U.S. patent application number 14/505636 was filed with the patent office on 2015-03-26 for methods, systems, computer readable media, and kits for sample identification.
The applicant listed for this patent is LIFE TECHNOLOGIES CORPORATION. Invention is credited to Earl Hubbell.
Application Number | 20150087537 14/505636 |
Document ID | / |
Family ID | 52691458 |
Filed Date | 2015-03-26 |
United States Patent
Application |
20150087537 |
Kind Code |
A1 |
Hubbell; Earl |
March 26, 2015 |
Methods, Systems, Computer Readable Media, and Kits for Sample
Identification
Abstract
A method for sequencing a polynucleotide sample having a barcode
sequence includes: introducing a series of nucleotides to the
polynucleotide sample according to a predetermined order of
nucleotide flows; obtaining a series of signals resulting from the
introducing of nucleotides to the polynucleotide sample; and
resolving the series of signals over the barcode sequence to render
a flowspace string, wherein the flowspace string is a codeword of
an error-correcting code that is (i) designed based on and adapted
for use with the predetermined order of nucleotide flows, and (ii)
capable of distinguishing any codeword in the error-correcting code
from the other codewords in the error-correcting code in the
presence of zero, one, and two errors.
Inventors: |
Hubbell; Earl; (Palo Alto,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
LIFE TECHNOLOGIES CORPORATION |
Carlsbad |
CA |
US |
|
|
Family ID: |
52691458 |
Appl. No.: |
14/505636 |
Filed: |
October 3, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13599876 |
Aug 30, 2012 |
|
|
|
14505636 |
|
|
|
|
61545290 |
Oct 10, 2011 |
|
|
|
61529687 |
Aug 31, 2011 |
|
|
|
61886833 |
Oct 4, 2013 |
|
|
|
Current U.S.
Class: |
506/4 ; 506/16;
702/20 |
Current CPC
Class: |
C12Q 1/6869 20130101;
C40B 20/04 20130101; B01J 2219/00547 20130101; B01J 2219/00317
20130101; C12Q 1/6874 20130101; C40B 70/00 20130101; G16B 30/00
20190201; C12Q 2537/157 20130101; C12Q 2563/179 20130101; G16C
99/00 20190201; C40B 50/16 20130101; B01J 2219/00572 20130101; B01J
2219/00466 20130101; C12Q 1/6869 20130101; B01J 2219/00653
20130101 |
Class at
Publication: |
506/4 ; 506/16;
702/20 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method for sequencing a polynucleotide sample having a barcode
sequence, comprising: introducing a series of nucleotides to the
polynucleotide sample according to a predetermined order of
nucleotide flows; obtaining a series of signals resulting from the
introducing of nucleotides to the polynucleotide sample; and
resolving the series of signals over the barcode sequence to render
a flowspace string, wherein the flowspace string is a codeword of
an error-correcting code that is (i) designed based on and adapted
for use with the predetermined order of nucleotide flows, and (ii)
capable of distinguishing any codeword in the error-correcting code
from the other codewords in the error-correcting code in the
presence of zero, one, and two errors.
2. The method of claim 1, wherein the error-correcting code is a
ternary code and the predetermined flow ordering is a
phase-protecting predetermined flow ordering.
3. The method of claim 1, wherein the error-correcting code is a
ternary code generated using a generator polynomial associated with
a ternary cyclic code.
4. The method of claim 3, wherein the generator polynomial
comprises 10210122.
5. The method of claim 3, wherein the generator polynomial
comprises 1022201.
6. The method of claim 3, wherein the generator polynomial
comprises 1112.
7. The method of claim 1, wherein each codeword of the
error-correcting code includes at least one 2-mer and at least one
1-mer.
8. The method of claim 1, wherein the error-correcting code is a
quaternary code generated by applying a distance-preserving Gray
map to an extended binary Golay code.
9. The method of claim 8, wherein the quaternary code is generated
by applying to the extended binary Golay code a Gray map mapping
pairs of binary digits 0 and 1 of the extended binary Golay code to
one of integers 0, 1, 2, and 3, wherein the Gray map mapping
preserves a predetermined minimal distance.
10. The method of claim 8, wherein the error-correcting code is
further capable of distinguishing any codeword in the
error-correcting code from the other codewords in the
error-correcting code in the presence of three errors.
11. The method of claim 1, wherein the error-correcting code is
generated using an octacode.
12. The method of claim 1, wherein the error-correcting code is a
quaternary code.
13. The method of claim 1, wherein the error-correcting code is
further designed by verifying that a predetermined minimal distance
between a codeword and other codewords in the error-correcting code
using a Lee metric determined in flowspace.
14. The method of claim 1, further comprising translating the
flowspace string into a base sequence to obtain the sequence of the
barcode sequence.
15. The method of claim 1, further comprising: decoding the
flowspace string to the correct flowspace codeword; and translating
the flowspace codeword into a base sequence to obtain the sequence
of the barcode sequence.
16. The method of claim 1, further comprising providing multiple
different polynucleotide samples for multiplex sequencing by the
series of flowed nucleotides, each different polynucleotide sample
comprising a different barcode sequence that gives a different
flowspace string, each different flowspace string being a different
codeword of the error-correcting code.
17. The method of claim 1, wherein any two flowspace codewords of
the error-correcting code have a Hamming distance of at least
5.
18. A system, including: a machine-readable memory; and a processor
configured to execute machine-readable instructions, which, when
executed by the processor, cause the system to perform a method for
sequencing a polynucleotide sample having a barcode sequence,
comprising: introducing a series of nucleotides to the
polynucleotide sample according to a predetermined order of
nucleotide flows; obtaining a series of signals resulting from the
introducing of nucleotides to the polynucleotide sample; and
resolving the series of signals over the barcode sequence to render
a flowspace string, wherein the flowspace string is a codeword of
an error-correcting code that is (i) designed based on and adapted
for use with the predetermined order of nucleotide flows, and (ii)
capable of distinguishing any codeword in the error-correcting code
from the other codewords in the error-correcting code in the
presence of zero, one, and two errors.
19. The system of claim 18, wherein the error-correcting code is a
ternary code and the predetermined flow ordering is a
phase-protecting predetermined flow ordering.
20. A set of barcodes for nucleic acid sequencing, comprising: a
plurality of nucleic acid base sequences, each nucleic acid base
sequence being a base space representation of a flowspace
representation of a codeword of an error-tolerant sample
discrimination code, the error-tolerant sample discrimination code
being (i) designed based on and adapted for use with the
predetermined order of nucleotide flows, and (ii) capable of
distinguishing any codeword in the error-correcting code from the
other codewords in the error-correcting code in the presence of
zero, one, and two errors.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S. patent
application Ser. No. 13/599,876, filed Aug. 30, 2012, which claims
the benefit of U.S. Prov. Pat. Appl. No. 61/545,290, filed Oct. 10,
2011, and U.S. Prov. Pat. Appl. No. 61/529,687, filed Aug. 31,
2011, which are all incorporated by reference herein in their
entirety. This application also claims the benefit of U.S. Prov.
Pat. Appl. No. 61/886,833, filed Oct. 4, 2013, which is
incorporated by reference herein in its entirety.
STATEMENT REGARDING COPYRIGHT NOTICE
[0002] A portion of the disclosure of this patent document contains
material which is subject to copyright protection. The copyright
owner has no objection to the facsimile reproduction by anyone of
the patent document or the patent disclosure, as it appears in the
Patent and Trademark Office patent file or records, but otherwise
reserves all copyright rights whatsoever.
FIELD
[0003] This application generally relates to methods, systems,
computer readable media, and kits for sample identification, and,
more specifically, to methods, systems, computer readable media,
and kits for designing and/or making and/or using sample
discriminating codes or barcodes for identifying sample nucleic
acids or other biomolecules or polymers.
BACKGROUND
[0004] Various instruments, apparatuses, and/or systems perform
sequencing of nucleic acid sequences using sequencing-by-synthesis,
including, for example, the Genome Analyzer/HiSeq/MiSeq platforms
(Illumina, Inc.; see, e.g., U.S. Pat. Nos. 6,833,246 and
5,750,341); the GS FLX, GS FLX Titanium, and GS Junior platforms
(Roche/454 Life Sciences; see, e.g., Ronaghi et al., SCIENCE,
281:363-365 (1998), and Margulies et al., NATURE, 437:376-380
(2005)); and the Ion PGM.TM. and Ion Proton.TM. Sequencers (Life
Technologies Corp./Ion Torrent; see, e.g., U.S. Pat. No. 7,948,015
and U.S. Pat. Appl. Publ. Nos. 2010/0137143, 2009/0026082, and
2010/0282617, which are all incorporated by reference herein in
their entirety). In order to increase sequencing throughput and/or
lower costs for sequencing-by-synthesis (and other sequencing
methods such as, e.g., sequencing-by-hybridization,
sequencing-by-ligation, etc.), there is a need for new methods,
systems, computer readable media, and kits that allow highly
efficient preparation and/or identification of samples of
potentially high complexity.
SUMMARY
[0005] According to an exemplary embodiment, there is provided a
method for sequencing a polynucleotide sample having a barcode
sequence, comprising: introducing a series of nucleotides to the
polynucleotide sample according to a predetermined order of
nucleotide flows; obtaining a series of signals resulting from the
introducing of nucleotides to the polynucleotide sample; and
resolving the series of signals over the barcode sequence to render
a flowspace string, wherein the flowspace string is a codeword of
an error-correcting code that is (i) designed based on and adapted
for use with the predetermined order of nucleotide flows, and (ii)
capable of distinguishing any codeword in the error-correcting code
from the other codewords in the error-correcting code in the
presence of zero, one, and two errors.
[0006] According to an exemplary embodiment, there is provided a
system, including: a machine-readable memory; and a processor
configured to execute machine-readable instructions, which, when
executed by the processor, cause the system to perform a method for
sequencing a polynucleotide sample having a barcode sequence,
comprising: introducing a series of nucleotides to the
polynucleotide sample according to a predetermined order of
nucleotide flows; obtaining a series of signals resulting from the
introducing of nucleotides to the polynucleotide sample; and
resolving the series of signals over the barcode sequence to render
a flowspace string, wherein the flowspace string is a codeword of
an error-correcting code that is (i) designed based on and adapted
for use with the predetermined order of nucleotide flows, and (ii)
capable of distinguishing any codeword in the error-correcting code
from the other codewords in the error-correcting code in the
presence of zero, one, and two errors.
[0007] According to an exemplary embodiment, there is provided a
set of barcodes for nucleic acid sequencing, comprising: a
plurality of nucleic acid base sequences, each nucleic acid base
sequence being a base space representation of a flowspace
representation of a codeword of an error-tolerant sample
discrimination code, the error-tolerant sample discrimination code
being (i) designed based on and adapted for use with the
predetermined order of nucleotide flows, and (ii) capable of
distinguishing any codeword in the error-correcting code from the
other codewords in the error-correcting code in the presence of
zero, one, and two errors.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] The accompanying drawings, which are incorporated into and
form a part of the specification, illustrate one or more exemplary
embodiments and serve to explain the principles of various
exemplary embodiments. The drawings are exemplary and explanatory
only and are not to be construed as limiting or restrictive in any
way.
[0009] FIG. 1A illustrates an exemplary system for obtaining,
processing, and/or analyzing multiplex nucleic acid sequencing
data.
[0010] FIG. 1B illustrates an exemplary method for obtaining,
processing, and/or analyzing multiplex nucleic acid sequencing
data.
[0011] FIG. 2A illustrates components of an exemplary system for
nucleic acid sequencing.
[0012] FIG. 2B illustrates an exemplary system for nucleic acid
sequencing.
[0013] FIG. 3A illustrates cross-sectional and expanded views of an
exemplary flow cell for nucleic acid sequencing.
[0014] FIG. 3B illustrates an exemplary uniform flow front between
successive reagents moving across a section of an exemplary
microwell array.
[0015] FIG. 4 illustrates an exemplary process for label-free,
pH-based sequencing.
[0016] FIG. 5 shows an examplary ionogram representation of signals
from which base calls may be made.
[0017] FIGS. 6A and 6B demonstrate a relationship between a base
space sequence and a flowspace vector.
[0018] FIG. 7A illustrates an exemplary translation to flowspace of
36 9-mer ternary Golay codewords permissible under a predetermined
flow ordering.
[0019] FIG. 7B illustrates an exemplary translation to flowspace of
332 ternary Golay codewords permissible under the same
predetermined flow ordering as in FIG. 7A.
[0020] FIG. 7C illustrates exemplary Golay flowspace barcode
weights for the codewords represented in FIG. 7A.
[0021] FIG. 8A illustrates 8 nonzero ternary tetracode
codewords.
[0022] FIG. 8B illustrates 288 nonzero ternary concatenated
tetracode codewords permissible under the same predetermined flow
ordering as in FIG. 7A.
[0023] FIG. 9 illustrates a pool of seven different polynucleotide
strands, each with a unique barcode sequence.
[0024] FIGS. 10A-10C illustrate an exemplary workflow for preparing
a multiplex sample.
[0025] FIG. 11 illustrates an exemplary beaded template.
[0026] FIG. 12 illustrates another exemplary beaded template.
[0027] FIG. 13 illustrates an exemplary mate pair beaded
template.
[0028] FIG. 14A illustrates an exemplary barcoded adaptor.
[0029] FIG. 14B illustrates an exemplary beaded template.
[0030] FIG. 15 illustrates another exemplary beaded template.
EXEMPLARY EMBODIMENTS
[0031] The foregoing general description and following detailed
description and the various embodiments described herein are
exemplary and explanatory only and are not to be construed as
limiting or restrictive in any way. Other embodiments, features,
objects, and advantages of the present teachings will be apparent
from the description and accompanying drawings, and from the
claims.
[0032] In accordance with the teachings and principles embodied in
this application, new methods, systems, computer readable media,
and kits that allow highly efficient preparation and/or
identification of samples of potentially high complexity are
provided. The new methods, systems, computer readable media, and
kits may help increase throughput by allowing contemporaneous
sequencing and/or analysis of multiple samples (e.g., multiplexed
sequencing), facilitated by using sample discriminating codes or
coded molecular constructs. Multiplexed sequencing may allow
multiple coded samples (for example, different samples or samples
from different sources) to be analyzed substantially simultaneously
in a single sequencing run (e.g., on a common slide, chip,
substrate, or other sample holder device).
[0033] In accordance with the teachings and principles embodied in
this application, new methods, systems, computer readable media,
and kits allowing identification of an origin of samples used in
multiplexed sequencing are provided. Such identification may
involve an analysis of sequencing data for the samples. The source
of the sequencing data may be uniquely tagged, coded, or identified
(e.g., to resolve a particular nucleic acid species associated with
a particular sample population). Such identification may be
facilitated by using unique sample discriminating codes or
sequences (also known as barcodes, e.g., nucleic acid barcodes)
that may be embedded within or otherwise associated with the
samples. Such discriminators are not, however, immune to errors or
misreads that may occur during sequencing. For example, an
erroneous barcode read may alter interpretation of the barcode
information, which may render the barcode unrecognizable and
prevent correct sample identification. An erroneous barcode read
may also result in the association of a sample to an incorrect
sample source or population of origin, which may be particularly
useful in clinical samples.
[0034] In accordance with the teachings and principles embodied in
this application, new methods, systems, computer readable media,
and kits that may help address the problem of detecting and/or
correcting errors that can arise during the sequencing of samples
comprising barcodes are provided. In various embodiments, sample
discriminating codes or sequences or barcodes and methodologies for
developing robust sample discriminating codes or sequences or
barcodes that incorporate an error-tolerant code (e.g., an
error-correcting code or an error-detecting code) are provided.
[0035] Unless otherwise specifically designated herein, terms,
techniques, and symbols of biochemistry, cell biology, cell and
tissue culture, genetics, molecular biology, nucleic acid
chemistry, and organic chemistry (including chemical and physical
analysis of polymer particles, enzymatic reactions and
purification, nucleic acid purification and preparation, nucleic
acid sequencing and analysis, polymerization techniques,
preparation of synthetic polynucleotides, recombinant techniques,
etc.) used herein follow those of standard treatises and texts in
the relevant field. See, e.g., Kornberg and Baker, DNA REPLICATION,
2nd ed. (W.H. Freeman, N.Y., 1992); Lehninger, BIOCHEMISTRY, 2nd
ed. (Worth Publishers, New York, 1975); Strachan and Read, HUMAN
MOLECULAR GENETICS, 2nd ed. (Wiley-Liss, New York, 1999); Birren et
al. (eds.), GENOME ANALYSIS: A LABORATORY MANUAL SERIES (Vols.
I-IV), Dieffenbach and Dveksler (eds.), PCR PRIMER: A LABORATORY
MANUAL, and Green and Sambrook (eds.), MOLECULAR CLONING: A
LABORATORY MANUAL (all from Cold Spring Harbor Laboratory Press);
and Hermanson, BIOCONJUGATE TECHNIQUES, 2nd ed. (Academic Press,
2008).
[0036] As used herein, "amplifying" generally refers to performing
an amplification reaction. As used herein, "amplicon" generally
refers to a product of a polynucleotide amplification reaction,
which includes a clonal population of polynucleotides, which may be
single stranded or double stranded and which may be replicated from
one or more starting sequences. The one or more starting sequences
may be one or more copies of the same sequence, or they may be a
mixture of different sequences that contain a common region that is
amplified such as, for example, a specific exon sequence present in
a mixture of DNA fragments extracted from a sample. Preferably,
amplicons may be formed by the amplification of a single starting
sequence. Amplicons may be produced by a variety of amplification
reactions whose products comprise replicates of one or more
starting, or target, nucleic acids. Amplification reactions
producing amplicons may be "template-driven" in that base pairing
of reactants, either nucleotides or oligonucleotides, have
complements in a template polynucleotide that are required for the
creation of reaction products. Template-driven reactions may be
primer extensions with a nucleic acid polymerase or oligonucleotide
ligations with a nucleic acid ligase. Such reactions include, for
example, polymerase chain reactions (PCRs), linear polymerase
reactions, nucleic acid sequence-based amplifications (NASBAs),
rolling circle amplifications, for example, or using rolling circle
amplification to form a single body that may exclusively occupy a
microwell as disclosed in Drmanac et al., U.S. Pat. Appl. Publ. No.
2009/0137404, which is incorporated by reference herein in its
entirety. As used herein, "solid phase amplicon" generally refers
to a solid phase support, such as a particle or bead, to which is
attached a clonal population of nucleic acid sequences, which may
have been produced by a emulsion PCR, for example.
[0037] As used herein, "analyte" generally refers to a molecule or
biological sample that can directly affect an electronic sensor in
a region (such as a defined space or reaction confinement region or
microwell, for example) or that can indirectly affect such an
electronic sensor by a by-product from a reaction involving such
molecule or biological cell located in such region. In an
embodiment, an analyte may be a sample or template nucleic acid,
which may be subjected to a sequencing reaction, which may, in
turn, generate a reaction by-product, such as one or more hydrogen
ions, that can affect an electronic sensor. The term "analyte" also
comprehends multiple copies of analytes, such as proteins,
peptides, nucleic acids, for example, attached to solid supports,
such as beads or particles, for example. In an embodiment, an
analyte may be a nucleic acid amplicon or a solid phase amplicon. A
sample nucleic acid template may be associated with a surface via
covalent bonding or a specific binding or coupling reaction, and
may be derived from, for example, a shot-gun fragmented DNA or
amplicon library (which are examples of library fragments further
discussed herein), or a sample emulsion PCR process creating
clonally-amplified sample nucleic acid templates on particles such
as IonSphere.TM. particles. An analyte may include particles having
attached thereto clonal populations of DNA fragments, e.g., genomic
DNA fragments, cDNA fragments, for example.
[0038] As used herein, "primer" generally refers to an
oligonucleotide, either natural or synthetic, that is capable, upon
forming a duplex with a polynucleotide template, of acting as a
point of initiation of nucleic acid synthesis and being extended
from its 3' end along the template so that an extended duplex may
be formed. Extension of a primer may be carried out with a nucleic
acid polymerase, such as a DNA or RNA polymerase. The sequence of
nucleotides added in the extension process may be determined by the
sequence of the template polynucleotide. Primers may have a length
in the range of from 14 to 40 nucleotides, or in the range of from
18 to 36 nucleotides, for example, or from N to M nucleotides where
N is an integer larger than 18 and M is an integer larger than N
and smaller than 36, for example. Other lengths are of course
possible. Primers may be employed in a variety of amplification
reactions, including linear amplification reactions using a single
primer, or polymerase chain reactions, employing two or more
primers, for example. Guidance for selecting the lengths and
sequences of primers may be found in Dieffenbach and Dveksler
(eds.), PCR PRIMER: A LABORATORY MANUAL, 2nd ed. (Cold Spring
Harbor Laboratory Press, New York, 2003).
[0039] As used herein, "polynucleotide" or "oligonucleotide"
generally refers to a linear polymer of nucleotide monomers and may
be DNA or RNA. Monomers making up polynucleotides are capable of
specifically binding to a natural polynucleotide by way of a
regular pattern of monomer-to-monomer interactions, such as
Watson-Crick type of base pairing, base stacking, Hoogsteen or
reverse Hoogsteen types of base pairing, for example. Such monomers
and their internucleosidic linkages may be naturally occurring or
may be analogs thereof, e.g., naturally occurring or non-naturally
occurring analogs. Non-naturally occurring analogs may include
PNAs, phosphorothioate internucleosidic linkages, bases containing
linking groups permitting the attachment of labels, such as
fluorophores, or haptens, for example. In an embodiment,
oligonucleotide may refer to smaller polynucleotides, for example,
having 5-40 monomeric units. Polynucleotides may include the
natural deoxyribonucleosides (e.g., deoxyadenosine, deoxycytidine,
deoxyguanosine, and deoxythymidine for DNA or their ribose
counterparts for RNA) linked by phosphodiester linkages. However,
they may also include non-natural nucleotide analogs, e.g.,
including modified bases, sugars, or internucleosidic linkages. In
an embodiment, a polynucleotide may be represented by a sequence of
letters (upper or lower case), such as "ATGCCTG," and it will be
understood that the nucleotides are in 5'.fwdarw.3' order from left
to right and that "A" denotes deoxyadenosine, "C" denotes
deoxycytidine, "G" denotes deoxyguanosine, and "T" denotes
deoxythymidine, and that "I" denotes deoxyinosine, and "U" denotes
deoxyuridine, unless otherwise indicated or obvious from context.
Whenever the use of an oligonucleotide or polynucleotide requires
enzymatic processing, such as extension by a polymerase, ligation
by a ligase, oligonucleotides or polynucleotides in those instances
may not contain certain analogs of internucleosidic linkages, sugar
moieties, or bases at any or some positions. Unless otherwise noted
the terminology and atom numbering conventions will follow those
disclosed in Strachan and Read, HUMAN MOLECULAR GENETICS, 2nd ed.
(Wiley-Liss, New York, 1999). Polynucleotides may range in size
from a few monomeric units, e.g., 5-40, to several thousand
monomeric units, for example.
[0040] As used herein, "defined space" (or "reaction space," which
may be used interchangeably with "defined space") generally refers
to any space or region (which may be in one, two, or three
dimensions) in which at least some of a molecule, fluid, and/or
solid can be confined, retained and/or localized. The space may be
a predetermined area (which may be a flat area) or volume, and may
be defined, for example, by a depression or a micro-machined well
in or associated with a microwell plate, microtiter plate,
microplate, or a chip. The area or volume may also be determined
based on an amount of fluid or solid, for example, deposited on an
area or in a volume otherwise defining a space. For example,
isolated hydrophobic areas on a generally hydrophobic surface may
provide defined spaces. In an embodiment, a defined space may be a
reaction chamber, such as a well or a microwell, which may be in a
chip. In an embodiment, a defined space may be a substantially flat
area on a substrate without wells, for example. A defined space may
contain or be exposed to enzymes and reagents used in nucleotide
incorporation.
[0041] As used herein, "reaction confinement region" generally
refers to any region in which a reaction may be confined and
includes, for example, a "reaction chamber," a "well," and a
"microwell" (each of which may be used interchangeably). A reaction
confinement region may include a region in which a physical or
chemical attribute of a solid substrate can permit the localization
of a reaction of interest, and a discrete region of a surface of a
substrate that can specifically bind an analyte of interest (such
as a discrete region with oligonucleotides or antibodies covalently
linked to such surface), for example. Reaction confinement regions
may be hollow or have well-defined shapes and volumes, which may be
manufactured into a substrate. These latter types of reaction
confinement regions are referred to herein as microwells or
reaction chambers, may be fabricated using any suitable
microfabrication techniques, and may have volume, shape, aspect
ratio (e.g., base width-to-well depth ratio), and other dimensional
characteristics that may be selected depending on particular
applications, including the nature of reactions taking place as
well as the reagents, by-products, and labeling techniques (if any)
that are employed. Reaction confinement regions may also be
substantially flat areas on a substrate without wells, for example.
In various embodiments, microwells may be fabricated using any
suitable fabrication technique known in the art. Exemplary
configurations (e.g., spacing, shape, and volume) of microwells or
reaction chambers are disclosed in Rothberg et al., U.S. Pat. Publ.
Nos. 2009/0127589 and 2009/0026082; Rothberg et al., U.K. Pat.
Appl. Publ. No. GB 2461127; and Kim et al., U.S. Pat. No.
7,785,862, which are all incorporated by reference in their
entirety.
[0042] Defined spaces or reaction confinement regions may be
arranged as an array, which may be a substantially planar
one-dimensional or two-dimensional arrangement of elements such as
sensors or wells. The number of columns (or rows) of a
two-dimensional array may or may not be the same. Preferably, the
array comprises at least 100,000 chambers. Preferably, each
reaction chamber has a horizontal width and a vertical depth that
has an aspect ratio of about 1:1 or less. Preferably, the pitch
between the reaction chambers is no more than about 10 microns.
Preferably, each reaction chamber is no greater than 10 .mu.m.sup.3
(i.e., 1 pL) in volume, or no greater than 0.34 pL in volume, and
more preferably no greater than 0.096 pL or even 0.012 pL in
volume. A reaction chamber may be 2.sup.2, 3.sup.2, 4.sup.2,
5.sup.2, 6.sup.2, 7.sup.2, 8.sup.2, 9.sup.2, or 10.sup.2 square
microns in cross-sectional area at the top, for example.
Preferably, the array may have at least 10.sup.2, 10.sup.3,
10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, or more
reaction chambers, for example. The reaction chambers may be
capacitively coupled to chemFETs.
[0043] Defined spaces or reaction confinement regions, whether
arranged as an array or in some other configuration, may be in
electrical communication with at least one sensor to allow
detection or measurement of one or more detectable or measurable
parameter or characteristics. The sensors may convert changes in
the presence, concentration, or amounts of reaction by-products (or
changes in ionic character of reactants) into an output signal,
which may be registered electronically, for example, as a change in
a voltage level or a current level which, in turn, may be processed
to extract information about a chemical reaction or desired
association event, for example, a nucleotide incorporation event.
The sensors may include at least one chemically sensitive field
effect transistor ("chemFET") that can be configured to generate at
least one output signal related to a property of a chemical
reaction or target analyte of interest in proximity thereof. Such
properties can include a concentration (or a change in
concentration) of a reactant, product or by-product, or a value of
a physical property (or a change in such value), such as an ion
concentration. An initial measurement or interrogation of a pH for
a defined space or reaction confinement region, for example, may be
represented as an electrical signal or a voltage, which may be
digitalized (e.g., converted to a digital representation of the
electrical signal or the voltage). Any of these measurements and
representations may be considered raw data or a raw signal.
[0044] As used herein, "nucleic acid template" (or "sequencing
template," which may be used interchangeably with "nucleic acid
template") generally refers to a nucleic acid sequence that is a
target of one or more nucleic acid sequencing reactions. A sequence
for a nucleic acid template may comprise a naturally-occurring or
synthetic nucleic acid sequence. A sequence for a nucleic acid
template may also include a known or unknown nucleic acid sequence
from a sample of interest. In various embodiments, a nucleic acid
template may be attached to a solid support such as, e.g., a bead,
microparticle, flow cell, or any other surface, support, or
object.
[0045] As used herein, "fragment library" generally refers to a
collection of nucleic acid fragments in which one or more fragments
are used as a sequencing template. A fragment library may be
generated in numerous ways (e.g., by cutting, shearing,
restricting, or otherwise subdividing a larger nucleic acid into
smaller fragments). Fragment libraries may be generated or obtained
from naturally occurring nucleic acids, such as, for example, from
bacteria, cancer cells, normal cells, or solid tissue. Libraries
comprising synthetic nucleic acid sequences may also be generated
to create a synthetic fragment library.
[0046] As used herein, "mate pair library" generally refers to a
collection of nucleic acid sequences comprising two or more
fragments having a particular relationship, such as being separated
by a known number of nucleotides, for example. Mate pair fragments
may be generated in numerous ways (e.g., by cutting, shearing,
restricting, or otherwise subdividing a larger nucleic acid and
associating the sequence fragments from the ends of the resulting
fragments or by associating other subsequences of the resulting
fragments). Mate pair libraries may be generated, for example, by
circularizing a nucleic acid with an internal adapter construct and
then removing the middle portion of the nucleic acid to create a
linear strand of nucleic acid comprising the internal adapter with
the sequences from the ends of the nucleic acid attached to either
end of the internal adapter. Like fragment libraries, mate pair
libraries may be generated or obtained from naturally occurring
nucleic acid sequences, such as, for example, from bacteria, cancer
cells, normal cells, or solid tissue. Synthetic mate pair libraries
may also be generated, e.g., by attaching synthetic nucleic acid
sequences to either end of an internal adapter sequence.
[0047] As used herein, a "molecular sample discriminating code" (or
"molecular barcode," which may be used interchangeably with
"molecular sample discriminating code") generally refers to an
identifiable or resolvable molecular marker, which may be uniquely
resolved and may be attached to a sample nucleic acid, biomolecule,
or polymer, for example. Such a molecular sample discriminating
code may be used for tracking, sorting, separating, and/or
identifying sample nucleic acids, biomolecules, or polymers, and
may be designed to have properties useful for manipulating nucleic
acids, biomolecules, polymers, or other molecules. Molecular sample
discriminating codes may comprise the same kind or type of material
or subunits comprising the nucleic acid, biomolecule, or polymer
they are intended to identify, or they may comprise one or more
different material(s) or subunit(s). A molecular sample
discriminating code may comprise a short nucleic acid comprising a
known or predetermined sequence. A molecular sample discriminating
code may be a nucleic acid sample discriminating code (or nucleic
acid barcode), which may be an identifiable or resolvable
nucleotide sequence (e.g., an oligonucleotide or polynucleotide
sequence), and which may include one or more restriction
endonuclease recognition sequences or cleavage sites, overhang
ends, adaptor sequences, primer sequences, and the like (including
combinations of features or properties). A molecular sample
discriminating code may be a biopolymer sample discriminating code,
which may include one or more antibody recognition sites,
restriction sites, intra- or inert-molecule binding sites, and the
like (including combinations of features or properties). A
plurality of different molecular sample discriminating codes may be
used to identify or characterize samples belonging to a common
group, and may be attached to, coupled with, or otherwise
associated with libraries of nucleic acids, biomolecules, polymers,
or other molecules, for example. A molecular sample discriminating
code or molecular barcode may be represented by a sample
discriminating code or sequence or barcode, which may comprise a
set of symbols, components, or characters that may be used to
represent or define a molecular sample discriminating code or
barcode. For example, a sample discriminating code or barcode may
comprise a sequence of letters defining a known or predetermined
sequence of nucleic acid bases or other biomolecule or polymer
constituents. Sample discriminating codes or barcodes may be used
in a variety of sets, subsets, and groupings. Sample discriminating
codes or barcodes may be read, or otherwise recognized, identified,
or interpreted as a function of a sequence or other arrangement or
relationship of subunits that together form a code. Sample
discriminating codes or barcodes may also contain one or more
additional functional elements including key sequences for quality
control and sample detection, primer sites, adaptors for ligation,
linkers for attaching to substrates, inserts, etc., for
example.
[0048] FIG. 1A illustrates an exemplary system for obtaining,
processing, and/or analyzing multiplex nucleic acid sequencing
data. The system includes a sequencing instrument 601, a server 602
or other computing means or resource, and one or more end user
computers 605 or other computing means or resource. The sequencing
instrument 601 may be configured to process samples comprising
barcodes and to deliver reagents according to a predetermined
ordering. The predetermined ordering may be based on a cyclical,
repeating pattern of consecutive repeats of a predetermined reagent
flow ordering (e.g., consecutive repeats of predetermined sequence
of four nucleotide reagents such as "TACG TACG . . . "), or may be
based on a random reagent flow ordering, or may be based on an
ordering comprising in whole or in part a phase-protecting reagent
flow ordering as described in Hubbell et al., U.S. patent
application Ser. No. 13/440,849, filed Apr. 5, 2012, which is
incorporated by reference herein in its entirety, or some
combination thereof. The server 602 may include a processor 603 and
a memory and/or database 604. The sequencing instrument 601 and the
server 602 may include one or more computer readable media for
obtaining, processing, and/or analyzing multiplex nucleic acid
sequencing data. In an embodiment, the barcodes may be determined
at least in part as a function of the ordering. In an embodiment,
the barcodes may comprises codewords of an error-tolerant code,
which codewords may be represented in flowspace rather than base
space (e.g., may comprise digits or characters corresponding to
numbers of nucleotide incorporations responsive to predetermined
nucleotide flows rather than actual bases such as nucleic acid
bases in base space). In an embodiment, the instrument and the
server or other computing means or resource may be configured as a
single component. One or more of these components may be used to
perform or implement one or more aspects of the embodiments
described herein.
[0049] FIG. 1B illustrates an exemplary method for obtaining,
processing, and/or analyzing multiplex nucleic acid sequencing
data. In step 611, a user obtains multiplex sequencing data from an
instrument configured to analyze sample nucleic acids comprising a
nucleic acid barcode designed at least in part as a function of a
predetermined or expected reagent flow ordering. The multiplex
sequencing data may include signal data indicative of hydrogen ion
concentrations, for example. The predetermined ordering may be
based on a cyclical, repeating pattern of consecutive repeats of a
predetermined reagent flow ordering (e.g., consecutive repeats of
predetermined sequence of four nucleotide reagents such as "TACG
TACG . . . "), or may be based on a random reagent flow ordering,
or may be based on an ordering comprising in whole or in part a
phase-protecting reagent flow ordering as described in Hubbell et
al., U.S. patent application Ser. No. 13/440,849, filed Apr. 5,
2012, which is incorporated by reference herein in its entirety, or
some combination thereof. In step 612, a server or other computing
means or resource converts the multiplex sequencing data into
sequences of bases. In step 613, the server or other computing
means or resource delivers the multiplex sequencing data and/or
sequences of bases to an end user. One or more of these steps
and/or components may be used to perform or implement one or more
aspects of the embodiments described herein.
[0050] In various embodiments, the methods, systems, computer
readable media, and kits described herein may advantageously be
used to determine the sequence and/or identity of one or more
nucleic acid samples using sequencing-by-synthesis. In
sequencing-by-synthesis, the sequence of a target nucleic acid may
be determined by the stepwise synthesis of complementary nucleic
acid strands on a target nucleic acid (whose sequence and/or
identity is to be determined) serving as a template for the
synthesis reactions (e.g., by a polymerase extension reaction that
typically includes the formation of a complex comprising a template
(or target polynucleotide), a primer annealed thereto, and a
polymerase operably coupled or associated with the primer-template
hybrid so as to be capable of incorporating a nucleotide species
(e.g., a nucleoside triphosphate, a nucleotide triphosphate, a
precursor nucleoside or nucleotide) to the primer). During
sequencing-by-synthesis, nucleotides may be sequentially added to
growing polynucleotide molecules or strands at positions
complementary to template polynucleotide molecules or strands. The
addition of the nucleotides to the growing complementary strands,
which may be detected using a variety of methods (e.g.,
pyrosequencing, fluorescence detection, and label-free electronic
detection), may be used to identify the sequence composition of the
template nucleic acid. This process may be iterated until a
complete or selected sequence length complementary to the template
has been synthesized.
[0051] In various embodiments, the methods, systems, computer
readable media, and kits described herein may advantageously be
used to generate, process, and/or analyze data and signals obtained
using electronic or charged-based nucleic acid sequencing. In
electronic or charged-based sequencing (such as, e.g., pH-based
sequencing), a nucleotide incorporation event may be determined by
detecting ions (e.g., hydrogen ions) generated as natural
by-products of polymerase-catalyzed nucleotide extension reactions.
This may be used to sequence a sample or template nucleic acid,
which may be a fragment of a nucleic acid sequence of interest, for
example, and which may be directly or indirectly attached as a
clonal population to a solid support, such as a particle,
microparticle, bead, etc. The sample or template nucleic acid may
be operably associated to a primer and polymerase and may be
subjected to repeated cycles or "flows" of deoxynucleoside
triphosphate ("dNTP") addition (which may be referred to herein as
"nucleotide flows" from which nucleotide incorporations may result)
and washing. The primer may be annealed to the sample or template
so that the primer's 3' end can be extended by a polymerase
whenever dNTPs complementary to the next base in the template are
added. Based on the known sequence of flows and on measured signals
indicative of ion concentration during each nucleotide flow, the
identity of the type, sequence and number of nucleotide(s)
associated with a sample nucleic acid present in a reaction chamber
can be determined.
[0052] FIG. 2A illustrates components of an exemplary system for
nucleic acid sequencing. The components include a flow cell and
sensor array 100, a reference electrode 108, a plurality of
reagents 114, a valve block 116, a wash solution 110, a valve 112,
a fluidics controller 118, lines 120/122/126, passages 104/109/111,
a waste container 106, an array controller 124, and a user
interface 128. The flow cell and sensor array 100 includes an inlet
102, an outlet 103, a microwell array 107, and a flow chamber 105
defining a flow path of reagents over the microwell array 107. The
reference electrode 108 may be of any suitable type or shape,
including a concentric cylinder with a fluid passage or a wire
inserted into a lumen of passage 111. The reagents 114 may be
driven through the fluid pathways, valves, and flow cell by pumps,
gas pressure, or other suitable methods, and may be discarded into
the waste container 106 after exiting the flow cell and sensor
array 100. The reagents 114 may, for example, contain dNTPs to be
flowed through passages 130 and through the valve block 116, which
may control the flow of the reagents 114 to flow chamber 105 (also
referred to herein as a reaction chamber) via passage 109. The
system may include a reservoir 110 for containing a wash solution
that may be used to wash away dNTPs, for example, that may have
previously been flowed. The microwell array 107 may include an
array of defined spaces or reaction confinement regions, such as
microwells, for example, that is operationally associated with a
sensor array so that, for example, each microwell has a sensor
suitable for detecting an analyte or reaction property of interest.
The microwell array 107 may preferably be integrated with the
sensor array as a single device or chip. The flow cell may have a
variety of designs for controlling the path and flow rate of
reagents over the microwell array 107, and may be a microfluidics
device. The array controller 124 may provide bias voltages and
timing and control signals to the sensor, and collect and/or
process output signals. The user interface 128 may display
information from the flow cell and sensor array 100 as well as
instrument settings and controls, and allow a user to enter or set
instrument settings and controls. The system may be configured to
let a single fluid or reagent contact the reference electrode 108
throughout an entire multi-step reaction. The valve 112 may be shut
to prevent any wash solution 110 from flowing into passage 109 as
the reagents are flowing. Although the flow of wash solution may be
stopped, there may still be uninterrupted fluid and electrical
communication between the reference electrode 108, passage 109, and
the sensor array 107. The distance between the reference electrode
108 and the junction between passages 109 and 111 may be selected
so that little or no amount of the reagents flowing in passage 109
and possibly diffusing into passage 111 reach the reference
electrode 108. In an embodiment, the wash solution 110 may be
selected as being in continuous contact with the reference
electrode 108, which may be especially useful for multi-step
reactions using frequent wash steps. In various embodiments, the
fluidics controller 118 may be programmed to control driving forces
for flowing reagents 114 and the operation of valve 112 and valve
block 116 with any suitable instrument control software, such as
LabView (National Instruments, Austin, Tex.), to deliver reagents
to the flow cell and sensor array 100 according to a predetermined
reagent flow ordering. The reagents may be delivered for
predetermined durations, at predetermined flow rates, and may
measure physical and/or chemical parameters providing information
about the status of one or more reactions taking place in defined
spaces or reaction confinement regions, such as, for example,
microwells.
[0053] FIG. 2B illustrates an exemplary system 2101 for nucleic
acid sequencing. The system includes a reactor array 2102; a reader
board 2103; a computer and/or server 2104, which includes a CPU
2105 and a memory 2106; and a display 2107, which may be internal
and/or external. One or more of these components may be used to
perform or implement one or more aspects of the exemplary
embodiments described herein.
[0054] FIG. 3A illustrates cross-sectional and expanded views of an
exemplary flow cell 200 for nucleic acid sequencing. The flow cell
200 includes a microwell array 202, a sensor array 205, and a flow
chamber 206 in which a reagent flow 208 may move across a surface
of the microwell array 202, over open ends of microwells in the
microwell array 202. The flow of reagents (e.g., nucleotide
species) can be provided in any suitable manner, including delivery
by pipettes, or through tubes or passages connected to a flow
chamber. The duration, concentration, and/or other flow parameters
may be the same or different for each reagent flow. Likewise, the
duration, composition, and/or concentration for each wash flow may
be the same or different. A microwell 201 in the microwell array
202 may have any suitable volume, shape, and aspect ratio, which
may be selected depending on one or more of any reagents,
by-products, and labeling techniques used, and the microwell 201
may be formed in layer 210, for example, using any suitable
microfabrication technique. A sensor 214 in the sensor array 205
may be an ion sensitive (ISFET) or a chemical sensitive (chemFET)
sensor with a floating gate 218 having a sensor plate 220 separated
from the microwell interior by a passivation layer 216, and may be
predominantly responsive to (and generate an output signal related
to) an amount of charge 224 present on the passivation layer 216
opposite of the sensor plate 220. Changes in the amount of charge
224 cause changes in the current between a source 221 and a drain
222 of the sensor 214, which may be used directly to provide a
current-based output signal or indirectly with additional circuitry
to provide a voltage output signal. Reactants, wash solutions, and
other reagents may move into microwells primarily by diffusion 240.
One or more analytical reactions to identify or determine
characteristics or properties of an analyte of interest may be
carried out in one or more microwells of the microwell array 202.
Such reactions may generate directly or indirectly by-products that
affect the amount of charge 224 adjacent to the sensor plate 220.
In an embodiment, a reference electrode 204 may be fluidly
connected to the flow chamber 206 via a flow passage 203. In an
embodiment, the microwell array 202 and the sensor array 205 may
together form an integrated unit forming a bottom wall or floor of
the flow cell 200. In an embodiment, one or more copies of an
analyte may be attached to a solid phase support 212, which may
include microparticles, nanoparticles, beads, gels, and may be
solid and porous, for example. The analyte may include a nucleic
acid analyte, including a single copy and multiple copies, and may
be made, for example, by rolling circle amplification (RCA),
exponential RCA, or other suitable techniques to produce an
amplicon without the need of a solid support.
[0055] FIG. 3B illustrates an exemplary uniform flow front between
successive reagents moving across a section 234 of an exemplary
microwell array. A "uniform flow front" between first reagent 232
and second reagent 230 generally refers to the reagents undergoing
little or no mixing as they move, thereby keeping a boundary 236
between them narrow. The boundary may be linear for flow cells
having inlets and outlets at opposite ends of their flow chambers,
or it may be curvilinear for flow cells having central inlets (or
outlets) and peripheral outlets (or inlets). In an embodiment, the
flow cell design and reagent flow rate may be selected so that each
new reagent flow with a uniform flow front as it transits the flow
chamber during a switch from one reagent to another.
[0056] FIG. 4 illustrates an exemplary process for label-free,
pH-based sequencing. A template 682 with sequence 685 and a primer
binding site 681 are attached to a solid phase support 680. The
template 682 may be attached as a clonal population to a solid
support, such as a microparticle or bead, for example, and may be
prepared as disclosed in Leamon et al., U.S. Pat. No. 7,323,305,
which is incorporated by reference herein in its entirety. In an
embodiment, the template may be associated with a substrate surface
or present in a liquid phase with or without being coupled to a
support. A primer 684 and DNA polymerase 686 are operably bound to
the template 682. As used herein, "operably bound" generally refers
to a primer being annealed to a template so that the primer's 3'
end may be extended by a polymerase and that a polymerase is bound
to such primer-template duplex (or in close proximity thereof) so
that binding and/or extension may take place when dNTPs are added.
In step 688, dNTP (shown as dATP) is added, and the DNA polymerase
686 incorporates a nucleotide "A" (since "T" is the next nucleotide
in the template 682 and is complementary to the flowed dATP
nucleotide). In step 690, a wash is performed. In step 692, the
next dNTP (shown as dCTP) is added, and the DNA polymerase 686
incorporates a nucleotide "C" (since "G" is the next nucleotide in
the template 682). The pH-based nucleic acid sequencing, in which
base incorporations may be determined by measuring hydrogen ions
that are generated as natural by-products of polymerase-catalyzed
extension reactions, may be performed using at least in part one or
more features of Anderson et al., A SYSTEM FOR MULTIPLEXED DIRECT
ELECTRICAL DETECTION OF DNA SYNTHESIS, Sensors and Actuators B:
Chem., 129:79-86 (2008); Rothberg et al., U.S. Pat. Appl. Publ. No.
2009/0026082; and Pourmand et al., DIRECT ELECTRICAL DETECTION OF
DNA SYNTHESIS, Proc. Natl. Acad. Sci., 103:6466-6470 (2006), which
are all incorporated by reference herein in their entirety. In an
embodiment, after each addition of a dNTP, an additional step may
be performed in which the reaction chambers are treated with a
dNTP-destroying agent, such as apyrase, to eliminate any residual
dNTPs remaining in the chamber that might result in spurious
extensions in subsequent cycles.
[0057] In an embodiment, the primer-template-polymerase complex may
be subjected to a series of exposures of different nucleotides in a
predetermined or known sequence or ordering. If one or more
nucleotides are incorporated, then the signal resulting from the
incorporation reaction may be detected, and after repeated cycles
of nucleotide addition, primer extension, and signal acquisition,
the nucleotide sequence of the template strand may be determined.
The output signals measured throughout this process depend on the
number of nucleotide incorporations. Specifically, in each addition
step, the polymerase extends the primer by incorporating added dNTP
only if the next base in the template is complementary to the added
dNTP. If there is one complementary base, there is one
incorporation; if two, there are two incorporations; if three,
there are three incorporations, and so on. With each incorporation,
an hydrogen ion is released, and collectively a population released
hydrogen ions change the local pH of the reaction chamber. The
production of hydrogen ions may be monotonically related to the
number of contiguous complementary bases in the template (as well
as to the total number of template molecules with primer and
polymerase that participate in an extension reaction). Thus, when
there is a number of contiguous identical complementary bases in
the template (which may represent a homopolymer region), the number
of hydrogen ions generated and thus the magnitude of the local pH
change is proportional to the number of contiguous identical
complementary bases (and the corresponding output signals are then
sometimes referred to as "1-mer," "2-mer," "3-mer" output signals,
etc.). If the next base in the template is not complementary to the
added dNTP, then no incorporation occurs and no hydrogen ion is
released (and the output signal is then sometimes referred to as a
"0-mer" output signal). In each wash step of the cycle, an
unbuffered wash solution at a predetermined pH may be used to
remove the dNTP of the previous step in order to prevent
misincorporations in later cycles. Deliveries of nucleotides to a
reaction vessel or chamber may be referred to as "flows" of
nucleotide triphosphates (or dNTPs). For convenience, a flow of
dATP will sometimes be referred to as "a flow of A" or "an A flow,"
and a sequence of flows may be represented as a sequence of
letters, such as "ATGT" indicating "a flow of dATP, followed by a
flow of dTTP, followed by a flow of dGTP, followed by a flow of
dTTP. In an embodiment, the four different kinds of dNTP are added
sequentially to the reaction chambers, so that each reaction is
exposed to the four different dNTPs, one at a time. In an
embodiment, the four different kinds of dNTP are added in the
following sequence: dATP, dCTP, dGTP, dTTP, dATP, dCTP, dGTP, dTTP,
etc., with each exposure, incorporation, and detection steps
followed by a wash step. Each exposure to a nucleotide followed by
a washing step can be considered a "nucleotide flow." Four
consecutive nucleotide flows can be considered a "cycle." For
example, a two cycle nucleotide flow order can be represented by:
dATP, dCTP, dGTP, dTTP, dATP, dCTP, dGTP, dTTP, with each exposure
being followed by a wash step. Different flow orders are of course
possible. In various embodiments, the predetermined sequence or
ordering may be based on a cyclical, repeating pattern of
consecutive repeats of a predetermined reagent flow ordering (e.g.,
consecutive repeats of predetermined sequence of four nucleotide
reagents such as "TACG TACG . . . "), or may be based on a random
reagent flow ordering, or may be based on an ordering comprising in
whole or in part a phase-protecting reagent flow ordering as
described in Hubbell et al., U.S. patent application Ser. No.
13/440,849, filed Apr. 5, 2012, which is incorporated by reference
herein in its entirety, or some combination thereof.
[0058] FIG. 5 shows an exemplary ionogram representation of signals
from which base calls may be made. In this example, the x-axis
shows the nucleotide that is flowed and the corresponding number of
nucleotide incorporations may be estimated by rounding to the
nearest integer shown in the y-axis, for example. Signals used to
make base calls and determine a flowspace vector may be from any
suitable point in the acquisition or processing of the data signals
received from sequencing operations. For example, the signals may
be raw acquisition data or data having been processed, such as,
e.g., by background filtering, normalization, correction for signal
decay, and/or correction for phase errors or effects, etc. The base
calls may be made by analyzing any suitable signal characteristics
(e.g., signal amplitude or intensity).
[0059] In various embodiments, output signals due to nucleotide
incorporation may be processed in various way to improve their
quality and/or signal-to-noise ratio, which may include performing
or implementing one or more of the teachings disclosed in Rearick
et al., U.S. patent application Ser. No. 13/339,846, filed Dec. 29,
2011, and in Hubbell, U.S. patent application Ser. No. 13/339,753,
filed Dec. 29, 2011, which are all incorporated by reference herein
in their entirety.
[0060] In various embodiments, output signals due to nucleotide
incorporation may be further processed, given knowledge of what
nucleotide species were flowed and in what order to obtain such
signals, to make base calls for the flows and compile consecutive
base calls associated with a sample nucleic acid template into a
read. A base call refers to a particular nucleotide identification
(e.g., dATP ("A"), dCTP ("C"), dGTP ("G"), or dTTP ("T")). Base
calling may include performing one or more signal normalizations,
signal phase and signal droop (e.g, enzyme efficiency loss)
estimations, and signal corrections, and may identify or estimate
base calls for each flow for each defined space. Base calling may
include performing or implementing one or more of the teachings
disclosed in Davey et al., U.S. patent application Ser. No.
13/283,320, filed Oct. 27, 2011, which is incorporated by reference
herein in its entirety. Other aspects of signal processing and base
calling may include performing or implementing one or more of the
teachings disclosed in Davey et al., U.S. patent application Ser.
No. 13/340,490, filed on Dec. 29, 2011, and Sikora et al., U.S.
patent application Ser. No. 13/588,408, filed on Aug. 17, 2012,
which are all incorporated by reference herein in their
entirety.
[0061] FIGS. 6A and 6B demonstrate a relationship between a base
space sequence and a flowspace vector. A series of signals
representative of a number of incorporations or lack thereof (e.g.,
0-mer, 1-mer, 2-mer, etc.) produced by a series of nucleotide flows
may be referred to as a flowspace vector or sequence, as opposed to
a base space sequence, which is simply the order of identified
nucleotide bases in a nucleic acid of interest. The flowspace
vector may be produced using any suitable nucleotide flow ordering,
including a predetermined ordering based on a cyclical, repeating
pattern of consecutive repeats of a predetermined reagent flow
ordering, based on a random reagent flow ordering, or based on an
ordering comprising in whole or in part a phase-protecting reagent
flow ordering as described in Hubbell et al., U.S. patent
application Ser. No. 13/440,849, filed Apr. 5, 2012, or some
combination thereof. In FIGS. 6A and 6B, an exemplary base space
sequence AGTCCA is subjected to sequencing operations using a
cyclical flow ordering of TACG (that is, a T nucleotide flow,
followed by an A nucleotide flow, followed by a C nucleotide flow,
followed by a G nucleotide flow, and this 4-flow ordering is then
repeated cyclically). The flows result in a series of signals
having an amplitude (e.g., signal intensity) related to the number
of nucleotide incorporations (e.g., 0-mer, 1-mer, 2-mer, etc.).
This series of signals generates the flowspace vector 101001021. As
shown in FIG. 6A, the base space sequence AGTCCA may be translated
to a flowspace vector 101001021 under a cyclical flow ordering of
TACG. The flowspace vector may change if the flow ordering is
changed. As shown in FIG. 6B, the flowspace vector may be mapped
back to the base space sequence associated with the sample.
[0062] Barcodes
[0063] In various embodiments, sample discriminating codes or
barcodes may comprise or correspond to or with (whether directly or
indirectly) sequences of nucleotides, biomolecule components and/or
subunits, or polymer components and/or subunits. In an embodiment,
a sample discriminating code or barcode may correspond to a
sequence of individual nucleotides in a nucleic acid or subunits of
a biomolecule or polymer or to sets, groups, or continuous or
discontinuous sequences of such nucleotides or subunits. In an
embodiment, a sample discriminating code or barcode may also
correspond to or with (whether directly or indirectly) transitions
between nucleotides, biomolecule subunits, or polymer subunits, or
other relationships between subunits forming a sample
discriminating code or barcode.
[0064] In various embodiments, sample discriminating codes or
barcodes may have properties that permit them to be read, or
otherwise recognized, identified, or interpreted with improved
accuracy and/or reduced error rates for a given code type, length,
or complexity. In an embodiment, a sample discriminating code or
barcode may be designed as a set (which may include subsets) of
individual sample discriminating codes or barcodes. In some
embodiments, one or more sample discriminating codes or barcodes in
a set (or in a subset from that set) may be selected based on one
or more criteria to improve accuracy and/or reduce error rates in
reading, or otherwise recognizing, identifying, discriminating, or
interpreting the codes.
[0065] In various embodiments, sample discriminating codes or
barcodes may be designed to exhibit high fidelity reads, which may
be assessed based on empirical sequencing measurements. The level
of fidelity may be based on predictions of the read accuracy of a
sample discriminating code or barcode having a particular
nucleotide sequence. Certain nucleotide sequences known to cause
sequencing read ambiguity, errors, or sequencing bias may be
avoided. Design may be based on accurately calling the sample
discriminating code or barcode (and associated sample or nucleic
acid population), even in the presence of one or more errors. In
various embodiments, fidelity may be based on the probability of
correctly sequencing the sample discriminating code or barcode,
which may be at least 82%, or at least 85%, or at least 90%, or at
least 95%, or at least 99%, or more.
[0066] In various embodiments, sample discriminating codes or
barcodes may be designed to exhibit improved read accuracy for
sequencing using a sequence-by-synthesis platform (as discussed
previously), which may include fluorophore-labeled nucleotide
sequencing platforms or non-labeled sequencing platforms, such as
the Ion PGM.TM. and Ion Proton.TM. Sequencers, for example. Design
of the sample discriminating codes or barcodes and specific
sequences are not limited to any particular instrument platform or
sequencing technology, however. In the case of non-nucleic acid
codes, sample discriminating codes or barcodes may be read,
identified, interpreted or otherwise recognized using methods known
in the art, including for example, amino acid sequencing for
protein sample discriminating codes.
[0067] In various embodiments, sample discriminating codes or
barcodes may be designed to optimize the barcode's observed
performance in a sequencing process. A design approach may include
applying a series of sample discriminating code or barcode
constraints or criteria to achieve desired properties or
performance. Such constraints or criteria may include one or more
of uniqueness of nucleic acid barcode sequences and a degree of
separation from other nucleic acid barcode sequences. A set of
barcodes may be a nested set of barcodes, which may be based on one
or more design criteria. In an embodiment, nested barcode sets may
be designed analogously to Matryoshka nesting, such that the
properties of a subset are entirely contained within the properties
of a genus set. For example, a first subset of barcodes meeting
certain properties (e.g., a high sequencing fidelity) may be
selected from a larger set of barcodes meeting the same properties.
For example, if a set of barcodes comprises 96 uniquely
identifiable barcodes, then a subset of 16 barcodes may be selected
from the 96 available barcodes for a sequencing experiment
comprises only 16 multiplexed samples. The subset of 16 barcodes
may thus be optimized to a similar degree as a larger subset of 32
barcodes or 48 barcodes selected from the full set of 96 barcodes.
In an embodiment, the barcodes may be designed as an ordered list
of nested barcodes. In an embodiment, the barcodes (e.g., a set of
96) may be ordered by having a first barcode, a second barcode that
is the one (of the remaining 95) that is furthest from the first
one under a suitable distance measure, a third barcode that is the
one (of the remaining 94) that is furthest from the first and
second one under a suitable distance measure, and so on until all
the barcodes have been ordered. A user may then select an
appropriate number of barcode from such an ordered list.
[0068] In various embodiments, sample discriminating codes or
barcodes may contain a target sequence that is a sequence of
interest, and in such cases may assist in uniquely identifying or
discriminating different target sequences. The target sequence may
be any type of sequence from any source of interest, including
amplicons, candidate genes, mutational hot spots, single nucleotide
polymorphisms, genomic library fragments, etc., for example. The
sample discriminating code or barcode sequence may be operatively
coupled to the target sequence at any of various points in the
sample preparation process using techniques such as PCR
amplification, DNA ligation, bacterial cloning, etc., for example.
The sample discriminating code or barcode sequence may be contained
in oligonucleotides and ligated to genomic library fragments using
any suitable DNA ligation technique.
[0069] In various embodiments, sample discriminating codes or
barcodes may have various lengths, which may be selected based on a
number of samples to be identified. In various embodiments, for a
16-sample multiplexed sequencing experiment, 16 uniquely
identifiable barcodes may be sufficient to uniquely identify each
sample. Similarly, for a 64- or 96-sample multiplexed sequencing
experiment, for example, only 64 or 96 barcodes may be sufficient,
respectively. Larger numbers of samples may require longer codes.
However, although longer codes will allow identification of a
larger number of samples, they may have drawbacks. For example, in
sequencing-by-synthesis, longer codes may require additional
numbers of nucleotide flows, which may decrease accuracy given that
sequencing tends to be maximally accurate in earlier flows, where
the codes may typically be located. In various embodiments, nucleic
acid barcodes, for example, may have a length of about 4-30 bases,
or about 4-50 bases, or more, for example. The length may be
selected based on one or both of a length of the probe sequence and
a number of samples in the experiment. The length may be a multiple
of the probe sequence length. The length may be longer for a larger
number of samples. For example, in a 16-sample experiment using
5-base probe sequences, the barcodes may be 5 bases in length; and
in a 96-sample experiment using 5-base probe sequences, the
barcodes may be 10 bases in length.
[0070] In various embodiments, sample discriminating codes or
barcodes may be designed based on one or more of the considerations
and/or criteria set forth above (which may be taken alone or in
combination). For example, a set of nucleic acid barcodes may be
designed such that problematic sequences are avoided in all
positions. In another example, a set of nucleic acid barcodes may
be designed such that problematic sequences are avoided and the
nucleic acid barcodes are sequenced with high fidelity. Various
combinations of considerations/criteria may be chosen based on the
sequencing experiment. For example, if barcodes are to be used for
a small number of samples, the barcodes may not necessarily be
designed to have nested subsets. The design considerations/criteria
may be selected based on the number of samples, the level of
accuracy needed, the sensitivity of the sequencing instrument to
detect individual samples, the accuracy of the sequencing
instrument, etc., for example.
[0071] In various embodiments, sample discriminating codes or
barcodes may be designed to have error-tolerant properties. The
error-tolerant properties may be in base space (in other words, the
errors here may related to incorrect bases in the barcode, such as,
e.g., a "C" base present where a "T" base should be in the
barcode). For example, a 1-base error-tolerant barcode set may be
designed such that if a sequencing error is encountered at any
position in one or more barcodes of the set each barcode may still
be resolvable from other barcodes in the set (e.g., the set may be
such that if one base is incorrect in a given erroneous barcode,
that erroneous barcode may still be resolved from the other
barcodes in the set because they all differ from the erroneous
barcode in at least two base locations, for example, so that if the
error occurred at one of these two locations, the other remains
available to allow distinction between the barcodes). The set may
also be designed to be able to distinguish barcodes within it even
where multiple errors (e.g., 2, 3, etc.) in one or more of the
barcodes are encountered. Such error-tolerant properties are
advantageous as they help provide more certainty for resolving even
complex multiplexed samples, even in the presence of potential
sequencing errors. Candidate barcodes in a set may be compared to
ascertain error-tolerant properties. For example, such barcodes can
be compared (e.g., via computer analysis or simulation) to
determine whether, if any one error (or 2, 3, etc., as the
criterion may be) occurred, the codes can still be
distinguished.
[0072] In various embodiments, sample discriminating codes or
barcodes as set forth herein may be used in any suitable manner to
assist in identifying or resolving samples. For example, barcodes
may be used individually, or two or more barcodes may be used in
combination. In an embodiment, a single barcode may identify one
target sequence or multiple target sequences. For example, a single
barcode may identify a group of target sequences. A barcode may be
read separately from the target sequence or as part of a larger
read operation spanning the barcode and a target sequence. The
barcode may be positioned at any suitable position within the
sample, including before or after a target sequence.
[0073] Barcode Design & Flowspace
[0074] In various embodiments, sample discriminating codes or
barcodes may be designed at least partly based on flowspace
considerations, rather than base space. In other words, design may
be based at least partly on flowspace vectors rather than base
sequences. For example, sample discriminating codes or barcodes may
be designed based on projection into flowspace as a flowspace
vector under a selected or predetermined flow ordering. A string of
characters in the flowspace vector of a barcode (e.g., a string of
digits or characters such as 0, 1, 2, etc., that may represent a
non-incorporation, a 1-mer incorporation, a 2-mer incorporation,
etc., responsive to flows of nucleotide flowed or introduced
according to a predetermined ordering) may represent or correspond
to a codeword of an error-tolerant code (e.g., an error-correcting
code). In an error-correcting code, a string of characters may be
such that errors introduced into the string (e.g., during
sequencing) can be detected and/or corrected based on remaining
characters in the string. An error-correcting code may be made up
of a set of different character strings, which may be referred to
as codewords, over a given finite alphabet .SIGMA. of character
elements. A codeword may be viewed as comprising a message plus
some redundant data or parity data allowing a decoder to correctly
decode a codeword containing one or more errors. Codewords may be
designed to be sufficiently separated from one another to allow for
a permissible numbers of errors to be detected in the transmission
of a codeword and, in some cases, to be corrected by calculating
which actual codeword is closest to the received codeword. In
sequencing-by-synthesis, for example, a message string may be
considered "transmitted" when a barcode has been sequenced and
projected into flowspace as a flowspace string.
[0075] In various embodiments, sample discriminating codes or
barcodes may be designed using any suitable type of
error-correcting code. The error-correcting code may be a linear
block code using an alphabet .SIGMA. of character elements with
each codeword having n encoding character elements. Redundancy
and/or parity data may be added to the message to allow a receiver
to detect and/or correct errors in a transmitted codeword, and to
recover the original message using a suitable decoding
algorithm.
[0076] In various embodiments, sample discriminating codes or
barcodes may be designed using various numbers of character
elements in a code alphabet, which may vary according to a
particular application. The error-correcting code may be a binary
code using an alphabet of two character elements. The
error-correcting code may be a ternary code using an alphabet of
three character elements. In an embodiment, the number of
characters elements may depend on a length of a longest homopolymer
run allowed in the barcode sequence. For example, if a barcode has
only 1-mers (no repeating bases), then the error-correcting code
may be a binary code with one character to represent a
non-incorporation and another character to represent a single-base
incorporation (e.g., an alphabet .SIGMA. for such a binary code may
be {0, 1}, with "0" representing a non-incorporation and "1"
representing a single-base incorporation). In another example, if
the barcode has only 1-mers and 2-mers, then the error-correcting
code may be a ternary code with the same non-incorporation and
single-base incorporation characters, and a third character to
represent a two-base incorporation (e.g., an alphabet .SIGMA. for
such a ternary code may be {0, 1, 2}, with "2" representing a
two-base incorporation). The size and the set of characters used in
other code alphabets may be suitably modified if the barcode
sequence has 3-mers, 4-mers, and so on.
[0077] In various embodiments, sample discriminating codes or
barcodes may be designed using an error-correcting code based at
least in part on Hamming codes, Golay codes, and/or tetracode
codes. In an embodiment, the error-correcting code may be a binary
Hamming code. In another embodiment, the error-correcting code may
be a binary Golay code. In an embodiment, the error-correcting code
may be a ternary Hamming code. In another embodiment, the
error-correcting code may be a ternary Golay code. See, e.g.,
Hoffman et al., Coding Theory: The Essentials, Marcel Dekker, Inc.
(1991); and Lin et al., Error Control Coding: Fundamentals And
Applications, Prentice Hall, Inc. (1983).
[0078] In various embodiments, sample discriminating codes or
barcodes may be designed to have error-tolerant properties
expressed in flowspace rather than in base space (in other words,
the errors here may related to incorrect digits or characters in
the flowspace representation of the barcode, e.g., an erroneous "0"
or "0-mer" present where a "1" or "1-mer" should be in the
flowspace representation). For example, a 1-base (in flowspace)
error-tolerant barcode set may be designed such that if a
sequencing error is encountered at any position in the flowspace
representation in one or more barcodes of the set each barcode may
still be resolvable from other barcodes in the set because their
flowspace representations all differ from the erroneous barcode(s)
in at least two digit locations, so that if the error occurred at
one of these two digit locations, the other remains available to
allow distinction between the barcodes. The set may also be
designed to be able to distinguish barcodes within it even where
multiple errors in flowspace (e.g., 2, 3, etc.) in one or more of
the barcodes are encountered. Such error-tolerant properties are
advantageous as they help provide more certainty for resolving even
complex multiplexed samples, even in the presence of potential
sequencing errors. Candidate barcodes in a set may be compared to
ascertain error-tolerant properties in flowspace. For example, such
barcodes can be compared (e.g., via computer analysis or
simulation) to determine whether, if any one error in flowspace (or
2, 3, etc., as the criterion may be) occurred, the codes can still
be distinguished.
[0079] In various embodiments, sample discriminating codes or
barcodes may be designed using one or more distance measures
capable of evaluating a distance between codewords. In an
embodiment, the distance measure may be a Hamming distance, which
corresponds to the number of positions at which two codewords
differ. Mathematically, if each codeword in a set of codewords has
a Hamming distance of at least d from all other codewords in the
set, then the code can correct up to (d-1)/2 errors, or conversely,
the Hamming distance d required to decode up to x number of errors
is 2x+1. The quantity d may be referred to as the minimum distance
of the code. The notation [n, k, d] may be used to characterize an
error-correcting code of length n digits that encodes k information
digits and has a minimum distance d. Other distance measures may be
used, including a Euclidean distance measure, a sum of absolute
values of differences between corresponding entries of two
codewords, and a sum of squared differences between corresponding
entries of two codewords, for example. In various embodiments,
using such distance measures can allow a distance between codewords
to be evaluated in flowspace, without a need for base calls to be
made.
[0080] In various embodiments, sample discriminating codes or
barcodes may be designed to have an error-correcting code with a
minimum distance of five that is capable of correcting up to two
digit errors in the codewords (such as, e.g., an erroneous "0" or
"0-mer" present where a "1" or "1-mer" should be at a first
location and, e.g., an erroneous "0" or "0-mer" present where a "2"
or "2-mer" should be at a second location in the flowspace
representation). In other words, each codeword may have a Hamming
distance of at least five from all other codewords. In another
embodiment, the error-correcting code may have a minimum distance
of three and be capable of correcting a single digit error in the
codewords. In other words, each codeword may have a Hamming
distance of at least three from all other codewords. In an
embodiment, an algorithm or methodology that iteratively compares
each codeword in a candidate group to all others in the group to
construct a largest codeword set that maintains the desired minimum
distance and has the desired error-correcting capability may be
used.
[0081] In various embodiments, sample discriminating codes or
barcodes may be designed to distinguish reads in flowspace rather
than base space, which may be particularly useful in
sequencing-by-synthesis and may help avoid an excessive number of
flows and thereby reduce error build-up and wasted/diminished
sequencing capacity. The Hamming distance, for example, may not be
desirable in base space. For example, a single base insertion at
the beginning of a sequence (e.g., AACGT vs. ACGT) would yield a
Hamming distance of 3 (based on the first four bases, to have equal
length) despite an in/del distance of only 1. Further, when
translating a binary code into 4 letters by paired bits, errors
automatically affect two bits simultaneously, and an error
correction of 1 bit is not guaranteed to correct 1 error in base
reading. Furthermore, conventional barcode designs may not
appropriately address sequencing error motifs. In an embodiment,
codewords may be selected for useful biological properties.
[0082] In various embodiments, sample discriminating codes or
barcodes may be designed for one error or two errors correction in
flowspace to correct flowspace errors such as, e.g., insertions and
deletions. The barcodes may collectively be designed to be tolerant
of single errors in flowspace. A subset of the barcodes may be
designed to correct a single flowspace error. The barcodes may
further be divided into subsets that, when used alone, may correct
for multiple flowspace errors (e.g., two or more errors). This may
allow for a set of 96 barcodes or more, for example, that can
correct two flowspace errors. The barcode set may be generated
using a ternary coding scheme in flowspace (e.g., in flowspace, the
barcodes may be viewed as having either 0, 1, or 2 incorporation(s)
in a given flow).
[0083] In various embodiments, sample discriminating codes or
barcodes may be designed around a Hamming ternary code mapped into
a particular predetermined flow ordering. For example, such a code
may be a [n=13, k=10, d=3] Hamming ternary code; and such a mapping
may take the first 10 "trits" (e.g., symbols of the ternary code,
such as 0, 1, and 2, for example) and assign them to some of the
flows in the predetermined ordering (e.g., flows 9-18), and take
three "parity check" trits and assign them to other flows (e.g.,
19-21). A final synchronization flow may then be a 1-mer (e.g., a
`C` at flow 22) to result in the flows terminating the codeword
being zero if they are specified to be zero. Some of the codewords
generated under the Hamming codes may not be permissible flowspace
representations (e.g., they may be valid mathematical codewords in
flowspace that do not correspond to a possible nucleic acid
sequence in base space given the predetermined flow ordering).
These codewords may be filtered out. In some embodiments, the
codewords may be further filtered to include only codewords
composed of a desired length (9-15 bases, for example).
[0084] In various embodiments, sample discriminating codes or
barcodes may be designed around an [n=11, k=6, d=5] ternary Golay
code using values 0, 1, and 2. Such a code has 729 (i.e., 3.sup.6)
distinct codewords of length 11 with a distance of 5 between the
codewords to correct 2 errors. The codewords may be generated
linearly or cyclically or using any suitable methods. As with the
Hamming code, some of the codewords generated under the ternary
Golay code may not correspond to a possible nucleic acid sequence
in base space given the predetermined flow ordering and can thus be
filtered out.
[0085] FIG. 7A illustrates an exemplary translation to flowspace of
36 9-mer ternary Golay codewords permissible under a predetermined
flow ordering. The x-axis corresponds to the first 21 flows of a
predetermined flow ordering (in this case, TACG, followed by TACG,
followed by TCTG, followed by AGCA, followed by TCGA, followed by T
(with the remaining flows in that ordering being CGA, followed by
TGTA, followed by CAGC)). The y-axis corresponds to homopolymer
responses to these flows, reflecting 36 permissible ternary Golay
codewords. The color/gray coding indicates the code symbols (black
is 0 for a 0-mer, red or light gray is 1 for a 1-mer, and blue or
dark gray is 2 for a 2-mer). For example, the sequence of 1-mer(s)
and 2-mer(s) in the first line (i.e., bottom row) corresponds to T
(1-mer responsive to flow 1 of T), followed by C (1-mer responsive
to flow 3 of C), followed by A (1-mer responsive to flow 6 of A),
followed by G (1-mer responsive to flow 8 of G), followed by T
(1-mer responsive to flow 9 of T), followed by CC (2-mer responsive
to flow 10 of C), followed by TT (2-mer responsive to flow 11 of
T), followed by G (1-mer responsive to flow 12 of G), followed by
AA (2-mer responsive to flow 13 of A), followed by T (1-mer
responsive to flow 17 of T), followed by C (1-mer responsive to
flow 18 of C), followed by T (1-mer responsive to flow 21 of T). In
each line, there are 5 base key TCAGT (corresponding to flows 1-9),
11 flows of code (a permissible Golay codeword in each line in
flows), and 1 flow to resynchronize (flow 21 of T). One may use the
existing 11-base codewords in the Ternary Golay code to fill in
flowspace. Every line differs from any other line in at least five
flows. As mentioned previously, there are 729 (i.e., 3.sup.6) Golay
codewords of length 11 in flowspace (e.g., sequences of eleven
characters selected from 0, 1, or 2) and, as illustrated in FIGS.
6A and 6B, a flowspace representation may be mapped into a base
sequence given a predetermined flow ordering. In base space, there
are 262,144 possible sequences of nine bases selected from A, C, G,
or T (i.e., 4.sup.9). However, not every one of the possible Golay
codewords in flowspace corresponds to one of the possible sequences
in base space under a given predetermined flow ordering. Codewords
that do not correspond to a permissible sequence may be filtered
out. A computer analysis and/or simulation may be performed to
determine which flowspace codewords, for a given predetermined flow
ordering, correspond to a possible sequence of bases in base
space.
[0086] FIG. 7B illustrates an exemplary translation to flowspace of
332 ternary Golay codewords permissible under the same
predetermined flow ordering as in FIG. 7A. The graph is essentially
the same as in FIG. 7A, except that the permissible Golay codewords
are not limited to 9-mer ones. In other words, of the 729 possible
[11, 6, 5] codewords, which have length 11 in flowspace (a property
of this particular code), these are the codewords that correspond
to a base space sequence that is possible (e.g., that could
actually occur) under the predetermined flow ordering of FIG. 7A.
Of course, this particular set of codewords is just an example, and
different ones would arise for that ternary Golay code with a
different predetermined flow ordering.
[0087] FIG. 7C illustrates exemplary Golay flowspace barcode
weights for the codewords represented in FIG. 7A. The x-axis shows
the number of bases in each codeword. The y-axis shows the
corresponding frequency. For example, there are 36 9-mers, 33
10-mers, 57 11-mers, etc. The codewords are separable under the
predetermined flow ordering in FIGS. 7A and 7B, and no particular
Hamming distance in base space was applied as constraint (in other
words, that distance in base space need only be at least 1).
[0088] In various embodiments, sample discriminating codes or
barcodes may be designed around a tetracode code, in which
codewords have length 4. There are 8 nonzero codewords (which may
take values 0, 1, or 2), and they can correct 1 error (and detect 2
errors).
[0089] FIG. 8A illustrates 8 nonzero ternary tetracode codewords.
The x-axis shows the position in the codeword. The y-axis shows
each codeword. Color/gray coding indicates the code symbols (black
is 0 for a 0-mer, red or light gray is 1 for a 1-mer, and blue or
dark gray is 2 for a 2-mer). Such codewords are always permissible
in a (repeating) 4-base flow order XYZW.
[0090] FIG. 8B illustrates 288 nonzero ternary concatenated
tetracode codewords permissible under the same predetermined flow
ordering as in FIG. 7A. The x-axis shows the flow number. The
y-axis shows each codeword. In each line, there are 5 base key
TCAGT (corresponding to flows 1-9), 12 flows of code (3
concatenated tetracode codewords), and 1 flow to resynchronize
(flow 22 of C). Here, not all flow sequences are permissible
because of interactions.
[0091] According to various exemplary embodiments, there are
provided sequencing methods and systems using sets of barcodes
designed in flowspace based on a predetermined order of nucleotide
flows that allow extreme multiplexing. In various examples, the
barcodes may be ternary or quaternary error-correcting barcodes
designed in flowspace based on a predetermined order of nucleotide
flows. Preferably, the barcodes may be ternary or quaternary
error-correcting barcodes designed in flowspace based on a
predetermined order of nucleotide flows that are capable of
correcting at least two errors in flowspace. In various examples,
the barcodes may be designed in flowspace based on a predetermined
order of nucleotide flows using one or more coding design matrices
or generating polynomials. In various examples, the predetermined
order of nucleotide flows or manner of translating codewords to
flowspace may be modified to add one or more stuffer flows. In
various examples, the codewords may be constrained to comprise at
least one 2-mer and one 1-mer. In various examples, the codewords
may be constrained to comprise codewords corresponding to
nucleotide sequences with flowspace representations that are
permissible given the predetermined order of nucleotide flows. In
various examples, the codewords may be precluded from being
multiples of another codeword.
[0092] In an example, the listing of R code set forth in Computer
Program Listing Appendix 1 may be used to design barcodes in
flowspace based on a predetermined order of nucleotide flows using
certain code generating polynomials. In this example, the
predetermined order of nucleotide flows corresponds to or is a
slightly modified version of the SAMBA flow order described in
Hubbell et al., U.S. Pat. Appl. Publ. No. 2012/0264621, published
Oct. 18, 2012.
[0093] More specifically, in such an example, barcodes in flowspace
may be designed using the following steps. First, a user or system
hardware or software component selects a predetermined order of
nucleotide flows. The predetermined order of nucleotide flows may
be based on or comprise in whole or in part any of the
phase-protecting flow orders (e.g., SAMBA) described or
contemplated in Hubbell et al., U.S. Pat. Appl. Publ. No.
2012/0264621, published Oct. 18, 2012, which is incorporated by
reference herein in its entirety, for example. The predetermined
order of nucleotide flows may also comprise some reference
subsequence, which may be used for stuffer alignment purposes
(e.g., the last GAT subsequence in SAMBA). Second, if use of a key
sequence is desired for a particular underlying sequencing
technology or application, a user or system hardware or software
component selects a base key codeword (e.g., TCAG or some other
permutation of T, C, A, and G). The base key may be expressed
relative to the predetermined order of nucleotide flows using
binary digits (e.g., if the flow order were TACGTACG then base key
TCAG could be expressed as Ser. No. 10/100,101). Third, a user or
system hardware or software component selects a code length n
(e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more), a
number of encoded information digits k (e.g., 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, or more), and a minimum distance d (e.g.,
2, 3, 4, 5, 6, or more). Fourth, a user or system hardware or
software component selects a code generator polynomial for a
ternary cyclic code. The code generator polynomial may be one of
the code generator polynomials described in Baicheva, T., "Binary
and ternary linear codes which are good and proper for error
correction," Institute of Mathematics and Informatics, Bulgarian
Academy of Sciences, 1-6, which is incorporated by reference herein
in its entirety, such as generator polynomial 10210122, which may
be padded with zeros at the end to match the code length, for
example, or any other suitable code generator polynomial for a
ternary cyclic code, for example. Fifth, if desired to satisfy an
application- or case-specific constraint (e.g., accommodating a
particular codeword size, maintaining alignment of a particular
subset of flows in the flow order, or skipping one or more
constraining bases in the flow order to maximize codewords that
map), a user or system hardware or software component modifies the
predetermined order of nucleotide flows as well as manner of
translating between base-space code representation and flowspace.
For example, to better accommodate codewords of length 16 using a
SAMBA flow order (normally of length 32 to its end or length 25 to
its final GAT subsequence), the flow order may be modified by
adding TACG at the beginning of the flow order (thereby making it
of length 36 to its end or length 29 to its final GAT subsequence),
and the manner of translating may be modified by inserting `zero`
digits to skip one or more constraining flows (e.g., a flowspace
representation of a codeword could be a concatenation of the eight
digits of the base key, the first six digits of the codeword, a
zero, the next two digits of the codeword, a zero, the last eight
digits of the codeword, and a series of three `ones` corresponding
to the last GAT subsequence in SAMBA, for a total of 29 digits).
Sixth, a user or system hardware or software component generates a
code matrix from the generator polynomial, which may be done by (i)
adding a `zero` to the generator polynomial (in addition to the
above-mentioned zero padding), (ii) assembling repeats of such a
zero-augmented generator polynomial (e.g., k repeats) into a
vector, and (iii) arranging the first n.times.k elements of the
resulting vector into a k by n matrix, for example. Seventh, a user
or system hardware or software component generates codewords from
the code matrix, which may be done by (i) generating all possible
codewords in base 10 (for a ternary code, for example, there would
be 3.sup.k possible codewords), (ii) converting the codewords to
base 3, (iii) multiplying the base 3 codewords and the code matrix
and representing the result as a vector, and (iv) turning the
elements of the vector back into base 3. Eighth, if desired, a user
or system hardware or software component may randomly resample the
codewords to shift the code. Ninth, a user or system hardware or
software component analyzes the generated codewords to determine
whether they meet one or more selection criteria. The selection
criteria may include some or all of: (i) comprising at least one
1-mer, (ii) comprising at least one 2-mer, and (iii) having a
permissible flowspace representation (e.g., some codewords may be
valid mathematical codewords in flowspace that do not correspond to
a possible nucleic acid sequence in base space given the
predetermined flow ordering). In an example, codewords that fail to
meet at least one of the above criteria may be filtered out. Tenth,
a user or system hardware or software component further refines the
codewords by selecting codewords having a weight closest to a
target weight. For example, the median weight (e.g., length in base
space) of the codewords may be calculated and codewords that are
not within a certain range from the median (e.g., within the square
root of 10 or some other number of bases above or below the median)
may be filtered out. Finally, a user or system hardware or software
component may verify that the minimal distance requirement between
any two codewords is satisfied, which may include using any
suitable metric, including summing a number of differences between
any given pair of codewords. In the above, with the exception of
when a given step must be completed for another to be performed,
the particular order of the steps may be altered. Further, not all
steps necessarily need to be performed in every implementation.
[0094] Table 1 shows a sample of six barcodes generated using the R
code listed in Computer Program Listing Appendix 1. In this
example, the predetermined order of nucleotide flows is a slightly
modified version of SAMBA, the code length is n=16 digits, the
number of encoded information digits is k=9, the minimum distance
is d=5, and the code generator polynomial comprises 10210122, which
may be padded with zeros at the end to match the code length. The
six barcodes in Table 1 represent the first six barcodes among a
subset of 871 barcodes separated by Hamming distance of 5 (2-error
correcting) with weights of 11-17 bases listed in U.S. Prov. Pat.
Appl. No. 61/886,833, filed Oct. 4, 2013, that were generated using
the R code in Computer Program Listing Appendix 1. The first column
shows the barcode number. The second column shows the barcode
sequence. The third column shows the flowspace representation of
the barcode given the flow order used to generate the barcode. The
fourth column shows the weight (W) of the barcode (in base-space,
e.g., number of bases). The fifth column shows the minimum distance
(MD) of the barcode.
TABLE-US-00001 TABLE 1 Sample of [16, 9, 5] barcodes. No. Barcode
Sequence Flowspace Representation W MD 1 TTGAGGATTCCA (SEQ ID NO:
1) 1010010120011201220100111 12 5 2 CCAGGCAATCCA (SEQ ID NO: 2)
1010010102001212120100111 12 5 3 TTCCGAACATCCA (SEQ ID NO: 3)
1010010122012011120100111 13 5 4 TAAGGCCAATTA (SEQ ID NO: 4)
1010010110002222200100111 12 5 5 TTGGAGCCTTA (SEQ ID NO: 5)
1010010120021120200100111 11 5 6 TTCCGGAAGGTA (SEQ ID NO: 6)
1010010122022200100100111 12 5
[0095] Table 2 shows a sample of six barcodes generated using the R
code listed in Computer Program Listing Appendix 1. In this
example, the predetermined order of nucleotide flows is SAMBA, the
code length is n=13 digits, the number of encoded information
digits is k=7, the minimum distance is d=3, and the code generator
polynomial comprises 1022201, which may be padded with zeros at the
end to match the code length. The six barcodes in Table 2 represent
the first six barcodes among a subset of 23,884 barcodes separated
by Hamming distance of 3 (1-error correcting) with weights of 11-17
bases listed in U.S. Prov. Pat. Appl. No. 61/886,833, filed Oct. 4,
2013, that were generated using the R code in Computer Program
Listing Appendix 1. The first column shows the barcode number. The
second column shows the barcode sequence. The third column shows
the flowspace representation of the barcode given the flow order
used to generate the barcode. The fourth column shows the weight
(W) of the barcode (in base-space, e.g., number of bases). The
fifth column shows the minimum distance (MD) of the barcode. Also,
in this example, to better accommodate codewords of length 13 using
a SAMBA flow order normally of length 32 to its end or length 25 to
its final GAT subsequence, the manner of translating a codeword to
flowspace may be modified by inserting a `zero` digit to skip a
flow (e.g., a flowspace representation of a codeword could be a
concatenation of the eight digits of the base key, the first two
digits of the codeword, a zero, the last eleven digits of the
codeword, and a series of three `ones` corresponding to the last
GAT subsequence in SAMBA, for a total of 25 digits).
TABLE-US-00002 TABLE 2 Sample of [13, 7, 3] barcodes. No. Barcode
Sequence Flowspace Representation W MD 1 TTCCGGATCGAA (SEQ ID NO:
7) 1010010122021000111200111 12 3 2 TTAAGGTCGAA (SEQ ID NO: 8)
1010010120002200111200111 11 3 3 CCGGAAGTCGAA (SEQ ID NO: 9)
1010010102022100111200111 12 3 4 TTCCAAGCCTCGAA (SEQ ID NO: 10)
1010010122002120111200111 14 3 5 CGGAACCTCGAA (SEQ ID NO: 11)
1010010101022020111200111 12 3 6 TCCACCTCGAA (SEQ ID NO: 12)
1010010112001020111200111 11 3
[0096] Table 3 shows a sample of six barcodes generated using the R
code listed in Computer Program Listing Appendix 1. In this
example, the predetermined order of nucleotide flows is SAMBA, the
code length is n=13 digits, the number of encoded information
digits is k=10, the minimum distance is d=5, and the code generator
polynomial comprises 1112, which may be padded with zeros at the
end to match the code length. The six barcodes in Table 3 represent
the first six barcodes among a subset of 7,487 barcodes separated
by Hamming distance of 5 (2-error correcting) with weights of 14-21
bases listed in U.S. Prov. Pat. Appl. No. 61/886,833, filed Oct. 4,
2013, that were generated using the R code in Computer Program
Listing Appendix 1. The first column shows the barcode number. The
second column shows the barcode sequence. The third column shows
the flowspace representation of the barcode given the flow order
used to generate the barcode. The fourth column shows the weight
(W) of the barcode (in base-space, e.g., number of bases). The
fifth column shows the minimum distance (MD) of the barcode. Also,
in this example, the manner of translating a codeword to flowspace
may be unmodified (e.g., a flowspace representation of a codeword
could be a concatenation of the eight digits of the base key, the
13 digits of the codeword, and a series of three `ones`
corresponding to the last CGA subsequence in SAMBA, for a total of
24 digits).
TABLE-US-00003 TABLE 3 Sample of [13, 10, 5] barcodes. No. Barcode
Sequence Flowspace Representation W MD 1 TCCGCAACCACGGAA (SEQ ID
NO: 13) 10100101102101002021012200111 15 5 2 TTCGGCCGGACCACGGAA
(SEQ ID NO: 14) 10100101201202021021012200111 18 5 3
AGGTGGAACACGGAA (SEQ ID NO: 15) 10100101010210022011012200111 15 5
4 TACCTCGACACGGAA (SEQ ID NO: 16) 10100101112011011011012200111 15
5 5 ACCGGTTCCGGACCAACGGAA (SEQ ID NO: 17)
10100101012222021022012200111 21 5 6 TACTTGCCAACGGAA (SEQ ID NO:
18) 10100101111020010022012200111 15 5
[0097] In an example, the listing of R code set forth in Computer
Program Listing Appendix 2 may be used to design barcodes in
flowspace based on a predetermined order of nucleotide flows using
an extended binary Golay code and a Gray map. In this example,
predetermined order of nucleotide flows corresponds to the SAMBA
flow order described in Hubbell et al., U.S. Pat. Appl. Publ. No.
2012/0264621, published Oct. 18, 2012, and is used with an extended
binary Golay code with minimum distance 8 (3 error correcting) and
a Gray map or quaternary code between pairs of binary digits and
0-3 that preserves the minimum distance requirement in
flowspace.
[0098] More specifically, in such an example, barcodes in flowspace
may be designed using the following steps. First, a user or system
hardware or software component selects a predetermined order of
nucleotide flows. The predetermined order of nucleotide flows may
be based on or comprise in whole or in part any of the
phase-protecting flow orders (e.g., SAMBA) described or
contemplated in Hubbell et al., U.S. Pat. Appl. Publ. No.
2012/0264621, published Oct. 18, 2012, which is incorporated by
reference herein in its entirety, for example. The predetermined
order of nucleotide flows may also comprise some reference
subsequence, which may be used for stuffer alignment purposes
(e.g., the last CGAT subsequence in SAMBA). Second, if use of a key
sequence is desired for a particular underlying sequencing
technology or application, a user or system hardware or software
component selects a base key codeword (e.g., TCAG or some other
permutation of T, C, A, and G). The base key may be expressed
relative to the predetermined order of nucleotide flows using
binary digits (e.g., if the flow order were TACGTACG then base key
TCAG could be expressed as Ser. No. 10/100,101). Third, a user or
system hardware or software component selects a code length n
(e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more), a
number of encoded information digits k (e.g., 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, or more), and a minimum distance d (e.g.,
2, 3, 4, 5, 6, or more). Fourth, a user or system hardware or
software component generates a binary Golay code generating matrix,
which may be done by (i) representing a Golay code vector of length
n by n as a n by n matrix and (ii) adjoining to the left of this
matrix a n by n diagonal matrix, resulting in a n by 2n matrix, for
example. Fifth, a user or system hardware or software component
generates a Gray map (see, e.g., Gray, F., "Pulse Code
Communication," U.S. Pat. No. 2,632,058; and Schwartz et al., "The
Structure of Single-Track Gray Codes," IEEE Transactions on
Information Theory, 45(7):2383-2396 (1999), which are all
incorporated by reference herein in their entirety) based on the
codewords in the adjoined n by 2n matrix while preserving the
minimum distance, which may be done by (i) splitting each codeword
into pairs of adjacent entries (e.g., splitting a 24 entry codeword
into 12 pairs) and (ii) assigning a quaternary code to each pair
(e.g., map a first pair of binary digits 10 to 3, a second pair of
binary digits 10 to 3, a third pair of binary digits 00 to 0, and
so on . . . ), for example. Sixth, if desired to satisfy an
application- or case-specific constraint (e.g., accommodating a
particular codeword size, maintaining alignment of a particular
subset of flows in the flow order, or skipping one or more
constraining bases in the flow order to maximize codewords that
map), a user or system hardware or software component modifies the
manner of translating between base-space code representation and
flowspace. For example, to better accommodate codewords of length
12 using a SAMBA flow order (normally of length 32 to its end or
length 25 to its final CGAT subsequence), the manner of translating
may be modified by inserting `zero` digits to skip one or more
constraining flows (e.g., a flowspace representation of a codeword
could be a concatenation of the eight digits of the base key, the
first two digits of the Gray mapped codeword, a zero, the next ten
digits of the Gray mapped codeword, and a series of four `ones`
corresponding to the last CGAT subsequence in SAMBA, for a total of
25 digits). Seventh, a user or system hardware or software
component generates codewords from the Gray mapped codewords, which
may be done by (i) generating all possible codewords in base 10
(for a binary code, for example, there would be 2.sup.k possible
codewords), (ii) converting the codewords to base 2, (iii)
multiplying the base 2 codewords and the adjoined Golay codeword
matrix and representing the result as a vector, and (iv) turning
the elements of the vector back into base 2. Eighth, if desired, a
user or system hardware or software component may randomly resample
the codewords to shift the code. Ninth, a user or system hardware
or software component analyzes the generated codewords to determine
whether they meet one or more selection criteria. The selection
criteria may include some or all of: (i) comprising at least one
1-mer, (ii) comprising at least one 2-mer, and (iii) having a
permissible flowspace representation (e.g., some codewords may be
valid mathematical codewords in flowspace that do not correspond to
a possible nucleic acid sequence in base space given the
predetermined flow ordering). In an example, codewords that fail to
meet at least one of the above criteria may be filtered out. Tenth,
a user or system hardware or software component further refines the
codewords by selecting codewords having a weight closest to a
target weight. For example, the median weight (e.g., length in base
space) of the codewords may be calculated and codewords that are
not within a certain range from the median (e.g., within the square
root of 10 or some other number of bases above or below the median)
may be filtered out. Finally, a user or system hardware or software
component may verify that the minimal distance requirement between
any two codewords is satisfied, which may include using any
suitable metric, including summing absolute values of differences
between any given pair of codewords, which may be referred to as a
Lee metric (see Lee, C. Y., "Some Properties of Nonbinary
Error-Correcting Codes," IRE Transactions on Information Theory,
77-82 (1958), which is incorporated by reference herein in its
entirety). In the above, with the exception of when a given step
must be completed for another to be performed, the particular order
of the steps may be altered. Further, not all steps necessarily
need to be performed in every implementation.
[0099] Table 4 shows a sample of six barcodes generated using the R
code listed in Computer Program Listing Appendix 2. In this
example, the predetermined order of nucleotide flows is SAMBA, the
code length is n=12 digits, the number of encoded information
digits is k=12, and the minimum distance is d=8. The six barcodes
in Table 4 represent the first six barcodes among a subset of 2,199
barcodes separated by Hamming distance of 8 (3-error correcting)
listed in U.S. Prov. Pat. Appl. No. 61/886,833, filed Oct. 4, 2013,
that were generated using the R code in Computer Program Listing
Appendix 2. The first column shows the barcode number. The second
column shows the barcode sequence. The third column shows the
flowspace representation of the barcode given the flow order used
to generate the barcode. The fourth column shows the weight (W) of
the barcode (in base-space, e.g., number of bases). The fifth
column shows the minimum distance (MD) of the barcode.
TABLE-US-00004 TABLE 4 Sample of [16, 9, 5] barcodes. No. Barcode
Sequence Flowspace Representation W MD 1 CCCGGGTTTCCGTTC (SEQ ID
NO: 19) 1010010103030000321021111 15 8 2 TTTCGGGTTCGGGTTTC (SEQ ID
NO: 20) 1010010131030000213031111 17 8 3 CCCGTTCCGGGAAAC (SEQ ID
NO: 21) 1010010103010000223301111 15 8 4 TTTCGTTTCGAAATC (SEQ ID
NO: 22) 1010010131010000311311111 15 8 5 TTCCGTCGGAATTTC (SEQ ID
NO: 23) 1010010122010000112231111 15 8 6 TTCGGTTCCCGGGAATC (SEQ ID
NO: 24) 1010010121020000233211111 17 8
[0100] In an example, the listing of R code set forth in Computer
Program Listing Appendix 3 may be used to design barcodes in
flowspace based on a predetermined order of nucleotide flows using
a quaternary code. In this example, the based on a predetermined
order of nucleotide flows corresponds to the SAMBA flow order
described in Hubbell et al., U.S. Pat. Appl. Publ. No.
2012/0264621, published Oct. 18, 2012, and is used with a
quaternary code (which may be an octacode).
[0101] More specifically, in such an example, barcodes in flowspace
may be designed using the following steps. First, a user or system
hardware or software component selects a predetermined order of
nucleotide flows. The predetermined order of nucleotide flows may
be based on or comprise in whole or in part any of the
phase-protecting flow orders (e.g., SAMBA) described or
contemplated in Hubbell et al., U.S. Pat. Appl. Publ. No.
2012/0264621, published Oct. 18, 2012, which is incorporated by
reference herein in its entirety, for example. The predetermined
order of nucleotide flows may also comprise some reference
subsequence, which may be used for stuffer alignment purposes
(e.g., the last CGAT subsequence in SAMBA). Second, if use of a key
sequence is desired for a particular underlying sequencing
technology or application, a user or system hardware or software
component selects a base key codeword (e.g., TCAG or some other
permutation of T, C, A, and G). The base key may be expressed
relative to the predetermined order of nucleotide flows using
binary digits (e.g., if the flow order were TACGTACG then base key
TCAG could be expressed as Ser. No. 10/100,101). Third, a user or
system hardware or software component selects a code length n
(e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more), a
number of encoded information digits k (e.g., 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, or more), and a minimum distance d (e.g.,
2, 3, 4, 5, 6, or more). Fourth, a user or system hardware or
software component generates a generator matrix for the quaternary
code, which may be the octacode (see, e.g., Forney, Jr., et al.,
"The Nordstrom-Robinson Code is the Binary Image of the Octacode,"
Feb. 8, 2001, which is incorporated by reference herein in its
entirety). Fifth, a user or system hardware or software component
generates codewords from the generator matrix, which may be done by
(i) generating all possible codewords in base 10 (for a quaternary
code, for example, there would be 4.sup.k possible codewords), (ii)
converting the codewords to base 4, (iii) multiplying the base 4
codewords and the generator matrix and representing the result as a
vector, and (iv) turning the elements of the vector back into base
4. Sixth, if desired, a user or system hardware or software
component may randomly resample the codewords to shift the code.
Seventh, if desired to satisfy an application- or case-specific
constraint (e.g., accommodating a particular codeword size,
maintaining alignment of a particular subset of flows in the flow
order, or skipping one or more constraining bases in the flow order
to maximize codewords that map), a user or system hardware or
software component modifies the manner of translating between
base-space code representation and flowspace. For example, to
better accommodate codewords of length 8 using a SAMBA flow order
(normally of length 32 to its end or length 21 to its first CGAT
subsequence), the manner of translating may be modified by
inserting `zero` digits to skip one or more constraining flows
(e.g., a flowspace representation of a codeword could be a
concatenation of the eight digits of the base key, the first two
digits of the codeword, a zero, the next six digits of the
codeword, and a series of four `ones` corresponding to the last
CGAT subsequence in SAMBA, for a total of 21 digits). Eighth, a
user or system hardware or software component analyzes the
generated codewords to determine whether they meet one or more
selection criteria. The selection criteria may include some or all
of: (i) comprising at least one 1-mer, (ii) comprising at least one
2-mer, and (iii) having a permissible flowspace representation
(e.g., some codewords may be valid mathematical codewords in
flowspace that do not correspond to a possible nucleic acid
sequence in base space given the predetermined flow ordering). In
an example, codewords that fail to meet at least one of the above
criteria may be filtered out. Ninth, a user or system hardware or
software component further refines the codewords by selecting
codewords having a weight closest to a target weight. For example,
the median weight (e.g., length in base space) of the codewords may
be calculated and codewords that are not within a certain range
from the median (e.g., within the square root of 10 or some other
number of bases above or below the median) may be filtered out.
Finally, a user or system hardware or software component may verify
that the minimal distance requirement between any two codewords is
satisfied, which may include using any suitable metric, including
summing absolute values of differences between any given pair of
codewords, which may be referred to as a Lee metric (see Lee, C.
Y., "Some Properties of Nonbinary Error-Correcting Codes," IRE
Transactions on Information Theory, 77-82 (1958), which is
incorporated by reference herein in its entirety). In the above,
with the exception of when a given step must be completed for
another to be performed, the particular order of the steps may be
altered. Further, not all steps necessarily need to be performed in
every implementation.
[0102] Table 5 shows a sample of six barcodes generated using the R
code listed in Computer Program Listing Appendix 3. In this
example, the predetermined order of nucleotide flows is SAMBA, the
code length is n=8 digits, the number of encoded information digits
is k=4, and the minimum distance is d=6. The six barcodes in Table
5 represent the first six barcodes among a subset of 168 barcodes
separated by Hamming distance of 6 (2-error correcting) listed in
U.S. Prov. Pat. Appl. No. 61/886,833, filed Oct. 4, 2013, that were
generated using the R code in Computer Program Listing Appendix 3.
The first column shows the barcode number. The second column shows
the barcode sequence. The third column shows the flowspace
representation of the barcode given the flow order used to generate
the barcode. The fourth column shows the weight (W) of the barcode
(in base-space, e.g., number of bases). The fifth column shows the
minimum distance (MD) of the barcode.
TABLE-US-00005 TABLE 5 Sample of [8, 4, 6] barcodes. No. Barcode
Sequence Flowspace Representation W MD 1 TTTAAAGGCCCAC (SEQ ID NO:
25) 101001013000323101111 13 6 2 TTCCCGGAAGGGCCCAC (SEQ ID NO: 26)
101001012302233101111 17 6 3 TCCACCCAC 101001011200103101111 9 6 4
TTGGGAGAC 101001012003110101111 9 6 5 CCGGGAAAGGGAC (SEQ ID NO: 27)
101001010203330101111 13 6 6 TGGAAACAC 101001011002301101111 9
6
[0103] According to an exemplary embodiment, there is provided a
method for sequencing a polynucleotide sample having a barcode
sequence, comprising: introducing a series of nucleotides to the
polynucleotide sample according to a predetermined order of
nucleotide flows; obtaining a series of signals resulting from the
introducing of nucleotides to the polynucleotide sample; and
resolving the series of signals over the barcode sequence to render
a flowspace string, wherein the flowspace string is a codeword of
an error-correcting code that is (i) designed based on and adapted
for use with the predetermined order of nucleotide flows, and (ii)
capable of distinguishing any codeword in the error-correcting code
from the other codewords in the error-correcting code in the
presence of zero, one, and two errors.
[0104] In such a method, the error-correcting code may be a ternary
code and the predetermined flow ordering may be a phase-protecting
predetermined flow ordering. The error-correcting code may be a
ternary code generated using a generator polynomial associated with
a ternary cyclic code. The generator polynomial may comprise
10210122, 1022201, or 1112, for example. Each codeword of the
error-correcting code may include at least one 2-mer and at least
one 1-mer. The error-correcting code may be a quaternary code
generated by applying a distance-preserving Gray map to an extended
binary Golay code. The quaternary code may be generated by applying
to the extended binary Golay code a Gray map mapping pairs of
binary digits 0 and 1 of the extended binary Golay code to one of
integers 0, 1, 2, and 3, wherein the Gray map mapping preserves a
predetermined minimal distance. The error-correcting code may be
further capable of distinguishing any codeword in the
error-correcting code from the other codewords in the
error-correcting code in the presence of three errors. The
error-correcting code may be generated using an octacode. The
error-correcting code may be a quaternary code. The
error-correcting code may be further designed by verifying that a
predetermined minimal distance between a codeword and other
codewords in the error-correcting code using a Lee metric
determined in flowspace. The method may further comprise
translating the flowspace string into a base sequence to obtain the
sequence of the barcode sequence. The method may further comprise:
decoding the flowspace string to the correct flowspace codeword;
and translating the flowspace codeword into a base sequence to
obtain the sequence of the barcode sequence. The method may further
comprise providing multiple different polynucleotide samples for
multiplex sequencing by the series of flowed nucleotides, each
different polynucleotide sample comprising a different barcode
sequence that gives a different flowspace string, each different
flowspace string being a different codeword of the error-correcting
code. Any two flowspace codewords of the error-correcting code may
have a Hamming distance of at least 5.
[0105] According to an exemplary embodiment, there is provided a
system, including: a machine-readable memory; and a processor
configured to execute machine-readable instructions, which, when
executed by the processor, cause the system to perform a method for
sequencing a polynucleotide sample having a barcode sequence,
comprising: introducing a series of nucleotides to the
polynucleotide sample according to a predetermined order of
nucleotide flows; obtaining a series of signals resulting from the
introducing of nucleotides to the polynucleotide sample; and
resolving the series of signals over the barcode sequence to render
a flowspace string, wherein the flowspace string is a codeword of
an error-correcting code that is (i) designed based on and adapted
for use with the predetermined order of nucleotide flows, and (ii)
capable of distinguishing any codeword in the error-correcting code
from the other codewords in the error-correcting code in the
presence of zero, one, and two errors. The error-correcting code
may be a ternary code and the predetermined flow ordering may be a
phase-protecting predetermined flow ordering.
[0106] According to an exemplary embodiment, there is provided a
set of barcodes for nucleic acid sequencing, comprising: a
plurality of nucleic acid base sequences, each nucleic acid base
sequence being a base space representation of a flowspace
representation of a codeword of an error-tolerant sample
discrimination code, the error-tolerant sample discrimination code
being (i) designed based on and adapted for use with the
predetermined order of nucleotide flows, and (ii) capable of
distinguishing any codeword in the error-correcting code from the
other codewords in the error-correcting code in the presence of
zero, one, and two errors.
[0107] According to an embodiment, there is provided a method for
generating barcodes, comprising: designing codewords based on a
predetermined flow order and using a ternary code, wherein the
codewords (1) are expressed in flowspace; (2) include 0-mer(s),
1-mer(s), or 2-mer(s) only; (3) can correct 2 flowspace errors; and
(4) are permissible flowspace sequences that correspond to base
space sequences that are possible given the predetermined flow
order. The ternary code may be a Hamming code, a Golay code, and a
tetracode code, for example. The barcodes may be compact in
flowspace (e.g., post-key all barcodes may be designed to end at
flow 21, with a length 11 ternary code, and a 5-base key); and may
have a buffer base at flow 21.
[0108] Barcodes as described herein may be particularly useful for
sequencing-by-synthesis methods that operate by unterminated
single-nucleotide addition, in which the precursor nucleotides are
repeatedly added individually to the reaction in series according
to a predetermined ordering (such as, e.g., methods based on
hydrogen ions produced by the incorporation reactions or on the
detection of inorganic pyrophosphate, which may be detected by
light emitted from an enzyme cascade initiated by the inorganic
pyrophosphate). In such methods, errors of insertions and/or
deletions may arise due to inaccurate base-calling in flowspace.
For example, in the sequence ACCGT, the C base 2-mer may be
incorrectly called as a 1-mer in flowspace, resulting in the
omission (deletion) of a C base in the sequence read (in other
words, that sequence could be incorrectly read as ACGT). Barcodes
as described herein may be particularly useful for detecting and/or
correcting such read errors.
[0109] Various algorithms and/or software tools may be used to
assist in the generation of error-correcting codes. A number of
different design considerations may factor into the development of
a coding strategy. As explained above, a barcode sequence and a
flowspace codeword have a mapping relationship to each another for
a given flow ordering. Thus, design or selection criteria with
respect to the barcode sequence may be translated into
corresponding design/selection criteria for the flowspace coding.
Likewise, design/selection criteria with respect to the flowspace
coding may be translated into corresponding design/selection
criteria for the barcode sequence.
[0110] In various embodiments, the size of an error-correcting code
(e.g., the number of codewords) may be varied as needed. A larger
code is generally more constrained and difficult to construct, but
may accommodate a larger number of multiplex samples. In an
embodiment, the error-correcting code may contain at least 16
different codewords; or at least 32 different codewords; or at
least 48 different codewords; or at least 96 different codewords;
or more, for example. Because codewords and barcode sequences are
related by flow mapping, these embodiments may translate to at
least 16 different barcode sequences; or at least 32 different
barcode sequences; or at least 48 different barcode sequences; or
at least at least 96 different barcode sequences; or more, for
example. Generally, the size of a code becomes smaller as the
minimum distance of the code is increased, and such a code
generally may accommodate fewer multiplex samples but with a better
error-correcting capability. An appropriate balance between the
error-correcting capability of the code and the size of the code
may be considered in the code design.
[0111] In various embodiments, the length of flowspace codewords
may be varied as needed. For example, if a larger code set (e.g.,
with more codewords) is needed, the length of the codewords may be
increased. In an embodiment, the flowspace codewords may have a
length of 15 or fewer digits, for example. In some embodiments, the
flowspace codewords may have a length of four, which can be
constructed of eight non-zero codewords that can detect two errors
or correct one error. Other factors that may be considered include
a desired error-correcting capability (e.g., the number of errors
that the code can correct) and a decoding complexity (e.g., the
computational time needed to decode each codeword). Also, flowspace
codewords that do not correspond to any valid sequence under the
predetermined flow ordering (e.g., in a cyclical four-nucleotide
flow ordering, codewords having four 0's in a row) may be
excluded.
[0112] In various embodiments, the length of the barcode sequences
(or number of nucleotide bases) may be varied as needed. In an
embodiment, the length may be limited to improve sequencing
efficiency. In various embodiments, the barcode sequences may have
a length of 20 or fewer bases; or in the range of 5-15 bases, for
example. In various embodiments, the length of homopolymer runs in
the barcodes may be limited to be compatible with the flowspace
coding scheme. In some embodiments, the barcode sequences may
contain only 1-mers (that is, no repeating bases), and the
error-correcting code may then be a binary code. In some
embodiments, the maximum length of homopolymer runs may be 3-mers
or 2-mers, and the error-correcting code may then be a quaternary
code or a ternary code, respectively.
[0113] In various embodiments, one or more molecular biology
properties of nucleotide base sequences may be considered in the
design or selection of barcode sequences. For example, the barcode
sequences may be designed or selected to avoid certain nucleotide
sequences known to cause sequencing read errors or result in
sequencing bias. This can enhance PCR and/or sequencing
performance. In some embodiments, because the GC (guanine/cytosine)
content of a sequence can affect sequencing quality, barcode
sequences having a GC content in the range of 40-60% may be
preferred and barcodes outside this range may be filtered out. The
AT content may also be similarly treated. In some cases, barcode
sequences that are self-complementary or complementary with a
primer sequence that is coupled to the barcode may be excluded.
[0114] An exemplary set of nucleic acid barcodes may be found in
Appendix I of U.S. Prov. Pat. Appl. No. 61/529,687, filed Aug. 31,
2011, which is incorporated by reference herein in its entirety.
Such nucleic acid barcodes (including various combinations,
sub-combinations, and portions thereof), may be used, for example,
in a multiplexed sequencing experiment with different samples.
[0115] In an embodiment, for a multiplex sequencing problem
requiring a set of 96 barcodes that can correct two errors in the
flowspace string, with some accommodation for potential loss due to
poorly behaving barcodes, and a predetermined flow ordering of
TACG, followed by TACG, followed by TCTG, followed by AGCA,
followed by TCGA, followed by TCGA, followed by TGTA, followed by
CAGC, for example, a set of barcode sequences may be generated
using a ternary Hamming code of 13-digit length, with ten of the
digits being treated as data and three of the digits being treated
as parity checks in the codeword. This particular coding scheme
yields about 140 codewords that can correct up to two errors. A
representative sampling of this particular coding scheme is shown
in Table 6 below. (A complete list of the barcodes and flowspace
codewords generated can be seen in Appendix 1 of U.S. Pat. Appl.
No. 61/529,687, filed Aug. 31, 2011, which is incorporated by
reference herein in its entirety.) In this example, the barcodes
were selected for those having 9-11 bases in length and were
designed for use in oligonucleotides for multiplex sequencing on an
Ion PGM.TM. sequencing instrument. The oligonucleotides for this
example contained, in the following order, a primer site, a TCAG
key sequence for quality control and sample detection, a unique
barcode sequence, a common C base at the 3' end of the barcode
sequences for synchronization to ensure that flows terminating the
codeword are zero if they are specified to be zero, and a GAT
buffer between the barcode and the insert to minimize the influence
of the variable barcode region on ligation of the adapter. This GAT
buffer is the same last three bases as the P1 adapter used for the
Ion PGM.TM. sequencing instrument. The information in Table 6 is
organized according to the serial number of the barcodes that were
generated. The second column shows the key sequence, barcode
sequences, and the common C base. The third column shows the
barcode sequences and the common C base. The fourth column shows
the projection of the combined sequence elements into flowspace. In
the table, the bases and flowspace vector elements corresponding to
the barcodes are all indicated in bold. In the flowspace mapping,
flows 1-8 were assigned to the key sequence, flows 9-18 were
assigned to the data digits of the barcode, and flows 19-21 were
assigned to the parity digits. Because all the barcodes were
followed immediately by a common C base, flow 22 was provided for
synchronization. Naturally, such keys, synchronization bases,
and/or buffers could be varied.
TABLE-US-00006 TABLE 6 Exemplary barcodes and projections into
flowspace. No. Key + Barcode + C Barcode + C Flowspace Vector 1
TCAGTCCTCGAATC (SEQ ID NO: 28) TCCTCGAATC 1010010112100010001211 2
TCAGCTTGCGGATC (SEQ ID NO: 29) CTTGCGGATC 1010010101210010002111 4
TCAGTCTAACGGAC (SEQ ID NO: 30) TCTAACGGAC 1010010111102010002101 5
TCAGTTCTTAGCGC (SEQ ID NO: 31) TTCTTAGCGC 1010010121201110001001 6
TCAGTGAGCGGAAC (SEQ ID NO: 32) TGAGCGGAAC 1010010110011110002201 7
TCAGTTAAGCGGTC (SEQ ID NO: 33) TTAAGCGGTC 1010010120002110002011 9
TCAGCTGACCGAAC (SEQ ID NO: 34) CTGACCGAAC 1010010101111020001201 11
TCAGTCTAGAGGTC (SEQ ID NO: 35) TCTAGAGGTC 1010010111101101002011 12
TCAGAAGAGGATTC (SEQ ID NO: 36) AAGAGGATTC
1010010100002101002121
[0116] According to an embodiment, there is provided a set of
barcodes for nucleic acid sequencing, comprising: a plurality of
nucleic acid base sequences, each nucleic acid base sequence being
a base space representation of a flowspace representation of a
codeword of an error-tolerant sample discrimination code. The
error-tolerant sample discrimination code may be tolerant to at
least two flowspace errors. The error-tolerant sample
discrimination code may be an error-correcting code, which may be a
ternary Hamming code, or a ternary Golay code, or a ternary
tetracode code. The error-tolerant sample discrimination code may
be used in various methods to detect flowspace errors (e.g., detect
that a particular digit, e.g., "1," for a given flow should be "2")
using any suitable error detection algorithm. Although detection
may sometimes suffice and correction is not necessarily required,
the error-tolerant sample discrimination code may also be used in
various methods to correct such detected errors using any suitable
error correction algorithm. Such a set of barcodes may be used to
distinguish samples based on a flowspace vector obtained during
sequencing (e.g., using sequencing-by-synthesis) before making any
actual base calls, which may be useful to perform highly rapid and
efficient preliminary sample discrimination.
[0117] Any suitable decoding algorithms and/or software tools may
be used for decoding the flowspace strings read from the barcode
sequences to correct and/or detect errors. For example, the
decoding can be performed using an exhaustion algorithm in which a
damaged codeword is compared to all other members of the code and
decoded as the closest matching codeword. If the damaged codeword
is equally close to two codewords or is further than half the
minimum distance from any codeword, then the algorithm may indicate
that an error is detected without making any corrections. In
another example, the decoding may involve performing the coding
operation in reverse. In another example, the decoding algorithm
may use linear algebra techniques to decode the codeword.
[0118] A method for sequencing a polynucleotide sample having a
barcode sequence, comprising: introducing a series of nucleotides
to the polynucleotide sample according to a predetermined flow
ordering; obtaining a series of signals resulting from the
introducing of nucleotides to the polynucleotide sample; and
resolving the series of signals over the barcode sequence to render
a flowspace string, wherein the flowspace string is a codeword of
an error-tolerant code capable of distinguishing the barcode
sequence from other barcode sequences in the presence of one or
more errors. In such a method, the error-tolerant code may be an
error-correcting code. The error-correcting code may be a ternary
code using a three character alphabet. The first character of the
alphabet may represent a 0-mer signal, the second character in the
alphabet may represent a 1-mer signal, and the third character in
the alphabet may represent a 2-mer signal. The ternary code may be
a ternary Hamming code. The ternary code may be a ternary Golay
code. The codeword may have a length of 15 or fewer characters. The
error-correcting code may be capable of correcting up to two errors
in the flowspace string. The error-correcting code may be capable
of correcting one error in the flowspace string. The barcode
sequence may have a length in the range of 5-15 bases. The barcode
sequence may have a GC content in the range of 40-60%. The method
may further comprise: determining whether the flowspace string
contains an error; and correcting the flowspace string if an error
is detected. The method may further comprise translating the
flowspace string into a base sequence to obtain the sequence of the
barcode sequence. The method may further comprise: decoding the
flowspace string to the correct flowspace codeword; and translating
the flowspace codeword into a base sequence to obtain the sequence
of the barcode sequence. The method may further comprise providing
multiple different polynucleotide samples for multiplex sequencing
by the series of flowed nucleotides, each different polynucleotide
sample comprising a different barcode sequence that gives a
different flowspace string, each different flowspace string being a
different codeword of the error-correcting code. Any two flowspace
codewords of the error-correcting code may have a Hamming distance
of at least 3. Any two flowspace codewords of the error-correcting
code may have a Hamming distance of at least 5. The method may
further comprise one or both of: (i) detecting hydrogen ions
released by the incorporation of nucleotides into the
polynucleotide sample, wherein the amplitude of the signals is
related to the amount of hydrogen ions detected, and (ii) detecting
inorganic pyrophosphate released by the incorporation of
nucleotides into the polynucleotide sample, wherein the amplitude
of the signals is related to the amount of inorganic pyrophosphate
detected. There is also provided a non-transitory machine-readable
storage medium comprising instructions which, when executed by a
processor, cause the processor to perform such a method and
variants thereof. There is also provided a system, including: a
machine-readable memory; and a processor configured to execute
machine-readable instructions, which, when executed by the
processor, cause the system to perform such a method and variants
thereof.
[0119] According to an embodiment, there is provided a method of
making a polynucleotide, comprising: constructing an error-tolerant
code consisting of a set of codewords; translating each codeword to
a sample discriminating code sequence for a given nucleotide flow
ordering; and obtaining a polynucleotide containing the sample
discriminating code sequence. The polynucleotide may be an
oligonucleotide that is 5-40 bases in length. The step of obtaining
the polynucleotide may comprise synthesizing the polynucleotide.
There is also provided a polynucleotide made according to the
method comprising: constructing an error-tolerant code consisting
of a set of codewords; translating each codeword to a sample
discriminating code sequence for a given nucleotide flow ordering;
and obtaining a polynucleotide containing the sample discriminating
code sequence. The sample discriminating code sequences may be a
barcode sequence. The error-tolerant code may be an
error-correcting code. The codewords may be translated to barcode
sequences for a given nucleotide flow ordering. The
error-correcting code, the codewords, and/or the barcode sequences
may be designed or selected in any manner described herein. A
polynucleotide containing the barcode sequence may be made using
any conventional polynucleotide synthesis technique known in the
art or can be supplied by commercial sources that provide
custom-made polynucleotides of the desired sequence.
[0120] According to an exemplary embodiment, there is provided a
method for generating sample discriminating code sequences,
comprising: constructing an error-tolerant code consisting of a set
of codewords; and translating each codeword to a sample
discriminating code sequence for a given nucleotide flow ordering.
The error-tolerant code may be an error-correcting code. The
codewords may be translated to barcode sequences for a given
nucleotide flow ordering. The error-correcting code, the codewords,
and/or the barcode sequences may be designed or selected in any
manner described herein. There is also provided a system for
generating sample discriminating code sequences, comprising: a
machine-readable memory; and a processor configured to execute
machine-readable instructions, which, when executed by the
processor, cause the system to perform a method for generating
sample discriminating code sequences, comprising: constructing an
error-tolerant code consisting of a set of codewords; receiving a
predetermined nucleotide flow ordering; and translating each
codeword to a sample discriminating code sequence according to the
predetermined nucleotide flow ordering. There is also provided a
non-transitory machine-readable storage medium comprising
instructions which, when executed by a processor, cause the
processor to perform a method for generating sample discriminating
code sequences, comprising: constructing an error-tolerant code
consisting of a set of codewords; receiving a predetermined
nucleotide flow ordering; and translating each codeword to a sample
discriminating code sequence according to the predetermined
nucleotide flow ordering. The sample discriminating code sequences
may be a barcode sequence.
[0121] According to an exemplary embodiment, there is provided a
sequencing kit, comprising: a plurality of different
polynucleotides, each different polynucleotide comprising a
different molecular sample discriminating code sequence, wherein a
flowspace projection of each different molecular sample
discriminating code sequence under a flow of a series of
nucleotides according to a predetermined flow ordering gives
different flowspace strings that are codewords of an error-tolerant
code. The plurality of different polynucleotides may include at
least 20, 30, 40, 50, 60, 70, 80, 90, 100, or a larger integer of,
different polynucleotides. The different molecular sample
discriminating code sequences may be different molecular barcode
sequences. The sequencing kit may further comprise a polymerase
enzyme. The sequencing kit may further comprise multiple containers
for holding the different polynucleotides, and each different
polynucleotide may be held in a different container. The
polynucleotides may be oligonucleotides of 5-40 bases in length.
The sequencing kit may further comprise multiple different kinds of
nucleotide monomers. The sequencing kit may further comprise a
ligase enzyme.
[0122] According to an exemplary embodiment, there is provided a
sequencing kit, comprising: multiple different polynucleotides
(which may be contained in vials, for example), each different
polynucleotide comprising a different barcode sequence as described
herein. The polynucleotides may be oligonucleotides having 5-40
bases. The sequencing kit may contain at least 16 different
polynucleotides, each comprising a different barcode sequence; or
at least 32 different polynucleotides; or at least 48 different
polynucleotides; or at least 96 different polynucleotides, or more,
for example. Each different polynucleotide may be provided in a
separate container (e.g., a separate vial). The polynucleotides may
be the barcode sequences themselves, or they may further include
other elements, such as primer sites, adaptors, ligating sites,
linkers, etc. The sequencing kit may also include a set of
precursor nucleotide monomers for carrying out
sequencing-by-synthesis operations, for example, and/or various
other reagents involved in a workflow for preparing and/or
sequencing a sample.
[0123] According to an exemplary embodiment, there is provided a
pool of different polynucleotide strands, each different
polynucleotide strand comprising a different barcode sequence;
wherein the flowspace projection of each different barcode sequence
under a flow of a series of nucleotides according to a
predetermined flow ordering gives different flowspace strings that
are codewords of an error-tolerant code. The error-tolerant code
may be an error-correcting code. The error-correcting code may be a
block code. The block code may be a ternary code using a
three-character alphabet. The barcode sequence may contain only
1-mer and 2-mer base sequences, and a first character of the
alphabet may represent a 0-mer signal, a second character in the
alphabet may represent a 1-mer signal, and a third character in the
alphabet may represent a 2-mer signal. The block code may be a
ternary Golay code. The block code may be a ternary Hamming code.
The block code may be a binary code using a two-character alphabet.
The barcode sequence may contain only 1-mer bases, and a first
character of the alphabet may represent a 0-mer signal, and a
second character in the alphabet may represent a 1-mer signal. Each
codeword may have a length of 15, 14, 13, 12, 11, 10, or fewer
digits. The error-correcting code may be configured to and/or
capable of correcting up to two errors in the flowspace string. The
error-correcting code may be configured to and/or capable of
correcting one error in the flowspace string. The barcode sequences
may have a length of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, or
fewer bases. The barcode sequences may have a GC content in the
range of 40-60%. The error-correcting code may have a minimum
distance of 3. The error-correcting code may have a minimum
distance of 5. The polynucleotide pool may be such that any two
different flowspace strings for the barcode sequences have a
Hamming distance of at least 3. The polynucleotide pool may be such
that any two different flowspace strings for the barcode sequences
have a Hamming distance of at least 5. The polynucleotide pool may
contain at least 96 different polynucleotide strands and the
error-correcting code may have at least 96 different codewords.
[0124] FIG. 9 illustrates a pool of seven different polynucleotide
strands, each associated with a unique barcode sequence. Each
polynucleotide strand may have a primer site, a standard key
sequence, and a unique barcode sequence. Each polynucleotide strand
also may have a different target sequence. Such a pool of
polynucleotide strands may be subject to multiplex sequencing and
the barcodes (with any read corrections as needed) may help
identify the source of the sequence data derived from a multiplex
sample.
[0125] According to an exemplary embodiment, there is provided a
sample identification kit, comprising: a plurality of sample
discriminating codes, wherein: a) each sample discriminating code
comprises a sequence of individual subunits; b) the sequence of
subunits of each sample discriminating code is distinguishable from
the sequence of individual subunits of each other member of the
plurality of sample discriminating codes; and c) each sample
discriminating code is tolerant to one or more errors so as to be
discretely resolvable with respect to other sample discriminating
codes.
[0126] According to an exemplary embodiment, there is provided a
sample identification kit, comprising: a plurality of sample
discriminating codes, wherein: a) each sample discriminating code
comprises a sequence of individual subunits; b) a detectable signal
is associated with each subunit or with pairs or sets of subunits
such that each sample discriminating code is associated with a
sequence of detectable signals; c) each sequence of detectable
signals is distinguishable from the sequence of detectable signals
of each other member of the plurality of sample discriminating
codes; and d) the sequence of detectable signals of each sample
discriminating code is tolerant to at least one error so as to be
discretely resolvable with respect to other sample discriminating
codes.
[0127] FIGS. 10A-10C illustrate an exemplary workflow for preparing
a multiplex sample. FIG. 10A shows an exemplary construction of a
genomic DNA fragment library. A bacterial genomic DNA 10 may be
fragmented into many DNA fragments 12 using any suitable technique,
such as sonication, mechanical shearing, or enzymatic digestion,
for example. Platform-specific adaptors 14 may then be ligated onto
the ends of the fragments 12. Referring to FIG. 10B, each fragment
sample 18 may then be isolated and combined with a bead 16. To
allow for identification of the fragment 18, a barcode sequence
(not shown in the figure) may be ligated to the fragment 18. The
fragment 18 may then be clonally amplified onto the bead 16,
resulting in many clonal copies of the fragment 18 on the bead 16.
This process may repeated for each different fragment 12 of the
library, resulting in many beads, each having the product of a
single library fragment 12 amplified many times. Referring to FIG.
10C, the beads 16 may then be loaded onto a microwell array. FIG.
10C shows a partial view of a DNA fragment inside a well as it is
undergoing sequencing reactions. A template strand 20 may be paired
with a growing complementary strand 22. In the left panel, an A
nucleotide is added to the microwell, resulting in a single-base
incorporation event, which generates a single hydrogen ion. In the
right panel, a T nucleotide is added to the microwell, resulting in
a two-base incorporation event, which generates two hydrogen ions.
The signal produced by the hydrogen ions are shown as peaks 26 in
the ionograms. In various embodiments, a sequencing kit may contain
one or more of the materials needed for the above sample
preparation and sequencing workflow, including reagents for
performing DNA fragmentation, adaptors, primers, ligase enzymes,
beads or other solid support, polymerase enzymes, or precursor
nucleotide monomers for the incorporation reactions.
[0128] According to an exemplary embodiment, there is provided a
system, comprising a plurality of identifiable nucleic acid
barcodes. The nucleic acid barcodes may be attached to, or
associated with, target nucleic acid fragments to form barcoded
target fragments. A library of barcoded target fragments may
include a plurality of a first barcode attached to target fragments
from a first source. Alternatively, a library of barcoded target
fragments may include different identifiable barcodes attached to
target fragments from different sources to make a multiplex
library. For example, a multiplex library may include a mixture of
a plurality of a first barcode attached to target fragments from a
first source, and a plurality of a second barcode attached to
target fragments from a second source. In the multiplex library,
the first and second barcodes may be used to identify the source of
the first and second target fragments, respectively. Any number of
different barcodes may be attached to target fragments from any
number of different sources. In a library of barcoded target
fragments, the barcode portion may be used to identify: a single
target fragment; a single source of the target fragments; a group
of target fragments; target fragments from a single source; target
fragments from different sources; target fragments from a
user-defined group; or any other grouping that may require or
benefit from identification. The sequence of the barcoded portion
of a barcoded target fragment may be separately read from the
target fragment, or read as part of a larger read spanning the
barcode and the target fragment. In a sequencing experiment, the
nucleic acid barcode may be sequenced with the target fragment and
then parsed algorithmically during processing of the sequencing
data. In various embodiments, a nucleic acid barcode may comprise a
synthetic or natural nucleic acid sequence, DNA, RNA, or other
nucleic acids and/or derivatives. For example, a nucleic acid
barcode may include nucleotide bases adenine, guanine, cytosine,
thymine, uracil, inosine, or analogs thereof. Such barcodes may
serve to identify a polynucleotide strand and/or distinguish it
from other polynucleotide strands (e.g., those containing a
different target sequence of interest), and may be used for various
purposes, such as tracking, sorting, and/or identifying the
samples, for example. Because different barcodes can be associated
with different polynucleotide strands, such barcodes may be useful
in multiplexed sequencing of different samples.
[0129] Multiplex Libraries
[0130] In various embodiments, there are provided sample
discriminating codes or barcodes (e.g., nucleic acid barcodes) that
may be attached to, or associated with, targets (e.g., nucleic acid
fragments) to generate barcoded libraries (e.g., barcoded nucleic
acid libraries). Such libraries may be prepared using one or more
suitable nucleic acid or biomolecule manipulation procedures,
including: fragmenting; size-selecting; end-repairing; tailing;
adaptor-joining; nick translation; and purification, for example.
In various embodiments, nucleic acid barcodes may be attached to,
or associated with, fragments of a target nucleic acid sample using
one or more suitable procedure, including ligation, cohesive-end
hybridization, nick-translation, primer extension, or
amplification, for example. In some embodiments, nucleic acid
barcodes may be attached to a target nucleic acid using
amplification primers having a particular barcode sequence.
[0131] In various embodiments, a target nucleic acid or biomolecule
(e.g., proteins, polysaccharides, and nucleic acids, and their
polymer subunits, etc.) sample may be isolated from any suitable
source, such as solid tissue, tissue, cells, yeast, bacteria, or
similar sources, for example. Any suitable methods for isolating
samples from such sources may be used. For example, solid tissue or
tissue may be weighed, cut, mashed, homogenized, and the sample may
be isolated from homogenized samples. An isolated nucleic acid
sample may be chromatin, which may be cross-linked with proteins
that bind DNA, in a procedure known as ChIP (chromatin
immunoprecipitation). In some embodiments, samples may be
fragmented using any suitable procedure, including cleaving with an
enzyme or chemical, or by shearing. Enzyme cleavage may include any
type of restriction endonuclease, endonuclease, or
transposase-mediated cleavage.
[0132] Fragment Libraries
[0133] In various embodiments, there are provided fragment
libraries, which may comprise: a first priming site (P1); a second
priming site (P2); an insert; an internal adaptor (IA); and a
barcode (BC). In some embodiments, a fragment library may include
constructs having certain arrangements, such as: a P1 priming site,
an insert, an internal adaptor (IA), a barcode (BC), and a P2
priming site. In some embodiments, the fragment library may be
attached to a solid support, such as a bead.
[0134] FIG. 11 illustrates an exemplary beaded template. It shows
an exemplary nucleic acid attached to a solid support, such as a
bead. A beaded template 700 includes a bead 710 having a linker
720, which is a sequence for attaching a template 730 to the solid
support. The template 730 may include a first or P1 priming site
740, an insert 750, and a second or P2 priming site 760. The
template 730 may be a synthetic template. The template 730 may be
representative of a fragment library. The template 730 may comprise
a nucleic acid barcode BC, which may be positioned between the P1
priming site 740 and the insert 750, for example. An internal
adaptor may be placed between the P1 priming site 740 and the
barcode BC, or between the barcode BC and the insert 750, or
between the insert 750 and the P2 priming site 760.
[0135] FIG. 12 illustrates another exemplary beaded template. The
nucleic acid barcode BC may be positioned between the insert 750
and the P2 priming site 760. An internal adaptor may be placed
between the P1 priming site 740 and the insert 750, or between the
insert 750 and the barcode BC, or between the barcode BC and the P2
priming site 760.
[0136] In various embodiments, the length of the linker 720 and
template 730 may vary. For example, the length of the linker 720
may range from 10 to 100 bases, for example, or from 15 to 45
bases, for example, and may be 18 bases (18b) in length, for
example. The template 730, which comprises the P1 priming site 740,
the insert 750, and the P2 priming site 760, may also vary in
length. For example, the P1 priming site 740 and the P2 priming
site 760 may each range from 10 to 100 bases, for example, or from
15 to 45 bases, for example, and may be 23 bases (23b) in length,
for example. The insert 750 may range from 2 bases (2b) to 20,000
bases (20 kb), for example, and may be 60 bases (60b), for example.
In an embodiment, the insert 750 may comprise more than 100 bases,
such as, e.g., 1,000 or more bases. In various embodiments, the
insert may be in the form of a concatenate, in which case, the
insert 750 may comprise up to 100,000 bases (100 kb) or more.
[0137] In various embodiments, the position of barcode BC may be
selected based on various considerations, including the length of
the insert, signal-to-noise ratio issues, and/or sequencing bias
issues. For example, where signal-to-noise ratio may be an issue
(e.g., the signal-to-noise ratio can decrease as additional
ligation cycles are performed in sequencing-by-ligation, for
example), the barcode BC may be positioned adjacent the P1 priming
site 740 to avoid potential errors due to a diminished
signal-to-noise ratio, and where the signal-to-noise ratio may not
be a significant issue, the barcode BC may be placed adjacent to
either the P1 priming site 740 or the P2 priming site 760. In some
cases, template sequences may interact differently with a probe
sequence used during the sequencing experiment. Placing the barcode
BC before the insert 750 can affect the sequencing results for the
insert 750. Positioning the barcode BC after the insert 750 can
decrease sequencing errors due to bias. Generally, the position of
the barcode can be affected by or affect sequencing, and the
position that best achieves desired results based on the conditions
of the sequencing process may be selected.
[0138] In various embodiments, sequencing and decoding of a nucleic
acid barcode may be performed with a single forward direction
sequence read (e.g., 5'-3' direction along the template), e.g.,
reading the barcode BC and the insert 750 in a single read. In an
embodiment, the forward read may be parsed into the barcode portion
and the insert portion algorithmically.
[0139] In various embodiments, sample discriminating codes or
barcodes may be attached to polymers, such as proteins, and may be
a polypeptide attached to a protein. Intein-mediated ligation may
join together separate proteins or polypeptides. For example,
expressed protein ligation (EPL) involves a native chemical
ligation (NCL) reaction between an intein-fusion protein and
protein having an N-Cys. In another example, protein trans-splicing
involves reconstitution of two halves of an intein protein (see
Dawson et al., "Synthesis of proteins by native chemical ligation,"
Science, 266:776-779 (1994); Muir, "Semisynthesis of Proteins by
Expressed Protein Ligation," Ann. Rev. Biochem., 72:249-289 (2003);
Paulus, "Protein Splicing and Related Forms of Protein
Autoprocessing," Ann. Rev. Biochem., 69:447-496 (2000); and
Muralidharan et al., "Protein ligation: an enabling technology for
the biophysical analysis of proteins," Nature Methods, 3:429-438
(2006)).
[0140] Mate Pair Libraries
[0141] In various embodiments, nucleic acid barcodes as described
herein may also be used in templates derived from a mate pair
library. FIG. 13 illustrates an exemplary mate pair beaded
template. It shows a beaded template 300 comprising a bead 310, a
linker 320, and a template 330. The template 330 may comprise a
first or P1 priming site 340 and second or P2 priming site 360,
each of which may range in length from 10 to 100 bases, for
example, or from 15 to 45 bases, for example, and may be 23 bases
in length, for example. The template 330 may further comprise an
insert 350, which may comprise a first tag sequence 352, a second
tag sequence 354, and an internal adapter 356 located between the
first and second tag sequences 352 and 354. In various embodiments,
the barcode BC may be placed between the second tag sequence 354
and the P2 priming site 360. Other positions are possible. The
first and second tag sequences 352 and 354 may each have a length
ranging from 2 bases (2b) to 20,000 bases (20 kb), for example, and
may have a length of 60 bases, for example; they may be the same
sequence or different sequences; and they may comprise a different
number of bases or the same number of bases. The internal adapter
356, which may be common to all of the template sequences, may have
a length ranging from 10 to 100 bases, for example, or from 15 to
45 bases, for example, and may have a length of 36 bases, for
example.
[0142] In various embodiments, the barcode BC may be positioned
based on the conditions of the sequencing process. For example, the
barcode BC may be positioned between the P1 priming site 340 and a
first tag sequence 352, as shown in FIG. 13, or between a second
tag sequence 354 and the P2 priming site 360. Alternatively, the
barcode BC may be positioned adjacent an internal adapter 356 and
either a first tag sequence 352 or a second tag sequence 354. In
another embodiment, the barcode BC may be integrated within an
internal adapter 356.
[0143] In various embodiments, nucleic acid barcodes as described
herein may be incorporated into an extended oligonucleotide
comprising the barcode and one or more of a P1 primer, a P2 primer,
and an internal adapter. For example, the barcode may be
incorporated into an oligonucleotide comprising the P2 primer, the
barcode, and an internal adapter, which may allow the barcode to be
sequenced in a separate read. In various embodiments, the barcode
may be incorporated into other oligonucleotides or arrangements of
oligonucleotides.
[0144] In various embodiments, nucleic acid barcodes as described
herein may be added to libraries using any suitable method. For
example, full-length double-stranded oligonucleotide pairs specific
for each barcode may be annealed and ligated onto double-stranded
nucleic acid fragments. In another example, one full-length
double-stranded oligonucleotide may be annealed to one short
universal oligonucleotide specific for each barcode and ligated
onto double-stranded nucleic acid fragments. In a further example,
a universal oligonucleotide adapter may be ligated onto
single-stranded RNA, converted into double-stranded DNA, and the
barcode may be added using a barcode-specific PCR primer during
library amplification.
[0145] In various embodiments, nucleic acid barcodes as described
herein may be adapted for use in generating mate pair libraries for
nucleic acid sequencing. For example, the barcodes may be used in
SOLiD.RTM. Mate-Paired Library Construction Kits by Applied
Biosystems (now Life Technologies Corp.). In various embodiments,
the P2 adaptor may be replaced with a multiplex adaptor having
three portions: an internal primer binding sequence; a barcode
sequence; and a P2 primer binding sequence.
[0146] In an embodiment, the first tag sequence 352 may be a first
sheared DNA tag sequence and the second tag sequence 354 may be a
second sheared DNA tag sequence 354. Because the internal adaptor
sequence may be located in between the two tag sequences 352 and
354, an alternative sequence may be used to prime the sequencing of
the barcode BC.
[0147] According to an embodiment, there is provided a method for
constructing a mate pair library using one or more barcodes as
described herein positioned adjacent a P2 primer, comprising the
following steps (which may be performed in addition to other
routine library creation steps known to those ordinarily skilled in
the art): (1) generating DNA fragments by shearing a DNA sample and
repairing the ends; (2) ligating LMP CAP adaptors to the ends of
the fragmented DNA; (3) circularizing the DNA with an internal
adaptor which leaves nicks; (4) conducting a nick translation
reaction to move the position of the nicks to a new position that
is within the DNA fragment (the timing of the nick translation
reaction may be stopped to place the nick at any desired position
along the DNA fragment); (5) digesting the nick translated DNA with
T7 exonuclease and S1 nuclease to release the linear,
double-stranded mate pair tags; and (6) ligating multiplex P1 and
P2 barcoded adaptors to the mate pair tags.
[0148] In an embodiment, such a mate pair library may be amplified,
quantitated by qPCR or other method, and/or pooled. In various
embodiments, beads may be templated with the mate pair library by
emulsion PCR, and the resulting beads may be sequenced. In such a
library, the P1 and IA end of the insert sequences and the barcode
may be sequenced in three separate reads from the same strand. The
barcode may be sequenced using barcode adaptor sequences having P2,
barcode, and priming sequences. Any suitable priming sequences may
be used.
[0149] Paired End Libraries
[0150] In various embodiments, nucleic acid barcodes as described
herein may be adapted for use in generating paired end libraries.
Generally, paired end libraries may be constructed by: fragmenting
a starting source of DNA (e.g., shearing); and attaching P1
adaptors and barcoded P2 adaptors to the ends of the fragments. The
paired end library may be amplified and sequenced. In an
embodiment, the paired ends and the barcodes in the paired end
library may be sequenced in separate reads from the same
strand.
[0151] SAGE.TM. Libraries
[0152] In various embodiments, nucleic acid barcodes as described
herein may be adapted to construct a nucleic acid library for use
in gene expression analysis using nucleic acid sequencing. For
example, the nucleic acid barcodes may be used in SOLiD.RTM.
SAGE.TM. gene expression analysis (where SAGE.TM. is Serial
Analysis of Gene Expression, developed by Applied Biosystems (now
Life Technologies Corp.)).
[0153] In various embodiments, nucleic acid barcodes as described
herein may be designed to lack one or more restriction enzyme
recognition sequence(s), amplification sequences, or adaptor
sequences that are used for constructing the nucleic acid library.
For example, in SAGE.TM., a recognition site for the restriction
enzyme EcoP15I is used to generate SAGE.TM. tags. Nucleic acid
barcodes used in SAGE.TM. other gene expression analysis, or other
analyses reliant on recognition sites for restriction enzymes, for
example, may be designed to avoid recognition sites necessary for
the further analysis carried out in those processes.
[0154] In various embodiments, SAGE.TM.-compatible nucleic acid
barcodes may be designed to be positioned adjacent the P1 primer.
SAGE.TM. tags have a 2-base overhang resulting from EcoP15I
cleavage. To account for the overhang, the nucleic acid barcode may
comprise an overhang end having 1, 2, 3, 4, 5, or longer overhang
end. The overhang end may include a degenerate sequence. The
nucleic acid barcode may include a 2-nucleotide degenerate
extension to ligate to the SAGE.TM. tag. Alternatively, the 2-base
overhang on the SAGE.TM. tag may be degraded or filled-in to
produce a blunt end for ligating to the nucleic acid barcode.
[0155] FIG. 14A illustrates an exemplary barcoded adaptor. It shows
a barcode BC attached to a P1 primer 440, wherein the barcode BC
comprises a 2-nucleotide degenerate extension NN. A P2 primer may
be adapted to ligate properly to the SAGE.TM. tag. The P2 primer
may have an NlaIII overhang (GTAC) attached to an EcoP15I
recognition site to ligate to the SAGE.TM. tag. FIG. 14B
illustrates an exemplary beaded template. It shows a SAGE.TM. tag
450 ligated to barcode BC and the NlaIII overhang 462 and EcoP15I
recognition site 464, which are ligated to P2 primer 460. P1 primer
440 is attached to solid support 410 (e.g., bead) through linker
420.
[0156] FIG. 15 illustrates another exemplary beaded template. It
shows a barcode BC positioned adjacent a P2 primer 560. Primer P1
540 is attached to a solid support 510 (e.g., a bead) through
linker 520. A 2-nucleotide degenerate overhang NN allows a SAGE.TM.
tag 550 to ligate to the P1 primer 540. On the other side of the
SAGE.TM. tag 550, an internal adapter IA is ligated to an EcoP15I
recognition site 564 and an NlaIII overhang 562. The barcode may be
incorporated in an oligonucleotide comprising one or more
oligonucleotide sequences, such as, e.g., an internal adapter and a
P2 primer, or comprising a modified internal adapter, the barcode,
and a P2 primer. In various embodiments, the barcode need not be
part of the library construct, but can be introduced by PCR
amplification using a primer having the barcode sequence.
[0157] According to an embodiment, there is provided a method for
generating barcoded SAGE.TM. libraries using one or more barcodes
as described herein positioned adjacent the P2 primer, comprising
the following steps (which may be performed in addition to other
routine library creation steps known to those ordinarily skilled in
the art): (1) generating an immobilized cDNA library from poly-A
RNA; (2) digesting the cDNA with a restriction enzyme to create
cohesive ends for EcoP151 ends (e.g., digesting with Nla III); (3)
ligating to the Nla III cut ends an internal adaptor having
cohesive ends for EcoP151 to form an EcoP151 recognition site; (4)
cleaving the EcoP15I site to generate SAGE.TM. tag fragments; (5)
ligating P1 adaptors (e.g., SAGE.TM.-specific P1 adaptors have a
2-base degenerate extension to hybridize with the overhang from the
cleaved EcoP15I ends); and (6) amplifying the library (e.g., PCR
using primers having a P2 adaptor and barcode sequences). Any
suitable primers may be used.
[0158] In various embodiments, such a library may be amplified,
quantitated by qPCR or other method, and/or pooled. In various
embodiments, beads may be templated with the SAGE.TM. library by
emulsion PCR, and the templated beads may be sequenced.
[0159] Yeast Libraries
[0160] In various embodiments, nucleic acid barcodes as described
herein may be used in combination with other yeast barcodes,
including those described in Yan et al., "Yeast Barcoders: a
chemogenomic application of a universal donor-strain collection
carrying bar-code identifiers," Nature Methods, 5(8):719-725
(2008), for example, which is incorporated by reference herein in
its entirety. Yeast barcodes may be unique sequences identifying
about 6,000 S. cerevisiae gene deletion strains, and may comprise a
signature sequence of about 20 bases flanked by conserved PCR
primer sequences. In an embodiment, a set of barcodes comprising
about 100 uniquely identifiable barcodes as described herein may be
used in combination with 6,000 other yeast barcodes to yield about
600,000 targets to be analyzed (e.g., per location on a slide when
using a SOLiD.RTM. sequencing platform or using some other support,
e.g., an Ion PGM.TM. or Ion Proton.TM. chip and sequencing
platform, for example). For example, a SOLiD.RTM. slide would
provide capacity for about 4.8 million targets, and using both
slides in a SOLiD.RTM. apparatus would allow about 9.6 million
targets to be analyzed simultaneously. Many more targets could be
analyzed simultaneously using Ion PGM.TM. 314.TM., 316.TM., or
318.TM. Chips (which have about 1, 6, and 11 million wells,
respectively), an Ion Proton.TM. Chip (which is expected to have
about 165 million wells), and/or an Ion Proton.TM. II Chip (which
is expected to have about 660 million wells). In an embodiment, a
sequencing experiment may be performed in which chemical compounds
are tested against each of the 6,000 S. cerevisiae gene deletion
strains. Each chemical compound may be identified by a uniquely
identifiable barcode as described herein, and each of the 6,000 S.
cerevisiae gene deletion strains may be identified by a uniquely
identifiable yeast barcode.
[0161] In various embodiments, nucleic acid barcodes as described
herein may be combined with at least one yeast barcode to prepare a
module to be analyzed. The module may comprise a first conserved
PCR primer adjacent a P1 primer. The nucleic acid barcode may be
ligated to a P2 primer between the P2 primer and a second conserved
PCR primer. An internal adapter may be positioned between the
nucleic acid barcode and the second conserved PCR primer. In an
embodiment, the complete nucleic acid sequence may comprise a P1
primer, a first conserved PCR primer, an insert with a yeast
barcode, a second conserved PCR primer, an internal adapter, a
nucleic acid barcode as described herein, and a P2 primer. Any
suitable primers may be used.
[0162] ChIP-Seq Libraries
[0163] In various embodiments, nucleic acid barcodes as described
herein may be adapted for use in Chromatin immunoprecipitation
(ChIP) sequencing to generate ChIP-based libraries. ChIP involves
isolating genomic nucleic acids that are associated with
DNA-binding proteins. Chromatin/protein complexes may be isolated
using a SOLiD.RTM. ChIP-Seq Kit from Applied Biosystems (now part
of Life Technologies Corp.). Isolated chromatin/protein complexes
can be manipulated and ligated to nucleic acid barcodes and related
adaptors to construct a ChIP-based library. General steps for ChIP
include: (1) treating live cells or tissue with formaldehyde to
crosslink proximal molecules to create protein/DNA complexes; (2)
lysing the cells to release the cross-linked complexes; (3)
fragmenting the DNA (e.g., via sonication); (4) immunoprecipitating
the protein/DNA complex of interest using certain antibodies
conjugated to beads; (5) releasing the DNA from the cross-linked
complex by heat treatment; and (6) purifying the released DNA.
General steps for preparing a ChIP-based library include: (1)
generating cohesive ends on the ChIP-isolated DNA (e.g.,
end-repair); and (2) attaching P1, P2 and/or coded adaptors (e.g.,
with nucleic acid barcodes) to the ends of the ChIP-isolated DNA.
Nick translation can be performed on the adaptor-ligated DNA to
close any gaps or nicks between the DNA fragment and the adaptors.
The ChIP-based library may include fragments of chromatin ligated
at the ends with any combination of P1, P2, and/or coded adaptors
(e.g., with nucleic acid barcodes).
[0164] According to various embodiments, one or more features of
any one or more of the above-discussed teachings and/or embodiments
may be performed or implemented using appropriately configured
and/or programmed hardware and/or software elements. Determining
whether an embodiment is implemented using hardware and/or software
elements may be based on any number of factors, such as desired
computational rate, power levels, heat tolerances, processing cycle
budget, input data rates, output data rates, memory resources, data
bus speeds, etc., and other design or performance constraints.
[0165] Examples of hardware elements may include processors,
microprocessors, input(s) and/or output(s) (I/O) device(s) (or
peripherals) that are communicatively coupled via a local interface
circuit, circuit elements (e.g., transistors, resistors,
capacitors, inductors, and so forth), integrated circuits,
application specific integrated circuits (ASIC), programmable logic
devices (PLD), digital signal processors (DSP), field programmable
gate array (FPGA), logic gates, registers, semiconductor device,
chips, microchips, chip sets, and so forth. The local interface may
include, for example, one or more buses or other wired or wireless
connections, controllers, buffers (caches), drivers, repeaters and
receivers, etc., to allow appropriate communications between
hardware components. A processor is a hardware device for executing
software, particularly software stored in memory. The processor can
be any custom made or commercially available processor, a central
processing unit (CPU), an auxiliary processor among several
processors associated with the computer, a semiconductor based
microprocessor (e.g., in the form of a microchip or chip set), a
macroprocessor, or generally any device for executing software
instructions. A processor can also represent a distributed
processing architecture. The I/O devices can include input devices,
for example, a keyboard, a mouse, a scanner, a microphone, a touch
screen, an interface for various medical devices and/or laboratory
instruments, a bar code reader, a stylus, a laser reader, a
radio-frequency device reader, etc. Furthermore, the I/O devices
also can include output devices, for example, a printer, a bar code
printer, a display, etc. Finally, the I/O devices further can
include devices that communicate as both inputs and outputs, for
example, a modulator/demodulator (modem; for accessing another
device, system, or network), a radio frequency (RF) or other
transceiver, a telephonic interface, a bridge, a router, etc.
[0166] Examples of software may include software components,
programs, applications, computer programs, application programs,
system programs, machine programs, operating system software,
middleware, firmware, software modules, routines, subroutines,
functions, methods, procedures, software interfaces, application
program interfaces (API), instruction sets, computing code,
computer code, code segments, computer code segments, words,
values, symbols, or any combination thereof. A software in memory
may include one or more separate programs, which may include
ordered listings of executable instructions for implementing
logical functions. The software in memory may include a system for
identifying data streams in accordance with the present teachings
and any suitable custom made or commercially available operating
system (O/S), which may control the execution of other computer
programs such as the system, and provides scheduling, input-output
control, file and data management, memory management, communication
control, etc.
[0167] According to various embodiments, one or more features of
any one or more of the above-discussed teachings and/or embodiments
may be performed or implemented using appropriately configured
and/or programmed non-transitory machine-readable medium or article
that may store an instruction or a set of instructions that, if
executed by a machine, may cause the machine to perform a method
and/or operations in accordance with the embodiments. Such a
machine may include, for example, any suitable processing platform,
computing platform, computing device, processing device, computing
system, processing system, computer, processor, scientific or
laboratory instrument, etc., and may be implemented using any
suitable combination of hardware and/or software. The
machine-readable medium or article may include, for example, any
suitable type of memory unit, memory device, memory article, memory
medium, storage device, storage article, storage medium and/or
storage unit, for example, memory, removable or non-removable
media, erasable or non-erasable media, writeable or re-writeable
media, digital or analog media, hard disk, floppy disk, read-only
memory compact disc (CD-ROM), recordable compact disc (CD-R),
rewriteable compact disc (CD-RW), optical disk, magnetic media,
magneto-optical media, removable memory cards or disks, various
types of Digital Versatile Disc (DVD), a tape, a cassette, etc.,
including any medium suitable for use in a computer. Memory can
include any one or a combination of volatile memory elements (e.g.,
random access memory (RAM, such as DRAM, SRAM, SDRAM, etc.)) and
nonvolatile memory elements (e.g., ROM, EPROM, EEROM, Flash memory,
hard drive, tape, CDROM, etc.). Moreover, memory can incorporate
electronic, magnetic, optical, and/or other types of storage media.
Memory can have a distributed architecture where various components
are situated remote from one another, but are still accessed by the
processor. The instructions may include any suitable type of code,
such as source code, compiled code, interpreted code, executable
code, static code, dynamic code, encrypted code, etc., implemented
using any suitable high-level, low-level, object-oriented, visual,
compiled and/or interpreted programming language.
[0168] According to various embodiments, one or more features of
any one or more of the above-discussed teachings and/or embodiments
may be performed or implemented at least partly using a
distributed, clustered, remote, or cloud computing resource.
[0169] According to various embodiments, one or more features of
any one or more of the above-discussed teachings and/or embodiments
may be performed or implemented using a source program, executable
program (object code), script, or any other entity comprising a set
of instructions to be performed. When a source program, the program
can be translated via a compiler, assembler, interpreter, etc.,
which may or may not be included within the memory, so as to
operate properly in connection with the O/S. The instructions may
be written using (a) an object oriented programming language, which
has classes of data and methods, or (b) a procedural programming
language, which has routines, subroutines, and/or functions, which
may include, for example, C, C++, Pascal, Basic, Fortran, Cobol,
Perl, Java, and Ada.
[0170] According to various embodiments, one or more of the
above-discussed embodiments may include transmitting, displaying,
storing, printing or outputting to a user interface device, a
computer readable storage medium, a local computer system or a
remote computer system, information related to any information,
signal, data, and/or intermediate or final results that may have
been generated, accessed, or used by such embodiments. Such
transmitted, displayed, stored, printed or outputted information
can take the form of searchable and/or filterable lists of runs and
reports, pictures, tables, charts, graphs, spreadsheets,
correlations, sequences, and combinations thereof, for example.
[0171] Various other embodiments may be derived by repeating,
adding, or substituting any generically or specifically described
features and/or components and/or substances and/or steps and/or
operating conditions set forth in one or more of the
above-described embodiments. Further, it should be understood that
an order of steps or order for performing certain actions is
immaterial so long as the objective of the steps or action remains
achievable, unless specifically stated otherwise. Furthermore, two
or more steps or actions can be conducted simultaneously so long as
the objective of the steps or action remains achievable, unless
specifically stated otherwise. Moreover, any one or more feature,
component, aspect, step, or other characteristic mentioned in one
of the above-discussed embodiments may be considered to be a
potential optional feature, component, aspect, step, or other
characteristic of any other of the above-discussed embodiments so
long as the objective of such any other of the above-discussed
embodiments remains achievable, unless specifically stated
otherwise.
[0172] Although various embodiments of the present teachings may
advantageously be used with sequencing-by-synthesis approaches, as
described herein and in Rothberg et al., U.S. Pat. Publ. No.
2009/0026082; Anderson et al., SENSORS AND ACTUATORS B CHEM.,
129:79-86 (2008); Pourmand et al., PROC. NATl. ACAD. SCI.,
103:6466-6470 (2006), which are all incorporated by reference
herein in their entirety, for example, the present teachings may
also be used with other approaches, such as variants of
sequencing-by-synthesis including methods where the nucleotides or
nucleoside triphosphate precursors are modified to be reversible
terminators (sometimes referred to as cyclic reversible termination
(CRT) methods) and methods where the nucleotides or nucleoside
triphosphate precursors are unmodified (sometimes referred to as
cyclic single base delivery (CSD) methods), for example, or more
generally methods that comprise repeated steps of delivering (or
extending in response to delivering) nucleotides (to the
polymerase-primer-template complex) and collecting signals (or
detecting the incorporation either directly or indirectly).
[0173] Although various embodiments of the present teachings may
advantageously be used in connection with pH-based sequence
detection, as described herein and in Rothberg et al., U.S. Pat.
Appl. Publ. Nos. 2009/0127589 and 2009/0026082 and Rothberg et al.,
U.K. Pat. Appl. Publ. No. GB2461127, which are all incorporated by
reference herein in their entirety, for example, the present
teachings may also be used with other detection approaches,
including the detection of pyrophosphate (PPi) released by the
incorporation reaction (see, e.g., U.S. Pat. Nos. 6,210,891;
6,258,568; and 6,828,100); various fluorescence-based sequencing
instrumentation (see, e.g., U.S. Pat. Nos. 7,211,390; 7,244,559;
and 7,264,929); some sequencing-by-synthesis techniques that can
detect labels associated with the nucleotides, such as mass tags,
fluorescent, and/or chemiluminescent labels (in which case an
inactivation step may be included in the workflow (e.g., by
chemical cleavage or photobleaching) prior to the next cycle of
synthesis and detection)); and more generally methods where an
incorporation reaction generates or results in a product or
constituent with a property capable of being monitored and used to
detect the incorporation event, including, for example, changes in
magnitude (e.g., heat) or concentration (e.g., pyrophosphate and/or
hydrogen ions), and signal (e.g., fluorescence, chemiluminescence,
light generation), in which cases the amount of the detected
product or constituent may be monotonically related to the number
of incorporation events, for example.
[0174] The following documents are all incorporated by reference
herein in their entirety: Li et al., International Publ. No.
WO/2012/044847, published Apr. 5, 2012; Chen et al., U.S. patent
application Ser. No. 13/482,542, filed May 29, 2012; Fu et al.,
"Counting individual DNA molecules by the stochastic attachment of
diverse labels," PNAS 108(22):9026-9031 (May 31, 2011); and
Shiroguchi et al., "Digital RNA sequencing minimizes
sequence-dependent bias and amplification noise with optimized
single-molecule barcodes," PNAS 109(4):1347-1352 (Jan. 24,
2012).
[0175] Although the present description described in detail certain
embodiments, other embodiments are also possible and within the
scope of the present invention. For example, those skilled in the
art may appreciate from the present description that the present
teachings may be implemented in a variety of forms, and that the
various embodiments may be implemented alone or in combination.
Variations and modifications will be apparent to those skilled in
the art from consideration of the specification and figures and
practice of the teachings described in the specification and
figures, and the claims.
Sequence CWU 1
1
45112DNAArtificial SequenceExemplary Barcode Sequence 1ttgaggattc
ca 12212DNAArtificial SequenceExemplary Barcode Sequence
2ccaggcaatc ca 12313DNAArtificial SequenceExemplary Barcode
Sequence 3ttccgaacat cca 13412DNAArtificial SequenceExemplary
Barcode Sequence 4taaggccaat ta 12511DNAArtificial
SequenceExemplary Barcode Sequence 5ttggagcctt a 11612DNAArtificial
SequenceExemplary Barcode Sequence 6ttccggaagg ta
12712DNAArtificial SequenceExemplary Barcode Sequence 7ttccggatcg
aa 12811DNAArtificial SequenceExemplary Barcode Sequence
8ttaaggtcga a 11912DNAArtificial SequenceExemplary Barcode Sequence
9ccggaagtcg aa 121014DNAArtificial SequenceExemplary Barcode
Sequence 10ttccaagcct cgaa 141112DNAArtificial SequenceExemplary
Barcode Sequence 11cggaacctcg aa 121211DNAArtificial
SequenceExemplary Barcode Sequence 12tccacctcga a
111315DNAArtificial SequenceExemplary Barcode Sequence 13tccgcaacca
cggaa 151418DNAArtificial SequenceExemplary Barcode Sequence
14ttcggccgga ccacggaa 181515DNAArtificial SequenceExemplary Barcode
Sequence 15aggtggaaca cggaa 151615DNAArtificial SequenceExemplary
Barcode Sequence 16tacctcgaca cggaa 151721DNAArtificial
SequenceExemplary Barcode Sequence 17accggttccg gaccaacgga a
211815DNAArtificial SequenceExemplary Barcode Sequence 18tacttgccaa
cggaa 151915DNAArtificial SequenceExemplary Barcode Sequence
19cccgggtttc cgttc 152017DNAArtificial SequenceExemplary Barcode
Sequence 20tttcgggttc gggtttc 172115DNAArtificial SequenceExemplary
Barcode Sequence 21cccgttccgg gaaac 152215DNAArtificial
SequenceExemplary Barcode Sequence 22tttcgtttcg aaatc
152315DNAArtificial SequenceExemplary Barcode Sequence 23ttccgtcgga
atttc 152417DNAArtificial SequenceExemplary Barcode Sequence
24ttcggttccc gggaatc 172513DNAArtificial SequenceExemplary Barcode
Sequence 25tttaaaggcc cac 132617DNAArtificial SequenceExemplary
Barcode Sequence 26ttcccggaag ggcccac 172713DNAArtificial
SequenceExemplary Barcode Sequence 27ccgggaaagg gac
132814DNAArtificial SequenceExemplary Barcode Sequence 28tcagtcctcg
aatc 142914DNAArtificial SequenceExemplary Barcode Sequence
29tcagcttgcg gatc 143014DNAArtificial SequenceExemplary Barcode
Sequence 30tcagtctaac ggac 143114DNAArtificial SequenceExemplary
Barcode Sequence 31tcagttctta gcgc 143214DNAArtificial
SequenceExemplary Barcode Sequence 32tcagtgagcg gaac
143314DNAArtificial SequenceExemplary Barcode Sequence 33tcagttaagc
ggtc 143414DNAArtificial SequenceExemplary Barcode Sequence
34tcagctgacc gaac 143514DNAArtificial SequenceExemplary Barcode
Sequence 35tcagtctaga ggtc 143614DNAArtificial SequenceExemplary
Barcode Sequence 36tcagaagagg attc 143710DNAArtificial
SequenceExemplary Barcode Sequence 37tcctcgaatc 103810DNAArtificial
SequenceExemplary Barcode Sequence 38cttgcggatc 103910DNAArtificial
SequenceExemplary Barcode Sequence 39tctaacggac 104010DNAArtificial
SequenceExemplary Barcode Sequence 40ttcttagcgc 104110DNAArtificial
SequenceExemplary Barcode Sequence 41tgagcggaac 104210DNAArtificial
SequenceExemplary Barcode Sequence 42ttaagcggtc 104310DNAArtificial
SequenceExemplary Barcode Sequence 43ctgaccgaac 104410DNAArtificial
SequenceExemplary Barcode Sequence 44tctagaggtc 104510DNAArtificial
SequenceExemplary Barcode Sequence 45aagaggattc 10
* * * * *