U.S. patent number 11,434,526 [Application Number 16/224,617] was granted by the patent office on 2022-09-06 for enhanced nucleic acid identification and detection.
This patent grant is currently assigned to CALIFORNIA INSTITUTE OF TECHNOLOGY. The grantee listed for this patent is CALIFORNIA INSTITUTE OF TECHNOLOGY. Invention is credited to Matthew S. Curtis, Rustem F. Ismagilov, Eugenia Khorosheva, Jesus Rodriguez Manzano, Bing Sun.
United States Patent |
11,434,526 |
Ismagilov , et al. |
September 6, 2022 |
Enhanced nucleic acid identification and detection
Abstract
The present invention relates to assays, including amplification
assays, conducted in the presence of modulators. These assays can
be used to detect the presence of particular nucleic acid
sequences. In particular, these assays can allow for genotyping or
other genetic analysis.
Inventors: |
Ismagilov; Rustem F. (Altadena,
CA), Sun; Bing (Shandong, CN), Rodriguez Manzano;
Jesus (Pasadena, CA), Khorosheva; Eugenia (South
Pasadena, CA), Curtis; Matthew S. (Pasadena, CA) |
Applicant: |
Name |
City |
State |
Country |
Type |
CALIFORNIA INSTITUTE OF TECHNOLOGY |
Pasadena |
CA |
US |
|
|
Assignee: |
CALIFORNIA INSTITUTE OF
TECHNOLOGY (Pasadena, CA)
|
Family
ID: |
1000006543313 |
Appl.
No.: |
16/224,617 |
Filed: |
December 18, 2018 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20190352705 A1 |
Nov 21, 2019 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
15030202 |
|
10196684 |
|
|
|
PCT/US2014/060977 |
Oct 16, 2014 |
|
|
|
|
61893051 |
Oct 18, 2013 |
|
|
|
|
61943784 |
Feb 24, 2014 |
|
|
|
|
61968191 |
Mar 20, 2014 |
|
|
|
|
61993183 |
May 14, 2014 |
|
|
|
|
62063293 |
Oct 13, 2014 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q
1/6844 (20130101); C12Q 1/6848 (20130101); C12Q
1/686 (20130101); C12Q 1/6851 (20130101); C12Q
1/707 (20130101); C12Q 1/6865 (20130101); C12Q
1/6844 (20130101); C12Q 2527/125 (20130101); C12Q
2565/501 (20130101); C12Q 1/6844 (20130101); C12Q
2527/125 (20130101); C12Q 2531/119 (20130101); C12Q
2565/629 (20130101) |
Current International
Class: |
C12Q
1/68 (20180101); C12Q 1/6851 (20180101); C12Q
1/686 (20180101); C12Q 1/6865 (20180101); C12Q
1/70 (20060101); C12Q 1/6848 (20180101); C12Q
1/6844 (20180101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
2371951 |
|
Oct 2011 |
|
EP |
|
3058100 |
|
Aug 2016 |
|
EP |
|
2004/009849 |
|
Jan 2004 |
|
WO |
|
2010/091111 |
|
Aug 2010 |
|
WO |
|
WO-2010091111 |
|
Aug 2010 |
|
WO |
|
2010/117620 |
|
Oct 2010 |
|
WO |
|
2011/067378 |
|
Jun 2011 |
|
WO |
|
2012/016357 |
|
Feb 2012 |
|
WO |
|
2012/109500 |
|
Aug 2012 |
|
WO |
|
2013/159116 |
|
Oct 2013 |
|
WO |
|
2014/055963 |
|
Apr 2014 |
|
WO |
|
2014/172688 |
|
Oct 2014 |
|
WO |
|
2015/009967 |
|
Jan 2015 |
|
WO |
|
2015/058008 |
|
Apr 2015 |
|
WO |
|
Other References
Joneja et al. Linear nicking endonuclease-mediated strand
displacement DNA amplification. Anal Biochem., vol. 414(1), p.
cited by examiner .
Kargar, M., et al. Loop-mediated isothermal amplification assay for
rapid detection of Hepatitis C virus. Indian J Virol., vol. 23(1),
p. 18-23, 2012. cited by examiner .
Bickle, TA., et al., "Biology of DNA Restriction", Microbial. Rev.,
Jun. 1993; vol. 57, No. 2 :434-450. 18 Pages. cited by applicant
.
Boulet, GA, et al., "Nucleic acid sequence-based amplification
assay for human papillomavirus mRNA detection and typing: evidence
for DNA amplification," J Clin Micro biol. Jul. 2010 48(7): 2524-9.
7 Pages. cited by applicant .
Chen, F., et al., "Recognition of an expanded genetic alphabet by
type-II restriction endonucleases and their application to analyze
polymerase fidelity," Nucl. Acids Res. 39 (9)3949-3961.2011. 14
Pages. cited by applicant .
Chen, F., et al., "Reconstructed evolutionary adaptive paths give
polymerases accepting reversible terminators for sequencing and SNP
detection," Proc. Natl. Acad. Sci. USAA107 (5) 1948-1953. 2010. 7
Pages. cited by applicant .
Choi, et al., "Peptide nucleic acid-based array for detecting and
genotyping human papillomaviruses," J. Clin Microbial, 2009, 47(6):
1785-1790. 7 Pages. cited by applicant .
Christian, et al., "Targeting DNA double-strand breaks with TAL
effector nucleases," Genetics186, 757-61. 2010. 14 Pages. cited by
applicant .
Communication Pursuant to Article 94(3) from Examining Division for
EP Patent Application No. 14853582.6 filed on Oct. 16, 2014, dated
Mar. 12, 2020. 6 pages. cited by applicant .
Communication Pursuant to Article 94(3) from Examining Division for
EP Patent Application No. 14853582.6 filed on Oct. 16, 2014, dated
Mar. 20, 2019. 7 pages. cited by applicant .
Cong, L., et al., "Multiplex genome engineering using CRISPR/Cas
systems," Science 2013 339 (6121): 819-823. 7 Pages. cited by
applicant .
Craw, P., et al., "Isothermal nucleic acid amplification
technologies for point-of-care diagnostics: a critical review," Lab
on a Chip, 12, 2469-2486. 2012. 19 Pages. cited by applicant .
D. J. Alexander, An Overview of the Epidemiology of Avian
Influenza, Vaccine, 2007, 25, 30:5637-44. Abstract Only. 2 pages.
cited by applicant .
Donis-Keller, et al., "Site-specific enzymatic cleavage of RNA,"
Nucleic Acids Res., 7(1): 179-92. 1979. 15 Pages. cited by
applicant .
Du, W. B., et al.,. "SlipChip." Lab Chip9, 2286-2292, 2009. 8
Pages. cited by applicant .
European Patent Office; Extended European Search Report and
Opinion. EP Patent Application No. 14853582.6 filed on filed Oct.
16, 2014, dated Mar. 21, 2017. 7pages. cited by applicant .
Fan et al., "Non-Invasive prenatal measurement of the fetal genome"
Nature 487, 320-324, 2012. 9 Pages. cited by applicant .
Fan, H. C., et al., "Noninvasive diagnosis of fetal aneuploidy by
shotgun sequencing DNA from maternal blood." Proc. Natl. Acad.
Sci., U.S.A. 105, 42, 16266-16271, 2008. 7 Pages. cited by
applicant .
Fan, H. C., et al., "Microfluidic digital PCR enables rapid
prenatal diagnosis of fetal aneuploidy." Am. J. Ob. Gynecol. 200,
543.e1-543.e7, 2009. 8 Pages. cited by applicant .
Feng Sehn, et al., "Digital PCR on a SlipChip" LabChip 10:
2666-2672. 2010. 9 Pages. cited by applicant .
Feng Shen et al., "Digital Isothermal Quantification of Nucleic
Acids via Simultaneous Chemical Initiation of Recombinase
Polymerase Amplification Reactions on SlipChip" Analytical
Chemistry, 2011. 83:3533-3540. cited by applicant .
Feng Shen, et al., "Multiplexed Quantification of Nucleic Acids
with large Dynamic Range Using Multivolume Digital RT-PCR on a
rotational SlipChip tested with HIV and Hepatitis C Viral Load"
JACS 133: 17705-17712. 2011. 9 pages. cited by applicant .
Feng Shen, et al., "Nanoliter Multiplex PCR Arrays on a SlipChip"
Analytical Chemistry, 82: 4606-4612. 2010. 8 Pages. cited by
applicant .
Fraser, et al., "Structural and Mechanistic insights into Hepatitis
C viral translation initiation" Nature Reviews Microbiology.5:
29-38. 2007. 11 Pages. cited by applicant .
Gansen, et al., "Digital LAMP in a sample self-digitization (SD)
chip." Lab Chip12, 2247-2254. 2012. 9 pages. cited by applicant
.
Heyries, K., et al., "Megapixel digital PCR". Nat. Methods8, 8,
649-651, 2011. 6 Pages. cited by applicant .
Hoshika, S., et al., "Artificial Genetic Systems: Self-Avoiding DNA
in PCR and Multiplexed PCR," Angew. Chem. Int. Ed.49 (32)
5554-5557, 2010. 5 Pages. cited by applicant .
Hoshika, S., et al., "Self-Avoiding Molecular Recognition Systems
(SAMRS)," Nucleic Acids Symp. Series. No. 52 (1) 129-130. 2008. 4
Pages. cited by applicant .
International Search Report for International Application No.
PCT/US14/60977 filed on Oct. 16, 2014 on behalf of California
Institute of Technology, dated Apr. 23, 2015. 7 pages . . . . cited
by applicant .
International Preliminary Report on Patentability for International
Application No. PCT/US2014/060977 filed on Oct. 16, 2014 on behalf
of California Institute of Technology, dated Apr. 19, 2016. 10
pages . . . . cited by applicant .
Johnson, V.A., et al., "Update of the Drug Resistance Mutations in
HIV-1," Mar. 2013, Topics in Antiviral Medicine, vol. 21, Issue
1:6-14. 10 Pages. cited by applicant .
Joneja et al., "Linear nicking endonuclease-mediated strand
displacement DNA amplification," Anal Biochem, Jul. 2011, vol. 414,
No. 1, pp. 58-69. 13 Pages. cited by applicant .
Kaihatsu, et al., "Rapid Identification of Swine-Origin Influenza A
Virus by Peptide Nucleic Acid Chromatography", Antivirals &
Antiretrovirals, 5(4): 077-079, 2013. 4 Pages. cited by applicant
.
Kaneko H, Kawana T, Fukushima E, and Suzutani T, "Tolerance of
loop-mediated isothermal amplification to a culture medium and
biological substances", J. Biochem., Biophys. Methods, 70: 499-501
(2007). cited by applicant .
Kargar, M., et al., "Loop-Mediated Isothermal Amplification Assay
for Rapid Detection of Hepatitis C virus," Indian J Virol. Jun.
2012; 23(1): 18-23. 7 Pages. cited by applicant .
Kasarjian, JKA.,et al., "Four new type I restriction enzymes
identified in Escherichia coli clinical isolates", Nucleic Acids
Res. 2005; 33(13): e114, 9 Pages. cited by applicant .
Kim, et al., "Genotyping with CRISPR-Cas-derived RNA guided
endonucleases," Nat Common. 5, 3157. 2014. 9 Pages. cited by
applicant .
Landry, M. L., "Diagnostic tests for influenza infection", Curr
Opin Pediatr, 2011,23: 91-97. 8 Pages. cited by applicant .
Laos, R., et al. "Directed Evolution of Polymerases To Accept
Nucleotides with Nonstandard Hydrogen Bond Patterns," Biochemistry
2013, 52, 5288-5294. 8 pages. cited by applicant .
Lartillot, N., et al., "PhyloBayes 3: A Bayesian software package
for phylogenetic reconstruction and molecular dating",
Bioinformatics, 2009, vol. 25, No. 17, 2286-2288. 4 pages. cited by
applicant .
Leconte, A.M., et al., "Directed evolution of DNA polymerases for
next-generation sequencing," Angew. Chem. Int. Ed., 2010.
49:5921-5924. 5 Pages. cited by applicant .
Li, CM, et al., "Cell type specific over-expression of chromosome
21 genes in fibroblasts and fetal hearts with trisomy 21," BMC
Medical Genetics 2006, 7: 24. 16 Pages. cited by applicant .
Li, L., et al., "Natural-like replication of an unnatural base pair
for the expansion of the genetic alphabet and biotechnology
applications," J. Am. Chem. Soc., 2014. 136:826-829. 5 pages. cited
by applicant .
Li, Z., et al., "Site-specifically arraying small molecules or
proteins on DNA using an expanded genetic alphabet," Chem. Eur.
J.,19:14205-14209. Issue 42, Oct. 2013. 6 Pages. cited by applicant
.
Liu, K., et al., "SATe-II: very fast and accurate simultaneous
estimation of multiple sequence alignments and phylogenetic trees",
Syst Biol, Advance access publication Dec. 2011, 61(1): 90-106. 18
Pages. cited by applicant .
Liu, W., et al., "SlipChip for Immunoassays in Nanoliter Volumes,"
Anal. Chem. vol. 82, No. 8, 3276-3282, 2010. 8 Pages. cited by
applicant .
Lo., YMD, et al., "Plasma placental RNA allelic ratio permits
noninvasive prenatal chromosomal aneuploidy detection," Nat. Med.
2007, vol. 13, No. 2, 218-223. 7 pages. cited by applicant .
Lo, YMD, et al., "Presence of fetal DNA in maternal plasma and
serum," Lancet350, 485-487. 1997. 4 Pages. cited by applicant .
Machado, M., et al., "Phred-Phrap package to analyses tools: a
pipeline to facilitate population genetics re-sequencing studies",
Investig Genet, 2011, 2, 3. 8 Pages. cited by applicant .
Mali, et al., "RNA-guided human genome engineering via Cas 9,"
Science, 339: 823-826. 2013. 6 Pages. cited by applicant .
Mali, P., et al., "Cas9 as a versatile tool for engineering
biology," Nat Methods, 2013, 10(10): 957-963. 8 Pages. cited by
applicant .
Malyshev, D.A., et al., "Efficient and sequence-independent
replication of DNA containing a third base pair establishes a
functional six-letter genetic alphabet," Proc. Natl. Acad. Sci.
USA, 2012 vol. 109, No. 30:12005-12010. 7 Pages. cited by applicant
.
Mani, N., et al., "Clinically Relevant HCV Drug Resistance
Mutations Figures and Tables," from HCV Phenotype Working Group,
HCV Drug Development Advisory Group, Ann Forum Collab HIV Res. vol.
14 (2): 2012; 1-10. 9 Pages. cited by applicant .
Munster, V. J., et al., "Spatial, temporal, and species variation
in the prevalence of influenza A viruses in wild migratory birds,"
PLoS Pathog, 2007, vol. 3, Issue 5, e61, 0630-0638. 10 Pages. cited
by applicant .
Non-Final Office Action for U.S. Appl. No. 15/030,202, filed Apr.
18, 2016 on behalf of California Institute of Technology, dated
Mar. 8, 2018. 16 pages . . . . cited by applicant .
Notice of Allowance for U.S. Appl. No. 15/030,202, filed Apr. 18,
2016 on behalf of California Institute of Technology, dated Sep.
14, 2018. 7 pages . . . . cited by applicant .
Orozovic, G., et al., "Detection of Resistance Mutations to
Antivirals Oseltamivir and Zanamivir in Avian Influenza A Viruses
Isolated from Wild Birds,". PLoS ONE. Jan. 6, 2011. vol. 6(1):
e16028. doi: 10.1371/journal.pone.0016028. 11 Pages. cited by
applicant .
Orum et al., "Single base pair mutation analysis by PNA directed
PCR clamping" Nucleic Acids Res 1993, 21 (23): 5332-5336. 5 Pages.
cited by applicant .
Ottesen, E. A., et al., "Microfluidic digital PCR enables multigene
analysis of individual environmental bacteria". Science 314 (5804),
1464-1467, 2006. 6 Pages. cited by applicant .
Pellicelli, A M., et al., "HCV genotype 1a shows a better
virological response to antiviral therapy than HCV genotype 1b,"
BMC Gastroenterol. Nov. 16, 2012; 12:162. 8 Pages. cited by
applicant .
Posada, D., "jModelTest: phylogenetic model averaging," Mol Biol
Evol, 2008, 25(7): 1253-1256. 5 Pages. cited by applicant .
Qian et al., "Scaling up Digital Circuit Computation with DNA
Strand Displacement Cascades", Science; vol. 332: 1196-1201. 2011.
8 Pages. cited by applicant .
Ray, et al., "Peptide nucleic acid (PNA): its medical and
biotechnical applications and promise for the future" FASEB, J,
vol. 14:1041-1060. 2000. 21 pages. cited by applicant .
Selck, D.A., et al., "Increased Robustness of Single-Molecule
Counting with Microfluidics, Digital Isothermal Amplification, and
a Mobile Phone versus Real-Time Kinetic Measurements," Analytical
Chemistry, 2013. 85:11129-11136. 9 Pages. cited by applicant .
Seo , Y.J., "Site-specific labeling of DNA and RNA using an
efficiently replicated and transcribed class of unnatural base
pairs," J. Am. Chern. Soc. 2011, 133:19878-19888. 12 Pages. cited
by applicant .
Shalem, O., et al., "Genome-scale CRISPR-Cas9 knockout screening in
human cells," Science 2014, vol. 343(6166): 84-87. 6 Pages. cited
by applicant .
Sherlock Biosciences: Better Diagnostic Testing Should be
Elementary. An Overview. Downloaded from the web at:
https://sherlock.bio/technology/ on Oct. 7, 2020. 6 Pages. cited by
applicant .
Silva, et al., "Meganucleases and other tools for targeted genome
engineering: perspectives and challenges for gene therapy," Curr
Gene Ther., 11: 11-27. 2011. 19 Pages. cited by applicant .
Smith et al., Mutation detection with MutH, MutL, and MutS mismatch
repair proteins Proc Natl Acad Sci, 1996, vol. 93(9): 4374-4379. 7
pages. cited by applicant .
Stamatakis, "RAxML version 8: a tool for phylogenetic analysis and
post-analysis of large phylogenies," Bioinformatics 2014, vol. 30,
No. 9, pp. 1312-1313. doi: 10.1093/bioinformatics/btu033. cited by
applicant .
Summons to attend oral proceedings pursuant to Rule 115(1) EPC for
EP Application No. 14853582.6 filed on Oct. 16, 2014 on behalf of
California Institute of Technology, dated Jul. 6, 2021. 10 pages.
cited by applicant .
Sun, B., et al., "Measuring Fate and Rate of Single-Molecule
Competition of Amplification and Restriction Digestion, and Its Use
for Rapid Genotyping Tested with Hepatitis C Viral RNA" Genotype
Determination, Angew. Chem. Int. Ed. 2014, 53, 8088-8092. 6 Pages.
cited by applicant .
Sun, B., et al., "Mechanistic evaluation of the pros and cons of
digital RT-LAMP for HIV-1 viral load quantification on a
microfluidic device and improved efficiency via a two-step digital
protocol". Anal Chem 85(3):1540-1546. 2013. 8 pages. cited by
applicant .
Tatsumi, et al., "Rapid Screening assay for KRAS mutations by the
modified smart amplification process," J Mol Diagn 2008, 10(6):
520-526. 8 Pages. cited by applicant .
Thorsen, T., et al., "Microfluidic large-scale integration".
Science288, 580-584, 2002. 6 Pages. cited by applicant .
Tong, Yanhong et al. "Multiple strategies to improve sensitivity,
speed and robustness of isothermal nucleic acid amplification for
rapid pathogen detection", BMC Biotechnology, Biomed Central Ltd,
vol. 11, No. 1, May 11, 2011, p. 50. 7 pages. cited by applicant
.
Tsongalis et al., "Branched DNA technology in Molecular
Diagnostics," Am J Clin Pathol 2006; 126: 448-453. 7 Pages. cited
by applicant .
Tsugunori Notomi, et al., "Loop-mediated isothermal amplification
of DNA", Nucleic Acids Res. vol. 28(12). E63. Jun. 15, 2000. 8
Pages. cited by applicant .
Urnov et al., "Highly efficient endogenous human gene correction
using designed zinc-finger nucleases", Nature, 2005. vol 435:
646-651. cited by applicant .
U.S. Appl. No. 61/516,628, filed Apr. 5, 2011 on behalf of Rustem
Ismagilov. cited by applicant .
U.S. Appl. No. 61/518,601, filed May 9, 2011 on behalf of Rustem
Ismagilov. cited by applicant .
U.S. Appl. No. 61/611,295, filed Mar. 25, 2012 on behalf of
Romualdas Vaisvila. cited by applicant .
U.S. Appl. No. 61/722,968, filed Nov. 6, 2012 on behalf of Yu
Zheng. cited by applicant .
U.S. Appl. No. 61/723,427, filed Nov. 7, 2012 on behalf of Ivan
Correa. cited by applicant .
U.S. Appl. No. 61/724,041, filed Nov. 8, 2012 on behalf of Shengxi
Guan. cited by applicant .
U.S. Appl. No. 62/038,036, filed Aug. 15, 2014 on behalf of Stefano
Begolo. cited by applicant .
U.S. Appl. No. 61/340,872 filed on behalf of Rustem F. Ismagilov,
filed Mar. 22, 2010. 589 pages. cited by applicant .
U.S. Appl. No. 61/162,922 filed on behalf of Rustem F. Ismagilov,
filed Mar. 24, 2009. 89 pages. cited by applicant .
U.S. Appl. No. 61/262,375 filed on behalf of Rustem F. Ismagilov,
filed Nov. 18, 2009. 130 pages. cited by applicant .
Wang, et al., "A one-step reverse transcription loop-mediated
isothermal amplification for detection and discrimination of
infectious bursal disease virus" Virol J, 2011. vol 8, No. 108. pp.
1-7. Especially p. 2 col. 2 para 2, p. 3 col. 1 para 1, p. 3 fig 1
A, p. 4col. 2 para 2, p. 5 col. 2 para 1, p. 5 fig 3. 8 Pages.
cited by applicant .
Wang, QQ, et al., "Rapid detection of hepatitis C virus RNA by a
reverse transcription loop-mediated isothermal amplification
assay," FEMS Immunol Med Microbial, 2011, Oct.; 63(1):144-147. 6
Pages. cited by applicant .
Wang, T., et al., "Genetic screens in human cells using the
CRISPR-Cas9 System," Science 2014, 343(6166): 80-84. 7 Pages. cited
by applicant .
Wegrzyn, J. L., et al., "PineSAP-sequence alignment and SNP
identification pipeline", Bioinformatics, 2009, vol. 25, No. 19,
2609-2610. 2 Pages. cited by applicant .
Weisinger, R. M., et al., "Mesofluidic Devices for DNA-Programmed
Combinatorial Chemistry," PLOS ONE 2012; 7 (3), e32299. 9 Pages.
cited by applicant .
Weisinger, R. M., et al., "Highly Parallel Translation of DNA
Sequences into Small Molecules," PLOS ONE 2012; 7 (3), e28056. 8
Pages. cited by applicant .
Written Opinion for International Application No. PCT/US14/60977
filed on Oct. 16, 2014 on behalf of California Institute of
Technology, dated Apr. 23, 2015. 9 pages . . . . cited by applicant
.
Yang J, et al.,, "Detection of hepatitis C virus by an improved
loop-mediated isothermal amplification assay." Arch Virol. Aug.
2011;156(8):1387-1396.11 Pages. cited by applicant .
Yang, Z., et al., "Conversion strategy using an expanded genetic
alphabet to assay nucleic acids," Anal. Chem. 85(9): 4705-4712.
2013. 9 Pages. cited by applicant .
Yang, Z., et al., "Enzymatic incorporation of a third nucleobase
pair," Nucl. Acids Res. 35 (13) 4238-4249. 2007. 13 Pages. cited by
applicant .
Yang, Z., et al., "Expanded Genetic Alphabets in the Polymerase
Chain Reaction," Angew. Chem. Int. Ed.49 (1)177-180. 2010. 5 Pages.
cited by applicant .
Decision of Refusal for EP Application No. 14853582.6 filed Oct.
16, 2014 on behalf of California Institute of Technology dated Apr.
7, 2022. 12 pages. cited by applicant .
Decision to Refuse a European Patent Application for EP Application
No. 14853582.6 filed Oct. 16, 2014 on behalf of California
Institute of Technology dated May 18, 2022. 9 pages. cited by
applicant.
|
Primary Examiner: Chunduru; Suryaprabha
Attorney, Agent or Firm: Steinfl + Bruno LLP
Government Interests
STATEMENT AS TO FEDERALLY SPONSORED RESEARCH
This invention was made with government support under Grant No.
OD003584, Grant No. EB012946, and Grant No. GM007616 awarded by the
National Institutes of Health and under Grant No. HR0011-11-2-0006
awarded by DARPA. The government has certain rights in the
invention.
Parent Case Text
CROSS-REFERENCE
This application is a continuation of U.S. application Ser. No.
15/030,202, filed Apr. 18, 2016, which is a U.S. National Phase
patent application of PCT/US2014/060977, filed Oct. 16, 2014, which
claims the benefit of U.S. Provisional Application No. 61/893,051,
filed Oct. 18, 2013, U.S. Provisional Application No. 61/943,784,
filed Feb. 24, 2014, U.S. Provisional Application No. 61/968,191,
filed Mar. 20, 2014, U.S. Provisional Application No. 61/993,183,
filed May 14, 2014, and U.S. Provisional Application No.
62/063,293, filed Oct. 13, 2014, all of which are incorporated
herein by reference.
Claims
What is claimed is:
1. A method, comprising: providing a volume suspected of containing
a target nucleic acid; dispersing said volume among a plurality of
areas, such that said plurality of areas comprises a distribution
of nucleic acids, and conducting an isothermal nucleic acid
amplification reaction in said volume in the dispersed volume in
said plurality of areas in presence of a modulator comprising an
engineered or non-natural sequence-specific nuclease selected from
the group consisting of zinc-finger nuclease, transcription
activator-like effector nuclease, meganuclease and RNA-guided Cas9
nuclease, the engineered or non-natural sequence-specific nuclease
cleaving said target nucleic acid within a region amplified by said
isothermal nucleic acid amplification reaction.
2. The method of claim 1, wherein said distribution generates
digital nucleic acid amplification signals.
3. The method of claim 2, wherein said plurality of areas each
comprises at most one copy of said target nucleic acid.
4. The method of claim 2, further comprising prior to the
conducting, providing the modulator to said plurality of areas.
5. The method of claim 1, wherein the providing comprises providing
a first volume comprising a first nucleic acid and a second volume
comprising a second nucleic acid, wherein the dispersing comprises
dispersing said first volume among a plurality of first areas and
dispersing said second volume among a plurality of second areas,
and wherein the conducting is performed in the dispersed first
volume in said plurality of first areas and in the dispersed second
volume in said plurality of second areas.
6. The method of claim 5, wherein said plurality of first areas
each comprise at most one copy of said first nucleic acid and said
plurality of second areas each comprise at most one copy of said
second nucleic acid.
7. The method of claim 5, further comprising prior to the
conducting, providing the modulator to said plurality of first
areas or to said plurality of second areas.
8. The method of claim 5, further comprising detecting a difference
in said isothermal nucleic acid amplification reaction between said
first nucleic acid and said second nucleic acid.
9. The method of claim 8, wherein said difference is diagnostic of
the presence of the target nucleic acid within said first nucleic
acid and said second nucleic acid.
10. The method of claim 1, wherein modulation by the modulator
comprises producing a difference in amplification efficiency.
11. The method of claim 10, wherein the said distribution generates
digital nucleic acid amplification signals, wherein said difference
in amplification efficiency produces a positive amplification
signal in a subset of said plurality of areas.
12. The method of claim 11, wherein said positive amplification
signal in said subset of said plurality of areas is diagnostic of
the presence of said target nucleic acid within said volume.
13. The method of claim 1, wherein the target nucleic acid
comprises an HCV nucleic acid.
14. The method of claim 13, wherein said method generates a signal
from which an HCV genotype can be determined.
15. The method of claim 1, further comprising comparing results of
said isothermal nucleic acid amplification reaction to results of a
control isothermal nucleic acid amplification reaction carried out
in the absence of the modulator.
16. The method of claim 1, wherein said isothermal nucleic acid
amplification reaction is selected from the group consisting of
Recombinase Polymerase Amplification (RPA), Loop-mediated
isothermal amplification (LAMP), Helicase-dependent amplification
(HAD), Strand displacement amplification (SDA), Nucleic acid
sequence based amplification (NASBA), and Nicking enzyme
amplification reaction (NEAR).
17. The method of claim 16, wherein said isothermal nucleic acid
amplification reaction is LAMP or NASBA.
18. The method of claim 1, wherein the modulator is RNA-guided Cas9
nuclease.
19. The method of claim 18, wherein the modulator further comprises
a crRNA and a tracrRNA, the crRNA, tracRNA and Cas9 forming a
Cas9-crRNA-tracrRNA complex.
Description
SEQUENCE LISTING
The instant application contains a Sequence Listing which has been
submitted electronically in ASCII format and is hereby incorporated
by reference in its entirety. Said ASCII copy, created on Dec. 18,
2018, is named 42436_US_Sequence_Listing.txt and is 29,414 bytes in
size.
BACKGROUND
Modern biological techniques, including nucleic acid analysis,
offer powerful tools for the analysis of samples. Samples from
subjects and environmental sources can be analyzed for the presence
of various compounds and organisms. Patients can be diagnosed for
diseases, including infectious diseases and genetic diseases.
Samples can be genotyped.
However, many analysis techniques require centralized laboratory
facilities, trained technicians, sample preparation, refrigeration,
and other resources. Such requirements can limit the utility of
these techniques in point-of-care settings, limited resource
settings, and other environments with difficult or no access to
necessary resources.
SUMMARY
In some aspects, this disclosure provides a method comprising: (a)
providing a first solution comprising a first nucleic acid and a
modulator, wherein said modulator is capable of acting on said
first nucleic acid in a region amplified by an isothermal nucleic
acid amplification reaction, thereby modulating said isothermal
nucleic acid amplification reaction; (b) preparing a second
solution comprising a second nucleic acid and optionally comprising
said modulator; and (c) conducting said isothermal nucleic acid
amplification reaction in said first solution and in said second
solution.
In some aspects, this disclosure provides a method comprising: (a)
providing a volume suspected of containing a target nucleic acid
molecule; and (b) conducting an isothermal nucleic acid
amplification reaction in said volume in the presence of a
modulator, wherein said modulator modulates said nucleic acid
amplification reaction in the presence of said target nucleic acid
molecule and wherein said modulator acts on said target nucleic
acid molecule within a region amplified by said isothermal nucleic
acid amplification reaction.
In some aspects, this disclosure provides a method comprising: (a)
providing a first volume comprising first nucleic acid and a second
volume comprising second nucleic acid; (b) dispersing said first
volume among a plurality of first areas such that said plurality of
first areas each comprise at most one copy of said first nucleic
acid and dispersing said second volume among a plurality of second
areas such that said plurality of second areas each comprise at
most one copy of said second nucleic acid; (c) providing a
modulator to said plurality of first areas or to said plurality of
second areas, wherein said modulator modulates a nucleic acid
amplification reaction when in the presence of said first nucleic
acid; and (d) conducting said nucleic acid amplification reaction
in said plurality of first areas and said plurality of second
areas.
In some aspects, this disclosure provides a method comprising: (a)
providing a volume suspected of containing target nucleic acid
molecules; (b) dispersing said volume among a plurality of areas,
such that said plurality of areas each comprise at most one of said
target nucleic acid molecules; (c) providing a modulator to said
plurality of areas, wherein said modulator modulates a nucleic acid
amplification reaction in the presence of said target nucleic acid
molecule; (d) conducting said nucleic acid amplification reaction
in said plurality of areas.
In some aspects, this disclosure provides a method comprising: (a)
providing a first volume comprising first nucleic acid and a second
volume comprising second nucleic acid; (b) dispersing said first
volume among a plurality of first areas and dispersing said second
volume among a plurality of second areas; (c) providing a modulator
to said plurality of first areas or to said plurality of second
areas, wherein said modulator modulates a nucleic acid
amplification reaction when in the presence of said first nucleic
acid; and (d) conducting said nucleic acid amplification reaction
in said plurality of first areas and in said plurality of second
areas, thereby producing positive amplification signal in a subset
of said plurality of first areas.
In some aspects, this disclosure provides a method comprising: (a)
providing a volume suspected of containing target nucleic acid
molecules; (b) dispersing said volume among a plurality of areas;
(c) providing a modulator to said plurality of areas, wherein said
modulator modulates a nucleic acid amplification reaction in the
presence of said target nucleic acid molecule; (d) conducting said
nucleic acid amplification reaction in said plurality of areas,
thereby producing positive amplification signal in a subset of said
plurality of areas.
In some embodiments of aspects provided herein, the method further
comprises detecting a difference in amplification between said
first nucleic acid and said second nucleic acid. In some
embodiments of aspects provided herein, said difference in
amplification comprises a difference in amplification rate. In some
embodiments of aspects provided herein, said difference in
amplification comprises a difference in amplification efficiency.
In some embodiments of aspects provided herein, said difference in
amplification comprises a difference in amplification rate and a
difference in amplification efficiency. In some embodiments of
aspects provided herein, said detecting comprises performing
sequencing. In some embodiments of aspects provided herein, said
detecting does not comprise performing sequencing. In some
embodiments of aspects provided herein, said detecting comprises
mass spectrometry. In some embodiments of aspects provided herein,
said detecting does not comprise mass spectrometry. In some
embodiments of aspects provided herein, said detecting comprises
performing electrophoresis. In some embodiments of aspects provided
herein, said detecting does not comprise performing
electrophoresis. In some embodiments of aspects provided herein,
said providing a modulator of step (c) occurs before said
dispersing of step (b). In some embodiments of aspects provided
herein, said providing a modulator of step (c) occurs during said
dispersing of step (b). In some embodiments of aspects provided
herein, said providing a modulator of step (c) occurs after said
dispersing of step (b). In some embodiments of aspects provided
herein, the method further comprises dispersing said first volume
among a plurality of third areas such that said plurality of third
areas each comprise more than one copy of said first nucleic acid
and dispersing said second volume among a plurality of fourth areas
such that said plurality of fourth areas each comprise more than
one copy of said second nucleic acid. In some embodiments of
aspects provided herein, the method further comprises dispersing
said volume among a second plurality of areas, such that said
second plurality of areas each comprise more than one of said
target nucleic acid molecules. In some embodiments of aspects
provided herein, said modulator acts during said nucleic acid
amplification reaction. In some embodiments of aspects provided
herein, said modulator acts before said nucleic acid amplification
reaction. In some embodiments of aspects provided herein, said
modulator acts after said nucleic acid amplification reaction. In
some embodiments of aspects provided herein, said modulator acts by
inhibiting said nucleic acid amplification reaction. In some
embodiments of aspects provided herein, said modulator acts by
promoting said nucleic acid amplification reaction. In some
embodiments of aspects provided herein, said modulator acts by
promoting said nucleic acid amplification reaction by inhibiting
off-target reactions. In some embodiments of aspects provided
herein, said nucleic acid amplification reaction comprises an
isothermal amplification reaction. In some embodiments of aspects
provided herein, said isothermal nucleic acid amplification
reaction is performed in a digital format. In some embodiments of
aspects provided herein, said modulator acts on a nucleic acid
outside of a priming region of said nucleic acid amplification
reaction. In some embodiments of aspects provided herein, said
modulator acts on a nucleic acid inside a priming region of said
nucleic acid amplification reaction. In some embodiments of aspects
provided herein, said modulator comprises an enzyme. In some
embodiments of aspects provided herein, said modulator comprises an
enzyme that acts on nucleic acids in a sequence-targeted manner. In
some embodiments of aspects provided herein, said modulator binds a
nucleic acid molecule in a sequence-targeted manner. In some
embodiments of aspects provided herein, said modulator acts on
nucleic acids in a methylation-targeted manner. In some embodiments
of aspects provided herein, said modulator acts on nucleic acids in
a glycosylation-targeted manner. In some embodiments of aspects
provided herein, said modulator comprises a restriction enzyme. In
some embodiments of aspects provided herein, said modulator
comprises a nucleic acid modifying enzyme. In some embodiments of
aspects provided herein, said modulator comprises a ligase. In some
embodiments of aspects provided herein, said modulator comprises an
engineered or non-natural nuclease. In some embodiments of aspects
provided herein, said modulator comprises a modulator selected from
the group consisting of zinc-finger nuclease, transcription
activator-like effector nuclease, meganuclease, and RNA-guided Cas9
nuclease. In some embodiments of aspects provided herein, said
modulator comprises an oligonucleotide. In some embodiments of
aspects provided herein, said modulator comprises an artificial
nucleic acid or a nucleic acid analog. In some embodiments of
aspects provided herein, said modulator comprises peptide nucleic
acid (PNA), locked nucleic acid (LNA), inosine, or
dideoxynucleotide (ddNTP). In some embodiments of aspects provided
herein, said modulator comprises an oligonucleotide comprising
modified bases or unnatural bases. In some embodiments of aspects
provided herein, said modulator comprises a repair protein. In some
embodiments of aspects provided herein, said modulator comprises a
repair protein selected from the group consisting of MutH, MutL,
and MutS. In some embodiments of aspects provided herein, said
modulator promotes said nucleic acid amplification reaction by
affecting secondary structures. In some embodiments of aspects
provided herein, said modulator competes with primers for said
nucleic acid amplification reaction. In some embodiments of aspects
provided herein, said modulator is inactive until activation by an
enzymatic activity. In some embodiments of aspects provided herein,
said conducting occurs on a microfluidic device. In some
embodiments of aspects provided herein, said conducting occurs on a
microwell plate. In some embodiments of aspects provided herein,
said conducting occurs on a solid support. In some embodiments of
aspects provided herein, said conducting occurs not on a solid
support. In some embodiments of aspects provided herein, said
conducting occurs in microfluidic droplets. In some embodiments of
aspects provided herein, said conducting occurs in an emulsion.
In some aspects, this disclosure provides a method comprising: (a)
providing a volume suspected of containing a first target nucleic
acid molecule; (b) conducting a first nucleic acid amplification
reaction on a first part of said volume in the presence of a first
modulator, wherein said first modulator modulates said first
nucleic acid amplification reaction in the presence of said first
target nucleic acid molecule; (c) conducting a second nucleic acid
amplification reaction on a second part of said volume, optionally
in the presence of a second modulator, wherein said second
modulator, if present, modulates said second nucleic acid
amplification reaction in the presence of a second target nucleic
acid molecule; (d) generating a modulated amplification pattern
based on results from said first nucleic acid amplification
reaction and said second nucleic acid amplification reaction; and
(e) comparing said modulated amplification pattern to a reference
pattern.
In some embodiments of aspects provided herein, said results
comprise amplification rate results. In some embodiments of aspects
provided herein, said results comprise amplification efficiency
results. In some embodiments of aspects provided herein, said
results comprise amplification rate results and amplification
efficiency results. In some embodiments of aspects provided herein,
said generating does not comprise gel electrophoresis. In some
embodiments of aspects provided herein, said first modulator or
said second modulator acts during said nucleic acid amplification
reaction. In some embodiments of aspects provided herein, said
first modulator or said second modulator acts before said nucleic
acid amplification reaction. In some embodiments of aspects
provided herein, said first modulator or said second modulator acts
after said nucleic acid amplification reaction. In some embodiments
of aspects provided herein, said first modulator or said second
modulator acts by inhibiting said nucleic acid amplification
reaction. In some embodiments of aspects provided herein, said
first modulator or said second modulator acts by promoting said
nucleic acid amplification reaction. In some embodiments of aspects
provided herein, said first modulator or said second modulator acts
by promoting said nucleic acid amplification reaction by inhibiting
off-target reactions. In some embodiments of aspects provided
herein, said first nucleic acid amplification reaction or said
second nucleic acid amplification reaction comprises an isothermal
amplification reaction. In some embodiments of aspects provided
herein, said first nucleic acid amplification reaction or said
second nucleic acid amplification is performed in a digital format.
In some embodiments of aspects provided herein, said first
modulator or said second modulator acts on a nucleic acid outside
of a priming region of said nucleic acid amplification reaction. In
some embodiments of aspects provided herein, said first modulator
or said second modulator comprises an enzyme. In some embodiments
of aspects provided herein, said first modulator or said second
modulator comprises an enzyme that acts on nucleic acids in a
sequence-targeted manner. In some embodiments of aspects provided
herein, said first modulator or said second modulator binds a
nucleic acid molecule in a sequence-targeted manner. In some
embodiments of aspects provided herein, said first modulator or
said second modulator acts on nucleic acids in a
methylation-targeted manner. In some embodiments of aspects
provided herein, said first modulator or said second modulator acts
on nucleic acids in a glycosylation-targeted manner. In some
embodiments of aspects provided herein, said first modulator or
said second modulator comprises a restriction enzyme. In some
embodiments of aspects provided herein, said first modulator or
said second modulator comprises a nucleic acid modifying enzyme. In
some embodiments of aspects provided herein, said first modulator
or said second modulator comprises a ligase. In some embodiments of
aspects provided herein, said first modulator or said second
modulator comprises an engineered or non-natural nuclease. In some
embodiments of aspects provided herein, said first modulator or
said second modulator comprises a modulator selected from the group
consisting of zinc-finger nuclease, transcription activator-like
effector nuclease, meganuclease, and RNA-guided Cas9 nuclease. In
some embodiments of aspects provided herein, said first modulator
or said second modulator comprises an oligonucleotide. In some
embodiments of aspects provided herein, said first modulator or
said second modulator comprises an artificial nucleic acid or a
nucleic acid analog. In some embodiments of aspects provided
herein, said first modulator or said second modulator comprises
peptide nucleic acid (PNA), locked nucleic acid (LNA), inosine, or
dideoxynucleotide (ddNTP). In some embodiments of aspects provided
herein, said first modulator or said second modulator comprises an
oligonucleotide comprising modified bases or unnatural bases. In
some embodiments of aspects provided herein, said first modulator
or said second modulator comprises a repair protein. In some
embodiments of aspects provided herein, said first modulator or
said second modulator comprises a repair protein selected from the
group consisting of MutH, MutL, and MutS. In some embodiments of
aspects provided herein, said first modulator or said second
modulator promotes said nucleic acid amplification reaction by
affecting secondary structures. In some embodiments of aspects
provided herein, said first modulator or said second modulator
competes with primers for said nucleic acid amplification reaction.
In some embodiments of aspects provided herein, said first
modulator or said second modulator is inactive until activation by
an enzymatic activity. In some embodiments of aspects provided
herein, said conducting a first nucleic acid amplification reaction
or said conducting a second nucleic acid amplification reaction
occurs on a microfluidic device. In some embodiments of aspects
provided herein, said conducting a first nucleic acid amplification
reaction or said conducting a second nucleic acid amplification
reaction occurs on a microwell plate. In some embodiments of
aspects provided herein, said conducting a first nucleic acid
amplification reaction or said conducting a second nucleic acid
amplification reaction occurs on a solid support. In some
embodiments of aspects provided herein, said conducting a first
nucleic acid amplification reaction or said conducting a second
nucleic acid amplification reaction occurs not on a solid support.
In some embodiments of aspects provided herein, said conducting a
first nucleic acid amplification reaction or said conducting a
second nucleic acid amplification reaction occurs in microfluidic
droplets. In some embodiments of aspects provided herein, said
conducting a first nucleic acid amplification reaction or said
conducting a second nucleic acid amplification reaction occurs in
an emulsion.
In some aspects, this disclosure provides a method comprising: (a)
providing a first volume comprising a first nucleic acid and a
second volume comprising a second nucleic acid; (b) dispersing said
first volume among a plurality of first areas; (c) dispersing said
second volume among a plurality of second areas; (d) providing a
modulator to said plurality of first areas or to said plurality of
second areas; and (e) conducting said nucleic acid amplification
reaction, thereby producing a positive signal in a subset of said
plurality of first areas, wherein said modulator modulates said
producing when in the presence of said first nucleic acid.
In some aspects, this disclosure provides a method comprising: (a)
providing a volume suspected of containing a target nucleic acid
molecule; (b) dispersing said volume among a plurality of areas;
(c) dispersing a modulator among said plurality of areas; (c)
conducting said nucleic acid amplification reaction in said
plurality of areas, thereby producing a positive amplification
signal in a subset of said plurality of areas, wherein said
modulator modulates said producing when in the presence of said
target nucleic acid molecule.
In some embodiments of aspects provided herein, said producing
comprises producing fluorescence. In some embodiments of aspects
provided herein, said producing comprises producing a precipitate.
In some embodiments of aspects provided herein, said producing
comprises producing a gas bubble. In some embodiments of aspects
provided herein, said producing comprises conducting nucleic acid
sequencing. In some embodiments of aspects provided herein, said
producing comprises conducting mass spectrometry. In some
embodiments of aspects provided herein, said producing comprises
quenching. In some embodiments of aspects provided herein, said
modulator comprises an enzyme. In some embodiments of aspects
provided herein, said modulator comprises an enzyme that acts on
nucleic acids in a sequence-targeted manner. In some embodiments of
aspects provided herein, said modulator binds a nucleic acid
molecule in a sequence-targeted manner. In some embodiments of
aspects provided herein, said modulator acts on nucleic acids in a
methylation-targeted manner. In some embodiments of aspects
provided herein, said modulator acts on nucleic acids in a
glycosylation-targeted manner. In some embodiments of aspects
provided herein, said modulator comprises a restriction enzyme. In
some embodiments of aspects provided herein, said modulator
comprises a nucleic acid modifying enzyme. In some embodiments of
aspects provided herein, said modulator comprises a ligase. In some
embodiments of aspects provided herein, said modulator comprises an
engineered or non-natural nuclease. In some embodiments of aspects
provided herein, said modulator comprises a modulator selected from
the group consisting of zinc-finger nuclease, transcription
activator-like effector nuclease, meganuclease, and RNA-guided Cas9
nuclease. In some embodiments of aspects provided herein, said
modulator comprises an oligonucleotide. In some embodiments of
aspects provided herein, said modulator comprises an artificial
nucleic acid or a nucleic acid analog. In some embodiments of
aspects provided herein, said modulator comprises peptide nucleic
acid (PNA), locked nucleic acid (LNA), inosine, or
dideoxynucleotide (ddNTP). In some embodiments of aspects provided
herein, said modulator comprises an oligonucleotide comprising
modified bases or unnatural bases. In some embodiments of aspects
provided herein, said modulator comprises a repair protein. In some
embodiments of aspects provided herein, said modulator comprises a
repair protein selected from the group consisting of MutH, MutL,
and MutS. In some embodiments of aspects provided herein, said
modulator promotes said nucleic acid amplification reaction by
affecting secondary structures. In some embodiments of aspects
provided herein, said modulator competes with primers for said
nucleic acid amplification reaction. In some embodiments of aspects
provided herein, said modulator is inactive until activation by an
enzymatic activity. In some embodiments of aspects provided herein,
said conducting occurs on a microfluidic device. In some
embodiments of aspects provided herein, said conducting occurs on a
microwell plate. In some embodiments of aspects provided herein,
said conducting occurs on a solid support. In some embodiments of
aspects provided herein, said conducting occurs not on a solid
support. In some embodiments of aspects provided herein, said
conducting occurs in microfluidic droplets. In some embodiments of
aspects provided herein, said conducting occurs in an emulsion. In
some embodiments of aspects provided herein, said nucleic acid
amplification reaction is conducted in a digital format. In some
embodiments of aspects provided herein, said nucleic acid
amplification reaction comprises an isothermal nucleic acid
amplification reaction.
In some aspects, this disclosure provides a method comprising: (a)
providing a volume comprising first reagents for a first reaction
and second reagents for a second reaction; (b) conducting said
first reaction and said second reaction; and (c) observing results
from said first reaction, thereby determining the relative rate or
relative efficiency of said first reaction and said second
reaction.
In some aspects, this disclosure provides a method comprising: (a)
providing a volume comprising first reagents for a first reaction
second reagents for a second reaction; (b) dispersing said volume
among a plurality of areas; and (c) conducting said first reaction
and said second reaction in said plurality of areas, thereby
producing positive signal in a subset of said plurality of first
areas.
In some embodiments of aspects provided herein, said conducting
occurs on a microfluidic device. In some embodiments of aspects
provided herein, said conducting occurs on a microwell plate. In
some embodiments of aspects provided herein, said conducting occurs
on a solid support. In some embodiments of aspects provided herein,
said conducting occurs not on a solid support. In some embodiments
of aspects provided herein, said conducting occurs in microfluidic
droplets. In some embodiments of aspects provided herein, said
conducting occurs in an emulsion. In some embodiments of aspects
provided herein, said conducting occurs in a digital format. In
some embodiments of aspects provided herein, said reaction, said
first reaction, or said second reaction comprise an isothermal
reaction.
In some aspects, this disclosure provides a device comprising: (a)
a sample inlet; (b) a reaction chamber; (c) a first modulator; and
(d) a fluid handling component, wherein said fluid handling
component is positioned to combine said first modulator with a
portion of a sample comprising an analyte loaded in said sample
inlet.
In some embodiments of aspects provided herein, the device further
comprises a second modulator. In some embodiments of aspects
provided herein, the device further comprises amplification
reaction reagents. In some embodiments of aspects provided herein,
said amplification reaction reagents comprise isothermal
amplification reaction reagents. In some embodiments of aspects
provided herein, the device further comprises a sample preparation
module. In some embodiments of aspects provided herein, the device
further comprises a detector. In some embodiments of aspects
provided herein, said first modulator or said second modulator
comprises an enzyme. In some embodiments of aspects provided
herein, said first modulator or said second modulator comprises an
enzyme that acts on nucleic acids in a sequence-targeted manner. In
some embodiments of aspects provided herein, said first modulator
or said second modulator binds a nucleic acid molecule in a
sequence-targeted manner. In some embodiments of aspects provided
herein, said first modulator or said second modulator acts on
nucleic acids in a methylation-targeted manner. In some embodiments
of aspects provided herein, said first modulator or said second
modulator acts on nucleic acids in a glycosylation-targeted manner.
In some embodiments of aspects provided herein, said first
modulator or said second modulator comprises a restriction enzyme.
In some embodiments of aspects provided herein, said first
modulator or said second modulator comprises a nucleic acid
modifying enzyme. In some embodiments of aspects provided herein,
said first modulator or said second modulator comprises a ligase.
In some embodiments of aspects provided herein, said first
modulator or said second modulator comprises an engineered or
non-natural nuclease. In some embodiments of aspects provided
herein, said first modulator or said second modulator comprises a
first modulator or said second modulator selected from the group
consisting of zinc-finger nuclease, transcription activator-like
effector nuclease, meganuclease, and RNA-guided Cas9 nuclease. In
some embodiments of aspects provided herein, said first modulator
or said second modulator comprises an oligonucleotide. In some
embodiments of aspects provided herein, said first modulator or
said second modulator comprises an artificial nucleic acid or a
nucleic acid analog. In some embodiments of aspects provided
herein, said first modulator or said second modulator comprises
peptide nucleic acid (PNA), locked nucleic acid (LNA), inosine, or
dideoxynucleotide (ddNTP). In some embodiments of aspects provided
herein, said first modulator or said second modulator comprises an
oligonucleotide comprising modified bases or unnatural bases. In
some embodiments of aspects provided herein, said first modulator
or said second modulator comprises a repair protein. In some
embodiments of aspects provided herein, said first modulator or
said second modulator comprises a repair protein selected from the
group consisting of MutH, MutL, and MutS. In some embodiments of
aspects provided herein, said first modulator or said second
modulator promotes said nucleic acid amplification reaction by
affecting secondary structures. In some embodiments of aspects
provided herein, said first modulator or said second modulator
competes with primers for said nucleic acid amplification reaction.
In some embodiments of aspects provided herein, said first
modulator or said second modulator is inactive until activation by
an enzymatic activity. In some embodiments of aspects provided
herein, said device comprises a microfluidic device. In some
embodiments of aspects provided herein, said device comprises a
microwell plate. In some embodiments of aspects provided herein,
said device comprises a solid support. In some embodiments of
aspects provided herein, said device does not comprise a solid
support. In some embodiments of aspects provided herein, said
device comprises a microfluidic droplet generator. In some
embodiments of aspects provided herein, said device comprises an
emulsion generator. In some embodiments of aspects provided herein,
said fluid handling component is configured to provide said portion
of said sample to said reaction chamber such that said reaction
chamber comprises at most one copy of said analyte. In some
embodiments of aspects provided herein, said analyte comprises a
nucleic acid. In some embodiments of aspects provided herein, said
analyte comprises DNA. In some embodiments of aspects provided
herein, said analyte comprises RNA.
INCORPORATION BY REFERENCE
All publications, patents, and patent applications mentioned in
this specification are herein incorporated by reference in their
entireties for all purposes to the same extent as if each
individual publication, patent, or patent application was
specifically and individually indicated to be incorporated by
reference in its entirety for all purposes.
BRIEF DESCRIPTION OF THE DRAWINGS
The novel features of the invention are set forth with
particularity in the appended claims. A better understanding of the
features and advantages of the present invention will be obtained
by reference to the following detailed description that sets forth
illustrative embodiments, in which the principles of the invention
are utilized, and the accompanying drawings of which:
FIG. 1 shows an exemplary schematic of an assay design.
FIG. 2A shows an exemplary schematic illustrating the possible
outcome and rate of an amplification reaction.
FIG. 2B shows an exemplary schematic illustrating the possible
outcome and rate of a nucleic acid amplification reaction in the
presence of a restriction enzyme.
FIG. 3A shows an exemplary schematic of an assay comprising the
same primer set and a different restriction enzyme in each
compartment.
FIG. 3B shows an exemplary schematic of an assay comprising a
different primer set and the same restriction enzyme in each
compartment.
FIG. 3C shows an exemplary schematic of an assay comprising a
different restriction enzyme in each column of compartments and a
different primer set in each row of compartments.
FIG. 3D shows an exemplary schematic of each compartment further
divided into smaller compartments to perform digital amplification
or detection.
FIG. 4 shows an exemplary schematic of a NASBA amplification
reaction.
FIG. 5A shows an exemplary alignment of RNA sequence, priming
region and digestion site for NheI, BstNI, BsrBI, BsrI, and
BcoDI.
FIG. 5B shows an exemplary alignment of RNA sequence and potential
digestion site for 1a 1b subtyping in core region of HCV.
FIG. 6 shows a computer system 601 that is programmed or otherwise
configured to regulate or analyze assays.
FIG. 7 shows an exemplary predicted amplification pattern.
FIG. 8 shows exemplary results for time to positive from an
assay.
FIG. 9 shows exemplary results for number of counts from an
assay.
FIG. 10 shows exemplary digital RT-LAMP results on a SlipChip
platform.
FIG. 11A shows exemplary results for real-time digital and bulk
amplification of HCV genotype 1 with and without NheI.
FIG. 11B shows exemplary results for real-time digital and bulk
amplification of HCV genotype 1 with and without BsrBI.
FIG. 11C shows exemplary results for real-time digital and bulk
amplification of HCV genotype 1 with and without BstNI.
FIG. 11D shows exemplary results for real-time digital and bulk
amplification of HCV genotype 2 with and without NheI.
FIG. 11E shows exemplary results for real-time digital and bulk
amplification of HCV genotype 2 with and without BsrBI.
FIG. 11F shows exemplary results for real-time digital and bulk
amplification of HCV genotype 2 with and without BstNI.
FIG. 11G shows exemplary results for real-time digital and bulk
amplification of HCV genotype 3 with and without NheI.
FIG. 11H shows exemplary results for real-time digital and bulk
amplification of HCV genotype 3 with and without BsrBI.
FIG. 11I shows exemplary results for real-time digital and bulk
amplification of HCV genotype 3 with and without BstNI.
FIG. 11J shows exemplary results for real-time digital and bulk
amplification of HCV genotype 4 with and without NheI.
FIG. 11K shows exemplary results for real-time digital and bulk
amplification of HCV genotype 4 with and without BsrBI.
FIG. 11L shows exemplary results for real-time digital and bulk
amplification of HCV genotype 4 with and without BstNI.
FIG. 12A shows exemplary results from digital RT-LAMP for HCV RNA
Genotype 1 with a matched inhibitor on a SlipChip device.
FIG. 12B shows exemplary results from digital RT-LAMP for HCV RNA
Genotype 1 with a mismatched inhibitor on a SlipChip device.
FIG. 12C shows exemplary results from digital RT-LAMP for HCV RNA
Genotype 1 with no inhibitor on a SlipChip device.
FIG. 13 shows exemplary alignment of RNA sequences for genotypes 1,
2, 3 and 4, priming and molecular beacon probe regions, and
digestion sites of NheI, BsrBI, ApoI, BsrGI, NruI (or Bsp681),
BseYI and BstXI.
FIG. 14 shows exemplary expected amplification results from an
assay.
FIG. 15 shows exemplary results for the time required for NASBA
reaction to change from negative.
FIG. 16A shows an exemplary design and expected results for an
assay for trisomy.
FIG. 16B shows an exemplary design and expected results for an
assay for trisomy.
FIG. 17 shows an exemplary illustration of B side primer and primer
part sequence variants (Seq ID Nos: 70-72 and 51) aligned to a
typical HCV sequence (Seq ID No: 94, Seq ID No: 95) shown together
with amino acid sequences encoded thereby (Seq ID No: 96, and Seq
ID No: 97).
FIG. 18 shows an exemplary illustration of F side primer and primer
part sequence variants (Seq ID No: 43, Seq ID No: 44, Seq ID No: 73
and Seq ID No: 74) aligned to a typical HCV sequence (Seq ID No:
98, Seq ID No: 99) shown together with amino acid sequences encoded
thereby (Seq ID No: 100, and Seq ID No: 101).
FIG. 19 shows exemplary results for the number of positive wells
versus time from a one-step dRT-LAMP HCV RNA detection assay.
FIG. 20 shows exemplary results for the signal from each well
versus time from a one-step dRT-LAMP HCV RNA detection assay.
FIG. 21 shows an exemplary image of a SlipChip device with results
from a one-step dRT-LAMP HCV RNA detection assay.
FIG. 22A shows exemplary results for the number of positive wells
versus time from a one-step dRT-LAMP HCV RNA detection assay.
FIG. 22B shows exemplary results for the number of positive wells
versus time from a one-step dRT-LAMP HCV RNA detection assay.
FIG. 23 shows exemplary results comparing time to positive for
different restriction enzymes at different dilutions.
FIG. 24A shows an exemplary schematic of a SlipChip device top and
bottom.
FIG. 24B shows an exemplary schematic of a SlipChip device aligned
for loading.
FIG. 24C shows an exemplary schematic of a SlipChip device aligned
for compartmentalization.
FIG. 25A shows exemplary results for 1280 fluorescence traces for
the RT-LAMP amplification process of all the wells on a SlipChip
device (solid lines) and normalized averaged fluorescence curve in
bulk (dashed line) in the absence of restriction enzymes.
FIG. 25B shows exemplary results for traces for a digital assay
(solid lines) and for a bulk assay (dashed line) in the presence of
restriction enzyme BsrBI.
FIG. 25C shows exemplary results for the change of cumulative
counts over time for wells exceeding the threshold in FIG. 25A,
(upper five lines), and FIG. 25B (lower lines).
FIG. 26 shows an exemplary histogram of real-time, single-molecule
digital RT-LAMP/RE experiments for HCV GT1 RNA.
FIG. 27A shows exemplary real-time RT-LAMP curves for GT1 in the
absence of restriction enzyme (positive control).
FIG. 27B shows exemplary real-time RT-LAMP curves for GT1 in the
presence of BsrBI.
FIG. 28A shows exemplary predicted results for an amplification
reaction assay with different restriction enzymes and
genotypes.
FIG. 28B shows exemplary experimental results on a device for an
amplification reaction assay with different restriction enzymes and
genotypes.
FIG. 29A shows exemplary experimental results in an electrophoresis
gel for an amplification reaction assay with different restriction
enzymes and genotypes.
FIG. 29B shows exemplary predicted results for an amplification
reaction assay with different restriction enzymes and
genotypes.
FIG. 30A shows exemplary results from a real-time bulk format HCV
genotyping assay.
FIG. 30B shows exemplary results from a digital format HCV
genotyping assay.
FIG. 31A shows exemplary results from a digital format HCV
genotyping assay for genotype 3 without a restriction enzyme,
conducted on a SlipChip device.
FIG. 31B shows exemplary results from a digital format HCV
genotyping assay for genotype 3 with BsrBI, conducted on a SlipChip
device.
FIG. 31C shows exemplary results from a digital format HCV
genotyping assay for genotype 1 with BsrBI, conducted on a SlipChip
device.
FIG. 31D shows exemplary results from a digital format HCV
genotyping assay for genotype 3 with BstNI, conducted on a SlipChip
device.
FIG. 32A shows exemplary results from performance of a NASBA
reaction using a DNA molecular beacon (dashed line) and RNA
molecular beacon (solid line) with standard concentration of RNase
H.
FIG. 32B shows exemplary results from performance of a NASBA
reaction using a DNA molecular beacon (dashed line) and RNA
molecular beacon (solid line) with increased concentration of RNase
H.
FIG. 33A shows exemplary results for mean time to positive from a
modified NASBA reaction.
FIG. 33B shows exemplary results for mean final fluorescent
intensity from a modified NASBA reaction.
FIG. 34A shows a graph of exemplary results from experiments on the
effect of preincubation on the time to positive of restriction
enzyme (ApoI) enhanced RNA NASBA compared to regular NASBA.
FIG. 34B shows exemplary results in an electrophoresis gel from
experiments on the effect of preincubation on the time to positive
of restriction enzyme (ApoI) enhanced RNA NASBA compared to regular
NASBA
DETAILED DESCRIPTION
Overview
Herein described are approaches, devices and methods that can be
used to control a process, such as a detection or an amplification
reaction, by adding a modulator. A modulator can be an external
substance that can produce a modulating (positive or negative)
effect to the process (e.g., amplification) and can change
(increase or decrease) one or more from the following: the rate of
the process, the efficiency of the process, the amount of product,
the identity of the product, or changes in the detection outcome. A
modulator can be an inhibitor, producing a negative modulating
effect. A modulator can be a promoter, producing a positive
modulating effect. Detection can include detection by
amplification, sequencing, mass spectrometry, electrophoresis, and
others, as well as processes used as part of detection, such as
reverse transcription; methods described herein can be used to
impact these processes.
In some cases, processes (e.g. detection and/or amplification
reactions) can be inhibited by the action of the modulator, such as
restriction enzyme or restriction endonuclease (RE) or other
nucleic acid modifying enzymes. For example, restriction enzymes
can cleave templates or products of amplification or reverse
transcription reactions. In some cases, a modulator can comprise a
modified oligonucleotide ("oligo"). Isothermal amplification
processes can provide advantages in these and other cases to
broaden the range of inhibitors available for use to inhibit the
process. In some examples, RNA-guided Cas9 nucleases from CRISPR
system or peptide nucleic acid (PNA) can be used. In some examples,
restriction enzymes (RE) can be used to control the process of
RT-LAMP amplification to perform genotyping (e.g. HCV
genotyping).
FIG. 1 shows an exemplary schematic of an assay design using
amplification in the presence of restriction enzymes to genotype
hepatitis C virus (HCV) RNA. Solid lines between genotypes (ovals,
left side) and restriction enzymes (rectangles, right side)
represent inhibition feedback and dashed lines represent lack of
inhibition feedback. By conducting amplification reactions on a
sample in the presence or absence of different restriction enzymes,
the sample's genotype can be determined based on which inhibitors
recognize the sample nucleic acid and therefore inhibit its
amplification.
FIG. 2 shows a schematic illustrating the possible outcome ("fate")
and rate of an amplification reaction. FIG. 2A shows a starting
molecule (top) with two possible outcomes or fates--no
amplification (left path) and amplification (right path). If the
molecule undergoes amplification, the rate of amplification can
also be measured. FIG. 2B shows a starting nucleic acid molecule
(top) with two possible outcomes or fates in the presence of a
restriction enzyme--amplification (left path) or no amplification
(right path). If the molecule undergoes amplification, the rate of
amplification can also be measured.
In some cases, a ligation reaction (e.g., using a ligase) can be
performed in combination with an amplification reaction, leading,
for example, to the detection of the ligated product. In some
cases, a modulator can modulate a ligation reaction. For example, a
restriction enzyme can digest template or product of a ligation
reaction.
The approaches, methods, and devices disclosed herein can provide
different advantages. In some cases, methods can be used that do
not require post-amplification digestion. In some cases, methods
can be used that do not require electrophoresis, such as gel
electrophoresis or capillary electrophoresis. In some cases,
modulators (e.g., restriction enzymes, oligonucleotides) can
provide specificity, such as by recognizing specific nucleotide
sequences. In some cases, the method can provide high sensitivity,
including single molecule sensitivity. Approaches, devices and
methods disclosed herein can be used to produce nucleic acids for
subsequent uses. Methods disclosed herein can comprise the
detection, quantification, production, or degradation of one or
more nucleic acids, including in a sequence-targeted or
sequence-specific manner Methods disclosed herein can comprise
detection or quantification of a single nucleotide polymorphism
(SNP), a genotype of an allele, modifications of nucleic acid
bases, molecules that interact with nucleic acids (including in a
sequence-targeted or sequence specific manner), transcription
factors, DNA-binding proteins, histones, oligonucleotides, or
enzymes that interact with nucleic acids (including in a
sequence-targeted or sequence specific manner). Methods disclosed
herein can comprise homogeneous reactions. Methods disclosed herein
can comprise one-step reactions or one-pot reactions. Methods
disclosed herein can comprise providing a direct read-out.
The present application incorporates the following applications by
reference in their entireties for any and all purposes: U.S.
Application 61/516,628, "Digital Isothermal Quantification of
Nucleic Acids Via Simultaneous Chemical Initiation of Recombinase
Polymerase Amplification (RPA) Reactions on Slip Chip," filed on
Apr. 5, 2011; U.S. Application 61/518,601, "Quantification of
Nucleic Acids With Large Dynamic Range Using Multivolume Digital
Reverse Transcription PCR (RT-PCR) On A Rotational Slip Chip Tested
With Viral Load," filed on May 9, 2011; U.S. application Ser. No.
13/257,811, "Slip Chip Device and Methods," filed on Sep. 20, 2011;
international application PCT/US2010/028361, "Slip Chip Device and
Methods," filed on Mar. 23, 2010; U.S. Application 61/262,375,
"Slip Chip Device and Methods," filed on Nov. 18, 2009; U.S.
Application 61/162,922, "Sip Chip Device and Methods," filed on
Mar. 24, 2009; U.S. Application 61/340,872, "Slip Chip Device and
Methods," filed on Mar. 22, 2010; U.S. application Ser. No.
13/440,371, "Analysis Devices, Kits, And Related Methods For
Digital Quantification Of Nucleic Acids And Other Analytes," filed
on Apr. 5, 2012; and U.S. application Ser. No. 13/467,482,
"Multivolume Devices, Kits, Related Methods for Quantification and
Detection of Nucleic Acids and Other Analytes," filed on May 9,
2012; U.S. application Ser. No. 13/868,028, "Fluidic Devices and
Systems for Sample Preparation or Autonomous Analysis," filed on
Apr. 22, 2013; U.S. application Ser. No. 13/868,009, "Fluidic
Devices for Biospecimen Preservation," filed on Apr. 22, 2013; and
international application PCT/US13/63594, "Methods and Systems for
Microfluidics Imaging and Analysis," filed on Oct. 4, 2013.
The term "or" as used herein is generally meant inclusively.
The term "about" as used herein means+/-10% of the recited
value.
Reaction Chemistries
The process to be modulated can comprise one or more reactions,
including but not limited to nucleic acid amplification, reverse
transcription, digestion, cloning, ligation, hybridization,
phosphorylation, dephosphorylation, glycosylation, deglycosylation,
ubiquitination, deubiquitination, S-nitrosylation,
denistrosylation, methylation, demethylation, N-acetylation,
deacetylation, lipidation, proteolysis, sequencing, or signal
generation.
Nucleic Acid Amplification
The process to be modulated can comprise nucleic acid
amplification. Various nucleic acid amplification methods can be
used. Modulation methods using restriction enzymes can use nucleic
acid amplification methods wherein the amplification conditions
allow the activity of the restriction enzyme to be preserved or
partially preserved. The nucleic acid amplification method can
comprise polymerase chain reaction (PCR), reverse transcription PCR
(RT-PCR), quantitative PCR (qPCR), reverse transcription qPCR
(RT-qPCR), nested PCR, multiplex PCR, asymmetric PCR, touchdown
PCR, random primer PCR, hemi-nested PCR, polymerase cycling
assembly (PCA), colony PCR, ligase chain reaction (LCR), digital
PCR, methylation specific-PCR (MSP), co-amplification at lower
denaturation temperature-PCR (COLD-PCR), allele-specific PCR,
intersequence-specific PCR (ISS-PCR), whole genome amplification
(WGA), inverse PCR, thermal asymmetric interlaced PCR (TAIL-PCR),
or other methods including isothermal amplification methods.
Isothermal amplification is a form of nucleic acid amplification
which does not rely on the thermal denaturation of the target
nucleic acid during the amplification reaction and hence may not
require multiple rapid changes in temperature. Isothermal nucleic
acid amplification methods can therefore be carried out inside or
outside of a laboratory environment. A number of isothermal nucleic
acid amplification methods have been developed, including but not
limited to Strand Displacement Amplification (SDA), Transcription
Mediated Amplification (TMA), Nucleic Acid Sequence Based
Amplification (NASBA), Recombinase Polymerase Amplification (RPA),
Rolling Circle Amplification (RCA), Ramification Amplification
(RAM), Helicase-Dependent Isothermal DNA Amplification (HDA),
Circular Helicase-Dependent Amplification (cHDA), Loop-Mediated
Isothermal Amplification (LAMP), Single Primer Isothermal
Amplification (SPIA), Signal Mediated Amplification of RNA
Technology (SMART), Self-Sustained Sequence Replication (3 SR),
Genome Exponential Amplification Reaction (GEAR) and Isothermal
Multiple Displacement Amplification (IMDA). Further examples of
such amplification chemistries are described in, for example,
("Isothermal nucleic acid amplification technologies for
point-of-care diagnostics: a critical review, Pascal Craw and
Wamadeva Balachandrana Lab Chip, 2012, 12, 2469-2486, DOI:
10.1039/C2LC40100B,") incorporated here in its entirety by
reference. Isothermal amplification methods that operate at
temperatures lower than PCR operating temperatures can be used,
e.g., to improve compatibility of restriction enzymes with the
amplification process if the restriction enzyme is not sufficiently
stable under typical PCR operating temperatures. Furthermore,
detection methods based on both signal amplification and target
amplification, such as branched-DNA-based detection methodologies,
can be used in this approach. For example, for branched-DNA-based
detection methodologies, using an enzyme that can cleave the target
in a position located between two positions used for binding of the
capture extender and the label extender (e.g., as described in
Tsongalis, Branched DNA Technology in Molecular Diagnostics, Am J
Clin Pathol 2006; 126: 448-453), can reduce the signal obtained in
the assay when a restriction enzyme recognizes and cleaves the
target.
Reverse-transcription loop mediated isothermal amplification
(RT-LAMP) can be used for nucleic acid amplification. RT-LAMP can
be used in an assay, including qualitative and quantitative assays
for nucleic acid detection, for example as shown in Examples 1-5,
Example 8, or Example 9. An RT-LAMP assay can comprise detection of
nucleic acids (such as HCV RNA) in at least one step, the test
comprising at least one nucleic acid primer set capable of
detecting nucleic acids (such as HCV RNA) in a RT LAMP based
molecular test. An RT-LAMP assay use a primer set comprising, for
instance, one pair of forward (FIP) and reverse (BIP) inner
primers, and forward (F3) primer. An RT-LAMP assay can comprise
using loop forward (LF) and/or loop back (LB) primers. An RT-LAMP
assay can comprise using reverse (B3) outer primer. An RT-LAMP
assay can comprise using LF primers that do not anneal or anneal
weakly to a template, such as an HCV RNA template, at a temperature
range applicable for reverse transcription, such as but not limited
to 37-60.degree. C. The temperature range can be optimized for the
selected reverse transcription. This can be done, in some cases, by
selecting the LF primers annealing place in a secondary structure
rich fragment of HCV 5-UTR RNA template, so that the template
self-complimentary duplex Tm for this annealing spot is in a range
appropriate for RT-LAMP temperatures, (such as 58-67.degree. C.).
It may also be done, in some cases, by pre-annealing LF primers
(before adding them to one-step RT-LAMP reaction mixture) with
their complementary template-annealing inhibiting oligonucleotides
(inhibitors), which, in turn, are 3' end modified to prevent their
elongation by DNA polymerase. Such 3' end modifications of
inhibitors may include but are not limited to Dideoxycytidine (ddC)
or Inverted dT. Such an inhibitor may also contain some modified
bases, which help to increase the Tm of the complex with LoopF
primers up to temperatures appropriate for RT-LAMP, such as
58-67.degree. C. An RT-LAMP assay can comprise loop forming primers
where the 5' ends and/or 3' ends (both FIP and BIP) are
complementary (or matching) to the target HCV secondary structure
small and/or large loops in the 5' UTR of the HCV genome, such as,
for example, to the domains II-IV loops in the 5' UTR HCV
structures sequences. An RT-LAMP assay can comprise primers wherein
Tm of the B2 annealing is higher than the Tm of its complementary
template fragment secondary structures, including all the base
pairing, hairpin and internal loops, budges and stuck pairs
communicated in (but not limited to) the published HCV 5'UTR
structure (see, e.g., "Christopher S. Fraser and Jennifer A.
Doudna, Structural and mechanistic insights into hepatitis C viral
translation initiation, Nature Reviews Microbiology 2007, 5:
29-38"). In some cases the net Tm (the temperature at which half of
a template is bound by B2) is in a range applicable for reverse
transcription with the used enzyme, including but not limited to
37-63.degree. C. An RT-LAMP assay can comprise primers wherein the
Tm of the B3 annealing is higher than the Tm of its complementary
template fragment secondary structures for self-assembly, including
all the base pairing, hairpin and internal loops, bulges and stuck
pairs communicated in (but not limited to) the published HCV 5'UTR
structure (see, e.g., "Christopher S. Fraser and Jennifer A.
Doudna, Structural and mechanistic insights into hepatitis C viral
translation initiation, Nature Reviews Microbiology 2007, 5:
29-38"). The net Tm (the temperature at which half of a template is
bound by B3) is in a range applicable for reverse transcription
with the used enzyme, including but not limited to 37-63.degree. C.
In some cases, an RT-LAMP assay can maximally decrease the
probability of loopF primers annealing to RNA template and their
subsequent participation as the primers in reverse transcription.
In some cases, the RT primers (B2 part of BIP, B3 if used) and
melting temperatures (TmB2 and TmB3) can be balanced to be higher
than the melting temperature (Tm2) of the innate secondary
structures of the corresponding parts of the HCV template, and the
temperature of the reverse transcription step can be raised to be
higher than Tm2 as well. The net Tm of B2 and B3 (if used)
heteroduplexes with the template can be in a range applicable for
reverse transcription with the used reverse transcriptase active
enzyme. A reverse transcriptase which is still active at the
temperature higher than Tm2 (including but not limited to
50-65.degree. C.) can be used. In a one-step format, to ensure a
detection of the majority of RNA templates present in reaction
solution, the enzyme used for reverse transcription can have an
RNase H activity, or a strong displacement activity. In some cases,
the elongating ends of the priming sequences of BIP and FIP (which
are 5' ends of B1c and F1c elongating as 3' ends of B1, F1; and 3'
ends of B2 and F2) can be complementary to the secondary structures
free fragments of the template at a chosen temperature applicable
for LAMP, such as including but not limited to 57.degree.
C.-72.degree. C.; as an example: the elongating ends of the loop's
forming primers (both FIP and BIP in a LAMP reaction) can be placed
to be complementary to the published HCV secondary structures'
small or large loops in the 5' UTR of the HCV genome, such as, for
example, to the domains II-IV loops in the 5' UTR HCV structures
sequences.
Nucleic acid sequence based amplification (NASBA) can be used for
nucleic acid amplification. If NASBA is used in combination with
restriction enzymes, the restriction site can be between the
forward and reverse primer, including the priming region. This
approach is not necessarily limited to targeting a single
restriction site. Multiple restriction sites on the same target
nucleic acid can be targeted, either with one enzyme or with a
mixture of several enzymes. Such multiple targeting can be used to
enhance degradation of the target molecules. Such multiple
targeting can be used to target multiple variants of the target
molecule that might be present in the mixture being analyzed, when,
for example, these multiple variants do not need to be
differentiated in that analysis. In some cases, reactions can be
performed on the 5' untranslated region (UTR) of the Hepatitis C
Virus (HCV). This region is known to be highly conserved among
genotypes of the virus, allowing the development of a single
amplification reaction that amplifies, for example, a sequence of
230 basepairs in this region. In some examples, the sequences used
for these reactions include, e.g., the universal forward primer
(P1)
TABLE-US-00001 (Seq ID No: 1)
5'-AATTCTAATACGACTCACTATAGGGCAAGCACCCTATCAGGCAG TA-3',
the universal reverse primer (P2):5'-GTCTAGCCATGGCGTTAGTA-3' (Seq
ID No: 2), or the universal molecular beacon:
5'-/FAM/CGATCGAGCCATAGTGGTCTGCGGAACCGGTCGATCG/BHQ1/-3' (Seq ID No:
3) (DNA or RNA). In some cases, the oligonucleotide modulator
specific for HCV Genotype 1 is GT1_antisense:
5'-AATCTCCAGGCAGTGtcgcc-3' (Seq ID No: 4), while the modulator
specific for HCV Genotype 2 is GT2_antisense:
5'-GACCGGACATAGAGTaaatt-3' (Seq ID No: 5). The modulators can act
to reduce and or inhibit amplification of the target. In this
example, the T7 promoter sequence that is part of primer P1 is
shown in italics and underlined and the stem sequence of the
molecular beacon is indicated in bold. A universal set of primers
can be designed to detect multiple or all HCV genotypes. A
pre-incubation step (e.g., 2-5 min at 65.degree. C. and cooling 10
min at 41.degree. C.) can be included in NASBA protocols. The assay
can lack pre-incubation. A NASBA enzyme mix can be made with
thermostable enzymes, for example thermostable reverse
transcriptase (e.g. RocketScript which may be purchased from
Bioneer or MonsterScript from Epicentre), thermostable RNAse H
(e.g. Hybridase Thermostable Rnase H which may be purchased from
Epicentre or thermostable RNase H2 from IDT) and thermostable T7
RNA polymerase (e.g. Thermo T7 RNA polymerase which may be
purchased from Toyobo). The optimum reaction temperature of these
enzymes is around 50.degree. C.--in some cases the reaction can be
run at about 50.degree. C. to improve the selectivity of annealing
of primers (P1 and P2), molecular beacon (DNA or RNA) and specific
oligonucleotide modulators (sense and antisense), and to decrease
the free energy of secondary structures (kcal/mol).
Nucleic acid-based logic gates and DNA circuits can be used for
nucleic acid amplification. The use of restriction enzymes with
nucleic acid-based logic gates and DNA circuits can reduce or stop
the intrinsic leakage problem for DNA networks. Combining the
molecular recognition ability of both restriction enzymes and DNA
networks, restriction enzyme logic gates can be highly active
components for the design and construction of biocomputational
devices (e.g., Qian and Winfree, Scaling Up Digital Circuit
Computation with DNA Strand Displacement Cascades, Science 2011;
6034: 1196-1201).
Modulators
Modulators (e.g. inhibitors or promoters) can be used in
conjunction with the methods disclosed herein. Modulators can
comprise, for example, restriction enzymes, oligonucleotides,
ligase enzymes, engineered or non-natural nucleases, nucleic acid
modifying enzymes, artificial nucleic acids or nucleic acid
analogs, modified bases, unnatural bases, or repair proteins.
Modulators can be used to recognize specific sequences and slow or
stop amplification reactions from occurring. In some examples, a
restriction enzyme can be selected to cleave a sequence located
between amplification primers, inhibiting amplification. In some
cases, an oligonucleotide can be selected to interfere with or
block primer binding, inhibiting amplification. Modulators can
require activation; for example, a modulator can be inactive until
activated by an enzyme. In one example, an oligonucleotide
modulator is incapable or less capable of binding to the target
nucleic acid until it is activated, such as by restriction enzyme
digestion or ligase assembly.
Modulators can affect processes in different ways. A modulator can
decrease or increase the rate of a reaction. In one example, a
restriction enzyme can digest template or amplified nucleic acid
molecules, slowing down an amplification reaction (e.g., reducing
the rate of production of amplicons). In another example, a
restriction enzyme can affect the structure of a nucleic acid
molecule, allowing easier access to the amplicon and speeding up an
amplification reaction (e.g., increasing the rate of production of
amplicons). A modulator can decrease or increase the probability or
chance that a given molecule will react, or will react sufficiently
to be detected. For example, a restriction enzyme can digest a
template nucleic acid molecule, preventing it from being amplified.
A modulator can affect the efficiency of a reaction. Modulators can
act by competing with the reaction or other process which they
modulate. In one example, a restriction enzyme modulator can
compete with an amplification reaction for the template nucleic
acid molecule. In another example, an oligonucleotide can compete
with nucleic acid amplification primers to bind to the nucleic acid
molecule. Modulators can act prior to the process which they
modulate. Modulators can act during the process which they
modulate. Modulators can act after the process which they
modulate.
Modulators can act on a nucleic acid molecule inside the priming
region of a nucleic acid amplification (within, for example, a
margin of one base). Modulators can act on a nucleic acid molecule
outside the priming region of a nucleic acid amplification (within,
for example, a margin of one base). Modulators can act on a nucleic
acid molecule inside the amplicon region of a nucleic acid
amplification (within, for example, a margin of one base).
Modulators can act on a nucleic acid molecule outside the amplicon
region of a nucleic acid amplification (within, for example, a
margin of one base). Modulators can act by inhibiting off-target
reactions, thereby promoting the primary reaction. Modulators can
act on a nucleic acid molecule in a sequence-specific manner or in
a sequence-targeted manner. For example, a restriction enzyme can
recognize or target a specific sequence or range of sequences, or
an oligonucleotide can selectively bind to a target sequence or
range of sequences. Modulators can act on a nucleic acid in a
modification-specific or modification-targeted manner. For example,
an enzyme can affect nucleic acids in certain states of
modification such as methylation or glycosylation.
Restriction enzymes can be used as modulators. A restriction enzyme
can be type I, type II, type III, type IV, type V or an artificial
restriction enzyme. A restriction enzyme can have digestion
activity for double stranded DNA, single stranded DNA, or DNA:RNA
hybrid molecules. A restriction enzyme can be thermally stable or
not thermally stable. Restriction enzymes compatible with
higher-temperature amplification and detection processes can be
selected from those present in thermophilic organisms, or
restriction enzymes with improved stability can be selected from
those developed using in vitro selection and in vitro evolution
processes. As of October 2013, the Restriction Enzyme Database
(REBASE, New England BioLabs) contained over 3800 biochemically
characterized restriction enzymes. Of over 3600 Type II REs, over
580 are commercially available, including over 220 distinct
specificities from a total of over 250 total specificities known.
The availability of restriction enzymes allows a wide range of
sequences to be targeted as a restriction site.
In some cases, the restriction site can be selected to be located
between the primer sequences used for amplification. It can be
selected to exert an improved or optimized inhibitory effect on the
amplification reaction. For example, when LAMP is used for
amplification, the restriction site can be between the B3 primer
and the F3 primer (e.g., see Example 1). In another example, when
RPA is used, the restriction site can be between the forward primer
and the reverse primer, including the priming region. In another
example, when NASBA is used, the restriction site can be between
the forward and reverse primer, including the priming region. This
approach is not limited to targeting a single restriction site.
Multiple restriction sites on the same target nucleic acid can be
targeted, either with one enzyme or with a mixture of several
enzymes. Such multiple targeting can be used to enhance degradation
of the target molecules, or to target multiple variants of the
target molecule that might be present in the mixture being
analyzed, if, for example, these multiple variants do not need to
be differentiated in that analysis.
In some cases, the restriction enzyme can also be used outside the
priming region. For example, a restriction enzyme can be used to
dissociate the secondary structure of RNA and promote the
amplification process. In such cases, restriction enzyme activity
can be used to promote amplification and detection reactions.
Methods, devices, and approaches discussed herein are not limited
to inhibiting or stopping reactions, but can also be used to
promote amplification and detection reactions. For example, a
restriction enzyme digestion can be incorporated into a NASBA
reaction to digest out of the amplicon (off-target) regions or
products, decreasing the amount of non-specific product and
enhancing the reaction. Restriction enzymes with a target sequence
not included in the amplified product can be used to omit the
recommended pre-incubation step for NASBA.
Artificial restriction enzymes such as zinc-finger nucleases (ZFNs)
(see, e.g., "F. D. Urnov, J. C. Miller, Y. L. Lee, C. M.
Beausejour, J. M. Rock, S. Augustus, A. C. Jamieson, M. H. Porteus,
P. D. Gregory and M. C. Holmes, Highly efficient endogenous human
gene correction suing designed zinc-finger nucleases, Nature, 2005,
435, 646-51"), transcription activator-like effector nucleases
(TALENs) (see, e.g., "M. Christian, T. Cermak, E. L. Doyle, C.
Schmidt, F. Zhang, A. Hummel, A. J. Bogdanove and D. F. Voytas,
Targeting DNA double-strand breaks with TAL effector nucleases,
Genetics, 2010, 186, 757-61"), meganucleases (see, e.g., "G. Silva,
L. Poirot, R. Galetto, J. Smith, G. Montoya, P. Duchateau and F.
Paques, Meganucleases and other tools for targeted genome
engineering: perspectives and challenges for gene therapy, Curr
Gene Ther, 2011, 11: 11-27"), or RNA-guided engineered nucleases
via Cas9 (RGENs) (see, e.g., P. Mali, L. Yang, K. M. Esvelt, J.
Aach, M. Guell, J. E. DiCarlo, J. E. Norville and G. M. Church,
RNA-guided human genome engineering via Cas9, Science, 2013, 339:
823-6 and J. M. Kim, D. Kim, S. Kim" and "J. S. Kim, Genotyping
with CRISPR-Cas-derived RNA-guided endonucleases, Nat Commun, 2014,
5, 3157") can be used to target identified genetic markers.
At least three types (I-III) of clustered short palindromic repeats
(CRISPR) systems have been identified across a wide range of
bacterial hosts and can be used as modulators. Type I and III
systems use a specialized CRISPR-associated nuclease (Cas) that
processes the precursor CRISPR RNA (pre-crRNA), and once mature,
each crRNA assembles into a large multi-Cas protein complex capable
of recognizing and cleaving nucleic acids complementary to the
crRNA. In contrast, type II CRISPR process pre-crRNAs by a
different mechanism in which a trans-activating crRNA (tracrRNA)
complementary to the repeat sequences in pre-crRNA triggers
processing by the double double-stranded (ds) RNA-specific
ribonuclease RNase II in the presence of Cas9 protein. Following
the hybridization between the two non-coding RNAs, Cas9 is targeted
to the genomic loci matching a 20 nucleotide guide within the
crRNA, immediately upstream of a 5'NGG protospacer adjacent motif
(PAM). crRNA and tracrRNA can be fused to generate a chimeric
single-guide RNA (sgRNA) that mimics the natural crRNA-tracrRNA
hybrid. Both crRNA-tracrRNA duplexes and sgRNA can be used to
target Cas9 for multiplexed genome editing. The methodologies
described herein can include the use of the CRISPR system to affect
the processes of detection or amplification. Methodologies can
include the use of Cas9 or its homologues or functional analogues,
such as crRNA and tracrRNA or sgRNA (origin of RNA includes the one
made in situ or ex situ by in vitro transcription) to control
nucleic acid amplification processes in a sequence specific manner,
where the activity of Cas9 can be preserved or partially preserved
under the conditions of amplification or detection. In some
examples, the specificity of the Cas9-crRNA-tracrRNA or Cas9-sgRNA
complexes can be modified by matching the sequence of the crRNA
with the target of interest. In some examples, these elements could
be combined with a detection or an amplification scheme to
identify, detect or differentiate nucleic acid sequences. In some
examples, by mixing these three elements in a PCR reaction,
together with the DNA or RNA template, the PCR product can be
cleaved while amplification is occurring, changing the outcome of
the reaction (e.g., including but not limited to: from positive to
negative, delayed time to positive or less number of counts in
digital format) and avoiding additional steps which other methods,
such as RFLP, can entail. This cleavage can occur, for example,
based on a specific single nucleotide polymorphism (SNP) and the
sequence surrounding it. Isothermal amplification methods (e.g.,
NASBA, LAMP, RPA, RCA) can have high compatibility with Cas9
systems during the process of amplification and can be used. In
some examples, the use of engineered Cas9-crRNA-tracrRNA can
overcome the limited availability of restriction endonuclease
sites.
Ligase enzymes can be used as modulators, including as inhibitors
or promoters. For example, a ligase enzyme can ligate two nucleic
acid molecules, allowing subsequent amplification of the ligated
product. A ligase enzyme can ligate two nucleic acid molecules,
promoting a folding of the ligated product with inhibits, prevents,
promotes, or enables subsequent amplification.
Oligonucleotides can be used as modulators, including as inhibitors
("oligos" or "oligo inhibitors"). Recognition, hybridization and
blocking of a specific sequence by an oligonucleotide can be used
to stop or delay a reaction of interest. The use of
oligonucleotides is not limited to inhibition of reactions, and can
also be used to enhance certain reactions, for example by affecting
the secondary structure of a nucleotide target, or by inhibiting
off-target reactions. Oligonucleotides can comprise synthetic or
naturally produced nucleic acid molecules. Modified nucleic acids
or nucleic-acid-like structures (e.g., peptide nucleic acids or
PNAs) can also be used, which can also be referred to as "oligos"
or "oligo inhibitors." In some examples, an oligonucleotide
inhibitor binds more tightly or faster to the target template or
intermediate product than, for example, the primers in the
amplification reaction. These oligonucleotides can be longer than
primers used for amplification. These oligonucleotides can contain
bases with or without modifications that bind more tightly to the
target. These oligonucleotides can be designed with special
structures (e.g., toe-hold structures), such as those used to
facilitate, accelerate or improve the specificity of DNA origami,
DNA self-assembly, or DNA circuits. The specificity of inhibitors
can be controlled or altered, in some examples, by the sequence of
the oligonucleotides, which can be tuned by a number of methods,
including by altering the percentage of matches between inhibitors
and template, or primers and template. The oligonucleotides can, in
some cases, include some modifications (e.g., locked nucleic acid
(LNA) or dideoxynucleotides (ddNTPs)), to increase the specificity,
change the annealing temperature, or produce a stronger inhibition
effect. If the priming region is targeted, the oligonucleotide
inhibitor can be chosen to bind more tightly or faster to the
target template or intermediate product (for example, it be longer
than primers used for amplification, or contain bases with or
without modifications that bind more tightly to the target) than
the primers in the competition. The specificity of the inhibitors
can be controlled by the sequence of the oligonucleotide, which can
be tuned by a number of methods, including by altering the
percentage of matches between inhibitors and template, or primers
and template. The oligonucleotides could include some modifications
(e.g., LNA, ddNTPs) to increase the specificity, change the
annealing temperature, or produce a stronger inhibition effect.
Oligonucleotides can comprise peptide nucleic acid (PNA). Peptide
nucleic acid is a type of nucleic acid analogue that replaces the
sugar phosphate backbone with N-(2-amino-ethyl)-glycine units. Due
to the fact that the backbone is uncharged, unlike DNA, the thermal
stability of a PNA:DNA duplex is higher than that of dsDNA. It is
also resistant to hydrolytic (enzymatic) cleavage and typically
cannot be recognized by polymerase as a primer from which to
extend. PNA-directed PCR clamping and selective inhibition by PNA
in an isothermal amplification system can be used with the
methodologies described herein. The following publications are
incorporated here by reference in their entireties for all
purposes: "Drum, H., P. E. Nielsen, M. Egholm, R. H. Berg, O.
Buchardt, and C. Stanley, Single base pair mutation analysis by PNA
directed PCR clamping, Nucleic Acids Res 1993, 21(23): 5332-5336,"
"K Tatsumi, Y Mitani, J Watanabe, H Takakura, K Hoshi, Y Kawai, T
Kikuchi, Y Kogo, A Oguchi-Katayama, Y Tomaru, H Kanamori, M Baba, T
I shadao, K Usui, M Itoh, P E Cizdziel, A Lezhava, M Ueda, Y
Ichikawa, I Endo, S Togo, H Shimada, and Y Hayashizaki, Rapid
screening assay for KRAS mutations by the modified smart
amplification process, J Mol Diagn 2008, 10(6): 520-526," "Jae-jin
Choi, Chunhee Kim, and Heekyung Park, Peptide nucleic acid-based
array for detecting and genotyping human papillomaviruses. J Clin
Microbiol 2009, 47(6): 1785-1790," and "Lizardi, P. M. (1993)
Rolling circle replication reporter systems, Yale University, U.S.
Pat. No. 7,618,776 B2." Together with some nucleases (e.g., 51
nuclease), PNA can function as an artificial restriction enzyme by
the invasion mechanism to dsDNA of PNA and degradation by nuclease
of the generated ssDNA part, (see, e.g., "A. Ray and B. Norden,
Peptide nucleic acid (PNA): its medical and biotechnical
applications and promise for the future, FASEB J 2000, 14:
1041-1060"). In some examples, this approach can be used in
combination with one or more isothermal amplification chemistry.
This approach can be used with a variety of target nucleic acids
(ssDNA, RNA, dsRNA or dsDNA). Using PNA as a diagnostic tool for
genotyping and subtyping (e.g., of influenza) can be conducted
qualitatively or quantitatively. The materials and methods
described in ("K Kaihatsu, S Sawada, and N Kato, Rapid
Identification of Swine-Origin Influenza A Virus by Peptide Nucleic
Acid Chromatography, Antivirals & Antiretrovirals 2013, 5(4):
077-079") can be used in combination with the methodologies
described herein.
Oligonucleotides (e.g., unmodified oligonucleotides such as RNA and
DNA, and modified oligonucleotides such as PNA and LNA) can be used
alone or in combination with certain enzymes (e.g., genome editing
engineered nucleases or methylase) as modulators, to tune the
process of amplification in a sequence-specific manner. This can
allow targeting new emerging targets while retaining the assay
setup, and the high throughput in screening different sequences,
which could facilitate pandemic disease monitoring and
epidemiological surveillance, for example in the case of influenza
A genotyping/subtyping.
Oligonucleotide modulators can be used in combination with RNase H
to modulate a nucleic acid amplification reaction. For example, a
sequence-specific DNA oligonucleotide modulator (e.g., an
inhibitor) complementary to an RNA template or product RNA (e.g.,
antisense RNA produced by NASBA reaction), can anneal to a target
nucleic acid and generate a DNA/RNA hybrid recognizable by RNase H.
RNase H can be used to cleave the RNA strand from a heteroduplex.
This oligonucleotide modulator-guided cleavage can prevent further
amplification of the RNA strand, changing rate of the reaction or
final number of amplified molecules ("fate"). The guide-RNase H can
be used to target specific sequences within a sequence targeted by
a variety amplification reactions, including but not limited to
Recombinase Polymerase Amplification (RPA), Loop-mediated
isothermal amplification (LAMP), Helicase-dependent amplification
(HAD), Strand displacement amplification (SDA), and Nicking enzyme
amplification reaction (NEAR).
RNA molecular beacons can be used as modulators. For example, an
RNA molecular beacon and an increased concentration of RNase H can
be used to increase the efficiency of a NASBA reaction. NASBA makes
use of RNase H to degrade the RNA/DNA heteroduplex created by
reverse transcription, enabling the hybridization of additional
primers and the generation of double-stranded DNA. Therefore,
higher RNase H concentration can benefit the performance of NASBA
reaction because the described steps will proceed more rapidly. The
amount of RNase H can be limited because of the presence of
sequence specific DNA molecular beacons, which can hybridize to a
NASBA product (e.g. antisense RNA) generating a DNA/RNA
heteroduplex that can be recognized and cleaved by the RNase H. At
high concentration this cleavage of the NASBA product decreases the
efficiency of the reaction. In order to increase efficiency of
NASBA reaction while avoiding undesired cleavage an RNA molecular
beacon can be used, allowing an increased amount of RNase H. A
thermostable RNase H can be used, e.g, to avoid losing activity
during steps with elevated temperature (e.g. pre-incubation of
NASBA reaction). The binding of primers to RNA templates can
produce a DNA/RNA heteroduplex detectable by RNase H. In some
examples, this modified NASBA reaction can make use of
RNA-containing primers P1 or P2 to prevent the RNase H mediated
degradation of template due to primer annealing. A modulator can be
a non-specific nuclease that cleaves RNA.
The enzyme RNase H is a non-specific nuclease that cleaves RNA.
RNase H's ribonuclease activity cleaves the 3'-O--P bond of RNA in
a DNA/RNA duplex to produce 3'-hydroxyl and 5-phosphate terminated
products. Therefore, RNAse H can be used as a modulator of an
amplification reaction by cleaving the RNA template or by cleaving
the generated RNA product (e.g., in a NASBA reaction). Other RNA-
and DNA-cleaving enzymes can be used as well. FIG. 4 shows an
exemplary schematic of a NASBA amplification reaction with the P1
(antisense)-P2 (sense) primer set. The overhang on the P1 encodes
the promoter sequence for the T7 RNA polymerase. A molecular beacon
with a fluorophore and a quencher with the NASBA amplification
reaction can generate a real-time detection system. Antisense
oligonucleotide (AO) modulator guides RNase H to specifically
cleave RNA template while sense oligonucleotide (SO) modulator
guides RNase H to specifically cleave generated antisense RNA.
Antisense oligonucleotide (AO) modulator and sense oligonucleotide
(SO) modulator can be used individually or in combination. DNA or
RNA molecular beacons target antisense RNA In some cases, in order
to modulate the reaction in a sequence specific manner, the
amplification system can be modified by the incorporation of RNAse
H and an oligonucleotide modulator complementary to the targeted
RNA. In some examples, this oligonucleotide can anneal to the
target RNA strand, and in some examples it can generate a DNA/RNA
hybrid that will be recognized by the RNAse H, cleaving the RNA
template and consequently reducing the initial amount of template
that would proceed to a successful amplification (Antisense
Oligonucleotide (AO), FIG. 4). In some cases, the oligonucleotide
modulator can target the produced RNA (e.g., antisense RNA) and can
slow down the reaction (Sense Oligonucleotide (SO), FIG. 4). In
some examples, the combination of a specific oligonucleotide
modulator together with a non-specific nuclease can generate a
guide-RNase H that can be used to specifically target a sequence of
interest. In order to cleave the RNA, RNAse H needs a DNA/RNA
hybrid with 4 or more nucleotides perfectly matched (see, e.g.,
"Donis-Keller H. Site specific enzymatic cleavage of RNA. Nucleic
Acids Res. 1979 Sep. 11; 7(1):179-92"). This property can be used
to identify single nucleotide point mutations. For example, in some
cases an oligonucleotide modulator of 7 bases can be designed to
target a sequence where a SNP (single nucleotide polymorphism)
could be present in the 4th position; the oligonucleotide can
hybridize under correct reaction conditions in the presence or
absence of the SNP, but RNAse H activity can be limited due to the
absence of the SNP. A perfectly matching RNA/DNA hybrid can be
cleaved, preventing amplification of the template, while the
presence of a SNP can prevent RNAse H activity, allowing
amplification as normal. Other enzymes that are sensitive to
matched or mismatched hybridization products can be used similarly,
including enzymes that detect one or more modifications of one or
more of nucleic acid bases. The units of RNase H typical NASBA
reactions can be limited because readout can be tied to the
presence of specific DNA molecular beacons (oligonucleotide
hybridization probes that can report the presence of specific
nucleic acid) which hybridize to the major NASBA product, antisense
RNA, generating a DNA/RNA heteroduplex. In such cases, at high
concentrations, RNase H can cleave the RNA and the efficiency of
the reaction can be reduced. Increasing the amount of RNAse H can
benefit the performance of the reaction because steps in which
RNAse H is involved (indicated with an asterisk, FIG. 4) will
proceed more rapidly; however this can be balanced with the
cleavage induced by the presence of DNA molecular beacon. In some
examples, in order to increase RNAseH concentration and positively
affect efficiency of guided-RNAse H, the NASBA reaction can be
modified in one or more of the following ways: (i) increase the
amount of RNase H; (ii), select a thermostable RNAseH to avoid
losing activity during pre-incubation of NASBA reaction; (iii)
incorporate an RNA molecular beacon to avoid undesired cleavage
promoted by the DNA probe/RNA antisense hybrid. As a result of this
change to an RNA beacon, in modified NASBA, reaction efficiency can
be improved. In addition, the competition between the
concentrations of molecular beacons in the system with the RNAse H
activity can be reduced or eliminated. As a result, greater
quantities of the RNA based molecular beacon can be added to
increase the fluorescent intensity of the product. In another
example, the Guide-RNase H system can be used to increase the
specificity or accuracy of amplification reactions. By
incorporating oligonucleotides that cannot hybridize to the target
sequence for amplification, but rather to off-target NASBA
products, these side-reactions can be selectively inhibited. In
addition, it is possible to generate oligonucleotides that differ
from conserved template regions by enough bases to prevent
annealing at reaction temperatures. The activity of RNase H can
then prevent the accumulation of errors in these regions. For
example: NASBA is known to suffer from the amplification of
off-target sequences due to its use of error-prone T7 polymerase
and AMV reverse transcriptase. As a result, off-target
oligonucleotides can be targeted this way to the region of a
molecular beacon thus preventing the amplification of products
undetectable by the beacon. In another example, this inhibition of
non-specific product can be caused not by the use of the
Guide-RNase H system but rather by the use of restriction enzymes.
In one example, the restriction enzyme ApoI was shown to recover
the specificity of a NASBA reaction performed without a
pre-incubation step.
Repair proteins (e.g., MutH, MutL, and MutS) can be used to produce
a sequence specific interference or inhibition of a nucleic acid
amplification system: For example, the Escherichia coli
methyl-directed DNA mismatch repair system (see, e.g., "Smith, J.
and P. Modrich, Mutation detection with MutH, MutL, and MutS
mismatch repair proteins. Proc Natl Acad Sci USA 1996, 93(9):
4374-4379") can identify and repair base-base mispairs and up to
three nucleotide insertion/deletion mismatches. Repair is initiated
by binding of MutS to the mispair. Binding of MutL to this complex
results in activation of MutH (ATP-dependent activation of
endonuclease activity), which incises the heteroduplex at d(GATC)
sequences in the vicinity of the mispair. In some examples,
combining the complex MutHLS or using one of these three proteins
together with a nucleic acid amplification system can produce
sequence-specific interference of the system. MutS is able to
suppress a nucleic acid extension reaction by binding specifically
to a mismatched base pair (see, e.g., Hayashizaki, Y; Itoh, M.;
Usui K.; Kazuhito M.; and Kanamori H., Novel MutS protein and
method of using same to determine mutations, 2011, Patent number EP
2 371 951 A1). This approach is not limited to these specific
proteins; rather, other proteins with related functional activities
can be used instead or in addition to these proteins.
Chemical modification of nucleic acids can be used to modulate
nucleic acid amplification. For example, a DNA intercalator
modified with an azide group (e.g., propidium monoazide (PMA)) or
other cross-linking group can be used as a modulator, inducing
modification of DNA that can interfere with amplification or
detection reactions. Providing both a chemical modifier and
reagents for amplification or detection reactions can allow
competition between the modification reaction and the amplification
or detection reaction. Chemically modified probes (e.g.,
oligonucleotides, PMA, or other probes described herein), similarly
modified with azide or other cross-linking groups, can provide
specificity in associating with a target nucleic acid and
modulating (e.g., inhibiting) amplification or detection reactions.
Similarly, these approaches can be used to enhance association
between a primer and a target nucleic acid, promoting
amplification.
Assays
The devices and methods described herein can be applied for assays
to detect genetic variation, including differences in genotypes,
ranging in size from a single nucleotide site to large nucleotide
sequences visible at a chromosomal level. Such genotype or
polymorphism analysis can be used for applications including but
not limited to early diagnosis, prevention and treatment of human
diseases; systematics and taxonomy; population, quantitative, and
evolutionary genetics; plant and animal breeding; identifying
individuals and populations (paternity and forensic analysis),
infectious disease diagnostics and monitoring and surveillance,
epidemiology. Examples of some applications of inventions described
herein are provided herein. These applications are not limited to
the use of any of the methods described herein may be used for
these applications, including those using different modulators
(e.g., restriction enzymes or oligonucleotides), including
inhibitors or promoters.
An assay can comprise conducting a reaction (e.g., amplification)
on a reagent (e.g., nucleic acid) in the presence of a modulator
(e.g., restriction enzyme) and comparing the results of the
reaction (e.g., reaction rate, reaction efficiency, reaction
outcome, positive or negative signal generation) to a reaction
conducted without a modulator. This can reveal a difference in
reaction outcome, indicating the presence or identity of a reagent
which is affected by the chosen modulator. An assay can comprise
conducting a reaction (e.g., amplification) on a reagent (e.g.,
nucleic acid) in the presence of a modulator (e.g., restriction
enzyme) and comparing the results of the reaction (e.g., reaction
rate, reaction efficiency, reaction outcome, positive or negative
signal generation) to a reaction conducted on a different reagent.
This can reveal a difference in the effect of the modulator on the
two different reagents, indicating the identity of the reagents or
of the modulator. An assay can comprise conducting multiple
reactions (e.g., amplification) on a reagent (e.g., nucleic acid)
in the presence or absence of a modulator (e.g., restriction
enzyme) or multiple modulators; the pattern of reaction outcomes in
the presence or absence of each modulator can be used to generate a
pattern or "fingerprint." This pattern can be compared to one or
more reference patterns indicating a particular reagent (e.g., a
nucleic acid with a particular genotype), allowing identification
of the reagent. Modulators can be provided before, during, or after
various sample handling steps, sample preparation steps, or
reaction steps. The above assays can be extended to 2, 3, 4, 5, 6,
7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75,
80, 85, 90, 95, 100, or more different reagents, modulators, or
both.
Modulators (e.g., restriction enzymes or oligonucleotides), either
promoters or inhibitors, can be used in conducting multiplexed
measurements. For example, when multiple variants (e.g., genotypes
of the HCV virus) need to be differentiated, multiple restriction
enzymes can be chosen to selectively target amplicons arising from
these genotypes. These reactions can be, for example, performed in
separate compartments for each enzyme or enzyme mixture, as
described elsewhere in this application for multiplexed
measurements. A sufficient number of restriction enzymes of
sufficiently different selectivity can be chosen such that each
variant can be uniquely identified. For example, the number of
enzymes used can be equal to or larger than the number of variants
to be differentiated and identified, although this is not always
required. In some examples, a cascade that processes samples
sequentially through several conditions can be applied to provide
higher throughput. One reaction can run through multiple steps for
short amount of time, and then the reaction result can be read out
only at the last step of the cascade, or the result for all steps
can be read out at once at the end of the cascade. The restriction
enzyme can be deactivated at the end of each step of the cascade.
The system can be designed in a way (e.g., by using different
primers for each condition) that only when the target is specific
to a certain combination of enzymes is a positive readout generated
in the last step. Thus the spatial multiplexing of restriction
enzymes, such as in FIG. 3, can be transferred to temporal
multiplexing. FIG. 3 shows exemplary nucleic acid profiling panels.
FIG. 3A shows one set of universal primers or amplification
chemistry with different restriction enzymes in each compartment.
FIG. 3B shows one type of restriction enzyme with different sets of
primers or amplification chemistries in each compartment. FIG. 3C
shows multiple sets of primers or amplification chemistries with
multiple restriction enzymes. FIG. 3D shows each compartment
further divided into smaller compartments to perform digital
amplification or detection, where one smaller compartment only
contains one molecule or no molecule. White spots represent
positive reactions (e.g., the restriction enzyme does not
substantially recognize any target sequence and does not
significantly influence the reaction rate), while the black spots
represent negative reactions (e.g., the restriction enzyme
recognizes a target sequence in the amplicon and so the reaction is
delayed or stopped). Each species or genotype assayed can generate
a specific nucleic profile or "fingerprint" corresponding to its
identity. This exemplary assay can also be implemented using other
modulators, such as oligonucleotides. This highly multiplexed panel
can be performed in any format comprising confined volumes, for
example, on a well plate, in a SlipChip device (e.g., Feng Shen,
Wenbin Du, Elena K. Davydova, Mikhail A. Karymov, Janmaj ay Pandey,
and Rustem F. Ismagilov, Nanoliter Multiplex PCR Arrays on a
SlipChip, Analytical Chemistry 2010; 82:4606-4612), in an emulsion
droplet system (e.g., RainDance or Quantalife systems), or
functionalized bead (e.g., BeadArray or Luminex systems).
Assays can comprise genetic fingerprinting (e.g., DNA testing, DNA
typing or DNA profiling). This methodology can use the
individuality of DNA molecules to distinguish between organisms or
to show the relationships between them. For example, restriction
fragment length polymorphism (RFLP) analysis can be used for
genetic fingerprinting. Detecting RFLPs involves fragmenting a
sample of DNA by a restriction enzyme, which can recognize and cut
DNA wherever a specific short sequence occurs. The resulting DNA
fragments can then be separated by length, for example through an
agarose gel electrophoresis, and analyzed, for example by transfer
to a membrane via the Southern blot procedure followed by
hybridization of the membrane to a labeled DNA probe to determine
the length of the fragments which are complementary to the probe.
An RFLP occurs when the length of a detected fragment varies
between individuals and can be used in genetic analysis. Assays
disclosed herein can produce a distinct pattern based on the
generation of a specific amplicon and the combination of different
restriction enzymes during the amplification method, for example as
shown in FIG. 3. This methodology does not require
post-amplification treatment for the readout and can generate a
specific identity or fingerprint for each analyzed target. Using a
panel comprising one or more preloaded restriction enzymes can be
used to generate a DNA profile for a specific amplicon or
amplicons. Exemplary applications of this assay include
epidemiological surveillance (for example, microbiological typing
systems for Salmonella spp., Escherichia spp., Staphylococcus spp.,
Campylobacter spp., Listeria spp. and others); bacterial species
are grouped showing maximal similarity phenotypic and genotypic
characters, however species may often be subdivided ("typed") on
the basis of characters of a single class (e.g., biotyping,
serotyping, phage typing, bacteriocin typing) and practical use of
this can be made to obtain information about sources and routes of
infection (epidemiological surveillance). Other applications
include characterization of genetic patterns associated to health
or diseases status (e.g., cancer), detection of drug resistance
mutations (e.g., HIV and HCV), and identification of antibiotic
resistance (e.g., Methicillin-resistant Staphylococcus aureus
(MRSA)) can be accomplished using the methodologies described
herein.
An assay can comprise conducting one or more reactions on a target
and observing reaction results. For example, an assay can comprise
combining reagents for two different reactions with a target shared
by both reactions, and observing the outcome of the competing
reactions. The outcome can be observed and used to determine
information about one or more of the conducted reactions, such as
reaction rate or reaction efficiency.
Assays can be conducted in a digital format, that is, assays can be
conducted on a sample divided into partitions containing one or
zero target molecules (e.g., nucleic acid molecules). In some
cases, some partitions can contain more than one target molecule;
in some cases, the majority of partitions contain one or zero
target molecules. This digital or single molecule format can be
used in conjunction with assays described herein, including
identification, detection, genotyping, SNP detection, rare allele
detection, and quantification of nucleic acids. Modulation,
including inhibition, of a reaction at single molecule level can be
different from that at bulk level. For example, in the case of
inhibition by restriction enzyme, in bulk reaction, a molecule that
is not inhibited or is less inhibited can cause amplification or
detection, thus lead to a positive of the entire mixture. In a
digital single molecule format, such a molecule will be confined,
for example, to a single partition or compartment, leading to a
positive in that single compartment. Results can be presented in a
binary format (e.g., yes/no, on/off), with each partition either
giving rise to a signal or not giving rise to a signal (e.g., an
indicator or readout reaches or does not reach a chosen threshold
value). By performing the reaction in digital format, it is
possible to translate a kinetic difference in amplification between
into probability difference (e.g., an increased or decreased
probability that a single sample molecule present in a partition
will be amplified), as shown for example in FIG. 10, allowing the
binary results from the partitions to be read or collected with an
end-point measurement. Quantitative results can also be obtained
from digital assays, allowing both genotyping and quantification of
viral load, for example. Quantitative results can also be obtained
from a sample with more than type of one target nucleic acid
present, allowing analysis of a population distribution between
targets. Real-time monitoring during the reaction can be used,
alone or in combination with digital or binary format results, to
observe a kinetic difference in amplification between samples.
Real-time digital analysis can provide information on the rate of
individual amplification reactions, on the distribution and the
heterogeneity of the rate of the amplification reactions, and on
the number of successful amplification reactions. This information,
in combination with the methods and reagents described herein, can
be used to enhance the quality of nucleic acid analysis or
detection. For example, real time digital analysis can be used to
analyze HCV genotyping RT-LAMP reactions. Real-time digital
analysis is not required for all cases, and end-point digital
analysis can be sufficient. In end-point digital analysis, as
described above, a single measurement of the extent of reaction is
obtained for the partitions or compartments of interest, and used
for analysis. Assays can also be performed in a quasi-digital
format, which is similar to the digital format described above
except that more than one copy of a target (e.g., 2, 3, 4, 5, 6, 7,
8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, or more copies of a
target) can be present in a single partition. In some cases, more
than one copy of a target can be present in the majority of
partitions. Nonetheless, each partition either generates a positive
or a negative signal, and results can be analyzed similarly to a
digital assay.
Examples of digital amplification and examples of genotyping
applications are described in the following patents and papers
incorporated here by reference in their entirety: U.S. Application
61/516,628, "Digital Isothermal Quantification of Nucleic Acids Via
Simultaneous Chemical Initiation of Recombinase Polymerase
Amplification (RPA) Reactions on Slip Chip," filed on Apr. 5, 2011;
U.S. Application 61/518,601, "Quantification of Nucleic Acids With
Large Dynamic Range Using Multivolume Digital Reverse Transcription
PCR (RT-PCR) On A Rotational Slip Chip Tested With Viral Load,"
filed on May 9, 2011; U.S. application Ser. No. 13/257,811, "Slip
Chip Device and Methods," filed on Sep. 20, 2011; international
application PCT/US2010/028361, "Slip Chip Device and Methods,"
filed on Mar. 23, 2010; U.S. Application 61/262,375, "Slip Chip
Device and Methods," filed on Nov. 18, 2009; U.S. Application
61/162,922, "Sip Chip Device and Methods," filed on Mar. 24, 2009;
U.S. Application 61/340,872, "Slip Chip Device and Methods," filed
on Mar. 22, 2010; U.S. application Ser. No. 13/440,371, "Analysis
Devices, Kits, And Related Methods For Digital Quantification Of
Nucleic Acids And Other Analytes," filed on Apr. 5, 2012; and U.S.
application Ser. No. 13/467,482, "Multivolume Devices, Kits,
Related Methods for Quantification and Detection of Nucleic Acids
and Other Analytes," filed on May 9, 2012; U.S. application Ser.
No. 13/868,028, "Fluidic Devices and Systems for Sample Preparation
or Autonomous Analysis," filed on Apr. 22, 2013; U.S. application
Ser. No. 13/868,009, "Fluidic Devices for Biospecimen
Preservation," filed on Apr. 22, 2013; and international
application PCT/US13/63594, "Methods and Systems for Microfluidics
Imaging and Analysis," filed on Oct. 4, 2013; Feng Shen, Wenbin Du,
Jason E. Kreutz, Alice Fok, and Rustem F. Ismagilov, "Digital PCR
on a SlipChip," Lab Chip 2010 10: 2666-2672; Feng Shen, Elena K.
Davydova, Wenbin Du, Jason E. Kreutz, Olaf Piepenburg, and Rustem
F. Ismagilov, "Digital Isothermal Quantification of Nucleic Acids
via Simultaneous Chemical Initiation of Recombinase Polymerase
Amplification Reactions on SlipChip," Analytical Chemistry 2011
83:3533-3540; Feng Shen, Bing Sun, Jason E. Kreutz, Elena K.
Davydova, Wenbin Du, Poluru L. Reddy, Loren J. Joseph, and Rustem
F. Ismagilov, "Multiplexed Quantification of Nucleic Acids with
Large Dynamic Range Using Multivolume Digital RT-PCR on a
Rotational SlipChip Tested with HIV and Hepatitis C Viral Load,"
JACS 2011 133: 17705-17712; Christina Fan, H., Gu, W., Wang, J.,
Blumenfeld, Y. J., El-Sayed, Y. Y. & Quake, S. R. Non-invasive
prenatal measurement of the fetal genome. Nature 487, 320-324,
(2012); Gansen, A., Herrick, A. M., Dimov, I. K., Lee, L. P. &
Chiu, D. T. Digital LAMP in a sample self-digitization (SD) chip.
Lab Chip 12, 2247-2254, (2012); Thorsen, T., Maerkl, S. J. &
Quake, S. R. Microfluidic large-scale integration. Science 298,
580-584, (2002); Ottesen, E. A., Hong, J. W., Quake, S. R. &
Leadbetter, J. R. Microfluidic digital PCR enables multigene
analysis of individual environmental bacteria. Science 314,
1464-1467, (2006); Fan, H. C., Blumenfeld, Y. J., Chitkara, U.,
Hudgins, L. & Quake, S. R. Noninvasive diagnosis of fetal
aneuploidy by shotgun sequencing DNA from maternal blood. Proc.
Natl. Acad. Sci., U.S.A. 105, 16266-16271, (2008); Du, W. B., Li,
L., Nichols, K. P. & Ismagilov, R. F. SlipChip. Lab Chip 9,
2286-2292, (2009); Fan, H. C., Blumenfeld, Y. J., El-Sayed, Y. Y.,
Chueh, J. & Quake, S. R. Microfluidic digital PCR enables rapid
prenatal diagnosis of fetal aneuploidy. Am. J. Ob. Gynecol. 200,
543.e541-543.e547, (2009); Liu, W. S., Chen, D. L., Du, W. B.,
Nichols, K. P. & Ismagilov, R. F. Slip Chip for Immunoassays in
Nanoliter Volumes. Anal. Chem. 82, 3276-3282, (2010); Shen, F., Du,
W. B., Davydova, E. K., Karymov, M. A., Pandey, J. & Ismagilov,
R. F. Nanoliter Multiplex PCR Arrays on a SlipChip. Anal. Chem. 82,
4606-4612, (2010); Heyries, K. A., Tropini, C., VanInsberghe, M.,
Doolin, C., Petriv, O. I., Singhal, A., Leung, K., Hughesman, C. B.
& Hansen, C. L. Megapixel digital PCR. Nat. Methods 8,
649-U664, (2011).
Readouts
Assay results can comprise a readout or detection mechanism chosen
from a range of readouts used to detect progress or results of
reactions. Examples include but are not limited to electrochemical
readouts, optical readouts, including for example fluorescence
readouts, colorimetric readouts, chemiluminescence, electrical
signals, quenching, probe binding, probe hybridization, metal
labeling, contrast agent labeling, absorbance, mass spectrometry,
sequencing, lateral flow strips, and the generation of a
heterogeneous substance (e.g., precipitation, gas bubble).
A readout mechanism can comprise fluorescence. For example
fluorescent dye can be used to label nucleic acids; reactions with
more nucleic acid product can yield more fluorescence signal.
Fluorescent dyes can include but are not limited to ethidium
bromide, berberine, proflavine, daunomycin, doxorubicin,
thalidomide, YOYO-1, SYBR Green I, SYBR Green II, oxazole yellow
(YO), thiazole orange (TO), PicoGreen (PG), TOTO, TO-PRO, SYTOX,
SYTO, other cyanine dyes, and calcein. The fluorescence intensity
can be measured at an end-point or in real-time, allowing
measurement of the reaction progress. For example, a given level of
fluorescence can be set as the threshold for a positive signal from
a digital or quasi-digital compartment. Alternatively, a readout
mechanism can operate without fluorescence.
A readout mechanism can comprise mass spectrometry. For example,
nucleic acids of different sizes (e.g. from restriction digestion
or ligation) can be distinguished and/or counted by mass
spectrometry. Alternatively, a readout mechanism can operate
without mass spectrometry.
A readout mechanism can comprise electrophoresis, including gel
electrophoresis. For example, nucleic acids of different sizes
(e.g. from restriction digestion or ligation) can be identified or
distinguished by electrophoresis. Alternatively, a readout
mechanism can operate without electrophoresis.
A readout mechanism can comprise sequencing. Sequencing, or
sequence determination techniques, can be performed by methods
including but not limited to Sanger sequencing, Illumina (Solexa)
sequencing, pyrosequencing, next generation sequencing,
Maxam-Gilbert sequencing, chain termination methods, shotgun
sequencing, or bridge PCR; next generation sequencing methodologies
can comprise massively parallel signature sequencing, polony
sequencing, SOLiD sequencing, Ion Torrent semiconductor sequencing,
DNA nanoball sequencing, Heliscope single molecule sequencing,
single molecule real time (SMRT) sequencing, nanopore DNA
sequencing, tunnelling currents DNA sequencing, sequencing by
hybridization, sequencing with mass spectrometry, microfluidic
Sanger sequencing, microscopy-based techniques, RNA polymerase
sequencing or in vitro virus high-throughput sequencing. Sequencing
reads can be used to identify reaction products, and the number of
sequencing reads generated for a given nucleic acid product can be
used to evaluate the reaction. For example, a given number of
sequencing reads can be set as the threshold for a positive signal
from a digital or quasi-digital compartment. Alternatively, a
readout mechanism can operate without sequencing.
Signal can be detected by a variety of techniques, including but
not limited to optical techniques, electrical techniques or
magnetic techniques. The signal can be optically detectable, for
example fluorescent signal, phosphorescent signal, colorimetric
signal, absorption signal, or scattering signal.
In some cases, a modulator can act on the read-out or detection
mechanism. For example, a modulator can affect the generation of a
fluorescent signal, the conducting of a sequencing reaction, the
formation of precipitate, the formation of a gas bubble, or other
read-out or detection mechanisms. For example, a modulator can
ligate a nucleic acid molecule to prepare it for subsequent
detection (e.g., sequencing or probe hybridization), or a modulator
can digest a nucleic acid molecule to prevent subsequent detection
(e.g., sequencing or probe hybridization). In another example, a
modulator can be added to an amplification reaction where a
fluorescent probe (e.g., molecular beacon, TaqMan, or Fluorescence
Resonance Energy Transfer (FRET) probe) is employed to generate a
specific fluorescent signal. Fluorescent probes can be designed to
hybridize within the amplification product. In some cases, the
addition of a modulator (e.g., an oligonucleotide) that hybridizes
on the same target as the probe, or a target similar to the target
on the probe, can prevent the interaction (e.g., by acting as a
block) between the probe and the amplification product and thus can
affect the readout. Specificity of modulators and probes can be
different. In some cases, the modulator can bond to a specific
region of a nucleic acid, such as for example to a SNP, and the
modulator can confer to the probe the ability to discriminate
between sequences. In some cases, probes can be sensitive to the
presence of a SNP without targeting the specific area where the SNP
is located.
In some examples, the methods described here can be used to select
genomic regions of interest and enrich regions of interest (e.g.,
regions of eukaryotic genomes) before sequencing. In some cases,
modulators can be used to inhibit the capture or pre-amplification
of a predominant population of nucleic acids, enabling enrichment
of the target of interest. In some cases, a modulator may be used
for sequencing purposes. For example, a modulator can comprise two
regions of specificity--one side of the modulator can recognize a
specific conserved region within a targeted genome and the other
side of the modulator can be designed to link to a particular
element (e.g., an immobilized primer present in the sequencing
platform). In some cases, as a result of the modulator interacting
simultaneously with both the molecule of interest and the platform,
a single nucleic acid molecule can be isolated and independently
analyzed from the pool of nucleic acids.
Platforms
The assays, reactions, and techniques described herein can be
performed on any suitable platform, including but not limited to
tubes, capillary tubes, droplets, microfluidic devices (e.g.,
SlipChip devices), wells, well plates, microplates, microfluidic
wells, microfluidic droplets, emulsions, solid supports (e.g.,
beads or microarrays), microchips, or gels (e.g., 2D gels, 3D gels)
and reactions inside gels including "polonies" as in polony PCR on
surfaces and in gels.
Platforms can comprise fluid handling mechanisms enabling loading,
unloading, mixing, and other handling of sample volumes, reagent
volumes, and other fluids. For example, a microfluidic device can
be used comprising channels for loading fluids into wells or
droplets, for mixing contents of wells or droplets, or for
off-loading of contents of wells or droplets.
Some platforms are useful for conducting assays in a digital or
quasi-digital format, as described herein. For example, wells, well
plates, microwells, microfluidic droplets, emulsions, beads, and
microarrays can provide a useful platform for conducting a digital
or quasi-digital assay. In such an assay, the compartments can
comprise individual wells, droplets, beads, or microarray
spots.
Platforms can be compatible with one or more readout or detection
mechanisms. For example, a platform can be transparent or
translucent in part or in total, allowing fluorescent measurement,
detection of precipitate or gas bubble, or other visual
observation. A platform can comprise visual detectors, such as
CCDs, CMOS sensors, cameras, photon detectors, and other sensors.
In another example, a platform can comprise electrical sensors,
such as electrodes positioned within microwells. Platforms can be
compatible with off-loading of samples for analysis. For example, a
platform can permit unloading of droplets or contents of wells for
mass spectrometry, sequencing, or electrophoresis.
Applications
An assay can be conducted in less than or equal to about 600
minutes, 540 minutes, 480 minutes, 420 minutes, 360 minutes, 300
minutes, 240 minutes, 180 minutes, 120 minutes, 110 minutes, 100
minutes, 90 minutes, 80 minutes, 70 minutes, 60 minutes, 50
minutes, 40 minutes, 30 minutes, 20 minutes, 15 minutes, 10
minutes, 9 minutes, 8 minutes, 7 minutes, 6 minutes, 5 minutes, 4
minutes, 3 minutes, 2 minutes, or 1 minute. An assay can have an
accuracy of at least about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%,
98%, 99%, 99.9%, or 99.99%. The rates of false positives can be
below 10%, below 1%, below 0.1%, below 0.01%, below 0.001%, or
below 0.0001%. The rates of false negatives can be below 10%, below
1%, below 0.1%, below 0.01%, below 0.001%, or below 0.0001%.
Assays can be used for single-nucleotide polymorphism (SNP)
detection or discovery. DNA sequence variations can occur when a
single nucleotide in a genome or other shared sequence differs
between members of a biological species, or between paired
chromosomes in a human. When a specific restriction enzyme pattern
or genetic fingerprint has been established (e.g., as described
herein), any change to it (e.g., new negative reactions) can
indicate a modification in the sequence of the produced amplicons,
from a SNP to a chromosome level change.
Assays can be used for detecting copy number variations (CNVs).
CNVs are a form of structural variation, alterations of the DNA of
a genome that changes the number of copies of one or more sections
of the DNA. CNVs can correspond to relatively large regions of the
genome that have been deleted or duplicated on certain chromosomes.
Like other types of genetic variation, some CNVs have been
associated with susceptibility or resistance to disease. Gene copy
number can be elevated in cancer cells. The methodology described
herein also allows identifying genetic changes at chromosome
level.
An assay can be used for quantitative detection of nucleic acids,
such as Hepatitis C RNA. For example, a method can be used
comprising the steps of taking a sample from the patient, accessing
RNA in the sample or extracting RNA from the sample, using at least
one RT-LAMP primer set as set out in Table 10 to reverse transcribe
and amplify the RNA in a qualitative and/or in a quantitative
format, and testing for amplification to confirm presence of
nucleic acids including but not limited to Hepatitis C RNA.
Assays can be used for genotyping, i.e. determining differences in
the genetic make-up (genotype) of an organism or group of organisms
by examining the DNA or RNA sequence and comparing it to a
reference sequence. This can be used to define biological
populations by use of molecular tools. For example, Example 1 shows
three different restriction enzymes (BsrBI, BstNI and NheI) used to
classify different hepatitis C virus (HCV) samples into the
genotype level, from genotype 1 to genotype 4. Subtyping of HCV can
also be achieved using this methodology. HCV subtype 1a and 1b are
reported to have different response to therapy (see, e.g., "A M
Pellicelli, M Romano, T Stroffolini, E Mazzoni, F Mecenate, R
Monarca, A Picardi, M E Bonaventura, C Mastropietro, P Vignally, A
Andreoli, M Marignani, C D'Ambrosio, L Miglioresi, L Nosotti, O
Mitidieri, U V Gentilucci, C Puoti, G Barbaro, A Barlattani, C
Furlan, G Barbarini, BMC Gastroenterol. 2012 Nov. 16; 12:162"), and
for the CLEO Group, HCV Genotype 1a shows a better virological
response to antiviral therapy than HCV Genotype 1b. As a result,
differentiating Genotype 1a from Genotype 1b can be clinically
important. Using the same priming region described in Example 1,
subtyping can be achieved with restriction enzyme BcoDI, as shown
in FIG. 5A. Other restriction enzyme candidates are available for
subtyping to target other regions of the HCV genome, such as NS5b
or CORE. For example, Hpy99I, BstNI and BssSI, among others, are
good candidates for 1a/1b subtyping in the HCV CORE region as shown
in FIG. 5B.
Assays can be used for detecting epigenetic marks or modifications
(e.g., methylation, glycosylation, hydroxymethylation): Epigenetic
modifications can comprise functionally relevant modifications to
the genome that do not involve a change in the nucleotide sequence.
Methylation of DNA is a common epigenetic signaling tool and is an
important component in numerous cellular processes (e.g., embryonic
development, genomic imprinting, X-chromosome inactivation). Errors
in methylation are linked to a variety of devastating consequences,
including several human diseases. Furthermore, adenine or cytosine
methylation is part of the restriction modification system of many
bacteria, in which specific DNA sequences are methylated
periodically. Foreign DNAs, which are not methylated in this
manner, that are introduced into the cell are degraded by
sequence-specific restriction enzymes and cleaved (while bacterial
genomic DNA is not recognized by these restriction enzymes). The
methylation of native DNA can act as a sort of primitive immune
system, allowing the bacteria to protect themselves from infection
by bacteriophage. As an example of this application, when
restriction enzyme recognition sites are methylated, DNA cleavage
can be blocked, depending on the restriction enzyme; the
methodologies presented herein can detect and identify such
methylation. In another example, some restriction enzymes depend on
methylation and hydroxymethylation for cleavage to occur (e.g.,
EpiMark.RTM.); methylation-dependent restriction enzyme activity
(both positive and negative) can be used to map epigenetic
modifications and study DNA methylations. Epigenetic analysis can
be accomplished using the methodologies described herein.
Assays can be used for identification of mutations, such as drug
resistance mutations (DRM). Drug resistance can be achieved by
multiple mechanisms, including horizontal acquisition of resistance
genes (carried by plasmids or transposons), by recombination of
foreign DNA into the chromosome, or by mutations in different
chromosomal loci. The methodologies described herein can be used
for the identification of a characteristic restriction enzyme
pattern or fingerprint, or the activity of specific restriction
enzymes, associated with mutations that confer drug resistance. For
example, an assay can be used for diagnosis of
Methicillin-resistant Staphylococcus aureus (MRSA): MRSA is a
pathogen responsible for a wide spectrum of healthcare-associated
and community-acquired infections. Infections with MRSA strains
that are resistant to different types of antibiotics are a serious
therapeutic problem, because only a limited spectrum of antibiotics
can be used, and treatment can require prolonged hospitalization
and result in economic losses. In order to limit the overspread of
pathogens, the development of diagnostic tools enabling rapid
identification of carriers and infected patients, also enabling
livestock and food supply screening and testing, may be
accomplished using the methodologies described herein.
Assays can be used to screen for transgene integration. A
transgenic organism has in its cells a foreign gene that has been
inserted by laboratory techniques or inherited from a transgenic
parent organism. Transgenic organisms can be produced by
introducing cloned genes, composed of DNA from microbes, animals,
or plants, into plant and animal cells. Transgenic technology
affords methods that allow the transfer of genes between different
species. Identification of a genetically modified organism (e.g.,
food or laboratory animals) may be accomplished using the
methodologies described herein.
Assays can be used for detection of restriction enzyme activity,
identifying new restriction enzymes, or evaluating restriction
enzyme activity. As explained in "Julie K. A. Kasarjian, Yoshiaki
Kodama, Masatake Iida, Katsura Matsuda, and Junichi Ryu, Four new
type I restriction enzymes identified in Escherichia coli clinical
isolates, Nucleic Acids Res. 2005; 33(13): e114," the recognition
sequences for type II enzymes are relatively easy to identify using
crude extracts to digest fixed DNA sequences to produce distinct
DNA bands; sequences can then be predicted using a computer
program, such as REBpredictor (New England BioLabs). However, no
simple method has been identified for finding type I recognition
sequences, in part because the enzymes produce DNA fragments with
random sequences (TA Bickle and DH Kruger, Biology of DNA
Restriction, Microbiol. Rev. 1993; 57:434-450). Identification of
new restriction enzymes or analysis of restriction enzyme target
sequences can be accomplished using the methodologies described
herein. For example, amplification reactions can be conducted on
different template nucleic acid sequences in the presence of a
restriction enzyme modulator, and the effect (e.g., reduced
efficiency or rate) of the modulator can be observed and correlated
to particular sequences.
Assays can be used to subtype or characterize strains of viruses.
For example, there are three types of influenza viruses: A, B and
C. Human influenza A and B viruses cause seasonal epidemics.
Influenza A viruses are hosted by numerous avian and mammalian
(humans, pigs, horses, dogs, marine mammals and others) species,
with a viral genome consisting of eight RNA segments that are
frequently exchanged between different viruses via a process known
as genetic reassortment. Influenza type A viruses are categorized
into subtypes based on the type of two proteins on the surface of
the viral envelope, H (hemagglutinin, a protein that causes red
blood cells to agglutinate) and N (neuraminidase, an enzyme that
cleaves the glycosidic bonds of the monosaccharide, neuraminic
acid). Different influenza viruses encode for different
hemagglutinin and neuraminidase proteins. For example, the H5N1
virus designates an influenza A subtype that has a type 5
hemagglutinin (H) protein and a type 1 neuraminidase (N) protein.
Influenza A subtypes found in humans include H1N1, H2N2, H3N2,
H5N1, H7N7, H1N2, H9N2, H7N2, H7N3, H10N7 and H7N9. The
methodologies described herein can be used for rapid and accurate
identification and screening of targets (e.g., influenza virus). An
assay can be conducted in less than or equal to about 600 minutes,
540 minutes, 480 minutes, 420 minutes, 360 minutes, 300 minutes,
240 minutes, 180 minutes, 120 minutes, 110 minutes, 100 minutes, 90
minutes, 80 minutes, 70 minutes, 60 minutes, 50 minutes, 40
minutes, 30 minutes, 20 minutes, 15 minutes, 10 minutes, 9 minutes,
8 minutes, 7 minutes, 6 minutes, 5 minutes, 4 minutes, 3 minutes, 2
minutes, or 1 minute. An assay can have an accuracy of at least
about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or
99.99%. The rates of false positives can be below 10%, below 1%,
below 0.1%, below 0.01%, below 0.001%, or below 0.0001%. The rates
of false negatives can be below 10%, below 1%, below 0.1%, below
0.01%, below 0.001%, or below 0.0001%. Methodologies can have
applications in pandemic influenza risk management. The
methodologies described herein can also be used to detect the
emergence of new virus strains, such as new strains of influenza.
Current systems for typing and subtyping influenza viruses include
virus replication in egg or cell culture followed by either
immunofluorescence assays with strain-specific monoclonal
antibodies or hemagglutination inhibition assays using a panel of
reference antisera, which can be tedious and requires several days
or even weeks (see M. L. Landry, Diagnostic tests for influenza
infection, Curr Opin Pediatr, 2011, 23: 91-97). Assays described
herein can be used for routine point-of-care tests, including
subtyping capability useful for surveillance of diseases.
Assays can comprise amplification of the haemagglutinin (HA) and/or
neuraminidase (NA) genes for subtyping, which genes comprise highly
variable genomic regions that hinder the standardization of
molecular methods. In some cases, HA and NA genes of influenza can
be targeted while circumventing the need for repeated re-design of
primers and probes. Influenza viruses can be identified detected
and monitored by using the methodologies described herein by
targeting sequences surrounding SNPs that are located in the matrix
(M) gene segment, a highly conserved gene in the influenza genome.
The M gene has enough genetic diversity for influenza subtyping
purposes and sufficient genetic stability to for detection and
typing. To reduce the number of sequences being targeted in this
approach, one can, for example, establish phylogenetic groups based
on the M segment that correlate with a group of subtypes, reducing
the number of variables to target and potentially simplifying the
analysis of HA and NA segments in the platform. Sequences for the M
gene segment of influenza A and B can be compiled using the
Influenza Virus Resource database at the National Center for
Biotechnology, the Influenza Research Database, and The Influenza
Sequence Database at Los Alamos National Laboratory. If needed,
sequences for HA and NA gene segments for influenza A can, for
example, be also compiled from the same source. This approach can
be used to find genetic markers that are unique to a particular
subtype or group of subtypes of influenza based on host species.
These databases can in some examples be separated by subtype and
host. Phylogenetic reconstruction can be conducted according to the
following bioinformatics pipeline. (i) Alignment: In the alignment
step of phylogenetic reconstruction, the homology of the whole
sequences can be refined to identify homologous sites by, for
example, placing gaps at sites where insertions or deletions have
occurred since the last common ancestor. To perform this step the
Prank algorithm as implemented in SATe II (Simultaneous Alignment
and Tree Estimation) can be used (see K. Liu, T. J. Warnow, M. T.
Holder, S. M. Nelesen, J. Yu, A. P. Stamatakis and C. R. Linder,
SATe-II: very fast and accurate simultaneous estimation of multiple
sequence alignments and phylogenetic trees, Syst Biol, 2012, 61:
90-106). The resulting alignment can, in some cases, be manually
curated to eliminate regions that could have been misaligned (due
to, e.g., high variability). (ii) Model selection: Some
phylogenetic methods (e.g., maximum likelihood and Bayesian
analysis) may benefit from specification of an evolutionary model.
In some cases the model of evolution can be selected using the
Akaike information criterion and/or Bayesian cross-validation
using, for example, jModelTest and PhyloBayes, respectively (see D.
Posada, jModelTest: phylogenetic model averaging, Mol Biol Evol,
2008, 25: 1253-1256; and N. Lartillot, T. Lepage and S. Blanquart,
PhyloBayes 3: A Bayesian software package for phylogenetic
reconstruction and molecular dating, Bioinformatics, 2009, 25,
2286: 2288). (iii) Phylogeny Reconstruction: In some cases
phylogenetic reconstruction can be performed under maximum
likelihood and Bayesian frameworks. Maximum likelihood can be
carried out using RAxML and reliability of nodes can be evaluated
using bootstrapping (see A. Stamatakis, RAxML version 8: a tool for
phylogenetic analysis and post-analysis of large phylogenies,
Bioinformatics, 2014, doi: 10.1093/bioinformatics/btu033). In some
examples Bayesian analysis can be performed using PhyloBayes.
Potential sources of systematic error can be evaluated using
Bayesian posterior predictive analysis as implemented in PhyloBayes
in order to assess the reliability of the resulting topology, in
some examples (See N. Lartillot, T. Lepage and S. Blanquart,
PhyloBayes 3: A Bayesian software package for phylogenetic
reconstruction and molecular dating, Bioinformatics, 2009, 25,
2286: 2288). (iv) Genetic marker prediction: Single nucleotide
polymorphism detection can involve looking across multiple sequence
alignments and identifying base discrepancies. The higher the
sequence coverage and quality score at a given site, the more
confident the SNP prediction. In some cases, existing tools (e.g.,
Phrap or PineSAP) can be used to make confident identifications
when visual confirmation is not an option (See M. Machado, W. C.
Magalhaes, A. Sene, B. Araujo, A. C. Faria-Campos, S. J. Chanock,
L. Scott, G. Oliveira, E. Tarazona-Santos and M. R. Rodrigues,
Phred-Phrap package to analyses tools: a pipeline to facilitate
population genetics re-sequencing studies, Investig Genet, 2011, 2,
3 and J. L. Wegrzyn, J. M. Lee, J. Liechty, and D. B. Neale,
PineSAP-sequence alignment and identification pipeline,
Bioinformatics, 2009, 25, 2609-2610). Strategies for ensuring low
rates of false positives in subtyping can also be used in some
examples; a test or assay can report not only the subtype but also
provide some information on, for example, the confidence of the
subtype designation. These approaches can be used to create tests
with low rates of false positives, which would be advantageous when
millions of people are screened. The rates of false positives can
be below 10%, below 1%, below 0.1%, below 0.01%, below 0.001%, or
below 0.0001%.
While a number of details are provided herein for relating to
analysis of influenza, analysis of other viruses (including
detection, typing, subtyping, SNP detection, and other analysis)
can be performed analogously. Analysis of Hepatitis viruses,
including HCV, HBV, HAV, HIV, HPV, and other viruses of relevance
to human health, agriculture, agricultural biotechnology, and other
practical applications, can be performed. Analysis and detection of
viral, archaeal, bacterial, fungal, mammalian, human, and other
nucleic acids can be performed. Analysis and detection includes
comparative analysis and detection, where a target nucleic acid is
compared with another nucleic acid.
The methodologies described herein can be used to detect other
activities in conjunction with detection and or amplification such
as reactions that make or break chemical bonds, reactions that lead
to formation of complexes between molecules, or reactions that lead
to formation of complexed between molecules and objects such as
beads and surfaces. The methodologies can be used to detect
activation of detection or amplification. For example, a protease
can be used to degrade at least one peptide bond in a complex
between a target nucleic acid and a molecule containing such a
peptide bond (e.g., proteins, peptides, and their derivatives).
This degradation can cause dissociation of the complex between the
target nucleic acid and the molecule containing such a peptide
bond, enhancing the amplification or detection of the target
nucleic acid. Similarly, a glycosidase can be used to degrade a
glycosidic bond, leading to the release of small sugars. If the
release of the small sugar or the degradation of the glycosidic
bond leads to the formation or degradation of some complex between
molecules, it can change the rate of an amplification reaction or
allow or prevent an amplification reaction. Glycoside hydrolase can
also be used as synthetic catalysts to form glycosidic bonds
through either reverse hydrolysis. Glycosyltransferases, on the
other hand, can establish natural glycosidic linkages, including
the biosynthesis of disaccharides, oligosaccharides and
polysaccharides. Glycosyltransferases can catalyse the transfer of
monosaccharide moieties from activated nucleotide sugar (also known
as the "glycosyl donor") to a glycosyl acceptor molecule, such as
an alcohol. The result of glycosyl transfer can be a carbohydrate,
glycoside, oligosaccharide, or a polysaccharide. Similarly, kinase
enzymes can be used to transfer phosphate groups from high-energy
donor molecules, such as ATP to specific substrates, a process
referred to as phosphorylation, while phosphorylases can be used to
conduct phosphorolysis, the breaking of a bond using an inorganic
phosphate group. Aptamers can be used to bind to specific proteins
or nucleic acid targets.
Assays can be used to identify drug resistance mutations (DRMs).
Drug resistance can be achieved by multiple mechanisms, including
but not limited to horizontal acquisition of resistance genes
(carried by plasmids or transposons), by recombination of foreign
DNA into the chromosome, or by mutations in different chromosomal
loci. The identification of a characteristic restriction enzyme
pattern or the activity of specific restriction enzymes associated
with mutations that confer drug resistance can, in some cases, be
accomplished using the methodologies described herein. Drug
resistance can be determined using the methodologies described
herein in subjects including but not limited to viruses, bacteria,
fungi, plants, prokaryotes, and eukaryotes. These mutations can
also be determined in, e.g., cancer cells and cell-free DNA. For
example, this can be applied to identify drug resistance mutations
in HCV (see, e.g., "Clinically Relevant HCV Drug Resistance
Mutations Figures and Tables, from HCV Phenotype Working Group, HCV
Drug Development Adivosry Group, Ann Forum Collab HIV Res. Volume
14 (2): 2012; 1-10" or "Forum for Collaborative HIV Research,
University of California Berkeley School of Public Health"), HIV
(see, e.g., "Victoria A. Johnson, MD, Vincent Calvez, MD, PhD,
Huldrych F. Gunthard, MD, Roger Paredes, MD, PhD, Deenan Pillay,
MD, PhD, Robert W. Shafer, MD, Annemarie M. Wensing, MD, PhD, and
Douglas D. Richman, MD, Update of the Drug Resistance Mutations in
HIV-1: March 2013, Topics in Antiviral Medicine, 2013; 21:6-14"),
and influenza A virus (see, e.g., "Goran Orozovic, Kanita Orozovic,
Johan Lennerstrand, Bjorn Olsen, Detection of Resistance Mutations
to Antivirals Oseltamivir and Zanamivir in Avian Influenza A
Viruses Isolated from Wild Birds. PLoS ONE 6(1): e16028.
doi:10.1371/journal.pone.0016028").
Assays can be used for genetic testing, including fetal genetic
testing. For example, assays can be used for non-invasive pre-natal
Trisomy 21 (Down syndrome) diagnostics. Assays can be used with a
screening test which indicates the likelihood of trisomy. Assays
can be used with or as a screening test for a subsequent diagnostic
test which is a more accurate test provided only to people with a
high score in the screening test. A screening test can comprise an
ultrasound test. A screening test can comprise a maternal serum
screening blood test measuring the level of human chorionic
gonadotropin (.beta.-hCG), pregnancy associated plasma protein-A
(PAPP-A), alpha fetoprotein (AFP), or other protein biomarkers. A
screening test can provide a probability instead of a finite
answer. If the screening test gives a high score, an invasive
diagnostic test, such as chorionic villus sampling (CVS) or
amniocentesis, can be used. Cell-free fetal DNA (cff DNA) or RNA
(cff RNA) exist in maternal plasma that can be isolated and
subjected to molecular analysis (see, e.g., "Y M Dennis Lo, Noemi
Corbetta, Paul F Chamberlain, Vik Rai, Ian L Sargent, Christopher W
G Redman, James S Wainscoat, Presence of fetal DNA in maternal
plasma and serum, Lancet 1997, 350, 485-487"). The cff DNA and cff
RNA can be used in assays for non-invasive biomarker discovery and
detection. For cff DNA, a biological and therefore technical
constraint is that it only takes up 3-6% of the total amount of
cell-free DNA. The proportion increases at a later stage of
gestation, but is still a minor fraction of the total amount of
cell-free DNA in plasma. Assays can directly target fetal-specific
DNA or RNA. The placenta is an organ that can represent genetic
information from the fetus. Placental-specific RNA, when expressed
and released in a tissue-specific manner, qualifies as a
fetal-specific RNA because it exists only in pregnant individuals
and does not exist before or after pregnancy. Assays can comprise
detection of trisomy 21 using placental specific RNA by direct
dosage-related difference in the expression of chromosome 21
encoded genes (see, e.g., "Chi-Ming Li, Meirong Guol, Martha Salas,
Nicole Schupf, Wayne Silverman, Warren B Zigman, Sameera Husain,
Dorothy Warburton, Harshwardhan Thaker, and Benjamin Tycko, "Cell
type-specific over-expression of chromosome 21 genes in fibroblasts
and fetal hearts with trisomy 21" BMC Medical Genetics 2006, 7:
24''). Assays can comprise detection of trisomy 21 using placental
specific RNA by relative RNA allelic ratio assessment using SNP
analysis (see, e.g., "Y M Dennis Lo., Nancy B Y Tsui, Rossa W K
Chiu, Tze K Lau, Tse N Leung, Macy M S Heung, Egeliki Gerovassili,
Yongjie Jin, Kypros H Nicolaides, Charles R Cantor, and Chunming
Ding, Plasma placental RNA allelic ratio permits noninvasive
prenatal chromosomal aneuploidy detection, Nat. Med. 2007, 13,
218"). Relative RNA allelic ratio assessment using SNP analysis can
quantify the relative abundance of each allele in expressed
placental specific RNA when there is a heterozygous loci on
chromosome 21 genes, with the assumption that the ratio of the two
alleles for mothers carrying a trisomy 21 baby should be 2:1, and
for a normal baby it should be 1:1. Since only a relative ratio is
required, the number of wells or other partitions can be small if
digital PCR is used in such an assay.
Described herein is an exemplary a rapid assay not requiring CVS or
amniocentesis that can be used as a screening test or a diagnostic
test with high sensitivity and specificity based on, in one
example, RNA SNP quantification on chromosome 21. In some cases,
this platform can have the capacity for collecting sample and
purifying RNA out of the plasma sample, multiplexed SNP ratio
quantification, and a relatively simple readout module, including
but not limited to one that is cell-phone enabled. The results can
be interpretable by, for example, the user or the physician, and in
some cases can be offered together with consultation service at the
clinic, to help parents make decisions and prepare. Assay coverage
can be at least about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%,
99%, 99.9%, 99.99%, or 100%. An assay can be used in combination
with another screening test and can decrease the number of
false-positives in the screening test. An assay can provide access
to such tests to people who do not currently have access. The
development of such a platform can fill the gaps between the large
demand for trisomy 21 detection and limited access to diagnostics.
In one example of this platform, a sample (such as, for example,
human blood) can be collected and loaded onto the integrated
device. In some cases, the sample can flow to merge with different
reagents to complete the RNA extraction step driven by, for
example, pressure. In some cases, the RNA can then be mixed with
isothermal amplification reagents containing, for example,
different inhibitors specific to different alleles. In some cases,
after rapid sequence specific amplification, the digital counts for
different reactions can be recorded (such as, for example, by a
cell phone, which can have a built-in analysis application). In
some cases, the assay can comprise a SNP assay for multiple loci,
increasing the population coverage of the entire assay. In some
cases, proper control and potentially other trisomy detection
assays can be included as well. In some cases, for heterozygous
loci, the ratio between the two alleles should be 1:1 for euploidy,
while that for aneuploidy should be about 2:1. In some cases, for
homozygous loci, only one allele will be detected. FIG. 16 shows a
schematic of an exemplary prenatal diagnostic test. In FIG. 16A,
results are shown for a sample, heterozygous at locus B, negative
(upper) and positive (lower) for trisomy. Both show a similar
number of positive signals for the `B` SNP assay, and the sample
positive for trisomy shows more positive signals for the `b` SNP
assay. In FIG. 16B, results are shown for a sample, homozygous at
locus A, negative (upper) and positive (lower) for trisomy. Both
show no positive signals for the `a` SNP assay, and the sample
positive for trisomy shows more positive signals for the `A` SNP
assay. Genetic testing (prenatal or postnatal) can be used to
screen for other aneuploidy conditions including but not limited to
Edwards syndrome (Trisomy 18) and Patau syndrome (Trisomy 13).
Genetic testing can be used to screen for other genetic conditions
including but not limited to phenylketonuria and congenital
hypothyroidism. Genetic testing can also be used to study or
predict drug metabolism (e.g., SNPs and other mutations in the
liver P450 cytochrome system of enzymes including CYP2C9, CYP2C19,
CYP3A4, and CYP1A2).
Assays can be used for epigenetic testing for diseases and other
conditions, including but not limited to Angelman syndrome,
Prader-Willi syndrome, Beckwith-Wiedemann syndrome, aberrant DNA
methylation associated with cancer (hypermethylation, e.g. at CpG
islands in the promoter region or hypomethylation, e.g. global
hypomethylation), epigenetic changes (e.g., CpG island methylation)
associated with reduced expression of DNA repair genes (e.g.,
BRCA1, WRN, FANCF, RAD51C, MGMT, MLH1, MSH2, ERCC1, Xpf, NEIL1,
FANCB, MSH4, ATM), and variant histones.
Nucleic acid amplification based on universal set of primers
targeting common sequences among bacteria or among fungi can be
used, for example, to evaluate microbial colonization. Common
sequences can include 16S ribosomal RNA or 23S ribosomal RNA in
bacteria and 18S ribosomal RNA or 28S ribosomal rRNA genes in
fungi. Addition of sequence-specific modulators into these
universal PCR systems can be used for bacterial or fungal typing
(ribotyping). Ribotyping mediated by modulators can be used, for
example, for environmental testing (water, soil, waste, fuel and
air) with bacteria including but not limited to Escherichia coli,
Bacillus subtilis, Clostridum perfringens, Clostridium difficile,
Enterobacter aerogenes, Enterococcus faecalis, Legionella
pneumophila, Legionella bozemanii, Listeria monocytogenes,
Pseudomonas aeruginosa, Salmonella typhimurium, Staphylococcus
aureus, and others. Assays can be used for detection of
multidrug-resistant organisms (such as Staphylococcus aureus,
Klebsiella pneumoniae, Acinetobacter spp., Enterococcus spp. and
Enterobacter spp). Assays can be used for detection or
identification of sulfate reducing organisms or other organisms
which can lead to pipeline corrosion. A sample can be taken from a
pipeline, an gut of an organism, or another source.
Assays can be used to identify or characterize mobile genetic
elements (e.g., transposons and bacteriophages) or foreign genes
inserted by laboratory techniques (e.g., genes inserted into
genetically modified organisms). For example, when an amplification
reaction targeting a sequence surrounding an inserted gene, the
reaction can be inhibited or promoted in the presence of a
modulator that interacts with the foreign gene. If the foreign gene
is not present, the modulator does not significantly act and the
amplification reaction can proceed without substantial change to
the rate or efficiency of amplification. Approaches described
herein can be used for agricultural biotechnology, to detect genes
transfected into plants, animals and microorganisms. In another
example, virulence factors of pathogenic bacteria encoded by
pathogenicity islands (PAI) can be assessed. PAI carry genes
encoding one or more virulent factors, including but not limited
to, adhesins, toxins, invasins, protein secretion systems, iron
uptake systems, and others. PAI comprise genomic regions that are
present on the genomes of pathogenic strains but absent or only
rarely present in those non-pathogenic variants of the same related
species. An amplification reaction can be triggered, for example,
by the presence a specific PAI. For example, an amplification
reaction can be blocked by a modulator, and in the presence of a
specific sequence contained in the PAI the modulator can be removed
and the amplification reaction can be initialized. The presence of
transferred genes (or transferred geneomictic islands) can also be
used in combination with a modulator, for example with pathogenic
bacteria such as Escherichia spp., Shigella spp., Yersinia spp.,
Vibrio spp., Clostridium spp., Haemophilus spp., Helicobacter spp.,
Neisseria spp., Pseudomonas spp., Mycobacterium spp. and
others.
Assays can be used identification of single point mutations, for
example for viral genotyping. Genotyped viruses can include but are
not limited to hepatitis C virus, hepatitis B virus, human
immunodeficiency virus, human cytomegalovirus, norovirus and
enterovirus. Assays can be used for viral typing and subtyping.
Typed or subtyped viruses can include but are not limited to human
papilloma virus, avian influenza virus, human influenza virus,
swine influenza virus, herpes simplex virus, foot and mouth disease
virus, dengue virus and rotavirus. Assays can be used for bacterial
typing. Typed bacteria can include but are not limited to
Francisella spp., Escherichia spp., Salmonella spp., Mycobacterium
spp., Bacillus spp., Staphylococcus spp., Streptococcus spp.,
Acinetobacter spp., Helicobacter spp., Bordetella spp., Bordetella
spp. and Vibrio spp. Assays can be used to assess for the presence
or absence of drug resistance mutations, in subjects including but
not limited to human immunodeficiency virus, hepatitis C virus, and
cancer drug resistance.
Control Systems
The present disclosure provides computer control systems that can
be employed to conduct, regulate, analyze, communicate results
from, or otherwise control assays and systems provided herein. FIG.
6 shows a computer system 601 that is programmed or otherwise
configured to regulate or analyze assays. The computer system 601
can regulate, for example, fluid handling for conducting an assay,
data collection of real-time reaction rates or end-point reaction
outcomes, analysis of data, and transmission or display of data or
results.
The computer system 601 includes a central processing unit (CPU,
also "processor" and "computer processor" herein) 605, which can be
a single core or multi core processor, or a plurality of processors
for parallel processing. The computer system 601 also includes
memory or memory location 610 (e.g., random-access memory,
read-only memory, flash memory), electronic storage unit 615 (e.g.,
hard disk), communication interface 620 (e.g., network adapter) for
communicating with one or more other systems, and peripheral
devices 625, such as cache, other memory, data storage and/or
electronic display adapters. The memory 610, storage unit 615,
interface 620 and peripheral devices 625 are in communication with
the CPU 605 through a communication bus (solid lines), such as a
motherboard. The storage unit 615 can be a data storage unit (or
data repository) for storing data.
The CPU 605 can execute a sequence of machine-readable
instructions, which can be embodied in a program or software. The
instructions may be stored in a memory location, such as the memory
610. Examples of operations performed by the CPU 605 can include
fetch, decode, execute, and writeback.
The storage unit 615 can store files, such as drivers, libraries
and saved programs. The storage unit 615 can store programs
generated by users and recorded sessions, as well as output(s)
associated with the programs. The storage unit 615 can store user
data, e.g., user preferences and user programs. The computer system
601 in some cases can include one or more additional data storage
units that are external to the computer system 601, such as located
on a remote server that is in communication with the computer
system 601 through an intranet or the Internet.
The computer system 601 can be in communication with an assay
system 630, including various elements of the assay system. Such
elements can include sensors, fluid handling mechanisms (e.g.,
motors, valves, pumps), and actuators.
Methods as described herein can be implemented by way of machine
(e.g., computer processor) executable code stored on an electronic
storage location of the computer system 601, such as, for example,
on the memory 610 or electronic storage unit 615. The machine
executable or machine readable code can be provided in the form of
software. During use, the code can be executed by the processor
605. In some cases, the code can be retrieved from the storage unit
615 and stored on the memory 610 for ready access by the processor
605. In some situations, the electronic storage unit 615 can be
precluded, and machine-executable instructions are stored on memory
610.
The code can be pre-compiled and configured for use with a machine
have a processer adapted to execute the code, or can be compiled
during runtime. The code can be supplied in a programming language
that can be selected to enable the code to execute in a
pre-compiled or as-compiled fashion.
Aspects of the systems and methods provided herein, such as the
computer system 601, can be embodied in programming Various aspects
of the technology may be thought of as "products" or "articles of
manufacture" typically in the form of machine (or processor)
executable code and/or associated data that is carried on or
embodied in a type of machine readable medium. Machine-executable
code can be stored on an electronic storage unit, such memory
(e.g., read-only memory, random-access memory, flash memory) or a
hard disk. "Storage" type media can include any or all of the
tangible memory of the computers, processors or the like, or
associated modules thereof, such as various semiconductor memories,
tape drives, disk drives and the like, which may provide
non-transitory storage at any time for the software programming.
All or portions of the software may at times be communicated
through the Internet or various other telecommunication networks.
Such communications, for example, may enable loading of the
software from one computer or processor into another, for example,
from a management server or host computer into the computer
platform of an application server. Thus, another type of media that
may bear the software elements includes optical, electrical and
electromagnetic waves, such as used across physical interfaces
between local devices, through wired and optical landline networks
and over various air-links. The physical elements that carry such
waves, such as wired or wireless links, optical links or the like,
also may be considered as media bearing the software. As used
herein, unless restricted to non-transitory, tangible "storage"
media, terms such as computer or machine "readable medium" refer to
any medium that participates in providing instructions to a
processor for execution.
Hence, a machine readable medium, such as computer-executable code,
may take many forms, including but not limited to, a tangible
storage medium, a carrier wave medium or physical transmission
medium. Non-volatile storage media include, for example, optical or
magnetic disks, such as any of the storage devices in any
computer(s) or the like, such as may be used to implement the
databases, etc. shown in the drawings. Volatile storage media
include dynamic memory, such as main memory of such a computer
platform. Tangible transmission media include coaxial cables;
copper wire and fiber optics, including the wires that comprise a
bus within a computer system. Carrier-wave transmission media may
take the form of electric or electromagnetic signals, or acoustic
or light waves such as those generated during radio frequency (RF)
and infrared (IR) data communications. Common forms of
computer-readable media therefore include for example: a floppy
disk, a flexible disk, hard disk, magnetic tape, any other magnetic
medium, a CD-ROM, DVD or DVD-ROM, any other optical medium, punch
cards paper tape, any other physical storage medium with patterns
of holes, a RAM, a ROM, a PROM and EPROM, a FLASH-EPROM, any other
memory chip or cartridge, a carrier wave transporting data or
instructions, cables or links transporting such a carrier wave, or
any other medium from which a computer may read programming code
and/or data. Many of these forms of computer readable media may be
involved in carrying one or more sequences of one or more
instructions to a processor for execution.
EXAMPLES
Example 1--Real-Time Bulk HCV Genotyping Results Using RT-LAMP and
Restriction Enzymes
Three restriction enzymes (BsrBI, NehI, and BstNI) were selected
based on hepatitis C virus (HCV) sequence and its variation in
different genotypes. A set of customized LAMP primers targeting
5'UTR were designed. This set of primers was optimized to show high
amplification efficiency for genotype 1, 2, 3 and 4. The cutting
site of the restriction enzyme is inside the priming region
(between B3 and F3; see Tsugunori Notomi, Hiroto Okayama, Harumi
Masubuchi, Toshihiro Yonekawa, Keiko Watanabe, Nobuyuki Amino and
Tetsu Hase, "Loop-mediated isothermal amplification of DNA",
Nucleic Acids Res. 2000 Jun. 15; 28(12):E63), so that the enzyme
cuts the product during amplification and leads to the inhibition
or delay of the reaction. The alignment of RNA sequence, priming
region and digestion site for NheI, BstNI, BsrBI, BsrI, and BcoDI
is shown in FIG. 5A. The digestion site for the enzymes is specific
to different genotypes so each enzyme specifically cuts certain
genotypes. For example, the sequence which BsrBI cuts is CCGCTC,
which with these RT-LAMP primers only exists in the amplicon of
genotype 1, 3 and 4. As a result, the LAMP reaction with BsrBI is
expected to be positive only for genotype 2. Based on the
specificity of the enzymes, the predicted amplification pattern of
LAMP-RE is shown in FIG. 7. For example, the digestion site for
Hpy99I (A) only exists in the amplicon of subtype 1a, the digestion
site for BstNI (B) only exists in subtype 1b, and BssSI (C) only
digests the amplicon of subtype 1b; therefore, the combination of
these enzymes enables the identification of subtype 1a and 1b. The
expected pattern of positive and negative reaction results is shown
in FIG. 7; each row stands for one HCV RNA genotype, each column
stands for one restriction enzyme, black stands for "positive or
not-delayed reaction," and white stands for "negative or delayed
reaction." The time required for the LAMP reaction to change from
negative (below intensity threshold) to positive (above intensity
threshold) is shown in FIG. 8; positive controls are experiments in
the absence of restriction enzyme, shown in solid grey as
reference. Different restriction enzymes exhibit different
capability for digestion, which results in different extent of
delay. All experiments were performed in triplicates, with p-value
shown above each bar in FIG. 8. In the real-time experiment, each
cycle was set to be 1 minute and the fluorescence intensity was
measured at the end of each cycle. Due to the time required for
imaging (12 s per cycle), the cycle numbers did not reflect the
absolute reaction time in the unit of minute. Real time RT-LAMP for
HCV genotype 1 showed a significant delay (later time to positive
than the positive control, last row) when it was combined with
BsrBI, NehI, BstNI. For genotype 2, delayed reaction was observed
with NehI. For Genotype 3 reaction with BsrBI was delayed and for
genotype 4 with BsrBI and NehI.
To amplify HCV viral RNA using an RT-LAMP method on a real-time PCR
machine without restriction enzymes, the RT-LAMP mix contained the
following: 20 .mu.L of RM, 2 .mu.L of EM, 1 .mu.L of FD, 4 .mu.L of
primer mixture (20 .mu.M BIP/FIP, 10 .mu.M LooP_B/Loop_F, and 2.5
.mu.M B3/F3), various amounts of RNA template solution, and enough
nuclease-free water to bring the volume to 40 .mu.L. The solution
was split into 10 .mu.L each and loaded into 3 wells on the Eco
real-time PCR (Illumina, CA) plate and heated at 63.degree. C. for
50 min.
To amplify HCV viral RNA using RT-LAMP in the presence of
restriction enzymes on a real-time PCR machine, the RT-LAMP mix
contained the following: 20 .mu.L of RM, 2 .mu.L of EM, 1 .mu.L of
FD, 4 .mu.L of primer mixture (20 .mu.M BIP/FIP, 10 .mu.M
LooP_B/Loop_F, and 2.5 .mu.M B3/F3), various amounts of RNA
template solution, 4 .mu.L diluted RE (20 fold diluted from
purchased stock solution) and enough nuclease-free water to bring
the volume to 40 .mu.L. The solution was split into 10 .mu.L each
and loaded into 3 wells on the Eco real-time PCR plate and heated
at 63.degree. C. for 50 min.
Example 2--End-Point Digital HCV Genotyping Results Using RT-LAMP
and Restriction Enzymes
Digestion was performed during amplification reaction for hepatitis
C virus (HCV) RNA on a SlipChip platform. Digital RT-LAMP for HCV
RNA was more thoroughly inhibited at the single RNA level compared
to a bulk assay, as shown for example in FIG. 9 and FIG. 10. FIG. 9
shows digital RT-LAMP results with and without restriction enzymes
for HCV genotyping. Positive controls are experiments in the
absence of restriction enzyme, shown in solid grey as reference.
Different restriction enzymes exhibit different capabilities for
digestion, which results in different counts among genotypes. All
experiments were performed in triplicates, with the p value shown
above each bar. FIG. 10 shows digital RT-LAMP results (black dots
are positive counts) on a SlipChip platform with genotype 1-4 HCV
RNA and different restriction enzymes--NheI (fourth row), BsrBI
(third row), and BstNI (second row)--as well as a positive control
(first row). Digital RT-LAMP for HCV Genotype 1 RNA was inhibited
by BsrBI, NheI, and BstNI at the single RNA level. Digital RT-LAMP
for Genotype 2 RNA was only inhibited by NheI. Digital RT-LAMP for
HCV Genotype 3 was only inhibited by BsrBI. Digital RT-LAMP for HCV
Genotype 4 RNA was inhibited by both BsrBI and NheI. These results
conform with the predicted pattern of inhibition based on genotype
sequences and restriction enzyme targeting.
The SlipChip device used was single volume 1280-well device,
designed and optimized based on "Bing Sun, Feng Shen, Stephanie E.
McCalla, Jason E. Kreutz, Mikhail A. Karymov, and Rustem F.
Ismagilov. Mechanistic evaluation of the pros and cons of digital
RT-LAMP for HIV-1 viral load quantification on a microfluidic
device and improved efficiency via a two-step digital protocol.
Anal Chem 2013, 85(3): 1540-1546." The procedure of fabricating the
SlipChip from soda-lime glass was based on the procedure described
in "Feng Shen, Bing Sun, Jason E. Kreutz, Elena K. Davydova, Wenbin
Du, Poluru L. Reddy, Loren J. Joseph, and Rustem F. Ismagilov,
Multiplexed quantification of nucleic acids with large dynamic
range using multivolume digital RT-PCR on a rotational SlipChip
tested with HIV and hepatitis C viral load. J Am Chem Soc 133(44):
17705-17712" and "Wenbin Du, Liang Li, Kevin P. Nichols, and Rustem
F Ismagilov, SlipChip, Lab Chip 2009, 9: 2286-2292." All features
were etched to a depth of 55 um to make the volume of loading well
equal to 3 nL.
To amplify HCV viral RNA using a RT-LAMP method on a real-time PCR
machine, the RT-LAMP mix contained the following: 20 .mu.L of RM, 2
.mu.L of EM, 1 .mu.L of FD, 4 .mu.L of primer mixture (20 .mu.M
BIP/FIP, 10 .mu.M LooP_B/Loop_F, and 2.5 .mu.M B3/F3), 2 .mu.L of
BSA (20 mg/mL), various amounts of RNA template solution, 4 .mu.L
diluted restriction enzyme (except for positive control), and
enough nuclease-free water to bring the volume to 40 .mu.L. The
solution was loaded onto a SlipChip and heated at 63.degree. C. for
50 min on a house-built real-time instrument. Experiments were
performed on a Bio-Rad PTC-200 thermocycler with a custom machined
block. The block contains a flat 3''.times.3'' portion onto which
the devices are placed ensuring optimal thermal contact. The
excitation light source used was a Philips Luxeon S (LXS8-PW30)
1315 lumen LED module with a Semrock filter (FF02-475). Image
Acquisition was performed with a VX-29MG camera and a Zeiss Macro
Planar T F2-100 mm lens. A Semrock filter (FF01-540) was used as an
emission filter. The exposure time was set to be 500 ms and gain to
be 1.
Example 3--Real-Time Digital HCV Genotyping Results Using RT-LAMP
and Restriction Enzymes
Experiments were performed as in the Example 2, except a
house-built imaging instrument was used to monitor the reactions in
individual wells of a SlipChip. Images were acquired every minute
with an exposure time of 500 ms and gain of 1. Both counts and time
to positive threshold changed with the addition of specific
restriction enzymes, as shown in FIG. 11A-11L. FIG. 11 shows
real-time digital HCV genotyping (genotype 1, 2, 3 and 4) results
using RT-LAMP and restriction enzymes. The solid curve with markers
in the first quadrant shows real-time monitored counts change over
time without restriction enzyme, while the dashed curve with
markers in the first quadrant shows real-time monitored counts
change over time with restriction enzymes. The solid line without
markers in the second quadrant shows time to positive (min) for
bulk experiments without restriction enzymes, while the dashed line
without markers in the second quadrant is time to positive (min)
for bulk experiments with restriction enzymes. FIG. 11A shows
real-time digital and bulk HCV genotyping results for Genotype 1
with and without restriction enzyme NheI. FIG. 11B shows real-time
digital and bulk HCV genotyping results for Genotype 1 with and
without restriction enzyme BsrBI. FIG. 11C shows real-time digital
and bulk HCV genotyping results for Genotype 1 with and without
restriction enzyme BstNI. FIG. 11D shows real-time digital and bulk
HCV genotyping results for Genotype 2 with and without restriction
enzyme NheI. FIG. 11E shows real-time digital and bulk HCV
genotyping results for Genotype 2 with and without restriction
enzyme BsrBI. FIG. 11F shows real-time digital and bulk HCV
genotyping results for Genotype 2 with and without restriction
enzyme BstNI. FIG. 11G shows real-time digital and bulk HCV
genotyping results for Genotype 3 with and without restriction
enzyme NheI. FIG. 11H shows real-time digital and bulk HCV
genotyping results for Genotype 3 with and without restriction
enzyme BsrBI. FIG. 11I shows real-time digital and bulk HCV
genotyping results for Genotype 3 with and without restriction
enzyme BstNI. FIG. 11J shows real-time digital and bulk HCV
genotyping results for Genotype 4 with and without restriction
enzyme NheI. FIG. 11K shows real-time digital and bulk HCV
genotyping results for Genotype 4 with and without restriction
enzyme BsrBI. FIG. 11L shows real-time digital and bulk HCV
genotyping results for Genotype 4 with and without restriction
enzyme BstNI. Real time digital traces can be analyzed in multiple
ways in this methodology, including end-point analysis, time-course
analysis, analysis of the area-under-the-curve, and so forth.
Example 4--Using Oligonucleotide Inhibitors to Selectively Delay a
HCV LAMP Amplification Reaction
Two oligonucleotide inhibitors were designed with the same sequence
except at four mutation points (underlined). The four mutations
were introduced in such a way that the melting temperatures (Tm) of
the two oligonucleotides (hybridized to DNA) are the same. The
sequences of the oligonucleotides are:
TABLE-US-00002 Matched inhibitor: (Seq ID No: 6)
CGGGGCACTCGCAAGCACCCTATCAGGCAGTACCACAAGGCCTTTCGCGA CCCAACTGAT
Mismatched inhibitor: (Seq ID No: 7)
CGGGGCACTCGCAAGCACTCTACCAGACAGTGCCACAAGGCCTTTCGCGA CCCAACTGAT
The results have been summarized in Table 1:
TABLE-US-00003 TABLE 1 Time-to-positive results for real-time
RT-LAMP with different oligonucleotide inhibitors for HCV RNA
Sample Time to positive/cycle (std. dev.) Positive Control 17.8
(0.23) With matched inhibitor 31.9 (0.79) With mismatched inhibitor
23.1 (0.16) (4 mismatches) Neg Ctrl. 54.3 (13.38)
Here time-to-positive is defined as the time required for the LAMP
reaction to change from negative (below intensity threshold) to
positive (above intensity threshold). In the real-time experiment,
each cycle was set to be 1 minute and the fluorescence intensity
was measured at the end of each cycle. Due to the time required for
imaging (12 s per cycle), the cycle numbers did not reflect the
absolute reaction time in the unit of minute.
Both matched and mismatched inhibitors have delayed the reaction;
however the mismatched inhibitors displayed less inhibition effect,
as expected. The matched and mismatched primers were specific
(perfectly matched) to different genotypes, resulting in different
inhibition effect to the same RNA. This difference leads to a
differentiation between genotypes. This difference led to the
differentiation between genotypes. For example, in the reaction
where there was oligonucleotide inhibitor specific to Genotype 1
(matched inhibitor in this example), when Genotype 1 HCV RNA was
introduced into the reaction a strong inhibition was observed. When
the inhibitor is not specific to Genotype 1 (such as the mismatched
inhibitor in this example) or is specific to other genotypes, when
Genotype 1 HCV RNA was introduced, little inhibition was
observed.
To amplify HCV RNA one-step RT-LAMP with oligonucleotide
inhibitors, per each 40 .mu.L the RT-LAMP mix contained the
following: 20 .mu.L of RM, 2 .mu.L of BSA (20 mg/mL), 2 .mu.L of
EM, 1 .mu.L of FD, 4 .mu.L of primer mixture (20 .mu.M BIP/FIP, 10
.mu.M LooP_B/Loop_F, and 2.5 .mu.M B3/F3), 2 .mu.L of RNase
Inhibitor (20 U/.mu.l), 4 .mu.L of HCV genotype 1 RNA, 1 .mu.L of
80 .mu.M oligonucleotide inhibitor, and enough nuclease-free water
to bring the volume to 40 .mu.L. The RNA was extracted from 140
.mu.L of plasma (AcroMetrix.RTM. HCV Genotyping Panel) using QIAamp
Viral RNA Mini Kit (Qiagen) with an elution volume of 60 .mu.L.
Loopamp.RTM. RT-LAMP mix was purchased from SA Scientific. The
solution was split into 10 .mu.L each and loaded onto Eco real-time
PCR machine and heated at 63.degree. C. for 60 cycles (1
min/cycle).
Example 5--Using Oligonucleotide Inhibitors Together with RT-LAMP
Reaction for HCV RNA Genotype 1 in Digital SlipChip Device
An experiment was also performed at single molecule level on a
SlipChip, as shown in FIG. 12. The reaction mix as detailed in
Example 4 was used. The digital experiments showed improved
specificity compared to bulk experiment. The specific
oligonucleotide inhibitor completely or nearly completely stopped
the reaction (very few counts after reaction), while the mismatched
oligonucleotide inhibitor did not change the count much (similar
number of counts to positive control without inhibitors). FIG. 12
shows digital RT-LAMP for HCV RNA Genotype 1 results on SlipChip.
Black dots represent positive counts. FIG. 12A shows results with
matched inhibitor, FIG. 12B shows results with mismatched
inhibitor, and FIG. 12C shows results from a positive control
without inhibitors.
To perform HCV RNA one-step RT-LAMP with oligonucleotide inhibitors
on a SlipChip, per each 40 .mu.L the RT-LAMP mix contained the
following: 20 .mu.L of RM, 2 .mu.L of BSA (20 mg/mL), 2 .mu.L of
EM, 1 .mu.L of FD, 4 .mu.L of primer mixture (20 .mu.M BIP/FIP, 10
.mu.M LooP_B/Loop_F, and 2.5 .mu.M B3/F3), 2 .mu.L of RNase
Inhibitor (20 U/.mu.l), 4 .mu.L of HCV genotype 1 RNA, 1 .mu.L of
80 .mu.M oligo inhibitor and enough nuclease-free water to bring
the volume to 40 .mu.L. The RNA was extracted from 140 .mu.L of
plasma (AcroMetrix.RTM. HCV Genotyping Panel) using QIAamp Viral
RNA Mini Kit (Qiagen) with an elution volume of 60 .mu.L.
Loopamp.RTM. RT-LAMP mix was purchased from SA Scientific. The
solution was directly loaded onto SlipChip devices and subject to
heating at 63.degree. C. for 50 minutes.
Example 6--Real-Time Bulk HCV Genotyping Results Using NASBA and
Restriction Enzymes
Seven restriction enzymes--NheI, BsrBI, ApoI, BsrGI, NruI, BseYI
and BstXI--were selected based on HCV sequence variation among
different genotypes (Bsp681 is an isoschizomer of NruI having the
same recognition and cleavage specificity). A set of customized
nucleic acid sequence based amplification (NASBA) primers and
molecular beacon probes targeting 5'UTR were designed; selected
sequences are showed in Table 2, wherein bold type indicates the
sequence of the bacteriophage T7 DNA-dependent RNA polymerase
promoter and stem sequences are indicated with underlines.
TABLE-US-00004 TABLE 2 NASBA primers and molecular beacon probe
targeting 5'UTR. Name Sequence 5'-3' 5'UTR_P2_NASBA_HCV_forward
GTCTAGCCATGGCGTTAGTA (Seq ID No: 2) 5'UTR_P1_NASBA_HCV_reverse_1
taatacgactcactatagggC AAGCACCCTATCAGGCAGTA (Seq ID No: 8)
5'UTR_P1_NASBA_HCV_reverse_2 taattctaatacgactcact
atagggCAAGCACCCTATCA GGCAGTA (Seq ID No: 9)
5'UTR_probe_NASBA_HCV_sense_1 /FAM/CGTACGGTCTGCGGAA
CCGGTGAGTACGTACG/ BHQ1/ (Seq ID No: 10)
5'UTR_probe_NASBA_HCV_sense_2 /FAM/CGATCGAGCCATAGT
GGTCTGCGGAACCGGTCGA TCG/BHQ1/ (Seq ID No: 3)
The cutting site of the restriction enzymes is included in the
produced amplicon (231 pb) inside the primer region, so that, for
example, the enzyme cuts the product during amplification and leads
to inhibition or delay of the reaction. Alignment of RNA sequences
for genotypes 1, 2, 3 and 4, priming and molecular beacon probe
regions, and digestion sites of NheI, BsrBI, ApoI, BsrGI, NruI (or
Bsp681), BseYI and BstXI is shown in FIG. 13. In FIG. 13, Consensus
genotype 1a (CON_GT1a); Consensus genotype 1b (CON_GT1b); Consensus
genotype 2a (CON_GT2a); Consensus genotype 2b (CON_GT2b); Consensus
genotype 3 (CON_GT3); Consensus genotype 4 (CON_GT4); A: NheI; B:
BsrBI; C: ApoI; D: BsrGI; E: NruI; F: BseYI; G: BstXI. Based on the
specificity of the enzymes, the pattern of NASBA-restriction enzyme
(NASBA-RE) results were predicted as shown in FIG. 14. In FIG. 14,
black circles represent negative NASBA reactions (inhibited
reaction in the presence of the restriction enzyme shown on the top
of the column) and white circles represent positive NASBA reactions
(non-inhibited reaction in the presence of the restriction shown on
the top of the column); each row represents a unique combination
(pattern or fingerprint) of positive and negative NASBA reactions
in the presence of different restriction enzymes associated with
one HCV genotype. Multiple patterns of inhibition are possible for
some genotypes due to the existence of mutations and multiple
sequences within each genotype.
By using the proposed pattern, and based on multiple nucleotide
sequence alignment obtained from HCV Los Alamos database, we
analyzed the coverage for Genotype 1 (subtypes 1a and 1b), Genotype
2, Genotype 3 (subtype 3a) and Genotype 4. As shown in Table 3, in
silico analysis showed that 97.6% (n=1,269) of HCV sequences were
correctly typed; 2% (n=26) of sequences are untyped; and 0.4% (n=5)
of sequences are mistyped. In Table 3, N seq stands for the number
of sequences; Pattern 1, 2, 3 and 4 are described in FIG. 14; No
Pattern includes the sequences that are not described by any of the
predicted patterns in FIG. 14. Numbers of sequences and percentages
in shaded boxes (Pattern 1 GT1, Pattern 2 GT2, Pattern 3 GT3, and
Pattern 4 GT4) describe genotypes under the correct expected
pattern.
TABLE-US-00005 TABLE 3 HCV genotype coverage based on predicted
patterns. HCV Genotype No (subtype) N Seq Pattern 1 Pattern 2
Pattern 3 Pattern 4 Pattern GT1 869 861 1 0 1 6 (1a + 1b) (99.1%)
(0.1%) (0.0%) (0.1%) (0.7%) GT2 190 0 181 0 0 9 (0.0%) (95.3%)
(0.0%) (0.0%) (4.7%) GT3 134 2 0 125 1 6 (3a) (1.5%) (0.0%) (93.3%)
(0.7%) (4.5%) GT4 107 0 0 0 102 5 (0.0%) (0.0%) (0.0%) (95.3%)
(4.7%)
The time required for NASBA reaction to change from negative (below
intensity threshold) to positive (above intensity threshold) is
shown in FIG. 15 and Table 4. The primer mix for 5'UTR NASBA
reaction used in this example includes: 5'UTR_P2_NASBA_HCV_forward,
5'UTR_P1_NASBA_HCV_reverse_1 and 5'UTR_probe_NASBA_HCV_sense_1.
Table 5 shows real-time NASBA results with and without restriction
enzymes for HCV genotyping with improved NASBA reaction. The primer
mix for 5'UTR NASBA reaction used for these results includes:
5'UTR_P2_NASBA_HCV_forward, 5'UTR_P1_NASBA_HCV_reverse_2 and
5'UTR_probe_NASBA_HCV_sense_2. NruI was replaced by BstEII.
Predicted (in silico) negative or delayed results are shown in
bold.
TABLE-US-00006 TABLE 4 Real-time NASBA results with and without
restriction enzymes for HCV genotyping. Restriction HCV RNA (Cq)
Enzyme GT1 GT2 GT3 GT4 Non-RE (PC) 41.7 88.9 72.8 71.6 41.7 90.6
71.8 64.9 NheI neg NT NT neg neg NT NT neg BsrBI neg 78.3 neg neg
neg 80.0 neg neg ApoI 38.2 94.6 NT NT neg 91.8 NT NT BsrGI 43.6
76.3 76.5 NT 44.5 75.2 76.5 NT
TABLE-US-00007 TABLE 5 Real-time NASBA results with and without
restriction enzymes for HCV genotyping with improved NASBA
reaction. Restriction Time to Positive in minutes (SD) Enzyme GT1
GT2 GT3 GT4 Non-RE (PC) 26.6 (0.2) 30.9 (0.7) 29.2 (1.2) 27.3 (0.1)
NheI-HF Neg Neg 35.4 (7.1) 64.2 (20.3) BsrBI Neg 42.6 (1.5) Neg
42.8 (0.3) ApoI 27.1 (0.2) 34.8 (2.5) Neg 47.5 (7.1) BsrGI 33.0
(1.2) 48.9 (1.8) 45.4 (17.6) 46.2 (6.3) BstEII 30.8 (0.4) 44.5
(6.9) Neg 31.5 (1.3) BstXI 28.2 (0.8) 37.0 (0.2) Neg 34.4 (3.3)
Bsp681 Neg 40.2 (3.3) Neg 45.8 (0.1)
In the real-time experiment, each cycle was set to be 1 minute and
the fluorescence intensity was measured at the end of each cycle.
Due to the time required for imaging (additional 12 seconds per
cycle), the cycle numbers did not reflect the absolute reaction
time in the unit of minute. The performance of this idea has been
evaluated by testing NheI, BsrBI, ApoI and BsrGI against HCV
genotypes 1, 2, 3 and 4. Preliminary results showed that real time
NASBA reactions for HCV Genotype 1 are inhibited in combination
with BsrBI, NehI, and are not inhibited in the presence of ApoI and
BsrGI. One of the replicates was also inhibited in the presence of
ApoI. For Genotype 2, no negative reactions were observed in the
presence of BsrBI, ApoI and BsrGI. For Genotype 3, reaction with
BsrBI was negative and positive with BsrGI, and for Genotype 4 the
reaction was negative with BsrBI and NehI.
After optimization of primers/probe for 5'UTR HCV NASBA reaction
the assay was evaluated with HCV GT1, GT2, GT3 and GT4 in the
presence of NheI-HF, BsrBI, ApoI, BsrGI, BstEII, BstXI and Bsp681
(restriction enzymes were selected based on Table 5). Time to
positive obtained in the presence of the restriction enzymes were
compared to a positive control reaction (without restriction
enzyme) for each HCV genotype (Table 5). Predicted (in silico)
negative or delayed reactions are shown in bold in Table 5.
Obtained reactions agreed with predicted results: GT1 amplification
reactions were completely inhibited by NheI-HF, BsrBI and Bsp681;
GT2 amplification reaction was completely inhibited by NheI-HF; GT3
amplification was completely stopped by BsrBI, ApoI, BstEII, BstXI
and Bsp681; GT4 amplification reaction were strongly inhibited by
NheI-HF, BsrBI, ApoI, BsrGI, Bsp681. Presence of non-specific
restriction enzymes also produced a delay in time to positive, but
the extent of inhibition was less significant.
To amplify HCV viral RNA using a NASBA method on real-time PCR
machine without restriction enzymes, the NASBA mix (NucliSens EasyQ
Basic Kit v2, Biomerieux) was prepared as follows: 55 .mu.L of
Enzyme Diluent were added to an Enzyme Sphere and let sit for 20
min. The reagent mix was prepared in a clean tube containing 80
.mu.L of Reagent Sphere Diluent, 12 .mu.L NASBA Water, 16 .mu.L KCl
stock solution and the Reagent Sphere. After vortexing for 30 sec,
4.8 .mu.L of vortexed NASBA forward primer (10 .mu.M stock), 4.8
.mu.L of vortexed NASBA reverse primer (10 .mu.M stock) and 2.4
.mu.L of vortexed NASBA probe (10 .mu.M stock) were added to the
reagent mix. The solution was split into 0.2 mL PCR tubes (10 .mu.L
each) and 4 .mu.L of HCV RNA (sample) or nuclease-free water
(non-template control) were loaded and incubated at 65.degree. C.
for 5 min Five .mu.L of Enzyme solution (after gently flicking it
to mix) and 1 .mu.L of nuclease-free water were added to each PCR
tube. The solution was split into 10 .mu.L each and loaded into 2
wells on a Eco real-time PCR (Illumina, CA) plate and heated at
41.degree. C. for 120 min.
To amplify HCV viral RNA using a NASBA method a on real-time PCR
machine in the presence of restriction enzyme, the NASBA mix
(NucliSens EasyQ Basic Kit v2, Biomerieux) was prepared as follows:
55 .mu.L of Enzyme Diluent were added to an Enzyme Sphere and let
sit for 20 min. The reagent mix was prepared in a clean tube
containing 80 .mu.L of Reagent Sphere Diluent, 12 .mu.L NASBA
Water, 16 .mu.L KCl stock solution and the Reagent Sphere. After
vortexing for 30 sec, 4.8 .mu.L of vortexed NASBA forward primer
(10 .mu.M stock), 4.8 .mu.L of vortexed NASBA reverse primer (10
.mu.M stock) and 2.4 .mu.L of vortexed NASBA probe (10 .mu.M stock)
were added to the reagent mix. The solution was split into 0.2 mL
PCR tubes (10 .mu.L each) and 4 .mu.L of HCV RNA (sample) or
nuclease-free water (non-template control) were loaded and
incubated at 65.degree. C. for 5 min. Five .mu.L of Enzyme solution
(after gently flicking it to mix) and 1 .mu.L of diluted RE (20
fold diluted from purchased stock solution) were added to each PCR
tube. The solution was split into 10 .mu.L each and loaded into 2
wells on an Eco real-time PCR (Illumina, CA) plate and heated at
41.degree. C. for 120 min.
Furthermore, a Nokia 808 Pureview cell phone was used to image
microwells of a multivolume device (see, e.g., Feng Shen, Bing Sun,
Jason E. Kreutz, Elena K. Davydova, Wenbin Du, Poluru L. Reddy,
Loren J. Joseph, and Rustem F. Ismagilov, "Multiplexed
Quantification of Nucleic Acids with Large Dynamic Range Using
Multivolume Digital RT-PCR on a Rotational SlipChip Tested with HIV
and Hepatitis C Viral Load," JACS 2011 133: 17705-17712) containing
NASBA amplification product. This cell phone features a CMOS sensor
with a Xenon flash. The Nokia 808 uses a 1/1.4-inch 41-megapixel
sensor with a pixel size of 1.4 .mu.m. Cell phone imaging was
performed with a painted shoebox painted black inside. All images
were taken using the standard cell phone camera application. The
white balance was set to automatic, the ISO was set at 800, the
exposure value was set at +2, the focus mode was set to "close-up,"
and the resolution was adjusted to 8 MP.
Example 7--Real-Time Bulk HCV Genotyping and Subtyping Using NASBA
and Restriction Enzymes
14 restriction enzymes--AlwI, ApoI, BseYI, BsiEI, BsmAI, BsrBI,
BsrGI, BsrI, BstEII, BstXI, BtsCI, HinfI, NheI and NruI--were
selected for HCV genotyping (genotypes 1, 2, 3, 4, 5 and 6) and
subtyping. The presence of target sequences for these restriction
enzymes have been tested within the amplicon generated with the
5'UTR NASBA primers described in Example 6 and against a sequence
alignment (n=1622) obtained from the Los Alamos HCV database.
Results obtained by in silico analysis are shown in Table 6. In
Table 6, the number of cutting sites per restriction enzyme against
HCV sequences are represented as percentage, numbers in shaded
boxes represent >70% coincidence. Included are Genotype 1 (GT1):
subtype 1a (GT1a), subtype 1b (GT1b) and other GT1 subtypes
(GT1nonAB); genotype 2 (GT2); Genotype 3 (GT3): subtype 3a (GT3a),
subtype 3b (GT3b), subtype 3k (GT3k) and other GT3 subtypes
(GT3nonABK); genotype 4 (GT4); genotype 5 (GT5); genotype 6 (GT6);
N seq stands for the number of analyzed HCV sequences.
HCV NASBA primers and molecular beacon probes were also designed in
CORE and NS5B regions for subtyping purposes; examples are shown in
Table 7, Table 8, and Table 9. In Table 7, Table 8, and Table 9,
bold type indicates the sequence of the bacteriophage T7
DNA-dependent RNA polymerase promoter, stem sequences are indicated
with underlines, Y represents C or T, R represents A or G, and I
represents inosine.
TABLE-US-00008 TABLE 6 Percentage of restriction enzyme cutting
site per HCV genotype/subtype within 5'UTR NASBA amplicon. HCV
Genotype/ Restriction enzymes Subtype N seq AlwI ApoI BseYI BsiEI
BsmAI BsrBI BsrGI BsrI BstEII BstXI Bt- sCI HinfI NheI NruI GT1a
504 30.8 0.2 0.0 98.6 12.1 100.0 0.0 0.2 0.0 0.0 1.4 1.8 99.6 99.6
GT1b 365 88.5 0.0 0.0 94.5 96.4 99.5 0.0 0.5 0.0 0.3 4.4 1.1 99.7
99.5 GT1nonAB 29 48.3 17.2 0.0 93.1 27.6 100.0 3.4 0.0 0.0 0.0 6.9
20.7 100.0 1- 00.0 GT2 190 3.2 0.0 2.1 0.0 0.5 2.1 0.5 97.9 0.0 1.6
0.0 1.1 96.8 0.0 GT3a 134 3.7 97.0 96.3 1.5 2.2 99.3 0.0 0.7 94.0
96.3 3.0 97.8 3.0 99.3 GT3b 25 0.0 96.0 0.0 20.0 0.0 100.0 0.0 0.0
0.0 0.0 80.0 96.0 0.0 100.0 GT3k 23 0.0 100.0 0.0 0.0 91.3 100.0
0.0 0.0 0.0 0.0 0.0 100.0 100.0 95.7 GT3nonABK 21 9.5 81.0 14.3
14.3 19.0 100.0 0.0 0.0 85.7 14.3 0.0 100.0 14.- 3 100.0 GT4 107
17.8 87.9 0.0 13.1 18.7 100.0 70.1 0.0 0.0 0.0 82.2 86.9 97.2 80.4-
GT5 52 1.9 1.9 0.0 17.3 98.1 100.0 0.0 0.0 0.0 0.0 82.7 5.8 100.0
100.0 GT6 172 71.5 0.0 0.0 60.5 73.8 89.5 1.2 0.6 0.0 0.6 29.1 30.2
99.4 77.3
TABLE-US-00009 TABLE 7 NASBA primers and molecular beacon probes
targeting NS5B. Name Sequence 5'-3' NS5B NASBA HCV
ACGGAGGCTATGACCYGGTA forward primer_1 (Seq ID No: 11) NS5B NASBA
HCV CTTCACGGAGGCTATGAC forward primer_2 (Seq ID No: 12) NS5B NASBA
HCV aattctaatacgactcactatagggagaaggAT reverse primer_1
GTTGCCTAGCCAGGARTT (Seq ID No: 13) NS5B NASBA HCV
aattctaatacgactcactatagggagaaggAT reverse primer_2
IATGTTGCCTAGCCAGG (Seq ID No: 14) NS5B NASBA HCV FAM probe_1
CCTGCACCAGAATACGACTTGGAGCTCAT AACGTGCAGGBHQ1 (Seq ID No: 15) NS5B
NASBA HCV FAM CCTGCACTAACATCATGITCCTCCAAY probe_2 GTGTCGTGCAGGBHQ1
(Seq ID No: 16)
TABLE-US-00010 TABLE 8 NASBA primers and molecular beacon probes
targeting CORE. Name Sequence 5'-3' CORE NASBA HCV
AGGACGTYAAGTTCCCGGG forward primer_1 (Seq ID No: 17) CORE NASBA HCV
GATCGTTGGTGGAGTTTAC forward primer_2 (Seq ID No: 18) CORE NASBA HCV
TCCTAAACCTCAAAGAAAAAC forward primer_3 (Seq ID No: 19) CORE NASBA
HCV aattctaatacgactcactatagggagaaggGC reverse primer_1
CAAGGRTACCCGGGCTG (Seq ID No: 20) CORE NASBA HCV
aattctaatacgactcactatagggagaaggTC reverse primer_2
RTTGCCATAGAGGGGCC (Seq ID No: 21) CORE NASBA HCV
aattctaatacgactcactatagggagaaggGG reverse primer_3
AGCCATCCYGCCCACCC (Seq ID No: 22) CORE NASBA HCV FAM
CCTGCAAAGACTTCCGA probe_1 GCGGTCRCAACCTGCAGGBHQ1 (Seq ID No: 23)
CORE NASBA HCV FAM CCTGCAAGGAAGACTTCC probe_2 GAGCGGTCRCATGCAGGBHQ1
(Seq ID No: 24) CORE NASBA HCV FAM CCTGCAAAGACTTCCGAGC probe_3
GGTCRCAACCTCGTGCAGGBHQ1 (Seq ID No: 25) CORE NASBA HCV FAM
CCTGCAGGGTGTGCGCGCG probe_4 ACGAGGAAGACTGCAGGBHQ1 (Seq ID No:
26)
TABLE-US-00011 TABLE 9 NASBA primers and molecular beacon probes
specific for HCV NS5B GT1A and GT1B. Amplicon Name Sequence 5'-3'
size P1_GT1A AATTCTAATACGACTCACTATAGGGAAATCTACGG 120 bp
ATAGCAAGTTRGC (Seq ID No: 27) P2_GT1A CCAAAGGCAGAAGAAAGTCA (Seq ID
No: 28) Beacon_GT1A /FAM/CGCGATGGAGGTTAARGCRGCGGCGTATCGCG /BHQ1/
(Seq ID No: 29) P1_GT1B_set1 AATTCTAATACGACTCACTATAGGGAAACTCCAAG
130 bp TCGTATTCTGGTT (Seq ID No: 30) P2_GT1B_set1
CGACCTTGTCGTTATCTGTGA (Seq ID No: 31) Beacon_GT1B_set1
/FAM/CGCGATTTCACGGAGGCTATGACTAGGTATCG CG/BHQ1/ (Seq ID No: 32)
P1_GT1B_set2 AATTCTAATACGACTCACTATAGGGAAATGAATGA 107 bp TCTGAGGTAG
(Seq ID No: 33) P2_GT1B_set2 TTCTTCTCCATCCTYMTA (Seq ID No: 34)
Beacon_GT1B_set2 /FAM/CGCGAT AARGCCCTRGAYTGYCAGATCTAATCGCG/BHQ1/
(Seq ID No: 35) P1_GT1B_set3 AATTCTAATACGACTCACTATAGGGAAACACAACA
119 bp TTGGTANATTGACT (Seq ID No: 36) P2_GT1B_set3
GGTGAAHRCCTGGAAAKCRAA (Seq ID No: 37) Beacon_GT1B_set3_1
/FAM/CGCGATCACRGTCACYGAGARYGAYATCCGAT CGCG/BHQ1/ (Seq ID No: 38)
Beacon_GT1B_set3_2 /FAM/CGCGATCGACACCCGYTGYTTYGACTCAAGAT CGCG/BHQ1/
(Seq ID No: 39) P1_GT1B_set4 AATTCTAATACGACTCACTATAGGGAAAAAGTGG 110
bp YTCAATGGAGTA (Seq ID No: 40) P2_GT1B_set4 CAAGGATGATYCTGATGAC
(Seq ID No: 41) Beacon_GT1B_set4
/FAM/CGCGATCCCTYCTAGCNCAGGARCAACTGATC GCG/BHQ1/ (Seq ID No: 42)
P1_GT1B_set5 AATTCTAATACGACTCACTATAGGGAAAGCTAGAA 113 bp GGATGGAGAAR
(Seq ID No: 43) P2_GT1B_set5 GARACAGCTAGACACACT (Seq ID No: 44)
Becon_GT1B_set5 /FAM/GCGATCGGCTAGGCAACATCATCATGATCGC/BHQ1/ (Seq ID
No: 45)
Example 8--Quantitative Nucleic Acid Detection by Loop-Mediated
Isothermal Amplification (LAMP)
A Reverse-Transcription Loop mediated amplification (RT LAMP) assay
was conducted for quantitative isothermal detection of nucleic
acids such as detection of Hepatitis C viral (HCV) RNA. The test
comprises at least one nucleic acid primer set capable of detecting
Hepatitis C viral (HCV) RNA in a LAMP based molecular test, the
primer set being chosen from the primer sets listed in Table 10.
Each assay consists of a primer set including one pair of forward
(FIP) and reverse (BIP) inner primers, forward (F3) and reverse
(B3) outer primers. The assay can also include loop forward (LF)
and/or loop back (LB) primers to accelerate the reaction. HCV
genotypes 1, 2, 3, 4, 5, 6, and 7 can be detected using the assay.
The assay is applicable for studying a number of diseases,
including but not limited to accurate HCV quantification using a
digital format (i.e., confining single molecules into compartments
and amplifying them separately) on a SlipChip device.
Primers for LAMP were designed to achieve improvements including a
higher melting temperature for reverse-transcription primers,
weakened loopF primer annealing to improve efficiency and delaying
time to product signal, and positioning important-to-anneal fast
primer parts (B1c and F1c) to be complementary to the secondary
structures loop in RNA template to improve detection efficiency.
HCV, like HIV, has a large variety of genotypes and mutates rapidly
due to the error-prone nature of the reverse transcriptase. As a
result, it is beneficial for a quantification assay to be able to
detect all the genotypes or genotypes with high prevalence. To make
the primer set general, the 3' halves of the B3, F3, B2, F2 primers
sequences and the 5' halves of the B1c and F1c primers sequences
were positioned to the most conserved positions in the all HCV
known sequences alignment. The primers were further made to be
universal and suitable to a widest known variety of HCV isolates,
and are shown in Table 10, Table 11, and Table 12. FIG. 17 shows an
illustration of one of the disclosed B side primers and primer
parts sequences variant aligned to one of the typical HCV
sequences. FIG. 18 shows an illustration of one of the disclosed F
side primers and primer parts sequences variant aligned to one of
the typical HCV sequences.
TABLE-US-00012 TABLE 10 A summary of basic and universal
(containing Inosine as a general nucleic acid base pairer) primers
developed for efficient and specific detection of, for example, HCV
RNA via RT-LAMP. Primer F3 FIP loopF (LF) basic CCTCCCGGGA
TCCAAGAAAGGACCCGGTCTTTTTCT GTCCTGGCAAT GAGCCATAG GCGGAACCGGTGAGTAC
TCCGGT (Seq ID (Seq ID No: 47) (Seq ID No: 46) No: 48) universal
CCTCCCGGGA TCCAAGAAAGGACCCIGTCTTTTTCT TTICCGGIAATT GAGCCATAG
GCGGAACCGGTGAGTAC CCGGT (Seq ID (Seq ID No: 49) (Seq ID No: 46) No:
50) Primer B3 BIP loopB (LB) basic GCACTCGCAA
TTGGGCGTGCCCCCGCAAGTTTTTCA CTGCTAGCCGA GCACCCTATC
GTACCACAAGGCCTTTCGCGACC GTAGTGTTG (Seq ID (Seq ID No: 52) (Seq ID
No: 51) No: 53) universal GCACTCGCAA TTGGGCGTGCCCCCGCIAGATTTTTC
CTGCTAGCCGA GCACCITATC AGTACCACAAGGCCITTCGCIACC GTAGIGTTG (Seq ID
(Seq ID No: 55) (Seq ID No: 54) No: 56,)
TABLE-US-00013 TABLE 11 A summary of additional FIP primers,
designed in this case to compensate for a known HCV isolates of
different subtypes/genotypes, via RT-LAMP detection. genotype FIP
variant 1 TCCAAGAAAGGICCCIGTCTTTTT CTGCGGAACCGGTGAGTAC (Seq ID No:
57) 2 CCCAAGAAAGGICCCIGTCTTTTT CTGCGGAACCGGTGAGTAC (Seq ID No: 58)
3 TCCAATGGAAAGGICCCIGTCTTTTT CTGCGGAACCGGTGAGTAC (Seq ID No: 59)
Some 4 and 6 TCCAAGAAAGGICCCIGTCTTTTT CTGCGGAACCGGTGAGTTC (Seq ID
No: 60) Some 1 TCCAIGAAAGGACCCGGTCTTTTT CTGCGGAACCGGTGAGTAC (Seq ID
No: 61)
TABLE-US-00014 TABLE 12 A summary of universal loopF (LF) primers,
designed to compensate for known subtypes/ genotypes sequence
variations. Template consensus genotype LF primer ACCGNAATTGCCAGGAC
1 GTCCTGGCAATTICGGT (Seq ID No: 62) (Seq ID No: 63)
ACCGGAATTNCCGGNAA 2 and 1 TTICCGGIAATTCCGGT (Seq ID No: 64) (Seq ID
No: 50) ACCGGAATNGCNGGGNN 3 and 4 IICCCIGCIATTCCGGT (Seq ID No: 65)
(Seq ID No: 66) ACCGGAATNGCNGGGGT AICCCIGCIATTCCGGT (Seq ID No: 67)
(Seq ID No: 68)
Back side primers can comprise the following:
TABLE-US-00015 BIP: (Seq ID No: 69)
5'TTGGGCGTGCCCCCGCAAGttttCAGTACCACAAGGCCTTTCGCGA CC 3'
BIP primer comprises of the B2 and B1c parts, which may be
connected directly, or through any linker sequence, including but
not limited to tttt.
TABLE-US-00016 B2 part of BIP: (Seq ID No: 70) the core sequence is
5'-CAGTACCACAAGGCCTTTCGCGACC- 3'
As a B2 part of BIP primer, an oligonucleotide is used comprising
at least 5 consecutive nucleotides of the nucleotide sequence
CAGTACCACAAGGCCTTTCGCGACC (Seq ID No: 70).
TABLE-US-00017 B1c part of BIP: (Seq ID No: 71) the core sequence
is 5'-TTGGGCGTGCCCCCGCAAG-3'
Variations of the B1c part of BIP incorporation of inosin, LNA or
BNA modified, and other modified bases.
TABLE-US-00018 (Seq ID No: 72) loopB: 5' CTGCTAGCCGAGTAGTGTTG
3'
A loopB element may or may not be present in the amplification
reaction. Variations of loopB include incorporation of inosine, LNA
or BNA modified, and other modified bases. As a loopB primer an
oligonucleotide can be used comprising at least 5 consecutive
nucleotides of the nucleotide sequence CTGCTAGCCGAGTAGTGTTG (Seq ID
No: 72).
TABLE-US-00019 (Seq ID No: 51) B3: 5'-GCACTCGCAAGCACCCTATC-3'
B3 primer may or may not be present in 1-step RT-LAMP reactions. As
a B3 primer an oligonucleotide can be used comprising at least 5
consecutive nucleotides of the nucleotide sequence
GCACTCGCAAGCACCCTATC (Seq ID No: 51).
Forward side primers can comprise the following:
TABLE-US-00020 (Seq ID No: 46) F3 primer:
5'-CCTCCCGGGAGAGCCATAG-3'
As a F3 primer an oligonucleotide can be used comprising at least 5
consecutive nucleotides of the nucleotide sequence
CCTCCCGGGAGAGCCATAG (Seq ID No: 46).
TABLE-US-00021 FIP primer: (Seq ID No: 47)
5'-TCCAAGAAAGGACCCGGTCTTTTTCTGCGGAACCGGTGAGTAC-3'
Variations on the FIP primer can include universal variants with
inosines, or any other nucleotide bases instead of them are as
follows:
TABLE-US-00022 (Seq ID No: 47) 5'-TCCAAGAAAGGACCCGGTC TTTTT
CTGCGGAACCGGTGAGTAC- 3' (Seq ID No: 57) 5'-TCCAAGAAAGGICCCIGTC
TTTTT CTGCGGAACCGGTGAGTAC- 3' (#1) (Seq ID No: 58)
5'-CCCAAGAAAGGICCCIGTC TTTTT CTGCGGAACCGGTGAGTAC- 3' (#2) (Seq ID
No: 59) 5'-TCCAATGGAAAGGICCCIGTC TTTTT CTGCGGAACCGGTGAGTA C-3' (#3)
(Seq ID No: 60) 5'-TCCAAGAAAGGICCCIGTC TTTTT CTGCGGAACCGGTGAGTTC-
3' (#4 for some #4,6) (Seq ID No: 61) 5'-TCCAI-GAAAGGACCCGGTC TTTTT
CTGCGGAACCGGTGAGTAC- 3'(#5 for some #1)
The FIP primer comprises of the F2 and F1c parts, which may be
connected directly, or through any linker sequence, including but
not limited to ttttt.
TABLE-US-00023 F2 part of FIP: (Seq ID No: 73) the core sequence is
5'-CTGCGGAACCGGTGAGTAC-3',
Variations of F2 can include incorporation of inosin, LNA or BNA
modified, and other modified bases. As a F2 part of FIP primer an
oligonucleotide can be used comprising at least 5 consecutive
nucleotides of the nucleotide sequence 5' CTGCGGAACCGGTGAGTAC 3'
(Seq ID No: 73).
TABLE-US-00024 F1c part of FIP: (Seq ID No: 74) the core sequence
is 5'-TCCAAGAAAGGACCCGGTC-3',
As a F1c part of FIP primer an oligonucleotide can be used
comprising at least 5 consecutive nucleotides of the nucleotide
sequence TCCAAGAAAGGACCCGGTC (Seq ID No: 74) Loop F primers (LF):
LF may or may not be used in the amplification reaction. Some of LF
variants used are:
TABLE-US-00025 (Seq ID No: 48) 5'GTCCTGGCAATTCCGGT 3' (Seq ID No:
75) 5'TCGTCCTGGCAATTCCG 3' (Seq ID No: 48) 5' GTCCTGGCAATTCCGGT
3'
Variations of LF can include but are not limited to incorporation
of inosine, LNA or BNA modified, and other modified bases. As a LF
primer an oligonucleotide can be used comprising at least 5
consecutive nucleotides of the nucleotide sequence
TCGTCCTGGCAATTCCG (Seq ID No: 75).
In addition, variations of all the mentioned primers and primer
parts can include but are not limited to incorporation of inosine,
LNA or BNA modified, and other modified bases; changing up to 20%
of the bases for the other nucleotides, including inosine, dUTPs,
LNA or BNA modified bases, RNA bases, abased nucleotides or any
nucleotide analogs; shifting or shortening the primer or primer
part up to 7 bases counting from either it's 5' or 3' ends, or
both; and simple elongating the primer. The primers were designed
based on HCV genotype 1a, but after modification it can be used to
detect all the major genotypes circulating in the US as well as
other nucleic acids.
LAMP was conducted in a digital format (e.g., confining single
molecules into compartments and amplifying them separately) on a
SlipChip device comprising 1280 wells. FIG. 19 shows results for
the number of positive wells versus time, from one step dRT-LAMP
HCV RNA detection with real-time tracking of the 1280 wells'
intensity over time. The reaction was done on standard fresh HCV
RNA quantified with dRT-PCR, in a presence of total RNA extracted
from human blood plasma, in 1.times. final concentration in
reaction mixture. .about.250 HCV RNA were loaded, copies quantified
with RT-PCR. FIG. 20 shows results for the signal from each well
versus time, from one step dRT-LAMP HCV RNA detection with
real-time tracking of the 1280 wells' intensity over time. At 50
minutes, 128 positive counts had been observed out of an estimated
total 133+/-11 viral copies loaded and quantified with RT-PCR. FIG.
21 shows an image of a SlipChip device with results from one step
dRT-LAMP HCV RNA detection. At 50 minutes, 99 positive counts are
visible out of an estimated total 133+/-11 viral copies loaded,
quantified with RT-PCR. FIG. 22 shows results for the number of
positive wells versus time, from one step dRT-LAMP HCV RNA
detection with real-time tracking of the 1280 wells' intensity over
time. Reaction was done on standard fresh HCV RNA quantified with
dRT-PCR, .about.133 HCV RNA copies were loaded (+/-.about.11
copies). At 50 minutes, 111 copies were detected in a first
experiment (FIG. 22A) 111 and 134 copies were detected in a second
experiment (FIG. 22B).
Example 9--Real-Time Digital RT-LAMP/Restriction Enzyme
(RT-LAMP/RE) Assay for HCV Genotyping
Real-time digital RT-LAMP/restriction enzyme (RT-LAMP/RE)
experiments were performed with HCV Genotype 1 (GT1) RNA using
BsrBI as the restriction enzyme. RT-LAMP primers are shown in Table
13. HCV GT1 isolate was obtained commercially and sequenced after
RNA purification to confirm the genotype assignment; sequencing
results for HCV RNA purified from the isolates is shown in Table
14.
TABLE-US-00026 TABLE 13 Sequence of primers used in RT-LAMP. primer
sequence (5'-3') F3 CCTCCCGGGAGAGCCATAG (Seq ID No: 46) HP
TCCAAGAAAGGACCCIGTCTTTTTCTGCGGAACCGGTGAGTAC (Seq ID No: 49) LF
TTICCGGIAATTCCGGT (Seq ID No: 50) B3 GCACTCGCAAGCACCITATC (Seq ID
No: 54) BIP TTGGGCGTGCCCCCGCIAGATTTTTCAGTACCACAAGGCCITT CGCIACC
(Seq ID No: 55) LB CTGCTAGCCGAGTAGIGTTG (Seq ID No: 56)
TABLE-US-00027 TABLE 14 Sequencing results for HCV RNA purified
from purchased isolates. Genotype 1
TCGTGCAGCCTCCAGGACCCCCCCTCTCGGGAGAGCCATAGTGGTCTGC
GGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTT
GGATCAACCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACT
GCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGAT
AGGGTGCTTGCGAGTGCCTCGGGAGGT (Seq ID No: 76) Genotype 2
TCGTACAGCCTCCAGGCCCCCCCCTCCCGGGAGAGCCATAGTGGTCTGC
GGAACCGGTGAGTACACCGGAATTGCCGGGAAGACTGGGTCCTTTCTT
GGATAAACCCACTCTATGCCCGGCCATTTGGGCGTGCCCCCGCAAGACT
GCTAGCCGAGTAGCGTTGGGTTGCGAAAGGCCTTGTGGTACTGCCTGAT
AGGGTGCTTGCGAGTGCCCCGGGAGGT (Seq ID No: 77) Genotype 3
TCGTGCAGCCTCCAGGATCCCCCCTCCCGGGAGAGCCATAGTGGTCTGC
GGAACCGGTGAGTACACCGGAATCGCTGGGGTGACCGGGTCCTTTCTTG
GAGCAACCCGCTCAATACCCAGAAATTTGGGCGTGCCCCCGCGAGATC
ACTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGAT
AGGGTGCTTGCGAGTGCCCCGGGAGGT (Seq ID No: 78) Genotype 4
TTGTACAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGC
GGAACCGGTGAGTACACCGGAATCGCCGGGATGACCGGGTCCTTTCTT
GGATAAACCCGCTCAATGCCCGGAAATTTGGGCGTGCCCCCGCAAGAC
TGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGA
TAGGGTGCTTGCGAGTGCCCCGGGAGGT (Seq ID No: 79)
BsrBI cuts dsDNA at sequences CCGCTC, and this sequence exists in
the RT-LAMP amplicon of GT1 RNA. With negative control experiments,
the highest possible BsrBI concentration that did not trigger ab
initio DNA synthesis within the time of interest under reaction
conditions was identified, as shown in FIG. 23. The concentration
was determined by performing a restriction enzyme dilution
experiment in the presence of all RT-LAMP components except HCV RNA
and choosing the concentration for which ab initio synthesis was
not observed within 50 min. Columns represent time to positive
(ttp) caused by ab initio DNA synthesis and error bars stand for
standard deviation. RT-LAMP reactions were performed in the absence
of HCV RNA and in the presence of three different dilutions
(100-fold, 200-fold and 300-fold) of NheI (grey), BsrBI (striped),
and BstNI (white). Horizontal solid line shows the ttp threshold
set for analysis (50 min). In the experiments reported in this
paper, 200-fold RE dilution was used because 100-fold dilution was
not enough to remove the influence of ab initio DNA synthesis
within 50 min.
A SlipChip microfluidic device was used to compartmentalize the
reaction mixture, as shown in FIG. 24. Schematic drawings show the
layout of top and bottom piece of the entire device on the right
and a zoomed-in region (black box) on the left (FIG. 24A), the
relative position of two pieces when they are aligned to allow the
loading of solution through the channel (FIG. 24B), and the
relative position of two pieces when they are slipped to separate
droplets from one another and form compartments (FIG. 24C). The
progress of amplification was monitored for each single molecule
using a CCD-based imaging system, with results shown in FIG. 25.
FIG. 25A shows 1280 fluorescence traces for the RT-LAMP
amplification process of all the wells on a SlipChip device (solid
lines) and normalized averaged fluorescence curve in bulk (dashed
line) in the absence of restriction enzymes. FIG. 25B shows traces
for digital (solid lines) and for bulk (dashed line) in the
presence of restriction enzyme BsrBI. Horizontal solid lines
indicate the threshold levels to consider a well positive. Vertical
solid lines show the mean of the time-to-positive distribution.
FIG. 25C shows the change of cumulative counts over time for wells
exceeding the threshold in FIG. 25A, (upper five lines), and FIG.
25B (lower lines). The two bars below the x-axis show
time-to-positive for real-time bulk experiments, the widths of
which stand for standard deviation for the bulk assay (n=5) (left
line for FIG. 25A results, right line from FIG. 25B results). Even
in the amplification reaction in the absence of the restriction
enzyme, significant heterogeneity was observed among rates of
amplification of different molecules (FIG. 25A). Addition of BsrBI
did not abolish this heterogeneity (FIG. 25B). On average, even
though the rates of the reactions decreased upon addition of BsrBI,
the shift in reaction times (approximately 5 min, for the first
well that turned positive) was small relative to the width of the
distribution of the reaction times (over 30 min). On the other
hand, the fate of single-molecule amplification did change
significantly upon addition of BsrBI: .about.10-fold fewer
molecules gave rise to successful amplification (with a p-value of
0.00033), indicating that in digital RT-LAMP, BsrBI affects fate
more than it affects rate. FIG. 26 shows a histogram of real-time,
single-molecule digital RT-LAMP/RE experiments for HCV GT1 RNA; the
graph shows the change of rate for positive wells in the absence of
restriction enzyme and in the presence of BsrBI; the two bars below
the x-axis show time-to-positive for real-time bulk experiments,
the widths of which stand for standard deviation for the bulk assay
(n=5) (left arrow for absence of restriction enzyme, right arrow
for presence of restriction enzyme).
The same competition experiments were performed in a bulk real-time
format using an RNA concentration of .about.3.3.times.105 copies/mL
(estimated based on digital RT-LAMP results), equivalent to the
concentration of a single molecule in a 3 nL well. Without BsrBI,
the reaction in this bulk experiment was approximately 5 min faster
than the mean amplification time in the corresponding digital
experiment (FIG. 25A); it was closer to the time of the
amplification of the first molecule (approximately 2 min slower)
(FIG. 25C). Upon addition of BsrBI, the bulk reaction showed
increased variance and slowed down by .DELTA.tb=4.9.+-.1.9 min
(FIG. 25C); this delay was similar to the delay of the
time-to-positive of the first molecule in the digital format,
.DELTA.td=4.2.+-.1.1 min (FIG. 25C). These data suggest that once
exponential amplification of some molecules takes off, this process
dominates the reaction mixture and is not affected by the
amplification of the molecules that amplify later in the digital
format--the bulk reaction has ended by then. In other words, the
bulk experiment is dominated by the rate of amplification of the
earliest molecules, and not sensitive to the fate of the rest of
the molecules. FIG. 27A shows real-time RT-LAMP curves for GT1 in
the absence of restriction enzyme (positive control); FIG. 27B
shows real-time RT-LAMP curves for GT1 in the presence of
BsrBI.
Based on consensus obtained by aligning sequences of each genotype
obtained from Los Alamos National Laboratory (LANL), three
restriction enzymes thermostable under RT-LAMP conditions were
chosen to target the sequence differences between these four
genotypes within the RT-LAMP amplicon. NheI-HF (targeting GCTAGC)
should recognize genotypes 1, 2, and 4; BsrBI (targeting CCGCTC)
should recognize genotypes 1, 3, and 4; and BstNI (targeting CCWGG)
should recognize only GT1. These predictions are illustrated
schematically in FIG. 28A, where black boxes represent predicted
positive signal (amplification) and empty boxes represent predicted
negative signal (inhibition). In FIG. 28, the first column in both
sections represents the positive control in the absence of
restriction enzyme and the following three columns indicate
experiments with different restriction enzymes; each row represents
a genotype (GT) of HCV RNA. Under LAMP conditions, these three
enzymes remained active and sequence specific, as shown in FIG. 29A
with gel electrophoresis and represented schematically in FIG. 29B.
In FIG. 29A, lanes 1, 6, 11, 16 and 21 are 100 bp DNA ladders;
lanes 2-5 are positive control, NheI-HF digestion product, BsrBI
digestion product, and BstNI digestion product for genotype 1,
respectively; lanes 7-10 are positive control and 3 restriction
enzyme digestion products for genotype 2; lanes 12-15 are for
genotype 3; and lanes 17-20 for genotype 4. The specificity of
restriction enzyme to different genotypes are the same as predicted
in FIG. 28A: for genotype 1, all 3 restriction enzymes digested the
product; for genotype 2 only NheI-HF digested the product; for
genotype 3 only BsrBI digested the product, and for genotype 4 both
NheI-HF and BsrBI digested the product.
For each genotype, four digital experiments were performed: one
positive control without restriction enzymes, and three experiments
with one restriction enzyme each. The positive control also
provided a measurement of the viral load and validation for
performing digital experiments, with results shown in Table 15. The
experimental results (FIG. 28B) agreed with the inhibition pattern
predicted (FIG. 28A) Amplification of GT1 was inhibited by all
three restriction enzymes; amplification of GT2 was inhibited by
NheI-HF only; amplification of GT3 was inhibited by BsrBI; and
amplification of GT4 was inhibited by NheI-HF and BsrBI. The fate
of molecules for each combination was dependent somewhat on the
restriction enzyme being used, but in all cases the inhibition was
strong and statistically significant (FIG. 30B).
TABLE-US-00028 TABLE 15 Statistical analysis of digital counts
obtained in positive controls for RT-LAMP of different HCV
genotypes. Distribution of numbers of amplifiable RNA molecules in
wells calculated based on observed digital counts and Poisson
statistics. HCV RNA GT1 GT2 GT3 GT4 Average counts 190 96 130 129
Standard deviation 44 23 18 5 Poisson estimate of zero 1090 1184
1150 1151 amplifiable molecules per well Poisson estimate of one
175 92 123 122 amplifiable molecule per well Poisson estimate of
two 14 4 7 6 amplifiable molecules per well Poisson estimate of
three 1 0 0 0 amplifiable molecules per well Poisson estimate of
average 0.16 0.078 0.11 0.11 amplifiable molecules per well
The performance of this HCV genotyping approach in a real-time bulk
format (FIG. 30A) was then compared to that in a digital format
(FIG. 30B). Experimental repeats were performed on different days
to ensure these experiments were not merely technical replicates.
Both formats agreed with the prediction shown in FIG. 24A. In the
digital format (FIG. 30B), reactions with restriction enzymes
specific to the genotype showed counts reduced by at least 10 fold,
giving statistically significant results (p<0.022). In the bulk
format (FIG. 30A), reactions with restriction enzymes that are
specific to the genotype were all delayed by a certain amount of
time ranging from 2 min (.about.10% relative to time-to-positive of
positive control) to 20 min (.about.100% relative to
time-to-positive of positive control). Acceptable p-values were
obtained for three of the four genotypes (p=0.079 for GT2 and
p<0.032 for others). As the strength of inhibition by the
restriction enzyme increased, (e.g., NheI-HF in FIG. 30B), in
digital, lower counts and smaller p-values were observed.
Results from the SlipChip device were also imaged on a cell phone,
as shown in FIG. 31. Positive wells were clearly distinguished from
negative wells, indicating the compatibility of this assay with
cell phone imaging. The combinations of RNA genotypes and REs are
GT3 without restriction enzyme (FIG. 31A), GT3 with BsrBI (FIG.
31B); GT1 with BsrBI (FIG. 31C); and GT3 with BstNI (FIG. 31D).
Details for conducting experiments as described in Example 9 are as
follows: All solvents and salts purchased from commercial sources
were used as received unless otherwise stated. The Loopamp.RTM. RNA
amplification kit and the Loopamp.RTM. Fluorescent Detection
Reagent kit were purchased from SA Scientific (San Antonio, Tex.,
USA). The LoopAmp.RTM. RNA amplification kit contains 2.times.
Reaction Mix (RM) (40 mM Tris-HCl pH 8.8, 20 mM KCl, 16 mM MgSO4,
20 mM (NH4)2504, 0.2% Tween20, 1.6 M Betaine and dNTPs 2.8 mM
each), Enzyme Mix (EM) (mixture of Bst DNA polymerase and AMV
reverse transcriptase), and distilled water (DW). Loopamp.RTM.
Fluorescent Detection Reagent kit contains Fluorescent Detection
Reagent (FD) (including calcein). SsoFast EvaGreen Supermix
(2.times.) was purchased from Bio-Rad Laboratories (Hercules,
Calif.). Bovine serum albumin (BSA) was purchased from Roche
Diagnostics (Indianapolis, Ind.). All restriction enzymes were
purchased from New England Biolabs (Ipswich, Mass.). All primers
were ordered from Integrated DNA Technologies (Coralville, Iowa).
Mineral oil (DNase, RNase, and Protease free), tetradecane, and
DEPC-treated nuclease-free water were purchased from Fisher
Scientific (Hanover Park, Ill.). Dichlorodimethylsilane was
purchased from Sigma-Aldrich (St. Louis, Mo.). AcroMetrix.RTM.
HCV-s panel and AcroMetrix.RTM. HCV High Control and EXPRESS
One-Step SYBR GreenER Universal were purchased from Life
Technologies (Grand Island, N.Y.). Genotype 3 and genotype 4 HCV
viral isolates were purchased from SeraCare Life Sciences
(Gaithersburg, Md.). Nucleic acid extraction kit QIAamp Viral RNA
Mini kit was purchased from QIAGEN (Inc, Valencia, Calif., USA) PCR
Mastercycler and in situ adapter were purchased from Eppendorf
(Hamburg, Germany) Eco real-time PCR system was purchased from
Illumina, Inc. (San Diego, Calif.). Photomasks were designed in
AutoCAD 2013 and ordered from CAD/Art Services, Inc. (Bandon,
Oreg.). Soda-lime glass plates coated with layers of chromium and
photoresist were ordered from the Telic Company (Valencia, Calif.).
Sanger sequencing service was provided by Laragen, Inc. HCV
sequences were extracted from Los Alamos database and aligned with
Geneious software.
4 different HCV genotypes were assayed. Genotypes 1 and 2 were
purchased from Acrometrix Corporation (Benicia, Calif., USA) and
genotypes 3 and 4 from SeraCare Life Sciences (Milford, Mass.,
USA). Genotype and viral load information was provided by these
companies: viral load of 2.5.times.107 IU/mL for GT1,
1.1.times.106-3.4.times.106 IU/mL for GT2, 5.7.times.106 IU/mL for
GT3, and 4.97.times.106 IU/mL for GT4. The genotype information was
also provided by the companies and we confirmed the genotype by
sequencing and phylogenetic analysis. The presence of targeted
single-nucleotide polymorphisms or SNPs (restriction enzyme cutting
sites) was confirmed by manual inspection of the sequencing
chromatograms. RNA was extracted using the QIAamp Viral RNA Mini
Kit (QIAGEN Inc, Valencia, Calif., USA) according to the
manufacturer's instructions, using 200 .mu.L of plasma and eluting
the resulting nucleic acid extraction in 60 .mu.L of elution
buffer. Nucleic acid extractions were analyzed immediately or
stored at -80.degree. C. until further analysis. To amplify HCV
viral RNA, the RT-PCR mix contained the following: 20 .mu.L of
2.times. SsoFast Evagreen SuperMix, 1 .mu.L of EXPRESS SYBR GreenER
RT module, 1 .mu.L of each primer (10 .mu.M), 2 .mu.L of template,
and enough nuclease-free water to bring the volume to 40 .mu.L. The
reverse transcription was carried out at 50.degree. C. for 15 min,
followed by 2 min of reaction termination at 95.degree. C. The
amplification step was performed by 40 cycles of the following
conditions: 95.degree. C. for 15 seconds, 55.degree. C. for 1 min
and 72.degree. C. for 1 min. The dendogram was constructed by
alignment of the 222 nucleotide sequences within the 5'UTR region
of HCV based on the UPGMA method under the Tamura-Nei model
(bootstrap=1,000 replicates). Reference sequences from HCV strains
(genotypes 1 to 4) were obtained from the Los Alamos HCV database.
To amplify HCV viral RNA using RT-LAMP on a real-time PCR machine,
the RT-LAMP mix contained the following: 20 .mu.L of 2.times.
reaction mix (RM), 2 .mu.L of enzyme mix (EM), 1 .mu.L of
fluorescent detection reagent (FD), 4 .mu.L of primer mixture (20
.mu.M BIP/FIP, 10 .mu.M LB/LF, and 2.5 .mu.M B3/F3), various
amounts of RNA template solution (2.86 .mu.L GT1 RNA for FIG. 3, 2
.mu.L 10-fold diluted GT1 RNA and 2 .mu.L RNA for all the other
genotypes for FIGS. 4 and 5), and enough nuclease-free water to
bring the volume to 40 .mu.L. The solution was split into 10 .mu.L
each and loaded into 3 wells on the Eco real-time PCR plate and
heated at 63.degree. C. for 50 min. RT-LAMP reagents and FD were
used as purchased from SA Scientific and used as it was. To amplify
HCV viral RNA using RT-LAMP in the presence of RE on real-time PCR
machine, the RT-LAMP mix contained the following: 20 .mu.L of RM, 2
.mu.L of EM, 1 .mu.L of FD, 4 .mu.L of primer mixture (20 .mu.M
BIP/FIP, 10 .mu.M LB/LF, and 2.5 .mu.M B3/F3), various amounts of
RNA template solution (2.86 .mu.L GT1 RNA for FIG. 3, 2 .mu.L
10-fold diluted GT1 RNA and 2 .mu.L RNA for all the other genotypes
for FIGS. 4 and 5), 4 .mu.L 20-fold diluted RE (to make a 200-fold
dilution in the final solution) and enough nuclease-free water to
bring the volume to 40 .mu.L. RE was diluted in nuclease-free water
before immediately mixed with RT-LAMP reagents, and fresh dilution
was made each time. The solution was split into 10 .mu.L each and
loaded into 3 wells on the Eco real-time PCR plate and heated at
63.degree. C. for 50 min Bulk RT-LAMP/RE assays were carried out in
an Eco Real-Time PCR System (Illumina, SD, USA) and data analysis
was performed using Eco Real-Time PCR System Software (version
4.0). To determine the time-to-positive (time required for the
fluorescent signal to cross the threshold), fluorescence intensity
between 5 min and 15 min was used as the baseline and the threshold
value was set to be half height of the maximum intensity. For the
single-volume 1280-well SlipChip, all features were etched to a
depth of 55 .mu.m in soda lime glass to make the volume of loading
well equal to 3 nL. To amplify HCV viral RNA using RT-LAMP method
on real-time PCR machine, the RT-LAMP mix contained the following:
20 .mu.L of RM, 2 .mu.L of EM, 1 .mu.L of FD, 4 .mu.L of primer
mixture (20 .mu.M BIP/FIP, 10 .mu.M LB/LF, and 2.5 .mu.M B3/F3), 2
.mu.L of BSA (20 mg/mL), various amounts of RNA template solution
(2.86 .mu.L GT1 RNA for FIG. 3, 2 .mu.L 10-fold diluted GT1 RNA and
2 .mu.L RNA for all the other genotypes for FIGS. 4 and 5), 4 .mu.L
diluted RE if not for positive control, and enough nuclease-free
water to bring the volume to 40 .mu.L. The solution was loaded onto
SlipChip and heated at 63.degree. C. for 50 min on a custom-built
real-time instrument. RT-LAMP reagents and FD were used as
purchased from SA Scientific. BSA was used as purchased from Roche
Diagnostics. Experiments were performed on a Bio-Rad PTC-200
thermocycler with a custom machined block. The block contains a
flat 3''.times.3'' portion onto which the devices are placed
ensuring optimal thermal contact. The excitation light source used
was a Philips Luxeon S (LXS8-PW30) 1315 lumen LED module with a
Semrock filter (FF02-475). Image Acquisition was performed with a
VX-29MG camera and a Zeiss Macro Planar T F2-100 mm lens. A Semrock
filter (FF01-540) was used as an emission filter. Images acquired
were analyzed using self-developed Labview software. The data were
analyzed by first creating a binary mask that defined the location
of each reaction volume within the image. The masked spots were
then overlaid on the stack of images collected over the course of
the experiment and the average intensity of each individual masked
spot was tracked over the course of the stack. Background
subtraction of the real-time trace was performed by creating a
least mean square fit of each individual trace. Threshold was then
manually set at the half height of the averaged maximum intensity,
and the time-to-positive of each reaction was then determined as
the point at which the real-time curve crossed the defined
threshold. Cell phone imaging white balance was set to automatic,
the ISO was set at 800, the exposure value was set at +2, the focus
mode was set to "close-up", and the resolution was adjusted to 8
MP. To test the specificity and activity of RE at the condition for
RT-LAMP, we first prepared RT-LAMP product from HCV RNA of genotype
1, 2, 3, and 4, respectively. The amplification procedure was the
same as described in above except that an additional 5 min at
85.degree. C. was used to inactivate the polymerase. 2 .mu.L
RT-LAMP product was mixed with 4 .mu.L fresh RM, 3 .mu.L
nuclease-free water and 1 .mu.L RE (or water for non-RE control)
and incubated at 63.degree. C. for 30 min. The digestion product
was analyzed on 1.2% agarose DNA gel stained with ethidium bromide
at 75 Volt for 40 min. To determine the restriction enzyme
concentration which did not trigger ab initio synthesis within 50
min, three dilutions (100-fold, 200-fold and 300-fold dilution in
the final mixture) of each RE were added to RT-LAMP mix containing
the same components as in the genotyping assay with the exception
of HCV RNA template that was replaced with nuclease-free water. RE
was diluted in nuclease-free water before immediately mixed with
RT-LAMP reagents, and fresh dilution was made each time. The
solution was split into 10 .mu.L each and loaded into 3 wells on
the Eco real-time PCR plate and heated at 63.degree. C. for 96 min
High-complexity molecular tests such as commercially available HCV
genotyping assays are not well suited for limited-resource
settings: for example, hybridization assays (Roche LINEAR ARRAY
Hepatitis C Virus Genotyping Test, Siemens VERSANT HCV Genotype 2.0
assay (LiPA)) and hybridization followed by electrochemical readout
(GenMark eSensor) assays start with a PCR step, take from several
hours up to one day, and require strict control of conditions;
sequencing analysis is also slow and requires complex protocols and
instrumentation (TRUGENE HCV Genotype Test). Automated real-time
RT-PCR with Taqman probes (Abbott RealTime HCV Genotype II) is
faster (.about.5 hrs) but is still too complex and as a kinetic
measurement not sufficiently robust for limited-resource
settings.
Example 10--Modified NASBA with Oligonucleotide Modulator
To amplify HCV viral RNA using a usual NASBA protocol on a
real-time PCR machine without oligonucleotide modulator, the NASBA
mix contained the following: 6.7 .mu.L of 3.times. Reaction Buffer
(NECB), 3.3 .mu.L of the nucleotide mix (NECN), 1.2 .mu.L of primer
mixture (10 .mu.M P1, 10 .mu.M P2 and 10 .mu.M DNA molecular
beacon), various amounts of RNA template solution, and
nuclease-free water (to bring the volume to 15 .mu.L). This mixture
was gently mixed and microcentrifuged for a few seconds, then P1
was annealed by heating for 2 min at 65.degree. C. and cooling 10
min at 41.degree. C. (pre-incubation step) Immediately after the
annealing, 5 .mu.L of enzyme mixture (NEC) was added to this
mixture. The solution was loaded into two wells (9 .mu.L each) of
an Eco real-time PCR plate and incubated at 41.degree. C. for 90
min while monitoring the fluorescent signal in one-minute
intervals. NASBA reagents were purchased from Life Sciences
Advanced Technologies.
To amplify HCV viral RNA using a modified NASBA method on a
real-time PCR machine without oligonucleotide modulator, the NASBA
mix contained the following: 6.7 .mu.L of 3.times. Reaction Buffer
(NECB), 3.3 .mu.L of the nucleotide mix (NECN), 1.2 .mu.L of primer
mixture (10 .mu.M P1, 10 .mu.M P2 and 10 .mu.M RNA molecular
beacon), 0.6 .mu.L of Hybridase Thermostable Rnase H various amount
of RNA template solution, and enough nuclease-free water (to bring
the volume to 15 .mu.L). This mixture was gently mixed and
microcentrifuged for a few seconds, then P1 was annealed by heating
for 2 min at 65.degree. C. and cooling 10 min at 41.degree. C.
(pre-incubation step). Immediately after the annealing 5 .mu.L of
enzyme mixture (NEC) was added to this mixture. The solution was
loaded into two wells (9 .mu.L each) of an Eco real-time PCR plate
and heated at 41.degree. C. for 90 min while monitoring the
fluorescent signal in one-minute intervals. NASBA reagents were
purchased from Life Sciences Advances Technologies and Hybridase
Thermostable Rnase H was purchased from Epicentre.
To amplify HCV viral RNA using a modified NASBA method on a
real-time PCR machine with oligonucleotide modulator, the NASBA mix
contained the following: 6.7 .mu.L of 3.times. Reaction Buffer
(NECB), 3.3 .mu.L of the nucleotide mix (NECN), 1.2 .mu.L of primer
mixture (10 .mu.M P1, 10 .mu.M P2 and 10 .mu.M RNA molecular
beacon), 0.5 .mu.L of specific oligonucleotide modulator (10
.mu.M), 0.6 .mu.L of Hybridase Thermostable Rnase H various amount
of RNA template solution, and enough nuclease-free water (to bring
the volume to 15 .mu.L). The mixture was gently mixed and
microcentrifuged for a few seconds, then P1 was annealed by heating
for 2 min at 65.degree. C. and cooling 10 min at 41.degree. C.
(pre-incubation step) Immediately after the annealing 5 .mu.L of
enzyme mixture (NEC) was added to this mixture. The solution was
loaded into two wells (9 .mu.L each) of an Eco real-time PCR plate
and heated at 41.degree. C. for 90 min while monitoring the
fluorescent signal in one-minute intervals. NASBA reagents were
purchased from Life Sciences Advances Technologies and Hybridase
Thermostable Rnase H was purchased from Epicentre.
Table 16 shows a comparison between a regular NASBA reaction and
the modified NASBA reaction as discussed above. Table 17 shows
real-time NASBA results with and without specific antisense
oligonucleotide modulators targeting HCV RNA template. HCV Genotype
1 (GT1) without antisense oligonucleotide modulator showed a Cq of
26.54; HCV GT1 in the presence of specific GT1 oligonucleotide
showed a Cq of 56.20, more than 20 min delay; HCV GT1 in the
presence of specific GT2 oligonucleotide showed a Cq of 28.86, more
than 2 min delay. Cq values are equivalent to 1.2 min.
TABLE-US-00029 TABLE 16 Regular NASBA reaction compared to the
modified NASBA reaction. regular modified Reagent NASBA NASBA NASBA
Enzyme Cocktail 5.0 .mu.L 5.0 .mu.L 3X NASBA Reaction buffer 6.7
.mu.L 6.7 .mu.L 6X Nucleotide Mix 3.3 .mu.L 3.3 .mu.L RNase H (5
U/.mu.L) -- 0.6 .mu.L P1 (10 uM stock) 0.4 .mu.L 0.4 .mu.L P2 (10
uM stock) 0.4 .mu.L 0.4 .mu.L DNA molecular beacon (10 uM stock)
0.4 .mu.L -- RNA molecular beacon (10 uM stock) -- 0.4 .mu.L RNA
2.5 .mu.L 2.5 .mu.L nuclease-free water 1.3 .mu.L 0.7 .mu.L
TABLE-US-00030 TABLE 17 Specific inhibition with guide-RNAseH.
Sample Cq (SD) HCV GT1 + RNAse H 26.54 (0.40) HCV GT1 +
oligonucleotide modulator GT1 + RNase H 56.20 (16.12) HCV GT1 +
oligonucleotide modulator GT2 + RNase H 28.86 (1.10)
FIG. 32 shows a comparison of NASBA reactions with DNA and RNA
molecular beacon before and after addition of extra amount of RNase
H. FIG. 32A shows the performance of a NASBA reaction using a DNA
molecular beacon (dashed line) and RNA molecular beacon (solid
line) with standard concentration of RNase H, as provided from a
commercial company. FIG. 32B shows the performance of a NASBA
reaction using a DNA molecular beacon (dashed line) and RNA
molecular beacon (solid line) with increased concentration of RNase
H. All 9 .mu.L reactions contained approximately 1,000 genomic
copies of hepatitis C virus GT1. Each experimental condition
represents a mean from triplicate reactions. NASBA reactions with
RNA molecular beacon were faster than reactions with DNA molecular
beacon. In the presence of higher RNase H concentration and RNA
molecular beacon efficiency of the reaction was improved, plateau
was reached faster.
FIG. 33 shows results from a modified NASBA reaction. Modified
NASBA as described in Table 16 was performed while varying the
final concentration of RNA molecular beacon in the mixture.
Triplicate reactions showed that the measured time to positive
(FIG. 33A) was effected very slightly as the beacon concentration
increased from 0.1 .mu.M to 0.4 .mu.M. In contrast, the endpoint
fluorescent intensity of the molecular beacons (FIG. 33B) increased
from 0.39 to 0.9.
Example 11--Restriction Enzyme (ApoI) Enhanced RNA NASBA
FIG. 34 shows results from experiments on the effect of
preincubation on the time to positive of restriction enzyme (ApoI)
enhanced RNA NASBA compared to regular NASBA. NASBA reagents were
purchased from Life Sciences Advances Technologies. Restriction
Enzyme ApoI was purchased from New England Biolabs, and experiments
were conducted under the following conditions:
Pre-incubation+ApoI (FIG. 34A, first from left): NASBA mix
containing the following: 6.7 .mu.L of 3.times. Reaction Buffer
(NECB), 3.3 .mu.L of the nucleotide mix (NECN), 1.2 .mu.L of primer
mixture (10 .mu.M P1, 10 .mu.M P2 and 10 .mu.M DNA molecular
beacon), and 2 .mu.L HCV RNA GT1 (final volume of 14 .mu.L). The
mixture was gently mixed and microcentrifuged for a few seconds,
then P1 was annealed by heating for 2 min at 65.degree. C. and
cooling 10 min at 41.degree. C. (pre-incubation step) Immediately
after the annealing 5 .mu.L of enzyme mixture (NEC)+1 .mu.L of ApoI
(5-fold diluted in water from original stock) were added to this
mixture. The solution was loaded into two wells (9 .mu.L each) of
an Eco real-time PCR plate and heated at 41.degree. C. for 90 min
while monitoring the fluorescent signal in one-minute
intervals;
Pre-incubation (FIG. 34A, second from left): NASBA mix containing
the following: 6.7 .mu.L of 3.times. Reaction Buffer (NECB), 3.3
.mu.L of the nucleotide mix (NECN), 1.2 .mu.L of primer mixture (10
.mu.M P1, 10 .mu.M P2 and 10 .mu.M DNA molecular beacon), and 2
.mu.L HCV RNA GT1 (final volume of 14 .mu.L). The mixture was
gently mixed and microcentrifuge for a few seconds, then P1 was
annealed by heating for 2 min at 65.degree. C. and cooling 10 min
at 41.degree. C. (pre-incubation step) Immediately after the
annealing 5 .mu.L of enzyme mixture (NEC)+1 .mu.L of distilled
water were added to this mixture. The solution was loaded into two
wells (9 .mu.L each) of an Eco real-time PCR plate and heated at
41.degree. C. for 90 min while monitoring the fluorescent signal in
one-minute intervals;
Ice+ApoI (FIG. 34A, third from left): NASBA mix containing the
following: 6.7 .mu.L of 3.times. Reaction Buffer (NECB), 3.3 .mu.L
of the nucleotide mix (NECN), 1.2 .mu.L of primer mixture (10 .mu.M
P1, 10 .mu.M P2 and 10 .mu.M DNA molecular beacon), and 2 .mu.L HCV
RNA GT1 (final volume of 14 .mu.L). The mixture was gently mixed
and microcentrifuge for a few seconds and kept on ice for 12 min,
time equivalent to pre-incubation Immediately after the annealing 5
.mu.L of enzyme mixture (NEC)+1 .mu.L of ApoI (5-fold diluted in
water from original stock) were added to this mixture. The solution
was loaded into two wells (9 .mu.L each) of an Eco real-time PCR
plate and heated at 41.degree. C. for 90 min while monitoring the
fluorescent signal in one-minute intervals;
Ice (FIG. 34A, fourth from left): NASBA mix containing the
following: 6.7 .mu.L of 3.times. Reaction Buffer (NECB), 3.3 .mu.L
of the nucleotide mix (NECN), 1.2 .mu.L of primer mixture (10 .mu.M
P1, 10 .mu.M P2 and 10 .mu.M DNA molecular beacon), and 2 .mu.L HCV
RNA GT1 (final volume of 14 .mu.L). The mixture was gently mixed
and microcentrifuge for a few seconds and kept on ice for 12 min,
time equivalent to pre-incubation Immediately after the annealing 5
.mu.L of enzyme mixture (NEC)+1 .mu.L of distilled water were added
to this mixture. The solution was loaded into two wells (9 .mu.L
each) of an Eco real-time PCR plate and heated at 41.degree. C. for
90 min while monitoring the fluorescent signal in one-minute
intervals.
The time to positive was reduced by the same degree via the
addition of ApoI and the inclusion of a pre-incubation step;
including both further reduced the time to positive (FIG. 34A).
FIG. 34B shows the effect of pre-incubation on the RNA product of
restriction enzyme (ApoI) enhanced RNA NASBA reaction compared to
regular NASBA as visualized by gel electrophoresis. When the
reaction is performed without pre-incubation, nonspecific products
dominate the visible reaction product. Including a pre-incubation
step reduces this product to a single predominant band. In a
similar manner, the addition of ApoI prevents the accumulation of
nonspecific product, to a greater degree. Each experimental
condition was run in duplicate.
While preferred embodiments of the present invention have been
shown and described herein, it will be obvious to those skilled in
the art that such embodiments are provided by way of example only.
Numerous variations, changes, and substitutions will now occur to
those skilled in the art without departing from the invention. It
should be understood that various alternatives to the embodiments
of the invention described herein may be employed in practicing the
invention. It is intended that the following claims define the
scope of the invention and that methods and structures within the
scope of these claims and their equivalents be covered thereby.
SEQUENCE LISTINGS
1
101146DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1aattctaata cgactcacta tagggcaagc accctatcag
gcagta 46220DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 2gtctagccat ggcgttagta 20337DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe5' FAM3'
BHQ1 3cgatcgagcc atagtggtct gcggaaccgg tcgatcg 37420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
4aatctccagg cagtgtcgcc 20520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 5gaccggacat agagtaaatt
20660DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 6cggggcactc gcaagcaccc tatcaggcag
taccacaagg cctttcgcga cccaactgat 60760DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 7cggggcactc gcaagcactc taccagacag tgccacaagg
cctttcgcga cccaactgat 60841DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 8taatacgact cactataggg
caagcaccct atcaggcagt a 41947DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 9taattctaat acgactcact
atagggcaag caccctatca ggcagta 471032DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe5' FAM3'
BHQ1 10cgtacggtct gcggaaccgg tgagtacgta cg 321120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
11acggaggcta tgaccyggta 201218DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 12cttcacggag gctatgac
181351DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 13aattctaata cgactcacta tagggagaag gatgttgcct
agccaggart t 511450DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primermodified_base(34)..(34)Inosine
14aattctaata cgactcacta tagggagaag gatnatgttg cctagccagg
501539DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe5' FAM3' BHQ1 15cctgcaccag aatacgactt ggagctcata
acgtgcagg 391639DNAArtificial SequenceDescription of Artificial
Sequence Synthetic probe5' FAMmodified_base(18)..(18)Inosine3' BHQ1
16cctgcactaa catcatgntc ctccaaygtg tcgtgcagg 391719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
17aggacgtyaa gttcccggg 191819DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 18gatcgttggt ggagtttac
191921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 19tcctaaacct caaagaaaaa c 212050DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
20aattctaata cgactcacta tagggagaag ggccaaggrt acccgggctg
502150DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 21aattctaata cgactcacta tagggagaag gtcrttgcca
tagaggggcc 502250DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 22aattctaata cgactcacta tagggagaag
gggagccatc cygcccaccc 502335DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe5' FAM3' BHQ1 23cctgcaaaga
cttccgagcg gtcrcaacct gcagg 352435DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe5' FAM3' BHQ1 24cctgcaagga
agacttccga gcggtcrcat gcagg 352538DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe5' FAM3' BHQ1 25cctgcaaaga
cttccgagcg gtcrcaacct cgtgcagg 382636DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe5' FAM3'
BHQ1 26cctgcagggt gtgcgcgcga cgaggaagac tgcagg 362748DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
27aattctaata cgactcacta tagggaaatc tacggatagc aagttrgc
482820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 28ccaaaggcag aagaaagtca 202932DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe5' FAM3'
BHQ1 29cgcgatggag gttaargcrg cggcgtatcg cg 323048DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
30aattctaata cgactcacta tagggaaact ccaagtcgta ttctggtt
483121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 31cgaccttgtc gttatctgtg a 213234DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe5' FAM3'
BHQ1 32cgcgatttca cggaggctat gactaggtat cgcg 343345DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
33aattctaata cgactcacta tagggaaatg aatgatctga ggtag
453418DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 34ttcttctcca tcctymta 183535DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe5' FAM3'
BHQ1 35cgcgataarg ccctrgaytg ycagatctaa tcgcg 353649DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
primermodified_base(42)..(42)a, c, g, t, unknown or other
36aattctaata cgactcacta tagggaaaca caacattggt anattgact
493721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 37ggtgaahrcc tggaaakcra a 213836DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe5' FAM3'
BHQ1 38cgcgatcacr gtcacygaga rygayatccg atcgcg 363936DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe5' FAM3'
BHQ1 39cgcgatcgac acccgytgyt tygactcaag atcgcg 364046DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
40aattctaata cgactcacta tagggaaaaa gtggytcaat ggagta
464119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 41caaggatgat yctgatgac 194235DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe5'
FAMmodified_base(17)..(17)a, c, g, t, unknown or other3' BHQ1
42cgcgatccct yctagcncag garcaactga tcgcg 354346DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
43aattctaata cgactcacta tagggaaagc tagaaggatg gagaar
464418DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 44garacagcta gacacact 184531DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe5' FAM3'
BHQ1 45gcgatcggct aggcaacatc atcatgatcg c 314619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
46cctcccggga gagccatag 194743DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 47tccaagaaag gacccggtct
ttttctgcgg aaccggtgag tac 434817DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 48gtcctggcaa ttccggt
174943DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primermodified_base(16)..(16)Inosine 49tccaagaaag
gacccngtct ttttctgcgg aaccggtgag tac 435017DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
primermodified_base(3)..(3)Inosinemodified_base(8)..(8)Inosine
50ttnccggnaa ttccggt 175120DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 51gcactcgcaa gcaccctatc
205249DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 52ttgggcgtgc ccccgcaagt ttttcagtac cacaaggcct
ttcgcgacc 495320DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 53ctgctagccg agtagtgttg
205420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primermodified_base(16)..(16)Inosine 54gcactcgcaa
gcaccntatc 205550DNAArtificial SequenceDescription of Artificial
Sequence Synthetic
primermodified_base(17)..(17)Inosinemodified_base(41)..(41)Inosinemodifie-
d_base(47)..(47)Inosine 55ttgggcgtgc ccccgcnaga tttttcagta
ccacaaggcc nttcgcnacc 505620DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(16)..(16)Inosine
56ctgctagccg agtagngttg 205743DNAArtificial SequenceDescription of
Artificial Sequence Synthetic
primermodified_base(12)..(12)Inosinemodified_base(16)..(16)Inosine
57tccaagaaag gncccngtct ttttctgcgg aaccggtgag tac
435843DNAArtificial SequenceDescription of Artificial Sequence
Synthetic
primermodified_base(12)..(12)Inosinemodified_base(16)..(16)Inosine
58cccaagaaag gncccngtct ttttctgcgg aaccggtgag tac
435945DNAArtificial SequenceDescription of Artificial Sequence
Synthetic
primermodified_base(14)..(14)Inosinemodified_base(18)..(18)Inosine
59tccaatggaa aggncccngt ctttttctgc ggaaccggtg agtac
456043DNAArtificial SequenceDescription of Artificial Sequence
Synthetic
primermodified_base(12)..(12)Inosinemodified_base(16)..(16)Inosine
60tccaagaaag gncccngtct ttttctgcgg aaccggtgag ttc
436143DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primermodified_base(5)..(5)Inosine 61tccangaaag
gacccggtct ttttctgcgg aaccggtgag tac 436217DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
primermodified_base(5)..(5)a, c, g, t, unknown or other
62accgnaattg ccaggac 176317DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(13)..(13)Inosine
63gtcctggcaa ttncggt 176417DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primermodified_base(10)..(10)a, c, g,
t, unknown or othermodified_base(15)..(15)a, c, g, t, unknown or
other 64accggaattn ccggnaa 176517DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primermodified_base(9)..(9)a, c,
g, t, unknown or othermodified_base(12)..(12)a, c, g, t, unknown or
othermodified_base(16)..(17)a, c, g, t, unknown or other
65accggaatng cngggnn 176617DNAArtificial SequenceDescription of
Artificial Sequence Synthetic
primermodified_base(1)..(2)Inosinemodified_base(6)..(6)Inosinemodifie-
d_base(9)..(9)Inosine 66nncccngcna ttccggt 176717DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
primermodified_base(9)..(9)a, c, g, t, unknown or
othermodified_base(12)..(12)a, c, g, t, unknown or other
67accggaatng cnggggt 176817DNAArtificial SequenceDescription of
Artificial Sequence Synthetic
primermodified_base(2)..(2)Inosinemodified_base(6)..(6)Inosinemodifie-
d_base(9)..(9)Inosine 68ancccngcna ttccggt 176948DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
69ttgggcgtgc ccccgcaagt tttcagtacc acaaggcctt tcgcgacc
487025DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 70cagtaccaca aggcctttcg cgacc 257119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
71ttgggcgtgc ccccgcaag 197220DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 72ctgctagccg agtagtgttg
207319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 73ctgcggaacc ggtgagtac 197419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
74tccaagaaag gacccggtc 197517DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 75tcgtcctggc aattccg
1776222DNAHepatitis c virus 76tcgtgcagcc tccaggaccc cccctctcgg
gagagccata gtggtctgcg gaaccggtga 60gtacaccgga attgccagga cgaccgggtc
ctttcttgga tcaacccgct caatgcctgg 120agatttgggc gtgcccccgc
gagactgcta gccgagtagt gttgggtcgc gaaaggcctt 180gtggtactgc
ctgatagggt gcttgcgagt gcctcgggag gt 22277222DNAHepatitis c virus
77tcgtacagcc tccaggcccc cccctcccgg gagagccata gtggtctgcg gaaccggtga
60gtacaccgga attgccggga agactgggtc ctttcttgga taaacccact ctatgcccgg
120ccatttgggc gtgcccccgc aagactgcta gccgagtagc gttgggttgc
gaaaggcctt 180gtggtactgc ctgatagggt gcttgcgagt gccccgggag gt
22278222DNAHepatitis c virus 78tcgtgcagcc tccaggatcc cccctcccgg
gagagccata gtggtctgcg gaaccggtga 60gtacaccgga atcgctgggg tgaccgggtc
ctttcttgga gcaacccgct caatacccag 120aaatttgggc gtgcccccgc
gagatcacta gccgagtagt gttgggtcgc gaaaggcctt 180gtggtactgc
ctgatagggt gcttgcgagt gccccgggag gt 22279222DNAHepatitis c virus
79ttgtacagcc tccaggaccc cccctcccgg gagagccata gtggtctgcg gaaccggtga
60gtacaccgga atcgccggga tgaccgggtc ctttcttgga taaacccgct caatgcccgg
120aaatttgggc gtgcccccgc aagactgcta gccgagtagt gttgggtcgc
gaaaggcctt 180gtggtactgc ctgatagggt gcttgcgagt gccccgggag gt
22280190DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 80cctcccggga gagccatagt ggtctgcgga
accggtgagt acaccggaat tgccgggayg 60accgggtcct ttcttggatm aacccgctca
atgcccggar atttgggcgt gcccccgcaa 120gactgctagc cgagtagtgt
tgggtcgcga aaggccttgt ggtactgcct gatagggtgc 180ttgcgagtgc
19081190DNAHepatitis c virus 81cctcccggga gagccatagt ggtctgcgga
accggtgagt acaccggaat tgccaggacg 60accgggtcct ttcgtggata aacccgctca
atgcctggag atttgggcgt gcccccgcaa 120gactgctagc cgagtagtgt
tgggtcgcga aaggccttgt ggtactgcct gatagggtgc 180ttgcgagtgc
19082190DNAHepatitis c virus 82cctcccggga gagccatagt ggtctgcgga
accggtgagt acaccggaat tgccaggacg 60accgggtcct ttcttggatc aacccgctca
atgcctggag atttgggcgt gcccccgcga 120gactgctagc cgagtagtgt
tgggtcgcga aaggccttgt ggtactgcct gatagggtgc 180ttgcgagtgc
19083190DNAHepatitis c virus 83cctcccggga aagccatagt ggtctgcgga
accggtgagt acaccggaat taccggaaag 60actgggtcct ttcttggata aacccactct
atgtccggtc atttgggcgt gcccccgcaa 120gactgctagc ctagtagcgt
tgggttgcga acggccttgt ggtactgcct gatagggtgc 180ttgcgagtgc
19084190DNAHepatitis c virus 84cctcccggga gagccatagt ggtctgcgga
accggtgagt acaccggaat cgctggggtg 60accgggtcct ttcttggagc aacccgctca
atacccagaa atttgggcgt gcccccgcga 120gatcactagc cgagtagtgt
tgggtcgcga aaggccttgt ggtactgcct gatagggtgc 180ttgcgagtgc
19085190DNAHepatitis c virus 85cctcccggga gagccatagt ggtctgcgga
accggtgagt acaccggaat cgccgggatg 60accgggtcct ttcttggatt aacccgctca
atgcccggaa atttgggcgt gcccccgcaa 120gactgctagc cgagtagtgt
tgggtcgcga aaggccttgt ggtactgcct gatagggtgc 180ttgcgagtgc
19086200DNAHepatitis c virus 86atgagcacga atcctaaacc tcaaagaaaa
accaaacgta acaccaaccg tcgcccacag 60gacgtcaagt tcccgggtgg cggtcagatc
gttggtggag tttacttgtt gccgcgcagg 120ggccctagat tgggtgtgcg
cgcgacgagg aagacttccg agcggtcgca acctcgaggt 180agacgtcagc
ctatccccaa 20087200DNAHepatitis c virus 87atgagcacga atcctaaacc
tcaaagaaaa accaaacgta acaccaaccg ccgcccacag 60gacgtcaagt tcccgggcgg
tggtcagatc gttggtggag tttacctgtt gccgcgcagg 120ggccccaggt
tgggtgtgcg cgcgactagg aagacttccg agcggtcgca acctcgtgga
180aggcgacaac ctatccccaa 20088231DNAHepatitis c virus 88gtctagccat
ggcgttagta tgagtgtcgt gcagcctcca ggaccccccc tcccgggaga 60gccatagtgg
tctgcggaac cggtgagtac accggaattg ccaggacgac cgggtccttt
120cttggataaa cccgctcaat gcctggagat ttgggcgtgc ccccgcaaga
ctgctagccg 180agtagtgttg ggtcgcgaaa ggccttgtgg tactgcctga
tagggtgctt g 23189231DNAHepatitis c virus
89gtctagccat ggcgttagta tgagtgtcgt gcagcctcca ggaccccccc tcccgggaga
60gccatagtgg tctgcggaac cggtgagtac accggaattg ccaggacgac cgggtccttt
120cttggatcaa cccgctcaat gcctggagat ttgggcgtgc ccccgcgaga
ctgctagccg 180agtagtgttg ggtcgcgaaa ggccttgtgg tactgcctga
tagggtgctt g 23190231DNAHepatitis c virus 90gtctagccat ggcgttagta
tgagtgtcgt acagcctcca ggcccccccc tcccgggaga 60gccatagtgg tctgcggaac
cggtgagtac accggaattg ccgggaagac tgggtccttt 120cttggataaa
cccactctat gcccggccat ttgggcgtgc ccccgcaaga ctgctagccg
180agtagcgttg ggttgcgaaa ggccttgtgg tactgcctga tagggtgctt g
23191231DNAHepatitis c virus 91gtctagccat ggcgttagta tgagtgtcgt
acagcctcca ggcccccccc tcccgggaga 60gccatagtgg tctgcggaac cggtgagtac
accggaatta ccggaaagac tgggtccttt 120cttggataaa cccactctat
gtccggtcat ttgggcgtgc ccccgcaaga ctgctagccg 180agtagcgttg
ggttgcgaaa ggccttgtgg tactgcctga tagggtgctt g 23192231DNAHepatitis
c virus 92gcctagccat ggcgttagta cgagtgtcgt gcagcctcca ggaccccccc
tcccgggaga 60gccatagtgg tctgcggaac cggtgagtac accggaatcg ctggggtgac
cgggtccttt 120cttggaacaa cccgctcaat acccagaaat ttgggcgtgc
ccccgcgaga tcactagccg 180agtagtgttg ggtcgcgaaa ggccttgtgg
tactgcctga tagggtgctt g 23193232DNAHepatitis c virus 93gtctagccat
ggcgttagta tgagtgttgt acagcctcca ggaccccccc tcccgggaga 60gccatagtgg
tctgcggaac cggtgagtac accggaatcg ccaggacgac cgggtccttt
120cttggattaa acccgctcaa tgcctggaaa tttgggcgtg cccccgcaag
actgctagcc 180gagtagtgtt gggttgcgaa aggccttgtg gtactgcctg
atagggtgct tg 2329495DNAHepatitis c virus 94tttgggcgtg cccccgcaag
actgctagcc gagtagtgtt gggtcgcgaa aggccttgtg 60gtactgcctg atagggtgct
tgcttgcgag tgccc 959595DNAHepatitis c virus 95gggcactcgc aagcaagcac
cctatcaggc agtaccacaa ggcctttcgc gacccaacac 60tactcggcta gcagtcttgc
gggggcacgc ccaaa 959611PRTHepatitis c virus 96Phe Gly Arg Ala Pro
Ala Arg Leu Leu Ala Glu1 5 109719PRTHepatitis c virus 97Cys Trp Val
Ala Lys Gly Leu Val Val Leu Pro Asp Arg Val Leu Ala1 5 10 15Ser Ala
Pro98104DNAHepatitis c virus 98gcagcctcca ggaccccccc tcccgggaga
gccatagtgg tctgcggaac cggtgagtac 60accggaattg ccaggacgac cgggtccttt
cttggataaa cccg 10499104DNAHepatitis c virus 99cgggtttatc
caagaaagga cccggtcgtc ctggcaattc cggtgtactc accggttccg 60cagaccacta
tggctctccc gggagggggg gtcctggagg ctgc 10410017PRTHepatitis c virus
100Ser Leu Gln Asp Pro Pro Ser Arg Glu Ser His Ser Gly Leu Arg Asn1
5 10 15Arg10116PRTHepatitis c virus 101Val His Arg Asn Cys Gln Asp
Asp Arg Val Leu Ser Trp Ile Asn Pro1 5 10 15
* * * * *
References