U.S. patent number 5,646,248 [Application Number 08/073,807] was granted by the patent office on 1997-07-08 for e-selection binding soluble lamp-1 polypeptide.
This patent grant is currently assigned to La Jolla Cancer Research Foundation. Invention is credited to Minoru Fukuda, John B. Lowe, Ritsuko Sawada.
United States Patent |
5,646,248 |
Sawada , et al. |
July 8, 1997 |
E-selection binding soluble lamp-1 polypeptide
Abstract
The present invention provides novel purified human lysosomal
membrane sialoglycoproteins. These novel human proteins, lamp-1 and
lamp-2, are highly glycosylated and are the major carriers of
polylactosaminoglycan, when expressed on the cell surface
participate in various cellular adhesion interactions.
Inventors: |
Sawada; Ritsuko (San Diego,
CA), Lowe; John B. (Ann Arbor, MI), Fukuda; Minoru
(San Diego, CA) |
Assignee: |
La Jolla Cancer Research
Foundation (La Jolla, CA)
|
Family
ID: |
22115914 |
Appl.
No.: |
08/073,807 |
Filed: |
June 8, 1993 |
Current U.S.
Class: |
530/350;
435/69.1; 536/23.5 |
Current CPC
Class: |
C07K
14/47 (20130101); C07K 14/705 (20130101); A61K
38/00 (20130101) |
Current International
Class: |
C07K
14/435 (20060101); C07K 14/47 (20060101); C07K
14/705 (20060101); A61K 38/00 (20060101); C07K
014/435 (); C12N 015/12 () |
Field of
Search: |
;530/350,395 ;435/69.1
;536/23.5 ;514/12 |
Other References
Sueyoshi et al., J. Biol. Chem., vol. 269, pp. 32342-32350, 1994.
.
Carlsson, Sven R. and Fukuda, Minoru. "The Lysosomal Membrane
Glycoprotein Lamp-1 is Transported to Lysosomes by Two Alternative
Pathways." Archives of Biochem. and Biophysics. 296:630-639 (1992).
.
Sawada, R, Tsuko et al., "The Genes of Major Lysosomal Membrane
Glycoproteins, Lamp-1 and Lamp-2." J. Biol. Chem. 268:9014-9022
(1993). .
Fukuda, Minoru et al., "Cloning of cDNAs Encoding Human Lysosomal
Membrane Glycoproteins, H-Lamp-1 and h-lamp-2." J. Biol. Chem.
263:18920-18298 (1988). .
Carlsson, Sven R. et al., "Isolation and Characterization of Human
Lysosomal Membrane Glycoproteins, h-lamp-1 and h-lamp-2." J. Biol.
Chem. 263:18911-18919 (1988). .
Lasky, Laurence A. et al., "An Endothelial Ligand for L-Selection
Is A Novel Mucin-like Molecule." Cell. 69:927-938 (1992). .
Lowe, John B. et al., "ELAM-1-Dependent Cell Adhesion to Vascular
Endothelium Determined by a Transfected Human Fucosyltranzferase
cDNA." Cell. 63:475-484 (1990). .
Mane, Shrikant M. et al., "Purification of Characterization of
Human Lysosmal Membrand Glycoproteins." Archives of Biochemistry
and Biophysics. 268:360-378 (1989). .
Harter, Cordula and Mellman, Ira "Transport of the Lysosomal
Membrane Glycoprotein lgp120 (lgp-A) to Lysosomes Does Not Require
Appearance on the Plasma Membrane." J. Cell Biology 117:311-325
(1992). .
Saitoh, Osamu et al., "Diffential Glycosylation and Cell Surface
Expression of Lysosomal Membrane Glycoproteins in Sublines of a
Human Colon Cancer Exhibiting Distincy Metastatic Potentials." J.
Biol. Chem. 267:5700-5711 (1992). .
Lee, Ni et al., "Granulocytic Differentiation of HL-60 Cells is
Associated with Increase of Poly-N-acetyllactosamine in Asn-linked
Oligosacchrides Attached to Human Lysosomal Membrane
Glycoproteins." J. Biol. Chem. 265:20476-20487 (1990). .
Springer, Timothy A. "Adhesion Receptors of the Immune System."
Nature. 346:425-434 (1990). .
Kuijpers, Taco W. et al., "CD66 Nonspecific Cross-reacting Antigens
Are Involved in Neutrophil Adherence to Cytokine-activitated
Endothelial Cells." J. Cell. Biol. 118:457-466 (1992). .
Lawrence, Michael B. et al., "Leukocytes Roll on a Selectin at
Physiologic Flow Rates: Distinction from and Prerequisite for
Adhesion through Integrins." Cell 65:859-873 (1991). .
Polley, Margaret J. et al., "CD62 and Endothelial cell-leukocyte
Adhesion Molecule 1 (ELAM-1) Recognize the Same Carbohydrate
Ligand, Sialyl-Lewis x." Proc. Natl. Acad. Sci. USA. 88:6224-6228
(1991). .
Viitala, Juha et al., "Molecular Cloning of cDNAs Encoding Lamp A,
a human Lysosomal Membrane Glycoprotein with Apparent M.sub.r
.apprxeq.120,000." Proc. Natl. Acad. Sci. USA 85:3743-3747 (1988).
.
Yamashita, Katsuko et al., "Carbohydrate Structures of Nonspecific
Cross-reacting Antigen-2, a Clycoprotein Purified from Meconium as
an Antigen Cross-reacting with Anticarcinoembryonic Antigen
Antibody." J. Biol. Chem. 264:17873-17881 (1989). .
Mulligan, Michael S. et al., "Role of Endothelial-Leukocyte
Adhesion Molecule 1 (ELAM-1) in Neutrophil-mediated Lung Injury in
Rats." J. Clin. Invest. 88:1396-1406 (1991). .
Ley, Klaus et al., "Lectin-Like Cell Adhesion Molecule 1 Mediates
Leukocyte Rolling in Mesenteric Venules in Vivo." Blood
77:2553-2555 (1991). .
Lippincott-Schwartz, Jennifer et al., "Cycling of the Integral
Membrane Glycoprotein LEP100, between Plasma Membrane and
Lysosomes: Kinetic an Morphological Analysis." Cell 49:669-677
(1987. .
Williams, Mark A. and Fukuda, Minoru, "Accumulation of Membrane
Glycoproteins in Lysosomes Requires a Tyrosine Residue at a
Particular Position in the Cytoplasmic Tail." J. Cell Biology.
111:955-966 (1990). .
Kim, Young S. et al., "Le.sup.x and Le.sup.y Antigen Expression in
Human Pancreatic Cancer." Cancer Res. 48:475-482 (1988). .
Carlsson, Sven R. and Fukuda, Minoru. "Structure of Human Lysosomal
Membrane Glycoprotein 1." J. Biol. Chem. 264:20526-20531 (1989).
.
Fukuda, Michiko N. et al., "Structures of Glycosphingolipids
Isolated from Human Granulocytes." J. Biol. Chem. 260:1067-1082
(1985). .
Mathews, Paul M. et al., "The Pathway and Targeting Signal for
Delivery of the Integral Membrane Glycoprotein LEP100 to
Lysosomes." J. Cell Biology. 118:1027-1040 (1992). .
Mizoguchi, Akira et al., "Changes in Asparagine-linked Sugar Chains
of Human Promyelocytic Leukemic Cells (HL-60) during Monocytoid
Differentiation and Myeloid Differentiation." J. Biol. Chem.
259:11949-11957 (1984). .
Maemura, Kentaro and Fukuda, Minoru "Poly-N-acetyllactosaminyl
o-Glycans Attached to Leukosialin." J. Biol. Chem. 267:24379-24386
(1992). .
Fukushima, Kiyoyasu et al., "Characterization of Sialosylated
Lewis.sup.x as a New Tumor-associated Antigen." Cancer Res.
44:5279-5285 (1984). .
Kameyama, Akihiko et al., "Total Synthesis of Sialyl Lewis X*."
Carbohy. Res. 209:C1-C4 (1991). .
Laferte, Suzanne and Dennis, James W. "Purification of Two
Glycoproteins Expressing .beta.1-6 Branched Asn-Linked
Oligosaccharides from Metastatic Tumour Cells." Biochem J.
259:569-576 (1989). .
Moore, Kevin L. et al., "Identification of Specific Glycoprotein
Ligand for P-selection (CD62) on Myeloid Cells." J. Cell Biol.
118:445-456 (1992). .
Phillips, M. Laurie, et al., "ELAM-1 Mediates Cell Adhesion by
Recognition of a Carbohydrate Ligand. Sialyl-Le.sup.x." Science.
250:1130-1131 (1990). .
Walz, Gerd, et al., "Recognitiion by ELAM-1 of the Sialyl-Le.sup.x
Determinant of Myeloid and Tumor Cells." Science. 250:1132-1135
(1990). .
Picker, Louis J. et al., "The Neutrophil Selection LECAM-1 Presents
Carbohydrates Ligands to the Vascular Selectins ELAM-1 and
GMP-140." Cell 66:921-933 (1991). .
Larsen, Eric et al., "PADGEM-Dependent Adhesion of Platelets to
Monocytes and Neutrophils is Mediated by a Lineage-Specific
Carbohydrate, LNF III (CD15)." Cell 63:467-474 (1990). .
Magnani, John L. et al., "A Monoclonal Antibody-defined Anitgen
Associated with Gastrointestinal Cancer is a Ganglioside Containing
Siaylylated Lacto-N-fucopentaose II." J. Biol. Chem.
257:14365-14369 (1992). .
Holmes, Eric H. et al., "Biosynthesis of the Sialyl-Le.sup.x
Determinant Carried by Type 2 Chain Glycosphingolipids (IV.sup.3
NeuAcIII.sup.3 FucnLc.sub.4, VI.sup.3 NeuAcV.sup.3 FucnLc.sup.6,
and VI.sup.3 NeuAcIII.sup.3 V.sup.3 Fuc.sub.2 Lc.sub.6) in Human
Lung Carcinoma PC9 Cells." J. Biol. Chem. 261:3737-3743 (1986).
.
Berg, Ellen L. et al., "A Carbohydrate Domain Common to Both Sialyl
Le.sup.a and Sialyl Le.sup.x is Recognized by the Endothelial Cell
Leukocyte Adhesion Molecule ELAM-1." J. Biol. Chem. 266:14869-14872
(1991) ..
|
Primary Examiner: Walsh; Stephen G.
Assistant Examiner: Teng; Sally P.
Attorney, Agent or Firm: Campbell & Flores LLP
Government Interests
This invention was made in part with Government support under Grant
Nos. R01 CA48737 and P01 AI33189 from the National Institutes of
Health. The Government may have certain rights in this invention.
Claims
What is claimed:
1. A lamp-1 polypeptide having the amino acid sequence shown in SEQ
ID NO.: 17, wherein the lamp-1 polypeptide is glycosylated with
sialyl Le.sup.x, soluble in an aqueous solvent and binds to
E-selectin.
2. The lamp-1 polypeptide of claim 1 produced by a method
comprising the steps of:
a. inserting into a suitable vector a nucleic acid molecule
encoding the lamp-1 polypeptide of claim 1;
b. transfecting the resulting vector into a suitable host cell that
expresses fucosyltransferase enzyme;
c. culturing the resulting host cell under conditions suitable for
the expression of the lamp-1 polypeptide; and
d. recovering the lamp-1 polypeptide so produced.
3. A pharmaceutical composition comprising a pharmaceutically
acceptable carrier and the lamp-1 polypeptide of claim 1.
4. A lamp-1 polypeptide having the amino acid sequence shown in SEQ
ID NO.: 18, wherein the lamp-1 polypeptide is glycosylated with
sialyl Le.sup.x, soluble in an aqueous solvent and binds to
E-selectin.
5. The lamp-1 polypeptide of claim 4 produced by the method
comprising:
a. inserting into a suitable vector a nucleic acid molecule
encoding the lamp-1 polypeptide of claim 4;
b. transfecting the resulting vector into a suitable host cell that
expresses fucosyltransferase enzyme;
c. culturing the resulting host cell under conditions suitable for
the expression of the lamp-1 polypeptide; and
d. recovering the lamp-1 polypeptide so produced.
6. A pharmaceutical composition comprising a pharmaceutically
acceptable carrier and the lamp-1 polypeptide of claim 4.
Description
BACKGROUND OF THE INVENTION
Adhesive interactions of cells with other cells and with the
extracellular matrix are crucial to all developmental processes,
but have a central role in the functions of the immune system
throughout life. Leukocyte trafficking, recruitment to sites of
inflammation, tumor cell adhesion to endothelial cells and
metastasis are mediated by three adhesion receptor families, the
integrin and immunoglobulin superfamilies and the recently
described selectin family. The known selectins contain an
N-terminal lectin domain that mediates adhesion by binding
carbohydrate ligands on opposing cells. The lectin domain is
followed by an epidermal growth factor-like domain and a series of
consensus repeats similar to those found in complement regulatory
proteins. The selectins are expressed on activated endothelial
cells and platelets and are implicated in the recruitment of
neutrophils and monocytes to sites of tissue injury.
E-selectin is a selectin that is transiently expressed on
endothelial cells 2-8 hr after stimulation of IL-1 and other
inflammatory agents, and mediates a neutrophil adhesion pathway
distinct from that mediated by ICAMS and leukocyte integrins. The
neutrophil chemoattractant IL-8, which is secreted by activated
endothelial cells, acts on neutrophils as a feedback inhibitor to
attenuate the hyperadhesive interaction between neutrophils and
E-selectin receptors. P-selectin is located in .alpha.-granules of
platelets and Weibel-Palade bodies of endothelial cells, and is
rapidly mobilized to the surface of these cells after stimulation
by products of the clotting cascade such as thrombin, where it
mediates adhesion of neutrophils and monocytes. Selectins function
in a wide range of cell interactions in the vasculature and are
expressed both on leukocytes and endothelial cells. Selectins
mediate adhesion events within the blood vascular compartment
through calcium-dependent recognition of specific
carbohydrates.
The acquisition of invasive properties by tumorigenic cells
constitutes an essential step in tumor progression. Since most
malignant tumors are carcinomas, the molecular mechanisms
underlying the invasion of epithelial cells are of particular
interest.
Over 90% of human tumors are carcinomas; in these, transformed
epithelial cells grow in an uncontrolled fashion, break through the
basement membrane, and invade the underlying mesenchyme. Local
invasion can compromise the function of involved tissues. It has
been shown that the state of differentiation and the concomitant
degree of invasiveness of carcinomas can determine cancer
progression. However, the most significant turning point in the
disease is the establishment of metastasis. It is known that the
malignant phenotype is the culmination of a series of genetic
changes that involves both positive and negative regulatory
elements. Investigation of the activation, regulation, mutation, or
somatic deletion of genes that encode these regulatory elements
presents a new frontier for research into the complex cellular
interactions that precede the development of metastasis.
The morphological and functional characteristics of carcinomas were
recognized years ago; the underlying molecular basis, however, is
only presently accessible to the investigation on a molecular
level. Thus, there is a great clinical need to elucidate the
underlying molecular basis of cellular adhesion and its role in
inflammatory responses and metastasis and to develop compounds that
can modify these cellular interactions. The present invention
satisfies this need and provides related advantages as well.
SUMMARY OF THE INVENTION
The present invention provides novel purified human lysosomal
membrane sialoglycoproteins. These novel human proteins, lamp-1 and
lamp-2, are highly glycosylated and are the major carriers of
polylactosaminoglycan. Lamp-1 and lamp-2 proteins are expressed on
the cell surface participate in various cellular adhesion
interactions.
Further provided by the present invention are methods of modifying
biological functions mediated by the regulatory activity of
selectin receptors, methods of alleviating pathologic conditions
mediated by lamp-derived polypeptide and selectin receptor
interactions. Isolated nucleic acids encoding the novel lamp-1 and
lamp-2 glycoproteins and soluble lamp-derived polypeptides are
provided, as well as vectors containing the nucleic acids and
recombinant host cells transformed with such vectors. This
invention provides antisense oligonucleotides capable of binding
specifically to mRNA molecules encoding human lamp-derived
polypeptides. The present invention provides monoclonal antibodies
to the soluble lamp-derived polypeptides. Methods of detecting the
presence of activated selectin receptors on platelets and
endothelial cell surfaces are also provided.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1A through 1D shows the results of flow cytometry analysis of
cell surface lamp-1 on various SP cell lines. From the left, the
solid lines represent profiles obtained by staining SP cell
transfectants without primary anti-human lamp-1 antibody. Dotted
lines represent profiles obtained by staining control,
non-transfected SP cells with anti-human lamp-1. The filled
profiles were obtained when SP cell transfectants were stained with
anti-human lamp-1 antibody. FIG. 1A, SP cell transfectant obtained
with pSVlamp-1. FIG. 1B, SP cell transfectant obtained with
pSR.alpha.lamp-1. FIG. 1C, SP cell transfectant obtained with
pSVlamp-1.sup.H. FIG. 1D, SP cell transfectant obtained with
pSR.alpha.lamp-1.sup.H.
FIG. 2A shows adhesion of various SP colonic carcinoma cells to
endothelial cells or E-selectin expressing CHO cells. SP cells
transfected with lamp-1 expression vectors (pSVlamp-1,
pSR.alpha.lamp-1, pSVlamp-1.sup.H, or pSR.alpha.lamp-1.sup.H), or
the parental SP cells were used in adhesion assays as described in
the Examples. Adhesion to IL-1.beta.-activated HUVEC monolayers is
indicated by the open bars, whereas adhesion to non-activated
HUVECS is represented by the solid bars. Adhesion to
E-selectin-expressing CHO cell monolayers is denoted by the hatched
bars, and the cross-hatched bars depict adhesion to control CHO
cell monolayers. Data shown correspond to the fraction of applied
cells that remained after washing, and represent the mean and
standard deviation derived from four replicate assays.
FIG. 2B shows the inhibition of adhesion to endothelial cells by
sialyl Le.sup.x glycolipid. The SP cell line transfected with the
pSR.alpha.lamp-1.sup.H vector was subjected to adhesion to
activated HUVEC monolayers exactly as in panel A (open bar), or as
in panel A after pre-treatment of the activated monolayers with
liposomes containing sialyl Lewis.sup.x glycolipid (hatched bar),
or after pre-treatment with liposomes containing the control
glycolipid paragloboside (cross-hatched bars). Data correspond to
the fraction of applied cells still adherent after washing, and are
the mean and one standard deviation, from four replicate
assays.
FIG. 3 shows binding of anti-sialyl Le.sup.x antibody to various
SP-cells. Increasing concentrations of monoclonal antibody specific
to sialyl Le.sup.x were incubated with cells, and binding was
determined as described in the "Examples." Cells tested are SP
cells transfected with pSVlamp-1 (.tangle-solidup.),
pSR.alpha.lamp-1 (.DELTA.), pSV.alpha.lamp-1.sup.H (.oval-solid.),
pSR.alpha.lamp-1.sup.H (.smallcircle.), and the parental SP cells
(.quadrature.). All of the transfected cells are the same as shown
in FIG. 1.
FIGS. 4A and 4B show the purification of soluble lamp-1 generated
from control CHO cells and CHO cells expressing sialyl Le.sup.x
structures. The culture medium from the CHO cells (lanes 1,4) are
successively applied to wheat germ agglutinin columns (lanes 2,5)
and DEAE-Sephadex column (lanes 3,6). Lanes 1-3 are the samples
isolated from the control CHO cells while lanes 4-6 are the samples
isolated from the CHO cells expressing sialyl Le.sup.x structures.
FIG. 4A is the protein staining while FIG. 4B is the Western blot
by anti-lamp-1 antibodies.
FIG. 5 shows the inhibition of cell adhesion to HUVEC by soluble
lamp-1. The adhesion of SP cells transfected with
pSR.alpha.lamp-1.sup.H, the same as shown in FIG. 1, was tested for
inhibition by soluble lamp-1 derived from sialyl Le.sup.x positive
CHO cells (hatched bars). The control soluble lamp-1 was obtained
from control CHO cells that do not express sialyl Le.sup.x
(cross-hatched bars). The amount of soluble lamp-1 is expressed as
.mu.g/50 .mu.l. The open bar represents the control without the
inhibitors while the closed bar represents the adhesion to
unstimulated HUVEC monolayers. One standard deviation is indicated
at the top of each bar.
FIG. 6 shows the increase of lamp-1 molecules on the cell surface
of SP colonic carcinoma cells results in increased adhesion to
E-selectin-expressing cells. Low metastatic colonic carcinoma SP
cells express a small amount of sialyl Le.sup.x on cell surface
lamp molecules (see the right cell). When the same cells were
transfected with lamp-1 expression vectors, the number of the cell
surface lamp-1 molecules was increased. This increase was
accompanied by an increased amount of cell surface sialyl Le.sup.x
determinants and the increased efficiency of adhesion to
E-selectin-expressing cells (see the left cell).
DETAILED DESCRIPTION OF THE INVENTION
Lamp-1 and lamp-2 are the most abundant glycoproteins within the
lysosomal membrane. Although the majority of lamp-1 and lamp-2
molecules reside in lysosomes, some lamp-1 and lamp-2 are expressed
on cell surfaces (Lippincott-Schwartz et al., Cell 49:669-677
(1987); Mane et al., Arch. Biochem. Biophys. 268:360-378 (1989);
Carlsson et al., Arch. Biochem. Biophys. 296:630-639 (1992) which
are incorporated herein by reference), suggesting that those
proteins can provide ligands for selectins. It has been shown that
highly metastatic colonic carcinoma L4 cells express more lamp-1
and lamp-2 on the cell surface than low metastatic SP cells (Saitoh
et al., J. Biol. Chem. 267:5700-5711 (1992) incorporated herein by
reference).
The lysosomal membrane glycoproteins, lamp-1 and lamp-2, are the
major carriers of polylactosaminoglycans in various cells (Viitala
et al., Proc. Natl. Acad. Sci. USA 85:3743-3747 (1988); Carlsson et
al., J. Biol. Chem. 263:18911-18919 (1988) both incorporated herein
by reference), and as such are the major carriers for
poly-N-acetyllactosamines that are able to display sialyl Le.sup.x
termini. It has also been shown that lamp-1 is the major
glycoprotein containing GlcNAc.beta.1.fwdarw.6
Man.alpha.1.fwdarw.6Man branching in metastatic tumor cells as
detected by leukophytohemagglutin binding (Laferte et al., Biochem.
J. 259:569-576 (1989) incorporated herein by reference).
Polylactosaminoglycans are high molecular weight carbohydrates and
are distinguished from usual complex-type Asn-linked saccharides by
having side chains composed of endo-.beta.-galactosidase
susceptible (Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.3).sub.n
repeats. The structures of polylactosaminoglycans are often
characteristic to different cell types and stages of
differentiation. For example, the termini of human granulocyte and
monocyte polylactosaminoglycans are enriched in the sialyl Le.sup.x
moiety (NeuNAc.alpha.2.fwdarw.3Gal.beta.1.fwdarw.4
(Fuc.alpha.1.fwdarw.3) GlcNAc.fwdarw.R) while erythrocyte
polylactosaminoglycans termini are enriched in
Fuc.alpha.1.fwdarw.2Gal.beta..fwdarw.4GlcNAc.fwdarw.R moieties,
representing portions of the ABO blood group antigen. It was
discovered recently that the terminal structures of
poly-N-acetyllactosamines unique to granulocytes and monocytes
serve as ligands for selectins present on endothelial cells and
platelets. It has also been demonstrated that the isomer of sialyl
Le.sup.x, sialyl Le.sup.a
NeuNAc.alpha.-2.fwdarw.3Gal.beta.1.fwdarw.3 (Fuc.alpha.1.fwdarw.4)
GlcNAc.fwdarw.R also serves as a ligand for E-selectin. Reports
from several laboratories have shown that the level of sialyl
Le.sup.x or sialyl Le.sup.a is increased in tumor cells,
particularly in carcinoma cells. It has also been demonstrated that
some tumor cells adhere to endothelial cells by selectin-mediated
interactions. These results suggest that tumor cells may adhere to
endothelial cells at metastatic sites by the binding of E- or
P-selectin to tumor cell surface carbohydrates.
In fact, it has been shown that highly metastatic colonic carcinoma
cell lines express more lamp-1 and lamp-2 on the cell surface than
poorly metastatic ones derived from a single human colon carcinoma
(Saitoh et al., supra). It was also shown that the highly
metastatic cell lines contain more poly-N-acetyllactosamine in
carbohydrates attached to lamp molecules. These results suggest
that tumor cells can modulate cell surface display of selectin
ligands by regulating levels of cell surface lamp-1 and lamp-2
expression, and further suggest that upregulation of
surface-localized lamp-1 and lamp-2 expression can therefore
promote or facilitate the metastatic process.
The present invention demonstrates that increased expression of
lamp-1 at the surface of colonic carcinoma cells leads to stronger
adhesion to E-selectin expressing cells. Increased surface
expression of lamp-1 was achieved by over-expression of lamp-1 or
by expression of mutated lamp-1 that became a plasma membrane
glycoprotein. Since low metastatic SP cells express only a small
amount of lamp-1 on the cell surface, SP cells were chosen for
increased expression of lamp-1 at the cell surface by gene
transfer.
The results obtained in the Examples presented infra are consistent
with the fact that lamp molecules are the major carriers of
poly-N-acetyllactosamines in nucleated cells. As shown previously
(Mizoguchi et al., J. Biol. Chem. 259:11949-11957 (1984); Fukuda et
al., J. Biol. Chem. 260:1067-1082 (1985); Holmes et al., J. Biol.
Chem. 261:3737-3943 (1986) which are incorporated herein by
reference), poly-N-acetyllactosamines appeared to be preferred
substrates for .alpha.1.fwdarw.3 fucosyltransferase and
.alpha.2.fwdarw.3 sialyltransferase, thus efficiently providing
sialyl Le.sup.x termini. Since SP colonic cells apparently contain
these glycosyltransferases, the amount of cell surface sialyl
Le.sup.x is almost certainly directly related to the amount of
sialyl Le.sup.x on the cell surface lamp-1 (see FIG. 6).
The present results are clearly consistent with the notion that
sialyl Le.sup.x structures present in lamp-1 serve well as ligands
for E-selectin on the cell surface. In a corroborative experiment,
the present study also demonstrated that a soluble lamp-1 can
inhibit E-selectin mediated adhesion and such inhibition can be
obtained only when the soluble lamp-1 was prepared from cells
expressing sialyl Le.sup.x structures. The results demonstrate that
lamp-1 can be an efficient inhibitor for E-selectin-mediated
adhesion.
It was shown that sialyl Le.sup.x terminal structures can be
present in glycolipids as well (Fukushima et al., Cancer Res.
44:5279-5285 (1984) incorporated herein by reference). Such
glycolipids are particularly enriched in colonic carcinoma cells
and it is plausible to assume that SP cells also contain such
glycolipids. In the present study, the increased amount of lamp-1
significantly increased the adhesion of SP cells to endothelial
cells and such adhesion can be inhibited efficiently by soluble
lamp1- that contains sialyl Le.sup.x structures. These results
suggest that sialyl Le.sup.x structures present on glycoproteins
may be better ligands than those on glycolipids. It is possible
that glycans attached to proteins may extend more, enabling
selectin molecules to bind to the presented ligand (see Moore et
al., J. Cell Biol. 118:445-456 (1992) incorporated herein by
reference).
It was recently shown that the nonspecific cross-reacting antigen
CD66 can inhibit E-selectin mediated adhesion (Kuijpers et al., J.
Cell Biol. 118:457-466 (1992) incorporated herein by reference).
CD66 is a member of the immunoglobulin superfamily and was shown to
contain sialyl Le.sup.x termini when it was purified from meconium
(Yamashita et al., J. Biol. Chem. 264:17873-17881 (1989)
incorporated herein by reference). Although it is not clear if CD66
is the major presenter of sialyl Le.sup.x on neutrophils, the
results are consistent with the present results, showing that a
sialyl Le.sup.x -containing glycoprotein can inhibit E-selectin
mediated adhesion. On the other hand, it was reported recently that
P-selectin binds preferentially to a glycoprotein with
Mr..about.120,000 (Moore, Supra). This molecule is different from
lamp molecules or leukosialin, although both lamp (Saitoh et al.,
supra) and leukosialin (Maemura et al., J. Biol. Chem.
267:24379-24386 (1992) incorporated herein by reference) were found
to contain sialyl Le.sup.x structures. It was shown that L-selectin
on neutrophils may present sialyl Le.sup.x to E-selectin (Picker et
al., Cell 66:921-933 (1991) incorporated herein by reference). On
the other hand, L-selectin was found to preferentially bind to two
glycoproteins on endothelial cells. Most recently a report
demonstrated that one of those glycoproteins is a leukosialin-like
glycoprotein containing a multiple number of O-glycans (Lasky et
al., Cell 69:927-938 (1992) incorporated herein by reference). It
is thus likely that glycans presented on this glycoprotein, termed
Glycam, provide a better ligand(s) for L-selectin. It thus seems
reasonable to assume that selectin ligands are preferentially
presented to selectins by a limited number of glycoproteins.
Nevertheless, the present study strongly suggests that lamp-1 may
function to present sialyl Le.sup.x and also sialyl Le.sup.a on
tumor cells, and most likely also on other cell types. Furthermore,
our present study demonstrated that lamp-1 can be used as an
efficient inhibitor in E-selectin mediated adhesion.
These results also strongly suggest that tumor cells utilize
selectin-carbohydrate interaction when tumor cells adhere at
metastatic sites. In fact, tumor cells, in particular carcinoma
cells, have been shown to be enriched with sialyl Le.sup.x and
sialyl Le.sup.a structures (Magnani et al., J. Biol. Chem.
257:14365-14369 (1982); Fukushima, supra; Kim et al., Cancer Res.
48:475-482 (1988) incorporated herein by reference), which are
ligands for E- and P-selectins (Lowe et al., Cell 63:475-484
(1990); Phillips et al., Science 250:1130-1132 (1990); Walz et al.,
Science 250:1132-1135 (1990); Larsen et al., Cell 63:467-474
(1990); Berg et al., J. Biol. Chem. 266:14869-14972 (1991); Polley
et al., Proc. Natl. Acad. Sci. USA 88:6224-6228 (1991) incorporated
herein by reference). It has also been shown that some tumor cells
aggregate with platelets (Nicolson, G. L., Curr. Opinion Cell Biol.
1:1009-1019 (1989) incorporated herein by reference) that
presumably express E- and P-selectin. Such aggregated cells then
could be trapped in capillary tubes, which could then trigger the
activation of endothelial cells leading to the expression of
E-selectin. It is possible that these events result in the lodging
of tumor cells in capillary beds at junctions between endothelial
cells (Nicolson, supra). In the case of neutrophil adhesion during
inflammation, it has been shown that such E-selectins mediated
adhesion leads to stronger adhesion to endothelial cells through
integrins and counter receptor interaction (Springer, T. A., Nature
(Lond.) 346:425-434 (1990) incorporated herein by reference). Once
such interaction is established, neutrophils cross the boundary
between endothelial cells and then establish extravasation. It was
demonstrated that neutrophil extravasation can be inhibited by
inhibition of the first step, rolling effect, with anti-E-selectin
antibody (Lawrence et al., Cell 65:859-873 (1991); Ley et al.,
Blood 77:2553-2555 (1991) incorporated herein by reference).
Recently, it was shown that E-selectin mediates acute lung
inflammation induced by deposition of IgG immune-complexes
(Mulligan et al., J. Clin. Invest. 88:1396-1406 (1991) incorporated
herein by reference). Most recent studies demonstrated that such
inflammation can be inhibited by administration of sialyl Le.sup.x
-glycopeptides or oligosaccharides. The present study strongly
suggests that sialyl Le.sup.x positive, soluble lamp-1 can be an
efficient inhibitor in such inflammatory processes. The
establishment of tumor metastasis is reminiscent of this process
and it is not unreasonable to assume that tumor cells may utilize
the same mechanism during metastatic spread. The present invention,
thus, provides means for binding selectin receptors on platelets
and endothelial cells that have been activated by an immune
response, thereby inhibiting or preventing binding to the selectin
receptor of the native membrane-bound lamp polypeptide. The
pathological conditions intended to be affected comprise, but are
not limited to carcinoma cells that express sialyl Le.sup.x and/or
sialyl Le.sup.a antigenic determinants, for example colon, breast,
stomach, pancreatic and lung carcinoma cells. The pathological
conditions intended also include leukemic cells that express sialyl
Le.sup.x and/or sialyl Le.sup.a determinants as a means to escape
from blood vessels into the body fluid, for example acute and
chronic myelogenous leukemia cells. Other pathological conditions
are those involving adhesion of circulating leukocytes to the
vascular endothelium during inflammatory diseases, for example,
ischemia-reperfusion injury that often occurs as a concomitant of
myocardial infarction and stroke and inflammatory conditions of the
lung.
Accordingly, the present invention provides soluble lamp-derived
polypeptides having sialylated carbohydrate antigens that bind
selectin receptors on the cell surface. The nucleic acid sequence
encoding the soluble lamp-1 polypeptide is included within the
sequence set forth in Table I (SEQ. ID NOS: 1,2,17,18)(from about
nucleic acid number 180 to about nucleic acid number 1330). The
nucleic acid sequence encoding the, soluble lamp-2 polypeptide is
included within the sequence set forth in Table II (SEQ. ID NOS:
3-11, 16) (from about nucleic acid number 119 to about nucleic acid
number 1568). Depending upon the cell type, purified mature lamp
polypeptide has a molecular mass between 90-120 kD, whereas the
soluble form has a molecular mass between 70-100 kD.
TABLE I -
GAATTCGGGCGGGCTTCTTCGCTGCCGACGTACGACGAGTGGCCGGGCTCTTGCGTCTGGTAACGCGCTGTCT
C 03 G C 90 ##STR1## ##STR2## ##STR3## ##STR4## ##STR5## ##STR6##
##STR7## ##STR8## ##STR9## ##STR10## ##STR11## ##STR12## ##STR13##
##STR14## ##STR15## T A 600 ##STR16## ##STR17## ##STR18##
CATATCATTGAGTTTAGGGTTCTGGTGTTTGGTTTCTTCATTCTTTACTGCACTCAGATTTAAGCCTTACAAA
G 020 T G 125 T T 230 T T 335 ##STR19## A A 455
TABLE II - ##STR20## ##STR21## ##STR22## ##STR23## ##STR24##
##STR25## ##STR26## ##STR27## ##STR28## ##STR29## ##STR30##
##STR31## ##STR32## ##STR33## ##STR34## ##STR35## ##STR36##
TTGGTTTTCAGTTGAATGAAGTAGAG
As used herein, the term "purified" means that the molecule or
compound is substantially free of contaminants normally associated
with a native or natural environment. For example, the mature
membrane-associated lamp-1 and lamp-2 polypeptides can be isolated
from various methods well known to a person of skill in the art.
The methods available for the purification of membrane proteins
include precipitation, gel filtration, ion-exchange, reverse-phase
and affinity chromatography. Other well-known methods are described
in Deutscher et al., Guide to Protein Purification: Methods in
Enzymology Vol. 182, (Academic Press 1990), which is incorporated
herein by reference. Alternatively, the purified polypeptides of
the present invention can also be obtained by well-known
recombinant methods as described, for example in Sambrook et al.,
Molecular Cloning: A Laboratory Manual 2d ed. (Cold Spring Harbor
Laboratory 1989), also incorporated herein by reference. An example
of the means for preparing soluble lamp-derived polypeptide is to
express nucleic acid encoding the soluble lamp in a suitable host
cell, such as a bacterial, yeast or mammalian cell, using methods
well known in the art, and recovering the expressed soluble
protein, again using methods well known in the art. The soluble
polypeptide and biologically active fragments thereof can also be
produced by chemical synthesis. Synthetic polypeptides can be
produced using Applied Biosystems, Inc. (Foster City, Calif.) Model
430A or 431A automatic polypeptide synthesized and chemistry
provided by the manufacturer. The soluble polypeptides can also be
isolated directly from cells that have been transformed with
expression vectors, described below in more detail.
As used herein, "lamp-derived polypeptide" means a polypeptide
having the amino acid sequence substantially the same as the amino
acid sequence shown in Table I for lamp-1 or Table II for lamp-2,
or active fragments thereof. As used herein the term "soluble
lamp-derived polypeptide" refers to a soluble, biologically active
fragment of the human lamp-1 or human lamp-2 polypeptide expressed
by the extracellular domain of its respective nucleic acid.
Further, "soluble polypeptide" refers to a non-naturally occurring
cleaved polypeptide that functions as a secreted molecule and
retains the ability to bind to the ligands recognized by its
membrane counterpart, for example, cell surface selectin receptors.
As used herein, an "active fragment" or "biologically active
fragment" refers to any portion of the lamp polypeptide shown in
Table I (SEQ ID NO: 2) or Table II (SEQ ID NO: 16) that binds to E-
and/or P-selectin receptors. Methods to determine lamp binding to
selectin receptors are well known to those of skill in the art, for
example, as set forth below.
The invention also encompasses nucleic acid molecules which differ
from that of the nucleic acid molecules shown in Table I (SEQ ID
NO: 1) or Table II, (SEQ ID NOS: 3-11) but which produce the same
phenotypic effect. These altered, but phenotypically equivalent
nucleic acid molecules are referred to as "equivalent nucleic
acids". This invention also encompasses nucleic acid molecules
characterized by changes in non-coding regions that do not alter
the phenotype of the polypeptides produced therefrom when compared
to the nucleic acid molecule described hereinabove. This invention
provides a nucleic acid molecule encoding soluble lamp-derived
polypeptide wherein said nucleic acid molecule has been mutated
such that the lysosomal targeting signal encoded thereby has been
rendered non-functional. Methods to mutate nucleic acid molecules
are well known in the art. An example of such method is
site-directed mutagenesis. This invention additionally provides
nucleic acid molecules which hybridize to the nucleic acid
molecules of the subject invention. As used herein, the term
"nucleic acid" encompasses RNA as well as single and
double-stranded DNA and cDNA. As used herein, the term
"polypeptide" encompasses any naturally occurring allelic variant
thereof as well as recombinant forms.
This invention provides an isolated nucleic acid molecule encoding
a human soluble lamp-derived polypeptide. As used herein, the term
"isolated nucleic acid molecule" means a nucleic acid molecule that
is in a form that does not occur in nature. Once means of isolating
a human lamp-1 or human lamp-2 nucleic acid is to probe a human
cDNA expression library with a natural or artificially designed
antibody to human lamp-1 or human lamp-2, using methods well known
in the art (see Gougos et al., J. Biol. Chem. 265:8361 (1990) which
is incorporated herein by reference). DNA and cDNA molecules which
encode human lamp polypeptides can be used to obtain complementary
genomic DNA, cDNA or RNA from human or other mammalian sources.
This invention provides an antisense oligonucleotide having a
sequence capable of binding specifically with any sequences of an
mRNA molecule which encodes human lamp-1 or an mRNA molecule which
encodes human lamp-2 so as to prevent translation of the mRNA
molecule. The antisense oligonucleotide can have a sequence capable
of binding specifically with any sequences of the cDNA molecule,
the sequence of which is shown in Table I or Table II. As used
herein, the phrase "binding specifically" encompasses the ability
of a nucleic acid sequence to recognize a nucleic acid sequence
complementary to its own and to form double-helical segments
through hydrogen bonding between complementary base pairs. A
particular example of an antisense oligonucleotide is an antisense
oligonucleotide comprising chemical analogues of nucleotides.
This invention also provides a pharmaceutical composition
comprising an amount of the oligonucleotide described above
effective to reduce expression of a human lamp-1 or human lamp-2
polypeptide by passing through a cell membrane and binding
specifically with mRNA encoding a human lamp-1 or human lamp-2
polypeptide in the cell so as to prevent its translation and a
pharmaceutically acceptable hydrophobic carrier capable of passing
through a cell membrane. The pharmaceutically acceptable
hydrophobic carrier capable of passing through cell membranes may
also comprise a structure which binds to a receptor specific for a
selected cell type and is thereby taken up by cells of the selected
cell type. The structure may be part of a protein known to bind to
a cell-type specific receptor, for example, an insulin molecule
which would target pancreatic cells. As used herein, the term
"pharmaceutically acceptable carrier" encompasses any of the
standard pharmaceutical carriers, such as a phosphate buffered
saline solution, water and emulsions such as an oil/water or
water/oil emulsion, and various types of wetting agents.
Antisense oligonucleotide drugs inhibit translation of mRNA
encoding these polypeptides. Synthetic oligonucleotides, or other
antisense chemical structures are designed to bind to mRNA encoding
the lamp polypeptides and inhibit translation of mRNA and are
useful as drugs to inhibit expression of lamp-1 and lamp-2
polypeptide genes in patients. This invention provides a means to
therapeutically alter levels of expression of human lamp
polypeptides by the use of a synthetic antisense oligonucleotide
drug (hereinafter SAOD) which inhibits translation of mRNA encoding
these polypeptides. Synthetic oligonucleotides, or other antisense
chemical structures designed to recognize and selectively bind to
mRNA, are constructed to be complementary to portions of the
nucleotide sequences shown in Table I or Table II of DNA, RNA or
chemically modified, artificial nucleic acids. The SAOD is designed
to be stable in the blood stream for administration to patients by
injection, or in laboratory cell culture conditions. The SAOD is
designed to be capable of passing through the cell membrane in
order to enter the cytoplasm of the cell by virtue of physical and
chemical properties of the SAOD which render it capable of passing
through cell membranes, for example, by designing small,
hydrophobic SAOD chemical structures, or by virtue of specific
transport systems in the cell which recognize and transport the
SAOD into the cell. In addition, the SAOD can be designed for
administration only to certain selected cell populations by
targeting the SAOD to be recognized by specific cellular uptake
mechanisms which bind and take up the SAOD only within select cell
populations. For example, the SAOD may be designed to bind to a
receptor found only in a certain cell type, as discussed supra. The
SAOD is also designed to recognize and selectively bind to the
target mRNA sequence, which may correspond to a sequence contained
within the sequence shown in Table I or Table II. The SAOD is
designed to inactivate the target mRNA sequence by either binding
to the target mRNA and inducing degradation of the mRNA by, for
example, RNase I digestion, or inhibiting translation of the mRNA
target by interfering with the binding of translation-regulating
factors or ribosomes, or inclusion of other chemical structures,
such as ribozyme sequences or reactive chemical groups which either
degrade or chemically modify the target mRNA. SAOD drugs have been
shown to be capable of such properties when directed against mRNA
targets (see Cohen et al., TIPS, 10:435 (1989) and Weintraub, Sci.
American, January (1990), pp.40; both incorporated herein by
reference). An SAOD serves as an effective therapeutic agent if it
is designed to be administered in vivo or ex vivo. In this manner,
an SAOD serves as a therapy to reduce lamp polypeptide expression
in particular target cells of a patient, in a clinical condition
which may benefit from reduced expression of lamp polypeptides,
inflammatory responses and tumor cell adhesion reactions that lead
to metastasis.
The invention further provides an isolated nucleic acid molecule
operatively linked to a promoter of RNA transcription, as well as
other regulatory sequences. As used herein, the term "operatively
linked" means positioned in such a manner that the promoter will
direct the transcription of RNA off of the nucleic acid molecule.
Examples of such promoters are SP6, T4 and T7. Vectors which
contain both a promoter and a cloning site into which an inserted
nucleic acid is operatively linked to that promoter are well known
in the art. Preferably, these vectors are capable of transcribing
RNA in vitro or in vivo. Examples of such vectors are the pGEM
series (Promega Biotech, Madison, WI).
This invention provides a vector comprising an isolated nucleic
acid molecule such as DNA, cDNA or RNA encoding a soluble
lamp-derived polypeptide. Examples of such vectors are viruses,
such as bacteriophages, baculoviruses and retroviruses; cosmids,
plasmids and other recombination vectors. Nucleic acid molecules
are inserted into vector genomes by methods well known in the art.
For example, insert and vector DNA can both or individually be
exposed to restriction enzymes to create complementary ends on both
molecules that base pair with each other and which are then joined
together with a ligase. Alternatively, synthetic nucleic acid
linkers can be ligated to the insert DNA that correspond to a
restriction site in the vector. The vector is then digested with
the respective restriction enzyme and the respective nucleic acid
may then be inserted. Additionally, an oligonucleotide containing a
termination codon and an appropriate restriction site can be
ligated into a vector containing, for example, some or all of the
following: a selectable marker gene, such as the neomycin gene for
selection of stable or transient transfectants in mammalian cells;
enhancer/promoter sequences from the immediate early gene of human
CMV for high levels of transcription; transcription termination and
RNA processing signals from SV40 for mRNA stability; SV40 polyoma
origins of replication and ColE1 for proper episomal replication;
versatile multiple cloning sites; and T7 and SP6 promoters for in
vitro transcription of sense and anti-sense RNA. Other means are
available.
Also provided are vectors comprising a DNA molecule encoding a
human soluble lamp-derived polypeptide, adapted for expression in a
bacterial cell, a yeast cell, a mammalian cell and other animal
cells. The vectors additionally comprise the regulatory elements
necessary for expression of the DNA in the bacterial, yeast,
mammalian or animal cells so located relative to the DNA encoding
soluble lamp-derived polypeptide as to permit expression thereof.
Regulatory elements required for expression include promoter
sequences to bind RNA polymerase and transcription initiation
sequences for ribosome binding. For example, a bacterial expression
vector includes a promoter such as the lac promoter and for
transcription initiation the Shine-Dalgarno sequence and the start
codon AUG (Maniatis et al., supra 1989). Similarly a eucaryotic
expression vector includes a heterologous or homologous promoter
for RNA polymerase II, a downstream polyadenylation signal, the
start codon AUG, and a termination codon for detachment of the
ribosome. Such vectors can be obtained commercially or assembled by
methods well known in the art, for example, the methods described
above for constructing vectors in general. Expression vectors are
useful to produce cells that express the polypeptide.
This invention provides a mammalian cell containing a cDNA molecule
encoding a human soluble lamp-derived polypeptide. An example is a
mammalian cell comprising a plasmid adapted for expression in a
mammalian cell. The plasmid has a cDNA molecule encoding a soluble
lamp-derived polypeptide and the regulatory elements necessary for
expression of the polypeptide. Various mammalian cells may be
utilized as hosts, including, for example, mouse fibroblast cell
NIH3T3, CHO cells, HeLa cells, Ltk- cells, etc. Expression plasmids
such as those described supra can be used to transfect mammalian
cells by methods well known in the art such as calcium phosphate
precipitation, DEAE-dextran, electroporation, microinjection or
lipofection.
This invention provides a pharmaceutical composition containing a
pharmaceutical carrier and any of a purified, soluble polypeptide,
an active fragment thereof, or a purified, mature protein and
active fragments thereof, alone or in combination with each other.
These polypeptides or proteins can be recombinantly derived,
chemically synthesized or purified from native sources. As used
herein, the term"pharmaceutically acceptable carrier" encompasses
any of the standard pharmaceutical carriers, such as phosphate
buffered saline solution, water and emulsions such as an oil/water
or water/oil emulsion, and various types of wetting agents.
Also provided are antibodies having specific reactivity with the
lamp-derived polypeptides of the subject invention. Active
fragments of antibodies are encompassed within the definition of
"antibody". The antibodies of the invention can be produced by any
method known in the art. For example, polyclonal and monoclonal
antibodies can be produced by methods well known in the art, as
described, for example, in Harlow and Lane, Antibodies: A
Laboratory Manual (Cold Spring Harbor Laboratory 1988), which is
incorporated herein by reference. The polypeptide, particularly
soluble lamp-derived polypeptide of the present invention, can be
used as the immunogen in generating such antibodies. Altered
antibodies such as chimeric, humanized, CDR-grafted or bifunctional
antibodies can also be produced by methods well known in the art.
Such antibodies can also be produced by hybridoma, chemical
synthesis or recombinant methods described, for example, in
Sambrook et al., supra, incorporated herein by reference. The
antibodies can be used for determining the presence or purification
of the soluble lamp-derived polypeptides of the present invention.
With respect to the detection of such polypeptides, the antibodies
can be used for in vitro diagnostic or in vivo imaging methods.
Immunological procedures useful for in vitro detection of the
target soluble lamp-derived polypeptide in a sample include
immunoassays that employ a detectable antibody. Such immunoassays
include, for example, ELISA, Pandex microfluorimetric assay,
agglutination assays, flow cytometry, serum diagnostic assays and
immunohistochemical staining procedures which are well known in the
art. An antibody can be made detectable by various means well known
in the art. For example, a detectable marker can be directly or
indirectly attached to the antibody. Useful markers include, for
example, radionuclides, enzymes, fluorogens, chromogens and
chemiluminescent labels.
This invention provides a method of modifying a biological function
mediated by the regulatory activity of a selectin receptor which
comprises contacting a suitable sample containing a selectin
receptor with an effective amount of a biologically active
lamp-derived polypeptide or a pharmaceutical composition described
above. As used herein "an effective amount" refers to an amount of
the polypeptide sufficient to bind to a selectin receptor and
thereby prevent or inhibit its regulatory activity. This method is
especially useful for modifying the regulatory activity of
E-selectin or P-selectin. Examples of regulatory activities
include, but are not limited to mediation of cellular adhesion to
endothelial cells and platelets.
An effective amount is any amount that is effective to modify the
biological function mediated by the regulatory activity of E-
and/or P-selectin receptors. The method can be practiced in vitro,
ex vivo or in vivo. If the method is practiced in vitro, contacting
is effected by incubating the sample with a polypeptide, a protein
or a pharmaceutical composition described above. The ex vivo method
is similar but includes the additional step of reintroducing the
treated sample into the subject.
However, in a preferred embodiment the contacting is effected in
vitro by administering a polypeptide, a protein or a pharmaceutical
composition, as described above to a subject, e.g., a mammal or a
human.
Methods of administration are well known to those of skill in the
art and include, but are not limited to, administration orally,
intravenously or parenterally. Administration will be in such a
dosage that the regulatory activity is effectively modified.
Administration can be effected continuously or intermittently such
that this amount is effective for its intended purpose.
This invention also provides a method of alleviating a pathologic
condition caused by a selectin-mediated activity comprising
contacting the selectin receptor with any of a purified soluble
lamp-derived polypeptide, an active fragment thereof, a
lamp-derived polypeptide or an active fragment thereof. The
selectin receptor is bound with said polypeptide to treat the
pathologic condition mediated by selectin receptor activity. As
used herein "pathologic conditions" refers to any pathology arising
from selectin receptor induced regulatory activity. For example,
tumor cell adhesion to endothelium and leukocyte adhesion to
inflammatory sites are selectin receptor mediated events.
In a preferred embodiment, the method is practiced by administering
to a subject, an effective amount of a purified lamp-derived
protein or a purified soluble lamp-derived polypeptide or a
biologically active fragment thereof, or the pharmaceutical
composition described above. Methods of administration are outlined
supra.
This invention also provides a method of detecting the presence of
selectin receptors on endothelial cells comprising contacting a
sample of endothelial cells with a lamp-derived polypeptide,
detecting binding of the lamp polypeptide to the selectin receptor,
wherein said binding indicates that the endothelial cell is in an
activated state (see Example IX infra).
It is understood that modifications which do not substantially
affect the activity of the various molecules of this invention are
also included within the definition of said molecules.
The following examples are intended to illustrate but not limit the
present invention.
EXAMPLE I
Plasmid Preparation and Vector Construction
A cDNA encoding the lamp-1 molecule, designated L1-15/202 (Williams
et al., J. Cell Biol. 111:955-966 (1990) incorporated herein by
reference), was inserted into Bluescript (Stratagene, La Jolla,
Calif.), resulting in pBL1-15/202. This cDNA contains the
full-length coding sequence of human lamp-1 and a truncated
3'-flanking sequence. After XhoI and BamHI digestion, the cDNA
insert was cloned into a pSV vector, resulting in pSVlamp-1. The
pSV vector is a derivative of pJC119 (Guan et al., Cell 37:779-787
(1984) incorporated herein by reference). The mutant cDNA in which
the cytoplasmic tyrosine is replaced with histidine was made as
described (Williams et al., supra), and constructed in the same
vector, resulting in pSVlamp-1.sup.H.
The wild-type and mutant lamp-1 cDNAs were cloned in parallel into
pcDL-SR.alpha.-478. The pcDL-SR.alpha. vector contains the SV40
promoter and the HTLV-1 LTR (Takebe et al., Mol. Cell. Biol.
8:466:472 (1988) incorporated herein by reference).
pcDL-SR.alpha.-478 was derived from pcDL-SR.alpha.-296 to generate
an EcoRI cloning site. cDNAs encoding wild-type lamp-1 and its
mutant were excised from the pSV vectors described above by XhoI
and BamHI and blunt-ended with the Klenow fragment of DNA
polymerase I. pcDL-SR.alpha.-478 vector was digested by EcoRI, and
EcoRI sites were also blunt-ended with the Klenow fragment of DNA
polymerase I. Each blunt-ended cDNA was then ligated between the
blunt EcoRI sites of pcDL-SR.alpha.-478. Clones containing a single
lamp-1 cDNA, or mutant lamp-1 cDNA, in the proper orientation, were
designated pSR.alpha.lamp-1 and pSR.alpha.lamp-1.sup.H,
respectively.
Plasmid pcDNA1-Fuc-TIII was constructed by first isolating from
PCDM7-.alpha.(1,3/1,4)FT (Kukowska-Latallo et al. Genes Develop.
4:1288-1303 (1990); Weston et al. J. Biol. Chem. 267:24575-24584
(1992) incorporated herein by reference) a 2.2 kb XhoI fragment
corresponding to the Fuc-TIII cDNA. This fragment was then cloned
into the sense orientation into the unique XhoI site in plasmid
pcDNAI (Invitrogen, San Diego, Calif.).
EXAMPLE II
Amplification of E-selectin Sequences
Human E-selection cDNA sequence was amplified by polymerase chain
reaction (PCR) (Higuchi et al., Nucl. Acids Res. 16:7351-7367
(1988) incorporated herein by reference) using a human endothelial
cDNA library (Staunton et al., Cell 52:925-933 (1988) incorporated
herein by reference) as a template. The cDNA library was
constructed from mRNA of activated human endothelial cells
(Staunton et al., supra). The 5'-,primer sequence was
5'-TCAAGTACTCTTGAAGTCATGATTGCTTCA-3' (SEQ ID NO: 12) and
corresponds to -9 to +12 nucleotides with respect to the
translation initiation codon with a ScaI restriction site at the
5'-end. The 3'-primer sequence was
5'-TGAAGTACTAACTTAAAGGATGTAAGAAGGCTT-3' (SEQ ID NO 13). This
sequence corresponds in anti-sense to -18 to +6 bp with respect to
the stop codon with the ScaI restriction site at the 5' end.
Amplification of cDNA was achieved after 40 cycles under the
following conditions: denaturation for 1 minute at 94.degree. C.,
annealing for 2 minutes at 55.degree. C., and polymerization for 3
minutes at 72.degree. C. The amplified DNA was cut with ScaI and
cloned into the EcoRV site of Bluescript/ks. The cDNA insert was
then excised by digestion with ScaI and KpnI. pcDL-SR.alpha.-478
was first digested with EcoRI and the EcoRI site was blunt-ended by
the Klenow fragment of DNA polymerase I. The blunt-ended plasmid
was then digested with KpnI, which is situated 3' to the EcoRI
site. The SmaI-KpnI fragment representing the E-selectin cDNA was
cloned between the blunt EcoRI-KpnI ends of pcDL-SR.alpha.-478 to
yield pSR.alpha.-E-selectin.
EXAMPLE III
Amplification of Lamp Sequences
A cDNA encoding soluble lamp-1 was amplified by PCR using the pSV
lamp-1 as a template. The 5'-primer sequence was
5'-TTTGAATTCCTCGCGCCATGGCGCC-3' (SEQ ID NO: 14). This corresponds
to -8 to +8 bp relative to the initiation codon plus an EcoRI
restriction site and TTT at 5'-end. The 3'-primer sequence is
5'-AAAGGTACCTAGCTGTTCTCGTCCAGCAG-3' (SEQ ID NO: 15. This sequence
contains the lamp-1 sequence in anti-sense from codons 348 to 353,
after which a stop codon is introduced. The sequence also contains
AAA plus a KpnI site. After amplification under the same conditions
described above, the DNA was cut with EcoRI and KpnI and then
cloned into the EcoRI/KpnI sites of pcDL-SR.alpha.-478, to yield
pSR.alpha.s-lamp-1.
EXAMPLE IV
Establishment of SP Colonic Cells Expressing Various Amounts of
Lamp-1 on the Cell Surface
The isolation and characterization of the poorly metastatic human
colon carcinoma line KM12-SP (hereinafter SP) has been previously
described (Saitoh et al., supra; Morikawa et al., Cancer Res.
48:1943-1948 (1988) incorporated herein by reference). This cell
line expresses less lamp-1 on the cell surface than its highly
metastatic counterpart, L4 (Saitoh et al., supra). SP colonic cells
are poorly metastatic in nude mouse experiments and express only 3%
of the total lamp-1 on the cell surface (Saitoh et al., supra).
In order to establish SP cells that express an increased amount of
cell surface lamp-1, SP colonic cells were transfected with vectors
that express wild-type, membrane-tethered lamp-1 (pSVlamp-1 and
pSR.alpha.lamp-1). The cells were co-transfected with pSV.sub.2
neo. The ratio of plasmids harboring lamp-1 cDNAs and pSV.sub.2 neo
was 10:1. After transfection, the cells were selected with G418 (1
mg/ml), in DME containing 10% fetal calf serum, sodium pyruvate,
MEM vitamin solution, non-essential amino acids, and antibiotics.
After culturing for 10 days in the presence of G418, clonal cell
lines were obtained by limiting dilution and different clones were
examined by immunofluorescence for cell surface expression of
lamp-1.
Similarly, in a second set of experiments, increased lamp-1 cell
surface expression was sought by expressing a mutant lamp-1 in
which a cytoplasmic tyrosine residue critical for lysosomal
targeting (Williams et al., supra) had been changed to a histidine
residue (vectors pSVlamp-1.sup.H and pSR.alpha.lamp-1.sup.H). The
resulting mutant lamp-1 molecule, in contrast to its wild-type
counterpart, does not sort to the lysosome, and therefore
accumulates preferentially at the cell surface via its default
biosynthetic pathway.
Several SP cell lines were derived from transfections with each of
the four lamp-1 vectors. FIG. 1 illustrates a flow cytometry
analysis of cell surface lamp-1 expression in representative clones
containing these different vectors. These cell lines each express
roughly at least two-fold more cell surface lamp-1 (mean
fluorescent intensities .about.20, .about.35, .about.40, .about.60)
than does the parental SP cell line (mean fluorescent
intensity=.about.13). Cells transfected with pSR.alpha.lamp-1
express more cell surface lamp-1 (FIG. 1B, mean fluorescence
intensity=.about.35) than do cells transfected with pSVlamp-1 (FIG.
1A, mean fluorescent intensity=.about.20), and cells expressing the
mutant lamp-1 express more surface-localized lamp-1 than do cells
expressing the wild-type lamp-1 (FIG. 1, compare panels C and D,
mean fluorescence intensities=.about.40 and .about.60,
respectively, versus panel A and B, respective mean fluorescence
intensities of .about.20 and .about.35).
EXAMPLE V
Establishment of CHO Cell Lines Expressing E-Selectin
CHO cells were co-transfected with pSR.alpha.E-selectin and
pSV.sub.2 dhfr in a 10:1 molar ratio, using the lipofectin
procedure. After the transfection, cells were cultured in
.alpha.-MEM without nucleotides for 14 days. The cells were then
propagated with increasing concentration of methotrexate (Sigma,
St. Louis, Mo.) final concentration of 0.5 .mu.M and cloned cell
lines were obtained in 24-well tissue culture plates. Each clone
was tested for HL-60 cell binding as a screen for cell surface
E-selectin expression. Clones that efficiently bound HL-60 cells
were subsequently tested by immunofluorescence using an
anti-E-selectin antibody to confirm E-selectin expression.
EXAMPLE VI
Expression of Soluble Lamp-1 in CHO Cells
In order to produce a soluble lamp-1 molecule that displays sialyl
Le.sup.x determinants, CHO cells were first co-transfected by the
lipofectin procedure (Bierhuizen et al., Proc. Natl. Acad. Sci. USA
84:9326-9330 (1992) incorporated herein by reference) with
pcDNA1-Fuc-TIII and pHyg (Sugden et al., Molec. Cell. Biol.
5:410-413 (1985) incorporated herein by reference) in a 10:1 molar
ratio. The transfected cells were selected in the presence of 500
.mu.g/ml of hygromycin (Sigma, St. Louis, Mo.) and the cloned in a
24-well tissue culture plate. Each cell line was assessed for the
expression of sialyl Le.sup.x by immunofluorescence.
Immunofluorescence staining was carried out using a mouse
monoclonal anti-sialyl Le.sup.x antibody, CSLEX (Fukushima et al.,
supra) (purchased from UCLA tissue culture laboratory), followed by
staining with rhodamine-conjugated goat anti-mouse IgM, using
procedures described previously (Williams et al., supra).
A clonal cell line stably expressing sialyl Le.sup.x molecules was
then co-transfected with pSR.alpha. s-lamp-1 and pSV.sub.2 dhfr,
and the transfected cells were selected in .alpha.-MEM without
nucleotides. After culturing under these conditions for 14 days,
the cells were propagated for gene amplification by methotrexate as
described above. Expression of soluble lamp-1 was determined by
immunoblotting of the conditioned medium. The conditioned medium
from each well was concentrated (Centricon 30, Amicon Inc.,
Beverly, Mass.), and the concentrated medium was applied to a
nitrocellulose membrane. After blocking with 5% milk in PBS, the
membrane was incubated at room temperature for 1 hour with rabbit
anti-lamp-1 antibody diluted in 20 mM Tris-HCl, pH 7.5 containing
1% BSA and 0.5M NaCl (buffer A). The membrane was then washed for 5
minutes at room temperature with 20 mM Tris-HCl, pH 7.5 containing
0.5M NaCl and 0.05% Tween-20 twice and with the same buffer without
Tween-20, and then incubated with alkaline phosphatase-conjugated
goat anti-rabbit antibody in buffer A. The blot was then washed
with the same buffer, and incubated with alkaline phosphatase
substrate (5-bromo-4-chloro-3-indolylphosphate and nitroblue
tetrazolium in 10 mM Tris-HCl, 2 mM MgCl.sub.2, pH 9.0) using
procedures previously described (Blake et al., Anal. Biochem.
136:175-179 (1984) incorporated herein by reference). One cell line
that produced an abundant amount of soluble lamp-1, as determined
with this procedure, was chosen for further study.
EXAMPLE VII
Purification of Soluble Lamp-1 from the Conditioned Medium of CHO
Cells
The CHO cell line expressing soluble lamp-1 was cultured in
.alpha.-MEM containing 0.5 .mu.M methotrexate, and the medium was
replaced with Opti-MEM (BRL, Bethesda, Md.) after the cells reached
confluency. After culturing for 3 days, the conditioned medium (260
ml) was collected and applied to a column (1.2.times.2.5 cm) of
wheat germ agglutinin-Agarose (E-Y Laboratories, San Mateo,
Calif.). The column was equilibrated with 10 mM potassium phosphate
buffer, pH 7.4 containing 0.14M NaCl and eluted with 100 mM GlcNAc
in the same buffer. The eluate was dialyzed against 50 mM potassium
phosphate buffer, pH 7.0, containing 1 mM EDTA and the sample was
applied to a column (2 ml) of DEAE-Sephadex (Sigma, St. Louis, Mo.)
equilibrated with the same buffer. The column was eluted with the
same buffer containing 0.1M NaCl without EDTA. The eluted sample
was then dialyzed against PBS, and tested in adhesion assays.
EXAMPLE VIII
Flow Cytometry Analysis
SP cells expressing various amounts of cell surface lamp-1 were
stained with the mouse IgG anti-human-lamp-1 antibody, BB6
(Carlsson et al., J. Biol. Chem. 264(34):20526-20531 (1989)
incorporated herein by reference); ascites diluted 1:500. Cells
were then stained with fluorescein-conjugated goat anti-mouse IgG
(40 .mu.g/ml)(Sigma, St. Louis Mo.) and subjected to analysis by
flow cytometry on a FACScan (Becton Dickinson, Mountain View,
Calif.). Cell staining was measured in arbitrary units as the log
of fluorescent intensity and displayed on a four decade scale.
EXAMPLE IX
Colonic Carcinoma Cells Adhere to IL-1.beta. Treated Endothelia
Through E-selectin Binding to Sialyl Le.sup.x Structures
The four lamp-1 transfected SP cell lines (SP-pSVlamp-1,
SP-pSR.alpha.lamp-1, SP-pSVlamp-1.sup.H, or
SP-pSR.alpha.lamp-1.sup.H), and the control SP cell line were then
subjected to adhesion assays to determine their relative abilities
to exhibit E-selectin-dependent adhesive properties.
Adhesion of SP cells to human umbilical vein endothelial cells,
hereinafter HUVEC, (Clonetics, San Diego, Calif.) was carried out
as described previously (Phillips et al., supra) with a slight
modification. Briefly, SP cells were metabolically labeled with
[.sup.35 S]-methionine (100 .mu.Ci/ml, ICN) in methionine-free DME
for 2 hours as described previously (Lee et al., J. Biol. Chem.
265:20476-20487 (1990) incorporated herein by reference). The
[.sup.35 S]-methionine labeled SP cells were harvested in the cell
dissociation solution (Specialty Media, Lavellette, N.J.) and
washed twice with DME before assay of the binding to HUVEC. HUVEC
monolayers cultured in 96-well tissue culture plates, were
activated with 5 unit/ml of IL-1.beta. (Boehringer-Mannheim,
Indianapolis, Ind.) for 4 hours and then washed with DME containing
5% fetal calf serum. Control non-activated HUVEC monolayers were
prepared identically (without II-1.beta.), and used in parallel for
adhesion assays.
Approximately 1.times.10.sup.5 of .sup.35 S-labeled SP cells were
added to the HUVEC monolayers in 0.1 ml of DME containing 5% fetal
calf serum. After incubation at 37.degree. C. for 15 minutes, the
cells were washed with the same solution three times. Adherent
cells remaining after washing were dissolved in 0.1 ml of cell
dissolution solution. The solution containing the solubilized cells
was added to 2 ml of Aquamix scintillation cocktail, and
radioactivity was determined by scintillation counting. The amount
of radioactivity in the cells added to each well was determined
independently, and was used to determine the fraction of applied
cells that actually adhered to the monolayers in each microliter
well. In order to test the inhibitory activity of soluble lamp-1,
purified soluble lamp-1 was dialyzed against PBS and aliquots,
serially diluted in DME containing 5% fetal calf serum, were added
to microtiter wells containing activated HUVEC monolayers. After
incubation for 15 minutes at 4.degree. C., the monolayers were used
in adhesion assays as described above.
A substantial fraction of cells expressing recombinant cell surface
lamp-1 bound to HUVEC monolayers, which were induced to express
E-selectin by pre-treatment with IL1-.beta., whereas the same cells
did not bind detectably to non-activated HUVECS (FIG. 2A). The
parental SP cells bound only modestly to activated HUVEC
monolayers. Essentially all of the adhesion observed with the
lamp-1 transfected cell lines is E-selectin-dependent, since
binding of the cell line expressing the largest amount of cell
surface lamp-1 (transfected with pSR.alpha.lamp-1.sup.H, see FIG.
1) may be virtually completely blocked by pre-treatment of the
monolayers with liposomes containing sialyl Lewis.sup.x glycolipid
(FIG. 2B). Under the same conditions, control liposomes did not
have an effect.
Binding of SP cells to CHO cells expressing E-selectin was carried
out in the same way except that the activation by IL-1.beta. was
omitted. Inhibition by sialyl Le.sup.x glycolipid (Kameyama et al.
Carbohydr. Res. 209:C1-C4 (1991) incorporated herein by reference),
NeuNAc.alpha.2.fwdarw.3Gal.beta.1.fwdarw.4(Fuc.alpha.1.fwdarw.3)GlcNAc.bet
a.1.fwdarw.3Gal.beta.1.fwdarw.4Glc-Cer was tested exactly as
described (Phillips et al., supra). Paragloboside,
NeuNAc.alpha.2.fwdarw.3Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.3Gal.beta.1
.fwdarw.4Glc-Cer was used as a control glycolipid.
Similar results were obtained in experiments using CHO cells
expressing E-selectin. Again, cells expressing increased levels of
cell surface lamp-1 bound to E-selectin-expressing CHO monolayers,
but not to control CHO monolayers that do not express E-selectin
(FIG. 2A). The control, parent SP cells bound moderately to the CHO
cell monolayer expressing E-selectin. When considered with the data
shown in FIG. 1, these observations indicate that the ability to
exhibit E-selectin-dependent adhesion in this static adhesion assay
may be conferred upon the SP cells by affecting only a modest
increase in cell surface lamp-1 expression. The two-fold increase
in cell surface lamp-1 expression shown by pSVlamp-1-transfected
cells, relative to the control SP cells (FIG. 1, compare SP vs
pSVlamp-1) appears sufficient to enable the SP cells to efficiently
adhere to E-selectin. Moreover, increased adhesion is seen when
higher levels of cell surface lamp-1 are present. (for example,
compare binding and lamp-1 expression of pSVlamp-1 transfectants;
48% bound, mean fluorescent intensity of .about.20, versus binding
and lamp-1 expression of pSR.alpha.lamp-1.sup.H transfectants;
.about.75% bound, mean fluorescent intensity of .about.60). These
results establish that the lamp-1 on the cell surface carry ligands
for E-selectin, and the degree of binding is roughly proportional
to the amount of lamp-1 expressed on the cell surface.
EXAMPLE X
Comparison of Cell Surface Sialyl Le.sup.x Expression Among SP
Cells Expressing Different Amounts of Cell Surface Lamp-1
Cell surface lamp-1 molecules are heavily substituted with N- and
O-linked oligosaccharide molecules that can terminate in the sialyl
Lewis.sup.x moiety (Lee et al., supra), an essential component of
the oligosaccharide ligand for E-selectin. It therefore seemed
possible that increased lamp-1 expression in turn would yield a
concomitant increase in cell surface sialyl Lewis.sup.x moieties
(displayed by surface localized lamp-1 molecules), and that this
would confer E-selectin-dependent adhesion competence upon the
lamp-1 transfectants.
A radioactive antibody binding assay was used to quantitate cell
surface sialyl Lewis.sup.x termini on the cell lines that express
recombinant lamp-1, and on the parental SP cells. The number of
binding sites for the monoclonal anti-sialyl Le.sup.x antibody was
measured as detailed previously (Saitoh et al., supra). At
near-saturating levels of anti-sialyl Lewis.sup.x antibody, each of
the cell lines that expresses supra-control level of lamp-1 also
displayed a substantially higher level of cell surface sialyl
Lewis.sup.x immunoreactivity than the level displayed by the
control SP cells (FIG. 3). These data are most consistent with the
hypothesis that the level of cell surface lamp-1 expression can
directly determine cell surface sialyl Lewis.sup.x expression
levels, and thus also E-selectin-dependent cell adhesion.
EXAMPLE XI
Soluble Lamp-1 Can Inhibit E-Selectin Mediated Binding
The data obtained from the experiments detailed above support an
essential role for lamp-1 in mediating E-selectin-dependent cell
adhesion of tumor cells, by functioning to present sialyl
Lewis.sup.x to E-selectin in a manner analogous to that proposed
for L-selectin on leukocytes (Picker et al., Cell 66:921-933 (1991)
incorporated herein by reference). It also suggests that soluble
lamp-1 molecules that display sialyl Lewis.sup.x -terminated
oligosaccharides may effectively disrupt E-selectin-dependent cell
adhesion by displacing cell-associated sialyl Lewis.sup.x binding
site(s) on E-selectin.
A soluble lamp-1 molecule that displays the sialyl Lewis.sup.x
moiety was prepared and its ability to block E-selectin-dependent
adhesion of lamp-1-expressing SP cells was tested. This reagent was
prepared from CHO cells stably transfected with a vector that
directs the expression of a soluble form of lamp-1, and with a
vector that encodes a human .alpha.(1,3)fucosyltransferase
(Fuc-TIII) (Kukowska-Latallo et al., supra) capable of creating the
sialyl Lewis.sup.x determinant using endogenous CHO cell
oligosaccharide precursors (Lowe et al., supra). The transfected
cells were confirmed to express sialyl Le.sup.x determinants by
immunofluorescence as described (Williams et al., supra). This
recombinant molecule was purified from media collected from these
cells using wheat germ agglutinin and DEAE-Sephadex column
chromatography procedures. The product of this purification
consisted largely of a single polypeptide (FIG. 4A) which by
Western blotting reacted with anti-lamp-1 antibodies (FIG. 4B).
A soluble lamp-1 molecule lacking the sialyl Lewis.sup.x
determinant was purified in an identical manner, using a control
CHO cell line stably transfected only with the vector that
synthesizes soluble lamp-1 molecules. This purified control protein
also reacts with anti-lamp-1 (FIG. 4B).
Using the adhesion assay previously shown to be
E-selectin-dependent (FIG. 2B), it was determined that the
concentration-dependent inhibition of adhesion of
pSR.alpha.lamp-1-transfected SP cells to activated HUVEC monolayers
(FIG. 5). By contrast, the control, sialyl Lewis.sup.x -negative
lamp-1 molecule inhibited the binding minimally, even at a
concentration that for the sialyl Lewis.sup.x -positive protein
diminished binding to 20% of control levels. These results indicate
that the sialyl Lewis.sup.x determinant achieves a conformation on
the soluble lamp-1 glycoprotein that is recognized by E-selectin
with an affinity sufficient to compete with the cell surface sialyl
Lewis.sup.x determinants that mediate adhesion to this selectin.
These results further suggest that this reagent, and analogous
ones, may prove useful as therapeutic agents which block
selectin-dependent inflammation or tumor metastasis.
Although the invention has been described with reference to the
disclosed embodiments, it should be understood that various
modifications can be made without departing from the spirit of the
invention. Accordingly, the invention is limited only by the
following claims.
__________________________________________________________________________
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 18 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 2455 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: double (D) TOPOLOGY: linear (ix) FEATURE: (A)
NAME/KEY: CDS (B) LOCATION: 191..1438 (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:1:
GAATTCGGGCGGGCTTCTTCGCTGCCGACGTACGACGAGTGGCCGGGCTCTTGCGTCTGG60
TAACGCGCTGTCTCTAACGCCAGCGCCGTCTCGCGCGCACTGCGCACAGACCACCCGCAG120
ACGCCCGGCAGTCCGCAGGCCCAAACGCGCACGCGACCCCGCTCTCCGCACCGTACCCGG180
CCGCCTCGGCATGGCGCCCCGCAGCGCCCGGCGACCCCTGCTGCTGCTA229
MetAlaProArgSerAlaArgArgProLeuLeuLeuLeu 1510
CTGCCTGTTGCTGCTGCTCGGCCTCATGCATTGTCGTCAGCAGCCATG277
LeuProValAlaAlaAlaArgProHisAlaLeuSerSerAlaAlaMet 152025
TTTATGGTGAAAAATGGCAACGGGACCGCGTGCATAATGGCCAACTTC325
PheMetValLysAsnGlyAsnGlyThrAlaCysIleMetAlaAsnPhe 30354045
TCTGCTGCCTTCTCAGTGAACTACGACACCAAGAGTGGCCCCAAGAAC373
SerAlaAlaPheSerValAsnTyrAspThrLysSerGlyProLysAsn 505560
ATGACCTTTGACCTGCCATCAGATGCCACAGTGGTGCTCAACCGCAGC421
MetThrPheAspLeuProSerAspAlaThrValValLeuAsnArgSer 657075
TCCTGTGGAAAAGAGAACACTTCTGACCCCAGTCTCGTGATTGCTTTT469
SerCysGlyLysGluAsnThrSerAspProSerLeuValIleAlaPhe 808590
GGAAGAGGACATACACTCACTCTCAATTTCACGAGAAATGCAACACGT517
GlyArgGlyHisThrLeuThrLeuAsnPheThrArgAsnAlaThrArg 95100105
TACAGCGTTCAGCTCATGAGTTTTGTTTATAACTTGTCAGACACACAC565
TyrSerValGlnLeuMetSerPheValTyrAsnLeuSerAspThrHis 110115120125
CTTTTCCCCAATGCGAGCTCCAAAGAAATCAAGACTGTGGAATCTATA613
LeuPheProAsnAlaSerSerLysGluIleLysThrValGluSerIle 130135140
ACTGACATCAGGGCAGATATAGATAAAAAATACAGATGTGTTAGTGGC661
ThrAspIleArgAlaAspIleAspLysLysTyrArgCysValSerGly 145150155
ACCCAGGTCCACATGAACAACGTGACCGTAACGCTCCATGATGCCACC709
ThrGlnValHisMetAsnAsnValThrValThrLeuHisAspAlaThr 160165170
ATCCAGGCGTACCTTTCCAACAGCAGCTTCAGCAGGGGAGAGACACGC757
IleGlnAlaTyrLeuSerAsnSerSerPheSerArgGlyGluThrArg 175180185
TGTGAACAAGACAGGCCTTCCCCAACCACAGCGCCCCCTGCGCCACCC805
CysGluGlnAspArgProSerProThrThrAlaProProAlaProPro 190195200205
AGCCCCTCGCCCTCACCCGTGCCCAAGAGCCCCTCTGTGGACAAGTAC853
SerProSerProSerProValProLysSerProSerValAspLysTyr 210215220
AACGTGAGCGGCACCAACGGGACCTGCCTGCTGGCCAGCATGGGGCTG901
AsnValSerGlyThrAsnGlyThrCysLeuLeuAlaSerMetGlyLeu 225230235
CAGCTGAACCTCACCTATGAGAGGAAGGACAACACGACGGTGACAAGG949
GlnLeuAsnLeuThrTyrGluArgLysAspAsnThrThrValThrArg 240245250
CTTCTCAACATCAACCCCAACAAGACCTCGGCCAGCGGGAGCTGCGGC997
LeuLeuAsnIleAsnProAsnLysThrSerAlaSerGlySerCysGly 255260265
GCCCACCTGGTGACTCTGGAGCTGCACAGCGAGGGCACCACCGTCCTG1045
AlaHisLeuValThrLeuGluLeuHisSerGluGlyThrThrValLeu 270275280285
CTCTTCCAGTTCGGGATGAATGCAAGTTCTAGCCGGTTTTTCCTACAA1093
LeuPheGlnPheGlyMetAsnAlaSerSerSerArgPhePheLeuGln 290295300
GGAATCCAGTTGAATACAATTCTTCCTGACGCCAGAGACCCTGCCTTT1141
GlyIleGlnLeuAsnThrIleLeuProAspAlaArgAspProAlaPhe 305310315
AAAGCTGCCAACGGCTCCCTGCGAGCGCTGCAGGCCACAGTCGGCAAT1189
LysAlaAlaAsnGlySerLeuArgAlaLeuGlnAlaThrValGlyAsn 320325330
TCCTACAAGTGCAACGCGGAGGAGCACGTCCGTGTCACGAAGGCGTTT1237
SerTyrLysCysAsnAlaGluGluHisValArgValThrLysAlaPhe 335340345
TCAGTCAATATATTCAAAGTGTGGGTCCAGGCTTTCAAGGTGGAAGGT1285
SerValAsnIlePheLysValTrpValGlnAlaPheLysValGluGly 350355360365
GGCCAGTTTGGCTCTGTGGAGGAGTGTCTGCTGGACGAGAACAGCACG1333
GlyGlnPheGlySerValGluGluCysLeuLeuAspGluAsnSerThr 370375380
CTGATCCCCATCGCTGTGGGTGGTGCCCTGGCGGGGCTGGTCCTCATC1381
LeuIleProIleAlaValGlyGlyAlaLeuAlaGlyLeuValLeuIle 385390395
GTCCTCATCGCCTACCTCGTCGGCAGGAAGAGGAGTCACGCAGGCTAC1429
ValLeuIleAlaTyrLeuValGlyArgLysArgSerHisAlaGlyTyr 400405410
CAGACTATCTAGCCTGGTGCACGCAGGCACAGCAGCTGCAGGGGCCTCT1478 GlnThrIle 415
GTTCCTTTCTCTGGGCTTAGGGTCCTGTCGAAGGGGAGGCACACTTTCTGCAAACGTTTC1538
TCAAATCTGCTTCATCCAATGTGAAGTTCATCTTGCAGCATTTACTATGCACAACAGAGT1598
AACTATCGAAATGACGGTGTTAATTTTGCTAACTGGGTTAAATATTTTGCTAACTGGTTA1658
AACATTAATATTTACCAAAGTAGGATTTTGAGGGTGGGGGTGCTCTCTCTGAGGGGGTGG1718
GGGTGCCGCTGTCTCTGAGGGGTGGGGGTGCCGCTGTCTGAGGGGTGGGGGTGCCGCTCT1778
CTCTGAGGGGGTGGGGGTGCCGCTTTCTCTGAGGGGGTGGGGGTGCCGCTCTCTCTGAGG1838
GGGTGGGGGTGCTGCTCTCTCCGAGGGGTGGAATGCCGCTGTCTCTGAGGGGTGGGGGTG1898
CCGCTCTAAATTGGCTCCATATCATTGAGTTTAGGGTTCTGGTGTTTGGTTTCTTCATTC1958
TTTACTGCACTCAGATTTAAGCCTTACAAAGGGAAACCTCTGGCCGTCACACGTAGGACG2018
CATGAAGGTCACTCGTGTGAGGCTGACATGCTCACACATTACAACAGTAGAGAGGGAAAA2078
TCCTAAGACAGAGGAACTCCAGAGATGAGTGTCTGGAGCGGCTTCAGTTCAGCTTTAAAG2138
GCCAGGACGCGCGACACGTGGCTGGCGGCCTCGTTCCAGTGGCGGCACGTCCTTGGCGTC2198
TCTAATGTCTGCAGCTCAAGGGCTGGCACTTTTTTAAATATAAAAATGGTGTTATTTTTA2258
TTTTTTTTTGTAAAGTGATTTTTGGTCTTCTGTTGACATTCGGGTGATCCTGTTCTGCGC2318
TGTGTACAATGTGAGATCGGTGCGTTCTCCTGATGTTTTGCCGTGGCTTGGGGATTGTAC2378
ACGGGACCAGCTCACGTAATGCATTGCCTGTAACAATGTAATAAAAAGCCTCTTTCTTTC2438
AAAAAAACCCCGAATTC2455 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 416 amino acids (B) TYPE: amino acid
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:2:
MetAlaProArgSerAlaArgArgProLeuLeuLeuLeuLeuProVal 151015
AlaAlaAlaArgProHisAlaLeuSerSerAlaAlaMetPheMetVal 202530
LysAsnGlyAsnGlyThrAlaCysIleMetAlaAsnPheSerAlaAla 354045
PheSerValAsnTyrAspThrLysSerGlyProLysAsnMetThrPhe 505560
AspLeuProSerAspAlaThrValValLeuAsnArgSerSerCysGly 65707580
LysGluAsnThrSerAspProSerLeuValIleAlaPheGlyArgGly 859095
HisThrLeuThrLeuAsnPheThrArgAsnAlaThrArgTyrSerVal 100105110
GlnLeuMetSerPheValTyrAsnLeuSerAspThrHisLeuPhePro 115120125
AsnAlaSerSerLysGluIleLysThrValGluSerIleThrAspIle 130135140
ArgAlaAspIleAspLysLysTyrArgCysValSerGlyThrGlnVal 145150155160
HisMetAsnAsnValThrValThrLeuHisAspAlaThrIleGlnAla 165170175
TyrLeuSerAsnSerSerPheSerArgGlyGluThrArgCysGluGln 180185190
AspArgProSerProThrThrAlaProProAlaProProSerProSer 195200205
ProSerProValProLysSerProSerValAspLysTyrAsnValSer 210215220
GlyThrAsnGlyThrCysLeuLeuAlaSerMetGlyLeuGlnLeuAsn 225230235240
LeuThrTyrGluArgLysAspAsnThrThrValThrArgLeuLeuAsn 245250255
IleAsnProAsnLysThrSerAlaSerGlySerCysGlyAlaHisLeu 260265270
ValThrLeuGluLeuHisSerGluGlyThrThrValLeuLeuPheGln 275280285
PheGlyMetAsnAlaSerSerSerArgPhePheLeuGlnGlyIleGln 290295300
LeuAsnThrIleLeuProAspAlaArgAspProAlaPheLysAlaAla 305310315320
AsnGlySerLeuArgAlaLeuGlnAlaThrValGlyAsnSerTyrLys 325330335
CysAsnAlaGluGluHisValArgValThrLysAlaPheSerValAsn 340345350
IlePheLysValTrpValGlnAlaPheLysValGluGlyGlyGlnPhe 355360365
GlySerValGluGluCysLeuLeuAspGluAsnSerThrLeuIlePro 370375380
IleAlaValGlyGlyAlaLeuAlaGlyLeuValLeuIleValLeuIle 385390395400
AlaTyrLeuValGlyArgLysArgSerHisAlaGlyTyrGlnThrIle 405410415 (2)
INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 210 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
double (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
CTTTTGCAAGGCTGTGGTCGGTGGTCATCAGTGCTCTTGACCCAGGTCCAGCGAGCCTTT60
TCCCTGGTGTTGCAGCTGTTGTTGTACCGCCGCCGTCGCCGCCGTCGCCGCCTGCTCTGC120
GGGGTCATGGTGTGCTTCCGCCTCTTCCCGGTTCCGGGCTCAGGGCTCGTTCTGGTCTGC180
CTAGTCCTGGGTGAGTTGTCGGGCCCTCCC210 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 159 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:4:
ATTTTTTTAAATGAATCCAGGAGCTGTGCGGTCTTATGCATTGGAACTTAATTTGACAGA60
TTCAGAAAATGCCACTTGCCTTTATGCAAAATGGCAGATGAATTTCACAGTTCGCTATGA120
AACTACAAATAAAACTTATGTAAGTATATATTTGGGTTT159 (2) INFORMATION FOR SEQ
ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 254 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY:
linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
CAAATTTCTATTTCTTTTAGAAAACTGTAACCATTTCAGACCATGGCACTGTGACATATA60
ATGGAAGCATTTGTGGGGATGATCAGAATGGTCCCAAAATAGCAGTGCAGTTCGGACCTG120
GCTTTTCCTGGATTGCGAATTTTACCAAGGCAGCATCTACTTATTCAAATGACAGCGTCT180
CATTTTCCTACAACACTGGTGATAACACAACATTTCCTGATGCTGAAGATAAAGGTAACC240
TTAAGAATGGATTT254 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 199 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:6:
TTGTTAATCTTGTTTTATAGGAATTCTTACTGTTGATGAACTTTTGGCCATCAGAATTCC60
ATTGAATGACCTTTTTAGATGCAATAGTTTATCAACTTTGGAAAAGAATGATGTTGTCCA120
ACACTACTGGGATGTTCTTGTACAAGCTTTTGTCCAAAATGGCACAGTGAGCACAAATGG180
TGAGTAACAACAGATTTTT199 (2) INFORMATION FOR SEQ ID NO:7: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 225 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:7:
TCCCTTTTCGCTTGTTTTAGAGTTCCTGTGTGATAAAGACAAAACTTCAACAGTGGCACC60
CACCATACACACCACTGTGCCATCTCCTACTACAACACCTACTCCAAAGGAAAAACCAGA120
ACCTGGAACCTATTCAGTTAATAATGGCAATGATACTTGTCTGCGTGCTACCATGGGGCT180
GCAGCTGAACATCACTCAGGATAAGGTATAGGTGTCTATCTTTAT225 (2) INFORMATION
FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 163 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY:
linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
CCTTTCTTCTTCTCCTGAAGGTTGCTTCAGTTATTAACATCAACCCCAATACAACTCACT60
CCACAGGCAGCTGCCGTTCTCACACTGCTCTACTTAGACTCAATAGCAGCACCATTAAGT120
ATCTAGACTTTGTCTTTGCTGTGGTGAGTAACAACAGATTTTT163 (2) INFORMATION FOR
SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 104 base
pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY:
linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
GGAAGCTCTTTTTCAAACAGAAAAATGAAAACCGATTTTATCTGAAGGAAGTGAACATCA60
GCATGTATTTGGTTAATGGCTCCGGTAAGCAAAGCACTGGACCT104 (2) INFORMATION FOR
SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 205 base
pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY:
linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
CCTGTTTCTTTTCTTTGAAGTTTTCAGCATTGCAAATAACAATCTCAGCTACTGGGATGC60
CCCCCTGGGAAGTTCTTATATGTGCAACAAAGAGCAGACTGTTTCAGTGTCTGGAGCATT120
TCAGATAAATACCTTTGATCTAAGGGTTCAGCCTTTCAATGTGACACAAGGAAAGTATTC180
TACAGGTAAGAATCAAGCAAACTTC205 (2) INFORMATION FOR SEQ ID NO:11: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 687 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:11:
TGTCCTTTCTCCACATCTAGCTCAAGACTGCAGTGCAGATGACGACAACTTCCTTGTGCC60
CATAGCGGTGGGAGCTGCCTTGGCAGGAGTACTTATTCTAGTGTTGCTGGCTTATTTTAT120
TGGTCTCAAGCACCATCATGCTGGATATGAGCAATTTTAGAATCTGCAACCTGATTGATT180
ATATAAAAATACATGCAAATAACAAGATTTTCTTACCTCTCAGTTGTTGAAACACTTTGC240
TTCTTAAAATTGATATGTTGAAACTTTAATTCTTTTATCAATCCCAGCATTTTGAGATCA300
GTCTTTATTAATAAAACCTGTTCTCTTTAATCAGCTTAAAATCCAAAGTGTCATATTTAC360
TGGTCCTGGAGACAAACTTGTTCAAAAGAACATCAACGTGCAATGTTTTAAGGGTCTATC420
TTAAGGAAGCCCTGGCCAAATTTTGACCTAACTTGAAGTATCCTTGAACTTATTAACATG480
GCCATTATAAGAATAAAATATGTAGTTGTGTCTTAATGGAATTAATAAATGTCATTTCAC540
TACTGGTGTTCTGTTTCAATCTATAAGGACTATAGTGATTTAAACTCATCAATGTGCCTT600
TGCATAAAGTTCATTAAATAAATATTGATGTGGTATAAATGCCCATCAGATATGCTTAAA660
CTTGGTTTTCAGTTGAATGAAGTAGAG687 (2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:12:
TCAAGTACTCTTGAAGTCATGATTGCTTCA30 (2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:13:
TGAAGTACTAACTTAAAGGATGTAAGAAGGCTT33 (2) INFORMATION FOR SEQ ID
NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B)
TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
TTTGAATTCCTCGCGCCATGGCGCC25 (2) INFORMATION FOR SEQ ID NO:15: (i)
SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:15: AAAGGTACCTAGCTGTTCTCGTCCAGCAG29
(2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 410 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
MetValCysPheArgLeuPheProValProGlySerGlyLeuValLeu 151015
ValLeuValCysLeuGlyAlaValArgSerTyrAlaLeuGluLeuAsn 202530
LeuThrAspSerGluAsnAlaThrCysLeuTyrAlaLysTrpGlnMet 354045
AsnPheThrValArgTyrGluThrThrAsnLysThrTyrLysThrVal 505560
ThrIleSerAspHisGlyThrValThrTyrAsnGlySerIleCysGly 65707580
AspAspGlnAspGlyProLysIleAlaValGlnPheGlyProGlyPhe 859095
SerTrpIleAlaAsnPheThrLysAlaAlaSerThrTyrSerAsnAsp 100105110
SerValSerPheSerTyrAsnThrGlyAspAsnThrThrPheProAsp 115120125
AlaGluAspLysGlyIleLeuThrValAspGluLeuLeuAlaIleArg 130135140
IleProLeuAsnAspLeuPheArgCysAsnSerLeuSerThrLeuGlu 145150155160
LysAsnAspValValGlnHisTyrTrpAspValLeuValGlnAlaPhe 165170175
ValGlnAsnGlyThrValSerThrAsnGluPheLeuCysAspLysAsp 180185190
LysThrSerThrValAlaProThrIleHisThrThrValProSerPro 195200205
ThrThrThrProThrProLysGluLysProGluProGlyThrTyrSer 210215220
ValAsnAsnGlyAsnAspThrCysLeuLeuAlaThrMetGlyLeuGln 225230235240
LeuAsnIleThrGlnAspLysValAlaSerValIleAsnIleAsnPro 245250255
AsnThrThrHisSerThrGlySerCysArgSerHisThrAlaLeuLeu 260265270
ArgLeuAsnSerSerThrIleLysTyrLeuAspPheValPheAlaVal 275280285
LysAsnGluAsnArgPheTyrLeuLysGluValAsnIleSerMetTyr 290295300
LeuValAsnGlySerValPheSerIleAlaAsnAsnAsnLeuSerTyr 305310315320
TrpAspAlaProLeuGlySerSerTyrMetCysAsnLysGluGlnThr 325330335
ValSerValSerGlyAlaPheGlnIleAsnThrPheAspLeuArgVal 340345350
GlnProPheAsnValThrGlnGlyLysTyrSerThrAlaGlnAspCys 355360365
SerAlaAspAspAspAsnPheLeuValProIleAlaValGlyAlaAla 370375380
LeuAlaGlyValLeuIleLeuValLeuLeuAlaTyrPheIleGlyLeu 385390395400
LysHisHisHisAlaGlyTyrGluGlnPhe 405410 (2) INFORMATION FOR SEQ ID
NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 353 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:17:
AlaMetPheMetValLysAsnGlyAsnGlyThrAlaCysIleMetAla 151015
AsnPheSerAlaAlaPheSerValAsnTyrAspThrLysSerGlyPro 202530
LysAsnMetThrPheAspLeuProSerAspAlaThrValValLeuAsn 354045
ArgSerSerCysGlyLysGluAsnThrSerAspProSerLeuValIle 505560
AlaPheGlyArgGlyHisThrLeuThrLeuAsnPheThrArgAsnAla 65707580
ThrArgTyrSerValGlnLeuMetSerPheValTyrAsnLeuSerAsp 859095
ThrHisLeuPheProAsnAlaSerSerLysGluIleLysThrValGlu 100105110
SerIleThrAspIleArgAlaAspIleAspLysLysTyrArgCysVal 115120125
SerGlyThrGlnValHisMetAsnAsnValThrValThrLeuHisAsp 130135140
AlaThrIleGlnAlaTyrLeuSerAsnSerSerPheSerArgGlyGlu 145150155160
ThrArgCysGluGlnAspArgProSerProThrThrAlaProProAla 165170175
ProProSerProSerProSerProValProLysSerProSerValAsp 180185190
LysTyrAsnValSerGlyThrAsnGlyThrCysLeuLeuAlaSerMet 195200205
GlyLeuGlnLeuAsnLeuThrTyrGluArgLysAspAsnThrThrVal 210215220
ThrArgLeuLeuAsnIleAsnProAsnLysThrSerAlaSerGlySer 225230235240
CysGlyAlaHisLeuValThrLeuGluLeuHisSerGluGlyThrThr 245250255
ValLeuLeuPheGlnPheGlyMetAsnAlaSerSerSerArgPhePhe 260265270
LeuGlnGlyIleGlnLeuAsnThrIleLeuProAspAlaArgAspPro 275280285
AlaPheLysAlaAlaAsnGlySerLeuArgAlaLeuGlnAlaThrVal 290295300
GlyAsnSerTyrLysCysAsnAlaGluGluHisValArgValThrLys 305310315320
AlaPheSerValAsnIlePheLysValTrpValGlnAlaPheLysVal 325330335
GluGlyGlyGlnPheGlySerValGluGluCysLeuLeuAspGluAsn 340345350 Ser (2)
INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 380 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
MetAlaProArgSerAlaArgArgProLeuLeuLeuLeuLeuProVal 151015
AlaAlaAlaArgProHisAlaLeuSerSerAlaAlaMetPheMetVal 202530
LysAsnGlyAsnGlyThrAlaCysIleMetAlaAsnPheSerAlaAla 354045
PheSerValAsnTyrAspThrLysSerGlyProLysAsnMetThrPhe 505560
AspLeuProSerAspAlaThrValValLeuAsnArgSerSerCysGly 65707580
LysGluAsnThrSerAspProSerLeuValIleAlaPheGlyArgGly 859095
HisThrLeuThrLeuAsnPheThrArgAsnAlaThrArgTyrSerVal 100105110
GlnLeuMetSerPheValTyrAsnLeuSerAspThrHisLeuPhePro 115120125
AsnAlaSerSerLysGluIleLysThrValGluSerIleThrAspIle 130135140
ArgAlaAspIleAspLysLysTyrArgCysValSerGlyThrGlnVal 145150155160
HisMetAsnAsnValThrValThrLeuHisAspAlaThrIleGlnAla 165170175
TyrLeuSerAsnSerSerPheSerArgGlyGluThrArgCysGluGln 180185190
AspArgProSerProThrThrAlaProProAlaProProSerProSer 195200205
ProSerProValProLysSerProSerValAspLysTyrAsnValSer 210215220
GlyThrAsnGlyThrCysLeuLeuAlaSerMetGlyLeuGlnLeuAsn 225230235240
LeuThrTyrGluArgLysAspAsnThrThrValThrArgLeuLeuAsn 245250255
IleAsnProAsnLysThrSerAlaSerGlySerCysGlyAlaHisLeu 260265270
ValThrLeuGluLeuHisSerGluGlyThrThrValLeuLeuPheGln 275280285
PheGlyMetAsnAlaSerSerSerArgPhePheLeuGlnGlyIleGln 290295300
LeuAsnThrIleLeuProAspAlaArgAspProAlaPheLysAlaAla 305310315320
AsnGlySerLeuArgAlaLeuGlnAlaThrValGlyAsnSerTyrLys 325330335
CysAsnAlaGluGluHisValArgValThrLysAlaPheSerValAsn 340345350
IlePheLysValTrpValGlnAlaPheLysValGluGlyGlyGlnPhe 355360365
GlySerValGluGluCysLeuLeuAspGluAsnSer 370375380
__________________________________________________________________________
* * * * *