U.S. patent number 5,643,748 [Application Number 08/306,231] was granted by the patent office on 1997-07-01 for hu-b1.219, a novel human hematopoietin receptor.
This patent grant is currently assigned to Progenitor, Inc.. Invention is credited to Joseph Cioffi, Alan Wayne Shafer, H. Ralph Snodgrass, Thomas Joel Zupancic.
United States Patent |
5,643,748 |
Snodgrass , et al. |
July 1, 1997 |
**Please see images for:
( Certificate of Correction ) ** |
HU-B1.219, a novel human hematopoietin receptor
Abstract
The present invention relates to a novel member of the
hematopoietin receptor family, herein referred to as Hu-B1.219. In
particular, the invention relates to nucleotide sequences and
expression vectors encoding Hu-B1.219 gene product. Genetically
engineered host cells that express the Hu-B1.219 coding sequence
may be used to evaluate and screen for ligands or drugs involved in
Hu-B1.219 interaction and regulation. Since Hu-B1.219 expression
has been detected in certain human fetal tissues and cancer cells,
molecular probes designed from its nucleotide sequence may be
useful for prenatal testing and cancer diagnosis.
Inventors: |
Snodgrass; H. Ralph (Powell,
OH), Cioffi; Joseph (Athens, OH), Zupancic; Thomas
Joel (Worthington, OH), Shafer; Alan Wayne (Albany,
OH) |
Assignee: |
Progenitor, Inc. (Columbus,
OH)
|
Family
ID: |
23184398 |
Appl.
No.: |
08/306,231 |
Filed: |
September 14, 1994 |
Current U.S.
Class: |
435/69.1;
435/320.1; 536/23.4; 530/300; 435/69.7; 536/23.5; 435/252.3 |
Current CPC
Class: |
C07K
14/705 (20130101); C07K 14/72 (20130101); A61P
7/00 (20180101); G01N 33/5011 (20130101); G01N
33/5091 (20130101); G01N 33/5008 (20130101); G01N
33/5044 (20130101); A61P 35/00 (20180101); C07K
14/715 (20130101); C12Q 1/6883 (20130101); A61P
7/06 (20180101); C12Q 2600/158 (20130101); A61K
38/00 (20130101) |
Current International
Class: |
C07K
14/705 (20060101); C07K 14/435 (20060101); C07K
14/715 (20060101); C07K 014/705 (); C12N 005/10 ();
C12N 015/17 () |
Field of
Search: |
;435/69.1,69.7,252.3,320.1 ;530/350 ;536/23.4,23.5 |
Primary Examiner: Ulm; John
Attorney, Agent or Firm: Pennie & Edmonds
Claims
What is claimed is:
1. An isolated nucleic acid molecule, comprising a nucleotide
sequence that hybridizes under stringent conditions to a second
nucleic acid molecule having the nucleotide sequence of SEQ ID NO:
2 between resides #143 and #672, or its complement.
2. An isolated nucleic acid molecule, comprising a nucleotide
sequence that hybridizes under stringent conditions to a second
nucleic acid molecule having the nucleotide sequence of SEQ ID NO:
2, or its complement.
3. An isolated nucleic acid molecule, comprising a nucleotide
sequence that (a) encodes a polypeptide having the amino acid
sequence of SEQ ID NO: 3, or (b) is the complement of the
nucleotide sequence.
4. The nucleic acid molecule of claim 1, 2 or 3 which is a
cDNA.
5. The nucleic acid molecule of claim 1, 2 or 3 which is a genomic
DNA.
6. The nucleic acid molecule of claim 1, 2 or 3 which is a double
helix.
7. A recombinant vector containing the nucleic acid molecule of
claim 1, 2 or 3.
8. An expression vector containing the nucleic acid molecule of
claim 1, 2 or 3 in which the nucleotide sequence is operatively
associated with a regulatory nucleotide sequence that controls
expression of the nucleotide sequence in a host cell.
9. A genetically-engineered host cell containing the nucleic acid
molecule of claim 1, 2 or 3.
10. A genetically-engineered host cell containing the nucleic acid
molecule of claim 1, 2 or 3 in which the nucleotide sequence is
operatively associated with a regulatory sequence that controls
expression of the nucleotide sequence in the host cell.
11. The genetically-engineered host cell of claim 10 in which the
host cell is a prokaryote.
12. The genetically-engineered host cell of claim 10 in which the
host cell is an eukaryote.
13. A method for producing a polypeptide, comprising:
(a) culturing the genetically-engineered host cell of claim 11;
and
(b) recovering the polypeptide from the cultured host cell or its
culture medium.
14. A method for producing a polypeptide, comprising:
(a) culturing the genetically-engineered host cell of claim 12;
and
(b) recovering the polypeptide from the cultured host cell or its
culture medium.
Description
1. INTRODUCTION
The present invention relates to a novel member of the
hematopoietin receptor family, herein referred to as Hu-B1.219. In
particular, the invention relates to nucleotide sequences and
expression vectors encoding Hu-B1.219 gene product. Genetically
engineered host cells that express the Hu-B1.219 coding sequence
may be used to evaluate and screen for ligands or drugs involved in
Hu-B1.219 interaction and regulation. Since Hu-B1.219 expression
has been detected in certain human fetal tissues and cancer cells,
molecular probes designed from its nucleotide sequence may be
useful for prenatal testing and cancer diagnosis.
2. BACKGROUND OF THE INVENTION
A variety of diseases, including malignancy and immunodeficiency,
are related to malfunction within the lympho-hematopoietic system.
Some of these conditions could be alleviated and/or cured by
repopulating the hematopoietic system with progenitor cells, which
when triggered to differentiate would overcome the patient's
deficiency. Therefore, the ability to initiate and regulate
hematopoiesis is of great importance (McCune et al., 1988, Science
241:1632).
The process of blood cell formation, by which a small number of
self-renewing stem cells give rise to lineage specific progenitor
cells that subsequently undergo proliferation and differentiation
to produce the mature circulating blood cells has been shown to be
at least in part regulated by specific hormones. These hormones are
collectively known as hematopoietic growth factors or cytokines
(Metcalf, 1985, Science 229:16; Dexter, 1987, J. Cell Sci. 88:1;
Golde and Gasson, 1988, Scientific American, July:62; Tabbara and
Robinson, 1991, Anti-Cancer Res. 11:81; Ogawa, 1989, Environ.
Health Presp. 80:199; Dexter, 1989, Br. Med. Bull. 45:337).
With the advent of recombinant DNA technology, the genes encoding a
number of these molecules have now been molecularly cloned and
expressed in recombinant form (Souza et al., 1986, Science 232:61;
Gough et al., 1984, Nature 309:763; Yokota et al., 1984, Proc.
Natl. Acad. Sci. U.S.A. 81:1070; Kawasaki et al., 1985, Science
230:291). These cytokines have been studied in their structure,
biology and even therapeutic potential. Some of the most well
characterized factors include erythropoietin (EPO), stem cell
factor (SCF), granulocyte macrophage colony stimulating factor
(GM-CSF), macrophage colony stimulating factor (M-CSF), granulocyte
colony stimulating factor (G-CSF), and the interleukins (IL-1 to
IL-14).
These factors act on different cell types at different stages
during blood cell development, and their potential uses in medicine
are far-reaching which include blood transfusions, bone marrow
transplantation, correcting immunosuppressive disorders, cancer
therapy, wound healing, and activation of the immune response.
(Golde and Gasson, 1988, Scientific American, July:62).
Apart from inducing proliferation and differentiation of
hematopoietic progenitor cells, such cytokines have also been shown
to activate a number of functions of mature blood cells (Stanley et
al., 1976, J. Exp. Med. 143:631; Schrader et al., 1981, Proc. Natl.
Acad. Sci. U.S.A. 78:323; Moore et al., 1980, J. Immunol. 125:1302;
Kurland et al., 1979, Proc. Natl. Acad. Sci. U.S.A. 76:2326;
Handman and Burgess, 1979, J. Immunol. 122:1134; Vadas et al.,
1983, Blood 61:1232; Vadas et al., 1983, J. Immunol. 130:795),
including influencing the migration of mature hematopoietic cells
(Weibart et al., 1986, J. Immunol. 137:3584).
Cytokines exert their effects on target cells by binding to
specific cell surface receptors. A number of cytokine receptors
have been identified and the genes encoding them molecularly
cloned. Several cytokine receptors have recently been classified
into a hematopoietin receptor (HR) superfamily. The grouping of
these receptors was based on the conservation of key amino acid
motifs in the extracellular domains (Bazan, 1990, Immunology Today
11:350) (FIG. 1). The HR family is defined by three conserved
motifs in the extracellular domain of these receptors. The first is
a Trp-Ser-X-Trp-Ser (WSXWS box) motif (SEQ ID NO:1) which is highly
conserved and located amino-terminal to the transmembrane domain.
Most members of the HR family contain this motif. The second
consists of four conserved cysteine residues located in the
N-terminal half of the extracellular region. The third is a
conserved fibronectin Type III (FN III) domain which is located
between the WSXWS box and the cysteines. The members of the HR
family include receptors for ligands such as erythropoietin (EPO),
granulocyte colony stimulating factor (G-CSF) (Fukunaga, 1990, Cell
61:341), granulocyte-macrophage colony stimulating factor (GM-CSF),
interleukin-3 (IL-3), IL-4, IL-5, IL-6, IL-7, and IL-2
(.beta.-subunit) (Cosman, 1990, TIBS 15:265).
Ligands for the HR are critically involved in the maturation and
differentiation of blood cells. For example, IL-3 promotes the
proliferation of early multilineage pluripotent stem cells, and
synergizes with EPO to produce red cells. IL-6 and IL-3 synergize
to induce proliferation of early hematopoietic precursors. GM-CSF
has been shown to induce the proliferation of granulocytes as well
as increase macrophage function. IL-7 is a bone marrow-derived
cytokine that plays a role in producing immature T and B
lymphocytes. IL-4 induces proliferation of antigen-primed B cells
and antigen-specific T cells. Thus, members of this receptor
superfamily are involved in the regulation of the hematopoietic
system.
3. SUMMARY OF THE INVENTION
The present invention relates to a novel member of the HR family,
referred to as Hu-B1.219. In particular, it relates to the
nucleotide sequences, expression vectors, and host cells expressing
the Hu-B1.219 gene.
The invention is based, in part, upon Applicants' discovery of a
cDNA clone, Hu-B1.219, isolated from a human fetal liver cDNA
library. While the nucleotide sequence of this clone shares certain
homology with other HR genes, it is also unique in its structure.
The human sequence is expressed in certain human fetal and tumor
cells. Therefore, a wide variety of uses are encompassed by the
present invention, including but not limited to, the diagnosis of
cancer, the marking of fetal tissues, and the screening of ligands
and compounds that bind the receptor molecule encoded by
Hu-B1.219.
For the purpose of the present invention, the designation Hu-B1.219
refers to the partial cDNA sequence disclosed in FIGS. 2A-2D. In
addition, Hu-B1.219 also refers to the entire coding sequence of
which the cDNA sequence of FIGS. 2A-2D is a part.
4. BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1. A schematic drawing of conserved regions shared by members
of HR family.
FIGS. 2A-2D. Nucleotide sequence (SEQ ID NO:2) and deduced amino
acid sequence (SEQ ID NO:3) of Hu-B1.219.
FIG. 3. Comparison of the spacing of conserved amino acids in the
FN III domain between HR genes and Hu-B1.219.
FIG. 4. Comparison of conserved motifs between HR molecules and
Hu-B1.219 in "Block 3" mIL2R.beta. (SEQ ID NO:4); hIL2R.sub..gamma.
(SEQ ID NO:5); mIL5R.alpha. (SEQ ID NO: 6); mEPOR (SEQ ID NO:7);
Hu-B1.219(5') (SEQ ID NO:8); Hu-B1.219(3') (SEQ ID NO:9).
FIG. 5. Comparison of conserved motifs between HR molecules and
Hu-B1.219 in "Block 6" mIL-2R.beta. (SEQ ID NO:10);
hIL-2R.sub..gamma. (SEQ ID NO:11); mIL-5R.alpha. (SEQ ID NO:12);
mEPOR (SEQ ID NO:13); Hu-B1.219(5') (SEQ ID NO:14); Hu-B1.219(3')
(SEQ ID NO:15).
5. DETAILED DESCRIPTION OF THE INVENTION
5.1 THE Hu-B1.219 CODING SEQUENCE
The present invention relates to nucleic acid and amino acid
sequences of a novel member of the HR family. In a specific
embodiment by way of example in Section 6, infra, a new member of
this HR family of receptors was cloned and characterized. The
nucleotide coding sequence and deduced amino acid sequence of the
novel receptor are unique, and the receptor is referred to as
Hu-B1.219. In accordance with the invention,. any nucleotide
sequence which encodes the amino acid sequence of the Hu-B1.219
gene product can be used to generate recombinant molecules which
direct the expression of Hu-B1.219 gene.
Analysis of the Hu-B1.219 sequence revealed significant homology to
the FN III domain of the HR family indicating that it was a member
of the HR family of receptors. The shared homology between
Hu-B1.219 and other known members of the HR family is discussed in
Section 6.2, infra. However, this receptor also contains regions of
previously unreported unique nucleotide sequences.
Northern blot hybridization analysis, indicates that Hu-B1.219 mRNA
is highly expressed in cells of hematopoietic origin. In addition,
the Hu-B1.219 sequence is expressed in certain tumor cells.
In order to clone the full length cDNA sequence encoding the entire
Hu-B1.219 cDNA, labeled DNA probes made from nucleic acid fragments
corresponding to any portion of the partial cDNA disclosed herein
may be used to screen the human fetal liver cDNA library. More
specifically, oligonucleotides corresponding to either the 5' or 3'
terminus of the partial cDNA sequence may be used to obtain longer
nucleotide sequences. Briefly, the library will be plated out to
yield a maximum of 30,000 pfu for each 150 mm plate. Approximately
40 plates may be screened. The plates are incubated at 37.degree.
C. until the plaques reach a diameter of 0.25 mm or are just
beginning to make contact with one another (3-8 hours). Nylon
filters are placed onto the soft top agarose and after 60 seconds,
the filters are peeled off and floated on a DNA denaturing solution
consisting of 0.4N sodium hydroxide. The filters are then immersed
in neutralizing solution consisting of 1M Tris HCL, pH 7.5, before
being allowed to air dry. The filters are prehybridized in casein
hybridization buffer containing 10% dextran sulfate, 0.5M NaCl,
50mM Tris HCL, pH 7.5, 0.1% sodium pyrosphosphate, 1% casein, 1%
SDS, and denatured salmon sperm DNA at 0.5 mg/ml for 6 hours at
60.degree. C. The radiolabeled probe is then denatured by heating
to 95.degree. C. for 2 minutes and then added to the
prehybridization solution containing the filters. The filters are
hybridized at 60.degree. C. for 16 hours. The filters are then
washed in 1.times.wash mix (10.times.wash mix contains 3M NaCl,
0.6M Tris base, and 0.02M EDTA) twice for 5 minutes each at room
temperature, then in 1.times.wash mix containing 1% SDS at
60.degree. C. for 30 minutes, and finally in 0.3.times.wash mix
containing 0.1% SDS at 60.degree. C. for 30 minutes. The filters
are then air dried and exposed to x-ray film for autoradiography.
After developing, the film is aligned with the filters to select a
positive plaque. If a single, isolated positive plaque cannot be
obtained, the agar plug containing the plaques will be removed and
placed in lambda dilution buffer containing 0.1M NaCl, 0.01M
magnesium sulfate, 0.035M Tris HCl, pH 7.5, 0.01% gelatin. The
phage will then be replated and rescreened to obtain single, well
isolated positive plaques. Positive plaques may be isolated and the
cDNA clones sequenced using primers based on the known cDNA
sequence. This step may be repeated until a full length cDNA is
obtained.
It may be necessary to screen multiple cDNA libraries from
different tissues to obtain a full length cDNA. In the event that
it is difficult to identify cDNA clones encoding the complete 5'
terminal coding region, an often encountered situation in cDNA
cloning, the RACE (Rapid Amplification of cDNA Ends) technique may
be used. RACE is a proven PCR-based strategy for amplifying the 5'
end of incomplete cDNAs. 5'-RACE-Ready cDNA synthesized from human
fetal liver containing a unique anchor sequence is commercially
available (Clontech). To obtain the 5' end of the cDNA, PCR is
carried out on 5'-RACE-Ready cDNA using the provided anchor primer
and the 3' primer. A secondary PCR reaction is then carried out
using the anchored primer and a nested 3' primer according to the
manufacturer's instructions. Once obtained, the full length cDNA
sequence may be translated into amino acid sequence and examined
for certain landmarks such as a continuous open reading frame
flanked by translation initiation and termination sites, a
potential signal sequence and transmembrane domain, and finally
overall structural similarity to known HR genes.
5 5.2 EXPRESSION OF Hu-B1.219 SEQUENCE
In accordance with the invention, Hu-B1.219 polynucleotide sequence
which encodes the Hu-B1.219 protein, peptide fragments of
Hu-B1.219, Hu-B1.219 fusion proteins or functional equivalents
thereof, may be used to generate recombinant DNA molecules that
direct the expression of Hu-B1.219 protein, Hu-B1.219 peptide
fragment, fusion proteins or a functional equivalent thereof, in
appropriate host cells. Such Hu-B1.219 polynucleotide sequences, as
well as other polynucleotides which selectively hybridize to at
least a part of such Hu-B1.219 polynucleotides or their
complements, may also be used in nucleic acid hybridization assays,
Southern and Northern blot analyses, etc.
Due to the inherent degeneracy of the genetic code, other DNA
sequences which encode substantially the same or a functionally
equivalent amino acid sequence, may be used in the practice of the
invention for the cloning and expression of the Hu-B1.219 protein.
Such DNA sequences include those which are capable of hybridizing
to the human Hu-B1.219 sequences under stringent conditions. The
phrase "stringent conditions" as used herein refers to those
hybridizing conditions that (1) employ low ionic strength and high
temperature for washing, for example, 0.015M NaCl/0.0015M sodium
citrate/0.1% SDS at 50.degree. C.; (2) employ during hybridization
a denaturing agent such as formamide, for example, 50% (vol/vol)
formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1%
polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with
750 mM NaCl, 75 mM sodium citrate at 42.degree. C.; or (3) employ
50% formamide, 5.times.SSC (0.75M NaCl, 0.075M Sodium
pyrophosphate, 5.times.Denhardt's solution, sonicated salmon sperm
DNA (50 g/ml), 0.1% SDS, and 10% dextran sulfate at 42.degree. C.,
with washes at 42.degree. C. in 0.2.times.SSC and 0.1% SDS.
Altered DNA sequences which may be used in accordance with the
invention include deletions, additions or substitutions of
different nucleotide residues resulting in a sequence that encodes
the same or a functionally equivalent gene product. The gene
product itself may contain deletions, additions or substitutions of
amino acid residues within a Hu-B1.219 sequence, which result in a
silent change thus producing a functionally equivalent Hu-B1.219
protein. Such amino acid substitutions may be made on the basis of
similarity in polarity, charge, solubility, hydrophobicity,
hydrophilicity, and/or the amphipathic nature of the residues
involved. For example, negatively charged amino acids include
aspartic acid and glutamic acid; positively charged amino acids
include lysine, histidine and arginine; amino acids with uncharged
polar head groups having similar hydrophilicity values include the
following: glycine, asparagine, glutamine, serine, threonine,
tyrosine; and amino acids with nonpolar head groups include
alanine, valine, isoleucine, leucine, phenylalanine, proline,
methionine, tryptophan.
The DNA sequences of the invention may be engineered in order to
alter an Hu-B1.219 coding sequence for a variety of ends including
but not limited to alterations which modify processing and
expression of the gene product. For example, mutations may be
introduced using techniques which are well known in the art, e.g.,
site-directed mutagenesis, to insert new restriction sites, to
alter glycosylation patterns, phosphorylation, etc.
In another embodiment of the invention, an Hu-B1.219 or a modified
Hu-B1.219 sequence may be ligated to a heterologous sequence to
encode a fusion protein. For example, for screening of peptide
libraries for inhibitors or stimulators of Hu-B1.219 activity, it
may be useful to encode a chimeric Hu-B1.219 protein expressing a
heterologous epitope that is recognized by a commercially available
antibody. A fusion protein may also be engineered to contain a
cleavage site located between a Hu-B1.219 sequence and the
heterologous protein sequence, so that the Hu-B1.219 may be cleaved
away from the heterologous moiety.
In an alternate embodiment of the invention, the coding sequence of
a Hu-B1.219 could be synthesized in whole or in part, using
chemical methods well known in the art. See, for example, Caruthers
et al., 1980, Nuc. Acids Res. Symp. Ser. 7:215-233; Crea and Horn,
180, Nuc. Acids Res. 9(10):2331; Matteucci and Caruthers, 1980,
Tetrahedron Letters 21:719; and Chow and Kempe, 1981, Nuc. Acids
Res. 9(12):2807-2817. Alternatively, the protein itself could be
produced using chemical methods to synthesize an Hu-B1.219 amino
acid sequence in whole or in part. For example, peptides can be
synthesized by solid phase techniques, cleaved from the resin, and
purified by preparative high performance liquid chromatography.
(e.g., see Creighton, 1983, Proteins Structures And Molecular
Principles, W. H. Freeman and Co., N.Y. pp. 50-60). The composition
of the synthetic peptides may be confirmed by amino acid analysis
or sequencing (e.g., the Edman degradation procedure; see
Creighton, 1983, Proteins, Structures and Molecular Principles, W.
H. Freeman and Co., N.Y., pp. 34-49).
In order to express a biologically active Hu-B1.219, the nucleotide
sequence coding for Hu-B1.219, or a functional equivalent, is
inserted into an appropriate expression vector, i.e., a vector
which contains the necessary elements for the transcription and
translation of the inserted coding sequence. The Hu-B1.219 gene
products as well as host cells or cell lines transfected or
transformed with recombinant Hu-B1.219 expression vectors can be
used for a variety of purposes. These include but are not limited
to generating antibodies (i.e., monoclonal or polyclonal) that
competitively inhibit activity of an Hu-B1.219 and neutralize its
activity; and antibodies that mimic the activity of Hu-B1.219
ligands in stimulating the receptor to transmit an intracellular
signal. Anti-Hu-B1.219 antibodies may be used in detecting and
quantifying expression of Hu-B1.219 levels in cells and
tissues.
5.3 EXPRESSION SYSTEMS
Methods which are well known to those skilled in the art can be
used to construct expression vectors containing the Hu-B1.219
coding sequence and appropriate transcriptional/translational
control signals. These methods include in vitro recombinant DNA
techniques, synthetic techniques and in vivo recombination/genetic
recombination. See, for example, the techniques described in
Sambrook et al., 1989, Molecular Cloning A Laboratory Manual, Cold
Spring Harbor Laboratory, New York and Ausubel et al., 1989,
Current Protocols in Molecular Biology, Greene Publishing
Associates and Wiley Interscience, New York.
A variety of host-expression vector systems may be utilized to
express the Hu-B1.219 coding sequence. These include but are not
limited to microorganisms such as bacteria transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression
vectors containing the Hu-B1.219 coding sequence; yeast transformed
with recombinant yeast expression vectors containing the Hu-B1.219
coding sequence; insect cell systems infected with recombinant
virus expression vectors (e.g., baculovirus) containing the
Hu-B1.219 coding sequence; plant cell systems infected with
recombinant virus expression vectors (e.g., cauliflower mosaic
virus, CaMV; tobacco mosaic virus, TMV) or transformed with
recombinant plasmid expression vectors (e.g., Ti plasmid)
containing the Hu-B1.219 coding sequence; or animal cell systems
The expression elements of these systems vary in their strength and
specificities. Depending on the host/vector system utilized, any of
a number of suitable transcription and translation elements,
including constitutive and inducible promoters, may be used in the
expression vector. For example, when cloning in bacterial systems,
inducible promoters such as pL of bacteriophage .lambda., plac,
ptrp, ptac (ptrp-lac hybrid promoter) and the like may be used;
when cloning in insect cell systems, promoters such as the
baculovirus polyhedrin promoter may be used; when cloning in plant
cell systems, promoters derived from the genome of plant cells
(e.g., heat shock promoters; the promoter for the small subunit of
RUBISCO; the promoter for the chlorophyll .alpha./.beta. binding
protein) or from plant viruses (e.g., the 35S RNA promoter of CaMV;
the coat protein promoter of TMV) may be used; when cloning in
mammalian cell systems, promoters derived from the genome of
mammalian cells (e.g., metallothionein promoter) or from mammalian
viruses (e.g., the adenovirus late promoter; the vaccinia virus
7.5K promoter) may be used; when generating cell lines that contain
multiple copies of the Hu-B1.219 DNA, SV40-, BPV- and EBV-based
vectors may be used with an appropriate selectable marker.
In bacterial systems a number of expression vectors may be
advantageously selected depending upon the use intended for the
Hu-B1.219 expressed. For example, when large quantities of
Hu-B1.219 are to be produced for the generation of antibodies or to
screen peptide libraries, vectors which direct the expression of
high levels of fusion protein products that are readily purified
may be desirable. Such vectors include but are not limited to the
E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J.
2:1791), in which the Hu-B1.219 coding sequence may be ligated into
the vector in frame with the lac Z coding region so that a hybrid
AS-lac Z protein is produced; pIN vectors (Inouye & Inouye,
1985, Nucleic acids Res. 13:3101-3109; Van Heeke & Schuster,
1989, J. Biol. Chem. 264:5503-5509); and the like. pGEX vectors may
also be used to express foreign polypeptides as fusion proteins
with glutathione S-transferase (GST). In general, such fusion
proteins are soluble and can easily be purified from lysed cells by
adsorption to glutathione-agarose beads followed by elution in the
presence of free glutathione. The pGEX vectors are designed to
include thrombin or factor Xa protease cleavage sites so that the
cloned polypeptide of interest can be released from the GST
moiety.
In yeast, a number of vectors containing constitutive or inducible
promoters may be used. For a review see, Current Protocols in
Molecular Biology, Vol. 2, 1988, Ed. Ausubel et al., Greene
Publish. Assoc. & Wiley Interscience, Ch. 13; Grant et al.,
1987, Expression and Secretion Vectors for Yeast, in Methods in
Enzymology, Eds. Wu & Grossman, 1987, Acad. Press, New York,
Vol. 153, pp. 516-544; Glover, 1986, DNA Cloning, Vol. II, IRL
Press, Wash., D.C., Ch. 3; and Bitter, 1987, Heterologous Gene
Expression in Yeast, Methods in Enzymology, Eds. Berger &
Kimmel, Acad. Press, N.Y., Vol. 152, pp. 673-684; and The Molecular
Biology of the Yeast Saccharomyces, 1982, Eds. Strathern et al.,
Cold Spring Harbor Press, Vols. I and II.
In cases where plant expression vectors are used, the expression of
the Hu-B1.219 coding sequence may be driven by any of a number of
promoters. For example, viral promoters such as the 35S RNA and 19S
RNA promoters of CaMV (Brisson et al., 1984, Nature 310:511-514),
or the coat protein promoter of TMV (Takamatsu et al., 1987, EMBO
J. 6:307-311) may be used; alternatively, plant promoters such as
the small subunit of RUBISCO (Coruzzi et al., 1984, EMBO J.
3:1671-1680; Broglie et al., 1984, Science 224:838-843); or heat
shock promoters, e.g., soybean hsp17.5-E or hsp17.3-B (Gurley et
al., 1986, Mol. Cell. Biol. 6:559-565) may be used. These
constructs can be introduced into plant cells using Ti plasmids, Ri
plasmids, plant virus vectors, direct DNA transformation,
microinjection, electroporation, etc. For reviews of such
techniques see, for example, Weissbach & Weissbach, 1988,
Methods for Plant Molecular Biology, Academic Press, N.Y., Section
VIII, pp. 421-463; and Grierson & Corey, 1988, Plant Molecular
Biology, 2d Ed., Blackie, London, Ch. 7-9.
An alternative expression system which could be used to express
Hu-B1.219 is an insect system. In one such system, Autographa
californica nuclear polyhidrosis virus (AcNPV) is used as a vector
to express foreign genes. The virus grows in Spodoptera frugiperda
cells. The Hu-B1.219 coding sequence may be cloned into
non-essential regions (for example the polyhedrin gene) of the
virus and placed under control of an AcNPV promoter (for example
the polyhedrin promoter). Successful insertion of the Hu-B1.219
coding sequence will result in inactivation of the polyhedrin gene
and production of non-occluded recombinant virus (i.e., virus
lacking the proteinaceous coat coded for by the polyhedrin gene).
These recombinant viruses are then used to infect Spodoptera
frugiperda cells in which the inserted gene is expressed. (e.g.,
see Smith et al., 1983, J. Viol. 46:584; Smith, U.S. Pat. No.
4,215,051).
In mammalian host cells, a number of viral based expression systems
may be utilized. In cases where an adenovirus is used as an
expression vector, the Hu-B1.219 coding sequence may be ligated to
an adenovirus transcription/translation control complex, e.g., the
late promoter and tripartite leader sequence. This chimeric gene
may then be inserted in the adenovirus genome by in vitro or in
vivo recombination. Insertion in a non-essential region of the
viral genome (e.g., region E1 or E3) will result in a recombinant
virus that is viable and capable of expressing Hu-B1.219 in
infected hosts. (e.g., See Logan & Shenk, 1984, Proc. Natl.
Acad. Sci. U.S.A. 81:3655-3659). Alternatively, the vaccinia 7.5K
promoter may be used. (See, e.g., Mackett et al., 1982, Proc. Natl.
Acad. Sci. U.S.A. 79:7415-7419; Mackett et al., 1984, J. Virol.
49:857-864; Panicali et al., 1982, Proc. Natl. Acad. Sci. U.S.A.
79:4927-4931).
Specific initiation signals may also be required for efficient
translation of inserted Hu-B1.219 coding sequences. These signals
include the ATG initiation codon and adjacent sequences. In cases
where the entire Hu-B1.219 gene, including its own initiation codon
and adjacent sequences, is inserted into the appropriate expression
vector, no additional translational control signals may be needed.
However, in cases where only a portion of the Hu-B1.219 coding
sequence is inserted, exogenous translational control signals,
including the ATG initiation codon, must be provided. Furthermore,
the initiation codon must be in phase with the reading frame of the
Hu-B1.219 coding sequence to ensure translation of the entire
insert. These exogenous translational control signals and
initiation codons can be of a variety of origins, both natural and
synthetic. The efficiency of expression may be enhanced by the
inclusion of appropriate transcription enhancer elements,
transcription terminators, etc. (see Bittner et al., 1987, Methods
in Enzymol. 153:516-544).
In addition, a host cell strain may be chosen which modulates the
expression of the inserted sequences, or modifies and processes the
gene product in the specific fashion desired. Such modifications
(e.g., glycosylation) and processing (e.g., cleavage) of protein
products may be important for the function of the protein. The
presence of several consensus N-glycosylation sites in the
Hu-B1.219 extracellular domain support the possibility that proper
modification may be important for Hu-B1.219 function. Different
host cells have characteristic and specific mechanisms for the
post-translational processing and modification of proteins.
Appropriate cell lines or host systems can be chosen to ensure the
correct modification and processing of the foreign protein
expressed. To this end, eukaryotic host cells which possess the
cellular machinery for proper processing of the primary transcript,
glycosylation, and phosphorylation of the gene product may be used.
Such mammalian host cells include but are not limited to CHO, VERO,
BHK, HeLa, COS, MDCK, 293, WI38, etc.
For long-term, high-yield production of recombinant proteins,
stable expression is preferred. For example, cell lines which
stably express the Hu-B1.219 may be engineered. Rather than using
expression vectors which contain viral origins of replication, host
cells can be transformed with the Hu-B1.219 DNA controlled by
appropriate expression control elements (e.g., promoter, enhancer,
sequences, transcription terminators, polyadenylation sites, etc.),
and a selectable marker. Following the introduction of foreign DNA,
engineered cells may be allowed to grow for 1-2 days in an enriched
media, and then are switched to a selective media. The selectable
marker in the recombinant plasmid confers resistance to the
selection and allows cells to stably integrate the plasmid into
their chromosomes and grow to form foci which in turn can be cloned
and expanded into cell lines. This method may advantageously be
used to engineer cell lines which express the Hu-B1.219 on the cell
surface. Such engineered cell lines are particularly useful in
screening for ligands or drugs that affect Hu-B1.219 function.
A number of selection systems may be used, including but not
limited to the herpes simplex virus thymidine kinase (Wigler, et
al., 1977, Cell 11:223), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc.
Natl. Acad. Sci. U.S.A. 48:2026), and adenine
phosphoribosyltransferase (Lowy, et al., 1980, Cell 22:817) genes
can be employed in tk.sup.-, hgprt.sup.- or aprt.sup.- cells,
respectively. Also, antimetabolite resistance can be used as the
basis of selection for dhfr, which confers resistance to
methotrexate (Wigler, et al., 1980, Natl. Acad. Sci. U.S.A.
77:3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. U.S.A.
78:1527); gpt, which confers resistance to mycophenolic acid
(Mulligan & Berg, 1981), Proc. Natl. Acad. Sci. U.S.A.
78:2072); neo, which confers resistance to the aminoglycoside G-418
(Colberre-Garapin, et al., 1981, J. Mol. Biol. 150:1); and hygro,
which confers resistance to hygromycin (Santerre, et al., 1984,
Gene 30:147) genes. Recently, additional selectable genes have been
described, namely trpB, which allows cells to utilize indole in
place of tryptophan; hisD, which allows cells to utilize histinol
in place of histidine (Hartman & Mulligan, 1988, Proc. Natl.
Acad. Sci. U.S.A. 85:8047); and ODC (ornithine decarboxylase) which
confers resistance to the ornithine decarboxylase inhibitor,
2-(difluoromethyl)-DL-ornithine, DFMO (McConlogue L., 1987, In:
Current Communications in Molecular Biology, Cold Spring Harbor
Laboratory ed.).
5.4 IDENTIFICATION OF CELLS THAT EXPRESS Hu-B1.219
The host cells which contain the coding sequence and which express
the biologically active gene product may be identified by at least
four general approaches; (a) DNA-DNA or DNA-RNA hybridization; (b)
the presence or absence of "marker" gene functions; (c) assessing
the level of transcription as measured by the expression of
Hu-B1.219 mRNA transcripts in the host cell; and (d) detection of
the gene product as measured by immunoassay or by its biological
activity. Prior to the identification of gene expression, the host
cells may be first mutagenized in an effort to increase the level
of expression of Hu-B1.219, especially in cell lines that produce
low amounts of Hu-B1.219.
In the first approach, the presence of the Hu-B1.219 coding
sequence inserted in the expression vector can be detected by
DNA-DNA or DNA-RNA hybridization using probes comprising nucleotide
sequences that are homologous to the Hu-B1.219 coding sequence,
respectively, or portions or derivatives thereof.
In the second approach, the recombinant expression vector/host
system can be identified and selected based upon the presence or
absence of certain "marker" gene functions (e.g., thymidine kinase
activity, resistance to antibiotics, resistance to methotrexate,
transformation phenotype, occlusion body formation in baculovirus,
etc.). For example, if the Hu-B1.219 coding sequence is inserted
within a marker gene sequence of the vector, recombinants
containing the Hu-B1.219 coding sequence can be identified by the
absence of the marker gene function. Alternatively, a marker gene
can be placed in tandem with the Hu-B1.219 sequence under the
control of the same or different promoter used to control the
expression of the Hu-B1.219 coding sequence. Expression of the
marker in response to induction or selection indicates expression
of the Hu-B1.219 coding sequence.
In the third approach, transcriptional activity for the Hu-B1.219
coding region can be assessed by hybridization assays. For example,
RNA can be isolated and analyzed by Northern blot using a probe
homologous to the Hu-B1.219 coding sequence or particular portions
thereof. Alternatively, total nucleic acids of the host cell may be
extracted and assayed for hybridization to such probes.
In the fourth approach, the expression of the Hu-B1.219 protein
product can be assessed immunologically, for example by Western
blots, immunoassays such as radioimmuno-precipitation,
enzyme-linked immunoassays and the like.
5.5 USES OF Hu-B1.219 ENGINEERED CELL LINES
In an embodiment of the invention, the Hu-B1.219 receptor and/or
cell lines that express the Hu-B1.219 receptor may be used to
screen for antibodies, peptides, or other ligands that act as
agonists or antagonists of the Hu-B1.219 receptor. For example,
anti-Hu-B1.219 antibodies may be used to inhibit or stimulate
receptor Hu-B1.219 function. Alternatively, be screening of peptide
libraries with recombinantly expressed soluble Hu-B1.219 protein or
cell lines expressing Hu-B1.219 protein may be useful for
identification of therapeutic molecules that function by inhibiting
or stimulating the biological activity of Hu-B1.219. The uses of
the Hu-B1.219 receptor and engineered cell lines, described in the
subsections below, may be employed equally well for other members
of the HR family.
In an embodiment of the invention, engineered cell lines which
express most of the Hu-B1.219 coding region or its ligand binding
domain or its ligand binding domain fused to another molecule such
as the immunoglobulin constant region (Hallenbaugh and Aruffo,
1992, Current Protocols in Immunology, Unit 10.19; Aruffo et al.,
1990, Cell 61:1303) may be utilized to produce a soluble receptor
to screen and identify ligand antagonists as well as agonists. The
soluble Hu-B1.219 protein or fusion protein may be used to identify
a ligand in binding assays, affinity chromatography,
immunoprecipitation, Western blot, and the like. Alternatively, the
ligand binding domain of Hu-B1.219 may be fused to the coding
sequence of the epidermal growth factor receptor transmembrane and
cytoplasmic regions. This approach provides for the use of the
epidermal growth factor receptor signal transduction pathway as a
means for detecting ligands that bind to Hu-B1.219 in a manner
capable of triggering an intracellular signal. Synthetic compounds,
natural products, and other sources of potentially biologically
active materials can be screened in a number of ways.
Random peptide libraries consisting of all possible combinations of
amino acids attached to a solid phase support may be used to
identify peptides that are able to bind to the ligand binding site
of a given receptor or other functional domains of a receptor such
as kinase domains (Lam, K. S. et al., 1991, Nature 354: 82-84). The
screening of peptide libraries may have therapeutic value in the
discovery of pharmaceutical agents that stimulate or inhibit the
biological activity of receptors through their interactions with
the given receptor.
Identification of molecules that are able to bind to the Hu-B1.219
may be accomplished by screening a peptide library with recombinant
soluble Hu-B1.219 protein. Methods for expression and purification
of Hu-B1.219 are described in Section 5.2, supra, and may be used
to express recombinant full length Hu-B1.219 or fragments of
Hu-B1.219 depending on the functional domains of interest. For
example, the cytoplasmic and extracellular ligand binding domains
of Hu-B1.219 may be separately expressed and used to screen peptide
libraries.
To identify and isolate the peptide/solid phase support that
interacts and forms a complex with Hu-B1.219, it is necessary to
label or "tag" the Hu-B1.219 molecule. The Hu-B1.219 protein may be
conjugated to enzymes such as alkaline phosphatase or horseradish
peroxidase or to other reagents such as fluorescent labels which
may include fluorescein isothiocyanate (FITC), phycoerythrin (PE)
or rhodamine. Conjugation of any given label to Hu-B1.219 may be
performed using techniques that are routine in the art.
Alternatively, Hu-B1.219 expression vectors may be engineered to
express a chimeric Hu-B1.219 protein containing an epitope for
which a commercially available antibody exist. The epitope specific
antibody may be tagged using methods well known in the art
including labeling with enzymes, fluorescent dyes or colored or
magnetic beads.
The "tagged" Hu-B1.219 conjugate is incubated with the random
peptide library for 30 minutes to one hour at 22.degree. C. to
allow complex formation between Hu-B1.219 and peptide species
within the library. The library is then washed to remove any
unbound Hu-B1.219 protein. If Hu-B1.219 has been conjugated to
alkaline phosphatase or horseradish peroxidase the whole library is
poured into a petri dish containing substrates for either alkaline
phosphatase or peroxidase, for example, 5-bromo-4-chloro-3-indoyl
phosphate (BCIP) or 3,3',4,"-diaminobenzidine (DAB), respectively.
After incubating for several minutes, the peptide/solid
phase-Hu-B1.219 complex changes color, and can be easily identified
and isolated physically under a dissecting microscope with a
micromanipulator. If a fluorescent tagged Hu-B1.219 molecule has
been used, complexes may be isolated by fluorescent activated
sorting. If a chimeric Hu-B1.219 protein expressing a heterologous
epitope has been used, detection of the peptide/Hu-B1.219 complex
may be accomplished by using a labeled epitope specific antibody.
Once isolated, the identity of the peptide attached to the solid
phase support may be determined by peptide sequencing.
In addition to using soluble Hu-B1.219 molecules, in another
embodiment, it is possible to detect peptides that bind to cell
surface receptors using intact cells. The use of intact cells is
preferred for use with receptors that are multi-subunits or labile
or with receptors that require the lipid domain of the cell
membrane to be functional. Methods for generating cell lines
expressing Hu-B1.219 are described in Section 5.3. The cells used
in this technique may be either live or fixed cells. The cells may
be incubated with the random peptide library and bind to certain
peptides in the library to form a "rosette" between the target
cells and the relevant solid phase support/peptide. The rosette can
thereafter be isolated by differential centrifugation or removed
physically under a dissecting microscope.
As an alternative to whole cell assays for membrane bound receptors
or receptors that require the lipid domain of the cell membrane to
be functional, the receptor molecules can be reconstituted into
liposomes where label or "tag" can be attached.
Various procedures known in the art may be used for the production
of antibodies to epitopes of the recombinantly produced Hu-B1.219
receptor. Such antibodies include but are not limited to
polyclonal, monoclonal, chimeric, single chain, Fab fragments and
fragments produced by an Fab expression library. Neutralizing
antibodies i.e., those which compete for the ligand binding site of
the receptor are especially preferred for diagnostics and
therapeutics.
Monoclonal antibodies that bind Hu-B1.219 may be radioactively
labeled allowing one to follow their location and distribution in
the body after injection. Radioisotope tagged antibodies may be
used as a non-invasive diagnostic tool for imaging de novo cells of
tumors and metastases.
Immunotoxins may also be designed which target cytotoxic agents to
specific sites in the body. For example, high affinity Hu-B1.219
specific monoclonal antibodies may be covalently complexed to
bacterial or plant toxins, such as diphtheria toxin, abrin or
ricin. A general method of preparation of antibody/hybrid molecules
may involve use of thiol-crosslinking reagents such as SPDP, which
attack the primary amino groups on the antibody and by disulfide
exchange, attach the toxin to the antibody. The hybrid antibodies
may be used to specifically eliminate Hu-B1.219 expressing tumor
cells.
For the production of antibodies, various host animals may be
immunized by injection with the Hu-B1.219 protein including but not
limited to rabbits, mice, rats, etc. Various adjuvants may be used
to increase the immunological response, depending on the host
species, including but not limited to Freund's (complete and
incomplete), mineral gels such as aluminum hydroxide, surface
active substances such as lysolecithin, pluronic polyols,
polyanions, peptides, oil emulsions, keyhole limpet hemocyanin,
dinitrophenol, and potentially useful human adjuvants such as BCG
(bacilli Calmette-Guerin) and Corynebacterium parvum.
Monoclonal antibodies to Hu-B1.219 may be prepared by using any
technique which provides for the production of antibody molecules
by continuous cell lines in culture. These include but are not
limited to the hybridoma technique originally described by Kohler
and Milstein, (Nature, 1975, 256:495-497), the human B-cell
hybridoma technique (Kosbor et al., 1983, Immunology Today, 4:72;
Cote et al., 1983, Proc. Natl. Acad. Sci., 80:2026-2030) and the
EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). In addition,
techniques developed for the production of "chimeric antibodies"
(Morrison et al., 1984, Proc. Natl. Acad. Sci., 81:6851-6855;
Neuberger et al., 1984, Nature, 312:604-608; Takeda et al., 1985,
Nature, 314:452-454) by splicing the genes from a mouse antibody
molecule of appropriate antigen specificity together with genes
from a human antibody molecule of appropriate biological activity
can be used. Alternatively, techniques described for the production
of single chain antibodies (U.S. Pat. No. 4,946,778) can be adapted
to produce Hu-B1.219-specific single chain antibodies.
Antibody fragments which contain specific binding sites of
Hu-B1.219 may be generated by known techniques. For example, such
fragments include but are not limited to: the F(ab').sub.2
fragments which can be produced by pepsin digestion of the antibody
molecule and the Fab fragments which can be generated by reducing
the disulfide bridges of the F(ab').sub.2 fragments. Alternatively,
Fab expression libraries may be constructed (Huse et al., 1989,
Science, 246:1275-1281) to allow rapid and easy identification of
monoclonal Fab fragments with the desired specificity to
Hu-B1.219.
5.6 USES OF Hu-B1.219 POLYNUCLEOTIDE
An Hu-B1.219 polynucleotide may be used for diagnostic and/or
therapeutic purposes. For diagnostic purposes, an Hu-B1.219
polynucleotide may be used to detect Hu-B1.219 gene expression or
aberrant Hu-B1.219 gene expression in disease states, e.g., chronic
myelogenous leukemia. Included in the scope of the invention are
oligonucleotide sequences, that include antisense RNA and DNA
molecules and ribozymes, that function to inhibit translation of an
Hu-B1.219.
5.6.1. DIAGNOSTIC USES OF AN Hu-B1.219 POLYNUCLEOTIDE
An Hu-B1.219 polynucleotide may have a number of uses for the
diagnosis of diseases resulting from aberrant expression of
Hu-B1.219. For example, the Hu-B1.219 DNA sequence may be used in
hybridization assays of biopsies or autopsies to diagnose
abnormalities of Hu-B1.219 expression; e.g., Southern or Northern
analysis, including in situ hybridization assays. Such techniques
are well known in the art, and are in fact the basis of many
commercially available diagnostic kits.
5.6.2. THERAPEUTIC USES OF AN Hu-B1.219 POLYNUCLEOTIDE
An Hu-B1.219 polynucleotide may be useful in the treatment of
various abnormal conditions. By introducing gene sequences into
cells, gene therapy can be used to treat conditions in which the
cells do not proliferate or differentiate normally due to
underexpression of normal Hu-B1.219 or expression of
abnormal/inactive Hu-B1.219. In some instances, the polynucleotide
encoding an Hu-B1.219 is intended to replace or act in the place of
a functionally deficient endogenous gene. Alternatively, abnormal
conditions characterized by overproliferation can be treated using
the gene therapy techniques described below.
Abnormal cellular proliferation is an important component of a
variety of disease states. Recombinant gene therapy vectors, such
as viral vectors, may be engineered to express variant, signalling
incompetent forms of Hu-B1.219 which may be used to inhibit the
activity of the naturally occurring endogenous Hu-B1.219. A
signalling incompetent form may be, for example, a truncated form
of the protein that is lacking all or part of its signal
transduction domain. Such a truncated form may participate in
normal binding to a substrate but lack signal transduction
activity. Thus recombinant gene therapy vectors may be used
therapeutically for treatment of diseases resulting from aberrant
expression or activity of an Hu-B1.219. Accordingly, the invention
provides a method of inhibiting the effects of signal transduction
by an endogenous Hu-B1.219 protein in a cell comprising delivering
a DNA molecule encoding a signalling incompetent form of the
Hu-B1.219 protein to the cell so that the signalling incompetent
Hu-B1.219 protein is produced in the cell and competes with the
endogenous Hu-B1.219 protein for access to molecules in the
Hu-B1.219 protein signalling pathway which activate or are
activated by the endogenous Hu-B1.219 protein.
Expression vectors derived from viruses such as retroviruses,
vaccinia virus, adeno-associated virus, herpes viruses, or bovine
papilloma virus, may be used for delivery of recombinant Hu-B1.219
into the targeted cell population. Methods which are well known to
those skilled in the art can be used to construct recombinant viral
vectors containing an Hu-B1.219 polynucleotide sequence. See, for
example, the techniques described in Maniatis et al., 1989,
Molecular Cloning A Laboratory Manual, Cold Spring Harbor
Laboratory, N.Y. and Ausubel et al., 1989, Current Protocols in
Molecular Biology, Greene Publishing Associates and Wiley
Interscience, N.Y. Alternatively, recombinant Hu-B1.219 molecules
can be reconstituted into liposomes for delivery to target
cells.
Oligonucleotide sequences, that include anti-sense RNA and DNA
molecules and ribozymes that function to inhibit the translation of
an Hu-B1.219 mRNA are within the scope of the invention. Anti-sense
RNA and DNA molecules act to directly block the translation of mRNA
by binding to targeted mRNA and preventing protein translation. In
regard to antisense DNA, oligodeoxyribonucleotides derived from the
translation initiation site, e.g., between -10 and +10 regions of
an Hu-B1.219 nucleotide sequence, are preferred.
Ribozymes are enzymatic RNA molecules capable of catalyzing the
specific cleavage of RNA. The mechanism of ribozyme action involves
sequence specific hybridization of the ribozyme molecule to
complementary target RNA, followed by endonucleolytic cleavage.
Within the scope of the invention are engineered hammerhead motif
ribozyme molecules that specifically and efficiently catalyze
endonucleolytic cleavage of Hu-B1.219 RNA sequences.
Specific ribozyme cleavage sites within any potential RNA target
are initially identified by scanning the target molecule for
ribozyme cleavage sites which include the following sequences, GUA,
GUU and GUC. Once identified, short RNA sequences of between 15 and
20 ribonucleotides corresponding to the region of the target gene
containing the cleavage site may be evaluated for predicted
structural features such as secondary structure that may render the
oligonucleotide sequence unsuitable. The suitability of candidate
targets may also be evaluated by testing their accessibility to
hybridization with complementary oligonucleotides, using
ribonuclease protection assays.
Both anti-sense RNA and DNA molecules and ribozymes of the
invention may be prepared by any method known in the art for the
synthesis of RNA molecules. These include techniques for chemically
synthesizing oligodeoxyribonucleotides well known in the art such
as for example solid phase phosphoramidite chemical synthesis.
Alternatively, RNA molecules may be generated by in vitro and in
vivo transcription of DNA sequences encoding the antisense RNA
molecule. Such DNA sequences may be incorporated into a wide
variety of vectors which incorporate suitable RNA polymerase
promoters such as the T7 or SP6 polymerase promoters.
Alternatively, antisense cDNA constructs that synthesize antisense
RNA constitutively or inducibly, depending on the promoter used,
can be introduced stably into cell lines.
Various modifications to the DNA molecules may be introduced as a
means of increasing intracellular stability and half-life. Possible
modifications include but are not limited to the addition of
flanking sequences of ribo- or deoxy- nucleotides to the 5' and/or
3' ends of the molecule or the use of phosphorothioate or 2'
O-methyl rather than phosphodiesterase linkages within the
oligodeoxyribonucleotide backbone.
Methods for introducing polynucleotides into such cells or tissue
include methods for in vitro introduction of polynucleotides such
as the insertion of naked polynucleotide, i.e., by injection into
tissue, the introduction of an Hu-B1.219 polynucleotide in a cell
ex vivo, i.e., for use in autologous cell therapy, the use of a
vector such as a virus, retrovirus, phage or plasmid, etc. or
techniques such as electroporation which may be used in vivo or ex
vivo.
6. EXAMPLE: MOLECULAR CLONING OF A NOVEL HEMATOPOIETIN RECEPTOR
COMPLEMENTARY DNA
6.1 MATERIALS AND METHODS
6.1.1 NORTHERN BLOT ANALYSIS
In order to study the expression of the Hu-B1.219 gene, Northern
blots containing RNA obtained from a variety of human tissues
(Clontech, Palo Alto, Calif.) was probed with a radiolabeled 530 bp
DNA probe corresponding to nucleotides 143 through 672 (see FIGS.
2A-2D). Briefly, the blots were prehybridized at 42.degree. C. for
3-6 hours in a solution containing 5.times.SSPE,
10.times.Denhardt's solution, 100 ug/ml freshly denatured, sheared
salmon sperm DNA, 50% formamide (freshly deionized), and 2% SDS.
The radiolabeled probe was heat denatured and added to the
prehybridization mix and allowed to hybridize at 42.degree. C. for
18-24 hours with constant shaking. The blots were rinsed in
2.times.SSC, 0.05% SDS several times at room temperature before
being transferred to a wash solution containing 0.1.times.SSC, 0.1%
SDS and agitated at 50.degree. C. for 40 minutes. The blots were
then covered with plastic wrap, mounted on Whatman paper and
exposed to x-ray film at -70.degree. C. using an intensifying
screen.
6.2 RESULTS
A number of cDNA clones were isolated from a human fetal liver cDNA
library (Clontech, Palo Alto, Calif.), and DNA sequences from
several clones were determined. Several of these clones (Hu-B1.219
#4, #33, #34) contained overlapping sequences, which were then
compiled into a contiguous nucleotide sequence. Both the cDNA and
predicted protein sequence from this cDNA fragment are shown in
FIGS. 2A-2D. This partial cDNA clone contains two FN III domains
including the presence of "WS box", which are characteristic of
genes of the HR family. Thus, this cDNA fragment represents a novel
member of the HR gene family, herein referred to as Hu-B1.219
(Table 1).
Various human tissue RNA was probed with a radiolabelled Hu-B1.219
fragment corresponding to nucleotide numbers from 143 to 672 as
disclosed in FIGS. 2A-2D for Northern blot analyses. Two different
size mRNAs were detected. This result suggests that there may be
another homologous gene or there is alternative splicing of a
single RNA transcript. Hu-B1.219 expression was by far the
strongest in human fetal tissues, particularly the liver and lung.
Trace levels were found in several adult tissues. Interestingly, a
chronic myelogenous leukemia cell line, K562, was strongly positive
for its expression, while some expression was also detected in A549
cells, a lung carcinoma cell line (Table 2).
Taken together, the data indicates that the Hu-B1.219 cDNA clone
represents a new member of the hematopoietin receptor family. A
summary of the data that supports this conclusion is as
follows:
1. The Hu-B1.219 DNA and protein sequences do not fully match any
known sequences in the corresponding computer data bases.
2. Hu-B1.219 shares certain DNA sequence homology with the IL-6R
and IL-4R.
3. It shares certain protein homology with G-CSFR, IL-6R, IL-3R
beta chain, gp130, IL-12R, and LIFR.
4. It contains two "WS box" motifs with the correct spacing of
conserved amino acids in both FN III domains (see FIG. 3).
5. It contains an amphipathic sequence in block 3 of both FN III
domains (see FIG. 4).
6. It contains alternating hydrophobic and basic amino acids in
block 6 of both FN III domains (see FIG. 5).
7. It contains conserved cysteines in these cysteine rich regions
upstream of both FN III domains.
8. It was originally cloned from a hematopoietic tissue, fetal
liver.
9. It is expressed by certain fetal tissues.
7. Deposit of Microorganisms
The following organisms were deposited with the American Type
Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md.
20852.
Strain Designation Accession No.
HUB1.219, #1
HUB1.219, #4
HUB1.219, #8
HUB1.219, #33
HUB1.219, #34
HUB1.219, #36
The present invention is not to be limited in scope by the
exemplified embodiments, which are intended as illustrations of
individual aspects of the invention. Indeed, various modifications
for the invention in addition to those shown and described herein
will become apparent to those skilled in the art from the foregoing
description and accompanying drawings. Such modifications are
intended to fall within the scope of the appended claims.
All publications cited herein are incorporated by reference in
their entirety.
TABLE 1 ______________________________________ Cytokine Receptor
Gene FN III Domain Sizes (bp) Gene Human Mouse Rat
______________________________________ Hu-B1.219(5') 273
Hu-B1.219(3') 282 IL-2R.beta. 291 288 291 IL-2R.gamma. 273
IL-3R.alpha. 246 252 IL-3R.beta.Aic2a 306 and 273 IL-3R.beta.Aic2b
306 and 282 303 and 276 IL-4R 294 291 IL-5R.alpha. 276 273 IL-6R
288 285 gp130 288 291 288 IL-7R 294 IL-9R 321 321 mpl 270 G-CSFR
300 297 GM-CSFR 288 CNTFR 282 285 PRLR 288 EPOR 288 285 288 LIFR-1
321 and 297 ______________________________________
TABLE 2 ______________________________________ SUMMARY OF NORTHERN
BLOT ANALYSIS OF Hu-B1.219 GENE EXPRESSION Tissue/cell line
Expression ______________________________________ HUMAN: fetal
brain - lung +++ liver +++++ kidney + adult heart + brain -
placenta +/- lung + liver + skeletal muscle - kidney +/- pancreas -
spleen - thymus - prostate - testis - ovary + small intestine -
colon - peripheral blood - leukocytes cancer HL-60 - HeLa - K-562
+++ MOLT-4 - Raji - SW480 - A549 + G361 -
______________________________________
__________________________________________________________________________
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 15 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 5 amino acids (B) TYPE: amino acid (C)
STRANDEDNESS: (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: TrpSerXaaTrpSer 15 (2)
INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 1707 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA (ix)
FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1707 (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:2:
ACAGTAAATTCTTTAGTTTTTCAACCAATAGATGCAAACTGGAACATA48
ThrValAsnSerLeuValPheGlnProIleAspAlaAsnTrpAsnIle 151015
CAGTGCTGGCTAAAAGGAGACTTAAAATTATTCATCTGTTATGTGGAG96
GlnCysTrpLeuLysGlyAspLeuLysLeuPheIleCysTyrValGlu 202530
TCATTATTTAAGAATCTAGTCAAGAATTATAACTATAAGGTCCATCTT144
SerLeuPheLysAsnLeuValLysAsnTyrAsnTyrLysValHisLeu 354045
TTATATGTTCTGCCTGAAGTGTTAGAAGATTCACCTCTGGTTCCCCAA192
LeuTyrValLeuProGluValLeuGluAspSerProLeuValProGln 505560
AAAGGCAGTTTTCAGATGGTTCACTGCAATTGCAGTGTTCATGAATGT240
LysGlySerPheGlnMetValHisCysAsnCysSerValHisGluCys 65707580
TGTGAATGTCTTGTGCCTGTGCCAACAGCCAAACTCAACGACACTCTC288
CysGluCysLeuValProValProThrAlaLysLeuAsnAspThrLeu 859095
CTTATGTGTTTGAAAATCACATCTGGTGGAGTAATTTTCCGGTCACCT336
LeuMetCysLeuLysIleThrSerGlyGlyValIlePheArgSerPro 100105110
CTAATGTCAGTTCAGCCCATAAATATGGTGAAGCCTGATCCACCATTA384
LeuMetSerValGlnProIleAsnMetValLysProAspProProLeu 115120125
GGTTTGCATATGGAAATCACAGATGATGGTAATTTAAAGATTTCTTGG432
GlyLeuHisMetGluIleThrAspAspGlyAsnLeuLysIleSerTrp 130135140
TCCAGCCCACCATTGGTACCATTTCCACTTCAATATCAAGTGAAATAT480
SerSerProProLeuValProPheProLeuGlnTyrGlnValLysTyr 145150155160
TCAGAGAATTCTACAACAGTTATCAGAGAAGCTGACAAGATTGTCTCA528
SerGluAsnSerThrThrValIleArgGluAlaAspLysIleValSer 165170175
GCTACATCCCTGCTAGTAGACAGTATACTTCCTGGGTCTTCGTATGAG576
AlaThrSerLeuLeuValAspSerIleLeuProGlySerSerTyrGlu 180185190
GTTCAGGTGAGGGGCAAGAGACTGGATGGCCCAGGAATCTGGAGTGAC624
ValGlnValArgGlyLysArgLeuAspGlyProGlyIleTrpSerAsp 195200205
TGGAGTACTCCTCGTGTCTTTACCACACAAGATGTCATATACTTTCCA672
TrpSerThrProArgValPheThrThrGlnAspValIleTyrPhePro 210215220
CCTAAAATTCTGACAAGTGTTGGGTCTAATGTTTCTTTTCACTGCATC720
ProLysIleLeuThrSerValGlySerAsnValSerPheHisCysIle 225230235240
TATAAGAAGGAAAACAAGATTGTTCCCTCAAAAGAGATTGTTTGGTGG768
TyrLysLysGluAsnLysIleValProSerLysGluIleValTrpTrp 245250255
ATGAATTTAGCTGAGAAAATTCCTCAAAGCCAGTATGATGTTGTGAGT816
MetAsnLeuAlaGluLysIleProGlnSerGlnTyrAspValValSer 260265270
GATCATGTTAGCAAAGTTACTTTTTTCAATCTGAATGAAACCAAACCT864
AspHisValSerLysValThrPhePheAsnLeuAsnGluThrLysPro 275280285
CGAGGAAAGTTTACCTATGATGCAGTGTACTGCTGCAATGAACATGAA912
ArgGlyLysPheThrTyrAspAlaValTyrCysCysAsnGluHisGlu 290295300
TGCCATCATCGCTATGCTGAATTATATGTGATTGATGTCAATATCAAT960
CysHisHisArgTyrAlaGluLeuTyrValIleAspValAsnIleAsn 305310315320
ATCTCATGTGAAACTGATGGGTACTTAACTAAAATGACTTGCAGATGG1008
IleSerCysGluThrAspGlyTyrLeuThrLysMetThrCysArgTrp 325330335
TCAACCAGTACAATCCAGTCACTTGCGGAAAGCACTTTGCAATTGAGG1056
SerThrSerThrIleGlnSerLeuAlaGluSerThrLeuGlnLeuArg 340345350
TATCATAGGAGCAGCCTTTACTGTTCTGATATTCCATCTATTCATCCC1104
TyrHisArgSerSerLeuTyrCysSerAspIleProSerIleHisPro 355360365
ATATCTGAGCCCAAAGATTGCTATTTGCAGAGTGATGGTTTTTATGAA1152
IleSerGluProLysAspCysTyrLeuGlnSerAspGlyPheTyrGlu 370375380
TGCATTTTCCAGCCAATCTTCCTATTATCTGGCTACACAATGTGGATT1200
CysIlePheGlnProIlePheLeuLeuSerGlyTyrThrMetTrpIle 385390395400
AGGATCAATCACTCTCTAGGTTCACTTGACTCTCCACCAACATGTGTC1248
ArgIleAsnHisSerLeuGlySerLeuAspSerProProThrCysVal 405410415
CTTCCTGATTCTGTGGTGAAGCCACTGCCTCCATCCAGTGTGAAAGCA1296
LeuProAspSerValValLysProLeuProProSerSerValLysAla 420425430
GAAATTACTATAAACATTGGATTATTGAAAATATCTTGGGAAAAGCCA1344
GluIleThrIleAsnIleGlyLeuLeuLysIleSerTrpGluLysPro 435440445
GTCTTTCCAGAGAATAACCTTCAATTCCAGATTCGCTATGGTTTAAGT1392
ValPheProGluAsnAsnLeuGlnPheGlnIleArgTyrGlyLeuSer 450455460
GGAAAAGAAGTACAATGGAAGATGTATGAGGTTTATGATGCAAAATCA1440
GlyLysGluValGlnTrpLysMetTyrGluValTyrAspAlaLysSer 465470475480
AAATCTGTCAGTCTCCCAGTTCCAGACTTGTGTGCAGTCTATGCTGTT1488
LysSerValSerLeuProValProAspLeuCysAlaValTyrAlaVal 485490495
CAGGTGCGCTGTAAGAGGCTAGATGGACTGGGATATTGGAGTAATTGG1536
GlnValArgCysLysArgLeuAspGlyLeuGlyTyrTrpSerAsnTrp 500505510
AGCAATCCAGCCTACACAGTTGTCATGGATATAAAAGTTCCTATGAGA1584
SerAsnProAlaTyrThrValValMetAspIleLysValProMetArg 515520525
GGACCTGAATTTTGGAGAATAATTAATGGAGATACTATGAAAAAGGAG1632
GlyProGluPheTrpArgIleIleAsnGlyAspThrMetLysLysGlu 530535540
AAAAATGTCACTTTACTTTGGAAGCCCCTGATGAAAAATGACTCATTG1680
LysAsnValThrLeuLeuTrpLysProLeuMetLysAsnAspSerLeu 545550555560
TGCAGTGTTCAGAGATATGTGATAAAC1707 CysSerValGlnArgTyrValIleAsn 565 (2)
INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 569 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
ThrValAsnSerLeuValPheGlnProIleAspAlaAsnTrpAsnIle 151015
GlnCysTrpLeuLysGlyAspLeuLysLeuPheIleCysTyrValGlu 202530
SerLeuPheLysAsnLeuValLysAsnTyrAsnTyrLysValHisLeu 354045
LeuTyrValLeuProGluValLeuGluAspSerProLeuValProGln 505560
LysGlySerPheGlnMetValHisCysAsnCysSerValHisGluCys 65707580
CysGluCysLeuValProValProThrAlaLysLeuAsnAspThrLeu 859095
LeuMetCysLeuLysIleThrSerGlyGlyValIlePheArgSerPro 100105110
LeuMetSerValGlnProIleAsnMetValLysProAspProProLeu 115120125
GlyLeuHisMetGluIleThrAspAspGlyAsnLeuLysIleSerTrp 130135140
SerSerProProLeuValProPheProLeuGlnTyrGlnValLysTyr 145150155160
SerGluAsnSerThrThrValIleArgGluAlaAspLysIleValSer 165170175
AlaThrSerLeuLeuValAspSerIleLeuProGlySerSerTyrGlu 180185190
ValGlnValArgGlyLysArgLeuAspGlyProGlyIleTrpSerAsp 195200205
TrpSerThrProArgValPheThrThrGlnAspValIleTyrPhePro 210215220
ProLysIleLeuThrSerValGlySerAsnValSerPheHisCysIle 225230235240
TyrLysLysGluAsnLysIleValProSerLysGluIleValTrpTrp 245250255
MetAsnLeuAlaGluLysIleProGlnSerGlnTyrAspValValSer 260265270
AspHisValSerLysValThrPhePheAsnLeuAsnGluThrLysPro 275280285
ArgGlyLysPheThrTyrAspAlaValTyrCysCysAsnGluHisGlu 290295300
CysHisHisArgTyrAlaGluLeuTyrValIleAspValAsnIleAsn 305310315320
IleSerCysGluThrAspGlyTyrLeuThrLysMetThrCysArgTrp 325330335
SerThrSerThrIleGlnSerLeuAlaGluSerThrLeuGlnLeuArg 340345350
TyrHisArgSerSerLeuTyrCysSerAspIleProSerIleHisPro 355360365
IleSerGluProLysAspCysTyrLeuGlnSerAspGlyPheTyrGlu 370375380
CysIlePheGlnProIlePheLeuLeuSerGlyTyrThrMetTrpIle 385390395400
ArgIleAsnHisSerLeuGlySerLeuAspSerProProThrCysVal 405410415
LeuProAspSerValValLysProLeuProProSerSerValLysAla 420425430
GluIleThrIleAsnIleGlyLeuLeuLysIleSerTrpGluLysPro 435440445
ValPheProGluAsnAsnLeuGlnPheGlnIleArgTyrGlyLeuSer 450455460
GlyLysGluValGlnTrpLysMetTyrGluValTyrAspAlaLysSer 465470475480
LysSerValSerLeuProValProAspLeuCysAlaValTyrAlaVal 485490495
GlnValArgCysLysArgLeuAspGlyLeuGlyTyrTrpSerAsnTrp 500505510
SerAsnProAlaTyrThrValValMetAspIleLysValProMetArg 515520525
GlyProGluPheTrpArgIleIleAsnGlyAspThrMetLysLysGlu 530535540
LysAsnValThrLeuLeuTrpLysProLeuMetLysAsnAspSerLeu 545550555560
CysSerValGlnArgTyrValIleAsn 565 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE:
amino acid (C) STRANDEDNESS: (D) TOPOLOGY: unknown (ii) MOLECULE
TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
GluProTyrLeuGluPheGluAlaArgArgArgLeuLeu 1510 (2) INFORMATION FOR
SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino
acids (B) TYPE: amino acid (C) STRANDEDNESS: (D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
GluHisLeuValGlnTyrArgThrAspTrpAspHisSer 1510 (2) INFORMATION FOR
SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino
acids (B) TYPE: amino acid (C) STRANDEDNESS: (D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
AspHisCysPheAsnTyrGluLeuLysIleTyrAsnThr 1510 (2) INFORMATION FOR
SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino
acids (B) TYPE: amino acid (C) STRANDEDNESS: (D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
ThrThrHisIleArgTyrGluValAspValSerAlaGly
1510 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:8: ProPheProLeuGlnTyrGlnValLysTyrGlnValLys
1510 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:9: GlnPheGlnIleArgTyrGlyLeuSerGlyLysGluVal
1510 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 15 amino acids (B) TYPE: amino acid
(C) STRANDEDNESS: (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
SerThrSerTyrGluValGlnValArgValLysAlaGlnArgAsn 151015 (2)
INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: (D)
TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:11:
GlnLysArgTyrThrPheArgValArgSerArgPheAsnProLeu 151015 (2)
INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: (D)
TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:12:
LeuSerLysTyrAspValGlnValArgAlaAlaValSerSerMet 151015 (2)
INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: (D)
TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:13:
GlyThrArgTyrThrPheAlaValArgAlaArgMetAlaProSer 151015 (2)
INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: (D)
TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:14:
GlySerSerTyrGluValGlnValArgGlyLysArgLeuAspGly 151015 (2)
INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: (D)
TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:15:
CysAlaValTyrAlaValGlnValArgCysLysArgLeuAspGly 151015
__________________________________________________________________________
* * * * *