following outlines the procedures used to generate a gene
library from an isolate, Streptomyces rimosus.
Isolate DNA.
1. Inoculate 25 ml Trypticase Soy Broth (BBL Microbiology Systems)
in 250 ml baffled erlenmeyer flasks with spores of Streptomyces
rimosus. Incubate at 30.degree. C. at 250 rpm for 48 hours.
2. Collect mycelin by centrifugation. Use 50 ml conical tubes and
centrifuge at 25.degree. C. at 4000 rpm for 10 minutes.
3. Decant supernatent and wash pellet 2.times. with 10 ml 10.3%
sucrose (centrifuge as above between washes).
4. Store pellet at -20.degree. C. for future use.
5. Resuspend pellet in 40 ml TE (10 mM Tris, 1 mM EDTA; pH 7.5)
containing lysozyme (1 mg/ml; Sigma Chemical Co.)and incubate at
37.degree. C. for 45 minutes.
6. Add sarcosyl (N-lauroylsarcosine, sodium salt, Sigma Chemical
Co.) to final concentration of 1% and invert gently to mix for
several minutes.
7. Transfer 20 ml of preparation to clean tube and add proteinase K
(Stratagene Cloning Systems) to a final concentration of 1 mg/ml.
Incubate overnight at 50.degree. C.
8. Extract 2.times. with Phenol (saturated with TE).
9. Extract 1.times. with Phenol:CH.sub.3 Cl.
10. Extract 1.times. with CH.sub.3 Cl: Isoamyl alcohol.
11. Precipitate DNA with 2 volumes of EtOH.
12. Spool DNA on sealed pasteur pipet.
13. Rinse with 70% EtOH.
14. Dry in air.
15. Resuspend DNA in 1 ml TE and store at 4.degree. C. to rehydrate
slowly.
16. Check quality of DNA:
Digest 10 .mu.l DNA with EcoRI restriction enzyme (Stratagene
Cloning Systems) according to manufacturers protocol electrophorese
DNA digest through 0.5% agarose, 20V overnight; stain gel in 1 g/ml
EtBr
17. Determine DNA concentration (A.sub.260 -A.sub.280).
Restriction Digest DNA
1. Incubate the following at 37.degree. C. for 3 hours:
______________________________________ 8 .mu.l DNA (.about.10
.mu.g) 35 .mu.l H.sub.2 O 5 .mu.l 10x restriction enzyme buffer 2
.mu.l EcoRI restriction enzyme (200 units)
______________________________________
Sucrose Gradient
1. Prepare small sucrose gradient (Sambrook, Fritsch and Maniatus,
1989) and run DNA at 45,000 rpm for 4 hours at 25.degree. C.
2. Examine 5 .mu.l of each fraction on 0.8% agarose gel.
3. Pool relevant fractions and precipitate DNA with 2.5 volumes of
EtOH for 1 hour at -70.degree. C.
4. Collect DNA by centrifugation at 13,200 rpm for 15 minutes.
5. Decant and wash with 1 ml of 70% EtOH.
6. Dry, resuspend in 15 .mu.l TE.
7. Store at 4.degree. C.
Dephosphorylate DNA
1. Dephosphorylate DNA with shrimp alkaline phosphatase according
to manufacturers protocol (US Biochemicals).
Adaptor Ligation
1. Ligate adaptors according to manufacturers protocol.
2. Briefly, gently resuspend DNA in EcoR I-BamH I adaptors
(Stratagene Cloning Systems); add 10.times. ligation buffer, 10 mM
rATP, and T4 DNA ligase and incubate at room temperature for 4-6
hours.
Preparation of Fosmid Arms
1. Fosmid aims can be prepared as described (Kim, et.al., Nucl.
Acids Res., 20:10832-10835, 1992). Plasmid DNA can be digested with
PmeI restriction enzyme (New England Biolabs) according to the
manufacturers protocol, dephosphorylated (Sambrook, Fritsch and
Maniatus, 1989), followed by a digestion with BamH I restriction
enzyme (New England Biolabs) according to the manufacturers
protocol, and another dephosphorylation step to generate two arms
each of which contain a cos site in the proper orientation for the
cloning and packaging of ligated DNA between 35-45 kbp.
Ligation to Fosmid Arms
1. Prepare the ligation reaction:
Add .about.50 ng each of insert and vector DNA to 1 U of T4 DNA
ligase (Boehringer Mannheim) and 10.times. ligase buffer as per
manufacturers instructions; add H.sub.2 O if necessary, to total of
10 .mu.l.
2. Incubate overnight at 16.degree. C.
Package and Plate
I. Package the ligation reactions using Gigapack XL packaging
system (Stratagene Cloning Systems, Inc.) following manufacturer's
protocol.
2 Transfect E.coli strain DH10B (Bethesda Research Laboratories,
Inc.) according to manufacturers protocol and spread onto
LB/Chloramphenicol plates (Sambrook, Fritsch and Maniatus,
1989).
EXAMPLE 3
Preparation of an Uncultivated Prokaryotic DNA Library
FIG. 1 shows an overview of the procedures used to construct an
environmental library from a mixed picoplankton sample. The goal
was to construct a stable, large insert DNA library representing
picoplankton genomic DNA.
Cell collection and preparation of DNA. Agarose plugs containing
concentrated picoplankton cells were prepared from samples
collected on an oceanographic cruise from Newport, Oreg. to
Honolulu, Hi. Seawater (30 liters) was collected in Niskin bottles,
screened through 10 .mu.m Nitex, and concentrated by hollow fiber
filtration (Amicon DC10) through 30,000 MW cutoff polysulfone
filters. The concentrated bacterioplankton cells were collected on
a 0.22 .mu.m, 47 mm Durapore filter, and resuspended in 1 ml of
2.times. STE buffer (1M NaCl, 0.1M EDTA, 10 mM Tris, pH 8.0) to a
final density of approximately 1.times.10.sup.10 cells per ml. The
cell suspension was mixed with one volume of 1% molten Seaplaque
LMP agarose (FMC) cooled to 40.degree. C., and then immediately
drawn into a 1 ml syringe. The syringe was sealed with parafilm and
placed on ice for 10 min. The cell-containing agarose plug was
extruded into 10 ml of Lysis Buffer (10 mM Tris pH 8.0, 50 mM NaCl,
0.1M EDTA, 1% Sarkosyl, 0.2% sodium deoxycholate, a mg/ml lysozyme)
and incubated at 37.degree. C. for one hour. The agarose plug was
then transferred to 40 mls of ESP Buffer (1% Sarcosyl, 1 mg/ml
proteinase-K, in 0.5M EDTA), and incubated at 55.degree. C. for 16
hours. The solution was decanted and replaced with fresh ESP
Buffer, and incubated at 55.degree. C. for an additional hour. The
agarose plugs were then placed in 50 mM EDTA and stored at
4.degree. C. shipboard for the duration of the oceanographic
cruise.
One slice of an agarose plug (72 .mu.l) prepared from a sample
collected off the Oregon coast was dialyzed overnight at 4.degree.
C. against 1 ml of buffer A (100 mM NaCl, 10 mM Bis Tris
Propane-HCl, 100 g/ml acetylated BSA: pH 7.0 @ 25.degree. C.) in a
2 ml microcentrifuge tube. The solution was replaced with 250 l of
fresh buffer A containing 10 mM MgCl.sub.2 and 1 mM DTT and
incubated on a rocking platform for 1 hr at room temperature. The
solution was then changed to 250 .mu.l of the same buffer
containing 4 U of Sau3A1 (NEB), equilibrated to 37.degree. C. in a
water bath, and then incubated on a rocking platform in a
37.degree. C. incubator for 45 min. The plug was transferred to a
1.5 ml microcentrifuge tube and incubated at 68.degree. C. for 30
min to inactivate the protein, e.g. enzyme, and to melt the
agarose. The agarose was digested and the DNA dephosphorylased
using Gelase and HK-phosphatase (Epicentre), respectively,
according to the manufacturer's recommendations. Protein was
removed by gentle phenol/chloroform extraction and the DNA was
ethanol precipitated, pelleted, and then washed with 70% ethanol.
This partially digested DNA was resuspended in sterile H.sub.2 O to
a concentration of 2.5 ng/l for ligation to the pFOS1 vector.
PCR amplification results from several of the agarose plugs (data
not shown) indicated the presence of significant amounts of
archaeal DNA. Quantitative hybridization experiments using rRNA
extracted from one sample, collected at 200 m of depth off the
Oregon Coast, indicated that planktonic archaea in (this assemblage
comprised approximately 4.7% of the total picoplankton biomass
(this sample corresponds to "PACI"-200 m in Table 1 of DeLong et
al., high abundance of Archaea in Antarctic marine picoplankton,
Nature, 371:695-698, 1994). Results from archaeal-biased rDNA PCR
amplification performed on agarose plug lysates confirmed the
presence of relatively large amounts of archaeal DNA in this
sample. Agarose plugs prepared from this picoplankton sample were
chosen for subsequent fosmid library preparation. Each 1 ml agarose
plug from this site contained approximately 7.5.times.10.sup.5
cells, therefore approximately 5.4.times.10.sup.5 cells were
present in the 72 .mu.l slice used in the preparation of the
partially digested DNA.
Vector arms are prepared from pFOS1 as described (Kim et al.,
Stable propagation of cosmid sized human DNA inserts in an F factor
based vector, Nucl. Acids Res., 20.10832-10835, 1992). Briefly, the
plasmid is completely digested with AstII, dephosphorylated with HK
phosphatase, and then digested with BamHI to generate two arms,
each of which contains a cos site in the proper orientation for
cloning and packaging ligated DNA between 35-45 kbp. The partially
digested picoplankton DNA is ligated overnight to the pFOS1 arms in
a 15 .mu.l ligation reaction containing 25 ng each of vector and
insert and 1 U of T4 DNA ligase (Boehringer-Mannheim). The ligated
DNA in four microliters of this reaction is in vitro packaged using
the Gigapack XL packaging system (Stratagene), the fosmid particles
transfected to E. coli strain DH10B (BRL), and the cells spread
onto LB.sub.cm15 plates. The resultant fosmid clones are picked
into 96-well microliter dishes containing LB.sub.cm15 supplemented
with 7% glycerol. Recombinant fosmids, each containing 40 kb of
picoplankton DNA insert, have yielded a library of 3,552 fosmid
clones, containing approximately 1.4.times.10.sup.8 base pairs of
cloned DNA. All of the clones examined contained inserts ranging
from 38 to 42 kbp. This library is stored frozen at -80.degree. C.
for later analysis.
EXAMPLE 4
Normalization of DNA from Environmental Samples
Prior to library generation, purified DNA from an environmental
sample can be normalized. DNA is first fractionated according to
the following protocol: Sample composed of genomic DNA is purified
on a cesium-chloride gradient. The cesium chloride (Rf=1.3980)
solution is filtered through a 0.2 Mm filter and 15 ml is loaded
into a 35 ml OptiSeal tube (Beckman). The DNA is added and
thoroughly mixed. Ten micrograms of bis-benzimide (Sigma; Hoechst
33258) is added and mixed thoroughly. The tube is then filled with
the filtered cesium chloride solution and spun in a VTi50 rotor in
a Beckman L8-70 Ultracentrifuge at 33,000 rpm for 72 hours.
Following centrifugation, a syringe pump and fractionator (Brandel
Model 186) are used to drive the gradient through an ISCO UA-5 UV
absorbance detector set to 280 nm. Peaks representing the DNA from
the organisms present in an environmental sample are obtained.
Normalization is then accomplished as follows:
1. Double-stranded DNA sample is resuspended in hybridization
buffer (0.12 M NaH.sub.2 PO.sub.4, pH 6.8/0.82 M NaCl/1 mM
EDTA/0.1% SDS).
2. Sample is overlaid with mineral oil and denatured by boiling for
10 minutes.
3. Sample is incubated at 68.degree. C. for 12-36 hours.
4. Double-stranded DNA is separated from single-stranded DNA
according to standard protocols (Sambrook, 1989) on hydroxyapatite
at 60.degree. C.
5. The single-stranded DNA fraction is desalted and amplified by
PCR.
The process is repeated for several more rounds (up to 5 or
more).
EXAMPLE 5
Hybridization Screening of Libraries Generated in Prokaryotes and
Expression Screening in Metabolically Rich Hosts
Hybridization screening may be performed on fosmid clones from a
library generated according to the protocol described in Example 3
above in any fosmid vector. For instance, the pMF3 vector is a
fosmid based vector which can be used for efficient yet stable
cloning in E. coli and which can be integrated and maintained
stably in Streptomyces coelicolor or Streptomyces lividans. A pMF3
library generated according to the above protocol is first
transformed into E. coli DH10B cells. Chloramphenicol
resistant transformants containing tcm or oxy are identified by
screening the library by colony hybridization using sequences
designed from previously published sequences of oxy and tcm genes.
}(27, }28) Colony hybridization screening is described in detail in
"Molecular Cloning", A Laboratory Manual, Sambrook, et al., (1989)
1.90-1.104. Colonies that test positive by hybridization can be
purified and their fosmid clones analyzed by restriction digestion
and PCR to confirm that they contain the complete biosynthetic
pathway
Alternatively, DNA from the abovementioned fosmid clones may be
used in a amplification reaction designed to identify clones
positive for an entire pathway. For example, the following
sequences may be employed in an amplification reaction to amplify a
pathway encoding the antibiotic gramicidin (gramicidin operon),
which resides on a 34 kbp DNA fragment potentially encoded on one
fosmid clone:
Primers:
5'CACACGGATCCGAGCTCATCGATAGGCATGTGTTTAACTTCTTGTCATC3' SEQ ID NO:1 -
5'CTTATTGGATCCGAGCTCAATTGCTGAAGAGTTGAAGGAGAGCATCTTCC3' SEQ ID
NO:2
Amplification reaction:
______________________________________ 1 .mu.l fosmid/insert DNA 5
.mu.l each primer (50 ng/.mu.l) 1 .mu.l Boehringer Mannheim EXPAND
Polymerase from their EXPAND kit 1 .mu.l dNTP's 5 .mu.l 10X Buffer
#3 from Boehringer Mannheim EXPAND kit 30 .mu.l ddH.sub.2 O
______________________________________
PCR Reaction Program:
______________________________________ 94.degree. C. 60 seconds 20
cycles of: 94.degree. C. 10 seconds 65.degree. C. 30 seconds
68.degree. C. 15 minutes one cycle of: 68.degree. C. 7 minutes
Store at 4.degree. C. ______________________________________
Fosmid DNA from clones that are shown to contain the
oxytetracycline or tetracenomycin polyketide encoding DNA sequences
are then used to transform S. lividans TK24 Dact protoplasts from
Example 6. Transformants are selected by overlaying regeneration
plates with hygromycin (pMF5). Resistant transformants are screened
for bioactivity by overlaying transformation plates with 2 ml of
nutrient soft agar containing cells of the test organisms
Escherichia coli or Bacillus subtilis. E. coli is resistant to the
thiostrepton concentration (50 mg/ml) to be used in the overlays of
pMF3 clones but is sensitive to oxytetracylin at a concentration of
5 mg/ml }(29). The B. subtilis test strain is rendered resistant to
thiostrepton prior to screening by transforming with a thiostrepton
marker carried on pHT315 }(30). Bioactivity is demonstrated by
inhibition of growth of the particular test strain around the S.
lividans colonies. To confirm bioactivity, presumptive active
clones are isolated and cultures extracted using a moderately polar
solvent, methanol. Extractions are prepared by addition of methanol
in a 1:1 ratio with the clone fermentation broth followed by
overnight shaking at 4.degree. C. Cell debris and media solids in
the aqueous phase are then be separated by centrifugation.
Recombinantly expressed compounds are recovered in the solvent
phase and may be concentrated or diluted as necessary. Extracts of
the clones are aliquoted onto 0.25-inch filter disks, the solvent
allowed to evaporate, and then placed on the surface of an overlay
containing the assay organisms. Following incubation at appropriate
temperatures, the diameter of the clearing zones is measured and
recorded. Diode array HPLC, using authentic oxytetracyclin and
tetracenomycin as standards, can be used to confirm expression of
these antibiotics from the recombinant clones.
Rescue of chromosmally integrated pathways
Sequence analysis of chromosomally integrated pathways identified
by screening can be performed for confirmation of the bioactive
molecule. One approach which can be taken to rescue fosmid DNA from
S. lividans clones exhibiting bioactivity against the test
organisms is based on the observation that plasmid vectors
containing IS117, such as pMF3, are present as circular
intermediates at a frequency of 1 per 10-30 chromosomes. The
presumptive positive clones can be grown in 25 ml broth cultures
and plasmid DNA isolated by standard alkaline lysis procedures.
Plasmid DNA preps are then used to transform E. coli and
transformants are selected for Cm.sup.r by plating onto LB
containing chloramphenicol (15 mg/ml). Fosmid DNA from the E. coli
Cm.sup.r transformants is isolated and analyzed by restriction
digestion analysis, PCR, and DNA sequencing.
EXAMPLE 6
Host Strain Construction
The following example describes modifications that can be performed
on the Streptomyces lividans strain to make it useful for screening
bioactive clones originally identified in E.coli according to
Example 5.
Streptomyces lividans is a strain is routinely used in the
recombinant expression of heterologous antibiotic pathways because
it recognizes a large number of promoters and appears to lack a
restriction system. Although Streptomyces lividans does not
normally produce the polyketide antibiotic actinorhodin, it
contains the requisite gene sequences, and several genes have been
identified that activate its production in S. lividans. One strain
of S. lividans, TK24, can be utilized as a host for screening for
bioactive clones. This strain contains a mutation in the rpsL gene,
encoding ribosomal protein S12, that confers resistance to
streptomycin and activates the production of actinorhodin. In order
to ensure that the bioactivity of S. lividans clones containing
putative polyketide or other antibiotic genes is not due to the
activation of the resident act gene cluster, these sequences should
be removed from host strain by gene replacement. The outline for
the gene replacement scheme is shown in FIG. 8. Gene fragments
internal to actVI and actVB, which define the boundaries of the act
cluster are amplified by PCR. The primers used for the
amplification have recognition sequences designed within them so
that they are cloned in the proper orientation respective to each
other and the act cluster. The actVB and actVI gene fragments are
cloned into pLL25 so that they flank the spectinomycin encoding
gene, generating pRBSV2. S. lividans TK24 protoplasts are
transformed with pRBSV2 using established transformation protocols
and transformants are selected for spectinomycin resistance. As
shown in FIG. 9, Spc.sup.r transformants can arise as a result of
several recombination events. Single recombination events within
actVI or actVB (events 1 and 2) result in the insertion of the
plasmid construct within the act cluster. A double crossover within
actVI and actVB (recombination event 3) results in the replacement
of the act cluster with the Spc.sup.r encoding gene. While both
types of recombinations can generate an Act.sup.- strain, the
present example focuses on the construction of a strain containing
the gene replacement. This is advantageous for two reasons: first,
it generates a stable Act.sup.- strain that cannot revert to
Act.sup.+ by recombination between repeated sequences, and second,
it decreases the amount of potential homology between cloned
sequences and the chromosome, and decreases the likelihood of
cloning partial pathways. Because the actinorhodin antibiotic is
pigmented, one is able to distinguish the different classes of
recombinants based on the pigment produced by the Spc.sup.r
transformants. Only Spc.sup.r transformants that are generated by
double recombination are non-pigmented. S. lividans TK24 clones
that have the act cluster replaced by spc are confirmed by Southern
hybridization and PCR analysis using standard techniques.
EXAMPLE 7
Screening of Large Insert Library for Compounds of Interest
Large insert libraries generated according to Examples 1 and 3 can
be screened for potentially clinically valuable compounds of
interest using the following method(s):
Organic Extraction of Fosmid Library Clones (aqueous):
Add equal volume of Methyl-Ethyl-Ketone (MEK)(Sigma Chemical Co.)
to each well of the microtiter plate from Example 3. Transfer MEK
phase to new plates. Spin plates to dry down. Resuspend sample(s)
in TN Buffer (50 mM Tris-7, 10 mM NaCl).
Protein Extraction of Streptomycine
1. Inoculate 25 ml Trypticase Soy Broth (BBL Microbiology Systems)
in 250 ml baffled erlenmeyer flasks with spores of Streptomyces
lividans TK24. Incubate at 30.degree. C. at 225 rpm for 48
hours.
2. Spin @ 4000 rpm in 50 ml conical to pellet cells (15
minutes).
3. Pour off supernatent and reserve.
4. Microscopically check pellet and supernatant.
5. Sonicate pellet
6. Pellet cell debris 4000 rpm/15 minutes (reserve).
7. Pull off supernatant.
8. Dialyze against 80% saturated Ammonium Sulfate solution
according to manufacturers instructions (Slide-A-Lyzer.TM. Dialysis
from Pierce.
9. Spin prep at 2500 rpm for 15 minutes.
10. Spin prep again at 3500 rpm for another 15 minutes.
11. Pull of supernatant and reserve.
12. Add 1 ml TN buffer (50 mM Tris pH 7; 100 mM NaCl)
In 1.5 ml screw caps, combine 50 l aqueous extract from fosmid
clones with 50 l protein extract of Streptomycine (1:1 ratio) in
assay wells.
Use different ratios of aqueous extract:protein extract (1:1 as
indicated above, 3:1, etc.), as desired.
Incubate at 30.degree. C. for 4 hours.
Bioassay
1. Spot 20 .mu.l of sample onto filter disk.
2. Lay filter disk on previously generated assay plate (growth
plate containing appropriate media to grow organism of interest,
with an overlay of .about.1 OD 600 of cells of test organism
solidified into soft agar). Grow cells overnight at the appropriate
incubation temperature for the test organism to grow. Identify
clearing zones for positive results (inhibition of growth).
__________________________________________________________________________
# SEQUENCE LISTING - - - - <160> NUMBER OF SEQ ID NOS: 9 - -
<210> SEQ ID NO 1 <211> LENGTH: 49 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial -
#Sequence: pcr primer - - <400> SEQUENCE: 1 - - cacacggatc
cgagctcatc gataggcatg tgtttaactt cttgtcatc - # 49 - - - -
<210> SEQ ID NO 2 <211> LENGTH: 50 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial -
#Sequence: pcr primer - - <400> SEQUENCE: 2 - - cttattggat
ccgagctcaa ttgctgaaga gttgaaggag agcatcttcc - # 50 - - - -
<210> SEQ ID NO 3 <211> LENGTH: 60 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial -
#Sequence: pcr primer - - <400> SEQUENCE: 3 - - gccgccgaca
ccccgatcac gccgatcgtg gtgtcctgct tcgacgccat ca - #aggcgacc 60 - - -
- <210> SEQ ID NO 4 <211> LENGTH: 59 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial -
#Sequence: pcr primer - - <400> SEQUENCE: 4 - - gccgccgaca
ccccgatcac cccgatcgtc gtcgcctgct tcgacgcgat cc - #gcgccac 59 - - -
- <210> SEQ ID NO 5 <211> LENGTH: 60 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial -
#Sequence: pcr primer - - <400> SEQUENCE: 5 - - tcctcggacg
ccccgatctc cccgatcacg atggcctgct tcgacgccat ca - #aggcgacc 60 - - -
- <210> SEQ ID NO 6 <211> LENGTH: 60 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial -
#Sequence: pcr primer - - <400> SEQUENCE: 6 - - gcggccgacg
ccccgatctc gcccatcacc gtggcctgct tcgatgcgat ca - #aggcgacc 60 - - -
- <210> SEQ ID NO 7 <211> LENGTH: 59 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial -
#Sequence: pcr primer - - <400> SEQUENCE: 7 - - gccaccgacg
cgccgatctc ccccatcacc gtggcctgct tcgacgccat ca - #aggcgac 59 - - -
- <210> SEQ ID NO 8 <211> LENGTH: 60 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial -
#Sequence: pcr primer - - <400> SEQUENCE: 8 - - gcggtggacg
cgccgatcac cccgctcacg atggcggcct tcgacgcgat cc - #gcgccacc 60 - - -
- <210> SEQ ID NO 9 <211> LENGTH: 60 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial - #Sequence: pcr primer - - <400> SEQUENCE: 9 - -
ggcgcagaga aagccagtac gccgctgggc gttggtggtt ttggcgcggc ac -
#gtgcatta 60
__________________________________________________________________________
* * * * *