U.S. patent number 5,856,092 [Application Number 08/429,659] was granted by the patent office on 1999-01-05 for detection of a nucleic acid sequence or a change therein.
This patent grant is currently assigned to Geneco Pty Ltd. Invention is credited to James Langham Dale, Peter Timms, Terence Patrick Walsh.
United States Patent |
5,856,092 |
Dale , et al. |
January 5, 1999 |
Detection of a nucleic acid sequence or a change therein
Abstract
A method for detecting a specific polynucleotide sequence in a
material is disclosed. The method includes exposing said material
to an oligonucleotide primer having a sequence complementary to
part of said specific polynucleotide sequence wherein said primer
binds to part of said polynucleotide sequence when present in said
material. Primer bound to the polynucleotide sequence is extended
wherein any extended primer includes a detectable element and/or a
separation element. Any extended primer is then separated into a
fraction wherein said fraction does not have detectable element not
included in said extended primer. One then determines whether any
extended primer is present in said fraction by assaying said
fraction for said extended primer wherein the presence of said
extended primer is indicative of the presence of the specific
polynucleotide sequence in said material and the absence of said
extended primer is indicative of the presence of the specific
polynucleotide sequences in said material and the absence of said
extended primer in said fraction is indicative of the absence of
the specific polynucleotide sequence in said material.
Inventors: |
Dale; James Langham (Moggill,
AU), Timms; Peter (East Ipswitch, AU),
Walsh; Terence Patrick (Acacia Ridge, AU) |
Assignee: |
Geneco Pty Ltd (Brisbane,
AU)
|
Family
ID: |
27424257 |
Appl.
No.: |
08/429,659 |
Filed: |
April 27, 1995 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
205132 |
Feb 28, 1994 |
|
|
|
|
744766 |
Aug 13, 1991 |
|
|
|
|
Foreign Application Priority Data
|
|
|
|
|
Feb 13, 1989 [AU] |
|
|
PJ2703 |
Feb 13, 1990 [IE] |
|
|
501/90 |
|
Current U.S.
Class: |
435/6.11;
536/25.32; 435/91.1; 536/24.33; 435/6.1; 435/6.18; 435/6.16 |
Current CPC
Class: |
C12Q
1/6827 (20130101) |
Current International
Class: |
C12Q
1/68 (20060101); C12Q 001/68 (); C12P 019/34 ();
C07H 021/00 (); C12N 015/00 () |
Field of
Search: |
;435/6,91.1
;536/23.1,24.33,25.32,25.4 ;935/76,77 ;436/94 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
A-69724/87 |
|
Sep 1987 |
|
AU |
|
A-70152/87 |
|
Sep 1987 |
|
AU |
|
62364/86 |
|
Dec 1987 |
|
AU |
|
A-80097/87 |
|
Apr 1988 |
|
AU |
|
11937/88 |
|
Sep 1988 |
|
AU |
|
A-14005/88 |
|
Oct 1988 |
|
AU |
|
A-21781/88 |
|
Apr 1989 |
|
AU |
|
A-26755/88 |
|
Jun 1989 |
|
AU |
|
84302648 |
|
Oct 1984 |
|
EP |
|
0297379 |
|
Jan 1989 |
|
EP |
|
WO 83/01459 |
|
Apr 1983 |
|
WO |
|
WO 86/03782 |
|
Jul 1986 |
|
WO |
|
PCT/US89/00120 |
|
Jul 1989 |
|
WO |
|
WO 89/10414 |
|
Nov 1989 |
|
WO |
|
WO 90/01069 |
|
Feb 1990 |
|
WO |
|
WO 90/06042 |
|
Jun 1990 |
|
WO |
|
Other References
Mitchell et al., "Affinity Generation of Single Stranded DNA
following the Polymerase Chain eaction: Application to Dideoxy
Sequencing," Journal of Cellular Biochemistry, Supplement 13E,
Abstracts 18th Annual meeting, WH 214, Apr. 1989. .
Smith, "DNA Sequence Analysis by Primed Synthesis" in Methods in
Enzymology, vol. 65, pp. 560-581 (1980). .
Mitchell, et al. Journal of Cellular Biochemistry, Supplemental
13E, 1989, p. 298. .
Sommer et al., "Minimal homology requirements for PCR primers",
Nucleic Acids Research, vol. 17, No. 16, 1989, p. 6749. .
Ballabio et al., Nature, 343, p. 220 (Jan. 18, 1990). .
Grimberg et al., Nuc. Acids Res. 17, p. 8390 (1989). .
Signer et al., Nuc. Acids Res. 16, p. 7738 (1988)..
|
Primary Examiner: Sisson; Bradley L.
Attorney, Agent or Firm: Marshall, O'Toole, Gerstein, Murray
& Borun
Parent Case Text
This application is a continuation of U.S. patent application Ser.
No. 08/205,132 filed Feb. 28, 1994, now abandoned, which is a
continuation of U.S. patent application Ser. No. 07/744,766, filed
on Aug. 13, 1991, now abandoned, which is a continuation-in-part of
International Application Number PCT/AU90/00058, filed on Feb. 13,
1990.
Claims
We claim:
1. A method for detecting whether a specific nucleotide or base is
at a particular position in a specific polynucleotide sequence
comprising:
a) exposing, under hybridizing conditions, said specific
polynucleotide sequence to an oligonucleotide primer wherein said
primer has a sequence complementary to part of the specific
polynucleotide sequence wherein said primer has incorporated at its
5' end an element selected from the group consisting of a
separation element and a detectable element, and wherein said
primer hybridizes at a location selected from the group consisting
of (i) immediately adjacent to the particular position and (ii) not
immediately adjacent to the particular position whereby there is an
intervening sequence between the particular position and primer
bound to the specific polynucleotide sequence;
b) extending said hybridized primer up to and including said
specific nucleotide or base wherein the 3' terminal nucleotide is a
ddNTP and further includes an element selected from the group
consisting of a separation element and a detectable element with
the proviso that said extended primer has at least one separation
element and at least one detectable element;
c) separating the product of step b) into fractions wherein one
said fraction contains the primer extension product that contains
the chain terminating nucleotide at said particular position;
and
d) determining whether said primer extension product having said
chain terminating nucleotide at said particular position is present
in said fraction by assaying said fraction wherein the assay does
not include a digestion step.
2. The method of claim 1 wherein said separating step comprises:
contacting any extended primer with a molecule having affinity for
the separation element, said molecule being linked to a support
that facilitates said separating; and separating said contacted
extended primer to provide said fraction.
3. The method of claim 2 wherein said separation element and said
molecule are selected from the group listed. as follows:
4. The method of claim 2 wherein said support is a test strip.
5. A method for detecting whether the same or different specific
nucleotides or bases are at particular positions in at least two
different specific polynucleotide sequences comprising:
a) exposing, under hybridizing conditions, said specific
polynucleotide sequences to at least two different oligonucleotide
primers, wherein each of said different oligonucleotide primers has
a sequence complementary to part of one of said different specific
polynucleotide, sequences wherein:
each of said primers hybridizes to its complementary polynucleotide
sequence when present in said material, each of said
oligonucleotide primers hybridizing to part of a different specific
polynucleotide sequence to that of the other primer(s),
each of said primers hybridizes to its complementary specific
polynucleotide sequence in said material a location selected from
the group consisting of (i) immediately adjacent to the particular
position and (ii) not immediately adjacent to the particular
position whereby there is an intervening sequence between the
particular position and primer hybridized to the specific
polynucleotide sequence, and
each of said primers has incorporated at their 5' end an element
selected from the group consisting of a separation element and a
detectable element;
b) extending said hybridized different oligonucleotide primers up
to and including said specific nucleotide or base wherein the 3'
terminal nucleotide is a ddNTP and further includes an element
selected from the group consisting of a detectable element and a
separation element, with the proviso that each of said extended
primers has at least one separation element and at least on
detectable element;
c) separating the product(s) of step b) into fractions wherein one
said fraction contains the primer extension product(s) that contain
the chain terminating nucleotide at said particular position;
and
d) determining whether any of said primer extension product having
said chain terminating nucleotide at said particular position is
present in said fraction by assaying said fraction wherein the
assay does not include a digestion step.
6. A screening method for detecting whether the same or different
specific nucleotides or bases are at particular positions in at
least two different specific polynucleotide sequences
comprising:
a) exposing, under hybridizing conditions, said specific nucleotide
sequences to at least two different oligonucleotide primers, each
of said different oligonucleotide primers having a sequence
complementary to part of one of said different specific
polynucleotide sequences wherein:
each of said primers hybridize to its complementary polynucleotide
sequence when present in said material, each of said
oligonucleotide primers hybridizing to part of a different specific
polynucleotide sequence to that of the other primer(s),
each of said primers hybridizes to its complementary specific
polynucleotide sequence in said material at a location selected
from the group consisting of (i) immediately adjacent to the
particular position and (ii) not immediately adjacent to the
particular position whereby there is an intervening sequence
between the particular position and primer hybridized to the
specific polynucleotide sequence when presenting said material;
and
each of said primers has incorporated at their 5' end an element
selected from the group consisting of a separation element and a
detectable element;
b) extending said hybridized different oligonucleotide primers up
to and including said specific nucleotide or bas e wherein the 3'
terminal nucleotide is a ddNTP and further includes an element
selected from the group consisting of a detectable element and a
separation element with the proviso that each of said extended
primers as at least one separation element and at least one
detectable element;
c) separating the product(s) of step b) into fractions wherein one
said fraction contains the primer extension product(s) that contain
the chain terminating nucleotide at said particular position;
and
d) determining whether at least one of said primers extension
products having said chain terminating nucleotide at said
particular position is present in said fraction by assaying said
fraction wherein the assay does not include a digestion step.
7. The method of any one of claims 1, 5, or 6 wherein said primer
binds to part of said specific polynucleotide in said material
immediately adjacent to the particular position.
8. The method of any one of claims 1, 5, or 6 wherein said primer
binds to part of said specific nucleotide sequence in said material
not immediately adjacent to the particular position whereby there
is an intervening sequence between the particular position and
primer bound to the specific polynucleotide sequence.
9. The method of any one of claims 1, 5, or 6 wherein the
separation element comprises an inert support.
10. The method of any one of claims 1, 5, or 6 wherein the
separation element comprises an inert solid support.
11. The method of any one of claims 1, 5, or 6 wherein said
extending step comprises using four different nucleotides selected
from the group consisting of dATP, dCTP, dGTP, dTTP, dUTP, dITP,
ddATP, ddCTP, ddGTP, ddITP, and ddTTP, and wherein said nucleotides
incorporate at least one element selected from the group consisting
of a detectable element and a separation element.
12. The method of claim 11 wherein at least one of said nucleotides
includes a detectable element.
13. The method of claim 11 wherein at least one of said nucleotides
includes a separation element.
14. The method of claim 11 wherein at least one of said nucleotides
includes separation and detectable elements.
15. The method of any one of claims 1, 5, or 6 wherein said
extending step comprises using one nucleotide sequence selected
from the group consisting of ddITP, ddATP, ddCTP, ddGTP, and ddTTP,
and wherein said nucleotide incorporates at least one element
selected from the group consisting of a detectable element and a
separation element.
16. The method of claim 15 wherein said nucleotide includes a
detectable element.
17. The method of claim 15 wherein said nucleotide includes a
separation element.
18. The method of claim 15 wherein said nucleotide includes
separation and detectable elements.
19. The method of any one of claims 1, 5, or 6 wherein said
separating step comprises, contacting any extended primer with a
molecule having affinity for said separation element; and
separating said contacted extended primer(s) to provide said
fraction wherein said separation element and said molecule are
selected from the group listed as follows;
20. The method of any one of claims 1, 5, or 6 wherein the specific
polynucleotide sequence(s) is a DNA sequence.
21. The method of any one of claims 1, 5, or 6 wherein the specific
polynucleotide sequence(s) is an RNA sequence.
22. The method of any one of claims 1, 5, or 6 wherein the specific
polynucleotide sequence(s) is from an organism selected from the of
infectious organisms and disease causing organisms.
23. The method of any one of claims 1, 5, or 6 wherein the
oligonucleotide primer incorporates a detectable element at its 5'
end.
24. The method of any one of claims 1, 5, or 6 wherein the
separating step is a washing step.
25. The method of claim 5 or claim 6 wherein each of said primers
incorporates a different separation element.
26. The method of claim 5 or claim 6 wherein said separating step
comprises: contacting any extended primers with molecules having
affinity for the separation elements, said molecules being linked
to supports that facilitate said separating; and separating said
contacted extended primers to provide said fraction.
27. The method of claim 26 wherein said separation elements and
said molecules are selected from the group listed as follows:
28. The method of claim 26 wherein said supports are test
strips.
29. The method of claim 28 wherein said separating step comprises
precipitating any extended primer(s) and resuspending said extended
primer(s) in a solution conducive to binding of said separation
element(s) to a molecule(s) having affinity for said separation
element(s).
Description
TECHNICAL FIELD
This invention relates to a method for detecting a specific
polynucleotide sequence in a material, a method for detecting at
least two different specific polynucleotide sequences in material
having a plurality of different polynucleotide sequences, methods
for detecting whether a specific nucleotide or base is at a
particular position in a specific polynucleotide sequence, methods
for detecting whether the same or different specific nucleotides or
bases are at particular positions in at least two different
specific polynucleotide sequences in material having a plurality of
different polynucleotide sequences, a screening method for
detecting the presence of at least two different specific
polynucleotide sequences in material having a plurality of
different polynucleotide sequences and screening methods for
detecting whether the same or different specific nucleotides or
bases are at particular positions in at least two different
specific polynucleotide sequences in material having a plurality of
different polynucleotide sequences.
BACKGROUND ART
At present, the most common technique for the detection of
polynucleotide sequences is hybridization using oligonucleotide or
polynucleotide probes. For this technique, the target nucleic acid
is usually bound, irreversibly, to a solid support such as
cellulose or nylon. The labelled probe is then added in solution
under hybridizing conditions and if there is sequence homology
between the probe and the target nucleic acid, the probe will form
a hybrid molecule with the target polynucleotide. This hybrid can
be detected in a variety of ways such as by radiolabelling or
biotin labelling. The disadvantages of this technique are, firstly,
that it requires considerable operator expertise, secondly, the
technique is lengthy and time-consuming and thirdly, cannot be
easily automated. Often the entire procedure can take more than 48
hours.
The liquid-solid methods normally employed for detecting specific
nucleic acids in samples include Southern blot, Northern blot and
dot blot hybridizations. These methods are slow, inefficient,
technically demanding and are not easily automated. The Southern
and Northern blot protocols have the further disadvantage of
inefficient transfer of nucleic acid from gel to paper. Other
groups have used liquid-solid hybridizations in which a capture
probe is bound to a solid support and the DNA sequence of interest
in the sample becomes bound to the capture probe. An example of
this is in Australian Patent specification no. AU-70152/87 which
describes using at least two oligonucleotide probes, which are
complementary to mutually exclusive regions of the same target
nucleic acid in a liquid hybridization format to anneal the probes
to the target, if it is present, and detecting the presence of the
target by immobilisation of the two-probe target sandwich by one of
the probes and subsequent detection of the other probe. However,
this method requires a second, detector probe to hybridise to the
DNA sequence of interest. This step reduces the specificity of the
assay and subsequently increases background. The present invention
overcomes this problem by involving only one probe which acts both
as capture probe and as detector probe.
In contrast to liquid-solid hybridization, liquid-liquid
hybridization has very rapid kinetics and improved sensitivity due
to greater access of the probe to the target sequence. For example,
Gene-Probe, Inc., uses a liquid hybridization hydroxapatite method
to detect DNA sequences. The main disadvantage of this system is
that it relies on adsorptive discrimination of double-stranded DNA
from single-stranded DNA sequences rather than sequence-specific
separation of hybrid from excess probe. The present invention
overcomes these disadvantages by allowing the nucleic acid
hybridizations to occur in solution followed by the removal of the
"hybrid" molecules onto a solid support matrix. Another potential
advantage of liquid hybridization is that a generalised solid
support can work for a multitude of targets if the support-binding
probes are labelled with the same capture molecule.
Several cases exist (Australian Patent specification nos.
AU-A-70152/87, AU-A-26755/88, AU-A-53105/86, AU-B-89575/82 and
AU-A-80097/87) which use a combination of two oligonucleotide
probes to detect specific nucleic acid sequences in a sample. All
these require the use of two short sequences of DNA on the target.
These sequences must both be conserved in all possible target, must
be mutually exclusive and non-overlapping and must have a similar
G+C ratio to enable both probes to hybridize to their complementary
sequence under the same conditions.
There is related background art concerning the use of a capture
probe to detect the nucleic acid sequence of interest and to remove
it from solution by binding the hybrid to a solid support matrix
(Australian Patent specification nos. AU-A-70152/87, AU-A-53105/86,
AU-A-21781/88, AU-A-69724/87, AU-A-14005/88). However, these
techniques use separate capture and detector probes, resulting in a
number of disadvantages as detailed above. The present invention
overcomes these problems by using a single capture/detector probe
system.
There are many examples available of attaching non-radioactive
reporter molecules to DNA, to enable the detection of specific
hybrids. However, when biotin is incorporated into the DNA molecule
for detection, even though several biotin molecules may be
incorporated per target molecule (thereby increasing the
sensitivity of detection) the mechanism of visualising the
incorporated biotin is complex and time consuming.
By contrast, the incorporation of other non-radioactive reporter
molecules (such as fluorescent, luminescent, chemiluminescent
molecules) enables rapid and simple detection of the target
sequence. However, the present art only enables a single reporter
molecule to be attached to each target sequence. This fact reduces
the overall sensitivity of the final assay. The present invention
overcomes both these problems at the one time by using a
chemiluminescent detection system for simple, rapid detection and
also by incorporating several detector molecules into each target,
thereby significantly increasing assay sensitivity.
There is, therefore, a demand for a simple method which utilises
the rapid kinetics of liquid hybridization, which only requires a
single probe for analysis, and which results in stable hybrids
thereby allowing the unhybridized material to be easily removed
from the sequences to be detected. Accordingly, the present
invention provides a liquid hybridization system in which a single
probe hybridizes to the sequence of interest and is then covalently
extended to produce a stable hybrid. This hybrid is then captured
on to a support matrix and subsequently washed to removed
unhybridized material. The system described by the present
invention is simple, rapid, sensitive, can be read visually or on a
simple plate reader, and may be readily automated.
In this area of nucleic acid hybridization there is a need to
detect two broad types of diseases: infectious and genetic. In
relation to infectious diseases, a number of DNA based systems have
been described to detect diseases caused by bacteria such as
Salmonella, Neisseria, parasitic organisms such as Chlamydia and
Rickettsiae, viruses such as hepatitis B and protozoa such as
Plasmodium. However, all of these suffer one or more of the
disadvantages listed above.
In relation to genetic diseases which are characterised by a
mutation (deletion, insertion, point mutation or translocation),
the technology is less well developed. These types of diseases are
currently diagnosed either by using restriction fragment length
polymorphism (RFLP) analysis or by precise hybridization of short
oligonucleotide probes. RFLP detection requires that a restriction
enzyme site is altered by the mutation and this is not always the
case. In addition, RFLP analysis requires the use of Southern blot
hybridization for detection. The use of short oligonucleotide
probes to detect point mutations also has several serious
disadvantages. In particular, the hybridization conditions must be
precise to ensure that a single base-pair mismatch does not result
in hybridization. In practice, salt concentration and temperature
determine the specificity of the hybridization conditions and these
are not easily controlled to the required preciseness. The present
invention overcomes the need for Southern hybridization analysis
and for precise control of hybridization conditions. It achieves
this by the specific primer probe hybridizing to a constant section
of the gene adjacent to the mutation and allowing the enzyme, a DNA
polymerase, to extend the DNA chain up to and including the
nucleotide or base mutation. By manipulation of the
dideoxynucleotide added to the polymerase reaction all of the
possible nucleotide changes can be detected.
Detection of both infectious and genetic diseases requires the
incorporation of some type of labelled molecule into the system.
Various radioactive isotopes or radioactivity labelled compounds
may be used as labels. However, radioactive labels have several
disadvantages, including; (i) hazardous, (ii) expensive, (iii)
limited shelf life, (iv) require expensive equipment for measuring
the signal generated. More recently, a range of non-radioactive
substances have been used to detect DNA molecules. Examples of
non-radioactive labels are fluorescent, luminescent,
chemiluminescent, enzymatic or immunological compounds. Labels
based on the affinity of biotin and avidin or streptavidin,
lanthanide chelates, lectins and proteins may also be used. The
preferred detection means would be by spectroscopy or
photochemistry or by the formation of a detectable complex between
the label moiety and the polypeptide, lectin, or antibody linked to
an entity capable of generating a detectable change, including
enzymes such as; alkaline phosphatase or horseradish
peroxidase.
However, what is lacking in the current technology is a single
system which encompasses: (i) a rapid means of detecting a
polynucleotide sequence, (ii) which is sufficiently sensitive to
detect low numbers of the target sequence in the sample and (iii)
which is non-radioactive. At present, no single system satisfies
all these requirements.
As a final aspect, the need to detect specific polynucleotide
sequences in a sample requires the organisation of all steps
either; (i) into a simple kit format, or (ii) into an automated
device. Whereas both, kits and automated machines, are available
for detecting proteins by way of antibodies, no systems are yet
available which simply, rapidly and inexpensively detect specific
polynucleotide sequences in a sample.
OBJECTS OF INVENTION
It is an object of this invention to provide a method for detecting
a specific polynucleotide sequence in a material.
Another object is to provide a method for detecting at least two
different specific polynucleotide sequences in material having a
plurality of different polynucleotide sequences.
A further object is to provide methods for detecting whether a
specific nucleotide or base is at a particular position in a
specific polynucleotide sequence.
Yet another object is to provide methods for detecting whether the
same or different specific nucleotides or bases are at particular
positions in at least two different specific polynucleotide
sequences in material having a plurality of different
polynucleotide sequences.
A further object is to provide a screening method for detecting the
presence of at least two different specific polynucleotide
sequences in material having a plurality of different
polynucleotide sequences.
Another object is to provide screening methods for detecting
whether the same or different specific nucleotides or bases are at
particular positions in at least two different specific
polynucleotide sequences in material having a plurality of
different polynucleotide sequences.
DISCLOSURE OF INVENTION
The following abbreviations and definitions apply throughout the
specification and claims:
SP--specific primer: a nucleotide sequence complementary to a
portion of the target sequence
Target--the nucleotide sequence to be detected in the sample; can
be derived from, for example, any infectious or parasitic organism
including any virus, fungus, bacteria, mycoplasma, nematode,
protozoan, etc.
Polymerase Enzyme--any DNA dependent DNA polymerase or RNA
dependent DNA polymerase
dNTP--all four deoxyribonucleotides that is dATP, dCTP, dGTP and
dTTP as well as dITP and dUTP
ddNTP--all four dideoxyribonucleotides that is ddATP, ddCTP, ddGTP
and ddTTP as well as ddITP
D--detector molecule: a molecule which can be covalently attached
to a nucleotide or nucleotide sequence and that can be subsequently
assayed for either directly or indirectly. For example, biotin;
radioisotopes of carbon, hydrogen, iodine, phosphorus and sulphur;
any antigen; haptens; fluorescent molecules including fluorescein,
rhodamine and eosin; enzymes including alkaline phosphates,
peroxidases and luciferase; any monoclonal anti body
dNTP-D--a detector molecule covalently bound to one of the four
deoxyribonucleotides
C--capture molecule: a molecule which can be covalently attached to
a nucleotide or nucleotide sequence and that will subsequently bind
to a specific affinity molecule. For example, biotin (binds with
avidin or streptavidin); antibody (binds with antigen); antigen
(binds with anti body)
SAM--specific affinity molecule: a molecule that will bind
specifically with a particular capture molecule. For example,
avidin or streptavidin; an antibody; an antigen
SS--solid support: any solid matrix to which the SAM is attached.
For example, agarose; polyacrylamide; magnetic beads; polystyrene;
microtitre plates; nylon; nitrocellulose
Wash--addition and removal of a solution for the purpose of
removing unreacted molecules
Stringency--conditions of salt and temperature which affect the
stability of the hydrogen bonds between two nucleic acid molecules.
For example, the hydrogen bonds are most unstable at high
stringency reflecting either high temperature or low salt or
both.
Assay--any procedure that is specific for detecting the detector
molecule and that can be measured either qualitatively or
quantitatively
X--any one of the four deoxyribonucleotides
Y--any one of the four ribonucleotides or deoxyribonucleotides; in
the example Y will form hydrogen bonds with X, le, a nucleotide
sequence of nine Y's will be complementary to a nucleotide sequence
of 9 X's
Z--any one of the four nucleotides forming a sequence not
complementary to the sequence
ddT--dideoxythymidine-5'-triphosphate: ddT has been used as example
as it base pairs with A in the target sequence.
If the base to be detected was C then ddG would be used, G with ddC
and T with ddA.
ddT-C--dideoxythymidine-5'-triphosphate/capture molecule complex:
ddT has been used as example as it base pairs with A in the target
sequence. If the base to be detected was C then ddG would be used,
G with ddC and T with ddA. The capture molecule is covalently
attached to ddT and represents any one of the capture molecules
described above.
immediately adjacent--means that there are no nucleotides or bases
between a primer bound to part of a specific polynucleotide
sequence and a specific nucleotide or base to be detected
fraction--means at least a portion of a mixture resulting from the
reaction of an oligonucleotide primer(s), extending reagents,
specific polynucleotide sequence(s), detectable element(s) and/or
separation elements
intervening sequence--means at least one nucleotide or base between
a primer bound to part of a specific polynucleotide sequence and a
specific nucleotide or base to be detected
oligonucleotide primer--a single stranded nucleic acid molecule
with a typical length of 5 to 60 nucleotides but can be 200 or more
nucleotides which has a sequence complementary to part of the
polynucleotide sequence to be detected
specific polynucleotide sequence--a partly or completely known
sequence of nucleotides
hybridization--the physical association of the oligonucleotide
primer with the complementary region of the target polynucleotide
sequence to form a double stranded hybrid nucleic acid molecule
An interfering detectable and/or separation element is, for
instance, one which is the same as that which is incorporated at
the position complementary to the specific nucleotide or base to be
detected, eg:
(A) Consider a single nucleotide or base N.sub.1 to be detected in
a specific polynucleotide sequence S.sub.1. Assume there is a bound
oligonucleotide primer P.sub.1 having a sequence complementary to
part of S.sub.1 and which is bound to S.sub.1 Assume there are
intervening nucleotides N.sub.A, N.sub.B and N.sub.C between
P.sub.1 and N.sub.1. Extend P.sub.1 up to and including N.sub.1
with complementary nucleotides to N.sub.A, N.sub.B N.sub.C and
N.sub.1, namely, N.sub.D, N.sub.E, N.sub.F and N.sub.2 S.sub.1
(S.sub.1 corresponding to a separation element) respectively; then
the following conditions are required:
N.sub.A N.sub.B or N.sub.C cannot be N.sub.1
(B) Consider two nucleotides or bases N.sub.1 and N.sub.2 to be
detected in two different specific polynucleotide sequences S.sub.1
and S.sub.2. Assume there are two different oligonucleotide primers
P.sub.1 and P.sub.2 (bound to S.sub.1 and S.sub.2 respectively)
having sequence complementary to part of S.sub.1 and S.sub.2.
Assume there are intervening nucleotides N.sub.A, N.sub.B and
N.sub.C between P.sub.1 and N.sub.1 and intervening nucleotides
N.sub.X, N.sub.Y and N.sub.Z between P.sub.2 and N.sub.2. Extend
(a) P.sub.1 up to and including N.sub.1 with complementary
nucleotides to N.sub.A, N.sub.B, N.sub.C and N.sub.1, namely,
N.sub.D, N.sub.E, N.sub.F and N.sub.3 -D.sub.1 (D.sub.1
corresponding to a detectable element) respectively; and (b)
P.sub.2 up to and including N.sub.2 with complementary nucleotides
to N.sub.X, N.sub.Y, N.sub.Z and N.sub.2, namely, N.sub.O, N.sub.p,
N.sub.Q and N.sub.4 -D.sub.2 (D.sub.2 corresponding to another
detectable element); then the following conditions are
required:
______________________________________ If N.sub.1 = N.sub.2 and
D.sub.1 = D.sub.2 then N.sub.A ) N.sub.B ) N.sub.C ) cannot be
N.sub.1 N.sub.X ) N.sub.Y ) N.sub.Z ) If N.sub.1 does not equal
N.sub.2 D.sub.1 = D.sub.2 then N.sub.A ) N.sub.B ) N.sub.C ) cannot
be N.sub.1 or N.sub.2 N.sub.X ) N.sub.Y ) N.sub.Z ) If N.sub.1 does
not equal N.sub.2 D.sub.1 does not equal D.sub.2 N.sub.A ) N.sub.B
) cannot be N.sub.1 N.sub.C ) N.sub.X ) N.sub.Y ) cannot be N.sub.2
N.sub.2 ) ______________________________________
According to a first embodiment of this invention there is provided
a method for detecting a specific polynucleotide sequence in a
material comprising:
a) exposing said material to an oligonucleotide primer having a
sequence complementary to part of said specific polynucleotide
sequence wherein said primer binds to part of said polynucleotide
sequence when present in said material;
b) extending primer bound to the polynucleotide sequence wherein
any extended primer includes a detectable element and/or a
separation element;
c) separating any extended primer into a fraction wherein said
fraction does not have detectable element not included in said
extended primer; and
d) determining whether any extended primer is present in said
fraction by assaying said fraction for said extended primer wherein
the presence of said extended primer is indicative of the presence
of the specific polynucleotide sequence in said material and the
absence of said extended primer in said fraction is indicative of
the absence of the specific polynucleotide sequence in said
material.
According to a second embodiment of this invention there is
provided a method for detecting at least two different specific
polynucleotide sequences in material having a plurality of
different polynucleotide sequences comprising:
a) exposing said material to at least two different oligonucleotide
primers, wherein each of said different oligonucleotide primers has
a sequence complementary to part of one of said different specific
polynucleotide sequences and wherein each of said primers binds to
part of one of said different specific polynucleotide sequences
when present in said material each of said oligonucleotide primers
binding to part of a different specific polynucleotide sequence to
the other of said oligonucleotide primer(s);
b) extending said different oligonucleotide primers bound to their
different specific polynucleotide sequences wherein any extended
primer includes a detectable element and/or a separation
element;
c) separating any extended primers into at least one fraction
wherein said fraction(s) does not have detectable element not
included in said extended primer(s); and
d) determining whether any extended primers are present in said
fraction(s) by assaying said fraction(s) for at least one of said
extended primers wherein the presence of said extended primer(s) is
indicative of the presence of at least one of the different
specific polynucleotide sequences in said material and the absence
of said extended primer(s) in said fraction(s) is indicative of the
absence of at least one different specific polynucleotide sequence
in said material.
According to a third embodiment of this invention there is provided
a method for detecting whether a specific nucleotide or base is at
a particular position in a specific polynucleotide sequence in
material comprising:
a) exposing said material to an oligonucleotide primer having a
sequence complementary to part of the specific polynucleotide
sequence wherein said primer binds to part of said specific
polynucleotide sequence in said material immediately adjacent to
the particular position;
b) extending primer bound to the specific polynucleotide sequence
with the proviso that the bound primer is only extended up to and
including said specific nucleotide or base when said specific
nucleotide or base is at the particular position in the specific
polynucleotide sequence wherein the extended primer has a
detectable element and/or a separation element at a position
complementary to said specific nucleotide or base;
c) separating any extended primer into a fraction wherein said
fraction does not have detectable element not included in said
extended primer; and
d) determining whether any extended primer is present in said
fraction by assaying said fraction for said extended primer wherein
the presence of said extended primer indicates that the specific
nucleotide or base is at the particular position in the specific
polynucleotide sequence and the absence of said extended primer
indicates that the specific nucleotide or base is not at the
particular position in the specific polynucleotide sequence.
According to a fourth embodiment of this invention there is
provided a method for detecting whether the same or different
specific nucleotides or bases are at particular positions in at
least two different specific polynucleotide sequences in material
having a plurality of different polynucleotide sequences
comprising:
a) exposing said material to at least two different oligonucleotide
primers, wherein each of said different oligonucleotide primers has
a sequence complementary to part of one of said different specific
polynucleotide sequences and wherein each of said primers binds to
its complementary polynucleotide sequence when present in said
material each of said oligonucleotide primers binding to part of a
different specific polynucleotide sequence to that of the other
primer(s) and wherein each of said primers binds to its
complementary specific polynucleotide sequence in said material
immediately adjacent to the particular position;
b) extending said different oligonucleotide primers bound to their
complementary polynucleotide sequences with the proviso that each
of the bound primers is only extended up to and including the
particular position when said specific nucleotide or base is at the
particular position in the specific nucleotide sequence wherein
each of said extended primers has a detectable element and/or a
separation element at a position complementary to said specific
nucleotide or base;
c) separating any extended primer(s) which has extended only up to
a specific nucleotide or base at a particular position into at
least one fraction wherein said fraction does not have detectable
element not included in said extended primer; and
d) determining whether at least one extended primer is present in
said fraction(s) by assaying said fraction(s) for said extended
primer(s) wherein the presence of an extended primer indicates that
a specific nucleotide or base is at a particular position in a
specific polynucleotide sequence and the absence of said extended
primer(s) in a fraction(s) indicates that at least one specific
nucleotide or base is not at a particular position in at least one
different specific polynucleotide sequence.
According to a fifth embodiment of this invention there is provided
a method for detecting whether a specific nucleotide or base is at
a particular position in a specific polynucleotide sequence in
material comprising:
a) exposing said material to an oligonucleotide primer having a
sequence complementary to part of the specific polynucleotide
sequence wherein said primer binds to part of said specific
polynucleotide sequence in said material not immediately adjacent
to the particular position whereby there is an intervening sequence
between the particular position and primer bound to the specific
polynucleotide sequence;
b) extending bound primer with the proviso that the bound primer is
only extended up to and including said specific nucleotide or base
when said specific nucleotide or base is at the particular position
in the specific polynucleotide sequence wherein the extended primer
has a detectable element and/or a separation element at a position
complementary to said specific nucleotide or base with the proviso
that the intervening sequence cannot be one where bases or
nucleotides complementary to the intervening sequence and which are
incorporated into the extended primer cause Incorporation of an
interfering detectable and/or separation element;
c) separating any extended primer which has extended only up to a
specific nucleotide or base at a particular position into a
fraction wherein said fraction does not have detectable element not
included in said extended primer; and
d) determining whether any extended primer is present in said
fraction by assaying said fraction for said extended primer wherein
the presence of said extended primer indicates that the specific
nucleotide or base is at the particular position in the specific
polynucleotide sequence and the absence of said extended primer
indicates that the specific nucleotide or base is not at the
particular position in the specific polynucleotide sequence.
According to a sixth embodiment of this invention there is provided
a method for detecting whether the same or different specific
nucleotides or bases are at particular positions in at least two
different specific polynucleotide sequences in material having a
plurality of different polynucleotide sequences comprising:
a) exposing said material to at least two different oligonucleotide
primers, wherein each of said different oligonucleotide primers has
a sequence complementary to part of one of said different specific
polynucleotide sequences and wherein each of said primers binds to
its complementary polynucleotide sequence not immediately adjacent
to the particular position whereby there is an intervening sequence
between the particular position and primer bound to the specific
polynucleotide sequence when present in said material each of said
oligonucleotide primers binding to part of a different specific
polynucleotide sequence to that of the other primer(s);
b) extending said different oligonucleotide primers bound to their
complementary polynucleotide sequences wherein each of the bound
primers is only extended up to and including the particular
position when said specific nucleotide or base is at the particular
position in the specific nucleotide sequence wherein each of said
extended primers has a detectable element and/or a separation
element at a position complementary to said specific nucleotide or
base with the proviso that the intervening sequences cannot be ones
where bases or nucleotides complementary to the intervening
sequences and which are incorporated into the extended primer(s)
cause incorporation of interfering detectable and/or separation
element(s);
c) separating any extended primer which has extended only up to a
specific nucleotide or base at a particular position into at least
one fraction wherein said fraction(s) does not have detectable
element not included in said extended primers; and
d) determining whether any extended primers are present in said
fraction(s) by assaying said fraction(s) for said extended
primer(s) wherein the presence of an extended primer(s) indicates
that at least one specific nucleotide or base is at a particular
position in a specific polynucleotide sequence and the absence of
said extended primer(s) in a fraction indicates that at least one
specific nucleotide or base is not at a particular position in at
least one different specific polynucleotide sequence.
According to a seventh embodiment of this invention there is
provided a kit for detecting a specific polynucleotide sequence in
a material comprising:
a) an oligonucleotide primer having a sequence complementary to
part of said specific polynucleotide sequence;
b) polymerase enzyme for extended the oligonucleotide primer;
c) at least one nucleotide selected from the group consisting of
dATP, dCTP, dGTP, dTTP, dUTP, dITP, ddATP, ddCTP, ddGTP, ddITP and
ddTTP; and
d) a detectable element and/or separation element which is
optionally attached to the oligonucleotide primer or one or more of
the nucleotides.
According to an eighth embodiment of this invention there is
provided a kit for detecting at least two different specific
polynucleotide sequences in a material having a plurality of
different polynucleotide sequences comprising:
a) at least two different oligonucleotide primers, wherein each of
said primers has a sequence complementary to part of one of said
specific polynucleotide sequences;
b) polymerase enzyme(s) for extending the different oligonucleotide
primers;
c) at least one nucleotide selected from the group consisting of
dATP, dCTP, dGTP, dTTP, dUTP, dITP, ddATP, ddCTP, ddGTP, ddITP and
ddTTP; and
d) a detectable element and/or separation element which is
optionally attached to the oligonucleotide primers or one or more
of the nucleotides.
According to a ninth embodiment of this invention there is provided
a kit for detecting whether a specific nucleotide or base is at a
particular position in a specific polynucleotide sequence in a
material comprising:
a) an oligonucleotide primer having a sequence complementary to
part of the specific polynucleotide sequence wherein said primer
binds to part of said specific polynucleotide sequence immediately
adjacent to the particular position;
b) a polymerase enzyme for extended the oligonucleotide primer;
c) one nucleotide selected from the group consisting of dATP, dCTP,
dGTP, dTTP, dUTP, dITP, ddITP, ddATP, ddCTP, ddGTP and ddTTP with
the proviso that said nucleotide is selected whereby bound primer
is only extended up to and including said specific nucleotide or
base when said specific nucleotide or base is at the particular
position in the specific polynucleotide sequence; and
d) a detectable element and/or separation element whereby extended
primer has a detectable element and/or a separation element at a
position complementary to said specific nucleotide or base and a
detectable and/or separation element optionally attached to the
oligonucleotide primer.
According to a tenth embodiment of this invention there is provided
a kit for detecting whether the same or different specific
nucleotides or bases are at particular positions in at least two
different specific polynucleotide sequences in material having a
plurality of different polynucleotide sequences comprising:
a) at least two different oligonucleotide primers, wherein each of
said primers has a sequence complementary to part of one of said
specific polynucleotide sequences and wherein each of said primers
binds to its complementary polynucleotide sequence when present in
said material each of said oligonucleotide primers binding to part
of a different specific polynucleotide sequence to that of the
other primer(s) and wherein each of said primers binds to its
complementary specific polynucleotide sequence in said material
immediately adjacent to the particular position;
b) a polymerase enzyme(s) for extending the different
oligonucleotide primers;
c) at least one nucleotide selected from the group consisting of
dATP, dCTP, dGTP, dTTP, dUTP, dITP, ddITP, ddATP, ddCTP, ddGTP and
ddTTP with the proviso that said nucleotide is selected whereby
bound primer is only extended up to and including said specific
nucleotide or base when said specific nucleotide or base is at the
particular position in the specific polynucleotide sequence;
and
d) at least one detectable element and/or separation element
whereby each extended primer has a detectable element and/or a
separation element at a position complementary to said specific
nucleotide or base and a detectable and/or separation element
optionally attached to the oligonucleotide primer.
According to an eleventh embodiment of this invention there is
provided a kit for detecting whether a specific nucleotide or base
is at a particular position in a specific polynucleotide sequence
in a material comprising:
a) an oligonucleotide primer having a sequence complementary to
part of the specific polynucleotide sequence wherein said primer
binds to part of said specific polynucleotide sequence not
immediately adjacent to the particular position whereby there is an
intervening sequence between the particular position and primer
bound to the specific polynucleotide sequence;
b) a polymerase enzyme for extended the oligonucleotide primer;
c) one nucleotide selected from the group consisting of dATP, dCTP,
dGTP, dTTP, dUTP, dITP, ddITP, ddATP, ddCTP, ddGTP and ddTTP with
the provision that said nucleotide is selected whereby bound primer
is only extended up to and including said specific nucleotide or
base when said specific nucleotide or base is at the particular
position in the specific polynucleotide sequence with the proviso
that the intervening sequence cannot be one where bases or
nucleotides complementary to the intervening sequence and which are
incorporated into the extended primer cause incorporation of an
interfering detectable and/or separation element; and
d) a detectable element and/or separation element whereby extended
primer has a detectable element and/or a separation element at a
position complementary to said specific nucleotide or base and a
detectable and/or separation element optionally attached to the
oligonucleotide primer.
According to a twelfth embodiment of this invention there is
provided a kit for detecting whether the same or different specific
nucleotides or bases are at particular positions in at least two
different specific polynucleotide sequences in material having a
plurality of different polynucleotide sequences comprising:
a) at least two different oligonucleotide primers, wherein each of
said primers has a sequence complementary to part of one of said
specific polynucleotide sequences and wherein each of said primers
binds to its complementary polynucleotide sequence when present in
said material each of said oligonucleotide primers binding to part
of a different specific polynucleotide sequence to that of the
other primer(s) and wherein each of said primers binds to its
complementary specific polynucleotide sequence in said material not
immediately adjacent to the particular position whereby there is an
intervening sequence between the particular position and primer
bound to the specific polynucleotide sequence;
b) a polymerase enzyme(s) for extending the different
oligonucleotide primers;
c) at least one nucleotide selected from the group consisting of
dATP, dCTP, dGTP, dTTP, dUTP, dITP, ddITP, ddATP, ddCTP, ddGTP and
ddTTP with the proviso that said nucleotide is selected whereby
bound primer is only extended up to and including said specific
nucleotide or base when said specific nucleotide or base is at the
particular position in the specific polynucleotide sequence with
the proviso that the intervening sequences cannot be ones where
bases or nucleotides complementary to the intervening sequences and
which are incorporated into the extended primer(s) cause
incorporation of an interfering detectable and/or separation
element(s); and
d) at least one detectable element and/or separation element
whereby each extended primer has a detectable element and/or a
separation element at a position complementary to said specific
nucleotide or base and a detectable and/or separation element
optionally attached to the oligonucleotide primer.
According to a thirteenth embodiment of this invention there is
provided an apparatus for performing the method of any one of the
embodiments of the invention comprising: a reactor;
means for adding oligonucleotide primer and reagents for extending
said primer to said reactor, said means for adding being
operatively associated with the reactor;
means for separating extended primer into at least one fraction(s)
and for holding said fraction(s), said means for separating being
operatively associated with the reactor; and
a detector for detecting the presence of any extended primer(s) in
said fraction(s), said detector being operatively associated with
said means for separating.
According to a fourteenth embodiment of this invention there is
provided a screening method for detecting the presence of at least
two different specific polynucleotide sequences in material having
a plurality of different polynucleotide sequences comprising:
a) exposing said material to at least two different oligonucleotide
primers, wherein each of said different oligonucleotide primers has
a sequence complementary to part of one of said different specific
polynucleotide sequences and wherein each of said primers binds to
part of one of said different specific polynucleotide sequences
when present in said material each of said oligonucleotide primers
binding to part of a different specific polynucleotide sequence to
the other of said oligonucleotide primer(s);
b) extending said different oligonucleotide primers bound to their
different specific polynucleotide sequences wherein any extended
primer includes a detectable element and/or a separation
element;
c) separating any extended primers into a fraction wherein said
fraction does not have detectable element not included in said
extended primer(s); and
d) determining whether any extended primers are present in said
fraction by assaying said fraction for all of said extended primers
wherein the presence of any one of said extended primers is
indicative of the present of at least one of the different specific
polynucleotide sequences in said material and the absence of all of
said extended primer(s) in said fraction is indicative of the
absence of all of the different specific polynucleotide sequences
in said material.
According to a fifteenth embodiment of this invention there is
provided a screening method for detecting whether the same or
different specific nucleotides or bases are at particular positions
in at least two different specific polynucleotide sequences in
material having a plurality of different polynucleotide sequences
comprising:
a) exposing said material to at least two different oligonucleotide
primers, wherein each of said different oligonucleotide primers has
a sequence complementary to part of one of said different specific
polynucleotide sequences and wherein each of said primers binds to
its complementary polynucleotide sequence when present in said
material each of said oligonucleotide primers binding to part of a
different specific polynucleotide sequence to that of the other
primer(s) and wherein each of said primers binds to Its
complementary specific polynucleotide sequence in said material
immediately adjacent to the particular position;
b) extending said different oligonucleotide primers bound to their
complementary polynucleotide sequences with the proviso that each
of the bound primers is only extended up to and including the
particular position when said specific nucleotide or base is at the
particular position in the specific nucleotide sequence wherein
each of said extended primers has a detectable element and/or a
separation element at a position complementary to said specific
nucleotide or base;
c) separating any extended primer(s) which has extended only up to
a specific nucleotide or base at a particular position into a
fraction wherein said fraction does not have detectable element not
included in said extended primer; and
d) determining whether at least one extended primer is present in
said fraction by assaying said fraction for all of said extended
primers wherein the present of an extended primer indicates that at
least one specific nucleotide or base is at a particular position
in a specific polynucleotide sequence and the absence of all said
extended primers in said fraction indicates that at least one
specific nucleotide or base is not at a particular position in any
of the different specific polynucleotide sequences.
According to a sixteenth embodiment of this invention there is
provided a screening method for detecting whether the same or
different specific nucleotides or bases are at particular positions
in at least two different specific polynucleotide sequences in
material having a plurality of different polynucleotide sequences
comprising:
a) exposing said material to at least two different oligonucleotide
primers, wherein of said different oligonucleotide primers has a
sequence complementary to part of one of said different specific
polynucleotide sequences and wherein each of said primers binds to
its complementary polynucleotide sequence not immediately adjacent
to the particular position whereby there is an intervening sequence
between the particular position and primer bound to the specific
polynucleotide sequence when present in said material each of said
oligonucleotide primers binding to part of a different specific
polynucleotide sequence to that of the other primer(s);
b) extending said different oligonucleotide primers bound to their
complementary polynucleotide sequences wherein each of the bound
primers is only extended up to and including the particular
position when said specific nucleotide or base is at the particular
position in the specific nucleotide sequence wherein each of said
extended primers has a detectable element and/or a separation
element at a position complementary to said specific nucleotide or
base with the proviso that the intervening sequences cannot be ones
where bases or nucleotides complementary to the intervening
sequences and which are incorporated into the extended primer(s)
cause incorporation of interfering detectable and/or separation
element(s);
c) separating any extended primer which has extended only up to a
specific nucleotide or base at a particular position into a
fraction wherein said fraction does not have detectable element not
included in said extended primers; and
d) determining whether any extended primers are present in said
fraction by assaying said fraction for all of said extended primers
wherein the presence of an extended primer indicates that at least
one specific nucleotide or base is at a particular position in a
specific polynucleotide sequence and the absence of any extended
primer indicates that a specific nucleotide or base is not at a
particular position in any of the different specific polynucleotide
sequences.
Generally the method for the detection of a nucleotide sequence or
nucleotide change in a nucleotide sequence uses:
a nucleic acid primer specific to part of a partly or wholly known
nucleotide sequence to be detected or specific to part of a partly
or wholly known nucleotide sequence which is immediately adjacent
to the nucleotide or base change to be detected or specific to part
of a partly or wholly known nucleotide sequence which is not
immediately adjacent to the nucleotide or base change to be
detected but has an intervening sequence between the bound primer
and the nucleotide or base change to be detected
extension of the primer catalysed by a nucleic acid polymerase
enzyme either (i) the attachment of a capture molecule at the 5'
end of the specific primer, addition of the target sequence under
hybridization conditions and the incorporation of a detector
molecule(s) in the enzyme catalysed extended primer or (ii) the
attachment of a detector molecule at the 5' end of the specific
primer, addition of the target sequence under hybridization
conditions and the incorporation of a capture molecule(s) in the
enzyme catalysed extended primer capture of the extended primer
using a specific affinity molecule attached to a solid support
assay for the detector molecule
Advantageously, for the first, second, seventh and eighth
embodiments extending the primer comprises using at least one
nucleotide selected from the group consisting of dATP, dCTP, dGTP,
dTTP, dUTP, dITP, ddATP, ddCTP, ddGTP, ddITP and ddTTP. Typically
two to four different nucleotides, and especially four different
nucleotides are used.
Generally, for the third, fifth, ninth and eleventh embodiments
extending the primer comprises using one nucleotide selected from
the group consisting of dATP, dCTP, dGTP, dTTP, dUTP, dITP, ddATP,
ddCTP, ddGTP, ddITP and ddTTP. Typically one nucleotide selected
from the group consisting of ddATP, ddCTP, ddGTP, ddITP and ddTTP
is used.
Typically, for the fourth, sixth, tenth and twelfth embodiments
extending the primer comprises using at least one nucleotide
selected from the group consisting of dATP, dCTP, dGTP, dTTP, dUTP,
dITP, ddATP, ddCTP, ddGTP, ddITP and ddTTP. Generally at least one
nucleotide selected from the group consisting of ddATP, ddCTP,
ddGTP, ddITP and ddTTP is used.
In addition to a nucleotide(s) also typically used in extending the
primer are at least one appropriate polymerase enzyme and
appropriate buffering agent.
Examples of polymerase enzymes are E.coli DNA polymerase, E.coli
DNA polymerase (Klenow fragment), Bacteriophage T7 DNA polymerase,
Bacteriophage T4 DNA polymerase, Taq DNA polymerase and AMV Reverse
transcriptase.
Buffering agents which buffer aqueous solutions between pH 6-8.5
are generally suitable for use with a polymerase enzyme to extend
the primer. Generally a magnesium salt (eg MgCl.sub.2 or
MgSO.sub.4) is included with the buffering agent. A total salt
concentration between 50 and 300 mM is generally acceptable.
Temperature of the extending reaction is chosen according to the
polymerase enzyme used and is typically in the range
25.degree.-80.degree. C., more typically 30.degree.-70.degree.
C.
It is preferred that at least one of the nucleotides has the
detectable element.
Alternatively, or in addition, the detectable element is linked to
the oligonucleotide primer.
Typically, the detectable element is a radioactive label selected
from the group consisting of .sup.3 H, .sup.125 I, .sup.131 I,
.sup.14 C, .sup.35 S and .sup.32 P
The detectable element may be non-radioactive and generally is
selected from the group consisting of an enzymatic group, an
immunological group, and a spectroscopically detectable group. The
spectroscopically detectable group may be a luminescent group, a
chemiluminescent group, an NMR detectable group, a fluorescent
group or an 1R detectable group.
Advantageously, the extended primer includes a separation element
which facilitates the separation of the extended primer into the
first fraction.
Generally, the specific polynucleotide sequence is a DNA sequence
or an RNA sequence.
The specific polynucleotide sequence may be from an infectious or
disease causing organism which may be live or non-viable viral,
bacterial, fungal or Protozoan.
The extending may include:
adding a plurality of nucleotide types to said primer bound to the
polynucleotide sequence to extend said primer; or
adding a single nucleotide type to said primer bound to the
polynucleotide sequence to extend said primer (third, fifth, ninth
and eleventh embodiments); or
adding at least one single nucleotide type to said primer bound to
the polynucleotide sequence to extend said primer.
In one particular method of the invention the exposure and primer
extension steps occur before the separation step.
In one form of this invention, the separation element is linked to
the oligonucleotide primer. Alternatively, the extended primer
includes a separation element which facilitates separation of
extended primer from the mixture into the first fraction and
wherein at least one of said nucleotides has the separation
element.
In one form of the invention, the separation step comprises:
contacting any extended primer with a molecule having affinity for
the separation element, the molecule being linked to a support that
facilitates the separating; and separating the contacted extended
primer(s) to provide the fraction.
Advantageously, the separation element and the molecule are
selected from the group listed immediately below:
______________________________________ Molecule Having Affinity for
Separation Element Separation Element
______________________________________ (a) a ligand for which a
receptor for the ligand; there is a receptor; (b) a receptor; the
ligand for the receptor; (c) an antigen; an antibody for the
antigen; (d) an antibody for the antigen; an antigen; (e) an
antiidiotypic an antibody for the antiidiotypic antibody; antibody;
(f) an antibody for an an antiidiotypic antibody for the
antiidiotypic antibody; antibody; (g) a haptenic group; an antibody
for the haptenic group; (h) an antibody for the haptenic group; a
haptenic group; (i) an enzyme; a binding inhibitor for the enzyme;
and (j) a binding the enzyme. inhibitor for an enzyme;
______________________________________
Typically, the separation element and the molecule are selected
from the group listed below:
______________________________________ Molecule Having Affinity for
Separation Element Separation Element
______________________________________ (a) a ligand for which a
specific receptor for the ligand; there is a specific receptor; (b)
a specific receptor; the ligand for the specific receptor; (c) an
antigen; a specific antibody for the antigen; (d) a specific
antibody the antigen; for an antigen; (e) an antiidiotypic an
antibody specific for the antiidiotypic antibody; antibody; (f) an
antibody for an an antiidiotypic antibody specific for the
antiidiotypic antibody; antibody; (g) a haptenic group; a specific
antibody for the haptenic group; (h) a specific antibody the
haptenic group; for a haptenic group; (i) an enzyme; a tight
binding inhibitor for the enzyme; (j) a tight binding and the
enzyme. inhibitor for an enzyme;
______________________________________
Typical examples of ligands for which there are available receptors
are:
a vitamin such as biotin, a sugar molecule such as glucose or
mannose, a hormone such as adrenalin or cortisone and a steroid
such as progesterone or testosterone. There are numerous types of
ligand which have available receptors and the preceding list is
given by way of exemplification only.
The separation typically includes a solid support which is
typically selected from the group consisting of latex, magnetic
beads, nitrocellulose, agarose, cellulose, polyacrylamide, nylon,
glass and polystyrene.
ADVANTAGES
1. General Advantages
A particular advantage of the method of the invention is that the
system combines separation and detection elements on the one
oligonucleotide after primer extension. Most other systems require
the use of a capture probe and a detector probe.
A further advantage is that the system depends on the enzyme driven
extension of the primer to incorporate a separation or detection
element or elements (depending on configuration) and the the
element or elements are therefore covalently attached to the
specific primer. Because of this covalent attachment, washing steps
can be performed at very high stringency which results in reduced
background and increased specificity.
Another advantage is that the method of the invention can be easily
automated.
In the method of the invention the steps can be incorporated into a
simple kit format.
A further advantage is that an oligonucleotide primer having a
sequence complimentary to a conserved or variable region of the
genome of the organism of interest can be used and thus can be
designed for high or low specificity (i.e., genus specific, species
specific or strain specific). a rapid and sensitive method for the
detection of specific polynucleotide. sequences or nucleotide
changes in specific polynucleotide sequences using a single
oligonucleotide probe.
Generally in the method of the invention the detectable hybrid is
captured by a solid matrix to allow washing away of unincorporated
detectable element. While this is not a difficult step it does add
to the time required for processing. The step can be overcome by
choosing a detectable element whereby any unincorporated detectable
element can be simple inactivated and left in the reaction mix,
rather than having to be physically removed.
Generally, a detection sensitivity in the order of 10.sup.3
-10.sup.4 genome copies is quite adequate for detecting a wide
range of virus, bacterial and parasitic organisms which are usually
present in moderate to high numbers in their respective disease
states. For defect diseases in which the infectious agent Is
present only in very low numbers (e.g. HIV) the method of the
invention can make use of the technique of polymerisation chain
reaction (PCR) which is effectively an amplification step which
results in an increase in sensitivity.
2. Infectious Disease Diagnosis Advantages
The method of the invention permits the rapid, simple and
non-hazardous detection of specific polynucleotide sequences in
samples of biological material especially infectious agents. The
detectable sequence may be part of an infectious organism such as a
virus, bacterium, Protozoan or fungus, or part of a gene in which
an abnormality results in a genetic disorder: for example,
sickle-cell anemia, cystic fibrosis, .alpha.-thalassemia or
.beta.-thalassemia.
Non-viable organisms can be detected using the method of the
invention.
A further advantage is the method can use a mixture of
oligonucleotide primers for the detection of a battery of agents
(e.g., pneumonia, mycoplasma, chlamydia, streptococcus, legionella,
RSV) suspected of causing a broad range of disease states.
3. Genetic Disease Diagnosis Advantages
The method can be used for the rapid detection of an altered
nucleotide base (point mutation) and for the detection of the
insertion or deletion of one or more nucleotides in a
polynucleotide sequence. In this instance the genetic change has to
be known and characterised at the DNA sequence level.
The detection of a single or more base changes can be
automated.
The method can be adapted to large scale screening for single (or
more) nucleotide changes. This is particularly important in
screening for genetic diseases such as cystic fibrosis but can also
be adapted to the differentiation of alleles not necessarily
involved in gene expression such as used for DNA profiling.
This particular method does not involve solid-liquid hybridization,
precise liquid hybridization conditions and is not technically
demanding. Other systems, such as Southern blot hybridization,
require that the target: polynucleotide sequence is linked to a
solid support (technically demanding) and/or the use of
oligonucleotide probes that require precise hybridization
conditions. These systems cannot be automated and are not easily
adapted to large scale screening.
BRIEF DESCRIPTION OF DRAWINGS
Preferred embodiments of the invention are now described with
reference to the following drawings in which:
FIG. 1 is a schematic drawing of a method for detecting a specific
polynucleotide sequence;
FIG. 2a is a schematic drawing of a method for detecting a specific
polynucleotide sequence using a separation element which links to
the oligonucleotide primer portion of an extended primer;
FIG. 2b is a schematic drawing of a method for detecting a specific
polynucleotide sequence using a separation element which links to
the extended portion of an extended primer;
FIG. 3a is a schematic drawing of a method for detecting a
nucleotide or base change using a separation element which links to
the oligonucleotide primer portion of an extended primer;
FIG. 3b is a schematic drawing of a method for detecting a
nucleotide or base change using a separation element which links to
the extended portion of an extended primer;
FIG. 3c is a schematic drawing of a method for detecting a
nucleotide or base change using a detectable element linked to the
extended portion of an extended primer;
FIG. 4 shows an autoradiograph used to verify the size of the
extended oligonucleotide produced in the third example of the
invention; and
FIG. 5 is a schematic depiction of an apparatus for performing any
one of the methods of the invention.
FIG. 6 shows the nucleotide sequences of the primer extension
reaction of Example 5. The sequence of the biotinylated specific
primer is set out in SEQ ID NO: 7. The sequences of the coding and
noncoding strands of the normal CFTR gene segment are set in SEQ ID
NO: 8 and 9, respectively, while the sequences of the coding and
noncoding strands of the .DELTA.F508 CFTR gene segment are set out
in SEQ ID NO: 10 and 11, respectively.
BEST MODE AND OTHER MODES OF CARRYING OUT THE INVENTION
There are four especially preferred applications of the methods of
the invention, that is, (i) the detection of a specific nucleotide
sequence (major application: infectious diseases) (ii) the
detection of a nucleotide or base change (major applications:
genetic diseases and DNA fingerprinting) (iii) the detection of
multiple specific nucleotide sequences using different capture
molecules (major application: multiple infectious diseases) and
(iv) detection of multiple nucleotide or base changes in different
polynucleotide sequences (major applications: multiple genetic
diseases and DNA fingerprinting). A single apparatus (with minor
modifications) is suitable for use with all applications.
1. Detection of a specific nucleotide sequence
Referring to FIG. 1, a method for detecting a specific
polynucleotide sequence first involves the synthesis of an
oligonucleotide primer complementary to the target polynucleotide
sequence. The optimum length of the primer depends on the length of
the most conserved sequence in the polynucleotide sequence to be
detected up to a maximum length of 30 nucleotides.
The specific primer is preferably attached to an inert solid
support, using the method of Ashley and MacDonald Analytical
Biochem., (1984) as described herein below in Example 1. Any inert
support particle to which small DNA molecules can be attached can
be used, for instance cellulose or nylon. The polynucleotide
sequence to be detected is added to the support-specific primer
conjugate in the presence of a solution that promotes rapid
hybridization between the specific primer and the polynucleotide
sequence. One appropriate solution contains 0.15M sodium chloride,
0.015M sodium citrate and 4% polyethylene glycol 6000. The support
is then washed.
The choice of washing buffer determines the stringency conditions.
A standard buffer is 140 mM sodium chloride, 15 mM sodium citrate
and 20 mM sodium phosphate, pH 7.0.
The specific primer is extended using either DNA polymerase I
(Klenow fragment) or reverse transcriptase in the presence of the
four deoxyribonucleotides, one of which is labelled, radioactively,
with biotin or with a fluorescent label. The length of extension
depends upon the time and temperature of the extension reaction
providing all chemicals are in non-limiting concentration.
Generally the reaction is carried out at 37.degree. C. for 30
minutes and the label is .sup.32 P. The level of incorporation of
labelled nucleotide into the extended primer is measured by liquid
scintillation when the label is .sup.32 P.
Alternatively the label can be a fluorescent label.
Following primer extension the mixture is washed and assayed for
presence of the label.
The presence of label after the final wash indicates that the
primer has been extended, and that, therefore, the nucleic acid
whose presence is being assayed is present. The specific primer can
only be extended using the nucleic acid to which it is
complementary as template.
In summary this method involves the following steps:
the synthesis of a specific primer complementary to part of a known
or partly known nucleic acid sequence, the target.
the attachment of a capture (Configuration A-FIG. 2a) or detector
(Configuration B-FIG. 2b) molecule to the 5' end of the specific
primer
the hybridization, in solution, of this specific primer to the
target nucleic acid sequence
the addition to the solution of the four deoxyribonucleotides and
either a DNA dependent DNA polymerase (if the target is DNA) or a
RNA dependent DNA polymerase (if the target is RNA) under
conditions suitable for the enzymatic extension of the specific
primer. One or more of the deoxyribonucleotides has covalently
attached to it a detector molecule (Configuration A) or a capture
molecule (Configuration B)
the polymerase enzyme extends the primer using the target nucleic
acid as a template and simultaneously incorporates either a
detector or a capture molecule into the extended primer
the reaction can be heat denatured and the cycle repeated to
amplify
the amount of extended specific primer for Configuration A, the
specific affinity molecule (attached to a solid support) is added
to the solution under conditions conducive to the binding of the
capture molecule to the specific affinity molecule for
Configuration B, the extended specific primer is precipitated with
ethanol, washed to remove unincorporated
deoxyribonucleotide-capture molecule complex. After washing, the
extended specific primer is resuspended in a solution conducive to
the binding of the capture molecule to the specific affinity
molecule. The specific affinity molecule (attached to a solid
support) is then added once the extended specific primer is
attached to the specific affinity molecule-solid support complex
via the capture molecule, the mix is washed extensively under high
stringency conditions at the conclusion of the washing step, the
mix is assayed using a procedure appropriate for detecting the
detector molecule
2. Detection of a nucleotide or base change
This method involves the following steps:
the synthesis of a specific primer complementary to part of a known
or partly known nucleic acid sequence, the target. The specific
primer sequence is complementary to the target sequence either
immediately adjacent to but not including the single nucleotide or
base to be detected or not immediately adjacent to the single
nucleotide or base to be detected but having an intervening
sequence between the bound primer and the nucleotide or base to be
detected
the attachment of a capture (Configuration A-FIG. 3a) or detector
(Configuration B-FIG. 3b) molecule to the 5' end of the specific
primer. For Configuration C (FIG. 3c), neither a capture or
detector molecule are attached to the specific primer at the 5' end
the hybridization, in solution, of this specific primer to the
target nucleic acid sequence
the addition to the solution of only one type of
dideoxyribonucleotide (or deoxyribonucleotide), that is, the one
which can pair or hydrogen bond with the base or nucleotide to be
detected in the target sequence and either a DNA dependent DNA
polymerase (if the target is DNA) or a RNA dependent DNA polymerase
(if the target is RNA) under conditions suitable for the enzymatic
extension of the specific primer. The dideoxyribonucleotide (or
deoxyribonucleotide) has covalently attached to it a detector
molecule (Configuration A and C) or a capture molecule
(Configuration B) the polymerase enzyme extends the primer using
the target nucleic acid as a template adding only one molecule of
the dideoxyribonucleotide (or deoxyribonucleotide) if base pairing
is possible. The specific primer is not extended if base pairing
between the dideoxyribonucleotide (or deoxyribonucleotide) and the
target sequence is not possible. A detector (Configuration A and C)
or a capture (Configuration B) molecule
the reaction can be heat denatured and the cycle repeated to
amplify
the amount of extended specific primer
for Configuration A, the specific affinity molecule (attached to a
solid support) is added to the solution under conditions conducive
to the binding of the capture molecule to the specific affinity
molecule for Configuration B, the extended specific primer is
precipitated with ethanol, washed to remove unincorporated
dideoxyribonnucleotide-capture molecule complex (or
deoxyribonucleotide-capture molecule complex). After washing, the
extended specific primer is resuspended in a solution conducive to
the binding of the capture molecule to the specific affinity
molecule. The specific affinity molecule (attached to a solid
support) is then added
for Configurations A and B. once the extended specific primer is
attached to the specific affinity molecule-solid support the
complex via the capture molecule, the mix is washed extensively
under high stringency conditions
for Configuration A and B, at the conclusion of the washing step,
the mix is assayed using a procedure appropriate for detecting the
detector molecule
for Configuration C, the reaction mix is loaded onto a lane of an
agarose or polyacrylamide gel of suitable composition,
electrophoresed to resolve the extended specific primer-detector
molecule complex and finally assayed using a procedure appropriate
for detecting the detector molecule. Labelled size standards are
normally included in another lane of the gel.
3. Detection of Multiple Specific Nucleotide Sequences using
Different Capture Molecules, ie Multiple Infectious Diseases
This method involves the following steps:
the synthesis of multiple different specific primers each of which
is complementary to a different known nucleic acid sequence, the
targets
the attachment of different capture molecules to the 5' end of the
different specific primers
the hybridization, in solution, of these different specific primers
(with attached different capture molecules) to the different target
nucleic acid sequences to which the different specific primers are
complementary
the addition to the solution of the four deoxyribonucleotides and
either a DNA dependent DNA polymerase (if the targets are all DNA),
or a RNA dependent DNA polymerase (if the targets are all RNA) or
both polymerases (if the targets are a mixture of both DNA and RNA)
under conditions suitable for the enzymatic extension of the
specific primers if these specific primers are hybridized with
their complementary target nucleic acid sequence. One or more of
the deoxyribonucleotides has covalently attached to it a detector
molecule the polymerase enzyme(s) extends the different specific
primer using the different target nucleic acid sequences as a
templates and simultaneously incorporates a detector molecule into
the extended primers
the reaction can be heat denatured and the cycle repeated to
amplify
the amount of different extended specific primers
different specific affinity molecules (which have specific affinity
for the different respective capture molecules and are attached to
solid supports such as "test strips") are added to the solution
under conditions conducive to the binding of the different capture
molecule to their different specific affinity molecule
once the different extended specific primers are attached to their
specific affinity molecule-solid support complexes via the
different capture molecules, each different complex is removed
individually with the appropriate test strip which subsequently is
washed extensively under high stringency conditions
at the conclusion of the washing step, one of the test strips is
assayed for the presence of detector molecule using a procedure
appropriate for the particular detector molecule. If the assay
indicates that the detector molecule Is present on the test strip
then this is indicative that the specific nucleotide sequence
targeted by the primer having that particular detectable molecule
is present in the test sample. If the assay indicates that no
detector molecule is present on the test strip then this is
indicative that the specific nucleotide sequence targeted by the
primer having that particular detectable molecule is not present in
the test sample the procedure of the last step is repeated for each
of the test strips
4. Detection of a multiple nucleotide or base chances in different
polynucleotide sequences, ie multiple genetic defects or
diseases
This method involves the following steps:
the synthesis of a multiple different specific primers each of
which is complementary to a different known nucleic acid sequence,
the targets. The different specific primer sequences are
complementary to their respective different target sequences
immediately adjacent to the single base to be detected
the attachment of different capture molecules to the 5' end of the
different specific primers
the hybridization, in solution, of these different specific primers
to their different respective target nucleic acid sequences the
addition of the solution of all four types of dideoxyribonucleotide
(eg, ddATP, ddCTP, ddGTP, ddTTP) and either a DNA dependent DNA
polymerase (if all the targets are DNA) or a RNA dependent DNA
polymerase (if all the targets are RNA) or both (if the targets are
a mixture of both DNA and RNA) under conditions suitable for the
enzymatic extension of the different specific primers. Each
dideoxyribonucleotide has covalently attached to it a different
detector molecule.
the polymerase enzyme extends the different specific primers using
the different target nucleic acid sequences as templates adding
only one molecule of one of the dideoxyribonucleotides
the reaction can be heat denatured and the cycle repeated to
amplify the amounts of extended different specific primers
the specific affinity molecules (with specific affinity for the
different respective capture molecules and are attached to solid
supports such as "test strips") are added to the solution under
conditions conducive to the binding of the different capture
molecules to the different specific affinity molecules
once the different extended specific primers are attached to their
specific affinity molecule-solid support complexes via the
different capture molecules, each different complex is removed
individually with the appropriate test strip which subsequently is
washed extensively under high stringency conditions
at the conclusion of the washing step, one of the test strips is
assayed for the presence of detector molecule using a procedure
appropriate for the particular detector molecule. If the assay
indicates that the detector molecule is present on the test strip
then this is indicative that the specific nucleotide sequence
targeted by the primer having that particular detectable molecule
is present in the test sample. If the assay indicates that no
detector molecule is present on the test strip then this is
indicative that the specific nucleotide sequence targeted by the
primer having that particular detectable molecule is not present in
the test sample the procedure of the last step is repeated for each
of the test strips
5. Apparatus for Carrying out Methods of the Invention
Referring to FIG. 5 apparatus 100 is generally suitable for
carrying out the methods of the invention according to
non-automatic or automatic procedures. The extending and separation
procedures take place within removable reactor 10 which is disposed
within support vessel 11. Vessel 11 is temperature controlled by
thermo-controlled jacket 12. The contents of reactor 10 are mixed
by shaking vessel 11 using shaker 13. The base of reactor 10 has
specific porosity membrane 14 supported by membrane support 15.
Reactor 10 is supported in vessel 11 by support for removable
reactor 21.
Sample material, primer(s) and extending reagents are delivered to
reactor 10 from their respective vessels 16, 17 and 18. Primer
annealing and extension are permitted to occur for an appropriate
period under gentle mixing and fixed temperature conditions. This
reaction creates an extended primer having a detectable element and
separation element provided the sample has a specific
polynucleotide sequence for which the primer has a sequence
complementary to part of the specific polynucleotide sequence.
Subsequently specific affinity molecule(s) (SAM(S)) attached to an
inert support for the separation element are added to reactor 10
from SAM supply vessel 19 and allowed to react with extended primer
for an appropriate period. Unreacted reagents, buffer and
unextended primer(s) are then removed to waste container 25 via
vacuum line 25, having associated vacuum pump 24, attached to the
base of support vessel 11 whilst extended primer(s) having attached
SAM(S) are retained in reactor 10 by membrane 14. The retained
primer-SAM complexes are washed with wash reagent supplied from
vessel 22 to remove background and thereby create the first
fraction in reactor 10. The first fraction is then examined for the
presence of detectable element with detector 23. Typically, the
detectable element is a radioactive element such as .sup.32 P and
detector 23 is a scintillation counter.
If the assay indicates that the detector molecule is present then
this is indicative that the specific nucleotide sequence is present
in the test sample. If the assay indicates that no detector
molecule is present then this is indicative that the specific
nucleotide sequence is not present in the test sample.
EXAMPLE 1
In this example of the detection of a specific polynucleotide
sequence, the method depicted in FIG. 1 was used for the detection
of the single stranded genomic DNA of the bacteriophage M13.
1. Synthesis of the synthetic primer.
A 17-mer DNA complementary to M13 ssDNA was synthesized on an
Applied Biosystems DNA Synthesizer.
The 17-mer had the nucleotide sequence set out in SEQ ID NO: 1:
##STR1##
This primer Is not only complementary to M13 single-stranded DNA
but also to the bacterial double-stranded DNA plasmid, pUC12.
2. Attachment of the Drimer to cellulose.
The method of Ashley and MacDonald (1984) was used to attach the
primer to ABM-cellulose. The amino benzyloxymethyl (ABM) groups on
ABM cellulose were diazotized to form
diazobenzyloxymethyl-cellulose (DBM-cellulose) by suspending the
DBM-cellulose in 1.2N HCL containing 0.27 mg NaNO.sub.2 /ml with
stirring at 0.degree. C. for 30 minutes. The specific primer was
attached to the DBM-cellulose by adding the primer to the
DBM-cellulose suspeneded in 25 mM NaPO.sub.4, pH6.5 and incubating
overnight at 4.degree. C. Approximately 40 .mu.g of specific primer
was bound to 20 mg of cellulose.
3. Hybridization of specific primer-cellulose (SP-cellulose) with
target nucleic acid
SP-cellulose was resuspended in a solution containing the target
nucleic acid either M13 ssDNA or pUC12 and water. This was mixed,
boiled for 5 minutes and quenched on ice. The mixture was then
washed by centrifugation using a wash buffer comprising 140 mM
sodium chloride, 15 mM sodium citrate and 20 mM sodium phosphate,
pH 7.0 to remove nucleic acids that had not hybridised with the
SP-cellulose.
4. Primer extension
The specific primer was extended using DNA polymerase I (Klenow
fragment) together with labelled and non-labelled nucleotides.
The reaction conditions were as follows:
______________________________________ 20:1 Reaction Mix
______________________________________ 50 mM Tris-HCl, pH 8.3 8 mM
Magnesium chloride 4 mM dithiothreitol 4 mM sodium pyrophosphate 1
mM each dATP, dGTP and dTTP 1 Ci .sup.32 P dCTP 7 units DNA
polymerase I, Klenow fragment.
______________________________________
It was found that the addition of polyethylene glycol 6000 to a
final concentration of 4% increased the incorporation of
radioactivity up to three fold.
The reaction mix was incubated for 2 hrs at 20.degree. C.
At the end of the incubation, unincorporated nucleotides were
removed by washing the SP-cellulose four times by centrifugation.
The washing buffer was 140 mM sodium chloride, 15 mM sodium citrate
and 20 mM sodium phosphate, pH 7.0. The sample was vortexed for 1
minute at room temperature then centrifuged at 12,000 g for 5
minutes. This was repeated four times.
Finally, the SP-cellulose was added to a vial containing
scintillation solution and incorporation was determined using a
liquid scintillation counter.
EXAMPLE 2
In this example of the detection of a specific polynucleotide
sequence according to the second embodiment of the invention,
single stranded genomic DNA from the bacteriophage M13 mp18 was
detected using the following oligonucleotide primer: ##STR2##
Specific Primer
The configuration used in this example is demonstrated In FIG. 2b;
the detector molecule in this example is .sup.32 P and is attached
to the 5' end of the specific primer; the capture molecule is
biotin and is incorporated into the extended primer as
biotin-16-dUTP (an analogue of dTTP); the specific affinity
molecule is streptavidin and the solid support is agarose.
The specific primer was synthesised using an oligonucleotide
synthesiser and was 5' end labelled with .sup.32 P using
polynucleotide kinase as follows:
______________________________________ Reaction mix:
______________________________________ Specific primer (50 pmoles
5'OH ends) 1 .mu.l 100 mM dithiothreitol 5 .mu.l 10x TM Buffer 5
.mu.l (600 mM Tris, pH 7.6; 90 mM MgCl.sub.2) .gamma.-.sup.32
P-dATP (3000 Ci/mmole) 15 .mu.l T.sub.4 polynucleotide kinase (8.6
units/ml) 2 .mu.l ddH.sub.2 O 22 .mu.l
______________________________________
The reaction mix was incubated at 37.degree. C. for 20 minutes. The
labelled primer was separated from unincorporated .sup.32 P using a
DEAE cellulose column.
The primer extension reaction was carried using the following
reaction mix either with M13 mp18 or lambda bacteriophage (as a
non-homologous control):
______________________________________ M13 Lambda
______________________________________ Template DNA (500 ng) 2.5 ul
10 ul .sup.32 P labelled specific primer 10 ul 10 ul DNA polymerase
(Klenow; 1 unit/ul 1 ul 1 ul Biotin-16-dUTP (1 mM) 1 ul 1 ul dCTP
(1 mM) 1 ul 1 ul dGTP (1 mM) 1 ul 1 ul dATP (1 mM) 1 ul 1 ul NaCl
(5 M) 1 ul 1 ul MgSO.sub.4 (1 M) 0.5 ul 0.5 ul Dithiothreitol (4
mM) 1.25 ul 1.25 ul Bovine serum albumin (1 mg/ml) 2.5 ul 2.5 ul
Tris HCl, pH 7.0 (1 M) 2.5 ul 2.5 ul ddH.sub.2 O 24.75 ul 25/25 ul
______________________________________
The reaction mix was incubated at 37.degree. C. for 60 minutes. At
the completion of the incubation, the extended primer was
precipitated with ethanol to remove unincorporated biotin-16-dUTP.
To the reaction mix was added one volume (50 ul) 5M amnonium
acetate and 250 ul ethanol, followed by brief mixing and incubation
at -20.degree. C. for one hour. The precipitate was collected by
centrifugation, dried briefly, resuspended in 50 ul ddH.sub.2 O and
applied to a 200 ul streptavidin/agarose column (containing 0.12 mg
streptavidin) previously equilibrated with binding buffer (10 mM
Tris HCl, pH7.5; 200 mM NaCl; 1 mM EDTA). The column was washed
five times with 500 ul each of binding buffer. The
streptavidin/agarose was suspended in 1 ml binding buffer to which
was added 6 ml of scintillation fluid and the mixture counted in a
liquid scintillation counter.
The results for the M13 and the lambda systems were as follows:
______________________________________ Template cpm
______________________________________ M13 29,055 lambda 1,043
______________________________________
The results demonstrate that the primer was specifically extended
only In the presence of the homologous template, M13, but not
extended in the presence of the non-homologous template, lambda.
Further, biotin was incorporated Into the extended primer.
EXAMPLE 3
In this example of the use of the invention for the detection of an
altered nucleotide base, the configuration shown in FIG. 3c was
used. The M13 sequence detected and the oligonucleotide primer
sequence used were as follows: ##STR3##
Specific Primer
The specific primer was synthesised using an oligonucleotide
synthesizer.
The reaction mix was set up as follows:
______________________________________ 500 ng M13mp18 ssDNA 2.5
.mu.l 0.8 pmoles specific primer 2.0 .mu.l 10x reaction buffer 1.5
.mu.l ddH.sub.2 O 1.0 .mu.l
______________________________________
This reaction mix was incubated at 55.degree. C. for 10 minutes at
which time the following were added:
______________________________________ .sup.32 P dATP (3000
Ci/mmole, 10 mCi/ml) 0.5 .mu.l .sup.32 P ddATP (3000 Ci/mmole, 10
mCi/ml) 1.5 .mu.l DNA polymerase (Klenow) (1 unit/.mu.l) 1.0 .mu.l
______________________________________
This reaction mix was incubated for a further 15 minutes at
25.degree. C. The reaction was stopped by the addition of 4 ul
formamide dye (95% formamide, 0.1% xylene cyanol, 0.1% bromophenol
blue). The reaction mix was heated at 100.degree. C. for three
minutes prior to loading on a 20% polyacrylamide gel and
electrophoresing for 30 minutes at 30 milliamps. The gel was then
fixed in 10% acetic acid, washed with ddH.sub.2 O and exposed to
X-ray film at -80.degree. C. for 12 hours.
The resulting autoradiograph (FIG. 4) exhibited only one band of 18
nucleotides in length. Thus the primer had been extended by only
one nucleotide by the incorporation of a labelled adenine residue
and thus detecting a specific single nucleotide in a nucleic acid
sequence.
EXAMPLE 4
In this example of the detection of a specific polynucleotide
sequence, the method of FIG. 2a was used for detection of the
single stranded genomic DNA of the bacteriophage M13.
1. Synthesis of the synthetic primer
A 25-mer DNA complementary to MIS ssDNA was synthesized by Clontec
(USA). The 25-mer had the nucleotide sequence set out in SEQ ID NO:
4 ##STR4## where X is biotin covalently attached to a modified
nucleotide.
2. Hybridisation and primer extension
The primer was mixed with buffer containing either M13 DNA (target)
or herring sperm DNA (control) and extended using DNA Polymerase I
(Klenow fragment).
Reaction conditions were as follows:
50 mM Tris pH 7.5
10 mM MgCl.sub.2
4 mM DTT
100 mM NaCl
50 ug/ml bovine serum albumin
0.02 mM each dATP, dGTP, dTTP
1 Ci .sup.32 P dCTP
742.5 ng/50 ul M13 or herring sperm DNA
25.8 ng/50 ul biotin-primer
0.5 units DNA polymerase I, Klenow fragment.
The reaction mixes were incubated at 37.degree. C. for 60' and
terminated by precipitation and washing.
Precipitation was carried out by addition of 5M ammonium acetate,
calf thymus DNA as carrier and ethanol. Pellets collected by
centrifugation were washed with 70% ethanol until washings
contained less than 500 cpm.
Washed pellets were then dissolved in binding buffer consisting of
200 mM NaCl, 10 mM Tris pH 7.5, 1 mM EDTA and applied to a column
of streptavidin-agarose. Columns were washed with several volumes
of buffer and counts bound to streptavidin agarose (SA) were
measured, with the following results:
______________________________________ Target cpm bound to SA M13
11,939 Herring Sperm 83 ______________________________________
The results demonstrate that only primers extended in the presence
of target M13 DNA result in significant radioactivity being bound
to the column.
EXAMPLE 5
In this example, Configuration A of the procedure of the invention
for detection of a modified nucleotide base was supplemented by the
following steps: (i) amplification of the target DNA by PCR and
purification of the amplified DNA, (ii) rapid annealing of a primer
including a capture molecule to the target DNA by quenching in an
ethanol/dry ice bath, and (iii) addition of unlabelled
dideoxynucleotides during the primer extension reaction to ensure
chain termination.
The procedure was utilized in a blind clinical trial to screen
human DNA for a codon deletion, the .DELTA.F508 mutation, in the
cystic fibrosis transmembrane conductance regulator (CFTR) gene.
The .DELTA.F508 mutation is one known mutation which results in
cystic fibrosis if the genotype of an individual is homozygous for
the mutation. Heterozygosity for the mutation does not result in
the cystic fibrosis phenotype. The codon is entirely missing in the
mutant gene. The three nucleotides normally encode a phenylalanine
which is amino acid 508 of the normal or wild type cystic fibrosis
protein.
A blind trial of 69 human blood samples was conducted. The entire
screening procedure, including PCR amplification, was independently
performed on each sample by two different operators.
1. DNA extraction from blood
Any standard technique may be used for the extraction of DNA from
blood samples. Two suitable techniques are described in Singer et
al., Nuc. Acids Res., 16, p. 7738 (1988) and Grimberg et al., Nuc,
Acids Res., 17, p. 8390 (1989).
2. PCR amplification of target sequence(s)
Polymerase chain reaction procedures were used to amplify the
target DNA sequence, a segment of the CFTR gene corresponding to
nucleotides 1613 through 1683, the numbering of which refers to the
sequence of the normal gene. Depending on the genotype of the
patient, the amplification products were either 71-base pair
segments corresponding to the normal CFTR gene sequence or 68-base
pair segments corresponding to the mutant gene sequence, or
both.
A 50 ul reaction mix contained 10 mM Tris, pH 8.0, 1.5 mM
MgCl.sub.2, 50 mM KCl, 200 uM each of dATP, dCTP, dGTP and dTTP, 50
pmoles each of primer CF1 ##STR5## and reverse primer CF2 ##STR6##
0.5-1.0 ug genomic DNA and 0.75 units Amplitaq DNA polymerase
(Perkin Elmer Cetus). The reaction mix was overlayed with 50 ul
paraffin oil. The fragments were amplified using a Perkin Elmer
Cetus DNA thermal cycler beginning with a 5 minute denaturation at
95.degree. C., followed by 30 cycles of: 45 second denaturation at
94.degree. C., 1 minute annealing at 45.degree. C. and 1 minute
extension at 72.degree. C. The final cycle was completed with a 7
minute extension step at 72.degree. C.
3. Purification of PCR product
Unreacted nucleotides, primers, unamplified genomic DNA and enzymes
were separated from the amplified DNA segments using an Isogene Kit
(Perkin Elmer Cetus). Briefly, a 45 ul aliquot of the completed PCR
mixture was added to 90 ul sodium iodide reagent and the resulting
solution was cooled on ice for 5 minutes. DNA binder (10 ul) was
then added and the solution gently rotated at room temperature for
10 minutes. The bound DNA was collected by centrifugation at 12,000
g for 5 minutes. The supernatant was discarded and the pellet was
washed three times with 200 ul wash buffer (10 mM Tris, pH 7.5, 10
mM NaCl, 1 mM EDTA, 70% ethanol) by vortexing and centrifugation.
The DNA was eluted from the final pellet with two washes of 20 ul
distilled water.
4. Synthesis of biotinylated specific primer
A forty base oligonucleotide specific to base numbers 1613 through
1652 of the normal CTFR gene was synthesized on an Applied
Biosystems (ABI) PCR-Mate DNA Synthesizer Model 391. Aminolink 2
(ABI) was used to introduce a single amino group at the 5' terminus
of the primer in the final coupling cycle. Biotin was coupled to
this 5' amino group by dissolving 50 ug of the unpurified
amino-modified 40mer in 300 ul 0.25M Tris-HCl, pH 8.5. 300 ul 15 mM
biotinamidocaproate N-hydroxysuccinimidester in 50%
dimethylformamide was then added to the solution and incubated at
25.degree. C. for 16 hours. The solution was then concentrated to
approximately 100 ul and the biotinylated primer purified by
reverse phase HPLC.
The sequence of the biotinylated specific primer was: SEQ ID NO:
7
Biotin-5 'TTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCAT 3'.
5. Primer extension reaction
An aliquot of 3 ul of the purified PCR product of each blood sample
was added to each of two Eppendorf tubes containing biotinylated
specific primer (BSP-1) (1 pmole), 2 ul 5.times. extension buffer
(200 mM Tris-HCl, pH 7.5; 100 mM MgCl.sub.2, 250 mM NaCl), 1 ul 5%
Tween 20/polyoxyethylene sorbitanmonolaurate Nonidet P40
(ethyphenylpolyethyleneglycol) (1:1 v/v) to a total volume of 10
ul. The solutions were boiled for three minutes and immediately
quenched in an ethanol/dry ice bath. 4.5 ul of either "C
termination mix" (22 mM DTT, 33 mM sodium isocitrate, 22 mM
MnCl.sub.2, 0.72% Tween 20/Nonidet P40 (1:1 v/v), 55 uM each of
ddATP, ddGTP, and ddTTP, and 1.1 uM .sup.35 S ddCTP) or "T
termination mix" (22 mM DTT, 33 mM sodium isocitrate, 22 mM
MnCl.sub.2, 0.72% Tween 20/Nonidet P40 (1:1 v/v), 55 uM each of
ddATP, ddCTP, and dd GTP, and 1.1 uM .sup.35 S ddTTP) was then
added to each Eppendorf tube and the mixtures were thawed on ice.
The BSP-1 was extended by one dideoxynucleotide through the
addition of 2 units T7 DNA polymerase and incubation for 5 minutes
at 37.degree. C. The mixture was again placed on ice.
The products of the extension reaction are diagrammed in FIG. 6.
Briefly, if only the normal gene is present (i.e., the patient is
homozygous normal), a radiolabelled C will be added in the first
aliquot; if only the mutant gene is present (i.e., the patient is
homozygous for the mutation), a radiolabelled T will be added in
the second aliquot; and, if the sample derives from a genetically
heterozygous patient, extension will occur in both aliquots.
6. Washing of beads and analysis
A 15 ul aliquot of Dynabeads M-280 Streptavidin (10 mg/ml) (Dynal
A.S., Oslo) was washed twice, each time with 250 ul 4.times.SSPE
(4.times.SSPE; 600 mM NaCl, 40 mM NaH.sub.2 PO.sub.4, 4 mM EDTA, pH
7.4)/0.1% SDS. The extended BSP-1 solution was added to the
Dynabead pellet together with 100 ul 4.times.SSPE/0.1% SDS. This
mixture was rotated for 30 minutes at 27.degree. C. The tube was
then placed in a Magnetic Particle Concentrator (Dynal A.S.) for 30
seconds before the supernatant was removed. The Dynabeads were then
washed an additional 12 times each with 250 ul 4.times.SSPE/0.1%
SDS, rotated for 3 minutes at 27.degree. C. and the supernatant was
discarded. Finally, the beads were resuspended in 100 ul
4.times.SSPE/0.1% SDS and counted in a liquid scintillation
counter.
7. Results
The prediction of genotype for each sample (patient) was based on
the counts obtained for the product of the primer extension
reaction using the C termination mix (contained .sup.35 S ddCTP)
compared to the counts obtained for the product of the parallel
primer extension reaction using the T termination mix (contained
.sup.35 S ddTTP). The ratio C:T is the number of cpm incorporated
into the primer as .sup.35 S ddCTP divided by the number of cpm
incorporated into the primer as .sup.35 S ddTTP.
Theoretically, the following ratio values (of C:T incorporation)
and corresponding genotype predictions may be determined from the
raw cpm data generated by the screening method:
______________________________________ Genotype Prediction Ratio
Value ______________________________________ Homozygous normal
(-/-) .infin. Heterozygous (+/-) 1 Homozygous mutation (+/+) 0
______________________________________
The ratio values determined from the raw cpm data (without
subtracting background counts) generated by the trial screening for
the .DELTA.F508 mutation actually fell into the following
ranges:
______________________________________ Homozygous normal (-/-)
>2,395 Heterozygous (+/-) 0.359-1.274 Homozygous 508 deletion
(+/+) <0.1. ______________________________________
The ratio values and genotype prediction for each sample in the
trial are presented below in Table 1, wherein the cpm values
obtained by the first operator are given in the first row for each
sample and the cpm values obtained by the second operator are given
in the second row for each sample.
TABLE 1 ______________________________________ C:T GENOTYPE SAMPLE
NO. RATIO PREDICTION ______________________________________ CF 1
0.632 (Operator 1) +/- 0.832 (Operator 2) CF 2 0.012 +/+ 0.083 CF 3
0.014 +/+ 0.084 CF 4 8.710 -/- 2.661 CF 5 4.221 -/- 4.034 CF 6
0.011 +/+ 0.045 CF 8 0.016 +/+ 0.027 CF 9 0.015 +/+ 0.044 CF 11
0.013 +/+ 0.044 CF 12 0.011 +/+ 0.043 CF 13 3.249 -/- 7.413 CF 14
0.011 +/+ 0.035 CF 16 9.109 -/- 7.369 CF 18 0.730 +/- 0.572 CF 20
0.019 +/+ 0.033 CF 21 0.023 +/+ 0.041 CF 23 6.455 -/- 3.336 CF 24
0.788 +/- 0.610 CF 25 0.953 +/- 0.689 CF 28 0.723 +/- 0.620 CF 29
16.523 -/- 9.603 CF 30 12.726 -/- 4.650 CF 31 6.966 -/- 4.696 CF 32
0.680 +/- 0.509 CF 33 0.573 +/- 0.594 CF 34 12.390 -/- 5.083 CF 37
0.809 +/- 0.608 CF 38 8.914 -/- 5.433 CF 39 0.621 +/- 0.788 CF 40
1.274 +/- 0.582 CF 41 0.010 +/+ 0.040 CF 42 14.583 -/- 7.896 CF 97
0.012 +/+ 0.049 CF 98 0.015 +/+ 0.017 CF 99 0.577 +/- 0.623 CF 100
0.591 +/- 0.662 CF 101 0.720 +/- 0.659 CF 102 0.741 +/- 1.010 CF
103 0.020 +/+ 0.014 CF 104 0.777 +/- 0.853 CF 106 9.449 -/- 3.498
CF 107 5.298 -/- 4.946 CF 111 6.118 -/- 10.446 CF 112 9.435 -/-
9.597 CF 113 0.651 +/- 0.697 CF 114 0.604 +/- 0.589 CF 115 0.682
+/- 0.760 CF 116 5.925 -/- 9.813 CF 117 0.716 +/- 0.628 CF 118
9.108 -/- 10.006 CF 119 0.635 +/- 0.375 CF 141 10.694 -/- 4.679 CF
143 0.473 +/- 0.359 CF 144 12.137 -/- 2.395 CF 145 0.429 +/- 0.415
CF 146 10.244 -/- 8.381 CF 147 0.511 +/- 0.442 CF 161 0.650 +/-
0.743 CF 164 0.755 +/- 0.522 CF 172 0.018 +/+ 0.032 CF 173 0.745
+/- 0.623 CF 174 7.596 -/- 5.559 CF 180 0.558 +/- 0.868 CF 182
7.015 -/- 6.985 CF 184 0.577 +/- 0.685 CF 194 5.508 -/- 4.445 CF
195 6.222 -/- 5.968 CF 199 0.684 +/- 0.616 CF 220 8.685 -/- 6.470
______________________________________
The genotype of the individuals from whom the samples were obtained
had been previously analyzed by an alternate technique as described
in Ballabio et al., Nature, 343, p. 220 (1990). The above
predictions of genotype as determined by a method of the invention
had a 100% correspondence to the results of the alternate
technique.
EXAMPLE 6
In this example, the procedure of Example 5 for detection of an
altered nucleotide or base was modified to a more readily
automatable format by the elimination of the separate step of
purification of PCR products and by a reordering of the steps
involving reacting the target DNA molecules, the primers including
capture molecules, and the ligands for the capture molecules
together before primer extension.
The modified procedure was utilized to rescreen the 69 blood
samples of Example 5 for the .DELTA.F508 mutation. DNA extraction
from the blood samples and PCR amplification of target DNA
sequence(s) were the same as in Example 5.
1. Preparation of samples for primer extension
Eppendorf tubes containing 15 ul of Dynabeads M-280 Streptavidin
(10 mg/ml) were prepared. The beads were washed twice, each time
with 250 ul 4.times.SSPE. The tubes were then placed in a
concentrator to aggregate the beads and form a pellet.
Concurrently, for each blood sample, a 3 ul aliquot of the PCR
product (target DNA) was added to each of two 10 ul mixtures
containing 1 pmole biotinylated primer (BSP-1), 2 ul
5.times.extension buffer, 1 ul 5% Tween 20/Nonidet NP40 (1:1 v/v)
and distilled water. The mixtures were microfuged briefly, boiled
for 3 minutes and immediately quenched in an ethanol/dry ice
bath.
The PCR product mixtures were then thawed at room temperature and
each was added to a separate Eppendorf tube containing a pellet of
Dynabeads. The mixture tubes were each washed with 100 ul of
4.times.SSPE/0.1% SDS and the wash was added to the respective bead
suspension. The suspensions were rotated for 30 minutes at room
temperature. The beads were then aggregated and washed 6 times,
each time with 250 ul 4.times.SSPE/0.1% SDS. Next, 250 ul Sequenase
wash buffer was added to each tube and the tubes were rotated for 4
minutes at room temperature. The beads were aggregated and the
supernatent was removed. This wash step was also repeated a total
of six times.
2. Primer extension reaction
4.5 ul "C termination mixes" and "T termination mixes" were
prepared as follows:
______________________________________ ddC mix ddT mix
______________________________________ 0.1 M DTT 1 ul 1 ul 0.1 M
MnCl.sub.2, 0.15 M Isocitrate 1 ul 1 ul 5% Tween 20/Nonidet NP 40
0.65 ul 0.65 ul cold ddCTP (250 uM) -- 1 ul cold ddTTP (250 uM) 1
ul -- .sup.35 S ddCTP (10 uM) 0.5 -- .sup.35 S ddTTP (10 uM) -- 0.5
ul distilled water 0.35 ul 0.35 ul,
______________________________________
and 10 ul buffer mixes were prepared from 1 ul 5% Tween 20/NP 40, 2
ul 5.times.Sequenase buffer and 7 ul distilled water.
To each bead pellet prepared in section 1 was added: 10 ul buffer
mix, 4.5 ul of either the C termination mix or the T termination
mix and 2 ul Sequenase enzyme (1 U/ul). The tubes were incubated at
37.degree. C. for 10 minutes with rotation. The beads were then
washed at 25.degree. C. with: (i) 250 ul 0.15M NaOH for 5 minutes,
(ii) 250 ul 0.1M NaOH for 4 minutes, (iii) 250 ul ddH.sub.2 O for 4
minutes, and (iv) 9 times with 250 ul 4.times.SSPE/0.1% SDS for 4
minutes. The beads were aggregated and the supernatent removed
after each wash. The resulting pellets were resuspended in 100 ul
4.times.SSPE/0.1% SDS and added to scintillation vials. The tubes
were washed with 4.times.SSPE/0.1% SDS and the wash was also added
to the respective scintillation vial.
The primer extension samples were then counted and the raw cpm data
was used to calculate a C:T ratio for each blood sample. The ratios
and corresponding genotype predictions are set in Table 2
below.
TABLE 2 ______________________________________ GENOTYPE SAMPLE NO.
C:T RATIO PREDICTION ______________________________________ CF 1
1.448 +/- CF 2 0.116 +/+ CF 3 0.087 +/+ CF 4 11.930 -/- CF 5 6.407
-/- CF 6 0.095 +/+ CF 8 0.077 +/+ CF 9 0.081 +/+ CF 11 0.067 +/+ CF
12 0.039 +/+ CF 13 13.200 -/- CF 14 0.046 +/+ CF 16 12.495 -/- CF
18 1.311 +/- CF 20 0.047 +/+ CF 21 0.054 +/+ CF 23 7.461 -/- CF 24
0.999 +/- CF 25 1.146 +/- CF 28 1.164 +/- CF 29 6.254 -/- CF 30
9.903 -/- CF 31 17.026 -/- CF 32 1.197 +/- CF 33 1.062 +/- CF 34
5.553 -/- CF 37 0.815 +/- CF 38 4.134 -/- CF 39 1.100 +/- CF 40
0.713 +/- CF 41 0.073 +/+ CF 42 11.665 -/- CF 97 0.006 +/+ CF 98
0.035 +/+ CF 99 0.824 +/- CF 100 0.855 +/- CF 101 0.738 +/- CF 102
0.695 +/- CF 103 0.043 +/+ CF 104 0.557 +/- CF 106 15.057 -/- CF
107 9.005 -/- CF 111 10.789 -/- CF 112 CF 113 1.062 +/- CF 114
0.633 +/- CF 115 0.959 +/- CF 116 11.066 -/- CF 117 0.796 +/- CF
118 12.149 -/- CF 119 0.737 +/- CF 141 7.047 -/- CF 143 0.608 +/-
CF 144 5.993 -/- CF 145 1.040 +/- CF 146 4.898 -/- CF 147 0.758 +/-
CF 161 1.034 +/- CF 164 0.867 +/- CF 172 0.096 +/+ CF 173 0.961 +/-
CF 174 5.721 -/- CF 180 0.803 +/- CF 182 7.902 -/- CF 184 0.773 +/-
CF 194 5.754 -/- CF 195 5.591 -/- CF 199 0.514 +/- CF 220 15.765
-/- ______________________________________
A ratio value for blood sample CF 112 was not calculated because
the counts for both primer extension reactions were below 5000 cpm,
indicating that the readings may not have been reliable. The ratio
values that were determined from the raw cpm data generated by the
rescreening fell into the following ranges:
______________________________________ Genotype Prediction Ratio
Value ______________________________________ Homozygous normal
>4.134 Heterozygous 0.557-1.448 Homozygous 508 deletion
<0.116. ______________________________________
The above predictions of genotype for each patient were in 100%
agreement with the results of the alternate technique, referenced
in Example 5, and with the results of the procedure of Example
5.
While the invention has been described in terms of specific
examples and preferred embodiments, it is understood that
variations and improvements will occur to those skilled in the art.
Therefore, it is intended that the claims cover all such equivalent
variations and improvements which come within the scope of the
invention as claimed. For instance, while Examples 5 and 6
specifically address detection of a variant DNA sequence involving
a codon deletion, it will be apparent that the procedures of these
examples are equally applicable to detection of a single base
variation in an RNA or DNA sequence.
Industrial Applicability
The method of the invention can be readily used in the following
applications:
a) the simple, rapid, sensitive and automatable detection of
infectious diseases of humans, animals and plants;
b) the specific, rapid and large scale detection of base changes in
nucleic acid sequences, particularly in the detection of gene
defects and DNA fingerprinting;
c) kits for use with the above applications; and
d) automated equipment for use with the above applications.
__________________________________________________________________________
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 11 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ
ID NO:1: TGACCGGCAGCAAAATG17 (2) INFORMATION FOR SEQ ID NO:2: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: YES (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:2: TTTGCTGCCGGTCACGGTTCGAA23 (2) INFORMATION
FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:3: AAACGACGGCCAGTGCC17 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:4: ACGTTGTAAAACGACGGCCAGTGCC25 (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:5: TTTCCTGGATTATGCCTGGCAC22 (2) INFORMATION FOR SEQ ID NO:6: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:6: GTATCTATATTCATCATAGGAAACAC26 (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)
MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:7: TTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCAT40 (2) INFORMATION
FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 71 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:8:
TTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATG60
AATATAGATAC71 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 71 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ
ID NO:9:
AAAGGACCTAATACGGACCGTGGTAATTTCTTTTATAGTAGAAACCACAAAGGATACTAC60
TTATATCTATG71 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 68 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
TTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATTGGTGTTTCCTATGATGAAT60
ATAGATAC68 (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 68 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
DNA (genomic) (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ
ID NO:11:
AAAGGACCTAATACGGACCGTGGTAATTTCTTTTATAGTAACCACAAAGGATACTACTTA60
TATCTATG68
__________________________________________________________________________
* * * * *