U.S. patent number 11,168,364 [Application Number 16/570,873] was granted by the patent office on 2021-11-09 for method and system for sequencing nucleic acids.
This patent grant is currently assigned to OMNIOME, INC.. The grantee listed for this patent is OMNIOME, INC.. Invention is credited to Mark A. Bernard, Corey M. Dambacher, Joseph Rokicki, Eugene Tu, Kandaswamy Vijayan, Kerry Wilson.
United States Patent |
11,168,364 |
Vijayan , et al. |
November 9, 2021 |
Method and system for sequencing nucleic acids
Abstract
Provided are compositions, methods and systems for determining
the sequence of a template nucleic acid using a polymerase-based,
sequencing-by-binding procedure. An examination step involves
monitoring the interaction between a polymerase and template
nucleic acid in the presence of one or more nucleotides. Identity
of the next correct nucleotide in the sequence is determined
without incorporation of any nucleotide into the structure of the
primer by formation of a phosphodiester bond. An optional
incorporation step can be used after the examination step to extend
the primer by one or more nucleotides, thereby incrementing the
template nucleotides that can be examined in a subsequent
examination step. The sequencing-by-binding procedure does not
require the use of labeled nucleotides or polymerases, but
optionally can employ these reagents.
Inventors: |
Vijayan; Kandaswamy (San Diego,
CA), Dambacher; Corey M. (San Diego, CA), Tu; Eugene
(San Diego, CA), Bernard; Mark A. (San Diego, CA),
Rokicki; Joseph (San Diego, CA), Wilson; Kerry (San
Diego, CA) |
Applicant: |
Name |
City |
State |
Country |
Type |
OMNIOME, INC. |
San Diego |
CA |
US |
|
|
Assignee: |
OMNIOME, INC. (San Diego,
CA)
|
Family
ID: |
59772700 |
Appl.
No.: |
16/570,873 |
Filed: |
September 13, 2019 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20200002762 A1 |
Jan 2, 2020 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
15677870 |
Aug 15, 2017 |
10443098 |
|
|
|
62447319 |
Jan 17, 2017 |
|
|
|
|
62375379 |
Aug 15, 2016 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q
1/6869 (20130101); C12N 15/1068 (20130101); C12P
19/34 (20130101); C12Q 1/6874 (20130101); G01N
33/50 (20130101); C12Q 1/6874 (20130101); C12Q
2521/101 (20130101); C12Q 2565/518 (20130101); C12Q
1/6869 (20130101); C12Q 2521/101 (20130101); C12Q
2565/518 (20130101); C12Q 1/6869 (20130101); C12Q
2521/101 (20130101); C12Q 2565/133 (20130101); C12Q
2565/518 (20130101); C12Q 1/6874 (20130101); C12Q
2521/101 (20130101); C12Q 2565/133 (20130101); C12Q
2565/518 (20130101); C12Q 2521/101 (20130101) |
Current International
Class: |
C12Q
1/6869 (20180101); C12Q 1/6874 (20180101); C12N
15/10 (20060101); C12P 19/34 (20060101); G01N
33/50 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
102634586 |
|
Aug 2012 |
|
CN |
|
1115848 |
|
Jul 2001 |
|
EP |
|
2008/502369 |
|
Jan 2008 |
|
JP |
|
WO-90/013666 |
|
Nov 1990 |
|
WO |
|
WO-91/06678 |
|
May 1991 |
|
WO |
|
WO-01/016375 |
|
Mar 2001 |
|
WO |
|
WO-01/016375 |
|
Mar 2001 |
|
WO |
|
WO-02/04680 |
|
Jan 2002 |
|
WO |
|
WO-02/04680 |
|
Jan 2002 |
|
WO |
|
WO-2005/019476 |
|
Mar 2005 |
|
WO |
|
WO-2005/065814 |
|
Jul 2005 |
|
WO |
|
WO-2005/121363 |
|
Dec 2005 |
|
WO |
|
WO-2005/121363 |
|
Dec 2005 |
|
WO |
|
WO-2005/123957 |
|
Dec 2005 |
|
WO |
|
WO-2005/123957 |
|
Dec 2005 |
|
WO |
|
WO-2007/091077 |
|
Aug 2007 |
|
WO |
|
WO-2007/123744 |
|
Nov 2007 |
|
WO |
|
WO-2007/123744 |
|
Nov 2007 |
|
WO |
|
WO-2009/145820 |
|
Dec 2009 |
|
WO |
|
WO-2009/145820 |
|
Dec 2009 |
|
WO |
|
WO-2009/145828 |
|
Dec 2009 |
|
WO |
|
WO-2009/145828 |
|
Dec 2009 |
|
WO |
|
WO-2010/068884 |
|
Jun 2010 |
|
WO |
|
WO-2010/068884 |
|
Jun 2010 |
|
WO |
|
WO-2010/111690 |
|
Sep 2010 |
|
WO |
|
WO-2010/111690 |
|
Sep 2010 |
|
WO |
|
WO-2010/141390 |
|
Dec 2010 |
|
WO |
|
WO-2010/141390 |
|
Dec 2010 |
|
WO |
|
WO-2011/159942 |
|
Dec 2011 |
|
WO |
|
WO-2012/166742 |
|
Dec 2012 |
|
WO |
|
WO-2012/166742 |
|
Dec 2012 |
|
WO |
|
WO-2013/096692 |
|
Jun 2013 |
|
WO |
|
WO-2013/159519 |
|
Oct 2013 |
|
WO |
|
WO-2014/114665 |
|
Jul 2014 |
|
WO |
|
WO-2014/142850 |
|
Sep 2014 |
|
WO |
|
WO-2017/014762 |
|
Jan 2017 |
|
WO |
|
WO-2017/184996 |
|
Oct 2017 |
|
WO |
|
WO-2017/190012 |
|
Nov 2017 |
|
WO |
|
WO-2017/190018 |
|
Nov 2017 |
|
WO |
|
WO-2018/035134 |
|
Feb 2018 |
|
WO |
|
Other References
Agnarsson, et al., "On-chip modulation of evanescent illumination
and live-cell imaging with polymer waveguides." Optics Express,
Nov. 7, 2011, vol. 19, No. 23: 22929-22935. cited by applicant
.
Anker, et al., "Biosensing with Plasmonic Nanosensors," Nature
Materials 7, No. 6 (Jun. 2008): 442-453. cited by applicant .
APCH231: Chemical Analysis Complexometric Titrations EDTA, notes
compiled by Dr. C. Southway, p. 30-42
(http://cheminnerweb.ukzn.ac.za/libraries/apch231_h_govenders_notes/apch2-
31_edta.sfib.ashx). cited by applicant .
Bandwar et al., "Peculiar 2-Aminopurine Fluorescence Monitors the
Dynamics of Open Complex Formation by Bacteriophage T7 RNA
Polymerase." The Journal of Biological Chemistry, vol. 275, No. 17,
Issue of 27: 14075-14082, 2001. cited by applicant .
Brockman, et al. "A Multistep Chemical Modification Procedure to
Create DNA Arrays on Gold Surfaces for the Study of Protein--DNA
Interactions with Surface Plasmon Resonance Imaging." Journal of
the American Chemical Society. Sep. 1999, 121: 8044-8051. cited by
applicant .
Brown, et al., "Pre-Steady-State Kinetic Analysis of Truncated and
Full-Length Saccharomyces cerevisiae DNA Polymerase Eta." Journal
of Nucleic Acids, 2010, Article ID 871939, 11 pages. cited by
applicant .
Campagnola, et al., "High-throughput Screening Identification of
Poliovirus RNA-dependent RNA Polymerase Inhibitors." Antiviral Res.
Sep. 2011; 91(3):241-251. cited by applicant .
Chan, et al., "A general method for discovering inhibitors of
protein-DNA interactions using photonic crystal biosensors." ACS
Chem Biol. Jul. 18, 2008; 3(7): 437-448. cited by applicant .
Chen, et al., "The History and Advances of Reversible Terminators
Used in New Generations of Sequencing Technology." Genomics
Proteomics Bioinformatics, 2013, 11(1): 34-40. cited by applicant
.
Chen, C.Y. (Jun. 24, 2014). "DNA polymerases drive DNA
sequencing-by-synthesis technologies: both past and present," Front
Microbiol 5:305. cited by applicant .
Chin, Y. E. et al., "The Effect of Divalent Nickel (Ni2+) on in
Vivo DNA Replication by DNA Polymerase a1," Cancer Research, May 1,
1994, vol. 54, pp. 2337-2341. cited by applicant .
Choi, et al., "EML4-ALK Mutations in Lung Cancer that Confer
Resistance to ALK Inhibitors." N. Engl. J. Med. (2010)18:1734-1739.
cited by applicant .
Concepcion, "Label-Free Detection of Biomolecular Interactions
Using BioLayer Interferometry for Kinetic Characterization."
Combinatorial Chemistry and High Throughput Screening. 2009,
12(8):791-800; abstract only. cited by applicant .
Crumpacker, "Mechanism of action of foscarnet against viral
polymerases." American Journal of Medicine, Feb. 14, 1992, vol. 92,
Issue 2, Supplement 1, pp. S3-S7, abstract only. cited by applicant
.
Datta, K. et al. (Feb. 21, 2003). "Salt dependence of DNA binding
by Thermus aquaticus and Escherichia coli DNA polymerases," J Biol
Chem 278(8):5694-5701. cited by applicant .
Deredge, D.J. et al. (Aug. 13, 2010, e-published Jun. 15, 2010).
"The glutamate effect on DNA binding by pol I DNA polymerases:
osmotic stress and the effective reversal of salt linkage," J Mol
Biol 401(2):223-238. cited by applicant .
Doublie, S. et al., "An open and closed case for all polymerases",
Structure, Feb. 1999, 7:R31-R35. cited by applicant .
Dunlap, C.A. et al. "Use of 2-Aminopurine and Tryptophan
Fluorescence as Probes in Kinetic Analyses of DNA Polymerase Beta."
Biochemistry, 2002, 41: 11226-11235. cited by applicant .
Dzantiev, L. et al. "A conformational change in E. coli DNA
polymerase I (Klenow fragment) is induced in the presence of a dNTP
complementary to the template base in the active site",
Biochemistry, 2000, 39(2):356-361. cited by applicant .
Engstrom, et al. (Oct. 15, 2006). "A label-free continuous
total-internal-reflection-fluorescence-based immunosensor."
Analytical Biochemistry 357(2):159-166. cited by applicant .
Eriksson, Oberg, Wahren, "Pyrophosphate analogues as inhibitors of
DNA polymerases of cytomegalovirus, herpes simplex virus and
cellular origin." Biochimica et Biophysica Acta (1982), 696(2):
115-123. cited by applicant .
Escobedo, et al., "Integrated nanohole array surface plasmon
resonance sensing device using a dual-wavelength source." Journal
of Micromechanics and Microengineering, vol. 21, No. 11, Oct. 3,
2011. cited by applicant .
Espinoza-Herrera, et al., "Following DNA Chain Extension and
Protein Conformational Changes in Crystals of a Y-Family DNA
Polymerase via Raman Crystallography." Biochemistry, Jul. 23, 2013,
52(29), abstract only. cited by applicant .
Fang, et al., "Genome-wide mapping of methylated adenine residues
in pathogenic Escherichia coli using single-molecule real-time
sequencing." Dec. 2012, vol. 30, No. 12, 1232-1243. cited by
applicant .
Favicchio et al., "Fluorescence Spectroscopy and Anisotrophy in the
analysis of DNA-Protein Interactions." Methods in Molecular
Biology, DNA-Protein Interactions, vol. 543, 2009, 589-611. cited
by applicant .
Federley, Richard George, "New insights into the mechanism of dna
replication on unmodified and benzo[a]pyrene modified templates
using surface plasmon resonance," Wayne State University
Dissertations, 2011, Paper 235, 208 pages. cited by applicant .
Fuller, et al., "The challenges of Sequencing by synthesis." Nature
Biotechnology, vol. 27, No. 11, Nov. 2009, pp. 1013-1023. cited by
applicant .
Horn, et al., "EML4-ALK: Honing in on a New Target in
Non-Small-Cell Lung Cancer." Journal of Clinical Oncology. Sep. 10,
2009. vol. 27, No. 26, p. 4232-4235. cited by applicant .
Hoshino, et al., "Effect of Ultrasound on DNA Polymerase Reactions:
Monitoring on a 27-MHz Quartz Crystal Microbalance."
Biomacromolecules, 2006, 7(3), pp. 682-685, abstract only. cited by
applicant .
Hutter, et al., "Labeled Nucleoside Triphosphates with Reversibly
Terminating Aminoalkoxyl Groups." vol. 29, Issue 11-12, 2010,
abstract only. cited by applicant .
International Search Report and Written Opinion dated Feb. 9, 2016,
issued in International Application No. PCT/ US2015/041415, 11
pages. cited by applicant .
International Search Report dated Jul. 28, 2017, for PCT
Application No. PCT/US2017/030143, filed Apr. 28, 2017, 3 pages.
cited by applicant .
International Search Report dated Nov. 7, 2017, for PCT Application
No. PCT/US2017/046976, filed Aug. 15, 2017, 6 pages. cited by
applicant .
International Search Report dated Jun. 19, 2018, for PCT
Application No. PCT/US2018/029420, filed Apr. 25, 2018, 6 pages.
cited by applicant .
Ion Torrent: "Ion Torrent Amplicon Sequencing", Internet Citation
[Online] Apr. 4, 2011 (Apr. 4, 2011), pp. 1-5, Retrieved from the
Internet: URL:
http://www.iontorrent.com/lib/images/PDFs/amplicon_application_note_04041-
1.pdf>. cited by applicant .
Jalali-Yazdi, F. et al. (Mar. 14, 2016, e-published Feb. 23, 2016).
"High-Throughput Measurement of Binding Kinetics by mRNA Display
and Next-Generation Sequencing," Angew Chem Int Ed Engl
55(12):4007-4010. cited by applicant .
Jindal, et al., "Suramin affects DNA Synthesis in HeLa Cells by
Inhibition of DNA Polymerases." Cancer Research, Dec. 15, 1990,
50:7754-7757. cited by applicant .
Jochmans, et al., "Indolopyridones Inhibit Human Immunodeficiency
Virus Reverse Transcriptase with a Novel Mechanism of Action."
Journal of Virology, Dec 2006, vol. 80, No. 24: 12283-12292. cited
by applicant .
Kaplan, "Photolabile chelators for the rapid photorelease of
divalent cations." Proc. Natl. Acad. Sci. USA, Sep. 1988, vol. 85:
6571-6575. cited by applicant .
Kaushik, et al., "Biochemical Analysis of Catalytically Crucial
Aspartate Mutants of Human Immunodeficiency Virus Type 1 Reverse
Transcriptase." Biochemistry, 1996, 35:11536-11546. cited by
applicant .
Kim, Dong-Sun, "An FET-type charge sensor for highly sensitive
detection of DNA sequence." Biosensors and Bioelectronics,
Microsensors and Microsystems 2003, 20, No. 1 (Jul. 30, 2004):
6974, abstract only. cited by applicant .
Klenow, H. et al. (May 1, 1969). "Effect of monovalent cations on
the activity of the DNA polymerase of Escherichia coli B," Eur J
Biochem 9(1):133-141. cited by applicant .
Kumar, et al., "Altered Order of Substrate Binding by DNA
Polymerase X from African Swine Fever Virus." Biochemistry 2008:
7875-7887. cited by applicant .
Leinbach, et al., "Mechanism of phosphonoacetate inhibition of
herpesvirus-induced DNA polymerase." Biochemistry, 1976, 15(2), pp.
426-430, abstract only. cited by applicant .
Lutz, et al. "An in vitro screening technique for DNA polymerases
that can incorporate modified nucleotides. Pseudothymidine as a
substrate for thermostable polymerases." Nucleic Acids Research,
1999, vol. 27, No. 13: 2792-2798. cited by applicant .
Maga, et al., "HIV-1 RT Inhibitors with a Novel Mechanism of
Action: NNRTIs that Compete with the Nucleotide Substrate." Viruses
2010, 2(4): 880-899. cited by applicant .
Maga, et al., "Selective Interaction of the Human Immunodeficiency
Virus Type 1 Reverse Transcriptase Nonnucleoside Inhibitor
Efavirenz and Its Thio-Substituted Analog with Different
Enzyme-Substrate Complexes." Antimicrobial Agents and Chemotherapy,
May 2000, vol. 44, No. 5: 1186-1194. cited by applicant .
Mano, H. "Non-solid oncogenes in solid tumors: EML4-ALK fusion
genes in lung cancer." (2008), Cancer Sci., 99:2349-2355. cited by
applicant .
Markiewicz, et al. "Single-Molecule Microscopy Reveals New Insights
into Nucleotide Selection by DNA Polymerase I." Nucleic Acids
Research, 2012, vol. 40, No. 16: 7975-7984. cited by applicant
.
Masheyekhi, et al., "Analysis of Read-Length Limiting Factors in
Pyrosequencing Chemistry." Anal Biochem. Apr. 15, 2007; 363(3):
275-287. cited by applicant .
Namasivayam, "Light-Induced Molecular Cutting: Localized Reaction
on a Single DNA Molecule." Anal. Chem. 2003, 75: 4118-4194. cited
by applicant .
Nath, N. et al. "Label free colorimetric biosensing using
nanoparticles." Jul. 2004; 14(4):377-89, abstract only. cited by
applicant .
Nazirizadeh, et al., "Low-cost label-free biosensors using photonic
crystals embedded between crossed polarizers." Optics Express, Aug.
30, 2010, vol. 18, No. 18, 19120-19128. cited by applicant .
Nikiforov, "Oligonucleotides labeled with single flurophores as
sensors for deoxynucleotide triphosphate binding by DNA
polymerases." Analytical Biochemistry 444 (2014): 60-66. cited by
applicant .
Patel, P.H. et al. "Insights into DNA Polymerization Mechanisms
from Structure and Function Analysis of HIV-1 Reverse
Transcriptase." 1995 Biochemistry 34:5351-5363, abstract only.
cited by applicant .
Peletskaya, et al. "Cross-Linking of the Fingers Subdomain of Human
Immunodeficiency Virus Type 1 Reverse Transcriptase to
Template-Primer." Journal of Virology, Oct. 2001, vol. 75, No. 19:
9435-9445. cited by applicant .
Pitta, et al., "Synthesis and HIV-1 RT inhibitory action of novel
(4/6-substituted benzo[d]thiazol-2-yl) thiazolidin-4-ones.
Divergence from the non-competitive inhibition mechanism." J.
Enzyme Inhib. Med. Chem. 28(10):113-122(2013), abstract only. cited
by applicant .
Potapova, I.A et al. (Dec. 1990). "NaF and mononucleotides as
inhibitors of 3'-5'-exonuclease activity and stimulators of
polymerase activity of E. coli DNA polymerase I Klenow fragment,"
FEBS Lett 277(1-2):109-111. cited by applicant .
Potapova, et al., "Interaction of dNTP, pyrophosphate and their
analogs with the dNTP-binding sites of E. coli DNA polymerase I
Klenow fragment and human DNA polymerase." Dec. 17, 1990, vol. 277,
Issues 1-2, pp. 194-196. cited by applicant .
Previte M.J. et al. (Jan. 23, 2015). "DNA sequencing using
polymerase substrate-binding kinetics," Nat Commun 6:5936. cited by
applicant .
Puttaswamy, "Optical Method for Measuring Spatial pH Change on
Conductive Microelectrodes." KTH, Royal Institute of Technology,
Stockholm, Sweden, 66 pages. cited by applicant .
Ren, et al., "Inhibition of Klenow DNA polymerase and
poly(A)-specific ribonuclease by aminoglycosides." RNA (2002),
8:1393-1400. cited by applicant .
Richard, A.J. et al. (Oct. 2006, e-published Aug. 30, 2006).
"Thermal stability landscape for Klenow DNA polymerase as a
function of pH and salt concentration," Biochim Biophys Acta
1764(10):1546-1552. cited by applicant .
Roettger, et al., Mismatched and Matched dNTP Incorporation by DNA
Polymerase p Proceed via Analogues Kinetic Pathways, Biochemistry,
2008, 47: 9718-9727. cited by applicant .
Santoso, Y. et al. (Jan. 12, 2010). "Conformational transitions in
DNA polymerase I revealed by single-molecule FRET," Proceedings of
the National Academy of Sciences, 107(2):715-720. cited by
applicant .
Schadt, et al., "Modeling Kinetic rate variation in third
generation DNA sequencing data to detect putative modifications to
DNA bases." Genome Research, 2013:129-141. cited by applicant .
Schultz, et al., "Single-target molecule detection with
nonbleaching multicolor optical immunolabels." PNAS, Feb. 1, 2000,
vol. 96, No. 3:996-1001. cited by applicant .
Sen, R. et al. "Intrinsic fluorescence of E. coli RNA polymerase as
a probe for its conformational changes during transcription
initiation." Biochem Biophys Res Commun. Jun. 15, 1994;
201(2):820-8. cited by applicant .
Soda, et al., "Identification of the transforming EML4-ALK fusion
gene in non-small-cell lung cancer." Aug. 2, 2007. vol.
448:561-566. cited by applicant .
Star, et al., "Electronic Detection of Specific Protein Binding
Using Nanotube FET Devices." Nano Letters 3, No. 4 (Apr. 1,
2003):459-463. cited by applicant .
Su, "Surface Plasmon Resonance Spectroscopy and Quartz Crystal
Microbalance Study of Streptavidin Film Structure effects on
Biotinylated DNA Assembly and Target DNA Hybridization." Langmuir,
2005, 21(1), pp. 348-353, abstract only. cited by applicant .
Tsai, Y. C. et al. (Jan. 1, 2009). "Site-specific labeling of T7
DNA polymerase with a conformationally sensitive fluorophore and
its use in detecting single-nucleotide polymorphisms" Analytical
Biochemistry, 384(1):136-144. cited by applicant .
Vaidyanathan, et al., "Binding kinetics of DNA-protein interaction
using surface plasmon resonance." Protocol Exchange, May 22, 2013,
11 pages. cited by applicant .
Vaidyanathan et al. "Binary and ternary binding affinities between
exonuclease-deficient Klenow fragment (Kf-exo(-)) and various
arylamine DNA lesions characterized by surface plasmon resonance."
Chem Res Toxicol. Aug. 20, 2012; 25(8): 1568-1570. cited by
applicant .
Vollmer, F. et al. "Whispering-gallery-mode biosensing: label-free
detection down to single molecules." Nature Methods, vol. 5, No. 7,
Jul. 2008:591-596. cited by applicant .
Walsh, et al., "Synthetic Nucleotides as Probes of DNA Polymerase
Specificity." Journal of Nucleic Acids, vol. 2012, Article ID
530963, 17 pages. cited by applicant .
Washington, et al., "Human DNA Polymerase Utilizes Different
Nucleotide Incorporation Mechanisms Dependent upon the Template
Base." Molecular and Cellular Biology, Jan. 2004, vol. 24, No. 2:
936-943. cited by applicant .
Written Opinion dated Jul. 28, 2017, for PCT Application No.
PCT/US2017/030143, filed Apr. 28, 2017, 5 pages. cited by applicant
.
Written Opinion dated Nov. 7, 2017, for PCT Application No.
PCT/US2017/046976, filed Aug. 15, 2017, 8 pages. cited by applicant
.
Written Opinion dated Jun. 19, 2018, for PCT Application No.
PCT/US2018/029420, filed Apr. 25, 2018, 9 pages. cited by applicant
.
Xia, S. et al., "DNA Mismatch Synthesis Complexes Provide Insights
into Base Selectivity of a B family DNA Polymerase." J Am Chem Soc.
Jan. 9, 2013; 135(1): 193-202. cited by applicant .
Yuzenkova, et al., "Tagetitoxin inhibits transcription by
stabilizing pre-translocated state of the elongation complex."
Nucleic Acids Research, 2013:1-9. cited by applicant.
|
Primary Examiner: Strzelecka; Teresa E
Attorney, Agent or Firm: Mintz, Levin, Cohn, Ferris, Glovsky
and Popeo, P.C.
Parent Case Text
RELATED APPLICATIONS
This application is a continuation of U.S. application Ser. No.
15/677,870, filed Aug. 15, 2017, now issued as U.S. Pat. No.
10,443,098, which claims the benefit of U.S. Provisional
Application No. 62/447,319, filed Jan. 17, 2017; and U.S.
Provisional Application No. 62/375,379, filed Aug. 15, 2016. The
disclosures of these earlier applications are hereby incorporated
by reference in their entireties.
REFERENCE TO A SEQUENCE LISTING, A TABLE OR A COMPUTER PROGRAM
LISTING APPENDIX SUBMITTED AS AN ASCII TEXT FILE
The Sequence Listing written in file 053195-502C02US SEQUENCE
LISTING ST25.txt, created on Jan. 21, 2021, 8,035 bytes, machine
format IBM-PC, MS Windows operating system, is hereby incorporated
by reference.
Claims
What is claimed is:
1. A method of determining the identity of the next correct
nucleotide for a primed template nucleic acid, the method
comprising: (a) contacting the primed template nucleic acid with a
plurality of nucleotide mixtures in serial fashion while precluding
incorporation of any nucleotide into the primer, wherein each of
the nucleotide mixtures comprises a combination of nucleotides that
is complementary to two, three or four different types of bases in
the template nucleic acid, thereby forming stabilized ternary
complexes that comprise the primed template nucleic acid molecule,
a polymerase and a next correct nucleotide from each of the
nucleotide mixtures; and (b) detecting the stabilized ternary
complexes while precluding incorporation of any nucleotide into the
primer, thereby determining the identity of the next correct
nucleotide for the primed template nucleic acid; wherein no
nucleotide is incorporated at the 3' end of the primer during or
between steps (a) and (b).
2. The method of claim 1, wherein the plurality of nucleotide
mixtures comprises a plurality of different nucleotide
mixtures.
3. The method of claim 2, wherein the plurality of different
nucleotide mixtures comprises four different nucleotide
mixtures.
4. The method of claim 2, wherein the plurality of different
nucleotide mixtures comprises six different nucleotide
mixtures.
5. The method of claim 1, wherein the determining in step (b)
comprises determining whether a nucleotide that is common to two of
the nucleotide mixtures is the next correct nucleotide for the
primed template nucleic acid.
6. The method of claim 1, wherein the ternary complex is stabilized
by the presence of a reversible terminator moiety on the 3'
terminal nucleotide of a primer of the primed template nucleic
acid.
7. The method of claim 6, further comprising, after step (b),
removing the reversible terminator moiety on the 3' terminal
nucleotide of the primer.
8. The method of claim 7, further comprising adding a reversible
terminator nucleotide to the primer after the removing of the
reversible terminator moiety on the 3' terminal nucleotide of the
primer.
9. The method of claim 1, wherein each of the nucleotide mixtures
comprises an unlabeled nucleotide.
10. The method of claim 1, wherein each of the nucleotide mixtures
comprises one or more nucleotides having an exogenous label.
11. The method of claim 10, wherein the exogenous label comprises a
fluorophore.
12. The method of claim 1, wherein the next correct nucleotide
comprises an exogenous label that is detected in step (b).
13. The method of claim 1, wherein the polymerase comprises an
exogenous label that is detected in step (b).
14. The method of claim 1, further comprising incorporating a
nucleotide at the 3' end of the primer after step (b).
15. The method of claim 14, wherein the nucleotide that is
incorporated lacks exogenous labels.
16. The method of claim 15, wherein the nucleotide that is
incorporated further comprises a reversible terminator.
17. The method of claim 1, wherein the primed template nucleic acid
is contacted with the polymerase before the primed template nucleic
acid is contacted with the nucleotide mixtures in step (a).
18. The method of claim 1, wherein the primed template nucleic acid
is attached to a solid support.
19. The method of claim 18, wherein the primed template nucleic
acid is a member of a clonal population of template nucleic
acids.
20. The method of claim 1, wherein the ternary complex is
stabilized by the presence of a non-catalytic metal ion.
21. A method of sequencing a primed template nucleic acid,
comprising: (a) contacting a primed template nucleic acid with a
first combination of nucleotides that is complementary to two,
three or four different types of bases in the template nucleic
acid, thereby forming a stabilized ternary complex between the
primed template nucleic acid, a polymerase and a nucleotide from
the first combination of nucleotides that is complementary to the
next base of the primed template nucleic acid; (b) detecting the
ternary complex while precluding incorporation of nucleotides into
the primer; (c) repeating steps (a) and (b) using the primed
template nucleic acid and a second combination of nucleotides that
is complementary to two, three or four different types of bases in
the template nucleic acid, wherein the second combination of
nucleotides is different from the first combination of nucleotides,
such that the next base of step (a) is assayed using the first
combination of nucleotides and then using the second combination of
nucleotides prior to an extension step at the next base; (d)
incorporating into the primer, after step (c), a nucleotide that is
complementary to the next base; and (e) repeating steps (a) through
(d) on a series of subsequent next base positions to identify a
sequence of the primed template nucleic acid.
Description
TECHNICAL FIELD
The present disclosure relates generally to the field of
biotechnology. More particularly, the disclosure concerns nucleic
acid sequencing technology. Still more particularly, the disclosure
concerns sequencing-by-binding techniques that identify a next
correct nucleotide independent of nucleotide incorporation.
BACKGROUND
The determination of nucleic acid sequence information is now an
important part of biological and medical research. For example,
nucleic acid sequence information is helpful for identifying genes
associated with certain diseases and phenotypes, identifying
potential drug targets, and understanding the mechanisms of disease
development and progress. Sequence information also is an important
part of personalized medicine, where it can be used to optimize the
diagnosis, treatment, or prevention of disease in a specific
subject.
High-throughput, cost-effective nucleic acid sequencing has the
potential to usher in a new era of research and personalized
medicine. Several commercial sequencing platforms are available,
but remain prohibitively expensive for genetic analysis in the
mass-market.
Currently, a variety of sequencing technologies utilize a method
known alternatively as "sequencing-by-synthesis" (SBS) or
"sequencing by incorporation." This method commonly employs a
polymerase to synthesize a DNA strand complementary to a template
strand that is to be sequenced. This may involve providing
nucleotides or short oligonucleotides, which are modified with
identifying tags, so that the base type of the incorporated
nucleotide or oligonucleotide is detected as synthesis proceeds.
Detection may be in real-time, where the nucleotides are detected
as they are incorporated. Unfortunately, real-time procedures can
sometimes suffer from inaccurate reads of regions containing highly
repetitive sequences and homopolymeric stretches. Detection may
also proceed in iterations of stop and proceed steps, wherein
controlled reaction conditions and/or reagents reversibly stop and
start the reaction at a given time during synthesis.
As many sequencing-by-synthesis technologies are based on
fluorescent detection, fluorescent labeling of nucleotides is
required. The necessary illumination and optical systems can
increase complexity and expense of the system. By way of example,
SBS methods often require fluorescently labeled dNTPs for detecting
incorporated nucleotides and identifying a template nucleic acid
sequence. However, the use of labeled nucleotides has limitations
on accuracy, since current SBS reactions using labeled nucleotides
become error-prone after a few hundred bases. Even a 1% error rate
could compromise the significance of the sequencing results when an
entire genome is to be analyzed. Accuracy may be decreased when a
failure to detect a single label results in a deletion error or
when the detection of a stray molecule results in an insertion
error. Fluorophores which are bleached cause false-negatives. In
addition, contamination of labeled dNTPs by unlabeled dNTPs (e.g.,
impurities or hydrolysis products) can also cause false-negatives.
Still further, stray signals from labeled dNTPs non-specifically
bound to a structured surface contribute to insertion errors or
high signal to noise ratios. The use of modified nucleotides
significantly slows enzyme kinetics, thereby making the sequencing
reaction very slow. Another challenge with labeled nucleotides in
SBS procedures is that the label needs to be removed or deactivated
after it is incorporated and detected, so that the next addition
can be observed without background signal. Thus, to obtain long
read-lengths, each addition must be followed by virtually 100%
chemical, enzymatic or photolytic steps to unblock the substrate or
remove the dye for the next addition.
Disclosed below is a technical approach that overcomes many of the
problems typically associated with prior sequencing
technologies.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a graph showing the results of an experiment using
non-labeled optical detection methods where magnesium was present
or absent during the binding or examination step.
FIG. 2 is a graph showing sequencing using Bst enzyme binding
kinetics for determining the correct base using Bst2.0 enzyme and
dNTPs.
FIG. 3 is a graph showing the effects of salt concentration on
match and mismatch base discrimination effects using biolayer
interferometry on a FORTEBIO.RTM. octet instrument (Menlo Park,
Calif.).
FIG. 4 is a graph showing base discrimination during the wash step,
i.e., during dissociation of the polymerase, using phiX_matchC and
FP2 primer and klenow or Bst2.0 enzyme, and SrCl2.
FIG. 5 is a graph showing the effect of washing on the
stabilization of nucleic acid, polymerase complex using varying
concentrations of SrCl2 (0 mM-14 mM).
FIG. 6 is a graph showing the effect of 3'.fwdarw.5' exonuclease
activity of DNA pol I on sequencing.
FIGS. 7A and 7B are graphs showing sequencing of human ALK
gatekeeper region using HIV-1 reverse transcriptase, NNRTI compound
7 and the indicated dNTPs. FIG. 7A is a graph showing the time
course for consecutive cycles of sequencing. FIG. 7B is a graph
showing cycles 1-12 in individual panels after subtracting
background from the previous cycle. The expected sequence read was
CAGCAGGA (SEQ ID NO: 1) and the observed sequence read was CAGCAGG
(SEQ ID NO:2).
FIG. 8 is a graph showing sequencing of human ALK gatekeeper region
using HIV-1 reverse transcriptase, NNRTI compound 18 and the
various dNTPs.
FIG. 9 is a sensorgram showing sequencing of the phiX_matchA
template using an SPRi biosensor. Grayed areas correspond to
correct base calls. The dotted line indicates the intensity change
threshold used to determine binding of the correct Klenow/dNTP
combination.
FIGS. 10A, 10B, and 10C are graphs showing sequencing of dsDNA by
nick translation using Bst DNA Polymerase from Bacillus
stearothermophilus. Double-stranded DNA with one base gap was
treated with Bst DNA Pol with or without the indicated dNTP in
Binding Buffer. Biosensors were transferred to Reaction Buffer for
dNTP incorporation followed by transfer to Reaction Buffer
containing Bst DNA Pol without dNTP for 5'-3' exonucleolytic
cleavage of the non-template strand for 120 seconds (FIG. 10A) or
60 seconds (FIG. 10B). As a control, Bst DNA Pol was used for
sequencing-by-binding a primed ssDNA template, dNTP incorporation
followed by 5'-3' exonucleolytic processing for 60 seconds (FIG.
10C).
FIGS. 11A, 11B, and 11C are graphs showing sequencing of dsDNA with
5'-flap by strand displacement using Klenow (3'.fwdarw.5' exo(-))
fragment of E. coli DNA polymerase. DNA templates were treated with
Klenow exo(-) DNA Pol with or without the indicated dNTP in Binding
Buffer without MgCl2. Biosensors were transferred to Wash Buffer
with MgCl2 for catalysis followed by re-equilibration in Binding
Buffer without enzyme or dNTP. Cycles were repeated for each
individual dNTP as indicated. FIG. 11A: Single-stranded DNA. FIG.
11B: double-stranded DNA with one base gap. FIG. 11C:
double-stranded DNA with a 5'-oligo-dT flap downstream of a one
base pair gap.
FIGS. 12A, 12B, and 12C are graphs showing sequencing ssDNA by
Klenow (3'.fwdarw.5' exo(-)) fragment of E. coli DNA polymerase are
promoted by salt components. Binding Buffers contain 200 mM
glutamate (FIG. 12A), 100 mM glutamate (FIG. 12B) and 50 mM
glutamate (FIG. 12C). Reaction Buffers contain MgCl2 without
glutamate. The applied dNTP for each cycle ("dNTP") is shown in the
top text row (SEQ ID NO:14) of each of FIGS. 12A, 12B, and 12C.
Binding of Klenow (exo(-)) indicates observed sequence ("Observed")
in the second row of FIGS. 12A (SEQ ID NO:15), 12B (SEQ ID NO:17),
and 12C (SEQ ID NO:19). "Expected" sequence based on the template
is shown in the third text row of FIGS. 12A (SEQ ID NO: 16), 12B
(SEQ ID NO:18), and 12C (SEQ ID NO:20).
FIGS. 13A, 13B, and 13C are graphs of sequencing the sense strand
of human ALK C4493A mutant in a background of ALK wild-type by
Klenow exo(-) DNA polymerase. FIG. 13 A is a sensorgram
demonstrating sequencing in ssDNA mixtures of wild-type and C4493A
mutant. FIG. 13B is a graph showing, in ssDNA mixtures, linear
quantitation of C4493A mutant shown in Cycle 4 (T), and linear
quantitation of wild-type ALK shown in cycle 3 (G).
FIG. 13C is a graph showing, in dsDNA-flap mixtures, linear
quantitation of C4493A mutant is shown in Cycle 4 (T), and roughly
linear quantities of wild-type ALK are shown in cycle 3 (G).
FIGS. 14A and 14B are graphs of divalent cation-mediated binding of
Klenow exo(-) and dCTP to human ALK C4493A mutant and dissociation
with or without catalytic metal (MgCl2). FIG. 14A is a graph
showing binding to the primer/template and dissociation in the
presence of non-catalytic metals. FIG. 14B is a graph showing
binding to the primer/template and dissociation in the presence of
catalytic metals.
FIG. 15 is a graph of Klenow exo(-) sequencing of human ALK C4493A
mutant (SEQ ID NO:31) in which binding is mediated by low
concentration of CoCl2, and incorporation is mediated by high
concentration of CoCl2. The dNTP sequence is also shown (SEQ ID
NO:30).
FIG. 16 is a graph of Klenow exo(-) sequencing of human ALK C4493A
mutant in which binding is mediated by Ni(II)SO4, and incorporation
is effected by MgCl2. Dissociation to baseline is observed only in
the presence of nucleoside diphosphate kinase and ADP, which
scavenge free dNTP thus prevent re-binding of dNTP into the complex
of Klenow exo(-) and primer/template. The three panels show the
sequence calls for three regions for the first 32 nucleotides
(CATCAGGATGAACCGGGGCAGGGATTGCAGGC (SEQ ID NO:23)). The upper left
panel shows the sequence call CATCAGGATGAA (SEQ ID NO:32), the
upper right panel shows the sequence call ACCGGGGCAGGGATTG (SEQ ID
NO:33), and the lower left panel shows the sequence call GCAGGCTCAC
(SEQ ID NO:34). The dNTP sequences are also shown for each panel:
CCAAGGTTCCAAGGTTCCAAGGTTCCAAGGTTCCA (SEQ ID NO:35) in the upper
left panel, AAGGTTCCAAGGTTCCAAGGTTCCAAGGTTCCAAG (SEQ ID NO:36) in
the upper right panel, and GGTTCCAAGGTTCCAAGGTTCCAAGGTTCCAAGGT (SEQ
ID NO:37) in the lower left panel.
FIGS. 17A and 17B are graphs showing homopolymer resolution during
Bsu Pol I (large fragment) sequencing of human ALK C4493A mutant.
Binding is mediated by Ni(II)SO4, incorporation by MgCl2, and
dissociation in the presence or absence of dNDP. FIG. 17A is a
sensorgram of sequencing using the Octet QK system. FIG. 17B is a
graph showing resolution of two consecutive G peaks is dependent
upon the concentrations of dNDP in the Reaction Buffer.
FIGS. 18A, 18B, 18C, 18D and 18E are graphs showing homopolymer
resolution during Bsu Pol I (large fragment) sequencing of human
wild-type ALK. FIG. 18A is a sensogram of Ni enhanced binding of
polymerase on templates ALK-G1, ALK-G2 and ALK-G3.
FIG. 18B is a sensogram of Ni enhanced binding of polymerase on
template ALK-G4. FIG. 18C is a sensogram of the
incorporation/dissociation time following addition of reaction
buffer containing Ni and Mg. FIG. 18D is a graph showing
examination phase parameters plotted versus the number of G
nucleotides in the primer strand needed to fill the C homopolymer
of the template. Control is a single G incorporation (G), and "**"
indicates statistically significant results with p<0.01. FIG.
18E is a graph showing initial rates observed during the
incorporation/dissociation phase plotted for indicated Bsu
polymerase concentrations. Control is a single G incorporation
(G).
FIG. 19 is a graphical interferometry trace showing the magnitude
of polymerase binding (vertical axis) as a function of reaction
progress (horizontal axis). Traces represent binding to four
different biosensor tips using different concentrations of
non-immobilized primed template nucleic acid in the polymerase
delivery reagent (PDR). Signals measured at the end of the period
of binary complex formation progressed lower as the non-immobilized
primed template nucleic acid molecule in the PDR increased in
concentration (i.e., the traces corresponding to 0 nM, 10 nM, 100
nM, and 1,000 nM concentrations).
FIG. 20 is a bar graph plotting differences in magnitude of binary
and ternary complex signals achieved using the indicated
concentrations of non-immobilized primed template nucleic acid in
the PDR. The PDR including 100 nM of the non-immobilized primed
template nucleic acid molecule gave the most dramatic difference in
signal magnitude.
FIG. 21 is a workflow diagram illustrating a sequencing-by-binding
protocol employing detectably labeled polymerase.
FIG. 22 is a bar graph presenting fluorescence intensity (vertical
axis) as a function of cycle number (horizontal axis), where each
cycle involved binding of labeled polymerase and one nucleotide at
a time.
SUMMARY
Provided herein are methods for determining the sequence of a
template nucleic acid molecule, where the methods are based on a
binding reaction carried out under specified conditions. The method
generally includes an examination step prior to incorporation of a
nucleotide. The examination step involves providing a template
nucleic acid molecule primed with a primer; contacting the primed
template nucleic acid molecule with a first reaction mixture that
includes a polymerase and at least one nucleotide molecule;
monitoring the interaction of the polymerase with the primed
template nucleic acid molecule in the presence of the nucleotide
molecule, without chemical incorporation of the nucleotide molecule
into the primed template nucleic acid; and identifying a next base
in the template nucleic acid using the monitored interaction of the
polymerase with the primed template nucleic acid molecule in the
presence of the nucleotide molecule. In this procedure, ternary
complex stabilization and binary complex destabilization
advantageously enhance discrimination between correct and incorrect
nucleotides.
Also provided herein is a method of determining the identity of the
next correct nucleotide for a primed template nucleic acid
molecule. The method can include steps of (a) providing a template
nucleic acid molecule primed with a primer; (b) serially contacting
the primed template nucleic acid molecule with reaction mixtures
each including a polymerase and a different combination of two or
three different test nucleotides under conditions that stabilize
ternary complexes including the primed template nucleic acid
molecule, the polymerase and a next correct nucleotide, while
precluding incorporation of any nucleotide into the primer; (c)
detecting interaction of the polymerase with the primed template
nucleic acid molecule without chemical incorporation of any
nucleotide into the primer of the primed template nucleic acid
molecule, to determine whether ternary complexes form; and (d)
determining whether a test nucleotide that is common to at least
two of the reaction mixtures is the next correct nucleotide for the
primed template nucleic acid molecule using the detected
interaction. Optionally, the method further includes (e)
incorporating a nucleotide at the 3' end of the primer after step
(c). In a further option, the nucleotide that is incorporated is an
unlabeled nucleotide or an unlabeled reversible terminator
nucleotide. Optionally, steps (b) through (e) can be repeated to
sequence the primed template nucleic acid molecule.
In some embodiments, step (d) of the above method includes
determining whether a test nucleotide that is common to two of the
reaction mixtures is the next correct nucleotide for the primed
template nucleic acid molecule using the detected interaction. In
this embodiment, four different reaction mixtures can be serially
contacted with the primed template nucleic acid molecule in step
(b), wherein in aggregate each different nucleotide is present in
two reaction mixtures.
In other embodiments, step (d) of the above method includes
determining whether a test nucleotide that is common to three of
the reaction mixtures is the next correct nucleotide for the primed
template nucleic acid molecule using the detected interaction. In
this embodiment, six different reaction mixtures can be serially
contacted with the primed template nucleic acid molecule in step
(b), wherein in aggregate each different nucleotide is present in
three reaction mixtures.
In particular embodiments, the conditions of step (b) also
destabilize binary complexes that include the primed template
nucleic acid molecule and the polymerase but not the next correct
nucleotide.
The ternary complex of step (b) can be stabilized by the presence
of a reversible terminator moiety on the 3' terminal nucleotide of
the primer. Optionally, after step (c), the method can include a
step of removing the reversible terminator moiety on the 3'
terminal nucleotide of the primer. In some embodiments of the above
method of determining the identity of the next correct nucleotide
for a primed template nucleic acid molecule, each of the test
nucleotides is an unlabeled nucleotide. Optionally, the polymerase
includes an exogenous label that is detected in step (c).
Alternatively or additionally, the next correct nucleotide includes
an exogenous label that is detected in step (c).
Further provided is a method of sequencing a primed template
nucleic acid. The method can include steps of (a) contacting a
primed template nucleic acid with a polymerase and a first
combination of two or three types of test nucleotides under
conditions that form a stabilized ternary complex between the
polymerase, primed template nucleic acid and a test nucleotide that
is complementary to the next base of the primed template nucleic
acid; (b) detecting the ternary complex while precluding
incorporation of test nucleotides into the primer; (c) repeating
steps (a) and (b) using the primed template nucleic acid, a
polymerase and a second combination of two or three types of test
nucleotides, wherein the second combination is different from the
first combination; (d) incorporating into the primer, after step
(c), a nucleotide that is complimentary to the next base; and (e)
repeating steps (a) through (d) to identify a sequence of the
primed template nucleic acid.
In some embodiments of the above sequencing method, the first
combination includes two, and only two, types of test nucleotides.
Optionally, the second combination can also include two, and only
two, types of test nucleotides.
In some embodiments of the above sequencing method, steps (a) and
(b) are carried out serially for four different combinations of two
types of test nucleotides, wherein each different nucleotide type
is contacted with the primed template nucleic acid two times in
aggregate. Alternatively, steps (a) and (b) can be carried out
serially for six different combinations of two types of test
nucleotides, wherein each different nucleotide type is present
three times in aggregate.
Further provided is a method of determining the identity of the
next correct nucleotide for a primed template nucleic acid
molecule. The method includes the steps of: (a) providing a
template nucleic acid molecule primed with a primer; (b) contacting
the primed template nucleic acid molecule from step (a) with a
first reaction mixture including a polymerase and at least one test
nucleotide under conditions that (i) stabilize ternary complexes
including the primed template nucleic acid molecule, the polymerase
and a next correct nucleotide, while precluding incorporation of
any nucleotide into the primer, and (ii) destabilize binary
complexes including the primed template nucleic acid molecule and
the polymerase but not the next correct nucleotide; (c) detecting
(e.g., monitoring) interaction of the polymerase with the primed
template nucleic acid molecule without chemical incorporation of
any nucleotide into the primer of the primed template nucleic acid
molecule, to determine whether a ternary complex formed in step
(b); and (d) determining whether any of the test nucleotides is the
next correct nucleotide for the primed template nucleic acid
molecule using the result of step (c). According to one generally
preferred embodiment, the conditions that stabilize ternary
complexes while precluding incorporation of any nucleotide into the
primer can be provided by including in the first reaction mixture a
non-catalytic metal ion that inhibits polymerization. According to
another generally preferred embodiment, the conditions that
stabilize ternary complexes while precluding incorporation of any
nucleotide into the primer can be provided by including in the
first reaction mixture a polymerase inhibitor selected from the
group consisting of an allosteric polymerase inhibitor, an
uncompetitive polymerase inhibitor, a competitive polymerase
inhibitor, and a non-competitive polymerase inhibitor. According to
another generally preferred embodiment, the conditions that
stabilize ternary complexes while precluding incorporation of any
nucleotide into the primer can be provided by terminating the
primer with a reversible terminator nucleotide before conducting
step (b). According to another generally preferred embodiment, the
conditions that destabilize binary complexes in step (b) can
include a concentration of from 50 mM to 1,500 mM of a salt that
provides monovalent cations, the salt being included in the first
reaction mixture. More preferably, the reaction conditions that
stabilize ternary complexes and destabilize binary complexes in
step (b) can enhance ternary complex formation over binary complex
formation by at least two-fold. Still more preferably, the reaction
conditions that stabilize ternary complexes and destabilize binary
complexes in step (b) can enhance ternary complex formation over
binary complex formation by at least five-fold. Alternatively, when
step (b) includes a concentration of from 50 mM to 1,500 mM of the
salt that provides monovalent cations in the first reaction
mixture, the salt that provides monovalent cations can further
provide glutamate anions. Alternatively, when step (b) includes a
concentration of from 50 mM to 1,500 mM of the salt that provides
monovalent cations in the first reaction mixture, the concentration
of the salt that provides monovalent cations can be from 50 mM to
500 mM. More preferably, the concentration of the salt that
provides monovalent cations can be from 100 mM to 300 mM.
Alternatively, when step (b) includes a concentration of from 50 mM
to 500 mM of the salt that provides monovalent cations in the first
reaction mixture, the first reaction mixture can further include a
glutamate salt at a concentration of from 10 mM to 1.6 M. When this
is the case, the concentration of the glutamate salt can be from 80
mM to 320 mM. Alternatively, when step (b) includes a concentration
of from 50 mM to 500 mM of the salt that provides monovalent
cations in the first reaction mixture, the salt can be a glutamate
salt. Alternatively, when step (b) includes a concentration of from
50 mM to 500 mM of the salt that provides monovalent cations in the
first reaction mixture, the salt can be selected from the group
consisting of NaCl, KCl, NH2(SO4), and potassium glutamate.
According to another embodiment, when step (b) includes a
concentration of from 50 mM to 1,500 mM of the salt that provides
monovalent cations in the first reaction mixture, the conditions
that stabilize ternary complexes while precluding incorporation of
any nucleotide into the primer can be provided by a non-catalytic
metal ion that inhibits polymerization. According to another
embodiment, when step (b) includes a concentration of from 50 mM to
1,500 mM of the salt that provides monovalent cations in the first
reaction mixture, the conditions that stabilize ternary complexes
while precluding incorporation of any nucleotide into the primer
can be provided by terminating the primer with a reversible
terminator nucleotide before performing step (b). According to
another embodiment, when step (b) includes a concentration of from
50 mM to 500 mM of the salt that provides monovalent cations in the
first reaction mixture, the conditions that destabilize binary
complexes in step (b) can include 200 mM of the salt that provides
monovalent cations. More preferably, the salt can be selected from
the group consisting of NaCl, KCl, NH2(SO4), and potassium
glutamate. Alternatively, the conditions that stabilize ternary
complexes while precluding incorporation of any nucleotide into the
primer can be provided by a non-catalytic metal ion that inhibits
polymerization. More preferably, the first reaction mixture can
include potassium glutamate at a concentration between 10 mM and
1.6 M. According to another embodiment, when step (b) includes a
concentration of from 50 mM to 500 mM of the salt that provides
monovalent cations in the first reaction mixture, and when the
conditions that destabilize binary complexes in step (b) include
200 mM of the salt that provides monovalent cations, the conditions
that stabilize ternary complexes while precluding incorporation of
any nucleotide into the primer can be provided by terminating the
primer with a reversible terminator nucleotide before performing
step (b). According to another generally preferred embodiment, each
of the test nucleotides of the first reaction mixture is a
different unlabeled nucleotide. More preferably, each of the
different unlabeled nucleotides can be a different native
nucleotide. Alternatively, the polymerase can include an exogenous
detectable label. For example, the exogenous detectable label can
include a fluorescent label. According to a different preferred
embodiment, when each of the test nucleotides of the first reaction
mixture is a different unlabeled nucleotide, the polymerase can
include a detectable label that emits a signal, and emission of the
signal by the detectable label can be substantially uniform when
the polymerase is complexed with the primed template nucleic acid
molecule in the presence or absence of any nucleotide. According to
another generally preferred embodiment, the primed template nucleic
acid molecule of step (a) is immobilized at a locus on a solid
support, the polymerase includes a detectable label that emits a
signal, where emission of the signal by the detectable label is
substantially uniform when the polymerase is complexed with the
primed template nucleic acid molecule in the presence or absence of
any nucleotide, step (c) includes measuring intensity of the signal
at the locus on the solid support, and increased formation of the
ternary complex in step (b) is indicated by increased intensity of
the signal at the locus. When this is the case, the solid support
can be contained within a flow cell, and the detectable label can
be a fluorescent detectable label. Alternatively, the method can
further include the step of (e) replacing the first reaction
mixture with a second reaction mixture that includes a polymerase,
one or more nucleotides, and a catalytic cation, whereby at least
one of the one or more nucleotides incorporates into the primer.
More preferably, the one or more nucleotides of the second reaction
mixture includes at least one reversible terminator nucleotide.
Still more preferably, the solid support is contained within a flow
cell, and step (e) includes replacing the first reaction mixture by
fluid flow through the flow cell. According to another preferred
embodiment, when the primed template nucleic acid molecule of step
(a) is immobilized at a locus on a solid support, when the
polymerase includes a detectable label that emits a signal, where
emission of the signal by the detectable label is substantially
uniform when the polymerase is complexed with the primed template
nucleic acid molecule in the presence or absence of any nucleotide,
when step (c) includes measuring intensity of the signal at the
locus on the solid support, when increased formation of the ternary
complex in step (b) is indicated by increased intensity of the
signal at the locus, and when the method further includes the step
of (e) replacing the first reaction mixture with a second reaction
mixture that includes a polymerase, one or more nucleotides, and a
catalytic cation, whereby at least one of the one or more
nucleotides incorporates into the primer, the second reaction
mixture can include less than 100 mM of each of NaCl and KCl.
According to another preferred embodiment, when the primed template
nucleic acid molecule of step (a) is immobilized at a locus on a
solid support, when the polymerase includes a detectable label that
emits a signal, where emission of the signal by the detectable
label is substantially uniform when the polymerase is complexed
with the primed template nucleic acid molecule in the presence or
absence of any nucleotide, when step (c) includes measuring
intensity of the signal at the locus on the solid support, when
increased formation of the ternary complex in step (b) is indicated
by increased intensity of the signal at the locus, and when the
method further includes the step of (e) replacing the first
reaction mixture with a second reaction mixture that includes a
polymerase, one or more nucleotides, and a catalytic cation,
whereby at least one of the one or more nucleotides incorporates
into the primer, the polymerase of the second reaction mixture can
be a different polymerase than the polymerase of the first reaction
mixture. In some embodiments, the reversible terminator nucleotide
does not include a fluorescent label. According to another
generally preferred embodiment, the primed template nucleic acid
molecule of step (a) can be immobilized at a locus on a solid
support contained within a flow cell, and the method further
includes the step of (e) replacing, by fluid flow through the flow
cell, the first reaction mixture with a second reaction mixture
including a polymerase, one or more nucleotides, and a catalytic
cation, whereby at least one of the one or more nucleotides
incorporates into the primer. According to one preferred
embodiment, the one or more nucleotides of the second reaction
mixture can include at least one reversible terminator nucleotide.
According to a different preferred embodiment, the second reaction
mixture includes less than 100 mM of each of NaCl and KCl.
According to still a different preferred embodiment, the method
further includes a step for washing the immobilized primed template
nucleic acid molecule between step (c) and step (e) to remove at
least one of the components of the first reaction mixture.
According to still yet another preferred embodiment, the polymerase
of the second reaction mixture is a different polymerase than the
polymerase of the first reaction mixture. In some embodiments, the
reversible terminator nucleotide does not include a fluorescent
label. According to another generally preferred embodiment, the
primed template nucleic acid molecule of step (a) is immobilized at
a locus on a solid support, step (c) includes measuring intensity
of a signal indicating interaction of the polymerase with the
primed template nucleic acid molecule at the locus on the solid
support, and step (d) includes determining that one of the test
nucleotides of the first reaction mixture is the next correct
nucleotide for the primed template nucleic acid molecule when the
measured intensity of the signal exceeds a predetermined threshold.
More preferably, there is the further step of washing the
immobilized primed template nucleic acid molecule after step (c)
and before step (e) to remove at least one of the components of the
first reaction mixture. According to another generally preferred
embodiment, the primed template nucleic acid molecule of step (a)
is immobilized at a locus on a solid support contained within a
flow cell, and the method further includes the steps of: washing
the immobilized primed template nucleic acid molecule after step
(c) to remove one or more of the at least one test nucleotide of
the first reaction mixture; and detecting (e.g., monitoring)
interaction of the polymerase with the immobilized primed template
nucleic acid molecule after the washing step to determine whether
there remains any of the ternary complex that may have formed in
step (b).
Further provided is a method of delivering polymerase and
nucleotide to a population of immobilized nucleic acid features,
where each feature includes a primed template nucleic acid
molecule. The method includes the step of: (a) contacting the
population of immobilized nucleic acid features with a first
reagent that includes a polymerase, a first nucleotide, and at
least one non-immobilized primed template nucleic acid molecule,
wherein the first nucleotide is not the next correct nucleotide for
any of the non-immobilized primed template nucleic acid molecules
of the first reagent, wherein the contacting takes place under
conditions that stabilize ternary complexes and inhibit or preclude
catalysis of phosphodiester bond formation by the polymerase, and
whereby, compared to the use of reagents including the polymerase
and the first nucleotide in the absence of the non-immobilized
primed template nucleic acid molecule of the first reagent,
nucleotide-independent polymerase binding to the primed template
nucleic acid molecule is reduced. In some embodiments, after step
(a) there is the further step of (b) replacing the first reagent
with a second reagent including the polymerase of the first
reagent, a second nucleotide, and at least one non-immobilized
primed template nucleic acid molecule, wherein the first and second
nucleotides are different from each other, wherein the second
nucleotide is not the cognate nucleotide for any of the
non-immobilized primed template nucleic acid molecules of the
second reagent, wherein the replacing takes place under conditions
that stabilize ternary complexes and inhibit or preclude catalysis
of phosphodiester bond formation by the polymerase, and whereby,
compared to the use of reagents including the polymerase and the
second nucleotide in the absence of the non-immobilized primed
template nucleic acid molecule of the second reagent,
nucleotide-independent polymerase binding to the primed template
nucleic acid molecule is reduced. In some embodiments, the
non-immobilized primed template nucleic acid molecules of the first
and second reagents are different from each other.
Further provided is a reaction mixture that includes each of: (a) a
plurality of immobilized nucleic acid features, each feature
including an immobilized primed template nucleic acid; (b) a
polymerase; (c) a non-immobilized primed template nucleic acid
molecule; and (d) a nucleotide, wherein the nucleotide is not the
cognate nucleotide for the non-immobilized primed template nucleic
acid molecule, and wherein nucleotide-independent binding of the
polymerase to the immobilized primed template nucleic acid is
reduced by the presence of the non-immobilized primed template
nucleic acid molecule. In some embodiments, the polymerase, the
immobilized primed template nucleic acid, and the nucleotide form a
stabilized ternary complex that is inhibited or precluded from
incorporating the nucleotide into the immobilized primed template
nucleic acid.
Further provided is a polymerase delivery reagent that includes
each of: (a) a polymerase; (b) at least one non-immobilized primed
template nucleic acid molecule; and (c) at least one nucleotide,
wherein none of the nucleotides is a next correct nucleotide for
any of the non-immobilized primed template nucleic acid molecules.
In some embodiments, the polymerase delivery reagent further
includes (d) a ternary complex stabilizing agent that inhibits
phosphodiester bond formation by the solution-phase polymerase. In
some embodiments, the at least one nucleotide includes at least one
native nucleotide. In some embodiments, the solution-phase primed
template nucleic acid molecule includes no more than three
different types of primed template nucleic acid molecule, each with
a different 3' terminal nucleotide. In some embodiments, the
polymerase is a mutant polymerase without catalytic phosphodiester
bond forming activity in the presence of Mg2+ ions.
Further provided is a method of identifying the next correct
nucleotide for a primed template nucleic acid molecule. The method
includes the step of (a) providing a template nucleic acid molecule
primed with a primer, where the primer includes a reversible
terminator moiety attached to its 3' terminal nucleotide. There
also can be the step of (b) serially contacting the primed template
nucleic acid molecule with a plurality of polymerase-nucleotide
combinations in the presence of a catalytic metal ion, and without
incorporating any nucleotide. Each of the combinations can include
a polymerase and a different nucleotide. As a consequence of the
serial contacting, there is formed a ternary complex including the
polymerase, one of the different nucleotides delivered in
combination with the polymerase, and the primed template nucleic
acid molecule when the one of the different nucleotides is the next
correct nucleotide. There also can be the step of (c) detecting the
ternary complex, thereby identifying the next correct nucleotide
for the primed template nucleic acid molecule as the one of the
different nucleotides that contacted the primed template nucleic
acid molecule in combination with the polymerase to form the
ternary complex. According to one generally preferred embodiment,
step (b) can involve serially contacting the primed template
nucleic acid molecule with the plurality of polymerase-nucleotide
combinations in the presence of the catalytic metal ion and in the
absence of any non-catalytic ion that inhibits incorporation. In
some embodiments, the catalytic metal ion is magnesium ion. In some
embodiments, the polymerase is a labeled polymerase that includes
an exogenous detectable label that produces a signal, where the
signal produced by the label of the labeled polymerase does not
substantially change in the presence or absence of any nucleotide,
and step (c) can involve detecting the ternary complex by detecting
the exogenous detectable label of the labeled polymerase. For
example, the exogenous detectable label of the labeled polymerase
need not be a conformationally sensitive label. Here, each of the
different nucleotides of the combinations in step (b) can be, for
example, a different native nucleotide. In some embodiments, when
step (b) involves serially contacting the primed template nucleic
acid molecule with the plurality of polymerase-nucleotide
combinations in the presence of the catalytic metal ion and in the
absence of any non-catalytic ion that inhibits incorporation, each
different nucleotide of the combination can be a different labeled
nucleotide having an exogenous detectable label that produces a
signal, where the signal produced by the different labeled
nucleotides is substantially the same before and after formation of
the ternary complex. In some other embodiments, when step (b)
involves serially contacting the primed template nucleic acid
molecule with the plurality of polymerase-nucleotide combinations
in the presence of the catalytic metal ion and in the absence of
any non-catalytic ion that inhibits incorporation, the primed
template nucleic acid molecule can be contained within a flow cell,
and step (b) can involve contacting the primed template nucleic
acid molecule by flowing through the flow cell, one at a time, a
plurality of reagent solutions, each including one of the plurality
of polymerase-nucleotide combinations. In one preferred embodiment,
the primed template nucleic acid molecule is disposed on a bead
contained within the flow cell. According to a different preferred
embodiment, the method further includes the step of flowing through
the flow cell, between flows of each of the plurality of reagent
solutions, a wash buffer that removes any of the polymerase and the
different nucleotides that did not combine with the primed template
nucleic acid molecule to form the ternary complex. According to
still a different preferred embodiment, the method further includes
the step of (d) flowing through the flow cell a stripping buffer
that dissociates the ternary complex to remove the polymerase and
the one of the different nucleotides from the primed template
nucleic acid molecule. Preferably, the disclosed method further
involves removing the reversible terminator moiety attached to the
3' terminal nucleotide of the primer of the primed template nucleic
acid molecule to produce a primed template nucleic acid molecule
including an extendable primer. Still more preferably, the method
further includes the step of (e) incorporating a nucleotide into
the extendable primer. When this is the case, step (e) can involve
incorporating with a polymerase different from the polymerase of
step (a). Alternatively, the nucleotide incorporated into the
extendable primer can include a reversible terminator moiety, and
the incorporation produces a blocked primed template nucleic acid
molecule. According to another generally preferred embodiment, the
polymerase is a labeled polymerase including an exogenous
detectable label. According to another generally preferred
embodiment, each of the different nucleotides of the combinations
is either a different native nucleotide, or a different unlabeled
nucleotide analog that is free of any exogenous fluorescent moiety.
According to another generally preferred embodiment, each different
nucleotide of the combination is a different labeled nucleotide
including an exogenous detectable label that produces a signal, and
wherein the signal produced by each of the different labeled
nucleotides is substantially the same before and after formation of
the ternary complex. According to another generally preferred
embodiment, the plurality of polymerase-nucleotide combinations
consists of four polymerase-nucleotide combinations. According to
another generally preferred embodiment, the primed template nucleic
acid molecule is contained within a flow cell, and wherein step (b)
includes serially contacting the primed template nucleic acid
molecule by flowing through the flow cell, one at a time, a
plurality of reagent solutions, each including one of the plurality
of polymerase-nucleotide combinations. According to another
generally preferred embodiment, the method can further include the
step of removing the reversible terminator moiety from the 3'
nucleotide of the primer of the primed template nucleic acid
molecule to produce a primed template nucleic acid molecule
including an extendable primer. According to another generally
preferred embodiment, the method further includes the step of (d)
flowing through the flow cell a stripping buffer that dissociates
the ternary complex to remove the polymerase and the one of the
different nucleotides from the primed template nucleic acid
molecule. More preferably, the method further includes the step of:
(e) removing the reversible terminator moiety attached to the 3'
terminal nucleotide of the primer of the primed template nucleic
acid molecule to produce a primed template nucleic acid molecule
that includes an extendable primer. Still more preferably, the
method further includes the step of: (f) incorporating a nucleotide
into the extendable primer. Yet more preferably, the nucleotide
incorporated into the extendable primer can include a reversible
terminator moiety. Yet still more preferably, the method can
further involve repeating steps (a)-(f) at least once to obtain
sequence information for the template nucleic acid molecule.
DETAILED DESCRIPTION
Disclosed herein is a technique that can be used for determining
the nucleotide sequence of a primed template nucleic acid molecule,
where identification of the next correct nucleotide in the sequence
is completely independent of nucleotide incorporation. More
particularly, the disclosed sequencing-by-binding approach relies
on formation and detection of a ternary complex to identify the
next correct nucleotide. This is distinct from
sequencing-by-synthesis procedures that rely on identifying the
incorporated nucleotide to determine sequence information.
The sequencing-by-binding procedure includes an "examination" step
that identifies the next template base, and an optional
"incorporation" step that adds one or more complementary
nucleotides to the 3'-end of the primer. The incorporation step may
be concurrent with or separate from the examination step. The
examination step involves monitoring the interaction between a
polymerase and a nucleic acid to be sequenced (template nucleic
acid) in the presence of nucleotides. Optionally, the interaction
may be in the presence of stabilizers, whereby the
polymerase-nucleic acid interaction is stabilized in the presence
of the next correct nucleotide. Alternatively, a primer having a
blocked 3' terminal nucleotide may be used to stabilize the ternary
complex and prevent the incorporation reaction from proceeding.
Binary complexes between a primed template nucleic acid and a
polymerase advantageously can be destabilized by a number of
different approaches, such as providing conditions of high
monovalent cation concentration, a concentration of glutamate ion,
and combinations thereof.
Advantageously, the technique can be practiced using various types
of nucleotides, including unlabeled (e.g., native) nucleotides,
nucleotides with detectable labels (e.g., fluorescent or other
optically detectable labels), or labeled or unlabeled nucleotide
analogs (e.g., modified nucleotides containing reversible
terminator moieties). Further, the technique provides controlled
reaction conditions, unambiguous determination of sequence, low
overall cost of reagents, and low instrument cost.
The disclosed technique can be applied to binding reactions used
for determining the identity of the next base of a primed template
nucleic acid by any means and for any reason. The technique can be
used to monitor specific binding of a DNA polymerase and the next
correct nucleotide (e.g., a dNTP) complementary to a primed
template nucleic acid, and to distinguish specific binding from
nonspecific binding. The technique may be applied to single
nucleotide determination (e.g., SNP determination), or
alternatively to more extensive nucleic acid sequencing procedures
employing reiterative cycles that identify one nucleotide at a
time.
The compositions, systems, and methods provided herein overcome or
reduce one or more problems associated with current
sequencing-by-synthesis methods. The provided methods can even be
carried out using native nucleotides that lack any exogenous
detectable label. Optionally, the method is carried out in the
absence of any detectable labels (e.g., on the nucleotides,
polymerase or templates being sequenced). Of course, labeled
nucleotides and/or labeled polymerases also can be used in
disclosed procedure.
Definitions
Unless defined otherwise, all technical and scientific terms used
herein have the same meaning as is commonly understood by one of
ordinary skill in the art. For clarity, the following specific
terms have the specified meanings. Other terms are defined in other
sections herein.
The singular forms "a" "an" and "the" include plural referents
unless the context clearly dictates otherwise. Approximating
language, as used in the description and claims, may be applied to
modify any quantitative representation that could permissibly vary
without resulting in a change in the basic function to which it is
related. Accordingly, a value modified by a term such as "about" is
not to be limited to the precise value specified. Unless otherwise
indicated, all numbers expressing quantities of ingredients,
properties such as molecular weight, reaction conditions, so forth
used in the specification and claims are to be understood as being
modified in all instances by the term "about." Accordingly, unless
indicated to the contrary, the numerical parameters set forth in
the following specification and attached claims are approximations
that may vary depending upon the desired properties sought to be
obtained by the present invention. At the very least each numerical
parameter should at least be construed in light of the number of
reported significant digits and by applying ordinary rounding
techniques.
As used herein, the term "each," when used in reference to a
collection of items, is intended to identify an individual item in
the collection but does not necessarily refer to every item in the
collection. Exceptions can occur if explicit disclosure or context
clearly dictates otherwise.
As used herein, "sequencing-by-binding" refers to a sequencing
technique wherein specific binding of a polymerase and cognate
nucleotide to a primed template nucleic acid is used for
identifying the next correct nucleotide to be incorporated into the
primer strand of the primed template nucleic acid. The specific
binding interaction need not result in chemical incorporation of
the nucleotide into the primer. In some embodiments, the specific
binding interaction precedes chemical incorporation of the
nucleotide into the primer strand or precedes chemical
incorporation of an analogous, next correct nucleotide into the
primer. Thus, identification of the next correct nucleotide can
take place without incorporation of the next correct
nucleotide.
As used herein, "stabilize" and its grammatical variants means to
hold steady or limit fluctuations. "Stabilizing" a ternary complex
refers to the process of promoting existence of the ternary complex
and of preventing incorporation of a nucleotide. The term can be
applied to any of a variety of complexes including, but not limited
to a binary complex or ternary complex. For example, the complex
that is stabilized can be a ternary complex between a polymerase,
primed template nucleic acid molecule and cognate nucleotide.
Generally, stabilization of the ternary complex prevents
incorporation of the nucleotide component of the ternary complex
into the primed nucleic acid component of the ternary complex.
Accordingly, stabilizing a ternary complex can refer to promoting
or prolonging non-covalent interactions that bind components of the
ternary complex, or inhibiting disruption of non-covalent
interactions that bind components of the ternary complex.
As used herein, "destabilize" and its grammatical variants means to
cause something to be unable to continue existing or working in its
usual way. "Destabilizing" a binary complex refers to the process
of promoting dissolution or breakdown of the binary complex.
"Destabilizing" also includes the process of inhibiting or
preventing formation of the binary complex.
As used herein, a "salt providing monovalent cations" is an ionic
compound that dissociates in aqueous solution to produce cations
having a single positive charge. For example, the cations can be
metal cations where the oxidation state +1.
As used herein, "a glutamate salt" is an ionic compound that
dissociates in aqueous solution to produce glutamate anions.
As used herein, to provide reaction conditions that "enhance"
ternary complex formation over binary complex formation means to
provide conditions that give a ratio of ternary complex to binary
complex signals that is greater than one. An enhancement of
two-fold means that signal associated with ternary complex
formation is twice the signal associated with binary complex
formation.
As used herein, "nucleic acid" or "oligonucleotide" or
"polynucleotide" means at least two nucleotides, or analogs
thereof, covalently linked together. Thus, "nucleic acid" embraces
DNA, RNA, or any combination thereof, that can be acted upon by a
polymerizing enzyme during nucleic acid synthesis. The term
includes single-, double-, or multiple-stranded DNA, RNA and
analogs (derivatives) thereof. Double-stranded nucleic acids
advantageously can minimize secondary structures that may hinder
nucleic acid synthesis. A double stranded nucleic acid may possess
a nick or a single-stranded gap. A nucleic acid may represent a
single, plural, or clonally amplified population of nucleic acid
molecules.
As used herein, a "template nucleic acid" is a nucleic acid to be
detected, sequenced, evaluated or otherwise analyzed using any
disclosed method.
As used herein, "primed template nucleic acid" is a template
nucleic acid primed with (i.e., hybridized to) a primer, wherein
the primer is an oligonucleotide having a 3'-end with a sequence
complementary to at least a portion of the template nucleic acid.
The primer can optionally have a free 5'-end (e.g., the primer
being noncovalently associated with the template) or the primer can
be continuous with the template (e.g., via a hairpin structure).
The primed template nucleic acid includes the complementary primer
bound to the template nucleic acid.
As used herein, the "next template nucleotide" (or the "next
template base") refers to the next nucleotide (or base) in a
template nucleic acid that is located immediately downstream of the
3'-end of a hybridized primer. In other words, the next template
nucleotide (or base) is located in the template strand immediately
5' of the base in the template strand that is hybridized to the 3'
end of the primer.
As used herein, the "next correct nucleotide" (sometimes referred
to as the "cognate" nucleotide) is the nucleotide having a base
complementary to the next template base located immediately
downstream of the 3'-end of a hybridized primer. A nucleotide
having a base that is not complementary to the next template base
is referred to as an "incorrect" (or "non-cognate") nucleotide.
As used herein, a "blocked primed template nucleic acid" is a
primed template nucleic acid modified to preclude or prevent
phosphodiester bond formation at the 3'-end of the primer. Blocking
may be accomplished, for example, by chemical modification with a
blocking group at either the 3' or 2' position of the five-carbon
sugar at the 3' terminus of the primer. Alternatively, or in
addition, chemical modifications that preclude or prevent
phosphodiester bond formation may also be made to the nitrogenous
base of a nucleotide. Reversible terminator nucleotide analogs
including each of these types of blocking groups will be familiar
to those having an ordinary level of skill in the art.
Incorporation of these analogs at the 3' terminus of a primer
results in a blocked primed template nucleic acid.
As used herein, a "nucleotide" is a molecule that includes a
nitrogenous base, a five-carbon sugar (ribose or deoxyribose), and
at least one phosphate group. The term embraces ribonucleotides,
deoxyribonucleotides, nucleotides modified to include exogenous
labels or reversible terminators, and nucleotide analogs.
As used herein, a "test nucleotide" is a nucleotide being
investigated for its ability to participate in formation of a
ternary complex that further includes a primed template nucleic
acid and a polymerase.
As used herein, a "native" nucleotide refers to a naturally
occurring nucleotide that does not include an exogenous label
(e.g., a fluorescent dye, or other label) or chemical modification
such as may characterize a nucleotide analog. Examples of native
nucleotides useful for carrying out the sequencing-by-binding
procedures described herein include: dATP
(2'-deoxyadenosine-5'-triphosphate); dGTP
(2'-deoxyguanosine-5'-triphosphate); dCTP
(2'-deoxycytidine-5'-triphosphate); dTTP
(2'-deoxythymidine-5'-triphosphate); and dUTP
(2'-deoxyuridine-5'-triphosphate).
As used herein, a "nucleotide analog" has modifications, such as
chemical moieties, which replace and/or modify any of the
components (e.g., nitrogenous base, five-carbon sugar, or phosphate
group(s)) of a native nucleotide. Nucleotide analogs may be either
incorporable or non-incorporable by a polymerase in a nucleic acid
polymerization reaction. Optionally, the 3'-OH group of a
nucleotide analog is modified with a moiety. The moiety may be a 3'
reversible or irreversible terminator. The base of a nucleotide may
be any of adenine, cytosine, guanine, thymine, or uracil, or
analogs thereof. Optionally, a nucleotide has an inosine, xanthine,
hypoxanthine, isocytosine, isoguanine, nitropyrrole (including
3-nitropyrrole) or nitroindole (including 5-nitroindole) base.
Nucleotides may include, but are not limited to, ATP, UTP, CTP,
GTP, ADP, UDP, CDP, GDP, AMP, UMP, CMP, GMP, dATP, dTTP, dUTP,
dCTP, dGTP, dADP, dTDP, dCDP, dGDP, dAMP, dTMP, dCMP, and dGMP.
Nucleotides may also contain terminating inhibitors of DNA
polymerase, dideoxynucleotides or 2',3' dideoxynucleotides, which
are abbreviated as ddNTPs (ddGTP, ddATP, ddTTP, ddUTP and
ddCTP).
As used herein, a "blocking moiety," when used with reference to a
nucleotide analog, is a part of the nucleotide that inhibits or
prevents the 3' oxygen of the nucleotide from forming a covalent
linkage to a second nucleotide (e.g., via the 3'-oxygen of the
nucleotide analog when it is present at the 3' end of a primer)
during the incorporation step of a nucleic acid polymerization
reaction. The blocking moiety of a "reversible terminator"
nucleotide can be removed from the nucleotide analog to allow for
nucleotide incorporation. Such a blocking moiety is referred to
herein as a "reversible terminator moiety."
As used herein, a "polymerase" can refer to a nucleic acid
synthesizing enzyme, including but not limited to, DNA polymerase,
RNA polymerase, reverse transcriptase, primase and transferase.
Typically, the polymerase includes one or more active sites at
which nucleotide binding and/or catalysis of nucleotide
polymerization may occur. The polymerase may catalyze the
polymerization of nucleotides to the 3'-end of a primer bound to
its complementary nucleic acid strand. For example, a polymerase
catalyzes the addition of a next correct nucleotide to the 3'-OH
group of the primer via a phosphodiester bond, thereby chemically
incorporating the nucleotide into the primer. Optionally a
polymerase lacks catalytic nucleotide polymerization function, for
example, due to a modification such as a mutation or chemical
modification. Optionally, the polymerase used in the provided
methods is a processive polymerase. Optionally, the polymerase used
in the provided methods is a distributive polymerase.
As used herein, "providing" a template, a primer, a primed template
nucleic acid, or a blocked primed template nucleic acid refers to
the preparation or delivery of one or many nucleic acid polymers,
for example to a reaction mixture or reaction chamber.
As used herein, "monitoring" (or sometimes "measuring") refers to a
process of detecting a measurable interaction or binding between
two molecular species. For example, monitoring may involve
detecting measurable interactions between a polymerase and primed
template nucleic acid, typically at various points throughout a
procedure. Monitoring can be intermittent (e.g., periodic) or
continuous (e.g., without interruption), and can involve
acquisition of quantitative results. Monitoring can be carried out
by detecting multiple signals over a period of time during a
binding event or, alternatively, by detecting signal(s) at a single
time point during or after a binding event.
As used herein, "contacting" refers to the mixing together of
reagents (e.g., mixing an immobilized template nucleic acid and
either a buffered solution that includes a polymerase, or the
combination of a polymerase and a test nucleotide) so that a
physical binding reaction or a chemical reaction may take
place.
As used herein, "incorporating" or "chemically incorporating," when
used in reference to a primer and cognate nucleotide, refers to the
process of joining the cognate nucleotide to the primer by
formation of a phosphodiester bond.
As used herein, a "binary complex" is a complex between a
polymerase and a primed template nucleic acid, where the complex
does not include the next correct nucleotide.
As used herein, a "ternary complex" is a complex between a
polymerase, a primed template nucleic acid (e.g., having a primer
with a free 3'-OH or a blocked 3' position), and the next correct
nucleotide positioned immediately downstream of the primer and
complementary to the template strand of the primed template nucleic
acid. The primed template nucleic acid can include, for example, a
primer with a free 3'-OH or a blocked primer (e.g., a primer with a
chemical modification on the base or the sugar moiety of the 3'
terminal nucleotide, where the modification precludes enzymatic
phosphodiester bond formation).
As used herein, a "catalytic metal ion" refers to a metal ion
required for phosphodiester bond formation between the 3'-OH of a
nucleic acid (e.g., a primer) and the phosphate of an incoming
nucleotide. A "divalent catalytic metal cation" is a catalytic
metal ion having a valence of two. Catalytic metal ions can be
present at concentrations necessary to stabilize formation of a
complex between a polymerase, a nucleotide, and a primed template
nucleic acid, referred to as non-catalytic concentrations of a
metal ion. Catalytic concentrations of a metal ion refer to the
amount of a metal ion needed by polymerases to catalyze the
reaction between the 3'-OH group of a nucleic acid (e.g., a primer)
and the phosphate group of an incoming nucleotide.
As used herein, a "non-catalytic metal ion" refers to a metal ion
that, when in the presence of a polymerase enzyme, does not
facilitate phosphodiester bond formation needed for chemical
incorporation of a nucleotide into a primer. Typically, the
non-catalytic metal ion is a cation. A non-catalytic metal ion may
inhibit phosphodiester bond formation by a polymerase, and so may
stabilize a ternary complex by preventing nucleotide incorporation.
Non-catalytic metal ions may interact with polymerases, for
example, via competitive binding compared to catalytic metal ions.
A "divalent non-catalytic metal ion" is a non-catalytic metal ion
having a valence of two. Examples of divalent non-catalytic metal
ions include, but are not limited to, Ca2+, Zn2+, Co2+, Ni2+, and
Sr2+. The trivalent Eu3+ ion is a non-catalytic metal ion having a
valence of three.
As used herein an "exogenous label" refers to a detectable chemical
moiety that has been added to a sequencing reagent, such as a
nucleotide or a polymerase (e.g., a DNA polymerase). While a native
dNTP may have a characteristic limited fluorescence profile, the
native dNTP does not include any added colorimetric or fluorescent
moiety. Conversely, a dATP (2'-deoxyadenosine-5'-triphosphate)
molecule modified to include a chemical linker and fluorescent
moiety attached to the gamma phosphate would be said to include an
exogenous label because the attached chemical components are not
ordinarily a part of the nucleotide. Of course, chemical
modifications to add detectable labels to nucleotide bases also
would be considered exogenous labels. Likewise, a DNA polymerase
modified to include a fluorescent dye (e.g., by attachment to a cys
residue that is part of the primary sequence of the enzyme) also
would be said to include an exogenous label because the label is
not ordinarily a part of the polymerase.
As used herein, a "polymerase-nucleotide combination" refers to a
polymerase and a nucleotide or nucleotide analog that are used
together (e.g., being mixed together and delivered as a mixture or
combination), where both components are required for the
combination.
As used herein, "discriminating conditions," when used in reference
to polymerase complexes, are reaction conditions that distinguish
between formation of a binary complex (a complex between the
polymerase and a primed template nucleic acid molecule absent a
cognate nucleotide) and a formation of a ternary complex (a complex
between the polymerase, primed template nucleic acid molecule and a
cognate nucleotide). Discriminating conditions may be provided by a
number of routes, including: use of salts (e.g., salts providing
monovalent cations, or glutamate anions), use of polymerase enzymes
engineered to exhibit low background binding in the presence of a
non-cognate nucleotide, temperature adjustment, and/or pH
adjustment etc.
As used herein, taking place "serially" or "in serial fashion"
means taking place sequentially, one after the other. In some
embodiments, two steps can occur in a series allowing for
intervening steps or actions (i.e., not necessarily without
interruption). Thus, contacting a nucleic acid molecule with two
different polymerase-nucleotide combinations "serially" or "in
serial fashion" means contacting with the first combination, and
then contacting with the second combination. Optionally,
polymerase-nucleotide combinations that serially contact a primed
template nucleic acid do not mingle with each other.
As used herein, a "flow cell" is a reaction chamber that includes
one or more channels that direct fluid in a predetermined manner to
conduct a desired reaction. The flow cell can be coupled to a
detector such that a reaction occurring in the reaction chamber can
be observed. For example, a flow cell can contain primed template
nucleic acid molecules (or blocked primed template nucleic acid
molecules), for example, tethered to a solid support, to which
nucleotides and ancillary reagents are iteratively applied and
washed away. The flow cell can include a transparent material that
permits the sample to be imaged after a desired reaction occurs.
For example, a flow cell can include a glass slide containing small
fluidic channels, through which polymerases, dNTPs and buffers can
be pumped. The glass inside the channels is decorated with one or
more primed template nucleic acid molecules to be sequenced. An
external imaging system can be positioned to detect the molecules
on the surface of the glass. Reagent exchange in a flow cell is
accomplished by pumping, drawing, or otherwise "flowing" different
liquid reagents through the flow cell. Exemplary flow cells,
methods for their manufacture and methods for their use are
described in US Pat. App. Publ. Nos. 2010/0111768 A1 or
2012-0270305 A1; or WO 05/065814, each of which is incorporated by
reference herein.
As used herein, "unlabeled" refers to a molecular species free of
added or exogenous label(s) or tag(s). A native nucleotide is an
example of an unlabeled molecular species.
Sequencing-by-Binding
Described herein, are polymerase-based, nucleic acid
sequencing-by-binding reactions, wherein the polymerase undergoes
conformational transitions between open and closed conformations
during discrete steps of the reaction. In one step, the polymerase
binds to a primed template nucleic acid to form a binary complex,
also referred to herein as the pre-insertion conformation. In a
subsequent step, an incoming nucleotide is bound and the polymerase
fingers close, forming a pre-chemistry conformation comprising the
polymerase, primed template nucleic acid and nucleotide; wherein
the bound nucleotide has not been incorporated. This step, also
referred to herein as an examination step, may be followed by a
chemical incorporation step wherein a phosphodiester bond is formed
with concomitant pyrophosphate cleavage from the nucleotide
(nucleotide incorporation). The polymerase, primed template nucleic
acid and newly incorporated nucleotide produce a post-chemistry,
pre-translation conformation. As both the pre-chemistry
conformation and the pre-translocation conformation comprise a
polymerase, primed template nucleic acid and nucleotide, wherein
the polymerase is in a closed state, either conformation may be
referred to herein as a ternary complex. Notably however,
phosphodiester bond formation can be precluded by the approach
described herein, so that the referenced ternary complexes are
necessarily in the pre-chemistry conformation. In the closed
pre-insertion state, divalent catalytic metal ions, such as Mg2+
mediate a rapid chemical step involving nucleophilic displacement
of a pyrophosphate (PPi) by the 3'-hydroxyl of the primer terminus.
The polymerase returns to an open state upon the release of PPi,
the post-translocation step, and translocation initiates the next
round of reaction. While a ternary complex can form in the absence
of a divalent catalytic metal ions (e.g., Mg2+), it is proficient
in chemical addition of nucleotide in the presence of the divalent
metal ions. Low or deficient levels of catalytic metal ions, such
as Mg2+ tend to lead to non-covalent (physical) sequestration of
the next correct nucleotide in a tight ternary complex. This
ternary complex may be referred to as a stabilized or trapped
ternary complex. In any reaction step described above, the
polymerase configuration and/or interaction with a nucleic acid may
be monitored during an examination step to identify the next
correct base in the nucleic acid sequence. Before or after
incorporation, reaction conditions can be changed to disengage the
polymerase from the primed template nucleic acid, and changed again
to remove from the local environment any reagents that inhibit
polymerase binding.
Generally speaking, the SBB procedure includes an "examination"
step that identifies the next template base, and optionally an
"incorporation" step that adds one or more complementary
nucleotides to the 3'-end of the primer component of the primed
template nucleic acid. Identity of the next correct nucleotide to
be added is determined either without, or before chemical linkage
of that nucleotide to the 3'-end of the primer through a covalent
bond. The examination step can involve providing a primed template
nucleic acid to be used in the procedure, and contacting the primed
template nucleic acid with a polymerase enzyme (e.g., a DNA
polymerase) and one or more test nucleotides being investigated as
the possible next correct nucleotide. Further, there is a step that
involves monitoring or measuring the interaction between the
polymerase and the primed template nucleic acid in the presence of
the test nucleotides. Optionally, the interaction can take place
when the primer of the primed template nucleic acid molecule
includes a blocking group that precludes enzymatic incorporation of
an incoming nucleotide into the primer. Optionally, the interaction
can take place in the presence of stabilizers, whereby the
polymerase-nucleic acid interaction is stabilized in the presence
of the next correct nucleotide (i.e., stabilizers that stabilize
the ternary complex). Again, the examination step identifies or
determines the identity of the next correct nucleotide without
requiring incorporation of that nucleotide. Stated differently,
identity of the next correct nucleotide can be established without
chemical incorporation of the nucleotide into the primer when one
or more cycles of examination is carried out using labeled or
unlabeled nucleotides. Likewise, the polymerase employed in the
procedure can be labeled or unlabeled.
Whereas methods involving a single template nucleic acid molecule
may be described for convenience, these methods are exemplary. The
sequencing methods provided herein readily encompass a plurality of
template nucleic acids, wherein the plurality of nucleic acids may
be clonally amplified copies of a single nucleic acid, or disparate
nucleic acids, including combinations, such as populations of
disparate nucleic acids that are clonally amplified.
The Examination Step
An examination step typically includes the following substeps: (1)
providing a primed template nucleic acid (i.e., a template nucleic
acid molecule hybridized with a primer that optionally may be
blocked from extension at its 3'-end); (2) contacting the primed
template nucleic acid with a reaction mixture that includes a
polymerase and at least one nucleotide; (3) monitoring the
interaction of the polymerase with the primed template nucleic acid
molecule in the presence of the nucleotide(s) and without chemical
incorporation of any nucleotide into the primed template nucleic
acid; and (4) determining from the monitored interaction the
identity of the next base in the template nucleic acid (i.e., the
next correct nucleotide). Optionally, the primed template nucleic
acid molecule can be contacted initially with the polymerase in the
absence of nucleotide(s) before contacting any nucleotide. The
primer of the primed template nucleic acid can be an extendible
primer. The primed template nucleic acid, the polymerase and the
test nucleotide are capable of forming a ternary complex when the
base of the test nucleotide is complementary to the next base of
the primed template nucleic acid molecule. The primed template
nucleic acid and the polymerase are capable of forming a binary
complex when the base of the test nucleotide is not complementary
to the next base of the primed template nucleic acid molecule.
Optionally, the contacting occurs under conditions that favor
formation of the ternary complex over formation of the binary
complex. Optionally, the conditions that favor or stabilize the
ternary complex are provided by either: (1) the presence of a
reversible terminator moiety on the 3' nucleotide of the primer of
the primed template nucleic acid molecule; or (2) the presence of a
non-catalytic ion (e.g., a divalent non-catalytic metal ion).
Optionally, the conditions that disfavor or destabilize binary
complexes are provided by the presence of one or more monovalent
cations and/or glutamate anions in the reaction mixture during the
examination step. The determining or identifying step can include
identifying the base of the nucleotide that is complementary to the
next base of the primed template nucleic acid. Optionally, this
includes contacting ternary complexes with one or more wash
solutions having different nucleotide compositions that permit
ternary complexes to be selectively maintained or dissociated.
The examination step may be controlled so that nucleotide
incorporation is either attenuated or accomplished. If nucleotide
incorporation is attenuated, a separate incorporation step may be
performed. The separate incorporation step may be accomplished
without the need for monitoring, as the base has already been
identified during the examination step. If nucleotide incorporation
proceeds during examination, subsequent nucleotide incorporation
may be attenuated by a stabilizer that traps the polymerase on the
nucleic acid after incorporation. A reversibly terminated
nucleotide may be used in the incorporation step to prevent the
addition of more than one nucleotide during a single cycle.
The sequencing-by-binding method allows for controlled
determination of a template nucleic acid base without the need for
labeled nucleotides, as the interaction between the polymerase and
template nucleic acid can be monitored without a label on the
nucleotide. The controlled nucleotide incorporation can also
provide accurate sequence information of repetitive and
homopolymeric regions without necessitating use of a labeled
nucleotide. Moreover, template nucleic acid molecules may be
sequenced under examination conditions which do not require
attachment of template nucleic acid or polymerase to a solid-phase
support. However, in certain preferred embodiments, primed template
nucleic acids to be sequenced are attached to a solid support, such
as an interior surface of a flow cell. The compositions, methods
and systems described herein provide numerous advantages over
previous systems, such as controlled reaction conditions,
unambiguous determination of sequence, long read lengths, low
overall cost of reagents, and low instrument cost.
Further provided herein is a method for sequencing a template
nucleic acid molecule, including an examination step that includes
providing a template nucleic acid molecule primed with a primer
(i.e., a primed template nucleic acid molecule); contacting the
primed template nucleic acid molecule with a first reaction mixture
that includes a polymerase and a first nucleotide molecule, wherein
the primed template nucleic acid molecule, the polymerase and the
first nucleotide molecule are capable of forming a ternary complex
when the first nucleotide molecule is complementary to a next base
of the primed template nucleic acid molecule, and wherein the
primed template nucleic acid molecule and the polymerase are
capable of forming a binary complex when the first nucleotide
molecule is not complementary to a next base of the primed template
nucleic acid molecule. The method further includes monitoring the
interaction of the polymerase with the primed template nucleic acid
molecule in the presence of the first nucleotide molecule, and
without chemical incorporation of the first nucleotide molecule
into the primer of the primed template nucleic acid molecule; and
determining the identity of the nucleotide that is complementary to
the next base of the primed template nucleic acid molecule by the
monitored interaction. Optionally, the contacting occurs under
conditions that stabilize formation of the ternary complex and
destabilize formation of the binary complex. Optionally, the
conditions that stabilize the ternary complex are provided by
either: (1) the presence of a reversible terminator moiety on the
3' nucleotide of the primer of the primed template nucleic acid
molecule; or (2) the presence of a non-catalytic ion (e.g., a
divalent non-catalytic metal ion). Optionally, the conditions that
destabilize binary complexes are provided by the presence of one or
more monovalent cations and/or glutamate anions in the reaction
mixture during the examination step. These steps can be repeated
one or more times. For example, the contacting and monitoring steps
can be repeated one or more times. Optionally, the contacting and
monitoring steps are repeated using the first reaction mixture.
Optionally, the contacting and monitoring steps are repeated using
a second reaction mixture including the polymerase and a second
nucleotide molecule. Optionally, the contacting and monitoring
steps are repeated using a third reaction mixture including the
polymerase and a third nucleotide molecule. Optionally, the
contacting and monitoring steps are repeated using a fourth
reaction mixture including the polymerase and a fourth nucleotide
molecule.
Also provided is a method for sequencing a template nucleic acid
molecule. The method includes an examination step that involves
providing a template nucleic acid molecule primed with a primer
(i.e., a primed template nucleic acid molecule); contacting the
primed template nucleic acid molecule with a reaction mixture
including an polymerase, a first nucleotide molecule and a second
nucleotide molecule, the first and second nucleotide molecules
being different from each other and present simultaneously in the
reaction mixture, optionally at different concentrations, wherein
the primed template nucleic acid molecule, the polymerase and the
first and/or second nucleotide molecule are capable of forming a
ternary complex when the first and/or second nucleotide molecule is
complementary to a next base of the primed template nucleic acid
molecule, wherein the primed template nucleic acid molecule and the
polymerase are capable of forming a binary complex when the first
and/or second nucleotide molecule is not complementary to a next
base of the primed template nucleic acid molecule. Optionally, the
contacting occurs under conditions that stabilize formation of the
ternary complex, and destabilize formation of the binary complex.
Optionally, the conditions stabilize formation of the ternary
complex and destabilize formation of the binary complex.
Optionally, the conditions that stabilize the ternary complex are
provided by either: (1) the presence of a reversible terminator
moiety on the 3' nucleotide of the primer of the primed template
nucleic acid molecule; or (2) the presence of a non-catalytic ion
(e.g., a divalent non-catalytic metal ion). Optionally, the
conditions that destabilize binary complexes are provided by the
presence of one or more monovalent cations and/or glutamate anions
in the reaction mixture during the examination step. The method
also includes monitoring the interaction of the polymerase with the
primed template nucleic acid molecule in the presence of the first
and second nucleotide molecules, and without chemical incorporation
of either of the first or second nucleotide molecules into the
primer of the primed template nucleic acid molecule; and
determining whether any of the nucleotides includes a base
complementary to the next base of the primed template nucleic acid
molecule by the monitored interaction. Optionally, the reaction
mixture further includes a third nucleotide molecule, wherein the
third nucleotide molecule is different from the first and second
nucleotide molecules and present in the reaction mixture at a
different concentration than the first and second nucleotide
molecules. Optionally, the reaction mixture further includes a
fourth nucleotide molecule, wherein the fourth nucleotide molecule
is different from the first, second and third nucleotide molecules
and present in the reaction mixture at a different concentration
than the first, second and third nucleotide molecules. Optionally,
the first reaction mixture includes one or more first nucleotide
molecules capable of incorporation and one or more first nucleotide
molecules incapable of incorporation into the primer of the primed
template nucleic acid molecule. Optionally, the second reaction
mixture comprises one or more second nucleotide molecules capable
of incorporation and one or more second nucleotide molecules
incapable of incorporation into the primer of the primed template
nucleic acid molecule. Optionally, the third reaction mixture
comprises one or more third nucleotide molecules capable of
incorporation and one or more third nucleotide molecules incapable
of incorporation into the primer of the primed template nucleic
acid molecule. Optionally, the fourth reaction mixture comprises
one or more fourth nucleotide molecules capable of incorporation
and one or more fourth nucleotide molecules incapable of
incorporation into the primer of the primed template nucleic acid
molecule.
Optionally, the provided methods further include a wash step. The
wash step can occur before or after any other step in the method.
Optionally, the wash step is performed prior to the monitoring step
and/or prior to the determining or identifying step. Optionally,
the wash step occurs under conditions that stabilize the ternary
complex. Optionally, the conditions result from the presence of a
reversible terminator moiety on the 3' nucleotide of the primer of
the primed template nucleic acid molecule. Optionally, the
conditions include a stabilizing agent. Optionally, the stabilizing
agent is a non-catalytic metal ion (e.g., a divalent non-catalytic
metal ion). Non-catalytic metal ions include, but are not limited
to, calcium, strontium, scandium, titanium, vanadium, chromium,
iron, cobalt, nickel, copper, zinc, gallium, germanium, arsenic,
selenium, rhodium, europium, and terbium ions. Optionally, the
non-catalytic metal ion is any of strontium, tin, or nickel ions.
Optionally, the ternary complex has a half-life and the wash step
is performed for a duration shorter than the half-life of the
ternary complex formed when a nucleotide molecule provides a base
that is complementary to the next base of the primed template
nucleic acid molecule.
Optionally, there is a reloading step following the monitoring
step. The reloading step includes contacting the primed template
nucleic acid with a reloading mixture that includes the polymerase
and the first or optional second, third and fourth nucleotide
molecule under conditions that stabilize the ternary complex and
destabilize binary complex formation.
The examination step may be controlled, in part, by providing
reaction conditions to prevent chemical incorporation of a
nucleotide, while allowing determination of the identity of the
next correct base on the primed template nucleic acid molecule.
Such reaction conditions may be referred to as examination reaction
conditions. Optionally, a ternary complex is formed under
examination conditions. Optionally, a stabilized ternary complex is
formed under examination conditions or in a pre-chemistry
conformation. Optionally, a stabilized ternary complex is in a
pre-translocation conformation, wherein the enclosed nucleotide has
been incorporated, but the ternary complex does not allow for the
incorporation of a subsequent nucleotide.
Optionally, the examination conditions accentuate the difference in
affinity for polymerase to primed template nucleic acids in the
presence of different nucleotides, for example by destabilizing
binary complexes. Optionally, the examination conditions cause
differential affinity of the polymerase for the primed template
nucleic acid in the presence of different nucleotides. By way of
example, the examination conditions that cause differential
affinity of the polymerase for the primed template nucleic acid in
the presence of different nucleotides include, but are not limited
to, high salt and glutamate ions. For example, the salt may
dissolve in aqueous solution to yield a monovalent cation, such as
a monovalent metal cation (e.g., sodium ion or potassium ion).
Optionally, the salt that provides the monovalent cations (e.g.,
monovalent metal cations) further provides glutamate anions. The
source of glutamate ions can be potassium glutamate. In some
instances, the concentrations of potassium glutamate that can be
used to alter polymerase affinity of the primed template nucleic
acid extend from 10 mM to 1.6 M of potassium glutamate, or any
amount in between 10 mM and 1.6 M. Optionally, as indicated above,
high salt refers to a concentration of salt from 50 to 1,500 mM
salt.
Examination typically involves detecting polymerase interaction
with a template nucleic acid. Detection may include optical,
electrical, thermal, acoustic, chemical and mechanical means.
Optionally, examination is performed after a wash step, wherein the
wash step removes any non-bound reagents (e.g., unbound polymerases
and/or nucleotides) from the region of observation. Optionally,
examination is performed during a wash step, such that the
dissociation kinetics of the polymerase-nucleic acid or
polymerase-nucleic acid-nucleotide complexes may be used to
determine the identity of the next base. Optionally, examination is
performed during the course of addition of the examination reaction
mixture (or first reaction mixture), such that the association
kinetics of the polymerase to the nucleic acid may be used to
determine the identity of the next base on the nucleic acid.
Optionally, examination involves distinguishing ternary complexes
from binary complexes of polymerase and nucleic acid. Optionally,
examination is performed under equilibrium conditions where the
affinities measured are equilibrium affinities. Multiple
examination steps comprising different or similar examination
reagents, may be performed sequentially to ascertain the identity
of the next template base. Multiple examination steps may be
utilized in cases where multiple template nucleic acids are being
sequenced simultaneously in one sequencing reaction, wherein
different nucleic acids react differently to the different
examination reagents. Optionally, multiple examination steps may
improve the accuracy of next base determination.
Generally, the examination step involves binding a polymerase to
the polymerization initiation site of a primed template nucleic
acid in a reaction mixture comprising one or more nucleotides, and
monitoring the interaction. Optionally, a nucleotide is sequestered
within the polymerase-primed template nucleic acid complex to form
a ternary complex, under conditions in which incorporation of the
enclosed nucleotide by the polymerase is attenuated or inhibited.
Optionally, the ternary complex is stabilized by the presence of a
blocking moiety (e.g., a reversible terminator moiety) on the 3'
terminal nucleotide of the primer. Optionally a stabilizer is added
to stabilize the ternary complex in the presence of the next
correct nucleotide. This ternary complex is in a stabilized or
polymerase-trapped pre-chemistry conformation. A ternary complex
that allows for the incorporation of the enclosed nucleotide but
does not allow for the incorporation of a subsequent nucleotide is
in a stabilized or trapped pre-translocation conformation.
Optionally, the polymerase is trapped at the polymerization site in
its ternary complex by one or a combination of means, not limited
to, crosslinking of the polymerase domains, crosslinking of the
polymerase to the nucleic acid, allosteric inhibition by small
molecules, uncompetitive inhibitors, competitive inhibitors,
non-competitive inhibitors, and denaturation; wherein the formation
of the trapped ternary complex provides information about the
identity of the next base on the nucleic acid template.
Generally speaking, in accordance with the methods provided herein,
the polymerase interacts with the primed template nucleic acid
molecule in the presence of the at least one nucleotide molecule to
form a complex. Optionally, the nucleotide molecule is a nucleotide
including a base complementary to a base of the template nucleic
acid molecule that is downstream of a 3'-end of the primer in the
primed template nucleic acid molecule. Optionally, the nucleotide
molecule is a next correct nucleotide (i.e., includes a base
complementary to a base of the template nucleic acid molecule that
is downstream of a 3'-end of the primer in the primed template
nucleic acid molecule), and the complex is a ternary complex that
includes the primed template nucleic acid molecule, the polymerase,
and the next correct nucleotide. Optionally, the formation of a
ternary complex is favored over the formation of a binary complex
between the primed template nucleic acid and the polymerase.
Optionally, the contacting occurs under conditions that stabilize
formation of the ternary complex and destabilize formation of the
binary complex. Optionally, the conditions that stabilize the
ternary complex are provided by either: (1) the presence of a
reversible terminator moiety on the 3' nucleotide of the primer of
the primed template nucleic acid molecule; or (2) the presence of a
non-catalytic ion (e.g., a divalent non-catalytic metal ion).
Optionally, the conditions that destabilize binary complexes are
provided by the presence of one or more monovalent cations and/or
glutamate anions in the reaction mixture during the examination
step. In a preferred embodiment, the formation of the ternary
complex may be favored over the formation of the binary complex
when the first reaction mixture includes a high concentration of
salt. Optionally, the first reaction mixture includes 50 mM to
1,500 mM of a salt to destabilize binary complex formation. Salt
concentrations in the range of from 100 mM to 1,500 mM, and from
200 mM to 1,500 mM are highly preferred. In certain embodiments,
the salt used for destabilizing binary complexes dissolves to yield
a monovalent ion, such as a monovalent metal cation (e.g., sodium
ion or potassium ion). In some instances, the salt is a glutamate
salt that provides the monovalent metal cation and a glutamate
anion. Formation of the ternary complex alternatively may be
favored over the formation of the binary complex when the first
reaction mixture comprises a buffer having a high pH. Optionally,
the pH is from 7.4 to 9.0. For certain polymerases extracted from
extremophile environments, the formation of the ternary complex may
be favored over the formation of binary complex when the first
reaction mixture comprises a buffer having low pH. Optionally, the
pH is from 4.0-7.0. The reaction temperature and/or organic and
inorganic additives may also be used to modulate the affinity
between the polymerase and primed template nucleic acid
molecules.
In the sequencing methods provided herein, a reaction mixture used
in the examination step can include 1, 2, 3, or 4 types of
nucleotide molecules. Optionally, the nucleotides are selected from
dATP, dTTP (or dUTP), dCTP, and dGTP. Optionally, the reaction
mixture comprises one or more triphosphate nucleotides and one or
more diphosphate nucleotides. Optionally, a ternary complex is
formed between the primed template nucleic acid, the polymerase,
and any one of the four nucleotide molecules so that four types of
ternary complexes may be formed.
Contacting Steps
In the provided methods, contacting of the primed template nucleic
acid molecule with a reaction mixture that includes a polymerase
and one or more nucleotide molecules preferably occurs under
conditions that stabilize formation of the ternary complex, and
that destabilize formation of binary complexes. These conditions
can be provided by alternative approaches that are a matter of
choice by the end-user.
Optionally, the conditions comprise contacting the primed nucleic
acid molecule with a buffer that regulates osmotic pressure.
Optionally, the reaction mixture used in the examination step
includes the buffer that regulates osmotic pressure. Optionally,
the buffer is a high salt buffer that includes a monovalent ion,
such as a monovalent metal ion (e.g., potassium ion or sodium ion)
at a concentration of from 50 to 1,500 mM. Salt concentrations in
the range of from 100 to 1,500 mM, and from 200 to 1,500 mM also
are highly preferred. Optionally, the buffer further includes a
source of glutamate ions (e.g., potassium glutamate). Optionally,
the conditions that stabilize formation of the ternary complex
involve contacting the primed nucleic acid molecule with a
stabilizing agent. Optionally, the reaction mixture used during the
examination step includes a stabilizing agent. Optionally, the
stabilizing agent is a non-catalytic metal ion (e.g., a divalent
non-catalytic metal ion). Non-catalytic metal ions useful in this
context include, but are not limited to, calcium, strontium,
scandium, titanium, vanadium, chromium, iron, cobalt, nickel,
copper, zinc, gallium, germanium, arsenic, selenium, rhodium,
europium, and terbium. Optionally, Ni2+ is provided in an
examination reaction to facilitate ternary complex formation.
Optionally, Sr2+ is provided in an examination reaction to
facilitate ternary complex formation. Optionally, the non-catalytic
metal ion is strontium, tin, or nickel. Optionally, the first
reaction mixture comprises from 0.01 mM to 30 mM strontium chloride
or nickel chloride.
Optionally, the contacting step is facilitated by the use of a flow
cell or chamber ("flow cell" hereafter). Flowing liquid reagents
through the flow cell, which contains an interior solid support
surface (e.g., a planar surface), conveniently permits reagent
exchange. Immobilized to the interior surface of the flow cell is
one or more primed template nucleic acids to be sequenced or
interrogated using the procedures described herein. Typical flow
cells will include microfluidic valving that permits delivery of
liquid reagents (e.g., components of the "reaction mixtures"
discussed herein) to an entry port. Liquid reagents can be removed
from the flow cell by exiting through an exit port.
Optionally, the contacting step is facilitated by physical transfer
or transport of a sensor from one reagent reservoir to another.
Plastic multiwell plates can serve as the reagent reservoirs. For
example, an optical sensor tip having primed template nucleic acid
molecules immobilized thereon can be transported from one well of a
multiwell plate to a different well of a multiwell plate with
continuous or intermittent monitoring during the transport
steps.
Monitoring Steps
Monitoring or measuring the interaction of the polymerase with the
primed template nucleic acid molecule in the presence of a
nucleotide molecule may be accomplished in many different ways. For
example, monitoring can include measuring association kinetics for
the interaction between the primed template nucleic acid, the
polymerase, and any one of the four nucleotide molecules.
Monitoring the interaction of the polymerase with the primed
template nucleic acid molecule in the presence of a nucleotide
molecule can include measuring equilibrium binding constants
between the polymerase and primed template nucleic acid molecule
(i.e., equilibrium binding constants of polymerase to the template
nucleic acid in the presence of any one or the four nucleotides).
Thus, for example, the monitoring includes measuring the
equilibrium binding constant of the polymerase to the primed
template nucleic acid in the presence of any one of the four
nucleotides. Monitoring the interaction of the polymerase with the
primed template nucleic acid molecule in the presence of a
nucleotide molecule includes measuring dissociation kinetics of the
polymerase from the primed template nucleic acid in the presence of
any one of the four nucleotides. Optionally, monitoring the
interaction of the polymerase with the primed template nucleic acid
molecule in the presence of a nucleotide molecule includes
measuring dissociation kinetics of the dissociation of the
closed-complex (i.e., dissociation of the primed template nucleic
acid, the polymerase, and any one of the four nucleotide
molecules). Optionally, the measured association kinetics are
different depending on the identity of the nucleotide molecule.
Optionally, the polymerase has a different affinity for each of the
four types of nucleotide molecules. Optionally, the polymerase has
a different dissociation constant for each of the four types of
nucleotide molecules in each type of ternary complex. Association,
equilibrium and dissociation kinetics are known and can be readily
determined by one in the art. See, for example, Markiewicz et al.,
Nucleic Acids Research 40(16):7975-84 (2012); Xia et al., J. Am.
Chem. Soc. 135(1):193-202 (2013); Brown et al., J. Nucleic Acids,
Article ID 871939, 11 pages (2010); Washington, et al., Mol. Cell.
Biol. 24(2):936-43 (2004); Walsh and Beuning, J. Nucleic Acids,
Article ID 530963, 17 pages (2012); and Roettger, et al.,
Biochemistry 47(37):9718-9727 (2008), which are incorporated by
reference herein in their entireties.
The monitoring step can include monitoring the steady state
interaction of the polymerase with the primed template nucleic acid
molecule in the presence of the first nucleotide molecule, without
chemical incorporation of the first nucleotide molecule into the
primer of the primed template nucleic acid molecule. Optionally,
the monitoring includes monitoring dissociation of the polymerase
with the primed template nucleic acid molecule in the presence of
the first nucleotide molecule, without chemical incorporation of
the first nucleotide molecule into the primer of the primed
template nucleic acid molecule. Optionally, the monitoring includes
monitoring association of the polymerase with the primed template
nucleic acid molecule in the presence of the first nucleotide
molecule, without chemical incorporation of the first nucleotide
molecule into the primer of the primed template nucleic acid
molecule. Again, the test nucleotides in these procedures may be
native nucleotides (i.e., unlabeled), labeled nucleotides (e.g.,
fluorescently labeled nucleotides), or nucleotide analogs (e.g.,
nucleotides modified to include reversible terminator
moieties).
In the sequencing methods provided herein, either a chemical block
on the 3' nucleotide of the primer of the primed template nucleic
acid molecule (e.g., a reversible terminator moiety on the base or
sugar of the nucleotide), or the absence of a catalytic metal ion
in the reaction mixture, or the absence of a catalytic metal ion in
the active site of the polymerase prevents the chemical
incorporation of the nucleotide into the primer of the primed
template nucleic acid. Optionally, the chelation of a catalytic
metal ion in the reaction mixtures of the contacting step prevents
the chemical incorporation of the nucleotide into the primer of the
primed template nucleic acid. Optionally, a non-catalytic metal ion
acts as a stabilizer for the ternary complex in the presence of the
next correct nucleotide. Optionally, the substitution of a
catalytic metal ion in the reaction mixtures of the contacting step
with a non-catalytic metal ion prevents the chemical incorporation
of the nucleotide molecule to the primed template nucleic acid.
Optionally, the catalytic metal ion is magnesium. The metal ion
mechanisms of polymerases postulate that a low concentration of
metal ions may be needed to stabilize the polymerase-nucleotide-DNA
binding interaction. See, for instance, Section 27.2.2, Berg J M,
Tymoczko J L, Stryer L, Biochemistry 5th Edition, WH Freeman Press,
2002.
Optionally, a low concentration of a catalytic ion in the reaction
mixture used during the examination step prevents the chemical
incorporation of the nucleotide molecule to the primed template
nucleic acid. Optionally, a low concentration is from about 1 .mu.M
to about 100 M. Optionally, a low concentration is from about 0.5
.mu.M to about 5 M. Optionally, the reaction mixture used during
the examination step includes cobalt ions and the incorporating
step involves contacting with an incorporation reaction mixture
that includes a higher concentration of cobalt ions as compared to
the concentration of cobalt ions in the first reaction mixture.
In an exemplary sequencing reaction, the examination step comprises
formation and/or stabilization of a ternary complex comprising a
polymerase, primed template nucleic acid, and nucleotide.
Characteristics of the formation and/or release of the ternary
complex are monitored to identify the enclosed nucleotide and
therefore the next base in the template nucleic acid. Ternary
complex characteristics can be dependent on the sequencing reaction
components (e.g., polymerase, primer, template nucleic acid,
nucleotide) and/or reaction mixture components and/or conditions.
Optionally, the ternary complex is in a pre-chemistry conformation.
Optionally, the ternary complex is in a pre-translocation
conformation. Optionally, the ternary complex is in a
post-translocation conformation.
The examination step involves monitoring the interaction of a
polymerase with a template nucleic acid in the presence of a
nucleotide. The formation of a ternary complex may be monitored.
Optionally, the absence of formation of ternary complex is
monitored. Optionally, the dissociation of a ternary complex is
monitored. Optionally, the incorporation step involves monitoring
incorporation of a nucleotide. Optionally, the incorporation step
involves monitoring the absence of nucleotide incorporation.
Any process of the examination and/or incorporation step may be
monitored. Optionally, a polymerase has a detectable tag.
Optionally, no component of the sequencing reaction is detectably
labeled. Optionally, the detectable tag or label on the polymerase
is removable. Optionally, the nucleotides or polymerases have a
detectable label, however, the label is not detected during
sequencing.
Monitoring the variation in affinity of a polymerase to a template
nucleic acid in the presence of correct and incorrect nucleotides,
under conditions that may or may not allow the incorporation of the
nucleotide, may be used to determine the sequence of the nucleic
acid. The affinity of a polymerase to a template nucleic acid in
the presence of different nucleotides, including modified or
labeled nucleotides, can be monitored as the off-rate of the
polymerase-nucleic acid interaction in the presence of the various
nucleotides. The affinities and off-rates of many standard
polymerases to various matched/correct, mismatched/incorrect and
modified nucleotides are known in the art. Single molecule imaging
of Klenow polymerase reveals that the off-rate for a template
nucleic acid for different nucleotide types, where the nucleotide
types are prevented from incorporating, are distinctly and
measurably different.
Optionally, a nucleotide of a particular type is made available to
a polymerase in the presence of a primed template nucleic acid. The
reaction is monitored, wherein, if the nucleotide is a next correct
nucleotide, the polymerase may be stabilized to form a ternary
complex. If the nucleotide is an incorrect nucleotide, a ternary
complex may still be formed; however, without the additional
assistance of stabilizing agents or reaction conditions (e.g.,
absence of catalytic ions, polymerase inhibitors, salt), the
ternary complex may dissociate. The rate of dissociation is
dependent on the affinity of the particular combination of
polymerase, template nucleic acid, and nucleotide, as well as
reaction conditions. Optionally, the affinity is measured as an
off-rate. Optionally, the affinity is different between different
nucleotides for the ternary complex. For example, if the next base
in the template nucleic acid downstream of the 3'-end of the primer
is G, the polymerase-nucleic acid affinity, measured as an
off-rate, is expected to be different based on whether dATP, dCTP,
dGTP or dTTP are added. In this case, dCTP would have the slowest
off-rate, with the other nucleotides providing different off-rates
for the interaction. Optionally, the off-rate may be different
depending on the reaction conditions, for example, the presence of
stabilizing agents (e.g., absence of magnesium or inhibitory
compounds) or reaction conditions (e.g., nucleotide modifications
or modified polymerases).
Once the identity of the next correct nucleotide is determined, 1,
2, 3, 4 or more nucleotide types may be introduced simultaneously
to the reaction mixture under conditions that specifically target
the formation of a ternary complex. Excess nucleotides optionally
may be removed from the reaction mixture and the reaction
conditions modulated to incorporate the next correct nucleotide of
the ternary complex. This sequencing reaction ensures that only one
nucleotide is incorporated per sequencing cycle. Preferably,
reversible terminator nucleotides are employed in the incorporation
step, and the optional wash step is omitted.
Identifying Steps
The identity of the next correct base or nucleotide can be
determined by monitoring the presence, formation, and/or
dissociation of the ternary complex. The identity of the next base
may be determined without chemically incorporating the next correct
nucleotide to the 3'-end of the primer. Optionally, the identity of
the next base is determined by monitoring the affinity of the
polymerase to the primed nucleic acid template in the presence of
added nucleotides. Optionally, the affinity of the polymerase to
the primed template nucleic acid in the presence of the next
correct nucleotide may be used to determine the next correct base
on the template nucleic acid. Optionally, the affinity of the
polymerase to the primed nucleic acid template in the presence of
an incorrect nucleotide may be used to determine the next correct
base on the template nucleic acid.
In certain embodiments, a ternary complex that includes a primed
template nucleic acid (or a blocked primed template nucleic acid)
is formed in the presence of a polymerase and a plurality of
nucleotides. Cognate nucleotide participating in the ternary
complex optionally is identified by observing destabilization of
the complex that occurs when the cognate nucleotide is absent from
the reaction mixture. This is conveniently carried out, for
example, by exchanging one reaction mixture for another. Here, loss
of the complex is an indicator of cognate nucleotide identity. Loss
of binding signal (e.g., a fluorescent binding signal associated
with a particular locus on a solid support) can occur when the
primed template nucleic acid is exposed to a reaction mixture that
does not include the cognate nucleotide. Optionally, maintenance of
a ternary complex in the presence of a single nucleotide in a
reaction mixture also can indicate identity of the cognate
nucleotide.
Incorporation Steps
The sequencing methods described herein optionally include an
incorporation step. The incorporation step involves chemically
incorporating one or more nucleotides at the 3'-end of a primer
bound to a template nucleic acid. Optionally, one or more
nucleotides is incorporated at the 3'-end of the primer. In a
preferred embodiment, only a single nucleotide is incorporated at
the 3'-end of the primer. Optionally, multiple nucleotides of the
same kind are incorporated at the 3'-end of the primer. Optionally,
multiple nucleotides of different kinds are incorporated at the
3'-end of the primer. Incorporated nucleotides alternatively can be
unlabeled nucleotides, reversible terminator nucleotides, or
detectably labeled nucleotide analogs. The polymerase can
dissociate from the polymerization initiation site after nucleotide
incorporation or can be retained at the polymerization initiation
site after incorporation.
The incorporation reaction may be facilitated by an incorporation
reaction mixture. Optionally, the incorporation reaction mixture
has a different composition of nucleotides than the examination
reaction. For example, the examination reaction can include one
type of nucleotide and the incorporation reaction can include
another type of nucleotide. By way of another example, the
examination reaction comprises one type of nucleotide and the
incorporation reaction comprises four types of nucleotides, or vice
versa. Optionally, the examination reaction mixture is altered or
replaced by the incorporation reaction mixture. Optionally, the
incorporation reaction mixture includes a catalytic metal ion
(e.g., a divalent catalytic metal ion), a monovalent metal cation
(e.g., potassium ions or sodium ions), glutamate ions, or a
combination thereof.
There is flexibility in the nature of the nucleotide used in the
incorporation step. For example, the at least one nucleotide can
include a 3'-hydroxyl group, which can be, for example, a free
3'-hydroxyl group. Optionally, the 3' position of the at least one
nucleotide molecule is modified to include a 3' terminator moiety.
The 3' terminator moiety may be a reversible terminator or may be
an irreversible terminator. Optionally, the reversible terminator
of the at least one nucleotide molecule is replaced or removed
before or after the examination step.
Nucleotides present in the reaction mixture but not sequestered in
a ternary complex may cause multiple nucleotide insertions. A wash
step can be employed prior to the chemical incorporation step to
ensure only the nucleotide sequestered within a trapped ternary
complex is available for incorporation during the incorporation
step. Optionally, free nucleotides may be removed by enzymes such
as phosphatases. The trapped polymerase complex may be a ternary
complex, a stabilized ternary complex or ternary complex involving
the polymerase, primed template nucleic acid and next correct
nucleotide.
Optionally, the nucleotide enclosed within the ternary complex of
the examination step is incorporated into the 3'-end of the
template nucleic acid primer during the incorporation step. For
example, a stabilized ternary complex of the examination step
comprises an incorporated next correct nucleotide. Optionally, the
nucleotide enclosed within the ternary complex of the examination
step is incorporated during the examination step, but the ternary
complex does not allow for the incorporation of a subsequent
nucleotide. In this instance, the ternary complex is released
during an incorporation step, thereby allowing a subsequent
nucleotide to become incorporated.
Optionally, the incorporation step involves replacing a nucleotide
from the examination step (e.g., the nucleotide is an incorrect
nucleotide) and incorporating another nucleotide into the 3'-end of
the template nucleic acid primer. The incorporation step can
involve releasing a nucleotide from within a ternary complex (e.g.,
the nucleotide is a modified nucleotide or nucleotide analog) and
incorporating a nucleotide of a different kind into the 3'-end of
the primer of the primed template nucleic acid molecule.
Optionally, the released nucleotide is removed and replaced with an
incorporation reaction mixture containing a next correct
nucleotide. For example, the incorporated nucleotide can be a
reversible terminator nucleotide, such as an unlabeled reversible
terminator nucleotide that does not include a detectable
fluorophore.
Suitable reaction conditions for incorporation may involve
replacing the examination reaction mixture with an incorporation
reaction mixture. Optionally, nucleotides present in the
examination reaction mixture are replaced with one or more
nucleotides in the incorporation reaction mixture. Optionally, the
polymerase present during the examination step is replaced during
the incorporation step. By this approach it is possible to employ
different types of polymerase in the examination and incorporation
steps. Optionally, the polymerase present during the examination
step is modified during the incorporation step. Optionally, the one
or more nucleotides present during the examination step are
modified during the incorporation step. The reaction mixture and/or
reaction conditions present during the examination step may be
altered by any means during the incorporation step. These means
include, but are not limited to, removing reagents, chelating
reagents, diluting reagents, adding reagents, altering reaction
conditions such as conductivity or pH, and any combination thereof.
The reagents in the reaction mixture including any combination of
polymerase, primed template nucleic acid, and nucleotide and each
may be modified during the examination step and/or incorporation
step.
Optionally, the reaction mixture employed in the incorporation step
includes competitive inhibitors, where the competitive inhibitors
reduce the occurrence of multiple incorporations. In one
embodiment, the competitive inhibitor is a non-incorporable
nucleotide. In an embodiment, the competitive inhibitor is an
aminoglycoside. The competitive inhibitor is capable of replacing
either the nucleotide or the catalytic metal ion in the active
site, such that after the first incorporation the competitive
inhibitor occupies the active site preventing a second
incorporation. In some embodiments, both an incorporable nucleotide
and a competitive inhibitor are introduced in the incorporation
step, such that the ratio of the incorporable nucleotide and the
inhibitor can be adjusted to ensure incorporation of a single
nucleotide at the 3'-end of the primer.
Optionally, the provided reaction mixtures including the
incorporation reaction mixtures include at least one nucleotide
molecule that is a non-incorporable nucleotide or a nucleotide
incapable of incorporation into the nucleic acid strand. In other
words, the provided reaction mixtures can include one or more
nucleotide molecules incapable of incorporation into the primer of
the primed template nucleic acid molecule. Such nucleotides
incapable of incorporation include, for example, diphosphate
nucleotides. For example, the nucleotide may contain modifications
to the triphosphate group that make the nucleotide
non-incorporable. Examples of non-incorporable nucleotides may be
found in U.S. Pat. No. 7,482,120, which is incorporated by
reference herein in its entirety. Optionally, the primer may not
contain a free hydroxyl group at its 3'-end, thereby rendering the
primer incapable of incorporating any nucleotide, and, thus, making
any nucleotide non-incorporable.
A polymerase inhibitor optionally may be included with the reaction
mixtures containing test nucleotides in the examination step to
trap the polymerase on the nucleic acid upon binding the next
correct nucleotide. Optionally, the polymerase inhibitor is a
pyrophosphate analog. Optionally, the polymerase inhibitor is an
allosteric inhibitor. Optionally, the polymerase inhibitor is a DNA
or an RNA aptamer. Optionally, the polymerase inhibitor competes
with a catalytic-ion binding site in the polymerase. Optionally,
the polymerase inhibitor is a reverse transcriptase inhibitor. The
polymerase inhibitor may be an HIV-1 reverse transcriptase
inhibitor or an HIV-2 reverse transcriptase inhibitor. The HIV-1
reverse transcriptase inhibitor may be a
(4/6-halogen/MeO/EtO-substituted
benzo[d]thiazol-2-yl)thiazolidin-4-one.
The provided method may further include preparing the primed
template nucleic acid molecule for a next examination step after
the incorporation step. Optionally, the preparing includes
subjecting the primed template nucleic acid or the nucleic
acid/polymerase complex to one or more wash steps; a temperature
change; a mechanical vibration; a pH change; or an optical
stimulation. Optionally, the wash step comprises contacting the
primed template nucleic acid or the primed template nucleic
acid/polymerase complex with one of more buffers, detergents,
protein denaturants, proteases, oxidizing agents, reducing agents,
or other agents capable of releasing internal crosslinks within a
polymerase or crosslinks between a polymerase and nucleic acid.
Optionally, the method further comprises repeating the examination
step and the incorporation step to sequence a template nucleic acid
molecule. The examination step may be repeated one or more times
prior to performing the incorporation step. Optionally, two
consecutive examination steps comprise reaction mixtures with
different nucleotide molecules. Optionally, the examination step
involves the use of a reaction mixture that includes combinations
of different nucleotides, such as pairwise combinations of
nucleotides. Optionally, prior to incorporating the single
nucleotide into the primed template nucleic acid molecule, the
first reaction mixture is replaced with a second reaction mixture
that includes a polymerase and 1, 2, 3, or 4 types of nucleotide
molecules. Optionally, the nucleotide molecules are selected from
dATP, dTTP (or dUTP), dCTP, and dGTP.
In the provided sequencing methods, the next base is identified
before the incorporation step, allowing the incorporation step to
not require labeled reagents and/or monitoring. Thus, in the
provided methods, a nucleotide, optionally, does not contain an
attached detectable tag or label. Optionally, the nucleotide
contains a detectable label, but the label is not detected in the
method. Optionally, the correct nucleotide does not contain a
detectable label; however, an incorrect or non-complementary
nucleotide to the next base contains a detectable label.
The examination step of the sequencing reaction may be repeated 1,
2, 3, 4 or more times prior to the incorporation step. The
examination and incorporation steps may be repeated until the
desired sequence of the template nucleic acid is obtained.
The formation of the ternary complex or the stabilized ternary
complex can be employed to ensure that only one nucleotide is added
to the template nucleic acid primer per cycle of sequencing,
wherein the added nucleotide is sequestered within the ternary
complex. The controlled incorporation of a single nucleotide per
sequencing cycle enhances sequencing accuracy for nucleic acid
regions comprising homopolymer repeats.
Reaction Mixtures
Nucleic acid sequencing reaction mixtures, or simply "reaction
mixtures," typically include reagents that are commonly present in
polymerase based nucleic acid synthesis reactions. Reaction mixture
reagents include, but are not limited to, enzymes (e.g.,
polymerase), dNTPs, template nucleic acids, primer nucleic acids,
salts, buffers, small molecules, co-factors, metals, and ions. The
ions may be catalytic ions, divalent catalytic ions, non-catalytic
ions, non-covalent metal ions, or a combination thereof. The
reaction mixture can include salts, such as NaCl, KCl, potassium
acetate, ammonium acetate, potassium glutamate, NH4Cl, or
(NH4HSO4), that ionize in aqueous solution to yield monovalent
cations. The reaction mixture can include a source of ions, such as
Mg2+ or Mn2+, Co2+, Cd2+ or Ba2+ ions. The reaction mixture can
include tin, Ca2+, Zn2+, Cu2+, Co2+, Fe(II)SO4, or Ni2+, or other
divalent non-catalytic metal cation that stabilizes ternary
complexes by inhibiting formation of phosphodiester bonds between
the primed template nucleic acid molecule and the cognate
nucleotide.
The buffer can include Tris, Tricine, HEPES, MOPS, ACES, MES,
phosphate-based buffers, and acetate-based buffers. The reaction
mixture can include chelating agents such as EDTA, EGTA, and the
like. Optionally, the reaction mixture includes cross-linking
reagents. Provided herein are first reaction mixtures, optionally,
used during the examination step, as well as incorporation reaction
mixtures used during nucleotide incorporation that can include one
or more of the aforementioned agents. First reaction mixtures when
used during examination can be referred to herein as examination
reaction mixtures. Optionally, the first reaction mixture comprises
a high concentration of salt; a high pH; 1, 2, 3, 4, or more types
of nucleotides; potassium glutamate; a chelating agent; a
polymerase inhibitor; a catalytic metal ion; a non-catalytic metal
ion; or any combination thereof. The first reaction mixture can
include 10 mM to 1.6 M of potassium glutamate (including any amount
between 10 mM and 1.6 M). Optionally, the incorporation reaction
mixture comprises a catalytic metal ion; 1, 2, 3, 4, or more types
of nucleotides; potassium chloride; a non-catalytic metal ion; or
any combination thereof.
The provided methods are conducted under reaction conditions that
modulate the formation and stabilization of a ternary complex
during an examination step. The reaction conditions of the
examination step favor the formation and/or stabilization of a
ternary complex encapsulating a nucleotide and hinder the formation
and/or stabilization of a binary complex. The binary interaction
between the polymerase and template nucleic acid may be manipulated
by modulating sequencing reaction parameters such as ionic
strength, pH, temperature, or any combination thereof, or by the
addition of a binary complex destabilizing agent to the reaction.
Optionally, high salt (e.g., 50 to 1,500 mM) and/or pH changes are
utilized to destabilize a binary complex. Optionally, a binary
complex may form between a polymerase and a template nucleic acid
during the examination or incorporation step of the sequencing
reaction, regardless of the presence of a nucleotide. Optionally,
the reaction conditions favor the stabilization of a ternary
complex and destabilization of a binary complex. By way of example,
the pH of the examination reaction mixture can be adjusted from 4.0
to 10.0 to favor the stabilization of a ternary complex and
destabilization of a binary complex. Optionally, the pH of the
examination reaction mixture is from 4.0 to 6.0. Optionally, the pH
of the examination reaction mixture is 6.0 to 10.0.
The provided sequencing methods disclosed herein promote polymerase
interaction with the nucleotides and template nucleic acid in a
manner that reveals the identity of the next base while controlling
the chemical addition of a nucleotide. Optionally, the methods are
performed in the absence of detectably labeled nucleotides, or in
the presence of labeled nucleotides wherein the labels are not
detected.
Provided herein are methods for the formation and/or stabilization
of a ternary complex comprising a polymerase bound to a primed
template nucleic acid and a nucleotide enclosed within the
polymerase-template nucleic acid complex, under examination
reaction conditions. Examination reaction conditions may inhibit or
attenuate nucleotide incorporation. Optionally, incorporation of
the enclosed nucleotide is inhibited and the complex is stabilized
or trapped in a pre-chemistry conformation or a ternary complex.
Optionally, the enclosed nucleotide is incorporated and a
subsequent nucleotide incorporation is inhibited. In this instance,
the complex is stabilized or trapped in a pre-translocation
conformation. For the sequencing reactions provided herein, the
ternary complex is stabilized during the examination step, allowing
for controlled nucleotide incorporation. Optionally, a stabilized
ternary complex is a complex wherein incorporation of an enclosed
nucleotide is attenuated, either transiently (e.g., to examine the
complex and then incorporate the nucleotide) or permanently (e.g.,
for examination only) during an examination step. Optionally, a
stabilized ternary complex allows for the incorporation of the
enclosed nucleotide, but does not allow for the incorporation of a
subsequent nucleotide. Optionally, the closed-complex is stabilized
in order to monitor any polymerase interaction with a template
nucleic acid in the presence of a nucleotide for identification of
the next base in the template nucleic acid.
Optionally, the enclosed nucleotide has severely reduced or
disabled binding to the template nucleic acid in the ternary
complex. Optionally, the enclosed nucleotide is base-paired to the
template nucleic acid at a next base. Optionally, the identity of
the polymerase, nucleotide, primer, template nucleic acid, or any
combination thereof, affects the interaction between the enclosed
nucleotide and the template nucleic acid in the ternary
complex.
Optionally, the enclosed nucleotide is bound to the polymerase of
the closed-complex. Optionally, the enclosed nucleotide is weakly
associated with the polymerase of the ternary complex. Optionally,
the identity of the polymerase, nucleotide, primer, template
nucleic acid, or any combination thereof, affects the interaction
between the enclosed nucleotide and the polymerase in the ternary
complex. For a given polymerase, each nucleotide has a different
affinity for the polymerase than another nucleotide. Optionally,
this affinity is dependent, in part, on the template nucleic acid
and/or the primer.
The ternary complex may be transiently formed. Optionally, the
enclosed nucleotide is a next correct nucleotide. In some methods,
the presence of the next correct nucleotide contributes, in part,
to the stabilization of a ternary complex. Optionally, the enclosed
nucleotide is not a next correct nucleotide.
Optionally, the examination reaction condition comprises a
plurality of primed template nucleic acids, polymerases,
nucleotides, or any combination thereof. Optionally, the plurality
of nucleotides comprises 1, 2, 3, 4, or more types of different
nucleotides, for example dATP, dTTP (or dUTP), dGTP, and dCTP.
Optionally, the plurality of template nucleic acids is a clonal
population of template nucleic acids.
The examination reaction mixture can include other molecules
including, but not limited to, enzymes. Optionally, the examination
reaction mixture comprises any reagents or biomolecules generally
present in a nucleic acid polymerization reaction. Reaction
components may include, but are not limited to, salts, buffers,
small molecules, detergents, crowding agents, metals, and ions.
Optionally, properties of the reaction mixture may be manipulated,
for example, electrically, magnetically, and/or with vibration.
Nucleotides and Nucleotide Analogs
Optionally, a ternary complex of an examination step comprises
either a native nucleotide, or a nucleotide analog or modified
nucleotide to facilitate stabilization of the ternary complex.
Optionally, a nucleotide analog comprises a nitrogenous base,
five-carbon sugar, and phosphate group; wherein any component of
the nucleotide may be modified and/or replaced. Nucleotide analogs
may be non-incorporable nucleotides. Non-incorporable nucleotides
may be modified to become incorporable at any point during the
sequencing method.
Nucleotide analogs include, but are not limited to, alpha-phosphate
modified nucleotides, alpha-beta nucleotide analogs, beta-phosphate
modified nucleotides, beta-gamma nucleotide analogs,
gamma-phosphate modified nucleotides, caged nucleotides, or ddNTPs.
Examples of nucleotide analogs are described in U.S. Pat. No.
8,071,755, which is incorporated by reference herein in its
entirety.
Nucleotide analogs can include terminators that reversibly prevent
nucleotide incorporation at the 3'-end of the primer. One type of
reversible terminator is a 3'-O-blocked reversible terminator. Here
the terminator moiety is linked to the oxygen atom of the 3'-OH end
of the 5-carbon sugar of a nucleotide. For example, U.S. Pat. Nos.
7,544,794 and 8,034,923 (the disclosures of these patents are
incorporated by reference) describe reversible terminator dNTPs
having the 3'-OH group replaced by a 3'-ONH2 group. Another type of
reversible terminator is a 3'-unblocked reversible terminator,
wherein the terminator moiety is linked to the nitrogenous base of
a nucleotide. For example, U.S. Pat. No. 8,808,989 (the disclosure
of which is incorporated by reference) discloses particular
examples of base-modified reversible terminator nucleotides that
may be used in connection with the methods described herein. Other
reversible terminators that similarly can be used in connection
with the methods described herein include those described in U.S.
Pat. Nos. 7,956,171, 8,071,755, and 9,399,798 (the disclosures of
these U.S. patents are incorporated by reference). For reviews of
nucleotide analogs having terminators see e.g., Mu, R., et al.,
"The History and Advances of Reversible Terminators Used in New
Generations of Sequencing Technology," Genomics, Proteomics &
Bioinformatics 11(1):34-40 (2013). Optionally, one or more native
nucleotides employed during the examination step is replaced by a
second type of nucleotide that is incorporated during the
incorporation step. For example, nucleotides present in the
reaction mixture used during an examination step may be replaced by
nucleotide analogs that include reversible terminator moieties
(e.g., positioned on the base or sugar of the nucleotide
molecule).
Optionally, nucleotide analogs have terminator moieties that
irreversibly prevent nucleotide incorporation at the 3'-end of the
primer. Irreversible nucleotide analogs include 2',
3'-dideoxynucleotides, ddNTPs (ddGTP, ddATP, ddTTP, ddCTP).
Dideoxynucleotides lack the 3'-OH group of dNTPs that is essential
for polymerase-mediated synthesis.
Optionally, non-incorporable nucleotides comprise a blocking moiety
that inhibits or prevents the nucleotide from forming a covalent
linkage to a second nucleotide (3'-OH of a primer) during the
incorporation step of a nucleic acid polymerization reaction. The
blocking moiety can be removed from the nucleotide, allowing for
nucleotide incorporation.
Optionally, a nucleotide analog present in a ternary complex
renders the ternary complex stable. Optionally, the nucleotide
analog is non-incorporable. Optionally, the nucleotide analog is
released and a native nucleotide is incorporated. Optionally, the
ternary complex is released, the nucleotide analog is modified, and
the modified nucleotide analog is incorporated. Optionally, the
ternary complex is released under reaction conditions that modify
and/or destabilize the nucleotide analog in the ternary
complex.
Optionally, a nucleotide analog present in a ternary complex is
incorporated and the ternary complex is stabilized. The ternary
complex may be stabilized by the nucleotide analog, or for example,
by any stabilizing methods disclosed herein. Optionally, the
nucleotide analog does not allow for the incorporation of a
subsequent nucleotide. The ternary complex can be released, for
example, by any methods described herein, and the nucleotide analog
is modified. The modified nucleotide analog may allow for
subsequent incorporation of a nucleotide to its 3'-end.
Optionally, a nucleotide analog is present in the reaction mixture
during the examination step. For example, 1, 2, 3, 4 or more
nucleotide analogs are present in the reaction mixture during the
examination step. Optionally, a nucleotide analog is replaced,
diluted, or sequestered during an incorporation step. Optionally, a
nucleotide analog is replaced with a native nucleotide. The native
nucleotide may include a next correct nucleotide. Optionally, a
nucleotide analog is modified during an incorporation step. The
modified nucleotide analog can be similar to or the same as a
native nucleotide.
Optionally, a nucleotide analog has a different binding affinity
for a polymerase than a native nucleotide. Optionally, a nucleotide
analog has a different interaction with a next base than a native
nucleotide. Nucleotide analogs and/or non-incorporable nucleotides
may base-pair with a complementary base of a template nucleic
acid.
Optionally, a nucleotide analog is a nucleotide, modified or
native, fused to a polymerase. Optionally, a plurality of
nucleotide analogs comprises fusions to a plurality of polymerases,
wherein each nucleotide analog comprises a different
polymerase.
A nucleotide can be modified to favor the formation of a
closed-complex over the formation of a binary complex. The
nucleotide modifications may be genetically engineered. A
nucleotide may be selected or modified to have a high affinity for
a polymerase, wherein the polymerase binds to a nucleotide prior to
binding to the template nucleic acid.
Any nucleotide modification that traps the polymerase in a ternary
complex may be used in the methods disclosed herein. The nucleotide
may be trapped permanently or transiently. Optionally, the
nucleotide analog is not the means by which a closed-complex is
stabilized. Any ternary complex stabilization method may be
combined in a reaction utilizing a nucleotide analog.
Optionally, a nucleotide analog that allows for the stabilization
of a closed-complex is combined with reaction conditions that
usually release the ternary complex. The conditions include, but
are not limited to, the presence of a release reagent (e.g.,
catalytic metal ion, such as magnesium or manganese). Optionally,
the ternary complex is stabilized even in the presence of a
catalytic metal ion. Optionally, the ternary complex is released
even in the presence of a nucleotide analog. Optionally, the
stabilization of the closed-complex is dependent, in part, on the
concentrations and/or identity of the stabilization reagent and/or
release reagents, and any combination thereof. Optionally, the
stabilization of a ternary complex using nucleotide analogs is
combined with additional reaction conditions that function to
stabilize a ternary complex, including, but not limited to,
sequestering, removing, reducing, omitting, and/or chelating a
catalytic metal ion; the presence of a polymerase inhibitor,
cross-linking agent; and any combination thereof.
Optionally, one or more nucleotides can be labeled with
distinguishing and/or detectable tags or labels, however such tags
or labels are not detected during examination, identification of
the base or incorporation of the base, and such tags or labels are
not detected during the sequencing methods disclosed herein. The
tags may be distinguishable by means of their differences in
fluorescence, Raman spectrum, charge, mass, refractive index,
luminescence, length, or any other measurable property. The tag may
be attached to one or more different positions on the nucleotide,
so long as the fidelity of binding to the polymerase-nucleic acid
complex is sufficiently maintained to enable identification of the
complementary base on the template nucleic acid correctly.
Optionally, the tag is attached to the nucleobase of the
nucleotide. Under suitable reaction conditions, the tagged
nucleotides may be enclosed in a ternary complex with the
polymerase and the primed template nucleic acid. Alternatively, a
tag is attached to the gamma phosphate position of the
nucleotide.
Enhancing Nucleotide Identification Using a Plurality of
Nucleotides in Multiple Examination Steps
The disclosed sequencing-by-binding technique can be performed
using more than one nucleotide during each cycle of an examination
step. For example, a single examination step optionally can be
conducted using two, three, or even four different nucleotides.
Optionally, each of the nucleotides is an unlabeled nucleotide,
such as a native nucleotide (i.e., dATP, dGTP, dCTP, dTTP or dUTP).
Preferably, a primed template nucleic acid molecule is contacted
with a plurality of reaction mixtures in a serial fashion, without
incorporation of any nucleotide into the primed template nucleic
acid. Optionally, each different reaction mixture includes a
polymerase and a different combination of two or three different
nucleotides. For example, there can be four different reaction
mixtures where, in aggregate, each different nucleotide (e.g.,
dATP, dGTP, dCTP, and dTTP) is present two times. This could be
accomplished, for example, by using the following four combinations
of nucleotides: (dATP and dTTP), (dATP and dGTP), (dTTP and dCTP),
and (dGTP and dCTP). An alternative would be the combinations:
(dGTP and dCTP), (dGTP and dTTP), (dATP and dCTP), and (dATP and
dTTP). Yet another alternative would be the combinations: (dATP and
dGTP), (dATP and dCTP), (dGTP and dTTP), and (dCTP and dTTP).
Examination steps can be conducted using four combinations of two
different nucleotides, one after the other (i.e., such that the
first combination is replaced by the second combination, the second
replaced by the third, and the third replaced by the fourth). When
this is the case, and when monitoring of the interaction of the
polymerase with the primed template nucleic acid yields a signal
confirming the binding interaction, the next correct nucleotide can
be identified as the nucleotide common to two different nucleotide
combinations yielding positive binding signals. If it is desired to
represent each different nucleotide three times among the
collection of nucleotide combinations, an exemplary combination
could be: (dATP and dTTP), (dATP and dGTP), (dATP and dCTP), (dTTP
and dGTP), (dTTP and dCTP), and (dGTP and dCTP). Examination steps
can be conducted using six combinations of two different
nucleotides, one after the other (i.e., such that the first
combination is replaced by the second combination, the second
replaced by the third, the third replaced by the fourth, the fourth
replaced by the fifth, and the fifth replaced by the sixth). When
this is the case, and when monitoring of the interaction of the
polymerase with the primed template nucleic acid yields a signal
confirming the binding interaction, the next correct nucleotide can
be identified as the nucleotide common to three different
nucleotide combinations yielding a positive binding signal.
One advantage underlying use of more than one nucleotide during the
examination step relates to confirmatory evidence that can be used
for establishing the template sequence in the sequencing-by-binding
procedure. When, for one or another reason, a single particular
examination step yields only a moderate signal representing the
binding interaction, testing carried out using the same nucleotide
in more than one combination of nucleotides offers the opportunity
for detecting the binding interaction more than once for each
particular nucleotide. This enhances correct base calling by
reducing the incidence of erroneously low, or false-negative
results in the monitoring step.
Polymerases
Polymerases that may be used to carry out the disclosed techniques
include naturally-occurring polymerases and any modified variations
thereof, including, but not limited to, mutants, recombinants,
fusions, genetic modifications, chemical modifications, synthetics,
and analogs. Naturally occurring polymerases and modified
variations thereof are not limited to polymerases that retain the
ability to catalyze a polymerization reaction. Optionally, the
naturally occurring and/or modified variations thereof retain the
ability to catalyze a polymerization reaction. Optionally, the
naturally-occurring and/or modified variations have special
properties that enhance their ability to sequence DNA, including
enhanced binding affinity to nucleic acids, reduced binding
affinity to nucleic acids, enhanced catalysis rates, reduced
catalysis rates, etc. Mutant polymerases include polymerases
wherein one or more amino acids are replaced with other amino acids
(naturally or non-naturally occurring), and insertions or deletions
of one or more amino acids.
Modified polymerases include polymerases that contain an external
tag (e.g., an exogenous detectable label), which can be used to
monitor the presence and interactions of the polymerase.
Optionally, intrinsic signals from the polymerase can be used to
monitor their presence and interactions. Thus, the provided methods
can include monitoring the interaction of the polymerase,
nucleotide and template nucleic acid through detection of an
intrinsic signal from the polymerase. Optionally, the intrinsic
signal is a light scattering signal. For example, intrinsic signals
include native fluorescence of certain amino acids such as
tryptophan, wherein changes in intrinsic signals from the
polymerase may indicate the formation of a ternary complex.
Optionally, the polymerase employed during the examination step is
an unlabeled polymerase, and monitoring is performed in the absence
of an exogenous detectable label associated with the polymerase.
Some modified polymerases or naturally occurring polymerases, under
specific reaction conditions, may incorporate only single
nucleotides and may remain bound to the primer-template after the
incorporation of the single nucleotide. Optionally, the thumb and
finger domains of the polymerase may form transient or covalent
crosslinks due to their physical proximity in the closed form of
the polymerase. The crosslinks may be formed, for example by native
or engineered cysteines at suitable positions on the thumb and
finger domains.
Optionally, the polymerase employed during the examination step
includes an exogenous detectable label (e.g., a fluorescent label)
chemically linked to the structure of the polymerase by a covalent
bond after the polymerase has been at least partially purified
using protein isolation techniques. For example, the exogenous
detectable label can be chemically linked to the polymerase using a
free sulfhydryl or a free amine moiety of the polymerase. This can
involve chemical linkage to the polymerase through the side chain
of a cysteine residue, or through the free amino group of the
N-terminus. In certain preferred embodiments, a fluorescent label
attached to the polymerase is useful for locating the polymerase,
as may be important for determining whether or not the polymerase
has localized to a spot on an array corresponding to immobilized
primed template nucleic acid. The fluorescent signal need not, and
preferably does not change absorption or emission characteristics
as the result of binding any nucleotide. Stated differently, the
signal emitted by the labeled polymerase is maintained uniformly in
the presence and absence of any nucleotide being investigated as a
possible next correct nucleotide.
The term polymerase and its variants, as used herein, also refers
to fusion proteins comprising at least two portions linked to each
other, for example, where one portion comprises a peptide that can
catalyze the polymerization of nucleotides into a nucleic acid
strand is linked to another portion that comprises a second moiety,
such as, a reporter enzyme or a processivity-modifying domain. For
example, T7 DNA polymerase comprises a nucleic acid polymerizing
domain and a thioredoxin binding domain, wherein thioredoxin
binding enhances the processivity of the polymerase. Absent the
thioredoxin binding, T7 DNA polymerase is a distributive polymerase
with processivity of only one to a few bases. Although DNA
polymerases differ in detail, they have a similar overall shape of
a hand with specific regions referred to as the fingers, the palm,
and the thumb; and a similar overall structural transition,
comprising the movement of the thumb and/or finger domains, during
the synthesis of nucleic acids.
DNA polymerases include, but are not limited to, bacterial DNA
polymerases, eukaryotic DNA polymerases, archaeal DNA polymerases,
viral DNA polymerases and phage DNA polymerases. Bacterial DNA
polymerases include E. coli DNA polymerases I, II and III, IV and
V, the Klenow fragment of E. coli DNA polymerase, Clostridium
stercorarium (Cst) DNA polymerase, Clostridium thermocellum (Cth)
DNA polymerase and Sulfolobus solfataricus (Sso) DNA polymerase.
Eukaryotic DNA polymerases include DNA polymerases .alpha., .beta.,
.gamma., .delta., , .eta., .zeta., .lamda., .sigma., .mu., and k,
as well as the Revl polymerase (terminal deoxycytidyl transferase)
and terminal deoxynucleotidyl transferase (TdT). Viral DNA
polymerases include T4 DNA polymerase, phi-29 DNA polymerase, GA-1,
phi-29-like DNA polymerases, PZA DNA polymerase, phi-15 DNA
polymerase, Cpl DNA polymerase, Cp7 DNA polymerase, T7 DNA
polymerase, and T4 polymerase. Other DNA polymerases include
thermostable and/or thermophilic DNA polymerases such as DNA
polymerases isolated from Thermus aquaticus (Taq) DNA polymerase,
Thermus filiformis (Tfi) DNA polymerase, Thermococcus zilligi (Tzi)
DNA polymerase, Thermus thermophilus (Tth) DNA polymerase, Thermus
flavusu (Tfl) DNA polymerase, Pyrococcus woesei (Pwo) DNA
polymerase, Pyrococcus furiosus (Pfu) DNA polymerase and Turbo Pfu
DNA polymerase, Thermococcus litoralis (Tli) DNA polymerase,
Pyrococcus sp. GB-D polymerase, Thermotoga maritima (Tma) DNA
polymerase, Bacillus stearothermophilus (Bst) DNA polymerase,
Pyrococcus Kodakaraensis (KOD) DNA polymerase, Pfx DNA polymerase,
Thermococcus sp. JDF-3 (JDF-3) DNA polymerase, Thermococcus
gorgonarius (Tgo) DNA polymerase, Thermococcus acidophilium DNA
polymerase; Sulfolobus acidocaldarius DNA polymerase; Thermococcus
sp. go N-7 DNA polymerase; Pyrodictium occultum DNA polymerase;
Methanococcus voltae DNA polymerase; Methanococcus
thermoautotrophicum DNA polymerase; Methanococcus jannaschii DNA
polymerase; Desulfurococcus strain TOK DNA polymerase (D. Tok Pol);
Pyrococcus abyssi DNA polymerase; Pyrococcus horikoshii DNA
polymerase; Pyrococcus islandicum DNA polymerase; Thermococcus
fumicolans DNA polymerase; Aeropyrum pernix DNA polymerase; and the
heterodimeric DNA polymerase DP1/DP2. Engineered and modified
polymerases also are useful in connection with the disclosed
techniques. For example, modified versions of the extremely
thermophilic marine archaea Thermococcus species 9.degree. N (e.g.,
Therminator DNA polymerase from New England BioLabs Inc.; Ipswich,
Mass.) can be used. Still other useful DNA polymerases, including
the 3PDX polymerase are disclosed in U.S. Pat. No. 8,703,461, the
disclosure of which is incorporated by reference in its
entirety.
RNA polymerases include, but are not limited to, viral RNA
polymerases such as T7 RNA polymerase, T3 polymerase, SP6
polymerase, and K11 polymerase; Eukaryotic RNA polymerases such as
RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA
polymerase IV, and RNA polymerase V; and Archaea RNA
polymerase.
Reverse transcriptases include, but are not limited to, HIV-1
reverse transcriptase from human immunodeficiency virus type 1 (PDB
1HMV), HIV-2 reverse transcriptase from human immunodeficiency
virus type 2, M-MLV reverse transcriptase from the Moloney murine
leukemia virus, AMV reverse transcriptase from the avian
myeloblastosis virus, and Telomerase reverse transcriptase that
maintains the telomeres of eukaryotic chromosomes.
Optionally, a polymerase is tagged with a chemiluminescent tag,
wherein closed-complex formation is monitored as a stable
luminescence signal in the presence of the appropriate luminescence
triggers. The unstable interaction of the polymerase with the
template nucleic acid in the presence of an incorrect nucleotide
results in a measurably weaker signal compared to the ternary
complex formed in the presence of the next correct nucleotide.
Additionally, an optional wash step prior to triggering
luminescence can remove substantially all polymerase molecules not
bound in a stable ternary complex.
Optionally, a polymerase is tagged with an optical scattering tag,
wherein ternary complex formation is monitored as a stable optical
scattering signal. The unstable interaction of the polymerase with
the nucleic acid in the presence of an incorrect nucleotide results
in a measurably weaker signal compared to the ternary complex
formed in the presence of the next correct nucleotide.
Optionally, the polymerase is tagged with a plasmonic nanoparticle
tag, wherein the ternary complex formation is monitored as a shift
in plasmonic resonance that is different from the plasmonic
resonance in the absence of the ternary complex or the presence of
a ternary complex comprising an incorrect nucleotide. The change in
plasmon resonance may be due to the change in local dielectric
environment in the ternary complex, or it may be due to the
synchronous aggregation of the plasmonic nanoparticles on a cluster
of clonally amplified nucleic acid molecules or another means that
affects the plasmons differently in the closed-complex
configuration.
Optionally, the polymerase is tagged with a Raman scattering tag,
wherein, the ternary complex formation is monitored as a stable
Raman scattering signal. The unstable interaction of polymerase
with the nucleic acid in the presence of an incorrect nucleotide
results in a measurably weaker signal compared to the ternary
complex formed in the presence of the next correct nucleotide.
Optionally, a next correct nucleotide is identified by a tag on a
polymerase selected or modified to have a high affinity for
nucleotides, wherein the polymerase binds to a nucleotide prior to
binding to the template nucleic acid. For example, the DNA
polymerase X from the African Swine Fever virus has an altered
order of substrate binding, where the polymerase first binds to a
nucleotide, then binds to the template nucleic acid. Optionally, a
polymerase is incubated with each type of nucleotide in separate
compartments, where each compartment contains a different type of
nucleotide and where the polymerase is labeled differently with a
tag depending on the nucleotide with which it is incubated. In
these conditions, unlabeled nucleotides are bound to differently
labeled polymerases. The polymerases may be the same kind of
polymerase bound to each nucleotide type or different polymerases
bound to each nucleotide type. The differentially tagged
polymerase-nucleotide complexes may be added simultaneously to any
step of the sequencing reaction. Each polymerase-nucleotide complex
binds to a template nucleic acid whose next base is complementary
to the nucleotide in the polymerase-nucleotide complex. The next
correct nucleotide is identified by the tag on the polymerase
carrying the nucleotide. The interrogation of the next template
base by the labeled polymerase-nucleotide complex may be performed
under non-incorporating and/or examination conditions, where once
the identity of the next template base is determined, the complex
is destabilized and removed, sequestered, and/or diluted and a
separate incorporation step is performed in a manner ensuring that
only one nucleotide is incorporated.
A common method to introduce a detectable tag on a polymerase
involves chemical conjugation to amines or cysteines present in the
non-active regions of the polymerase. Such conjugation methods are
well known in the art. As non-limiting examples,
n-hydroxysuccinimide esters (NHS esters) are commonly employed to
label amine groups that may be found on an enzyme. Cysteines
readily react with thiols or maleimide groups, while carboxyl
groups may be reacted with amines by activating them with EDC
(1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride).
Optionally, N-Hydroxysuccinimide (NHS) chemistry is employed at pH
ranges where only the N-terminal amines are reactive (for instance,
pH 7), such that only a single tag is added per polymerase.
Optionally, the tag attached to the polymerase is a charge tag,
such that the formation of stable ternary complex can be detected
by electrical means by measuring changes in local charge density
around the template nucleic acids. Methods for detecting electrical
charges are well known in the art, comprising methods such as
field-effect transistors, dielectric spectroscopy, impedance
measurements, and pH measurements, among others. Field-effect
transistors include, but are not limited to, ion-sensitive
field-effect transistors (ISFET), charge-modulated field-effect
transistors, insulated-gate field-effect transistors, metal oxide
semiconductor field-effect transistors and field-effect transistors
fabricated using semiconducting single wall carbon nanotubes.
Optionally, a charge tag is a peptide tag having an isoelectric
point below about 4 or above about 10. Optionally, a polymerase
comprising a peptide tag has a total isoelectric point below about
5 or above about 9. A charge tag may be any moiety which is
positively or negatively charged. The charge tag may comprise
additional moieties including mass and/or labels such as dyes.
Optionally, the charge tag possesses a positive or negative charge
only under certain reaction conditions such as changes in pH.
A polymerase optionally may be labeled with a fluorophore and/or
quencher. Optionally, a nucleic acid is labeled with a fluorophore
and/or quencher. Optionally, one or more nucleotides are labeled
with a fluorophore and/or quencher. Exemplary fluorophores include,
but are not limited to, fluorescent nanocrystals; quantum dots;
d-Rhodamine acceptor dyes including dichloro[R110], dichloro[R6G],
dichloro[TAMRA], dichloro[ROX] or the like; fluorescein donor dye
including fluorescein, 6-FAM, or the like; Cyanine dyes such as
Cy3B; Alexa dyes, SETA dyes, Atto dyes such as atto 647N which
forms a FRET pair with Cy3B and the like. Fluorophores include, but
are not limited to, MDCC
(7-diethylamino-3-[([(2-maleimidyl)ethyl]amino)carbonyl]coumarin),
TET, HEX, Cy3, TMR, ROX, Texas Red, Cy5, LC red 705 and LC red 640.
Fluorophores and methods for their use including attachment to
polymerases and other molecules are described in The Molecular
Probes.RTM. Handbook (Life Technologies, Carlsbad Calif.) and
Fluorophores Guide (Promega, Madison, Wis.), which are incorporated
herein by reference in their entireties. Exemplary quenchers
include, but are not limited to, ZEN, IBFQ, BHQ-1, BHQ-2, DDQ-I,
DDQ-11, Dabcyl, Qx1 quencher, Iowa Black RQ, and IRDye QC-1.
Optionally, a conformationally sensitive dye may be attached close
to the active site of the polymerase without affecting the
polymerization ability or fidelity of the polymerase; wherein a
change in conformation, or a change in polar environment due to the
formation of a ternary complex is reflected as a change in
fluorescence or absorbance properties of the dye. Common
fluorophores such as cy3 and fluorescein are known to have strong
solvatochromatic response to polymerase binding and ternary complex
formation, to the extent that the formation of ternary complex can
be distinguished clearly from the binary polymerase-nucleic acid
complex. Optionally, the ternary complex can be distinguished from
binary complexes based on differences in fluorescence or absorbance
signals from a conformationally sensitive dye. Optionally, a
solvatochromatic dye may be employed to monitor conformational
transitions; wherein the change in local polar environment induced
by the conformational change can be used as the reporter signal.
Solvatochromatic dyes include, but are not limited to, Reichart's
dye, IR44, merocyanine dyes (e.g., merocyanine 540),
4-[2-N-substituted-1,4-hydropyridin-4-ylidine)ethylidene]cyclohexa--
2,5-dien-1-one, red pyrazolone dyes, azomethine dyes, indoaniline
dyes, diazamerocyanine dyes, indigoid dyes, as exemplified by
indigo, and others as well as mixtures thereof. Methods to
introduce dyes or fluorophores to specific sites of a polymerase
are well known in the art. As a non-limiting example, a procedure
for site specific labeling of a T7 DNA polymerase with a dye is
provided in Yu-Chih Tsai, Zhinan Jin, and Kenneth A. Johnson,
"Site-Specific Labeling of T7 DNA Polymerase with a
Conformationally Sensitive Fluorophore and Its Use in Detecting
Single-Nucleotide Polymorphisms," Analytical Biochemistry 384, no.
1 (Jan. 1, 2009): 136-44, which is incorporated herein in its
entirety by reference.
Optionally, a polymerase is tagged with a fluorophore at a position
that could sense ternary complex formation without interfering with
the reaction. The polymerase may be a native or modified
polymerase. Modified polymerases include those with one or more
amino acid mutations, additions, and/or deletions. Optionally, one
or more, but not all, cysteine amino acids are mutated to another
amino acid, such as alanine. In this case, the remaining one or
more cysteines are used for site-specific conjugation to a
fluorophore. Alternatively, one or more amino acids are mutated to
a reactive amino acid suitable for fluorophore conjugation, such as
cysteines or amino acids comprising primary amines.
Optionally, binding between a polymerase and a template nucleic
acid in the presence of a correct nucleotide may induce a decrease
in fluorescence, whereas binding with an incorrect nucleotide
causes an increase in fluorescence. Binding between a polymerase
and a template nucleic acid in the presence of a correct nucleotide
may induce an increase in fluorescence, whereas binding with an
incorrect nucleotide causes a decrease in fluorescence. The
fluorescent signals may be used to monitor the kinetics of a
nucleotide-induced conformational change and identify the next base
in the template nucleic acid sequence.
Optionally, the polymerase/nucleic-acid interaction may be
monitored by scattering signal originating from the polymerase or
tags attached to the polymerase, for instance, nanoparticle
tags.
As discussed above, polymerases may be modified to facilitate
ternary complex formation and/or stabilization during the
examination step of the sequencing methods described herein. Thus,
a modified polymerase may be used in the provided methods.
Modifications of polymerases may include cross-linking the members
within the ternary complex with cross-linkers or forming disulfide
bonds within the polymerase to maintain a ternary complex.
Optionally, cysteine residues are positioned so that when a ternary
complex is formed, the cysteines are in close proximity to form at
least one disulfide bond to trap the polymerase in the closed
conformation. Optionally, the finger and the thumb domain of the
polymerase are engineered to contain one or more cysteines each,
such that in the closed-complex, the cysteines on the opposing
fingers interact, forming a disulfide bond and trapping the
polymerase in its closed conformation. Introducing cysteines to
suitable positions on the polymerase so as to induce disulfide bond
formation can be accomplished using methods known to those in the
art of protein engineering. A reducing agent such as
2-mercaptoethanol (BME), cysteine-HCl, dithiothreitol (DTT), Tris
(2-carboxyethyl) phosphine (TCEP), or any combination thereof may
be used to reduce the disulfide bond and release the polymerase.
Optionally, nucleotides are added sequentially, one at a time, in
separate examination steps along with the cysteine modified
polymerase, wherein the need for additional examination reaction
conditions that favor ternary complex formation and/or
stabilization is optional. Optionally, 1, 2, 3, 4 or more
nucleotides are added in combination (e.g., dATP, dTTP, dCTP, and
dGTP), in one examination step along with the cysteine modified
polymerase, wherein the need for additional examination reaction
conditions that favor ternary complex formation and/or
stabilization is optional.
Optionally, a cysteine-modified polymerase binds to a template
nucleic acid without incorporating a correct nucleotide while
forming a ternary complex. While in the ternary complex, the
cysteines of the polymerase are close enough in space to form at
least one disulfide bond, thereby stabilizing the ternary complex.
In this example, the polymerase is trapped and prevented from
nucleotide incorporation.
Optionally, a nucleotide present in the examination reaction
mixture is a next correct nucleotide, and the cysteine-modified
polymerase binds to a template nucleic acid and incorporates the
next correct nucleotide forming a ternary complex; wherein while in
the closed-complex, the cysteines of the polymerase are close
enough in space to form at least one disulfide bond, thereby
stabilizing the ternary complex. After ternary complex
stabilization and monitoring, an incorporation step can be
performed wherein a reducing agent breaks the disulfide bond,
releasing the polymerase from the ternary complex. The reducing
agent may then be removed, diluted, or sequestered and another
examination step may be performed.
Optionally, the nucleotide of the disulfide-stabilized ternary
complex is incorporated prior to or during stabilization of the
ternary complex. An incorporation step may be performed by reducing
the disulfide bond to allow for subsequent nucleotide incorporation
and/or an additional examination step.
Optionally, one nucleotide is added to the reaction mixture during
the examination step. Optionally, 1, 2, 3, 4 or more nucleotides
are added to the reaction mixture during the examination step.
Optionally, the next correct nucleotide is enclosed within the
ternary complex. Optionally, an incorrect nucleotide is enclosed
within the ternary complex.
Optionally, a polymerase may form a disulfide bond with itself
after formation of a ternary complex. A polymerase can form a
disulfide bond to the primed template nucleic acid after formation
of a ternary complex. The ternary complex may include a next
correct nucleotide based-paired to the next base and/or
incorporated to the primer of the primed template nucleic acid.
Optionally, the ternary complex comprises an incorrect nucleotide,
wherein binding to the next base and/or incorporation is
attenuated.
Optionally, the polymerase is stabilized via cross-linking methods
involving the polymerase of the ternary complex. The cross-linking
methods do not need to be reversible, as the polymerase can be
unbound from the nucleic acid using other means, such as enzymatic
or chemical cleavage, denaturation or any combination thereof.
Denaturants include, but are not limited to, acids such as acetic
acid, or trichloroacetic acid; solvents such as ethanol or
methanol; chaotropic agents such as urea, guanidinium chloride,
lithium perchlorate; surfactants such as sodium dodecyl sulfate; or
any combination thereof. Chemical cleavage includes the use of one
or more of natural, modified, or commercially available proteases.
Additional methods for releasing a cross-linked polymerase include,
but are not limited to, altering pH, temperature, ionic strength,
or any combination thereof.
The ternary complex is formed without incorporation of the enclosed
nucleotide during an examination step of a reaction. Optionally,
the examination reaction mixture at any point in time includes a
cross-linking agent, wherein the ternary complex is cross-linked.
In this example, the polymerase is trapped and prevented from
nucleotide incorporation. Optionally, a nucleotide present in the
examination reaction mixture is a next correct nucleotide, and a
polymerase binds to a template nucleic acid and incorporates the
next correct nucleotide forming a ternary complex; wherein, while
in the ternary complex, a cross-linking agent is available to trap
the ternary complex. After ternary complex stabilization and
monitoring, an incorporation step can be performed wherein the
ternary complex is released from its closed-conformation.
Optionally, a ternary complex is formed and the next correct
nucleotide is incorporated into the template nucleic acid primer.
The cross-linking inhibits the polymerase from translocating to the
next base position and the next nucleotide cannot be added until
the polymerase is no longer cross-linked. Optionally, the
nucleotide of the cross-linked-stabilized ternary complex is
incorporated prior to or during stabilization of the ternary
complex. An incorporation step may be performed by cleaving the
linkage and/or denaturing the polymerase to allow for subsequent
nucleotide incorporation and/or an additional examination step.
Optionally, a polymerase may be cross-linked to itself after
formation of a ternary complex. Thus, a polymerase can be
cross-linked to the primed template nucleic acid after formation of
a ternary complex. The ternary complex may include a next correct
nucleotide which is based-paired to the next base and/or
incorporated to the primer of the primed template nucleic acid.
Optionally, the ternary complex comprises an incorrect nucleotide
who's binding to the next base and/or incorporation is
attenuated.
Optionally, a polymerase is modified to favor the formation of a
closed-complex over the formation of a binary complex. The
polymerase modifications may be genetically engineered. Polymerases
may be selected based on their selective binding affinities to the
template nucleic acid. A polymerase may be selected or modified to
have a high affinity for nucleotides, wherein the polymerase binds
to a nucleotide prior to binding to the template nucleic acid. For
example, the DNA polymerase X from the African Swine Fever virus
has an altered order of substrate binding, where the polymerase
first binds to a nucleotide, then binds to the template nucleic
acid. Polymerases that bind to nucleotides first may be utilized to
develop novel sequencing schemes. Polymerase modifications can be
designed to trap the polymerase in a ternary complex in the methods
disclosed herein. The polymerase may be trapped permanently or
transiently.
Optionally, a modified polymerase that allows for the stabilization
of a ternary complex is combined with reaction conditions, usually
to release the ternary complex, including, but not limited to, the
presence of a release reagent (e.g., catalytic metal ion, such as
magnesium or manganese). Optionally, the ternary complex is
stabilized even in the presence of a catalytic metal ion.
Optionally, the ternary complex is released even in the presence of
a cross-linking agent. Optionally, the stabilization of the
closed-complex is dependent, in part, on the concentrations and/or
identity of the stabilization reagent and/or the release reagents,
and any combination thereof. Optionally, the stabilization of a
ternary complex using one or more modified polymerases is combined
with additional reaction conditions to stabilize a ternary complex,
including, but not limited to, sequestering, removing, reducing,
omitting, and/or chelating a catalytic metal ion; the presence of a
polymerase inhibitor, or non-incorporable nucleotide; and any
combination thereof.
Polymerase Delivery Reagents
In one aspect, the disclosed technique relates to a method of
delivering polymerase and nucleotide to a population of immobilized
nucleic acid features, where each feature includes one or more
primed template nucleic acid molecules. The method includes the
step of contacting the population of immobilized nucleic acid
features with a first reagent that includes: a polymerase, a first
nucleotide, and at least one non-immobilized primed template
nucleic acid molecule that is free in solution. The first
nucleotide of the first reagent is not the next correct nucleotide
for any of the non-immobilized primed template nucleic acid
molecules of the first reagent. As well, the contacting step takes
place under conditions that stabilize ternary complexes, and that
inhibit or preclude catalysis of phosphodiester bond formation by
the polymerase. By this procedure, compared to the use of reagents
containing the polymerase and the first nucleotide in the absence
of said non-immobilized primed template nucleic acid molecule of
the first reagent, nucleotide-independent polymerase binding to the
primed template nucleic acid molecule to form binary complexes is
reduced. In one embodiment of the technique, there is the further
step of replacing the first reagent with a second reagent that
includes: the same type of polymerase of the first reagent, a
second nucleotide, and at least one non-immobilized primed template
nucleic acid molecule that is free in solution. Here the first and
second nucleotides are different from each other. The second
nucleotide is not the cognate nucleotide for any of the
non-immobilized primed template nucleic acid molecules of the
second reagent. As well, the replacing step takes place under
conditions that stabilize ternary complexes and inhibit or preclude
catalysis of phosphodiester bond formation by the polymerase. When
this is the case, compared to the use of reagents that include the
polymerase and the second nucleotide in the absence of said
non-immobilized primed template nucleic acid molecule of the second
reagent, nucleotide-independent polymerase binding to the primed
template nucleic acid molecule to form binary complexes is reduced.
Optionally, the non-immobilized primed template nucleic acid
molecules of the first and second reagents are different from each
other.
In another aspect, a reaction mixture is disclosed. The reaction
mixture includes: a plurality of immobilized nucleic acid features,
where each feature includes an immobilized primed template nucleic
acid; a polymerase; a non-immobilized primed template nucleic acid
molecule (i.e., free in solution); and a nucleotide. The nucleotide
is not the cognate nucleotide for the non-immobilized primed
template nucleic acid molecule. As well, nucleotide-independent
binding of the polymerase to the immobilized primed template
nucleic acid to form binary complexes is reduced by the presence of
the non-immobilized primed template nucleic acid molecule. In one
preferred embodiment, the polymerase, the immobilized primed
template nucleic acid, and the nucleotide form a stabilized ternary
complex that is inhibited or precluded from incorporating the
nucleotide into the immobilized primed template nucleic acid.
In yet another aspect, there is disclosed a polymerase delivery
reagent that includes: a polymerase; at least one non-immobilized
primed template nucleic acid molecule; and at least one nucleotide.
Here, none of the nucleotides is a next correct nucleotide for any
of the non-immobilized primed template nucleic acid molecules.
Optionally, the polymerase delivery reagent further includes a
ternary complex stabilizing agent that inhibits phosphodiester bond
formation by the solution-phase polymerase. Optionally, the at
least one nucleotide includes at least one native nucleotide.
Optionally, the solution-phase primed template nucleic acid
molecule includes no more than three different types of primed
template nucleic acid molecule, each with a different 3' terminal
nucleotide. For example, the polymerase optionally is a mutant
polymerase without catalytic phosphodiester bond forming activity
in the presence of Mg2+ ions.
Use of Polymerase Inhibitors to Stabilize Ternary Complexes
A ternary complex may be formed and/or stabilized by the addition
of a polymerase inhibitor to the examination reaction mixture.
Inhibitor molecules phosphonoacetate, (phosphonoacetic acid) and
phosphonoformate (phosphonoformic acid, common name Foscarnet),
Suramin, Aminoglycosides, INDOPY-1 and Tagetitoxin are non-limiting
examples of uncompetitive or noncompetitive inhibitors of
polymerase activity. The binding of the inhibitor molecule, near
the active site of the enzyme, traps the polymerase in either a
pre-translocation or post-translocation step of the nucleotide
incorporation cycle, stabilizing the polymerase in its ternary
complex conformation before or after the incorporation of a
nucleotide, and forcing the polymerase to be bound to the template
nucleic acid until the inhibitor molecules are not available in the
reaction mixture by removal, dilution or chelation.
Thus, provided is a method for sequencing a template nucleic acid
molecule including an examination step including providing a
template nucleic acid molecule primed with a primer; contacting the
primed template nucleic acid molecule with a first reaction mixture
comprising a polymerase, a polymerase inhibitor and at least one
unlabeled nucleotide molecule; monitoring the interaction of the
polymerase with the primed template nucleic acid molecule in the
presence of the unlabeled nucleotide molecule without incorporation
of the nucleotide into the primer of the primed template nucleic
acid molecule; and identifying the nucleotide that is complementary
to the next base of the primed template nucleic acid molecule by
the monitored interaction. The polymerase inhibitor prevents the
incorporation of the unlabeled nucleotide molecule into the primer
of the primer template nucleic acid. Optionally, the inhibitor is a
non-competitive inhibitor, an allosteric inhibitor, or an
uncompetitive allosteric inhibitor. Optionally, the polymerase
inhibitor competes with a catalytic ion binding site in the
polymerase.
Aminoglycosides non-competitively inhibit polymerase activity by
displacing magnesium binding sites in a Klenow polymerase. The
non-competitive nature of the interaction with respect to
nucleotide binding allows the polymerase to interact with the
template nucleic acid and nucleotide, affecting only the catalytic
step of nucleotide incorporation.
One inhibitor molecule is the drug Efavirenz, which acts as a
non-competitive inhibitor to the HIV-1 reverse transcriptase. The
drug has high affinity and a low off-rate for the closed-complex
configuration of the polymerase, such that, once the polymerase
incorporates the next correct nucleotide, the drug binds to the
polymerase, preventing the polymerase from opening its fingers to
allow for binding and/or incorporation of a subsequent nucleotide.
If the reaction occurs under conditions that favor ternary complex
formation over the formation of a binary complex, non-specific
polymerase-template nucleic acid interactions can be eliminated,
wherein, the binding of the polymerase signifies the added
nucleotide is complementary to the next base on the template. If
the reaction occurs under examination reaction conditions, the
high-affinity binding of the polymerase to the template nucleic
acid containing the next correct nucleotide can be used to
distinguish the ternary complex from random, non-specific
interaction of polymerase with the template nucleic acid.
Optionally, high-affinity polymerase binding indicates nucleotide
incorporation, and a separate incorporation step is not required.
Once the polymerase is bound, and the binding detected, the excess
nucleotides and polymerases may be removed or sequestered from the
reaction mixture. The next nucleotide may be added under
examination reaction conditions and the process repeated cyclically
for all nucleotide types, or in a random or predetermined order,
until sequencing of a desired read-length is complete.
Any polymerase may be chosen and a suitable non-competitive
inhibitor may be uncovered using a high-throughput screening (HTS)
process. Many examples of HTS processes for polymerase inhibitors
are found in the literature, wherein the specific screening
criteria is for non-competitive polymerase inhibitors. As a general
concept, these inhibitors can be screened to have a binding site
that is only exposed when the polymerase is in its closed
conformation, and they bind with high affinities and very low
off-rates, such that the binding of the inhibitor stabilizes the
polymerase in the closed conformation. Such an inhibitor allows
incorporation of a single base, after which the binding of the
inhibitor prevents the polymerase from opening up to receive
another nucleotide. The entire system can be washed away, including
the polymerase, before initiating the next step (examination or
incorporation) in the sequencing reaction.
Optionally, polymerase inhibitors found to be effective in
inhibiting a HIV-1 reverse transcriptase polymerase are employed to
stabilize a ternary complex. Optionally, the inhibitor is an
inhibitor of HIV-2 reverse transcriptase. HIV-1 reverse
transcriptase inhibitors include nucleoside/nucleotide reverse
transcriptase inhibitors (NRTI) and non-nucleoside reverse
transcriptase inhibitors (NNRTI). NRTIs include, but are not
limited to, COMBIVIR (lamivudine and zidovudine; GlaxoSmithKline,
Middlesex, UK), EMTRIVA (emtricitabine; Gilead Sciences, Foster
City, Calif.), EPIVIR (lamivudine; GlaxoSmithKline, Middlesex, UK),
EPZICOM (abacavir sulfate and lamivudine; GlaxoSmithKline,
Middlesex, UK), HIVID (zalcitabine; Hoffmann-La Roche, Nutley,
N.J.), RETROVIR (zidovudine; GlaxoSmithKline, Middlesex, UK),
TRIZIVIR (abacavir sulfate, zidovudine, lamivudine;
GlaxoSmithKline, Middlesex, UK), TRUVADA (emtricitabine/tenofovir
disoproxil fumarate; Gilead Sciences, Foster City, Calif.), VIDEX
EC (enteric coated didanosine; Bristol Myers-Squibb, New York,
N.Y.), VIDEX (didanosine; Bristol Myers-Squibb, New York, N.Y.),
VIREAD (tenofovir disoproxil fumarate; Gilead Sciences, Foster
City, Calif.), ZERIT (stavudine; Bristol Myers-Squibb, New York,
N.Y.), and ZIAGEN (abacavir sulfate; GlaxoSmithKline, Middlesex,
UK). Examples of NNRTI include, but are not limited to, VIRAMUNE
(nevirapine; Boehringer Ingelheim, Rhein, Germany), SUSTIVA
(efavirenz, Bristol Myers-Squibb, New York, N.Y.), DELAVIRDINE
(Rescriptor; Pfizer, New York, N.Y.), and INTELENCE (etravirine;
Tibotec Therapeutics, Eastgate Village, Ireland). Optionally,
NNRTIs are non-competitive polymerase inhibitors that bind to an
allosteric center located near the RNA polymerase active site on
subunit p66.
Optionally, an HIV-1 reverse transcriptase polymerase inhibitor is
a (4/6-halogen/MeO/EtO-substituted
benzo[d]thiazol-2-yl)thiazolidin-4-one. Table 1 includes a list of
19 (4/6-halogen/MeO/EtO-substituted
benzo[d]thiazol-2-yl)thiazolidin-4-ones inhibitors (adapted from E.
Pitta et. al., Synthesis and HIV-1 RT inhibitory action of novel
(4/6-substituted benzo[d]thiazol-2-yl)thiazolidin-4-ones.
Divergence from the non-competitive inhibition mechanism, Journal
of Enzyme Inhibition and Medicinal Chemistry, February 2013, Vol.
28, No. 1, Pages 113-122). The (4/6-halogen/MeO/EtO-substituted
benzo[d]thiazol-2-yl)thiazolidin-4-ones inhibitors have the
following formula:
##STR00001##
TABLE-US-00001 TABLE 1 (4/6-halogen/MeO/EtO-substituted
benzo[d]thiazol- 2-yl)thiazolidin-4-ones inhibitors NNRTI Inhibitor
R X.sub.1 X.sub.2 1 4-H, 6-H F F 2 4-H, 6-H F Cl 3 4-H, 6-Cl Cl Cl
4 4-H, 6-Cl F Cl 5 4-H, 6-Cl F F 6 4-H, 6-H Cl Cl 7 4-H, 6-H F Cl 8
4-H, 6-H F F 9 4-H, 6-F Cl Cl 10 4-H, 6-F F Cl 11 4-H, 6-F F F 12
4-H, 6-MeO Cl Cl 13 4-H, 6-MeO F Cl 14 4-H, 6-MeO F F 15 4-MeO, 6-H
Cl Cl 16 4-MeO, 6-H F Cl 17 4-H, 6-EtO Cl Cl 18 4-H, 6-EtO F Cl 19
4-H, 6-EtO F F
Any suitable combination of polymerase inhibitors and polymerase
mutants may be used so long as they trap/stabilize the ternary
complex and, optionally, prevent multiple nucleotide incorporations
per cycle.
The provided reaction mixtures can include from 100 nM to 1 mM of
the polymerase inhibitor, or any amount of inhibitor between 100 nM
and 1 mM. Optionally, the provided reaction mixtures can comprise
from 1 to 200 .mu.M of the polymerase inhibitor or any amount in
between. Optionally, the reaction mixtures include from 30 to 150
.mu.M of the polymerase inhibitor. Optionally, the reaction
mixtures include from 30 to 70 .mu.M of the polymerase inhibitor.
Optionally, the reaction mixtures include from 60 to 140 .mu.M of
the polymerase inhibitor.
Optionally, the polymerase of the ternary complex is prevented from
opening its finger domains and translocating to the next template
nucleic acid position by using pyrophosphate analogs or other
related molecules. Pyrophosphate analogs configure the polymerase
in ternary complex by occupying sites close to the triphosphate
binding site in the active pocket of the polymerase. Release of the
pyrophosphate (PPi) is critical for the polymerase to assume the
open conformation, translocate to the next template nucleic acid
position, and accept the next nucleotide. The non-competitive
inhibitor, such as Foscarnet (phosphonoformate), phosphonoacetate
or other pyrophosphate analogs, traps the polymerase in its
fingers-closed confirmation. Optionally, binding of the PPi analog
is reversible, with the polymerase activity fully restored by
washing away, diluting, or sequestering the inhibitor in the
reaction mixture. Broadly, any non-competitive inhibitor of
polymerase activity may be used during the sequencing reaction.
Optionally, a polymerase inhibitor which stabilizes a ternary
complex is combined with reaction conditions which usually release
the ternary complex, including, but not limited to, the presence of
a catalytic metal ion, such as magnesium or manganese. Optionally,
the ternary complex is stabilized even in the presence of a
catalytic metal ion. Optionally, the ternary complex is released
even in the presence of a polymerase inhibitor. Optionally, the
stabilization of the ternary complex is dependent, in part, on the
concentrations, the identity of the stabilization reagent, the
identity of release reagents, and any combination thereof.
Optionally, the stabilization of a ternary complex using polymerase
inhibitors is combined with additional reaction conditions which
also function to stabilize a ternary complex, including, but not
limited to, sequestering, removing, reducing, omitting, and/or
chelating a catalytic metal ion; the presence of a modified
polymerase in the ternary complex; a non-incorporable nucleotide in
the ternary complex; and any combination thereof.
Conditions for Forming and Manipulating Ternary Complexes
As used herein, a ternary complex includes a polymerase, a primed
template nucleic acid, and a nucleotide. The ternary complex may be
in a pre-chemistry conformation, wherein a nucleotide is
sequestered but not incorporated. Optionally, the ternary complex
may be stabilized by the presence of a chemical block on the 3'
nucleotide of the primer of the primed template nucleic acid
molecule (e.g., a reversible terminator moiety on the base or sugar
of the nucleotide). The ternary complex may be in a
pre-translocation conformation, wherein a nucleotide is
incorporated by formation of a phosphodiester bond with the 3'-end
of the primer in the primed template nucleic acid. The ternary
complex may be formed in the absence of catalytic metal ions, or
under deficient levels of catalytic metal ions, thereby physically
sequestering the next correct nucleotide within the polymerase
active site without chemical incorporation. Optionally, the
sequestered nucleotide may be a non-incorporable nucleotide. The
ternary complex may be formed in the presence of catalytic metal
ions, where the ternary complex comprises a nucleotide analog which
is incorporated, but a PPi is not capable of release. In this
instance, the ternary complex is stabilized in a pre-translocation
conformation. Optionally, a pre-translocation conformation is
stabilized by chemically cross-linking the polymerase. Optionally,
the ternary complex may be stabilized by external means. In some
instances, the ternary complex may be stabilized by allosteric
binding of small molecules. Optionally, ternary complex may be
stabilized by pyrophosphate analogs, including, but not limited to,
phosphonoformates, that bind close to the active site with high
affinity, preventing translocation of the polymerase.
As used herein, a stabilized ternary complex refers to a polymerase
trapped at the polymerization initiation site (3'-end of the
primer) of the primed template nucleic acid by one or a
combinations of means, including but not limited to, crosslinking
the thumb and finger domains in the closed conformation, binding of
an allosteric inhibitor that prevents return of the polymerase to
an open conformation, binding of pyrophosphate analogs that trap
polymerase in the pre-translocation step, absence of catalytic
metal ions in the active site of the polymerase, and addition of a
non-catalytic metal ion such as nickel, barium, tin and strontium
as substitutes for a catalytic metal ion. As such, the polymerase
may be trapped at the polymerization initiation site even after the
incorporation of a nucleotide. Therefore, the polymerase may be
trapped in the pre-chemistry conformation, pre-translocation step,
post-translocation step, or any intermediate step thereof, thereby
allowing for sufficient examination and identification of the next
correct nucleotide or base.
As described herein, a polymerase-based, sequencing-by-binding
reaction generally involves providing a primed template nucleic
acid, providing the primed template nucleic acid with a polymerase
and one or more types of nucleotides, wherein the nucleotides may
or may not be complementary to the next base of the primed template
nucleic acid, and examining the interaction of the polymerase with
the primed template nucleic acid under conditions wherein either
chemical incorporation of a nucleotide to the primed template
nucleic acid is disabled or severely inhibited in the pre-chemistry
conformation or one or more complementary nucleotide incorporation
occurs at the 3'-end of the primer. Optionally, when the
pre-chemistry conformation is stabilized prior to nucleotide
incorporation, preferably using stabilizers or a 3' reversibly
terminated primer, a separate incorporation step may follow the
examination step to incorporate a single nucleotide at the 3'-end
of the primer. Optionally, where a single nucleotide incorporation
occurs, the pre-translocation conformation may be stabilized to
facilitate examination and/or prevent subsequent nucleotide
incorporation.
While single template nucleic acid molecules may be described for
ease of exposition, the sequencing methods provided herein readily
encompass a plurality of template nucleic acids, wherein the
plurality of nucleic acids may be clonally amplified copies of a
single nucleic acid, or disparate nucleic acids, including
combinations, such as populations of disparate nucleic acids that
are clonally amplified.
Optionally, the ternary complex is transiently formed during the
examination step of the sequencing methods provided herein.
Optionally, the ternary complex is stabilized during the
examination step. The stabilized ternary complex may not allow for
the incorporation of a nucleotide in a polymerization reaction
during the examination step, this includes incorporation of the
enclosed nucleotide and/or incorporation of a subsequent nucleotide
after the enclosed nucleotide. Reaction conditions that modulate
the stability of a ternary complex include, but are not limited to,
the availability of catalytic metal ions, suboptimal or inhibitory
metal ions, ionic strength, pH, temperature, polymerase inhibitors,
cross-linking reagents, and any combination thereof. Reaction
reagents modulate the stability of a ternary complex include, but
are not limited to, non-incorporable nucleotides, incorrect
nucleotides, nucleotide analogs, modified polymerases, template
nucleic acids with non-extendible polymerization initiation sites,
and any combination thereof.
Optionally, a ternary complex is released from its trapped or
stabilized conformation, which may allow for nucleotide
incorporation at the 3'-end of the primer in the primer-template
nucleic acid duplex. The ternary complex can be destabilized and/or
released by modulating the reaction conditions. In addition, the
ternary complex can be destabilized by electrical, magnetic, and/or
mechanical means. Mechanical means include mechanical agitation,
for example, by using ultrasound agitation. Mechanical vibration
destabilizes the closed-complex and suppresses binding of the
polymerase to the DNA. Thus, rather than a wash step where the
examination reaction mixture is replaced with an incorporation
mixture, mechanical agitation may be used to remove the polymerase
from the template nucleic acid, enabling cycling through successive
incorporation steps with a single nucleotide addition per step.
Any combination of ternary complex stabilization or ternary complex
release reaction conditions and/or methods may be combined. For
example, a polymerase inhibitor which stabilizes a ternary complex
may be present in the examination reaction with a catalytic ion,
which functions to release the ternary complex. In the
aforementioned example, the closed-complex may be stabilized or
released, depending on the polymerase inhibitor properties and
concentration, the concentration of the catalytic metal ion, other
reagents and/or conditions of the reaction mixture, and any
combination thereof.
The ternary complex can be stabilized under reaction conditions
where covalent attachment of a nucleotide to the 3'-end of the
primer in the primed template nucleic acid is attenuated.
Optionally, the ternary complex is in a pre-chemistry conformation.
Optionally, the ternary complex is in a pre-translocation
conformation. The formation of this ternary complex can be
initiated and/or stabilized by modulating the availability of a
catalytic metal ion that permits ternary complex release and/or
chemical incorporation of a nucleotide to the primer in the
reaction mixture. Exemplary metal ions include, but are not limited
to, magnesium, manganese, cobalt, and barium. Catalytic ions (e.g.,
divalent catalytic metal ions) may arise from any formulation, for
example, salts such as MgCl2, Mg (C2H3O2)2, and MnCl2.
The selection and/or concentration of the catalytic metal ion may
be based on the polymerase and/or nucleotides in the sequencing
reaction. For example, the HIV reverse transcriptase utilizes
magnesium for nucleotide incorporation (N Kaushik 1996 Biochemistry
35:11536-11546, and H P Patel 1995 Biochemistry 34:5351-5363, which
are incorporated by reference herein in their entireties). The rate
of ternary complex formation using magnesium versus manganese can
be different depending on the polymerase and the identity of the
nucleotide. Thus, the stability of the closed-complex may differ
depending on catalytic metal ion, polymerase, and/or nucleotide
identity. Further, the concentration of catalytic ion necessary for
ternary complex stabilization may vary depending on the catalytic
metal ion, polymerase, and/or nucleotide identity and can be
readily determined using the guidance provided herein. For example,
nucleotide incorporation may occur at high catalytic ion
concentrations of one metal ion but does not occur at low
concentrations of the same metal ion, or vice versa. Therefore,
modifying metal ion identity, metal ion concentration, polymerase
identity, and/or nucleotide identity allows for controlled
examination reaction conditions.
The ternary complex may be formed and/or stabilized by
sequestering, removing, reducing, omitting, and/or chelating a
catalytic metal ion during the examination step of the sequencing
reaction so that ternary complex release and/or chemical
incorporation does not occur. Chelation includes any procedure that
renders the catalytic metal ion unavailable for nucleotide
incorporation, including using EDTA and/or EGTA. A reduction
includes diluting the concentration of a catalytic metal ion in the
reaction mixture.
The reaction mixture used in the examination step can be diluted or
replaced with a solution comprising a non-catalytic ion, which
permits ternary complex formation, but inhibits nucleotide
incorporation. Optionally, a non-catalytic metal ion and a
catalytic metal ion are both present in the reaction mixture,
wherein one ion is present in a higher effective concentration than
the other. In the provided methods, a non-catalytic ion such as
cobalt can become catalytic, i.e., facilitate nucleotide
incorporation at high concentrations.
Non-catalytic ions may be added to, or included in, a reaction
mixture used under examination conditions. The reaction may already
include nucleotides. Optionally, non-catalytic ions are complexed
to one or more nucleotides and complexed nucleotides are added to
the reaction mixture. Non-catalytic ions can complex to nucleotides
by mixing nucleotides with non-catalytic ions at elevated
temperatures (about 80.degree. C.). For example, a chromium
nucleotide complex may be added to a mixture to facilitate ternary
complex formation and stabilization. Optionally, a chromium
nucleotide complex is a chromium monodentate, bidentate, or
tridentate complex. Optionally, a chromium nucleotide complex is an
.alpha.-monodentate, or .beta.-.gamma.-bidentate nucleotide.
Optionally, a ternary complex is formed between a polymerase,
primed template nucleic acid, and nucleotide in reaction conditions
comprising Sr2+ wherein Sr2+ induces the formation of the ternary
complex. The presence of Sr2+ can allow for the favorable formation
of a ternary complex comprising a next correct nucleotide over the
formation a complex comprising an incorrect nucleotide. Sr2+ may be
present at concentrations from about 0.01 mM to about 30 mM.
Optionally, Sr2+ is present as 10 mM SrCl2. The formation of the
ternary complex is monitored under examination conditions to
identify the next base in the template nucleic acid of the ternary
complex. The affinity of the polymerase (e.g., Klenow fragment of
E. coli DNA polymerase I, Bst) for each dNTPs (e.g., dATP, dTTP,
dCTP, dGTP) in the presence of Sr2+ can be different. Therefore,
examination can involve measuring the binding affinities of
polymerase-template nucleic acids to dNTPs; wherein binding
affinity is indicative of the next base in the template nucleic
acid. Optionally, the binding interaction may be performed under
conditions that destabilize the binary interactions between the
polymerase and primed template nucleic acid. Optionally, the
binding interaction may be performed under conditions that
stabilize the ternary interactions between the polymerase, the
primed template nucleic acid, and the next correct nucleotide.
Optionally, after examination, a wash step removes unbound
nucleotides, and Mg2+ is added to the reaction to induce nucleotide
incorporation and pyrophosphate (PPi) release. Optionally, the wash
step comprises Sr2+ to maintain the stability of the ternary
complex, preventing the dissociation of the ternary complex. The
reaction may be repeated until a desired sequence read-length is
obtained.
Optionally, a ternary complex is formed between a polymerase,
primed template nucleic acid, and nucleotide in reaction conditions
comprising Ni2+ wherein Ni2+ induces the formation of the ternary
complex. The presence of Ni2+ can allow for the favorable formation
of a ternary complex comprising a next correct nucleotide over the
formation a complex comprising an incorrect nucleotide. Ni2+ may be
present at concentrations from about 0.01 mM to about 30 mM.
Optionally, Ni2+ is present as 10 mM NiCl2. The formation of the
ternary complex is monitored under examination conditions to
identify the next base in the template nucleic acid of the ternary
complex. The affinity of the polymerase (e.g., Klenow fragment of
E. coli DNA polymerase I, Bst) for each dNTPs (e.g., dATP, dTTP,
dCTP, dGTP) in the presence of Sr2+ can be different. Therefore,
examination can involve measuring the binding affinities of
polymerase-template nucleic acids to dNTPs; wherein binding
affinity is indicative of the next base in the template nucleic
acid. Optionally, the binding interaction may be performed under
conditions that destabilize the binary interactions between the
polymerase and primed template nucleic acid. Optionally, the
binding interaction may be performed under conditions that
stabilizes the ternary interactions between the polymerase, the
primed template nucleic acid, and the next correct nucleotide.
Optionally, after examination, a wash removes unbound nucleotides
and polymerase, and Mg2+ is added to the reaction to induce
nucleotide incorporation and pyrophosphate release. Optionally, the
wash buffer comprises Ni2+ to maintain the stability of the ternary
complex, preventing the dissociation of the ternary complex. The
reaction may be repeated until a desired sequence read-length is
obtained.
Optionally, a ternary complex is formed between a polymerase,
primed template nucleic acid, and nucleotide in reaction conditions
comprising non-catalytic concentrations of Co2+ wherein Co2+
induces the formation of the ternary complex. The presence of
non-catalytic concentrations of Co2+ can allow for the favorable
formation of a ternary complex comprising a next correct nucleotide
over the formation a complex comprising an incorrect nucleotide.
Co2+ may be present at concentrations from about 0.01 mM to about
0.5 mM. Optionally, Co2+ is present as 0.5 mM CoCl2. The formation
of the ternary complex is monitored under examination conditions to
identify the next base in the template nucleic acid of the ternary
complex. The affinity of the polymerase (e.g., Klenow fragment of
E. coli DNA polymerase I, Bst) for each dNTPs (e.g., dATP, dTTP,
dCTP, dGTP) in the presence of Co2+ can be different. Therefore,
examination can involve measuring the binding affinities of
polymerase-template nucleic acids to dNTPs; wherein binding
affinity is indicative of the next base in the template nucleic
acid. Optionally, the binding interaction may be performed under
conditions that destabilize the binary interactions between the
polymerase and primed template nucleic acid. Optionally, the
binding interaction may be performed under conditions that
stabilizes the ternary interactions between the polymerase, the
primed template nucleic acid, and the next correct nucleotide.
After examination, a wash removes unbound nucleotides and
polymerase, and Co2+ at a catalytic concentration is added to the
reaction to induce nucleotide incorporation and pyrophosphate
release. Optionally, the wash buffer comprises non-catalytic
amounts of Co2+ to maintain the stability of the ternary complex,
preventing the dissociation of the ternary complex. The reaction
may be repeated until a desired sequence read-length is
obtained.
Optionally, a catalytic metal ion (e.g., a divalent catalytic metal
ion) may facilitate the formation of a closed-complex without
subsequent nucleotide incorporation and ternary complex release.
Optionally, a concentration of 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, or
10 .mu.M Mg2+ in a reaction mixture can induce conformational
change of a polymerase to form a ternary complex without subsequent
nucleotide incorporation, PPi and ternary complex release.
Optionally, the concentration of Mg2+ is from about 0.5 .mu.M to
about 10 .mu.M, from about 0.5 .mu.M to about 5 .mu.M, from about
0.5 .mu.M to about 4 .mu.M, from about 0.5 .mu.M to about 3 .mu.M,
from about M to about 5 M, from about 1 .mu.M to about 4 .mu.M, and
from about 1 .mu.M to about 3 M.
Optionally, the concentration of catalytic metal ion (e.g., a
divalent catalytic metal ion) in the sequencing reaction which is
necessary to allow nucleotide incorporation is from about 0.001 mM
to about 10 mM, from about 0.01 mM to about 5 mM, from about 0.01
mM to about 3 mM, from about 0.01 to about 2 mM, from about 0.01 mM
to about 1 mM, from about 0.05 to about 10 mM, from about 0.05 mM
to about 5 mM, from about 0.05 mM to about 3 mM, from about 0.05 to
about 2 mM, or from about 0.05 mM to about 1 mM. Optionally, the
concentration of catalytic metal ion is from 5 to 50 mM.
Optionally, the concentration of catalytic metal ion is from 5 to
15 mM, or about 10 mM.
A non-catalytic ion (e.g., a divalent non-catalytic metal ion) may
be added to the reaction mixture at any stage including before,
during, or after any of the following reaction steps: providing a
primed template nucleic acid, providing a polymerase, formation of
a binary complex, providing a nucleotide, formation of a
pre-chemistry ternary complex, nucleotide incorporation, formation
of a pre-translocation ternary complex, and formation of a
post-translocation conformation. The non-catalytic ion may be added
to the reaction mixture during wash steps. The non-catalytic ion
may be present through the reaction in the reaction mixture. For
example, a catalytic ion is added to the reaction mixture at
concentrations which dilute the non-catalytic metal ion, allowing
for nucleotide incorporation.
The ability of catalytic and non-catalytic ions to modulate
nucleotide incorporation may depend on conditions in the reaction
mixture including, but not limited to, pH, ionic strength,
chelating agents, chemical cross-linking, modified polymerases,
non-incorporable nucleotides, mechanical or vibration energy, and
electric fields.
Optionally, the concentration of non-catalytic metal ion (e.g., a
divalent non-catalytic metal ion) in the sequencing reaction
necessary to allow for ternary complex formation without nucleotide
incorporation is from about 0.1 mM to about 50 mM, from about 0.1
mM to about 40 mM, from about 0.1 mM to about 30 mM, from about 0.1
mM to about 20 mM, from about 0.1 mM to about 10 mM, from about 0.1
mM to about 5 mM, from about 0.1 to about 1 mM, from about 1 mM to
about 50 mM, from about 1 to about 40 mM, from about 1 mM to about
30 mM, from about 1 mM to about 20 mM, from about 1 mM to about 10
mM, from about 1 mM to about 5 mM, from about 2 mM to about 30 mM,
from about 2 mM to about 20 mM, from about 2 mM to about 10 mM, or
any concentration within these ranges. Non-catalytic ions useful in
this regard include, but are not limited to: calcium, strontium,
scandium, titanium, vanadium, chromium, iron, cobalt, nickel,
copper, zinc, gallium, germanium, arsenic, selenium, rhodium,
europium, and terbium ions. Optionally, Ni2+ is provided in an
examination reaction to facilitate ternary complex formation.
Optionally, Sr2+ is provided in an examination reaction to
facilitate ternary complex formation. In certain embodiments, one
or more non-catalytic ions may be included at an above-indicated
concentration, while other non-catalytic ions are excluded from the
reaction mixture during the examination step. For example, nickel
or strontium may be included, while calcium is excluded.
Detection Platforms: Instrumentation for Detecting the Ternary
Complex
Interaction between the polymerase and the template nucleic acid in
the presence of nucleotides can be monitored with or without the
use of a tagged label. For example, the sequencing reaction may be
monitored by detecting the change in refractive index, charge
detection, Raman scattering detection, ellipsometry detection, pH
detection, size detection, mass detection, surface plasmon
resonance, guided mode resonance, nanopore optical interferometry,
whispering gallery mode resonance, nanoparticle scattering,
photonic crystal, quartz crystal microbalance, bio-layer
interferometry, vibrational detection, pressure detection and other
label free detection schemes that detect the added mass or
refractive index due to polymerase binding in a ternary complex
with a template nucleic acid.
Optionally, a Raman signature of a polymerase is exploited to
detect polymerase conformational changes that occur during one or
more steps of a sequencing method disclosed herein, for example
ternary complex formation or release. Optionally, during one or
more steps of a nucleic acid sequencing method described herein,
light is directed to the sequencing reaction mixture in the
visible, near infrared, or near ultraviolet range. The light
interacts with molecular vibrations or other excitations in the
reaction, resulting in the energy of the light being shifted. The
shift in energy provides information about the vibrational modes of
the reaction and therefore provides information on the
configurations of reaction components (e.g., polymerase). The
sequencing methods of this disclosure may be detected with surface
enhanced Raman, resonance Raman, tip-enhanced Raman, polarized
Raman, stimulated Raman, transmission Raman, spatially offset
Raman, and hyper Raman spectroscopy.
Optionally, detecting a change in refractive index is accomplished
in one or a combination of means, including, but not limited to,
surface plasmon resonance sensing, localized plasmon resonance
sensing, plasmon-photon coupling sensing, transmission sensing
through sub-wavelength nanoholes (enhanced optical transmission),
photonic crystal sensing, interferometry sensing, refraction
sensing, guided mode resonance sensing, ring resonator sensing, or
ellipsometry sensing. Optionally, nucleic acid molecules may be
localized to a surface, wherein the interaction of polymerase with
nucleic acids in the presence of various nucleotides may be
measured as a change in the local refractive index.
Optionally, the template nucleic acid is tethered to or localized
appropriately on or near a surface, such that the interaction of
polymerase and template nucleic acid in the presence of nucleotides
changes the light transmitted across or reflected from the surface.
The surface may contain nanostructures. Optionally, the surface is
capable of sustaining plasmons or plasmon resonance. Optionally,
the surface is a photonic substrate, not limited to a resonant
cavity, resonant ring or photonic crystal slab. Optionally, the
surface is a guided mode resonance sensor. Optionally, the nucleic
acid is tethered to, or localized appropriately on or near a
nanohole array, a nanoparticle or a microparticle, such that the
interaction of polymerase and template nucleic acid in the presence
of nucleotides changes the absorbance, scattering, reflection or
resonance of the light interacting with the microparticle or
nanoparticle.
Optionally, a nanohole array on a gold surface is used as a
refractive index sensor. The template nucleic acid may be attached
to a metal surface by standard thiol chemistry, incorporating the
thiol group on one of the primers used in a PCR reaction to amplify
the DNA. When the dimensions of the nanohole array are
appropriately tuned to the incident light, binding of the
polymerase to the template nucleic acid in the presence of
nucleotides can be monitored as a change in light transmitted
across the nanoholes. For both the labeled and label-free schemes,
simple and straightforward measurement of equilibrium signal
intensity may reveal the formation of a stable closed-complex.
Optionally, nucleic acid molecules are localized to a surface
capable of sustaining surface plasmons, wherein the change in
refractive index caused by the polymerase interaction with
localized nucleic acids may be monitored through the change in the
properties of the surface plasmons, wherein further, said
properties of surface plasmons may include surface plasmon
resonance. Surface plasmons, localized surface plasmons (LSP), or
surface plasmon polaritons (SPP), arise from the coupling of
electromagnetic waves to plasma oscillations of surface charges.
LSPs are confined to nanoparticle surfaces, while SPPs and are
confined to high electron density surfaces, at the interface
between high electron mobility surfaces and dielectric media.
Surface plasmons may propagate along the direction of the
interface, whereas they penetrate into the dielectric medium only
in an evanescent fashion. Surface plasmon resonance conditions are
established when the frequency of incident electromagnetic
radiation matches the natural frequency of oscillation of the
surface electrons. Changes in dielectric properties at the
interface, for instance due to binding or molecular crowding,
affects the oscillation of surface electrons, thereby altering the
surface plasmon resonance wavelength. Surfaces capable of surface
plasmon resonance include, in a non-limiting manner, nanoparticles,
clusters and aggregates of nanoparticles, continuous planar
surfaces, nanostructured surfaces, and microstructured surfaces.
Materials such as gold, silver, aluminum, high conductivity metal
oxides (e.g., indium tin oxide, zinc oxide, tungsten oxide) are
capable of supporting surface plasmon resonance at their
surfaces.
Optionally, a single nucleic acid molecule, or multiple clonal
copies of a nucleic acid, are attached to a nanoparticle, such that
binding of polymerase to the nucleic acid causes a shift in the
localized surface plasmon resonance (LSPR). Light incident on the
nanoparticles induces the conduction electrons in them to oscillate
collectively with a resonant frequency that depends on the
nanoparticles' size, shape and composition. Nanoparticles of
interest may assume different shapes, including spherical
nanoparticles, nanorods, nanopyramids, nanodiamonds, and nanodiscs.
As a result of these LSPR modes, the nanoparticles absorb and
scatter light so intensely that single nanoparticles are easily
observed by eye using dark-field (optical scattering) microscopy.
For example, a single 80-nm silver nanosphere scatters 445-nm blue
light with a scattering cross-section of (3.times.10-2) m2, a
million fold greater than the fluorescence cross-section of a
fluorescein molecule, and a thousand fold greater than the
cross-section of a similarly sized nanosphere filled with
fluorescein to the self-quenching limit. Optionally, the
nanoparticles are plasmon-resonant particles configured as
ultra-bright, nanosized optical scatters with a scattering peak
anywhere in the visible spectrum. Plasmon-resonant particles are
advantageous as they do not bleach. Optionally, plasmon-resonant
particles are prepared, coated with template nucleic acids, and
provided in a reaction mixture comprising a polymerase and one or
more nucleotides, wherein a polymerase-template nucleic
acid-particle interaction is detected. One or more of the
aforementioned steps may be based on or derived from one or more
methods disclosed in Sheldon Schultz et al., "Single-Target
Molecule Detection with Nonbleaching Multicolor Optical
Immunolabels," Proceedings of the National Academy of Sciences 97,
no. 3 (Feb. 1, 2000): 996-1001, which is incorporated by reference
herein in its entirety.
The very large extinction coefficients at resonant wavelength
enables noble-metal nanoparticles to serve as extremely intense
labels for near-surface interactions. Optionally, polymerase
interaction with nanoparticle-localized DNA results in a shift in
the resonant wavelength. The change in resonant wavelength due to
binding or binding interactions can be measured in one of many
ways. Optionally, the illumination is scanned through a range of
wavelengths to identify the wavelength at which maximum scattering
is observed at an imaging device. Optionally, broadband
illumination is utilized in conjunction with a dispersive element
near the imaging device, such that the resonant peak is identified
spectroscopically. Optionally, the nanoparticle system may be
illuminated at its resonant wavelength, or near its resonant
wavelength, and any binding interactions may be observed as a drop
in intensity of light scattered as the new resonant wavelength
shifts away from the illumination wavelength. Depending on the
positioning of the illuminating wavelength, interactions may even
appear as an increase in nanoparticle scattering as the resonance
peak shifts towards the illumination wavelength. Optionally,
DNA-attached-nanoparticles may be localized to a surface, or,
alternatively, the DNA-attached-nanoparticles may be suspended in
solution. A comprehensive review of biosensing using nanoparticles
is described in Jeffrey N. Anker et al., "Biosensing with Plasmonic
Nanosensors," Nature Materials 7, no. 6 (June 2008): 442-53, which
is incorporated in its entirety herein by reference.
Optionally, nano-features capable of LSPR are lithographically
patterned on a planar substrate. The two dimensional patterning of
nano-features has advantages in multiplexing and high-throughput
analysis of a large number of different nucleic acid molecules.
Optionally, gold nanoposts are substrates for surface plasmon
resonance imaging detection of polymerase-template nucleic acid
interactions, wherein the nucleic acids are attached to the
nanoposts. Nanostructure size and period can influence surface
plasmon resonance signal enhancement, optionally, providing a 2, 3,
4, 5, 6, 7, 8-fold or higher signal amplification when compared to
control films.
Optionally, surface plasmon resonance may be sustained in planar
surfaces. A number of commercial instruments based on the
Kretschmann configuration (e.g., Biacore, Uppsala, Sweden) and
surface plasmon resonance imaging (e.g., GWC Technologies, Madison,
Wis., or Horiba, Kyoto, Japan) are readily available in the market,
and have well established protocols to attach DNA to their surface,
both in a single spot and in multiplexed array patterns. In the
Kretschmann configuration, a metal film, typically gold is
evaporated onto the side of a prism and incident radiation is
launched at an angle to excite the surface plasmons. An evanescent
wave penetrates through the metal film exciting plasmons on the
other side, where it may be used to monitor near-surface and
surface interactions near the gold film. At the resonant angle, the
light reflected from the prism-gold interface is severely
attenuated. Assuming fixed wavelength illumination, binding
interactions may be examined by monitoring both the intensity of
the reflected light at a fixed angle close to the resonant angle,
as well as by monitoring the changes in angle of incidence required
to establish surface plasmon resonance conditions (minimum
reflectivity). When a 2D imaging device such as a CCD or CMOS
camera is utilized to monitor the reflected light, the entire
illumination area may be imaged with high resolution. This method
is called surface plasmon resonance imaging (SPRi). It allows high
throughput analysis of independent regions on the surface
simultaneously. Broadband illumination may also be used, in a fixed
angle configuration, wherein the wavelength that is coupled to the
surface plasmon resonance is identified spectroscopically by
looking for dips in the reflected spectrum. Surface interactions
are monitored through shifts in the resonant wavelength.
Surface plasmon resonance is well established for monitoring
protein-nucleic acid interactions, and there exist many standard
protocols both for nucleic acid attachment as well for analyzing
the data. Illustrative references from literature include Bongsup
Cho et al., "Binding Kinetics of DNA-Protein Interaction Using
Surface Plasmon Resonance," Protocol Exchange, May 22, 2013, and,
Jennifer M. Brockman, Anthony G. Frutos, and Robert M. Corn, "A
Multistep Chemical Modification Procedure To Create DNA Arrays on
Gold Surfaces for the Study of Protein-DNA Interactions with
Surface Plasmon Resonance Imaging," Journal of the American
Chemical Society 121, no. 35 (Sep. 1, 1999): 8044-51, both of which
are included herein in their entireties by reference.
Polymerase/nucleic-acid interactions may be monitored on
nanostructured surfaces capable of sustaining localized surface
plasmons. Optionally, polymerase/nucleic-acid interactions may be
monitored on nanostructured surfaces capable of sustaining surface
plasmon polaritons.
Optionally, polymerase/nucleic-acid interactions may be monitored
on nanostructured surfaces capable of sustaining localized surface
plasmons. Optionally, polymerase/nucleic-acid interactions may be
monitored on nanostructured surfaces capable of sustaining surface
plasmon polaritons.
Optionally, extraordinary optical transmission (EOT) through a
nanoholes array may be used to monitor nucleic-acid/polymerase
interactions. Light transmitted across subwavelength nanoholes in
plasmonic metal films is higher than expected from classical
electromagnetic theory. This enhanced optical transmission may be
explained by considering plasmonic resonant coupling to the
incident radiation, whereby at resonant wavelength, a larger than
anticipated fraction of light is transmitted across the metallic
nanoholes. The enhanced optical transmission is dependent on the
dimensions and pitch of the nanoholes, properties of the metal, as
well as the dielectric properties of the medium on either side of
the metal film bearing the nanoholes. In the context of a
biosensor, the transmissivity of the metallic nanohole array
depends on the refractive index of the medium contacting the metal
film, whereby, for instance, the interaction of polymerase with
nucleic acid attached to the metal surface may be monitored as a
change in intensity of light transmitted across the nanoholes
array. The elegance of the EOT/plasmonic nanohole array approach is
that the instrumentation and alignment requirements of surface
plasmon resonance may be replaced by very compact optics and
imaging elements. For instance, just a low power LED illumination
and inexpensive CMOS or CCD camera may suffice to implement robust
EOT plasmonic sensors. An exemplary nanohole array-based surface
plasmon resonance sensing device is described in C. Escobedo et
al., "Integrated Nanohole Array Surface Plasmon Resonance Sensing
Device Using a Dual-Wavelength Source," Journal of Micromechanics
and Microengineering 21, no. 11 (Nov. 1, 2011): 115001, which is
herein incorporated by reference in its entirety.
The plasmonic nanohole array may be patterned on an optically
opaque layer of gold (greater than 50 nm thickness) deposited on a
glass surface. Optionally, the plasmonic nanohole array may be
patterned on an optically thick film of aluminum or silver
deposited on glass. Optionally, the nanohole array is patterned on
an optically thick metal layer deposited on low refractive index
plastic. Patterning plasmonic nanohole arrays on low refractive
index plastics enhances the sensitivity of the device to refractive
index changes by better matching the refractive indices on the two
sides of the metal layer. Optionally, refractive index sensitivity
of the nanohole array is increased by increasing the distance
between holes. Optionally, nanohole arrays are fabricated by
replication, for example, by embossing, casting,
imprint-lithography, or template-stripping. Optionally, nanohole
arrays are fabricated by self-assembly using colloids. Optionally,
nanohole arrays are fabricated by projection direct patterning,
such as laser interference lithography.
A nano-bucket configuration may be preferable to a nanohole
configuration. In the nanohole configuration, the bottom of the
nano-feature is glass or plastic or other appropriate dielectric,
whereas in the nano-bucket configuration, the bottom of the
nano-feature comprises a plasmonic metal. The nanobucket array
configuration may be easier to fabricate in a mass production
manner, while maintaining the transmission sensitivity to local
refractive index.
Optionally, the nanohole array plasmonic sensing is combined with
lens-free holographic imaging for large area imaging in an
inexpensive manner. Optionally, a plasmonic biosensing platform
comprises a plasmonic chip comprising nanohole arrays, a
light-emitting diode source configured to illuminate the chip, and
a CMOS imager chip to record diffraction patterns of the nanoholes,
which is modulated by molecular binding events on the surface. The
binding events may be the formation of a ternary complex between a
polymerase and a template nucleic acid in the presence of a
nucleotide.
The methods to functionalize surfaces (for nucleic acid attachment)
for surface plasmon resonance sensing may be directly applied to
EOT nanohole arrays as both sensing schemes employ similar metal
surfaces to which nucleic acids need to be attached.
Optionally, the refractive index changes associated with
polymerase/nucleic acid interaction may be monitored on
nanostructured surfaces that do not support plasmons. Optionally,
guided mode resonance may be used to monitor the
polymerase/nucleic-acid interaction. Guided-mode resonance or
waveguide-mode resonance is a phenomenon wherein the guided modes
of an optical waveguide can be excited and simultaneously extracted
by the introduction of a phase-matching element, such as a
diffraction grating or prism. Such guided modes are also called
"leaky modes," as they do not remain guided and have been observed
in one and two-dimensional photonic crystal slabs. Guided mode
resonance may be considered a coupling of a diffracted mode to a
waveguide mode of two optical structured placed adjacent or on top
of each other. For instance, for a diffraction grating placed on
top of an optical waveguide, one of the diffracted modes may couple
exactly into the guided mode of the optical waveguide, resulting in
propagation of that mode along the waveguide. For off-resonance
conditions, no light is coupled into the waveguide, so the
structure may appear completely transparent (if dielectric
waveguides are used). At resonance, the resonant wavelength is
strongly coupled into the waveguide, and may be coupled out of the
structure depending on downstream elements from the
grating-waveguide interface. In cases where the grating coupler is
extended over the entire surface of the waveguide, the light cannot
be guided, as any light coupled in is coupled out at the next
grating element. Therefore, in a grating waveguide structure,
resonance is observed as a strong reflection peak, whereas the
structure is transparent to off-resonance conditions. The resonance
conditions are dependent on angle, grating properties, polarization
and wavelength of incident light. For cases where the guided mode
propagation is not present, for instance due to a grating coupled
to the entire surface of the waveguide, the resonant mode may also
be called leaky-mode resonance, in light of the strong optical
confinement and evanescent propagation of radiation in a transverse
direction from the waveguide layer. Change in dielectric properties
near the grating, for instance due to binding of biomolecules
affects the coupling into the waveguide, thereby altering the
resonant conditions. Optionally, where nucleic acid molecules are
attached to the surface of grating waveguide structures, the
polymerase/nucleic-acid interaction may be monitored as a change in
wavelength of the leaky mode resonance.
A diffraction element may be used directly on a transparent
substrate without an explicit need for a waveguide element. The
change in resonance conditions due to interactions near the grating
nanostructure may be monitored as resonant wavelength shifts in the
reflected or transmitted radiation.
Reflected light from a nucleic acid attached guided mode resonant
sensor may be used to monitor the polymerase/nucleic-acid
interaction. A broadband illumination source may be employed for
illumination, and a spectroscopic examination of reflected light
could reveal changes in local refractive index due to polymerase
binding.
Optionally, a broadband illumination may be used and the
transmitted light may be examined to identify resonant shifts due
to polymerase interaction. A linearly polarized narrow band
illumination may be used, and the transmitted light may be filtered
through a cross-polarizer; wherein the transmitted light is
completely attenuated due to the crossed polarizers excepting for
the leaky mode response whose polarization is modified. This
implementation converts refractive index monitoring to a simple
transmission assay that may be monitored on inexpensive imaging
systems. Published material describe the assembly of the optical
components. See, Yousef Nazirizadeh et al., "Low-Cost Label-Free
Biosensors Using Photonic Crystals Embedded between Crossed
Polarizers," Optics Express 18, no. 18 (Aug. 30, 2010): 19120-28,
which is incorporated herein by reference in its entirety.
In addition to nanostructured surfaces, plain, unstructured
surfaces may also be used advantageously for monitoring refractive
index modulations. Optionally, interferometry may be employed to
monitor the interaction of polymerase with nucleic acid bound to an
unstructured, optically transparent substrate. Nucleic acid
molecules may be attached to the top surface of a glass slide (by
any means known in the art), and the system illuminated from the
bottom surface of the glass slide. There are two reflection
surfaces in this configuration, one reflection from the bottom
surface of the glass slide, and the other from the top surface
which has nucleic acid molecules attached to it. The two reflected
waves may interfere with each other causing constructive or
destructive interference based on the path length differences, with
the wave reflected from the top surface modulated by the changes in
dielectric constant due to the bound nucleic acid molecules (and
subsequently by the interaction of polymerase with the bound
nucleic acid molecules). With the reflection from the bottom
surface unchanged, any binding to the nucleic acid molecules may be
reflected in the phase difference between the beams reflected from
the top and bottom surfaces, which in turn affects the interference
pattern that is observed. Optionally, bio-layer interferometry is
used to monitor the nucleic acid/polymerase interaction. Bio-layer
interferometry may be performed on commercial devices such as those
sold by Pall Forte Bio corporation (Menlo Park, Calif.).
Optionally, the reflected light from the top surface is selectively
chosen by using focusing optics. The reflected light from the
bottom surface is disregarded because it is not in the focal plane.
Focusing only on the nucleic-acid-attached top surface, the light
collected by the focusing lens comprises a planar wave,
corresponding to the partially reflected incident radiation, and a
scattered wave, corresponding to the radiations scattered in the
collection direction by molecules in the focal plane. These two
components may be made to interfere if the incident radiation is
coherent. This scattering based interferometric detection is
extremely sensitive and can be used to detect down to single
protein molecules.
Optionally, a field-effect transistor (FET) is configured as a
biosensor for the detection of a ternary complex. A gate terminal
of the FET is modified by the addition of template nucleic acids.
The binding of a polymerase comprising a charged tag results in
changes in electrochemical signals. Binding of a polymerase with a
next correct nucleotide to the template nucleic acid provides
different signals than polymerase binding to a template nucleic
acid in the presence of other incorrect nucleotides, where each
incorrect nucleotide may also provide a different signal.
Optionally, polymerase interactions with a template nucleic acid
are monitored using FET without the use of a labeled tag on the
polymerase, primed template nucleic acid, or nucleotide.
Optionally, the pH change that occurs due to release of H+ ions
during the incorporation reaction is detected using a FET.
Optionally, the polymerase comprises a tag that generates
continuous H+ ions that is detected by the FET. Optionally, the
continuous H+ ion generating tag is an ATP synthase. Optionally,
the continuous H+ ion generation tag is palladium, copper or
another catalyst. Optionally, the release of a PPi after nucleotide
incorporation is detected using FET. For example, one type of
nucleotide may be provided to a reaction at a time. Once the next
correct nucleotide is added and conditions allow for incorporation,
PPi is cleaved, released, and detected using FET, therefore
identifying the next correct nucleotide and the next base.
Optionally, template nucleic acids are bound to walls of a
nanotube. Optionally, a polymerase is bound to a wall of a
nanotube. FET is advantageous for use as a sequencing sensor due to
its small size and low weight, making it appropriate for use as a
portable sequencing monitoring component. Details of FET detection
of molecular interactions are described in Dong-Sun Kim et al., "An
FET-Type Charge Sensor for Highly Sensitive Detection of DNA
Sequence," Biosensors and Bioelectronics, Microsensors and
Microsystems 2003, 20, no. 1 (Jul. 30, 2004): 69-74,
doi:10.1016/j.bios.2004.01.025 and Alexander Star et al.,
"Electronic Detection of Specific Protein Binding Using Nanotube
FET Devices," Nano Letters 3, no. 4 (Apr. 1, 2003): 459-63,
doi:10.1021/nl0340172, which are incorporated by reference herein
in their entireties.
By way of example, the polymerase comprises a fluorescent tag. To
monitor polymerase-nucleic acid interaction with high
signal-to-noise, evanescent illumination or confocal imaging may be
employed. The formation of a ternary complex on localized template
nucleic acids may be observed as an increased fluorescence compared
to the background, for instance, whereas in some instances it may
be also be observed as a decreased fluorescence due to quenching or
change in local polar environment. Optionally, a fraction of
polymerase molecules may be tagged with a fluorophore while another
fraction may be tagged with a quencher in the same reaction
mixture; wherein, the formation of ternary complex on a localized,
clonal population of nucleic acid is revealed as decrease in
fluorescence compared to the background. The clonal population of
nucleic acids may be attached to a support surface such as a planar
substrate, microparticle, or nanoparticle. Optionally, a polymerase
is tagged with a fluorophore, luminophore, chemiluminophore,
chromophore, or bioluminophore.
Optionally, a plurality of template nucleic acids is tethered to a
surface and one (or more) dNTPs are flowed in sequentially. The
spectrum of affinities reveals the identity of the next correct
nucleotide and therefore the next base in the template nucleic
acid. Optionally, the affinities are measured without needing to
remove and replace reaction mixture conditions, i.e., a wash step.
Autocorrelation of the measured intensities of the binding
interaction, for instance, could readily reveal the dynamics of the
interaction, thus revealing the affinities without requiring a
washing step to measure the off-rate.
Any technique that can measure dynamic interactions between a
polymerase and nucleic acid may be used to measure the affinities
and enable the sequencing reaction methods disclosed herein.
Systems for Detecting Nucleotide-Specific Ternary Complex
Formation
The provided methods can be performed on a platform, where any
component of the nucleic acid polymerization reaction is localized
to a surface. Optionally, the template nucleic acid is attached to
a planar substrate, a nanohole array, a microparticle, or a
nanoparticle. Optionally, all reaction components are freely
suspended in the reaction mixture.
Optionally, the template nucleic acid is immobilized to a surface.
The surface may be a planar substrate, a hydrogel, a nanohole
array, a microparticle, or a nanoparticle. Optionally, the first
reaction mixture comprises a plurality of clonally amplified
template nucleic acid molecules. Optionally, the first reaction
mixture comprises a plurality of distinguishable template nucleic
acids.
Provided herein, inter alia, are systems for performing sequencing
reactions involving the examination of the interaction between a
polymerase and a primed template nucleic acid in the presence of
nucleotides to identify the next base in the template nucleic acid
sequence or to identify the number of nucleotides needed to fill a
homopolymer region encountered during sequencing. Optionally,
examination includes monitoring the affinity of the polymerase for
the primed template nucleic acid in the presence of nucleotides.
Optionally, the polymerase binds transiently with the nucleic acid
and the binding kinetics and affinity provides information about
the identity of the next base on the template nucleic acid.
Optionally, a closed-complex is formed, wherein the reaction
conditions involved in the formation of the closed-complex provide
information about the next base on the nucleic acid. Optionally,
the polymerase is trapped at the polymerization site in its ternary
complex by one or a combination of means, not limited to,
crosslinking of the polymerase domains, crosslinking of the
polymerase to the nucleic acid, allosteric inhibition by small
molecules, uncompetitive inhibitors, competitive inhibitors,
non-competitive inhibitors, and denaturation; wherein the formation
of the trapped polymerase complex provides information about the
identity of the next base on the nucleic acid template.
Also provided is a system for performing one or more steps of any
sequencing method disclosed herein. Optionally, the system includes
components and reagents necessary to perform a polymerase and
template nucleic acid binding assay in the presence of nucleotides,
wherein the template nucleic acid is provided on a nanostructure.
Optionally, the system comprises one or more reagents and
instructions necessary to bind template DNA molecules onto a
nanostructure. For example, the system provides a nanostructure,
such as a chip, configured for use with surface plasmon resonance
to determine binding kinetics. An example of such a chip is a CM5
sensor S chip (GE Healthcare, Piscatawany, N.J. The system may
provide instrumentation such as an SPR instrument (e.g., Biacore).
The system may provide streptavidin and/or biotin. Optionally, the
system provides biotin-DNA, DNA ligase, buffers, and/or DNA
polymerase for preparation of biotinylated template DNA.
Optionally, the system provides a gel or reagents (e.g.,
phenol:chloroform) for biotinylated DNA purification.
Alternatively, the system provides reagents for biotinylated
template DNA characterization, for example, mass spectrometry or
HPLC. Optionally, the system comprises streptavidin, a chip,
reagents, instrumentation, and/or instructions for immobilization
of streptavidin on a chip. Optionally, a chip is provided in the
system already configured for template DNA coating, wherein the
chip is immobilized with a reagent capable of binding template
nucleic acids or modified template nucleic acids (e.g.,
biotinylated template DNA). Optionally, the system provides
reagents for chip regeneration.
Also provided is a system for performing one or more steps of any
sequencing method disclosed herein. Optionally, the system includes
components and reagents necessary to perform a polymerase and
template nucleic acid binding assay in the presence of nucleotides,
wherein the template nucleic acid is provided on a nanoparticle.
Optionally, the system comprises one or more reagents and
instructions necessary to bind template DNA molecules onto a
nanoparticle. The nanoparticle may be configured for the
electrochemical detection of nucleic acid-polymerase interaction,
for instance, by using gold nanoparticles. Optionally, the
DNA-nanoparticle conjugates are formed between aqueous gold colloid
solutions and template DNA molecules comprising free thiol or
disulfide groups at their ends. The conjugates may comprise
clonally amplified populations of DNA molecules which may or may
not comprise the same nucleic acid sequence. Optionally, the
nanoparticle conjugates are stabilized against flocculation and
precipitation at high temperature (e.g., >60.degree. C.) and
high ionic strength (e.g., 1M Na+). Optionally, the system provides
reagents for preparing template DNA molecules for nanoparticle
attachment, including, generating template DNA molecules with
disulfides or thiols. Disulfide-containing template nucleic acids
may be synthesized using, for example, a 3'-thiol modifier
controlled-pore glass (CPG) or by beginning with a universal
support CPG and adding a disulfide modifier phosphoramidite as the
first monomer in the sequence. The system may provide for nucleic
acid synthesis reagents and/or instructions for obtaining
disulfide-modified template nucleic acids. Thiol-containing
template nucleic acids may also be generated during nucleic acid
synthesis with a 5'-tritylthiol modifier phosphoramidite. The
system may provide reagents and/or instructions for nanoparticle
conjugate purification using for example, electrophoresis or
centrifugation. Optionally, nanoparticle conjugates are used to
monitor polymerase-template nucleic acid interactions
colorimetrically. In this instance, the melting temperature of the
nanoparticle conjugate increases in the presence of strong
polymerase binding. Therefore, the strength of DNA binding can be
determined by the change in this melting transition, which is
observable by a color change.
Also provided is a system for performing one or more steps of any
sequencing method disclosed herein. Optionally, the system includes
components and reagents necessary to perform a polymerase and
template nucleic acid binding assay in the presence of nucleotides,
using a detectable polymerase. Optionally, the polymerase is
detectably labeled. Optionally, the polymerase is detected using
intrinsic properties of the polymerase, for example, aromatic amino
acids. Optionally, the polymerase and template nucleic acids are
configured for use in solution, without conjugation to a support.
The detectable label on the polymerase may be a fluorophore,
wherein fluorescence is used to monitor polymerase-template nucleic
acid binding events. Optionally, the detectable polymerase may be
used in combination with template nucleic acids in solution, or
template nucleic acids conjugated to a support structure.
Optionally, one or more cysteine residues of the polymerase is
labeled with Cy3-maleimide or Cy3-iodoacetamide. Optionally, the
system comprises reagents and/or instructions necessary to prepare
fluorescently labeled polymerase molecules. The system may comprise
reagents and/or instructions for purification of fluorescently
labeled polymerases.
Procedural Features of the Methods
Following the examination step, where the identity of the next base
has been identified via formation of a ternary complex, the
reaction conditions may be reset, recharged, or modified as
appropriate, in preparation for the optional incorporation step or
an additional examination step. Optionally, the identity of the
next base has been identified without chemically incorporating a
nucleotide. Optionally, the identity of the next base is identified
with chemical incorporation of a nucleotide, wherein a subsequent
nucleotide incorporation has been inhibited. Optionally, all
components of the examination step, excluding the template nucleic
acid being sequenced, are removed or washed away, returning the
system to the pre-examination condition. Optionally, partial
components of the examination step are removed. Optionally,
additional components are added to the examination step.
Optionally, reversible terminator nucleotides are used in the
incorporation step to ensure one, and only one nucleotide (i.e.,
only a single nucleotide) is incorporated per cycle. No labels are
required on the reversible terminator nucleotides as the base
identity is known from the examination step. Non-fluorescently
labeled reversible terminators are readily available from
commercial suppliers. Non-labeled reversible terminator nucleotides
are expected to have much faster incorporation kinetics compared to
labeled reversible terminators due to their smaller steric
footprint, and similar size to natural nucleotides.
Disclosed herein, in part, are reagent cycling sequencing methods,
wherein sequencing reagents are introduced, one after another, for
every cycle of examination and/or incorporation. Optionally, the
sequencing reaction mixture comprises a polymerase, a primed
template nucleic acid, and at least one type of nucleotide.
Optionally, the nucleotide and/or polymerase are introduced
cyclically to the sequencing reaction mixture. Optionally, the
sequencing reaction mixture comprises a plurality of polymerases,
primed template nucleic acids, and nucleotides. Optionally, a
plurality of nucleotides and/or a plurality of polymerases are
introduced cyclically to the sequencing reaction mixture.
Optionally, the examination step of the sequencing reaction has a
different composition than the incorporation step of the sequencing
reaction.
As provided herein, a polymerase refers to a single polymerase or a
plurality of polymerases. As provided herein, a primed template
nucleic acid or template nucleic acid refers to a single primed
template nucleic acid or single template nucleic acid, or a
plurality of primed template nucleic acids or a plurality of
template nucleic acids. As provided herein, a nucleotide refers to
one nucleotide or a plurality of nucleotides. As provided herein, a
single nucleotide is one nucleotide. Optionally, the sequencing
reaction nucleotides include, but are not limited to, 1, 2, 3, or 4
of the following nucleotides: dATP, dGTP, dCTP, and dTTP (or dUTP).
Optionally, reagent cycling involves immobilizing a template
nucleic acid to a platform, washing away the current reaction
mixture, and adding a new reaction mixture to the template nucleic
acid.
Optionally, one or more nucleotides are sequentially added to and
removed from the sequencing reaction. Optionally, 1, 2, 3, 4, or
more types of nucleotides are added to and removed from the
reaction mixture. For example, one type of nucleotide is added to
the sequencing reaction, removed, and replaced by another type of
nucleotide. Optionally, a nucleotide type present during the
examination step is different from a nucleotide type present during
the incorporation step. Optionally, a nucleotide type present
during one examination step is different from a nucleotide type
present during a sequential examination step (i.e., the sequential
examination step is performed prior to an incorporation step).
Optionally, 1, 2, 3, 4 or more types of nucleotides are present in
the examination reaction mixture and 1, 2, 3, 4, or more types of
nucleotides are present in the incorporation reaction mixture.
Optionally, a polymerase is cyclically added to and removed from
the sequencing reaction. One or more different types of polymerases
may be cyclically added to and removed from the sequencing
reaction. Optionally, a polymerase type present during the
examination step is different from a polymerase type present during
the incorporation step. A polymerase type present during one
examination step may be different from a polymerase type present
during a sequential examination step (i.e. the sequential
examination step is performed prior to an incorporation step).
Optionally, reagents conditions such as the presence of reagents,
pH, temperature, and ionic strength are varied throughout the
sequencing reaction. Optionally, a metal is cyclically added to and
removed from the sequencing reaction. For example, a catalytic
metal ion may be absent during an examination step and present
during an incorporation step. Alternatively, a polymerase inhibitor
may be present during an examination step and absent during an
incorporation step. Optionally, reaction components that are
consumed during the sequencing reaction are supplemented with the
addition of new components at any point during the sequencing
reaction.
Nucleotides can be added one type at a time, with the polymerase,
to a reaction condition which favors ternary complex formation, and
destabilizes formation of binary complexes. The polymerase binds
only to the template nucleic acid if the next correct nucleotide is
present. A wash step after every nucleotide addition ensures all
excess polymerases and nucleotides not involved in a ternary
complex are removed from the reaction mixture. If the nucleotides
are added one at a time, in a known order, the next base on the
template nucleic acid is determined by the formation of a ternary
complex when the added nucleotide is the next correct nucleotide.
The ternary complex may be identified by both the conformational
change and the increased stability of the polymerase-template
nucleic acid-nucleotide interaction. Optionally, the stability of
the ternary complex formed in the presence of the next correct
nucleotide is at least an order of magnitude greater than the
unstable interactions of the polymerase with the template nucleic
acid in the presence of incorrect nucleotides. The use of a wash
step ensures that there are no unbound nucleotides and polymerases
and that the only nucleotides present in the reaction are those
sequestered in a ternary complex with a polymerase and a template
nucleic acid. Once the next base on the template nucleic acid is
determined, the next correct nucleotide sequestered in the
closed-complex may be incorporated by a reagent exchange (e.g.,
flowing through a flow cell) that provides reaction conditions
favoring dissociation or destabilization of the ternary complex,
and extending the template nucleic acid primer strand by one base
(incorporation). Therefore, the wash step ensures that the only
nucleotide incorporated is the next correct nucleotide from the
ternary complex. This reagent cycling method may be repeated and
the nucleic acid sequence determined. This reagent cycling method
may be applied to a single template nucleic acid molecule, or to
collections of clonal populations such as PCR products or
rolling-circle amplified DNA. Many different templates can be
sequenced in parallel if they are arrayed, for instance, on a solid
support. Optionally, the wash step destabilizes binary complex
formation. Optionally, the washing is performed for a duration of
time which ensures that the binary complex is removed, leaving the
stabilized closed-complex in the reaction mixture. Optionally, the
wash step includes washing the reaction with a high ionic strength
or a high pH solution.
Optionally, the incorporation step is a three stage process. In the
first stage, all four nucleotide types are introduced into a
reaction comprising a primed template nucleic acid, with a high
fidelity polymerase, in reaction conditions which favor the
formation of a ternary complex, and the next correct nucleotides
are allowed to form stable ternary complexes with the template
nucleic acid. In a second stage, excess nucleotides and unbound
polymerase optionally are washed away. In a third stage, reaction
conditions are modified so that the ternary complex is destabilized
and the sequestered nucleotides within the ternary complex become
incorporated into the 3'-end of the primer of the primed template
nucleic acid. Formation of tight polymerase-nucleic acid complexes
in the incorporation step can be enabled by standard techniques
such as fusing a non-specific DNA binding domain to the polymerase
(e.g., Phusion polymerase), and utilizing high concentrations of
nucleotides to ensure correct nucleotides are always present in the
closed-complex.
Polymerase molecules bind to primed nucleic acid molecules in a
fingers-closed conformation in the presence of the next correct
nucleotide even in the absence of divalent metal ions that are
typically required for polymerase synthesis reactions. The
conformational change traps the nucleotide complementary to the
next template base within the active site of the polymerase.
Optionally, the formation of the ternary complex may be used to
determine the identity of the next base on the template nucleic
acid. Optionally, the primed template nucleic acids may be
contacted serially by different nucleotides in the presence of
polymerase, in the absence of catalytic divalent metal ions;
wherein the formation of a closed-complex indicates the nucleotide
currently in contact with the template nucleic acid is the
complementary nucleotide to the next base on the nucleic acid. A
known order of nucleotides (in the presence of polymerase, absence
of catalytic metal ions) brought into contact with the template
nucleic acid ensures facile identification of the complementary
nucleotide based on the particular position in the order that
induces ternary complex formation. Optionally, an appropriate wash
step may be performed after every nucleotide addition to ensure
removal of all excess enzymes and nucleotides, leaving behind only
the polymerase that are bound to nucleic acids in a ternary complex
with the next correct nucleotide at the active site. The ternary
complex may be identified by means that reveal the conformational
change of the polymerase in the closed conformation or by means
that reveal the increased stability of the
polymerase/nucleic-acid/next-correct-nucleotide complex compared to
binary polymerase-nucleic acid complexes or compared to unstable
interactions between the polymerase, primed template nucleic acid
and incorrect nucleotides.
Optionally, the process of identifying the next complementary
nucleotide (examination step) comprises the steps of contacting
immobilized primed template nucleic acids with an examination
mixture comprising polymerase and nucleotides of one kind under
conditions that inhibit the chemical incorporation of the
nucleotide, optionally removing unbound reagents by a wash step,
detecting the presence of polymerase ternary complex on the
immobilized nucleic acids, and repeating these steps, serially,
with nucleotides of different kinds until a ternary complex is
formed and detected. The ternary complex may be identified by both
the conformational change and the increased stability of the
polymerase/nucleic-acid/next-correct-nucleotide complex. The wash
step between successive nucleotide additions may be eliminated by
the use of detection mechanisms that can detect the formation of
the closed-complex with high fidelity, for instance, evanescent
wave sensing methods or methods that selectively monitor signals
from the ternary complex. The examination steps noted above may be
followed by an incorporation step comprising, contacting the
ternary complex with catalytic metal ions to covalently add the
nucleotide sequestered in the ternary complex to the 3'-end of the
primer. Optionally, the incorporation step may comprise, contacting
the immobilized nucleic acids with a pre-incorporation mixture
comprising a combination of multiple types of nucleotides and
polymerase under conditions that inhibit the chemical incorporation
of the nucleotides; wherein the pre-incorporation mixture may
contain additives and solution conditions to ensure highly
efficient ternary complex formation (e.g., low-salt conditions).
The methods may also include performing a wash step to remove
unbound reagents and providing the immobilized complexes with an
incorporation mixture, comprising catalytic metal ions, to
chemically incorporate nucleotides sequestered within the active
site of the polymerase. The pre-incorporation mixture ensures
highly efficient ternary complex formation, while the wash step and
incorporation mixture ensure the addition of a single nucleotide to
the 3'-end of the primer. Optionally, the incorporation step may
occur directly after examination an addition of one type of
nucleotide. For instance, a repeated pattern used for sequencing
may comprise the following flow pattern (i) dATP+/polymerase, (ii)
Wash, (iii) Mg2+, (iv) Wash, (v) dTTP+/polymerase, (vi) Wash, (vii)
Mg2+, (viii) Wash, (ix) dCTP+/polymerase, (x) Wash (xi) Mg2+, (xii)
Wash, (xiii) dGTP+/polymerase, (xiv) Wash, (xv) Mg2+, (xvi) Wash.
Optionally, the repeated pattern used for sequencing may include
(i) dATP+/polymerase, (ii) Wash, (iii) dTTP+/polymerase, (iv) Wash,
(v) dGTP+/polymerase, (vi) Wash, (vii) dCTP+/polymerase, (viii)
Wash, (ix) Pre-incorporation mixture, (x) Wash, (xi) Mg2+, (xii)
Wash. The wash steps typically contain metal ion chelators and
other small molecules to prevent accidental incorporations during
the examination steps. After the incorporation step, the primer
strand is typically extended by one base. Repeating this process,
sequential nucleobases of a nucleic acid may be identified,
effectively determining the nucleic acid sequence. Optionally, the
examination step is performed at high salt conditions, for example,
under conditions of 50 mM to 1,500 mM salt (i.e., a salt providing
monovalent cations, such as monovalent metal cations).
For sequencing applications, it can be advantageous to minimize or
eliminate fluidics and reagents exchange. Removing pumps, valves
and reagent containers can allow for smaller and less complicated
devices. Disclosed herein, in part, are "all-in" sequencing
methods, wherein the need to introduce reagents one after another,
for every cycle of examination and/or incorporation, is eliminated.
Reagents are added only once to the reaction, and
sequencing-by-synthesis is performed by manipulating reagents
already enclosed within the sequencing reaction. A scheme such as
this requires a method to distinguish different nucleotides, a
method to synchronize incorporation of nucleotides across a clonal
population of nucleic acids and/or across different nucleic acid
molecules, and a method to ensure only one nucleotide is added per
cycle. Optionally, the sequencing reaction mixture includes a
polymerase, a primed template nucleic acid, and at least one type
of nucleotide. Optionally, the sequencing reaction mixture
comprises a plurality of polymerases, primed template nucleic
acids, and nucleotides. As provided herein, a polymerase refers to
a single polymerase or a plurality of polymerases. As provided
herein, a primed template nucleic acid or template nucleic acid
refers to a single primed template nucleic acid or single template
nucleic acid, or a plurality of primed template nucleic acids or a
plurality of template nucleic acids. As provided herein, a
nucleotide refers to one nucleotide or a plurality of nucleotides.
As provided herein, a single nucleotide is one nucleotide.
Optionally, the sequencing reaction nucleotides include, but are
not limited to, 1, 2, 3, or 4 of the following nucleotides: dATP,
dGTP, dCTP, and dTTP (or dUTP).
Optionally, the examination step and the incorporation step take
place in a single sequencing reaction mixture.
Optionally, 1, 2, 3, 4 or more types of nucleotides (e.g. dATP,
dGTP, dCTP, dTTP) are present in the reaction mixture together at
the same time, wherein one type of nucleotide is a next correct
nucleotide. The reaction mixture further comprises at least one
polymerase and at least one primed template nucleic acids.
Optionally, the template nucleic acid is a clonal population of
template nucleic acids. Optionally, the polymerase, primed template
nucleic acid, and the nucleotide form a ternary complex under
examination reaction conditions.
In the provided methods, four types of nucleotides can be present
at distinct and different concentrations wherein the diffusion and
binding time of the polymerase to the template nucleic acid is
different for each of the four nucleotides, should they be the next
correct nucleotide, due to the different concentrations of the four
nucleotides. For example, the nucleotide at the highest
concentration would bind to its complementary base on the template
nucleic acid with a faster time, and the nucleotide at the lowest
concentration would bind to its complementary base on the template
nucleic acid with a slower time; wherein binding to the
complementary base on the template nucleic acid refers to the
polymerase binding to the template nucleic acid with the next
correct nucleotide in a ternary complex. The identity of the next
correct nucleotide is therefore determined by monitoring the rate
or time of binding of polymerase to the template nucleic acid in a
ternary complex. Optionally, the four types of nucleotides may be
distinguished by their concentration, wherein the different
concentrations of the nucleotides result in measurably different
on-rates for the polymerase binding to the nucleic acid.
Optionally, the four types of nucleotides may be distinguished by
their concentrations, wherein the different concentrations of the
nucleotides result in measurably different on-rates for the
formation of a stabilized ternary complex.
Optionally, the polymerase is labeled. In some instances, the
polymerase is not labeled and any label free detection method
disclosed herein or known in the art is employed. Optionally, the
binding of the polymerase to the nucleic acid is monitored via a
detectable feature of the polymerase. Optionally, the formation of
a stabilized ternary complex is monitored via a detectable feature
of the polymerase. A detectable feature of the polymerase may
include, but is not limited to, optical, electrical, thermal,
colorimetric, mass, and any combination thereof.
Optionally, 1, 2, 3, 4, or more nucleotides types (e.g., dATP,
dTTP, dCTP, dGTP) are tethered to 1, 2, 3, 4, or more different
polymerases; wherein each nucleotide type is tethered to a
different polymerase and each polymerase has a different tag or a
feature from the other polymerases to enable its identification.
All tethered nucleotide types can be added together to a sequencing
reaction mixture forming a ternary complex comprising a tethered
nucleotide-polymerase; the ternary complex is monitored to identify
the polymerase, thereby identifying the next correct nucleotide to
which the polymerase is tethered. The tethering may occur at the
gamma phosphate of the nucleotide through a multi-phosphate group
and a linker molecule. Such gamma-phosphate linking methods are
standard in the art, where a fluorophore is attached to the gamma
phosphate linker. The tags include, but are not limited to,
optical, electrical, thermal, colorimetric, mass, or any other
detectable feature. Optionally, different nucleotide types are
identified by distinguishable tags. Optionally, the distinguishable
tags are attached to the gamma phosphate position of each
nucleotide.
Optionally, the sequencing reaction mixture comprises a catalytic
metal ion. Optionally, the catalytic metal ion is available to
react with a polymerase at any point in the sequencing reaction in
a transient manner. To ensure robust sequencing, the catalytic
metal ion is available for a brief period of time, allowing for a
single nucleotide complementary to the next base in the template
nucleic acid to be incorporated into the 3'-end of the primer
during an incorporation step. In this instance, no other
nucleotides, for example, the nucleotides complementary to the
bases downstream of the next base in the template nucleic acid, are
incorporated. Optionally, the catalytic metal ion magnesium is
present as a photocaged complex (e.g., DM-Nitrophen) in the
sequencing reaction mixture such that localized UV illumination
releases the magnesium, making it available to the polymerase for
nucleotide incorporation. Furthermore, the sequencing reaction
mixture may contain EDTA, wherein the magnesium is released from
the polymerase active site after catalytic nucleotide incorporation
and captured by the EDTA in the sequencing reaction mixture,
thereby rendering magnesium incapable of catalyzing a subsequent
nucleotide incorporation.
Thus, in the provided methods, a catalytic metal ion can be present
in a sequencing reaction in a chelated or caged form from which it
can be released by a trigger. For example, the catalytic metal ion
catalyzes the incorporation of the ternary complex next correct
nucleotide, and, as the catalytic metal ion is released from the
active site, it is sequestered by a second chelating or caging
agent, disabling the metal ion from catalyzing a subsequent
incorporation. The localized release of the catalytic metal ion
from its cheating or caged complex is ensured by using a localized
uncaging or un-chelating scheme, such as an evanescent wave
illumination or a structured illumination. Controlled release of
the catalytic metal ions may occur for example, by thermal means.
Controlled release of the catalytic metal ions from their
photocaged complex may be released locally near the template
nucleic acid by confined optical fields, for instance by evanescent
illumination such as waveguides or total internal reflection
microscopy. Controlled release of the catalytic metal ions may
occur for example, by altering the pH of the solution near the
vicinity of the template nucleic acid. Chelating agents such as
EDTA and EGTA are pH dependent. At a pH below 5, divalent cations
Mg2+ and Mn2+ are not effectively chelated by EDTA. A method to
controllably manipulate the pH near the template nucleic acid
allows the controlled release of a catalytic metal ion from a
chelating agent. Optionally, the local pH change is induced by
applying a voltage to the surface to which the nucleic acid is
attached. The pH method offers an advantage in that that metal goes
back to its chelated form when the pH is reverted back to the
chelating range.
Optionally, a catalytic metal ion is strongly bound to the active
site of the polymerase, making it necessary to remove the
polymerase from the template nucleic acid after a single nucleotide
incorporation. The removal of polymerase may be accomplished by the
use of a highly distributive polymerase, which falls off the 3'-end
of the strand being synthesized (primer) after the addition of
every nucleotide. The unbound polymerase may further be subjected
to an electric or magnetic field to remove it from the vicinity of
the nucleic acid molecules. Any metal ions bound to the polymerase
may be sequestered by chelating agents present in the sequencing
reaction mixture, or by molecules which compete with the metal ions
for binding to the active site of the polymerase without disturbing
the formation of the closed-complex. The forces which remove or
move the polymerase away from the template nucleic acid (e.g.,
electric field, magnetic field, and/or chelating agent) may be
terminated, allowing for the polymerase to approach the template
nucleic acid for another round of sequencing (i.e., examination and
incorporation). The next round of sequencing, in a non-limiting
example, comprises the formation of a ternary complex, removing
unbound polymerase away from the vicinity of the template nucleic
acid and/or ternary complex, controlling the release of a catalytic
metal ion to incorporate a single nucleotide sequestered within the
ternary complex, removing the polymerase which dissociates from the
template nucleic acid after single incorporation away from the
vicinity of the template nucleic acid, sequestering any free
catalytic metal ions through the use of chelating agents or
competitive binders, and allowing the polymerase to approach the
template nucleic acid to perform the next cycle of sequencing.
Described above are polymerase-nucleic acid binding reactions for
the identification of a nucleic acid sequence. Nucleic acid
sequence identification may include information regarding nucleic
acid modifications. Nucleic acid modifications include methylation
and hydroxymethylation. Methylation may occur on cytosine bases of
a template nucleic acid. DNA methylation may stably alter the
expression of genes. DNA methylation is also indicated in the
development of various types of cancers, atherosclerosis, and
aging. DNA methylation therefore can serve as an epigenetic
biomarker for human disease.
Optionally, one or more cytosine methylations on a template nucleic
acid are identified during the sequencing-by-binding methods
provided herein. The template nucleic acid may be clonally
amplified prior to sequencing, wherein the amplicons comprise the
same methylation as their template nucleic acid. Amplification of
the template nucleic acids may include the use of DNA
methyltransferases to achieve amplicon methylation. The template
nucleic acids or amplified template nucleic acids are provided to a
reaction mixture comprising a polymerase and one or more nucleotide
types, wherein the interaction between the polymerase and nucleic
acids is monitored. Optionally, the interaction between the
polymerase and template nucleic acid in the presence of a
methylated cytosine is different than the interaction in the
presence of an unmodified cytosine. Therefore, based on examination
of a polymerase-nucleic acid interaction, the identity of a
modified nucleotide is determined.
Provided herein are methods to create a table of polymerase-nucleic
acid affinities for a variety of possible combinations of
nucleotides and next bases. Because these affinities are affected
primarily by interactions at the polymerase active site, where only
the nucleotide and next base on the nucleic acid template
participate, context specific effects may be neglected. Context
specific effects may include secondary structures of the nucleic
acid and contribution of bases further down the sequence from the
next base on the template nucleic acid. The table of affinities
allows for the determination of a nucleotide, natural or modified,
which induces the widest and most easily measured dispersion in
affinities for different template bases. Optionally, the template
bases are 1, 2, 3, or 4 of the bases dATP, dTTP, dCTP, and dGTP. It
is understood that the strongest affinity will exist for the base
that is complementary to the nucleotide. As used herein, dispersion
particularly refers to the variation in affinities for the other
three incorrect, non-complementary bases. Optionally, each affinity
is measured under examination conditions that inhibit nucleotide
incorporation and destabilize binary complex formation. Optionally,
the polymerase is modified or selected to provide a wide dispersion
in affinities. The engineered or natural polymerase may have
unfavorable error profiles or other unfavorable properties as a
sequencing enzyme, which is immaterial as this polymerase will only
be used under non-incorporating conditions. A polymerase may be
expressly selected for its ability to provide easily measurable and
distinct affinities for different template bases. Evolving or
screening for polymerases with desired properties are standard
procedures in the art (e.g., screening for polymerases with high
affinity for modified nucleotides). Optionally, a polymerase is
replaced with a high-fidelity polymerase for an incorporation step.
Optionally, a combination of polymerase and nucleotide is selected
that provides the most convenient affinities for the template
bases, thereby allowing for the execution of a sequencing method
that measure the affinity of the selected polymerase to the
template nucleic acid in the presence of the selected nucleotide.
The next base on the nucleic acid is determined from the measured
affinity, as the spectrum of affinities for the template bases is
provided in the constructed affinity table. The affinity can be an
on-rate, off-rate, or combination of on-rate and off-rate of the
polymerase nucleic acid interaction.
The affinity of a polymerase for a template nucleic acid in the
presence of a nucleotide can be measured in a plurality of methods
known to one of skill in the art. Optionally, the affinity is
measured as an off-rate, where the off-rate is measured by
monitoring the release of the polymerase from the template nucleic
acid as the reaction is washed by a wash buffer. Optionally, the
affinity is measured as an off-rate, where the off-rate is measured
by monitoring the release of the polymerase from the template
nucleic acid under equilibrium binding conditions, especially
equilibrium binding conditions where the polymerase binding rates
are low or diffusion limited. The polymerase binding rates may be
diffusion limited at sufficiently low concentrations of polymerase,
wherein if the polymerase falls-off from the DNA-polymerase
complex, it does not load back immediately, allowing for sufficient
time to detect that the polymerase has been released from the
complex. For a higher affinity interaction, the polymerase is
released from the nucleic acid slowly, whereas a low affinity
interaction results in the polymerase being released more rapidly.
The spectrum of affinities, in this case, translates to different
off-rates, with the off-rates measured under dynamic wash
conditions or at equilibrium. The smallest off-rate corresponds to
the base complementary to the added nucleotide, while the other
off-rates vary, in a known fashion, depending on the combination of
polymerase and nucleotide selected.
Optionally, the off-rate is measured as an equilibrium signal
intensity after the polymerase and nucleotide are provided in the
reaction mixture, wherein the interaction with the lowest off-rate
(highest affinity) nucleotide produces the strongest signal, while
the interactions with other, varying, off-rate nucleotides produce
signals of measurably different intensities. As a non-limiting
example, a fluorescently labeled polymerase, measured, preferably,
under total internal reflection (TIRF) conditions, produces
different measured fluorescence intensities depending on the number
of polymerase molecules bound to surface-immobilized nucleic acid
molecules in a suitably chosen window of time. The intrinsic
fluorescence of the polymerase, for instance, tryptophan
fluorescence, may also be utilized. A high off-rate interaction
produces low measured intensities, as the number of bound
polymerase molecules, in the chosen time window is very small,
wherein a high off-rate indicates that most of the polymerase is
unbound from the nucleic acid. Any surface localized measurement
scheme may be employed including, but not limited to, labeled or
fluorescence schemes. Suitable measurement schemes that measure
affinities under equilibrium conditions include, but are not
limited to, bound mass, refractive index, surface charge,
dielectric constant, and schemes known in the art. Optionally, a
combination of on-rate and off-rate engineering yields higher
fidelity detection in the proposed schemes. As a non-limiting
example, a uniformly low on-rate, base dependent, varying off-rate
results in an unbound polymerase remaining unbound for prolonged
periods, allowing enhanced discrimination of the variation in
off-rate and measured intensity. The on-rate may be manipulated by
lowering the concentration of the added polymerase, nucleotide, or
both polymerase and nucleotide.
Optionally, the interaction between the polymerase and the nucleic
acid is monitored via a detectable tag attached to the polymerase.
The tag may be monitored by detection methods including, but
limited to, optical, electrical, thermal, mass, size, charge,
vibration, and pressure. The label may be magnetic, fluorescent or
charged. For external and internal label schemes, fluorescence
anisotropy may be used to determine the stable binding of a
polymerase to a nucleic acid in a ternary complex.
By way of example, a polymerase is tagged with a fluorophore,
wherein closed-complex formation is monitored as a stable
fluorescent signal. The unstable interaction of the polymerase with
the template nucleic acid in the presence of an incorrect
nucleotide results in a measurably weaker signal compared to the
ternary complex formed in the presence of the next correct
nucleotide.
Optionally, the interaction between the polymerase and the template
nucleic acid in the presence of a nucleotide is monitored utilizing
intrinsic signals from the polymerase including, but not limited
to, Raman signature, tryptophan, 2-aminopurine or other intrinsic
fluorescence. Intrinsic fluorescence of polymerase amino acids can
be exploited to detect polymerase conformational changes that occur
during one or more steps of a sequencing method disclosed herein,
for example ternary complex formation or release. Amino acids with
intrinsic fluorescence include tryptophan, tyrosine, and
phenylalanine. Optionally, one or more polymerase amino acids are
mutated to comprise a tryptophan, tyrosine, or phenylalanine
residue. Polymerases may be modified by any means, including
genetic or chemical modification, to comprise additional amino
acids with intrinsic fluorescence. Optionally, intrinsic
fluorescence is influenced by the proximity of other amino acids
which may cause quenching of fluorescence, such as those amino
acids having protonated groups (e.g., aspartic acid, glutamic
acid). Optionally, a tryptophan residue of a polymerase is buried
in a hydrophobic core, when the polymerase is configured in a
ternary complex, and exposed to an aqueous environment, when the
polymerase is released or not engaged in a closed-complex
confirmation. The emission spectrum of the tryptophan is different
depending on the environment (hydrophilic or hydrophobic), allowing
for the detection of a ternary complex. Optionally, intrinsic
fluorescence of a polymerase is used to identify conformational
changes during a sequencing reaction. In one example, intrinsic
fluorescence emissions from tryptophan residues of a polymerase are
monitored using techniques similar to those referenced in Yu-Chih
Tsai, Zhinan Jin, and Kenneth A. Johnson, "Site-Specific Labeling
of T7 DNA Polymerase with a Conformationally Sensitive Fluorophore
and Its Use in Detecting Single-Nucleotide Polymorphisms,"
Analytical Biochemistry 384, no. 1 (Jan. 1, 2009): 136-44, which is
herein incorporated in its entirety by reference.
Optionally, in the provided methods, following one or more
examination and/or incorporation steps a subset of nucleotides is
added to reduce or reset phasing. Thus, the methods can include one
or more steps of contacting a template nucleic acid molecule being
sequenced with a composition comprising a subset of nucleotides and
an enzyme for incorporating the nucleotides into the strand
opposite the template strand of the nucleic acid molecule. The
contacting can occur under conditions to reduce phasing in the
nucleic acid molecule. Optionally, the step of contacting the
template nucleic acid molecule occurs after an incorporation step
and/or after an examination step. Optionally, the contacting occurs
after 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45,
50, 60, 65, 70, 75, 80, 85, 90, 95, or 100 rounds or more of
sequencing, i.e., rounds of examination and incorporation.
Optionally, the contacting occurs after 30 to 60 rounds of
sequencing. Optionally, the contacting occurs after every round of
sequencing, i.e., after one examination and incorporation step.
Optionally, multiple contacting steps occur after every round of
sequencing, wherein each contacting step may comprise different
subsets of nucleotides. Optionally, the method further comprises
one or more washing steps after contacting. Optionally, the subset
comprises two or three nucleotides. Optionally, the subset
comprises three nucleotides. Optionally, the subset of nucleotides
is selected from three of dATP, dGTP, dCTP, dTTP (or dUTP) or a
derivative thereof. Optionally, the three nucleotides comprise
adenosine, cytosine, and guanine. Optionally, the three nucleotides
comprise adenosine, cytosine, and thymine. Optionally, the three
nucleotides comprise cytosine, guanine and thymine. Optionally, the
three nucleotides comprise adenosine, guanine and thymine.
Optionally, each round of contacting comprises the same subset or
different subsets of nucleotides. Optionally, sequencing of a
nucleic acid template is monitored and the contacting with the
subset of nucleotides occurs upon detection of phasing. See also
for example, U.S. Pat. No. 8,236,532, which is incorporated herein
by reference in its entirety.
Optionally, the sequencing reaction involves a plurality of
template nucleic acids, polymerases and/or nucleotides, wherein a
plurality of ternary complexes is monitored. Clonally amplified
template nucleic acids may be sequenced together wherein the clones
are localized in close proximity to allow for enhanced monitoring
during sequencing. Optionally, the formation of a ternary complex
ensures the synchronicity of base extension across a plurality of
clonally amplified template nucleic acids. The synchronicity of
base extension allows for the addition of only one base per
sequencing cycle.
EXAMPLES
Example 1 describes procedures that investigated the consequence of
including or omitting a divalent catalytic cation during the
examination step. The procedure was conducted using a label-free
system and Klenow polymerase.
Example 1
Determination of Base Sequence with or without Magnesium in the
Binding Step
Materials and methods used in the procedure were as follows.
Polymerase buffer: 20 mM Tris, pH 8.0, 300 mM NaCl, 5 mM DTT, 100
.mu.M dNTP, 150 nM Klenow, 0.01% BSA, 0.02% Tween-20, 10 mM MgCl2.
Exam buffer: 20 mM Tris buffer (pH 8.0), 300 mM NaCl, 5 mM DTT, 100
.mu.M dNTP, 150 nM Klenow, 0.01% BSA, 0.02% Tween-20. Incorporation
buffer: 20 mM Tris buffer (pH 8), 300 mM NaCl, 5 mM DTT, 0.01% BSA,
0.02% Tween-20, 10 mM MgCl2. Wash Buffer: 20 mM Tris buffer (pH 8),
300 mM NaCl, 5 mM DTT, 0.01% BSA, 0.02% Tween-20.
FIG. 1 shows the results of an experiment using non-labeled optical
detection methods where magnesium was present or absent during the
examination step. The first flow included dCTP (C:T mismatch) and
the second flow included dATP (A:T match). The solid line in FIG. 1
shows the results obtained using Polymerase Buffer. The pre-steady
state rate constants were 0.0106 and 0.0084 for the match A and
mismatch C steps, respectively. The difference was too small to
accurately discriminate the cognate base. The dashed line in FIG. 1
represents a magnesium-free examination step in exam buffer,
followed by soaking in incorporation buffer. A signal threshold of
1.1 nm accurately determined the correct base. These results showed
that the sensing platform was unable to capture transient kinetics
that could discriminate a match from mismatch base, and would be
incapable of sequence determination when magnesium was included in
the buffer during examination (Polymerase Buffer, solid line, FIG.
1). In contrast, binding in the absence of magnesium provided very
large discrimination between correct and incorrect base (Exam
Buffer, dashed line, FIG. 1). The correct base sequence in this
procedure was determined by signal thresholding rather than binding
rates.
Example 2 describes procedures that demonstrated how binding
kinetics can be used to determine the correct base or nucleotide
during the examination step (i.e., during the formation of a
ternary complex between the polymerase, DNA template and
nucleotide). The Bst enzyme showed a bimodal binding curve when the
correct base was presented and a basic exponential binding behavior
when the incorrect base was presented, thereby allowing for
discrimination and detection of the correct base or nucleotide
during the procedure.
Example 2
Sequencing Using Bst Enzyme Binding Kinetics
Materials and methods used in the procedure were as follows. The
FORTEBIO.RTM. (Menlo Park, Calif.) Octet instrument (Red384 or QK)
uses biolayer interferometry to measure binding reactions at the
surface of a fiber optic tip. The tips were functionalized with
streptavidin (SA) to enable binding to 5' biotin labeled DNA
templates hybridized with a primer that is complementary to
sequences near the 3'-end of the template. PhiX_matchC and
phiX_matchA were loaded onto individual tips. Primer-template was
loaded onto the tips at between 100 and 500 nM in 1-2.times.PBS
containing 0.01-0.02% BSA and 0.01-0.02% Tween-20 (loading buffer).
The FP2 primer was in 1.25-2 fold excess over template. Loading was
monitored by a change in signal, and usually reached a plateau
within 5 minutes at 30.degree. C. Tips were soaked in loading
buffer for 1-5 minutes to remove unbound DNA material. For base
calling, tips were typically soaked in solutions containing
1.times.Taq buffer (10 mM Tris-HCl (pH 8.3), 50 mM KCl, at
25.degree. C., magnesium-free) supplemented with 0.01-0.02% BSA and
0.01-0.02% Tween-20 (LS buffer), 100 nM polymerase enzyme, 100
.mu.M nucleotide, and varying concentrations of additional NaCl
from 50 to 300 mM. In this experiment, for determining the correct
base, 30 nM Bst2.0 enzyme, 100 .mu.M dNTP, and LS buffer containing
150 mM NaCl was used. The phiX_matchC duplex will form a ternary
complex and show an increase in binding signal because the correct
next nucleotide (cognate) is presented. The phiX_matchA should not
because it is an incorrect nucleotide (noncognate). After the
examination step, the sensors were soaked in LS buffer containing 5
mM Mg.sup.2+, to allow the polymerase to incorporate the
nucleotide, which was followed by washing with LS buffer containing
150 mM NaCl.
Results of the procedure are shown in FIG. 2. Iterative cycling
showed that this method can be used for sequence determination.
Table 2 shows that the first three bases were correctly identified
by this examination method. The fourth base was a "no call" by the
examination method, and may reflect multiple additions. Consistent
with this, subsequent bases were correctly identified. Overall, 5
of 6 bases were identified correctly. Further, misincorporation of
an incorrect base was not observed.
TABLE-US-00002 TABLE 2 Base Identification Expected base A G C T
Comments C x x C G x G C x x C C x x ? Difficult call T x x x T T X
x x T
Example 3 describes a sequencing reaction wherein an examination
step that employed high salt conditions was followed by an
incorporation step.
Example 3
Sequencing-by-Binding
Materials and methods used in the procedure were as follows. The
binding/examination buffer used in this instance was LS buffer
having 250 mM NaCl, 100 .mu.M dGTP, dCTP, dATP, or dTTP, 1.5 mM
Sr.sup.2+, 100 nM Klenow exo(-) polymerase. The incorporation
buffer was LS buffer with 50 mM NaCl, 50 mM MgCl2, and the wash
buffer was LS buffer with 250 mM NaCl. Using a FORTEBIO.RTM. Octet
Red384 system (Menlo Park, Calif.), sequencing cycles were
performed using biotin phiX_matchC template and FP2 primer
sequences attached to SA sensor tips. Sequencing steps consisted of
the following: (a) Examination with dATP, (b) incorporation, (c)
wash; (d) Examination with dGTP, (e) incorporation, (f) wash; (g)
Examination with dCTP, (h) incorporation, (i) wash; (j) Examination
with dTTP (k) incorporation, (1) wash, followed by repeat of these
steps from (a). For base calls, the examination step produced a
detectable signal above the baseline from the previous wash step
and/or relative to a control sequences.
Results from this procedure indicated that 12 bases were correctly
identified. Two bases were not identified because the binding
signal was too low. This experiment identified 12/14 bases
correctly, as shown below in Table 3.
TABLE-US-00003 TABLE 3 Sequence Identification Expected base G C T
A Comment C C G G C C C No call T T T T C C G G T T A A T No call G
G T T T T
Example 4 describes procedures initially used to establish the
effect of a salt containing a monovalent cation on polymerase
match/mismatch discrimination. The FORTEBIO.RTM. Octet instrument
(Red384 or QK) (Menlo Park, Calif.) employed in the procedure used
biolayer interferometry to measure binding reactions at the surface
of a fiber optic tip. The tips had been functionalized with
streptavidin (SA) to enable binding to 5' biotin labeled DNA
templates hybridized with a primer that was complementary to
sequences near the 3'-end of the template.
Example 4
Salt Concentration on Match/Mismatch Base Discrimination
Materials and methods used in the procedure were as follows.
PhiX_matchC and phiX_matchA were loaded onto individual tips.
Primer-template was loaded onto the tips at between 100 and 500 nM
in 1-2.times.PBS containing 0.01-0.02% BSA and 0.01-0.02% Tween-20
(loading buffer). The FP2 primer was in 1.25-2 fold excess over
template. Loading was monitored by a change in signal, and usually
reached a plateau within 5 minutes at 30.degree. C. Tips were
soaked in Loading buffer for 1-5 minutes to remove unbound DNA
material. For base calling, tips were typically soaked in solutions
containing 1.times.Taq buffer (10 mM Tris-HCl, 50 mM KCl, pH 8.3 at
25.degree. C., magnesium free) supplemented with 0.01-0.02% BSA and
0.01-0.02% Tween-20 (LS buffer), 100 nM polymerase enzyme, 100
.mu.M dNTP, and varying concentrations of additional NaCl from 50
to 300 mM. The phiX_matchC duplex will form a ternary complex and
show an increase in binding signal, because the correct next
nucleotide (cognate) is presented. The phiX_matchA should not cause
an increased binding signal because it is an incorrect (noncognate)
nucleotide.
Results indicated that both templates bound polymerase enzyme under
standard reaction conditions. However, as the salt concentration
increased, the binding affinity of the non-cognate complex
decreased while binding affinity of the cognate complex remained
high. Thus, the signal to noise ratio (SNR) of base discrimination
increased such that the next correct base can be easily identified
during this examination step (see FIG. 3). Although NaCl was used
in this example as the model salt containing a monovalent cation,
other salts such as KCl, NH2(SO4), potassium glutamate, and others
known in the art also can be used. Polymerases that show
differences in binding affinity between correct and incorrect
nucleotides included Klenow polymerase, Bst2.0, Bsu, and Taq.
Example 5 describes procedures that demonstrated how examination
during both the association and dissociation phases of the binding
reaction could be used to improve sequence fidelity. In this
instance, the cognate nucleotide could be identified by
dissociation of (i.e., loss of) a ternary complex.
Example 5
Base Discrimination During Dissociation/Wash Step
Materials and methods used in the procedure were as follows. In
this experiment, phiX_matchC and FP2 primer were loaded onto
SA-sensor tips, as described above. Polymerase complex was formed
in LS buffer with 100 .mu.M of either dGTP, dCTP, dATP, or dTTP,
and 100 nM Klenow or Bst2.0 enzyme, and 1 mM SrCl2.
Results indicated that, in low salt, polymerase efficiently bound
to DNA of the primed template nucleic acid regardless of whether
cognate nucleotide was present. In wash buffer (LS buffer+50 mM or
100 mM added NaCl), all complexes dissociated. Even SrCl2 did not
stabilize complexes when additional NaCl was present. However, when
50 .mu.M of the same dNTP that was in the binding buffer was
included in the wash buffer, then only the complexes with incorrect
nucleotides dissociated and the correct ternary complex was
stabilized (see FIG. 4). Furthermore, it was found that dNTPs were
unnecessary in the binding step and could be included during
washing. A bound binary complex could still allow the correct base
to enter and form a ternary complex when the correct dNTP was
subsequently introduced. Additionally, fidelity was not affected by
the presence of incorrect nucleotides. Thus, the dissociation rates
of the polymerase can also be used to determine the correct base in
a mixture of dNTPs (e.g., at different concentrations which will
dissociate at different rates).
Example 6
Stabilization of Nucleic Acid:Polymerase Complex in Wash Buffer
To minimize the possibility of multiple incorporations in a
homopolymer region, a wash step can be performed before
incorporation. Metal cations such as calcium and strontium can
stabilize the polymerase complex (like magnesium), but cannot
support catalysis of the phosphodiester bond which results in
incorporation of the nucleotide. In this experiment, varying
concentrations of SrCl2 (0 mM-14 mM) were added to the wash buffer
(LS buffer). The polymerase complex was much more stable in the
presence of as little as 3.5 mM Sr.sup.2+ ion (lowest
concentration) in the wash buffer. Further, stability of the
complex was not noticeably affected when correct or incorrect
nucleotide was present during the binding step indicating that
Sr.sup.2+ related stability of the polymerase was not limited to
ternary complexes. The results are shown in FIG. 5.
Example 7 describes procedures that investigated the effect of the
3'-5' exonuclease activity of DNA Pol I was investigated.
Exonuclease activity increase fidelity as an incorrect base or flap
is removed by the proofreading function provided by the exonuclease
activity of the polymerase. However, this activity can potentially
cleave correct bases and lead to incorrect sequence reads.
Example 7
Use of DNA Pol I without 3'-5' Exonuclease Activity
Materials and methods used in the procedure were as follows. A
primer with a 3' terminal mismatch was hybridized to template
creating a frayed end or flap construct. Klenow exo(-) polymerase
will not be able to extend this terminus. However, DNA pol I large
fragment has exonuclease activity and could remove the mismatch
base. Once removed, the primer can be extended normally by klenow
exo(-) polymerase or DNA polymerase. Two sensors having immobilized
flap structures were exposed to either DNA polymerase or Klenow
exo(-) for sequencing. The sensors were then exposed to the
template sequence in the correct order. The DNA polymerase sensor
was able to add the bases, whereas the Klenow fragment sensor was
unable to add any bases due to the flap structure. Any 3'.fwdarw.5'
exo activity of the DNA polymerase would cause base addition to be
out of sync with the sequence.
Results from the procedure are presented in FIG. 6. Cleavage of
mismatch base by DNA polymerase allowed subsequent base additions.
Bases were correct out to 4 cycles. Without exonuclease activity,
Klenow exo(-) was unable to extend the template. In cases where
spurious exonuclease activity is detrimental, the exonuclease can
be inhibited by competitive, uncompetitive or noncompetitive
compounds or analogs. For example, NaF is competitive inhibitor of
DNA polymerase exonuclease function (Potapova et al., FEBS Letters,
277(1-2):109-111 (1990)).
TABLE-US-00004 TABLE 4 Nucleic Acid Sequences Nucleic acid
sequences used in Examples 2-7 Name Length Sequence (5'-3')
Modification phiX_ 101 GGC AAA TCA CCA GAA GGC GGT TCC TGA 5'
biotin matchC ATG AAT GGG AAG CCT TCA AGA AGG TGA TAA GCA GGA GAA
ACA TAC GAA GGC GCA TAA CGA TAC CAC TGA CCC TC (SEQ ID NO: 3) phiX_
101 GGC AAA TCA CCA GAA GGC GGT TCC TGA 5' biotin matchA ATG AAT
GGG AAG CCT TCA AGA AGG TGA TAA GCA GGA GAA ACA TAC GAA GCA TCA TAA
CGA TAC CAC TGA CCC TC (SEQ ID NO: 4) FP2 22 GAG GGT CAG TGG TAT
CGT TAT G (SEQ ID NO: 5) PhiX_50 50 TGA TAA GCA GGA GAA ACA TAC GAA
GCA 5' biotin matchA TCA TAA CGA TAC CAC TGA CCC TC (SEQ ID NO: 6)
Alk_Btn- 50 GTGAGCCTGCAATCCCTGCCCCGGTTCATCCT 5' biotin 4460-4509S
GCTGGAGCTCATGGCGGG (SEQ ID NO: 7) ALK_44 14 CCCGCCATGAGCTC
96-4509AS (SEQ ID NO: 8)
Example 8 describes procedures employing HIV-1 reverse
transcriptase in combination with enzyme inhibitors. As background
on the target sequence used in this Example, the EML4-ALK fusion is
found in 4-5% of patients with non-small-cell lung cancer (Soda et
al., Nature 448:561-6 (2007); Mano, Cancer Sci. 99:2349-55 (2008);
and Horn and Pao, J. Clin. Oncol. 27:4232-5 (2009)). The ALK C4493A
mutation has been identified in clinical lung tumors, which results
in the L1196M "gatekeeper" mutation in ALK protein and confers
resistance to the chemotherapy drug crizotinib (Choi et al., N.
Engl. J. Med. 18:1734-9 (2010)). The 4496-4509AS primer enables
sequencing into the region with the gatekeeper mutation. Template
oligonucleotide sequence was derived from wild-type human ALK gene
(nucleotide numbers 4460-4509). The primer sequence was
complementary to a portion of the human ALK gene (nucleotide
numbers 4496-4509).
Example 8
Sequencing Using HIV Reverse Transcriptase (RT) and Non-Nucleoside
Reverse Transcriptase Inhibitor (NNRTI) Compounds 7 and 18
Materials and methods used in the procedure were as follows. The
DNA sequence of template oligonucleotide Btn-4460-4509S with 3'
inverted dT was:
Biotin-5'-GTGAGCCTGCAATCCCTGCCCCGGTTCATCCTGCTGGAGCTCATGGCGGG-3'-(3'--
dT-5') (SEQ ID NO:9). The DNA sequence of primer oligonucleotide
4496-4509AS was: 5'-CCCGCCATGAGCTC-3' (SEQ ID NO:10). Template
oligonucleotide Btn-4460-4509S and primer oligonucleotide
4496-4509AS were synthesized and analyzed (liquid
chromatography-mass spectrometry (LC-MS) and electrospray
ionization (ESI)) by Integrated DNA Technologies (Coralville,
Iowa). Oligonucleotides were prepared in TE Buffer (10 mM Tris
buffer (pH 8.0), 0.1 mM EDTA) to 100 .mu.M. Primer and template
oligonucleotides were combined (10 .mu.M each strand) in a tube
containing Annealing Buffer (10 mM Tris buffer (pH 8.0), 0.1 mM
EDTA, 80 mM KCl). The tube containing primer-template solution was
loaded onto a dry heat block (95.degree. C. for 5 minutes), and the
block was transferred to the bench top to anneal the strands by
gradually cooling to ambient temperature. Uncompetitive NNRTI
compounds (Pitta et al., J. Enzyme Inhib. Med. Chem. 28(10): 113-22
(2013)), which is incorporated by reference herein in its
entirety), were from Epigen Biosciences, Inc. (San Diego, Calif.).
NNRTI compounds 7
(3-4-chloro-benzo[d]thiazol-2-yl)-2-(2-chloro-6-fluorophenyl)thiazolidin--
4-one) and 18
(3-(6-ethoxy-benzo[d]thiazol-2-yl)-2-(2-chloro-6-fluorophenyl)thiazolidin-
-4-one) were dissolved in dimethylsulfoxide (DMSO) to
concentrations of 25.0 mM and 15.0 mM, respectively. Recombinant
purified HIV reverse transcriptase (HIV RT) was from Worthington
Biochemical Corp (Lakewood, N.J.). Ultra-pure bovine serum albumin
(BSA) was from Ambion (Foster City, Calif.). All reagents and
solutions were molecular biology grade. Primer-template duplex was
diluted (100 .mu.M) into Annealing Buffer. Immediately before use,
HIV Reverse Transcriptase was pre-diluted into Enzyme Diluent (50
mM Tris buffer (pH 8.0), 8 mM MgCl2). Binding buffer (50 mM Tris
buffer (pH 8.0), 160 mM KCl, 0.5 mM EDTA, 11 mM MgCl2, 0.3% (v/v)
Triton X-100, 5.3 mM dithiothreitol (DTT), 100 .mu.g/mL bovine
serum albumin (BSA), 100 .mu.M dNTP (dATP, dTTP, dGTP or dCTP), 100
nM HIV RT). NNRTI compounds were pre-diluted with DMSO immediately
before being spiked into Binding Buffer. Reaction Buffer was
Binding Buffer without NNRTI, dNTP or HIV RT enzyme. Buffer
containing Primer-Template (PT), PT Wash Buffer, Binding buffer
containing one dNTP, and Reaction Buffer were loaded (200
.mu.L/well) into a Greiner 96-well black microplate (Sigma-Aldrich,
St. Louis, Mo.; catalog number M9685). Streptavidin (SA) Biosensors
(Pall ForteBio Corp., Menlo Park, Calif.; catalog number 18-5019)
were re-hydrated in Annealing Buffer for approximately 10 minutes
before use. The Octet QK biosensor system (Pall ForteBio Corp.,
Menlo Park, Calif.) was set for 30.degree. C. operation and was
programmed to coat the biosensors with Primer-Template and wash
away unbound Primer-Template with PT Wash Buffer. Biosensors were
transferred to Binding Buffer containing HIV RT and dCTP+NNRTI
(association phase) followed by Reaction Buffer (dCTP incorporation
and dissociation phase). Similarly, biosensors were transferred to
solutions containing individual deoxyribonucleoside triphosphates
(dATP, dGTP, dCTP or dTTP) in a cycical fashion, as indicated.
Cycles of binding and incorporation were repeated multiple times.
Monitoring data generated by the Octet interferometry instrument
were imported into Microsoft Excel and Prism software (GraphPad
Software, San Diego, Calif.) for display. The progress of binding
and dissociation reactions was smoothed either by averaging within
a 19.4-second window or by Prism software (19.4-second window and
6th-order smoothing polynomial).
Results from the procedure are shown in FIGS. 7A-7B, and in FIG. 8.
Non-nucleoside reverse transcriptase inhibitors (NNRTI) with
reportedly an uncompetitive mode of inhibition were utilized for
DNA sequencing via the DNA-dependent DNA polymerase activity of HIV
reverse transcriptase. In assays for binding to biosensor coated
with primer-template, the combination of HIV reverse transcriptase,
correct dNTP and NNRTI compound 7 (40 .mu.M) exhibit distinct peaks
for binding in the association phase followed by decreased binding
in wash buffer during the dissociation phase (FIG. 7A, circles).
Unlike the NNRTI-stabilized HIV RT-dNTP mixtures, reactions
containing HIV RT and correct dNTP did not produce appreciable
binding peaks (FIG. 7A, triangles) nor did controls (HIV RT with or
without 40 .mu.M NNRTI compound 7; FIG. 7A, solid and dashed
lines). The time course for binding and dissociation demonstrate
sequencing for the first six cycles (nucleotide sequence CAGCAG) in
FIG. 7A. The seventh cycle and eighth cycles with incorrect
nucleotides dCTP and dATP, respectively did not produce a binding
peak. The ninth cycle with the correct nucleotide dGTP (FIG. 7A).
Time courses for binding (0-5 minutes) and dissociation (5-10
minutes) are shown for each cycle in FIG. 7B. Similarly, sequencing
using HIV RT and NNRTI compound 18 also produced sequencing
results. In assays for binding to biosensor coated with
primer-template, the combination of HIV reverse transcriptase,
correct dNTP and NNRTI compound 18 (80 .mu.M) exhibit distinct
peaks for binding in the association phase followed by decreased
binding in wash buffer during the dissociation phase (FIG. 8,
diamonds). Unlike the NNRTI-stabilized HIV RT-dNTP mixtures,
reactions containing HIV RT and correct dNTP did not produce
appreciable binding peaks (FIG. 8, triangles) nor did controls (HIV
RT with 80 .mu.M NNRTI compound 18; FIG. 8, dashed lines). In
cycles 1-3, binding peaks indicated binding of HIV RT with correct
nucleotide and compound 18 for sequence CAG (FIG. 8). Cycle 4 with
HIV RT, incorrect nucleotide dTTP and compound 18 did not show a
binding peak (FIG. 8). Subsequent cycles did not show further peaks
for sequencing analysis.
Example 9 describes procedures that demonstrated utility of another
label-free sequencing system. More specifically, the results
demonstrated the ability to accurately sequence DNA using a
Klenow/dNTP binding assay on an SPRi biosensor. The SPRi biosensor
has sufficient sensitivity and durability to detect the different
steps necessary for performing DNA sequencing over multiple
examination/incorporation rounds. Below there is shown sequencing
of three base pairs within a 60 bp strand. This technique can be
extendable to an arbitrary number of sequencing cycles.
Example 9
DNA Sequencing on a Surface Plasmon Resonance (SPR) Imaging
Biosensor
Materials and methods used in the procedure were as follows. SPR
sensor chip: 20 mm.times.20 mm.times.1 mm high refractive index
(1.61) slide (NanoSPR, Chicago, Ill.). Alkanethiols, PEG6:
monothioalkane(C11)PEG6-OH(11-mercaptoundecyl hexaethyleneglycol
(catalogue number, SPT-0011P6); and BAT: biotinylated alkane PEG
thiol (catalogue number, SPT-0012D), were obtained from Sensopath
technologies (Bozeman, Mont.). Base buffer (wash): 300 mM KCl, 20
mM Tris HCl (pH 8.0), 0.01% Tween-20, 1 mM SrCl2. Examination
buffer: Base buffer plus 50 nM Klenow fragment and 100 nM dNTP.
Incorporation buffer: Base buffer plus 10 mM MgCl2. Prior to the
experiment the gold coated SPR slide was coated with a mixed SAM of
18% BAT with 82% PEG6 diluted in 100% EtOH to final combined
concentration of 1.times.10-4 M. SPR slides were incubated in the
alkanethiol solution overnight at room temperature. After
incubation the SPR slides were rinsed in fresh 100% EtOH, followed
by 50% EtOH in deionized water, and deionized water. The slides
were then dried in air. The slides were mounted on a custom built
SPR imaging system that provided fluidic control, image
acquisition, and data quantitation. A solution containing 10
.mu.g/ml of streptavidin in base buffer was injected into the flow
cell. Binding of the resulting streptavidin layer was monitored by
measuring the change in light reflected from the SPR chip for
approximately 180 seconds. This was followed by washing with excess
base buffer. Prehybridized primer FP2/PhiX_matchA template DNA was
then injected into the flow cell and allowed to bind to the
streptavidin layer for approximately 180 seconds, followed by
washing with excess base buffer. For sequencing, solutions
containing 50 nM Klenow fragment were prepared in base buffer with
100 nM of either dATP, dCTP, dTTP, or dGTP. The dNTP solutions were
individually injected into the flow cell (in the order G, A, A, T,
C, G), and allowed to incubate for approximately 180 seconds in
order to examine the SPRi response. If there was no/low signal
change, then the flow cell was washed with excess base buffer. If
the SPR signal indicated a base match, then the flow cell was
washed with incorporation buffer (containing 10 mM Mg2+) for 30
seconds to incorporate the correct dNTP, followed by wash with base
buffer. The examination, incorporation, and wash steps were
repeated.
FIG. 9 shows the sensorgram recorded for the identification of
three mismatched bases and three correct bases. The first three
correct conjugate bases of the phiX_matchA template after the
annealed primer sequence were A, T, and G. The first solution
flowed over the sensor contained polymerase and dGTP, which
corresponded to a base pair mismatch. The resulting sensor trace
showed little change in baseline reflectance, indicating that the
polymerase molecule did not bind to the primed template strand. The
next solution flowed over the sensor contained polymerase and dATP,
which corresponded to the correct conjugate base. The resulting
trace (highlighted in the gray box), showed a strong increase in
reflected light indicating that the polymerase had bound to the
primed template strand, thereby shifting the position of the SPR.
After allowing the polymerase solution to incubate for
approximately 180 seconds (to ensure saturation of available
binding sites), incorporation solution containing 10 mM Mg2+ was
introduced into the flow cell. The introduction of Mg2+ allowed the
polymerase to incorporate the bound dATP into the primer strand
bound to the template. To ensure successful incorporation of dATP,
the polymerase-dATP solution was again flowed over the sensor chip.
This time, however, the amount of the reflected light did not
increase as strongly as before indicating that the polymerase did
not bind to the template strand as the correct cognate base was no
longer A. To examine the next correct base, a solution of
polymerase and dTTP was flowed over the sensor. Once again the
intensity of reflected light increased above the threshold value
indicating that the incorporation of dATP was successful and the
next correct base was T, as expected. Incorporation buffer was
flowed over the sensor chip to incorporate the base. The process
was repeated two more time using a mismatch (polymerase-dCTP),
followed by a match (polymerase-dGTP). In both cases the expected
response was observed indicating that the next correct conjugate
base was in fact G.
Example 10 describes procedures that demonstrated sequencing of a
double-stranded DNA template.
Example 10
Sequencing Double-Stranded DNA by Nick Translation
Materials and methods used in the procedure were as follows. The
DNA sequence of template oligonucleotide Btn-4460-4509S having a 3'
inverted dT was:
Biotin-5'-GTGAGCCTGCAATCCCTGCCCCGGTTCATCCTGCTGGAGCTCATGGCGGG-3'-(-
3'-dT-5') (SEQ ID NO:9). The DNA sequence of primer oligonucleotide
4496-4509AS was: 5'-CCCGCCATGAGCTC-3' (SEQ ID NO:10). The DNA
sequence of oligonucleotide 4460-4494AS was:
5'-AGCAGGATGAACCGGG/i5NitInd/CAGGGATTGCAGGCTCAC-3' (SEQ ID NO:11),
where "/i5NitInd/" is a 5-nitroindole-2'-deoxyribose residue.
5-Nitroindole is intended to prevent formation of guanine tetrads
in this context and serves as a universal base. Oligonucleotides
were prepared in TE Buffer (10 mM Tris pH 8.0, 0.1 mM EDTA) to 100
.mu.M. To prepare the ssDNA primer/template, oligonucleotides
Btn-4460-4509S and 4496-4509AS were combined (10 .mu.M each strand)
in a tube containing Annealing Buffer (10 mM Tris buffer (pH 8.0),
0.1 mM EDTA, 80 mM KCl). To prepare the dsDNA primer/template with
a 1-base pair gap, oligonucleotides Btn-4460-4509S, 4496-4509AS and
4460-4494AS were combined (10 .mu.M each strand) in a tube
containing Annealing Buffer. The tubes containing oligonucleotide
solutions were loaded onto a dry heat block (95.degree. C. for 5
minutes), and the block was transferred to the bench top to anneal
strands by gradually cooling to ambient temperature. Full-length
DNA polymerase encoded by Bacillus stearothermophilus ("Bst DNA
polymerase", recombinant enzyme purified from Escherichia coli) was
purchased from New England Biolabs (Ipswich, Mass.; catalog no.
M0328L). Ultra-pure bovine serum albumin (BSA) was purchased from
Ambion (Foster City, Calif.). All reagents and solutions were
molecular biology grade. Primer-template duplex was diluted (100
.mu.M) into Annealing Buffer. Binding buffer was 50 mM Tris buffer
(pH 8.0), 300 mM KCl, 0.1% (v/v) Triton-X100, 100 .mu.g/mL bovine
serum albumin. Reaction Buffer was Binding Buffer containing 10 mM
MgCl2. Buffer containing Primer-Template (PT), Binding buffer
containing one dNTP, and Reaction Buffer were loaded (200
.mu.L/well) into a Greiner 96-well black microplate (Sigma-Aldrich,
St. Louis, Mo.; catalog number M9685), and PCR-grade mineral oil
(Sigma-Aldrich, St. Louis, Mo.; catalog no. M8662) was applied (75
.mu.L/well). Streptavidin (SA) Biosensors (Pall ForteBio Corp.,
Menlo Park, Calif.; catalog number 18-5019) were re-hydrated in
Annealing Buffer for approximately 10 minutes before use. The Octet
QK biosensor system (Pall ForteBio Corp., Menlo Park, Calif.) was
set for 30.degree. C. operation and was programmed to coat the
biosensors with Primer-Template and wash away unbound
Primer-Template with Binding Buffer. Biosensors were transferred to
Binding Buffer containing 136 Unit/mL Bst DNA Polymerase and 200
.mu.M dNTP (dATP, dTTP, dGTP or dCTP) as indicated (association
phase) followed by Reaction Buffer for dNTP incorporation.
Biosensors were transferred to Reaction Buffer containing Bst DNA
Polymerase (136 Unit/mL) without dNTP to promote nick translation
via 5'-3' exonuclease activity. Biosensors were transferred to
Reaction Buffer without enzyme or magnesium (dissociation phase).
Similarly, biosensors were transferred to solutions containing
individual deoxyribonucleoside triphosphates (dATP, dGTP, dCTP or
dTTP) in a cyclical fashion, as indicated. Cycles of binding and
incorporation and 5'-3' exonucleolytic cleavage were repeated
multiple times to assess sequencing. Monitoring data generated by
the Octet interferometry instrument were imported into Microsoft
Excel and Prism software (GraphPad Software, San Diego, Calif.) for
display.
Results from the procedure are shown in FIGS. 10A-10C. In assays
for binding to biosensor coated with primer-template, the
combination of Bst DNA polymerase and correct
2'-deoxyribonucleoside triphosphate (dCTP) exhibit distinct peak
for binding in the association phase (FIGS. 10A, 10B, and 10C, dCTP
"C"). Cycle 1 demonstrates binding and incorporation to the one
base pair gap in the dsDNA template (FIGS. 10A and 10B) and
incorporation of correct nucleotide downstream of the primer in the
control ssDNA template (FIG. 10C). Controls lacking dNTP show
minimal binding (FIGS. 10A, 10B, and 10C, cycles 1-7). Cycle 2
shows binding of polymerase to dsDNA template in combination with
the next correct nucleotide, dATP (FIGS. 10A and 10B, dATP "A"),
which is less than that of the unobstructed ssDNA template (FIG.
10C, dATP "A") indicates that the exonucleolytic cleavage of the
complementary strand was not complete. The time course for binding
and dissociation demonstrate sequencing for the first three cycles
(nucleotide sequence CAG) of dsDNA (FIGS. 10A and 10B) and ssDNA
(FIG. 10C). As expected the fourth cycle with the incorrect
nucleotide dTTP did not produce a binding peak (FIGS. 10A, 10B, and
10C). These results demonstrate the ability to sequence
double-stranded DNA by nick translation using the DNA polymerase
and 5'-3' exonuclease activities of Bst DNA polymerase.
Example 11 describes additional procedures used to demonstrate
sequencing on a double-stranded DNA template.
Example 11
Sequencing Double-Stranded DNA by Strand Displacement
Materials and methods used in the procedure were as follows. The
DNA sequence of template oligonucleotide Btn-4460-4509S with 3'
inverted dT was:
Biotin-5'-GTGAGCCTGCAATCCCTGCCCCGGTTCATCCTGCTGGAGCTCATGGCGGG-3'-(3'--
dT-5') (SEQ ID NO:9). The DNA sequence of primer oligonucleotide
4496-4509AS was: 5'-CCCGCCATGAGCTC-3' (SEQ ID NO:10). The DNA
sequence of oligonucleotide 4460-4494AS was:
5'-AGCAGGATGAACCGGG/i5NitInd/CAGGGATTGCAGGCTCAC-3' (SEQ ID NO: 11),
where "/i5NitInd/" is a 5-nitroindole-2'-deoxyribose residue.
5-Nitroindole is intended to prevent formation of guanine tetrads
in this context and serves as a universal base. The DNA sequence of
oligonucleotide 4460-4494AS-T8 was:
5'-TTTTTTTTAGCAGGATGAACCGGG/i5NitInd/CAGGGATTGCAGGCTCAC-3' (SEQ ID
NO:12), where "/i5NitInd/" is a 5-nitroindole-2'-deoxyribose
residue. 5-Nitroindole is intended to prevent formation of guanine
tetrads in this context and serves as a universal base.
Oligonucleotides Btn-4460-4509S, 4460-4494AS, 4496-4509AS and
4460-4494AS-T8 were synthesized and analyzed (liquid
chromatography-mass spectrometry (LC-MS) and electrospray
ionization (ESI)) by Integrated DNA Technologies (Coralville,
Iowa). Oligonucleotides were prepared in TE Buffer (10 mM Tris
buffer (pH 8.0), 0.1 mM EDTA) to 100 .mu.M. To prepare the ssDNA
primer/template, oligonucleotides Btn-4460-4509S and 4496-4509AS
were combined (10 .mu.M each strand) in a tube containing Annealing
Buffer (10 mM Tris buffer (pH 8.0), 0.1 mM EDTA, 80 mM KCl). To
prepare the dsDNA primer/template with a 1-base gap,
oligonucleotides Btn-4460-4509S, 4496-4509AS and 4460-4494AS were
combined (10 .mu.M each strand) in a tube containing Annealing
Buffer. To prepare the dsDNA primer/template with a 5'-oligo-dT
flap and 1-base gap, oligonucleotides Btn-4460-4509S, 4496-4509AS
and 4460-4494-AS-T8 were combined (10 .mu.M each strand) in a tube
containing Annealing Buffer. The tubes containing oligonucleotide
solutions were loaded onto a dry heat block (95.degree. C. for 5
minutes), and the block was transferred to the bench top to anneal
strands by gradual cooling to ambient temperature. Klenow (3'-*5'
exo(-)) fragment of E. coli DNA polymerase was purchased from
Enzymatics (Beverly, Mass.; catalog no. P7010-LC-L). Ultra-pure
bovine serum albumin (BSA) was purchased from Ambion (Foster City,
Calif.). All reagents and solutions were molecular biology grade.
Primer-template duplex was diluted (50 nM) into Annealing Buffer.
Binding buffer was 20 mM Tris, pH 8.0, 300 mM KCl, 0.01% (v/v)
Tween-20, 100 .mu.g/mL bovine serum albumin, 1.0 mM dithiothreitol.
Reaction Buffer was Binding Buffer containing 50 mM KCl and 10 mM
MgCl2. Buffer containing Primer-Template (PT), Binding buffer
containing one dNTP, and Reaction Buffer were loaded (200
.mu.L/well) into a Greiner 96-well black microplate (Sigma-Aldrich,
St. Louis, Mo.; catalog number M9685), and PCR-grade mineral oil
(Sigma-Aldrich, St. Louis, Mo.; catalog no. M8662) was applied (75
.mu.L/well). Streptavidin (SA) Biosensors (Pall ForteBio Corp.,
Menlo Park, Calif.; catalog number 18-5019) were re-hydrated in
Annealing Buffer for approximately 10 minutes before use. The Octet
QK biosensor system (Pall ForteBio Corp., Menlo Park, Calif.) was
set for 30.degree. C. operation and was programmed to coat the
biosensors with Primer-Template and wash away unbound
Primer-Template with Binding Buffer. Biosensors were transferred to
Binding Buffer containing Klenow exo(-) (68 Unit/mL) and 100 .mu.M
dNTP (dATP, dTTP, dGTP or dCTP) as indicated (association phase)
followed by Reaction Buffer for dNTP incorporation. Biosensors were
transferred to Reaction Buffer without enzyme or magnesium
(dissociation phase). Similarly, biosensors were transferred
cyclically to solutions containing individual deoxyribonucleoside
triphosphates (dATP, dGTP, dCTP or dTTP) as indicated. Cycles of
binding and incorporation were repeated multiple times to assess
sequencing. Monitoring data generated by the Octet interferometry
instrument were imported into Microsoft Excel and Prism software
(GraphPad Software, San Diego, Calif.) for display.
Results from the procedure are shown in FIGS. 11A-11C. In assays
for binding to biosensor coated with ssDNA primer-template, Klenow
exo(-) yielded binding peaks in the presence of the correct
individual dNTPs but not with the incorrect dTTP nucleotide (FIG.
11A, dark trace). By contrast, the negative control (enzyme without
dNTP) failed to bind as shown by a consistently flat binding
response (FIG. 11A, gray trace). Thus, Klenow exo(-) yielded a
sequence of CAGCAG (C?)A (SEQ ID NO:13), which is 88% identical to
the expected sequence (CAGCAGGA (SEQ ID NO: 1)). In assays for
binding to biosensor coated with dsDNA primer-template with a
1-base gap between the anti-sense primer and the downstream
antisense strand, Klenow exo(-) yielded a binding peak only in the
presence of the first correct individual dCTP nucleotide (FIG. 11B,
dark trace). The negative control (enzyme without dNTP) failed to
bind as shown by a consistently flat binding response (FIG. 11B,
gray trace). Thus, Klenow exo(-) yielded a sequence of "C" in which
the first base of the gap is filled with the correct nucleotide.
However, in subsequent cycles further binding or polymerization
into the double-stranded DNA region is blocked. Blockage of further
sequencing is likely due to the inherent lack of the 5'-3'
exonuclease domain of Klenow exo(-) (for nick translation) or to
inability to disrupt the downstream double-stranded helix of DNA
(strand displacement). Therefore, a 5'-oligo-dT flap was introduced
to provide a better substrate to Klenow exo(-) for strand
displacement. Biosensors were coated with dsDNA primer-template
bearing a 5'-oligo-dT flap with a 1-base gap between the anti-sense
primer and the downstream antisense strand. Klenow exo(-) yielded
binding peaks in the 1-base gap (C) of cycle #1, and additional
binding peaks were observed into the dsDNA region providing the
sequence AGC for cycle #2, 3 and 5 (FIG. 11C, dark trace). Cycles
#4, 6, 7 and 8 with the incorrect dNTP did not afford binding of
enzyme to the immobilized DNA (FIG. 11C). The negative control
(enzyme without dNTP) failed to bind as shown by a flat binding
response (FIG. 11C, gray trace). Thus, Klenow exo(-) yielded a 100%
correct sequence of "CAGC" in which the first base of the gap was
filled with the correct nucleotide, and further binding or
polymerization was observed for three additional bases into the
double-stranded DNA region. The 5'-flap adjacent to the
double-stranded DNA region enabled Klenow exo(-) to sequence by
strand displacement (FIG. 11C), whereas lack of the 5'-flap blocked
sequencing into the dsDNA region (FIG. 11B). These results
demonstrate the ability to sequence double-stranded DNA using
Klenow exo(-) fragment of DNA polymerase by a strand displacement
mechanism.
Example 12 describes procedures that investigated the effect of
glutamate anions on the sequencing reaction.
Example 12
Effect of Anions on Single Stranded DNA Sequencing
To prepare the ssDNA primer/template, oligonucleotides
Btn-4460-4509S (SEQ ID NO:9) and 4496-4509AS (SEQ ID NO:10) were
combined (10 .mu.M each strand) in a tube containing Annealing
Buffer (10 mM Tris pH 8.0, 0.1 mM EDTA, 80 mM KCl). Tubes
containing oligonucleotide solutions were loaded onto a dry heat
block (95.degree. C. for 5 minutes), and the block was transferred
to the bench top to anneal strands by gradually cooling to ambient
temperature. Klenow (3'.fwdarw.5' exo(-)) fragment of E. coli DNA
polymerase was purchased from Enzymatics (Beverly, Mass.; catalog
no. P7010-LC-L). Potassium glutamate was purchased from (Teknova,
Hollister, Calif.; catalog no. P2000). Ultra-pure bovine serum
albumin (BSA) was purchased from Ambion (Foster City, Calif.). All
reagents and solutions were molecular biology grade. Binding buffer
was 20 mM Tris buffer (pH 8.0), 300 mM KCl, 0.01% (v/v) Tween-20,
100 .mu.g/mL bovine serum albumin, 1.0 mM dithiothreitol. Reaction
Buffer was Binding Buffer containing 50 mM KCl and 10 mM MgCl2. For
each level of potassium glutamate tested, the Binding Buffers were
prepared to contain 0, 50, 100 or 200 mM potassium glutamate.
Reaction Buffers did not contain potassium glutamate. The Octet QK
biosensor system was set up as described in Example 11 Biosensors
were transferred to Binding Buffer containing Klenow exo(-) (68
Unit/mL) and 100 .mu.M dNTP (dATP, dTTP, dGTP or dCTP) as indicated
(association phase) followed by Reaction Buffer for dNTP
incorporation. Biosensors were transferred to Reaction Buffer
containing magnesium without enzyme (dissociation phase).
Biosensors were transferred to Binding Buffers without enzyme or
dNTP but containing the respective concentrations of potassium
glutamate to re-equilibrate. Similarly, biosensors were transferred
to solutions containing individual deoxyribonucleoside
triphosphates (dATP, dGTP, dCTP or dTTP) in a cycical fashion, as
indicated. Cycles of binding and incorporation were repeated
multiple times to assess sequencing. Monitoring data generated by
the Octet interferometry instrument were imported into Microsoft
Excel and Prism software (GraphPad Software, San Diego, Calif.) for
display.
Results of the procedure are shown in FIGS. 12A-12C. In assays for
binding to biosensor coated with ssDNA primer-template, Klenow
exo(-) (KCl without glutamate) yielded binding peaks for sequencing
using the correct nucleotides as did enzyme in KCl containing 200
mM glutamate (FIG. 12A, dotted line and solid line, respectively).
However, buffers without glutamate exhibited decreased amplitude of
binding peaks combined with increasing background compared to
formulations with 200 mM glutamate (FIG. 12A). Correct sequence was
observed in KCl and 200 mM glutamate formulations according to the
relative peak heights for mixtures containing enzyme and correct
dNTP (but not incorrect dNTP) over a 8.25-hour time course (FIG.
12A). Homopolymer runs appear to be detected as a single peak under
these conditions. (FIGS. 12A, 12B, and 12C). In buffers containing
KCl and 100 mM glutamate, correct sequences were observed with
strong peak signal for enzyme and correct dNTP over the course of 7
hours, whereas the control (enzyme without dNTP) produced no peaks
and a gradual increase in background (FIG. 12B). Buffers containing
KCl and 50 mM glutamate show correct sequences over the course of 7
hours, whereas the control enzyme without dNTP yielded no binding
peaks and a flat, stable background (FIG. 12C). These results
demonstrate the ability to sequence single-stranded DNA using
Klenow exo(-) fragment of DNA polymerase with enhancement by
potassium glutamate and protection from evaporation by mineral oil
overlay.
Example 13 describes procedures used to demonstrate detection of
small quantities of mutant sequence in the presence of similar
sequences using ssDNA or dsDNA templates.
Example 13
Detecting a Point Mutation in a Wild-Type Background by Sequencing
Single-Stranded DNA and Double-Stranded 5'-Flap DNA
Materials and methods used in the procedure were as follows. The
DNA sequence of template oligonucleotide Btn-4460-4509S with 3'
inverted dT was:
Biotin-5'-GTGAGCCTGCAATCCCTGCCCCGGTTCATCCTGCTGGAGCTCATGGCGGG-3'-(3'--
dT-5') (SEQ ID NO:9). The DNA sequence of template oligonucleotide
Btn-4460-4509S C4493A with 3' inverted dT was:
Biotin-5'-GTGAGCCTGCAATCCCTGCCCCGGTTCATCCTGATGGAGCTCATGGCGGG-3'-(3'-dT-5'-
) (SEQ ID NO:21). The DNA sequence of primer oligonucleotide
4496-4509AS was: 5'-CCCGCCATGAGCTC-3' (SEQ ID NO:10). The DNA
sequence of oligonucleotide 4460-4494AS-T8 was:
5'-TTTTTTTTTTAGCAGGATGAACCGGG/i5NitInd/CAGGGATTGCAGGCTCAC-3' (SEQ
ID NO:12), where "/i5NitInd/" is a 5-nitroindole-2'-deoxyribose
residue. 5-Nitroindole is intended to prevent formation of guanine
tetrads in this context and serves as a universal base.
Oligonucleotides Btn-4460-4509S, Btn-4460-4509S C4493A, 4496-4509AS
and 4460-4494AS-T8 were synthesized and analyzed (liquid
chromatography-mass spectrometry (LC-MS) and electrospray
ionization (ESI)) by Integrated DNA Technologies (Coralville,
Iowa). Oligonucleotides were prepared in TE Buffer (10 mM Tris
buffer (pH 8.0), 0.1 mM EDTA) to 100 .mu.M. To prepare the ssDNA
primer/template, oligonucleotides Btn-4460-4509S (or C4493A) and
4496-4509AS were combined (10 .mu.M each strand) in a tube
containing Annealing Buffer (10 mM Tris buffer (pH 8.0), 0.1 mM
EDTA, 80 mM KCl). To prepare the dsDNA primer/template with a
5'-oligo-dT flap and 1-base gap, oligonucleotides Btn-4460-4509S
(or C4493A), 4496-4509AS and 4460-4494-AS-T8 were combined (10
.mu.M each strand) in a tube containing Annealing Buffer. The tubes
containing oligonucleotide solutions were loaded onto a dry heat
block (95.degree. C. for 5 min), and the block was transferred to
the bench top to anneal strands by gradual cooling to ambient
temperature. Klenow (3'-*5' exo(-)) fragment of E. coli DNA
polymerase was purchased from Enzymatics (Beverly, Mass.; catalog
no. P7010-LC-L). Ultra-pure bovine serum albumin (BSA) and
UltraPure Salmon Sperm DNA Solution were purchased from Life
Technologies (Foster City, Calif.). Nickel(II) sulfate hexahydrate
(catalog no. 467901), dCDP, dGDP and dTDP were purchased from Sigma
(St. Louis, Mo.). All reagents and solutions were molecular biology
grade. Primer-template duplex was diluted (50 nM) into Annealing
Buffer. Wash buffer was 20 mM Tris, pH 8.0, 200 mM KCl, 200 mM
potassium glutamate, 0.01% (v/v), Tween-20, 100 .mu.g/mL bovine
serum albumin, 1.0 mM dithiothreitol. Binding Buffer was Wash
Buffer containing 2.0 mM Ni(II)SO4. Reaction Buffer was 20 mM Tris,
pH 8.0, 50 mM KCl, MgCl2 (10 mM), 0.01% (v/v) Tween-20, 100
.mu.g/mL bovine serum albumin, 1.0 mM dithiothreitol. EDTA Wash
Buffer was Binding Buffer containing 100 .mu.M EDTA. Buffer
containing Primer-Template (PT), Binding buffer containing one dNTP
and Reaction Buffer were loaded (200 .mu.L/well) into a Greiner
96-well black microplate (Sigma-Aldrich, St. Louis, Mo.; catalog
number M9685), and PCR-grade mineral oil (Sigma-Aldrich, St. Louis,
Mo.; catalog no. M8662) was applied (75 .mu.L/well). High-precision
streptavidin biosensors (Pall ForteBio Corp., Menlo Park, Calif.;
catalog number 18-5117) were re-hydrated in Annealing Buffer for
approximately 10 minutes before use. The Octet QK biosensor system
(Pall ForteBio Corp., Menlo Park, Calif.) was set for 30.degree. C.
operation and was programmed to coat the biosensors with
Primer-Template and wash away unbound Primer-Template with Wash
Buffer. Biosensors were transferred to Binding Buffer containing
Klenow exo(-) (68 Unit/mL), Ni(II)SO4 (1.5 mM) and 100 .mu.M dNTP
(dATP, dTTP, dGTP or dCTP) as indicated (association phase)
followed by dNTP incorporation (dissociation phase) in Reaction
Buffer containing MgCl2 (10 mM). Biosensors were transferred to
EDTA Wash Buffer followed by re-equilibration in Reaction Buffer
without enzyme, nucleotide or divalent cation. Similarly,
biosensors were transferred to solutions containing individual
deoxyribonucleoside triphosphates (dATP, dGTP, dCTP or dTTP) in a
cycical fashion, as indicated. Cycles of binding and incorporation
were repeated for each dNTP to assess sequencing. Monitoring data
generated by the Octet interferometry instrument were imported into
Microsoft Excel and Prism software (GraphPad Software, San Diego,
Calif.) for display.
Results of the procedure are shown in FIGS. 13A-13C. In assays for
binding to biosensor coated with ssDNA primer-template, Klenow
exo(-) enzyme bound strongly to the biosensor in the presence of
correct dNTP in cycles 1-2 (FIG. 13A). The "G" peak in cycle 3
shows increasing peak height in mixtures containing increasing
concentrations of ALK wild-type template (FIG. 13A). The "T" peak
in cycle 4 shows increasing peak heights in mixtures containing
increasing concentrations of ALK C4493A mutation. The "T" readout
at cycle 4 corresponds to the antisense nucleotide of the C4493A
mutant. Both ALK wild-type and C4493A templates produce full-height
peaks of "C" and "A" in cycles 5 and 6. Peaks indicate correct
sequences for ALK wild-type (CAGCA) and ALK C4493A (CATCA) in FIG.
13A. Peak intensities during sequencing allow quantitation of
mutant allele in mixtures with wild-type sequence. The intensity of
cycle 4 peak (T) was proportional to the quantity of ALK C4493A
mutant sequence in the ALK wild-type background for ssDNA (FIG.
13B) and dsDNA-flap (FIG. 13C). Similarly, the cycle 3 peak (G)
decreased linearly with increasing mutant concentration in the
ssDNA template (FIG. 13B), and peak 3 intensity decreased with
mutant concentration for the dsDNA-flap template (FIG. 13C). In a
wild-type background, as little as 5% of a mutant sequence could be
detected in either ssDNA or dsDNA-flap templates.
Example 14 describes procedures that were used to demonstrate
stabilization of ternary complexes by different divalent
cations.
Example 14
Effect of Divalent Cations on Stabilizing the Ternary Complex and
Polymerase Catalysis
Materials and methods used in the procedure were as follows. The
DNA sequence of template oligonucleotide Btn-4460-4509S C4493A with
3' inverted dT was:
Biotin-5'-GTGAGCCTGCAATCCCTGCCCCGGTTCATCCTGATGGAGCTCATGGCGGG-3'-(3'-dT-5'-
) (SEQ ID NO:21). The DNA sequence of primer oligonucleotide
4496-4509AS was: 5'-CCCGCCATGAGCTC-3' (SEQ ID NO:10).
Oligonucleotides Btn-4460-4509S C4493A and 4496-4509AS were
synthesized and analyzed (liquid chromatography-mass spectrometry
(LC-MS) and electrospray ionization (ESI)) by Integrated DNA
Technologies (Coralville, Iowa). Oligonucleotides were prepared in
TE Buffer (10 mM Tris buffer (pH 8.0), 0.1 mM EDTA) to 100 .mu.M.
To prepare the ssDNA primer/template, oligonucleotides
Btn-4460-4509S C4493A and 4496-4509AS were combined (10 .mu.M each
strand) in a tube containing Annealing Buffer (10 mM Tris buffer
(pH 8.0), 0.1 mM EDTA, 80 mM KCl). The tubes containing
oligonucleotide solutions were loaded onto a dry heat block
(95.degree. C. for 5 minutes), and the block was transferred to the
bench top to anneal strands by gradually cooling to ambient
temperature. Klenow (3'.fwdarw.5' exo(-)) fragment of E. coli DNA
polymerase was purchased from Enzymatics (Beverly, Mass.; catalog
no. P7010-LC-L). Ultra-pure bovine serum albumin (BSA) and
UltraPure Salmon Sperm DNA Solution were purchased from Life
Technologies (Foster City, Calif.). Strontium chloride, calcium
chloride, manganese chloride, barium chloride, cobalt chloride,
zinc chloride, copper(II) chloride, ferrous ammonium sulfate,
ammonium sulfate, nickel(II) sulfate hexahydrate, dCDP, dGDP and
dTDP were purchased from Sigma (St. Louis, Mo.). All reagents and
solutions were molecular biology grade. Primer-template duplex was
diluted (100 nM) into Annealing Buffer. Wash buffer was 20 mM Tris
buffer (pH 8.0), 50 mM KCl, 0.01% (v/v) Tween-20, 100 .mu.g/mL
bovine serum albumin, 1.0 mM dithiothreitol. Binding Buffer was 20
mM Tris buffer (pH 8.0), 200 mM KCl, 200 mM potassium glutamate,
0.01% (v/v) Tween-20, 100 .mu.g/mL bovine serum albumin, 1.0 mM
dithiothreitol. Reaction Buffer was 20 mM Tris buffer (pH 8.0), 50
mM KCl, 0.01% (v/v) Tween-20, 100 .mu.g/mL bovine serum albumin,
1.0 mM dithiothreitol and the indicated divalent cation. EDTA Wash
Buffer was Binding Buffer containing 100 .mu.M EDTA. Buffer
containing Primer-Template (PT), Binding buffer containing one dNTP
and Reaction Buffer were loaded (200 .mu.L/well) into a Greiner
96-well black microplate (Sigma-Aldrich, St. Louis, Mo.; catalog
number M9685), and PCR-grade mineral oil (Sigma-Aldrich, St. Louis,
Mo.; catalog no. M8662) was applied (75 .mu.L/well). High-precision
streptavidin biosensors (Pall ForteBio Corp., Menlo Park, Calif.;
catalog number 18-5117) were re-hydrated in Annealing Buffer for
approximately 10 minutes before use. The Octet QK biosensor system
(Pall ForteBio Corp., Menlo Park, Calif.) was set for 30.degree. C.
operation and was programmed to coat the biosensors with
Primer-Template and wash away unbound Primer-Template with Wash
Buffer. To measure the initial level of unincorporated
primer/template, biosensors were transferred to Binding Buffer
containing Klenow exo(-) (68 Unit/mL), SrCl2 (2.0 mM) and 100 .mu.M
dCTP (association phase) followed by Wash Buffer containing SrCl2
(2.0 mM) and salmon sperm DNA trap (500 .mu.g/mL) without MgCl2.
Sensors were transferred to Wash Buffer containing and salmon sperm
DNA trap (500 .mu.g/mL) without MgCl2, followed by EDTA Wash Buffer
and re-equilibration in Binding Buffer. Binding to unincorporated
primer/template was measured and stability of the ternary complex
in divalent cation-free Binding Buffer was monitored. Biosensors
were transferred to Binding Buffer containing Klenow exo(-) (68
Unit/mL), either CoCl2 (1.0 mM) or the indicated divalent cation
(2.0 mM), and 100 .mu.M dCTP (association phase) followed by Wash
Buffer containing the same concentration of the same divalent
cation and salmon sperm DNA trap (500 .mu.g/mL) without MgCl2.
Sensors were transferred to Wash Buffer containing and salmon sperm
DNA trap (500 .mu.g/mL) without MgCl2, followed by EDTA Wash Buffer
and re-equilibration in Binding Buffer. Stabilization of the
ternary complex in Binding Buffers containing various divalent
cations without dNTP was measured. Biosensors were transferred to
Binding Buffer containing Klenow exo(-) (68 Unit/mL), either CoCl2
(1.0 mM) or the indicated divalent cation (2.0 mM), and 100 .mu.M
dCTP (association phase) followed by Wash Buffer containing the
same divalent cation and salmon sperm DNA trap (500 .mu.g/mL)
without MgCl2. Sensors were transferred to Wash Buffer containing
and salmon sperm DNA trap (500 .mu.g/mL) with 10 mM MgCl2, followed
by EDTA Wash Buffer and re-equilibration in Binding Buffer.
Finally, nucleotide incorporation was determined by measuring the
remaining unincorporated primer/template. Biosensors were
transferred to Binding Buffer containing Klenow exo(-) (68
Unit/mL), SrCl2 (2.0 mM) and 100 .mu.M dCTP (association phase)
followed by Wash Buffer containing SrCl2 (2.0 mM) and salmon sperm
DNA trap (500 .mu.g/mL) without MgCl2. Sensors were transferred to
Wash Buffer containing and salmon sperm DNA trap (500 .mu.g/mL)
without MgCl2, followed by EDTA Wash Buffer and re-equilibration in
Binding Buffer. Monitoring data generated by the Octet
interferometry instrument were imported into Microsoft Excel and
Prism software (GraphPad Software, San Diego, Calif.) for
display.
Results of the procedure are shown on FIGS. 14A-14B. Assays were
performed for binding of polymerase and dCTP to biosensor coated
with ssDNA primer-template. In the first non-catalytic cycle,
Klenow exo(-) enzyme bound strongly to the biosensor in the
presence of correct nucleotide (dCTP) and SrCl2 followed by wash
that returns to baseline (FIG. 14A, Peak #1). In the second
(non-catalytic) cycle, the sensors are bound strongly by enzyme and
dCTP in the presence of Ni(II)SO4, BaCl2 and SrCl2 but not EDTA
(FIG. 14 A, Peak #2-3). Wash Buffer containing Ni(II)SO4 stabilizes
the ternary complex over the course of 10 minutes (FIG. 14A, Peak
#2-3). Signal decreases in the presence of Mg2+(FIG. 14A, Peak #3
dissociation) which corresponds to incorporation as evidenced by
low levels of Sr2+-mediated binding by Klenow exo(-) and dCTP (FIG.
14A, Peak #4). These results demonstrate the ability of Ni2+ to
stabilize the ternary complex of Klenow exo(-), dNTP and ssDNA
primer/template in buffers lacking dNTP, and this stabilization is
compatible with enzymatic incorporation of nucleotide by the DNA
polymerase. Klenow exo(-) exhibits polymerase activity in the
presence of alternative divalent cations other than magnesium ion.
Assays were performed for binding of polymerase and dCTP to
biosensor coated with ssDNA primer-template. In the first
non-catalytic cycle, Klenow exo(-) enzyme bound strongly to the
biosensor in the presence of correct nucleotide (dCTP) and SrCl2
followed by wash that returns to baseline (FIG. 14B, Peak #1). In
the second binding cycle, the sensors are bound strongly by enzyme
and dCTP in the presence of SrCl2 or ammonium sulfate (FIG. 14B,
Peak #2-3). However, several divalent cations (Cu2+, Ca2+, Co2+,
Fe2+, Zn2+) displayed a transient peak for binding immobilized
primer/template by Klenow exo(-) and dCTP in the Binding Buffer
(FIG. 14B, Peak 2). Following the disappearance of the transient
peak (Ca2+, Co2+, Fe2+, Zn2+) or the flat peak (Mn2+), Wash Buffer
containing the same divalent cations and salmon sperm DNA trap or
trap alone did not further decrease the binding signal (except for
Ca2+ brought to baseline) in FIG. 14A (Peak #2). In cycle 3, a
second exposure of biosensors to enzyme, dCTP and the divalent
cations Ca2+, Co2+, Fe2+, Zn2+ did not exhibit appreciable binding
(FIG. 14B, Peak 3), nor did the standard Sr2+-mediated binding
control (FIG. 14B, Peak 4). To a lesser extent, Cu2+ also appears
to enhance polymerase activity by Klenow exo(-), because the second
exposure to Cu2+(FIG. 14B, Peak 3) was less than the first Cu2+
binding (FIG. 14B, Peak 2). This lack of binding signal for
divalent cations (Ca2+, Co2+, Fe2+, Zn2+, Mn2+) after the first
exposure to enzyme and dNTP and failure of Sr2+-mediated control
conditions to support binding suggests that complete nucleotide
incorporation was achieved using certain divalent cations (Ca2+,
Co2+, Fe2+, Zn2+, Mn2+) in the absence of Mg2+, and these transient
peaks can be used for DNA sequencing.
Example 15 describes procedures employing the Co2+ divalent
cation.
Example 15
Long Read-Lengths by Sequencing Single-Stranded DNA Using
CoCl2-Mediated Binding and Catalysis
Materials and methods used in the procedure were as follows. The
DNA sequence of template oligonucleotide phiX_100 mismatch was:
Biotin-5'-GGCAAATCACCAGAAGGCGGTTCCTGAATGAATGGGAAGCCTTCAAGAA-GGTGATAAGCAGG-
AGAAACATACGAAGCATCATAACGATACCACTGACCC-3' (SEQ ID NO:22). The DNA
sequence of primer oligonucleotide FP2 was:
5'-GAGGGTCAGTGGTATCGTTATG-3' (SEQ ID NO:5). Oligonucleotides were
synthesized and analyzed (liquid chromatography-mass spectrometry
(LC-MS) and electrospray ionization (ESI)) by Integrated DNA
Technologies (Coralville, Iowa). Oligonucleotides were prepared in
TE Buffer (10 mM Tris pH 8.0, 0.1 mM EDTA) to 100 .mu.M. To prepare
the ssDNA primer/template, oligonucleotides "phiX_100mismatch" and
"FP2" were combined (10 .mu.M each strand) in a tube containing
Annealing Buffer (10 mM Tris pH 8.0, 0.1 mM EDTA, 80 mM KCl). The
tube containing oligonucleotide solutions was loaded onto a dry
heat block (95.degree. C. for 5 min), and the block was transferred
to the bench top to anneal strands by gradual cooling to ambient
temperature. Klenow (3'-+5' exo(-)) fragment of E. coli DNA
polymerase was purchased from Enzymatics (Beverly, Mass.; catalog
no. P7010-LC-L). Ultra-pure bovine serum albumin (BSA) and
UltraPure Salmon Sperm DNA Solution were purchased from Life
Technologies (Foster City, Calif.). Saccharomyces cerevisiae
nucleoside diphosphate kinase (NDPK) enzyme (catalog no. N0379),
adenosine diphosphate (ADP) and cobalt(II) chloride hexahydrate
(catalog no. 255599) were purchased from Sigma (St. Louis, Mo.).
All reagents and solutions were molecular biology grade.
Primer-template duplex was diluted (100 nM) into Annealing Buffer.
Wash Buffer was 20 mM Tris, pH 8.0, 200 mM KCl, 200 mM potassium
glutamate, 0.01% (v/v) Tween-20, 100 .mu.g/mL bovine serum albumin,
1.0 mM dithiothreitol. Binding Buffer was Wash Buffer containing
low CoCl2 (0.050 mM). Reaction Buffer was Binding Buffer containing
high CoCl2 (15 mM). EDTA Wash Buffer was Binding Buffer containing
1.0 mM EDTA. Buffer containing Primer-Template (PT), Binding buffer
containing one dNTP, and Reaction Buffer were loaded (200
.mu.L/well) into a Greiner 96-well black microplate (Sigma-Aldrich,
St. Louis, Mo.; catalog number M9685), and PCR-grade mineral oil
(Sigma-Aldrich, St. Louis, Mo.; catalog no. M8662) was applied (75
.mu.L/well). High-precision streptavidin biosensors (Pall ForteBio
Corp., Menlo Park, Calif.; catalog number 18-5117) were re-hydrated
in Annealing Buffer for approximately 10 minutes before use. The
Octet QK biosensor system (Pall ForteBio Corp., Menlo Park, Calif.)
was set for 30.degree. C. operation and was programmed to coat the
biosensors with Primer-Template and wash away unbound
Primer-Template with Wash Buffer. Biosensors were transferred to
Binding Buffer containing Klenow exo(-) (68 Unit/mL), CoCl2 (100
.mu.M) and 100 .mu.M dNTP (dATP, dTTP, dGTP or dCTP) as indicated
(association phase) followed by dNTP incorporation (dissociation
phase) in Reaction Buffer containing CoCl2 (15 mM), NDPK, ADP (1
mM) and salmon sperm DNA (500 .mu.g/mL). Biosensors were
transferred to EDTA Wash Buffer followed by re-equilibration in
Reaction Buffer without enzyme, nucleotide or divalent cation.
Similarly, biosensors were transferred cyclically to solutions
containing individual deoxyribonucleoside triphosphates (dATP,
dGTP, dCTP or dTTP) as indicated. Duplicate cycles of binding and
incorporation were repeated for each dNTP to assess sequencing.
Monitoring data generated by the Octet interferometry instrument
were imported into Microsoft Excel and Prism software (GraphPad
Software, San Diego, Calif.) for display.
Results of the procedure are presented in FIG. 15. In assays for
binding to biosensor coated with ssDNA primer-template, Klenow
(exo(-)) enzyme bound poorly to the biosensor in the absence of
dNTP (FIG. 15, hatched bars). In the presence of the correct
individual dNTPs, strong peaks were observed for the first 40
cycles (FIG. 15, black bars) that correspond to the 100% correct
DNA sequence for the first 30 nucleotides, assuming that each
homopolymer is compressed into a single peak. Thereafter, small
peak heights were observed in cycles 41 onward that did not
correspond to discernable sequence. These results demonstrate the
ability to sequence double-stranded DNA using Klenow exo(-)
fragment of DNA polymerase with the binding of
enzyme-dNTP-primer/template ternary complex in examination phase
mediated by low Co2+ concentration followed by dNTP incorporation
in the presence of high Co2+ concentration.
Example 16 describes procedures used to demonstrate extended
sequence determination. As indicated below, the results confirmed
the ability to sequence single-stranded DNA using a DNA polymerase
(Klenow exo(-) fragment), where the binding of
enzyme-dNTP-primer/template ternary complex in the examination
phase was stabilized by a divalent non-catalytic cation (i.e.,
Ni2+). Cognate dNTP was subsequently incorporated into the primer
of the primed template nucleic acid molecule via exchange with
divalent catalytic cation (i.e., MgCl2).
Example 16
Long Read-Lengths by Sequencing Single-Stranded DNA Using
Nickel-Enhanced Binding Magnesium Exchange and Catalysis in the
Presence of Polymerase Trap and dNTP-Scavenging Enzyme
Materials and methods used in the procedure were as follows. The
DNA sequence of template oligonucleotide Btn-4460-4509S C4493A with
3' inverted dT was:
Biotin-5'-GTGAGCCTGCAATCCCTGCCCCGGTTCATCCTGATGGAGCTCATGGCGGG-3'-(3'-dT-5'-
) (SEQ ID NO:21). The DNA sequence of primer oligonucleotide
4496-4509AS was: 5'-CCCGCCATGAGCTC-3' (SEQ ID NO:10).
Oligonucleotides were synthesized and analyzed (liquid
chromatography-mass spectrometry (LC-MS) and electrospray
ionization (ESI)) by Integrated DNA Technologies (Coralville,
Iowa). Oligonucleotides were prepared in TE Buffer (10 mM Tris
buffer (pH 8.0), 0.1 mM EDTA) to 100 .mu.M. To prepare the ssDNA
primer/template, oligonucleotides "Btn-4460-4509S C4493A" and
"4496-4509AS" were combined (10 .mu.M each strand) in a tube
containing Annealing Buffer (10 mM Tris buffer (pH 8.0), 0.1 mM
EDTA, 80 mM KCl). The tube containing oligonucleotide solutions was
loaded onto a dry heat block (95.degree. C. for 5 minutes), and the
block was transferred to the bench top to anneal strands by
gradually cooling to ambient temperature. Klenow (3'.fwdarw.5'
exo(-)) fragment of E. coli DNA polymerase was purchased from
Enzymatics (Beverly, Mass.; catalog no. P7010-LC-L). Ultra-pure
bovine serum albumin (BSA) and UltraPure Salmon Sperm DNA Solution
were purchased from Life Technologies (Foster City, Calif.).
Saccharomyces cerevisiae nucleoside diphosphate kinase (NDPK)
enzyme (catalog no. N0379), adenosine diphosphate (ADP) and
nickel(II) sulfate hexahydrate (catalog no. 467901) were purchased
from Sigma (St. Louis, Mo.). All reagents and solutions were
molecular biology grade. Primer-template duplex was diluted (100
nM) into Annealing Buffer. Wash buffer was 20 mM Tris buffer (pH
8.0), 200 mM KCl, 200 mM potassium glutamate, 0.01% (v/v),
Tween-20, 100 .mu.g/mL bovine serum albumin, 1.0 mM dithiothreitol.
Binding Buffer was Wash Buffer containing 2.0 mM Ni(II)SO4.
Reaction Buffer was Binding Buffer containing MgCl2 (10 mM). EDTA
Wash Buffer was Binding Buffer containing 1.0 mM EDTA. Buffer
containing Primer-Template (PT), Binding buffer containing one dNTP
and Reaction Buffer were loaded (200 .mu.L/well) into a Greiner
96-well black microplate (Sigma-Aldrich, St. Louis, Mo.; catalog
number M9685), and PCR-grade mineral oil (Sigma-Aldrich, St. Louis,
Mo.; catalog no. M8662) was applied (75 .mu.L/well). High-precision
streptavidin biosensors (Pall ForteBio Corp., Menlo Park, Calif.;
catalog number 18-5117) were re-hydrated in Annealing Buffer for
approximately 10 minutes before use. The OCTET.RTM. QK biosensor
system (Pall ForteBio Corp., Menlo Park, Calif.) was set for
30.degree. C. operation and was programmed to coat the biosensors
with Primer-Template and wash away unbound Primer-Template with
Wash Buffer. Biosensors were transferred to Binding Buffer
containing Klenow exo(-) (68 Unit/mL), Ni(II)SO4 (2.0 mM) and 100
.mu.M dNTP (dATP, dTTP, dGTP or dCTP) as indicated (association
phase) followed by dNTP incorporation (dissociation phase) in
Reaction Buffer containing MgCl2 (10 mM), NDPK, ADP (1 mM) and
salmon sperm DNA (500 .mu.g/mL). Biosensors were transferred to
EDTA Wash Buffer followed by re-equilibration in Reaction Buffer
without enzyme, nucleotide or divalent cation. Similarly,
biosensors were transferred cyclically to solutions containing
individual deoxyribonucleoside triphosphates (dATP, dGTP, dCTP or
dTTP) as indicated. Duplicate cycles of binding and incorporation
were repeated for each dNTP to assess sequencing. Monitoring data
generated by the Octet interferometry instrument were imported into
Microsoft Excel and Prism software (GraphPad Software, San Diego,
Calif.) for display.
Results of the procedure are shown in FIG. 16. In assays for
binding to biosensor coated with ssDNA primer-template, Klenow
(exo(-)) enzyme bound poorly to the biosensor in the absence of
dNTP (FIG. 16, "Klenow"). In the presence of the correct individual
dNTPs, strong peaks were observed (FIG. 16, "Klenow+dNTP") that
correspond to the 100% correct DNA sequence for the first 32
nucleotides (CATCAGGATGAACCGGGGCAGGGATTGCAGGC (SEQ ID NO:23)),
assuming that each homopolymer is compressed into a single peak.
After 750 minutes, signal was minimal and did not yield discernable
sequence for the final four nucleotides (TCAC). Homopolymer
compression could result from polymerase incorporating more than
one dNTP in the reaction buffer. Two methods were employed to
prevent homopolymer compression by conditions intended to support
single-turnover incorporation. First, to block free Klenow from
re-binding to the primer/template and incorporating a second dNTP,
some Reaction Buffers contained an excess of salmon sperm DNA as a
polymerase trap. Second, to prevent free dNTP in the Reaction
Buffer from re-binding the Klenow-primer/template complex and being
enzymatically incorporated into the nascent chain, Reaction Buffers
containing NDPK and ADP were intended to convert free dNTP to dNDP
and ATP so that the dNDP cannot be incorporated by polymerase. The
ternary complex was formed in the (association phase), which was
followed by dissociation in Reaction Buffers. Reaction buffers
containing the polymerase trap demonstrated an accumulation on the
biosensor tip as evidenced by the binding amplitude exceeding the
dissociation amplitude (FIG. 16, "Klenow+dNTP"). By contrast,
Reaction Buffers containing NDPK and ADP produced baseline
resolution following dissociation, suggesting that dissociation
phase was complete (FIG. 16, "NDPK+ADP+Klenow+dNTP"). These results
suggest a role for dNTP in re-binding to the
polymerase-primer/template complex that can result in capped,
non-productive termination of sequencing. Reaction Buffers
containing NDPK and ADP appear to prevent these non-productive
capped products by depleting the pool of free dNTP during
catalysis. Single-turnover incorporation was not achieved, since
homopolymer compression was observed even in the presence of salmon
sperm DNA, NDPK and ADP; the expected sequence
(CATCAGGATGAACCGGGGCAGGGATTGCAGGCTCAC (SEQ ID NO:24)) was detected
as CATCAGATGACGCAGATGCAGC (SEQ ID NO:25) without sequential
dinucleotides (GG, AA, CC or TT), trinucleotide (GGG) or
tetranucleotide (GGGG) as shown in FIG. 16.
Example 17 describes procedures used to demonstrate extended
sequence determination using a polymerase different from the one
employed in the preceding Example. As indicated below, the results
confirmed the ability to sequence single-stranded DNA using Bsu Pol
I (large fragment), where the binding of
enzyme-dNTP-primer/template ternary complex in examination phase
was stabilized by a divalent non-catalytic cation (i.e., Ni2+).
Cognate dNTP was subsequently incorporated into the primer of the
primed template nucleic acid molecule via exchange with divalent
catalytic cation (i.e., MgCl2). Homopolymer resolution was improved
by using competing dNDP in Reaction Buffers.
Example 17
Homopolymer Resolution by Sequencing Single-Stranded DNA Using
Nickel(II)-Enhanced Binding, Magnesium Exchange and Catalysis in
Presence of Polymerase Trap and 2'-Deoxyribonucleoside
Diphosphate
Materials and methods used in the procedure were as follows. The
DNA sequence of template oligonucleotide Btn-4460-4509S C4493A with
3' inverted dT was:
Biotin-5'-GTGAGCCTGCAATCCCTGCCCCGGTTCATCCTGATGGAGCTCATGGCGGG-3'-(3'-dT-5'-
) (SEQ ID NO:21). The DNA sequence of primer oligonucleotide
4496-4509AS was: 5'-CCCGCCATGAGCTC-3' (SEQ ID NO:10).
Oligonucleotides were synthesized and analyzed (liquid
chromatography-mass spectrometry (LC-MS) and electrospray
ionization (ESI)) by Integrated DNA Technologies (Coralville,
Iowa). Oligonucleotides were prepared in TE Buffer (10 mM Tris
buffer (pH 8.0), 0.1 mM EDTA) to 100 .mu.M. To prepare the ssDNA
primer/template, oligonucleotides "Btn-4460-4509S C4493A" and
"4496-4509AS" were combined (10 .mu.M each strand) in a tube
containing Annealing Buffer (10 mM Tris buffer (pH 8.0), 0.1 mM
EDTA, 80 mM KCl). The tube containing oligonucleotide solutions was
loaded onto a dry heat block (95.degree. C. for 5 minutes), and the
block was transferred to the bench top to anneal strands by
gradually cooling to ambient temperature. Bsu DNA polymerase I
(large fragment) from Bacillus subtilis lacking exonuclease
activity was purchased from New England Biolabs (Ipswich, Mass.;
catalog no. M0330L). Ultra-pure bovine serum albumin (BSA) and
UltraPure Salmon Sperm DNA Solution were purchased from Life
Technologies (Foster City, Calif.). Nickel(II) sulfate hexahydrate
(catalog no. 467901), dCDP, dGDP and dTDP were purchased from Sigma
(St. Louis, Mo.). All reagents and solutions were molecular biology
grade. Primer-template duplex was diluted (100 nM) into Annealing
Buffer. Wash buffer was 20 mM Tris, pH 8.0, 200 mM KCl, 200 mM
potassium glutamate, 0.01% (v/v), Tween-20, 100 .mu.g/mL bovine
serum albumin, 1.0 mM dithiothreitol. Binding Buffer was Wash
Buffer containing 2.0 mM Ni(II)SO4. Reaction Buffer was 20 mM Tris
buffer (pH 8.0), 50 mM KCl, MgCl2 (10 mM), 0.01% (v/v) Tween-20,
100 .mu.g/mL bovine serum albumin, 1.0 mM dithiothreitol. EDTA Wash
Buffer was Binding Buffer containing 1.0 mM EDTA. Buffer containing
Primer-Template (PT), Binding buffer containing one dNTP and
Reaction Buffer were loaded (200 .mu.L/well) into a Greiner 96-well
black microplate (Sigma-Aldrich, St. Louis, Mo.; catalog number
M9685), and PCR-grade mineral oil (Sigma-Aldrich, St. Louis, Mo.;
catalog no. M8662) was applied (75 .mu.L/well). High-precision
streptavidin biosensors (Pall ForteBio Corp., Menlo Park, Calif.;
catalog number 18-5117) were re-hydrated in Annealing Buffer for
approximately 10 minutes before use. The Octet QK biosensor system
(Pall ForteBio Corp., Menlo Park, Calif.) was set for 30.degree. C.
operation and was programmed to coat the biosensors with
Primer-Template and wash away unbound Primer-Template with Wash
Buffer. Biosensors were transferred to Binding Buffer containing
Bsu Pol I (68 Unit/mL), Ni(II)SO4 (1.0 mM) and 100 .mu.M dNTP
(dATP, dTTP, dGTP or dCTP) as indicated (association phase)
followed by dNTP incorporation (dissociation phase) in Reaction
Buffer containing MgCl2 (10 mM), salmon sperm DNA (500 .mu.g/mL)
and the corresponding dNDP (except for dADP which was not used).
Biosensors were transferred to EDTA Wash Buffer followed by
re-equilibration in Reaction Buffer without enzyme, nucleotide or
divalent cation. Similarly, biosensors were transferred cyclically
to solutions containing individual deoxyribonucleoside
triphosphates (dATP, dGTP, dCTP or dTTP) as indicated. Cycles of
binding and incorporation were repeated for each dNTP to assess
sequencing. Monitoring data generated by the Octet interferometry
instrument were imported into Microsoft Excel and Prism software
(GraphPad Software, San Diego, Calif.) for display.
Results of the procedure are presented in FIGS. 17A-17B. In assays
for binding to biosensor coated with ssDNA primer-template, Bsu Pol
I enzyme bound strongly to the biosensor in the presence of correct
dNTP (FIG. 17A). Signal peaks in which the Reaction Buffer contains
excess dNDP (3.0 mM) correspond to correct DNA sequence of CATCAGG
with the two GG of the homopolymer are resolved with detection of
two distinct peaks (FIG. 17A, arrows). In contrast, failure to
resolve homopolymer was observed in signal peaks for control
lacking dNDP in Reaction Buffer, which correspond to correct DNA
sequence of CATCAGGAT assuming that the GG homopolymer is
compressed into a single G peak (FIG. 17A, "Control"). The effect
of dNDP on homopolymer resolution is validated by two means: (1)
the height of the second G peak of the GG dinucleotide is dependent
upon the concentration of dNDP in the Reaction Buffer (FIG. 17A,
second arrow); and (2) the next nucleotides (A and T) following the
GG homopolymer are inversely related to the dNDP concentration in
Reaction Buffer. Homopolymer compression could result from
polymerase incorporating more than one dNTP in the reaction buffer.
Two methods were employed to prevent homopolymer compression by
conditions intended to support single-turnover incorporation.
First, to block free Bsu Pol I from re-binding to the
primer/template and incorporating a second dNTP, the Reaction
Buffers contained an excess of salmon sperm DNA as a polymerase
trap. Second, to prevent free dNTP in the Reaction Buffer from
re-binding the Bsu Pol-primer/template complex and being
enzymatically incorporated into the nascent chain, Reaction Buffers
containing dNDP to compete for polymerase binding by free dNTP are
expected to bind Bsu Pol-primer/template complex and block further
incorporation, hence blocking homopolymer compression. The goal of
single-turnover incorporation is close to being achieved, since the
second peak of the GG homopolymer was 60.1% the size of the first G
peak (FIG. 17B), and binding for the next two nucleotides (A and T)
by homopolymer compression was diminished by 73.4% and 92.0%,
respectively (FIG. 17B).
Example 18 describes the procedures used to demonstrate Kinetic
resolution of homopolymer sequences. As indicated below, the
results conformed the ability to quantitatively detect single and
multiple incorporation into a homopolymer template using a two-step
method. First, the kinetic parameters for association of the
ternary complex differed for single incorporation (ALK-G1) compared
to multiple incorporation (ALK-G2, ALK-G3, ALK-G4). Second, after
transfer of the ternary complex-coated biosensor tip to the
Reaction Buffer, the initial rate of dissociation (0-8 s) allowed
incorporation of two, three or four nucleotides in a homopolymer
template (ALK-G2, ALK-G3, ALK-G4) to be discerned
quantitatively.
Example 18
Kinetic Method for Homopolymer Resolution by Sequencing
Single-Stranded DNA Using Nickel(II)-Enhanced Binding, Magnesium
Exchange and Catalysis in Presence of 2'-Deoxyribonucleoside
Diphosphate and Competing Substrate
Materials and methods used in the procedure were as follows. The
DNA sequence of wild-type ALK template oligonucleotide
Btn-4460-4509S with 3' inverted dT was:
Biotin-5'-GTGAGCCTGCAATCCCTGCCCCGGTTCATCCTGCTGGAGCTCATGGCGGG-3'-(3'-dT-5'-
) (SEQ ID NO: 7). The DNA sequence of ALK-G1 primer oligonucleotide
4494-4509AS was: 5'-CCCGCCATGAGCTCCA-3' (SEQ ID NO: 26). The DNA
sequence of ALK-G2 primer oligonucleotide 4491-4509AS was:
5'-CCCGCCATGAGCTCCAGCA-3' (SEQ ID NO: 27). The DNA sequence of
ALK-G3 primer oligonucleotide 4476-4509AS was:
5'-CCCGCCATGAGCTCCAGCAGGATGAACC/ideoxyI/GGGCA-3' (SEQ ID NO: 28),
where "/ideoxyI/" is a 2'-deoxyinosine residue. The DNA sequence of
ALK-G4 primer oligonucleotide 4482-4509AS:
5'-CCCGCCATGAGCTCCAGCAGGATGAACC-3' (SEQ ID NO: 29).
Oligonucleotides were synthesized and analyzed (liquid
chromatography-mass spectrometry (LC-MS) and electrospray
ionization (ESI)) by Integrated DNA Technologies (Coralville,
Iowa). Oligonucleotides were prepared in TE Buffer (10 mM Tris
buffer (pH 8.0), 0.1 mM EDTA) to 100 .mu.M. To prepare the ssDNA
primer/template, oligonucleotide "Btn-4460-4509S" and either
"4494-4509AS," "4491-4509AS," "4476-4509AS," or "4482-4509AS"
(ALK-G1, ALK-G2, ALK-G3 or ALK-G4 duplexes, respectively) were
combined (10 .mu.M each strand) in tubes containing Annealing
Buffer (10 mM Tris buffer (pH 8.0), 0.1 mM EDTA, 80 mM KCl). The
tubes containing oligonucleotide solutions were loaded onto a dry
heat block (95.degree. C. for 5 minutes), and the block was
transferred to the bench top to anneal strands by gradually cooling
to ambient temperature. Bsu DNA polymerase I (large fragment) from
Bacillus subtilis lacking exonuclease activity was purchased from
New England Biolabs (Ipswich, Mass.; catalog no. M0330L).
Ultra-pure bovine serum albumin (BSA) and UltraPure Salmon Sperm
DNA Solution were purchased from Life Technologies (Foster City,
Calif.). The substrate analogs
2'-deoxyadenosine-5'-O-(1-thiotriphosphate) (".alpha.-S-dATP"),
2'-deoxycytidine-5'-O-(1-thiotriphosphate) (".alpha.-S-dCTP"),
2'-deoxyguanosine-5'-O-(1-thiotriphosphate) (".alpha.-S-dGTP") and
2'-deoxythymidine-5'-O-(1-thiotriphosphate) (".alpha.-S-dTTP") were
purchased from TriLink Biotechnologies, Inc. (San Diego, Calif.).
Nickel(II) sulfate hexahydrate (catalog no. 467901) was purchased
from Sigma (St. Louis, Mo.). All reagents and solutions were
molecular biology grade. Primer-template duplex was diluted (100
nM) into Annealing Buffer. Wash buffer was 30 mM Tris, pH 8.0, 160
mM KCl, 160 mM potassium glutamate, 0.01% (v/v), Tween-20, 100
.mu.g/mL bovine serum albumin, 1.0 mM dithiothreitol. Binding
Buffer was Wash Buffer containing Bsu Pol I (68 Unit/mL) 100 .mu.M
dGTP+1.0 mM Ni(II)SO4. Reaction Buffer was Wash Buffer containing
Bsu (1 U/mL), MgCl2 (80 .mu.M), dGTP (28.1 .mu.M), .alpha.-S-dGTP
(162 .mu.M). EDTA Wash Buffer was Wash Buffer without Ni(II)SO4 but
containing 1.0 mM EDTA. Buffer containing Primer-Template (PT),
Binding Buffer and Reaction Buffer containing were loaded (200
.mu.L/well) into a Greiner 96-well black microplate (Sigma-Aldrich,
St. Louis, Mo.; catalog number M9685), and PCR-grade mineral oil
(Sigma-Aldrich, St. Louis, Mo.; catalog no. M8662) was applied (75
.mu.L/well). High-precision streptavidin biosensors (Pall ForteBio
Corp., Menlo Park, Calif.; catalog number 18-5117) were re-hydrated
in Annealing Buffer for approximately 10 minutes before use. The
Octet QK biosensor system (Pall ForteBio Corp., Menlo Park, Calif.)
was set for 30.degree. C. operation and was programmed to coat the
biosensors with Primer-Template and wash away unbound
Primer-Template with Wash Buffer. Biosensors were transferred to
Binding Buffer (association phase) followed by dNTP incorporation
(dissociation phase) in Reaction Buffer. Biosensors were
transferred to EDTA Wash Buffer followed by re-equilibration in
Reaction Buffer without enzyme, nucleotide or MgCl2. Monitoring
data generated by the Octet interferometry instrument were imported
into Microsoft Excel and Prism software (GraphPad Software, San
Diego, Calif.) for display. The association phase time series were
fitted to a single exponential association equation using Prism
software. Association phase kinetic parameters (kobs and amplitude)
were analyzed by InStat statistical software (GraphPad Software,
San Diego, Calif.) using the Dunnett test with single incorporation
of G as the control condition. The dissociation phase time series
were fitted to a double exponential dissociation equation using
Prism software.
Results of the procedure are shown in FIG. 18A-18E. In assays for
binding to biosensor coated with ssDNA primer-template, Bsu Pol I
enzyme bound strongly to the primer/template-coated biosensor in
the presence of correct dGTP (FIGS. 18A and 18B). Signals for
binding to ALK-G1 (FIG. 18A) were higher than binding to ALK-G2,
ALK-G3 and ALK-G4 (FIGS. 18A and 18B). After biosensor coated with
ternary complexes was transferred to incorporation buffer
containing polymerase, dGTP and .alpha.-S-dGTP, Ni2+ and Mg2+,
distinct dissociation time courses were observed depending on the
ALK template (FIG. 18C). The association phase for formation of the
ternary complex was analyzed for how the association kinetic
parameters may be affected by the number of nucleotides for
incorporation into the homopolymer of the primer/template.
Primer/templates with multiple (2-4) nucleotides for incorporation
into the homopolymer had lower amplitude for association than the
control single incorporation (FIG. 18D), which was statistically
significant (p<0.01) by the Dunnett test. Similarly,
primer/templates with multiple (2-4) nucleotides for incorporation
into the homopolymer had higher apparent kinetic constant for
association (kobs) than the control single incorporation (FIG.
18D), which was statistically significant (p<0.01) by the
Dunnett test. This finding indicates that single incorporation is
kinetically distinguishable from multiple incorporation in a
homopolymer template. Finally, the observed dissociation rate (0-8
s following transfer into Reaction Buffer) increases with
increasing numbers of nucleotides for incorporation in the rank
order of ALK-G2<ALK-G3<ALK-G4.about.ALK-G1, where Bsu
polymerase concentrations are between 0.13-1 U/mL (FIG. 18E).
Example 19 describes procedures used for optimizing discrimination
between correct and incorrect nucleotides by the polymerase in the
absence of chemical incorporation of any nucleotide into the primer
of a primed template nucleic acid molecule. The procedure focused
on titrating salts that dissolve in aqueous solution to provide
monovalent cations. Binding of polymerase to a primed template
nucleic acid molecule was monitored in the presence of either a
cognate or non-cognate nucleotide. The procedure focused on
enhancement of nucleotide discrimination under conditions that
preferentially destabilized binary complex formation.
Example 19
Enhancing Polymerase Discrimination Between Cognate and Non-Cognate
Nucleotides by Preferentially Destabilizing Binary Complex
Formation
Materials and methods used in the procedure were as follows. A
FORTEBIO.RTM. (Menlo Park, Calif.) OCTET.RTM. instrument employing
biolayer interferometry to measure binding reactions at the surface
of a fiber optic tip was used in a multiwell plate format to
investigate differential stability of binary and ternary complexes.
Template strands biotinylated at their 5'-ends were used to
immobilize the primed template nucleic acid onto fiber optic tips
functionalized with streptavidin (SA) according to standard
procedures. The expected sequence read from the biotinylated
template DNA had a potential read length of 86 nucleotides, where
the next correct nucleotide to be added to the primer was dCTP.
Tips were first equilibrated in a Tris-buffered solution containing
30 mM Tris-HCl (pH 8.0), and 0.1 mM EDTA before commencing the
cycling protocol. Independent binding reactions for the two test
nucleotides (i.e., cognate and non-cognate nucleotides) were
carried out in the presence of concentrations of NaCl, KCl, or
potassium glutamate that varied from 50 mM to 500 mM. A fourth
trial was conducted using a fixed 160 mM concentration of potassium
glutamate, while the concentration of KCl varied from 50 mM to 500
mM. In all instances, the reaction mixture used during the
examination step contained Tris-HCl (pH 8.0), 0.01% Tween-20, 100
.mu.g/ml BSA, 2 mM NiSO4, 350 U/ml Bsu DNA polymerase large
fragment; and one of the nucleotides at a concentration of 100
.mu.M (dCTP was used as a cognate nucleotide, and dGTP was used as
a non-cognate nucleotide). Following each examination step, tips
were exposed to a buffer containing 30 mM Tris-HCl (pH 8.0), 500 mM
KCl, 2 mM EDTA and 0.05% Tween-20 for 20 seconds to strip enzyme
complexes from the primed template nucleic acid. The stripping step
was followed by a 15 second exposure to examination buffer without
enzyme, dNTP or divalent cations to regenerate tips for the next
cycle of examination. When using a single contacting step to effect
binding of polymerase and nucleotide to the primed template nucleic
acid, the binding step was 45 seconds long, with binding
interactions being monitored continuously. This was accomplished by
contacting the primed template nucleic acid with a single solution
that included the polymerase and test nucleotide. Results from
interferometry monitoring were analyzed to identify formation of
ternary complexes (i.e., identifying cognate nucleotide) or binary
complexes (i.e., identifying non-cognate nucleotide). Numerical
results from the interferometry testing are presented in Tables
5-8. Some of the rounded binary complex measurement values were so
low that they appeared as 0.00 in the table, yet permitted
calculation of a fold enhancement.
TABLE-US-00005 TABLE 5 Establishing Conditions for Optimal
Discrimination in the Sequencing-by-Binding Procedure Ternary
Binary Fold KCl Complex Complex Enhancement conc Signal Signal
(Ternary/ (mM) (.DELTA..lamda., nm) (.DELTA..lamda., nm) Binary) 50
2.98 2.90 1.03 75 2.59 2.68 0.97 100 2.29 2.29 1.00 125 1.93 1.98
0.98 150 1.67 1.67 1.00 175 1.41 1.43 0.99 200 1.30 1.20 1.08 225
1.20 1.03 1.17 250 1.11 0.82 1.35 275 1.02 0.67 1.51 300 0.96 0.47
2.04 325 0.71 0.36 1.97 350 0.64 0.17 3.72 375 0.49 0.15 3.21 400
0.39 0.04 9.48 425 0.28 0.00 85.77 450 0.19 0.01 16.47 475 0.14
0.03 4.89 500 0.09 0.04 2.69
TABLE-US-00006 TABLE 6 Establishing Conditions for Optimal
Discrimination in the Sequencing-by-Binding Procedure Ternary
Binary Fold NaCl Complex Complex Enhancement conc Signal Signal
(Ternary/ (mM) (.DELTA..lamda., nm) (.DELTA..lamda., nm) Binary) 50
3.33 3.11 1.07 75 2.77 2.51 1.10 100 2.34 2.17 1.07 125 1.99 1.91
1.04 150 1.73 1.67 1.04 175 1.51 1.36 1.11 200 1.36 1.15 1.19 225
1.28 1.01 1.27 250 1.18 0.80 1.47 275 1.11 0.67 1.65 300 0.99 0.53
1.86 325 0.93 0.34 2.76 350 0.74 0.25 2.94 375 0.61 0.17 3.62 400
0.48 0.08 5.93 425 0.38 0.07 5.16 450 0.26 0.04 6.65 475 0.19 0.02
10.28 500 0.21 0.00 ND
TABLE-US-00007 TABLE 7 Establishing Conditions for Optimal
Discrimination in the Sequencing-by-Binding Procedure Ternary
Binary Fold Potassium Complex Complex Enhancement Glutamate Signal
Signal (Ternary/ (mM) (.DELTA..lamda., nm) (.DELTA..lamda., nm)
Binary) 50 1.67 1.59 1.05 75 1.69 1.68 1.01 100 1.67 1.64 1.02 125
1.65 1.57 1.05 150 1.62 1.51 1.07 175 1.56 1.44 1.08 200 1.51 1.40
1.07 225 1.53 1.38 1.11 250 1.48 1.27 1.17 275 1.52 1.24 1.22 300
1.50 1.23 1.23 325 1.46 1.15 1.27 350 1.39 1.07 1.30 375 1.36 1.03
1.32 400 1.36 0.99 1.36 425 1.33 0.91 1.46 450 1.31 0.86 1.52 475
1.28 0.82 1.56 500 1.28 0.80 1.60
TABLE-US-00008 TABLE 8 Establishing Conditions for Optimal
Discrimination in the Sequencing-by-Binding Procedure 160 mM
Potassium Ternary Binary Fold Glutamate/ Complex Complex
Enhancement KCl conc Signal Signal (Ternary/ (mM) (.DELTA..lamda.,
nm) (.DELTA..lamda., nm) Binary) 50 1.57 1.27 1.24 75 1.49 1.06
1.41 100 1.52 0.89 1.71 125 1.44 0.70 2.05 150 1.40 0.57 2.46 175
1.30 0.39 3.31 200 1.19 0.29 4.15 225 1.12 0.21 5.35 250 0.98 0.14
7.02 275 0.88 0.10 9.07 300 0.76 0.09 8.34 325 0.65 0.07 8.97 350
0.54 0.07 7.94 375 0.45 0.04 12.46 400 0.37 0.03 13.75 425 0.31
0.02 13.28 450 0.25 0.03 7.24 475 0.22 0.05 4.54 500 0.21 0.07
2.97
Results presented in Tables 5-8 showed how salts that provide
monovalent cations preferentially destabilized binary complex
formation, and enhanced polymerase discriminatory potential under
conditions that precluded nucleotide incorporation. Substantially
all of the monovalent cation and glutamate ion in the binding
reaction mixtures were provided by the added salts, and so
contributions of monovalent cations from buffer and other sources
were regarded as insignificant for this analysis. Binding signals
were measured and compared for polymerase interaction with a primed
template nucleic acid in the presence of cognate or non-cognate
nucleotides. Again, these results apply to binding reactions that
discriminate between correct and incorrect nucleotides without
relying on nucleotide incorporation as a readout. Of course,
nucleotide used in the procedure can be labeled or unlabeled.
Preferably however, the nucleotide is a native nucleotide that is
unlabeled.
Binary complex formation was destabilized under conditions used in
the examining step. Dose-response titrations with model salts that
provide monovalent cations (e.g., NaCl, KCl, and potassium
glutamate) similarly indicated that binary and ternary complexes
were differentially sensitive to the added salt. As the salt
concentration increased, binary complexes became progressively less
stable relative to the corresponding ternary complexes. An example
concentration range for enhancing discrimination between the
ternary complex (indicating the presence of cognate nucleotide) and
binary complex (indicating the presence of non-cognate nucleotide)
was 200 mM to 500 mM of the salts providing monovalent cations.
These values were useful in procedures wherein polymerase binding
to the primed template nucleic acid molecule served as an indicator
of nucleotide identity (i.e., cognate versus non-cognate).
Dose-response titrations of potassium glutamate similarly indicated
differential stability of the binary and ternary complexes. Here
again the binary complex became progressively less stable relative
to the corresponding ternary complex as the concentration of added
glutamate salt increased. Since potassium glutamate includes two
potassium ions for each glutamate ion, the contribution to the
potassium ion concentration in the reaction mixture was double the
concentration of added glutamate salt.
Under the non-incorporating conditions of the described procedure,
and in the absence of a source of glutamate, concentrations of
salts containing monovalent cations that were below 200 mM provided
modest discrimination between cognate and non-cognate nucleotide
binding. However, the polymerase enzyme under these conditions
maintained a high binding capacity. Titration of either of KCl or
NaCl alone showed destabilization of binary complex formation, and
that fold-discrimination was achieved at concentrations above 250
mM, although there was some loss of polymerase binding activity.
Potassium glutamate also destabilized binary complex formation, and
enhanced discriminatory potential substantially over the full range
of concentrations that were tested. To obtain long read lengths
using the sequencing-by-binding procedure, high signals that
discriminate correct base calls from incorrect base calls must be
maintained over many bases of the targeted template. In the
interest of maintaining a high binding capacity with improved
fold-discrimination, constant levels of glutamate (e.g., 0 mM, 80
mM, 160 mM, and 320 mM) were used while titrating KCl from 50 mM to
500 mM.
Enhancement of the discriminatory potential of the polymerase
resulted from combining a salt that provided monovalent cations
together with a glutamate salt under conditions where
polymerization was precluded. For example, at either 150 mM of KCl
or 150 mM of potassium glutamate there was modest discrimination
between formation of ternary and binary complexes. However,
combining the two agents enhanced the discriminatory potential. The
effect could not be attributed to either the increased monovalent
cation concentration or the glutamate ion concentration alone.
Preferred conditions for destabilizing binary complex formation
during the examination step included a salt providing monovalent
cations, where the concentration of the salt fell in the range of
from 50 mM to 1,500 mM, more preferably in the range of from 50 mM
to 500 mM.
Additional procedures consistent with the foregoing description,
together with further analysis of results from Tables 5-8, were
carried out to better establish conditions useful for destabilizing
binary complexes in the examination step. Titration with a salt
that provided monovalent metal cations (e.g., KCl) yielded a plot
showing that a maximum difference between signals for ternary and
binary complexes (a parameter relevant to the sequencing-by-binding
procedure) occurred when the salt was in the concentration range of
from about 300 mM-350 mM (see Table 5). However, a shift toward
lower concentration ranges was achieved when a glutamate salt
(e.g., potassium glutamate) was also included. Here the difference
between signals was most pronounced in the range of from about 100
mM-300 mM of the salt providing monovalent cations (e.g.,
monovalent metal cations) when a glutamate salt was included at a
concentration of from 80 mM-320 mM. Indeed, the difference between
signals was most pronounced in the range of from: 100 mM-200 mM at
320 mM of the glutamate salt; 150 mM-250 mM at 160 mM of the
glutamate salt (see Table 8); and 175 mM-300 mM at 80 mM of the
glutamate salt. Maximum signal ratios for ternary complexes over
binary complexes (a different parameter measuring discriminatory
effectiveness) centered at about 450 mM for the salt providing
monovalent metal cations when the titration was carried out in the
absence of the glutamate salt. Ratios in the combined titration
were most pronounced when the salt providing monovalent metal
cations fell in the range of from: 200 mM-250 mM at 320 mM of the
glutamate salt; 350 mM-450 mM at 160 mM of the glutamate salt; and
275 mM-350 mM at 80 mM of the glutamate salt. In all instances, the
concentration of salt providing monovalent cations that produced
maximum discriminatory ratios was substantially higher than the
concentration needed to achieve the maximum differences between the
signals indicating ternary and binary complexes. Notably, testing
conducted using the glutamate salt alone (i.e., without added KCl)
at substantially the concentrations cited above (i.e., 75 mM, 150
mM, and 325 mM) showed either substantially no enhancement of
discriminatory potential, or only very modest enhancement (see
Table 7). In the absence of added salt, concentrations of the
glutamate salt required for generating useful conditions in the
examination step preferably were higher than 325 mM.
Still further testing conducted using the Bst and Klenow
polymerases confirmed that binary complex formation was
preferentially destabilized by examination conditions that included
a glutamate salt and/or salts that provided monovalent cations
(e.g., monovalent metal cations). Generally speaking, as the
concentration of potassium glutamate increased, the concentration
of KCl that destabilized binary complexes could be decreased while
still giving good discriminatory results. When the potassium
glutamate concentration was as high as 500 mM, added KCl could be
omitted completely (i.e., the concentration of added KCl was 0 mM)
while still providing good discrimination between correct and
incorrect nucleotides. Likewise, when the potassium glutamate
concentration was 320 mM, a KCl concentration of 25 mM gave
outstanding results using the Klenow polymerase. When using the Bst
enzyme, somewhat higher concentrations of KCl were required to
achieve the best results.
Thus, while optimal discriminatory conditions differed somewhat
between the different polymerases, it was generally true that salts
providing monovalent cations (e.g., monovalent metal cations),
either alone or in combination with another glutamate salt,
preferentially destabilized binary complexes, thereby enhancing
discrimination between correct and incorrect nucleotide binding. It
was even demonstrated that the glutamate salt could serve as the
salt providing the monovalent metal cations.
Based on the foregoing, and further in view of the additional
testing according to the procedures described in the Example,
preferred conditions for destabilizing binary complex formation
were as follows. The reaction mixture employed in the examination
step should contain a source of monovalent cations, preferably
monovalent metal cations (e.g., metal cations having oxidation
state of +1). This conveniently can be accomplished by including in
the reaction mixture a salt that provides monovalent cations, where
the salt is included at a concentration of from about 50 mM-1,500
mM. Preferably, the salt is included at a concentration of from
about 50 mM-500 mM. Still more preferably, the salt is included at
a concentration of from about 100 mM-300 mM. Optionally, the salt
that provides monovalent cations also provides glutamate anions
(i.e., the salt is a glutamate salt). When the salt used is these
concentration ranges is a salt other than a glutamate salt, the
reaction mixture containing the salt optionally may further include
a glutamate salt at a concentration of from about 10 mM-1,600 mM,
more preferably in the range of from 10 mM-500 mM, or still more
preferably in the range of from 80 mM-320 mM. Generally speaking,
reaction conditions used for contacting primed template nucleic
acid molecules with the reaction mixture in an examination step
preferably favor ternary complex formation over binary complex
formation by at least two-fold, by at least five-fold, or even
more. Notably, reduced ternary complex formation can be
accommodated in the examination step of the sequencing-by-binding
procedure because an incorporation reaction can be conducted with
high efficiency under different reaction conditions that promote
interactions (e.g., including interactions that permit or favor
formation of binary complexes) between polymerase and the primed
template nucleic acid molecule.
Yet another approach for reducing or minimizing contributions due
to signals resulting from binary complex formation involves the
reagent and approach used for delivering the polymerase to the
primed template nucleic acid molecules. Here a specialized
"polymerase delivery reagent" (PDR) can be used for
sequencing-by-binding procedures, subject to certain restrictions
on the nucleotide undergoing examination. The PDR advantageously
helps minimize unwanted binary complex formation, while still
permitting efficient formation of ternary complexes. The disclosed
PDR can be used on a variety of platforms (e.g., label-free SPR;
fluorescent pols in flow cells; etc.) to obtain improved results.
Generally speaking, signal-to-noise ratios are improved in
procedures that employ the PDR and monitor polymerase binding as
indicators of cognate and non-cognate nucleotide identity, and this
aids in correct base calling and extended reads.
Prior to development of the PDR, polymerase reagent was delivered
to immobilized primed template nucleic acid molecules in the
absence of free nucleic acid molecules. At least some level of
background signal always was detected due to binding of the
polymerase to primed template nucleic acid molecules in the absence
of cognate nucleotide. Indeed, conditions could be identified where
background binding was so extensive that no observable difference
was detected when the correct base was added. This background
signal was attributed to binary complex formation, where polymerase
bound to primed template nucleic acid molecules in the absence of
cognate nucleotide.
As described elsewhere herein, alternative approaches used to
reduce signal arising from binary complex formation focused on
concentrations and combinations of salts. For example,
concentration ranges of KCl and potassium glutamate were shown
useful and adequate for suppressing binary complex formation.
However, alternative use of the PDR advantageously permits salt
conditions used for optimizing reduction of binary complex
formation to be changed--still with outstanding results. This
further illustrated that multiple different approaches can be used
for suppressing or "destabilizing" binary complex formation.
Example 20 describes procedures that demonstrated how use of the
PDR advantageously reduced signal arising from binary complex
formation while permitting correct ternary complex formation. The
polymerase delivery reagent included: (a) a DNA polymerase; and (b)
a primed template nucleic acid. The included primed template
nucleic acid is free in solution, and can interact with the
polymerase to form a complex (e.g., a binary complex).
Example 20
Polymerase Delivery Reagent (PDR) for Reducing Binary Complex
Formation in a Sequencing-by-Binding Procedure
Four streptavidin-coated Octet tips were contacted with binding
buffer solutions containing biotinylated template DNA strands
hybridized to primers to prepare immobilized primed template
nucleic acid molecules. In this procedure, binding buffer was an
ACES-buffered (pH 7.5) solution that included KCl, potassium
glutamate, TbCl3, Tween-80 and BSA. Thereafter the biosensor tips
were washed using binding buffer that did not include nucleic
acids. Binary complex formation was accomplished by contacting the
biosensor tips with binding buffer containing 1 .mu.M of a Bst DNA
polymerase engineered to contain an added cysteine residue together
with either 0 nM, 10 nM, 100 nM or 1,000 nM of a soluble or
solution-phase (i.e., free in solution) primed template nucleic
acid that was not biotinylated. The solution used to form binary
complexes representing background signal did not include the
cognate nucleotide. Notably, the solution-phase primed template
nucleic acid had a sequence different from the sequence of the
primed template nucleic acids immobilized to the biosensor tip.
Finally, ternary complexes were formed by contacting the biosensor
tip with a binding buffer solution that included either 0 nM, 10
nM, 100 nM or 1,000 nM of a soluble or solution-phase (i.e., free
in solution) primed template nucleic acid together with 100 .mu.M
of the nucleotide that was the next correct nucleotide for the
immobilized primed template nucleic acid molecule. The
solution-phase nucleotide included in the binding buffer was not
the cognate nucleotide for the solution-phase primed template
nucleic acid. When using different reagents containing
solution-phase nucleotides to be tested as cognate nucleotides for
immobilized nucleic acid features (e.g., primed template nucleic
acids immobilized directly or indirectly to a surface within a flow
cell), the solution-phase nucleotide should not be the cognate
nucleotide for the solution-phase primed template nucleic acid. In
this way, only binary complexes, and not ternary complexes, can
form between the solution-phase nucleotide and the solution-phase
primed template nucleic acid molecule. Optionally, there can be
more than one solution-phase primed template nucleic acid molecule
in the reagent solution containing the solution-phase nucleotide.
More particularly, there can be up to three different
solution-phase primed template nucleic acids in a single reagent
solution containing the solution-phase nucleotide, where the
solution-phase nucleotide is not the cognate nucleotide for any of
the solution-phase primed template nucleic acids.
Results from these procedures, shown in FIG. 19, confirmed that
delivery of the polymerase in combination with a solution-phase
nucleotide and a solution-phase primed template nucleic acid, where
the solution-phase nucleotide was not the cognate nucleotide for
the solution-phase primed template nucleic acid advantageously
suppressed or destabilized binary complex formation while still
permitting ternary complex formation. More particularly, as the
concentration of the solution-phase primed template nucleic acid
increased, there was a corresponding decrease in the magnitude of
the polymerase binding signal in the absence of nucleotide. Here
only binary complex formation was possibly. Thereafter, inclusion
of nucleotide that was the cognate nucleotide for the primed
template nucleic acid immobilized to the biosensor tip gave
increased binding signals. Comparison of the results from this
procedure indicated that an optimal difference in that signal
magnitudes occurred when the solution-phase primed template nucleic
acid was present at the 100 nM concentration (see FIG. 20).
Accordingly, routine procedures can be followed to optimize
concentrations of the solution-phase primed template nucleic acid
needed to give good results.
Taken together, these results show how use of the PDR reagent
improved discrimination between binary and ternary complex
formation in a way that was not previously possible. Similarly good
results were obtained using two independent DNA polymerase enzymes.
This confirmed the general utility of the approach.
In some embodiments, a plurality of independent examination
reactions is completed before performance of any incorporation
reaction. According to different preferred approaches, this can
involve carrying out examination reactions using a detectably
labeled polymerase, or using one or more detectably labeled
nucleotides.
In one approach, examination reactions can be carried out using as
few as a single labeled polymerase, rather than a collection of
distinguishably labeled polymerases. Primed template nucleic acids
(e.g., a collection of spaced apart features, such as immobilized
RCA products or beads displaying primed template nucleic acids) can
be contacted with combinations of the labeled polymerase and one or
more nucleotides. Following a period to allow binding, and
optionally a wash step to remove any non-complexed materials (e.g.,
labeled polymerase) from the binding reaction mixture, interaction
of the labeled polymerase with the primed template nucleic acid
molecule is assessed. After completion of a first examination
reaction, and removal or stripping of the polymerase-nucleotide(s)
combination from the primed template nucleic acid molecule, a
second examination reaction is carried out by contacting the primed
template nucleic acid molecule with a second
polymerase-nucleotide(s) combination. The detection and removal
procedures are then repeated. Nucleotides used in this procedure
need not carry any detectable label, because it is the localization
of the polymerase to the primed template nucleic acid molecule that
is detected or monitored in this procedure as an indicator of
cognate nucleotide identity. Again, the detectably labeled
polymerase preferentially produces a signal that does not
substantially change as the result of interaction with any
nucleotide. More particularly, the signal is substantially uniform.
By this approach, localization of the signal, as contrasted with
production of the signal, can be monitored to assess ternary
complex formation. Procedures can be carried out using either
non-catalytic metal ions or reversibly blocked primers in the
primed template nucleic acid molecules to stabilize ternary
complexes. Thus, serial examination reactions can be carried out
using as few as a single type of detectably labeled polymerase in a
procedure that repeatedly or iteratively tests different
nucleotides or nucleotide combinations for the ability to promote
ternary complex formation.
In an alternative approach, detectably labeled nucleotides can be
used in place of detectably labeled polymerase(s). Optionally, the
labeled nucleotides harbor fluorescent moieties, Raman-active
moieties, etc. Optionally, each different labeled nucleotide among
a plurality of labeled nucleotides used in a procedure includes the
same type of fluorescent moiety. Alternatively, each different
labeled nucleotide among a plurality of labeled nucleotides used in
a procedure can include different fluorescent moieties that are not
distinguished from each other by their optical properties during a
procedure. For example, a single or common detection channel or
wavelength range can be used for detecting the different labeled
nucleotides in ternary complexes. Preferably, optical properties
(e.g., excitation or emission spectra) of fluorescent moieties of
the labeled nucleotides remain substantially unchanged when the
labeled nucleotide are free in solution (i.e., not included in a
ternary complex) or participating in a ternary complex. Thus,
labeled nucleotides need not be labeled with any conformationally
sensitive label, or intercalating dye that emits a distinctive
optical signal when the nucleotide participates in a ternary
complex. As well, success of the technique does not require that
the detectable labels participate in energy transfer relationships
with any other fluorescent dye or quencher moieties (e.g.,
detectable moieties preferably need not be FRET partners). In some
embodiments, polymerase-nucleotide combinations can be delivered to
a primed template nucleic acid molecule (e.g., a primed template
nucleic acid molecule immobilized within a flow cell) in serial
fashion, one at a time. Cognate nucleotide identification can
involve detecting a ternary complex by detecting the label moiety
attached to the nucleotide. For example, this can involve
associating cognate nucleotide identity with the identity of the
nucleotide that was contacted to the primed template nucleic acid
molecule in combination with the polymerase, where a ternary
complex was formed as a consequence. Simply detecting the ternary
complex where polymerase-nucleotide combinations were delivered to
the primed template nucleic acid in a known order (e.g., in a
serial fashion) can be sufficient to identify the next correct
nucleotide.
In some preferred approaches, steps that involve contacting a
polymerase in combination with one or more nucleotides to a primed
template nucleic acid molecule (e.g., an immobilized primed
template nucleic acid molecule) can be carried out using a blocked
primed template nucleic acid molecule in the presence of a
catalytic metal ion (e.g., magnesium ion or manganese ion). The
blocked primed template nucleic acid molecule can include a primer
with a 3' terminal nucleotide having a reversible terminator
moiety, as described herein. Practically speaking, reagents or
solutions containing the different polymerase-nucleotide
combinations can also include the catalytic metal ion. When
contacted to the blocked primed template nucleic acid molecule,
incorporation of cognate nucleotide is precluded by the presence of
a reversible terminator moiety on the 3' terminal nucleotide of the
primer strand hybridized to the template strand of the primed
template nucleic acid molecule. Ternary complexes including the
blocked primed template nucleic acid molecule can form efficiently
without incorporation, regardless of the catalytic capacity of the
polymerase. While not wishing to be constrained by any particular
theory of operation, one possibility is that the presence of the
catalytic metal ion helps maintain integrity of the polymerase and
its ability to recognize and discriminate between cognate and
non-cognate nucleotides. Alternatively, inclusion of the catalytic
metal ion may beneficially impact the structure of the ternary
complex itself. Notwithstanding the underlying mechanism, some
preferred approaches for carrying out the disclosed techniques can
involve contacting a blocked primed template nucleic acid molecule
(e.g., having a primer with a reversible terminator moiety attached
to the 3' terminal nucleotide) with a polymerase-nucleotide
combination in the presence of a catalytic metal ion (e.g., either
or both of magnesium ion and manganese ion). Preferably, the
contacting step is carried out in the presence of the catalytic
metal ion, and in the absence of non-catalytic metal ions that
inhibit nucleotide incorporation.
FIG. 21 illustrates a simplified workflow for the iterative
sequencing procedure employing a single type of detectably labeled
polymerase; and FIG. 22 illustrates results obtained using that
procedure and protocols essentially as described herein. Here, the
labeled polymerase and one nucleotide at a time contacted beads
harboring a reversibly blocked primed template nucleic acid for the
Alk-C2 target sequence, where the expected sequence of nucleotides
was CGGG. All binding reactions were carried out in the presence of
Mg2+ ion, although inclusion of this catalytic metal ion was
optional. In each cycle of examining four different nucleotides in
a serial fashion, the correct nucleotide was associated with the
highest binding signal. This indicated that detectably labeled
polymerase associated with the blocked primed template nucleic acid
molecule to form ternary complexes in the expected fashion.
The following Example illustrates one embodiment of the
sequencing-by-binding technique, where a single type of detectably
labeled polymerase was used to assess binding of native
nucleotides.
Example 21
Labeled Polymerase Sequencing
Flow cells were prepared using magnetic 1 .mu.M microbeads
displaying synthetic primed template nucleic acids of known
sequence. Briefly, streptavidin-coated MyOne C1 magnetic beads
(ThermoFisher Scientific; Waltham, Mass.) were functionalized with
a TCO-PEG4-NHS (transcyclooctene-polyethylene
glycol-N-hydroxysuccinimide) moiety that reacts with free amine
moieties on the streptavidin. The TCO-modified beads were then
incubated in a solution containing the desired primed template
nucleic acid molecule at a concentration of 100 nM. The beads were
next introduced into a flow cell constructed with an
aminosilane-coated coverslip that had been modified with an
NHS-tetrazine ester reagent to covalently bind the TCO modified
beads. The beads were allowed to settle to the surface and bind for
about 15 minutes, and the bead density checked by optical
microscopy. If higher bead density was required, more beads were
flowed in and allowed to bind. Contents of the flow cell were
"blocked" with SuperBlock (ThermoFisher Scientific) to minimize
non-specific binding of reagents to the beads or background
surfaces.
Prior to initiating the sequencing run, reagents were loaded into
15 mL conical tubes and connected to a fluidic manifold with
reagent lines leading to the flow cell. The flow cell containing
the bead array was mounted on a microscope equipped with a
20.times. objective, and then connected to the fluidic manifold.
The flow cell was purged with wash reagent to equilibrate the beads
and primed template nucleic acid with the starting reaction
conditions. Sequencing was initiated using an automated protocol to
control the order and timing of reagent delivery. FIG. 21 shows a
flow diagram outlining an example workflow. In this procedure
labeled polymerase and a single nucleotide at a time were contacted
to the immobilized primed template nucleic acid molecules. The
polymerase used in the procedure was a BSU polymerase engineered to
contain a cysteine that was chemically attached to a fluorescent
Cy5 label.
FIG. 22 shows the resulting maximum fluorescence intensities for
equilibrium binding of fluorescently labeled polymerase, where the
polymerase bound primed template nucleic acid molecules in
combination with one native nucleotide at a time. Again, there was
no energy transfer between the fluorescent moiety and the
nucleotide to make the detection. As well, the label on the
polymerase served only to provide a way to track location of the
polymerase, where fluorescence of the polymerase remained
substantially unchanged as a consequence of different nucleotides
being present in the reaction mixtures. Maximum binding signals for
each cycle were considered the correct base calls. Base calls for
each cycle of the feature represented in the figure corresponded to
the first four bases of one of the Alk gene fragments included in
the template panel. In each case, the feature being sequenced
showed a unique response to each examination step. This
demonstrated how repetitive cycles of examining as few as one
nucleotide at a time using a fluorescently labeled polymerase could
be used for sequencing a template nucleic acid.
Disclosed above are materials, compositions, and components that
can be used for, can be used in conjunction with, can be used in
preparation for, or are products of the disclosed methods and
compositions. It is to be understood that when combinations,
subsets, interactions, groups, etc. of these materials are
disclosed, and that while specific reference of each various
individual and collective combinations and permutations of these
compounds may not be explicitly disclosed, each is specifically
contemplated and described herein. For example, if a method is
disclosed and discussed and a number of modifications that can be
made to a number of molecules including the method are discussed,
each and every combination and permutation of the method, and the
modifications that are possible are specifically contemplated
unless specifically indicated to the contrary. Likewise, any subset
or combination of these is also specifically contemplated and
disclosed. This concept applies to all aspects of this disclosure,
including steps in methods using the disclosed compositions. Thus,
if there are a variety of additional steps that can be performed,
it is understood that each of these additional steps can be
performed with any specific method steps or combination of method
steps of the disclosed methods, and that each such combination or
subset of combinations is specifically contemplated and should be
considered disclosed.
Publications cited herein, and the material for which they are
cited, are hereby specifically incorporated by reference in their
entireties. All publications, patents, and patent applications
mentioned in this specification are herein incorporated by
reference to the same extent as if each individual publication,
patent, or patent application was specifically and individually
indicated to be incorporated by reference.
It is to be understood that the headings used herein are for
organizational purposes only and are not meant to limit the
description or claims.
A number of embodiments have been described. Nevertheless, it will
be understood that various modifications may be made. Accordingly,
other embodiments are within the scope of the claims.
SEQUENCE LISTINGS
1
3718DNAartificial sequencesynthetic construct 1cagcagga
827DNAartificial sequencesynthetic construct 2cagcagg
73101DNAartificial sequencesynthetic construct 3ggcaaatcac
cagaaggcgg ttcctgaatg aatgggaagc cttcaagaag gtgataagca 60ggagaaacat
acgaaggcgc ataacgatac cactgaccct c 1014101DNAartificial
sequencesynthetic construct 4ggcaaatcac cagaaggcgg ttcctgaatg
aatgggaagc cttcaagaag gtgataagca 60ggagaaacat acgaagcatc ataacgatac
cactgaccct c 101522DNAartificial sequencesynthetic construct
5gagggtcagt ggtatcgtta tg 22650DNAartificial sequencesynthetic
construct 6tgataagcag gagaaacata cgaagcatca taacgatacc actgaccctc
50750DNAartificial sequencesynthetic construct 7gtgagcctgc
aatccctgcc ccggttcatc ctgctggagc tcatggcggg 50814DNAartificial
sequencesynthetic construct 8cccgccatga gctc 14950DNAartificial
sequencesynthetic construct 9gtgagcctgc aatccctgcc ccggttcatc
ctgctggagc tcatggcggg 501014DNAartificial sequencesynthetic
construct 10cccgccatga gctc 141135DNAartificial sequencesynthetic
construct5-Nitroindole(17)..(17)misc_feature(17)..(17)n is a, c, g,
or t 11agcaggatga accgggncag ggattgcagg ctcac 351243DNAartificial
sequencesynthetic
construct5-nitroindole(25)..(25)misc_feature(25)..(25)n is a, c, g,
or t 12ttttttttag caggatgaac cgggncaggg attgcaggct cac
43138DNAartificial sequencesynthetic construct 13cagcagca
81453DNAartificial sequencesynthetic construct 14cagtcagtca
gtcagtcagt cagtcagtca gtcagtcagt cagtcagtca gtc 531527DNAartificial
sequencesynthetic construct 15cagcagcatc gcacgcagca tcgcccc
271636DNAartificial sequencesynthetic construct 16cagcaggatg
aaccggggca gggattgcag gctcac 361723DNAartificial sequencesynthetic
construct 17cagcagagtg agcgcgcgcg ggg 231836DNAartificial
sequencesynthetic construct 18cagcaggatg aaccggggca gggattgcag
gctcac 361917DNAartificial sequencesynthetic construct 19cagcagatga
cgcagag 172036DNAartificial sequencesynthetic construct
20cagcaggatg aaccggggca gggattgcag gctcac 362136DNAartificial
sequencesynthetic construct 21cagcaggatg aaccggggca gggattgcag
gctcac 362299DNAartificial sequencesynthetic construct 22ggcaaatcac
cagaaggcgg ttcctgaatg aatgggaagc cttcaagaag gtgataagca 60ggagaaacat
acgaagcatc ataacgatac cactgaccc 992332DNAartificial
sequencesynthetic construct 23catcaggatg aaccggggca gggattgcag gc
322436DNAartificial sequencesynthetic construct 24catcaggatg
aaccggggca gggattgcag gctcac 362522DNAartificial sequencesynthetic
construct 25catcagatga cgcagatgca gc 222616DNAartificial
sequencesynthetic construct 26cccgccatga gctcca 162719DNAartificial
sequencesynthetic construct 27cccgccatga gctccagca
192834DNAartificial sequencesynthetic
construct2'-deoxyinosine(29)..(29)misc_feature(29)..(29)n is a, c,
g, or t 28cccgccatga gctccagcag gatgaaccng ggca 342928DNAartificial
sequencesynthetic construct 29cccgccatga gctccagcag gatgaacc
283043DNAartificial sequencesynthetic construct 30atgctcatgc
tcatgctcat gctcatgctc atgctcatgc tca 433126DNAartificial
sequencesynthetic construct 31atgctcgtat gtctctgcta tcactc
263212DNAArtificial Sequencesynthetic construct 32catcaggatg aa
123316DNAArtificial Sequencesynthetic construct 33accggggcag ggattg
163410DNAArtificial Sequencesynthetic construct 34gcaggctcac
103535DNAArtificial Sequencesynthetic construct 35ccaaggttcc
aaggttccaa ggttccaagg ttcca 353635DNAArtificial Sequencesynthetic
construct 36aaggttccaa ggttccaagg ttccaaggtt ccaag
353735DNAArtificial Sequencesynthetic construct 37ggttccaagg
ttccaaggtt ccaaggttcc aaggt 35
* * * * *
References