U.S. patent number 11,001,896 [Application Number 16/382,080] was granted by the patent office on 2021-05-11 for system and method to synthesize a target molecule within a droplet.
This patent grant is currently assigned to The Regents of the University of California. The grantee listed for this patent is The Regents of the University of California. Invention is credited to Adam R. Abate, Dennis Jay Eastburn, Adam R. Sciambi.
View All Diagrams
United States Patent |
11,001,896 |
Abate , et al. |
May 11, 2021 |
System and method to synthesize a target molecule within a
droplet
Abstract
The disclosed embodiments generally relate to a method and
system to synthesize a target molecule within a droplet. In an
exemplary embodiment, a first microfluidic device configured to
contact a polynucleotide-containing component from a sample with
lysis reagents to form a first droplet. The lysis reagents include
an enzyme having protease activity. The first droplet is
encapsulated with an immiscible carrier fluid. A collection
reservoir is provided to receive and incubate the first droplet for
a first duration of time. The first duration of time is sufficient
to inactivate the enzyme of the lysis reagent. A second
microfluidic device is provided to receive the first droplet and
add nucleic acid synthesis reagent to thereby form a second nucleic
acid synthesis droplet in the immiscible carrier fluid. Finally, a
reaction chamber is provided to synthesize the target
polynucleotide within the second nucleic acid synthesis
droplet.
Inventors: |
Abate; Adam R. (Daly City,
CA), Eastburn; Dennis Jay (Burlingame, CA), Sciambi; Adam
R. (San Francisco, CA) |
Applicant: |
Name |
City |
State |
Country |
Type |
The Regents of the University of California |
Oakland |
CA |
US |
|
|
Assignee: |
The Regents of the University of
California (Oakland, CA)
|
Family
ID: |
1000005543237 |
Appl.
No.: |
16/382,080 |
Filed: |
April 11, 2019 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20190330701 A1 |
Oct 31, 2019 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
16164707 |
Oct 18, 2018 |
|
|
|
|
14420646 |
Dec 25, 2018 |
10161007 |
|
|
|
PCT/US2013/054517 |
Aug 12, 2013 |
|
|
|
|
61682707 |
Aug 13, 2012 |
|
|
|
|
61784754 |
Mar 14, 2013 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
B01L
7/52 (20130101); C12Q 1/686 (20130101); B01F
5/0652 (20130101); B01F 13/0062 (20130101); C12Q
1/6806 (20130101); B01L 3/502784 (20130101); B01F
13/0076 (20130101); C12Q 1/6886 (20130101); C12Q
1/6844 (20130101); B01F 3/0807 (20130101); C12Q
1/6806 (20130101); C12Q 2563/159 (20130101); C12Q
1/686 (20130101); C12Q 2537/143 (20130101); C12Q
2563/159 (20130101); C12Q 2565/629 (20130101); B01L
2400/0487 (20130101); B01L 2300/1822 (20130101); C12Q
2600/118 (20130101); B01L 2300/0883 (20130101); B01L
2300/0816 (20130101); B01L 2300/0867 (20130101); B01L
2300/0864 (20130101); B01L 2400/0415 (20130101); C12Q
2600/16 (20130101); C12Q 2600/158 (20130101); B01L
2200/0652 (20130101) |
Current International
Class: |
C12P
19/34 (20060101); C12Q 1/6886 (20180101); C12Q
1/6806 (20180101); C12Q 1/6844 (20180101); C12Q
1/686 (20180101); B01F 3/08 (20060101); B01F
13/00 (20060101); B01F 5/06 (20060101); B01L
3/00 (20060101); B01L 7/00 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
2013203624 |
|
May 2013 |
|
AU |
|
2013302867 |
|
Feb 2015 |
|
AU |
|
2016215298 |
|
Aug 2017 |
|
AU |
|
2016215304 |
|
Aug 2017 |
|
AU |
|
2017382905 |
|
Jul 2019 |
|
AU |
|
2019226236 |
|
Sep 2019 |
|
AU |
|
2881783 |
|
Feb 2014 |
|
CA |
|
3001986 |
|
Apr 2016 |
|
CA |
|
2974299 |
|
Aug 2016 |
|
CA |
|
2974306 |
|
Aug 2016 |
|
CA |
|
1693478 |
|
Nov 2005 |
|
CN |
|
104736725 |
|
Jun 2015 |
|
CN |
|
107107058 |
|
Aug 2017 |
|
CN |
|
107429426 |
|
Dec 2017 |
|
CN |
|
107530654 |
|
Jan 2018 |
|
CN |
|
108350488 |
|
Jul 2018 |
|
CN |
|
110088290 |
|
Aug 2019 |
|
CN |
|
10339452 |
|
Mar 2005 |
|
DE |
|
1547677 |
|
Jun 2005 |
|
EP |
|
2145955 |
|
Feb 2012 |
|
EP |
|
2565650 |
|
Mar 2013 |
|
EP |
|
2882872 |
|
Jun 2015 |
|
EP |
|
3160654 |
|
May 2017 |
|
EP |
|
3209419 |
|
Aug 2017 |
|
EP |
|
3253479 |
|
Dec 2017 |
|
EP |
|
3253910 |
|
Dec 2017 |
|
EP |
|
3337907 |
|
Jun 2018 |
|
EP |
|
3497228 |
|
Jun 2019 |
|
EP |
|
3571308 |
|
Nov 2019 |
|
EP |
|
2519906 |
|
May 2015 |
|
GB |
|
2539836 |
|
Dec 2016 |
|
GB |
|
2014521334 |
|
Aug 2014 |
|
JP |
|
2015533079 |
|
Nov 2015 |
|
JP |
|
2018505671 |
|
Mar 2018 |
|
JP |
|
2018508198 |
|
Mar 2018 |
|
JP |
|
2018525004 |
|
Sep 2018 |
|
JP |
|
WO 1994012216 |
|
Jun 1994 |
|
WO |
|
WO 2007140015 |
|
Dec 2007 |
|
WO |
|
WO 2009050512 |
|
Apr 2009 |
|
WO |
|
WO 2009054870 |
|
Apr 2009 |
|
WO |
|
WO 2009111014 |
|
Sep 2009 |
|
WO |
|
WO 2010148039 |
|
Dec 2010 |
|
WO |
|
WO 2011047307 |
|
Apr 2011 |
|
WO |
|
WO 2012011091 |
|
Jan 2012 |
|
WO |
|
WO 2012048341 |
|
Apr 2012 |
|
WO |
|
WO 2012162267 |
|
May 2012 |
|
WO |
|
WO 2012083225 |
|
Jun 2012 |
|
WO |
|
WO 2012109600 |
|
Aug 2012 |
|
WO |
|
WO 2012142213 |
|
Oct 2012 |
|
WO |
|
2013095469 |
|
Jun 2013 |
|
WO |
|
WO 2013119753 |
|
Aug 2013 |
|
WO |
|
WO 2013126741 |
|
Aug 2013 |
|
WO |
|
WO 2013130512 |
|
Sep 2013 |
|
WO |
|
WO 2013134261 |
|
Sep 2013 |
|
WO |
|
WO 2013173394 |
|
Nov 2013 |
|
WO |
|
2014028378 |
|
Feb 2014 |
|
WO |
|
WO 2014028378 |
|
Feb 2014 |
|
WO |
|
WO 2014028537 |
|
Feb 2014 |
|
WO |
|
WO 2014047556 |
|
Mar 2014 |
|
WO |
|
WO 2014083435 |
|
Jun 2014 |
|
WO |
|
WO 2014093676 |
|
Jun 2014 |
|
WO |
|
WO 2014108323 |
|
Jul 2014 |
|
WO |
|
WO 2014138132 |
|
Sep 2014 |
|
WO |
|
WO 2014151658 |
|
Sep 2014 |
|
WO |
|
WO 2014153071 |
|
Sep 2014 |
|
WO |
|
WO 2015120398 |
|
Feb 2015 |
|
WO |
|
WO 2015031691 |
|
Mar 2015 |
|
WO |
|
2015069798 |
|
May 2015 |
|
WO |
|
WO 2015200717 |
|
Jun 2015 |
|
WO |
|
WO 2015157369 |
|
Oct 2015 |
|
WO |
|
2015179848 |
|
Nov 2015 |
|
WO |
|
2015189336 |
|
Dec 2015 |
|
WO |
|
WO 2016064755 |
|
Apr 2016 |
|
WO |
|
WO 2016065056 |
|
Apr 2016 |
|
WO |
|
WO 2016126865 |
|
Aug 2016 |
|
WO |
|
WO 2016126871 |
|
Aug 2016 |
|
WO |
|
2017031125 |
|
Feb 2017 |
|
WO |
|
WO2018119301 |
|
Jun 2018 |
|
WO |
|
2019099908 |
|
May 2019 |
|
WO |
|
Other References
US. Appl. No. 16/324,532, Feb. 8, 2019, Abate, Adam et al. cited by
applicant .
U.S. Appl. No. 16/164,707, Oct. 18, 2018, Abate, Adam et al. cited
by applicant .
Fu, Yusi et al (2015) "Uniform and accurate single-cell sequencing
based on emulsion whole-genome amplification"; Proc Natl Acad Sci U
S A. 112(38); pp. 11923-11928. cited by applicant .
Grover, et al (2009) "Multiple displacement amplification as a
pre-polymerase chain reaction (pre-PCR) to detect ultra low
population of Ralstonia solanacearum (Smith 1896) Yabuchi et al.
(1996)" Lett Appl Microbiol. 49(5); pp. 539-543. cited by applicant
.
Kuster, et al (2013) "Interfacing droplet microfluidics with
matrix-assisted laser desorption/ionization mass spectrometry:
label-free content analysis of single droplets"; Anal Chem.
5;85(3); pp. 1285-1289. cited by applicant .
Nishikawa, Yohei et al (2015) "Monodisperse Picoliter Droplets for
Low-Bias and Contamination-Free Reactions in Single-Cell Whole
Genome Amplification" PLoS One 10(9); pp. e0138733. cited by
applicant .
Nunes et al. (2013) "Dripping and jetting in microfluidic
multiphase flows applied to particle and fiber synthesis"; J Phys D
Appl Phys. 46(11); pii: 114002. cited by applicant .
Sciambia Adam and Abate Adam R., (2015) "Accurate microfluidic
sorting of droplets at 30 kHz"; Lab Chip 15(1); pp. 47-51. cited by
applicant .
Sidore, et al (2016) "Enhanced sequencing coverage with digital
droplet multiple displacement amplification"; Nucleic Acids Res.
44(7):e66.; pp. 1-9. cited by applicant .
Tamminen, et al (2015) "Single gene-based distinction of individual
microbial genomes from a mixed population of microbial cells";
Front Microbiol. 6:195; pp. 1-10. cited by applicant .
Wheeler et al, (2005) "Digital microfluidics with in-line sample
purification for proteomics analyses with MALDI-MS"; Anal Chem.
77(2); 534-40. cited by applicant .
Yu, et al (2014) "Mung bean nuclease treatment increases capture
specificity of microdroplet-PCR based targeted DNA enrichment";
PLoS One 9(7): e103491; pp. 1-7. cited by applicant .
Abate Adam. R, et al; (2010) "Microfluidic sorting with high-speed
single-layer membrane valves"; Applied Physics Letters 96; pp.
203509-1-203509-3. cited by applicant .
Abate Adam. R., et al; "High-throughput injection with
microfluidics using picoinjectors"; PNAS vol. 107 1 No. 45; Nov. 9,
2010; pp. 19163-19166. cited by applicant .
Abate AR, et al; (2011) "Efficient encapsulation with
plug-triggered drop formation"; Physical Review E.;84(3):031502.
cited by applicant .
Abate AR and Weitz DA; (2011) "Faster multiple emulsification with
drop splitting". Lab on a Chip;11(11); pp. 1911-1915. cited by
applicant .
Abate AR, et al; (2011) "One-step formation of multiple emulsions
in microfluidics"; Lab on a Chip11(2); pp. 253-258. cited by
applicant .
Abate AR, et al; (2008) "Photoreactive coating for high-contrast
spatial patterning of microfluidic device wettability"; Lab on a
Chip 8(12); pp. 2157-2160. cited by applicant .
Ali et al. "Rolling circle amplification: a versatile tool for
chemical biology, materials science and medicine"; Chem Soc Rev.
vol. 43; Mar. 18, 2014; pp. 3324-3341. cited by applicant .
Agresti JJ, et al; "Ultrahigh-throughput screening in drop-based
microfluidics for directed evolution"; PNAS vol. 107, No. 9; Mar.
2, 2010; pp. 4004-4009. cited by applicant .
Agresti J., et al; (2010) "Correction for Ultrahigh-throughput
screening in drop-based microftuidics for directed evolution";
Proc. Nat.l Acad. Sci. USA, 107; pp. 6550-6551. cited by applicant
.
Ahn K, et al; (2006) "Electrocoalescence of drops synchronized by
size-dependent flow in microfluidic channels"; Appl Phys Lett 88;
pp. 264105-1-264105-3. cited by applicant .
Allen LZ, et al; (2011) "Single virus genomics: a new tool for
virus discovery"; PLoS One 6(3):e17722. cited by applicant .
Arriaga LR, et al. (2014) "Ultrathin Shell Double Emulsion
Templated Giant Unilamellar Lipid Vesicles with Controlled
Microdomain Formation"; Small 10(5); pp. 950-956; Epub Oct. 22,
2013. cited by applicant .
Atten P; (1993) "Electrocoalescence of Water Droplets in an
Insulating Liquid"; J Electrostat 30; pp. 259-269. cited by
applicant .
Barenholz Y, et al; (1977) "A simple method for the preparation of
homogeneous phospholipid vesicles" Biochemistry 16(12); pp.
2806-2810. cited by applicant .
Baret J-C, et al. (2009) "Fluorescence-activated droplet sorting
(FADS): efficient microfluidic cell sorting based on enzymatic
activity"; Lab on a Chip;9(13); pp. 1850-1858. cited by applicant
.
Battaglia G, et al; (2006) "Polymeric vesicle permeability: a
facile chemical assay"; Langmuir 22(11); pp. 4910-4913. cited by
applicant .
Beer NR, et al; (2008) "On-chip single-copy real-time
reverse-transcription PCR in isolated picoliter droplets"; Anal
Chem 80; pp. 1854-1858. cited by applicant .
Bernath, et al; (2004) "In vitro compartmentalization by double
emulsions: sorting and gene enrichment by fluorescence activated
cell sorting"; Analytical Biochemistry 325; pp. 151-157. cited by
applicant .
Bird et al., (1988) "Single-chain antigen-binding proteins";
Science 242; pp. 423-426. cited by applicant .
Blainey PC. (2013) "The future is now: single-cell genomics of
bacteria and archaea"; FEMS microbiology reviews 37(3); pp.
407-427. cited by applicant .
Brouzes E, et al; "Droplet microfluidic technology for single-cell
high-throughput screening"; PNAS vol. 106, No. 34; Aug. 25, 2009;
pp. 14195-14200. cited by applicant .
Brown, R. B. et al: (2008) "Current techniques for single-cell
lysis"; J. R. Soc. Interface 5; pp. S131-S138. cited by applicant
.
Caron G.; (1998) "Assessment of bacterial viability status by flow
cytometry and single cell sorting"; Journal of applied microbiology
84(6): pp. 988-998. cited by applicant .
Chaffer C. L. and Weinberg R. A.; "A Perspective on Cancer Cell
Metastasis"; Science, vol. 331; Mar. 25, 2011; pp. 1559-1564. cited
by applicant .
Chabert M, et al; (2005) "Droplet fusion by alternating current
(AC) field electrocoalescence in microchannels"; Electrophoresis
26; pp. 3706-3715. cited by applicant .
Chen C-M, et al; (2000) "Influence of pH on the stability of
oil-in-water emulsions stabilized by a splittable surfactant";
Colloids and Surfaces A: Physicochemical and Engineering Aspects
170(2); pp. 173-179. cited by applicant .
Chung, C. et al; (2010) "Droplet dynamics passing through
obstructions in confined microchannel flow"; Microfluidics
Nanofluidics, 9(6), pp. 1151-1163. cited by applicant .
Clausell-Tormos, Jennifer, et al; "Droplet-based microfluidic
platforms for the encapsulation and screening of Mammalian cells
and multicellular organisms"; Chemistry and Biology 15; (May 2008);
pp. 427-437. cited by applicant .
Dejournette CJ, et al; (2013) "Creating Biocompatible Oil-Water
Interfaces without Synthesis: Direct Interactions between Primary
Amines and Carboxylated Perfluorocarbon Surfactants"; Analytical
chemistry.;85(21); pp. 10556-10564. cited by applicant .
Dietrich et al; "Effects of UV irradiation and hydrogen peroxide on
DNA fragmentation, motility and fertilizing ability of rainbow
trout (Oncorhynchus mykiss) spermatozoa"; Theriogenology. vol. 64;
(Nov. 2005) pp. 1809-1822. cited by applicant .
Duffy DC, et al; (1998) "Rapid Prototyping of Microfluidic Systems
in Poly(dimethylsiloxane)"; Anal. Chem. 70; 4974-4984. cited by
applicant .
Eastburn Dennis J., et al; (2013) "Ultrahigh-Throughput Mammalian
Single-Cell Reverse-Transcriptase Polymerase Chain Reaction in
Microfluidic Drops"; Anal. Chem. 85; pp. 8016-8021. cited by
applicant .
Eastburn DJ,et al; (2013) "Picoinjection Enables Digital Detection
of RNA with Droplet RT-PCR"; PloS one.; 8(4):e62961. cited by
applicant .
Edd et al., (2008) Controlled encapsulation of single cells into
monodisperse picoliter drop Lab on a Chip, 8(8); pp. 1262-1264.
cited by applicant .
European search report and opinion dated Feb. 8, 2016 for EP
Application No. 13829925. cited by applicant .
Frenz L, et al; (2009) "Reliable microfluidic on-chip incubation of
droplets in delay-lines"; Lab on a Chip 9(10); pp. 1344-1348. cited
by applicant .
Garstecki P. et al; "Formation of droplets and bubbles in a
microfluidic T-junction-scaling and mechanism of break-up"; Lab
Chip 6; (2006); pp. 437-446. cited by applicant .
Gevensleben H, et al; (2013) "Noninvasive Detection of HER2
Amplification with Plasma DNA Digital PCR"; Clinical Cancer
Research.;19(12); pp. 3276-3284. cited by applicant .
Grib Skov, et al; (1986) "Sigma factors from E. coli, B. subtilis,
phage SP01, and phage T4 are homologous proteins"; Nucl. Acids Res.
14(6):6745-6763. cited by applicant .
Hayward RC, et al; (2006) "Dewetting instability during the
formation of polymersomes from block-copolymer-stabilized double
emulsions"; Langmuir 22(10); pp. 4457-4461. cited by applicant
.
Herminghaus S, "Dynamical Instability of Thin Liquid Films Between
Conducting Media"; Physical Review Letter, vol. 83, No. 12; Sep.
20, 1999; pp. 2359-2361. cited by applicant .
Holland, et al; (1991) "Detection of specific polymerase chain
reaction product by utilizing the 5'--3' exonuclease activity of
Thermus aquaticus DNA polymerase"; PNAS, 88 (16); 7276-7280. cited
by applicant .
Holtze C., et al; (2008) "Biocompatible surfactants for
water-in-fluorocarbon emulsions"; Lab Chip 8; pp. 1632-1639. cited
by applicant .
Horton et al; "Gene splicing by overlap extension: tailor-made
genes using the polymerase chain reaction"; Biotechniques, vol. 54;
Mar. 1, 2013; pp. 129-133. cited by applicant .
Hu, Hoa et al; (2009) "Mutation screening in 86 known X-linked
mental retardation genes by droplet-based multiplex PCR and massive
parallel sequencing"; HUGO J.3; pp. 41-49. cited by applicant .
Huebner et al; (2008) "Microdroplets: A sea of applications?"; Lab
on a Chip, 8; pp. 1244-1254. cited by applicant .
Hunkapiller and Hood, (1986) "Immunology: The growing
immunoglobulin gene superfamily"; Nature, 323; pp. 15-16. cited by
applicant .
Hunt JA, et al; (1994) "Effect of pH on the stability and surface
composition of emulsions made with whey protein isolate"; Journal
of Agricultural and Food Chemistry.; 42(10); pp. 2131-2135. cited
by applicant .
Huston et al; (1988) "Protein engineering of antibody binding
sites: recovery of specific activity in an anti-digoxin
single-chain Fv analogue produced in Escherichia coli"; Proc. Natl.
Acad. Sci. U.S.A., 85; pp. 5879-5883. cited by applicant .
International Search Report and Written Opinion dated Feb. 21, 2014
for PCT/US2013/054517. cited by applicant .
Kawasaki (1990) "Sample Preparation From Blood, Cells, and Other
Fluids"; Chapter 18; pp. 146-152 in PCR protocols: A guide to
methods and Applications, edited by Michael A. Innis, David H.
Gelfand, John J. Sninsky, Thomas J. White. cited by applicant .
Ki, JS., et al. (2005) "Integrated method for single-cell DNA
extraction, PCR amplification, and sequencing of ribosomal DNA from
harmful Dinoflagellates Cochlodium polykrikoides and Alexandrium
catenella"; Marine Biotechnology, vol. 6; pp. 587-593. cited by
applicant .
Kiss MM, et al.(2008) "High-Throughput Quantitative Polymerase
Chain Reaction in Picoliter Droplets"; Anal Chem 80(23); pp.
8975-8981. cited by applicant .
Kritikou Ekat; "It's cheaper in the Picolab"; Nat Rev Genet, 6;
(Sep. 2005); pp. 668. cited by applicant .
Lagally ET, et al; (2001) "Single-Molecule DNA Amplification and
Analysis in an Integrated Microfluidic Device"; Analytical
Chemistry.; 73(3); pp. 565-570. cited by applicant .
Lanzavecchia et al; (1987) "The use of hybrid hybridomas to target
human cytotoxic T lymphocytes"; Eur. J. Immunol. 17(1); pp.
105-111. cited by applicant .
Leary JF. (1994) "Strategies for rare cell detection and
isolation"; Methods Cell Biol.;42(Pt B); pp. 331-358. cited by
applicant .
Lim, Shuan and Abate Adam, (2013) "Ultrahigh-throughput sorting of
microfluidic drops with flow cytometry"; Lab Chip13; pp. 4563-4572.
cited by applicant .
Link, et al; (2004) "Geometrically mediated breakup of drops in
microfluidic devices"; Phys Rev Lett. 92(5):054503. cited by
applicant .
Livak KJ and Schmittgen TD; (2001) "Analysis of Relative Gene
Expression Data Using Real-Time Quantitative PCR and the 2<
sup>--.DELTA..DELTA.CT</sup> Method"; methods.; 25(4); pp.
402-408. cited by applicant .
Longo MC, et al; (1990) "Use of uracil DNA glycosylase to control
carry-over contamination in polymerase chain reactions";
Gene.;93(1); pp. 125-128. cited by applicant .
Malloggi F, et al; "Electrowetting-controlled droplet generation in
a microfluidic flow-focusing device"; J. Phys.: Condens. Matter 19;
(2007); 462101; 7 pages. cited by applicant .
Markou Athina,et al; (2011) "Molecular Characterization of
Circulating Tumor Cells in Breast Cancer by a Liquid Bead Array
Hybridization Assay"; Clinical Chemistry 57:3; pp. 421-430. cited
by applicant .
Marcus et al., "Parallel Picoliter RT-PCR Assays Using
Microfluidics"; Analytical Chemistry, 78(3); (2006); pp. 956-958.
cited by applicant .
Mary P Pascaline, et al; "Controlling droplet incubation using
close-packed plug flow"; Biomicrofluidics 5; (2011); pp.
024101-1-024101-6. cited by applicant .
Mazutis L, et al; (2013) "Single-cell analysis and sorting using
droplet-based microfluidics"; Nature protocols.8(5); pp. 870-891.
cited by applicant .
Mcdonald, et al; (2000) "Fabrication of microfluidic systems in
poly(dimethylsiloxane"; Electrophoresis, 21(1); pp. 27-40. cited by
applicant .
Medkova, Martina et al; "Analyzing Cancer at Single Cell Resolution
with Droplet Technology"; American Association of Cancer Research
(AACR); Apr. 19, 2010; 1 page. cited by applicant .
Metzker, Michael L. "Sequencing technologies--the next generation";
Nature Reviews Genetics, vol. 11 (Jan. 2010); pp. 31-46. cited by
applicant .
Miyazaki, K; (2002) "Random DNA fragmentation with endonuclease V:
application to DNA shuffling"; Nucleic Acids Res. 30(24); e139.
cited by applicant .
Miyazaki et al. (2013) "A new large-DNA-fragment delivery system
based on integrase activity from an integrative and conjugative
element"; Appl Environ Microbiol 79(14); pp. 4440-4447. cited by
applicant .
Moon Sangjun, et al; "Drop-on-Demand Single Cell Isolation and
Total RNA Analysis"; PloS ONE, vol. 6, Issue 3; e17455 (Mar. 2011);
pp. 1-10. cited by applicant .
Morton et al; (2008) "Crossing microfluidic streamlines to lyse,
label and wash cells.dagger."; Lab on a Chip, 8(9); pp. 1448-1453.
cited by applicant .
Mui B, et al; (1993) "Osmotic properties of large unilamellar
vesicles prepared by extrusion"; Biophysical journal 64(2); pp.
443-453. cited by applicant .
Nagrath Sunitha, et al; "Isolation of rare circulating tumour cells
in cancer patients by microchip technology"; Nature 450(7173); Dec.
20, 2007; pp. 1235-1239. cited by applicant .
Nakano M, et al. (2005) "Single-molecule reverse transcription
polymerase chain reaction using water-in-oil emulsion"; J Biosci
Bioeng 99; pp. 293-295. cited by applicant .
Nikolova AN and Jones MN; (1996) "Effect of grafted PEG-2000 on the
size and permeability of vesicles"; Biochimica et Biophysica Acta
(BBA)-Lipids and Lipid Metabolism.;1304(2); pp. 120-128. cited by
applicant .
Novak, et al; (2011) "Single-cell multiplex gene detection and
sequencing with microfluidically generated agarose emulsions";
Angew Chem Int Ed Engl. 50(2):390-395. cited by applicant .
Oberholzer,Thomas, et al; (1995) "Polymerase chain reaction in
liposomes"; Chemistry & Biology vol. 2 No. 10; pp. 677-682.
cited by applicant .
O'Donovan B, et al; (2012) "Electrode-free picoinjection of
microfluidic drops"; Lab Chip 12; pp. 4029-4032. cited by applicant
.
Okochi M et al; (2010) "Droplet-based gene expression analysis
using a device with magnetic force-based-droplet-handling system";
J Biosci Bioeng. 109(2); pp. 193-197. cited by applicant .
Perry DJ; (1999) "Solid-Phase Sequencing of Biotinylated PCR
Products with Streptavidin-Coated Magnetic Beads"; Hemostasis and
Thrombosis Protocols: Springer;. p. 49-54. cited by applicant .
Piatek AS, et al; (1998) "Molecular beacon sequence analysis for
detecting drug resistance in Mycobacterium tuberculosis";. Nat
Biotechnol.16(4); pp. 359-363. cited by applicant .
Priest Craig, et al; (2006) "Controlled electrocoalescence in
microfluidics: Targeting a single lamella"; Appl Phys Lett, 89; pp.
134101-1-134101-3. cited by applicant .
Sciambi et al. (2013) "Adding reagent to droplets with controlled
rupture of encapsulated double emulsions"; Biomicrofluidics 7(4);
pp. 1-6. cited by applicant .
Scott S. H, et al; (2011) "Microfluidic immuno magnetic
multi-target sorting--a model for controlling deflection of
paramagnetic beads"; Lab Chip 11; pp. 2577-2582. cited by applicant
.
Seemann R, et al; (2012) "Droplet based microfluidics"; Rep Prog
Phys 75; pp. 016601. cited by applicant .
Shui et al; (2011) "Microfluidic DNA fragmentation for on-chip
genomic analysis" Nanotechnology 22(49): 494013. 7 pages. cited by
applicant .
Siegel Adam C,et al; (2007) "Microsolidics: Fabrication of
Three-Dimensional Metallic Microstructures in Poly(
dimethylsiloxane )"; Adv Mater 19; pp. 727-733. cited by applicant
.
Song H, et al; (2006) "Reactions in droplets in microfluidic
channels" Angew Chem Int Ed Engl 45; pp. 7336-7356. cited by
applicant .
Squires Tom M.; "Microfluidics: Fluid physics at the nanoliter
scale"; Reviews of modern physics.; 77(3); (Jul. 2005) pp.
977-1026. cited by applicant .
Stone HA, et al; (2004) "Engineering flows in small devices:
microfluidics toward a lab-on-a-chip"; Annu Rev Fluid Mech.;36; pp.
381-411. cited by applicant .
Stott Shannon L.; et al; "Isolation of circulating tumor cells
using a microvortex-generating herringbone-chip"; PNAS vol. 107,
No. 43; Oct. 26, 2010; pp. 18392-18397. cited by applicant .
Syed et al. (2009) "Next-generation sequencing library preparation:
simultaneous fragmentation and tagging using in vitro
transposition"; Nature Methods vol. 6; pp. 1-2. cited by applicant
.
Tadmor AD, et al. (2011) "Probing individual environmental bacteria
for viruses by using microfluidic digital PCR"; Science.;333(6038);
pp. 58-62. cited by applicant .
Takagi et al. (2005) "Continuous particle separation in a
microchannel having asymmetrically arranged multiple branches" Lab
Chip, 5(7); pp. 778-784. cited by applicant .
Teh SY,et al; (2008) "Droplet microfluidics"; Lab Chip 8; pp.
198-220. cited by applicant .
Tewhey Ryan, et al; "Microdroplet-based PCR enrichment for
large-scale targeted sequencing"; Nature Biotechnology, vol. 27 No.
11; (Nov. 2009); pp. 1025-1035. cited by applicant .
Thomann Y, et al; (2005) "PMMA Gradient Materials and in situ
Nanocoating via Self-Assembly of Semifluorinated Hyperbranched
Amphiphiles"; Macromolecular Chemistry and Physics.; 206(1); pp.
135-141. cited by applicant .
Thorsen T, et al; (2001) "Dynamic pattern formation in a
vesicle-generating microfluidic device"; Phys Rev Lett 86; pp.
4163-4166. cited by applicant .
Tsai Scott S. H., et al; (2011) "Microfluidic immunomagnetic
multi-target sorting--a model for controlling deflection of
paramagnetic beads"; Lab Chip 11; pp. 2577-2582. cited by applicant
.
Ullal, et al; (2014) "Cancer cell profiling by barcoding allows
multiplexed protein analysis in fine needle aspirates"; Sci Transl
Med. 6(219):219ra9; pp. 1-22. cited by applicant .
Utada, et al; (2007) "Dripping to jetting transitions in coflowing
liquid streams"; Phys Rev Lett. Aug. 31, 2007;99(9; pp.
:094502-1-094502-4. cited by applicant .
Vanapalli SA,et al; "Hydrodynamic resistance of single confined
moving drops in rectangular microchannels"; Lab Chip 9 (2009); pp.
982-990. cited by applicant .
Vickers, et al., (2006) "Generation of Hydrophilic
Poly(dimethylsiloxane) for High-Performance Microchip
Electrophoresis"; Anal. Chem, 78(21); pp. 7446-7452. cited by
applicant .
Wang C, et al; (2012) "Amphiphilic building blocks for
self-assembly: from amphiphiles to supra-amphiphiles"; Accounts of
Chemical Research 45(4); pp. 608-618. cited by applicant .
Whitcombe D, et al; (1999) "Detection of PCR products using
self-probing amplicons and fluorescence"; Nature biotechnology
17(8); pp. 804-807. cited by applicant .
Whitesides GM. (2006) The origins and the future of microfluidics.
Nature 442(7101); pp. 368-373. cited by applicant .
Xia YN, et al; (1998) "Soft lithography"; Angew Chem Int Edit 37;
pp. 551-575. cited by applicant .
Zeng Yong, et al; "High-Performance Single Cell Genetic Analysis
Using Microfluidic Emulsion Generator Arrays"; Anal Chem. 82(8);
Apr. 15, 2010; pp. 3183-3190. cited by applicant .
Zheng B, et al; (2004) "Formation of droplets of in microfluidic
channels alternating composition and applications to indexing of
concentrations in droplet-based assays"; Anal Chem 76; pp.
4977-4982. cited by applicant .
Zhong Qun, et al; (2011) "Multiplex digital PCR: breaking the one
target per color barrier of quantitative PCR"; Lab Chip 11; pp.
2167-2174. cited by applicant .
Zhu et al., (2001) "Reverse transcriptase template switching: a
SMART approach for full-length cDNA library construction";
BioTechniques 30: pp. 892-897. cited by applicant .
Zhu Z, et al (2012) "Highly sensitive and quantitative detection of
rare pathogens through agarose droplet microfluidic emulsion PCR at
the single-cell level"; Lab on a Chip 12(20); pp. 3907-3913. cited
by applicant .
Zien TF; (1969) "Hydrodynamics of bolus flow--an analytical
approach to blood flow in capillaries"; Math Biophys, 31; pp.
681-694. cited by applicant .
EmPCR-amplificationmanual for GS-FLX series (May 2011). cited by
applicant .
Extended European Search Report received for European Patent
Application Serial No. 15812857.9 dated Oct. 17, 2017, 7 pages.
cited by applicant .
Extended European Search Report received for European Patent
Application Serial No. 15853268.9 dated Sep. 3, 2018, 12 pages.
cited by applicant .
Extended European Search Report received for European Patent
Application Serial No. 16747224.0 dated May 24, 2018, 9 pages.
cited by applicant .
Extended European Search Report received for European Patent
Application Serial No. 16747229.9 dated Sep. 10, 2018, 8 pages.
cited by applicant .
Extended European Search Report received for European Patent
Application Serial No. 16837703.4 dated Nov. 29, 2018, 9 pages.
cited by applicant .
First search received for Chinese Patent Application Serial No.
2013800532581 dated Feb. 22, 2016, 2 pages. cited by applicant
.
First search received for Chinese Patent Application Serial No.
2015800704110 dated Dec. 13, 2018, 2 pages. cited by applicant
.
International Preliminary Report on Patentability received for PCT
Application Serial No. PCT/US2013/054517 dated Feb. 26, 2015, 14
pages. cited by applicant .
International Preliminary Report on Patentability received for PCT
Application Serial No. PCT/US2015/037822 dated Jan. 5, 2017, 7
pages. cited by applicant .
International Preliminary Report on Patentability received for PCT
Application Serial No. PCT/US2015/056743 dated May 4, 2017, 9
pages. cited by applicant .
International Preliminary Report on Patentability received for PCT
Application Serial No. PCT/US2016/016438 dated Aug. 17, 2017, 10
pages. cited by applicant .
International Preliminary Report on Patentability received for PCT
Application Serial No. PCT/US2016/016444 dated Aug. 17, 2017, 40
pages. cited by applicant .
International Preliminary Report on Patentability received for PCT
Application Serial No. PCT/US2016/047199 dated Mar. 1, 2018, 8
pages. cited by applicant .
International Preliminary Report on Patentability received for PCT
Application Serial No. PCT/US2017/046159 dated Feb. 21, 2019, 9
pages. cited by applicant .
International Preliminary Report on Patentability received for PCT
Application Serial No. PCT/US2017/068006 dated Jul. 4, 2019, 7
pages. cited by applicant .
International Search Report and Written Opinion received for PCT
Application Serial No. PCT/US2015/037822 dated Feb. 2, 2016, 9
pages. cited by applicant .
International Search Report and Written Opinion received for PCT
Application Serial No. PCT/US2015/056743 dated Mar. 3, 2016, 12
pages. cited by applicant .
International Search Report and Written Opinion received for PCT
Application Serial No. PCT/US2016/016438 dated Jun. 10, 2016, 14
pages. cited by applicant .
International Search Report and Written Opinion received for PCT
Application Serial No. PCT/US2016/016444 dated Jul. 27, 2016, 43
pages. cited by applicant .
International Search Report and Written Opinion received for PCT
Application Serial No. PCT/US2016/047199 dated Dec. 12, 2016, 10
pages. cited by applicant .
International Search Report and Written Opinion received for PCT
Application Serial No. PCT/US2017/046159 dated Nov. 21, 2017, 12
pages. cited by applicant .
International Search Report and Written Opinion received for PCT
Application Serial No. PCT/US2017/068006 dated Mar. 26, 2018, 10
pages. cited by applicant .
Rolando, Monica , et al., "Legionella pneumophila Effector RomA
Uniquely Modifies Host Chromatin to Repress Gene Expression and
Promote Intracellular Bacterial Replication", Cell Host &
Microbe, vol. 13(4), Apr. 17, 2013, 395-405. cited by applicant
.
Gong, Jian, et al., Characterization and Design of Digitizing
Processess for uniform and controllable droplet volume in ewod
Digital Microfluidics, Solid-State Sensor, Actuator and Microsystem
Workshop, Jun. 5, 2006, (Year: 2006). cited by applicant .
Kumaresan P, Yang CJ, Cronier SA, Blazej RG, Mathies RA,
High-throughput single copy DNA amplification and cell analysis in
engineered nanoliter droplets. Analytical chemistry, May 15, 2008;
80(10):3522-9, (Year:2008). cited by applicant .
Pekin D, Skhiri Y, Baretjc, Le Corre D, Mazutis L, Ben Salem C,
Millot F, El Harrak A, Hutchison JB, Larson JW, Link DR,
Laurent-Pulg P, Griffiths AD, Taly V (2011) Lab Chip 11:2156-2166
(Year: 2011). cited by applicant .
Demaree et al, (2018) "An Ultranigh-throughput Microfluidic
Platform for Single-cell Genome Sequencing", Journal of Visualized
Experiments, No. 135. cited by applicant .
Freeman et al, (2017) "Single-cell genome sequencing at
ultra-high-throughput with microfluidic droplet barcoding.
(includes Online Methods)", Nature Biotechnology, vol. 35, No. 7,
pp. 640-646. cited by applicant .
Rakszewska et al, (2014) "One drop at a time: toward droplet
microfluidics as a versatile tool for single-cell analysis", NPG
Asia Materials, vol. 6, No. 10, pp. 1-11. cited by applicant .
Shembekar et al, (2016) "Droplet-based microfluidics in drug
discovery, transcriptomics and high-throughput molecular genetics",
Lab on a Chip, vol. 16, No. 8, pp. 1314-1331. cited by applicant
.
Ichii, Tetsuo , et al., "Amplification of RNA in Growing and
Dividing Micro-Droplets", 14th International Conf on Miniaturized
Systems for Chemistry and Life Sciences, 2010, 2089-2091. cited by
applicant .
Lim, Shaun W., et al., "Ultrahigh-throughput sorting of
microfluidic drops with flow cytometry", Lab Chip, 2013, vol. 13,
pp. 4563-4572. cited by applicant .
Caruccio, et al., "Preparation of next-generation sequencing
libraries using Nextera.TM. technology: simultaneous DNA
fragmentation and adaptor tagging by in vitro transposition",
Methods in Molecular Biology, 2011, vol. 733, pp. 241-255. cited by
applicant .
Hindson, et al., "High-throughput droplet digital PCR system for
Absolute Quatitation of DN A copy number", Analytical chemistry,
83(22), 2011, 8604-8610. cited by applicant .
Le Goff, et al., "Hydrogel microparticles for biosensing", Eur
Polym J., 2015, vol. 72,, 49 pages. cited by applicant .
Integrated DNA Technologies "Molecular Facts and Figures", 2011,
1-9. cited by applicant .
Lage, J. M., et al., "Whole Genome Analysis of Genetic Alterations
in Small DNA Samples Using Hyperbranched Strand Displacement
Amplification and Array-CGH", Genome Res., 13, 2003, 294-307. cited
by applicant .
Spencer, Sarah J., et al., "Massively parallel sequencing of single
cells by epicPCR links functional genes with phylogenetic markers",
The ISME Journal 10, 2016, 427-436. cited by applicant.
|
Primary Examiner: Horlick; Kenneth R
Attorney, Agent or Firm: Baba; Edward J. Bozicevic, Field
& Francis LLP
Government Interests
GOVERNMENT SUPPORT
This invention was made with government support under grant nos.
HG007233 and AR068129, awarded by the National Institutes of
Health, and grant no. DBI1253293, awarded by the National Science
Foundation. The government has certain rights in the invention.
Parent Case Text
CROSS-REFERENCE TO RELATED APPLICATIONS
This application is a continuation of U.S. application Ser. No.
16/164,707, filed Oct. 18, 2018, which application is a
continuation of U.S. application Ser. No. 14/420,646, now U.S. Pat.
No. 10,161,007, which application is a 35 U.S.C. .sctn. 371
national stage entry of International Application No.
PCT/US2013/054517, filed Aug. 12, 2013, which application claims
priority to U.S. Provisional Application No. 61/682,707, filed Aug.
13, 2012; and to U.S. Provisional Application No. 61/784,754, filed
Mar. 14, 2013; which applications are incorporated by reference
herein in their entireties and for all purposes.
Claims
What is claimed is:
1. A system to synthesize a target polynucleotide, comprising: a
first microfluidic device configured to contact a
polynucleotide-containing component from a sample with lysis
reagents to form a first droplet, the lysis reagents comprising an
enzyme having protease activity, wherein the first droplet is
encapsulated with an immiscible carrier fluid; a collection
reservoir interposed between the first microfluidic device and a
second microfluidic device, the collection reservoir positioned to
receive the first droplet from the first microfluidic device and
incubate the first droplet for a first duration sufficient to
inactivate the enzyme, the second microfluidic device fluidically
coupled to the collection reservoir, the second microfluidic device
configured to receive the first droplet and add nucleic acid
synthesis reagent to form a second nucleic acid synthesis droplet
in the immiscible carrier fluid; and a reaction chamber fluidically
coupled to the second microfluidic device, the reaction chamber
configured to synthesize the target polynucleotide within the
second nucleic acid synthesis droplet; wherein the first and the
second device are discrete.
2. The system of claim 1, wherein each of the first microfluidic
device and the second microfluidic device is formed as separate
entities on a microfluidic chip.
3. The system of claim 2, wherein the collection reservoir is
segregated from the microfluidic chip.
4. The system of claim 3, wherein the collection reservoir receives
the first droplet for the first duration to inactivate the
enzyme.
5. The system of claim 2, wherein the reaction chamber is
segregated from the microfluidic chip and configured to synthesize
the target polynucleotide within the second nucleic acid synthesis
droplet.
6. The system of claim 1, wherein the collection reservoir is
integrated with the first microfluidic device and wherein the
reaction chamber is integrated with the second microfluidic
device.
7. The system of claim 1, wherein the first duration is a period
longer than necessary for cell lysis.
8. The system of claim 1, wherein the collection reservoir is
configured to incubate the first droplet and the enzyme having
protease activity at a temperature to inactivate the enzyme having
protease activity.
9. The system of claim 1, wherein the first microfluidic device is
further configured to receive and add a plurality of nucleic acid
synthesis reagents to the first droplet.
10. The system of claim 1, wherein the second nucleic acid
synthesis droplet has a volume of 0.001 to 1000 picoliters.
11. The system of claim 1, wherein the second nucleic acid
synthesis droplet has a diameter of between 0.1 microns to 1000
microns.
12. The system of claim 1, wherein the second microfluidic device
further comprises: one or more channels configured to contact the
lysis reagents with a continuous stream of fluid comprising the
nucleic acid synthesis reagent and form the second nucleic acid
synthesis droplet from a portion of the continuous stream of
fluid.
13. The system of claim 1, further comprising a detector to detect
the target polynucleotide by determining a sequence of a nucleic
acid synthesis product of the nucleic acid synthesis droplet.
14. The system of claim 1, further comprising a detector to detect
the target polynucleotide, wherein the system is configured to form
a double-emulsion, the double emulsion including the nucleic acid
synthesis droplet within an outer droplet, and sort the
double-emulsion based on at least one of droplet size and
fluorescence.
Description
INTRODUCTION
Biological samples from a subject often contain a large number of
different components. For example, a sample of a subject's blood
may contain free floating DNA and RNA, circulating cells, and many
other components. The number and diversity of such components in a
biological sample often complicates or prevents the accurate
identification and/or quantification of specific components of
interest within the sample, which would enable the diagnosis or
monitoring of a condition in the subject, such as cancer.
For instance, circulating tumor cells (CTCs) are cells shed from
tumors that enter into a subject's blood stream. Once in the blood,
these cells can circulate through the subject's body, where they
can invade other tissues and grow new tumors. CTCs are thus
implicated in metastasis, which is the primary cause of death in
subjects with cancer. Efforts to count CTCs have been hampered by
the fact that CTCs are extremely difficult to detect: they are
exceptionally rare, and may be difficult to distinguish from
healthy cells. Current approaches for detecting CTCs rely on
immunoassays, in which antibodies are used to target specific
biomarkers on the surfaces of the CTCs. However, such approaches
have limitations in sensitivity and/or specificity, leading to many
healthy cells being mischaracterized as cancerous, and many cancer
cells being missed in the analysis.
SUMMARY
Methods for the detection of components from biological samples are
provided. In certain aspects, the methods may be used to detect
and/or quantify specific components in a biological sample, such as
tumor cells (e.g., circulating tumor cells, or CTCs). Systems and
devices for use in practicing methods of the invention are also
provided.
Methods of the present disclosure include methods for the detection
of cells in a biological sample, such as tumor cells. Using
microfluidics, components of the biological sample may be
encapsulated into microdroplets, which are tiny spheres of solution
generally ranging from 0.1 to 1000 .mu.m in diameter, which may be
used to encapsulate cells, polynucleotides, polypeptides, and other
components. The components encapsulated in each microdroplet may be
assayed, as described more fully herein.
Aspects of the methods may include encapsulating in a microdroplet
a cell obtained from a subject's blood sample, wherein at least one
cell is present in the microdroplet; lysing the cell; introducing
polymerase chain reaction (PCR) reagents, a detection component,
and a plurality of PCR primers into the microdroplet and incubating
the microdroplet under conditions allowing for PCR amplification to
produce PCR amplification products, wherein the plurality of PCR
primers include one or more primers that hybridizes to one or more
oligonucleotides (e.g., oncogenes); and detecting the presence or
absence of the PCR amplification products by detection of the
detection component, wherein detection of the detection component
indicates the presence of PCR amplification products. In certain
aspects, the step of lysing the cell involves introducing a lysing
agent into the microdroplet and incubating the microdroplet under
conditions effective for cell lysis. The methods may include
determining the number of circulating tumor cells (CTCs) present in
a sample of the subject's blood, based at least in part on the
number of microdroplets in which PCR products were detected. In
other aspects, the methods may include determining the number of
tumor cells present in a solid tissue sample from the subject,
based at least in part on the number of microdroplets in which PCR
products were detected.
In other aspects, the methods for the detection of cells include
encapsulating a plurality of cells in a plurality of microdroplets
under conditions in which a majority of microdroplets contain zero
or one cell, wherein the plurality of cells are obtained from a
subject's blood sample; enriching the plurality of microdroplets
for microdroplets containing one cell; lysing the cell; introducing
polymerase chain reaction (PCR) reagents, a detection component,
and a plurality of PCR primers into the plurality of microdroplets
and incubating the plurality of microdroplets under conditions
allowing for PCR amplification to produce PCR amplification
products, wherein the plurality of PCR primers include one or more
primers that each hybridize to one or more oligonucleotides (e.g.,
oncogenes); detecting the presence or absence of the PCR
amplification products by detection of the detection component,
wherein detection of the detection component indicates the presence
of the PCR amplification products; and determining the number of
cells present in the sample of the subject's blood based at least
in part on the number of microdroplets in which the PCR
amplification products were detected; wherein one or more steps are
performed under microfluidic control. In certain aspects, the cells
are tumor cells, and the plurality of PCR primers include one or
more primers that each hybridize to one or more oncogenes. The step
of lysing the cell may involve introducing a lysing agent into the
microdroplet and incubating the microdroplet under conditions
effective for cell lysis.
Methods of the present disclosure also include methods for
genotyping cells, including tumor cells. In certain aspects, the
methods for genotyping cells include encapsulating in a
microdroplet a cell obtained from a biological sample from the
subject, wherein one cell is present in the microdroplet;
introducing a lysing agent into the microdroplet and incubating the
microdroplet under conditions effective for cell lysis; introducing
polymerase chain reaction (PCR) reagents and a plurality PCR
primers into the microdroplet, and incubating the microdroplet
under conditions allowing for PCR amplification to produce PCR
amplification products; introducing a plurality of probes into the
microdroplet, wherein the probes hybridize to one or more mutations
of interest and fluoresce at different wavelengths; and detecting
the presence or absence of specific PCR amplification products by
detection of fluorescence of a probe, wherein detection of
fluorescence indicates the presence of the PCR amplification
products; wherein one or more of steps are performed under
microfluidic control. The plurality of probes may include one or
more TaqMan.RTM. probes.
Methods of the present disclosure also include methods for the
detection of cancer, the methods including encapsulating in a
microdroplet oligonucleotides obtained from a biological sample
from the subject, wherein at least one oligonucleotide is present
in the microdroplet; introducing polymerase chain reaction (PCR)
reagents, a detection component, and a plurality of PCR primers
into the microdroplet and incubating the microdroplet under
conditions allowing for PCR amplification to produce PCR
amplification products, wherein the plurality of PCR primers
include one or more primers that each hybridize to one or more
oncogenes; and detecting the presence or absence of the PCR
amplification products by detection of the detection component,
wherein detection of the detection component indicates the presence
of the PCR amplification products. The detection of cancer in the
subject may be based upon the presence of PCR amplification
products for one or more oncogenes.
In other aspects, the methods of the present disclosure include
encapsulating in a microdroplet an oligonucleotide obtained from a
biological sample obtained from a subject, wherein at least one
oligonucleotide is present in the microdroplet; introducing
polymerase chain reaction (PCR) reagents, a detection component,
and a plurality of PCR primers into the microdroplet and incubating
the microdroplet under conditions allowing for PCR amplification to
produce PCR amplification products; and detecting the presence or
absence of the PCR amplification products by detection of the
detection component, wherein detection of the detection component
indicates the presence of PCR amplification products; wherein one
or more steps are performed under microfluidic control.
In practicing the subject methods, several variations may be
employed. For example, a wide range of different PCR-based assays
may be employed, such as quantitative PCR (qPCR). The number and
nature of primers used in such assays may vary, based at least in
part on the type of assay being performed, the nature of the
biological sample, and/or other factors. In certain aspects, the
number of primers that may be added to a microdroplet may be 1 to
100 or more, and/or may include primers to detect from about 1 to
100 or more different genes (e.g., oncogenes). In addition to, or
instead of, such primers, one or more probes (e.g., TaqMan.RTM.
probes) may be employed in practicing the subject methods.
The microdroplets themselves may vary, including in size,
composition, contents, and the like. Microdroplets may generally
have an internal volume of about 0.001 to 1000 picoliters or more.
Further, microdroplets may or may not be stabilized by surfactants
and/or particles.
The means by which reagents are added to a microdroplet may vary
greatly. Reagents may be added in one step or in multiple steps,
such as 2 or more steps, 4 or more steps, or 10 or more steps. In
certain aspects, reagents may be added using techniques including
droplet coalescence, picoinjection, multiple droplet coalescence,
and the like, as shall be described more fully herein. In certain
embodiments, reagents are added by a method in which the injection
fluid itself acts as an electrode. The injection fluid may contain
one or more types of dissolved electrolytes that permit it to be
used as such. Where the injection fluid itself acts as the
electrode, the need for metal electrodes in the microfluidic chip
for the purpose of adding reagents to a droplet may be obviated. In
certain embodiments, the injection fluid does not act as an
electrode, but one or more liquid electrodes are utilized in place
of metal electrodes.
Various ways of detecting the absence or presence of PCR products
may be employed, using a variety of different detection components.
Detection components of interest include, but are not limited to,
fluorescein and its derivatives; rhodamine and its derivatives;
cyanine and its derivatives; coumarin and its derivatives; Cascade
Blue and its derivatives; Lucifer Yellow and its derivatives;
BODIPY and its derivatives; and the like. Exemplary fluorophores
include indocarbocyanine (C3), indodicarbocyanine (C5), Cy3, Cy3.5,
Cy5, Cy5.5, Cy7, Texas Red, Pacific Blue, Oregon Green 488, Alexa
fluor-355, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa
Fluor-555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 647, Alexa
Fluor 660, Alexa Fluor 680, JOE, Lissamine, Rhodamine Green,
BODIPY, fluorescein isothiocyanate (FITC), carboxy-fluorescein
(FAM), phycoerythrin, rhodamine, dichlororhodamine (dRhodamine),
carboxy tetramethylrhodamine (TAMRA), carboxy-X-rhodamine (ROX),
LIZ, VIC, NED, PET, SYBR, PicoGreen, RiboGreen, and the like.
Detection components may include beads (e.g., magnetic or
fluorescent beads, such as Luminex beads) and the like. In certain
aspects, detection may involve holding a microdroplet at a fixed
position during thermal cycling so it can be repeatedly imaged.
Such repeated imaging may involve the use of a Megadroplet Array,
as shall be described more fully herein. In certain aspects,
detection may involve fixing and/or permeabilizing one or more
cells in one or more microdroplets.
Suitable subjects for the methods disclosed herein include mammals,
e.g., humans. The subject may be one that exhibits clinical
presentations of a disease condition, or has been diagnosed with a
disease. In certain aspects, the subject may be one that has been
diagnosed with cancer, exhibits clinical presentations of cancer,
or is determined to be at risk of developing cancer due to one or
more factors such as family history, environmental exposure,
genetic mutation(s), lifestyle (e.g., diet and/or smoking), the
presence of one or more other disease conditions, and the like.
Microfluidic systems and devices are also provided by the present
disclosure. In certain aspects, the microfluidic devices include a
cell loading region to encapsulate a cell to be analyzed in a
microdroplet; a first chamber in fluidic communication with the
cell loading region, the first chamber having a means for adding a
first reagent to the microdroplet, and a heating element; a second
chamber in fluidic communication with the first chamber, the second
chamber having a means for adding a second reagent to the
microdroplet, and a heating element, wherein the heating element
may heat the microdroplet at one or more temperatures; and a
detection region, in fluidic communication with the second chamber,
which detects the presence or absence of reaction products from the
first or second chamber.
BRIEF DESCRIPTION OF THE DRAWINGS
The invention may be best understood from the following detailed
description when read in conjunction with the accompanying
drawings. Included in the drawings are the following figures:
FIG. 1 is a simplified depiction of a microfluidic system of the
instant disclosure. In the depicted system, the microfluidic system
may be used for detecting and/or genotyping a component of a
biological sample. As applied to the detection of tumor cells in
this particular system, nucleated blood cells are encapsulated into
individual droplets using an encapsulation device (left). The
droplets are injected with a lysis buffer and incubated at
37.degree. C. to accelerate cell lysis. They are injected with PCR
mix containing primers targeting characteristic oncogenic mutations
(center). The droplets are flowed through a channel snaking over
zones maintained at 65.degree. C. and 95.degree. C. As the droplets
move through the zones, their temperature cycles, as needed for
PCR. During this PCR reaction, if a droplet contains a genome of a
tumor cell with a mutation for which the primers are designed to
detect, amplification will be initiated, producing a fluorescent
output that turns the droplet fluorescent. The droplets are then
optically scanned using flow cytometry and sorted using droplet
sorting to recover them (right). The droplets may be stored or used
for further analysis, such as being subjected to sequencing (e.g.,
used as input for a next-gen sequencer, or provided to a sequencing
facility).
FIG. 2, Panels A-E depict single cells enclosed in microdroplets,
using a fluorescence assay. Yeast cells (black specks) enter from
the far left and are encapsulated into drops, shown at low
(4.times. objective; Panel A) and high magnification (10.times.
objective; Panel B). The drops are incubated to allowing the yeast
to secrete their product (Panel C); this produces a fluorescent
compound in the drops, so that drops containing efficient producers
quickly become fluorescent (Panel D). The drops are then sorted to
extract the most efficient yeast using a microfluidic sorter (Panel
E). The scale bars denote 80 mm.
FIG. 3 depicts digital detection of BRAF using a TaqMan.RTM. PCR
probe labeled with the fluorophore FAM that is complementary to an
amplicon from a portion of the human BRAF gene. Fluorescent drops
indicate amplification of the BRAF gene from purified human genomic
DNA, while non-fluorescent drops were devoid of the gene.
FIG. 4, Panels A-B depict a binary PCR reaction to detect CTCs.
Panel A: Forward and reverse primers are encapsulated in the drops
that target an oncogenic sequence. If the oncogenic sequence is
present, the PCR reaction produces double-stranded PCR products
(Panel A, upper), whereas, if it is not, no products are produced
(Panel A, lower). An intercalating stain (e.g., SybrGreen) may also
be present in the drop. Panel B: If double-stranded products are
produced, the dye intercalates into them, becoming fluorescent, and
turning the drop fluorescent (Panel B, upper); by contrast, if no
double-stranded products are produced, the dye remains
non-fluorescent, producing a dim drop (Panel B, lower).
FIG. 5 is an optical microscopy image of massively parallel drop
formation in a serial bisection device. DI water that does not
contain cells is injected from the left. The solution flowing in
along the top and bottom arrows is HFE-7500 fluorocarbon oil with a
fluorocarbon surfactant at 2% by weight. After serial bisection,
the resulting drops shown to the far right are 25 .mu.m in
diameter.
FIG. 6 is a schematic microfluidic device and data showing
procedure for droplet-based detection of CTCs. Blood cells and rare
CTCs are encapsulated in microdrops with lysis buffer containing
Proteinase K. The drops are incubated at 55.degree. C. to lyse
cells and digest cellular proteins. Drops are then split to a size
optimal for imaging, and the Proteinase K is heat-inactivated. The
drops are then picoinjected with PCR reagents and TaqMan.RTM.
probes, followed by thermocycling and imaging on a Megadroplet
Array. CTCs are identified based on the presence of CTC-specific
transcripts, detected by multiplexed TaqMan.RTM. probe
fluorescence.
FIG. 7 shows relief of cell lysate-mediated inhibition of RT-PCR by
proteinase K treatment. Increasing concentrations of cells were
either treated with proteinase K and lysis buffer or lysis buffer
only. Cells were then incubated at 55.degree. C. followed by
95.degree. C. Whole cell lysates were added directly to RT-PCR
reactions at several drop relevant concentrations. Strong relief of
lysate inhibition on PCR was seen at final cell concentrations of 1
cell per 200 pL in Proteinase K treated lysates but not in lysis
buffer only lysates. PCR products are visualized on an ethidium
bromide stained agarose gel.
FIG. 8, Panels 1-3 show an integrated microfluidic system for cell
encapsulation/dilution, lysis and drop splitting (center image).
Panel 1: Co-flow module relies on laminar flow of Proteinase K
containing lysis buffer and cell suspension solutions to
encapsulate cells in drops without premature lysis or mixing of
cells prior to drop formation; a laminar flow boundary is just
visible between the cell and lysis buffer streams. Panel 2: Drops
containing cells flow through a 55.degree. C. incubation channel
for 20 minutes to lyse cells and digest inhibitory proteins. Panel
3: Drops are split to allow for efficient picoinjection of
2.times.RT-PCR reagents and imaging on the droplet array
FIG. 9, Panels A-C show TaqMan.RTM. RT-PCR in drops following
picoinjection. Drops containing a limiting dilution of total RNA
from the prostate cancer cell line PC3 were injected with an equal
volume of 2.times.RT-PCR reagents and a TaqMan.RTM. probe targeting
EpCAM, (Panel A). Following picoinjection, drops were thermocycled
and imaged for fluorescence, (Panel B). The number of fluorescent
drops was found to be in agreement with the prediction of a Poisson
distribution, demonstrating adequate sensitivity to detect single
transcript molecules in drops. Panel C: To further confirm the
results, the drops from Panel B were chemically ruptured and their
contents run on an agarose gel to observe the presence of PCR
products in negative control drops that were injected without
RT-PCR enzymes (-) and experimental drops that received both RT and
Taq (+). Both control reactions performed in a tube with no
picoinjection and picoinjected reactions produced bands of similar
intensity, demonstrating that the reaction efficiency was
comparable. White stars mark picoinjected drops.
FIG. 10 shows detection of EpCAM transcripts from droplet
encapsulated MCF7 breast cancer cells. Using the device depicted in
FIG. 8, Panels 1-3, MCF7 cells were encapsulated in drops, lysed
and drops were split. Lysate containing drops were then
picoinjected with RT-PCR reagents and TaqMan.RTM. probes. Drops
were then thermocycled and imaged for fluorescence. Brightfield and
fluorescent channels are shown merged.
FIG. 11 depicts digital droplet RT-PCR multiplexing with
TaqMan.RTM. probes. Limiting dilutions of total RNA from both Raji
cells (B-lymphocytes) and PC3 prostate cancer cells were
encapsulated in drops together with RT-PCR reagents and TaqMan.RTM.
probes specific to CD45 (blue), CD44 (red) and EpCAM (green).
Orange drops indicate the presence of both CD44 and EpCAM
transcripts detected by a multiplex reaction. Other probe
multiplexing combinations have also been seen (data not shown).
Fluorescent channels are shown individually as a magnified inset
for the dashed box region.
FIG. 12, Panels A-C show a schematic illustration of a device for
performing multiplexed qPCR analysis on cells individually. The
device consists of an array of about 10 million traps indented into
a PDMS channel that sits above a thermal system (Panel A). The
height of the microfluidic channel is smaller than the diameter of
the drops, causing drops to adopt a flattened pancake shape. When a
drop flows over an unoccupied indentation, it adopts a lower, more
energetically favorable, radius of curvature, leading to a force
that pulls the drop entirely into the trap (Panel B). By flowing
drops as a close pack, it is ensured that all traps on the array
are occupied, as illustrated in Panel C. The entire device is
thermal cycled and imaged between cycles using a microarray
scanner.
FIG. 13 depicts a Megadroplet Array for multiplexed qPCR analysis,
of the type depicted in FIG. 12, Panels A-C. Drops are pipetted and
sealed in a clear glass/epoxy chamber and fixed in place using a
microfabricated well array (top). The entire chip is clamped to a
metal block and thermocycled using Peltier heaters under the copper
blocks. Thermometers, a heat sink, a fan (top), and digital
controllers are used to regulate and cycle the temperature
(bottom). Amplification is monitored in real time by imaging the
array through the transparent plates that make up the top of the
device.
FIG. 14, Panels A-B depict the use of a one-color flow-cytometer
used to detect PCR amplification products in drops, via
fluorescence. Panel A: Schematic of detector, consisting of a 488
nm laser directed into the back of an objective, and focused onto a
microfluidic channel through which the droplets flow. The laser
excites fluorescent dyes within the drops, and any emitted light is
captured by the objective and imaged onto a photomultiplier tube
(PMT) after it is filtered through a dichroic mirror and 520.+-.5
nm band pass filter. Panel B: The drops appear as peaks in
intensity as a function of time, as shown by the output voltage of
a PMT, which is proportional to the intensity of the emitted light,
as a function of time for detected fluorescent drops.
FIG. 15, Panels A-C show a schematic of device setup. Panel A:
Drops, spacer oil, and 1 M NaCl are introduced to the PDMS device
via syringe pumps. The picoinjection fluid is introduced using an
air pressure control pump. Electrodes from the high voltage
amplifier are connected to a wire submerged in the picoinjection
fluid and to the metal needle of the syringe containing the 1 M
NaCl "Faraday Mote." Panel B: A magnified view of the droplet
spacer and picoinjection site. Panel C: Further magnified view of
the picoinjection site showing the fluid bulge at the injection
orifice.
FIG. 16, Panels A-B show bright field microscopy images of the
picoinjection site. In the absence of an electric field (Panel A),
surfactants prevent coalescence with the injection fluid and a
distinct boundary is visible at the droplet/injection fluid
interface. When the electric field is applied, the boundary
disappears and reagent is injected as the droplet passes (Panel
B).
FIG. 17, Panels A-C show the volume fraction increase (Vf) of drop
size after injection for (Panel A) 100 mM, (Panel B) 50 mM, and
(Panel C) 25 mM injection fluids. A stronger electric field more
readily ruptures the oil/water interfaces allowing injection over a
larger length of the passing droplets, and larger injection
volumes. Higher molarities of dissolved electrolytes produce
stronger electric fields at the injection site for a given voltage,
also increasing injection volume. The error bars represent 1
standard deviation in either direction for >1200 drops sampled
at each point.
FIG. 18 is a heat map showing injection volume as a function of
applied voltage and the molarity of dissolved NaCl in the injection
fluid. Arrows/ticks indicate data points. The injection volume can
be adjusted in the range of 0-36 pL with a resolution of .about.2.6
pL 5 (4% Vf) with 100V increments of the applied signal. The
largest injected volumes were 3000 V with the 100 mM fluid.
Increasing electric field above this allows for electrowetting,
causing drops to spontaneously form at the picoinjector, adversely
affecting injection efficacy and consistency.
FIG. 19 shows ethidium bromide stained 2% agarose gel. Total RNA
isolated from an MCF7 human cell line was encapsulated in drops and
picoinjected with an RT-PCR reaction mixture either with (+) or
without 50 (-) reverse transcriptase (RT) and Taq DNA polymerase.
Non-emulsified control reactions were performed in parallel. Only
reactions receiving enzyme generated the expected 100 bp amplicon.
Both positive control and picoinjected reactions produced PCR
products, demonstrating that the electric field generated during
picoinjection is 55 biologically compatible with DNA, reverse
transcriptase, and Taq.
FIG. 20, Panels A-B show adding reagents via multiple droplet
coalescence. Panel A: A schematic of a microfluidic device for
adding reagents via multiple droplet coalescence. The reagent to
add is introduced from below, along with oil, into a very small
drop maker. This leads to the production of a train of very small
drops at a high frequency. The drops to which the reagent is to be
added are injected, spaced by oil, from the left and then the
streams combine where the channel intersects with the outlet of the
tiny drop maker. Because the reagent drops are much smaller than
the target drops, they are introduced at a high rate frequency, and
so many (tens or more) of these drops are injected for every one
target drop. Due to their small size they flow faster than the
larger drops and collect behind them so that, by the time the reach
the electrode channels they are in contact and can be coalesced by
the electric field. Panel B: Close-up of the coalescence region in
such a microfluidic device. Drops flow from left to the right. A
train of tiny droplets form behind the droplet to which they are to
be added. Once the tiny droplets and the droplet pass through the
coalescence region, the electrodes cause the tiny droplets to merge
into the droplet. The resulting output on the right is a droplet
that contains the reagent(s) that were present in the tiny
droplets.
FIG. 21 shows a schematic of a microfluidic device whereby a
microdroplet may be purified. That is, a majority of the fluid in
the drop is replaced it with a purified solution, without removing
any discrete reagents that may be encapsulated in the drop, such a
cells or beads. The microdroplet is first injected with a solution
to dilute any impurities within it. The diluted microdroplet is
then flowed through a microfluidic channel on which an electric
field is being applied using electrodes. Due to the
dielectrophoretic forces generated by the field, as the cells or
other discrete reagents pass through the field they will be
displaced in the flow. The drops are then split, so that all the
objects end up in one microdroplet. Accordingly, the initial
microdroplet has been washed, in that the contaminants may be
removed while the presence and/or concentration of discrete
reagents, such as beads or cells, that may be encapsulated within
the droplet are maintained in the resulting microdroplet.
FIG. 22, Panels A-B show sorting. Droplets enter from the right and
flow to the left, passing by the electrodes. The drops are thus
sorted on the presence (Panel A; droplets flow into the top output)
or absence of a particular property (Panel B; droplets flow into
the bottom output).
FIG. 23 shows a schematic of a coalescence process, starting with
the formation of double emulsions (E2) from a reinjected single
emulsion (E1) in a hydrophilic channel (top, left). These are
turned into triple emulsions (E3) at a hydrophobic junction
(bottom, left), which are then coalesced using an electric field
into an inverted E2 (E2', bottom, right).
FIG. 24, Panels A-D show microscope images of (a) double emulsions
(E2) formation, (b) triple emulsion (E3) formation, (c) E3
coalescence, and (d) the final inverted E2 (E2') products. The
scale bar applies to all images.
FIG. 25, Panels A-B show two fast-camera time series showing E3
coalescence into E2'. The oil shell of the inner E1 is
false-colored blue.
FIG. 26, Panels A-C show microfluidic devices and digital RT-PCR
workflow used in the study of Example 5. (A) Drops containing RNA
and RT-PCR reagents are created with a microfluidic T-junction and
carrier oil. Brightfield microscopy images of the drop formation
are shown below, the middle image showing the generation of one
population of drops from a single reaction mixture, and the lower
the generation of two populations from two mixtures. (B) After
formation, the drops are picoinjected with reverse transcriptase
using a picoinjection channel triggered by an electric field,
applied by an electrode channel immediately opposite the
picoinjector. (C) The picoinjected drops are collected into a tube,
thermocycled, and imaged with a fluorescent microscope.
FIG. 27, Panels A-C show digital RT-PCR TaqMan.RTM. assays in
microfluidic drops following picoinjection of reverse
transcriptase. (A) Control RT-PCR reactions containing PC3 cell
total RNA were emulsified on a T-junction drop maker, thermocycled,
and imaged. FAM (green) fluorescence indicates TaqMan.RTM.
detection of an EpCAM transcript and Cy5 (red) indicates detection
of CD44 transcripts. Brightfield images (BF) of the same drops are
shown in the image panel on the far right. (B) RT-PCR reactions
lacking reverse transcriptase were emulsified on a T-junction drop
maker and subsequently picoinjected with reverse transcriptase.
Picoinjection fluid is pictured as dark gray in the schematic
diagram on the left. Brightfield images demonstrate that the drops
roughly doubled in size after picoinjection. (C) RT-PCR reactions
subjected to picoinjection omitting the reverse transcriptase show
no TaqMan.RTM. signal for EpCAM and CD44, demonstrating the
specificity of the TaqMan.RTM. assay. The red arrows indicate the
direction of emulsion flow in the illustrations. Scale bars=100
.mu.m.
FIG. 28, Panels A-B show a comparison of digital RT-PCR detection
rates between control drops and drops that were picoinjected with
reverse transcriptase. (A) Scatter plots of FAM and Cy5 drop
intensities for a control sample (left) and picoinjected sample
(right). The gating thresholds used to label a drop as positive or
negative for TaqMan.RTM. signal are demarcated by the lines, and
divide the scatter plot into quadrants, (-,-), (-,+), (+,-), (+,+).
(B) The bar graph shows the average TaqMan.RTM. positive drop count
with picoinjection relative to the normalized count for CD44 and
EpCAM TaqMan.RTM. assays for control populations. The data
represent the average of four independent experimental
replicates.
FIG. 29, Panels A-B shows that picoinjection enables analysis of
discrete drop populations. (A) Non-picoinjected drops. Control
RT-PCR reactions containing mixed PC3 cell total RNA and Raji cell
total RNA were emulsified with a T-junction drop maker,
thermocycled, and imaged. Merged FAM and HEX fluorescent images are
shown with FAM (green) fluorescence indicating TaqMan.RTM.
detection of an EpCAM transcript and HEX (red) indicating the
presence of PTPRC transcripts. The yellow drops indicate the
presence of multiplexed TaqMan.RTM. assays, where EpCAM and PTPRC
transcripts were co-encapsulated in the same drop. The brightfield
images (BF) are shown in the panel on the right. (B) Picoinjected
drops. A double T-junction drop maker simultaneously created two
populations of drops that were immediately picoinjected. One drop
maker created drops containing only Raji cell RNA, and the other
drops containing only PC3 cell RNA. Both drop types initially lack
reverse transcriptase, which is added via picoinjection just
downstream of the drop makers. The overwhelming majority of drops
display no multiplexing, demonstrating that transfer of material
during picoinjection is very rare. The red arrows indicate the
direction of emulsion flow in the illustrations. Scale bars=100
.mu.m.
FIG. 30, Panels A-B shows a dual transcript detection analysis,
indicating minimal cross-contamination during picoinjection. (A)
Scatter plots of FAM and HEX drop intensities for a co-encapsulated
control sample (left) and dual population picoinjected sample
(right). Using this analysis, large numbers of TaqMan.RTM.
multiplexed drops were identified in the co-encapsulated controls
that were virtually absent in the dual population picoinjected
drops (upper right quadrants of gated scatter plots). (B) A bar
graph of different bright drop populations relative to the total
bright count for co-encapsulation control and for dual population
picoinjection. The data represent the average of three experimental
replicates.
FIG. 31 Panels A-B shows that dual populations of RNA drops can be
stored offline and picoinjected at a later time. (A) An emulsion
was made consisting of two populations of drops, one containing RNA
recovered from Raji cells, and the other from PC3 cells. The drops
were collected into a syringe, incubated off chip, and then
re-introduced into a microfluidic device to picoinject. The drops
were then collected, thermocycled, and imaged. These drops are
somewhat more polydisperse and displayed higher multiplexing rates
(1%) than the drops picoinjected on the same device on which they
were formed, which is most likely due to merger of some of the
drops during incubation and reinjection. The ability to reinject
emulsions following incubation to add reagents may be important for
numerous droplet-based molecular biology assays. (B) Brightfield
images of picoinjected emulsions. Scale bars=100 .mu.m.
FIG. 32 shows an embodiment of a single cell RT-PCR microfluidic
device as described herein.
FIG. 33 shows the effect of including ridge structures in a
microfluidic device channel downstream of a droplet forming
junction. A T-junction drop maker without ridges is shown to the
left. As the flow rate ratio is increased, the drop maker stops
forming drops and instead forms a long jet. This is due to the jet
wetting the channel walls and adhering, preventing the formation of
drops. On the right, a similar T-junction is shown with ridge
structures. The ridges trap a suitable phase, e.g., a hydrophobic
oil phase, near the walls, making it difficult for the aqueous
phase to wet. This allows the device to form drops at much higher
flow rate ratios before it eventually wets at R=0.9. This shows
that inclusion of the ridges allows the drop maker to function over
a much wider range than if the ridges are omitted. The channel
widths are 30 microns and the peaks of the ridges are about 5-10
microns. The top and bottom sets of images correspond to
experiments performs with different microfluidic devices.
FIG. 34 provides a flow diagram showing a general fabrication
scheme for an embodiment of a liquid electrode as described
herein.
FIG. 35 provides a sequence of three images taken at different
times as an electrode channel is being filled with salt water (time
course proceeds from left to right; Panels A-C). The salt water is
introduced into the inlet of the channel and pressurized, causing
it to slowly fill the channel. The air that is originally in the
channel is pushed into the PDMS so that, by the end, it is entirely
filled with liquid.
FIG. 36 shows electric field lines simulated for various liquid
electrode configurations. The simulations are of positive and
ground electrodes showing equipotential lines for three different
geometries.
FIG. 37 provides two images of a droplet merger device that merges
large drops with small drops utilizing liquid electrodes. To merge
the drops, an electric field is applied using a salt-water
electrode. When the field is off, no merger occurs (right) and when
it is on, the drops merge (left).
FIG. 38 provides two different views of a three dimensions
schematic showing a device which may be used to encapsulate single
emulsions in double emulsions. It includes a channel in which the
single emulsions are introduced, which channel opens up into a
large channel in which additional aqueous phase is added. This
focuses the injected drops through an orifice, causing them to be
encapsulated in oil drops and forming water-in-oil-in-water double
emulsions.
FIG. 39 provides two schematics of PDMS slabs that may be used to
construct a double emulsification device. The slab on the left has
channels with two heights--short channels for the droplet
reinjection and constriction channels (see previous Figure) and
tall channels for the aqueous phase and outlets. The slab on the
right has only the tall channels. To complete the device, the slabs
are aligned and sealed together so that the channels are facing.
The devices are bonded using plasma oxidation.
FIG. 40 provides a microscope image of a double emulsification
device encapsulating a reinjected single emulsions in double
emulsions. The reinjected single emulsions enter from above and are
encapsulated in the constriction shown in the center of the device.
They then exit as double emulsions, four of which are shown towards
the bottom of the device.
FIG. 41 provides fluorescent microscope images of fluorescent
double emulsions. The image on the left shows double emulsions
formed by shaking the fluids, which results in a large amount of
polydispersity and a small number of drops of the appropriate size
for FACS sorting. The image on the right shows double emulsions
made with the microfluidic process disclosed herein, which are much
more monodisperse.
FIG. 42 provides a histogram of the drop areas for shaken vs.
device-created double emulsions. The device-created double
emulsions are much more monodisperse, as demonstrated by the
peak.
FIG. 43 shows FACS fluorescence and scattering data for
microfluidic device generated double emulsions according to the
present disclosure. The upper plot shows the intensity histogram of
the population as measured with the FITC channel (.about.520 nm) of
the FACS. The plots below show the forward and side scattering of
the drops, gated according to FITC signal.
FIG. 44 shows FACS fluorescence and scattering data for shaken
double emulsions. The upper plot shows the intensity histogram of
the population as measured with the FITC channel (.about.520 nm) of
the FACS. The plots below show the forward and side scattering of
the drops, gated according to FITC signal.
FIG. 45 provides a histogram of droplet intensity as read out with
the FACS (FITC channel) for four different concentrations of
encapsulated dye. The dye is composed of fluorescently-labeled
BSA.
FIG. 46 shows the results of an experiment designed to test the
detection rate of the FACS-run drops. Two populations of drops were
created, one with labeled BSA fluorescent at 520 nm, and another
with BSA fluorescent at 647 nm. The two populations were then mixed
in defined ratios and the samples were run on FACS. The measured
ratio was found to agree with the known ratio, demonstrating that
the FACS measurements are accurate over this range.
FIG. 47 shows emulsions containing three different concentrations
of DNA. All drops contain TaqMan.RTM. probes for the DNA target,
but the target is encapsulated at limiting concentration, so that
only the drops that get a target undergo amplification. When the
target concentration is reduced, the fraction of fluorescent drops
goes down. The lower plots show the drops after being encapsulated
in double emulsions and screed on FACS.
FIG. 48 shows emulsions containing three concentrations of DNA
lower than those in the previous Figure. All drops contain
TaqMan.RTM. probes for the DNA target, but the target is
encapsulated at limiting concentration, so that only the drops that
get a target undergo amplification. When the target concentration
is reduced, the fraction of fluorescent drops goes down. The lower
plots show the drops after being encapsulated in double emulsions
and screed on FACS.
FIG. 49 shows emulsions as for FIGS. 47 and 48 at the lowest DNA
concentration of the three Figures. The lower plot shows the drops
after being encapsulated in double emulsions and screed on
FACS.
FIG. 50 shows a plot of the detected number of positives by FACS
analysis of double emulsions plotted versus the number of positives
detected by imaging the drops before double emulsification using a
fluorescent microscope. The results agree with one another over the
two decades tested.
FIG. 51 provides a plot showing the fraction of drops that are
positive as a function of the log-2 concentration. As the
concentration of DNA goes up, more drops become fluorescent because
more of them contain at least a single molecule.
FIG. 52 provides images showing drops in which a TaqMan.RTM. PCR
reaction has been performed with encapsulated Azospira. The upper
images correspond to a reaction in which a 110 bp amplicon was
produced, whereas the lower images correspond to a 147 bp
amplicon.
FIG. 53 shows a picture of a gel showing bands corresponding to the
amplicons of two TaqMan.RTM. PCR reactions, one for a 464 bp
amplicon and one for a 550 bp amplicon.
FIG. 54 shows a picture of a gel validating that PCR reactions can
be multiplexed by adding multiple primer sets to a sample
containing bacteria.
FIG. 55 shows results for the PCR amplification of Azospira
amplicons (left) and FACS analysis of Azospira containing double
emulsions (right).
DETAILED DESCRIPTION
Methods for the detection of components from biological samples are
provided. In certain aspects, the methods may be used to detect
and/or quantify specific components in a biological sample, such as
tumor cells (e.g., circulating tumor cells). Systems and devices
for use in practicing methods of the invention are also
provided.
The subject methods and devices may find use in a wide variety of
applications, such as the detection of cancer, detection of
aneuploidy from DNA circulating in a mother's blood stream,
monitoring disease progression, analyzing the DNA or RNA content of
cells, and a variety of other applications in which it is desired
to detect and/or quantify specific components in a biological
sample.
Before the present invention is described in greater detail, it is
to be understood that this invention is not limited to particular
embodiments described, and as such may, of course, vary. It is also
to be understood that the terminology used herein is for the
purpose of describing particular embodiments only, and is not
intended to be limiting, since the scope of the present invention
will be limited only by the appended claims.
Where a range of values is provided, it is understood that each
intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limits of that range is also specifically disclosed. Each
smaller range between any stated value or intervening value in a
stated range and any other stated or intervening value in that
stated range is encompassed within the invention. The upper and
lower limits of these smaller ranges may independently be included
or excluded in the range, and each range where either, neither or
both limits are included in the smaller ranges is also encompassed
within the invention, subject to any specifically excluded limit in
the stated range. Where the stated range includes one or both of
the limits, ranges excluding either or both of those included
limits are also included in the invention.
Unless defined otherwise, all technical and scientific terms used
herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, some potential and exemplary methods and materials may
now be described. Any and all publications mentioned herein are
incorporated herein by reference to disclose and describe the
methods and/or materials in connection with which the publications
are cited. It is understood that the present disclosure supersedes
any disclosure of an incorporated publication to the extent there
is a contradiction.
It must be noted that as used herein and in the appended claims,
the singular forms "a", "an", and "the" include plural referents
unless the context clearly dictates otherwise. Thus, for example,
reference to "a microdroplet" includes a plurality of such
microdroplets and reference to "the microdroplet" includes
reference to one or more microdroplets, and so forth.
It is further noted that the claims may be drafted to exclude any
element which may be optional. As such, this statement is intended
to serve as antecedent basis for use of such exclusive terminology
as "solely", "only" and the like in connection with the recitation
of claim elements, or the use of a "negative" limitation.
The publications discussed herein are provided solely for their
disclosure prior to the filing date of the present application.
Nothing herein is to be construed as an admission that the present
invention is not entitled to antedate such publication by virtue of
prior invention. Further, the dates of publication provided may be
different from the actual publication dates which may need to be
independently confirmed. To the extent such publications may set
out definitions of a term that conflict with the explicit or
implicit definition of the present disclosure, the definition of
the present disclosure controls.
As will be apparent to those of skill in the art upon reading this
disclosure, each of the individual embodiments described and
illustrated herein has discrete components and features which may
be readily separated from or combined with the features of any of
the other several embodiments without departing from the scope or
spirit of the present invention. Any recited method can be carried
out in the order of events recited or in any other order which is
logically possible.
Methods
As summarized above, aspects of the invention include methods for
the detection of components from biological samples. Aspects
include methods for the detection, quantification, and/or
genotyping of cells, e.g. normal cells (i.e., non-tumor cells),
tumor cells or CTCs.
As used herein, the phrase "biological sample" encompasses a
variety of sample types obtained from an individual and can be used
in a diagnostic or monitoring assay. The definition encompasses
blood and other liquid samples of biological origin, solid tissue
samples such as a biopsy specimen or tissue cultures or cells
derived therefrom and the progeny thereof. The definition also
includes samples that have been manipulated in any way after their
procurement, such as by treatment with reagents, solubilization, or
enrichment for certain components, such as polynucleotides. The
term "biological sample" encompasses a clinical sample, and also
includes cells in culture, cell supernatants, cell lysates, cells,
serum, plasma, biological fluid, and tissue samples. "Biological
sample" includes cells; biological fluids such as blood,
cerebrospinal fluid, semen, saliva, and the like; bile; bone
marrow; skin (e.g., skin biopsy); and antibodies obtained from an
individual.
As described more fully herein, in various aspects the subject
methods may be used to detect a variety of components from such
biological samples. Components of interest include, but are not
necessarily limited to, cells (e.g., circulating cells and/or
circulating tumor cells), polynucleotides (e.g., DNA and/or RNA),
polypeptides (e.g., peptides and/or proteins), and many other
components that may be present in a biological sample.
"Polynucleotides" or "oligonucleotides" as used herein refer to
linear polymers of nucleotide monomers, and may be used
interchangeably. Polynucleotides and oligonucleotides can have any
of a variety of structural configurations, e.g., be single
stranded, double stranded, or a combination of both, as well as
having higher order intra- or intermolecular secondary/tertiary
structures, e.g., hairpins, loops, triple stranded regions, etc.
Polynucleotides typically range in size from a few monomeric units,
e.g. 5-40, when they are usually referred to as "oligonucleotides,"
to several thousand monomeric units. Whenever a polynucleotide or
oligonucleotide is represented by a sequence of letters (upper or
lower case), such as "ATGCCTG," it will be understood that the
nucleotides are in 5'.fwdarw.3' order from left to right and that
"A" denotes deoxyadenosine, "C" denotes deoxycytidine, "G" denotes
deoxyguanosine, and "T" denotes thymidine, "I" denotes
deoxyinosine, "U" denotes uridine, unless otherwise indicated or
obvious from context. Unless otherwise noted the terminology and
atom numbering conventions will follow those disclosed in Strachan
and Read, Human Molecular Genetics 2 (Wiley-Liss, New York,
1999).
The terms "polypeptide," "peptide," and "protein," used
interchangeably herein, refer to a polymeric form of amino acids of
any length. NH.sub.2 refers to the free amino group present at the
amino terminus of a polypeptide. COOH refers to the free carboxyl
group present at the carboxyl terminus of a polypeptide. In keeping
with standard polypeptide nomenclature, J. Biol. Chem., 243 (1969),
3552-3559 is used.
In certain aspects, methods are provided for counting and/or
genotyping cells, including normal cells or tumor cells, such as
CTCs. A feature of such methods is the use of microfluidics.
FIG. 1 presents a non-limiting, simplified representation of one
type of a microfluidics system and method of the present
disclosure. The particular application depicted in FIG. 1 is the
detection and/or genotyping of cells, e.g., tumor cells, from a
biological sample. In one such method, nucleated blood cells may be
obtained from a biological sample from a subject. The nucleated
blood cells are encapsulated into individual drops using an
encapsulation device (left). The drops may then be injected with a
lysis buffer and incubated at conditions that accelerate cell lysis
(e.g., at 37.degree. C.). The drops may be injected with a PCR mix
that includes one or more primers targeting characteristic
oncogenic mutations (center). The drops containing the PCR mix may
be flowed through a channel that incubates the droplets under
conditions effective for PCR. In the figure, this is achieved by
flowing the drops through a channel that snakes over various zones
maintained at 65.degree. C. and 95.degree. C. As the drops move
through the zones, their temperature cycles, as needed for PCR.
During the PCR reaction, if a droplet contains a genome of a cell
with a mutation for which the primer(s) are designed to detect,
amplification is initiated. The presence of these particular PCR
products may be detected by, for example, a fluorescent output that
turns the drop fluorescent (FIGS. 3-4). The drops may thus be
scanned, such as by using flow cytometry, to detect the presence of
fluorescent drops (FIG. 14, Panels A-B). In certain aspects, the
drops may also be sorted using, for example, droplet sorting to
recover drops of interest (right). Using the nomenclature of the
current disclosure, the steps described above are thus performed
"under microfluidic control." That is, the steps are performed on
one or more microfluidics devices.
FIG. 2, Panels A-E depict a microfluidics system involving many of
the general principles and steps described above. Here, yeast cells
(black specks) enter from the far left and are encapsulated into
drops, shown at low (4.times. objective; Panel A) and high
magnification (10.times. objective; Panel B). The drops are
incubated to allowing the yeast to secrete their product (Panel C);
this produces a fluorescent compound in the drops, so that drops
containing efficient producers quickly become fluorescent (Panel
D). The drops are then sorted to extract the most efficient yeast
using a microfluidic sorter (Panel E).
Encapsulating a component from a biological sample may be achieved
by any convenient means. FIG. 5 presents but one possible example,
in which droplets are formed in a massively parallel fashion a
serial bisection device. For instance, cell-containing solution may
be injected from the left and formed into large drops, which flow
into the serial bisection array and are split into small drops;
drops shown to the far right are 25 mm in diameter. Encapsulation
approaches of interest also include, but are not limited to,
hydrodynamically-triggered drop formation and those described by
Link, et al., Phys. Rev. Lett. 92, 054503 (2004), the disclosure of
which is incorporated herein by reference.
As evidenced by FIGS. 1, 4, and 6, a feature of certain methods of
the present disclosure is the use of a polymerase chain reaction
(PCR)-based assay to detect the presence of certain
oligonucleotides and/or oncogene(s) present in cells. Examples of
PCR-based assays of interest include, but are not limited to,
quantitative PCR (qPCR), quantitative fluorescent PCR (QF-PCR),
multiplex fluorescent PCR (MF-PCR), real time PCR (RT-PCR), single
cell PCR, PCR-RFLP/RT-PCR-RFLP, hot start PCR, nested PCR, in situ
polony PCR, in situ rolling circle amplification (RCA), bridge PCR,
picotiter PCR and emulsion PCR. Other suitable amplification
methods include the ligase chain reaction (LCR), transcription
amplification, self-sustained sequence replication, selective
amplification of target polynucleotide sequences, consensus
sequence primed polymerase chain reaction (CP-PCR), arbitrarily
primed polymerase chain reaction (AP-PCR), degenerate
oligonucleotide-primed PCR (DOP-PCR) and nucleic acid based
sequence amplification (NABSA).
A PCR-based assay may be used to detect the presence of certain
gene(s), such as certain oncogene(s). FIG. 4, Panels A-B depict a
PCR-based assay to detect oncogenes. In this assay, one or more
primers specific to each oncogene of interest are reacted with the
genome of each cell. These primers have sequences specific to the
particular oncogene, so that they will only hybridize and initiate
PCR when they are complimentary to the genome of the cell. If an
oncogene is present and the primer is a match, large many copies of
the oncogene are created. To determine whether an oncogene is
present, the PCR products may be detected through an assay probing
the liquid of the drop, such as by staining the solution with an
intercalating dye, like SybrGreen or ethidium bromide, hybridizing
the PCR products to a solid substrate, such as a bead (e.g.,
magnetic or fluorescent beads, such as Luminex beads), or detecting
them through an intermolecular reaction, such as FRET. These dyes,
beads, and the like are each examples of a "detection component," a
term that is used broadly and generically herein to refer to any
component that is used to detect the presence or absence of PCR
product(s).
A great number of variations of these basic approaches will now be
outlined in greater detail below.
Detecting Rare Cells (e.g., Tumor Cells)
Aspects of the subject methods involve detecting the presence of
one or more subset of cells (e.g., tumor cells) in a biological
sample. Such a scheme is depicted in FIG. 6. To use this approach
for the detection of tumor cells, a biological sample (e.g., whole
blood) may be recovered from a subject using any convenient means.
The biological sample may be processed to remove components other
than cells using, for example, processing steps such as
centrifugation, filtration, and the like.
Each cell in the biological sample is then encapsulated into a
droplet using a microfluidic device, such as that shown in FIGS. 5
and/or 8. Using the example from FIG. 5, the cell-containing
solution is injected from the left and formed into large drops,
which flow into the serial bisection array and are split into
smaller droplets. Other methods of encapsulating cells into
droplets are known in the art. Where desired, the cells may be
stained with one or more antibodies and/or probes prior to
encapsulating them into drops. As used herein, the terms "drop,"
"droplet," and "microdroplet" may be used interchangeably, to refer
to tiny spheres containing an aqueous phase, e.g., water, generally
ranging from 0.1 to 1000 .mu.m in diameter, which may be used to
encapsulate cells, DNA, enzymes, and other components. Accordingly,
the terms may be used to refer to a droplet produced in, on, or by
a microfluidics device.
One or more lysing agents may also be added to the droplets
containing a cell, under conditions in which the cell(s) may be
caused to burst, thereby releasing their genomes. The lysing agents
may be added after the cells are encapsulated into microdroplets.
Any convenient lysing agent may be employed, such as proteinase K
or cytotoxins. In particular embodiments, cells may be
co-encapsulated in drops with lysis buffer containing detergents
such as Triton X100 and/or proteinase K. The specific conditions in
which the cell(s) may be caused to burst will vary depending on the
specific lysing agent used. For example, if proteinase K is
incorporated as a lysing agent, the microdroplets may be heated to
about 37-60.degree. C. for about 20 min to lyse the cells and to
allow the proteinase K to digest cellular proteins, after which
they may be heated to about 95.degree. C. for about 5-10 min to
deactivate the proteinase K.
In certain aspects, cell lysis may also, or instead, rely on
techniques that do not involve addition of lysing agent. For
example, lysis may be achieved by mechanical techniques that may
employ various geometric features to effect piercing, shearing,
abrading, etc. of cells. Other types of mechanical breakage such as
acoustic techniques may also be used. Further, thermal energy can
also be used to lyse cells. Any convenient means of effecting cell
lysis may be employed in the methods described herein.
Primers may be introduced into the droplet, for each of the genes,
e.g., oncogenes, to be detected. Hence, in certain aspects, primers
for all oncogenes may be present in the droplet at the same time,
thereby providing a multiplexed assay. The droplets are
temperature-cycled so that droplets containing cancerous cells, for
example, will undergo PCR. During this time, only the primers
corresponding to oncogenes present in the genome will induce
amplification, creating many copies of these oncogenes in the
droplet. Detecting the presence of these PCR products may be
achieved by a variety of ways, such as by using FRET, staining with
an intercalating dye, or attaching them to a bead. For more
information on the different options for this, see the section
describing variations of the technique. The droplet may be
optically probed to detect the PCR products (FIG. 14). Optically
probing the droplet may involve counting the number of tumor cells
present in the initial population, and/or to allow for the
identification the oncogenes present in each tumor cell.
The subject methods may be used to determine whether a biological
sample contains particular cells of interest, e.g., tumor cells, or
not. In certain aspects, the subject methods may include
quantifying the number of cells of interest, e.g., tumor cells,
present in a biological sample. Quantifying the number of cells of
interest, e.g., tumor cells, present in a biological sample may be
based at least in part on the number of microdroplets in which PCR
amplification products were detected. For example, microdroplets
may be produced under conditions in which the majority of droplets
are expected to contain zero or one cells. Those droplets that do
not contain any cells may be removed, using techniques described
more fully herein. After performing the PCR steps outlined above,
the total number of microdroplets that are detected to contain PCR
products may be counted, so as to quantify the number of cells of
interest, e.g., tumor cells, in the biological sample. In certain
aspects, the methods may also include counting the total number of
microdroplets, so as to determine the fraction or percentage of
cells from the biological sample that are cells of interest, e.g.,
tumor cells.
PCR
As summarized above, in practicing methods of the invention a
PCR-based assay may be used to detect the presence of certain genes
of interest, e.g., oncogene(s), present in cells. The conditions of
such PCR-based assays may vary in one or more ways.
For instance, the number of PCR primers that may be added to a
microdroplet may vary. The term "primer" may refer to more than one
primer and refers to an oligonucleotide, whether occurring
naturally, as in a purified restriction digest, or produced
synthetically, which is capable of acting as a point of initiation
of synthesis along a complementary strand when placed under
conditions in which synthesis of a primer extension product which
is complementary to a nucleic acid strand is catalyzed. Such
conditions include the presence of four different
deoxyribonucleoside triphosphates and a polymerization-inducing
agent such as DNA polymerase or reverse transcriptase, in a
suitable buffer ("buffer" includes substituents which are
cofactors, or which affect pH, ionic strength, etc.), and at a
suitable temperature. The primer is preferably single-stranded for
maximum efficiency in amplification.
The complement of a nucleic acid sequence as used herein refers to
an oligonucleotide which, when aligned with the nucleic acid
sequence such that the 5' end of one sequence is paired with the 3'
end of the other, is in "antiparallel association." Complementarity
need not be perfect; stable duplexes may contain mismatched base
pairs or unmatched bases. Those skilled in the art of nucleic acid
technology can determine duplex stability empirically considering a
number of variables including, for example, the length of the
oligonucleotide, percent concentration of cytosine and guanine
bases in the oligonucleotide, ionic strength, and incidence of
mismatched base pairs.
The number of PCR primers that may be added to a microdroplet may
range from about 1 to about 500 or more, e.g., about 2 to 100
primers, about 2 to 10 primers, about 10 to 20 primers, about 20 to
30 primers, about 30 to 40 primers, about 40 to 50 primers, about
50 to 60 primers, about 60 to 70 primers, about 70 to 80 primers,
about 80 to 90 primers, about 90 to 100 primers, about 100 to 150
primers, about 150 to 200 primers, about 200 to 250 primers, about
250 to 300 primers, about 300 to 350 primers, about 350 to 400
primers, about 400 to 450 primers, about 450 to 500 primers, or
about 500 primers or more.
These primers may contain primers for one or more gene of interest,
e.g. oncogenes. The number of primers for genes of interest that
are added may be from about one to 500, e.g., about 1 to 10
primers, about 10 to 20 primers, about 20 to 30 primers, about 30
to 40 primers, about 40 to 50 primers, about 50 to 60 primers,
about 60 to 70 primers, about 70 to 80 primers, about 80 to 90
primers, about 90 to 100 primers, about 100 to 150 primers, about
150 to 200 primers, about 200 to 250 primers, about 250 to 300
primers, about 300 to 350 primers, about 350 to 400 primers, about
400 to 450 primers, about 450 to 500 primers, or about 500 primers
or more. Genes and oncogenes of interest include, but are not
limited to, BAX, BCL2L1, CASP8, CDK4, ELK1, ETS1, HGF, JAK2, JUNB,
JUND, KIT, KITLG, MCL1, MET, MOS, MYB, NFKBIA, EGFR, Myc, EpCAM,
NRAS, PIK3CA, PML, PRKCA, RAF1, RARA, REL, ROS1, RUNX1, SRC, STAT3,
CD45, cytokeratins, CEA, CD133, HER2, CD44, CD49f, CD146, MUC1/2,
and ZHX2.
Such primers and/or reagents may be added to a microdroplet in one
step, or in more than one step. For instance, the primers may be
added in two or more steps, three or more steps, four or more
steps, or five or more steps. Regardless of whether the primers are
added in one step or in more than one step, they may be added after
the addition of a lysing agent, prior to the addition of a lysing
agent, or concomitantly with the addition of a lysing agent. When
added before or after the addition of a lysing agent, the PCR
primers may be added in a separate step from the addition of a
lysing agent.
Once primers have been added to a microdroplet, the microdroplet
may be incubated under conditions allowing for PCR. The
microdroplet may be incubated on the same microfluidic device as
was used to add the primer(s), or may be incubated on a separate
device. In certain embodiments, incubating the microdroplet under
conditions allowing for PCR amplification is performed on the same
microfluidic device used to encapsulate the cells and lyse the
cells. Incubating the microdroplets may take a variety of forms. In
certain aspects, the drops containing the PCR mix may be flowed
through a channel that incubates the droplets under conditions
effective for PCR. Flowing the microdroplets through a channel may
involve a channel that snakes over various temperature zones
maintained at temperatures effective for PCR. Such channels may,
for example, cycle over two or more temperature zones, wherein at
least one zone is maintained at about 65.degree. C. and at least
one zone is maintained at about 95.degree. C. As the drops move
through such zones, their temperature cycles, as needed for PCR.
The precise number of zones, and the respective temperature of each
zone, may be readily determined by those of skill in the art to
achieve the desired PCR amplification.
In other embodiments, incubating the microdroplets may involve the
use of a device of the general types depicted in FIG. 12, Panels
A-C, and FIG. 13; a device of this general type may be referred to
herein as a "Megadroplet Array." In such a device, an array of
hundreds, thousands, or millions of traps indented into a channel
(e.g., a PDMS channel) sit above a thermal system (FIG. 12, Panel
A). The channel may be pressurized, thereby preventing gas from
escaping. The height of the microfluidic channel is smaller than
the diameter of the drops, causing drops to adopt a flattened
pancake shape. When a drop flows over an unoccupied indentation, it
adopts a lower, more energetically favorable, radius of curvature,
leading to a force that pulls the drop entirely into the trap (FIG.
12, Panel B). By flowing drops as a close pack, it is ensured that
all traps on the array are occupied, as illustrated in FIG. 12,
Panel C. The entire device may be thermal cycled using a
heater.
In certain aspects, the heater includes a Peltier plate, heat sink,
and control computer. The Peltier plate allows for the heating or
cooling of the chip above or below room temperature by controlling
the applied current. To ensure controlled and reproducible
temperature, a computer may monitor the temperature of the array
using integrated temperature probes, and may adjust the applied
current to heat and cool as needed. A metallic (e.g. copper) plate
allows for uniform application of heat and dissipation of excess
heat during cooling cycles, enabling cooling from about 95.degree.
C. to about 60.degree. C. in under about one minute.
Methods of the invention may also include introducing one or more
probes to the microdroplet. As used herein with respect to nucleic
acids, the term "probe" refers to a labeled oligonucleotide which
forms a duplex structure with a sequence in the target nucleic
acid, due to complementarity of at least one sequence in the probe
with a sequence in the target region. The probe, preferably, does
not contain a sequence complementary to sequence(s) used to prime
the polymerase chain reaction. The number of probes that are added
may be from about one to 500, e.g., about 1 to 10 probes, about 10
to 20 probes, about 20 to 30 probes, about 30 to 40 probes, about
40 to 50 probes, about 50 to 60 probes, about 60 to 70 probes,
about 70 to 80 probes, about 80 to 90 probes, about 90 to 100
probes, about 100 to 150 probes, about 150 to 200 probes, about 200
to 250 probes, about 250 to 300 probes, about 300 to 350 probes,
about 350 to 400 probes, about 400 to 450 probes, about 450 to 500
probes, or about 500 probes or more. The probe(s) may be introduced
into the microdroplet prior to, subsequent with, or after the
addition of the one or more primer(s). Probes of interest include,
but are not limited to, TaqMan.RTM. probes (e.g., as described in
Holland, P. M.; Abramson, R. D.; Watson, R.; Gelfand, D. H. (1991).
"Detection of specific polymerase chain reaction product by
utilizing the 5'----3' exonuclease activity of Thermus aquaticus
DNA polymerase". PNAS, 88 (16): 7276-7280).
In certain embodiments, an RT-PCR based assay may be used to detect
the presence of certain transcripts of interest, e.g., oncogene(s),
present in cells. In such embodiments, reverse transcriptase and
any other reagents necessary for cDNA synthesis are added to the
microdroplet in addition to the reagents used to carry out PCR
described herein (collectively referred to as the "RT-PCR
reagents"). The RT-PCR reagents are added to the microdroplet using
any of the methods described herein. Once reagents for RT-PCR have
been added to a microdroplet, the microdroplet may be incubated
under conditions allowing for reverse transcription followed by
conditions allowing for PCR as described herein. The microdroplet
may be incubated on the same microfluidic device as was used to add
the RT-PCR reagents, or may be incubated on a separate device. In
certain embodiments, incubating the microdroplet under conditions
allowing for RT-PCR is performed on the same microfluidic device
used to encapsulate the cells and lyse the cells.
In certain embodiments, the reagents added to the microdroplet for
RT-PCR or PCR further includes a fluorescent DNA probe capable of
detecting real-time RT-PCR or PCR products. Any suitable
fluorescent DNA probe can be used including, but not limited to
SYBR Green, TaqMan.RTM., Molecular Beacons and Scorpion probes. In
certain embodiments, the reagents added to the microdroplet include
more than one DNA probe, e.g., two fluorescent DNA probes, three
fluorescent DNA probes, or four fluorescent DNA probes. The use of
multiple fluorescent DNA probes allows for the concurrent
measurement of RT-PCR or PCR products in a single reaction.
Double PCR
To amplify rare transcripts, a microdroplet that has undergone a
first-step RT-PCR or PCR reaction as described herein may be
further subjected to a second step PCR reaction. In some
embodiments, a portion of a microdroplet that has undergone a
first-step RT-PCR or PCR reaction is extracted from the
microdroplet and coalesced with a droplet containing additional PCR
reagents, including, but not limited to enzymes (e.g. DNA
polymerase), DNA probes (e.g. fluorescent DNA probes) and primers.
In certain embodiments, the droplet containing the additional PCR
reagents is larger than the microdroplet that has undergone the
first step RT-PCR or PCR reaction. This may be beneficial, for
example, because it allows for the dilution of cellular components
that may be inhibitory to the second step PCR. The second step PCR
reaction may be carried out on the same microfluidic device used to
carry out the first-step reaction or on a different microfluidic
device.
In some embodiments, the primers used in the second step PCR
reaction are the same primers used in the first step RT-PCR or PCR
reaction. In other embodiments, the primers used in the second step
PCR reaction are different than the primers used in the first step
reaction.
Multiplexing
In certain embodiments of the subject methods, multiple biomarkers
may be detected and analyzed for a particular cell. Biomarkers
detected may include, but are not limited to, one or more proteins,
transcripts and/or genetic signatures in the cell's genome or
combinations thereof. With standard fluorescence based detection,
the number of biomarkers that can be simultaneously interrogated
may be limited to the number of fluorescent dyes that can be
independently visualized within each microdrop. In certain
embodiments, the number of biomarkers that can be individually
detected within a particular microdroplet can be increased. For
example, this may be accomplished by segregation of dyes to
different parts of the microdroplet. In particular embodiments,
beads (e.g. LUMINEX.RTM. beads) conjugated with dyes and probes
(e.g., nucleic acid or antibody probes) may be encapsulated in the
microdroplet to increase the number of biomarkers analyzed. In
another embodiment, fluorescence polarization may be used to
achieve a greater number of detectable signals for different
biomarkers for a single cell. For example, fluorescent dyes may be
attached to various probes and the microdroplet may be visualized
under different polarization conditions. In this way, the same
colored dye can be utilized to provide a signal for different probe
targets for a single cell. The use of fixed and/or permeabilized
cells (as discussed in greater detail below) also allows for
increased levels of multiplexing. For example, labeled antibodies
may be used to target protein targets localized to cellular
components while labeled PCR and/or RT-PCR products are free within
a microdroplet. This allows for dyes of the same color to be used
for antibodies and for amplicons produced by RT-PCR.
Types of Microdroplets
In practicing the methods of the present invention, the composition
and nature of the microdroplets may vary. For instance, in certain
aspects, a surfactant may be used to stabilize the microdroplets.
Accordingly, a microdroplet may involve a surfactant stabilized
emulsion. Any convenient surfactant that allows for the desired
reactions to be performed in the drops may be used. In other
aspects, a microdroplet is not stabilized by surfactants or
particles.
The surfactant used depends on a number of factors such as the oil
and aqueous phases (or other suitable immiscible phases, e.g., any
suitable hydrophobic and hydrophilic phases) used for the
emulsions. For example, when using aqueous droplets in a
fluorocarbon oil, the surfactant may have a hydrophilic block
(PEG-PPO) and a hydrophobic fluorinated block (Krytox FSH). If,
however, the oil was switched to be a hydrocarbon oil, for example,
the surfactant would instead be chosen so that it had a hydrophobic
hydrocarbon block, like the surfactant ABIL EM90. In selecting a
surfactant, desirable properties that may be considered in choosing
the surfactant may include one or more of the following: (1) the
surfactant has low viscosity; (2) the surfactant is immiscible with
the polymer used to construct the device, and thus it doesn't swell
the device; (3) biocompatibility; (4) the assay reagents are not
soluble in the surfactant; (5) the surfactant exhibits favorable
gas solubility, in that it allows gases to come in and out; (6) the
surfactant has a boiling point higher than the temperature used for
PCR (e.g., 95C); (7) the emulsion stability; (8) that the
surfactant stabilizes drops of the desired size; (9) that the
surfactant is soluble in the carrier phase and not in the droplet
phase; (10) that the surfactant has limited fluorescence
properties; and (11) that the surfactant remains soluble in the
carrier phase over a range of temperatures.
Other surfactants can also be envisioned, including ionic
surfactants. Other additives can also be included in the oil to
stabilize the drops, including polymers that increase droplet
stability at temperatures above 35.degree. C.
Adding Reagents to Microdroplets
In practicing the subject methods, a number of reagents may need to
be added to the microdroplets, in one or more steps (e.g., about 2,
about 3, about 4, or about 5 or more steps). The means of adding
reagents to the microdroplets may vary in a number of ways.
Approaches of interest include, but are not limited to, those
described by Ahn, et al., Appl. Phys. Lett. 88, 264105 (2006);
Priest, et al., Appl. Phys. Lett. 89, 134101 (2006); Abate, et al.,
PNAS, Nov. 9, 2010 vol. 107 no. 45 19163-19166; and Song, et al.,
Anal. Chem., 2006, 78 (14), pp 4839-4849; the disclosures of which
are incorporated herein by reference.
For instance, a reagent may be added to a microdroplet by a method
involving merging a microdroplet with a second microdroplet that
contains the reagent(s). The reagent(s) that are contained in the
second microdroplet may be added by any convenient means,
specifically including those described herein. This droplet may be
merged with the first microdroplet to create a microdroplet that
includes the contents of both the first microdroplet and the second
microdroplet.
One or more reagents may also, or instead, be added using
techniques such as droplet coalescence, or picoinjection. In
droplet coalescence, a target drop (i.e., the microdroplet) may be
flowed alongside a microdroplet containing the reagent(s) to be
added to the microdroplet. The two microdroplets may be flowed such
that they are in contact with each other, but not touching other
microdroplets. These drops may then be passed through electrodes or
other means of applying an electrical field, wherein the electric
field may destabilize the microdroplets such that they are merged
together.
Reagents may also, or instead, be added using picoinjection. In
this approach, a target drop (i.e., the microdroplet) may be flowed
past a channel containing the reagent(s) to be added, wherein the
reagent(s) are at an elevated pressure. Due to the presence of the
surfactants, however, in the absence of an electric field, the
microdroplet will flow past without being injected, because
surfactants coating the microdroplet may prevent the fluid(s) from
entering. However, if an electric field is applied to the
microdroplet as it passes the injector, fluid containing the
reagent(s) will be injected into the microdroplet. The amount of
reagent added to the microdroplet may be controlled by several
different parameters, such as by adjusting the injection pressure
and the velocity of the flowing drops, by switching the electric
field on and off, and the like.
In other aspects, one or more reagents may also, or instead, be
added to a microdroplet by a method that does not rely on merging
two droplets together or on injecting liquid into a drop. Rather,
one or more reagents may be added to a microdroplet by a method
involving the steps of emulsifying a reagent into a stream of very
small drops, and merging these small drops with a target
microdroplet (FIG. 20, Panels A-B). Such methods shall be referred
to herein as "reagent addition through multiple-drop coalescence."
These methods take advantage of the fact that due to the small size
of the drops to be added compared to that of the target drops, the
small drops will flow faster than the target drops and collect
behind them. The collection can then be merged by, for example,
applying an electric field. This approach can also, or instead, be
used to add multiple reagents to a microdroplet by using several
co-flowing streams of small drops of different fluids. To enable
effective merger of the tiny and target drops, it is important to
make the tiny drops smaller than the channel containing the target
drops, and also to make the distance between the channel injecting
the target drops from the electrodes applying the electric field
sufficiently long so as to give the tiny drops time to "catch up"
to the target drops. If this channel is too short, not all tiny
drops will merge with the target drop and adding less reagent than
desired. To a certain degree, this can be compensated for by
increasing the magnitude of the electric field, which tends to
allow drops that are farther apart to merge. In addition to making
the tiny drops on the same microfluidic device, as is shown in FIG.
20, Panels A-B, they can also, or instead, be made offline using
another microfluidic drop maker or through homogenization and then
injecting them into the device containing the target drops.
Accordingly, in certain aspects a reagent is added to a
microdroplet by a method involving emulsifying the reagent into a
stream of droplets, wherein the droplets are smaller than the size
of the microdroplet; flowing the droplets together with the
microdroplet; and merging a droplet with the microdroplet. The
diameter of the droplets contained in the stream of droplets may
vary ranging from about 75% or less than that of the diameter of
the microdroplet, e.g., the diameter of the flowing droplets is
about 75% or less than that of the diameter of the microdroplet,
about 50% or less than that of the diameter of the microdroplet,
about 25% or less than that of the diameter of the microdroplet,
about 15% or less than that of the diameter of the microdroplet,
about 10% or less than that of the diameter of the microdroplet,
about 5% or less than that of the diameter of the microdroplet, or
about 2% or less than that of the diameter of the microdroplet. In
certain aspects, a plurality of flowing droplets may be merged with
the microdroplet, such as 2 or more droplets, 3 or more, 4 or more,
or 5 or more. Such merging may be achieved by any convenient means,
including but not limited to by applying an electric field, wherein
the electric field is effective to merge the flowing droplet with
the microdroplet.
As a variation of the above-described methods, the fluids may be
jetting. That is, rather than emulsifying the fluid to be added
into flowing droplets, a long jet of this fluid can be formed and
flowed alongside the target microdroplet. These two fluids can then
be merged by, for example, applying an electric field. The result
is a jet with bulges where the microdroplets are, which may
naturally break apart into microdroplets of roughly the size of the
target microdroplets before the merger, due to the Rayleigh plateau
instability. A number of variants are contemplated. For instance,
one or more agents may be added to the jetting fluid to make it
easier to jet, such as gelling agents and/or surfactants. Moreover,
the viscosity of the continuous fluid could also be adjusted to
enable jetting, such as that described by Utada, et al., Phys. Rev.
Lett. 99, 094502 (2007), the disclosure of which is incorporated
herein by reference.
In other aspects, one or more reagents may be added using a method
that uses the injection fluid itself as an electrode, by exploiting
dissolved electrolytes in solution (FIGS. 15-19). Methods of this
general type are described more fully herein in Example 3.
In another aspect, a reagent is added to a drop (e.g., a
microdroplet) formed at an earlier time by enveloping the drop to
which the reagent is be added (i.e., the "target drop") inside a
drop containing the reagent to be added (the "target reagent"). In
certain embodiments such a method is carried out by first
encapsulating the target drop in a shell of a suitable hydrophobic
phase, e.g., oil, to form a double emulsion. The double emulsion is
then encapsulated by a drop containing the target reagent to form a
triple emulsion. To combine the target drop with the drop
containing the target reagent, the double emulsion is then burst
open using any suitable method, including, but not limited to,
applying an electric field, adding chemicals that destabilizes the
droplet interface, flowing the triple emulsion through
constrictions and other microfluidic geometries, applying
mechanical agitation or ultrasound, increasing or reducing
temperature, or by encapsulating magnetic particles in the drops
that can rupture the double emulsion interface when pulled by a
magnetic field. Methods of making a triple emulsion and combining a
target drop with a target reagent are described in Example 4
provided herein.
Detecting PCR Products
In practicing the subject methods, the manner in which PCR products
may be detected may vary. For example, if the goal is simply to
count the number of a particular cell type, e.g., tumor cells,
present in a population, this may be achieved by using a simple
binary assay in which SybrGreen, or any other stain and/or
intercalating stain, is added to each microdroplet so that in the
event a characterizing gene, e.g., an oncogene, is present and PCR
products are produced, the drop will become fluorescent. The change
in fluorescence may be due to fluorescence polarization. The
detection component may include the use of an intercalating stain
(e.g., SybrGreen).
A variety of different detection components may be used in
practicing the subject methods, including using fluorescent dyes
known in the art. Fluorescent dyes may typically be divided into
families, such as fluorescein and its derivatives; rhodamine and
its derivatives; cyanine and its derivatives; coumarin and its
derivatives; Cascade Blue and its derivatives; Lucifer Yellow and
its derivatives; BODIPY and its derivatives; and the like.
Exemplary fluorophores include indocarbocyanine (C3),
indodicarbocyanine (C5), Cy3, Cy3.5, Cy5, Cy5.5, Cy7, Texas Red,
Pacific Blue, Oregon Green 488, Alexa fluor-355, Alexa Fluor 488,
Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor-555, Alexa Fluor 568,
Alexa Fluor 594, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680,
JOE, Lissamine, Rhodamine Green, BODIPY, fluorescein isothiocyanate
(FITC), carboxy-fluorescein (FAM), phycoerythrin, rhodamine,
dichlororhodamine (dRhodamine), carboxy tetramethylrhodamine
(TAMRA), carboxy-X-rhodamine (ROX), LIZ, VIC, NED, PET, SYBR,
PicoGreen, RiboGreen, and the like. Descriptions of fluorophores
and their use, can be found in, among other places, R. Haugland,
Handbook of Fluorescent Probes and Research Products, 9th ed.
(2002), Molecular Probes, Eugene, Oreg.; M. Schena, Microarray
Analysis (2003), John Wiley & Sons, Hoboken, N.J.; Synthetic
Medicinal Chemistry 2003/2004 Catalog, Berry and Associates, Ann
Arbor, Mich.; G. Hermanson, Bioconjugate Techniques, Academic Press
(1996); and Glen Research 2002 Catalog, Sterling, Va.
FIG. 14, Panels A-B depict the use of a one-color flow-cytometer,
which can be used, for example, to detect tumor cell containing
drops. Panel A presents a schematic of a detector, consisting of a
488 nm laser directed into the back of an objective, and focused
onto a microfluidic channel through which the droplets flow. The
laser may excite fluorescent dyes within the drops, and any emitted
light is captured by the objective and imaged onto a PMT after it
is filtered through a dichroic mirror and 520.+-.5 nm band pass
filter. Turning to Panel B, drops appear as peaks in intensity as a
function of time, as shown by the output voltage of a PMT, which is
proportional to the intensity of the emitted light, as a function
of time for detected fluorescent drops.
FIGS. 3 and 4, Panels A-B further illustrate such a concept. FIG.
3, for example, is a non-limiting example that depicts digital
detection of BRAF using TaqMan.RTM. PCR assays in arrayed
microdrops. Fluorescent drops indicate amplification of the BRAF
gene from human genomic DNA, while non-fluorescent drops were
devoid of the gene. Turning to FIG. 4, Panels A-B, this scheme is
generalized. In FIG. 4, Panel A, a schematic is presented showing
forward and reverse primers being encapsulated in the microdroplets
that target an oncogenic sequence. If the oncogenic sequence is
present, the PCR reaction produces double-stranded PCR products
(Panel A, upper), whereas, if it is not, no products are produced
(Panel A, lower). SybrGreen, or any other type of intercalating
stain, is also present in the drop. The results are depicted by the
images in FIG. 4, Panel B, in that if double-stranded products are
produced, the dye intercalates into them, becoming fluorescent, and
turning the drop fluorescent (FIG. 4, Panel B, upper); by contrast,
if no double-stranded products are produced, the dye remains
non-fluorescent, producing a dim drop (FIG. 4, Panel B, lower).
In other aspects, particularly if a goal is to further characterize
the oncogenes present, additional testing may be needed. For
instance, in the case of the multiplex assays described more fully
herein (Example 2), this may be achieved by having optical outputs
that relate which of the gene(s) amplified in the drop. An
alternative approach would be to use a binary output, for example,
with an intercalated stain, to simply determine which droplets have
any oncogenes. These can then be sorted to recover these drops so
that they could be analyzed in greater detail to determine which
oncogenes they contain. To determine the oncogenes present in such
a drop, microfluidic techniques or nonmicrofluidic techniques could
be used. Using non-microfluidic techniques, a droplet identified as
containing an oncogene can be placed into a well on a wellplate
where will be diluted into a larger volume, releasing all of the
PCR products that were created during the multiplexed PCR reaction.
Samples from this well can then be transferred into other wells,
into each of which would be added primers for one of the oncogenes.
These wells would then be temperature-cycled to initiate PCR, at
which point an intercalating stain would be added to cause wells
that have matching oncogenes and primers to light up.
In practicing the subject methods, therefore, a component may be
detected based upon, for example, a change in fluorescence. In
certain aspects, the change in fluorescence is due to fluorescence
resonance energy transfer (FRET). In this approach, a special set
of primers may be used in which the 5' primer has a quencher dye
and the 3' primer has a fluorescent dye. These dyes can be arranged
anywhere on the primers, either on the ends or in the middles.
Because the primers are complementary, they will exist as duplexes
in solution, so that the emission of the fluorescent dye will be
quenched by the quencher dye, since they will be in close proximity
to one another, causing the solution to appear dark. After PCR,
these primers will be incorporated into the long PCR products, and
will therefore be far apart from one another. This will allow the
fluorescent dye to emit light, causing the solution to become
fluorescent. Hence, to detect if a particular oncogene is present,
one may measure the intensity of the droplet at the wavelength of
the fluorescent dye. To detect if different oncogenes are present,
this would be done with different colored dyes for the different
primers. This would cause the droplet to become fluorescent at all
wavelengths corresponding to the primers of the oncogenes present
in the cell.
Sorting
In practicing the methods of the present disclosure, one or more
sorting steps may be employed. Sorting approaches of interest
include, by are not necessarily limited to, approaches that involve
the use of membrane valves, bifurcating channels, surface acoustic
waves, and/or dielectrophoresis. Sorting approaches of interest
further include those depicted in FIGS. 2 and 22, Panels A-B, and
those described by Agresti, et al., PNAS vol. 107, no 9, 4004-4009;
the disclosure of which is incorporated herein by reference. A
population may be enriched by sorting, in that a population
containing a mix of members having or not having a desired property
may be enriched by removing those members that do not have the
desired property, thereby producing an enriched population having
the desired property.
Sorting may be applied before or after any of the steps described
herein. Moreover, two or more sorting steps may be applied to a
population of microdroplets, e.g., about 2 or more sorting steps,
about 3 or more, about 4 or more, or about 5 or more, etc. When a
plurality of sorting steps is applied, the steps may be
substantially identical or different in one or more ways (e.g.,
sorting based upon a different property, sorting using a different
technique, and the like).
Moreover, droplets may be purified prior to, or after, any sorting
step. FIG. 21 presents a schematic of a microfluidic device whereby
a microdroplet may be purified. That is, a majority of the fluid in
the drop is replaced it with a purified solution, without removing
any discrete reagents that may be encapsulated in the drop, such a
cells or beads. The microdroplet is first injected with a solution
to dilute any impurities within it. The diluted microdroplet is
then flowed through a microfluidic channel on which an electric
field is being applied using electrodes. Due to the
dielectrophoretic forces generated by the field, as the cells or
other discrete reagents pass through the field they will be
displaced in the flow. The drops are then split, so that all the
objects end up in one microdroplet. Accordingly, the initial
microdroplet has been purified, in that the contaminants may be
removed while the presence and/or concentration of discrete
reagents, such as beads or cells, that may be encapsulated within
the droplet are maintained in the resulting microdroplet.
Microdroplets may be sorted based on one or more properties.
Properties of interest include, but are not limited to, the size,
viscosity, mass, buoyancy, surface tension, electrical
conductivity, charge, magnetism, and/or presence or absence of one
or more components. In certain aspects, sorting may be based at
least in part upon the presence or absence of a cell in the
microdroplet. In certain aspects, sorting may be based at least in
part based upon the detection of the presence or absence of PCR
amplification products.
Microdroplet sorting may be employed, for example, to remove
microdroplets in which no cells are present. Encapsulation may
result in one or more microdroplets, including a majority of the
microdroplets, in which no cell is present. If such empty drops
were left in the system, they would be processed as any other drop,
during which reagents and time would be wasted. To achieve the
highest speed and efficiency, these empty drops may be removed with
droplet sorting. For example, as described in Example 1, a drop
maker may operate close to the dripping-to-jetting transition such
that, in the absence of a cell, 8 .mu.m drops are formed; by
contrast, when a cell is present the disturbance created in the
flow will trigger the breakup of the jet, forming drops 25 .mu.m in
diameter. The device may thus produce a bi-disperse population of
empty 8 .mu.m drops and single-cell containing 25 .mu.m drops,
which may then be sorted by size using, e.g., a hydrodynamic sorter
to recover only the larger, single-cell containing drops.
Passive sorters of interest include hydrodynamic sorters, which
sort microdroplets into different channels according to size, based
on the different ways in which small and large drops travel through
the microfluidic channels. Also of interest are bulk sorters, a
simple example of which is a tube containing drops of different
mass in a gravitational field. By centrifuging, agitating, and/or
shaking the tube, lighter drops that are more buoyant will
naturally migrate to the top of the container. Drops that have
magnetic properties could be sorted in a similar process, except by
applying a magnetic field to the container, towards which drops
with magnetic properties will naturally migrate according to the
magnitude of those properties. A passive sorter as used in the
subject methods may also involve relatively large channels that
will sort large numbers of drops simultaneously based on their flow
properties.
Picoinjection can also be used to change the electrical properties
of the drops. This could be used, for example, to change the
conductivity of the drops by adding ions, which could then be used
to sort them, for example, using dielectrophoresis. Alternatively,
picoinjection can also be used to charge the drops. This could be
achieved by injecting a fluid into the drops that is charged, so
that after injection, the drops would be charged. This would
produce a collection of drops in which some were charged and others
not, and the charged drops could then be extracted by flowing them
through a region of electric field, which will deflect them based
on their charge amount. By injecting different amounts of liquid by
modulating the piocoinjection, or by modulating the voltage to
inject different charges for affixed injection volume, the final
charge on the drops could be adjusted, to produce drops with
different charge. These would then be deflected by different
amounts in the electric field region, allowing them to be sorted
into different containers.
Suitable Subjects
The subject methods may be applied to biological samples taken from
a variety of different subjects. In many embodiments the subjects
are "mammals" or "mammalian", where these terms are used broadly to
describe organisms which are within the class mammalia, including
the orders carnivore (e.g., dogs and cats), rodentia (e.g., mice,
guinea pigs, and rats), and primates (e.g., humans, chimpanzees,
and monkeys). In many embodiments, the subjects are humans. The
subject methods may be applied to human subjects of both genders
and at any stage of development (i.e., neonates, infant, juvenile,
adolescent, adult), where in certain embodiments the human subject
is a juvenile, adolescent or adult. While the present invention may
be applied to a human subject, it is to be understood that the
subject methods may also be carried-out on other animal subjects
(that is, in "non-human subjects") such as, but not limited to,
birds, mice, rats, dogs, cats, livestock and horses. Accordingly,
it is to be understood that any subject in need of assessment
according to the present disclosure is suitable.
Moreover, suitable subjects include those who have and those who
have not been diagnosed with a condition, such as cancer. Suitable
subjects include those that are and are not displaying clinical
presentations of one or more cancers. In certain aspects, a subject
may one that may be at risk of developing cancer, due to one or
more factors such as family history, chemical and/or environmental
exposure, genetic mutation(s) (e.g., BRCA1 and/or BRCA2 mutation),
hormones, infectious agents, radiation exposure, lifestyle (e.g.,
diet and/or smoking), presence of one or more other disease
conditions, and the like.
As described more fully above, a variety of different types of
biological samples may be obtained from such subjects. In certain
embodiments, whole blood is extracted from a subject. When desired,
whole blood may be treated prior to practicing the subject methods,
such as by centrifugation, fractionation, purification, and the
like. The volume of the whole blood sample that is extracted from a
subject may be 100 mL or less, e.g., about 100 mL or less, about 50
mL or less, about 30 mL or less, about 15 mL or less, about 10 mL
or less, about 5 mL or less, or about 1 mL or less.
The subject methods and devices provided herein are compatible with
both fixed and live cells. In certain embodiments, the subject
methods and devices are practiced with live cells. In other
embodiments, the subject methods and devices are practiced with
fixed cells. Fixing a cellular sample allows for the sample to be
washed to extract small molecules and lipids that may interfere
with downstream analysis. Further, fixing and permeabilizing cells
allows the cells to be stained with antibodies for surface proteins
as well as intracellular proteins. Combined with the RT-PCR methods
described herein, such staining can be used to achieve high levels
of multiplexing because the antibodies are localized to the cell
sample, while RT-PCR products are free within a microdroplet. Such
a configuration allows for dyes of the same color to be used for
antibodies and for amplicons produced by RT-PCR. Any suitable
method can be used to fix cells, including but not limited to,
fixing using formaldehyde, methanol and/or acetone.
RT-PCR carried out on a fixed cell encapsulated in a microdroplet
can be carried out by first diluting the microdroplet and
performing the RT-PCR reaction on a sample of the diluted
microdroplet. Such dilution of the cellular sample can help to
limit any cellular compounds that would interfere with RT-PCR. In
other embodiments, the RT-PCR reagents are added directly to the
microdroplet containing the fixed cell in a "one pot" reaction
without any dilution of sample. In certain embodiments, fixed cells
are solubilized prior to the RT-PCR using proteases and
deteregents.
Genotyping Cells
As summarized above, aspects of the invention also include methods
for genotyping components from biological samples. By "genotyping"
it is meant the detection of two or more oligonucleotides (e.g.,
oncogenes) in a particular cell. Aspects include methods for
genotyping cells, e.g., tumor cells, including CTCs.
In certain such aspects, the methods involve encapsulating in a
microdroplet a cell obtained from a subject's blood sample, wherein
one cell is present in the microdroplet; introducing a lysing agent
into the microdroplet and incubating the microdroplet under
conditions effective for cell lysis; introducing polymerase chain
reaction (PCR) reagents and a plurality PCR primers into the
microdroplet, and incubating the microdroplet under conditions
allowing for PCR amplification to produce PCR amplification
products, wherein the plurality of PCR primers include one or more
primers that each hybridize to one or more oncogenes; introducing a
plurality of probes into the microdroplet, wherein the probes
hybridize to one or more mutations of interest and fluoresce at
different wavelengths; and detecting the presence or absence of
specific PCR amplification products by detection of fluorescence of
a probe, wherein detection of fluorescence indicates the presence
of the PCR amplification products; wherein one or more of steps are
performed under microfluidic control.
In other aspects, the methods may involve encapsulating in a
microdroplet a cell obtained from a subject's blood sample, wherein
one cell is present in the microdroplet; introducing a lysing agent
into the microdroplet and incubating the microdroplet under
conditions effective for cell lysis; introducing polymerase chain
reaction (PCR) reagents and a plurality PCR primers into the
microdroplet, and incubating the microdroplet under conditions
allowing for PCR amplification to produce PCR amplification
products, wherein the plurality of PCR primers include one or more
primers that each hybridize to one or more oncogenes, said primers
comprising forward primers comprising a label, and reverse primers
comprising a capture sequence; introducing a fluorescent bead into
the microdroplet, wherein the bead includes a nucleotide sequence
complementary to a capture sequence; and detecting the presence or
absence of the PCR amplification products by detection of
fluorescence of the bead and fluorescence of a primer, wherein
detection of fluorescence indicates the presence of the PCR
amplification products; wherein one or more of steps are performed
under microfluidic control.
In practicing the methods for genotyping cells, any variants to the
general steps described herein, such as the number of primers that
may be added, the manner in which reagents are added, suitable
subjects, and the like, may be made.
Detecting Cancer
Methods according to the present invention also involve methods for
detecting cancer. Such methods may include encapsulating in a
microdroplet oligonucleotides obtained from a biological sample
from the subject, wherein at least one oligonucleotide is present
in the microdroplet; introducing polymerase chain reaction (PCR)
reagents, a detection component, and a plurality of PCR primers
into the microdroplet and incubating the microdroplet under
conditions allowing for PCR amplification to produce PCR
amplification products, wherein the plurality of PCR primers
include one or more primers that each hybridize to one or more
oncogenes; and detecting the presence or absence of the PCR
amplification products by detection of the detection component,
wherein detection of the detection component indicates the presence
of the PCR amplification products.
Detection of one or more PCR amplification products corresponding
to one or more oncogenes may be indicative that the subject has
cancer. The specific oncogenes that are added to the microdroplet
may vary. In certain aspects, the oncogene(s) may be specific for a
particular type of cancer, e.g., breast cancer, colon cancer, and
the like.
Moreover, in practicing the subject methods the biological sample
from which the components are to be detected may vary, and may be
based at least in part on the particular type of cancer for which
detection is sought. For instance, breast tissue may be used as the
biological sample in certain instances, if it is desired to
determine whether the subject has breast cancer, and the like.
In practicing the methods for detecting cancer, any variants to the
general steps described herein, such as the number of primers that
may be added, the manner in which reagents are added, suitable
subjects, and the like, may be made.
Devices
As indicated above, embodiments of the invention employ
microfluidics devices. Microfluidics devices of this invention may
be characterized in various ways. In certain embodiments, for
example, microfluidics devices have at least one "micro" channel.
Such channels may have at least one cross-sectional dimension on
the order of a millimeter or smaller (e.g., less than or equal to
about 1 millimeter). Obviously for certain applications, this
dimension may be adjusted; in some embodiments the at least one
cross-sectional dimension is about 500 micrometers or less. In some
embodiments, again as applications permit, the cross-sectional
dimension is about 100 micrometers or less (or even about 10
micrometers or less--sometimes even about 1 micrometer or less). A
cross-sectional dimension is one that is generally perpendicular to
the direction of centerline flow, although it should be understood
that when encountering flow through elbows or other features that
tend to change flow direction, the cross-sectional dimension in
play need not be strictly perpendicular to flow. It should also be
understood that in some embodiments, a micro-channel may have two
or more cross-sectional dimensions such as the height and width of
a rectangular cross-section or the major and minor axes of an
elliptical cross-section. Either of these dimensions may be
compared against sizes presented here. Note that micro-channels
employed in this invention may have two dimensions that are grossly
disproportionate--e.g., a rectangular cross-section having a height
of about 100-200 micrometers and a width on the order or a
centimeter or more. Of course, certain devices may employ channels
in which the two or more axes are very similar or even identical in
size (e.g., channels having a square or circular
cross-section).
In some embodiments, microfluidic devices of this invention are
fabricated using microfabrication technology. Such technology is
commonly employed to fabricate integrated circuits (ICs),
microelectromechanical devices (MEMS), display devices, and the
like. Among the types of microfabrication processes that can be
employed to produce small dimension patterns in microfluidic device
fabrication are photolithography (including X-ray lithography,
e-beam lithography, etc.), self-aligned deposition and etching
technologies, anisotropic deposition and etching processes,
self-assembling mask formation (e.g., forming layers of
hydrophobic-hydrophilic copolymers), etc.
In view of the above, it should be understood that some of the
principles and design features described herein can be scaled to
larger devices and systems including devices and systems employing
channels reaching the millimeter or even centimeter scale channel
cross-sections. Thus, when describing some devices and systems as
"microfluidic," it is intended that the description apply equally,
in certain embodiments, to some larger scale devices.
When referring to a microfluidic "device" it is generally intended
to represent a single entity in which one or more channels,
reservoirs, stations, etc. share a continuous substrate, which may
or may not be monolithic. A microfluidics "system" may include one
or more microfluidic devices and associated fluidic connections,
electrical connections, control/logic features, etc. Aspects of
microfluidic devices include the presence of one or more fluid flow
paths, e.g., channels, having dimensions as discussed herein.
In certain embodiments, microfluidic devices of this invention
provide a continuous flow of a fluid medium. Fluid flowing through
a channel in a microfluidic device exhibits many interesting
properties. Typically, the dimensionless Reynolds number is
extremely low, resulting in flow that always remains laminar.
Further, in this regime, two fluids joining will not easily mix,
and diffusion alone may drive the mixing of two compounds.
Various features and examples of microfluidic device components
suitable for use with this invention will now be described.
Substrate
Substrates used in microfluidic systems are the supports in which
the necessary elements for fluid transport are provided. The basic
structure may be monolithic, laminated, or otherwise sectioned.
Commonly, substrates include one or more microchannels serving as
conduits for molecular libraries and reagents (if necessary). They
may also include input ports, output ports, and/or features to
assist in flow control.
In certain embodiments, the substrate choice may be dependent on
the application and design of the device. Substrate materials are
generally chosen for their compatibility with a variety of
operating conditions. Limitations in microfabrication processes for
a given material are also relevant considerations in choosing a
suitable substrate. Useful substrate materials include, e.g.,
glass, polymers, silicon, metal, and ceramics.
Polymers are standard materials for microfluidic devices because
they are amenable to both cost effective and high volume
production. Polymers can be classified into three categories
according to their molding behavior: thermoplastic polymers,
elastomeric polymers and duroplastic polymers. Thermoplastic
polymers can be molded into shapes above the glass transition
temperature, and will retain these shapes after cooling below the
glass transition temperature. Elastomeric polymers can be stretched
upon application of an external force, but will go back to original
state once the external force is removed. Elastomers do not melt
before reaching their decomposition temperatures. Duroplastic
polymers have to be cast into their final shape because they soften
a little before the temperature reaches their decomposition
temperature.
Among the polymers that may be used in microfabricated device of
this invention are polyamide (PA), polybutylenterephthalate (PBT),
polycarbonate (PC), polyethylene (PE), polymethylmethacrylate
(PMMA), polyoxymethylene (POM), polypropylene (PP),
polyphenylenether (PPE), polystyrene (PS) and polysulphone (PSU).
The chemical and physical properties of polymers can limit their
uses in microfluidics devices. Specifically in comparison to glass,
the lower resistance against chemicals, the aging, the mechanical
stability, and the UV stability can limit the use of polymers for
certain applications.
Glass, which may also be used as the substrate material, has
specific advantages under certain operating conditions. Since glass
is chemically inert to most liquids and gases, it is particularly
appropriate for applications employing certain solvents that have a
tendency to dissolve plastics. Additionally, its transparent
properties make glass particularly useful for optical or UV
detection.
Surface Treatments and Coatings
Surface modification may be useful for controlling the functional
mechanics (e.g., flow control) of a microfluidic device. For
example, it may be advantageous to keep fluidic species from
adsorbing to channel walls or for attaching antibodies to the
surface for detection of biological components.
Polymer devices in particular tend to be hydrophobic, and thus
loading of the channels may be difficult. The hydrophobic nature of
polymer surfaces also make it difficult to control electroosmotic
flow (EOF). One technique for coating polymer surface is the
application of polyelectrolyte multilayers (PEM) to channel
surfaces. PEM involves filling the channel successively with
alternating solutions of positive and negative polyelectrolytes
allowing for multilayers to form electrostatic bonds. Although the
layers typically do not bond to the channel surfaces, they may
completely cover the channels even after long-term storage. Another
technique for applying a hydrophilic layer on polymer surfaces
involves the UV grafting of polymers to the surface of the
channels. First grafting sites, radicals, are created at the
surface by exposing the surface to UV irradiation while
simultaneously exposing the device to a monomer solution. The
monomers react to form a polymer covalently bonded at the reaction
site.
Glass channels generally have high levels of surface charge,
thereby causing proteins to adsorb and possibly hindering
separation processes. In some situations, it may be advantageous to
apply a polydimethylsiloxane (PDMS) and/or surfactant coating to
the glass channels. Other polymers that may be employed to retard
surface adsorption include polyacrylamide, glycol groups,
polysiloxanes, glyceroglycidoxypropyl, poly(ethyleneglycol) and
hydroxyethylated poly(ethyleneimine) Furthermore, for
electroosmotic devices it is advantageous to have a coating bearing
a charge that is adjustable in magnitude by manipulating conditions
inside of the device (e.g. pH). The direction of the flow can also
be selected based on the coating since the coating can either be
positively or negatively charged.
Specialized coatings can also be applied to immobilize certain
species on the channel surface--this process is known by those
skilled in the art as "functionalizing the surface." For example, a
polymethylmethacrylate (PMMA) surface may be coated with amines to
facilitate attachment of a variety of functional groups or targets.
Alternatively, PMMA surfaces can be rendered hydrophilic through an
oxygen plasma treatment process.
Microfluidic Elements
Microfluidic systems can contain a number of microchannels, valves,
pumps, reactors, mixers and other components. Some of these
components and their general structures and dimensions are
discussed below.
Various types of valves can be used for flow control in
microfluidic devices of this invention. These include, but are not
limited to passive valves and check valves (membrane, flap,
bivalvular, leakage, etc.). Flow rate through these valves are
dependent on various physical features of the valve such as surface
area, size of flow channel, valve material, etc. Valves also have
associated operational and manufacturing advantages/disadvantages
that should be taken into consideration during design of a
microfluidic device.
Micropumps as with other microfluidic components are subjected to
manufacturing constraints. Typical considerations in pump design
include treatment of bubbles, clogs, and durability. Micropumps
currently available include, but are not limited to electric
equivalent pumps, fixed-stroke microdisplacement, peristaltic
micromembrane and pumps with integrated check valves.
Macrodevices rely on turbulent forces such as shaking and stirring
to mix reagents. In comparison, such turbulent forces are not
practically attainable in microdevices, mixing in microfluidic
devices is generally accomplished through diffusion. Since mixing
through diffusion can be slow and inefficient, microstructures are
often designed to enhance the mixing process. These structures
manipulate fluids in a way that increases interfacial surface area
between the fluid regions, thereby speeding up diffusion. In
certain embodiments, microfluidic mixers are employed. Such mixers
may be provide upstream from (and in some cases integrated with) a
microfluidic separation device of this invention.
Micromixers may be classified into two general categories: active
mixers and passive mixers. Active mixers work by exerting active
control over flow regions (e.g. varying pressure gradients,
electric charges, etc.). Passive mixers do not require inputted
energy and use only "fluid dynamics" (e.g. pressure) to drive fluid
flow at a constant rate. One example of a passive mixer involves
stacking two flow streams on top of one another separated by a
plate. The flow streams are contacted with each other once the
separation plate is removed. The stacking of the two liquids
increases contact area and decreases diffusion length, thereby
enhancing the diffusion process. Mixing and reaction devices can be
connected to heat transfer systems if heat management is needed. As
with macro-heat exchangers, micro-heat exchanges can either have
co-current, counter-current, or cross-flow flow schemes.
Microfluidic devices frequently have channel widths and depths
between about 10 .mu.m and about 10 cm. A common channel structure
includes a long main separation channel, and three shorter
"offshoot" side channels terminating in either a buffer, sample, or
waste reservoir. The separation channel can be several centimeters
long, and the three side channels usually are only a few
millimeters in length. Of course, the actual length,
cross-sectional area, shape, and branch design of a microfluidic
device depends on the application as well other design
considerations such as throughput (which depends on flow
resistance), velocity profile, residence time, etc.
Microfluidic devices described herein may include electric field
generators to perform certain steps of the methods described
herein, including, but not limited to, picoinjection, droplet
coalescence, selective droplet fusion, and droplet sorting. In
certain embodiments, the electric fields are generated using metal
electrodes. In particular embodiments, electric fields are
generated using liquid electrodes. In certain embodiments, liquid
electrodes include liquid electrode channels filled with a
conducting liquid (e.g. salt water or buffer) and situated at
positions in the microfluidic device where an electric field is
desired. In particular embodiments, the liquid electrodes are
energized using a power supply or high voltage amplifier. In some
embodiments, the liquid electrode channel includes an inlet port so
that a conducting liquid can be added to the liquid electrode
channel. Such conducting liquid may be added to the liquid
electrode channel, for example, by connecting a tube filled with
the liquid to the inlet port and applying pressure. In particular
embodiments, the liquid electrode channel also includes an outlet
port for releasing conducting liquid from the channel. In
particular embodiments, the liquid electrodes are used in
picoinjection, droplet coalescence, selective droplet fusion,
and/or droplet sorting aspects of a microfluidic device described
herein. Liquid electrodes may find use, for example, where a
material to be injected via application of an electric field is not
charged.
Liquid electrodes as described herein also have applicability
outside of the specific microfluidic device applications discussed
herein. For example, liquid electrodes may be utilized in a variety
of devices in which metal electrodes are generally used. In
addition, liquid electrodes may be particularly well suited for use
in flexible devices, such as devices that are designed to be worn
on the body and/or devices that must flex as a result of their
operation.
In certain embodiments, one or more walls of a microfluidic device
channel immediately down-stream of a junction with one or more of
an input microchannel, pairing microchannel and/or picoinjection
microchannel includes one or more ridges. Such ridges in the walls
of the microchannel are configured to trap a layer of a suitable
phase, e.g., a suitable hydrophobic phase (e.g., oil) and thereby
prevent an immiscible phase, e.g., an aqueous phase, from touching
the walls of the microchannel, which can cause wetting of the
channel walls. Such wetting may be undesirable as it may lead to
unpredictable drop formation and/or allow fluids to transfer
between drops, leading to contamination. In certain embodiments,
the ridges allow for the formation of drops at higher flow rate
ratios R (Q.sub.aq/Q.sub.sum).
In certain embodiments, the width of one or more of the
microchannels of the microfluidic device (e.g., input microchannel,
pairing microchannel, pioinjection microchannel, and/or a flow
channel upstream or downstream of one or more of these channels) is
100 microns or less, e.g., 90 microns or less, 80 microns or less,
70 microns or less, 60 microns or less, 50 microns or less, 45
microns or less, 40 microns or less, 39 microns or less, 38 microns
or less, 37 microns or less, 36 microns or less, 35 microns or
less, 34 microns or less, 33 microns or less, 32 microns or less,
31 microns or less, 30 microns or less, 29 microns or less, 28
microns or less, 27 microns or less, 26 microns or less, 25 microns
or less, 20 microns or less. 15 microns or less, or 10 microns or
less. In some embodiments, the width of one or more of the above
microchannels is from about 10 microns to about 15 microns, from
about 15 microns to about 20 microns, from about 20 microns to
about 25 microns, from about 25 microns to about 30 microns, from
about 30 microns to about 35 microns, from about 35 microns to
about 40 microns, from about 40 microns to about 45 microns, or
from about 45 microns to about 50 microns, from about 50 microns to
about 60 microns, from about 60 microns to about 70 microns, from
about 70 microns to about 80 microns, from about 80 microns to
about 90 microns, or from about 90 microns to about 100
microns.
In certain embodiments, the base of each of the one or more ridges
is from about 10 microns to about 20 microns in length, e.g., from
about 11 to about 19 microns in length, from about 12 to about 18
microns in length, from about 13 to about 17 microns in length,
from about 14 to about 16 microns in length, or about 15 microns in
length.
In certain embodiments, the peak of each of the one or more ridges
has a width of about 1 to about 10 microns, e.g., from about 1 to
about 9 microns, from about 2 to about 8 microns, from about 3 to
about 7 microns, from about 4 to about 6 microns, or about 5
microns. In certain embodiments, the peak of each of the one or
more ridges has a width of from about 1 micron to about 2 microns,
from about 2 microns to about 3 microns, from about 3 microns to
about 4 microns, from about 4 microns to about 5 microns, from
about 5 microns to about 6 microns, from about 6 microns to about 7
microns, from about 7 microns to about 8 microns, from about 8
microns to about 9 microns, or from about 9 microns to about 10
microns.
In certain embodiments, the height of each of the one or more
ridges is from about 5 microns to about 15 microns, e.g., about 6
microns to about 14 microns, about 7 microns to about 13 microns,
about 8 microns to about 12 microns, about 9 microns to about 11
microns, or about 10 microns.
In certain embodiments, the ratio of the base of each of the one or
more ridges to the height of each of the one or more ridges is from
about 1.0:0.75 to about 0.75:1.0. In certain embodiments, the ratio
of the base of each of the one or more ridges to the width of the
peak of each of the one or more ridges is about 1.0:0.5 to about
1.0:0.1, e.g, from about 1.0:0.2, from about 1.0:0.3, or from about
1.0:0.4.
In certain embodiments, the ratio of the base of each of the one or
more ridges to the height of each of the one or more ridges to the
width of the peak of the one or more ridges is about
1:0.75:0.5.
In certain embodiments, a channel as described herein is provided
with a plurality of ridges which extend for a distance along the
channel wall. This distance may be, for example, from about 50
microns to about 500 microns, e.g., from about 50 microns to about
450 microns, from about 100 microns to about 400 microns, from
about 150 microns to about 350 microns, from about 200 microns to
about 300 microns, or about 250 microns. In certain embodiments, a
plurality of ridges may be provided which extend for a distance
along the channel wall, wherein the ratio between the distance
along the channel wall and the width of the channel is from about
10:1 to about 1:2, e.g., about 10:1, about 9:1, about 8:1, about
7:1, about 6:1 about 5:1, about 4:1, about 3:1, about 2:1, about
1:1, or about 1:2.
It should be noted that one or more of the various dimensions
discussed above may be scaled up or down as appropriate for a
particular application, for example each of the above dimensions
may be scaled up or down by a factor of 2, 5, 10 or more as
appropriate.
In some embodiments, one or more channel junctions, e.g., one or
more droplet forming junctions, such as a picoinjector junction,
include a "step-down" structure. This is depicted, for example, in
FIG. 26, wherein the portion of the flow channel at the
picoinjector junction and downstream of the picoinjector junction
is wider than the portion of the flow channel upstream of the
picoinjector junction. This step-down structure facilitates the
pinching-off of droplets and thus facilitates droplet formation.
The step size may be chosen based on the desired size of the
droplet to be formed, with larger steps creating larger droplets.
Such structures may also help to avoid dripping of material from
the picoinjector following injection from the picoinjector into a
droplet. In some embodiments, the width of the flow channel at the
picoinjector junction and downstream of the picoinjector junction
is from about 5% to about 50% wider than the width of the flow
channel immediately upstream of the picoinjector junction, e.g.,
about 5 to about 10% wider, about 10 to about 20% wider, about 20
to about 30% wider, about 30 to about 40% wider or about 40 to
about 50% wider.
Methods of Fabrication
Microfabrication processes differ depending on the type of
materials used in the substrate and the desired production volume.
For small volume production or prototypes, fabrication techniques
include LIGA, powder blasting, laser ablation, mechanical
machining, electrical discharge machining, photoforming, etc.
Technologies for mass production of microfluidic devices may use
either lithographic or master-based replication processes.
Lithographic processes for fabricating substrates from
silicon/glass include both wet and dry etching techniques commonly
used in fabrication of semiconductor devices. Injection molding and
hot embossing typically are used for mass production of plastic
substrates.
Glass, Silicon and Other "Hard" Materials (Lithography, Etching,
Deposition)
The combination of lithography, etching and deposition techniques
may be used to make microcanals and microcavities out of glass,
silicon and other "hard" materials. Technologies based on the above
techniques are commonly applied in for fabrication of devices in
the scale of 0.1-500 micrometers.
Microfabrication techniques based on current semiconductor
fabrication processes are generally carried out in a clean room.
The quality of the clean room is classified by the number of
particles <4 .mu.m in size in a cubic inch. Typical clean room
classes for MEMS microfabrication are 1000 to 10000.
In certain embodiments, photolithography may be used in
microfabrication. In photolithography, a photoresist that has been
deposited on a substrate is exposed to a light source through an
optical mask. Conventional photoresist methods allow structural
heights of up to 10-40 .mu.m. If higher structures are needed,
thicker photoresists such as SU-8, or polyimide, which results in
heights of up to 1 mm, can be used.
After transferring the pattern on the mask to the
photoresist-covered substrate, the substrate is then etched using
either a wet or dry process. In wet etching, the substrate--area
not protected by the mask--is subjected to chemical attack in the
liquid phase. The liquid reagent used in the etching process
depends on whether the etching is isotropic or anisotropic.
Isotropic etching generally uses an acid to form three-dimensional
structures such as spherical cavities in glass or silicon.
Anisotropic etching forms flat surfaces such as wells and canals
using a highly basic solvent. Wet anisotropic etching on silicon
creates an oblique channel profile.
Dry etching involves attacking the substrate by ions in either a
gaseous or plasma phase. Dry etching techniques can be used to
create rectangular channel cross-sections and arbitrary channel
pathways. Various types of dry etching that may be employed
including physical, chemical, physico-chemical (e.g., RIE), and
physico-chemical with inhibitor. Physical etching uses ions
accelerated through an electric field to bombard the substrate's
surface to "etch" the structures. Chemical etching may employ an
electric field to migrate chemical species to the substrate's
surface. The chemical species then reacts with the substrate's
surface to produce voids and a volatile species.
In certain embodiments, deposition is used in microfabrication.
Deposition techniques can be used to create layers of metals,
insulators, semiconductors, polymers, proteins and other organic
substances. Most deposition techniques fall into one of two main
categories: physical vapor deposition (PVD) and chemical vapor
deposition (CVD). In one approach to PVD, a substrate target is
contacted with a holding gas (which may be produced by evaporation
for example). Certain species in the gas adsorb to the target's
surface, forming a layer constituting the deposit. In another
approach commonly used in the microelectronics fabrication
industry, a target containing the material to be deposited is
sputtered with using an argon ion beam or other appropriately
energetic source. The sputtered material then deposits on the
surface of the microfluidic device. In CVD, species in contact with
the target react with the surface, forming components that are
chemically bonded to the object. Other deposition techniques
include: spin coating, plasma spraying, plasma polymerization, dip
coating, casting and Langmuir-Blodgett film deposition. In plasma
spraying, a fine powder containing particles of up to 100 .mu.m in
diameter is suspended in a carrier gas. The mixture containing the
particles is accelerated through a plasma jet and heated. Molten
particles splatter onto a substrate and freeze to form a dense
coating. Plasma polymerization produces polymer films (e.g. PMMA)
from plasma containing organic vapors.
Once the microchannels, microcavities and other features have been
etched into the glass or silicon substrate, the etched features are
usually sealed to ensure that the microfluidic device is
"watertight." When sealing, adhesion can be applied on all surfaces
brought into contact with one another. The sealing process may
involve fusion techniques such as those developed for bonding
between glass-silicon, glass-glass, or silicon-silicon.
Anodic bonding can be used for bonding glass to silicon. A voltage
is applied between the glass and silicon and the temperature of the
system is elevated to induce the sealing of the surfaces. The
electric field and elevated temperature induces the migration of
sodium ions in the glass to the glass-silicon interface. The sodium
ions in the glass-silicon interface are highly reactive with the
silicon surface forming a solid chemical bond between the surfaces.
The type of glass used should ideally have a thermal expansion
coefficient near that of silicon (e.g. Pyrex Corning 7740).
Fusion bonding can be used for glass-glass or silicon-silicon
sealing. The substrates are first forced and aligned together by
applying a high contact force. Once in contact, atomic attraction
forces (primarily van der Waals forces) hold the substrates
together so they can be placed into a furnace and annealed at high
temperatures. Depending on the material, temperatures used ranges
between about 600 and 1100.degree. C.
Polymers/Plastics
A number of techniques may be employed for micromachining plastic
substrates in accordance with embodiments of this invention. Among
these are laser ablation, stereolithography, oxygen plasma etching,
particle jet ablation, and microelectro-erosion. Some of these
techniques can be used to shape other materials (glass, silicon,
ceramics, etc.) as well.
To produce multiple copies of a microfluidic device, replication
techniques are employed. Such techniques involve first fabricating
a master or mold insert containing the pattern to be replicated.
The master is then used to mass-produce polymer substrates through
polymer replication processes.
In the replication process, the master pattern contained in a mold
is replicated onto the polymer structure. In certain embodiments, a
polymer and curing agent mix is poured onto a mold under high
temperatures. After cooling the mix, the polymer contains the
pattern of the mold, and is then removed from the mold.
Alternatively, the plastic can be injected into a structure
containing a mold insert. In microinjection, plastic heated to a
liquid state is injected into a mold. After separation and cooling,
the plastic retains the mold's shape.
PDMS (polydimethylsiloxane), a silicon-based organic polymer, may
be employed in the molding process to form microfluidic structures.
Because of its elastic character, PDMS is well suited for
microchannels between about 5 and 500 .mu.m. Specific properties of
PDMS make it particularly suitable for microfluidic purposes: 1) It
is optically clear which allows for visualization of the flows; 2)
PDMS when mixed with a proper amount of reticulating agent has
elastomeric qualities that facilitates keeping microfluidic
connections "watertight;" 3) Valves and pumps using membranes can
be made with PDMS because of its elasticity; 4) Untreated PDMS is
hydrophobic, and becomes temporarily hydrophilic after oxidation of
surface by oxygen plasma or after immersion in strong base;
oxidized PDMS adheres by itself to glass, silicon, or polyethylene,
as long as those surfaces were themselves exposed to an oxygen
plasma. 5) PDMS is permeable to gas. Filling of the channel with
liquids is facilitated even when there are air bubbles in the canal
because the air bubbles are forced out of the material. But it's
also permeable to non polar-organic solvents.
Microinjection can be used to form plastic substrates employed in a
wide range of microfluidic designs. In this process, a liquid
plastic material is first injected into a mold under vacuum and
pressure, at a temperature greater than the glass transition
temperature of the plastic. The plastic is then cooled below the
glass transition temperature. After removing the mold, the
resulting plastic structure is the negative of the mold's
pattern.
Yet another replicating technique is hot embossing, in which a
polymer substrate and a master are heated above the polymer's glass
transition temperature, Tg (which for PMMA or PC is around
100-180.degree. C.). The embossing master is then pressed against
the substrate with a preset compression force. The system is then
cooled below Tg and the mold and substrate are then separated.
Typically, the polymer is subjected to the highest physical forces
upon separation from the mold tool, particularly when the
microstructure contains high aspect ratios and vertical walls. To
avoid damage to the polymer microstructure, material properties of
the substrate and the mold tool may be taken into consideration.
These properties include: sidewall roughness, sidewall angles,
chemical interface between embossing master and substrate and
temperature coefficients. High sidewall roughness of the embossing
tool can damage the polymer microstructure since roughness
contributes to frictional forces between the tool and the structure
during the separation process. The microstructure may be destroyed
if frictional forces are larger than the local tensile strength of
the polymer. Friction between the tool and the substrate may be
important in microstructures with vertical walls. The chemical
interface between the master and substrate could also be of
concern. Because the embossing process subjects the system to
elevated temperatures, chemical bonds could form in the
master-substrate interface. These interfacial bonds could interfere
with the separation process. Differences in the thermal expansion
coefficients of the tool and the substrate could create addition
frictional forces.
Various techniques can be employed to form molds, embossing
masters, and other masters containing patterns used to replicate
plastic structures through the replication processes mentioned
above. Examples of such techniques include LIGA (described below),
ablation techniques, and various other mechanical machining
techniques. Similar techniques can also be used for creating masks,
prototypes and microfluidic structures in small volumes. Materials
used for the mold tool include metals, metal alloys, silicon and
other hard materials.
Laser ablation may be employed to form microstructures either
directly on the substrate or through the use of a mask. This
technique uses a precision-guided laser, typically with wavelength
between infrared and ultraviolet. Laser ablation may be performed
on glass and metal substrates, as well as on polymer substrates.
Laser ablation can be performed either through moving the substrate
surface relative to a fixed laser beam, or moving the beam relative
to a fixed substrate. Various micro-wells, canals, and high aspect
structures can be made with laser ablation.
Certain materials such as stainless steel make very durable mold
inserts and can be micromachined to form structures down to the
10-.mu.m range. Various other micromachining techniques for
microfabrication exist including .mu.-Electro Discharge Machining
(.mu.-EDM), .mu.-milling, focused ion beam milling. .mu.-EDM allows
the fabrication of 3-dimensional structures in conducting
materials. In .mu.-EDM, material is removed by high-frequency
electric discharge generated between an electrode (cathode tool)
and a workpiece (anode). Both the workpiece and the tool are
submerged in a dielectric fluid. This technique produces a
comparatively rougher surface but offers flexibility in terms of
materials and geometries.
Electroplating may be employed for making a replication mold
tool/master out of, e.g., a nickel alloy. The process starts with a
photolithography step where a photoresist is used to defined
structures for electroplating. Areas to be electroplated are free
of resist. For structures with high aspect ratios and low roughness
requirements, LIGA can be used to produce electroplating forms.
LIGA is a German acronym for Lithographic (Lithography),
Galvanoformung (electroplating), Abformung (molding). In one
approach to LIGA, thick PMMA layers are exposed to x-rays from a
synchrotron source. Surfaces created by LIGA have low roughness
(around 10 nm RMS) and the resulting nickel tool has good surface
chemistry for most polymers.
As with glass and silicon devices, polymeric microfluidic devices
must be closed up before they can become functional. Common
problems in the bonding process for microfluidic devices include
the blocking of channels and changes in the physical parameters of
the channels. Lamination is one method used to seal plastic
microfluidic devices. In one lamination process, a PET foil (about
30 .mu.m) coated with a melting adhesive layer (typically 5-10
.mu.m) is rolled with a heated roller, onto the microstructure.
Through this process, the lid foil is sealed onto the channel
plate. Several research groups have reported a bonding by
polymerization at interfaces, whereby the structures are heated and
force is applied on opposite sides to close the channel. But
excessive force applied may damage the microstructures. Both
reversible and irreversible bonding techniques exist for
plastic-plastic and plastic-glass interfaces. One method of
reversible sealing involves first thoroughly rinsing a PDMS
substrate and a glass plate (or a second piece of PDMS) with
methanol and bringing the surfaces into contact with one another
prior to drying. The microstructure is then dried in an oven at
65.degree. C. for 10 min. No clean room is required for this
process. Irreversible sealing is accomplished by first thoroughly
rinsing the pieces with methanol and then drying them separately
with a nitrogen stream. The two pieces are then placed in an air
plasma cleaner and oxidized at high power for about 45 seconds. The
substrates are then brought into contact with each other and an
irreversible seal forms spontaneously.
Other available techniques include laser and ultrasonic welding. In
laser welding, polymers are joined together through laser-generated
heat. This method has been used in the fabrication of micropumps.
Ultrasonic welding is another bonding technique that may be
employed in some applications.
The nucleic acid amplification technique described here is a
polymerase chain reaction (PCR). However, in certain embodiments,
non-PCR amplification techniques may be employed such as various
isothermal nucleic acid amplification techniques; e.g., real-time
strand displacement amplification (SDA), rolling-circle
amplification (RCA) and multiple-displacement amplification
(MDA).
Regarding PCR amplification modules, it will be necessary to
provide to such modules at least the building blocks for amplifying
nucleic acids (e.g., ample concentrations of four nucleotides),
primers, polymerase (e.g., Taq), and appropriate temperature
control programs). The polymerase and nucleotide building blocks
may be provided in a buffer solution provided via an external port
to the amplification module or from an upstream source. In certain
embodiments, the buffer stream provided to the sorting module
contains some of all the raw materials for nucleic acid
amplification. For PCR in particular, precise temperature control
of the reacting mixture is extremely important in order to achieve
high reaction efficiency. One method of on-chip thermal control is
Joule heating in which electrodes are used to heat the fluid inside
the module at defined locations. The fluid conductivity may be used
as a temperature feedback for power control.
In certain aspects, the drops containing the PCR mix may be flowed
through a channel that incubates the droplets under conditions
effective for PCR. Flowing the microdroplets through a channel may
involve a channel that snakes over various temperature zones
maintained at temperatures effective for PCR. Such channels may,
for example, cycle over two or more temperature zones, wherein at
least one zone is maintained at about 65.degree. C. and at least
one zone is maintained at about 95.degree. C. As the drops move
through such zones, their temperature cycles, as needed for PCR.
The precise number of zones, and the respective temperature of each
zone, may be readily determined by those of skill in the art to
achieve the desired PCR amplification.
In other embodiments, incubating the microdroplets may involve the
use of a Megadroplet Array. In such a device, an array consists of
channels in which the channel ceilings are indented with millions
of circular traps that are about 25 .mu.m in diameter. Drops are
distributed into the trapping channels using distribution
plates--large channels connecting the inlets of the trapping
channels (FIG. 12, Panel A). Due to the large size of the
distribution channels compared to the trapping channels--the
distribution channels are about 100.times.500 .mu.m in height and
width, compared to only about 15.times.100 .mu.m for the droplet
trapping channels--the hydrodynamic resistance of the distribution
channels is .about.1500 times lower than that of the trapping
channels; this ensures that the distribution channel fills with
drops before the trapping channels begin to fill, allowing even
distribution of the drops into the trapping channels. When the
drops flow into the trapping channels, they are slightly pancaked
in shape because the vertical height of the channel is 15 .mu.m, or
10 .mu.m shorter than the drops, as illustrated in FIG. 12, Panel
B. When a drop nears a trap, its interface adopts a larger, more
energetically favorable radius of curvature. To minimize its
surface energy, the drop entirely fills the trap, allowing it to
adopt the lowest, most energetically favorable, average radius of
curvature. After a trap is occupied by a drop, no other drops are
able to enter because the trap is large enough to fit only one
drop; additional drops are diverted downstream, to occupy the first
vacant trap they encounter. Because the array is filled using a
close-packed emulsion, every trap will be occupied by a drop, since
this is the most energetically favorable state under low flow
conditions. After the droplet array is filled, oil is injected to
remove excess drops and the array is thermal cycled and imaged.
A variety of different ways can be used to fill the traps of the
device. For instance, buoyancy effects and centrifugation can also
be used to fill and empty the traps by flipping the device with
respect to the earth's gravitational field, since the droplet
density is 63% that of the fluorocarbon carrier oil. That is, if
the drops were heavier than the oil phase, then the wells could be
imprinted into the "floor" of the device so that when the emulsion
was flowed over it, the drops would sink into the wells. The flow
rate of the emulsion could be adjusted to optimize this and the
drop size would be made to be approximately the same size as the
well so that the well could only fit a single drop at a time. In
other aspects, the drops could also, or instead, be stored in a
large chamber with no wells.
The device may achieve thermal cycling using a heater consisting of
a Peltier plate, heat sink, and control computer (FIG. 12, Panel A;
FIG. 13). The Peltier plate allows heating and/or cooling the chip
above or below room temperature by controlling the applied current.
To ensure controlled and reproducible temperature, a computer
monitors the temperature of the array using integrated temperature
probes, and adjusts the applied current to heat and cool as needed.
A metallic (e.g., copper) plate allows uniform application of heat
and dissipation of excess heat during cooling cycles, enabling
cooling from 95.degree. C. to 60.degree. C. in under 1 min
execution. In order to image microdroplets, certain embodiments may
incorporate a scanner bed. In certain aspects, the scanner bed is a
Canoscan 9000F scanner bed.
In order to effectively amplify nucleic acids from target
components, the microfluidics system may include a cell lysing or
viral protein coat-disrupting module to free nucleic acids prior to
providing the sample to an amplification module. Cell lysing
modules may rely on chemical, thermal, and/or mechanical means to
effect cell lysis. Because the cell membrane consists of a lipid
double-layer, lysis buffers containing surfactants can solubilize
the lipid membranes. Typically, the lysis buffer will be introduced
directly to a lysis chamber via an external port so that the cells
are not prematurely lysed during sorting or other upstream process.
In cases where organelle integrity is necessary, chemical lysis
methods may be inappropriate. Mechanical breakdown of the cell
membrane by shear and wear is appropriate in certain applications.
Lysis modules relying mechanical techniques may employ various
geometric features to effect piercing, shearing, abrading, etc. of
cells entering the module. Other types of mechanical breakage such
as acoustic techniques may also yield appropriate lysate. Further,
thermal energy can also be used to lyse cells such as bacteria,
yeasts, and spores. Heating disrupts the cell membrane and the
intracellular materials are released. In order to enable
subcellular fractionation in microfluidic systems a lysis module
may also employ an electrokinetic technique or electroporation.
Electroporation creates transient or permanent holes in the cell
membranes by application of an external electric field that induces
changes in the plasma membrane and disrupts the transmembrane
potential. In microfluidic electroporation devices, the membrane
may be permanently disrupted, and holes on the cell membranes
sustained to release desired intracellular materials released.
Single Cell RT-PCR Microfluidic Device
In another aspect, provided herein is a single cell RT-PCR
microfluidic device, described in greater detail below with
reference to FIG. 32. In certain embodiments, the single cell
RT-PCR microfluidic device includes an input microchannel, which
may be coupled to a flow focus drop maker, for introducing
microdroplets into the microfluidic device, wherein the flow focus
drop maker spaces the microdroplets in the input microchannel,
e.g., by a volume of a suitable hydrophobic phase, e.g., oil,
wherein each microdroplet may include a cell lysate sample. An
exemplary embodiment is shown in FIG. 32 (Panel A).
The microfluidic device may further include a pairing microchannel
in fluidic communication with the input microchannel and a dilution
buffer drop maker in fluidic communication with the pairing
microchannel. In such embodiments, a microdroplet from the input
microchannel flows into the pairing microchannel where the dilution
buffer drop maker produces a drop of dilution buffer that is larger
than and paired with each microdroplet. In certain embodiments, the
dilution buffer drop maker is a T-junction drop maker. An exemplary
embodiment is shown in FIG. 32 (Panel B).
The microfluidic device may also include a merging microchannel in
fluidic communication with the pairing microchannel, the merging
microchannel including an electric field generator positioned in
proximity thereto. In such embodiments, the paired microdroplet and
drop of dilution buffer enter the merging microchannel from the
pairing microchannel and are merged upon passing through an
electric field produced by the electric field generator to produce
a diluted microdroplet. Any suitable electric field generator can
be used to produce the diluted microdroplet. In certain
embodiments, the electric field is created by metal electrodes. In
other embodiments, the electric field is created by liquid
electrodes as discussed herein. An exemplary embodiment is shown in
FIG. 32 (Panel C).
The microfluidic device may also include a series of mixing
microchannels in fluidic communication with the merging
microchannel. Such mixing microchannels allow for the mixing of the
contents of the diluted microdroplet.
The microfluidic device may also include a drop sampler in fluidic
communication with the mixing microchannels. Such a drop sampler is
capable of taking a sample of the diluted microdroplet, e.g., to be
used in a subsequent RT-PCR reaction carried out in the
microfluidic device. An exemplary embodiment is shown in FIG. 32
(Panel D).
The microfluidic may also include a picoinjection microchannel
comprising a picoinjector, wherein the picoinjection microchannel
may be a pressurized microchannel capable of receiving the sample
of the diluted microdroplet produced by the drop sampler and
allowing the picoinejctor to picoinject RT-PCR reagents into the
sample. In certain embodiments the picoinjection is assisted by an
electric field applied to the picoinjection microchannel. Any
electric field generator can be used to create an electric field
for picoinjection. In certain embodiments, the electric field is
created by metal electrodes. In other embodiments, the electric
field is created by liquid electrodes as discussed herein. An
exemplary embodiment is shown in FIG. 32 (Panel E).
Samples of the diluted microdroplet that have been picoinjected
with RT-PCR reagents can then be subjected to conditions for RT-PCR
using any of the approaches described herein. The single cell
RT-PCR microfluidic device advantageously allows for the dilution
of the cell lysate sample prior to addition of RT-PCR agents. Such
dilution helps in prevent inhibition of RT-PCR that may be caused
by components of the cell lysate. In certain embodiments, the
microfluidic device also includes an encapsulating chamber in
fluidic communication with the input microchannel, for
encapsulating a cell and lysis regeant into a microdroplet. In such
embodiments, the input microchannel is capable of receiving the
microdroplet from the encapsulating chamber.
Certain non-limiting aspects of the disclosure are provided below:
1. A method for the detection of cells, the method including:
encapsulating in a microdroplet a cell obtained from a biological
sample from a subject, wherein at least one cell is present in the
microdroplet; incubating the microdroplet under conditions
effective for cell lysis; introducing polymerase chain reaction
(PCR) reagents, a detection component, and a plurality of PCR
primers into the microdroplet and incubating the microdroplet under
conditions allowing for PCR amplification to produce PCR
amplification products, wherein the plurality of PCR primers
include one or more primers that each hybridize to one or more
oligonucleotides; and detecting the presence or absence of the PCR
amplification products by detection of the detection component,
wherein detection of the detection component indicates the presence
of PCR amplification products; wherein one or more steps are
performed under microfluidic control. 2. The method according to 1,
wherein incubating the microdroplet under conditions effective for
cell lysis includes introducing a lysing agent into the
microdroplet. 3. The method according to 1 or 2, wherein the one or
more oligonucleotides are oncogenes. 4. The method according to any
of 1-3, wherein the biological sample is blood and the method
includes determining the number of circulating tumor cells (CTCs)
present in the sample of the subject's blood based at least in part
on the number of microdroplets in which PCR amplification products
were detected. 5. The method according to any of 1-4, wherein all
steps are performed under microfluidic control. 6. The method
according to 5, wherein all steps are performed on the same
microfluidic device. 7. The method according to any of the above,
wherein the plurality of PCR primers includes 10 or more primers.
8. The method according to any of the above, wherein the plurality
of PCR primers includes 20 to 100 primers. 9. The method according
to any of the above, wherein the plurality of PCR primers includes
primers for 10 or more oncogenes. 10. The method according to any
of the above, wherein incubating the microdroplet under conditions
allowing for PCR amplification is performed on the same
microfluidic device used to encapsulate the cells and lyse the
cells. 11. The method according to any of the above, wherein the
PCR reagents and PCR primers are added at the same time as the
lysing agent. 12. The method according to any of the above, wherein
the PCR reagents are added in two steps or more. 13. The method
according to any of the above, further including introducing a
probe into the microdroplet. 14. The method according to 13,
wherein the probe is introduced prior to incubating the
microdroplet under conditions allowing for PCR amplification. 15.
The method according to 13 or 14, wherein the probe is a
TaqMan.RTM. probe. 16. The method according to any of the above,
wherein a reagent is added to the microdroplet by merging the
microdroplet with a second microdroplet including the reagent. 17.
The method according to any of the above, wherein a reagent is
added to the microdroplet using either droplet coalescence or
picoinjection. 18. The method according to any of the above,
wherein a reagent is added to the microdroplet by a method
including: a) emulsifying the reagent into a stream of droplets,
wherein the droplets are smaller than the size of the microdroplet;
b) flowing the droplets together with the microdroplet; and c)
merging a droplet with the microdroplet. 19. The method according
to 18, wherein the diameter of the droplets is 25% or less than
that of the diameter of the microdroplet, and a plurality of
droplets are merged with the microdroplet. 20. The method according
to 18 or 19, wherein the merging includes applying an electric
field. 21. The method according to any of the above, wherein a
reagent is added to the microdroplet by a method including: a)
jetting the reagent into a fluid jet; b) flowing the fluid jet
alongside the microdroplet; and c) merging a droplet with the
microdroplet. 22. The method according to 21, wherein merging
includes applying an electric field. 23. The method according to 21
or 22, wherein jetting the reagent includes adding a
viscosity-increasing agent or surfactant. 24. The method according
to any of the above, wherein a reagent is added to the microdroplet
by a method including using a fluid injected into the microdroplet
as an electrode. 25. The method according to any of the above,
wherein the detection component is detected based on a change in
fluorescence. 26. The method according to 25, where in the change
in fluorescence is due to fluorescence resonance energy transfer
(FRET). 27. The method according to 25, where in the change in
fluorescence is due to fluorescence polarization. 28. The method
according to 25 or 27, wherein the detection component is an
intercalating stain. 29. The method according to any of the above,
wherein detecting the presence or absence of the PCR amplification
products includes repeatedly imaging the microdroplet. 30. The
method according to 29, wherein the microdroplet is repeatedly
imaged while the microdroplet is subjected to conditions allowing
for PCR amplification to produce the PCR amplification products.
31. The method according to any of the above, wherein incubating
the microdroplet under conditions allowing for PCR amplification
and detecting the presence or absence of the PCR amplification
products are performed on a Megadroplet Array. 32. The method
according to any of the above, including sorting a microdroplet.
33. The method according to 32, wherein the sorting includes using
membrane valves, bifurcating channels, surface acoustic waves, or
dielectrophoresis. 34. The method according to 32 or 33, wherein
the microdroplet is sorted based on a property including size,
viscosity, mass, buoyancy, surface tension, electrical
conductivity, charge, or magnetism. 35. The method according to any
of 32-34, including sorting based at least in part based upon the
detection of the presence or absence of PCR amplification products.
36. The method according to any of 32-35, wherein the microdroplet
is sorted prior to the introduction of a PCR reagent. 37. The
method according to any of 32-36, wherein the microdroplet is
sorted prior to the introduction of a lysing agent. 38. The method
according to any of the above, further including: injecting a
diluent into the microdroplet; and flowing the microdroplet through
a microfluidic channel on which an electric field is being applied,
under conditions in which the microdroplet is split. 39. The method
according to any of the above, wherein the subject is mammalian.
40. The method according to any of the above, wherein the subject
is human. 41. The method according to any of the above, wherein the
subject has been diagnosed with cancer. 42. The method according to
any of the above, wherein the biological sample is a blood sample.
43. The method of 42, wherein the blood sample is whole blood. 44.
The method of 42 or 43, including fractionating the blood sample.
45. The method of any one of 42-44, including drawing 30 mL or less
of the subject's blood. 46. The method of 45, wherein the blood
sample is 15 mL or less. 47. The method of any one of the above,
including fixing and/or permeabilizing the cell. 48. The method of
any one of the above, including introducing a plurality of
different detection components, and detecting the presence or
absence of the PCR amplification products by detection of the
plurality of detection components, wherein detection of the
detection components indicates the presence of PCR amplification
products. 49. The method of any one of the above, including
contacting the cell or a component thereof with a detectably
labeled antibody. 50. A method for the detection of tumor cells,
the method including: encapsulating a plurality of cells in a
plurality of microdroplets under conditions in which a majority of
microdroplets include zero or one cell, wherein the plurality of
cells are obtained from a subject's blood sample suspected of
containing circulating tumor cells (CTCs); enriching the plurality
of microdroplets for microdroplets containing one cell; introducing
a lysing agent into the plurality of microdroplets and incubating
under conditions effective for cell lysis; introducing polymerase
chain reaction (PCR) reagents, a detection component, and a
plurality of PCR primers into the plurality of microdroplets and
incubating the plurality of microdroplets under conditions allowing
for PCR amplification to produce PCR amplification products,
wherein the plurality of PCR primers include one or more primers
that each hybridize to one or more oncogenes; detecting the
presence or absence of the PCR amplification products by detection
of the detection component, wherein detection of the detection
component indicates the presence of the PCR amplification products;
and determining the number of CTCs present in a sample of the
subject's blood based at least in part on the number of
microdroplets in which the PCR amplification products were
detected; wherein one or more steps are performed under
microfluidic control. 51. The method according to 50, wherein all
steps are all performed under microfluidic control. 52. The method
according to 50 or 51, wherein all steps are performed on the same
microfluidic device. 53. The method according to any of 50-52,
wherein the plurality of PCR primers includes 10 or more primers.
54. The method according to any of 50-53, wherein the plurality of
PCR primers includes primers for 10 or more oncogenes. 55. The
method according to any of 50-54, wherein the plurality of PCR
primers includes a plurality of probes. 56. The method according to
55, wherein the probes include TaqMan.RTM. probes. 57. The method
according to any of 50-56, wherein the PCR reagents are added in
two steps or more. 58. The method according to any of 50-57,
further including introducing a probe into the microdroplet. 59.
The method according to any of 50-58, wherein a reagent is added to
the plurality of microdroplets by merging a microdroplet with a
second microdroplet including the reagent. 60. The method according
to any of 50-59, wherein a reagent is added to the plurality of
microdroplets using either droplet coalescence or picoinjection.
61. The method according to any of 50-60, wherein a reagent is
added to the plurality of microdroplets by a method including: a)
emulsifying the reagent into a stream of droplets, wherein the
droplets are smaller than the size of a microdroplet; b) flowing
the droplets together with the microdroplet; and c) merging a
droplet with the microdroplet. 62. The method according to 58,
wherein the merging includes applying an electric field. 63. The
method according to any of 50-62, wherein a reagent is added to the
plurality of microdroplets by a method including: a) jetting the
reagent into a fluid jet; b) flowing the fluid jet alongside a
microdroplet; and c) merging a droplet with the microdroplet. 64.
The method according to any of 50-63, wherein a reagent is added to
the microdroplet by a method including using a fluid injected into
the microdroplet as an electrode. 65. The method according to any
of 50-64, including sorting a microdroplet. 66. The method
according to 65, wherein the plurality of microdroplets is sorted
based on a property including size, viscosity, mass, buoyancy,
surface tension, electrical conductivity, charge, or magnetism. 67.
The method according to any of 65-66, wherein the plurality of
microdroplets is sorted prior to the introduction of a PCR reagent.
68. The method according to any of 50-67, wherein detecting the
presence or absence of the PCR amplification products includes
repeatedly imaging the plurality of microdroplets. 69. The method
according to 68, wherein the plurality of microdroplets is
repeatedly imaged while the plurality of microdroplets is subjected
to conditions allowing for PCR amplification to produce the PCR
amplification products. 70. The method according to any of 50-69,
wherein incubating the plurality of microdroplets under conditions
allowing for PCR amplification and detecting the presence or
absence of the PCR amplification products are performed on a
Megadroplet Array. 71. The method according to any of 50-70,
wherein the subject is mammalian. 72. The method according to any
of 50-71, wherein the subject is human. 73. The method according to
any of 50-72, wherein the subject has been diagnosed with cancer.
74. A method for genotyping of cells, the method including:
encapsulating in a microdroplet a cell obtained from a biological
sample from a subject, wherein one cell is present in the
microdroplet; introducing a lysing agent into the microdroplet and
incubating the microdroplet under conditions effective for cell
lysis; introducing polymerase chain reaction (PCR) reagents and a
plurality PCR primers into the microdroplet, and incubating the
microdroplet under conditions allowing for PCR amplification to
produce PCR amplification products, wherein the plurality of PCR
primers include one or more primers that each hybridize to one or
more oncogenes; introducing a plurality of probes into the
microdroplet, wherein the probes hybridize to one or more mutations
of interest and fluoresce at different wavelengths; and detecting
the presence or absence of specific PCR amplification products by
detection of fluorescence of a probe, wherein detection of
fluorescence indicates the presence of the PCR amplification
products; wherein one or more of steps are performed under
microfluidic control. 75. The method according to 74, wherein the
probes include TaqMan.RTM. probes. 76. The method according to 74
or 75, wherein detecting the presence or absence of specific PCR
amplification products by detection of fluorescence of a probe
includes repeatedly imaging the microdroplet while the microdroplet
is subjected to conditions allowing for PCR amplification to
produce PCR amplification products. 77. The method according to 76,
including obtaining time-dependent fluorescence information. 78.
The method according to any of 74-77, wherein a reagent is added to
the microdroplet by merging the microdroplet with a second
microdroplet including the reagent. 79. The method according to any
of 74-78, wherein a reagent is added to the microdroplet using
either droplet coalescence or picoinjection. 80. The method
according to any of 74-79, wherein a reagent is added to the
microdroplet by a method including: a) emulsifying the reagent into
a stream of droplets, wherein the droplets are smaller than the
size of the microdroplet; b) flowing the droplets together with the
microdroplet; and c) merging a droplet with the microdroplet. 81.
The method according to any of 74-80, wherein a reagent is added to
the microdroplet by a method including: a) jetting the reagent into
a fluid jet; b) flowing the fluid jet alongside the microdroplet;
and c) merging a droplet with the microdroplet. 82. The method
according to any of 74-81, wherein a reagent is added to the
microdroplet by a method including using a fluid injected into the
microdroplet as an electrode. 83. The method according to any of
74-82, including sorting a microdroplet. 84. The method according
to 83, wherein the microdroplet is sorted based on a property
including size, viscosity, mass, buoyancy, surface tension,
electrical conductivity, charge, or magnetism. 85. The method
according to any of 74-84, wherein the subject is mammalian. 86.
The method according to any of 74-85, wherein the subject is human.
87. The method according to any of 74-86, wherein the subject has
been diagnosed with cancer. 88. A method for the detection of
cancer in a subject, the method including: encapsulating in a
microdroplet oligonucleotides obtained from a biological sample
from the subject, wherein at least one oligonucleotide is present
in the microdroplet; introducing polymerase chain reaction (PCR)
reagents, a detection component, and a plurality of PCR primers
into the microdroplet and incubating the microdroplet under
conditions allowing for PCR amplification to produce PCR
amplification products, wherein the plurality of PCR primers
include one or more primers that each hybridize to one or more
oncogenes; detecting the presence or absence of the PCR
amplification products by detection of the detection component,
wherein detection of the detection component indicates the presence
of the PCR amplification products; and diagnosing the subject as
having cancer or not based at least in part on the presence or
absence of the PCR amplification products; wherein one or more
steps are performed under microfluidic control. 89. The method
according to 88, wherein the plurality of PCR primers includes 10
or more primers. 90. The method according to any of 88-89, wherein
the plurality of PCR primers includes primers for 10 or more
oncogenes. 91. The method according to any of 88-90, further
including introducing a probe into the microdroplet. 92. The method
according to 91, wherein the probe is introduced prior to
incubating the microdroplet under conditions allowing for PCR
amplification. 93. The method according to 91 or 92, wherein the
probe is a TaqMan.RTM. probe. 94. The method according to any of
88-93, wherein a reagent is added to the microdroplet by merging
the microdroplet with a second microdroplet including the reagent.
95. The method according to any of 88-94, wherein a reagent is
added to the microdroplet using either
droplet coalescence or picoinjection. 96. The method according to
any of 88-95, wherein a reagent is added to the microdroplet by a
method including: a) emulsifying the reagent into a stream of
droplets, wherein the droplets are smaller than the size of the
microdroplet; b) flowing the droplets together with the
microdroplet; and c) merging a droplet with the microdroplet. 97.
The method according to any of 88-96, wherein a reagent is added to
the microdroplet by a method including: a) jetting the reagent into
a fluid jet; b) flowing the fluid jet alongside the microdroplet;
and c) merging a droplet with the microdroplet. 98. The method
according to any of 88-97, wherein a reagent is added to the
microdroplet by a method including using a fluid injected into the
microdroplet as an electrode. 99. The method according to any of
88-98, wherein the detection component is detected based on a
change in fluorescence. 100. The method according to any of 88-99,
wherein detecting the presence or absence of the PCR amplification
products includes repeatedly imaging the microdroplet. 101. The
method according to 100, wherein the microdroplet is repeatedly
imaged while the microdroplet is subjected to conditions allowing
for PCR amplification to produce the PCR amplification products.
102. The method according to any of 88-101, including sorting a
microdroplet. 103. The method according to 102, wherein the
microdroplet is sorted based on a property including size,
viscosity, mass, buoyancy, surface tension, electrical
conductivity, charge, or magnetism. 104. The method according to
any of 88-103, including sorting based at least in part based upon
the detection of the presence or absence of PCR amplification
products. 105. The method according to any of 88-104, further
including: injecting a diluent into the microdroplet; and flowing
the microdroplet through a microfluidic channel on which an
electric field is being applied, under conditions in which the
microdroplet is split. 106. The method according to any of 88-105,
wherein the subject is mammalian. 107. The method according to any
of 88-106, wherein the subject is human. 108. The method according
to any of 88-107, wherein the subject has been diagnosed with
cancer. 109. A microfluidic device including: a cell encapsulation
device for encapsulating a cell obtained from a subject's blood
sample in a microdroplet; a first chamber in fluidic communication
with the cell encapsulation device, the first chamber including a
first reagent injector element for adding a first reagent to the
microdroplet, and a heating element; a second chamber in fluidic
communication with the first chamber, the second chamber including
a second reagent injector element for adding a second reagent to
the microdroplet, and a heating element, wherein the heating
element is configured to heat the microdroplet at two or more
temperatures; and a detection region, in fluidic communication with
the second chamber, which detects the presence or absence of
reaction products from the second chamber. 110. The microfluidic
device as set forth in 109, wherein the heating element of the
second chamber includes a Peltier plate, heat sink, and control
computer. 111. The microfluidic device as set forth in 109, wherein
the microfluidic device includes one or more liquid electrodes.
112. A single cell RT-PCR microfluidic device including: an input
microchannel coupled to a drop maker for introducing microdroplets
into the microfluidic device; a pairing microchannel in fluidic
communication with the input microchannel; a dilution buffer drop
maker in fluidic communication with the pairing microchannel, for
producing drops of dilution buffer that are larger in volume than
the microdroplets and for pairing a single drop of dilution buffer
with a single microdroplet; a merging microchannel in fluidic
communication with the pairing microchannel, for accepting a paired
drop of dilution buffer and microdroplet from the pairing
microchannel; a first electric field generator positioned along the
merging microchannel for producing an electric field that is
capable of merging a paired drop of dilution buffer and
microdroplet in the merging microchannel to form a diluted
microdroplet; a mixing microchannel in fluidic communication with
the merging microchannel, for receiving the diluted microdroplet
from the merging channel and mixing the contents of the diluted
microdroplet; a drop sampler in fluidic communication with the
mixing microchannel, for extracting a sample of the diluted
microdroplet, a picoinjection microchannel in fluidic communication
with the drop sampler, wherein the picoinjection microchannel
includes a picoinjector and is for receiving the sample of the
diluted microdroplet and picoinjecting RT-PCR reagents into the
sample; a second electric field generator, wherein the second
electric field generator is positioned along the picoinjection
microchannel to create an electric field sufficient to allow for
the picoinjection of the RT-PCR reagents into the sample; a
thermocycler heating element in fluidic communication with the
picoinjection microchannel for carrying out an RT-PCR reaction on
the sample picoinjected with the RT-PCR reagents. 113. The
microfluidic device of 112, further including an encapsulating
chamber in fluidic communication with the input microchannel, for
encapsulating a cell and lysis regeant into a microdroplet. 114.
The microfluidic device of 112, wherein the first and/or second
electric field generators are liquid electrodes connected to a
power supply or high voltage amplifier. 115. The microfluidic
device of 112, including ridges in one or more walls of a
microfluidic flow channel downstream of the input microchannel,
wherein the ridges are configured to trap a layer of oil and
prevent wetting of the one or more walls of the flow channel. 116.
The microfluidic device of 112, including ridges in one or more
walls of a microfluidic flow channel downstream of the pairing
microchannel, wherein the ridges are configured to trap a layer of
oil and prevent wetting of the one or more walls of the flow
channel. 117. The microfluidic device of 112, including ridges in
one or more walls of a microfluidic flow channel downstream of the
picoinjection microchannel, wherein the ridges are configured to
trap a layer of oil and prevent wetting of the one or more walls of
the flow channel. 118. The microfluidic device of 112, wherein the
pioinjection microchannel is configured to receive a sample that
has undergone an RT-PCR reaction in the sampler and picoinject the
sample with PCR reagents. 119. The microfluidic device of 118,
wherein the thermocycler is configured for performing a PCR
reaction on a sample picoinjected with the PCR reagents. 120. The
microfluidic device of 118, wherein the PCR reagents and the RT-PCR
reagents include the same primers. 121. The microfluidic device of
118, wherein the PCR reagents and the RT-PCR reagents include
different primers. 122. The microfluidic device of 112, wherein the
RT-PCR reagents includes a bead conjugated with a fluorescent dye
and a nucleic acid probe. 123. The microfluidic device of 112,
wherein the RT-PCR reagents includes a fluorescent DNA probe. 124.
A single cell RT-PCR microfluidic device including: an input
microchannel coupled to a flow focus drop maker for introducing
microdroplets into the microfluidic device, wherein the flow focus
drop maker spaces the microdroplets in the input microchannel by a
volume of oil and wherein each microdroplet including a cell lysate
sample; a pairing microchannel in fluidic communication with the
input microchannel; a dilution buffer drop maker in fluidic
communication with the pairing microchannel, for producing a drop
of dilution buffer that is larger in volume than a microdroplet and
for pairing a single drop of dilution buffer with a single
microdroplet; a merging microchannel in fluidic communication with
the pairing microchannel, for accepting a paired drop of dilution
buffer and microdroplet from the pairing microchannel; a first
electric field generator positioned along the merging microchannel
for producing an electric field across the merging channel that is
capable of merging a paired drop of dilution buffer and
microdroplet in the merging microchannel to form a diluted
microdroplet; a mixing microchannel in fluidic communication with
the merging microchannel, for receiving the diluted microdroplet
from the merging channel and mixing the contents of the diluted
microdroplet; a drop sampler in fluidic communication with the
mixing microchannel, for extracting a sample of the diluted
microdroplet, a picoinjection microchannel in fluidic communication
with the drop sampler, wherein the picoinjection microchannel
includes a picoinjector and is for receiving the sample of the
diluted microdroplet and picoinjecting RT-PCR reagents into the
sample; a second electric field generator, wherein the second
electric field generator is positioned along the picoinjection
microchannel to create an electric field across the picoinjection
microchannel sufficient to allow for the picoinjection of the
RT-PCR reagents into the sample; a thermocycler heating element in
fluidic communication with the picoinjection microchannel for
carrying out an RT-PCR reaction on the sample picoinjected with the
RT-PCR reagents. 125. The microfluidic device of 124, further
including an encapsulating chamber in fluidic communication with
the input microchannel, for encapsulating a cell and lysis regeant
into a microdroplet. 126. The microfluidic device of 124, wherein
the first and/or second electric field generators are liquid
electrodes connected to a power supply or high voltage amplifier.
127. The microfluidic device of 124, including ridges in one or
more walls of a microfluidic flow channel downstream of the input
microchannel, wherein the ridges are configured to trap a layer of
oil and prevent wetting of the one or more walls of the flow
channel. 128. The microfluidic device of 124, including ridges in
one or more walls of a microfluidic flow channel downstream of the
pairing microchannel, wherein the ridges are configured to trap a
layer of oil and prevent wetting of the one or more walls of the
flow channel. 129. The microfluidic device of 124, including ridges
in one or more walls of a microfluidic flow channel downstream of
the picoinjection microchannel, wherein the ridges are configured
to trap a layer of oil and prevent wetting of the one or more walls
of the flow channel. 130. The microfluidic device of 124, wherein
the pioinjection microchannel is configured to receive a sample
that has undergone an RT-PCR reaction in the sampler and picoinject
the sample with PCR reagents. 131. The microfluidic device of 130,
wherein the thermocycler is configured for performing a PCR
reaction on a sample picoinjected with the PCR reagents. 132. The
microfluidic device of 130, wherein the PCR reagents and the RT-PCR
reagents include the same primers. 133. The microfluidic device of
130, wherein the PCR reagents and the RT-PCR reagents include
different primers. 134. The microfluidic device of 124, wherein the
RT-PCR reagents includes a bead conjugated with a fluorescent dye
and a nucleic acid probe. 135. The microfluidic device of 124,
wherein the RT-PCR reagents includes a fluorescent DNA probe. 136.
The method of any one of 1-20, wherein a reagent is added to the
microdroplet by: contacting the microdroplet with oil so that the
oil encapsulates the microdroplet to form a double emulsion;
contacting the double emulsion with a drop containing the reagent
so that the drop containing the reagent encapsulates the double
emulsion to form a triple emulsion; applying an electrical field to
the triple emulsion so that the fluid interfaces of the triple
emulsion are ruptured and allow the microdroplet and reagent to
mix. 137. The method of 136, wherein the electric field is applied
by one or more liquid electrodes. 138. A microfluidic device
including: a flow channel, a microfluidic junction fluidically
connected to the flow channel, and ridges in one or more walls of
the microfluidic flow channel immediately downstream of the
microfluidic junction. 139. The microfluidic device of 138, wherein
the ridges trap a layer of oil and prevent wetting of the one or
more walls of the flow channel. 140. The microfluidic device of
138, wherein the base of each of the one or more ridges is from
about 10 microns to about 20 microns in length. 141. The
microfluidic device of 138, wherein, the peak of each of the one or
more ridges has a width of about 1 to about 10 microns. 142. The
microfluidic device of 138, wherein the height of each of the one
or more ridges is from about 5 microns to about 15 microns. 143.
The microfluidic device of 138, wherein the ratio of the base of
each of the one or more ridges to the height of each of the one or
more ridges is from about 1.0:0.75 to about 0.75:1.0. 144. The
microfluidic device of 138, wherein the base of each of the one or
more ridges to the height of each of the one or more ridges to the
width of the peak of the one or more ridges is about 1:0.75:0.5.
145. The microfluidic device of 138, wherein the ridges extend for
a distance along the channel wall of from about 50 microns to about
500 microns. 146. The microfluidic device of 138, wherein the
ridges extend for a distance along the channel wall, wherein the
ratio between the distance along the channel wall and the width of
the channel is from about 10:1 to about 1:2.
EXAMPLES
As can be appreciated from the disclosure provided above, the
present disclosure has a wide variety of applications. Accordingly,
the following examples are put forth so as to provide those of
ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention nor are they intended to represent that the
experiments below are all or the only experiments performed. Those
of skill in the art will readily recognize a variety of noncritical
parameters that could be changed or modified to yield essentially
similar results. Thus, the following examples are put forth so as
to provide those of ordinary skill in the art with a complete
disclosure and description of how to make and use the present
invention, and are not intended to limit the scope of what the
inventors regard as their invention nor are they intended to
represent that the experiments below are all or the only
experiments performed. Efforts have been made to ensure accuracy
with respect to numbers used (e.g. amounts, temperature, etc.) but
some experimental errors and deviations should be accounted
for.
Example 1: Microfluidic System for Performing Single-Cell PCR
Reactions
Device manufacturing: The chips were made using the same
photolithographic processes in polydimethylsiloxane as the other
devices described above. A general schematic of the chips is shown
in FIG. 1. The general approach carried out by such chips is
depicted in FIG. 6.
Sample preparation: 5-25 mL whole blood samples were extracted from
a subject via syringe. Nucleated cells were separated using on-chip
pinched-flow fractionation, as generally described in Lab on a
Chip, 2005, 5, 778-784; the disclosure of which is incorporated
herein by reference. Nucleated cells were collected for subsequent
analysis.
PCR Reactions: The assay requires the execution of an RT-PCR
reaction in drops containing concentrated cell lysates; however,
cell lysates inhibit RT-PCR (FIG. 7). To overcome this inhibition,
a protocol has been developed that utilizes proteinase K to digest
inhibitory proteins in cell lysates. Using proteinase K allows
efficient amplification in lysates at concentrations as high as 1
cell in 50 pL, with optimal amplification occurring at 1 cell in
200 pL (FIG. 7). Thus, the system operates at this
concentration.
Cell encapsulation, lysis, and proteinase K digestion are
accomplished using an integrated microfluidic system (FIG. 8,
Panels 1-3). Cells are co-encapsulated in 70 .mu.m drops (200 pL)
with lysis buffer containing non-ionic detergents and proteinase K
using a 30.times.30 .mu.m flow focus device. Importantly, the cells
are not exposed to lysis buffer until they are encapsulated in
drops, ensuring that no lysis occurs prior to encapsulation. This
is enabled by the laminar flow conditions in the microfluidic
channels, which ensure that diffusive mixing is negligible compared
to the convection of the fluids. Following encapsulation, the
close-packed drops move through a 55.degree. C. incubation channel
for 20 min, to allow the cells to lyse and the proteinase K to
digest inhibitory proteins. The drops are then split into
equally-sized drops using a hierarchical splitter (FIG. 5; FIG. 8,
Panel 3), producing drops of the ideal small size for picoinjection
and Megadroplet Array imaging (FIGS. 12-13).
Prior to injection of the RT-PCR reagents and enzymes, the
proteinase K is inactivated by heating the drops to 95.degree. C.
for 10 min. The drops are then injected with an equal volume of
2.times. primers and RT-PCR reagents (FIG. 9, Panel A). After
picoinjection, the emulsion is collected into a PCR tube and
thermal cycled. To determine whether a drop contains a cancer cell,
TaqMan.RTM. probes are also included that hybridize to the EpCAM
amplicons; this allows the probes to be hydrolyzed by the 5'-3'
nuclease activity of Taq DNA polymerase, liberating the 5'
fluorophore from the quenching 3' end modification making the drop
fluorescent. By contrast, drops not containing cancer cells do not
have EpCAM amplicons, so that the TaqMan.RTM. probes remain
quenched and non-fluorescent (FIG. 4, Panels A-B). Hence, a bright
drop relates the presence of an EpCAM positive cancer cell (FIG. 9,
Panels B-C; FIG. 10). The thermocycled drops are injected into a
flow cell 30 .mu.m in height and 54 cm.sup.2 in area; the narrow
vertical gap of the flow cell forces the emulsion into a monolayer,
allowing unobstructed epi-fluorescence visualization of every drop.
For the fluorescence imaging, an automated microscope captures a
mosaic of the entire flow cell and stores the images on a hard
drive. The images are processed with custom Matlab code to identify
fluorescent drops and measure their brightness. All data is stored
digitally and analyzed using custom algorithms.
Example 2: Quantitative Multiplexed Assay
To screen more than one gene simultaneously, a multiplexed qPCR
reaction may be utilized. Reactions were initially performed in
bulk with PCR tubes to optimize reaction conditions. Using these
methods, successful multiplexing was achieved during digital
droplet RT-PCR for three TaqMan.RTM. probes, EpCAM, CD44 and CD45.
An example of this multiplexing is shown in FIG. 11, where EpCAM
and CD44 probes were multiplexed in drops containing both target
transcripts. All PCR primer sets were designed to span large
introns, making these larger genomic PCR products highly unlikely
in multiplex reactions. Additionally, all TaqMan.RTM. probes are
designed to hybridize to exon-exon junctions. The current probe
sets do not recognize gDNA.
Single-Cell qPCR with Megadroplet Arrays: To perform qPCR analysis
on single cells, the drops are imaged as they are thermal cycled.
This requires that the drops be held at fixed positions during
thermal cycling so they can be repeatedly imaged. The microfluidic
system used to prepare the drops was prepared as described above
and in Example 1. After the drops are formed and loaded with cells
and qPCR reagents, they are introduced into a Megadroplet Array
(FIG. 12, Panels A-C; FIG. 13). The array consists of channels in
which the channel ceilings are indented with millions of circular
traps 25 .mu.m in diameter. When the drops flow into the array,
they are slightly pancaked in shape because the vertical height of
the flow channel is 15 .mu.m, or 10 mm shorter than the drops. When
a drop nears a trap, its interface adopts a larger, more
energetically favorable radius of curvature. To minimize its
surface energy, the drop will entirely fill the trap, allowing it
to adopt the lowest, most energetically favorable, average radius
of curvature. The capillary pressure of the drop is several orders
of magnitude larger than the shear exerted by the flow, ensuring
that the drops remain intact and confined in the traps. After a
trap is occupied by a drop, no other drops are able to enter
because the trap will be large enough to fit only one drop;
additional drops are diverted downstream, to occupy the first
vacant trap they encounter. The array is filled using a
close-packed emulsion, and thus every trap is occupied by a drop.
After the droplet array is filled, oil is injected to remove excess
drops and the array is thermal cycled and imaged.
Thermal system for temperature cycling and imaging: Once the array
is filled with drops and cells, the device is thermal cycled while
simultaneously imaging the drops, to obtain the time-dependent
information necessary for qPCR. The thermal cycling is accomplished
using a custom heater consisting of a Peltier plate, heat sink, and
control computer (FIG. 13). The Peltier plate permits heating or
cooling the chip above or below room temperature by controlling the
applied current. To ensure controlled and reproducible temperature,
a computer monitors the temperature of the array using integrated
temperature probes, and adjusts the applied current to heat and
cool as needed. A copper-plate allows uniform application of heat
and dissipation of excess heat during cooling cycles, enabling
cooling from 95.degree. C. to 60.degree. C. in under 1 min
execution of the qPCR assay in under two hours. To image the
droplets during temperature cycling, a customized Canoscan 9000F
scanner bed having a resolution of 9600 dpi by 9600 dpi is
utilized. For 10 million hexagonally-packed 25 .mu.m drops (54
cm.sup.2), 800 million pixels are required at highest resolution.
With a resolution of 20 pixels per drop, the full image may be
captured in 3s. The array is imaged several times per cycle with
different excitation and emission filters to visualize the
different dyes for the multiplexed TaqMan.RTM. probes.
Example 3: Electrode-Free Picoinjection of Drops of Microfluidic
Drops
Microfluidic devices were fabricated in poly(dimethylsiloxane)
(PDMS) using soft photolithographic techniques. The devices had
channel heights of 30 .mu.m, optimal for the picoinjection of
water-in-oil droplets that are 50 .mu.m in diameter. The device
design is similar to those described previously by Abate, et al.
Proc. Natl. Acad. Sci. U.S.A., 2010, 107, 19163; the disclosure of
which is incorporated herein by reference. An important difference,
however, is that the channels for the metal solder electrodes are
removed. Further, a "Faraday Mote"--an empty channel filled with a
conducting aqueous solution--is implemented that runs between the
injection site and the droplet spacer, as shown in FIG. 15, Panel
B. The mote electrically isolates re-injected drops upstream of the
picoinjection site from electric fields emanating from the
picoinjector, preventing unintended merging. The emulsion that was
picoinjected consists of monodisperse droplets of 3.8 mM
fluorescein sodium salt (C.sub.20H.sub.10Na.sub.2O.sub.5) dissolved
in Milli-Q H.sub.2O. The droplets are suspended in a carrier oil of
Novec HFE-7500 fluorinated oil with 2% (wt/wt) dissolved
biocompatible surfactant. The picoinjection fluids consist of a
dilution series of NaCl ranging from 0 to 500 mM, each containing
3.8 mM fluorescein sodium salt. This range of concentrations
reflects the molarities of dissolved ions present in most
biological buffers and reagents. Thus, since in most applications
the fluids will already contain the requisite ions, the technique
can be used without adding additional reagents to the
solutions.
Droplets and carrier oil were introduced via syringe pumps (New
Era) and spaced using the same carrier oil and surfactant mixture
described above (FIG. 15, Panels A-B). The picoinjection fluid was
contained in a BD Falcon tube. Through the cap of the Falcon tube
was submerged a wire electrode into the fluid, as illustrated in
FIG. 15, Panel A. Gaps in the cap were sealed with LocTite UV-cured
epoxy. The picoinjection fluid was charged using a function
generator outputting a 10 kHz sinusoidal signal ranging from 0 to 5
volts. This output was amplified 1000.times. by a Trek 609E-6 model
HV amplifier. The positive output of the amplifier was attached via
an alligator clip to the wire submerged in the picoinjection fluid.
The ground electrode of the amplifier was attached to the metal
needle of a syringe containing a 1 M solution of NaCl, introduced
into the Faraday Mote (FIG. 15, Panel A). The two electrodes were
never in electrical contact and the emulsions exiting the device
were collected into separate, electrically isolated containers to
avoid a closed circuit and prevent current flow.
The picoinjected reagent was infused into the device through PE-2
tubing (Scientific Commodities) using an air pressure pump
(ControlAir Inc.) controlled by custom LabVIEW software. The
injection fluid was pressurized such that the oil/water interface
at the picoinjection orifice is in mechanical equilibrium with the
droplet channel; the pressure difference across the interface is
equal to the Laplace pressure, causing the injection fluid to bulge
into the droplet channel without budding off and forming its own
drops (FIG. 15, Panel C). For this device, drops and spacer oil
were injected the at flow rates of 200 and 400 .mu.L hr.sup.-1,
respectively. At these flow rates, the picoinjection fluid
interface is in mechanical equilibrium for an applied pressure of
.about.13 psi. The lengths of the tubing carrying the injection
fluid and solution serving as a Faraday mote was controlled, since
longer tubes have higher electrical resistance and may attenuate
the AC signal applied to trigger picoinjection.
To picoinject drops with reagent, the previously formed
monodisperse emulsion was re-injected into the picoinjection
device. The emulsion was introduced at a high volume-fraction such
that there is little carrier oil and the drops are packed together.
The packed drops traveled through a narrowing channel that forced
them single file. Additional oil with surfactant is added from two
perpendicular channels, spacing the drops evenly, as shown in FIG.
15, Panel B. A simple T-junction spacer was also found to work. The
droplets then passed the picoinjector, a narrow channel containing
the reagent to be added. To trigger picoinjection, the voltage
signal was applied to the electrode submerged in the injection
fluid, generating an electric field at the picoinjector as the
drops pass the injection site. This caused the drops to coalesce
with the injection fluid. As they traveled past, fluid was injected
into them through a liquid bridge formed after the two fluids
coalesce. The applied signal must have zero offset to prevent
electrophoretic migration of charged particles in the solutions.
Additionally, the frequency of the signal must be high enough to
ensure that during the act of injecting, the sign of the field
switches many times between positive and negative, so that the net
charge of the fluid added to the droplets is approximately zero.
This ensured that the droplets leaving the injector have zero net
charge, which was important for ensuring that they remain stable. A
10 kHz signal was applied.
To analyze the behavior of the picoinjector, the injection site was
observed under a microscope. In the absence of an electric field, a
distinct boundary was observed between the droplet and the
injection fluid, as shown in FIG. 16, Panel A. When a 250 V signal
was applied to the picoinjector, the boundary vanishes and droplet
coalescence is visible, as demonstrated in FIG. 16, Panel B. Thus,
electrification of the injection fluid is adequate to trigger
picoinjection, demonstrating that electrically-isolated electrodes
are not needed.
To determine if it were possible to vary the injection volume using
the applied voltage, voltage was varied between 0-5000V and the
volume change of the resulting droplets was measured. Injection
volume was quantified with an optical fluorescence detection setup.
As the drops passed a 472 nm wavelength laser focused on the
droplet channel .about.1 cm downstream of the picoinjector, the
emitted fluorescence signal from the dissolved fluorescein
contained within the drops was amplified by a photomultiplier tube
(PMT) and converted to a voltage signal analyzed with LabVIEW FPGA.
As the drops passed the laser, their fluorescence signals resembled
square waves as a function of time, with amplitudes and widths that
corresponded to the drop intensity and length, respectively. The
drops had a spherical diameter larger than the dimensions of the
channel, causing them to be cylindrical in shape. Thus, the drop
volume is approximately linear as a function of length. To
calculate the volume fractional (Vf) increase, the ratio of the
drop length before and after picoinjection was measured. These
measurements were repeated for a range of applied voltages and
molarities of NaCl in the injection fluid.
The increase in volume was plotted as a function of applied voltage
for three representative molarities of injection fluid in FIG. 17,
Panels A-C. In all cases the injection volume increased with the
applied voltage, though this effect is most prominent for the 100
mM injection solution shown in FIG. 17, Panel A. The dependence of
the droplet volume on the applied voltage may be attributed to the
observation that the droplets are not perfect cylinders as they
travel past the picoinjector; instead they have a "bullet" shape,
with the leading edge having a smaller radius of curvature than the
trailing edge. Consequently, as the drops pass the picoinjector,
the thickness of the oil layer separating their interface from the
bulge of the picoinjection fluid decreases. For an
electrically-induced thin-film instability, the threshold voltage
required to rupture the interface depends on the thickness of the
film, decreasing as the film gets thinner. Hence, because the film
thickness decreases as the drops pass the picoinjector, the moment
of coalescence depends on electric field magnitude: for higher
fields it is possible to rupture thicker films, leading to
picoinjection at an earlier point; conversely, for lower fields
thinner films are ruptured, causing picoinjection to start at a
later point. Because the volume injected depends on the duration of
picoinjection, it therefore also depends on applied voltage. This
is supported by data which shows a dependence on applied voltage
for all molarities (FIG. 17, Panels A-C). It was also observed that
the curves relating volume injected to applied voltage are lower
for lower molarities, as shown for the 50 mM and 25 mM data in FIG.
17, Panels B and C, respectively. This may be attributable to the
fact that lower molarity solutions have a lower conductivity, and
can thus attenuate the AC signals used to trigger injection,
reducing the volume injected for a particular applied voltage.
Above 3000V and 100 mM, the injected volume begins to decrease and
the variability in drop size increases. In images of these systems
at these voltages, it was observed that the picoinjection fluid is
no longer held at equilibrium in the picoinjection orifice, but
instead wets the channel walls and buds off small drops into the
flow channel.
To characterize the behavior of the electrode-free picoinjector for
all parameters, injection volume was measured as a function of
molarity and applied voltage and the resulting data was plotted on
a 2D heat-map (FIG. 18). This data demonstrates that the technique
should allow controlled picoinjection for most biological buffers,
which commonly have molarities within the tested range.
To investigate whether the electric fields and currents generated
by the high-voltage signal may disrupt biomolecules needed for
downstream assays, the picoinjector was used to prepare droplets
for an RT-PCR reaction. Drops containing total RNA isolated from an
MCF7 human cell line were picoinjected with an RT-PCR reaction
mixture containing the enzymes reverse transcriptase (RT) and Taq
DNA polymerase. Negative-control drops were injected with a mixture
containing no enzymes. Additional non-emulsified positive and
negative control reactions were performed in parallel with the same
RT-PCR mixture. Following thermocycling, the emulsions were broken
and the amplification products visualized on an ethidium
bromide-stained 2% agarose gel. The positive control and
picoinjected drops showed PCR bands of comparable intensity for the
expected 100 bp amplicon length, as visible in FIG. 19. In
contrast, the negative controls showed no amplification,
demonstrating that applying the triggering signal to the
picoinjection fluid is sufficiently biocompatible so as to allow
downstream RT-PCR reactions in drops.
Example 4: Coalescing Triple-Emulsions to Add Reagent to
Droplets
One step, which may be important in running a droplet reaction, is
the ability to add reagents to pre-existing drops. As an example,
drop addition might be beneficial if a final drop reaction requires
a reagent that could be denatured in a prior heating step. If no
drop-stabilizing surfactants are used, adding reagent can be as
simple as bringing a drop in contact with a second reagent-filled
one. Standard drop processing and storage often require
surfactant-stabilized drops, however, and localized electric fields
have been utilized to selectively disrupt and merge pairs of drops.
Merging involves timing the flow of original and reagent drops so
that they pair up and are in contact. A second strategy uses
electric fields to destabilize a passing drop so it can be injected
with reagent from a side channel. This avoids the issue of
synchronization, but has the disadvantage that each drop is
potentially cross-contaminated when joined with the side channel.
Furthermore, only a volume less than or equal to the passing drop
can be injected.
Rather than merging or injecting reagents with a drop, presented
here is a different scheme where the original drop is enveloped
within a larger reagent droplet and then both are coalesced via
application of an electric field. In some embodiments, this
enveloping facilitates the pairing of one original drop with one
reagent envelope. The contained nature of the mixing may also limit
cross-contamination and facilitate the addition of arbitrary
volumes as compared with a droplet injector.
The drop-envelope pairing is made possible with surface chemistry.
To reduce interfacial energy, a hydrophilic channel encapsulates an
oil-coated drop in aqueous reagent if available. A subsequent
hydrophobic channel then encapsulates it in oil, creating a stable
water-in-oil drop in a water-in oil drop, or triple emulsion (E3).
This technique of alternating channel hydrophobicity has each
low-order emulsion triggering the formation of the next higher one,
with reliable quintuple emulsions even possible. The triggering
leads to the proper pairing of one original drop per envelope. Once
there, the original drop surface is in maximal contact with the
inner surface of the reagent envelope, facilitating later
electro-coalescence. This contact means that any volume of reagent
could be added to the original drop, from a thin-shelled reagent
envelope of fractional volume to an envelope 10.sup.2, 10.sup.3,
10.sup.4 or more times larger.
A detailed schematic of the E3 scheme is shown in FIG. 23. First, a
premade, water-in-oil emulsion (E1) was reinjected into the device
through a hydrophilic channel (FIG. 23, top left). The drops met a
junction where co-flowing reagent pinched them off individually,
surrounding them to reduce surface repulsion. The oil of the E1
formed thin, stable shells that housed each original drop. The
channel immediately after the junction was designed to include
ridges as described herein to traps pockets of aqueous fluid. This
prevented oil from contacting the walls during budding and
potentially altering their hydrophobicity. The water-in-oil-in
water double emulsion (E2) then traveled to a second junction where
it met a hydrophobic channel carrying oil (FIG. 23, bottom left)
(Additional description and characterization of double emulsions
and their formation are provided in the descriptions of FIGS.
38-51). Here, the aqueous reagents were repelled from the walls,
and formed an E3 drop. In the figure, the E2 is shown in the
process of seeding the E3 by weakening the adhesion of the reagent
fluid to the hydrophilic channel. The volume ratio of reagent to
the original E1 drops was determined by the flow rates at the first
junction.
After formation, the E3 was passed into a narrow constriction and
coalesced with an electric field. The electric field was generated
between two salt-solution containing channels, an electrode
carrying a high, alternating voltage and a grounded moat (FIG. 23,
bottom). The constriction may have facilitated application of the
electric field to the drops because the reagent envelope likely
contained mobile ions that could screen the interior from the
electric field. As seen in the figure, constricting the E3 forces
the inner drop to the channel wall. After coalescing, the oil shell
collapsed and became the innermost phase of an inverted
oil-water-oil double emulsion (E2').
The device itself was constructed using conventional PDMS
fabrication techniques. First, a master was made by spinning layers
of SU-8 resist onto a silicon wafer and sequentially exposing them
with UV light (Blakray) and a patterned mylar mask (Fineline
Imaging). After developing in CD-30, the SU-8 master was covered in
PDMS (PDMS manufacturer) with a 10:1 polymer to cross-linker mix,
placed in vacuum to remove trapped air, and baked for 1 hour at
75.degree. C. The device was then extricated and given access holes
with a 0.75 mm biopsy punch. Next, the device was bonded to a 1
mm-thick glass slide by exposing both to 1 mbar O.sub.2 in a 300 W
plasma cleaner for 20 s, attaching, and then baking for 10 min at
75.degree. C.
The final processing steps created the hydrophilic and hydrophobic
channels. First, Aquapel.RTM. was flowed backwards through the
device, into the drop outlet and out the carrier oil inlet. At the
same time, the drop reinjector inlet was pressurized with 15 psi
air to prevent the Aquapel.RTM. from entering the double-emulsion,
hydrophilic section of the device. Next, the same inlets exposed to
Aquapel.RTM. were plugged with PEEK tubing (Resolution Systems,
TPK.515-5M) and the device was re-exposed to 1 mbar O.sub.2 plasma
in the same cleaner for 1 min. The plasma made exposed channels
hydrophilic, while the plugs kept the hydrophobic channels as they
were. This hydrophilic treatment was only semi-permanent, and other
methods not used here are capable of creating robust hydrophilic
channels.
To operate, syringes filled with the appropriate fluids were
connected to the finished device via PE-2 tubing (Scientific
Commodities, #BB31695) and the same PEEK tubing and pressurized
using syringe pumps (New Era). The reinjected drops consisted of
Milli-Q water in a fluorinated oil (Novec HFE 7500) with a 1% w/w
biocompatiable surfactant. The drops were flowed at a relatively
slow flow rate of 20 .mu.L/hr, and a snaking channel was used (FIG.
23, top left) to add flow resistance and filter any pressure
fluctuations. The test reagent was PBS buffer (model #) with 0.1%
pluronic surfactant (model #), and the carrier oil was the same as
with the reinjected drops. These were flowed at equal rates between
200 .mu.L/hr and 1200 .mu.L/hr. The electrodes and moat were filled
with 3.0 NaCl solution. The electrode, which was a dead end, was
pressurized with a solution-filled syringe until air in the channel
was absorbed by the PDMS. It was connected to a 20 kHz high voltage
oscillator (JKL Components Corp, BXA-12579) running at 500 V. Such
large voltages applied to merge or inject drops have been shown to
be biologically compatible.
FIG. 24 shows microscope images of the running E3 device. The
reinjected E1 travelling from the top of FIG. 24, Panel A, are
starkly outlined because the disparate oil and water indices of
refraction bent the back lighting. After the E1 was encapsulated at
the junction by reagent flowing from the sides and became an E2,
the inner and outer indices of refraction matched and the borders
became much fainter. This is an indication of the thinness of the
oil shell, which did not appreciably refract. In FIG. 24, Panel A,
the E1 consisted of 30 .mu.m-diameter drops (15 pL), and all
channels here were hydrophilic and square, 30 .mu.m to a side.
At the next junction, seen in FIG. 24, Panel B, the E2 exited the
hydrophilic channel as an E3 in a large square, hydrophobic
channel, 60 .mu.m to a side. As with the initial emulsion, the
edges of these E3 drops were clearly visible due to refractive
mismatch. Conceivably, this step could have caused timing issues
because the inner E1 needed to synchronize with the large drop
formation. However, this problem was avoided because the arrival of
the E1 at the junction weakened the adhesion of the reagent phase
to the hydrophilic channel and induced budding. The process is
shown in the inset of FIG. 24, Panel B, and caused a very regular
loading of E1 into the E3.
The coalescence of the E3 is shown in FIG. 24, Panel C. The 60
.mu.m-wide channel narrowed to 15 .mu.m, squeezing the E1 against
the walls where the electric field from the electrode could
penetrate. The new E2' product of coalescing can be seen on the
right. The collapsed oil remnants appear in high contrast and have
a volume of roughly 2 pL, corresponding to an original oil shell
that was 1 .mu.m thick. The remnants could conceivably have merged
with the carrier oil during coalescence except for the fact that
the E3 was squeezed against the channel wall where there is no oil.
In the inset, the constriction is shown without electric field. No
coalescence occurred and the constriction moved the inner phases to
the rear. The regularity of coalescence is demonstrated in FIG. 24,
Panel D, the top of which shows a mixing channel for homogenizing
the aqueous contents of the drop.
The precise dynamics of E3 coalescing were determined using a fast
camera. Two time series are shown in FIG. 25, with the oil shell of
the inner E1 highlighted in blue (indicated by arrows in FIG. 25).
Each starts out at a time t=-0.7 ms where the inner E1 was not yet
constricted and was spherical. Time t=0.0 ms was set immediately
before rupturing when the E1 was pinned against the constriction
walls and slightly flattened. By next frame, t=0.1 ms, the E1
ruptured. In FIG. 25, Panel A, the rupturing ejected contents of
the E1 to the back of the drop, whereas in FIG. 25, Panel B, the
contents were ejected forward. In high-order emulsions, the
unconstrained surface of an inner phase will be tangent somewhere
with the surface of the next outermost phase to reduce interfacial
energy (i.e. the phases are never perfectly concentric). This
randomly positioned contact point helps merging and may determine
where the drop ruptures. After rupturing, the oil shells collapsed
as shown in the frame at t=1.1 ms.
The robustness of this process depends on the appropriate channels
being hydrophilic or hydrophobic. If the first section of the
device is not sufficiently hydrophilic, the oil of E1 may wet the
channel walls immediately after the junction. Instead of travelling
as spheres down the center of the channel as in FIG. 24, Panel A,
they may travel as hemispheres down the side and slip into the
carrier fluid at the next junction as a single emulsion rather than
enveloped. If the second section of the device is not sufficiently
hydrophobic, there may be electro-wetting at the constriction and
small satellite drops will buff off at the tail of the passing E3.
As is, this scheme produces aqueous drops with oil in them (E2') as
opposed to the pure aqueous drops (E1) of the merger and injector
strategies mentioned previously. Depending on the desired product,
this might be acceptable; otherwise, various techniques like
microfluidic centrifuges or drop splitting can be employed to
remove the oil.
From the study described, a triple emulsion coalescence strategy
was demonstrated to be a robust method for adding a reagent to a
collection of drops. Such triple emulsion coalescence was carried
out without loss of drops or drop mixing, owing to the surface
chemistry of the channels rather than careful synchronization.
Example 5: Picoinjection Enables Digital Detection of RNA Molecules
with Droplet Rt-PCR
Most biological assays require the stepwise addition of reagents at
different times. For microfluidic techniques to be most widely
useful, a robust procedure for adding reagents to drops is
therefore important. One technique for accomplishing this is
electrocoalescence of drops, in which the reagent is added by
merging the drop with a drop of the reagent using an electric
field. Another technique is picoinjection, which injects the
reagent directly into the drops by flowing them past a pressurized
channel and applying an electric field. An advantage of
picoinjection is that it does not require the synchronization of
two streams of drops, making it easier to implement and more robust
in operation. However, variability in the volume injected from drop
to drop and the potential degradation of reagents by the electric
field may interfere with assays. In addition, during picoinjection,
the drops temporarily merge with the reagent fluid, potentially
allowing transfer of material between drops, and
cross-contamination.
This study investigated the impact of picoinjection on biological
assays performed in drops and the extent of material transfer
between drops. Using sensitive digital RT-PCR assays, it is shown
that picoinjection is a robust method for adding reagents to drops,
allowing the detection of RNA transcripts at rates comparable to
reactions not incorporating picoinjection. It was also determined
that there is negligible transfer of material between drops. The
benefit of workflows incorporating picoinjection over those that do
not is that picoinjection allows reagents to be added in a stepwise
fashion, opening up new possibilities for applying digital RT-PCR
to the analysis of heterogeneous populations of nucleic acids,
viruses, and cells.
Materials and Methods
Microfluidic Device Fabrication
The microfluidic devices consisted of polydimethylsiloxane (PDMS)
channels bonded to a glass slide. To make the PDMS mold, a device
master was first created by spinning a 30 mm-thick layer of
photoresist (SU-8 3025) onto a silicon wafer, followed by a
patterned UV exposure and resist development. Next, an uncured mix
of polymer and crosslinker (10:1) was poured over the master and
baked at 80.degree. C. for 1 hour. After peeling off the cured
mold, access holes were punched in the PDMS slab with a 0.75 mm
biopsy coring needle. The device was washed with isopropanol, dried
with air, and then bonded to a glass slide following a 20 s
treatment of 1 mbar O.sub.2 plasma in a 300 W plasma cleaner. To
make the devices hydrophobic, the channels were flushed with
Aquapel.RTM. and baked at 80.degree. C. for 10 min.
RNA Isolation
Human PC3 prostate cancer or Raji B-lymphocyte cell lines were
cultured in appropriate growth medium supplemented with 10% FBS,
penicillin and streptomycin at 37.degree. C. with 5% CO.sub.2.
Prior to RNA isolation, Raji cells were pelleted and washed once in
phosphate buffered saline (PBS). Confluent and adhered PC3 cells
were first trypsinized prior to pelleting and washing. Total RNA
was isolated from cell pellets using an RNeasy Mini Kit (Qiagen).
Total RNA was quantified using a spectrophotometer and the
indicated amounts (between 150 and 1000 ng) of RNA were used in
subsequent 25 ml RT-PCR reactions.
TaqMan.RTM. RT-PCR Reactions
The sequence of amplification primers used for the RT-PCR reactions
were as follows: EpCAM Forward 5'-CCTATGCATCTCACCCATCTC-3', EpCAM
Reverse 5'-AGTTGTTGCTGGAATTGTTGTG-3'; CD44 Forward
5'-ACGGTTAACAATAGTTATGGTAATTGG-3', CD44 Reverse
5'-CAACACCTCCCAGTATGACAC-3'; PTPRC/CD45 Forward
5'-CCATATGTTTGCTTTCCTTCTCC-3', PTPRC/CD45 Reverse
5'-TGGTGACTTTTGGCAGATGA-3'. All PCR primers were validated prior to
use in microfluidic droplet experiments with tube-based RT-PCR
reactions. Products from these reactions were run on agarose gels
and single bands of the predicted amplicon size were observed for
each primer set. The sequence of the TaqMan.RTM. probes was as
follows: EpCAM
5'-/6-FAM/ATCTCAGCC/ZEN/TTCTCATACTTTGCCATTCTC/IABkFQ/-3'; CD44
5'-/Cy5/TGCTTCAATGCTTCAGCTCCACCT/IAbRQSp/-3'; PTPRC/CD45
5'-/HEX/CCTGGTCTC/ZEN/CATGTTTCAGTTCTGTCA/IABkFQ/-3'. Pre-mixed
amplification primers and TaqMan.RTM. probes were ordered as a
PrimeTime Standard qPCR assay from Integrated DNA Technologies
(IDT) and were used at the suggested 1.times. working
concentration. Superscript III reverse transcriptase (Invitrogen)
was added directly to PCR reactions to enable first stand cDNA
synthesis. Following emulsification or picoinjection of RT-PCR
reagents, drops were collected in PCR tubes and transferred to a
T100 Thermal Cycler (BioRad). Reactions were incubated at
50.degree. C. for 15 min followed by 93.degree. C. for 2 min and 41
cycles of: 92.degree. C., 15 s and 60.degree. C., 1 min.
Emulsion Generation and Picoinjection
The reaction mixtures were loaded into 1 mL syringes and injected
into microfluidic T junction drop makers using syringe pumps (New
Era) controlled with custom LabVIEW software. The dimensions of the
device and flow rates of the reagents were adjusted to obtain the
desired 30 mm drop size. To apply the electric field for
picoinjection, the electrode and surrounding moat channels were
filled with a 3M NaCl solution, having a conductivity of .about.0.1
S/cm. The electrode was energized using 20 kHz, 300 VAC signals
generated by a fluorescent light inverter (JKL Components Corp)
attached via an alligator clip to the syringe needle.
Immunofluorescence Imaging
To image the thermocycled droplets, 10 mL of emulsion were pipetted
into Countess chambered coverglass slides (Invitrogen). The slides
were imaged on a Nikon Eclipse Ti inverted microscope using
conventional widefield epifluorescence and a 4.times. objective.
Fluorescence filters were chosen to optimize the signal intensity
and to mitigate background fluorescence due to spectral overlapping
of the dyes used in the multiplexed reactions. The images were
captured using NIS Elements imaging software from Nikon.
Data Analysis
The droplet images were analyzed using custom MATLAB software. For
each field of view, brightfield and fluorescence images were
captured. The software first located all drops in the brightfield
image by fitting circles to the drop interfaces. Next, the light
background in the fluorescence images was subtracted using a smooth
polynomial surface constrained to vary over size scales much larger
than the drops. The software then measured the average fluorescence
intensity within each droplet's circular boundary. The resultant
intensity values were offset so that the cluster of lowest
intensity (empty) had an average of zero. Drops were determined to
be "positive" or "negative" based on whether their intensity fell
above or below, respectively, a defined threshold.
Results
Detection of RNA Transcripts in Picoinjected Drops.
A potential concern when using picoinjection for RT-PCR assays is
the possibility that it may interfere with reactions in the drops;
for example, the process may result in variability in the amount of
reagents between the drops or degradation of key components upon
exposure to the electric field. To investigate these issues, the
detection of two cancer-relevant human transcripts, EpCAM and CD44,
was compared in picoinjected and non-picoinjected drops using
TaqMan.RTM. RT-PCR, (FIG. 26). The TaqMan.RTM. probe for detecting
EpCAM was conjugated to the fluorophore 6 carboxyfuoroscein (FAM)
and the probe for CD44 to the dye Cy5. The probe mix also contained
primers that flank the TaqMan.RTM. probes and yield .about.150 base
amplicons from these genes.
To prepare the non-picoinjected control drops, the probe mix was
added to a 25 ml RT-PCR master mix reaction containing 150 ng of
total RNA isolated from the human PC3 prostate cancer cell line.
The RT-PCR solution was the emulsified into monodisperse 30 mm (14
pL) drops with a T-junction drop maker, and the drops were
collected into PCR tubes and thermocycled (FIG. 26, Panel A and 26,
Panel C). During thermocycling, drops containing at least one EpCAM
or CD44 transcript were amplified, becoming fluorescent at the
wavelengths of the associated FAM and Cy5 dyes. By contrast, drops
without a molecule did not undergo amplification and remained dim,
as in standard TaqMan.RTM.-based digital droplet RT-PCR. Following
thermocycling, the drops were pipetted into chambered slides and
imaged with a fluorescence microscope. To measure the
concentrations of EpCAM and CD44 in the original solution, the
number of drops with FAM or Cy5 fluorescence were counted. The
reactions showed a digital fluorescent signal for both the EpCAM
and CD44 probes, indicating that these transcripts were present at
limiting concentrations in the drops, as shown in FIG. 27, Panel A.
Control reactions where reverse transcriptase was omitted failed to
produce a fluorescent signal, indicating that the TaqMan.RTM.
assays were specific and not the result of non-specific cleavage of
TaqMan.RTM. probes caused by the emulsification process.
To test the impact of picoinjection on TaqMan.RTM. RT-PCR, a
similar experiment as above was performed, but the RT-PCR reagents
were separated into two solutions added at different times. Total
RNA, RT-PCR buffer, primers, probes, and DNA polymerase were
emulsified into 30 mm diameter drops; these drops were not capable
of RT-PCR, since they lacked reverse transcriptase. Using
picoinjection, an equal volume of 2.times. reverse transcriptase
was introduced in PCR buffer and the drops were thermocycled. Just
as with the non-picoinjected control, this emulsion showed a robust
digital signal and had an equivalent ratio of
fluorescent-to-non-fluorescent drops, as shown in FIG. 27, Panels A
and B. To confirm that the fluorescence was not due to background
hydrolysis of the TaqMan.RTM. probes, disruption of the probes by
the electric field, or some other factor, additional reactions were
performed where a picoinjection fluid lacking reverse transcriptase
was added to RNA-containing drops. In these drops, no fluorescence
was evident following thermocycling (FIG. 27, Panel C),
demonstrating that the signal was indeed a result of digital
detection of RNA molecules, and that these assays were
specific.
Quantification of RT-PCR Detection Rates in Picoinjected Drops
To precisely quantify the impact of picoinjection on TaqMan.RTM.
RT-PCR transcript detection, four independent replicates of the
picoinjected and non-picoinjected drops were collected. To automate
data analysis, a custom MATLAB software was used to locate the
drops in the images and measure their fluorescence intensities. For
a particular channel (FAM or Cy5), the fluorescence intensity
within each drop was averaged; all drop values were subsequently
offset so that the cluster of empty drops had an average of zero
(See Materials and Methods). Using one threshold for both channels,
each drop was labeled as positive or negative for EpCAM and CD44
based on whether it was above or below the threshold, respectively,
as shown in FIG. 28, Panel A. In total, 16,216 control drops and
14,254 picoinjected drops were analyzed from the four experimental
replicates. To determine the TaqMan.RTM. detection rate of
picoinjected drops relative to non-picoinjected controls, the total
number of CD44 (Cy5) and EpCAM (FAM) positive control drops in each
replicate was normalized. Following picoinjection of reverse
transcriptase, 92% (+/-26%) of CD44 positive drops and 87% (+/-34%)
of EpCAM positive drops were detected relative to the control drops
(FIG. 28, Panel B). Although the average transcript detection rate
for picoinjected drops was slightly lower than that of control
drops for a given RNA concentration, the difference was not
statistically significant, and some experimental replicates had
detection rates for picoinjected drops higher than for the
controls. Based on these results, it was conclude that
picoinjection affords transcript detection rates equivalent to that
of digital RT-PCR, with the benefit of allowing the reaction
components to be added at different times.
Discrete Populations of Drops can be Picoinjected with Minimal
Cross-Contamination
An important feature when adding reagents to drops is maintaining
the unique contents of each drop and preventing the transfer of
material between drops. Unlike the merger of two discrete drops,
the contents of a picoinjected drop become momentarily connected
with the fluid being added, as illustrated in FIG. 26, Panel B.
After the drop disconnects from the fluid, it may leave material
behind that, in turn, may be added to the drops that follow. This
could lead to transfer of material between drops, and
cross-contamination. To examine the extent to which picoinjection
results in cross-contamination, TaqMan.RTM. RT-PCR reactions were
again used because they are extremely sensitive and capable of
detecting the transfer of just a single RNA molecule. A
FAM-conjugated TaqMan.RTM. probe was used for targeting the EpCAM
transcript and a hexachlorofluorescein (HEX) conjugated TaqMan.RTM.
probe was used for recognizing the B-lymphocyte-specific transcript
PTPRC. Total RNA was isolated from PC3 cells expressing EpCAM but
not PTPRC, and a B-lymphocyte derived cell line (Raji) expressing
PTPRC but not EpCAM. For a control set of drops, the RNA from both
cell types was mixed, TaqMan.RTM. probes and RT-PCR reagents were
added, and the solutions were emulsified into 30 mm drops. The
drops were collected into a tube, thermocycled, and imaged, FIG.
29A. In the images, a large number of drops displayed FAM and HEX
fluorescence, indicative of multiplexed TaqMan.RTM. detection of
PTPRC and EpCAM transcripts. A smaller fraction had pure green or
red fluorescence, indicating that they originally contained just
one of these molecules, while even fewer were dim and were thus
devoid of these transcripts.
To observe the rate of picoinjector cross-contamination, a
microfluidic device was used that synchronously produced two
populations of drops from opposing T-junctions, pictured in FIG.
29, Panel B. One population contained only Raji cell RNA and PTPRC
transcripts; the other, only PC3 cell RNA and EpCAM transcripts, as
illustrated in FIG. 29, Panel B. Both populations contained primers
and TaqMan.RTM. probes for EpCAM and PTPRC and were therefore
capable of signalling the presence of either transcript Immediately
after formation, the drops were picoinjected with the 2.times.
reverse transcriptase, thereby enabling first strand cDNA template
synthesis for the TaqMan.RTM. assay, and an opportunity for
contamination. If RNA was transferred between drops, some of the
drops should have displayed a multiplexed TaqMan.RTM. signal,
whereas in the absence of contamination, there should have been two
distinct populations and no multiplexing. In the fluorescence
images, two distinct populations were observed, one positive for
EpCAM (FAM) and the other for PTPRC (HEX), with almost no yellow
multiplexed drops that would be indicative of a multiplexed signal,
as shown in FIG. 29, Panel B. This demonstrated that
cross-contamination during picoinjection is rare.
To measure the precise rate of cross-contamination, automated
droplet detection software was used to analyze thousands of drops,
FIG. 30, Panel A, and the results were plotted as a percentage of
the total number of TaqMan.RTM. positive drops, FIG. 30, Panel B. A
total of 5771 TaqMan.RTM. positive control drops and 7329
TaqMan.RTM. positive picoinjected drops were analyzed from three
independent experimental replicates. For the control drops, in
which the Raji and PC3 RNA were combined, a multiplexing rate 44%
(+/-9.26) was observed. By contrast, for the picoinjected drops,
only 0.31% (+/-0.14) multiplexed drops were observed, as shown in
FIG. 30, Panel B. Hence, with picoinjection, there was some
multiplexing, although the rate was so low it cannot be ruled out
as resulting from other sources of RNA transfer, such as merger of
drops during thermocycling or transport of RNA between droplet
interfaces.
The dual population experiments in which the drops were
picoinjected immediately after being formed allowed for the
estimation of the precise amount of cross-contamination, but in
most actual implementations of picoinjection for biological assays,
the drops will be formed on one device, removed offline for
incubation or thermocycling, and then reinjected into another
device for picoinjection. To demonstrate that picoinjection is
effective for digital RT-PCR reactions performed under these
conditions, and to estimate the rate of cross contamination, a dual
population of drops was again created, but this time the drops were
pulled offline and stored in a 1 mL syringe before reinjecting and
picoinjecting them. Just as before, it was observed that nearly all
drops were pure green or red, indicating minimal cross
contamination, as shown in FIG. 31. However, some drops with a
multiplexed signal were also observed, as shown by the rare yellow
drops in the image. In this experiment, the multiplexing rate was
1%, higher than with the drops that were picoinjected immediately
after formation. While cross-contamination at the picoinjector
cannot be ruled out, it is suspected that the higher multiplexing
rate was the result of merger of drops during offline storage and
reinjection, during which the drops may be subjected to dust, air,
and shear forces that can increase the chances for merger. This is
supported by the observation that during reinjection of the
emulsion there were occasional large merged drops, and also that
the picoinjected emulsion was somewhat polydisperse, as shown in
FIG. 31. Nevertheless, even under these rough conditions, the vast
majority of drops displayed no multiplexing, indicating that they
retained their integrity as distinct reactors.
From these studies, it was demonstrated that picoinjection is
compatible with droplet digital RT-PCR and affords single RNA
molecule detection rates equivalent to workflows not incorporating
picoinjection. This showed that picoinjection is compatible with
reactions involving common biological components, like nucleic
acids, enzymes, buffers, and dyes. It was also observed that there
was negligible transfer of material between drops during
picoinjection. These results support picoinjection as a powerful
and robust technique for adding reagents to drops for
ultrahigh-throughput biological assays.
Example 6: Single Cell RT-PCR Microfluidic Device
FIG. 32 shows one embodiment of a single cell RT-PCR microfluidic
device as provided herein. The cells of interested were first
encapsulated in drops with lysis reagent including proteases and
detergents and incubated offline. These drops were then introduced
into this device and spaced by oil using an input microchannel and
a flow focus drop maker for introducing microdroplets (Panel A). In
a pairing microchannel, the spaced drops were then paired with
large drops containing a dilution buffer that were created by a
dilution buffer drop maker in fluidic communication with the
pairing microchannel (Panel B). The big and small drops were then
merged in a merging microchannel with an electric field (Panel C),
adding the contents of the small drop to the large drop. The merged
drops passed through mixing microchannels and then a small portion
was sampled from them by a drop sampler (Panel D). The small
portion was then passeed by a picoinjection microchannel where the
small portion was then picoinjected with the RT-PCR reagent (Panel
E). The drops were then thermocycled for the RT-PCR reaction.
This system facilitated single cell RT-PCR because it allowed for
the performance of the cell lysis and protein digestion in one step
(not shown) and subsequent dilution of the lysate in the drop prior
to addition of the RT-PCR reagent. Without the dilution, the lysate
could have inhibited the RT-PCR reaction.
The device worked robustly, at least in part, because the timing of
each microfluidic component was set by the periodicity of the large
drop maker making the dilution drops. Without this periodic drop
formation, the device might operate less stably and potentially
produce polydisperse drops.
Example 7: Testing of Microfluidic Droplet Forming Devices
Utilizing Channels Including Ridges
T-junction drop makers with and without channel ridges positioned
downstream of the T-junction were tested to determine the effect of
including such ridges on droplet formation performance. The channel
widths were about 30 microns and the width of the ridge peaks were
from about 5 to about 10 microns. See FIG. 33.
PDMS microfluidic devices were prepared generally as described
herein and plasma treated for 10 seconds. The flow rate ratio was
monitored, wherein the sum (Q.sub.sum) of individual flow rates
(Q.sub.oil)+(Q.sub.aq) was approximately 1000 .mu.l/hr, and the
ratio (R)=Q.sub.aq/Q.sub.sum, and droplet formation was
visualized.
As the flow rate ratio was increased for the device lacking ridges,
the drop maker stopped forming drops and instead formed a long jet.
Without intending to be bound by any particular theory, it is
believe that this was due to the jet wetting the channel walls and
adhering, preventing the formation of drops. See FIG. 33, left
side. For the device which included the ridges, the ridges
successfully trapped oil near the walls, making it difficult for
the aqueous phase to wet. This allowed the device to form drops at
much higher flow rate ratios before it eventually wet at R=0.9.
This demonstrated that the ridges allow the drop maker to function
over a much wider range than would be possible without the ridges.
The top and bottom sets of images in FIG. 33 correspond to
experiments performs with different devices. When the experiment
was performed with the first pair of devices, a 21-fold increase in
maximum O.sub.aq/Q.sub.oil was achieved. When the same experiment
was performed with a second set of devices, an 8-fold increase in
maximum O.sub.aq/Q.sub.oil was achieved. This discrepancy may be
attributed to experimental variability because the wetting
properties that lead to jetting are somewhat unpredictable,
hysteretic, and prone to variability.
Example 8: Fabrication and Testing of Liquid Electrodes
Many microfluidic devices utilize metal electrodes to create
electric fields when such fields are called for in a particular
microfluidic device application. However, there may be
disadvantages to using such metal electrodes including an increased
number of fabrication steps and the potential for failure of the
electrodes.
Advantageously, the present disclosure describes the fabrication
and use of liquid electrodes, which simplify the fabrication
process and provide similar and/or improved capabilities relative
to metal electrodes.
FIG. 34 provides an overview of an exemplary liquid electrode
fabrication method. Initially, an SU-8 photoresist master was
fabricated on an Si wafer (A). PDMS was then cast, degassed and
cured (B). Inlet ports were punched in the PDMS, and the PDMS was
bonded to a glass slide (C). Finally, the channel was filled with a
NaCl solution. FIG. 35 provides a sequence of three images taken at
different times as an electrode channel was being filled with salt
water (time course proceeds from left to right). The salt water was
introduced into the inlet of the channel and pressurized, causing
it to slowly fill the channel. The air that was originally in the
channel was pushed into the PDMS so that, by the end, it was
entirely filled with liquid.
Electric field lines for various liquid electrode configurations
were simulated as shown in FIG. 36. The simulations are of positive
and ground electrodes showing equipotential lines for three
different geometries.
The liquid electrodes were capable of merging drops through
application of an electric field as shown in FIG. 37, which
provides two images of a droplet merger device that merges large
drops with small drops utilizing liquid electrodes. To merge the
drops, an electric field was applied using a salt-water electrode.
When the field was off, no merger occurred (right) and when it was
on, the drops merged (left).
Example 9: PCR Analysis and FACS Sorting of Azopira/E. coli
Mixture
Two different species of microbes, Azospira and E. coli. Were
encapsulated in microdrops. In-droplet PCR was performed using
TaqMan.RTM. and primers for Azospira and/or E. coli. FIG. 52
provides images showing drops in which a TaqMan.RTM. PCR reaction
was performed with encapsulated Azospira. The upper images
correspond to a reaction in which a 110 bp amplicon was produced,
whereas the lower images to a 147 bp amplicon. FIG. 53 shows a
picture of a gel testing 16S primers for Azospira and E. coli. The
gel shows the bands corresponding to the amplicons of two
TaqMan.RTM. PCR reactions, one for a 464 bp amplicon and one for a
550 bp amplicon. FIG. 54 provides a picture of a gel validating
that the in-droplet PCR reactions can be multiplexed by adding
multiple primer sets to a sample containing bacteria. FIG. 55 shows
results for an experiment where the TaqMan.RTM. reaction had
primers and probes only for Azospira, so only the drops containing
one of these microbes underwent amplification and became
fluorescent, while the empty drops or the ones with E. coli
remained dim. The emulsion was then encapsulated into double
emulsions using a microfluidic device and sorted on FACS. The plots
to the right in FIG. 55 show the FACS data. The upper plot shows
the scattering cross section plotted as a function of the drop
fluorescence. Based on this, a population was gated out by drawing
boundaries (shown above), and this population was sorted based on
the drop intensity. The gating allowed erroneous events due to
small oil drops or dust to be discarded. When looking at only the
double emulsions, the population had two distinct peaks which
corresponded to the fluorescent and non-fluorescent drops, shown in
the lower histogram. An attempt to re-amplify the amplicons created
during the in-droplet PCRs was unsuccessful, potentially due to
their chemical structure since they may contain analogue bases or
due to an inhibitory effect of the carrier oil.
Although the foregoing invention has been described in some detail
by way of illustration and example for purposes of clarity of
understanding, it is readily apparent to those of ordinary skill in
the art in light of the teachings of this disclosure that certain
changes and modifications may be made thereto without departing
from the spirit or scope of the appended claims.
Accordingly, the preceding merely illustrates the principles of the
invention. It will be appreciated that those skilled in the art
will be able to devise various arrangements which, although not
explicitly described or shown herein, embody the principles of the
invention and are included within its spirit and scope.
Furthermore, all examples and conditional language recited herein
are principally intended to aid the reader in understanding the
principles of the invention being without limitation to such
specifically recited examples and conditions. Moreover, all
statements herein reciting principles, aspects, and embodiments of
the invention as well as specific examples thereof, are intended to
encompass both structural and functional equivalents thereof.
Additionally, it is intended that such equivalents include both
currently known equivalents and equivalents developed in the
future, i.e., any elements developed that perform the same
function, regardless of structure. The scope of the present
invention, therefore, is not intended to be limited to the
exemplary embodiments shown and described herein. Rather, the scope
and spirit of present invention is embodied by the appended
claims.
SEQUENCE LISTINGS
1
9121DNAArtificial sequencesynthetic polynucleotide 1cctatgcatc
tcacccatct c 21222DNAArtificial sequencesynthetic polynucleotide
2agttgttgct ggaattgttg tg 22327DNAArtificial sequencesynthetic
polynucleotide 3acggttaaca atagttatgg taattgg 27421DNAArtificial
sequencesynthetic polynucleotide 4caacacctcc cagtatgaca c
21523DNAArtificial sequencesynthetic polynucleotide 5ccatatgttt
gctttccttc tcc 23620DNAArtificial sequencesynthetic polynucleotide
6tggtgacttt tggcagatga 20730DNAArtificial sequencesynthetic
polynucleotide 7atctcagcct tctcatactt tgccattctc 30824DNAArtificial
sequencesynthetic polynucleotide 8tgcttcaatg cttcagctcc acct
24927DNAArtificial sequencesynthetic polynucleotide 9cctggtctcc
atgtttcagt tctgtca 27
* * * * *